WO2019033079A1 - CONDITIONAL-siRNAS AND USES THEREOF IN TREATING CARDIAC HYERTROPHY - Google Patents
CONDITIONAL-siRNAS AND USES THEREOF IN TREATING CARDIAC HYERTROPHY Download PDFInfo
- Publication number
- WO2019033079A1 WO2019033079A1 PCT/US2018/046379 US2018046379W WO2019033079A1 WO 2019033079 A1 WO2019033079 A1 WO 2019033079A1 US 2018046379 W US2018046379 W US 2018046379W WO 2019033079 A1 WO2019033079 A1 WO 2019033079A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sensor
- sequence
- rna
- strand
- seq
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/323—Chemical structure of the sugar modified ring structure
- C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/351—Conjugate
- C12N2310/3515—Lipophilic moiety, e.g. cholesterol
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/351—Conjugate
- C12N2310/3519—Fusion with another nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/50—Methods for regulating/modulating their activity
- C12N2320/51—Methods for regulating/modulating their activity modulating the chemical stability, e.g. nuclease-resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/50—Methods for regulating/modulating their activity
- C12N2320/53—Methods for regulating/modulating their activity reducing unwanted side-effects
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Definitions
- RNA interference is a sequence-specific mRNA degradation pathway mediated by siRNA duplexes, key for cellular immunity and developmental regulation.
- RNAi RNA interference
- researchers have utilized synthetic RNAi triggers for therapeutics by inhibiting a specific gene product found to be essential in disease driving pathways but non-essential for normal functioning.
- conditionally active siRNA complexes described below are candidates for investigation of treatments for those indications, such as cardiac hypertrophy.
- Heart Failure is a chronic cardiac condition, affecting millions of people worldwide, and considered a major contributor to healthcare expenditure in the US.
- Compensatory cardiac hypertrophy is one of the initial hallmarks of pathological ventricular remodeling, which is characterized by an upregulation of a variety of genes and miRNA that mediate and regulate myocardial hypertrophy, and ultimately HF.
- HF Heart Failure
- Figure 1 shows a comparison of secondary and tertiary structure (from full atomistic MD simulations) of a Cond-siRNA construct according to one embodiment.
- Black arrows show corresponding features between the 2D and 3D representations.
- Figure 2 is a diagram showing the RNAi pathway.
- FIG. 3 shows toehold mediated strand displacement process of conditional siRNA.
- step I c-siRNA meets RNA transcript with correct activation sequence (Input).
- step II an Input RNA binds to the toehold.
- step III shows toehold mediated strand displacement.
- step IV shows the sensor strand and input forming a waste duplex that separates from the pro-siRNA.
- step V XRN1 , exosome and other cytosolic RNAses rapidly degrade unprotected overhangs, turning pro-siRNA into efficient Dicer substrate.
- step VI siRNA is processed by Dicer for incorporation into RISC.
- the basic biophysical process of toehold mediated strand displacement includes a fast 1 D random walk: uS to mS for each of ⁇ ⁇ 2 steps. This results in sequence specificity from both toehold and duplexes. Thermodynamically stable chemical modifications are confined to sensor strand to avoid kinetic traps.
- Figure 4 A) General construct design of cond-siRNA with green sensor strand designed reverse comp. to signal gene mRNA, red core strand with nick either 1 1 or12 bp from toehold end on sensor side designed comp. to sensor and guide, and yellow guide strand designed reverse comp. to target gene mRNA. B) Model of cond-siRNA. C) Molecular simulation of cond-siRNA
- Figure 5 shows an overview of the design process for Cond-siRNAs according to one embodiment.
- Figure 6 shows a hypothetical sensor duplex for mRNA used to check for thermodynamic stability of the sensor according to one embodiment.
- Figure 7 shows a structure calculation showing sensor strand with low internal secondary structure according to one embodiment.
- Figure 8 shows a histogram showing a 97% predicted formation of the hypothetical sensor duplex and correct secondary structure according to one embodiment.
- Figure 9 shows a hypothetical sensor duplex for miRNA used to check for thermodynamic stability of the sensor according to one embodiment.
- Figure 10 shows a structure of the RNAi targeting duplex according to one embodiment.
- Figure 1 1 is a schematic diagram of a signaling pathway involved in cardiac gene program regulating hypertrophy.
- Figure 12 is a schematic depicting in vivo and in vitro screening approaches.
- Figure 13 A) NuPack generated secondary structure of selected NPPB 31 bpsensor strand. Minimal secondary structure with approximately 40-50% probability of folding onto itself. B) NPPB sensor strand bound to 5' and 3' core overhangs 99% of the time.
- Figure 14 A) NuPack generated secondary structure of selected MYH7 31 bpsensor strand. Minimal secondary structure with approximately 30% probability folding onto itself. B) NPPB sensor strand bound to 5' and 3' core overhangs 97% of the time.
- Figure 15 A) NuPack generated secondary structure of HDAC2 25 bp guide strand. Significant secondary structure indicated by the equilibrium probabilities of binding. B) NuPack generated secondary structure of HDAC2 guide bound to core strand with the 5' and 3' overhangs that bind to the appropriate sensor strand. Although guide strand has significant and strong secondary structure, when placed with core strand, guide binds to core 100%.
- Figure 16 shows test constructs detecting murine ANP mRNA and targeting murine Calcineurin according to certain embodiments.
- Figure 17 shows test constructs detecting murine and human mir-23a- 3p and targeting murine Calcineurin according to certain embodiments.
- Figure 18 is a schematic depicting a site of injury that can be targeted for treatment according to methods of the present invention.
- Figure 19 is a series of bar graphs depicting experimental results of differential gene expression in tissues of wild-type mice in homeostasis.
- Figure 20 Gene expression in NRVM under hypoxia.
- Figure 21 Differential miRNA expression in NRVM under hypoxia.
- Figure 22 Gene expression in NRVM after PE treatment.
- Figure 23 Differential miRNA expression in NRVM after treatment with PE.
- Figure 24 Gene expression in mice with non-ischemic (TAC) and ischemic (l/R) HF.
- Figure 25 miRNA expression in mice with non-ischemic (TAC) and ischemic (l/R) HF.
- Figure 26 shows an equilibrium probability for an MFE structure
- Figure 27 shows an equilibrium probability for an MFE structure
- Figure 28 shows an equilibrium probability for an MFE structure
- Figure 29 shows an equilibrium probability for an MFE structure
- Figure 30 shows (ANP : calcineurin) and (mir-23a-3p : calcineurin) Cond-siRNAs on 10% non-denaturing PAGE gel in TBE. The correct assemblies are indicated in the green boxes.
- Figure 31 shows results of a dual luciferase assay of mir-23a-3p : calcineurin Cond-siRNA according to certain embodiments.
- Figure 32 is a bar graph showing RNAi activity against Calcineurin in NRVM cells under PE stimulation according to one embodiment.
- Figure 33 shows images of NRVM cells with and without PE stimulation when treated with scrambled siRNA (negative control), (ANP : calcineurin) Cond- siRNA, and commercial calcineurin siRNA (positive control) according to one embodiment.
- Figure 34 shows results of cell size quantitation according to one embodiment.
- Figure 35A shows Post-MI cardiac remodeling and left ventricular enlargement.
- Figure 35B is a bar graph showing experimental results where patients with any of the patterns of LV remodeling post-MI had a greater risk of the composite of cardiovascular (CV) death, Ml, heart failure (HF), stroke, or resuscitated cardiac arrest.
- CV cardiovascular
- Ml cardiovascular
- HF heart failure
- stroke or resuscitated cardiac arrest.
- Figure 36 is a flowchart accompanied by a corresponding schematic showing the RNA interference pathway starting with pri-miRNA processing in the nucleus.
- Figure 37 is a schematic showing post-MI remodeling
- Figure 38 is a series of bar graphs depicting experimental results of differential miRNA expression in tissues of wild-type mice in homeostasis
- Figure 39 is a table including candidate sensor strands for the 3' UTR of the human myh7 gene. Column abbreviations are as follows: BS is Bad Segments; 3LN is 3-Letteredness; NBP is Number Bad Points; P is Position.
- Figure 40 is a table including candidate sensor strands for the 3' UTR of the rat myh7 gene. Column abbreviations are as follows: BS is Bad Segments; 3LN is 3-Letteredness; NBP is Number Bad Points; P is Position.
- Figure 41 is a table including candidate sensor strands for the 3' UTR of the human nppa gene. Column abbreviations are as follows: BS is Bad Segments; 3LN is 3-Letteredness; NBP is Number Bad Points; P is Position.
- Figure 42 is a table including candidate sensor strands for the 3' UTR of the rat nppa gene. Column abbreviations are as follows: BS is Bad Segments; 3LN is 3-Letteredness; NBP is Number Bad Points; P is Position.
- Figure 43 is a table including candidate sensor strands for the 3' UTR of the human nppb gene. Column abbreviations are as follows: BS is Bad Segments; 3LN is 3-Letteredness; NBP is Number Bad Points; P is Position.
- Figure 44 is a table including candidate sensor strands for the 3' UTR of the rat nppb gene. Column abbreviations are as follows: BS is Bad Segments; 3LN is 3-Letteredness; NBP is Number Bad Points; P is Position.
- Figure 45 shows a top view of a 3D schematic of a Cond-siRNA construct according to one embodiment.
- conditional siRNA complexes also referred to herein as Cond-siRNA, a conditional RNA-sensor, or an RNA-sensor
- a therapeutic component e.g., siRNA molecule
- the conditional siRNA complexes are inactive under normal conditions, but are activated upon interaction between the molecular sensor and a biomarker.
- Such molecules are synthetic riboswitch molecules that allow an input gene or RNA molecule to "switch on" an RNAi pathway against a target output gene.
- RNA-sensor molecule or complex includes sensor strand, a guide strand, and a core strand that bind to each other to form a multi-strand molecular complex having a dual duplex structure shown in Figs. 1 , 45.
- those three strands (core, sensor and guide) form two parallel oligonucleotide duplexes connected in a double crossover configuration.
- the length of each of the oligonucleotide duplexes is sufficient to operate within the RNA interference (RNAi) pathway (See Figs. 2, 36).
- the duplexes may be between about 15 and 30 base pairs in length.
- the duplexes are between 15 and 20 base pairs in length, between 20 and 25 base pairs in length, between 25 and 30 base pairs in length. In other embodiments, the duplexes are about 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 25, 26, 27, 28, 29, 30, or more than 30 base pairs in length.
- the double crossover configuration as shown in Fig. 1 represents the inactive or "OFF" state of the RNA-sensor complex wherein the sensor duplex inhibits RNAi loading of the siRNA duplex, serving as a "lock” on RNAi activity.
- the guide strand binds a first portion (or “passenger” segment) of the core strand to form an siRNA duplex that serves as a pro-RNA molecule.
- the pro- RNA molecule operates in the RNAi pathway of a target cell to alter expression of a target gene or target RNA molecule associated with a pathological condition (i.e., the "therapeutic target molecule").
- the second duplex is formed by the sensor strand binding to a second portion (or "protection” segment) of the core strand to form the sensor duplex.
- the core strand has a third portion (or "protection” segment) that binds the sensor strand.
- the core strand includes the passenger strand (P) that is joined to first and second protection segments (A, B) at each end by a linker (L1 , L2) in the following configuration:
- the sequence of the core strand is determined by the sequences of the sensor and guide strands, and may be fully or complementary to the sensor strand, the guide strand, or both.
- Any suitable linker can be used in accordance with the embodiments described herein, including, but not limited to, an internal C3 spacer, a C6 linker, a tri-ethylene glycol linker.
- the RNA-sensor complex is activated to the "ON" state upon interaction with a biomarker in the cell expressing a phenotype associated with the pathological condition targeted by the guide strand of the siRNA duplex. This activation is primarily due to the design of the sensor strand, which serves as the activation signal for RNAi activity. When this is the case, the RNA-sensor complex is said to detect the biomarker.
- the sensor strand includes a nucleotide sequence designed to bind the biomarker associated with the pathological condition (i.e., "pathological biomarker"). Binding to the biomarker is initiated by the binding of at least one toehold segment (single stranded) to an input RNA strand that encodes at least a portion of the pathological biomarker, as shown in Fig. 3. Upon displacement of the sensor strand, the sensor and input strands from a waste duplex that separates from the pro-siRNA molecule, allowing the pro-siRNA to be processed by the target cell's RNAi system.
- the structure and binding dynamics of the conditional-siRNAs described herein is explained further in U.S. Patent No. 9,725,715, the content of which is incorporated herein by reference in its entirety.
- the sequence of the sensor strand can be fully or partially complementary to an RNA sequence present in the pathological biomarker.
- the sensor strand is 100% complementary to the RNA sequence present in the pathological biomarker.
- Other embodiments may include a sensor strand that is largely complementary to the RNA sequence present in the pathological biomarker, for example, the sensor strand may be greater than 70% complementary, greater than 75% complementary, greater than 80% complementary, greater than 85% complementary, greater than 90% complementary, greater than 95% complementary, greater than 96% complementary, greater than 97% complementary, greater than 98% complementary, or greater than 99% complementary to the RNA sequence present in the pathological biomarker.
- the pathological biomarker is an RNA sequence that forms or encodes a molecule that is associated with the pathologic condition.
- the pathological biomarker is an RNA sequence that is present in the target cell under pathological conditions, but is substantially absent under normal conditions.
- the pathological biomarker is an RNA sequence that is upregulated in the target cell under pathological conditions as compared to normal conditions.
- the guide strand includes a Dicer cleavage site near the 3' end.
- the sequence between the Dicer cleavage site and the 3' terminus of the guide strand is either fully or partially complementary to a nucleotide sequence found in the therapeutic target molecule (e.g., target gene, target mRNA or target miRNA).
- the Cond-siRNA is said to target the gene or RNA molecule.
- the guide strand is 100% complementary to the nucleotide sequence found in the therapeutic target molecule.
- inventions may include a guide strand that is largely complementary to the nucleotide sequence found in the therapeutic target molecule, for example, the guide strand may be greater than 70% complementary, greater than 75% complementary, greater than 80% complementary, greater than 85% complementary, greater than 90% complementary, greater than 95% complementary, greater than 96% complementary, greater than 97% complementary, greater than 98% complementary, or greater than 99% complementary to the nucleotide sequence found in the therapeutic target molecule.
- LNAs Locked Nucleic Acids
- RNA nucleotides with an extra bridge between the 2' O and 4' C increases thermal stability of RNA duplexes and allows for resistance to nucleases.
- 2' O-Methyl modifications confer stability, increase binding affinity to RNA nucleotides and prevent degradation by nucleases.
- phosphorothioate modification by replacing one of the non-bridging oxygens in the phosphate linkage between bases with a sulfur that reduces nucleolytic degradation; however also lowers binding affinity.
- the RNA-sensor complex includes one or more modifications to the nucleotide sequence of the sensor strand, the core strand, and/or the guide strand.
- exemplary modifications include, but are not limited to, locked nucleic acids (LNA), peptide nucleic acids (PNA), 2'-0- methyl modifications, morpholino modifications, phosphorothioate modifications, terminal modifications, and other linker or backbone modifications or connections. Additional chemical modifications may be chosen according to methods described in US9725715B2, the disclosure of which is hereby fully incorporated herein.
- the approach of designing a cond-siRNA sensor complex for use in treating a disease or other pathological condition using the cond-siRNA sensor complexes is advantageous in that it allows the complex to become biologically active only in diseased cells AND remain OFF in healthy cells.
- the approach allows for increased disease cell specificity and prevents toxicity from delivery to unintended off-targets.
- the approach combines disease specificity from one gene with treatment efficacy from a second gene to create therapeutics that are precisely tailored to specific gene expression patterns.
- the approach is advantageous due to steric hindrance of the two RNA duplexes positioned in a parallel configuration (Fig. 4). The sensor strand inhibits RNAi loading of siRNA and will only displace when activated in disease cells.
- siRNA complex is designed based on biomarkers and therapeutic target molecules that are specific to each cell type, pathological condition, and/or indication. According to certain embodiments, methods for designing and testing each conditional siRNA complex includes several steps, as described below.
- Figure 5 shows an overview of the design process.
- methods for designing a conditional siRNA complex includes a step of determining a biomarker that will serve as an input for activation and a therapeutic target for RNAi inhibition. This step may include a determining one or more factors that are differentially expressed (i.e., upregulated or present in a diseased cell as compared to a normal cell) using methods known in the art.
- the design method further includes a step of generating a list of candidate target segments of the biomarker (i.e., target mRNA sequence or target miRNA sequence) that can serve as a biomarker segment for binding the sensor strand, and then designing sensor strands for each biomarker.
- the biomarker i.e., target mRNA sequence or target miRNA sequence
- the design method further includes a step of estimating the thermodynamic stability of the resulting sensor strand— biomarker duplexes (the sensor duplex) generated by the target segments and sensor strands by using secondary structure prediction tools used in the art [15].
- the design method further includes a step of checking for the uniqueness of the binding site for the most stable sensor duplexes against the known transcriptome of the animal to which the conditional siRNA complex will be tested against.
- the design method further includes a step of generating a list of guide strand sequences by using a protocol that may include, but is not limited to, standard siRNA design tools, literature references, or heuristic rules.
- the design method further includes a step of creating a Dicer substrate from the chosen guide strand sequences.
- the design method further includes a step of generating sequences for the core strand that connect the sensor strands to the guide strands.
- the design method further includes a step of checking that the sensor : guide pairing does not create unwanted interactions.
- the design method further includes a step of selecting a pattern of suitable chemical modifications as described herein, and optionally simulating the constructs using molecular simulation methods used in the art [16] to simulate the constructs (optional).
- the design method may also include a method of synthesizing or purchasing the sensor, core, and guide strands from commercial vendors such as Qiagen, Dharmacon, or IDT, the constructs of which are then assembled, characterized, and purified using gel electrophoresis.
- the design method further includes a step of conducting preliminary biological testing and validation of the construct function, and then optionally test in in vitro and in vivo models of pathological conditions, including, but not limited to, Ml induced maladaptive hypertrophy as described below.
- methods for designing and testing sensor strands that target an mRNA biomarker includes an algorithm that includes several steps, as described below.
- a method for designing a sensor strand for an mRNA biomarker includes a step of identifying the 3' UTR for each messenger RNA biomarker.
- the mRNA sensor design method further includes a step of generating all possible consecutive 31 base sequences for each 3' UTR identified above.
- the mRNA sensor design method further includes a step of obtaining the prospective sensor strand sequence for each sequence segment from the previous step by identifying the reverse complement (full or partial) of each sequence
- the mRNA sensor design method further includes a step of checking each sensor strand sequence for the following undesirable features: (i) three or more consecutive Gs, and (ii) four or more consecutive A or U bases.
- the mRNA sensor design method further includes a step of checking each sensor strand sequence for the following desirable features: (i) higher than 50% G/C bases - this correlates with thermodynamic stability, (ii) "three letteredness," (iii) The first base at the 5' end of the sensor strand is a C or a G; and (iv) the 9th base from the 3' end of the sensor strand is a C or a G.
- "three letteredness” is defined as the proportion of the sequence comprising of the three most numerous bases (e.g., the extent to which sequence is mostly made of A, U, C; or C, G, A; or A, U, G).
- a higher three letteredness score correlates with lower internal secondary structure. Exemplar ranking tables can be seen in Figs. 39-44, which correspond to the genes or nucleotide sequences in Appendices C-H, submitted herewith.
- the mRNA sensor design method further includes a step of ranking all possible sensor strands. Strands with the least number of features from 4 and the highest scores from 5 are ranked highest
- the mRNA sensor design method further includes a step of generating hypothetical sensor duplexes using the pattern shown in Figure 6, starting from the highest ranked strands.
- the RNA sensor design method further includes a step of using Nupack or similar secondary structure prediction codes to calculate the following, starting from the highest ranked strands: (i) the internal secondary structure of the sensor strand (lower amounts of internal secondary structure are desirable (Figure 7), (ii) the thermodynamic stability of the hypothetical duplex from 7. Ideally, at 1 nM strand concentration, Nupack should predict that > 90% or > 95% of component strands should form the hypothetical sensor duplex ( Figure 8); and (iii) if sensor duplex is not stable, can adjust 1 to 5 bases at the 5' terminus of the sensor sequence to increase stability at the cost of reducing complementarity to the corresponding binding site on the putative biomarker.
- the RNA sensor design method further includes a step of screening the sensor strand for thermodynamically stable duplexes using NCBI BLAST according to the following parameters: (i) use the "somewhat similar" search option, (ii) for sensor sequences, the 8 bases at the 3' terminus (constituting the 3' toehold) should have no more than 5 bases complementary to known transcripts in the target animal (eg, human or mouse) other than the intended biomarker, and (iii) if the first two criteria not met, broaden sequences considered in 1 to the coding region or the entirety of the mRNA.
- methods for designing and testing sensor strands that target an miRNA biomarker includes an algorithm that includes several steps, as described below.
- a method for designing a sensor strand for an miRNA biomarker includes a step of identifying a guide sequence for each miRNA biomarker, to which the sensor strand is designed to bind (typically approximately 21 bases according to one aspect)
- the miRNA sensor design method further includes a step of obtaining the reverse complement (full or partial) of the miRNA guide sequence.
- the miRNA sensor design method further includes a step of adding 8 more bases to the 5' end of the sequence from the prior step.
- the miRNA sensor design method further includes a step of generating hypothetical sensor duplexes using the pattern shown in Figure 9, starting from the sequence developed in the prior step.
- the miRNA sensor design method further includes a step of using Nupack or similar secondary structure prediction codes to calculate the following: (i) the thermodynamic stability of the hypothetical duplex from the prior step. Ideally, at 1 nM strand concentration, Nupack should predict that > 90% or > 95% of component strands should form the hypothetical sensor duplex, (ii) if sensor duplex is not stable or the secondary structure is incorrect, determine whether the 8 terminal bases at the 5' end of the sensor strand, or the length of strand A or strand B can be altered or modified to optimize thermodynamic stability.
- the miRNA sensor design method further includes a step of screening the sensor strand for thermodynamically stable duplexes in NCBI BLAST according to the following parameters: (i) use the "somewhat similar" search option, (ii) for sensor sequences, the 8 bases added at the 5' end of the sensor should not increase complementarity to transcripts other than the intended miRNA. If they do, adjust the sequence and start over from 4.
- methods for designing a guide strand sequence against a therapeutic target gene or RNA molecule includes several steps, as described below.
- a method for designing a guide strand sequence against a therapeutic target includes a step of obtaining one or more prospective guide strand sequences using at least one of the following methods: (i) find a published guide strand sequence for the intended target; (ii) find a known miRNA target site on the target gene, or (iii) use a published algorithm or design tool known in the art [17, 18].
- the guide strand design method further includes a step of checking the guide sequence to make sure that the 6 bases at the 5' domain ( Figure 10) is more AU rich than the 6 bases in the 3' domain ( Figure 10). This will improve probability for correct strand loading [19].
- the 3' domain should be CG rich, and terminate in a CG base-pair.
- the guide strand design method further includes a step of adding four terminal bases to the 5' end of the guide strand to complete the duplex. Those should be CG rich to improve thermodynamic stability.
- the guide strand design method further includes a step of constructing the hypothetical RNAi targeting duplex as shown in Figure 10.
- the guide strand design method further includes a step of checking that the guide strand has weak internal secondary structure and minimal tendency to bind to itself (no more than 10% at 1 nM strand concentration) using Nupack or similar standard secondary structure calculation tool. Adjust bases added in 3 as necessary.
- methods for designing a core strand sequence and checking compatibility of pairing sensor to guide includes several steps, as described below.
- a method for designing a guide strand sequence against a therapeutic target includes a step of choosing a suitable combination of sensor and guide strands, methods for designing those strands are discussed above and in the working examples, according to the embodiments described herein.
- the core strand design method further includes a step of constructing the core strand by constructing a strand of the form 5' - B - C3 - P - C3 A - 3' where A and B are the sequence of complementary strand B from the hypothetical sensor duplex ( Figures 6 or 9), P is the sequence of the passenger strand from the hypothetical RNAi duplex ( Figure 10) and C3 are C3 linkers.
- the core strand design method further includes a step of using Nupack or similar standard secondary structure calculation tool to check that the guide strand and core strand base-pairing has the following properties: (i) > 95% of strands are base-paired in the correct duplex at 1 nM strand concentration, (ii) the guide strand duplex has the correct conformation, with a -23 base-pair duplex, a two base 3' guide strand overhang, and 10-12 base 5' and 3' core overhangs with minimal secondary structures, and (iii) If above criteria not met, choose new sensor or guide pairing.
- a myocardial infarction is a heart attack. Mis can occur when a blood clot blocks a coronary artery, interrupting blood flow to the heart-a condition known as cardiac ischemia.
- Heart muscles downstream of the blockage lose oxygen, leading to injury and death of the muscle cells.
- Post-MI the hypoxia and tissue damage induces left ventricular remodeling (Figs. 35A, 37).
- Cardiac reperfusion results in inflammation and oxidative damage.
- the injuries to cardiomyocytes during Ml can cause a cascade of biological signaling events that leads cardiomyocytes to increase in volume and undergo proliferation in a specific way that compromises the functioning of the heart.
- This hypertrophic response is driven by a complex interplay of factors including a maladaptive regeneration gene program. During maladaptive regeneration, the heart undergoes changes that induce detrimental conditions to the patient (Fig. 35B).
- the affected ventricle increases its volume, but the walls of the ventricle become thinner, and the ability of the heart to pump blood decreases over time. This can lead to a variety of serious problems, including heart failure, a second heart attack, or sudden death. Thus, this process is called maladaptive hypertrophy (as opposed to adaptive hypertrophy, which strengthens the heart in reaction to stimuli such as exercise).
- Maladaptive cardiac hypertrophy can be ameliorated by drugs that inhibit calcineurin and histone deacetylase 2 (HDAC2), for example.
- HDAC2 histone deacetylase 2
- these drugs can cause serious side effects in non-cardiac tissues. Therefore, it's necessary to have a method to restrict drug activity to the heart.
- RNA interference pathway RNA interference pathway
- RNAi silencing of the target genes are restricted to cardiomyocytes that express Ml associated RNA biomarkers. This means that RNAi activity will NOT occur in other organs and tissues where inhibition of the targets can cause serious side effects.
- a strand-displacement operated, programmable conditional-siRNA complex that can be activated by specific mRNA and miRNA transcripts expressed in the hypertrophied myocardium, to target unrelated pro-hypertrophic pathways by RNAi knockdown.
- Certain genes are upregulated under pathological cardiac hypertrophic conditions, which may be candidate pathological biomarkers to guide a Cond-siRNA molecule to a population of target cells, and which can be used to displace the sensor strand of the Cond-siRNA.
- pathological cardiac hypertrophic conditions may be candidate pathological biomarkers to guide a Cond-siRNA molecule to a population of target cells, and which can be used to displace the sensor strand of the Cond-siRNA.
- certain signaling cascades are activated under hypertrophic stimulating conditions (see Fig. 1 1 ).
- genes and miRNAs that are upregulated in pathological cardiac hypertrophy were screened for differential gene expression in wild type (wt) mice as well as under various hypertrophic conditions to determine which genes are suitable candidates for use as a target for designing a sensor strand. See working examples below
- In vitro screening approaches may include the use of a cardiomyocyte cell line (e.g., neonatal rat ventricular myocytes (NRVM), human cardiac myocytes (HCM)) cultured under hypoxic conditions or treated with phenylephrine.
- a cardiomyocyte cell line e.g., neonatal rat ventricular myocytes (NRVM), human cardiac myocytes (HCM)
- NRVM neonatal rat ventricular myocytes
- HCM human cardiac myocytes
- Fig. 12A In vivo approaches may also be used including, but not limited to, rat models for ischemic heart failure (HF) (e.g., ischemia/reperfusion model), or rat models for nonischemic HF (e.g. , thoracic aortic constriction (TAC) model). See Fig. 12B.
- HF ischemic heart failure
- TAC thoracic aortic constriction
- RNA pathological biomarkers input signals
- the purpose of using pathological RNA biomarkers specific to the condition of cardiac hypertrophy for conditional RNAi activation is to ensure that RNAi activity is only active in cardiac tissues. Ideally, these biomarkers should be highly overexpressed in cardiac tissues affected by Ml and not expressed in other tissues of the body.
- ADP atrial naturetic peptide
- BNP B-type natriuretic peptide
- ⁇ myosin heavy chain ⁇
- therapeutic biomarkers that may be used to activate the conditional siRNA complexes in accordance with the embodiments described herein include, but are not limited to, mRNA biomarkers for Ml affected cardiomyocytes, such as those described below.
- a Cond-siRNA for treating cardiac hypertrophy includes a sensor strand designed to target a biomarker that is present and/or upregulated in heart cells (e.g., cardiac myocytes).
- biomarkers may include, but are not limited to, atrial naturetic peptide (ANP), B-type natriuretic peptide (BNP), myosin heavy chain ⁇ ( ⁇ ), mir-23a-3p, mir-125-5p, and mir-199b-5p.
- the sensor strand detects an mRNA or an miRNA sequence that encodes the biomarker.
- the sensor strand detects an mRNA sequence that encodes the biomarker by binding to the 3' UTR of the mRNA. Additional information regarding exemplary biomarkers is discussed below.
- ANP signal sensor strands
- nppa Netruiretic Peptide A encodes for ANP protein that is overexpressed in hypertrophic conditions, thus is suitable as a biomarker for hypertrophy.
- BNP signal sensor strands
- nppb Netruiretic Peptide B
- BNP protein that functions as a cardiac hormone and regulates natruiresis, diuresis, vasorelaxation and cardiovascular homeostasis.
- High concentrations of BNP in bloodstream indicates heart failure, and is a biomarker for hypertrophy.
- significant upregulation of BNP in induced cardiac hypertrophic conditions is indicative of effective sensor strand gene selection.
- a NPPB RH SSS v2.0 sensor was designed, wherein 31 bp sequence windows checked by hand through screening in entire 3' UTR of homo sapiens mRNA based on A-U richness, hairpins, poly G tracts, and 8 bp toehold region. Three areas were found; NCBI Blast check for matches with other mRNAs and % yield of binding narrowed down options to chosen sensor (see NPPB sensor structures, Fig. 13).
- ⁇ (myh7) signal sensor strands.
- MYH7 myosin heavy chain 7 encodes for the ⁇ -heavy chain subunit of cardiac myosin. Varying amounts of the encoded protein correlate with cardiac muscle fiber contractile velocity. myh7 is predominantly expressed in the ventricle and type I muscle fibers. Gene mutations are associated with hypertrophic cardiomyopathy, and mybh7 is upregulated in pathological cardiac hypertrophy. A significant upregulation of myh7 is seen in induced cardiac hypertrophic conditions, indicating that myh7 is another potential sensor strand gene selection.
- a myh7 RH SSS v2.0 sensor was designed, wherein 31 bp sequence windows checked by hand through screening of entire homo sapiens mRNA. Because 3' UTR of mRNA is short with numerous poly G tracts, screening went into the coding region; however those contained secondary structure. Only 1 area found and chosen; checked NCBI Blast for matches with other mRNAs (see, e.g., myh7 sensor structures, Fig. 14).
- the sensor strand is fully complementary to any of the biomarkers discussed above (i.e., 100% complementary). In some embodiments the sensor strand is partially complementary to any of the biomarkers discussed above.
- the sensor strand may be at least 70% complementary to the biomarker, at least 70% complementary to the biomarker, at least 75% complementary to the biomarker, at least 80% complementary to the biomarker, at least 85% complementary to the biomarker, at least 90% complementary to the biomarker, at least 95% complementary to the biomarker, at least 96% complementary to the biomarker, at least 97% complementary to the biomarker, at least 98% complementary to the biomarker, or at least 99% complementary to the biomarker.
- the complementarity of the sensor strand to the biomarker may be matched to any 19-40 base segment of any variant of the mRNA sequence that encodes ANP (nppa), BNP (nppb), or ⁇ (myh7).
- the sensor strand includes one of the sequences in Table 1 below:
- a Cond-siRNA for treating cardiac hypertrophy includes a guide strand designed to target a therapeutic RNAi target that is present and/or upregulated in heart cells (e.g., cardiac myocytes) and known to the field to ameliorate post-MI maladaptive hypertrophy, but whose systemic inhibition or expression may lead to unwanted side effects.
- a therapeutic RNAi target that is present and/or upregulated in heart cells (e.g., cardiac myocytes) and known to the field to ameliorate post-MI maladaptive hypertrophy, but whose systemic inhibition or expression may lead to unwanted side effects.
- therapeutic targets that may be used to design guide strands of Cond-siRNAs include, but are not limited to, Calcineurin [7-10] (or a subunit thereof, e.g., PPP3Ca, PPP3CB, PPP3CC, PPP3R1 , PPP3R2), and HDAC2 [1 1 , 12] or HDAC2 [1 1 , 12].
- the guide strand binds to an mRNA or an miRNA sequence that encodes the therapeutic target.
- HDAC2 guide strands.
- HDAC2 Histone deacetylase 2
- HDAC2 inhibition represses the maladaptive regeneration program through a pathway involving GSK3 , inhibiting the hypertrophic response.
- HDAC2 serves as a key cardiac hypertrophic regulator and a potential therapeutic target.
- an HDAC2 RH TGS v2.1 guide strand was designed, wherein a 23 base-pair sequence was taken from the HDAC2 homo sapiens mRNA based on past research utilizing HDAC2-targeted siRNAs. Two U base pairs added to the 3' end. Four base pairs at 5' end purposefully changed to mismatch the mRNA in order to prevent potential improper Dicer cleavage and RISC complex loading incorporation. An NCBI Blast check was also done to check for matches with other mRNAs. See HDAC2 guide strand structures, Fig. 15
- Calcineurin guide strands Calcineurin guide strands. Calcineurin is a major propoter of cardiac hypertrophy, and inhibition of Calcineurin has been found to reduce hypertrophy. And, since it's always present in ischemic cells, calcineurin is a good therapeutic target for the present invention.
- the RNAi targeting segment of the guide strand (i.e., bases 1 -21 from the 3' terminus) is fully complementary to any of the therapeutic targets discussed above (i.e. , 100% complementary). In some aspects, the RNAi targeting segment of the guide strand (i.e., bases 1 -21 from the 3' terminus) is partially complementary to any of the therapeutic targets discussed above.
- the sensor strand may be at least 70% complementary to the biomarker, at least 70% complementary to the biomarker, at least 75% complementary to the biomarker, at least 80% complementary to the biomarker, at least 85% complementary to the biomarker, at least 90% complementary to the biomarker, at least 95% complementary to the biomarker, at least 96% complementary to the biomarker, at least 97% complementary to the biomarker, at least 98% complementary to the biomarker, or at least 99% complementary to any of the therapeutic targets discussed above.
- bases 14-20 from the 3' terminus has at least 90% complementarity to the 3' UTR of an mRNA sequence that encodes at least a portion of a subunit of calcineurin (e.g., PPP3Ca, PPP3CB, PPP3CC, PPP3R1 , PPP3R2) or HDAC2.
- a subunit of calcineurin e.g., PPP3Ca, PPP3CB, PPP3CC, PPP3R1 , PPP3R2
- HDAC2 HDAC
- Cond-siRNAs that inhibit maladaptive hypertrophy are Cond-siRNAs that detect any biomarker from list A and target any member of list B in Table 2 below
- the Cond-siRNA described herein may have a sensor strand that is mostly or completely complementary to a sequence of the RNA transcripts corresponding to biomarkers listed in A, and a guide strand that targets a member of list B in the manner described above.
- the sensor strand includes one of the sequences in Table 3 below:
- a Cond-siRNA for treating cardiac hypertrophy includes a core strand designed to connect the sensor to the guide strand according a method described above.
- the core strand includes one of the sequences in Table 4 below:
- the core strands above include C3 spacer linkers, where indicated, but any suitable linker may be used.
- a Cond-siRNA for treating cardiac hypertrophy is a construct that includes a guide strand, core strand, and sensor strand as indicated in Table 5 below (also see Figs. 16-17):
- conditional siRNA complex may comprise any combination of one sensor strand, one guide strand, and one core strand selected from Tables 1 , 3, and 4, respectively. Additional embodiments of the conditional siRNA complex showing the full complex may be found in Appendix A, which is attached hereto.
- the cond-siRNA complexes described above may be used in methods to treat cardiac hypertrophy.
- a method for treating cardiac hypertrophy is disclosed herein, wherein the method includes a step of administering to a subject a therapeutically effective amount of one or more of the cardiac hypertrophy-related cond-siRNAs described above.
- the subject may be any human or other animal suffering from post-MI cardiac hypertrophy, or any other type of cardiac hypertrophy.
- Treating" or “treatment” of a condition may refer to preventing the condition, slowing the onset or rate of development of the condition, reducing the risk of developing the condition, preventing or delaying the development of symptoms associated with the condition, reducing or ending symptoms associated with the condition, generating a complete or partial regression of the condition, or some combination thereof.
- the methods for treating cardiac hypertrophy include administering a therapeutically effective amount of a therapeutic composition.
- An "effective amount,” “therapeutically effective amount” or “effective dose” is an amount of a composition (e.g., a therapeutic composition or agent) that produces a desired therapeutic effect in a subject, such as preventing or treating a target condition or alleviating symptoms associated with the condition.
- the precise therapeutically effective amount is an amount of the composition that will yield the most effective results in terms of efficacy of treatment in a given subject.
- This amount will vary depending upon a variety of factors, including but not limited to the characteristics of the therapeutic compound (including activity, pharmacokinetics, pharmacodynamics, and bioavailability), the physiological condition of the subject (including age, sex, disease type and stage, general physical condition, responsiveness to a given dosage, and type of medication), the nature of the pharmaceutically acceptable carrier or carriers in the formulation, and the route of administration.
- One skilled in the clinical and pharmacological arts will be able to determine a therapeutically effective amount through routine experimentation, namely by monitoring a subject's response to administration of a compound and adjusting the dosage accordingly. For additional guidance, see Remington: The Science and Practice of Pharmacy 21 st Edition, Univ. of Sciences in Philadelphia (USIP), Lippincott Williams & Wilkins, Philadelphia, PA, 2005.
- one or more cond-siRNAs may be used alone or as part of a pharmaceutical composition for treating cardiac hypertrophy.
- a pharmaceutical composition comprising any one or more of the cardiac hypertrophy-related Cond-siRNAs described above is disclosed.
- the therapeutic compositions may also include one or more pharmaceutically acceptable carriers.
- a "pharmaceutically acceptable carrier” refers to a pharmaceutically acceptable material, composition, or vehicle that is involved in carrying or transporting a compound of interest from one tissue, organ, or portion of the body to another tissue, organ, or portion of the body.
- the carrier may be a liquid or solid filler, diluent, excipient, solvent, or encapsulating material, or some combination thereof.
- Each component of the carrier must be “pharmaceutically acceptable” in that it must be compatible with the other ingredients of the formulation. It also must be suitable for contact with any tissue, organ, or portion of the body that it may encounter, meaning that it must not carry a risk of toxicity, irritation, allergic response, immunogenicity, or any other complication that excessively outweighs its therapeutic benefits.
- compositions described herein may be administered by any suitable route of administration.
- a route of administration may refer to any administration pathway known in the art, including but not limited to aerosol, enteral, nasal, ophthalmic, oral, parenteral, rectal, transdermal (e.g., topical cream or ointment, patch), or vaginal.
- transdermal administration may be accomplished using a topical cream or ointment or by means of a transdermal patch.
- Parenter refers to a route of administration that is generally associated with injection, including infraorbital, infusion, intraarterial, intracapsular, intracardiac, intradermal, intramuscular, intraperitoneal, intrapulmonary, intraspinal, intrasternal, intrathecal, intrauterine, intravenous, subarachnoid, subcapsular, subcutaneous, transmucosal, or transtracheal.
- the cardiac hypertrophy-related cond-siRNAs or therapeutic compositions thereof is administered by intracardial injection (Fig. 18) to ensure local delivery to the heart tissue.
- Example 1 Prohypertrophic gene and miRNA expression screening for selection of sensor candidates for treatment of cardiac hypertrophy
- Suitable pathological biomarker candidates (ANP, BNP, MYH7, MEF2C, Myocardin, DDiT4L, and miRNAs) were screened in NRVM for differential expression under hypoxic conditions as shown in Figs. 20-21 .
- NRVM cells were prepared cultured on standard petri dish substrates using techniques known to those who are skilled in the art [1 ,2]. Cultured NRVM cells are then exposed to hypoxic conditions (0.2% O2 atmosphere) for 24 hours at 37C. This was followed by incubation for 12 hours under normal oxygen conditions (95% ambient air/5% C02).
- NRVM cells were harvested and total RNA was extracted using protocols and kits standard in the art [3].
- the messenger RNAs ANP, BNP, Myh7, MEF2C, Myocardin, DDiT4L, and the microRNAs mir-23a-3p, mir-125b- 5p, mir-199b-5p, mir-208 and mir-195 were quantified by quantitative RT-PCR using standard methods appropriate for mRNAs4 and miRNAs [5].
- Results are presented in Figs. 20-21 as fold change in copy numbers of mRNA or miRNA present in NRVM cells exposed to hypoxia compared to those incubated for 36 hours under normal oxygen conditions.
- Phenylephrine stimulation is a standard method for studying hypertrophy in cardiomyocytes [6,7].
- NRVM cells were prepared by standard protocols. Phenylephrine was then added to the culture media to 50 ⁇ concentration for 24 hours. After 24 hours, cells were harvested for RNA isolation and analysis as described above.
- mice underwent procedures to simulate ischemic (deprivation of blood flow) heart failure. At day zero, mice were subject to ischemic heart failure via surgical clamping of a coronary artery for 20 min, followed by reperfusion. After 28 days, the experimental mice were sacrificed. Heart tissue was harvested and RNA was isolated using standard protocols as described above. mRNA and miRNAs were quantified using RT-PCR as described above. The mRNA and miRNA in the treated mice were compared with those found in control mice who were subjected to a sham procedure that did not involve clamping of the coronary artery to induce ischemia / reperfusion.
- mice underwent thoracic aortic constriction (TAC) procedures to induce non-ischemic heart failure. Briefly the upper thorax of mice constricted to reduce blood flow through the aorta for 28 days. This induced non-ischemic heart failure. After 28 days, the animals were sacrificed and heart tissue was harvested. RNA was isolated using standard protocols as described above. mRNA and miRNAs were quantified using RT-PCR as described above. The mRNA and miRNA in the treated mice were compared with those found in control mice who were subjected to a sham procedure that did not involve aortic constriction.
- TAC thoracic aortic constriction
- the 5' UTR and coding sequences of messenger RNAs are frequently occupied by mRNA binding proteins or transiting ribosomes. In mammals, miRNAs commonly bind at 3' UTR sites to regulate mRNAs. Thus, binding sites in the 3' UTR may be more accessible than sites in the 5' UTR and the coding sequence of region of mRNAs.
- sensors When designing sensors to detect mRNAs, it is desirable to start with sites in the 3' UTR. If such sites cannot be found or there are other reasons (such as the need to detect a particular important sequence in the coding region or the 5' UTR), then sensors can be designed to those sites.
- ANP 3'UTR sequencing results were used to test the ability of ANP : Calcineurin Cond-siRNAs to inhibit phenylephrine induced cardiomyocytes hypertrophy. Thus, an ANP sensor was designed to target rat ANP.
- the 3' UTR of ANP mRNA found in neonatal rat ventricular cardiomyocytes cells was sequenced by extracting RNA using standard procedures, amplifying the 3' UTR via RT-PCR, and submitting the amplified DNA for sequencing by the Massachusetts General Hospital's DNA sequencing core.
- sequenced DNA is as follows (N indicates indetermined base)
- the Python code that was generated performed following analyses for each sensor sequence: (i) add one demerit point for each occurrence of three or more consecutive Gs (eg: GGG, GGGG, GGGGG); (ii) add one demerit point for each occurrence of four or more consecutive A/Ts (eg: AT AT, AAAA, TTTT, TTAT, etc), (iii) calculate the percent of the sequence composed of G or Cs; and (iv) calculate the percent of the sequence accounted for by the most numerous three bases (e.g., out of A, G, C, T, if A, G and T are the most numerous in the sequence, what percent of bases are A, G or T).
- the list of possible sensors were ranked by the following criteria, in order of importance: (i) least number of demerit points, preferably 0' (ii) highest 3 letteredness; and (iii) highest GC content (see, e.g. , Figs. 41 -42)
- sequences on the ranked list were screened one by one for two qualities: (i) the hypothetical sensor duplex has high stability and correctness according to standard RNA secondary structure prediction codes; and (ii) the sensor strand has few significant matches to RNA transcripts other than nppa mRNA in rats and mice that extends from the toehold region (8 bases at 3') into more than 50% of the duplex region (bases 9 to 31 from the 3').
- the first base was changed at the 5' from an A to a C. This gives the following sensor sequence:
- NCBI BLAST of the sensor sequence using "somewhat similar” settings showed no significant sequence matches other than to mouse and rat ANP (nppa) mRNA.
- Calcineurin is a heterodimer composed of one of three catalytic isozymes (PPP3CA, PPP3CB, PPP3CC) and one of two regulatory subunits (PPP3R1 and PPP3R2).
- PPP3CA catalytic isozymes
- PPP3CB catalytic isozymes
- PPP3R1 and PPP3R2 regulatory subunits
- a guide sequence against the PPP3CA subunit of Calcineurin was identified that targets a widely conserved target site present in human, rat, and mice: UGUUGU UUGGCUU UUCCUG UU (SEQ ID NO:32)
- nucleotides and modifications are indacted as follows: (1 ) +A, +T, +C, +G are LNA; (2) mA, mU, mC, mG are 2'-0-methyl; (3) rA, rU, rC, rG are RNA; (3) * denotes phosphorothioate backbone connection; (4) /5Sp9/ is a tri-ethylene glycol linker; (5) /iSpC3/ is an internal C3 spacer; (6) /5AmMC6/ is a 5' primary amine modification on a C6 linker; (7) /3AmMO/ is a 3' primary amine modification.
- EXAMPLE 3 Design of mir-23a-3p:Calcineurin Cond-siRNA
- mir-23a-3p The reverse complement of mir-23a-3p is GGAAAUCCCUGGCAAUGUGAU (SEQ ID NO:38)
- the Cond-siRNA sensor to sense a microRNA input is that the microRNA guide strand is usually only 21 nt long, whereas the Cond-siRNA sensor's duplex region is usually 23 nucleotides long and the toehold is usually 5 to 8 nucleotides long. This means that a microRNA guide strand is not long enough to completely displace the sensor strand from the core strand.
- scheme A gives a 23 bp sensor duplex and allows the miRNA to displace up to 4 terminal bases of the 5' core strand segment, scheme B, 23 bp sensor, 3 terminal bases displaced, scheme C, 23 bp sensor, 4 terminal bases displaced, scheme D, 23 bp sensor, 5 terminal bases displaced, scheme E, 22 bp sensor, 5 terminal bases displaced, and scheme F, 22 bp sensor, 3 terminal bases displaced
- a sequence: CGAAGAAC (SEQ ID NO:40) is added to the 5' of the sensor. This sequence is designed to improve thermodynamic stability of the sensor duplex, minimize secondary structure in the sensor strand, and minimize overlap with non-mir23a-3p transcripts.
- the sensor According to NCBI BLAST, the sensor has no significant unintended matches to human RNA transcripts, and there are only a few significant unintended matches to mouse RNA transcripts.
- nucleotides and modifications are indacted as follows: (1 ) +A, +T, +C, +G are LNA; (2) mA, mU, mC, mG are 2'-0-methyl; (3) rA, rU, rC, rG are RNA; (3) * denotes phosphorothioate backbone connection; (4) /5Sp9/ is a th-ethylene glycol linker; (5) /iSpC3/ is an internal C3 spacer; (6) /5AmMC6/ is a 5' primary amine modification on a C6 linker; (7) /3
- Cond-siRNAs were designed and synthesized to detect murine ANP or mir-23a-3p and inhibit calcineurin. The constructs are shown in Figures 16 and 17. All strands were purchased from a commercial oligonucleotide vendor (Exiqon Inc, now a part of Qiagen).
- constructs were annealed at 500 nM, loaded at 20 uL per well in 10% non-denaturing PAGE. Run in 1xTBE buffer at 120V for 90 min. The correct bands were excised. The Cond-siRNA constructs were then extracted via the crush and soak method using standard RNA isolation kits.
- Figure 30 shows an example gel where Cond-siRNAs were assembled and purified.
- Dual lucif erase assays of mir-23a-3p calcineurin Cond-siRNA ( Figure 31 ).
- the Cond-siRNA described above was assessed for its ability of to keep RNAi activity OFF in the absence of the correct biomarker and switching RNAi ON in the presence of RNA transcripts bearing the mir-23a-3p sequence.
- unpurified mir-23a-3p calcineurin Cond-siRNAs was co-transfected at the indicated concentrations into human Hek 293 cells, along activator and dual luciferase plasmids.
- the activator plasmids expressed either a null transcript, a transcript with an incorrect activator, the 21 base mir-23a-3p sequence, or a longer sequence that was complementary to the entire sensor strand.
- the dual luciferase plasmid encoded Firefly luciferase as the control and a Renilla luciferase with the calcineurin target site in its 3' UTR as the target of RNAi.
- ANP calcineurin Cond-siRNA in NRVM cells under PE stimulation.
- murine ANP calcineurin Cond-siRNA could detect overexpression of ANP upon phenylephrine (PE) stimulation, and activate RNAi knockdown against calcineurin.
- ANP calcineurin against murine biomarkers and targets is tested because there are no suitable human models to test against.
- the biological effect of this murine oriented Cond-siRNA should be representative of biological effects that Cond-siRNA configured for humans would have.
- NRVM cells were incubated using standard protocols under normal conditions (95% air, 5% C02, 37C).
- the purified ANP calcineurin Cond-siRNA was transfected at 20 nM concentration into NRVM cells using RNAiMax. The transfected cells were incubated for 24 hours. PE was then added to the media to 50 ⁇ final concentration. After a further 48 hours, cells were harvested and stained or processed for RNA isolation.
- Example 5 Exemplary guide and sensor strand sequences
- Example 5a randomly chosen human/rat PPP3CA mRNA guide paired with randomly chosen human NPPA sensor
- Core is: CUCGCCUCUCC UGACUGAUGCUGGUAAAGUGG GAUGGUGACUUC
- Example 5b human/rat PPP3CA mRNA guide above paired with randomly chosen human NPPB sensor
- Cond-siRNA Sensor GGAAUCAGAAGCAGGUGUCUGCAGCCAGGAC
- Core is: CUUCUGAUUCC UGACUGAGAUGCUGGUAAAGUGG UGCAGACACCUG
- Example 5c human/rat PPP3CA mRNA guide above paired with randomly chosen human Myh7 sensor
- Core is: CAGCUCCUUGG UGACUGAGAUGCUGGUAAAGUGG GAGCCUGUGUAA
- Example 5d randomly chosen human/rat HDAC2 mRNA guide paired with human NPPA sensor from example 1
- Core is: CUCGCCUCUCC GCGGAUAGCUUGUGAUGAAGUGG GAUGGUGACUUC
- Example 5e randomly chosen human/rat HDAC2 mRNA guide above paired with human NPPB sensor from example 2
- Core is: CUUCUGAUUCC GCGGAUAGCUUGUGAUGAAGUGG UGCAGACACCUG
- Example 5f randomly chosen human/rat HDAC2 mRNA guide above paired with human Myh7 sensor from example 3.
- Core is: CAGCUCCUUGG GCGGAUAGCUUGUGAUGAAGUGG GAGCCUGUGUAA
- Example 5g randomly chosen human/rat PPP3CA mRNA guide paired with mir-23a-3p sensor
- Cond-siRNA Sensor CGAAGAAC GGAAAUCCCUGGCAAUGUGAU
- Core is: UCCGUUCUUCG UGACUGAGAUGCUGGUAAAGUGG UGCCAGGGAUU
- Example 5h human/rat PPP3CA mRNA guide above paired with mir- 125b-5p sensor
- Cond-siRNA Sensor CGACAGU UCACAAGUUAGGGUCUCAGGGA
- Core is: GUGAACUGUCG UGACUGAGAUGCUGGUAAAGUGG GACCCUAACUU
- Example 5i human/rat PPP3CA mRNA guide above paired with mir- 195b-5p sensor
- Cond-siRNA Sensor CCUGAA GAACAG AU AG U C U AAACAC U GGG
- Core is: UGUUCUUCAGG UGACUGAGAUGCUGGUAAAGUGG UUUAGACUAUC
- Example 5j randomly chosen human/rat HDAC2 mRNA guide paired with mir-23a-3p sensor
- Cond-siRNA Sensor CGAAGAAC GGAAAUCCCUGGCAAUGUGAU
- Core is: AACAGCUCCUUGG GCGGAUAGCUUGUGAUGAAGUGG GGAGCCUGUGUGU [00265]
- Example 5k randomly chosen human/rat HDAC2 mRNA guide above paired with mir-125b-5p sensor
- Cond-siRNA Sensor CGACAGU UCACAAGUUAGGGUCUCAGGGA
- Core is: UCCGUUCUUCG GCGGAUAGCUUGUGAUGAAGUGG UGCCAGGGAUU
- Example 5I randomly chosen human/rat HDAC2 mRNA guide above paired with mir-195b-5p sensor
- Cond-siRNA Sensor CCUGAA GAACAG AU AG U C U AAACAC U GGG
- Core is: UGUUCUUCAGG GCGGAUAGCUUGUGAUGAAGUGG UUUAGACUAUC
- Example 6 Exemplar siRNAs designed by a commercial siRNA automated design website
- the design tool was tasked with designing siRNAs targeting the protein coding region of both the human and the rat mRNA.
- the top three candidates are shown.
- Cond-siRNA guides are made by adding 4 G/C rich bases to the 5' of the antisense strand.
- Antisense 5' U.A.U.U.G.C.U.C.G.G.A.U.C.U.U.G.U.C.U.U.C.U.U.C.U.U 3'
- Antisense 5' U.U.U.A.C.C.A.G.C.A.U.C.U.C.A.G.U.C.A.U.C.A.G.U.C.A. U.U 3'
- Antisense 5' A.A.U.C.C.A.U.C.U.U.C.U.C.U.G.A.C.C. U.U 3'
- Antisense 5' U.U.U.C.U.G.U.A.C.A.U.U.C.U.A.U.A.G.C.U.U 3'
- Antisense 5' U.U.A.C.A.U. U.C.C.U.G.C.U.U.A.A.G.G.U.U 3'
- Antisense 5' U.U.G.C.C.A.U.C.U.U.G.C.C.A.A.U.U.G.C.U.U 3'
- Antisense 5' U.A.C.A.G.C.A.C.A.C.A.C.U.C.U.A.U.A.C.U.U 3'
- Antisense 5' A.U.A.G.C.C.U.C.U.G.U.C.C.A.C.A.U.A.G.U.U 3'
- Antisense 5' U.U.C.A.U.C.A.C.A.A.G.C.U.A.U.C.C.G.C.U.U 3'
- Antisense 5' U.U.U.U.C.C.A.G.C.A.C.C.A.A.U.A.U.C.C.U.U 3'
- Antisense 5' U.A.A.A.U.C.U.C.U.G.C.A.U.C.U.G.C.U.U.U.U.U.U.U.U.U 3'
- Example 7 Example designs for miRNA sensor strands
- miRNAs have highly conserved sequences across mammalian species. Therefore, we can design a single miRNA sensor for all test animals, including humans.
- HDAC Histone deacetylase
- Rij RPV Virus meets RNAi. Symposium on Antiviral Applications of RNA Interference. EMBO Reports. 2008;9(8):725-729. doi: 10.1038/embor.2008.133.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Plant Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Virology (AREA)
- Analytical Chemistry (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Disclosed herein are conditional siRNAs activatable by pro-hypertrophic RNA sequences and use thereof for treating conditions such as cardiac hypertrophy. The conditional siRNAs target calcineurin or HDAC2.
Description
CONDITIONAL-siRNAS AND USES THEREOF IN TREATING CARDIAC
HYPERTROPHY
PRIORITY CLAIM
[0001] This application claims priority to U.S. Provisional Patent Application No. 62/543,882, filed August 10, 2017, the subject matter of which is hereby incorporated by reference in its entirety, as if fully set forth herein.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with government support under Grant Number 133241 1 , awarded by National Science Foundation through the Emerging Frontiers in Research and Innovation, Origami Design for Integration of Self- assembling Systems for Engineering Innovation (EFRI-ODISSEI), and Grant Number AI029329, awarded by National Institutes of Health (NIH). The government has certain rights to the invention.
BACKGROUND
[0003] RNA interference (RNAi) is a sequence-specific mRNA degradation pathway mediated by siRNA duplexes, key for cellular immunity and developmental regulation. Researchers have utilized synthetic RNAi triggers for therapeutics by inhibiting a specific gene product found to be essential in disease driving pathways but non-essential for normal functioning.
[0004] Consider however that some genes essential in disease progression may have vital functions in normal cells and are dangerous to target. Meanwhile other upregulated genes are not essential for disease progression, but serve as effective indicators. Therefore, there is a need in the art to develop effective therapies to exploit this differential expression in various indications. The conditionally active siRNA complexes described below are candidates for investigation of treatments for those indications, such as cardiac hypertrophy.
[0005] Heart Failure (HF) is a chronic cardiac condition, affecting millions of people worldwide, and considered a major contributor to healthcare expenditure in the US. Compensatory cardiac hypertrophy is one of the initial hallmarks of pathological ventricular remodeling, which is characterized by an upregulation of a variety of genes and miRNA that mediate and regulate myocardial hypertrophy, and
ultimately HF. Even though important advances have been done in the treatment of HF, no cardiac specific therapies with lack of adverse effects have been developed to date. Therefore, there is a need in the art to develop an effective therapy for HF.
BRIEF DESCRIPTION OF THE DRAWINGS
[0006] This application contains at least one drawing executed in color. Copies of this application with color drawing(s) will be provided by the Office upon request and payment of the necessary fees.
[0007] Figure 1 shows a comparison of secondary and tertiary structure (from full atomistic MD simulations) of a Cond-siRNA construct according to one embodiment. Black arrows show corresponding features between the 2D and 3D representations.
[0008] Figure 2 is a diagram showing the RNAi pathway.
[0009] Figure 3 shows toehold mediated strand displacement process of conditional siRNA. In step I, c-siRNA meets RNA transcript with correct activation sequence (Input). In step II, an Input RNA binds to the toehold. Step III shows toehold mediated strand displacement. Step IV shows the sensor strand and input forming a waste duplex that separates from the pro-siRNA. In step V, XRN1 , exosome and other cytosolic RNAses rapidly degrade unprotected overhangs, turning pro-siRNA into efficient Dicer substrate. In step VI, siRNA is processed by Dicer for incorporation into RISC. The basic biophysical process of toehold mediated strand displacement includes a fast 1 D random walk: uS to mS for each of ΝΛ2 steps. This results in sequence specificity from both toehold and duplexes. Thermodynamically stable chemical modifications are confined to sensor strand to avoid kinetic traps.
[0010] Figure 4: A) General construct design of cond-siRNA with green sensor strand designed reverse comp. to signal gene mRNA, red core strand with nick either 1 1 or12 bp from toehold end on sensor side designed comp. to sensor and guide, and yellow guide strand designed reverse comp. to target gene mRNA. B) Model of cond-siRNA. C) Molecular simulation of cond-siRNA
[0011] Figure 5 shows an overview of the design process for Cond-siRNAs according to one embodiment.
[0012] Figure 6 shows a hypothetical sensor duplex for mRNA used to check for thermodynamic stability of the sensor according to one embodiment.
[0013] Figure 7 shows a structure calculation showing sensor strand with low internal secondary structure according to one embodiment.
[0014] Figure 8 shows a histogram showing a 97% predicted formation of the hypothetical sensor duplex and correct secondary structure according to one embodiment.
[0015] Figure 9 shows a hypothetical sensor duplex for miRNA used to check for thermodynamic stability of the sensor according to one embodiment.
[0016] Figure 10 shows a structure of the RNAi targeting duplex according to one embodiment.
[0017] Figure 1 1 is a schematic diagram of a signaling pathway involved in cardiac gene program regulating hypertrophy.
[0018] Figure 12 is a schematic depicting in vivo and in vitro screening approaches.
[0019] Figure 13: A) NuPack generated secondary structure of selected NPPB 31 bpsensor strand. Minimal secondary structure with approximately 40-50% probability of folding onto itself. B) NPPB sensor strand bound to 5' and 3' core overhangs 99% of the time.
[0020] Figure 14: A) NuPack generated secondary structure of selected MYH7 31 bpsensor strand. Minimal secondary structure with approximately 30% probability folding onto itself. B) NPPB sensor strand bound to 5' and 3' core overhangs 97% of the time.
[0021] Figure 15: A) NuPack generated secondary structure of HDAC2 25 bp guide strand. Significant secondary structure indicated by the equilibrium probabilities of binding. B) NuPack generated secondary structure of HDAC2 guide bound to core strand with the 5' and 3' overhangs that bind to the appropriate sensor strand. Although guide strand has significant and strong secondary structure, when placed with core strand, guide binds to core 100%.
[0022] Figure 16 shows test constructs detecting murine ANP mRNA and targeting murine Calcineurin according to certain embodiments.
[0023] Figure 17 shows test constructs detecting murine and human mir-23a- 3p and targeting murine Calcineurin according to certain embodiments.
[0024] Figure 18 is a schematic depicting a site of injury that can be targeted for treatment according to methods of the present invention.
[0025] Figure 19 is a series of bar graphs depicting experimental results of differential gene expression in tissues of wild-type mice in homeostasis.
[0026] Figure 20: Gene expression in NRVM under hypoxia.
[0027] Figure 21 : Differential miRNA expression in NRVM under hypoxia.
[0028] Figure 22: Gene expression in NRVM after PE treatment.
[0029] Figure 23: Differential miRNA expression in NRVM after treatment with PE.
[0030] Figure 24: Gene expression in mice with non-ischemic (TAC) and ischemic (l/R) HF.
[0031] Figure 25: miRNA expression in mice with non-ischemic (TAC) and ischemic (l/R) HF.
[0032] Figure 26 shows an equilibrium probability for an MFE structure
[0033] Figure 27 shows an equilibrium probability for an MFE structure
[0034] Figure 28 shows an equilibrium probability for an MFE structure
[0035] Figure 29 shows an equilibrium probability for an MFE structure
[0036] Figure 30 shows (ANP : calcineurin) and (mir-23a-3p : calcineurin) Cond-siRNAs on 10% non-denaturing PAGE gel in TBE. The correct assemblies are indicated in the green boxes.
[0037] Figure 31 shows results of a dual luciferase assay of mir-23a-3p : calcineurin Cond-siRNA according to certain embodiments.
[0038] Figure 32 is a bar graph showing RNAi activity against Calcineurin in NRVM cells under PE stimulation according to one embodiment.
[0039] Figure 33 shows images of NRVM cells with and without PE stimulation when treated with scrambled siRNA (negative control), (ANP : calcineurin) Cond- siRNA, and commercial calcineurin siRNA (positive control) according to one
embodiment.
[0040] Figure 34 shows results of cell size quantitation according to one embodiment.
[0041] Figure 35A shows Post-MI cardiac remodeling and left ventricular enlargement.
[0042] Figure 35B is a bar graph showing experimental results where patients with any of the patterns of LV remodeling post-MI had a greater risk of the composite of cardiovascular (CV) death, Ml, heart failure (HF), stroke, or resuscitated cardiac arrest.
[0043] Figure 36 is a flowchart accompanied by a corresponding schematic showing the RNA interference pathway starting with pri-miRNA processing in the nucleus.
[0044] Figure 37 is a schematic showing post-MI remodeling
[0045] Figure 38 is a series of bar graphs depicting experimental results of differential miRNA expression in tissues of wild-type mice in homeostasis
[0046] Figure 39 is a table including candidate sensor strands for the 3' UTR of the human myh7 gene. Column abbreviations are as follows: BS is Bad Segments; 3LN is 3-Letteredness; NBP is Number Bad Points; P is Position.
[0047] Figure 40 is a table including candidate sensor strands for the 3' UTR of the rat myh7 gene. Column abbreviations are as follows: BS is Bad Segments; 3LN is 3-Letteredness; NBP is Number Bad Points; P is Position.
[0048] Figure 41 is a table including candidate sensor strands for the 3' UTR of the human nppa gene. Column abbreviations are as follows: BS is Bad Segments; 3LN is 3-Letteredness; NBP is Number Bad Points; P is Position.
[0049] Figure 42 is a table including candidate sensor strands for the 3' UTR of the rat nppa gene. Column abbreviations are as follows: BS is Bad Segments; 3LN is 3-Letteredness; NBP is Number Bad Points; P is Position.
[0050] Figure 43 is a table including candidate sensor strands for the 3' UTR of the human nppb gene. Column abbreviations are as follows: BS is Bad Segments; 3LN is 3-Letteredness; NBP is Number Bad Points; P is Position.
[0051] Figure 44 is a table including candidate sensor strands for the 3' UTR of the rat nppb gene. Column abbreviations are as follows: BS is Bad Segments; 3LN is 3-Letteredness; NBP is Number Bad Points; P is Position.
[0052] Figure 45 shows a top view of a 3D schematic of a Cond-siRNA construct according to one embodiment.
DETAILED DESCRIPTION
Overview of Conditional-siRNA
[0053] Described herein are conditional siRNA complexes (also referred to herein as Cond-siRNA, a conditional RNA-sensor, or an RNA-sensor) that include a therapeutic component (e.g., siRNA molecule) associated with a molecular sensor via a core molecule. The conditional siRNA complexes are inactive under normal conditions, but are activated upon interaction between the molecular sensor and a biomarker. Such molecules are synthetic riboswitch molecules that allow an input gene or RNA molecule to "switch on" an RNAi pathway against a target output gene.
[0054] An RNA-sensor molecule or complex includes sensor strand, a guide strand, and a core strand that bind to each other to form a multi-strand molecular complex having a dual duplex structure shown in Figs. 1 , 45. In certain embodiments, those three strands (core, sensor and guide) form two parallel oligonucleotide duplexes connected in a double crossover configuration. [14] (See Figure 1 ). In some aspects, the length of each of the oligonucleotide duplexes is sufficient to operate within the RNA interference (RNAi) pathway (See Figs. 2, 36). For example, the duplexes may be between about 15 and 30 base pairs in length. In some embodiments, the duplexes are between 15 and 20 base pairs in length, between 20 and 25 base pairs in length, between 25 and 30 base pairs in length. In other embodiments, the duplexes are about 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 25, 26, 27, 28, 29, 30, or more than 30 base pairs in length.
[0055] The double crossover configuration as shown in Fig. 1 represents the inactive or "OFF" state of the RNA-sensor complex wherein the sensor duplex inhibits RNAi loading of the siRNA duplex, serving as a "lock" on RNAi activity. In the OFF state, the guide strand binds a first portion (or "passenger" segment) of the core strand to form an siRNA duplex that serves as a pro-RNA molecule. The pro- RNA molecule operates in the RNAi pathway of a target cell to alter expression of a
target gene or target RNA molecule associated with a pathological condition (i.e., the "therapeutic target molecule"). The second duplex is formed by the sensor strand binding to a second portion (or "protection" segment) of the core strand to form the sensor duplex. In some embodiments, the core strand has a third portion (or "protection" segment) that binds the sensor strand. In certain such embodiments, the core strand includes the passenger strand (P) that is joined to first and second protection segments (A, B) at each end by a linker (L1 , L2) in the following configuration:
[0056] 5' B— L2— P— L1— A 3'
[0057] The sequence of the core strand is determined by the sequences of the sensor and guide strands, and may be fully or complementary to the sensor strand, the guide strand, or both. Any suitable linker can be used in accordance with the embodiments described herein, including, but not limited to, an internal C3 spacer, a C6 linker, a tri-ethylene glycol linker.
[0058] The RNA-sensor complex is activated to the "ON" state upon interaction with a biomarker in the cell expressing a phenotype associated with the pathological condition targeted by the guide strand of the siRNA duplex. This activation is primarily due to the design of the sensor strand, which serves as the activation signal for RNAi activity. When this is the case, the RNA-sensor complex is said to detect the biomarker.
[0059] The sensor strand includes a nucleotide sequence designed to bind the biomarker associated with the pathological condition (i.e., "pathological biomarker"). Binding to the biomarker is initiated by the binding of at least one toehold segment (single stranded) to an input RNA strand that encodes at least a portion of the pathological biomarker, as shown in Fig. 3. Upon displacement of the sensor strand, the sensor and input strands from a waste duplex that separates from the pro-siRNA molecule, allowing the pro-siRNA to be processed by the target cell's RNAi system. The structure and binding dynamics of the conditional-siRNAs described herein is explained further in U.S. Patent No. 9,725,715, the content of which is incorporated herein by reference in its entirety.
[0060] The sequence of the sensor strand can be fully or partially complementary to an RNA sequence present in the pathological biomarker. In
certain embodiments, the sensor strand is 100% complementary to the RNA sequence present in the pathological biomarker. Other embodiments may include a sensor strand that is largely complementary to the RNA sequence present in the pathological biomarker, for example, the sensor strand may be greater than 70% complementary, greater than 75% complementary, greater than 80% complementary, greater than 85% complementary, greater than 90% complementary, greater than 95% complementary, greater than 96% complementary, greater than 97% complementary, greater than 98% complementary, or greater than 99% complementary to the RNA sequence present in the pathological biomarker.
[0061] In some embodiments, the pathological biomarker is an RNA sequence that forms or encodes a molecule that is associated with the pathologic condition. In some aspects, the pathological biomarker is an RNA sequence that is present in the target cell under pathological conditions, but is substantially absent under normal conditions. Alternatively, the pathological biomarker is an RNA sequence that is upregulated in the target cell under pathological conditions as compared to normal conditions.
[0062] The guide strand includes a Dicer cleavage site near the 3' end. The sequence between the Dicer cleavage site and the 3' terminus of the guide strand is either fully or partially complementary to a nucleotide sequence found in the therapeutic target molecule (e.g., target gene, target mRNA or target miRNA). When this is the case, the Cond-siRNA is said to target the gene or RNA molecule. In certain embodiments, the guide strand is 100% complementary to the nucleotide sequence found in the therapeutic target molecule. Other embodiments may include a guide strand that is largely complementary to the nucleotide sequence found in the therapeutic target molecule, for example, the guide strand may be greater than 70% complementary, greater than 75% complementary, greater than 80% complementary, greater than 85% complementary, greater than 90% complementary, greater than 95% complementary, greater than 96% complementary, greater than 97% complementary, greater than 98% complementary, or greater than 99% complementary to the nucleotide sequence found in the therapeutic target molecule.
[0063] A challenge of using oligonucleotides in vivo lies in preventing nuclease degradation of RNA nucleotides. Several chemical modifications in the sensor strand can be used to overcome this challenge. For example, Locked
Nucleic Acids (LNAs) include a modification of RNA nucleotides with an extra bridge between the 2' O and 4' C increases thermal stability of RNA duplexes and allows for resistance to nucleases. 2' O-Methyl modifications confer stability, increase binding affinity to RNA nucleotides and prevent degradation by nucleases. And, phosphorothioate: modification by replacing one of the non-bridging oxygens in the phosphate linkage between bases with a sulfur that reduces nucleolytic degradation; however also lowers binding affinity.
[0064] Thus, in certain embodiments, the RNA-sensor complex includes one or more modifications to the nucleotide sequence of the sensor strand, the core strand, and/or the guide strand. Exemplary modifications that may be used include, but are not limited to, locked nucleic acids (LNA), peptide nucleic acids (PNA), 2'-0- methyl modifications, morpholino modifications, phosphorothioate modifications, terminal modifications, and other linker or backbone modifications or connections. Additional chemical modifications may be chosen according to methods described in US9725715B2, the disclosure of which is hereby fully incorporated herein.
[0065] The approach of designing a cond-siRNA sensor complex for use in treating a disease or other pathological condition using the cond-siRNA sensor complexes is advantageous in that it allows the complex to become biologically active only in diseased cells AND remain OFF in healthy cells. In addition, the approach allows for increased disease cell specificity and prevents toxicity from delivery to unintended off-targets. Further, the approach combines disease specificity from one gene with treatment efficacy from a second gene to create therapeutics that are precisely tailored to specific gene expression patterns. Still further, the approach is advantageous due to steric hindrance of the two RNA duplexes positioned in a parallel configuration (Fig. 4). The sensor strand inhibits RNAi loading of siRNA and will only displace when activated in disease cells.
Overview of methods for designing a conditional siRNA complex
[0066] An siRNA complex is designed based on biomarkers and therapeutic target molecules that are specific to each cell type, pathological condition, and/or indication. According to certain embodiments, methods for designing and testing each conditional siRNA complex includes several steps, as described below.
[0067] Figure 5 shows an overview of the design process. In certain
embodiments methods for designing a conditional siRNA complex (the "design method") includes a step of determining a biomarker that will serve as an input for activation and a therapeutic target for RNAi inhibition. This step may include a determining one or more factors that are differentially expressed (i.e., upregulated or present in a diseased cell as compared to a normal cell) using methods known in the art.
[0068] The design method further includes a step of generating a list of candidate target segments of the biomarker (i.e., target mRNA sequence or target miRNA sequence) that can serve as a biomarker segment for binding the sensor strand, and then designing sensor strands for each biomarker.
[0069] The design method further includes a step of estimating the thermodynamic stability of the resulting sensor strand— biomarker duplexes (the sensor duplex) generated by the target segments and sensor strands by using secondary structure prediction tools used in the art [15].
[0070] The design method further includes a step of checking for the uniqueness of the binding site for the most stable sensor duplexes against the known transcriptome of the animal to which the conditional siRNA complex will be tested against.
[0071] The design method further includes a step of generating a list of guide strand sequences by using a protocol that may include, but is not limited to, standard siRNA design tools, literature references, or heuristic rules.
[0072] The design method further includes a step of creating a Dicer substrate from the chosen guide strand sequences.
[0073] The design method further includes a step of generating sequences for the core strand that connect the sensor strands to the guide strands.
[0074] The design method further includes a step of checking that the sensor : guide pairing does not create unwanted interactions.
[0075] The design method further includes a step of selecting a pattern of suitable chemical modifications as described herein, and optionally simulating the constructs using molecular simulation methods used in the art [16] to simulate the constructs (optional).
[0076] The design method may also include a method of synthesizing or purchasing the sensor, core, and guide strands from commercial vendors such as Qiagen, Dharmacon, or IDT, the constructs of which are then assembled, characterized, and purified using gel electrophoresis.
[0077] The design method further includes a step of conducting preliminary biological testing and validation of the construct function, and then optionally test in in vitro and in vivo models of pathological conditions, including, but not limited to, Ml induced maladaptive hypertrophy as described below.
[0078] Additional embodiments related to designing the guide, the sensor and the core strands are explained below.
Method for designing sensor strands for mRNA biomarker
[0079] According to certain embodiments, methods for designing and testing sensor strands that target an mRNA biomarker includes an algorithm that includes several steps, as described below.
[0080] In certain embodiments, a method for designing a sensor strand for an mRNA biomarker (the "mRNA sensor design method") includes a step of identifying the 3' UTR for each messenger RNA biomarker.
[0081] The mRNA sensor design method further includes a step of generating all possible consecutive 31 base sequences for each 3' UTR identified above.
[0082] The mRNA sensor design method further includes a step of obtaining the prospective sensor strand sequence for each sequence segment from the previous step by identifying the reverse complement (full or partial) of each sequence
[0083] The mRNA sensor design method further includes a step of checking each sensor strand sequence for the following undesirable features: (i) three or more consecutive Gs, and (ii) four or more consecutive A or U bases.
[0084] The mRNA sensor design method further includes a step of checking each sensor strand sequence for the following desirable features: (i) higher than 50% G/C bases - this correlates with thermodynamic stability, (ii) "three letteredness," (iii) The first base at the 5' end of the sensor strand is a C or a G; and (iv) the 9th base from the 3' end of the sensor strand is a C or a G. According to the
embodiments described herein, "three letteredness" is defined as the proportion of the sequence comprising of the three most numerous bases (e.g., the extent to which sequence is mostly made of A, U, C; or C, G, A; or A, U, G). A higher three letteredness score correlates with lower internal secondary structure. Exemplar ranking tables can be seen in Figs. 39-44, which correspond to the genes or nucleotide sequences in Appendices C-H, submitted herewith.
[0085] The mRNA sensor design method further includes a step of ranking all possible sensor strands. Strands with the least number of features from 4 and the highest scores from 5 are ranked highest
[0086] The mRNA sensor design method further includes a step of generating hypothetical sensor duplexes using the pattern shown in Figure 6, starting from the highest ranked strands.
[0087] The RNA sensor design method further includes a step of using Nupack or similar secondary structure prediction codes to calculate the following, starting from the highest ranked strands: (i) the internal secondary structure of the sensor strand (lower amounts of internal secondary structure are desirable (Figure 7), (ii) the thermodynamic stability of the hypothetical duplex from 7. Ideally, at 1 nM strand concentration, Nupack should predict that > 90% or > 95% of component strands should form the hypothetical sensor duplex (Figure 8); and (iii) if sensor duplex is not stable, can adjust 1 to 5 bases at the 5' terminus of the sensor sequence to increase stability at the cost of reducing complementarity to the corresponding binding site on the putative biomarker.
[0088] The RNA sensor design method further includes a step of screening the sensor strand for thermodynamically stable duplexes using NCBI BLAST according to the following parameters: (i) use the "somewhat similar" search option, (ii) for sensor sequences, the 8 bases at the 3' terminus (constituting the 3' toehold) should have no more than 5 bases complementary to known transcripts in the target animal (eg, human or mouse) other than the intended biomarker, and (iii) if the first two criteria not met, broaden sequences considered in 1 to the coding region or the entirety of the mRNA.
Method for designing sensors for miRNA biomarker
[0089] According to certain embodiments, methods for designing and testing
sensor strands that target an miRNA biomarker includes an algorithm that includes several steps, as described below.
[0090] In certain embodiments, a method for designing a sensor strand for an miRNA biomarker (the "miRNA sensor design method") includes a step of identifying a guide sequence for each miRNA biomarker, to which the sensor strand is designed to bind (typically approximately 21 bases according to one aspect)
[0091] The miRNA sensor design method further includes a step of obtaining the reverse complement (full or partial) of the miRNA guide sequence.
[0092] The miRNA sensor design method further includes a step of adding 8 more bases to the 5' end of the sequence from the prior step.
[0093] The miRNA sensor design method further includes a step of generating hypothetical sensor duplexes using the pattern shown in Figure 9, starting from the sequence developed in the prior step.
[0094] The miRNA sensor design method further includes a step of using Nupack or similar secondary structure prediction codes to calculate the following: (i) the thermodynamic stability of the hypothetical duplex from the prior step. Ideally, at 1 nM strand concentration, Nupack should predict that > 90% or > 95% of component strands should form the hypothetical sensor duplex, (ii) if sensor duplex is not stable or the secondary structure is incorrect, determine whether the 8 terminal bases at the 5' end of the sensor strand, or the length of strand A or strand B can be altered or modified to optimize thermodynamic stability.
[0095] The miRNA sensor design method further includes a step of screening the sensor strand for thermodynamically stable duplexes in NCBI BLAST according to the following parameters: (i) use the "somewhat similar" search option, (ii) for sensor sequences, the 8 bases added at the 5' end of the sensor should not increase complementarity to transcripts other than the intended miRNA. If they do, adjust the sequence and start over from 4.
Methods for designing a guide strand sequence against a therapeutic target molecule
[0096] According to certain embodiments, methods for designing a guide strand sequence against a therapeutic target gene or RNA molecule (e.g., mRNA or
miRNA) includes several steps, as described below.
[0097] In certain embodiments, a method for designing a guide strand sequence against a therapeutic target (the "guide strand design method") includes a step of obtaining one or more prospective guide strand sequences using at least one of the following methods: (i) find a published guide strand sequence for the intended target; (ii) find a known miRNA target site on the target gene, or (iii) use a published algorithm or design tool known in the art [17, 18].
[0098] The guide strand design method further includes a step of checking the guide sequence to make sure that the 6 bases at the 5' domain (Figure 10) is more AU rich than the 6 bases in the 3' domain (Figure 10). This will improve probability for correct strand loading [19]. Ideally, the 3' domain should be CG rich, and terminate in a CG base-pair.
[0099] The guide strand design method further includes a step of adding four terminal bases to the 5' end of the guide strand to complete the duplex. Those should be CG rich to improve thermodynamic stability.
[00100] The guide strand design method further includes a step of constructing the hypothetical RNAi targeting duplex as shown in Figure 10.
[00101] The guide strand design method further includes a step of checking that the guide strand has weak internal secondary structure and minimal tendency to bind to itself (no more than 10% at 1 nM strand concentration) using Nupack or similar standard secondary structure calculation tool. Adjust bases added in 3 as necessary.
Methods for designing a core strand sequence and checking compatibility of pairing sensor to guide
[00102] According to certain embodiments, methods for designing a core strand sequence and checking compatibility of pairing sensor to guide includes several steps, as described below.
[00103] In certain embodiments, a method for designing a guide strand sequence against a therapeutic target (the "core strand design method") includes a step of choosing a suitable combination of sensor and guide strands, methods for designing those strands are discussed above and in the working examples,
according to the embodiments described herein.
[00104] The core strand design method further includes a step of constructing the core strand by constructing a strand of the form 5' - B - C3 - P - C3 A - 3' where A and B are the sequence of complementary strand B from the hypothetical sensor duplex (Figures 6 or 9), P is the sequence of the passenger strand from the hypothetical RNAi duplex (Figure 10) and C3 are C3 linkers.
[00105] The core strand design method further includes a step of using Nupack or similar standard secondary structure calculation tool to check that the guide strand and core strand base-pairing has the following properties: (i) > 95% of strands are base-paired in the correct duplex at 1 nM strand concentration, (ii) the guide strand duplex has the correct conformation, with a -23 base-pair duplex, a two base 3' guide strand overhang, and 10-12 base 5' and 3' core overhangs with minimal secondary structures, and (iii) If above criteria not met, choose new sensor or guide pairing.
Conditional siRNA complexes for treating cardiac hypertrophy
[00106] Disclosed herein is a therapeutic strategy that targets molecular pathways involved in cardiac hypertrophy (that often results after a myocardial infarction), with minimal off-target effects. A myocardial infarction (Ml) is a heart attack. Mis can occur when a blood clot blocks a coronary artery, interrupting blood flow to the heart-a condition known as cardiac ischemia.
[00107] Heart muscles downstream of the blockage lose oxygen, leading to injury and death of the muscle cells. Post-MI, the hypoxia and tissue damage induces left ventricular remodeling (Figs. 35A, 37). Cardiac reperfusion results in inflammation and oxidative damage. The injuries to cardiomyocytes during Ml can cause a cascade of biological signaling events that leads cardiomyocytes to increase in volume and undergo proliferation in a specific way that compromises the functioning of the heart. This hypertrophic response is driven by a complex interplay of factors including a maladaptive regeneration gene program. During maladaptive regeneration, the heart undergoes changes that induce detrimental conditions to the patient (Fig. 35B). The affected ventricle increases its volume, but the walls of the ventricle become thinner, and the ability of the heart to pump blood decreases over time. This can lead to a variety of serious problems, including heart failure, a second
heart attack, or sudden death. Thus, this process is called maladaptive hypertrophy (as opposed to adaptive hypertrophy, which strengthens the heart in reaction to stimuli such as exercise).
[00108] Maladaptive cardiac hypertrophy can be ameliorated by drugs that inhibit calcineurin and histone deacetylase 2 (HDAC2), for example. However, these drugs can cause serious side effects in non-cardiac tissues. Therefore, it's necessary to have a method to restrict drug activity to the heart.
[00109] The specificity and versatility of the conditional small interfering RNAs (cond-siRNA) described herein offers a new class of therapeutics for a variety of diseases and cancers by hijacking the RNA interference (RNAi) pathway. Although current treatment options for post-MI cardiac hypertrophy alleviate the severity of the condition, it is necessary to target the internal maladaptive gene program that drives the hypertrophic responses. In particular, cond-siRNAs (Fig 4) are sequenced with a signal and target strand that due to steric hindrance, will only activate when the appropriate cardiac hypertrophy signal is present— thus only targeting disease cells through toehold-mediated strand displacement.
[00110] The Cond-siRNAs described herein can achieve this by using cardiac RNA biomarkers of Ml as activation signals to switch ON RNAi silencing against calcineurin or HDAC2. Using this approach, RNAi silencing of the target genes are restricted to cardiomyocytes that express Ml associated RNA biomarkers. This means that RNAi activity will NOT occur in other organs and tissues where inhibition of the targets can cause serious side effects. In one aspect, disclosed herein is a strand-displacement operated, programmable conditional-siRNA complex that can be activated by specific mRNA and miRNA transcripts expressed in the hypertrophied myocardium, to target unrelated pro-hypertrophic pathways by RNAi knockdown.
[00111] To design an effective Cond-siRNA for treating Cardiac Hypertrophy, in vivo and/or in vitro screening approaches for measuring relevant gene expression may be used in accordance with the embodiments described herein.
[00112] Certain genes are upregulated under pathological cardiac hypertrophic conditions, which may be candidate pathological biomarkers to guide a Cond-siRNA molecule to a population of target cells, and which can be used to displace the
sensor strand of the Cond-siRNA. For example, certain signaling cascades are activated under hypertrophic stimulating conditions (see Fig. 1 1 ). For example, genes and miRNAs that are upregulated in pathological cardiac hypertrophy were screened for differential gene expression in wild type (wt) mice as well as under various hypertrophic conditions to determine which genes are suitable candidates for use as a target for designing a sensor strand. See working examples below
[00113] In vitro screening approaches may include the use of a cardiomyocyte cell line (e.g., neonatal rat ventricular myocytes (NRVM), human cardiac myocytes (HCM)) cultured under hypoxic conditions or treated with phenylephrine. Fig. 12A. In vivo approaches may also be used including, but not limited to, rat models for ischemic heart failure (HF) (e.g., ischemia/reperfusion model), or rat models for nonischemic HF (e.g. , thoracic aortic constriction (TAC) model). See Fig. 12B.
[00114] Selection of RNA pathological biomarkers (input signals) for activation of Cond-siRNAs an important process for designing the cond-siRNA complexes described herein. The purpose of using pathological RNA biomarkers specific to the condition of cardiac hypertrophy for conditional RNAi activation is to ensure that RNAi activity is only active in cardiac tissues. Ideally, these biomarkers should be highly overexpressed in cardiac tissues affected by Ml and not expressed in other tissues of the body. By comparing data gathered from in vitro and in vivo experiments on NRVM cell cultures and mice models with known organism wide expression patterns for the tested mRNAs and miRNAs (see working examples below), it was determined that at least three mRNAs and three miRNAs fit the criteria, including mRNAs that encode atrial naturetic peptide (ANP), B-type natriuretic peptide (BNP), and myosin heavy chain β (ΜΗΟβ), and miRNAs that encode mir- 23a-3p, mir-125-5p, and mir-199b-5p.
[00115] Thus therapeutic biomarkers that may be used to activate the conditional siRNA complexes in accordance with the embodiments described herein include, but are not limited to, mRNA biomarkers for Ml affected cardiomyocytes, such as those described below.
[00116] In certain embodiments, a Cond-siRNA for treating cardiac hypertrophy includes a sensor strand designed to target a biomarker that is present and/or upregulated in heart cells (e.g., cardiac myocytes). Such biomarkers may include,
but are not limited to, atrial naturetic peptide (ANP), B-type natriuretic peptide (BNP), myosin heavy chain β (ΜΗΟβ), mir-23a-3p, mir-125-5p, and mir-199b-5p. In some aspects, the sensor strand detects an mRNA or an miRNA sequence that encodes the biomarker. And, in certain aspects, the sensor strand detects an mRNA sequence that encodes the biomarker by binding to the 3' UTR of the mRNA. Additional information regarding exemplary biomarkers is discussed below.
[00117] ANP (nppa) signal sensor strands, nppa (Natruiretic Peptide A) encodes for ANP protein that is overexpressed in hypertrophic conditions, thus is suitable as a biomarker for hypertrophy.
[00118] BNP (nppb) signal sensor strands, nppb (Natruiretic Peptide B) encodes for BNP protein that functions as a cardiac hormone and regulates natruiresis, diuresis, vasorelaxation and cardiovascular homeostasis. Low levels of BNP naturally found in the bloodstream in healthy individuals; high levels from cardiac ventricles. High concentrations of BNP in bloodstream indicates heart failure, and is a biomarker for hypertrophy. Thus, significant upregulation of BNP in induced cardiac hypertrophic conditions is indicative of effective sensor strand gene selection.
[00119] In some embodiments, a NPPB RH SSS v2.0 sensor was designed, wherein 31 bp sequence windows checked by hand through screening in entire 3' UTR of homo sapiens mRNA based on A-U richness, hairpins, poly G tracts, and 8 bp toehold region. Three areas were found; NCBI Blast check for matches with other mRNAs and % yield of binding narrowed down options to chosen sensor (see NPPB sensor structures, Fig. 13).
[00120] ΜΗΟβ (myh7) signal sensor strands. MYH7 (myosin heavy chain 7) encodes for the β-heavy chain subunit of cardiac myosin. Varying amounts of the encoded protein correlate with cardiac muscle fiber contractile velocity. myh7 is predominantly expressed in the ventricle and type I muscle fibers. Gene mutations are associated with hypertrophic cardiomyopathy, and mybh7 is upregulated in pathological cardiac hypertrophy. A significant upregulation of myh7 is seen in induced cardiac hypertrophic conditions, indicating that myh7 is another potential sensor strand gene selection.
[00121] In some embodiments, a myh7 RH SSS v2.0 sensor was designed, wherein 31 bp sequence windows checked by hand through screening of entire
homo sapiens mRNA. Because 3' UTR of mRNA is short with numerous poly G tracts, screening went into the coding region; however those contained secondary structure. Only 1 area found and chosen; checked NCBI Blast for matches with other mRNAs (see, e.g., myh7 sensor structures, Fig. 14).
[00122] In some embodiments, the sensor strand is fully complementary to any of the biomarkers discussed above (i.e., 100% complementary). In some embodiments the sensor strand is partially complementary to any of the biomarkers discussed above. For example, the sensor strand may be at least 70% complementary to the biomarker, at least 70% complementary to the biomarker, at least 75% complementary to the biomarker, at least 80% complementary to the biomarker, at least 85% complementary to the biomarker, at least 90% complementary to the biomarker, at least 95% complementary to the biomarker, at least 96% complementary to the biomarker, at least 97% complementary to the biomarker, at least 98% complementary to the biomarker, or at least 99% complementary to the biomarker.
[00123] Further, the complementarity of the sensor strand to the biomarker may be matched to any 19-40 base segment of any variant of the mRNA sequence that encodes ANP (nppa), BNP (nppb), or ΜΗΟβ (myh7).
[00124] In other embodiments, the sensor strand includes one of the sequences in Table 1 below:
[00125] In certain embodiments, a Cond-siRNA for treating cardiac hypertrophy includes a guide strand designed to target a therapeutic RNAi target that is present and/or upregulated in heart cells (e.g., cardiac myocytes) and known to the field to ameliorate post-MI maladaptive hypertrophy, but whose systemic inhibition or expression may lead to unwanted side effects. In certain embodiments, therapeutic targets that may be used to design guide strands of Cond-siRNAs include, but are not limited to, Calcineurin [7-10] (or a subunit thereof, e.g., PPP3Ca, PPP3CB, PPP3CC, PPP3R1 , PPP3R2), and HDAC2 [1 1 , 12] or HDAC2 [1 1 , 12]. In some aspects, the guide strand binds to an mRNA or an miRNA sequence that encodes the therapeutic target.
[00126] HDAC2 guide strands. HDAC2 (Histone deacetylase 2) functions as a central regulator in transcriptional regulation, cell cycle progression and developmental pathways by modifying chromatin structure. HDAC2 inhibition represses the maladaptive regeneration program through a pathway involving GSK3 , inhibiting the hypertrophic response. HDAC2 serves as a key cardiac hypertrophic regulator and a potential therapeutic target.
[00127] In some embodiments, an HDAC2 RH TGS v2.1 guide strand was designed, wherein a 23 base-pair sequence was taken from the HDAC2 homo sapiens mRNA based on past research utilizing HDAC2-targeted siRNAs. Two U base pairs added to the 3' end. Four base pairs at 5' end purposefully changed to mismatch the mRNA in order to prevent potential improper Dicer cleavage and RISC complex loading incorporation. An NCBI Blast check was also done to check for matches with other mRNAs. See HDAC2 guide strand structures, Fig. 15
[00128] Calcineurin guide strands. Calcineurin is a major propoter of cardiac hypertrophy, and inhibition of Calcineurin has been found to reduce hypertrophy. And, since it's always present in ischemic cells, calcineurin is a good therapeutic target for the present invention.
[00129] In some aspects, the RNAi targeting segment of the guide strand (i.e., bases 1 -21 from the 3' terminus) is fully complementary to any of the therapeutic
targets discussed above (i.e. , 100% complementary). In some aspects, the RNAi targeting segment of the guide strand (i.e., bases 1 -21 from the 3' terminus) is partially complementary to any of the therapeutic targets discussed above. For example, the sensor strand may be at least 70% complementary to the biomarker, at least 70% complementary to the biomarker, at least 75% complementary to the biomarker, at least 80% complementary to the biomarker, at least 85% complementary to the biomarker, at least 90% complementary to the biomarker, at least 95% complementary to the biomarker, at least 96% complementary to the biomarker, at least 97% complementary to the biomarker, at least 98% complementary to the biomarker, or at least 99% complementary to any of the therapeutic targets discussed above. In other embodiments, bases 14-20 from the 3' terminus (the putative seed region of the guide strand) has at least 90% complementarity to the 3' UTR of an mRNA sequence that encodes at least a portion of a subunit of calcineurin (e.g., PPP3Ca, PPP3CB, PPP3CC, PPP3R1 , PPP3R2) or HDAC2.
[00130] In certain embodiments, Cond-siRNAs that inhibit maladaptive hypertrophy are Cond-siRNAs that detect any biomarker from list A and target any member of list B in Table 2 below
[00131] Table 2
[00132] Thus, according to some embodiments, the Cond-siRNA described herein may have a sensor strand that is mostly or completely complementary to a sequence of the RNA transcripts corresponding to biomarkers listed in A, and a guide strand that targets a member of list B in the manner described above.
[00133] In other embodiments, the sensor strand includes one of the sequences in Table 3 below:
[00134] In other embodiments, a Cond-siRNA for treating cardiac hypertrophy includes a core strand designed to connect the sensor to the guide strand according a method described above. IN certain aspects the core strand includes one of the sequences in Table 4 below:
[00135] In some embodiments, the core strands above include C3 spacer linkers, where indicated, but any suitable linker may be used.
[00136] In certain embodiments, a Cond-siRNA for treating cardiac hypertrophy is a construct that includes a guide strand, core strand, and sensor strand as indicated in Table 5 below (also see Figs. 16-17):
[00137] In other embodiments, the conditional siRNA complex may comprise any combination of one sensor strand, one guide strand, and one core strand selected from Tables 1 , 3, and 4, respectively. Additional embodiments of the conditional siRNA complex showing the full complex may be found in Appendix A, which is attached hereto.
[00138] Further, as described in the examples below, several mRNA and miRNA transcripts were screened under different pro-hypertrophic conditions both in vivo and in vitro, to assist with designing cond-siRNA complex strands.
Methods of Treatment
[00139] The cond-siRNA complexes described above may be used in methods to treat cardiac hypertrophy. Thus, in some embodiments, a method for treating cardiac hypertrophy is disclosed herein, wherein the method includes a step of administering to a subject a therapeutically effective amount of one or more of the cardiac hypertrophy-related cond-siRNAs described above. As disclosed herein, the subject may be any human or other animal suffering from post-MI cardiac hypertrophy, or any other type of cardiac hypertrophy.
[00140] "Treating" or "treatment" of a condition may refer to preventing the condition, slowing the onset or rate of development of the condition, reducing the risk of developing the condition, preventing or delaying the development of symptoms associated with the condition, reducing or ending symptoms associated with the condition, generating a complete or partial regression of the condition, or some combination thereof.
[00141] The methods for treating cardiac hypertrophy include administering a therapeutically effective amount of a therapeutic composition. An "effective amount," "therapeutically effective amount" or "effective dose" is an amount of a composition (e.g., a therapeutic composition or agent) that produces a desired therapeutic effect in a subject, such as preventing or treating a target condition or alleviating symptoms associated with the condition. The precise therapeutically effective amount is an amount of the composition that will yield the most effective results in terms of
efficacy of treatment in a given subject. This amount will vary depending upon a variety of factors, including but not limited to the characteristics of the therapeutic compound (including activity, pharmacokinetics, pharmacodynamics, and bioavailability), the physiological condition of the subject (including age, sex, disease type and stage, general physical condition, responsiveness to a given dosage, and type of medication), the nature of the pharmaceutically acceptable carrier or carriers in the formulation, and the route of administration. One skilled in the clinical and pharmacological arts will be able to determine a therapeutically effective amount through routine experimentation, namely by monitoring a subject's response to administration of a compound and adjusting the dosage accordingly. For additional guidance, see Remington: The Science and Practice of Pharmacy 21 st Edition, Univ. of Sciences in Philadelphia (USIP), Lippincott Williams & Wilkins, Philadelphia, PA, 2005.
[00142] In some embodiments, one or more cond-siRNAs may be used alone or as part of a pharmaceutical composition for treating cardiac hypertrophy. Thus, in some embodiments, a pharmaceutical composition comprising any one or more of the cardiac hypertrophy-related Cond-siRNAs described above is disclosed. The therapeutic compositions may also include one or more pharmaceutically acceptable carriers. A "pharmaceutically acceptable carrier" refers to a pharmaceutically acceptable material, composition, or vehicle that is involved in carrying or transporting a compound of interest from one tissue, organ, or portion of the body to another tissue, organ, or portion of the body. For example, the carrier may be a liquid or solid filler, diluent, excipient, solvent, or encapsulating material, or some combination thereof. Each component of the carrier must be "pharmaceutically acceptable" in that it must be compatible with the other ingredients of the formulation. It also must be suitable for contact with any tissue, organ, or portion of the body that it may encounter, meaning that it must not carry a risk of toxicity, irritation, allergic response, immunogenicity, or any other complication that excessively outweighs its therapeutic benefits.
[00143] The therapeutic compositions described herein may be administered by any suitable route of administration. A route of administration may refer to any administration pathway known in the art, including but not limited to aerosol, enteral, nasal, ophthalmic, oral, parenteral, rectal, transdermal (e.g., topical cream or
ointment, patch), or vaginal. "Transdermal" administration may be accomplished using a topical cream or ointment or by means of a transdermal patch. "Parenteral" refers to a route of administration that is generally associated with injection, including infraorbital, infusion, intraarterial, intracapsular, intracardiac, intradermal, intramuscular, intraperitoneal, intrapulmonary, intraspinal, intrasternal, intrathecal, intrauterine, intravenous, subarachnoid, subcapsular, subcutaneous, transmucosal, or transtracheal. In one embodiment the cardiac hypertrophy-related cond-siRNAs or therapeutic compositions thereof is administered by intracardial injection (Fig. 18) to ensure local delivery to the heart tissue.
[00144] Having described the invention with reference to the embodiments and illustrative examples, those in the art may appreciate modifications to the invention as described and illustrated that do not depart from the spirit and scope of the invention as disclosed in the specification. The examples are set forth to aid in understanding the invention but are not intended to, and should not be construed to limit its scope in any way. The examples do not include detailed descriptions of conventional methods. Such methods are well known to those of ordinary skill in the art and are described in numerous publications. Further, all references cited above and in the examples below are hereby incorporated by reference in their entirety, as if fully set forth herein. All appendices A-E submitted herewith constitute part of the complete disclosure.
EXAMPLES
[00145] Example 1 : Prohypertrophic gene and miRNA expression screening for selection of sensor candidates for treatment of cardiac hypertrophy
[00146] Genes and miRNA that are upregulated under pathological cardiac hypertrophic conditions were screened for differential expression in mice and in NRVM under various conditions to determine which molecules are suitable candidates for use as a biomarker target for designing a sensor strand.
[00147] Differential gene expression in tissues of wild type mice in homeostasis. Suitable pathological biomarker candidates should be differentially expressed in the heart as compared to other tissues to minimize off target effects. Several genes that are upregulated in pathological cardiac hypertrophy (DDiT4L, MYH7, ANP, BNP), as
well as transcription factors that control their expression (MEF2C, Myocardin), were measured in normal heart, liver, lung, kidney, skeletal muscle, and brains of wt mice. Fig. 19. Several miRNA were also measured, as shown in 38
[00148] Differential gene and miRNA expression in NRVM under hypoxic conditions. Suitable pathological biomarker candidates (ANP, BNP, MYH7, MEF2C, Myocardin, DDiT4L, and miRNAs) were screened in NRVM for differential expression under hypoxic conditions as shown in Figs. 20-21 .
[00149] This experiment mimics oxygen deprivation (hypoxia) during myocardial infarction (Ml). NRVM cells were prepared cultured on standard petri dish substrates using techniques known to those who are skilled in the art [1 ,2]. Cultured NRVM cells are then exposed to hypoxic conditions (0.2% O2 atmosphere) for 24 hours at 37C. This was followed by incubation for 12 hours under normal oxygen conditions (95% ambient air/5% C02).
[00150] Following incubation, NRVM cells were harvested and total RNA was extracted using protocols and kits standard in the art [3]. The messenger RNAs ANP, BNP, Myh7, MEF2C, Myocardin, DDiT4L, and the microRNAs mir-23a-3p, mir-125b- 5p, mir-199b-5p, mir-208 and mir-195 were quantified by quantitative RT-PCR using standard methods appropriate for mRNAs4 and miRNAs [5].
[00151] Results are presented in Figs. 20-21 as fold change in copy numbers of mRNA or miRNA present in NRVM cells exposed to hypoxia compared to those incubated for 36 hours under normal oxygen conditions.
[00152] The results of this experiment show that ANP, BNP, DDiT4L, mir-23a- 3p, and mir-199b-5p, were over expressed by more than 4X under hypoxic conditions.
[00153] Differential gene and miRNA expression in NRVM after phenylephrine treatment. Expression of miRNAs, and of ANP, BNP, MYH7, MEF2C, Myocardin, DDiT4L was measured in phenylephrine (PE) treated as compared to untreated NRVM.
[00154] Phenylephrine stimulation is a standard method for studying hypertrophy in cardiomyocytes [6,7]. In this experiment, NRVM cells were prepared by standard protocols. Phenylephrine was then added to the culture media to 50 μΜ concentration for 24 hours. After 24 hours, cells were harvested for RNA isolation
and analysis as described above.
[00155] The results of the experiment show that ANP, BNP, Myh7, myocardin mRNA were overexpressed by more than 10X after PE stimulation (Fig. 22), and that miRNAs, mir-23a-3p, mir-125b-5p, and mir-199b-5p were overexpressed by more than 4X after PE stimulation (Fig. 23).
[00156] Differential gene expression in mouse models of heart failure. Expression of ANP, BNP, MYH7, MEF2C, Myocardin, DDiT4L was measured in heart tissue of mice with non-ischemic heart failure in a thoracic aortic constriction (TAC) model and of mice with ischemic heart failure in an ischemia/reperfusion (l/R) model as compared to sham-treated mice.
[00157] In experiments related to the ischemia / reperfusion (l/R) model, mice underwent procedures to simulate ischemic (deprivation of blood flow) heart failure. At day zero, mice were subject to ischemic heart failure via surgical clamping of a coronary artery for 20 min, followed by reperfusion. After 28 days, the experimental mice were sacrificed. Heart tissue was harvested and RNA was isolated using standard protocols as described above. mRNA and miRNAs were quantified using RT-PCR as described above. The mRNA and miRNA in the treated mice were compared with those found in control mice who were subjected to a sham procedure that did not involve clamping of the coronary artery to induce ischemia / reperfusion.
[00158] The results show that all mRNAs tested were overexpressed by more than 10X in mice with ischemic HF (Fig. 24). ANP and myh7 were overexpressed by more than 1000X (Fig. 24). And for miRNAs, only mir-23a-3p was significantly overexpressed, by ~15X (Fig. 25).
[00159] In experiments related to the non-ischemic HF model (TAC), mice underwent thoracic aortic constriction (TAC) procedures to induce non-ischemic heart failure. Briefly the upper thorax of mice constricted to reduce blood flow through the aorta for 28 days. This induced non-ischemic heart failure. After 28 days, the animals were sacrificed and heart tissue was harvested. RNA was isolated using standard protocols as described above. mRNA and miRNAs were quantified using RT-PCR as described above. The mRNA and miRNA in the treated mice were compared with those found in control mice who were subjected to a sham procedure that did not involve aortic constriction.
[00160] The results show that all mRNAs tested were overexpressed by more than 20X in the constricted mice (Fig 24). ANP and myh7 were overexpressed by more than 1000X (Fig 24). For miRNAs, all tested miRNAs were overexpressed by more than 10X. (Fig 25). And, mir-23a-3p was overexpressed by ~80X (Fig 25).
[00161] Example 2: Design of ANP:Calcineurin Cond-siRNA
[00162] The 5' UTR and coding sequences of messenger RNAs are frequently occupied by mRNA binding proteins or transiting ribosomes. In mammals, miRNAs commonly bind at 3' UTR sites to regulate mRNAs. Thus, binding sites in the 3' UTR may be more accessible than sites in the 5' UTR and the coding sequence of region of mRNAs.
[00163] When designing sensors to detect mRNAs, it is desirable to start with sites in the 3' UTR. If such sites cannot be found or there are other reasons (such as the need to detect a particular important sequence in the coding region or the 5' UTR), then sensors can be designed to those sites.
[00164] ANP 3'UTR sequencing results. Murine models were used to test the ability of ANP : Calcineurin Cond-siRNAs to inhibit phenylephrine induced cardiomyocytes hypertrophy. Thus, an ANP sensor was designed to target rat ANP.
[00165] To design the ANP sensor, the 3' UTR of ANP mRNA found in neonatal rat ventricular cardiomyocytes cells was sequenced by extracting RNA using standard procedures, amplifying the 3' UTR via RT-PCR, and submitting the amplified DNA for sequencing by the Massachusetts General Hospital's DNA sequencing core.
[00166] The sequenced DNA is as follows (N indicates indetermined base)
ANP 3'UTR sequencing results from CCIB DNA Core (MGH)
>293387-293389_D10_1_074_nppa_3_UTR_Ane.seq
> this is the forward sequence:
TC AGCC AN NNNNNNNN GAGCAG ATCGCAAAAG ATCCCAAGGCCTTGCG
GTGTGTCACACAGCTTGGTCGCATTGCCACTGAGAGGTGGTGAATACCC
TCCTGGAGCTGCAGCTTCCTGTCTTCATCTATCACGATCGATGTTAAGTG
TAGATGAGTGGTTTAGTGAGGCCTTACCTCTCCCACTCTGCATATTAAGG
TAGATCCTCACCCNNNNANNANNNNCNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNN (SEQ ID NO:27)
[00167] Using NCBI BLAST, it was determined that the central sequence
[00168] GAGCAGATCGCAAAAGATCCCAAGGCCTTGCGGTGTGTCACACA GCTTGGTCGCATTGCCACTGAGAGGTGGTGAATACCCTCCTGGAGCTGCAGC
TTCCTGTCTTCATCTATCACGATCGATGTTAAGTGTAGATGAGTGGTTTAGTGAG GCCTTACCTCTCCCACTCTGCATATTAAGGTAGATCCTCACCC (SEQ ID NO:28)
[00169] Is 99% homologous to rattus norvegicus nppa mRNA 3' UTR and 92% homologous to mus musculus nppa mRNA 3' UTR.
[00170] Generation of sensor candidates:
[00171] To generate candidate sensor strands, the reverse complement of the above sequence was determined.
[00172] NNNNNNNN NNNNNNNNNNNNNNNNNNNNNNGNNNNTNNTNNNN GGGTGAGGATCTACCTTAATATGCAGAGTGGGAGAGGTAAGGCCTCACTAAAC CACTCATCTACACTTAACATCGATCGTGATAGATGAAGACAGGAAGCTGCAGCT CCAGGAGGGTATTCACCACCTCTCAGTGGCAATGCGACCAAGCTGTGTGACAC ACCGCAAGGCCTTGGGATCTTTTGCGATCTGCTCNN N N N N N N NTGGCTGA
(SEQ ID NO:29)
[00173] Then, a Python script was used to generate all possible consecutive 31 nt segments (8 nt for toehold, plus 23 nt for duplex region) of the central bold sequence (rat nppa 3 prime utr sensor.xlsx). These are the initial possible sensor sequences for this region (T needs to be converted to U). The python script is attached herewith as Appendix B.
[00174] The Python code that was generated performed following analyses for each sensor sequence: (i) add one demerit point for each occurrence of three or more consecutive Gs (eg: GGG, GGGG, GGGGG); (ii) add one demerit point for each occurrence of four or more consecutive A/Ts (eg: AT AT, AAAA, TTTT, TTAT, etc), (iii) calculate the percent of the sequence composed of G or Cs; and (iv) calculate the percent of the sequence accounted for by the most numerous three bases (e.g., out of A, G, C, T, if A, G and T are the most numerous in the sequence, what percent of bases are A, G or T).
[00175] Then the list of possible sensors were ranked by the following criteria,
in order of importance: (i) least number of demerit points, preferably 0' (ii) highest 3 letteredness; and (iii) highest GC content (see, e.g. , Figs. 41 -42)
[00176] The sequences on the ranked list were screened one by one for two qualities: (i) the hypothetical sensor duplex has high stability and correctness according to standard RNA secondary structure prediction codes; and (ii) the sensor strand has few significant matches to RNA transcripts other than nppa mRNA in rats and mice that extends from the toehold region (8 bases at 3') into more than 50% of the duplex region (bases 9 to 31 from the 3').
[00177] The following sensor sequence was identified as favorable:
[00178] ATTCACCACCTCTCAGTGGCAATGCGACCAA (SEQ ID NO 30)
[00179] To further improve the thermodynamic stability of the sensor, the first base was changed at the 5' from an A to a C. This gives the following sensor sequence:
[00180] Sensor (mutated base underlined): CUUCACCACCU CUCAGUGGCAAU GCGACCAA (SEQ ID NO:31 )
[00181] On nupack, the hypothetical sensor duplex constructed from this sequence showed 8 thermodynamic stability, with an equilibrium concentration of 0.97nM. Also see Fig. 26.
[00182] NCBI BLAST of the sensor sequence using "somewhat similar" settings showed no significant sequence matches other than to mouse and rat ANP (nppa) mRNA.
[00183] Calcineurin is a heterodimer composed of one of three catalytic isozymes (PPP3CA, PPP3CB, PPP3CC) and one of two regulatory subunits (PPP3R1 and PPP3R2). To target Calcineurin, a guide sequence against the PPP3CA subunit of Calcineurin was identified that targets a widely conserved target site present in human, rat, and mice: UGUUGU UUGGCUU UUCCUG UU (SEQ ID NO:32)
[00184] The segment CGAG was then added to the 5' end to create a 23 nt guide strand, and then generated the core strand according to the previous stated rules. Those sequences are shown below:
Guide: CG AG UGUUGU UUGGC UU UUCCUG UU (SEQ ID NO: 1 1 )
Sensor (mutated base underlined): CUUCACCACCU CUCAGUGGCAAU GCGACCAA (SEQ ID NO:33)
Core: AGGUGGUGAAG-linker-CAGGAAAAGCCAAACAACACUCG-linker- AUUGCCACUGAG (SEQ ID NO: 19)
[00185] The guide strand plus the core strand showed good thermodynamic stability as predicted by Nupack (Fig. 27)
[00186] Then, chemical modifications were added according to schemes previously disclosed in U.S. Patent No. 9,725,715, the subject matter of which is incorporated by reference herein. The final sequences are shown below:
Sensor: /5Sp9/ mC*+T*mU*mC*+A*mC*mC*+A*mC*+C*mU*mC*mU*+C*mA *mG*+T*mG*+G*mC*mA*+A*mll *mG*mC*+G*mA*mC*mC*+A*mA
*/3AmMO/ (SEQ ID NO:34)
Guide: /5AmMC6/+C*+G rArG rUrGrUrUrGrU rUrUrGrGrC rUrU
rUrUrCrCrUrG rUrU (SEQ ID NO:35)
Core: inArGmGrUrGrGrUrGrArArG /iSpC3/ mC*+A*
mGrGrArArArArGrCrCrArArArCrArArCrArCrUrC*mG /iSpC3/
rArUrUrGrCrCrArCrUrGrAmG (SEQ ID NO:36)
[00187] The nucleotides and modifications are indacted as follows: (1 ) +A, +T, +C, +G are LNA; (2) mA, mU, mC, mG are 2'-0-methyl; (3) rA, rU, rC, rG are RNA; (3) * denotes phosphorothioate backbone connection; (4) /5Sp9/ is a tri-ethylene glycol linker; (5) /iSpC3/ is an internal C3 spacer; (6) /5AmMC6/ is a 5' primary amine modification on a C6 linker; (7) /3AmMO/ is a 3' primary amine modification.
[00188] EXAMPLE 3: Design of mir-23a-3p:Calcineurin Cond-siRNA
[00189] An mir-23a-3p sensor was designed as follows. The mir-23a entry for miRbase is found at the following URL:http://www.mirbase.org/cgi- bin/mirna entry. pl?acc= Ml 0000079
[00190] The sequence of mir-23a-3P sequence, 5'-3' is:
>hsa-miR-23a-3p MIMAT0000078
AUCACAUUGCCAGGGAUUUCC (SEQ ID NO:37)
[00191] The reverse complement of mir-23a-3p is
GGAAAUCCCUGGCAAUGUGAU (SEQ ID NO:38)
[00192] The Cond-siRNA sensor to sense a microRNA input is that the microRNA guide strand is usually only 21 nt long, whereas the Cond-siRNA sensor's duplex region is usually 23 nucleotides long and the toehold is usually 5 to 8 nucleotides long. This means that a microRNA guide strand is not long enough to completely displace the sensor strand from the core strand.
[00193] This issue was solved by configuring the sensor strand so that the guide strand will displace the sensor from base-pairing with the 3' overhang of the core strand and the last few bases at the 5' terminus of 5' overhang of the core strand.
[00194] This way, the 3' overhang of the core strand becomes unprotected and is degraded. The 5' terminus of the 5' overhang also becomes unprotected and subject to degradation, leading to eventual degradation of the entire 5' overhang. This then allows the sensor strand to completely dissociate from the RNAi region.
[00195] Thus, assuming a 21 nt miRNA guide strand, some of the possible geometries for the sensor strand, starting from the 3' end, are shown in Table 6 below:
[00196] In Table 6, scheme A gives a 23 bp sensor duplex and allows the miRNA to displace up to 4 terminal bases of the 5' core strand segment, scheme B, 23 bp sensor, 3 terminal bases displaced, scheme C, 23 bp sensor, 4 terminal bases displaced, scheme D, 23 bp sensor, 5 terminal bases displaced, scheme E, 22 bp
sensor, 5 terminal bases displaced, and scheme F, 22 bp sensor, 3 terminal bases displaced
[00197] Calcineurin Sensor design:
[00198] Scheme F from Table 6 was used to design the following calcineurin sensor: 5' CGAAGAACGGAAAUCCCUGGCAAUGUGAU 3' (SEQ ID N0 39)
[00199] A sequence: CGAAGAAC (SEQ ID NO:40) is added to the 5' of the sensor. This sequence is designed to improve thermodynamic stability of the sensor duplex, minimize secondary structure in the sensor strand, and minimize overlap with non-mir23a-3p transcripts.
[00200] According to NCBI BLAST, the sensor has no significant unintended matches to human RNA transcripts, and there are only a few significant unintended matches to mouse RNA transcripts.
[00201] The same Calcineurin PPP3CA siRNA guide identified for the ANP : Calcineurin construct above was used and the core strand sequence was generated using the algorithms described herein.
Core: UCCGUUCUUCG-linker-CAGGAAAAGCCAAACAACACUCG-linker- UGCCAGGGAUU (SEQ ID NO:41 )
[00202] The guide strand plus the core strand showed good thermodynamic stability as predicted by Nupack (Fig. 28), as did the hypothetical sensor duplex (Fig. 29).
[00203] Thus, the final fully modified sequences are as follows:
Calcineurin guide: C6Amine +C*+G rArG rUrGrUrUrGrll rUrUrGrGrC rUrU rUrUrCrCrUrG rUrU (SEQ ID NO:42)
Mir-23a-3p sensor using a 22 bp sensor duplex with LNA pattern:
/5Sp9/ mC*+G*mA*+A*mG*mA+A*mC *+G*mG*mA*
+A*mA*mU*mC*mC*+C*mU*mG*+G*mC*mA *+A*mU*mG*+T*mG*+A*+T */3AmMO/ (SEQ ID NO:43)
Core strand :mUrCrCrGrUrUrCrUrUrCrG /iSpC3/
mC*+A*mGrGrArArArArGrCrCrArArArCrArArCrArCrUrC*mG /iSpC3/ rUrGrCrCrArGrGrG mA rU mU (SEQ ID NO:44)
[00204] The nucleotides and modifications are indacted as follows: (1 ) +A, +T, +C, +G are LNA; (2) mA, mU, mC, mG are 2'-0-methyl; (3) rA, rU, rC, rG are RNA; (3) * denotes phosphorothioate backbone connection; (4) /5Sp9/ is a th-ethylene glycol linker; (5) /iSpC3/ is an internal C3 spacer; (6) /5AmMC6/ is a 5' primary amine modification on a C6 linker; (7) /3AmMG7 is a 3' primary amine modification.
[00205] EXAMPLE 4: Synthesis and testing of Cond-siRNA constructs
[00206] To demonstrate use of Cond-siRNAs to inhibit hypertrophy of cardiomyocytes, Cond-siRNAs were designed and synthesized to detect murine ANP or mir-23a-3p and inhibit calcineurin. The constructs are shown in Figures 16 and 17. All strands were purchased from a commercial oligonucleotide vendor (Exiqon Inc, now a part of Qiagen).
[00207] Assembly and purification. Sensor, core, and guide strands were mixed at 1 .0: 1 .1 : 1 .0 ratios at 50 nM to 1 uM strand concentrations and underwent thermal annealing in 1 x PBS buffer (80C for 30 seconds followed by constant temperature incubation at 50C to 60C for ~1 hour followed by cooling to room temperature).
[00208] Where purification was desired, constructs were annealed at 500 nM, loaded at 20 uL per well in 10% non-denaturing PAGE. Run in 1xTBE buffer at 120V for 90 min. The correct bands were excised. The Cond-siRNA constructs were then extracted via the crush and soak method using standard RNA isolation kits.
[00209] Figure 30 shows an example gel where Cond-siRNAs were assembled and purified.
[00210] Dual lucif erase assays of mir-23a-3p : calcineurin Cond-siRNA (Figure 31 ). For this assay, the Cond-siRNA described above was assessed for its ability of to keep RNAi activity OFF in the absence of the correct biomarker and switching RNAi ON in the presence of RNA transcripts bearing the mir-23a-3p sequence. For this test, unpurified mir-23a-3p : calcineurin Cond-siRNAs was co-transfected at the indicated concentrations into human Hek 293 cells, along activator and dual luciferase plasmids.
[00211] The activator plasmids expressed either a null transcript, a transcript with an incorrect activator, the 21 base mir-23a-3p sequence, or a longer sequence that was complementary to the entire sensor strand.
[00212] The dual luciferase plasmid encoded Firefly luciferase as the control and a Renilla luciferase with the calcineurin target site in its 3' UTR as the target of RNAi.
[00213] The results show that this Cond-siRNA had significantly increased RNAi activity against the calcineurin target when either the mir-23a-3p sequence or the fully matching sequence was expressed. Fig. 31 . Thus, this construct should be able to activation RNAi activity against calcineurin in the presence of mir-23a-3p.
[00214] in vitro experiment for purified ANP : calcineurin Cond-siRNA in NRVM cells under PE stimulation. For this experiment, it was tested whether the murine ANP : calcineurin Cond-siRNA could detect overexpression of ANP upon phenylephrine (PE) stimulation, and activate RNAi knockdown against calcineurin.
[00215] The biological effects of ANP : calcineurin against murine biomarkers and targets is tested because there are no suitable human models to test against. The biological effect of this murine oriented Cond-siRNA should be representative of biological effects that Cond-siRNA configured for humans would have.
[00216] For this experiment, NRVM cells were incubated using standard protocols under normal conditions (95% air, 5% C02, 37C). The purified ANP : calcineurin Cond-siRNA was transfected at 20 nM concentration into NRVM cells using RNAiMax. The transfected cells were incubated for 24 hours. PE was then added to the media to 50 μΜ final concentration. After a further 48 hours, cells were harvested and stained or processed for RNA isolation.
[00217] The results for RT-PCR quantitation of calcineurin mRNA are shown in Figure 32. For each cohort (untreated and PE treated cells), the level of calcineurin mRNA observed in cells transfected with scrambled siRNA (negative control) was normalized to 1 .0. In the untreated cohort, cells transfected with ANP:Calcineurin Cond-siRNA had no detectable knockdown of calcineurin. This means that, as intended, the Cond-siRNA has very little RNAi activity in normal cells.
[00218] In cells treated with PE, the Cond-siRNA activated RNAi, and reduced calcineurin mRNA levels by ~ 50% compared with levels seen in cells transfected with the scrambled siRNA control. This shows that the ANP : calcineurin Cond- siRNA can detect overexpression of ANP mRNA, and respond with RNAi inhibition of calcineurin as intended.
[00219] The results of imaging of the treated and untreated cells by fluorescence microscopy are shown in Figure 33. The results show that cells treated with purified ANP : calcineurin Cond-siRNAs underwent less hypertrophy than cells treated with scrambled siRNA. Furthermore, the effects of treatment with Cond- siRNAs was similar to treatment with the positive control (commercial, non- conditional calcineurin siRNA).
[00220] The results of cell size quantitation using fluorescence microscopy are shown in Figure 34. The results show that PE stimulation resulting in the increase in the average cell size from -750 μιη2 to -1300 μιη2 in cells treated with the negative control scrambled siRNA. However, in cells treated with the Cond-siRNA, average cell size increased from -750 μιη2 to -900 μιη2, and was not statistically significant. This result is similar to the non-conditional, commercial calcineurin siRNA.
[00221] The above results show that the ANP : Calcineurin Cond-siRNA has low background RNAi activity, can detect and respond to PE stimulation of NRVM cells, and has significant biological effects on reducing hypertrophy of NRVM cells.
[00222] Example 5: Exemplary guide and sensor strand sequences
[00223] Below are examples of automatically generating core strand
sequences from guide and sensor strand sequences. These have 23 bp sensor duplexes with 8 base toeholds
[00224] Example 5a, randomly chosen human/rat PPP3CA mRNA guide paired with randomly chosen human NPPA sensor
[00225] Cond-siRNA Guide: CCAC UUUACCAGCAUCUCAGUCAUU
[00226] Cond-siRNA Sensor:
GGAGAGGCGAGGAAGUCACCAUCAAACCACU
[00227] Core is: CUCGCCUCUCC UGACUGAGAUGCUGGUAAAGUGG GAUGGUGACUUC
[00228] Example 5b, human/rat PPP3CA mRNA guide above paired with randomly chosen human NPPB sensor
[00229] Cond-siRNA Guide: CCAC UUUACCAGCAUCUCAGUCAUU
[00230] Cond-siRNA Sensor:
GGAAUCAGAAGCAGGUGUCUGCAGCCAGGAC
[00231] Core is: CUUCUGAUUCC UGACUGAGAUGCUGGUAAAGUGG UGCAGACACCUG
[00232] Example 5c, human/rat PPP3CA mRNA guide above paired with randomly chosen human Myh7 sensor
[00233] Cond-siRNA Guide: CCAC UUUACCAGCAUCUCAGUCAUU
[00234] Cond-siRNA Sensor:
CCAAGGAGCUGUUACACAGGCUCCAGCAUGG
[00235] Core is: CAGCUCCUUGG UGACUGAGAUGCUGGUAAAGUGG GAGCCUGUGUAA
[00236] Example 5d, randomly chosen human/rat HDAC2 mRNA guide paired with human NPPA sensor from example 1
[00237] Cond-siRNA Guide: CCAC UUCAUCACAAGCUAUCCGCUU
[00238] Cond-siRNA Sensor:
GGAGAGGCGAGGAAGUCACCAUCAAACCACU
[00239] Core is: CUCGCCUCUCC GCGGAUAGCUUGUGAUGAAGUGG GAUGGUGACUUC
[00240] Example 5e, randomly chosen human/rat HDAC2 mRNA guide above paired with human NPPB sensor from example 2
[00241] Cond-siRNA Guide: CCAC UUCAUCACAAGCUAUCCGCUU
[00242] Cond-siRNA Sensor:
GGAAUCAGAAGCAGGUGUCUGCAGCCAGGAC
[00243] Core is: CUUCUGAUUCC GCGGAUAGCUUGUGAUGAAGUGG UGCAGACACCUG
[00244] Example 5f, randomly chosen human/rat HDAC2 mRNA guide above paired with human Myh7 sensor from example 3
[00245] Cond-siRNA Guide: CCAC UUCAUCACAAGCUAUCCGCUU
[00246] Cond-siRNA Sensor:
CCAAGGAGCUGUUACACAGGCUCCAGCAUGG
[00247] Core is: CAGCUCCUUGG GCGGAUAGCUUGUGAUGAAGUGG GAGCCUGUGUAA
[00248] In the next examples, we reuse the guide from examples 1 -6, but choose miRNA sensors. The sensors are configured as 22 bp duplexes with 7 base overhangs and symmetric 1 1 base core strand overhangs
[00249] Example 5g, randomly chosen human/rat PPP3CA mRNA guide paired with mir-23a-3p sensor
[00250] Cond-siRNA Guide: CCAC UUUACCAGCAUCUCAGUCAUU
[00251] Cond-siRNA Sensor: CGAAGAAC GGAAAUCCCUGGCAAUGUGAU
[00252] Core is: UCCGUUCUUCG UGACUGAGAUGCUGGUAAAGUGG UGCCAGGGAUU
[00253] Example 5h, human/rat PPP3CA mRNA guide above paired with mir- 125b-5p sensor
[00254] Cond-siRNA Guide: CCAC UUUACCAGCAUCUCAGUCAUU
[00255] Cond-siRNA Sensor: CGACAGU UCACAAGUUAGGGUCUCAGGGA
[00256] Core is: GUGAACUGUCG UGACUGAGAUGCUGGUAAAGUGG GACCCUAACUU
[00257] Example 5i, human/rat PPP3CA mRNA guide above paired with mir- 195b-5p sensor
[00258] Cond-siRNA Guide: CCAC UUUACCAGCAUCUCAGUCAUU
[00259] Cond-siRNA Sensor: CCUGAA GAACAG AU AG U C U AAACAC U GGG
[00260] Core is: UGUUCUUCAGG UGACUGAGAUGCUGGUAAAGUGG UUUAGACUAUC
[00261] Example 5j, randomly chosen human/rat HDAC2 mRNA guide paired with mir-23a-3p sensor
[00262] Cond-siRNA Guide: CCAC UUCAUCACAAGCUAUCCGCUU
[00263] Cond-siRNA Sensor: CGAAGAAC GGAAAUCCCUGGCAAUGUGAU
[00264] Core is: AACAGCUCCUUGG GCGGAUAGCUUGUGAUGAAGUGG GGAGCCUGUGU
[00265] Example 5k, randomly chosen human/rat HDAC2 mRNA guide above paired with mir-125b-5p sensor
[00266] Cond-siRNA Guide: CCAC UUCAUCACAAGCUAUCCGCUU
[00267] Cond-siRNA Sensor: CGACAGU UCACAAGUUAGGGUCUCAGGGA
[00268] Core is: UCCGUUCUUCG GCGGAUAGCUUGUGAUGAAGUGG UGCCAGGGAUU
[00269] Example 5I, randomly chosen human/rat HDAC2 mRNA guide above paired with mir-195b-5p sensor
[00270] Cond-siRNA Guide: CCAC UUCAUCACAAGCUAUCCGCUU
[00271] Cond-siRNA Sensor: CCUGAA GAACAG AU AG U C U AAACAC U GGG
[00272] Core is: UGUUCUUCAGG GCGGAUAGCUUGUGAUGAAGUGG UUUAGACUAUC
[00273] Example 6: Exemplar siRNAs designed by a commercial siRNA automated design website
[00274] From: http://dharmacon.horizondiscovery.com/design-center/
[00275] For each category below, the design tool was tasked with designing siRNAs targeting the protein coding region of both the human and the rat mRNA. The top three candidates are shown. Cond-siRNA guides are made by adding 4 G/C rich bases to the 5' of the antisense strand.
[00276] Candidate siRNA guide strands sequences (antisense) and
corresponding target sites (sense) targeting both Human (NM_000944) and Rat (NM_017041 ) PPP3CA mRNA
[00277] Sense: 5' G.A.A.C.A.A.G.A.U.C.C.G.A.G.C.A.A.U.A.U.U 3'
[00278] Antisense: 5' U.A.U.U.G.C.U.C.G.G.A.U.C.U.U.G.U.U.C.U.U 3'
[00279] Cond-siRNA Guide: 5' CGAC
U.A.U.U.G.C.U.C.G.G.A.U.C.U. U.G.U.U.C.U.U 3'
[00280] Sense: 5' U.G.A.C.U.G.A.G.A.U.G.C.U.G.G.U.A.A.A.U.U 3'
[00281] Antisense: 5' U.U.U.A.C.C.A.G.C.A.U.C.U.C.A.G.U.C.A. U.U 3'
[00282] Cond-siRNA Guide: 5' CGAC
U.U.U.A.C.C.A.G.C.A.U.C.U.C.A.G.U.C.A.U.U 3'
[00283] Sense: 5' G.G.U.C.A.G.A.A.G.A.A.G.A.U.G.G.A.U.U.U.U 3'
[00284] Antisense: 5' A.A.U.C.C.A.U.C.U.U.C.U.U.C.U.G.A.C.C. U.U 3'
[00285] Cond-siRNA Guide: 5' CCAC
A.A.U.C.C.A.U.C.U.U.C.U.U.C.U.G.A.C.C.U.U 3'
[00286] Candidate siRNA guide strands sequences (antisense) and corresponding target sites (sense) targeting both Human (NM_001 142353) and Rat (NM_017042) PPP3CB mRNA
[00287] Sense: 5' G.C.U.A.U.A.G.A.A.U.G.U.A.C.A.G.A.A.A.U.U 3'
[00288] Antisense: 5' U.U.U.C.U.G.U.A.C.A.U.U.C.U.A.U.A.G.C.U.U 3'
[00289] Cond-siRNA Guide: 5' CGAC
U. U.U.C.U.G.U.A.C.A.U.U.C.U.A.U.A.G.C.U.U
[00290] Sense: 5' C.C.U.U.U.A.A.G.C.A.G.G.A.A.U.G.U.A.A.U. U 3'
[00291] Antisense: 5' U.U.A.C.A.U. U.C.C.U.G.C.U.U.A.A.A.G.G.U.U 3'
[00292] Cond-siRNA Guide: 5' GGAC
U. U.A.C.A.U.U.C.C.U.G.C.U.U.A.A.A.G.G.U.U
[00293] Sense: 5' G.C.A.A.U.U.G.G.C.A.A.G.A. U.G.G.C.A.A.U.U 3'
[00294] Antisense: 5' U.U.G.C.C.A.U.C.U.U.G.C.C.A.A.U.U.G.C.U.U 3'
[00295] Cond-siRNA Guide: 5' CCAC
U.U.G.C.C.A.U.C.U.U.G.C.C.A.A. U.U.G.C.U.U
[00296] Candidate siRNA guide strands sequences (antisense) and corresponding target sites (sense) targeting both Human (NM_001243974) and Rat (NM_134367) PPP3CB mRNA
[00297] Sense: 5' G.U.A.U.A.G.A.G.U.G. U.G.U.G.C.U.G.U.A.U.U 3'
[00298] Antisense: 5' U.A.C.A.G.C.A.C.A.C.A.C.U.C.U.A.U.A.C.U.U 3'
[00299] Cond-siRNA Guide: 5' CCAC
U.A.C.A.G.C.A.C.A.C.A.C. U.C. U.A.U.A.C.U.U 3'
[00300] Sense: 5' A.G.U.A.U.U.U.G.A.G.A.A.U.G.G.G.A.A.A.U.U 3'
[00301] Antisense: 5' U.U.U.C.C.C.A.U.U.C. U.C.A.A.A.U.A.C.U.U.U 3'
[00302] Cond-siRNA Guide: 5' CCAC
U. U.U.C.C.C.A.U.U.C.U.C.A.A.A.U.A.C.U.U.U 3'
[00303] Sense: 5' C.U.A.U.G. U.G.G.A.C.A.G.A.G.G.C.U.A.U.U.U 3'
[00304] Antisense: 5' A.U.A.G.C.C.U.C.U.G.U.C.C.A.C.A.U.A.G.U.U 3'
[00305] Cond-siRNA Guide: 5' CCAC
A.U.A.G.C.C.U.C.U.G.U.C.C.A.C.A.U.A.G.U.U 3'
[00306] Candidate siRNA guide strands sequences (antisense) and
corresponding target sites (sense) targeting both Human (NM_001527) and Rat (NM_053447) HDAC2 mRNA
[00307] Sense: 5' G.C.G.G.A.U.A.G.C.U.U.G.U.G.A.U.G.A.A.U. U 3'
[00308] Antisense: 5' U.U.C.A.U.C.A.C.A.A.G.C.U.A.U.C.C.G.C.U.U 3'
[00309] Cond-siRNA Guide: 5' CCAC
U.U.C.A.U.C.A.C.A.A.G.C.U.A. U.C.C.G.C.U.U 3'
[00310] Sense: 5' G.G.A.U.A. U.U.G.G.U.G.C.U.G.G.A.A.A.A.U.U 3'
[00311] Antisense: 5' U.U.U.U.C.C.A.G.C.A.C.C.A.A.U.A.U.C.C.U.U 3'
[00312] Cond-siRNA Guide: 5' CCAC
U. U.U.U.C.C.A.G.C.A.C.C.A.A.U.A.U.C.C.U.U 3'
[00313] Sense: 5' A.A.G.C.A.G.A.U.G.C.A.G.A.G.A.U.U.U.A.U. U 3'
[00314] Antisense: 5' U.A.A.A.U.C.U.C.U.G.C.A.U.C.U.G.C.U.U.U.U 3'
[00315] Cond-siRNA Guide: 5' CCAC
U.A.A.A.U.C.U.C.U.G.C.A.U.C.U.G.C.U.U.U.U 3'
[00316] Example 7: Example designs for miRNA sensor strands
[00317] Example designs for miRNA sensor strands are shown below.
[00318] miRNAs have highly conserved sequences across mammalian species. Therefore, we can design a single miRNA sensor for all test animals, including humans.
[00319] For each sequence, we first take the reverse complement of the guide
sequence, then add 8 bases to create a 29 nt sensor.
[00320] >hsa-miR-23a-3p MIMAT0000078
[00321] AUCACAUUGCCAGGGAUUUCC
[00322] > reverse complement
[00323] GGAAAUCCCUGGCAAUGUGAU
[00324] > Sensor, add 8 bases to make 29 mer
[00325] CGAAGAAC GGAAAUCCCUGGCAAUGUGAU
[00326] Nupack shows minimum secondary structure and no self-self base- pairing accept
[00327] >hsa-miR-125b-5p MIMAT0000423
[00328] UCCCUGAGACCCUAACUUGUGA
[00329] > reverse complement
[00330] UCACAAGUUAGGGUCUCAGGGA
[00331] > Sensor, add 7 bases to make 29 mer,
[00332] CGACAGU UCACAAGUUAGGGUCUCAGGGA
[00333] Use secondary structure prediction codes make sure that the secondary structure is relatively open. If not, change the added bases and try again
[00334] >hsa-miR-199b-5p MIMAT0000263
[00335] CCCAGUGUUUAGACUAUCUGUUC
[00336] > reverse complement
[00337] GAACAGAUAGUCUAAACACUGGG
[00338] > Sensor, add 6 bases to make 29 mer,
[00339] CCUGAA GAACAGAUAGUCUAAACACUGGG
[00340] Acceptably low secondary structure
[00341] Example 8: miRNAs
[00342] Additional miRNAs are shown below:
[00343] >rno-miR-23a-3p MIMAT0000792
[00344] AUCACAUUGCCAGGGAUUUCC
[00345] >hsa-miR-23a-3p MIMAT0000078
[00346] AUCACAUUGCCAGGGAUUUCC
[00347] >rno-miR-23a-3p MIMAT0000792
[00348] AUCACAUUGCCAGGGAUUUCC
[00349] >mmu-miR-125b-5p MIMAT0000136
[00350] UCCCUGAGACCCUAACUUGUGA
[00351] >hsa-miR-125b-5p MIMAT0000423
[00352] UCCCUGAGACCCUAACUUGUGA
[00353] >rno-miR-125b-5p MIMAT0000830
[00354] UCCCUGAGACCCUAACUUGUGA
[00355] >hsa-miR-199b-5p MIMAT0000263
[00356] CCCAGUGUUUAGACUAUCUGUUC
[00357] >mmu-miR-199b-5p MIMAT0000672
[00358] CCCAGUGUUUAGACUACCUGUUC
REFERENCES
1 Au - Graham, E. L , Au - Balla, C, Au - Franchino, H., Au - Melman, Y., Au - del Monte, F. & Au - Das, S. Isolation, Culture, and Functional Characterization of Adult Mouse Cardiomyoctyes. JoVE, e50289, doi:doi: 10.3791 /50289 (2013).
2 Paradis, A. N., Gay, M. S., Wilson, C. G. & Zhang, L. Newborn
Hypoxia/Anoxia Inhibits Cardiomyocyte Proliferation and Decreases Cardiomyocyte Endowment in the Developing Heart: Role of Endothelin-1 . PLOS ONE 10, e01 16600, doi: 10.1371/journal.pone.01 16600 (2015).
3 Xiao, J., Liu, H., Cretoiu, D., Toader, D. O., Suciu, N., Shi, J. , Shen, S., Bei, Y. , Sluijter, J. P. G., Das, S., Kong, X. & Li, X. miR-31 a-5p promotes postnatal cardiomyocyte proliferation by targeting RhoBTBI . Experimental &Amp; Molecular Medicine 49, e386, doi: 10.1038/emm.2017.150 (2017).
4 Nolan, T., Hands, R. E. & Bustin, S. A. Quantification of mRNA using real-time RT-PCR. Nature Protocols 1 , 1559, doi: 10.1038/nprot.2006.236 (2006).
5 Fiedler, S. D., Carletti, M. Z. & Christenson, L. K. in RT-PCR Protocols:
Second Edition (ed Nicola King) 49-64 (Humana Press, 2010).
6 Hartmann, H. A., Mazzocca, N. J., Kleiman, R. B. & Houser, S. R. Effects of phenylephrine on calcium current and contractility of feline ventricular myocytes. American Journal of Physiology-Heart and Circulatory Physiology 255, H 1 173-
H1 180, doi: 10.1 152/ajpheart.1988.255.5. H1 173 (1988).
7 Katanosaka, Y., Iwata, Y., Kobayashi, Y., Shibasaki, F., Wakabayashi, S. & Shigekawa, M. Calcineurin Inhibits Na+/Ca2+ Exchange in Phenylephrine-treated Hypertrophic Cardiomyocytes. Journal of Biological Chemistry 280, 5764-5772, doi: 10.1074/jbc. M410240200 (2005).
8 Sussman, M. A., Lim, H. W., Gude, N., Taigen, T., Olson, E. N., Robbins, J., Colbert, M. C, Gualberto, A. , Wieczorek, D. F. & Molkentin, J. D. Prevention of Cardiac Hypertrophy in Mice by Calcineurin Inhibition. Science 281 , 1690-1693, doi: 10.1 126/science.281 .5383.1690 (1998).
9 Tham, Y. K., Bernardo, B. C, Ooi, J. Y. Y., Weeks, K. L. & McMullen, J. R. Pathophysiology of cardiac hypertrophy and heart failure: signaling pathways and novel therapeutic targets. Archives of Toxicology 89, 1401 -1438,
doi: 10.1007/s00204-015-1477-x (2015).
10 Molkentin, J. D. , Lu, J.-R., Antos, C. L, Markham, B., Richardson, J., Robbins, J., Grant, S. R. & Olson, E. N. A Calcineurin-Dependent Transcriptional Pathway for Cardiac Hypertrophy. Cell 93, 215-228, doi:https://doi.org/10.1016/S0092- 8674(00)81573-1 (1998).
1 1 Cao, D. J., Wang, Z. V. , Battiprolu, P. K., Jiang, N., Morales, C. R., Kong, Y., Rothermel, B. A. , Gillette, T. G. & Hill, J. A. Histone deacetylase (HDAC) inhibitors attenuate cardiac hypertrophy by suppressing autophagy. Proceedings of the
National Academy of Sciences 108, 4123-4128, doi: 10.1073/pnas.1015081 108 (201 1 ).
12 Trivedi, C. M., Luo, Y., Yin, Z., Zhang, M., Zhu, W. , Wang, T., Floss, T., Goettlicher, M., Noppinger, P. R., Wurst, W., Ferrari, V. A., Abrams, C. S., Gruber, P. J. & Epstein, J. A. Hdac2 regulates the cardiac hypertrophic response by modulating Gsk3 activity. Nature Medicine 13, 324, doi: 10.1038/nm1552
https://www.nature.eom/articles/nm1552#supplementary-information (2007).
13 Liu, X., Xiao, J., Zhu, H., Wei, X., Piatt, C, Damilano, F., Xiao, C, Bezzerides, V., Bostrom, P., Che, L, Zhang, C, Spiegelman, Bruce M. & Rosenzweig, A. miR- 222 Is Necessary for Exercise-Induced Cardiac Growth and Protects against
Pathological Cardiac Remodeling. Cell Metabolism 21 , 584-595,
doi:https://doi.org/10.1016/j.cmet.2015.02.014 (2015).
14 Han, S.-P., Goddard III, W. A., Scherer, L. & Rossi, J. J. Signal activatable constructs and related components compositions methods and systems. USA patent US9725715B2 (2015).
15 Zadeh, J. N. , Steenberg, C. D., Bois, J. S., Wolfe, B. R., Pierce, M. B., Khan, A. R., Dirks, R. M. & Pierce, N. A. NUPACK: Analysis and design of nucleic acid systems. Journal of Computational Chemistry 32, 170-173, doi: 10.1002/jcc.21596 (201 1 ).
16 Jaramillo-Botero, A., Nielsen, R., Abrol, R., Su, J., Pascal, T., Mueller, J. & Goddard, W. Vol. 307 Topics in Current Chemistry (eds Barbara Kirchner & Jadran Vrabec) 1 -42 (Springer Berlin / Heidelberg, 2012).
17 Naito, Y. & Ui-Tei, K. in siRNA Design: Methods and Protocols (ed Debra J.
Taxman) 57-68 (Humana Press, 2013).
18 Boudreau, R. L, Spengler, R. M. & Davidson, B. L. Rational Design of Therapeutic siRNAs: Minimizing Off-targeting Potential to Improve the Safety of RNAi Therapy for Huntington's Disease. Mol Ther,
doi:http://www.nature.com/mt/journal/vaop/ncurrent/suppinfo/mt201 1 185s1 .html (201 1 ).
19 Sano, M., Sierant, M., Miyagishi, M., Nakanishi, M., Takagi, Y. & Sutou, S. Effect of asymmetric terminal structures of short RNA duplexes on the RNA interference activity and strand selection. Nucleic Acids Research 36, 5812-5821 , doi: 10.1093/nar/gkn584 (2008).
1 . Konstam MA, Kramer DG, Patel AR, Maron MS, Udelson JE. Left ventricular remodeling in heart failure: current concepts in clinical significance and assessment. JACC Cardiovasc Imaging. 201 1 ; 4(1 ): 98-108. doi: 10.1016/j.jcmg.2010.10.008.
2. Rij RPV. Virus meets RNAi. Symposium on Antiviral Applications of RNA Interference. EMBO Reports. 2008;9(8):725-729. doi: 10.1038/embor.2008.133.
3. J. N. Zadeh, C. D. Steenberg, J. S. Bois, B. R. Wolfe, M. B. Pierce, A. R. Khan, R. M. Dirks, N. A. Pierce. NUPACK: analysis and design of nucleic acid systems. J Comput Chem. 32: 170-173, 201 1 .
4. Jessup M, Brozena S. Heart Failure. New England Journal of Medicine. 2003; 348:2007-2018. doi: 10.1056/NEJMra021498.
Claims
1 . A conditional RNA-sensor complex comprising: a sensor strand comprising at least one toehold segment, wherein the toehold segment binds a pathological biomarker present in or overexpressed in a target cell; and a double stranded pro-RNA molecule comprising a guide strand comprising an RNA molecule that binds a therapeutic target molecule in the target cell; and a core strand comprising a first portion comprising a passenger strand that is fully or partially complimentary to and binds the guide strand; a second portion comprising a first protection segment that is fully or partially complimentary to and binds the sensor strand; and a first linker that joins a first end of the passenger strand to the first protection segment.
2. The conditional RNA-sensor complex of claim 1 , wherein the core strand
further comprises a third portion comprising a second protection segment that is fully or partially complimentary to and binds the sensor strand, and a second linker that joins a second end of the passenger strand to the second protection segment.
3. The conditional RNA-sensor complex of claim 1 or 2, wherein the toehold segment is an aptamer.
4. The conditional RNA-sensor complex of any of claims 1 -3, wherein the sensor strand is displaced from the double stranded pro-RNA molecule when the pathological biomarker binds the toehold segment and the resulting double
stranded pro-RNA molecule is a substrate for Dicer.
5. The conditional RNA-sensor complex of any of claims 1 -4, wherein the target cell is a cardiac myocyte.
6. The conditional RNA-sensor complex of claim 5, wherein the target cell is a cardiac myocyte and the pathological biomarker is a biomarker associated with myocardial infarction or cardiac hypertrophy.
7. The conditional RNA-sensor complex of claim 6, wherein the pathological biomarker comprises a molecule that encodes at least a portion of ANP, BNP, ΜΗΟβ, mir-23a-3p, mir-125-6p, or mir-199b-5p.
8. The conditional RNA-sensor complex of any of claims 1 -7, wherein the
molecule that encodes at least a portion of ANP, BNP, ΜΗΟβ, mir-23a-3p, mir-125-6p, or mir-199b-5p is an mRNA molecule or an miRNA molecule.
9. The conditional RNA-sensor complex of claim 8, wherein the RNA molecule comprises a sequence selected from SEQ ID NOS: 1 -10.
10. The conditional RNA-sensor complex of claim 9, wherein the sensor strand further comprises one or more chemical modifications to the RNA sequence, wherein the one or more chemical modifications are selected from a locked nucleic acid (LNA) modification, a peptide nucleic acid (PNA) modification, a 2'-0-methyl modification, morpholino modification, a phosphorothioate modification, a terminal modification, or a linker modification.
1 1 . The conditional RNA-sensor complex of any of claims 5-10, wherein the
double stranded pro-RNA molecule is an RNA interference (RNAi) molecule and the therapeutic target molecule is an RNA molecule that encodes at least a portion of calcineurin or histone deacetylase 2 (HDAC2).
12. The conditional RNA-sensor complex of claim 1 1 , wherein the guide strand comprises a sequence selected from SEQ ID NOS: 1 1 -16.
13. The conditional RNA-sensor complex of any of claims 1 -12, wherein the first, linker, the second linker, or both the first and second linkers is a C3 spacer.
14. The conditional RNA-sensor complex of claim 1 1 , wherein the guide strand further comprises one or more chemical modifications to the RNA sequence, wherein the one or more chemical modifications are selected from a locked nucleic acid (LNA) modification, a peptide nucleic acid (PNA) modification, a 2'-0-methyl modification, morpholino modification, a phosphorothioate modification, a terminal modification, or a linker modification.
15. The conditional RNA-sensor complex of any of claims 1 -14, wherein the core strand comprises a passenger strand; a first linker that joins a 3' end of the passenger strand to the first protection segment; and a second linker that joins a 5' end of the passenger strand to the second
protection segment
16. The conditional RNA-sensor complex of claim 15, wherein the core strand comprises a sequence selected from SEQ ID NOS: 17-26.
17. The conditional RNA-sensor complex of claim 15 or 16, wherein the core
strand further comprises one or more chemical modifications to the RNA sequence, wherein the one or more chemical modifications are selected from a locked nucleic acid (LNA) modification, a peptide nucleic acid (PNA) modification, a 2'-0-methyl modification, morpholino modification, a phosphorothioate modification, a terminal modification, or a linker
modification.
18. The conditional RNA-sensor complex of any of claims 1 -6, wherein the sensor strand comprises a sequence having at least 95% homology to SEQ ID NO:4, the core strand comprises a sequence having at least 95% homology to SEQ ID NO:21 , and the guide strand comprises a sequence having at least 95% homology to SEQ ID NO: 15.
19. The conditional RNA-sensor complex of any of claims 1 -6, wherein the sensor strand comprises a sequence having at least 95% homology to SEQ ID NO:5,
the core strand comprises a sequence having at least 95% homology to SEQ ID NO:22, and the guide strand comprises a sequence having at least 95% homology to SEQ ID NO: 15.
20. The conditional RNA-sensor complex of any of claims 1 -6, wherein the sensor strand comprises a sequence having at least 95% homology to SEQ ID NO:6, the core strand comprises a sequence having at least 95% homology to SEQ ID NO:23, and the guide strand comprises a sequence having at least 95% homology to SEQ ID NO: 15.
21 . The conditional RNA-sensor complex of any of claims 1 -6, wherein the sensor strand comprises a sequence having at least 95% homology to SEQ ID NO:7, the core strand comprises a sequence having at least 95% homology to SEQ ID NO:24, and the guide strand comprises a sequence having at least 95% homology to SEQ ID NO: 15.
22. The conditional RNA-sensor complex of any of claims 1 -6, wherein the sensor strand comprises a sequence having at least 95% homology to SEQ ID NO:8, the core strand comprises a sequence having at least 95% homology to SEQ ID NO:25, and the guide strand comprises a sequence having at least 95% homology to SEQ ID NO: 16.
23. The conditional RNA-sensor complex of any of claims 1 -6, wherein the sensor strand comprises a sequence having at least 95% homology to SEQ ID NO:9, the core strand comprises a sequence having at least 95% homology to SEQ ID NO:26, and the guide strand comprises a sequence having at least 95% homology to SEQ ID NO: 16.
24. The conditional RNA-sensor complex of any of claims 1 -6, wherein the sensor strand comprises a sequence having at least 95% homology to SEQ ID NO:8, the core strand comprises a sequence having at least 95% homology to SEQ ID NO: 18, and the guide strand comprises a sequence having at least 95% homology to SEQ ID NO: 1 1 .
25. The conditional RNA-sensor complex of any of claims 1 -6, wherein the sensor strand comprises a sequence having at least 95% homology to SEQ ID
NO: 10, the core strand comprises a sequence having at least 95% homology to SEQ ID NO: 19, and the guide strand comprises a sequence having at least 95% homology to SEQ ID NO: 12.
26. The conditional RNA-sensor complex of any of claims 1 -6, wherein the sensor strand comprises a sequence having at least 95% homology to SEQ ID NO: 1 , the core strand comprises a sequence having at least 95% homology to SEQ ID NO: 19, and the guide strand comprises a sequence having at least 95% homology to SEQ ID NO: 12.
27. The conditional RNA-sensor complex of any of claims 1 -6, wherein the sensor strand comprises a sequence having at least 95% homology to SEQ ID NO:2, the core strand comprises a sequence having at least 95% homology to SEQ ID NO: 19, and the guide strand comprises a sequence having at least 95% homology to SEQ ID NO: 12.
28. The conditional RNA-sensor complex of any of claims 18-27, wherein the sensor strand, the guide strand and/or the core strand further comprises one or more chemical modifications to the RNA sequence, wherein the one or more chemical modifications are selected from a locked nucleic acid (LNA) modification, a peptide nucleic acid (PNA) modification, a 2'-0-methyl modification, morpholino modification, a phosphorothioate modification, a terminal modification, or a linker modification.
29. A pharmaceutical composition comprising: a conditional RNA-sensor complex of any of claims 1 -28; and a pharmaceutically acceptable carrier or excipient.
30. A method of treating a pathological condition comprising administering a
therapeutically effective amount of a conditional RNA-sensor complex of any of claims 1 -29 or a pharmaceutical composition of claim 30 to a subject suffering from the pathological condition.
31 . The method of claim 30, wherein the pathological condition is myocardial infarction (Ml), cardiac hypertrophy.
32. The method of claim 31 , wherein administering a therapeutically effective amount comprises an intramyocardial injection of the conditional RNA-sensor complex or the pharmaceutical composition after detection of Ml.
33. A conditional siRNA comprising a core strand, a sensor strand, and an siRNA guide strand, wherein the conditional siRNA is activatable by a pro- hypertrophic RNA sequences, and wherein the conditional siRNA targets calcineurin or HDAC-2.
34. A pharmaceutical composition comprising the conditional siRNA of claim 33 and a pharmaceutically acceptable carrier or excipient.
35. A method of treating cardiac hypertrophy comprising administering a
therapeutically effective amount of the conditional siRNA of claim 1 or the pharmaceutical composition of claim 34 to the subject suffering from cardiac hypertrophy.
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP18844244.6A EP3665281A4 (en) | 2017-08-10 | 2018-08-10 | CONDITIONAL-siRNAS AND USES THEREOF IN TREATING CARDIAC HYPERTROPHY |
CN201880066486.5A CN111630166B (en) | 2017-08-10 | 2018-08-10 | Conditional-siRNA and its use in treating myocardial hypertrophy |
US16/638,107 US20230107117A1 (en) | 2017-08-10 | 2018-08-10 | CONDITIONAL-siRNAS AND USES THEREOF IN TREATING CARDIAC HYPERTROPHY |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US201762543882P | 2017-08-10 | 2017-08-10 | |
US62/543,882 | 2017-08-10 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2019033079A1 true WO2019033079A1 (en) | 2019-02-14 |
Family
ID=65271671
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2018/046379 WO2019033079A1 (en) | 2017-08-10 | 2018-08-10 | CONDITIONAL-siRNAS AND USES THEREOF IN TREATING CARDIAC HYERTROPHY |
Country Status (4)
Country | Link |
---|---|
US (1) | US20230107117A1 (en) |
EP (1) | EP3665281A4 (en) |
CN (1) | CN111630166B (en) |
WO (1) | WO2019033079A1 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP3833757A4 (en) * | 2018-08-10 | 2022-05-18 | City of Hope | Programmable conditional sirnas and uses thereof |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114606196A (en) * | 2020-12-04 | 2022-06-10 | 南京大学 | Cell therapy for siRNA expression and in vivo delivery |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20120101147A1 (en) * | 2008-12-03 | 2012-04-26 | The General Hospital Corporation D/B/A Massachusetts General Hospital | Inhibition of hdac2 to promote memory |
WO2013142735A1 (en) * | 2012-03-21 | 2013-09-26 | California Institute Of Technology | Targeting domain and related signal activated molecular delivery |
US20150315581A1 (en) * | 2011-06-23 | 2015-11-05 | California Institute Of Technology | Signal activatable constructs and related components compositions methods and systems |
US20170183652A1 (en) * | 2014-04-22 | 2017-06-29 | Medizinische Hochschule Hannover | Lncrnas for therapy and diagnosis of cardiac hypertrophy |
Family Cites Families (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101563458A (en) * | 2006-12-14 | 2009-10-21 | 诺瓦提斯公司 | Compositions and methods to treat muscular and cardiovascular disorders |
US9029524B2 (en) * | 2007-12-10 | 2015-05-12 | California Institute Of Technology | Signal activated RNA interference |
WO2011163526A2 (en) * | 2010-06-23 | 2011-12-29 | California Institute Of Technology | Signal activated molecular delivery |
CA2856116A1 (en) * | 2011-11-17 | 2013-05-23 | The United States Of America, As Represented By The Secretary, Department Of Health & Human Services | Therapeutic rna switches compositions and methods of use |
-
2018
- 2018-08-10 CN CN201880066486.5A patent/CN111630166B/en active Active
- 2018-08-10 US US16/638,107 patent/US20230107117A1/en active Pending
- 2018-08-10 EP EP18844244.6A patent/EP3665281A4/en active Pending
- 2018-08-10 WO PCT/US2018/046379 patent/WO2019033079A1/en unknown
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20120101147A1 (en) * | 2008-12-03 | 2012-04-26 | The General Hospital Corporation D/B/A Massachusetts General Hospital | Inhibition of hdac2 to promote memory |
US20150315581A1 (en) * | 2011-06-23 | 2015-11-05 | California Institute Of Technology | Signal activatable constructs and related components compositions methods and systems |
WO2013142735A1 (en) * | 2012-03-21 | 2013-09-26 | California Institute Of Technology | Targeting domain and related signal activated molecular delivery |
US20170183652A1 (en) * | 2014-04-22 | 2017-06-29 | Medizinische Hochschule Hannover | Lncrnas for therapy and diagnosis of cardiac hypertrophy |
Non-Patent Citations (1)
Title |
---|
See also references of EP3665281A4 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP3833757A4 (en) * | 2018-08-10 | 2022-05-18 | City of Hope | Programmable conditional sirnas and uses thereof |
US11999954B2 (en) | 2018-08-10 | 2024-06-04 | Clty of Hope | Programmable conditional SIRNAS and uses thereof |
Also Published As
Publication number | Publication date |
---|---|
EP3665281A4 (en) | 2021-05-05 |
CN111630166B (en) | 2024-04-19 |
CN111630166A (en) | 2020-09-04 |
EP3665281A1 (en) | 2020-06-17 |
US20230107117A1 (en) | 2023-04-06 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US10253319B2 (en) | miRNA modulators of thermogenesis | |
AU2012322788B2 (en) | Micrornas in neurodegenerative disorders | |
AU2013248981B2 (en) | Mirna modulators of thermogenesis | |
Li et al. | Noncoding RNAs in cardiac hypertrophy | |
Marrosu et al. | Gapmer antisense oligonucleotides suppress the mutant allele of COL6A3 and restore functional protein in ullrich muscular dystrophy | |
EP2298359A1 (en) | Nucleic acid capable of controlling degranulation of mast cell | |
US20100113562A1 (en) | Therapeutic targets and molecules | |
US10280422B2 (en) | MiR-92 inhibitors and uses thereof | |
JP6919098B2 (en) | Modulation of microRNAs for myotonic dystrophy type 1 and microRNA antagonists for that purpose | |
Evangelista et al. | miR-222 contributes to sex-dimorphic cardiac eNOS expression via ets-1 | |
US20230407308A1 (en) | Conditional-sirnas and uses thereof in treating acute myeloid leukemia | |
JP2016530887A (en) | Antisense oligomers and methods for treating SMN-related pathologies | |
WO2019033079A1 (en) | CONDITIONAL-siRNAS AND USES THEREOF IN TREATING CARDIAC HYERTROPHY | |
US11667920B2 (en) | Methods for treating brain injury | |
Liu et al. | Circ_NNT suppresses the apoptosis and inflammation in glucose-induced human retinal pigment epithelium by regulating miR-320b/TIMP3 axis in diabetic retinopathy | |
WO2014187856A1 (en) | Nucleoli disorganisation by knocking down specific alu-repeat containing rna sequences | |
JP6286050B2 (en) | Avian influenza virus miRNA and its identification, detection and use | |
US20220211739A1 (en) | Oligomeric nucleic acid molecule, and application thereof in an acute intermittent porphyria treatment | |
EP4046631A1 (en) | Msi2 as a therapeutic target for the treatment of myotonic dystrophy | |
WO2020193709A1 (en) | Inhibitor of mir-129 and uses thereof | |
CN111263811A (en) | Compositions and methods for detecting and treating insulin resistance | |
KR20100037237A (en) | Sirna targeing gch1 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18844244 Country of ref document: EP Kind code of ref document: A1 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
ENP | Entry into the national phase |
Ref document number: 2018844244 Country of ref document: EP Effective date: 20200310 |