WO2019180664A1 - Method for preventing or modulating fibrosis and fibrotic response associated with the integrated stress response - Google Patents

Method for preventing or modulating fibrosis and fibrotic response associated with the integrated stress response Download PDF

Info

Publication number
WO2019180664A1
WO2019180664A1 PCT/IB2019/052321 IB2019052321W WO2019180664A1 WO 2019180664 A1 WO2019180664 A1 WO 2019180664A1 IB 2019052321 W IB2019052321 W IB 2019052321W WO 2019180664 A1 WO2019180664 A1 WO 2019180664A1
Authority
WO
WIPO (PCT)
Prior art keywords
sox9
substituted
unsubstituted
eif2oc
atf4
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2019/052321
Other languages
French (fr)
Inventor
Song Eng Kathryn CHEAH
Danny Chan
Cheng Wang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Hong Kong HKU
Original Assignee
University of Hong Kong HKU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Hong Kong HKU filed Critical University of Hong Kong HKU
Publication of WO2019180664A1 publication Critical patent/WO2019180664A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/16Amides, e.g. hydroxamic acids
    • A61K31/165Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics

Definitions

  • This invention relates to a method of preventing, ameliorating and/or treating fibrosis or fibrotic response associated with the integrated stress response arising from cellular stresses involving the phosphorylated eukaryotic initiation factor 2a (p-eIF2a) pathway.
  • the present invention provides a method which prevents or alleviates aberrant cell differentiation associated with the p-eIF2a pathway in various organs and tissues, where the aberrant cell differentiation causes a fibrosis or fibrotic response.
  • ISR Integrated Stress Response
  • ER intrinsic endoplasmic reticulum
  • ISR is primarily a pro-survival homeostatic program aiming to optimize the cellular adaptive response to stress, exposure to severe stress, either in intensity or in duration, will overwhelm the capacity of this adaptive response and drive signaling toward cell death.
  • the general translation initiation factor eIF2 is a major controller of protein synthesis at the level of translation.
  • eIF2 is a trimeric complex of a, b and g subunits that binds to both GTP and the initiator methionyl tRNA (Met-tRNA;) to form a ternary complex (cIF2*GTP*Mct- tRNAi).
  • eIF2B is a complex composed of five different subunits, eIF2B 1 , eIF2B2, eIF2B3, eIF2B4, eIF2B5 (also called the a, b, g, d, and e subunits).
  • eIF2B5 catalyzes the GDP/GTP exchange reaction and with eIF2B3, forms the‘catalytic core’.
  • eIF2B complex normally works to activate eIF2 via phosphorylation of eIF2 serine-51 (Ser-51).
  • Ser-51 phosphorylated on Ser-51
  • eIF2a-P dissociates from the eIF2B regulatory sub-complex and eIF2B is inactive.
  • Phosphorylated eIF2 blocks protein synthesis thus phosphorylation renders eIF2 an inhibitor of its own guanine nucleotide exchange factor (GEF).
  • GEF eIF2B catalyses release of eIF5 and GDP.
  • the core event in ISR is the phosphorylation of the alpha subunit of eIF2 (eIF2a) by one of four members of eIF2a kinase family: general control nonderepressible 2 (GCN2), protein kinase R (PKR), PKR-like endoplasmic reticulum kinase (PERK) and Fleme-regulated eIF2a kinase (F1RI) (2, 6, 9, 12, 84).
  • GCN22 general control nonderepressible 2
  • PLR protein kinase R
  • PERK PKR-like endoplasmic reticulum kinase
  • Fleme-regulated eIF2a kinase (F1RI) Fleme-regulated eIF2a kinase
  • ATF4 is the main effector of the ISR. It forms homodimers and heterodimers that bind to DNA targets to control the expression of genes involved in cellular adaptation, including cell death, cell survival or cell differentiation. It is likely that the duration and level of eIF2a phosphorylation, as well as ATF4 regulation, determine the balance between cell survival and cell death.
  • ECM extracellular matrix
  • integrins extracellular matrix
  • genes encoding collagen I cause osteogenesis imperfecta (OI) (13); and mutations-in fibrillins cause Marfan syndrome.
  • OI osteogenesis imperfecta
  • Many mutations in ECM genes result in misfolded proteins which can trigger the unfolded protein response as a result of the ER stress (22).
  • ER endoplasmic reticulum
  • URR adaptive unfolded protein response
  • Targeting the UPR is therefore a strategy for the treatment of disorders associated with ER stress.
  • type Schmid MCDS
  • CBZ carbamazepine
  • UPR Ultrastained activation of UPR has been implicated in the progression of a variety of diseases, including cancer, diabetes, inflammatory disease and neurodegenerative disorders (16). In the past few years, UPR has become an attractive target for drug discovery.
  • UPR Upon ER stress, UPR activates three independent ER stress sensors: inositol-requiring 1 (IRE1), PKR-like ER kinase (PERK), and membrane-tethered activating transcription factor 6 (ATF6) (17).
  • IRE1 inositol-requiring 1
  • PERK PKR-like ER kinase
  • ATF6 membrane-tethered activating transcription factor 6
  • ISR integrated stress response
  • Activation of the ISR and PERK signaling pathway is implicated in many diseases including cancer, diabetes, obesity, neurodegeneration and skeletal disorders (18, 71, 85).
  • the ISR has a central role in many forms of cellular stress, such as oxidative stress, hypoxia, ER stress, and its induction is associated with diverse common diseases, such as cancer, diabetes, lung disease, obesity, neurodegeneration and skeletal disorders and the associated induced fibrosis (26, 29). Recently, ISR has been implicated in intervertebral disc degeneration (19, 20), which is very common in humans and often causes low back pain (LBP).
  • LBP low back pain
  • SOX9 Sex-Determining Region Y-Box 9
  • Sox9 ATF4 directly transactivated Sex-Determining Region Y-Box 9
  • SOX9 is a potent transcription factor with key roles in cell fate determination in many cell types, not only in chondrocytes, but also in many other cell types, notably stem cells (dermal papilla, gonads, intestinal, neural etc.) (21) and is activated in acquired diseases such as cancer, obesity and fibrosis (22).
  • the present invention demonstrated for the first time a direct linkage between SOX9 and ISR, which may have broad implications for various diseases.
  • the eIF2a phosphorylation can be 1) either stimulated through chemical activators of eIF2a kinases by, for example, histidinol, asparaginase, halofuginone, arginine deiminase, BTdCPU, BEPP monohydrochloride and CCT020312, or prevented by indirubin-3’ -monoxime, SP600125, SyK, GSK260641, GSK2656157, C16, 2-aminopurine and aminopyrazolindane; 2) modulated via inhibiting eIF2a phosphatases, by, for example, guanabenz and Sephinl, to block GADD34, or nelfinavir to decrease CReP expression and disrupt binding of CReP-PPl complex to eIF2a; and most importantly, 3) reversing the consequences of eIF2a phosphorylation using Integrated Stress Response Inhibi
  • This invention relates to methods of preventing, ameliorating and/or treating fibrosis or fibrotic response associated with the integrated stress response involving eukaryotic Initiation Factor 2 (eIF2), phosphorylated eukaryotic initiation factor 2a (p-eIF2a) and PKR-like endoplasmic reticulum kinase (PERK) pathway arising from various cellular stresses, such as oxidative stress, hypoxia, ER stress, chronic or prolonged bio-mechanical stress and others.
  • eIF2 eukaryotic Initiation Factor 2
  • p-eIF2a phosphorylated eukaryotic initiation factor 2a
  • PERK PKR-like endoplasmic reticulum kinase pathway arising from various cellular stresses, such as oxidative stress, hypoxia, ER stress, chronic or prolonged bio-mechanical stress and others.
  • the present invention provides a method which prevents or alleviates aberrant cell differentiation caused by the activation of the integrated stress response and/or associated with the p-eIF2a and PERK pathway in various organs and tissues, and thereby prevents, ameliorates and/or treats fibrosis or fibrotic response.
  • the present invention provides a method of manipulating the inhibitory effects of p-eIF2a using a p-eIF2a modulator or a phosphorylated eukaryotic initiation factor 2b modulator (p-eIF2 -modulator) for the prevention, amelioration and/or treatment of fibrosis or fibrotic responses described herein.
  • FIG. 1 shows a schematic of the PERK signaling pathway in eukaryotes.
  • PERK is one of the kinases that phosphorylates eIF2a.
  • p-eIF2a acts to suppress global protein synthesis by suppressing Cap-dependent translation initiation while activating preferential translation of ISR-specific mRNAs, such as for transcription factor ATF4 and CHOP.
  • ATF4 in turn activates transcription of additional genes involved in cellular adaptation, including cell death, cell survival or cell differentiation.
  • Figures 2A-2Q show that small molecule IS RIB ameliorates skeletal deformities in l3del mice by preventing ATF4 induction under ER stress.
  • Figure 2A is a schematic timeline of the ISRIB (2.5 mg/kg) or vehicle (0.5% DMSO in 0.9% saline) administration in mice. ISRIB was administered by daily intraperitoneal injection starting on E13.5 and ending on p20. The animals were harvested at indicated time points.
  • Figures 2B and 2C demonstrate that treatment with ISRIB did not affect the body weight gain or body length growth in wild type mice.
  • Figures 2E and 2F show the radiographic analyses of WT and l3del mice demonstrating that skeletal deformities of l3del mice were alleviated at p20 by ISRIB treatment.
  • These alleviated skeletal deformities include the length of tibia, femur and spine (spine length here is measured by the length of 7 continuous vertebrae consisting of the last sacral vertebra and six tail vertebrae); pelvic bone deformation (Q1: the angle between ilium and pubis); Coxa Vara ( Q2 : the angle between the proximal head and the shaft of the femur) and Genu Varum ( Q3 : the angle between proximal head and distal head of tibia).
  • Figures 2G and 2H show the rescue of growth plate abnormalities in l3del mice by treatment with ISRIB at plO and p20, respectively, as demonstrated by histology (a-a”) and in vivo expression profiles of SOX9 (b-b” and c-c”), Col2al (d- d”) and Ppr (e-e”).
  • Figures 21 and 2J show the hypertrophic zone (HZ) length measurement and Sox9 + , Col2al + and Ppr + cells quantification in tested animals at indicated time points.
  • Figure 2K suggests that histology of plO growth plates was comparable between ISRIB-treated and vehicle-treated WT mice.
  • Figures 2L and 2M show the alleviation of the HZ expansion in caudal intervertebral disc (IVD) by ISRIB in l3del mice at plO and p20.
  • Figures 2N-2P show the results of in situ hybridization assays for different genes:
  • Figure 2N shows the alleviation of the growth plate deformities in caudal IVD by ISRIB in l3del mice as indicated by reduced number of the Sox9 (a-a”, c-c”) and the Col2al (b-b”, d-d”) expressing cells in the lower HZ at plO and p20.
  • Figure 20 shows that at plO, the transcripts of Atf4 ' (a-a”), Atf3 (b-b”), Chop (c-c”), Eroll (d-d”) and Fgf21 (e-e”) were down-regulated in HZ of ISRIB-treated l3del mice, while Rip (f-f”) was not affected.
  • Figure 2P shows that at plO, the protein level of ATF4 (a-b”), ATF3 (c-d”), CHOP (e-f”) and FGF21 (g-h”) were down-regulated in HZ of ISRIB- treated l3del mice.
  • Figure 2Q shows by TUNEL assays that ISRIB treatment did not induce apoptosis in l3del mice.
  • Figures 3A-3M show degenerative intervertebral disc (IVD) features in a human patient with metaphyseal chondrodysplasia, type Schmid (MCDS) and l3del mice.
  • Figure 3A shows the radiographic analysis that revealed early onset of Intervertebral Disc Degeneration (IDD) in a 20- years-old MCDS patient.
  • IDD Intervertebral Disc Degeneration
  • Figure 3B shows the FAST staining revealing swelling of the nucleus pulposus (middle arrow), endplate expansion (upper and lower dashed arrows) and accumulation of chondrocyte -like cells in the inner annulus fibrosus (iAF) in 13del mice (circled region) at 4 weeks (mouse age of 4 weeks is regarded as equivalent to human age of 14 years).
  • Figure 3C shows the radiographic analysis revealing severe intervertebral disc degeneration in tail region (T5/6, T6/7 and T7/8) in 7-, 9-, 12- and 16-month old 13del mice.
  • Figure 3D shows histological analysis demonstrating that the tail intervertebral discs (IVD) of 6-month old (upper panel) and 16-month old (lower panel) 13del mice exhibited significant characteristics of disc degeneration, including loss of nucleus pulposus/annulus fibrosus (NP/AF) boundary, disc bulging and widening of the AF interlamellar space.
  • the circled region clearly shows the inward bulging of inner AF (iAF) lamellae and significantly decreased volume of vascular canals in subchondral region between spinal growth plate and endplate in 6-month old 13del mice.
  • the 13del disc clearly exhibited (a) the altered NP structure and matrix, (b) the inward bulging of AF lamellae and the consequent fissure (boxed regions).
  • Figure 3E shows that excessive cell death (by TUNEL assay) in NP of the degenerated tail IVD of l6-month l3del mice compared to WT mice.
  • Figure 3F shows that the essential ER stress sensor BIP was ectopically upregulated in the core region of l3del NP at 6-month stage both transcriptionally (Rip, upper panel) and translationally (BIP, lower panel).
  • Figures 3G and 3H show that significant upregulation of p- eIF2oc, the most upstream event in ISR, was only observed in l3del degenerated tail discs (Figure 3G) but not in l3del lumbar discs (Figure 3H), indicating that ISR was only triggered in degenerated discs in spite of the transgene-bearing genetic background.
  • Figure 31 shows that concomitantly, although the transcriptional expression level of Atf4 was not changed, the protein level of ATF4 was significantly upregulated in NP of 6-month old l3del mice, indicating the contributory regulation of ISR.
  • Figure 3J shows that activation of ATF5, the vital transcription factor of mitochondria-dependent oxidative stress response, was observed in the core part of NP of 6-month old l3del mice (circled), indicating the induction of oxidative stress.
  • Figure 3K shows that in WT control mice, the peripheral nucleus pulposus cells (NPCs) highly expressed Sox9 and the level was much lower in cells within core region.
  • NPCs peripheral nucleus pulposus cells
  • the cell fate of NP cells was affected as indicated by the ectopic expression of Sox9 in cells within the NP core region.
  • FIG. 3L shows that OPN, a major component of NP extracellular matrix, was highly expressed in peripheral NPCs at young stage (plO, p20 and 4-month), the expression level is diminished at maturity (6-month) and absent at elderly stage (16-month) in WT mice.
  • OPN is a target of SOX9.
  • Figure 3M shows that similarly to Opn, oc-SMA marked the peripheral NPC at young stage (4-month) but became absent at 6-month in WT mice, while this marker was persistently expressed in l3del peripheral NPCs and was ectopically expressed in core NPCs.
  • Figures 4A-4C show that ISRIB ameliorated the IVD phenotypes of l3del mice.
  • Figure 4A shows that treatment with ISRIB (2.5mg/kg) eased the IVD abnormalities in l3del lumbar spine as demonstrated by the less expanded endplate and the more organized iAF structure.
  • Figure 4B shows that in l3del mice, treatment with ISRIB reduced the number of reprogrammed chondrocytes in the growth plates and endplates. Moreover, the ectopic expression of Opn in NP was greatly reduced.
  • FIG. 4C shows that in l3del lumbar IVD, ATF3 (a downstream target of ATF4) was significantly activated in the hypertrophic chondrocytes (HCs) of the growth plate and endplate (EP) as well as in the NP (arrows). No ATF3 expression was detected in lumbar IVD of l3del mice treated with ISRIB and there appeared to be fewer ATF3-expressing HCs.
  • Figures 5A-5B show morphological and fibrotic changes of punctured murine discs in transgenic mice in which NPCs are specifically labelled with EGFP.
  • annulus fibrosis (AF) puncture was induced at level 6 and level 8 of mouse tail discs.
  • Disc degeneration was observed by FAST staining of murine tail IVDs at different time points after AF puncture.
  • Figure 5B severe fibrotic changes in injured discs were demonstrated by the presence of oc-SMA, FAP-a and FSP-l stained cells, indicating they are myofibroblasts/fibroblast-like.
  • these accumulated myofibroblasts/fibroblast-like cells were EGFP-tagged indicating that these cells are derived from NP cells and fibrotic cell fate change of NP cells was induced by the puncture.
  • Figures 6A-6B show pathogenic changes in the kidney biopsy samples from patients with renal fibrosis (provided by Dr. Susan Yung, Prof. T. M. Chan, Department of Medicine, The University of Hong Kong).
  • Figure 6A lists the baseline clinical condition of the patients.
  • Figure 6B shows that severe fibrosis was observed in renal biopsy samples from patients with IgA nephropathy (Figure 6B-a’), diabetic nephropathy ( Figure 6B-a”) and Fupus Nephritis (Figure 6B-a”’), marked by oc-SMA.
  • oc-SMA was not only highly expressed in renal interstitium in all specimens, but also in the glomerular mesangium in the lupus nephritis specimen. Strikingly, ectopic expression of SOX9 was observed in all specimens ( Figure 6B-b, b’, b” and b’”), with highly tubular expression in IgA nephropathy and diabetic nephropathy patients, and tubulo interstitial as well as interstitial inflammatory cells expression in patients with lupus nephritis.
  • ISR was significantly activated, marked by the upregulation of p-eIF2oc (Figure 6B-d, d’, d” and d’”) and its downstream target ATF4 ( Figure 6B-c, c’, c” and c’”) in tubular interstitium in all specimen, indicating the etiological role of ISR in the genesis of renal fibrosis.
  • Figures 7A-7D demonstrate the putative ATF4 binding regions on Sox9 within the topologically associated domains (TAD), indicating the potential ISR-regulation of Sox9 by enhancers.
  • Figure 7A shows that human SOX9 ( hSOX9 ) and mouse Sox9 ( mSOX9 ) are located within the boundary region between 2 sub-TADs and share a highly conserved TAD pattern.
  • Figure 7B and 7C demonstrate the highly conserved CCCT C-binding factor (CTCF) insulator binding region presenting in human and mouse Sox9 gene locus.
  • CTCF CCCT C-binding factor
  • Figure 8 is a presentation of ATF4 ChIP peaks on regulatory regions (+/-2kb from transcriptional start site, TSS) of vital chondrogenic transcriptional factors (SOX, MEF2, RUNX, GLI and FOXA). The expression trends of these factors in WT and l3del chondrocytes were measured by normalized microarray expression profiles of the different populations of chondrocytes in the growth plate.
  • TSS transcriptional start site
  • chondrocytes isolated by fractionating the growth plate, include proliferating chondrocytes (PC), prehypertrophic chondrocytes (pHC), upper hypertrophic chondrocytes (UHC), middle hypertrophic chondrocytes (MHC) and lower hypertrophic chondrocytes (LHC) (82).
  • PC proliferating chondrocytes
  • pHC prehypertrophic chondrocytes
  • UHC upper hypertrophic chondrocytes
  • MHC middle hypertrophic chondrocytes
  • LHC lower hypertrophic chondrocytes
  • Figure 9A shows luciferase activities of Sox9 promoter reporters with different lengths of the 5’ flanking region of the gene (pSox9-2.7K, pSox9-l.8K and pSox9-0.8K) or ATF4 putative binding sites mutants (pSox9-l.8Ml, pSox9-l.8M2 and pSox9-l.8M3) responding to different dosages of ATF4 measured in ATDC5 cells.
  • Figure 9B shows ChIP-PCR demonstrating the direct binding of ATF4 to a putative motif on the Sox9 promoter in vivo, using the nuclear extracts from E15.5 WT and C10-ATF4 limbs. An ATF4 ChIP-seq peak (dark triangle) around this region has been reported in ER-stressed MEF cells.
  • Figures 10A-10C show the activation of the ISR in the SM/J mouse which is a natural model of early onset IDD.
  • Figure 10B shows that ISR was activated in degenerative SM/J tail IVDs compared to LG/J IVDs as revealed by ectopic expression of Atf4 and Chop.
  • Figure 10C shows ectopic expression of Sox9 and Col2al observed in degenerative SM/J tail IVDs compared to LG/J IVDs.
  • Figure 11A shows the histology of a chordoma sample (panel a is a low power image and panels b-e are high power images).
  • Figure 11B shows the histology of non-degenerated NP tissues..
  • Figure 12 shows different cell populations in human chordoma as revealed by single cell RNA sequencing. Two technologies were used: 10X Genomics and manual picking with Smartseq2. Panel a) shows two chordomas (cervical chordoma and sacrum chordoma) in 10X Genomics; panel b) shows a chordoma in smartseq2; panel c) shows sub-population 2 (S2) marked by Fibrosis markers; panel d) shows sub-population 2 (S2) of the third chordoma also marked by Fibrosis markers; panel e) shows two chordomas in 10X Genomics where the crosses indicate cells that were marked by co-expression of various markers; and panel f) shows a chordoma in smartseq2 where the crosses indicate cells that were marked by co-expression of various markers.
  • Figure 13 shows histological features of degenerated NP tissues. Note: clusters of round cells resembling chondrocytes (left panel) and spindle like cells resembling fibroblasts (right panel).
  • Figure 14 studies the co-expression of SOX9 with ISR effectors in human NP cells from degenerated discs.
  • Panel a) indicates SOX9 is expressed in non-degenerated NP tissue in chondrocyte like cells.
  • Panel b) indicates SOX9 expression is upregulated in the fibroblast-like cells in the degenerated NP tissue. Different from the notochordal-like and chondrocyte-like cells in non-degenerated NP, fibroblast-like cells were specifically identified the degenerated NP, characterized by their distinct cell morphology and higher expression level of SOX9.
  • Panels c) to f) represent tSNEplots of populations identified by single cell RNAsequencing.
  • DS refers to degenerated NP and DS01-05 and DS06 respectively refer to sample number.
  • Crosses Cells which were marked by co-expression of SOX9, CHOP, ATF4/ATF3/ATF6, and GADD34.
  • the present invention provides a method of preventing, ameliorating and/or treating fibrosis or fibrotic response associated with the integrated stress response (ISR) involving the phosphorylated eukaryotic initiation factor 2a (p-eIF2a) pathway arising from various cellular stresses, such as oxidative stress, hypoxia and ER stress, chronic or prolonged bio mechanical stress.
  • ISR integrated stress response
  • p-eIF2a phosphorylated eukaryotic initiation factor 2a pathway arising from various cellular stresses, such as oxidative stress, hypoxia and ER stress, chronic or prolonged bio mechanical stress.
  • the present invention provides a method of using a p-eIF2a-modulator for the prevention, amelioration and/or treatment of fibrosis or fibrotic response described herein.
  • phosphorylated eukaryotic initiation factor 2a pathways or p-eIF2a pathways include signaling pathways where de -phosphorylated eIF2a or phosphorylated eIF2a is involved, and include signaling pathways which are directly or indirectly affected by the de phosphorylation or phosphorylation of eIF2a.
  • ISR integrated stress response
  • the present invention represents the first mechanistic study in a model of human chondrodysplasia associated with ER stress that demonstrates causality and a direct link between the ISR and reprogrammed chondrocyte differentiation.
  • ISR signalling reverses hypertrophic chondrocyte differentiation via ATF4-directed trans activation of the transcription factor gene Sox9.
  • Sox9 a potent transcription factor gene
  • the present invention also discloses the dual action of CFlOP and ATF4 in promoting hypertrophic chondrocyte survival, establishing the critical role of CFlOP in partnership with ATF4 in enabling chondrocyte survival via the transactivation of Fgf21.
  • the present invention highlights the complex consequences of activating ISR, in part because of the distinct roles of ATF4 in controlling cell differentiation and proliferation depending on cell context.
  • the present invention further demonstrates that treatment of mutant l3del mice with a small molecule inhibitor of the ISR pathway, ISRIB (trans-N,N’ -(Cyclohexane- 1 ,4- diyl)bis(2-(4-chlorophenoxy)acetamide), which targets the interaction between eukaryotic initiation factor 2 (eIF2) and eukaryotic initiation factor 2B (eIF2B) and thereby suppresses ATF4 induction, prevents the differentiation defects and ameliorates chondrodysplasia in the l3del mice ( Figures 2A-2Q), and ameliorates the degenerative intervertebral disc (IVD) syndromes of the l3del mice ( Figures 4A-4C).
  • ISRIB trans-N,N’ -(Cyclohexane- 1 ,4- diyl)bis(2-(4-chlorophenoxy)acetamide
  • the present invention identifies a key causative role for the ISR in MCDS and demonstrates that targeting early in the pathway, i.e., at the level of PERK phosphorylation of eIF2a could be an effective therapeutic approach.
  • ISRIB antagonizes the preferential translation of ATF4 and other preferentially translated transcripts mediated by the ISR, thereby reversing or preventing reverted differentiation (i.e., reversing or preventing the transition of cells to a less mature stage).
  • ISR preferential translation of ATF4 and other preferentially translated transcripts mediated by the ISR
  • reversing or preventing reverted differentiation i.e., reversing or preventing the transition of cells to a less mature stage.
  • the net result is the improvement of murine skeletal development. This result may reflect the dominance of de-differentiation in the pathogenesis of the chondrodysplasia.
  • a dose of ISRIB is administered to a subject to achieve an optimal level of cell differentiation and cell survival.
  • the effective amount of ISRIB is 0.05-0.1, 0.1- 1, 1-5, 5-10, 10-20, 20-25, 25-50 or 50-100 mg/kg per day.
  • the subject is treated for 1 day or up to 365 days. In various embodiments, the subject is treated for 5, 10, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325 or 350 days.
  • the present invention provides a method of preventing, ameliorating and/or treating a disorder associated with integrated stress response involving the p-eIF2oc pathway in a subject using a molecule that targets the underlying p-eIF2oc-pathway.
  • molecules to be used in the present invention are modulators which directly or indirectly suppress the translational or transcriptional expression of ATF4 or SOX9.
  • SOX9 is a potent transcription factor with key roles in cell fate determination, not only in chondrocyte differentiation, but also in many other cell types, notably stem cells (e.g. dermal papilla, gonads, intestinal, and neural) and its overexpression or dysfunction results in many diseases including fibrosis and cancer (14).
  • stem cells e.g. dermal papilla, gonads, intestinal, and neural
  • its overexpression or dysfunction results in many diseases including fibrosis and cancer (14).
  • the present invention revealed that given the importance of ATF4 to normal development, simply preventing its expression globally may not work therapeutically. Rather, the present invention introduces for a novel and viable approach to alter cell differentiation or cell fate by targeting the translational control of ATF4 that leads to its over expression.
  • the present invention provides a method of preventing and/or ameliorating aberrant cell differentiation through the inhibition of ectopic expression of Sox9/SOX9 (referring to mouse transcription factor gene Sox9 and human transcription factor gene SOX9, respectively).
  • the present method prevents and/or alleviates conditions, disorders or diseases resulting from an aberrant cell differentiation.
  • aberrant cell differentiation includes any process whereby the cells undergo abnormal cell differentiation including without limitation de-differentiation, trans-differentiation and reverted differentiation.
  • the present method includes the use of a molecule which inhibits the ectopic expression of Sox9/SOX9.
  • the present method includes a use of a molecule which inhibits the ectopic expression of ATF4 which subsequently reduces the ectopic expression of Sox9/SOX9.
  • the molecule is a modulator that is capable of directly or indirectly inhibiting the transcriptional or translational expression of ATF4.
  • the modulator represented by Formula I is ISRIB having the formula
  • the modulator represented by
  • Formula I includes molecules that are described in WO 2014/144952, the entire contents of which are incorporated herein by reference into this application.
  • the modulator represented by Formula I is selected from the following molecules:
  • the modulator subject to the present invention is represented by Formula II: (II), wherein R 1 is bicycloheteroaryl, including but not limited to pyrrolopyrimidine, which may be unsubstituted or substituted with groups such as amino and alkyl; R 2 is heteroaryl, including but not limited to pyridyl, pyrrolyl and pyrazolyl, which may be unsubstituted or substituted with groups such as halogen, alkyl and trihaloalkyl, and R 3 is hydrogen or halogen.
  • the modulator is represented by Formula II which includes molecules described in WO2011/119663, the entire contents of which are incorporated herein by reference into this application.
  • the modulator represented by Formula II is GSK2656157 having the formula various embodiments, the modulator represented by Formula II is selected from the following molecules:
  • the modulator is Act2B
  • ER stress can increase cell death in injured tissues, induce epithelial-mesenchymal transition (EMT) and promote fibrotic remodeling instead of the restoration of normal tissue architecture (23).
  • EMT epithelial-mesenchymal transition
  • fibrotic remodeling instead of the restoration of normal tissue architecture (23).
  • Activation of ER stress and oxidative stress is a common pathological feature of fibrosis in a variety of organs, including lung (24), liver (25) and heart (26).
  • Fibrosis is an excessive accumulation of extracellular matrix (ECM) that can lead to distortion of tissue architecture and loss of organ function (27, 28). This pathology commonly results from a wound healing response to repeated or chronic injury or tissue damage, irrespective of the underlying etiology, and can occur in virtually any solid organ or tissue.
  • ECM extracellular matrix
  • a broad range of prevalent chronic diseases can give rise to fibrosis, including intervertebral disc degeneration (IDD) (62), osteoarthritis (63), diabetes, hypertension, viral and nonviral hepatitis, heart failure and cardiomyopathy, idiopathic pulmonary disease, scleroderma, and cancer.
  • Fibrosis resulting from these and other diseases can lead to failure of liver, lung, kidney, heart, or other vital organs as excessive ECM replaces and disrupts parenchymal tissue.
  • Ectopic expression of transcription factor Sex-Determining Region Y-Box 9 Sox9
  • Sox9 transcription factor Sex-Determining Region Y-Box 9
  • Fibrosis may be induced in other tissues such as liver, lung, cardiac, skin and so on (64).
  • the present invention provides a method of preventing, ameliorating and/or treating fibrosis or fibrotic response associated with the integrated stress response (ISR) involving the phosphorylated eukaryotic initiation factor 2a (p-eIF2a) pathway arising from various cellular stresses such as oxidative stress, hypoxia and ER stress, chronic or prolonged bio mechanical stress.
  • ISR integrated stress response
  • p-eIF2a phosphorylated eukaryotic initiation factor 2a pathway arising from various cellular stresses such as oxidative stress, hypoxia and ER stress, chronic or prolonged bio mechanical stress.
  • the present invention demonstrates for the first time a direct linkage between Sox9/SOX9 (mouse/human), ATF4 and ISR.
  • the present invention provides a novel approach for treating, preventing and/or ameliorating fibrosis or fibrotic response through the modulation of ectopic expression of ATF4 and its potential downstream mediators, such as Sox9/SOX9 and CFIOP.
  • the present invention provides a method for treating, preventing and/or ameliorating fibrosis or fibrotic response through the modulation of activity of ATF4 and its potential downstream mediators, such as Sox9/SOX9 and CFIOP.
  • the present method reduces the expression of Sox9 and/or CFlOP in an organ or tissue, thereby preventing or reducing the occurrence of fibrotic response in the organ or tissue.
  • presence or progress of fibrosis is indicated by an elevated level of one or more fibrotic factors as compared to normal subjects or cells (81).
  • the present invention provides a method of modulating the level of one or more fibrotic factors, which are indicative of the presence or progress of fibrosis, comprising a step of using a p-eIF2a- modulator described herein.
  • fibrotic factors include but are not limited to fibrillar proteins, glycoproteins, small leucine rich proteoglycans (SLRPs) and matricellular proteins.
  • fibrillar proteins include but are not limited to fibrillar collagen (e.g. type I-III, V, XI), fibronectin (e.g. ED-A, ED-B), and elastin.
  • glycoproteins include but are not limited to non-fibrillar collagen (e.g. type IV, VI- VIII, XIV), fibrillin (e.g. fibrillin 1-3), LTBP (e.g. LTBP 1-4), tenascin (e.g.
  • small leucine rich proteoglycans include but are not limited to biglycan, lumican, fibromodulin, dermatopontin and decorin.
  • matricellular proteins include but are not limited to CCN (CCN1-6), periostin, osteopontin and osteonectin (e.g. SPARC).
  • fibrotic factor is alpha smooth muscle actin (a-SMA), fibroblast activation protein alpha (FAP-a) and fibroblast specific protein 1 (FSP-l) or transforming growth factor b (TGF- b).
  • fibrotic factors include factors which involve the posttranslational modifications of the ECM, including but are not limited to lysyl oxidase (LOX), LOX-like 1-4 (LOXL-l-4), LH 1-3, transglutaminase 1-7 (e.g. TG 1-7), matrix metalloprotease, (e.g. MMP 1-3, 7- 17, 19-21, 23-28), tissue inhibitor of matrix metalloproteinase (e.g. TIMP 1-4) and plasmin- activation inhibitor (e.g. uPA, tPA, PAI-l, PAI-2). Rosenbloom et al. (2017) (64) and Dickens et al.
  • LOX lysyl oxidase
  • L-l-4 LH 1-3
  • transglutaminase 1-7 e.g. TG 1-7
  • matrix metalloprotease e.g. MMP 1-3, 7- 17, 19-21, 23-28
  • fibrotic responses include but are not limited to responses that initiate or advance fibrosis in organ or tissues described herein. In one embodiment, fibrotic responses are triggered by other complications, diseases or disorders such as obesity and cancer.
  • fibrosis to be treated, prevented and/or ameliorated by the present invention is a fibrosis occurs in an organ or a tissue.
  • fibrosis is a fibrosis that occurs in lung, liver, heart, brain, kidney, bone, skin, pancreas, intervertebral disc, cartilage and connective tissues.
  • fibrosis occurs as a result of trauma, e.g. in wound healing after burns.
  • fibrosis occurs as a result of other complications, diseases or disorders.
  • fibrosis is any fibrosis caused by, directly or indirectly, or associated with the activation of ISR involving the p-eIF2oc pathway.
  • the present method can be used to reverse fibrosis by, for example, reversing an established fibrosis, reducing the extent of excessive ECM or tissue deposited in a particular tissue, or reducing the extent of fibrotic process occurred and so on.
  • the present invention provides a method of preventing or ameliorating aberrant cell differentiation which results in an aberrant synthesis or accumulation of ECM, where the aberrant cell differentiation is caused by the activation of the ISR.
  • the present method prevents or ameliorates cell differentiation into a type of cell such as fibroblasts and myofibroblasts that synthesizes ECM.
  • the present method prevents or ameliorates an aberrant cell differentiation into a myofibroblastic lineage.
  • the present invention provides a method of using a p-eIF2oc-modulator described herein for the prevention, treatment and/or amelioration of fibrosis caused by an aberrant cell differentiation.
  • the present invention provides a method of using a p-eIF2oc-modulator described herein for the prevention, treatment and/or amelioration of aberrant accumulation of ECM caused by an aberrant cell differentiation. In one embodiment, the present invention provides a method of using a p-eIF2oc-modulator described herein for the prevention, treatment and/or amelioration of aberrant synthesis or accumulation of ECM that is caused by an aberrant cell differentiation and/or activation of transcription factor gene Sox9/SOX9.
  • the present invention provides a method of using a p-eIF2oc-modulator described herein for the prevention and/or amelioration aberrant synthesis or accumulation of ECM in a tissue or organ, where the aberrant accumulation of ECM is caused by the activation of the ISR.
  • the present invention provides a fibrotic mouse model and a method for screening candidate molecule for the ability to modulate fibrosis associated with integrated stress response (ISR) involving the p-eIF2oc pathway, the method comprising the steps of a) administering a candidate molecule to the mouse, and b) measuring one or more of fibrotic factors described herein, where changes in one or more fibrotic factors in the presence of the candidate molecule as compared to a control molecule indicates that the candidate molecule is capable of modulating fibrosis associated with ISR involving the p-eIF2oc pathway.
  • ISR integrated stress response
  • the fibrotic mouse model carries a Sox9 gene which can be conditionally knocked out (i.e., can be removed or inactivated in specific tissue(s) rather than universally removed or inactivated in the whole organism), thereby allowing to determine whether the effect of the candidate molecule on fibrosis is through its action on Sox9 in specific tissue(s).
  • the fibrotic mouse model can be obtained by crossing Sox9- flox mice with mice carrying Cre recombinase expressed from a tissue-specific promoter, which results in progeny with Sox9 knock out in a particular tissue.
  • the fibrotic mouse model is a Ddit3- null ( Ddit3 encodes protein CHOP).
  • the fibrotic mouse model carries a Ddit3 gene which can be conditionally knocked out in a similar manner as for 5ox9-conditional knockout.
  • the present invention provides a method of preventing, ameliorating and/or treating fibrosis or fibrotic response associated with integrated stress response involving the eukaryotic Initiation Factor 2 (eIF2), phosphorylated eukaryotic initiation factor 2a (p-eIF2a) and PKR-like endoplasmic reticulum kinase (PERK) pathway in a subject, comprising the step of administering to said subject an effective amount of a molecule which targets the p-eIF2a pathway (a“p-eIF2a modulator”).
  • eIF2 eukaryotic Initiation Factor 2
  • p-eIF2a phosphorylated eukaryotic initiation factor 2a
  • PERK PKR-like endoplasmic reticulum kinase
  • the present invention provides a use of a p- eIF2a modulator for the preparation of a medicament for preventing, ameliorating and/or treating fibrosis or fibrotic response associated with integrated stress response involving the p-eIF2a pathway.
  • the present invention provides molecules that are capable of modulating the p-eIF2a pathway for use in the treatment of diseases or modulation of conditions described herein.
  • the present invention provides a method of manipulating the inhibitory effects of p-eIF2a using a p-eIF2a modulator or a phosphorylated eukaryotic initiation factor 2 b- modulator (p-eIF2 -modulator) for the prevention, amelioration and/or treatment of fibrosis or fibrotic responses described herein.
  • the subject is a human including an adult and a child, or an animal.
  • “effective amount” means the amount of a molecule necessary to achieve a desired physiological effect.
  • the present invention provides a method of modulating the p-eIF2a pathway in a cell or a population of cells, the method comprising contacting the cell(s) with an effective amount of a p-eIF2a or a r-eIH2b modulator.
  • p-eIF2a modulators are small molecules, nucleic acids, proteins or other biomolecules.
  • p-eIF2a modulators are small molecules which are represented by Formula I or II described above.
  • p-eIF2a modulators are p- eIF2a inhibitors such as ISRIB, GSK2656157, Act2B and their analogs that inhibit one or more downstream molecules or signaling events in the p-eIF2a pathway.
  • p- eIF2a modulators are molecules such as Sulubrinal and Guanzbenz and their analogs that activate one or more downstream molecules or signaling events in the p-eIF2a pathway.
  • p-eIF2a modulators are molecules that alter one or more downstream molecules or signaling events in the p-eIF2a pathway (for example, those illustrated in Figure 1), and the p- eIF2a pathway can be part of the cellular stress responses such as oxidative stress, ER stress and hypoxia, or other chronic or prolonged biomechanical stress.
  • said p-eIF2oc modulators such as ISRIB and Act2B and their analogs are capable of targeting eIF2oc phosphorylation.
  • p-eIF2oc modulators are molecules which are capable of targeting GADD34-Pplc or promoting the assembly of GADD34- Pplc.
  • p-eIF2oc modulators are molecules which are capable of modulating the expression of ATF4 and its potential downstream factors, such as Sox9.
  • the effective amount of p-eIF2oc modulator such as ISRIB to be given to a subject is 2.5 mg/kg to 20 mg/kg per day.
  • the effective amount of p-eIF2oc modulator is 0.05-0.1, 0.1-1, 1-5, 5-10, 10-20, 20-25, 25-50 or 50-100 mg/kg per day.
  • the subject is treated for 1 day or up to 365 days. In various embodiments, the subject is treated for 5, 10, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325 or 350 days.
  • two or more p-eIF2oc pathway modulators are administered concurrently.
  • the second or subsequent p-eIF2oc pathway modulators are administered immediately or a certain period after the administration of the previous p-eIF2oc pathway modulator.
  • the present invention provides a method of inhibiting the ATF4/ISR mediated activation of transcription of murine .SY «9/human SOX9, thereby preventing, alleviating and/or treating fibrosis or fibrotic response in an organ or a tissue resulting from the overexpression of protein SOX9; the method comprises a step of contacting the cells with, or administering to a subject, a molecule that is capable of blocking the ATF4-binding site on the Sox9/SOX9 locus, or by interfering with molecules that modulate the ATF4-mediated transcription of Sox9//SOX9 (such as a molecule that enhances the binding between ATF4 and Sox9/SOX9 locus, i.e., an ATF4-binding enhancer).
  • a molecule that is capable of blocking the ATF4-binding site on the Sox9/SOX9 locus or by interfering with molecules that modulate the ATF4-mediated transcription of Sox9//SOX9 (such
  • Mouse Sox9 was found to be located at the boundary between two sub-TADs (topologically associated domains) on chromosome 11 (chrll :l l0760000-H4800000), represented by chr 11:111520000- 112200000 and chrll : ll3l60000-H4l60000 respectively (68, 63) (Fig 8A, lower panel). Binding sites for ATF4 in mouse embryonic fibroblasts have been reported (44).
  • the present invention has identified the putative binding site for ATF4 on the Sox9 locus in hypertrophic chondrocytes of mice - a region on chromosome 11 (loci: 112642927-112643074) which covers the promotor region of Sox9 ( Figure 8). It is thus possible to inhibit the transcription of Sox9 by using molecules that interfere with the entirety or a part of the putative ATF4-binding site and thereby modulate conditions resulting from the overexpression of SOX9.
  • the present invention provides a method of inhibiting the transcription of mouse Sox9 by using a molecule that blocks or interferes with one or more binding sites for ATF4 on the mouse Sox9 locus, thereby preventing, ameliorating and/or treating fibrosis or fibrotic response in an organ or a tissue.
  • said ATF4 binding site is located on mouse chromosome 11 (loci: 112642927-112643074) having the sequence TGTTGCAA (SEQ ID NO: 1).
  • said ATF4 binding site is located within the binding sites for ATF4 as reported in Flan:
  • the present invention further provides a method of inhibiting the transcription of human SOX9 by using a molecule that blocks or interferes with one or more binding sites for ATF4 on the human SOX9 locus, thereby preventing, ameliorating and/or treating fibrosis or fibrotic response in an organ or a tissue.
  • said ATF4 binding site is located on human chromosome 17 (chr 17:68609000-71514000).
  • said ATF4 binding site is TGTTGCAA (SEQ ID NO.: 3) (33) which is the consensus sequence of ATF4 binding site on human SOX9 locus.
  • ATF4-binding sites on Sox9/SOX9 or other related ATF4 potential downstream factors are mapped by the core Amino Acid Response Element (AARE) sequence TTgCaTCA (SEQ ID: 4), which is the complementary strand of SEQ ID NO.l.
  • AARE Amino Acid Response Element
  • open chromatin regions in cells expressing Sox9/SOX9 upon induction of the ISR and/or ATF4 over-expression are identified via ATAC-seq (34).
  • This method applies hyperactive Tn5 transposase, which inserts sequencing adapters into accessible regions of chromatin, to mark accessible regions of DNA, which are then sequenced.
  • GFP or other reporters
  • GFP are inserted into 3’ untranslated region of mouse or human loci and targeted so as to provide a readout of SOX9 activity, or, alternatively, the cells derived from Sox9 EGFP/+ mice are adopted (35). Cells are then subjected to ER stress, hypoxia or other stresses to induce ISR, or over-expression of ATF4 is induced.
  • regions in the mouse genome or human genome that are constitutively open and therefore not subject to position effects are used for assaying the enhancer activity (e.g. the TIGRE locus (36)).
  • Reporter loci are targeted in cell lines and transgenic mice with a vector comprising a minimal promoter (such as hsp68 or the minimal SOX9 promoter which has no activity in cells/transgenic mice) linked by a 2A peptide sequence (37) to a fluorescence reporter (e.g. GFP, RFP, YFP etc.) or other reporters (e.g. luciferase).
  • the enhancer interference assay is used for functional validation of enhancer elements by epigenome inhibition in vitro and in vivo, using a nuclease-deficient Cas9 (dCas9)-histone demethylase (38) fusion to inhibit the activity of candidate enhancer(s) by selectively altering the chromatin state of the target enhancer(s).
  • dCas9-histone demethylase (38) fusion to inhibit the activity of candidate enhancer(s) by selectively altering the chromatin state of the target enhancer(s).
  • Removal of H3K4mel/me2 modifications from specific active enhancer(s) using targeted catalytically inactive dead-Cas9 (dCas9) fused to the lysine-specific demethylase 1 (KDM1A/ESD1) results in‘inactivation’ of enhancer elements and down-regulation of gene expression from the associated loci.
  • the transgene containing dCas9-ESDl is targeted using CRISPR-Cas9 (39), in which a guide RNA (gRNA) is specifically designed to direct ESD1 to the putative Sox9/SOX9 enhancer(s).
  • gRNA guide RNA
  • the expression of ESD1 on targeted specific enhancer(s) silences the candidate enhancer(s) by demethylation of histone H3K4me2 and destruction of K27 acetylation (H3K27ac).
  • the targeted enhancer(s), resulting in loss of .VGA 9-dr ivcn EGFP expression when ISR is activated and/or when ATF4 is over expressed, are first identified in vitro.
  • the activities of identified ISR-inducible and or ATF4-inducible SOX9 enhancer(s) are assessed by: a) mutating the enhancer(s) in mice using CRISPR-Cas9; and b) targeting the enhancer(s) to the ISR reporter vector described above comprising a minimal hsp68 promoter, and testing for the enhancer’s ability to be activated upon ATF4 or ISR induction.
  • Enhancers that are active and specific to Sox9 can then be identified by determining whether the ISR is triggered and/or ATF4 is over-expressed.
  • the present invention provides a method of inhibiting the transcription of Sox9/SOX9 (such as murine Sox9/ Human SOX9 ) by using a molecule that blocks or interferes with one or more ATF4 binding enhancers which regulates the transcription of murine Sox9, said ATF4 binding enhancer comprises a sequence selected from the group consisting of SEQ ID NOs. : 5-29, thereby preventing, ameliorating and/or treating fibrosis or fibrotic response in an organ or a tissue.
  • Sox9/SOX9 such as murine Sox9/ Human SOX9
  • the present invention provides a method of inhibiting the transcription of human SOX9 by using a molecule that blocks or interferes with one or more ATF4 binding enhancers which regulate the transcription of human SOX9, thereby preventing, ameliorating and/or treating fibrosis or fibrotic response in an organ or tissue.
  • ATF4 ChIP-seq can be used in human fibroblasts, cancer cell lines, and any other cell lines where ISR induces SOX9 expression differentiated from human induced pluripotent stem cells such as chondrocytes.
  • the cells are treated with an ER stress-inducer such as tunicamycin (41) to activate the preferential translation of ATF4, and three biological replicates for each cell type are generated.
  • said ATF4 binding enhancers are located within human chromosome 17 (chr 17:68609000-71514000) .
  • the present invention provides a method of inhibiting the transcription of human SOX9 by using a molecule that blocks or interferes with one or more ATF4 binding enhancers which regulate the transcription of human SOX9, thereby preventing, ameliorating and/or treating fibrosis or fibrotic response in an organ or a tissue
  • said ATF4 binding enhancer comprises a sequence that could be similar/homologous to the murine sequence selected from the group consisting of SEQ ID Nos:. 5-29.
  • said ATF4 binding enhancer comprises a sequence corresponding to a sequence which is at least 70%, 75%, 80%, 85%, 90% or 95% homologous to the sequence selected from the group consisting of SEQ ID Nos. 5-29.
  • said ATF4 binding enhancer in human comprises a sequence corresponding to and showing high consensus to the murine sequence selected from the group consisting of SEQ ID Nos. 5-29. It is also possible that there will be human specific ATF4 binding enhancers not present in mouse. These will be detected by the ATAC-seq and ATF4 ChIP-seq approaches described above. Functional validation of the human enhancer activity will be tested by linking putative enhancer(s) to reporter (e.g.
  • Fuciferase/fluorescent proteins constructs and testing for their activation upon inducing the ISR in vitro (mouse or human cell-lines) and in vivo, using transgenic mice in which the ISR is induced, such as in 13del and/or SM/J.
  • ISRIB a selective modulator of phosphorylated-eukaryotic initiation factor (p- eIF2a) and eIF2B complex
  • p- eIF2a phosphorylated-eukaryotic initiation factor
  • eIF2B complex a selective modulator of phosphorylated-eukaryotic initiation factor (p- eIF2a) and eIF2B complex
  • ATF4 can transactivate Chop and ATF3, and form a heterodimer with ATF3 to modulate the expression of target genes, such as GADD34.
  • CHOP also acts upstream of GADD34, which encodes a regulatory subunit of the protein phosphatase complex that dephosphorylates p-eIF2a and restores protein translation.
  • ATF4, CHOP and GADD34 form a negative feedback loop to ensure transient attenuation of protein synthesis and later recovery of protein translation during ER stress response (42, 43).
  • the present invention discloses a novel approach in preventing or treating ISR-associated diseases, in particular to diseases where aberrant cell differentiation and over-synthesis and/or perturbed homeostasis of ECM proteins are the underlying cause.
  • the present invention provides a use of a modulator of a phosphorylated eukaryotic initiation factor 2a (p-eIF2a) for the manufacture of a medicament for the prevention, amelioration and/or treatment of fibrosis caused by the activation of the integrated stress response (ISR) involving the p-eIF2oc pathway in an organ or tissue, wherein the modulator is represented by Formula I:
  • each of Rl, R2, R3 and R4 is independently selected from a group consisting of hydrogen, halogen, -OCH3, -OCH 2 Ph, -C(0)Ph, -CH3, -CF3, -CCI3, -CN, -S(0)CH 3 , -OH, -NH 2 , -COOH, - CONH2, -NO2, -C(0)CH 3 , -CH(CH 3 ) 2 , -CCSi(CH 3 ) 3 , -CCH, -CH 2 CCH, -SH, SO3H, -S0 4 H, -
  • R 1 is pyrrolopyrimidine, which may be unsubstituted or substituted with amino or alkyl;
  • R 2 is pyridyl, pyrrolyl or pyrazolyl, which may be unsubstituted or substituted with halogen, alkyl or trihaloalkyl; and
  • R 3 is hydrogen or halogen.
  • an effective amount of the modulator is capable of one or more of the following: a) inhibiting the phosphorylation of eIF2oc;
  • the organ or tissue is selected from the group consisting of lung, liver, heart, brain, kidney, bone, skin, pancreas, intervertebral disc, cartilage and connective tissues.
  • the fibrosis is caused by an aberrant synthesis or accumulation of extracellular matrix (ECM) protein in the organ or tissue.
  • ECM extracellular matrix
  • the extracellular matrix (ECM) protein is synthesized by fibroblasts, myofibroblasts, or both.
  • the modulator is selected from the following:
  • the modulator is selected from the following:
  • the effective amount of the modulator is 0.1 mg/kg to 50 mg/kg per day.
  • the present invention provides a method of preventing and/or ameliorating aberrant synthesis or accumulation of extracellular matrix (ECM) protein in an organ or tissue of a subject, the method comprises a step of administering to the subject an effective amount of a molecule that is capable of inhibiting the p-eIF2oc pathway.
  • ECM extracellular matrix
  • the molecule is a small molecule represented by Formula I:
  • the molecule is capable of inhibiting the ectopic expression of Chop, Sox9/SOX9 and/or ATF4.
  • the molecule is capable of inhibiting the binding between ATF4 and a transcriptional regulatory element of mouse/human Sox9/SOX9.
  • the transcriptional regulatory element of Sox9/SOX9 comprises the nucleic acid sequence selected from the group consisting of SEQ ID NOs.: 1-3.
  • the transcriptional regulatory element of Sox9/SOX9 is a stress-induced or ATF-induced enhancer that regulates the transcription of Sox9/SOX9
  • the enhancer comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs.: 5-29, or a nucleic acid sequence which is at least 80% homologous to the nucleic acid sequence selected from the group consisting of SEQ ID NOs.: 5-29.
  • the aberrant synthesis or accumulation of extracellular matrix (ECM) protein is caused by an aberrant cell differentiation in a population of cells caused by the activation of integrated stress response (ISR).
  • ISR integrated stress response
  • the population of cells comprises cells that can be differentiated to fibroblasts, myofibroblasts, or both.
  • the present invention provides a method of modulating the level of one or more fibrotic factors in an organ or tissue of a subject, wherein the fibrotic factors are indicative of the presence or progress of fibrosis, the method comprises a step of administering to the subject an effective amount of a p-eIF2oc modulator.
  • the fibrotic factor is selected from the group consisting of fibrillar collagen type I, II, III, V and XI, fibronectin ED-A and ED-B, elastin, non-fibrillar collagen type IV, VI, VII, VIII and XIV, fibrillin 1-3, LTBP 1-4, tenascin C (R, W and X), Hyaluronan form HA, versican V0-V3, syndecan 1-4, fibulin 1-7, biglycan, lumican, fibromodulin, dermatopontin, decorin, CCN1-6, periostin, osteopontin, osteonectin, SPARC, alpha smooth muscle actin, fibroblast activation protein alpha, fibroblast specific protein 1 and transforming growth factor b.
  • the fibrotic factor is selected from the group consisting of lysyl oxidase, LOX-like 1-4, LH 1-3, transglutaminase 1-7, matrix metalloprotease 1-3, 7- 17, 19-21 and 23-28, tissue inhibitor of matrix metalloproteinase 1-4 and plasmin-activation inhibitor uPA, tPA, PAI-l and PAI-2.
  • the present invention provides a method of preventing, ameliorating and/or treating fibrosis caused by the activation of the integrated stress response (ISR) involving the phosphorylated eukaryotic initiation factor 2a (p-eIF2a) signaling pathway in an organ or tissue of a subject, the method comprises a step of administering to the subject an effective amount of a p-eIF2a modulator.
  • ISR integrated stress response
  • p-eIF2a phosphorylated eukaryotic initiation factor 2a
  • an effective amount of the p-eIF2a modulator is capable of one or more of the following:
  • the organ or tissue is selected from the group consisting of lung, liver, heart, brain, kidney, bone, skin, pancreas, intervertebral disc, cartilage and connective tissues.
  • the fibrosis is caused by an aberrant synthesis or accumulation of extracellular matrix (ECM) protein in the organ or tissue.
  • ECM extracellular matrix
  • the extracellular matrix (ECM) protein is synthesized by fibroblasts, myofibroblasts, or both.
  • the p-eIF2oc modulator is represented by Formula I:
  • each of R1 , R2, R3 and R4 is independently selected from a group consisting of hydrogen, halogen, -OCH , -OCH 2 Ph, -C(0)Ph, -CH , -CF , -CC1 3 , -CN, -S(0)CH , -OH, -NH 2 , -COOH, -
  • the effective amount of the p-eIF2oc modulator is 0.1 mg/kg to 50 mg/kg per day.
  • the present invention provides a method of screening a candidate molecule for the ability to modulate fibrosis associated with integrated stress response (ISR) involving the p-eIF2oc pathway, the method comprises the steps of
  • the fibrotic mouse model is a transgenic mouse carrying a Sox9 gene which is conditionally knockout.
  • the fibrotic mouse model is a transgenic mouse carrying a Ddit3 gene which is conditionally knockout, or carrying no Ddit3 gene.
  • the fibrotic factors are selected from the group consisting of fibrillar collagen type I, II, III, V and XI, fibronectin ED- A and ED-B, elastin, non-fibrillar collagen type IV, VI, VII, VIII and XIV, fibrillin 1-3, LTBP 1-4, tenascin C (R, W and X), Hyaluronan form HA, versican V0-V3, syndecan 1-4, fibulin 1-7, biglycan, lumican, fibromodulin, dermatopontin, decorin, CCN1-6, periostin, osteopontin, osteonectin, SPARC, alpha smooth muscle actin, fibroblast activation protein alpha, fibroblast specific protein 1, transforming growth factor b, lysyl oxidase, LOX-like 1-4, LH 1-3, transglutaminase 1-7, matrix metalloprotease 1-3, 7- 17,
  • transitional term“comprising”, which is synonymous with“including”,“containing” or“characterized by”, is inclusive or open-ended, and does not exclude additional, un-recited elements or method steps.
  • the l3del transgenic mice were maintained in Fl (C57BL/6 x CBA) background.
  • the Chop-null mice and Fgf2l-null mice were reported previously (43, 44). Animal care and experiments performed were in accordance with the protocols approved by the Committee on the Use of Live Animals in Teaching and Research of the University of Hong Kong.
  • FAST staining refers to a multidye staining procedure using fast green, Alcian blue, Safranin-O, and tartrazine and was performed as described previously (45).
  • a AGACTAC A AA AGCTT CTTG (SEQ ID NO: 38) and 5’ -AAGAATTCTCATCGAAGTGCAA (SEQ ID NO: 39); and Fgf21, 5’- CAGGGGTCATTCAAATCCTG (SEQ ID NO: 40) and 5’- AGGAATCCTGCTTGGTCTTG (SEQ ID NO: 41).
  • Apoptotic cells in the growth plate of examined animals were detected by in situ terminal deoxynucleotidyltransferase deoxyuridine triphosphate nick end labeling (TUNEL) assay using the In situ Cell Death Detection Kit (Roche) following the manufacturer’s instructions.
  • TUNEL in situ terminal deoxynucleotidyltransferase deoxyuridine triphosphate nick end labeling
  • ISRIB (SML0843, Sigma) was dissolved in DMSO to make a 5 mg/ml stock and stored at 4°C. Animals were intraperitoneally injected with ISRIB (48, 49) (2.5 mg/kg, diluted in 0.9% saline) or vehicle (5% DMSO in saline) from E13.5 to p20. Animals were collected at plO and p20 for further analysis.
  • annulus puncture was performed in the tail discs of Foxa2mNE-Cre; 7/EG double transgenic mice. Briefly, 3-month- old mice, regardless of the gender, were anesthetized by intraperitoneal injection of Hypnorm and Dormicum at 1 ml/kg of body weight and the caudal disc levels were identified by X-ray (Model 43 855a; Faxitron Corp, IL, USA).
  • the tail skin was incised longitudinally and the C5/6 and C7/8 levels were punctured by inserting a 30G needle bevel into the dorsal annulus at 1 mm depth (BD biosciences) perpendicular to middle of the disc under the guidance of surgical microscope (Wild M691, Switzerland).
  • the C6/7 level was left untreated as control.
  • the mice were allowed to recover and have free activity in cage.
  • the operated animals were subjected to X-ray for disc height measurement.
  • the animals were euthanized and the spine was decalcified by EDTA and embedded in paraffin for histological analysis.
  • Luciferase assays were conducted using a dual luciferase reporter assay kit (Promega), according to the manufacturer’s protocol. Different promoter fragments of Sox9 were cloned into a pGL3 -basic vector (Promega) to drive the expression of firefly luciferase.
  • ATDC5 cells were plated at 2xl0 4 cells/well in 24-well plates. After l8-hours incubation, the cells were transfected with tested constructs with Renilla luciferase vector, which served as an internal control. Data presented are ratios of Luc/Renilla activity from at least three different experiments, and each experiment was performed in triplicate for each DNA sample.
  • fibrosis e.g. disc- and renal fibrosis
  • fibrosis e.g. disc- and renal fibrosis
  • the mouse models are prepared by crossing Sox9-flox mice (with tissue-specific Cre ) or Chop- null mice to l3del mice or mouse models where fibrosis is induced such as mouse models of kidney fibrosis (e.g. Lupus-prone/diabetic mice); mouse models of experimental induced liver fibrosis (e.g.
  • the present invention searched published ER stress-associated ATF4 ChIP-Seq data (40) for binding peaks in transcription factor genes, including members of SOX, RUNX, MEF2, GLI and FOXA families, and found ATF4 binding peaks in regulatory regions of Sox9, Sox5, Sox6, Runx2, GU2 and GU3, suggesting that the Sox family could be the regulatory targets of ATF4.
  • Transcription factor SOX9 is highly expressed in immature chondrocytes, transactivates critical cartilaginous matrix genes and regulates chondrocyte proliferation, differentiation and hypertrophy (50-54). It is required for the expression of SOX5 and SOX6, which cooperate with SOX9 to transactivate Col2al (54).
  • ISRIB Integrated Stress Response InhiBitor
  • ISRIB specifically reduced the amount of ATF4 and CHOP protein, and inhibited p- eIF2oc/ATF4/CHOP signaling transduction, marked by the down-regulation of the transcripts as well as the protein level of their downstream targets (ATF3, EROll and FGF21) ( Figures 20 and 2P).
  • inhibition of p-eIF2oc/ATF4/CHOP by ISRIB did not induce apoptosis ( Figure 2Q) in l3del HC.
  • ISRIB corrected the molecular, histological, and skeletal defects in l3del mice.
  • IDD Intervertebral disc degeneration
  • ISR Intervertebral disc degeneration
  • the tail intervertebral disc (IVD) of 13del mice exhibited significant characteristics of disc degeneration at adult stages ( Figure 3C), including altered NP structure and matrix, loss of NP/AF boundary, disc bulging, widening of the AF interlamellar space and the inward bulging of AF lamellae and consequently fissure ( Figure 3D).
  • Figure 3C tail intervertebral disc
  • Figure 3E excessive cell death was observed in l3del degenerated disc at l6-month stage, consistent with human IDD studies (61) ( Figure 3E).
  • ISRIB prevents the molecular chanees in the 13del IVD
  • the annulus puncturing protocol was used to induce disc degeneration in mouse tail discs.
  • the tail disc degeneration was observed after 2 weeks post puncturing and demonstrated that notochord descendants become fibroblasts and myofibroblasts by expressing alpha smooth muscle actin (oc-SMA), fibroblast activation protein alpha (FAP-a) and Fibroblast-specific protein 1 (FSP- 1) markers with their levels increasing from 4 weeks to 12 weeks post puncturing ( Figures 5A- 5B).
  • the present model could be used to study injury-induced fibrotic changes and subsequent disc degeneration in the IVD from activation of ISR in NP.
  • Lupus nephritis is a potentially reversible cause of severe acute kidney injury and is an important cause of end-stage renal failure in Asians and patients of African or Hispanic descent. It is characterized by aberrant exaggerated innate and adaptive immune responses, autoantibody production and their deposition in the kidney parenchyma, triggering complement activation, activation and proliferation of resident renal cells, and expression of pro-inflammatory and chemotactic molecules leading to the influx of inflammatory cells, all of which culminate in the destruction of normal nephrons and their replacement by fibrous tissue.
  • Anti-double-stranded DNA (anti-dsDNA) antibody level correlates with disease activity in most patients.
  • Fibrosis may also be induced in other tissues such as liver, lung, cardiac, skin and so on (64).
  • Viral 2A peptides allow expression of multiple proteins from a single ORF in transgenic zebrafish embryos genesis 45, 625-629 (2007).
  • Matrix metalloproteinase 12 is an indicator of intervertebral disc degeneration co-expressed with fibrotic markers. Osteoarthritis Cartilage. 24(10): 1826- 1836 (2016).
  • Osteopontin is a novel downstream target of SOX9 with diagnostic implications for progression of liver fibrosis in humans. Hepatology. 56(3): 1108-16 (2012). doi: 10.1002/hep.25758.

Landscapes

  • Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Epidemiology (AREA)
  • Organic Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Urology & Nephrology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

What is described is a method of preventing, ameliorating and/or treating fibrosis or fibrotic response associated with the integrated stress response (ISR) involving the eukaryotic Initiation Factor 2 (eIF2), phosphorylated eukaryotic initiation factor 2α (p-eIF2α) and PKR-like endoplasmic reticulum kinase (PERK) pathway arising from various cellular stresses, such as oxidative stress, hypoxia and ER stress, chronic or prolonged bio-mechanical stress and others. In one embodiment, it provides a method which prevents or alleviates aberrant cell differentiation caused by the activation of the integrated stress response and thereby prevents, treats or alleviates fibrosis or fibrotic response resulting therefrom. In another embodiment, it provides a method of using a p-eIF2α-modulator or a phosphorylated eukaryotic initiation factor 2βmodulator (p-eIF2β-modulator) for the prevention, amelioration and/or treatment of fibrosis or fibrotic response described herein.

Description

METHOD FOR PREVENTING OR MODULATING FIBROSIS AND FIBROTIC RESPONSE ASSOCIATED WITH THE INTEGRATED STRESS RESPONSE
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Serial No. 62/646, 037, filed March 21, 2018, the entire contents and disclosures of which are hereby incorporated by reference into this application.
FIELD OF THE INVENTION
[0002] This invention relates to a method of preventing, ameliorating and/or treating fibrosis or fibrotic response associated with the integrated stress response arising from cellular stresses involving the phosphorylated eukaryotic initiation factor 2a (p-eIF2a) pathway. In one embodiment, the present invention provides a method which prevents or alleviates aberrant cell differentiation associated with the p-eIF2a pathway in various organs and tissues, where the aberrant cell differentiation causes a fibrosis or fibrotic response. This application cites various publications, the entire contents of which are incorporated herein by reference into this application.
BACKGROUND OF THE INVENTION
[0003] Integrated Stress Response (ISR) is a eukaryotic cellular stress response aiming to restore cellular homeostasis upon different types of extrinsic or intrinsic stresses. ISR can be stimulated by a range of physiological or pathological changes (1-5), including hypoxia, amino acid deprivation, glucose/nutrition deprivation, viral infection (2, 3, 5-8) and intrinsic endoplasmic reticulum (ER) stress (9), which caused by the accumulation of unfolded or misfolded proteins within ER. Furthermore, in the context of cancer biology, oncogene activation can also trigger ISR (10, 11).
[0004] Although ISR is primarily a pro-survival homeostatic program aiming to optimize the cellular adaptive response to stress, exposure to severe stress, either in intensity or in duration, will overwhelm the capacity of this adaptive response and drive signaling toward cell death.
[0005] The general translation initiation factor eIF2 is a major controller of protein synthesis at the level of translation. eIF2 is a trimeric complex of a, b and g subunits that binds to both GTP and the initiator methionyl tRNA (Met-tRNA;) to form a ternary complex (cIF2*GTP*Mct- tRNAi). eIF2B is a complex composed of five different subunits, eIF2B 1 , eIF2B2, eIF2B3, eIF2B4, eIF2B5 (also called the a, b, g, d, and e subunits). eIF2B5 catalyzes the GDP/GTP exchange reaction and with eIF2B3, forms the‘catalytic core’. eIF2B complex normally works to activate eIF2 via phosphorylation of eIF2 serine-51 (Ser-51). When phosphorylated on Ser-51, eIF2a-P dissociates from the eIF2B regulatory sub-complex and eIF2B is inactive. Phosphorylated eIF2 blocks protein synthesis thus phosphorylation renders eIF2 an inhibitor of its own guanine nucleotide exchange factor (GEF). GEF eIF2B catalyses release of eIF5 and GDP. The core event in ISR is the phosphorylation of the alpha subunit of eIF2 (eIF2a) by one of four members of eIF2a kinase family: general control nonderepressible 2 (GCN2), protein kinase R (PKR), PKR-like endoplasmic reticulum kinase (PERK) and Fleme-regulated eIF2a kinase (F1RI) (2, 6, 9, 12, 84). The eIF2 complex functions in translation initiation. Phosphorylation of the a-subunit of the eIF2 blocks the activity of the guanine nucleotide exchange factor eIF2B, leading to a decrease in global Cap-dependent protein synthesis and the preferential translation of ISR-specific genes, notably the transcription factor Activating Transcription Factor 4 (ATF4), and CFIOP, which aid cell adaption and recovery. ATF4 is the main effector of the ISR. It forms homodimers and heterodimers that bind to DNA targets to control the expression of genes involved in cellular adaptation, including cell death, cell survival or cell differentiation. It is likely that the duration and level of eIF2a phosphorylation, as well as ATF4 regulation, determine the balance between cell survival and cell death.
[0006] It is well established that mutations in genes encoding extracellular matrix (ECM) components or their receptors (such as integrins) cause disorders affecting the connective tissues of many organs (72). For example, mutations in genes encoding collagen I cause osteogenesis imperfecta (OI) (13); and mutations-in fibrillins cause Marfan syndrome. Many mutations in ECM genes result in misfolded proteins which can trigger the unfolded protein response as a result of the ER stress (22). Recent molecular evidence supports the notion that the underlying pathology is the consequence of retention of such mutant ECM proteins in the endoplasmic reticulum (ER), which induces ER stress and the adaptive unfolded protein response (UPR) (14, 15) . Targeting the UPR is therefore a strategy for the treatment of disorders associated with ER stress. In the context of metaphyseal chondrodysplasia, type Schmid (MCDS), an example is a clinical trial addressing the use of carbamazepine (CBZ) to alleviate accumulation of misfolded proteins by increasing proteolysis (70).
[0007] Sustained activation of UPR has been implicated in the progression of a variety of diseases, including cancer, diabetes, inflammatory disease and neurodegenerative disorders (16). In the past few years, UPR has become an attractive target for drug discovery.
[0008] Upon ER stress, UPR activates three independent ER stress sensors: inositol-requiring 1 (IRE1), PKR-like ER kinase (PERK), and membrane-tethered activating transcription factor 6 (ATF6) (17). Among these, activation of the PERK signaling pathway is likely to be the first line of defense against ER stress and is a central part of a more general integrated stress response (ISR) activated by diverse stress stimuli. Activation of the ISR and PERK signaling pathway is implicated in many diseases including cancer, diabetes, obesity, neurodegeneration and skeletal disorders (18, 71, 85).
[0009] The ISR has a central role in many forms of cellular stress, such as oxidative stress, hypoxia, ER stress, and its induction is associated with diverse common diseases, such as cancer, diabetes, lung disease, obesity, neurodegeneration and skeletal disorders and the associated induced fibrosis (26, 29). Recently, ISR has been implicated in intervertebral disc degeneration (19, 20), which is very common in humans and often causes low back pain (LBP).
[0010] While stress responses commonly result in apoptosis, understanding of how cells adapt and survive and a molecular understanding on the consequences of inducing the ISR on cell fate and differentiation in vivo is lacking. Through an in vivo model of human chondrodysplasia, it has presently been found that ISR may have different etiological roles in diseases and disorders by directly changing cell differentiation process in an ATF4-dependent manner (WO2018/055578, and C. Wang et al, (2018) (58), the entire contents of which are incorporated herein by reference into this application). It was found that in human chondrodysplasia, in which misfolded ECM protein accumulated within the ER and triggered ER stress in hypertrophic chondrocytes, ATF4 directly transactivated Sex-Determining Region Y-Box 9 ( Sox9 ), which in turn disrupted the normal developmental process and caused reversion of cell differentiation. SOX9 is a potent transcription factor with key roles in cell fate determination in many cell types, not only in chondrocytes, but also in many other cell types, notably stem cells (dermal papilla, gonads, intestinal, neural etc.) (21) and is activated in acquired diseases such as cancer, obesity and fibrosis (22). The present invention demonstrated for the first time a direct linkage between SOX9 and ISR, which may have broad implications for various diseases.
[0011] Several pharmacological approaches exist for targeting the components of ISR. The eIF2a phosphorylation can be 1) either stimulated through chemical activators of eIF2a kinases by, for example, histidinol, asparaginase, halofuginone, arginine deiminase, BTdCPU, BEPP monohydrochloride and CCT020312, or prevented by indirubin-3’ -monoxime, SP600125, SyK, GSK260641, GSK2656157, C16, 2-aminopurine and aminopyrazolindane; 2) modulated via inhibiting eIF2a phosphatases, by, for example, guanabenz and Sephinl, to block GADD34, or nelfinavir to decrease CReP expression and disrupt binding of CReP-PPl complex to eIF2a; and most importantly, 3) reversing the consequences of eIF2a phosphorylation using Integrated Stress Response Inhibitor (ISRIB) (18, 83). BRIEF SUMMARY OF THE INVENTION
[0012] This invention relates to methods of preventing, ameliorating and/or treating fibrosis or fibrotic response associated with the integrated stress response involving eukaryotic Initiation Factor 2 (eIF2), phosphorylated eukaryotic initiation factor 2a (p-eIF2a) and PKR-like endoplasmic reticulum kinase (PERK) pathway arising from various cellular stresses, such as oxidative stress, hypoxia, ER stress, chronic or prolonged bio-mechanical stress and others. In one embodiment, the present invention provides a method which prevents or alleviates aberrant cell differentiation caused by the activation of the integrated stress response and/or associated with the p-eIF2a and PERK pathway in various organs and tissues, and thereby prevents, ameliorates and/or treats fibrosis or fibrotic response. In another embodiment, the present invention provides a method of manipulating the inhibitory effects of p-eIF2a using a p-eIF2a modulator or a phosphorylated eukaryotic initiation factor 2b modulator (p-eIF2 -modulator) for the prevention, amelioration and/or treatment of fibrosis or fibrotic responses described herein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0013] Figure 1 shows a schematic of the PERK signaling pathway in eukaryotes. PERK is one of the kinases that phosphorylates eIF2a. Upon phosphorylation by PERK, p-eIF2a acts to suppress global protein synthesis by suppressing Cap-dependent translation initiation while activating preferential translation of ISR-specific mRNAs, such as for transcription factor ATF4 and CHOP. ATF4 in turn activates transcription of additional genes involved in cellular adaptation, including cell death, cell survival or cell differentiation.
[0014] Figures 2A-2Q show that small molecule IS RIB ameliorates skeletal deformities in l3del mice by preventing ATF4 induction under ER stress. Figure 2A is a schematic timeline of the ISRIB (2.5 mg/kg) or vehicle (0.5% DMSO in 0.9% saline) administration in mice. ISRIB was administered by daily intraperitoneal injection starting on E13.5 and ending on p20. The animals were harvested at indicated time points. Figures 2B and 2C demonstrate that treatment with ISRIB did not affect the body weight gain or body length growth in wild type mice. Figure 2D shows body lengths of the vehicle-treated (n=20) and ISRIB-treated (n=l6) l3del mice at indicated time points. Significant and consistent improvement of body length in ISRIB-treated l3del mice was observed at all point from birth to p20. Figures 2E and 2F show the radiographic analyses of WT and l3del mice demonstrating that skeletal deformities of l3del mice were alleviated at p20 by ISRIB treatment. These alleviated skeletal deformities include the length of tibia, femur and spine (spine length here is measured by the length of 7 continuous vertebrae consisting of the last sacral vertebra and six tail vertebrae); pelvic bone deformation (Q1: the angle between ilium and pubis); Coxa Vara ( Q2 : the angle between the proximal head and the shaft of the femur) and Genu Varum ( Q3 : the angle between proximal head and distal head of tibia). Figures 2G and 2H show the rescue of growth plate abnormalities in l3del mice by treatment with ISRIB at plO and p20, respectively, as demonstrated by histology (a-a”) and in vivo expression profiles of SOX9 (b-b” and c-c”), Col2al (d- d”) and Ppr (e-e”). Figures 21 and 2J show the hypertrophic zone (HZ) length measurement and Sox9+, Col2al+ and Ppr+ cells quantification in tested animals at indicated time points. Figure 2K suggests that histology of plO growth plates was comparable between ISRIB-treated and vehicle-treated WT mice. Figures 2L and 2M show the alleviation of the HZ expansion in caudal intervertebral disc (IVD) by ISRIB in l3del mice at plO and p20. Figures 2N-2P show the results of in situ hybridization assays for different genes: Figure 2N shows the alleviation of the growth plate deformities in caudal IVD by ISRIB in l3del mice as indicated by reduced number of the Sox9 (a-a”, c-c”) and the Col2al (b-b”, d-d”) expressing cells in the lower HZ at plO and p20. Figure 20 shows that at plO, the transcripts of Atf4' (a-a”), Atf3 (b-b”), Chop (c-c”), Eroll (d-d”) and Fgf21 (e-e”) were down-regulated in HZ of ISRIB-treated l3del mice, while Rip (f-f”) was not affected. Figure 2P shows that at plO, the protein level of ATF4 (a-b”), ATF3 (c-d”), CHOP (e-f”) and FGF21 (g-h”) were down-regulated in HZ of ISRIB- treated l3del mice. Figure 2Q shows by TUNEL assays that ISRIB treatment did not induce apoptosis in l3del mice.
[0015] Figures 3A-3M show degenerative intervertebral disc (IVD) features in a human patient with metaphyseal chondrodysplasia, type Schmid (MCDS) and l3del mice. Figure 3A shows the radiographic analysis that revealed early onset of Intervertebral Disc Degeneration (IDD) in a 20- years-old MCDS patient. Figure 3B shows the FAST staining revealing swelling of the nucleus pulposus (middle arrow), endplate expansion (upper and lower dashed arrows) and accumulation of chondrocyte -like cells in the inner annulus fibrosus (iAF) in 13del mice (circled region) at 4 weeks (mouse age of 4 weeks is regarded as equivalent to human age of 14 years). Figure 3C shows the radiographic analysis revealing severe intervertebral disc degeneration in tail region (T5/6, T6/7 and T7/8) in 7-, 9-, 12- and 16-month old 13del mice. Figure 3D shows histological analysis demonstrating that the tail intervertebral discs (IVD) of 6-month old (upper panel) and 16-month old (lower panel) 13del mice exhibited significant characteristics of disc degeneration, including loss of nucleus pulposus/annulus fibrosus (NP/AF) boundary, disc bulging and widening of the AF interlamellar space. Notably, the circled region clearly shows the inward bulging of inner AF (iAF) lamellae and significantly decreased volume of vascular canals in subchondral region between spinal growth plate and endplate in 6-month old 13del mice. Moreover, at 16-month, the 13del disc clearly exhibited (a) the altered NP structure and matrix, (b) the inward bulging of AF lamellae and the consequent fissure (boxed regions). Figure 3E shows that excessive cell death (by TUNEL assay) in NP of the degenerated tail IVD of l6-month l3del mice compared to WT mice. Figure 3F shows that the essential ER stress sensor BIP was ectopically upregulated in the core region of l3del NP at 6-month stage both transcriptionally (Rip, upper panel) and translationally (BIP, lower panel). Figures 3G and 3H show that significant upregulation of p- eIF2oc, the most upstream event in ISR, was only observed in l3del degenerated tail discs (Figure 3G) but not in l3del lumbar discs (Figure 3H), indicating that ISR was only triggered in degenerated discs in spite of the transgene-bearing genetic background. Figure 31 shows that concomitantly, although the transcriptional expression level of Atf4 was not changed, the protein level of ATF4 was significantly upregulated in NP of 6-month old l3del mice, indicating the contributory regulation of ISR. Figure 3J shows that activation of ATF5, the vital transcription factor of mitochondria-dependent oxidative stress response, was observed in the core part of NP of 6-month old l3del mice (circled), indicating the induction of oxidative stress. Figure 3K shows that in WT control mice, the peripheral nucleus pulposus cells (NPCs) highly expressed Sox9 and the level was much lower in cells within core region. However, as a consequence of induction of stress in 6-month l3del NP, the cell fate of NP cells was affected as indicated by the ectopic expression of Sox9 in cells within the NP core region. Figure 3L shows that OPN, a major component of NP extracellular matrix, was highly expressed in peripheral NPCs at young stage (plO, p20 and 4-month), the expression level is diminished at maturity (6-month) and absent at elderly stage (16-month) in WT mice. However, in l3del NP, not only the persistent upregulation in peripheral NPCs but also the ectopic expression of Opn in NPCs within the NP core region was observed. Moreover, at older 16-month stage, the Opn+ cells were still detected. It is notable that OPN is a target of SOX9. (73, 74) Figure 3M shows that similarly to Opn, oc-SMA marked the peripheral NPC at young stage (4-month) but became absent at 6-month in WT mice, while this marker was persistently expressed in l3del peripheral NPCs and was ectopically expressed in core NPCs.
[0016] Figures 4A-4C show that ISRIB ameliorated the IVD phenotypes of l3del mice. Figure 4A shows that treatment with ISRIB (2.5mg/kg) eased the IVD abnormalities in l3del lumbar spine as demonstrated by the less expanded endplate and the more organized iAF structure. Figure 4B shows that in l3del mice, treatment with ISRIB reduced the number of reprogrammed chondrocytes in the growth plates and endplates. Moreover, the ectopic expression of Opn in NP was greatly reduced. Figure 4C shows that in l3del lumbar IVD, ATF3 (a downstream target of ATF4) was significantly activated in the hypertrophic chondrocytes (HCs) of the growth plate and endplate (EP) as well as in the NP (arrows). No ATF3 expression was detected in lumbar IVD of l3del mice treated with ISRIB and there appeared to be fewer ATF3-expressing HCs.
[0017] Figures 5A-5B show morphological and fibrotic changes of punctured murine discs in transgenic mice in which NPCs are specifically labelled with EGFP. In Figure 5A, annulus fibrosis (AF) puncture was induced at level 6 and level 8 of mouse tail discs. Disc degeneration was observed by FAST staining of murine tail IVDs at different time points after AF puncture. In Figure 5B, severe fibrotic changes in injured discs were demonstrated by the presence of oc-SMA, FAP-a and FSP-l stained cells, indicating they are myofibroblasts/fibroblast-like. Notably, these accumulated myofibroblasts/fibroblast-like cells were EGFP-tagged indicating that these cells are derived from NP cells and fibrotic cell fate change of NP cells was induced by the puncture. (Fabel: C denotes control; 12WPP denotes 12 weeks post-puncture).
[0018] Figures 6A-6B show pathogenic changes in the kidney biopsy samples from patients with renal fibrosis (provided by Dr. Susan Yung, Prof. T. M. Chan, Department of Medicine, The University of Hong Kong). Figure 6A lists the baseline clinical condition of the patients. Figure 6B shows that severe fibrosis was observed in renal biopsy samples from patients with IgA nephropathy (Figure 6B-a’), diabetic nephropathy (Figure 6B-a”) and Fupus Nephritis (Figure 6B-a”’), marked by oc-SMA. Notably, oc-SMA was not only highly expressed in renal interstitium in all specimens, but also in the glomerular mesangium in the lupus nephritis specimen. Strikingly, ectopic expression of SOX9 was observed in all specimens (Figure 6B-b, b’, b” and b’”), with highly tubular expression in IgA nephropathy and diabetic nephropathy patients, and tubulo interstitial as well as interstitial inflammatory cells expression in patients with lupus nephritis. Concomitantly, ISR was significantly activated, marked by the upregulation of p-eIF2oc (Figure 6B-d, d’, d” and d’”) and its downstream target ATF4 (Figure 6B-c, c’, c” and c’”) in tubular interstitium in all specimen, indicating the etiological role of ISR in the genesis of renal fibrosis.
[0019] Figures 7A-7D demonstrate the putative ATF4 binding regions on Sox9 within the topologically associated domains (TAD), indicating the potential ISR-regulation of Sox9 by enhancers. Figure 7A shows that human SOX9 ( hSOX9 ) and mouse Sox9 ( mSOX9 ) are located within the boundary region between 2 sub-TADs and share a highly conserved TAD pattern. Figure 7B and 7C demonstrate the highly conserved CCCT C-binding factor (CTCF) insulator binding region presenting in human and mouse Sox9 gene locus. Figure 7D demonstrates an example of putative ATF4 binding enhancer region on mSox9.
[0020] Figure 8 is a presentation of ATF4 ChIP peaks on regulatory regions (+/-2kb from transcriptional start site, TSS) of vital chondrogenic transcriptional factors (SOX, MEF2, RUNX, GLI and FOXA). The expression trends of these factors in WT and l3del chondrocytes were measured by normalized microarray expression profiles of the different populations of chondrocytes in the growth plate. These chondrocytes, isolated by fractionating the growth plate, include proliferating chondrocytes (PC), prehypertrophic chondrocytes (pHC), upper hypertrophic chondrocytes (UHC), middle hypertrophic chondrocytes (MHC) and lower hypertrophic chondrocytes (LHC) (82). TSS refers to transcriptional start site.
[0021] Figure 9A shows luciferase activities of Sox9 promoter reporters with different lengths of the 5’ flanking region of the gene (pSox9-2.7K, pSox9-l.8K and pSox9-0.8K) or ATF4 putative binding sites mutants (pSox9-l.8Ml, pSox9-l.8M2 and pSox9-l.8M3) responding to different dosages of ATF4 measured in ATDC5 cells. Figure 9B shows ChIP-PCR demonstrating the direct binding of ATF4 to a putative motif on the Sox9 promoter in vivo, using the nuclear extracts from E15.5 WT and C10-ATF4 limbs. An ATF4 ChIP-seq peak (dark triangle) around this region has been reported in ER-stressed MEF cells.
[0022] Figures 10A-10C show the activation of the ISR in the SM/J mouse which is a natural model of early onset IDD. Figure 10A shows early onset and spontaneous degenerative changes in tail IVDs of SM/J mice comparing to those of LG/J mice at 4-weeks of age. Safranin-O/Fast- Green staining and an IVD scoring system specific to mouse were applied to evaluate the histological changes of the NP and AF. Different severity of IVD degenerative changes and the IVD score for each disc are shown (NP = nucleus pulposus; AF = annulus fibrosus. Scale bars indicate 200 pm). Figure 10B shows that ISR was activated in degenerative SM/J tail IVDs compared to LG/J IVDs as revealed by ectopic expression of Atf4 and Chop. . Figure 10C shows ectopic expression of Sox9 and Col2al observed in degenerative SM/J tail IVDs compared to LG/J IVDs.
[0023] Figure 11A shows the histology of a chordoma sample (panel a is a low power image and panels b-e are high power images). Figure 11B shows the histology of non-degenerated NP tissues..
[0024] Figure 12 shows different cell populations in human chordoma as revealed by single cell RNA sequencing. Two technologies were used: 10X Genomics and manual picking with Smartseq2. Panel a) shows two chordomas (cervical chordoma and sacrum chordoma) in 10X Genomics; panel b) shows a chordoma in smartseq2; panel c) shows sub-population 2 (S2) marked by Fibrosis markers; panel d) shows sub-population 2 (S2) of the third chordoma also marked by Fibrosis markers; panel e) shows two chordomas in 10X Genomics where the crosses indicate cells that were marked by co-expression of various markers; and panel f) shows a chordoma in smartseq2 where the crosses indicate cells that were marked by co-expression of various markers.
[0025] Figure 13 shows histological features of degenerated NP tissues. Note: clusters of round cells resembling chondrocytes (left panel) and spindle like cells resembling fibroblasts (right panel).
[0026] Figure 14 studies the co-expression of SOX9 with ISR effectors in human NP cells from degenerated discs. Panel a) indicates SOX9 is expressed in non-degenerated NP tissue in chondrocyte like cells. Panel b) indicates SOX9 expression is upregulated in the fibroblast-like cells in the degenerated NP tissue. Different from the notochordal-like and chondrocyte-like cells in non-degenerated NP, fibroblast-like cells were specifically identified the degenerated NP, characterized by their distinct cell morphology and higher expression level of SOX9. Panels c) to f) represent tSNEplots of populations identified by single cell RNAsequencing. Two technologies were used: 10X Genomics and manual picking with Smartseq2. (Key: DS refers to degenerated NP and DS01-05 and DS06 respectively refer to sample number. Crosses: Cells which were marked by co-expression of SOX9, CHOP, ATF4/ATF3/ATF6, and GADD34.)
DETAIFED DESCRIPTION OF THE INVENTION
[0027] In one embodiment, the present invention provides a method of preventing, ameliorating and/or treating fibrosis or fibrotic response associated with the integrated stress response (ISR) involving the phosphorylated eukaryotic initiation factor 2a (p-eIF2a) pathway arising from various cellular stresses, such as oxidative stress, hypoxia and ER stress, chronic or prolonged bio mechanical stress.
[0028] In one embodiment, the present invention provides a method of using a p-eIF2a-modulator for the prevention, amelioration and/or treatment of fibrosis or fibrotic response described herein.
[0029] As described herein, phosphorylated eukaryotic initiation factor 2a pathways or p-eIF2a pathways include signaling pathways where de -phosphorylated eIF2a or phosphorylated eIF2a is involved, and include signaling pathways which are directly or indirectly affected by the de phosphorylation or phosphorylation of eIF2a.
ISR-associated skeletal diseases
[0030] The integrated stress response (ISR) is an adaptive cell-survival pathway that can be activated when misfolded proteins trigger endoplasmic reticulum (ER) stress. It is implicated in development and diseases, with many human genetic skeletal deformities being caused by mutations that trigger the ISR.(75-77)
[0031] In a metaphyseal chondrodysplasia, type Schmid (MCDS) transgenic mouse model (13del), which carries a 13 bp deletion in CollOal equivalent to the human mutation causing MCDS, misfolded mutant collagen X induces ER stress. Although the chondrocytes survive, their differentiation is reversed by an unknown mechanism to a more juvenile state characterized by the re-expression of prehypertrophic chondrocyte markers ( Ppr , Sox9 and Col2al), disrupting endochondral ossification, and skeletal dysplasia ensues. A similar effect on hypertrophic chondrocyte differentiation has been described in other mouse models of dwarfism (78).
[0032] The present invention represents the first mechanistic study in a model of human chondrodysplasia associated with ER stress that demonstrates causality and a direct link between the ISR and reprogrammed chondrocyte differentiation. Disclosed herein, ISR signalling reverses hypertrophic chondrocyte differentiation via ATF4-directed trans activation of the transcription factor gene Sox9. By genetic and molecular analyses, the present invention established that the major effect of the ISR is the preferential expression of ATF4 which activates the transcription of a potent transcription factor gene Sox9 (a key regulator of chondrocyte differentiation and proliferation). The present invention also discloses the dual action of CFlOP and ATF4 in promoting hypertrophic chondrocyte survival, establishing the critical role of CFlOP in partnership with ATF4 in enabling chondrocyte survival via the transactivation of Fgf21. The present invention highlights the complex consequences of activating ISR, in part because of the distinct roles of ATF4 in controlling cell differentiation and proliferation depending on cell context.
[0033] The present invention further demonstrates that treatment of mutant l3del mice with a small molecule inhibitor of the ISR pathway, ISRIB (trans-N,N’ -(Cyclohexane- 1 ,4- diyl)bis(2-(4-chlorophenoxy)acetamide), which targets the interaction between eukaryotic initiation factor 2 (eIF2) and eukaryotic initiation factor 2B (eIF2B) and thereby suppresses ATF4 induction, prevents the differentiation defects and ameliorates chondrodysplasia in the l3del mice (Figures 2A-2Q), and ameliorates the degenerative intervertebral disc (IVD) syndromes of the l3del mice (Figures 4A-4C). The failure of chemical chaperones or ER-stress reducing reagents to rescue chondrodysplasia in mouse models (79) and the benign impact of either absence of (80), or overexpressing Xbpls (this study) underscore cell context-dependent effects of the different arms of the UPR. Importantly, the present invention identifies a key causative role for the ISR in MCDS and demonstrates that targeting early in the pathway, i.e., at the level of PERK phosphorylation of eIF2a could be an effective therapeutic approach.
[0034] As disclosed herein, the effect of ISRIB on the aberrant differentiation of ER-stressed F1C reveals the contextual complexity of ISRIB action. ISRIB antagonizes the preferential translation of ATF4 and other preferentially translated transcripts mediated by the ISR, thereby reversing or preventing reverted differentiation (i.e., reversing or preventing the transition of cells to a less mature stage). In the context of the l3del mutation, the net result is the improvement of murine skeletal development. This result may reflect the dominance of de-differentiation in the pathogenesis of the chondrodysplasia. By finding the dose of ISRIB that titrates ATF4-CFIOP levels and prevents and/or ameliorates the aberrant differentiation (by reversing and/or preventing reverted differentiation) without causing death of the stressed chondrocytes, the dualism inherent in the ISR may be exploited therapeutically. In the present invention, a dose of ISRIB is administered to a subject to achieve an optimal level of cell differentiation and cell survival.
[0035] In one embodiment, 2.5 mg/kg of ISRIB is administered to a subject twice a day, effectively and substantially alleviating the defects. In another embodiment, 5 mg/kg ISRIB is administered to a subject twice a day. In various embodiments, the effective amount of ISRIB is 0.05-0.1, 0.1- 1, 1-5, 5-10, 10-20, 20-25, 25-50 or 50-100 mg/kg per day. In one embodiment, the subject is treated for 1 day or up to 365 days. In various embodiments, the subject is treated for 5, 10, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325 or 350 days.
ISR-associated diseases involving p-e!F2q pathway
[0036] In one embodiment, the present invention provides a method of preventing, ameliorating and/or treating a disorder associated with integrated stress response involving the p-eIF2oc pathway in a subject using a molecule that targets the underlying p-eIF2oc-pathway. In one embodiment, molecules to be used in the present invention are modulators which directly or indirectly suppress the translational or transcriptional expression of ATF4 or SOX9. Without limiting the generality of the foregoing, the following illustrates a few embodiments of the present invention.
[0037] As reported herein, over-expression of ATF4 as part of the ISR has far reaching consequences in vivo, it directly activates the expression of Sox9 and thereby reverses the differentiation of a mature chondrocyte to a more immature state. SOX9 is a potent transcription factor with key roles in cell fate determination, not only in chondrocyte differentiation, but also in many other cell types, notably stem cells (e.g. dermal papilla, gonads, intestinal, and neural) and its overexpression or dysfunction results in many diseases including fibrosis and cancer (14). By preventing aberrant cell differentiation, titrated inhibition of the ISR emerges as a rationale therapeutic strategy for treating disorders caused by ISR. The present invention revealed that given the importance of ATF4 to normal development, simply preventing its expression globally may not work therapeutically. Rather, the present invention introduces for a novel and viable approach to alter cell differentiation or cell fate by targeting the translational control of ATF4 that leads to its over expression.
[0038] In one embodiment, the present invention provides a method of preventing and/or ameliorating aberrant cell differentiation through the inhibition of ectopic expression of Sox9/SOX9 (referring to mouse transcription factor gene Sox9 and human transcription factor gene SOX9, respectively). In another embodiment, the present method prevents and/or alleviates conditions, disorders or diseases resulting from an aberrant cell differentiation. As used herein, “aberrant cell differentiation” includes any process whereby the cells undergo abnormal cell differentiation including without limitation de-differentiation, trans-differentiation and reverted differentiation. In one embodiment, the present method includes the use of a molecule which inhibits the ectopic expression of Sox9/SOX9. In another embodiment, the present method includes a use of a molecule which inhibits the ectopic expression of ATF4 which subsequently reduces the ectopic expression of Sox9/SOX9. In one embodiment, the molecule is a modulator that is capable of directly or indirectly inhibiting the transcriptional or translational expression of ATF4.
[0039] In one embodiment, the modulator in the present invention is represented by Formula I:
Figure imgf000014_0001
wherein each of Rl, R2, R3 and R4 is independently hydrogen, halogen, -OCH3, -OCH2Ph, -C(0)Ph, -CH3, -CF3, -CCI3, -CN, -S(0)CH3, -OH, -NH2, -COOH, -CONH2, -N02, -C(0)CH3, -CH(CH3)2, -CCSi(CH3)3, -CCH, -CH2CCH, -SH, -SO3H, - SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC=(0)NHNH2, -NHC=(0)NH2, -NHS02H, -NHC=(0)H, -NHOH, -OCF3, -OCHF2, -N3, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl.
[0040] In one embodiment, the modulator represented by Formula I is ISRIB having the formula
Figure imgf000014_0002
one embodiment, the modulator represented by
Formula I includes molecules that are described in WO 2014/144952, the entire contents of which are incorporated herein by reference into this application.
[0041] In another embodiment, the modulator represented by Formula I is selected from the following molecules:
Figure imgf000014_0003
Figure imgf000015_0001
[0042] In one embodiment, the modulator subject to the present invention is represented by Formula II:
Figure imgf000015_0002
(II), wherein R1 is bicycloheteroaryl, including but not limited to pyrrolopyrimidine, which may be unsubstituted or substituted with groups such as amino and alkyl; R2 is heteroaryl, including but not limited to pyridyl, pyrrolyl and pyrazolyl, which may be unsubstituted or substituted with groups such as halogen, alkyl and trihaloalkyl, and R3 is hydrogen or halogen. In one embodiment, the modulator is represented by Formula II which includes molecules described in WO2011/119663, the entire contents of which are incorporated herein by reference into this application.
[0043] In one embodiment, the modulator represented by Formula II is GSK2656157 having the formula
Figure imgf000016_0001
various embodiments, the modulator represented by Formula II is selected from the following molecules:
Figure imgf000016_0002
[0044] In one embodiment, the modulator is Act2B
Figure imgf000016_0003
as described in Wong et al. (69) , the entire contents of which are incorporated herein by reference into this application.
Fibrosis
[0045] The persistent presence of ER stress can increase cell death in injured tissues, induce epithelial-mesenchymal transition (EMT) and promote fibrotic remodeling instead of the restoration of normal tissue architecture (23). Activation of ER stress and oxidative stress is a common pathological feature of fibrosis in a variety of organs, including lung (24), liver (25) and heart (26).
[0046] Fibrosis is an excessive accumulation of extracellular matrix (ECM) that can lead to distortion of tissue architecture and loss of organ function (27, 28). This pathology commonly results from a wound healing response to repeated or chronic injury or tissue damage, irrespective of the underlying etiology, and can occur in virtually any solid organ or tissue. A broad range of prevalent chronic diseases can give rise to fibrosis, including intervertebral disc degeneration (IDD) (62), osteoarthritis (63), diabetes, hypertension, viral and nonviral hepatitis, heart failure and cardiomyopathy, idiopathic pulmonary disease, scleroderma, and cancer. Fibrosis resulting from these and other diseases can lead to failure of liver, lung, kidney, heart, or other vital organs as excessive ECM replaces and disrupts parenchymal tissue. Ectopic expression of transcription factor Sex-Determining Region Y-Box 9 ( Sox9 ) has been widely reported to mediate ECM deposition, including deposition of collagens and other structural proteins, in the pathology of fibrosis in multiple organs, including liver (29), kidney (30, 31), lung, myocardium (32), intervertebral discs, and articular cartilage. Fibrosis may be induced in other tissues such as liver, lung, cardiac, skin and so on (64).
[0047] The data in Figure 6 demonstrated that ISR was significantly activated (marked by the upregulation of p-eIF2oc (Figure 6d-d”’) and its downstream target ATF4 (Figure 6c-c”’)) in renal biopsy samples from human patients with IgA nephropathy (Figure 6a’), diabetic nephropathy (Figure 6a”) and Lupus Nephritis (Figure 6a’”). Strikingly, ectopic expression of human transcription factor gene SOX9 can be observed in these patients (Figure 6b-b’”). These data indicated the etiological role of ISR in the genesis of renal fibrosis.
[0048] In one embodiment, the present invention provides a method of preventing, ameliorating and/or treating fibrosis or fibrotic response associated with the integrated stress response (ISR) involving the phosphorylated eukaryotic initiation factor 2a (p-eIF2a) pathway arising from various cellular stresses such as oxidative stress, hypoxia and ER stress, chronic or prolonged bio mechanical stress.
[0049] As reported herein, the present invention demonstrates for the first time a direct linkage between Sox9/SOX9 (mouse/human), ATF4 and ISR. In one embodiment, the present invention provides a novel approach for treating, preventing and/or ameliorating fibrosis or fibrotic response through the modulation of ectopic expression of ATF4 and its potential downstream mediators, such as Sox9/SOX9 and CFIOP. In one embodiment, the present invention provides a method for treating, preventing and/or ameliorating fibrosis or fibrotic response through the modulation of activity of ATF4 and its potential downstream mediators, such as Sox9/SOX9 and CFIOP.
[0050] In one embodiment, through the inhibition of expression or activity of ATF4, the present method reduces the expression of Sox9 and/or CFlOP in an organ or tissue, thereby preventing or reducing the occurrence of fibrotic response in the organ or tissue.
[0051] In one embodiment, presence or progress of fibrosis is indicated by an elevated level of one or more fibrotic factors as compared to normal subjects or cells (81). In one embodiment, the present invention provides a method of modulating the level of one or more fibrotic factors, which are indicative of the presence or progress of fibrosis, comprising a step of using a p-eIF2a- modulator described herein.
[0052] In one embodiment, fibrotic factors include but are not limited to fibrillar proteins, glycoproteins, small leucine rich proteoglycans (SLRPs) and matricellular proteins. In one embodiment, fibrillar proteins include but are not limited to fibrillar collagen (e.g. type I-III, V, XI), fibronectin (e.g. ED-A, ED-B), and elastin. In one embodiment, glycoproteins include but are not limited to non-fibrillar collagen (e.g. type IV, VI- VIII, XIV), fibrillin (e.g. fibrillin 1-3), LTBP (e.g. LTBP 1-4), tenascin (e.g. tenascin C (R, W, X)), Hyaluronan (e.g. form HA), versican (e.g. V0-V3), syndecan (e.g. syndecan 1-4), fibulin (e.g. fibulin 1-7). In one embodiment, small leucine rich proteoglycans (SLRPs) include but are not limited to biglycan, lumican, fibromodulin, dermatopontin and decorin. In one embodiment, matricellular proteins include but are not limited to CCN (CCN1-6), periostin, osteopontin and osteonectin (e.g. SPARC). In one embodiment, fibrotic factor is alpha smooth muscle actin (a-SMA), fibroblast activation protein alpha (FAP-a) and fibroblast specific protein 1 (FSP-l) or transforming growth factor b (TGF- b).
[0053] In one embodiment, fibrotic factors include factors which involve the posttranslational modifications of the ECM, including but are not limited to lysyl oxidase (LOX), LOX-like 1-4 (LOXL-l-4), LH 1-3, transglutaminase 1-7 (e.g. TG 1-7), matrix metalloprotease, (e.g. MMP 1-3, 7- 17, 19-21, 23-28), tissue inhibitor of matrix metalloproteinase (e.g. TIMP 1-4) and plasmin- activation inhibitor (e.g. uPA, tPA, PAI-l, PAI-2). Rosenbloom et al. (2017) (64) and Dickens et al. (2019) (65) reviewed the molecular mechanism involved in the development of tissue fibrosis, it is appreciated that one of ordinary skill in the art would be able to determine the presence or progress of fibrosis based on fibrotic factors according to the knowledge in the art at the time of invention.
[0054] In one embodiment, fibrotic responses include but are not limited to responses that initiate or advance fibrosis in organ or tissues described herein. In one embodiment, fibrotic responses are triggered by other complications, diseases or disorders such as obesity and cancer.
[0055] In one embodiment, fibrosis to be treated, prevented and/or ameliorated by the present invention is a fibrosis occurs in an organ or a tissue. In one embodiment, fibrosis is a fibrosis that occurs in lung, liver, heart, brain, kidney, bone, skin, pancreas, intervertebral disc, cartilage and connective tissues. In one embodiment, fibrosis occurs as a result of trauma, e.g. in wound healing after burns. In one embodiment, fibrosis occurs as a result of other complications, diseases or disorders. In one embodiment, fibrosis is any fibrosis caused by, directly or indirectly, or associated with the activation of ISR involving the p-eIF2oc pathway.
[0056] In one embodiment, the present method can be used to reverse fibrosis by, for example, reversing an established fibrosis, reducing the extent of excessive ECM or tissue deposited in a particular tissue, or reducing the extent of fibrotic process occurred and so on. [0057] In one embodiment, the present invention provides a method of preventing or ameliorating aberrant cell differentiation which results in an aberrant synthesis or accumulation of ECM, where the aberrant cell differentiation is caused by the activation of the ISR. In one embodiment, the present method prevents or ameliorates cell differentiation into a type of cell such as fibroblasts and myofibroblasts that synthesizes ECM. In another embodiment, the present method prevents or ameliorates an aberrant cell differentiation into a myofibroblastic lineage.
[0058] In one embodiment, the present invention provides a method of using a p-eIF2oc-modulator described herein for the prevention, treatment and/or amelioration of fibrosis caused by an aberrant cell differentiation.
[0059] In one embodiment, the present invention provides a method of using a p-eIF2oc-modulator described herein for the prevention, treatment and/or amelioration of aberrant accumulation of ECM caused by an aberrant cell differentiation. In one embodiment, the present invention provides a method of using a p-eIF2oc-modulator described herein for the prevention, treatment and/or amelioration of aberrant synthesis or accumulation of ECM that is caused by an aberrant cell differentiation and/or activation of transcription factor gene Sox9/SOX9.
[0060] In one embodiment, the present invention provides a method of using a p-eIF2oc-modulator described herein for the prevention and/or amelioration aberrant synthesis or accumulation of ECM in a tissue or organ, where the aberrant accumulation of ECM is caused by the activation of the ISR.
[0061] In one embodiment, the present invention provides a fibrotic mouse model and a method for screening candidate molecule for the ability to modulate fibrosis associated with integrated stress response (ISR) involving the p-eIF2oc pathway, the method comprising the steps of a) administering a candidate molecule to the mouse, and b) measuring one or more of fibrotic factors described herein, where changes in one or more fibrotic factors in the presence of the candidate molecule as compared to a control molecule indicates that the candidate molecule is capable of modulating fibrosis associated with ISR involving the p-eIF2oc pathway. In one embodiment, the fibrotic mouse model carries a Sox9 gene which can be conditionally knocked out (i.e., can be removed or inactivated in specific tissue(s) rather than universally removed or inactivated in the whole organism), thereby allowing to determine whether the effect of the candidate molecule on fibrosis is through its action on Sox9 in specific tissue(s). For example, the fibrotic mouse model can be obtained by crossing Sox9- flox mice with mice carrying Cre recombinase expressed from a tissue-specific promoter, which results in progeny with Sox9 knock out in a particular tissue. In one embodiment, the fibrotic mouse model is a Ddit3- null ( Ddit3 encodes protein CHOP). In another embodiment, the fibrotic mouse model carries a Ddit3 gene which can be conditionally knocked out in a similar manner as for 5ox9-conditional knockout. p-eIF2g modulators
[0062] In one embodiment, the present invention provides a method of preventing, ameliorating and/or treating fibrosis or fibrotic response associated with integrated stress response involving the eukaryotic Initiation Factor 2 (eIF2), phosphorylated eukaryotic initiation factor 2a (p-eIF2a) and PKR-like endoplasmic reticulum kinase (PERK) pathway in a subject, comprising the step of administering to said subject an effective amount of a molecule which targets the p-eIF2a pathway (a“p-eIF2a modulator”). In another embodiment, the present invention provides a use of a p- eIF2a modulator for the preparation of a medicament for preventing, ameliorating and/or treating fibrosis or fibrotic response associated with integrated stress response involving the p-eIF2a pathway. In another embodiment, the present invention provides molecules that are capable of modulating the p-eIF2a pathway for use in the treatment of diseases or modulation of conditions described herein. In yet another embodiment, the present invention provides a method of manipulating the inhibitory effects of p-eIF2a using a p-eIF2a modulator or a phosphorylated eukaryotic initiation factor 2 b- modulator (p-eIF2 -modulator) for the prevention, amelioration and/or treatment of fibrosis or fibrotic responses described herein.
[0063] In one embodiment, the subject is a human including an adult and a child, or an animal.
[0064] In one embodiment,“effective amount” means the amount of a molecule necessary to achieve a desired physiological effect.
[0065] In one embodiment, the present invention provides a method of modulating the p-eIF2a pathway in a cell or a population of cells, the method comprising contacting the cell(s) with an effective amount of a p-eIF2a or a r-eIH2b modulator.
[0066] In one embodiment, p-eIF2a modulators are small molecules, nucleic acids, proteins or other biomolecules. In one embodiment, p-eIF2a modulators are small molecules which are represented by Formula I or II described above. In one embodiment, p-eIF2a modulators are p- eIF2a inhibitors such as ISRIB, GSK2656157, Act2B and their analogs that inhibit one or more downstream molecules or signaling events in the p-eIF2a pathway. In another embodiment, p- eIF2a modulators are molecules such as Sulubrinal and Guanzbenz and their analogs that activate one or more downstream molecules or signaling events in the p-eIF2a pathway. In yet another embodiment, p-eIF2a modulators are molecules that alter one or more downstream molecules or signaling events in the p-eIF2a pathway (for example, those illustrated in Figure 1), and the p- eIF2a pathway can be part of the cellular stress responses such as oxidative stress, ER stress and hypoxia, or other chronic or prolonged biomechanical stress.
[0067] In one embodiment, said p-eIF2oc modulators such as ISRIB and Act2B and their analogs are capable of targeting eIF2oc phosphorylation. In another embodiment, p-eIF2oc modulators are molecules which are capable of targeting GADD34-Pplc or promoting the assembly of GADD34- Pplc. In yet another embodiment, p-eIF2oc modulators are molecules which are capable of modulating the expression of ATF4 and its potential downstream factors, such as Sox9.
[0068] In one embodiment of the present invention, the effective amount of p-eIF2oc modulator such as ISRIB to be given to a subject is 2.5 mg/kg to 20 mg/kg per day. In various embodiments, the effective amount of p-eIF2oc modulator is 0.05-0.1, 0.1-1, 1-5, 5-10, 10-20, 20-25, 25-50 or 50-100 mg/kg per day. In one embodiment, the subject is treated for 1 day or up to 365 days. In various embodiments, the subject is treated for 5, 10, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325 or 350 days.
[0069] In one embodiment, two or more p-eIF2oc pathway modulators are administered concurrently. In another embodiment where two or more p-eIF2oc pathway modulators are to be administered, the second or subsequent p-eIF2oc pathway modulators are administered immediately or a certain period after the administration of the previous p-eIF2oc pathway modulator.
ATF4-binding site on Sox9 locus and binding enhancers
[0070] In one embodiment, the present invention provides a method of inhibiting the ATF4/ISR mediated activation of transcription of murine .SY«9/human SOX9, thereby preventing, alleviating and/or treating fibrosis or fibrotic response in an organ or a tissue resulting from the overexpression of protein SOX9; the method comprises a step of contacting the cells with, or administering to a subject, a molecule that is capable of blocking the ATF4-binding site on the Sox9/SOX9 locus, or by interfering with molecules that modulate the ATF4-mediated transcription of Sox9//SOX9 (such as a molecule that enhances the binding between ATF4 and Sox9/SOX9 locus, i.e., an ATF4-binding enhancer).
[0071] Mouse Sox9 was found to be located at the boundary between two sub-TADs (topologically associated domains) on chromosome 11 (chrll :l l0760000-H4800000), represented by chr 11:111520000- 112200000 and chrll : ll3l60000-H4l60000 respectively (68, 63) (Fig 8A, lower panel). Binding sites for ATF4 in mouse embryonic fibroblasts have been reported (44). While in human genome, SOX9 was found to be located in a genomic locus at the boundary between two sub-TADs on chromosome 17 (chrl7:68055000-72l84000), represented by chrl7:68609000-69l 17000 and chrl7:705l4000-7l5l4000 respectively (63, 64) (Figure 7A, upper panel). The Sox9/SOX9 TAD pattern is conserved between human and mouse as indicated in Figures 7B and 7C.
[0072] The present invention has identified the putative binding site for ATF4 on the Sox9 locus in hypertrophic chondrocytes of mice - a region on chromosome 11 (loci: 112642927-112643074) which covers the promotor region of Sox9 (Figure 8). It is thus possible to inhibit the transcription of Sox9 by using molecules that interfere with the entirety or a part of the putative ATF4-binding site and thereby modulate conditions resulting from the overexpression of SOX9.
[0073] In one embodiment, the present invention provides a method of inhibiting the transcription of mouse Sox9 by using a molecule that blocks or interferes with one or more binding sites for ATF4 on the mouse Sox9 locus, thereby preventing, ameliorating and/or treating fibrosis or fibrotic response in an organ or a tissue. In one embodiment, said ATF4 binding site is located on mouse chromosome 11 (loci: 112642927-112643074) having the sequence TGTTGCAA (SEQ ID NO: 1). In another embodiment, said ATF4 binding site is located within the binding sites for ATF4 as reported in Flan:
GTCACCCAAACATTTGCTTCCAAAAGACCATTTCTAAGCACTTTTTTTGGAAGCCGGC AGACTCCAGGCGCAGAAGCCCAGCTCCGCTTTGACGAGCAGCTGTTGCAATTTCCA TTGCTGTAAACGCCAGCGAAGTCCCGGGTACCAC) (SEQ ID NO.: 2), the entire contents of which are incorporated herein by reference into this application (38).
[0074] In one embodiment, the present invention further provides a method of inhibiting the transcription of human SOX9 by using a molecule that blocks or interferes with one or more binding sites for ATF4 on the human SOX9 locus, thereby preventing, ameliorating and/or treating fibrosis or fibrotic response in an organ or a tissue. In various embodiments, said ATF4 binding site is located on human chromosome 17 (chr 17:68609000-71514000). In one embodiment, said ATF4 binding site is TGTTGCAA (SEQ ID NO.: 3) (33) which is the consensus sequence of ATF4 binding site on human SOX9 locus.
[0075] In various embodiments, various approaches including those described in Flan (40) are used to identify the functional binding sites of ATF4 on Sox9/SOX9 or other related ATF4 potential downstream factors. In one embodiment, ATF4-binding sites on Sox9/SOX9 or other related ATF4 potential downstream factors are mapped by the core Amino Acid Response Element (AARE) sequence TTgCaTCA (SEQ ID: 4), which is the complementary strand of SEQ ID NO.l.
[0076] In one embodiment, open chromatin regions in cells expressing Sox9/SOX9 upon induction of the ISR and/or ATF4 over-expression are identified via ATAC-seq (34). This method applies hyperactive Tn5 transposase, which inserts sequencing adapters into accessible regions of chromatin, to mark accessible regions of DNA, which are then sequenced. GFP (or other reporters) are inserted into 3’ untranslated region of mouse or human loci and targeted so as to provide a readout of SOX9 activity, or, alternatively, the cells derived from Sox9EGFP/+ mice are adopted (35). Cells are then subjected to ER stress, hypoxia or other stresses to induce ISR, or over-expression of ATF4 is induced.
[0077] Three biological replicates for ATAC-seq are generated to identify enhancers that are active and distinct to the Sox9+v7SOX9+vepopulation. Approximately 10,000 FACS sorted EGFP+ve and EGFP ve cells are isolated from Sox9EGEP/+ mice and library are prepared via NEBNext High Fidelity 2x PCR Master Mix. The amplified libraries are purified by AMPure beads, quantitated (KAPA biosystems) and sequenced at 10-15 million reads.
[0078] Filtered reads are aligned to the mouse and human reference genomes using Burrows- Wheeler Aligner (BWA) for mapping low-divergent sequences against a large reference genome and subjected to peak calling using MACS2. The regions with enrichment of transposition events indicating for open chromatin are identified. By comparing Sox9+ve/SOX9+ve specific enhancer profiles, it is able to distinguish and capture putative ISR induced and/or ATF4-associated enhancers: a) those for driving Sox9/SOX9 expression under normal non-stressed conditions; and b) those active when the ISR is induced and/or ATF4 is overexpressed. This approach allows prioritization of the putative enhancers, not only for functional validation but also for generation of a regulatory map of ISR- and/or ATF4-associated Sox9/SOX9 enhancers.
[0079] To overcome variability in expression due to position effects, regions in the mouse genome or human genome that are constitutively open and therefore not subject to position effects are used for assaying the enhancer activity (e.g. the TIGRE locus (36)). Reporter loci are targeted in cell lines and transgenic mice with a vector comprising a minimal promoter (such as hsp68 or the minimal SOX9 promoter which has no activity in cells/transgenic mice) linked by a 2A peptide sequence (37) to a fluorescence reporter (e.g. GFP, RFP, YFP etc.) or other reporters (e.g. luciferase).
[0080] In one embodiment, the enhancer interference assay is used for functional validation of enhancer elements by epigenome inhibition in vitro and in vivo, using a nuclease-deficient Cas9 (dCas9)-histone demethylase (38) fusion to inhibit the activity of candidate enhancer(s) by selectively altering the chromatin state of the target enhancer(s). Removal of H3K4mel/me2 modifications from specific active enhancer(s) using targeted catalytically inactive dead-Cas9 (dCas9) fused to the lysine-specific demethylase 1 (KDM1A/ESD1) results in‘inactivation’ of enhancer elements and down-regulation of gene expression from the associated loci. The transgene containing dCas9-ESDl is targeted using CRISPR-Cas9 (39), in which a guide RNA (gRNA) is specifically designed to direct ESD1 to the putative Sox9/SOX9 enhancer(s). In this way, the expression of ESD1 on targeted specific enhancer(s) silences the candidate enhancer(s) by demethylation of histone H3K4me2 and destruction of K27 acetylation (H3K27ac).
[0081] The targeted enhancer(s), resulting in loss of .VGA 9-dr ivcn EGFP expression when ISR is activated and/or when ATF4 is over expressed, are first identified in vitro. In vivo, the activities of identified ISR-inducible and or ATF4-inducible SOX9 enhancer(s) are assessed by: a) mutating the enhancer(s) in mice using CRISPR-Cas9; and b) targeting the enhancer(s) to the ISR reporter vector described above comprising a minimal hsp68 promoter, and testing for the enhancer’s ability to be activated upon ATF4 or ISR induction. The assessment is conducted in double transgenics bearing a mutated enhancer and a Sox9-driven reporter gene (e.g. Sox9-EGFP, YFP or RFP). Enhancers that are active and specific to Sox9 can then be identified by determining whether the ISR is triggered and/or ATF4 is over-expressed.
[0082] A total of 25 putative ATF4 binding enhancer regions were identified in the mouse Sox9- TAD domain (Table 1) by published ATF4 ChIP-seq (40), and Fig 8D demonstrates an example of putative ATF4 binding enhancer region of mSox9. Taken together, these findings strongly suggest that ISR-induced ATF4 may regulate the Sox9 expression by enhancers.
[0083] In one embodiment, the present invention provides a method of inhibiting the transcription of Sox9/SOX9 (such as murine Sox9/ Human SOX9 ) by using a molecule that blocks or interferes with one or more ATF4 binding enhancers which regulates the transcription of murine Sox9, said ATF4 binding enhancer comprises a sequence selected from the group consisting of SEQ ID NOs. : 5-29, thereby preventing, ameliorating and/or treating fibrosis or fibrotic response in an organ or a tissue.
[0084] In another embodiment, the present invention provides a method of inhibiting the transcription of human SOX9 by using a molecule that blocks or interferes with one or more ATF4 binding enhancers which regulate the transcription of human SOX9, thereby preventing, ameliorating and/or treating fibrosis or fibrotic response in an organ or tissue. To identify the putative ATF4 binding enhancer regions in the human SOX9-TAD domain, ATF4 ChIP-seq can be used in human fibroblasts, cancer cell lines, and any other cell lines where ISR induces SOX9 expression differentiated from human induced pluripotent stem cells such as chondrocytes. The cells are treated with an ER stress-inducer such as tunicamycin (41) to activate the preferential translation of ATF4, and three biological replicates for each cell type are generated. In one embodiment, said ATF4 binding enhancers are located within human chromosome 17 (chr 17:68609000-71514000) .
[0085] In various embodiments, the present invention provides a method of inhibiting the transcription of human SOX9 by using a molecule that blocks or interferes with one or more ATF4 binding enhancers which regulate the transcription of human SOX9, thereby preventing, ameliorating and/or treating fibrosis or fibrotic response in an organ or a tissue, said ATF4 binding enhancer comprises a sequence that could be similar/homologous to the murine sequence selected from the group consisting of SEQ ID Nos:. 5-29. In one embodiment, said ATF4 binding enhancer comprises a sequence corresponding to a sequence which is at least 70%, 75%, 80%, 85%, 90% or 95% homologous to the sequence selected from the group consisting of SEQ ID Nos. 5-29. In another embodiment, said ATF4 binding enhancer in human comprises a sequence corresponding to and showing high consensus to the murine sequence selected from the group consisting of SEQ ID Nos. 5-29. It is also possible that there will be human specific ATF4 binding enhancers not present in mouse. These will be detected by the ATAC-seq and ATF4 ChIP-seq approaches described above. Functional validation of the human enhancer activity will be tested by linking putative enhancer(s) to reporter (e.g. Fuciferase/fluorescent proteins) constructs and testing for their activation upon inducing the ISR in vitro (mouse or human cell-lines) and in vivo, using transgenic mice in which the ISR is induced, such as in 13del and/or SM/J.
Table 1. Putative ATF4 binding sites on murine Sox9 locus within Chromosome 11 in mice.
Figure imgf000026_0001
Discussion
[0086] In a transgenic mouse model displaying phenotypes reminiscent of congenital dwarfism [Metaphyseal chondrodysplasia, type Schmid (MCDS), MIM156500] and intervertebral disc changes consistent with early stages of human intervertebral disc degeneration (IDD), it has been shown that synthesis of misfolded collagen X in hypertrophic chondrocytes causes abnormal intracellular retention of secreted proteins and triggers the unfolded protein response (15). Specifically, it has been found that the PERK pathway, which controls protein translation via eIF2a phosphorylation and induction of the transcription factor ATF4, causes the hypertrophic chondrocyte differentiation defect in the growing long bones and spine. In one embodiment of the present invention, ISRIB, a selective modulator of phosphorylated-eukaryotic initiation factor (p- eIF2a) and eIF2B complex, is used to prevent and/or ameliorate the dwarfism and intervertebral disc degeneration caused by induction of the integrated stress response pathway.
[0087] As shown in Figure 1, activation of PERK signaling pathway leads to eIF2a phosphorylation, which represses the global protein translation but preferentially facilitates the translation of ATF4 transcripts via bypassing an inhibitory upstream open reading frame (uORF) (42). ATF4 can transactivate Chop and ATF3, and form a heterodimer with ATF3 to modulate the expression of target genes, such as GADD34. CHOP also acts upstream of GADD34, which encodes a regulatory subunit of the protein phosphatase complex that dephosphorylates p-eIF2a and restores protein translation. Thus ATF4, CHOP and GADD34 form a negative feedback loop to ensure transient attenuation of protein synthesis and later recovery of protein translation during ER stress response (42, 43).
[0088] The present invention discloses a novel approach in preventing or treating ISR-associated diseases, in particular to diseases where aberrant cell differentiation and over-synthesis and/or perturbed homeostasis of ECM proteins are the underlying cause.
[0089] In one embodiment, the present invention provides a use of a modulator of a phosphorylated eukaryotic initiation factor 2a (p-eIF2a) for the manufacture of a medicament for the prevention, amelioration and/or treatment of fibrosis caused by the activation of the integrated stress response (ISR) involving the p-eIF2oc pathway in an organ or tissue, wherein the modulator is represented by Formula I:
Figure imgf000027_0001
wherein each of Rl, R2, R3 and R4 is independently selected from a group consisting of hydrogen, halogen, -OCH3, -OCH2Ph, -C(0)Ph, -CH3, -CF3, -CCI3, -CN, -S(0)CH3, -OH, -NH2, -COOH, - CONH2, -NO2, -C(0)CH3, -CH(CH3)2, -CCSi(CH3)3, -CCH, -CH2CCH, -SH, SO3H, -S04H, -
SO2NH2, -NHNH2, -0NH2, -NHC=(0)NHNH2, -NHC=(0)NH2, -NHSO2H, -NHC=(0)H, - NHOH, -OCF3, -OCHF2, N3, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl; or Formula II:
Figure imgf000027_0002
wherein R1 is pyrrolopyrimidine, which may be unsubstituted or substituted with amino or alkyl; R2 is pyridyl, pyrrolyl or pyrazolyl, which may be unsubstituted or substituted with halogen, alkyl or trihaloalkyl; and R3 is hydrogen or halogen.
[0090] In one embodiment of the use described herein, an effective amount of the modulator is capable of one or more of the following: a) inhibiting the phosphorylation of eIF2oc;
b) promoting the de-phosphorylation of eIF2oc;
c) inhibiting the effect of phosphorylated-eIF2oc;
d) inhibiting the transcription or expression of Sox9/SOX9;
e) inhibiting the transcription or expression of Ddit3/Chop
f) inhibiting the activity, transcription or expression of ATF4; and
g) promoting the assembly of GADD34-Pplc.
[0091] In one embodiment of the use described herein, the organ or tissue is selected from the group consisting of lung, liver, heart, brain, kidney, bone, skin, pancreas, intervertebral disc, cartilage and connective tissues.
[0092] In one embodiment of the use described herein, the fibrosis is caused by an aberrant synthesis or accumulation of extracellular matrix (ECM) protein in the organ or tissue.
[0093] In one embodiment of the use described herein, the extracellular matrix (ECM) protein is synthesized by fibroblasts, myofibroblasts, or both.
[0094] In one embodiment of the use described herein, the modulator is selected from the following:
Figure imgf000028_0001
[0095] In one embodiment of the use described herein, the modulator is selected from the following
Figure imgf000029_0001
[0096] In one embodiment of the use described herein, the effective amount of the modulator is 0.1 mg/kg to 50 mg/kg per day.
[0097] In one embodiment, the present invention provides a method of preventing and/or ameliorating aberrant synthesis or accumulation of extracellular matrix (ECM) protein in an organ or tissue of a subject, the method comprises a step of administering to the subject an effective amount of a molecule that is capable of inhibiting the p-eIF2oc pathway.
[0098] In one embodiment of the method described herein, the molecule is a small molecule represented by Formula I:
Figure imgf000029_0002
wherein each of Rl , R2, R3 and R4 is independently selected from a group consisting of hydrogen, halogen, -OCH3, -OCH2Ph, -C(0)Ph, -CH3, -CF3, -CCb, -CN, -S(0)CH3, -OH, -NH2, -COOH, - CONH2, -N02, -C(0)CH3, -CH(CH3)2, -CCSi(CH3)3, -CCH, -CH2CCH, -SH, SO3H, -S04H, - SO2NH2, -NHNH2, -ONH2, -NHC=(0)NHNH2, -NHC=(0)NH2, -NHS02H, -NHC=(0)H, - NHOH, -OCF3, -OCHF2, N3, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl; or Formula II:
Figure imgf000029_0003
wherein R1 is pyrrolopyrimidine, which may be unsubstituted or substituted with amino or alkyl; R2 is pyridyl, pyrrolyl or pyrazolyl, which may be unsubstituted or substituted with halogen, alkyl or trihaloalkyl; and R3 is hydrogen or halogen.
[0099] In one embodiment of the method described herein, the molecule is capable of inhibiting the ectopic expression of Chop, Sox9/SOX9 and/or ATF4.
[0100] In one embodiment of the method described herein, the molecule is capable of inhibiting the binding between ATF4 and a transcriptional regulatory element of mouse/human Sox9/SOX9. [0101] In one embodiment of the method described herein, the transcriptional regulatory element of Sox9/SOX9 comprises the nucleic acid sequence selected from the group consisting of SEQ ID NOs.: 1-3.
[0102] In one embodiment of the method described herein, the transcriptional regulatory element of Sox9/SOX9 is a stress-induced or ATF-induced enhancer that regulates the transcription of Sox9/SOX9, the enhancer comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs.: 5-29, or a nucleic acid sequence which is at least 80% homologous to the nucleic acid sequence selected from the group consisting of SEQ ID NOs.: 5-29.
[0103] In one embodiment of the method described herein, the aberrant synthesis or accumulation of extracellular matrix (ECM) protein is caused by an aberrant cell differentiation in a population of cells caused by the activation of integrated stress response (ISR).
[0104] In one embodiment of the method described herein, the population of cells comprises cells that can be differentiated to fibroblasts, myofibroblasts, or both.
[0105] In one embodiment of the method described herein, the present invention provides a method of modulating the level of one or more fibrotic factors in an organ or tissue of a subject, wherein the fibrotic factors are indicative of the presence or progress of fibrosis, the method comprises a step of administering to the subject an effective amount of a p-eIF2oc modulator.
[0106] In one embodiment of the method described herein, the fibrotic factor is selected from the group consisting of fibrillar collagen type I, II, III, V and XI, fibronectin ED-A and ED-B, elastin, non-fibrillar collagen type IV, VI, VII, VIII and XIV, fibrillin 1-3, LTBP 1-4, tenascin C (R, W and X), Hyaluronan form HA, versican V0-V3, syndecan 1-4, fibulin 1-7, biglycan, lumican, fibromodulin, dermatopontin, decorin, CCN1-6, periostin, osteopontin, osteonectin, SPARC, alpha smooth muscle actin, fibroblast activation protein alpha, fibroblast specific protein 1 and transforming growth factor b.
[0107] In one embodiment of the method described herein, the fibrotic factor is selected from the group consisting of lysyl oxidase, LOX-like 1-4, LH 1-3, transglutaminase 1-7, matrix metalloprotease 1-3, 7- 17, 19-21 and 23-28, tissue inhibitor of matrix metalloproteinase 1-4 and plasmin-activation inhibitor uPA, tPA, PAI-l and PAI-2.
[0108] In one embodiment, the present invention provides a method of preventing, ameliorating and/or treating fibrosis caused by the activation of the integrated stress response (ISR) involving the phosphorylated eukaryotic initiation factor 2a (p-eIF2a) signaling pathway in an organ or tissue of a subject, the method comprises a step of administering to the subject an effective amount of a p-eIF2a modulator.
[0109] In one embodiment of the method described herein, an effective amount of the p-eIF2a modulator is capable of one or more of the following:
a) inhibiting the phosphorylation of eIF2oc;
b) promoting the de -phosphorylation of eIF2oc;
c) inhibiting the effect of phosphorylated-eIF2oc;
d) inhibiting the transcription or expression of Ddit3/Chop
e) inhibiting the transcription or expression of Sox9/SOX9;
f) inhibiting the activity, transcription or expression of ATF4; and
g) promoting the assembly of GADD34-Pplc.
[0110] In one embodiment of the method described herein, the organ or tissue is selected from the group consisting of lung, liver, heart, brain, kidney, bone, skin, pancreas, intervertebral disc, cartilage and connective tissues.
[0111] In one embodiment of the method described herein, the fibrosis is caused by an aberrant synthesis or accumulation of extracellular matrix (ECM) protein in the organ or tissue.
[0112] In one embodiment of the method described herein, the extracellular matrix (ECM) protein is synthesized by fibroblasts, myofibroblasts, or both.
[0113] In one embodiment of the method described herein, the p-eIF2oc modulator is represented by Formula I:
Figure imgf000031_0001
wherein each of R1 , R2, R3 and R4 is independently selected from a group consisting of hydrogen, halogen, -OCH , -OCH2Ph, -C(0)Ph, -CH , -CF , -CC13, -CN, -S(0)CH , -OH, -NH2, -COOH, -
CONH2, -NO2, -C(0)CH3, -CH(CH3)2, -CCSi(CH ) , -CCH, -CH2CCH, -SH, S03H, -S04H, - SO2NH2, -NHNH2, -ONH2, -NHC=(0)NHNH2, -NHC=(0)NH2, -NHSO2H, -NHC=(0)H, - NHOH, -OCF3, -OCHF2, N3, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl; or Formula II:
Figure imgf000031_0002
wherein R1 is pyrrolopyrimidine, which may be unsubstituted or substituted with amino or alkyl; R2 is pyridyl, pyrrolyl or pyrazolyl, which may be unsubstituted or substituted with halogen, alkyl or trihaloalkyl; and R3 is hydrogen or halogen.
[0114] In one embodiment of the method described herein, the effective amount of the p-eIF2oc modulator is 0.1 mg/kg to 50 mg/kg per day.
[0115] In one embodiment, the present invention provides a method of screening a candidate molecule for the ability to modulate fibrosis associated with integrated stress response (ISR) involving the p-eIF2oc pathway, the method comprises the steps of
a) administering said candidate molecule to a fibrotic mouse model; and
b) measuring one or more of fibrotic factors in the mouse treated with said candidate molecule:
wherein changes in said one or more of fibrotic factors in the presence of said candidate molecule as compared to a control molecule indicate that said candidate molecule is capable of modulating fibrosis associated with ISR involving the p-eIF2oc pathway.
[0116] In one embodiment of the method described herein, the the fibrotic mouse model is a transgenic mouse carrying a Sox9 gene which is conditionally knockout.
[0117] In one embodiment of the method described herein, the fibrotic mouse model is a transgenic mouse carrying a Ddit3 gene which is conditionally knockout, or carrying no Ddit3 gene.
[0118] In one embodiment of the method described herein, the fibrotic factors are selected from the group consisting of fibrillar collagen type I, II, III, V and XI, fibronectin ED- A and ED-B, elastin, non-fibrillar collagen type IV, VI, VII, VIII and XIV, fibrillin 1-3, LTBP 1-4, tenascin C (R, W and X), Hyaluronan form HA, versican V0-V3, syndecan 1-4, fibulin 1-7, biglycan, lumican, fibromodulin, dermatopontin, decorin, CCN1-6, periostin, osteopontin, osteonectin, SPARC, alpha smooth muscle actin, fibroblast activation protein alpha, fibroblast specific protein 1, transforming growth factor b, lysyl oxidase, LOX-like 1-4, LH 1-3, transglutaminase 1-7, matrix metalloprotease 1-3, 7- 17, 19-21 and 23-28, tissue inhibitor of matrix metalloproteinase 1-4 and plasmin-activation inhibitor uPA, tPA, PAI- 1 and PAI-2 .
[0119] This invention will be better understood by reference to the examples which follow. However, one skilled in the art will readily appreciate that the examples provided are merely for illustrative purposes and are not meant to limit the scope of the invention which is defined by the claims following thereafter.
[0120] Throughout this application, it is to be noted that the transitional term“comprising”, which is synonymous with“including”,“containing” or“characterized by”, is inclusive or open-ended, and does not exclude additional, un-recited elements or method steps.
Materials and Methods
Mice breeding
[0121] The l3del transgenic mice were maintained in Fl (C57BL/6 x CBA) background. The Chop-null mice and Fgf2l-null mice were reported previously (43, 44). Animal care and experiments performed were in accordance with the protocols approved by the Committee on the Use of Live Animals in Teaching and Research of the University of Hong Kong.
Histological and immunofluorescence analyses
[0122] Limbs were fixed in 4% PFA, follwed by demineralization in 0.5M EDTA (pH 8.0) prior to embedding in paraffin. Slides were stained with Alcian Blue for cartilage matrix and Fast Red for nuclei. Immunofluorescence was performed using antibodies against ATF4 (sc-200, Santa Cruz), ATF3 (HPA001562, Sigma), CHOP (sc-575, Santa Cruz), GADD34 (sc-825, Santa Cruz), FGF21 (42189, AIS) and Sox9 (AB5535, Millipore).
FAST Staining
[0123] FAST staining refers to a multidye staining procedure using fast green, Alcian blue, Safranin-O, and tartrazine and was performed as described previously (45).
In-Situ hybridization
[0124] In-situ hybridization was performed as previously described (46), using [35S]UTP-labeled ribopobes for ColIOuI . Col2a I , Bip, 13del(15), Ihh (from A. McMahon), Sox9 (47) and the PTHrP receptor (Ppr) (from H. Kronenberg). The probes for Atf4, Atf3, Chop, Eroll and Fgf21 were mouse cDNA fragments, generated by RT-PCR from growth plate total RNA. The primers used are as follows: Atf4, 5’- GAGGTGGCCAAGCACTTGAAA (SEQ ID NO: 32) and 5’- GAACCACCTGGAGAAGGCAGATT (SEQ ID NO: 33); Atf3, 5’-
GCTTCCCCAGTGGAGCCAAT (SEQ ID NO: 34) and 5’- CCACCTCTGCTTAGCTCTGCAAT (SEQ ID NO: 35); Chop, 5’- ATGAGGATCTGCAGGAGGTCCTGTC (SEQ ID NO: 36) and 5’- GATGCCC ACT GTT C ATGCTTGGT (SEQ ID NO: 37); Eroll, 5’-
A AGACTAC A AA AGCTT CTTG (SEQ ID NO: 38) and 5’ -AAGAATTCTCATCGAAGTGCAA (SEQ ID NO: 39); and Fgf21, 5’- CAGGGGTCATTCAAATCCTG (SEQ ID NO: 40) and 5’- AGGAATCCTGCTTGGTCTTG (SEQ ID NO: 41).
TUNEL assay
[0125] Apoptotic cells in the growth plate of examined animals were detected by in situ terminal deoxynucleotidyltransferase deoxyuridine triphosphate nick end labeling (TUNEL) assay using the In Situ Cell Death Detection Kit (Roche) following the manufacturer’s instructions.
TSRTB treatments
[0126] ISRIB (SML0843, Sigma) was dissolved in DMSO to make a 5 mg/ml stock and stored at 4°C. Animals were intraperitoneally injected with ISRIB (48, 49) (2.5 mg/kg, diluted in 0.9% saline) or vehicle (5% DMSO in saline) from E13.5 to p20. Animals were collected at plO and p20 for further analysis.
Radiography of mouse skeleton
[0127] Mice were anesthetized before radiography. Radiography was performed using digital Faxitron system (UltraFocus) at 20 kVA with 5 second exposure.
Statistical analyses
[0128] No statistical methods were used to predetermine sample size. Statistical analyses used are detailed in the figure legends. Unpaired two tailed Student’s t-test was used to establish statistical significance. For growth analysis, two tailed Mann-Whitney 17-test was used. P < 0.05 was considered statistically significant.
Induction of mouse tail disc degeneration
[0129] To investigate the fate of notochord descendent cells in disc degeneration, annulus puncture was performed in the tail discs of Foxa2mNE-Cre; 7/EG double transgenic mice. Briefly, 3-month- old mice, regardless of the gender, were anesthetized by intraperitoneal injection of Hypnorm and Dormicum at 1 ml/kg of body weight and the caudal disc levels were identified by X-ray (Model 43 855a; Faxitron Corp, IL, USA). The tail skin was incised longitudinally and the C5/6 and C7/8 levels were punctured by inserting a 30G needle bevel into the dorsal annulus at 1 mm depth (BD biosciences) perpendicular to middle of the disc under the guidance of surgical microscope (Wild M691, Switzerland). The C6/7 level was left untreated as control. The mice were allowed to recover and have free activity in cage. At 3 days, 4 weeks, and 12 months after puncture, the operated animals were subjected to X-ray for disc height measurement. At endpoints, the animals were euthanized and the spine was decalcified by EDTA and embedded in paraffin for histological analysis.
Dual-Luciferase Reporter Assay
[0130] Luciferase assays were conducted using a dual luciferase reporter assay kit (Promega), according to the manufacturer’s protocol. Different promoter fragments of Sox9 were cloned into a pGL3 -basic vector (Promega) to drive the expression of firefly luciferase. ATDC5 cells were plated at 2xl04 cells/well in 24-well plates. After l8-hours incubation, the cells were transfected with tested constructs with Renilla luciferase vector, which served as an internal control. Data presented are ratios of Luc/Renilla activity from at least three different experiments, and each experiment was performed in triplicate for each DNA sample.
Study using fibrotic mouse model
[0131] The etiological role of Sox9 and CHOP, as a downstream consequence of the preferential translation of ATF4 under the ISR, in fibrosis (e.g. disc- and renal fibrosis) is further investigated using typical fibrotic mouse model where Sox9 or Chop has been or can be conditionally knockout. The mouse models are prepared by crossing Sox9-flox mice (with tissue-specific Cre ) or Chop- null mice to l3del mice or mouse models where fibrosis is induced such as mouse models of kidney fibrosis (e.g. Lupus-prone/diabetic mice); mouse models of experimental induced liver fibrosis (e.g. chemical induced fibrosis); mouse models of lung fibrosis; mouse models of cardiac hypertrophy/ myocardial infarction associated fibrosis (66) or SM/J mice (68), and are used for screening candidate molecules for their effect on fibrosis.
Results
ATF4 directly activates Sox9
[0132] The present invention searched published ER stress-associated ATF4 ChIP-Seq data (40) for binding peaks in transcription factor genes, including members of SOX, RUNX, MEF2, GLI and FOXA families, and found ATF4 binding peaks in regulatory regions of Sox9, Sox5, Sox6, Runx2, GU2 and GU3, suggesting that the Sox family could be the regulatory targets of ATF4.
[0133] Transcription factor SOX9 is highly expressed in immature chondrocytes, transactivates critical cartilaginous matrix genes and regulates chondrocyte proliferation, differentiation and hypertrophy (50-54). It is required for the expression of SOX5 and SOX6, which cooperate with SOX9 to transactivate Col2al (54). Two putative C/EBP-ATF4 motifs, named Al and A2, were identified in the Sox9 promoter region covering the ATF4 binding peak.
[0134] By transfection assays in ATDC5 chondrocyte cells, the present invention found that ATF4 could transactivate luciferase reporters controlled by putative ATF4-binding motif-in Sox9 promoter region (Figure 9A). Mutation of Al and A2 respectively reduced or abolished ATF4 activation of the Sox9 reporters. Anti-ATF4 ChIP-PCR assays, using nuclear extracts from E15.5 wild-type and C10-ATF4 limbs, demonstrated that ATF4 binds directly to the putative motifs region on the Sox9 promoter in vivo (Figure 9B).
Figure imgf000035_0001
[0135] In the unfolded protein response (UPR), PERK phosphorylation of serine 51 in eIF2oc is the critical upstream controlling point that triggers the p-eIF2oc/ATF4/CHOP signaling pathway (18). The present data shows that genetically ablating key transcription factors in the PERK signaling as a strategy for rescuing the aberrant chondrocyte differentiation is imperfect because of its effects on cell survival. In addition, addressing the effects of transcription factor over expression and cell-type specificity is required because ATF4 is essential for normal development. Therefore, it is necessary to identify a suitable entry point in the pathway which can be manipulated for protection or rescue from the effects of ER stress without interfering with normal developmental function.
[0136] Small molecules targeting ISR signaling pathway have been reported. Recently, a small molecule, Integrated Stress Response InhiBitor (ISRIB) has been reported to render cells insensitive to eIF2oc phosphorylation by targeting the interaction between eIF2 and eIF2B, and its activity is independent of eIF2a phosphorylation (55, 56). ISRIB shows acceptable pharmacokinetic properties and no overall toxicity in mice, and has been reported to show significant neurotrophic effects in mice (55, 57).
[0137] The potential of ISRIB to modify the chondrodysplasia phenotype has been tested by treating l3del and wild- type littermates with ISRIB or vehicle twice daily by intraperitoneal injection from E13.5 (onset of expression of 13del transgene) to postnatal day 20 (p20) (Figure 2A). In wild-type mice, ISRIB had no adverse effects on weight gain or body growth (Figures 2B and 2C). However, ISRIB markedly reduced the dwarfism of l3del mice from new born to juvenile stages (Figure 2D). Radiographic analyses revealed that treatment with ISRIB ameliorated the skeletal deformities at p20 (Figures 2E and 2F), including the length of tibia/femur and spine; tibia bowing ( genu varum: the angle between proximal head and distal head of tibia); pelvic bone orientation (the angle between ilium and pubis), and coxa vara (narrowed angle between the proximal head and the shaft of the femur) (Figure 2E).
[0138] Moreover, it was found that the HZ expansion in the limb growth plates of ISRIB -treated l3del mice was greatly reduced and the number of Sox9 A Col2a!+ and Ppr+ cells in the HZ at plO and p20 was diminished (Figures 2G-2J). ISRIB had no observable effect on the limb growth plates in wild-type mice (Figure 2K). ISRIB treatment in l3del mice also reduced the deformities in other growth plates, such as the axial skeleton, with reduced HZ expansion and decreased number of Sox9+ and Col2a!+ premature cells in tail intervertebral disc growth plates (Figures 2F-2N). As expected, ISRIB specifically reduced the amount of ATF4 and CHOP protein, and inhibited p- eIF2oc/ATF4/CHOP signaling transduction, marked by the down-regulation of the transcripts as well as the protein level of their downstream targets (ATF3, EROll and FGF21) (Figures 20 and 2P). Importantly, inhibition of p-eIF2oc/ATF4/CHOP by ISRIB did not induce apoptosis (Figure 2Q) in l3del HC. Thus, without any obvious adverse effect, ISRIB corrected the molecular, histological, and skeletal defects in l3del mice.
Intervertebral disc degeneration ( IDD ) and ISR in MCDS mice
[0139] It is noted that some cases of MCDS display spinal abnormalities including abnormalities in vertebral bodies and end plate irregularities (59). S. Ikegawa at the Center for Integrative Medical Sciences, RIKEN, Tokyo, has examined the MRI of the spine of a 20-year-old male MCDS patient and found evidence for signal intensity loss (“dark disc”) and irregularities in the end plate (Figure 3A) consistent with the notion that endplate irregularities are associated with IDD (60).
[0140] The expanded and irregular endplates was observed in l3del mice at early plO and p20 stage (Figures 2F-2N). Concomitantly, the nucleus pulposus (NP) were swollen in appearance and there were irregularities in the inner AF (iAF) and endplate boundaries, with chondrocyte-like cells present at NP-AF and endplate boundaries (Figure 3B). As a consequence, the tail intervertebral disc (IVD) of 13del mice exhibited significant characteristics of disc degeneration at adult stages (Figure 3C), including altered NP structure and matrix, loss of NP/AF boundary, disc bulging, widening of the AF interlamellar space and the inward bulging of AF lamellae and consequently fissure (Figure 3D). Interestingly, excessive cell death was observed in l3del degenerated disc at l6-month stage, consistent with human IDD studies (61) (Figure 3E). It is notable that volume of vascular canals in subchondral region between spinal growth plate and endplate significantly decreased in l3del disc (Figure 3D), indicating that the importation of oxygen and/or nutrition from endplate to NP and exportation of metabolites from NP to endplate might be lowered, consequently inducing integrated stress response. Consistently, the transcriptional and translational upregulation of BIP, the essential ER stress sensor, was observed in core region of l3del degenerated NP (Figure 3F). Notably, the upregulation of p-eIF2oc was observed in degenerated l3del tail IVD (Figure 3G), but not in lumbar discs (Figure 3H). Concomitantly, the protein level of ATF4 was upregulate, while the transcriptional expression level of ATF4 was not changed (Figure 31). Strikingly, ATF5, the key sensor and signal transducer of mitochondria- related oxidative stress was also significantly upregulated in 13del degenerated NP (Figure 3J). Taken together, these data strongly suggest the induction of multiple stresses in 13del NP.
[0141] Interestingly, the elevated stress response in 13del NP was accompanied by significant cell fate change as implied by the ectopic expression of Sox9 (Figure 3K). On the other hand, disrupted matrix deposition in NP could be an important characteristic of degenerative changes. In 13del lumbar NP, the ectopic upregulation of Opn was observed from plO to 16-month stages (Figure 3L). Moreover, the WT peripheral NP cells were found to be oc-SMA+ at young age (4-month), but were absent at 6-month (Figure 3M). However, in 13del degenerated NP, the peripheral NP cells persistently expressed oc-SMA at 6-month stage and ectopic expression of this factor in core region of NP was also observed (Figure 3M).
[0142] These findings suggest 13del mice could be used to model fibrotic changes in the IVD from activation of ISR in NP.
ISRIB prevents the molecular chanees in the 13del IVD
[0143] As mentioned above, ISRIB treatment in 13del mice reduced the deformities in growth plates of axial skeleton, with reduced HZ expansion and decreased number of Sox9+ and Co 12a O premature cells in tail intervertebral disc growth plates (Figures 2L-2N). In addition, after 20-days of ISRIB treatment, the iAF was more regular in ISRIB-treated 13del mice, with fewer chondrocyte-like cells present (Figure 4A).
[0144] Disrupted matrix deposition in NP could be an important characteristic of degenerative changes. In 13del lumbar NP, the ectopic upregulation of Opn was observed at plO, p20 and 16- month stages (Figures 4B and 3L). Strikingly, 20-days treatment of ISRIB greatly reduced the ectopic NP expression of Opn (Figure 4B), which may prevent the consequent NP degeneration in later stage.
[0145] Multiple stresses can activate the integrated stress response in which ATF4 directly transactivates another important transcription factor ATF3. In l3del lumbar IVD, ATF3 is significantly activated not only in HCs in the growth plate and endplate, but also in the NP (Figure 4C). This finding strongly suggests the correlation between spine alignment and the onset of IDD. After the ISRIB treatment, no Atf3+ cell can be detected in L3-L6 NP, nor growth plates or endplates (Figure 4C).
Fibrotic changes and disc deeeneration in murine injury model
[0146] The annulus puncturing protocol was used to induce disc degeneration in mouse tail discs. The tail disc degeneration was observed after 2 weeks post puncturing and demonstrated that notochord descendants become fibroblasts and myofibroblasts by expressing alpha smooth muscle actin (oc-SMA), fibroblast activation protein alpha (FAP-a) and Fibroblast-specific protein 1 (FSP- 1) markers with their levels increasing from 4 weeks to 12 weeks post puncturing (Figures 5A- 5B). The present model could be used to study injury-induced fibrotic changes and subsequent disc degeneration in the IVD from activation of ISR in NP.
Fibrotic changes in a mouse model of natural early onset of disc degeneration
[0147] In human IDD, the NP becomes fibrotic with chondrocyte-like cells (CLCs) replacing notochordal like cells (NCLs). There is also a gradual decrease in cellularity and appearance of cell clusters (67). In contrast, NCLs persist in animals that are more resistant to IDD. A recent paper described two mouse models (SM/J, LG/J) with different healing capacity (68). SM/J mice, a natural strain of mice exhibiting early onset IDD, showed early onset disc degeneration with chondrogenic events, progressive fibrotic and extracellular matrix to (Figure 10A). Safranin- O/Fast-Green staining and an IVD scoring system specific for mice (69) were applied to evaluate the histological changes of the NP and AF. The number of NCLs decreased with increased severity of IDD. In contrast, LG/J mice with good healing capacity maintained a relatively constant pool of NCLs in the NP in the first few months of life. To determine the underlying mechanism of early onset IDD, whether the ISR was activated in the NP of SM/J mice through the expression of Atf4 and Ddit3/Chop was tested. Strikingly, Atf4' and Ddit3/Chop were highly upregulated in the NP of SM/J mice while absent in the LG/J mice (Figure 10B). Consistent with the morphological changes, marker analysis using chondrogenic genes showed cells in the NP of SM/J mice becoming more chondrocyte -like. At 4-week-old, the expression of Sox9 and downstream target Col2al was upregulated in the NP of SM/J mice while the expression in the NP of LG/J mice was relatively low compared to the surrounding cartilaginous endplates, the growth plates and the inner AF (Figure 10C). These results indicated that fibrotic changes present in a natural strain of mice with early onset IDD are associated with the activation of ISR.
ISR in renal fibrosis
[0148] Lupus nephritis is a potentially reversible cause of severe acute kidney injury and is an important cause of end-stage renal failure in Asians and patients of African or Hispanic descent. It is characterized by aberrant exaggerated innate and adaptive immune responses, autoantibody production and their deposition in the kidney parenchyma, triggering complement activation, activation and proliferation of resident renal cells, and expression of pro-inflammatory and chemotactic molecules leading to the influx of inflammatory cells, all of which culminate in the destruction of normal nephrons and their replacement by fibrous tissue. Anti-double-stranded DNA (anti-dsDNA) antibody level correlates with disease activity in most patients. There is evidence that apart from mediating pathogenic processes through the formation of immune complexes, pathogenic anti-dsDNA antibodies can bind to resident renal cells and induce downstream pro- apoptotic, pro-inflammatory, or pro-fibrotic processes or a combination of these. Recent data also highlight the critical role of macrophages in acute and chronic kidney injury. Though clinically effective, current treatments for lupus nephritis encompass non-specific immunosuppression and the anti-inflammatory action of high-dose corticosteroids. The clinical and histological impact of novel biologies targeting pro-inflammatory molecules remains to be investigated. Insight into the underlying mechanisms that induce fibrotic processes in the kidney affected by lupus nephritis could present opportunities for more specific novel treatment options to improve clinical outcomes while minimizing off-target unwanted effects. Given the fact that ISR was triggered in various renal fibrosis conditions (including lupus nephritis) (Figure 6B) accompanied by the activation of SOX9, the lupus-prone mice will be a suitable model for understanding the role of ISR in kidney fibrosis, as well as for drug testing via targeting ISR.
ISR in other mouse models of fibrosis
[0149] In addition to lupus nephritis, mouse models of fibrosis associated with diabetic nephropathy may be used. Fibrosis may also be induced in other tissues such as liver, lung, cardiac, skin and so on (64).
References:
1. C. O. Brostrom, C. R. Prostko, R. J. Kaufman, M. A. Brostrom, Inhibition of Translational Initiation by Activators of the Glucose -regulated Stress Protein and Heat Shock Protein Stress Response Systems: ROLE OF THE INTERFERON-INDUCIBLE DOUBLE- STRANDED RNA-ACTIVATED EUKARYOTIC INITIATION FACTOR 2a KINASE. Journal of Biological Chemistry 271, 24995-25002 (1996).
2. T. E. Dever et al, Phosphorylation of initiation factor 2 alpha by protein kinase GCN2 mediates gene - specific translational control of GCN4 in yeast. Cell 68, 585-596.
3. H. P. Harding et al. , An Integrated Stress Response Regulates Amino Acid Metabolism and Resistance to Oxidative Stress. Molecular Cell 11, 619-633. 4. D. Ron, Translational control in the endoplasmic reticulum stress response. The Journal of Clinical Investigation 110, 1383-1388 (2002).
5. R. C. Wek, H. Y. Jiang, T. G. Anthony, Coping with stress: eIF2 kinases and translational control. Biochemical Society Transactions 34, 7 (2006).
6. M. A. Garcia, E. F. Meurs, M. Esteban, The dsRNA protein kinase PKR: Virus and cell control. Biochimie 89, 799-811 (2007).
7. T. Rzymski et al, Regulation of autophagy by ATF4 in response to severe hypoxia.
Oncogene 29, 4424 (2010).
8. J. Ye et al. , The GCN2 - ATF4 pathway is critical for tumour cell survival and proliferation in response to nutrient deprivation. The EMBO Journal 29, 2082 (2010).
9. H. R Harding, Y. Zhang, D. Ron, Protein translation and folding are coupled by an endoplasmic-reticulum-resident kinase. Nature 397, 271 (1999).
10. C. Denoyelle et al, Anti-oncogenic role of the endoplasmic reticulum differentially activated by mutations in the MAPK pathway. Nature Cell Biology 8, 1053 (2006).
11. L. S. Hart et al, ER stress-mediated autophagy promotes Myc-dependent transformation and tumor growth. The Journal of Clinical Investigation 122, 4621-4634 (2012).
12. A. P Han et al, Heme - regulated eIF2a kinase (HRI) is required for translational regulation and survival of erythroid precursors in iron deficiency. The EMBO Journal 20, 6909 (2001).
13. T. S. Lisse et al, ER stress-mediated apoptosis in a new mouse model of osteogenesis imperfecta. PLoS genetics 4, e7 (2008).
14. K. Y. Tsang, D. Chan, J. F. Bateman, K. S. Cheah, In vivo cellular adaptation to ER stress: survival strategies with double-edged consequences. Journal of cell science 123, 2145- 2154 (2010).
15. K. Y. Tsang et al. , Surviving endoplasmic reticulum stress is coupled to altered chondrocyte differentiation and function. PLoS Biol 5, e44 (2007).
16. C. Hetz, E. Che vet, H. R Harding, Targeting the unfolded protein response in disease. Nat Rev Drug Discov 12, 703-719 (2013).
17. D. T. Rutkowski, R. S. Hegde, Regulation of basal cellular physiology by the homeostatic unfolded protein response. (2010).
18. K. Pakos-Zebrucka et al, The integrated stress response. EMBO reports 17, 1374-1395 (2016).
19. C.-Q. Zhao, Y.-H. Zhang, S.-D. Jiang, L.-S. Jiang, L.-Y. Dai, Both endoplasmic reticulum and mitochondria are involved in disc cell apoptosis and intervertebral disc degeneration in rats. Age 32, 161-177 (2010).
20. D. Xu et al, Hydrogen sulfide protects against endoplasmic reticulum stress and mitochondrial injury in nucleus pulposus cells and ameliorates intervertebral disc degeneration. Pharmacological Research 117, 357-369 (2017).
21. A. Jo et al. , The versatile functions of Sox9 in development, stem cells, and human diseases.
Genes & Diseases 1, 149-161 (2014).
22. J. Pritchett, V. Athwal, N. Roberts, N. A. Hanley, K. P Hanley, Understanding the role of SOX9 in acquired diseases: lessons from development. Trends Mol Med 17, 166-174 (2011).
23. Y. Y. Ho, D. Lagares, A. M. Tager, M. Kapoor, Fibrosis [mdash] a lethal component of systemic sclerosis. Nat Rev Rheumatol 10, 390-402 (2014).
24. P Cheresh, S.-J. Kim, S. Tulasiram, D. W. Kamp, Oxidative Stress and Pulmonary Fibrosis.
Biochimica et biophysica acta 1832, 1028-1040 (2013).
25. R. M. Liu, K. A. Gaston Pravia, Oxidative stress and glutathione in TGF- -mediated fibrogenesis. Free Radical Biology and Medicine 48, 1-15 (2010).
26. I. Cucoranu et al, NAD(P)H Oxidase 4 Mediates Transforming Growth Factor-b!- Induced Differentiation of Cardiac Fibroblasts Into Myofibroblasts. Circulation Research 97, 900 (2005). 27. A. K. Ghosh, D. E. Vaughan, PAI-l in Tissue Fibrosis. Journal of cellular physiology 227, 493-507 (2012).
28. T. A. Wynn, Cellular and molecular mechanisms of fibrosis. The Journal of pathology 214,
199-210 (2008).
29. V. S. Athwal et al, SOX9 predicts progression toward cirrhosis in patients while its loss protects against liver fibrosis. EMBO Molecular Medicine 9, 1696-1710 (2017).
30. H. M. Kang et al, Sox9-Positive Progenitor Cells Play a Key Role in Renal Tubule Epithelial Regeneration in Mice. Cell Reports 14, 861-871 (2016).
31. H. Li et al, TGF- -mediated upregulation of Sox9 in fibroblast promotes renal fibrosis.
Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease 1864, 520-532 (2018).
32. G. P. A. Lacraz et al, Tomo-Seq Identifies SOX9 as a Key Regulator of Cardiac Fibrosis During Ischemic Injury. Circulation 136, 1396 (2017).
33. Stela S. Palii, Michelle M. Thiaville, Y.-X. Pan, C. Zhong, Michael S. Kilberg, Characterization of the amino acid response element within the human sodium-coupled neutral amino acid transporter 2 (SNAT2) System A transporter gene. Biochemical Journal 395, 517-527 (2006).
34. J. Buenrostro, B. Wu, H. Chang, W. Greenleaf, ATAC-seq: A Method for Assaying Chromatin Accessibility Genome -Wide. Current protocols in molecular biology / edited by Frederick M. Ausubel ... [et al.] 109, 21.29.21-21.29.29 (2015).
35. L. Nel-Themaat et al. , Morphometric analysis of testis cord formation in Sox9-EGFP mice.
Developmental Dynamics 238, 1100-1110 (2009).
36. L. Madisen et al, Transgenic mice for intersectional targeting of neural sensors and effectors with high specificity and performance. Neuron 85, 942-958 (2015).
37. E. Provost, J. Rhee, S. D. Leach, Viral 2A peptides allow expression of multiple proteins from a single ORF in transgenic zebrafish embryos genesis 45, 625-629 (2007).
38. N. A. Kearns et al, Functional annotation of native enhancers with a Cas9-histone demethylase fusion. NatMeth 12, 401-403 (2015).
39. L. Cong et al, Multiplex Genome Engineering Using CRISPR/Cas Systems. Science ( New York, N Y.) 339, 819-823 (2013).
40. J. Han et al, ER-stress-induced transcriptional regulation increases protein synthesis leading to cell death. Nat Cell Biol 15, 481-490 (2013).
41. C. M. Oslowski, F. Urano, Measuring ER stress and the unfolded protein response using mammalian tissue culture system. Methods in enzymology 490, 71-92 (2011).
42. H. P. Harding et al. , Regulated translation initiation controls stress-induced gene expression in mammalian cells. Mol Cell 6, 1099-1108 (2000).
43. H. Zinszner et al, CHOP is implicated in programmed cell death in response to impaired function of the endoplasmic reticulum. Genes & development 12, 982-995 (1998).
44. Y. Hotta et al, Fibroblast Growth Factor 21 Regulates Lipolysis in White Adipose Tissue But Is Not Required for Ketogenesis and Triglyceride Clearance in Liver. Endocrinology 150, 4625-4633 (2009).
45. V. Y. L. Leung, W. C. W. Chan, S.-C. Hung, K. M. C. Cheung, D. Chan, Matrix Remodeling During Intervertebral Disc Growth and Degeneration Detected by Multichromatic FAST Staining. Journal of Histochemistry and Cytochemistry 57, 249-256 (2009).
46. A. W. K. Wai et al. , Disrupted expression of matrix genes in the growth plate of the mouse cartilage matrix deficiency (cmd) mutant. Developmental Genetics 22, 349-358 (1998).
47. L.-J. Ng et al, SOX9 Binds DNA, Activates Transcription, and Coexpresses with Type II Collagen during Chondrogenesis in the Mouse. Developmental Biology 183, 108-121 (1997).
48. C. Sidrauski et al. , Pharmacological brake-release of mRNA translation enhances cognitive memory. eLife 2, e00498 (2013).
49. G. V. Di Prisco et al. , Translational control of mGluR-dependent long-term depression and object-place learning by eIF2[alpha]. Nat Neurosci 17, 1073-1082 (2014). 50. H. Akiyama, M.-C. Chaboissier, J. F. Martin, A. Schedl, B. de Crombrugghe, The transcription factor Sox9 has essential roles in successive steps of the chondrocyte differentiation pathway and is required for expression of Sox5 and Sox6. Genes & development 16, 2813-2828 (2002).
51. D. M. Bell etal, SOX9 directly regulates the type-ll collagen gene. Nat Genet 16, 174-178 (1997).
52. P. Dy et al. , Sox9 directs hypertrophic maturation and blocks osteoblast differentiation of growth plate chondrocytes. Dev Cell 22, 597-609 (2012).
53. V. Y. L. Leung et al, SOX9 Governs Differentiation Stage-Specific Gene Expression in Growth Plate Chondrocytes via Direct Concomitant Transactivation and Repression. PLoS genetics 7, el002356 (2011).
54. C. F. Liu, W. E. Samsa, G. Zhou, V. Lefebvre, Transcriptional control of chondrocyte specification and differentiation. Semin Cell Dev Biol 62, 34-49 (2017).
55. Y. Sekine et al, Mutations in a translation initiation factor identify the target of a memory enhancing compound. Science 348, 1027 (2015).
56. C. Sidrauski et al, Pharmacological dimerization and activation of the exchange factor eIF2B antagonizes the integrated stress response. eLife 4, e07314 (2015).
57. G. V. Di Prisco et al. , Translational control of mGluR-dependent long-term depression and object-place learning by eIF2alpha. Nat Neurosci 17, 1073-1082 (2014).
58. C. Wang et al, Inhibiting the integrated stress response pathway prevents aberrant chondrocyte differentiation thereby alleviating chondrodysplasia. eLife 7, (2018).
59. R. Savarirayan, V. Cormier-Daire, R. S. Lachman, D. L. Rimoin, Schmid type metaphyseal chondrodysplasia: a spondylometaphyseal dysplasia identical to the“Japanese” type. Pediatric Radiology 30, 460-463 (2000).
60. D. Samartzis et al, Classification of Schmorl's nodes of the lumbar spine and association with disc degeneration: a large-scale population-based MRI study. Osteoarthritis and Cartilage 24, 1753-1760.
61. H. Wang et al, Role of death receptor, mitochondrial and endoplasmic reticulum pathways in different stages of degenerative human lumbar disc. Apoptosis 16, 990 (2011).
62. F. J. Lv et al, Matrix metalloproteinase 12 is an indicator of intervertebral disc degeneration co-expressed with fibrotic markers. Osteoarthritis Cartilage. 24(10): 1826- 1836 (2016).
63. T. M. Campbell et al, Genome wide gene expression analysis of the posterior capsule in patients with osteoarthritisand knee flexion contracture. J Rheumatol. 41 ( 1 1 ): 2232-9 (2014).
64. J. Rosenbloom et al, Human Fibrotic Diseases: Current Challenges in Fibrosis Research .Methods Mol Biol. 1627:1-23 (2017).
65. J.A. Dickens et al, Pulmonary endoplasmic reticulum stress-scars, smoke, and suffocation.
FEBS J. 286(2):322-341. (2019)
66. L. Rittie, Fibrosis: Methods and Protocols (Methods in Molecular Biology), Humana Press. (1st ed. 2017).
67. J. P. Urban and Roberts S. Degeneration of the intervertebral disc. Arthritis Res Ther.
5(3): 120-30 (2003).
68. Y. Zhang et al, Early onset of disc degeneration in SM/J mice is associated with changes in ion transport systems and fibrotic events. Matrix Biol. 70:123-139 (2018).
69. V. Tam et al., Histological and reference system for the analysis of mouse intervertebral disc. J Orthop Res. 36(l):233-243 (2018).
70. L.A. Mullan et al, Increased intracellular proteolysis reduces disease severity in an ER stress-associated dwarfism. J Clin Invest. 127(10):3861-3865 (2017).
71. V.K. Pandey et al, Activation of PERK-eIF2a-ATF4 pathway contributes to diabetic hepatotoxicity: Attenuation of ER stress by Morin. Cell Signal, pii: S0898-6568(19)30051- 8 (2019). 72. J.F. Bateman, R.P. Boot-Handford, S.R. Lamande. Genetic diseases of connective tissues: cellular and extracellular effects of ECM mutations Nat Rev Genet. 10(3): 173-183 (2009). doi: l0.l038/nrg2520
73. Jin F, Jiang K, Ji S, Wang L, Ni Z, Huang F, Li C, Chen R, Zhang H, Hu Z, Zha X. Deficient TSCl/TSC2-complex suppression of SOX9-osteopontin-AKT signalling cascade constrains tumour growth in tuberous sclerosis complex. Hum Mol Genet.; 26(2):407-4l9 (2017). doi: l0.l093/hmg/ddw397.
74. Pritchett J, Harvey E, Athwal V, Berry A, Rowe C, Oakley F, Moles A, Mann DA, Bobola N, Sharrocks AD, Thomson BJ, Zaitoun AM, Irving WL, Guha IN, Hanley NA, Hanley KP. Osteopontin is a novel downstream target of SOX9 with diagnostic implications for progression of liver fibrosis in humans. Hepatology. 56(3): 1108-16 (2012). doi: 10.1002/hep.25758.
75. Patterson SE et al. Mechanisms and models of endoplasmic reticulum stress in chondrodysplasia. Dev Dyn. 243(7): 875-893 (2014)
76. Gawron K. Endoplasmic reticulum stress in chondrodysplasias caused by mutations in collagen types II and X. Cell Stress Chaperones. 21(6):943-958 (2016). Epub 2016 Aug 15. Review
77. Tsang KY, Chan D, Bateman JF, Cheah KS. In vivo cellular adaptation to ER stress: survival strategies with double-edged consequences. JCellSci. 123(Pt 13):2145-54 (2010). doi: 10.1242/jcs.068833
78. K. L. Posey et al. , Chop (Ddit3) is essential for D469del-COMP retention and cell death in chondrocytes in an inducible transgenic mouse model of pseudoachondroplasia. Am J Pathol 180, 727-737 (2012)
79. S. Nundlall et al, An unfolded protein response is the initial cellular response to the expression of mutant matrilin-3 in a mouse model of multiple epiphyseal dysplasia. Cell Stress & Chaperones 15, 835-849 (2010)
80. P. Podszywalow-Bartnicka et al, Increased phosphorylation of eIF2a in chronic myeloid leukemia cells stimulates secretion of matrix modifying enzymes. Oncotarget 7, 79706- 79721 (2016).
81. M.Walraven and B. Hinz, Therapeutic approaches to control tissue repair and fibrosis:
Extracellular matrix as a game changer. The address for the corresponding author was captured as affiliation for all authors. Matrix Biol pii: S0945-053X(17)30490-0 (2018).
82. Z Tan et al., Synergistic co-regulation and competition by a SOX9-GLI-FOXA phasic transcriptional network coordinate chondrocyte differentiation transitions. PLoS Genet. 14(4):el007346. (2018) doi: 10.1371/journal.pgen.100734
83. Rabouw, H. H. et al, Small molecule ISRIB suppresses the integrated stress response within a defined window of activation. PNAS 116(6), 2097-2102 (2019). doi: 10.1073/pnas.l815767116
84. Pavitt, G. D., Regulation of translation initiation factor eIF2B at the hub of the integrated stress response. Wiley Interdiscip. Rev. RNA 9(6):el491 (2018). doi: 10.1002/wrna.l491
85. Pandey, V. K. et al, Activation of PERK-eIF2a-ATF4 pathway contributes to diabetic hepatotoxicity: Attenuation of ER stress by Morin. Cell Signal pii: S0898-6568(19)30051- 8 (20419), doi: 10.1016/j.cellsig.2019.03.008

Claims

What is claimed is:
1. Use of a modulator of a phosphorylated eukaryotic initiation factor 2a (p-eIF2a) for the manufacture of a medicament for the prevention, amelioration and/or treatment of fibrosis caused by the activation of the integrated stress response (ISR) involving the p-eIF2 a pathway in an organ or tissue, wherein the modulator is represented by Formula I:
Figure imgf000044_0001
wherein each of Rl, R2, R3 and R4 is independently selected from a group consisting of hydrogen, halogen, -OCH3, -OCH2Ph, -C(0)Ph, -CH3, -CF3, -CCI3, -CN, -S(0)CH3, -OH, - NH2, -COOH, - CONH2, -N02, -C(0)CH3, -CH(CH3)2, -CCSi(CH3)3, -CCH, -CH2CCH, -SH,
SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC=(0)NHNH2, -NHC=(0)NH2, -NHSO2H, -NHC=(0)H, -NHOH, -OCF3, -OCHF2, N3, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl; or Formula II:
Figure imgf000044_0002
wherein R1 is pyrrolopyrimidine, which may be unsubstituted or substituted with amino or alkyl; R2 is pyridyl, pyrrolyl or pyrazolyl, which may be unsubstituted or substituted with halogen, alkyl or trihaloalkyl; and R3 is hydrogen or halogen.
2. The use of claim 1, wherein an effective amount of the modulator is capable of one or more of the following:
a) inhibiting the phosphorylation of eIF2oc;
b) promoting the de-phosphorylation of eIF2oc;
c) inhibiting the effect of phosphorylated-eIF2oc;
d) inhibiting the transcription or expression of Sox9/SOX9;
e) inhibiting the transcription or expression of Ddit3/Chop
f) inhibiting the activity, transcription or expression of ATF4; and
g) promoting the assembly of GADD34-Pplc.
3. The use of claim 1 or 2, wherein the organ or tissue is selected from the group consisting of lung, liver, heart, brain, kidney, bone, skin, pancreas, intervertebral disc, cartilage and connective tissues.
4. The use of any one of claims 1-3, wherein the fibrosis is caused by an aberrant synthesis or accumulation of extracellular matrix (ECM) protein in the organ or tissue.
5. The use of claim 4, wherein the extracellular matrix (ECM) protein is synthesized by fibroblasts, myofibroblasts, or both.
6. The use of any one of claims 1-5, wherein the modulator is selected from the following:
Figure imgf000045_0001
7. The use of any one of claims 1-5, wherein the modulator is selected from the following
Figure imgf000045_0002
8. The use of any one of claims 1-7, wherein the effective amount of the modulator is 0.1 mg/kg to 50 mg/kg per day.
9. A method of preventing and/or ameliorating aberrant synthesis or accumulation of extracellular matrix (ECM) proteins in an organ or tissue of a subject, the method comprising a step of administering to the subject an effective amount of a molecule that is capable of inhibiting the p-eIF2oc pathway.
10. The method of claim 9, wherein the molecule is a small molecule represented by Formula I:
Figure imgf000046_0001
wherein each of Rl, R2, R3 and R4 is independently selected from a group consisting of hydrogen, halogen, -OCH3, -OCH2Ph, -C(0)Ph, -CH3, -CF , -CCl , -CN, -S(0)CH , -OH, - NH2, -COOH, - CONH2, -N02, -C(0)CH , -CH(CH )2, -CCSi(CH ) , -CCH, -CH2CCH, -SH, SO H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC=(0)NHNH2, -NHC=(0)NH2, -NHSO2H, -NHC=(0)H, -NHOH, -OCH3, -OCF3, -OCHF2, N3, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl; or Formula II:
Figure imgf000046_0002
wherein R1 is pyrrolopyrimidine, which may be unsubstituted or substituted with amino or alkyl; R2 is pyridyl, pyrrolyl or pyrazolyl, which may be unsubstituted or substituted with halogen, alkyl or trihaloalkyl; and R3 is hydrogen or halogen.
11. The method of any one of claims 9-10, wherein the molecule is capable of inhibiting the ectopic expression of Chop, Sox9/SOX9 and/or ATF4.
12. The method of claim 11, wherein the molecule is capable of inhibiting the binding between ATF4 and a transcriptional regulatory element of mouse/human Sox9/SOX9.
13. The method of claim 12, wherein the transcriptional regulatory element of Sox9/SOX9 comprises the nucleic acid sequence selected from the group consisting of SEQ ID NOs.: 1-
3.
14. The method of claim 12, wherein the transcriptional regulatory element of Sox9/SOX9 is a stress-induced or ATF-induced enhancer that regulates the transcription of Sox9/SOX9, said enhancer comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs.: 5-29, or a nucleic acid sequence which is at least 80% homologous to the nucleic acid sequence selected from the group consisting of SEQ ID NOs.: 5-29.
15. The method of any one of claims 8-14, wherein the aberrant synthesis or accumulation of extracellular matrix (ECM) protein is caused by an aberrant cell differentiation in a population of cells caused by the activation of integrated stress response (ISR).
16. The method of claim 15, wherein the population of cells comprises cells that can be differentiated to fibroblasts, myofibroblasts, or both.
17. A method of modulating the level of one or more fibrotic factors in an organ or tissue of a subject, wherein the fibrotic factors are indicative of the presence or progress of fibrosis, comprising a step of administering to said subject an effective amount of a p-eIF2oc modulator.
18. The method of claim 17, wherein the fibrotic factor is selected from the group consisting of fibrillar collagen type I, II, III, V and XI, fibronectin ED- A and ED-B, elastin, non-fibrillar collagen type IV, VI, VII, VIII and XIV, fibrillin 1-3, LTBP 1-4, tenascin C (R, W and X), Hyaluronan form HA, versican V0-V3, syndecan 1-4, fibulin 1-7, biglycan, lumican, fibromodulin, dermatopontin, decorin, CCN1-6, periostin, osteopontin, osteonectin, SPARC, alpha smooth muscle actin, fibroblast activation protein alpha, fibroblast specific protein 1 and transforming growth factor b.
19. The method of claim 17, wherein the fibrotic factor is selected from the group consisting of lysyl oxidase, LOX-like 1-4, LH 1-3, transglutaminase 1-7, matrix metalloprotease 1-3, 7- 17, 19-21 and 23-28, tissue inhibitor of matrix metalloproteinase 1-4 and plasmin-activation inhibitor uPA, tPA, PAI-l and PAI-2.
20. A method of preventing, ameliorating and/or treating fibrosis caused by the activation of the integrated stress response (ISR) involving the phosphorylated eukaryotic initiation factor 2a (p-eIF2oc) signaling pathway in an organ or tissue of a subject, comprising a step of administering to said subject an effective amount of a p-eIF2oc modulator.
21. The method of claim 20, wherein an effective amount of the p-eIF2oc modulator is capable of one or more of the following:
a) inhibiting the phosphorylation of eIF2oc;
b) promoting the de -phosphorylation of eIF2oc;
c) inhibiting the effect of phosphorylated-eIF2oc;
d) inhibiting the transcription or expression of Ddit3/Chop
e) inhibiting the transcription or expression of Sox9/SOX9;
f) inhibiting the activity, transcription or expression of ATF4; and
g) promoting the assembly of GADD34-Pplc.
22. The method of claim 20 or 21, wherein the organ or tissue is selected from the group consisting of lung, liver, heart, brain, kidney, bone, skin, pancreas, intervertebral disc, cartilage and connective tissues.
23. The method of any one of claims 20-22, wherein the fibrosis is caused by an aberrant synthesis or accumulation of extracellular matrix (ECM) protein in the organ or tissue.
24. The method of claim 23, wherein the extracellular matrix (ECM) protein is synthesized by fibroblasts, myofibroblasts, or both.
25. The method of any one of claims 20-24, wherein the p-eIF2oc modulator is represented by
Formula I:
Figure imgf000048_0001
wherein each of Rl, R2, R3 and R4 is independently selected from a group consisting of hydrogen, halogen, -OCH3, -OCH2Ph, -C(0)Ph, -CH3, -CF3, -CCI3, -CN, -S(0)CH3, -OH, - NH2, -COOH, - CONH2, -NO2, -C(0)CH3, -CH(CH3)2, -CCSi(CH3)3, -CCH, -CH2CCH, -SH,
S03H, -SO4H, -SO2NH2, -NHNH2, -0NH2, -NHC=(0)NHNH2, -NHC=(0)NH2, -NHSO2H, -NFlC=(0)F[, -NFlOFl, -OCF3, -OCF1F2, N3, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl; or Formula II:
Figure imgf000049_0001
wherein R1 is pyrrolopyrimidine, which may be unsubstituted or substituted with amino or alkyl; R2 is pyridyl, pyrrolyl or pyrazolyl, which may be unsubstituted or substituted with halogen, alkyl or trihaloalkyl; and R3 is hydrogen or halogen.
26. The method of any one of claims 20-25, wherein the effective amount of the p-eIF2oc modulator is 0.1 mg/kg to 50 mg/kg per day.
27. A method of screening a candidate molecule for the ability to modulate fibrosis associated with integrated stress response (ISR) involving the p-eIF2oc pathway, the method comprising the steps of
c) administering said candidate molecule to a fibrotic mouse model; and
d) measuring one or more of fibrotic factors in the mouse treated with said candidate molecule:
wherein changes in said one or more of fibrotic factors in the presence of said candidate molecule as compared to a control molecule indicate that said candidate molecule is capable of modulating fibrosis associated with ISR involving the p-eIF2oc pathway.
28. The method of claim 27, wherein the fibrotic mouse model is a transgenic mouse carrying a Sox9 gene which is conditionally knockout.
29. The method of claim 27, wherein the fibrotic mouse model is a transgenic mouse carrying a Ddit3 gene which is conditionally knockout, or carrying no Ddit3 gene.
30. The method of any one of claims 27-29, wherein said one or more of fibrotic factors are selected from the group consisting of fibrillar collagen type I, II, III, V and XI, fibronectin ED- A and ED-B, elastin, non-fibrillar collagen type IV, VI, VII, VIII and XIV, fibrillin 1-3, LTBP 1-4, tenascin C (R, W and X), Hyaluronan form HA, versican V0-V3, syndecan 1-4, fibulin 1-7, biglycan, lumican, fibromodulin, dermatopontin, decorin, CCN1-6, periostin, osteopontin, osteonectin, SPARC, alpha smooth muscle actin, fibroblast activation protein alpha, fibroblast specific protein 1, transforming growth factor b, lysyl oxidase, LOX-like 1- 4, LH 1-3, transglutaminase 1-7, matrix metalloprotease 1-3, 7- 17, 19-21 and 23-28, tissue inhibitor of matrix metalloproteinase 1-4 and plasmin-activation inhibitor uPA, tPA, PAI-l and PAI-2 .
PCT/IB2019/052321 2018-03-21 2019-03-21 Method for preventing or modulating fibrosis and fibrotic response associated with the integrated stress response Ceased WO2019180664A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201862646037P 2018-03-21 2018-03-21
US62/646,037 2018-03-21

Publications (1)

Publication Number Publication Date
WO2019180664A1 true WO2019180664A1 (en) 2019-09-26

Family

ID=67986854

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2019/052321 Ceased WO2019180664A1 (en) 2018-03-21 2019-03-21 Method for preventing or modulating fibrosis and fibrotic response associated with the integrated stress response

Country Status (1)

Country Link
WO (1) WO2019180664A1 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114672547A (en) * 2022-01-24 2022-06-28 中山大学附属第一医院 Application of Periostin gene in preparation of products for diagnosis and treatment of intervertebral disc degeneration
CN118576616A (en) * 2024-05-28 2024-09-03 南通大学附属医院 Application of Atf3-siRNA in the preparation of drugs for treating liver fibrosis caused by Schistosoma japonicum
WO2025231528A1 (en) * 2024-05-09 2025-11-13 Baker Heart and Diabetes Institute Compositions and methods for treating fibrosis
WO2025245500A1 (en) * 2024-05-23 2025-11-27 Revir Therapeutics, Inc. 2-(4-chloro-3-fluorophenoxy)-n-[trans-4-[5-[3-(trifluoromethoxy)-1-azetidinyl]-1,3,4-oxadiazol-2-yl]cyclohexyl]-acetamide for use in the treatment of vanishing white matter, huntington's disease, charcot marie tooth syndrome, amyotrophic lateral sclerosis or for increasing the guanine nucleotide exchange factor activit
WO2026064126A1 (en) * 2024-09-19 2026-03-26 University Of Rochester Use of gadd34 inhibitors such as sephin1 for the treatment of fibrotic airways disease

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014144952A2 (en) * 2013-03-15 2014-09-18 Peter Walter Modulators of the eif2alpha pathway
WO2015120350A2 (en) * 2014-02-07 2015-08-13 Effector Therapeutics, Inc. Compositions and methods for treating fibrotic disease
WO2016025635A2 (en) * 2014-08-13 2016-02-18 Epizyme, Inc. Combination therapy for treating cancer
WO2018055578A1 (en) * 2016-09-22 2018-03-29 The University Of Hong Kong Preventive and therapeutic approach for aberrant cell differentiation and isr-associated diseases

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014144952A2 (en) * 2013-03-15 2014-09-18 Peter Walter Modulators of the eif2alpha pathway
WO2015120350A2 (en) * 2014-02-07 2015-08-13 Effector Therapeutics, Inc. Compositions and methods for treating fibrotic disease
WO2016025635A2 (en) * 2014-08-13 2016-02-18 Epizyme, Inc. Combination therapy for treating cancer
WO2018055578A1 (en) * 2016-09-22 2018-03-29 The University Of Hong Kong Preventive and therapeutic approach for aberrant cell differentiation and isr-associated diseases

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114672547A (en) * 2022-01-24 2022-06-28 中山大学附属第一医院 Application of Periostin gene in preparation of products for diagnosis and treatment of intervertebral disc degeneration
WO2025231528A1 (en) * 2024-05-09 2025-11-13 Baker Heart and Diabetes Institute Compositions and methods for treating fibrosis
WO2025245500A1 (en) * 2024-05-23 2025-11-27 Revir Therapeutics, Inc. 2-(4-chloro-3-fluorophenoxy)-n-[trans-4-[5-[3-(trifluoromethoxy)-1-azetidinyl]-1,3,4-oxadiazol-2-yl]cyclohexyl]-acetamide for use in the treatment of vanishing white matter, huntington's disease, charcot marie tooth syndrome, amyotrophic lateral sclerosis or for increasing the guanine nucleotide exchange factor activit
CN118576616A (en) * 2024-05-28 2024-09-03 南通大学附属医院 Application of Atf3-siRNA in the preparation of drugs for treating liver fibrosis caused by Schistosoma japonicum
WO2026064126A1 (en) * 2024-09-19 2026-03-26 University Of Rochester Use of gadd34 inhibitors such as sephin1 for the treatment of fibrotic airways disease

Similar Documents

Publication Publication Date Title
Chen et al. YY1 regulates skeletal muscle regeneration through controlling metabolic reprogramming of satellite cells
Tang et al. The proto-oncogene tyrosine protein kinase Src is essential for macrophage-myofibroblast transition during renal scarring
Sun et al. Regulator of calcineurin 1 (RCAN1) facilitates neuronal apoptosis through caspase-3 activation
Murray-Zmijewski et al. p53/p63/p73 isoforms: an orchestra of isoforms to harmonise cell differentiation and response to stress
Burghardt et al. LMX1B is essential for the maintenance of differentiated podocytes in adult kidneys
WO2019180664A1 (en) Method for preventing or modulating fibrosis and fibrotic response associated with the integrated stress response
Xu et al. Glycogen synthase kinase 3β dictates podocyte motility and focal adhesion turnover by modulating paxillin activity: implications for the protective effect of low-dose lithium in podocytopathy
Miller et al. p66Shc regulates renal vascular tone in hypertension-induced nephropathy
KR20050090420A (en) Metastin derivative and use thereof
JP2009213490A (en) Bone and/or joint disease-associated gene
JP7570100B2 (en) Method for removing senescent cells and method for preparing senescent cells
Yaghmaeian Salmani et al. Evolutionarily conserved anterior expansion of the central nervous system promoted by a common PcG-Hox program
JP7211936B2 (en) Biomarkers of cell death
Law et al. Expression of non-acetylatable H2A. Z in myoblast cells blocks myoblast differentiation through disruption of MyoD expression
Zhang et al. Downregulation of miR-151-5p contributes to increased susceptibility to arrhythmogenesis during myocardial infarction with estrogen deprivation
US11759437B2 (en) Preventive and therapeutic approach for aberrant cell differentiation and ISR-associated diseases
Xu et al. NSD2 promotes pressure overload-induced cardiac hypertrophy via activating circCmiss1/TfR1/ferroptosis signaling
Jin et al. SRSF7 promotes pulmonary fibrosis through regulating PKM alternative splicing in lung fibroblasts
JP7297104B2 (en) Animal model of idiopathic pulmonary fibrosis, its construction method and use
Liu et al. Cytoplasmic and nuclear NFATc3 cooperatively contributes to vascular smooth muscle cell dysfunction and drives aortic aneurysm and dissection
Sun et al. Antihypoxic effect of miR-24 in SH-SY5Y cells under hypoxia via downregulating expression of neurocan
US20250250309A1 (en) Chimeric efferocytic receptors improve apoptotic cell clearance and alleviate inflammation
de Melo The impact of Lama2-deficiency on cell cycle regulation and survival
Tang et al. p53 peptide prevents LITAF-induced TNF-alpha-mediated mouse lung lesions and endotoxic shock
Wu et al. Zinc finger BED-type containing 6 (ZBED6) ameliorates cardiac fibrosis by inhibiting Piezo1 transcription and YAP nuclear translocation

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19770612

Country of ref document: EP

Kind code of ref document: A1

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19770612

Country of ref document: EP

Kind code of ref document: A1