WO2020028850A1 - Srnas that enhance plant resistance - Google Patents

Srnas that enhance plant resistance Download PDF

Info

Publication number
WO2020028850A1
WO2020028850A1 PCT/US2019/044971 US2019044971W WO2020028850A1 WO 2020028850 A1 WO2020028850 A1 WO 2020028850A1 US 2019044971 W US2019044971 W US 2019044971W WO 2020028850 A1 WO2020028850 A1 WO 2020028850A1
Authority
WO
WIPO (PCT)
Prior art keywords
plant
ppr
pathogen
sirnas
capsici
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2019/044971
Other languages
French (fr)
Inventor
Wenbo Ma
Yingnan HOU
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of California Berkeley
University of California San Diego UCSD
Original Assignee
University of California Berkeley
University of California San Diego UCSD
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of California Berkeley, University of California San Diego UCSD filed Critical University of California Berkeley
Publication of WO2020028850A1 publication Critical patent/WO2020028850A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8282Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance

Definitions

  • Phytophthora are filamentous eukaryotic pathogens that exert major threats to food safety and human wellness (Kamoun et al., 2015). Hundreds of billions of dollars are lost each year due to destructive crop diseases caused by Phytophthora species. For example, the notorious potato pathogen Phytophthora infestans was the culprit of the Irish Famine in the nineteenth century and remains a serious problem worldwide. Battling Phytophthora diseases is a major challenge in agriculture.
  • RNA silencing has a well-established role in anti- viral immunity and viral RNA silencing suppressors are indispensable for infection (Ding, 2010).
  • PSR RNA silencing
  • RNA-dependent RNA polymerases RNA-dependent RNA polymerases
  • RNAs that can be expressed in plants and their use for increasing plant resistance to pathogens, including for example Phytophthora and Verticilium, are described.
  • a transgenic plant engineered to heterologously express an miRNA comprising any one of SEQ ID NO: 1-19 is provided, wherein the transgenic plant has enhanced resistance to a pathogen compared to a control plant that does not heterologously express the miRNA.
  • the plant further heterologously expresses a pentatricopeptide repeat (PPR)- encoding transcript.
  • the PPR-encoding transcript contains a mutation such that the transcript does not express a function protein..
  • the PPR- encoding transcript and the miRNA are from the same species of plant and are different from the transgenic plant species.
  • the transgenic plant comprises an expression cassette, the expression cassette comprising a promoter operably linked to a polynucleotide encoding the miRNA, wherein the promoter is heterologous to the polynucleotide.
  • the promoter is constitutive or tissue-specific or inducible.
  • the plant is a dicot plant. In some embodiments, the plant is a cotton plant.
  • the pathogen is one or more of a species of Phytophthora and/or Verticillium or other filamentous eukaryotic pathogen.
  • the method comprises (i) modifying an endogenous promoter of the plant to heterologously express the miRNA or (ii) introducing the expression cassette into the plant. In some embodiments, the method further comprises selecting from a plurality of modified plants, one or more plant with enhanced resistance to the pathogen (including but not limited to Phytophthora).
  • a method of inducing resistance in a plant to a pathogen comprising, contacting a plant with an miRNA comprising any one of SEQ ID NO: 1-19 in an amount to induce resistance to a pathogen.
  • the method further comprises contacting the plant with a pentatricopeptide repeat (PPR)-encoding transcript.
  • the PPR-encoding transcript contains a mutation such that the transcript does not express a function protein.
  • the PPR-encoding transcript and the miRNA are from the same (or different) species of plant and are different from the transgenic plant species
  • the plant is a dicot plant.
  • the plant is a cotton plant.
  • the pathogen is one or more of a species of Phytophthora and/or Verticillium.
  • the contacting comprising spraying aerial parts of the plant or contacting roots of the plant with the miRNA (and optionally the PPR-encoding transcript).
  • pathogen-resistant or “pathogen resistance” refers to an increase in the ability of a plant to prevent or resist pathogen infection or pathogen-induced symptoms.
  • Pathogen resistance can be increased resistance relative to a particular pathogen species or genus (e.g., Verticilium or Phytophthora), increased resistance to multiple pathogens, or increased resistance to all pathogens (e.g., systemic acquired resistance).
  • resistance of a plant to a pathogen is "increased" when one or more symptoms of pathogen infection are reduced relative to a control (e.g., a plant in which a polynucleotide that inhibits expression of a pathogen target gene is not expressed).
  • Pathogens include, but are not limited to, viruses, bacteria, nematodes, fungi, oomycetes or insects (see, e.g., Agrios, Plant Pathology (Academic Press, San Diego, CA (1988)).
  • the pathogen is a fungal pathogen.
  • the pathogen is an oomycete pathogen.
  • the pathogen is Phytophthora.
  • the pathogen is Verticillium.
  • nucleic acid or “polynucleotide” refers to a single or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5' to the 3' end. Nucleic acids may also include modified nucleotides that permit correct read through by a polymerase and do not significantly alter expression of a polypeptide encoded by that nucleic acid.
  • nucleic acid encoding or “polynucleotide encoding” refers to a nucleic acid which directs the expression of a specific protein or peptide, or a non-coding RNA.
  • the nucleic acid sequences include both the DNA strand sequence that is transcribed into RNA and, when encoding a protein, the RNA sequence that is translated into protein.
  • the nucleic acid sequences include both the full length nucleic acid sequences as well as non-full length sequences derived from the full length sequences.
  • Two nucleic acid sequences or polypeptides are said to be “identical” if the sequence of nucleotides or amino acid residues, respectively, in the two sequences is the same when aligned for maximum correspondence as described below. "Percentage of sequence identity” is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
  • the percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.
  • percentage of sequence identity is used in reference to proteins or peptides, it is recognized that residue positions that are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. Where sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution.
  • Means for making this adjustment are well known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1.
  • the scoring of conservative substitutions is calculated according to, e.g., the algorithm of Meyers & Miller, Computer Applic. Biol. Sci. 4:11-17 (1988) e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, California, USA).
  • substantially identical refers to a sequence that has at least 60% sequence identity to a reference sequence.
  • percent identity can be any integer from 60% to 100%.
  • Exemplary embodiments include at least: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, as compared to a reference sequence using the programs described herein; preferably BLAST using standard parameters, as described below.
  • sequence comparison typically one sequence acts as a reference sequence to which test sequences are compared.
  • test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated.
  • sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
  • a “comparison window,” as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.
  • Methods of alignment of sequences for comparison are well- known in the art.
  • Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman Add. APL. Math.2:482 (1981), by the homology alignment algorithm of Needleman and Wunsch J. Mol. Biol.48:443 (1970), by the search for similarity method of Pearson and Lipman Proc. Natl.
  • HSPs high scoring sequence pairs
  • T is referred to as the neighborhood word score threshold (Altschul et al, supra).
  • These initial neighborhood word hits acts as seeds for initiating searches to find longer HSPs containing them.
  • the word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased.
  • Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always ⁇ 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score.
  • Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached.
  • the BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
  • the BLASTP program uses as defaults a word size (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1989)).
  • the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Nat'l. Acad. Sci. USA 90:5873-5787 (1993)).
  • One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
  • P(N) the smallest sum probability
  • a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.01, more preferably less than about 10 -5 , and most preferably less than about 10 -20 .
  • a polynucleotide sequence is "heterologous" to an organism or a second polynucleotide sequence if it originates from a foreign species, or, if from the same species, is modified from its original form.
  • a promoter when a promoter is said to be operably linked to a heterologous coding sequence, it means that the coding sequence is derived from one species whereas the promoter sequence is derived another, different species; or, if both are derived from the same species, the coding sequence is not naturally associated with the promoter (e.g., is a genetically engineered coding sequence, e.g., from a different gene in the same species, or an allele from a different ecotype or variety).
  • An "expression cassette” refers to a nucleic acid construct, which when introduced into a host cell, results in transcription and/or translation of a RNA or polypeptide, respectively. Antisense constructs or sense constructs that are not or cannot be translated are expressly included by this definition.
  • One of skill will recognize that the inserted polynucleotide sequence need not be identical, but may be only substantially similar to a sequence of the gene from which it was derived.
  • promoter refers to a polynucleotide sequence capable of driving transcription of a coding sequence in a cell.
  • promoters used in the polynucleotide constructs of the invention include cis-acting transcriptional control elements and regulatory sequences that are involved in regulating or modulating the timing and/or rate of transcription of a gene.
  • a promoter can be a cis-acting transcriptional control element, including an enhancer, a promoter, a transcription terminator, an origin of replication, a chromosomal integration sequence, 5' and 3' untranslated regions, or an intronic sequence, which are involved in transcriptional regulation.
  • These cis-acting sequences typically interact with proteins or other biomolecules to carry out (turn on/off, regulate, modulate, etc.) gene transcription.
  • tissue-specific promoter initiates transcription only in one or a few particular tissue types.
  • inducible promoter is one that initiates transcription only under particular environmental conditions or developmental conditions.
  • plant includes whole plants, shoot vegetative organs and/or structures (e.g., leaves, stems and tubers), roots, flowers and floral organs (e.g., bracts, sepals, petals, stamens, carpels, anthers), ovules (including egg and central cells), seed (including zygote, embryo, endosperm, and seed coat), fruit (e.g., the mature ovary), seedlings, plant tissue (e.g., vascular tissue, ground tissue, and the like), cells (e.g., guard cells, egg cells, trichomes and the like), and progeny of same.
  • shoot vegetative organs and/or structures e.g., leaves, stems and tubers
  • roots e.g., bracts, sepals, petals, stamens, carpels, anthers
  • ovules including egg and central cells
  • seed including zygote, embryo, endosperm, and seed coat
  • fruit e.g., the mature
  • the class of plants that can be used in the method of the invention is generally as broad as the class of higher and lower plants amenable to transformation techniques, including angiosperms (monocotyledonous and dicotyledonous plants), gymnosperms, ferns, and multicellular algae. It includes plants of a variety of ploidy levels, including aneuploid, polyploid, diploid, haploid, and hemizygous.
  • FIG.1 PSR2 affects the accumulation of specific 21-nt siRNAs in Arabidopsis.
  • FIG.1A Mutants defective in secondary siRNA production and a transgenic line expressing PSR2 (PSR2-5) are hypersusceptible to Phytophthora capsici. Arabidopsis plants were inoculated with zoospore suspensions of P. capsici isolate LT263. Photos were taken at 3 days post inoculation (dpi). Arrows indicate inoculated leaves. WT: wild-type Col-0.
  • FIG.1C Size distribution of total small RNAs in WT and PSR2-5 plants. Data from two biological replicates are presented.
  • FIG.1D Reads fraction of 21-nt sRNAs in WT and PSR2-5 plants. Percentage of reads count of miRNAs, and siRNAs produced from Pol IV transcripts (P4siRNA), transposable elements (TE), protein-coding transcripts (PC), TAS and PPR transcripts are presented. Data from two biological replicates are presented.
  • FIG.1E Changes in the abundance (in a log2 scale) of 21-nt small RNAs derived from different classes of transcripts in PSR2-5.
  • P4 RNA polymerase IV
  • TE transposable elements
  • PC protein-coding genes
  • tasiRNA trans acting siRNAs
  • PPR pentatricopeptide repeat protein- coding genes.
  • FIG.1F Secondary siRNAs generated from PPR, TAS and NB-LRR loci in WT and PSR2-5 plants. The number in each plot indicates the scale of sRNA reads count derived from each locus.
  • FIG.2 Secondary siRNAs generated from a cluster of PPR genes contribute to
  • FIG.2A Northern blotting showing induced accumulation of miR161 and two representative PPR-derived secondary siRNAs in wild-type Col-0 (WT) plants during P. capsici infection (0-24 hours post inoculation with zoospore suspensions). Numbers represent relative signal intensities. U6 was used as a loading control. Water was used as the“mock” treatment. Similar results were obtained from two biological replicates. See also Figure 7A-D.
  • FIG.2B Northern blotting showing that the abundance of miR161 and miR393 remained unchanged in bak1/serk4 mutant after inoculated with P. capsici.
  • FIG.2C miR161 is a positive regulator of plant immunity.
  • the abundance of two PPR- derived siRNAs was determined in WT, MIR161ox and MIR161cri plants by northern blotting.
  • Disease severity index (DSI) of WT, MIR161ox and MIR161cri plants was determined at 3 days after zoospore inoculation by P. capsici. Values are mean ⁇ SEM of three biological replicates. Student’s t-test was used for comparisons (mutants versus WT). Statistically significant results are labeled with * (p £ 0.05).
  • N320 Northern blotting was used to examine the abundance of two PPR-derived siRNAs determined in WT, MIR161ox and MIR161cri plants. See also Figure 8A-J.
  • FIG.2D MIR173cri mutants are hypersusceptible to P. capsici.
  • the abundance of two PPR-derived siRNAs was evaluated in WT and the mutants.
  • DSI was determined at 3 dpi.
  • FIG.2E Secondary siRNA-producing PPR genes contribute to Arabidopsis resistance to P. capsici. DSI of eight PPR mutants was determined at 3 dpi. Values are mean ⁇ SEM of three biological replicates. Student’s t-test was used for comparisons (mutants versus WT). * labels results that are statistically different at p £ 0.05. N320. See also Figure 9.
  • FIG 3 A PPR-derived siRNA silences a gene in Phytophthora to confer resistance.
  • FIG 3A A flow chart describing the experimental procedure of the functional analysis of PPR-derived siRNAs.
  • FIG 3B Base pairing of the PPR-derived siR1310 and siR0513 with their predicted target site in Phyca_554980 of P. capsici (SEQ ID NOS 1409-1412, respectively, in order of appearance). See also Figure 10A-C.
  • FIG 3C Quantitative RT-PCR determining the transcript abundances of Phyca_554980 and Phyca_538731 (an off-target control) in P. capsici transformants harboring synthesized siR1310. P. capsici transformed with siRGFP was used as a negative control. Values are mean ⁇ SEM of three biological replicates. See also Figure 11A-G.
  • FIG 3F Quantitative RT-PCR determining the abundances of siR1310 in leaves or extracellular vesicles (EV) of WT and PSR2-5 Arabidopsis plants with or without P. capsici infection. Values are mean ⁇ SEM of three biological replicates.
  • FIG 3G Transcript abundances of Phyca_554980 in wild-type (WT), MIR161ox, PSR2- 5 and rdr6 plants inoculated with P. capsici.
  • the transcript levels at 1 dpi were determined by qRT-PCR. Values are mean ⁇ SEM of three biological replicates. Student’s t-test was used for comparisons (mutants versus WT).
  • FIG.4 PPR-derived siR1310 silences a reporter gene during Phytophthora infection.
  • FIG.4A Schematic illustration of the construction of mRFP reporters containing either a target site of siR1310 (t-mRFP) or a mutated version of the target site (mt-mRFP).
  • FIG.4D mRFP transcript levels of the P. capsici strains infecting wild-type (WT), MIR161ox and MIR161cri plants were determined by qRT-PCR. Values are mean ⁇ SEM of at least four replicates. Student’s t-test was used for comparisons (mutants versus WT). * represents statistical difference (p £ 0.05); NS represents no statistical difference. Because t-mRFP and mt- mRFP constructs were independently transformed into P. capsici, their basal mRFP expression levels were different. See also Figure11A-G.
  • FIG.5 PSR2 associates with DRB4 in Arabidopsis.
  • FIG.5A Schematic representation of the domain structure of PSR2 and DRB4.
  • PSR2 has seven tandem repeat units consisting of W, Y and/or L motifs.
  • S secretion signal;
  • R RxLR domain.
  • DRB4 has two double-stranded RNA-binding motifs (dsRBM) at the N-terminus.
  • FIG.5B The two dsRNA-binding domains of DRB4 mediate interaction with PSR2 in planta.
  • Flag-PSR2, DRB4-YFP, and DRB4 truncates were transiently expressed in N. benthamiana.
  • Total proteins were extracted and PSR2 was pulled down using anti-Flag agarose beads.
  • Enrichment of DRB4 or its truncated mutants in the immune complexes was detected by western blotting. * labels corresponding protein band.
  • the gel stained with Coomassie Brilliant Blue (CBB) was used as a loading control.
  • CBB Coomassie Brilliant Blue
  • FIG.5C WY1 and LWY2 are necessary and sufficient for PSR2 interaction with DRB4.
  • PSR2, PSR2DWY1, PSR2DLWY2, and PSR2WY1+LWY2 were fused with a flag tag and individually expressed in N. benthamiana together with DRB4-YFP. Enrichment of DRB4 in the immune complexes pulled down by anti-Flag agarose beads was detected by western blotting. * labels corresponding protein band in each lane. The arrowhead labels signals corresponding to DRB4.
  • FIG.5D WY1 and LWY2 are necessary and sufficient for the transgene silencing suppression activity of PSR2.
  • Leaves of N. benthamiana 16c plants were co-infiltrated with Agrobacterium carrying 35S:GFP and 35S:PSR2 constructs. Pictures were taken 5 days after Agrobacterium infiltration. EV: Empty vector. See also Figure 12A-D.
  • FIG.5E Virulence activities of PSR2 and its derivatives were examined on N.
  • FIG.5F Reduced dsRNA cleavage in PSR2-5 and a drb4 mutant plants.
  • In vitro synthesized 510-bp dsRNAs were labeled with 32 P, and then incubated with crude protein extracts. The cleavage products were analyzed by electrophoresis. A 22-nt DNA end-labeled with 32 P and a dsRNA ladder were used as size markers.
  • the arrow labels the 510-bp dsRNAs and the arrowhead labels sRNA products. Numbers represent the relative abundances of the sRNA products with the level in wild-type (WT) set to 1.
  • Total proteins in the crude extracts were analyzed on SDS-PAGE and stained with Coomassie Brilliant Blue (CBB) as a loading control.
  • CBB Coomassie Brilliant Blue
  • FIG.6A drb4 and PSR2-5 plants were hypersusceptible to P. capsici. Roots of 14-day- old seedlings were inoculated by zoospore suspensions and the photos were taken at 3 dpi. This phenotype was complemented by introducing DRB4-YFP under its native promoter into the drb4 mutant. See also Figure12A-D.
  • FIG.6B Five-week-old drb4 and PSR2-5 plants exhibited a similar curly/narrow leaf phenotype.
  • FIG.6C Venn diagram showing PPR loci with reduced secondary siRNA production in rdr6, drb4 and PSR2-5 plants compared to wild-type Arabidopsis respectively.
  • FIG.7A-D Accumulation of secondary siRNA-triggering miRNAs and tasiRNA in Arabidopsis during P. capsici infection, related to Figure 2.
  • FIG.7A Quantitative RT-PCR showing transcript abundances of pri-miRNAs in wild- type Arabidopsis Col-0 during P. capsici infection at 0, 3, 6 and 12 hours post inoculation (hpi). Values are mean ⁇ SD. Water was used as a mock treatment.
  • FIG.7B Northern blotting showing the abundances of miR173, miR390 and miR393 during P. capsici infection in wild-type (WT) Arabidopsis plants. Numbers represent relative signal intensities. U6 was used as a loading control.
  • FIG.7C Sequence alignment of two PPR-siRNAs.
  • PPR-siRNA-1 and PPR-siRNA-2 were used as representatives to show abundance changes in Arabidopsis (SEQ ID NOS 1413- 1434, respectively, in order of appearance). Similar sequences could be produced from multiple PPR loci.
  • FIG.7D Northern blotting showing the abundances of two tasiRNAs (siR255 and siR1511) during P. capsici infection (0-24 hours post inoculation). The production of these tasiRNAs is triggered by miR173. Water was used as a mock treatment. U6 served as a loading control. Numbers represent relative signal intensities.
  • FIG.8A-J Disease susceptibility of miR161 and miR173 mutants, related to Figure 2.
  • FIG.8A Sequences in the foldback region of pri-miR161 in wild-type (WT) and MIR161cri lines (SEQ ID NOS 1435-1440, respectively, in order of appearance).
  • the sequences in purple correspond to miR161.
  • MIR161cri-7 has one nucleotide insertion (in red), which reduces, but not abolishes miR161 production.
  • MIR161cri-8 has a deletion of six nucleotides, abolishing miR161 production.
  • FIG.8B Northern blotting showing the abundance of miR161 in wild-type Arabidopsis (WT), MIR161 over-expression lines (MIR161ox), and crispr mutants (MIR161cri) lines.
  • FIG.8D Northern blotting showing the increased accumulation of miR173 and tasiRNAs (represented by siR1511) in MIR173 over-expression lines (MIR173ox). However, the abundance of PPR-derived siRNAs (represented by PPR-siRNA-2) was not increased. Numbers represent relative signal intensities. U6 was used as a loading control.
  • FIG.8E MIR173ox plants exhibited similar susceptibility to wild-type (WT) when inoculated with P. capsici zoospore suspension. DSI was determined at 3 dpi. Values are mean ⁇ SEM of three biological replicates.
  • FIG.8F Northern blotting showing the increased accumulation of miR390 in MIR390 over-expression (MIR390ox) lines.
  • FIG.8G MIR390ox plants exhibited similar susceptibility to wild-type (WT) when inoculated with P. capsici zoospore suspension. DSI was determined at 3 dpi. Values are mean ⁇ SEM of three biological replicates.
  • FIG.8H Sequences in the foldback region of MIR173 in wild-type and MIR173cri lines (SEQ ID NOS 1441-1446, respectively, in order of appearance). miR173 can be generated from both purple regions. Mutated nucleotides in MIR173cri-3 are highlighted in red. In addition to mutations, MIR173cri-7 also have a deletion of ten nucleotides, leading to abolishment of miR173 production.
  • FIG.8I Northern blotting showing the diminished accumulation of tasiRNAs
  • FIG.8J Symptoms of MIR173cri mutants after P. capsici infection. Photos were taken at 3 dpi. Arrows indicate inoculated leaves.
  • FIG.9A-C Characterization of the T-DNA insertion mutants of eight PPR genes that can generate secondary siRNAs, related to Figure 2.
  • FIG.9A Schematic maps of the T-DNA insertion site in each mutant and the locations of the primers used for quantitative RT-PCR. Black arrows label the predicted target sites of miR161. White arrows label the predicted target sites of tasiRNAs.
  • FIG.9B Quantitative RT-PCR measuring the transcript levels of the corresponding PPR gene in each mutant. Values are mean ⁇ SD of at least three replicates.
  • FIG.9C Disease symptoms of the mutants after P. capsici inoculation Photos were taken at 3 dpi. Inoculated leaves were removed from the plants at 3 dpi to better show the symptoms.
  • FIG.10A-C Potential targets of PPR-derived siRNAs in Arabidopsis and
  • FIG.10A Venn diagram showing a minimal overlap between genes up-regulated in PSR2-5 plants, compared to wild-type Arabidopsis Col-0, and the genes predicted to contain target site(s) of PPR-derived siRNAs.
  • FIG.10B A list showing the 11 genes that are up-regulated in PSR2-5 and are also potential targets of PPR-derived siRNAs. Only two of the 11 genes contain PPR domains in their deduced amino acid sequences. At1g12775 can also produce siRNAs, but it is not in the gene cluster that produces the large majority of PPR-derived siRNAs.
  • FIG.10C Amino acid sequence alignment of homologs of Phyca_554980 encoded protein in Phytophthora species P. capsici, P. parasitica, P. infestans, P. ramorum, P.
  • cinnamomi and P. sojae (from the top to the bottom in the alignment) (SEQ ID NOS 1447-1452, respectively, in order of appearance).
  • the protein sequences were identified using FungiDB (http://fungidb.org/fungidb/). Highlighted areas represent highly conserved sequences.
  • FIG.11A-G Target gene silencing and developmental defects of P. capsici
  • FIG.11A Quantitative RT-PCR of the predicted target gene Phyca_554980 in ten independent transformants of P. capsici that potentially carry siR1310. Transformants potentially carrying siRGFP were used as controls. Values are mean ⁇ SEM.
  • FIG.11B Insufficient base pairing of the PPR-derived siR1310 and siR0513 with their predicted off-target Phyca_538731 of P. capsici (SEQ ID NOS 1453-1456, respectively, in order of appearance).
  • FIG.11C Mycelium growth of two siR1310 transformants with largely reduced transcript levels of the target gene Phyca_554980.
  • P. capsici strains were grown on V8 plates. Pictures were taken after 5 days of growth. Transformants carrying siRGFP and wild-type (WT) strain were used as controls.
  • FIG.11D Mycelium growth rate (shown as colony diameters) of P. capsici strains. Values are mean ⁇ SEM. Different letters indicate values that are statistically different (p ⁇ 0.05).
  • FIG.11E Number of zoospores produced by P. capsici strains. Sporangia growing in sterilized water were stressed to release zoospores by illumination for 12 hours and then chilling at 4°C for 1 hour. Zoospores were counted from four randomly selected fields of view under a microscope for each strain using a hemocytometer. Values are mean ⁇ SEM. Different letters indicate values that are statistically different (p ⁇ 0.05).
  • FIG.11F Quantitative RT-PCR showing the level of siR0513 in WT and PSR2-5 plants in EVs isolated from leaves tissues. Values are mean ⁇ SEM. * and ** label results that are statistically different with the WT value at p £ 0.05 or p £ 0.01.
  • FIG.11G Stem loop qPCR showing the level of siR1310 in MIR161ox and MIR161cri mutant plants compared to wild-type (WT) Arabidopsis. Values are mean ⁇ SEM. * and ** label results that are statistically different with the WT value at p £ 0.05 or p £ 0.01.
  • FIG.12A-D The RNAi suppression activity of PSR2 depends on its association with DRB4, related to Figure 5 and 6.
  • FIG.12A Western blotting showing the abundance of GFP proteins in N. benthamiana 16c leaves expressing wild-type or truncated PSR2.
  • Total proteins were extracted from leaves infiltrated with Agrobacterium carrying 35S-GFP and another strain carrying either the pEG100 empty vector (EV) or various truncates of PSR2-Flag at 5 dpi.
  • Coomassie Brilliant blue staining (CBB) was used as loading control.
  • FIG.12B Western blotting showing the protein levels of PSR2 or its derivatives in the infiltrated leaves. Total proteins were extracted from infiltrated leaves at 2 days after Agro- infiltration and the proteins were detected by anti-Flag antibody. Coomassie Brilliant blue staining (CBB) was used as loading control.
  • CBB Coomassie Brilliant blue staining
  • FIG.12C YFP-PSR2 and DRB4-YFP were expressed in N. benthamiana through Agrobacterium-mediated transient expression.
  • Total proteins were extracted from the infiltrated leaves with treatment of RNase III and the immune complexes were pulled-down using anti-GFP magnetic beads.
  • the immuno-precipitated proteins were then incubated with in vitro synthesized dsRNA (510-bp in length).
  • dsRNA enriched on the beads was extracted using Trizol/chloroform and then analyzed on 2% agarose gel along with Ethidium bromide staining.
  • YFP was used as a negative control.
  • the Arrowhead shows the position of the 510-bp dsRNA. Protein levels of immuno-precipitated YFP, PSR2 and DRB4 were confirmed by western blotting using anti-GFP antibody.
  • FIG.12D Detached leaves from four-week-old plants of wild-type (WT), PSR2-5, drb4 and a complementation line of drb4 (DRB4 expressed under its native promoter) were inoculated with zoospore suspensions of P. capsici strain LT263. Inoculated leaves were stained with trypan blue to visualize the lesions at 3 dpi. Disease severity index (DSI) was also determined. Values are mean ⁇ SD. * labels results that are statistically different at p £ 0.05.
  • FIG.13 A model illustrating an arms race centered on host-induced gene silencing in Arabidopsis during Phytophthora infection. Phytophthora capsici can be recognized by
  • PSR2 associates with the host protein DRB4 and interferes with secondary siRNA production from specific loci, especially the PPR loci, to promote the infection.
  • FIG.14 Schematic illustration of inoculation method and construction of at1g62914m (SEQ ID NOS 1457-1459, respectively, in order of appearance). A codon encoding a tyrosine (Y144) was mutated into a stop codon.
  • FIG.15 Nicotiana benthamiana leaves expressing both atMIR161 and at1g62914m produced a much higher amount of siRNAs derived from at1g62914m transcripts.
  • FIG.16 Plants producing antimicrobial siRNAs exhibited enhanced resistance to P. capsici. Leaves of Nicotiana benthamiana that express atMIR161, at1g62914m, or
  • AtMIR161+at1g62914m were inoculated with Phytophthora capsici strain LT263. Disease severity was evaluated at 3 days post inoculation. The results show that plants expressing atMIR161+at1g62914m exhibited much enhanced resistance to P. capsici. This experiment was repeated three times with similar results. Images of representative inoculated leaves (two per treatment) are shown below (Panel A). Lesion size of each inoculated leaf was measured and analyzed (Panel B). Please note that not all leaves expressed the same amount of atMIR161 and/or at1g62914m transcripts, hence the variation within the same treatment. DETAILED DESCRIPTION OF THE INVENTION
  • the inventors have discovered that certain miRNAs, when expressed in a plant, induce resistance to certain pathogens (including filamentous eukaryotic pathogens such as
  • the pathogen is Phytophthora.
  • the pathogen is an oomycete.
  • the pathogen is an ascomycete.
  • the pathogen is a hemi-ascomycete.
  • the pathogen is a basidiomycete.
  • plants that heterologously express the miRNA are provided.
  • transgenic plants can be generated that comprise an expression cassette comprising a promoter operably linked to a polynucleotide encoding the miRNA.
  • the promoter is heterologous to the polynucleotide encoding the miRNA.
  • the promoter is not endogenously linked to the
  • the polynucleotide or is a modified form from the endogenous promoter (e.g., such that expression of the polynucleotide is increased).
  • the promoter is from the same species as the transgenic plant. In some embodiments, the promoter is from a different plant species.
  • the polynucleotide is from the same plant species or is substantially identical to a polynucleotide from the same plant species. In some embodiments, the polynucleotide is from a different plant species from the transgenic plant or is substantially identical to the polynucleotide from a different plant species.
  • miRNA161 sequences include but are not limited (i) to those listed below or (ii) to RNA sequences substantially identical to those listed below or (iii) to RNA sequences that include 1, 2, 3, 4 or 5 nucleotide changes compared to any of the sequences below:
  • SEQ ID NO:1 >ath-MIR161.1 Arabidopsis thaliana
  • SEQ ID NO:13 >ath-MIR161.2 Arabidopsis thaliana UCAAUGCAUUGAAAGUGACUA SEQ ID NO:14>bna-miR161 Brassica napus
  • one or more PPR transcript that serves as a target for miR161 is also expressed in the plant.
  • the PPR transcript is a P-type PPR transcript. See, e.g., Barkan, Annu. Rev. Plant Biol.2014.65:415-442.
  • the PPR transcript(s) is in the Rf-like (or RFL,“RF” stands for“restorer of fertility”) sub-clade of PPR-P genes.
  • Rf-like or RFL,“RF” stands for“restorer of fertility
  • Exemplary anti-pathogen siRNAs are displayed for example in Table S3 as depicted in Hou, et al., A Phytophthora Effector Suppresses Trans-Kingdom RNAi to Promote Disease Susceptibility, 25(1) Cell Host & Microbe 153-165 (Jan.9, 2019) or in U.S. Provisional Patent Application No.62/714,342.
  • Table S1 provides a listing of various Arabidopsis PPR transcripts.
  • the ant-pathogen siRNAs target one or more of the 249 P. capsici gene sequences as depicted in Table S4.
  • the miR161 and the PPR transcript introduced into the plant are both from the same species. This will allow for optimal ability of the miR161 to generate siRNAs from the PPR transcript. However, this is optional and in other cases, the miR161 sequence and the PPR transcript are from different plant species. Exemplary sequences encoded by PPR genes are provided in Table S3 as depicted in Hou, et al., A Phytophthora Effector Suppresses Trans-Kingdom RNAi to Promote Disease Susceptibility, 25(1) Cell Host & Microbe 153-165 (Jan.9, 2019). As shown in Example 2, the co-expression of at least one PPR gene with miR161 increases resistance in the plant to pathogens.
  • polynucleotides e.g., miRNA 161 members, PPR transcripts or promoters
  • oligonucleotide probes based on the sequences disclosed here can be used to identify the desired polynucleotide in a cDNA or genomic DNA library from a desired plant species.
  • genomic libraries large segments of genomic DNA are generated by random fragmentation, e.g. using restriction endonucleases, and are ligated with vector DNA to form concatemers that can be packaged into the appropriate vector.
  • cDNA libraries from plants or plant parts may be constructed.
  • the cDNA or genomic library can then be screened using a probe based upon a sequence disclosed here. Probes may be used to hybridize with genomic DNA or cDNA sequences to isolate homologous genes in the same or different plant species. Alternatively, antibodies raised against a polypeptide can be used to screen an mRNA expression library.
  • the nucleic acids of interest can be amplified from nucleic acid samples using amplification techniques. For instance, polymerase chain reaction (PCR) technology to amplify the sequences of the genes directly from mRNA, from cDNA, from genomic libraries or cDNA libraries. PCR and other in vitro amplification methods may also be useful, for example, to clone nucleic acid sequences that code for proteins to be expressed, to make nucleic acids to use as probes for detecting the presence of the desired mRNA in samples, for nucleic acid sequencing, or for other purposes.
  • PCR Protocols A Guide to Methods and Applications. (Innis, M, Gelfand, D., Sninsky, J. and White, T., eds.), Academic Press, San Diego (1990).
  • Polynucleotides can also be synthesized by well-known techniques as described in the technical literature. See, e.g., Carruthers et al., Cold Spring Harbor Symp. Quant. Biol.47:411- 418 (1982), and Adams et al., J. Am. Chem. Soc.105:661 (1983). Double stranded DNA fragments may then be obtained either by synthesizing the complementary strand and annealing the strands together under appropriate conditions, or by adding the complementary strand using DNA polymerase with an appropriate primer sequence.
  • a desired polynucleotide sequence can be used to prepare an expression cassette for expression in a plant.
  • expression of the polynucleotide is directed by a heterologous promoter. Any of a number of means well known in the art can be used to drive expression of the polynucleotide sequence of interest in plants. Any organ can be targeted, such as shoot vegetative organs/structures (e.g. leaves, stems and tubers), roots, flowers and floral organs/structures (e.g. bracts, sepals, petals, stamens, carpels, anthers and ovules), seed (including embryo, endosperm, and seed coat) and fruit.
  • shoot vegetative organs/structures e.g. leaves, stems and tubers
  • roots e.g. bracts, sepals, petals, stamens, carpels, anthers and ovules
  • seed including embryo, endosperm, and seed coat
  • expression can be conditioned to only occur under certain conditions (e.g., using an inducible promoter).
  • a plant promoter fragment may be employed to direct expression of the polynucleotide sequence of interest in all tissues of a regenerated plant.
  • Such promoters are referred to herein as "constitutive" promoters and are active under most environmental conditions and states of development or cell differentiation.
  • constitutive promoters include the cauliflower mosaic virus (CaMV) 35S transcription initiation region, the 1'- or 2'- promoter derived from T-DNA of Agrobacterium tumafaciens, and other transcription initiation regions from various plant genes.
  • the plant promoter may direct expression of the polynucleotide sequence of interest in a specific tissue (tissue-specific promoters) or may be otherwise under more precise environmental control (inducible promoters).
  • tissue-specific promoters under developmental control include promoters that initiate transcription only in certain tissues, such as leaves or guard cells (including but not limited to those described in WO/2005/085449; U.S.
  • Patent No.6,653,535 Li et al., Sci China C Life Sci.2005 Apr;48(2):181-6; Husebye, et al., Plant Physiol, April 2002, Vol.128, pp.1180-1188; and Plesch, et al., Gene, Volume 249, Number 1, 16 May 2000 , pp.83-89(7)).
  • environmental conditions include the presence of a pathogen, anaerobic conditions, elevated temperature, or the presence of light.
  • the promoter is a constitutive promoter. In some embodiments, the promoter is an inducible promoter. In some embodiments, the promoter is stress inducible (e.g., inducible by abiotic stress). In some embodiments, the promoter is pathogen inducible. In some embodiments, the promoter is induced upon infection by Phytophthora or Verticillium.
  • pathogen inducible promoters include Botyritis-Induced Kinase 1 (BIK1) and the plant defensing gene PDF1.2. See, e.g., Penninckx et al., Plant Cell 10:2103- 2113 (1998); see also Veronese et al., Plant Cell 18:257-273 (2006).
  • a polyadenylation region at the 3'-end of the coding region can be included.
  • the polyadenylation region can be derived from a variety of plant genes, or from T-DNA.
  • the vector comprising the sequences will typically comprise a marker gene that confers a selectable phenotype on plant cells.
  • the marker may encode biocide resistance, particularly antibiotic resistance, such as resistance to kanamycin, G418, bleomycin,
  • hygromycin or herbicide resistance, such as resistance to chlorosluforon or Basta.
  • transgenic plants comprising recombinant expression cassettes for expressing a polynucleotide sequence as described herein.
  • a transgenic plant is generated that contains a complete or partial sequence of a polynucleotide (e.g., an miRNA161 sequence or a promoter) that is derived from a species other than the species of the transgenic plant.
  • a polynucleotide e.g., an miRNA161 sequence or a promoter
  • transgenic plants encompass the plant or plant cell in which the expression cassette is introduced as well as progeny of such plants or plant cells that contain the expression cassette, including the progeny that have the expression cassette stably integrated in a chromosome.
  • the transgenic plants comprising recombinant expression cassettes for expressing a polynucleotide sequence as described herein have increased or enhanced pathogen resistance compared to a plant lacking the recombinant expression cassette, wherein the transgenic plants comprising recombinant expression cassettes for expressing the polynucleotide sequence have about the same growth as a plant lacking the recombinant expression cassette. Methods for determining increased pathogen resistance are described below.
  • a recombinant expression vector as described herein may be introduced into the genome of the desired plant host by a variety of conventional techniques.
  • the DNA construct may be introduced directly into the genomic DNA of the plant cell using techniques such as electroporation and microinjection of plant cell protoplasts, or the DNA construct can be introduced directly to plant tissue using ballistic methods, such as DNA particle bombardment.
  • the DNA construct may be combined with suitable T-DNA flanking regions and introduced into a conventional Agrobacterium tumefaciens host vector. The virulence functions of the Agrobacterium tumefaciens host will direct the insertion of the construct and adjacent marker into the plant cell DNA when the cell is infected by the bacteria.
  • transient expression of the polynucleotide sequence of interest is also encompassed by the disclosure, generally expression will be from insertion of expression cassettes into the plant genome, e.g., such that at least some plant offspring also contain the integrated expression cassette.
  • Microinjection techniques are also useful for this purpose. These techniques are well known in the art and thoroughly described in the literature. The introduction of DNA constructs using polyethylene glycol precipitation is described in Paszkowski et al. EMBO J.3:2717-2722 (1984). Electroporation techniques are described in Fromm et al. Proc. Natl. Acad. Sci. USA 82:5824 (1985). Ballistic transformation techniques are described in Klein et al. Nature 327:70- 73 (1987).
  • Agrobacterium tumefaciens-mediated transformation techniques including disarming and use of binary vectors, are well described in the scientific literature. See, for example, Horsch et al. Science 233:496-498 (1984), and Fraley et al. Proc. Natl. Acad. Sci. USA 80:4803 (1983).
  • Transformed plant cells derived by any of the above transformation techniques can be cultured to regenerate a whole plant that possesses the transformed genotype and thus the desired phenotype such as enhanced pathogen resistance.
  • Such regeneration techniques rely on manipulation of certain phytohormones in a tissue culture growth medium, typically relying on a biocide and/or herbicide marker which has been introduced together with the desired nucleotide sequences.
  • Plant regeneration from cultured protoplasts is described in Evans et al., Protoplasts Isolation and Culture, Handbook of Plant Cell Culture, pp.124-176, MacMillilan Publishing Company, New York, 1983; and Binding, Regeneration of Plants, Plant Protoplasts, pp.21-73, CRC Press, Boca Raton, 1985. Regeneration can also be obtained from plant callus, explants, organs, or parts thereof.
  • Such regeneration techniques are described generally in Klee et al. Ann. Rev. of Plant Phys.38:467-486 (1987).
  • the expression cassette After the expression cassette is stably incorporated in transgenic plants and confirmed to be operable, it can be introduced into other plants by sexual crossing. Any of a number of standard breeding techniques can be used, depending upon the species to be crossed.
  • an endogenous promoter sequence can be altered (e.g., by one or more nucleotide change) to generate a higher expressing promoter.
  • This latter method can involve introduction of a new expression cassette into the plant or can involve in vivo mutation, for example using a targeted nuclease (e.g., CRISPR, talens, zinc fingers) in combination with a second nuclease (e.g., CRISPR, talens, zinc fingers) in combination with a second
  • Plant gene manipulations can be precisely tailored in non-transgenic organisms using the CRlSPR/Cas9 genome editing method.
  • a complex of two small RNAs - the CRISPR-RNA (crRNA) and the trans- activating crRNA (tracrRNA) - directs the nuclease (Cas9) to a specific DNA sequence complementary to the crRNA. Binding of these RNAs to Cas9 involves specific sequences and secondary structures in the RNA.
  • the two RNA components can be simplified into a single element, the single guide-RNA (sgRNA), which is transcribed from a cassette containing a target sequence defined by the user.
  • sgRNA single guide-RNA
  • This system has been used for genome editing in humans, zebrafish, Drosophila, mice, nematodes, bacteria, yeast, and plants.
  • the nuclease creates double stranded breaks at the target region programmed by the sgRNA. These can be repaired by non-homologous recombination, which often yields inactivating mutations. The breaks can also be repaired by homologous recombination, which enables the system to be used for gene targeted gene replacement.
  • Promoter mutations can be introduced into plants using the CAS9/CRISPR system.
  • a native promoter sequence in a plant or plant cell can be altered in situ to generate a plant or plant cell carrying a polynucleotide comprising a mutated miRNA promoter as described herein.
  • the CRISPR/Cas system has been modified for use in prokaryotic and eukaryotic systems for genome editing and transcriptional regulation.
  • the "CRISPR/Cas" system refers to a widespread class of bacterial systems for defense against foreign nucleic acid.
  • CRISPR/Cas systems are found in a wide range of eubacteria and archaeal organisms.
  • CRJSPR/Cas systems include type I, II, and III sub-types. Wild-type type H CRISPR/Cas systems utilize the RNA- mediated nuclease, Cas9 in complex with guide and activating RNA to recognize and cleave foreign nucleic acid.
  • Cas9 homologs are found in a wide variety of eubacteria, including, but not limited to bacteria of the following taxonomic groups: Actinobacteria, Aquificae, Bacteroidetes- Chlorobi, Chlamydiae-Verrucomicrobia, Chlroflexi, Cvanobacteria, Firmicutes, Proteobacteria, Spirochaetes, and Thermotogae.
  • An exemplary Cas9 protein is the Streptococcus pyogenes Cas9 protein. Additional non-limiting examples of Cas9 proteins and homologs thereof have been described in literature.
  • the RNA-guided nuclease is a Cpf1 nuclease or a Cas9 nuclease.
  • a method can be provided using CRISPR/Cas9 or Cpf1 to introduce at least one of the promoter mutations described herein into a plant cell.
  • a method of altering a (e.g., native) nucleic acid encoding the miRNA in a plant is described.
  • the method can comprise introducing into the plant cell an engineered, non-naturally occurring Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR associated (Cas) (CRISPR-Cas) system as well as a guide nucleic acid (e.g., RNA) to introduce one or more alteration in an endogenous miRNA promoter.
  • CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
  • Cas Clustered Regularly Interspaced Short Palindromic Repeats
  • RNA guide nucleic acid
  • the CRISPR-Cas system comprises one or more vectors comprising: (a) a first regulatory element operable in a plant cell operably linked to at least one nucleotide sequence encoding a CRISPR-Cas system guide RNA that hybridizes with the target sequence, and (b) a second regulatory element operable in a plant cell operably linked to a nucleotide sequence encoding a Type-II Cas9 or Cpf1 protein, wherein components (a) and (b) are located on the same or different vectors of the system, whereby the guide RNA targets the target sequence and the Cas9 protein cleaves the DNA molecule, whereby at least one of the promoter mutations described herein is introduced into the target nucleic acid.
  • the expression cassettes and constructs can be used to confer increased or enhanced pathogen resistance on essentially any plant.
  • the methods have use over a broad range of plants, including species from the genera Asparagus, Atropa, Avena, Brassica, Citrus, Citrullus, Capsicum, Cucumis, Cucurbita, Daucus, Fragaria, Glycine, Gossypium, Helianthus, Heterocallis, Hordeum, Hyoscyamus, Lactuca, Linum, Lolium, Lycopersicon, Malus, Manihot, Majorana, Medicago, Nicotiana, Oryza, Panieum, Pannesetum, Persea, Pisum, Pyrus, Prunus, Raphanus, Secale, Senecio, Sinapis, Solanum, Sorghum, Trigonella, Triticum, Vitis, Vigna, and Zea.
  • the plant is a cotton plant. In some embodiments, the plant is an ornamental plant. In some embodiments, the plant is a vegetable- or fruit-producing plant. In some embodiments, the plant is a monocot. In some embodiments, the plant is a dicot.
  • Plants (or parts of plants) with increased pathogen resistance can be selected in many ways. The following methods are but a few of the possibilities.
  • One method of selecting plants or parts of plants (e.g., fruits and vegetables) with increased pathogen resistance is to determine resistance of a plant to a specific plant pathogen.
  • Possible pathogens include, but are not limited to, viruses, bacteria, nematodes, oomycetes, fungi or insects (see, e.g., Agrios, Plant Pathology (Academic Press, San Diego, CA) (1988)). Resistance responses of plants vary depending on many factors, including what pathogen, compound, or plant is used.
  • increased resistance is measured by the reduction or elimination of disease symptoms (e.g., reduction in the number or size of lesions or reduction in the amount of pathogen biomass on the plant or a part of the plant) when compared to a control plant.
  • resistance is increased when the number or sizes of lesions or amount of pathogen biomass on the plant or on a part of the plant is decreased by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more relative to a control (e.g., relative to a plant in which a heterologous polynucleotide has not been expressed).
  • Increased pathogen resistance can also be determined by measuring the increased expression of a gene operably linked a defense related promoter. Measurement of such expression can be measured by quantifying the accumulation of RNA or subsequent protein product (e.g., using northern or western blot techniques, respectively (see, e.g., Sambrook et al. and Ausubel et al.).
  • RNAi RNA interference
  • Plants have evolved complex immunity that must be defeated by pathogens to establish infection.
  • the destructive eukaryotic pathogen Phytophthora encodes suppressors of RNA interference (RNAi), but it remains unknown whether they target a specific host RNAi pathway that confers resistance.
  • RNAi RNA interference
  • siRNAs as antimicrobial agents targeting eukaryotic pathogens and highlight a defense/counter-defense arms race centered on trans-kingdom gene silencing between hosts and pathogens.
  • Phytophthora infection induces the production of a diverse pool of secondary siRNAs from specific transcripts in Arabidopsis.
  • siRNAs function as a collection of antimicrobial agents and silence target genes in Phytophthora during infection.
  • PSR2 blocks this host-induced gene silencing by suppressing the biogenesis of specific secondary siRNAs.
  • hosts and pathogens are engaged in an arms race centered on cross-kingdom RNAi-based immunity.
  • RNA-dependent RNA polymerase 6 RDR6
  • SGS3 Suppressor of Gene Silencing 3
  • rdr6 and sgs3 mutants are hypersusceptible, with the rdr6 mutant exhibiting the most severe disease symptoms ( Figure 1A and 1B).
  • a transgenic Arabidopsis line that constitutively expresses PSR2 under the CaMV 35S promoter (Qiao et al., 2013; Xiong et al., 2014) also showed enhanced susceptibility ( Figure 1A and 1B). These results support a role of the secondary siRNA pathway in plant defense during Phytophthora infection.
  • PSR2 diminishes the accumulation of specific secondary siRNAs in Arabidopsis
  • FIG. 1C A genome-wide small RNA profiling of PSR2-5 revealed a significant reduction in the 21-nucleotide population (Figure 1C), which is mainly composed of miRNAs and secondary siRNAs (Li et al., 2016). Further analysis of changes in individual 21-nucleotide sRNA classes revealed a moderate, 5%, reduction in the miRNA level; however, drastic decreases were observed in the abundances of secondary siRNAs generated from transcripts of TAS1a/b/c, TAS2, and several pentatricopeptide-repeat protein (PPR)-encoding gene loci (Figure 1D-1F).
  • PPR pentatricopeptide-repeat protein
  • TAS loci derived tasiRNAs exhibit an approximately 75% reduction in PSR2-5 plants ( Figure 1D and 7A-D), the largely diminished PPR-derived siRNAs in PSR2-5 is likely attributed to inhibition of both miR161- and miR173-triggered siRNA production.
  • miR161 and PPR-siRNAs are induced during Phytophthora infection
  • MAMP microbe-associated molecular patterns
  • miR161 contributes to Arabidopsis defense to P. capsici by triggering PPR-siRNA production
  • PPR-siRNAs target Phytophthora transcripts to confer resistance
  • siRNAs are believed to amplify miRNA-mediated gene silencing, specifically by miRNAs that potentially regulate large gene families (Adenot et al., 2006).
  • PPR-derived siRNAs may be used by Arabidopsis to target genes in P. capsici for silencing.
  • a prediction of potential targets in P. capsici transcripts using 3922 distinct PPR- derived siRNA sequences revealed 437 siRNA-P. capsici transcript pairs ( Figure 3A). These matched pairs correspond to 249 P. capsici genes as potential targets of PPR-siRNAs (Table S4).
  • Phyca_554980 is predicted to be regulated by six other PPR-siRNAs (Table S4), including siR0513 ( Figure 3B). Taken together, these results indicate that Phyca_554980 might be an important target of PPR-siRNAs in Phytophthora.
  • siR1310 can specifically silence target gene(s) in Phytophthora, we determined the consequence of the silencing event by analyzing the developmental phenotypes and virulence activities of the P. capsici transformants. Compared to a wild-type strain and the transformants harboring siRGFP, transformants harboring siR1310 exhibited a moderate decrease in mycelial growth ( Figure 11C and 11D) and significant defects in sporangia development ( Figure 3D) and zoospore release (Figure 11E). Importantly, introduction of siR1310 nearly abolished the ability of P. capsici to cause disease on Nicotiana benthamiana (Figure 3E).
  • PPR-derived siRNAs can specifically silence target gene(s) in P. capsici such as Phyca_554980, which is required for Phytophthora development and pathogenicity. As such, PPR-derived siRNAs may contribute to resistance to P. capsici.
  • PPR-siRNAs confer cross-kingdom gene silencing during Phytophthora infection
  • capsici was used to infect MIR161ox-3 plants ( Figure 3G), which, at least in part, could be due to the enhanced silencing effect by an increased level of PPR-derived siRNAs.
  • DRB4 binds to dsRNA precursors through two double stranded RNA-binding domains (dsRBM1 and dsRBM2) and associates with Dicer-like 4 (DCL4), which processes the dsRNA substrates (Adenot et al., 2006; Fukudome et al., 2011).
  • DCL4 Dicer-like 4
  • PSR2 protein has a modular architecture, containing seven imperfect tandem repeats (Ye and Ma, 2016). Repeats 2-7 each includes three conserved motifs, which were named“L”, “W”, and“Y” after a conserved amino acid residue in their respective sequences (Jiang et al., 2008; Ye and Ma, 2016). Repeat 1 lacks an“L” motif, but contains the“W” and the“Y” motifs ( Figure 5A). Analysis of truncated mutants of PSR2 revealed that the first (WY1) and the second (LWY2) repeat units are required for interaction with DRB4 ( Figure 5C).
  • DRB4 is a virulence target of PSR2
  • drb4 is hypersusceptible to P. capsici ( Figure 6A and 12D).
  • both PSR2-5 and drb4 exhibit a subtle developmental phenotype, i.e. narrow and curly leaves ( Figure 6B).
  • a similar, but more profound, leaf phenotype has been reported in rdr6 (Peragine et al., 2004), indicating that it is likely associated with secondary siRNA production.
  • NB-LRR nucleotide-binding site leucine-rich repeat proteins
  • siRNAs derived from endogenous plant transcripts target mRNAs of a eukaryotic pathogen in trans. Consistent with their importance as an antimicrobial strategy, the biogenesis of secondary siRNAs is specifically suppressed by the Phytophthora effector PSR2. RNAi-based immunity thus represents an important battleground in the evolution of host- pathogen interactions.
  • Host-derived sRNAs have been found to facilitate plant defense to fungal pathogens. Two miRNAs were shown to be exported from cotton and to reduce the virulence of Verticillium dahlia (Zhang et al., 2016). Furthermore, plant EVs were recently reported to mediate the transportation of host sRNAs that can target virulence genes of another fungal pathogen Botrytis cinerea (Cai et al., 2018). In this study, we show secondary siRNAs are important executors of host-induced gene silencing in an oomycete pathogen, which is evolutionarily very distant from fungi (Kamoun et al., 2015). Perception of P.
  • capsici by Arabidopsis induces a transcriptional induction of the trigger miRNA, miR161, which subsequently results in increased production and accumulation of secondary siRNAs derived from specific PPR transcripts.
  • the diverse PPR- siRNA pool includes numerous sequences, some of which can directly silence transcripts in P. capsici.
  • miR161 can also be induced by bacterial flagellin (Li et al., 2010), indicating that the production of secondary siRNAs is a general immune response triggered by a broad spectrum of pathogens.
  • 216 siRNA-target pairs representing 150 potential targets can be predicted from the fungal pathogen Verticillium dahliae (Table S4). It is therefore likely that PPR-derived siRNAs also target mRNAs in V.
  • Secondary siRNAs have been implicated in playing a role in host-parasite interactions. It was recently reported that miRNAs produced by the parasitic plant Cuscuta campestris triggered siRNA production in host plants and manipulated host gene expression (Shahid et al., 2018). In our study, secondary siRNAs produced by plant hosts function as antimicrobial agents. The abundance and sequence complexity of secondary siRNAs is much higher than their miRNA triggers, which provides advantages during a co-evolutionary arms race with the pathogens. During host-pathogen co-evolution, it would be expected that pathogen genes targeted by host sRNAs are under strong selection to diversify, which could abolish sequence complementarity and thus evade silencing.
  • MIR genes must maintain a foldback structure in their primary transcripts for processing, they are constrained in how rapidly they can evolve, which would be expected to compromise their utility as direct antimicrobial agents.
  • the induction of a diverse pool of secondary siRNAs upon pathogen perception facilitates co-evolution with sequence changes in the targeted pathogen genes. This is particularly robust when the siRNAs are generated from non-coding genes (such as TAS in Arabidopsis) or genes within large families (such as PPR).
  • Production of secondary siRNA from PPR transcripts is prevalent in eudicots, suggesting an ancient and potentially essential function (Xia et al., 2013). Most eudicot species encode over 400 PPR genes in their genome (Barkan and Small, 2014), but only a small number produce siRNAs.
  • siRNA-producing PPRs constitute a monophyletic clade that is evolving rapidly, possibly driven by the arms race with pathogens (Dahan and Mireau, 2013). None of the PPR mutants in the secondary siRNA-generating cluster that we examined exhibit morphological defects in Arabidopsis, indicating that these genes may tolerate sequence changes.
  • EVs mediate intercellular transport of sRNAs in mammals (Meldolesi, 2018), and have been shown to transport sRNAs from parasitic nematodes into mammalian host cells, where they suppress host immune responses (Buck et al., 2014).
  • nematode EVs were recently shown to be specifically enriched in secondary siRNAs (Chow et al., 2018).
  • Arabidopsis thaliana ecotype Col-0 was used as wild-type and for generating transgenic lines.
  • the sgRNA cassettes were cloned into pCAMBIA1300-pYAO:Cas9 into the SpeI site.
  • sequences corresponding to the sense and antisense strands of the siR1310 target site or mutated target site were synthesized and annealed respectively.
  • the DNA fragments were then ligated with pTOR-mRFP into the EcoRI site.
  • roots of two-week old seedlings, grown on MS medium (Murashige and Skoog agar containing 1% (wt/vol) sucrose) were dipped in a zoospores suspension (100 zoospores/mL) for five seconds as described (Wang et al., 2013).
  • MS medium Middle-week old seedlings
  • zoospores suspension 100 zoospores/mL
  • EVs were isolated from the pooled apoplastic fluid of 36 five-week old Arabidopsis plants grown at 22 ⁇ 2°C with a 9 h light/15 h dark photoperiod following the protocol of Rutter et al. (2017), including fractionation on an iodixanol density gradient (OptiPrep, Sigma Aldrich). Purified EVs were quantified using a ZetaView nanoparticle tracking analyzer from ParticleMetrix. Approximately 10 x 10 9 EVs from each replicate were used for RNA extraction.
  • RNAs were extracted from Arabidopsis leaves and EVs with or without infection at different time points using TRIzol reagent (Invitrogen). Small RNA northern blotting was performed as described using 5 mg of total RNA extract (Pall and Hamilton, 2008). U6 was used as a loading control. The results were visualized using a Typhoon phosphorimager and quantified with ImageQuant TL (GE). Sequences of the oligonucleotide probes are listed in Table S7. For quantitative RT-PCR, three biological repeats were performed, and relative expression levels were calculated using the 2 - ⁇ Ct equation. Actin2 was used as the internal control. Gene-specific primers used for qRT-PCR are listed in Table S7.
  • siRNA levels were quantified using stem-loop qRT-PCR as described in (Varkonyi-Gasic et al., 2007) starting with 1.0 ⁇ g total RNA from leaves.
  • siRNA levels were quantified using the QuantiMir kit from System Biosciences (Mountain View, CA), starting with 2.0 ⁇ g total RNA from leaves, diluting the resulting cDNA 100 fold, and then using 2-4 ⁇ L of diluted cDNA for each 25 ⁇ L reaction.
  • the qRT-PCR step was performed using SYBRTM Green PCR Master Mix from Invitrogen and using U6 as an internal control.
  • RNA oligonucleotides corresponding to siRGFP and siR1310 were synthesized and annealed to form siRNA duplex (listed in Table S7).
  • a polyethylene glycol (PEG)-mediated protoplast transformation procedure was followed as described with modifications (Dou et al., 2008).
  • Protoplasts of P. capsici isolate LT263 were prepared as described with a concentration of 2x10 4 protoplast per mL.25 mg of pTOR plasmid DNA and 8 mg of siRNA duplex were added into 1 mL of protoplast suspension for transformation (Blanco and Judelson, 2005; Varkonyi- Gasic et al., 2007).
  • Transformants were recovered in pea medium and then selected on V8 agar plates supplemented with 50 mg /mL of G418. Transformants with G418 resistance were sub- cultured and analyzed for development and virulence activity. Mycelia from each transformant were collected for RNA extraction and gene expression analysis.
  • 3xFlag-PSR2, DRB4-YFP and their derivatives were co-expressed in N. benthamiana using Agrobacterium-mediated infiltration.
  • Total proteins were extracted using an IP buffer [10% (v/v) glycerol, 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM DTT, 1x protease inhibitor mixture (Roche), 1 mM PMSF, and 0.1% CA-630], and then incubated with either anti-Flag agarose (Sigma-Aldrich) or anti-GFP magnetic beads (Chromotek) at 4 ⁇ C for one hour.
  • IP buffer 10% (v/v) glycerol, 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM DTT, 1x protease inhibitor mixture (Roche), 1 mM PMSF, and 0.1% CA-630
  • PSR2 and its derivatives were cloned into the vector pEG100 and the recombinant plasmids were transformed into Agrobacterium tumefaciens strain GV3101.
  • the bacteria were co-infiltrated into N. benthamiana 16c leaves together with Agrobacterium carrying 35S-GFP (Qiao et al., 2013). Green fluorescence was observed using a hand-held UV light at five days after Agro-infiltration.
  • the protein levels of GFP were determined by western blotting using an anti-GFP antibody (Santa Cruz).
  • the protein levels of PSR2 and its derivatives were examined by western blotting using an anti-PSR2 antisera generated in this study.
  • Sense and antisense transcripts of green fluorescent protein were synthesized from a plasmid template containing a partial GFP gene with 510-bp in length.
  • In vitro transcription was conducted by incubating 0.1 mM plasmid DNA in a 50 mL reaction system with 0.5 mM of T7 RNA polymerase and 5 mM of NTP mix for 3 hours at 37oC.2 U Turbo DNase (Ambion) was added to the reaction mixture at 37oC for 15 minutes to remove the template DNA. Nucleotides and NTPs were also removed using Bio-Spin 6 columns (BioRad).
  • RNAs Single- stranded RNAs were purified using acidic phenol/chloroform (Ambion), and precipitated using isopropanol (FisherChemical). RNA pellet was then dissolved in 30 mL RNase-free water. Equal amounts of the ssRNAs were annealed as described and used for further analyses (Fukudome et al., 2011). For protein-dsRNA binding assay, YFP-PSR2 and DRB4-YFP fusion proteins were transiently expressed in N.
  • benthamiana and total proteins were extracted using the IP buffer containing 10% (vol/vol) glycerol, 50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 5 mM DTT, 1x protease inhibitor mixture (Roche), 1 mM PMSF, and 0.1% CA-630.
  • Double-stranded RNA was removed by adding 7 mL of RNaseIII (NEB), 10 mL of 10x RNaseIII buffer and 10 mL of 10x MnCl2 to 1 mL of protein extract. Samples were then centrifuged at 12,000 rpm, 4 ⁇ C for 15 min and the supernatant incubated with anti-GFP magnetic beads for two hours at 4 ⁇ C (Chromotek).
  • synthesized 510-bp dsRNAs were added to a final concentration of ⁇ 33 nM and incubated with the immune complexes at 4 ⁇ C in a dsRNA-binding buffer containing 30 mM Tris-HCl (pH 7.0), 10 mM NaCl, 20 mM MgCl2, 0.1 mM EDTA, and 5 mM DTT for 30 minutes.
  • the beads were washed with binding buffer to remove the unbounded dsRNA before the protein-bounded RNAs were extracted using Trizol/Chloroform (Ambion) and then analyzed on 2% Agarose gel with ethidium bromide staining.
  • 510-bp dsRNAs synthesized as above were labeled with [ ⁇ - 32 P] UTP as described (Fukudome et al., 2011).
  • Crude protein extracts from 0.5 g leaves of four-week-old wild-type, drb4 and PSR2-5 Arabidopsis plants were extracted using an extraction buffer containing 20 mM Tris-HCl (pH 7.5), 4 mM MgCl 2 , 5 mM DTT, 1x protease inhibitor mixture (Roche) and 1 mM PMSF at 4 ⁇ C.
  • the 32 P-labeled dsRNAs (final concentration of ⁇ 1 nM) were incubated with 30 mL of the cleavage buffer as described (Fukudome et al., 2011).
  • One mL of RNaseOUT (Invitrogen) was added to each 40 mL reaction mixture. After incubation at 23 ⁇ C for two hours, the cleavage products were purified by phenol/chloroform (Ambion), analyzed on 15% denaturing PAGE with 8 M urea, and detected by autoradiography.
  • sRNA libraries were single-end sequenced on the Illumina HiSeq4000 platform with read lengths of 50 bases. Adapter sequences were trimmed from fastq reads using Cutadapt v1.4.1 (Martin, 2011), the remaining sequences in the size range of 18- to 28-nt were mapped to the Arabidopsis thaliana reference genome annotation (TAIR10) using Bowtie v1.0.1
  • PC-siRNAs Protein-coding gene-derived siRNAs
  • TE-siRNAs transposon element derived siRNAs
  • TPM transcripts per million
  • t/r/sn/snoRNA-derived sequences The abundance of sRNAs from each locus was summed by hits-normalized-abundance of all mapped reads from that region. Loci with normalized TPM >10 in WT were further analyzed for abundance changes in PSR2-5 (Table S1).
  • RNA-seq libraries were analyzed using paired-end sequencing on the Illumina
  • HiSeq4000 platform with read lengths of 150 bases Reads were mapped to the TAIR10 genome using HISAT2 v2-2.0.5 (Kim et al., 2015) allowing only one unique hit (-k 1) and length less than 5000 (-X 5000). PCR duplicates were further removed using SAMTools v1.4 (Li et al., 2009). FPKM (Fragments Per Kilobase of transcript per Million mapped reads) of each gene was calculated using StringTie v1.3.3b (Pertea et al., 2015), and edgeR (Robinson et al., 2010) was used to identify genes that were differentially expressed between PSR and WT replicates.
  • the Plant Membrane-Associated REMORIN1.3 Accumulates in Discrete Perihaustorial Domains and Enhances Susceptibility to Phytophthora infestans. Plant Physiol 165, 1005-1018.
  • RNA-Seq reveals infection-related gene expression changes in Phytophthora capsici. PLoS One 8, e74588. 18. Cheng, C.Y., Krishnakumar, V., Chan, A.P., Thibaud-Nissen, F., Schobel, S., and Town, C.D. (2017). Araport11: a complete reannotation of the Arabidopsis thaliana reference genome. Plant J 89, 789-804.
  • psRNATarget a plant small RNA target analysis server.
  • HISAT a fast spliced aligner with low memory requirements. Nat Methods 12, 357-360.
  • edgeR a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26, 139- 140.
  • Pentatricopeptide repeat proteins a socket set for organelle gene expression. Trends Plant Sci 13, 663-670.
  • Phytophthora suppressor of RNA silencing 2 is a conserved RxLR effector that promotes infection in soybean and Arabidopsis thaliana. Mol Plant Microbe Interact 27, 1379-1389. 69. Yan, L., Wei, S., Wu, Y., Hu, R., Li, H., Yang, W., and Xie, Q. (2015). High-Efficiency Genome Editing in Arabidopsis Using YAO Promoter-Driven CRISPR/Cas9 System. Mol Plant 8, 1820-1823.
  • MicroRNAs as master regulators of the plant NB- LRR defense gene family via the production of phased, trans-acting siRNAs. Genes Dev 25, 2540-2553.
  • Table S1 Normalized reads of 21-nt siRNAs produced from individual loci in wild-type (WT) and PSR2-5 Arabidopsis plants. Note: The normalized reads of sRNAs are presented by transcripts per million (TPM).
  • Nicotiana benthamiana plants producing antimicrobial siRNAs derived from an Arabidopsis thaliana mRNA show enhanced resistance to Phytophthora capsici
  • Agrobacterium tumefaciens carrying one of the following constructs (see FIG.14):
  • AtMIR161 (at1g48267, the gene encoding miR161 in Arabidopsis thaliana)
  • At1g62914m (a mutated at1g62914 gene containing a premature stop codon– see Figure 1 below for details. Without the mutation, this gene in the ecotype Col-0 of Arabidopsis thaliana is predicted to encode a PPR protein; with the mutation, at1g62914m no longer encodes a functional protein but can still be transcribed to mRNA, which carries the target site of miR161. Therefore, transcripts of at1g62914m are expected to serve as the precursor for secondary siRNA production if the same plant cell also produces miR161. This construct was used to eliminate the possible impact of At1g62914 protein on plant defense.)
  • At1g62914m-derived siRNAs were determined by quantitative RT-PCR. Two siRNAs (i.e. siR1310 and siR0513) that can silence a virulence-related gene in P. capsici were examined as representatives. The results show that leaves expressing both atMIR161 and at1g62914m produced a much higher amount of the siRNAs that can silence a virulence-related gene in Phytophthora capsici. See FIG.15.
  • AtMIR161+at1g62914m were inoculated with Phytophthora capsici strain LT263. Disease severity was evaluated at 3 days post inoculation. The results show that plants expressing atMIR161+at1g62914m exhibited much enhanced resistance to P. capsici. This experiment was repeated three times with similar results. Images of representative inoculated leaves (two per treatment) are shown below (Panel A, FIG.16). Lesion size of each inoculated leaf was measured and analyzed (Panel B, FIG.16). Please note that not all leaves expressed the same amount of atMIR161 and/or at1g62914m transcripts, hence the variation within the same treatment.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Virology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Plants expressing miRNA and methods of making and their use are described. Specifically, the disclosure provides a transgenic plant engineered to heterologously express an miRNA, wherein the plant further heterologously expresses a pentatricopeptide repeat (PPR)- encoding transcript, and wherein the transgenic plant has enhanced resistance to a pathogen compared to a control plant that does not heterologously express the miRNA. Further disclosed are miRNA sequences that are used in the disclosure.

Description

PATENT
Attorney Docket No.081906- 1146535 (230610PC)
Client Ref. No.2019-102-2 sRNAS THAT ENHANCE PLANT RESISTANCE CROSS-REFERENCE TO RELATED PATENT APPLICATIONS
[0001] The present invention claims benefit of priority to U.S. Provisional Patent Application No.62/714,342, filed August 3, 2018, which is incorporated by reference for all purposes. STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT
[0002] This invention was made with Government support under U.S. Department of
Agriculture National Institutes of Food and Agriculture (USDA-NIFA) Grant No.2014-67013- 21554. The government has certain rights in this invention. SEQUENCE LISTING
[0002.1] The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on August 2, 2019, is named 081906-1146535_230610PC_SL.txt and is 332,041 bytes in size. BACKGROUND OF THE INVENTION
[0003] Phytophthora are filamentous eukaryotic pathogens that exert major threats to food safety and human wellness (Kamoun et al., 2015). Hundreds of billions of dollars are lost each year due to destructive crop diseases caused by Phytophthora species. For example, the notorious potato pathogen Phytophthora infestans was the culprit of the Irish Famine in the nineteenth century and remains a serious problem worldwide. Battling Phytophthora diseases is a major challenge in agriculture.
[0004] Plants have evolved a complex immune system during an arms race with potential pathogens in the environment. However, successful pathogens are able to defeat host immunity, mainly through the function of secreted proteins, called effectors (Jones and Dangl, 2006; Dou, and Zhou, 2012). Many effectors directly manipulate host cellular processes inside the host cells. The study of pathogen effectors and their targets has yielded important insights into basic plant cell biology in general, and immune signaling in particular (Win et al., 2012). Similar to many other filamentous fungi and oomycete pathogens, Phytophthora establishes intimate symbiotic associations with host plants through infection structures called haustoria, which are
invaginations of host plasma membrane induced by extensions of Phytophthora hyphae (Bozkurt et al., 2014). Haustoria are believed to facilitate nutrient transportation from the host, and, more importantly, act as an essential interface for effector delivery from the pathogens (Petre and Kamoun, 2014). Each Phytophthora species is predicted to encode several hundreds to over one thousand effectors that have diverse cellular functions in plant hosts (Haas et al., 2009; Lamour et al., 2012; Pais et al., 2013; Tyler et al., 2006). This remarkably large effector repertoire reflects a high level of complexity in the defense/counter-defense crosstalk between
Phytophthora and their plant hosts.
[0005] Recent studies have revealed that some Phytophthora effectors can inhibit the RNA silencing pathway in plants (Qiao et al., 2013). RNA silencing has a well-established role in anti- viral immunity and viral RNA silencing suppressors are indispensable for infection (Ding, 2010). These Phytophthora suppressors of RNA silencing (PSR) enhance plant susceptibility to Phytophthora (Qiao et al., 2013; Xiong et al., 2014). However, the role of RNA silencing in defense against eukaryotic pathogens is unclear; more importantly, how these pathogens can overcome RNAi-based defense mechanisms to establish successful infection remains unknown.
[0006] Gene silencing is mediated by small RNAs. Plants produce two major classes of sRNAs, microRNAs (miRNAs) and small interfering RNAs (siRNAs), which are distinctive in biosynthetic pathways and functions (Axtell, 2013). miRNAs are encoded from endogenous MIR loci, where the primary transcripts form foldback precursors that are subsequently processed. In contrast, the precursors of siRNAs are long double-stranded RNAs (dsRNAs) synthesized by RNA-dependent RNA polymerases (RDRPs) (Chen, 2009). A small number of miRNAs trigger the generation of secondary siRNAs, which are derived from a subset of miRNA-targeted transcripts. Land plants retain a complex pathway to generate numerous secondary siRNAs with diverse sequences from both coding and non-coding transcripts, but the biological functions of these secondary siRNAs are largely unknown (Borges and Martienssen, 2015).
[0007] Among the RNA silencing suppressors identified from Phytophthora sojae, PSR2 was found to impair the accumulation of two secondary siRNAs, derived from the non-coding TAS1a/b/c and TAS2 transcripts respectively, in Arabidopsis (Qiao et al., 2013). BRIEF SUMMARY OF THE INVENTION
[0008] miRNAs that can be expressed in plants and their use for increasing plant resistance to pathogens, including for example Phytophthora and Verticilium, are described. In some embodiments, a transgenic plant engineered to heterologously express an miRNA comprising any one of SEQ ID NO: 1-19 is provided, wherein the transgenic plant has enhanced resistance to a pathogen compared to a control plant that does not heterologously express the miRNA. In some embodiments, the plant further heterologously expresses a pentatricopeptide repeat (PPR)- encoding transcript. In some embodiments, the PPR-encoding transcript contains a mutation such that the transcript does not express a function protein.. In some embodiments, the PPR- encoding transcript and the miRNA are from the same species of plant and are different from the transgenic plant species. In some embodiments, the transgenic plant comprises an expression cassette, the expression cassette comprising a promoter operably linked to a polynucleotide encoding the miRNA, wherein the promoter is heterologous to the polynucleotide. In some embodiments, the promoter is constitutive or tissue-specific or inducible.
[0009] In some embodiments, the plant is a dicot plant. In some embodiments, the plant is a cotton plant.
[0010] In some embodiments, the pathogen is one or more of a species of Phytophthora and/or Verticillium or other filamentous eukaryotic pathogen.
[0011] Also provided is a method of making the transgenic plant as described above or elsewhere herein. In some embodiments, the method comprises (i) modifying an endogenous promoter of the plant to heterologously express the miRNA or (ii) introducing the expression cassette into the plant. In some embodiments, the method further comprises selecting from a plurality of modified plants, one or more plant with enhanced resistance to the pathogen (including but not limited to Phytophthora).
[0011] Also provided is a method of inducing resistance in a plant to a pathogen, the method comprising, contacting a plant with an miRNA comprising any one of SEQ ID NO: 1-19 in an amount to induce resistance to a pathogen. In some embodiments, the method further comprises contacting the plant with a pentatricopeptide repeat (PPR)-encoding transcript. In some embodiments, the PPR-encoding transcript contains a mutation such that the transcript does not express a function protein. In some embodiments, the PPR-encoding transcript and the miRNA are from the same (or different) species of plant and are different from the transgenic plant species In some embodiments, the plant is a dicot plant. In some embodiments, the plant is a cotton plant. In some embodiments, the pathogen is one or more of a species of Phytophthora and/or Verticillium. In some embodiments, the contacting comprising spraying aerial parts of the plant or contacting roots of the plant with the miRNA (and optionally the PPR-encoding transcript).
DEFINITIONS
[0012] The term "pathogen-resistant" or "pathogen resistance" refers to an increase in the ability of a plant to prevent or resist pathogen infection or pathogen-induced symptoms.
Pathogen resistance can be increased resistance relative to a particular pathogen species or genus (e.g., Verticilium or Phytophthora), increased resistance to multiple pathogens, or increased resistance to all pathogens (e.g., systemic acquired resistance). In some embodiments, resistance of a plant to a pathogen is "increased" when one or more symptoms of pathogen infection are reduced relative to a control (e.g., a plant in which a polynucleotide that inhibits expression of a pathogen target gene is not expressed).
[0013] "Pathogens" include, but are not limited to, viruses, bacteria, nematodes, fungi, oomycetes or insects (see, e.g., Agrios, Plant Pathology (Academic Press, San Diego, CA (1988)). In some embodiments, the pathogen is a fungal pathogen. In some embodiments, the pathogen is an oomycete pathogen. In some embodiments, the pathogen is Phytophthora. In some embodiments, the pathogen is Verticillium.
[0014] The term "nucleic acid" or "polynucleotide" refers to a single or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5' to the 3' end. Nucleic acids may also include modified nucleotides that permit correct read through by a polymerase and do not significantly alter expression of a polypeptide encoded by that nucleic acid.
[0015] The phrase "nucleic acid encoding" or "polynucleotide encoding" refers to a nucleic acid which directs the expression of a specific protein or peptide, or a non-coding RNA. The nucleic acid sequences include both the DNA strand sequence that is transcribed into RNA and, when encoding a protein, the RNA sequence that is translated into protein. The nucleic acid sequences include both the full length nucleic acid sequences as well as non-full length sequences derived from the full length sequences.
[0016] Two nucleic acid sequences or polypeptides are said to be "identical" if the sequence of nucleotides or amino acid residues, respectively, in the two sequences is the same when aligned for maximum correspondence as described below. "Percentage of sequence identity" is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. When percentage of sequence identity is used in reference to proteins or peptides, it is recognized that residue positions that are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. Where sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution.
Means for making this adjustment are well known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated according to, e.g., the algorithm of Meyers & Miller, Computer Applic. Biol. Sci. 4:11-17 (1988) e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, California, USA).
[0017] The term "substantial identity" or "substantially identical," as used in the context of polynucleotide or polypeptide sequences, refers to a sequence that has at least 60% sequence identity to a reference sequence. Alternatively, percent identity can be any integer from 60% to 100%. Exemplary embodiments include at least: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, as compared to a reference sequence using the programs described herein; preferably BLAST using standard parameters, as described below. One of skill will recognize that these values can be appropriately adjusted to determine corresponding identity of proteins encoded by two nucleotide sequences by taking into account codon degeneracy, amino acid similarity, reading frame positioning and the like.
[0018] For sequence comparison, typically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
[0019] A "comparison window," as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of alignment of sequences for comparison are well- known in the art. Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman Add. APL. Math.2:482 (1981), by the homology alignment algorithm of Needleman and Wunsch J. Mol. Biol.48:443 (1970), by the search for similarity method of Pearson and Lipman Proc. Natl. Acad. Sci. (U.S.A.) 85: 2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, WI), or by manual alignment and visual inspection.
[0020] Algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1990) J. Mol. Biol.215: 403-410 and Altschul et al. (1977) Nucleic Acids Res.25: 3389-3402, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (NCBI) web site. The algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al, supra). These initial neighborhood word hits acts as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a word size (W) of 28, an expectation (E) of 10, M=1, N=-2, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a word size (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1989)).
[0021] The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Nat'l. Acad. Sci. USA 90:5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.01, more preferably less than about 10-5, and most preferably less than about 10-20.
[0022] A polynucleotide sequence is "heterologous" to an organism or a second polynucleotide sequence if it originates from a foreign species, or, if from the same species, is modified from its original form. For example, when a promoter is said to be operably linked to a heterologous coding sequence, it means that the coding sequence is derived from one species whereas the promoter sequence is derived another, different species; or, if both are derived from the same species, the coding sequence is not naturally associated with the promoter (e.g., is a genetically engineered coding sequence, e.g., from a different gene in the same species, or an allele from a different ecotype or variety).
[0023] An "expression cassette" refers to a nucleic acid construct, which when introduced into a host cell, results in transcription and/or translation of a RNA or polypeptide, respectively. Antisense constructs or sense constructs that are not or cannot be translated are expressly included by this definition. One of skill will recognize that the inserted polynucleotide sequence need not be identical, but may be only substantially similar to a sequence of the gene from which it was derived.
[0024] The term "promoter," as used herein, refers to a polynucleotide sequence capable of driving transcription of a coding sequence in a cell. Thus, promoters used in the polynucleotide constructs of the invention include cis-acting transcriptional control elements and regulatory sequences that are involved in regulating or modulating the timing and/or rate of transcription of a gene. For example, a promoter can be a cis-acting transcriptional control element, including an enhancer, a promoter, a transcription terminator, an origin of replication, a chromosomal integration sequence, 5' and 3' untranslated regions, or an intronic sequence, which are involved in transcriptional regulation. These cis-acting sequences typically interact with proteins or other biomolecules to carry out (turn on/off, regulate, modulate, etc.) gene transcription. A
"constitutive promoter" is one that is capable of initiating transcription in nearly all tissue types, whereas a "tissue-specific promoter" initiates transcription only in one or a few particular tissue types. An "inducible promoter" is one that initiates transcription only under particular environmental conditions or developmental conditions. [0025] The term "plant" includes whole plants, shoot vegetative organs and/or structures (e.g., leaves, stems and tubers), roots, flowers and floral organs (e.g., bracts, sepals, petals, stamens, carpels, anthers), ovules (including egg and central cells), seed (including zygote, embryo, endosperm, and seed coat), fruit (e.g., the mature ovary), seedlings, plant tissue (e.g., vascular tissue, ground tissue, and the like), cells (e.g., guard cells, egg cells, trichomes and the like), and progeny of same. The class of plants that can be used in the method of the invention is generally as broad as the class of higher and lower plants amenable to transformation techniques, including angiosperms (monocotyledonous and dicotyledonous plants), gymnosperms, ferns, and multicellular algae. It includes plants of a variety of ploidy levels, including aneuploid, polyploid, diploid, haploid, and hemizygous.
BRIEF DESCRIPTION OF THE DRAWINGS
[0026] FIG.1 PSR2 affects the accumulation of specific 21-nt siRNAs in Arabidopsis.
[0027] FIG.1A Mutants defective in secondary siRNA production and a transgenic line expressing PSR2 (PSR2-5) are hypersusceptible to Phytophthora capsici. Arabidopsis plants were inoculated with zoospore suspensions of P. capsici isolate LT263. Photos were taken at 3 days post inoculation (dpi). Arrows indicate inoculated leaves. WT: wild-type Col-0.
[0028] FIG.1B Disease severity index (DSI) and pathogen biomass in inoculated Arabidopsis plants at 3 dpi. Values are mean±SEM of three biological replicates. Student’s t-test was used for comparisons (mutants versus WT). * and ** label results that are statistically different at p £ 0.05 or p £ 0.01. More than 20 leaves were inoculated in every biological replicate (N³20).
[0029] FIG.1C Size distribution of total small RNAs in WT and PSR2-5 plants. Data from two biological replicates are presented.
[0030] FIG.1D Reads fraction of 21-nt sRNAs in WT and PSR2-5 plants. Percentage of reads count of miRNAs, and siRNAs produced from Pol IV transcripts (P4siRNA), transposable elements (TE), protein-coding transcripts (PC), TAS and PPR transcripts are presented. Data from two biological replicates are presented.
[0031] FIG.1E Changes in the abundance (in a log2 scale) of 21-nt small RNAs derived from different classes of transcripts in PSR2-5. P4: RNA polymerase IV; TE: transposable elements; PC: protein-coding genes; tasiRNA: trans acting siRNAs; PPR: pentatricopeptide repeat protein- coding genes.
[0032] FIG.1F Secondary siRNAs generated from PPR, TAS and NB-LRR loci in WT and PSR2-5 plants. The number in each plot indicates the scale of sRNA reads count derived from each locus.
[0033] FIG.2 Secondary siRNAs generated from a cluster of PPR genes contribute to
Arabidopsis resistance to P. capsici.
[0034] FIG.2A Northern blotting showing induced accumulation of miR161 and two representative PPR-derived secondary siRNAs in wild-type Col-0 (WT) plants during P. capsici infection (0-24 hours post inoculation with zoospore suspensions). Numbers represent relative signal intensities. U6 was used as a loading control. Water was used as the“mock” treatment. Similar results were obtained from two biological replicates. See also Figure 7A-D.
[0035] FIG.2B Northern blotting showing that the abundance of miR161 and miR393 remained unchanged in bak1/serk4 mutant after inoculated with P. capsici.
[0036] FIG.2C miR161 is a positive regulator of plant immunity. The abundance of two PPR- derived siRNAs was determined in WT, MIR161ox and MIR161cri plants by northern blotting. Disease severity index (DSI) of WT, MIR161ox and MIR161cri plants was determined at 3 days after zoospore inoculation by P. capsici. Values are mean±SEM of three biological replicates. Student’s t-test was used for comparisons (mutants versus WT). Statistically significant results are labeled with * (p £ 0.05). N³20. Northern blotting was used to examine the abundance of two PPR-derived siRNAs determined in WT, MIR161ox and MIR161cri plants. See also Figure 8A-J.
[0037] FIG.2D MIR173cri mutants are hypersusceptible to P. capsici. The abundance of two PPR-derived siRNAs was evaluated in WT and the mutants. DSI was determined at 3 dpi.
Values are mean±SEM of three biological replicates. Student’s t-test was used for comparisons (mutants versus WT). Statistically significant results are labeled with * (p £ 0.05). N³20. The abundance of two PPR-derived siRNAs was evaluated in WT and MIR173cri mutants. See also Figure 8A-J. [0038] FIG.2E Secondary siRNA-producing PPR genes contribute to Arabidopsis resistance to P. capsici. DSI of eight PPR mutants was determined at 3 dpi. Values are mean±SEM of three biological replicates. Student’s t-test was used for comparisons (mutants versus WT). * labels results that are statistically different at p £ 0.05. N³20. See also Figure 9.
[0039] FIG 3 A PPR-derived siRNA silences a gene in Phytophthora to confer resistance.
[0040] FIG 3A A flow chart describing the experimental procedure of the functional analysis of PPR-derived siRNAs.
[0041] FIG 3B Base pairing of the PPR-derived siR1310 and siR0513 with their predicted target site in Phyca_554980 of P. capsici (SEQ ID NOS 1409-1412, respectively, in order of appearance). See also Figure 10A-C.
[0042] FIG 3C Quantitative RT-PCR determining the transcript abundances of Phyca_554980 and Phyca_538731 (an off-target control) in P. capsici transformants harboring synthesized siR1310. P. capsici transformed with siRGFP was used as a negative control. Values are mean±SEM of three biological replicates. See also Figure 11A-G.
[0043] FIG 3D Numbers of sporangia produced by wild-type (WT) or transformants of P. capsici harboring siR1310 or siRGFP. Sporangia formation of P. capsici strains. Mycelium plugs were cultured in V8 medium for 2 days before sporangia were induced in sterilized water for 1 day in the dark. Number of sporangia were counted from four randomly selected fields of view under a microscope for each strain. Bars=200 mm. Arrows indicate sporangia. Values are mean±SEM of three biological replicates. One-way ANOVA and post-hoc Tukey testing were used for statistical comparison. Different letters indicate significant differences (p £ 0.05). See also Figure 11A-G.
[0044] FIG 3E P. capsici transformants carrying siR1310 are no longer able to infect N.
benthamiana. Mycelial plugs were used to inoculated detached leaves of N. benthamiana. Photos of inoculated leaves were taken at 3 dpi under UV to better visualize the lesions. Lesion sizes are presented as mean±SEM of three replicates. One-way ANOVA and post-hoc Tukey testing were used for statistical comparison. Different letters indicate significant differences (p £ 0.05). [0045] FIG 3F Quantitative RT-PCR determining the abundances of siR1310 in leaves or extracellular vesicles (EV) of WT and PSR2-5 Arabidopsis plants with or without P. capsici infection. Values are mean±SEM of three biological replicates.
[0046] FIG 3G Transcript abundances of Phyca_554980 in wild-type (WT), MIR161ox, PSR2- 5 and rdr6 plants inoculated with P. capsici. The transcript levels at 1 dpi were determined by qRT-PCR. Values are mean±SEM of three biological replicates. Student’s t-test was used for comparisons (mutants versus WT).
[0047] FIG.4 PPR-derived siR1310 silences a reporter gene during Phytophthora infection.
[0048] FIG.4A Schematic illustration of the construction of mRFP reporters containing either a target site of siR1310 (t-mRFP) or a mutated version of the target site (mt-mRFP).
[0049] FIG.4 B- FIG.4 C Red fluorescence intensity were monitored during P. capsici infection of WT, MIR161ox, or MIR161cri Arabidopsis plants. Because the t-mRFP and mt- mRFP constructs were independently transformed into P. capsici, their basal mRFP expression levels were different. Photos were taken at 2 dpi. Bars=20 mm. Values shown in panel C are mean±SEM. One-way ANOVA and post-hoc Tukey testing were used for statistical comparison. Different letters indicate values that are statistically different (p £ 0.05). N ³8.
[0050] FIG.4D mRFP transcript levels of the P. capsici strains infecting wild-type (WT), MIR161ox and MIR161cri plants were determined by qRT-PCR. Values are mean±SEM of at least four replicates. Student’s t-test was used for comparisons (mutants versus WT). * represents statistical difference (p £ 0.05); NS represents no statistical difference. Because t-mRFP and mt- mRFP constructs were independently transformed into P. capsici, their basal mRFP expression levels were different. See also Figure11A-G.
[0051] FIG.5 PSR2 associates with DRB4 in Arabidopsis.
[0052] FIG.5A Schematic representation of the domain structure of PSR2 and DRB4. PSR2 has seven tandem repeat units consisting of W, Y and/or L motifs. S: secretion signal; R: RxLR domain. DRB4 has two double-stranded RNA-binding motifs (dsRBM) at the N-terminus.
[0053] FIG.5B The two dsRNA-binding domains of DRB4 mediate interaction with PSR2 in planta. Flag-PSR2, DRB4-YFP, and DRB4 truncates were transiently expressed in N. benthamiana. Total proteins were extracted and PSR2 was pulled down using anti-Flag agarose beads. Enrichment of DRB4 or its truncated mutants in the immune complexes was detected by western blotting. * labels corresponding protein band. The gel stained with Coomassie Brilliant Blue (CBB) was used as a loading control.
[0054] FIG.5C WY1 and LWY2 are necessary and sufficient for PSR2 interaction with DRB4. PSR2, PSR2DWY1, PSR2DLWY2, and PSR2WY1+LWY2 were fused with a flag tag and individually expressed in N. benthamiana together with DRB4-YFP. Enrichment of DRB4 in the immune complexes pulled down by anti-Flag agarose beads was detected by western blotting. * labels corresponding protein band in each lane. The arrowhead labels signals corresponding to DRB4.
[0055] FIG.5D WY1 and LWY2 are necessary and sufficient for the transgene silencing suppression activity of PSR2. Leaves of N. benthamiana 16c plants were co-infiltrated with Agrobacterium carrying 35S:GFP and 35S:PSR2 constructs. Pictures were taken 5 days after Agrobacterium infiltration. EV: Empty vector. See also Figure 12A-D.
[0056] FIG.5E Virulence activities of PSR2 and its derivatives were examined on N.
benthamiana leaves inoculated with mycelial plugs of P. capsici strain LT263. Lesions were visualized under a UV lamp at 3 days post inoculation and lesion sizes were measured. YFP was used as a control. Values are mean±SEM. Different letters indicate statistically different values (p<0.01). See also Figure 12A-D.
[0057] FIG.5F Reduced dsRNA cleavage in PSR2-5 and a drb4 mutant plants. In vitro synthesized 510-bp dsRNAs were labeled with 32P, and then incubated with crude protein extracts. The cleavage products were analyzed by electrophoresis. A 22-nt DNA end-labeled with 32P and a dsRNA ladder were used as size markers. The arrow labels the 510-bp dsRNAs and the arrowhead labels sRNA products. Numbers represent the relative abundances of the sRNA products with the level in wild-type (WT) set to 1. Total proteins in the crude extracts were analyzed on SDS-PAGE and stained with Coomassie Brilliant Blue (CBB) as a loading control.
[0058] FIG.6 A drb4 mutant phenocopies PSR2-expressing plants. [0059] FIG.6A drb4 and PSR2-5 plants were hypersusceptible to P. capsici. Roots of 14-day- old seedlings were inoculated by zoospore suspensions and the photos were taken at 3 dpi. This phenotype was complemented by introducing DRB4-YFP under its native promoter into the drb4 mutant. See also Figure12A-D.
[0060] FIG.6B Five-week-old drb4 and PSR2-5 plants exhibited a similar curly/narrow leaf phenotype.
[0061] FIG.6C Venn diagram showing PPR loci with reduced secondary siRNA production in rdr6, drb4 and PSR2-5 plants compared to wild-type Arabidopsis respectively.
[0062] FIG.7A-D Accumulation of secondary siRNA-triggering miRNAs and tasiRNA in Arabidopsis during P. capsici infection, related to Figure 2.
[0063] FIG.7A Quantitative RT-PCR showing transcript abundances of pri-miRNAs in wild- type Arabidopsis Col-0 during P. capsici infection at 0, 3, 6 and 12 hours post inoculation (hpi). Values are mean±SD. Water was used as a mock treatment.
[0064] FIG.7B Northern blotting showing the abundances of miR173, miR390 and miR393 during P. capsici infection in wild-type (WT) Arabidopsis plants. Numbers represent relative signal intensities. U6 was used as a loading control.
[0065] FIG.7C Sequence alignment of two PPR-siRNAs. PPR-siRNA-1 and PPR-siRNA-2 were used as representatives to show abundance changes in Arabidopsis (SEQ ID NOS 1413- 1434, respectively, in order of appearance). Similar sequences could be produced from multiple PPR loci.
[0066] FIG.7D Northern blotting showing the abundances of two tasiRNAs (siR255 and siR1511) during P. capsici infection (0-24 hours post inoculation). The production of these tasiRNAs is triggered by miR173. Water was used as a mock treatment. U6 served as a loading control. Numbers represent relative signal intensities.
[0067] FIG.8A-J. Disease susceptibility of miR161 and miR173 mutants, related to Figure 2.
[0068] FIG.8A Sequences in the foldback region of pri-miR161 in wild-type (WT) and MIR161cri lines (SEQ ID NOS 1435-1440, respectively, in order of appearance). The sequences in purple correspond to miR161. MIR161cri-7 has one nucleotide insertion (in red), which reduces, but not abolishes miR161 production. MIR161cri-8 has a deletion of six nucleotides, abolishing miR161 production.
[0069] FIG.8B Northern blotting showing the abundance of miR161 in wild-type Arabidopsis (WT), MIR161 over-expression lines (MIR161ox), and crispr mutants (MIR161cri) lines.
Numbers represent relative signal intensities. U6 was used as a loading control.
[0070] FIG.8C Disease symptoms of WT, MIR161ox and MIR161cri plants after inoculated with P. capsici zoospore suspension. Photos were taken at 3 dpi. Arrows indicate inoculated leaves.
[0071] FIG.8D Northern blotting showing the increased accumulation of miR173 and tasiRNAs (represented by siR1511) in MIR173 over-expression lines (MIR173ox). However, the abundance of PPR-derived siRNAs (represented by PPR-siRNA-2) was not increased. Numbers represent relative signal intensities. U6 was used as a loading control.
[0072] FIG.8E MIR173ox plants exhibited similar susceptibility to wild-type (WT) when inoculated with P. capsici zoospore suspension. DSI was determined at 3 dpi. Values are mean±SEM of three biological replicates.
[0073] FIG.8F Northern blotting showing the increased accumulation of miR390 in MIR390 over-expression (MIR390ox) lines.
[0074] FIG.8G MIR390ox plants exhibited similar susceptibility to wild-type (WT) when inoculated with P. capsici zoospore suspension. DSI was determined at 3 dpi. Values are mean±SEM of three biological replicates.
[0075] FIG.8H Sequences in the foldback region of MIR173 in wild-type and MIR173cri lines (SEQ ID NOS 1441-1446, respectively, in order of appearance). miR173 can be generated from both purple regions. Mutated nucleotides in MIR173cri-3 are highlighted in red. In addition to mutations, MIR173cri-7 also have a deletion of ten nucleotides, leading to abolishment of miR173 production.
[0076] FIG.8I Northern blotting showing the diminished accumulation of tasiRNAs
(represented by siR255 and siR1511) in MIR173cri mutants. Numbers represent relative signal intensities. U6 was used as a loading control. [0077] FIG.8J Symptoms of MIR173cri mutants after P. capsici infection. Photos were taken at 3 dpi. Arrows indicate inoculated leaves.
[0078] FIG.9A-C Characterization of the T-DNA insertion mutants of eight PPR genes that can generate secondary siRNAs, related to Figure 2.
[0079] FIG.9A Schematic maps of the T-DNA insertion site in each mutant and the locations of the primers used for quantitative RT-PCR. Black arrows label the predicted target sites of miR161. White arrows label the predicted target sites of tasiRNAs.
[0080] FIG.9B Quantitative RT-PCR measuring the transcript levels of the corresponding PPR gene in each mutant. Values are mean±SD of at least three replicates.
[0081] FIG.9C Disease symptoms of the mutants after P. capsici inoculation. Photos were taken at 3 dpi. Inoculated leaves were removed from the plants at 3 dpi to better show the symptoms.
[0082] FIG.10A-C Potential targets of PPR-derived siRNAs in Arabidopsis and
Phytophthora, related to Figure 3.
[0083] FIG.10A Venn diagram showing a minimal overlap between genes up-regulated in PSR2-5 plants, compared to wild-type Arabidopsis Col-0, and the genes predicted to contain target site(s) of PPR-derived siRNAs.
[0084] FIG.10B A list showing the 11 genes that are up-regulated in PSR2-5 and are also potential targets of PPR-derived siRNAs. Only two of the 11 genes contain PPR domains in their deduced amino acid sequences. At1g12775 can also produce siRNAs, but it is not in the gene cluster that produces the large majority of PPR-derived siRNAs.
[0085] FIG.10C Amino acid sequence alignment of homologs of Phyca_554980 encoded protein in Phytophthora species P. capsici, P. parasitica, P. infestans, P. ramorum, P.
cinnamomi, and P. sojae (from the top to the bottom in the alignment) (SEQ ID NOS 1447-1452, respectively, in order of appearance). The protein sequences were identified using FungiDB (http://fungidb.org/fungidb/). Highlighted areas represent highly conserved sequences.
[0086] FIG.11A-G Target gene silencing and developmental defects of P. capsici
transformants carrying siR1310, related to Figure 3. [0087] FIG.11A Quantitative RT-PCR of the predicted target gene Phyca_554980 in ten independent transformants of P. capsici that potentially carry siR1310. Transformants potentially carrying siRGFP were used as controls. Values are mean±SEM.
[0088] FIG.11B Insufficient base pairing of the PPR-derived siR1310 and siR0513 with their predicted off-target Phyca_538731 of P. capsici (SEQ ID NOS 1453-1456, respectively, in order of appearance).
[0089] FIG.11C Mycelium growth of two siR1310 transformants with largely reduced transcript levels of the target gene Phyca_554980. P. capsici strains were grown on V8 plates. Pictures were taken after 5 days of growth. Transformants carrying siRGFP and wild-type (WT) strain were used as controls.
[0090] FIG.11D Mycelium growth rate (shown as colony diameters) of P. capsici strains. Values are mean±SEM. Different letters indicate values that are statistically different (p < 0.05).
[0091] FIG.11E Number of zoospores produced by P. capsici strains. Sporangia growing in sterilized water were stressed to release zoospores by illumination for 12 hours and then chilling at 4°C for 1 hour. Zoospores were counted from four randomly selected fields of view under a microscope for each strain using a hemocytometer. Values are mean±SEM. Different letters indicate values that are statistically different (p < 0.05).
[0092] FIG.11F Quantitative RT-PCR showing the level of siR0513 in WT and PSR2-5 plants in EVs isolated from leaves tissues. Values are mean±SEM. * and ** label results that are statistically different with the WT value at p £ 0.05 or p £ 0.01.
[0093] FIG.11G Stem loop qPCR showing the level of siR1310 in MIR161ox and MIR161cri mutant plants compared to wild-type (WT) Arabidopsis. Values are mean±SEM. * and ** label results that are statistically different with the WT value at p £ 0.05 or p £ 0.01.
[0094] FIG.12A-D The RNAi suppression activity of PSR2 depends on its association with DRB4, related to Figure 5 and 6.
[0095] FIG.12A Western blotting showing the abundance of GFP proteins in N. benthamiana 16c leaves expressing wild-type or truncated PSR2. Total proteins were extracted from leaves infiltrated with Agrobacterium carrying 35S-GFP and another strain carrying either the pEG100 empty vector (EV) or various truncates of PSR2-Flag at 5 dpi. Coomassie Brilliant blue staining (CBB) was used as loading control.
[0096] FIG.12B Western blotting showing the protein levels of PSR2 or its derivatives in the infiltrated leaves. Total proteins were extracted from infiltrated leaves at 2 days after Agro- infiltration and the proteins were detected by anti-Flag antibody. Coomassie Brilliant blue staining (CBB) was used as loading control.
[0097] FIG.12C YFP-PSR2 and DRB4-YFP were expressed in N. benthamiana through Agrobacterium-mediated transient expression. Total proteins were extracted from the infiltrated leaves with treatment of RNase III and the immune complexes were pulled-down using anti-GFP magnetic beads. The immuno-precipitated proteins were then incubated with in vitro synthesized dsRNA (510-bp in length). dsRNA enriched on the beads was extracted using Trizol/chloroform and then analyzed on 2% agarose gel along with Ethidium bromide staining. YFP was used as a negative control. The Arrowhead shows the position of the 510-bp dsRNA. Protein levels of immuno-precipitated YFP, PSR2 and DRB4 were confirmed by western blotting using anti-GFP antibody.
[0098] FIG.12D Detached leaves from four-week-old plants of wild-type (WT), PSR2-5, drb4 and a complementation line of drb4 (DRB4 expressed under its native promoter) were inoculated with zoospore suspensions of P. capsici strain LT263. Inoculated leaves were stained with trypan blue to visualize the lesions at 3 dpi. Disease severity index (DSI) was also determined. Values are mean±SD. * labels results that are statistically different at p £ 0.05.
[0099] FIG.13. A model illustrating an arms race centered on host-induced gene silencing in Arabidopsis during Phytophthora infection. Phytophthora capsici can be recognized by
Arabidopsis in a BAK1-dependent manner, likely by receptor localized on the cell surface. miR161 is induced upon this recognition and the increased accumulation of miR161 leads to increased production of secondary siRNAs from a small number of PPR transcripts. PPR- derived siRNA production is also affected by miR173-dependent tasiRNAs. These PPR-derived siRNAs confer resistance to P. capsici, likely through extracellular vesicle mediated
transportation and conferring targeted gene(s) silencing in the pathogen. As a counter-defense strategy, some Phytophthora species evolved effectors possessing RNA silencing suppression activity. In particular, PSR2 associates with the host protein DRB4 and interferes with secondary siRNA production from specific loci, especially the PPR loci, to promote the infection.
[0100] FIG.14: Schematic illustration of inoculation method and construction of at1g62914m (SEQ ID NOS 1457-1459, respectively, in order of appearance). A codon encoding a tyrosine (Y144) was mutated into a stop codon.
[0101] FIG.15: Nicotiana benthamiana leaves expressing both atMIR161 and at1g62914m produced a much higher amount of siRNAs derived from at1g62914m transcripts.
[0102] FIG.16: Plants producing antimicrobial siRNAs exhibited enhanced resistance to P. capsici. Leaves of Nicotiana benthamiana that express atMIR161, at1g62914m, or
atMIR161+at1g62914m were inoculated with Phytophthora capsici strain LT263. Disease severity was evaluated at 3 days post inoculation. The results show that plants expressing atMIR161+at1g62914m exhibited much enhanced resistance to P. capsici. This experiment was repeated three times with similar results. Images of representative inoculated leaves (two per treatment) are shown below (Panel A). Lesion size of each inoculated leaf was measured and analyzed (Panel B). Please note that not all leaves expressed the same amount of atMIR161 and/or at1g62914m transcripts, hence the variation within the same treatment. DETAILED DESCRIPTION OF THE INVENTION
[0103] The inventors have discovered that certain miRNAs, when expressed in a plant, induce resistance to certain pathogens (including filamentous eukaryotic pathogens such as
Phytophthora and Verticilium.) For example, expression of an miRNA161 family member in a plant is effective in increasing resistance to Phytophthora pathogens. Without intending to be bound by a certain mechanism of action, it is believed that expression of the miRNA results in causing production in the plant of numerous siRNAs, some of which are effective causing plant resistance to the pathogens. In some embodiments, the pathogen is Phytophthora. In some embodiments, the pathogen is an oomycete. In some embodiments, the pathogen is an ascomycete. In some embodiments, the pathogen is a hemi-ascomycete. In some embodiments, the pathogen is a basidiomycete. [0104] Accordingly, in some embodiments, plants that heterologously express the miRNA are provided. In some embodiments, transgenic plants can be generated that comprise an expression cassette comprising a promoter operably linked to a polynucleotide encoding the miRNA. In some embodiments, the promoter is heterologous to the polynucleotide encoding the miRNA. For example in some embodiments, the promoter is not endogenously linked to the
polynucleotide, or is a modified form from the endogenous promoter (e.g., such that expression of the polynucleotide is increased). In some embodiments, the promoter is from the same species as the transgenic plant. In some embodiments, the promoter is from a different plant species. In some embodiments, the polynucleotide is from the same plant species or is substantially identical to a polynucleotide from the same plant species. In some embodiments, the polynucleotide is from a different plant species from the transgenic plant or is substantially identical to the polynucleotide from a different plant species.
[0105] Exemplary miRNA161 sequences include but are not limited (i) to those listed below or (ii) to RNA sequences substantially identical to those listed below or (iii) to RNA sequences that include 1, 2, 3, 4 or 5 nucleotide changes compared to any of the sequences below:
SEQ ID NO:1 >ath-MIR161.1 Arabidopsis thaliana
UGAAAGUGACUACAUCGGGGU SEQ ID NO:2 >pav-miR161.1 Prunus avium L.
UUGAAAGUGAAAACAUCAGGC SEQ ID NO:3 >Aca-miR161.1 Azolla caroliniana
UGAAAGUGACUACAUCGGGGU SEQ ID NO:4 >Asp-miR161.1 Alsophila spinulosa
UGAAAGUGACUACAUCGGGGU SEQ ID NO:5 >Cfo-miR161.1 Cyrtomium fortunei
UGAAAGUGACUACAUCGGGGU SEQ ID NO:6 >Pnu-miR161.1 Psilotum nudum
UGAAAGUGACUACAUCGGGGU SEQ ID NO:7>Scu-miR161.1 Salvinia cucullata
UGAAAGUGACUACAUCGGGGU SEQ ID NO:8>Smo-miR161.1 Salvinia molesta
UGAAAGUGACUACAUCGGGGU SEQ ID NO:9>Vst-miR161.1 Vandenboschia striata UGAAAGUGACUACAUCGGGGU SEQ ID NO:10>Isi-miR161.1 Isoetes sinensis
UGAAAGUGACUACAUCGGGGU SEQ ID NO:11>Era-miR161.1 Equisetum ramosissimum UGAAAGUGACUACAUCGGGGU
Figure imgf000023_0001
SEQ ID NO:13 >ath-MIR161.2 Arabidopsis thaliana UCAAUGCAUUGAAAGUGACUA SEQ ID NO:14>bna-miR161 Brassica napus
UCAAUGCACUGAAAGUGACUA SEQ ID NO:15>bra-miR161-5p Brassica rapa
UCAAUGCACUGAAAGUGACUA SEQ ID NO:16>cas-miR161 Camelina sativa
UCAAUGCAUUGAAAGUGACUA SEQ ID NO:17>dlo-miR161.2 Dimocarpus longan CAAUUGCAUUGAAAGCUGCUA SEQ ID NO:18>pav-miR161.2 Prunus avium L.
UUAAGGAAUUGAAAGUGAAAA SE ID 1
{
Figure imgf000023_0002
[0106] In some embodiments, one or more PPR transcript that serves as a target for miR161 is also expressed in the plant. In some embodiments, the PPR transcript is a P-type PPR transcript. See, e.g., Barkan, Annu. Rev. Plant Biol.2014.65:415-442. In some embodiments, the PPR transcript(s) is in the Rf-like (or RFL,“RF” stands for“restorer of fertility”) sub-clade of PPR-P genes. Related information of RF-like PPR genes, and RF-like transcripts, can be found in Dahan and Mireau, RNA Biology 10:9, 1469–1476, September 2013 as well as in Fujii et al., Proc. Natl. Acad. Sci. USA January 25, 2011, vol.108, no.4, pp.1723–1728, including supplemental Table 1 therein listing a number of Rf-like PPR genes. Howell (The Plant Cell, Vol.19: 926–942, March 2007) describes siRNAs that are specifically generated from PPR-P genes in Arabidopsis and other plant species. The PPR transcript will contain one or more (e.g., 2, 3, 4, 5, 6, 7, or more) sequences encoding anti-pathogen siRNAs. Exemplary anti-pathogen siRNAs are displayed for example in Table S3 as depicted in Hou, et al., A Phytophthora Effector Suppresses Trans-Kingdom RNAi to Promote Disease Susceptibility, 25(1) Cell Host & Microbe 153-165 (Jan.9, 2019) or in U.S. Provisional Patent Application No.62/714,342. Table S1 provides a listing of various Arabidopsis PPR transcripts. In some embodiments, the ant-pathogen siRNAs target one or more of the 249 P. capsici gene sequences as depicted in Table S4.
[0107] In some embodiments, the miR161 and the PPR transcript introduced into the plant are both from the same species. This will allow for optimal ability of the miR161 to generate siRNAs from the PPR transcript. However, this is optional and in other cases, the miR161 sequence and the PPR transcript are from different plant species. Exemplary sequences encoded by PPR genes are provided in Table S3 as depicted in Hou, et al., A Phytophthora Effector Suppresses Trans-Kingdom RNAi to Promote Disease Susceptibility, 25(1) Cell Host & Microbe 153-165 (Jan.9, 2019). As shown in Example 2, the co-expression of at least one PPR gene with miR161 increases resistance in the plant to pathogens.
[0108] The isolation of polynucleotides (e.g., miRNA 161 members, PPR transcripts or promoters) may be accomplished by a number of techniques. For instance, oligonucleotide probes based on the sequences disclosed here can be used to identify the desired polynucleotide in a cDNA or genomic DNA library from a desired plant species. To construct genomic libraries, large segments of genomic DNA are generated by random fragmentation, e.g. using restriction endonucleases, and are ligated with vector DNA to form concatemers that can be packaged into the appropriate vector. Alternatively, cDNA libraries from plants or plant parts may be constructed.
[0109] The cDNA or genomic library can then be screened using a probe based upon a sequence disclosed here. Probes may be used to hybridize with genomic DNA or cDNA sequences to isolate homologous genes in the same or different plant species. Alternatively, antibodies raised against a polypeptide can be used to screen an mRNA expression library.
[0110] Alternatively, the nucleic acids of interest can be amplified from nucleic acid samples using amplification techniques. For instance, polymerase chain reaction (PCR) technology to amplify the sequences of the genes directly from mRNA, from cDNA, from genomic libraries or cDNA libraries. PCR and other in vitro amplification methods may also be useful, for example, to clone nucleic acid sequences that code for proteins to be expressed, to make nucleic acids to use as probes for detecting the presence of the desired mRNA in samples, for nucleic acid sequencing, or for other purposes. For a general overview of PCR see PCR Protocols: A Guide to Methods and Applications. (Innis, M, Gelfand, D., Sninsky, J. and White, T., eds.), Academic Press, San Diego (1990).
[0111] Polynucleotides can also be synthesized by well-known techniques as described in the technical literature. See, e.g., Carruthers et al., Cold Spring Harbor Symp. Quant. Biol.47:411- 418 (1982), and Adams et al., J. Am. Chem. Soc.105:661 (1983). Double stranded DNA fragments may then be obtained either by synthesizing the complementary strand and annealing the strands together under appropriate conditions, or by adding the complementary strand using DNA polymerase with an appropriate primer sequence.
[0112] Once a desired polynucleotide sequence is obtained, it can be used to prepare an expression cassette for expression in a plant. In some embodiments, expression of the polynucleotide is directed by a heterologous promoter. Any of a number of means well known in the art can be used to drive expression of the polynucleotide sequence of interest in plants. Any organ can be targeted, such as shoot vegetative organs/structures (e.g. leaves, stems and tubers), roots, flowers and floral organs/structures (e.g. bracts, sepals, petals, stamens, carpels, anthers and ovules), seed (including embryo, endosperm, and seed coat) and fruit. Alternatively, expression can be conditioned to only occur under certain conditions (e.g., using an inducible promoter). [0113] For example, a plant promoter fragment may be employed to direct expression of the polynucleotide sequence of interest in all tissues of a regenerated plant. Such promoters are referred to herein as "constitutive" promoters and are active under most environmental conditions and states of development or cell differentiation. Examples of constitutive promoters include the cauliflower mosaic virus (CaMV) 35S transcription initiation region, the 1'- or 2'- promoter derived from T-DNA of Agrobacterium tumafaciens, and other transcription initiation regions from various plant genes.
[0114] Alternatively, the plant promoter may direct expression of the polynucleotide sequence of interest in a specific tissue (tissue-specific promoters) or may be otherwise under more precise environmental control (inducible promoters). Examples of tissue-specific promoters under developmental control include promoters that initiate transcription only in certain tissues, such as leaves or guard cells (including but not limited to those described in WO/2005/085449; U.S. Patent No.6,653,535; Li et al., Sci China C Life Sci.2005 Apr;48(2):181-6; Husebye, et al., Plant Physiol, April 2002, Vol.128, pp.1180-1188; and Plesch, et al., Gene, Volume 249, Number 1, 16 May 2000 , pp.83-89(7)). Examples of environmental conditions that may affect transcription by inducible promoters include the presence of a pathogen, anaerobic conditions, elevated temperature, or the presence of light.
[0115] In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter is an inducible promoter. In some embodiments, the promoter is stress inducible (e.g., inducible by abiotic stress). In some embodiments, the promoter is pathogen inducible. In some embodiments, the promoter is induced upon infection by Phytophthora or Verticillium. Non-limiting examples of pathogen inducible promoters include Botyritis-Induced Kinase 1 (BIK1) and the plant defensing gene PDF1.2. See, e.g., Penninckx et al., Plant Cell 10:2103- 2113 (1998); see also Veronese et al., Plant Cell 18:257-273 (2006).
[0116] In some embodiments, a polyadenylation region at the 3'-end of the coding region can be included. The polyadenylation region can be derived from a variety of plant genes, or from T-DNA.
[0117] The vector comprising the sequences will typically comprise a marker gene that confers a selectable phenotype on plant cells. For example, the marker may encode biocide resistance, particularly antibiotic resistance, such as resistance to kanamycin, G418, bleomycin,
hygromycin, or herbicide resistance, such as resistance to chlorosluforon or Basta.
[0118] As detailed herein, embodiments of the present invention provide for transgenic plants comprising recombinant expression cassettes for expressing a polynucleotide sequence as described herein. In some embodiments, a transgenic plant is generated that contains a complete or partial sequence of a polynucleotide (e.g., an miRNA161 sequence or a promoter) that is derived from a species other than the species of the transgenic plant. It should be recognized that transgenic plants encompass the plant or plant cell in which the expression cassette is introduced as well as progeny of such plants or plant cells that contain the expression cassette, including the progeny that have the expression cassette stably integrated in a chromosome.
[0119] In some embodiments, the transgenic plants comprising recombinant expression cassettes for expressing a polynucleotide sequence as described herein have increased or enhanced pathogen resistance compared to a plant lacking the recombinant expression cassette, wherein the transgenic plants comprising recombinant expression cassettes for expressing the polynucleotide sequence have about the same growth as a plant lacking the recombinant expression cassette. Methods for determining increased pathogen resistance are described below.
[0120] A recombinant expression vector as described herein may be introduced into the genome of the desired plant host by a variety of conventional techniques. For example, the DNA construct may be introduced directly into the genomic DNA of the plant cell using techniques such as electroporation and microinjection of plant cell protoplasts, or the DNA construct can be introduced directly to plant tissue using ballistic methods, such as DNA particle bombardment. Alternatively, the DNA construct may be combined with suitable T-DNA flanking regions and introduced into a conventional Agrobacterium tumefaciens host vector. The virulence functions of the Agrobacterium tumefaciens host will direct the insertion of the construct and adjacent marker into the plant cell DNA when the cell is infected by the bacteria. While transient expression of the polynucleotide sequence of interest is also encompassed by the disclosure, generally expression will be from insertion of expression cassettes into the plant genome, e.g., such that at least some plant offspring also contain the integrated expression cassette. [0121] Microinjection techniques are also useful for this purpose. These techniques are well known in the art and thoroughly described in the literature. The introduction of DNA constructs using polyethylene glycol precipitation is described in Paszkowski et al. EMBO J.3:2717-2722 (1984). Electroporation techniques are described in Fromm et al. Proc. Natl. Acad. Sci. USA 82:5824 (1985). Ballistic transformation techniques are described in Klein et al. Nature 327:70- 73 (1987).
[0122] Agrobacterium tumefaciens-mediated transformation techniques, including disarming and use of binary vectors, are well described in the scientific literature. See, for example, Horsch et al. Science 233:496-498 (1984), and Fraley et al. Proc. Natl. Acad. Sci. USA 80:4803 (1983).
[0123] Transformed plant cells derived by any of the above transformation techniques can be cultured to regenerate a whole plant that possesses the transformed genotype and thus the desired phenotype such as enhanced pathogen resistance. Such regeneration techniques rely on manipulation of certain phytohormones in a tissue culture growth medium, typically relying on a biocide and/or herbicide marker which has been introduced together with the desired nucleotide sequences. Plant regeneration from cultured protoplasts is described in Evans et al., Protoplasts Isolation and Culture, Handbook of Plant Cell Culture, pp.124-176, MacMillilan Publishing Company, New York, 1983; and Binding, Regeneration of Plants, Plant Protoplasts, pp.21-73, CRC Press, Boca Raton, 1985. Regeneration can also be obtained from plant callus, explants, organs, or parts thereof. Such regeneration techniques are described generally in Klee et al. Ann. Rev. of Plant Phys.38:467-486 (1987).
[0124] After the expression cassette is stably incorporated in transgenic plants and confirmed to be operable, it can be introduced into other plants by sexual crossing. Any of a number of standard breeding techniques can be used, depending upon the species to be crossed.
Alternatively, an endogenous promoter sequence can be altered (e.g., by one or more nucleotide change) to generate a higher expressing promoter. This latter method can involve introduction of a new expression cassette into the plant or can involve in vivo mutation, for example using a targeted nuclease (e.g., CRISPR, talens, zinc fingers) in combination with a second
polynucleotide that is introduced by homologous recombination (and optionally a third targeting polynucleotide). [0125] Plant gene manipulations can be precisely tailored in non-transgenic organisms using the CRlSPR/Cas9 genome editing method. In this bacterial antiviral and transcriptional regulatory system, a complex of two small RNAs - the CRISPR-RNA (crRNA) and the trans- activating crRNA (tracrRNA) - directs the nuclease (Cas9) to a specific DNA sequence complementary to the crRNA. Binding of these RNAs to Cas9 involves specific sequences and secondary structures in the RNA. The two RNA components can be simplified into a single element, the single guide-RNA (sgRNA), which is transcribed from a cassette containing a target sequence defined by the user. This system has been used for genome editing in humans, zebrafish, Drosophila, mice, nematodes, bacteria, yeast, and plants. In this system the nuclease creates double stranded breaks at the target region programmed by the sgRNA. These can be repaired by non-homologous recombination, which often yields inactivating mutations. The breaks can also be repaired by homologous recombination, which enables the system to be used for gene targeted gene replacement. Promoter mutations can be introduced into plants using the CAS9/CRISPR system. Accordingly, in some embodiments, instead of generating a transgenic plant, a native promoter sequence in a plant or plant cell can be altered in situ to generate a plant or plant cell carrying a polynucleotide comprising a mutated miRNA promoter as described herein.
[0126] The CRISPR/Cas system has been modified for use in prokaryotic and eukaryotic systems for genome editing and transcriptional regulation. The "CRISPR/Cas" system refers to a widespread class of bacterial systems for defense against foreign nucleic acid. CRISPR/Cas systems are found in a wide range of eubacteria and archaeal organisms. CRJSPR/Cas systems include type I, II, and III sub-types. Wild-type type H CRISPR/Cas systems utilize the RNA- mediated nuclease, Cas9 in complex with guide and activating RNA to recognize and cleave foreign nucleic acid. Cas9 homologs are found in a wide variety of eubacteria, including, but not limited to bacteria of the following taxonomic groups: Actinobacteria, Aquificae, Bacteroidetes- Chlorobi, Chlamydiae-Verrucomicrobia, Chlroflexi, Cvanobacteria, Firmicutes, Proteobacteria, Spirochaetes, and Thermotogae. An exemplary Cas9 protein is the Streptococcus pyogenes Cas9 protein. Additional non-limiting examples of Cas9 proteins and homologs thereof have been described in literature. In some embodiments, the RNA-guided nuclease is a Cpf1 nuclease or a Cas9 nuclease. [0127] Accordingly, in one aspect, a method can be provided using CRISPR/Cas9 or Cpf1 to introduce at least one of the promoter mutations described herein into a plant cell. In some embodiments, a method of altering a (e.g., native) nucleic acid encoding the miRNA in a plant is described. In some embodiments, the method can comprise introducing into the plant cell an engineered, non-naturally occurring Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR associated (Cas) (CRISPR-Cas) system as well as a guide nucleic acid (e.g., RNA) to introduce one or more alteration in an endogenous miRNA promoter. In some embodiments, the CRISPR-Cas system comprises one or more vectors comprising: (a) a first regulatory element operable in a plant cell operably linked to at least one nucleotide sequence encoding a CRISPR-Cas system guide RNA that hybridizes with the target sequence, and (b) a second regulatory element operable in a plant cell operably linked to a nucleotide sequence encoding a Type-II Cas9 or Cpf1 protein, wherein components (a) and (b) are located on the same or different vectors of the system, whereby the guide RNA targets the target sequence and the Cas9 protein cleaves the DNA molecule, whereby at least one of the promoter mutations described herein is introduced into the target nucleic acid.
[0128] The expression cassettes and constructs (e.g., expressing an miRNA as described herein) can be used to confer increased or enhanced pathogen resistance on essentially any plant. Thus, the methods have use over a broad range of plants, including species from the genera Asparagus, Atropa, Avena, Brassica, Citrus, Citrullus, Capsicum, Cucumis, Cucurbita, Daucus, Fragaria, Glycine, Gossypium, Helianthus, Heterocallis, Hordeum, Hyoscyamus, Lactuca, Linum, Lolium, Lycopersicon, Malus, Manihot, Majorana, Medicago, Nicotiana, Oryza, Panieum, Pannesetum, Persea, Pisum, Pyrus, Prunus, Raphanus, Secale, Senecio, Sinapis, Solanum, Sorghum, Trigonella, Triticum, Vitis, Vigna, and Zea. In some embodiments, the plant is a cotton plant. In some embodiments, the plant is an ornamental plant. In some embodiments, the plant is a vegetable- or fruit-producing plant. In some embodiments, the plant is a monocot. In some embodiments, the plant is a dicot.
[0129] Plants (or parts of plants) with increased pathogen resistance can be selected in many ways. The following methods are but a few of the possibilities. One method of selecting plants or parts of plants (e.g., fruits and vegetables) with increased pathogen resistance is to determine resistance of a plant to a specific plant pathogen. Possible pathogens include, but are not limited to, viruses, bacteria, nematodes, oomycetes, fungi or insects (see, e.g., Agrios, Plant Pathology (Academic Press, San Diego, CA) (1988)). Resistance responses of plants vary depending on many factors, including what pathogen, compound, or plant is used. Generally, increased resistance is measured by the reduction or elimination of disease symptoms (e.g., reduction in the number or size of lesions or reduction in the amount of pathogen biomass on the plant or a part of the plant) when compared to a control plant. In some embodiments, resistance is increased when the number or sizes of lesions or amount of pathogen biomass on the plant or on a part of the plant is decreased by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more relative to a control (e.g., relative to a plant in which a heterologous polynucleotide has not been expressed).
[0130] Increased pathogen resistance can also be determined by measuring the increased expression of a gene operably linked a defense related promoter. Measurement of such expression can be measured by quantifying the accumulation of RNA or subsequent protein product (e.g., using northern or western blot techniques, respectively (see, e.g., Sambrook et al. and Ausubel et al.).
EXAMPLES
Example 1
[0131] Plants have evolved complex immunity that must be defeated by pathogens to establish infection. The destructive eukaryotic pathogen Phytophthora encodes suppressors of RNA interference (RNAi), but it remains unknown whether they target a specific host RNAi pathway that confers resistance. Here, we show that Phytophthora infection of Arabidopsis plants leads to increased production of a diverse pool of secondary siRNAs. Instead of regulating endogenous genes, these siRNAs are found in extracellular vesicles and silence target genes in Phytophthora during natural infection. Introduction of a plant siRNA in Phytophthora leads to developmental deficiency and abolished virulence while Arabidopsis mutants defective in secondary siRNA biogenesis are hypersusceptible. Notably, we show that the Phytophthora RNAi suppressor PSR2 specifically inhibits secondary siRNA biogenesis in Arabidopsis and promotes infection. These findings reveal siRNAs as antimicrobial agents targeting eukaryotic pathogens and highlight a defense/counter-defense arms race centered on trans-kingdom gene silencing between hosts and pathogens. [0132] Here, we report that Phytophthora infection induces the production of a diverse pool of secondary siRNAs from specific transcripts in Arabidopsis. These siRNAs function as a collection of antimicrobial agents and silence target genes in Phytophthora during infection. As a counter-defense mechanism, PSR2 blocks this host-induced gene silencing by suppressing the biogenesis of specific secondary siRNAs. Thus, hosts and pathogens are engaged in an arms race centered on cross-kingdom RNAi-based immunity.
Results
Secondary siRNA pathway is required for Arabidopsis defense against Phytophthora
[0133] In Arabidopsis, RNA-dependent RNA polymerase 6 (RDR6) and Suppressor of Gene Silencing 3 (SGS3) are responsible for the synthesis of long dsRNA precursors from miRNA- targeted transcripts and thereby are key components of secondary siRNA production (Adenot et al., 2006; Peragine et al., 2004). Infection assays using Phytophthora capsici strain LT263, which does not have a PSR2 homolog, showed that rdr6 and sgs3 mutants are hypersusceptible, with the rdr6 mutant exhibiting the most severe disease symptoms (Figure 1A and 1B).
Similarly, a transgenic Arabidopsis line (PSR2-5) that constitutively expresses PSR2 under the CaMV 35S promoter (Qiao et al., 2013; Xiong et al., 2014) also showed enhanced susceptibility (Figure 1A and 1B). These results support a role of the secondary siRNA pathway in plant defense during Phytophthora infection.
PSR2 diminishes the accumulation of specific secondary siRNAs in Arabidopsis
[0134] A genome-wide small RNA profiling of PSR2-5 revealed a significant reduction in the 21-nucleotide population (Figure 1C), which is mainly composed of miRNAs and secondary siRNAs (Li et al., 2016). Further analysis of changes in individual 21-nucleotide sRNA classes revealed a moderate, 5%, reduction in the miRNA level; however, drastic decreases were observed in the abundances of secondary siRNAs generated from transcripts of TAS1a/b/c, TAS2, and several pentatricopeptide-repeat protein (PPR)-encoding gene loci (Figure 1D-1F). In contrast, siRNAs produced from RNA polymerase IV-dependent transcripts, the non-coding TAS3 transcripts, or transcripts of other loci, including transposable elements and protein-coding genes other than PPR, remained mostly unchanged (Figure 1D-1F). These results demonstrate a specific inhibitory effect of PSR2 on secondary siRNAs generated from PPR and TAS1/2 transcripts in Arabidopsis. [0135] The largest reduction (>90%) of sRNAs in PSR2-5 was observed from PPR-derived secondary siRNAs (Figure 1D and 1E). PPR represents a large gene family with approximately 450 members encoded in Arabidopsis (Schmitz-Linneweber and Small, 2008). The vast majority of PPR-siRNAs are produced from transcripts of fifteen PPR loci and PSR2 inhibits siRNA production from all of them (Table S1). Thirteen of siRNA-generating PPR transcripts contain target site(s) of microR161 (miR161), which is predicted to trigger sRNA production through the secondary siRNA pathway (Table S1). Another microRNA, miR173, can target TAS1/2 transcripts and trigger the production of trans-acting siRNAs (tasiRNAs) (Chen et al., 2007; Chen, 2009). Several of these TAS1/2-derived siRNAs have predicted targets sites in the siRNA- producing PPR transcripts and may also trigger siRNA production (Howell et al., 2007). Since TAS loci derived tasiRNAs exhibit an approximately 75% reduction in PSR2-5 plants (Figure 1D and 7A-D), the largely diminished PPR-derived siRNAs in PSR2-5 is likely attributed to inhibition of both miR161- and miR173-triggered siRNA production.
miR161 and PPR-siRNAs are induced during Phytophthora infection
[0136] In order to investigate a potential contribution of miR161 and miR173 in plant defense, we conducted quantitative RT-PCR analysis to examine the primary transcript levels of their corresponding MIR genes during P. capsici infection. We detected an induction of pri-miR161 whereas the pri-miR173 level remained unchanged (Figure 7A). Consistently, northern blotting of mature miRNAs showed that miR161 accumulation was increased during P. capsici infection, especially at 6 and 24 hours post inoculation (hpi) (Figure 2A). A similar induction was also observed for miR393 (Figure 7B), which is known to be induced by microbial pathogens (e.g. bacterial flagella) and to contribute to plant basal defense (Navarro et al., 2006). In contrast to miR161 and miR393, the abundance of miR173 was unaltered, consistent with the unchanged pri-miR173 transcript levels determined by qRT-PCR (Figure 7A and 7B). We also quantified the levels of pri-miR390 transcripts and mature miR390, which is the trigger of secondary siRNAs produced from the non-coding TAS3 transcripts (Adenot et al., 2006; Axtell et al., 2006). Similar to miR173, miR390 was not induced during P. capsici infection (Figure 7A and 7B).
[0137] The induction of miR161 at 6 hpi suggested that P. capsici induces an immune response during the initial stages of infection in Arabidopsis. Plant immunity can be activated by “non-self” molecules called microbe-associated molecular patterns (MAMP) (Jones and Dangl, 2006). Perception of MAMPs requires pattern recognition receptors and co-receptors located on the plant cell surface (Boutrot and Zipfel, 2017). In Arabidopsis, the leucine-rich repeat receptor- like kinases BRASSINOSTEROID INSENSITIVE 1-ASSOCIATED KINASE 1 (BAK1) and SOMATIC-EMBRYOGENESIS RECEPTOR-LIKE KINASE 4 (SERK4) are required for the activation of plant immunity by functioning as co-receptors for multiple unrelated MAMPs (Chinchilla et al., 2009; Roux et al., 2011). The induction of miR161 or miR393 was abolished in bak1-5/serk4 plants inoculated with P. capsici (Figure 2B), indicating that the enhanced accumulation of miR161 is a plant defense response elicited upon perception of the
Phytophthora pathogen.
[0138] As a major trigger of siRNA production from PPR transcripts, increased levels of miR161 would be expected to enhance accumulation of PPR-derived secondary siRNAs (Addo- Quaye et al., 2008; Howell et al., 2007). Indeed, northern blotting showed that, similar to miR161, the levels of two representative secondary siRNAs (named PPR-siRNA-1 and PPR- siRNA-2; Figure 7C) were also increased during P. capsici infection at and after 6 hpi (Figure 2A). As a control, tasiRNAs dependent on miR173 did not exhibit differential accumulations in infected plants, consistent with the unchanged levels of their“trigger” miRNA during infection (Figure 7D).
miR161 contributes to Arabidopsis defense to P. capsici by triggering PPR-siRNA production
[0139] We next determined the contribution of miR161 to Arabidopsis defense against P. capsici. For this purpose, we generated transgenic lines that either over-express MIR161 (MIR161ox) or have the MIR161 knocked out (MIR161cri, Figure 8A and 8B) using
CRISPR/Cas9-based mutagenesis. Northern blotting confirmed increased accumulation of miR161 in independent MIR161ox lines or reduced accumulation in MIR161cri lines (Figure 2C). The MIR161ox plants showed enhanced resistance to P. capsici whereas the MIR161cri mutants exhibited hypersusceptibility (Figure 2C and 8C), suggesting a role of miR161 as a positive regulator of Arabidopsis defense. On the contrary, overexpression of miR173 or miR390 had no effect on Arabidopsis resistance to P. capsici (Figure 8D-8G).
[0140] Although the accumulation of PPR-siRNA-1 and PPR-siRNA-2 was decreased in MIR161cri lines (Figure 2C), it was not abolished, probably because PPR-siRNAs could also be triggered by miR173-dependent tasiRNAs. Indeed, in MIR173 knockout lines (MIR173cri, Figure 8H), the abundance of PPR-derived siRNAs was diminished (Figure 2D), likely due to the largely reduced tasiRNA levels (Figure 8I). Similar to the MIR161cri mutants, MIR173cri plants also showed enhanced susceptibility to P. capsici (Figure 2D and 8J). Note that PPR- derived siRNA levels in MIR173ox lines were similar to those in wild-type plants, although the corresponding tasiRNA levels were significantly increased (Figure 8D). This is in agreement with the previous results that the susceptibility of MIR173ox lines to P. capsici remained unchanged.
[0141] These results prompted us to examine the function of the PPR-derived siRNAs in plant immunity by analyzing individual mutants of eight PPR genes in a cluster on Arabidopsis chromosome 1, from which secondary siRNAs are abundantly produced in a miR161- and tasiRNA-dependent manner (Addo-Quaye et al., 2008; Howell et al., 2007). We acquired T- DNA insertion mutants, one for each PPR gene (Figure 9A), and confirmed that the
corresponding transcripts were largely reduced if not diminished (Figure 9B). Presumably, the low transcript levels would nearly abolish secondary siRNA production. Significantly, four of these eight mutants showed increased susceptibility to P. capsici (Figure 2E and 9C), providing further evidence supporting that PPR-derived siRNAs contribute to plant immunity.
PPR-siRNAs target Phytophthora transcripts to confer resistance
[0142] In plants, secondary siRNAs are believed to amplify miRNA-mediated gene silencing, specifically by miRNAs that potentially regulate large gene families (Adenot et al., 2006).
Arabidopsis encodes approximately 450 PPR genes (Barkan and Small, 2014) and it was proposed that siRNAs derived from a small number of PPR transcripts regulate a larger number of family members (Fei et al., 2013). We conducted RNA-seq analysis and compared transcriptome changes in PSR2-5 with wild-type Col-0. Two hundred and forty-nine genes were found to be up-regulated in PSR2-5 and 366 were down-regulated (Figure 10A and Table S2). However, only 11 of the up-regulated genes were predicted to have target site(s) of PPR-derived siRNAs (3922 siRNAs in total). This is surprising because 1326 Arabidopsis genes, including 134 PPR genes, were predicted as potential targets of this large pool of siRNAs (Table S3 as depicted in Hou, et al., A Phytophthora Effector Suppresses Trans-Kingdom RNAi to Promote Disease Susceptibility, 25(1) Cell Host & Microbe 153-165 (Jan.9, 2019)). Furthermore, among the 11 up-regulated genes that could also be targeted by PPR-siRNAs, only two have PPR motifs (Figure 10B). These results indicate that the primary targets of the PPR-derived siRNA population are not Arabidopsis PPR genes.
[0143] Gene silencing in eukaryotic pathogens by plant hosts have been observed. The first example of this host-induced gene silencing (HIGS) during natural infection was reported in cotton, where two miRNAs regulate virulence-related genes in the fungal pathogen Verticillium dahlia (Zhang et al., 2016). Furthermore, transgenic plants expressing artificial RNAi-inducing dsRNAs can trigger specific gene silencing in fungal and Phytophthora pathogens, as well as other parasites (Baulcombe, 2015; Hua et al., 2017; Jahan et al., 2015). These observations indicate that host-produced sRNAs can function, in part, to silence pathogen genes. We thus tested whether the PPR-derived siRNAs may be used by Arabidopsis to target genes in P. capsici for silencing. A prediction of potential targets in P. capsici transcripts using 3922 distinct PPR- derived siRNA sequences revealed 437 siRNA-P. capsici transcript pairs (Figure 3A). These matched pairs correspond to 249 P. capsici genes as potential targets of PPR-siRNAs (Table S4).
[0144] To test whether some of the predicted targets could be silenced by the corresponding plant siRNAs, we directly introduced synthesized 21-bp small RNA duplexes into P. capsici, mimicking what may occur during natural infection (Figure 3A). For this purpose, we focused on a PPR-derived siRNA-1310 (hereafter siR1310), which is predicted to target the P. capsici gene Phyca_554980 (Figure 3B). Phyca_554980 is constitutively expressed in P. capsici (Chen et al., 2013). Encoding a U2-associated splicing factor, homologs of Phyca_554980 are also present in other Phytophthora species (Figure 10C), consistent with a conserved, housekeeping function. In addition to siR1310, Phyca_554980 is predicted to be regulated by six other PPR-siRNAs (Table S4), including siR0513 (Figure 3B). Taken together, these results indicate that Phyca_554980 might be an important target of PPR-siRNAs in Phytophthora.
[0145] Using a PEG-mediated transformation procedure, we incubated P. capsici protoplasts with the synthesized siR1310 duplex and a plasmid carrying a gene that confers resistance to the antibiotic G418. Transformants that gained G418 resistance potentially also took up the sRNAs. As a control, a 21-bp sRNA duplex designed to target a GFP gene was also synthesized and introduced into P. capsici. Seven of ten transformants potentially harboring siR1310 exhibited significantly reduced abundance of Phyca_554980 transcripts (Figure 3C and 11A). This silencing effect is specific as Phyca_554980 transcript levels were not affected in strains transformed with siRGFP (Figure 3C and 11A). We further confirmed the silencing specificity of siR1310 by examining the transcript levels of another P. capsici gene Phyca_538731, which was used as an“off-target” control. Phyca_538731 is predicted to be insufficient as a silencing target although it contains a sequence that partially matches siR1310 (Figure 11B). The transcript abundance of Phyca_538731 was not reduced in transformants harboring either siR1310 or siRGFP (Figure 3C).
[0146] Knowing that siR1310 can specifically silence target gene(s) in Phytophthora, we determined the consequence of the silencing event by analyzing the developmental phenotypes and virulence activities of the P. capsici transformants. Compared to a wild-type strain and the transformants harboring siRGFP, transformants harboring siR1310 exhibited a moderate decrease in mycelial growth (Figure 11C and 11D) and significant defects in sporangia development (Figure 3D) and zoospore release (Figure 11E). Importantly, introduction of siR1310 nearly abolished the ability of P. capsici to cause disease on Nicotiana benthamiana (Figure 3E). Because the leaves were inoculated with mycelia plugs, the drastically reduced virulence activity cannot be fully attributed to defects on sporulation of these transformants. These data indicate that PPR-derived siRNAs can specifically silence target gene(s) in P. capsici such as Phyca_554980, which is required for Phytophthora development and pathogenicity. As such, PPR-derived siRNAs may contribute to resistance to P. capsici.
PPR-siRNAs confer cross-kingdom gene silencing during Phytophthora infection
[0147] To explore whether PPR-derived siRNAs could be transported from host plants to Phytophthora, we examined their presence in extracellular vesicles (EVs). A role of EVs in plant immunity has been proposed as they accumulate around fungal haustoria (An et al., 2006a; An et al., 2006b; Micali et al., 2011), and have recently been shown to carry stress-response proteins (Rutter et al., 2017) and small RNAs (Cai et al., 2018). Using qRT-PCR, we were able to detect siR1310 in EVs isolated from wild-type Arabidopsis leaves (Figure 3F). The abundance of these siRNAs was significantly lower in EVs isolated from PSR2-5 leaves, consistent with an overall reduction of siR1310 in PSR2-5. Furthermore, P. capsici infection resulted in an increase of siR1310 abundance in EVs and this increase was abolished in PSR2-5 plants inoculated with P. capsici (Figure 3F). Similarly, siR0513, another PPR-siRNA that can target Phyca_554980, could also be detected in EVs (Figure 11F). These results suggest that PPR-siRNAs are cargos of EVs and could be transported to silence target gene(s) in Phytophthora.
[0148] We next examined whether cross-kingdom gene silencing by PPR-siRNAs occurs during natural infection by monitoring the expression profiles of Phyca_554980 when wild-type P. capsici was used to inoculate wild-type Arabidopsis, PSR2-5, rdr6 or the MIR161ox-3 plants. The transcript abundances of Phyca_554980 were determined at one day post inoculation (dpi). We observed that Phyca_554980 exhibited increased expression levels when P. capsici was used to infect PSR2-5 or rdr6 plants (Figure 3G), which have decreased accumulation of PPR-siRNAs compared to wild-type plants. In contrast, Phyca_554980 transcript level was decreased when P. capsici was used to infect MIR161ox-3 plants (Figure 3G), which, at least in part, could be due to the enhanced silencing effect by an increased level of PPR-derived siRNAs. These results suggest that Phyca_554980 expression in P. capsici is manipulated by host sRNAs during infection, potentially through the function of PPR-siRNAs in EVs such as siR1310 and siR0513.
[0149] Since Phyca_554980 plays an important role in the development and virulence activity of P. capsici, its expression could be affected by multiple factors in addition to host siRNAs. To further demonstrate that cross-kingdom gene silencing occurs during natural infection, we generated P. capsici strains carrying a reporter to monitor the silencing effect of siR1310. A siR1310 target site (t) and a mutant version (mt) were incorporated into the 5' UTR sequence of an mRFP gene to generate t-mRFP and mt-mRFP, respectively (Figure 4A). These constructs were then introduced into P. capsici. Transformants with stable RFP expression were monitored for mRFP transcript levels during the infection of wild-type, MIR161ox, and MIR161cri plants, which accumulate different levels of siR1310 (Figure 11G). P. capsici carrying t-mRFP showed higher fluorescence intensities in hyphae when infecting MIR161cri-8 plants compared to wild- type plants, whereas the lowest fluorescence signals were observed in hyphae infecting the MIR161ox plants (Figure 4B and 4C). In contrast, a strain carrying mt-mRFP did not show observable differences in fluorescence intensities from hyphae infecting these lines (Figure 4B and 4C). A similar conclusion was made by quantifying the transcript levels of mRFP by qRT- PCR (Figure 4D). Collectively, these results support direct gene silencing by siR1310, and possibly other PPR-derived siRNAs produced by Arabidopsis, in P. capsici during natural infection as an antimicrobial mechanism. PSR2 interferes with secondary siRNA production by associating with DRB4
[0150] We next investigated the molecular basis underlying PSR2-mediated suppression of secondary siRNA accumulation in Arabidopsis by characterizing PSR2-interacting proteins. Using Yeast two-hybrid screening of an Arabidopsis cDNA library, we identified candidates that may associate with PSR2 in plant cells (Table S5). Among them, we were particularly interested in Double stranded RNA-binding protein 4 (DRB4), which has a known function in secondary siRNA biogenesis. DRB4 binds to dsRNA precursors through two double stranded RNA-binding domains (dsRBM1 and dsRBM2) and associates with Dicer-like 4 (DCL4), which processes the dsRNA substrates (Adenot et al., 2006; Fukudome et al., 2011). Co-immunoprecipitation of PSR2 with DRB4 after expressing both proteins in N. benthamiana confirmed their interaction in plant cells (Figure 5A and 5B). Furthermore, the two dsRBM domains of DRB4 are required for its interaction with PSR2.
[0151] PSR2 protein has a modular architecture, containing seven imperfect tandem repeats (Ye and Ma, 2016). Repeats 2-7 each includes three conserved motifs, which were named“L”, “W”, and“Y” after a conserved amino acid residue in their respective sequences (Jiang et al., 2008; Ye and Ma, 2016). Repeat 1 lacks an“L” motif, but contains the“W” and the“Y” motifs (Figure 5A). Analysis of truncated mutants of PSR2 revealed that the first (WY1) and the second (LWY2) repeat units are required for interaction with DRB4 (Figure 5C). Consistent with this observation, the mutants PSR2DWY1 and PSR2DLWY2 lost the ability to suppress transgene silencing (Figure 5D and 12A) or promote Phytophthora infection in N. benthamiana (Figure 5E and 12B). In addition, a fragment of PSR2 (55-215 aa), which spans WY1 and LWY2, is sufficient for association with DRB4 (Figure 5C). This fragment is also sufficient, although with an activity slightly weaker than full-length PSR2, to suppress transgene silencing (Figure 5D and 12A) and promote Phytophthora infection (Figure 5E and 12B). These results form a strong link between DRB4 interaction and the virulence function of PSR2.
[0152] Next, we explored how PSR2 may affect secondary siRNA biogenesis through the interaction with DRB4. We first examined whether PSR2 could interfere with the dicing of dsRNA substrates. Long dsRNAs (510 bp in length, corresponding to GFP sequence) were synthesized in vitro, labeled with 32P, and then incubated with crude protein extracts of leaf tissues collected from wild-type, PSR2-5, or drb4 plants. Cleavage products of sRNAs with 20- 25 nt in size were then detected by autoradiography. Extracts from both drb4 and PSR2-5 plants showed reduced production of sRNAs, suggesting that PSR2 interferes with the dicing process (Figure 5F). We further examined whether PSR2 can bind dsRNAs in plant cells. YFP-PSR2 and DRB4-YFP were expressed independently in N. benthamiana and then pulled down using resins conjugated with an anti-GFP antibody. The protein-bound resins were incubated with the in vitro synthesized 510-bp dsRNAs and those bound to the immunoprecipitated proteins were detected. Our results show that both PSR2 and DRB4 associates with dsRNAs (Figure 12C). This might be due to a direct binding of PSR2 with dsRNAs, which may lead to competition with DRB4 for binding to dsRNA precursors. Or, it is also possible that PSR2 indirectly binds to dsRNAs by associating with the dicing complex and interferes with the processing of the dsRNA substrates. drb4 phenocopies PSR2-5 plants
[0153] To further demonstrate that DRB4 is a virulence target of PSR2, we examined the development and disease susceptibility phenotypes of an Arabidopsis drb4 mutant. Similar to PSR2-5, drb4 is hypersusceptible to P. capsici (Figure 6A and 12D). In addition, both PSR2-5 and drb4 exhibit a subtle developmental phenotype, i.e. narrow and curly leaves (Figure 6B). A similar, but more profound, leaf phenotype has been reported in rdr6 (Peragine et al., 2004), indicating that it is likely associated with secondary siRNA production. Genome-wide sRNA profiling analysis further confirmed that as all siRNA-producing PPR loci were affected by RDR6 and PSR2, most of them were also affected by DRB4 (Figure 6C). On the contrary, siRNAs produced from transcripts encoding nucleotide-binding site leucine-rich repeat proteins (NB-LRR) were unaffected in either PSR2-5 or drb4 plants although their production is fully dependent on RDR6 (Table S6). Encoding canonical disease resistance proteins, NB-LRRs constitute another large gene family that can produce secondary siRNAs (Zhai et al., 2011). The observation that PSR2 does not have a major impact on NB-LRR-derived siRNAs is intriguing because reduced abundance of these siRNAs may lead to increased expression of disease resistance genes that could be detrimental to the pathogen. Although it remains to be determined how PSR2 and DRB4 specifically affects PPR-derived but not NB-LRR-derived siRNAs, these results support DRB4 as a virulence target of PSR2 in Arabidopsis. Discussion
[0154] Here, we show that siRNAs derived from endogenous plant transcripts target mRNAs of a eukaryotic pathogen in trans. Consistent with their importance as an antimicrobial strategy, the biogenesis of secondary siRNAs is specifically suppressed by the Phytophthora effector PSR2. RNAi-based immunity thus represents an important battleground in the evolution of host- pathogen interactions.
[0155] Host-derived sRNAs have been found to facilitate plant defense to fungal pathogens. Two miRNAs were shown to be exported from cotton and to reduce the virulence of Verticillium dahlia (Zhang et al., 2016). Furthermore, plant EVs were recently reported to mediate the transportation of host sRNAs that can target virulence genes of another fungal pathogen Botrytis cinerea (Cai et al., 2018). In this study, we show secondary siRNAs are important executors of host-induced gene silencing in an oomycete pathogen, which is evolutionarily very distant from fungi (Kamoun et al., 2015). Perception of P. capsici by Arabidopsis induces a transcriptional induction of the trigger miRNA, miR161, which subsequently results in increased production and accumulation of secondary siRNAs derived from specific PPR transcripts. The diverse PPR- siRNA pool includes numerous sequences, some of which can directly silence transcripts in P. capsici. Interestingly, miR161 can also be induced by bacterial flagellin (Li et al., 2010), indicating that the production of secondary siRNAs is a general immune response triggered by a broad spectrum of pathogens. Indeed, 216 siRNA-target pairs representing 150 potential targets can be predicted from the fungal pathogen Verticillium dahliae (Table S4). It is therefore likely that PPR-derived siRNAs also target mRNAs in V. dahliae for silencing. Consistent with this notion, rdr6 mutants of Arabidopsis exhibit hypersusceptibility to V. dahlia as well as B. cinerea (Ellendorff et al., 2009; Cai et al., 2018).
[0156] Secondary siRNAs have been implicated in playing a role in host-parasite interactions. It was recently reported that miRNAs produced by the parasitic plant Cuscuta campestris triggered siRNA production in host plants and manipulated host gene expression (Shahid et al., 2018). In our study, secondary siRNAs produced by plant hosts function as antimicrobial agents. The abundance and sequence complexity of secondary siRNAs is much higher than their miRNA triggers, which provides advantages during a co-evolutionary arms race with the pathogens. During host-pathogen co-evolution, it would be expected that pathogen genes targeted by host sRNAs are under strong selection to diversify, which could abolish sequence complementarity and thus evade silencing. Because MIR genes must maintain a foldback structure in their primary transcripts for processing, they are constrained in how rapidly they can evolve, which would be expected to compromise their utility as direct antimicrobial agents. The induction of a diverse pool of secondary siRNAs upon pathogen perception facilitates co-evolution with sequence changes in the targeted pathogen genes. This is particularly robust when the siRNAs are generated from non-coding genes (such as TAS in Arabidopsis) or genes within large families (such as PPR). Production of secondary siRNA from PPR transcripts is prevalent in eudicots, suggesting an ancient and potentially essential function (Xia et al., 2013). Most eudicot species encode over 400 PPR genes in their genome (Barkan and Small, 2014), but only a small number produce siRNAs. These siRNA-producing PPRs constitute a monophyletic clade that is evolving rapidly, possibly driven by the arms race with pathogens (Dahan and Mireau, 2013). None of the PPR mutants in the secondary siRNA-generating cluster that we examined exhibit morphological defects in Arabidopsis, indicating that these genes may tolerate sequence changes.
[0157] The presence of PPR-siRNAs in EVs suggests a potential mechanism for trafficking of pathogen-targeting sRNAs from plant hosts to pathogens. EVs mediate intercellular transport of sRNAs in mammals (Meldolesi, 2018), and have been shown to transport sRNAs from parasitic nematodes into mammalian host cells, where they suppress host immune responses (Buck et al., 2014). Notably, nematode EVs were recently shown to be specifically enriched in secondary siRNAs (Chow et al., 2018). In addition, purified plant EVs have been shown to be taken up by fungal hyphae in culture (Regente et al, 2017; Cai et al, 2018), indicating they could deliver sRNAs to pathogens. Global analysis of sRNA composition in plant EVs shows that siRNAs are the major sRNA cargo in terms of abundance (Baldrich, Rutter, Innes and Meyers, unpublished data). These results, together, support secondary siRNAs as prominent executors for cross- kingdom silencing.
[0158] Host defense mechanisms and pathogen virulence strategies are linked. Successful pathogens must defeat host immunity in order to establish infection. By investigating the function of PSR2, we demonstrate that Phytophthora pathogens have evolved effectors to suppress siRNA-based immunity. PSR2 is a conserved effector in Phytophthora (Xiong et al., 2014), thus, suppression of secondary siRNA production is likely a common virulence strategy of Phytophthora and may also be employed by other fungal and oomycete pathogens that are potentially targeted by host-induced gene silencing.
[0159] Taken together, this work establishes a role for secondary siRNAs in plant immunity and sets the foundation for manipulating this particular pathway as a strategy to enhance broad- spectrum resistance to plant disease.
Materials and Methods
Plant Material and Growth Conditions
[0160] Arabidopsis thaliana ecotype Col-0 was used as wild-type and for generating transgenic lines. T-DNA insertion lines of AT1G62910 (SALK_152489), AT1G63130
(SAIL_119_G05), AT1G62930 (SAIL_18_E04), AT1G63080 (SALK_020638C), AT1G63400 (CS316928), AT1G63150 (SALK_152489), AT1G62590 (SALK_114012), and AT1G62914 (CS433098) were obtained from the Arabidopsis Biological Resource Center (ABRC). PSR2-5 are used from lab seeds stock. Arabidopsis and Nicotiana benthamiana plants were grown at 22±2°C with a 12 h light/12 h dark photoperiod.
Cloning and constructs
[0161] To construct miRNA overexpression lines in Arabidopsis, DNA sequences encoding the pri-miRNAs of miR161, miR173 and miR390 were amplified from cDNA of Arabidopsis Col-0 by PCR using gene-specific primers (listed in Table S7). The PCR products were inserted into pENTR/D-TOPO and subsequently pEG100 using Gateway cloning (Invitrogen) (Earley et al., 2006). To generate the knockout lines of miR161 and miR173, the Yao promoter-driven CRISPR/Cas9 system was utilized (Yan et al., 2015). The sgRNA cassettes were cloned into pCAMBIA1300-pYAO:Cas9 into the SpeI site. To construct an mRFP reporter containing the target site of siR1310, sequences corresponding to the sense and antisense strands of the siR1310 target site or mutated target site were synthesized and annealed respectively. The DNA fragments were then ligated with pTOR-mRFP into the EcoRI site.
Phytophthora capsici inoculation and phenotypic analysis
[0162] In most experiments, four-week-old Arabidopsis plants were inoculated with zoospore suspension (200-500 zoospores/mL) of P. capsici isolate LT263 as previously described (Hou and Ma, 2017). Disease symptoms were monitored three days after inoculation, and disease severity was evaluated as Mean DSI (Wang et al., 2013). Biomass of P. capsici was also determined by qPCR using P. capsici specific primers (listed in Table S7) (Silvar et al., 2005). For root infection, roots of two-week old seedlings, grown on MS medium (Murashige and Skoog agar containing 1% (wt/vol) sucrose) were dipped in a zoospores suspension (100 zoospores/mL) for five seconds as described (Wang et al., 2013). The seedlings were
immediately planted in soil and the disease symptoms were monitored at three days after inoculation. For inoculation of N. benthamiana, the abaxial sides of detached leaves were inoculated with fresh mycelial plugs (0.5 cm). Leaves were kept in sealed 0.8% water agar plates in the dark at 25°C. Lesions were observed under UV light three days after inoculation. Sizes of the lesion areas were analyzed using imageJ (imagej.net).
Isolation of extracellular vesicles (EVs)
[0163] For each biological replicate, EVs were isolated from the pooled apoplastic fluid of 36 five-week old Arabidopsis plants grown at 22±2°C with a 9 h light/15 h dark photoperiod following the protocol of Rutter et al. (2017), including fractionation on an iodixanol density gradient (OptiPrep, Sigma Aldrich). Purified EVs were quantified using a ZetaView nanoparticle tracking analyzer from ParticleMetrix. Approximately 10 x 109 EVs from each replicate were used for RNA extraction.
RNA extraction, northern blotting and quantitative real-time PCR
[0164] Total RNAs were extracted from Arabidopsis leaves and EVs with or without infection at different time points using TRIzol reagent (Invitrogen). Small RNA northern blotting was performed as described using 5 mg of total RNA extract (Pall and Hamilton, 2008). U6 was used as a loading control. The results were visualized using a Typhoon phosphorimager and quantified with ImageQuant TL (GE). Sequences of the oligonucleotide probes are listed in Table S7. For quantitative RT-PCR, three biological repeats were performed, and relative expression levels were calculated using the 2-△△Ct equation. Actin2 was used as the internal control. Gene-specific primers used for qRT-PCR are listed in Table S7. For Figure 11G, siRNA levels were quantified using stem-loop qRT-PCR as described in (Varkonyi-Gasic et al., 2007) starting with 1.0 µg total RNA from leaves. For Figures 3F and 11F, siRNA levels were quantified using the QuantiMir kit from System Biosciences (Mountain View, CA), starting with 2.0 µg total RNA from leaves, diluting the resulting cDNA 100 fold, and then using 2-4 µL of diluted cDNA for each 25 µL reaction. For both stem-loop and QuantiMir methods, the qRT-PCR step was performed using SYBR™ Green PCR Master Mix from Invitrogen and using U6 as an internal control.
Transformation of sRNAs into Phytophthora protoplasts
[0165] RNA oligonucleotides corresponding to siRGFP and siR1310 were synthesized and annealed to form siRNA duplex (listed in Table S7). A polyethylene glycol (PEG)-mediated protoplast transformation procedure was followed as described with modifications (Dou et al., 2008). Protoplasts of P. capsici isolate LT263 were prepared as described with a concentration of 2x104 protoplast per mL.25 mg of pTOR plasmid DNA and 8 mg of siRNA duplex were added into 1 mL of protoplast suspension for transformation (Blanco and Judelson, 2005; Varkonyi- Gasic et al., 2007). Transformants were recovered in pea medium and then selected on V8 agar plates supplemented with 50 mg /mL of G418. Transformants with G418 resistance were sub- cultured and analyzed for development and virulence activity. Mycelia from each transformant were collected for RNA extraction and gene expression analysis.
Microscopy of Phytophthora capsica during infection
[0166] Four-week-old Arabidopsis plants were inoculated with a zoospore suspension (200- 500 zoospores/mL) of P. capsici transformants expressing t-mRFP or mt-mRFP. Confocal images were captured at 2 dpi using a Leica SP5 confocal microscope under 40x lens. The average fluorescence strength of the entire hyphae in the images was estimated using Image J (http://imagej.nih.gov/ij/).
Co-immunoprecipitation assays of PSR2 and DRB4
[0167] 3xFlag-PSR2, DRB4-YFP and their derivatives were co-expressed in N. benthamiana using Agrobacterium-mediated infiltration. Total proteins were extracted using an IP buffer [10% (v/v) glycerol, 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM DTT, 1x protease inhibitor mixture (Roche), 1 mM PMSF, and 0.1% CA-630], and then incubated with either anti-Flag agarose (Sigma-Aldrich) or anti-GFP magnetic beads (Chromotek) at 4 ^C for one hour. The beads were washed for five times using the IP buffer, and PSR2 and DRB4 in the immune complexes were detected by western blotting using anti-Flag (Sigma Aldrich) or anti-GFP antibody (Clontech) respectively. Transgene silencing suppression assay using N. benthamiana 16c plants
[0168] PSR2 and its derivatives were cloned into the vector pEG100 and the recombinant plasmids were transformed into Agrobacterium tumefaciens strain GV3101. The bacteria were co-infiltrated into N. benthamiana 16c leaves together with Agrobacterium carrying 35S-GFP (Qiao et al., 2013). Green fluorescence was observed using a hand-held UV light at five days after Agro-infiltration. The protein levels of GFP were determined by western blotting using an anti-GFP antibody (Santa Cruz). The protein levels of PSR2 and its derivatives were examined by western blotting using an anti-PSR2 antisera generated in this study.
Double-stranded RNA binding and cleavage assays
[0169] Sense and antisense transcripts of green fluorescent protein (GFP) were synthesized from a plasmid template containing a partial GFP gene with 510-bp in length. In vitro transcription was conducted by incubating 0.1 mM plasmid DNA in a 50 mL reaction system with 0.5 mM of T7 RNA polymerase and 5 mM of NTP mix for 3 hours at 37ºC.2 U Turbo DNase (Ambion) was added to the reaction mixture at 37ºC for 15 minutes to remove the template DNA. Nucleotides and NTPs were also removed using Bio-Spin 6 columns (BioRad). Single- stranded RNAs were purified using acidic phenol/chloroform (Ambion), and precipitated using isopropanol (FisherChemical). RNA pellet was then dissolved in 30 mL RNase-free water. Equal amounts of the ssRNAs were annealed as described and used for further analyses (Fukudome et al., 2011). For protein-dsRNA binding assay, YFP-PSR2 and DRB4-YFP fusion proteins were transiently expressed in N. benthamiana and total proteins were extracted using the IP buffer containing 10% (vol/vol) glycerol, 50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 5 mM DTT, 1x protease inhibitor mixture (Roche), 1 mM PMSF, and 0.1% CA-630. Double-stranded RNA was removed by adding 7 mL of RNaseIII (NEB), 10 mL of 10x RNaseIII buffer and 10 mL of 10x MnCl2 to 1 mL of protein extract. Samples were then centrifuged at 12,000 rpm, 4 ^C for 15 min and the supernatant incubated with anti-GFP magnetic beads for two hours at 4 ^C (Chromotek). After washing beads, synthesized 510-bp dsRNAs were added to a final concentration of ~33 nM and incubated with the immune complexes at 4 ^C in a dsRNA-binding buffer containing 30 mM Tris-HCl (pH 7.0), 10 mM NaCl, 20 mM MgCl2, 0.1 mM EDTA, and 5 mM DTT for 30 minutes. The beads were washed with binding buffer to remove the unbounded dsRNA before the protein-bounded RNAs were extracted using Trizol/Chloroform (Ambion) and then analyzed on 2% Agarose gel with ethidium bromide staining. For the dsRNA cleavage assay, 510-bp dsRNAs synthesized as above were labeled with [ ^-32P] UTP as described (Fukudome et al., 2011). Crude protein extracts from 0.5 g leaves of four-week-old wild-type, drb4 and PSR2-5 Arabidopsis plants were extracted using an extraction buffer containing 20 mM Tris-HCl (pH 7.5), 4 mM MgCl2, 5 mM DTT, 1x protease inhibitor mixture (Roche) and 1 mM PMSF at 4 ^C. The 32P-labeled dsRNAs (final concentration of ~1 nM) were incubated with 30 mL of the cleavage buffer as described (Fukudome et al., 2011). One mL of RNaseOUT (Invitrogen) was added to each 40 mL reaction mixture. After incubation at 23 ^C for two hours, the cleavage products were purified by phenol/chloroform (Ambion), analyzed on 15% denaturing PAGE with 8 M urea, and detected by autoradiography.
RNA sequencing and data analysis
[0170] sRNA libraries were single-end sequenced on the Illumina HiSeq4000 platform with read lengths of 50 bases. Adapter sequences were trimmed from fastq reads using Cutadapt v1.4.1 (Martin, 2011), the remaining sequences in the size range of 18- to 28-nt were mapped to the Arabidopsis thaliana reference genome annotation (TAIR10) using Bowtie v1.0.1
(Langmead et al., 2009), allowing all alignments (-a) and zero mismatch (-v 0) per read. After removing the reads associated with t/r/sn/snoRNAs, the rest of the perfectly matched 18-28 nt sRNAs were used for further analysis. The sequences of mature miRNAs were from miRbase (version 21), and eight TAS loci: TAS1a, TAS1b, TAS1c, TAS2, TAS3, TAS3b, TAS3c and TAS4 for trans-acting siRNAs identification. The list of Pol IV-dependent siRNA loci (P4siRNAs) has been previously described (Zhai et al., 2015). Protein-coding gene-derived siRNAs (PC-siRNAs) and transposon element derived siRNAs (TE-siRNAs) were calculated using Araport11 annotation (Cheng et al., 2017), with 27,655 protein-coding regions and 3,901 TEs. For normalization, the abundances of sRNAs in each library were normalized to transcripts per million (TPM), excluding t/r/sn/snoRNA-derived sequences. The abundance of sRNAs from each locus was summed by hits-normalized-abundance of all mapped reads from that region. Loci with normalized TPM >10 in WT were further analyzed for abundance changes in PSR2-5 (Table S1).
[0171] RNA-seq libraries were analyzed using paired-end sequencing on the Illumina
HiSeq4000 platform with read lengths of 150 bases. Reads were mapped to the TAIR10 genome using HISAT2 v2-2.0.5 (Kim et al., 2015) allowing only one unique hit (-k 1) and length less than 5000 (-X 5000). PCR duplicates were further removed using SAMTools v1.4 (Li et al., 2009). FPKM (Fragments Per Kilobase of transcript per Million mapped reads) of each gene was calculated using StringTie v1.3.3b (Pertea et al., 2015), and edgeR (Robinson et al., 2010) was used to identify genes that were differentially expressed between PSR and WT replicates.
siRNA target prediction in Arabidopsis, Phytophthora capsici and Verticillium dahliae
[0172] 3922 distinct PPR-derived siRNA sequences were used for target prediction using the psRNATarget web server (http://plantgrn.noble.org/psRNATarget) (Dai and Zhao, 2011).
Default setting of Schema V1 was used. For target prediction in Arabidopsis,“Arabidopsis thaliana, transcript, JGI genomic project, Phytozome 12, 167_TAIR10” was chosen as the target file. For target prediction in P. capsici,“Phyca11_filtered_transcripts.fasta” was downloaded as the target file from JGI (https://genome.jgi.doe.gov/Phyca11/Phyca11.home.html). For target prediction in V. dahliae,“Verticillium dahliae v1.0” was downloaded as the target file from JGI (https://genome.jgi.doe.g 1 1 h e.html). Genes with expectation £2 were considered as potential ta
Figure imgf000048_0001
rgets o - er ve s RNAs.
Statistical data analysis
[0173] Data reported in this study were analyzed using JMP Pro v13.0 (SAS). To test for normal distribution of the collected data, normal quantile plots were inspected and Shapiro-Wilk goodness-of-fit tests were performed. To ensure that the variances are equal, the Levene's test was used. When comparing a test group to a control group, a two-tailed Student's t-test was used. The significance values are reported as follows: * = p < 0.05, ** = p < 0.01, and *** = p < 0.001. When comparing the means of multiple groups, a one-way ANOVA followed by Tukey's HSD post hoc test was performed. Significant differences between groups (p < 0.05) are denoted with different letters.
References
[0174] The following references were referred to in this disclosure:
1. Addo-Quaye, C., Eshoo, T.W., Bartel, D.P., and Axtell, M.J. (2008). Endogenous siRNA and miRNA targets identified by sequencing of the Arabidopsis degradome. Curr Biol 18, 758- 762. 2. Adenot, X., Elmayan, T., Lauressergues, D., Boutet, S., Bouche, N., Gasciolli, V., and Vaucheret, H. (2006). DRB4-dependent TAS3 trans-acting siRNAs control leaf morphology through AGO7. Curr Biol 16, 927-932.
3. An, Q., Ehlers, K., Kogel, K.H., van Bel, A.J., and Huckelhoven, R. (2006a). Multivesicular compartments proliferate in susceptible and resistant MLA12-barley leaves in response to infection by the biotrophic powdery mildew fungus. New Phytol 172, 563-576.
4. An, Q., Huckelhoven, R., Kogel, K.H., and van Bel, A.J. (2006b). Multivesicular bodies participate in a cell wall-associated defence response in barley leaves attacked by the pathogenic powdery mildew fungus. Cell Microbiol 8, 1009-1019.
5. Axtell, M.J., Jan, C., Rajagopalan, R., and Bartel, D.P. (2006). A two-hit trigger for siRNA biogenesis in plants. Cell 127, 565-577.
6. Axtell, M.J. (2013). Classification and Comparison of Small RNAs from Plants. Annu Rev Plant Biol, 64, 137-159.
7. Barkan, A., and Small, I. (2014). Pentatricopeptide repeat proteins in plants. Annu Rev Plant Biol 65, 415-442.
8. Baulcombe, D.C. (2015). VIGS, HIGS and FIGS: small RNA silencing in the interactions of viruses or filamentous organisms with their plant hosts. Curr Opin Plant Biol 26, 141-146. 9. Blanco, F.A., and Judelson, H.S. (2005). A bZIP transcription factor from Phytophthora interacts with a protein kinase and is required for zoospore motility and plant infection. Mol Microbiol 56, 638-648.
10. Borges, F., and Martienssen, R.A. (2015). The expanding world of small RNAs in plants. Nat Rev Mol Cell Biol 16, 727-741.
11. Boutrot, F., and Zipfel, C. (2017). Function, Discovery, and Exploitation of Plant Pattern Recognition Receptors for Broad-Spectrum Disease Resistance. Annu Rev Phytopathol 55, 257-286.
12. Bozkurt, T.O., Richardson, A., Dagdas, Y.F., Mongrand, S., Kamoun, S., and Raffaele, S.
(2014). The Plant Membrane-Associated REMORIN1.3 Accumulates in Discrete Perihaustorial Domains and Enhances Susceptibility to Phytophthora infestans. Plant Physiol 165, 1005-1018.
13. Buck, A.H., Coakley, G., Simbari, F., McSorley, H.J., Quintana, J.F., Le Bihan, T., Kumar, S., Abreu-Goodger, C., Lear, M., Harcus, Y., et al. (2014). Exosomes secreted by nematode parasites transfer small RNAs to mammalian cells and modulate innate immunity. Nat Commun 5, 5488.
14. Cai, Q., Qiao, L., Wang, M., He, B., Lin, F.M., Palmquist, J., Huang, S.D., and Jin, H.
(2018). Plants send small RNAs in extracellular vesicles to fungal pathogen to silence virulence genes. Science 360, 1126-1129.
15. Chen, H.M., Li, Y.H., and Wu, S.H. (2007). Bioinformatic prediction and experimental validation of a microRNA-directed tandem trans-acting siRNA cascade in Arabidopsis. Proc Natl Acad Sci U S A 104, 3318-3323.
16. Chen, X. (2009). Small RNAs and their roles in plant development. Annu Rev Cell Dev Biol 25, 21-44.
17. Chen, X.R., Xing, Y.P., Li, Y.P., Tong, Y.H., and Xu, J.Y. (2013). RNA-Seq reveals infection-related gene expression changes in Phytophthora capsici. PLoS One 8, e74588. 18. Cheng, C.Y., Krishnakumar, V., Chan, A.P., Thibaud-Nissen, F., Schobel, S., and Town, C.D. (2017). Araport11: a complete reannotation of the Arabidopsis thaliana reference genome. Plant J 89, 789-804.
19. Chinchilla, D., Shan, L., He, P., de Vries, S., and Kemmerling, B. (2009). One for all: the receptor-associated kinase BAK1. Trends Plant Sci 14, 535-541.
20. Dahan, J., and Mireau, H. (2013). The Rf and Rf-like PPR in higher plants, a fast-evolving subclass of PPR genes. RNA Biol 10, 1469-1476.
21. Dai, X., and Zhao, P.X. (2011). psRNATarget: a plant small RNA target analysis server.
Nucleic Acids Res 39, W155-159.
22. Ding, S.W. (2010). RNA-based antiviral immunity. Nat Rev Immunol 10, 632-644.
23. Dou, D., and Zhou, J.M. (2012). Phytopathogen effectors subverting host immunity: different foes, similar battleground. Cell Host Microbe 12, 484-495.
24. Dou, D., Kale, S.D., Wang, X., Chen, Y., Wang, Q., Jiang, R.H., Arredondo, F.D., Anderson, R.G., Thakur, P.B., McDowell, J.M., et al. (2008). Conserved C-terminal motifs required for avirulence and suppression of cell death by Phytophthora sojae effector Avr1b. Plant Cell 20, 1118-1133.
25. Earley, K.W., Haag, J.R., Pontes, O., Opper, K., Juehne, T., Song, K., and Pikaard, C.S.
(2006). Gateway-compatible vectors for plant functional genomics and proteomics. Plant J 45, 616-629. 26. Ellendorff, U., Fradin, E.F., de Jonge, R., and Thomma, B.P. (2009). RNA silencing is required for Arabidopsis defence against Verticillium wilt disease. J Exp Bot 60, 591-602. 27. Franklin Wang-Ngai Chow, G. K., Cesaré Ovando-Vázquez, Dominik R Laetsch, Jose Bermúdez-Barrientos, Julie Claycomb, Mark Blaxter, Cei Abreu-Goodger, Amy Buck.2018. An extracellular argonaute protein mediates export of repeat-associated small RNAs into vesicles in parasitic nematodes. BioRxiv. DOI: https://doi.org/10.1101/343772.
28. Fei, Q., Xia, R., and Meyers, B.C. (2013). Phased, secondary, small interfering RNAs in posttranscriptional regulatory networks. Plant Cell 25, 2400-2415.
29. Fukudome, A., Kanaya, A., Egami, M., Nakazawa, Y., Hiraguri, A., Moriyama, H., and Fukuhara, T. (2011). Specific requirement of DRB4, a dsRNA-binding protein, for the in vitro dsRNA-cleaving activity of Arabidopsis Dicer-like 4. RNA 17, 750-760.
30. Haas, B.J., Kamoun, S., Zody, M.C., Jiang, R.H., Handsaker, R.E., Cano, L.M., Grabherr, M., Kodira, C.D., Raffaele, S., Torto-Alalibo, T., et al. (2009). Genome sequence and analysis of the Irish potato famine pathogen Phytophthora infestans. Nature 461, 393-398. 31. Hou, Y., and Ma, W. (2017). Small RNA and mRNA Profiling of Arabidopsis in Response to Phytophthora Infection and PAMP Treatment. Methods Mol Biol 1578, 273-283.
32. Howell, M.D., Fahlgren, N., Chapman, E.J., Cumbie, J.S., Sullivan, C.M., Givan, S.A., Kasschau, K.D., and Carrington, J.C. (2007). Genome-wide analysis of the RNA- DEPENDENT RNA POLYMERASE6/DICER-LIKE4 pathway in Arabidopsis reveals dependency on miRNA- and tasiRNA-directed targeting. Plant Cell 19, 926-942.
33. Hua, C., Zhao, J.H., and Guo, H.S. (2017). Trans-kingdom RNA silencing in Plant-Fungal Pathogen Interactions. Mol Plant 11, 235-244.
34. Jahan, S.N., Asman, A.K., Corcoran, P., Fogelqvist, J., Vetukuri, R.R., and Dixelius, C.
(2015). Plant-mediated gene silencing restricts growth of the potato late blight pathogen Phytophthora infestans. J Exp Bot 66, 2785-2794.
35. Jiang, R.H., Tripathy, S., Govers, F., and Tyler, B.M. (2008). RXLR effector reservoir in two Phytophthora species is dominated by a single rapidly evolving superfamily with more than 700 members. Proc Natl Acad Sci U S A 105, 4874-4879.
36. Jones, J.D., and Dangl, J.L. (2006). The plant immune system. Nature 444, 323-329. 37. Kamoun, S., Furzer, O., Jones, J.D.G., Judelson, H.S., Ali, G.S., Dalio, R.J.D., Roy, S.G., Schena, L., Zambounis, A., Panabieres, F., et al. (2015). The Top 10 oomycete pathogens in molecular plant pathology. Mol Plant Pathol 16, 413-434.
38. Kim, D., Langmead, B., and Salzberg, S.L. (2015). HISAT: a fast spliced aligner with low memory requirements. Nat Methods 12, 357-360.
39. Lamour, K.H., Mudge, J., Gobena, D., Hurtado-Gonzales, O.P., Schmutz, J., Kuo, A., Miller, N.A., Rice, B.J., Raffaele, S., Cano, L.M., et al. (2012). Genome sequencing and mapping reveal loss of heterozygosity as a mechanism for rapid adaptation in the vegetable pathogen Phytophthora capsici. Mol Plant Microbe Interact 25, 1350-1360.
40. Langmead, B., Trapnell, C., Pop, M., and Salzberg, S.L. (2009). Ultrafast and memory- efficient alignment of short DNA sequences to the human genome. Genome Biol 10, R25. 41. Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G., Durbin, R., and Genome Project Data Processing, S. (2009). The Sequence Alignment/Map format and SAMtools. Bioinformatics 25, 2078-2079.
42. Li, S., Le, B., Ma, X., You, C., Yu, Y., Zhang, B., Liu, L., Gao, L., Shi, T., Zhao, Y., et al.
(2016). Biogenesis of phased siRNAs on membrane-bound polysomes in Arabidopsis. Elife 5, e22750.
43. Li, Y., Zhang, Q., Zhang, J., Wu, L., Qi, Y., and Zhou, J.M. (2010). Identification of microRNAs involved in pathogen-associated molecular pattern-triggered plant innate immunity. Plant Physiol 152, 2222-2231.
44. Macho, A.P., and Zipfel, C. (2014). Plant PRRs and the activation of innate immune signaling. Mol Cell 54, 263-272.
45. Martin, M. (2011). Cutadapt removes adapter sequences from high-throughput sequencing reads.201117.
46. Meldolesi, J. (2018). Exosomes and Ectosomes in Intercellular Communication. Curr Biol 28, R435-R444.
47. Micali, C.O., Neumann, U., Grunewald, D., Panstruga, R., and O'Connell, R. (2011).
Biogenesis of a specialized plant-fungal interface during host cell internalization of Golovinomyces orontii haustoria. Cell Microbiol 13, 210-226. 48. Navarro, L., Dunoyer, P., Jay, F., Arnold, B., Dharmasiri, N., Estelle, M., Voinnet, O., and Jones, J.D. (2006). A plant miRNA contributes to antibacterial resistance by repressing auxin signaling. Science 312, 436-439.
49. Pais, M., Win, J., Yoshida, K., Etherington, G.J., Cano, L.M., Raffaele, S., Banfield, M.J., Jones, A., Kamoun, S., and Saunders, D.G.O. (2013). From pathogen genomes to host plant processes: the power of plant parasitic oomycetes. Genome Biology 14, 211-220.
50. Pall, G.S., and Hamilton, A.J. (2008). Improved northern blot method for enhanced detection of small RNA. Nat Protoc 3, 1077-1084.
51. Peragine, A., Yoshikawa, M., Wu, G., Albrecht, H.L., and Poethig, R.S. (2004). SGS3 and SGS2/SDE1/RDR6 are required for juvenile development and the production of trans-acting siRNAs in Arabidopsis. Genes Dev 18, 2368-2379.
52. Pertea, M., Pertea, G.M., Antonescu, C.M., Chang, T.C., Mendell, J.T., and Salzberg, S.L.
(2015). StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. Nat Biotechnol 33, 290-295.
53. Petre B, Kamoun S (2014) How Do Filamentous Pathogens Deliver Effector Proteins into Plant Cells? PLoS Biol 12: e1001801.
54. Qiao, Y., Liu, L., Xiong, Q., Flores, C., Wong, J., Shi, J., Wang, X., Liu, X., Xiang, Q., Jiang, S., et al. (2013). Oomycete pathogens encode RNA silencing suppressors. Nat Genet 45, 330-333.
55. Regente, M., Pinedo, M., San Clemente, H., Balliau, T., Jamet, E., and de la Canal, L.2017.
Plant extracellular vesicles are incorporated by a fungal pathogen and inhibit its growth. J Exp Bot 68, 5485-5495.
56. Robinson, M.D., McCarthy, D.J., and Smyth, G.K. (2010). edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26, 139- 140.
57. Roux, M., Schwessinger, B., Albrecht, C., Chinchilla, D., Jones, A., Holton, N., Malinovsky, F.G., Tor, M., de Vries, S., and Zipfel, C. (2011). The Arabidopsis Leucine-Rich Repeat Receptor-Like Kinases BAK1/SERK3 and BKK1/SERK4 Are Required for Innate Immunity to Hemibiotrophic and Biotrophic Pathogens. Plant Cell 23, 2440-2455.
58. Rutter, B.D., and Innes, R.W. (2017). Extracellular Vesicles Isolated from the Leaf Apoplast Carry Stress-Response Proteins. Plant Physiol 173, 728-741. 59. Rutter, B. D., Rutter, K. L., and Innes, R. W. 2017. Isolation and quantification of plant extracellular vesicles. Bio-Protocol 7. DOI: 10.21769/BioProtoc.2533
60. Schmitz-Linneweber, C., and Small, I. (2008). Pentatricopeptide repeat proteins: a socket set for organelle gene expression. Trends Plant Sci 13, 663-670.
61. Shahid, S., Kim, G., Johnson, N.R., Wafula, E., Wang, F., Coruh, C., Bernal-Galeano, V., Phifer, T., dePamphilis, C.W., Westwood, J.H., et al. (2018). MicroRNAs from the parasitic plant Cuscuta campestris target host messenger RNAs. Nature 553, 82-85.
62. Silvar, C., Duncan, J.M., Cooke, D.E.L., Williams, N.A., Diaz, J., and Merino, F. (2005).
Development of specific PCR primers for identification and detection of Phytophthora capsici Leon. Eur J Plant Pathol 112, 43-52.
63. Tyler, B.M., Tripathy, S., Zhang, X., Dehal, P., Jiang, R.H., Aerts, A., Arredondo, F.D., Baxter, L., Bensasson, D., Beynon, J.L., et al. (2006). Phytophthora genome sequences uncover evolutionary origins and mechanisms of pathogenesis. Science 313, 1261-1266. 64. Varkonyi-Gasic, E., Wu, R., Wood, M., Walton, E.F., and Hellens, R.P. (2007). Protocol: a highly sensitive RT-PCR method for detection and quantification of microRNAs. Plant Methods 3, 12.
65. Wang, Y., Bouwmeester, K., van de Mortel, J.E., Shan, W., and Govers, F. (2013). A novel Arabidopsis-oomycete pathosystem: differential interactions with Phytophthora capsici reveal a role for camalexin, indole glucosinolates and salicylic acid in defence. Plant Cell Environ 36, 1192-1203.
66. Win, J., Chaparro-Garcia, A., Belhaj, K., Saunders, D.G., Yoshida, K., Dong, S., Schornack, S., Zipfel, C., Robatzek, S., Hogenhout, S.A., et al. (2012). Effector biology of plant- associated organisms: concepts and perspectives. Cold Spring Harb Symp Quant Biol 77, 235-247.
67. Xia, R., Meyers, B.C., Liu, Z., Beers, E.P., and Ye, S. (2013). MicroRNA superfamilies descended from miR390 and their roles in secondary small interfering RNA Biogenesis in Eudicots. Plant Cell 25, 1555-1572.
68. Xiong, Q., Ye, W., Choi, D., Wong, J., Qiao, Y., Tao, K., Wang, Y., and Ma, W. (2014).
Phytophthora suppressor of RNA silencing 2 is a conserved RxLR effector that promotes infection in soybean and Arabidopsis thaliana. Mol Plant Microbe Interact 27, 1379-1389. 69. Yan, L., Wei, S., Wu, Y., Hu, R., Li, H., Yang, W., and Xie, Q. (2015). High-Efficiency Genome Editing in Arabidopsis Using YAO Promoter-Driven CRISPR/Cas9 System. Mol Plant 8, 1820-1823.
70. Ye, W., and Ma, W. (2016). Filamentous pathogen effectors interfering with small RNA silencing in plant hosts. Curr Opin Microbiol 32, 1-6.
71. Zhai, J., Bischof, S., Wang, H., Feng, S., Lee, T.F., Teng, C., Chen, X., Park, S.Y., Liu, L., Gallego-Bartolome, J., et al. (2015). A One Precursor One siRNA Model for Pol IV- Dependent siRNA Biogenesis. Cell 163, 445-455.
72. Zhai, J., Jeong, D.H., De Paoli, E., Park, S., Rosen, B.D., Li, Y., Gonzalez, A.J., Yan, Z., Kitto, S.L., Grusak, M.A., et al. (2011). MicroRNAs as master regulators of the plant NB- LRR defense gene family via the production of phased, trans-acting siRNAs. Genes Dev 25, 2540-2553.
73. Zhang, T., Zhao, Y.L., Zhao, J.H., Wang, S., Jin, Y., Chen, Z.Q., Fang, Y.Y., Hua, C.L., Ding, S.W., and Guo, H.S. (2016). Cotton plants export microRNAs to inhibit virulence gene expression in a fungal pathogen. Nat Plants 2, 16153.
Supplementary Tables
Table S1. Normalized reads of 21-nt siRNAs produced from individual loci in wild-type (WT) and PSR2-5 Arabidopsis plants. Note: The normalized reads of sRNAs are presented by transcripts per million (TPM).
TPM of 21nt siRNA
Figure imgf000056_0001
TPM_of_21nt_sRNA_from_PPR_loci
Figure imgf000056_0002
Figure imgf000057_0001
Figure imgf000058_0001
Figure imgf000059_0001
Figure imgf000060_0001
Figure imgf000061_0001
Figure imgf000062_0001
Figure imgf000063_0001
Figure imgf000064_0001
Figure imgf000065_0001
Figure imgf000066_0001
Figure imgf000067_0001
Figure imgf000068_0001
Figure imgf000069_0001
Figure imgf000070_0001
20
09 07 15 14 14 05 10 22 18 07 12 09 10 57 06 05 17 07 81 29 11 11 71 06 05 20 08 09 15 09 17 13 20 22 05 05 09 05 07
Figure imgf000071_0001
10 AT1G11130 -1.01843 4.75776 42.78654 6.11E-11 1.27E-09 .
Figure imgf000072_0001
A
U G
G U G
U
71
Figure imgf000073_0001
4 9
61
72
Figure imgf000074_0001
73
Figure imgf000075_0001
74
Figure imgf000076_0001
75
Figure imgf000077_0001
76
Figure imgf000078_0001
U
A C C A A A G A C
U U C
G
77
Figure imgf000079_0001
6 3
19
78
Figure imgf000080_0001
79
Figure imgf000081_0001
80
Figure imgf000082_0001
81
Figure imgf000083_0001
7 2
28
82
Figure imgf000084_0001
A
G C U U A G A G A C
C A A
C
83
Figure imgf000085_0001
84
Figure imgf000086_0001
A
C C A C A U U U A C U G
C C G U
U 85
Figure imgf000087_0001
86
Figure imgf000088_0001
Figure imgf000089_0001
88
Figure imgf000090_0001
Figure imgf000091_0001
Figure imgf000092_0001
Figure imgf000093_0001
92
Figure imgf000094_0001
93
Figure imgf000095_0001
94
Figure imgf000096_0001
95
Figure imgf000097_0001
96
Figure imgf000098_0001
97
Figure imgf000099_0001
98
Figure imgf000100_0001
99
Figure imgf000101_0001
Table S5. Candidate Arabidopsis proteins identified from a yeast two-hybrid screening that may associate with PSR2.
Figure imgf000102_0001
03
1
Figure imgf000105_0001
Figure imgf000107_0001
Example 2
[0175] Nicotiana benthamiana plants producing antimicrobial siRNAs derived from an Arabidopsis thaliana mRNA show enhanced resistance to Phytophthora capsici
[0176] Leaves of Nicotiana benthamiana (a tobacco relative) were infiltrated with
Agrobacterium tumefaciens carrying one of the following constructs (see FIG.14):
1. atMIR161 (at1g48267, the gene encoding miR161 in Arabidopsis thaliana)
2. at1g62914m (a mutated at1g62914 gene containing a premature stop codon– see Figure 1 below for details. Without the mutation, this gene in the ecotype Col-0 of Arabidopsis thaliana is predicted to encode a PPR protein; with the mutation, at1g62914m no longer encodes a functional protein but can still be transcribed to mRNA, which carries the target site of miR161. Therefore, transcripts of at1g62914m are expected to serve as the precursor for secondary siRNA production if the same plant cell also produces miR161. This construct was used to eliminate the possible impact of At1g62914 protein on plant defense.)
3. atMIR161 + at1g62914m (a mixture of the constructs above)
[0177] Levels of at1g62914m-derived siRNAs were determined by quantitative RT-PCR. Two siRNAs (i.e. siR1310 and siR0513) that can silence a virulence-related gene in P. capsici were examined as representatives. The results show that leaves expressing both atMIR161 and at1g62914m produced a much higher amount of the siRNAs that can silence a virulence-related gene in Phytophthora capsici. See FIG.15.
[0178] Leaves of Nicotiana benthamiana that express atMIR161, at1g62914m, or
atMIR161+at1g62914m were inoculated with Phytophthora capsici strain LT263. Disease severity was evaluated at 3 days post inoculation. The results show that plants expressing atMIR161+at1g62914m exhibited much enhanced resistance to P. capsici. This experiment was repeated three times with similar results. Images of representative inoculated leaves (two per treatment) are shown below (Panel A, FIG.16). Lesion size of each inoculated leaf was measured and analyzed (Panel B, FIG.16). Please note that not all leaves expressed the same amount of atMIR161 and/or at1g62914m transcripts, hence the variation within the same treatment. [0179] All publications, patents and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference. Although the foregoing disclosure has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art in light of the teachings of this disclosure that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.

Claims

WHAT IS CLAIMED IS: 1. A transgenic plant engineered to heterologously express an miRNA comprising any one of SEQ ID NO: 1-19, wherein the transgenic plant has enhanced resistance to a pathogen compared to a control plant that does not heterologously express the miRNA.
2. The transgenic plant of claim 1, wherein the plant further heterologously expresses a pentatricopeptide repeat (PPR)-encoding transcript.
3. The transgenic plant of claim 2, wherein the PPR-encoding transcript contains a mutation such that the transcript does not express a function protein.
4. The transgenic plant of claim 2 or 3, wherein PPR-encoding transcript and the miRNA are from the same species of plant and are different from the transgenic plant species.
5. The transgenic plant of claim 1, wherein the transgenic plant comprises an expression cassette, the expression cassette comprising a promoter operably linked to a polynucleotide encoding the miRNA, wherein the promoter is heterologous to the
polynucleotide.
6. The transgenic plant of claim 5, wherein the promoter is a constitutive or tissue-specific or inducible promoter.
7. The transgenic plant of any one of claim 1-6, wherein the plant is a dicot plant.
8. The transgenic plant of claim 7, wherein the plant is a cotton plant.
9. The transgenic plant of any of claim 1-8, wherein the pathogen is one or more of a species of Phytophthora and/or Verticillium.
10. A method of making the transgenic plant of any of claims 1-9, comprising (i) modifying an endogenous promoter of the plant to heterologously express the miRNA or (ii) introducing the expression cassette into the plant.
11. The method of claim 10, further comprising selecting from a plurality of modified plants, one or more plant with enhanced resistance to the pathogen.
12. A method of inducing resistance in a plant to a pathogen, the method comprising,
contacting a plant with an miRNA comprising any of SEQ ID NO: 1-19 in an amount to induce resistance to a pathogen.
13. The method of claim 12, further comprising contacting the plant with a pentatricopeptide repeat (PPR)-encoding transcript.
14. The method of claim 13, wherein the PPR-encoding transcript contains a mutation such that the transcript does not express a function protein.
15. The method of claim 2 or 3, wherein PPR-encoding transcript and the miRNA are from the same species of plant and are different from the transgenic plant species.
16. The method of any one of claim 12-15, wherein the plant is a dicot plant.
17. The method of claim 16, wherein the plant is a cotton plant.
18. The method of any of claims 12-17, wherein the pathogen is one or more of a species of Phytophthora and/or Verticillium.
19. The method of any of claims 12-18, wherein the contacting comprising spraying aerial parts of the plant or contacting roots of the plant with the miRNA (and optionally the PPR-encoding transcript).
PCT/US2019/044971 2018-08-03 2019-08-02 Srnas that enhance plant resistance Ceased WO2020028850A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201862714342P 2018-08-03 2018-08-03
US62/714,342 2018-08-03

Publications (1)

Publication Number Publication Date
WO2020028850A1 true WO2020028850A1 (en) 2020-02-06

Family

ID=69232666

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2019/044971 Ceased WO2020028850A1 (en) 2018-08-03 2019-08-02 Srnas that enhance plant resistance

Country Status (1)

Country Link
WO (1) WO2020028850A1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111235164A (en) * 2020-03-30 2020-06-05 西北农林科技大学 Negative regulatory factor AtPPR1 gene of phytophthora resistance and homologous gene thereof
CN113151281A (en) * 2021-05-30 2021-07-23 中国农业大学 Plant expression vector for targeted silencing of phytophthora capsici cellulose synthase 3 and application thereof
CN116724888A (en) * 2023-05-25 2023-09-12 贵州师范大学 Method for rapidly inducing Alsophila spinulosa cluster buds
CN118581142A (en) * 2024-08-02 2024-09-03 内蒙古农业大学 Application of a long noncoding RNA gene StlncPDR-AS in potato disease resistance breeding

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160257969A1 (en) * 2005-01-07 2016-09-08 Oregon State University Method to trigger rna interference

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160257969A1 (en) * 2005-01-07 2016-09-08 Oregon State University Method to trigger rna interference

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
JEONG, DONG-HOON ET AL.: "Comprehensive Investigation of MicroRNAs Enhanced by Analysis of Sequence Variants, Expression Patterns, ARGONAUTE Loading, and Target Cleavage1[W][OA]", PLANT PHYSIOLOGY, vol. 162, no. 3, 24 May 2013 (2013-05-24), pages 1225 - 1245, XP055712936, DOI: 10.1104/pp.113.219873 *
XING ET AL.: "Genome-wide investigation of pentatricopeptide repeat gene family in poplar and their expression analysis in response to biotic and abiotic stresses", SCIENTIFIC REPORTS, vol. 8, no. 1, 2817, 18 February 2018 (2018-02-18), pages 1 - 9, XP055712945, DOI: 10.1038/s41598-018-21269-1 *
YAGI, Y. ET AL.: "The potential for manipulating RNA with pentatricopeptide repeat proteins", THE PLANT JOURNAL, vol. 78, no. 5, 7 November 2013 (2013-11-07), pages 772 - 782, XP055273334, DOI: 10.1111/tpj.12377 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111235164A (en) * 2020-03-30 2020-06-05 西北农林科技大学 Negative regulatory factor AtPPR1 gene of phytophthora resistance and homologous gene thereof
CN111235164B (en) * 2020-03-30 2022-06-28 西北农林科技大学 Application of AtPPR1 Gene and Its Homologous Gene, a Negative Regulator of Phytophthora Resistance
CN113151281A (en) * 2021-05-30 2021-07-23 中国农业大学 Plant expression vector for targeted silencing of phytophthora capsici cellulose synthase 3 and application thereof
CN116724888A (en) * 2023-05-25 2023-09-12 贵州师范大学 Method for rapidly inducing Alsophila spinulosa cluster buds
CN116724888B (en) * 2023-05-25 2024-04-16 贵州师范大学 A method for rapidly inducing clustered buds of Alsophila spinulosa
CN118581142A (en) * 2024-08-02 2024-09-03 内蒙古农业大学 Application of a long noncoding RNA gene StlncPDR-AS in potato disease resistance breeding

Similar Documents

Publication Publication Date Title
KR102871442B1 (en) Modifying the specificity of plant non-coding RNA molecules for silencing gene expression
Dunker et al. Oomycete small RNAs bind to the plant RNA-induced silencing complex for virulence
Hewezi et al. Arabidopsis miR827 mediates post‐transcriptional gene silencing of its ubiquitin E3 ligase target gene in the syncytium of the cyst nematode Heterodera schachtii to enhance susceptibility
Mao et al. Manipulating plant RNA-silencing pathways to improve the gene editing efficiency of CRISPR/Cas9 systems
Pflieger et al. Efficient virus‐induced gene silencing in Arabidopsis using a ‘one‐step’TYMV‐derived vector
Wang et al. ARGONAUTE 2 increases rice susceptibility to rice black‐streaked dwarf virus infection by epigenetically regulating HEXOKINASE 1 expression
EP3289089B1 (en) CONTROLLING FUNGAL PATHOGENS BY DISABLING THEIR SMALL RNA PATHWAYS USING RNAi-BASED STRATEGY
US11085051B2 (en) Controlling fungal pathogens by disabling their small RNA pathways using RNAi-based strategy
Lu et al. A high-throughput virus-induced gene-silencing vector for screening transcription factors in virus-induced plant defense response in orchid
US10119148B2 (en) RNAs from pathogens inhibit plant immunity
WO2020028850A1 (en) Srnas that enhance plant resistance
CN111032684A (en) Method for increasing grain productivity
Junhua et al. Osa-miR439 negatively regulates rice immunity against Magnaporthe oryzae
Niu et al. Deep sequencing uncovers rice long siRNAs and its involvement in immunity against Rhizoctonia solani
Xu et al. Transcriptome profiling reveals a petunia transcription factor, PhCOL4, contributing to antiviral RNA silencing
US8569578B1 (en) Generating transgenic potatoes with novel resistance to potato cyst nematodes by silencing nematode parasitism genes of CLE -1 and CLE-4s
Wu et al. Potentiation of host defense through sRNA packaged in OMVs of Xanthomonas oryzae pv. Oryzicola
US7189892B2 (en) Nucleic acids encoding phloem small RNA-binding proteins and transgenic plants comprising them
Bridgen Identification and characterisation of fip37-4 suppressor mutants in Arabidopsis thaliana
Florian et al. Oomycete small RNAs bind to the plant RNA-induced silencing complex for virulence
Wang et al. A specialized ARGONAUTE enables trans-species RNA interference in plant immunity
Ketehouli et al. Yonggang Zhou, Weican Liu, Xiaowei Li, Daqian Sun, Keheng Xu, Chen Feng, Idrice Carther Kue Foka
Zheng The miR159-GAMYB pathway: silencing and function of GAMYB homologues amongst diverse plant species
Mochama Dissecting RNA Silencing Pathways in Sclerotinia Sclerotiorum
Canto Pastor Small RNAs in Tomato: from defence to development

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19844010

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19844010

Country of ref document: EP

Kind code of ref document: A1