WO2020081972A1 - Myocardial enhancer rna and methods of use - Google Patents
Myocardial enhancer rna and methods of use Download PDFInfo
- Publication number
- WO2020081972A1 WO2020081972A1 PCT/US2019/056995 US2019056995W WO2020081972A1 WO 2020081972 A1 WO2020081972 A1 WO 2020081972A1 US 2019056995 W US2019056995 W US 2019056995W WO 2020081972 A1 WO2020081972 A1 WO 2020081972A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- uhrt
- rna
- seq
- edna
- enhancer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4716—Muscle proteins, e.g. myosin, actin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
Definitions
- enhancer-promoter interactions Many transcriptional circuits are controlled by enhancer-promoter interactions.
- An enhancer is a relatively short (50-1500 bp) region of DNA that can be bound by proteins (activators) to increase the likelihood that transcription of a particular gene will occur.
- Enhancers are cis-acting and can be located up to 1 Mbp (1,000,000 bp) upstream or downstream from the transcription start site of the gene they regulate. In eukaryotic cells the chromatin complex of DNA is folded so although the enhancer DNA may be far from the gene in a linear way, it is spatially close to the promoter and gene. This allows it to interact with the general transcription factors and RNA polymerase II required for expression of the gene. Many active enhancers transcribe noncoding, enhancer RNAs (eRNAs), capable of facilitating enhancer-promoter interactions for gene regulation, and levels of eRNAs reflect the degree of enhancer and promoter activation.
- eRNAs enhancer RNAs
- the present disclosure relates generally to the use of noncoding enhancer RNAs (eRNAs) as therapeutic agents. More specifically, the present disclosure relates to the use of noncoding myocardial eRNAs to inhibit the formation of a trasnscriptional complex between the myocardial enhancer DNA (eDNA) and the promoters of the myocardial myosin heavy chain genes (Myh6 and Myh7) in a cardiomyocyte (the eDNA-Myh6 promoter-Myh7 promoter complex).
- eDNA myocardial enhancer DNA
- Myh6 and Myh7 myocardial myosin heavy chain genes
- the nonencoding eRNA is a cardioprotective eRNA, named Uheart (Uhrt) for Upstream Myosin Heavy chain RNA Transcript, optionally wherein the Uhrt is an RNA comprising a sequence having at least 95% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2.
- Uheart Uheart
- Uhrt an RNA comprising a sequence having at least 95% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2.
- SEQ ID NO: 1 is mouse Uhrt RNA
- SEQ ID NO: 2 is human Uhrt RNA
- SEQ ID NO: 3 is human enhancer DNA
- SEQ ID NO: 4 is mouse enhancer DNA
- SEQ ID NO: 5 is mouse Uhrt DNA equivalent
- SEQ ID NO: 6 is human Uhrt DNA equivalent
- a method of inhibiting the assembly of an enhancer DNA-Myh6 promoter-Myh7 promoter complex comprises enhancing the percentage of myocardial enhancer DNA that is bound to Uhrt.
- the enhancer DNA comprises a sequence selected from the group of SEQ ID NO: 3 and sequences having at least 95% sequence identity with SEQ ID NO: 3.
- the method comprises increasing the intracellular concentration of active Uhrt RNA and/or increasing the percentage of myocardial eDNA that has an Uhrt RNA bound to it.
- an isolated nucleic acid comprising a sequence having at least 95% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2 is provided, or a eDNA derivative of such sequences.
- the isolated nucleic acid comprises a sequence selected from the group consisting of SEQ ID NO: 1, a eDNA complement of SEQ ID NO: 1, SEQ ID NO: 2, and a eDNA complement of SEQ ID NO:2.
- a nucleic acid comprising a sequence having at least 95% sequence identity to SEQ ID NO: 1, a eDNA complement of SEQ ID NO: 1, SEQ ID NO:2, or a eDNA complement of SEQ ID NO: 2, wherein the nucleic acids are modified to comprise a covalently linked detectable marker.
- a nucleic acid sequence is provided comprising SEQ ID NO: 1 coupled to a detectable marker.
- a nucleic acid sequence is provided comprising SEQ ID NO: 2 coupled to a detectable marker.
- a method of measuring Uhrt in a patient biological sample comprises providing an RNA sample recovered from the patient and conducting quantitative reverse transcriptase polymerase chain reaction (rtPCR) using primers that specifically bind to Uhrt cDNA, and detecting the detecting the resulting amplicon as a measure of the Uhrt in the patient sample.
- rtPCR quantitative reverse transcriptase polymerase chain reaction
- a method of identifying a patient at risk for hypertrophy comprises providing a sample of RNA recovered from cardiomyocytes from the patient, analyzing the levels of Uhrt RNA, and comparing the Uhrt RNA levels in the patient cardiomyocytes to a reference sample. In one illustrative embodiment, if the analysis of the relative concentration of patient Uhrt RNA is lower than the reference sample Uhrt RNA level, then the patient is identified as at risk for hypertrophy.
- the reference sample is an RNA sample recovered from myocardial cells of one or more healthy individuals that are free of any cardiac disease.
- a method of treaing a patient for heart disease comprises administering an RNA sequence to the patient.
- the RNA sequence comprises a sequence having at least 95% sequence identity to SEQ ID NO: 2 or its corresponding DNA equivalent thereof.
- a method of switching a cardiomyocyte from a stressed-state to a non-stressed state comprises decreasing Brgl activity and increasing Uhrt activity.
- a method of detecting a patient at risk for hypertrophy comprises providing a test sample comprising RNA from the patient, contacting the test sample with a reverse transcriptase primer specific for an enhancer RNA comprising the sequence for Uhrt, reverse transcribing the enhancer RNA to produce a corresponding test cDNA, contacting the test cDNA with PCR primers specific for Uhrt RNA, conducting a PCR reaction on the test cDNA, detecting the amplified product, determining the concentration of the enhancer RNA in the test sample, and obtaining a reference concentration of the corresponding enhancer RNA.
- the reference sample represents the average concentration of an eRNA having at least 95% sequence identity to SEQ ID NO: 2 as found in the general population.
- Fig. 1 is an illustration depicting a mouse Myh locus, showing the size of Myh6, Myh7, and eDNA.
- Fig. 2 is a graph representing the quantitation of Myh6 and Myh7 mRNAs in E13.5 e- DNA-null hearts (Sm22a-Cre;eDNA f/f ) verses wild type (wt) fetal hearts.
- Fig. 3 is a graph representing the quantitation of Myh6 and Myh7 mRNAs in adult eDNA-null hearts (Tnnt2-rtTA;TRE-Cre;eDNA f/f ) verses wild type (wt) adult hearts.
- Fig. 4 is a graph representing the quantitation of Myh6 and Myh7 mRNAs in adult eDNA-null hearts or in wild type (wt) adult hearts 7 days after TAC.
- Fig. 5 is a graph representing a ChIP analysis of Brgl-eDNA binding in E13.5 hearts and adult hearts 7 days after sham or TAC operation.
- Fig. 6 is a graph representing a 3C analysis of Myh6 and Myh7 proximal promoters and eDNA in control (Ctrl) and Brgl-null hearts (KO) of E10.5 embryos.
- Fig. 7 is a graph representing a 3C analysis of Myh6 and Myh7 proximal promoters and eDNA in control (Ctrl) and Brgl- null hearts (KO) adult hearts 7 days after sham or TAC operation.
- Fig. 8 is a graph representing the quantitation of Uhrt and Myh7 RNA in mouse hearts. P: postnatal day.
- Fig. 9 is a graph representing the quantification of cardiac Uhrt RNAs 2-56 days (d) after TAC operation.
- Fig. 10 is a graph representing the ventricle/body- weight ratio of hearts 2 weeks (w) after TAC.
- Fig. 11 is a graph representing the quantification of cardiomyocyte cross-sectional areas by wheat germ agglutinin staining in WT and Uhrt KO mice 2 weeks after TAC.
- Fig. 12 is an illustration of eDNA reporter mouse lines and quantification of Uhrt 7 days after sham or TAC operation.
- Fig. 13 is a graph representing the quantification of lacZ RNAs in hearts from eDNA reporter mice 7 days after sham or TAC operation.
- Fig. 14 is a graph representing a ChIP quantitation of CTCF-eDNA binding in adult control (Ctrl) and Brgl-null (KO) hearts 7 days after sham or TAC operation.
- Fig. 15 is a graph representing a DRIP quantitation of Uhrt-eDNA hybrid in control (Ctrl) and Brgl-null (KO) adult hearts 2 days after sham or TAC operation.
- Fig. 16 is a graph representing an, amylose pull-down assay of MBP-Brgl D1D2 protein binding to ssDNA (CTCF site), ssRNA (Uhrt sequence at CTCF site) and Uhrt-eDNA hybrid at CTCF site.
- MBP maltose binding protein.
- Fig. 17 is a graph representing a ChIP analysis of Setx-eDNA binding in adult Ctrl and Brgl-null (KO) hearts 7 days after sham or TAC operation.
- Fig. 18 is a graph representing a ChIP-on-ChIP quantitation of Setx on Brgl- immunoprecipitated eDNA 7 days after sham or TAC operation.
- Fig. 19 is a graph representing the human Uhrt levels using an X-Gal assay with heart sections.
- Fig. 20 is a graph representing the human Uhrt levels in heDNA reporter mice 7 days after sham or TAC operation.
- Fig. 21 is a graph representing the quantification of Uhrt, Myh6 and Myh7 RNAs of human ventricular tissues with nonfailing and failing hearts.
- Fig. 22 is an illustration of the molecular interactions between Brgl, Uhrt, and eDNA in cardiac physiology and pathology.
- the term“Uhrt” includes any RNA sequence that binds to an enhancer DNA (eDNA) that participates in an enhancer DNA-Myh6 promoter- Myh7 promoter complex in a mammalian cardiomyocyte.
- eDNA enhancer DNA
- eDNA enhancer DNA
- this includes both the mouse Uhrt and human Uhrt of SEQ ID NOs: 1 and 2, respectively.
- human Uhrt is denoted as UHRT.
- the term“enhancer” refers to a region of DNA that can increase the likelihood that a cis linked gene is transcribed.
- a myocardial eDNA is an enhancer element located in a patient’s cardiomyocyte that helps regulate the expression of Myh7 and Myh6.
- treating includes prophylaxis of the specific disorder or condition, or alleviation of the symptoms associated with a specific disorder or condition and/or preventing or eliminating said symptoms.
- an "effective” amount or a “therapeutically effective amount” of an enhancer RNA, an interference RNA, or antisense RNA mimetic refers to a nontoxic but sufficient amount of the compound to provide the desired effect.
- the amount that is “effective” will vary from subject to subject, depending on the age and general condition of the individual, mode of administration, and the like. Thus, it is not always possible to specify an exact “effective amount.” However, an appropriate “effective” amount in any individual case may be determined by one of ordinary skill in the art using routine experimentation.
- isolated describes a polynucleotide, a polypeptide, or a cell that is in an environment different from that in which the polynucleotide, the polypeptide, or the cell naturally occurs.
- detectable marker describes a molecule conjugated directly or indirectly to a second molecule to facilitate detection of the second molecule.
- labels include fluorescent tags, enzymatic linkages, and radioactive isotopes.
- a reference sample refers to a sample that is representative of the general population.
- a test sample is the sample to be analyzed.
- the reference sample is distinguished from individuals or a subpopulation that displays or expresses a genotypic or phenotypic characteristic that is not present in the majority of a relevant population as a whole.
- the reference sample may be based on population data (i.e., average concentration of a molecule) or may be a sample recovered from an individual or from a control population know to lack the genotypic or phenotypic characteristic not present in the majority of the relevant population as a whole.
- a reference concentration refers to the concentration of a molecule in the reference sample
- “Uhrt activity” refers to the ability of a Uhrt nucleic acid to specifically bind to its corresponding eDNA.
- Brgl activity refers to the ability of a Brgl protein to specifically bind to the eDNA-Myh6 promoter-Myh7 promoter complex.
- patient without further designation is intended to encompass any warm blooded vertebrate domesticated animal (including for example, but not limited to livestock, horses, mice, cats, dogs and other pets) and humans.
- the present disclosure is directed to the use of noncoding RNAs to inhibit the assembly of an enhancer DNA-Myh6 promoter- Myh7 promoter complex.
- a method of inhibiting assembly of an enhancer DNA-Myh6 promoter-Myh7 promoter complex in a cell is a provided.
- the cell is a heart cell.
- the cell is a cardiomyocyte.
- a method of inhibiting assembly of an enhancer DNA-Myh6 promoter- Myh7 promoter complex in a cardiomyocyte comprising enhancing binding of Uhrt to the enhancer DNA.
- the enhancer DNA comprises a sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, sequences having at least 95% sequence identity to SEQ ID NO: 3 and sequences having at least 95% sequence identity to SEQ ID NO: 4, and the Uhrt is an RNA sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, sequences having at least 95% sequence identity to SEQ ID NO: 1 and sequences having at least 95% sequence identity to SEQ ID NO: 2 or a DNA equivalent of said RNA sequences.
- the method comprises increasing the intracellular concentration of active Uhrt RNA and/or increasing the percentage of myocardial eDNA that is bound to Uhrt RNA.
- increasing the intracellular concentration of active Uhrt RNA comprises introducing additional Uhrt RNA into a cardiomyocyte.
- a eDNA equivalent of Uhrt may be provided intracellularly to the cardiomyocyte.
- An active Uhrt RNA or its eDNA equivalent refers to an isolated nucleic acid that is able to bind to eDNA.
- the enhancer DNA comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 3.
- the enhancer DNA consists essentially of a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 4.
- the enhancer DNA consists of a sequence having at least 95% sequence identity to SEQ ID NO: 3.
- the enhancer DNA consists of SEQ ID NO:
- a method of inhibiting assembly of an eDNA-Myh6 promoter- Myh7 promoter complex in a cardiomyocyte comprises enhancing binding of Uhrt to said enhancer.
- the Uhrt comprises an RNA sequence having at least 95% sequence identity to SEQ ID NO: 2 or its eDNA equivalent thereof.
- the Uhrt comprises an RNA sequence having at least 90%, 91%, 92%,
- the Uhrt RNA comprises SEQ ID NO: 2 or its eDNA equivalent thereof.
- the enhancer DNA comprises SEQ ID NO: 3 and the Uhrt comprises SEQ ID NO: 2 or its eDNA equivalent.
- the method of inhibiting assembly of an eDNA-Myh6 promoter- Myh7 promoter complex in a cardiomyocyte comprises a step of increasing the amount of Uhrt binding to said enhancer.
- the Uhrt comprises an RNA sequence having at least 95% sequence identity to SEQ ID NO: 1 or its eDNA equivalent thereof.
- the Uhrt comprises an RNA sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 1 or its cDNA equivalent thereof.
- the Uhrt RNA comprises SEQ ID NO: 2 or its cDNA equivalent thereof.
- the enhancer DNA comprises SEQ ID NO: 3 and the Uhrt comprises SEQ ID NO:l or its cDNA equivalent. In some embodiments, the enhancer DNA comprises SEQ ID NO: 4 and the Uhrt comprises SEQ ID NO: 1 or its cDNA equivalent. In one embodiment the enhancer DNA comprises SEQ ID NO: 3 and the Uhrt comprises SEQ ID NO: 2 or its cDNA equivalent.
- the method of inhibiting assembly of an eDNA-Myh6 promoter- Myh7 promoter complex in a cardiomyocyte comprises a step of decreasing Brgl activity.
- Brgl activity is decreased by introducing an interfering RNA (iRNA) to the cardiomyocyte to inhibit the translation of Brgl.
- iRNA interfering RNA
- nucleic acids comprising a myocardial eRNA.
- an isolated RNA comprising a sequence having at least 95% or 99% sequence identity with SEQ ID NO: 1 or 2, or a DNA equivalent is provided.
- an isolated DNA comprising a sequence having at least 95% or 99% sequence identity with SEQ ID NO: 5 or 6 is provided.
- the isolated RNA comprises the sequence of SEQ ID NO: 1 or 2, and in a further embodiment the isolated RNA consists of SEQ ID NO: 1 or 2.
- an isolated DNA is provided comprising the sequence of SEQ ID NO: 5 or 6, and in a further embodiment the isolated DNA consists of SEQ ID NO:
- a nucleic acid comprising the sequence of SEQ ID NO: 1 or its cDNA equivalent coupled to a marker.
- the nucleic acid comprises a sequence consisting of SEQ ID NO: 1 or its cDNA equivalent coupled to a marker.
- the marker is a detectable marker.
- detectable the marker is selected from the group consisting of a fluorescent tag, an antibody, and a small peptide.
- the detectable marker is coupled to an isolated nucleic acid comprising SEQ ID NO: 1 or its cDNA equivalent by a covalent linkage.
- a nucleic acid comprising a sequence comprising SEQ ID NO: 2 is disclosed.
- the nucleic acid comprises a sequence comprising SEQ ID NO: 2 or its cDNA equivalent coupled to a marker.
- the nucleic acid comprises a sequence consisting of SEQ ID NO: 2 or its cDNA equivalent coupled to a marker.
- the marker is a detectable marker.
- the detectable marker is selected from the group consisting of a radionuclide, fluorescent tag, an enzyme, an antibody, and small peptide.
- the detectable marker is coupled to an isolated nucleic acid comprising SEQ ID NO: 2 or its cDNA equivalent by a covalent linkage.
- a method of measuring Uhrt in a patient biological sample comprising, providing an RNA sample recovered from said patient, contacting the RNA sample with a nucleic acid that specifically binds to Uhrt, and detecting hybrids formed between the diagnostic nucleic acid and Uhrt as an indication of the presence and quantity of Uhrt in the patient sample.
- the diagnostic nucleic acid is a nucleic acid that is labeled with a detectable maker.
- the labeled diagnostic nucleic acid is an RNA sequence having at least 95% or 99% sequence identity with SEQ ID NO: 1 or 2.
- the labeled diagnostic nucleic acid is an RNA sequence comprising the sequence of SEQ ID NO: 1 or 2, and in a further embodiment the labeled diagnostic nucleic acid is an RNA sequence consisting of SEQ ID NO: 1 or 2.
- the labeled diagnostic nucleic acid is a DNA sequence comprising a sequence having at least 95% or 99% sequence identity with SEQ ID NO: 5 or 6, or its complement thereof.
- the labeled diagnostic nucleic acid comprises the sequence of SEQ ID NO: 5 or 6, and in a further embodiment the labeled diagnostic nucleic acid consists of SEQ ID NO: 5 or 6.
- the biological sample is heart tissue, blood, plasma, or a combination thereof, wherein the sample comprises cardiomyocytes RNA.
- the biological sample is a tissue or blood sample that comprises cardiomyocytes.
- the biological sample is biopsy tissue sample comprising cardiomyocytes.
- the sample is recovered during an operation, biopsy, or autopsy.
- the method of detecting and/or measuring the relative concentration of eRNA in a patient's cardiomyocytes comprises providing an RNA sample recovered from the patient and conducting quantitative reverse transcriptase polymerase chain reaction (rtPCR) to determined eRNA concentrations.
- rtPCR quantitative reverse transcriptase polymerase chain reaction
- the RNA sample is prepared from a tissue sample isolated from the patient, more particularly from a tissue or blood sample that comprises cardiomyocytes, using techniques known to those skilled in the art.
- the rtPCR is conducted using standard techniques known to the skilled practitioner, including a first step of converting the RNA present in the RNA sample to cDNA using reverse polymerase and a suitable set of primers.
- the reverse transcriptase reaction is conducted using a primer that specifically binds to the target eRNA (e.g., an eRNA comprising SEQ ID NO: 1 or 2 or derivative thereof).
- the generated cDNA is then amplified using standard PCR techniques and primers that specifically bind to Uhrt cDNA. Detection of the resulting amplicon as a measure of the Uhrt in the patient sample. In some embodiments, the resulting amplicon provides a measure of the relevant concentration of the Uhrt in the patient sample.
- the PCR primers each comprise a sequence of at least 10 nucleotides, wherein the continuous primer sequence has at least 95% sequence identity to a corresponding equivalent fragment of SEQ ID NO: 2 or its compliment.
- a nucleic acid sequence comprising a sequence of at least 10 nucleotides that has at least 95% sequence identity to a corresponding complementary portion of SEQ ID NO: 2 or its corresponding DNA equivalent or compliment thereof.
- the nucleic acid is labeled with a detectable marker.
- the detectable marker is selected from the group consisting of a fluorophore and radioisotope, and fluorophore.
- the term“label” includes a covalent linkage or other known methods in the art of labeling nucleic acids.
- a method of identifying a patient at risk for hypertrophy comprises, providing a sample of RNA recovered from cardiomyocytes from the patient, analyzing the levels of Uhrt , and comparing the relative concentration levels of Uhrt in the patient cardiomyoctes to a reference sample.
- the reference sample comprises a known concentration of Uhrt.
- the reference sample is a known concentration of Uhrt representing an amount of Uhrt expected in a patient sample not at risk for hypertrophy.
- the reference sample may vary depending on age, gender, and species of the patient.
- the reference sample comprises an expected concentration of Uhrt in a normal fetal heart from a relevant population.
- the reference sample comprises an expected concentration of Uhrt in a normal infant heart from a relevant population.
- the reference sample comprises an expected concentration of Uhrt in a normal adolescent heart from a relevant population. In some embodiments, the reference sample comprises an expected concentration of Uhrt in a normal adult heart from a relevant population. In an illustrative embodiment, a low level of Uhrt RNA in the sample RNA recovered from cardiomyocytes compared to the reference sample identifies a patient at risk for hypertrophy.
- the analyzing step is performed using PCR, quantitative real-time PCR, Northern Blot, flow cytometry, mass spectrometry, molecular probes, or a combination thereof.
- a method of treating a patient at risk for heart disease comprises administering an isolated RNA sequence to the patient.
- the RNA sequence comprises a sequence having at least 95% sequence identity to SEQ ID NO: 2 or its corresponding DNA equivalent.
- the RNA sequence comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 2 or its DNA equivalent.
- the method further comprises decreasing Brgl activity.
- Brgl activity can be decreased by administering an iRNA to a cardiomyocyte designed to inhibit the translation of Brgl.
- the method further comprises analyzing Uhrt levels after the step of administering the RNA.
- the step of analyzing may include performing PCR, rt-qPCR, Northern Blot, flow cytometry, mass spectrometry, the use of molecular probes, or a combination thereof.
- a method of switching a cardiomyocyte from a stressed-state to a non-stressed state comprising decreasing Brgl activity and increasing Uhrt activity.
- the Brg 1 activity is decreased by providing a Brgl iRNA.
- the Uhrt activity is increased by providing a Uhrt RNA.
- a method of detecting a patient at risk for hypertrophy comprises providing a test sample comprising RNA from the patient, contacting the test sample with a reverse transcriptase primer specific for an enhancer RNA comprising the sequence for Uhrt, reverse transcribing the enhancer RNA to produce a corresponding test cDNA, contacting the test cDNA with PCR primers specific for Uhrt RNA.
- the primers comprise a sequence of at least 10 nucleotides having at least a 90% sequence identity to a corresponding complementary portion of SEQ ID NO: 2.
- the primers comprise a sequence of at least 10 nucleotides having at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to a corresponding complementary portion of SEQ ID NO: 2.
- the method further comprises conducting a PCR reaction on the test cDNA, and detecting the resulting amplified product. In some embodiments, the method further comprises determining the concentration of the enhancer RNA in the test sample based on the detected test cDNA. In some embodiments, the method further comprises obtaining a reference concentration of the corresponding enhancer RNA from a reference sample. In an illustrative embodiment, a detected low level of the enhancer RNA in the test sample as compared to the reference concentration level of the enhancer RNA indicates hypertrophy.
- a method of detecting a patient at risk for hypertrophy comprising providing a test sample comprising RNA from the patient; contacting the test sample with a reverse transcriptase primer specific for an enhancer RNA comprising the sequence for Uhrt; reverse transcribing the enhancer RNA to produce a corresponding test cDNA; contacting the test cDNA with PCR primers specific for Uhrt RNA wherein said primers comprise a sequence of at least 10 nucleotides having at least a 90% sequence identity to a corresponding complementary portion of SEQ ID NO: 2; conducting a PCR reaction on the test cDNA, and detecting the resulting amplified product; determining the concentration of the enhancer RNA in the test sample based on the detected test cDNA; and obtaining a reference concentration of the corresponding enhancer RNA; wherein a detected lower level of the enhancer RNA in the test sample as compared to the reference concentration level of the enhancer RNA indicates hypertrophy.
- a method of inhibiting assembly of an enhancer DNA-Myh6 promoter-Myh7 promoter complex in a cardiomyocyte cell comprises the step of enhancing binding of Uhrt to said enhancer, wherein said enhancer comprises a sequence having at least 90, 95% or 99% sequence identity with SEQ ID NO: 3.
- the method of embodiment 1 is provided wherein the Uhrt comprises an RNA sequence having at least 90, 95% or 99% sequence identity to SEQ ID NO: 2.
- the method of embodiment 1 is provided wherein the Uhrt RNA comprises SEQ ID NO: 2 and said enhancer comprises SEQ ID NO: 3.
- the method of embodiment 1 is provided wherein the Uhrt comprises an RNA sequence having at least 95% sequence identity to SEQ ID NO: 1.
- the method of embodiment 1 is provided wherein the Uhrt RNA comprises SEQ ID NO: 1 and said enhancer comprises SEQ ID NO: 3.
- the method of any one of embodiments 1-5 is provided wherein the method further comprising a step of decreasing Brgl activity.
- the method of embodiment 6 is provided wherein the Brgl activity is decreased by introducing an interfering RNA into said cardiomyocyte cell to inhibit translation of Brgl.
- RNA sequence consisting of SEQ ID NO: 1, or its DNA equivalent thereof, coupled to a marker is provided.
- nucleic acid comprising an RNA sequence consisting of SEQ ID NO: 2, or its DNA equivalent thereof, coupled to a marker.
- the nucleic acid of embodiment 8 or 9 is provided wherein the marker is selected from the group consisting of a fluorescent tag, an antibody, and a small peptide.
- a method of measuring Uhrt in a patient biological sample comprises:
- the method of embodiment 11 is provided wherein Uhrt is detected by quantitative reverse transcription PCR wherein an amplicon is only produced in the presence of Uhrt.
- RNA sample is reverse transcribed into cDNA and said cDNA is contacted with a pair of PCR primers wherein said primers each comprise a sequence of at least 10 nucleotides that each have at least 95% sequence identity to a corresponding DNA equivalent of SEQ ID NO: 2 or a compliment thereof.
- nucleic acid comprises a sequence of at least 10 nucleotides that has at least 95% sequence identity to a corresponding complementary portion of SEQ ID NO: 2 or its corresponding DNA equivalent or compliment thereof, wherein said nucleic acid is labeled with a detectable marker.
- the detectable marker is selected from the group consisting of a fluorophore and a radioisotope and a fluorophore.
- a method of identifying a patient at risk for hypertrophy comprises:
- RNA recovered from cardiomyocytes from the patient analyzing the levels of Uhrt RNA in said sample.
- Uhrt RNA levels in the patient cardiomyocytes to a reference sample, wherein a low level of Uhrt RNA compared to the reference sample identifies a patient at risk for hypertrophy.
- the method of embodiment 16 is provided wherein the reference sample is either a set of values based on population data (i.e., average concentration of a molecule in a target population) or the detected eRNA levels in a sample recovered from an individual or from a control population know to lack the relevant genotypic or phenotypic characteristic (e.g., low levels of eRNA, optionally the RNA of SEQ ID NO: 1 or 2) associated with hypertrophy.
- population data i.e., average concentration of a molecule in a target population
- the detected eRNA levels in a sample recovered from an individual or from a control population know to lack the relevant genotypic or phenotypic characteristic (e.g., low levels of eRNA, optionally the RNA of SEQ ID NO: 1 or 2) associated with hypertrophy.
- a method of identifying a patient at risk for heart disease comprises:
- RNA sequence comprises a sequence having at least 95% sequence identity to SEQ ID NO: 2 or its corresponding DNA equivalent thereof.
- the method of embodiment 18 is provided wherein the heart disease is hypertrophy.
- the method of embodiment 18 or 19 is provided wherein the method further comprises decreasing Brgl activity.
- a method of switching a cardiomyocyte from a stressed-state to a non-stressed state comprises:
- the method of embodiment 21 is provided wherein decreasing the Brgl activity comprises providing a Brgl interfering RNA.
- the method of embodiment 21 or 22 is provided wherein the step of increasing of Uhrt activity comprises providing a Uhrt RNA.
- the enhancer robustly transcribed Uhrt, which inhibited enhancer’s looping to its target Myh promoters, switching fetal Myh to adult status.
- Uhrt transcription was shut down, and the enhancer regained its looping to Myh loci, triggering Myh switch and hypertrophy.
- enhancer-Afv/i looping required the chromatin remodeler Brgl to recruit the looping regulator CTCF to the enhancer. Binding of CTCF to the enhancer was inhibited by Uhrt, which tethered to the enhancer to form RNA-DNA hybrid, preventing CTCF binding. Cardiac stress stimulated Brgl to bind to Uhrt- DNA hybrid and recruit Senataxin— an RNA- DNA helicase— to unwind the hybrid and restore DNA duplex, enabling CTCF to bind and trigger enhancer looping and Myh switch. Termination of Uhrt transcription unleashed the enhancer and sensitized the hearts to stress-induced hypertrophy. The enhancer- UHRT interaction was conserved in humanhearts. Our studies thus identify a new cardioprotective eRNA, exemplifying a novel eRNA function in enhancer silencing and disease biology.
- Inactive/poised enhancers were excluded from eRNA investigations due to the lack of specific chromatin markers to align with eRNA transcription profiles.
- the current model indicates that eRNAs are either transcriptional noises that mark activated enhancers or are capable of facilitating enhancer function by enabling enhancer looping to target promoters or by scaffolding enhancer-promoter structure.
- eRNAs are either transcriptional noises that mark activated enhancers or are capable of facilitating enhancer function by enabling enhancer looping to target promoters or by scaffolding enhancer-promoter structure.
- Myh6 and Myh7 changes under different pathophysiological conditions, correlating with heart function in animals and in patients with cardiomyopathy.
- Myh genes are regulated antithetically— with up-regulation of one isoform always accompanied by down-regulation of the other— and their ratio governs cardiac resistance to pathological hypertrophy.
- Hearts expressing more Myh6 show resistance to pathological stress; those expressing more Myh7 are susceptible.
- the new eRNA-enhancer interaction provides a mechanism that coordinates antithetical Myh changes to control cardiac contractility and resistance to stress. It also provides a therapeutic strategy to shut down Myh7, the mutations of which are the underlying causes of disease in many patients with hypertrophic or dilated cardiomyopathy.
- sgRNA single guide RNA
- the 20-bp spacer sequence specific to target locus was designed by deskgen
- DNA template for sgRNA in vitro transcription was PCR-amplified from pX330 plasmid (42230, Addgene) to acquire a fused DNA template containing the T7 promoter at 5’ end, spacer sequence, and transactivating CRISPR RNA (tracrRNA) sequence at 3’ end.
- the PCR product was gel purified (28704, Qiagen) for in vitro transcription using
- RNA was purified with miRNeasy Mini Kit (217004, Qiagen) for mouse injection.
- 20-bp spacer sequences of sgRNAs for eDNAfif mouse line are CAACCCTGAGCACGTGGAGC (SEQ ID NO: 7) and
- the date of observing of a vaginal plug was set as embryonic day E0.5 by convention.
- mice were purchased from Charles River (Strain Code: 022).
- the eDNAffi mouse line was generated using the CRISPR/Cas9 system by cytoplasmic injection of mouse embryos with sgRNAs,
- Cas9 mRNA (L-6129, TriLink Biotechnologies) and single-stranded DNA donors containing loxP sequence (IDT, Ultramer DNA Oligonucleotides).
- B6D2F1 C57BL/6 x DBA2, Charles River female mice and CD1 mouse strains were used as embryo donors and foster mothers, respectively.
- Superovulated female B6D2F1 mice (4-week-old) were mated to B6D2F1 stud males to collect fertilized embryos. Zygotes were harvested and kept in M16 medium (M7292, Sigma) at 37°C for 1 hr and then transferred in M2 medium (M7167, Sigma) to inject sgRNAs, Cas9 mRNA and single- stranded DNA donors.
- Injected zygotes were cultured in M16 medium for 1 hr at 37 °C before transferred into the oviducts of pseudopregnant CD1 female mice.
- the Uhrt-tdT03xpolyA donor vector was generated by cloning homology arms of 2.5-3-kb on either side that is specific to the targeted endogenous locus at the 89-bp from mouse Uhrt transcriptional start site into tdT03xpolyA vector.
- the donor vector was then mixed with sgRNA and Cas9 mRNA for cytoplasmic injection.
- mice were derived by pronuclear injection of mouse embryos.
- enhancer DNA reporter lines eDNA-lacZ or heDNA-lacZ
- mouse or human enhancer DNA was subcloned into pENTR/TEV/D-TOPO donor vector (K253520, Thermo Fisher Scientific), and gateway recombination was performed with hsp68-lacZ destination vector (37843, Addgene) to generate eDNA-hsp68-lacZ reporter for mouse injection.
- mouse Uhrt or human UHRT cDNA was subcloned into a modified pcDNA3.l(+) vector whose CMV promoter was surrounded by two loxP sites.
- a fragment containing both loxP, CMV, Uhrt/UHRT cDNA and SV40 polyA terminator (pA) was subcloned into pENTR/TEV/D-TOPO donor vector and recombined into the hsp68-lacZ destination vector by gateway reaction to generate LoxP-CMV-loxP-Uhrt-pA-hsp68-lacZ or LoxP-CMV-loxP-UHRT-pA-hsp68-lacZ plasmid. These plasmids were then linearized for pronuclear injection. LacZ reporter assay
- X-gal staining was performed using X-gal staining kit (K146501, Thermo Fisher Scientific) following the manufacturer’s instruction. El 1.5 embryos were fixed in 4% paraformaldehyde/PBS on ice for 30 min. For adult heart tissues, 7-pm sections were acquired using a Leica cryostat and air-dried for 5 min. 4% paraformaldehyde/PBS was added on the section and fixed for 10 min at room temperature, followed by washing with PBS for 3 times. Embryos or sections were then processed for X-gal staining.
- 3C-qPCR was performed following the protocol described with modifications. Briefly, embryonic mouse hearts were collected and cross-linked with 1% formaldehyde immediately. Adult hearts were cut into pieces on ice and homogenized in 1 % formaldehyde immediately and incubated at room temperature for 15 min with rotation, followed by standard glycine quenching. After centrifuge (2,000 g x 5 min), pellets were resuspended in ice-cold PBS and pass the tissue strainer (250 pm) for centrifuge.
- cytoplasmic lysis buffer (10 mM HEPES, 60 mM KC1, 1 mM EDTA, 0.1% (v/v) NP40, 1 mM DTT and 1 mM PMSF, pH 7.6) and incubated on ice for 30 min and then centrifuged (2,000 g x 5 min) to collect cross-linked nuclei. Nuclei was washed with restriction enzyme buffer and resuspended in restriction enzyme buffer with 0.3% SDS and incubated with shaking at 1400 rpm overnight at 37 °C. 2x volume of restriction enzyme buffer was added to disperse the aggregations.
- SDS was sequestered by adding Triton X-100 (1.8% of final concentration) and incubated with shaking at 1400 rpm for 2 hr at 37°C. Restriction enzyme was then added and incubated with shaking at 1400 rpm overnight at 37°C. In the next day, SDS was added into the buffer (1.6% of final concentration) and incubated with shaking at 1400 rpm for 30 min at 65 °C to stop the digestion.
- a 7-ml ligation reaction system was established with T4 DNA ligase (M0202, New England Biolabs) and DNA at the final concentration less than 1 ng/pl to favor intramolecular ligation. Ligation was performed overnight at l6°C with rotation.
- Reverse-cross-link was performed by adding 5 M NaCl, 1 M EDTA and Proteinase K into the ligation mix overnight at 65 °C followed by phenol/chloroform extraction and ethanol precipitation.
- the 3C library was amplified in 5-7 PCR cycles using Phusion polymerase (M0530, New England biolabs) and diluted for nested quantitative PCR.
- Phusion polymerase M0530, New England biolabs
- CSP6I ER0211, Thermo Fisher Scientific
- the genomic area +1192 to -1892 from Myh6 transcriptional start site generated by CSP6I digestion was used for determining Afy -eDNA interaction.
- the genomic area +1237 to +2911 from Uhrt transcriptional start site generated by CSP6I digestion was used for determining Myh6- eDNA interaction.
- the genomic area -147 to -1302 From Myh7 transcriptional start site generated by CSP6I digestion was used for determining Myh6-Myh7 interaction.
- MSPI R0106, New England Biolabs
- the genomic area +2263 to -1093 from Myh7 transcriptional start site generated by MSPI digestion was used for determining Myh7-eDNA interaction.
- the genomic area +528 to +1665 from Uhrt transcriptional start site generated by MSPI digestion was used for determining Myh7-e DNA interaction.
- 3C library was denatured at 95°C for 5 min with salmon testis DNA (Sigma) and 5C oligonucleotides in annealing buffer (20 mM Tris-acetate at pH 7.9, 50 mM potassium acetate, 10 mM magnesium acetate, and 1 mM DTT), followed by annealing for 16 h at 48 °C.
- Annealed primers were ligated for 1 h at 48 °C by adding 20 pL of ligation buffer (25 mM Tris-HCl at pH 7.6, 31.25 mM potassium acetate, 12.5 mM magnesium acetate, 1.25 mM NAD, 12.5 mM DTT, 0.125% Triton X-100) containing 10 units of Taq DNA ligase (NEB). Unincorporated primers were removed by MinElute Reaction Cleanup Kit (Qiagen). 5C ligation products were amplified by PCR using specific 5C primers for each looping reaction as follow.
- ligation buffer 25 mM Tris-HCl at pH 7.6, 31.25 mM potassium acetate, 12.5 mM magnesium acetate, 1.25 mM NAD, 12.5 mM DTT, 0.125% Triton X-100
- Myh7-eDNA 5C-F T A AT ACG ACTC ACT AT AGCCTTGTCTTCCC (SEQ ID NO: 10) Myh7-eDNA 5C-R, TATTAACCCTCACTAAAGGGAAGCCCAGA (SEQ ID NO: 11) Myh6-eDNA 5C-F, T A AT ACG ACTC ACT AT AGCCGCTCTTG AG (SEQ ID NO: 12) Myh6-eDNA 5C-R, T ATT A ACCCTC ACT A A AGGG ACCT A A ACCTC (SEQ ID NO: 13) Myh6-Myh7 5C-F, TAATACGACTCACTATAGCCCTTGAGGG (SEQ ID NO: 14)
- Myh6-Myh7 5C-R TATTAACCCTCACTAAAGGGAATGGGCTG (SEQ ID NO: 15).
- Chromatin immunoprecipitation quantitative PCR (ChIP-qPCR)
- Embryonic mouse hearts were collected and cross-linked immediately. For adult hearts, tissues were cut into pieces on ice, homogenized with 1 % formaldehyde immediately and incubated at room temperature for 15 min with rotation. Glycine was then added to quench the cross-link reaction and pass the tissue strainer (250 pm) (87791, Thermo Fisher Scientific). After centrifuge (2,000 g x 5 min), the pellets were resuspended in nuclei lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris, pH 8.1) for sonication to shear chromatin with Bioruptor
- TAC Transaortic constriction
- mice The TAC surgery was performed on adult mice of 8-10 weeks of age and between 20 and 25 g of weight. Mice were fed with doxycycline food pellets (6 g doxycycline per kg of food; Bioserv) 7 days before the TAC operation if needed. Mice were anaesthetized with isoflurane (3%, inhalation) in an induction chamber and endotracheal intubation was performed with a 20-gauge intravenous catheter and ventilated with a mouse ventilator (Minivent, Harvard Apparatus) to maintain anesthesia with haled isoflurane (1- 2%). A longitudinal 5 mm incision of the skin was made with scissors at the midline of sternum.
- doxycycline food pellets (6 g doxycycline per kg of food; Bioserv) 7 days before the TAC operation if needed.
- Mice were anaesthetized with isoflurane (3%, inhalation) in an induction chamber and endotracheal intubation was performed with
- the chest cavity was opened by a small incision at the level of the second intercostal space 2-3 mm from the left sternal border and two chest retractors were gently inserted to spread the wound 4-5 mm in width to expose the transverse portion of the aorta.
- a nonabsorbable 6-0 suture is brought by one ligation aid and moved underneath the transverse aorta between the left common carotid artery and the brachiocephalic trunk to make a loose knot.
- 27-gauge needle was placed directly above and parallel to the aorta. The knot was then tied around the aorta and needle, and secured with a second knot.
- mice were removed from the knot carefully to create a lumen with a fixed stenotic diameter. The chest cavity was then closed by 6-0 silk suture. Sham operated mice underwent similar surgical procedures, including isolation of the aorta and looping of the aorta, but without tying of the suture. The TAC was verified and qualified by the pressure gradient across the aortic constriction measured by echocardiography. Only mice with a pressure gradient 30 mmHg were used for further experiments and analysis. Echocardiography
- Transthoracic ultrasonography was performed with a GE Vivid 7 ultrasound platform (GE Health Care) equipped with a 13 MHz transducer to determine aortic pressure gradient and left ventricular function at the time points as indicated.
- the echocardiographer was blinded to the genotypes and surgical procedure.
- the isoflurane (inhalational) was adjusted to anaesthetize the mice while maintaining their heart rates at 450-550 beats per minute to minimize its effects on heart rates.
- the peak aortic pressure gradient was measured by continuous wave Doppler across the aortic constriction.
- Left ventricular function was assessed by M-mode scanning of the left ventricular chamber, standardized by two-dimensional, short-axis views of the left ventricle at the mid papillary muscle level.
- Left ventricular chamber size and wall thickness were measured in at least three beats from each projection and averaged.
- Left ventricular internal dimensions at diastole and systole were measured.
- the fractional shortening (LS) of the left ventricle was defined as (1 minus LVIDs/LVIDd) x 100%.
- the mean LS of the left ventricle was determined by the average of LS measurements of the left ventricular contraction over five beats. P values were calculated by Student’s z-test. Error bars indicate standard error of the mean (SEM).
- the 5’ and 3’ RACE were performed using the SMARTer® RACE 573’ kit (634858, Takara Bio) following the manufacturer’s instruction. Total RNA of adult mouse hearts was extracted by TRIzol and used as template. Primers used for 5’ RACE
- RNA probe template was generated by PCR with a forward primer containing the T7 promoter. Single-stranded RNA was then in vitro transcribed with labeling mix in the kit to label the RNA with digoxigenin.
- full-length RNAs were transcribed and performed in vitro translation using the PURExpress Kit (E6800, New England biolabs).
- Transcend-tRNA L506A, Promega was added into the translation reaction system.
- Codon substitution frequency Physical Codon substitution frequency
- Ribo-Seq Ribosome profiling
- Ribosomal profiling was performed using mammalian TruSeq Ribo Profile
- rRNAs were depleted by Ribo-Zero Gold rRNA Removal kit (MRZG126, Illumina) and ribosome-protected fragments were amplified in 9 PCR cycles using Phusion polymerase and purified by 10% NovexTM TBE-Urea Gels (EC6875BOX, Thermo Fisher Scientific). Libraries were sequenced on HiSeqSE50 platform. Reads were mapped to mmlO build of the mouse genome using TopHat2.
- RT-qPCR Quantitative reverse transcription PCR
- RT-qPCR was then performed using Power SYBR Green PCR Master Mix (4367659, Thermo Fisher Scientific) with StepOnePlus Real-time PCR System (Thermo Fisher Scientific). Transcription factor lib ( Tfllb ) was used as a normalizer. Threshold cycles and melting curve measurements were performed with ABI software. Primers for RT-qPCR of mRNA were as follows. Mouse T/IIb-F, CTCTGTGGCGGCAGCAGCTATTT (SEQ ID NO: 24); Mouse Tfllb-R, CGAGGGTAGATCAGTCTGTAGGA (SEQ ID NO: 25); Mouse MyM-F,
- CTTCACAGTCACCGTCTTGC SEQ ID NO: 29
- Mouse Uhrt-R Mouse Uhrt-R
- TGAACTCGGCAAGTCCCTC SEQ ID NO: 31; Human Tfllb-R,
- TTCAGGATTCTCCGTGAAGGG (SEQ ID NO: 34); Human Myh6-R,
- nuclei pellets were first rinsed in glycerol buffer (20 mM Tris-HCl, pH 7.9, 75 mM NaCl, 0.5 mM EDTA, 0.85 mM DTT, 0.125 mM PMSF, 50% glycerol) and equal volume of cold nuclei lysis buffer (10 mM HEPES, pH 7.6, 1 mM DTT, 7.5 mM MgCh, 0.2 mM EDTA, 0.3 M NaCl, 1 M UREA, 1% NP-40) was added and incubated for 10 min on ice with vortex for 2 times for each 5-min interval.
- glycerol buffer 20 mM Tris-HCl, pH 7.9, 75 mM NaCl, 0.5 mM EDTA, 0.85 mM DTT, 0.125 mM PMSF, 50% glycerol
- cold nuclei lysis buffer (10 mM HEPES, pH 7.6, 1 mM DTT, 7.5 mM Mg
- Cardiomyocytes were isolated from the ventricles of adult mice using enzymatic digestion on a Langendorff system with constant retrograde perfusion and pressure measurement. Enzyme digestion solution was made with Ca ⁇ + (12.5 mM), collagenase type II (300 U/ml, LS004174, Worthington Biochemicals), and protease type XIV (0.04 mg/ml, P5147, Sigma) in Tyrode’s solution (133.5 mM NaCl, 4.0 mM KC1, 1.2 mM NafUPCU, 10 mM
- Ventricular myocytes were resuspended in Tyrode’s solution containing 1 mg/ml BSA and centrifuged at 46 g x 3 min, and the cardiomyocyte pellets were collected. The supernatants were further centrifuged at 46 g x 3 min to discard the pellets, and the cell suspensions were centrifuged at
- CD3l + endothelial cells were then isolated from the pellets using mouse CD31 MicroBeads (130097418, Miltenyi). Remaining cells were collected as cardiac fibroblasts.
- Cardiomyocytes of the papillary muscle at the mid-left ventricular cavity were selected for cardiomyocyte size.
- the images were acquired by fluorescence microscope (Nikon Eclipse Ni) equipped with HAMAMATSU imaging system.
- Embryonic or adult hearts were collected and digested with lysis buffer (0.5% SDS, 2 mM EDTA, 10 mM Tris-HCl, pH 8.1, 100 mM NaCl). Genomic DNA was then extracted by phenol/chloroform and precipitated by ethanol. 5 pg genomic DNA was further digested by a combination of BsoBl, Nhel, Ncol and Stul overnight at 37 °C with or without RNase H (M0297, New England Biolabs) and followed by phenol/chloroform extraction and ethanol precipitation.
- lysis buffer 0.5% SDS, 2 mM EDTA, 10 mM Tris-HCl, pH 8.1, 100 mM NaCl.
- Digested DNA was then rinsed in 500 pl binding buffer (1% Triton X-100, 50 mM Tris-HCl, 75 mM KC1, 3 mM MgCh, 10 mM DTT) and pre-cleaned by ChIP-Grade Protein G magnetic beads.
- Anti-DNA-RNA hybrid S9.6 antibody (ENH001, Kerafast) was then incubated with the digested DNA overnight at 4 °C with rotation.
- the immunoprecipitated complex was washed once with low salt wash buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, pH 8.1, 150 mM NaCl), high salt wash buffer (0.1% SDS, 1% Triton C-100, 2 mM EDTA, 20 mMTris- HC1, pH 8.1, 500 mM NaCl), LiCl wash buffer (0.25 M LiCl, 1% IGEPAL-CA630, 1% deoxycholic acid (sodium salt), 1 mM EDTA, 10 mM Tris, pH 8.1) and twice with TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) and then treated by proteinase K at 65 °C with agitation.
- low salt wash buffer 0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, pH
- DNA/RNA hybrid was extracted by phenol/chloroform, precipitated by ethanol, and digested with TURBOTM DNase (AM2238, Thermo Fisher Scientific). TRIzol was then added to extract RNA, and strand-specific reverse transcription was performed with SuperscriptTM VILOTM cDNA Synthesis Kit.
- CTCF Crohn's disease blots
- Senataxin ABSOR1, Millipore
- TFIIB abl095l8, Abeam
- HRP-conjugated anti-rabbit IgG 211-032-171, Jackson ImmunoResearch Laboratories
- Chemiluminescence was detected with PierceTM ECL Plus Western Blotting Substrate (32134, Thermo Fisher Scientific) and visualized by Odyssey Image System (LI- COR).
- Electrophoretic mobility shift assay (EMSA)
- RNA-DNA hybrid probe a DNA oligo containing the T7 promoter (lowercase) and a CTCF binding sequence (uppercase) from the mouse eDNA locus with CTCF consensus binding motif (underlined) and surrounding sequences
- RNA product contains two more guanine nucleotides (lowercase) at 5’ end by T7 RNA polymerase (ggTCAGCCACACAACAGAGGGGGTGGCACAGCTCTTGGGA (SEQ ID NO: 41)), its 5’ biotin-labeled reverse complementary DNA oligo was introduced 2 more cytosine nucleotides at 3’ end to acquire a blunt-ended probe.
- RNA oligo with the same sequence as RNA was synthesized and annealed with the biotin-labeled reverse complementary DNA oligo.
- a mutant probe was synthesized with a mutated CTCF consensus binding motif (ggTCAGCCACACAACAGAAAAAATGGCACAGCTCTTGGGA (SEQ ID NO: 42)).
- MBP Maltose-binding protein
- MBP-Brgl D1D2 protein 20 pmol purified Maltose-binding protein (MBP) or MBP-Brgl D1D2 protein was incubated with Amylose Magnetic Beads (E8035, New England Biolabs) for 2 hr at 4 °C with rotation. After washed three times with MBP column binding buffer (10 mM Tris-HCl, pH7.5, 150 mM NaCl, 1 mM DTT, 0.1% Triton X-100), the beads were resuspended in 500 pl binding buffer.
- MBP column binding buffer 10 mM Tris-HCl, pH7.5, 150 mM NaCl, 1 mM DTT, 0.1% Triton X-100
- ssDNA 200-bp single stranded DNA
- ssRNA single stranded RNA
- DNA-RNA hybrid probe annealed from the ssRNA and its complementary DNA were incubated with the beads for 2 hr at 4 °C with rotation and washed three times with low salt wash buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, pH 8.1, 150 mM NaCl) and three times with high salt wash buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, pH 8.1, 500 mM NaCl).
- low salt wash buffer 0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, pH 8.1, 150 mM NaCl
- high salt wash buffer 0.1% SDS, 1% Triton X-100, 2 mM
- elution buffer (10 mM Tris-HCl, pH7.5, 150 mM NaCl, 1 mM DTT, 0.1% Triton X-100, 10 mM maltose).
- Proteinase K was incubated with the elution buffer at 65 °C for 1 hr and the probes were purified by miRNeasy Mini Kit (217004, Qiagen).
- MEME Suite was used for motif discovery as described. Briefly, all sequences from different species were trimmed to the same size and subjected to MEME-ChIP using
- JASPAR_CORE_2009.MEME motif database CentriMo from MEME Suite was used to calculate different motifs distribution. FindMotif tools from HOMER were used to confirm the results from MEME Suite.
- genomic region 7.5-kb upstream of the mouse Myh7 gene transcriptional start site that spanned a highly conserved 4-kb genomic region (Fig. 1).
- this genomic region was enriched with chromatin signatures of active enhancers— acetylated histone 3 lysine 27 (H3K27ac) and monomethylated histone 3 lysine 4 (H3K4mel) with low levels of trimethylated histone 3 lysine 4 (H3K4me3)— and the boundaries of this genomic region were well-demarcated by levels of H3K27ac and H3K4mel (Fig. 1).
- this genomic region contained consensus binding motifs of transcriptional factor MEF2A and GATA4 that are critical for heart development, and the motifs were conserved between mouse and human. Accordingly, we postulated this 4-kb DNA functioned as a cardiac-specific enhancer and referred to it as eDNA.
- eDNA was an enhancer
- basal heat shock promoter hsp68 to drive the expression of lacZ reporter gene in transgenic mice.
- eDNA enhanced lacZ expression only in the heart but not other tissues of El 1.5 embryos, indicating a cardiac-specific enhancer activity.
- DNAse-I footprinting studies revealed hypersensitivity sites in eDNA region primarily in the heart, consistent with its cardiac-specific activity.
- eDNA As a cardiac-specific enhancer was collectively supported by chromatin signatures, in vivo reporter studies, DNAse-I footprinting, as well as the ability of eDNA to undergo looping to its target promoters, and its bidirectional transcription into cardiac-specific noncoding RNAs.
- CRISPR CRISPR Repeats
- eDNA could form a three-dimensional chromatin loop, like an enhancer, to its target Myh7 and Myh6 promoters (Fig. 1).
- chromosome conformation capture with quantitative PCR (3C-qPCR) to determine the looping between eDNA and Myh promoters.
- 3C-qPCR quantitative PCR
- eDNA was capable of looping to Myh6 and Myh7 proximal promoters, which were previously shown to control Myh isoform expression.
- eDNA displayed much diminished looping to Myh loci in normal adult hearts, consistent with its lack of activity on Myh expression in mature hearts (Fig. 3).
- TAC-induced hypertrophy was reduced by 55%, with the decline of left ventricular fractional shortening reduced by 42%.
- Brgl The functional requirement of Brgl was revealed by the disruption of eDNA-Myh looping in fetal or stressed hearts lacking myocardial Brgl (Sm22a-Cre ;Brgl fl/ fl or Tnnl2-rlTA;TRE- Cre ; Brg 1 I/I ) (Fig. 6 and 7).
- Brgl and eDNA knockout studies showed that both Brgl and eDNA were essential for eDNA-Myh looping to trigger Myh switch in response to pathophysiological stimuli (Figs. 2, 3, 4).
- the formation or disruption of a Brg 1 -eDNA-Myh6-Myh7 three-dimensional complex provides a critical spatial mechanism to orchestrate antithetical Myh changes.
- chromatin signatures of eDNA activity (H3K4ml and H3K27ac) diminished, along with physiological Myh switch and reduced eDNA-Myh looping.
- Uhrt increased sharply within the first 24 hours after birth, while Myh7 levels dropped precipitously in the same period, indicating an abrupt neonatal cessation of eDNA-Myh looping. Therefore, Uhrt can be transcribed from eDNA only when eDNA is functionally silent with minimal looping to its target Myh promoters. This contrasts sharply with known eRNAs, whose levels of expression track activities of enhancers and promoters. The Uhrt-eDNA interaction suggests a new mode of eRNA function.
- Uhrt was expressed specifically in the heart: its levels were undetectable or minimal in non-cardiac tissues.
- Uhrt was transcribed in cardiomyocytes but not endothelial cells or fibroblasts and was highly enriched in the nuclei, revealed by cell sorting and nuclear/cytoplasmic fractionation studies. Codon substitution frequency suggested a highly negative translation score of Uhrt (-1148), which was further confirmed by in vitro transcription and translation of Uhrt that found no peptide translation.
- Ribosome profiling of adult hearts showed minimal ribosome binding to Uhrt, consistent with Uhrt being a nuclear, noncoding RNA.
- transgenic Uhrt expression could be shut down by Sm22a-Cre that removed the floxed CMV promoter but maintained eDNA in Sm22a- Cre ; CM V ]ox - eDNA - hsp68 - lacZ line (abbreviated as eDNA-lacZ ).
- CM V ]ox - eDNA - hsp68 - lacZ line
- CTCF CCCTC-binding factor
- CTCF binding site on eDNA was guanine -rich with a GC skew score of 0.66, which was highly prone to form RNA- DNA hybrid, and indeed, this site resided within the Uhrt-eDNA hybrid zone.
- Brgl was essential for recruiting Setx to eDNA. This recruitment was further supported by ChIP-on-ChIP analyses that showed co-occupancy of Brgl and Setx on eDNA of TAC-stressed hearts (Fig. 18). Given the known role of Setx helicase in resolving enhancer RNA-DNA hybrids, these findings indicate that Brgl recruits Setx to Uhrt-eDNA site to unwind the RNA-DNA hybrid, releasing eDNA strands to form DNA duplex, to enable CTCF binding and the trigger of eDNA-Afyri looping and Myh isoform switch.
- heDNA indeed, displayed cardiac-specific enhancer activity on hsp68 promoter in mouse embryos, and such cardiac specificity was consistent with human chromatin studies that showed higher H3K27ac signals in hearts but minimal H3K27ac in aortic tissues.
- heDNA is the human homolog of mouse eDNA.
- Strand-specific RT-qPCR showed that this human RNA was predominantly expressed in the heart.
- This human RNA had highly negative coding potential score (-993), and showed no translation of peptides or proteins by in vitro translation assay, consistent of its being a noncoding RNA.
- lacZ activity was induced by TAC (2.3-fold) in heDNA- lacZ hearts (without UHRT expression) but was eliminated by UHRT expression in CMV- heDNA-lacZ eart?, (Fig. 20).
- lacZ activity was minimal in either reporter mice (Fig. 20) due to the lack in normal adult hearts of Brgl required for enhancer activity.
- the in vivo interaction of human eDNA and UHRT in mice indicates a mechanistic conservation of eDNA -Uhrt interaction in humans.
- Uhn -eDNA interaction controls the assembly of eD N A-Myh6-Myh 7 complex to direct antithetical Myh regulation in development and in disease to govern cardiac contractility and resistance to pathological stress (Fig. 22).
- Those three DNA regulatory elements eDNA, Myh6, Myh7 promoters
- eDNA, Myh6, Myh7 promoters are brought together in the three-dimensional space by Brgl and CTCF to coordinate Myh regulation and cardiac pathophysiology, a process opposed by Uhrt (Fig. 22).
- Uhrt like many eRNAs, arises from a bidirectionally transcribed enhancer, doesn’t splice into isoforms, and maintains enhancer-encoded nucleotides for its function.
- lncRNAs enhancer-associated long noncoding RNAs
- the enhancer-encoded nucleotides are deleted from primary RNAs, which splice into different isoforms.
- Uhrt thus provides a unique example of a cardiomyocyte- specific and protective eRNA, distinct from those and other lncRNAs that affect heart development or function.
- Using Uhrt to silence pathogenic eDNA may provide therapeutic benefits to heart failure patients.
- identifying cardiac-specific factors essential for eDNA-Myh looping will have translational values, especially for patients with Myh7 mutations causing hypertrophic or dilated cardiomyopathy. Inhibition of such factors by small molecules can disrupt eDNA- Myh looping and shut down mutant Myh7 expression to prevent disease progression.
- eRNAs Transcription of eRNAs is thought to reflect enhancer activation, with many eRNAs known to facilitate interactions between enhancers and promoters.
- Uhrt provides a counter example— it is transcribed by an inactive enhancer and physically blocks enhancer activation and looping toward target promoters. Transcription of eRNAs could therefore mark an inactive, rather than active, state of the enhancer.
- This unusual function of Uhrt reveals a new enhancer- eRNA interface in transcriptional circuitry and uncovers a new mechanism of enhancer activation, mediated by a chromatin remodeler Brgl that recruits an RNA-DNA helicase Setx to unwind eDNA -Uhrt and enable looping.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Plant Pathology (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Toxicology (AREA)
- Medicinal Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Disclosed are methods of detecting myocardial enhancer RNA levels in mammalian cardiomyocytes. In a further embodiment, a method of disrupting assembly of an enhancer DNA-Myh6 promoter-Myh7 promoter complex, is provided wherein the method comprises providing enhancer RNA to a cardiomyocyte.
Description
MYOCARDIAL ENHANCER RNA AND METHODS OF USE
CROSS REFERENCE TO RELATED APPLICATIONS
This application claims priority to U.S. Provisional Patent Application No. 62/747,732 filed on October 19, 2018. The disclosure of this application is hereby expressly incorporated by reference in its entirety.
STATEMENT OF GOVERNMENT SUPPORT
This invention was made with government support under HL118087 and HL121197 awarded by the National Institutes of Health. The Government has certain rights in the invention.
INCORPORATION BY REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY
Incorporated by reference in its entirety is a computer-readable nucleotide/amino acid sequence listing submitted concurrently herewith and identified as follows: 36 kilobytes ACII (Text) file named“299852_ST25.txt,” created on October 15, 2019.
BACKGROUND OF THE DISCLOSURE
Many transcriptional circuits are controlled by enhancer-promoter interactions. An enhancer is a relatively short (50-1500 bp) region of DNA that can be bound by proteins (activators) to increase the likelihood that transcription of a particular gene will occur.
Enhancers are cis-acting and can be located up to 1 Mbp (1,000,000 bp) upstream or downstream from the transcription start site of the gene they regulate. In eukaryotic cells the chromatin complex of DNA is folded so although the enhancer DNA may be far from the gene in a linear way, it is spatially close to the promoter and gene. This allows it to interact with the general transcription factors and RNA polymerase II required for expression of the gene. Many active enhancers transcribe noncoding, enhancer RNAs (eRNAs), capable of facilitating enhancer-promoter interactions for gene regulation, and levels of eRNAs reflect the degree of enhancer and promoter activation.
SUMMARY
The present disclosure relates generally to the use of noncoding enhancer RNAs (eRNAs) as therapeutic agents. More specifically, the present disclosure relates to the use of
noncoding myocardial eRNAs to inhibit the formation of a trasnscriptional complex between the myocardial enhancer DNA (eDNA) and the promoters of the myocardial myosin heavy chain genes (Myh6 and Myh7) in a cardiomyocyte (the eDNA-Myh6 promoter-Myh7 promoter complex). In one embodiment the nonencoding eRNA is a cardioprotective eRNA, named Uheart (Uhrt) for Upstream Myosin Heavy chain RNA Transcript, optionally wherein the Uhrt is an RNA comprising a sequence having at least 95% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2. A representative listing of relevant sequence identifiers is as follows:
SEQ ID NO: 1 is mouse Uhrt RNA
SEQ ID NO: 2 is human Uhrt RNA
SEQ ID NO: 3 is human enhancer DNA
SEQ ID NO: 4 is mouse enhancer DNA
SEQ ID NO: 5 is mouse Uhrt DNA equivalent
SEQ ID NO: 6 is human Uhrt DNA equivalent
In one embodiment, a method of inhibiting the assembly of an enhancer DNA-Myh6 promoter-Myh7 promoter complex is provided. In some embodiments, the method comprises enhancing the percentage of myocardial enhancer DNA that is bound to Uhrt. In some embodiments, the enhancer DNA comprises a sequence selected from the group of SEQ ID NO: 3 and sequences having at least 95% sequence identity with SEQ ID NO: 3. In one embodiment the method comprises increasing the intracellular concentration of active Uhrt RNA and/or increasing the percentage of myocardial eDNA that has an Uhrt RNA bound to it.
In accordance with one embodiment an isolated nucleic acid comprising a sequence having at least 95% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2 is provided, or a eDNA derivative of such sequences. In one embodiment the isolated nucleic acid comprises a sequence selected from the group consisting of SEQ ID NO: 1, a eDNA complement of SEQ ID NO: 1, SEQ ID NO: 2, and a eDNA complement of SEQ ID NO:2. In one embodiment a nucleic acid is provided comprising a sequence having at least 95% sequence identity to SEQ ID NO: 1, a eDNA complement of SEQ ID NO: 1, SEQ ID NO:2, or a eDNA complement of SEQ ID NO: 2, wherein the nucleic acids are modified to comprise a covalently linked detectable marker. In some embodiments, a nucleic acid sequence is provided comprising SEQ ID NO: 1 coupled to a detectable marker. In some embodiments, a nucleic acid sequence is provided comprising SEQ ID NO: 2 coupled to a detectable marker.
In some embodiments, a method of measuring Uhrt in a patient biological sample is provided. In one embodiment, the method comprises providing an RNA sample recovered from the patient and conducting quantitative reverse transcriptase polymerase chain reaction (rtPCR)
using primers that specifically bind to Uhrt cDNA, and detecting the detecting the resulting amplicon as a measure of the Uhrt in the patient sample.
In some embodiments, a method of identifying a patient at risk for hypertrophy is provided. In one embodiment, the method comprises providing a sample of RNA recovered from cardiomyocytes from the patient, analyzing the levels of Uhrt RNA, and comparing the Uhrt RNA levels in the patient cardiomyocytes to a reference sample. In one illustrative embodiment, if the analysis of the relative concentration of patient Uhrt RNA is lower than the reference sample Uhrt RNA level, then the patient is identified as at risk for hypertrophy. In one embodiment the reference sample is an RNA sample recovered from myocardial cells of one or more healthy individuals that are free of any cardiac disease.
In some embodiments, a method of treaing a patient for heart disease is provided. In some embodiment, the method comprises administering an RNA sequence to the patient. In some embodiments the RNA sequence comprises a sequence having at least 95% sequence identity to SEQ ID NO: 2 or its corresponding DNA equivalent thereof.
In some embodiments, a method of switching a cardiomyocyte from a stressed-state to a non-stressed state is provided. In some embodiments, the method comprises decreasing Brgl activity and increasing Uhrt activity.
In some embodiments, a method of detecting a patient at risk for hypertrophy is provided. The method comprises providing a test sample comprising RNA from the patient, contacting the test sample with a reverse transcriptase primer specific for an enhancer RNA comprising the sequence for Uhrt, reverse transcribing the enhancer RNA to produce a corresponding test cDNA, contacting the test cDNA with PCR primers specific for Uhrt RNA, conducting a PCR reaction on the test cDNA, detecting the amplified product, determining the concentration of the enhancer RNA in the test sample, and obtaining a reference concentration of the corresponding enhancer RNA. In some embodiments, if the enhancer RNA in the test sample is lower in concentration or level than the reference concentration level, then the patient is at risk or may be diagnosed with hypertrophy. In one embodiment the reference sample represents the average concentration of an eRNA having at least 95% sequence identity to SEQ ID NO: 2 as found in the general population.
BRIEF DESCRIPTION OF THE DRAWINGS
Fig. 1 is an illustration depicting a mouse Myh locus, showing the size of Myh6, Myh7, and eDNA.
Fig. 2 is a graph representing the quantitation of Myh6 and Myh7 mRNAs in E13.5 e- DNA-null hearts (Sm22a-Cre;eDNAf/f) verses wild type (wt) fetal hearts.
Fig. 3 is a graph representing the quantitation of Myh6 and Myh7 mRNAs in adult eDNA-null hearts (Tnnt2-rtTA;TRE-Cre;eDNAf/f) verses wild type (wt) adult hearts.
Fig. 4 is a graph representing the quantitation of Myh6 and Myh7 mRNAs in adult eDNA-null hearts or in wild type (wt) adult hearts 7 days after TAC.
Fig. 5 is a graph representing a ChIP analysis of Brgl-eDNA binding in E13.5 hearts and adult hearts 7 days after sham or TAC operation.
Fig. 6 is a graph representing a 3C analysis of Myh6 and Myh7 proximal promoters and eDNA in control (Ctrl) and Brgl-null hearts (KO) of E10.5 embryos.
Fig. 7 is a graph representing a 3C analysis of Myh6 and Myh7 proximal promoters and eDNA in control (Ctrl) and Brgl- null hearts (KO) adult hearts 7 days after sham or TAC operation.
Fig. 8 is a graph representing the quantitation of Uhrt and Myh7 RNA in mouse hearts. P: postnatal day.
Fig. 9 is a graph representing the quantification of cardiac Uhrt RNAs 2-56 days (d) after TAC operation.
Fig. 10 is a graph representing the ventricle/body- weight ratio of hearts 2 weeks (w) after TAC.
Fig. 11 is a graph representing the quantification of cardiomyocyte cross-sectional areas by wheat germ agglutinin staining in WT and Uhrt KO mice 2 weeks after TAC.
Fig. 12 is an illustration of eDNA reporter mouse lines and quantification of Uhrt 7 days after sham or TAC operation.
Fig. 13 is a graph representing the quantification of lacZ RNAs in hearts from eDNA reporter mice 7 days after sham or TAC operation.
Fig. 14 is a graph representing a ChIP quantitation of CTCF-eDNA binding in adult control (Ctrl) and Brgl-null (KO) hearts 7 days after sham or TAC operation.
Fig. 15 is a graph representing a DRIP quantitation of Uhrt-eDNA hybrid in control (Ctrl) and Brgl-null (KO) adult hearts 2 days after sham or TAC operation.
Fig. 16 is a graph representing an, amylose pull-down assay of MBP-Brgl D1D2 protein binding to ssDNA (CTCF site), ssRNA (Uhrt sequence at CTCF site) and Uhrt-eDNA hybrid at CTCF site. MBP: maltose binding protein.
Fig. 17 is a graph representing a ChIP analysis of Setx-eDNA binding in adult Ctrl and Brgl-null (KO) hearts 7 days after sham or TAC operation.
Fig. 18 is a graph representing a ChIP-on-ChIP quantitation of Setx on Brgl- immunoprecipitated eDNA 7 days after sham or TAC operation.
Fig. 19 is a graph representing the human Uhrt levels using an X-Gal assay with heart sections.
Fig. 20 is a graph representing the human Uhrt levels in heDNA reporter mice 7 days after sham or TAC operation.
Fig. 21 is a graph representing the quantification of Uhrt, Myh6 and Myh7 RNAs of human ventricular tissues with nonfailing and failing hearts.
Fig. 22 is an illustration of the molecular interactions between Brgl, Uhrt, and eDNA in cardiac physiology and pathology.
DETAILED DESCRIPTION DEFINITIONS
In describing and claiming the invention, the following terminology will be used in accordance with the definitions set forth below.
As used herein, the term“Uhrt” includes any RNA sequence that binds to an enhancer DNA (eDNA) that participates in an enhancer DNA-Myh6 promoter- Myh7 promoter complex in a mammalian cardiomyocyte. For example this includes both the mouse Uhrt and human Uhrt of SEQ ID NOs: 1 and 2, respectively. In some embodiments human Uhrt is denoted as UHRT.
As used herein, the term“enhancer” refers to a region of DNA that can increase the likelihood that a cis linked gene is transcribed. A myocardial eDNA is an enhancer element located in a patient’s cardiomyocyte that helps regulate the expression of Myh7 and Myh6.
As used herein, the term "treating" includes prophylaxis of the specific disorder or condition, or alleviation of the symptoms associated with a specific disorder or condition and/or preventing or eliminating said symptoms.
As used herein an "effective" amount or a "therapeutically effective amount" of an enhancer RNA, an interference RNA, or antisense RNA mimetic refers to a nontoxic but sufficient amount of the compound to provide the desired effect. The amount that is "effective" will vary from subject to subject, depending on the age and general condition of the individual, mode of administration, and the like. Thus, it is not always possible to specify an exact "effective amount." However, an appropriate "effective" amount in any individual case may be determined by one of ordinary skill in the art using routine experimentation.
As used herein the term "isolated" describes a polynucleotide, a polypeptide, or a cell that is in an environment different from that in which the polynucleotide, the polypeptide, or the cell naturally occurs.
As used herein the term "detectable marker" describes a molecule conjugated directly or indirectly to a second molecule to facilitate detection of the second molecule. Specific, non limiting examples of labels include fluorescent tags, enzymatic linkages, and radioactive isotopes.
As used herein,“a reference sample” refers to a sample that is representative of the general population. A test sample is the sample to be analyzed. The reference sample is distinguished from individuals or a subpopulation that displays or expresses a genotypic or phenotypic characteristic that is not present in the majority of a relevant population as a whole. The reference sample may be based on population data (i.e., average concentration of a molecule) or may be a sample recovered from an individual or from a control population know to lack the genotypic or phenotypic characteristic not present in the majority of the relevant population as a whole.
As used herein,“a reference concentration” refers to the concentration of a molecule in the reference sample
As used herein,“Uhrt activity” refers to the ability of a Uhrt nucleic acid to specifically bind to its corresponding eDNA.
As used herein,“Brgl activity” refers to the ability of a Brgl protein to specifically bind to the eDNA-Myh6 promoter-Myh7 promoter complex.
As used herein the term "patient" without further designation is intended to encompass any warm blooded vertebrate domesticated animal (including for example, but not limited to livestock, horses, mice, cats, dogs and other pets) and humans.
EMBODIMENTS
In one embodiment, the present disclosure is directed to the use of noncoding RNAs to inhibit the assembly of an enhancer DNA-Myh6 promoter- Myh7 promoter complex. In some embodiments, a method of inhibiting assembly of an enhancer DNA-Myh6 promoter-Myh7 promoter complex in a cell is a provided. In some embodiments, the cell is a heart cell. In some embodiments, the cell is a cardiomyocyte.
In some embodiments, a method of inhibiting assembly of an enhancer DNA-Myh6 promoter- Myh7 promoter complex in a cardiomyocyte comprising enhancing binding of Uhrt to the enhancer DNA is provided. In some embodiments, the enhancer DNA comprises a sequence
selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, sequences having at least 95% sequence identity to SEQ ID NO: 3 and sequences having at least 95% sequence identity to SEQ ID NO: 4, and the Uhrt is an RNA sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, sequences having at least 95% sequence identity to SEQ ID NO: 1 and sequences having at least 95% sequence identity to SEQ ID NO: 2 or a DNA equivalent of said RNA sequences.
In one embodiment, the method comprises increasing the intracellular concentration of active Uhrt RNA and/or increasing the percentage of myocardial eDNA that is bound to Uhrt RNA. In some embodiments, increasing the intracellular concentration of active Uhrt RNA comprises introducing additional Uhrt RNA into a cardiomyocyte. In an alternative
embodiment, a eDNA equivalent of Uhrt may be provided intracellularly to the cardiomyocyte. An active Uhrt RNA or its eDNA equivalent refers to an isolated nucleic acid that is able to bind to eDNA.
In some embodiments, the enhancer DNA comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 3. In some embodiments, the enhancer DNA consists essentially of a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 4. In some embodiments, the enhancer DNA consists of a sequence having at least 95% sequence identity to SEQ ID NO: 3. In some embodiments, the enhancer DNA consists of SEQ ID NO:
3.
In some embodiments, a method of inhibiting assembly of an eDNA-Myh6 promoter- Myh7 promoter complex in a cardiomyocyte is provided. The method comprises enhancing binding of Uhrt to said enhancer. In some embodiments, the Uhrt comprises an RNA sequence having at least 95% sequence identity to SEQ ID NO: 2 or its eDNA equivalent thereof. In some embodiments, the Uhrt comprises an RNA sequence having at least 90%, 91%, 92%,
93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 2 or its eDNA equivalent thereof. In some embodiments, the Uhrt RNA comprises SEQ ID NO: 2 or its eDNA equivalent thereof. In some embodiments, the enhancer DNA comprises SEQ ID NO: 3 and the Uhrt comprises SEQ ID NO: 2 or its eDNA equivalent.
In some embodiments, the method of inhibiting assembly of an eDNA-Myh6 promoter- Myh7 promoter complex in a cardiomyocyte comprises a step of increasing the amount of Uhrt binding to said enhancer. In some embodiments, the Uhrt comprises an RNA sequence having at least 95% sequence identity to SEQ ID NO: 1 or its eDNA equivalent thereof. In some embodiments, the Uhrt comprises an RNA sequence having at least 90%, 91%, 92%, 93%,
94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 1 or its cDNA equivalent thereof. In some embodiments, the Uhrt RNA comprises SEQ ID NO: 2 or its cDNA equivalent thereof. In some embodiments, the enhancer DNA comprises SEQ ID NO: 3 and the Uhrt comprises SEQ ID NO:l or its cDNA equivalent. In some embodiments, the enhancer DNA comprises SEQ ID NO: 4 and the Uhrt comprises SEQ ID NO: 1 or its cDNA equivalent. In one embodiment the enhancer DNA comprises SEQ ID NO: 3 and the Uhrt comprises SEQ ID NO: 2 or its cDNA equivalent.
In some embodiments, the method of inhibiting assembly of an eDNA-Myh6 promoter- Myh7 promoter complex in a cardiomyocyte comprises a step of decreasing Brgl activity. In an illustrative embodiment, Brgl activity is decreased by introducing an interfering RNA (iRNA) to the cardiomyocyte to inhibit the translation of Brgl.
One aspect of the present disclosure is directed to nucleic acids comprising a myocardial eRNA. In one embodiment an isolated RNA comprising a sequence having at least 95% or 99% sequence identity with SEQ ID NO: 1 or 2, or a DNA equivalent is provided. In one embodiment an isolated DNA comprising a sequence having at least 95% or 99% sequence identity with SEQ ID NO: 5 or 6 is provided. In one embodiment the isolated RNA comprises the sequence of SEQ ID NO: 1 or 2, and in a further embodiment the isolated RNA consists of SEQ ID NO: 1 or 2. In one embodiment an isolated DNA is provided comprising the sequence of SEQ ID NO: 5 or 6, and in a further embodiment the isolated DNA consists of SEQ ID NO:
5 or 6.
In accordance with one embodiment, a nucleic acid is provided comprising the sequence of SEQ ID NO: 1 or its cDNA equivalent coupled to a marker. In some embodiments, the nucleic acid comprises a sequence consisting of SEQ ID NO: 1 or its cDNA equivalent coupled to a marker. In some embodiments, the marker is a detectable marker. In some embodiments, detectable the marker is selected from the group consisting of a fluorescent tag, an antibody, and a small peptide. In some embodiments, the detectable marker is coupled to an isolated nucleic acid comprising SEQ ID NO: 1 or its cDNA equivalent by a covalent linkage.
In some embodiments, a nucleic acid comprising a sequence comprising SEQ ID NO: 2 is disclosed. In some embodiments, the nucleic acid comprises a sequence comprising SEQ ID NO: 2 or its cDNA equivalent coupled to a marker. In some embodiments, the nucleic acid comprises a sequence consisting of SEQ ID NO: 2 or its cDNA equivalent coupled to a marker. In some embodiments, the marker is a detectable marker. In some embodiments, the detectable marker is selected from the group consisting of a radionuclide, fluorescent tag, an enzyme, an
antibody, and small peptide. In some embodiments, the detectable marker is coupled to an isolated nucleic acid comprising SEQ ID NO: 2 or its cDNA equivalent by a covalent linkage.
In some embodiments a method of measuring Uhrt in a patient biological sample is provided. The method comprising, providing an RNA sample recovered from said patient, contacting the RNA sample with a nucleic acid that specifically binds to Uhrt, and detecting hybrids formed between the diagnostic nucleic acid and Uhrt as an indication of the presence and quantity of Uhrt in the patient sample. In one embodiment the diagnostic nucleic acid is a nucleic acid that is labeled with a detectable maker. In one embodiment the labeled diagnostic nucleic acid is an RNA sequence having at least 95% or 99% sequence identity with SEQ ID NO: 1 or 2. In one embodiment the labeled diagnostic nucleic acid is an RNA sequence comprising the sequence of SEQ ID NO: 1 or 2, and in a further embodiment the labeled diagnostic nucleic acid is an RNA sequence consisting of SEQ ID NO: 1 or 2. In one embodiment the labeled diagnostic nucleic acid is a DNA sequence comprising a sequence having at least 95% or 99% sequence identity with SEQ ID NO: 5 or 6, or its complement thereof. In one embodiment the labeled diagnostic nucleic acid comprises the sequence of SEQ ID NO: 5 or 6, and in a further embodiment the labeled diagnostic nucleic acid consists of SEQ ID NO: 5 or 6.
In some embodiments, the biological sample is heart tissue, blood, plasma, or a combination thereof, wherein the sample comprises cardiomyocytes RNA. In one embodiment the biological sample is a tissue or blood sample that comprises cardiomyocytes. In some embodiments, the biological sample is biopsy tissue sample comprising cardiomyocytes. In some embodiments, the sample is recovered during an operation, biopsy, or autopsy.
In one embodiment, the method of detecting and/or measuring the relative concentration of eRNA in a patient's cardiomyocytes comprises providing an RNA sample recovered from the patient and conducting quantitative reverse transcriptase polymerase chain reaction (rtPCR) to determined eRNA concentrations. In one embodiment the RNA sample is prepared from a tissue sample isolated from the patient, more particularly from a tissue or blood sample that comprises cardiomyocytes, using techniques known to those skilled in the art. The rtPCR is conducted using standard techniques known to the skilled practitioner, including a first step of converting the RNA present in the RNA sample to cDNA using reverse polymerase and a suitable set of primers. In one embodiment the reverse transcriptase reaction is conducted using a primer that specifically binds to the target eRNA (e.g., an eRNA comprising SEQ ID NO: 1 or 2 or derivative thereof). The generated cDNA is then amplified using standard PCR techniques and primers that specifically bind to Uhrt cDNA. Detection of the resulting amplicon as a
measure of the Uhrt in the patient sample. In some embodiments, the resulting amplicon provides a measure of the relevant concentration of the Uhrt in the patient sample. In some embodiments, the PCR primers each comprise a sequence of at least 10 nucleotides, wherein the continuous primer sequence has at least 95% sequence identity to a corresponding equivalent fragment of SEQ ID NO: 2 or its compliment.
In some embodiments, a nucleic acid sequence is provided comprising a sequence of at least 10 nucleotides that has at least 95% sequence identity to a corresponding complementary portion of SEQ ID NO: 2 or its corresponding DNA equivalent or compliment thereof. In some embodiments, the nucleic acid is labeled with a detectable marker. In some embodiments, the detectable marker is selected from the group consisting of a fluorophore and radioisotope, and fluorophore. In some embodiments, the term“label” includes a covalent linkage or other known methods in the art of labeling nucleic acids.
In some embodiments, a method of identifying a patient at risk for hypertrophy is provided. The method comprises, providing a sample of RNA recovered from cardiomyocytes from the patient, analyzing the levels of Uhrt , and comparing the relative concentration levels of Uhrt in the patient cardiomyoctes to a reference sample.
In some embodiments, the reference sample comprises a known concentration of Uhrt.
In some embodiments, the reference sample is a known concentration of Uhrt representing an amount of Uhrt expected in a patient sample not at risk for hypertrophy. The reference sample may vary depending on age, gender, and species of the patient. In some embodiments, the reference sample comprises an expected concentration of Uhrt in a normal fetal heart from a relevant population. In some embodiments, the reference sample comprises an expected concentration of Uhrt in a normal infant heart from a relevant population. In some
embodiments, the reference sample comprises an expected concentration of Uhrt in a normal adolescent heart from a relevant population. In some embodiments, the reference sample comprises an expected concentration of Uhrt in a normal adult heart from a relevant population. In an illustrative embodiment, a low level of Uhrt RNA in the sample RNA recovered from cardiomyocytes compared to the reference sample identifies a patient at risk for hypertrophy.
In some embodiments, the analyzing step is performed using PCR, quantitative real-time PCR, Northern Blot, flow cytometry, mass spectrometry, molecular probes, or a combination thereof.
In some embodiments, a method of treating a patient at risk for heart disease is provided. In some embodiments, the heart disease is hypertrophy. The method comprises administering an isolated RNA sequence to the patient. In some embodiments, the RNA
sequence comprises a sequence having at least 95% sequence identity to SEQ ID NO: 2 or its corresponding DNA equivalent. In some embodiments, the RNA sequence comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 2 or its DNA equivalent.
In some embodiments, the method further comprises decreasing Brgl activity. In an illustrative embodiment, Brgl activity can be decreased by administering an iRNA to a cardiomyocyte designed to inhibit the translation of Brgl.
In some embodiments, the method further comprises analyzing Uhrt levels after the step of administering the RNA. In an illustrative embodiment, the step of analyzing may include performing PCR, rt-qPCR, Northern Blot, flow cytometry, mass spectrometry, the use of molecular probes, or a combination thereof.
In some embodiments, a method of switching a cardiomyocyte from a stressed-state to a non-stressed state is provided. The method comprising decreasing Brgl activity and increasing Uhrt activity. In some embodiments, the Brg 1 activity is decreased by providing a Brgl iRNA. In some embodiments, the Uhrt activity is increased by providing a Uhrt RNA.
In one embodiment a method of detecting a patient at risk for hypertrophy is provided. The method comprises providing a test sample comprising RNA from the patient, contacting the test sample with a reverse transcriptase primer specific for an enhancer RNA comprising the sequence for Uhrt, reverse transcribing the enhancer RNA to produce a corresponding test cDNA, contacting the test cDNA with PCR primers specific for Uhrt RNA. In some embodiments, the primers comprise a sequence of at least 10 nucleotides having at least a 90% sequence identity to a corresponding complementary portion of SEQ ID NO: 2. In some embodiments, the primers comprise a sequence of at least 10 nucleotides having at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to a corresponding complementary portion of SEQ ID NO: 2.
In some embodiments, the method further comprises conducting a PCR reaction on the test cDNA, and detecting the resulting amplified product. In some embodiments, the method further comprises determining the concentration of the enhancer RNA in the test sample based on the detected test cDNA. In some embodiments, the method further comprises obtaining a reference concentration of the corresponding enhancer RNA from a reference sample. In an illustrative embodiment, a detected low level of the enhancer RNA in the test sample as compared to the reference concentration level of the enhancer RNA indicates hypertrophy.
In some embodiments, a method of detecting a patient at risk for hypertrophy is provided. The method comprising providing a test sample comprising RNA from the patient;
contacting the test sample with a reverse transcriptase primer specific for an enhancer RNA comprising the sequence for Uhrt; reverse transcribing the enhancer RNA to produce a corresponding test cDNA; contacting the test cDNA with PCR primers specific for Uhrt RNA wherein said primers comprise a sequence of at least 10 nucleotides having at least a 90% sequence identity to a corresponding complementary portion of SEQ ID NO: 2; conducting a PCR reaction on the test cDNA, and detecting the resulting amplified product; determining the concentration of the enhancer RNA in the test sample based on the detected test cDNA; and obtaining a reference concentration of the corresponding enhancer RNA; wherein a detected lower level of the enhancer RNA in the test sample as compared to the reference concentration level of the enhancer RNA indicates hypertrophy.
In accordance with embodiment 1 a method of inhibiting assembly of an enhancer DNA-Myh6 promoter-Myh7 promoter complex in a cardiomyocyte cell is provided. The method comprises the step of enhancing binding of Uhrt to said enhancer, wherein said enhancer comprises a sequence having at least 90, 95% or 99% sequence identity with SEQ ID NO: 3.
In accordance with embodiment 2, the method of embodiment 1 is provided wherein the Uhrt comprises an RNA sequence having at least 90, 95% or 99% sequence identity to SEQ ID NO: 2.
In accordance with embodiment 3, the method of embodiment 1 is provided wherein the Uhrt RNA comprises SEQ ID NO: 2 and said enhancer comprises SEQ ID NO: 3.
In accordance with embodiment 4, the method of embodiment 1 is provided wherein the Uhrt comprises an RNA sequence having at least 95% sequence identity to SEQ ID NO: 1.
In accordance with embodiment 5, the method of embodiment 1 is provided wherein the Uhrt RNA comprises SEQ ID NO: 1 and said enhancer comprises SEQ ID NO: 3.
In accordance with embodiment 6, the method of any one of embodiments 1-5 is provided wherein the method further comprising a step of decreasing Brgl activity.
In accordance with embodiment 7, the method of embodiment 6 is provided wherein the Brgl activity is decreased by introducing an interfering RNA into said cardiomyocyte cell to inhibit translation of Brgl.
In accordance with embodiment 8, a nucleic acid comprising an RNA sequence consisting of SEQ ID NO: 1, or its DNA equivalent thereof, coupled to a marker is provided.
In accordance with embodiment 9, a nucleic acid comprising an RNA sequence consisting of SEQ ID NO: 2, or its DNA equivalent thereof, coupled to a marker is provided.
In accordance with embodiment 10, the nucleic acid of embodiment 8 or 9 is provided wherein the marker is selected from the group consisting of a fluorescent tag, an antibody, and a small peptide.
In accordance with embodiment 11, a method of measuring Uhrt in a patient biological sample is provided. The method comprises:
providing an RNA sample obtained from said patient;
contacting the RNA sample with a nucleic acid that specifically binds to Uhrt; and
detecting the Uhrt in the patient sample.
In accordance with embodiment 12, the method of embodiment 11 is provided wherein Uhrt is detected by quantitative reverse transcription PCR wherein an amplicon is only produced in the presence of Uhrt.
In accordance with embodiment 13, the method of embodiment 11 or 12 is provided wherein said RNA sample is reverse transcribed into cDNA and said cDNA is contacted with a pair of PCR primers wherein said primers each comprise a sequence of at least 10 nucleotides that each have at least 95% sequence identity to a corresponding DNA equivalent of SEQ ID NO: 2 or a compliment thereof.
In accordance with embodiment 14, the method of any one of embodiments 11-13 is provided wherein said nucleic acid comprises a sequence of at least 10 nucleotides that has at least 95% sequence identity to a corresponding complementary portion of SEQ ID NO: 2 or its corresponding DNA equivalent or compliment thereof, wherein said nucleic acid is labeled with a detectable marker.
In accordance with embodiment 15, the method of embodiment 14 is provided wherein the detectable marker is selected from the group consisting of a fluorophore and a radioisotope and a fluorophore.
In accordance with embodiment 16, a method of identifying a patient at risk for hypertrophy is provided. The method comprises:
providing a sample of RNA recovered from cardiomyocytes from the patient; analyzing the levels of Uhrt RNA in said sample; and
comparing the Uhrt RNA levels in the patient cardiomyocytes to a reference sample, wherein a low level of Uhrt RNA compared to the reference sample identifies a patient at risk for hypertrophy.
In accordance with embodiment 17, the method of embodiment 16 is provided wherein the reference sample is either a set of values based on population data (i.e., average
concentration of a molecule in a target population) or the detected eRNA levels in a sample recovered from an individual or from a control population know to lack the relevant genotypic or phenotypic characteristic (e.g., low levels of eRNA, optionally the RNA of SEQ ID NO: 1 or 2) associated with hypertrophy.
In accordance with embodiment 18, a method of identifying a patient at risk for heart disease is provided. The method comprises:
administering an RNA sequence to the patient, wherein the RNA sequence comprises a sequence having at least 95% sequence identity to SEQ ID NO: 2 or its corresponding DNA equivalent thereof.
In accordance with embodiment 19, the method of embodiment 18 is provided wherein the heart disease is hypertrophy.
In accordance with embodiment 20, the method of embodiment 18 or 19 is provided wherein the method further comprises decreasing Brgl activity.
In accordance with embodiment 21, a method of switching a cardiomyocyte from a stressed-state to a non-stressed state is provided wherein the method comprises:
decreasing Brgl activity, and
increasing Uhrt activity, wherein the cardiomyocyte is switched from a stressed- state to a non-stressed state.
In accordance with embodiment 22, the method of embodiment 21 is provided wherein decreasing the Brgl activity comprises providing a Brgl interfering RNA.
In accordance with embodiment 23, the method of embodiment 21 or 22 is provided wherein the step of increasing of Uhrt activity comprises providing a Uhrt RNA.
EXAMPLE 1
We identified a cardiac-specific enhancer, situated upstream of its target myosin heavy chain genes ( Myh6 and Myh7), that gave rise to a cardioprotective eRNA, which we named Uheart (Uhrt) for Upstream Myosin Heavy chain RNA Transcript. In fetal mouse hearts, the enhancer produced little Uhrt and actively looped to Myh6 and Myh7 promoters, forming an e n h a ncer- Myh6- Myh 7 triplex to trigger antithetical Myh regulation— Myh7 up- and Myh6 down-regulation— to maintain Myh in fetal status. As the heart matured, the enhancer robustly transcribed Uhrt, which inhibited enhancer’s looping to its target Myh promoters, switching fetal Myh to adult status. Upon cardiac stress, Uhrt transcription was shut down, and the enhancer regained its looping to Myh loci, triggering Myh switch and hypertrophy.
Mechanistically, enhancer-Afv/i looping required the chromatin remodeler Brgl to recruit the
looping regulator CTCF to the enhancer. Binding of CTCF to the enhancer was inhibited by Uhrt, which tethered to the enhancer to form RNA-DNA hybrid, preventing CTCF binding. Cardiac stress stimulated Brgl to bind to Uhrt- DNA hybrid and recruit Senataxin— an RNA- DNA helicase— to unwind the hybrid and restore DNA duplex, enabling CTCF to bind and trigger enhancer looping and Myh switch. Termination of Uhrt transcription unleashed the enhancer and sensitized the hearts to stress-induced hypertrophy. The enhancer- UHRT interaction was conserved in humanhearts. Our studies thus identify a new cardioprotective eRNA, exemplifying a novel eRNA function in enhancer silencing and disease biology.
Inactive/poised enhancers were excluded from eRNA investigations due to the lack of specific chromatin markers to align with eRNA transcription profiles. The current model indicates that eRNAs are either transcriptional noises that mark activated enhancers or are capable of facilitating enhancer function by enabling enhancer looping to target promoters or by scaffolding enhancer-promoter structure. To the best of our knowledge, there has been no description of eRNAs transcribed from inactive enhancers and capable of keeping the enhancers silent. We found an unconventional eRNA that prevents enhancer-promoter interactions to regulate molecular motor gene expression and cardiac pathophysiology. The molecular motor myosin heavy chain Myh6 and Myh7 control the contraction of mammalian hearts. The relative amount of Myh6 and Myh7 changes under different pathophysiological conditions, correlating with heart function in animals and in patients with cardiomyopathy. Myh genes are regulated antithetically— with up-regulation of one isoform always accompanied by down-regulation of the other— and their ratio governs cardiac resistance to pathological hypertrophy. Hearts expressing more Myh6 show resistance to pathological stress; those expressing more Myh7 are susceptible. The new eRNA-enhancer interaction provides a mechanism that coordinates antithetical Myh changes to control cardiac contractility and resistance to stress. It also provides a therapeutic strategy to shut down Myh7, the mutations of which are the underlying causes of disease in many patients with hypertrophic or dilated cardiomyopathy.
In vitro transcription of single guide RNA (sgRNA) for mouse injection
The 20-bp spacer sequence specific to target locus was designed by deskgen
(www.deskgen.com). DNA template for sgRNA in vitro transcription was PCR-amplified from pX330 plasmid (42230, Addgene) to acquire a fused DNA template containing the T7 promoter at 5’ end, spacer sequence, and transactivating CRISPR RNA (tracrRNA) sequence at 3’ end. The PCR product was gel purified (28704, Qiagen) for in vitro transcription using
MEGAshortscript T7 Kit (AM1354, Thermo Fisher Scientific), and the RNA was purified with miRNeasy Mini Kit (217004, Qiagen) for mouse injection. 20-bp spacer sequences of sgRNAs
for eDNAfif mouse line are CAACCCTGAGCACGTGGAGC (SEQ ID NO: 7) and
GGCTTAAGAGATCCTCTTGG (SEQ ID NO: 8). Spacer sequence of sgRNA for both Uhrt knockout mouse line and Uhrt CMV knockin (Uhrt KI) is ACACTATGAGATGGACTCGC (SEQ ID NO: 9).
Developmental day determination and mouse line generation
The date of observing of a vaginal plug was set as embryonic day E0.5 by convention.
Mouse lines Sm22a- Cre, Brglflf, and Tnnt2-rtTA;Tre-cre were previously described. CD1 mice were purchased from Charles River (Strain Code: 022). The eDNAffi mouse line was generated using the CRISPR/Cas9 system by cytoplasmic injection of mouse embryos with sgRNAs,
Cas9 mRNA (L-6129, TriLink Biotechnologies) and single-stranded DNA donors containing loxP sequence (IDT, Ultramer DNA Oligonucleotides). B6D2F1 (C57BL/6 x DBA2, Charles River) female mice and CD1 mouse strains were used as embryo donors and foster mothers, respectively. Superovulated female B6D2F1 mice (4-week-old) were mated to B6D2F1 stud males to collect fertilized embryos. Zygotes were harvested and kept in M16 medium (M7292, Sigma) at 37°C for 1 hr and then transferred in M2 medium (M7167, Sigma) to inject sgRNAs, Cas9 mRNA and single- stranded DNA donors. Injected zygotes were cultured in M16 medium for 1 hr at 37 °C before transferred into the oviducts of pseudopregnant CD1 female mice. For Uhrt knockout mouse line, the Uhrt-tdT03xpolyA donor vector was generated by cloning homology arms of 2.5-3-kb on either side that is specific to the targeted endogenous locus at the 89-bp from mouse Uhrt transcriptional start site into tdT03xpolyA vector. The donor vector was then mixed with sgRNA and Cas9 mRNA for cytoplasmic injection.
Transgenic mice were derived by pronuclear injection of mouse embryos. For enhancer DNA reporter lines ( eDNA-lacZ or heDNA-lacZ ), mouse or human enhancer DNA was subcloned into pENTR/TEV/D-TOPO donor vector (K253520, Thermo Fisher Scientific), and gateway recombination was performed with hsp68-lacZ destination vector (37843, Addgene) to generate eDNA-hsp68-lacZ reporter for mouse injection. For Uhrt reporter lines ( CMV-eDNA - lacZ and CMV-heDNA-lacZ), mouse Uhrt or human UHRT cDNA was subcloned into a modified pcDNA3.l(+) vector whose CMV promoter was surrounded by two loxP sites. A fragment containing both loxP, CMV, Uhrt/UHRT cDNA and SV40 polyA terminator (pA) was subcloned into pENTR/TEV/D-TOPO donor vector and recombined into the hsp68-lacZ destination vector by gateway reaction to generate LoxP-CMV-loxP-Uhrt-pA-hsp68-lacZ or LoxP-CMV-loxP-UHRT-pA-hsp68-lacZ plasmid. These plasmids were then linearized for pronuclear injection.
LacZ reporter assay
Whole-mount X-gal staining was performed using X-gal staining kit (K146501, Thermo Fisher Scientific) following the manufacturer’s instruction. El 1.5 embryos were fixed in 4% paraformaldehyde/PBS on ice for 30 min. For adult heart tissues, 7-pm sections were acquired using a Leica cryostat and air-dried for 5 min. 4% paraformaldehyde/PBS was added on the section and fixed for 10 min at room temperature, followed by washing with PBS for 3 times. Embryos or sections were then processed for X-gal staining.
Chromosome conformation capture with quantitative PCR (3C-qPCR)
3C-qPCR was performed following the protocol described with modifications. Briefly, embryonic mouse hearts were collected and cross-linked with 1% formaldehyde immediately. Adult hearts were cut into pieces on ice and homogenized in 1 % formaldehyde immediately and incubated at room temperature for 15 min with rotation, followed by standard glycine quenching. After centrifuge (2,000 g x 5 min), pellets were resuspended in ice-cold PBS and pass the tissue strainer (250 pm) for centrifuge. The pellets were resuspended in cytoplasmic lysis buffer (10 mM HEPES, 60 mM KC1, 1 mM EDTA, 0.1% (v/v) NP40, 1 mM DTT and 1 mM PMSF, pH 7.6) and incubated on ice for 30 min and then centrifuged (2,000 g x 5 min) to collect cross-linked nuclei. Nuclei was washed with restriction enzyme buffer and resuspended in restriction enzyme buffer with 0.3% SDS and incubated with shaking at 1400 rpm overnight at 37 °C. 2x volume of restriction enzyme buffer was added to disperse the aggregations.
SDS was sequestered by adding Triton X-100 (1.8% of final concentration) and incubated with shaking at 1400 rpm for 2 hr at 37°C. Restriction enzyme was then added and incubated with shaking at 1400 rpm overnight at 37°C. In the next day, SDS was added into the buffer (1.6% of final concentration) and incubated with shaking at 1400 rpm for 30 min at 65 °C to stop the digestion. A 7-ml ligation reaction system was established with T4 DNA ligase (M0202, New England Biolabs) and DNA at the final concentration less than 1 ng/pl to favor intramolecular ligation. Ligation was performed overnight at l6°C with rotation. Reverse-cross-link was performed by adding 5 M NaCl, 1 M EDTA and Proteinase K into the ligation mix overnight at 65 °C followed by phenol/chloroform extraction and ethanol precipitation. The 3C library was amplified in 5-7 PCR cycles using Phusion polymerase (M0530, New England biolabs) and diluted for nested quantitative PCR. For Afy -eDNA and Myh6-Myh7 interactions, CSP6I (ER0211, Thermo Fisher Scientific) was used for digestion. The genomic area +1192 to -1892 from Myh6 transcriptional start site generated by CSP6I digestion was used for determining
Afy -eDNA interaction. The genomic area +1237 to +2911 from Uhrt transcriptional start site generated by CSP6I digestion was used for determining Myh6- eDNA interaction. The genomic area -147 to -1302 From Myh7 transcriptional start site generated by CSP6I digestion was used for determining Myh6-Myh7 interaction. For Myh7-eDNA, MSPI (R0106, New England Biolabs) was used for digestion. The genomic area +2263 to -1093 from Myh7 transcriptional start site generated by MSPI digestion was used for determining Myh7-eDNA interaction. The genomic area +528 to +1665 from Uhrt transcriptional start site generated by MSPI digestion was used for determining Myh7-e DNA interaction.
Chromosome Conformation Capture Carbon Copy (5C)
For 5C library preparation, 3C library was denatured at 95°C for 5 min with salmon testis DNA (Sigma) and 5C oligonucleotides in annealing buffer (20 mM Tris-acetate at pH 7.9, 50 mM potassium acetate, 10 mM magnesium acetate, and 1 mM DTT), followed by annealing for 16 h at 48 °C. Annealed primers were ligated for 1 h at 48 °C by adding 20 pL of ligation buffer (25 mM Tris-HCl at pH 7.6, 31.25 mM potassium acetate, 12.5 mM magnesium acetate, 1.25 mM NAD, 12.5 mM DTT, 0.125% Triton X-100) containing 10 units of Taq DNA ligase (NEB). Unincorporated primers were removed by MinElute Reaction Cleanup Kit (Qiagen). 5C ligation products were amplified by PCR using specific 5C primers for each looping reaction as follow.
Myh7-eDNA 5C-F, T A AT ACG ACTC ACT AT AGCCTTGTCTTCCC (SEQ ID NO: 10) Myh7-eDNA 5C-R, TATTAACCCTCACTAAAGGGAAGCCCAGA (SEQ ID NO: 11) Myh6-eDNA 5C-F, T A AT ACG ACTC ACT AT AGCCGCTCTTG AG (SEQ ID NO: 12) Myh6-eDNA 5C-R, T ATT A ACCCTC ACT A A AGGG ACCT A A ACCTC (SEQ ID NO: 13) Myh6-Myh7 5C-F, TAATACGACTCACTATAGCCCTTGAGGG (SEQ ID NO: 14)
Myh6-Myh7 5C-R, TATTAACCCTCACTAAAGGGAATGGGCTG (SEQ ID NO: 15).
Chromatin immunoprecipitation quantitative PCR (ChIP-qPCR)
Embryonic mouse hearts were collected and cross-linked immediately. For adult hearts, tissues were cut into pieces on ice, homogenized with 1 % formaldehyde immediately and incubated at room temperature for 15 min with rotation. Glycine was then added to quench the cross-link reaction and pass the tissue strainer (250 pm) (87791, Thermo Fisher Scientific). After centrifuge (2,000 g x 5 min), the pellets were resuspended in nuclei lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris, pH 8.1) for sonication to shear chromatin with Bioruptor
(Diagenode) (30 s on, 30 s off, power setting H, 30 min, twice) to generate the fragments at the
range of 100-300 bp. Sonicated chromatin was pre- cleaned by ChIP-Grade Protein G magnetic beads (9006, Cell Signaling Technologies) and immunoprecipitated with anti-Brgl Jl antibody, anti-CTCF (61311, Active motif), anti-RPA (MABE285, Millipore) or anti-Senataxin
(ABN421, Millipore) overnight. ChIP- Grade Protein G magnetic beads were added to collect the immunoprecitate complex and washed once with low salt wash buffer (0.1% SDS, 1%
Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, pH 8.1, 150 mM NaCl), high salt wash buffer (0.1% SDS, 1% Triton X- 100, 2 mM EDTA, 20 mM Tris-HCl, pH 8.1, 500 mM NaCl), LiCl wash buffer (0.25 MLiCl, 1% IGEPAL-CA630, 1% deoxycholic acid (sodium salt), 1 mM EDTA, 10 mM Tris, pH 8.1) and twice with TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0). Quantitative PCR was then performed with primers as follows. Mouse ChIP-eDNA-F, CTTCGTATCAGGGGGTGTTCC (SEQ ID NO: 16) Mouse ChIP-eDNA-R,
GAAGGGGTTGGAAGGTCACT (SEQ ID NO: 17).
Transaortic constriction (TAC)
The TAC surgery was performed on adult mice of 8-10 weeks of age and between 20 and 25 g of weight. Mice were fed with doxycycline food pellets (6 g doxycycline per kg of food; Bioserv) 7 days before the TAC operation if needed. Mice were anaesthetized with isoflurane (3%, inhalation) in an induction chamber and endotracheal intubation was performed with a 20-gauge intravenous catheter and ventilated with a mouse ventilator (Minivent, Harvard Apparatus) to maintain anesthesia with haled isoflurane (1- 2%). A longitudinal 5 mm incision of the skin was made with scissors at the midline of sternum. The chest cavity was opened by a small incision at the level of the second intercostal space 2-3 mm from the left sternal border and two chest retractors were gently inserted to spread the wound 4-5 mm in width to expose the transverse portion of the aorta. A nonabsorbable 6-0 suture is brought by one ligation aid and moved underneath the transverse aorta between the left common carotid artery and the brachiocephalic trunk to make a loose knot. For aortic constriction, 27-gauge needle was placed directly above and parallel to the aorta. The knot was then tied around the aorta and needle, and secured with a second knot. The needle was removed from the knot carefully to create a lumen with a fixed stenotic diameter. The chest cavity was then closed by 6-0 silk suture. Sham operated mice underwent similar surgical procedures, including isolation of the aorta and looping of the aorta, but without tying of the suture. The TAC was verified and qualified by the pressure gradient across the aortic constriction measured by echocardiography. Only mice with a pressure gradient 30 mmHg were used for further experiments and analysis.
Echocardiography
Transthoracic ultrasonography was performed with a GE Vivid 7 ultrasound platform (GE Health Care) equipped with a 13 MHz transducer to determine aortic pressure gradient and left ventricular function at the time points as indicated. The echocardiographer was blinded to the genotypes and surgical procedure. The isoflurane (inhalational) was adjusted to anaesthetize the mice while maintaining their heart rates at 450-550 beats per minute to minimize its effects on heart rates. The peak aortic pressure gradient was measured by continuous wave Doppler across the aortic constriction. Left ventricular function was assessed by M-mode scanning of the left ventricular chamber, standardized by two-dimensional, short-axis views of the left ventricle at the mid papillary muscle level. Left ventricular chamber size and wall thickness were measured in at least three beats from each projection and averaged. Left ventricular internal dimensions at diastole and systole (LVIDd and LVIDs, respectively) were measured. The fractional shortening (LS) of the left ventricle was defined as (1 minus LVIDs/LVIDd) x 100%. The mean LS of the left ventricle was determined by the average of LS measurements of the left ventricular contraction over five beats. P values were calculated by Student’s z-test. Error bars indicate standard error of the mean (SEM).
Rapid amplification of cDNA ends (RACE) and Uhrt cloning
The 5’ and 3’ RACE were performed using the SMARTer® RACE 573’ kit (634858, Takara Bio) following the manufacturer’s instruction. Total RNA of adult mouse hearts was extracted by TRIzol and used as template. Primers used for 5’ RACE
(GCCTAGGGGCCTGTGGCCTCTTGG; SEQ ID NO: 18) and 3’ RACE
(CC A AG AGGCC AC AGGCCCCT AGGC ; SEQ ID NO: 19). Once the 5’ and 3’ cDNA ends were reached, common primers were used to amplify full-length Uhrt transcripts, which were subcloned into pCR II TA cloning vector for sequencing. For human UHRT, total RNA of adult human hearts was purchased from Takara Bio (636532) as template. Primers used for 5’ RACE (TACCTCTCTATCCTCTTGTCCAATGACATTGCC; SEQ ID NO: 20) and 3’ RACE
(GGAGGGGGGTGGCATGACTCTTGGAAGA; SEQ ID NO: 21). Once the 5’ and 3’ cDNA ends were reached, common primers were used to amplify full-length UHRT transcripts, which were subcloned into pCR II TA cloning vector for sequencing.
Northern blot analysis and in vitro translation
Northern blot analysis was performed using the DIG Northern Starter Kit
(12039672910, Roche) with 5 ug total RNAs from adult mouse hearts. Single-stranded RNA
probe template was generated by PCR with a forward primer containing the T7 promoter. Single- stranded RNA was then in vitro transcribed with labeling mix in the kit to label the RNA with digoxigenin. For in vitro translation, full-length RNAs were transcribed and performed in vitro translation using the PURExpress Kit (E6800, New England biolabs). To label synthesized protein, Transcend-tRNA (L506A, Promega) was added into the translation reaction system.
Codon substitution frequency (PhyloCSF) and ribosome profiling (Ribo-Seq)
To measure the coding potential of mouse Uhrt and human UHRT, we used PhyloCSF software to compute the score for how likely each sequence represents a conserved coding region. We used multi-species alignment between human, mouse, rat, rhesus and dog for each gene as input for PhyloSCF. The options used for PhyloSCF are ATGStop for sequences with full ORF, and Asis for other sequences.
Ribosomal profiling was performed using mammalian TruSeq Ribo Profile
(RPHMR12126, Illumina) following the manufacture’s instruction with modifications described below. Mouse adult hearts were dissected and rinsed in ice-cold PBS with 8 mg/ml cycloheximide (2112, Cell Signaling Technologies) for 5 min. Tissues were then cut into pieces and homogenized with lysis buffer in the kit. Lysates were treated with ARTseq nuclease and the ribosome protected fragments were isolated using MicroSpin S-400 columns (27514001,
GE Healthcare). rRNAs were depleted by Ribo-Zero Gold rRNA Removal kit (MRZG126, Illumina) and ribosome-protected fragments were amplified in 9 PCR cycles using Phusion polymerase and purified by 10% Novex™ TBE-Urea Gels (EC6875BOX, Thermo Fisher Scientific). Libraries were sequenced on HiSeqSE50 platform. Reads were mapped to mmlO build of the mouse genome using TopHat2.
Quantitative reverse transcription PCR (RT-qPCR)
Total RNA was extracted by TRIzol, and reverse transcription was performed with PrimeScript™ RT reagent Kit (RR036a, Takara Bio). For strand-specific reverse transcription, Superscript™ VILO™ cDNA Synthesis Kit (11754050, Thermo Fisher Scientific) was used with specific primers (Mouse: GAGGCATCCGATCCCATTACAGA (SEQ ID NO: 22);
human: CTTCCCACTACCTCTCTATC (SEQ ID NO: 23). RT-qPCR was then performed using Power SYBR Green PCR Master Mix (4367659, Thermo Fisher Scientific) with StepOnePlus Real-time PCR System (Thermo Fisher Scientific). Transcription factor lib ( Tfllb ) was used as a normalizer. Threshold cycles and melting curve measurements were performed with ABI software. Primers for RT-qPCR of mRNA were as follows. Mouse T/IIb-F,
CTCTGTGGCGGCAGCAGCTATTT (SEQ ID NO: 24); Mouse Tfllb-R, CGAGGGTAGATCAGTCTGTAGGA (SEQ ID NO: 25); Mouse MyM-F,
ACGGTGACCATAAAGGAGGA(SEQ ID NO: 26); Mouse Myh6- R,
TGTCCTCGATCTTGTCGAAC (SEQ ID NO: 27); Mouse Myh7-F,
GCCCTTTGACCTCAAGAAAG (SEQ ID NO: 28); Mouse Myh7- R,
CTTCACAGTCACCGTCTTGC (SEQ ID NO: 29); Mouse Uhrt-R ,
TCAGTCTGTGGCCTAAGCTC (SEQ ID NO: 30); Mouse Uhrt-R,
TGAACTCGGCAAGTCCCTC (SEQ ID NO: 31); Human Tfllb-R,
GAGCAGTTCTGATCGGGCAA (SEQ ID NO: 32); Human Tfllb-R,
CGAGGGTAGATCAGTCTGTAGGA (SEQ ID NO: 33); Human MyM-F,
TTCAGGATTCTCCGTGAAGGG (SEQ ID NO: 34); Human Myh6-R,
GTCGAACTTGGGTGGGTTCT (SEQ ID NO: 35); Human Myh7- F,
GAGCTCACCTACCAGACGGA (SEQ ID NO: 36); Human Myh7-R,
CCTCATTCAAGCCCTTCGTG (SEQ ID NO: 37); Human UHRT-R,
AGTGGCCCCAAGGTGTTAAG (SEQ ID NO: 38); and Human UHRT-R,
CGCGTGCACCTATTCTCTCT (SEQ ID NO: 39).
Cytoplasmic, nuclear and chromatin-associated RNA fraction
To isolate cytosolic and nuclear RNAs from adult hearts, 10 pg hearts were
homogenized in cell fractionation buffer from PARIS kit (AM1921, Thermo Fisher Scientific), followed by centrifuge (500 g x 5 min). The supernatants (set as the cytosolic fraction) and the pellets were washed twice and lysed in cell disruption buffer on ice. TRIzol was then added into both fractions to extract RNA for RT-qPCR. To isolate chromatin-associated RNAs, nuclei pellets were first rinsed in glycerol buffer (20 mM Tris-HCl, pH 7.9, 75 mM NaCl, 0.5 mM EDTA, 0.85 mM DTT, 0.125 mM PMSF, 50% glycerol) and equal volume of cold nuclei lysis buffer (10 mM HEPES, pH 7.6, 1 mM DTT, 7.5 mM MgCh, 0.2 mM EDTA, 0.3 M NaCl, 1 M UREA, 1% NP-40) was added and incubated for 10 min on ice with vortex for 2 times for each 5-min interval. After centrifuge (12,000 g x 10 min), the supernatants were collected as nucleoplasma, and the pellets as chromatin. Pellets were washed twice with cold nuclei lysis buffer. TRIzol was then added into both fractions to extract RNA for RT-qPCR.
Cardiomyocyte isolation
Cardiomyocytes were isolated from the ventricles of adult mice using enzymatic digestion on a Langendorff system with constant retrograde perfusion and pressure
measurement. Enzyme digestion solution was made with Ca^+ (12.5 mM), collagenase type II (300 U/ml, LS004174, Worthington Biochemicals), and protease type XIV (0.04 mg/ml, P5147, Sigma) in Tyrode’s solution (133.5 mM NaCl, 4.0 mM KC1, 1.2 mM NafUPCU, 10 mM
HEPES, 1.2 mM MgS04, and 10 mM glucose; pH = 7.4, adjusted with NaOH) Ventricular myocytes were resuspended in Tyrode’s solution containing 1 mg/ml BSA and centrifuged at 46 g x 3 min, and the cardiomyocyte pellets were collected. The supernatants were further centrifuged at 46 g x 3 min to discard the pellets, and the cell suspensions were centrifuged at
300 g x 10 min. CD3l+ endothelial cells were then isolated from the pellets using mouse CD31 MicroBeads (130097418, Miltenyi). Remaining cells were collected as cardiac fibroblasts.
Histology, trichrome staining, and morphometric analysis of cardiomyocytes
Adult hearts were dissected and fixed overnight in 4% paraformaldehyde/PBS, followed by dehydration through an ethanol series, treated with xylenes, and embedded in paraffin wax overnight. 7 pm sections were then acquired using a Leica microtome. After re-hydration, the sections were stained with trichrome stain (Masson) kit (HT15-1KT, Sigma) following the manufacturer’s instruction. Fluorescein isothiocyanate-conjugated wheat germ agglutinin (WGA) was used to visualize the cell border of cardiomyocytes in paraffin sections.
Cardiomyocytes of the papillary muscle at the mid-left ventricular cavity were selected for cardiomyocyte size. The images were acquired by fluorescence microscope (Nikon Eclipse Ni) equipped with HAMAMATSU imaging system.
Strand-specific DNA-RNA immunoprecipitation with quantitative reverse transcription PCR (DRIP-RT -qPCR)
Embryonic or adult hearts were collected and digested with lysis buffer (0.5% SDS, 2 mM EDTA, 10 mM Tris-HCl, pH 8.1, 100 mM NaCl). Genomic DNA was then extracted by phenol/chloroform and precipitated by ethanol. 5 pg genomic DNA was further digested by a combination of BsoBl, Nhel, Ncol and Stul overnight at 37 °C with or without RNase H (M0297, New England Biolabs) and followed by phenol/chloroform extraction and ethanol precipitation. Digested DNA was then rinsed in 500 pl binding buffer (1% Triton X-100, 50 mM Tris-HCl, 75 mM KC1, 3 mM MgCh, 10 mM DTT) and pre-cleaned by ChIP-Grade Protein G magnetic beads. Anti-DNA-RNA hybrid S9.6 antibody (ENH001, Kerafast) was then incubated with the digested DNA overnight at 4 °C with rotation. The immunoprecipitated complex was washed once with low salt wash buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, pH 8.1, 150 mM NaCl), high salt wash buffer (0.1% SDS, 1% Triton
C-100, 2 mM EDTA, 20 mMTris- HC1, pH 8.1, 500 mM NaCl), LiCl wash buffer (0.25 M LiCl, 1% IGEPAL-CA630, 1% deoxycholic acid (sodium salt), 1 mM EDTA, 10 mM Tris, pH 8.1) and twice with TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) and then treated by proteinase K at 65 °C with agitation. DNA/RNA hybrid was extracted by phenol/chloroform, precipitated by ethanol, and digested with TURBO™ DNase (AM2238, Thermo Fisher Scientific). TRIzol was then added to extract RNA, and strand-specific reverse transcription was performed with Superscript™ VILO™ cDNA Synthesis Kit.
Western immunoblot analysis
Whole hearts were collected and homogenized in buffer A (25 mM HEPES, pH 7.0, 25 mM KC1, 5 mM MgCh, 0.05 mM EDTA, 10% glycerol, 0.1% NP-40). After lysis of heart tissues on ice for 10 min, nuclear pellets were collected and resuspended in buffer B (50 mM Tris-Hcl, pH 6.8, 2% SDS, 100 mM DTT, 10% glycerol) and lysed on ice for 30 min. After centrifuge, the supernatants were collected and boiled. The blots were reacted with antibodies for CTCF (61311, Active motif), Senataxin (ABN421, Millipore), and TFIIB (abl095l8, Abeam) followed by HRP-conjugated anti-rabbit IgG (211-032-171, Jackson ImmunoResearch Laboratories). Chemiluminescence was detected with Pierce™ ECL Plus Western Blotting Substrate (32134, Thermo Fisher Scientific) and visualized by Odyssey Image System (LI- COR).
Electrophoretic mobility shift assay (EMSA)
EMSA was performed by using LightShift™ Chemiluminescent RNA EMSA Kit (20158, Thermo Fisher Scientific) following the manufacture’s instruction. For RNA-DNA hybrid probe, a DNA oligo containing the T7 promoter (lowercase) and a CTCF binding sequence (uppercase) from the mouse eDNA locus with CTCF consensus binding motif (underlined) and surrounding sequences
(ttaatacgactcactataggTCAGCCACACAACAGAGGGGGTGGCACAGCTCTTGGGA (SEQ ID NO: 40)), as well as its reverse complementary DNA oligo, were synthesized (Thermo Fisher Scientific) and annealed for In vitro transcription with MEGAshortscript T7 Kit. Given the RNA product contains two more guanine nucleotides (lowercase) at 5’ end by T7 RNA polymerase (ggTCAGCCACACAACAGAGGGGGTGGCACAGCTCTTGGGA (SEQ ID NO: 41)), its 5’ biotin-labeled reverse complementary DNA oligo was introduced 2 more cytosine nucleotides at 3’ end to acquire a blunt-ended probe. For double-stranded DNA probe, a DNA oligo with the same sequence as RNA was synthesized and annealed with the biotin-labeled
reverse complementary DNA oligo. A mutant probe was synthesized with a mutated CTCF consensus binding motif (ggTCAGCCACACAACAGAAAAAATGGCACAGCTCTTGGGA (SEQ ID NO: 42)). All thesebiotin-labelled probes were incubated with 200 ng CTCF recombinant proteins (H00010664-P01, Abnova) in 20 mΐ IX binding buffer (10 mM HEPES- KOH, pH 7.3, 10 mM NaCl, 1 mM MgCh, 1 mM DTT) with 5 pg tRNA carrier at room temperature for 30 min. The reactions were then loaded onto 6% Novex TBE gels
(EC6265BOX, Thermo Fisher Scientific) and transferred to Bright Star- Plus positive charged membrane (AM10110, Thermo Fisher Scientific). Biotin-labeled probes were detected by Chemiluminescent Nucleic Acid Detection Module (89880, Thermo Fisher Scientific) using Odyssey Imaging System (LI-COR).
Amylose pull-down
20 pmol purified Maltose-binding protein (MBP) or MBP-Brgl D1D2 protein was incubated with Amylose Magnetic Beads (E8035, New England Biolabs) for 2 hr at 4 °C with rotation. After washed three times with MBP column binding buffer (10 mM Tris-HCl, pH7.5, 150 mM NaCl, 1 mM DTT, 0.1% Triton X-100), the beads were resuspended in 500 pl binding buffer. 20 pmol of 200-bp single stranded DNA (ssDNA) probe containing the CTCF binding motif in the eDNA (chrl4:55, 004, 492-55, 004, 691, mmlO), single stranded RNA (ssRNA) probe with the same sequence as the ssDNA, and DNA-RNA hybrid probe annealed from the ssRNA and its complementary DNA were incubated with the beads for 2 hr at 4 °C with rotation and washed three times with low salt wash buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, pH 8.1, 150 mM NaCl) and three times with high salt wash buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, pH 8.1, 500 mM NaCl). The beads were then eluted with elution buffer (10 mM Tris-HCl, pH7.5, 150 mM NaCl, 1 mM DTT, 0.1% Triton X-100, 10 mM maltose). Proteinase K was incubated with the elution buffer at 65 °C for 1 hr and the probes were purified by miRNeasy Mini Kit (217004, Qiagen).
Reverse transcription was performed for ssRNA samples with Superscript™ VILO™ Master Mix (11755050, Thermo Fisher Scientific). All samples were then performed with qPCR analysis.
Motif prediction
MEME Suite was used for motif discovery as described. Briefly, all sequences from different species were trimmed to the same size and subjected to MEME-ChIP using
JASPAR_CORE_2009.MEME motif database. CentriMo from MEME Suite was used to
calculate different motifs distribution. FindMotif tools from HOMER were used to confirm the results from MEME Suite.
RNA secondary structural prediction and DNA homology score
To predict the secondary structure for mouse Uhrt and human UHRT, their sequences were submitted on Vienna RNA fold web server (http://rna.tbi.univie.ac.at/cgi- bin/RNAfold.cgi) with calculation of minimum free energy. To score the sequence homology of mouse and human eDNA, as well as mouse Uhrt and human UHRT, respective sequences were submitted on T-coffee for analysis (https://www.ebi.ac.uk/Tools/msa/tcoffee/).
Human heart tissue analysis
Human heart samples were obtained from Duke Human Heart Repository
(https://sites.duke.edu/dhhr/) and as described. The study of human tissues is in compliance with the regulation of Duke and Indiana University. Human tissues were processed for RT- qPCR. Other human tissue RNAs were purchased from Takara Bio.
Statistical analysis
Statistical significances were calculated using GraphPad Prism 6 (GraphPad Software, La Jolla, CA) or SPSS 25 (IBM, Armonk, New York). Differences between two groups were compared by student’ s ί-test, and differences among multiple groups were compared by one way ANOVA analysis of variance. All significance levels were computed as 2-tailed and a value of P<0.05 was considered statistically significant.
EXAMPLE 2
By surveying cardiac chromatin modifications in ENCODE database, we identified a genomic region 7.5-kb upstream of the mouse Myh7 gene transcriptional start site that spanned a highly conserved 4-kb genomic region (Fig. 1). In embryonic day 14.5 (E14.5) hearts, this genomic region was enriched with chromatin signatures of active enhancers— acetylated histone 3 lysine 27 (H3K27ac) and monomethylated histone 3 lysine 4 (H3K4mel) with low levels of trimethylated histone 3 lysine 4 (H3K4me3)— and the boundaries of this genomic region were well-demarcated by levels of H3K27ac and H3K4mel (Fig. 1). Also, this genomic region contained consensus binding motifs of transcriptional factor MEF2A and GATA4 that are critical for heart development, and the motifs were conserved between mouse and human. Accordingly, we postulated this 4-kb DNA functioned as a cardiac-specific enhancer and
referred to it as eDNA. To test whether eDNA was an enhancer, we fused the eDNA fragment to basal heat shock promoter hsp68 to drive the expression of lacZ reporter gene in transgenic mice. We found that eDNA enhanced lacZ expression only in the heart but not other tissues of El 1.5 embryos, indicating a cardiac-specific enhancer activity. DNAse-I footprinting studies (ENCODE database) revealed hypersensitivity sites in eDNA region primarily in the heart, consistent with its cardiac-specific activity. The role of eDNA as a cardiac-specific enhancer was collectively supported by chromatin signatures, in vivo reporter studies, DNAse-I footprinting, as well as the ability of eDNA to undergo looping to its target promoters, and its bidirectional transcription into cardiac-specific noncoding RNAs.
Given that eDNA was located upstream of Myh genes, we asked whether eDNA targeted Myh genes. We first examined Myh expression in mouse hearts lacking eDNA. To generate eDNA knockout mice, we used Clustered Regularly Interspaced Short Palindromic
Repeats (CRISPR) technology to introduce two loxP sites flanking eDNA (eDNAf/f). eDNA^ alleles were then deleted in cardiomyocytes by Cre recombinase driven by Sm22a promoter, which acted in fetal cardiomyocytes by E8.5 and deleted eDNA efficiently. In E13.5 eDNA- null hearts ( Sm22o.Cre ; e DNAN) , Myh7 was decreased by 60%, Myh6 increased 62%, and Myhl/6 ratio reduced 75% (Fig. 2), suggesting that eDNA is active in fetal hearts to maintain high Myh7 and low Myh6 expression. We then tested whether eDNA was required for pathological Myh switch in stressed adult hearts. We crossed eDNAf/f with the driver Tnnt2- rtTA;TRE-Cre to enable doxycycline-inducible, cardiomyocyte-specific deletion of eDNA in adult hearts, with Cre recombinase driven by cardiac-specific troponin ( Tnnt2 ) promoter and tetracycline response element ( TRE ). In this mouse line (Tnnt2-rtTA;TRE-Cre;eDNAf/f), doxycycline treatment effectively deleted eDNA within 7 days. In normal adult hearts, eDNA deletion had no impact on Myh6 or Myh7 levels (Fig. 3), suggesting the lack of eDNA activity in mature hearts. However, when the hearts were pressure-overloaded by transaortic constriction (TAC), eDNA deletion prevented stress-induced Myh6-to-Myh7 switch and restored Myh isoform expression to pre-stress levels (Fig. 4), indicating that eDNA is active in stressed hearts to trigger pathological Myh switch, a return to fetal state. Overall, the results suggest that eDNA is functionally active in fetal and stressed hearts to control Myh isoform expression.
We then tested whether eDNA could form a three-dimensional chromatin loop, like an enhancer, to its target Myh7 and Myh6 promoters (Fig. 1). We conducted chromosome conformation capture with quantitative PCR (3C-qPCR) to determine the looping between eDNA and Myh promoters. In fetal and stressed adult hearts when eDNA was essential for Myh expression (Fig. 2 and 4), eDNA was capable of looping to Myh6 and Myh7 proximal promoters,
which were previously shown to control Myh isoform expression. Conversely, eDNA displayed much diminished looping to Myh loci in normal adult hearts, consistent with its lack of activity on Myh expression in mature hearts (Fig. 3). The specificity of 3C-qPCR assays was validated by sequencing of the PCR products. Remarkably, Myh6 and Myh7 promoters, although 28-kb apart, were in close proximity in the three-dimensional chromatin space, providing a structural basis for their coordinated changes. Collectively, the results of eDNA reporter, knockout, and chromatin looping studies indicate that eDNA acts as an enhancer to control Myh promoters in fetal and stressed hearts. Next, we asked whether eDNA was essential for hypertrophy, given that Myh isoform ratio controls cardiac resistance to pathological stress. Indeed, in eDNA-null hearts (Tnnt2-rtTA;TRE-Cre ;eDNAf/f), TAC-induced hypertrophy was reduced by 55%, with the decline of left ventricular fractional shortening reduced by 42%. These studies demonstrated a pathogenic role of eDNA as an enhancer in stress-induced Myh switch and hypertrophy.
We next asked if Brgl, a pro-hypertrophic chromatin remodeler that triggered Myh switch, was essential for eDNA looping to Myh loci. Chromatin immunoprecipitation (ChIP) of heart tissues showed that Brgl was enriched on eDNA in fetal hearts (E13.5), whereas its occupancy of eDNA was reduced by 35% in normal adult hearts (Fig. 5). Upon cardiac stress by TAC, Brgl was activated and re-accumulated on eDNA with 87% increase of ChIP signals, restoring the occupancy to fetal levels (Fig. 5). The results suggested that Brgl bound to eDNA to trigger eDNA- Myh looping and Myh switch. The functional requirement of Brgl was revealed by the disruption of eDNA-Myh looping in fetal or stressed hearts lacking myocardial Brgl (Sm22a-Cre ;Brglfl/fl or Tnnl2-rlTA;TRE- Cre ; Brg 1I/I) (Fig. 6 and 7). Brgl and eDNA knockout studies showed that both Brgl and eDNA were essential for eDNA-Myh looping to trigger Myh switch in response to pathophysiological stimuli (Figs. 2, 3, 4). The formation or disruption of a Brg 1 -eDNA-Myh6-Myh7 three-dimensional complex provides a critical spatial mechanism to orchestrate antithetical Myh changes.
We asked whether eDNA activity was regulated by its transcription into RNAs. By 5’ and 3’ rapid amplification of eDNA ends (RACE) analysis of adult mouse hearts, we identified two RNA species transcribed from the 4-kb eDNA region. A 3.3-kb RNA was transcribed in an opposite direction From Myh7 gene, and the other 0.75-kb RNA ( Antisense-eRNA ) in Myh7 direction. In adult hearts, both RNA species were detectable by northern blot analysis, confirming their length identified by RACE.
We then focused on the 3.3-kb RNA to study its pathophysiological role and named this eRNA Uheart (abbreviated as Uhrt) for Upstream Myosin Heavy Chain RNA Transcript. Strand- specific RT-qPCR showed Uhrt levels were minimal in embryonic hearts (Fig. 8), when
eDNA was enriched with chromatin signatures of activity (H3K27ac and H3K4ml) and underwent looping to Myh promoters to activate Myh.7 isoform (Fig. 1 and 2). Conversely, as Uhrt expression increased from fetal to neonatal and to adult phase (Fig. 8), chromatin signatures of eDNA activity (H3K4ml and H3K27ac) diminished, along with physiological Myh switch and reduced eDNA-Myh looping. Remarkably, Uhrt increased sharply within the first 24 hours after birth, while Myh7 levels dropped precipitously in the same period, indicating an abrupt neonatal cessation of eDNA-Myh looping. Therefore, Uhrt can be transcribed from eDNA only when eDNA is functionally silent with minimal looping to its target Myh promoters. This contrasts sharply with known eRNAs, whose levels of expression track activities of enhancers and promoters. The Uhrt-eDNA interaction suggests a new mode of eRNA function.
Uhrt was expressed specifically in the heart: its levels were undetectable or minimal in non-cardiac tissues. In adult hearts Uhrt was transcribed in cardiomyocytes but not endothelial cells or fibroblasts and was highly enriched in the nuclei, revealed by cell sorting and nuclear/cytoplasmic fractionation studies. Codon substitution frequency suggested a highly negative translation score of Uhrt (-1148), which was further confirmed by in vitro transcription and translation of Uhrt that found no peptide translation. Ribosome profiling of adult hearts showed minimal ribosome binding to Uhrt, consistent with Uhrt being a nuclear, noncoding RNA. These observations together demonstrated that Uhrt is a cardiomyocyte-specific enhancer RNA transcribed from a functionally inactive enhancer in mature hearts.
We predicted that Uhrt transcription would be compromised in TAC-stressed hearts where eDNA displayed enhancer activity and Myh looping. Indeed, strand-specific RT-qPCR of heart tissues showed that Uhrt expression was reduced by 62% within 2 days after TAC, and its levels remained reduced by 62-78% in 7-56 days after TAC (Fig. 9), suggesting a role of Uhrt in pathological hypertrophy. To assess its in vivo function, we used CRISPR to insert upstream of Uhrt a red fluorescent protein variant ( tdTomato ) followed by 3 repeats of polyA
transcription termination signals ( tdT03xpolyA ) to stop Uhrt, transcription. This genetic knockout was specific to Uhrt since it didn’t affect Antisense-eRNA transcription from the same eDNA nor did it alter eDNA-dependent Myh6 and Myh7 expression in E13.5 hearts that had minimal Uhrt transcription. The Uhrt- null mice lived to adulthood and appeared grossly normal with normal weight, body size, and left ventricular fractional shortening. The lack of Uhrt in adult hearts, however, accelerated cardiac functional decline caused by TAC. Within 2 weeks of TAC, factional shortening of Uhrt- null hearts decreased from 40% to 18%, whereas the control showed a decline from 40% to 30%, showing a 40% excess of functional decline in the absence of Uhrt. After 12 weeks of TAC, Uhn-nuU mice had a mortality of 90%, while control mice
25%, revealing a 3.6-fold excess of mortality. Also, Uhrt- null hearts exhibited 114-125% increase of hypertrophy by ventricle/body- weight ratio and by cardiomyocyte cross-sectional area, compared to 71-77% increase of hypertrophy in control hearts (Fig. 10 and 11), indicating 1.6-fold excess hypertrophy. Uhrt- null hearts are therefore susceptible to stress-induced pathology, suggesting a cardioprotective role of Uhrt, opposite to that of eDNA.
To address whether Uhrt transcription blocked eDNA activity in the heart, we generated a stable transgenic reporter mouse line in which Uhrt transcription from eDNA was driven by a loxP-floxed CMV promoter, followed by hsp68 basal promoter fused to lacZ reporter ( CMV11"' - eDNA-hsp68-lacZ, abbreviated as CMV-eDNA-lacZ) (Fig. 12). The CMV promoter, whose activity wasn’t inhibited by TAC, allowed Uhrt expression under stress conditions to rescue Uhrt levels in TAC-stressed hearts. Conversely, transgenic Uhrt expression could be shut down by Sm22a-Cre that removed the floxed CMV promoter but maintained eDNA in Sm22a- Cre ; CM V]ox - eDNA - hsp68 - lacZ line (abbreviated as eDNA-lacZ ). In TAC-stressed hearts, where endogenous Uhrt was repressed, CMV-eDNA-lacZ transcribed Uhrt 3.2-fold higher than eDNA- lacZ mice (Fig. 12), showing a rescue of Uhrt levels by CMV promoter. The CMV-eDNA-lacZ line with high Uhrt expression displayed low eDNA activity on hsp68 promoter, whereas eDNA-lacZ line that had 3-fold less Uhrt showed 6.4-fold stronger eDNA activity (Fig. 13). The rescue of Uhrt by CMV promoter was therefore sufficient to eliminate TAC-induced eDNA activity (Fig. 13). Conversely, in sham-operated or normal adult hearts, which had abundant endogenous Uhrt and minimal Brgl that’s required for eDNA activity, both transgenic reporter lines showed low eDNA activity (Fig. 13). These in vivo reporter studies indicate that Uhrt inhibits eDNA activity on target promoters.
We then set out to find how Uhrt inhibited eDNA activity. We postulated that Uhrt might hybridize with its eDNA template to form RNA-DNA hybrid duplex with a unpaired, non-template strand of eDNA— a triplex R loop structure that might prohibit eDNA looping. To test this model, we first examined the distribution of nuclear Uhrt between chromatin and nucleoplasm. By strand-specific RT-qPCR and chromatin-nucleoplasm fractionation, we found that 25% of Uhrt transcripts existed in the nucleoplasm (nuclei depleted of chromatin), and 75% of Uhrt were associated with chromatin, indicating that most Uhrt was tethered to chromatin. To test whether Uhrt bound to eDNA to form RNA-DNA hybrid, we used the antibody S9.6 that specifically detects RNA-DNA hybrid duplex to conduct DNA-RNA hybrid
immunoprecipitation (DRIP) followed by strand-specific RT-qPCR to quantitate Uhrt. In E13.5 hearts, we found no enrichment of Uhrt in the RNA-DNA hybrid, consistent with low Uhrt levels in embryos (Fig. 8). Conversely, in mature adult hearts, DRIP-qPCR showed that Uhrt
was enriched by 3.7-4.2-fold in the RNA-DNA hybrid complex, the formation of which, however, was suppressed by TAC. The specificity of RNA-DNA hybrid was confirmed by Rnase H, which specifically degrades RNA-DNA hybrid. Therefore, Uhrt predominantly existed in RNA-DNA form tethered to eDNA.
These results were further supported by the guanine over cytosine (GC) skew score of Uhrt, which measures (G-C)/(G+C) ratio in RNA to predict RNA-DNA hybrid formation. The 5’ l.l-kb of Uhrt, which had the lowest score of GC skew score (0.029), exhibited the lowest RNA-DNA enrichment by DRIP, whereas the mid- third l.l-kb and 3’-third l.l-kb fragments of Uhrt, which had much higher GC skew score (0.16), displayed the highest DRIP enrichment. Therefore, the 3’ 2.2-kb fragment of Uhrt was tethered to eDNA as an RNA-DNA hybrid duplex. We then tested the presence of an unpaired, non-template strand eDNA in the R-loop triplex. Single-strand DNAs (ssDNAs) are known to be coated by a ssDNA-specific binding protein— replication protein A (RPA). By chromatin-IP using antibodies against RPA coupled with qPCR, we found that RPA-eDNA complex increased by 171% in adult hearts with abundant Uhrt-eDNA hybrid, compared to that of E13.5 hearts that had minimal Uhrt-e DNA hybrid. In TAC-stressed hearts, as expected, the RPA-eDNA complex was reduced by 42%, along with a reduction of Uhrt-eDNA hybrid. Overall, these observations demonstrated that Uhrt hybridizes with eDNA to form a triplex R loop structure, consisting of a Uhrt-eDNA hybrid duplex with an unpaired strand of eDNA.
We next asked whether Brgl or its associated factor could bind to Uhrt-eDNA hybrid. We first investigated the role in eDNA looping of CCCTC-binding factor (CTCF), a regulator protein essential for chromatin looping and three-dimensional structure formation. CTCF contains 11 highly conserved zinc finger domains, capable of binding to specific double- stranded DNA sequence to cause chromatin looping. We found a CTCF consensus binding motif (AGGGGGTGG; SEQ ID NO: 43) on eDNA near the conserved MEF2A and GATA4 sites. ChIP analysis of heart tissues verified CTCF was enriched on eDNA region in E13.5 hearts, whereas its occupancy on eDNA dropped by 42% in normal adult hearts, but was increased by 81% and restored to fetal levels by TAC, while CTCF protein levels remained unchanged. Such dynamic CTCF binding to eDNA coincided with and accounted for the ability of eDNA to loop to Myh loci in fetal and stressed hearts. Interestingly, the CTCF binding site on eDNA was guanine -rich with a GC skew score of 0.66, which was highly prone to form RNA- DNA hybrid, and indeed, this site resided within the Uhrt-eDNA hybrid zone. Given that CTCF contains zinc finger domains that bind to DNA duplex, we hypothesized that CTCF binding to eDNA was disabled by the formation of Uhrt-eDNA hybrid across the binding site. Using
electrophoretic mobility shift assay (EMSA) and probes of CTCF binding site sequence, we found that CTCF proteins were capable of binding to the double- stranded eDNA binding site, but failed to bind Uhrt-eDNA duplex in this binding site. Mutation of the double-stranded eDNA probe (AGGGGGTGG (SEQ ID NO: 43) to AAAAAATGG (SEQ ID NO: 44)) disrupted CTCF binding in EMSA, indicating a specificity of the binding site. The in vivo ChIP and in vitro EMSA studies, together, revealed the ability of Uhrt to inhibit CTCF binding to eDNA, thus preventing eDNA looping.
Given that Brgl was essential for eDNA looping, we tested whether CTCF was recruited by Brgl to eDNA to trigger the looping. Indeed, loss of Brgl abolished CTCF binding to eDNA in TAC-stressed hearts of Tnnt2-rtTA;TRE-Cre;Brglf/f mice (Fig. 14). The ability of CTCF to bind eDNA duplex but not Uhrt-eDNA hybrid brought the next question: how did Brgl resolve Uhrt-eDNA hybrid and restore eDNA duplex to enable CTCF binding? DRIP- qPCR analysis of heart tissues showed that in the absence of myocardial Brgl ( Tnnt2 - rtTA;TRE-Cre;Brglf/f), Uhrt-e DNA hybrid was restored by 60% in TAC-stressed hearts (Fig. 15), suggesting that Brgl was essential for disrupting Uhrt-eDNA hybrid. The persistence of Uhrt-eDNA hybrid in Brgl-null hearts, however, wasn’t caused by increased Uhrt levels in stressed Brgl-null hearts. Therefore, in stressed hearts, there were two factors that contributed to the resolution of Uhrt-eDNA hybrid structure— the reduction of Uhrt transcription and the activation of Brgl to resolve that structure.
To test how Brgl could disrupt Uhrt-eDNA hybrid, we first used amylose pulldown experiments to examine Brgl’s binding to the following probes: ssDNA (CTCF binding site), ssRNA (Uhrt sequence at CTCF binding site), and Uhrt -eDNA hybrid (CTCF binding site). We found that Brgl couldn’t bind ssDNA, bound ssRNA modestly, but bound Uhrt-e DNA hybrid strongly (Fig. 16). Brgl, unlike CTCF, was capable of binding Uhrt-eDNA hybrid. To further determine how Brgl resolved Uhrt-eDNA hybrid, we examined Brgl’s interaction with Senataxin (Setx), a major RNA-DNA hybrid helicase that’ s known to resolve RNA-DNA hybrid in vivo. By ChIP analysis, we found that Setx occupied eDNA in TAC-stressed hearts when Brgl was up-regulated, with 3 -fold enrichment compared to normal hearts that had low Brgl expression (Fig. 17). Such stress-induced Setx binding to eDNA was abolished by myocardial Brgl knockout ( Tnnt2-rt TL ; TRE-Cre ;Brg ll/f) in which Setx proteins levels remained unchanged (Fig. 17). Therefore, Brgl was essential for recruiting Setx to eDNA. This recruitment was further supported by ChIP-on-ChIP analyses that showed co-occupancy of Brgl and Setx on eDNA of TAC-stressed hearts (Fig. 18). Given the known role of Setx helicase in resolving enhancer RNA-DNA hybrids, these findings indicate that Brgl recruits
Setx to Uhrt-eDNA site to unwind the RNA-DNA hybrid, releasing eDNA strands to form DNA duplex, to enable CTCF binding and the trigger of eDNA-Afyri looping and Myh isoform switch.
To determine the conservation of eDNA and Uhrt in human hearts, we searched ENCODE cardiac chromatin modifications and VISTA enhancer database. In human fetal hearts, 6-kb upstream of MYH7 transcriptional start site existed a 5.5-kb genomic region that was highly enriched with H3K27ac, a chromatin signature of active enhancers. Sequence alignment showed 50% of homology between this 5.5-kb fragment (termed heDNA) and mouse eDNA. To test heDNA enhancer activity, we generated a mouse line transgenic for heDNA-hsp68-lacZ reporter. The heDNA, indeed, displayed cardiac-specific enhancer activity on hsp68 promoter in mouse embryos, and such cardiac specificity was consistent with human chromatin studies that showed higher H3K27ac signals in hearts but minimal H3K27ac in aortic tissues. Overall, the results suggest that heDNA is the human homolog of mouse eDNA. We next tested whether heDNA was transcribed into an Uhrt homolog by 5’ and 3’ RACE analysis of adult human hearts. We identified a single 2.3-kb RNA species transcribed from heDNA in an opposite direction from MYH7 gene, with 57% sequence homology and similar predicted secondary structure to mouse Uhrt. Strand-specific RT-qPCR showed that this human RNA was predominantly expressed in the heart. This human RNA had highly negative coding potential score (-993), and showed no translation of peptides or proteins by in vitro translation assay, consistent of its being a noncoding RNA. These observations together suggest that this enhancer RNA is human UHRT.
To test heDNA- UHRT interaction, we generated a stable transgenic mouse reporter line in which the transcription of human UHRT from heDNA was driven by a floxed CMV promoter, followed by hsp68 basal promoter fused to lacZ reporter ( CMV11"' -heDNA -hsp68-lacZ, abbreviated as CMV-heDNA-lacZ ). To stop UHRT transcription, we used Sm22a-Cre to delete floxed CMV promoter in cardiomyocytes of Sm22a-Cre CMMlox-heDNA-hsp68-lacZ ( heDNA - lacZ) mice (Fig. 19). We found that lacZ activity was induced by TAC (2.3-fold) in heDNA- lacZ hearts (without UHRT expression) but was eliminated by UHRT expression in CMV- heDNA-lacZ eart?, (Fig. 20). In sham hearts, lacZ activity was minimal in either reporter mice (Fig. 20) due to the lack in normal adult hearts of Brgl required for enhancer activity. The in vivo interaction of human eDNA and UHRT in mice indicates a mechanistic conservation of eDNA -Uhrt interaction in humans.
We then asked whether human heDNA and UHRT showed antithetical changes in human hearts, like their mouse homologs. Chromatin studies of human tissues (VISTA database) showed that heDNA contained high H3K27ac signals in the hearts with dilated
cardiomyopathy compared to normal hearts, suggesting an increased heDNA enhancer activity in diseased state, similar to that of mouse eDNA in TAC-stressed hearts. Also, human UHRT expression was reduced by 52% in failing human hearts that had hypertrophic or dilated cardiomyopathy, accompanied by antithetical MYH isoform changes (92% increase of MYH7 and 85% reduction of MYH6) (Fig. 21). Such inverse correlation of heDNA activity and UHRT levels suggests an evolutionary conservation of eDNA-Uhrt interaction pertinent to the pathogenesis of human heart failure.
Uhn -eDNA interaction controls the assembly of eD N A-Myh6-Myh 7 complex to direct antithetical Myh regulation in development and in disease to govern cardiac contractility and resistance to pathological stress (Fig. 22). Those three DNA regulatory elements (eDNA, Myh6, Myh7 promoters) are brought together in the three-dimensional space by Brgl and CTCF to coordinate Myh regulation and cardiac pathophysiology, a process opposed by Uhrt (Fig. 22). Uhrt, like many eRNAs, arises from a bidirectionally transcribed enhancer, doesn’t splice into isoforms, and maintains enhancer-encoded nucleotides for its function. These eRNA features contrast with the known enhancer-associated long noncoding RNAs (lncRNAs) expressed in the heart or fibroblasts for heart development and fibrosis. In those lncRNAs ( Upperhand ,
WISPER, CARMEN ), the enhancer-encoded nucleotides are deleted from primary RNAs, which splice into different isoforms. Uhrt thus provides a unique example of a cardiomyocyte- specific and protective eRNA, distinct from those and other lncRNAs that affect heart development or function. Using Uhrt to silence pathogenic eDNA may provide therapeutic benefits to heart failure patients. Also, identifying cardiac-specific factors essential for eDNA-Myh looping will have translational values, especially for patients with Myh7 mutations causing hypertrophic or dilated cardiomyopathy. Inhibition of such factors by small molecules can disrupt eDNA- Myh looping and shut down mutant Myh7 expression to prevent disease progression.
Transcription of eRNAs is thought to reflect enhancer activation, with many eRNAs known to facilitate interactions between enhancers and promoters. However, Uhrt provides a counter example— it is transcribed by an inactive enhancer and physically blocks enhancer activation and looping toward target promoters. Transcription of eRNAs could therefore mark an inactive, rather than active, state of the enhancer. This unusual function of Uhrt reveals a new enhancer- eRNA interface in transcriptional circuitry and uncovers a new mechanism of enhancer activation, mediated by a chromatin remodeler Brgl that recruits an RNA-DNA helicase Setx to unwind eDNA -Uhrt and enable looping. Such Brgl- and U/7/7-conlrolled enhancer activation is particularly salient in the disease context, as their dynamic interactions orchestrate different phases of cardiac pathophysiology. The eDNA- Uhrt mode of interaction cautions the use of
enhancer transcription as a marker of enhancer activation and emphasizes the importance of studying the transcription of functionally silent enhancers.
Claims
1. A method of inhibiting assembly of an enhancer DNA-Myh6 promoter- Myh7 promoter complex in a cardiomyocyte cell, comprising:
enhancing binding of Uhrt to said enhancer, wherein said enhancer comprises a sequence having at least 95% sequence identity with SEQ ID NO: 3.
2. The method of claim 1, wherein the Uhrt comprises an RNA sequence having at least 95% sequence identity to SEQ ID NO: 2.
3. The method of claim 2, wherein the Uhrt RNA comprises SEQ ID NO: 2 and said enhancer comprises SEQ ID NO: 3.
4. The method of claim 1, wherein the Uhrt comprises an RNA sequence having at least 95% sequence identity to SEQ ID NO: 1.
5. The method of claim 4, wherein the Uhrt RNA comprises SEQ ID NO: 1 and said enhancer comprises SEQ ID NO: 3.
6. The method of claim 1 further comprising a step of decreasing Brgl activity.
7. The method of claim 6, wherein the Brgl activity is decreased by introducing an interfering RNA into said cardiomyocyte cell to inhibit translation of Brgl.
8. A nucleic acid comprising an RNA sequence consisting of SEQ ID NO: 1, or its DNA equivalent therof, coupled to a marker.
9. A nucleic acid comprising an RNA sequence consisting of SEQ ID NO: 2, or its DNA equivalent thereof, coupled to a marker.
10. The nucleic acid of claim 8 or 9 wherein the marker is selected from the group consisting of a fluorescent tag, an antibody, and a small peptide.
11. A method of measuring Uhrt in a patient biological sample comprising:
providing an RNA sample recovered from said patient
contacting the RNA sample with a nucleic acid that specifically binds to Uhrt; and
detecting the Uhrt in the patient sample.
12. The method of claim 11, wherein Uhrt is detected by quantitative reverse transcription PCR wherein an amplicon is only produced in the presence of Uhrt.
13. The method of claim 12, wherein said RNA sample is reverse transcribed into cDNA and said cDNA is contacted with a pair of PCR primers wherein said primers each comprise a sequence of at least 10 nucleotides that each have at least 95% sequence identity to a corresponding DNA equivalent of SEQ ID NO: 2 or a compliment thereof.
14. The method of claim 11, wherein said nucleic acid comprises a sequence of at least 10 nucleotides that has at least 95% sequence identity to a corresponding complementary portion of SEQ ID NO: 2 or its corresponding DNA equivalent or compliment thereof, wherein said nucleic acid is labeled with a detectable marker.
15. The method of claim 14 wherein the detectable marker is selected from the group consisting of a fluorophore and a radioisotope and a fluorophore.
16. A method of identifying a patient at risk for hypertrophy comprising:
providing a sample of RNA recovered from cardiomyocytes from the patient; analyzing the levels of Uhrt RNA; and
comparing the Uhrt RNA levels in the patient cardiomyocytes to a reference sample, wherein a low level of Uhrt RNA compared to the reference sample identifies a patient at risk for hypertrophy.
17. A method of treating a patient at risk for heart disease comprising:
administering an RNA sequence to the patient, wherein the RNA sequence comprises a sequence having at least 95% sequence identity to SEQ ID NO: 2 or its corresponding DNA equivalent thereof.
18. The method of claim 17, wherein the heart disease is hypertrophy.
19. The method of claim 17, further comprising decreasing Brgl activity.
20. The method of claim 19, wherein the Brgl activity is decreased by administering an interfering RNA to silence the translation of Brgl.
21. The method of claim 17, further comprising analyzing Uhrt levels after the step of administering the RNA.
22. A method of switching a cardiomyocyte from a stressed-state to a non-stressed state comprising:
decreasing Brgl activity, and
increasing Uhrt activity, wherein the cardiomyocyte is switched from a stressed- state to a non-stressed state.
23. The method of claim 22, wherein decreasing the Brgl activity comprises providing a Brgl interfering RNA.
24. The method of claim 22, wherein the increasing of Uhrt activity comprises providing a Uhrt RNA.
25. A method of detecting a patient at risk for hypertrophy, the method comprising:
providing a test sample comprising RNA from the patient;
contacting the test sample with a reverse transcriptase primer specific for an enhancer RNA comprising the sequence for Uhrt;
reverse transcribing the enhancer RNA to produce a corresponding test cDNA; contacting the test cDNA with PCR primers specific for Uhrt RNA wherein said primers comprise a sequence of at least 10 nucleotides having at least a 90% sequence identity to a corresponding complementary portion of SEQ ID NO: 2;
conducting a PCR reaction on the test cDNA, and detecting the resulting amplified product;
determining the concentration of the enhancer RNA in the test sample based on the detected test cDNA; and
obtaining a reference concentration of the corresponding enhancer RNA; wherein a detected lower level of the enhancer RNA in the test sample as compared to the reference concentration level of the enhancer RNA indicates hypertrophy.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US17/283,845 US12286626B2 (en) | 2018-10-19 | 2019-10-18 | Myocardial enhancer RNA and methods of use |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201862747732P | 2018-10-19 | 2018-10-19 | |
| US62/747,732 | 2018-10-19 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2020081972A1 true WO2020081972A1 (en) | 2020-04-23 |
Family
ID=70284121
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2019/056995 Ceased WO2020081972A1 (en) | 2018-10-19 | 2019-10-18 | Myocardial enhancer rna and methods of use |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US12286626B2 (en) |
| WO (1) | WO2020081972A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022120133A1 (en) * | 2020-12-04 | 2022-06-09 | Northwestern University | Material and methods for modifying expression of myosin heavy chain genes |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2025245481A1 (en) * | 2024-05-24 | 2025-11-27 | The Regents Of The University Of California | Methods and materials for treating cardiac conditions |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050214835A1 (en) * | 1997-01-30 | 2005-09-29 | The Regents Of The University Of Colorado | Diagnosis and treatment of myocardial failure |
| US20160114004A1 (en) * | 2014-10-24 | 2016-04-28 | Indiana University Research & Technology Corporation | Role of a cluster of long noncoding rna transcripts in protecting the heart from pathological hypertrophy |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3093351B1 (en) * | 2008-07-09 | 2018-04-18 | Celera Corporation | Genetic polymorphisms associated with cardiovascular diseases, methods of detection and uses thereof |
-
2019
- 2019-10-18 WO PCT/US2019/056995 patent/WO2020081972A1/en not_active Ceased
- 2019-10-18 US US17/283,845 patent/US12286626B2/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050214835A1 (en) * | 1997-01-30 | 2005-09-29 | The Regents Of The University Of Colorado | Diagnosis and treatment of myocardial failure |
| US20160114004A1 (en) * | 2014-10-24 | 2016-04-28 | Indiana University Research & Technology Corporation | Role of a cluster of long noncoding rna transcripts in protecting the heart from pathological hypertrophy |
Non-Patent Citations (3)
| Title |
|---|
| DATABASE GenBank [online] 14 March 2015 (2015-03-14), "Human chromosome 14 DNA sequence BAC C-2201G16 of library CalTech-D from chromosome 14 of Homo sapiens (Human), complete sequence", Database accession no. AL132855.4 * |
| DATABASE GenBank [online] 27 April 2005 (2005-04-27), "Mus musculus BAC clone RP23-171A13 from chromosome 14, complete sequence", Database accession no. AC157212 * |
| QIN ET AL.: "Localization of human cardiac beta-myosin heavy chain gene (MYH7) to chromosome 14q12 by in situ hybridization", CYTOGENET CELL GENET, vol. 54, 1990, pages 74 - 76 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022120133A1 (en) * | 2020-12-04 | 2022-06-09 | Northwestern University | Material and methods for modifying expression of myosin heavy chain genes |
Also Published As
| Publication number | Publication date |
|---|---|
| US20210380977A1 (en) | 2021-12-09 |
| US12286626B2 (en) | 2025-04-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AC't Hoen et al. | Generation and characterization of transgenic mice with the full-length human DMD gene | |
| Fish et al. | Dynamic regulation of VEGF-inducible genes by an ERK/ERG/p300 transcriptional network | |
| Hammer et al. | Diversity of alpha-fetoprotein gene expression in mice is generated by a combination of separate enhancer elements | |
| Liu et al. | Kruppel-like factor 4 abrogates myocardin-induced activation of smooth muscle gene expression | |
| Shi et al. | Disruption of both ROCK1 and ROCK2 genes in cardiomyocytes promotes autophagy and reduces cardiac fibrosis during aging | |
| Ding et al. | A modifier screen identifies DNAJB6 as a cardiomyopathy susceptibility gene | |
| HUP0301729A2 (en) | Remedies for heart failure | |
| Tung et al. | FTO is necessary for the induction of leptin resistance by high-fat feeding | |
| Zakariyah et al. | Congenital heart defect causing mutation in Nkx2. 5 displays in vivo functional deficit | |
| Ishiwata et al. | HSPB2 is dispensable for the cardiac hypertrophic response but reduces mitochondrial energetics following pressure overload in mice | |
| JP4292401B2 (en) | Utilization of histamine receptor H3 gene involved in regulation of body weight or food intake | |
| US12286626B2 (en) | Myocardial enhancer RNA and methods of use | |
| Makki et al. | Ubiquitin specific protease 18 (Usp18) is a WT1 transcriptional target | |
| Kuratomi et al. | NRSF regulates the developmental and hypertrophic changes of HCN4 transcription in rat cardiac myocytes | |
| US5858774A (en) | Antisense DNA constructs for expression of hybrid MRNAs driven by inducible, tissue-specific promoters | |
| Jin et al. | Differential roles for ETS, CREB, and EGR binding sites in mediating VEGF receptor 1 expression in vivo | |
| JP7325466B2 (en) | Vectors and methods for regenerative medicine | |
| Zhang et al. | Genome writing to dissect consequences of SVA retrotransposon disease X-Linked Dystonia Parkinsonism | |
| Gauss et al. | AP-1 is essential for p67 phox promoter activity | |
| Yeh et al. | Molecular cloning and expression of channel catfish, Ictalurus punctatus, complement membrane attack complex inhibitor CD59 | |
| Hunt et al. | Transcriptional regulation of the murine C5a receptor gene: NF-Y is required for basal and LPS induced expression in macrophages and endothelial cells | |
| Li et al. | Isolation and characterization of a new chemokine receptor gene, the putative chicken CXCR1 | |
| Lou et al. | Identification of the promoter of human transcription factor Sp3 and evidence of the role of factors Sp1 and Sp3 in the expression of Sp3 protein | |
| Yevtodiyenko et al. | A 178-kb BAC transgene imprints the mouse Gtl2 gene and localizes tissue-specific regulatory elements | |
| Warthi et al. | An inducible Cre mouse with preferential activity in vascular smooth muscle evades a previously lethal intestinal phenotype |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 19873755 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 19873755 Country of ref document: EP Kind code of ref document: A1 |
|
| WWG | Wipo information: grant in national office |
Ref document number: 17283845 Country of ref document: US |