WO2020041733A1 - The microbiome as a target of micrornas for the treatment of disease - Google Patents

The microbiome as a target of micrornas for the treatment of disease Download PDF

Info

Publication number
WO2020041733A1
WO2020041733A1 PCT/US2019/047954 US2019047954W WO2020041733A1 WO 2020041733 A1 WO2020041733 A1 WO 2020041733A1 US 2019047954 W US2019047954 W US 2019047954W WO 2020041733 A1 WO2020041733 A1 WO 2020041733A1
Authority
WO
WIPO (PCT)
Prior art keywords
mir
nucleic acid
sequence
muciniphila
eae
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2019/047954
Other languages
French (fr)
Inventor
Shirong LIU
Howard Weiner
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Brigham and Womens Hospital Inc
Original Assignee
Brigham and Womens Hospital Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Brigham and Womens Hospital Inc filed Critical Brigham and Womens Hospital Inc
Priority to US17/270,711 priority Critical patent/US20210348163A1/en
Publication of WO2020041733A1 publication Critical patent/WO2020041733A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7105Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/712Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0031Rectum, anus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0053Mouth and digestive tract, i.e. intraoral and peroral administration
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • C12N2310/141MicroRNAs, miRNAs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/35Special therapeutic applications based on a specific dosage / administration regimen

Definitions

  • the Microbiome as a Target of MicroRNAs for the Treatment of Disease
  • This application relates, at least in part, to methods for treating subjects who have autoimmune diseases including multiple sclerosis.
  • the methods include administering, e.g., orally, one or more micro RNAs, e.g., miR-30d, miR-7706, and miR-l246, or mimics thereof.
  • micro RNAs e.g., miR-30d, miR-7706, and miR-l246, or mimics thereof.
  • MS Multiple sclerosis
  • CNS central nervous system
  • MS is an autoimmune disease directed against the central nervous system (CNS) myelin, and is associated with demyelination, oligodendrocyte loss, reactive gliosis, and axonal degeneration (Baecher-Allan et al., 2018).
  • MS is a heterogeneous, multifactorial disease influenced by both genetic and environmental factors (Baecher-Allan et al., 2018).
  • Interferon gamma ( ⁇ FNy) -producing Thl and interleukin- 17 (IL-l7)-secreting Thl7 CD4+ T cells play a central role in the pathogenesis of MS (Baecher-Allan et al., 2018). These responses can be regulated in the periphery and/or in the CNS by regulatory cells such as FoxP3+ regulatory T cells (Tregs) (Lu and Rudensky, 2009).
  • regulatory cells such as FoxP3+ regulatory T cells (Tregs) (Lu and Rudensky, 2009).
  • the method comprise administering a therapeutically effective amount of a nucleic acid comprising a sequence that is identical to a contiguous sequence of at least 12 nucleotides present in mature miR-30d, miR-7706, and/or miR-l246 microRNA, to a subject in need thereof.
  • nucleic acids comprising a sequence that is identical to a contiguous sequence of at least 12 nucleotides present in mature miR-30d, miR-7706, and/or miR-l246 microRNA for use in a method of treating, reducing risk of development or progression of, or reducing symptoms of, an inflammatory condition in a subject, the method comprising administering a therapeutically effective amount of a nucleic acid comprising a sequence that is identical to a contiguous sequence of at least 12 nucleotides present in mature miR- 30d, miR-7706, and/or miR-l246 microRNA, to a subject in need thereof.
  • the methods comprise administering a therapeutically effective amount of a nucleic acid comprising a sequence that is identical to a contiguous sequence of at least 12 nucleotides present in mature miR-30d, miR-7706, and/or miR-l246 microRNA, to a subject in need thereof.
  • nucleic acids comprising a sequence that is identical to a contiguous sequence of at least 12 nucleotides present in mature miR-30d, miR-7706, and/or miR-l246 microRNA for use in a method of reducing interferon gamma (IFNy)- producing Thl and/or interleukin- 17 (IL-l7)-secreting Thl7 CD4+ T cells, and/or increasing regulatory cells such as FoxP3+ regulatory T cells (Tregs), in the periphery and/or in the CNS in a subject.
  • IFNy interferon gamma
  • IL-l7 interleukin- 17
  • Tregs FoxP3+ regulatory T cells
  • the nucleic acid is 12-24 nucleotides long.
  • the nucleic acid is identical to a contiguous sequence of at least 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 nucleotides present in mature miR- 30d, miR-7706, and/or miR-l246 microRNA.
  • the nucleic acid is a mature miRNA or miRNA mimic selected from miR-30d, miR-7706, and/or miR-l246, e.g., a miRNA mimic thereof.
  • the methods include administering miR-30d; miR- 7706; miR-l246; miR-30d and miR-7706; miR-30d and miR-l246; miR-7706 and miR-l246; or miR-30d, miR-7706, and miR-l246.
  • the methods include administering a therapeutically effective amount of a nucleic acid comprising a sequence that is identical to a contiguous sequence of at least 12 nucleotides present in mature miR-30d to a subject in need thereof. Also provided herein are nucleic acids comprising a sequence that is identical to a contiguous sequence of at least 12 nucleotides present in mature miR-30d for use in a method of increasing relative abundance of Akkermansia muciniphila in the gut microbiome of a subject in need thereof.
  • the nucleic acid is 12-24 nucleotides long. In some embodiments, the nucleic acid is identical to a contiguous sequence of at least 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 nucleotides present in mature miR-30d microRNA.
  • the nucleic acid is a mature miR-30d miRNA or miRNA mimic of miR-30d.
  • the subject has an inflammatory condition.
  • the subject has cancer, e.g., a solid tumor, e.g., and is being treated with immunotherapy, e.g., a checkpoint inhibitor antibody.
  • the condition is an inflammatory autoimmune disease.
  • the condition is selected from the group consisting of Type 1 diabetes; multiple sclerosis; inflammatory bowel disease (IBD)/colitis; obesity and obesity-related conditions; epilepsy; immune-mediated liver injury; amyotrophic lateral sclerosis (ALS); rheumatoid arthritis; and aging or progeria.
  • IBD inflammatory bowel disease
  • ALS amyotrophic lateral sclerosis
  • progeria aging or progeria.
  • the nucleic acid is a miRNA mimic.
  • the miRNA mimic comprises one or more modifications.
  • the modifications include but are not limited to: double-stranded sequence, 5’ Amino-Modifier C6, and/or 3’ [dT][dT]
  • the nucleic acid is administered orally or rectally.
  • the nucleic acids are formulated to be administered orally or rectally.
  • all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.
  • Figures 1 A-D Analysis of Gut Microbiome Changes During MOG- induced EAE.
  • A-D Mice were immunized with OVA or MOG and feces were collected at day 0 (0-day post immunization, 0 d.p.i., naive), 8 d.p.i. (prior to EAE symptom onset for MOG-immunized mice), and 15 d.p.i. (peak EAE for MOG-immunized mice).
  • A- C Bacterial 16S rDNA sequence-based microbiome surveys were performed.
  • A Principal coordinates analysis
  • PCoA Principal coordinates analysis
  • B Principal coordinates analysis
  • C Principal coordinates analysis
  • muciniphila by measuring 16S rDNA, referenced to universal bacterial 16S rDNA.
  • FIGS 2A-I Both Fecal Transfer and Fecal miRNA Transfer from Peak EAE Donor Ameliorate EAE in Recipients.
  • (A-B) The effect of transfer of feces from different stages of EAE on EAE in recipient mice.
  • A Schematic of experimental design. Donor mice were immunized with MOG/CFAto induce EAE. Feces were collected at day 0 (naive), day 8 post immunization (8 d.p.i., prior to symptom onset), and 15 d.p.i. (peak) and orally gavaged to recipient mice 6 days-, 4 days- and 2 days- prior to the induction of EAE in the recipients.
  • C-D Analysis of the role of live bacteria in the EAE fecal transfer.
  • C Experimental scheme. Donor mice were immunized with MOG or ovalbumin (OVA). Feces were collected at 15 d.p.i. (EAE peak), heat- inactivated or kept intact, and orally gavaged to recipient mice 6 days-, 4 days- and 2 days- prior to EAE induction in the recipients.
  • EAE peak 15 d.p.i.
  • E-F Effect of oral administration of MOG-induced EAE peak fecal RNA on EAE.
  • E Experimental scheme. Donor mice were immunized with MOG or OVA. Feces were collected at 15 d.p.i. when the MOG-immunized mice were at peak of EAE. Fecal RNA was isolated from donor feces and orally gavaged 6 days-, 4 days- and 2 days- prior to induction of EAE in the recipients.
  • FIGS 4A-I Oral Administration of Synthetic miR-30d Ameliorates EAE in a Recipient Gut microbiome-dependent Manner.
  • B Quantification of demyelination and axonal loss for individual mice.
  • C-D Mice were immunized with MOG and orally administered synthetic miR-30d or scramble control daily at a dose of 1000 pmol in 200 m ⁇ H 2 0/mouse for 7 consecutive days.
  • E-G Effect on EAE of transfer of fecal microbiome from synthetic miR-30d treated mice. Donor mice were immunized with MOG and orally treated with FLO (vehicle), scrambled-miR-30d, or miR-30d for 7 consecutive days. Feces were collected and used to colonize mice that were pre-treated with antibiotics (ABX) for 7 days prior to colonization. Recipient mice were then induced for EAE.
  • FIGS 5A-I Enhances b-galactosidase of A. muciniphila and Expands A. muciniphila in vivo.
  • A. muciniphila genes (AMUC_RS06985, AMUC_RS07700,
  • AMLTC_RSl0850 were predicted to be targeted by miR-30d by sequence alignment. SEQ ID NOs:37, 2, 38, 2, 39 and 2 are shown.
  • C Protein sequence alignment of AMETC_RS06985 of A.
  • muciniphila was grown on BHI agar containing lactose and b-galactosidase activity indicator, X-gal and was treated with synthetic miR-30d or scrambled miR-30d.
  • F-I The effect of oral administration of synthetic miR-30d on the gut microbiome. Mice were immunized with MOG and orally gavaged with 250 pmol synthetic miR-30d, scramble or H 2 0 (vehicle) for 7 days.
  • PCoA Principal coordinates analysis
  • Foxp3+ T cells in the total CD4+ T cell population (C) and in the nb11+ CD4+ T cell population (D) in the spleen were analyzed by FACS.
  • Left panel Representative FACS plots of Foxp3+ CD4+ T cells;
  • Error bars denote mean ⁇ SEM, One- way ANOVA Tukey’s multiple comparisons test. n.s. not significant, * P ⁇ 0.05, ** P ⁇ 0.0l.
  • E Sorted naive CD4+ T cells from Foxp3-GFP reporter mice were induced toward Treg cell differentiation for 3 days in the presence of TGF-b plus IL-2 and in the presence of either A. muciniphila or E. coli.
  • F CDllc+ dendritic cells were sorted from the mesenteric lymph nodes (MLN) of naive mice and stimulated with A. muciniphila or E. coli. Sorted naive CD4+ T cells from Foxp3-GFP reporter mice were added 24 hours after and were induced toward Treg cell differentiation for 3 days in the presence of TGF-b and IL-2.
  • E-F 72 h after Treg induction, live CD4+ cells were gated and determined for Foxp3+ (GFP+) T cells. Left panel:
  • RNA was isolated and quantified for Tgfb, 116, and II lb by qPCR. Data represent the mean ⁇ SEM, n 7, one-way ANOVA Dunnett’s multiple comparisons test. n.s. not significant, * P ⁇ 0.05, ** R ⁇ 0.01, *** P ⁇ 0.00l, **** PO.OOOl.
  • FIGS 8A-B The Dose Response of Oral Administration of Synthetic miR-30d in Ameliorating EAE.
  • the indicated dose of synthetic miR-30d, scrambled sequence control, or H20 as blank control were orally administered to MOG/CFA-induced EAE mice starting from when the mice were scored 1, for 7 consecutive days.
  • A Clinical scores of EAE (left) at the end of treatment (17 d.p.i) and 1 day post the end of treatment (18 d.p.i). Sample size of each group is indicated, Error bars denote mean ⁇ SEM, statistical analysis by two-way ANOVA.
  • mice were immunized with MOG and orally administered synthetic miR-30d or scrambled miR-30d control daily at a dose of 250 pmol in 200 m ⁇ FhO/mouse for 7 consecutive days.
  • FIGS 10A-B Treg-Promoting Effect of Oral MiR-30d Administration is not Caused by Acting on T cell Differentiation Directly.
  • T cells from C57BL/6 spleen were differentiated into Treg (Foxp3+), Thl7 (IL-17A+) and Thl (IFN-y+) cells by plate bound anti-CD3 and anti-CD28 in the presence of corresponding polarizing cytokines.
  • the direct effect of miR-30d on T cell differentiation was examined by supplying synthetic miR-30d to the culture.
  • T cell subsets were analyzed by FACS. Left panel: Representative FACS plots of T cell subsets; Right panel: Bar graph of % of T cell subsets individual culture. Error bars denote mean ⁇ SEM; one- way ANOVA Tukey’s multiple comparisons test. * P ⁇ 0.05, n.s. ⁇ not significant.
  • FIGS 13A-B MiR-30d enter A. muciniphila and Promote the Growth of A. muciniphila in vitro.
  • A. muciniphila was cultured in presence of synthetic miR-30d or scrambled control for 18 hours to an exponential phase. miR-30d in A. muciniphila was determined by in situ hybridization using a 5’-DIG and 3’-DIG dual labeled probe for miR-30d and 10 nm immuno gold-conjugated anti-Digoxigenin antibody.
  • Figures 14A-B Oral Administration of Synthetic MiR-1246 and MiR- 7706 Ameliorated EAE.
  • HFD High fat diet
  • mice C57BL/J DIO stock No: 380050; Black 6 DIO, the Jackson Laboratory
  • HFD 60 kcal% fat, 5.2 kcal/gram
  • IPGTT intra- peritoneal glucose tolerance test
  • the gut microbiome plays an important role in the development of immune system (An et al., 2014; Belkaid and Hand, 2014; Hooper et al., 2012). Different commensals in the gut have been shown to promote the differentiation of subsets of lymphocytes.
  • segmented filamentous bacteria induce intestinal Thl7 cells (Ivanov et al., 2009)
  • Bacteroides fragilis (B. fragilis) colonization of germ-free mice preferentially induces Thl cells (Mazmanian et al., 2005)
  • polysaccharide A of B. fragilis suppresses Thl7 cells in conventional mice by promoting IL-10 producing in Tregs through a TLR2 signaling pathway (Round et al., 2011).
  • Clusters IV and XlVa of Clostridium promotes a transforming growth factor-b (TGF-P)-rich environment in the gut and Treg accumulation (Atarashi et al., 2011).
  • TGF-P
  • the gut microbiome has been linked to many disorders including
  • FMT fecal microbiome transplantation
  • FMT is a result of the transfer of microbes as the transfer of sterile filtrates from donor stool, rather than fecal microbes, was efficacious in patients with Clostridium difficile infection (Ott et al., 2017), raising the possibility that FMT may not act by microbial transfer but by transplantation of other fecal component(s) which in turn modulate the microbiome.
  • miR-30d increased the abundance of the gut commensal Akkermansia muciniphila (A. muciniphila).
  • muciniphila is a mucin-degrading bacterium (Derrien et al., 2004) that has been reported to have anti-inflammatory properties. It has been shown that A.
  • muciniphila improved diet-induced obesity (Everard et al., 2013) in a mechanism likely dependent on a specific protein (Amuc l 100) isolated from the outer membrane of A. muciniphila (Plovier et al., 2017). Furthermore, oral administration of A. muciniphila was shown to enhance glucose tolerance and attenuate adipose tissue inflammation by inducing Foxp3+ Tregs in the visceral adipose tissue (Shin et al., 2014). Of note, treatment with metformin increased A. muciniphila (Wu et al., 2017), and metformin treatment has been shown to attenuate EAE (Nath et al., 2009).
  • A. muciniphila has been shown to be associated with progeria in humans and transplantation of A. muciniphila was sufficient to enhance healthspan and lifespan in progeroid mouse models (Barcena et al., 2019).
  • Several groups have reported an increase of A. muciniphila in the gut microbiome of MS subjects (Berer et al., 2017; Cekanaviciute et al., 2017; Jangi et al., 2016; Tremlett et al., 2016).
  • Cekanaviciute et al. found that A. muciniphila increased Thl differentiation in vitro but found no effect in A.
  • muciniphila- monocolonized mice (Cekanaviciute et al., 2017).
  • cell-mediated autoimmune diseases such as EAE in mice and MS in humans induced miR-30d upregulation in intestinal DCs and in the stool specimen.
  • miR- 30d expanded A. muciniphila in the EAE mouse gut by directly regulating gene expression of AMUC RS06985, which we identified to be a new b-galactosidase in A. muciniphila.
  • A. muciniphila in turn induced upregulation of TFG-b and
  • FMT is a complex biologic intervention without well-defined targets. More importantly, in practice, currently only feces from “Healthy” donor are used in most FMTs (Schmidt et al., 2018). While their effects on diseases have not been fully evaluated, feces from patients and diseased models have been excluded from FMT trials. As shown herein, feces from peak diseased donors improved the disease, and synthetic miRNAs were identified that can specifically modulate the microbiome and ameliorate inflammatory autoimmune disease.
  • miRNAs were identified in the feces of both EAE mice and untreated MS patients, which suggests that fecal miRNAs may represent a previously unrecognized process by which the host regulates the microbiome.
  • the present methods can be used to treat, risk of development or progression of, or reduce symptoms of, inflammatory conditions in a subject.
  • to“treat” means to ameliorate at least one symptom of the disorder.
  • the methods described herein include methods for the treatment of disorders associated with inflammation, e.g., as described herein.
  • the methods include administering a therapeutically effective amount of one or more miRNAs as described herein, to a subject who is in need of, or who has been determined to be in need of, such treatment.
  • the miRNAs can include, e.g., miR-30d, miR-7706, and/or miR- 1246.
  • the methods can include administering miR-30d; miR-7706; miR-l246; miR- 30d and miR-7706; miR-30d and miR-l246; miR-7706 and miR-l246; or miR-30d, miR-7706, and miR-l246.
  • the conditions that can be treated include inflammatory autoimmune diseases in a subject.
  • Inflammatory diseases include Type 1 diabetes; multiple sclerosis;
  • IBD inflammatory bowel disease
  • ALS amyotrophic lateral sclerosis
  • the methods can be used to reduce interferon gamma (IFNy)-producing Thl and/or interleukin- 17 (IL-l7)-secreting Thl7 CD4+ T cells, and/or increase regulatory cells such as FoxP3+ regulatory T cells (Tregs), in the periphery and/or in the CNS.
  • IFNy interferon gamma
  • IL-l7 interleukin- 17
  • Tregs FoxP3+ regulatory T cells
  • the condition is one that has been shown to be improved by increasing Akkermansia muciniphila.
  • Akkermansia muciniphila has been shown to improve metabolism in obese and diabetic mice, and in overweight and obese human (see, e.g., Plovier et al,.
  • a purified membrane protein from Akkermansia muciniphila or the pasteurized bacterium improves metabolism in obese and diabetic mice. Nat Med. 2017; 23(1): 107-113; Depommier et al.,
  • the present methods can be used to treat Type 1 diabetes, as it has been shown that vancomycin increases Akkermansia and reduces diabetes in NOD mouse. See, e.g., Hansen et al, Early life treatment with vancomycin propagates Akkermansia muciniphila and reduces diabetes incidence in the NOD mouse. Diabetologia. 2012; 55(8):2285-94.
  • Akkermansia muciniphila has been shown to protect from immune-mediated liver injury in mouse model; see e.g., Wu et al., Protective Effect of Akkermansia muciniphila against Immune-Mediated Liver Injury in a Mouse Model. Front Microbiol. 2017; 8: 1804.
  • the ketogenic diet (KD) has been used to treat refractory epilepsy.
  • ALS Amyotrophic Lateral Sclerosis
  • gut microbiota play an important part in the pathogenesis of mucosal inflammation, such as inflammatory bowel disease (IBD).
  • IBD inflammatory bowel disease
  • IBD inflammatory bowel disease
  • progeria is characterized by intestinal dysbiosis with alterations in gut microbiome including a decrease in the abundance of Verrucomicrobia which Akkermansia belongs to. They found that human progeria patients also display intestinal dysbiosis and that long-lived humans (that is, centenarians) exhibit a substantial increase in Verrucomicrobia. Using the mouse models of progeria, they found that transplantation with the verrucomicrobia Akkermansia muciniphila was sufficient to enhance healthspan and lifespan in both progeroid mouse models.
  • Immunotherapy can include administration of an immunotherapy compound, e.g., an immune checkpoint inhibitory antibody, e.g., to PD-L1, PD-l, CTLA-4 (Cytotoxic T-Lymphocyte- Associated Protein-4; CD 152); LAG-3 (Lymphocyte Activation Gene 3; CD223); TIM-3 (T-cell Immunoglobulin domain and Mucin domain 3; HAVCR2); TIGIT (T cell Immunoreceptor with Ig and ITEM domains); B7-H3 (CD276); VSIR (V-set immunoregulatory receptor, aka VISTA, B7H5, Cl0orf54); BTLA 30 (B- and T Lymphocyte Attenuator, CD272); GARP (Glycoprotein A Repetitions; Predominant; 25 PVRIG (PVR related immunoglobulin domain containing); or VTCN1 (Vset domain containing T cell activation inhibitor 1, aka B7-H4).
  • an immunotherapy compound
  • the methods can be used to treat a solid or hematopoietic tumor, e.g., melanoma, lung cancer (e.g., non-small cell lung cancer or small cell lung cancer), renal cell carcinoma, urothelial bladder cancer, hodgkins lymphoma, head and neck cancer, merkel cell carcinoma, MSI-H or dMMR cancer, colorectal cancer, gastic cancer, hepatocellular carcinoma, cervical cancer, PMBL, cutaneous squamous cell cancer, breast cancer, esophageal cancer, pancreatic cancer, ovarian cancer, and prostate cancer.
  • a solid or hematopoietic tumor e.g., melanoma
  • lung cancer e.g., non-small cell lung cancer or small cell lung cancer
  • renal cell carcinoma e.g., urothelial bladder cancer, hodgkins lymphoma, head and neck cancer, merkel cell carcinoma, MSI-H or dMMR cancer, colorectal cancer
  • compositions comprising a miRNA described herein, e.g., human miR-30d, miR-7706, and/or miR- 1246, as an active ingredient.
  • the composition can include miR-30d; miR-7706; miR-l246; miR-30d and miR-7706; miR-30d and miR-l246; miR-7706 and miR- 1246; or miR-30d, miR-7706, and miR-l246.
  • the human miR-30d precursor sequence is as follows:
  • the mature hsa-miR-30d sequence is uguaaacauccccgacuggaag (SEQ ID NO: 1
  • the human miR-7706 precursor sequence is as follows:
  • the mature hsa-miR-7706 sequence is ugaagcgccugugcucugccgaga (SEQ ID NO: 1
  • the human miR-l246 precursor sequence is as follows:
  • the mature hsa-miR-l246 sequence is aauggauuuuuggagcagg (SEQ ID NO: 1
  • the present methods include the administration of at least one miRNA; the miRNAs used herein include pre-miRNA and mature miRNA, or a mimic thereof.
  • miRNA mimics are chemically synthesized nucleic acid based molecules. microRNA mimics imitate the function of endogenous microRNAs in cells and can be designed as mature molecules, double-stranded molecules, or miRNA precursors (e.g., pri- or pre-microRNAs). MicroRNA mimics can be include synthetic and/or natural, modified and/or unmodified RNA, DNA, RNA-DNA hybrids or alternative nucleic acid chemistries as are generally known in the art.
  • a miRNA mimic as used herein can be a double stranded nucleic acid having a guide strand that has a nucleic acid sequence that is similar, or in some cases identical, to a guide strand of a naturally occurring mature miRNA.
  • Naturally occurring miRNAs are processed from long nucleic acids having secondary structural properties (referred to as pri-miRNA and pre-miRNA) to produce naturally occurring mature miRNA.
  • the mature miRNA is a double stranded molecule of about 22 (e.g., 20-24 or 21-23) nucleotides in length.
  • the miRNA includes a sequence with at least 80% sequence identity to the full sequence of the endogenous human miRNA (i.e., SEQ ID NO:2, 4, or 6). In some embodiments, the miRNA includes a sequence with at least 90% sequence identity to at least 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 consecutive nucleotides of SEQ ID NO: 2, 4, or 6. In some embodiments, the miRNA includes a sequence with at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the full length og SEQ ID NO:2, 4, or 6. In some embodiments the sequence of the miRNA mimic may include the same bases, but the base of the mimic may be modified, i.e. hydrophobically modified. In other cases the mimic may include one or more different bases or nucleotides than the naturally occurring mature miRNA.
  • an inhibitory nucleic acid contain a sequence that is identical to at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25
  • the miRNAs comprise a sequence that is complementary to a contiguous sequence of at least, e.g, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25, nucleotides present in a mature microRNA miR-30d, miR-7706, and/or miR-l246, e.g., having the sequence of SEQ ID NO:2, 4, or 6, optionally wherein the nucleic acid comprises at least one modified base.
  • miRNA mimics are available and known in the art.
  • miRNA mimics can be, e.g., double-stranded RNA molecules, e.g., with at least one strand with at least 90% sequence identity to SEQ ID NO: 2, 4, or 6.
  • a miRNA mimic can include one or more modifications, on one strand or on both sense and anti-sense strand, as compared to an endogenous (natural) miRNA, such as natural residues or non-natural residues substituted at one or more positions with respect to the endogenous miRNA sequence.
  • nucleotides that can be employed in miRNA mimics can include, without limitation, 5- Amino-Modifier C6, 5-fluorouracil, 5-bromouracil, 5- chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5- carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1 -methyl guanine, l-methylinosine, 2, 2-dimethyl guanine, 2- methyladenine, 2-methylguanine, 3 -methyl cytosine, 5 -methyl cytosine, N6-adenine, 7- methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
  • compositions typically include a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carrier includes saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, lipids, lipidsome, nanoparticles, microvesicles, compatible with pharmaceutical administration. Supplementary active compounds can also be incorporated into the compositions.
  • the composition can include an immunotherapy compound, e.g., an immune checkpoint inhibitory antibody, e.g., to PD-L1, PD-l, CTLA-4 (Cytotoxic T- Lymphocyte- Associated Protein-4; CD 152); LAG-3 (Lymphocyte Activation Gene 3; CD223); TIM-3 (T-cell Immunoglobulin domain and Mucin domain 3; HAVCR2); TIGIT (T cell Immunoreceptor with Ig and ITEM domains); B7-H3 (CD276); VSIR (V-set immunoregulatory receptor, aka VISTA, B7H5, Cl0orf54); BTLA 30 (B- and T Lymphocyte Attenuator, CD272); GARP (Glycoprotein A Repetitions;
  • an immune checkpoint inhibitory antibody e.g., to PD-L1, PD-l, CTLA-4 (Cytotoxic T- Lymphocyte- Associated Protein-4; CD 152); LAG-3 (Lymph
  • Predominant 25 PVRIG (PVR related immunoglobulin domain containing); or VTCN1 (Vset domain containing T cell activation inhibitor 1, aka B7-H4).
  • the supplementary active compounds can also be administered separately, e.g., as a combination therapy, e.g., in some embodiments the two compounds are administered concurrently (either in a single or separate compositions) or sequentially.
  • compositions are typically formulated to be compatible with its intended route of administration.
  • routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, and rectal administration.
  • solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as
  • ethylenediaminetetraacetic acid ethylenediaminetetraacetic acid
  • buffers such as acetates, citrates or phosphates
  • agents for the adjustment of tonicity such as sodium chloride or dextrose.
  • pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide.
  • the parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
  • Oral compositions generally include an inert diluent or an edible carrier.
  • the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules, e.g., gelatin capsules.
  • Oral compositions can also be prepared using a fluid carrier for use as a mouthwash.
  • Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition.
  • the tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
  • a binder such as microcrystalline cellulose, gum tragacanth or gelatin
  • an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch
  • a lubricant such as magnesium stearate or Sterotes
  • a glidant such as colloidal silicon dioxide
  • compositions can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.
  • suppositories e.g., with conventional suppository bases such as cocoa butter and other glycerides
  • retention enemas for rectal delivery.
  • the compounds can be delivered in the form of an aerosol spray from a pressured container or dispenser that contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.
  • a suitable propellant e.g., a gas such as carbon dioxide, or a nebulizer.
  • nucleic acid agents can be administered by any method suitable for administration of nucleic acid agents, such as a DNA vaccine.
  • methods include gene guns, bio injectors, and skin patches as well as needle-free methods such as the micro-particle DNA vaccine technology disclosed in U.S. Patent No. 6,194,389, and the mammalian transdermal needle-free vaccination with powder-form vaccine as disclosed in U.S. Patent No. 6,168,587. Additionally, intranasal delivery is possible, as described in, inter alia, Hamajima et al., Clin. Immunol. Immunopathol., 88(2), 205-10 (1998).
  • Liposomes e.g., as described in U.S. Patent No. 6,472,375
  • microencapsulation can also be used.
  • Biodegradable targetable microparticle delivery systems can also be used (e.g., as described in U.S. Patent No. 6,471,996).
  • the therapeutic compounds are prepared with carriers that will protect the therapeutic compounds against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
  • a controlled release formulation including implants and microencapsulated delivery systems.
  • Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid.
  • Such formulations can be prepared using standard techniques, or obtained commercially, e.g., from Alza Corporation and Nova Pharmaceuticals, Inc.
  • Liposomal suspensions (including liposomes targeted to selected cells with monoclonal antibodies to cellular antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811.
  • compositions can be included in a container, pack, or dispenser together with instructions for administration.
  • mice and Foxp3 GFP+ mice were from The Jackson Laboratory and acclimated in the local animal facility for at least two weeks prior to study initiation. Otherwise specified, all mice used were 6-8 weeks old at the initiation of study.
  • mice of same age and gender were ear-tagged and randomly allocated into groups and co-housed. Mice were housed under specific pathogen-free conditions at the Harvard Institutes of Medicine and the Hale Building for
  • EAE was induced by injecting 6- to 8-week-old female C57BL/6J mice with 150 pg MOG35 -55 peptide (Genemed Synthesis) emulsified in complete Freund’s adjuvant (CFA)(BDTM DifcoTM) per mouse subcutaneously in the flanks, followed by intraperitoneal administration of 150 ng pertussis toxin (List biological laboratories, Inc.) per mouse on days 0 and 2 as described (Mayo et ak, 2014).
  • CFA complete Freund’s adjuvant
  • mice were euthanized at the termination of experiments and were
  • RNA including miRNA was extracted from stool specimens using mirVanaTM miRNA isolation kit (catalog number: AM1560, Ambion®) following the established protocol (Liu et al., 2016). Briefly, mouse or human stool was
  • RNA isolates were stored at -80 °C until use.
  • fecal transplantation 5 mg per mouse of feces from donor mice was suspended in 200 m ⁇ sterile PBS and was administered to recipient C57BL/6J mice by orally gavage at the time showed in the figures. In some cases, feces were inactivated by heating at 80 °C for 60 min to kill bacteria while keeping miRNA in the feces (Jung et al., 2010). To investigate the effect of fecal RNA on EAE, 10 pg of RNA isolated from feces, as described above, was eluted in 200 m ⁇ nuclease-free water and administered to mouse by orally gavage at the time as indicated in the figures.
  • RNA-seq libraries were constructed from fecal RNA isolates using NEXTflexTM Small RNA-Seq Kit (Bioo Scientific Corporation., USA). 500 ng of RNA was used as input material. The library was prepared with a unique indexed primer so that libraries could be pooled into one sequencing flow cell. Multiplex adaptor ligations, primer hybridization, reverse transcription reaction and PCR amplification were performed according to the manufacturer’s protocol. Libraries were further purified with a gel size selection using Blue Pippin (Sage Science, Inc. USA). The obtained libraries were checked for quality with Agilent 2200 TapeStation and were sequenced with the Illumina NextSeq 500 System (50 nt, single read) at the Biopolymers Facility at Harvard Medical School.
  • Quantitative PCR was performed to verify the relative level of miRNAs that were identified in small RNA-Seq. 200 ng of total fecal RNA was input for miRNA cDNA synthesis using TaqManTM Advanced miRNA cDNA Synthesis kit (Applied Biosystems).
  • MiRNA cDNAs were then quantified by real-time PCR using TaqMan® Fast Advanced Master Mix and TaqMan Advanced MiRNA Assays (Applied Biosystems) on QuantStudioTM 7 Flex Real-Time PCR System (Applied Biosystems) following the manufacturer’s protocol: hsa-miR-2l-5p/mmu-miR-2la-5p (Assay ID: mmu482709_mir), mmu-miR-30d-5p/ hsa-miR-30d-5p (Assay ID:
  • mmu478606_mir hsa-miR-7706 (Assay ID: 480578_mir), hsa-miR-l246 (Assay ID: 47788 l mir).
  • a reference gene for quantifying fecal miRNA using qPCR has not been established.
  • MiR-2l has been detected in both mouse and human feces (Johnston et al., 2018; Link et al., 2010; Liu et al., 2016; Schonauen et al., 2018).
  • Our small RNA-seq data suggested that miR-2l was highly presented in mouse and human feces and was not distinguishable between healthy and MS patient and between naive and immunized mice.
  • We thus used miR-2l as reference to measure the relative level of miR-30d, miR-l246 and miR-7706 using comparative CT method (Schmittgen and Livak, 2008).
  • mice were given a mixture of antibiotics (ampicillin 1 mg/ml, vancomycin 0.5 mg/ml, neomycin 1 mg/ml, metronidazole 1 mg/ml, and streptomycin 1 mg/ml (Sigma-Aldrich)), following an established protocol (Benjamin et al., 2013) in drinking water or in 200m1 nuclease-free water by orally gavage as specified on figure legends, for 7 consecutive days. Bacteria depletion was confirmed by culturing the colonic luminal content anaerobically on BHI agar and aerobically on LB agar. 16S rDNA Analyses of Gut Microbiome
  • 16S rDNA sequence survey was performed following our established procedure (Liu et al., 2016; Tankou et al., 2018). Briefly, DNA in the mouse feces was extracted using a QIAamp Fast DNA Stool Mini Kit (Qiagen). Amplicons spanning variable region 4 (V4) of the bacterial 16S rRNA gene were generated with primers containing barcodes (515F, 806R) from the Earth Microbiome project (Caporaso et al., 2012) using HotMaster Taq and HotMaster Mix (QuantaBio) and paired-end sequenced on an Illumina MiSeq platform at the Harvard Medical School Biopolymer Facility.
  • V4 Variplicons spanning variable region 4 (V4) of the bacterial 16S rRNA gene were generated with primers containing barcodes (515F, 806R) from the Earth Microbiome project (Caporaso et al., 2012) using HotMaster Taq and HotMaster Mix (QuantaBio) and paired-end sequence
  • amplification reactions consisting of DNA, TaqMan® Universal PCR Master Mix (Applied Biosystems), and primer pairs as follows: All bacteria (universal 16S rDNA, reference): Forward: TCCTACGGGAGGCAGCAGT (SEQ ID NO:7), Reverse: GGACTACCAGGGTATCTAATCCTGTT (SEQ ID NO: 8), Probe:
  • CGTATTACCGCGGCTGCTGGCAC (SEQ ID NO: 9) (Nadkarni et al., 2002); A. muciniphila 16S rRNA gene: Forward: C GGT GG AGT AT GT GGC TT A AT (SEQ ID NO: 10), Reverse: CCATGCAGCACCTGTGTAA (SEQ ID NO: 11), probe:
  • E. coli 16S rRNA gene was detected using the primers and probe: Forward:
  • CAGAAGAAGCACCGGCTAAC (SEQ ID NO: 15). The relative quantity was calculated using the comparative CT method normalizing to the amount of all bacteria in the sample (Schmittgen and Livak, 2008).
  • the sequence of miR-30d-5p (uguaaacauccccgacuggaag (SEQ ID NO:2)) was blasted against whole genome sequence of A. muciniphila using the NCBI blast tool for sequence pairing. RNAhybrid was used to characterize the minimum free energy of secondary structure binding between miR-30d and potential targeting A.
  • Mission® miRNA mimics used were (5’ to 3’): miR-30d-
  • 5p_antisense [AmC6]CUUCCAGUCGGGGAUGUUUUACA[dT][dT] (SEQ ID NO:2); miR-30d-5p_sense: UGUAAAC AUCCCCGACUGGAAG[dT] [dT] (SEQ ID NO:2); hsa-miR-l246_anti sense: [AmC6]CCUGCUCCAAAAAUCCUAUU[dT][dT] (SEQ ID NO:6); hsa-miR-l246_sense: aauggauuuuuggagcagg[dT][dT] (SEQ ID NO:6); hsa-miR-7706_anti sense:
  • Synthetic miR-30d was orally administered to germ-free mice and fecal specimen were collected at the gavage (0 hour), and every 2 hours post
  • Fecal sample was soaked in 2 ml cold PBS for 5 min, and dissociated with PowerLyzer®24 Homgenizer (Mo Bio Laboratories, CA). The suspension was centrifuged at 300 xg, 4 °C for 10 min, followed by the additional centrifugation at 2000xg, 4 °C for 15 min. The supernatant was collected and filtered through a 0.8 pm filter (EMD Millipore, MA) to further remove debris.
  • PowerLyzer®24 Homgenizer Mo Bio Laboratories, CA
  • the supernatant was collected and filtered through a 0.8 pm filter (EMD Millipore, MA) to further remove debris.
  • MV Microvesicle
  • exosome and non-vesicle fractions were sequentially separated from the filtrate with 0.22 pm filter (EMD Millipore), 0.02 pm filter (GE Healthcare) and 3 kDa Amicon ETltra Centrifugal Filters (EMD Millipore), as previously described (Wei et al., 2017).
  • Total RNA was isolated from each fraction using Total RNA Purification Kit (Norgen Biotek, Canada). The RNA concentrations were determined using Quant-iT
  • RNA Assay Kit (Thermo Fisher Scientific). Two nanogram of total RNA was used in 10 pl reverse transcription reaction with ETniversal cDNA Synthesis kit II (Exiqon). The qPCR reaction was performed using the ExiLENT SYBR Green master mix and pre-designed LNA primers (Exiqon) and miR-2l as reference.
  • mice 12 (Strain #: 7296, The Coli Genetic Stock Center at Yale) were grown anaerobically in Brain Heart Infusion (BHI) medium (SKU 53286, Sigma Aldrich).
  • BHI Brain Heart Infusion
  • 5xl0 8 freshly cultured logarithmic phase bacteria in 200 pl BHI medium were given by oral gavage daily for 7 consecutive days.
  • A. muciniphila and E. coli K-12 were cultured to a logarithmic phase and harvested by spinning down at 12600 rpm.
  • the bacteria suspensions were inactivated by eight cycles of freezing at -80 °C and thawing at 37 °C.
  • the bacteria suspensions were inactivated by eight cycles of freezing at -80 °C and thawing at 37 °C.
  • muciniphila was inoculated to a 010 mm sterile disk (Item ID: 74146, Millipore Sigma) on BHI w/o Dextrose plus 0.2% lactose and plus 400 pg/ml X-Gal, and incubated at 37°C anaerobically for 5 days, during which 30 m ⁇ of 100 mM synthetic miR-30d, or scrambled miR-30d was added at 24 h and 48 h after inoculation b-galactosidase activity was quantified by measuring the color changed (blue) area around the disk with A. muciniphila using ImageJ.
  • A. muciniphila was cultured in the presence of H 2 0 (vehicle), 3 pM miRNA mimics miR-30d, and scrambled miR-30d to a log phase and stopped by chilling on ice and stabilized with RNAlater® Solutions (Ambion). Total bacterial RNA from cultured bacterial was extracted using TRIzol® MaxTMBacterial RNA isolation Kit (Ambion) following the manufacturer’s protocol. cDNA was prepared using High Capacity cDNA Reverse Transcription Kit (Applied biosystems). QPCR was performed using Taqman Universal PCR Master Mix and TaqMan® Gene Expression Assay primer pairs as following: A. muciniphila AMUC RS06985: Forward:
  • AMUC RS07700 Forward: T GAAAGGGAGGGTT C ATCTG (SEQ ID NO:20), Reverse: ATCC AC ACGGGC AGAGT AAT (SEQ ID NO:2l), probe:
  • AMUC RS10850 Forward: CAACATGGAAACCTCCATCC (SEQ ID NO:23), Reverse: GACCAGTTCCTGGGTGACAT (SEQ ID NO:X24X), probe:
  • AMUC_RS07700 were amplified by PCR using the following primers (with restriction sequences underlined): AMUC_RS06985 (XbaIAMUC_RS06985Fwd: 5’- GCTCTAGAGCATGAAATTTGTCGCCAAAATCCTG-3’ (SEQ ID NO:29), KpnIAUMC_RS06985Rev: 5’-
  • bacteria were streaked on LB agar containing 100 pg/ml ampicillin and 400 pg/ml X-gal, and grew at 37°C for 3 days.
  • the sequence of protein product of A. muciniphila gene AMUC RS06985 was aligned to sequences of beta-galactosidases of different species available at UniProt (uniprot.org) using Protein BLAST tool from NCBI. Typical positive blast hit, the beta-galactosidase of Ktedonobacter racemifer DSM 44963 (Accession ID: EFH89096) (E value: 0.023) was further aligned using T- Coffee (Notredame et al., 2000) and viewed with Jalview (Waterhouse et al., 2009).
  • mice were immunized with MOG and simultaneously orally administered with synthetic miRNA or bacteria for 7 consecutive days as indicated in results.
  • cells were collected from the spleen and measured T lymphocytes following established approach (Rezende et al., 2015). Briefly, intracellular cytokine staining was performed by first stimulating cells for 4 h with PMA (phorbol 12- myristate l3-aceate; 50 ng/ml; Sigma-Aldrich) and ionomycin (1 mM; Sigma-Aldrich) and a protein-transport inhibitor containing monensin (1 pg/ml Golgi Stop; BD
  • PE-Cy7-IL-l7A eBiol7B7; 1 : 100; eBioscience.
  • colonic tissue was collected 10 days post MOG/CFA or OVA/CFA immunization.
  • Colonic epithelial cells and lamina basement cells were isolated following the established protocol(Moreira et al., 2019).
  • Colonic homogenates were incubated with DTT as described(Moreira et al., 2019) and were separated into CD45- and CD45+ fractions using CD45 Microbeads (Order number: 130-052-301, Miltenyi Biotec).
  • Epithelial cells from the CD45- fraction were further sorted out by staining with 7-AAD for dead cell exclusion and FITC-anti-CD3 (500A2; 1 : 100; Biolegend), APC-anti-CD326 (Ep-CAM) (G8.8; 1 : 100; Biolegend), APC-anti-CD324 (E- Cadherin) (DECMA-l; 1 : 100; Biolegend) and APC-anti-pan Cytokeratin (C-l l;
  • CD45+ fraction was further sorted for ab+ T cells (7-AAD-,
  • CD3+, TCRy5-, TCRp+) and gd+ T cells (7-AAD-, CD3+, TCRp-, TCRy5+) by staining with 7-AAD for dead cell exclusion and FITC-anti-CD3 (500A2; 1 : 100; Biolegend), PE-anti -TCRy5 (GL3; 1 : 100; Biolegend) and Brilliant Violet 605 -anti - TCR-b (H57-597; 1 : 100; Biolegend).
  • CD45+ fraction was separated from the colonic lamina intestinal isolates using CD45 Microbeads and was further stained with 7-AAD and APC-conjugated epithelium dump channel (anti-CD326 (Ep-CAM) (G8.8; 1 : 100; Biolegend), anti-CD324 (E-Cadherin) (DECMA-l; 1 : 100; Biolegend), anti-pan Cytokeratin (C-l l; 1 : 100; Invitrogen)), PerCP-conjugated dump channel (anti-NKl.l (PK136; 1 : 100; Biolegend), anti-Ly-6G (1 A8; 1 : 100; Biolegend), anti-B220 (RA3- 6B2; 1 : 100; Biolegend), anti-CD3 l7 (927; 1 : 100; Biolegend), anti-CD3 (145-201; 1 : 100; Biolegend)), FITC-anti-CD45 (30-F11 ; 1
  • DCs dendritic cells
  • MSNs of naive mice were first enriched with ETltraPure CD1 lc MicroBeads (order No. 130-108-338, Miltenyi Biotec), and then sorted by gating 7-AAD- PerCP- CD45+ F4/80- CD64- CD1 lc+ cells.
  • Antibodies used for sorting were: PerCP-conjugated dump channel (anti-TER-l 19 (TER-119), anti-NKl.l(PKl36), anti-CD l9(6D5), anti- Ly-6G (1A8), anti-CD3e(l45-2Cl 1), all at 1 :300 dilution; Biolegend), APC-anti- CD45 (30-F11; 1 :300; Biolegend), FITC-anti-F4/F80 (BM8; 1 : 100; Biolegend), FITC-anti-CD64 (X54-5/7.1; 1 : 100; Biolegend) and PE-anti-CDl lc (N418; 1 :200; Biolegend).
  • Naive CD4+ T cells were isolated from the spleen of Foxp3 GFP+ mice using Naive CD4+ T cell Isolation Kit (Order No. 130-104-453, Miltenyi Biotec).
  • muciniphila or E. coli were added to directly stimulate naive CD4 T cells.
  • qPCR was performed to detect miR-30d using TaqMan® MiRNA Reverse Transcription (Applied Biosystems) and Taqman ETniversal PCR Master Mix according to the manufacturer’s protocol.
  • the input of total RNA per sample was 5 ng.
  • the TaqMan® MiRNA Assay IDs (Applied Biosystems) were: snoRNAl35 (inner control, assay ID: 001230), the hsa-miR-30d-5p (assay ID: 000420).
  • the TaqManTMGene Expression Assay IDs were: Gapdh (Assay ID: Mm999999l5_gl, reference gene), Tgfbl (Assay ID: MmOl l78820_ml), 116 (Assay ID: Mm00446l90_ml), Illbeta (Assay ID: Mm00434228_ml).
  • A. muciniphila was cultured in 1 ml medium of BHI w/o dextrose plus 0.2% mucin in the presence of 5 mM synthetic miR-30d mimics or scramble for 18 hours to an exponential phase.
  • Bacterial cells were spin down at 12000 rpm. Washed twice with ice cold PBS and fixed with 4% PFA/0.25% Glutaraldehyde. 100 nm cryosection were proceeded on nickel grids and carried out for in situ hybridization using a 5’- DIG and 3’-DIG dual labeled probe for miR-30d (Cat#YD00613716-BEG,
  • EAE is a primary animal model of MS (Robinson et al., 2014).
  • Mouse model of spontaneous relapsing-remitting MS does not develop EAE when raised under germ-free condition (Berer et al., 2011) and mice orally treated with antibiotics have less severe EAE (Ochoa-Reparaz et al.,
  • muciniphila was increased in the feces from MOG-induced EAE mice, but not from OVA/CFA immunized mice, on day 15 ( Figure 1C and Table 1), which we confirmed by quantitative PCR (qPCR) ( Figure ID).
  • qPCR quantitative PCR
  • A. muciniphila was also found to be increased in the stool of untreated MS patients compared to healthy subjects from multiple studies including ours (Berer et al., 2017; Cekanaviciute et al., 2017; Jangi et al., 2016; Tremlett et al., 2016).
  • Taxonomy for Table 1 is :
  • o Verrucomicrobiales
  • f Verrucomicrobiaceae
  • g Akkermansia
  • MicroRNAs are heat resistant (Jung et ah, 2010); thus to determine whether fecal miRNAs were responsible for the effects we observed, we purified fecal RNA from peak EAE feces and administered it orally to recipient mice prior to
  • RNA components found in the feces are small RNAs, and predominantly miRNAs (Liu et ah, 2016).
  • fecal miRNAs were generated during EAE, we performed small RNA sequencing in which we measured fecal RNA from peak EAE, OVA-immunized and non-immunized mice.
  • peak EAE mice had an increased level of miR- 30d-5p (miR-30d) compared to OVA-immunized and non-immunized mice ( Figure 3A and Table 2).
  • nb ⁇ 1+ CD4+ T cell population was MOG-specific (Bettelli et al.,
  • MiRNAs are stable (Jung et al., 2010) in a varies of mechanisms including existing in extracellular microvesicle (MV) and/or in a MV-free high-density lipoproteins or argonaute protein-binding form (Creemers et al., 2012). To investigate whether oral delivered miR-30d can survive the gastric acidity and reach intact to the colon.
  • A. muciniphila When we replaced glucose with the disaccharide lactose (can be cleaved by b-galactosidase, also called lactase, into glucose and galactose) in culture, A. muciniphila was able to grow. The use of another disaccharide, sucrose, which requires a-galactosidase to cleave into glucose and fructose, did not support the growth of A. muciniphila. Thus, these data suggest that A. muciniphila has b- galactosidase, which converts lactose to glucose. To test this hypothesis, we used another BHI agar without glucose, but contains mucin, which is favored by A.
  • X-gal is an organic substrate for b-galactosidase that is hydrolyzed to the blue-color product 5,5'-dibromo-4,4'-dichloro-indigo (Kiernan, 2007) ( Figure 12).
  • A. muciniphila colonies turned blue, confirming that A. muciniphila has b-galactosidase to hydrolyze mucin. This is consistent with a study in which b- galactosidase was found to be among mucin-degrading enzymes in the A. muciniphila membrane protein fraction (Ottman et al., 2017).
  • b- galactosidase was found to be among mucin-degrading enzymes in the A. muciniphila membrane protein fraction (Ottman et al., 2017).
  • AMUC RS07700 with the protein sequences of different b-galactosidases.
  • AMUC RS06985 was homologous to b-galactosidases of several species including Ktedonobacter racemifer ( Figure 5C), Bifidobacterium bifidum,
  • o Verrucomicrobiales
  • f Verrucomicrobiaceae
  • g Akkermansia
  • Example 6 A. muciniphila Ameliorates EAE by Stimulating Treg-driving Cytokines in Dendritic Cells
  • A. muciniphila induces Foxp3+ Tregs
  • Both bacteria minimally induced Foxp3+ Tregs ( Figure 6E), suggesting that A. muciniphila does not directly induce more Tregs as compared to E. coli.
  • DCs from mesenteric lymph node are known to play a crucial role in Treg induction (Coombes et ak, 2007; Cording et ah, 2014; Pezoldt et ah, 2018), we isolated DCs from MLN, pulsed them with inactivated A. muciniphila or E. coli , and co-cultured them with naive CD4+ T cells. We found that A.
  • miR-7706 and miR-l246 are two additional miRNAs that are able to improve disease.
  • Type 1 diabetes is an autoimmune disease pathologically featured by lower insulin due to loss of pancreatic islets.
  • the NOD/ShiLtJ commonly called NOD mice is a polygenic model for autoimmune type 1 diabetes. NOD mouse is characterized by hyperglycemia and insulitis. Dramatic pancreatic insulin decrease occurs in females at about 12 weeks of age.
  • To test the effect of miRNA on T1D we orally gavaged miR-30d to NOD mice starting prior to onset of disease at 8 weeks of age at the dose of 250 pmol for 11 consecutive days. We found that 11 days orally administration of synthetic miR-30d delayed the disease by 5 weeks (Figure 16).
  • Our data suggest that the miRNAs we identified from the stool of peak EAE and untreated MS patient stool not only have beneficial effects on EAE, but also have favorable potentials against other autoimmune diseases, such as T1D.
  • miR-30d can modulate gut microbiome; obesity is a condition that has been reported to be associated with perturbations in the microbiome.
  • HFD high fat diet induced diabetes mouse model
  • miR-30d may be a treatment in lowering lipids in obesity and in improving obesity-related conditions.
  • oligodendrocyte glycoprotein-specific T and B cells cooperate to induce a Devic- like disease in mice.
  • muciniphila gen. nov. sp. nov., a human intestinal mucin-degrading bacterium.
  • Thl7 Cells by Segmented Filamentous Bacteria Cell 139, 14-14.
  • SortMeRNA fast and accurate filtering of ribosomal RNAs in metatranscriptomic data. Bioinformatics 28, 3211-3217. doi: l0.l093/bioinformatics/bts6l 1
  • Treg cells mediate recovery from EAE by controlling effector T cell proliferation and motility in the CNS. Acta Neuropathol Commun 2, 163. doi: l0.H86/s40478-
  • RNAhybrid microRNA target prediction easy, fast and flexible. Nucleic Acids Research 34, W451-4. doi: l0.l093/nar/gkl243 Lee, Y., Awasthi, A., Yosef, N., Quintana, F.J., Xiao, S., Peters, A., Wu, C.,
  • Vafadamejad E., Floess, S., Arampatzi, P., Buettner, M., Schweer, J., Fleissner, D., Vital, M., Pieper, D.H., Basic, M., Dersch, P., Strowig, T., Hornef, M.,
  • EAE autoimmune encephalomyelitis
  • the Toll-like receptor 2 pathway establishes colonization by a commensal of the human microbiota. Science (New York, NY) 332, 974-977.
  • Host-derived fecal microRNAs can indicate gut microbiota healthiness and ability to induce inflammation. Theranostics 9, 4542-4557.
  • Jalview Version 2 a multiple sequence alignment editor and analysis workbench. Bioinformatics 25, 1189-1191. doi: l0. l093/bioinformatics/btp033

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Medicinal Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Methods for treating subjects who have autoimmune diseases including multiple sclerosis. The methods include administering, e.g., orally, one or more micro RNAs, e.g., miR-30d, miR-7706, and miR-1246, or mimics thereof.

Description

The Microbiome as a Target of MicroRNAs for the Treatment of Disease
CLAIM OF PRIORITY
This application claims the benefit of ET.S. Provisional Application Serial No. 62722136, filed on August 23, 2018. The entire contents of the foregoing are incorporated herein by reference. TECHNICAL FIELD
This application relates, at least in part, to methods for treating subjects who have autoimmune diseases including multiple sclerosis. The methods include administering, e.g., orally, one or more micro RNAs, e.g., miR-30d, miR-7706, and miR-l246, or mimics thereof. BACKGROUND
Multiple sclerosis (MS) is an autoimmune disease directed against the central nervous system (CNS) myelin, and is associated with demyelination, oligodendrocyte loss, reactive gliosis, and axonal degeneration (Baecher-Allan et al., 2018). MS is a heterogeneous, multifactorial disease influenced by both genetic and environmental factors (Baecher-Allan et al., 2018). Pathologically, activated autoreactive CD4+ T cells in the periphery migrate to the CNS and initiate the MS process. Interferon gamma (åFNy) -producing Thl and interleukin- 17 (IL-l7)-secreting Thl7 CD4+ T cells play a central role in the pathogenesis of MS (Baecher-Allan et al., 2018). These responses can be regulated in the periphery and/or in the CNS by regulatory cells such as FoxP3+ regulatory T cells (Tregs) (Lu and Rudensky, 2009).
SUMMARY
As shown herein, administration of certain miRNAs, including miR-30d, increased the abundance of the gut commensal Akkermansia muciniphila (A.
muciniphila ), which in turn induced cytokines in dendritic cells that drove Treg differentiation and ameliorated symptoms in the experimental autoimmune encephalomyelitis (EAE) model of MS. In addition, administration of miR-7706 and miR-l246 was also shown to ameliorate EAE. These findings identify new avenues of therapeutic intervention. Thus provided herein are methods for treating, reducing risk of development or progression of, or reducing symptoms of, an inflammatory condition in a subject. The method comprise administering a therapeutically effective amount of a nucleic acid comprising a sequence that is identical to a contiguous sequence of at least 12 nucleotides present in mature miR-30d, miR-7706, and/or miR-l246 microRNA, to a subject in need thereof. Also provided herein are nucleic acids comprising a sequence that is identical to a contiguous sequence of at least 12 nucleotides present in mature miR-30d, miR-7706, and/or miR-l246 microRNA for use in a method of treating, reducing risk of development or progression of, or reducing symptoms of, an inflammatory condition in a subject, the method comprising administering a therapeutically effective amount of a nucleic acid comprising a sequence that is identical to a contiguous sequence of at least 12 nucleotides present in mature miR- 30d, miR-7706, and/or miR-l246 microRNA, to a subject in need thereof.
Also provided herein are methods for reducing interferon gamma (åFNy)- producing Thl and/or interleukin- 17 (IL-l7)-secreting Thl7 CD4+ T cells, and/or increasing regulatory cells such as FoxP3+ regulatory T cells (Tregs), in the periphery and/or in the CNS in a subject. The methods comprise administering a therapeutically effective amount of a nucleic acid comprising a sequence that is identical to a contiguous sequence of at least 12 nucleotides present in mature miR-30d, miR-7706, and/or miR-l246 microRNA, to a subject in need thereof. Additionally provided herein are nucleic acids comprising a sequence that is identical to a contiguous sequence of at least 12 nucleotides present in mature miR-30d, miR-7706, and/or miR-l246 microRNA for use in a method of reducing interferon gamma (IFNy)- producing Thl and/or interleukin- 17 (IL-l7)-secreting Thl7 CD4+ T cells, and/or increasing regulatory cells such as FoxP3+ regulatory T cells (Tregs), in the periphery and/or in the CNS in a subject.
In some embodiments, the nucleic acid is 12-24 nucleotides long.
In some embodiments, the nucleic acid is identical to a contiguous sequence of at least 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 nucleotides present in mature miR- 30d, miR-7706, and/or miR-l246 microRNA.
In some embodiments, the nucleic acid is a mature miRNA or miRNA mimic selected from miR-30d, miR-7706, and/or miR-l246, e.g., a miRNA mimic thereof. In some embodiments, the methods include administering miR-30d; miR- 7706; miR-l246; miR-30d and miR-7706; miR-30d and miR-l246; miR-7706 and miR-l246; or miR-30d, miR-7706, and miR-l246.
Further provided herein are methods for of increasing relative abundance of Akkermansia muciniphila in the gut microbiome of a subject. The methods include administering a therapeutically effective amount of a nucleic acid comprising a sequence that is identical to a contiguous sequence of at least 12 nucleotides present in mature miR-30d to a subject in need thereof. Also provided herein are nucleic acids comprising a sequence that is identical to a contiguous sequence of at least 12 nucleotides present in mature miR-30d for use in a method of increasing relative abundance of Akkermansia muciniphila in the gut microbiome of a subject in need thereof.
In some embodiments, the nucleic acid is 12-24 nucleotides long. In some embodiments, the nucleic acid is identical to a contiguous sequence of at least 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 nucleotides present in mature miR-30d microRNA.
In some embodiments, the nucleic acid is a mature miR-30d miRNA or miRNA mimic of miR-30d.
In some embodiments, the subject has an inflammatory condition. In some embodiments, the subject has cancer, e.g., a solid tumor, e.g., and is being treated with immunotherapy, e.g., a checkpoint inhibitor antibody.
In some embodiments, the condition is an inflammatory autoimmune disease.
In some embodiments, the condition is selected from the group consisting of Type 1 diabetes; multiple sclerosis; inflammatory bowel disease (IBD)/colitis; obesity and obesity-related conditions; epilepsy; immune-mediated liver injury; amyotrophic lateral sclerosis (ALS); rheumatoid arthritis; and aging or progeria.
In some embodiments, the nucleic acid is a miRNA mimic. In some embodiments, the miRNA mimic comprises one or more modifications. In some embodiments, the modifications include but are not limited to: double-stranded sequence, 5’ Amino-Modifier C6, and/or 3’ [dT][dT]
In some embodiments, the nucleic acid is administered orally or rectally.
In some embodiments, the nucleic acids are formulated to be administered orally or rectally. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.
Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.
DESCRIPTION OF DRAWINGS
Figures 1 A-D. Analysis of Gut Microbiome Changes During MOG- induced EAE.
(A-D) Mice were immunized with OVA or MOG and feces were collected at day 0 (0-day post immunization, 0 d.p.i., naive), 8 d.p.i. (prior to EAE symptom onset for MOG-immunized mice), and 15 d.p.i. (peak EAE for MOG-immunized mice). (A- C) Bacterial 16S rDNA sequence-based microbiome surveys were performed. (A) Principal coordinates analysis (PCoA) based on unweighted UniFrac metrics. (B) Principal coordinates analysis (PCoA) based on weighted UniFrac metrics. (C)
Relative abundance of bacteria classified at a species-level taxonomy. OVA n=5, MOG h=10. One-way ANOVADunnetf s multiple comparisons test. Arrow highlights species that were increased at EAE peak; MOG 15 d.p.i. vs MOG 0 d.p.i. P= 0.0001, MOG 15 d.p.i. vs MOG 8 d.p.i. P= 0.0099, MOG 15 d.p.i. vs OVA 15 d.p.i. P= 0.05. (D) qPCR quantification of the relative abundance of Akkermansia muciniphila (A. muciniphila ) by measuring 16S rDNA, referenced to universal bacterial 16S rDNA. Naive n=27, 15 d.p.i. of OVA n=l9, 15 d.p.i. of MOG n=23. Error bars denote mean ± SEM, One-way ANOVA Tukey’s multiple comparisons test.
Figures 2A-I. Both Fecal Transfer and Fecal miRNA Transfer from Peak EAE Donor Ameliorate EAE in Recipients.
(A-B) The effect of transfer of feces from different stages of EAE on EAE in recipient mice. (A) Schematic of experimental design. Donor mice were immunized with MOG/CFAto induce EAE. Feces were collected at day 0 (naive), day 8 post immunization (8 d.p.i., prior to symptom onset), and 15 d.p.i. (peak) and orally gavaged to recipient mice 6 days-, 4 days- and 2 days- prior to the induction of EAE in the recipients. (B) Clinical scores of EAE (left) and linear regression curves (right) in recipient mice. Combined data of two independent experiments at 0 d.p.i. (n=l2), 8 d.p.i. (n=5), and 15 d.p.i. (n=l2). Error bars denote mean ± SEM; statistical analysis by two-way ANOVA and linear regression. (C-D), Analysis of the role of live bacteria in the EAE fecal transfer. (C) Experimental scheme. Donor mice were immunized with MOG or ovalbumin (OVA). Feces were collected at 15 d.p.i. (EAE peak), heat- inactivated or kept intact, and orally gavaged to recipient mice 6 days-, 4 days- and 2 days- prior to EAE induction in the recipients. (D) Clinical scores of EAE (left) and linear regression curves (right) in the recipient mice. Representative data of two independent experiments with n=7 each group; Error bars denote mean ± SEM, statistical analysis by two-way ANOVA and linear regression. (E-F) Effect of oral administration of MOG-induced EAE peak fecal RNA on EAE. (E) Experimental scheme. Donor mice were immunized with MOG or OVA. Feces were collected at 15 d.p.i. when the MOG-immunized mice were at peak of EAE. Fecal RNA was isolated from donor feces and orally gavaged 6 days-, 4 days- and 2 days- prior to induction of EAE in the recipients. (F) Clinical scores of EAE (left) and linear regression curves (right) in the recipient mice. Representative data of two independent experiments with h=10 each group; Error bars denote mean ± SEM, statistical analysis by two-way
ANOVA and linear regression. (G-I) Therapeutic effect of oral administration of EAE peak fecal RNA on established EAE. Fecal RNA isolated from EAE peak or OVA- immunized mice was orally gavaged to EAE recipients at the dose of 10 pg RNA in 200 mΐ FhO/mouse daily for 7 consecutive days starting when recipients had a disease score = 1. (G) Clinical scores of EAE (left) and linear regression curves (right) in the recipient mice, representative data of three independent experiments, FhO (vehicle) n=l3, OVA-induced n=l2, MOG-induced n=l3; Error bars denote mean ± SEM, statistical analysis by two-way ANOVA and linear regression. (H) Histopathological evaluation of demyelination with Luxol Fast Blue (LFB) and axonal loss with Bielschowsky’s silver (Silver) staining of representative spinal cord sections from naive mice and EAE mice treated with feces from FhO (vehicle) or EAE peak EAE feces. Arrows denote demyelination (LFB) and axonal lost (Silver) in FhO (vehicle) treated EAE, scale bars, 500 pm. (I) Quantification of demyelination and axonal loss based on LFB and Silver staining for individual mice. Representative data of three independent experiments with n=6 mice/group, Error bars denote mean ± SEM, one- way ANOVADunnett’s multiple comparisons test. n.s. not significant, * P<0.05, ** PO.Ol, *** P<0.00l, **** p<0.000l.
Figures 3A-D. MiR-30d Is Enriched in Feces from EAE Animals at Peak
Disease and in Feces from Untreated MS Patients.
(A-B), RNA was isolated from feces of non-immunized (naive) mice, mice immunized with OVA or mice immunized with MOG at 15 days post immunization (peak EAE). (A) Fold change of the changed miRNAs in top 25 abundant miRNAs by small RNA-Seq. Data were normalized to total reads. * P<0.05, ** R<0.01, n=5 each group, Error bars denote mean ± SEM, two-way ANOVADunnett’s multiple comparisons test. (B) higher expression of miR-30d-5p in MOG-immunized EAE peak was verified by qPCR; Non-immunized n=9, OVA-immunized n=l2, MOG- immunized n=l2, Error bars denote mean ± SEM, one-way ANOVADunnett’s multiple comparisons test. (C-D), RNA was isolated from feces of non-treated relapsing-remitting MS patients and healthy controls (HC). (C) Fold change of the top 25 miRNAs by small RNA-Seq. Data were normalized to total reads. * P<0.05, ** PO.Ol, h=10 each group; Error bars denote mean ± SEM, Mann Whitney test. (D) higher expressions of miR-30d-5p, miR-7706 and miR-l246 in MS patients were verified by qPCR, n=l2 each group, Error bars denote median ± 95%CI, Mann Whitney test. n.s. not significant, * P .05, ** PO.Ol, *** PO.OOl.
Figures 4A-I. Oral Administration of Synthetic miR-30d Ameliorates EAE in a Recipient Gut microbiome-dependent Manner.
(A-B) synthetic miR-30d, scramble control, or FhO(vehicle) was orally gavaged to EAE recipients starting at disease onset (day 11, disease score=l) daily for 7 consecutive days. (A) Clinical scores of EAE (left) and linear regression curves (right) in the recipient mice. Representative data of two independent experiments; FhO(vehicle) n=8, scramble n=l3, miR-30d n=ll, Error bars denote mean ± SEM, statistical analysis by two-way ANOVA and linear regression. (B) Quantification of demyelination and axonal loss for individual mice. Data combined from two independent experiments with n=8 mice/group; Error bars denote mean ± SEM, one- way ANOVADunnett’s multiple comparisons test. (C-D) Mice were immunized with MOG and orally administered synthetic miR-30d or scramble control daily at a dose of 1000 pmol in 200 mΐ H20/mouse for 7 consecutive days. Foxp3+ T cells in the total CD4+ T cell population (C) and in the nb11+ CD4+ T cell population (D) in the spleen were analyzed by FACS. Left panel: Representative FACS plots of Foxp3+ CD4+ T cells; Right panel: % of CD4+ Foxp3+ T cells in individual animals (n=4 per group). Error bars denote mean ± SEM; one-way ANOVA Tukey’s multiple comparisons test. (E-G) Effect on EAE of transfer of fecal microbiome from synthetic miR-30d treated mice. Donor mice were immunized with MOG and orally treated with FLO (vehicle), scrambled-miR-30d, or miR-30d for 7 consecutive days. Feces were collected and used to colonize mice that were pre-treated with antibiotics (ABX) for 7 days prior to colonization. Recipient mice were then induced for EAE. (E)
Experimental scheme. (F) Clinical scores of EAE (left) and linear regression curves (right) in the recipient mice. Combined data of two experiments with FLO (vehicle) n=l9, scramble n=2l, miR-30d n=24; Error bars denote mean ± SEM, statistical analysis by two-way ANOVA and linear regression. (G) Quantification of
demyelination and axonal loss. Values for individual mice are shown, combined from 2 independent experiments. n=l9, scramble n=l9, miR-30d n=20; Error bars denote mean ± SEM, one-way ANOVA Dunnett’s multiple comparisons test. (H-I) ABX abrogated therapeutic effect of oral miR-30d on EAE. Synthetic miR-30d, scramble control, or FLO (vehicle) control was orally gavaged to EAE recipients starting at the onset of disease (day 11, disease score =1) at a dose of 250 pmol in 200 mΐ FLO /mouse daily for 7 consecutive days. Mice were simultaneously gavaged with an antibiotics mixture (ABX). (H) Clinical scores of EAE (left) and linear regression curves (right., Combined data from two independent experiments, H20 (vehicle) h=10, Scrambled miR-30d n=ll, miR-30d n=ll, Error bars denote mean ± SEM, statistical analysis by two-way ANOVA and linear regression. (I) Quantification of demyelination and axonal loss for individual mice from two independent experiments (n=6 mice/group); Error bars denote mean ± SEM, one-way ANOVA Dunnett’s multiple comparisons test. * P<0.05, ** P<0.0l, *** P<0.00l.
Figures 5A-I. MiR-30d Enhances b-galactosidase of A. muciniphila and Expands A. muciniphila in vivo.
(A) A. muciniphila genes (AMUC_RS06985, AMUC_RS07700,
AMLTC_RSl0850) were predicted to be targeted by miR-30d by sequence alignment. SEQ ID NOs:37, 2, 38, 2, 39 and 2 are shown. (B) A. muciniphila was grown in the presence of synthetic miR-30d, scrambled miR-30d or H20 (vehicle). Transcripts of the predicted targeting genes at log phase were quantified by qPCR normalized to 16S rRNA. H2O (vehicle) n=l3, scrambled miR-30d n=l5, miR-30d n=l5, Error bars denote mean ± SEM, one-way ANOVADunnett’s multiple comparisons test. (C) Protein sequence alignment of AMETC_RS06985 of A. muciniphila (SEQ ID NO:40) and b-galactosidase of Ktedonobacter racemifer ( K . racemifer)(K rac_ 10625) (SEQ ID NO:4l). (D) AMUC RS06985 of A. muciniphila or its truncated sequence was cloned into a b-galactosidase-deficient (lacZAM l 5) . coli. The cloned A. coli colonies were grown on an X-gal-containing agar. (E) A. muciniphila was grown on BHI agar containing lactose and b-galactosidase activity indicator, X-gal and was treated with synthetic miR-30d or scrambled miR-30d. b-galactosidase activity was quantified according to the color change, n=5 each group, Error bars denote mean ± SEM, paired t test. (F-I) The effect of oral administration of synthetic miR-30d on the gut microbiome. Mice were immunized with MOG and orally gavaged with 250 pmol synthetic miR-30d, scramble or H20 (vehicle) for 7 days. Feces were collected at day 7 and bacterial 16S rDNA sequence-based microbiome surveys were performed. (F) Experimental scheme. (G) Principal coordinates analysis (PCoA) based on weighted UniFrac metrics and (H) Relative abundance of bacteria by 16S sequencing was classified at a species-level taxonomy. H2O (vehicle) n=l4, scramble n=l3, miR-30d n=l3. One-way ANOVADunnett’s multiple comparisons test. Arrow identifies species that were significantly higher in miR-30d group compared to the other two groups. H2O (vehicle) vs miR-30d .P= 0.0129, scramble vs miR-30d .P= 0.0087. (I) qPCR quantification of the relative abundance of A. muciniphila by measuring the 16S rDNA gene, referenced to universal 16S rDNA. H2O (vehicle) n=l4, scramble n=l4, miR-30d n=l3. Error bars denote mean ± SEM, One-way ANOVA Tukey’s multiple comparisons test.
Figures 6A-G A. muciniphila Promotes Tregs by Stimulating the
Production of Treg-driving Cytokines in Dendritic Cells and Suppresses EAE.
(A-B) Effect of orally gavaged A. muciniphila on established EAE. Fresh cultured log phase Akkermanisa , E. coli , or Brain Heart Infusion culture medium
(Medium) was orally administered to EAE recipients in 200 mΐ culture medium daily starting at the onset of disease (day 11, disease score=l) for 7 consecutive days. (A) Clinical scores of EAE (left) and linear regression curves (right) in the recipient mice. Combined data of 3 experiments. Medium n=23, E. coli n=27, A. muciniphila n=28, Error bars denote mean ± SEM, statistical analysis by two-way ANOVA and linear regression. (B) Quantification of demyelination and axonal loss for individual mice. Combined data of three independent experiments (n=6 mice/group); Error bars denote mean ± SEM, one-way ANOVA Dunnett’s multiple comparisons test. (C-D) Freshly cultured logarithmic phase A. muciniphila , E. coli , or Medium was orally
administered to MOG-immunized mice in 200 mΐ culture medium/mouse daily for 7 consecutive days. Foxp3+ T cells in the total CD4+ T cell population (C) and in the nb11+ CD4+ T cell population (D) in the spleen were analyzed by FACS. Left panel: Representative FACS plots of Foxp3+ CD4+ T cells; Right panel: % of CD4+ Foxp3 T cells in individual animals (n=4 per group). Error bars denote mean ± SEM, One- way ANOVA Tukey’s multiple comparisons test. n.s. not significant, * P<0.05, ** P<0.0l. (E) Sorted naive CD4+ T cells from Foxp3-GFP reporter mice were induced toward Treg cell differentiation for 3 days in the presence of TGF-b plus IL-2 and in the presence of either A. muciniphila or E. coli. (F) CDllc+ dendritic cells were sorted from the mesenteric lymph nodes (MLN) of naive mice and stimulated with A. muciniphila or E. coli. Sorted naive CD4+ T cells from Foxp3-GFP reporter mice were added 24 hours after and were induced toward Treg cell differentiation for 3 days in the presence of TGF-b and IL-2. (E-F) 72 h after Treg induction, live CD4+ cells were gated and determined for Foxp3+ (GFP+) T cells. Left panel:
Representative FACS plots of Foxp3+ CD4+ T cells; Right panel: % of CD4+ Foxp3+ T cells in individual replicates. Data represent the mean ± SEM, (E) n=4 and (F) n=9, one-way ANOVA Dunnett’s multiple comparisons test. (G) CDllc+ dendritic cells were sorted from the MLN of naive mice and stimulated with E. coli or A.
muciniphila for 24 hours. RNA was isolated and quantified for Tgfb, 116, and II lb by qPCR. Data represent the mean ± SEM, n=7, one-way ANOVA Dunnett’s multiple comparisons test. n.s. not significant, * P<0.05, ** R<0.01, *** P<0.00l, **** PO.OOOl.
Figure 7. Intestinal Dendritic Cells Are Responsible for the Generation of miR-30d Specifically upon MOG Immunization.
Mice were immunized with MOG or OVA/CFA. 10 days post immunization, dendritic cells, epithelial cells, macrophages, TCR ab+ and TCR gd+ intraepithelial lymphocytes (IEL) in the colon were sorted. The expression of miR-30d-5p in these cells was determined by qPCR. n=6, Error bars denote mean ± SEM, one-way ANOVADunnetfs multiple comparisons test. n.s. not significant, ** P<0.0l, *** PO.OOl.
Figures 8A-B. The Dose Response of Oral Administration of Synthetic miR-30d in Ameliorating EAE.
The indicated dose of synthetic miR-30d, scrambled sequence control, or H20 as blank control were orally administered to MOG/CFA-induced EAE mice starting from when the mice were scored 1, for 7 consecutive days. (A) Clinical scores of EAE (left) at the end of treatment (17 d.p.i) and 1 day post the end of treatment (18 d.p.i). Sample size of each group is indicated, Error bars denote mean ± SEM, statistical analysis by two-way ANOVA. (B) Quantification of demyelination (LFB and MBP) and axonal loss (Silver and Neurofilament) for individual mice were determined by histological staining of the spinal cords. n=6 mice/group; Error bars denote mean ± SEM, one-way ANOVADunnett’s multiple comparisons test.
Figure 9. Oral Administration of Synthetic miR-30d at the Dose of 250 pmol Increases Foxp3+ Regulatory T Cells.
Mice were immunized with MOG and orally administered synthetic miR-30d or scrambled miR-30d control daily at a dose of 250 pmol in 200 mΐ FhO/mouse for 7 consecutive days. Foxp3+ T cells in the total CD4+ T cell population in the spleen were analyzed by FACS. Left panel: Representative FACS plots of Foxp3+ CD4+ T cells; Right panel: % of CD4+ Foxp3+ T cells in individual animals (h=10 per group). Error bars denote mean ± SEM; one-way ANOVA Tukey’s multiple comparisons test. * P<0.05, *** PO.OOl.
Figures 10A-B. Treg-Promoting Effect of Oral MiR-30d Administration is not Caused by Acting on T cell Differentiation Directly.
(A) Mice were immunized with MOG and orally administered synthetic miR- 30d or scrambled control daily at a dose of 1000 pmol in 200 mΐ FhO/mouse for 7 consecutive days. miR-30d level in the serum specimen were quantified by qPCR. n=5 per group, Error bars denote mean ± SEM; one-way ANOVA Tukey’s multiple comparisons test. n.s. < not significant. (B) Naive CD4+ T cells from C57BL/6 spleen were differentiated into Treg (Foxp3+), Thl7 (IL-17A+) and Thl (IFN-y+) cells by plate bound anti-CD3 and anti-CD28 in the presence of corresponding polarizing cytokines. The direct effect of miR-30d on T cell differentiation was examined by supplying synthetic miR-30d to the culture. T cell subsets were analyzed by FACS. Left panel: Representative FACS plots of T cell subsets; Right panel: Bar graph of % of T cell subsets individual culture. Error bars denote mean ± SEM; one- way ANOVA Tukey’s multiple comparisons test. * P<0.05, n.s. < not significant.
Figure 11. Orally Administered miR-30d Keeps Intact to the Gut in
Forms of Microvesicles and Non-vesicles.
Germ-free mice were orally administered synthetic miR-30d 1000 pmol in 200 mΐ. Fecal specimen were collected dynamically. Microvesicle (220 nm-800 nm) fractions, Exosome (20 nm-220 nm) fractions and Non- Vesicle (Vesicle-free, <20 nm) fractions of the feces were separated by size filtration. RNAwas isolated and miR- 30d, and as control, miR-l224 level in the fecal specimen were quantified by qPCR. n=2 per group, Error bars denote mean ± SEM; one-way ANOVA Tukey’s multiple comparisons test. ** P<0.0l, *** P<0.00l.
Figure 12. Detection of b-galactosidase (lactase) Activity in A. muciniphila which Hydrolyzes Lactose into Dextrose (glucose) that is Essential for A.
muciniphila.
Scheme of b-galactosidase activity test with X-gal.
Figures 13A-B. MiR-30d enter A. muciniphila and Promote the Growth of A. muciniphila in vitro.
(A) A. muciniphila was cultured in presence of synthetic miR-30d or scrambled control for 18 hours to an exponential phase. miR-30d in A. muciniphila was determined by in situ hybridization using a 5’-DIG and 3’-DIG dual labeled probe for miR-30d and 10 nm immuno gold-conjugated anti-Digoxigenin antibody.
(B) Synthetic miR-30d or scrambled control were supplied in a mixed culture of A. muciniphila and E. coli for 18 hours. The relative abundance of A. muciniphila and E. coli was determined by qPCR detecting 16S rDNAs of A. muciniphila and E. coli. n=8 per group, Error bars denote mean ± SEM; one-way ANOVA Tukey’s multiple comparisons test. ** P<0.0l, n.s. < not significant.
Figures 14A-B. Oral Administration of Synthetic MiR-1246 and MiR- 7706 Ameliorated EAE.
(A-B) synthetic miR-l246, miR-7706, scrambled miR-7706 control, or H20 (vehicle) was orally gavaged to EAE recipients at the dose of 250 pmol starting at disease onset (day 11, disease score=l) daily for 7 consecutive days. (A) Clinical scores of EAE (left) and linear regression curves (right) in the recipient mice. Sample size: H20 n=8, Scramble n=5, miR-7706 n=ll, miR-l246 n=ll; Error bars denote mean ± SEM, statistical analysis by two-way ANOVA and linear regression based on the scores from the start of the treatment (11 d.p.i) until the end of experiment. (B) Quantification of demyelination and axonal loss for individual mice. n=5 per group; Error bars denote mean ± SEM, one-way ANOVA Dunnett’s multiple comparisons test.
Figure 15. Oral Administration of Synthetic MiR-30d Ameliorates Chronic Progressive EAE.
Chronic progressive EAE was induced in 8-week-old female NOD/ShiLtJ
(Commonly called NOD) mice by subcutaneous immunization with 150 pg of MOG35-55 peptide in 4 mg/ml CFA. Pertussis toxin was given i.p. (150 ng per mouse) at the time of immunization and 48 h later. 250 pmol synthetic miR-30d or scrambled miR-30d control was orally administered daily beginning on day 43 post immunization when mice were scored 2, for 14 consecutive days. Clinical scores of EAE in the recipient mice were monitored n = 13 animals per group; Error bars denote mean ± SEM, statistical analysis by two-way ANOVA.
Figures 16A-B. Oral Administration of Synthetic MiR-30d Reduces Type
1 Diabetes Incidence and Improves Hyperglycemia in NOD Mouse Model.
(A-B) NOD/ShiLtJ (commonly called NOD) mice spontaneously develop diabetic hyperglycemia starting at -12 weeks of age. 250 pmol of synthetic miR-30d or scrambled control were orally administered daily to the mice starting 8 weeks of age for 11 consecutive days. Blood glucose level (A) and diabetes incidence (B) were monitored once per week n = 10 animals per group; Error bars denote mean ± SEM, statistical analysis by two-way ANOVA.
Figures 17A-B. Oral Administration of Synthetic MiR-30d Improves Type
2 Diabetes/Obesity in High Fat Diet Induced Obesity (DIO) Mouse Model.
(A-B) High fat diet (HFD) induced diabetes mice (C57BL/J DIO stock No: 380050; Black 6 DIO, the Jackson Laboratory) were kept on HFD (60 kcal% fat, 5.2 kcal/gram) and were orally gavaged synthesized miR-30d or scrambled control at the dose of 500 pmol every other day for 8 weeks starting at 12 weeks of age. intra- peritoneal glucose tolerance test (IPGTT) was used to assess the ability of metabolizing glucose (A), and lipids (Cholesterol, Triglycerides) and Lactate dehydrogenase (LDH) in sera were measured (B) by the end of treatment.
DETAILED DESCRIPTION
The gut microbiome plays an important role in the development of immune system (An et al., 2014; Belkaid and Hand, 2014; Hooper et al., 2012). Different commensals in the gut have been shown to promote the differentiation of subsets of lymphocytes. In mice, segmented filamentous bacteria induce intestinal Thl7 cells (Ivanov et al., 2009), Bacteroides fragilis (B. fragilis) colonization of germ-free mice preferentially induces Thl cells (Mazmanian et al., 2005), and polysaccharide A of B. fragilis suppresses Thl7 cells in conventional mice by promoting IL-10 producing in Tregs through a TLR2 signaling pathway (Round et al., 2011). Clusters IV and XlVa of Clostridium promotes a transforming growth factor-b (TGF-P)-rich environment in the gut and Treg accumulation (Atarashi et al., 2011). The human symbiont
Clostridium ramosum was also demonstrated to induce Treg (Sefik et al., 2015;
Yissachar et al., 2017).
The gut microbiome has been linked to many disorders including
inflammatory bowel disease (Ott et al., 2004), obesity (Tumbaugh et al., 2008), diabetes (Qin et al., 2012), and autism (Hsiao et al., 2013) and modulation of gut microbiome is being explored as a therapeutic modality. One such approach is fecal microbiome transplantation (FMT) for which there are more than 200 registered clinical trials (Schmidt et al., 2018). It is not clear whether FMT is a result of the transfer of microbes as the transfer of sterile filtrates from donor stool, rather than fecal microbes, was efficacious in patients with Clostridium difficile infection (Ott et al., 2017), raising the possibility that FMT may not act by microbial transfer but by transplantation of other fecal component(s) which in turn modulate the microbiome.
We and others have detected an altered gut microbiome in MS (Berer et al.,
2017; Cekanaviciute et al., 2017; Chen et al., 2016; Jangi et al., 2016; Tremlett et al.,
2016) and we have previously identified microRNAs (miRNA, miR) in the feces and found that fecal miRNA can shape the gut microbiome (Liu et al., 2016). In line with this, a recent study found that ginger-derived miRNAs can be taken up by the gut microbes, alter the microbial composition, and modulate the host physiology (Teng et al., 2018). Here, in order to investigate how the altered gut microbiome affects the course of MS, and whether fecal miRNA may be involved, we studied the gut microbiome and miRNA in the experimental autoimmune encephalomyelitis (EAE) model of MS. Unexpectedly, transfer of feces from EAE peak disease was protective when EAE was induced in recipient animals. We found that miR-30d, rather than live microbes, was responsible for the disease amelioration following fecal transfer.
Furthermore, we found that miR-30d increased the abundance of the gut commensal Akkermansia muciniphila (A. muciniphila).
A. muciniphila is a mucin-degrading bacterium (Derrien et al., 2004) that has been reported to have anti-inflammatory properties. It has been shown that A.
muciniphila improved diet-induced obesity (Everard et al., 2013) in a mechanism likely dependent on a specific protein (Amuc l 100) isolated from the outer membrane of A. muciniphila (Plovier et al., 2017). Furthermore, oral administration of A. muciniphila was shown to enhance glucose tolerance and attenuate adipose tissue inflammation by inducing Foxp3+ Tregs in the visceral adipose tissue (Shin et al., 2014). Of note, treatment with metformin increased A. muciniphila (Wu et al., 2017), and metformin treatment has been shown to attenuate EAE (Nath et al., 2009).
Consistent with these studies, Hansen et al. reported that early life treatment with vancomycin propagated A. muciniphila and reduced diabetes incidence in the NOD mouse (Hansen et al., 2012). Furthermore, A. muciniphila has been shown to be associated with the anti-seizure effects of a ketogenic diet (Olson et al., 2018) and very recently shown to improve SODl-Tg model of Amyotrophic Lateral Sclerosis
(Blacher et al., 2019). Decreased A. muciniphila has been shown to be associated with progeria in humans and transplantation of A. muciniphila was sufficient to enhance healthspan and lifespan in progeroid mouse models (Barcena et al., 2019). Several groups have reported an increase of A. muciniphila in the gut microbiome of MS subjects (Berer et al., 2017; Cekanaviciute et al., 2017; Jangi et al., 2016; Tremlett et al., 2016). Cekanaviciute et al. found that A. muciniphila increased Thl differentiation in vitro but found no effect in A. muciniphila- monocolonized mice (Cekanaviciute et al., 2017). In this study, we found that cell-mediated autoimmune diseases such as EAE in mice and MS in humans induced miR-30d upregulation in intestinal DCs and in the stool specimen. Although the mechanisms underlying this miRNA upregulation remains to be elucidated, the present results showed that oral administration of miR- 30d expanded A. muciniphila in the EAE mouse gut by directly regulating gene expression of AMUC RS06985, which we identified to be a new b-galactosidase in A. muciniphila. A. muciniphila in turn induced upregulation of TFG-b and
downregulation of IL-6 and IL- 1 b transcripts by DCs in mesenteric lymph nodes (MLN), favoring Treg expansion that control effector T cells during EAE (Koutrolos et al., 2014).
Given that the microbiome plays an important role in health and disease (An et al., 2014; Fung et al., 2017; Honda and Littman, 2016; Hooper et al., 2012; Jangi et al., 2016; Qin et al., 2012; Tremaroli and Backhed, 2012), a major unmet need is to find approaches by which the microbiome can be specifically manipulated (Schmidt et al., 2018). FMT has been shown to be effective in the treatment of recurrent Clostridium difficile infection (van Nood et al., 2013), and is being investigated as a potential treatment for a number of disease conditions (Schmidt et al., 2018).
Although promising, FMT is a complex biologic intervention without well-defined targets (Ianiro et al., 2014). More importantly, in practice, currently only feces from “Healthy” donor are used in most FMTs (Schmidt et al., 2018). While their effects on diseases have not been fully evaluated, feces from patients and diseased models have been excluded from FMT trials. As shown herein, feces from peak diseased donors improved the disease, and synthetic miRNAs were identified that can specifically modulate the microbiome and ameliorate inflammatory autoimmune disease. Of note, the miRNAs were identified in the feces of both EAE mice and untreated MS patients, which suggests that fecal miRNAs may represent a previously unrecognized process by which the host regulates the microbiome. These findings identify a new avenue for modulating the microbiome and raise the possibility that the feces of animals with disease and patients may be enriched for miRNAs with therapeutic properties.
Methods of Treatment
The present methods can be used to treat, risk of development or progression of, or reduce symptoms of, inflammatory conditions in a subject. As used in this context, to“treat” means to ameliorate at least one symptom of the disorder. The methods described herein include methods for the treatment of disorders associated with inflammation, e.g., as described herein. Generally, the methods include administering a therapeutically effective amount of one or more miRNAs as described herein, to a subject who is in need of, or who has been determined to be in need of, such treatment. The miRNAs can include, e.g., miR-30d, miR-7706, and/or miR- 1246. The methods can include administering miR-30d; miR-7706; miR-l246; miR- 30d and miR-7706; miR-30d and miR-l246; miR-7706 and miR-l246; or miR-30d, miR-7706, and miR-l246.
The conditions that can be treated include inflammatory autoimmune diseases in a subject. Inflammatory diseases include Type 1 diabetes; multiple sclerosis;
inflammatory bowel disease (IBD)/colitis; obesity and obesity-related conditions; epilepsy; immune-mediated liver injury; amyotrophic lateral sclerosis (ALS);
rheumatoid arthritis; and aging or progeria.
In some embodiments, the methods can be used to reduce interferon gamma (IFNy)-producing Thl and/or interleukin- 17 (IL-l7)-secreting Thl7 CD4+ T cells, and/or increase regulatory cells such as FoxP3+ regulatory T cells (Tregs), in the periphery and/or in the CNS.
In some embodiments, the condition is one that has been shown to be improved by increasing Akkermansia muciniphila. For example, Akkermansia muciniphila has been shown to improve metabolism in obese and diabetic mice, and in overweight and obese human (see, e.g., Plovier et al,. A purified membrane protein from Akkermansia muciniphila or the pasteurized bacterium improves metabolism in obese and diabetic mice. Nat Med. 2017; 23(1): 107-113; Depommier et al.,
Supplementation with Akkermansia muciniphila in overweight and obese human volunteers: a proof-of-concept exploratory study. Nat Med. 20l9;25(7): 1096-1103; Shin et al., An increase in the Akkermansia spp. population induced by metformin treatment improves glucose homeostasis in diet-induced obese mice. Gut. 2014;
63(5):727-35; and Everard et al, Cross-talk between Akkermansia muciniphila and intestinal epithelium controls diet-induced obesity. Proc Natl Acad Sci U S A.
2013; 110(22):9066-71).
The present methods can be used to treat Type 1 diabetes, as it has been shown that vancomycin increases Akkermansia and reduces diabetes in NOD mouse. See, e.g., Hansen et al, Early life treatment with vancomycin propagates Akkermansia muciniphila and reduces diabetes incidence in the NOD mouse. Diabetologia. 2012; 55(8):2285-94.
Orally administered Akkermansia muciniphila has been shown to protect from immune-mediated liver injury in mouse model; see e.g., Wu et al., Protective Effect of Akkermansia muciniphila against Immune-Mediated Liver Injury in a Mouse Model. Front Microbiol. 2017; 8: 1804. The ketogenic diet (KD) has been used to treat refractory epilepsy.
Akkermansia has been shown to mediate ketogenic diet protection of seizures, see Olson et al, The Gut Microbiota Mediates the Anti-Seizure Effects of the Ketogenic Diet.Cell. 20l8;l73(7): l728-l74l.el3.
Amyotrophic Lateral Sclerosis (ALS) is a genetically-driven
neurodegenerative disorder. Akkermansia muciniphila has been shown to ameliorate mouse- ALS symptoms in a SODl-Tg mice model, see Blacher et al, Potential roles of gut microbiome and metabolites in modulating ALS in mice. Nature. 2019; DOI:
10.1038/s41586-019-1443-5.
In addition, gut microbiota play an important part in the pathogenesis of mucosal inflammation, such as inflammatory bowel disease (IBD). Extracellular vesicles (EV) from Akkermansia muciniphila protected from DSS-induced IBD phenotypes, see Kang et al., Extracellular vesicles derived from gut microbiota, especially Akkermansia muciniphila, protect the progression of dextran sulfate sodium-induced colitis. PLoS One. 2013; 8(l0):e76520.
Further, while the precise role of gut microbiome in aging has not been well elucidated, in two different mouse models of progeria Barcena et al found that progeria is characterized by intestinal dysbiosis with alterations in gut microbiome including a decrease in the abundance of Verrucomicrobia which Akkermansia belongs to. They found that human progeria patients also display intestinal dysbiosis and that long-lived humans (that is, centenarians) exhibit a substantial increase in Verrucomicrobia. Using the mouse models of progeria, they found that transplantation with the verrucomicrobia Akkermansia muciniphila was sufficient to enhance healthspan and lifespan in both progeroid mouse models. These findings provide a rationale for microbiome-, particularly Akkermansia-based interventions against age- related diseases. See Barcena, C. et al. Healthspan and lifespan extension by fecal microbiota transplantation into progeroid mice. Nat Med 25, 1234-1242 (2019).
Finally, Akkermansia muciniphila was shown to improve the efficacy of immunotherapy, e.g., anti-PD-l, in tumor therapy, and thus the present methods may be used in treating subjects with cancer, e.g., combination with immunotherapy in the treatment of cancers, e.g., solid tumors including . See Routy et al, Gut microbiome influences efficacy of PD-l-based immunotherapy against epithelial tumors. Science. 2018; 359(637l):9l-97. Immunotherapy can include administration of an immunotherapy compound, e.g., an immune checkpoint inhibitory antibody, e.g., to PD-L1, PD-l, CTLA-4 (Cytotoxic T-Lymphocyte- Associated Protein-4; CD 152); LAG-3 (Lymphocyte Activation Gene 3; CD223); TIM-3 (T-cell Immunoglobulin domain and Mucin domain 3; HAVCR2); TIGIT (T cell Immunoreceptor with Ig and ITEM domains); B7-H3 (CD276); VSIR (V-set immunoregulatory receptor, aka VISTA, B7H5, Cl0orf54); BTLA 30 (B- and T Lymphocyte Attenuator, CD272); GARP (Glycoprotein A Repetitions; Predominant; 25 PVRIG (PVR related immunoglobulin domain containing); or VTCN1 (Vset domain containing T cell activation inhibitor 1, aka B7-H4). The methods can be used to treat a solid or hematopoietic tumor, e.g., melanoma, lung cancer (e.g., non-small cell lung cancer or small cell lung cancer), renal cell carcinoma, urothelial bladder cancer, hodgkins lymphoma, head and neck cancer, merkel cell carcinoma, MSI-H or dMMR cancer, colorectal cancer, gastic cancer, hepatocellular carcinoma, cervical cancer, PMBL, cutaneous squamous cell cancer, breast cancer, esophageal cancer, pancreatic cancer, ovarian cancer, and prostate cancer.
Pharmaceutical Compositions and Methods of Administration
The methods described herein include the use of pharmaceutical compositions comprising a miRNA described herein, e.g., human miR-30d, miR-7706, and/or miR- 1246, as an active ingredient. The composition can include miR-30d; miR-7706; miR-l246; miR-30d and miR-7706; miR-30d and miR-l246; miR-7706 and miR- 1246; or miR-30d, miR-7706, and miR-l246.
The human miR-30d precursor sequence is as follows:
GUUGUUGUAAACAUCCCCGACUGGAAGCUGUAAGACACAGCUAAGCUU UCAGUCAGAUGUUUGCUGCUAC (SEQ ID NO: 1), which has a predicted tertiary stem-loop structure as follows:
guu u ccc gua ac
5 ' gu guaaacauc gacuggaagcu ag a
I I I I I I I I I I I I I I I I I I I I I I I I
3 ' eg cguuuguag cugacuuucga uc c
cau u --a --a ga
The mature hsa-miR-30d sequence is uguaaacauccccgacuggaag (SEQ ID
NO:2).
The human miR-7706 precursor sequence is as follows:
UGGAGCUGUGUGCAGGGCCAGCGCGGAGCCCGAGCAGCCGCGGUGAAG CGCCUGUGCUCUGCCGAGA (SEQ ID NO:3), which has a predicted tertiary stem-loop structure as follows:
uggag g u - - gga - ag
5 ' cu ug gcagggc cag cgc gcc eg c
I I I I I I I I I I I I I I I I I I I I I I
3 ' ga gc cgucucg guc geg ugg gc a
- a - - u c aag c eg
The mature hsa-miR-7706 sequence is ugaagcgccugugcucugccgaga (SEQ ID
NO:4).
The human miR-l246 precursor sequence is as follows:
UGUAUCCUUGAAUGGAUUUUUGGAGCAGGAGUGGACACCUGACCCAAA GGAAAUCAAUCCAUAGGCUAGCAAU (SEQ ID NO: 5), which has a predicted tertiary stem-loop structure as follows:
-au uga - ag a u
5 ' ugu ecu auggauu uuugg cagg g g
I I I I I I I I I I I I I I I I I I I I I I I
3 ' aeg gga uaccuaa aaacc gucc c g
ua auc - cuaaagg ca a a
The mature hsa-miR-l246 sequence is aauggauuuuuggagcagg (SEQ ID
NO:6).
In some embodiments, the present methods include the administration of at least one miRNA; the miRNAs used herein include pre-miRNA and mature miRNA, or a mimic thereof. "miRNA mimics" are chemically synthesized nucleic acid based molecules. microRNA mimics imitate the function of endogenous microRNAs in cells and can be designed as mature molecules, double-stranded molecules, or miRNA precursors (e.g., pri- or pre-microRNAs). MicroRNA mimics can be include synthetic and/or natural, modified and/or unmodified RNA, DNA, RNA-DNA hybrids or alternative nucleic acid chemistries as are generally known in the art.
A miRNA mimic as used herein can be a double stranded nucleic acid having a guide strand that has a nucleic acid sequence that is similar, or in some cases identical, to a guide strand of a naturally occurring mature miRNA. Naturally occurring miRNAs are processed from long nucleic acids having secondary structural properties (referred to as pri-miRNA and pre-miRNA) to produce naturally occurring mature miRNA. The mature miRNA is a double stranded molecule of about 22 (e.g., 20-24 or 21-23) nucleotides in length.
In some embodiments, the miRNA includes a sequence with at least 80% sequence identity to the full sequence of the endogenous human miRNA (i.e., SEQ ID NO:2, 4, or 6). In some embodiments, the miRNA includes a sequence with at least 90% sequence identity to at least 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 consecutive nucleotides of SEQ ID NO: 2, 4, or 6. In some embodiments, the miRNA includes a sequence with at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the full length og SEQ ID NO:2, 4, or 6. In some embodiments the sequence of the miRNA mimic may include the same bases, but the base of the mimic may be modified, i.e. hydrophobically modified. In other cases the mimic may include one or more different bases or nucleotides than the naturally occurring mature miRNA.
One having skill in the art armed with the sequences provided herein will be able, without undue experimentation, to identify further sequences. In some embodiments, an inhibitory nucleic acid contain a sequence that is identical to at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25
continguous nucleotides present in the miRNA, e.g., mature or precursor miRNA). In some embodiments, the miRNAs comprise a sequence that is complementary to a contiguous sequence of at least, e.g, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25, nucleotides present in a mature microRNA miR-30d, miR-7706, and/or miR-l246, e.g., having the sequence of SEQ ID NO:2, 4, or 6, optionally wherein the nucleic acid comprises at least one modified base.
miRNA mimics are available and known in the art. miRNA mimics can be, e.g., double-stranded RNA molecules, e.g., with at least one strand with at least 90% sequence identity to SEQ ID NO: 2, 4, or 6. A miRNA mimic can include one or more modifications, on one strand or on both sense and anti-sense strand, as compared to an endogenous (natural) miRNA, such as natural residues or non-natural residues substituted at one or more positions with respect to the endogenous miRNA sequence. Examples of nucleotides that can be employed in miRNA mimics can include, without limitation, 5- Amino-Modifier C6, 5-fluorouracil, 5-bromouracil, 5- chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5- carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1 -methyl guanine, l-methylinosine, 2, 2-dimethyl guanine, 2- methyladenine, 2-methylguanine, 3 -methyl cytosine, 5 -methyl cytosine, N6-adenine, 7- methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2- methythio-N6-isopentenyladeninje, uracil-5oxyacetic acid, wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4- thiouracil, 5-methyluracil, uracil-5-oxacetic acid methylester, uracil-5-oxacetic acid, 5-methyl-2-thiouracil, 3-dT, 3-dTdT, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine.
Pharmaceutical compositions typically include a pharmaceutically acceptable carrier. As used herein the language“pharmaceutically acceptable carrier” includes saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, lipids, lipidsome, nanoparticles, microvesicles, compatible with pharmaceutical administration. Supplementary active compounds can also be incorporated into the compositions. For example, for treating cancer the composition can include an immunotherapy compound, e.g., an immune checkpoint inhibitory antibody, e.g., to PD-L1, PD-l, CTLA-4 (Cytotoxic T- Lymphocyte- Associated Protein-4; CD 152); LAG-3 (Lymphocyte Activation Gene 3; CD223); TIM-3 (T-cell Immunoglobulin domain and Mucin domain 3; HAVCR2); TIGIT (T cell Immunoreceptor with Ig and ITEM domains); B7-H3 (CD276); VSIR (V-set immunoregulatory receptor, aka VISTA, B7H5, Cl0orf54); BTLA 30 (B- and T Lymphocyte Attenuator, CD272); GARP (Glycoprotein A Repetitions;
Predominant; 25 PVRIG (PVR related immunoglobulin domain containing); or VTCN1 (Vset domain containing T cell activation inhibitor 1, aka B7-H4). The supplementary active compounds can also be administered separately, e.g., as a combination therapy, e.g., in some embodiments the two compounds are administered concurrently (either in a single or separate compositions) or sequentially.
Pharmaceutical compositions are typically formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, and rectal administration.
Methods of formulating suitable pharmaceutical compositions are known in the art, see, e.g., Remington: The Science and Practice of Pharmacy, 21 st ed., 2005; and the books in the series Drugs and the Pharmaceutical Sciences: a Series of Textbooks and Monographs (Dekker, NY). For example, solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as
ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
In the present methods, oral administration is preferred. Oral compositions generally include an inert diluent or an edible carrier. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules, e.g., gelatin capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
The pharmaceutical compositions can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.
For administration by inhalation, the compounds can be delivered in the form of an aerosol spray from a pressured container or dispenser that contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer. Such methods include those described in U.S. Patent No. 6,468,798.
Therapeutic compounds that are or include nucleic acids can be administered by any method suitable for administration of nucleic acid agents, such as a DNA vaccine. These methods include gene guns, bio injectors, and skin patches as well as needle-free methods such as the micro-particle DNA vaccine technology disclosed in U.S. Patent No. 6,194,389, and the mammalian transdermal needle-free vaccination with powder-form vaccine as disclosed in U.S. Patent No. 6,168,587. Additionally, intranasal delivery is possible, as described in, inter alia, Hamajima et al., Clin. Immunol. Immunopathol., 88(2), 205-10 (1998). Liposomes (e.g., as described in U.S. Patent No. 6,472,375) and microencapsulation can also be used. Biodegradable targetable microparticle delivery systems can also be used (e.g., as described in U.S. Patent No. 6,471,996).
In some embodiments, the therapeutic compounds are prepared with carriers that will protect the therapeutic compounds against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Such formulations can be prepared using standard techniques, or obtained commercially, e.g., from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to selected cells with monoclonal antibodies to cellular antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811.
The pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration.
EXAMPLES
The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.
EXPERIMENTAL PROCEDURES
The following materials and methods were used in the Examples set forth below, unless otherwise noted.
Mice and Fecal Specimen Collection
Animal procedures were approved by the Harvard Medical Area (HMA) Standing Committee on Animals. C57BL/6J mice and Foxp3GFP+ mice (Stock No. 023800) were from The Jackson Laboratory and acclimated in the local animal facility for at least two weeks prior to study initiation. Otherwise specified, all mice used were 6-8 weeks old at the initiation of study. For all experiments (fecal transplantation, fecal RNA transplantation, synthetic microRNA administration, bacteria administration), mice of same age and gender were ear-tagged and randomly allocated into groups and co-housed. Mice were housed under specific pathogen-free conditions at the Harvard Institutes of Medicine and the Hale Building for
Transformative Medicine at Brigham and Women’s Hospital. Mice that received oral administration of Akkermansia muciniphila (A. muciniphila) or E. coli were housed in BSL-2N facility. Fecal specimens were collected immediately upon defecation, snap frozen, and stored at -80 °C for analysis.
Human Fecal Specimens
Human fecal specimens were collected from 12 healthy volunteers (9 females, average 49 years of age) and 12 untreated relapsing-remitting multiple sclerosis patients (11 females, average 47 years of age). All subjects gave written consent according to a protocol approved by the Institutional Review Board at Brigham and Women’s Hospital. All subjects were excluded for GI disorders, antibiotics, or probiotic use in the last 2 months and during the sampling period. All stool samples were collected using Commode specimen collection system (Fisher Scientific) and stored at -80 °C until further processing.
EAE Induction
EAE was induced by injecting 6- to 8-week-old female C57BL/6J mice with 150 pg MOG35 -55 peptide (Genemed Synthesis) emulsified in complete Freund’s adjuvant (CFA)(BD™ Difco™) per mouse subcutaneously in the flanks, followed by intraperitoneal administration of 150 ng pertussis toxin (List biological laboratories, Inc.) per mouse on days 0 and 2 as described (Mayo et ak, 2014). In some
experiments, as an immunization control, 150 pg OVA327-333 (Anaspec) were used to replace MOG35-55. Clinical signs of EAE were assessed according to the following score: 0, no signs of disease; 1, loss of tone in the tail; 2, hind limb paresis; 3, hind limb paralysis; 4, tetraplegia; 5, moribund.
Histopathology
Mice were euthanized at the termination of experiments and were
intracardially perfused with PBS, followed by fixation with Bouin's Fixative solution (RICCA Chemical). Tissue was processed and stained as previously described (Mayo et ak, 2014). Paraffin embedded serial sections were stained with Luxol Fast Blue for myelin, Bielschowsky silver for axons. In dose response experiments, additional evaluation of demyelination and neuron loss was carried out using rabbit anti-MBP (1 : 1000; Dako) and neurofilament (1 :3000; Abeam) respectively and with secondary biotinylated antibodies. Avi din-peroxidase and 3,4-Diaminobenzidine was used as the color substrate (Reuter et al., 2015). The demyelinated area and axonal/neuronal loss were determined using ImageJ software (National Institutes of Health, USA) and the percentages of demyelinated and axonal/neuronal lost area out of total area were calculated.
Fecal RNA Isolation
Total RNA (including miRNA) was extracted from stool specimens using mirVana™ miRNA isolation kit (catalog number: AM1560, Ambion®) following the established protocol (Liu et al., 2016). Briefly, mouse or human stool was
homogenized in sterile PBS. RNA was extracted with acid Acid-Phenol: Chloroform. Aqueous phase precipitation was performed by mixing with 1.25 volumes of 100% ethanol, followed by purification on a glass fiber filter cartridge. Following elution, RNA quality was assessed by A260/A280 ratios using ND-1000 Nanodrop and Agilent 2100 Bioanalyzer (Agilent Technologies). The purity of RNA was
A260/A280: 1.8-2.0, A260/A230: >1.3. RNA isolates were stored at -80 °C until use.
Fecal Transplantation, Fecal RNA Treatment
For mouse fecal transplantation, 5 mg per mouse of feces from donor mice was suspended in 200 mΐ sterile PBS and was administered to recipient C57BL/6J mice by orally gavage at the time showed in the figures. In some cases, feces were inactivated by heating at 80 °C for 60 min to kill bacteria while keeping miRNA in the feces (Jung et al., 2010). To investigate the effect of fecal RNA on EAE, 10 pg of RNA isolated from feces, as described above, was eluted in 200 mΐ nuclease-free water and administered to mouse by orally gavage at the time as indicated in the figures.
Small RNA Sequencing
Small RNA-seq libraries were constructed from fecal RNA isolates using NEXTflex™ Small RNA-Seq Kit (Bioo Scientific Corporation., USA). 500 ng of RNA was used as input material. The library was prepared with a unique indexed primer so that libraries could be pooled into one sequencing flow cell. Multiplex adaptor ligations, primer hybridization, reverse transcription reaction and PCR amplification were performed according to the manufacturer’s protocol. Libraries were further purified with a gel size selection using Blue Pippin (Sage Science, Inc. USA). The obtained libraries were checked for quality with Agilent 2200 TapeStation and were sequenced with the Illumina NextSeq 500 System (50 nt, single read) at the Biopolymers Facility at Harvard Medical School. Data were analyzed following the exceRpt small RNA-seq pipeline V4.6.2 (Subramanian et al., 2015). Normalization and differential expression were performed with the R package DESeq2 v.1.10.1 (R version 3.3.2) (Love et al., 2014).
MiRNA Measurement by qPCR
Quantitative PCR (qPCR) was performed to verify the relative level of miRNAs that were identified in small RNA-Seq. 200 ng of total fecal RNA was input for miRNA cDNA synthesis using TaqMan™ Advanced miRNA cDNA Synthesis kit (Applied Biosystems). MiRNA cDNAs were then quantified by real-time PCR using TaqMan® Fast Advanced Master Mix and TaqMan Advanced MiRNA Assays (Applied Biosystems) on QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems) following the manufacturer’s protocol: hsa-miR-2l-5p/mmu-miR-2la-5p (Assay ID: mmu482709_mir), mmu-miR-30d-5p/ hsa-miR-30d-5p (Assay ID:
mmu478606_mir), hsa-miR-7706 (Assay ID: 480578_mir), hsa-miR-l246 (Assay ID: 47788 l mir). A reference gene for quantifying fecal miRNA using qPCR has not been established. MiR-2l has been detected in both mouse and human feces (Johnston et al., 2018; Link et al., 2010; Liu et al., 2016; Schonauen et al., 2018). Our small RNA-seq data suggested that miR-2l was highly presented in mouse and human feces and was not distinguishable between healthy and MS patient and between naive and immunized mice. We thus used miR-2l as reference to measure the relative level of miR-30d, miR-l246 and miR-7706 using comparative CT method (Schmittgen and Livak, 2008).
Antibiotic Treatment
In order to investigate the involvement of gut microbiome in the effect of miRNA, to deplete bacteria, mice were given a mixture of antibiotics (ampicillin 1 mg/ml, vancomycin 0.5 mg/ml, neomycin 1 mg/ml, metronidazole 1 mg/ml, and streptomycin 1 mg/ml (Sigma-Aldrich)), following an established protocol (Benjamin et al., 2013) in drinking water or in 200m1 nuclease-free water by orally gavage as specified on figure legends, for 7 consecutive days. Bacteria depletion was confirmed by culturing the colonic luminal content anaerobically on BHI agar and aerobically on LB agar. 16S rDNA Analyses of Gut Microbiome
16S rDNA sequence survey was performed following our established procedure (Liu et al., 2016; Tankou et al., 2018). Briefly, DNA in the mouse feces was extracted using a QIAamp Fast DNA Stool Mini Kit (Qiagen). Amplicons spanning variable region 4 (V4) of the bacterial 16S rRNA gene were generated with primers containing barcodes (515F, 806R) from the Earth Microbiome project (Caporaso et al., 2012) using HotMaster Taq and HotMaster Mix (QuantaBio) and paired-end sequenced on an Illumina MiSeq platform at the Harvard Medical School Biopolymer Facility. Data was processed using the QIIME 2 software following an established protocol (Caporaso et al., 2012; 2010). Briefly, sequences were de- multiplexed and quality filtered in which reads were truncated if two consecutive bases fall below a quality score of Q20 (1% error), and reads that were <75% of full length were discarded (Caporaso et al., 2012). OTUs were picked using the open reference method sumaclust (metabarcoding.org/sumatra) and sortmeRNA (Kopylova et al., 2012). Taxonomy was picked against the Greengenes database
(greengenes.secondgenome.com) using a 97% similarity threshold.
Fecal Microbe Quantification by qPCR
DNA extracted from fecal pellets as above described was verified for specific bacteria abundance. Quantitative PCR (qPCR) analysis was conducted using a ViiA7 system (Applied Biosystems). A. muciniphila was quantified by Taqman
amplification reactions consisting of DNA, TaqMan® Universal PCR Master Mix (Applied Biosystems), and primer pairs as follows: All bacteria (universal 16S rDNA, reference): Forward: TCCTACGGGAGGCAGCAGT (SEQ ID NO:7), Reverse: GGACTACCAGGGTATCTAATCCTGTT (SEQ ID NO: 8), Probe:
CGTATTACCGCGGCTGCTGGCAC (SEQ ID NO: 9) (Nadkarni et al., 2002); A. muciniphila 16S rRNA gene: Forward: C GGT GG AGT AT GT GGC TT A AT (SEQ ID NO: 10), Reverse: CCATGCAGCACCTGTGTAA (SEQ ID NO: 11), probe:
CGCCTCCGAAGAGTCGCATG (SEQ ID NO: 12). In some experiment, E. coli 16S rRNA gene was detected using the primers and probe: Forward:
AGGCCTTCGGGTTGTAAAGT (SEQ ID NO: 13), Reverse:
CGGGGATTTCACATCTGACT (SEQ ID NO: 14), Probe:
CAGAAGAAGCACCGGCTAAC (SEQ ID NO: 15). The relative quantity was calculated using the comparative CT method normalizing to the amount of all bacteria in the sample (Schmittgen and Livak, 2008).
MiRNA Target Prediction
The sequence of miR-30d-5p (uguaaacauccccgacuggaag (SEQ ID NO:2)) was blasted against whole genome sequence of A. muciniphila using the NCBI blast tool for sequence pairing. RNAhybrid was used to characterize the minimum free energy of secondary structure binding between miR-30d and potential targeting A.
muciniphila RNA (Kriiger and Rehmsmeier, 2006; Rehmsmeier et al., 2004).
Synthetic MiRNA Treatment
Synthesized Mission® miRNA mimics (Sigma-Aldrich) of miR-30d-5p
(uguaaacauccccgacuggaag (SEQ ID NO:2)) and scrambled miR-30d-5p sequence miRNA control (guggaugaaccgcaacuaccau (SEQ ID NO: 16)) were orally gavaged to C57BL/6J mice at a dose of 250 pmol daily in 200 mΐ nuclease-free water for 7 consecutive days.
The sequences of Mission® miRNA mimics used were (5’ to 3’): miR-30d-
5p_antisense: [AmC6]CUUCCAGUCGGGGAUGUUUUACA[dT][dT] (SEQ ID NO:2); miR-30d-5p_sense: UGUAAAC AUCCCCGACUGGAAG[dT] [dT] (SEQ ID NO:2); hsa-miR-l246_anti sense: [AmC6]CCUGCUCCAAAAAUCCUAUU[dT][dT] (SEQ ID NO:6); hsa-miR-l246_sense: aauggauuuuuggagcagg[dT][dT] (SEQ ID NO:6); hsa-miR-7706_anti sense:
[AmC6]UCUCGGCAGAGCACAGGCGCUUUCA[dT][dT] (SEQ ID NO:4); hsa- miR-7706_sense: ugaagcgccugugcucugccgaga[dT][dT] (SEQ ID NO:4). Feces were collected 24 hours post last synthetic miRNA administration for bacteria abundance detection. In dose response experiments (Figures 8A-B), different doses of miRNAs were used as indicated.
Dynamic miR-30d Measurement in the Gut (feces) Post Oral
Administration of miR-30d
Synthetic miR-30d was orally administered to germ-free mice and fecal specimen were collected at the gavage (0 hour), and every 2 hours post
administration. Fecal sample was soaked in 2 ml cold PBS for 5 min, and dissociated with PowerLyzer®24 Homgenizer (Mo Bio Laboratories, CA). The suspension was centrifuged at 300 xg, 4 °C for 10 min, followed by the additional centrifugation at 2000xg, 4 °C for 15 min. The supernatant was collected and filtered through a 0.8 pm filter (EMD Millipore, MA) to further remove debris. Microvesicle (MV), exosome and non-vesicle fractions were sequentially separated from the filtrate with 0.22 pm filter (EMD Millipore), 0.02 pm filter (GE Healthcare) and 3 kDa Amicon ETltra Centrifugal Filters (EMD Millipore), as previously described (Wei et al., 2017). Total RNA was isolated from each fraction using Total RNA Purification Kit (Norgen Biotek, Canada). The RNA concentrations were determined using Quant-iT
RiboGreen RNA Assay Kit (Thermo Fisher Scientific). Two nanogram of total RNA was used in 10 pl reverse transcription reaction with ETniversal cDNA Synthesis kit II (Exiqon). The qPCR reaction was performed using the ExiLENT SYBR Green master mix and pre-designed LNA primers (Exiqon) and miR-2l as reference.
In experiment of determine miRNAs in serum, serum RNA was isolated using Plasma/Serum RNA Purification Kit (Norgen Biotek Corporation). The levels of miRNA were quantified with qPCR using the approach described in this section.
Bacteria Strains, Growth Conditions and Bacteria Administration
Akkermansia muciniphila Derrien et al. (ATCC® BAA-835™) and E. coli K-
12 (Strain #: 7296, The Coli Genetic Stock Center at Yale) were grown anaerobically in Brain Heart Infusion (BHI) medium (SKU 53286, Sigma Aldrich). For mice treatment, 5xl08 freshly cultured logarithmic phase bacteria in 200 pl BHI medium were given by oral gavage daily for 7 consecutive days. For in vitro stimulation of cultured cells (Figure 6E-G), A. muciniphila and E. coli K-12 were cultured to a logarithmic phase and harvested by spinning down at 12600 rpm. Bacteria were resuspended in sterile PBS to a density of OD600 =1. The bacteria suspensions were inactivated by eight cycles of freezing at -80 °C and thawing at 37 °C. The
inactivation was confirmed by culturing the suspension to find no growing clone.
In experiments testing b-galactosidase activity in A. muciniphila , freshly cultured logarithmic phase A. muciniphila was spread or streaked over the surface of agar (1.5%) containing one of the following broth: BHI (with 0.2% dextrose), BHI w/o Dextrose (Ordering code: B2701-09, United States Biological), BHI w/o
Dextrose plus 0.2% lactose (Catalog No. L6-500, Fisher Scientific), BHI w/o
Dextrose plus 0.2% sucrose (SKU S0389, Sigma Aldrich), BHI w/o Dextrose plus 0.2% mucin from porcine stomach (SKU Ml 778, Sigma Aldrich), or BHI w/o Dextrose plus 0.2% mucin from porcine stomach and plus 400 pg/ml X-Gal (Catalog No. X4281, Gold Biotechnology), and incubated at 37°C anaerobically for 5 days. In experiments investigating the effect of miR-30d on A. muciniphila b- galactosidase (Figure 5E), 10 mΐ of freshly cultured logarithmic phase A. muciniphila was inoculated to a 010 mm sterile disk (Item ID: 74146, Millipore Sigma) on BHI w/o Dextrose plus 0.2% lactose and plus 400 pg/ml X-Gal, and incubated at 37°C anaerobically for 5 days, during which 30 mΐ of 100 mM synthetic miR-30d, or scrambled miR-30d was added at 24 h and 48 h after inoculation b-galactosidase activity was quantified by measuring the color changed (blue) area around the disk with A. muciniphila using ImageJ.
Bacterial Gene Transcript Quantification by qPCR
A. muciniphila was cultured in the presence of H20 (vehicle), 3 pM miRNA mimics miR-30d, and scrambled miR-30d to a log phase and stopped by chilling on ice and stabilized with RNAlater® Solutions (Ambion). Total bacterial RNA from cultured bacterial was extracted using TRIzol® Max™Bacterial RNA isolation Kit (Ambion) following the manufacturer’s protocol. cDNA was prepared using High Capacity cDNA Reverse Transcription Kit (Applied biosystems). QPCR was performed using Taqman Universal PCR Master Mix and TaqMan® Gene Expression Assay primer pairs as following: A. muciniphila AMUC RS06985: Forward:
CCATTTACGGCAGAAACAGC (SEQ ID NO: 17), Reverse:
GCCAGGGAGAGGGTTTTTAC (SEQ ID NO: 18), probe:
C GT G A AGG A A AT AGC C C T G A (SEQ ID NO: 19). A. muciniphila
AMUC RS07700: Forward: T GAAAGGGAGGGTT C ATCTG (SEQ ID NO:20), Reverse: ATCC AC ACGGGC AGAGT AAT (SEQ ID NO:2l), probe:
TTTATAGAAATGCGGGTGGC (SEQ ID NO:22). A. muciniphila
AMUC RS10850: Forward: CAACATGGAAACCTCCATCC (SEQ ID NO:23), Reverse: GACCAGTTCCTGGGTGACAT (SEQ ID NO:X24X), probe:
AG AC TTTT GT GG AC AT GGGG (SEQ ID NO:25). The relative quantity of each bacterial gene transcripts was calculated by the ACt method and referenced to A. muciniphila 16S rRNA: Forward: C GGT GG AGT AT GT GGC TT AAT (SEQ ID NO:26), Reverse: CCATGCAGCACCTGTGTAA (SEQ ID NO:27), probe:
CGCCTCCGAAGAGTCGCATG (SEQ ID NO: 28). Construction of E. coli Strains Expressing AMUC RS06985 and
Detection of b-galactosidase (lactase) Activity
The genes AMUC_RS06985, truncated AMUC_RS06985, and
AMUC_RS07700 were amplified by PCR using the following primers (with restriction sequences underlined): AMUC_RS06985 (XbaIAMUC_RS06985Fwd: 5’- GCTCTAGAGCATGAAATTTGTCGCCAAAATCCTG-3’ (SEQ ID NO:29), KpnIAUMC_RS06985Rev: 5’-
GGGGTACCCCTTATTCAATGCTCTTGAGCACTTC-3’ (SEQ ID NO: 30)), truncated AMUC_RS06985 (XbaITruncatedAMUC_RS06985Fwd:5’- GCTCTAGAGCATGAAATTTGTCGCCTAATAATCCTGACCATCGCCGC -3’
(SEQ ID NO:3 l), KpnITruncatedAUMC_RS06985Rev:5’- GGGGTACCCCTTATTCAATGCTCTTGAGCACTTC-3’ (SEQ ID NO: 32)), and AMUC_RS07700 (XbaIAMUC_RS07700Fwd: 5’ -
GCTCTAGAGCATGAATGTTATGTCGAAACGTTTTTTTGCC-3’ (SEQ ID NO:33), KpnIAUMC_RS07700Rev:5’-
GGGGTACCCCATTTACCGGGTCAGCATGCCGTTGGCTAT-3’ (SEQ ID NO:34)).
PCR products of the genes containing Xbal and Kpnl restriction sites were cloned into pUCl8 (a gift from Joachim Messing, Addgene plasmid # 50004) (Norrander et al., 1983) between the Xbal and Kpnl sites of the vector. TOP10 competent //. coli cells (Genotype: F- mcrA A(mrr-hsdRMS-mcrBC) F OlacZAM 15 D lacX74 recAl araD139 A( araleu)7697 galU galK rpsL (StrR) endAl nupG )
(Invitrogen) were transformed with constructed plasmids by heat shock. Cells with ampicillin resistance were selected by plating the transformed cells on LB agar containing 100 pg/ml Ampicillin. E. coli strains expressing the intended inserts were confirmed by sequencing using primers: Ml3pETC-Fwd 5'- CCCAGTCACGACGTTGTAAAACG-3' (SEQ ID NO:35) and Ml3pUC-Rev 5'- AGCGGATAACAATTTCAC ACAGG-3 ' (SEQ ID NO: 36). To detect b- galactosidase activity of the constructed strains, bacteria were streaked on LB agar containing 100 pg/ml ampicillin and 400 pg/ml X-gal, and grew at 37°C for 3 days.
Protein Sequence Alignment
The sequence of protein product of A. muciniphila gene AMUC RS06985 (Accession ID: WP 012420345) was aligned to sequences of beta-galactosidases of different species available at UniProt (uniprot.org) using Protein BLAST tool from NCBI. Typical positive blast hit, the beta-galactosidase of Ktedonobacter racemifer DSM 44963 (Accession ID: EFH89096) (E value: 0.023) was further aligned using T- Coffee (Notredame et al., 2000) and viewed with Jalview (Waterhouse et al., 2009).
Flow Cytometry and Cell Isolation
To investigate the effect of miRNA or bacteria on immune cells in vivo , mice were immunized with MOG and simultaneously orally administered with synthetic miRNA or bacteria for 7 consecutive days as indicated in results. On day 8 post immunization, cells were collected from the spleen and measured T lymphocytes following established approach (Rezende et al., 2015). Briefly, intracellular cytokine staining was performed by first stimulating cells for 4 h with PMA (phorbol 12- myristate l3-aceate; 50 ng/ml; Sigma-Aldrich) and ionomycin (1 mM; Sigma-Aldrich) and a protein-transport inhibitor containing monensin (1 pg/ml Golgi Stop; BD
Biosciences) before detection by staining with antibodies. Surface markers were stained for 25 min at 4°C in Mg2+ and Ca2+ free HBSS with 2% FCS, 0.4% EDTA (0.5 M) and 2.5% HEPES (1 M) then were fixed in Cytoperm/Cytofix (eBioscience), permeabilized with Perm/Wash Buffer (eBiosciences). Flow-cytometric acquisition was performed on a Fortessa (BD Biosciences) by using DIVA software (BD
Biosciences) and data were analyzed with FlowJo software versions 10.4.1 (TreeStar). Surface staining antibodies included: Alexa Fluor® 700 anti-CD3 (17A2; 1 : 100; Biolegend), BV605-anti-CD4 (RM4.5; 1 :300; BD Bioscience), PE-anti -Vb eta 11 (RR3-15; 1 :200; BD Pharmingen). Intracellular staining antibodies used: FITC-anti- FoxP3 (FJK-l6s; 1 : 100; eBioscience), BV42l-anti-IFN-Y (XMG1.2; 1 :300;
Biolegend), PE-Cy7-IL-l7A (eBiol7B7; 1 : 100; eBioscience).
To investigate which intestinal cells expressed miR-30d during EAE-induction
(Figure 7), colonic tissue was collected 10 days post MOG/CFA or OVA/CFA immunization. Colonic epithelial cells and lamina propria cells were isolated following the established protocol(Moreira et al., 2019). Colonic homogenates were incubated with DTT as described(Moreira et al., 2019) and were separated into CD45- and CD45+ fractions using CD45 Microbeads (Order number: 130-052-301, Miltenyi Biotec). Epithelial cells from the CD45- fraction were further sorted out by staining with 7-AAD for dead cell exclusion and FITC-anti-CD3 (500A2; 1 : 100; Biolegend), APC-anti-CD326 (Ep-CAM) (G8.8; 1 : 100; Biolegend), APC-anti-CD324 (E- Cadherin) (DECMA-l; 1 : 100; Biolegend) and APC-anti-pan Cytokeratin (C-l l;
1 : 100; Invitrogen). CD45+ fraction was further sorted for ab+ T cells (7-AAD-,
CD3+, TCRy5-, TCRp+) and gd+ T cells (7-AAD-, CD3+, TCRp-, TCRy5+) by staining with 7-AAD for dead cell exclusion and FITC-anti-CD3 (500A2; 1 : 100; Biolegend), PE-anti -TCRy5 (GL3; 1 : 100; Biolegend) and Brilliant Violet 605 -anti - TCR-b (H57-597; 1 : 100; Biolegend). CD45+ fraction was separated from the colonic lamina propria isolates using CD45 Microbeads and was further stained with 7-AAD and APC-conjugated epithelium dump channel (anti-CD326 (Ep-CAM) (G8.8; 1 : 100; Biolegend), anti-CD324 (E-Cadherin) (DECMA-l; 1 : 100; Biolegend), anti-pan Cytokeratin (C-l l; 1 : 100; Invitrogen)), PerCP-conjugated dump channel (anti-NKl.l (PK136; 1 : 100; Biolegend), anti-Ly-6G (1 A8; 1 : 100; Biolegend), anti-B220 (RA3- 6B2; 1 : 100; Biolegend), anti-CD3 l7 (927; 1 : 100; Biolegend), anti-CD3 (145-201; 1 : 100; Biolegend)), FITC-anti-CD45 (30-F11 ; 1 : 100; Biolegend), PE-anti-CX3CRl (SA011F11; 1 : 100; Biolegend), BV605-anti-F4/80 (BM8; 1 : 100; Biolegend), BV605- anti-CD64 (X54-5/7.1; 1 :100; Biolegend), PE/Cy7-anti-CDl lc (N418; 1 : 100;
Biolegend) and AF700-anti-I-A/I-E (MHCII) (M5/114.15.2; 1 : 100; Biolegend) to sort for macrophages (7-AAD- APC- PerCP- CD45+ F4/80+ CD64+ CX3CR1+) and dendritic cells (7-AAD- APC- PerCP- CD45+ F4/80- CD64- MHCII hi+ CD1 lc+).
To investigate the effect of A. muciniphila on Foxp3+ Treg induction (Figure 6E-G), CD1 lc+ dendritic cells (DCs) isolated from the mesenteric lymph nodes
(MLNs) of naive mice were first enriched with ETltraPure CD1 lc MicroBeads (order No. 130-108-338, Miltenyi Biotec), and then sorted by gating 7-AAD- PerCP- CD45+ F4/80- CD64- CD1 lc+ cells. Antibodies used for sorting were: PerCP-conjugated dump channel (anti-TER-l 19 (TER-119), anti-NKl.l(PKl36), anti-CD l9(6D5), anti- Ly-6G (1A8), anti-CD3e(l45-2Cl 1), all at 1 :300 dilution; Biolegend), APC-anti- CD45 (30-F11; 1 :300; Biolegend), FITC-anti-F4/F80 (BM8; 1 : 100; Biolegend), FITC-anti-CD64 (X54-5/7.1; 1 : 100; Biolegend) and PE-anti-CDl lc (N418; 1 :200; Biolegend). Naive CD4+ T cells were isolated from the spleen of Foxp3GFP+mice using Naive CD4+ T cell Isolation Kit (Order No. 130-104-453, Miltenyi Biotec).
In vitro Induction of Foxp3 Tregs with A. muciniphila
To investigate the effect of A. muciniphila on Foxp3+ Treg induction (Figure 6E-G), Foxp3+ Tregs were induced from naive CD4+ T cells that were purified from the splenocytes of Foxp3GFP+ mice as described above in the presence of TGF-b! (2 ng/ml, R&D Systems) and IL-2 (10 ng/ml, R&D Systems) for 3 days. In some experiments (Figure 6E), 1 mΐ/well (200 mΐ) of the inactivated OD600=l A.
muciniphila or E. coli were added to directly stimulate naive CD4 T cells. In some experiments (Figure 6F-G), 1 mΐ/well of the inactivated OD600=l A. muciniphila or E. coli were added to DCs, isolated from MLN of naive mice, described above, for 24 hours. Stimulated DCs were harvested for RNA isolation (Figure 6G), or co-cultured with naive CD4 T cells to expand Tregs for additional 3 days by adding naive CD4+
T from Foxp3GFP+ mice to the stimulated DCs, at a DC: naive CD4+ T cell ratio of 1 : 10 (Figure 6F).
Cellular RNA Isolation and qPCR Quantification of Transcripts of miRNA and Cytokine Genes
To determine miR-30d changes in different cells (epithelial cells,
macrophages, dendritic cells, TCRa.p+IELs, TCRyd+IELs) in the gut of MOG/CFA- or OVA/CFA- immunized mice (Figure 7), and to determine the expression of Tgfb, 116 and II lb mRNAs in A. muciniphi la-treated DCs (Figure 6G), total RNA (including miRNA) was extracted from sorted cells or cultured DCs using mirVana™ miRNA isolation kit (catalog number: AM1560, Ambion®) following manufacturer’s protocol. qPCR was performed to detect miR-30d using TaqMan® MiRNA Reverse Transcription (Applied Biosystems) and Taqman ETniversal PCR Master Mix according to the manufacturer’s protocol. The input of total RNA per sample was 5 ng. The TaqMan® MiRNA Assay IDs (Applied Biosystems) were: snoRNAl35 (inner control, assay ID: 001230), the hsa-miR-30d-5p (assay ID: 000420). The TaqMan™Gene Expression Assay IDs (Applied Biosystems) were: Gapdh (Assay ID: Mm999999l5_gl, reference gene), Tgfbl (Assay ID: MmOl l78820_ml), 116 (Assay ID: Mm00446l90_ml), Illbeta (Assay ID: Mm00434228_ml).
In Situ Hybridization Detection of miR-30d Entered in A. muciniphila
A. muciniphila was cultured in 1 ml medium of BHI w/o dextrose plus 0.2% mucin in the presence of 5 mM synthetic miR-30d mimics or scramble for 18 hours to an exponential phase. Bacterial cells were spin down at 12000 rpm. Washed twice with ice cold PBS and fixed with 4% PFA/0.25% Glutaraldehyde. 100 nm cryosection were proceeded on nickel grids and carried out for in situ hybridization using a 5’- DIG and 3’-DIG dual labeled probe for miR-30d (Cat#YD00613716-BEG,
Product#3391 12, Qiagen) and 10 nm immuno gold-conjugated anti-Digoxigenin antibody (Cat#25399, Electron Microscopy Sciences) following the manufacturer’s protocol. Sections on grids were imaged using Tecnai G2 Spirit BioTWIN
Transmission Electron Microscope.
Statistical Analysis
ETnless otherwise indicated, data were analyzed using GraphPad Prism 7.0c software (San Diego, CA, ETSA). The differences between two groups were analyzed with Student’s t-test with proper correction. The differences between more than two groups were analyzed using ANOVA with multiple comparisons test. A two-sided p- value of <0.05 was considered as significant. ETnless otherwise specified, results were expressed as mean ± SEM.
Example 1. Gut Microbiome Changes during EAE
Commensal microbiome is essential for the development and function of the host immune system (Belkaid and Hand, 2014). EAE is a primary animal model of MS (Robinson et al., 2014). Mouse model of spontaneous relapsing-remitting MS does not develop EAE when raised under germ-free condition (Berer et al., 2011) and mice orally treated with antibiotics have less severe EAE (Ochoa-Reparaz et al.,
2009). We and others have detected an altered gut microbiome in MS (Berer et al., 2017; Cekanaviciute et al., 2017; Chen et al., 2016; Jangi et al., 2016; Tremlett et al., 2016). To investigate the microbiome composition in EAE, we induced EAE in C57BL/6 mice by immunization with myelin oligodendrocyte glycoprotein (MOG) emulsified with Freund's complete adjuvant (CFA). Control mice were immunized with ovalbumin (OVA)/CFA emulsion. Fecal specimens were collected at the time of immunization, 8 days post immunization (8 d.p.i., prior to onset of EAE), and 15 d.p.i. (peak EAE disease); we performed 16S rDNA sequencing to analyze the microbiome. An unweighted (Figure 1A) and a weighted (Figure IB) ETniFrac beta- diversity metric assessment of overall microbial structure did not reveal significant difference between MOG-induced EAE and OVA-immunized control. We next investigated whether the relative abundances of the microbiome differed between MOG- and OVA- immunized mice at a species-level taxonomy. We found that A. muciniphila was increased in the feces from MOG-induced EAE mice, but not from OVA/CFA immunized mice, on day 15 (Figure 1C and Table 1), which we confirmed by quantitative PCR (qPCR) (Figure ID). Of note, A. muciniphila was also found to be increased in the stool of untreated MS patients compared to healthy subjects from multiple studies including ours (Berer et al., 2017; Cekanaviciute et al., 2017; Jangi et al., 2016; Tremlett et al., 2016).
Table 1 - Gut microbiome during EAE
Figure imgf000038_0001
Taxonomy for Table 1 :
A. k _ Bacteria; p _ Bacteroidetes; c _ Bacteroidia; o _ Bacteroi dales; f _ S24-7; g _ ; s _
B. k _ Bacteria; p _ Firmicutes; c _ Clostridia; o _ Clostri diales; f _ ; g ; s _
C. k _ Bacteria; p _ Verrucomicrobia; c _ Verrucomicrobiae;
o _ Verrucomicrobiales; f _ Verrucomicrobiaceae; g _ Akkermansia;
s _ muciniphila
D. k _ Bacteria; p _ Firmicutes; c _ Bacilli; o _ Turicibacterales;
f _ Turicibacteraceae; g _ Turicibacter; s _
E. k _ Bacteria; p _ Firmicutes; c _ Clostridia; o _ Clostridiales;
f Ruminococcaceae; g _ Oscillospira; s _
F. k _ Bacteria; p _ Firmicutes; c _ Clostridia; o _ Clostridiales; f _ Lachnospiraceae; g_; s_
G. k _ Bacteria; p _ Firmicutes; c _ Clostridia; o _ Clostridiales;
f Ruminococcaceae; g _ ; s _
H. k _ Bacteria; p _ Firmicutes; c _ Clostridia; o _ Clostridiales; f _ Lachnospiraceae; g _ [Ruminococcus]; s _ gnavus
I. k _ Bacteria; p _ Firmicutes; c _ Bacilli; o _ Lactobacillales; f _ Lactobacillaceae; g _ Lactobacillus; s _
J. Other Example 2. Orally Transfer of Feces and Fecal miRNA from Peak EAE Ameliorated EAE
To investigate whether the gut microbiome from mice with EAE had pathogenic properties, we transplanted feces from EAE mice into naive animals that were then immunized with MOG for EAE induction (Figure 2A). We found that transplantation of feces obtained during peak EAE (day 15) ameliorated disease in recipient mice as compared to transplantation of feces from healthy mice (day 0) (Figure 2B). A similar trend was observed using feces obtained from EAE animals on day 8 (Figure 2B). To determine whether live bacteria in peak EAE feces were responsible for the effects we observed, we heat-inactivated feces from peak EAE donor mice prior to transfer (Figure 2C). We found that both intact and heat- inactivated peak EAE feces ameliorated EAE in a similar fashion (Figure 2D), indicating that live microbes were not required and a heat resistant component in the peak EAE feces improved EAE. No effect was observed when feces from OVA- immunized mice were transferred (Figure 2D). We and others have reported that host miRNAs can modulate bacterial transcripts and growth (Liu et ah, 2016; Teng et ah, 2018). MicroRNAs are heat resistant (Jung et ah, 2010); thus to determine whether fecal miRNAs were responsible for the effects we observed, we purified fecal RNA from peak EAE feces and administered it orally to recipient mice prior to
immunization for EAE (Figure 2E). We found that the purified peak EAE fecal RNA ameliorated EAE similarly to peak EAE feces (Figure 2F). No effect was observed with fecal RNA from non-immunized animals or OVA-immunized animals (Figure 2F). Furthermore, we also observed a disease ameliorating effect, as indicated by decreased clinical EAE score, less demyelination and axonal loss, when fecal RNA was administered at the onset of EAE (Figure 2G-I) rather than being given prophylactically.
Example 3. MiR-30d is Enriched in Feces from EAE Animals at Peak Disease and in Feces from Untreated MS Patients
We have previously shown that the majority of RNA components found in the feces are small RNAs, and predominantly miRNAs (Liu et ah, 2016). To identify which fecal miRNAs were generated during EAE, we performed small RNA sequencing in which we measured fecal RNA from peak EAE, OVA-immunized and non-immunized mice. We found that peak EAE mice had an increased level of miR- 30d-5p (miR-30d) compared to OVA-immunized and non-immunized mice (Figure 3A and Table 2). We confirmed the increased level of miR-30d in peak EAE feces by qPCR (Figure 3B). We then asked whether specific fecal miRNAs were increased in subjects with MS. We investigated untreated relapsing-remitting MS subjects and compared them to age- and sex- matched controls. Using small RNA sequencing followed by qPCR confirmation we found that miR-30d, miR-7706 and miR-l246 were higher in untreated MS vs. healthy control (Figure 3C-D and Table 3). Thus, fecal miR-30d was increased in both peak EAE and subjects with MS.
To determine which cells were responsible for the upregulation of miR-30d and whether this upregulation was specific for MOG immunization, we immunized mice with either MOG or OVA emulsified in CFA and measured miR-30d in DCs, epithelial cells, macrophages, ab T cells and gd T cells in the colon. We found that only DCs upregulated miR-30d and that this effect was dependent on MOG immunization, as non-immunized mice or OVA-immunized mice did not show increased miR-30d expression (Figure 7). Thus, colonic DCs are responsible for miR- 30d upregulation upon MOG immunization.
Table 2. Fecal miRNA in OVA- vs MOG-immunized mice, p<0.05
Figure imgf000040_0001
Figure imgf000041_0001
Table 3. Fecal miRNAs in MS patients vs healthy subjects, p<0.05
Figure imgf000041_0002
Example 4. Oral Administration of Synthetic miR-30d Ameliorates EAE in a Recipient Gut Microbiome-dependent Manner
To investigate whether miR-30d could affect EAE, we synthesized miR-30d and administered it orally for 7 consecutive days to mice with established EAE. As a control, we administered a scrambled sequence of miR-30d. We found that oral administration of synthetic miR-30d at the dose of 250 pmol, but not its scrambled sequence, ameliorated EAE as measured by clinical score, which was associated with decreased demyelination and axonal loss (Figure 4A, B). The EAE-improving effect was enhanced with an increasing doses of 1000 pmol and 2500 pmol (Figures 8A, B). To address potential cellular mechanisms by which oral miR-30d affected EAE, we examined T cells in the spleen and found an increase in Foxp3+CD4+ Tregs both in the total CD4+ T cell population and in the nbΐ 1+ CD4+ T cell population (Figure 4C-D, Figure 9). nbΐ 1+ CD4+ T cell population was MOG-specific (Bettelli et al.,
2006a). No change was observed in rFN-y-expressing Thl or IL-l 7-expressing Thl7 populations (not shown). We then asked whether the Treg-promoting effect of oral miR-30d was a result from a direct effect of miR-30d on T cell differentiation. We first measured the level of miR-30d in sera of synthetic miR-30d orally treated mice and found no increase of miR-30d in sera (Figure 10A), suggesting that the orally administered synthetic miR-30d did not enter the circulation. Furthermore, we differentiated naive CD4+ T cells into Treg, Thl and Thl7 cells in the presence of miR-30d, and found no effect (Figure 10B). Thus, miR-30d indirectly induces Treg expansion.
The existence of miRNA in the gut lumen and feces has been reported by many studies including ours (Link et al., 2012; Liu et al., 2016; Mohan et al., 2016; Teng et al., 2018; Viennois et al., 2019). MiRNAs are stable (Jung et al., 2010) in a varies of mechanisms including existing in extracellular microvesicle (MV) and/or in a MV-free high-density lipoproteins or argonaute protein-binding form (Creemers et al., 2012). To investigate whether oral delivered miR-30d can survive the gastric acidity and reach intact to the colon. We measured dynamic miR-30d levels in extracellular vesicle fraction and non-vesicle fraction of feces after oral administration of synthetic miR-30d in germ-free mice. We found that synthetic miR-30d reached intact into the colon (feces) in the fraction of 220 nm to 800 nm-sized microvesicle and the fraction of non-vesicle (Figure 11).
We have previously shown that orally administered miRNAs can shape the microbiome (Liu et al., 2016). To determine whether oral synthetic miR-30d administration induced a protective microbiome phenotype, we orally administered synthetic miR-30d or a scrambled control for 7 consecutive days, starting at the time of immunization. Feces were collected on day 7 post immunization and transferred to naive recipient mice that had been pre-treated with antibiotics for microbiome depletion and then immunized with MOG/CFA for EAE induction (Figure 4E). We found that microbiome transferred from miR-30d- treated donor mice ameliorated EAE in recipients as compared to transferred from water- treated or scrambled miR- 30d- treated donors (Figure 4F, G), suggesting that miR-30d treatment enriched microbes that were of regulatory effect for EAE. To further establish that the therapeutic effect of oral miR-30d required the microbiome, we administered antibiotics at the time of oral gavage with synthetic miR-30d and found that antibiotic administration abrogated the protective effect of oral miR-30d on EAE (Figure 4H,
I) Example 5. MiR-30d Upregulates AMUC RS06985, a new b- galactosidase that is Essential for the Growth of A. muciniphila, and Expands A. muciniphila
We next investigated which components of the microbiome in the recipient were involved in the amelioration of EAE by orally administered miR-30d. We and others have previously reported that host fecal miRNA is able to regulate bacterial gene transcription and growth (Liu et al., 2016; Teng et al., 2018). Our data showed above suggest that it was/were microbe(s) that was/were increased by miR-30d or increased in the EAE feces that mediated the EAE-improving effect; and we showed that A. muciniphila was increased in the feces of EAE and MS. Thus, we asked whether miR-30d could regulate d muciniphila. We blasted the miR-30d sequence against the whole genome sequence of A. muciniphila and found that three genes (Locus tags: AMUC_RS06985, AMUC_RS07700, and AMUC_RS 10850) were potential targets of miR-30d (Figure 5A). We then cultured A. muciniphila in the presence of synthetic miR-30d or its scrambled sequence and found that miR-30d promoted the expression of two of these candidate genes (Locus tag:
AMETC_RS06985, AMUC_RS07700) (Figure 5B). The function of these genes or their protein products has not been reported. Gene bank sequence annotations suggest that these genes encode putative phosphate-binding protein and putative glycosyl hydrolase family protein, respectively, indicating that these genes may be involved in the utilization of glucose (dextrose). We then asked whether A. muciniphila uses glucose for its survival and growth. As previously reported, A. muciniphila grows well on complete brain heart infusion (BHI) agar which contains 0.2% glucose (Derrien et al., 2004). Deprivation of glucose from BHI (BHI without dextrose) resulted in an impaired bacterial growth, suggesting that glucose is essential for A. muciniphila survival. When we replaced glucose with the disaccharide lactose (can be cleaved by b-galactosidase, also called lactase, into glucose and galactose) in culture, A. muciniphila was able to grow. The use of another disaccharide, sucrose, which requires a-galactosidase to cleave into glucose and fructose, did not support the growth of A. muciniphila. Thus, these data suggest that A. muciniphila has b- galactosidase, which converts lactose to glucose. To test this hypothesis, we used another BHI agar without glucose, but contains mucin, which is favored by A.
muciniphila (Derrien et al., 2004), and added X-gal to ascertain the b-galactosidase activity. X-gal is an organic substrate for b-galactosidase that is hydrolyzed to the blue-color product 5,5'-dibromo-4,4'-dichloro-indigo (Kiernan, 2007) (Figure 12).
We found that A. muciniphila colonies turned blue, confirming that A. muciniphila has b-galactosidase to hydrolyze mucin. This is consistent with a study in which b- galactosidase was found to be among mucin-degrading enzymes in the A. muciniphila membrane protein fraction (Ottman et al., 2017). To determine whether the protein products of either AMUC_RS06985 or AMUC_RS07700 are the b-galactosidase in A. muciniphila , we aligned the protein sequences of AMUC RS06985 or
AMUC RS07700 with the protein sequences of different b-galactosidases. We found that AMUC RS06985 was homologous to b-galactosidases of several species including Ktedonobacter racemifer (Figure 5C), Bifidobacterium bifidum,
Pectobacterium parmentieri , Streptomyces pratensis , and Rattus norvegicus (not shown). We did not find homology between AMUC_RS07700 and any b- galactosidases. To verify the b-galactosidase activity of AMUC RS06985, we cloned AMUC RS06985 into a b-galactosidase- deficient Escherichia coli (E. coli ) strain {lacZAMIS) and tested the b-galactosidase activity on an agar containing X-gal. We found that introduction of AMUC RS06985, but not a truncated AMUC RS06985, conferred b-galactosidase activity in the b-gal actosi dase-deti ci ent E. coli strain
(Figure 5D). These data identified AMUC RS06985 as a new b-galactosidase in A. muciniphila. We and others have showed that microRNA can enter bacteria, regulate the gene expression and growth of bacteria (Liu et al., 2016; Teng et al., 2018). We confirmed through in situ hybridization and transmission electron microscopy that miR-30d was able to enter A. muciniphila (Figure 13A). We observed that in an in vitro co-culture of A. muciniphila and A. coli , supplement of miR-30d in the culture specifically increased A. muciniphila , as indicated by the increased ratio of A.
muciniphila to E. coli (Figure 13B). We next asked whether miR-30d affected b- galactosidase in A. muciniphila. We cultured A. muciniphila on agar containing lactose and X-gal, and treated them with miR-30d. We found that miR-30d-treated A. muciniphila exhibited a significant enhanced b-galactosidase activity, compared to scrambled miR-30d-treated A. muciniphila (Figure 5E). Thus, miR-30d can promote A. muciniphila growth by enhancing bacterial b-galactosidase.
We then asked whether oral administration of synthetic miR-30d could affect the abundance of A. muciniphila in mouse gut. We orally gavaged mice with synthetic miR-30d for 7 days starting at the time of MOG-immunization and then analyzed the fecal microbiome by 16S sequencing (Figure 5F). We found oral administration of synthetic miR-30d did not change the overall microbial structure, as suggested by weighted UniFrac beta-diversity metric assessment (Figure 5G). However, we found an increase of A. muciniphila in miR-30d treated mice as compared to animals given a scrambled sequence or vehicle (Figure 5H and Table 4). We confirmed this result by qPCR (Figure 51). Thus, it appears that oral miR-30d administration acts by expanding A. muciniphila.
Table 4 - Gut microbiome modulated by oral miR-30d administration
Figure imgf000045_0001
Taxonomy for Table 4:
A. k _ Bacteria; p _ Bacteroidetes; c _ Bacteroidia; o _ Bacteroi dales; f _ S24-7; g _ ; s _
B. k _ Bacteria; p _ Bacteroidetes; c _ Bacteroidia; o _ Bacteroi dales;
f _ Rikenellaceae; g _ ; s _
C. k _ Bacteria; p _ Firmicutes; c _ Clostridia; o _ Clostridiales; f _ Clostridiaceae; g_; s_
D. k _ Bacteria; p _ Firmicutes; c _ Clostridia; o _ Clostridiales; f _ ; g _ ; s _
E. k _ Bacteria; p _ Firmicutes; c _ Bacilli; o _ Lactobacillales; f _ Lactobacillaceae; g _ Lactobacillus; s _ F. k _ Bacteria; p _ Firmicutes; c _ Clostridia; o _ Clostri diales; f _ Lachnospiraceae; g_; s_
G. k _ Bacteria; p _ Firmicutes; c _ Bacilli; o _ Turicibacterales;
f _ Turicibacteraceae; g _ Turicibacter; s _
H. k _ Bacteria; p _ Bacteroidetes; c _ Bacteroidia; o _ Bacteroi dales;
f _ Bacteroidaceae; g _ Bacteroi des
I. k _ Bacteria; p _ Firmicutes; c _ Clostridia; o _ Clostridiales;
f Ruminococcaceae; g _ Oscillospira; s _
J. k _ Bacteria; p _ Firmicutes; c _ Clostridia; o _ Clostridiales; f _ Lachnospiraceae
K. k _ Bacteria; p _ Verrucomicrobia; c _ Verrucomicrobiae;
o _ Verrucomicrobiales; f _ Verrucomicrobiaceae; g _ Akkermansia;
s _ muciniphila
L. k _ Bacteria; p _ Firmicutes; c _ Clostridia; o _ Clostridiales;
f Ruminococcaceae; g Ruminococcus; s _
M. Other
Example 6. A. muciniphila Ameliorates EAE by Stimulating Treg-driving Cytokines in Dendritic Cells
To directly investigate whether there was an ameliorating effect of A.
muciniphila on EAE, we orally treated established EAE with A. muciniphila for 7 consecutive days. We observed a decrease in disease score associated with reduced demyelination and axonal loss (Figure 6A, B). As observed with synthetic oral miR30d, A. muciniphila treatment also increased Foxp3+ Tregs in the spleen (Figure 6C, D)
To explore the potential mechanism by which A. muciniphila induces Foxp3+ Tregs, we first investigated whether A. muciniphila had a direct effect on Treg cell differentiation by co-culturing inactivated A. muciniphila or E. coli (as a control) with naive CD4+ T cells. We found that both bacteria minimally induced Foxp3+ Tregs (Figure 6E), suggesting that A. muciniphila does not directly induce more Tregs as compared to E. coli. DCs from mesenteric lymph node (MLN) are known to play a crucial role in Treg induction (Coombes et ak, 2007; Cording et ah, 2014; Pezoldt et ah, 2018), we isolated DCs from MLN, pulsed them with inactivated A. muciniphila or E. coli , and co-cultured them with naive CD4+ T cells. We found that A.
muciniphila- pulsed DCs induced significantly more Foxp3+ Tregs as compared to E. coli- treated DCs (Figure 6F). Thus, DCs are important for the induction of Foxp3+ Tregs by A. muciniphila. We next investigated how A. muciniphila increased the ability of DCs to induce Foxp3+ Tregs. We measured mRNAs of cytokines involved in CD4+ T cell differentiation, including Tgfb, il6 and illb. We found that both A. muciniphila and E. coli induced Tgfb expression to a similar extent; however, the expression of 116 and Illb, known to inhibit Foxp3+ Tregs generation (Bettelli et ak, 2006b; Lee et ak, 2012; Sutton et ak, 2006), was significantly lower in A.
muciniphila- stimulated DCs as compared to E. co/z-stimulated DCs (Figure 6G), suggesting that A. muciniphila preferentially stimulates Treg-inducing cytokines. Taken together, these data suggest that miR-30d promotes A. muciniphila growth in the gut that in turn induce Tregs in a mechanism dependent on increased TGF-b and decreased IL-6 and IL-lp production by DCs.
Example 7. Effect of administration of miR-7706 and miR-1246 on EAE
We asked that whether two other miRNAs identified in MS stool, miR-7706 and miR-l246, can affect EAE. We synthesized the mimics of miR-7706 and miR- 1246 and orally gave to MOG-immunized mice at disease onset when clinically scored 1 at the dose of 250 pmol for 7 consecutive days. We found that both miR- 7706 and miR-l246 ameliorated EAE, as indicated by the EAE clinical scores
(Figure 14A) and pathology (Figure 14B). Thus miR-7706 and miR-l246 are two additional miRNAs that are able to improve disease.
Example 8. Effect of administration of miR-30 in animal models of MS, T1D, and Obesity
So far there is no treatment for progressive MS. We investigated whether miR- 30d could treat progressive MS using animal model. We used the NOD/ShiLtJ (commonly called NOD) mice and immunized them with MOG/CFA for progressive EAE. We treated the mice with 250 pmol miR-30d daily for 14 consecutive days starting when the EAE score=2. We found that miR-30d orally treatment significantly improved the disease (Figure 15).
We next asked whether synthetic miRNA could treat diseases other than EAE/MS. Type 1 diabetes (T1D) is an autoimmune disease pathologically featured by lower insulin due to loss of pancreatic islets. The NOD/ShiLtJ (commonly called NOD) mice is a polygenic model for autoimmune type 1 diabetes. NOD mouse is characterized by hyperglycemia and insulitis. Dramatic pancreatic insulin decrease occurs in females at about 12 weeks of age. To test the effect of miRNA on T1D, we orally gavaged miR-30d to NOD mice starting prior to onset of disease at 8 weeks of age at the dose of 250 pmol for 11 consecutive days. We found that 11 days orally administration of synthetic miR-30d delayed the disease by 5 weeks (Figure 16). Our data suggest that the miRNAs we identified from the stool of peak EAE and untreated MS patient stool not only have beneficial effects on EAE, but also have favorable potentials against other autoimmune diseases, such as T1D.
As noted above, miR-30d can modulate gut microbiome; obesity is a condition that has been reported to be associated with perturbations in the microbiome. We investigated whether miR-30d oral treatment can change obesity. We obtained high fat diet (HFD) induced diabetes mouse model (C57BL/J DIO stock No: 380050;
Black 6 DIO, the Jackson Laboratory) and kept them on HFD. We treated the DIO mice by oral gavage synthesized Mission® miR-30d or scrambled control at the dose of 500 pmol every other day for 8 weeks starting at 12 weeks of age. IPGTT test was carried out by the end of treatment and lipids in sera were measured. We found that miR-30d treatment significantly improved the glucose tolerance (Figure 17A), as well as reduced the cholesterol and triglycerides in DIO mice (Figure 17B),
suggesting that miR-30d may be a treatment in lowering lipids in obesity and in improving obesity-related conditions.
REFERENCES:
An, D., Oh, S.F., Olszak, T., Neves, J.F., Avci, F.Y., Erturk-Hasdemir, D., Lu, X., Zeissig, S., Blumberg, R.S., Kasper, D.L., 2014. Sphingolipids from a Symbiotic Microbe Regulate Homeostasis of Host Intestinal Natural Killer T Cells. Cell 156,
123-133. doi: l0.l0l6/j.cell.20l3.11.042
Atarashi, K., Tanoue, T., Shima, T., Imaoka, A., Kuwahara, T., Momose, Y., Cheng, G., Yamasaki, S., Saito, T., Ohba, Y., Taniguchi, T., Takeda, K., Hori, S., Ivanov, I.I., Umesaki, Y., Itoh, K., Honda, K., 2011. Induction of colonic regulatory T cells by indigenous Clostridium species. Science (New York, NY) 331, 337-341. doi: 10.1 l26/science.1198469
Baecher-Allan, C., Kaskow, B.J., Weiner, H.L., 2018. Multiple Sclerosis:
Mechanisms and Immunotherapy. Neuron 97, 742-768. doi: l0.l0l6/j.neuron.20l8.0l.02l
Barcena, C., Valdes-Mas, R., Mayoral, P., Garabaya, C., Durand, S., Rodriguez, F., Fernandez-Garcia, M.T., Salazar, N., Nogacka, A.M., Garatachea, N., Bossut, N., Aprahamian, F., Luda, A., Kroemer, G., Freije, JM.P., Quiros, P.M., Lopez- Otin, C., 2019. Healthspan and lifespan extension by fecal microbiota
transplantation into progeroid mice. Nat Med 25, 1234-1242.
doi: 10.1038/s41591-019-0504-5
Belkaid, Y., Hand, T.W., 2014. Role of the Microbiota in Immunity and
Inflammation. Cell 157, 121-141. doi: 10. l0l6/j cell.20l4.03.0l 1
Benjamin, J.L., Sumpter, R., Levine, B., Hooper, L.V., 2013. Intestinal Epithelial Autophagy Is Essential for Host Defense against Invasive Bacteria. Cell Host Microbe 13, 723-734. doi: l0. l0l6/j.chom.20l3.05.004
Berer, K., Gerdes, L.A., Cekanaviciute, E., Jia, X., Xiao, L., Xia, Z., Liu, C., Klotz, L., Stauffer, U., Baranzini, S.E., Kiimpfel, T., Hohlfeld, R., Krishnamoorthy, G., Wekerle, H., 2017. Gut microbiota from multiple sclerosis patients enables spontaneous autoimmune encephalomyelitis in mice. Proceedings of the National Academy of Sciences 114, 10719-10724. doi: l0. l073/pnas. l7H233 H4
Berer, K., Mues, M., Koutrolos, M., Rasbi, Z.A., Boziki, M., Johner, C., Wekerle, H., Krishnamoorthy, G., 2011. Commensal microbiota and myelin autoantigen cooperate to trigger autoimmune demyelination. Nature 479, 538-541.
doi: l0.l038/naturel0554
Bettelli, E., Baeten, D., Jager, A., Sobel, R.A., Kuchroo, V.K., 2006a. Myelin
oligodendrocyte glycoprotein-specific T and B cells cooperate to induce a Devic- like disease in mice. The Journal of Clinical Investigation 116, 2393-2402.
doi: 10.1172/JCI28334
Bettelli, E., Carrier, Y., Gao, W., Korn, T., Strom, T.B., Oukka, M., Weiner, H.L., Kuchroo, V.K., 2006b. Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature 441, 235-238.
doi: l0.l038/nature04753
Blacher, E., Bashiardes, S., Shapiro, H., Rothschild, D., Mor, U., Dori-Bachash, M., Kleimeyer, C., Moresi, C., Harnik, Y., Zur, M., Zabari, M., Brik, R.B.-Z., Kviatcovsky, D., Zmora, N., Cohen, Y., Bar, N., Levi, F, Amar, N., Mehlman, T., Brandis, A., Biton, F, Kuperman, Y., Tsoory, M., Alfahel, L., Harmelin, A., Schwartz, M., Israelson, A., Arike, L., Johansson, M.E.V., Hansson, G.C., Gotkine, M., Segal, E., Elinav, E., 2019. Potential roles of gut microbiome and metabolites in modulating ALS in mice. Nature. doi: l0. l038/s4l586-0l9-l443-5
Caporaso, J.G., Kuczynski, J., Stombaugh, J., Bittinger, K., Bushman, F.D., Costello, E.K., Fierer, N., Pena, A.G., Goodrich, J.K., Gordon, J.I., Huttley, G.A., Kelley,
S.T., Knights, D., Koenig, J.E., Ley, R.E., Lozupone, C.A., McDonald, D., Muegge, B.D., Pirrung, M., Reeder, J., Sevinsky, J.R., Tumbaugh, P.J., Walters, W.A., Widmann, J., Yatsunenko, T., Zaneveld, J., Knight, R., 2010. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 7, 335-336. doi: l0.l038/nmeth.f.303
Caporaso, J.G., Lauber, C.L., Walters, W.A., Berg-Lyons, D., Huntley, J., Fierer, N., Owens, S.M., Betley, J., Fraser, L., Bauer, M., Gormley, N., Gilbert, J.A., Smith, G., Knight, R., 2012. ETltra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME Journal 6, 1621-1624.
doi: l0.l038/ismej.20l2.8
Cekanaviciute, E., Yoo, B.B., Runia, T.F., Debelius, J.W., Singh, S., Nelson, C.A., Kanner, R., Bencosme, Y., Lee, Y.K., Hauser, S.L., Crabtree-Hartman, E., Sand, I.K., Gacias, M., Zhu, Y., Casaccia, P., Cree, B.A.C., Knight, R., Mazmanian, S.K., Baranzini, S.E., 2017. Gut bacteria from multiple sclerosis patients modulate human T cells and exacerbate symptoms in mouse models. Proceedings of the National Academy of Sciences 114, 10713-10718.
doi: l0.l073/pnas.l7l 1235114
Chen, J., Chia, N., Kalari, K.R., Yao, J.Z., Novotna, M., Soldan, M.M.P., Luckey, D.H., Marietta, E.V., Jeraldo, P.R., Chen, X., Weinshenker, B.G., Rodriguez, M., Kantarci, O.H., Nelson, H., Murray, J.A., Mangalam, A.K., 2016. Multiple sclerosis patients have a distinct gut microbiota compared to healthy controls. Sci Rep 6, 28484. doi: l0. l038/srep28484
Coombes, J.L., Siddiqui, K.R.R., Arancibia-Carcamo, C.V., Hall, J., Sun, C.-M., Belkaid, Y., Powrie, F., 2007. A functionally specialized population of mucosal CD103+ DCs induces Foxp3+ regulatory T cells via a TGF-beta and retinoic acid-dependent mechanism. J Exp Med 204, 1757-1764.
doi: 10. l084/jem.20070590
Cording, S., Wahl, B., Kulkarni, D., Chopra, H., Pezoldt, J., Buettner, M., Dummer, A., Hadis, U., Heimesaat, M., Bereswill, S., Falk, C., Bode, U., Hamann, A., Fleissner, D., Huehn, J., Pabst, O., 2014. The intestinal micro-environment imprints stromal cells to promote efficient Treg induction in gut-draining lymph nodes. Mucosal Immunol 7, 359-368. doi: l0.l038/mi.20l3.54
Creemers, E.E., Tijsen, A.J., Pinto, Y.M., 2012. Circulating microRNAs: novel
biomarkers and extracellular communicators in cardiovascular disease? Circ. Res. 110, 483-495. doi: 10.1161/CIRCRESAHA.111.247452
Derrien, M., Vaughan, E.E., Plugge, C.M., de Vos, W.M., 2004. Akkermansia
muciniphila gen. nov., sp. nov., a human intestinal mucin-degrading bacterium. Int. J. Syst. Evol. Microbiol. 54, 1469-1476. doi: l0. l099/ijs.0.02873-0
Everard, A., Belzer, C., Geurts, L., Ouwerkerk, J.P., Druart, C., Bindels, L.B., Guiot, Y., Derrien, M., Muccioli, G.G., Delzenne, N.M., de Vos, W.M., Cani, P.D., 2013. Cross-talk between Akkermansia muciniphila and intestinal epithelium controls diet-induced obesity. Proceedings of the National Academy of Sciences 110, 9066-9071. doi: 10. l073/pnas.1219451110
Fung, T.C., Olson, C.A., Hsiao, E.Y., 2017. Interactions between the microbiota, immune and nervous systems in health and disease. Nat Neurosci 20, 145-155. doi: l0.l038/nn.4476
Hansen, C.H.F., Krych, L., Nielsen, D.S., Vogensen, F.K., Hansen, L.H., Sorensen, S.J., Buschard, K., Hansen, A.K., 2012. Early life treatment with vancomycin propagates Akkermansia muciniphila and reduces diabetes incidence in the NOD mouse. Diabetologia 55, 2285-2294. doi: l0. l007/s00l25-0l2-2564-7
Honda, K., Littman, D.R., 2016. The microbiota in adaptive immune homeostasis and disease. Nature 535, 75-84. doi: l0.l038/naturel8848
Hooper, L.V., Littman, D.R., Macpherson, A.J., 2012. Interactions between the
microbiota and the immune system. Science (New York, NY) 336, 1268-1273. doi: 10.1 l26/science.1223490
Hsiao, E.Y., McBride, S.W., Hsien, S., Sharon, G., Hyde, E.R., McCue, T., Codelli, J.A., Chow, J., Reisman, S.E., Petrosino, J.F., Patterson, P.H., Mazmanian, S.K., 2013. Microbiota modulate behavioral and physiological abnormalities associated with neurodevelopmental disorders. Cell 155, 1451-1463.
doi: l0.l0l6/j.cell.20l3.11.024
Ianiro, G., Bibbo, S., Scaldaferri, F., Gasbarrini, A., Cammarota, G., 2014. Fecal microbiota transplantation in inflammatory bowel disease: beyond the excitement. Medicine (Baltimore) 93, e97-e97. doi: l0.l097/MD.0000000000000097
Ivanov, I.I., Atarashi, K., Manel, N., Brodie, E.L., Shima, T., Karaoz, U., Wei, D., Goldfarb, K.C., Santee, C.A., Lynch, S.V., Tanoue, T., Imaoka, A., Itoh, K., Takeda, K., Umesaki, Y., Honda, K., Littman, D.R., 2009. Induction of Intestinal
Thl7 Cells by Segmented Filamentous Bacteria. Cell 139, 14-14.
doi: l0.l0l6/j.cell.2009.09.033
Jangi, S., Gandhi, R., Cox, L.M., Li, N., Glehn, Von, F., Yan, R., Patel, B., Mazzola, M.A., Liu, S., Glanz, B.L., Cook, S., Tankou, S., Stuart, F., Melo, K., Nejad, P., Smith, K., Toptjuolu, B.D., Holden, J., Kivisakk, P., Chitnis, T., De Jager, P.L.,
Quintana, F.J., Gerber, G.K., Bry, L., Weiner, H.L., 2016. Alterations of the human gut microbiome in multiple sclerosis. Nat Commun 7, 12015.
doi: l0.l038/ncommsl20l5
Johnston, D.G.W., Williams, M.A., Thaiss, C.A., Cabrera-Rubio, R., Raverdeau, M., McEntee, C., Cotter, P.D., Elinav, E., O'Neill, L.A.J., Corr, S.C., 2018. Loss of
MicroRNA-2l Influences the Gut Microbiota, Causing Reduced Susceptibility in a Murine Model of Colitis. J Crohns Colitis 12, 835-848. doi: l0.l093/ecco- jcc/jjy038
Jung, M., Schaefer, A., Steiner, F, Kempkensteffen, C., Stephan, C., Erbersdobler, A., Jung, K., 2010. Robust microRNA stability in degraded RNA preparations from human tissue and cell samples. Clin. Chem. 56, 998-1006.
doi: l0.l373/clinchem.2009.141580
Kiernan, J.A., 2007. Indigogenic substrates for detection and localization of enzymes.
Biotech Histochem 82, 73-103. doi: l0.l080/l052029070l375278
Kopylova, E., Noe, L., Touzet, H., 2012. SortMeRNA: fast and accurate filtering of ribosomal RNAs in metatranscriptomic data. Bioinformatics 28, 3211-3217. doi: l0.l093/bioinformatics/bts6l 1
Koutrolos, M., Berer, K., Kawakami, N., Wekerle, H., Krishnamoorthy, G., 2014.
Treg cells mediate recovery from EAE by controlling effector T cell proliferation and motility in the CNS. Acta Neuropathol Commun 2, 163. doi: l0.H86/s40478-
014-0163-1
Kriiger, J., Rehmsmeier, M., 2006. RNAhybrid: microRNA target prediction easy, fast and flexible. Nucleic Acids Research 34, W451-4. doi: l0.l093/nar/gkl243 Lee, Y., Awasthi, A., Yosef, N., Quintana, F.J., Xiao, S., Peters, A., Wu, C.,
Kleinewietfeld, M., Kunder, S., Hafler, D.A., Sobel, R.A., Regev, A., Kuchroo, V.K., 2012. Induction and molecular signature of pathogenic TH17 cells. Nat Immunol 13, 991-999. doi: l0.l038/ni.24l6
Link, A., Balaguer, F., Shen, Y., Nagasaka, T., Lozano, J.J., Boland, C.R., Goel, A., 2010. Fecal MicroRNAs as novel biomarkers for colon cancer screening. Cancer Epidemiol. Biomarkers Prev. 19, 1766-1774. doi: l0. H58/l055-9965.EPI-l0- 0027
Link, A., Becker, V., Goel, A., Wex, T., Malfertheiner, P., 2012. Feasibility of fecal microRNAs as novel biomarkers for pancreatic cancer. PLoS ONE 7, e42933. doi: l0.l37l/journal.pone.0042933.s00l
Liu, S., da Cunha, A.P., Rezende, R.M., Cialic, R., Wei, Z., Bry, L., Comstock, L.E., Gandhi, R., Weiner, H.L., 2016. The Host Shapes the Gut Microbiota via Fecal MicroRNA. Cell Host Microbe 19, 32-43. doi: l0.l0l6/j.chom.20l5.12.005 Love, M.I., Huber, W., Anders, S., 2014. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15, 550.
doi: 10.1186/S13059-014-0550-8
Lu, L.-F., Rudensky, A., 2009. Molecular orchestration of differentiation and function of regulatory T cells. Genes \& Development 23, 1270-1282.
doi: 10.1 lOl/gad.1791009
Mayo, L., Trauger, S.A., Blain, M., Nadeau, M., Patel, B., Alvarez, J.I., Mascanfroni,
I.D., Yeste, A., Kivisakk, P., Kallas, K., Ellezam, B., Bakshi, R., Prat, A., Antel,
J.P., Weiner, H.L., Quintana, F.J., 2014. Regulation of astrocyte activation by glycolipids drives chronic CNS inflammation. Nat Med 20, 1147-1156.
doi: l0.l038/nm.368l
Mazmanian, S.K., Liu, C.H., Tzianabos, A.O., Kasper, D.L., 2005. An
immunomodulatory molecule of symbiotic bacteria directs maturation of the host immune system. Cell 122, 107-118. doi : 10.1016/j . cell.2005.05.007
Mohan, M., Chow, C.-E.T., Ryan, C.N., Chan, L.S., Dufour, L, Aye, P.P., Blanchard, L, Moehs, C.P., Sestak, K., 2016. Dietary Gluten-Induced Gut Dysbiosis Is
Accompanied by Selective Upregulation of microRNAs with Intestinal Tight Junction and Bacteria-Binding Motifs in Rhesus Macaque Model of Celiac Disease. Nutrients 8. doi: 10.3390/nu8l 10684 Moreira, T.G., Horta, L.S., Gomes-Santos, A.C., Oliveira, R.P., Queiroz, N.M.G.P., Mangani, D., Daniel, B., Vieira, A.T., Liu, S., Rodrigues, A.M., Gomes, D.A., Gabriely, G., Ferreira, E., Weiner, H.L., Rezende, R.M., Nagy, L., Faria, A.M.C., 2019. CLA-supplemented diet accelerates experimental colorectal cancer by inducing TGF-P-producing macrophages and T cells. Mucosal Immunol 12, 188—
199. doi: 10.1038/S41385-018-0090-8
Nadkarni, M.A., Martin, F.E., Jacques, N.A., Hunter, N., 2002. Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set. Microbiology (Reading, Engl.) 148, 257-266.
doi: 10.1099/00221287-148-1-257
Nath, N., Khan, M., Paintlia, M.K., Singh, F, Hoda, M.N., Giri, S., 2009. Metformin attenuated the autoimmune disease of the central nervous system in animal models of multiple sclerosis. J Immunol 182, 8005-8014.
doi: 10.4049/jimmunol.0803563
Norrander, J., Kempe, T., Messing, J., 1983. Construction of improved M13 vectors using oligodeoxynucleotide-directed mutagenesis. Gene 26, 101-106.
Notredame, C., Higgins, D.G., Heringa, J., 2000. T-Coffee: A novel method for fast and accurate multiple sequence alignment. J. Mol. Biol. 302, 205-217.
doi: 10. l006/jmbi.2000.4042
Ochoa-Reparaz, J., Mielcarz, D.W., Ditrio, L.E., Burroughs, A.R., Foureau, D.M., Haque-Begum, S., Kasper, L.H., 2009. Role of gut commensal microflora in the development of experimental autoimmune encephalomyelitis. J Immunol 183, 6041-6050. doi: l0.4049/jimmunol.0900747
Olson, C.A., Vuong, H.E., Yano, J.M., Liang, Q.Y., Nusbaum, D.J., Hsiao, E.Y., 2018. The Gut Microbiota Mediates the Anti-Seizure Effects of the Ketogenic
Diet. Cell 173, l728-l74l.el3. doi: l0. l0l6/j.cell.20l8.04.027
Ott, S.J., Musfeldt, M., Wenderoth, D.F., Hampe, J., Brant, O., Folsch, U.R., Timmis, K.N., Schreiber, S., 2004. Reduction in diversity of the colonic mucosa associated bacterial microflora in patients with active inflammatory bowel disease. Gut 53, 685-693. doi: 10.1 l36/gut.2003.025403
Ott, S.J., Waetzig, G.H., Rehman, A., Moltzau-Anderson, J., Bharti, R., Grasis, J.A., Cassidy, L., Tholey, A., Fickenscher, H., Seegert, D., Rosenstiel, P., Schreiber,
S., 2017. Efficacy of Sterile Fecal Filtrate Transfer for Treating Patients With Clostridium difficile Infection. Gastroenterology 152, 799-81 l.e7.
doi: 10. l053/j.gastro.2016.11.010
Ottman, N., Reunanen, J., Meijerink, M., Pietila, T.E., Kainulainen, V., Klievink, J., Huuskonen, L., Aalvink, S., Skumik, M., Boeren, S., Satokari, R., Mercenier, A., Palva, A., Smidt, H., de Vos, W.M., Belzer, C., 2017. Pili-like proteins of
Akkermansia muciniphila modulate host immune responses and gut barrier function. PLoS ONE 12, e0l73004. doi: 10. l37l/journal. pone.0173004
Pezoldt, J., Pasztoi, M., Zou, M., Wiechers, C., Beckstette, M., Thierry, G.R.,
Vafadamejad, E., Floess, S., Arampatzi, P., Buettner, M., Schweer, J., Fleissner, D., Vital, M., Pieper, D.H., Basic, M., Dersch, P., Strowig, T., Hornef, M.,
Bleich, A., Bode, U., Pabst, O., Bajenoff, M., Saliba, A.-E., Huehn, J., 2018. Neonatally imprinted stromal cell subsets induce tolerogenic dendritic cells in mesenteric lymph nodes. Nat Commun 9, 3903. doi: l0.l038/s4l467-0l8-06423-7 Plovier, H., Everard, A., Druart, C., Depommier, C., Van Hul, M., Geurts, L.,
Chilloux, J., Ottman, N., Duparc, T., Lichtenstein, L., Myridakis, A., Delzenne,
N.M., Klievink, J., Bhattacharjee, A., van der Ark, K.C.H., Aalvink, S., Martinez, L.O., Dumas, M.-E., Maiter, D., Loumaye, A., Hermans, M.P., Thissen, J.-P., Belzer, C., de Vos, W.M., Cani, P.D., 2017. A purified membrane protein from Akkermansia muciniphila or the pasteurized bacterium improves metabolism in obese and diabetic mice. Nat Med 23, 107-113. doi: l0.l038/nm.4236
Qin, J., Li, Y., Cai, Z., Li, S., Zhu, J., Zhang, F., Liang, S., Zhang, W., Guan, Y.,
Shen, D., Peng, Y., Zhang, D., Jie, Z., Wu, W., Qin, Y., Xue, W., Li, J., Han, L., Lu, D., Wu, P., Dai, Y., Sun, X., Li, Z., Tang, A., Zhong, S., Li, X., Chen, W.,
Xu, R., Wang, M., Feng, Q., Gong, M., Yu, J., Zhang, Y., Zhang, M., Hansen, T., Sanchez, G., Raes, J., Falony, G., Okuda, S., Almeida, M., LeChatelier, E.,
Renault, P., Pons, N., Batto, J.-M., Zhang, Z., Chen, H., Yang, R., Zheng, W., Li, S., Yang, H., Wang, J., Ehrlich, S.D., Nielsen, R., Pedersen, O., Kristiansen, K., Wang, J., 2012. A metagenome-wide association study of gut microbiota in type 2 diabetes. Nature 490, 55-60. doi: l0. l038/naturel l450
Rehmsmeier, M., Steffen, P., Hochsmann, M., Giegerich, R., 2004. Fast and effective prediction of microRNA/target duplexes. RNA 10, 1507-1517.
doi: l0.l26l/rna.5248604
Reuter, E., Gollan, R., Grohmann, N., Paterka, M., Salmon, H., Birkenstock, J., Richers, S., Leuenberger, T., Brandt, A.U., Kuhlmann, T., Zipp, F., Siffrin, V., 2015. Cross-recognition of a myelin peptide by CD8+ T cells in the CNS is not sufficient to promote neuronal damage. J. Neurosci. 35, 4837-4850.
doi: 10.1523/JNEUROSCI.3380-14.2015
Rezende, R.M., da Cunha, A.P., Kuhn, C., Rubino, S., M’Hamdi, H., Gabriely, G., Vandeventer, T., Liu, S., Cialic, R., Pinheiro-Rosa, N., Oliveira, R.P.,
Gaublomme, J.T., Obholzer, N., Kozubek, J., Pochet, N., Faria, A.M.C., Weiner, H.L., 2015. Identification and characterization of latency-associated peptide- expressing gd T cells. Nat Commun 6, 8726. doi: l0.l038/ncomms9726
Robinson, A.P., Harp, C.T., Noronha, A., Miller, S.D., 2014. The experimental
autoimmune encephalomyelitis (EAE) model of MS: utility for understanding disease pathophysiology and treatment. Handb Clin Neurol 122, 173-189.
doi: 10.1016/B978-0-444-52001-2.00008-X
Round, J.L., Lee, S.M., Li, J., Tran, G., Jabri, B., Chatila, T.A., Mazmanian, S.K., 2011. The Toll-like receptor 2 pathway establishes colonization by a commensal of the human microbiota. Science (New York, NY) 332, 974-977.
doi: 10.1 l26/science.1206095
Schmidt, T.S.B., Raes, J., Bork, P., 2018. The Human Gut Microbiome: From
Association to Modulation. Cell 172, 1198-1215. doi: l0. l0l6/j.cell.20l8.02.044 Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data by the
comparative C(T) method. Nat Protoc 3, 1101-1108. doi: l0. l038/nprot.2008.73 Schonauen, K., Le, N., Arnim, von, U., Schulz, C., Malfertheiner, P., Link, A., 2018.
Circulating and Fecal microRNAs as Biomarkers for Inflammatory Bowel Diseases. Inflammatory Bowel Diseases 142, 46. doi: l0. l093/ibd/izy046
Sefik, E., Geva-Zatorsky, N., Oh, S., Konnikova, L., Zemmour, D., McGuire, A.M., Burzyn, D., Ortiz-Lopez, A., Lobera, M., Yang, J., Ghosh, S., Earl, A., Snapper, S.B., Jupp, R., Kasper, D., Mathis, D., Benoist, C., 2015. Individual intestinal symbionts induce a distinct population of RORy+ regulatory T cells. Science (New York, NY) 349, 993-997. doi: l0. H26/science.aaa9420
Shin, N.-R., Lee, J.-C., Lee, H.-Y., Kim, M.-S., Whon, T.W., Lee, M.-S., Bae, J.-W., 2014. An increase in the Akkermansia spp. population induced by metformin treatment improves glucose homeostasis in diet-induced obese mice. Gut 63, 727- 735. doi: 10.1 !36/gutjnl-20l2-303839 Subramanian, S.L., Kitchen, R.R., Alexander, R., Carter, B.S., Cheung, K.-H., Laurent, L.C., Pico, A., Roberts, L.R., Roth, M.E., Rozowsky, J.S., Su, A.I., Gerstein, M.B., Milosavljevic, A., 2015. Integration of extracellular RNA profiling data using metadata, biomedical ontologies and Linked Data
technologies. J Extracell Vesicles 4, 27497. doi: 10.3402/jev.v4.27497
Sutton, C., Brereton, C., Keogh, B., Mills, K.H.G., Lavelle, E.C., 2006. A crucial role for interleukin (IL)-l in the induction of IL-l7-producing T cells that mediate autoimmune encephalomyelitis. J Exp Med 203, 1685-1691.
doi: 10. l084/jem.20060285
Tankou, S.K., Regev, K., Healy, B.C., Tjon, E., Laghi, L., Cox, L.M., Kivisakk, P., Pierre, I.V., Hrishikesh, L., Gandhi, R., Cook, S., Glanz, B., Stankiewicz, J., Weiner, H.L., 2018. A probiotic modulates the microbiome and immunity in multiple sclerosis. Annals of Neurology 83, 1147-1161. doi: l0.l002/ana.25244 Teng, Y., Ren, Y., Sayed, M., Hu, X., Lei, C., Kumar, A., Hutchins, E., Mu, J., Deng, Z., Luo, C., Sundaram, K., Sriwastva, M.K., Zhang, L., Hsieh, M., Reiman, R.,
Haribabu, B., Yan, J., Jala, V.R., Miller, D.M., Van Keuren- Jensen, K., Merchant, M L., McClain, C.J., Park, J.W., Egilmez, N.K., Zhang, H.-G, 2018. Plant- Derived Exosomal MicroRNAs Shape the Gut Microbiota. Cell Host Microbe 24, 637-652. e8. doi: l0. l0l6/j.chom.20l8.10.001
Tremaroli, V., Backhed, F., 2012. Functional interactions between the gut microbiota and host metabolism. Nature 489, 242-249. doi: l0.l038/naturel l552
Tremlett, H., Fadrosh, D.W., Faruqi, A.A., Zhu, F., Hart, J., Roalstad, S., Graves, J., Lynch, S., Waubant, E., US Network of Pediatric MS Centers, 2016. Gut microbiota in early pediatric multiple sclerosis: a case-control study. Eur. J.
Neurol. 23, 1308-1321. doi: l0. l l l l/ene.13026
Tumbaugh, P.J., Hamady, M., Yatsunenko, T., Cantarel, B.L., Duncan, A., Ley, R.E., Sogin, M.L., Jones, W.J., Roe, B.A., Affourtit, J.P., Egholm, M., Henrissat, B., Heath, A.C., Knight, R., Gordon, J.I., 2008. A core gut microbiome in obese and lean twins. Nature 457, 480-484. doi: l0. l038/nature07540
van Nood, E., Vrieze, A., Nieuwdorp, M., Fuentes, S., Zoetendal, E.G., de Vos,
W.M., Visser, C.E., Kuijper, E.J., Bartelsman, J.F.W.M., Tijssen, J.G.P.,
Speelman, P., Dijkgraaf, M.G.W., Keller, J.J., 2013. Duodenal infusion of donor feces for recurrent Clostridium difficile. N. Engl. J. Med. 368, 407-415. doi: l0.l056/NEJMoal205037
Viennois, E., Chassaing, B., Tahsin, A., Pujada, A., Wang, L., Gewirtz, A.T., Merlin, D., 2019. Host-derived fecal microRNAs can indicate gut microbiota healthiness and ability to induce inflammation. Theranostics 9, 4542-4557.
doi: 10.7l50/thno.35282
Waterhouse, A.M., Procter, J.B., Martin, D.M.A., Clamp, M., Barton, G.J., 2009.
Jalview Version 2— a multiple sequence alignment editor and analysis workbench. Bioinformatics 25, 1189-1191. doi: l0. l093/bioinformatics/btp033
Wei, Z., Batagov, A.O., Schinelli, S., Wang, J., Wang, Y., Fatimy, El, R.,
Rabinovsky, R., Balaj, L., Chen, C.C., Hochberg, F., Carter, B., Breakefield,
X.O., Krichevsky, A.M., 2017. Coding and noncoding landscape of extracellular RNA released by human glioma stem cells. Nat Commun 8, 1145-15.
doi: 10.1038/S41467-017-01196-c
Wu, H., Esteve, E., Tremaroli, V., Khan, M.T., Caesar, R., Manneras-Holm, L.,
Stahlman, M., Olsson, L.M., Serino, M., Planas-Felix, M., Xifira, G., Mercader,
J.M., Torrents, D., Burcelin, R., Ricart, W., Perkins, R., Fernandez -Real, J.M., Backhed, F., 2017. Metformin alters the gut microbiome of individuals with treatment-naive type 2 diabetes, contributing to the therapeutic effects of the drug. Nat Med 23, 850-858. doi: l0. l038/nm.4345
Yissachar, N., Zhou, Y., ETng, L., Lai, N.Y., Mohan, J.F., Ehrlicher, A., Weitz, D.A., Kasper, D.L., Chiu, I.M., Mathis, D., Benoist, C., 2017. An Intestinal Organ Culture System ETncovers a Role for the Nervous System in Microbe-Immune Crosstalk. Cell 168, H35-l l48.el2. doi: l0. l0l6/j.cell.20l7.02.009
OTHER EMBODIMENTS
It is to be understood that while the invention has been described in
conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

WHAT IS CLAIMED IS:
1. A method of treating, reducing risk of development or progression of, or reducing symptoms of, an inflammatory condition in a subject, the method comprising administering a therapeutically effective amount of a nucleic acid comprising a sequence that is identical to a contiguous sequence of at least 12 nucleotides present in mature miR-30d, miR-7706, and/or miR-l246 microRNA, to a subject in need thereof.
2. A method of reducing interferon gamma (IFNy)-producing Thl and/or interleukin- 17 (IL-l7)-secreting Thl 7 CD4+ T cells, and/or increasing regulatory cells such as FoxP3+ regulatory T cells (Tregs), in the periphery and/or in the CNS in a subject, the method comprising administering a therapeutically effective amount of a nucleic acid comprising a sequence that is identical to a contiguous sequence of at least 12 nucleotides present in mature miR-30d, miR-7706, and/or miR-l246 microRNA, to a subject in need thereof.
3. The method of claim 1 or 2, wherein the nucleic acid is a miRNA selected from miR-30d, miR-7706, and/or miR-l246.
4. The method of claim 4, comprising administering miR-30d; miR-7706; miR-l246; miR-30d and miR-7706; miR-30d and miR-l246; miR-7706 and miR-l246; or miR-30d, miR-7706, and miR-l246.
5. A method of increasing relative abundance of Akkermansia muciniphila in the gut microbiome of a subject, the method comprising administering a therapeutically effective amount of a nucleic acid comprising a sequence that is identical to a contiguous sequence of at least 12 nucleotides present in mature miR-30d to a subject in need thereof.
6. The method of claim 2 or 5, wherein the subject has an inflammatory condition.
7. The method of claim 1 or 6, wherein the condition is an inflammatory
autoimmune disease.
8. The method of claim 1 or 6, wherein the condition is selected from the group
consisting of Type 1 diabetes; multiple sclerosis; inflammatory bowel disease (IBD)/colitis; obesity and obesity-related conditions; epilepsy; immune-mediated liver injury; amyotrophic lateral sclerosis (ALS); rheumatoid arthritis; and aging or progeria.
9. The method of any of claims 1-8, wherein the nucleic acid is a miRNA mimic.
10. The method of claim 9, wherein the miRNA mimic comprises one or more
modifications.
11. The method of claim 10, wherein the modifications include but are not limited to: double-stranded sequence, 5’ Amino-Modifier C6, and/or 3’ [dT][dT]
12. The method of any of claims 1-11, wherein the nucleic acid is administered orally.
13. The method of any of claims 1-11, wherein the nucleic acid is administered
rectally.
14. A nucleic acid comprising a sequence that is identical to a contiguous sequence of at least 12 nucleotides present in mature miR-30d, miR-7706, and/or miR-l246 microRNA for use in a method of treating, reducing risk of development or progression of, or reducing symptoms of, an inflammatory condition in a subject, the method comprising administering a therapeutically effective amount of a nucleic acid comprising a sequence that is identical to a contiguous sequence of at least 12 nucleotides present in mature miR-30d, miR-7706, and/or miR-l246 microRNA, to a subject in need thereof.
15. A nucleic acid comprising a sequence that is identical to a contiguous sequence of at least 12 nucleotides present in mature miR-30d, miR-7706, and/or miR-l246 microRNA for use in a method of reducing interferon gamma (IFNy)-producing Thl and/or interleukin-l 7 (IL-l7)-secreting Thl7 CD4+ T cells, and/or increasing regulatory cells such as FoxP3+ regulatory T cells (Tregs), in the periphery and/or in the CNS in a subject.
16. The nucleic acid for the use of claim 14 or 15, wherein the nucleic acid is a
miRNA selected from miR-30d, miR-7706, and/or miR-l246.
17. The nucleic acid for the use of claim 16, comprising administering miR-30d; miR- 7706; miR-l246; miR-30d and miR-7706; miR-30d and miR-l246; miR-7706 and miR-l246; or miR-30d, miR-7706, and miR-l246.
18. A nucleic acid comprising a sequence that is identical to a contiguous sequence of at least 12 nucleotides present in mature miR-30d for use in a method of increasing relative abundance of Akkermansia muciniphila in the gut microbiome of a subject in need thereof.
19. The nucleic acid for the use of claim 15 or 18, wherein the subject has an
inflammatory condition.
20. The nucleic acid for the use of claim 14 or 19, wherein the condition is an
inflammatory autoimmune disease.
21. The nucleic acid for the use of claim 14 or 19, wherein the condition is selected from the group consisting of Type 1 diabetes; multiple sclerosis; inflammatory bowel disease (IBD)/colitis; obesity and obesity-related conditions; epilepsy; immune-mediated liver injury; amyotrophic lateral sclerosis (ALS); rheumatoid arthritis; and aging or progeria.
22. The nucleic acid for the use of any of claims 14-21, wherein the nucleic acid is a miRNA mimic.
23. The nucleic acid for the use of claim 22, wherein the miRNA mimic comprises one or more modifications.
24. The nucleic acid for the use of claim 23, wherein the modifications include but are not limited to: double- stranded sequence, 5’ Amino-Modifier C6, and/or 3’
[dT][dT]
25. The nucleic acid for the use of claims 14-24, wherein the nucleic acid is
formulated to be administered orally.
26. The nucleic acid for the use of claims 14-24, wherein the nucleic acid is
formulated to be administered rectally.
PCT/US2019/047954 2018-08-23 2019-08-23 The microbiome as a target of micrornas for the treatment of disease Ceased WO2020041733A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US17/270,711 US20210348163A1 (en) 2018-08-23 2019-08-23 The Microbiome as a Target of MicroRNAs for the Treatment of Disease

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201862722136P 2018-08-23 2018-08-23
US62/722,136 2018-08-23

Publications (1)

Publication Number Publication Date
WO2020041733A1 true WO2020041733A1 (en) 2020-02-27

Family

ID=69591137

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2019/047954 Ceased WO2020041733A1 (en) 2018-08-23 2019-08-23 The microbiome as a target of micrornas for the treatment of disease

Country Status (2)

Country Link
US (1) US20210348163A1 (en)
WO (1) WO2020041733A1 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150232837A1 (en) * 2012-08-31 2015-08-20 Aptamir Therapeutics, Inc. Mirna modulators of chronic visceral inflammation

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9421218B2 (en) * 2010-04-13 2016-08-23 New York University Compositions and methods for treatment of melanoma

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150232837A1 (en) * 2012-08-31 2015-08-20 Aptamir Therapeutics, Inc. Mirna modulators of chronic visceral inflammation

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
HSU, P ET AL.: "IL -10 Potentiates Differentiation of Human Induced Regulatory T Cells via STAT3 and Foxo1", THE JOURNAL OF IMMUNOLOGY, vol. 195, no. 8, 15 October 2015 (2015-10-15), pages 3665 - 3674, XP055598526, DOI: 10.4049/jimmunol.1402898 *
JIANG, M ET AL.: "Exosomes from MiR-30d-5p-ADSCs Reverse Acute Ischemic Stroke-Induced, Autophagy-Mediated Brain Injury by Promoting M2 Microglial/Macrophage Polarization", CELLULAR PHYSIOLOGY AND BIOCHEMISTRY, vol. 47, no. 2, 29 May 2018 (2018-05-29), pages 864 - 878, XP055687911 *

Also Published As

Publication number Publication date
US20210348163A1 (en) 2021-11-11

Similar Documents

Publication Publication Date Title
Liu et al. Oral administration of miR-30d from feces of MS patients suppresses MS-like symptoms in mice by expanding Akkermansia muciniphila
AU2025203709A1 (en) Intestinal microbiota and GVHD
Ballal et al. Host lysozyme-mediated lysis of Lactococcus lactis facilitates delivery of colitis-attenuating superoxide dismutase to inflamed colons
O'Mahony et al. Commensal-induced regulatory T cells mediate protection against pathogen-stimulated NF-κB activation
Chen et al. Dysbiosis of the rat vagina is efficiently rescued by vaginal microbiota transplantation or probiotic combination
Rizzello et al. Role of natural killer and dendritic cell crosstalk in immunomodulation by commensal bacteria probiotics
Feleszko et al. Probiotic‐induced suppression of allergic sensitization and airway inflammation is associated with an increase of T regulatory‐dependent mechanisms in a murine model of asthma
Shih et al. Microbial induction of inflammatory bowel disease associated gene TL1A (TNFSF15) in antigen presenting cells
KR102248111B1 (en) Novel Bifidobacterium bifidum Strain and Polysaccharides Derived from Bifidobacterium bifidum
AU2018367596A1 (en) Compositions and methods for treating immune disorders using immune modulating
Yuan et al. Blockade of immune-checkpoint B7-H4 and lysine demethylase 5B in esophageal squamous cell carcinoma confers protective immunity against P. gingivalis infection
Stanisavljević et al. Gut microbiota confers resistance of albino oxford rats to the induction of experimental autoimmune encephalomyelitis
JP2021518414A (en) Compositions Containing Bacterial Strains
JP7040701B2 (en) Anti-cancer oncolytic virus combination therapy and excellent responder selection platform
Ayariga et al. Microbiota in a long survival discourse with the human host
JP5069556B2 (en) T cell apoptosis inducer
US20210348163A1 (en) The Microbiome as a Target of MicroRNAs for the Treatment of Disease
Saeki et al. Toll‐like receptor 2‐mediated modulation of growth and functions of regulatory T cells by oral streptococci
Nagatani et al. Antigen-specific regulatory T cells are detected in Peyer's patches after the interaction between T cells and dendritic cells loaded with orally administered antigen
McMurran CNS Remyelination and the gut microbiota
US20130230859A1 (en) Use of blood group status
Lange The antidepressant Amitriptyline induces gut microbiome dysbiosis and facilitates enteropathogenic infection in mice
Janakiraman Regulation of spontaneous CNS autoimmunity by dietary salt
Shen Interkingdom communication of a bacterial mutualist and its mammalian host
Beuving The role of the gut microbiota in the pathogenesis of multiple sclerosis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19852446

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19852446

Country of ref document: EP

Kind code of ref document: A1