WO2019036720A1 - Targeting micrornas to improve autophagy activity in cystic fibrosis and associated disorders - Google Patents

Targeting micrornas to improve autophagy activity in cystic fibrosis and associated disorders Download PDF

Info

Publication number
WO2019036720A1
WO2019036720A1 PCT/US2018/047089 US2018047089W WO2019036720A1 WO 2019036720 A1 WO2019036720 A1 WO 2019036720A1 US 2018047089 W US2018047089 W US 2018047089W WO 2019036720 A1 WO2019036720 A1 WO 2019036720A1
Authority
WO
WIPO (PCT)
Prior art keywords
mir
patient
composition
expression
nucleic acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2018/047089
Other languages
French (fr)
Inventor
Amal AMER
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ohio State Innovation Foundation
Original Assignee
Ohio State Innovation Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ohio State Innovation Foundation filed Critical Ohio State Innovation Foundation
Publication of WO2019036720A1 publication Critical patent/WO2019036720A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • C12N2310/113Antisense targeting other non-coding nucleic acids, e.g. antagomirs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/178Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • Cystic fibrosis is an autosomal recessive disease caused by mutations in the CFTR gene that result in defective CFTR function in many organs; however, the majority of CF-associated morbidity and mortality arises from pulmonary infection and inflammation (Jiang Q, et al., "Cellular heterogeneity of CFTR expression and function in the lung:
  • the CFTR. gene encodes a transmembrane chloride channel that is regulated by ATP hydrolysis and expressed in various cell types including epithelial ceils and macrophages (Welsh MJ, et al, "Dysfunction of CFTR bearing the delta F508 mutation,” J ' Cell Sci Suppl 1993; 17:235-9).
  • the CFTR channel conducts anions and plays a critical role in regulating the volume and composition of airway surface liquid (Coakley RD, et al., "Abnormal surface liquid pH regulation by cultured cystic fibrosis bronchial epithelium,” Proc Natl Acad Sci USA 2003; 100: 16083-8), a thin layer of aqueous fluid and mucus covering the airway surface whose properties include facilitating mucociliary clearance, bacterial killing, and epithelial cell homeostasis (Blouquit S, et al ,, “Ion and fluid transport properties of small airways in cystic fibrosis," Am JRespir Crit Care Med 2006; 174:299- 305).
  • the mutant form of the protein fails to traffic properly to the plasma membrane. This leads to a critical lack of fluid exchange across the membrane. Should the F508del-CFTR traffic to the cell membrane in response to therapy, the mutant protein then regains partial channel function in epithelial ceils (French PJ, et al., "A delta F508 mutation in mouse cystic fibrosis transmembrane conductance regulator results in a temperature-sensitive processing defect in vivo," J Clin Invest 1996; 98: 1304-12; Gomes-Alves P, et al., "Low temperature restoring effect on F508del-CFTR misprocessing: A proteomic approach," J Proteomics 2009; 73 :218-30).
  • Autophagy functions to yield energy and nutrients during stress or starvation of the cell (Yang Z, et al., "Eaten alive: a history of
  • autophagy can also restrict specific pathogens within macrophages and improve clearance of misfoided protein aggregates that cannot be managed by proteasomes (Bjorkoy G, et al., "p62/SQSTMl : a missing link between protein aggregates and the autophagy machinery," Autophagy 2006; 2: 138-9).
  • the process of autophagy involves formation of double-membrane compartments (phagophores) that engulf nonfunctional organelles and cytoplasm. These phagophores then mature into autophagosomes that fuse with Ivsosomes to form autolysosomes, within which the autophagic cargo is degraded and recycled for protein and ATP synthesis via
  • Autophagy as a regulated pathway of cellular degradation Science 2000; 290: 1717-21). Autophagosome formation is mediated by a series of autophagy-promoting molecules including Atg5, Atgl2, Atgl6, Atg7, Atg8 (mammalian MAP1LC3/LC3 and GABARAP) and Vps30/Atg6 (BECNl/Beclinl) ⁇ Id.). Thus, the absence or reduction in expression of one factor can markedly impair the autophagy process.
  • Burkholderia (B) cenocepacia is notorious for infecting CF patients and is resistant to the majority of antibiotics. In healthy macrophages, B. cenocepacia is cleared by autophagy. However, macrophages from CF humans and mice fail to control B.
  • CF mice allow A cenocepacia to establish infection in their lungs, which triggers an intense, and often lethal, inflammatory response ⁇ Id). Therefore, clearance of B. cenocepacia from the lungs of CF mice refl ects the amount of autophagy activity.
  • the pathobiology of CF is multi-factorial, including functional impairment of autophagy in macrophages, as indicated by increased susceptibility to specific bacterial infections and inflammation (Junkins RD, et al., "The emerging potential of autophagy- based therapies in the treatment of cy stic fibrosis lung infections," Autophagy 2014; 10:538- 47).
  • autophagy controls bacterial infection and ILIB/IL- ⁇ ⁇ production in macrophages (Mayer ML, et al., "Rescue of dysfunctional autophagy attenuates hyperinflammatory responses from cystic fibrosis ceils,” J Immunol ' 2013; 190: 1227-38).
  • CF pathobiology encompasses several immune cells, in addition to epithelial cells, recognizing that CF is a newly identified immune deficiency disorder.
  • Rapamycin treatment also improves CFTR function in airway epithelial cells (Luciani A 2011; Luciani A 2010; Luciani A, et ai., "Targeting autophagy as a novel strategy for facilitating the therapeutic action of potentiators on DeltaF508 cystic fibrosis transmembrane conductance regulator," Autophagy 2012; 8: 1657- 72).
  • the use of rapamycin reinforces the concept that restoration of autophagy activity is beneficial for CF patients.
  • rapamycin elicits severe side-effects and thus cannot be used for the young CF population.
  • the disclosed subject matter in one aspect, relates to compounds, compositions and methods of making and using compounds and
  • compositions relate cystic fibrosis therapy and compositions for cystic fibrosis therapy.
  • the disclosed subject matter relates to modulation of autophagy activity and compositions for modulating autophagy activity.
  • the disclosed subject matter relates to antagomirs that comprise a nucleic acid that hybridizes to a Mir 77-92 cluster under moderate or high stringent conditions. Pharmaceutical compositions comprising these antagomirs and a pharmaceutically acceptable carrier are also disclosed. Methods of using these
  • compositions to treat a patient with cystic fibrosis increasing clearance of infection in a patient with cystic fibrosis, reducing inflammation in a patient, modulating autophagy activity in a patient, increasing CFTR function in a patient, and treating other related diseases are also disclosed.
  • Methods of assaying levels of Mir 17-92 expression are also disclosed.
  • Figures 1A-1C show primary F508del (CF) murine macrophages exhibit weak autophagic flux during resting and starvation conditions.
  • Figure 1A shows western blot for basal level autophagy proteins in WT (black bars) and F508del primary mouse macrophages (white bars). Densitometry analyses of western blot bands were normalized to their respective loading control bands using ImageJ software to control for loading. Panels shown represent 3 independent experiments displaying similar results.
  • Figure IB shows the scoring of the percentage of macrophages harboring more than 5 puncta in WT and F508del macrophages before (NT, black) and after 2 h of starvation (starved, white).
  • FIG. 1C shows confocai microscopy representing autophagy activity of resting and starved WT and F508del macrophages.
  • Blue (DAPI) stain indicates nuclei and green stain indicates L.C3 pun eta (autophagosome formation).
  • Asterisks (*) indicates p ⁇ 0.05; **, p ⁇ 0.01 ; and ***, p ⁇ 0.001.
  • Figures 2A-2E show Mirl 7-92 cluster expression i s elevated in primary
  • FIG. 1A shows quantitative real-time PGR (qPCR) representing the expression of Mir 17-92 cluster members in resting WT (black bars) and F508del (white bars) murine macrophages.
  • WT macrophage cluster expression compared to F508del macrophage cluster expression was also significant as calculated by two-way ANOVA p ⁇ 0.05.
  • WT macrophages n 5 and F508del
  • Graphs are representative of compiling means ⁇ SD.
  • Figure 2B shows qPCR representing the expression of Mir 17-92 cluster in human blood monocyte-derived macrophages from 6 non-CF (black bars) and 6 CF (white bars) patients. Data shown represent the means ⁇ SD. Student's two-tailed /-test was used to assess significance.
  • Figure 2C shows western blot for autophagy proteins in WT (black bars) and mir 17-92 " ' ' macrophages (gray bars). Densitometric analyses of bands were normalized to their respective actin loading control bands using imageJ software. Each blot is representative of 3 independent experiments displaying similar results.
  • Figures 3A-3D show Mir 17 and Mir20a target the 3 'UTRs of Atg7 and Atg 1611.
  • FIG. 3C and 31 show western blot for (Figure 3C) ATG7 or ( Figure 3D) ATG16L1 in F508del macrophages transfected with antagomirl 7 and antagomir20a. The blot is representative of 3 independent experiments displaying similar results and protein bands were normalized to their respective ACTB bands and quantified by Image.) software. * indicates p ⁇ 0.05; and ***, p 0.001 .
  • Figures 4A-4C show decreasing the expression of Mir 17 and Mir 20a in live F508del mice improves the expression of autophagy molecules.
  • Figure 4B shows expression of autophagy-regulating genes in F508del murine lung homogenate after intra-tracheai treatment with scramble (black bars) or antagomirl 7 and antagomir20a (white bars) assessed by qPCR. Data shown are
  • FIG. 4C shows western blot for autophagy proteins, ATG7 and ATG16L1, in F508del lung homogenates post-intra-tracheal administration of scrambled control (black bars) or antagomirl 7 and anatgoMir20a (white bars).
  • the blots shown are representative of 3 independent experiments displaying similar results and protein production bands were normalized to their respective ACTB bands and quantified by Image! software. * indicates p ⁇ 0.05; and p ⁇ 0.001.
  • FIGS 5A-5B show targeting Mirl 7 and Mir '20a in F508del mice increases autophagy-mediated clearance of Burkholderia cenocepacia.
  • F508del mice were intratracheallv treated with scrambled control (black bars) or antagomirl 7 and
  • Figure 6 shows CFTR function is reduced in F508del murine macrophages and partially restored by decreasing /W 7 and Mir 20a expression levels via autophagy
  • F508del macrophages were untransfected, transfected with scramble control or antagomirl? and -20a (Antagomirs) for 48 h, and 3 -methyl adenine (3 -MA) for 6 h to inhibit autophagic flux.
  • Cells were loaded with SPQ dye, quenched using an iodide buffer, and fluorescence output was measured. Data are presented as means of percent increase of F508del-CFTR ⁇ SD from 5 independent experiments. Student's two-tailed -test was used to determine significance of antagomir transfection, and 3 -MA inhibition. ** indicates p ⁇ 0.01.
  • Figure 7A-7C show expression of autophagy genes, proteins and MirlOl in WT and F508del macrophages.
  • Figure 7A shows qPCR representing the expression of Atgl2 in macrophages from WT (black bars), F508del (white bars) and Mir 17 -92a cluster (gray bars) mice.
  • Figisre 7C shows western blot for ATG7 and ATG16L1 in F508del macrophages transfected with antagomirl? or antagomir20a.
  • the blot is representative of 3 independent experiments displaying similar results.
  • Actin (ACTB) is used as the loading control.
  • FIGs 8A-8C show CF patients have elevated Mircl/Mirl 7-92 cluster expression.
  • Figisre 8A human neutrophils were isolated from peripheral blood samples from CF patients and healthy controls.
  • Figure 8B human plasma was isolated from peripheral blood samples from CF patients and healthy controls.
  • Mircl/Mirl 7-92 cluster expression was determined by qRT-PCR, n 55 for the CF group and // 49 for the non-CF group.
  • sputum was obtained from 29 CF patients.
  • Mire 1 /Mir 17 -92 cluster expression was determined by qRT-PCR and expression levels compared to plasma levels from Figure SB. Mir!
  • Figures 9A-9C show sputum Mircl/Mirl 7-92 cluster expression correlates with lung function.
  • Figures 10A-10B show sputum Mircl/Mirl 7-92 cluster expression predicts pulmonary exacerbations.
  • sputum samples cluster expression levels were grouped according to the presence or absence of a pulmonary exacerbation.
  • Figure 10B sputum from CF patients at baseline and 6 months-post-Lumacaftor/Ivacaftor initiation were obtained.
  • *" p value ⁇ 0.05, "**" - p value ⁇ 0.01 , "***" - p value ⁇ 0.001.
  • isolated means that the referenced material is removed from the environment in which it is normally found.
  • an isolated biological material can be free of cellular components, i.e., components of the cells in which the material is found or produced.
  • Isolated nucleic acid molecules include, for example, a PGR product, an isolated mR A, a cDNA, or a restriction fragment.
  • Isolated nucleic acid molecules also include, for example, sequences inserted into plasmids, cosmids, artificial chromosomes, and the like.
  • An isolated nucleic acid molecule is preferably excised from the genome in which it may be found, and more preferably is no longer joined to non-regulator ⁇ ' sequences, non-coding sequences, or to other genes located upstream or downstream of the nucleic acid molecule when found within the genome.
  • An isolated protein may be associated with other proteins or nucleic acids, or both, with which it associates in the cell, or with cellular membranes if it is a membrane-associated protein.
  • reduce or other forms of the word, such as “reducing” or “reduction,” is meant lowering of an event or characteristic (e.g., infection). It is understood that this is typically in relation to some standard or expected value, in other words it is relative, but that it is not always necessary for the standard or relative value to be referred to. For example, “reduces infection” means decreasing the amount of tumor cells relative to a standard or a control.
  • prevent or other forms of the word, such as “preventing” or “prevention,” is meant to stop a particular event or characteristic, to stabilize or delay the development or progression of a particular event or characteristic, or to minimize the chances that a particular event or characteristic will occur. Prevent does not require comparison to a control as it is typically more absolute than, for example, reduce. As used herein, something could be reduced but not prevented, but something that is reduced could also be prevented. Likewise, something could be prevented but not reduced, but something that is prevented could also be reduced. It is understood that where reduce or prevent are used, unless specifically indicated otherwise, the use of the other word is also expressly disclosed.
  • treatment refers to obtaining beneficial or desired clinical results.
  • beneficial or desired clinical results include, but are not limited to, any one or more of: alleviation of one or more symptoms (such as infection), diminishment of extent of infection, stabilized (i.e., not worsening) state of infection, delaying spread (e.g., infections) of the infection, delaying occurrence or recurrence of infection, delay or slowing of infection progression, and amelioration of the infected state.
  • patient preferably refers to a human in need of cystic fibrosis therapy and/or autophagy activity modulation.
  • patient can also refer to non- human animals, preferably mammals such as dogs, cats, horses, cows, pigs, sheep and non- human primates, among others, that are in need of treatment with a composition disclosed herein.
  • administering refers to any method of providing a pharmaceutical preparation to a patient.
  • Such methods are well known to those skilled in the art and include, but are not limited to, oral administration, transdermal administration, administration by inhalation, nasal administration, topical administration, intravaginal administration, ophthalmic administration, intraaural administration, intracerebral administration, rectal administration, sublingual administration, buccal administration, and parenteral administration, including injectable such as intravenous administration, intra-arterial administration, intramuscular administration, and subcutaneous administration.
  • Administration can be continuous or intermittent.
  • a preparation can be administered therapeutically; that is, administered to treat an existing disease or condition.
  • a preparation can be administered prophylactically; that is, administered for prevention of a disease or condition.
  • composition is intended to encompass a product comprising the specified ingredients in the specified amounts, as well as any product which results, directly or indirectly, from combination of the specified ingredients in the specified amounts. It is also understood that the compositions disclosed herein have certain functions. Disclosed herein are certain structural requirements for performing the disclosed functions, and it is understood that there are a variety of structures which can perform the same function which are related to the disclosed structures, and that these structures will ultimately achieve the same result. A weight percent (wt.%) of a component, unless specifically stated to the contrary, is based on the total weight of the formulation or composition in which the component is included.
  • nucleic acid molecule refers to the phosphate ester polymeric form of ribonucieosides (adenosine, guanosine, uridine or cytidine; "RNA molecules”) or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or
  • DNA molecules deoxycytidine
  • DNA molecules any phosphoester analogs thereof, such as phosphorothioates and thioesters, in either single stranded form, or a double-stranded helix. Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible.
  • nucleic acid molecule and in particular DNA or RNA molecule, refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear ⁇ e.g., restriction fragments) or circular DNA molecules, plasmids, and chromosomes.
  • a "recombinant DNA molecule” is a DNA molecule that has undergone a molecular biological manipulation.
  • nucleic acid hybridization refers to anti-parallel hydrogen bonding between two single-stranded nucleic acids, in which A pairs with T (or U if an RNA nucleic acid) and C pairs with G. Nucleic acid molecules are "hybridizable" to each other when at least one strand of one nucleic acid molecule can form hydrogen bonds with the
  • Stringency of hybridization is determined, e.g., by (i) the temperature at which
  • hybridization and/or washing is performed, and (ii ) the ionic strength and (iii) concentration of denaturants such as formamide of the hybridization and washing solutions, as well as other parameters.
  • Hybridization requires that the two strands contain substantially complementary sequences. Depending on the stringency of hybridization, however, some degree of mismatches may be tolerated. Under "low stringency” conditions, a greater percentage of mismatches are tolerable (i.e., will not prevent formation of an anti-parallel hybrid). See Molecular Biology of the Cell, Alberts et al., 3rd ed,, New York and London: Garland Publ., 1994, Ch. 7.
  • hybridizes By “specifically hybridizes” is meant that a probe, primer, or oligonucleotide recognizes and physically interacts (that is, base-pairs) with a substantially complementary nucleic acid under high stringency conditions, and does not substantially base pair with other nucleic acids. Typically, hybridization of two strands at high stringency or under high stringent conditions requires that the sequences exhibit a high degree of complementarity over an extended portion of their length. Examples of high stringency conditions include: hybridization to filter-bound DNA in 0.5 M NaHPQ 4 , 7% SDS, 1 mM EDTA at 65°C, followed by washing in 0.
  • Ix SSC/0.1% SDS at 68°C (where Ix SSC is 0.15M NaCl, 0.15M Na citrate) or for oligonucleotide molecules washing in 6xSSC/0.5% sodium pyrophosphate at about 37°C (for 14 nucleotide-long oligos), at about 48°C (for about 17 nucleoti de-long oligos), at about 55°C (for 20 nucleotide-long oligos), and at about 60°C (for 23 nucleotide- long oligos)).
  • high stringency hybridization refers to a combination of solvent and temperature where two strands will pair to form a "hybrid" helix only if their nucleotide sequences are almost perfectly complementary (see Molecular Biology of the Cell, Alberts et al, 3rd ed., New York and London: Garland Publ., 1994, Ch. 7).
  • Conditions of intermediate or moderate stringency such as, for example, an aqueous solution of 2* SSC at 65°C; alternatively, for example, hybridization to filter-bound DNA in 0.5 M NaHPC , 7% SDS, 1 mM EDTA at 65°C, and washing in 0.2 x SSC/0.1% SDS at 42°C
  • low stringency such as, for example, an aqueous solution of 2> ⁇ SSC at 55°C
  • hybridization reaction depend on the concentration of the target DNA and length and base composition of the probe, and are normally determined empirically in preliminary experiments, which are routine (see Southern, J. Mol. Biol. 1975; 98: 503, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 2, eh. 9.50, CSH Laboratory Press, 1989; Ausubel et l. (eds.), 1989, Current Protocols in Molecular Biology, Vol. I, Green Publishing Associates, Inc., and John Wiley & Sons, Inc., New York, at p. 2. 10.3).
  • standard hybridization conditions refers to hybridization conditions that allow hybridization of sequences having at least 75% sequence identity. According to a specific embodiment, hybridization conditions of higher stringency may be used to allow hybridization of only sequences having at least 80% sequence identity, at least 90% sequence identity, at least 95% sequence identity, or at least 99% sequence identity.
  • Nucleic acid molecules that "hybridize" to any desired nucleic acids of the present invention may be of any length. In one embodiment, such nucleic acid molecules are at least 10, at least 15, at least 20, at least 30, at least 40, at least 50, and at least 70 nucleotides in length. In another embodiment, nucleic acid molecules that hybridize are of about the same length as the particular desired nucleic acid.
  • sequence similarity generally refers to the degree of identity or correspondence between different nucleotide sequences of nucleic acid molecules or amino acid sequences of proteins that may or may not share a common evolutionary origin. Sequence identity can be determined using any of a number of publicly available sequence comparison algorithms, such as BLAST, FASTA, DNA Strider, GCG (Genetics Computer Group, Program Manual for the GCG Package, Version 7, Madison, Wisconsin), etc.
  • the sequences are aligned for optimal comparison purposes.
  • the two sequences are, or are about, of the same length.
  • the percent identity between two sequences can be determined using techniques similar to those described below, with or without allowing gaps. In calculating percent sequence identity, typically exact matches are counted.
  • the determination of percent identity between two sequences can be accomplished using a mathematical algorithm.
  • a non-limiting example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of ariin and Altschul, Proc Natl Acad Sci USA 1990, 87:2264, modified as in Kariin and Altschul, Proc Natl Acad Sci USA 1993, 90:5873-5877. Such an algorithm is incorporated into the NBLAST and
  • Gapped BLAST can be utilized as described in Altschul et al, Nucleic Acids Res.
  • PSI-Blast can be used to perform an iterated search that detects distant relationship between molecules. See Altschul et al. (1997) supra. When utilizing BLAST, Gapped BLAST, and PSI-Blast programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. Another non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller, CABIOS 1988; 4: 11-17. Such an algorithm is incorporated into the ALIGN program (version 2.0), which is part of the GCG sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used.
  • ALIGN program version 2.0
  • MicroRNAs can regulate individual stages of these processes (Treiber T, et a!., "Regulation of microRNA biogenesis and function," Thromb Haemost 2012; 107:605-10).
  • Mirs are an evolutionarily, conserved class of small ( ⁇ 21-24 nucleotides) noncoding RNAs that play key roles in the transcriptional and posttranscriptionai regulation of gene expression (Id . Reports have demonstrated the extent to which Mirs regulate CFTR expression and function (Oglesby ⁇ 2013;
  • Mirl 7-92 cluster target multiple essential autophagy factors.
  • Mirs comprising the Mirl 7-92 cluster exhibit a trend towards upregulation in CF cells, especially Mirl 7 and Mir20a, which are significantly increased in murine macrophages.
  • Mir 17 is also significantly upregulated in macrophages derived from CF patients. Luciferase assays validated that both Mirl 7 and Mir 20a target Atg7 and Atgl6ll.
  • reducing the inherently elevated expression of Mir 17 and Mir 20a improves ATG7 and ATG16L1 expression both in vitro and in vivo.
  • reducing Mirl 7 and Mir 20a expression improves CFTR function by restoring autophagy expression.
  • targeting Mirl 7 was more efficient.
  • B. cenocepacia clearance is improved in CF mice after intra-tracheal treatment with antagomirs to Mir 17 and Mir20a. Containment of B. cenocepacia upon administration of these specific antagomirs is accompanied by improved expression of targeted autophagy proteins.
  • the disclosed material advances understanding of the mechanism underlying defective autophagy in CF and provides a therapeutic approach for restoring CFTR function and autophagy activity in patients with CF and other associated disorders.
  • Mir 138 was identified to regulate CFTR expression through its interaction with the transcriptional regulatory protein SIN3A (Ramachandra S 2012).
  • Mir 384, Mil 494 and Mir 1246 are involved in the post-transcriptional regulation of CFTR channel synthesis ⁇ Id).
  • compositions comprise antagomirs.
  • Antagomirs interact with a target nucleic acid molecule (e.g., microRNA) through either canonical or non-canonical base pairing.
  • the interaction of the antagomirs and the target molecule is designed to interrupt a processing function that normally would take place on the target molecule, such as transcription or replication.
  • Antagomirs can be designed based on the sequence of the target nucleic acid molecule.
  • Target mature miR-17-5P 5' -CAA AGU GCU UAC AGU GCA GGU 34
  • compositions comprising an antagomir and a pharmaceutically acceptable carrier.
  • the antagomir comprises, or is, a nucleic acid that hybridizes to & Mir 17-92 cluster under moderate stringent conditions.
  • the nucleic acid can be a noti-naturally occurring nucleic acid.
  • the nucleic acid hybridizes to the Mir 17-92 cluster under high stringent conditions.
  • Reference to Mir 17-92 includes any part of the cluster.
  • T e Mir 17-19 cluster can be from a mouse or human, preferably a human.
  • the nucleic acid can hybridize to Mir 17, Mir 18a, Mir 19a, Mir 20a, Mir 19b, or Mir 92 under moderate or under high stringent conditions.
  • the nucleic acid hybridizes to Mirl 7 under moderate or under high stringent conditions. In other examples, the nucleic acid hybridizes io Mir 20a under moderate or under high stringent conditions. In further examples, the composition can comprise more than one antagomir, each antagomir comprising a nucleic acid that hybridizes under moderate or stringent conditions to a different part of the Mirl 7-92 cluster.
  • the nucleic acid can hybridize to SEQ ID Nos. : 10, 14, 18, 22, 26, 30, 34, or 37.
  • the nucleic acid can hybridize to SEQ ID Nos.: 10, 20, 34, 01- 37.
  • the nucleic acid can have at least 80 % sequence homology to SEQ ID Nos: 12, 16, 20, 24, 28, 32, 36, or 39, e.g., at least 90%, at least 95%, or at least 99% sequence homology to SEQ ID Nos: 12, 16, 20, 24, 28, 32, 36, or 39,
  • the nucleic acid can have from 1 to 7, from 1 to 6, from 1 to 5, from 1 to 4, from 1 to 3, from 1 to 2, substitutions, e.g., 1, 2, 3, 4, 5, 6, or 7 substitutions.
  • the nucleic acid can have SEQ ID NO. : 12, 16, 20, 24, 28, 32, 36, or 39. In specific examples, the nucleic acid can have SEQ ID NO. : 12, 24, 36, or 39.
  • the composition can comprise more than one antagomir, each antagiomir comprising a nucleic acid that hybridizes to a different part of the Mirl 7-19 cluster under moderate stringent conditions.
  • the composition can comprise multiple nucleic acids that hybridize to difference sequences chosen from SEQ ID NO.: 10, 14, 18, 22, 26, or 30 under moderate or high stringent conditions.
  • any two or more of the nucleic acids disclosed herein can be combined in the disclosed compositions.
  • nucleic acids can also be modified by many means known in the art.
  • modifications include methylation, "caps", substitution of one or more of the naturally occurring nucleotides with an analog, and internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoroamidates, carbamates, etc.) and with charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).
  • Polynucleotides may contain one or more additional covalentiy linked moieties, such as, for example, proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalators (e.g., acridine, psoralen, etc.), chelators (e.g. , metals, radioactive metals, iron, oxidative metals, etc.), and alkylators.
  • the polynucleotides may be derivatized by formation of a methyl or ethyl phosphotri ester or an alky! phosphoramidate linkage.
  • proteins e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.
  • intercalators e.g., acridine, psoralen, etc.
  • chelators e.g. , metals, radioactive metals, iron, oxidative metal
  • polynucleotides herein may also be modified with a label capable of providing a detectable signal, either directly or indirectly.
  • exemplary' labels include radioisotopes, fluorescent molecules, biotin, and the like.
  • the disclosed nucleic acids can have from 15 to 30 nucleosides, e.g., from 18 to 27, from 21 to 24, from 17 to 28, from 19 to 27, from 21 to 25, from 16 to 29, from 17 to 28, from 18 to 28, from 19 to 27, from 20 to 26, from 21 to 25, from 22 to 24 nucleosides.
  • the disclosed antagomirs can be obtained commercially, or can be prepared by nucleic acid synthetic techniques known to those of skill in the art. For example, they can be made using standard chemical synthesis methods or can be produced using enzymatic methods or any other known method. Such methods can range from standard enzymatic digestion followed by nucleotide fragment isolation (see for example, Sambrook et al.
  • compositions can be formulated in a physiologically- or
  • parenteral includes subcutaneous, intradermal, intravenous, intramuscular, intraperitoneal, and intrasternal administration, such as by injection.
  • Administration of the disclosed compounds or compositi ons can be a single admini stration, or at continuous or distinct intervals as can be readily determined by a person skilled in the
  • compositions can also be administered utilizing liposome technology, slow release capsules, implantable pumps, and biodegradable containers. These delivery methods can, advantageously, provide a uniform dosage over an extended period of time.
  • the compounds can also be administered in their salt derivative forms or crystalline forms.
  • liposomes comprising the pharmaceutical compositions disclosed herein.
  • compositions can be formulated according to known methods for preparing pharmaceutically acceptable compositions. Formulations are described in detail in a number of sources which are well known and readily available to those skilled in the art. For example, Remington '$ Pharmaceutical Science by E.W. Martin (1995) describes formulations that can be used in connection with the disclosed methods.
  • the compositions disclosed herein can be formulated such that an effective amount of the compound (antagomir) is combined with a suitable carrier in order to facilitate effective administration of the compound.
  • the compositions used can also be in a variety of forms. These include, for example, solid, semi-solid, and liquid dosage forms, such as tablets, pills, powders, liquid solutions or suspension, suppositories, injectable and infusible solutions, and sprays. The preferred form depends on the intended mode of administration and therapeutic application.
  • the compositions also preferably include conventional
  • compositions disclosed herein can advantageously comprise between about 0.1% and 99%, and especially, 1 and 1 5% by weight of the total of one or more of the subject compounds based on the weight of the total composition including carrier or diluent.
  • Formulations suitable for administration include, for example, aqueous sterile injection solutions, which can contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient; and aqueous and nonaqueous sterile suspensions, which can include suspending agents and thickening agents.
  • the formulations can be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and can be stored in a freeze dried (iyophilized) condition requiring only the condition of the sterile liquid carrier, for example, water for injections, prior to use.
  • Extemporaneous injection solutions and suspensions can be prepared from sterile powder, granules, tablets, etc.
  • compositions disclosed herein can include other agents conventional in the art having regard to the type of formulation in question.
  • Compositions disclosed herein can be delivered to a cell either through direct contact with the cell or via a carrier means.
  • Carrier means for delivering compounds and compositions to cells are known in the art and include, for example, encapsulating the composition in a liposome moiety.
  • Another means for delivery of compositions disclosed herein to a cell comprises attaching the compounds to a protein or nucleic acid that is targeted for delivery to the target cell.
  • 20030032594 and 20020120100 disclose amino acid sequences that can be coupled to another composition and that allows the composition to be translocated across biological membranes.
  • U.S. Application Publication No. 20020035243 also describes compositions for transporting biological moieties across cell membranes for intracellular delivery.
  • Compounds can also be incorporated into polymers, examples of which include poly (D-L lactide-co-glycolide) polymer for intracranial tumors; poly[bis(p- carboxyphenoxy) propane: sebacic acid] in a 20:80 molar ratio (as used in GLIADEL);
  • compositions disclosed herein can be locally administered at one or more anatomical sites, such as the lungs optionally in combination with a
  • compositions disclosed herein can be systemically administered, such as intravenously or orally, optionally in combination with a pharmaceutically acceptable carrier such as an inert diluent, or an assimilable edible carrier for oral delivery. They can be enclosed in hard or soft shell gelatin capsules, can be compressed into tablets, or can be incorporated directly with the food of the patient's diet.
  • a pharmaceutically acceptable carrier such as an inert diluent, or an assimilable edible carrier for oral delivery. They can be enclosed in hard or soft shell gelatin capsules, can be compressed into tablets, or can be incorporated directly with the food of the patient's diet.
  • the compositions can be combined with one or more excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, aerosol sprays, and the like.
  • the tablets, troches, pills, capsules, and the like can also contain the following: binders such as gum tragacanth, acacia, com starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, fructose, lactose or aspartame or a flavoring agent such as peppermint, oil of wintergreen, or cherry flavoring can be added.
  • a liquid carrier such as a vegetable oil or a polyethylene glycol.
  • tablets, pills, or capsules can be coated with gelatin, wax, shellac, or sugar and the like.
  • a syrup or elixir can contain the
  • active compound sucrose or fructose as a sweetening agent, methyl and propylparabens as preservatives, a dye and flavoring such as cherry or orange flavor.
  • any material used in preparing any unit dosage form should be pharmaceutically acceptable and substantially non-toxic in the amounts employed.
  • the active compound can be incorporated into sustained-release preparations and devices.
  • compositions disclosed herein can be administered intravenously, intramuscularly, or intraperitoneal! ⁇ - by infusion or injection.
  • Solutions of the active agent or its salts can be prepared in water, optionally mixed with a nontoxic surfactant.
  • Dispersions can also be prepared in glycerol, liquid polyethylene glycols, triacetin, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations can contain a preservative to prevent the growth of microorganisms.
  • the pharmaceutical dosage forms suitable for injection or infusion can include sterile aqueous solutions or dispersions or sterile powders comprising the active ingredient, which are adapted for the extemporaneous preparation of sterile injectable or infusible solutions or dispersions, optionally encapsulated in liposomes.
  • the ultimate dosage form should be sterile, fluid and stable under the conditions of manufacture and storage, he liquid carrier or vehicle can be a solvent or liquid dispersion medium comprising, for example, water, ethanol, a polyol (for example, glycerol, propylene glycol, liquid polyethylene glycols, and the like), vegetable oils, nontoxic glyceryl esters, and suitable mixtures thereof.
  • the proper fluidity can be maintained, for example, by the formation of liposomes, by the maintenance of the required particle size in the case of dispersions or by the use of surfactants.
  • the prevention of the action of microorganisms can be brought about by various other antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars, buffers or sodium chloride.
  • Prolonged absorption of the injectable compositions can be brought about by the inclusion of agents that delay absorption, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions are prepared by incorporating a compound and/or agent disclosed herein in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filter sterilization.
  • the preferred methods of preparation are vacuum drying and the freeze drying techniques, which yield a powder of the active ingredient plus any additional desired ingredient present in the previously sterile- filtered solutions.
  • the composition can be combined with a solubilizer and mixed with a propellant mixture.
  • the composition can be micronized in a mixture of propellant and a pharmaceutically acceptable surfactant.
  • the disclosed compositions can also be nebulized to facilitate administration by inhalation.
  • Useful solid carriers include finely divided solids such as talc, clay, macrocrystalline cellulose, silica, alumina and the like.
  • Useful liquid carriers include water, alcohols or glycols or water-aicohol/gfycol blends, in which the compounds can be dissolved or dispersed at effective levels, optionally with the aid of non-toxic surfactants.
  • Adjuvants such as fragrances and additional antimicrobial agents can be added to optimize the properties for a given use.
  • the resultant liquid compositions can be applied from absorbent pads, used to impregnate bandages and other dressings, or sprayed onto the affected area using pump-type or aerosol sprayers, for example.
  • Useful dosages of the compounds and agents and pharmaceutical compositions disclosed herein can be determined by comparing their in vitro activity, and in vivo activity in animal models. Methods for the extrapolation of effective dosages in mice, and other animals, to humans are known to the art.
  • compositions that comprise a compound disclosed herein in combination with a pharmaceutically acceptable carrier.
  • Pharmaceutical compositions adapted for oral, inhalation, or parenteral administration, comprising an amount of a compound constitute a preferred aspect.
  • the dose administered to a patient, particularly a human should be sufficient to achieve a therapeutic response in the patient over a reasonable time frame, without lethal toxicity, and preferably causing no more than an acceptable level of side effects or morbidity.
  • dosage will depend upon a variety of factors including the condition (health) of the patient, the body weight of the patient, kind of concurrent treatment, if any, frequency of treatment, therapeutic ratio, as well as the severity and stage of the pathological condition.
  • disclosed herein are methods of treating a patient with cystic fibrosis that comprise administering to the patient a pharmaceutical composition as disclosed herein. Also, disclosed are methods increasing clearance of Burkholderia cenocepacia in a patient with cystic fibrosis that comprise administering to the patient a pharmaceutical composition as disclosed herein. Clearance of other infections, e.g., with Staphylococcus aureus (S, aureus) and P'seudomonas aeruginosa (P. aeruginosa), can be accomplished by the same method.
  • Staphylococcus aureus S, aureus
  • P'seudomonas aeruginosa P. aeruginosa
  • a patient e.g., a patient having cystic fibrosis
  • methods of modulating autophagy activity in a patient that comprise administering to the patient a pharmaceutical composition as disclosed herein.
  • methods of reducing infection e.g., an infection is from Burkholderia cenocepacid
  • methods of increasing CFTR function in a patient that comprise administering to the patient a pharmaceutical composition as disclosed herein.
  • compositions as disclosed herein are methods of treating chronic obstructive pulmonary disease, pulmonary hypertension, oxidative stress, acute lung injury, sepsis, infectious lung disease, or idiopathic lung fibrosis in a patient that comprise administering to the patient a pharmaceutical composition as disclosed herein. Also, disclosed are methods of reducing inflammation in a patient with cystic fibrosis that comprise administering to the patient a pharmaceutical composition as disclosed herein.
  • the pharmaceutical composition can comprise an antagomir and a pharmaceutically acceptable carrier, wherein the antagomir comprises a nucleic acid that hybridizes to & Mir 17 -92 cluster under moderate stringent conditions.
  • the antagomir is antagiomir specific for Mir 17.
  • the administration can be by, e.g., a nebulizer or inhaler.
  • the patient can be assayed for Mir : 1 ⁇ '-92 expression before administration, during
  • the disclosed methods are particularly suitable for patients with cystic fibrosis, but may also be used in other disease conditions characterized by weak autophagy accompanied by upregulation of the Mir 17-92 cluster or its members.
  • assaying of ' Mir 1 17-92 expression can be performed prior to, during, or after administering any of the disclosed compositions.
  • the disclosed methods can comprise the step of determining a level of ' Mir 1 17-92 expression in any cell, e.g., macrophage or neutrophil.
  • determining the level of one or more specific Mirs can be performed.
  • the level of expression of one or more of Mir 77, Mir 18a, Mir 19a, Mir 20a, Mir 19b, or Mir92 can be determined.
  • the level of expression can be determined in any cell, but in specific examples, the level of expression is determined in macrophages or neutrophil s.
  • the level of expression ⁇ Mir 17-92 cluster, or any specific Mir within the cluster, can also be assayed from a blood sample.
  • the level of expression of ' Mir 1 17-92 cluster, or any specific Mir within the cluster can be correlated to a level of autophagy activity, the likelihood of getting or clearing an infection, the likelihood of inflammation, or the likelihood of obtaining cancer.
  • determining the level ⁇ 7- 92 cluster in a sample from a patient e.g., a sputum sample.
  • Patient' s having levels of Mirl ' 7-92 cluster that correlate with a high likelihood of getting cancer can then be treated, e.g., by the administration of preventative or therapeutic cancer treatments.
  • the patients can also be given any of the antogomir containing compositions disclosed herein.
  • the disclosed methods can also comprise determining the level of expression of any one or more of ' Mir 101, Mir 145, Mir223, Mir 384, Mir 494, and Mir 1246. For example.
  • Mir- 126 was downregulated in bronchial epithelial cells from CF patients which modulates inflammatory response (Oglesby, I.K., et al., "Regulation of cystic fibrosis transmembrane conductance regulator by microRNA-145, -223, and -494 is altered in DeltaF508 cystic fibrosis airway epithelium," J Immunol, 2013, 190(7):3354-62).
  • miR-17 overexpression in CF airway epithelial ceils decreases interieukin-8 production (Oglesby, I.K., et al., "miR-17 overexpression in cystic fibrosis airway epithelial cells decreases interleukin-8 production," / ⁇ .
  • Mirs were recently shown to have variant regional expression in the CF lung, with hypoxia-driven upper lobe predominance of some Mirs (Armstrong, D.A., et al ., "Pulmonary microRNA profiling: implications in upper lobe predominant lung disease,” Clin Epigenetics, 2017; 9:56).
  • the level of expression of ' Mir 17-92 cluster, or a specific Mir therein, can be determined over a period of several years (e.g., for 5 year, 10 years, 20 years, 30 years, or 40 years).
  • F508del mice were obtained from Case Western Reserve University. mirl7-92"' ⁇ floxed mice were generously donated from the lab of Dr. Clay Marsh at The Dorothy M. Davis Heart and Lung Research Institute. All mice were housed in the OSU vivarium. BMDMs were isolated as previously described (Abdulrahman BA 201 1 ; Abdulrahman BA 2013). Immunoblotting
  • Macrophages were lysed in lysis buffer solution (lOmM Hepes, 5mM MgCh, ImM EGTA, 142mM KC1, 1% P-40) supplemented with a protease inhibitor cocktail (Roche Applied Science, 11 836 170 001). Thirty micrograms of protein were separated by sodium dodecyi sulfate- 12% PAGE and transferred to polyvinylidene difluroide membranes (Bio- Rad Laboratories, 162-01 17).
  • Membranes were probed for ATG12-ATG5, ATG12, ATG16L1, ATG7 and actin (ACTB) (Sigma-Aldrich, A0856, A8731, SAB2501677, A2856 and Abeam ab8226, respectively). Protein bands were detected with secondary antibodies conjugated to horseradish peroxidase; Rabbit: GE Healthcare #NA934; Mouse:
  • Chloroform (Fisher Scientific, 268320010), isopropanol (Fisher Scientific, BP2618-212), and glycogen (Fisher Scientific, 10814010) were used to isolate total macrophage RNA and its concentration was measured by Nanodrop.
  • RNA to cDNA were analyzed by first converting the RNA to cDNA by priming with specific primers (Applied Biosystems, Assay ID 2308, 2422, 395, 396, 580, 431, 002253, 001232, respectively) using the TAQMANTM MicroRNA Reverse Transcription Kit (Applied Biosystems, 4366596). PGR was conducted according to the manufacturer's guidelines.
  • Antagomirl7 and antagomir20a were diluted to 100 nM in phosphate-buffered saline (Gibco, 14190-144) and transfected into macrophages using the Lipofectamine LTX and PLUS reagents (Life Technologies, 15338100) for 48 h according to the manufacturer's instructions.
  • mice were anesthetized via isofluorane (The Ohio State University Veterinary Hospital) and intratracheally received antagomirl 7 and antagomir20 or scramble control (GE Dharmacon, ffi-310561 -08-0020, IH-310514-07-0020, or ⁇ - 001005-01-20, respectively) at 25 ( ug per mouse in 24-h intervals for 72 h (Krutzfeidt J, et a!., "Silencing of microRNAs in vivo with 'antagomirs'," Nature 2005; 438:685-9;
  • mice The other lobe was homogenized in lysis buffer with protease inhibitor, as described previously, for protein analysis. Homogenization was accomplished using the Qiagen Tissue Lyser (Qiagen, 85600) and accompanying 5 -mm stainless steel beads (Qiagen, 69989). Another set of mice was treated as described above then infected intratracheaily with B. cenocepacia and colony-forming units (CPUs) were quantified from homogenized lungs as previously described (Abdulrahman BA 201 ).
  • Qiagen Tissue Lyser Qiagen, 85600
  • 5 -mm stainless steel beads Qiagen, 69989
  • the ⁇ 3 ⁇ 3 cell line was co-transfected with a piasmid containing either the Mir 3 'UTR target clone for murine Atg7, Atgl6ll or control vector (GeneCopoeia,
  • Antagomirl7 and antagomir20a were also transfected separately to downregulate endogenous Mir 17 or Mir 20a expression within the ⁇ 3 ⁇ 3 cells. Firefly and Renilla Luciferase activities were measured consecutively by using the Dual-Luciferase Reporter Assay system (Promega, El 910) 24 h after transfection.
  • the seed regions (5' nucleotides 2 through 8) of mature Mir 17 and Mir 2 Octfd are predicted to bind with perfect complementarity to the sequence 5'- GCACUUU-3 ' (SEQ ID ⁇ 0 .' ⁇ ) ⁇ , which is present in ti ⁇ Q Atg7 md AtgJ6U 3 ' UTR .
  • Site- directed mutagenesis was used to introduce 3 point mutations within these 7 nucleotides of the Atg7 and Atgl6Il 3 'UTR luciferase reporters to further test Mirl 7 and Mir20a/ ' b binding specificity.
  • Atgl6 3'UTR Mutant cattagagaccttaagtcacaattttcaagaaagctacggcaccacatggc 4 g 104a_c 107t_t 109g antisense
  • Atgl6 3'UTR Mutant ctgggctgggaaaggactcactgtcctgctcgcc 5 c805g t807c tS!Oa sense
  • Atgl6 3'UTR Mutant ggcgagcaggaeagtgagtcctttcccagcecag 6 c805g_t807c_t810a antisense
  • CFTR channels can transport chloride as well as iodide. Therefore, CFTR function was assessed by measuring iodide efflux using the fluorescent and halide-sensitive dye 6- methoxy-N-(3-sulfopropyl) quinoiinium (SPQ) as previously described (Cormet-Boyaka E, et al, " Rescuing cystic fibrosis transmembrane conductance regulator (CFTR)-processing mutants by transcomplementation," Proc Natl Acad Sci USA 2004; 101 :8221-6). Briefly, macrophages were plated in a 96-well plate.
  • SPQ fluorescent and halide-sensitive dye 6- methoxy-N-(3-sulfopropyl) quinoiinium
  • CF macrophages exert weak autophagic activity (Abduirahman BA 2011;
  • LC3 is a cytosolic autophagy protein that is recruited to phagophores; the subsequent
  • autophagosomes appear as donut-shaped structures called puncta. Significantly fewer resting CF macrophages had more than 5 puncta when compared to their WT counterparts (Figs. IB and IC). In addition, to determine autophagy activity in response to stimulation, macrophages were starved and those expressing more than 5 puncta were quantified. CF macrophages failed to increase their puncta content in response to starvation in contrast to WT macrophages (Figs. IB and IC). Therefore, CF macrophages fail to mount an autophagic flux response upon starvation. Together, these data provide evidence that CF macrophages exhibit lower expression of essential ATG proteins and are characterized by weak autophagic activity.
  • Mir 101 was reported to target STMN1, RAB5A, and ATG4D, each of which is an important autophagic regulator (Frankel LB, et ai, "microRNA-101 is a potent inhibitor of autophagy," EMBO J 201 1 ;
  • the Mir 17-92 cluster is predicted to target Atg4, Atg5, Becnl, Atg7, Atgl2, Atgiei! and !.v3 (Table 2).
  • qRT-PCR quantitative real-time PCR
  • mice Since a complete knockout of the cluster is embryonic lethal, these mice were obtained by breeding a Lyz2 LysM-cre mouse with a mirl 7-92 " ' ' floxed mouse, thus, knocking out the Mirl 7-92 cluster specifically in the myeloid lineage (Mendeli JT 2008).
  • the protein lysates of WT and mir 17 -92 ' ' ' macrophages were analyzed by western blot using specific autophagy antibodies.
  • ATG12-ATG5, ATG7, and ATG16L1 protein levels were substantially elevated in the absence of the Mir 17-92 cluster, but not ATG12, (Fig. 2C) as were their
  • FIG. 2D To determine if the elevated levels of ATG proteins in mir ⁇ 17-92 ' ' ' macrophages are directly associated with low levels of the cluster, mir '17-92 ' ' ' macrophages were transfected with Mirl 7 and Mir 20a mimics to restore their expression and assessed the autophagy protein expression profile. Overexpression of Mir 17 and Mir 20a led to a reduction in ATG12-ATG5 and ATG7 expression when compared to their scrambled controls (Fig. 2E). Collectively, these data provide strong evidence that the Mir 17-92 cluster modulates the expression of essential autophagy-related genes in macrophages.
  • Mirl 7 and Mir20a target the 3' ⁇ m3 ⁇ 4transSated region of Atg7 and Atgl6ll.
  • RNAs comprising the cluster are elevated in human and murine CF macrophages; however, Mirl 7 and Mir 20a exhibit the most significantly increased expression in mice, and Mir 17 is elevated in human CF macrophages (Figs. 2A and 2B). Therefore, Mirl 7 and Mir20a were further characterized in CF mice. Targeting only 2 Mirs is a more feasible therapeutic approach to take in the future, as it would potentially reduce off-target effects.
  • IH3T3 cells were transiently transfected with a iuciferase reporter construct containing the full length 3'-UTR of Atg7, Atgl6ll or an empty vector iuciferase reporter.
  • Transfection with Mirl 7 or Mir '20a mimics reduced iuciferase activity from ceils transfected with either Atg 7-3 '-UTR-luc or Atgl6ll -3 '-UTR-luc constructs (Figs. 3A and 3B).
  • mutations in the 3' -UTR of Atg7 (M-Atg7) or Atgl 611 Qs'l-Atgl6U) eliminated the Mirl 7 and Mir 20a mimic-mediated reduction of
  • FIGs. 3A and 3B Iuciferase activity.
  • CF macrophages transfected with either antagomirl7 or antagomir20a elicited a nonsignificant increase in ATG7 and ATG16L1 protein expression (Fig. 7C).
  • antagomirl7 and antagomir20a significantly increased the expression of ATG7 and ATG16L1 when compared to scramble-transfected cells (Figs. 3C and 3D).
  • Pulmonary delivery of antagomirl7 and antagomir20a improves the expression of targeted autophagy genes and autophagy activity in CF mice.
  • antagomirs against /W 7 and Mir 20a or scrambled control were delivered intratracheally, once a day for 3 days, to mice.
  • the lungs were harvested, homogenized and analyzed for the expression of Mirl 7 and Mir 20a by qRT-PCR. This regimen effectively lowered the expression of elevated Mir 17 and Mir 20a in the lungs of CF mice and did not alter the expression of other members of the cluster (Fig.
  • B. cenocepacia is primarily cleared by autophagy in the lungs of healthy mice and represents an often fatal infection in CF patients who suffer from reduced autophagy activity. Stimulation of autophagy by rapamycin in live mice and their macrophages contains the infection (Abdulrahman BA 2011).
  • bacterial loads were examined in the lungs of antagomir-treated CF mice to determine the functional consequences of targeted reduction of Mir 17 and Mir 20a.
  • CF mice treated with M/W 7 and Mir 20a antagomirs improved clearance of B. cenocepacia infection compared to their counterparts treated with scrambled control antagomirs (Fig. 5A). Both groups harbored similar bacterial loads at 4 h (Zhang L. 2009).
  • CFTR function is impaired in primary FSOSdel macrophages and is improved by reducing the levels of Mirl 7 and Mir20a via improved autophagy.
  • CFTR function was assessed using the fluorescent and hali de-sensitive compound 6-methoxy-N-(3-sulfopropyl)-quinolinium (SPQ) after modification of a protocol used to measure CFTR function in airway epithelial cells (Sermet-Gaudelus I, et al., "Normal function of the cystic fibrosis conductance regulator protein can be associated with homozygous (Delta)F508 mutation," Pediatr Res 2002; 52:628-35; Xie J, et al, "Intracellular loop between transmembrane segments IV and V of cystic fibrosis transmembrane conductance regulator is involved in regulation of chlori de channel conductance state," J Biol Chem 1995; 270:28084-91).
  • SPQ 6-methoxy-N-(3-sulfopropyl)-quinolinium
  • CFTR was activated using a "cocktail" containing forskolin, cpt-cAMP and 3-isobutyl-l-methylxanthine/IBMX to increase cAMP, since CFTR is a cAMP-activated channel .
  • Results demonstrated that resting CF macrophages exhibited significantly reduced CFTR activity compared to WT cells. Forty-eight h after transfection of combined antagomirs against Mirl 7 and Mir20a, an increase in fluorescence was detected in CF macrophages (Fig. 6). These results indicate that reducing the expression of inherently elevated Mirl 7 and Mir 20a in CF macrophages improves F508dei-CFTR function.
  • CF macrophages were transfected with antagomirl7 and antagomir20a in the presence or absence of the autophagy inhibitor 3-methyladenine (3 -MA).
  • the function of CFTR was determined by the SPQ assay as described above.
  • inhibition of autophagy activity by 3 -MA abolished the beneficial effect on CFTR function in CF macrophages achieved via decreasing Mirl 7 and Mir 20a expression (Fig. 6).
  • the Mir20a antagomir failed to elevate Alg7 expression, suggesting that A// 7 has more specificity towards Atg7 than Mir 0a
  • the seed sequences of Mir 17 and Mir20a are the same but have different duplex structures causing different silencing efficacies for their targets.
  • Online computational prediction data showed that the free energy release between Mirl 7 and Atg7 or Atgl6ll is higher than between Mi 20a and Atg7 or Atgl6ll suggesting that Mir 17 binds to the 3'UTR of Atg7 or Atgl6U more stably and complementary than Mir 20a.
  • targeting Mirl 7 can be used in conjunction with CFTR potentiators that are demonstrating partial efficacy in clinical trials.
  • Improved autophagy activity may be a result of the release of sequestered essential autophagy proteins, such as ATG7, from SQSTMl /p62 collections within F508del aggregates (Abdulrahman BA 2011; Assani K 2014; Luciani A 2011; Junkins RD 2014; Luciam A 2010; Mayer ML 2013).
  • the disassembly of these aggregates would allow for the autophagy molecules to traffic and localize to the phagophore membrane, and also permit folded F508del-CFTR protein to reach the plasma membrane and facilitate chloride transport.
  • Another potential regulator ⁇ ' element of autophagy is the existence of 2 paralogs of the cluster, Mirl06a-363 and Mir 106b ⁇ 2 '5. Each paralog shares high sequence similarity with one another and intersects the predicted targets.
  • the role of autophagy regulation by the paralogs is unknown, although their expression is dispensable early in life, whereas expression of the Mirl 7-92 cluster is required for normal development (Ventura A, et al., "Targeted deletion reveals essential and overlapping functions of the Mirl 7 through 92 family of MirNA clusters," C 2008; 132:875-86).
  • CF Male and female children older than 2 years and adult patients with CF were recruited from a CF clinic. The diagnosis of CF was confirmed by the presence of two CF causing mutations on genetic blood testing and/or an elevated sweat chloride test. Data including patient demographics, medications, hospitalizations for PEx, and relevant clinical factors were collected in a database upon recruitment. Age and gender-matched healthy controls were recruited through Clinical Research Services. The control population was older and had more females, but subjects undergoing Ivacaftor/Lumacaftor treatment were not matched to healthy controls, and tended to be younger skewing the overall cohort.
  • the CF subjects had moderate lung disease as shown by forced expiratory volume in 1 second (FEVi)% predicted based on American Thoracic Society criteria (Beydon, N., et al., "An official American Thoracic Society/European Respiratory Society statement: pulmonary function testing in preschool children, " Am J Respir Crit Care Med, 2007; 175(12): 1304- 45, and the majority were pancreatic insufficient.
  • the majority of the CF cohort had at least one copy of the F508del mutation.
  • Subject outcomes were stratified based upon Mire 1 /Mir 17-92 cluster expression.
  • the occurrence of a PEx was the primary outcome measure which was defined by clinicians, and verified according to a previously published definition (Rosenfeld, M, et al., "Defining a pulmonary exacerbation in cystic fibrosis,” J Pediatr, 2001 ; 139(3):359-65).
  • the outcome of lung function was measured FEVi and forced vital capacity (FVC) on pulmonary function testing during routine clinical visits.
  • Percent predicted measurements and z scores for FEVi and FVC were derived from reference equations (Jones, M., et al., "Forced expiratory flows and volumes in infants.
  • RNA from plasma and sputum samples was isolated using the miRNeasy Mini Kit (Qiagen, 217004), Expression of mature Mir 17, Mir 18a, Mir 19a, Mir 19b, MirlOa, Mir92a, Mir 101, and SNORD48/RNU48 fas an endogenous control for neutrophils) or cel-mir-39, cel-mir-54, and cel-mir238 (Thermo Fisher Scientific, 000200, 001361 , and 000248, spike-in controls for plasma and sputum samples), were analyzed by first converting the RNA to cDNA using specific primers (Applied Biosystems, Assay ID 2308, 2422, 395, 396, 580, 431, 002253, 001232, respectively) using the T aqManTM MicroRNA Re
  • PCR was conducted according to the manufacturer's guidelines.
  • cDNA was primed with speeificTaqMan primers listed above and assayed using TaqMan Universal PCR MasterMix (Applied Biosystems, 4304437) and Applied Biosystems, 4304437).
  • the Mire 1/Mir 17-92 cluster is elevated in CF mouse model and in human CF macrophages (Tazi, M.F., et al., "Elevated Mircl/Mirl7-92 cluster expression negatively regulates autophagy and CFTR (cystic fibrosis transmembrane conductance regulator) function in CF macrophages," Autophagy, 2016; 12(1 1 ):2026-2037). To determine if this finding was specific to macrophages or more broadly expressed, Mire 1/Mir 17-92 cluster expression was examined in neutrophils isolated from blood of 5 patients with CF and 5 age-matched, healthy controls.
  • CF neutrophils demonstrated significantly increased Mir 18, Mir 19b, and Mir92 expression compared to non-CF neutrophils (Figure 8A).
  • the expression of Mir 18, Mir 19a and Mir 20a was also increased but did not reach statistical significance. Therefore, taken our published and recent findings herein, the expression of specific Mirs within the Mire 1/Mir 17-92 is significantly elevated in macrophages but not neutrophils from CF patients.
  • Innate immune cells such macrophages and neutrophils, from CF patients express high levels of Mir 17-92 cluster and are associated with weak autophagy activity which is essential for CFTR regulation, offering a potential new biomarker for autophagy-related functions in immune cells.
  • the results with macrophages and neutrophils offer a reliable sample for testing the Mir el ' /Mir 17-92 cluster as a biomarker, the routine derivation of immune cells from blood samples can be laborious in a clinical setting. Therefore, it was determined if the expression of the Mir 17-92 cluster in readily available samples such as plasma and sputum.
  • Cluster expression was measured in frozen plasma samples to determine if the Mire I /Mir 17-92 cluster could be detected in the absence of circulating phagocytes. Mire 1/Mir 17-92 cluster expression was detected in low levels in both CF and non-CF plasma samples ( Figure 8B). There was no significant difference between CF and non-CF plasma samples.
  • Mire 1/Mir 17-92 cluster were analyzed for their correlation with index lung function (FEVi, FVC), BMI, and age. Sputum concentrations for all six cluster members correlated with FVC (rho range -0.389 - -0.545, Mir 92a shown in Figure 9A), FEVI (rho range -0.392 - - 0.503), and age (rho range 0,44 - 0,528, Mir 92a shown in Figure 9B).
  • Mircl/Mirl 7-92 cluster expression correlates with the onset of pulmonary
  • Lumacaftor/Ivacaftor is a combination CFTR modulator that was approved in July 2015 by the United States Food and Drug Administration for CF patients that are homozygous for the F508del mutation. Lumacaftor/Ivacaftor demonstrated modest increases in patient lung function and decreases in PEx in clinical trials (Wainwright, C.E., et al., "Lumacaftor-Ivacaftor in Patients with Cystic Fibrosis Homozygous for Phe508del CFTR," N Engl J Med, 2015, 373(18): 1783-4).
  • Mircl/Mirl 7-92 cluster expression was measured in sputum from 17 subjects before and 6 months after Lumacaftor/Ivacaftor initiation to determine if treatment initiation impacted cluster expression (Figisre 10B).
  • Mir92a expression significantly decreased post Lumacaftor/Ivacaftor initiation, but there was an overall wide spread of data points for the other individual Mirs pre- and post- Lumacaftor/Ivacaftor initiation.
  • Outliers were noted in subjects who were exacerbated at drug initiation, similar to sputum levels previously presented. Therefore, in congruence with modest clinical improvement observed in clinical trials, Lumacaftor/Ivacaftor treatment did not significantly affect the expression of the Mircl/Mirl 7-92 cluster.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Cystic fibrosis therapy and compositions for cystic fibrosis therapy are disclosed. Methods of modulating autophagy activity and compositions for modulating autophagy activity are disclosed. In specific aspects, antagomirs that comprise a nucleic acid that hybridizes to a Mir17-92 cluster under moderate or high stringent conditions are disclosed. Pharmaceutical compositions comprising these antagomirs and a pharmaceutically acceptable carrier are also disclosed. Methods of using these pharmaceutical compositions to treat a patient with cystic fibrosis, increasing clearance of infection in a patient with cystic fibrosis, reducing inflammation in a patient, modulating autophagy activity in a patient, increasing CFTR function in a patient, and treating other related diseases are also disclosed. Methods of assaying levels of Mir17-92 expression are also disclosed.

Description

TARGETING MICRORNAS TO IMPROVE AUTOPHAGY ACTIVITY IN CYSTIC FIBROSIS AND ASSOCIATED DISORDERS
CROSS REFERENCE TO RELATED APPLICATIONS
This application claims the benefit of U.S. Provisional Patent Application Serial No. 62/547,482 filed August 18, 2017, which is expressly incorporated herein by reference.
ACKNOWLEDGEMENT OF GOVERNMENT SUPPORT
This invention was made with government support under Grant No. R01HL127651 awarded by the National Institutes of Health. The government has certain rights in the invention.
BACKGROUND
Cystic fibrosis (CF) is an autosomal recessive disease caused by mutations in the CFTR gene that result in defective CFTR function in many organs; however, the majority of CF-associated morbidity and mortality arises from pulmonary infection and inflammation (Jiang Q, et al., "Cellular heterogeneity of CFTR expression and function in the lung:
implications for gene therapy of cystic fibrosis," Eur J Hum Genet 1998; 6: 12-31). The CFTR. gene encodes a transmembrane chloride channel that is regulated by ATP hydrolysis and expressed in various cell types including epithelial ceils and macrophages (Welsh MJ, et al, "Dysfunction of CFTR bearing the delta F508 mutation," J ' Cell Sci Suppl 1993; 17:235-9).
In epithelial cells, the CFTR channel conducts anions and plays a critical role in regulating the volume and composition of airway surface liquid (Coakley RD, et al., "Abnormal surface liquid pH regulation by cultured cystic fibrosis bronchial epithelium," Proc Natl Acad Sci USA 2003; 100: 16083-8), a thin layer of aqueous fluid and mucus covering the airway surface whose properties include facilitating mucociliary clearance, bacterial killing, and epithelial cell homeostasis (Blouquit S, et al ,, "Ion and fluid transport properties of small airways in cystic fibrosis," Am JRespir Crit Care Med 2006; 174:299- 305).
The function of the CFTR channel in macrophages remains unclear although recent work demonstrates that defective CFTR function i s accompanied by an impaired innate immune response to specific infections (Bmscia EM, et al., "Innate and Adaptive Immunity in Cystic Fibrosis," Clin Chest Med, ' 2016; 37: 17-29, Hartl D, et al., "Innate immunity in cystic fibrosis lung disease," J Cyst Fibros 2012; 1 1 : 363 -82; Doling G, et al., "Cystic fibrosis and innate immunity: how chloride channel mutations provoke lung disease," Cell Microbiol 2009, 11 :208-16, Pier GB. "Role of the cystic fibrosis transmembrane conductance regulator in innate immunity to Pseudomonas aeruginosa infections," Proc Natl Acad Sci USA 2000; 97:8822-8; Abdulrahman BA et al., "Autophagy stimulation by rapamycin suppresses lung inflammation and infection by Burkholderia cenocepacia in a model of cystic fibrosis," Autophagy 2011; 7: 1359-70; Abdulrahman BA, et al., "Depletion of the ubiquitin-binding adaptor molecule SQSTMl/p62 from macrophages harboring cftr DeltaF508 mutation improves the delivery of Burkholderia cenocepacia to the autophagic machinery " JBiol Chem 2013; 288:2049-58).
In CF patients with the most common mutation, F508del, the mutant form of the protein fails to traffic properly to the plasma membrane. This leads to a critical lack of fluid exchange across the membrane. Should the F508del-CFTR traffic to the cell membrane in response to therapy, the mutant protein then regains partial channel function in epithelial ceils (French PJ, et al., "A delta F508 mutation in mouse cystic fibrosis transmembrane conductance regulator results in a temperature-sensitive processing defect in vivo," J Clin Invest 1996; 98: 1304-12; Gomes-Alves P, et al., "Low temperature restoring effect on F508del-CFTR misprocessing: A proteomic approach," J Proteomics 2009; 73 :218-30). Heterozygote humans and mice do not suffer pathological symptoms despite the fact that their cells exhibit only 50% functional activity of the CFTR channel (Hogenauer C, et al., "Active intestinal chloride secretion in human carriers of cystic fibrosis mutations: an evaluation of the hypothesis that heterozygotes have subnormal active intestinal chloride secretion," Am J Hum Genet 2000; 67: 1422-7). Thus, small improvement of CFTR channel function in F508dei homozygotes is accompanied by a significant improvement in ensuing symptoms as reported by several clinical trials (Oglesby IK, et al., "Regulation of cy stic fibrosis transmembrane conductance regulator by microRNA-145, -223, and -494 is altered in DeltaF508 cystic fibrosis airway epithelium," J Immunol 2013, 190:3354-62; Klionsky DJ," The molecular machinery of autophagy and its role in physiology and disease," Semin Cell Dev Biol 2010, 21 :663),
Recent studies have implicated reduced autophagy activity in a number of physiological and pathophysiological processes such as aging, cancer, neurodegenerative diseases, innate immunity, chronic obstructive pulmonary disease, pulmonary hypertension, idiopathic lung fibrosis, and CF (Abdulrahman BA 2011; Abdulrahman BA 2013; Klionsky D.) 2010, Assani K, et al., "IFN-gamma stimulates autophagy-mediated clearance of Burkholderia cenocepacia in human cystic fibrosis macrophages," PLoS One 2014;
z 9:e96681; Luciani A, et al., "Cystic fibrosis: a disorder with defective autophagy,"
Autophagy 201 1 ; 7: 104-6; Mizushima N, et al ., "A protein conjugation system essential for autophagy," Nature 1998; 395:395-8; Wang CW, et al., "The molecular mechanism of autophagy," Mol Med 2003; 9:65-76). Autophagy functions to yield energy and nutrients during stress or starvation of the cell (Yang Z, et al., "Eaten alive: a history of
macroautophagy," Nat Cell Biol 2010; 12:814-22). In addition, autophagy can also restrict specific pathogens within macrophages and improve clearance of misfoided protein aggregates that cannot be managed by proteasomes (Bjorkoy G, et al., "p62/SQSTMl : a missing link between protein aggregates and the autophagy machinery," Autophagy 2006; 2: 138-9). The process of autophagy involves formation of double-membrane compartments (phagophores) that engulf nonfunctional organelles and cytoplasm. These phagophores then mature into autophagosomes that fuse with Ivsosomes to form autolysosomes, within which the autophagic cargo is degraded and recycled for protein and ATP synthesis via
degradative enzymes from the iysosome (Mizushima N 1998; Klionsky DJ, et al.,
" Autophagy as a regulated pathway of cellular degradation," Science 2000; 290: 1717-21). Autophagosome formation is mediated by a series of autophagy-promoting molecules including Atg5, Atgl2, Atgl6, Atg7, Atg8 (mammalian MAP1LC3/LC3 and GABARAP) and Vps30/Atg6 (BECNl/Beclinl) {Id.). Thus, the absence or reduction in expression of one factor can markedly impair the autophagy process.
Burkholderia (B) cenocepacia is notorious for infecting CF patients and is resistant to the majority of antibiotics. In healthy macrophages, B. cenocepacia is cleared by autophagy. However, macrophages from CF humans and mice fail to control B.
cenocepacia due to impaired autophagy activity (Abdulrahman BA 201 1; Abdulrahman BA 2013; Abdelaziz HAD, et al., "The cooperation between the autophagy machinery and the infiammasome to implement an appropriate innate immune response: Do they regulate each other? Immunological Reviews 2015; 265: 194-204). CF mice allow A cenocepacia to establish infection in their lungs, which triggers an intense, and often lethal, inflammatory response {Id). Therefore, clearance of B. cenocepacia from the lungs of CF mice refl ects the amount of autophagy activity.
The pathobiology of CF is multi-factorial, including functional impairment of autophagy in macrophages, as indicated by increased susceptibility to specific bacterial infections and inflammation (Junkins RD, et al., "The emerging potential of autophagy- based therapies in the treatment of cy stic fibrosis lung infections," Autophagy 2014; 10:538- 47). Macrophages expressing mutant F508dei-CFTR on both alleles inherently exert reduced autophagv activity, which is associated with exacerbated inflammatory responses (Abdulrahman BA 2011; Abdulrahman BA 2013; Luciani A 201 1 , Luciani A, et ai, "Defective CFTR induces aggresome formation and lung inflammation in cystic fibrosis through ROS-mediated autophagy inhibition," Nat Cell Biol 2010, 1.2:863-75). In this regard, autophagy controls bacterial infection and ILIB/IL-Ι β production in macrophages (Mayer ML, et al., "Rescue of dysfunctional autophagy attenuates hyperinflammatory responses from cystic fibrosis ceils," J Immunol ' 2013; 190: 1227-38). The link between the CFTR mutation and the autophagy impairment has established macrophages as major players in CF pathology (Abdulrahman BA 2011; Abdulrahman BA 2013; opp BT, et al., "Exaggerated inflammatory responses mediated by Burkholderia cenocepacia in human macrophages derived from Cystic fibrosis patients," Biochem Biophys Res Commiin 2012; 424:221-7). Emerging studies also investigate neutrophil function in CF (Witko-Sarsat V, et al ., "Inflammation and CFTR: might neutrophils be the key in cystic fibrosis?" Mediators Inflamm 1999; 8:7-11; Zhou Y, et ai., "Cystic fibrosis transmembrane conductance regulator recruitment to phagosomes in neutrophils," J Innate Immun 2013, 5:219-30). Thus, CF pathobiology encompasses several immune cells, in addition to epithelial cells, recognizing that CF is a newly identified immune deficiency disorder.
It was previously demonstrated in a CF mouse model, that treatment with rapamycin, an autophagy-inducing drug, improves autophagy activity and reduces the lung inflammatory response both in vitro and in vivo. (Abdulrahman BA 2011; Abdulrahman BA 2013; Abdelaziz HAD 2015; Amer AO, et al, "Autophagy is an immediate macrophage response to Legionella pneumophila," Cell Microbiol 2005, 7:765-78; Khalil H, et al., "Aging is associated with hypermethylation of autophagy genes in macrophages,"
Epigenetics 2016, 11(5):381 -8). Rapamycin treatment also improves CFTR function in airway epithelial cells (Luciani A 2011; Luciani A 2010; Luciani A, et ai., "Targeting autophagy as a novel strategy for facilitating the therapeutic action of potentiators on DeltaF508 cystic fibrosis transmembrane conductance regulator," Autophagy 2012; 8: 1657- 72). The use of rapamycin reinforces the concept that restoration of autophagy activity is beneficial for CF patients. However, rapamycin elicits severe side-effects and thus cannot be used for the young CF population. Therefore, alternative approaches to improve autophagy in CF and associated disorders are needed (Junkins RD 2014; Huang S, et al., "Inhibitors of mammalian target of rapamycin as novel antitumor agents: from bench to clinic," ( 'HIT Opin Investig Drugs 2002; 3 :295-304). The compositions and methods disclosed herein address these and other needs. SUMMARY
In accordance with the purposes of the disclosed materials and methods, as embodied and broadly described herein, the disclosed subject matter, in one aspect, relates to compounds, compositions and methods of making and using compounds and
compositions. In specific aspects, the disclosed subject matter relates cystic fibrosis therapy and compositions for cystic fibrosis therapy. In further aspects, the disclosed subject matter relates to modulation of autophagy activity and compositions for modulating autophagy activity. In specific embodiments, the disclosed subject matter relates to antagomirs that comprise a nucleic acid that hybridizes to a Mir 77-92 cluster under moderate or high stringent conditions. Pharmaceutical compositions comprising these antagomirs and a pharmaceutically acceptable carrier are also disclosed. Methods of using these
pharmaceutical compositions to treat a patient with cystic fibrosis, increasing clearance of infection in a patient with cystic fibrosis, reducing inflammation in a patient, modulating autophagy activity in a patient, increasing CFTR function in a patient, and treating other related diseases are also disclosed. Methods of assaying levels of Mir 17-92 expression are also disclosed.
Additional advantages will be set forth in part in the description that follows or may¬ be learned by practice of the aspects described below. The advantages described below will be realized and attained by elements and combinations particularly pointed out in the appended claims. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive.
BRIEF DESCRIPTION OF THE FIGURES
The accompanying figures, which are incorporated in and constitute a part of this specification, illustrate several aspects described below.
Figures 1A-1C show primary F508del (CF) murine macrophages exhibit weak autophagic flux during resting and starvation conditions. Figure 1A shows western blot for basal level autophagy proteins in WT (black bars) and F508del primary mouse macrophages (white bars). Densitometry analyses of western blot bands were normalized to their respective loading control bands using ImageJ software to control for loading. Panels shown represent 3 independent experiments displaying similar results. Figure IB shows the scoring of the percentage of macrophages harboring more than 5 puncta in WT and F508del macrophages before (NT, black) and after 2 h of starvation (starved, white). Data are representative of scoring the means ± SEM of 900 WT macrophages and 700 F508del macrophages. Figure 1C shows confocai microscopy representing autophagy activity of resting and starved WT and F508del macrophages. Blue (DAPI) stain indicates nuclei and green stain indicates L.C3 pun eta (autophagosome formation). Asterisks (*) indicates p<0.05; **, p<0.01 ; and ***, p<0.001.
Figures 2A-2E show Mirl 7-92 cluster expression i s elevated in primary
homozygous F508del macrophages and targets several autophagy molecules. Figure 2A shows quantitative real-time PGR (qPCR) representing the expression of Mir 17-92 cluster members in resting WT (black bars) and F508del (white bars) murine macrophages.
Student's two-tailed /-test was used to determine significance at p<0.5. WT macrophage cluster expression compared to F508del macrophage cluster expression was also significant as calculated by two-way ANOVA p<0.05. WT macrophages n=5 and F508del
macrophages n=4 for Mir 17-92 analysis. Graphs are representative of compiling means ± SD. Figure 2B shows qPCR representing the expression of Mir 17-92 cluster in human blood monocyte-derived macrophages from 6 non-CF (black bars) and 6 CF (white bars) patients. Data shown represent the means ± SD. Student's two-tailed /-test was used to assess significance. Figure 2C shows western blot for autophagy proteins in WT (black bars) and mir 17-92"'' macrophages (gray bars). Densitometric analyses of bands were normalized to their respective actin loading control bands using imageJ software. Each blot is representative of 3 independent experiments displaying similar results. Figure 2D shows qPCR results for autophagy-regulating genes in WT (black bars) and mir 17-92"''' macrophages (gray bars). Data are presented as fold change compared to WT normalized to 1 and are presented as the means ± SD, n=3. Student's two-tailed /-test was used to determine significance at p<0.05. Figure 2E shows western blot for autophagy proteins in mir 17-92''" macrophages untreated (NT, black bars), transfected with scramble control nucleotides (gray bars), or Mir 17 and Mir 20a mimics (white bars). Protein level s were normalized to their respective actin levels and quantified by ImageJ software, n=3. * indicates p<0.05 for differences between transfected scrambled controls and mimics.
Figures 3A-3D show Mir 17 and Mir20a target the 3 'UTRs of Atg7 and Atg 1611. In Figures 3A and 3B, NIH3T3 cells transfected with luciferase reporter constructs containing the 3 'UTR of murine Atg7 (Figure 3A) or Atg 1611 (Figure 3B), or their mutated 3'UTR (M-Atg7, M~Atgl6Il), were not treated (NT) or treated with scramble control nucleotides (Figures 3A and 3B), or Mir 17 or Mir 20a mimics or their corresponding antagomirs.
Antagomirl? and antagomir20a were transfected to reduce corresponding endogenous miRNA. levels. Luciferase expression was normalized to the level of Renilla measured. Data shown are representative of the average luciferase production conducted in quadruplicate ± SD. n=3 and asterisks indicate significant differences by one-way ANOVA. Figures 3C and 31) show western blot for (Figure 3C) ATG7 or (Figure 3D) ATG16L1 in F508del macrophages transfected with antagomirl 7 and antagomir20a. The blot is representative of 3 independent experiments displaying similar results and protein bands were normalized to their respective ACTB bands and quantified by Image.) software. * indicates p<0.05; and ***, p 0.001 .
Figures 4A-4C show decreasing the expression of Mir 17 and Mir 20a in live F508del mice improves the expression of autophagy molecules. Figure 4A shows expression of members of the Mirl 7-92 cluster in F508del mice intratracheallv treated with scrambled control (black bars) or antagornirs to Mir 17 and Mir 20a (white bars) as measured by qPCR, Data are presented as the mean ± SD and are representative of n=6. Student's two-tailed /-test was used to determine significance for Mir 17 and Mir '20a. Significance assessed at p<0.05. Figure 4B shows expression of autophagy-regulating genes in F508del murine lung homogenate after intra-tracheai treatment with scramble (black bars) or antagomirl 7 and antagomir20a (white bars) assessed by qPCR. Data shown are
representative of the average expression analyzed in duplicate and presented as fold-change compared to WT normalized to one ± SD (n=3). Student's two-tailed /-test was performed and asterisks indicate significant differences at p<0.05. Figure 4C shows western blot for autophagy proteins, ATG7 and ATG16L1, in F508del lung homogenates post-intra-tracheal administration of scrambled control (black bars) or antagomirl 7 and anatgoMir20a (white bars). The blots shown are representative of 3 independent experiments displaying similar results and protein production bands were normalized to their respective ACTB bands and quantified by Image! software. * indicates p<0.05; and p<0.001.
Figures 5A-5B show targeting Mirl 7 and Mir '20a in F508del mice increases autophagy-mediated clearance of Burkholderia cenocepacia. F508del mice were intratracheallv treated with scrambled control (black bars) or antagomirl 7 and
antagomir20a (white bars), then infected with B. cenocepacia. Figure 5A shows after 48 h of infection, lungs were homogenized and plated for colony forming units (CPUs). Data shown represent the average CFU/gram of lung ± SD, n=4 per condition. Students two- tailed t-test was used to determine significance (*) at p<0.05. Figure SB show qPCR of individual Mirs within the Mir 17-92 cluster in lung homogenates. Data represent the mean expression ± SD, n=4 per condition. Student's two-tailed /-test was used to determine significance. * indicates p<0.05; **, p<0.01 . Figure 6 shows CFTR function is reduced in F508del murine macrophages and partially restored by decreasing /W 7 and Mir 20a expression levels via autophagy, F508del macrophages were untransfected, transfected with scramble control or antagomirl? and -20a (Antagomirs) for 48 h, and 3 -methyl adenine (3 -MA) for 6 h to inhibit autophagic flux. Cells were loaded with SPQ dye, quenched using an iodide buffer, and fluorescence output was measured. Data are presented as means of percent increase of F508del-CFTR ± SD from 5 independent experiments. Student's two-tailed -test was used to determine significance of antagomir transfection, and 3 -MA inhibition. ** indicates p<0.01.
Figure 7A-7C show expression of autophagy genes, proteins and MirlOl in WT and F508del macrophages. Figure 7A shows qPCR representing the expression of Atgl2 in macrophages from WT (black bars), F508del (white bars) and Mir 17 -92a cluster (gray bars) mice. Figure 7B shows qPCR representing the expression of Mir 101 in macrophages from WT (black bars) and F508del mice. Data shown represent the means ± SD, n=3. Student's two-tailed /-test was used to determine significance at p<0,05. Figisre 7C shows western blot for ATG7 and ATG16L1 in F508del macrophages transfected with antagomirl? or antagomir20a. The blot is representative of 3 independent experiments displaying similar results. Actin (ACTB) is used as the loading control.
Figures 8A-8C show CF patients have elevated Mircl/Mirl 7-92 cluster expression. In Figisre 8A, human neutrophils were isolated from peripheral blood samples from CF patients and healthy controls. Mircl/Mirl 7 -92 cluster expression was determined by qRT- PCR, n=8 for the control group and n=5 for the CF group, significance determined with Mann-Whitney U tests. Mir 17 p value 0,9433, Mir 18a p value I , Mir 19a p value 0.4762, Mir 19b p value l, Mir20a p value 0,8329, and Mir92 p value 0.9433. In Figure 8B, human plasma was isolated from peripheral blood samples from CF patients and healthy controls. Mircl/Mirl 7-92 cluster expression was determined by qRT-PCR, n 55 for the CF group and // 49 for the non-CF group. Mir 17 p value 0,4773, Mir 18a p value 0.6336, Mir 19a p value 0.2258, Mir 19b p value 0.2233, Mir 20a p value 0.4345, and Mir92a p value 0.1446. In Figisre 8C, sputum was obtained from 29 CF patients. Mire 1 /Mir 17 -92 cluster expression was determined by qRT-PCR and expression levels compared to plasma levels from Figure SB. Mir! " p value < 0.0001, Mir 18a p value < 0.0001, Mir 19a p value < 0,0001, Mirl9h p value < 0.0001 , Mir20a p value < 0.0001, mdMir92 p value < 0.0001. "*" = p value < 0.05, "**" = p value < 0.01, "***" = p value O.001.
Figures 9A-9C show sputum Mircl/Mirl 7-92 cluster expression correlates with lung function. Figure 9A shows a correlation plot for sputum Mir92a expression and forced vital capacity (FVC) from 27 patients with CF. Spearman's rank correlation coefficient (rho) = -0.545, p value = 0.003. Figure 9B shows a correlation plot for sputum Mir92a expression and age from 28 patients with CF. Spearman's rank correlation coefficient (rho) = 0,528, p value = 0,004, Figure 9C shows a correlation plot for FVC and age from 77 patients with CF. Pearson correlation coefficient (r) = - 0.3 9, p value = 0.005.
Figures 10A-10B show sputum Mircl/Mirl 7-92 cluster expression predicts pulmonary exacerbations. In Figure 10A, sputum samples cluster expression levels were grouped according to the presence or absence of a pulmonary exacerbation. Mir 17 p value = 0.004, Mir 18a p value = 0.024, Mr 19a p value = 0.019, Mir 19b p value = 0.012, Mir20a p value =:: 0.029, and Mir92a p value = 0.047. In Figure 10B, sputum from CF patients at baseline and 6 months-post-Lumacaftor/Ivacaftor initiation were obtained. Mircl/Mirl 7-92 cluster expression was determined by qRT-PCR, n=16 for each group. Expression levels were compared for each subject pre- and post-drug initiation. Mir 17 p value :;= 0.597, Mir 18a p value = 0.231, Mir 19a p value = 0.632, Mir 19b p value = 0.632, Mir20a p value = 0.376, mdMir92 p value = 0.058. *" = p value < 0.05, "**" - p value < 0.01 , "***" - p value <0.001.
DETAILED DESCRIPTION
The materials, compounds, compositions, and methods described herein may be understood more readily by reference to the following detailed description of specific aspects of the disclosed subject matter and the Examples and Figures included therein.
Before the present materials, compounds, compositions, and methods are disclosed and described, it is to be understood that the aspects described below are not limited to specific synthetic methods or specific reagents, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular aspects only and is not intended to be limiting.
Also, throughout this specification, various publications are referenced. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which the disclosed matter pertains. The references disclosed are also individually and specifically incorporated by reference herein for the material contained in them that is discussed in the sentence in which the reference is relied upon.
Definitions
In this specification and in the claims that follow, reference will be made to a number of terms, which shall be defined to have the following meanings: Throughout the specification and claims the word "comprise" and other forms of the word, such as "comprising" and "comprises," means including but not limited to, and is not intended to exclude, for example, other additives, components, integers, or steps.
As used in the description and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a composition" includes mixtures of two or more such compositions, reference to "an antagomif" includes mixtures of two or more such antagomirs, reference to "the agent" includes mixtures of two or more such agents, and the like.
"Optional" or "optionally" means that the subsequently described event or circumstance can or cannot occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.
As used herein, the term "isolated" means that the referenced material is removed from the environment in which it is normally found. Thus, an isolated biological material can be free of cellular components, i.e., components of the cells in which the material is found or produced. Isolated nucleic acid molecules include, for example, a PGR product, an isolated mR A, a cDNA, or a restriction fragment. Isolated nucleic acid molecules also include, for example, sequences inserted into plasmids, cosmids, artificial chromosomes, and the like. An isolated nucleic acid molecule is preferably excised from the genome in which it may be found, and more preferably is no longer joined to non-regulator}' sequences, non-coding sequences, or to other genes located upstream or downstream of the nucleic acid molecule when found within the genome. An isolated protein may be associated with other proteins or nucleic acids, or both, with which it associates in the cell, or with cellular membranes if it is a membrane-associated protein.
By "reduce" or other forms of the word, such as "reducing" or "reduction," is meant lowering of an event or characteristic (e.g., infection). It is understood that this is typically in relation to some standard or expected value, in other words it is relative, but that it is not always necessary for the standard or relative value to be referred to. For example, "reduces infection" means decreasing the amount of tumor cells relative to a standard or a control.
By "prevent" or other forms of the word, such as "preventing" or "prevention," is meant to stop a particular event or characteristic, to stabilize or delay the development or progression of a particular event or characteristic, or to minimize the chances that a particular event or characteristic will occur. Prevent does not require comparison to a control as it is typically more absolute than, for example, reduce. As used herein, something could be reduced but not prevented, but something that is reduced could also be prevented. Likewise, something could be prevented but not reduced, but something that is prevented could also be reduced. It is understood that where reduce or prevent are used, unless specifically indicated otherwise, the use of the other word is also expressly disclosed.
As used herein, "treatment" refers to obtaining beneficial or desired clinical results. Beneficial or desired clinical results include, but are not limited to, any one or more of: alleviation of one or more symptoms (such as infection), diminishment of extent of infection, stabilized (i.e., not worsening) state of infection, delaying spread (e.g., infections) of the infection, delaying occurrence or recurrence of infection, delay or slowing of infection progression, and amelioration of the infected state.
The term "patient" preferably refers to a human in need of cystic fibrosis therapy and/or autophagy activity modulation. However, the term "patient" can also refer to non- human animals, preferably mammals such as dogs, cats, horses, cows, pigs, sheep and non- human primates, among others, that are in need of treatment with a composition disclosed herein.
As used herein, the terms "administering" and "administration" refer to any method of providing a pharmaceutical preparation to a patient. Such methods are well known to those skilled in the art and include, but are not limited to, oral administration, transdermal administration, administration by inhalation, nasal administration, topical administration, intravaginal administration, ophthalmic administration, intraaural administration, intracerebral administration, rectal administration, sublingual administration, buccal administration, and parenteral administration, including injectable such as intravenous administration, intra-arterial administration, intramuscular administration, and subcutaneous administration. Administration can be continuous or intermittent. In some examples, a preparation can be administered therapeutically; that is, administered to treat an existing disease or condition. In some examples, a preparation can be administered prophylactically; that is, administered for prevention of a disease or condition.
As used herein, the term "composition" is intended to encompass a product comprising the specified ingredients in the specified amounts, as well as any product which results, directly or indirectly, from combination of the specified ingredients in the specified amounts. It is also understood that the compositions disclosed herein have certain functions. Disclosed herein are certain structural requirements for performing the disclosed functions, and it is understood that there are a variety of structures which can perform the same function which are related to the disclosed structures, and that these structures will ultimately achieve the same result. A weight percent (wt.%) of a component, unless specifically stated to the contrary, is based on the total weight of the formulation or composition in which the component is included.
A "nucleic acid molecule" refers to the phosphate ester polymeric form of ribonucieosides (adenosine, guanosine, uridine or cytidine; "RNA molecules") or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or
deoxycytidine; "DNA molecules"), or any phosphoester analogs thereof, such as phosphorothioates and thioesters, in either single stranded form, or a double-stranded helix. Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible. The term nucleic acid molecule, and in particular DNA or RNA molecule, refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear {e.g., restriction fragments) or circular DNA molecules, plasmids, and chromosomes. In discussing the structure of particular double-stranded DNA molecules, sequences may be described herein according to the normal convention of giving only the sequence in the 5' to 3' direction along the non -transcribed strand of DNA (i.e., the strand having a sequence homologous to the mR A). A "recombinant DNA molecule" is a DNA molecule that has undergone a molecular biological manipulation.
The term "nucleic acid hybridization" refers to anti-parallel hydrogen bonding between two single-stranded nucleic acids, in which A pairs with T (or U if an RNA nucleic acid) and C pairs with G. Nucleic acid molecules are "hybridizable" to each other when at least one strand of one nucleic acid molecule can form hydrogen bonds with the
complementary bases of another nucleic acid molecule under defined stringency conditions. Stringency of hybridization is determined, e.g., by (i) the temperature at which
hybridization and/or washing is performed, and (ii ) the ionic strength and (iii) concentration of denaturants such as formamide of the hybridization and washing solutions, as well as other parameters. Hybridization requires that the two strands contain substantially complementary sequences. Depending on the stringency of hybridization, however, some degree of mismatches may be tolerated. Under "low stringency" conditions, a greater percentage of mismatches are tolerable (i.e., will not prevent formation of an anti-parallel hybrid). See Molecular Biology of the Cell, Alberts et al., 3rd ed,, New York and London: Garland Publ., 1994, Ch. 7.
By "specifically hybridizes" is meant that a probe, primer, or oligonucleotide recognizes and physically interacts (that is, base-pairs) with a substantially complementary nucleic acid under high stringency conditions, and does not substantially base pair with other nucleic acids. Typically, hybridization of two strands at high stringency or under high stringent conditions requires that the sequences exhibit a high degree of complementarity over an extended portion of their length. Examples of high stringency conditions include: hybridization to filter-bound DNA in 0.5 M NaHPQ4, 7% SDS, 1 mM EDTA at 65°C, followed by washing in 0. Ix SSC/0.1% SDS at 68°C (where Ix SSC is 0.15M NaCl, 0.15M Na citrate) or for oligonucleotide molecules washing in 6xSSC/0.5% sodium pyrophosphate at about 37°C (for 14 nucleotide-long oligos), at about 48°C (for about 17 nucleoti de-long oligos), at about 55°C (for 20 nucleotide-long oligos), and at about 60°C (for 23 nucleotide- long oligos)). Accordingly, the term "high stringency hybridization" refers to a combination of solvent and temperature where two strands will pair to form a "hybrid" helix only if their nucleotide sequences are almost perfectly complementary (see Molecular Biology of the Cell, Alberts et al, 3rd ed., New York and London: Garland Publ., 1994, Ch. 7).
Conditions of intermediate or moderate stringency (such as, for example, an aqueous solution of 2* SSC at 65°C; alternatively, for example, hybridization to filter-bound DNA in 0.5 M NaHPC , 7% SDS, 1 mM EDTA at 65°C, and washing in 0.2 x SSC/0.1% SDS at 42°C) and low stringency (such as, for example, an aqueous solution of 2><SSC at 55°C), require correspondingly less overall complementarity for hybridization to occur between two sequences. Specific temperature and salt conditions for any given stringency
hybridization reaction depend on the concentration of the target DNA and length and base composition of the probe, and are normally determined empirically in preliminary experiments, which are routine (see Southern, J. Mol. Biol. 1975; 98: 503, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 2, eh. 9.50, CSH Laboratory Press, 1989; Ausubel et l. (eds.), 1989, Current Protocols in Molecular Biology, Vol. I, Green Publishing Associates, Inc., and John Wiley & Sons, Inc., New York, at p. 2. 10.3).
As used herein, the term "standard hybridization conditions" refers to hybridization conditions that allow hybridization of sequences having at least 75% sequence identity. According to a specific embodiment, hybridization conditions of higher stringency may be used to allow hybridization of only sequences having at least 80% sequence identity, at least 90% sequence identity, at least 95% sequence identity, or at least 99% sequence identity.
Nucleic acid molecules that "hybridize" to any desired nucleic acids of the present invention may be of any length. In one embodiment, such nucleic acid molecules are at least 10, at least 15, at least 20, at least 30, at least 40, at least 50, and at least 70 nucleotides in length. In another embodiment, nucleic acid molecules that hybridize are of about the same length as the particular desired nucleic acid.
The terms "percent (%) sequence similarity", "percent (¾)' sequence identity", and the like, generally refer to the degree of identity or correspondence between different nucleotide sequences of nucleic acid molecules or amino acid sequences of proteins that may or may not share a common evolutionary origin. Sequence identity can be determined using any of a number of publicly available sequence comparison algorithms, such as BLAST, FASTA, DNA Strider, GCG (Genetics Computer Group, Program Manual for the GCG Package, Version 7, Madison, Wisconsin), etc.
To determine the percent identity between two amino acid sequences or two nucleic acid molecules, the sequences are aligned for optimal comparison purposes. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., percent identity :;= number of identical positions/total number of positions (e.g. , overlapping positions) x 100). In one embodiment, the two sequences are, or are about, of the same length. The percent identity between two sequences can be determined using techniques similar to those described below, with or without allowing gaps. In calculating percent sequence identity, typically exact matches are counted.
The determination of percent identity between two sequences can be accomplished using a mathematical algorithm. A non-limiting example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of ariin and Altschul, Proc Natl Acad Sci USA 1990, 87:2264, modified as in Kariin and Altschul, Proc Natl Acad Sci USA 1993, 90:5873-5877. Such an algorithm is incorporated into the NBLAST and
XBLAST programs of Altschul et al, J Mol. Biol 1990; 215: 403. BLAST nucleotide searches can be performed with the NBLAST program, score :;= 100, wordlength :;= 12, to obtain nucleotide sequences homologous to sequences of the invention. BLAST protein searches can be performed with the XBLAST program, score = 50, wordlength =:: 3, to obtain amino acid sequences homologous to protein sequences of the invention. To obtain gapped alignments for comparison puiposes, Gapped BLAST can be utilized as described in Altschul et al, Nucleic Acids Res. 1997, 25:3389, Alternatively, PSI-Blast can be used to perform an iterated search that detects distant relationship between molecules. See Altschul et al. (1997) supra. When utilizing BLAST, Gapped BLAST, and PSI-Blast programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. Another non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller, CABIOS 1988; 4: 11-17. Such an algorithm is incorporated into the ALIGN program (version 2.0), which is part of the GCG sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used.
Compositions
Production of functional proteins requires multiple steps, including gene
transcription and posttranslational processing. MicroRNAs (Mirs) can regulate individual stages of these processes (Treiber T, et a!., "Regulation of microRNA biogenesis and function," Thromb Haemost 2012; 107:605-10). Mirs are an evolutionarily, conserved class of small (~21-24 nucleotides) noncoding RNAs that play key roles in the transcriptional and posttranscriptionai regulation of gene expression (Id . Reports have demonstrated the extent to which Mirs regulate CFTR expression and function (Oglesby ΪΚ 2013;
Ramachandran S, et al., "A microRNA network regulates expression and biosynthesis of wild-type and DeltaF508 mutant cystic fibrosis transmembrane conductance regulator," Proc Natl Acad Sci USA 2012; 109: 13362-7; Bazett M, et al., "MicroRNA profiling of cystic fibrosis intestinal disease in mice," Mo I Genet Metab 201 1; 103 :38-43), yet their role in the context of autophagy has yet to be investigated.
As disclosed herein, in silico approaches were used to identify the importance of the Mir 17-92 cluster, which generates a single polycistronic transcript that yields 6 mature Mirs: Mir J 7, Mir 18a, Mir 19a, Mir20a, Mir 19 b, and Mir92 (Mendell JT, Miriad roles for the Mirl7-92 cluster in development and disease," Cell 2008; 133 :217-22). The
polycistronic Mirl 7-92 cluster was initially linked to tumorigenesis (Id . Dakhlallah D, et al ., "Epigenetic Regulation of Mir 17-92 Contributes to the Pathogenesis of Pulmonary Fibrosis," Am J Respir Crit Care Med 2013; 187:397-405; Aguda BD, et al., "MicroRNA regulation of a cancer network: consequences of the feedback loops involving Mirl 7-92, E2F, and jc," Proc Natl Acad Sci USA 2008; 105: 19678-83; Nana-Sinkam SP, et al., "Lung microRNA: from development to disease," Expert Rev Respir Med 2009, 3 :373-85, Bonauer A, et al., "The microRNA- 7-92 cluster: still a Miracle?" Cell Cycle 2009; 8:3866- 73; Chen L, et al., " / 17-92 cluster microRNAs confers tumorigenicity in multiple myeloma," Cancer Lett 2011; 309:62-70; Griilari J, et al, "Mir 17-92 cluster: ups and downs in cancer and aging," Bioger ontology 2010; 1 1 :501-6; Hayashita Y, et al., "A polycistronic microRNA cluster, Mirl 7-92, is overexpressed in human lung cancers and enhances ceil proliferation," Cancer Res 2005; 65:9628-32). The role of the M ' ir 17-92 cluster in CF has not been investigated. As demonstrated herein, members of the Mirl 7-92 cluster target multiple essential autophagy factors. In addition, several specific Mirs comprising the Mirl 7-92 cluster are overexpressed in CF human and murine macrophages with corresponding reduced expression of their predicted autophagy-targeted genes. Mirs comprising the Mirl 7-92 cluster exhibit a trend towards upregulation in CF cells, especially Mirl 7 and Mir20a, which are significantly increased in murine macrophages. Mir 17 is also significantly upregulated in macrophages derived from CF patients. Luciferase assays validated that both Mirl 7 and Mir 20a target Atg7 and Atgl6ll. Notably, reducing the inherently elevated expression of Mir 17 and Mir 20a improves ATG7 and ATG16L1 expression both in vitro and in vivo. In addition, reducing Mirl 7 and Mir 20a expression improves CFTR function by restoring autophagy expression. In this regard, targeting Mirl 7 was more efficient. Accordingly, B. cenocepacia clearance is improved in CF mice after intra-tracheal treatment with antagomirs to Mir 17 and Mir20a. Containment of B. cenocepacia upon administration of these specific antagomirs is accompanied by improved expression of targeted autophagy proteins. The disclosed material advances understanding of the mechanism underlying defective autophagy in CF and provides a therapeutic approach for restoring CFTR function and autophagy activity in patients with CF and other associated disorders.
In addition to the Mirl 7 -92a cluster, other Mirs also play a role in the function of the CFTR protein (Ramachandra S 2012; Bazett M 2011; Gillen AE, et al., "MicroRNA regulation of expression of the cystic fibrosis transmembrane conductance regulator gene," Biochem J 201 1 ; 438:25-32). Mir 138 was identified to regulate CFTR expression through its interaction with the transcriptional regulatory protein SIN3A (Ramachandra S 2012). Mir 384, Mil 494 and Mir 1246 are involved in the post-transcriptional regulation of CFTR channel synthesis {Id). Individuals carrying the F508dei mutation exhibit increased expression of Mir 145, Mir223, md Mir 494 in bronchial epithelium that correlates with decreased CFTR expression (Oglesby IK 2013). Therefore, overexpression of a variety of Mirs may cooperate to disrupt several functions in the CF cell. Thus the use of antagomirs of these Mir targets is also contemplated herein.
The disclosed compositions comprise antagomirs. Antagomirs interact with a target nucleic acid molecule (e.g., microRNA) through either canonical or non-canonical base pairing. The interaction of the antagomirs and the target molecule is designed to interrupt a processing function that normally would take place on the target molecule, such as transcription or replication. Antagomirs can be designed based on the sequence of the target nucleic acid molecule.
In the disclosed compositions, reference is made to the following sequences.
Figure imgf000019_0001
Antisense mature miR- 3'-UCA AAA CGU CCA A AG GUA GGU 27
19B-1 sequence CG-5'
AntagomiR miR~19B-l 5'-GC TGG ATG GAA ACC TGC AAA ACT28
S'
Mutant AntagomiR miR- 5'-GC AGG AAG CAA. AGC TCC TAA 29
19B-1 (Control) ACT-3'
Target mature miR-92A- 5'-AGG UUG GGA UCG GUU GCA AUG 30
J sequence CU-3'
Antisense mature niiR- 3'-UCC AAC CCU AGC CAA CGU UAC 31
92 A- 1 sequence GA-5'
AntagomiR miR-92A-l 5 '-AG CAT TGC AAC CGA TCC CAA CCT- 32
3'
Mutant AntagomiR miR- 5 '-AG GAT TCC ATC GGA ACC GAA CCT- 33
92 A- 1 (Control) 3'
Target mature miR-17-5P 5' -CAA AGU GCU UAC AGU GCA GGU 34
AG-3 '
sequence (mouse)
Antisense mature miR- 3' -GUU UCA CGA AUG UCA CGU CCA 35
UC-5'
17-5P sequence (mouse)
AntagomiR miR-17-5P 5'-CU ACC UGC ACU GUA AGC ACU 36
(mouse) UlJG-3'
Target mature miR-20 5'~UAA AGU GCU UAU AGU GCA GGU 37
AG-3'
sequence (mouse)
Antisense mature miR-20 3'-AUU UCA CGA AUA UCA CGU CCA 38
UC-5'
sequence (mouse)
AntagomiR miR-20 5'-CU-ACC UGC ACU AUA AGC ACU 39
UUA-3'
(mouse)
In specific examples, disclosed herein are pharmaceutical composition comprising an antagomir and a pharmaceutically acceptable carrier. In the disclosed compositions the antagomir comprises, or is, a nucleic acid that hybridizes to & Mir 17-92 cluster under moderate stringent conditions. The nucleic acid can be a noti-naturally occurring nucleic acid. In other examples, the nucleic acid hybridizes to the Mir 17-92 cluster under high stringent conditions. Reference to Mir 17-92 includes any part of the cluster. T e Mir 17-19 cluster can be from a mouse or human, preferably a human. In specific examples, however, the nucleic acid can hybridize to Mir 17, Mir 18a, Mir 19a, Mir 20a, Mir 19b, or Mir 92 under moderate or under high stringent conditions. In specific examples, the nucleic acid hybridizes to Mirl 7 under moderate or under high stringent conditions. In other examples, the nucleic acid hybridizes io Mir 20a under moderate or under high stringent conditions. In further examples, the composition can comprise more than one antagomir, each antagomir comprising a nucleic acid that hybridizes under moderate or stringent conditions to a different part of the Mirl 7-92 cluster.
In the disclosed compositions, the nucleic acid can hybridize to SEQ ID Nos. : 10, 14, 18, 22, 26, 30, 34, or 37. For example, the nucleic acid can hybridize to SEQ ID Nos.: 10, 20, 34, 01- 37.
In the disclosed compositions, the nucleic acid can have at least 80 % sequence homology to SEQ ID Nos: 12, 16, 20, 24, 28, 32, 36, or 39, e.g., at least 90%, at least 95%, or at least 99% sequence homology to SEQ ID Nos: 12, 16, 20, 24, 28, 32, 36, or 39, For example, the nucleic acid can have from 1 to 7, from 1 to 6, from 1 to 5, from 1 to 4, from 1 to 3, from 1 to 2, substitutions, e.g., 1, 2, 3, 4, 5, 6, or 7 substitutions.
In the disclosed compositions, the nucleic acid can have SEQ ID NO. : 12, 16, 20, 24, 28, 32, 36, or 39. In specific examples, the nucleic acid can have SEQ ID NO. : 12, 24, 36, or 39.
In the disclosed compositions, the composition can comprise more than one antagomir, each antagiomir comprising a nucleic acid that hybridizes to a different part of the Mirl 7-19 cluster under moderate stringent conditions. For example, the composition can comprise multiple nucleic acids that hybridize to difference sequences chosen from SEQ ID NO.: 10, 14, 18, 22, 26, or 30 under moderate or high stringent conditions. In other examples, any two or more of the nucleic acids disclosed herein can be combined in the disclosed compositions.
The disclosed nucleic acids can also be modified by many means known in the art. Non-limiting examples of such modifications include methylation, "caps", substitution of one or more of the naturally occurring nucleotides with an analog, and internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoroamidates, carbamates, etc.) and with charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.). Polynucleotides may contain one or more additional covalentiy linked moieties, such as, for example, proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalators (e.g., acridine, psoralen, etc.), chelators (e.g. , metals, radioactive metals, iron, oxidative metals, etc.), and alkylators. The polynucleotides may be derivatized by formation of a methyl or ethyl phosphotri ester or an alky! phosphoramidate linkage. Furthermore, the
polynucleotides herein may also be modified with a label capable of providing a detectable signal, either directly or indirectly. Exemplar}' labels include radioisotopes, fluorescent molecules, biotin, and the like.
The disclosed nucleic acids can have from 15 to 30 nucleosides, e.g., from 18 to 27, from 21 to 24, from 17 to 28, from 19 to 27, from 21 to 25, from 16 to 29, from 17 to 28, from 18 to 28, from 19 to 27, from 20 to 26, from 21 to 25, from 22 to 24 nucleosides.
The disclosed antagomirs can be obtained commercially, or can be prepared by nucleic acid synthetic techniques known to those of skill in the art. For example, they can be made using standard chemical synthesis methods or can be produced using enzymatic methods or any other known method. Such methods can range from standard enzymatic digestion followed by nucleotide fragment isolation (see for example, Sambrook et al. Molecular Cloning: A Laboratory Manual, 2nd Edition (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989) Chapters 5, 6) to purely synthetic methods, for example, by the cyanoethvl phosphoramidite method using a Miliigen or Beckman System lPlus DNA synthesizer (for example, Model 8700 automated synthesizer of Milligen- Biosearch, Burlington, MA or ABI Model 3 SOB). Synthetic methods useful for making oligonucleotides are also described by Acuta et al., Ann, Rev. Biochem. 1984, 53 :323-356, (phosphotriester and phosphite-triester methods), and Narang et al.. Methods Enzymol. 1980; 65:610-620, (phosphotriester method).
Pharmaceutical Compositions
The disclosed compositions can be formulated in a physiologically- or
pharmaceutically-acceptabie form and administered by any suitable route known in the art including, for example, oral, nasal, rectal, topical, and parenteral routes of administration. As used herein, the term parenteral includes subcutaneous, intradermal, intravenous, intramuscular, intraperitoneal, and intrasternal administration, such as by injection.
Administration of the disclosed compounds or compositi ons can be a single admini stration, or at continuous or distinct intervals as can be readily determined by a person skilled in the
The disclosed compositions can also be administered utilizing liposome technology, slow release capsules, implantable pumps, and biodegradable containers. These delivery methods can, advantageously, provide a uniform dosage over an extended period of time. The compounds can also be administered in their salt derivative forms or crystalline forms. Thus disclosed herein are liposomes comprising the pharmaceutical compositions disclosed herein.
The disclosed compositions can be formulated according to known methods for preparing pharmaceutically acceptable compositions. Formulations are described in detail in a number of sources which are well known and readily available to those skilled in the art. For example, Remington '$ Pharmaceutical Science by E.W. Martin (1995) describes formulations that can be used in connection with the disclosed methods. In general, the compositions disclosed herein can be formulated such that an effective amount of the compound (antagomir) is combined with a suitable carrier in order to facilitate effective administration of the compound. The compositions used can also be in a variety of forms. These include, for example, solid, semi-solid, and liquid dosage forms, such as tablets, pills, powders, liquid solutions or suspension, suppositories, injectable and infusible solutions, and sprays. The preferred form depends on the intended mode of administration and therapeutic application. The compositions also preferably include conventional
pharmaceutically-acceptable carriers and diluents which are known to those skilled in the art. Examples of carriers or diluents for use with the compounds include ethanol, dimethyl sulfoxide, glycerol, alumina, starch, saline, and equivalent carriers and diluents. To provide for the administration of such dosages for the desired therapeutic treatment, compositions disclosed herein can advantageously comprise between about 0.1% and 99%, and especially, 1 and 1 5% by weight of the total of one or more of the subject compounds based on the weight of the total composition including carrier or diluent.
Formulations suitable for administration include, for example, aqueous sterile injection solutions, which can contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient; and aqueous and nonaqueous sterile suspensions, which can include suspending agents and thickening agents. The formulations can be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and can be stored in a freeze dried (iyophilized) condition requiring only the condition of the sterile liquid carrier, for example, water for injections, prior to use. Extemporaneous injection solutions and suspensions can be prepared from sterile powder, granules, tablets, etc. It should be understood that in addition to the ingredients particularly mentioned above, the compositions disclosed herein can include other agents conventional in the art having regard to the type of formulation in question. Compositions disclosed herein can be delivered to a cell either through direct contact with the cell or via a carrier means. Carrier means for delivering compounds and compositions to cells are known in the art and include, for example, encapsulating the composition in a liposome moiety. Another means for delivery of compositions disclosed herein to a cell comprises attaching the compounds to a protein or nucleic acid that is targeted for delivery to the target cell. U.S. Patent No. 6,960,648 and U.S. Application Publication Nos. 20030032594 and 20020120100 disclose amino acid sequences that can be coupled to another composition and that allows the composition to be translocated across biological membranes. U.S. Application Publication No. 20020035243 also describes compositions for transporting biological moieties across cell membranes for intracellular delivery. Compounds can also be incorporated into polymers, examples of which include poly (D-L lactide-co-glycolide) polymer for intracranial tumors; poly[bis(p- carboxyphenoxy) propane: sebacic acid] in a 20:80 molar ratio (as used in GLIADEL);
chondroitin; chitin; and chitosan.
In certain examples, compositions disclosed herein can be locally administered at one or more anatomical sites, such as the lungs optionally in combination with a
pharmaceutically acceptable carrier such as an inert diluent. Compositions disclosed herein can be systemically administered, such as intravenously or orally, optionally in combination with a pharmaceutically acceptable carrier such as an inert diluent, or an assimilable edible carrier for oral delivery. They can be enclosed in hard or soft shell gelatin capsules, can be compressed into tablets, or can be incorporated directly with the food of the patient's diet. For oral therapeutic administration, the compositions can be combined with one or more excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, aerosol sprays, and the like.
The tablets, troches, pills, capsules, and the like can also contain the following: binders such as gum tragacanth, acacia, com starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, fructose, lactose or aspartame or a flavoring agent such as peppermint, oil of wintergreen, or cherry flavoring can be added. When the unit dosage form is a capsule, it can contain, in addition to materials of the above type, a liquid carrier, such as a vegetable oil or a polyethylene glycol. Various other materials can be present as coatings or to otherwise modify the physical form of the solid unit dosage form. For instance, tablets, pills, or capsules can be coated with gelatin, wax, shellac, or sugar and the like. A syrup or elixir can contain the
?? active compound, sucrose or fructose as a sweetening agent, methyl and propylparabens as preservatives, a dye and flavoring such as cherry or orange flavor. Of course, any material used in preparing any unit dosage form should be pharmaceutically acceptable and substantially non-toxic in the amounts employed. In addition, the active compound can be incorporated into sustained-release preparations and devices.
Compositions disclosed herein, including pharmaceutically acceptable salts, or hydrates thereof, can be administered intravenously, intramuscularly, or intraperitoneal!}- by infusion or injection. Solutions of the active agent or its salts can be prepared in water, optionally mixed with a nontoxic surfactant. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, triacetin, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations can contain a preservative to prevent the growth of microorganisms.
The pharmaceutical dosage forms suitable for injection or infusion can include sterile aqueous solutions or dispersions or sterile powders comprising the active ingredient, which are adapted for the extemporaneous preparation of sterile injectable or infusible solutions or dispersions, optionally encapsulated in liposomes. The ultimate dosage form should be sterile, fluid and stable under the conditions of manufacture and storage, he liquid carrier or vehicle can be a solvent or liquid dispersion medium comprising, for example, water, ethanol, a polyol (for example, glycerol, propylene glycol, liquid polyethylene glycols, and the like), vegetable oils, nontoxic glyceryl esters, and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the formation of liposomes, by the maintenance of the required particle size in the case of dispersions or by the use of surfactants. Optionally, the prevention of the action of microorganisms can be brought about by various other antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, buffers or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the inclusion of agents that delay absorption, for example, aluminum monostearate and gelatin.
Sterile injectable solutions are prepared by incorporating a compound and/or agent disclosed herein in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filter sterilization. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze drying techniques, which yield a powder of the active ingredient plus any additional desired ingredient present in the previously sterile- filtered solutions.
For administration by inhalation, the composition can be combined with a solubilizer and mixed with a propellant mixture. The composition can be micronized in a mixture of propellant and a pharmaceutically acceptable surfactant. The disclosed compositions can also be nebulized to facilitate administration by inhalation.
Useful solid carriers include finely divided solids such as talc, clay, macrocrystalline cellulose, silica, alumina and the like. Useful liquid carriers include water, alcohols or glycols or water-aicohol/gfycol blends, in which the compounds can be dissolved or dispersed at effective levels, optionally with the aid of non-toxic surfactants. Adjuvants such as fragrances and additional antimicrobial agents can be added to optimize the properties for a given use. The resultant liquid compositions can be applied from absorbent pads, used to impregnate bandages and other dressings, or sprayed onto the affected area using pump-type or aerosol sprayers, for example.
Useful dosages of the compounds and agents and pharmaceutical compositions disclosed herein can be determined by comparing their in vitro activity, and in vivo activity in animal models. Methods for the extrapolation of effective dosages in mice, and other animals, to humans are known to the art.
Also disclosed are pharmaceutical compositions that comprise a compound disclosed herein in combination with a pharmaceutically acceptable carrier. Pharmaceutical compositions adapted for oral, inhalation, or parenteral administration, comprising an amount of a compound constitute a preferred aspect. The dose administered to a patient, particularly a human, should be sufficient to achieve a therapeutic response in the patient over a reasonable time frame, without lethal toxicity, and preferably causing no more than an acceptable level of side effects or morbidity. One skilled in the art will recognize that dosage will depend upon a variety of factors including the condition (health) of the patient, the body weight of the patient, kind of concurrent treatment, if any, frequency of treatment, therapeutic ratio, as well as the severity and stage of the pathological condition.
Methods of Use
Inherently elevated A / 7-92 expression contributes to decreased autophagy in CF cells and that defective CFTR protein function is improved when autophagy activity is enhanced by reducing the expression of 'Mir Ί7 and Mir 20a. Several reports demonstrate that partial restoration of CFTR function is sufficient for improving CF pathobiology. Over 80% of CF individuals carry at least one allele with the F508dei-CFTR mutation (Bowling FG, et al., "Screening for cystic fibrosis: use of delta F508 mutation," Lancet 1990; 335:925-6), which leads to misfolding of the CFTR protein preventing its proper trafficking to the plasma membrane (Welsh MJ 1993; Morris MR, et al., "Cellular localisation of the most common mutant form of the CF gene protein, delta F508-CFTR," Biochem Soc Trans 1998; 26:8293). These heterozygote individuals express 50% of the normal amount of CFTR protein and secrete 50% of the airway surface fluid and chloride ions compared to healthy non-CF individuals (Patel S, et al., " Potentiators (specific therapies for class III and IV mutations) for cystic fibrosis," Cochrane Database SystRev 2015, 3:CD009841; Kuk K, et al., "Lumacaftor and ivacaftor in the management of patients with cystic fibrosis: current evidence and future prospects," Ther Adv Respir Dis 2015; 9:313-26). However, heterozygote humans and mice do not exhibit pathological symptoms (Cohen JC, et al, " The "Goldilocks effect" in cystic fibrosis: identification of a lung phenotype in the cftr knockout and heterozygous mouse," BMC Genet 2004; 5:21 ; Gabriel SE, et al,, "Cystic fibrosis heterozygote resistance to cholera toxin in the cystic fibrosis mouse model," Science 1994, 266: 107-9, Guilbault C, et al, "Cystic fibrosis mouse models," Am J Respir Cell Mol Biol 2007; 36: 1-7). Furthermore, increasing the expression of F508del-CFTR in only 10% of CF epithelial cells is sufficient to improve the level of CFTR-mediated chloride ion transport (Johnson LG, et al., "Efficiency of gene transfer for restoration of normal airway epithelial function in cystic fibrosis," Nat Genet 1992; 2:21-5). Similarly, expression of CFTR in 25%> of airway ceils is sufficient to restore normal mucus transport due to proper fluid homeostasis (Zhang L 2009).
As shown herein downregulation of inherently elevated Mir 17 and Mir 20a in murine macrophages results in improved CFTR channel function. Other Mirs within the cluster were unregulated only to a small extent. Thus, it appears that correcting Mir 17 and optionally Mir 20a is sufficient to restore significant autophagy activity in mice. Since Mir 17 is significantly elevated in human macrophages, it is possible that reducing its expression alone will be sufficient to improve CFTR functions and bacterial clearance in CF patients.
Thus, disclosed herein are methods of treating a patient with cystic fibrosis that comprise administering to the patient a pharmaceutical composition as disclosed herein. Also, disclosed are methods increasing clearance of Burkholderia cenocepacia in a patient with cystic fibrosis that comprise administering to the patient a pharmaceutical composition as disclosed herein. Clearance of other infections, e.g., with Staphylococcus aureus (S, aureus) and P'seudomonas aeruginosa (P. aeruginosa), can be accomplished by the same method. Still further, disclosed are methods of modulating autophagy activity in a patient (e.g., a patient having cystic fibrosis) that comprise administering to the patient a pharmaceutical composition as disclosed herein. Still further, disclosed herein are methods of reducing infection (e.g., an infection is from Burkholderia cenocepacid) in a patient (e.g., a patient having cystic fibrosis) that comprise administering to the patient a pharmaceutical composition as disclosed herein. Also, disclosed herein are methods of increasing CFTR function in a patient that comprise administering to the patient a pharmaceutical
composition as disclosed herein. Also, disclosed herein are methods of treating chronic obstructive pulmonary disease, pulmonary hypertension, oxidative stress, acute lung injury, sepsis, infectious lung disease, or idiopathic lung fibrosis in a patient that comprise administering to the patient a pharmaceutical composition as disclosed herein. Also, disclosed are methods of reducing inflammation in a patient with cystic fibrosis that comprise administering to the patient a pharmaceutical composition as disclosed herein.
In any of the disclosed methods, the pharmaceutical composition can comprise an antagomir and a pharmaceutically acceptable carrier, wherein the antagomir comprises a nucleic acid that hybridizes to & Mir 17 -92 cluster under moderate stringent conditions. In specific examples, the antagomir is antagiomir specific for Mir 17. In the disclosed methods the administration can be by, e.g., a nebulizer or inhaler. In any of the disclosed methods, the patient can be assayed for Mir :1~ '-92 expression before administration, during
administration, and/or after administration of the pharmaceutical composition. The disclosed methods are particularly suitable for patients with cystic fibrosis, but may also be used in other disease conditions characterized by weak autophagy accompanied by upregulation of the Mir 17-92 cluster or its members.
Assays
In the methods disclosed herein, assaying of 'Mir 117-92 expression can be performed prior to, during, or after administering any of the disclosed compositions. For example, the disclosed methods can comprise the step of determining a level of 'Mir 117-92 expression in any cell, e.g., macrophage or neutrophil. Alternatively, determining the level of one or more specific Mirs can be performed. These methods can permit one to evaluate the efficacy of treatment for CF and other diseases.
Also disclosed herein are methods of assaying autophagy activity in sputum from a patient with cystic fibrosis that comprise determining a level of expression of 'Mir : 17-92 cluster in the patient's sputum. In other examples, the level of expression of one or more of Mir 77, Mir 18a, Mir 19a, Mir 20a, Mir 19b, or Mir92 can be determined. The level of expression can be determined in any cell, but in specific examples, the level of expression is determined in macrophages or neutrophil s. The level of expression οΐ Mir 17-92 cluster, or any specific Mir within the cluster, can also be assayed from a blood sample.
The level of expression of 'Mir 117-92 cluster, or any specific Mir within the cluster, can be correlated to a level of autophagy activity, the likelihood of getting or clearing an infection, the likelihood of inflammation, or the likelihood of obtaining cancer.
In particular, cancer has emerged as an increasingly significant problem affecting the CF community as the average life expectancy for CF patients now exceeds 40 years (Maisonneuve P, et al ., "Cancer risk in cystic fibrosis: a 20-year nationwide study from the United States," J Natl Cancer Inst 2013; 105: 122-9; Maisonneuve P, et al., "Risk of pancreatic cancer in patients with cystic fibrosis," Gut 2007; 56: 1327-8). The fact that elevated expression of the Mir 17-92 cluster is associated with several types of
malignancies, and our findings that this cluster is elevated in CF patients, raises growing concerns about cancer predispositions in the CF population (Aguda BD 2008; Olive V, et al., "Mirl7-92, a cluster of MirNAs in the midst of the cancer network," Int J Biochem Ceil Biol 2010; 42: 1348-54; Padua RA, et al., "The cystic fibrosis delta F508 gene mutation and cancer," Hum Mutat 1997; 10:45-8). Current strides in research aim to prolong and improve the life of CF patients, however CF patients are prone to different types of cancers later in life (Maisonneuve P 20 3; Padua RA 1997; Neglia JP, et al ., "The risk of cancer among patients with cystic fibrosis," Cystic Fibrosis and Cancer Study Group," NEnglJMed
1995; 332:494-9). Elevated expression of the Mir 17-92 cluster in CF may contribute to this predisposition. It has also been shown that the Mir 17-92 cluster is highly expressed in intestinal tissue in CF patients (Bazett M 201 1). Should high levels of the Mir 17 -92 cluster correlate with increased susceptibility to cancer in CF, it would be even more critical to find approaches to control expression of the Mirl 7-92 cluster throughout the patient's life in an effort to improve bacterial clearance and chronic inflammation early in life, and prevent cancer at later stages in life. However, it will be important to carefully titrate the expression of Mir 17 and Mir 20a to normal physiological levels, rather than abolish them, given the importance of these Mirs in regulating diverse biological pathways. Thus, disclosed herein are methods of predicting cancer in a CF patient comprising determining the level οΐΜίιΊ 7- 92 cluster in a sample from a patient, e.g., a sputum sample. Patient' s having levels of Mirl ' 7-92 cluster that correlate with a high likelihood of getting cancer can then be treated, e.g., by the administration of preventative or therapeutic cancer treatments. The patients can also be given any of the antogomir containing compositions disclosed herein. The disclosed methods can also comprise determining the level of expression of any one or more of 'Mir 101, Mir 145, Mir223, Mir 384, Mir 494, and Mir 1246. For example. Increased mir-494 repressed CFTR expression (Amato, F., et al., "Gene mutation in microRNA target sites of CFTR gene: a novel pathogenetic mechanism in cystic fibrosis?" PLoS One, 2013; 8(3):e60448; Megiorni, F., et al., "Synergistic post-transcriptional regulation of the Cystic Fibrosis Transmembrane conductance Regulator (CFTR) by miR- 101 and miR-494 specific binding," PLoS One, 201 1; 6(10):e26601), whereas that of mir- 138 increased its level (Ramachandran, S., et al., "A microRNA network regulates expression and biosynthesis of wild-type and DeltaF508 mutant cystic fibrosis
transmembrane conductance regulator," Proc Nail Acad Sci USA, 2012; 109(33): 13362-7). Other studies have assessed miRNA-mediated regulation of inflammation in CF patients (Bhattacharyya, S., et al., "Elevated miR-155 promotes inflammation in cystic fibrosis by driving hyperexpression of interleukin-8," J Biol Chem, 2011 , 286(13): 11604-15). Mir- 126 was downregulated in bronchial epithelial cells from CF patients which modulates inflammatory response (Oglesby, I.K., et al., "Regulation of cystic fibrosis transmembrane conductance regulator by microRNA-145, -223, and -494 is altered in DeltaF508 cystic fibrosis airway epithelium," J Immunol, 2013, 190(7):3354-62). miR-17 overexpression in CF airway epithelial ceils decreases interieukin-8 production (Oglesby, I.K., et al., "miR-17 overexpression in cystic fibrosis airway epithelial cells decreases interleukin-8 production," /·.'///· Respir J, 2015; 46(5): 1350-60). Recently, Mirs were recently shown to have variant regional expression in the CF lung, with hypoxia-driven upper lobe predominance of some Mirs (Armstrong, D.A., et al ., "Pulmonary microRNA profiling: implications in upper lobe predominant lung disease," Clin Epigenetics, 2017; 9:56).
The level of expression of 'Mir 17-92 cluster, or a specific Mir therein, can be determined over a period of several years (e.g., for 5 year, 10 years, 20 years, 30 years, or 40 years).
EXAMPLES
The following examples are set forth below to illustrate the methods and results according to the disclosed subject matter. These examples are not intended to be inclusive of all aspects of the subject matter disclosed herein, but rather to illustrate representative methods and results. These examples are not intended to exclude equivalents and variations of the present invention, which are apparent to one skilled in the art.
Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.), but some errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, temperature is in °C or is at ambient temperature, and pressure is at or near atmospheric. There are numerous variations and combinations of reaction conditions, e.g., component concentrations, temperatures, pressures, and other reaction ranges and conditions that can be used to optimize the product purity and yield obtained from the described process. Only reasonable and routine experimentation will be required to optimize such process conditions.
All animal experiments were performed according to protocols approved by the Animal Care and Use Committee (IACUC) of The Ohio State University College of Medicine. Wild-type (WT) C57BL/6 mice were obtained from Jackson laboratories.
F508del mice were obtained from Case Western Reserve University. mirl7-92"'~ floxed mice were generously donated from the lab of Dr. Clay Marsh at The Dorothy M. Davis Heart and Lung Research Institute. All mice were housed in the OSU vivarium. BMDMs were isolated as previously described (Abdulrahman BA 201 1 ; Abdulrahman BA 2013). Immunoblotting
Macrophages were lysed in lysis buffer solution (lOmM Hepes, 5mM MgCh, ImM EGTA, 142mM KC1, 1% P-40) supplemented with a protease inhibitor cocktail (Roche Applied Science, 11 836 170 001). Thirty micrograms of protein were separated by sodium dodecyi sulfate- 12% PAGE and transferred to polyvinylidene difluroide membranes (Bio- Rad Laboratories, 162-01 17). Membranes were probed for ATG12-ATG5, ATG12, ATG16L1, ATG7 and actin (ACTB) (Sigma-Aldrich, A0856, A8731, SAB2501677, A2856 and Abeam ab8226, respectively). Protein bands were detected with secondary antibodies conjugated to horseradish peroxidase; Rabbit: GE Healthcare #NA934; Mouse:
ThermoFisher Scientific #A28177; goat: Santa Cruz #sc-2020 followed by enhanced chemiluminescence reagents (Amersham/GE Health Care-Life Sciences, RPN 2106), Confocal microscopy
Immunofluorescence microscopy experiments were performed as previously described (Abdulrahman BA 2011; Abdulrahman BA 2013). Antibodies used to stain autophagosomes were rabbit anti-LC3 (Abgent, API 805a) followed by fluorescent secondary antibodies (Molecular Probes, Al 1008), Nuclei were stained with the nucleic acid dye 4',6'-diamino-2-phenylindole (DAPI), Samples were analyzed with a FluoView F V 1 Oi confocal m i croscope .
Quantitative real-time PGR (qRT~PCR) for expression of Mirs
Total RNA was isolated from cells that were lysed in Trizol (Invitrogen Life
Technologies, 15596-026). Chloroform (Fisher Scientific, 268320010), isopropanol (Fisher Scientific, BP2618-212), and glycogen (Fisher Scientific, 10814010) were used to isolate total macrophage RNA and its concentration was measured by Nanodrop. Expression of mature Mirl 7, Mir 18a, Mir 19a, Mir 19b, Mir20a, Mir92a, Mir 101, and snoRNA202 as an endogenous control, were analyzed by first converting the RNA to cDNA by priming with specific primers (Applied Biosystems, Assay ID 2308, 2422, 395, 396, 580, 431, 002253, 001232, respectively) using the TAQMAN™ MicroRNA Reverse Transcription Kit (Applied Biosystems, 4366596). PGR was conducted according to the manufacturer's guidelines. For qRT-PCR, cDNA was primed with specific TaqMan primers listed above and assayed using TaqMan Universal PGR MasterMix (Applied Biosystems, 4304437) and Applied Biosystems ABI 7900HT real-time PGR system. Expression was calculated as relative copy numbers. Ct values of each Mir were subtracted from the average Ct of the internal control, snoRNA202 (mouse) or SNORD48/RNU48 (human), and the resulting ACt was used in the equation: relative copy numbers = (2"ΔΔα).
Quantitative real-time PCR for expression of autophag genes
Total RNA was isolated from cells lysed in Trizol, Atg5, Atg7, and Atgl6ll mRNA expression was assessed using SYBR Green PGR Master Mix (Life Technologies, 4309155). Briefly, Ct values of each target gene were subtracted from the average Ct of the housekeeping gene, Gapdh, and the resulting ACt was used.
Downregulation of elevated Mirl 7 and Mir20a in vitro and in vivo
Antagomirl7 and antagomir20a (Applied Biosystems, MH12412 and AM10057, respectively) were diluted to 100 nM in phosphate-buffered saline (Gibco, 14190-144) and transfected into macrophages using the Lipofectamine LTX and PLUS reagents (Life Technologies, 15338100) for 48 h according to the manufacturer's instructions. For in vivo studies, 2 -month-old F508del mice were anesthetized via isofluorane (The Ohio State University Veterinary Hospital) and intratracheally received antagomirl 7 and antagomir20 or scramble control (GE Dharmacon, ffi-310561 -08-0020, IH-310514-07-0020, or ΓΝ- 001005-01-20, respectively) at 25 (ug per mouse in 24-h intervals for 72 h (Krutzfeidt J, et a!., "Silencing of microRNAs in vivo with 'antagomirs'," Nature 2005; 438:685-9;
Wahlquist C, et al., "Inhibition of Mir25 improves cardiac contractility in the failing heart," Nature 2014; 508:531-5). The dose was derived from previous publications (Lovett-Racke AE, et al., "Silencing T-bet defines a critical role in the differentiation of autoreactive T lymphocytes," Immunity 2004; 21 :719-31). The antagomirs were reconstituted in siRNA buffer (GE Dhannacon, B2000UB100) and diluted in 1 X phosphate-buffered saline prior to administration. After 3 treatments, the mice were sacrificed and lungs were isolated. One lobe of the lung was homogenized in Trizol for RNA isolation. The other lobe was homogenized in lysis buffer with protease inhibitor, as described previously, for protein analysis. Homogenization was accomplished using the Qiagen Tissue Lyser (Qiagen, 85600) and accompanying 5 -mm stainless steel beads (Qiagen, 69989). Another set of mice was treated as described above then infected intratracheaily with B. cenocepacia and colony-forming units (CPUs) were quantified from homogenized lungs as previously described (Abdulrahman BA 201 ).
Luciferase reporter assays
The ΝΓΗ3Τ3 cell line was co-transfected with a piasmid containing either the Mir 3 'UTR target clone for murine Atg7, Atgl6ll or control vector (GeneCopoeia,
MmiT035820-MT01 , MmiT036321 -MT01 or CmiTOOOOOl, respectively) and Mir mimics to Mir 17 and Mir20a (Applied Biosystems, 4464066 or AM17101, respectively) using Lipofectamine 2000 according to the manufacturer's protocol. Antagomirl7 and antagomir20a were also transfected separately to downregulate endogenous Mir 17 or Mir 20a expression within the ΝΠΤ3Τ3 cells. Firefly and Renilla Luciferase activities were measured consecutively by using the Dual-Luciferase Reporter Assay system (Promega, El 910) 24 h after transfection. The seed regions (5' nucleotides 2 through 8) of mature Mir 17 and Mir 2 Octfd are predicted to bind with perfect complementarity to the sequence 5'- GCACUUU-3 ' (SEQ ID \0 .'■)}, which is present in ti\Q Atg7 md AtgJ6U 3 ' UTR . Site- directed mutagenesis was used to introduce 3 point mutations within these 7 nucleotides of the Atg7 and Atgl6Il 3 'UTR luciferase reporters to further test Mirl 7 and Mir20a/'b binding specificity. Primers for introducing point mutations were designed using the QuikChange Primer Design online tool to be compatible with the QuikChange Lightning Multi Site- Directed Mutagenesis kit (Agilent Technologies, # 210514). A list of mutagenesis primers can be found in Table 1.
Table 1. Site-directed mutagenesis primer sequences.
Figure imgf000033_0001
Atgl6 3'UTR Mutant cattagagaccttaagtcacaattttcaagaaagctacggcaccacatggc 4 g 104a_c 107t_t 109g antisense
Atgl6 3'UTR Mutant ctgggctgggaaaggactcactgtcctgctcgcc 5 c805g t807c tS!Oa sense
Atgl6 3'UTR Mutant ggcgagcaggaeagtgagtcctttcccagcecag 6 c805g_t807c_t810a antisense
Atgl6 3'UTR Mutant cacgtttgtctgtcacacttactttactcgttattttttgcttccacactgttct 7 g870a a872t t874g sense
Atg 16 3'UTR Mutant agaacagtgtggaagcaaaaaataacgagtaaagtaagtgtgacagacaaacgtg 8 g870a_a872t_t874g antisense
CFTR function
CFTR channels can transport chloride as well as iodide. Therefore, CFTR function was assessed by measuring iodide efflux using the fluorescent and halide-sensitive dye 6- methoxy-N-(3-sulfopropyl) quinoiinium (SPQ) as previously described (Cormet-Boyaka E, et al, " Rescuing cystic fibrosis transmembrane conductance regulator (CFTR)-processing mutants by transcomplementation," Proc Natl Acad Sci USA 2004; 101 :8221-6). Briefly, macrophages were plated in a 96-well plate. Cells were loaded with SPQ (Molecular Probes, M-440) using hypotonic shock and were incubated with 10 mM SPQ in Opti- MEM: water (1 : 1) for 15 min at 37°C. Cells were then washed and incubated twice for 10 min with fluorescence quenching Nal buffer (130 mM Nal, 5 mM KN03, 2.5 mM
Ca[N03]2, 2.5 mM Mg[N03]2, 10 niM D-glucose, 10 mM N-[2-hydroxyethyl] piperazine- A7 "-[2-ethanesulfonic] acid/HEPES, pH 7,4). Subsequently, cells were switched to a dequenching isotonic NaN03 buffer (identical to Nal buffer except that 130 mM Nal was replaced with 130 mM NaN03) in the presence of 20 μΜ forskolin (Abeam, ab 120058) and 100 μΜ 8-(4-chlorophenylthio)-c-AMP (Sigma-Aidrich, c3912) to activate CFTR. Nonspecific increase in fluorescence was measured by incubating the cells with the activation cocktail and the specific CFTR inhibitor GlyHl 01 (10 μΜ; Calbiochem, 219671.
Fluorescence was measured using the plate reader VICTOR X3 (Perkin Elmer) with excitation wavelength at 350 nm and DAPI emission filter.
Statistical analysis
All experiments were performed at least 3 independent times unless stated otherwise and yielded similar results. Comparisons of groups for statistical difference were done using two-tailed Student's /-test or ANOVA when described. P -value <0.05 was considered significant. * indicates p<0.05; **, p<0.01 ; and ***, p<0.001.
3? EXAMPLE 1:
Expression of autophagy proteins is reduced in primary CF (FSOSdel) macrophages,
CF macrophages exert weak autophagic activity (Abduirahman BA 2011;
Abdulrahman BA 2013, Assini K 2014) yet the underlying mechanisms behind this reduction remain unknown. To investigate the potential mechanism for compromised autophagy activity in CF cells, the expression of autophagy-related proteins in wild-type (WT) C57/BL6J and CF murine macrophages was investigated by western blot using specifi c antibodies. Notably, the expression of members of the ATG12-ATG5 protein complex and ATG7 was decreased in CF macrophages when compared to WT cells (Fig. 1A). However, ATG12 protein and mRNA levels were comparable in WT and F508del macrophages (Fig. 1A and Fig. 7A) (Abdulrahman BA 2011). To evaluate if the low expression level of autophagy family member proteins reduces the basal autophagy activity in resting WT and CF macrophages, the number of macrophages exhibiting more than 5 LC3 labeied-autophagosomes (puncta) was quantified using confocal microscopy. LC3 is a cytosolic autophagy protein that is recruited to phagophores; the subsequent
autophagosomes appear as donut-shaped structures called puncta. Significantly fewer resting CF macrophages had more than 5 puncta when compared to their WT counterparts (Figs. IB and IC). In addition, to determine autophagy activity in response to stimulation, macrophages were starved and those expressing more than 5 puncta were quantified. CF macrophages failed to increase their puncta content in response to starvation in contrast to WT macrophages (Figs. IB and IC). Therefore, CF macrophages fail to mount an autophagic flux response upon starvation. Together, these data provide evidence that CF macrophages exhibit lower expression of essential ATG proteins and are characterized by weak autophagic activity.
Expression of the Mirl 7-92 cluster is elevated in primary CF macrophages resulting in the reduction of several autophagy molecules.
Given the lack of current evidence regarding autophagy regulation in CF, predicted Mirs that may play a role in modulating the autophagy process was investigated and whether their expression is altered in CF cells. Using 2 online web servers that predict targets of specific Mirs, TargetScan and MirBase, it was determined that Mir 101 and the Mir 17-92 cluster are predicted to target autophagy-related mRNAs. Mir 101 was reported to target STMN1, RAB5A, and ATG4D, each of which is an important autophagic regulator (Frankel LB, et ai, "microRNA-101 is a potent inhibitor of autophagy," EMBO J 201 1 ;
.1.) 30:4628-41). The Mir 17-92 cluster is predicted to target Atg4, Atg5, Becnl, Atg7, Atgl2, Atgiei! and !.v3 (Table 2).
Table 2. Mirs comprising the Mircl /Mir7-92 cluster and MirlOl and their predicted targets.
Figure imgf000036_0001
To determine whether the expression of MirlOl and the Mir 17-92 cluster are altered in CF macrophages, quantitative real-time PCR (qRT-PCR) was performed on RNA lysates from murine WT and CF macrophages. Expression of MirlOl was not statistically different between WT and CF macrophages (Fig. 7B), whereas the Mir 17-92 cluster expression was significantly elevated in CF macrophages (Fig. 2A). While members of the cluster exhibit a trend towards upregulation in murine CF macrophages, Mir 17 and Mir 20a were
significantly increased (Fig. 2A). To determine whether these findings are consistent with human CF pathology, expression of Mirs comprising the cluster was assessed in
macrophages derived from blood monocytes of CF patients. Several members of the cluster were upreguiated, but only Mir 17 was significantly upreguiated in both human and mouse samples (Fig. 2B). These data suggest that the inherently elevated expression level of Mir 17-92 cluster members in CF macrophages contributes at least in part to the reduced expression of several autophagy-related genes that potentially impair autophagy activity in CF macrophages.
To determine the extent to which the elevated Mirl 7-92 cluster contributed to the reduced expression of autophagy molecules, their expression was examined in the absence of cluster expression. Macrophages lacking the Mir 17-92 cluster were obtained from mirl 7- 92'''' floxed mice (Chakraborty S, et al., uPri-Mirl7-92a transcript folds into a tertiary structure and autoreguiates its processing," RNA 2012; 18: 1014-28). Since a complete knockout of the cluster is embryonic lethal, these mice were obtained by breeding a Lyz2 LysM-cre mouse with a mirl 7-92"'' floxed mouse, thus, knocking out the Mirl 7-92 cluster specifically in the myeloid lineage (Mendeli JT 2008). The protein lysates of WT and mir 17 -92''' macrophages were analyzed by western blot using specific autophagy antibodies. ATG12-ATG5, ATG7, and ATG16L1 protein levels were substantially elevated in the absence of the Mir 17-92 cluster, but not ATG12, (Fig. 2C) as were their
corresponding mRNA expression (Fig. 2D). To determine if the elevated levels of ATG proteins in mir 17-92''' macrophages are directly associated with low levels of the cluster, mir '17-92''' macrophages were transfected with Mirl 7 and Mir 20a mimics to restore their expression and assessed the autophagy protein expression profile. Overexpression of Mir 17 and Mir 20a led to a reduction in ATG12-ATG5 and ATG7 expression when compared to their scrambled controls (Fig. 2E). Collectively, these data provide strong evidence that the Mir 17-92 cluster modulates the expression of essential autophagy-related genes in macrophages.
Mirl 7 and Mir20a target the 3'~m¾transSated region of Atg7 and Atgl6ll.
Several microRNAs comprising the cluster are elevated in human and murine CF macrophages; however, Mirl 7 and Mir 20a exhibit the most significantly increased expression in mice, and Mir 17 is elevated in human CF macrophages (Figs. 2A and 2B). Therefore, Mirl 7 and Mir20a were further characterized in CF mice. Targeting only 2 Mirs is a more feasible therapeutic approach to take in the future, as it would potentially reduce off-target effects. To confirm the binding of Mir 17 and Mir 20a to the 3' untranslated (3 - UTR) regions ofAtg7 and Atgl6ll, IH3T3 cells were transiently transfected with a iuciferase reporter construct containing the full length 3'-UTR of Atg7, Atgl6ll or an empty vector iuciferase reporter. Transfection with Mirl 7 or Mir '20a mimics reduced iuciferase activity from ceils transfected with either Atg 7-3 '-UTR-luc or Atgl6ll -3 '-UTR-luc constructs (Figs. 3A and 3B). Notably, mutations in the 3' -UTR of Atg7 (M-Atg7) or Atgl 611 Qs'l-Atgl6U) eliminated the Mirl 7 and Mir 20a mimic-mediated reduction of
Iuciferase activity (Figs. 3A and 3B). To further verify the relationship between Mirl 7 and Mir 20a and the expression of their respective targets Atg7 and Atgl '611, the expression of these Mirs were inhibited in CF macrophages using specific antagomirs. CF macrophages transfected with either antagomirl7 or antagomir20a elicited a nonsignificant increase in ATG7 and ATG16L1 protein expression (Fig. 7C). However when transfected together, antagomirl7 and antagomir20a significantly increased the expression of ATG7 and ATG16L1 when compared to scramble-transfected cells (Figs. 3C and 3D). Therefore, transfection with specific antagomirl 7 and antagomir20a improved the expression of ATG7 and ATG16L1, whereas transfection with scramble antagomirs did not (Figs. 3A and 3B). Taken together, these data demonstrate that Mirl 7 and Mir 20a target the Atg7 and Atgl6ll genes and modulate their expression in CF macrophages.
Pulmonary delivery of antagomirl7 and antagomir20a improves the expression of targeted autophagy genes and autophagy activity in CF mice.
To determine whether reducing the elevated expression of Mir J 7 and Mir 20a in vivo improves the expression of targeted autophagy genes, antagomirs against /W 7 and Mir 20a or scrambled control were delivered intratracheally, once a day for 3 days, to mice. The lungs were harvested, homogenized and analyzed for the expression of Mirl 7 and Mir 20a by qRT-PCR. This regimen effectively lowered the expression of elevated Mir 17 and Mir 20a in the lungs of CF mice and did not alter the expression of other members of the cluster (Fig. 4.4), To determine the extent to which decreasing the expression of "Mir 17 and Mir20a rescues the expression of targeted autophagy genes in vivo, lung homogenates were analyzed for the mRNA levels of autophagy genes Atg5, Atg7 and Atg 1611 by qRT-PCR and western blot. Delivery οΐΜίιΊ7 and Mir 20a antagomirs to the lungs of CF mice resulted in a statistically significant increase of mRNA levels of Alg7 and protein levels of ATG7 and ATG16L1 (Figs. 4B and 4C).
B. cenocepacia is primarily cleared by autophagy in the lungs of healthy mice and represents an often fatal infection in CF patients who suffer from reduced autophagy activity. Stimulation of autophagy by rapamycin in live mice and their macrophages contains the infection (Abdulrahman BA 2011). Thus, bacterial loads were examined in the lungs of antagomir-treated CF mice to determine the functional consequences of targeted reduction of Mir 17 and Mir 20a. Notably, CF mice treated with M/W 7 and Mir 20a antagomirs improved clearance of B. cenocepacia infection compared to their counterparts treated with scrambled control antagomirs (Fig. 5A). Both groups harbored similar bacterial loads at 4 h (Zhang L. 2009). Improved autophagy activity as indicated by improved bacterial clearance, was accompanied by significant reductions in the expression of ir 17 and Mir -20a in lung tissues of mice treated with the corresponding antagomirs even in the presence of B. cenocepacia (Fig. SB). Therefore, targeting Mirl 7 and MirlOa in vivo improves autophagy activity in live CF mice.
CFTR function is impaired in primary FSOSdel macrophages and is improved by reducing the levels of Mirl 7 and Mir20a via improved autophagy.
As demonstrated herein, correcting the inherently elevated levels of Mirl 7 and Mir 20a in CF macrophages in vitro and in vivo improved autophagy activity. To determine the effect of reducing Mirl 7 and Mir 20a on the function of the F508del-CFTR channel, primary CF macrophages were transfected with antagomirs against Mir 17 and Mir 20a or a scramble control . After 48 h, CFTR function was assessed using the fluorescent and hali de- sensitive compound 6-methoxy-N-(3-sulfopropyl)-quinolinium (SPQ) after modification of a protocol used to measure CFTR function in airway epithelial cells (Sermet-Gaudelus I, et al., "Normal function of the cystic fibrosis conductance regulator protein can be associated with homozygous (Delta)F508 mutation," Pediatr Res 2002; 52:628-35; Xie J, et al,, "Intracellular loop between transmembrane segments IV and V of cystic fibrosis transmembrane conductance regulator is involved in regulation of chlori de channel conductance state," J Biol Chem 1995; 270:28084-91). CFTR was activated using a "cocktail" containing forskolin, cpt-cAMP and 3-isobutyl-l-methylxanthine/IBMX to increase cAMP, since CFTR is a cAMP-activated channel . Results demonstrated that resting CF macrophages exhibited significantly reduced CFTR activity compared to WT cells. Forty-eight h after transfection of combined antagomirs against Mirl 7 and Mir20a, an increase in fluorescence was detected in CF macrophages (Fig. 6). These results indicate that reducing the expression of inherently elevated Mirl 7 and Mir 20a in CF macrophages improves F508dei-CFTR function. Furthermore, to determine if this improvement in CFTR function was mediated by increased autophagy activity in antagomir-treated cells, CF macrophages were transfected with antagomirl7 and antagomir20a in the presence or absence of the autophagy inhibitor 3-methyladenine (3 -MA). The function of CFTR was determined by the SPQ assay as described above. Notably, inhibition of autophagy activity by 3 -MA abolished the beneficial effect on CFTR function in CF macrophages achieved via decreasing Mirl 7 and Mir 20a expression (Fig. 6). Collectively, these findings provide evidence that restoration of CFTR function upon reduction of Mirl 7 and Mir 20a is mediated by autophagy. Together, these data provide evidence that correcting elevated levels of Mir 17 and Mir 20a in CF improves autophagy and CFTR function.
Discussion
Both Mir 17 and Mir 20a mimics were able to downregulate Atg7 and Atgl6ll;
however, the Mir20a antagomir failed to elevate Alg7 expression, suggesting that A// 7 has more specificity towards Atg7 than Mir 0a, Notably, the seed sequences of Mir 17 and Mir20a are the same but have different duplex structures causing different silencing efficacies for their targets. Online computational prediction data showed that the free energy release between Mirl 7 and Atg7 or Atgl6ll is higher than between Mi 20a and Atg7 or Atgl6ll suggesting that Mir 17 binds to the 3'UTR of Atg7 or Atgl6U more stably and complementary than Mir 20a. Thus, targeting Mirl 7 can be used in conjunction with CFTR potentiators that are demonstrating partial efficacy in clinical trials. These findings are corroborated by the recent clinical trials demonstrating the restoration of defective autophagv in CF airways can be achieved by proteostasis regulators, such as cystamine and its reduced form, cysteamine (De Stefano D, et al ., "Restoration of CFTR function in patients with cystic fibrosis carrying the F508del-CFTR mutation,'" Autophagy 2014;
10:2053-74). As suggested above, these agents also rescue and stabilize F508del-CFTR at the plasma membrane (Luciani A 212; Villella VR, et al., "Towards a rational combination therapy of cystic fibrosis: How cystamine restores the stability of mutant CFTR,"
Autophagy 2013; 9: 1431 -4).
Improved autophagy activity may be a result of the release of sequestered essential autophagy proteins, such as ATG7, from SQSTMl /p62 collections within F508del aggregates (Abdulrahman BA 2011; Assani K 2014; Luciani A 2011; Junkins RD 2014; Luciam A 2010; Mayer ML 2013). The disassembly of these aggregates would allow for the autophagy molecules to traffic and localize to the phagophore membrane, and also permit folded F508del-CFTR protein to reach the plasma membrane and facilitate chloride transport.
Another potential regulator}' element of autophagy is the existence of 2 paralogs of the cluster, Mirl06a-363 and Mir 106b~2 '5. Each paralog shares high sequence similarity with one another and intersects the predicted targets. The role of autophagy regulation by the paralogs is unknown, although their expression is dispensable early in life, whereas expression of the Mirl 7-92 cluster is required for normal development (Ventura A, et al., "Targeted deletion reveals essential and overlapping functions of the Mirl 7 through 92 family of MirNA clusters," C 2008; 132:875-86).
EXAMPLE 2:
Male and female children older than 2 years and adult patients with CF were recruited from a CF clinic. The diagnosis of CF was confirmed by the presence of two CF causing mutations on genetic blood testing and/or an elevated sweat chloride test. Data including patient demographics, medications, hospitalizations for PEx, and relevant clinical factors were collected in a database upon recruitment. Age and gender-matched healthy controls were recruited through Clinical Research Services. The control population was older and had more females, but subjects undergoing Ivacaftor/Lumacaftor treatment were not matched to healthy controls, and tended to be younger skewing the overall cohort. The CF subjects had moderate lung disease as shown by forced expiratory volume in 1 second (FEVi)% predicted based on American Thoracic Society criteria (Beydon, N., et al., "An official American Thoracic Society/European Respiratory Society statement: pulmonary function testing in preschool children, " Am J Respir Crit Care Med, 2007; 175(12): 1304- 45, and the majority were pancreatic insufficient. The majority of the CF cohort had at least one copy of the F508del mutation.
Study parameters
Subject outcomes were stratified based upon Mire 1 /Mir 17-92 cluster expression. The occurrence of a PEx was the primary outcome measure which was defined by clinicians, and verified according to a previously published definition (Rosenfeld, M, et al., "Defining a pulmonary exacerbation in cystic fibrosis," J Pediatr, 2001 ; 139(3):359-65). The outcome of lung function was measured FEVi and forced vital capacity (FVC) on pulmonary function testing during routine clinical visits. Percent predicted measurements and z scores for FEVi and FVC were derived from reference equations (Jones, M., et al., "Forced expiratory flows and volumes in infants. Normative data and lung growth," Am J Respir Crit Care Med, 2000; 161(2 Pt l):353-9; Castile, R., et al, "Adult-type pulmonary function tests in infants without respiratory disease," Pediatr Pulmonoi, 2000; 30(3):215- 27). Nutritional status was determined by body mass index (BMI), which was calculated based on clinical measurements made by pulmonary dieticians during routine clinical visits. Sample collection
Whole blood samples were obtained and plasma was isolated via centrifugation and frozen at -80°C. Human neutrophils were then isolated and purified by negative selection. Briefly, blood was transferred to 50 mi conical tube and 50 μΐ of an antibody cocktail added per ml of blood (Stemcell technologies, Vancouver, BC, Canada), plus 50 μΐ of magnetic beads per ml of blood. The sample was incubated 5 min at room temperature, then PBS- EDTA was added up to 50 ml, the tube was placed in the magnet for 10 min, the
supernatant was transferred to a new tube and magnetic beads were added at the same amount of the previous step. The sample was placed 5 min in the magnet and the supernatant was collected. The ceils were centrifuged at 1600 rpm, and re-suspended in 1 ml of HBSS plus 1% of FBS before further experimentation. Sputum samples were obtained by spontaneous expectoration into sterile containers, all quoted in Trizol, and frozen at - 80°C.
Quantitative real-time PCR (qRT-PCR) for expression of Mirs
Total RNA was isolated from neutrophils lysed in Trizol (Invitrogen Life
Technologies, 15596-026) via chloroform (Fisher Scientific, 268320010), isopropanol (Fisher Scientific, BP2618-212), and glycogen (Fisher Scientific, 10814010). Total RNA from plasma and sputum samples was isolated using the miRNeasy Mini Kit (Qiagen, 217004), Expression of mature Mir 17, Mir 18a, Mir 19a, Mir 19b, MirlOa, Mir92a, Mir 101, and SNORD48/RNU48 fas an endogenous control for neutrophils) or cel-mir-39, cel-mir-54, and cel-mir238 (Thermo Fisher Scientific, 000200, 001361 , and 000248, spike-in controls for plasma and sputum samples), were analyzed by first converting the RNA to cDNA using specific primers (Applied Biosystems, Assay ID 2308, 2422, 395, 396, 580, 431, 002253, 001232, respectively) using the T aqMan™ MicroRNA Reverse Transcription Kit (Applied Biosystems, 4366596). PCR was conducted according to the manufacturer's guidelines. For qRT-PCR, cDNA was primed with speeificTaqMan primers listed above and assayed using TaqMan Universal PCR MasterMix (Applied Biosystems, 4304437) and Applied
Biosystems ABI 7900HT real-time PCR system. Expression was calculated as relative copy numbers. Ct values of each r'r were subtracted from the average Ct of the internal
{SNORD48,RNU48) or spike-in (cel-mir-39, -54, and -238) control, and the resulting ACt was used in the equation: relative copy numbers = (2-ΛΑ&).
The expression of Mire 1/Mir 17-9 cluster is elevated in neutrophils derived from CF patients
The Mire 1/Mir 17-92 cluster is elevated in CF mouse model and in human CF macrophages (Tazi, M.F., et al., "Elevated Mircl/Mirl7-92 cluster expression negatively regulates autophagy and CFTR (cystic fibrosis transmembrane conductance regulator) function in CF macrophages," Autophagy, 2016; 12(1 1 ):2026-2037). To determine if this finding was specific to macrophages or more broadly expressed, Mire 1/Mir 17-92 cluster expression was examined in neutrophils isolated from blood of 5 patients with CF and 5 age-matched, healthy controls. CF neutrophils demonstrated significantly increased Mir 18, Mir 19b, and Mir92 expression compared to non-CF neutrophils (Figure 8A). The expression of Mir 18, Mir 19a and Mir 20a was also increased but did not reach statistical significance. Therefore, taken our published and recent findings herein, the expression of specific Mirs within the Mire 1/Mir 17-92 is significantly elevated in macrophages but not neutrophils from CF patients.
CF patients have elevated Mire 1/Mir 17-92 cluster expression in sputum and not plasma
Innate immune cells, such macrophages and neutrophils, from CF patients express high levels of Mir 17-92 cluster and are associated with weak autophagy activity which is essential for CFTR regulation, offering a potential new biomarker for autophagy-related functions in immune cells. Although, the results with macrophages and neutrophils offer a reliable sample for testing the Mir el '/Mir 17-92 cluster as a biomarker, the routine derivation of immune cells from blood samples can be laborious in a clinical setting. Therefore, it was determined if the expression of the Mir 17-92 cluster in readily available samples such as plasma and sputum. Cluster expression was measured in frozen plasma samples to determine if the Mire I /Mir 17-92 cluster could be detected in the absence of circulating phagocytes. Mire 1/Mir 17-92 cluster expression was detected in low levels in both CF and non-CF plasma samples (Figure 8B). There was no significant difference between CF and non-CF plasma samples.
Given that sputum samples are non-invasively collected from CF patients on regular basis and yield considerable amounts of biological material, it was determined if
Mire 1/Mir 17-92 cluster expression was detectable in 45 CF sputum samples. Control sputum from non-CF individuals was not available for comparison. All six cluster members were detectable in CF sputum (Figure 8C). There was significantly higher expression of all cluster members in CF sputum compared to non-CF plasma (Figure 8C). Therefore, although plasma samples do not demonstrate substantial differences between CF and non- CF individuals, sputum samples elicit high levels of 'Mire 1/Mir 17-92 cluster that may reflect disease prognosis.
Sputum Mircl/Mirl 7-92 cluster expression correlates with lung function
In order to determine ΐ Mire 1/Mir 17-92 cluster expression in sputum samples correlated with clinical outcomes, both plasma and sputum expression levels of
Mire 1/Mir 17-92 cluster were analyzed for their correlation with index lung function (FEVi, FVC), BMI, and age. Sputum concentrations for all six cluster members correlated with FVC (rho range -0.389 - -0.545, Mir 92a shown in Figure 9A), FEVI (rho range -0.392 - - 0.503), and age (rho range 0,44 - 0,528, Mir 92a shown in Figure 9B). However, there was a greater correlation of cluster expression with age, compared to FVC and age (Figure 9C, rho = -0,3 9, p value 0,005), Combined, these results suggest associations of cluster expression with lung function and age, independent of the natural association of age and lung function in CF. All other comparisons were not significant.
Mircl/Mirl 7-92 cluster expression correlates with the onset of pulmonary
exacerbations
There are no reliable existing biomarkers in clinical use to predict PEx in patients with CF. PEx are associated with acute morbidity and rapid lung function decline, and hence, it is important to early detect and potentially prevent PEx. Due to the wide spread of cluster expression in sputum observed (Figure 8C), it was determined if Mircl/Mirl "7-92 cluster expression in sputum correlated with PEx status. Comparing exacerbated and non- exacerbated subjects, all six members of 'the Mire 1 '/Mir 17-92 cluster expression were significantly elevated in subjects at the start of a PEx compared to non-exacerbated subjects (Figure 10A). The effect of exacerbation was still significant for all six members after controlling for sex and age using ANCOVA. These results indicate that the Mire 1 /Mir 17-92 cluster expression may be useful in a model for predicting PEx.
Lumacaftor/Ivacaftor do eot alter Mircl/Mirl 7-92 cluster expression
Lumacaftor/Ivacaftor is a combination CFTR modulator that was approved in July 2015 by the United States Food and Drug Administration for CF patients that are homozygous for the F508del mutation. Lumacaftor/Ivacaftor demonstrated modest increases in patient lung function and decreases in PEx in clinical trials (Wainwright, C.E., et al., "Lumacaftor-Ivacaftor in Patients with Cystic Fibrosis Homozygous for Phe508del CFTR," N Engl J Med, 2015, 373(18): 1783-4). Opinions regarding the clinical utility of this new drug remain guarded (Jones, A.M., et al., "Lumacaftor/ivacaftor for patients homozygous for Phe508del-CFTR: should we curb our enthusiasm?" Thorax, 2015,
70(7):615-6) and there is few existing data regarding its efficacy and immunologic effects in CF patients. Mircl/Mirl 7-92 cluster expression was measured in sputum from 17 subjects before and 6 months after Lumacaftor/Ivacaftor initiation to determine if treatment initiation impacted cluster expression (Figisre 10B). Mir92a expression significantly decreased post Lumacaftor/Ivacaftor initiation, but there was an overall wide spread of data points for the other individual Mirs pre- and post- Lumacaftor/Ivacaftor initiation. Outliers were noted in subjects who were exacerbated at drug initiation, similar to sputum levels previously presented. Therefore, in congruence with modest clinical improvement observed in clinical trials, Lumacaftor/Ivacaftor treatment did not significantly affect the expression of the Mircl/Mirl 7-92 cluster.
It will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention. Other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein. It is intended that the specification and examples be considered as exemplar}' only, with a true scope and spirit of the invention being indicated by the following claims.

Claims

CLAIMS What is claimed is:
1 . A pharmaceutical composition comprising: an antagomir and a pharmaceutically acceptable carrier, wherein the antagomir comprises a nucleic acid that hybridizes to a human Mirl 7-92 cluster under moderate stringent conditions.
2. The composition of claim I , wherein the nucleic acid hybridizes to the Mir J 7-92 cluster under high stringent conditions.
3. The composition of any one of the preceding claims, wherein the nucleic acid
hybridizes lo Ί /// " Mir 18a, Mir 19a, Mir20a, Mir 19b, or Mir92.
4. The composition of any one of the preceding claims, wherein the nucleic acid
hybridizes to Mir 17.
5. The composition of any one of the preceding claims, wherein the nucleic acid
hybridizes to Mir 20a,
6. The composition of any one of the preceding claims, wherein the nucleic acid
hybridizes to SEQ ID Nos. : 10, 14, 18, 22, 26, or 30.
7. The composition of any one of the preceding claims, wherein the nucleic acid
hybridizes to SEQ ID Nos. : 10 or 22.
8. The composition of any one of the preceding claims, wherein the nucleic acid has at least 80 % sequence homology to SEQ ID Nos: 12, 16, 20, 24, 28, or 32.
9. The composition of any one of the preceding claims, wherein the nucleic acid has at least 90 % sequence homology to SEQ ID Nos: 12, 16, 20, 24, 28, or 32.
10. The composition of any one of the preceding claims, wherein the nucleic acid has at least 95 % sequence homology to SEQ ID Nos: 12, 16, 20, 24, 28, or 32.
1 1. The composition of any one of the preceding claims, wherein the nucleic acid has at least 99 % sequence homology to SEQ ID Nos: 12, 16, 20, 24, 28, or 32.
12. The composition of any one of the preceding claims, wherein the nucleic acid has SEQ ID NO. : 12, 16, 20, 24, 28, or 32.
13. The composition of any one of the preceding claims, wherein the nucleic acid has SEQ ID NO. : 12 or 24.
14. The composition of any one of the preceding claims, wherein the composition
comprises more than one antagomir, each comprising a nucleic acid that hybridizes to a different part of the Mir 17-92 cluster under moderate stringent conditions.
15. The composition of any one of the preceding claims, wherein the composition is an oral tablet.
16. The composition of any one of the preceding claims, wherein the composition is an inhalable composition.
17. A liposome comprising the composition of any one of claims 1-16.
18. A method of treating a patient with cystic fibrosis, comprising; administering to the patient a pharmaceutical composition of any one of claims 1-16.
19. A method of increasing clearance of Burkholderia cenocepacia in a patient with cystic fibrosis, comprising: administering to the patient a pharmaceutical
composition of any one of claims 1-16.
20. A method of modulating autophagy activity in a patient, comprising: administering to the patient a pharmaceutical composition of any one of claim s 1-16.
21 . The method of claim 20, wherein the patient has cystic fibrosis.
22. A method of reducing infection in a patient, comprising: administering to the
patient a pharmaceutical composition of any one of claims 1-16.
23. The method of claim 22, wherein the infection is from Burkholderia cenocepacia Staphylococcus aureus or Pseudomonas aeruginosa.
24. The method of claim 22, wherein the patient has cystic fibrosis.
25. A method of treating chronic obstructive pulmonary disease, pulmonary
hypertension, oxidative stress, acute lung injury, sepsis, infectious lung disease, or idiopathic lung fibrosis in a patient, comprising: administering to the patient a pharmaceutical composition of any one of claims 1-16.
26. A method of reducing inflammation in a patient with cystic fibrosis, comprising: administering to the patient a pharmaceutical composition of any one of claims 1-16.
27. The method of any one of claims 18-26, wherein administration is by a nebulizer or inhaler.
28. The method of any one of claims 18-26, wherein the patient is assayed for Mir 17-92 expression before administration, during administration, and/or after administration of the pharmaceutical composition.
29. A method of modulating CFTR channel activity in a patient, comprising:
administering to the patient a pharmaceutical composition of any one of claims 1-16.
30. The method of claim 29, wherein the patient has cystic fibrosis.
31. Method of assaying autophagy activity in sputum from a patient with cystic fibrosis, comprising: determining a level of expression of 'Mir 17-92 cluster in the patient's sputum.
32. The method of claim 31 , wherein the level of expression of one or more of Mirl 7, Mir 18a, Mir 19a, Mir 20a, Mir 19h, or Mir92 is determined.
33. The method of any one of claims 31-32, further comprising determining a level of expression of 'Mir 17-92 cluster in the patient's blood.
PCT/US2018/047089 2017-08-18 2018-08-20 Targeting micrornas to improve autophagy activity in cystic fibrosis and associated disorders Ceased WO2019036720A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201762547482P 2017-08-18 2017-08-18
US62/547,482 2017-08-18

Publications (1)

Publication Number Publication Date
WO2019036720A1 true WO2019036720A1 (en) 2019-02-21

Family

ID=65362924

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2018/047089 Ceased WO2019036720A1 (en) 2017-08-18 2018-08-20 Targeting micrornas to improve autophagy activity in cystic fibrosis and associated disorders

Country Status (1)

Country Link
WO (1) WO2019036720A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110468084A (en) * 2019-09-20 2019-11-19 华南农业大学 A strain of Burkholderia cepacia and its application in the control of litchi frost blight and litchi anthracnose
WO2023092151A1 (en) * 2021-11-22 2023-05-25 Ohio State Innovation Foundation Compositions and methods for the treatment of neurodegenerative disorders
CN116334138A (en) * 2023-04-23 2023-06-27 中国医学科学院北京协和医院 A kind of cystic fibrosis mouse model and its construction method and application

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110136124A1 (en) * 2009-09-23 2011-06-09 Wilson Roa Microrna expression profiles associated with lung cancer
US20130064810A1 (en) * 2010-02-26 2013-03-14 Hans-Guido Wendel Methods and Compositions for the Detection and Treatment of Cancer involving miRNAs and miRNA Inhibitors and Targets

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110136124A1 (en) * 2009-09-23 2011-06-09 Wilson Roa Microrna expression profiles associated with lung cancer
US20130064810A1 (en) * 2010-02-26 2013-03-14 Hans-Guido Wendel Methods and Compositions for the Detection and Treatment of Cancer involving miRNAs and miRNA Inhibitors and Targets

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
TAZI ET AL.: "Elevated Mirc1/Mir17-92 Cluster Expression Negatively Regulates Autophagy And CFTR (Cystic Fibrosis Transmembrane Conductance Regulator) Function In CF Macrophages", AUTOPHAGY, vol. 12, no. 11, 19 August 2016 (2016-08-19), pages 2026 - 2037, XP055575320 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110468084A (en) * 2019-09-20 2019-11-19 华南农业大学 A strain of Burkholderia cepacia and its application in the control of litchi frost blight and litchi anthracnose
WO2023092151A1 (en) * 2021-11-22 2023-05-25 Ohio State Innovation Foundation Compositions and methods for the treatment of neurodegenerative disorders
CN116334138A (en) * 2023-04-23 2023-06-27 中国医学科学院北京协和医院 A kind of cystic fibrosis mouse model and its construction method and application

Similar Documents

Publication Publication Date Title
Tazi et al. Elevated Mirc1/Mir17-92 cluster expression negatively regulates autophagy and CFTR (cystic fibrosis transmembrane conductance regulator) function in CF macrophages
Elmasry et al. Epigenetic modifications in hyperhomocysteinemia: potential role in diabetic retinopathy and age-related macular degeneration
US20190113518A1 (en) Predictive markers for polyamine inhibitor cancer therapies
KR20150131312A (en) Combination cancer treatments utilizing micrornas and egfr-tki inhibitors
US20210038732A1 (en) Anticancer microrna and lipid formulations thereof
US20240408091A1 (en) Compositions and methods for treating vascular ehlers danlos syndrome and associated disorders
US11660306B2 (en) Treatment of Rett syndrome
WO2019036720A1 (en) Targeting micrornas to improve autophagy activity in cystic fibrosis and associated disorders
US20160108406A1 (en) Method of regulating cftr expression and processing
WO2017070198A1 (en) Polymerase q as a target in hr-deficient cancers
TW201420105A (en) Mucosal healing promoter
US20130079384A1 (en) Means and Methods for Determining Risk of Cardiovascular Disease
US9790492B2 (en) Agent for treating cancer
US20160090636A1 (en) MicroRNA-129 AS A BIOMARKER FOR COLORECTAL CANCER
EP2622075B1 (en) Use of mirnas for the diagnosis, prophylaxis, treatment and follow-up of diseases involving macroautophagy abnormalities
WO2013103836A2 (en) Methods of treating cancer
US20220267769A1 (en) Medical uses, methods and uses
WO2020014650A1 (en) Methods of using pharmacologic inhibitors of type 2 cytokine signaling to treat or prevent pancreatic cancer
AU2022384267A1 (en) Lncrna transcripts in melanomagenesis
Lin et al. MiR-155 protects against sepsis-induced cardiomyocyte apoptosis via activation of NO/cGMP signaling pathway by eNOS.
Zhou et al. MiR-513a-3p promotes radiation-induced apoptosis of human lung cells by inhibiting glutathione S-transferase P1
EP3236966B1 (en) Combination of raf inhibitors and taxanes
US11116754B2 (en) Inhibition of TOR complex 2 increases immunity against bacterial infection
US20200222444A1 (en) Methods of inhibiting cell proliferation and mettl8 activity
US9670489B2 (en) Method for treating and/or preventing myopia

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18846779

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18846779

Country of ref document: EP

Kind code of ref document: A1