WO2019048881A1 - Oligonucléotides comprenant des liaisons internucléosidiques de type triazole et (phosphore)amidate, leur procédé de préparation et leurs utilisations - Google Patents

Oligonucléotides comprenant des liaisons internucléosidiques de type triazole et (phosphore)amidate, leur procédé de préparation et leurs utilisations Download PDF

Info

Publication number
WO2019048881A1
WO2019048881A1 PCT/GB2018/052555 GB2018052555W WO2019048881A1 WO 2019048881 A1 WO2019048881 A1 WO 2019048881A1 GB 2018052555 W GB2018052555 W GB 2018052555W WO 2019048881 A1 WO2019048881 A1 WO 2019048881A1
Authority
WO
WIPO (PCT)
Prior art keywords
oligonucleotide
formula
nucleoside
alkyl
independently selected
Prior art date
Application number
PCT/GB2018/052555
Other languages
English (en)
Inventor
Tom Brown
Afaf Helmy El-Sagheer
Original Assignee
Oxford University Innovation Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Oxford University Innovation Limited filed Critical Oxford University Innovation Limited
Publication of WO2019048881A1 publication Critical patent/WO2019048881A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H1/00—Processes for the preparation of sugar derivatives
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids

Definitions

  • the present invention relates to a process for preparing oligonucleotides or oligonucleotide analogues.
  • the present invention also relates to the oligonucleotides and oligonucleotide analogues formed from said process and to use of these oligonucleotides and oligonucleotide analogues in the synthesis of genes, as therapeutics in treatment of certain diseases and disorders (e.g. cancer) and as templates in polymerase chain reactions, DNA replication processes, RNA transcription processes and/or translation processes.
  • PCR DNA polymerases cannot discriminate between the canonical deoxyribonucleoside triphosphates (dNTPs) and modified versions. This is because any modified dNTP must possess the same fundamental Watson-Crick base pairing properties as its natural counterpart in order to be incorporated into DNA by polymerase enzymes. Consequently, the natural and unnatural dNTPs compete in an uncontrollable manner.
  • An obvious solution to this problem is to assemble DNA by ligation of pre-synthesized chemically modified oligonucleotides. This would open up new areas of biology, allowing a vast array of modifications to be incorporated into genomic DNA.
  • Ligation can be carried out enzymatically, 3 but chemical ligation offers an attractive alternative. 4 It is compatible with large scale applications, radical modifications to the sugars and nucleobases, templated or non-templated reactions, and can be carried out in conditions under which ligase enzymes would not remain functional, including automated nucleic acid assembly. Moreover, chemical ligation is not restricted to the natural phosphodiester backbone of DNA; other backbones can be produced, some of which have been found to be biocompatible.
  • a process for preparing a target oligonucleotide or oligonucleotide analogue comprising two or more different phosphodiester mimic inter-nucleoside linkages, as defined herein.
  • an oligonucleotide or oligonucleotide analogue as defined herein.
  • a use of an oligonucleotide or oligonucleotide, as defined herein, in the synthesis of genes in the synthesis of genes.
  • a use of an oligonucleotide or oligonucleotide, as defined herein, as a template in the synthesis of genes is provided.
  • oligonucleotide or oligonucleotide as defined herein, as:
  • interference RNA e.g. siRNA
  • an RNA component of a CRISPR-Cas system e.g. crRNA, tracrRNA or gRNA
  • the disease or disorder is cancer, a genetic disorder or an infection.
  • oligonucleotide or oligonucleotide as defined herein, as:
  • PCR polymerase chain reaction
  • alkyl includes both straight and branched chain alkyl groups. References to individual alkyl groups such as “propyl” are specific for the straight chain version only and references to individual branched chain alkyl groups such as “isopropyl” are specific for the branched chain version only.
  • (1-6C)alkyl includes (1-4C)alkyl, (1-3C)alkyl, propyl, isopropyl and f-butyl.
  • (m-nC) or "(m-nC) group” used alone or as a prefix, refers to any group having m to n carbon atoms.
  • halo refers to fluoro, chloro, bromo and iodo.
  • oligonucleotide or oligonucleotide analogue of the invention means those oligonucleotides or oligonucleotide analogues which are disclosed herein, both generically and specifically.
  • oligonucleotide refers to a polynucleotide strand. It will therefore be understood that the term oligonucleotide used herein covers both "short" polynucleotide strands comprising between 2 and 500 nucleotide residues and "long” polynucleotide strands comprising greater than 500 nucleotide residues. It will also be appreciated by those skilled in the art that an oligonucleotide has a 5' and a 3' end and comprises a sequence of nucleosides linked together by inter-nucleoside linkages.
  • oligonucleotide analogue and “nucleotide analogue” refer to any modified synthetic analogues of oligonucleotides or nucleotides respectively that are known in the art.
  • oligonucleotide analogues include peptide nucleic acids (PNAs), morpholino oligonucleotides, phosphorothioate oligonucleotides, phosphorodithioate oligonucleotides, alkylphosphonate oligonucleotides, acylphosphonate oligonucleotides and phosphoramidate oligonucleotides.
  • PNAs peptide nucleic acids
  • morpholino oligonucleotides include morpholino oligonucleotides, phosphorothioate oligonucleotides, phosphorodithioate oligonucleotides, alkylphosphonate oligonucle
  • nucleobase analogue refers to any analogues of nucleobases known in the art.
  • the skilled person will appreciate there to be numerous natural and synthetic nucleobase analogues available in the art which could be employed in the present invention. As such, the skilled person will readily be able to identify suitable nucleobase analogues for use in the present invention.
  • Commonly available nucleobase analogues are commercially available from a number of sources (for example, see the Glen Research catalogue (http://www.glenresearch.com/Catalog/contents.php). It will also be appreciated that the term “nucleobase analogue” covers: universal/degenerate bases (e.g.
  • 3-nitropyrrole, 5-nitroindole and hypoxanthine fluorescent bases (e.g. tricyclic cytosine analogues (tCO, tCS) and 2- aminopurine); base analogues bearing reactive groups selected from alkynes, thiols or amines; and base analogues that can crosslink oligonucleotides to DNA, RNA or proteins (e.g. 5-bromouracil or 3-cyanovinyl carbazole).
  • fluorescent bases e.g. tricyclic cytosine analogues (tCO, tCS) and 2- aminopurine
  • base analogues bearing reactive groups selected from alkynes, thiols or amines e.g. 5-bromouracil or 3-cyanovinyl carbazole.
  • the nucleobase or nucleobase analogue is attached to a sugar moiety (typically ribose or deoxyribose) or a ribose or deoxyribose mimic, for example a chemically modified sugar derivative (e.g. a chemically modified ribose or deoxyribose) or a cyclic group that functions as a synthetic mimic of a ribose or deoxyribose sugar moiety (e.g. the morpholino ring present in morpholino oligonucleotides).
  • a sugar moiety typically ribose or deoxyribose
  • a ribose or deoxyribose mimic for example a chemically modified sugar derivative (e.g. a chemically modified ribose or deoxyribose) or a cyclic group that functions as a synthetic mimic of a ribose or deoxyribose sugar moiety (e.g. the morph
  • nucleoside is used herein to refer to a moiety composed of a sugar / a ribose or deoxyribose mimic bound to a nucleobase/nucleobase analogue.
  • nucleoside as used herein excludes the inter-nucleoside linkage that connects adjacent nucleosides together.
  • An "inter-nucleoside linkage” is a linking group that connects the rings of the sugar / ribose or deoxyribose mimic of adjacent nucleosides.
  • locked nucleic acid LIMA or locked nucleoside
  • nucleic acids or nucleosides comprising a ribose or deoxyribose moiety in which the conformation of the ribose or deoxyribose ring is fixed or locked in a specific conformation, typically by a bridging group.
  • the bridging group connects the 2' and 4' carbon atoms of the ribose or deoxyribose rings and locks the ribose or deoxyribose in the 3'-endo conformation (which is often found in A-form duplexes).
  • Examples of locked nucleic acid/nucleoside structures are well known in the art and are commercially available.
  • a process for preparing a target oligonucleotide or oligonucleotide analogue comprising two or more different phosphodiester mimic inter-nucleoside linkages comprising the steps of:
  • R 1 a , R 1 b , R 1 c , R 1 d , R 1 e , R 1 f , R 1 9 and R 1 h are each independently selected from hydrogen or (1 -4C)alkyl, wherein each (1 -4C)alkyl is optionally substituted with one or more NH2, OH or SH;
  • V and W are independently selected from O, S or NR X , wherein R x is selected from hydrogen or (1 -4C)alkyl;
  • x, xi , z and zi are integers independently selected from 0 to 2; and y and yi are integers independently selected from 0 to 1 ;
  • ⁇ f independently denote the points of attachment to the target oligonucleotide or oligonucleotide analogue
  • R 2a , R 2b , R 2c , R 2d , R 3a , R 3b , R 3c and R 3d are independently selected from hydrogen or (1-4C)alkyl, wherein each (1-4C)alkyl is optionally substituted with one or more NH2, OH or SH
  • R 2e and R 3e are independently selected from hydrogen or (1-4C)alkyl
  • Vi, Wi and W2 are independently selected from O, S or NR Z , wherein R z is selected from hydrogen or (1-4C)alkyl;
  • Q is selected from S or O
  • n, rii , m and m 1 are integers independently selected from 0 to 2; and p, pi and P2 are integers independently selected from 0 to 1 ;
  • steps A) and B) above are conducted in either order;
  • the inventors have discovered a new process for preparing oligonucleotides or oligonucleotide analogues comprising two or more different phosphodiester mimic inter- nucleoside linkages.
  • the inventors In exploiting orthogonal chemistries to prepare the two or more different phosphodiester mimic inter-nucleoside linkages, the inventors have provided a cheap and highly efficient process for preparing oligonucleotides and analogues thereof comprising a vast array of modifications.
  • the inventors have also discovered that the two or more different phosphodiester mimic inter-nucleoside linkages used in the present process are fully compatible with and readable by DNA and RNA polymerases, which makes the oligonucleotides and oligonucleotide analogues prepared by the present process of particular use in a number of biological applications.
  • the process of the present invention also comprises the preparation of long polynucleotides (e.g. genes), wherein the long polynucleotide comprises greater than 500 nucleotide residues.
  • the process of the present invention is conducted in the presence of a template.
  • any suitable template may be used.
  • a person skilled in the art will be able to select a suitable template having the correct size and nucleoside sequence for hybridisation with the oligonucleotides and oligonucleotide analogues of the present process that are to be ligated together.
  • the template may comprise both an oligonucleotide and a synthetic oligonucleotide analogue, such as, for example, a peptide nucleic acid (PNA).
  • PNA peptide nucleic acid
  • the template is a single stranded oligonucleotide or oligonucleotide analogue that the oligonucleotides or oligonucleotide analogues to be ligated bind to, such that, functional groups on the termini of adjacent oligonucleotides or oligonucleotide analogues are available to be ligated together to form an inter-nucleoside linkage of Formula I, II and III as defined herein.
  • the process of the present invention is conducted in the absence of a template.
  • Processes conducted in the absence of a template will be understood to encompass reactions such as, for example, solution phase reactions and/or solid supported reactions.
  • At least one of the oligonucleotides or oligonucleotide analogues to be ligated is attached to a solid support.
  • the solid support is selected from controlled pore glass (CPG), silica, hydroxylated methacrylic polymer beads (e.g. Toyopearl® beads), grafted copolymers comprising a crosslinked polystyrene matrix onto which polyethylene glycol is grafted (e.g. Tenagel®) or microporous polystyrene (MPPS).
  • CPG controlled pore glass
  • MPPS microporous polystyrene
  • the solid support is selected from controlled pore glass (CPG) or microporous polystyrene (MPPS).
  • the solid support is a controlled pore glass (CPG) support.
  • One of the advantages of the present invention is that it allows multiple (i.e. three or more) oligonucleotides or oligonucleotide analogous to ligated together sequentially.
  • the inventors have advantageously discovered that in exploiting the orthogonal chemistries used to prepare the one or more phosphodiester backbone mimic inter-nucleoside linkages of Formulae I, II or III, oligonucleotides and oligonucleotide analogues can be prepared easily and very efficiently, without the need for any functional group interconversions.
  • target oligonucleotides or oligonucleotide analogues prepared by the present process may comprise any number of phosphodiester backbone mimic inter-nucleoside linkages of Formula I and any number of phosphodiester backbone mimic inter-nucleoside linkages of Formula II or Formula III.
  • the target oligonucleotide or oligonucleotide analogue comprises one or more phosphodiester backbone mimic inter- nucleoside linkages of Formula I and one or more phosphodiester backbone mimic inter- nucleoside linkages of Formula II.
  • the target oligonucleotide or oligonucleotide analogue comprises one phosphodiester backbone mimic inter-nucleoside linkage of Formula I and one phosphodiester backbone mimic inter-nucleoside linkage of Formula II.
  • the target oligonucleotide or oligonucleotide analogue comprises one or more phosphodiester backbone mimic inter- nucleoside linkages of Formula I and one or more phosphodiester backbone mimic inter- nucleoside linkages of Formula III.
  • the target oligonucleotide or oligonucleotide analogue comprises one phosphodiester backbone mimic inter-nucleoside linkage of Formula I and one phosphodiester backbone mimic inter-nucleoside linkage of Formula III.
  • the one or more phosphodiester backbone mimic inter- nucleoside linkages of Formula II or Formula III are formed before the one or more phosphodiester backbone mimic inter-nucleoside linkages of Formula I.
  • step B) of the present process is conducted before step A).
  • the target oligonucleotide prepared by the present process may also comprises at least one locked nucleoside.
  • Locked nucleosides are well known in the art and include nucleic acids and/or nucleosides comprising a ribose or deoxyribose moiety in which the conformation of the ribose or deoxyribose ring is fixed or "locked" in a specific conformation, typically by a bridging group.
  • a non-limiting list of suitable locked nucleosides which may be used in the present invention are described in K. Singh, S. and J. Wengel (1998).
  • the at least one locked nucleoside may be positioned at either the 3' or 5' end of an inter-nucleoside linkage of Formula I, II or III defined herein, or a locked nucleoside may be positioned at both the 3' and 5' end of an inter- nucleoside linkage of Formula I, II or III defined herein.
  • the at least one locked nucleoside is positioned at the 3' end of an inter-nucleoside linkage of Formula I, II or III defined herein.
  • the at least one locked nucleoside is positioned at the 5' end of an inter-nucleoside linkage of Formula I, II or III defined herein.
  • the target oligonucleotide or oligonucleotide analogue comprises at least two locked nucleosides, with at least one locked nucleoside positioned at the 3' end of an inter-nucleoside linkage of Formula I, II or III defined herein and at least one locked nucleoside position at 5' end of an inter-nucleoside linkage of Formula I, II or III defined herein.
  • target oligonucleotides or oligonucleotide analogues prepared by the process of the present invention may be isolated and purified using any suitable techniques known in the art.
  • the target oligonucleotides or oligonucleotide analogues formed by the process of the present invention are isolated and purified using column chromatography, such as, for example, using Sephadex® columns (i.e. cross-linked dextran gels).
  • step A) of the present process involves ligating two or more oligonucleotides or oligonucleotide analogues together to form one or more phosphodiester backbone mimic inter-nucleoside linkages of Formula la, shown below, at the point(s) of ligation:
  • V and W are independently selected from O, S or NR X , wherein R x is selected from hydrogen or (1-4C)alkyl;
  • x, xi , z and zi are integers independently selected from 0 to 2;
  • y and yi are integers independently selected from 0 to 1 ; with the proviso that the sum of x, xi , y, yi , z and zi is either 0, 1 , 2, 3, 4, 5 or 6.
  • step A) of the present process involves ligating two or more oligonucleotides or oligonucleotide analogues together to form one or more phosphodiester backbone mimic inter-nucleoside linkages of Formula lb, shown below, at the point(s) of ligation:
  • x, xi , z and zi are integers independently selected from 0 to 2;
  • y and yi are integers independently selected from 0 to 1 ;
  • step A) of the present process involves ligating two or more oligonucleotides or oligonucleotide analogues together to form one or more phosphodiester backbone mimic inter-nucleoside linkages at the point(s) of ligation selected from:
  • ⁇ denotes the point of attachment to a 5' carbon of a nucleoside of the target oligonucleotide or oligonucleotide analogue.
  • step A) of the present process involves ligating two or more oligonucleotides or oligonucleotide analogues together to form one or more phosphodiester backbone mimic inter-nucleoside linkages at the point(s) of ligation selected from:
  • / a denotes the point of attachment to a 3' carbon of a nucleoside of the target oligonucleotide or oligonucleotide analogue
  • ⁇ denotes the point of attachment to a 5' carbon of a nucleoside of the target oligonucleotide or oligonucleotide analogue.
  • step A) of the present process involves ligating two or more oligonucleotides or oligonucleotide analogues together to form a phosphodiester backbone mimic inter-nucleoside linkage at the point of ligation of the formula:
  • / a denotes the point of attachment to a 3' carbon of a nucleoside of the target oligonucleotide or oligonucleotide analogue
  • ⁇ denotes the point of attachment to a 5' carbon of a nucleoside of the target oligonucleotide or oligonucleotide analogue.
  • the one or more phosphodiester backbone mimic inter- nucleoside linkages of Formulae I, la or lb may be prepared using any suitable technique known in the art. The person skilled in the art will be able to select suitable reaction conditions and reagents to prepare the one or more phosphodiester backbone mimic inter-nucleoside linkages of Formulae I, la or lb.
  • the one or more phosphodiester backbone mimic inter-nucleoside linkages of Formula I are formed at the point(s) of ligation by reacting:
  • ⁇ a' denotes the point of attachment to the alkyne terminating oligonucleotide or oligonucleotide analogue
  • V is selected from O, S or NR X , wherein R x is selected from hydrogen or (1- 4C)alkyl; R 1 a , R 1 b , R 1 c and R 1 d are independently selected from hydrogen or (1 - 4C)alkyl, wherein each (1 -4C)alkyl is optionally substituted with one or more NH 2 , OH or SH;
  • x and z are integers independently selected from 0 to 2;
  • y is an integer selected from 0 to 1 ;
  • ' denotes the point of attachment to the azide terminating oligonucleotide or oligonucleotide analogue
  • W is selected from O, S or NR X , wherein R x is selected from hydrogen or (1 - 4C)alkyl;
  • R 1 e , R 1 f , R 19 and R 1 h are independently selected from hydrogen or (1 -4C)alkyl, wherein each (1 -4C)alkyl is optionally substituted with one or more NH2, OH or SH;
  • xi and zi are integers independently selected from 0 to 2; and yi is an integer selected from 0 to 1 ;
  • the alkyne terminal functional group of Formula A may be protected using a suitable protecting group.
  • suitable protecting groups include, for example, trialkylsilylacetylenes (e.g. trimethylsilylacetylene).
  • alkyne terminal functional group of Formula A it may be necessary to conduct the reaction between the one or more alkyne terminating oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula A and the one or more azide terminating oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula B in the presence of a deprotecting agent.
  • Suitable deprotecting agents will be apparent to those skilled in the art.
  • the reaction between the one or more alkyne terminating oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula A and the one or more azide terminating oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula B may optionally be carried out in the presence of tetrabutylammonium fluoride (TBAF) as the deprotecting agent.
  • TBAF tetrabutylammonium fluoride
  • the azido terminal functional group of Formula B may be masked in the form of an azide precursor.
  • suitable azide precursors will be known to the person skilled in the art.
  • Non-limiting examples of azide precursors include alkyl halides, tosylates or mesylates.
  • the azido terminal functional group of Formula B is delivered in the form of an azide precursor, it will be understood that it will be necessary to conduct the reaction between the one or more alkyne terminating oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula A and the one or more azide terminating oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula B in the presence of a suitable azide source (e.g. NaNs), to firstly convert the azide precursor to the terminal functional group of Formula B.
  • a suitable azide source e.g. NaNs
  • the sum of integers x, xi , y, yi , z and zi is either 0, 1 , 2, 3, 4 or 5.
  • the sum of integers x, xi , y, yi , z and zi is either 0, 1 , 2, 3 or 4. More suitably, the sum of integers x, xi , y, yi , z and zi is either 1 , 2, 3 or 4.
  • the sum of integers x, xi , y, yi , z and zi is either 1 , 2 or 3.
  • V is selected from O or NR X , wherein R x is selected from hydrogen or (1-4C)alkyl.
  • V is selected from O or NR X , wherein R x is selected from hydrogen or methyl.
  • V is O.
  • y is 1. In another embodiment, y is 0.
  • W is selected from O or NR X , wherein R x is selected from hydrogen or (1-4C)alkyl.
  • W is selected from O or NR X , wherein R x is selected from hydrogen or methyl.
  • W is O.
  • yi is 1. In other embodiments, yi is 0.
  • R 1a , R 1 b , R 1c , R 1d , R 1e , R 1f , R 19 and R 1 h are independently selected from hydrogen or (1-4C)alkyl.
  • R 1a , R 1 b , R 1c , R 1d , R 1 e , R 1f , R 19 and R 1 h are independently selected from hydrogen or methyl.
  • R 1a , R 1 b , R 1c , R 1d , R 1e , R 1f , R 19 and R 1 h are hydrogen.
  • x, xi , z and zi are integers independently selected from 0 to 1.
  • ⁇ a' denotes the point of attachment to a 3' carbon of a
  • ⁇ v denotes the point of attachment to a 5' carbon of a nucleoside of the azide terminating oligonucleotide or oligonucleotide analogue.
  • step A) of the process may be conducted using any suitable reaction conditions.
  • reaction conditions used in the step A) of the present process will vary according to the specific oligonucleotide, oligonucleotide analogue and/or functional groups of Formula A and B that are used.
  • suitable reaction conditions e.g. temperature, pressures, reaction times, concentration etc.
  • the reaction between the one or more alkyne terminating oligonucleotides or oligonucleotide analogues of step A1) and the one or more azide terminating oligonucleotides or oligonucleotide analogues of step A2) is conducted in the presence of a catalyst.
  • the catalyst is a copper (I) species.
  • suitable catalysts include copper iodide (Cul), copper bromide (CuBr) or copper iodide-triethyl phosphite (Cul.P(OEt) 3 ).
  • the catalyst e.g. the copper (I) species
  • the catalyst may be formed in situ upon adding a pre-catalyst complex and reducing agent to the reaction conditions. Accordingly, in an embodiment, the catalyst may be added in the form of a pre-catalyst together with a reducing agent.
  • suitable pre-catalysts include copper sulfate (CuSCU), copper chloride (CuC ), copper bromide (CuBr2), copper formate (Cu(OC(0)H)2), copper hydroxide (CuOhb) and copper nitrate (Cu(NOs)2).
  • a non-limiting example of a suitable reducing agent is sodium ascorbate.
  • the pre-catalyst is copper sulfate and the reducing agent is sodium ascorbate.
  • the step of reacting together the alkyne terminating oligonucleotide or oligonucleotide analogue comprising a terminal functional group of Formula A with the azide terminating oligonucleotide or oligonucleotide analogue comprising a terminal functional group of Formula B may be repeated sequentially more than once, for example, more than twice, more than three times, more than four times or more than five times, to form an oligonucleotide or oligonucleotide analogue comprising the one or more phosphodiester backbone mimic inter-nucleoside linkages of Formula I.
  • step B) of the present process involves ligating two or more oligonucleotides or oligonucleotide analogues together to form one or more phosphodiester backbone mimic inter-nucleoside linkages of Formula lla, shown below, at the point(s) of ligation:
  • / c and d independently denote the points of attachment to the target oligonucleotide or oligonucleotide analogue
  • R 2a , R 2b , R 2c , R 2d , R 2e and R z are independently selected from hydrogen or (1- 4C)alkyl;
  • n and ni are integers independently selected from 0 to 2;
  • q is an interger from 0 to 1 ;
  • n + ni + p 2, 3 or 4.
  • step B) of the present process involves ligating two or more oligonucleotides or oligonucleotide analogues together to form one or more phosphodiester backbone mimic inter-nucleoside linkages of Formula lib, shown below, at the point(s) of ligation:
  • / c and ⁇ d independently denote the points of attachment to the target oligonucleotide or oligonucleotide analogue
  • R 2a , R 2b , R 2c , R 2d and R 2e are independently selected from hydrogen or (1- 4C)alkyl;
  • n and ni are integers independently selected from 0 to 2, with the proviso that
  • step B) of the present process involves ligating two or more oligonucleotides or oligonucleotide analogues together to form one or more phosphodiester backbone mimic inter-nucleoside linkages at the point(s) of ligation selected from:
  • step B) of the present process involves ligating two or more oligonucleotides or oligonucleotide analogues together to form one or more phosphodiester backbone mimic inter-nucleoside linkages at the point(s) of ligation selected from:
  • step B) of the present process involves ligating two or more oligonucleotides or oligonucleotide analogues together to form one or more phosphodiester backbone mimic inter-nucleoside linkages at the point(s) of ligation selected from:
  • c denotes the point of attachment to a 3' carbon of a nucleoside of the target oligonucleotide or oligonucleotide analogue
  • ⁇ d denotes the point of attachment to a 5' carbon of a nucleoside of the target oligonucleotide or oligonucleotide analogue.
  • the one or more phosphodiester backbone mimic inter- nucleoside linkages of Formulae II, lla or lib may be prepared using any suitable technique known in the art.
  • the person skilled in the art will be able to select suitable reaction conditions and reagents to prepared the one or more phosphodiester backbone mimic inter-nucleoside linkages of Formulae II, lla or lib.
  • a suitable protecting group for an amino or alkylamino group is, for example, an acyl group, for example an alkanoyl group such as acetyl, an alkoxycarbonyl group, for example a methoxycarbonyl, ethoxycarbonyl or t-butoxycarbonyl group, an arylmethoxycarbonyl group, for example benzyloxycarbonyl, or an aroyl group, for example benzoyl.
  • the deprotection conditions for the above protecting groups necessarily vary with the choice of protecting group.
  • an acyl group such as an alkanoyl or alkoxycarbonyl group or an aroyl group may be removed by, for example, hydrolysis with a suitable base such as an alkali metal hydroxide, for example lithium or sodium hydroxide.
  • a suitable base such as an alkali metal hydroxide, for example lithium or sodium hydroxide.
  • an acyl group such as a te/f-butoxycarbonyl group may be removed, for example, by treatment with a suitable acid as hydrochloric, sulfuric or phosphoric acid or tnfluoroacetic acid and an arylmethoxycarbonyl group such as a benzyloxycarbonyl group may be removed, for example, by hydrogenation over a catalyst such as palladium-on-carbon, or by treatment with a Lewis acid for example boron tris(trifluoroacetate).
  • a suitable alternative protecting group for a primary amino group is, for example, a phthaloyl group which may be removed by treatment with an alkylamine, for example dimethylaminopropylamine, or with hydrazine.
  • a suitable protecting group for a carboxy group is, for example, an esterifying group, for example a methyl or an ethyl group which may be removed, for example, by hydrolysis with a base such as sodium hydroxide, or for example a t-butyl group which may be removed, for example, by treatment with an acid, for example an organic acid such as tnfluoroacetic acid, or for example a benzyl group which may be removed, for example, by hydrogenation over a catalyst such as palladium-on-carbon.
  • a base such as sodium hydroxide
  • a t-butyl group which may be removed, for example, by treatment with an acid, for example an organic acid such as tnfluoroacetic acid, or for example a benzyl group which may be removed, for example, by hydrogenation over a catalyst such as palladium-on-carbon.
  • the one or more phosphodiester backbone mimic inter-nucleoside linkages of Formula II are formed by reacting:
  • / c denotes the point of attachment to the oligonucleotide or oligonucleotide analogue comprising a terminal functional group of Formula C;
  • X is a leaving group selected from halo, OS02R x1 , (1-2C)haloalkyl, (1- 2C)haloalkoxy, OR" 2 , heteroaryl, wherein R x1 and R* 2 are independently selected from H, (1-6C)alkyl, (1-6C)alkanoyl, cycloalkyl, heteroalkyl, aryl, heteroaryl, (1-2C)haloalkyl, and wherein each of (1-6C)alkyl, cycloalkyl, heteroalkyl, aryl, heteroaryl are optionally further substituted with one or more groups selected from (1-4C)alkyl, halo, cyano, nitro or (1-2C)haloalkyl;
  • Vi is selected from O, S or NR Z , wherein R z is selected from hydrogen or (1- 4C)alkyl;
  • Q is selected from O or S
  • R 2a and R 2b are independently selected from hydrogen or (1-4C)alkyl, wherein each (1-4C)alkyl is optionally substituted with one or more NH2, OH or SH; n is an integer selected from 0 to 2; and
  • p is an integer selected from 0 to 1 ;
  • oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula D, shown below:
  • ⁇ d' denotes the point of attachment to the oligonucleotide or oligonucleotide analogue comprising a terminal functional group of Formula D;
  • R 2c and R 2d are independently selected from hydrogen or (1-4C)alkyl
  • Wi is selected from O or NH
  • X a is selected from NR e or SH, wherein R e is selected from hydrogen or (1- 4C)alkyl;
  • ni is an integer selected from 0 to 2;
  • pi is an integer selected from 0 or 1 ;
  • reaction is optionally conducted in the presence of one or more of the following:
  • the sum of integers n, ni , p is equal to 2, 3 or 4.
  • the sum of integers n, ni , p is equal to 2 or 3.
  • the sum of integers n, ni , p is equal to 2.
  • X is selected from halo, OS0 2 R x1 , (1-2C)haloalkyl, (1- 2C)haloalkoxy, OR" 2 , 5-membered heteroaryl, wherein R x1 and R* 2 are independently selected from H, (1-6C)alkyl, (1-6C)alkonyl, aryl or (1-2C)haloalkyl, and wherein each of (1-6C)alkyl or aryl is optionally further substituted with one or more groups selected from (1-4C)alkyl, halo, cyano, nitro or (1-2C)haloalkyl.
  • X is selected from halo, OS0 2 R x1 , (1-2C)haloalkyl, (1-2C)haloalkoxy, OR" 2 , triazolyl, wherein R x1 and R" 2 are independently selected from H, (1- 6C)alkyl, (1-6C)alkonyl, phenyl or (1-2C)haloalkyl. More suitably, X is selected from halo, (1- 2C)haloalkyl or OR" 2 , wherein R* 2 is selected from H, (1-6C)alkyl or a (1-6C)alkonyl. Even more suitably, X is selected from OR" 2 , wherein R" 2 is selected from H or (1-6C)alkyl. Most suitably, X is OH.
  • Vi is selected from O or NR Z , wherein R z is selected from hydrogen or (1-4C)alkyl.
  • R z is selected from hydrogen or (1-4C)alkyl.
  • Vi is selected from O or N z , wherein R z is selected from hydrogen or methyl.
  • Vi is O.
  • Q is O.
  • Wi is O.
  • n and ni are integers selected from 0 or 1.
  • the sum of integers n, ni , p and pi is equal to 2, 3 or 4.
  • the sum of integers n, ni , p and pi is equal to 2 or 3.
  • the sum of integers n, ni , p and pi is equal to 2.
  • R 2a , R 2b , R 2c and R 2d are independently selected from hydrogen or (1-4C)alkyl.
  • R 2a , R 2b , R 2c and R 2d are independently selected from hydrogen or methyl.
  • R 2a , R 2b , R 2c and R 2d are hydrogen.
  • pi is 0.
  • p is 0.
  • X a is NR e , wherein R e is selected from hydrogen or (1- 4C)alkyl.
  • R e is selected from hydrogen or (1- 4C)alkyl.
  • X a is NH 2 .
  • the reaction between the one or more oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula C and the one or more oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula D is conducted at a temperature of between 0 °C and 150 °C.
  • the reaction between the one or more oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula C and the one or more oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula D is conducted at a temperature of between 0 °C and 100 °C.
  • the reaction between the one or more oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula C and the one or more oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula D is conducted at a temperature of between 0 °C and 75 °C.
  • the reaction between the one or more oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula C and the one or more oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula D is carried out in a polar solvent.
  • the polar solvent may be used to solubilise the oligonucleotides comprising functional groups of Formulae C and D and thereby facilitate reaction therebetween. Accordingly, it will be understood that the polar solvent selected will depend on the specific oligonucleotides selected.
  • Suitable polar solvents may include, but are not limited to, water, an aqueous buffered solution (e.g. a solution of sodium phosphate or sodium carbonate), DMF, DMSO, acetonitrile, tetrahydrofuran (THF) and mixtures thereof with aqueous salt solutions.
  • the reaction between the one or more oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula C and the one or more oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula D is carried out in an aqueous medium at a pH within the range of 5 to 9.
  • the reaction between the one or more oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula C and the one or more oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula D is carried out at a pH within the range of 6 to 8.
  • the reaction between the one or more oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula C and the one or more oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula D is carried out at a pH within the range of 6.5 to 7.5.
  • a suitable buffer is present to maintain the reaction medium within the pH range 5 to 9. In a further embodiment, the buffer maintains the reaction medium within the pH range 6 to 8. In another embodiment, the buffer maintains the reaction medium within the pH range 6.5 to 7.5.
  • the buffer is selected from the group comprising: phosphate, acetate, borate, citrate, sulfonic acid, ascorbate, linolenate, carbonate and bicarbonate based buffers.
  • the buffer is selected from the group comprising: phosphate, acetate, carbonate and bicarbonate based buffers.
  • the buffer is sodium phosphate or sodium carbonate.
  • the reaction between the one or more oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula C and the one or more oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula D is conducted in the presence of a salt (e.g. NaCI).
  • a salt e.g. NaCI
  • Any suitable concentration of salt may be used.
  • the salt is present in a concentration of between 20 mM and 500 mM. More suitably, the salt is present in a concentration between 50 mM and 300 mM. Yet more suitably, the salt is present in a concentration between 100 mM and 250 mM.
  • the reaction between the one or more oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula C and the one or more oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula D is carried out in the presence of a catalyst.
  • a catalysts may be any suitable reagent that helps to promote the rate of the reaction between the one or more oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula C and the one or more oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula D.
  • the catalyst is an acid and/or a base. Most suitably, the catalyst is a base.
  • suitable bases include NaOH, trimethylamine, diisopropylethylamine and N-methylmorpholine.
  • the reaction between the one or more oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula C and the one or more oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula D is carried out in the presence of one or more peptide coupling agents.
  • Any suitable peptide coupling reagent capable of enhancing the reaction between the functional group of Formula C and the functional group of Formula D may be used. It will be understood that the peptide coupling agent is preferably present when X is OH (i.e. the functional group of Formula C comprises a carboxy group).
  • the peptide coupling reagent is a carbodiimide-based coupling reagent.
  • the peptide coupling reagent is selected from 1- [Bis(dimethylamino)methylene]-1 H-1 ,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate (HATU), 2-(1 H-benzotriazol-1-yl)-1 ,1 ,3,3-tetramethyluronium hexafluorophosphate (HBTU), (Benzotriazol-1-yloxy)tris(dimethylamino)phosphonium hexafluorophosphate (BOP), benzotriazol-1-yl-oxytripyrrolidinophosphonium hexafluorophosphate (PyBOP), 4-(4,6-Dimethoxy-1 ,3,5-triazin-2-yl)-4-methylmorpholinium chloride (DMTMM), N-Ethoxycarbonyl-2-ethoxy-1 ,2-dihydroquinoline (EEDQ), ⁇ ,
  • the coupling reagent is selected from ⁇ , ⁇ '-dicyclohexylcarbodiimide (DCC), ⁇ , ⁇ '-diisopropylcarbodiimide (DIC) or 1-ethyl-3-(3- dimethylaminopropyl)carbodiimide (EDCI).
  • the coupling reagent is 1-ethyl-3-(3- dimethylaminopropyl)carbodiimide (EDCI).
  • Additional activating agents such as, for example, hydroxybenzotriazole (HOBt), N-hydroxy 2-phenyl benzimidazole (HOBI), 1-hydroxy-7-azabenzotriazole (HOAt), N- hydroxysuccinimide (NHS), N-hydroxysulfosuccinimide (Sulfo-NHS), 4-dimethylaminopyridine (DMAP) and ethyl cyano(hydroxyimino)acetate (Oxyma Pure ® ) may also be used together with the peptide coupling reagent defined hereinabove, to further enhance reactivity between the functional group of Formula C and the functional group of Formula D.
  • HOBt hydroxybenzotriazole
  • HOBI N-hydroxy 2-phenyl benzimidazole
  • HOAt 1-hydroxy-7-azabenzotriazole
  • NHS N- hydroxysuccinimide
  • Sulfo-NHS N-hydroxysulfosuccinimide
  • DMAP 4-
  • the activating agent is N-hydroxysuccinimde (NHS), N- hydroxysulfosuccinimide (Sulfo-NHS) or ethyl cyano(hydroxyimino)acetate (Oxyma Pure ® ).
  • the activating agent is N-hydroxysuccinimde (NHS).
  • the reaction between the one or more oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula C and the one or more oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula D is carried out in the presence of both a peptide coupling agent (e.g. EDCI) and an activating agent (e.g. NHS).
  • a peptide coupling agent e.g. EDCI
  • activating agent e.g. NHS
  • the ratio of peptide coupling agent (e.g. EDCI) to activating agent (e.g. NHS) is from between 10: 1 to 1 : 1. More suitably, the ratio of peptide coupling agent (e.g. EDCI) to activating agent (e.g. NHS) is from between 6: 1 to 1 :1.
  • the step of reacting together the one or more oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula C and the one or more oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula D may be repeated sequentially more than once, for example, more than twice, more than three times, more than four times or more than five times, to form an oligonucleotide or oligonucleotide analogue comprising the one or more phosphodiester backbone mimic inter-nucleoside linkages of Formula II.
  • step B) of the present process involves ligating two or more oligonucleotides or oligonucleotide analogues together to form one or more phosphodiester backbone mimic inter-nucleoside linkages of Formula Ilia, shown below, at the point(s) of ligation:
  • e and / f independently denote the points of attachment to the target oligonucleotide or oligonucleotide analogue
  • W2 is selected from O or NH
  • n and m 1 are integers independently selected from 0 to 2; and P2 is an integer selected from 0 or 1 ;
  • step B) of the present process involves ligating two or more oligonucleotides or oligonucleotide analogues together to form one or more phosphodiester backbone mimic inter-nucleoside linkages of Formula ll lb, shown below, at the point(s) of ligation:
  • e and / f independently denote the points of attachment to the target oligonucleotide or oligonucleotide analogue
  • R 3a , R 3b , R 3c and R 3d are independently selected from hydrogen or (1 -4C)alkyl
  • n and m 1 are integers independently selected from 0 to 2;
  • step B) of the present process involves ligating two or more oligonucleotides or oligonucleotide analogues together to form one or more phosphodiester backbone mimic inter-nucleoside linkages of Formula lllc, shown below, at the point(s) of ligation:
  • e and / f independently denote the points of attachment to the target oligonucleotide or oligonucleotide analogue
  • n and m ⁇ are integers independently selected from 0 to 2;
  • step B) of the present process involves ligating two or more oligonucleotides or oligonucleotide analogues together to form one or more phosphodiester backbone mimic inter-nucleoside linkages at the point(s) of ligation of the formula:
  • e denotes the point of attachment to a 3' carbon of a nucleoside of the target oligonucleotide or oligonucleotide analogue
  • f denotes the point of attachment to a 5' carbon of a nucleoside of the target oligonucleotide or oligonucleotide analogue
  • the one or more phosphodiester backbone mimic inter- nucleoside linkages of Formulae I II , Il ia, 1 Mb or ll lc may be prepared using any suitable technique known in the art. The person skilled in the art will be able to select suitable reaction conditions and reagents to prepared the one or more phosphodiester backbone mimic inter- nucleoside linkages of Formulae II I, I lia, 1 Mb or l llc.
  • the one or more phosphodiester backbone mimic inter-nucleoside linkages of Formula II I are formed by reacting:
  • ⁇ e' denotes the point of attachment to the oligonucleotide or oligonucleotide analogue comprising a terminal functional group of Formula E;
  • R 3a and R 3b are independently selected from hydrogen or (1 -4C)alkyl, wherein each (1 -4C)alkyl is optionally substituted with one or more NH2, OH or SH; and
  • n is an integer selected from 0 to 2;
  • oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula F shown below:
  • f denotes the point of attachment to the oligonucleotide or oligonucleotide analogue comprising a terminal functional group of Formula F;
  • R 3c and R 3d are independently selected from hydrogen or (1 -4C)alkyl, wherein each (1 -4C)alkyl is optionally substituted with one or more NH2, OH or SH;
  • R 3e is selected from and hydrogen or (1 -4C)alkyl
  • W2 is selected from O, S or NR Z , wherein R z is selected from hydrogen or (1 - 4C)alkyl
  • mi is an integer selected from 0 to 2;
  • P2 is an integer selected from 0 or 1 ;
  • reaction is optionally conducted in the presence of one or more of the following:
  • s e denotes the point of attachment to a 3' carbon of a nucleoside of the target oligonucleotide or oligonucleotide analogue
  • ⁇ f denotes the point of attachment to a 5' carbon of a nucleoside of the target oligonucleotide or oligonucleotide analogue
  • R 3a , R 3b , R 3c and R 3d are independently selected from hydrogen or (1 -4C)alkyl.
  • R 3a , R 3b , R 3c and R 3d are independently selected from hydrogen or methyl.
  • R 3a , R 3b , R 3c and R 3d are hydrogen.
  • R 3e is selected from hydrogen or methyl.
  • R 3e is hydrogen.
  • W2 is selected from O or NH.
  • P2 is 0.
  • n and mi are integer independently selected from 0 or 1 .
  • m and mi are 0.
  • the sum of integers m, mi and P2 is equal to 0, 1 , 2, 3 or 4.
  • the sum of integers m, mi and p2 is equal to 0, 1 , 2 or 3. More suitably, the sum of integers m, mi and P2 is equal to 0, 1 or 2. Most suitably, the sum of integers m, mi and P2 is equal to 0 or 1 .
  • the reaction between the one or more oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula E and the one or more oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula F is conducted in the presence of one or more peptide coupling reagents.
  • Suitable peptide coupling reagents are analogous to those described in paragraphs [0098] and [0099] hereinabove.
  • Additional activating may also be used together with the peptide coupling reagent defined hereinabove, to further enhance reactivity between the functional group of Formula E and the functional group of Formula F.
  • Suitable activating agents are analogous to those described in paragraphs [00100] and [00101] hereinabove.
  • the step of reacting together the one or more oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula E and the one or more oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula F may be repeated sequentially more than once, for example, more than twice, more than three times, more than four times or more than five times, to form an oligonucleotide or oligonucleotide analogue comprising the one or more phosphodiester backbone mimic inter-nucleoside linkages of Formula III.
  • the one or more alkyne terminating oligonucleotides comprising a terminal functional group of Formula A, or the one or more azide terminating oligonucleotides comprising a terminal functional group of Formula B further comprise a terminal functional group selected from Formula C, Formula D, Formula E or Formula F, as defined hereinabove.
  • the one or more alkyne terminating oligonucleotides comprising a terminal functional group of Formula A further comprise a terminal functional group selected from Formula D or Formula F, as defined hereinabove.
  • the one or more azide terminating oligonucleotides comprising a terminal functional group of Formula B further comprise a terminal functional group selected from Formula C or Formula E, as defined hereinabove.
  • the one or more alkyne terminating oligonucleotides comprising a terminal functional group of Formula A further comprise a terminal functional group selected from Formula C or Formula E, as defined hereinabove.
  • the one or more azide terminating oligonucleotides comprising a terminal functional group of Formula B further comprise a terminal functional group selected from Formula D or Formula F, as defined hereinabove.
  • a process for preparing a target oligonucleotide or oligonucleotide analogue comprising two or more different phosphodiester mimic inter-nucleoside linkages comprising the steps of:
  • V and W are independently selected from O, S or NR X , wherein R x is selected from hydrogen or (1 -4C)alkyl;
  • x, xi , z and zi are integers independently selected from 0 to 2; and y and yi are integers independently selected from 0 to 1 ;
  • ⁇ f independently denote the points of attachment to the target oligonucleotide or oligonucleotide analogue
  • R 2a , R 2b , R 2c , R 2d , R 2e , R 3a , R 3b , R 3c and R 3d are independently selected from hydrogen or (1-4C)alkyl
  • W2 is selected from O or NH
  • n, rii, m and m 1 are integers independently selected from 0 to 2; and p and P2 are integers independently selected from 0 to 1 ;
  • steps A) and B) above are conducted in either order;
  • x, xi , z and zi are integers independently selected from 0 to 2; and y and yi are integers independently selected from 0 to 1 ;
  • / c d e and / f independently denote the points of attachment to the target oligonucleotide or oligonucleotide analogue
  • R 2a , R 2b , R 2c , R 2d and R 2e are independently selected from hydrogen or (1 - 4C)alkyl, n, ⁇ , m and m ⁇ are integers independently selected from 0 to 2; and and wherein steps A) and B) above are conducted in either order;
  • / a denotes the point of attachment to a 3' carbon of a nucleoside of the target oligonucleotide or oligonucleotide analogue
  • ⁇ denotes the point of attachment to a 5' carbon of a nucleoside of the target oligonucleotide or oligonucleotide analogue
  • ligating two or more oligonucleotides or oligonucleotide analogues together to form one or more phosphodiester backbone mimic inter-nucleoside linkages at the point(s) of ligation selected from:
  • / c denotes the point of attachment to a 3' carbon of a nucleoside of the target oligonucleotide or oligonucleotide analogue
  • ⁇ d denotes the point of attachment to a 5' carbon of a nucleoside of the target oligonucleotide or oligonucleotide analogue
  • e denotes the point of attachment to a 3' carbon of a nucleoside of the target oligonucleotide or oligonucleotide analogue
  • f denotes the point of attachment to a 5' carbon of a nucleoside of the target oligonucleotide or oligonucleotide analogue
  • steps A) and B) above are conducted in either order.
  • a catalyst e.g. a copper (I) species
  • ⁇ a' denotes the point of attachment to the alkyne terminating oligonucleotide or oligonucleotide analogue
  • ' denotes the point of attachment to the azide terminating oligonucleotide or oligonucleotide analogue
  • V and W are independently selected from O, S or NR X , wherein R x is selected from hydrogen or (1 -4C)alkyl;
  • x, xi , z and zi are integers independently selected from 0 to 2; and y and yi are integers independently selected from 0 to 1 ; and
  • ⁇ f independently denote the points of attachment to the target oligonucleotide or oligonucleotide analogue
  • / c denotes the point of attachment to the oligonucleotide or oligonucleotide analogue comprising a terminal functional group of Formula C1 ;
  • ⁇ d' denotes the point of attachment to the oligonucleotide or oligonucleotide analogue comprising a terminal functional group of Formula D1 ;
  • ⁇ e' denotes the point of attachment to the oligonucleotide or oligonucleotide analogue comprising a terminal functional group of Formula E1
  • f denotes the point of attachment to the oligonucleotide or oligonucleotide analogue comprising a terminal functional group of Formula F1 ;
  • X is selected from OR" 2 , wherein R" 2 is selected from hydrogen or (1 - 6C)alkyl;
  • R 2a , R 2b , R 2c , R 2d , R 2e , R 3a , R 3b , R 3c and R 3d are independently selected from hydrogen or (1 -4C)alkyl
  • n, ni , m and m ⁇ are integers independently selected from 0 to 2; and p is an integer selected from 0 to 1 ;
  • steps A) and B) above are conducted in either order; with the proviso that:
  • ⁇ a' denotes the point of attachment to the alkyne terminating oligonucleotide or oligonucleotide analogue
  • ' denotes the point of attachment to the azide terminating oligonucleotide or oligonucleotide analogue
  • x, xi , z and zi are integers independently selected from 0 to 2; and y and yi are integers independently selected from 0 to 1 ; and
  • Formula ll lc wherein the one or more phosphodiester backbone mimic inter-nucleoside linkages of Formula lib are formed at the point(s) of ligation by reacting:
  • oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula D2, shown below:
  • oligonucleotides or oligonucleotide analogues comprising a terminal functional group of Formula F2 shown below:
  • Formula F2 optionally, in the presence of one or more peptide coupling reagents (e.g. 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide);
  • one or more peptide coupling reagents e.g. 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide
  • ⁇ f independently denote the points of attachment to the target oligonucleotide or oligonucleotide analogue
  • / c denotes the point of attachment to the oligonucleotide or oligonucleotide analogue comprising a terminal functional group of Formula C2;
  • ⁇ d' denotes the point of attachment to the oligonucleotide or oligonucleotide analogue comprising a terminal functional group of Formula D2;
  • ⁇ e' denotes the point of attachment to the oligonucleotide or oligonucleotide analogue comprising a terminal functional group of Formula E2;
  • ⁇ f denotes the point of attachment to the oligonucleotide or oligonucleotide analogue comprising a terminal functional group of Formula F2;
  • X is OH
  • R 2a , R 2b , R 2c and R 2d are independently selected from hydrogen or methyl
  • n, rii , m and m ⁇ are integers independently selected from 0 to 2;
  • steps A) and B) above are conducted in either order; with the proviso that:
  • an oligonucleotide or oligonucleotide analogue comprising:
  • R 1 a , R 1 b , R 1 c , R 1 d , R 1 e , R 1 f , R 1 9 and R 1 h are each independently selected from hydrogen or (1 -4C)alkyl, wherein each (1 -4C)alkyl is optionally substituted with one or more NH2, OH or SH;
  • V and W are independently selected from O, S or NR X , wherein R x is selected from hydrogen or (1 -4C)alkyl;
  • x, xi, z and zi are integers independently selected from 0 to 2; and y and yi are integers independently selected from 0 to 1 ;
  • ⁇ f independently denote the points of attachment to the target oligonucleotide or oligonucleotide analogue
  • R 2a , R 2b , R 2c , R 2d , R 3a , R 3b , R 3c and R 3d are independently selected from hydrogen or (1-4C)alkyl, wherein each (1-4C)alkyl is optionally substituted with one or more NH2, OH or SH
  • R 2e and R 3e are independently selected from hydrogen or (1-4C)alkyl
  • Vi, Wi and W2 are independently selected from O, S or NR Z , wherein R z is selected from hydrogen or (1-4C)alkyl;
  • Q is selected from S or O
  • n, ni, m and mi are integers independently selected from 0 to 2; and p, pi and P2 are integers independently selected from 0 to 1 ;
  • the oligonucleotide or oligonucleotide analogue comprises one or more phosphodiester backbone mimic inter-nucleoside linkages of Formula I and one or more phosphodiester backbone mimic inter-nucleoside linkages of Formula II.
  • the oligonucleotide or oligonucleotide analogue comprises one phosphodiester backbone mimic inter-nucleoside linkage of Formula I and one phosphodiester backbone mimic inter- nucleoside linkage of Formula II.
  • the oligonucleotide or oligonucleotide analogue comprises one or more phosphodiester backbone mimic inter-nucleoside linkage of Formula I and one or more phosphodiester backbone mimic inter-nucleoside linkage of Formula III.
  • the oligonucleotide or oligonucleotide analogue comprises one phosphodiester backbone mimic inter-nucleoside linkages of Formula I and one phosphodiester backbone mimic inter- nucleoside linkages of Formula III.
  • R 1a , R 1 b , R 1c , R 1d , R 2a , R 2b , R 2c , R 2d , R 3a , R 3b , R 3c and R 3d are independently selected from hydrogen or (1-4C)alkyl.
  • R 1a , R 1 b , R 1c , R 1d , R 2a , R 2b , R 2c , R 2d , R 3a , R 3b , R 3c and R 3d are independently selected from hydrogen or methyl.
  • R 1a , R 1 b , R 1c , R 1d , R 2a , R 2b , R 2c , R 2d , R 3a , R 3b , R 3c and R 3d are hydrogen.
  • V and W are independently selected from O or NR X , wherein R x is selected from hydrogen or (1-4C)alkyl.
  • V and W are independently selected from O or NR X , wherein R x is selected from hydrogen or methyl. More suitably, V and W are independently selected from O or NH2. Most suitably, V and W are both O.
  • the sum of integers x, xi , y, yi , z and zi is either 0, 1 , 2, 3, 4 or 5.
  • the sum of integers x, xi , y, yi , z and zi is either 0, 1 , 2, 3 or 4. More suitably, the sum of integers x, xi , y, yi , z and zi is either 1 , 2, 3 or 4.
  • the sum of integers x, xi , y, yi , z and zi is either 1 , 2 or 3.
  • Q is oxygen
  • pi is 0.
  • p is 0.
  • Vi and Wi are independently selected from O or NR Z , wherein R z is selected from hydrogen or (1-4C)alkyl.
  • R z is selected from hydrogen or (1-4C)alkyl.
  • Vi and Wi are independently selected from O or NR Z , wherein R z is selected from hydrogen or methyl. More suitably, Vi and Wi are independently selected from O or NH. Most suitably, Vi and Wi are both oxygen.
  • the sum of integers n, ni , p is equal to 2, 3 or 4.
  • the sum of integers n, ni , p is equal to 2 or 3.
  • the sum of integers n, ni , p is equal to 2.
  • the sum of integers m and mi is equal to 0, 1 , 2, 3 or 4.
  • the sum of integers m and mi is equal to 0, 1 , 2 or 3. More suitably, the sum of integers m and mi is equal to 0, 1 or 2. Most suitably, the sum of integers m and mi is equal to 0 or 1.
  • s e denotes the point of attachment to a 3' carbon of a nucleoside of the oligonucleotide or oligonucleotide analogue and ⁇ f denotes the point of attachment to a 5' carbon of a nucleoside of the oligonucleotide or oligonucleotide analogue.
  • the one or more phosphodiester backbone mimic inter- nucleoside linkages of Formula I are selected from one of the following:
  • Zi and ⁇ 2 are independently selected from O or NH; a denotes the point of attachment to a 3' carbon of a nucleoside of the oligonucleotide or oligonucleotide analogue;
  • ⁇ denotes the point of attachment to a 5' carbon of a nucleoside of the oligonucleotide or oligonucleotide analogue.
  • the one or more phosphodiester backbone mimic inter- nucleoside linkages of Formula I I are selected from one of the following:
  • / c denotes the point of attachment to a 3' carbon of a nucleoside of the oligonucleotide or oligonucleotide analogue
  • ⁇ d denotes the point of attachment to a 5' carbon of a nucleoside of the oligonucleotide or oligonucleotide analogue.
  • the one or more phosphodiester backbone mimic inter- nucleoside linkages of Formula II I is of the following formula:
  • e denotes the point of attachment to a 3' carbon of a nucleoside of the oligonucleotide or oligonucleotide analogue
  • f denotes the point of attachment to a 5' carbon of a nucleoside of the oligonucleotide or oligonucleotide analogue.
  • an oligonucleotide or oligonucleotide analogue comprising:
  • x, xi , z and zi are integers independently selected from 0 to 2; and y and yi are integers independently selected from 0 to 1 ;
  • ⁇ f independently denote the points of attachment to the target oligonucleotide or oligonucleotide analogue
  • R 2a , R 2b , R 2c and R 2d are independently selected from hydrogen or (1- 4C)alkyl
  • n, ni , m and m ⁇ are integers independently selected from 0 to 2; and with the proviso that:
  • an oligonucleotide or oligonucleotide analogue comprising:
  • Zi and ⁇ 2 are independently selected from O or NH;
  • / a denotes the point of attachment to a 3' carbon of a nucleoside of the oligonucleotide or oligonucleotide analogue
  • ⁇ denotes the point of attachment to a 5' carbon of a nucleoside of the oligonucleotide or oligonucleotide analogue
  • c denotes the point of attachment to a 3' carbon of a nucleoside of the target oligonucleotide or oligonucleotide analogue
  • ⁇ d denotes the point of attachment to a 5' carbon of a nucleoside of the target oligonucleotide or oligonucleotide analogue
  • e denotes the point of attachment to a 3' carbon of a nucleoside of the target oligonucleotide or oligonucleotide analogue
  • f denotes the point of attachment to a 5' carbon of a nucleoside of the target oligonucleotide or oligonucleotide analogue.
  • oligonucleotides may be used therapeutically for the treatment of various diseases and disorders, such as, for example, cancer, genetic disorders and infection.
  • the present invention provides a use of an oligonucleotide or oligonucleotide analogue, as defined herein, in the treatment of a disease or disorder.
  • the disease or disorder is cancer.
  • the disease or disorder is a genetic disorder.
  • the disease or disorder is an infection.
  • a method for the treatment of a disease or disorder comprising administering a therapeutically effective amount of an oligonucleotide or oligonucleotide analogue, as defined herein, or a pharmaceutically acceptable salt or solvate thereof.
  • the disease or disorder is cancer.
  • the disease or disorder is a genetic disorder.
  • the disease or disorder is an infection.
  • oligonucleotide or oligonucleotide as defined herein, in the synthesis of genes.
  • oligonucleotide or oligonucleotide, as defined herein as a template in the synthesis of genes.
  • oligonucleotide or oligonucleotide as defined herein, as:
  • interference RNA e.g. siRNA
  • an RNA component of a CRISPR-Cas system e.g. crRNA, tracrRNA or
  • oligonucleotide or oligonucleotide analogue as defined herein, as:
  • PCR polymerase chain reaction
  • a method for amplifying an oligonucleotide or oligonucleotide analogue sequence comprising the steps of:
  • step 2 2) carrying out a polymerase chain reaction (PCR) using the oligonucleotide or oligonucleotide analogue of step 1 as a template.
  • PCR polymerase chain reaction
  • a method for replicating an oligonucleotide or oligonucleotide analogue sequence comprising the steps of:
  • step 2 2) carrying out a replication reaction using the oligonucleotide or oligonucleotide analogue of step 1 as a template.
  • RNA sequence comprising the steps of:
  • step 2 2) transcribing the oligonucleotide or oligonucleotide analogue of step 1 to form a
  • RNA transcript ribonucleic acid
  • a method for producing a deoxyribonucleic acid (DNA) sequence comprising the steps of:
  • step 2 2) reverse-transcribing the oligonucleotide or oligonucleotide analogue of step 1 to form a complementary deoxyribonucleic acid (cDNA) sequence.
  • cDNA complementary deoxyribonucleic acid
  • a method for preparing a protein or peptide comprising the steps of: 1) providing an oligonucleotide or oligonucleotide ananlogue as defined herein; and
  • step 2 2) translating the oligonucleotide or oligonucleotide analogue of step 1 to form the protein or peptide.
  • Class 1 systems have a multi-subunit crRNA-effector complex such as Cascade- Cas3, whereas Class 2 systems have a crRNA-effector complex having a single Cas protein, such as Cas9, Cas12 (previously referred to as Cpfl) and Cas 13a (previously referred to as C2c2).
  • Cpfl Cas9
  • Cas12 previously referred to as Cpfl
  • Cas 13a previously referred to as C2c2
  • Type II systems there is a second RNA component tracrRNA which hybridises to crRNA to form a crRNA:tracr RNA duplex, these two RNA components may be linked to form single guide RNA.
  • RNA components in such CRISPR-Cas systems may be adapted to be an oligonucleotide in accordance with the invention or a dinucleotide of the invention may be comprised within an RNA components of a CRISPR-Cas system.
  • RNA component e.g., to guide the crRNA:effector complex to a target site.
  • Standard methods are known in the art for testing whether oligonucleotides of the invention when used as such CRISPR RNA components retain the desired function (e.g. by comparing the desired function to that of a control CRISPR RNA component which has the same nucleosides without any-triazole linker moieties between nucleosides or locked nucleosides).
  • CRISPR RNA components or "RNA component of a CRISPR-Cas system” is used herein, as in most CRISPR-Cas systems, the nucleic acid sequences which guide the effector protein(s) to a desired target sequence are RNA components.
  • CRISPR hybrid DNA/RNA polynucleotides which can also function to guide effector protein(s) to a desired target site in a DNA or RNA sequence are also known in the art - see for example Rueda et al. (Mapping the sugar dependency for rational generation of a DNA-RNA hybrid- guided Cas9 endonuclease, Nature Communications 8, Article Number: 1610 (2017)).
  • reference to CRISPR RNA components herein may also encompass hybrid RNA/DNA components such as crDNA/RNA, tracrDNA/RNA or gDNA/RNA.
  • the oligonucleotides of the invention may have particular utility in in vivo gene therapy applications.
  • one way of carrying out in vivo therapy using a Type II CRISPR-Cas system involves delivering the Cas9 and tracrRNA via a virus, which can assemble inactive complexes inside of cells.
  • the crRNA can then be administered later to assemble and selectively activate CRISPR/Cas9 complexes, which would then go on to target and edit specific sites in the human genome, such as disease relevant genes (Gagnon and Corey, Proc. Natl. Acad. Sci. USA 1 12: 15536-15537, 2015; Rahdar, et al, Proc. Natl. Acad. Sci.
  • crRNA:effector complexes i.e. CRISPR-Cas complexes, such as CRISPR/Cas9
  • CRISPR-Cas complexes such as CRISPR/Cas9
  • Oligonucleotides of the invention when used as crRNAs may improve this approach by offering stability against degradation.
  • the oligonucleotides of the invention when used as CRISPR RNA components can advantageously be used for the various applications of CRISPR-Cas systems known in the art including: gene-editing, gene activation (CRISPRa) or gene interference (CRISPRi), base-editing, multiplex engineering (CRISPRm), DNA amplification, diagnostics (e.g. SKERLOCK or DETECTR), cell recording (e.g. CAMERA), typing bacteria, antimicrobial applications, synthesising new chemicals etc..
  • CRISPR-Cas systems known in the art including: gene-editing, gene activation (CRISPRa) or gene interference (CRISPRi), base-editing, multiplex engineering (CRISPRm), DNA amplification, diagnostics (e.g. SKERLOCK or DETECTR), cell recording (e.g. CAMERA), typing bacteria, antimicrobial applications, synthesising new chemicals etc.
  • the oligonucleotides of the invention can be used as RNA components such as the "sacrificial RNA molecules" used to create a signal.
  • Figure 1 shows: A) a schematic representation of the templated simultaneous orthogonal phosphoramidate and CuAAC ligation reactions; and B) a schematic representation of the concept of single tube gene assembly by phosphoramidate ligation followed by transcription of modified DNA.
  • Figure 2 shows the 12% denaturing PAGE analysis of 3'-phosphate/5'-amine oligonucleotides ligation to give the phosphoramidate-containing product.
  • Lane 1 phosphoramidate reaction mixture (ODN 1 , 81-mer), lane 2; reference starting material ODN 3.
  • ODN 3 An excess of the amine oligonucleotide (ODN 3) was used, resulting in a residual lower band and complete consumption of the phosphate oligonucleotide.
  • Figure 3 shows the 12% denaturing PAGE analysis for optimisation of 3'-phosphate/5'-amine oligonucleotides ligation to give the phosphoramidate template (ODN 1 , 81-mer) top bands. Lanes 1-8; reaction mixture after 5, 10, 15, 30, 45, 60 120 and 360 min. An excess of the amine oligonucleotide was used resulting in a residual lower band and consumption of the phosphate oligonucleotide
  • Figure 4 shows the PCR amplification of the 81-mer phosphoramidate DNA template (ODN 1).
  • Lane 1 50 bp DNA ladder, lane 2; PCR using the phosphoramidate-containing template ODN 1 , lane 3; control PCR without a phosphoramidate linkage.
  • Figure 5 shows the 6% denaturing PAGE analysis of 3'-phosphate/5'-amine oligonucleotide ligation to give the product containing two phosphoramidate linkages (ODN 5, 303-mer).
  • Figure 6 shows the PCR amplification of the 303-mer DNA template ODN 5.
  • Lane 1 50 bp DNA ladder, lane 2; control PCR without phosphoramidate linkage, lane 3 and 4; PCR using the phosphoramidate-containing template ODN 5 (303-mer).
  • Figure 7 shows the sequence alignment of 20 Clones from PCR of ODN 5 (2x phosphoramidate linkages in 303-mer section of EGFP gene, in red with the ligation points in blue). All the sequences are identical indicating the biocompatibility of the phosphoramidate linkage. Only a few mutations were observed and these are far from the ligation points (see Table 1). The mutations could have occurred during sequencing or during oligonucleotide synthesis and purification.
  • Figure 8 shows: A) PCR amplification of the double stranded phosphoramidate EGFP gene (762-mer). Lane 1 ; 100 bp DNA ladder, lane 2; PCR using the double strand phosphoramidate EGFP gene (762-mer), lane 3; control PCR for individual oligos without ligation.
  • Figure 9 shows the data from cloning and sequencing of the PCR product from the phosphoramidate EGFP gene (762-mer) showing the faithful copying at the ligation points (shown in red in the sequence text) (A) and the water mark GTACA (B). All clones show the water mark which was inserted into the sequence of the synthesised EGFP gene as a unique signature to differentiate it from potential contaminant DNA.
  • Figure 10 shows the data from cloning and sequencing of the PCR product of the phosphoramidate EGFP gene (762-mer). The data show that the polymerase copied the gene faithfully including the bases around the phosphoramidate ligation points (shown in red in the inserted sequence text). Only one deletion mutation was found in this clone.
  • Figure 11 shows the transcription of 79-mer unmodified and phosphoramidate-containing DNA templates.
  • Lane 1 and 2 reaction using phosphoramidate template (ODN 27) and short coding strand (ODN 33) for 2 and 4 h respectively; lane 3; template ODN 31 lane 4 and 5, reaction using control template (ODN 31) and short coding strand (ODN 33) for 2 and 4 h respectively; Lane 6 and 7, reaction using phosphoramidate template (ODN 27) and long coding strand (ODN 32) for 2 and 4 h respectively; lane 8 and 9, reaction using control template (ODN 31) and long coding strand (ODN 32) for 2 and 4 h respectively. 15% polyacrylamide gel.
  • Figure 12 shows the ES- Mass spectra of A), the RNA transcripts from the phosphoramidate- containing template (ODN 27) and B), the normal template (ODN 31).
  • the transcripts have the expected 5'-triphosphate and an additional 3'-cytidine.
  • Required mass 17.236 KD. Found mass, 17.239 (transcript with 5'-triphosphate), 17.261 (transcript with 5'-triphosphate + Na + ) and 17.566 (transcript with 5'-triphosphate and 3'-cytidine).
  • Figure 13 shows the orthogonal phosphoramidate and CuAAC reactions for ligation of three oligonucleotides to make a 303-mer product.
  • Lane 1 ODN 6, Iane2; 2 x CuAAC reactions, lane 3; 2 x phosphoramidate reactions, lane 4; orthogonal phosphoramidate and CuAAC reactions.
  • Figure 14 shows the orthogonal phosphoramidate and CuAAC reactions for ligation of three oligonucleotides to make a fluorescent 331 -mer product.
  • Lane 1 starting material ODN 39, Iane2; orthogonal phosphoramidate and CuAAC reactions using ODN 39 (3'-phosphate, 5'- Cy3), ODN 38 (3'-propargyl and 5'-amine) and ODN 40 (5'-azide).
  • ODN 39 3'-phosphate, 5'- Cy3
  • ODN 38 (3'-propargyl and 5'-amine
  • ODN 40 (5'-azide).
  • Figure 15 shows a schematic representation of the orthogonal phosphoramidate and CuAAC reactions for ligation of three oligonucleotides to make a 303-mer product. Also shown is the gel electrophoresis trace. Lane 1 ; orthogonal phosphoramidate and CuAAC reactions using ODN 6 (3'-phosphate), ODN 38 (3'-propargyl and 5'-amine) and ODN 37 (5'-azide), Iane2; starting material ODN 6. Denaturing 8% polyacrylamide gel-electrophoresis.
  • Figure 16 shows a schematic representation of how the process of the present invention may be applied using solid supported chemistry.
  • Standard DNA phosphoramidites, solid supports, and additional reagents were purchased from Link Technologies Ltd and Applied Biosystems Ltd.
  • 5'- Monomethoxytritylamino-2'-deoxythymidine,3'-[(2-cyanoethyl)-(N,N-diisopropyl)]- phosphoramidite was purchased from Glen Research (Catalog Number: 10-1932-90).
  • oligonucleotides were synthesized on an Applied Biosystems 394 automated DNA/ RNA synthesizer using a standard 0.2 or 1.0 /ymole phosphoramidite cycle of acid- catalyzed detritylation, coupling, capping, and iodine oxidation. Stepwise coupling efficiencies and overall yields were determined by the automated trityl cation conductivity monitoring facility and in all cases were >98.0%.
  • oligonucleotides Purification of oligonucleotides was carried out by reversed-phase HPLC on a Gilson system using a Brownlee Aquapore column (C8, 8 mm x 250 mm, 300A pore) with a gradient of acetonitrile in triethylammonium bicarbonate (TEAB) increasing from 0% to 50% buffer B over 30 min with a flow rate of 4 mL/min (buffer A: 0.1 M triethylammonium bicarbonate, pH 7.0, buffer B: 0.1 M triethylammonium bicarbonate, pH 7.0 with 50% acetonitrile). Elution of oligonucleotides was monitored by ultraviolet absorption at 295 or 300 nm. After HPLC purification, oligonucleotides were freeze dried then dissolved in water without the need for desalting.
  • TEAB triethylammonium bicarbonate
  • oligonucleotides For long oligonucleotides, polyacrylamide gel electrophoresis was used for purification. Oligonucleotide bands were then visualized using a UV lamp and the desired bands excised, crushed and soaked in water overnight at 37 °C. After evaporation, samples were desalted using NAP-25 followed by NAP-10 columns (G.E. Healthcare Life Sciences). All oligonucleotides were characterised by electrospray mass spectrometry using a Bruker micrOTOF II focus ESI-TOF MS instrument in ESI " mode. Data were processed using MaxEnt.
  • GoTaq DNA polymerase was used to generate a PCR product from the 81 -mer template (ODN 1) which includes one phosphoramidate linkage.
  • ODN 1 81 -mer template
  • Reagents and conditions 4 ⁇ _ of 5x buffer (Promega green PCR buffer) was used in a total reaction volume of 20 ⁇ _ with 5 ng of the DNA template, 0.5 mM of each primer, 0.2 mM dNTP and 1.0 unit of GoTaq polymerase.
  • the reaction mixture was loaded onto a 2% agarose gel in 1xTBE buffer.
  • 5 X Promega green PCR buffer was provided with the enzyme (Promega GoTaq DNA polymerase), pH 8.5 containing 7.5 mM MgC to give a final Mg 2+ concentration of 1.5 mM.
  • the buffer contains Tris.HCI, KCI and two dyes (blue and yellow) that separate during electrophoresis to monitor the migration process.
  • Oligonucleotides ODN 6, ODN 7, ODN 8 with splints ODN 9 and ODN 10 were annealed by heating at 90 °C for 5 min then cooling slowly to room temperature.
  • a solution of 1-(2-hydroxyethyl) imidazole (1.0 M, 10 ⁇ _) (0.1 M final concentration) and EDC.HCI (6.0 M, 10 ⁇ _) (0.6 M final concentration) was added to the annealed oligonucleotides and the reaction mixture was kept at room temperature for 2 h. Reagents were removed using NAP-25 gel-filtration column and the ligated DNA was analysed by denaturing 6% polyacrylamide gel electrophoresis.
  • TC total clones
  • NMC non-mutant clones
  • MC mutant clones
  • IM insertion mutation
  • DM deletion mutation
  • SM substituted mutation
  • LPM ligation point mutation
  • TB total number of bases
  • TM total number of mutation.
  • EDC.HCI (30 mg) and a solution of 1-(2-hydroxyethyl) imidazole (1.0 M, 30 ⁇ _) were added to the annealed oligonucleotides and the reaction mixture was kept at room temperature for 2 h. Reagents were removed using NAP-25 gel-filtration column and the ligated DNA was analysed by denaturing 4% polyacrylamide gel electrophoresis. The band was cut and DNA was extracted then used in PCR.
  • a PCR product from the whole EGFP gene duplex was generated using GoTaq DNA polymerase under the same conditions explained above for PCR of 81-mer ODN 1.
  • the PCR product was purified by extraction from a 2% agarose gel ( Figure 8A) using a QIAquick Gel Extraction kit. It was then inserted into the vector pCR2.1. Cloning into the TOPO vector was done with a standard TOPO cloning protocol. Automated Sanger DNA sequencing was performed; and the data is shown in Figure 9 and Figure 10. This procedure was carried out by Eurofins GmbH.
  • Oligonucleotide bands were then visualized using a UV lamp and the desired bands excised, crushed and soaked in buffer (50 mM Tris-HCI, pH 7.5, 25 mM NaCI) overnight at 37 °C. After evaporation of the solvent, samples were desalted using two NAP-25 columns (G.E. Healthcare Life Sciences, cat. no. 17-0852-01). The expected product was confirmed by mass spectrometry of transcripts formed from phosphoramidate-containing and control strands using the long coding strand.
  • RNA transcripts were precipitated by adding sodium acetate (3 M, 50 ⁇ ) followed by isopropanol (150 ⁇ ). The mixture was left at -80 °C for 3 h then centrifuged at 4 °C and 13 RPM for 10 min. The RNA was dried then dissolved in 20 ⁇ water where 0.5 ⁇ was analysed by mass spectrometry. The crude transcripts gave the same (expected) mass for phosphoramidate and control templates.
  • a solution of Cu' click catalyst was prepared from fr/s-hydroxypropyltriazole (0.7 ⁇ in 0.2 M NaCI, 17.0 ⁇ _), and sodium ascorbate (1.0 ⁇ in 0.2 M NaCI, 2.0 ⁇ _) and CuS0 4 .5H 2 0 (0.1 ⁇ in 0.2 M NaCI, 1.0 ⁇ _) was added to the above annealed oligonucleotides. The mixture was kept at room temperature for 2 h before analysis by denaturing 4% polyacrylamide gel electrophoresis.
  • a solution of Cu' click catalyst was prepared from fr/s-hydroxypropyltriazole (0.35 ⁇ in 0.2 M NaCI, 17.0 ⁇ _), sodium ascorbate (1.0 ⁇ in 0.2 M NaCI, 1.0 ⁇ _) and CuS0 4 .5H 2 0 (0.1 ⁇ in 0.2 M NaCI, 1.0 ⁇ _) followed by EDC.HCI (10 mg) and a solution of 1-(2-hydroxyethyl) imidazole (1.0 M, 10 ⁇ _) were added to the annealed oligonucleotides and the reaction mixture was kept at room temperature for 2 h before being analysed by denaturing 8% polyacrylamide gel electrophoresis.
  • Figure 13 shows similar results for all three reactions indicating the orthogonality of CuAAC click and phosphoramidate ligations.
  • the orthogonal CuAAC and phosphoramidate reactions were repeated under the same conditions using fluorescently labelled oligonucleotide ODN 39, and gave a similar result as indicated by denaturing 8% polyacrylamide gel-electrophoresis ( Figure 14).
  • ODN 7 AAATTTATTTGTACTACTGGTAAATTGCCAGTTCCATGGCCAACCTT
  • ODN 8 I AAACAACATGACTTTTTCAAGTCTGCCATGCCAGAAGGTTATGTTCA
  • SeqI D 13 ⁇ ODN 11 GTTCTTTCTTGAACATAA PCR Primer 1 for 303-mer template j SeqI D 14 j ODN 12 ; AAGCTTT ATTAAAAT GTCTA PCR Primer 2 for 303-mer template SeqID 15 pTCGACGGTACCGCGGGCCCGGGATCCACCGGTCGCCACCATGGT
  • SeqID 16 pGGCCGCTTTACTTGTACAGCTCGTCCATGCCGAGAGTGATCCCGG
  • SeqID 17 gTCGACGGTACCGCGGGCCCGGGATCCACCGGTCGCCACCATGGT
  • ODN 27 TTCTCCCTATAGTGAGTCGTATTAGGACCAGCGT transcription template
  • SeqID 30 j ⁇ TCGCCCTTGCTCACCATGGTGGCGACTTCTCCCTATAGTGAGTCG
  • ODN 31 TTCTCCCTATAGTGAGTCGTATTAGGACCAGCGT control for transcription
  • SeqID 34 j ACGCTGGTCCTAATACGACTCACTATAGGGAGAAGTCGCCACCATG
  • SeqID 35 j ACGCTGGTCCTAATACGACTCACTATAGGGAGAAGTCGCC short
  • SeqID 36 j pppGGGAGAAGUCGCCACCAUGGUGAGCAAGGGCGAGGAGCUGU j
  • SeqID 37 j AAGCTTTATTAAAATGTCTAAAGGTGAAGAATTATTCACTGGTGTTG j
  • SeqID 39 JTTTCGGTTATGGTGTTCAATGTTTTGCTAGATACCCAGATCATATGA

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention concerne un procédé de préparation d'oligonucléotides ou d'analogues d'oligonucléotides comprenant des liaisons internucléosidiques de type triazole et (phosphore)amidate. La présente invention concerne également des oligonucléotides et analogues d'oligonucléotides formés à partir dudit procédé et l'utilisation de ces oligonucléotides et analogues d'oligonucléotides dans la synthèse de gènes, en tant qu'agents thérapeutiques destinés à être utilisés dans le traitement de certaines maladies et troubles (par exemple le cancer) et en tant que modèles dans des réactions en chaîne de la polymérase, des processus de réplication d'ADN, des processus de transcription d'ARN et/ou des processus de traduction.
PCT/GB2018/052555 2017-09-07 2018-09-07 Oligonucléotides comprenant des liaisons internucléosidiques de type triazole et (phosphore)amidate, leur procédé de préparation et leurs utilisations WO2019048881A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB1714403.1A GB201714403D0 (en) 2017-09-07 2017-09-07 Process for oligonucleotide synthesis
GB1714403.1 2017-09-07

Publications (1)

Publication Number Publication Date
WO2019048881A1 true WO2019048881A1 (fr) 2019-03-14

Family

ID=60117291

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2018/052555 WO2019048881A1 (fr) 2017-09-07 2018-09-07 Oligonucléotides comprenant des liaisons internucléosidiques de type triazole et (phosphore)amidate, leur procédé de préparation et leurs utilisations

Country Status (2)

Country Link
GB (1) GB201714403D0 (fr)
WO (1) WO2019048881A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11866726B2 (en) 2017-07-14 2024-01-09 Editas Medicine, Inc. Systems and methods for targeted integration and genome editing and detection thereof using integrated priming sites

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994022891A1 (fr) * 1993-03-31 1994-10-13 Sterling Winthrop Inc. Oligonucleotides a liaisons d'amides remplacant les liaisons de phosphodiesters
WO2000047593A1 (fr) * 1999-02-12 2000-08-17 Isis Pharmaceuticals, Inc. Composes, procedes et intermediaires pour la synthese de composes oligomeres a squelettes mixtes
WO2011089393A1 (fr) * 2010-01-23 2011-07-28 Trillion Genomics Limited Détection
US20130046083A1 (en) * 2011-08-16 2013-02-21 Tom Brown Oligonucleotide ligation
WO2015177520A1 (fr) * 2014-05-19 2015-11-26 University Of Southampton Traitement d'acide nucléique sur un fragment d'acide nucléique ayant une liaison triazole
WO2018075785A1 (fr) * 2016-10-19 2018-04-26 Illumina, Inc. Méthodes de ligature chimique d'acides nucléiques

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994022891A1 (fr) * 1993-03-31 1994-10-13 Sterling Winthrop Inc. Oligonucleotides a liaisons d'amides remplacant les liaisons de phosphodiesters
WO2000047593A1 (fr) * 1999-02-12 2000-08-17 Isis Pharmaceuticals, Inc. Composes, procedes et intermediaires pour la synthese de composes oligomeres a squelettes mixtes
WO2011089393A1 (fr) * 2010-01-23 2011-07-28 Trillion Genomics Limited Détection
US20130046083A1 (en) * 2011-08-16 2013-02-21 Tom Brown Oligonucleotide ligation
WO2015177520A1 (fr) * 2014-05-19 2015-11-26 University Of Southampton Traitement d'acide nucléique sur un fragment d'acide nucléique ayant une liaison triazole
WO2018075785A1 (fr) * 2016-10-19 2018-04-26 Illumina, Inc. Méthodes de ligature chimique d'acides nucléiques

Non-Patent Citations (26)

* Cited by examiner, † Cited by third party
Title
A. H. EI-SAGHEER; A. P. SANZONE; R. GAO; A. TAVASSOLI; T. BROWN, PROC. NATL. ACAD. SCI. USA., vol. 108, 2011, pages 11338 - 11343
A. H. EI-SAGHEER; T. BROWN, PROC. NATL. ACAD. SCI. USA., vol. 107, 2010, pages 15329 - 15334
A. H. EL-SAGHEER ET AL: "Biocompatible artificial DNA linker that is read through by DNA polymerases and is functional in Escherichia coli", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 108, no. 28, 12 July 2011 (2011-07-12), pages 11338 - 11343, XP055196445, ISSN: 0027-8424, DOI: 10.1073/pnas.1101519108 *
A. S. XIONG; R. H. PENG; J. ZHUANG; J. G. LIU; F. GAO; J. M. CHEN; Z. M. CHENG; Q. H. YAO, BIOTECHNOL. ADV., vol. 26, 2008, pages 121 - 134
A. SHIVALINGAM; A. E. S. TYBURN; A. H. EI-SAGHEER; T. BROWN, J. AMER. CHEM. SOC., 2017
AFAF H. EL-SAGHEER ET AL: "Single tube gene synthesis by phosphoramidate chemical ligation", CHEMICAL COMMUNICATIONS, vol. 53, no. 77, 15 September 2017 (2017-09-15), pages 10700 - 10702, XP055521965, ISSN: 1359-7345, DOI: 10.1039/C7CC00858A *
ARUN SHIVALINGAM ET AL: "Molecular Requirements of High-Fidelity Replication-Competent DNA Backbones for Orthogonal Chemical Ligation", JOURNAL OF THE AMERICAN CHEMICAL SOCIETY, vol. 139, no. 4, 23 February 2017 (2017-02-23), pages 1575 - 1583, XP055454219, ISSN: 0002-7863, DOI: 10.1021/jacs.6b11530 *
BARRANGOU, R., GENOME BIOLOGY, vol. 16, 2015, pages 247
GAGNON; COREY, PROC. NATL. ACAD. SCI. USA, vol. 112, 2015, pages 15536 - 15537
J. A. DOUDNA; E. CHARPENTIER, SCIENCE, vol. 346, 2014, pages 12580961 - 12580969
J. AM. CHEM. SOC., vol. 139, no. 4, 2017, pages 1575 - 1583
K. SINGH, S.; J. WENGEL: "Universality of LNA-mediated high-affinity nucleic acid recognition", CHEMICAL COMMUNICATIONS, vol. 12, 1998, pages 1247 - 1248, XP002954208, DOI: doi:10.1039/a801571f
KAUR, H. ET AL.: "Perspectives on Chemistry and Therapeutic Applications of Locked Nucleic Acid (LNA", CHEMICAL REVIEWS, vol. 107, no. 11, 2007, pages 4672 - 4697
KUWAHARA M ET AL: "Transcription and reverse transcription of artificial nucleic acids involving backbone modification by template-directed DNA polymerase reactions", BIOORGANIC & MEDICINAL CHEMISTRY, PERGAMON, GB, vol. 17, no. 11, 1 June 2009 (2009-06-01), pages 3782 - 3788, XP026118922, ISSN: 0968-0896, [retrieved on 20090503], DOI: 10.1016/J.BMC.2009.04.045 *
LIANG ET AL., BIOTECHNOL., vol. 208, 2015, pages 44 - 53
M. M. SUZUKI; A. BIRD, NATURE REV. GENET., vol. 9, 2008, pages 465 - 476
MAKAROVA ET AL., BIOL DIRECT., vol. 6, 2011, pages 38
MAKAROVA ET AL., NAT REV MICROBIOL., vol. 13, 2015, pages 722 - 736
MAKAROVA, KOONIN METHODS MOL BIOL., vol. 1311, 2015, pages 47 - 75
NATURE COMMUNICATIONS, vol. 8, 2017
PROC. NATL. ACAD. SCI. USA., vol. 108, 2011, pages 11338 - 11343
RAHDAR ET AL., PROC. NATL. ACAD. SCI. USA, vol. 112, 2015, pages 7110 - 7117
S. DE KOK; L. H. STANTON; T. SLABY; M. DUROT; V. F. HOLMES; K. G. PATEL; D. PLATT; E. B. SHAPLAND; Z. SERBER; J. DEAN, ACS SYN. BIOL., vol. 3, 2014, pages 97 - 106
S. KOSURI; G. M. CHURCH, NATURE METH., vol. 11, 2014, pages 499 - 507
YU ET AL., BIOTECHNOL., vol. 38, 2016, pages 919 - 929
ZURIS ET AL., NAT. BIOTECHNOL., vol. 33, 2015, pages 73 - 80

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11866726B2 (en) 2017-07-14 2024-01-09 Editas Medicine, Inc. Systems and methods for targeted integration and genome editing and detection thereof using integrated priming sites

Also Published As

Publication number Publication date
GB201714403D0 (en) 2017-10-25

Similar Documents

Publication Publication Date Title
Flamme et al. Chemical methods for the modification of RNA
JP2693643B2 (ja) キラルリン結合を有するオリゴヌクレオチド
US5962674A (en) Synthesis of oligonucleotides containing alkylphosphonate internucleoside linkages
JP3050595B2 (ja) オリゴヌクレオチド類似体
CA2303299C (fr) Analogues d'oligonucleotides
US20130046083A1 (en) Oligonucleotide ligation
JP4791043B2 (ja) 同一固体支持体上で、２以上のオリゴヌクレオチドをタンデムに合成するための方法および組成物
JPH08508490A (ja) 新規５’−置換ヌクレオシド及びそれから得られるオリゴマー
CN111684073B (zh) 核酸分子的制造方法
CN111819280A (zh) 发夹型单链rna分子的制备方法
EP4162044A1 (fr) Molécules d'arn guides matrices
US11110114B2 (en) Dinucleotides
WO2019048881A1 (fr) Oligonucléotides comprenant des liaisons internucléosidiques de type triazole et (phosphore)amidate, leur procédé de préparation et leurs utilisations
WO2019048882A1 (fr) Oligonucléotides et leurs analogues
Danielsen et al. Gapmer Antisense Oligonucleotides Containing 2′, 3′‐Dideoxy‐2′‐fluoro‐3′‐C‐hydroxymethyl‐β‐d‐lyxofuranosyl Nucleotides Display Site‐Specific RNase H Cleavage and Induce Gene Silencing
US11104700B2 (en) Oligonucleotides
Worthington et al. Mixed-sequence pyrrolidine-amide oligonucleotide mimics: Boc (Z) synthesis and DNA/RNA binding properties
Srivastava et al. Achiral, acyclic nucleic acids: synthesis and biophysical studies of a possible prebiotic polymer
WO1996039414A1 (fr) Groupes nouveaux de protection des bases pendant la synthese d'oligonucleotides
WO2020161187A1 (fr) Procédé et produits de production d'oligonucléotides monocaténaires fonctionnalisés
Watts et al. Synthesis of nucleic acids
JP4047814B2 (ja) 新規カリックス［４］アレーン−ヌクレオシドおよびカリックス［４］アレーン−オリゴヌクレオチドハイブリッド
Epple Backbone-modified oligonucleotides for biology and medicine
WO2019150564A1 (fr) Procédé de réplication d'adn utilisant un oligonucléotide ayant un squelette de sulfonamide en tant que matrice
US6153742A (en) General process for the preparation of cyclic oligonucleotides

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18769457

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18769457

Country of ref document: EP

Kind code of ref document: A1