WO2019216623A1 - Cellular vaccine having immune tolerance for treatment of diabetes and obesity and method for producing insulin-secreting cells - Google Patents

Abstract

The present invention relates to a method for preparing an immune-tolerant cellular vaccine for treating diabetes and obesity, and more specifically, to a method for preparing immune-tolerant cells, the method comprising adding a culture of insulin-secreting pancreatic β-cell spheroids to a medium containing GM-CSF, and culturing immature dendritic cells and inducing same to differentiate into immune-tolerant cells; a cellular vaccine prepared by the method; a method for preparing the cellular vaccine; and a composition comprising the cells for preventing or treating diabetes or obesity.

Description

Method for producing immune tolerant cell vaccine and insulin secreting cells for the treatment of diabetes and obesity

This application claims priority to Korean Patent Application No. 10-2018-0054515, filed May 11, 2018, the entire disclosure of which is incorporated herein by reference.

The present invention relates to a method for producing an immune tolerant cell vaccine for the treatment of diabetes and obesity. More specifically, insulin-secreting pancreatic β-cell ellipsoid culture is added to a medium containing GM-CSF, and immature dendritic cells are cultured for immunity. The present invention relates to a method for producing immune tolerant cells, a cell vaccine prepared according to the method and a method for producing the same, and a composition for preventing or treating diabetes or obesity comprising the cells.

Dendritic cells (Dendritic Cells) are antigen-presenting cells of the mammalian immune system and have branched or dendritic spines. The main function of dendritic cells is to process antigenic substances and present them on the cell surface to T cells of the immune system. Dendritic cells, therefore, are the major antigen-labeling cells that activate non-sensitized T lymphocytes, acting as messengers between the innate and adaptive immune systems. It is located in peripheral tissues, forms a dense network, plays a role in monitoring the immune system through the expression and response to pathogen-aware receptors such as Toll-like receptors (TLR). Dendritic cells in peripheral tissues have an immature phenotype characterized by low levels of major histocompatibility complex (MHC) and costimulatory molecules (CD80, CD86) and high endoctic rates.

Prophylactic vaccines are one of the most effective ways to prevent disease, and prophylactic vaccines are designed to prevent the spread of infection, and their activity is associated with the induction of specific antibodies and memory B cells. Therapeutic vaccines, on the other hand, are designed to eliminate the cause of a given disease. The activity of therapeutic vaccines is primarily dependent on antigen specific CD8 ⁺ T cells sensitized to produce Cytotoxic T Lymphocytes (CTLs) that reject cancer or infected cells.

Diabetes mellitus is due to quantitative deficiency or lack of action in insulin, resulting in elevated blood sugar levels compared to normal people, resulting in markedly healthy blood vessels such as microvascular disorders in the kidneys, retina, nerves, and atherosclerosis. It is a metabolic disease that damages life. Until now, hypoglycemic agents such as insulin, insulin secretagogues, insulin resistance enhancers, and α-glucosidase inhibitors have been widely applied as clinical treatments. However, although these hypoglycemic agents have been recognized for their usefulness, each has many problems. For example, insulin is at risk of causing hypoglycemia when administered in an inappropriate manner or at a dose. In addition, the effectiveness of insulin secretagogues and insulin resistance improving agents is decreased in diabetic patients whose insulin secretion capacity of the pancreas is remarkably decreased, or the effectiveness of insulin and insulin secretagogues is decreased in diabetic patients with significant insulin resistance.

In connection with the treatment or prevention of diabetes, various treatments for preventing diabetes using a non-obese diabetes (NOD) mouse model have been studied (Immunity. 2005 Aug; 23 (2): 115-26). However, only a few of the various therapies are known to inhibit the development of diabetes or reverse hyperglycemia, and few therapies inhibit obesity-related insulin resistant diabetes and reverse hyperglycemia.

On the other hand, in the clinical studies of diabetes prevention or treatment agents, cell vaccines of type 1 diabetes, which have been currently researched and developed, have failed to meet expectations. Type 2 diabetes and obesity-related cell vaccines have been developed. not yet.

Therefore, the present inventors have studied for the development of vaccine composition using dendritic cells, matured immunity by treating the insulin-secreting pancreatic β-cell culture or exosomes extracted therefrom to increase insulin secretion ability through 3D ellipsoid culture. It was confirmed that there is an effect of inducing tolerant dendritic cells, and confirmed that the cells exhibit a vaccine effect against metabolic diseases such as type 1, type 2 diabetes and obesity, and completed the present invention.

Therefore, the object of the present invention

A method for producing dendritic cells for immune tolerance characterized in that immature dendritic cells are cultured in a medium containing GM-CSF to which pancreatic β-cell exosomes are added and differentiated into mature immune tolerant dendritic cells.

The immature dendritic cells are obtained through cell culture in a medium containing IL-4 and GM-CSF,

The pancreatic β cell exosomes,

a) centrifuging pancreatic β cells from which the TSPAN2 (tetraspanin-2) gene has been removed and culturing three-dimensional spheroids;

b) separating the exosomes from the culture or obtaining a culture medium containing the exosomes; to provide a method characterized in that it is prepared by a method comprising a.

Another object of the present invention is to provide a dendritic cell for immune tolerance prepared by the above method.

Still another object of the present invention is to provide a dendritic cell vaccine comprising the above-mentioned immune tolerance dendritic cells as an active ingredient.

In addition, another object of the present invention is to provide a dendritic cell vaccine comprising the immune tolerance dendritic cells as an active ingredient.

In addition, another object of the present invention to provide a dendritic cell vaccine consisting essentially of the immune tolerance dendritic cells as an active ingredient.

Still another object of the present invention is to provide a composition for preventing or treating type 1, type 2 diabetes or obesity, comprising the immune tolerant dendritic cells of the present invention.

Further, another object of the present invention is to provide a composition for preventing or treating type 1, type 2 diabetes or obesity, which is composed of the immune tolerant dendritic cells of the present invention.

Still another object of the present invention is to provide a composition for preventing or treating type 1, type 2 diabetes or obesity, which is essentially composed of the immune tolerant dendritic cells of the present invention.

It is still another object of the present invention to provide a composition, which further comprises insulin secreting cells having the following properties in the immunotolerant dendritic cells of the present invention:

a) be insulin producing cells (IPCs);

b) The tetraspanin-2 gene is knocked out.

Another object of the present invention is to provide the use of the immunotolerant dendritic cells of the present invention for the preparation of a prophylactic or therapeutic agent for the prevention or treatment of type 1, type 2 diabetes or obesity.

Another object of the present invention is to prevent or treat type 1, type 2 diabetes or obesity, comprising administering to a subject in need thereof an effective amount of a composition comprising the immune tolerant dendritic cells of the present invention as an active ingredient. To provide a way.

In order to achieve the above object, the present invention

A method for producing dendritic cells for immune tolerance characterized in that immature dendritic cells are cultured in a medium containing GM-CSF to which pancreatic β-cell exosomes are added and differentiated into mature immune tolerant dendritic cells.

The immature dendritic cells are obtained through stem cell culture in a medium containing IL-4 and GM-CSF,

The pancreatic β cell exosomes,

a) centrifuging pancreatic β cells from which the TSPAN2 (tetraspanin-2) gene has been removed and culturing three-dimensional spheroids;

b) separating the exosomes from the culture or obtaining a culture medium containing the exosomes; provides a method characterized in that it is prepared by a method comprising a.

In order to achieve another object of the present invention, the present invention provides a dendritic cell for immune tolerance prepared by the above method.

In order to achieve another object of the present invention, the present invention provides a dendritic cell vaccine comprising the above-mentioned immune tolerance dendritic cells as an active ingredient.

The present invention also provides a dendritic cell vaccine composed of the above-mentioned immune tolerance dendritic cells as an active ingredient.

The present invention also provides a dendritic cell vaccine consisting essentially of the immune tolerance dendritic cells as an active ingredient.

In order to achieve another object of the present invention, the present invention provides a composition for the prevention or treatment of type 1, type 2 diabetes or obesity comprising the immune tolerant dendritic cells of the present invention.

The present invention also provides a composition for the prevention or treatment of type 1, type 2 diabetes or obesity composed of the dendritic cells for immune tolerance of the present invention.

In addition, the present invention provides a composition for the prevention or treatment of type 1, type 2 diabetes or obesity consisting essentially of the immune tolerant dendritic cells of the present invention.

In order to achieve another object of the present invention, the present invention provides a composition characterized in that it further comprises insulin secreting cells differentiated from mesenchymal stem cells having the following characteristics to the immunotolerant dendritic cells of the present invention:

a) be insulin producing cells (IPCs);

b) The tetraspanin-2 gene is knocked out.

In order to achieve another object of the present invention, the present invention provides a use of the immunotolerant dendritic cells of the present invention for the preparation of a prophylactic or therapeutic agent for the prevention or treatment of type 1, type 2 diabetes or obesity.

In order to achieve another object of the present invention, the present invention comprises administering to a subject in need thereof an effective amount of a composition comprising the immune tolerant dendritic cells of the present invention as an active ingredient. Or a method for preventing or treating obesity.

Hereinafter, the present invention will be described in detail.

The present invention is a method for producing dendritic cells for immune tolerance, characterized in that immature dendritic cells are cultured in a medium containing GM-CSF to which pancreatic β-cell exosomes are added to differentiate into mature immune tolerant dendritic cells.

The immature dendritic cells are obtained through stem cell culture in a medium containing IL-4 and GM-CSF,

The pancreatic β cell exosomes,

a) centrifuging pancreatic β cells from which the TSPAN2 (tetraspanin-2) gene has been removed and culturing three-dimensional spheroids;

b) separating the exosomes from the culture or obtaining a culture medium containing the exosomes; provides a method characterized in that it is prepared by a method comprising a.

In the method of producing dendritic cells for immune tolerance according to the present invention, three-dimensional spheroid culture of pancreatic β cells from which the TSPAN2 gene has been removed is confirmed to increase insulin secretion, and culture of these pancreatic β cells or exosomes derived therefrom The immature dendritic cells are treated to induce maturation of the immature dendritic cells, and then to the immature dendritic cells.

In the present invention, the stem cell refers to an undifferentiated cell having the ability to differentiate into various types of body tissues, which are totipotent stem cells, pluripotent stem cells, and multipotent stem cells. (multipotent stem cell). Stem cells are differentiated into a variety of tissue cells when appropriate conditions are set in an undifferentiated state, and research for applying them to treatment such as regenerating damaged tissues is being conducted. Stem cells may be derived from umbilical cord, umbilical cord blood, bone marrow, fat, muscle, nerves, skin, amniotic membrane, chorion, decidual membrane, or placenta, and are preferably bone marrow-derived stem cells.

In the present invention, immunotolerance is also referred to as immunological tolerance, and refers to a state that does not show an immune response to a specific antigen. In the present invention, the immune tolerant dendritic cell means a dendritic cell that induces tolerance to autologous antigen and inhibits the proliferation of T cells. For the purpose of the present invention, the immune tolerant dendritic cell is immune to an antigen causing diabetes. Dendritic cells that induce tolerance. The immune tolerance dendritic cells of the present invention can be obtained by inducing differentiation of immature dendritic cells.

Immature dendritic cells (DCs) of the invention can be obtained by a method of isolating DC progenitor cells from a suitable tissue source containing progenitor cells or by making immature DCs. The method of producing immature DC refers to a method of producing immature DCs by differentiating progenitor cells in vitro, wherein the progenitor cells may be blood mononuclear cells or hematopoietic stem cells derived from a suitable tissue source. Suitable tissue sources may be bone marrow, peripheral blood, umbilical cord blood, and the like, more preferably derived from bone marrow cells.

In the present invention, the granulocyte-macrophage colony stimulating factor (GM-CSF) may help to induce differentiation of dendritic cells by rapidly increasing the number of cells.

In one embodiment of the present invention, in order to prepare mature dendritic cells, the immature dendritic cells and exosomes obtained from pancreatic β cell cultures are mixed with 30 μL and cultured to obtain mature dendritic cells, and then the immune tolerance induced dendritic cells are induced. Prepared.

More specifically, (1) bone marrow-derived stem cells from the tibia and the femur of the mouse were isolated and cultured in a medium containing IL-4 and GM-CSF to obtain immature dendritic cells, (2) the following a) to c Pancreatic β cell culture was prepared by the method of step).

a) removing the TSPAN2 (tetraspanin-2) gene from the pancreatic β cell line, RNAKT-15 cell line;

b) centrifuging the pancreatic β cells from which the TSPAN2 gene has been removed to form a three-dimensional spheroid culture;

c) obtaining a cell culture comprising any one or more selected from the group consisting of pancreatic β cells and medium from which the TSPAN2 gene has been removed;

Immature dendritic cells of step 1) were then mixed with (3) pancreatic β cell culture of step 2) to differentiate immature dendritic cells into mature dendritic cells.

'TSPAN-2 (tetraspanin-2) gene' of the present invention is a gene encoding the tetraspanin-2 protein, which belongs to the transmembrane 4 superfamily or the tetraspanin family. Tetraspanin-2 protein is a membrane protein with four characteristic hydrophobic domains, also known as NET3, TSN2, TSPAN2, TSPAN-2, and the like, and three major isoforms are known. It plays an important role in cell development, activation, growth and motility, also known as NET3, TSN2, TSPAN2, TSPAN-2 and the like, and three major isoforms are known. It is also known that tetraspanin-2 plays a role in regulating JNK / β-catenin signaling in human pancreatic β cells and promoting apoptosis.

The pancreatic β cells from which the tetraspanin-2 gene of the present invention has been removed can reduce the serine phosphorylation of IRS-1 and increase the tyrosine phosphorylation of IRS-1, thereby increasing insulin sensitivity. have.

In the present invention, the three-dimensional spheroid cultured pancreatic β cells are characterized by an increase in insulin secretion ability.

The pancreatic β cells of the present invention increase the expression of 'E-cadherin' in 3D ellipsoid. E-cadherin is a protein that plays an essential role in early embryonic epithelialization, cell rearrangement, tissue morphogenesis, establishment of cell polarity and maintenance of tissue structure. In the present invention, E-cadherin may be used as a major marker for exosome isolation. In spheroids, E-cadherin increases insulin protein secretion in a contact-dependent manner.

In the present invention, the culture of step b) is characterized in that it comprises an immunogenic exosomes.

In the present invention, the 'exosome' is a vesicle of membrane structure secreted from various types of cells, and is known to play various roles such as binding to other cells and tissues to deliver membrane components, proteins, and RNA. have.

The present invention also provides mature dendritic cells prepared by the above method. Also provided is a dendritic cell vaccine comprising mature dendritic cells according to the present invention.

In the method for producing a mature dendritic cell vaccine of the present invention, the immature dendritic cells are differentiated into mature dendritic cells according to the above method ((1) to (3)), and (4) undifferentiated immature dendritic cells are removed. It includes a step.

In the present invention, the immune tolerant dendritic cell vaccine prepared by the above method may preferably be a vaccine for preventing diabetes or obesity, or may be a vaccine for treating diabetes or obesity. In the present invention, diabetes may be type 1 diabetes or type 2 diabetes.

In the present invention, the 'vaccine' refers to a biological agent containing an antigen that immunizes the living body, and refers to an immunogen or antigenic substance that immunizes the living body by injection or oral administration to a human or animal to prevent infection. In vivo immunization is largely divided into autoimmunity, in which immunity is automatically obtained after infection by pathogens, and passive immunity obtained by an externally injected vaccine. While autoimmunity is characterized by a long period of generation of antibodies related to immunity and continuous immunity, passive immunization with vaccines acts immediately to treat infectious diseases, but has a disadvantage of poor sustainability.

The vaccine composition of the present invention may include a pharmaceutically acceptable carrier. Any component suitable for delivery of an antigenic substance to an in vivo site, for example, water, saline, phosphate buffered saline, Ringer's solution, dextrose solution, serum-containing solution, Hans' solution, other water soluble physiological equilibrium solutions , Oils, esters and glycols, and the like.

Carriers of the present invention may include suitable auxiliary ingredients and preservatives to enhance chemical stability and isotonicity, and may include temperature stabilizers or freezes by including stabilizers such as trehalose, glycine, sorbitol, lactose or monosodium glutamate (MSG). The vaccine composition can be protected against drying. The vaccine composition of the present invention may comprise a suspension liquid, such as sterile water or saline (preferably buffered saline).

The vaccine composition of the present invention may contain any adjuvant in an amount sufficient to enhance the immune response to the immunogen. Suitable adjuvants include aluminum salts (aluminum phosphate or aluminum hydroxide, squalene mixtures (SAF-1), muramyl peptides, saponin derivatives, mycobacteria ( mycobacterium cell wall preparation, monophosphoryl lipid A, mycolic acid derivatives, nonionic block copolymer surfactants, Quil A, cholera toxin B subunit, polyphosphazene ) And derivatives, and immuno-stimulating complexes (ISCOMs).

As with all other vaccine compositions, the immunologically effective amount of an immunogen should be determined empirically, in which case factors that may be considered include immunogenicity, route of administration and frequency of immune administration administered. It can also be controlled according to the progression and instability of complications caused by obesity and blood glucose in the patient, the type of formulation, the age, sex, weight, health condition, diet, time of administration and method of administration of the patient.

The ellipsoid cultured pancreatic β cell culture, which is the antigenic substance in the vaccine composition of the present invention, may be present in various concentrations in the composition of the present invention, but in general, the antigenic substance is sufficient to induce the formation of an appropriate level of antibody in vivo. Include in the required concentration.

As used herein, the term “administration” means introducing a predetermined substance into a patient by any suitable method, and the route of administration of the dendritic cell vaccine of the present invention is administered through any general route as long as they can reach the target tissue. Can be.

The vaccine composition of the present invention can be used to treat pancreatic cancer by administering via the systemic or mucosal route. Administration of the vaccine composition may include intramuscular, intraperitoneal, subcutaneous or subcutaneous, intestinal mesentery, pancreatic β cells, intrahepatic, renal subcutaneous injection, oral / meal, respiratory, mucosal administration to the genitourinary tract. But it is not limited thereto.

In addition, in order to enhance the efficacy of a dendritic cell-based vaccine, a combination of cytokines that help activate T cells, such as IL-12, may be used in combination with dendritic cells, or dendritic cells transfected with the cytokine gene may be used. Could be.

Cells containing dendritic cells, which are the active ingredients of the vaccine produced by the present invention, are inoculated as a therapeutic vaccine in the human body, so that cell proliferation can be eliminated in order to increase safety. For example, it can be treated with heat treatment, radiation treatment, or mitomycin C (MMC) treatment to selectively use it more safely as a cell vaccine, and eliminate the proliferative ability while remaining functioning as a vaccine. have. For example, 25-50 µg / ml of mitomycin C may be added to dendritic cells to be insulated at 37 ° C. for 30 minutes to 60 minutes. The cell processing method by heat can be heat-processed for 20 minutes at 50 to 65 degreeC, for example.

In addition, the present invention provides a composition for preventing or treating diabetes, comprising the dendritic cells for immune tolerance of the present invention as an active ingredient. The present invention also provides a composition for preventing or treating obesity, comprising the dendritic cells for immune tolerance of the present invention as an active ingredient. The composition of the present invention may preferably be a pharmaceutical composition.

The pharmaceutical composition according to the invention may contain the mature dendritic cells according to the invention alone or may be formulated in a suitable form with a pharmaceutically acceptable carrier and may further contain excipients or diluents. As used herein, 'pharmaceutically acceptable' refers to a non-toxic composition that, when administered to human beings, is physiologically acceptable and typically does not cause allergic or similar reactions such as gastrointestinal disorders, dizziness, and the like.

The composition of the present invention may be administered to any mammal, including humans. For example, it can be administered orally or parenterally. Parenteral administration methods include, but are not limited to, intravenous, intramuscular, intraarterial, intramedullary, intradural, intrarenal, transdermal, subcutaneous, intraperitoneal, intraperitoneal, intranasal, intestinal, topical, and sublingual Or rectal administration.

The pharmaceutical composition of the present invention may be formulated into a preparation for oral or parenteral administration according to the route of administration as described above.

In the case of preparations for oral administration, the compositions of the present invention may be formulated using methods known in the art as powders, granules, tablets, pills, dragees, capsules, solutions, gels, syrups, slurries, suspensions and the like. Can be. For example, oral formulations can be obtained by tablets or dragees by combining the active ingredients with solid excipients and then grinding them, adding suitable auxiliaries and processing them into granule mixtures. Examples of suitable excipients include sugars, including lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol and maltitol and starch, cellulose, including starch, corn starch, wheat starch, rice starch and potato starch, and the like. Fillers such as cellulose, gelatin, polyvinylpyrrolidone, and the like, including methyl cellulose, sodium carboxymethylcellulose, hydroxypropylmethyl-cellulose, and the like. In addition, crosslinked polyvinylpyrrolidone, agar, alginic acid or sodium alginate and the like may optionally be added as a disintegrant. Furthermore, the pharmaceutical composition of the present invention may further include an anticoagulant, a lubricant, a humectant, a perfume, an emulsifier, a preservative, and the like.

Formulations for parenteral administration may be formulated by methods known in the art in the form of injections, creams, lotions, external ointments, oils, humectants, gels, aerosols and nasal inhalants. These formulations are generally known in all pharmaceutical chemistries.

In addition, the pharmaceutical compositions of the present invention may be formulated with a cell therapeutic agent according to the route of administration as described above.

The 'cell therapy' refers to proliferating, selecting, or otherwise changing the biological characteristics of living autologous, allogenic, and xenogenic cells in vitro to restore the function of cells and tissues. Medicines used for the purpose of treatment, diagnosis and prevention through a series of activities. Since 1993, the United States has managed cell therapy as a medicine since 2002. These cell therapies can be broadly classified into two fields. The first is stem cell therapy for tissue regeneration or long-term function recovery, and the second is immunization for the regulation of immune responses such as suppressing the immune response or enhancing the immune response in vivo. Can be classified as a cell therapy.

In the case of cell therapeutic agents, they may be administered by any device capable of moving to the target cell. In addition, the cell therapy may be administered parenterally, and may be administered by intravenous infusion, subcutaneous infusion, intraperitoneal infusion, transdermal administration, etc. Suitable dosages may be formulated by method of administration, mode of administration, age, weight, sex, time of administration and Various prescriptions may be made by such factors as the route of administration, but preferably 1 × ^{10 5} to 10 × ^{10 9} cells per dose.

The total effective amount of the composition of the present invention may be administered to a patient in a single dose and may be administered by a fractionated treatment protocol which is administered in multiple doses for a long time. The pharmaceutical composition of the present invention may vary the content of the active ingredient depending on the extent of the disease. Preferably the preferred total dose of the pharmaceutical composition of the present invention may be about 0.01 μg to 10,000 mg, most preferably 0.1 μg to 500 mg per kg of patient body weight per day. However, the dosage of the pharmaceutical composition is determined in consideration of various factors such as the formulation method, route of administration and frequency of treatment, as well as various factors such as the patient's age, weight, health status, sex, severity of the disease, diet and excretion rate. In view of this, one of ordinary skill in the art will be able to determine the appropriate effective dosage of the compositions of the present invention. The pharmaceutical composition according to the present invention is not particularly limited to its formulation, route of administration and method of administration as long as the effect of the present invention is shown.

In another aspect, the present invention provides a composition, characterized in that it further comprises an insulin secreting cell having the following properties:

a) be insulin producing cells (IPCs);

b) The tetraspanin-2 gene is knocked out.

The insulin secreting cells of the present invention may be induced differentiation from mesenchymal stem cells, and when additionally administering or transplanting insulin secreting cells in which such tetraspanin-2 gene is removed, IRS-1 Increasing insulin sensitivity may be achieved by reducing serine phosphorylation and further increasing tyrosine phosphorylation of IRS-1.

As a result of confirming the effect of the 3D ellipsoid culture on the insulin secretion ability of the pancreas-derived cells in one embodiment of the present invention, the amount of insulin secretion increased more than two times in the 3D ellipsoid culture compared to the control (2D planar culture) It could be confirmed that (Fig. 1).

In one embodiment of the present invention confirmed the effect of the dendritic cell vaccine of the present invention on diabetes incidence in diabetic non-obesity (NOD) mice to be a type 1 diabetes model, 16 weeks of age in the case of a control (No injection) The incidence of diabetes among the whole group gradually increased, whereas, in the group receiving the dendritic cell vaccine (DC-Vac), diabetes did not develop (FIG. 4), and only DC-Vac was administered even after stopping the insulin administration. Normal blood sugar was found to be maintained (Fig. 5a to 5c).

In another embodiment of the present invention, after administering the dendritic cell vaccine (DC-Vac) and a combination thereof (DC-Vac + TK-IPCs) according to the present invention to a non-obese (NOD) mouse, the adipose tissue of the mouse As a result, it was confirmed that the fat cell size was smaller when the vaccine was administered (FIG. 6). In addition, as a result of measuring the amount of adiponectin and the amount of adiponectin in the mouse, when the vaccine is administered, the body fat amount is low, the adiponectin content is high, and both the blood glucose level and the insulin concentration decrease in the DC-Vac group compared to the control group, DC In the -Vac + TK-IPCs administration group, the blood content was found to be lower (FIGS. 7A to 7D).

In another embodiment of the present invention, after administering the dendritic cell vaccine according to the present invention to a high fat diet-induced obesity mouse and a normal diet mouse, insulin sensitivity and glucose tolerance were measured. Compared with the control group, and when administered in combination with TK-IPCs it was confirmed that the effect is much better and controlled similarly to normal mice (Figs. 8a and 8b).

In another embodiment of the present invention, after administration of the dendritic cell vaccine or a combination thereof according to the present invention to mice fed high fat diet and normal diet mice, the weight, blood sugar, plasma of fasting mice As a result of measuring the insulin concentration, it was confirmed that the dendritic cell vaccine-administered group was lower than the control group, and even lower when the TK-IPCs were administered in combination (FIGS. 9A to 9C).

In another embodiment of the invention, the phosphorylation of IRS-1 at Ser307 or at tyrosine results in that phosphorylation of IRS-1 at Ser307 is reduced when treated with dendritic cell vaccine, and TK-IPCs In combination with and decreased even more, the treatment of DC-Vac and TK-IPCs was found to increase tyrosine phosphorylation (Fig. 10a and 10b).

The present invention also provides the use of the immune tolerant dendritic cells of the present invention for the preparation of a type 1, type 2 diabetes or obesity prophylaxis or treatment.

The present invention also provides a method for preventing or treating type 1, type 2 diabetes or obesity, comprising administering to a subject in need thereof an effective amount of a composition comprising the immune tolerant dendritic cells of the present invention as an active ingredient. do.

The 'effective amount' of the present invention, when administered to an individual, refers to an amount that shows the effect of improving, treating, preventing, detecting, diagnosing or preventing or reducing diabetes or obesity in an individual, wherein the 'individual' is an animal, preferably It may be a mammal, especially an animal including a human, and may be cells, tissues, organs or the like derived from the animal. The subject may be a patient in need of the effect.

The 'treatment' of the present invention refers generically to improving symptoms of diabetes, obesity or diabetes, obesity, which may include treating, substantially preventing, or improving the condition of diabetes or obesity, It includes, but is not limited to, alleviating, healing or preventing one or most of the symptoms resulting from diabetes or obesity.

The term 'comprising' of the present invention is used in the same way as 'containing' or 'featured' and does not exclude additional component elements or method steps not mentioned in the composition or method. . The term 'consisting of' means to exclude additional elements, steps or components, etc., unless otherwise noted. The term “consisting essentially of” means within the scope of the composition or method, including the component elements or steps described, as well as the component elements or steps that do not substantially affect its basic properties, and the like.

Accordingly, the present invention provides a method for producing immune tolerant dendritic cells suitable for the prevention or treatment of diabetes and obesity, it is possible to obtain a prophylactic or therapeutic effect against diabetes and obesity when inoculating the immune tolerant dendritic cells of the present invention. In addition, when used in combination with bone marrow-derived insulin secreting cells, insulin sensitivity may be further increased by decreasing serine phosphorylation of IRS-1 and increasing tyrosine phosphorylation of IRS-1, which may be useful for the prevention or treatment of diabetes and obesity. have.

1 shows that insulin secretion ability is increased in 3D ellipsoid culture of pancreatic β cells.

Figure 2a shows that dendritic cells are induced into immune tolerant dendritic cells after maturation, so that immune tolerant dendritic cells (tDC) show low levels of MHC II expression.

 2b shows that tDC expresses 3-dioxygenase (IDO) immunosuppressive molecule by western blotting.

2c shows that mature dendritic cells (mDCs) show high secretion compared to tDCs showing low IL-10, IL-12 and TNF-α secretion.

3 shows that IPCs and TK + IPCs increase insulin production when stimulated with high glucose (10 mM) concentrations. MSC was used as a control.

Figure 4 shows that the treatment of dendritic cell vaccine (DC-Vac) in the development of a mouse model of diabetes newly prevent the development of diabetes in the mouse.

5A to 5C show dendritic cell vaccines (DC-Vac) only (FIG. 5A), dendritic cell vaccines and exendin-4 (DC-Vac + exendin) (FIG. 5B). And it shows the result of measuring the blood glucose change when treated with bone marrow-derived insulin secreting cells (DC-Vac + TK-IPCs) (Fig. 5c).

Figure 6 is treated only with dendritic cell vaccine (DC-Vac) (middle panel), treated with dendritic cell vaccine and bone marrow-derived insulin secreting cells (DC-Vac + TK-IPCs) (lower panel) The result of observation under a microscope of the change of fat accumulation in the liver (upper panel) is shown.

7A-7D show the body fat mass of mice (FIG. 7A), the adiponectin in mice when treated with dendritic cell vaccine (DC-Vac), dendritic cell vaccine and bone marrow-derived insulin secreting cells (DC-Vac + TK-IPCs). (adiponectin) concentration (FIG. 7B), blood glucose concentration (FIG. 7C), and plasma insulin concentration (FIG. 7D) are measured.

8A and 8B show dendritic cell vaccine (DC-Vac), dendritic cell vaccine and bone marrow-derived insulin secreting cells (DC-Vac + TK-IPCs) in an obese mouse model of type 2 diabetes (ob / ob mouse) In one case, blood glucose levels (FIG. 8A) and insulin sensitivity test results (FIG. 8B) of obese mice are shown.

9A-9C show body weights 6 and 10 weeks after treatment of dendritic cell vaccine (DC-Vac), dendritic cell vaccine and bone marrow-derived insulin secreting cells (DC-Vac + TK-IPCs) in obese mice (FIG. 9A). , Blood glucose concentration (FIG. 9B) and blood insulin concentration (FIG. 9C) are measured.

10A and 10B show IRS-1 in Ser307 in hepatocytes extracted from mice treated with dendritic cell vaccine (DC-Vac), dendritic cell vaccine and bone marrow-derived insulin secreting cells (DC-Vac + TK-IPCs) in obese mice. Phosphorylation of insulin receptor substrate-1) (increased insulin resistance) (FIG. 10A) and tyrosine phosphorylation of IRS-1 (reduced insulin resistance) (FIG. 10B) are shown by Western blot.

Hereinafter, the present invention will be described in detail.

However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

Experiment method

1.Creation of TSPAN2-knockout (TSPAN2-EN) RNAKT-15 Cell Line

TSPAN2-KO RNAKT-15 cell line was generated by permanently removing the TSPAN2 gene using RNA scissors (Crispr / Cas9) from RNAKT-15 cells, a human pancreatic β cell line.

Crispr / Cas9 sequence: GGGGACTGGGGATCCCGCCGCCGGGCCGCAGC (SEQ ID NO: 1)

2. Cell Culture and Human Pancreatic β Cell Culture Preparation

The TSPAN2-KO RNAKT-15 cell line prepared above was prepared by adding 10% fetal bovine serum (Thermo, Rockville, MD, USA), 1% penicillin-streptomycin, 10 mM nicotinamide, 10 μM troglitazone, and 16.7 μM zinc sulfate. Cultured in glucose (5 mM) DMEM medium at 37 ° C. and 5% CO ₂ conditions. Cells were then harvested in 15 mL tubes and centrifuged at 13,000 rpm for 3 minutes, the supernatant was removed and resuspended in fresh culture medium. Resuspended cells were incubated in ultra-low attachment surface 96-well at a concentration of 1 × 10 ⁴ cells / ml. Then, centrifuged at 1,800 rpm for 3 minutes to form a three-dimensional (3D) spheroid (spheroid), and the pancreatic cell culture was prepared by increasing the insulin secretion ability through the β-cell spheroid culture.

3. Flow Cytometry

FITC-labeled monoclonal antibodies against CD44, CD90, CD31, CD45 molecules, purified monoclonal antibodies against PE-conjugated monoclonal antibodies against MHC-II (Santa Cruz Biotechnology, Santa Cruz, Calif.). Samples were analyzed on FACSCalibur (BD Biosciences).

4. Insulin Secretion Assay

Insulin secretion was measured by replacing the buffer culture medium in RNAKT-15 cells incubated with 2D plane and 3D ellipsoid. After 1 hour equilibration at 37 ° C., the cells were incubated with buffer containing 10 mM glucose concentration for 1 hour. After 1 hour, the supernatants were pooled and insulin content was measured using the Human Insulin ELISA Kit (Thermo Fisher Scientific).

5. EXOsome Extraction

Exosomes were extracted from the 3D spheroid cultured RNAKT-15 cell culture prepared as described above. First, the cells and culture were collected in a tube, and then centrifuged for 10 minutes at a speed of 300xg. The supernatant thus obtained was transferred to a 50 ml centrifuge tube and centrifuged at 4 ° C. for 20 minutes at a rate of 2000 × g.

The separated supernatant was obtained and transferred to a polyalloy tube or polycarbonate bottle suitable for ultracentrifugation rotor, then centrifuged at 4 ° C. for 30 minutes at a rate of 10,000 × g, and pellets were obtained. (At this time, for swing-bucket rotors, the pellets are at the bottom of the tube. For fixed-angle rotors, the pellets are on the side of the tube facing up near the bottom of the tube).

The supernatant was then completely removed after centrifugation at 4 ° C. for at least 70 minutes at a rate of 100,000 × g.

The pellet was then resuspended in each tube of 1 mL phosphate buffer saline (PBS). Resuspended pellets were collected from all the tubes, and then PBS was added thereto to completely fill the tubes and centrifuged at 100,000 xg and 4 ° C for 70 minutes. Then all supernatant was removed. The pellet (exosome) obtained by removing the supernatant was resuspended or concentrated.

When resuspended, resuspended by adding 50-100 μl of PBS or TBS.

When concentrating the exosomes, the supernatant obtained above was centrifuged at 4 ° C. for 1 hour at a rate of 100,000 × g using a TLA-100.3 rotor and a corresponding thick walled polycarbonate tube. . Most of the PBS on the visible pellets was removed and exosomes were resuspended in 20-50 μl of fresh PBS.

6. Culture of Dendritic Cells

Bone marrow-derived cells obtained from tibia and femur of female NOD mice (5 weeks old, Samtacobio Korea Co., Ltd.) were obtained. Immature dendritic cells (DCs) were then isolated from bone marrow-derived cells and 10% Fetal Bovine Serum, 1% penicillin / streptomycin, rmIL-4 and rmGM-CSF were added to RPMI1640 medium. Next, exosomes (30 ul) were added and cultured for 24 hours on days 6-9, and administration of LPS (lipopolysaccharide) and antigen myosin (Myosin, From Porcine heart; Sigma) were performed. Thereafter, mature dendritic cells were obtained, and immunotolerant dendritic cells were obtained by treatment of metformin and vitamin D on day 10.

7. Induced bone marrow mesenchymal stem cells insulin secreting cells

To separate bone marrow derived mesenchyma stem cells (BD-MSCs) from bone marrow, bone marrow cells obtained from bone marrow of female non-diabetic C57BL / 6 mice were treated with 8 ~ 10 media in alpha-MEM (15% fbs) media. Incubate for 12 days. Media change every 3 days and then MSC was isolated by 15 days of 5% FBS high DMEM. In the next step, BD-MSC was incubated for 7 days in Low DMEM medium containing 5% FBS, 20 μmol / L nicotinamide, and in the last step for another 7 days in Low DMEM medium with 10 μmol / L Exclusive-4. Insulin secreting β cells (IPCs) were induced. TSPAN2-KO IPCs (TK-IPCs) cell line was generated by permanent removal of the TSPAN2 gene using gene shears (Crispr / Cas9) in the cells. 3 × 10 ⁶ TK-IPCs were implanted into the pancreas.

8. How to administer dendritic cell vaccine to mouse model

Experiments were performed using 13-week-old female non-diabetic C57Bl / 6J mice and diabetic mice. Diabetic mice were measured once per week urine glucose, three consecutive positive values were defined as diabetes, it was confirmed that the blood glucose level is> 250mg / dl. Diabetic mice were divided into two groups, one group containing 13 mg of insulin, and blood glucose levels for 40 days after subcutaneous transplantation of insulin pellets continuously released at 0.1 units / implant (LinShin Canada, Inc.) Was maintained at <250 mg / dl. The insulin pellets were then removed. Next, 1.5 × 10 ⁶ / ml of exosome pulsed dendritic cells (DC-Vac) extracted from a solution of TSPAN2 knockout β-cell ellipsoid prepared in the above-described method in each of the non-diabetic and diabetic mice were obtained. At concentrations, subcutaneous injections were made on days 0 and 14. Then 50 ng of exendin-4 (Bachem) was injected intraperitoneally (ip) on days 0, 1, 2, 7, 8 and 9. Subsequent development of diabetes was observed by measuring blood glucose levels 2-3 times per week. This was followed and monitored for a minimum of 2-4 months. Obesity and type 2 diabetes models were also tested as above, and dendritic cell vaccine (DC-Vac) was injected subcutaneously on days 0 and 14 at a concentration of 1.5 × 10 ⁶ cells / ml.

9. Metabolic Measurements in Obese Mouse Models

Male mice with different genotypes (C57BL / 6) (5 weeks old, Samta Cobio Korea Co., Ltd.) Male mice with different genotypes were placed in a barrier-free facility and followed for 12 weeks. The normal diet (ND) and the high fat diet (HFD) were divided into six groups per group. For free (ND) feed, Envigo, Alconbury Huntingdon, UK, 2018S feed, and high-fat feed (HFD) feed contain 60% fat, Research Diets (New Brunswick, NJ, USA D12492 feed. Polyclonal rabbit anti-mouse ACRP30 / adiponectin antibodies were purchased from invitrogen for the measurement of serum adiponectin using the ELISA method.

10. Western Blot

After lysing the RNAKT-15 cell culture prepared above, it was mixed with loading buffer and separated by SDS-PAGE. The protein was then transferred to a nitrocellulose membrane. Nonspecific binding sites on the membrane were blocked using 5% skim milk for 90 minutes at room temperature. Anti-insulin-receptor-b (purchases Santa Cruz), anti-phosphotyrosine (purchase Santa Cruz), anti-IRS-1 (purchase Upstate Biotechnology and anti-IRS-1-pSer307 (Upstate), the primary antibodies at 4 ° C Incubated with Biotechnology), and then treated with secondary antibody for 1 hour at room temperature Protein bands in the membrane bands were visualized using Santa Cruz Biotechnology Inc.'s ECL Plus Blotting Detection System.

Example 1 Effect of Dendritic Cell Vaccine on Type 1 Diabetes

1-1. Effect of 3D Ellipsoid Culture on Insulin Secretion Capacity of RNAKT-15 Cells

TGF2 knockout (TSPAN2-KO) RNAKT-15 cell line was allowed to increase insulin secretion ability through three-dimensional ellipsoidal culture according to the method described above. Then, as a control, other conditions except three-dimensional culture were compared by measuring the insulin secretion in each of the same cell line.

As a result, as shown in Figure 1, it was confirmed that the amount of insulin secretion increased more than two times in the case of 3D ellipsoid culture compared to the control (2D planar culture).

1-2. Characterization of Dendritic Cells for Immunity

Expression and secretion of MHC II, IDO or major cytokines were confirmed by flow cytometry or Western blot, respectively, in order to analyze the expression and molecular characterization of immunotolerant dendritic cells prepared according to the method of the present invention.

As a result, as shown in Figures 2a to 2c, dendritic cells are induced into immune tolerant dendritic cells (tDCs) after maturation, showing low levels of MHC II expression (Figure 2a), where tDCs are 3-dioxygenase (IDO) immunity. By expressing the inhibitory molecules, dendritic cells were induced into the immune tolerant dendritic cells after maturation, indicating that there is an immunosuppressive effect (FIG. In addition, immune tolerant dendritic cells (tDCs) secrete low levels of IL-10, IL-12 and TNF-α, whereas mature dendritic cells (mDCs) have high levels of IL-10, IL-12 and TNF-α. It was confirmed that secretion of immune tolerant dendritic cells (tDC) through the regulation of IL-10, IL-12 and TNF-α plays a very important role in immune defense and host defense (Fig. 2c)

1-3. Comparison of Insulin Production Capacity for High Glucose Stimulation

In the present invention, when bone marrow-derived mesenchymal stem cells are treated as a control group, high concentrations of glucose are administered to IPCs (TK-IPCS) knocked-out insulin secreting cells (IPCs) and tetraspanin-2 gene, respectively. Insulin secretion level was confirmed

As a result, as shown in Figure 3, when stimulated with a high concentration of glucose (10mM) concentrations of IPCs and TK + IPCs compared with the increase in insulin production, insulin secretion is almost measured in the mesenchymal stem cells (MSC) negative control group It wasn't. These results indicate that insulin secretion was increased by differentiation of IPCs from MSCs, and in particular, TK + IPCs were confirmed to maintain high insulin secretion ability even at high blood glucose levels.

Example 2: Effect of Dendritic Cell Vaccine on Type 1 Diabetes

2-1. Effect on Type 1 Diabetes Incidence in Mice

Diabetes Mellitus of Female Mice Treated with Dendritic Cell Vaccine (DC-Vac) Prepared According to the Method of the Present Invention in Diabetic Non-obese (NOD) Mice That Are Type 1 Diabetes Models Percentage diabetic was measured weekly.

The onset of diabetes was evaluated based on blood glucose above 250 mg / dl.

As a result, as shown in FIG. 4, in the control group (No injection), the incidence rate of diabetes among the whole group gradually increased, starting from 16 weeks of age, while the dendritic cell vaccine (DC-Vac) 1.5 × 10 ⁶ cells were 13 weeks of age. Diabetes did not develop in the group administered to female non-diabetic mice at day 0 and day 14.

These results show that administration of a small amount of DC-Vac before the onset of diabetes can suppress the development of diabetes.

2-2. Effect on blood glucose

In order to confirm these results, the effect on the blood glucose level was confirmed in the mice administered or not administered the dendritic cell vaccine (DC-Vac) as described above.

When 13-week-old diabetic female NOD mice (four for each group) received only 1.5 × 10 ⁶ dendritic cell vaccine (DC-Vac) at days 0 and 14, 1 and 14 (FIG. 5A), DC-Vac Experiments were performed by dividing with + exendin-4 (FIG. 5B) and with DC-Vac + TSPAN2 knockout IPS (TK-IPCs) (FIG. 5C). For TK-IPCs TK-IPCs of 3x10 ⁶ cells were transplanted into the pancreas. Insulin pump (micro-osmotic pump, 0.2 U / day) was inserted in the subcutaneous of the mouse, the insulin pump was removed on day 21. Thereafter, blood glucose levels were measured from venous blood every day.

As a result, as shown in FIGS. 5A to 5C, 3/4 of normal blood glucose levels were maintained even when DC-Vac alone was administered, and normal blood sugar levels were maintained in case of DC-Vac + exendin. In the case of -Vac + TK-IPCs, blood glucose remained close to normal mice. These results indicate that the dendritic cell vaccine of the present invention can exert even better effects when used in combination with other diabetes therapeutics.

Example  3: Effect of Dendritic Cell Vaccine on Obesity

3-1. Effect on adipose tissue

13-week-old male mice induced with high-fat obesity were administered DC-Vac + TK-IPCs when only 1.5x10 ⁶ / mL dendritic cell vaccine (DC-Vac) was administered. No infusion was done in the control group. After 8 weeks, the mice were sacrificed and the adipose tissue was extracted. The extracted tissue was examined under a microscope to determine the degree of lipid deposition in liver tissue due to obesity (H & E staining (X400 magnification)).

As a result, as shown in Figure 6, the group containing the dendritic cell vaccine compared to the control group (No injection) was found to have a lower fat content of the cell, even more when the DC-Vac + TK-IPCs administration It was confirmed that the fat content was small and close to normal.

3-2. Body fat and Adiponectin  Effect on content

When only DC-Vac was administered to 13-week-old male mice (n = 8), the body fat mass, blood adiponectin, blood glucose, and plasma insulin concentrations of the mice were measured 4 weeks after the administration of DC-Vac + TK-IPCs.

Bruker minispec Body Composition Analyzer was performed to determine the body fat of each mouse. As a result, as shown in FIG. 7A, body fat was decreased in the DC-Vac-administered group and further decreased in the DC-Vac + TK-IPCs-administered group compared to the non-administered control group (No injection).

In addition, blood was collected from the mice, and serum was separated by centrifugation, and the content of adiponectin in the serum was measured by ELISA. Adiponectin shows protective activity in various processes such as energy metabolism, inflammation and cell proliferation, therefore, adiponectin plays an important role for the prevention and / or treatment of obesity and obesity related diseases. As a result, as shown in Figure 7b compared with the control group was increased in the DC-Vac administration group, DC-Vac + TK-IPCs administration group was found to be higher blood adiponectin content.

In addition, blood glucose levels (FIG. 7c) and plasma insulin levels (FIG. 7d) were measured using a kit for measuring blood glucose and insulin concentrations, respectively, and blood glucose levels and insulin concentrations were decreased in the DC-Vac-administered group compared to the control group. In the DC-Vac + TK-IPCs administration group, the blood content was found to be lower.

Through this, it was confirmed that the dendritic cell vaccine DC-Vac of the present invention and its concomitant administration (DC-Vac + TK-IPCs) had an excellent obesity improving effect.

Example 4 Effect of Cell Vaccine on Type 2 Diabetes

4-1. Effect on insulin sensitivity and glucose tolerance

Five-week-old mice were reared in groups of 8 per group in the normal diet (ND) and high fat diet (HFD) groups. On day 0 of breeding, 1.5 × 10 ⁶ DC-Vac vaccine was administered and IPCs were transplanted on day 1, and insulin sensitivity (FIG. 8A) and glucose tolerance (FIG. 8B) of diet-induced obese mice were measured.

For this purpose, oral glucose tolerance test and insulin resistance test were performed in the high-fat diet group (HFD) (60 kcal% fat) and the normal chow diet group (18 kcal% fat). Glucose (2 g kg ^{-1 in} body weight) was administered orally. Insulin (0.5 U kg ^{- 1} body weight) was administered by intraperitoneal (IP) injection. Glucose levels were monitored at 30, 60, 90 and 120 minutes before the test by the tail bleed method.

As a result, as shown in FIG. 8A, blood glucose levels were measured after insulin administration. As a result, blood glucose was rapidly removed from blood in the dendritic cell vaccine-administered group (Ob / Ob Dc-Vac) compared to the obese mouse control (Obese-no injection). In addition, in the group administered with DC-Vac and TK-IPCs, the blood glucose level was changed to normal mouse level (Lean-no injection).

In addition, as shown in Figure 8b, after measuring the change in blood glucose with time after administration of glucose, in the obese mouse control group, the blood glucose level did not decrease until 90 minutes, whereas after 90 minutes, the dendritic cell vaccine administration group (Ob / In the case of Ob Dc-Vac), the increased blood glucose level gradually decreased after 30 minutes, and in the group administered with DC-Vac and TK-IPCs, similar to the normal mouse level (Lean-no injection) It was confirmed that blood sugar is controlled.

4-2. Effect on body weight, blood sugar and plasma insulin concentration

In order to determine the effect of the dendritic cell vaccine and the TK-IPCs in combination with the present invention on body weight, blood glucose and plasma insulin concentration, according to the respective administration method for obesity-induced mice through a high-fat diet Administered. The foods were fasted for 6 hours after and 6 weeks after dosing. The mice were then weighed and blood glucose and plasma insulin concentrations were measured respectively.

As a result, as shown in Figs. 9a to 9c, body weight (Fig. 9a), blood sugar (Fig. 9b), plasma insulin (Fig. 9c) compared to the DC-Vac administration group, compared to the control group, DC-Vac + TK-IPCs administration group It was found to be even lower.

Example 5: Effect of Dendritic Cell Vaccines on Insulin Signaling

5-1. Impact on IRS-1 Phosphorylation

To determine the effect of the dendritic cell vaccine of the present invention on insulin signal transmission in vivo, it was performed as follows. Obese mice were given a dendritic cell vaccine (DC-Vac), and the mice were sacrificed to remove liver tissue. Hepatocytes were then extracted from liver tissue by conventional methods in the art. Then, 10 ng / ml TNF-α was treated for 1 hour, and then cells were obtained to extract the protein. Then, the phosphorylation of IRS-1 (insulin receptor substrate-1) in Ser307 was analyzed to determine insulin resistance by Western blot method according to the experimental method.

As a result, as shown in Figure 10a, the TRSF-α treatment increased the phosphorylation of IRS-1 (IRS-1 ^pSer307 ) in Ser307 compared to the control group, but the phosphorylation of IRS-1 in ^Ser307 Was decreased when treated with TNF-α and dendritic cell vaccine (TNF-α + DC-Vac) and further decreased with TNF-α + DC-Vac + TK-IPCs. This shows that treatment of DC-Vac and TK-IPCs reduces insulin resistance.

5-2. Impact on IRS-1 Phosphorylation

In addition, according to the experimental method, type 2 diabetic obese mice were treated with DC-Vac, DC-Vac + TK-IPCs, and then 25mIU / kg insulin (Eli Lilly) was administered with an insulin pump. After 4 weeks, mice were sacrificed to remove liver tissue. The protein was then extracted from liver tissue by conventional methods in the art. Then, the insulin signal was analyzed by tyrosine phosphorylation (IRS-1 ^{pTyr )} of IRS-1, which means a decrease in insulin resistance by Western blot method according to the experimental method.

As a result, as shown in Figure 10b, the administration of insulin increased the tyrosine phosphorylation (IRS-1 ^pTyr ) of IRS-1 compared to the case without administration, DC-Vac and TK-IPCs treatment compared to the control group Increasing insulin signaling has been shown to reduce insulin resistance.

As described above, the present invention provides a method for producing immune-tolerant dendritic cells suitable for the prevention or treatment of diabetes and obesity, and when the inoculation of the immune-tolerant dendritic cells of the present invention to obtain a preventive or therapeutic effect on diabetes and obesity Can be. In addition, when used in combination with bone marrow-derived insulin secreting cells, insulin sensitivity is further increased by reducing serine phosphorylation of IRS-1 and increasing tyrosine phosphorylation of IRS-1, thereby preventing or treating type 1, type 2 diabetes and obesity. It can be usefully used for.

Claims (20)

1. A method for producing dendritic cells for immune tolerance characterized in that immature dendritic cells are cultured in a medium containing GM-CSF to which pancreatic β-cell exosomes are added and differentiated into mature immune tolerant dendritic cells.

   The immature dendritic cells are obtained through stem cell culture in a medium containing IL-4 and GM-CSF,

   The pancreatic β cell exosomes,

   a) centrifuging pancreatic β cells from which the TSPAN2 (tetraspanin-2) gene has been removed and culturing three-dimensional spheroids;

   b) separating the exosomes from the culture or obtaining a culture medium containing the exosomes; to obtain the method.
2. The method of claim 1, wherein the stem cells are bone marrow-derived mesenchymal stem cells (Bone Marrow derived stem cells).
3. The method of claim 1, wherein the pancreatic β cells are cultured in three-dimensional spheroids to increase insulin secretion ability.
4. The method of claim 1, wherein the pancreatic insulin secreting β cells are induced differentiation from mesenchymal stem cells to insulin producing cells (IPCs).
5. The method of claim 1, wherein the immune tolerant dendritic cells increase insulin sensitivity by reducing serine phosphorylation of IRS-1 and increasing tyrosine phosphorylation of IRS-1.
6. The method of claim 1, wherein the three-dimensional spheroid cultured pancreatic β cells are characterized in that insulin secretion ability is improved.
7. The method of claim 1, wherein the culture of step b) comprises immunogenic exosomes.
8. A dendritic cell for immune tolerance prepared by the method of any one of claims 1 to 7.
9. Dendritic cell vaccine comprising a dendritic cell for immune tolerance of claim 8 as an active ingredient.
10. 10. The dendritic cell vaccine of claim 9, wherein the dendritic cell vaccine is substantially free of undifferentiated immature dendritic cells.
11. A composition for preventing or treating diabetes, comprising the dendritic cell for immune tolerance of claim 8 as an active ingredient.
12. 12. The composition of claim 11, wherein the diabetes is type 1 diabetes or type 2 diabetes.
13. Claim 8 composition for preventing or treating obesity comprising the dendritic cells for immune tolerance as an active ingredient.
14. The composition of claim 11 or 13, wherein the composition further comprises insulin secreting cells having the following properties:

    a) be insulin producing cells (IPCs);

    b) The tetraspanin-2 gene is knocked out.
15. The composition of claim 14, wherein the insulin secreting cells are induced differentiation from mesenchymal stem cells.
16. The composition of claim 14, wherein the composition increases insulin sensitivity by reducing serine phosphorylation of IRS-1 and increasing tyrosine phosphorylation of IRS-1.
17. Use of the immune tolerant dendritic cells of claim 8 for the preparation of a prophylactic or therapeutic agent for diabetes.
18. A method for treating diabetes comprising administering to a subject in need thereof an effective amount of a composition comprising the immune tolerant dendritic cells of claim 8 as an active ingredient.
19. Use of the immune tolerant dendritic cell of claim 8 for the preparation of an agent for the prevention or treatment of obesity.
20. A method of treating obesity, comprising administering to a subject in need thereof an effective amount of a composition comprising the immune tolerant dendritic cells of claim 8 as an active ingredient.

Images