WO2020099451A1 - Terminal deoxynucleotidyl transferase variants and uses thereof - Google Patents
Terminal deoxynucleotidyl transferase variants and uses thereof Download PDFInfo
- Publication number
- WO2020099451A1 WO2020099451A1 PCT/EP2019/081099 EP2019081099W WO2020099451A1 WO 2020099451 A1 WO2020099451 A1 WO 2020099451A1 EP 2019081099 W EP2019081099 W EP 2019081099W WO 2020099451 A1 WO2020099451 A1 WO 2020099451A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- respect
- nos
- substitution
- tdt
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1241—Nucleotidyltransferases (2.7.7)
- C12N9/1264—DNA nucleotidylexotransferase (2.7.7.31), i.e. terminal nucleotidyl transferase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/07—Nucleotidyltransferases (2.7.7)
- C12Y207/07031—DNA nucleotidylexotransferase (2.7.7.31), i.e. terminal deoxynucleotidyl transferase
Definitions
- the present invention is directed to terminal deoxynucleotidyl transferase (TdT) variants that display enhanced efficiency in incorporating reversibly blocked nucleoside triphosphates into a polynucleotide, and to their use in synthesizing polynucleotides of any predetermined sequence. Additionally, in some embodiments, TdT variants of the invention exhibit enhanced stability with respect to wildtype enzymes.
- TdT terminal deoxynucleotidyl transferase
- the invention is based on the discovery that the efficiency of TdT -based nucleotide incorporation depends in part on the nucleotide sequence of the 3’ end of the polynucleotide being extended; thus, the invention is in part an appreciation and recognition that TdT variants of the invention are capable of efficiently extending a polynucleotide independent of the nucleotide sequence of its 3’ end.
- the invention is directed to a terminal deoxynucleotidyl transferase (TdT) variant comprising an amino acid sequence at least sixty percent identical to an amino acid sequence selected from SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 with a substitution of glutamine at position 326 with respect to SEQ ID NOs 3, 8, 10 and 14, or glutamine at position 325 with respect to SEQ ID NO: 4 and 5, or glutamine at position 332 with respect to SEQ ID NO: 7 and 9, or glutamine at position 329 with respect to SEQ ID NO: 13 and 16, or glutamine at position 321 with respect to SEQ ID NO: 6, or glutamine at position 327 with respect to SEQ ID NO: 1 1, or glutamine at position 324 with respect to SEQ ID NO: 12, or glutamine at position 339 with respect to SEQ ID NO: 15, or glutamine at position 309 with respect to SEQ ID NO: 24 and 26, or glutamine at position 307 with respect to SEQ ID NO: 25, wherein
- the above percent identity value is at least 80 percent identity with the indicated SEQ ID NOs; in some embodiments, the above percent identity value is at least 90 percent identity with the indicated SEQ ID NOs; in some embodiments, the above percent identity value is at least 95 percent identity with the indicated SEQ ID NOs; in some embodiments, the above percent identity value is at least 97 percent identity; in some embodiments, the above percent identity value is at least 98 percent identity; in some embodiments, the above percent identity value is at least 99 percent identity.
- the variant consists in a sequence selected from the group consisting in SEQ ID NOs; in some embodiments, the above percent identity value is at least 90 percent identity with the indicated SEQ ID NOs; in some embodiments, the above percent identity value is at least 95 percent identity with the indicated SEQ ID NOs; in some embodiments, the above percent identity value is at least 97 percent identity; in some embodiments, the above percent identity value is at least 98 percent identity; in some embodiments, the above percent identity value is at least 99 percent identity.
- the variant
- the percent identity values used to compare a reference sequence to a variant sequence do not include the expressly specified amino acid positions containing substitutions of the variant sequence; that is, the percent identity relationship is between sequences of a reference protein and sequences of a variant protein outside of the expressly specified positions containing substitutions in the variant.
- the percent identity would be in regard to sequences 1-24, 26-80 and 82-100.
- such 3’-0-modified nucleotide may comprise a 3’-0-NH2- nucleoside triphosphate, a 3’-O-azidomethyl -nucleoside triphosphate, a 3’-0-allyl-nucleoside triphosphate, a 3 ⁇ — (2-nitrobenzyl)-nucleoside triphosphate, or a 3’-0-propargyl-nucleoside triphosphate.
- the above substitution for glutamine is selected from the group consisting of T, F, L and M; in other embodiments, the above substitution for glutamine is selected from the group consisting of T, F, L, M, I, V and Y. In some embodiments, said substitution is F. In some embodiments, the substitution of glutamine may be in combination with other mutations described herein, such as those at the lysine, histidine, alanine, tryptophan, glycine or glutamine below.
- the invention is directed to a terminal deoxynucleotidyl transferase (TdT) variant comprising an amino acid sequence at least sixty percent 60% identical to an amino acid sequence selected from SEQ ID NO: 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 and comprising a substitution of lysine at position 265 with respect to SEQ ID NOs 3, 7, 8, 9, 10, 13 and 14, or lysine at position 263 with respect to SEQ ID NOs 6 and 12, or lysine at position 264 with respect to SEQ ID NO 5, or lysine at position 266 with respect to SEQ ID NO 11, or lysine at position 268 with respect to SEQ ID NO 16, or lysine at position 272 with respect to SEQ ID NO 15, wherein the TdT variant (i) is capable of synthesizing a nucleic acid fragment without a template and (ii) is capable of incorporating a 3’-0-modified nucleotide onto a free 3’-hydroxyl
- the above percent identity value is at least 80 percent identity with the indicated SEQ ID NOs; in some embodiments, the above percent identity value is at least 90 percent identity with the indicated SEQ ID NOs; in some embodiments, the above percent identity value is at least 95 percent identity with the indicated SEQ ID NOs; in some embodiments, the above percent identity value is at least 97 percent identity; in some embodiments, the above percent identity value is at least 98 percent identity; in some embodiments, the above percent identity value is at least 99 percent identity.
- such 3’-0-modified nucleotide may comprise a 3’-0-NH2-nucleoside triphosphate, a 3’-0-azidomethyl-nucleoside triphosphate, a 3’-0-allyl- nucleoside triphosphate, a 3 ⁇ — (2-nitrobenzyl)-nucleoside triphosphate, or a 3’-0-propargyl- nucleoside triphosphate.
- the amino acid substitution of lysine is selected from the group consisting of E, T, A and R. In some embodiments, said substitution is T. In some embodiments, the substitution of lysine may be in combination with other mutations described herein, such as those at the glutamine above, or the histidine, alanine, tryptophan, glycine or glutamine below.
- the invention is directed to a terminal deoxynucleotidyl transferase (TdT) variant comprising an amino acid sequence at least sixty percent 60% identical to an amino acid sequence selected from SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15 or 16 and comprising a substitution of histidine at position 337 with respect to SEQ ID NOs 3, 8, 10 and 14, or histidine at position 336 with respect to SEQ ID NOs 4 and 5, or histidine at position 343 with respect to SEQ ID NOs 7 and 9, or histidine at position 340 with respect to SEQ ID NOs 13 and 16, or histidine at position 332 with respect to SEQ ID NO 6, or histidine at position 338 with respect to SEQ ID NO 11, or histidine at position 335 with respect to SEQ ID NO 12, or histidine at position 350 with respect to SEQ ID NO 15, wherein the TdT variant (i) is capable of synthesizing a nucleic acid fragment without a template and
- the above percent identity value is at least 80 percent identity with the indicated SEQ ID NOs; in some embodiments, the above percent identity value is at least 90 percent identity with the indicated SEQ ID NOs; in some embodiments, the above percent identity value is at least 95 percent identity with the indicated SEQ ID NOs; in some embodiments, the above percent identity value is at least 97 percent identity; in some embodiments, the above percent identity value is at least 98 percent identity; in some embodiments, the above percent identity value is at least 99 percent identity.
- such 3’-0-modified nucleotide may comprise a 3’-0-NH2-nucleoside triphosphate, a 3’-0- azidomethyl-nucleoside triphosphate, a 3’-0-allyl-nucleoside triphosphate, a 3 ⁇ — (2- nitrobenzyl)-nucleoside triphosphate, or a 3’-0-propargyl-nucleoside triphosphate.
- the amino acid substitution of histidine is selected from the group consisting of Y, F, N and D.
- the substitution of histidine may be in combination with other mutations described herein, such as those at the glutamine or lysine above, or the alanine, tryptophan, glycine or glutamine below.
- the invention is directed to a terminal deoxynucleotidyl transferase (TdT) variant comprising an amino acid sequence at least sixty percent 60% identical to an amino acid sequence selected from SEQ ID NO: 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14 or 15 and comprising a substitution of tryptophan at position 377 with respect to SEQ ID NOs 3, 8, 10 and 14, or tryptophan at position 376 with respect to SEQ ID NOs 4 and 5, or tryptophan at position 372 with respect to SEQ ID NO 6, or tryptophan at position 380 with respect to SEQ ID NO 13, or tryptophan at position 383 with respect to SEQ ID NO 9, or tryptophan at position 378 with respect to SEQ ID NO 11, or tryptophan at position 375 with respect to SEQ ID NO 12, or tryptophan at position 380 with respect to SEQ ID NO 13, or tryptophan at position 390 with respect to SEQ ID NO 15, wherein the TdT variant (i) is capable of
- the above percent identity value is at least 80 percent identity with the indicated SEQ ID NOs; in some embodiments, the above percent identity value is at least 90 percent identity with the indicated SEQ ID NOs; in some embodiments, the above percent identity value is at least 95 percent identity with the indicated SEQ ID NOs; in some embodiments, the above percent identity value is at least 97 percent identity; in some embodiments, the above percent identity value is at least 98 percent identity; in some embodiments, the above percent identity value is at least 99 percent identity.
- such 3’-0-modified nucleotide may comprise a 3’-0-NH2-nucleoside triphosphate, a 3’-0- azidomethyl-nucleoside triphosphate, a 3’-0-allyl-nucleoside triphosphate, a 3 ⁇ — (2- nitrobenzyl)-nucleoside triphosphate, or a 3’-0-propargyl-nucleoside triphosphate.
- tryptophan is substituted with R or K.
- tryptophan is substituted with R.
- the substitution of tryptophan may be in combination with other mutations described herein, such as those at the glutamine, lysine or histidine above, or the alanine, or glycine, or glutamine below.
- the invention is directed to a terminal deoxynucleotidyl transferase (TdT) variant comprising an amino acid sequence at least sixty percent 60% identical to an amino acid sequence selected from SEQ ID NO: 3, 4, 5, 6, 8, 10, 1 1, 13, 14, 15 or 16 with a substitution of alanine at position 17 with respect to SEQ ID NOs 3, 4, 5, 6, 8, 10, 13, 14 and 15, or alanine at position 18 with respect to SEQ ID NO: 11 and 16, wherein the TdT variant (i) is capable of synthesizing a nucleic acid fragment without a template and (ii) is capable of incorporating a 3’-0-modified nucleotide onto a free 3’-hydroxyl of a nucleic acid fragment.
- TdT terminal deoxynucleotidyl transferase
- the above percent identity value is at least 80 percent identity with the indicated SEQ ID NOs; in some embodiments, the above percent identity value is at least 90 percent identity with the indicated SEQ ID NOs; in some embodiments, the above percent identity value is at least 95 percent identity with the indicated SEQ ID NOs; in some embodiments, the above percent identity value is at least 97 percent identity; in some embodiments, the above percent identity value is at least 98 percent identity; in some embodiments, the above percent identity value is at least 99 percent identity.
- such 3’-0-modified nucleotide may comprise a 3’-0-NH2-nucleoside triphosphate, a 3’-0- azidomethyl-nucleoside triphosphate, a 3’-0-allyl-nucleoside triphosphate, a 3 ⁇ — (2- nitrobenzyl)-nucleoside triphosphate, or a 3’-O-propargy 1-nucleoside triphosphate.
- the above substitution for alanine is V, I or L.
- the above substitution for alanine is V.
- the substitution of alanine may be in combination with other mutations described herein, such as those at the glutamine, lysine, histidine or tryptophan above, or the glycine or glutamine below.
- the invention is directed to a terminal deoxynucleotidyl transferase (TdT) variant comprising an amino acid sequence at least sixty percent 60% identical to an amino acid sequence selected from SEQ ID NO: 3, 9, 1 1 or 15 with a substitution of glycine at position 57 with respect to SEQ ID NOs 3 and 15, or glycine at position 58 with respect to SEQ ID NO: 9 and 11, wherein the TdT variant (i) is capable of synthesizing a nucleic acid fragment without a template and (ii) is capable of incorporating a 3’-0-modified nucleotide onto a free 3’-hydroxyl of a nucleic acid fragment.
- TdT terminal deoxynucleotidyl transferase
- the above percent identity value is at least 80 percent identity with the indicated SEQ ID NOs; in some embodiments, the above percent identity value is at least 90 percent identity with the indicated SEQ ID NOs; in some embodiments, the above percent identity value is at least 95 percent identity with the indicated SEQ ID NOs; in some embodiments, the above percent identity value is at least 97 percent identity; in some embodiments, the above percent identity value is at least 98 percent identity; in some embodiments, the above percent identity value is at least 99 percent identity.
- such 3’-0-modified nucleotide may comprise a 3’-0-NH2-nucleoside triphosphate, a 3’-0-azidomethyl-nucleoside triphosphate, a 3’-0-allyl-nucleoside triphosphate, a 3 ⁇ — (2-nitrobenzyl)-nucleoside triphosphate, or a 3’-0-propargyl-nucleoside triphosphate.
- the above substitution for glycine is E.
- the substitution of glycine may be in combination with other mutations described herein, such as those at the glutamine, lysine, histidine, tryptophan or alanine above and/or the glutamine described below.
- the invention is directed to a terminal deoxynucleotidyl transferase (TdT) variant comprising an amino acid sequence at least sixty percent 60% identical to an amino acid sequence selected from SEQ ID NO: 3, 4, or 6and comprising a substitution of glutamine at position 261 with respect to SEQ ID NO: 3, or glutamine at position 262 with respect to SEQ ID NO: 6, or glutamine at position 264 with respect to SEQ ID NO 4, wherein the TdT variant (i) is capable of synthesizing a nucleic acid fragment without a template and (ii) is capable of incorporating a 3’-0-modified nucleotide onto a free 3’-hydroxyl of a nucleic acid fragment.
- TdT terminal deoxynucleotidyl transferase
- the above percent identity value is at least 80 percent identity with the indicated SEQ ID NOs; in some embodiments, the above percent identity value is at least 90 percent identity with the indicated SEQ ID NOs; in some embodiments, the above percent identity value is at least 95 percent identity with the indicated SEQ ID NOs; in some embodiments, the above percent identity value is at least 97 percent identity; in some embodiments, the above percent identity value is at least 98 percent identity; in some embodiments, the above percent identity value is at least 99 percent identity.
- such 3’-0-modified nucleotide may comprise a 3’-0-NH2-nucleoside triphosphate, a 3’-0-azidomethyl-nucleoside triphosphate, a 3’-0-allyl-nucleoside triphosphate, a 3 ⁇ — (2-nitrobenzyl)-nucleoside triphosphate, or a 3’-0-propargyl-nucleoside triphosphate.
- the amino acid substitution of glutamine is R.
- the substitution of glutamine at this position may be in combination with other mutations described herein, such as those at the glutamine, histidine, lysine, alanine, tryptophan or glycine above.
- the invention is directed to a terminal deoxynucleotidyl transferase (TdT) variant comprising an amino acid sequence at least ninety percent identical to the amino acid sequence as set forth in SEQ ID NO: 4 with substitutions at position M63, R207, R324 and E327.
- TdT terminal deoxynucleotidyl transferase
- the invention is directed to a terminal deoxynucleotidyl transferase (TdT) variant comprising or consisting in an amino acid sequence at least ninety percent identical to the amino acid sequence as set forth in SEQ ID NO: 24 with substitutions at positions M47, R190, R308 and E31 1.
- the invention is directed to a terminal deoxynucleotidyl transferase (TdT) variant comprising or consisting in an amino acid sequence at least ninety percent identical to the amino acid sequence as set forth in SEQ ID NO: 26 with substitutions at positions M46, R190 and E31 1.
- TdT terminal deoxynucleotidyl transferase
- at least one of the amino acid substitutions is selected from the group consisting in M46R, M47R, M63R, R190L, R207L, E227N and E31 1N.
- the invention is directed to a terminal deoxynucleotidyl transferase (TdT) variant comprising an amino acid sequence at least ninety percent identical to the amino acid sequence as set forth in SEQ ID NO: 25 with substitutions at positions R184, R306 and E309. Particularly, the substitutions are selected from the group consisting in R184L, R306A and E309N.
- the variant consists in an amino acid sequence having at least 90% identity with the amino acid sequence set forth in SEQ ID NO: 25 with the substitutions R184L, R306A and E309N.
- a TdT variant of the invention comprises substitutions of glutamine (first occurrence above), lysine, histidine, tryptophan, alanine, glycine and glutamine (second occurrence above) at the indicated positions and specified SEQ ID NOs described above.
- a TdT variant of the invention comprises an isolated protein.
- each such TdT variant may further comprise from 1 to 1 1 additional substitutions selected from the positions listed in the rows of Table 1 (set forth in Fig. 2) for the specified SEQ ID NO.
- additional substitutions are sometimes referred to herein as“supplemental substitutions” and contribute to an increased efficiency or rate of incorporation of 3’-0-modified nucleoside triphosphates onto a polynucleotide.
- the supplemental substitutions are selected from Table 1.
- a TdT variant with arginine substituted for glutamine at position 326 of SEQ ID NO 3 may further comprise the following substitutions: L52F, M63R, A108V and L131P (that is, substitutions for the first four positions listed in row 2 of Table 1).
- the TdT variant may be characterized as follows using the nomenclature described below: Q326R + L52F + M63R + A108V + L131P with respect to SEQ ID NO: 3, and otherwise comprising at least 90 percent sequence identity with SEQ ID NO 3.
- a TdT variant with arginine substituted for glutamine at position 325 of SEQ ID NO 5, aspartic acid substituted for histidine at position 336 of SEQ ID NO 5, and arginine substituted for tryptophan at position 376 of SEQ ID NO 5, may further comprise the substitutions M63R, A110V, L131P, C173G, R207N, E294A, R325P, E327N and R353K (selected from row 4 of Table 1, set forth in Fig. 2).
- the TdT variant may be characterized as Q325R + H336D + W376D + M63R + A110V + L131P + C173G + R207N + E294A + R325P + E327N + R353K with respect to SEQ ID NO: 5, and otherwise comprise a specified percent sequence identity, such as at least 90 percent sequence identity, with SEQ ID NO: 5.
- each such TdT variant may further comprise from 1 to 12 additional substitutions selected from the positions listed in the rows of Table 2 (set forth in Fig. 3) for the specified SEQ ID NO.
- additional substitutions are sometimes referred to herein as “Stability Substitutions” and contribute to an increased stability of a TdT variant, particularly with respect to reaction conditions of template-free enzymatic polynucleotide incorporation, and with respect to elevated temperature.
- a TdT variant may comprise substitutions A17V, K265E and W377R from Table 3B, supplemental substitutions M63R, L131P, C173G, R207L, G284L and R325P from Table 1, and stability substitutions S119A and S146E from Table 2, wherein the position numbers are with respect to SEQ ID NO: 3.
- Such TdT variant may be designated as A17V + M63R + SI 19A + L131P + S146E + C173G + R207L + K265E + G284L + R325P + W377R and it is understood that in addition to these specific substitution the TdT variant comprises a specified percent sequence identity, such as at least 90 percent sequence identity, with SEQ ID NO: 3.
- a TdT variant of the invention comprises all or part of a BRCT-like segment attached to its N-terminus, e.g. see Delarue et al, EMBO J., 21(3): 427- 439 (2002).
- the invention is directed to TdT variants comprising an amino acid sequence that has at least 90 percent identity with SEQ ID NO: 1, wherein each such TdT variant (i) comprises at least one mutation at one or more positions selected from the group consisting of G186, S248, T331, Q390, K394, Q455 or H466 with respect to SEQ ID NO: 1 , or a functional equivalent thereof, and (ii) is capable of extending a polynucleotide without a template, and (iii) is capable of incorporating 3’-0-modified nucleoside triphosphates with greater efficiency than a wild type TdT.
- TdT variants of the invention comprise G186E.
- TdT variants of the invention comprise K394 E/T/A/R.
- the invention is directed to TdT variants comprising an amino acid sequence that has at least 90 percent identity with SEQ ID NO: 3, wherein each such TdT variant (i) comprises at least one mutation at one or more positions selected from the group consisting of G57, SI 19, T202, Q261, K265, Q326 or H337 with respect to SEQ ID NO: 3, or a functional equivalent thereof, and (ii) is capable of extending a polynucleotide without a template, and (iii) is capable of incorporating 3’-0- modified nucleoside triphosphates with greater efficiency than a wild type TdT.
- TdT variants of the invention comprise G57E. In some embodiments, TdT variants of the invention comprise K265E/T/A/R. In some embodiments, TdT variants of the invention comprise T202A. In some embodiments, TdT variants of the invention comprise Q326T/F/L/M or Q326T/F/L/M/I/V/Y. In some embodiments, TdT variants of the invention comprise S1 19A. In some embodiments, TdT variants of the invention comprise Q261R. In some embodiments, TdT variants of the invention comprise H337Y/F/D.
- TdT variants of the invention comprise one or more amino acid changes selected from the group consisting of T202A, Q326T/F/L/M or Q326T/F/L/M/I/V/Y/W, S119A, Q261R, H337Y/F/D, G57E and K265E/T/A/R.
- TdT variants of the invention comprise K265E/T/A; and in other embodiments comprise both G57E and K265E/T/A.
- variant TdTs of the invention have at least 95 percent identity with the reference or wild type TdT sequence SEQ ID NO: 3.
- variant TdTs of the invention have at least 98 percent identity with SEQ ID NO: 3.
- TdT variants of the invention displaying increase efficiency of incorporation comprise one or more amino acid changes selected from the group consisting of T202A, Q326T/F/L/M or Q326T/F/L/M/I/V/Y, Q261R, H337Y/F/D, G57E and K265E/T/A/R.
- TdT variants of the invention displaying enhanced stability comprise the amino acid change SI 19A.
- TdT variants of the invention displaying increased efficiency of incorporation comprise, either individually or in combination, G57E, K265T/E/R/A, Q326T/F/L/M, or H337Y/F/D.
- the invention further relates to the use of a TdT variant of the invention for synthesizing a nucleic acid molecule without template by the successive addition of one or more 3’-0-modified nucleotides to a nucleic acid fragment.
- such methods comprise the steps of (a) providing an initiator comprising an oligonucleotide having a free 3’-hydroxyl; (b) reacting under enzymatic extension conditions a TdT variant of the invention with the initiator or an extended initiator in the presence of a 3’-0-reversibly blocked nucleoside triphosphate.
- such method further includes steps of
- the invention includes nucleic acid molecules encoding a variant TdTs described above, expression vectors comprising such nucleic acid molecules, and host cells comprising the aforementioned nucleic acid molecules or the aforementioned expression vectors.
- the invention includes processes for producing a variant TdT of the invention, wherein a host cell is cultivated under culture conditions allowing the expression of the nucleic acid encoding said variant TdT, and wherein the variant TdT is optionally retrieved.
- the invention also includes kits for performing template-free polynucleotide elongations of any predetermine sequence, wherein the kits include a TdT variant of the invention.
- kits may further comprise 3’-0-blocked deoxyribonucleoside triphosphates (dNTPs) for A, C, G and T for DNA elongation, or 3’-0- blocked ribonucleoside triphosphates (rNTPs) for rA, rC, rG and U for RNA elongation.
- dNTPs deoxyribonucleoside triphosphates
- rNTPs 3’-0- blocked ribonucleoside triphosphates
- the present invention advantageously overcomes problems in the field of template- free enzymatic nucleic acid synthesis related to the efficient incorporation of 3’-0-modified nucleoside triphosphates by providing new TdT variants with a capability of incorporating 3’- O-modified nucleotides with greater efficiency or at a higher rate than wild type TdTs or previously available TdT variants, particularly with respect to incorporation of nucleotides onto polynucleotides that comprise certain 3’ nucleotide sequences described herein.
- the present invention also advantageously overcomes problems in the above field by providing new TdT variants with increased stability in comparison with wild type TdTs.
- Fig. 1 illustrates diagrammatically the steps of a method of template-free enzymatic nucleic acid synthesis using TdT variants of the invention.
- Fig. 2 contains Table 1 listing supplementary substitutions for the various SEQ ID NOs.
- Fig. 3 contains Table 2 listing stability substitutions for the various SEQ ID NOs.
- the present invention provides variants of the TdT polymerase that can be used for synthesizing polynucleotides, such as DNA or RNA, of predetermined sequences without the use of template strand.
- the TdT variants of the invention allow modified nucleotides, and more particularly 3’O-reversibly blocked nucleoside triphosphates, to be used in an enzyme- based method of polynucleotide synthesis.
- the variants of the present invention are described according to their mutations or substitutions at specific residues, whose positions are designated with respect to a specified SEQ ID NO.
- a TdT variant may be operably linked to a linker moiety including a covalent or non-covalent bond; amino acid tag (e.g., poly-amino acid tag, poly-His tag, 6His-tag); chemical compound (e.g., polyethylene glycol); protein-protein binding pair (e.g., biotin-avidin); affinity coupling; capture probes; or any combination of these.
- the linker moiety can be separate from or part of a TdT variant (e.g., recombinant His-tagged polymerase, such as exemplified by the following pairs of SEQ ID NOs: 19 and 20, 21 and 22, 23 and 24, and 25 and 26).
- the linker moiety does not interfere with the nucleotide binding activity, or catalytic activity of the mutant TdT.
- the efficiency of a variant TdT in incorporating a 3’O-modified nucleoside triphosphate is at least 105 percent that of a previous available TdT wildtype or variant; in other embodiments, the efficiency of a variant TdT in incorporating a 3’O-modified nucleoside triphosphate is at least 110 percent that of a previous available TdT wildtype or variant; in other embodiments, the efficiency of a variant TdT in incorporating a 3’0-modified nucleoside triphosphate is at least 150 percent that of a previous available TdT wildtype or variant.
- a TdT variant of the invention comprises an amino acid sequences at least 60 percent identical to the SEQ ID NOs specified in Table 3 A and comprises at least a substitution of glutamine at the position indicated in column 1 for the specified SEQ ID NO.
- a TdT variant of the invention comprises an amino acid sequences at least 60 percent identical to the SEQ ID NOs specified in Table 3 A and comprises from 1 to 7 substitutions of glutamine, lysine, histidine, tryptophan, alanine or glycine at the positions indicated in columns 1 to 7, respectively, for the specified SEQ ID NOs.
- a TdT variant of the invention comprises an amino acid sequences at least 60 percent identical to the SEQ ID NOs specified in Table 3B and comprises at least a substitution of glutamine with one of T, F, L or M at the indicated position for the specified SEQ ID NO.
- a TdT variant of the invention comprises an amino acid sequences at least 60 percent identical to the SEQ ID NOs specified in Table 3B and comprises from 1 to 7 substitutions of glutamine with one of T, F, L or M, lysine with one of E, T, A or R, histidine with one of Y, F or D, tryptophan with R, alanine with V or glycine with E at the positions indicated in columns 1 to 7, respectively, for the specified SEQ ID NOs.
- the amino acid associated with the column is not present in the specified SEQ ID NO so that there is no substitution at that position of the TdT variant.
- each of the TdT variants described in the previous paragraph further (i) is capable of synthesizing a nucleic acid fragment without a template and (ii) is capable of incorporating a 3’-0-modified nucleotide onto a free 3’-hydroxyl of a nucleic acid fragment.
- the above percent identity value is at least 80 percent identity with the indicated SEQ ID NOs.
- the percent identity value of the previous paragraph is at least 90 percent identity; in some embodiments, such percent identity value is at least 95 percent identity; in some embodiments, such percent identity value is at least 98 percent identity; in some embodiments, such percent identity value is at least 99 percent identity.
- the above-mentioned 3’-0-modified nucleotide may comprise a 3’-0- NH2-nucleoside triphosphate, a 3’-O-azi do methyl-nucleoside triphosphate, a 3’-0-allyl- nucleoside triphosphate, a 3 ⁇ — (2-nitrobenzyl)-nucleoside triphosphate, or a 3’-0-propargyl- nucleoside triphosphate.
- Table 3A TdT variants with substitutions at positions Q455, K394, H466, W506, A146, G186 and/or Q390 (with respect to SEQ ID NO: 1) or functionally equivalent positions of the specified SEQ ID NO: 1
- Table 3B TdT variants with indicated substitutions at positions Q455, K394, H466, W506, A146, G186 and/or Q390 (with respect to SEQ ID NO: 1) or functionally equivalent positions of the specified SEQ ID NO: 1
- TdT variants of the invention may comprise, in addition to the substitutions set forth in Tables 3 A and 3B, one or more Supplementary Substitutions at the positions listed in Table 1 (set forth in Fig. 2) with respect to the specified SEQ ID NOs, and/or one or more stability enhancing substitutions at the positions listed in Table 2 with respect to the specified SEQ ID NOs (set forth in Fig. 3).
- stabilizing substitutions In regard to the stability enhancing mutations of Table 2, several adjacent substitutions are believed to exert a stabilizing effect by forming salt bridges between side chains. Thus, the equivalent stabilizing effect of substitutions Q166E and D170R may be obtained by switching the positions of E and R. Accordingly, in addition to the substitutions shown in Table 2, stabilizing substitutions also include the pairs, Q166R with D170E, C188D with L189R, and S275R with Q278E.
- TdT variants of the invention are set forth in Table 4.
- Each of the TdT variants DS1001 through DS 1018 comprises an amino acid sequence at least 60 percent identical to SEQ ID NO 3 and comprises the substitutions at the indicated positions.
- TdT variants DS 1001 through DS 1018 comprises an amino acid sequence at least 80 percent identical to SEQ ID NO 3 and comprises the substitutions at the indicated positions; in some embodiments, TdT variants DS1001 through DS 1018 comprises an amino acid sequence at least 90 percent identical to SEQ ID NO 3 and comprises the substitutions at the indicated positions; in some embodiments, TdT variants DS1001 through DS1018 comprises an amino acid sequence at least 95 percent identical to SEQ ID NO 3 and comprises the substitutions at the indicated positions; in some embodiments, TdT variants DS1001 through DS 1018 comprises an amino acid sequence at least 97 percent identical to SEQ ID NO 3 and comprises the substitutions at the indicated positions; in some embodiments, TdT variants DS1001 through DS1018 comprises an amino acid sequence at least 98 percent identical to SEQ ID NO 3 and comprises the substitutions at the indicated positions; in some embodiments, TdT variants DS1001 through DS1018 comprises an amino acid sequence at least 99 percent
- TdT variants of the invention as described above each comprise an amino acid sequence having a percent sequence identity with a specified SEQ ID NO, subject to the presence of indicated substitutions.
- the number and type of sequence differences between a TdT variant of the invention described in this manner and the specified SEQ ID NO may be due to substitutions, deletion and/or insertions, and the amino acids substituted, deleted and/or inserted may comprise any amino acid.
- such deletions, substitutions and/or insertions comprise only naturally occurring amino acids.
- substitutions comprise only conservative, or synonymous, amino acid changes, as described in Grantham, Science, 185: 862-864 (1974). That is, a substitution of an amino acid can occur only among members of its set of synonymous amino acids.
- sets of synonymous amino acids that may be employed are set forth in Table 5A. Table 5 A: Synonymous Sets of Amino Acids I
- sets of synonymous amino acids that may be employed are set forth in Table 5B.
- the efficiency of nucleotide incorporation by variants of the invention may be measured by an extension, or elongation, assay, e.g. as described in Boule et al (cited below); Bentolila et al (cited below); and Hiat et al, U.S. patent 5808045, the latter of which is incorporated herein by reference.
- a fluorescently labeled oligonucleotide having a free 3’-hydroxyl is reacted under TdT extension conditions with a variant TdT to be tested for a predetermined duration in the presence of a reversibly blocked nucleoside triphosphate, after which the extension reaction is stopped and the amounts of extension products and unextended initiator oligonucleotide are quantified after separation by gel electrophoresis.
- the incorporation efficiency of a variant TdT may be readily compared to the efficiencies of other variants or to that of wild type or reference TdTs, or other polymerases.
- a measure of variant TdT efficiency may be a ratio (given as a percentage) of amount of extended product using the variant TdT over the amount of extended product using wild type TdT in an equivalent assay.
- the following particular extension assay may be used to measure incorporation efficiencies of TdTs:
- Primer used is the following: 5'-AAAAAAAAAAAAAAGGGG-3' (SEQ ID NO: 2)
- the primer has also an ATTO fluorescent dye on the 5’ extremity.
- Representative modified nucleotides used include 3'-0-amino-2',3'-dideoxynucleotides-5'- triphosphates (ONH2, Firebird Biosciences), such as 3'-0-amino-2',3'-dideoxyadenosine-5'- triphosphate.
- dNTP 3'-0-amino-2',3'-dideoxynucleotides-5'- triphosphates
- ONH2 Firebird Biosciences
- 3'-0-amino-2',3'-dideoxyadenosine-5'- triphosphate 3'-0-amino-2',3'-dideoxyadenosine-5'- triphosphate.
- the Activity buffer comprises, for example, TdT reaction buffer (available from New England Biolabs) supplemented with C0CI2.
- the product of the assay is analyzed by conventional polyacrylamide gel electrophoresis.
- products of the above assay may be analyzed in a 16 percent polyacrylamide denaturing gel (Bio-Rad). Gels are made just before the analysis by pouring polyacrylamide inside glass plates and let it polymerize. The gel inside the glass plates is mounted on an adapted tank filed with TBE buffer (Sigma) for the electrophoresis step. The samples to be analyzed are loaded on the top of the gel. A voltage of 500 to 2,000V is applied between the top and bottom of the gel for 3 to 6h at room temperature. After separation, gel fluorescence is scanned using, for example, a Typhoon scanner (GE Life Sciences). The gel image is analyzed using Image J software (imagej.nih.gov/ij/), or its equivalent, to calculate the percentage of incorporation of the modified nucleotides.
- Image J software imagej.nih.gov/ij/
- the invention includes methods of measuring the capability of a polymerase, such as a TdT variant, to incorporate a dNTP onto a 3’ end of a polynucleotide (i.e. a“test polynucleotide”).
- One such method comprises providing a test polynucleotide with a free 3’ hydroxyl under reaction conditions in which it is substantially only single stranded, but that upon extension with a polymerase, such as a TdT variant, forms a stable hairpin structure comprising a single stranded loop and a double stranded stem, thereby allowing detection of an extension of the 3’ end by the presence of the double stranded polynucleotide.
- a polymerase such as a TdT variant
- the double stranded structure may be detected in a variety of ways including, but not limited to, fluorescent dyes that preferentially fluoresce upon intercalation into the double stranded structure, fluorescent resonance energy transfer (FRET) between an acceptor (or donor) on the extended polynucleotide and a donor (or acceptor) on an oligonucleotide that forms a triplex with the newly formed hairpin stem, FRET acceptors and donors that are both attached to the test polynucleotide and that are brought into FRET proximity upon formation of a hairpin, or the like.
- fluorescent dyes that preferentially fluoresce upon intercalation into the double stranded structure
- FRET fluorescent resonance energy transfer
- a stem portion of a test polynucleotide after extension by a single nucleotide is in the range of 4 to 6 basepairs in length; in other embodiments, such stem portion is 4 to 5 basepairs in length; and in still other embodiments, such stem portion is 4 basepairs in length.
- a test polynucleotide has a length in the range of from 10 to 20 nucleotides; in other embodiments, a test polynucleotide has a length in the range of from 12 to 15 nucleotides.
- test polynucleotide it is advantageous or convenient to extend the test polynucleotide with a nucleotide that maximizes the difference between the melting temperatures of the stem without extension and the stem with extension; thus, in some embodiments, a test polynucleotide is extended with a dC or dG (and accordingly the test polynucleotide is selected to have an appropriate complementary nucleotide for stem formation).
- test polynucleotides for hairpin completion assays include p875 (5’- CAGTTAAAAACT) (SEQ ID NO: 21) which is completed by extending with a dGTP; p876 (5’- GAGTTAAAACT) (SEQ ID NO: 22) which is completed by extending with a dCTP; and p877 (5’- CAGCAAGGCT) (SEQ ID NO: 23) which is completed by extending with a dGTP.
- Exemplary reaction conditions for such test polynucleotides may comprise: 2.5 - 5 mM of test polynucleotide, 1 :4000 dilution of GelRed ® (intercalating dye from Biotium, Inc., Fremont, CA), 200mM Cacodylate KOH pH 6.8, ImM C0CI2, 0-20% of DMSO and 3’ ONH 2 dGTP and TdT at desired concentrations.
- Completion of the hairpin may be monitored by an increase in fluorescence of GelRed® dye using a conventional fluorimeter, such as a TECAN reader at a reaction temperature of 28-38°C, using an excitation filter set to 360nm and anemission filter set to 635nm.
- TdT variants may be tested for their capacity for template-free incorporate of nucleoside triphosphates by the following steps: (a) combining a test polynucleotide having a free 3’-hydroxyl, a TdT variant and a nucleoside triphosphate under conditions wherein the test polynucleotide is single stranded but upon incorporation of the nucleoside triphosphate forms a hairpin having a double stranded stem region, and (b) detecting the amount of double stranded stem regions formed as a measure of the capacity of the TdT variant to incorporate the nucleoside triphosphate.
- the nucleoside triphosphate is a 3’-0-blocked nucleoside triphosphate.
- enzyme stability means a capability of an enzyme (or variant thereof) to retain a particular activity after it has been subjected to destabilizing conditions for a period of time, such as, elevated temperature, lowered temperature, low pH, high pH, exposure to a chaotropic agent, or the like.
- enzyme stability may be measured by exposing the enzyme to elevated temperatures, e.g. in the range of 50-70° C. for a period of time, e.g. in the range of 15-30 minutes, after which the activity of template-free elongation of an initiator stranded using a 3’-modified NTP is tested.
- enzyme stability may be measured by exposing the enzyme to low pH, e.g.
- TdT variants of the invention having enhanced stability with respect to elevated temperature display template-free initiator elongation activity using 3’-0-modified dNTPs equal to or greater than that of wild type TdT.
- TdT variants of the invention having enhanced stability with respect to pH display template-free initiator elongation activity using 3’-0- modified dNTPs equal to or greater than that of wild type TdT.
- such elevated temperature or pH stability is with respect to template-free initiator elongation activity using 3’-0-amine protected dNTPs.
- Template-free enzymatic synthesis of polynucleotides may be carried out by a variety of known protocols using template-free polymerases, such as terminal deoxynucleotidyl transferase (TdT), including variants thereof engineered to have improved characteristics, such as greater temperatue stability or greater efficiency in the incorporation of 3’-0-blocked deoxynucleoside triphosphates (3’-0-blocked dNTPs), e.g. Ybert et al, International patent publication WO/2015/159023; Ybert et al, International patent publication WO/2017/216472; Hyman, U.S. patent 5436143; Hiatt et al, U.S.
- template-free polymerases such as terminal deoxynucleotidyl transferase (TdT)
- TdT terminal deoxynucleotidyl transferase
- 3’-0-blocked dNTPs 3’-0-blocked
- the method of enzymatic DNA synthesis comprises repeated cycles of steps, such as are illustrated in Fig. 1, in which a predetermined nucleotide is added in each cycle.
- Initiator polynucleotides (100) are provided, for example, attached to solid support (102), which have free 3’-hydroxyl groups (103).
- This reaction produces elongated initiator polynucleotides whose 3’-hydroxyls are protected (106).
- the 3’-O-protection group is removed, or deprotected, and the desired sequence is cleaved from the original initiator polynucleotide.
- cleavage may be carried out using any of a variety of single strand cleavage techniques, for example, by inserting a cleavable nucleotide or cleavable linker at a predetermined location within the original initiator polynucleotide.
- Exemplary cleavable nucleotides or linkers include, but are not limited to, (i) a uracil nucleotide which is cleaved by uracil DNA glycosylase; (ii) a photocleavable group, such as a nitrobenzyl linker, as described in U.S. patent 5,739,386; or an inosine which is cleaved by endonuclease V.
- a cleaved polynucleotide may have a free 5’-hydroxyl; in other embodiments, a cleaved polynucleotide may have a 5’-phosphorylated end.
- the 3’-O-protection groups are removed to expose free 3’-hydroxyls (103) and the elongated initiator polynucleotides are subjected to another cycle of nucleotide addition and deprotection.
- an ordered sequence of nucleotides is coupled to an initiator nucleic acid using a TdT in the presence of 3’-0-reversibly blocked dNTPs in each synthesis step.
- the method of synthesizing an oligonucleotide comprises the steps of (a) providing an initiator having a free 3’-hydroxyl; (b) reacting under extension conditions the initiator or an extension intermediate having a free 3’-hydroxyl with a TdT in the presence of a 3’-0-blocked nucleoside triphosphate to produce a 3’-0-blocked extension intermediate; (c) deblocking the extension intermediate to produce an extension intermediate with a free 3’-hydroxyl; and (d) repeating steps (b) and (c) until the polynucleotide is synthesized.
- an initiator is provided as an oligonucleotide attached to a solid support, e.g. by its 5’ end.
- the above method may also include washing steps after the reaction, or extension, step, as well as after the de -blocking step.
- the step of reacting may include a sub-step of removing unincorporated nucleoside triphosphates, e.g. by washing, after a predetermined incubation period, or reaction time. Such predetermined incubation periods or reaction times may be a few seconds, e.g. 30 sec, to several minutes, e.g. 30 min.
- the above method may also include capping step(s) as well as washing steps after the reacting, or extending, step, as well as after the deblocking step.
- capping steps may be included in which non-extended free 3’-hydroxyls are reacted with compounds that prevents any further extensions of the capped strand.
- such compound may be a dideoxynucleoside triphosphate.
- non-extended strands with free 3’-hydroxyls may be degraded by treating them with a 3’-exonuclease activity, e.g. Exo I. For example, see Hyman, U.S. patent 5436143.
- strands that fail to be deblocked may be treated to either remove the strand or render it inert to further extensions.
- capping steps may be undesirable as capping may prevent the production of equal molar amounts of a plurality of oligonucleotides. Without capping, sequences will have a uniform distribution of deletion errors, but each of a plurality of oligonucleotides will be present in equal molar amounts. This would not be the case where non-extended fragments are capped.
- reaction conditions for an extension or elongation step may comprising the following: 2.0 mM purified TdT; 125-600 mM 3’-0-blocked dNTP (e.g. 3’-0- NH2-blocked dNTP); about 10 to about 500 mM potassium cacodylate buffer (pH between 6.5 and 7.5) and from about 0.01 to about 10 mM of a divalent cation (e.g. C0CI2 or MnCH), where the elongation reaction may be carried out in a 50 pL reaction volume, at a temperature within the range RT to 45°C, for 3 minutes.
- a divalent cation e.g. C0CI2 or MnCH
- reaction conditions for a deblocking step may comprise the following: 700 mM NaNCk; 1 M sodium acetate (adjusted with acetic acid to pH in the range of 4.8-6.5), where the deblocking reaction may be carried out in a 50 pL volume, at a temperature within the range of RT to 45°C for 30 seconds to several minutes.
- the steps of deblocking and/or cleaving may include a variety of chemical or physical conditions, e.g. light, heat, pH, presence of specific reagents, such as enzymes, which are able to cleave a specified chemical bond.
- Guidance in selecting 3’-O-blocking groups and corresponding de-blocking conditions may be found in the following references, which are incorporated by reference: U.S. patent 5808045; U.S. patent 8808988; International patent publication WO91/06678; and references cited below.
- the cleaving agent (also sometimes referred to as a de-blocking reagent or agent) is a chemical cleaving agent, such as, for example, dithiothreitol (DTT).
- a cleaving agent may be an enzymatic cleaving agent, such as, for example, a phosphatase, which may cleave a 3’-phosphate blocking group. It will be understood by the person skilled in the art that the selection of deblocking agent depends on the type of 3’- nucleotide blocking group used, whether one or multiple blocking groups are being used, whether initiators are attached to living cells or organisms or to solid supports, and the like, that necessitate mild treatment.
- a phosphine such as tris(2- carboxyethyl)phosphine (TCEP) can be used to cleave a 3 O-azidomethyl groups
- TCEP tris(2- carboxyethyl)phosphine
- palladium complexes can be used to cleave a 3’O-allyl groups
- sodium nitrite can be used to cleave a 3’O-amino group.
- the cleaving reaction involves TCEP, a palladium complex or sodium nitrite.
- blocking groups that may be removed using orthogonal de -blocking conditions.
- the following exemplary pairs of blocking groups may be used in parallel synthesis embodiments, such as those described above. It is understood that other blocking group pairs, or groups containing more than two, may be available for use in these embodiments of the invention.
- deprotection conditions that is, conditions that do not disrupt cellular membranes, denature proteins, interfere with key cellular functions, or the like.
- deprotection conditions are within a range of physiological conditions compatible with cell survival.
- enzymatic deprotection is desirable because it may be carried out under physiological conditions.
- specific enzymatically removable blocking groups are associated with specific enzymes for their removal.
- ester- or acyl- based blocking groups may be removed with an esterase, such as acetylesterase, or like enzyme, and a phosphate blocking group may be removed with a 3’ phosphatase, such as T4 polynucleotide kinase.
- esterase such as acetylesterase, or like enzyme
- a phosphate blocking group may be removed with a 3’ phosphatase, such as T4 polynucleotide kinase.
- 3’-O-phosphates may be removed by treatment with as solution of 100 mM Tris-HCl (pH 6.5) 10 mM M gC 12 , 5 mM 2-mercaptoethanol, and one Unit T4 polynucleotide kinase. The reaction proceeds for one minute at a temperature of 37°C.
- a "3'-phosphate -blocked” or “3’-phosphate-protected” nucleotide refers to nucleotides in which the hydroxyl group at the 3'-position is blocked by the presence of a phosphate containing moiety.
- 3'-phosphate-blocked nucleotides in accordance with the invention arc nucleotidyl-3'-phosphate monoester/nucleotidyl-2',3'-cyclic phosphate, nuclcotidyl-2'-phosphate monoester and nucleotidyl-2' or 3'-alkylphosphate diester, and nucleotidyl-2' or 3'-pyrophosphate.
- Thiophosphate or other analogs of such compounds can also be used, provided that the substitution does not prevent dephosphorylation resulting in a free 3’-OH by a phosphatase.
- an“initiator” refers to a short oligonucleotide sequence with a free 3’-end, which can be further elongated by a template-free polymerase, such as TdT.
- the initiating fragment is a DNA initiating fragment.
- the initiating fragment is an RNA initiating fragment.
- the initiating fragment possesses between 3 and 100 nucleotides, in particular between 3 and 20 nucleotides.
- the initiating fragment is single-stranded.
- the initiating fragment is double-stranded.
- an initiator oligonucleotide synthesized with a 5’-primary amine may be covalently linked to magnetic beads using the manufacturer’s protocol.
- an initiator oligonucleotide synthesized with a 3’-primary amine may be covalently linked to magnetic beads using the manufacturer’s protocol.
- attachment chemistries amenable for use with embodiments of the invention are well-known in the art, e.g. Integrated DNA Technologies brochure,“Strategies for Attaching Oligonucleotides to Solid Supports,” v.6 (2014); Hermanson, Bioconjugate Techniques, Second Edition (Academic Press, 2008); and like references.
- 3’-0-blocked dNTPs employed in the invention may be purchased from commercial vendors or synthesized using published techniques, e.g. U.S. patent 7057026; International patent publications W02004/005667, W091/06678; Canard et al, Gene (cited above); Metzker et al, Nucleic Acids Research, 22: 4259-4267 (1994); Meng et al, J. Org. Chem., 14: 3248-3252 (3006); U.S. patent publication 2005/037991.
- the modified nucleotides comprise a modified nucleotide or nucleoside molecule comprising a purine or pyrimidine base and a ribose or deoxyribose sugar moiety having a removable 3’-OH blocking group covalently attached thereto, such that the 3’ carbon atom has attached a group of the structure:
- R’ of the modified nucleotide or nucleoside is an alkyl or substituted alkyl, with the proviso that such alkyl or substituted alkyl has from 1 to 10 carbon atoms and from 0 to 4 oxygen or nitrogen heteroatoms.
- -Z of the modified nucleotide or nucleoside is of formula -C(R’) 2 -N3. In certain embodiments, Z is an azido methyl group.
- Z is a cleavable organic moiety with or without heteroatoms having a molecular weight of 200 or less. In other embodiments, Z is a cleavable organic moiety with or without heteroatoms having a molecular weight of 100 or less. In other embodiments, Z is a cleavable organic moiety with or without heteroatoms having a molecular weight of 50 or less. In some embodiments, Z is an enzymatically cleavable organic moiety with or without heteroatoms having a molecular weight of 200 or less. In other embodiments, Z is an enzymatically cleavable organic moiety with or without heteroatoms having a molecular weight of 100 or less.
- Z is an enzymatically cleavable organic moiety with or without heteroatoms having a molecular weight of 50 or less. In other embodiments, Z is an enzymatically cleavable ester group having a molecular weight of 200 or less. In other embodiments, Z is a phosphate group removable by a 3’-phosphatase. In some embodiments, one or more of the following 3’-phosphatases may be used with the manufacturer’s recommended protocols: T4 polynucleotide kinase, calf intestinal alkaline phosphatase, recombinant shrimp alkaline phosphatase (e.g. available from New England Biolabs, Beverly, MA)
- the 3’-blocked nucleotide triphosphate is blocked by either a 3’-0-azidomethyl, 3’-0-NH 2 or 3’-0-allyl group.
- 3’-0-blocking groups of the invention include 3’-0- methyl, 3’-0-(2-nitrobenzyl), 3’-0-allyl, 3’-0-amine, 3’-0-azidomethyl, 3’-0-tert-butoxy ethoxy, 3’-0-(2-cyanoethyl), and 3’-0-propargyl.
- Variants of the invention may be produced by mutating known reference or wild type TdT-coding polynucleotides, then expressing it using conventional molecular biology techniques.
- the mouse TdT gene (SEQ ID NO: 1) may be assembled from synthetic fragments using conventional molecular biology techniques, e.g. using protocols described by Stemmer et al, Gene, 164: 49-53 (1995); Kodumal et al, Proc. Natl. Acad. Sci., 101 : 15573-15578 (2004); or the like, or it may be directly cloned from mouse cells using protocols described by Boule et al, Mol. Biotechnology, 10: 199-208 (1998), or Bentolila et al, EMBO J., 14: 4221-4229 (1995); or the like.
- an isolated TdT gene may be inserted into an expression vector, such as pET32 (Novagen) to give a vector pCTdT which then may be used to make and express variant TdT proteins using conventional protocols.
- Vectors with the correct sequence may be transformed in E. coli producer strains.
- Transformed strains are cultured using conventional techniques to pellets from which TdT protein is extracted. For example, previously prepared pellets are thawed in 30 to 37°C water bath. Once fully thawed, pellets are resuspended in lysis buffer composed of 50mM tris-HCL (Sigma) pH 7.5, 150mM NaCl (Sigma), 0.5mM mercaptoethanol (Sigma), 5% glycerol (Sigma), 20mM imidazole (Sigma) and 1 tab for lOOmL of protease cocktail inhibitor (Thermo fisher). Careful resuspension is carried out in order to avoid premature lysis and remaining of aggregates.
- lysis buffer composed of 50mM tris-HCL (Sigma) pH 7.5, 150mM NaCl (Sigma), 0.5mM mercaptoethanol (Sigma), 5% glycerol (Sigma), 20mM imidazole (Sigma) and 1 tab for lOOmL of
- Resuspended cells are lysed through several cycles of French press, until full color homogeneity is obtained. Usual pressure used is 14,000psi. Lysate is then centrifuged for lh to lh30 at 10,000 rpm. Centrifugate is pass through a 0.2pm filter to remove any debris before column purification.
- TdT protein may be purified from the centrifugate in a one-step affinity procedure.
- Ni-NTA affinity column GE Healthcare
- Ni-NTA affinity column GE Healthcare
- the column has been washed and equilibrated with 15 column volumes of 50mM tris- HCL (Sigma) pH 7.5, 150mM NaCl (Sigma) and 20mM imidazole (Sigma).
- Polymerases are bound to the column after equilibration.
- a washing buffer composed of 50mM tris-HCL (Sigma) pH 7.5, 500mM NaCl (Sigma) and 20mM imidazole (Sigma), is applied to the column for 15 column volumes.
- the polymerases After wash the polymerases are eluted with 50mM tris-HCL (Sigma) pH 7.5, 500mM NaCl (Sigma) and 0.5M imidazole (Sigma). Fractions corresponding to the highest concentration of polymerases of interest are collected and pooled in a single sample. The pooled fractions are dialyzed against the dialysis buffer (20 mM Tris-HCl, pH 6.8, 200mM Na Cl, 50mM MgOAc, lOOmM [NH4]2S04). The dialysate is subsequently concentrated with the help of concentration filters (Amicon Ultra-30, Merk Millipore).
- Concentrated enzyme is distributed in small aliquots, 50% glycerol final is added, and those aliquots are then frozen at -20°C and stored for long term. 5pL of various fraction of the purified enzymes are analyzed in SDSPAGE gels.
- kits of the invention comprise a TdT variant of the invention in a formulation suitable for carrying out template-free enzymatic polynucleotide synthesis as described herein.
- kits of the invention may also include synthesis buffers that provide reaction conditions for optimizing the template-free addition or incorporation of a 3’-0-protected dNTP to a growing strand.
- kits of the invention further include 3’-0-reversibly protected dNTPs.
- the 3’-O-reversibly protected dNTPs may comprise 3’-0-amino-dNTPs or 3’-0-azidomethyl-dNTPs.
- kits may include one or more of the following items, either separately or together with the above-mentioned items: (i) deprotection reagents for carrying out a deprotecting step as described herein, (ii) solid supports with initiators attached thereto, (iii) cleavage reagents for releasing completed polynucleotides from solid supports, (iv) wash reagents or buffers for removing unreacted 3’-0-protected dNTPs at the end of an enzymatic addition or coupling step, and (v) post-synthesis processing reagents, such as purification columns, desalting reagents, eluting reagents, and the like.
- an initiator comprising an inosine cleavable nucleotide may come with an endonuclease V cleavage reagent; an initiator comprising a nitrobenzyl photo cleavable linker may come with a suitable light source for cleaving the photocleavable linker; an initiator comprising a uracil may come with a uracil DNA glycosylase cleavage reagent; and the like.
- Example 1 Generation. Expression and Purification of TdT Variants
- the TdT mouse gene may be generated from the pET28 plasmid described in [Boule et al., 1998, Mol. Biotechnol. 10, 199-208] For example, the gene may be amplified by using the following primers:
- T7-pro TAATACGACTCACTATAGGG (SEQ ID N°33)
- T7-ter GCT AGTT ATT GCT C AGCGG (SEQ ID N°34) through standard molecular biology techniques.
- the sequence is then cloned into plasmid pET32 backbone to give the new pCTdT plasmid.
- pCTdT is transformed into commercial E. coli cells, BL21 (DE3, from Novagen). Growing colonies on plate with kanamycin are isolated and named Ec-CTdT.Polymerase variants generation.
- the pCTdT vector is used as starting vector. Specific primers comprising one or several point mutations have been generated from Agilent online software
- the Ec-CTdT and Ec-DSi or Ec-DSi’ strains may be used for inoculating 250mL erlens with 50mL of LB media supplemented with appropriate amount of kanamycin. After overnight growth at 37°C, appropriate volumes of these pre-cultures are used to inoculate 5L erlens with 2L LB media with kanamycin. The initial OD for the 5L cultures is chosen to be 0.01. The erlens are put at 37°C under strong agitation and the OD of the different cultures are regularly checked.
- each erlen is supplemented by the addition of lmL of 1M IPTG (Isopropyl b-D-l- thiogalactopyranoside, Sigma).
- IPTG Isopropyl b-D-l- thiogalactopyranoside
- the erlens are put back to agitation under a controlled temperature of 37°C. After overnight expression, the cells are harvested in several pellets. Pellets expressing the same variants are pooled and stored at -20°C, eventually for several months.
- a one-step affinity procedure is used to purify the produced and extracted polymerase enzymes.
- a Ni-NTA affinity column (GE Healthcare) is used to bind the polymerases. Initially the column has been washed and equilibrated with 15 column volumes of 50mM tris-HCL (Sigma) pH 7.5, 150mM NaCl (Sigma) and 20mM imidazole (Sigma). Polymerases are bound to the column after equilibration. Then a washing buffer, composed of 50mM tris-HCL (Sigma) pH 7.5, 500mM NaCl (Sigma) and 20mM imidazole (Sigma), is applied to the column for 15 column volumes.
- the polymerases After wash the polymerases are eluted with 50mM tris-HCL (Sigma) pH 7.5, 500mM NaCl (Sigma) and 0.5M imidazole (Sigma). Fractions corresponding to the highest concentration of polymerases of interest are collected and pooled in a single sample. The pooled fractions are dialyzed against the dialysis buffer (20 mM Tris-HCl, pH 6.8, 200mM Na Cl, 50mM MgOAc, lOOmM [NH ⁇ SC ). The dialysate is subsequently concentrated with the help of concentration filters (Amicon Ultra-30, Merk Millipore).
- Concentrated enzyme is distributed in small aliquots, 50% glycerol final is added, and those aliquots are then frozen at -20°C and stored for long term. 5pL of various fraction of the purified enzymes are analyzed in SDS-PAGE gels.
- the invention is based in part on a recognition and appreciation by the inventors that certain nucleotide sequences are difficult for TdTs to extend.
- an object of this experiment was to discover new TdT variants that exhibit enhanced capability to synthesize such difficult sequences based on comparison to an earlier TdT variant, designated M27 (SEQ ID NO: 32).
- M27 an earlier TdT variant
- a mutation library of mouse TdT (SEQ ID NO: 3) was produced based on structural information from mouse TdT, the activities of TdT variants from prior libraries, and from conventional protein engineering techniques.
- TdT variants from the library are expressed and purified as described above and were screened for their capability to synthesize certain difficult-to-synthesize sequences (shown in Table 7) at a higher rate than that of M27.
- the extended primer is linked to a solid support that allows removal of the reaction buffer between each step. As noted above, the reactions were run for 3 min at 37°C after which the extended primers were (i) cleaved from their supports, (ii) separated by electrophoresis and (iii) the fluorescent intensity of the bands was measured to evaluate the efficiency of synthesis for each variant. The results are shown in Table 7 where the entries are relative values that reflect the relative extension rates among the variants. Table 7: Synthesis Efficiency of Various TdT Variants
- Elongation efficiency of variants M27, M44 and M45 were also measured under different reaction temperatures. In these experiments only a single elongation step was performed.
- the Reaction conditions were as follows: primer (i.e. initiator) concentration of 0.5 mM, a single 3’-ONH2-dTTP at 125 mM, and TdT reaction buffer (for example, available from New England Biolabs) supplemented with CoC12.
- primers i.e. initiator
- TdT reaction buffer for example, available from New England Biolabs
- Primers were labeled with an ATTO fluorescent dye on the 5’ extremity. The reactions were run for 10 min separately at 37°C, 45°C, 50°C and 55°C. The results are shown in Table 8 where the values in the Table are relative magnitudes.
- non-mouse TdT variants were constructed from publicly available genes and were tested to determine their ability to incorporate 3’-0-amino-dNTPs into a test polynucleotide (p877) in hairpin completion assays as described above.
- the TdT variants are identified in Table 9 along with their incorporation capacity as compared to mouse TdT variant, M27.
- Table 9 Characteristics of Non-Mouse TdT Variants
- Amino acids are represented by either their one-letter or three-letters code according to the following nomenclature: A: alanine (Ala); C: cysteine (Cys); D: aspartic acid (Asp); E: glutamic acid (Glu); F: phenylalanine (Phe); G: glycine (Gly); H: histidine (His); I: isoleucine (lie); K: lysine (Lys); L: leucine (Leu); M: methionine (Met); N: asparagine (Asn); P: proline (Pro); Q: glutamine (Gin); R: arginine (Arg); S: serine (Ser); T: threonine (Thr); V: valine (Val); W: tryptophan (Trp ) and Y tyrosine (Tyr).
- A alanine
- C cysteine
- D aspartic acid
- Glu glutamic acid
- F
- “Functionally equivalent” in reference to a substituted residue means the substituted residue of a variant TdT has an identical functional role as a residue in a sequence of another TdT having a sequence homologous to SEQ ID NO: 1.
- Functionally equivalent residues may be identified by using sequence alignments, for example, using the Mutalin line alignment software (http://multalin.toulouse.inra.fr/multalin/multalin.html; 1988, Nucl. Acids Res., 16 (22), 25 10881-10890). After alignment, the functionally equivalent residues are at homologous positions on the different sequences considered. Sequence alignments and identification of functionally equivalent residues may be determined between any TdT and their natural variants, including inter-species.
- isolated in reference to protein means such a compound which has been identified and separated and/or recovered from a component of its natural environment or from a heterogeneous reaction mixture. Contaminant components of a natural environment or reaction mixture are materials which would interfere with a protein’s function, and may include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes.
- a protein of the invention is purified (1) to greater than 95% by weight of protein as determined by the Lowry method, and most preferably more than 99% by weight, (2) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator, or (3) to homogeneity by SDS-PAGE under reducing or nonreducing conditions using Coomassie blue or, preferably, silver stain.
- an isolated protein of the invention may include the protein of the invention in situ within recombinant cells since at least one component of the protein’s natural environment will not be present. Ordinarily, an isolated protein of the invention is prepared by at least one purification step.
- “Kit” refers to any delivery system for delivering materials or reagents for carrying out a method of the invention.
- delivery systems include systems and/or compounds (such as dilutants, surfactants, carriers, or the like) that allow for the storage, transport, or delivery of reaction reagents (e.g., one or more TdT variants, reaction buffers, 3’-0-protected-dNTPs, deprotection reagents, solid supports with initiators attached , etc. in the appropriate containers) and/or supporting materials (e.g., buffers, written instructions for performing the assay etc.) from one location to another.
- reaction reagents e.g., one or more TdT variants, reaction buffers, 3’-0-protected-dNTPs, deprotection reagents, solid supports with initiators attached , etc. in the appropriate containers
- supporting materials e.g., buffers, written instructions for performing the assay etc.
- kits include one or more enclosures (e.g., boxes) containing the relevant reaction reagents and/or supporting materials. Such contents may be delivered to the intended recipient together or separately.
- a first container may contain one or more TdT variants for use in a synthesis method, while a second or additional containers may contain deprotection agents, solid supports with initiators, 3’-0-protected dNTPs, or the like.
- Mutagenesis activities consist in deleting, inserting or substituting one or several amino-acids in the sequence of a protein or in the case of the invention of a polymerase.
- L238A denotes that amino acid residue (Leucine, L) at position 238 of a reference, or wild type, sequence is changed to an Alanine (A).
- A132V/I/M denotes that amino acid residue (Alanine, A) at position 132 of the parent sequence is substituted by one of the following amino acids: Valine (V), Isoleucine (I), or Methionine (M).
- the substitution can be a conservative or non-conservative substitution.
- conservative substitutions are within the groups of basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine, asparagine and threonine), hydrophobic amino acids (methionine, leucine, isoleucine, cysteine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine), and small amino acids (glycine, alanine and serine).
- basic amino acids arginine, lysine and histidine
- acidic amino acids glutmic acid and aspartic acid
- polar amino acids glutamine, asparagine and threonine
- hydrophobic amino acids methionine, leucine, isoleucine, cysteine and valine
- aromatic amino acids phenylalanine, tryptophan and tyrosine
- small amino acids glycine, alanine and serine
- sequence identity refers to the number (or fraction, usually expressed as a percentage) of matches (e.g., identical amino acid residues) between two sequences, such as two polypeptide sequences or two polynucleotide sequences.
- sequence identity is determined by comparing the sequences when aligned so as to maximize overlap and identity while minimizing sequence gaps.
- sequence identity may be determined using any of a number of mathematical global or local alignment algorithms, depending on the length of the two sequences. Sequences of similar lengths are preferably aligned using a global alignment algorithm (e.g.
- Needleman and Wunsch algorithm Needleman and Wunsch, 1970 which aligns the sequences optimally over the entire length, while sequences of substantially different lengths are preferably aligned using a local alignment algorithm (e.g. Smith and Waterman algorithm (Smith and Waterman, 1981) or Altschul algorithm (Altschul et al., 1997; Altschul et al., 2005)). Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software available on internet web sites such as http://blast.ncbi.nlm.nih.gov/ or ttp://www.ebi. ac.uk/Tools/emboss/.
- Polynucleotide” or“oligonucleotide” are used interchangeably and each mean a linear polymer of nucleotide monomers or analogs thereof.
- Monomers making up polynucleotides and oligonucleotides are capable of specifically binding to a natural polynucleotide by way of a regular pattern of monomer-to-monomer interactions, such as Watson-Crick type of base pairing, base stacking, Hoogsteen or reverse Hoogsteen types of base pairing, or the like.
- Such monomers and their intemucleosidic linkages may be naturally occurring or may be analogs thereof, e.g. naturally occurring or non-naturally occurring analogs.
- Non-naturally occurring analogs may include PNAs, phosphorothioate intemucleosidic linkages, bases containing linking groups permitting the attachment of labels, such as fluorophores, or haptens, and the like.
- labels such as fluorophores, or haptens, and the like.
- oligonucleotide or polynucleotide requires enzymatic processing, such as extension by a polymerase, ligation by a ligase, or the like, one of ordinary skill would understand that oligonucleotides or polynucleotides in those instances would not contain certain analogs of intemucleosidic linkages, sugar moieties, or bases at any or some positions.
- Polynucleotides typically range in size from a few monomeric units, e.g. 5-40, when they are usually referred to as “oligonucleotides,” to several thousand monomeric units.
- oligonucleotides typically range in size from a few monomeric units, e.g. 5-40, when they are usually referred to as “oligonucleotides,” to several thousand monomeric units.
- ATGCCTG a sequence of letters (upper or lower case)
- A denotes deoxyadenosine
- C denotes deoxycytidine
- G denotes deoxyguanosine
- T denotes thymidine
- “I” denotes deoxyinosine
- U denotes uridine, unless otherwise indicated or obvious from context.
- polynucleotides comprise the four natural nucleosides (e.g. deoxyadenosine, deoxycytidine, deoxyguanosine, deoxythymidine for DNA or their ribose counterparts for RNA) linked by phosphodiester linkages; however, they may also comprise non-natural nucleotide analogs, e.g. including modified bases, sugars, or intemucleosidic linkages.
- nucleosides e.g. deoxyadenosine, deoxycytidine, deoxyguanosine, deoxythymidine for DNA or their ribose counterparts for RNA
- non-natural nucleotide analogs e.g. including modified bases, sugars, or intemucleosidic linkages.
- oligonucleotide or polynucleotide substrate requirements for activity e.g. single stranded DNA, RNA/DNA duplex, or the like
- selection of appropriate composition for the oligonucleotide or polynucleotide substrates is well within the knowledge of one of ordinary skill, especially with guidance from treatises, such as Sambrook et al, Molecular Cloning, Second Edition (Cold Spring Harbor Laboratory, New York, 1989), and like references.
- the oligonucleotide and polynucleotide may refer to either a single stranded form or a double stranded form (i.e. duplexes of an oligonucleotide or polynucleotide and its respective complement). It will be clear to one of ordinary skill which form or whether both forms are intended from the context of the terms usage.
- Primer means an oligonucleotide, either natural or synthetic that is capable, upon forming a duplex with a polynucleotide template, of acting as a point of initiation of nucleic acid synthesis and being extended from its 3’ end along the template so that an extended duplex is formed.
- Extension of a primer is usually carried out with a nucleic acid polymerase, such as a DNA or RNA polymerase.
- the sequence of nucleotides added in the extension process is determined by the sequence of the template polynucleotide.
- primers are extended by a DNA polymerase.
- Primers usually have a length in the range of from 14 to 40 nucleotides, or in the range of from 18 to 36 nucleotides. Primers are employed in a variety of nucleic amplification reactions, for example, linear amplification reactions using a single primer, or polymerase chain reactions, employing two or more primers. Guidance for selecting the lengths and sequences of primers for particular applications is well known to those of ordinary skill in the art, as evidenced by the following references that are incorporated by reference: Dieffenbach, editor, PCR Primer: A Laboratory Manual, 2nd Edition (Cold Spring Harbor Press, New York, 2003).
- A“substitution” means that an amino acid residue is replaced by another amino acid residue.
- substitution refers to the replacement of an amino acid residue by another selected from the naturally-occurring standard 20 amino acid residues, rare naturally occurring amino acid residues (e.g.
- substitution refers to the replacement of an amino acid residue by another selected from the naturally-occurring standard 20 amino acid residues.
- the sign“+” indicates a combination of substitutions.
- amino acids are herein represented by their one-letter or three-letters code according to the following nomenclature: A: alanine (Ala); C: cysteine (Cys); D: aspartic acid (Asp); E: glutamic acid (Glu); F: phenylalanine (Phe); G: glycine (Gly); H: histidine (His); I: isoleucine (lie); K: lysine (Lys); L: leucine (Leu); M: methionine (Met); N: asparagine (Asn); P: proline (Pro); Q: glutamine (Gin); R: arginine (Arg); S: serine (Ser); T: threonine (Thr); V: valine (Val); W: tryptophan (Trp ) and Y: tyrosine (Tyr).
- A alanine
- C cysteine
- D aspartic acid
- Glu glutamic acid
- F
- L238A denotes that amino acid residue (Leucine, L) at position 238 of the parent sequence is changed to an Alanine (A).
- A132V/I/M denotes that amino acid residue (Alanine, A) at position 132 of the parent sequence is substituted by one of the following amino acids: Valine (V), Isoleucine (I), or Methionine (M).
- V Valine
- I Isoleucine
- M Methionine
- the substitution can be a conservative or non conservative substitution.
- conservative substitutions are within the groups of basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine, asparagine and threonine), hydrophobic amino acids (methionine, leucine, isoleucine, cysteine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine), and small amino acids (glycine, alanine and serine).
- basic amino acids arginine, lysine and histidine
- acidic amino acids glutmic acid and aspartic acid
- polar amino acids glutamine, asparagine and threonine
- hydrophobic amino acids methionine, leucine, isoleucine, cysteine and valine
- aromatic amino acids phenylalanine, tryptophan and tyrosine
- small amino acids glycine, alanine and serine
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
Description
Claims
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2021526276A JP2022513031A (en) | 2018-11-14 | 2019-11-13 | Terminal deoxynucleotidyl transferase variant and its use |
| SG11202104601PA SG11202104601PA (en) | 2018-11-14 | 2019-11-13 | Terminal deoxynucleotidyl transferase variants and uses thereof |
| CA3119845A CA3119845A1 (en) | 2018-11-14 | 2019-11-13 | Terminal deoxynucleotidyl transferase variants and uses thereof |
| AU2019379287A AU2019379287A1 (en) | 2018-11-14 | 2019-11-13 | Terminal deoxynucleotidyl transferase variants and uses thereof |
| CN201980089035.8A CN113302289A (en) | 2018-11-14 | 2019-11-13 | Terminal deoxynucleotidyl transferase variants and uses thereof |
| EP19801879.8A EP3880808A1 (en) | 2018-11-14 | 2019-11-13 | Terminal deoxynucleotidyl transferase variants and uses thereof |
| US17/293,017 US11859217B2 (en) | 2018-11-14 | 2019-11-13 | Terminal deoxynucleotidyl transferase variants and uses thereof |
| IL283068A IL283068A (en) | 2018-11-14 | 2021-05-10 | Terminal deoxynucleotidyl transferase variants and uses thereof |
| US18/504,010 US12371680B2 (en) | 2018-11-14 | 2023-11-07 | Terminal deoxynucleotidyl transferase variants and uses thereof |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP18206298.4 | 2018-11-14 | ||
| EP18206298 | 2018-11-14 | ||
| EP19305677 | 2019-05-28 | ||
| EP19305677.7 | 2019-05-28 | ||
| EP19195662.2 | 2019-09-05 | ||
| EP19195662 | 2019-09-05 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US17/293,017 A-371-Of-International US11859217B2 (en) | 2018-11-14 | 2019-11-13 | Terminal deoxynucleotidyl transferase variants and uses thereof |
| US18/504,010 Continuation US12371680B2 (en) | 2018-11-14 | 2023-11-07 | Terminal deoxynucleotidyl transferase variants and uses thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2020099451A1 true WO2020099451A1 (en) | 2020-05-22 |
Family
ID=68536875
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2019/081099 Ceased WO2020099451A1 (en) | 2018-11-14 | 2019-11-13 | Terminal deoxynucleotidyl transferase variants and uses thereof |
Country Status (9)
| Country | Link |
|---|---|
| US (2) | US11859217B2 (en) |
| EP (1) | EP3880808A1 (en) |
| JP (1) | JP2022513031A (en) |
| CN (1) | CN113302289A (en) |
| AU (1) | AU2019379287A1 (en) |
| CA (1) | CA3119845A1 (en) |
| IL (1) | IL283068A (en) |
| SG (1) | SG11202104601PA (en) |
| WO (1) | WO2020099451A1 (en) |
Cited By (31)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021018921A1 (en) | 2019-08-01 | 2021-02-04 | Dna Script | Increasing long-sequence yields in template-free enzymatic synthesis of polynucleotides. |
| WO2021058438A1 (en) | 2019-09-23 | 2021-04-01 | Dna Script | Increasing long-sequence yields in template-free enzymatic synthesis of polynucleotides |
| WO2021116270A1 (en) * | 2019-12-12 | 2021-06-17 | Dna Script | Chimeric terminal deoxynucleotidyl transferases for template-free enzymatic synthesis of polynucleotides |
| WO2021122539A1 (en) * | 2019-12-16 | 2021-06-24 | Dna Script | Template-free enzymatic polynucleotide synthesis using dismutationless terminal deoxynucleotidyl transferase variants |
| WO2021213903A1 (en) * | 2020-04-20 | 2021-10-28 | Dna Script | Terminal deoxynucleotidyl transferase variants and uses thereof |
| WO2021254934A1 (en) | 2020-06-16 | 2021-12-23 | Dna Script | Systems, apparatus and kits for enzymatic polynucleotide synthesis |
| WO2022013094A1 (en) | 2020-07-15 | 2022-01-20 | Dna Script | Massively parallel enzymatic synthesis of polynucleotides |
| WO2022063835A1 (en) * | 2020-09-22 | 2022-03-31 | Dna Script | Stabilized n-terminally truncated terminal deoxynucleotidyl transferase variants and uses thereof |
| WO2022090057A1 (en) | 2020-10-26 | 2022-05-05 | Dna Script | Novel variants of endonuclease v and uses thereof |
| US11359221B2 (en) | 2019-02-12 | 2022-06-14 | Dna Script Sas | Efficient product cleavage in template-free enzymatic synthesis of polynucleotides |
| WO2022207934A1 (en) | 2021-04-02 | 2022-10-06 | Dna Script | Methods and kits for enzymatic synthesis of g4-prone polynucleotides |
| DE102022114351A1 (en) | 2021-06-10 | 2022-12-15 | Dna Script | ENZYMATIC SYNTHESIS OF POLYNUCLEOTIDES USING 3'-O-AMINO-2'-DEOXYRIBONUCLEOSIDE TRIPHOSPHATE MONOMERS |
| WO2023083999A2 (en) | 2021-11-10 | 2023-05-19 | Dna Script | Novel terminal deoxynucleotidyl transferase (tdt) variants |
| WO2023083997A2 (en) | 2021-11-10 | 2023-05-19 | Dna Script | Novel terminal deoxynucleotidyl |
| WO2024083883A1 (en) | 2022-10-19 | 2024-04-25 | Dna Script | Methods and products for removal of uracil containing polynucleotides |
| WO2024141628A1 (en) | 2022-12-31 | 2024-07-04 | Dna Script | Variable viscosity inks for inkjet delivery of enzyme reagents |
| WO2024227846A2 (en) | 2023-05-03 | 2024-11-07 | Dna Script | Reagent used in deprotection of 3'-o-amino polynucleotides |
| WO2025003434A1 (en) | 2023-06-30 | 2025-01-02 | Dna Script | Nucleic acid synthesis on reusable support |
| EP4407026A3 (en) * | 2019-05-28 | 2025-01-15 | DNA Script | Variants of terminal deoxynucleotidyl transferase and uses thereof |
| WO2025088024A1 (en) * | 2023-10-24 | 2025-05-01 | Dna Script | Novel terminal deoxynucleotidyl transferase (tdt) variants and uses thereof |
| GB2635104A (en) * | 2023-09-08 | 2025-05-07 | Evonetix Ltd | Enzymes and methods |
| WO2025093659A1 (en) | 2023-11-04 | 2025-05-08 | Dna Script | 3'-o-aminooxymethyl blocked nucleotides and use thereof in enzymatic synthesis of polynucleotides |
| EP4450620A4 (en) * | 2022-01-28 | 2025-06-25 | Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences | Terminal transferase variant for controllable synthesis of single-stranded dna and use thereof |
| WO2025132627A1 (en) | 2023-12-18 | 2025-06-26 | Dna Script | Stabilized variants of highly active endonuclease v for cleavage of labelled dna |
| WO2025132603A1 (en) | 2023-12-18 | 2025-06-26 | Dna Script | Novel variants of endonuclease v for cleavage of labelled dna |
| US12371680B2 (en) | 2018-11-14 | 2025-07-29 | Dna Script Sas | Terminal deoxynucleotidyl transferase variants and uses thereof |
| US12421628B2 (en) | 2018-07-23 | 2025-09-23 | Dna Script | Massively parallel enzymatic synthesis of nucleic acid strands |
| WO2026008717A2 (en) | 2024-07-02 | 2026-01-08 | Dna Script | Method for enzymatic synthesis of polynucleotides |
| WO2026008711A2 (en) | 2024-07-02 | 2026-01-08 | Dna Script | Filtering device and method for polynucleotide enzymatic synthesis |
| WO2026017834A1 (en) | 2024-07-19 | 2026-01-22 | Dna Script | Inkjet-assisted enzymatic nucleic acid synthesis and cleavage |
| US12565641B2 (en) | 2021-10-15 | 2026-03-03 | Codexis, Inc. | Engineered terminal deoxynucleotidyl transferase variants |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4623103B1 (en) | 2023-01-06 | 2026-02-04 | DNA Script | Methods for obtaining correctly assembled nucleic acids |
| EP4652292A1 (en) | 2023-01-16 | 2025-11-26 | DNA Script | Inkjet-assisted enzymatic nucleic acid synthesis |
| WO2024153642A1 (en) | 2023-01-16 | 2024-07-25 | Dna Script | Scarless template-free enzymatic synthesis of polynucleotides |
| CN120060189A (en) * | 2023-11-30 | 2025-05-30 | 北京擎科生物科技股份有限公司 | Terminal deoxynucleotidyl transferase mutant and application thereof |
| WO2025221943A1 (en) * | 2024-04-16 | 2025-10-23 | Codexis, Inc. | Engineered terminal nucleotidyl transferase variants and uses thereof |
| CN118995661B (en) * | 2024-09-27 | 2025-06-20 | 浙江大学 | A terminal deoxynucleotidyl transferase mutant with high thermal stability and its application |
| CN119506242B (en) * | 2024-11-12 | 2025-11-07 | 生工生物工程(上海)股份有限公司 | Terminal transferase mutant, recombinant protein, nucleic acid molecule and oligonucleotide single base extension method |
Citations (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1991006678A1 (en) | 1989-10-26 | 1991-05-16 | Sri International | Dna sequencing |
| US5436143A (en) | 1992-12-23 | 1995-07-25 | Hyman; Edward D. | Method for enzymatic synthesis of oligonucleotides |
| US5739386A (en) | 1994-06-23 | 1998-04-14 | Affymax Technologies N.V. | Photolabile compounds and methods for their use |
| US5763594A (en) | 1994-09-02 | 1998-06-09 | Andrew C. Hiatt | 3' protected nucleotides for enzyme catalyzed template-independent creation of phosphodiester bonds |
| US5808045A (en) | 1994-09-02 | 1998-09-15 | Andrew C. Hiatt | Compositions for enzyme catalyzed template-independent creation of phosphodiester bonds using protected nucleotides |
| WO2004005667A1 (en) | 2002-07-08 | 2004-01-15 | Shell Internationale Research Maatschappij B.V. | Choke for controlling the flow of drilling mud |
| US20050037991A1 (en) | 2003-06-30 | 2005-02-17 | Roche Molecular Systems, Inc. | Synthesis and compositions of 2'-terminator nucleotides |
| US7057026B2 (en) | 2001-12-04 | 2006-06-06 | Solexa Limited | Labelled nucleotides |
| US7544794B1 (en) | 2005-03-11 | 2009-06-09 | Steven Albert Benner | Method for sequencing DNA and RNA by synthesis |
| US8808988B2 (en) | 2006-09-28 | 2014-08-19 | Illumina, Inc. | Compositions and methods for nucleotide sequencing |
| WO2015159023A1 (en) | 2014-04-17 | 2015-10-22 | Dna Script | Method for synthesising nucleic acids, in particular long nucleic acids, use of said method and kit for implementing said method |
| CA3024184A1 (en) * | 2016-06-14 | 2017-12-21 | Dna Script | Variants of a dna polymerase of the polx family |
Family Cites Families (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE69731463T2 (en) * | 1996-02-21 | 2005-10-27 | The Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services | RECOMBINANT RIBONUCLEASE PROTEINS |
| SG86311A1 (en) * | 1997-04-10 | 2002-02-19 | Univ Singapore | Bacillus stearothermophilus dna polymerase i (klenow) clones with reduced 3'-to-5' exonuclease activity |
| CN105264085B (en) * | 2013-10-15 | 2020-10-13 | 分子组装有限责任公司 | Method and apparatus for synthesizing nucleic acid |
| US11390858B2 (en) * | 2014-10-20 | 2022-07-19 | Molecular Assemblies, Inc. | Modified template-independent enzymes for polydeoxynucleotide synthesis |
| US10774316B2 (en) * | 2014-10-20 | 2020-09-15 | Molecular Assemblies, Inc. | Modified template-independent enzymes for polydeoxynucleotide synthesis |
| EP3209781B8 (en) * | 2014-10-20 | 2020-01-15 | Molecular Assemblies Inc. | Modified template-independent enzymes for polydeoxynucleotide synthesis |
| GB201502152D0 (en) * | 2015-02-10 | 2015-03-25 | Nuclera Nucleics Ltd | Novel use |
| US11993800B2 (en) * | 2017-05-26 | 2024-05-28 | Nuclera Ltd. | Use of terminal transferase enzyme in nucleic acid synthesis |
| US10752887B2 (en) * | 2018-01-08 | 2020-08-25 | Dna Script | Variants of terminal deoxynucleotidyl transferase and uses thereof |
| AU2019379287A1 (en) | 2018-11-14 | 2021-06-03 | Dna Script | Terminal deoxynucleotidyl transferase variants and uses thereof |
-
2019
- 2019-11-13 AU AU2019379287A patent/AU2019379287A1/en active Pending
- 2019-11-13 US US17/293,017 patent/US11859217B2/en active Active
- 2019-11-13 JP JP2021526276A patent/JP2022513031A/en active Pending
- 2019-11-13 EP EP19801879.8A patent/EP3880808A1/en active Pending
- 2019-11-13 CN CN201980089035.8A patent/CN113302289A/en active Pending
- 2019-11-13 CA CA3119845A patent/CA3119845A1/en active Pending
- 2019-11-13 WO PCT/EP2019/081099 patent/WO2020099451A1/en not_active Ceased
- 2019-11-13 SG SG11202104601PA patent/SG11202104601PA/en unknown
-
2021
- 2021-05-10 IL IL283068A patent/IL283068A/en unknown
-
2023
- 2023-11-07 US US18/504,010 patent/US12371680B2/en active Active
Patent Citations (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1991006678A1 (en) | 1989-10-26 | 1991-05-16 | Sri International | Dna sequencing |
| US5436143A (en) | 1992-12-23 | 1995-07-25 | Hyman; Edward D. | Method for enzymatic synthesis of oligonucleotides |
| US5739386A (en) | 1994-06-23 | 1998-04-14 | Affymax Technologies N.V. | Photolabile compounds and methods for their use |
| US5763594A (en) | 1994-09-02 | 1998-06-09 | Andrew C. Hiatt | 3' protected nucleotides for enzyme catalyzed template-independent creation of phosphodiester bonds |
| US5808045A (en) | 1994-09-02 | 1998-09-15 | Andrew C. Hiatt | Compositions for enzyme catalyzed template-independent creation of phosphodiester bonds using protected nucleotides |
| US7057026B2 (en) | 2001-12-04 | 2006-06-06 | Solexa Limited | Labelled nucleotides |
| WO2004005667A1 (en) | 2002-07-08 | 2004-01-15 | Shell Internationale Research Maatschappij B.V. | Choke for controlling the flow of drilling mud |
| US20050037991A1 (en) | 2003-06-30 | 2005-02-17 | Roche Molecular Systems, Inc. | Synthesis and compositions of 2'-terminator nucleotides |
| US7544794B1 (en) | 2005-03-11 | 2009-06-09 | Steven Albert Benner | Method for sequencing DNA and RNA by synthesis |
| US8808988B2 (en) | 2006-09-28 | 2014-08-19 | Illumina, Inc. | Compositions and methods for nucleotide sequencing |
| WO2015159023A1 (en) | 2014-04-17 | 2015-10-22 | Dna Script | Method for synthesising nucleic acids, in particular long nucleic acids, use of said method and kit for implementing said method |
| CA3024184A1 (en) * | 2016-06-14 | 2017-12-21 | Dna Script | Variants of a dna polymerase of the polx family |
| WO2017216472A2 (en) | 2016-06-14 | 2017-12-21 | Dna Script | Variants of a dna polymerase of the polx family |
Non-Patent Citations (26)
| Title |
|---|
| "PCR Primer: A Laboratory Manual", 2003, COLD SPRING HARBOR PRESS |
| "Technologies brochure", vol. 6, 2014, article "Strategies for Attaching Oligonucleotides to Solid Supports" |
| BECKER ET AL., J. BIOL. CHEM., vol. 242, no. 5, 1967, pages 936 - 950 |
| BENTOLILA ET AL., EMBO J., vol. 14, 1995, pages 4221 - 4229 |
| BOULE ET AL., MOL. BIOTECHNOL., vol. 10, 1998, pages 199 - 208 |
| BOULE ET AL., MOL. BIOTECHNOLOGY, vol. 10, 1998, pages 199 - 208 |
| CAMERON ET AL., BIOCHEMISTRY, vol. 16, no. 23, 1977, pages 5120 - 5126 |
| CANARD ET AL., GENE, vol. 148, 1994, pages 1 - 6 |
| CANARD ET AL., PROC. NATL. ACAD. SCI., vol. 92, 1995, pages 10859 - 10863 |
| DELARUE ET AL., EMBO J., vol. 21, no. 3, 2002, pages 427 - 439 |
| DELARUE M ET AL: "Crystal structures of a template-independent DNA polymerase: murine terminal deoxynucleotidyltransferase", THE EMBO JOURNAL,, vol. 21, no. 3, 1 February 2002 (2002-02-01), pages 427 - 439, XP002767368, ISSN: 1460-2075, DOI: 10.1093/EMBOJ/21.3.427 * |
| FERRERO ET AL., MONATSHEFTE FUR CHEMIE, vol. 131, 2000, pages 585 - 616 |
| GRANTHAM: "Science", vol. 185, 1974, pages: 862 - 864 |
| HERMANSON: "Bioconjugate Techniques", 2008, ACADEMIC PRESS |
| JENSEN ET AL., BIOCHEMISTRY, vol. 57, 2018, pages 1821 - 1832 |
| KODUMAL ET AL., PROC. NATL. ACAD. SCI., vol. 101, 2004, pages 15573 - 15578 |
| MATHEWS ET AL., ORGANIC & BIOMOLECULAR CHEMISTRY |
| MENG ET AL., J. ORG. CHEM., vol. 14, pages 3248 - 3252 |
| METZKER ET AL., NUCLEIC ACIDS RESEARCH, vol. 22, 1994, pages 4259 - 4267 |
| RASOLONJATOVO ET AL., NUCLEOSIDES & NUCLEOTIDES, vol. 18, no. 4&5, 1999, pages 1021 - 1022 |
| SAMBROOK ET AL.: "Molecular Cloning", 1989, COLD SPRING HARBOR LABORATORY |
| SCHMITZ ET AL., ORGANIC LETT., vol. 1, no. 11, 1999, pages 1729 - 1731 |
| STEMMER ET AL., GENE, vol. 164, 1995, pages 49 - 53 |
| STRACHANREAD: "Human Molecular Genetics", vol. 2, 1999, WILEY-LISS |
| TAUNTON-RIGBY ET AL., J. ORG. CHEM., vol. 38, no. 5, 1973, pages 977 - 985 |
| UEMURA ET AL., TETRAHEDRON LETT., vol. 30, no. 29, 1989, pages 3819 - 3820 |
Cited By (38)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12421628B2 (en) | 2018-07-23 | 2025-09-23 | Dna Script | Massively parallel enzymatic synthesis of nucleic acid strands |
| US12371680B2 (en) | 2018-11-14 | 2025-07-29 | Dna Script Sas | Terminal deoxynucleotidyl transferase variants and uses thereof |
| US11359221B2 (en) | 2019-02-12 | 2022-06-14 | Dna Script Sas | Efficient product cleavage in template-free enzymatic synthesis of polynucleotides |
| US11905541B2 (en) | 2019-02-12 | 2024-02-20 | Dna Script Sas | Efficient product cleavage in template-free enzymatic synthesis of polynucleotides |
| EP4407026A3 (en) * | 2019-05-28 | 2025-01-15 | DNA Script | Variants of terminal deoxynucleotidyl transferase and uses thereof |
| WO2021018921A1 (en) | 2019-08-01 | 2021-02-04 | Dna Script | Increasing long-sequence yields in template-free enzymatic synthesis of polynucleotides. |
| WO2021058438A1 (en) | 2019-09-23 | 2021-04-01 | Dna Script | Increasing long-sequence yields in template-free enzymatic synthesis of polynucleotides |
| US12606856B2 (en) | 2019-09-23 | 2026-04-21 | Dna Script | Increasing long-sequence yields in template-free enzymatic synthesis of polynucleotides |
| WO2021116270A1 (en) * | 2019-12-12 | 2021-06-17 | Dna Script | Chimeric terminal deoxynucleotidyl transferases for template-free enzymatic synthesis of polynucleotides |
| WO2021122539A1 (en) * | 2019-12-16 | 2021-06-24 | Dna Script | Template-free enzymatic polynucleotide synthesis using dismutationless terminal deoxynucleotidyl transferase variants |
| WO2021213903A1 (en) * | 2020-04-20 | 2021-10-28 | Dna Script | Terminal deoxynucleotidyl transferase variants and uses thereof |
| US12377397B2 (en) | 2020-06-16 | 2025-08-05 | Dna Script | Systems, apparatus and kits for enzymatic polynucleotide synthesis |
| EP4578954A2 (en) | 2020-06-16 | 2025-07-02 | DNA Script | Method for enzymatic polynucleotide synthesis |
| WO2021254934A1 (en) | 2020-06-16 | 2021-12-23 | Dna Script | Systems, apparatus and kits for enzymatic polynucleotide synthesis |
| WO2022013094A1 (en) | 2020-07-15 | 2022-01-20 | Dna Script | Massively parallel enzymatic synthesis of polynucleotides |
| WO2022063835A1 (en) * | 2020-09-22 | 2022-03-31 | Dna Script | Stabilized n-terminally truncated terminal deoxynucleotidyl transferase variants and uses thereof |
| WO2022090057A1 (en) | 2020-10-26 | 2022-05-05 | Dna Script | Novel variants of endonuclease v and uses thereof |
| DE102022107811A1 (en) | 2021-04-02 | 2022-10-06 | Dna Script | METHODS AND KITS FOR THE ENZYMATIC SYNTHESIS OF G4 TENDERING POLYNUCLEOTIDS |
| WO2022207934A1 (en) | 2021-04-02 | 2022-10-06 | Dna Script | Methods and kits for enzymatic synthesis of g4-prone polynucleotides |
| WO2022258809A1 (en) | 2021-06-10 | 2022-12-15 | Dna Script | Enzymatic synthesis of polynucleotides using 3'-o-amino-2'-deoxyribonucleoside triphosphate monomers |
| DE102022114351A1 (en) | 2021-06-10 | 2022-12-15 | Dna Script | ENZYMATIC SYNTHESIS OF POLYNUCLEOTIDES USING 3'-O-AMINO-2'-DEOXYRIBONUCLEOSIDE TRIPHOSPHATE MONOMERS |
| US12565641B2 (en) | 2021-10-15 | 2026-03-03 | Codexis, Inc. | Engineered terminal deoxynucleotidyl transferase variants |
| WO2023083997A2 (en) | 2021-11-10 | 2023-05-19 | Dna Script | Novel terminal deoxynucleotidyl |
| WO2023083999A2 (en) | 2021-11-10 | 2023-05-19 | Dna Script | Novel terminal deoxynucleotidyl transferase (tdt) variants |
| EP4450620A4 (en) * | 2022-01-28 | 2025-06-25 | Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences | Terminal transferase variant for controllable synthesis of single-stranded dna and use thereof |
| WO2024083883A1 (en) | 2022-10-19 | 2024-04-25 | Dna Script | Methods and products for removal of uracil containing polynucleotides |
| WO2024141628A1 (en) | 2022-12-31 | 2024-07-04 | Dna Script | Variable viscosity inks for inkjet delivery of enzyme reagents |
| WO2024227846A2 (en) | 2023-05-03 | 2024-11-07 | Dna Script | Reagent used in deprotection of 3'-o-amino polynucleotides |
| WO2025003434A1 (en) | 2023-06-30 | 2025-01-02 | Dna Script | Nucleic acid synthesis on reusable support |
| WO2025052145A3 (en) * | 2023-09-08 | 2025-05-15 | Evonetix Ltd | Enzymes and methods |
| GB2635104A (en) * | 2023-09-08 | 2025-05-07 | Evonetix Ltd | Enzymes and methods |
| WO2025088024A1 (en) * | 2023-10-24 | 2025-05-01 | Dna Script | Novel terminal deoxynucleotidyl transferase (tdt) variants and uses thereof |
| WO2025093659A1 (en) | 2023-11-04 | 2025-05-08 | Dna Script | 3'-o-aminooxymethyl blocked nucleotides and use thereof in enzymatic synthesis of polynucleotides |
| WO2025132627A1 (en) | 2023-12-18 | 2025-06-26 | Dna Script | Stabilized variants of highly active endonuclease v for cleavage of labelled dna |
| WO2025132603A1 (en) | 2023-12-18 | 2025-06-26 | Dna Script | Novel variants of endonuclease v for cleavage of labelled dna |
| WO2026008717A2 (en) | 2024-07-02 | 2026-01-08 | Dna Script | Method for enzymatic synthesis of polynucleotides |
| WO2026008711A2 (en) | 2024-07-02 | 2026-01-08 | Dna Script | Filtering device and method for polynucleotide enzymatic synthesis |
| WO2026017834A1 (en) | 2024-07-19 | 2026-01-22 | Dna Script | Inkjet-assisted enzymatic nucleic acid synthesis and cleavage |
Also Published As
| Publication number | Publication date |
|---|---|
| IL283068A (en) | 2021-06-30 |
| US11859217B2 (en) | 2024-01-02 |
| EP3880808A1 (en) | 2021-09-22 |
| JP2022513031A (en) | 2022-02-07 |
| CN113302289A (en) | 2021-08-24 |
| US20240093165A1 (en) | 2024-03-21 |
| US12371680B2 (en) | 2025-07-29 |
| US20220002687A1 (en) | 2022-01-06 |
| AU2019379287A1 (en) | 2021-06-03 |
| CA3119845A1 (en) | 2020-05-22 |
| SG11202104601PA (en) | 2021-06-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12371680B2 (en) | Terminal deoxynucleotidyl transferase variants and uses thereof | |
| EP4073240B1 (en) | Chimeric terminals deoxynucleotidyltranseras for the template-free enzymatic synthesis of polynucleotides | |
| JP7538807B2 (en) | Efficient product cleavage in template-free enzymatic polynucleotide synthesis. | |
| US12584154B2 (en) | Template-free enzymatic synthesis of polynucleotides using poly(A) and poly(U) polymerases | |
| US20230159903A1 (en) | Terminal Deoxynucleotidyl Transferase Variants and Uses Thereof | |
| WO2022063835A1 (en) | Stabilized n-terminally truncated terminal deoxynucleotidyl transferase variants and uses thereof | |
| US20220411840A1 (en) | High Efficiency Template-Free Enzymatic Synthesis of Polynucleotides | |
| US20230203553A1 (en) | Template-Free Enzymatic Polynucleotide Synthesis Using Dismutationless Terminal Deoxynucleotidyl Transferase Variants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 19801879 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3119845 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2021526276 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2019379287 Country of ref document: AU Date of ref document: 20191113 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2019801879 Country of ref document: EP Effective date: 20210614 |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 283068 Country of ref document: IL |











