WO2019236754A1 - Compounds and methods for the treatment of autism spectrum disorder and other neurological or psychiatric disorders - Google Patents
Compounds and methods for the treatment of autism spectrum disorder and other neurological or psychiatric disorders Download PDFInfo
- Publication number
- WO2019236754A1 WO2019236754A1 PCT/US2019/035659 US2019035659W WO2019236754A1 WO 2019236754 A1 WO2019236754 A1 WO 2019236754A1 US 2019035659 W US2019035659 W US 2019035659W WO 2019236754 A1 WO2019236754 A1 WO 2019236754A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- hnrnp
- activity
- subject
- asd
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/12—Ketones
- A61K31/122—Ketones having the oxygen directly attached to a ring, e.g. quinones, vitamin K1, anthralin
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
- G01N33/5023—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects on expression patterns
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
- G01N33/5058—Neurological cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6875—Nucleoproteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/28—Neurological disorders
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/50—Determining the risk of developing a disease
Definitions
- the present invention relates to treatment of neurological disorders.
- autism spectrum disorder There is a high incidence of autism spectrum disorder (ASD) in the general population ( ⁇ l in 68 children). Very few therapeutics have effects on the primary symptoms of autism spectrum disorder (and correlated neurological conditions e.g. attention- deficit/hyperactivity disorder (ADHD), epilepsy, mental retardation, intellectual disability), including those typically used for neuropsychiatric disorders. There exists a need for safe compounds for the treatment of autism spectrum disorder.
- ADHD attention- deficit/hyperactivity disorder
- the invention provides a compounds, compositions, and methods for the treatment, e.g., reduction of symptoms, of autism spectrum disorder (ASD) as well as other neurological and/or psychological disorders or conditions.
- autism spectrum disorder e.g., autism spectrum disorder (ASD)
- exemplary neurological and psychiatric disorders include, but are not limited to, autism, autism spectrum disorder, mental retardation, learning disability, intellectual disability, attention-deficit/hyperactivity disorder (ADHD), dyslexia, epilepsy, bipolar disorder, and schizophrenia.
- a method for reducing a symptom of Autism Spectrum Disorder is carried out by administering to a subject a composition that upregulates or downregulates heterogeneous nuclear ribonucleoprotein L (hnRNP L) or a downstream target of hnRNP L.
- the subject to be treated is identified by behavioral indications and/or aberrant expression of hnRNP L and/or genetic abnormalities or aberrant expression/splicing in a downstream target of hnRNP L, e.g., RbFoxl or Binl.
- Compounds that upregulate hnRNP L are also useful to treat, e.g, reduce the symptoms, of intellectual disability as well as neurodegenerative disease such as Alzheimer’s Disease (AD) or dementia.
- AD Alzheimer’s Disease
- Subjects to be treated for AD are identified by clinical diagnosis and/or detection of a neurochemical biomarker in the cerebrospinal fluid (e.g. b-amyloid peptides, total tau and phospho-tau) and/or identification of a genetic biomarker (e.g., PSEN1, PSEN2, APOE e4, BIN1 alleles) (Humpel, Trends Biotechnol, 2011 Jan; 29(1): 26-32; Huynh and Mohan, Mar 20; 8:102. 2017) and/or aberrant expression of hnRNP L.
- Such compounds are also useful for maladies such as dementia and/or brain injury/concussion, e.g., disorders involving a role of tau (MAPT), e.g., in frontotemporal dementia.
- a neurochemical biomarker in the cerebrospinal fluid e.g. b-amyloid peptides, total tau and phospho-tau
- a genetic biomarker e.
- RNA is useful in detection of defects in splicing (spliceopathy), e.g., abnormal regulation of alternative splicing.
- the invention includes methods of detection of such defects as well as therapeutic methods for treating the defects.
- Protein and nucleic acid sequences useful in such therapeutic methods include: mRNA: Homo sapiens heterogeneous nuclear ribonucleoprotein L (HNRNPL), transcript variant 1, mRNA, 2,129 bp linear mRNA Accession: NM_00l533.2 GI: 52632382; Homo sapiens heterogeneous nuclear
- ribonucleoprotein L (HNRNPL), transcript variant 2, mRNA 1,895 bp linear mRNA, Accession: NM_00l005335.l GI: 52632384.
- Useful protein/polypeptide sequences include: heterogeneous nuclear ribonucleoprotein L isoform a [Homo sapiens], 589 aa protein, Accession: NP_00l524.2 GI: 52632383; heterogeneous nuclear ribonucleoprotein L isoform b [Homo sapiens], 456 aa protein, Accession: NP_00l005335.l GI: 52632385.
- the method optionally includes a step wherein the downstream target comprises BIN1, e.g., BIN I mRNA, Homo sapiens bridging integrator 1 (BIN1), transcript variant 1, mRNA, 2,686 bp linear mRNA, Accession: NM_l39343.2 GI: 346716175;
- BIN1 Homo sapiens bridging integrator 1
- transcript variant 1 mRNA, 2,686 bp linear mRNA, Accession: NM_l39343.2 GI: 346716175;
- BIN 1 Protein myc box-dependent- interacting protein 1 isoform 1 [Homo sapiens], 593 aa protein, is available at Accession: NP_647593.l GI: 21536400. Protein isoforms 2-16 are also available in the art.
- other targets include TTN and DMD (see table below).
- the downstream targets include transcripts that are also targets of FOX1 (RBFOX1/A2BP1, Accession No. NP_665898.l).
- FOX1 RBFOX1/A2BP1, Accession No. NP_665898.l.
- hnRNP L and FOX1 co-immunoprecipitate (i.e., these splicing factors likely function together; Fig. 3).
- Aberrant splicing of FOX1 targets due to a mutation in FOX1, leading in turn to ASD) is rescued by hnRNP F if the targets are downstream of both splicing factors.
- compositions such as small molecule drugs, e.g., ascochlorin, are also useful to treat spliceopathies.
- the composition increases the level of hnRNP F in a neuronal cell of the subject.
- the composition comprises an isoprenoid antibiotic such as ascochlorin or derivatives thereof.
- Delivery routes include intrathecal, intravenous (IV), sub-cutaneous, oral, skin patch, nasal aerosol.
- route of administration comprises least intrusive modes of delivery such as oral administration.
- a preferred composition includes ascochlorin or a derivative thereof.
- exemplary derivative compounds include an ascochlorin glycoside Vertihemipterin A, a aglycone thereof, 4',5'-dihydro-4'-hydroxyascochlorin, 8'-hydroxyascochlorin; LL-Zl272delta, 8', 9'- dehydroascochlorin, ascofuranone, ascofuranol, AS-6, Cylindrol A5, 4-O-methylascochhlorin (MAC), or colletochlorin.
- Particularly preferred are compounds characterized as having minimal or absence of toxicity. For example, MAC has been tested in clinical trials (U.S. Patent 3,995,061, 1976) and was well tolerated.
- the ascochlorin derivatives 4-O-methyl- ascochlorin (MAC), and 4-O-ethyl-ascochlorin display low toxicity as assessed by high LD50 after ip or oral administration (Hosokawa T et ah, U.S. Patent 3,995,061, 1976).
- Suitable compound include 4-O-methylascochlorin (MAC), 4-O-ethylascochlorin, and other derivatives/analogs, including AS-6, ascofuranone (AF) and AF-like analogs/ubiquinol mimics isolated via novel routes of synthesis using structure activity relationships (SAR)
- a method of identifying a compound for treatment of ASD include steps of contacting a neuronal cell with a candidate compound and detecting an increase in hnRNP F expression or activity or an increase in expression or activity of a downstream target of hnRNP F, wherein the increase indicates that the compound decreases a symptom or severity of ASD as well as other disorders/diseases as listed above).
- Suitable exemplary cell lines include mammalian/human (normal or diseased) iPS cells-derived neuroprogenitor, neuron, or glia including
- oligodendrocytes oligodendrocytes, astrocytes (e.g., GIBCO® Human Neural Stem Cells (hNSCs, embryonic H9-derived), rat fetal neural stem cells, rat glial precusor cells (rGPC); rat adrenal gland phaeochromocytoma PC-12 cell line); primary neurons/glia cultures; immortalized neuronal cell lines (e.g., neuroblastoma cell lines: human SH-SY5Y, human SK-N-AS, hybrid rat/mouse Fl 1; or mouse hippocampal neuronal HT-22 cell line).
- hNSCs Human Neural Stem Cells
- rGPC rat fetal neural stem cells
- rGPC rat glial precusor cells
- PC-12 cell line primary neurons/glia cultures
- immortalized neuronal cell lines e.g., neuroblastoma cell lines: human SH-SY5Y, human SK-
- Diagnostic methods are also encompassed.
- a method for identifying a subject suffering from or at risk of developing ASD comprise the steps of detecting a mutation/defect in the hnRNP L
- Suitable patient-derived samples to be evaluated include those obtained in a minimally or non-invasive manner, e.g., bodily fluids as well as cell or tissue samples, as described below.
- DNA/RNA mutation includes but is not limited to: deletion, insertion, point mutation, mis sense mutation, sense mutation, single nucleotide polymorphism, splice site mutation, cryptic splice site recruitment, mutation in RNA binding protein (RBP) binding sequence.
- the nature of the protein defect includes but is not limited to: truncation, elongation, amino acid change, aberrant post-translation modification.
- Assessment includes using minimally invasive procedures, e.g., using DNA from hair, skin cells, saliva, blood, iPS cells derived differentiated cells (e.g., neurons).
- a method for identifying a subject suffering from or at risk of developing ASD comprising detecting an alteration (or a change) in hnRNP L level (RNA, protein or activity, versus normal) or an alteration (or a change) in the normal hnRNP L mRNA variant/protein isoform (e.g., expression of the fetal isoform versus adult isoform) in a tissue of the subject compared to a normal control hnRNP L level, wherein a decrease or increase of at least 10% compared to a normal control level indicates that the subject comprises or is at risk of developing ASD.
- an increase may reflect a compensatory mechanism linked to the pathogenesis.
- both increased level as well as decreased level of splicing factors have been linked to pathogenesis, e.g., decrease in RBFOX1 linked to heart failure (Gao et al., J Clin Invest. 2016 Jan; 126(1): 195-206).
- hnRNP L-specific primers e.g., Origene HNRNPL Human qPCR Primer Pair (NMJ301533) cat#HP228l07;
- TwistDx TM isothermal nucleic acid amplification technology that enables combination of primers and detection of multiple hnRNP L variants.
- assays e.g., Western blot analysis, using a commercially available anti-human hnRNP L antibody (monoclonal, e.g., clone 4D11, or polyclonal) are useful. Methods are used to assess activity levels, e.g., hnRNP L variants with higher or lower activity.
- a method for identifying in a subject suffering from or at risk of developing ASD (or other disorders/diseases) also include evaluation of efficacy of therapeutic treatment, comprising partial of at least 10%, or complete, restoration of normal hnRNP L level (RNA, protein or activity) or hnRNP L mRNA variant/protein isoform expression pattern, in a tissue of a subject where normal is defined as control values found in corresponding normal human tissue.
- the method of treatment describes herein may further comprise administering to a subject a composition that upregulates heterogeneous nuclear ribonucleoprotein L (hnRNP L) or restores normal splicing in a downstream target of hnRNP L that is misspliced as a result of a genetic mutation in the target gene, or subsequently to the neurological pathogenesis related to ASD or other disorders/diseases.
- hnRNP L heterogeneous nuclear ribonucleoprotein L
- the invention includes methods of diagnosis that include the steps of contacting a tissue or bodily fluid sample from a subject with an hnRNP L binding agent and a detectable label to form a complex and measuring the amount of the complex.
- Suitable reagents include but are not limited to a Tagged/flagged/radiolabeled anti-hnRNP L antibody, a
- Tagged/flagged/radiolabeled short nucleotide sequence that binds hnRNP L e.g., CACA repeats, or derived from a known hnRNP L RNA target
- Tagged/flagged protein partner e.g., RBFOX1
- short peptide derived-thereof e.g., a known hnRNP L RNA target
- Tagged/flagged nucleotide sequence derived from hnRNP L RNA based on documented autoregulation.
- Tagged or flagged reagents are those that are labelled with a radioactive compound visually detectable reagent such as a fluorescent compound (whether the reagent is directly labeled, or by using a secondary conjugated (e.g., Alexa, Cy3, Cy5) antibody directed against the reagent), or that can be detected using a colorimetric assay (e.g., ELISA).
- a radioactive compound visually detectable reagent such as a fluorescent compound (whether the reagent is directly labeled, or by using a secondary conjugated (e.g., Alexa, Cy3, Cy5) antibody directed against the reagent), or that can be detected using a colorimetric assay (e.g., ELISA).
- detection methods are also useful in a method of monitoring disease severity or response to treatment, comprising measuring an amount of hnRNP L level (mRNA, protein, activity) in a tissue of a subject following administration of a medicament, wherein an increase over time indicates that the disease severity is decreasing in response to treatment.
- the invention also includes methods of diagnosis that include the steps of contacting a tissue or bodily fluid sample from a subject with altered splicing, or expression level, or variant/isoform expression profile, of a target of hnRNP L (e.g., BIN1, DMD, TTN) to determine a subject suitable for treatment or assess progress/efficacy of treatment.
- a target of hnRNP L e.g., BIN1, DMD, TTN
- the invention also includes methods of assessing efficacy of a therapeutic agent on the above hnRNP L or target of hnRNP L, that include the steps of contacting a tissue or bodily fluid sample from a subject, and showing restoration of the normal expression level or splicing or variant/isoform expression profile.
- Fig. 1 is a diagram showing that hnRNP L plays a key role in brain pathophysiology.
- the hnRNP L binding site described herein, comprises a consensus amino acid sequence shown in the above sequence logo plot.
- such high-affinity hnRNP L binding sites may comprise between two and four motifs, mostly of the high-score type (ACAC, CACA): SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4.
- such intermediate-affinity hnRNP L binding sites may comprise only one or two high-score motifs each (ACAC, CACA): SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7.
- such low-affinity hnRNP L binding sites may comprise only a single, low-score motif (TACA, CACC): SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10.
- Fig. 2 is a series of photographs showing that ascochlorin treatment increases the level of hnRNP L in rat embryonic cortical neurons.
- Fig. 3 is a photograph showing that HNRNP L interacts with RBFOX1.
- Fig. 4 is a table showing the absence of significant toxicity with administration of ascochlorin/derivatives in multiple disease models.
- Fig. 5 is a table of ascochlorin and derivatives thereof and corresponding chemical structures.
- Fig. 6 is a table showing that the ascochlorin derivatives 4-O-methyl-ascochlorin (MAC), and 4-O-ethyl-ascochlorin display low toxicity as assessed by high FD50 after ip or oral administration.
- MAC 4-O-methyl-ascochlorin
- MAC 4-O-ethyl-ascochlorin
- Fig. 7 is a diagram showing compounds 18 and 19 from West et al. Eur. J. Med. Chem. 2017.
- Fig. 8 is a diagram showing ascochlorin derivatives/analogs and corresponding chemical structures.
- hnRNP L splicing factor L
- hnRNP L conserved pathway downstream of the splicing factor hnRNP L, which comprises 46 genes that are conserved from invertebrates to mammals including humans.
- a bioinformatic analysis of a compendium of known human alternative splicing events was carried out to identify sequences that include the hnRNP L binding motif and are expressed in skeletal muscle and/or the heart. This analysis revealed 46 conserved putative targets of hnRNP L in muscle and the heart. (See U.S. Patent 9,662,314, 2017.)
- SLC39A9 act as a zinc-influx NP 360845.2
- the hnRNP L pathway is highly enriched in genes that are linked to autism spectrum disorder (ASD, 12 targets/46).
- isoprenoid antibiotics including but not limited to the compounds ascochlorin, and its derivatives (i.e. natural and synthetic related compounds, e.g. 4-O-methyl ascochlorin (MAC), the ascochlorin glycoside
- Vertihemipterin A and its aglycone, 4',5'-dihydro-4'-hydroxyascochlorin, 8'- hydroxyascochlorin; LL-Zl272delta, 8',9'-dehydroascochlorin; ascofuranone; ascofuranol; AS-6; Cylindrol A5) can be used directly, and/or as chemical template structures, to treat autism spectrum disorder and related neurological/psychiatric disorders, including but not limited to, mental retardation, learning disability, attention deficit hyperactivity disorder, dyslexia, epilepsy, bipolar disorder, and schizophrenia. Isoprenoid antibiotics have been shown to increase hnRNP L protein levels 12c in vitro (Kang et al., J Proteome
- the hnRNP L pathway is useful to identify genes/targets relevant to the treatment of ASD.
- a cell-based assay is used to identify drugs that modulate hnRNP L levels.
- Such a cell-based assay utilizes any relevant cell type, e.g., rat embryonic cortical neurons (see Fig. 2), where hnRNP L plays a role in cell physiology/morphology (including but not limited to, neurons, glia, stem cells, pluripotent/multipotent progenitor cells, or undifferentiated cells).
- Such assays enable the identification of pharmacological compounds that are useful for the development of ASD therapeutics.
- the pathway may be used to identify targets/therapeutic compounds for other neurological/psychiatric disorders, including but not limited to, mental retardation, learning disability, attention deficit hyperactivity disorder, dyslexia, epilepsy, bipolar disorder, and schizophrenia.
- the compounds and methods targeting hnRNP L-regulated pathway are useful as treatment formulations and to identify compound and/or targets for the treatment of autism spectrum disorder and other neurological/psychiatric disorders.
- Isoprenoid antibiotics including but not limited to the compounds ascochlorin, and its derivatives (i.e. natural and synthetic related compounds, e.g. ascofuranone, ascofuranol, MAC, AS-6, cylindrol As, vertihemipterin A, vertihemipterin A aglycone, 8’- hydroxyascochlorin, 8’,9’-dehydroaschchlorin, 8’-acetoxyascochlorin, colletochlorin) can be used directly, and/or as chemical template structures, to treat autism, autism spectrum disorder and related neurological and psychiatric disorders, including but not limited to, mental retardation, learning disability, attention deficit hyperactivity disorder, dyslexia, epilepsy, bipolar disorder, and schizophrenia.
- the compounds ascochlorin, and its derivatives i.e. natural and synthetic related compounds, e.g. ascofuranone, ascofuranol, MAC, AS-6, c
- Ascochlorin been shown to increase hnRNP L protein levels in vitro , in U20S osteosarcoma cells (Kang et al., J Proteome Res. 2006 Oct;5(l0):2620-3). Surprisingly, ascochlorin has been shown to increase hnRNP L levels in neurons (e.g., primary rat cortical neurons, Fig. 2), a cell/tissue type significantly different from osteosarcoma tissue.
- the hnRNP L pathway can be utilized to identify novel genes/targets relevant to the treatment of autism spectrum disorder.
- a cell-based assay e.g., assessing drug-induced changes in hnRNP L levels
- optimized in cell types where hnRNP L plays a role in cell physiology/morphology including but not limited to, neurons, glia, stem cells,
- pluripotent/multipotent progenitor cells enables the identification of pharmacological compounds that are useful for the development of autism spectrum disorder therapeutics.
- this screening strategy is useful to identify novel targets/pre-therapeutic leads for other neurological and psychiatric disorders, including but not limited to, mental retardation, intellectual disability, learning disability, attention deficit hyperactivity disorder, dyslexia, epilepsy, bipolar disorder, and schizophrenia.
- Autism spectrum disorder is a complex neurodevelopmental disorder that is typically recognized in early childhood and has a lifelong course (Lacivita et al., J. Med. Chem. 2017, 60 (22), 9114-9141 and references cited therein). According to the latest diagnostic criteria, it is characterized by two core symptoms: (1) persistent deficits in social communication and social interaction, (2) restricted, repetitive patterns of behavior, interests, and activities. The diagnosis is based on clinical observation and further established by standardized testing of the patient with the Autism Diagnostic Observation Schedule 2, and/or by parental interview with the Autism Diagnostic Interview-Revised. Thus far, no behavioral, neuroimaging, electrophysiological, or genetic tests can specifically diagnose ASD. Comorbid conditions such as intellectual disability, seizures, and sleep problems are frequent, whereas anxiety, depression, and obsessive-compulsive disorder (OCD) are less frequent.
- OCD obsessive-compulsive disorder
- ASD distinguishes from most other behavioral disorders for the impressive clinical and pathogenetic heterogeneity, which has led to the designation with the term ASD of a set of neurodevelopmental disorders with early onset in life, sharing autism as a common feature, but caused by separate processes.
- ASD was believed to be relatively rare, but the prevalence rates have dramatically increased in the past decade, from approximately 4/10000 to 1/68 children.
- ASD has recently emerged as a major public health issue worldwide.
- Altered neurodevelopment during the first and second trimesters of prenatal life is believed to be an underlying neuropathological cause of ASD.
- Post-mortem studies have unveiled neuroanatomic and cytoarchitectonic aberrations in various brain regions, including cerebellum, hippocampus, inferior olivary complex, amygdala, entorhinal cortex, fusiform gyrus, and anterior and posterior cingulate cortex, with increased growth of the frontal lobes, thinner cortical minicolumns, and increased dendritic spine density.
- the neurocognitive phenotype of ASD is the result of a complex and highly heterogeneous set of genetic and environmental causes.
- the disorder is the result of purely genetic causes due to known chromosomal aberrations or mutations, while in other patients, the disorder is more likely related to environmental causes, such as prenatal exposure to chemical pollutants, toxins, viruses, or even drugs.
- hundreds of risk genes have been identified and not a major causative gene, with either rare variants that are highly penetrant or common variants with small effects. It is therefore not surprising that this genetic heterogeneity is not associated with a characteristic
- neuropathology for ASD is receiving attention because of the altered expression of neuroinflammatory markers observed in the amniotic fluid, serum, cerebrospinal fluid, and the brain tissue of ASD patients (Lacivita etak, J.Med.Chem. 2017, 60 (22) 9114 -9141 and references cited therein).
- the present invention relates to the treatment of neurological disorders using isoprenoid (prenyl-phenol) antibiotics, including but not limited to the compounds ascochlorin, its derivatives and analogs (e.g. ascofuranone, ascofuranol, MAC, AS-6, cylindrol As, vertihemipterin A, vertihemipterin A aglycone, 8’-hydroxyascochlorin, 8’, 9’- dehydroaschchlorin, 8’-acetoxyascochlorin, colletochlorin) which can be used directly, and/or as chemical template structures, to help treat neurological disorders in humans.
- the relevant neurological and psychiatric disorders include, but are not limited to, autism, autism spectrum disorder, mental retardation, learning disability, intellectual disability, attention deficit hyperactivity disorder, dyslexia, epilepsy, bipolar disorder, and schizophrenia.
- Isoprenoid antibiotics were originally isolated from the phytopathogenic fungus Ascochyta viciae. (Sasaki, H. et al. J Antibiot (Tokyo), 1973, 26:676-680). Among them, ascochlorin and ascofuranone have been shown to be non-toxic compounds.
- Structurally related compounds have been subsequently isolated from other fungi (e.g., Fusarium, Cylindrocladium, Cylindrocladium ilicicola, Nectria coccinea, Colletotrichum nicotianae, Acremonium luzulae, Cephalosporium diospyri, Verticillium, Cylindrocarpon lucidum, Nigrosabulum globosum, and the insect pathogenic fungus Verticillium hemipterigenum).
- fungi e.g., Fusarium, Cylindrocladium, Cylindrocladium ilicicola, Nectria coccinea, Colletotrichum nicotianae, Acremonium luzulae, Cephalosporium diospyri, Verticillium, Cylindrocarpon lucidum, Nigrosabulum globosum, and the insect pathogenic fungus Verticillium hemipterigenum).
- Ascochlorin and derivatives e.g., MAC
- analogs e.g., ascofuranone
- ascochlorin and its derivatives exhibit a wide range of physiological activities, including antimicrobial/antiviral activity, trypanocidal properties, hypolipidemic activity, suppression of hypertension, improvement of type I and II diabetes, anti inflammatory, and immunomodulation.
- Additonal compounds include an ascochlorin derivative from Cylindrocarpon sp. FKI-4602.
- hnRNP L binds to RNA targets, for example, the following sequence:
- osteosarcoma cells results in a >10 fold increase in the levels of three proteins, including the splicing factor hnRNP L (first most upregulated protein, 12c), as well as BIN1 (third most upregulated protein, lOx) (Kang J. H. et al. J Proteome Res. 2006;5:2620-2631). It has been determined by bioinformatics analysis that BIN 1 is a candidate target of hnRNP L. In addition, the BIN1 gene was shown to be associated with autism spectrum disorder (Connolly J. J. et al. Child Dev. 2013 Jan-Feb;84(l): 17-33).
- VEGF vascular endothelial growth factor
- GLUT-l glucose transporter 1
- Both VEGF and GLUT-l RNAs are well-established targets of hnRNP L (Hamilton B. J. et al. Biochem Biophys Res Commun. 1999;261:646-651; Ray P. S. et al. Nature. 2009;457:9l5- 919; Shih S. C. et al. J Biol Chem. 1999;274:1359-1365).
- Ascochlorin and/or its derivatives promote the maintenance of normal brain physiology by targeting hnRNP L and/or components of the coordinated hnRNP L-regulated pathway(s).
- the compounds and methods of the invention provide therapeutic interventions to reduce the symptoms of autism spectrum disorder and additional neurological and psychiatric disorders by addressing underlying causes, e.g., aberrant splicing defects in the genes identified herein.
- RNA binding protein RBFoxl binds to the hexamer UGCAUG (Lee, et al., Neuron 89(1): 113-28, 2016; Auweter, et al. EMBO J. 25(1): 163-73, 2006). Mutations in the conserved splicing factor FOX1 are linked to autism spectrum disorder (Davis L. K. et al. Am J Med Genet A. 2012;158A:1654-1661; Martin C. L. et al. Am J Med Genet B
- Fig. 2 is a photograph of an electrophoretic gel showing how ascochlorin treatment increases the level of hnRNP L in rat embryonic cortical neurons (hnRNP L 60 KDa). Fig. 2 also shows that ascochlorin treatment does not affect the level of the control protein in rat embryonic cortical neurons (GAD PH 40 KDa).
- Fig. 3 indicates that HNRNP L interacts with RBFOXL
- Ascochlorin and/or its derivatives can promote the maintenance of normal brain physiology by targeting hnRNP L and/or components of the coordinated hnRNP L-regulated pathway(s).
- the compounds and methods described herein provide pharmacological leads to help treat autism spectrum disorder and additional neurological and psychiatric disorders.
- General Definitions Unless specifically defined otherwise, all technical and scientific terms used herein shall be taken to have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in cell culture, molecular genetics, and biochemistry).
- phrases such as“at least one of’ or“one or more of’ may occur followed by a conjunctive list of elements or features.
- the term “and/or” may also occur in a list of two or more elements or features. Unless otherwise implicitly or explicitly contradicted by the context in which it is used, such a phrase is intended to mean any of the listed elements or features individually or any of the recited elements or features in combination with any of the other recited elements or features.
- the phrases“at least one of A and B;”“one or more of A and B;” and“A and/or B” are each intended to mean“A alone, B alone, or A and B together.”
- a similar interpretation is also intended for lists including three or more items.
- phrases“at least one of A, B, and C;”“one or more of A, B, and C;” and“A, B, and/or C” are each intended to mean“A alone, B alone, C alone, A and B together, A and C together, B and C together, or A and B and C together.”
- use of the term“based on,” above and in the claims is intended to mean,“based at least in part on,” such that an unrecited feature or element is also permissible
- a small molecule is a compound that is less than 2000 daltons in mass.
- the molecular mass of the small molecule is preferably less than 1000 daltons, more preferably less than 600 daltons, e.g., the compound is less than 500 daltons, 400 daltons, 300 daltons, 200 daltons, or 100 daltons.
- an“isolated” or“purified” nucleic acid molecule, polynucleotide, polypeptide, or protein is substantially free of other cellular material, or culture medium when produced by recombinant techniques, or chemical precursors or other chemicals when chemically synthesized.
- Purified compounds are at least 60% by weight (dry weight) the compound of interest.
- the preparation is at least 75%, more preferably at least 90%, and most preferably at least 99%, by weight the compound of interest.
- a purified compound is one that is at least 90%, 91%, 92%, 93%, 94%, 95%, 98%, 99%, or 100% (w/w) of the desired compound by weight. Purity is measured by any appropriate standard method, for example, by column chromatography, thin layer chromatography, or high-performance liquid chromatography (HPLC) analysis.
- HPLC high-performance liquid chromatography
- RNA ribonucleic acid
- DNA deoxyribonucleic acid
- a purified protein or polypeptide is free of the amino acids that flank it in its naturally-occurring state. Purified also defines a degree of sterility that is safe for administration to a human subject, e.g., lacking infectious or toxic agents.
- nucleotide or polypeptide that has been separated from the components that naturally accompany it.
- nucleotides and polypeptides are substantially pure when they are at least 60%, 70%, 80%, 90%, 95%, or even 99%, by weight, free from the proteins and naturally-occurring organic molecules with they are naturally associated.
- transitional term“comprising,” which is synonymous with“including,” “containing,” or“characterized by,” is inclusive or open-ended and does not exclude additional, unrecited elements or method steps.
- the transitional phrase “consisting of’ excludes any element, step, or ingredient not specified in the claim.
- the transitional phrase“consisting essentially of’ limits the scope of a claim to the specified materials or steps“and those that do not materially affect the basic and novel
- a disease state or“a nucleic acid” is a reference to one or more such embodiments, and includes equivalents thereof known to those skilled in the art and so forth.
- treating encompasses, e.g., inhibition, regression, or stasis of the progression of a disorder. Treating also encompasses the prevention or amelioration of any symptom or symptoms of the disorder.
- inhibitortion of disease progression or a disease complication in a subject means preventing or reducing the disease progression and/or disease complication in the subject.
- a“symptom” associated with a disorder includes any clinical or laboratory manifestation associated with the disorder, and is not limited to what the subject can feel or observe.
- “effective” when referring to an amount of a therapeutic compound refers to the quantity of the compound that is sufficient to yield a desired therapeutic response without undue adverse side effects (such as toxicity, irritation, or allergic response) commensurate with a reasonable benefit/risk ratio when used in the manner of this disclosure.
- “pharmaceutically acceptable” carrier or excipient refers to a carrier or excipient that is suitable for use with humans and/or animals without undue adverse side effects (such as toxicity, irritation, and allergic response) commensurate with a reasonable benefit/risk ratio. It can be, e.g., a pharmaceutically acceptable solvent, suspending agent or vehicle, for delivering the instant compounds to the subject.
- neurological disorder or disease refers to a disorder, disease or condition which directly or indirectly affects the normal functioning or anatomy of a subject's nervous system, including, but not limited to, the brain.
- the neurological disorder or disease is a neurodevelopmental disorder.
- An example of a neurological disorder or disease is autism.
- Another example of a neurological disorder or disease is autism spectrum disorder.
- the neurological disorder or disease is epilepsy, schizophrenia or mental retardation.
- Autism spectrum disorder is a range of complex neurodevelopment disorders, characterized by social impairments, communication difficulties, and restricted, repetitive, and stereotyped patterns of behavior. Autism (also known as autistic disorder or classical ASD) is the most severe form of ASD. Other conditions along the spectrum include Asperger syndrome, childhood disintegrative disorder and pervasive developmental disorder not otherwise specified (also referred to as PDD- NOS), and Chromosome l5ql l.2-13.1 duplication syndrome (dupl5q syndrome).
- treating a neurological disorder or disease includes, but is not limited to, reversing, alleviating or inhibiting the progression of a neurological disorder or disease or conditions associated with a neurological disorder or disease.
- to treat or “treatment” is an approach for obtaining beneficial or desired results, including clinical results.
- beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of extent of disease, stabilized (i.e. not worsening) state of disease, preventing spread of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable.
- Treatment can also mean prolonging survival as compared to expected survival if not receiving treatment.
- treating a neurological disorder or disease includes preventing the occurrence of a neurological disorder or disease or symptoms or conditions associated with a neurological disorder or disease or preventing worsening of the severity of a neurological disorder or disease or conditions associated with a neurological disorder or disease.
- neurological function refers to the functioning and/or activity of a subject's nervous system.
- improving neurological function refers to improving the structure, function and/or activity of a subject's nervous system.
- improving neurological function includes improving neurodevelopment and/or improving behavior.
- subject refers to any member of the animal kingdom, such as a mammal. In one embodiment, the subject is a human. In another embodiment, the subject is a mouse.
- a cell includes a single cell as well as a plurality or population of cells. Administering a modulator or an agent to a cell includes both in vitro and in vivo
- the modulators and agents described herein may be formulated into pharmaceutical compositions for administration to subjects and/or use in subjects in a biologically compatible form suitable for administration in vivo.
- the compositions described herein can be prepared by per se known methods for the preparation of pharmaceutically acceptable compositions that can be administered to subjects, such that an effective quantity of the active substance is combined in a mixture with a pharmaceutically acceptable vehicle. Suitable vehicles are described, for example, in Remington's Pharmaceutical Sciences (Remington's).
- compositions include, albeit not exclusively, solutions of the substances in association with one or more pharmaceutically acceptable vehicles or diluents, and contained in buffered solutions with a suitable pH and iso- osmotic with the physiological fluids.
- the modulators and agents described herein are formulated into pharmaceutical compositions for administration to the brain or central nervous system of a subject.
- Modulators, agents and pharmaceutical compositions which cannot penetrate the blood-brain barrier can be effectively administered by an intraventricular route or other appropriate delivery system suitable for administration to the brain.
- compositions include, without limitation, lyophilized powders or aqueous or non-aqueous sterile injectable solutions or suspensions, which may further contain antioxidants, buffers, bacteriostats and solutes that render the compositions substantially compatible with the tissues or the blood of an intended recipient.
- Other components that may be present in such compositions include water, surfactants (such as Tween), alcohols, polyols, glycerin and vegetable oils, for example.
- Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules, tablets, or concentrated solutions or suspensions. Proteins may be supplied, for example but not by way of limitation, as a lyophilized powder which is reconstituted with sterile water or saline prior to administration to the patient.
- compositions may comprise a pharmaceutically acceptable carrier.
- suitable pharmaceutically acceptable carriers include essentially chemically inert and nontoxic compositions that do not interfere with the effectiveness of the biological activity of the pharmaceutical composition.
- suitable pharmaceutical carriers include, but are not limited to, water, saline solutions, glycerol solutions, ethanol, N-(l (2,3- dioleyloxy)propyl)N,N,N-trimethylammonium chloride (DOTMA), diolesylphosphotidyl- ethanolamine (DOPE), and liposomes.
- DOTMA N-(l (2,3- dioleyloxy)propyl)N,N,N-trimethylammonium chloride
- DOPE diolesylphosphotidyl- ethanolamine
- liposomes Such compositions should contain a therapeutically effective amount of the compound, together with a suitable amount of carrier so as to provide the form for direct administration to the patient.
- compositions may be in the form of a pharmaceutically acceptable salt which includes, without limitation, those formed with free amino groups such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with free carboxyl groups such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylarnino ethanol, histidine, procaine, etc.
- a pharmaceutically acceptable salt which includes, without limitation, those formed with free amino groups such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc.
- free carboxyl groups such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylarnino ethanol, histidine, procaine, etc.
- modulators, agents and/or pharmaceutical compositions described herein may be administered to, or used in, living organisms including humans, and animals.
- subject or “animal” as used herein refers to any member of the animal kingdom, in one embodiment a mammal such as a human being.
- compositions is defined as an amount effective, at dosages and for periods of time necessary to achieve the desired result.
- an effective amount of a substance may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the recombinant protein to elicit a desired response in the individual.
- Dosage regime may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation.
- Pharmacological stabilization of the hnRNP L-FOX1 complex may be beneficial in cases where a decrease in the levels of FOX1 ( ⁇ 5.9 x) is known to cause autism (Voineagu I. et al. Nature. 2011;474:380-384). Further highlighting the potential of ascochlorin and its derivatives for the treatment neurological disorders is evidence that some antibiotics have ancillary neuroprotective effects (Stock M. L. et al. Neuropharmacology. 20l3;73C:l74-l82).
- Additional compounds include, but are not limited to:
- cefacetrile cefotaxime
- ciproflaxin cefacetrile
- netilimicine ciproflaxin
- netilimicine or a quinolone/fluoroquinolone compound.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Biomedical Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Biotechnology (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Cell Biology (AREA)
- Food Science & Technology (AREA)
- General Physics & Mathematics (AREA)
- Pharmacology & Pharmacy (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Tropical Medicine & Parasitology (AREA)
- Toxicology (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Disclosed are methods of treating autism spectrum disorder (ASD) by administering a therapeutically effective amount of an isoprenoid antibiotic. Also disclosed are methods of modulating (either upregulation or downregulation) hnRNP L and hnRNP L targets by administering a therapeutically effective amount of an isoprenoid antibiotic. Methods of screening compounds for use in treating autism spectrum disorder (ASD) are also described.
Description
COMPOUNDS AND METHODS FOR THE TREATMENT OF AUTISM SPECTRUM DISORDER AND OTHER NEUROLOGICAL OR PSYCHIATRIC DISORDERS
FIELD OF THE INVENTION
The present invention relates to treatment of neurological disorders.
BACKGROUND
There is a high incidence of autism spectrum disorder (ASD) in the general population (~l in 68 children). Very few therapeutics have effects on the primary symptoms of autism spectrum disorder (and correlated neurological conditions e.g. attention- deficit/hyperactivity disorder (ADHD), epilepsy, mental retardation, intellectual disability), including those typically used for neuropsychiatric disorders. There exists a need for safe compounds for the treatment of autism spectrum disorder.
SUMMARY OF THE INVENTION
The invention provides a compounds, compositions, and methods for the treatment, e.g., reduction of symptoms, of autism spectrum disorder (ASD) as well as other neurological and/or psychological disorders or conditions. Exemplary neurological and psychiatric disorders include, but are not limited to, autism, autism spectrum disorder, mental retardation, learning disability, intellectual disability, attention-deficit/hyperactivity disorder (ADHD), dyslexia, epilepsy, bipolar disorder, and schizophrenia.
A method for reducing a symptom of Autism Spectrum Disorder (ASD) is carried out by administering to a subject a composition that upregulates or downregulates heterogeneous nuclear ribonucleoprotein L (hnRNP L) or a downstream target of hnRNP L. The subject to be treated is identified by behavioral indications and/or aberrant expression of hnRNP L and/or genetic abnormalities or aberrant expression/splicing in a downstream target of hnRNP L, e.g., RbFoxl or Binl. Compounds that upregulate hnRNP L are also useful to treat, e.g, reduce the symptoms, of intellectual disability as well as neurodegenerative disease such as Alzheimer’s Disease (AD) or dementia. Subjects to be treated for AD are identified by clinical diagnosis and/or detection of a neurochemical biomarker in the cerebrospinal fluid (e.g. b-amyloid peptides, total tau and phospho-tau) and/or identification of a genetic biomarker (e.g., PSEN1, PSEN2, APOE e4, BIN1 alleles) (Humpel, Trends Biotechnol, 2011
Jan; 29(1): 26-32; Huynh and Mohan, Mar 20; 8:102. 2017) and/or aberrant expression of hnRNP L. Such compounds are also useful for maladies such as dementia and/or brain injury/concussion, e.g., disorders involving a role of tau (MAPT), e.g., in frontotemporal dementia.
RNA is useful in detection of defects in splicing (spliceopathy), e.g., abnormal regulation of alternative splicing. The invention includes methods of detection of such defects as well as therapeutic methods for treating the defects. Protein and nucleic acid sequences useful in such therapeutic methods include: mRNA: Homo sapiens heterogeneous nuclear ribonucleoprotein L (HNRNPL), transcript variant 1, mRNA, 2,129 bp linear mRNA Accession: NM_00l533.2 GI: 52632382; Homo sapiens heterogeneous nuclear
ribonucleoprotein L (HNRNPL), transcript variant 2, mRNA 1,895 bp linear mRNA, Accession: NM_00l005335.l GI: 52632384. Useful protein/polypeptide sequences include: heterogeneous nuclear ribonucleoprotein L isoform a [Homo sapiens], 589 aa protein, Accession: NP_00l524.2 GI: 52632383; heterogeneous nuclear ribonucleoprotein L isoform b [Homo sapiens], 456 aa protein, Accession: NP_00l005335.l GI: 52632385.
The method optionally includes a step wherein the downstream target comprises BIN1, e.g., BIN I mRNA, Homo sapiens bridging integrator 1 (BIN1), transcript variant 1, mRNA, 2,686 bp linear mRNA, Accession: NM_l39343.2 GI: 346716175;
Ensembl:ENSG00000l367l7. The sequence of BIN 1 Protein, myc box-dependent- interacting protein 1 isoform 1 [Homo sapiens], 593 aa protein, is available at Accession: NP_647593.l GI: 21536400. Protein isoforms 2-16 are also available in the art. In addition to BIN1, other targets include TTN and DMD (see table below).
In some embodiments, the downstream targets include transcripts that are also targets of FOX1 (RBFOX1/A2BP1, Accession No. NP_665898.l). We have shown that hnRNP L and FOX1 co-immunoprecipitate (i.e., these splicing factors likely function together; Fig. 3). Aberrant splicing of FOX1 targets (due to a mutation in FOX1, leading in turn to ASD) is rescued by hnRNP F if the targets are downstream of both splicing factors.
Compositions such as small molecule drugs, e.g., ascochlorin, are also useful to treat spliceopathies. In preferred embodiments, the composition increases the level of hnRNP F in a neuronal cell of the subject. For example, the composition comprises an isoprenoid antibiotic such as ascochlorin or derivatives thereof. Delivery routes include intrathecal,
intravenous (IV), sub-cutaneous, oral, skin patch, nasal aerosol. Preferably, route of administration comprises least intrusive modes of delivery such as oral administration.
A preferred composition includes ascochlorin or a derivative thereof. Exemplary derivative compounds include an ascochlorin glycoside Vertihemipterin A, a aglycone thereof, 4',5'-dihydro-4'-hydroxyascochlorin, 8'-hydroxyascochlorin; LL-Zl272delta, 8', 9'- dehydroascochlorin, ascofuranone, ascofuranol, AS-6, Cylindrol A5, 4-O-methylascochhlorin (MAC), or colletochlorin. Particularly preferred are compounds characterized as having minimal or absence of toxicity. For example, MAC has been tested in clinical trials (U.S. Patent 3,995,061, 1976) and was well tolerated. The ascochlorin derivatives 4-O-methyl- ascochlorin (MAC), and 4-O-ethyl-ascochlorin display low toxicity as assessed by high LD50 after ip or oral administration (Hosokawa T et ah, U.S. Patent 3,995,061, 1976). Suitable compound include 4-O-methylascochlorin (MAC), 4-O-ethylascochlorin, and other derivatives/analogs, including AS-6, ascofuranone (AF) and AF-like analogs/ubiquinol mimics isolated via novel routes of synthesis using structure activity relationships (SAR)
(e.g., AF-like analogues 18 and 19, as described in West et ah, Eur J Med Chem. 2017 Dec 1; 141:676-689), ascochlorin glycoside Vertihemipterin A, a aglycone thereof, 4',5'-dihydro- 4'-hydroxyascochlorin, 8'-hydroxyascochlorin; FF-Zl272delta, 8',9'-dehydroascochlorin.
In addition to therapeutic method, screening methods are encompassed by the invention. For example, a method of identifying a compound for treatment of ASD (and other disorders/diseases described above), include steps of contacting a neuronal cell with a candidate compound and detecting an increase in hnRNP F expression or activity or an increase in expression or activity of a downstream target of hnRNP F, wherein the increase indicates that the compound decreases a symptom or severity of ASD as well as other disorders/diseases as listed above). Suitable exemplary cell lines include mammalian/human (normal or diseased) iPS cells-derived neuroprogenitor, neuron, or glia including
oligodendrocytes, astrocytes (e.g., GIBCO® Human Neural Stem Cells (hNSCs, embryonic H9-derived), rat fetal neural stem cells, rat glial precusor cells (rGPC); rat adrenal gland phaeochromocytoma PC-12 cell line); primary neurons/glia cultures; immortalized neuronal cell lines (e.g., neuroblastoma cell lines: human SH-SY5Y, human SK-N-AS, hybrid rat/mouse Fl 1; or mouse hippocampal neuronal HT-22 cell line).
Diagnostic methods are also encompassed. For example, a method for identifying a subject suffering from or at risk of developing ASD (other disorders/diseases described
above), comprise the steps of detecting a mutation/defect in the hnRNP L
gene/mRN A/protein in a tissue/cells of the subject. Suitable patient-derived samples to be evaluated include those obtained in a minimally or non-invasive manner, e.g., bodily fluids as well as cell or tissue samples, as described below.
The nature of DNA/RNA mutation includes but is not limited to: deletion, insertion, point mutation, mis sense mutation, sense mutation, single nucleotide polymorphism, splice site mutation, cryptic splice site recruitment, mutation in RNA binding protein (RBP) binding sequence. The nature of the protein defect includes but is not limited to: truncation, elongation, amino acid change, aberrant post-translation modification. Assessment includes using minimally invasive procedures, e.g., using DNA from hair, skin cells, saliva, blood, iPS cells derived differentiated cells (e.g., neurons).
A method for identifying a subject suffering from or at risk of developing ASD (or other disorders/diseases listed above), comprising detecting an alteration (or a change) in hnRNP L level (RNA, protein or activity, versus normal) or an alteration (or a change) in the normal hnRNP L mRNA variant/protein isoform (e.g., expression of the fetal isoform versus adult isoform) in a tissue of the subject compared to a normal control hnRNP L level, wherein a decrease or increase of at least 10% compared to a normal control level indicates that the subject comprises or is at risk of developing ASD. For example, an increase may reflect a compensatory mechanism linked to the pathogenesis. In some cases, both increased level as well as decreased level of splicing factors (other than hnRNP L) have been linked to pathogenesis, e.g., decrease in RBFOX1 linked to heart failure (Gao et al., J Clin Invest. 2016 Jan; 126(1): 195-206).
Assessment of differential hnRNP L expression, examples include but are not limited to mRNA levels, e.g., quantitative RT-PCR analysis using hnRNP L-specific primers (e.g., Origene HNRNPL Human qPCR Primer Pair (NMJ301533) cat#HP228l07);
TwistDx™ isothermal nucleic acid amplification technology that enables combination of primers and detection of multiple hnRNP L variants. For determination of protein levels, assays, e.g., Western blot analysis, using a commercially available anti-human hnRNP L antibody (monoclonal, e.g., clone 4D11, or polyclonal) are useful. Methods are used to assess activity levels, e.g., hnRNP L variants with higher or lower activity.
A method for identifying in a subject suffering from or at risk of developing ASD (or other disorders/diseases) also include evaluation of efficacy of therapeutic treatment,
comprising partial of at least 10%, or complete, restoration of normal hnRNP L level (RNA, protein or activity) or hnRNP L mRNA variant/protein isoform expression pattern, in a tissue of a subject where normal is defined as control values found in corresponding normal human tissue.
The method of treatment describes herein may further comprise administering to a subject a composition that upregulates heterogeneous nuclear ribonucleoprotein L (hnRNP L) or restores normal splicing in a downstream target of hnRNP L that is misspliced as a result of a genetic mutation in the target gene, or subsequently to the neurological pathogenesis related to ASD or other disorders/diseases.
The invention includes methods of diagnosis that include the steps of contacting a tissue or bodily fluid sample from a subject with an hnRNP L binding agent and a detectable label to form a complex and measuring the amount of the complex. Suitable reagents include but are not limited to a Tagged/flagged/radiolabeled anti-hnRNP L antibody, a
Tagged/flagged/radiolabeled short nucleotide sequence that binds hnRNP L (e.g., CACA repeats, or derived from a known hnRNP L RNA target), Tagged/flagged protein partner (e.g., RBFOX1), or short peptide derived-thereof, and Tagged/flagged nucleotide sequence derived from hnRNP L RNA (based on documented autoregulation). Tagged or flagged reagents are those that are labelled with a radioactive compound visually detectable reagent such as a fluorescent compound (whether the reagent is directly labeled, or by using a secondary conjugated (e.g., Alexa, Cy3, Cy5) antibody directed against the reagent), or that can be detected using a colorimetric assay (e.g., ELISA). Such detection methods are also useful in a method of monitoring disease severity or response to treatment, comprising measuring an amount of hnRNP L level (mRNA, protein, activity) in a tissue of a subject following administration of a medicament, wherein an increase over time indicates that the disease severity is decreasing in response to treatment.
The invention also includes methods of diagnosis that include the steps of contacting a tissue or bodily fluid sample from a subject with altered splicing, or expression level, or variant/isoform expression profile, of a target of hnRNP L (e.g., BIN1, DMD, TTN) to determine a subject suitable for treatment or assess progress/efficacy of treatment. The invention also includes methods of assessing efficacy of a therapeutic agent on the above hnRNP L or target of hnRNP L, that include the steps of contacting a tissue or bodily fluid
sample from a subject, and showing restoration of the normal expression level or splicing or variant/isoform expression profile.
Each embodiment disclosed herein is contemplated as being applicable to each of the other disclosed embodiments.
Other features and advantages of the invention will be apparent from the following description of the preferred embodiments thereof, and from the claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below.
All references, e.g., journal articles, protein or nucleic acid sequence accession numbers, cited U.S. patents, U.S. patent application publications and PCT patent applications designating the U.S., are hereby incorporated by reference in their entirety.
DESCRIPTION OF THE DRAWINGS
Fig. 1 is a diagram showing that hnRNP L plays a key role in brain pathophysiology. The 10 nucleotide consensus hnRNP L target sequence, and exemplary 10 hnRNP L target sequences (with high-score motifs in red or in bold, low-score motifs underlined), and 2 control sequences (with asterisks; #20 or SEQ ID NO: 11 and #15 or SEQ ID NO: 13) with their KD values are given. (See Hui et al. EMBO J. 24(11): 1988-98, 2005.) In some embodiments, the hnRNP L binding site, described herein, comprises a consensus amino acid sequence shown in the above sequence logo plot. For example, such high-affinity hnRNP L binding sites may comprise between two and four motifs, mostly of the high-score type (ACAC, CACA): SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4. For example, such intermediate-affinity hnRNP L binding sites may comprise only one or two high-score motifs each (ACAC, CACA): SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7. For example, such low-affinity hnRNP L binding sites may comprise only a single, low-score motif (TACA, CACC): SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10.
Hui # Sequence SEQ ID NO:
51 ATACATGACACACACACGCA 1
55 CACACACACTACACCACAC 2
1 CACACCACAACGGCACCACA 3
63 TGCATCTACGTACACACACA 4
33 AATCACATACGCTTTACACA 5
105 CCGGACAAACACACGAACAC 6
26 TGCAAATGAAATGACTACAC 7
72 TTCACCTTTACCGGCAGCCT 8
49 TGCAAACCTAAATGAGGTACA 9
23 AAACCACCCCAAACAACAAC 10
20* TTT AC G ACT CT GC AC GTT A A 11
6 ATGCAGCCCTCGTCATTGGC 12
15* TTGTTCCGATATAGCGCGAC 13
Fig. 2 is a series of photographs showing that ascochlorin treatment increases the level of hnRNP L in rat embryonic cortical neurons.
Fig. 3 is a photograph showing that HNRNP L interacts with RBFOX1.
Fig. 4 is a table showing the absence of significant toxicity with administration of ascochlorin/derivatives in multiple disease models.
Fig. 5 is a table of ascochlorin and derivatives thereof and corresponding chemical structures.
Fig. 6 is a table showing that the ascochlorin derivatives 4-O-methyl-ascochlorin (MAC), and 4-O-ethyl-ascochlorin display low toxicity as assessed by high FD50 after ip or oral administration.
Fig. 7 is a diagram showing compounds 18 and 19 from West et al. Eur. J. Med. Chem. 2017.
Fig. 8 is a diagram showing ascochlorin derivatives/analogs and corresponding chemical structures.
DETAILED DESCRIPTION
Described herein is a conserved pathway downstream of the splicing factor hnRNP L, which comprises 46 genes that are conserved from invertebrates to mammals including humans. A bioinformatic analysis of a compendium of known human alternative splicing events was carried out to identify sequences that include the hnRNP L binding motif and are expressed in skeletal muscle and/or the heart. This analysis revealed 46 conserved putative targets of hnRNP L in muscle and the heart. (See U.S. Patent 9,662,314, 2017.)
Table of 46 genes
Ensembl Gene Accession
Human Gene Description
ID Number *
AB11 ABF interactor EnsembkENSG NP 005461.2
l/spectrin SH3 00000097007
Acetyl Coenzyme A EnsembhENSG
ACSS2 NP_001070020.2 synthetase 00000131069
ArfGAP GTPase
ankyrin repeat and EnsembhENSG
AGAP3 NP_l 14152.3
PH domain 00000133612
containing
Alanine glyoxylate EnsembhENSG
AGXT2L2 NP_699204.l aminotransferase 2 00000175309
Beta amyloid EnsembhENSG
APP NP_000475.l precursor 00000142192
Plasma membrane EnsembhENSG
ATP2B1 NPJ301673.2 calcium ATPase 00000070961
Plasma membrane EnsembhENSG
ATP2B4 NPJ301675.3 calcium ATPase 00000058668
EnsembhENSG
BIN1 Bridging integrator NP_647593.l
00000136717
Nucleosome
BPTF/ EnsembhENSG
remodeling factor NP_872579.2
FALZ 00000171634
subunit
Cl2orf4l/ Histone acetyl EnsembhENSG
NP 360292.3
KANSL2 transferase activity 00000139620
Cl4orfl33/ Sorting of lysosomal EnsembhENSG
NP_071350.2
VIPAR proteins 00000151445
EnsembhENSG
DMD Dystrophin NP_003997.1
00000198947
EnsembhENSG
DTNA Dystrobrevin NP_00l38l.2
00000134769
Argonaute EnsembhENSG
EIF2C2 NP_036286.2 translation factor 2C 00000123908
Transmission across EnsembhENSG
EPB41L2 NP_001422.1 chemical synapses 00000079819
EnsembhENSG
FMNL2 Formin NP_443137.2
00000157827
Ral GTPase
GARNL1/ EnsembhENSG
activating protein a NP 919277.2
RALGAPA1 00000174373
subunit
EnsembhENSG
ITSN2 Intersectin NP 003015.2
00000198399
Homolog of murine EnsembhENSG
KIAA1217 NP 062536.2
Sickle tail 00000120549
Leucine rich repeat EnsembhENSG
LRRFIP1 NP_00l 131024.1 flightless interacting 00000124831
MAPT Microtubule EnsembhENSG NP 001116538.2
associated Tau 00000186868
MYC associated EnsembhENSG
MAX NPJ302373.3 factor X 00000125952
Myocyte specific EnsembhENSG
MEF2A NPJ305578.2 enhancer factor 00000068305
Neural cell adhesion EnsembhENSG
NCAM1 NP_001229536.1 molecule 1 00000149294
EnsembhENSG
PALLD Palladin NP_00l 159580.1
00000129116
PDZ and LIM EnsembhENSG
PDLIM7 NPJ305442.2 domain 00000196923
Serine/Threonine
Phosphatase 2 A EnsembhENSG
PPP2R5C NP_00l 155197.1 regulatory subunit 00000078304
B56
Tyrosine
EnsembhENSG
PTPN3 phosphatase non NPJ302820.3
00000070159
receptor
Retinitis pigmentosa EnsembhENSG
RPGR NP_001030025.1
GTPase regulator 00000156313
RNA polymerase 1
EnsembhENSG
RRN3 specific NPJ360897.3
00000085721
transcription factor
SAD1/ Serine threonine EnsembhENSG
NP_l 15806.1
BRSK2 kinase SAD 00000174672
EnsembhENSG
SAMD4A Smaug homolog 1 NPJ356404.4
00000020577
EnsembhENSG
SEMA6D Semaphorin 6D NP_70587l.l
00000137872
Phosphate carrier
EnsembhENSG
SLC25A3 protein, NP_005879.1
00000075415
mitonchondrial
NFR2 pathway, may
EnsembhENSG
SLC39A9 act as a zinc-influx NP 360845.2
00000029364
transporter
EnsembhENSG
SMTN Smoothelin NP_00l 193946.1
00000183963
Sorbin and SH3 EnsembhENSG
SORBS 1 NR_001030126.1 domain containing 1 00000095637
EnsembhENSG
STXBP5 Tomosyn NP_640337.3
00000164506
Archvillin; EnsembhENSG
SVIL NP 368506.2
Supervilin, 00000197321
TPM1 Tropomyosin EnsembhENSG NP 001018004.1
00000140416
EnsembkENSG
TPM3 Tropomyosin NP_689476.2
00000143549
Tripartite motif EnsembkENSG
TRIM66 NP_055633.l containing 66 00000166436
EnsembkENSG
TTN Titin NP_001254479.2
00000155657
Vacuolar protein EnsembkENSG
VPS29 NP_476528.l sorting 29 00000111237
Aminoacyl proline EnsembkENSG
XPNPEP1 NP_065116.3 aminopeptidase 00000108039
Protein kinase C EnsembkENSG
ZMYND8 NP 898868.1 binding protein 1 00000101040
* Representative protein in the family encoded by the gene.
The hnRNP L pathway is highly enriched in genes that are linked to autism spectrum disorder (ASD, 12 targets/46). Based on this discovery, isoprenoid antibiotics, including but not limited to the compounds ascochlorin, and its derivatives (i.e. natural and synthetic related compounds, e.g. 4-O-methyl ascochlorin (MAC), the ascochlorin glycoside
Vertihemipterin A, and its aglycone, 4',5'-dihydro-4'-hydroxyascochlorin, 8'- hydroxyascochlorin; LL-Zl272delta, 8',9'-dehydroascochlorin; ascofuranone; ascofuranol; AS-6; Cylindrol A5) can be used directly, and/or as chemical template structures, to treat autism spectrum disorder and related neurological/psychiatric disorders, including but not limited to, mental retardation, learning disability, attention deficit hyperactivity disorder, dyslexia, epilepsy, bipolar disorder, and schizophrenia. Isoprenoid antibiotics have been shown to increase hnRNP L protein levels 12c in vitro (Kang et al., J Proteome
Res. 2006 Oct;5(l0):2620-3).
The hnRNP L pathway is useful to identify genes/targets relevant to the treatment of ASD. For example, a cell-based assay is used to identify drugs that modulate hnRNP L levels. Such a cell-based assay utilizes any relevant cell type, e.g., rat embryonic cortical neurons (see Fig. 2), where hnRNP L plays a role in cell physiology/morphology (including but not limited to, neurons, glia, stem cells, pluripotent/multipotent progenitor cells, or undifferentiated cells). Such assays enable the identification of pharmacological compounds that are useful for the development of ASD therapeutics. In addition to being relevant to ASD, the pathway may be used to identify targets/therapeutic compounds for other
neurological/psychiatric disorders, including but not limited to, mental retardation, learning disability, attention deficit hyperactivity disorder, dyslexia, epilepsy, bipolar disorder, and schizophrenia.
Thus, the compounds and methods targeting hnRNP L-regulated pathway are useful as treatment formulations and to identify compound and/or targets for the treatment of autism spectrum disorder and other neurological/psychiatric disorders.
Isoprenoid antibiotics
Isoprenoid antibiotics, including but not limited to the compounds ascochlorin, and its derivatives (i.e. natural and synthetic related compounds, e.g. ascofuranone, ascofuranol, MAC, AS-6, cylindrol As, vertihemipterin A, vertihemipterin A aglycone, 8’- hydroxyascochlorin, 8’,9’-dehydroaschchlorin, 8’-acetoxyascochlorin, colletochlorin) can be used directly, and/or as chemical template structures, to treat autism, autism spectrum disorder and related neurological and psychiatric disorders, including but not limited to, mental retardation, learning disability, attention deficit hyperactivity disorder, dyslexia, epilepsy, bipolar disorder, and schizophrenia.
Ascochlorin been shown to increase hnRNP L protein levels in vitro , in U20S osteosarcoma cells (Kang et al., J Proteome Res. 2006 Oct;5(l0):2620-3). Surprisingly, ascochlorin has been shown to increase hnRNP L levels in neurons (e.g., primary rat cortical neurons, Fig. 2), a cell/tissue type significantly different from osteosarcoma tissue. In addition, the hnRNP L pathway can be utilized to identify novel genes/targets relevant to the treatment of autism spectrum disorder. A cell-based assay (e.g., assessing drug-induced changes in hnRNP L levels), optimized in cell types where hnRNP L plays a role in cell physiology/morphology (including but not limited to, neurons, glia, stem cells,
pluripotent/multipotent progenitor cells, or undifferentiated cells), enables the identification of pharmacological compounds that are useful for the development of autism spectrum disorder therapeutics. In addition to ASD, this screening strategy is useful to identify novel targets/pre-therapeutic leads for other neurological and psychiatric disorders, including but not limited to, mental retardation, intellectual disability, learning disability, attention deficit hyperactivity disorder, dyslexia, epilepsy, bipolar disorder, and schizophrenia.
Autism spectrum disorder
Autism spectrum disorder (ASD) is a complex neurodevelopmental disorder that is typically recognized in early childhood and has a lifelong course (Lacivita et al., J. Med.
Chem. 2017, 60 (22), 9114-9141 and references cited therein). According to the latest diagnostic criteria, it is characterized by two core symptoms: (1) persistent deficits in social communication and social interaction, (2) restricted, repetitive patterns of behavior, interests, and activities. The diagnosis is based on clinical observation and further established by standardized testing of the patient with the Autism Diagnostic Observation Schedule 2, and/or by parental interview with the Autism Diagnostic Interview-Revised. Thus far, no behavioral, neuroimaging, electrophysiological, or genetic tests can specifically diagnose ASD. Comorbid conditions such as intellectual disability, seizures, and sleep problems are frequent, whereas anxiety, depression, and obsessive-compulsive disorder (OCD) are less frequent.
ASD distinguishes from most other behavioral disorders for the impressive clinical and pathogenetic heterogeneity, which has led to the designation with the term ASD of a set of neurodevelopmental disorders with early onset in life, sharing autism as a common feature, but caused by separate processes. Originally, ASD was believed to be relatively rare, but the prevalence rates have dramatically increased in the past decade, from approximately 4/10000 to 1/68 children. Various reasons have been put forward to account for this dramatic increase, including broadening of the spectrum to include even milder forms, improved clinical detection, and higher public awareness. As a result, ASD has recently emerged as a major public health issue worldwide.
Altered neurodevelopment during the first and second trimesters of prenatal life is believed to be an underlying neuropathological cause of ASD. Post-mortem studies have unveiled neuroanatomic and cytoarchitectonic aberrations in various brain regions, including cerebellum, hippocampus, inferior olivary complex, amygdala, entorhinal cortex, fusiform gyrus, and anterior and posterior cingulate cortex, with increased growth of the frontal lobes, thinner cortical minicolumns, and increased dendritic spine density. While some of these aberrations (e.g., reduced programmed cell death and/or increased cell proliferation, altered cell migration, abnormal cell differentiation with reduced neuronal body size, abnormal neurite sprouting, pruning that cause atypical wiring into the brain, reduced synapse formation and delayed myelination) appear to be related to alterations occurring during early pregnancy, corresponding neurodevelopmental processes and accompanying brain plasticity are active well into late prenatal and postnatal life (Bryan Kolb and Robbin Gibb, Brain Plasticity and Behaviour in the Developing Brain, J Can Acad Child Adolesc Psychiatry.
2011 Nov; 20(4): 265-276). The observed abnormal neuronal wiring was previously thought to be characterized by long-range hypoconnectivity and local hyperconnectivity. Recent studies have instead shown that abnormal neuronal wiring is characterized by a highly individualized combination of hyper- and hypoconnectivity specific to each ASD patient.
The neurocognitive phenotype of ASD is the result of a complex and highly heterogeneous set of genetic and environmental causes. However, in some patients, the disorder is the result of purely genetic causes due to known chromosomal aberrations or mutations, while in other patients, the disorder is more likely related to environmental causes, such as prenatal exposure to chemical pollutants, toxins, viruses, or even drugs. To date, hundreds of risk genes have been identified and not a major causative gene, with either rare variants that are highly penetrant or common variants with small effects. It is therefore not surprising that this genetic heterogeneity is not associated with a characteristic
neuropathology for ASD. Finally, neuroinflammation in ASD is receiving attention because of the altered expression of neuroinflammatory markers observed in the amniotic fluid, serum, cerebrospinal fluid, and the brain tissue of ASD patients (Lacivita etak, J.Med.Chem. 2017, 60 (22) 9114 -9141 and references cited therein).
The present invention relates to the treatment of neurological disorders using isoprenoid (prenyl-phenol) antibiotics, including but not limited to the compounds ascochlorin, its derivatives and analogs (e.g. ascofuranone, ascofuranol, MAC, AS-6, cylindrol As, vertihemipterin A, vertihemipterin A aglycone, 8’-hydroxyascochlorin, 8’, 9’- dehydroaschchlorin, 8’-acetoxyascochlorin, colletochlorin) which can be used directly, and/or as chemical template structures, to help treat neurological disorders in humans. The relevant neurological and psychiatric disorders include, but are not limited to, autism, autism spectrum disorder, mental retardation, learning disability, intellectual disability, attention deficit hyperactivity disorder, dyslexia, epilepsy, bipolar disorder, and schizophrenia.
Natural Sources of the Isoprenoid Antibiotic Compounds
Isoprenoid antibiotics were originally isolated from the phytopathogenic fungus Ascochyta viciae. (Sasaki, H. et al. J Antibiot (Tokyo), 1973, 26:676-680). Among them, ascochlorin and ascofuranone have been shown to be non-toxic compounds. Structurally related compounds have been subsequently isolated from other fungi (e.g., Fusarium, Cylindrocladium, Cylindrocladium ilicicola, Nectria coccinea, Colletotrichum nicotianae, Acremonium luzulae, Cephalosporium diospyri, Verticillium, Cylindrocarpon lucidum,
Nigrosabulum globosum, and the insect pathogenic fungus Verticillium hemipterigenum). (Hosono, K. et al. J Antibiot (Tokyo), 2009, 62:571-574; Seephonkai, P. et al. J Antibiot (Tokyo), 2004, 57:10-16).
Physiological Properties of the Isoprenoid Antibiotic Compounds
Ascochlorin and derivatives (e.g., MAC) as well as analogs (e.g., ascofuranone) display antitumorigenic properties, both in vitro and in vivo (Min-Wen et al., Adv Protein Chem Struct Biol. 2017; 108: 199-225).
In addition to anticancer properties, ascochlorin and its derivatives exhibit a wide range of physiological activities, including antimicrobial/antiviral activity, trypanocidal properties, hypolipidemic activity, suppression of hypertension, improvement of type I and II diabetes, anti inflammatory, and immunomodulation. (Yabu, Y. et al. Parasitol Int. 2003, 52:155-164; Hosono, K. et al. J Antibiot (Tokyo), 2009, 62:571-574; Lee et al., J Cell Biochem. 2016 Apr;l l7(4):978-87; Shen et al., Eur J Pharmacol. 2016 Nov 15;791:205-212).
Other examples of ascochlorin derivatives may be found in:
(i) Pubchem databases:
http://www.ncbi.nlm.nih.gov/pccompound/?term=ascochlorin; by using the “similar compounds” interactive link;
(ii) Pharmaceutical composition and method of using the same. United States Patent No. 3,995,061.
(iii) Ascochlorin derivatives, and pharmaceutical composition containing the same.
United States Patent No. 4,500,544;
(iv) Pyridyl carbonyl ascochlorin derivatives and pharmaceutical compositions
containing the same. United States Patent No. 4,542,143;
(v) Ligands of nuclear receptor. United States Patent No. 6,605,639.
(vi) Ascochlorin derivative and use thereof as ampk activator. WO 2017/119515.
(vii) R. A. West, et al., African trypanosomiasis: Synthesis & SAR enabling novel drug discovery of ubiquinol mimics for trypanosome alternative oxidase, European Journal of Medicinal Chemistry 141 (2017) 676-689,
https://doi.Org/l0.l0l6/j.ejmech.20l7.09.067.
(viii) Togashi, M et al., Ascochlorin Derivatives as Ligands for Nuclear Hormone Receptors. J. Med. Chem. 2003; 46:4113-4123.
(ix) Saimoto, H et al., Pharmacophore Identification of Ascofuranone, Potent
Inhibitor of Cyanide-Insensitive Alternative Oxidase of Trypanosoma brucei. J. Biochem. 2013; 153:267-273.
Additonal compounds include an ascochlorin derivative from Cylindrocarpon sp. FKI-4602.
Kawaguchi et al., J Antibiot (Tokyo). 2013 Jan;66(l):23-9; ascochlorin derivatives from the leafhopper pathogenic fungus Microcera sp. BCC 17074. Isaka et al., J Antibiot (Tokyo). 2015 Jan;68(l):47-5l; and compound described in Discovery of a new structural class of competitive hDHODH inhibitors with in vitro and in vivo anti inflammatory, immunosuppressive effects. Shen et al., Eur J Pharmacol. 2016 Nov 15;791:205-212.
Splicing Factor hnRNP L and Downstream RNA Targets:
hnRNP L binds to RNA targets, for example, the following sequence:
Proteome analysis has demonstrated that ascochlorin treatment of human
osteosarcoma cells (U20S) results in a >10 fold increase in the levels of three proteins, including the splicing factor hnRNP L (first most upregulated protein, 12c), as well as BIN1 (third most upregulated protein, lOx) (Kang J. H. et al. J Proteome Res. 2006;5:2620-2631). It has been determined by bioinformatics analysis that BIN 1 is a candidate target of hnRNP L. In addition, the BIN1 gene was shown to be associated with autism spectrum disorder (Connolly J. J. et al. Child Dev. 2013 Jan-Feb;84(l): 17-33).
The methylated derivative of ascochlorin, 4-O-methylascochlorin (MAC), increases the expression of vascular endothelial growth factor (VEGF) and glucose transporter 1 (GLUT-l) (Jeong J. H. et al. Biochem Biophys Res Commun. 2011;406:353-358). Both VEGF and GLUT-l RNAs are well-established targets of hnRNP L (Hamilton B. J. et al. Biochem Biophys Res Commun. 1999;261:646-651; Ray P. S. et al. Nature. 2009;457:9l5- 919; Shih S. C. et al. J Biol Chem. 1999;274:1359-1365).
Ascochlorin and/or its derivatives promote the maintenance of normal brain physiology by targeting hnRNP L and/or components of the coordinated hnRNP L-regulated pathway(s). The compounds and methods of the invention provide therapeutic interventions to reduce the symptoms of autism spectrum disorder and additional neurological and psychiatric disorders by addressing underlying causes, e.g., aberrant splicing defects in the genes identified herein.
RBFoxl
The RNA binding protein RBFoxl binds to the hexamer UGCAUG (Lee, et al., Neuron 89(1): 113-28, 2016; Auweter, et al. EMBO J. 25(1): 163-73, 2006). Mutations in the conserved splicing factor FOX1 are linked to autism spectrum disorder (Davis L. K. et al. Am J Med Genet A. 2012;158A:1654-1661; Martin C. L. et al. Am J Med Genet B
Neuropsychiatr Genet. 2007;l44B:869-876 ; Voineagu I. et al. Nature. 2011;474:380-384). Identification of Compounds to treat autism spectrum disorder
Compounds that modify hnRNP L levels therefore hold promise as lead structures for the development of ASD/mental retardation/neurological disorders. Using Western Blot analysis, it has been observed that ascochlorin treatment of cultured rat primary cortical neurons results in increased levels of hnRNP L. Fig. 2 is a photograph of an electrophoretic gel showing how ascochlorin treatment increases the level of hnRNP L in rat embryonic cortical neurons (hnRNP L 60 KDa). Fig. 2 also shows that ascochlorin treatment does not affect the level of the control protein in rat embryonic cortical neurons (GAD PH 40 KDa).
Fig. 3 indicates that HNRNP L interacts with RBFOXL
Ascochlorin and/or its derivatives can promote the maintenance of normal brain physiology by targeting hnRNP L and/or components of the coordinated hnRNP L-regulated pathway(s). The compounds and methods described herein provide pharmacological leads to help treat autism spectrum disorder and additional neurological and psychiatric disorders. General Definitions
Unless specifically defined otherwise, all technical and scientific terms used herein shall be taken to have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in cell culture, molecular genetics, and biochemistry).
As used herein, the term“about” in the context of a numerical value or range means ±10% of the numerical value or range recited or claimed, unless the context requires a more limited range.
In the descriptions above and in the claims, phrases such as“at least one of’ or“one or more of’ may occur followed by a conjunctive list of elements or features. The term “and/or” may also occur in a list of two or more elements or features. Unless otherwise implicitly or explicitly contradicted by the context in which it is used, such a phrase is intended to mean any of the listed elements or features individually or any of the recited elements or features in combination with any of the other recited elements or features. For example, the phrases“at least one of A and B;”“one or more of A and B;” and“A and/or B” are each intended to mean“A alone, B alone, or A and B together.” A similar interpretation is also intended for lists including three or more items. For example, the phrases“at least one of A, B, and C;”“one or more of A, B, and C;” and“A, B, and/or C” are each intended to mean“A alone, B alone, C alone, A and B together, A and C together, B and C together, or A and B and C together.” In addition, use of the term“based on,” above and in the claims is intended to mean,“based at least in part on,” such that an unrecited feature or element is also permissible
It is understood that where a parameter range is provided, all integers within that range, and tenths thereof, are also provided by the invention. For example,“0.2-5 mg” is a disclosure of 0.2 mg, 0.3 mg, 0.4 mg, 0.5 mg, 0.6 mg etc. up to and including 5.0 mg.
A small molecule is a compound that is less than 2000 daltons in mass. The molecular mass of the small molecule is preferably less than 1000 daltons, more preferably less than 600 daltons, e.g., the compound is less than 500 daltons, 400 daltons, 300 daltons, 200 daltons, or 100 daltons.
As used herein, an“isolated” or“purified” nucleic acid molecule, polynucleotide, polypeptide, or protein, is substantially free of other cellular material, or culture medium when produced by recombinant techniques, or chemical precursors or other chemicals when chemically synthesized. Purified compounds are at least 60% by weight (dry weight) the compound of interest. Preferably, the preparation is at least 75%, more preferably at least
90%, and most preferably at least 99%, by weight the compound of interest. For example, a purified compound is one that is at least 90%, 91%, 92%, 93%, 94%, 95%, 98%, 99%, or 100% (w/w) of the desired compound by weight. Purity is measured by any appropriate standard method, for example, by column chromatography, thin layer chromatography, or high-performance liquid chromatography (HPLC) analysis. A purified or isolated
polynucleotide (ribonucleic acid (RNA) or deoxyribonucleic acid (DNA)) is free of the genes or sequences that flank it in its naturally-occurring state. A purified protein or polypeptide is free of the amino acids that flank it in its naturally-occurring state. Purified also defines a degree of sterility that is safe for administration to a human subject, e.g., lacking infectious or toxic agents.
Similarly, by“substantially pure” is meant a nucleotide or polypeptide that has been separated from the components that naturally accompany it. Typically, the nucleotides and polypeptides are substantially pure when they are at least 60%, 70%, 80%, 90%, 95%, or even 99%, by weight, free from the proteins and naturally-occurring organic molecules with they are naturally associated.
The transitional term“comprising,” which is synonymous with“including,” “containing,” or“characterized by,” is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. By contrast, the transitional phrase “consisting of’ excludes any element, step, or ingredient not specified in the claim. The transitional phrase“consisting essentially of’ limits the scope of a claim to the specified materials or steps“and those that do not materially affect the basic and novel
characteristic(s)” of the claimed invention.
The terms“subject,”“patient,”“individual,” and the like as used herein are not intended to be limiting and can be generally interchanged. That is, an individual described as a“patient” does not necessarily have a given disease, but may be merely seeking medical advice.
As used herein, the singular forms“a,”“an,” and“the” include the plural reference unless the context clearly dictates otherwise. Thus, for example, a reference to“a disease,”
“a disease state”, or“a nucleic acid” is a reference to one or more such embodiments, and includes equivalents thereof known to those skilled in the art and so forth.
As used herein,“treating” encompasses, e.g., inhibition, regression, or stasis of the progression of a disorder. Treating also encompasses the prevention or amelioration of any
symptom or symptoms of the disorder. As used herein,“inhibition” of disease progression or a disease complication in a subject means preventing or reducing the disease progression and/or disease complication in the subject.
As used herein, a“symptom” associated with a disorder includes any clinical or laboratory manifestation associated with the disorder, and is not limited to what the subject can feel or observe.
As used herein,“effective” when referring to an amount of a therapeutic compound refers to the quantity of the compound that is sufficient to yield a desired therapeutic response without undue adverse side effects (such as toxicity, irritation, or allergic response) commensurate with a reasonable benefit/risk ratio when used in the manner of this disclosure.
As used herein,“pharmaceutically acceptable” carrier or excipient refers to a carrier or excipient that is suitable for use with humans and/or animals without undue adverse side effects (such as toxicity, irritation, and allergic response) commensurate with a reasonable benefit/risk ratio. It can be, e.g., a pharmaceutically acceptable solvent, suspending agent or vehicle, for delivering the instant compounds to the subject.
Examples are provided below to facilitate a more complete understanding of the invention. The following examples illustrate the exemplary modes of making and practicing the invention. However, the scope of the invention is not limited to specific embodiments disclosed in these Examples, which are for purposes of illustration only, since alternative methods can be utilized to obtain similar results.
The term "neurological disorder or disease" as used herein refers to a disorder, disease or condition which directly or indirectly affects the normal functioning or anatomy of a subject's nervous system, including, but not limited to, the brain. In one embodiment, the neurological disorder or disease is a neurodevelopmental disorder.
An example of a neurological disorder or disease is autism. Another example of a neurological disorder or disease is autism spectrum disorder. In other examples, the neurological disorder or disease is epilepsy, schizophrenia or mental retardation.
Autism spectrum disorder (ASD) is a range of complex neurodevelopment disorders, characterized by social impairments, communication difficulties, and restricted, repetitive, and stereotyped patterns of behavior. Autism (also known as autistic disorder or classical ASD) is the most severe form of ASD. Other conditions along the spectrum include Asperger syndrome, childhood disintegrative disorder and pervasive developmental disorder not
otherwise specified (also referred to as PDD- NOS), and Chromosome l5ql l.2-13.1 duplication syndrome (dupl5q syndrome).
The phrase "treating a neurological disorder or disease" as used herein includes, but is not limited to, reversing, alleviating or inhibiting the progression of a neurological disorder or disease or conditions associated with a neurological disorder or disease. As used herein, and as well understood in the art, "to treat" or "treatment" is an approach for obtaining beneficial or desired results, including clinical results. Beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of extent of disease, stabilized (i.e. not worsening) state of disease, preventing spread of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. "Treatment" can also mean prolonging survival as compared to expected survival if not receiving treatment.
In one embodiment, treating a neurological disorder or disease includes preventing the occurrence of a neurological disorder or disease or symptoms or conditions associated with a neurological disorder or disease or preventing worsening of the severity of a neurological disorder or disease or conditions associated with a neurological disorder or disease.
The term "neurological function" as used herein refers to the functioning and/or activity of a subject's nervous system.
The term "improving neurological function" as used herein refers to improving the structure, function and/or activity of a subject's nervous system. In one embodiment, improving neurological function includes improving neurodevelopment and/or improving behavior.
The term "subject" as used herein refers to any member of the animal kingdom, such as a mammal. In one embodiment, the subject is a human. In another embodiment, the subject is a mouse.
The term "a cell" includes a single cell as well as a plurality or population of cells. Administering a modulator or an agent to a cell includes both in vitro and in vivo
administrations.
The modulators and agents described herein may be formulated into pharmaceutical compositions for administration to subjects and/or use in subjects in a biologically compatible form suitable for administration in vivo. The compositions described herein can be prepared
by per se known methods for the preparation of pharmaceutically acceptable compositions that can be administered to subjects, such that an effective quantity of the active substance is combined in a mixture with a pharmaceutically acceptable vehicle. Suitable vehicles are described, for example, in Remington's Pharmaceutical Sciences (Remington's
Pharmaceutical Sciences, 20th ed., Mack Publishing Company, Easton, Pa., USA, 2000). On this basis, the compositions include, albeit not exclusively, solutions of the substances in association with one or more pharmaceutically acceptable vehicles or diluents, and contained in buffered solutions with a suitable pH and iso- osmotic with the physiological fluids.
In one embodiment, the modulators and agents described herein are formulated into pharmaceutical compositions for administration to the brain or central nervous system of a subject. Modulators, agents and pharmaceutical compositions which cannot penetrate the blood-brain barrier can be effectively administered by an intraventricular route or other appropriate delivery system suitable for administration to the brain.
Pharmaceutical compositions include, without limitation, lyophilized powders or aqueous or non-aqueous sterile injectable solutions or suspensions, which may further contain antioxidants, buffers, bacteriostats and solutes that render the compositions substantially compatible with the tissues or the blood of an intended recipient. Other components that may be present in such compositions include water, surfactants (such as Tween), alcohols, polyols, glycerin and vegetable oils, for example. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules, tablets, or concentrated solutions or suspensions. Proteins may be supplied, for example but not by way of limitation, as a lyophilized powder which is reconstituted with sterile water or saline prior to administration to the patient.
Pharmaceutical compositions may comprise a pharmaceutically acceptable carrier. Suitable pharmaceutically acceptable carriers include essentially chemically inert and nontoxic compositions that do not interfere with the effectiveness of the biological activity of the pharmaceutical composition. Examples of suitable pharmaceutical carriers include, but are not limited to, water, saline solutions, glycerol solutions, ethanol, N-(l (2,3- dioleyloxy)propyl)N,N,N-trimethylammonium chloride (DOTMA), diolesylphosphotidyl- ethanolamine (DOPE), and liposomes. Such compositions should contain a therapeutically effective amount of the compound, together with a suitable amount of carrier so as to provide the form for direct administration to the patient.
The compositions may be in the form of a pharmaceutically acceptable salt which includes, without limitation, those formed with free amino groups such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with free carboxyl groups such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylarnino ethanol, histidine, procaine, etc.
The modulators, agents and/or pharmaceutical compositions described herein may be administered to, or used in, living organisms including humans, and animals. The term "subject" or "animal" as used herein refers to any member of the animal kingdom, in one embodiment a mammal such as a human being.
Administration of an "effective amount" of the modulators, agents and/or
pharmaceutical compositions is defined as an amount effective, at dosages and for periods of time necessary to achieve the desired result. For example, an effective amount of a substance may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the recombinant protein to elicit a desired response in the individual.
Dosage regime may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation.
Treatment of ASP and FQX1
The utility of ascochlorin (which increases hnRNP L levels ~12c (Kang J. H. et al. J Proteome Res. 2006;5:2620-2631) and its derivatives as for the treatment of autism spectrum disorder is underscored by the discovery that hnRNP L directly interacts with FOX1.
Pharmacological stabilization of the hnRNP L-FOX1 complex may be beneficial in cases where a decrease in the levels of FOX1 (~5.9 x) is known to cause autism (Voineagu I. et al. Nature. 2011;474:380-384). Further highlighting the potential of ascochlorin and its derivatives for the treatment neurological disorders is evidence that some antibiotics have ancillary neuroprotective effects (Stock M. L. et al. Neuropharmacology. 20l3;73C:l74-l82).
In addition to ascochlorin, the compounds and compositions described below are useful for the treatment of ASD.
Compounds of Formula 1
Formula 1
1 CHO H H Cl H
2 CHO H H Cl OAc
3 CHO H H Br H
4 CHO H H H H
5 CHO H CH3CO Cl H
6 CHO H CH3 Cl H
7 CHO CH3 CH3 Cl H
8 CHO CH3CO CH3 Cl H 9 CHO CH3 CH3CO Cl H
10 CHO CH3 H Cl H
11 CHO H CH3CH2 Cl H
12 CHO H Allyl Cl H
13 CHO H Butyl Cl H
14 CHO H CH2COOH Cl H
15 CHO H (CH2)2COOH Cl H
16 CHO H (CH2)3COOH Cl H
17 CHO H (CH2)4COOH Cl H
18 CHO H CH2COOCH3 Cl H
19 CHO H Nicotinoyl Cl H
20 CHO H Benzoyl Cl H 21 CHO H Isonicotinoyl Cl H 22 CHO H CH2COOC2H5 Cl H
23 CHO H CH2COOCH3 Cl H
24 CHO H CH2COOH Cl H
25 CHO H CHCH3COOC2H5 Cl H
26 CHO H CHCH3COOC4H9 Cl H
CHO H CHCH2CH3COOC2H5 Cl H
CHO H (CH2)3COOC2H5 Cl H
CHO H CHCH3COOH Cl H
CHO H (CH2)3COOH Cl H
CHO H Nicotinoyl Cl H
CHO H COC6H4OCH3 Cl H
CHO H COC6H4COOCH3 Cl H
CHO H CON(C2H5) Cl H
CHO H COCH2OC6H4Cl Cl H
CHO H Isonicotinoyl Cl H
CHO H Picolinoyl Cl H
CHO H CH3 Cl H
C2H2COCH3 H H Cl O CHO H CH3CO H H
CHO H CH3 H H
C2H2COCH3 H CH2COOH Cl O CHO CH3CO CH3CO Cl H C(OCH3)2 H CH3CO Cl H C(OCH2CH3)2 H CH3CO Cl H C(OCH2CH3)2 H CH3 Cl H
C(0(CH2)3CH3)2 H CH3 Cl H
50 CHO H CH2CH Cl H
51 CHO H CH2CHCH2 Cl H
52 C02H H H Cl H
Compounds of Formula 2
Formula 2
Compound # Ri R2 R3
53 Cl H H
54 H H H
55 Cl H OH
56 Cl H OAc
57 Cl CH H
58 Cl CH CO H
59 H CH H
60 H CH CO H
61 Cl H OCO(CH )2
62 Cl H OCOCH2C(CH )2
Additional compounds include, but are not limited to:
3-chloro-4,6-dihydroxy-2-methyl-5-((2E,4E)-3-methyl-5-((lR,2R,6R)-l,2,6-trimethyl-3- oxocyclohexyl)penta-2,4-dien- 1 -yl)benzaldehyde;
3-chloro-6-hydroxy-4-methoxy-2-methyl-5-((2E,4E)-3-methyl-5-((lR,2R,6R)-l,2,6- trimethyl-3-oxocyclohexyl)penta-2,4-dien-l-yl)benzaldehyde;
2-(2-chloro-4-formyl-5-hydroxy-3-methyl-6-((2E,4E)-3-methyl-5-((lR,2R,6R)- 1,2,6- trimethyl-3-oxocyclohexyl)penta-2,4-dien-l-yl)phenoxy)acetic acid;
3-chloro-5-((2E,6E)-7-((S)-5,5-dimethyl-4-oxotetrahydrofuran-2-yl)-3-methylocta-
2.6-dien-l-yl)-4,6-dihydroxy-2-methylbenzaldehyde;
(R,E)-5-(3-chloro-5-formyl-2,6-dihydroxy-4-methylphenyl)-3-methyl-l-((lS,2R,6R)-
1.2.6-trimethyl-3-oxocyclohexyl)pent-3-en-2-yl butyrate;
3-chloro-4,6-dihydroxy-5-((2E,6E)-7-((2R,3S)-3-hydroxy-5,5-dimethyl-4- oxotetrahydrofuran-2-yl)-3-methylocta-2,6-dien-l-yl)-2-methylbenzaldehyde;
3-chloro-5-((R,E)-4-(((2R,3R,4R,5S,6R)-3,4-dihydroxy-6-(hydroxymethyl)-5- methoxytetrahydro-2H-pyran-2-yl)oxy)-3-methyl-5-((lS,2R,6R)-l,2,6-trimethyl-3- oxocyclohexyl)pent-2-en-l-yl)-4,6-dihydroxy-2-methylbenzaldehyde;
3-chloro-4,6-dihydroxy-5-((R,E)-4-hydroxy-3-methyl-5-((lS,2R,6R)-l,2,6-trimethyl-
3-oxocyclohexyl)pent-2-en-l-yl)-2-methylbenzaldehyde;
3-chloro-4,6-dihydroxy-5-((2E,4E)-5-((lS,2S,3S,6R)-3-hydroxy-l,2,6-trimethyl-5- oxocyclohexyl)-3-methylpenta-2,4-dien-l-yl)-2-methylbenzaldehyde;
3-chloro-4, 6-dihydroxy-2-methyl-5-((2E,4E)-3-methyl-5-((lS,2R,6R)- 1,2,6- trimethyl-5-oxocyclohex-3 -en- 1 -yl)penta-2,4-dien- 1 -yl)benzaldehyde;
3-chloro-4,6-dihydroxy-5-((2E,4E)-5-((lS,2S,3S,6R)-3-hydroxy-l,2,6-trimethyl-5- oxocyclohexyl)-3-methylpenta-2,4-dien-l-yl)-2-methylbenzaldehyde;
(E)-3-chloro-5-(3,7-dimethylocta-2,6-dien-l-yl)-4,6-dihydroxy-2- methylbenzaldehyde;
cefacetrile; cefotaxime; ciproflaxin; netilimicine; or a quinolone/fluoroquinolone compound.
OTHER EMBODIMENTS
While the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
The patent and scientific literature referred to herein establishes the knowledge that is available to those with skill in the art. All United States patents and published or unpublished United States patent applications cited herein are incorporated by reference. All published foreign patents and patent applications cited herein are hereby incorporated by reference. Genbank and NCBI submissions indicated by accession number cited herein are hereby
incorporated by reference. All other published references, documents, manuscripts and scientific literature cited herein are hereby incorporated by reference.
While this invention has been particularly shown and described with references to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims.
Claims
1. A method for treating or reducing a symptom of Autism Spectrum Disorder (ASD), comprising administering to a subject a composition that either upregulates or downregulates heterogeneous nuclear ribonucleoprotein L (hnRNP L) or a target of hnRNP L selected from the group consisting of BIN1, AB11, ACSS2, AGAP3,
AGXT2L2, APP, ATP2B1, ATP2B4, BPTF, Cl2orf4l, Cl4orfl33, DMD, DTNA, E1F2C2, EPB41L2, FMNL2, GARNL1, ITSN2, KIAA1217, LRRFIP1, MAPT, MAX , MEF2A, NCAM1, PALLD, PDLIM7, PPP2R5C, PTPN3, RPGR, RRN3, SAD1, SAMD4A, SEMA6D, SLC25A3, SLC39A9, SMTN, SORBS 1, STXBP5, SVIL, TPM1, TPM3, TRIM66, TTN, VPS29, XPNPEP1, and ZMYND8.
2. The method of claim 1, wherein said target of hnRNP L comprises BIN1.
3. The method of claim 1, wherein said target of hnRNP L further comprises a
RBFOX1.
4. The method of claim 1, wherein said composition modulates the level of hnRNP L in a neuronal cell of said subject.
5. The method of claim 1, wherein said composition comprises an isoprenoid antibiotic.
6. The method of claim 1, wherein said composition comprises ascochlorin or a
derivative or analog thereof.
7. A method of identifying a compound for treatment of ASD, comprising contacting a neuronal cell with a candidate compound and detecting a change in hnRNP L expression or activity or a change in expression or activity of a downstream target of hnRNP L, wherein an increase or decrease in said expresson or activity indicates that said compound decreases a symptom or severity of ASD.
8. The method of claim 7, wherein said a change in hnRNP L expression or activity or a change in expression or activity of a downstream target of hnRNP L comprises an increase in said expresson or activity.
9. The method of claim 7, wherein said a change in hnRNP L expression or activity or a change in expression or activity of a downstream target of hnRNP L comprises a decrease in said expresson or activity.
10. A method for identifying a subject suffering from or at risk of developing ASD, comprising detecting a nucleic acid mutation in hnRNP L in a tissue of said subject.
11. A method for identifying a subject suffering from or at risk of developing ASD,
comprising detecting a decrease in hnRNP L level in a tissue of said subject compared to a normal control hnRNP L level, wherein a change of at least 10% compared to said normal control level indicates that said subject comprises or is at risk of developing ASD.
12. The method of claim 9, further comprising administering to said subject a
composition that alters expression of heterogeneous nuclear ribonucleoprotein L (hnRNP L) or a target of hnRNP L selected from the group consisting of AB11, ACSS2, AGAP3, AGXT2L2, APP, ATP2B1, ATP2B4, BIN1, BPTF, Cl2orf4l, Cl4orfl33, DMD, DTNA, E1F2C2, EPB41L2, FMNL2, GARNL1, ITSN2,
KIAA1217, LRRFIP1, MAPT, MAX , MEF2A, NCAM1, PALLD, PDLIM7, PPP2R5C, PTPN3, , RPGR, RRN3, SAD1, SAMD4A, SEMA6D, SLC25A3, SLC39A9, SMTN, SORBS 1, STXBP5, SVIL, TPM1, TPM3, TRIM66, TTN, VPS29, XPNPEP1, and ZMYND8.
13. The method of claim 12, wherein said target of hnRNP L further comprises RBFOX1.
14. A composition comprising an isoprenoid antibiotic for use in the method of claim 1.
15. The composition of claim 14, wherein said antibiotic comprises ascochlorin or a
derivative thereof.
16. The method of claim 1, wherein hnRNP L interacts with RBFOX1.
17. The method of claim 12, wherein hnRNP L interacts with RBFOX1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US15/734,869 US20210236438A1 (en) | 2018-06-05 | 2019-06-05 | Compounds and methods for the treatment of autism spectrum disorder and other neurological or psychiatric disorders |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201862681070P | 2018-06-05 | 2018-06-05 | |
| US62/681,070 | 2018-06-05 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2019236754A1 true WO2019236754A1 (en) | 2019-12-12 |
Family
ID=68769559
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2019/035659 Ceased WO2019236754A1 (en) | 2018-06-05 | 2019-06-05 | Compounds and methods for the treatment of autism spectrum disorder and other neurological or psychiatric disorders |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US20210236438A1 (en) |
| WO (1) | WO2019236754A1 (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116735892B (en) * | 2023-05-24 | 2026-04-17 | 中南大学湘雅医院 | An early diagnostic biomarker for Alzheimer's disease and its application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140243378A1 (en) * | 2011-10-21 | 2014-08-28 | Tufts Medical Center, Inc. | Compositions and Methods for the Treatment of Muscular Disease, and Related Screening Methods |
-
2019
- 2019-06-05 WO PCT/US2019/035659 patent/WO2019236754A1/en not_active Ceased
- 2019-06-05 US US15/734,869 patent/US20210236438A1/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140243378A1 (en) * | 2011-10-21 | 2014-08-28 | Tufts Medical Center, Inc. | Compositions and Methods for the Treatment of Muscular Disease, and Related Screening Methods |
Non-Patent Citations (3)
| Title |
|---|
| BLUE ET AL.: "How alternative splicing affects membrane-trafficking dynamics", J CELL SCI., vol. 131, no. 10, jcs216465, 16 May 2018 (2018-05-16), pages 1 - 13, XP055660471, DOI: 10.1242/jcs.216465 * |
| BUTLER ET AL.: "High-Resolution Chromosome Ideogram Representation of Currently Recognized Genes for Autism Spectrum Disorders", INT. J. MOL. SCI., vol. 16, no. 3, 20 March 2015 (2015-03-20), pages 6464 - 6495, XP055455960 * |
| LEE ET AL.: "Cytoplasmic Rbfox1 Regulates the Expression of Synaptic and Autism-Related Gene", NEURON, vol. 89, no. 1, 6 January 2016 (2016-01-06), pages 113 - 128, XP029381423 * |
Also Published As
| Publication number | Publication date |
|---|---|
| US20210236438A1 (en) | 2021-08-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Squarzoni et al. | Interleukin‐6 neutralization ameliorates symptoms in prematurely aged mice | |
| Peeters et al. | Clinical and genetic diversity of SMN1-negative proximal spinal muscular atrophies | |
| Joshi et al. | The MDM4/MDM2-p53-IGF1 axis controls axonal regeneration, sprouting and functional recovery after CNS injury | |
| WO2019236750A2 (en) | Targeted treatment of autism spectrum disorder and other neurological or psychiatric disorders | |
| US20180217163A1 (en) | Treatment of neurodegenerative conditions using pkc activators after determining the presence of the apoe4 allele | |
| WO2014176394A1 (en) | Vitamin d receptor/smad genomic circuit gates fibrotic response | |
| Du et al. | Small-molecule activation of TFEB alleviates Niemann–Pick disease type C via promoting lysosomal exocytosis and biogenesis | |
| Perronnet et al. | Upregulation of brain utrophin does not rescue behavioral alterations in dystrophin-deficient mice | |
| CN116397021A (en) | Application of PPP4r3a and/or Kif2a in diagnosis and treatment of progressive supranuclear palsy | |
| Nicolas et al. | A postzygotic de novo NCDN mutation identified in a sporadic FTLD patient results in neurochondrin haploinsufficiency and altered FUS granule dynamics | |
| US20210236438A1 (en) | Compounds and methods for the treatment of autism spectrum disorder and other neurological or psychiatric disorders | |
| Lee et al. | Interferon regulatory factor-1 (IRF-1) regulates VEGF-induced angiogenesis in HUVECs | |
| JP2020090525A (en) | Agent, method and kit for increasing intracellular Nix-mediated mitophagy for treating or preventing neurodegenerative disorder | |
| JP2024512569A (en) | Use of ADNF polypeptides in therapy | |
| JP2019182873A (en) | Compositions and methods for treating and preventing pancreatitis, kidney injury and kidney cancer | |
| CN121816198A (en) | Treatment methods for VEXAS syndrome | |
| US20220213479A1 (en) | Restoration of the cftr function by splicing modulation | |
| US20230032239A1 (en) | A method of treatment in predisposed subjects for lmna-related dilated cardiomyopathy | |
| US20250000838A1 (en) | Uses of Inhibitors of YTH Domain Family Proteins in the Management of Cognitive or Developmental Disorders | |
| Dejbakht et al. | Multiple Sclerosis: New Insights into Molecular Pathogenesis and Novel Platforms for Disease Treatment | |
| EP4630558A2 (en) | Targeted treatment of spliceopathy-induced neurological disorders | |
| US20090239884A1 (en) | Methods of Treating Inflammation | |
| CN116407634B (en) | Application of substances that increase the C-terminal content of Slack protein | |
| WO2021127003A1 (en) | Treating heart disease in muscular dystrophy patients | |
| US20240254489A1 (en) | Compositions and methods of targeting the pax6 signaling pathway to reduce formation of amyloid beta plaques and neurofibrillary tangles |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 19815505 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 19815505 Country of ref document: EP Kind code of ref document: A1 |



