WO2019246013A1 - Peptides to enhance bone growth, repair and cell function - Google Patents

Peptides to enhance bone growth, repair and cell function Download PDF

Info

Publication number
WO2019246013A1
WO2019246013A1 PCT/US2019/037607 US2019037607W WO2019246013A1 WO 2019246013 A1 WO2019246013 A1 WO 2019246013A1 US 2019037607 W US2019037607 W US 2019037607W WO 2019246013 A1 WO2019246013 A1 WO 2019246013A1
Authority
WO
WIPO (PCT)
Prior art keywords
peptide
bone
subject
multimer
residues
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2019/037607
Other languages
French (fr)
Inventor
Paul C. Billings
Maurizio Pacifici
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Childrens Hospital of Philadelphia CHOP
Original Assignee
Childrens Hospital of Philadelphia CHOP
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Childrens Hospital of Philadelphia CHOP filed Critical Childrens Hospital of Philadelphia CHOP
Publication of WO2019246013A1 publication Critical patent/WO2019246013A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475Growth factors; Growth regulators
    • C07K14/50Fibroblast growth factor [FGF]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475Growth factors; Growth regulators
    • C07K14/51Bone morphogenetic factor; Osteogenins; Osteogenic factor; Bone-inducing factor
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the present disclosure relates to the fields of molecular biology and medicine. More particularly, it relates to the fields of musculoskeletal tissues including cartilage and bone physiology, bone disease and injury, cartilage and bone repair, bone implants and bone grafts. Specifically, it deals with recombinant peptides or protein fragments to enhance cartilage and bone formation, healing and regeneration.
  • the bone morphogenetic proteins are members of the transforming growth factor-b (TGF-b) superfamily and comprise an evolutionary diverse group of about 15 signaling proteins (Huminiecki et al, 2009; Massague, 1998; Wang et al, 2014).
  • the BMPs are initially synthesized as large precursor proteins while entering the secretory pathway, undergo proteolytic processing and glycosylation, and are secreted as active dimers (Constam & Robertson, 1999; Degnin et al, 2004; Sun & Davies, 1995).
  • the type II receptors are constitutively active, whereas the type I receptors contain a Gly/Ser-rich domain that is phosphorylated by a type II receptor within the complex to activate kinase activity.
  • These steps lead to recruitment of downstream canonical signaling effectors referred to as receptor-activated SMADs (SMAD1/5/8) that interact with SMAD4, translocate to the nucleus and modulate expression of target genes ((Shi and Massague, 2003; Heldin etal, 1997).
  • SMAD1/5/8 receptor-activated SMADs
  • These basic processes and steps are shared by all BMPs, but the proteins exert diverse functions and affect a large number of distinct developmental, homeostatic and pathological processes (Wang et al, 2014; Hogan, 1996; Salazar et al, 2016).
  • BMPs heparan sulfate
  • HS heparan sulfate
  • FGFs fibroblast growth factors
  • the domains reside immediately upstream of the first conserved cysteine and are thus near the N-terminus of the mature protein, and their sequences in human BMP2 and BMP4 are QAKHKQRKRLKSSC (SEQ ID NO: 6) and SPKHHSQRARKKKNKNC (SEQ ID NO: 7) respectively, with the first cysteine of the knot serving as a reference point (Rider & Mulloy, 2017).
  • QAKHKQRKRLKSSC SEQ ID NO: 6
  • SPKHHSQRARKKKNKNC SEQ ID NO: 7
  • an isolated peptide of no more than 50 residues comprises a sequence selected from the group consisting of GGGKVVLKNY QEMVVEGCGCR (SEQ ID NO: 1), GGGNVILKKYRNMVVRS CGCH (SEQ ID NO: 2) and GGGNVILKKYRNMVVRACGCH (SEQ ID NO: 3), or a multimer comprising at least two of the same or different peptides.
  • the peptide maybe no more than about 100 residues, no more than about 75 residues, no more than about 50 residues, no more than about 45 residues, no more than about 40 residues, no more than about 35 residues, no more than about 30 residues, no more than about 29 residues, no more than about 28 residues, no more than about 27 residues, no more than about 26 residues, no more than about 25 residues, no more than about 24 residues, no more than about 23 residues, no more than about 22 residues, or is 21 residues.
  • the multimer may be a dimer, trimer or tetramer comprising at least two peptides having SEQ ID NOS: 1, 2 and/or 3.
  • the multimer may be a homo-multimer or a hetero-multimer.
  • the multimer may comprise at least two peptides having SEQ ID NOS: 1, 2 and/or 3 linked to a carrier molecule, such as avidin (e.g ., deglycosylated avidin).
  • a carrier molecule such as avidin (e.g ., deglycosylated avidin).
  • the peptide or peptide multimer may be linked to a diagnostic or therapeutic label or agent.
  • the peptide or peptide multimer may comprise only L amino acids, only D amino acids, or a mixture of D and L amino acids.
  • the peptide dimer, trimer or multimer may further comprise domain or domains from another signaling and growth factor protein(s), including other BMP proteins (BMP2, BMP4) or members of protein families such as hedgehog and fibroblast growth factor proteins.
  • BMP2, BMP4 BMP proteins
  • Also provided is a method of increasing bone mass and/or volume and/or increasing cartilage mass and/or volume in a subject comprising (a) identifying a patient in need of increased bone mass and/or volume, and/or in need of increased cartilage mass and/or volume; and (b) administering to said subject an peptide or peptide multimer as described above.
  • the subject may be in need of increased bone mass and/or volume, and/or may be in need of increased cartilage mass and/or volume.
  • the peptide or peptide multimer may be administered to said subject systemically, such as intravenously, intra-articularly, intra-peritoneally, intramuscularly, subcutaneously or topically.
  • the peptide or peptide multimer may be administered to a bone and/or cartilage target site, such as injected at said site.
  • the peptide or peptide multimer may be comprised in a time-release device implanted at said site.
  • the peptide or peptide multimer may also be administered in combination with full-length BMP proteins, such as BMP2 (Infuse) and/or BMP7 (Osigraft).
  • BMP2 Infuse
  • BMP7 BMP7
  • the subject may be a human or a non-human animal.
  • the non-human animal may be a mouse, a rat, a rabbit, a dog, a cat, a horse, a monkey or a cow.
  • the subject may have cancer, or the subject may not have cancer.
  • the method may further comprise at least a second administration of said peptide or peptide multimer, including wherein said subject receives 1- 5 administrations per week, and/or wherein said subject receives at least 5 administrations.
  • the method may further comprise assessing bone and/or cartilage mass and/or volume following administration of said peptide or peptide multimer, such as by bone and/or cartilage imaging.
  • the subject may suffer from osteoporosis, bone fracture, spinal degeneration, alveolar/extraction socket defect, bone loss due to trauma, Paget’s Disease or congenital bone diseases, or from bone loss due to cancer metastasis.
  • the human subject may be a subject of 60 years or older.
  • the subject may be a human subject having a metabolic disease that impairs bone fracture repair.
  • a method of increasing bone and/or cartilage growth in a subject comprising administering to said subject a peptide or peptide multimer as defined above.
  • the subject may be in need of increased bone growth and/or in need of increased cartilage growth.
  • the subject may cancer, or may not have cancer.
  • the subject may be a human, such as a subject of 60 years or older, including a human subject having a metabolic disease that impairs bone fracture repair.
  • the subject may be a non-human animal.
  • the method may further comprise at least a second administration of said peptide or peptide multimer.
  • the subject may receive 1-5 administrations per week, such as wherein said subject receives at least 5 administrations.
  • the method may further comprises assessing bone and/or cartilage growth following administration of said peptide or peptide multimer, such as by bone and/or cartilage imaging.
  • the peptide or peptide multimer may also be administered in combination with full-length BMP proteins, such as BMP2 (Infuse) and/or BMP7 (Osigraft).
  • a method of increasing chondrogenesis and chondrocyte development in a subject comprising administering to said subject a peptide or peptide multimer as defined above;
  • a method of increasing chondrocyte maturation and hypertrophy in a subj ect comprising administering to said subject a peptide or peptide multimer as defined above;
  • a method of increasing osteogenesis and osteoblast development in a subject comprising administering to said subject a peptide or peptide multimer as defined above; a method of increasing bone and/or cartilage strength in a subject comprising administering to said subject a peptide or peptide multimer as defined above; or a method of repairing a bone and/or cartilage defect in a subject comprising administering to said subject a peptide or peptide multimer as defined above.
  • the subject may be a human subject having a metabolic disease that impairs bone fracture repair.
  • the peptide or peptide multimer may also be administered in combination with full- length BMP proteins, such as BMP2 (Infuse) and/or BMP7 (Osigraft).
  • a method of detecting the presence and/or location of heparan sulfate (HS) and/or heparan sulfate-rich proteoglycans (HSPGs) in a tissue or target site in a subject comprising contacting a tissue with or administering to a subject a peptide or peptide multimer as defined above, and detecting specific binding of said peptide or peptide multimer to said tissue or target site.
  • HS heparan sulfate
  • HSPGs heparan sulfate-rich proteoglycans
  • a method of targeting an agent to a cell or tissue containing heparan sulfate (HS) and/or heparan sulfate-rich proteoglycans (HSPGs) in subject comprising administering to said subject a peptide or peptide multimer as defined above, wherein said peptide or peptide multimer is conjugated to said agent.
  • the agent may be a therapeutic agent, such as an agent modulates bone and/or cartilage formation.
  • the agent may be a diagnostic agent, such as a fluorophore, a chromophore, or a spin label.
  • the peptide may be administered to the subject systemically, intravenously, intra- peritoneally, intramuscularly, subcutaneously or topically.
  • the peptide may be administered to a bone target site, including injection at the site.
  • the peptide also may be comprised in a time-release device implanted at the site, may be in a monomeric or oligomeric structure, and may be a single entity or a combination of peptides.
  • the non-human subject may be a human or a non-human animal, such as a mouse, a rat, a rabbit, a dog, a cat, a horse, a monkey or a cow.
  • the subject may have cancer, or may not.
  • compositions and kits of the invention can be used to achieve methods of the invention.
  • the term“about” is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects.
  • FIGS. 1A-B Sequence of N-terminal region is distinct in different BMPs.
  • FIG. 1A Amino acid alignment of the entire N-terminal region of BMP2, BMP4, BMP5, BMP6 and BMP7, using the first conserved cysteine in the cysteine knot as a reference point (shaded in gray). The basic amino acids Arg and Lys are bolded and underlined. Note that the predicted HS-binding domain in BMP2 and BMP4 lies directly upstream of the first cysteine, while the predicted site in BMP5, BMP6 and BMP7 is further upstream.
  • FIG. 1B Evolutionary N- terminal amino acid sequence alignment of the five BMPs from A tropicalis to H. sapiens. All five proteins are highly conserved. Predicted HS-binding domains are bolded and underlined.
  • FIGS. 2A-C Synthetic peptides from N-terminal and C-terminal regions.
  • FIG. 2A Amino acid sequences of the synthesized N-terminal peptides that span the predicted HS- binding domains of BMP2 to BMP7. Peptides were N-terminally linked to a biotin molecule via a triple glycine linker. Kd values (nM) and pi of synthetic peptides are shown, as well as the accession numbers for the full-length proteins from which the respective peptides were derived.
  • FIG. 2B Amino acid sequences of the synthesized C-terminal peptides spanning putative HS-binding domains of BMP4, BMP5 and BMP6/7. Note that the C-terminal regions of BMP6 and BMP7 are completely identical.
  • FIG. 2C Schematic of a representative BMP protein. The encoded and newly synthesized protein consists of a signal peptide (green), a prodomain (yellow) and the mature biologically-active ligand (blue). A furin cleavage site separates the prodomain from the mature ligand which contains seven conserved cysteines forming three intramolecular disulfide bonds and one intermolecular disulfide bond.
  • FIGS. 3A-C N-terminal peptides have diverse HS-binding properties compared to full-length proteins.
  • FIG. 3A N-terminal peptides from BMP2, BMP4, BMP5, BMP6 and BMP7 (designated as 2N, 4N, 5N, 6N and 7N, respectively) were each incubated on plates coated with immobilized HS. Binding was measured using NAHRP at an absorbance of 450nm. Note that the N-terminal peptides from BMP2 and BMP4 interacted with HS with saturation kinetics and high affinity (K d s ⁇ 1 OOnM). whereas those from BMP5, BMP6 and BMP7 did not. (FIG.
  • FIGS. 4A-C N-terminal tetrameric complexes display differential binding properties.
  • FIG. 4A Architecture of a schematic tetrameric complex assembled with NAHRP and biotinylated peptides. Each NAHRP molecule interacts with four peptide monomers to form a tetrameric binding complex.
  • FIG. 4B Solid phase binding assays of N-terminal peptide tetrameric complexes from BMP2 and BMP4 (designated 2N and 4N, respectively) to immobilized HS. Note that both peptide complexes bind to substrate-bound HS with saturable kinetics and are fully competed by soluble heparin (H).
  • FIG. 4C Binding assays of N-terminal peptide tetrameric complexes from BMP5, BMP6 and BMP7 (designated 5N, 6N and 7N) to substrate-bound HS. Note that all three complexes exhibit very poor binding. Each binding curve is representative of a minimum of 5 independent experiments.
  • FIGS. 5A-C C-terminal region of BMP5, BMP6 and BMP7 has high HS-binding affinity
  • FIG. 5 A Amino acid alignment of the C-terminal region of BMP2 and BMP4 versus BMP5, BMP6 and BMP7. Basic residues are bolded and underlined. Note that the region in BMP5, BMP6 and BMP7 contains a XBBXBX (SEQ ID NO: 4) sequence that fully matches a typical CW motif, while the corresponding region in BMP2 and BMP4 contains non conservative substitutions within Asn (N) and Gln (Q) replacing a Lys and an Arg.
  • FIG. 5B Solid phase binding assays of synthetic C-terminal peptides from BMP4, BMP5 and BMP6/7 (designated 4C, 5C and 6/7C) to substrate-bound HS.
  • the C-terminal sequences of BMP6 and BMP7 are identical. Note that while the BMP4 peptide failed to bind HS, the BMP5 and BMP6/7 peptides did bind.
  • FIG. 5C Solid phase binding assays of tetrameric C-terminal peptide complexes from BMP4, BMP5 and BMP6/7 to HS.
  • FIGS. 6A-I N-terminal region of BMP2 and BMP4 displays a continuous electropositive surface.
  • FIGS. 6A-C I-TASSER-based models of the N-terminal regions of BMP2, BMP4 and BMP5, spanning the predicted HS-binding motifs and designated as BMP2 N, BMP4 N and BMP5 N.
  • the N-terminal amino acid is designed by a blue dot and the C- terminal one by a red dot; the backbone is in black; and Lys and Arg residues are in purple and cyan, respectively. Note that all the regions display some degree of helical structure.
  • FIGS. 6D-F Helical wheel diagrams of the regions shown in FIGS. 6A-C.
  • FIGS. 6D-E The wheel diagrams for BMP2 and BMP4 reveal continuous positive charge on the surface of the helix (FIGS. 6D-E), while the BMP5 diagram presents with an unorganized and discontinuous arrangement of positive charge (FIG. 6F).
  • FIGS. 6G-I I-TASSER-based models of the C-terminal regions of BMP2, BMP4 and BMP5 spanning the putative HS-binding motifs and designated as BMP2 C, BMP4 C and BMP5 C. Symbols are as in FIGS. 6A-C. Note that the region in BMP2 and BMP4 contains negatively charged residues (Asp in orange and Glu in yellow) that are inconsistent with a typical HS-binding domain and that are absent in the BMP5 region.
  • FIGS. 7A-B The peptides are able to interact with the cell surface.
  • FIG. 7A Fluorescent N-terminal peptide tetramers from BMP2, BMP4 and BMP5 (designated 2N, 4N and 5N, respectively) were allowed to interact with K562 cells in vitro and binding was assessed by flow cytometry. Note that the 2N and 4N peptides vigorously interacted with the cell surface and were competed out by soluble heparin (Hep). However, the peptide from BMP5 produced minimal if any binding. The fluorescent NA backbone produced no signal on its own as did the cells (FIG. 7A, far left).
  • FIG. 7B Fluorescent C-terminal peptide tetramers from BMP4 and BMP5 (designated 4C and 5C, respectively) were allowed to interact with K562 cells in vitro, and binding levels were assessed as above. Note that the 5C peptide did bind to the cell surface and was competed out by soluble heparin, but the 4C peptide did not bind.
  • FIGS. 8A-K The HS-binding peptides stimulate chondrogenesis.
  • FIGS. 8A-F Day 3 mouse embryo limb bud cell micromass cultures stained with alcian blue on day 3 following treatment with: vehicle control (FIG. 8A); NA backbone (FIG. 8B); rhBMP2 (FIG. 8C); N-terminal BMP2 peptide tetramer designated 2N (FIG. 8D); N-terminal BMP4 peptide tetramer designated 4N (FIG. 8E); and C-terminal BMP5 peptide tetramer designated 5C (FIG. 8F).
  • FIGS. 8D-F the peptides stimulated chondrogenesis as indicated by an increase in alcian blue-positive nodules (FIGS. 8D-F) compared by controls (FIGS. 8A-B).
  • FIG. 8G Scater plots of levels of alcian blue staining in FIGS. 8A-F quantified by Image! Data confirm that treatment with peptides 2N, 4N or 5C or with rhBMP2 increased chondrogenesis over control levels (Con and NA).
  • FIGS. 8H-J Scater plots of expression levels of Sox9, Col2, and Aggrecan in day 3 limb bud cell cultures treated with peptide tetramers or left untreated (Con).
  • FIG. 8K Scater plots of ID1 expression in AD293 cells after treatment with vehicle (Con), NA backbone (NA) or tetrameric 2N, 4N or 5C peptides. Each peptide stimulated ID1 expression with respect to controls. Data are averages of five independent experiments. *P ⁇ 0.05; **R ⁇ 0.01; ***P ⁇ 0.00l.
  • FIGS. 9A-B The peptides compete with respective BMPs for HS binding.
  • FIG. 9A Competition binding assays in which rhBMP2 (4 mM) was co-incubated with increasing concentrations of monomeric 2N, 4N, 5N or 5C peptides and tested for binding to substrate- bound HS. Note that both the 2N and 4N peptides competed with rhBMP2 binding to HS (blue and black lines), while both 5N and 5C peptides had minimal effects (red lines).
  • FIG. 9A Competition binding assays in which rhBMP2 (4 mM) was co-incubated with increasing concentrations of monomeric 2N, 4N, 5N or 5C peptides and tested for binding to substrate- bound HS. Note that both the 2N and 4N peptides competed with rhBMP2 binding to HS (blue and black lines), while both 5N and 5C peptides had minimal effects (red lines).
  • FIG. 10 Structures of full-length BMP2, 4 and 5. Secondary structure predications used the structural information of BMP2 and BMP7 (PDB #3BMP and 1BMP) and were carried out using the I-TASSER server for protein structure and function prediction (Yang et al, 2014) and resulting structures were visualized using Chimera (world- wide-web at cgl.ucsf.edu/chimera). The N- and C- termini are delineated by blue and red dots, respectively.
  • FIGS. 11A-B Alcian blue staining of day 3 limb bud cells from Ell mouse embryos. Cells treated with full length recombinant human BMP2, 4, and 5 proteins.
  • FIG. 12. Sequence alignment of BMP2, 4, 5, 6 and 7 spanning humans to frogs. Note that all BMPs are >90% conserved.
  • FIG. 13. Effect of BMP2 and Peptide on ID1 expression.
  • Ad 239 cells were seeded in 6 well plates (2.5 x 10 5 cells/well) and 24 hr later, treated with BMP2 and/or peptide for 3 hr.
  • RNA was isolated, cDNA was prepared and ID1 (a BMP early response gene) and GAPDH expression was determined by qPCR.
  • FIG. 14 Effect of BMP2 and Peptide on Chondrogenic differentiation.
  • Micromass cultures were prepared from El 1 CD-l mouse embryo limb buds. Limb bud mesenchyme was dissociated in 0.5% trypsin-EDTA at 37°C. The dissociated cells were suspended at a concentration of 10 x 10 6 cells/ml in DMEM + 3% FCS.
  • Micromass cultures were initiated by spotting 15 pl of cell suspensions (1.5 x 10 5 cells) onto the surface of l2-well tissue culture plates. After 24 hr, cultures were treated with rhBMP2 and/or peptide. Cultures were stained with Alcian blue (pH 1.0) after 6 days to monitor chondrogenic cell differentiation. Images were quantitated with Image J. (*P ⁇ 0.05, ***P ⁇ 0.001, **** p ⁇ 0.0001).
  • Bone morphogenetic proteins are a group of growth factors also known as cytokines and as metabologens. Originally discovered by their ability to induce the formation of bone and cartilage, BMPs are now considered to constitute a group of pivotal morphogenetic signals, orchestrating tissue architecture throughout the body. The important functioning of BMP signals in physiology is emphasized by the multitude of roles for dysregulated BMP signalling in pathological processes. Cancerous disease often involves misregulation of the BMP signalling system.
  • BMP signalling Absence of BMP signalling is, for instance, an important factor in the progression of colon cancer, and conversely, overactivation of BMP signalling following reflux-induced esophagitis provokes Barrett's esophagus and is thus instrumental in the development of adenocarcinoma in the proximal portion of the gastrointestinal tract.
  • Recombinant human BMPs rhBMPs
  • rhBMP-2 and rhBMP-7 are Food and Drug Administration (FDA)-approved for some uses.
  • FDA Food and Drug Administration
  • BMPs for clinical use are produced using recombinant DNA technology (recombinant human BMPs; rhBMPs). rhBMPs are used in oral surgeries. BMP-7 has also recently found use in the treatment of chronic kidney disease (CKD). BMP-7 has been shown in murine animal models to reverse the loss of glomeruli due to sclerosis. Curis has been in the forefront of developing BMP-7 for this use. In 2002, Curis licensed BMP-7 to Ortho Biotech Products, a subsidiary of Johnson & Johnson.
  • CKD chronic kidney disease
  • rhBMP-2 and rhBMP-7 are used in the treatment of a variety of bone-related conditions including spinal fusions and non-unions, the risks of this off-label treatment are not understood. While rhBMPs are approved for specific applications (spinal lumbar fusions with an anterior approach and tibia nonunions), up to 85% of all BMP usage is off-label. rhBMP-2 is used extensively in other lumbar spinal fusion techniques (e.g., using a posterior approach, anterior or posterior cervical fusions).
  • rhBMP-7 (a.k.a. OP-l; Stryker Biotech) for a humanitarian device exemption as an alternative to autograft in long bone nonunions.
  • the humanitarian device exemption was extended as an alternative to autograft for posterolateral fusion.
  • rhBMP-2 (Infuse; Medtronic) was approved for anterior lumbar interbody fusions (ALIFs) with a lumbar fusion device.
  • ALIFs anterior lumbar interbody fusions
  • BMPs are delivered to the site of the fracture by being incorporated into a bone implant, and released gradually to allow bone formation, as the growth stimulation by BMPs must be localized and sustained for some weeks.
  • the BMPs are eluted through a purified collagen matrix which is implanted in the site of the fracture.
  • rhBMP-2 helps grow bone better than any other rhBMP so it is much more widely used clinically. There is “little debate or controversy" about the effectiveness of rhBMP-2 to grow bone to achieve spinal fusions, and Medtronic generates $700 million in annual sales from their product. D. Contraindications
  • BMPs interact with specific receptors on the cell surface, referred to as bone morphogenetic protein receptors (BMPRs).
  • BMPRs bone morphogenetic protein receptors
  • BMPRs Signal transduction through BMPRs results in mobilization of members of the SMAD family of proteins.
  • the signaling pathways involving BMPs, BMPRs and SMADs are important in the development of the heart, central nervous system, and cartilage, as well as post-natal bone development.
  • BMP4 and its inhibitors noggin and chordin help regulate polarity of the embryo (i.e.. back to front patterning).
  • BMP -4 and its inhibitors play a major role in neurulation and the development of the neural plate.
  • BMP -4 signals ectoderm cells to develop into skin cells, but the secretion of inhibitors by the underlying mesoderm blocks the action of BMP -4 to allow the ectoderm to continue on its normal course of neural cell development.
  • BMP signaling regulates a variety of embryonic patterning during fetal and embryonic development.
  • BMP signaling controls the early formation of the Mullerian duct (MD) which is a tubular structure in early embryonic developmental stage and eventually becomes female reproductive tracts.
  • MD Mullerian duct
  • Chemical inhibiting BMP signals in chicken embryo caused a disruption of MD invagination and blocked the epithelial thickening of the MD-forming region, indicating that the BMP signals play a role in early MD development.
  • BMP signaling is involved in the formation of foregut and hindgut, intestinal villus patterning, and endocardial differentiation.
  • Villi contribute to increase the effective absorption of nutrients by extending the surface area in small intestine.
  • Gain or lose function of BMP signaling altered the patterning of clusters and emergence of villi in mouse intestinal model.
  • BMP signal derived from myocardium is also involved in endocardial differentiation during heart development.
  • Inhibited BMP signal in zebrafish embryonic model caused strong reduction of endocardial differentiation, but only had little effect in myocardial development.
  • Notch-Wnt- Bmp crosstalk is required for radial patterning during mouse cochlea development via antagonizing manner.
  • BMP2 Bacillus subtilis factor 2
  • BMP7 a metalloprotease. Since then, thirteen more BMPs have been discovered, bringing the total to twenty.
  • BMP1 does not belong to the TGF-b family of proteins. It is a
  • BMP1 Chromosome 8; metalloprotease that acts on procollagen I, II, and III. It is
  • BMP2 Chromosome 20; cartilage formation. It is a candidate as a retinoid mediator.
  • BMP4 mesoderm It also plays a role in fracture repair, epidermis Chromosome: 14; formation, dorsal-ventral axis formation, and ovarian follicle Location: l4q22-q23 development.
  • BMP7 Chromosome 20; production of SMAD1. Also key in renal development and
  • Chromosome 1;
  • Chromosome 1;
  • BMP10 May pi a y a roie i n the trabeculation of the embryonic heart. Chromosome: 2;
  • BMPs can be costly compared with other techniques such as bone grafting. However, this cost is often far less than the costs required with orthopedic revision in multiple surgeries.
  • BMP use was greater among patients with previous surgery and among those having complex fusion procedures (combined anterior and posterior approach, or greater than 2 disc levels).
  • Major medical complications, wound complications, and 30-day rehospitalization rates were nearly identical with or without BMP.
  • Reoperation rates were also very similar, even after stratifying by previous surgery or surgical complexity, and after adjusting for demographic and clinical features.
  • adjusted hospital charges for operations involving BMP were about $15,000 more than hospital charges for fusions without BMP, though reimbursement under Medicare's Diagnosis-Related Group system averaged only about $850 more.
  • Significantly fewer patients receiving BMP were discharged to a skilled nursing facility.
  • the BMP peptides will generally comprise peptides of no more than about 100 residues and a sequence below:
  • GGGNVILKKYRNMVVRACGCH (SEQ ID NO: 3) or a multimer comprising at least two of the same or different peptides as shown above.
  • the peptide, dimer, trimer or multimer may include a domain from other signaling and growth factor proteins, including other BMP proteins, such as BMP2 and BMP4, or members of protein families such as hedgehog proteins.
  • the peptide may have no more than 75 residues, nor more than 50 residues, no more than 45 residues, no more than 40 residues, no more than 35 residues, no more than 30 residues, no more than 29 residues, no more than 28 residues, no more than 27 residues, no more than 26 residues, no more than 25 residues, no more than 24 residues, no more than 23 residues, no more than 22 residues, or is 21 residues.
  • the multimer may be a dimer, trimer or tetramer of one or more of the same or different sequences as shown above, and may further comprise domains from other proteins as stated above.
  • the multimer may be a homo-multimer or a hetero-multimer.
  • the multimer is therefore composed of at least two peptides that are linked. The linkage may be to each other through a chemical or peptide bridge, or through separate bridge structures to a single carrier molecule.
  • Avidin is a suitable bridge (e.g., deglycosylated avidin), but many other options exist.
  • a thiol-containing Cysteine (Cys) amino acid residue can be added to the N- or C-terminal end of the peptide.
  • L amino acid constructs may not only comprise L amino acids, but may also comprise only D amino acids, or a mixture of D and L amino acids.
  • D amino acids are well known as promoting stability for in vivo applications of peptide constructs.
  • Bone is a living, growing tissue. It is porous and mineralized, and made up of cells, vessels, organic matrix and inorganic hydroxyapatite crystals.
  • the human skeleton is actually made up of 2 types of bones: the cortical bone and the trabecular bone.
  • Cortical bone represents nearly 80% of the skeletal mass.
  • Cortical bone has a slow turnover rate and a high resistance to bending and torsion. It provides strength where bending would be undesirable as in the middle of long bones.
  • Trabecular bone only represents 20% of the skeletal mass, but 80% of the bone surface. It is less dense, more elastic and has a higher turnover rate than cortical bone.
  • Osteoprogenitors Human bone precursor cells are characterized as small-sized cells that express low amounts of bone proteins (osteocalcin, osteonectin, and alkaline phosphatase) and have a low degree of internal complexity (Long et al, 1995). When stimulated to differentiate, these preosteoblast cells become osteoblast in their appearance, size, antigenic expression, and internal structure. Although these cells are normally present at very low frequencies in bone marrow, a process for isolating these cells has been described (Long et al, 1995).
  • U.S. Patent 5,972,703 further describes methods of isolating and using bone precursor cells, and is specifically incorporated herein by reference.
  • Osteoblasts An osteoblast is a mononucleate cell that is responsible for bone formation. Osteoblasts produce osteoid, which is composed mainly of Type I collagen. Osteoblasts are also responsible for mineralization of the osteoid matrix. Bone is a dynamic tissue that is constantly being reshaped by osteoblasts, which build bone, and osteoclasts, which resorb bone. Osteoblast cells tend to decrease in number and activity as individuals become elderly, thus decreasing the natural renovation of the bone tissue.
  • Osteoblasts arise from osteoprogenitor cells located in the periosteum and the bone marrow. Osteoprogenitors are immature progenitor cells that express the master regulatory transcription factor Cbfal/Runx2. Osteoprogenitors are induced to differentiate under the influence of growth factors, in particular the bone morphogenetic proteins (BMPs). Aside from BMPs, other growth factors including fibroblast growth factor (FGF), platelet-derived growth factor (PDGF), transforming growth factor b (TGF-b) may promote the division of osteoprogenitors and potentially increase osteogenesis.
  • BMPs bone morphogenetic proteins
  • FGF fibroblast growth factor
  • PDGF platelet-derived growth factor
  • TGF-b transforming growth factor b
  • osteoprogenitors start to differentiate into osteoblasts, they begin to express a range of genetic markers including Osterix, Coll, ALP, osteocalcin, osteopontin, and osteonectin.
  • osteoblast implies an immature cell type, osteoblasts are in fact the mature bone cells entirely responsible for generating bone tissue in animals and humans.
  • Osteoclasts An osteoclast is a type of bone cell that removes bone tissue by removing its mineralized matrix. This process is known as bone resorption. Osteoclasts and osteoblasts are instrumental in controlling the amount of bone tissue: osteoblasts form bone, osteoclasts resorb bone. Osteoclasts are formed by the fusion of cells of the monocyte-macrophage cell lineage. Osteoclasts are characterized by high expression of tartrate resistant acid phosphatase (TRAP) and cathepsin K.
  • TRIP tartrate resistant acid phosphatase
  • Osteoclast formation requires the presence of RANK ligand (receptor activator of nuclear factor kb) and M-CSF (Macrophage colony-stimulating factor). These membrane bound proteins are produced by neighboring stromal cells and osteoblasts; thus requiring direct contact between these cells and osteoclast precursors. M-CSF acts through its receptor on the osteoclast, c-fms (colony stimulating factor 1 receptor), a transmembrane tyrosine kinase- receptor, leading to secondary messenger activation of tyrosine kinase Src. Both of these molecules are necessary for osteoclastogenesis and are widely involved in the differentiation of monocyte/macrophage derived cells.
  • RANK ligand receptor activator of nuclear factor kb
  • M-CSF Macrophage colony-stimulating factor
  • RANKL is a member of the tumor necrosis family (TNF), and is essential in osteoclastogenesis.
  • RANKL knockout mice exhibit a phenotype of osteopetrosis and defects of tooth eruption, along with an absence or deficiency of osteoclasts.
  • RANKL activates NF-kb (nuclear factor-kb) and NFATcl (nuclear factor of activated t cells, cytoplasmic, calcineurin-dependent 1) through RANK.
  • NF-kb activation is stimulated almost immediately after RANKL-RANK interaction occurs, and is not upregulated.
  • NFATcl stimulation begins -24-48 hours after binding occurs and its expression has been shown to be RANKL dependent.
  • Osteoclast differentiation is inhibited by osteoprotegerin (OPG), which binds to RANKL thereby preventing interaction with RANK.
  • OPG osteoprotegerin
  • Intramembranous ossification mainly occurs during formation of the flat bones of the skull; the bone is formed from mesenchyme tissue.
  • the steps in intramembranous ossification are development of ossification center, calcification, formation of trabeculae and development of periosteum.
  • Endochondral ossification occurs in long bones, such as limbs; the bone is formed around a cartilage template.
  • the steps in endochondral ossification are development of cartilage model, growth of cartilage model, development of the primary ossification center and development of the secondary ossification center.
  • Endochondral ossification begins with points in the cartilage called “primary ossification centers.” They mostly appear during fetal development, though a few short bones begin their primary ossification after birth. They are responsible for the formation of the diaphyses of long bones, short bones and certain parts of irregular bones. Secondary ossification occurs after birth, and forms the epiphyses of long bones and the extremities of irregular and flat bones. The diaphysis and both epiphyses of a long bone are separated by a growing zone of cartilage (the epiphyseal plate). When the child reaches skeletal maturity (18 to 25 years of age), all of the cartilage is replaced by bone, fusing the diaphysis and both epiphyses together (epiphyseal closure).
  • Remodeling or bone turnover is the process of resorption followed by replacement of bone with little change in shape and occurs throughout a person’s life. Osteoblasts and osteoclasts, coupled together via paracrine cell signaling, are referred to as bone remodeling units.
  • the purpose of remodeling is to regulate calcium homeostasis, repair micro-damaged bones (from everyday stress) but also to shape and sculpture the skeleton during growth.
  • the process of bone resorption by the osteoclasts releases stored calcium into the systemic circulation and is an important process in regulating calcium balance. As bone formation actively fixes circulating calcium in its mineral form, removing it from the bloodstream, resorption actively unfixes it thereby increasing circulating calcium levels. These processes occur in tandem at site-specific locations.
  • Chondrocytes are the only cells found in healthy cartilage. They produce and maintain the cartilaginous matrix, which consists mainly of collagen and proteoglycans. Although the word chondroblast is commonly used to describe an immature chondrocyte, the term is imprecise, since the progenitor of chondrocytes (which are mesenchymal stem cells) can differentiate into various cell types, including osteoblasts.
  • the chondrocytic lineage is:
  • CFU-F Colony -forming unit-fibroblast
  • Mesenchymal (mesoderm origin) stem cells are undifferentiated, meaning they can differentiate into a variety of generative cells commonly known as steochondrogenic (or osteogenic, chondrogenic, osteoprogenitor, etc.) cells.
  • steochondrogenic or osteogenic, chondrogenic, osteoprogenitor, etc.
  • the originally undifferentiated mesenchymal stem cells lose their pluripotency, proliferate and crowd together in a dense aggregate of chondrogenic cells (cartilage) at the location of chondrification.
  • chondrogenic cells differentiate into so-called chondroblasts, which then synthesize the cartilage extra cellular matrix (ECM), consisting of a ground substance (proteoglycans, gly cos aminogly cans for low osmotic potential) and fibers.
  • ECM cartilage extra cellular matrix
  • the chondroblast is now a mature chondrocyte that is usually inactive but can still secrete and degrade the matrix, depending on conditions.
  • BMP4 and FGF2 have been experimentally shown to increase chondrocyte differentiation. Chondrocytes undergo terminal differentiation when they become hypertrophic, which happens during endochondral ossification. This last stage is characterized by major phenotypic changes in the cell.
  • Chondrification is the process by which cartilage is formed from condensed mesenchyme tissue, which differentiates into chondroblasts and begins secreting the molecules (aggrecan and collagen type II) that form the extracellular matrix.
  • cartilage growth consists mostly of the maturing of immature cartilage to a more mature state. The division of cells within cartilage occurs very slowly, and thus growth in cartilage is usually not based on an increase in size or mass of the cartilage itself.
  • the articular cartilage function is dependent on the molecular composition of the extracellular matrix (ECM).
  • ECM extracellular matrix
  • the ECM consists mainly of proteoglycan and collagens.
  • the main proteoglycan in cartilage is aggrecan, which, as its name suggests, forms large aggregates with hyaluronan. These aggregates are negatively charged and hold water in the tissue.
  • the collagen mostly collagen type II, constrains the proteoglycans.
  • the ECM responds to tensile and compressive forces that are experienced by the cartilage.
  • Cartilage growth thus refers to the matrix deposition, but can also refer to both the growth and remodeling of the extracellular matrix. Due to the great stress on the patellofemoral joint during resisted knee extension, the articular cartilage of the patella is among the thickest in the human body.
  • articular cartilage in load bearing joints such as knee and hip have been studied extensively at macro, micro and nano-scales. These mechanical properties include the response of cartilage in frictional, compressive, shear and tensile loading. Cartilage is resilient and displays viscoelastic properties. Frictional properties include those involving lubricin, a glycoprotein abundant in cartilage and synovial fluid, plays a major role in bio-lubrication and wear protection of cartilage.
  • Cartilage has limited repair capabilities. Because chondrocytes are bound in lacunae, they cannot migrate to damaged areas. Therefore, cartilage damage is difficult to heal. Also, because hyaline cartilage does not have a blood supply, the deposition of new matrix is slow. Damaged hyaline cartilage is usually replaced by fibrocartilage scar tissue. Over the last years, surgeons and scientists have elaborated a series of cartilage repair procedures that help to postpone the need for joint replacement. Bioengineering techniques are being developed to generate new cartilage, using a cellular "scaffolding" material and cultured cells to grow artificial cartilage.
  • osteoporosis also of great significance is the chronic condition of osteoporosis, including age-related osteoporosis and osteoporosis associated with post-menopausal hormone status.
  • Other conditions characterized by the need for bone growth include primary and secondary hyperparathyroidism, disuse osteoporosis, diabetes-related osteoporosis, and glucocorticoid-related osteoporosis.
  • Several other conditions such as, for example, vitamin D deficiency, exists.
  • pediatric congenital conditions that are characterized by poor bone quality and amount -including osteogenesis imperfecta- that could benefit from enhanced bone formation and reduced bone turnover.
  • Fracture The first example is the otherwise healthy individual who suffers a fracture. Often, clinical bone fracture is treated by casting to alleviate pain and allow natural repair mechanisms to heal the wound. There has been progress in the treatment of fracture in recent times, however, even without considering the various complications that may arise in treating fractured bones, any new procedures to increase bone healing in normal circumstances would represent a great advance. There are a number of conditions in which bone fracture healing is defective, including metabolic diseases such as diabetes. Also, fracture healing is often poor in the elderly.
  • Periodontal Disease Progressive periodontal disease leads to tooth loss through destruction of the tooth's attachment to the surrounding bone. Approximately 5 - 20% of the U.S. population (15-60 million individuals) suffers from severe generalized periodontal disease, and there are 2 million related surgical procedures. Moreover, if the disease is defined as the identification of at least one site of clinical attachment loss, then approximately 80% of all adults are affected, and 90% of those aged 55 to 64 years. If untreated, approximately 88% of affected individuals show moderate to rapid progression of the disease- which shows a strong correlation with age. The major current treatment for periodontal disease is regenerative therapy consisting of replacement of lost periodontal tissues. The lost bone is usually treated with an individual's own bone and bone marrow, due to their high osteogenic potential.
  • Bone allografts (between individuals) can also be performed using stored human bone. Although current periodontal cost analyses are hard to obtain, the size of the affected population and the current use of bone grafts as a first-order therapy strongly suggest that this area represents an attractive target for bone-building therapies.
  • Osteopenia/osteoporosis refers to a heterogeneous group of disorders characterized by decreased bone mass and fractures.
  • Osteopenia is a bone mass that is one or more standard deviations below the mean bone mass for a population; osteoporosis is defined as 2.5 SD or lower.
  • An estimated 20-25 million people are at increased risk for fracture because of site-specific bone loss.
  • Risk factors for osteoporosis include increasing age, gender (more females), low bone mass, early menopause, race (Caucasians in general; Asian and Hispanic females), low calcium intake, reduced physical activity, genetic factors, environmental factors (including cigarette smoking and abuse of alcohol or caffeine), and deficiencies in neuromuscular control that create a propensity to fall.
  • osteoporosis is a significant health care problem.
  • Osteoporosis once thought to be a natural part of aging among women, is no longer considered age or gender-dependent. Osteoporosis is defined as a skeletal disorder characterized by compromised bone strength predisposing to an increased risk of fracture. Bone strength reflects the integration of two main features: bone density and bone quality. Bone density is expressed as grams of mineral per area or volume and in any given individual is determined by peak bone mass and amount of bone loss. Bone quality refers to architecture, turnover, damage accumulation ( e.g ., microfractures) and mineralization. A fracture occurs when a failure-inducing force (e.g., trauma) is applied to osteoporotic bone.
  • a failure-inducing force e.g., trauma
  • Bone Reconstruction/Grafting A fourth example is related to bone reconstruction and, specifically, the ability to reconstruct defects in bone tissue that result from traumatic injury; as a consequence of cancer or cancer surgery; as a result of a birth defect; or as a result of aging.
  • implant materials e.g., titanium
  • Titanium implants provide excellent temporary stability across bony defects and are an excellent material for bone implants or artificial joints such as hip, knee and joint replacements.
  • experience has shown that a lack of viable bone binding to implants the defect can result in exposure of the appliance to infection, structural instability and, ultimately, failure to repair the defect.
  • a therapeutic agent that stimulates bone formation on or around the implant will facilitate more rapid recovery.
  • Autologous bone grafts are another possibility, but they have several demonstrated disadvantages in that they must be harvested from a donor site such as iliac crest or rib, they usually provide insufficient bone to completely fill the defect, and the bone that does form is sometimes prone to infection and resorption.
  • Partially purified xenogeneic preparations are not practical for clinical use because microgram quantities are purified from kilograms of bovine bone, making large scale commercial production both costly and impractical. Allografts and demineralized bone preparations are therefore often employed, but suffer from their devitalized nature in that they only function as scaffolds for endogenous bone cell growth.
  • Microsurgical transfers of free bone grafts with attached soft tissue and blood vessels can close bony defects with an immediate source of blood supply to the graft.
  • these techniques are time consuming, have been shown to produce a great deal of morbidity, and can only be used by specially trained individuals.
  • the bone implant is often limited in quantity and is not readily contoured. In the mandible, for example, the majority of patients cannot wear dental appliances using presently accepted techniques (even after continuity is established), and thus gain little improvement in the ability to masticate.
  • Bone cancer occurs infrequently while bone metastases are present in a wide range of cancers, including thyroid, kidney, and lung.
  • Metastatic bone cancer is a chronic condition; survival from the time of diagnosis is variable depending on tumor type. In prostate and breast cancer and in multiple myeloma, survival time is measurable in years. For advanced lung cancer, it is measured in months. Cancer symptoms include pain, hypercalcemia, pathologic fracture, and spinal cord or nerve compression.
  • Prognosis of metastatic bone cancer is influenced by primary tumor site, presence of extra-osseous disease, and the extent and tempo of the bone disease. Bone cancer/metastasis progression is determined by imaging tests and measurement of bone specific markers. Recent investigations show a strong correlation between the rate of bone resorption and clinical outcome, both in terms of disease progression or death. .
  • Multiple myeloma is a B-lymphocyte malignancy characterized by the accumulation of malignant clonal plasma cells in the bone marrow.
  • the clinical manifestations of the disease are due to the replacement of normal bone marrow components by abnormal plasma cells, with subsequent overproduction of a monoclonal immunoglobulin (M protein or M component), bone destruction, bone pain, anemia, hypercalcemia and renal dysfunction.
  • M protein or M component monoclonal immunoglobulin
  • myeloma bone disease is not a metastatic disease. Rather, myeloma cells are derived from the B-cells of the immune system that normally reside in the bone marrow and are therefore intimately associated with bone. Indeed, the bone marrow microenvironment plays an important role in the growth, survival and resistance to chemotherapy of the myeloma cells, which, in turn, regulate the increased bone loss associated with this disorder (world-wide- web at multiplemyeloma.org).
  • MBD Myeloma Bone Disease.
  • the MBD lesions are unique in that they do not heal or repair, despite the patients’ having many years of complete remission. Mechanistically, this seems to be related to the inhibition and/or loss of the bone-forming osteoblast during disease progression. Indeed, bone marker studies and histomorphometry indicate that both the bone-resorbing osteoclast and osteoblast activity are increased, but balanced early in the disease, whereas overt MBD shows high osteoclast activity and low osteoblast activity.
  • MBD is a disorder in which bone formation and bone loss are uncoupled and would benefit from therapies that both stimulate bone formation and retard its loss.
  • Chondropathies Several diseases can affect cartilage. Chondrodystrophies are a group of diseases, characterized by the disturbance of growth and subsequent ossification of cartilage. Some common diseases that affect the cartilage are listed below.
  • Osteoarthritis is a disease of the whole joint, however one of the most affected tissues is the articular cartilage.
  • the cartilage covering bones articular cartilage— a subset of hyaline cartilage
  • articular cartilage a subset of hyaline cartilage
  • Osteoarthritis affects the joints exposed to high stress and is therefore considered the result of "wear and tear” rather than a true disease.
  • It is treated by arthroplasty the replacement of the joint by a synthetic joint often made of a stainless steel alloy (cobalt chromoly) and ultra-high molecular weight polyethylene (UHMWPE).
  • Cobalt chromoly cobalt chromoly
  • UHMWPE ultra-high molecular weight polyethylene
  • Achondroplasia results from reduced proliferation of chondrocytes in the epiphyseal plate of long bones during infancy and childhood, resulting in dwarfism.
  • Costochondritis is an inflammation of cartilage in the ribs, causing chest pain.
  • Spinal disc herniation is an asymmetrical compression of an intervertebral disc ruptures the sac-like disc, causing a herniation of its soft content. The hernia often compresses the adjacent nerves and causes back pain.
  • Relapsing polychondritis is the destruction, probably autoimmune, of cartilage, especially of the nose and ears, causing disfiguration. Death occurs by suffocation as the larynx loses its rigidity and collapses.
  • the present invention provides for the treatment of bone disease and bone trauma by stimulating the production of new cartilage and bone tissue.
  • Other agents may be used in combination with the peptide or peptides of the present invention. More generally, these agents would be provided in a combined amount (along with the peptide or peptides) to produce any of the effects discussed above.
  • This process may involve contacting the cell or subject with both agents at the same time. This may be achieved by contacting the cell with a single composition or pharmacological formulation that includes both agents, or by contacting the cell or subject with two distinct compositions or formulations, at the same time, wherein one composition includes the peptide and the other includes the second agent.
  • one agent may precede or follow the other by intervals ranging from minutes to weeks.
  • the agents are applied separately to the cell or subject, one would generally ensure that a significant period of time did not expire between the time of each delivery, such that the agents would still be able to exert an advantageously combined effect on the cell or subject.
  • the peptide or peptides is“A” and the other agent is“B”:
  • Combination agents include bisphosphonates (DidronelTM, FosamaxTM and ActonelTM), SERMs (Evista) or other hormone derivatives, and Parathyroid Hormone (PTH) analogs.
  • compositions of the present invention comprise an effective amount of one or more BMP peptides dissolved or dispersed in a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carrier refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, such as, for example, a human, as appropriate.
  • the preparation of a pharmaceutical composition that contains at least one BMP peptide, and optionally an additional active ingredient, will be known to those of skill in the art in light of the present disclosure, as exemplified by Remington’s Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, incorporated herein by reference.
  • preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biological Standards.
  • “pharmaceutically acceptable carrier” includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, such like materials and combinations thereof, as would be known to one of ordinary skill in the art (see, for example, Remington’s Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, 1289-1329, incorporated herein by reference). Except insofar as any conventional carrier is incompatible with the active ingredient, its use in the pharmaceutical compositions is contemplated.
  • the BMP peptide may be admixed with different types of carriers depending on how it is administered or is administered alone or in combination.
  • the present invention can be administered intravenously, intradermally, transdermally, intrathecally, intraarterially, intraperitoneally, topically, intramuscularly, subcutaneously, topically, locally, injection, infusion, continuous infusion, localized perfusion bathing target cells directly, via a catheter in lipid compositions (e.g., nanoparticles, liposomes), or by other method or any combination of the forgoing as would be known to one of ordinary skill in the art (see, for example, Remington’s Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, incorporated herein by reference).
  • the peptide is formulated into a syringeable composition for use in intravenous administration.
  • the BMP peptide may be formulated into a composition in a free base, neutral or salt form or ester. It may also be synthesized/formulated in a prodrug form.
  • Pharmaceutically acceptable salts include the acid addition salts, e.g., those formed with the free amino groups of a proteinaceous composition, or which are formed with inorganic acids such as for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, fumaric, or mandelic acid.
  • Salts formed with the free carboxyl groups can also be derived from inorganic bases such as for example, sodium, potassium, ammonium, calcium or ferric hydroxides; or such organic bases as isopropylamine, trimethylamine, histidine or procaine.
  • inorganic bases such as for example, sodium, potassium, ammonium, calcium or ferric hydroxides; or such organic bases as isopropylamine, trimethylamine, histidine or procaine.
  • the composition of the present invention suitable for administration is provided in a pharmaceutically acceptable carrier with or without an inert diluent.
  • the carrier should be assimilable and includes liquid, semi-solid, i.e., pastes, or solid carriers. Except insofar as any conventional media, agent, diluent or carrier is detrimental to the recipient or to the therapeutic effectiveness of the composition contained therein, its use in administrable composition for use in practicing the methods of the present invention is appropriate.
  • carriers or diluents include fats, oils, water, saline solutions, lipids, liposomes, resins, binders, fillers and the like, or combinations thereof.
  • composition may also comprise various antioxidants to retard oxidation of one or more component. Additionally, the prevention of the action of microorganisms can be brought about by preservatives such as various antibacterial and antifungal agents, including but not limited to parabens (e.g., methylparabens, propylparabens), chlorobutanol, phenol, sorbic acid, thimerosal or combinations thereof.
  • parabens e.g., methylparabens, propylparabens
  • chlorobutanol phenol
  • sorbic acid thimerosal or combinations thereof.
  • the composition is combined or mixed thoroughly with a semi-solid or solid carrier.
  • the mixing can be carried out in any convenient manner such as grinding.
  • Stabilizing agents can be also added in the mixing process in order to protect the composition from loss of therapeutic activity, /. e.. denaturation in the stomach.
  • stabilizers for use in the composition include buffers, amino acids such as glycine and lysine, carbohydrates such as dextrose, mannose, galactose, fructose, lactose, sucrose, maltose, sorbitol, mannitol, etc.
  • the present invention may concern the use of a pharmaceutical lipid vehicle compositions that include a BMP peptide, one or more lipids, and an aqueous solvent.
  • lipid will be defined to include any of a broad range of substances that is characteristically insoluble in water and extractable with an organic solvent. This broad class of compounds are well known to those of skill in the art, and as the term “lipid” is used herein, it is not limited to any particular structure. Examples include compounds which contain long-chain aliphatic hydrocarbons and their derivatives. A lipid may be naturally-occurring or synthetic (i.e., designed or produced by man).
  • Lipids are well known in the art, and include for example, neutral fats, phospholipids, phosphoglycerides, steroids, terpenes, lysolipids, glycosphingolipids, glycolipids, sulphatides, lipids with ether and ester- linked fatty acids and polymerizable lipids, and combinations thereof.
  • the BMP peptide may be dispersed in a solution containing a lipid, dissolved with a lipid, emulsified with a lipid, mixed with a lipid, combined with a lipid, covalently bonded to a lipid, contained as a suspension in a lipid, contained or complexed with a micelle or liposome, or otherwise associated with a lipid or lipid structure by any means known to those of ordinary skill in the art.
  • the dispersion may or may not result in the formation of liposomes.
  • the actual dosage amount of a composition of the present invention administered to an animal patient can be determined by physical and physiological factors such as body weight, severity of condition, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the patient and on the route of administration. Depending upon the dosage and the route of administration, the number of administrations of a preferred dosage and/or an effective amount may vary according to the response of the subject. The practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject.
  • BMP peptide pharmaceutical compositions may comprise, for example, at least about 0.1% of the peptide, about 0.5% of the peptide, or about 1.0% of the peptide. In other embodiments, the peptide may comprise between about 2% to about 75% of the weight of the unit, or between about 25% to about 60%, for example, and any range derivable therein. Naturally, the amount of the peptide in each therapeutically useful composition may be prepared in such a way that a suitable dosage will be obtained in any given unit dose of the compound.
  • a dose of BMP peptide may also comprise from about 0.1 microgram/kg/body weight, about 0.2 microgram/kg/body weight, about 0.5 microgram/kg/body weight, about 1 microgram/kg/body weight, about 5 microgram/kg/body weight, about 10 microgram/kg/body weight, about 50 microgram/kg/body weight, about 100 microgram/kg/body weight, about 200 microgram/kg/body weight, about 350 microgram/kg/body weight, about 500 microgram/kg/body weight, about 1 milbgram/kg/body weight, about 5 milbgram/kg/body weight, about 10 milbgram/kg/body weight, about 50 milbgram/kg/body weight, about 100 milbgram/kg/body weight, about 200 milbgram/kg/body weight, about 350 milligram/kg/body weight, about 500 milbgram/kg/body weight, to about 1000 mg/kg/body weight or more per administration, and any range derivable therein.
  • a range of about 5 mg/kg/body weight to about 100 mg/kg/body weight, about 5 microgram/kg/body weight to about 500 milbgram/kg/body weight, etc. can be administered, based on the numbers described above.
  • BMP peptide may be administered via a parenteral route.
  • parenteral includes routes that bypass the alimentary tract.
  • the pharmaceutical compositions disclosed herein may be administered for example, but not limited to intravenously, intradermally, intramuscularly, intraarterially, intrathecally, subcutaneous, or intraperitoneally U.S. Patents 6,537,514, 6,613,308, 5,466,468, 5,543,158; 5,641,515; and 5,399,363 (each specifically incorporated herein by reference in its entirety).
  • Solutions of the active compounds as free base or pharmacologically acceptable salts may be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose.
  • Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
  • the pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (U.S. Patent 5,466,468, specifically incorporated herein by reference in its entirety). In all cases the form must be sterile and must be fluid to the extent that easy injectability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (i.e., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils.
  • polyol i.e., glycerol, propylene glycol, and liquid polyethylene glycol, and the like
  • suitable mixtures thereof and/or vegetable oils.
  • Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • the prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars or sodium chloride.
  • Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
  • aqueous solutions For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose.
  • aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration.
  • sterile aqueous media that can be employed will be known to those of skill in the art in light of the present disclosure.
  • one dosage may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example,“Remington's Pharmaceutical Sciences” l5th Edition, pages 1035- 1038 and 1570-1580).
  • Some variation in dosage will necessarily occur depending on the condition of the subject being treated.
  • the person responsible for administration will, in any event, determine the appropriate dose for the individual subject.
  • preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biologies standards.
  • Sustained release formulations for treating of bone conditions include U.S.
  • Methods and injectable compositions for bone repair are described in U.S. Patents 4,863,732, 5,531,791, 5,840,290, 6,281,195, 6,288,043, 6,485,754, 6,662,805 and 7,008,433, all of which are incorporated by reference.
  • Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filtered sterilization.
  • dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • a powdered composition is combined with a liquid carrier such as, e.g. , water or a saline solution, with or without a stabilizing agent.
  • BMP peptides for administration by routes discussed above, such agents, alone or in combination, maybe used in the context of devices, such as implants.
  • implants A variety of bone related implants are contemplated, including dental implants, joint implants such as hips, knees, and elbows, vertebral/spinal implants, and others.
  • the BMP peptide may be impregnated in a surface of the implant, including in a bioactive matrix or coating.
  • the peptide may be further formulated to sustained, delayed, prolonged or time release.
  • the coating may comprise polymers, for example, such as those listed below. The following is a list of U.S. patents relating to bone implants and devices which may be utilized in accordance with this embodiment of the invention:
  • Bone implant in particular, an inter-vertebral implant
  • extrude osteogenic material and a method of stabilizing bones while extruding osteogenic material
  • Implant materials having a phosphatase and an organophosphorus compound for in vivo mineralization of bone
  • Bone stabilization implant having a bone plate portion with integral cable clamping means
  • a method generally comprises:
  • step (d) comparing the characteristic measured in step (c) with that observed in the absence of the candidate peptide, optionally with a negative control peptide, wherein an increase between the measured characteristic indicates that said peptide is, indeed, a bone and cartilage production stimulator.
  • Assays may be conducted in isolated cells or in organisms including transgenic animals. Bone formation can be identified by the von Kossa or Alzarin Red stains, FTIR or Raman spectrometric analysis, or by fluorochromes linked to compounds that bind bone. Cartilage formation can be identified by alcian blue staining or MRI.
  • Antibodies against human BMP2/BMP4 BMP-2/4 (H-l): SC-137087
  • BMP5 AF6176 and MAB7151
  • BMP5 BMP5
  • S&D Systems Minneapolis, MN
  • NeutrAvidin (NA), NA-HRP, NA-DyLight 488 (NA-488) and anti-mouse-HRP secondary antibody conjugate were obtained from Thermo- Fisher and Cell Signaling Technology (Danvers, MA).
  • Heparan sulfate (Sigma # H7640) isolated from bovine kidney and hyaluronic acid (Sigma # 53747) from Streptococcus equisimilis were obtained from Millipore-Sigma (St. Louis, MO). Full-length human BMP2, 4, 5, 6 and 7 were obtained from R&D and ProSpec (East Brunswick, NJ).
  • BMPs Protein Modifications and Peptide Synthesis.
  • full-length BMPs were biotinylated using EZ-Link Sulfo-NHS-LC-Biotin (Thermo-Fisher) in PBS in a total volume of 150 pl on ice for 1 hr. Reactions were quenched by the addition of 5 m ⁇ Tris-buffered saline (TBS) containing 50 pg BSA.
  • TBS Tris-buffered saline
  • Peptides encompassing the HS-binding domain from each BMP contained the putative Cardin-Weintraub (CW) motif and also a minimum of 3 flanking amino acids on the N- and C-terminal sides of the domain.
  • CW Cardin-Weintraub
  • biotinylated peptides were oligomerized into tetramers by incubation with NA or NA-HRP at a molar ratio of 50: 1 of peptide to NAHRP, with each avidin molecule binding 4 biotins (Dundas el al, 2013) and referred to as tetrameric complexes. Because the C-terminal peptides from BMP5 and BMP7 contain two Cys residues, they were prepared in water containing 1 mM dithiothreitol (DTT). Peptides were used within 2 weeks after being dissolved.
  • DTT dithiothreitol
  • Plates were developed by addition of HRP substrate O-phenylenediamine dihydrochloride (OPD) in phosphate-citrate buffer (50 mM sodium phosphate and 25 mM citric acid, pH 5) and read at 450 nm. Very low levels of background binding were exhibited by NA-HRP alone or when complexed with biotinylated- BSA.
  • OPD O-phenylenediamine dihydrochloride
  • proteins were applied to 96 well HS-coated plates in PBST at indicated concentrations for 2 hr at 4°C. Plates were rinsed 3 times with PBST, and bound proteins were assessed with BMP-specific antibodies.
  • the proteins were first labeled with biotin and applied to 96 well HS-coated plates in PBST for 2hr. The plates were washed, incubated with NA-HRP, washed again, and developed with OPD substrate. Similar results were obtained with heparin-coated plates.
  • HS plates were incubated with full-length rhBMP2 or rhBMP5 (4 mM) in the presence of increasing amounts of peptides in PBST for 2 hr with gentle shaking. The plates were washed, and bound BMP2 and BMP5 were assessed using anti-BMP2 antibody (1 :2000) and anti-BMP5 antibody (1 :2000) followed by anti-mouse HRP secondary antibody conjugate (1:5000). Plates were developed by addition of OPD substrate.
  • K562 human myelogenous leukemia cells (Lozzio & Lozzio, 1979) and AD293 cells were grown in DMEM containing 10% fetal calf serum.
  • Micromass cultures were prepared from El l CD-l mouse embryo limb buds (Mundy etal., 2016). Briefly, limb bud mesenchyme was dissociated in 0.5% trypsin-EDTA at 37°C. The dissociated cells were suspended at a concentration of 10 x 10 6 cells/ml in DMEM containing 3% fetal bovine serum and antibiotics.
  • Micromass cultures were initiated by spotting 15 pl of cell suspensions (1.5 x 10 5 cells) onto the surface of 12-well tissue culture plates.
  • K562 cells were washed with PBS and fixed with 2% buffered formalin for 20 min on ice. The cells were washed with PBS and blocked by incubation in PBS, 1% BSA for 20 min on ice. Approximately 10 6 cells (100 pl) were incubated with peptide tetramers containing fluorescent NA-488. Following incubation for 2 hr on ice, the cells were washed and analyzed on a BD Accuri Flow Cytometer located in the Flow Cytometry Core Laboratory in the inventors’ institution.
  • RNA was isolated using TRIzol Reagent (Thermo Fisher Scientific) following the manufacturers protocol. Five pg of glycogen (Thremo Fisher #AM95lO) was added to the aqueous phase prior to the addition of isopropanol to facilitate RNA precipitation. RNA quantification was determined using a Nanodrop spectrophotometer. cDNA was prepared from 2 pg of purified RNA using a Verso cDNA synthesis Kit (Thermo Scientific # AB1453A) following the manufactures protocol. Gene expression was determined by Quantitative real-time PCR (qPCR) using SYBR Green PCR Master Mix in an ABI 7500 Real-Time PCR System, located in the NAPCore facility in the inventors’ institution.
  • qPCR Quantitative real-time PCR
  • GAPDH was used as the endogenous control and relative expression was calculated using the AACt method. All PCR primers were obtained from Integrated DNA Technologies (Coralville, IA; world-wide-web at idtdna.com) and are listed in Table 2.
  • N-terminal Regions Have Distinct Sequences and Binding Properties. As indicated above, the N-terminal regions of mature BMP5, BMP6 and BMP7 upstream of the cysteine knot are much longer than those in BMP2 and BMP4 and are currently thought to contain a major HS binding domain (Brkljacic et al, 2013; Irie el al, 2003; Vogel & Mancera, 2012). To ask what may lie behind such length difference, the inventors aligned the N-terminal regions from each BMP protein and compared the putative HS-binding domains within them, using the first conserved cysteine as a reference mark (FIG. 1A).
  • the HS binding domains of BMP2 and BMP4 exhibited typical Cardin-Weintraub (CW) motifs with XBBXBX (SEQ ID NO: 4) and XBBBXBX arrangements, respectively (FIG. 1A), and their amino acid sequences are highly conserved from Xenopus to humans (FIG. 1B and FIGS. 11A-B).
  • the putative HS binding domains in BMP5, BMP6 and BMP7 were not only further upstream of the first cysteine (FIG. 1A), but also had unusual sequence features.
  • the domains in BMP5 and BMP6 consisted of three basic residues separated from the next single basic residue by three non-charged amino acids, and the domain in BMP7 lacked a doublet or triplet of basic residues altogether (FIG. 1A). These considerations raised the question whether these domains in BMP5, BMP6 and BMP7 were actually able to interact with HS. To investigate this, the inventors synthesized 20-25 amino acid-long peptides spanning the predicted HS-binding domain of each of the five BMPs (FIG. 2A) and tested them in solid phase binding assays with immobilized HS.
  • the BMP2- and BMP4-derived peptides readily bound to HS and exhibited saturable binding curves, yielding calculated Kas of about 100 nM (FIG. 3A).
  • the peptides derived from BMP5, BMP6 and BMP7 did not bind appreciably (FIG. 3A), and the same outcome was observed when the microwell plates were coated with heparin instead of HS (not shown).
  • the C-terminal Region of BMP5/6/7 Contains a CW Motif.
  • the inventors aligned the entire amino acid sequences of these BMPs (FIGS. 11 A-B) and searched for possible additional CW-like motifs. Indeed, they noted that their C-terminal region did contain one such motif with a XBBXBX (SEQ ID NO: 4) configuration (FIG. 5A).
  • the differential ability of N-terminal or C-terminal BMP domains to interact with HS raised the question as to whether there may be differences in their 3D configuration and spatial arrangement, possibly providing further insights into the basis of protein-HS interactions.
  • the inventors utilized the I-TASSER server at the University of Michigan that allows for protein structural and functional predictions (Y ang el al. , 2015). F ocusing on BMP2, BMP4 and BMP5 as representatives of the two BMP subgroups above, they found that their N-terminal domains displayed a helical structure, more prominent in BMP2 and BMP4 than BMP5 (FIGS. 6A-C).
  • the inventors subjected the domains to helical wheel projection analysis. Quite interestingly, the basic residues in BMP2 and BMP4 aligned to form a large cationic cluster along one face of the helix (FIGS. 6D-E), whereas the basic residues in BMP5 were separated by non-charged amino acids seemingly preventing the assembly of a large cationic surface (FIG. 6F). The latter provides an additional explanation for poor HS binding of the BMP5 N-terminal peptide (see FIG. 3A).
  • the inventors carried out a similar I-TASSER analysis of the C-terminal domains of BMP2, BMP4 and BMP5, but they turned out to have largely unstructured configurations with no obvious pattern (FIGS. 6G-I). This indicates that the strong HS-binding properties of the C- terminal domain in BMP5 (and by extension, BMP6 and BMP7) are mainly due to its specific amino acid sequence and spacing.
  • the Peptides Have Differential Cell Surface-Binding Abilities.
  • the inventors asked whether the differential ability of N-terminal and C-terminal peptides from the five BMPs to interact with immobilized HS was also displayed in their binding to the cell surface, thus providing insights into the interactive behaviors of mature BMPs.
  • the inventors carried out FACS analyses using K562 cells as a convenient in vitro model system. Cells were briefly fixed and incubated for 2 hrs on ice with N-terminal or C-terminal peptides from BMP2, BMP4, BMP5, BMP6 or BMP7 that had been pre-assembled into tetramers by incubation with fluorescent NA-488.
  • Peptides Can Stimulate Chondrogenic Cell Differentiation.
  • a previous study indicated that a peptide spanning the N-terminal HS-binding domain of BMP 4 (residues 15 to 24 within the mature protein) had biological activity on its own and stimulated osteogenic cell differentiation in cultures of human mesenchymal stem cells (Choi etal., 2010).
  • the inventors determined their effects on chondrogenic differentiation, using micromass cultures of mouse embryo limb bud mesenchymal cells (Huegl, 2015).
  • the Peptides Exhibit Binding-Competition Ability Toward Their Respective Proteins.
  • the stimulatory effects of the peptides on chondrogenesis could be due to a variety of mechanisms.
  • One possibility is that the peptides competed with binding of endogenous BMPs to cell surface HS and rendered the proteins available for further biological action.
  • the inventors carried out solid phase competition assays using peptides and full-length rhBMP2 and rhBMP5. HS-coated microplates were incubated with rhBMP2 (FIG. 9A) or rhBMP5 (FIG.
  • the HS-binding C-terminal and N-terminal domains of these BMPs contain a motif conforming to typical CW structures.
  • Cardin and Weintraub originally proposed that the positively charged amino acids in the XBBBXXBX (SEQ ID NO: 5) motif would be arrayed on one face of an a-helix, whereas they would be aligned on one side of a a-strand in the XBBXBX (SEQ ID NO: 4) motif (Cardin & Weintraub, 1989), providing a suitable surface for interaction with sulfated sugar clusters along the HS chains in each case (Sarrazin etal, 2011).
  • this server carries out protein/peptide structure predictions by searching the Protein Data Bank (PDB) and relating the input sequence to known protein structures with similar or identical sequences (Yang et al. , 2015).
  • PDB Protein Data Bank
  • the predicted structure of the peptides characterized here may not fully mimic their native configurations within the intact protein. Given their biological activities, however, it is likely that the peptides did possess functionally relevant configurations. This was indicated by their selective ability to interact with substrate-bound HS, bind to the cell surface, stimulate chondrogenesis and compete with binding of their respective full-length proteins.
  • HS chains themselves are endowed with a remarkable degree of structural diversity and complexity they acquire during their biosynthesis in the Golgi and by action of extracellular sulfatases (Sarrazin et al, 2011; Bishop et al, 2007).
  • the synthesis of HS chains initiates with the assembly of a tetrasaccharide linkage region to prescribed serine residues along the proteoglycan core proteins.
  • Chain polymerization continues with addition of aN-acetyl-D-glucosamine (GlcNAc) residue and then proceeds with alternating addition of glucuronic acid (GlcA) and GlcNAc residues by EXT1/EXT2 glycosylpolymerase complexes, producing HS chains of about 20 to 25 kDa in size. While these steps are ongoing, the elongating chains undergo a series of concurrent structural modifications that start with N- deacetylation and A-sulfation of GlcNAc residues by members of the N-deacetylase-N- sulfotransferase family.
  • Modifications continue with epimerization of certain D-glucuronic acid residues to L-iduronic acid and with 0-sulfation at positions C2, C6 or C3 around glucosamine and glucuronic/iduronic rings by O-sulfotransferase family members.
  • Such multiple serial biosynthetic steps result in chains with highly diverse sulfation and sugar modification patterns within 6-12 sugar residue-long segments flanked by largely unmodified and un-sulfated segments (Sarrazin el al, 2011; Bishop el al. , 2007).
  • HS chains to strongly and specifically interact with proteins
  • Some proteins such as fibroblast growth factor 2 (FGF2) and antithrombin require specific modifications of HS for optimal binding including 3-0 sulfation (Richard et al., 2009; Turnbull et al., 1992; Schultz et al, 2017), whereas other proteins such as IL-8 and thrombin mainly rely on HS domain structure or charge density, respectively (Lortat-Jacob et al, 1995; Spillmann et al, 1998).
  • FGF2 fibroblast growth factor 2
  • thrombin mainly rely on HS domain structure or charge density, respectively (Lortat-Jacob et al, 1995; Spillmann et al, 1998).
  • HME hereditary Multiple Exostoses
  • conditional Extl ablation in perichondrial cells caused a sharp decrease in local ERK/FGF signaling and a reciprocal increase in canonical BMP signaling (Huegel et al., 2013; Sinha et al. 2017).
  • BMP signaling is pro-chondrogenic while ERK/FGF signaling is anti-chondrogenic (Buckland et al, 1998; Yoon el al, 2006).
  • BMP(s) is/are the main culprits in inducing ectopic chondrogenesis and osteochondroma formation in HME, although the preferential expression and function of BMP2 in perichondrium point to this protein as a pathogenic candidate (Tsuji et al, 2006). Nonetheless, the studies stress the point that HS plays a critical role in fine-tuning the local activities, range of action and developmental effects of different HS-binding proteins (Bishop et al, 2015) and that severe consequences can ensue when these balances are not maintained.
  • the peptides may prove to be a safer and more versatile strategy for treatment of fracture repair, spine fusion and related clinical problems.
  • the peptides could be used in combination with rhBMP2 or rhBMP7 to reduce the amounts of these proteins needed for treatment as data in FIG. 13 suggest, thus likely rendering their use much safer.
  • hIDl NM 002165 F 5’ -GGTGGAGATTCTCCAGC ACG 283-333 (51)
  • mGAPDH NM 008084 F 5'ATCTTGGGCTACACTGAGGA 1051-1172 (122)
  • mAggrecan NM 007424 F 5'GGAGCGAGTCCAACTCTTCA 105-224 (120)
  • compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Toxicology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The disclosure relates to peptides derived from bone morphogenic proteins, and multimers thereof that bind heparan sulfate and heparan sulfate-rich proteglycans. Compositions containing these molecules are useful in the treatment of diseases or disorders including osteoporosis, Paget's disease, bone disease, bone fractures, etc.

Description

DESCRIPTION
PEPTIDES TO ENHANCE BONE GROWTH, REPAIR AND CELL FUNCTION
This application claims benefit of priority to U.S. Provisional Application Serial No. 62/689,013, filed June 22, 2018, the entire contents of which are hereby incorporated by reference.
BACKGROUND
I. Field
The present disclosure relates to the fields of molecular biology and medicine. More particularly, it relates to the fields of musculoskeletal tissues including cartilage and bone physiology, bone disease and injury, cartilage and bone repair, bone implants and bone grafts. Specifically, it deals with recombinant peptides or protein fragments to enhance cartilage and bone formation, healing and regeneration.
II. Related Art
The bone morphogenetic proteins (BMPs) are members of the transforming growth factor-b (TGF-b) superfamily and comprise an evolutionary diverse group of about 15 signaling proteins (Huminiecki et al, 2009; Massague, 1998; Wang et al, 2014). The BMPs are initially synthesized as large precursor proteins while entering the secretory pathway, undergo proteolytic processing and glycosylation, and are secreted as active dimers (Constam & Robertson, 1999; Degnin et al, 2004; Sun & Davies, 1995). Dimerization is needed for signaling function and is stabilized by 7 highly conserved Cys residues that interact to form cysteine-knot motifs (Sun & Davies; Avsian-Kretchmer & Hsueh, 2004; Scheufler etal., 1991; Iyer and Acharya, 2011). Active BMPs interact with type I and type II cell surface receptors that have serine/threonine kinase activity and assemble into tetrameric signaling complexes (Shi and Massague, 2003; Heldin et al, 1997). The type II receptors are constitutively active, whereas the type I receptors contain a Gly/Ser-rich domain that is phosphorylated by a type II receptor within the complex to activate kinase activity. These steps lead to recruitment of downstream canonical signaling effectors referred to as receptor-activated SMADs (SMAD1/5/8) that interact with SMAD4, translocate to the nucleus and modulate expression of target genes ((Shi and Massague, 2003; Heldin etal, 1997). These basic processes and steps are shared by all BMPs, but the proteins exert diverse functions and affect a large number of distinct developmental, homeostatic and pathological processes (Wang et al, 2014; Hogan, 1996; Salazar et al, 2016). Such diversity of roles and action is largely ascribable to the distinct binding affinities by the BMPs for various combinations of type I and type II receptors and to the patterns of ligands, receptors and endogenous inhibitors expressed in distinct biological contexts and tissues and at different developmental and growth stages (Balemans and Hul, 2002; Brazil et al, 2015; Massague, 2012).
A long-known but still intriguing feature of BMPs is that they interact with the heparan sulfate (HS) chains of cell surface and matrix-bound proteoglycans (Rider, 2006; Ruppert et al. , 1996; Sarrazin et al. , 2011), a macromolecular family that includes syndecans, glypicans and perlecan (Iozzo, 2001). The ability to interact with HS is actually shared by several other growth factors and signaling proteins, including hedgehogs and fibroblast growth factors (FGFs) (Ohlig et al, 2012; Wu et al, 2003), and is assignable to the presence of HS-binding domains present in these proteins (Rider, 2006). The interactions with HS are thought to be important in regulating protein distribution, tum-over, diffusion, and availability and in turn, interactions with -and signaling by- cognate receptors (Sarrazin et al. , 2011; Bishop et al. , 2007). Cardin and Weintraub were among the very first to carry out detailed studies to identify and characterize protein domain(s) responsible for interactions with HS (Cardin & Weintraub, 1989). Comparative analyses on vitronectin, platelet factor-4, apoliprotein A and apoliprotein B led to the identification of two HS-binding motifs - XBBXBX (SEQ ID NO: 4) and XBBBXXBX (SEQ ID NO: 5) - where B represents a basic residue (Arg or Lys) and X represents anon-charged residue. Subsequent studies on many other proteins have verified and greatly extended those original findings (Billings & Pacifici, 2015; Fromm et al. , 1997; Hileman et al, 1998). The HS-binding domains in BMP2 and BMP4 have been characterized in previous studies (Ruppert et al, 1996; Choi et al, 2010). The domains reside immediately upstream of the first conserved cysteine and are thus near the N-terminus of the mature protein, and their sequences in human BMP2 and BMP4 are QAKHKQRKRLKSSC (SEQ ID NO: 6) and SPKHHSQRARKKKNKNC (SEQ ID NO: 7) respectively, with the first cysteine of the knot serving as a reference point (Rider & Mulloy, 2017). These distinct sequences are highly conserved, and experimental mutations of their basic residues were shown to alter HS binding and biological function (Ruppert et al. , 1996; Ohkawara et al. , 2002). Notably, these sequences reiterate a fundamental and yet largely unexplained feature of HS-binding domains characterized in these and many other proteins, namely, that the amino acid sequence and organization of each domain vary greatly from protein to protein (Billings & Pacifici, 2015). SUMMARY
Thus, in accordance with the present disclosure, there is provided an isolated peptide of no more than 50 residues and comprises a sequence selected from the group consisting of GGGKVVLKNY QEMVVEGCGCR (SEQ ID NO: 1), GGGNVILKKYRNMVVRS CGCH (SEQ ID NO: 2) and GGGNVILKKYRNMVVRACGCH (SEQ ID NO: 3), or a multimer comprising at least two of the same or different peptides. The peptide maybe no more than about 100 residues, no more than about 75 residues, no more than about 50 residues, no more than about 45 residues, no more than about 40 residues, no more than about 35 residues, no more than about 30 residues, no more than about 29 residues, no more than about 28 residues, no more than about 27 residues, no more than about 26 residues, no more than about 25 residues, no more than about 24 residues, no more than about 23 residues, no more than about 22 residues, or is 21 residues. The multimer may be a dimer, trimer or tetramer comprising at least two peptides having SEQ ID NOS: 1, 2 and/or 3. The multimer may be a homo-multimer or a hetero-multimer. The multimer may comprise at least two peptides having SEQ ID NOS: 1, 2 and/or 3 linked to a carrier molecule, such as avidin ( e.g ., deglycosylated avidin). The peptide or peptide multimer may be linked to a diagnostic or therapeutic label or agent. The peptide or peptide multimer may comprise only L amino acids, only D amino acids, or a mixture of D and L amino acids. The peptide dimer, trimer or multimer may further comprise domain or domains from another signaling and growth factor protein(s), including other BMP proteins (BMP2, BMP4) or members of protein families such as hedgehog and fibroblast growth factor proteins.
Also provided is a method of increasing bone mass and/or volume and/or increasing cartilage mass and/or volume in a subject comprising (a) identifying a patient in need of increased bone mass and/or volume, and/or in need of increased cartilage mass and/or volume; and (b) administering to said subject an peptide or peptide multimer as described above. The subject may be in need of increased bone mass and/or volume, and/or may be in need of increased cartilage mass and/or volume. The peptide or peptide multimer may be administered to said subject systemically, such as intravenously, intra-articularly, intra-peritoneally, intramuscularly, subcutaneously or topically. The peptide or peptide multimer may be administered to a bone and/or cartilage target site, such as injected at said site. The peptide or peptide multimer may be comprised in a time-release device implanted at said site. The peptide or peptide multimer may also be administered in combination with full-length BMP proteins, such as BMP2 (Infuse) and/or BMP7 (Osigraft). The subject may be a human or a non-human animal. The non-human animal may be a mouse, a rat, a rabbit, a dog, a cat, a horse, a monkey or a cow. The subject may have cancer, or the subject may not have cancer. The method may further comprise at least a second administration of said peptide or peptide multimer, including wherein said subject receives 1- 5 administrations per week, and/or wherein said subject receives at least 5 administrations. The method may further comprise assessing bone and/or cartilage mass and/or volume following administration of said peptide or peptide multimer, such as by bone and/or cartilage imaging. The subject may suffer from osteoporosis, bone fracture, spinal degeneration, alveolar/extraction socket defect, bone loss due to trauma, Paget’s Disease or congenital bone diseases, or from bone loss due to cancer metastasis. The human subject may be a subject of 60 years or older. The subject may be a human subject having a metabolic disease that impairs bone fracture repair.
In another embodiment, there is provided a method of increasing bone and/or cartilage growth in a subject comprising administering to said subject a peptide or peptide multimer as defined above. The subject may be in need of increased bone growth and/or in need of increased cartilage growth. The subject may cancer, or may not have cancer. The subject may be a human, such as a subject of 60 years or older, including a human subject having a metabolic disease that impairs bone fracture repair. The subject may be a non-human animal. The method may further comprise at least a second administration of said peptide or peptide multimer. The subject may receive 1-5 administrations per week, such as wherein said subject receives at least 5 administrations. The method may further comprises assessing bone and/or cartilage growth following administration of said peptide or peptide multimer, such as by bone and/or cartilage imaging. The peptide or peptide multimer may also be administered in combination with full-length BMP proteins, such as BMP2 (Infuse) and/or BMP7 (Osigraft).
Other methods include:
a method of increasing chondrogenesis and chondrocyte development in a subject comprising administering to said subject a peptide or peptide multimer as defined above;
a method of increasing chondrocyte maturation and hypertrophy in a subj ect comprising administering to said subject a peptide or peptide multimer as defined above;
a method of increasing osteogenesis and osteoblast development in a subject comprising administering to said subject a peptide or peptide multimer as defined above; a method of increasing bone and/or cartilage strength in a subject comprising administering to said subject a peptide or peptide multimer as defined above; or a method of repairing a bone and/or cartilage defect in a subject comprising administering to said subject a peptide or peptide multimer as defined above.
The subject may be a human subject having a metabolic disease that impairs bone fracture repair. The peptide or peptide multimer may also be administered in combination with full- length BMP proteins, such as BMP2 (Infuse) and/or BMP7 (Osigraft).
In still another embodiment, there is provided a method of detecting the presence and/or location of heparan sulfate (HS) and/or heparan sulfate-rich proteoglycans (HSPGs) in a tissue or target site in a subject comprising contacting a tissue with or administering to a subject a peptide or peptide multimer as defined above, and detecting specific binding of said peptide or peptide multimer to said tissue or target site.
Further provided is a method of targeting an agent to a cell or tissue containing heparan sulfate (HS) and/or heparan sulfate-rich proteoglycans (HSPGs) in subject comprising administering to said subject a peptide or peptide multimer as defined above, wherein said peptide or peptide multimer is conjugated to said agent. The agent may be a therapeutic agent, such as an agent modulates bone and/or cartilage formation. The agent may be a diagnostic agent, such as a fluorophore, a chromophore, or a spin label.
The peptide may be administered to the subject systemically, intravenously, intra- peritoneally, intramuscularly, subcutaneously or topically. The peptide may be administered to a bone target site, including injection at the site. The peptide also may be comprised in a time-release device implanted at the site, may be in a monomeric or oligomeric structure, and may be a single entity or a combination of peptides.
The non-human subject may be a human or a non-human animal, such as a mouse, a rat, a rabbit, a dog, a cat, a horse, a monkey or a cow. The subject may have cancer, or may not.
It is contemplated that any method or composition described herein can be implemented with respect to any other method or composition described herein.
The use of the word“a” or“an” when used in conjunction with the term“comprising” in the claims and/or the specification may mean“one,” but it is also consistent with the meaning of“one or more,”“at least one,” and“one or more than one.”
It is contemplated that any embodiment discussed in this specification can be implemented with respect to any method or composition of the invention, and vice versa. Furthermore, compositions and kits of the invention can be used to achieve methods of the invention.
Throughout this application, the term“about” is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects.
BRIEF DESCRIPTION OF THE DRAWINGS
The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
FIGS. 1A-B. Sequence of N-terminal region is distinct in different BMPs. (FIG. 1A) Amino acid alignment of the entire N-terminal region of BMP2, BMP4, BMP5, BMP6 and BMP7, using the first conserved cysteine in the cysteine knot as a reference point (shaded in gray). The basic amino acids Arg and Lys are bolded and underlined. Note that the predicted HS-binding domain in BMP2 and BMP4 lies directly upstream of the first cysteine, while the predicted site in BMP5, BMP6 and BMP7 is further upstream. (FIG. 1B) Evolutionary N- terminal amino acid sequence alignment of the five BMPs from A tropicalis to H. sapiens. All five proteins are highly conserved. Predicted HS-binding domains are bolded and underlined.
FIGS. 2A-C. Synthetic peptides from N-terminal and C-terminal regions. (FIG. 2A) Amino acid sequences of the synthesized N-terminal peptides that span the predicted HS- binding domains of BMP2 to BMP7. Peptides were N-terminally linked to a biotin molecule via a triple glycine linker. Kd values (nM) and pi of synthetic peptides are shown, as well as the accession numbers for the full-length proteins from which the respective peptides were derived. [BMP2 = SEQ ID NO: 6; BMP4 = SEQ ID NO: 7; BMP5 = SEQ ID NO: 20; BMP6 = SEQ ID NO: 21; BMP7 = SEQ ID NO: 22] (FIG. 2B) Amino acid sequences of the synthesized C-terminal peptides spanning putative HS-binding domains of BMP4, BMP5 and BMP6/7. Note that the C-terminal regions of BMP6 and BMP7 are completely identical. (FIG. 2C) Schematic of a representative BMP protein. The encoded and newly synthesized protein consists of a signal peptide (green), a prodomain (yellow) and the mature biologically-active ligand (blue). A furin cleavage site separates the prodomain from the mature ligand which contains seven conserved cysteines forming three intramolecular disulfide bonds and one intermolecular disulfide bond.
FIGS. 3A-C. N-terminal peptides have diverse HS-binding properties compared to full-length proteins. (FIG. 3A) N-terminal peptides from BMP2, BMP4, BMP5, BMP6 and BMP7 (designated as 2N, 4N, 5N, 6N and 7N, respectively) were each incubated on plates coated with immobilized HS. Binding was measured using NAHRP at an absorbance of 450nm. Note that the N-terminal peptides from BMP2 and BMP4 interacted with HS with saturation kinetics and high affinity (Kds ~ 1 OOnM). whereas those from BMP5, BMP6 and BMP7 did not. (FIG. 3B) Binding assays for rhBMP2, rhBMP4 and rhBMP5 to HS-coated plates. Bound proteins were detected using their respective antibodies conjugated to HRP. Note that BMP2 and BMP5 displayed saturable binding in the conditions used, while BMP4 binding exhibited a slower kinetics. Inset shows a double reciprocal plot for rhBMP2 and rhBMP5 with calculated Kd values of 37 nM and 16 nM, respectively. (FIG. 3C) Binding assays for rhBMP6 and rhBMP7. Because specific antibodies for these BMPs could not be obtained, the proteins were biotinylated using EZ-link Sulfo-NHS-LC-Biotin (Thermo Scientific) prior to binding assays, and the bound proteins were then detected using NAHRP. Inset shows a double reciprocal plot with calculated Kd values of 56 nM and 40 nM for the two BMPs, respectively. Note that NAHRP by itself elicited no signal. Each binding curve is representative of a minimum of 5 independent experiments.
FIGS. 4A-C. N-terminal tetrameric complexes display differential binding properties. (FIG. 4A) Architecture of a schematic tetrameric complex assembled with NAHRP and biotinylated peptides. Each NAHRP molecule interacts with four peptide monomers to form a tetrameric binding complex. (FIG. 4B) Solid phase binding assays of N-terminal peptide tetrameric complexes from BMP2 and BMP4 (designated 2N and 4N, respectively) to immobilized HS. Note that both peptide complexes bind to substrate-bound HS with saturable kinetics and are fully competed by soluble heparin (H). NAHRP by itself elicited no signal. (FIG. 4C) Binding assays of N-terminal peptide tetrameric complexes from BMP5, BMP6 and BMP7 (designated 5N, 6N and 7N) to substrate-bound HS. Note that all three complexes exhibit very poor binding. Each binding curve is representative of a minimum of 5 independent experiments.
FIGS. 5A-C. C-terminal region of BMP5, BMP6 and BMP7 has high HS-binding affinity (FIG. 5 A) Amino acid alignment of the C-terminal region of BMP2 and BMP4 versus BMP5, BMP6 and BMP7. Basic residues are bolded and underlined. Note that the region in BMP5, BMP6 and BMP7 contains a XBBXBX (SEQ ID NO: 4) sequence that fully matches a typical CW motif, while the corresponding region in BMP2 and BMP4 contains non conservative substitutions within Asn (N) and Gln (Q) replacing a Lys and an Arg. In addition, note that the BMP2 and BMP4 region contains also two negatively charged, acidic residues (Glu and Asp) that would likely interfere with HS binding. (FIG. 5B) Solid phase binding assays of synthetic C-terminal peptides from BMP4, BMP5 and BMP6/7 (designated 4C, 5C and 6/7C) to substrate-bound HS. The C-terminal sequences of BMP6 and BMP7 are identical. Note that while the BMP4 peptide failed to bind HS, the BMP5 and BMP6/7 peptides did bind. (FIG. 5C) Solid phase binding assays of tetrameric C-terminal peptide complexes from BMP4, BMP5 and BMP6/7 to HS. The BMP5 and BMP6/7 complexes bind to HS with saturable kinetics and were competed out by soluble heparin (H), whereas the tetrameric BMP4 peptide still failed to bind. Inset shows a double reciprocal plot for BMP5 and BMP6/7 peptide tetramers. Each binding curve is representative of a minimum of 5 independent experiments.
FIGS. 6A-I. N-terminal region of BMP2 and BMP4 displays a continuous electropositive surface. (FIGS. 6A-C) I-TASSER-based models of the N-terminal regions of BMP2, BMP4 and BMP5, spanning the predicted HS-binding motifs and designated as BMP2 N, BMP4 N and BMP5 N. The N-terminal amino acid is designed by a blue dot and the C- terminal one by a red dot; the backbone is in black; and Lys and Arg residues are in purple and cyan, respectively. Note that all the regions display some degree of helical structure. (FIGS. 6D-F) Helical wheel diagrams of the regions shown in FIGS. 6A-C. The wheel diagrams for BMP2 and BMP4 reveal continuous positive charge on the surface of the helix (FIGS. 6D-E), while the BMP5 diagram presents with an unorganized and discontinuous arrangement of positive charge (FIG. 6F). (FIGS. 6G-I) I-TASSER-based models of the C-terminal regions of BMP2, BMP4 and BMP5 spanning the putative HS-binding motifs and designated as BMP2 C, BMP4 C and BMP5 C. Symbols are as in FIGS. 6A-C. Note that the region in BMP2 and BMP4 contains negatively charged residues (Asp in orange and Glu in yellow) that are inconsistent with a typical HS-binding domain and that are absent in the BMP5 region.
FIGS. 7A-B. The peptides are able to interact with the cell surface. (FIG. 7A) Fluorescent N-terminal peptide tetramers from BMP2, BMP4 and BMP5 (designated 2N, 4N and 5N, respectively) were allowed to interact with K562 cells in vitro and binding was assessed by flow cytometry. Note that the 2N and 4N peptides vigorously interacted with the cell surface and were competed out by soluble heparin (Hep). However, the peptide from BMP5 produced minimal if any binding. The fluorescent NA backbone produced no signal on its own as did the cells (FIG. 7A, far left). As an additional control for binding specificity, cells were trypsinized prior to incubation with peptides, and this treatment fully prevented binding. (FIG. 7B) Fluorescent C-terminal peptide tetramers from BMP4 and BMP5 (designated 4C and 5C, respectively) were allowed to interact with K562 cells in vitro, and binding levels were assessed as above. Note that the 5C peptide did bind to the cell surface and was competed out by soluble heparin, but the 4C peptide did not bind.
FIGS. 8A-K. The HS-binding peptides stimulate chondrogenesis. (FIGS. 8A-F) Day 3 mouse embryo limb bud cell micromass cultures stained with alcian blue on day 3 following treatment with: vehicle control (FIG. 8A); NA backbone (FIG. 8B); rhBMP2 (FIG. 8C); N-terminal BMP2 peptide tetramer designated 2N (FIG. 8D); N-terminal BMP4 peptide tetramer designated 4N (FIG. 8E); and C-terminal BMP5 peptide tetramer designated 5C (FIG. 8F). Note that the peptides stimulated chondrogenesis as indicated by an increase in alcian blue-positive nodules (FIGS. 8D-F) compared by controls (FIGS. 8A-B). (FIG. 8G) Scater plots of levels of alcian blue staining in FIGS. 8A-F quantified by Image! Data confirm that treatment with peptides 2N, 4N or 5C or with rhBMP2 increased chondrogenesis over control levels (Con and NA). (FIGS. 8H-J) Scater plots of expression levels of Sox9, Col2, and Aggrecan in day 3 limb bud cell cultures treated with peptide tetramers or left untreated (Con). Note that the 2N, 4N and 5C peptides significantly increased expression of Sox9 and Col2 (FIGS. 8H-I), while the strongest stimulation of Aggrecan expression occurred with the 4N peptide (FIG. 8J). Data are averages of three independent experiments. (FIG. 8K) Scater plots of ID1 expression in AD293 cells after treatment with vehicle (Con), NA backbone (NA) or tetrameric 2N, 4N or 5C peptides. Each peptide stimulated ID1 expression with respect to controls. Data are averages of five independent experiments. *P<0.05; **R<0.01; ***P<0.00l.
FIGS. 9A-B. The peptides compete with respective BMPs for HS binding. (FIG. 9A) Competition binding assays in which rhBMP2 (4 mM) was co-incubated with increasing concentrations of monomeric 2N, 4N, 5N or 5C peptides and tested for binding to substrate- bound HS. Note that both the 2N and 4N peptides competed with rhBMP2 binding to HS (blue and black lines), while both 5N and 5C peptides had minimal effects (red lines). (FIG. 9B) Competition binding assays in which rhBMP5 (4 pM) was co-incubated with increasing concentrations of monomeric 2N, 4N, 5N or 5C peptides and tested for binding to substrate- bound HS. Note that the 5C peptide did compete for binding (red lines with hallow circled), but the 5N peptide did not (red line with filled red circles). Note also that both 2N and 4N peptides also competed with rhBMP5 binding. Each binding curve is representative of 3 independent experiments.
FIG. 10. Structures of full-length BMP2, 4 and 5. Secondary structure predications used the structural information of BMP2 and BMP7 (PDB #3BMP and 1BMP) and were carried out using the I-TASSER server for protein structure and function prediction (Yang et al, 2014) and resulting structures were visualized using Chimera (world- wide-web at cgl.ucsf.edu/chimera). The N- and C- termini are delineated by blue and red dots, respectively.
FIGS. 11A-B. Alcian blue staining of day 3 limb bud cells from Ell mouse embryos. Cells treated with full length recombinant human BMP2, 4, and 5 proteins.
FIG. 12. Sequence alignment of BMP2, 4, 5, 6 and 7 spanning humans to frogs. Note that all BMPs are >90% conserved. FIG. 13. Effect of BMP2 and Peptide on ID1 expression. Ad 239 cells were seeded in 6 well plates (2.5 x 105 cells/well) and 24 hr later, treated with BMP2 and/or peptide for 3 hr. At the termination of the assay, RNA was isolated, cDNA was prepared and ID1 (a BMP early response gene) and GAPDH expression was determined by qPCR.
FIG. 14. Effect of BMP2 and Peptide on Chondrogenic differentiation. Micromass cultures were prepared from El 1 CD-l mouse embryo limb buds. Limb bud mesenchyme was dissociated in 0.5% trypsin-EDTA at 37°C. The dissociated cells were suspended at a concentration of 10 x 106 cells/ml in DMEM + 3% FCS. Micromass cultures were initiated by spotting 15 pl of cell suspensions (1.5 x 105 cells) onto the surface of l2-well tissue culture plates. After 24 hr, cultures were treated with rhBMP2 and/or peptide. Cultures were stained with Alcian blue (pH 1.0) after 6 days to monitor chondrogenic cell differentiation. Images were quantitated with Image J. (*P<0.05, ***P <0.001, ****p <0.0001).
DETAILED DESCRIPTION OF THE INVENTION
As discussed above, the structure-function relationship of sequence motifs in BMPs remains largely obscure. In an attempt to address this and related puzzles, the inventors focused here on BMP5, BMP6 and BMP7 and did so for several reasons. First, their HS-binding domains have not been well defined compared to those of BMP2 and BMP4 (Brkljacic et al, 2013; Irie et al. , 2003; Gandhi and Macera, 2012). Based on sequence homologies, the three proteins are classified as a separate evolutionary subgroup distinct from the BMP2/BMP4 subgroup within the TGF-b superfamily (Hinck, 2012). Of relevance to the inventors’ own field of research, the three BMPs have been found to have roles in skeletal development and growth (Mikic et al, 1995; Perry et al, 2008; Luo et al, 1995) different from those of BMP2 and BMP4 (Tsuji et al. , 2006; Selever et al. , 2004). Intriguingly, their N-terminal regions from the first conserved Cys are much longer than those of BMP2 and BMP4, and an initial perusal of possible HS-binding domains within that region revealed some unexpected anomalies as detailed below. Those initial insights were systematically explored in the present study, and the results presented here reveal that the domain with highest HS-binding affinity is actually located at the C-terminal portion of mature BMP5, 6 and 7. The inventors also present evidence that synthetic peptides corresponding to HS-binding domains have biological activity in chondrogenic and cell signaling assays in vitro.
These and other aspects of the invention are set forth in detail below.
I. Bone Morphogenic Proteins
Bone morphogenetic proteins (BMPs) are a group of growth factors also known as cytokines and as metabologens. Originally discovered by their ability to induce the formation of bone and cartilage, BMPs are now considered to constitute a group of pivotal morphogenetic signals, orchestrating tissue architecture throughout the body. The important functioning of BMP signals in physiology is emphasized by the multitude of roles for dysregulated BMP signalling in pathological processes. Cancerous disease often involves misregulation of the BMP signalling system. Absence of BMP signalling is, for instance, an important factor in the progression of colon cancer, and conversely, overactivation of BMP signalling following reflux-induced esophagitis provokes Barrett's esophagus and is thus instrumental in the development of adenocarcinoma in the proximal portion of the gastrointestinal tract. Recombinant human BMPs (rhBMPs) are used in orthopedic applications such as spinal fusions, non-unions and oral surgery. rhBMP-2 and rhBMP-7 are Food and Drug Administration (FDA)-approved for some uses. rhBMP-2 causes more overgrown bone than any other BMPs and is widely used off-label.
A. Medical Uses
BMPs for clinical use are produced using recombinant DNA technology (recombinant human BMPs; rhBMPs). rhBMPs are used in oral surgeries. BMP-7 has also recently found use in the treatment of chronic kidney disease (CKD). BMP-7 has been shown in murine animal models to reverse the loss of glomeruli due to sclerosis. Curis has been in the forefront of developing BMP-7 for this use. In 2002, Curis licensed BMP-7 to Ortho Biotech Products, a subsidiary of Johnson & Johnson.
B. Off-Label Use
Although rhBMP-2 and rhBMP-7 are used in the treatment of a variety of bone-related conditions including spinal fusions and non-unions, the risks of this off-label treatment are not understood. While rhBMPs are approved for specific applications (spinal lumbar fusions with an anterior approach and tibia nonunions), up to 85% of all BMP usage is off-label. rhBMP-2 is used extensively in other lumbar spinal fusion techniques (e.g., using a posterior approach, anterior or posterior cervical fusions).
C. Alternative to Autograft in Long Bone Non-unions
In 2001, the Food and Drug Administration (FDA) approved rhBMP-7 (a.k.a. OP-l; Stryker Biotech) for a humanitarian device exemption as an alternative to autograft in long bone nonunions. In 2004, the humanitarian device exemption was extended as an alternative to autograft for posterolateral fusion. In 2002, rhBMP-2 (Infuse; Medtronic) was approved for anterior lumbar interbody fusions (ALIFs) with a lumbar fusion device. In 2008 it was approved to repair posterolateral lumbar pseudarthrosis, open tibia shaft fractures with intramedullary nail fixation. In these products, BMPs are delivered to the site of the fracture by being incorporated into a bone implant, and released gradually to allow bone formation, as the growth stimulation by BMPs must be localized and sustained for some weeks. The BMPs are eluted through a purified collagen matrix which is implanted in the site of the fracture. rhBMP-2 helps grow bone better than any other rhBMP so it is much more widely used clinically. There is "little debate or controversy" about the effectiveness of rhBMP-2 to grow bone to achieve spinal fusions, and Medtronic generates $700 million in annual sales from their product. D. Contraindications
Bone morphogenetic protein (rhBMP) should not be routinely used in any type of anterior cervical spine fusion, such as with anterior cervical discectomy and fusion. There are reports of this therapy causing swelling of soft tissue which in turn can cause life-threatening complications due to difficulty swallowing and pressure on the respiratory tract.
E. Function
BMPs interact with specific receptors on the cell surface, referred to as bone morphogenetic protein receptors (BMPRs).
Signal transduction through BMPRs results in mobilization of members of the SMAD family of proteins. The signaling pathways involving BMPs, BMPRs and SMADs are important in the development of the heart, central nervous system, and cartilage, as well as post-natal bone development.
They have an important role during embryonic development on the embryonic patterning and early skeletal formation. As such, disruption of BMP signaling can affect the body plan of the developing embryo. For example, BMP4 and its inhibitors noggin and chordin help regulate polarity of the embryo (i.e.. back to front patterning). Specifically BMP -4 and its inhibitors play a major role in neurulation and the development of the neural plate. BMP -4 signals ectoderm cells to develop into skin cells, but the secretion of inhibitors by the underlying mesoderm blocks the action of BMP -4 to allow the ectoderm to continue on its normal course of neural cell development.
As a member of the transforming growth factor-beta superfamily, BMP signaling regulates a variety of embryonic patterning during fetal and embryonic development. For example, BMP signaling controls the early formation of the Mullerian duct (MD) which is a tubular structure in early embryonic developmental stage and eventually becomes female reproductive tracts. Chemical inhibiting BMP signals in chicken embryo caused a disruption of MD invagination and blocked the epithelial thickening of the MD-forming region, indicating that the BMP signals play a role in early MD development. Moreover, BMP signaling is involved in the formation of foregut and hindgut, intestinal villus patterning, and endocardial differentiation. Villi contribute to increase the effective absorption of nutrients by extending the surface area in small intestine. Gain or lose function of BMP signaling altered the patterning of clusters and emergence of villi in mouse intestinal model. BMP signal derived from myocardium is also involved in endocardial differentiation during heart development. Inhibited BMP signal in zebrafish embryonic model caused strong reduction of endocardial differentiation, but only had little effect in myocardial development. In addition, Notch-Wnt- Bmp crosstalk is required for radial patterning during mouse cochlea development via antagonizing manner.
Mutations in BMPs and their inhibitors are associated with a number of human disorders which affect the skeleton.
Several BMPs are also named 'cartilage-derived morphogenetic proteins' (CDMPs), while others are referred to as 'growth differentiation factors' (GDFs).
F. Types
Originally, seven such proteins were discovered. Of these, six (BMP2 through BMP7) belong to the Transforming growth factor beta superfamily of proteins. BMP1 is a metalloprotease. Since then, thirteen more BMPs have been discovered, bringing the total to twenty.
BMP Known functions Gene Locus
BMP1 does not belong to the TGF-b family of proteins. It is a
BMP1 Chromosome: 8; metalloprotease that acts on procollagen I, II, and III. It is
Location: 8p2l involved in cartilage development.
Acts as a disulfide-linked homodimer and induces bone and
BMP2 Chromosome: 20; cartilage formation. It is a candidate as a retinoid mediator.
Location: 20pl2 Plays a key role in osteoblast differentiation.
BMP3 Chromosome: 14;
Induces bone formation.
Location: 14r22
Regulates the formation of teeth, limbs and bone from
BMP4 mesoderm. It also plays a role in fracture repair, epidermis Chromosome: 14; formation, dorsal-ventral axis formation, and ovarian follicle Location: l4q22-q23 development.
BMP5 Chromosome: 6;
Performs functions in cartilage development.
Location: 6pl2. l
BMP6 Plays a role in joint integrity in adults. Controls iron Chromosome: 6; homeostasis via regulation of hepcidin. Location: 6pl2.1
Plays a key role in osteoblast differentiation. It also induces the
BMP7 Chromosome: 20; production of SMAD1. Also key in renal development and
Location: 20ql3 repair.
Chromosome: 1;
BMP8a involved in bone and cartilage development.
Location: lp35-p32
Chromosome: 1;
BMP8b Expressed in the hippocampus.
Location: lp35-p32
BMP10 May piay a roie in the trabeculation of the embryonic heart. Chromosome: 2;
Location: 2pl4
BMP11 Chromosome: 12;
Controls anterior-posterior patterning.
Location: 12r BMP 15 Chromosome: X;
May play a role in oocyte and follicular development.
Location: Xpl l.2
G. Costs
At between US$6000 and $10,000 for a typical treatment, BMPs can be costly compared with other techniques such as bone grafting. However, this cost is often far less than the costs required with orthopedic revision in multiple surgeries.
While there is little debate that rhBMPs are successful clinically, there is controversy about their use. It is common for orthopedic surgeons to be paid for their contribution to the development of anew product, but some of the surgeons responsible for the original Medtronic- supported studies on the efficacy of rhBMP-2 have been accused of bias and conflict of interest. Early clinical trials using rhBMP-2 underreported adverse events associated with treatment. In the 13 original industry-sponsored publications related to safety, there were zero adverse events in 780 patients. It has since been revealed that potential complications can arise from the use including implant displacement, subsidence, infection, urogenital events, and retrograde ejaculation.
Based on a study conducted by the Department of Family Medicine at the Oregon Health and Science University the use of BMP increased rapidly, from 5.5% of fusion cases in 2003 to 28.1% of fusion cases in 2008. BMP use was greater among patients with previous surgery and among those having complex fusion procedures (combined anterior and posterior approach, or greater than 2 disc levels). Major medical complications, wound complications, and 30-day rehospitalization rates were nearly identical with or without BMP. Reoperation rates were also very similar, even after stratifying by previous surgery or surgical complexity, and after adjusting for demographic and clinical features. On average, adjusted hospital charges for operations involving BMP were about $15,000 more than hospital charges for fusions without BMP, though reimbursement under Medicare's Diagnosis-Related Group system averaged only about $850 more. Significantly fewer patients receiving BMP were discharged to a skilled nursing facility.
H. BMP Peptides and Multimers
The BMP peptides will generally comprise peptides of no more than about 100 residues and a sequence below:
GGGKVVLKNY QEMVVEGCGCR (SEQ ID NO: 1)
GGGNVILKKYRNMV VRS C GCH (SEQ ID NO: 2)
GGGNVILKKYRNMVVRACGCH (SEQ ID NO: 3) or a multimer comprising at least two of the same or different peptides as shown above. The peptide, dimer, trimer or multimer may include a domain from other signaling and growth factor proteins, including other BMP proteins, such as BMP2 and BMP4, or members of protein families such as hedgehog proteins. The peptide may have no more than 75 residues, nor more than 50 residues, no more than 45 residues, no more than 40 residues, no more than 35 residues, no more than 30 residues, no more than 29 residues, no more than 28 residues, no more than 27 residues, no more than 26 residues, no more than 25 residues, no more than 24 residues, no more than 23 residues, no more than 22 residues, or is 21 residues.
The multimer may be a dimer, trimer or tetramer of one or more of the same or different sequences as shown above, and may further comprise domains from other proteins as stated above. Thus, the multimer may be a homo-multimer or a hetero-multimer. The multimer is therefore composed of at least two peptides that are linked. The linkage may be to each other through a chemical or peptide bridge, or through separate bridge structures to a single carrier molecule. Avidin is a suitable bridge (e.g., deglycosylated avidin), but many other options exist. As an example, a thiol-containing Cysteine (Cys) amino acid residue can be added to the N- or C-terminal end of the peptide. Air oxidation of the thiol groups present in these Cys residues will result in disulfide bond formation and peptide dimerization. The peptide or peptide multimer may be linked to a diagnostic or therapeutic label or agent, depending on the purpose for its use.
While the inventors have tested L amino acid constructs, peptide or peptide multimers may not only comprise L amino acids, but may also comprise only D amino acids, or a mixture of D and L amino acids. D amino acids are well known as promoting stability for in vivo applications of peptide constructs.
II. Bone Structure and Physiology
Bone is a living, growing tissue. It is porous and mineralized, and made up of cells, vessels, organic matrix and inorganic hydroxyapatite crystals. The human skeleton is actually made up of 2 types of bones: the cortical bone and the trabecular bone. Cortical bone represents nearly 80% of the skeletal mass. Cortical bone has a slow turnover rate and a high resistance to bending and torsion. It provides strength where bending would be undesirable as in the middle of long bones. Trabecular bone only represents 20% of the skeletal mass, but 80% of the bone surface. It is less dense, more elastic and has a higher turnover rate than cortical bone. A. Bone Forming Cells
Osteoprogenitors. Human bone precursor cells are characterized as small-sized cells that express low amounts of bone proteins (osteocalcin, osteonectin, and alkaline phosphatase) and have a low degree of internal complexity (Long et al, 1995). When stimulated to differentiate, these preosteoblast cells become osteoblast in their appearance, size, antigenic expression, and internal structure. Although these cells are normally present at very low frequencies in bone marrow, a process for isolating these cells has been described (Long et al, 1995). U.S. Patent 5,972,703 further describes methods of isolating and using bone precursor cells, and is specifically incorporated herein by reference.
A number of studies indicate that bone marrow derived cells have osteogenic potential. The majority of these investigations point to mesenchymal stem cells (MSC) as undergoing differentiation into osteoblasts when cultured in the presence of bone-active cytokines (Jaiswal et al, 2000; Phinney et al, 1999; Aubin, 1998; Zohar et al, 1997). Mesenchymal stem cells are a pluripotent population capable of generating multiple stromal cell lineages. MSC, as currently used, are a heterogeneous population of cells isolated by plastic adherence, and propagated by low-density passage. Nonetheless, a recent publication indicates the clonal nature of cell fate outcomes in MSC indicating that a single MSC cell can give rise to two or three mesenchymal lineages one of which is usually bone cells (Pihenger et al, 1999). These studies are consistent with earlier reports that demonstrated the osteogenic potential of bone marrow stromal cells, in particular the so-called CFU-f from both mice and human (Friedenstein et al, 1968; Reddi and Huggins, 1972; Friedenstein et al, 1982; Ashton et al, 1985; Bleiberg, 1985; Gronthos et al, 1994; Gronthos et al, 1999).
Single-cell isolation of human MSC generated clones that express the same surface phenotype as unfractionated MSC (Pihenger et al, 1999). Interestingly, of the 6 MSC clones evaluated, 2 retained osteogenic, chrondrogenic and adipogenic potential; others were bipotent (either osteo- plus chondrogenic potential, or osteo-adipocytic potential) or were uni-lineage (chondrocyte). This suggests that MSC themselves are heterogeneous in nature (although culture conditions also may have led to loss of lineage potential). To date, the self-renewal capacity of MSC remains in question. Nonetheless, these in vitro studies and other in vivo studies (Kadiyala et al, 1997; Petite et al, 2000; Krebsbach et al, 1999) show that MSC can commit to the bone cell lineage and develop to the state of matrix mineralization in vitro, or bone formation in vivo.
Preosteoblasts. Preosteoblasts are intermediate between osteoprogenitor cells and osteoblasts. They show increasing expression of bone phenotypic markers such as alkaline phosphatase (Kale et ctl, 2000). They have a more limited proliferative capacity, but nonetheless continue to divide and produce more preosteoblasts or osteoblasts.
Osteoblasts. An osteoblast is a mononucleate cell that is responsible for bone formation. Osteoblasts produce osteoid, which is composed mainly of Type I collagen. Osteoblasts are also responsible for mineralization of the osteoid matrix. Bone is a dynamic tissue that is constantly being reshaped by osteoblasts, which build bone, and osteoclasts, which resorb bone. Osteoblast cells tend to decrease in number and activity as individuals become elderly, thus decreasing the natural renovation of the bone tissue.
Osteoblasts arise from osteoprogenitor cells located in the periosteum and the bone marrow. Osteoprogenitors are immature progenitor cells that express the master regulatory transcription factor Cbfal/Runx2. Osteoprogenitors are induced to differentiate under the influence of growth factors, in particular the bone morphogenetic proteins (BMPs). Aside from BMPs, other growth factors including fibroblast growth factor (FGF), platelet-derived growth factor (PDGF), transforming growth factor b (TGF-b) may promote the division of osteoprogenitors and potentially increase osteogenesis. Once osteoprogenitors start to differentiate into osteoblasts, they begin to express a range of genetic markers including Osterix, Coll, ALP, osteocalcin, osteopontin, and osteonectin. Although the term osteoblast implies an immature cell type, osteoblasts are in fact the mature bone cells entirely responsible for generating bone tissue in animals and humans.
Osteoclasts. An osteoclast is a type of bone cell that removes bone tissue by removing its mineralized matrix. This process is known as bone resorption. Osteoclasts and osteoblasts are instrumental in controlling the amount of bone tissue: osteoblasts form bone, osteoclasts resorb bone. Osteoclasts are formed by the fusion of cells of the monocyte-macrophage cell lineage. Osteoclasts are characterized by high expression of tartrate resistant acid phosphatase (TRAP) and cathepsin K.
Osteoclast formation requires the presence of RANK ligand (receptor activator of nuclear factor kb) and M-CSF (Macrophage colony-stimulating factor). These membrane bound proteins are produced by neighboring stromal cells and osteoblasts; thus requiring direct contact between these cells and osteoclast precursors. M-CSF acts through its receptor on the osteoclast, c-fms (colony stimulating factor 1 receptor), a transmembrane tyrosine kinase- receptor, leading to secondary messenger activation of tyrosine kinase Src. Both of these molecules are necessary for osteoclastogenesis and are widely involved in the differentiation of monocyte/macrophage derived cells. RANKL is a member of the tumor necrosis family (TNF), and is essential in osteoclastogenesis. RANKL knockout mice exhibit a phenotype of osteopetrosis and defects of tooth eruption, along with an absence or deficiency of osteoclasts. RANKL activates NF-kb (nuclear factor-kb) and NFATcl (nuclear factor of activated t cells, cytoplasmic, calcineurin-dependent 1) through RANK. NF-kb activation is stimulated almost immediately after RANKL-RANK interaction occurs, and is not upregulated. NFATcl stimulation, however, begins -24-48 hours after binding occurs and its expression has been shown to be RANKL dependent. Osteoclast differentiation is inhibited by osteoprotegerin (OPG), which binds to RANKL thereby preventing interaction with RANK.
B. Bone Formation
The formation of bone during the fetal stage of development occurs by two processes: intramembranous ossification and endochondral ossification. Intramembranous ossification mainly occurs during formation of the flat bones of the skull; the bone is formed from mesenchyme tissue. The steps in intramembranous ossification are development of ossification center, calcification, formation of trabeculae and development of periosteum. Endochondral ossification, on the other hand, occurs in long bones, such as limbs; the bone is formed around a cartilage template. The steps in endochondral ossification are development of cartilage model, growth of cartilage model, development of the primary ossification center and development of the secondary ossification center.
Endochondral ossification begins with points in the cartilage called “primary ossification centers.” They mostly appear during fetal development, though a few short bones begin their primary ossification after birth. They are responsible for the formation of the diaphyses of long bones, short bones and certain parts of irregular bones. Secondary ossification occurs after birth, and forms the epiphyses of long bones and the extremities of irregular and flat bones. The diaphysis and both epiphyses of a long bone are separated by a growing zone of cartilage (the epiphyseal plate). When the child reaches skeletal maturity (18 to 25 years of age), all of the cartilage is replaced by bone, fusing the diaphysis and both epiphyses together (epiphyseal closure).
Remodeling or bone turnover is the process of resorption followed by replacement of bone with little change in shape and occurs throughout a person’s life. Osteoblasts and osteoclasts, coupled together via paracrine cell signaling, are referred to as bone remodeling units. The purpose of remodeling is to regulate calcium homeostasis, repair micro-damaged bones (from everyday stress) but also to shape and sculpture the skeleton during growth. The process of bone resorption by the osteoclasts releases stored calcium into the systemic circulation and is an important process in regulating calcium balance. As bone formation actively fixes circulating calcium in its mineral form, removing it from the bloodstream, resorption actively unfixes it thereby increasing circulating calcium levels. These processes occur in tandem at site-specific locations.
Repeated stress, such as weight-bearing exercise or bone healing, results in the bone thickening at the points of maximum stress (Wolffs law). It has been hypothesized that this is a result of bone’s piezoelectric properties, which cause bone to generate small electrical potentials under stress.
C. Chondrocytes
Chondrocytes are the only cells found in healthy cartilage. They produce and maintain the cartilaginous matrix, which consists mainly of collagen and proteoglycans. Although the word chondroblast is commonly used to describe an immature chondrocyte, the term is imprecise, since the progenitor of chondrocytes (which are mesenchymal stem cells) can differentiate into various cell types, including osteoblasts.
From least- to terminally-differentiated, the chondrocytic lineage is:
Colony -forming unit-fibroblast (CFU-F)
Mesenchymal stem cell / marrow stromal cell (MSC)
Chondrocyte
Hypertrophic chondrocyte
Mesenchymal (mesoderm origin) stem cells (MSC) are undifferentiated, meaning they can differentiate into a variety of generative cells commonly known as steochondrogenic (or osteogenic, chondrogenic, osteoprogenitor, etc.) cells. When referring to bone, or in this case cartilage, the originally undifferentiated mesenchymal stem cells lose their pluripotency, proliferate and crowd together in a dense aggregate of chondrogenic cells (cartilage) at the location of chondrification. These chondrogenic cells differentiate into so-called chondroblasts, which then synthesize the cartilage extra cellular matrix (ECM), consisting of a ground substance (proteoglycans, gly cos aminogly cans for low osmotic potential) and fibers. The chondroblast is now a mature chondrocyte that is usually inactive but can still secrete and degrade the matrix, depending on conditions.
BMP4 and FGF2 have been experimentally shown to increase chondrocyte differentiation. Chondrocytes undergo terminal differentiation when they become hypertrophic, which happens during endochondral ossification. This last stage is characterized by major phenotypic changes in the cell.
D. Cartilage Development
In embryogenesis, the skeletal system is derived from the mesoderm germ layer. Chondrification (also known as chondrogenesis) is the process by which cartilage is formed from condensed mesenchyme tissue, which differentiates into chondroblasts and begins secreting the molecules (aggrecan and collagen type II) that form the extracellular matrix. Following the initial chondrification that occurs during embryogenesis, cartilage growth consists mostly of the maturing of immature cartilage to a more mature state. The division of cells within cartilage occurs very slowly, and thus growth in cartilage is usually not based on an increase in size or mass of the cartilage itself.
The articular cartilage function is dependent on the molecular composition of the extracellular matrix (ECM). The ECM consists mainly of proteoglycan and collagens. The main proteoglycan in cartilage is aggrecan, which, as its name suggests, forms large aggregates with hyaluronan. These aggregates are negatively charged and hold water in the tissue. The collagen, mostly collagen type II, constrains the proteoglycans. The ECM responds to tensile and compressive forces that are experienced by the cartilage. Cartilage growth thus refers to the matrix deposition, but can also refer to both the growth and remodeling of the extracellular matrix. Due to the great stress on the patellofemoral joint during resisted knee extension, the articular cartilage of the patella is among the thickest in the human body.
The mechanical properties of articular cartilage in load bearing joints such as knee and hip have been studied extensively at macro, micro and nano-scales. These mechanical properties include the response of cartilage in frictional, compressive, shear and tensile loading. Cartilage is resilient and displays viscoelastic properties. Frictional properties include those involving lubricin, a glycoprotein abundant in cartilage and synovial fluid, plays a major role in bio-lubrication and wear protection of cartilage.
Cartilage has limited repair capabilities. Because chondrocytes are bound in lacunae, they cannot migrate to damaged areas. Therefore, cartilage damage is difficult to heal. Also, because hyaline cartilage does not have a blood supply, the deposition of new matrix is slow. Damaged hyaline cartilage is usually replaced by fibrocartilage scar tissue. Over the last years, surgeons and scientists have elaborated a series of cartilage repair procedures that help to postpone the need for joint replacement. Bioengineering techniques are being developed to generate new cartilage, using a cellular "scaffolding" material and cultured cells to grow artificial cartilage.
III. Treatments
A. Bone Diseases and Conditions
There are a plethora of conditions which are characterized by the need to enhance bone formation or to inhibit bone resorption and thus would benefit from the use of BMP peptides or combinations of BMP peptides, optionally further administered with agents, in promoting bone formation and/or bone repair. Perhaps the most obvious is the case of bone fractures, where it would be desirable to stimulate bone growth and to hasten and complete bone repair. Agents that enhance bone formation would also be useful in facial reconstruction procedures. Other bone deficit conditions include bone segmental defects, periodontal disease, metastatic bone disease, osteolytic bone disease and conditions where connective tissue repair would be beneficial, such as healing or regeneration of cartilage defects or injury. Also of great significance is the chronic condition of osteoporosis, including age-related osteoporosis and osteoporosis associated with post-menopausal hormone status. Other conditions characterized by the need for bone growth include primary and secondary hyperparathyroidism, disuse osteoporosis, diabetes-related osteoporosis, and glucocorticoid-related osteoporosis. Several other conditions, such as, for example, vitamin D deficiency, exists. There are also pediatric congenital conditions that are characterized by poor bone quality and amount -including osteogenesis imperfecta- that could benefit from enhanced bone formation and reduced bone turnover.
Fracture. The first example is the otherwise healthy individual who suffers a fracture. Often, clinical bone fracture is treated by casting to alleviate pain and allow natural repair mechanisms to heal the wound. There has been progress in the treatment of fracture in recent times, however, even without considering the various complications that may arise in treating fractured bones, any new procedures to increase bone healing in normal circumstances would represent a great advance. There are a number of conditions in which bone fracture healing is defective, including metabolic diseases such as diabetes. Also, fracture healing is often poor in the elderly.
Periodontal Disease. Progressive periodontal disease leads to tooth loss through destruction of the tooth's attachment to the surrounding bone. Approximately 5 - 20% of the U.S. population (15-60 million individuals) suffers from severe generalized periodontal disease, and there are 2 million related surgical procedures. Moreover, if the disease is defined as the identification of at least one site of clinical attachment loss, then approximately 80% of all adults are affected, and 90% of those aged 55 to 64 years. If untreated, approximately 88% of affected individuals show moderate to rapid progression of the disease- which shows a strong correlation with age. The major current treatment for periodontal disease is regenerative therapy consisting of replacement of lost periodontal tissues. The lost bone is usually treated with an individual's own bone and bone marrow, due to their high osteogenic potential. Bone allografts (between individuals) can also be performed using stored human bone. Although current periodontal cost analyses are hard to obtain, the size of the affected population and the current use of bone grafts as a first-order therapy strongly suggest that this area represents an attractive target for bone-building therapies.
Osteopenia/osteoporosis. The terms osteopenia and osteoporosis refers to a heterogeneous group of disorders characterized by decreased bone mass and fractures. Osteopenia is a bone mass that is one or more standard deviations below the mean bone mass for a population; osteoporosis is defined as 2.5 SD or lower. An estimated 20-25 million people are at increased risk for fracture because of site-specific bone loss. Risk factors for osteoporosis include increasing age, gender (more females), low bone mass, early menopause, race (Caucasians in general; Asian and Hispanic females), low calcium intake, reduced physical activity, genetic factors, environmental factors (including cigarette smoking and abuse of alcohol or caffeine), and deficiencies in neuromuscular control that create a propensity to fall.
More than a million fractures in the U.S. each year can be attributed to osteoporosis. In economic terms, the costs (exclusive of lost wages) for osteoporosis therapies are $35 billion worldwide. Demographic trends (i.e., the gradually increasing age of the U.S. population) suggest that these costs may increase to $62 billion by the year 2020. Clearly, osteoporosis is a significant health care problem.
Osteoporosis, once thought to be a natural part of aging among women, is no longer considered age or gender-dependent. Osteoporosis is defined as a skeletal disorder characterized by compromised bone strength predisposing to an increased risk of fracture. Bone strength reflects the integration of two main features: bone density and bone quality. Bone density is expressed as grams of mineral per area or volume and in any given individual is determined by peak bone mass and amount of bone loss. Bone quality refers to architecture, turnover, damage accumulation ( e.g ., microfractures) and mineralization. A fracture occurs when a failure-inducing force (e.g., trauma) is applied to osteoporotic bone. Current therapies for osteoporosis patients focus on fracture prevention, not for promoting bone formation or fracture repair. This remains an important consideration because of the literature, which clearly states that significant morbidity and mortality are associated with prolonged bed rest in the elderly, particularly those who have suffered hip fractures. Complications of bed rest include blood clots and pneumonia. These complications are recognized and measures are usually taken to avoid them, but these is hardly the best approach to therapy. Thus, the osteoporotic patient population would benefit from new therapies designed to strengthen bone and speed up the fracture repair process, thus getting these people on their feet before the complications arise.
Bone Reconstruction/Grafting. A fourth example is related to bone reconstruction and, specifically, the ability to reconstruct defects in bone tissue that result from traumatic injury; as a consequence of cancer or cancer surgery; as a result of a birth defect; or as a result of aging. There is a significant need for more frequent orthopedic implants, and cranial and facial bone are particular targets for this type of reconstructive need. The availability of new implant materials, e.g., titanium, has permitted the repair of relatively large defects. Titanium implants provide excellent temporary stability across bony defects and are an excellent material for bone implants or artificial joints such as hip, knee and joint replacements. However, experience has shown that a lack of viable bone binding to implants the defect can result in exposure of the appliance to infection, structural instability and, ultimately, failure to repair the defect. Thus, a therapeutic agent that stimulates bone formation on or around the implant will facilitate more rapid recovery.
Autologous bone grafts are another possibility, but they have several demonstrated disadvantages in that they must be harvested from a donor site such as iliac crest or rib, they usually provide insufficient bone to completely fill the defect, and the bone that does form is sometimes prone to infection and resorption. Partially purified xenogeneic preparations are not practical for clinical use because microgram quantities are purified from kilograms of bovine bone, making large scale commercial production both costly and impractical. Allografts and demineralized bone preparations are therefore often employed, but suffer from their devitalized nature in that they only function as scaffolds for endogenous bone cell growth.
Microsurgical transfers of free bone grafts with attached soft tissue and blood vessels can close bony defects with an immediate source of blood supply to the graft. However, these techniques are time consuming, have been shown to produce a great deal of morbidity, and can only be used by specially trained individuals. Furthermore, the bone implant is often limited in quantity and is not readily contoured. In the mandible, for example, the majority of patients cannot wear dental appliances using presently accepted techniques (even after continuity is established), and thus gain little improvement in the ability to masticate.
In connection with bone reconstruction, specific problem areas for improvement are those concerned with treating large defects, such as created by trauma, birth defects, or particularly, following tumor resection; and also the area of artificial joints. The success of orthopaedic implants, interfaces and artificial joints could conceivably be improved if the surface of the implant, or a functional part of an implant, were to be coated with a bone stimulatory agent. The surface of implants could be coated with one or more appropriate materials in order to promote a more effective interaction with the biological site surrounding the implant and, ideally, to promote tissue repair.
Primary Bone Cancer and Metastatic Bone Disease. Bone cancer occurs infrequently while bone metastases are present in a wide range of cancers, including thyroid, kidney, and lung. Metastatic bone cancer is a chronic condition; survival from the time of diagnosis is variable depending on tumor type. In prostate and breast cancer and in multiple myeloma, survival time is measurable in years. For advanced lung cancer, it is measured in months. Cancer symptoms include pain, hypercalcemia, pathologic fracture, and spinal cord or nerve compression. Prognosis of metastatic bone cancer is influenced by primary tumor site, presence of extra-osseous disease, and the extent and tempo of the bone disease. Bone cancer/metastasis progression is determined by imaging tests and measurement of bone specific markers. Recent investigations show a strong correlation between the rate of bone resorption and clinical outcome, both in terms of disease progression or death. .
Multiple Myeloma. Multiple myeloma (MM) is a B-lymphocyte malignancy characterized by the accumulation of malignant clonal plasma cells in the bone marrow. The clinical manifestations of the disease are due to the replacement of normal bone marrow components by abnormal plasma cells, with subsequent overproduction of a monoclonal immunoglobulin (M protein or M component), bone destruction, bone pain, anemia, hypercalcemia and renal dysfunction.
As distinct from other cancers that spread to the bone ( e.g . , breast, lung, thyroid, kidney, prostate), myeloma bone disease (MBD) is not a metastatic disease. Rather, myeloma cells are derived from the B-cells of the immune system that normally reside in the bone marrow and are therefore intimately associated with bone. Indeed, the bone marrow microenvironment plays an important role in the growth, survival and resistance to chemotherapy of the myeloma cells, which, in turn, regulate the increased bone loss associated with this disorder (world-wide- web at multiplemyeloma.org). Over 90% of myeloma patients have bone involvement, versus 40-60% of cancer patients who have bone metastasis, and over 80% have intractable bone pain. Additionally, approximately 30% of myeloma patients have hypercalcemia that is a result of the increased osteolytic activity associated with this disease (Cavo et al, 2006).
Common problems in myeloma are weakness, confusion and fatigue due to hypercalcemia. Headache, visual changes and retinopathy may be the result of hyperviscosity of the blood depending on the properties of the paraprotein. Finally, there may be radicular pain, loss of bowel or bladder control (due to involvement of spinal cord leading to cord compression) or carpal tunnel syndrome and other neuropathies (due to infiltration of peripheral nerves by amyloid). It may give rise to paraplegia in late presenting cases.
Myeloma Bone Disease. As discussed above, unlike the osteolysis associated with other bone tumors, the MBD lesions are unique in that they do not heal or repair, despite the patients’ having many years of complete remission. Mechanistically, this seems to be related to the inhibition and/or loss of the bone-forming osteoblast during disease progression. Indeed, bone marker studies and histomorphometry indicate that both the bone-resorbing osteoclast and osteoblast activity are increased, but balanced early in the disease, whereas overt MBD shows high osteoclast activity and low osteoblast activity. Thus, MBD is a disorder in which bone formation and bone loss are uncoupled and would benefit from therapies that both stimulate bone formation and retard its loss.
A number of therapeutic approaches have been used in MBD, with the endpoints of treating pain, hypercalcemia, or the reduction of skeletal related events (SRE). Many of these may present serious complications. Surgery, such as vertebroplasty or kyphoplasty, that is performed for stability and pain relief has the attendant surgical risks (e.g., infection) made worse by a compromised immune system and does not reverse existing skeletal defects. Radiation therapy and radioisotope therapy are both used to prevent/control disease progression and have the typical risks of irradiation therapies. More recently, drugs such as the bisphosphonates that inhibit osteoclast activity have become a standard of therapy for MBD, despite the fact that they work poorly in this disorder. In 9 major double-blind, placebo- controlled trials on bisphosphonates, only 66% of patients showed an effective reduction in pain; 56% showed a reduction in SRE and only 1 of the 9 demonstrated a survival benefit.
Chondropathies. Several diseases can affect cartilage. Chondrodystrophies are a group of diseases, characterized by the disturbance of growth and subsequent ossification of cartilage. Some common diseases that affect the cartilage are listed below.
Osteoarthritis is a disease of the whole joint, however one of the most affected tissues is the articular cartilage. The cartilage covering bones (articular cartilage— a subset of hyaline cartilage) is thinned, eventually completely wearing away, resulting in a "bone against bone" within the joint, leading to reduced motion, and pain. Osteoarthritis affects the joints exposed to high stress and is therefore considered the result of "wear and tear" rather than a true disease. It is treated by arthroplasty, the replacement of the joint by a synthetic joint often made of a stainless steel alloy (cobalt chromoly) and ultra-high molecular weight polyethylene (UHMWPE). Chondroitin sulfate or glucosamine sulfate supplements, have been claimed to reduce the symptoms of osteoarthritis but there is little good evidence to support this claim.
Traumatic rupture or detachment is cartilage damage, often in the knee, and can be partially repaired through knee cartilage replacement therapy. Often when athletes talk of damaged "cartilage" in their knee, they are referring to a damaged meniscus (a fibrocartilage structure) and not the articular cartilage.
Achondroplasia results from reduced proliferation of chondrocytes in the epiphyseal plate of long bones during infancy and childhood, resulting in dwarfism.
Costochondritis is an inflammation of cartilage in the ribs, causing chest pain.
Spinal disc herniation is an asymmetrical compression of an intervertebral disc ruptures the sac-like disc, causing a herniation of its soft content. The hernia often compresses the adjacent nerves and causes back pain.
Relapsing polychondritis is the destruction, probably autoimmune, of cartilage, especially of the nose and ears, causing disfiguration. Death occurs by suffocation as the larynx loses its rigidity and collapses.
B. Combination Treatments
As discussed, the present invention provides for the treatment of bone disease and bone trauma by stimulating the production of new cartilage and bone tissue. Other agents may be used in combination with the peptide or peptides of the present invention. More generally, these agents would be provided in a combined amount (along with the peptide or peptides) to produce any of the effects discussed above. This process may involve contacting the cell or subject with both agents at the same time. This may be achieved by contacting the cell with a single composition or pharmacological formulation that includes both agents, or by contacting the cell or subject with two distinct compositions or formulations, at the same time, wherein one composition includes the peptide and the other includes the second agent.
Alternatively, one agent may precede or follow the other by intervals ranging from minutes to weeks. In embodiments where the agents are applied separately to the cell or subject, one would generally ensure that a significant period of time did not expire between the time of each delivery, such that the agents would still be able to exert an advantageously combined effect on the cell or subject. In such instances, it is contemplated that one may contact the cell or subject with both modalities within about 12-24 h of each other and, more preferably, within about 6-12 h of each other. In some situations, it may be desirable to extend the time period for treatment significantly, however, where several days (2, 3, 4, 5, 6 or 7) to several weeks (1, 2, 3, 4, 5, 6, 7 or 8) lapse between the respective administrations.
Various combinations may be employed, the peptide or peptides is“A” and the other agent is“B”:
A/B/A B/A/B B/B/A A/A/B A/B/B B/A/A A/B/B/B B/A/B/B
B/B/B/A B/B/A/B A/A/B/B A/B/A/B A/B/B/A B/B/A/A
B/A/B/A B/A/A/B A/A/A/B B/A/A/A A/B/A/A A/A/B/A
Administration protocols and formulation of such agents will generally follow those of standard pharmaceutical drugs, as discussed further below. Combination agents include bisphosphonates (Didronel™, Fosamax™ and Actonel™), SERMs (Evista) or other hormone derivatives, and Parathyroid Hormone (PTH) analogs.
IV. Pharmaceutical Formulations and Delivery
A. Compositions and Routes
Pharmaceutical compositions of the present invention comprise an effective amount of one or more BMP peptides dissolved or dispersed in a pharmaceutically acceptable carrier. The phrases“pharmaceutical or pharmacologically acceptable” refer to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, such as, for example, a human, as appropriate. The preparation of a pharmaceutical composition that contains at least one BMP peptide, and optionally an additional active ingredient, will be known to those of skill in the art in light of the present disclosure, as exemplified by Remington’s Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, incorporated herein by reference. Moreover, for animal ( e.g ., human) administration, it will be understood that preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biological Standards.
As used herein,“pharmaceutically acceptable carrier” includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, such like materials and combinations thereof, as would be known to one of ordinary skill in the art (see, for example, Remington’s Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, 1289-1329, incorporated herein by reference). Except insofar as any conventional carrier is incompatible with the active ingredient, its use in the pharmaceutical compositions is contemplated.
The BMP peptide may be admixed with different types of carriers depending on how it is administered or is administered alone or in combination. The present invention can be administered intravenously, intradermally, transdermally, intrathecally, intraarterially, intraperitoneally, topically, intramuscularly, subcutaneously, topically, locally, injection, infusion, continuous infusion, localized perfusion bathing target cells directly, via a catheter in lipid compositions (e.g., nanoparticles, liposomes), or by other method or any combination of the forgoing as would be known to one of ordinary skill in the art (see, for example, Remington’s Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, incorporated herein by reference). In particular, the peptide is formulated into a syringeable composition for use in intravenous administration.
The BMP peptide may be formulated into a composition in a free base, neutral or salt form or ester. It may also be synthesized/formulated in a prodrug form. Pharmaceutically acceptable salts, include the acid addition salts, e.g., those formed with the free amino groups of a proteinaceous composition, or which are formed with inorganic acids such as for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, fumaric, or mandelic acid. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as for example, sodium, potassium, ammonium, calcium or ferric hydroxides; or such organic bases as isopropylamine, trimethylamine, histidine or procaine. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective.
Further in accordance with the present invention, the composition of the present invention suitable for administration is provided in a pharmaceutically acceptable carrier with or without an inert diluent. The carrier should be assimilable and includes liquid, semi-solid, i.e., pastes, or solid carriers. Except insofar as any conventional media, agent, diluent or carrier is detrimental to the recipient or to the therapeutic effectiveness of the composition contained therein, its use in administrable composition for use in practicing the methods of the present invention is appropriate. Examples of carriers or diluents include fats, oils, water, saline solutions, lipids, liposomes, resins, binders, fillers and the like, or combinations thereof. The composition may also comprise various antioxidants to retard oxidation of one or more component. Additionally, the prevention of the action of microorganisms can be brought about by preservatives such as various antibacterial and antifungal agents, including but not limited to parabens (e.g., methylparabens, propylparabens), chlorobutanol, phenol, sorbic acid, thimerosal or combinations thereof.
In a specific embodiment of the present invention, the composition is combined or mixed thoroughly with a semi-solid or solid carrier. The mixing can be carried out in any convenient manner such as grinding. Stabilizing agents can be also added in the mixing process in order to protect the composition from loss of therapeutic activity, /. e.. denaturation in the stomach. Examples of stabilizers for use in the composition include buffers, amino acids such as glycine and lysine, carbohydrates such as dextrose, mannose, galactose, fructose, lactose, sucrose, maltose, sorbitol, mannitol, etc.
In further embodiments, the present invention may concern the use of a pharmaceutical lipid vehicle compositions that include a BMP peptide, one or more lipids, and an aqueous solvent. As used herein, the term“lipid” will be defined to include any of a broad range of substances that is characteristically insoluble in water and extractable with an organic solvent. This broad class of compounds are well known to those of skill in the art, and as the term “lipid” is used herein, it is not limited to any particular structure. Examples include compounds which contain long-chain aliphatic hydrocarbons and their derivatives. A lipid may be naturally-occurring or synthetic (i.e., designed or produced by man). Lipids are well known in the art, and include for example, neutral fats, phospholipids, phosphoglycerides, steroids, terpenes, lysolipids, glycosphingolipids, glycolipids, sulphatides, lipids with ether and ester- linked fatty acids and polymerizable lipids, and combinations thereof.
One of ordinary skill in the art would be familiar with the range of techniques that can be employed for dispersing a composition in a lipid vehicle. For example, the BMP peptide may be dispersed in a solution containing a lipid, dissolved with a lipid, emulsified with a lipid, mixed with a lipid, combined with a lipid, covalently bonded to a lipid, contained as a suspension in a lipid, contained or complexed with a micelle or liposome, or otherwise associated with a lipid or lipid structure by any means known to those of ordinary skill in the art. The dispersion may or may not result in the formation of liposomes.
The actual dosage amount of a composition of the present invention administered to an animal patient can be determined by physical and physiological factors such as body weight, severity of condition, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the patient and on the route of administration. Depending upon the dosage and the route of administration, the number of administrations of a preferred dosage and/or an effective amount may vary according to the response of the subject. The practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject.
In certain embodiments, BMP peptide pharmaceutical compositions may comprise, for example, at least about 0.1% of the peptide, about 0.5% of the peptide, or about 1.0% of the peptide. In other embodiments, the peptide may comprise between about 2% to about 75% of the weight of the unit, or between about 25% to about 60%, for example, and any range derivable therein. Naturally, the amount of the peptide in each therapeutically useful composition may be prepared in such a way that a suitable dosage will be obtained in any given unit dose of the compound. Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, as well as other pharmacological considerations will be contemplated by one skilled in the art of preparing such pharmaceutical formulations, and as such, a variety of dosages and treatment regimens may be desirable.
In other non-limiting examples, a dose of BMP peptide may also comprise from about 0.1 microgram/kg/body weight, about 0.2 microgram/kg/body weight, about 0.5 microgram/kg/body weight, about 1 microgram/kg/body weight, about 5 microgram/kg/body weight, about 10 microgram/kg/body weight, about 50 microgram/kg/body weight, about 100 microgram/kg/body weight, about 200 microgram/kg/body weight, about 350 microgram/kg/body weight, about 500 microgram/kg/body weight, about 1 milbgram/kg/body weight, about 5 milbgram/kg/body weight, about 10 milbgram/kg/body weight, about 50 milbgram/kg/body weight, about 100 milbgram/kg/body weight, about 200 milbgram/kg/body weight, about 350 milligram/kg/body weight, about 500 milbgram/kg/body weight, to about 1000 mg/kg/body weight or more per administration, and any range derivable therein. In non- limiting examples of a derivable range from the numbers listed herein, a range of about 5 mg/kg/body weight to about 100 mg/kg/body weight, about 5 microgram/kg/body weight to about 500 milbgram/kg/body weight, etc., can be administered, based on the numbers described above.
In further embodiments, BMP peptide may be administered via a parenteral route. As used herein, the term“parenteral” includes routes that bypass the alimentary tract. Specifically, the pharmaceutical compositions disclosed herein may be administered for example, but not limited to intravenously, intradermally, intramuscularly, intraarterially, intrathecally, subcutaneous, or intraperitoneally U.S. Patents 6,537,514, 6,613,308, 5,466,468, 5,543,158; 5,641,515; and 5,399,363 (each specifically incorporated herein by reference in its entirety). Solutions of the active compounds as free base or pharmacologically acceptable salts may be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (U.S. Patent 5,466,468, specifically incorporated herein by reference in its entirety). In all cases the form must be sterile and must be fluid to the extent that easy injectability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (i.e., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils. Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it may be desirable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration. In this connection, sterile aqueous media that can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosage may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example,“Remington's Pharmaceutical Sciences” l5th Edition, pages 1035- 1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject. Moreover, for human administration, preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biologies standards. Sustained release formulations for treating of bone conditions include U.S. Patents 4,722,948, 4,843,112, 4,975,526, 5,085,861, 5,162,114, 5,741,796 and 6,936,270, all of which are incorporated by reference. Methods and injectable compositions for bone repair are described in U.S. Patents 4,863,732, 5,531,791, 5,840,290, 6,281,195, 6,288,043, 6,485,754, 6,662,805 and 7,008,433, all of which are incorporated by reference.
Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. A powdered composition is combined with a liquid carrier such as, e.g. , water or a saline solution, with or without a stabilizing agent.
B. Devices
In addition to providing BMP peptides for administration by routes discussed above, such agents, alone or in combination, maybe used in the context of devices, such as implants. A variety of bone related implants are contemplated, including dental implants, joint implants such as hips, knees, and elbows, vertebral/spinal implants, and others. The BMP peptide may be impregnated in a surface of the implant, including in a bioactive matrix or coating. The peptide may be further formulated to sustained, delayed, prolonged or time release. The coating may comprise polymers, for example, such as those listed below. The following is a list of U.S. patents relating to bone implants and devices which may be utilized in accordance with this embodiment of the invention:
TABLE A - BONE IMPLANT PATENTS
U.S. Patent* Patent Title
7,044,972 Bone implant, in particular, an inter-vertebral implant
7,022,137 Bone hemi-lumbar interbody spinal fusion implant having an asymmetrical leading end and method of installation thereof
7,001,551 Method of forming a composite bone material implant
6,994,726 Dual function prosthetic bone implant and method for preparing the same
6,989,031 Hemi-interbody spinal implant manufactured from a major long bone ring or a bone composite
6,988,015 Bone implant
6,981,975 Method for inserting a spinal fusion implant having deployable bone engaging projections
6,981,872 Bone implant method of implanting, and kit for use in making implants, particularly useful with respect to dental implants
6,929,662 End member for a bone fusion implant
6,923,830 Spinal fusion implant having deployable bone engaging projections
6,921,264 Implant to be implanted in bone tissue or in bone tissue supplemented with bone substitute material
6,918,766 Method, arrangement and use of an implant for ensuring delivery of bioactive substance to the bone and/or tissue surrounding the implant
6,913,621 Flexible implant using partially demineralized bone
6,899,734 Modular implant for fusing adjacent bone structure
6,860,884 Implant for bone connector
6.852.129 Adjustable bone fusion implant and method
6,802,845 Implant for bone connector
6,786,908 Bone fracture support implant with non-metal spacers
6,767,367 Spinal fusion implant having deployable bone engaging projections 6,761,738 Reinforced molded implant formed of cortical bone
6,755,832 Bone plate implant
6.730.129 Implant for application in bone, method for producing such an implant, and use of such an implant
6,689,167 Method of using spinal fusion device, bone joining implant, and vertebral fusion implant
6,689,136 Implant for fixing two bone fragments to each other
6,666,890 Bone hemi-lumbar interbody spinal implant having an asymmetrical leading end and method of installation thereof
6,652,592 Segmentally demineralized bone implant
6,648,917 Adjustable bone fusion implant and method
6,607,557 Artificial bone graft implant 6,599,322 Method for producing undercut micro recesses in a surface, a surgical implant made thereby, and method for fixing an implant to bone
6,562,074 Adjustable bone fusion implant and method
6,562,073 Spinal bone implant
0473,944 Bone implant
6,540,770 Reversible fixation device for securing an implant in bone
6,537,277 Implant for fixing a bone plate
6,506,051 Bone implant with intermediate member and expanding assembly
6,478,825 Implant, method of making same and use of the implant for the treatment of bone defects
6,458,136 Orthopedic instrument for sizing implant sites and for pressurizing bone cement and a method for using the same
6,447,545 Self-aligning bone implant
6,436,146 Implant for treating ailments of a joint or a bone
6,371,986 Spinal fusion device, bone joining implant, and vertebral fusion implant
6,370,418 Device and method for measuring the position of a bone implant
6,364,880 Spinal implant with bone screws
6,350,283 Bone hemi-lumbar interbody spinal implant having an asymmetrical leading end and method of installation thereof
6,350,126 Bone implant
6,287,343 Threaded spinal implant with bone ingrowth openings
6,270,346 Dental implant for bone regrowth
6,248,109 Implant for interconnecting two bone fragments
6,217,617 Bone implant and method of securing
6,214,050 Expandable implant for inter-bone stabilization and adapted to
extrude osteogenic material, and a method of stabilizing bones while extruding osteogenic material
6,213,775 Method of fastening an implant to a bone and an implant therefor
6,206,923 Flexible implant using partially demineralized bone
6,203,545 Implant for fixing bone fragments after an osteotomy
6,149,689 Implant as bone replacement
6,149,688 Artificial bone graft implant
6,149,686 Threaded spinal implant with bone ingrowth openings
6,126,662 Bone implant
6,083,264 Implant material for replacing or augmenting living bone tissue involving thermoplastic syntactic foam
6,058,590 Apparatus and methods for embedding a biocompatible material in a polymer bone implant
6,018,094 Implant and insert assembly for bone and uses thereof
5,976,147 Modular instrumentation for bone preparation and implant trial reduction of orthopedic implants 5,906,488 Releasable holding device preventing undesirable rotation during tightening of a screw connection in a bone anchored implant
5,899,939 Bone-derived implant for load-supporting applications
5,895,425 Bone implant
5,890,902 Implant bone locking mechanism and artificial periodontal ligament system
5,885,287 Self-tapping interbody bone implant
5,819,748 Implant for use in bone surgery
5,810,589 Dental implant abutment combination that reduces crestal bone stress
5,759,035 Bone fusion dental implant with hybrid anchor
5,720,750 Device for the preparation of a tubular bone for the insertion of an implant shaft
5,709,683 Interbody bone implant having conjoining stabilization features for bony fusion
5,709,547 Dental implant for anchorage in cortical bone
5,674,725 Implant materials having a phosphatase and an organophosphorus compound for in vivo mineralization of bone
5,658,338 Prosthetic modular bone fixation mantle and implant system
D38l,080 Combined metallic skull base surgical implant and bone flap
fixation plate
5,639,402 Method for fabricating artificial bone implant green parts
5,624,462 Bone implant and method of securing
D378,3l4 Bone spinal implant
5,607,430 Bone stabilization implant having a bone plate portion with integral cable clamping means
5,571,185 Process for the production of a bone implant and a bone implant produced thereby
5,456,723 Metallic implant anchorable to bone tissue for replacing a broken or diseased bone
5,441,538 Bone implant and method of securing
5,405,388 Bone biopsy implant
5,397,358 Bone implant
5,383,935 Prosthetic implant with self-generated current for early fixation in skeletal bone
5,364,268 Method for installing a dental implant fixture in cortical bone
5,312,256 Dental implant for vertical penetration, adapted to different degrees of hardness of the bone
* - The preceding patents are all hereby incorporated by reference in their entirety. V. Screening Assays
In still further embodiments, the present invention provides methods identifying new and useful BMP peptide for use in stimulating bone production. For example, a method generally comprises:
(a) providing a candidate BMP peptide or a combination of peptides;
(b) admixing the candidate peptide with a cell or a suitable experimental animal;
(c) measuring cartilage, osteoblast or osteoclast activity, or bone growth, strength, mass or formation; and
(d) comparing the characteristic measured in step (c) with that observed in the absence of the candidate peptide, optionally with a negative control peptide, wherein an increase between the measured characteristic indicates that said peptide is, indeed, a bone and cartilage production stimulator.
Assays may be conducted in isolated cells or in organisms including transgenic animals. Bone formation can be identified by the von Kossa or Alzarin Red stains, FTIR or Raman spectrometric analysis, or by fluorochromes linked to compounds that bind bone. Cartilage formation can be identified by alcian blue staining or MRI.
It will, of course, be understood that all the screening methods of the present invention are useful in themselves notwithstanding the fact that effective candidates may not be found. The invention provides methods for screening for such candidates, not solely methods of finding them.
VI. Examples
The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
EXAMPLE 1 - MATERIALS & METHODS
Reagents. Antibodies against human BMP2/BMP4 (BMP-2/4 (H-l): SC-137087) and BMP5 (AF6176 and MAB7151) were obtained from Santa Cruz (Dallas, TX) and R&D Systems (Minneapolis, MN), respectively. NeutrAvidin (NA), NA-HRP, NA-DyLight 488 (NA-488) and anti-mouse-HRP secondary antibody conjugate were obtained from Thermo- Fisher and Cell Signaling Technology (Danvers, MA). Heparan sulfate (Sigma # H7640) isolated from bovine kidney and hyaluronic acid (Sigma # 53747) from Streptococcus equisimilis were obtained from Millipore-Sigma (St. Louis, MO). Full-length human BMP2, 4, 5, 6 and 7 were obtained from R&D and ProSpec (East Brunswick, NJ).
Protein Modifications and Peptide Synthesis. Where indicated, full-length BMPs were biotinylated using EZ-Link Sulfo-NHS-LC-Biotin (Thermo-Fisher) in PBS in a total volume of 150 pl on ice for 1 hr. Reactions were quenched by the addition of 5 mΐ Tris-buffered saline (TBS) containing 50 pg BSA. Peptides encompassing the HS-binding domain from each BMP contained the putative Cardin-Weintraub (CW) motif and also a minimum of 3 flanking amino acids on the N- and C-terminal sides of the domain. Three Glycine residues were added to the N-terminus of each peptide to provide a flexible linker between an N-terminal biotin tag and the peptide itself. Peptides were purified by reverse phase HPLC (Cl 8 column), and peptide mass was confirmed by MALDI-TOF mass spectrometry. All peptides were synthesized and purified by Peptide 2 (Chantilly, VA). When indicated, biotinylated peptides were oligomerized into tetramers by incubation with NA or NA-HRP at a molar ratio of 50: 1 of peptide to NAHRP, with each avidin molecule binding 4 biotins (Dundas el al, 2013) and referred to as tetrameric complexes. Because the C-terminal peptides from BMP5 and BMP7 contain two Cys residues, they were prepared in water containing 1 mM dithiothreitol (DTT). Peptides were used within 2 weeks after being dissolved.
In Silico Modeling. Amino acid sequence alignments were performed using the T- coffee alignment tool (tcoffee.crg.cat). Helical wheel projections were constructed using DrawCoil 1.0 (world-wide-web at grigoryanlab.org/drawcoil). Secondary structure predictions made use of the structural information of BMP2 (PDB# 3BMP) and BMP7 (PDB# 1BMP ) and were carried out using the I-TASSER server for protein structure and function prediction (Yang et al. , 2015). Resulting structures were visualized using Chimera (world-wide-web at cgl.ucsf.edu/chimera). All peptides have isoelectric points (pi) > 10, with the exception of BMP4 C-terminal peptide, and are predicted to contain some alpha helix, except the C-terminal domain of BMP5-7.
Solid Phase Binding Assays. Nunc MaxiSorp flat bottom 96 well plates were coated with HS (5 pg/ml) in 50 mM carbonate buffer (pH 9.4) overnight at 4°C. Unless otherwise indicated, all binding assays were carried out in 1 x PBS, 0.1% tween 20 (PBST) containing 1% bovine serum albumin (PBSTB). Plates were incubated with peptides for a minimum of 2 hr at room temperature with gentle shaking. At the termination of the binding assay, the plates were washed 3 times with PBST and a final rinse with PBS. Plates were developed by addition of HRP substrate O-phenylenediamine dihydrochloride (OPD) in phosphate-citrate buffer (50 mM sodium phosphate and 25 mM citric acid, pH 5) and read at 450 nm. Very low levels of background binding were exhibited by NA-HRP alone or when complexed with biotinylated- BSA.
To assess binding of full-length rhBMP2, rhBMP4 and rhBMP5, proteins were applied to 96 well HS-coated plates in PBST at indicated concentrations for 2 hr at 4°C. Plates were rinsed 3 times with PBST, and bound proteins were assessed with BMP-specific antibodies. To assess binding of full-length rhBMP6 and rhBMP7, the proteins were first labeled with biotin and applied to 96 well HS-coated plates in PBST for 2hr. The plates were washed, incubated with NA-HRP, washed again, and developed with OPD substrate. Similar results were obtained with heparin-coated plates.
Competition Assays. HS plates were incubated with full-length rhBMP2 or rhBMP5 (4 mM) in the presence of increasing amounts of peptides in PBST for 2 hr with gentle shaking. The plates were washed, and bound BMP2 and BMP5 were assessed using anti-BMP2 antibody (1 :2000) and anti-BMP5 antibody (1 :2000) followed by anti-mouse HRP secondary antibody conjugate (1:5000). Plates were developed by addition of OPD substrate.
Cells and Cell Culture. K562 human myelogenous leukemia cells (Lozzio & Lozzio, 1979) and AD293 cells were grown in DMEM containing 10% fetal calf serum. Micromass cultures were prepared from El l CD-l mouse embryo limb buds (Mundy etal., 2016). Briefly, limb bud mesenchyme was dissociated in 0.5% trypsin-EDTA at 37°C. The dissociated cells were suspended at a concentration of 10 x 106 cells/ml in DMEM containing 3% fetal bovine serum and antibiotics. Micromass cultures were initiated by spotting 15 pl of cell suspensions (1.5 x 105 cells) onto the surface of 12-well tissue culture plates. After a 90 minute incubation at 37°C in a humidified CCh incubator to allow for cell attachment, the cultures were given 0.5 ml of medium. After 24 hr, cultures were treated with full-length BMP proteins or tetrameric peptide complexes in the same medium. Fresh reagents, including BMP proteins or peptides, were given with medium change every third day. Cultures were stained with Alcian blue (pH 1.0) after 3 days to monitor chondrogenic cell differentiation or processed for PCR analysis of gene expression (Mundy et al, 2016). Images were taken with a Nikon SMZ-U microscope equipped with a SPOT insight camera (Diagnostic Instruments, Inc.; Sterling Heights, MI) and acquired with SPOT 4.0 software. Micromass analysis was performed using Image! Images were made binary under an RGB threshold and“Particle Analysis” was utilized to measure Alcian blue positive area and nodule number (Gutierrez el al, 2012).
FACS analysis of peptide binding. K562 cells were washed with PBS and fixed with 2% buffered formalin for 20 min on ice. The cells were washed with PBS and blocked by incubation in PBS, 1% BSA for 20 min on ice. Approximately 106 cells (100 pl) were incubated with peptide tetramers containing fluorescent NA-488. Following incubation for 2 hr on ice, the cells were washed and analyzed on a BD Accuri Flow Cytometer located in the Flow Cytometry Core Laboratory in the inventors’ institution.
Gene Expression analysis. Total RNA was isolated using TRIzol Reagent (Thermo Fisher Scientific) following the manufacturers protocol. Five pg of glycogen (Thremo Fisher #AM95lO) was added to the aqueous phase prior to the addition of isopropanol to facilitate RNA precipitation. RNA quantification was determined using a Nanodrop spectrophotometer. cDNA was prepared from 2 pg of purified RNA using a Verso cDNA synthesis Kit (Thermo Scientific # AB1453A) following the manufactures protocol. Gene expression was determined by Quantitative real-time PCR (qPCR) using SYBR Green PCR Master Mix in an ABI 7500 Real-Time PCR System, located in the NAPCore facility in the inventors’ institution. GAPDH was used as the endogenous control and relative expression was calculated using the AACt method. All PCR primers were obtained from Integrated DNA Technologies (Coralville, IA; world-wide-web at idtdna.com) and are listed in Table 2.
Statistical Analysis. All statistical analysis was performed using GraphPad Prism software (world-wide-web at graphpad.com).
EXAMPLE 2 - RESULTS
N-terminal Regions Have Distinct Sequences and Binding Properties. As indicated above, the N-terminal regions of mature BMP5, BMP6 and BMP7 upstream of the cysteine knot are much longer than those in BMP2 and BMP4 and are currently thought to contain a major HS binding domain (Brkljacic et al, 2013; Irie el al, 2003; Gandhi & Mancera, 2012). To ask what may lie behind such length difference, the inventors aligned the N-terminal regions from each BMP protein and compared the putative HS-binding domains within them, using the first conserved cysteine as a reference mark (FIG. 1A). As expected, the HS binding domains of BMP2 and BMP4 exhibited typical Cardin-Weintraub (CW) motifs with XBBXBX (SEQ ID NO: 4) and XBBBXBX arrangements, respectively (FIG. 1A), and their amino acid sequences are highly conserved from Xenopus to humans (FIG. 1B and FIGS. 11A-B). In comparison, the putative HS binding domains in BMP5, BMP6 and BMP7 were not only further upstream of the first cysteine (FIG. 1A), but also had unusual sequence features. The domains in BMP5 and BMP6 consisted of three basic residues separated from the next single basic residue by three non-charged amino acids, and the domain in BMP7 lacked a doublet or triplet of basic residues altogether (FIG. 1A). These considerations raised the question whether these domains in BMP5, BMP6 and BMP7 were actually able to interact with HS. To investigate this, the inventors synthesized 20-25 amino acid-long peptides spanning the predicted HS-binding domain of each of the five BMPs (FIG. 2A) and tested them in solid phase binding assays with immobilized HS. The BMP2- and BMP4-derived peptides readily bound to HS and exhibited saturable binding curves, yielding calculated Kas of about 100 nM (FIG. 3A). However, the peptides derived from BMP5, BMP6 and BMP7 did not bind appreciably (FIG. 3A), and the same outcome was observed when the microwell plates were coated with heparin instead of HS (not shown).
It is possible that when free in solution, the BMP5/6/7 peptides might have acquired abnormal conformations that precluded or inhibited their natural interactions with HS. To address this question, the peptides from the five proteins were preassembled and tethered into tetrameric complexes by incubation with NeutrAvidin-horseradish peroxidase (NA-HRP) (FIG. 4A) and tested in solid phase HS binding assays (FIG. 4B). Interestingly, the tetrameric peptide complexes from BMP2 or BMP4 not only bound to HS, but did so with higher affinity (Kd ~ 6 nM) (FIG. 4B) than their respective monomeric peptides (FIG. 3A); their binding was fully prevented by addition of soluble heparin (FIG. 4B). However, the tetrameric peptide complexes from BMP5, BMP6 or BMP7 were still unable to appreciably bind to HS (FIG. 4C). As expected, full length recombinant human (rh) BMP2, 4, 5, 6 and 7 readily interacted with immobilized HS and did so with comparable affinities (FIGS. 3B-C).
The C-terminal Region of BMP5/6/7 Contains a CW Motif. The ability of full length rhBMP5, rhBMP6 and rhBMP7 to bind to immobilized HS in contrast to the very poor binding by monomeric or tetrameric peptides from their N-terminal regions led us to consider whether the main HS-binding domain in these proteins may reside elsewhere. Thus, the inventors aligned the entire amino acid sequences of these BMPs (FIGS. 11 A-B) and searched for possible additional CW-like motifs. Indeed, they noted that their C-terminal region did contain one such motif with a XBBXBX (SEQ ID NO: 4) configuration (FIG. 5A). Intriguingly, in the corresponding C-terminal region in BMP2 and BMP4, the motif was different and contained non-charged residues in place of Lys and Arg (FIG. 5A), thus likely minimizing its potential ability to interact with HS. To test these predictions, the inventors prepared monomeric and tetrameric peptides spanning the C-terminal region of BMP4, 5, 6 and 7 (FIG. 2B) and tested them for HS binding in solid phase assays. The inventors chose the C-terminal peptide from BMP4 as a representative for the BMP2/4 subfamily, as their sequences are nearly identical. In line with the inventors’ reasoning above, the peptides from BMP5, 6 and 7 did in fact bind to HS with high affinity (Kd ~ 9 nM) and were competed out by soluble heparin (FIGS. 5B-C), while the peptide from BMP4 bound poorly (FIG. 5B).
The N-terminal and C-terminal Domains Display Different Configurations. The differential ability of N-terminal or C-terminal BMP domains to interact with HS raised the question as to whether there may be differences in their 3D configuration and spatial arrangement, possibly providing further insights into the basis of protein-HS interactions. Thus, the inventors utilized the I-TASSER server at the University of Michigan that allows for protein structural and functional predictions (Y ang el al. , 2015). F ocusing on BMP2, BMP4 and BMP5 as representatives of the two BMP subgroups above, they found that their N-terminal domains displayed a helical structure, more prominent in BMP2 and BMP4 than BMP5 (FIGS. 6A-C). The inventors subjected the domains to helical wheel projection analysis. Quite interestingly, the basic residues in BMP2 and BMP4 aligned to form a large cationic cluster along one face of the helix (FIGS. 6D-E), whereas the basic residues in BMP5 were separated by non-charged amino acids seemingly preventing the assembly of a large cationic surface (FIG. 6F). The latter provides an additional explanation for poor HS binding of the BMP5 N-terminal peptide (see FIG. 3A).
The inventors carried out a similar I-TASSER analysis of the C-terminal domains of BMP2, BMP4 and BMP5, but they turned out to have largely unstructured configurations with no obvious pattern (FIGS. 6G-I). This indicates that the strong HS-binding properties of the C- terminal domain in BMP5 (and by extension, BMP6 and BMP7) are mainly due to its specific amino acid sequence and spacing.
The Peptides Have Differential Cell Surface-Binding Abilities. Next, the inventors asked whether the differential ability of N-terminal and C-terminal peptides from the five BMPs to interact with immobilized HS was also displayed in their binding to the cell surface, thus providing insights into the interactive behaviors of mature BMPs. To address this question, the inventors carried out FACS analyses using K562 cells as a convenient in vitro model system. Cells were briefly fixed and incubated for 2 hrs on ice with N-terminal or C-terminal peptides from BMP2, BMP4, BMP5, BMP6 or BMP7 that had been pre-assembled into tetramers by incubation with fluorescent NA-488. After incubation, the cells were washed, and FACS was used to assess the levels of bound peptides. The N-terminal peptides from BMP2 and BMP4 prominently bound to the cells, while those derived from BMP5 did not (FIG. 7A). BMP2/4 peptide binding was inhibited by addition of soluble heparin or pre-treatment of the cells with trypsin (FIG. 7A). Virtually opposite results were obtained with the C-terminal peptides. The BMP5 peptide readily bound to the cells while the BMP4 peptide did not (FIG. 7B); binding was prevented by soluble heparin.
To further evaluate peptide-binding specificity to the cell surface, the tetrameric peptide complexes were pre-incubated with soluble heparin, HS or hyaluronic acid (HA), a non- sulfated glycosaminoglycan, and were then incubated with K562 cells for 2 hrs as above. Cells were washed, and levels of peptide binding was assessed by FACS. Peptide binding was prevented by heparin and HS, albeit to a slightly lesser extent (data not shown). In contrast, HA was not able to prevent binding in a significant manner. The data indicate that binding of the BMP2N, BMP4N and BMP5C peptides to the cell surface was specific and competed out by soluble heparin and HS.
Peptides Can Stimulate Chondrogenic Cell Differentiation. A previous study indicated that a peptide spanning the N-terminal HS-binding domain of BMP 4 (residues 15 to 24 within the mature protein) had biological activity on its own and stimulated osteogenic cell differentiation in cultures of human mesenchymal stem cells (Choi etal., 2010). To investigate the potential biological activity of the BMP peptides characterized in this study, the inventors determined their effects on chondrogenic differentiation, using micromass cultures of mouse embryo limb bud mesenchymal cells (Huegl, 2015). Indeed, treatment with N-terminal tetrameric peptide complexes from BMP2 or BMP4 or C-terminal peptide complex from BMP5 stimulated chondrogenesis appreciably (FIGS. 8D-F). As expected, full length rhBMP2 stimulated chondrogenesis as well (FIG. 8C). This stimulation was evident by alcian blue staining of cartilage nodules (FIGS. 8D-F) and computer-assisted image quantification of the nodules (FIG. 8G) compared to untreated control cultures (FIGS. 8A and 8G) or cultures treated with empty NA backbone (FIGS. 8B and 8G). To verify these data, the inventors carried out quantitative PCR analyses of chondrogenic genes (Lefebvre & Bhattaram, 2010) and found that expression of Sox9, collagen 2 and aggrecan was stimulated in peptide-treated cultures compared to controls (FIGS. 8H-J). The peptides were also able to stimulate the expression of Idl, a direct target of canonical BMP signaling (Katagiri et al, 2002) (FIG. 8K).
The Peptides Exhibit Binding-Competition Ability Toward Their Respective Proteins. The stimulatory effects of the peptides on chondrogenesis could be due to a variety of mechanisms. One possibility is that the peptides competed with binding of endogenous BMPs to cell surface HS and rendered the proteins available for further biological action. To gain insights into this possibility, the inventors carried out solid phase competition assays using peptides and full-length rhBMP2 and rhBMP5. HS-coated microplates were incubated with rhBMP2 (FIG. 9A) or rhBMP5 (FIG. 9B) in the presence of increasing amounts of N-terminal BMP2, BMP4 or BMP5 peptide or C-terminal BMP5 peptide. Binding of rhBMP2 to HS was readily competed out by the BMP2 or BMP4 peptides, but minimally by both BMP5 peptides (FIG. 9A). In good agreement, rhBMP5 binding to HS was competed by its HS-binding C- terminal peptide but not the non-binding N-terminal peptide (FIG. 9B). Interestingly however, rhBMP5 binding was also inhibited by the BMP2/4 peptides (FIG. 9B).
EXAMPLE 3 - DISCUSSION
The data in this study reveal that the C-terminal regions of mature BMP5, BMP6 and BMP7 contain a domain characterized by strong HS-binding ability. The amino acid sequence of this domain is virtually identical in the three BMPs and is highly conserved through evolution (see FIG. 12). As indicated by the solid phase assays, peptides encompassing this C- terminal domain bind to HS with nanomolar affinities comparable to those exhibited by peptides of the N-terminal domain of BMP2 and BMP4. The solid phase assays show that the different peptides also possess significant specificity in their ability to compete with BMP binding, indicating that their respective amino acid sequences are functionally distinctive and discriminatory. Previous studies found that mutations of basic residues within the N-terminal domain of BMP2 and BMP4 reduced HS binding and also altered the bioactivity of the mutant proteins (Ruppert el al, 1996; Ohkawara el al, 2002). Interestingly however, mutations of basic residues within the N-terminal domain of BMP7 were found to have no major effect on HS binding (McClarence, 2011), hinting at the possibility that the major HS-binding domain may actually reside elsewhere along the protein as in fact shown here. In sum, these data and previous studies provide strong evidence that the C-terminal domain in BMP5/6/7 and the N- terminal domain in BMP2/4 represent major and selective mediators of HS binding.
The HS-binding C-terminal and N-terminal domains of these BMPs contain a motif conforming to typical CW structures. Cardin and Weintraub originally proposed that the positively charged amino acids in the XBBBXXBX (SEQ ID NO: 5) motif would be arrayed on one face of an a-helix, whereas they would be aligned on one side of a a-strand in the XBBXBX (SEQ ID NO: 4) motif (Cardin & Weintraub, 1989), providing a suitable surface for interaction with sulfated sugar clusters along the HS chains in each case (Sarrazin etal, 2011). Subsequent studies have emphasized the importance of spacing among positively charged amino acids, irrespective of whether they are arranged in an a-helix or a b-strand (Fromm el al, 1997; Margalit et al, 1993). Protein structure predictions and mapping of electrostatic surfaces have suggested that the mature BMP2 dimer exhibits two electropositive surfaces, whereas the BMP7 dimer exhibits a single one (Gandhi & Mancera, 2012). A major conclusion of this work was that the BMP2 dimer would possess two major HS-binding domains in line with previous protein-HS binding kinetics data (Ruppert et al, 1996), whereas BMP7 would possess one only. The authors speculated that the two surfaces in the BMP2 dimer were provided by the N-terminal a-helical CW domain of each monomer, with the two domains located on opposite sides of the dimer fingers held together by the central wrist/palm region (Rider & Mulloy, 2017; Gandhi & Mancera, 2012). However, no explanation was given as to why the BMP7 dimer would display one electropositive surface only. Based on the data indicating that the major HS-binding motif in BMP7 is in the C-terminus, it is possible that the single surface could originate from two C-terminal unstructured domains arranged in proximity within the wrist/palm region of the dimer as suggested by structural predictions with the I- TASSER server (FIG. 10).
It is important to point out that this server carries out protein/peptide structure predictions by searching the Protein Data Bank (PDB) and relating the input sequence to known protein structures with similar or identical sequences (Yang et al. , 2015). Thus, the predicted structure of the peptides characterized here may not fully mimic their native configurations within the intact protein. Given their biological activities, however, it is likely that the peptides did possess functionally relevant configurations. This was indicated by their selective ability to interact with substrate-bound HS, bind to the cell surface, stimulate chondrogenesis and compete with binding of their respective full-length proteins.
Deciphering the exact 3D organization and features of BMP dimers will require further analysis, and the contribution of single or groups of basic residues -distant from the CW motifs- will need to be taken into consideration to precisely delineate the overall structural basis of BMP-HS interactions (Billings & Pacifici, 2015; Chang et al, 2011; Whalen et al, 2013). It will be necessary also to clarify the spatial orientation of different BMPs with respect to the HS chain backbone given that their electropositive surfaces differ in location and structure as suggested above. In addition, the HS chains themselves are endowed with a remarkable degree of structural diversity and complexity they acquire during their biosynthesis in the Golgi and by action of extracellular sulfatases (Sarrazin et al, 2011; Bishop et al, 2007). The synthesis of HS chains initiates with the assembly of a tetrasaccharide linkage region to prescribed serine residues along the proteoglycan core proteins. Chain polymerization continues with addition of aN-acetyl-D-glucosamine (GlcNAc) residue and then proceeds with alternating addition of glucuronic acid (GlcA) and GlcNAc residues by EXT1/EXT2 glycosylpolymerase complexes, producing HS chains of about 20 to 25 kDa in size. While these steps are ongoing, the elongating chains undergo a series of concurrent structural modifications that start with N- deacetylation and A-sulfation of GlcNAc residues by members of the N-deacetylase-N- sulfotransferase family. Modifications continue with epimerization of certain D-glucuronic acid residues to L-iduronic acid and with 0-sulfation at positions C2, C6 or C3 around glucosamine and glucuronic/iduronic rings by O-sulfotransferase family members. Such multiple serial biosynthetic steps result in chains with highly diverse sulfation and sugar modification patterns within 6-12 sugar residue-long segments flanked by largely unmodified and un-sulfated segments (Sarrazin el al, 2011; Bishop el al. , 2007). These features are thought to represent the basis for the ability of HS chains to strongly and specifically interact with proteins (Bishop etal, 2007; Billings & Pacifici, 2012; Xu & Esko, 2014). Some proteins such as fibroblast growth factor 2 (FGF2) and antithrombin require specific modifications of HS for optimal binding including 3-0 sulfation (Richard et al., 2009; Turnbull et al., 1992; Schultz et al, 2017), whereas other proteins such as IL-8 and thrombin mainly rely on HS domain structure or charge density, respectively (Lortat-Jacob et al, 1995; Spillmann et al, 1998). At present, relatively little is known about HS structural features mediating BMP interactions and whether different BMPs require distinct HS modifications and segments for optimal binding (Xu & Esko, 2014; Matsuo & Kimura-Yoshida, 2014), though the BMP antagonist Noggin preferentially binds to HS carrying N-, 6-0- and 2-0-sulfates (Viviano et al, 2004). Nonetheless, it is interesting to note that while HS is a positive regulator of the biological function of certain signaling proteins such as FGF2 (Omtiz and Itoh, 2015; Shimokawa et al, 2011), it appears to normally restrain and limit the function and activity of BMPs (Ruppert et al, 1996; Ohkawara et al, 2002). Together, the above studies underline the striking diversity and subtleties of HS-protein interactions that are of essential importance to numerous developmental and physiologic processes (Salazar et al, 2016; Matsuo & Kimura-Yoshida, 2014; Lin, 2004) and can cause pathologies when deranged (Lindahl & Kjellen, 2013).
Amongst the latter, a case in point is Hereditary Multiple Exostoses, a rare congenital pediatric disorder that is caused by loss-of-function mutations in EXT1 or EXT 2 and involves significant decreases in HS levels (Cheung et al, 2001; Hecht et al, 1995). HME is characterized by cartilaginous tumors (called exostoses or osteochondromas) that develop within perichondrium flanking the growth plates of long bones, ribs and other elements, but the underlying mechanisms had long remained unclear (Hecht et al. , 2005; Jones et al. , 2011). Using mouse models, the inventors found that conditional Extl ablation in perichondrial cells (and concurrent drop in HS levels) caused a sharp decrease in local ERK/FGF signaling and a reciprocal increase in canonical BMP signaling (Huegel et al., 2013; Sinha et al. 2017). These opposing signaling changes were followed by the development of cartilaginous tumors in very good correlation with the fact that normally, BMP signaling is pro-chondrogenic while ERK/FGF signaling is anti-chondrogenic (Buckland et al, 1998; Yoon el al, 2006). The inventors do not know yet which BMP(s) is/are the main culprits in inducing ectopic chondrogenesis and osteochondroma formation in HME, although the preferential expression and function of BMP2 in perichondrium point to this protein as a pathogenic candidate (Tsuji et al, 2006). Nonetheless, the studies stress the point that HS plays a critical role in fine-tuning the local activities, range of action and developmental effects of different HS-binding proteins (Bishop et al, 2015) and that severe consequences can ensue when these balances are not maintained.
Given their pro-skeletogenic properties, recombinant human BMP2 and BMP7 are currently used clinically to stimulate fracture repair and spine fusion (James et al, 2010; Lissenberg-Thunnissen et al, 2011). However, because the proteins are very potent and are used in large excess over endogenous levels in these clinical conditions, they exert broad and unrestrained action and can elicit side effects, at times severe ( James et al, 2010; Lissenberg- Thunnissen etal, 2011). One possible way to alleviate these problems would be to use peptides that mimic properties of their full-length counterparts (Janda etal, 2017) and/or induce similar biological responses. One example is the study cited above in which a peptide spanning the N- terminal HS-binding domain of BMP4 was found to stimulate osteogenic cell differentiation in vitro and bone repair in vivo in a manner similar to full length rhBMP4 (Choi et al, 2010). These data complement well and extend those observations and show that peptides spanning the HS-binding domain of BMP2 and BMP4 at the N-terminus and of BMP5 at the C-terminus stimulate chondrogenesis and chondrogenic gene expression in primary mouse embryo limb bud cells in micromass culture. The solid phase binding assays indicate that the peptides can compete with their full-length counterparts for HS binding, demonstrating also a degree of selectivity and specificity. In recent studies, the inventors demonstrated the presence of endogenous BMPs bound to the cell surface (Mundy et al, 2018) and also observed that treatment with heparitinase (in the absence of exogenous BMPs) greatly and rapidly stimulated canonical BMP signaling and chondrogenic cell differentiation (Huegel et al, 2015; 2013). Therefore, it is likely that the peptides were able to exert pro-chondrogenic effects by: dislodging endogenous HS-bound BMPs; reducing the normal restraining effects of HS on BMP availability and action; and allowing the proteins to exert greater biological activity. By relying on endogenous BMPs and stimulating their action, the peptides may prove to be a safer and more versatile strategy for treatment of fracture repair, spine fusion and related clinical problems. In addition, the peptides could be used in combination with rhBMP2 or rhBMP7 to reduce the amounts of these proteins needed for treatment as data in FIG. 13 suggest, thus likely rendering their use much safer.
Table 1 - Sequence Information for Human BMP proteins
Protein Accession1 Size Signal Pro-region Mat Peptide
BMP2 NP_00l l9l 396 1-23 24-281 283-396
BMP4 NP_00l l93 408 1-24 25-293 293-408
BMP5 NP 066551 454 1-30 31-316 317-454
BMP6 NP_00l709 517 1-20 21-374 375-517
BMP7 NP 001710 431 1-29 30-292 293-431
1 - NCBI accession number
Table 2 - Primers used for qPCR
Gene Accession1 Sequence Position2 hGAPDH NM 002046 F: 5’ - AG ATC ATC AGC AATGCCTCCTG 536-644 (109)
R: 5’ - ATGGC ATGGACTGTGGTC ATG
(F = SEQ ID NO: 8; R = SEQ ID NO: 9)
hIDl NM 002165 F: 5’ -GGTGGAGATTCTCCAGC ACG 283-333 (51)
R: 5’ -TCCAACTGAAGGTCCCTGATG
(F = SEQ ID NO: 10; R = SEQ ID NO: 11)
mGAPDH NM 008084 F: 5'ATCTTGGGCTACACTGAGGA 1051-1172 (122)
R: 5 'C AGG AAATG AGCTTG AC AA AGT
(F = SEQ ID NO: 12; R = SEQ ID NO: 13)
mSox9 NM 011448 F: 5'GAGCTCAGCAAGACTCTGGG 775-905 (131)
R: 5'CGGGGCTGGTACTTGTAATC
(F = SEQ ID NO: 14; R = SEQ ID NO: 15)
mAggrecan NM 007424 F: 5'GGAGCGAGTCCAACTCTTCA 105-224 (120)
R: 5'CGCTCAGTGAGTTGTCATGG
(F = SEQ ID NO: 168; R = SEQ ID NO: 17)
mCol2al NM 031163 F: 5' CTACGGTGTCAGGGCCAG 292-407 (116)
R: 5' GTGTCACACACACAGATGCG
(F = SEQ ID NO: 18; R = SEQ ID NO: 19)
1 - NCBI Accession number
2 - Numbers in parenthesis, amplicon size in bp. Table 3 - Accession Numbers for BMP Proteins from Different species
BMP protein Species Nucleotide1 Protein1
BMP2 H. sapiens NM_00l200 NP_00l 191
BMP2 M. musculus NM_007553 NP_03l579
BMP2 F. catus XM_003983769 XP_0039838l8
BMP2 G. gallus NM_204358 NP_989689
BMP2 X. tropicalis NM 001015963 NP 001015963
BMP4 H. sapiens NM_00l202 NP_00l 193
BMP4 M. musculus NM_007554 NP_03l580
BMP4 F. catus XM_006932864 XP_006932926
BMP4 G. gallus NM_205237.3 NP_990568
BMP4 X. tropicalis NM 001017034 AAY90071
BMP5 H. sapiens KC485577 NP_06655l
BMP5 M. musculus NM_007555 NP_03l58l
BMP5 F. catus XM_003986274 XP_003986323
BMP5 G. gallus NM_205l48.3 NP_990479
BMP5 X. tropicalis XM 002934847 XP 004914553
BMP6 H. sapiens NM_001718 NP_00l709
BMP6 M. musculus NM_007556 NP_03l582
BMP6 F. catus XM_023253693 XP_023109461
BMP6 G. gallus XM_015275997 CR_015131483
BMP6 X. tropicalis NM 001112907 NP 001106378
BMP7 H. sapiens NM_001719 NR_001710
BMP7 M. musculus NM_007557 NP_03l583
BMP7 F. catus XM_0l 1280760 XP_011279062
BMP7 G. gallus XM_417496 cr_417496
BMP7 X. tropicalis XM 012970500 AAT72008
1 - NCBI accession number
All of the compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.
VII. References
The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference.
U.S. Patent 4,196,265
U.S. Patent 4,722,948
U.S. Patent 4,843,112
U.S. Patent 4,863,732
U.S. Patent 4,975,526
U.S. Patent 5,571,714
U.S. Patent 5,772,998
U.S. Patent 5,783,185
U.S. Patent 5,085,861
U.S. Patent 5,162,114
U.S. Patent 5,399,363
U.S. Patent 5,466,468
U.S. Patent 5,531,791
U.S. Patent 5,543,158
U.S. Patent 5,580,579
U.S. Patent 5,629,001
U.S. Patent 5,641,515
U.S. Patent 5,741,796
U.S. Patent 5,792, 451
U.S. Patent 5,840,290
U.S. Patent 5,972,703
U.S. Patent 6,074,674
U.S. Patent 6,270,750
U.S. Patent 6,281,195
U.S. Patent 6,288,043
U.S. Patent 6,485,754
U.S. Patent 6,537,514
U.S. Patent 6,613,308
U.S. Patent 6,662,805 U.S. Patent 6,936,270
U.S. Patent 7,008,433
Alliston et al. , EMJO. J, 20(9):2254-2272, 2001.
Ashton et al, Bone, 6:313-319, 1985.
Aubin, Biochem. Cell Biology. 76:899-910. 1998.
Balooch et al. , Proc. Natl. Acad. Sci. USA, 102(52): 18813-18818, 2005.
Beamer et al. , Bone, l8(5):397-403, 1996.
Beidler et al, J. Immunol., 141(11):4053-4060, 1988.
Bleiberg, Connect Tissue Res., 14: 121-127, 1985.
Campbell et al., Am. Rev. Respir. Dis. , 130(3):417-423, 1984.
Cavo et al, New England Journal of Medicine 354: 1076-1078, 2006.
Dempster et al. , Endocr. Rev., l4(6):690-709, 1993.
EP Application 125,023
EP Application 171,496
EP Application 173,494
EP Application 184, 187
Filvaroff et al, Development, 126(19):4267-4279, 1999.
Friedenstein et al, Exp. Hematol, 10:217-227,1982.
Friedenstein et al, Transplantation, 6:230-247,1968.
Gefter et al, Somatic Cell Genet., 3:231-236, 1977.
Goding, In: Monoclonal Antibodies: Principles and Practice, 2d ed., Academic Press, Orlando, Fl, pp 60-61, 71-74, 1986.
Gronthos et al, Blood, 84:4164-4173, 1994.
Gronthos et al, J. Bone Min. Res., 14:47-56, 1999.
Harlow and Lane, In: Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988.
Hwang et al, Crit. Rev. Ther. Drug Carrier Syst., l5(3):243-284, 1998.
Itoh et al, J. Bone Miner res., 15(9): 1766-1775, 2000.
Jaiswal et al, J. Biol. Chem., 275:9645-9652, 2000.
Jones et al, Nature, 321:522-525, 1986.
Kadiyala et al. Cell Transplantation, 6: 125-134, 1997.
Kale et al. , Nat. Biotech., 18:954-958, 2000.
Kang et al, EMBO. J, 24(l4):2543-2555, 2005.
Karst et al., J. Cell Physiol., 200:99-106, 2004. Katagirl et al., Biochem. Biophys. Res. Commun., l72(l):295-299, 1990.
Kohler and Milstein, Eur. J. Immunol., 6:511-519, 1976.
Kohler and Milstein, Nature, 256:495-497, 1975.
Lee and Lorenzo, Endocrinology, l40(8):3552-356l, 1999.
Lieber et aI., ArrI. Spectrosc. 57:1363-67, 2003.
Long, J. Clin. Invest., 95:881-887, 1995.
Mathiowitz et al, Nature, 386(6623):410-414, 1997.
Mohammad et al, PLoS ONE, 4:e5275, 2009.
Morrison, Science, 229(4719): 1202-1207, 1985.
Mundy and Bonewald, Ann. NY Acad. Sci., 593:91-97, 1990.
Oliver & Pharr, J. Mater. Res., 19:3-20, 2004.
PCT Appln. PCT/US86/02269
PCT Appln. WO 86/01533
Petite et al, Nat. Biotech., 18:959-963, 2000.
Phinney et al, J. Cellular Biochem., 75:424-436,1999.
Pittenger et al, Science, 284: 143-147,1999.
Quinn et al., J. Bone Miner. Res., 16: 1787-94, 2001.
Raisz, J. Clin. Invest., 115(12):3318-3325, 2005.
Reddi and Huggins, Proc. Natl. Acad. Sci. USA, 69: 1601-1605, 1972.
Remington’s Pharmaceutical Sciences, 15* ed., pages 1035-1038 and 1570-1580, Mack Publishing Company, Easton, PA, 1980.
Remingtons Pharmaceutical Sciences, 18th Ed. Mack Printing Company, pp. 1289-1329, 1990. Schriefer et al., J. Biomeck, 38:467-75, 2006.
Shaw et al, J. Natl. Cancer Inst., 80(19): 1553-1559, 1988.
Sun et al, J. Steroid Biochem., 26(1): 83-92, 1987.
Takuwa et al, Biochem. Biophys. Res. Commun., 174(1):96-101, 1991.
Terpos et al, Annals of Oncology 16: 1223-1231, 2005.
Thirunavukkaraus et al, J. Biol. Chem., 276:36241-50, 2001.
Verhoeyen et al, Science, 239(4847): 1534-1536, 1988.
Wood et al, J. Clin. Lab. Immunol., 17(4): 167-171, 1985.
Zohar et al, Blood, 90:3471-3481, 1997.
Huminiecki et al, (2009) BMC Evol. Biol. 9, 28
Massague, J. (1998) Annu. Rev. Biochem. 67, 753-791
Wang et al, (2014) Genes & Diseases 1, 87-105 Constam & Robertson,. (1999) J. Cell Biol. 144, 139-149
Degnin et al, (2004) Mol. Biol. Cell 15, 5012-5020
Sun & Davies, (1995) Annu. Rev. Biophys. Biomol. Struct. 24, 269-291
Avsian-Kretchmer & Hsueh, (2004) Mol. Endocrinol. 18, 1-12
Scheufler et al, (1991) J. Mol. Biol. 287, 103-287
Iyer & Achaiya, (2011) FEBS Lett. 278, 4304-4322
Shi & Massague (2003) Cell 113, 685-700
Heldin et al, (1997) Nature 390, 465-471
Hogan, B.L. (1996) Curr. Opin. Genet. Dev. 6, 432-438
Salazar et al, (2016) Nat. Rev. Endocrinology 12, 203-221
Balemans & Van Hul, (2002) Dev. Biol. 250, 231-250
Brazil et al, (2015) Trends Cell Biol. 25, 249-264
Massague, J. (2012) Nat. Rev. Mol. Cell. Biol. 13, 616-630
Rider, C.C. (2006) Biochem. Soc. Trans. 34, 458-460
Ruppert et al, (1996) Eur. J. Biochem. 237, 295-302
Sarrazin et al, (2011) Cold Spring Harb. Prospect. Biol. 3, a004952
Iozzo, R.V. (2001) J: Clin. Invest. 108, 165-167
Ohlig et al, (2012) . Biol. Chem. 287, 43708-43719
Wu et al, (2003) . Biol. Chem. 278, 17121-17129
Bishop et al, (2007) Nature 446, 1030-1037
Cardin & Weintraub, (1989 ) Arterioschler. Thromb. Vase. Biol. 9, 21-32
Billings & Pacifici, (2015) Connect. Tissue Res. 56, 272-280
Fromm et al, (1997) Arch. Biochem. Biophys. 343, 92-100
Hileman et al, (1998) BioEssays 20, 156-167
Choi et al, (2010) Biomaterials 31, 7226-7238
Rider & Mulloy, (2017 ) Molecules 22, 713
Ohkawara et al. , (2002) Curr. Biol. 12, 205-209
Brkljacic et al, (2013) Int. Orhop. 37, 529-541
Iri e et al, (2003) Biochem. Biophys. Res. Commun. 308, 858-865
Gandhi & Mancera, (2012) Biochim. Biophys. Acta 1824, 1374-1381
Hinck, A.P. (2012) FEBS Lett. 586, 1860-1870
Mikic et al, (1995) Bone 16, 445-454
Perry et al, (2008) Bone 42, 216-225
Luo et al, (1995) Genes & Dev. 9, 2808-2820 Tsuji et al., (2006) Nat. Genet. 38, 1424-1429
Selever et al., (2004 ) Dev. Biol. 276, 268-279
Yang, et al.., (2015 ) Nat. Methods 12, 7-8
Huegel et al, (2015 )Am. J. Path. 185, 1676-1685
Lefebvre & Bhattaram (2010) Curr. Topics Dev. Biol. 90, 291-317
Katagiri et al, (2002) Genes to Cells 7, 949-960
McClarence, D. (2011) University of London School of Biological Sciences Ph.D. Thesis, 209
Margalit e/ a/., (1993) J. Biol. Chem. 268, 19228-19231
Chang e/ al, (2011) . Biol. Chem. 286, 44391-44402
Whalen et al, (2013 ) Proc. Natl. Acad. Sci. USA 110, 16420-16425
Xu & Esko, (2014) Annu. Rev. Biochem. 83, 129-157
Richard et al, (2009) . Biol. Chem. 284, 27054-27064
Turnbull et al, (1992) . Biol. Chem. 267, 10337-10341
Schultz et al, (2017) J. Biol. Chem. 292, 2495-2509
Lortat-Jacob et al, (1995) Biochem. J. 310, 497-505
Spillmann et al, (1998) . Biol. Chem. 273, 15486-15493
Matsuo & Kimura-Yoshida, (2014) Phil. Trans. R. Soc. B 369, 20130545
Viviano et al, (2004) . Biol. Chem. 279, 5604-5611
Omitz & Itoh, (2015) WIREs Dev. Biol. 4, 215-266
Shimokawa e/ a/., (2011) Dev. Cell 21, 257-272
Lin, X. (2004) Development 131, 6009-6021
Lindahl & Kjellen, (2013) J. Intern. Med. 273, 555-571
Cheung et al, (2001) Am. J. Hum. Genet. 69, 55-66
Hecht e/ a/., (1995) Am. J. Hum. Genet. 56, 1125-1131
Hecht et al, (2005) Differentiation 73, 212-221
Jones, K.B. (201 1 ) ./ Pediatr. Orthop. 31, 577-586
Huegel et al, (2013) ev. Biol. 377, 100-112
Sinha et al, (2017) PLoS Genetics 13, el006742
Buckland et al, (1998) Mech. Dev. 71, 143-150
Yoon et al, (2006) Development 133, 4667-4678
James et al, (2016) Tissue Engeneerin, Pt. B 22, 284-297
Lissenberg-Thunnissen et al, (201 1 ) Ini. Orthop. 35, 1271-1280
Janda et al, (2017) Nature 545, 234-237
Mundy et al, (2018) . Biol. Chem. doi: 10. l074/jbc.RAl 17.000264 Dundas et al., (2013 )Appl. Microbiol. Biotechnol. 97, 9343-9353 Lozzio & Lozzio, (1979) Leuk. Res. 3, 363-370
Mundy et al., (2016) J. Cell. Physiol. 231, 1033-1044
Gutierrez et al, (2012) Universitas Scientiarum 17, 167-178 Yang et al., Nat. Methods 12, 7-8 (2014).

Claims

WHAT IS CLAIMED:
1. An isolated peptide of no more than 50 residues and comprises a sequence selected from the group consisting of GGGKVVLKNY QEMVVEGCGCR (SEQ ID NO: 1), GGGNVILKKYRNMVVRSCGCH (SEQ ID NO: 2) and
GGGNVILKKYRNMVVRACGCH (SEQ ID NO: 3), or a multimer comprising at least two of the same or different peptides.
2. The isolated peptide of claim 1, wherein the peptide is no more than 100 residues, no more than 75 residues, no more than 50 residues, no more than 45 residues, no more than 40 residues, no more than 35 residues, no more than 30 residues, no more than 29 residues, no more than 28 residues, no more than 27 residues, no more than 26 residues, no more than 25 residues, no more than 24 residues, no more than 23 residues, no more than 22 residues, or is 21 residues.
3. The isolated peptide of claim 1, wherein the multimer comprises at least two peptides having SEQ ID NOS: 1, 2 and/or 3, and/or is a dimer, a trimer, a tetramer, a homo- multimer or a hetero-multimer.
4. The isolated peptide of claim 1, further comprising a domain or domains from another signaling and growth factor protein(s).
5. The isolated peptide of claim 4, wherein said another signaling and growth factor protein(s) are a distinct BMP protein(s) ( e.g ., BMP2, BMP4) or a hedgehog family protein(s) or a fibroblast growth factor protein(s).
6. The isolated peptide of claim 1, wherein the multimer comprises at least two peptides linked to a carrier molecule, such as avidin (e.g., deglycosylated avidin).
7. The isolated peptide of claim 1, wherein the peptide or peptide multimer is linked to a diagnostic or therapeutic label or agent.
8. The isolated peptide of claim 1, wherein the peptide or peptide multimer comprises only L amino acids.
9. The isolated peptide of claim 1, wherein the peptide or peptide multimer comprises only D amino acids.
10. The isolated peptide of claim 1, wherein the peptide or peptide multimer comprises a mixture of D and L amino acids.
11. A method of increasing bone mass and/or volume and/or increasing cartilage mass and/or volume in a subject comprising:
(a) identifying a patient in need of increased bone mass and/or volume, and/or in need of increased cartilage mass and/or volume; and
(b) administering to said subj ect an peptide or peptide multimer according to claims 1 10
12. The method of claim 11, wherein the subject is in need of increased bone mass and/or volume.
13. The method of claim 11, wherein the subject is in need of increased cartilage mass and/or volume.
14. The method of claim 11, wherein said peptide or peptide multimer is administered to said subject systemically.
15. The method of claim 14, wherein said peptide or peptide multimer is administered intravenously, intra-articularly, intra-peritoneally, intramuscularly, subcutaneously or topically.
16. The method of claim 11, wherein said peptide or peptide multimer is administered to a bone and/or cartilage target site.
17. The method of claim 16, wherein said peptide or peptide multimer is injected at said site.
18. The method of claim 16, wherein said peptide or peptide multimer is comprised in a time-release device implanted at said site.
19. The method of claim 11, wherein said subject is a human.
20. The method of claim 11, wherein said subject is a non-human animal.
21. The method of claim 20, wherein said non-human animal is a mouse, a rat, a rabbit, a dog, a cat, a horse, a monkey or a cow.
22. The method of claim 11, wherein said subject has cancer.
23. The method of claim 11, wherein said subject does not have cancer.
24. The method of claim 11, further comprising at least a second administration of said peptide or peptide multimer.
25. The method of claim 24, wherein said subject receives 1-5 administrations per week.
26. The method of claim 24, wherein said subject receives at least 5 administrations.
27. The method of claim 11 , further comprising assessing bone and/or cartilage mass and/or volume following administration of said peptide or peptide multimer.
28. The method of claim 27, wherein assessing comprises bone and/or cartilage imaging.
29. The method of claim 11, wherein said subject suffers from osteoporosis, bone fracture, spinal degeneration, alveolar/extraction socket defect, bone loss due to trauma, Paget’s Disease or congenital bone diseases.
30. The method of claim 11, wherein said subject suffers from bone loss due to cancer metastasis.
31. The method of claim 19, wherein said human subject is a subject of 60 years or older.
32. A method of increasing bone and/or cartilage growth in a subject comprising administering to said subject a peptide or peptide multimer according to claims 1-10.
33. The method of claim 32, wherein the subject is in need of increased bone growth.
34. The method of claim 32, wherein the subject is in need of increased cartilage growth.
35. The method of claim 32, wherein said subject has cancer.
36. The method of claim 32, wherein said subject does not have cancer.
37. The method of claim 32, wherein said subject is a human.
38. The method of claim 37, wherein said human subject is a subject of 60 years or older.
39. The method of claim 32, wherein said subject is a non-human animal.
40. The method of claim 32, further comprising at least a second administration of said peptide or peptide multimer.
41. The method of claim 40, wherein said subject receives 1-5 administrations per week.
42. The method of claim 40, wherein said subject receives at least 5 administrations.
43. The method of claim 32, further comprising assessing bone and/or cartilage growth following administration of said peptide or peptide multimer.
44. The method of claim 43, wherein assessing comprises bone and/or cartilage imaging.
45. A method of increasing chondrogenesis and chondrocyte development in a subject comprising administering to said subject a peptide or peptide multimer according to claims 1-10.
46. A method of increasing chondrocyte maturation and hypertrophy in a subject comprising administering to said subject a peptide or peptide multimer according to claims 1-10.
47. A method of increasing osteogenesis and osteoblast development in a subject comprising administering to said subject a peptide or peptide multimer according to claims 1-10.
48. A method of increasing bone and/or cartilage strength in a subject comprising administering to said subject a peptide or peptide multimer according to claims 1-10.
49. A method of repairing a bone and/or cartilage defect in a subject comprising administering to said subject a peptide or peptide multimer according to claims 1-10.
50. A method of detecting the presence and/or location of heparan sulfate (HS) and/or heparan sulfate-rich proteoglycans (HSPGs) in a tissue or target site in a subject comprising contacting a tissue with or administering to a subject a peptide or peptide multimer according to claims 1-10 and detecting specific binding of said peptide or peptide multimer to said tissue or target site.
51. A method of targeting an agent to a cell or tissue containing heparan sulfate (HS) and/or heparan sulfate-rich proteoglycans (HSPGs) in subject comprising administering to said subject a peptide or peptide multimer according to claims 1-10, wherein said peptide or peptide multimer is conjugated to said agent.
52. The method of claim 51, wherein the agent is a therapeutic agent.
53. The method of claim 52, wherein the therapeutic agent modulates bone and/or cartilage formation.
54. The method of claim 51, wherein the agent is a diagnostic agent.
55. The method of claim 54, wherein the diagnostic agent is a fluorophore, a chromophore, or a spin label.
56. The method of claim 11, 32, or 45-49, wherein the subject is a human subject having a metabolic disease that impairs bone fracture repair.
PCT/US2019/037607 2018-06-22 2019-06-18 Peptides to enhance bone growth, repair and cell function Ceased WO2019246013A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201862689013P 2018-06-22 2018-06-22
US62/689,013 2018-06-22

Publications (1)

Publication Number Publication Date
WO2019246013A1 true WO2019246013A1 (en) 2019-12-26

Family

ID=68983030

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2019/037607 Ceased WO2019246013A1 (en) 2018-06-22 2019-06-18 Peptides to enhance bone growth, repair and cell function

Country Status (1)

Country Link
WO (1) WO2019246013A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12398176B2 (en) 2018-08-27 2025-08-26 Regeneron Pharmaceuticals, Inc. Use of Raman spectroscopy in downstream purification

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060235204A1 (en) * 2004-03-31 2006-10-19 Xencor, Inc. BMP-2 variants with improved properties
WO2009030500A1 (en) * 2007-09-06 2009-03-12 Abbott Gmbh & Co. Kg Bone morphogenetic protein (bmp)-binding domains of proteins of the repulsive guidance molecule (rgm) protein family and functional fragments thereof, and use of same
WO2010103070A2 (en) * 2009-03-12 2010-09-16 Charité - Universitätsmedizin Berlin Bone morphogenetic protein 2 (bmp2) variants with reduced bmp antagonist sensitivity

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060235204A1 (en) * 2004-03-31 2006-10-19 Xencor, Inc. BMP-2 variants with improved properties
WO2009030500A1 (en) * 2007-09-06 2009-03-12 Abbott Gmbh & Co. Kg Bone morphogenetic protein (bmp)-binding domains of proteins of the repulsive guidance molecule (rgm) protein family and functional fragments thereof, and use of same
WO2010103070A2 (en) * 2009-03-12 2010-09-16 Charité - Universitätsmedizin Berlin Bone morphogenetic protein 2 (bmp2) variants with reduced bmp antagonist sensitivity

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
BILLINGS ET AL.: "Domains with highest heparan sulfate-binding affinity reside at opposite ends in BMP2/4 versus BMP5/6/7: Implications for function", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 293, 6 August 2018 (2018-08-06), pages 14371 - 14383, XP055664221 *
OHKAWARA ET AL.: "Action Range of BMP Is Defined by Its N-Terminal Basic Amino Acid Core", CURRENT BIOLOGY, vol. 12, no. 3, 5 February 2002 (2002-02-05), pages 205 - 209, XP026073721, DOI: 10.1016/S0960-9822(01)00684-4 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12398176B2 (en) 2018-08-27 2025-08-26 Regeneron Pharmaceuticals, Inc. Use of Raman spectroscopy in downstream purification

Similar Documents

Publication Publication Date Title
Vukicevic et al. The clinical use of bone morphogenetic proteins revisited: a novel biocompatible carrier device OSTEOGROW for bone healing
RU2496790C2 (en) Neuroendocrine factors for treating degenerative disorders
ES2598006T3 (en) Anti-TGF-beta antibodies for bone growth induction
US20160250224A1 (en) Orexin-control of bone formation and loss
EP3341398B1 (en) Compounds for inducing tissue formation and uses thereof
JP2010520212A (en) NELL-1 enhances bone mineralization
US20230295262A1 (en) Programmed cells for targeted articular cartilage and bone regeneration
US20220267394A1 (en) Compounds for inducing tissue formation and uses thereof
JP2010069327A (en) Bone generation by gene therapy
US12186367B2 (en) Isoform Nell-1 peptide
IL258132B2 (en) Pharmaceutical association comprising at least one growth factor receptor-binding compound for use in the treatment, prevention or diagnostic of neoplastic disease
WO2019246013A1 (en) Peptides to enhance bone growth, repair and cell function
JP7302903B2 (en) A composition for preventing, improving or treating a cartilage-related disease containing HAPLN1 or a symptom thereof
US9045553B2 (en) Cerberus/Coco derivatives and uses thereof
JP2010503610A (en) Use of cathepsin K antagonists in bone production
Kim et al. Osteogenic Cells and Microenvironment of Early Bone Development and Clinical Implication
WO2009058690A2 (en) Nell-1 compositions
Kim et al. Osteogenic Cells and Microenvironment of Early Bone Development and Implication in Clinical Application
WO2017032857A2 (en) Compounds for inducing tissue formation and uses thereof
CA2525107A1 (en) Novel fibroblast growth factors and methods of use thereof
US20050256039A1 (en) Novel fibroblast growth factors and methods of use thereof
Curak Slobodan Vukicevic, Hermann Oppermann, Donatella Verbanac, Morana Jankolija, Irena Popek, Jasna
HK1256357B (en) Compounds for inducing tissue formation and uses thereof
HK1256357A1 (en) Compounds for inducing tissue formation and uses thereof
HK1256243B (en) Compounds for inducing tissue formation and uses thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19822728

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19822728

Country of ref document: EP

Kind code of ref document: A1