WO2019018928A1 - Nanoscale optoregulation of neural stem cell differentiation - Google Patents

Abstract

The present application relates generally to nanoscale optoregulation of neural stem cell differentiation. Specifically, a method of differentiating a neural stem cell (NSC) is described comprising illuminating with a laser one or more NSCs containing a gold nanoparticle functionalized with a mitochondria targeting moiety. The moiety may include a lipophilic phosphonium cation, including triphenylphosphonium. An enriched population of differentiated cells obtained from said method may be used in a method to treat a subject with a neurological disorder or to induce wound healing and/or tissue regeneration in a subject. A gold nanoparticle comprising said moiety is also disclosed as is a kit and commercial package comprising a gold nanoparticle and the specific moiety (3-Carboxypropyl)triphenylphosphonium bromide.

Description

NANOSCALE OPTOREGULATION OF NEURAL STEM CELL

DIFFERENTIATION

CROSS REFERENCE TO RELATED APPLICATION

[0001] This application claims priority to US 62/536,657, filed July 25, 2017, the entire contents of which are hereby incorporated by reference.

FIELD

[0002] The present disclosure relates generally to nanoscale optoregulation of neural stem cell differentiation.

BACKGROUND

[0003] Stem cells (SCs) are unspecialized cells known for their self-renewal capacity and pluripotency. These cells can proliferate without being differentiated into other cellular types, and are capable of differentiating into a variety of cell lineages¹¹¹. Therefore, SCs are key players in numerous vital processes such as morphogenesis and organ repair¹²¹. Neural stem cells (NSCs), from three specific niches (the subventricular zone (SVZ), the subgranular zone of the dentate gyrus (SGZ) and the external germinal layer of the cerebellum)¹³¹, are multipotent adult SCs with both self-renewing and differentiating properties in development of fetal and adult central nervous system¹³¹. NSCs can keep their stem cell identity and renew themselves, or can differentiate into other types of cells such as neurons, astrocytes and oligodendrocytes¹⁴¹. Therefore, they are tremendous promise for a variety of cell-based treatments for neural diseases and injuries¹⁵¹. However, therapeutic applications of NSCs have been met with only modest success due to the challenge of defining a transplantable NSC population and directing NSC differentiation. Appropriate numbers of NSCs in the nervous system depend on a fine balance between self-renewal and differentiation, something that highlights the importance of controlling the NSC fate as a choice between self-renewal and differentiation. SUMMARY

[0004] In one aspect there is described a gold nanoparticle (AuNP) comprising a mitochondria targeting moiety.

[0005] In one example the targeting moiety comprises a lipophilic phosphonium cation.

[0006] In one example the targeting moiety comprises

triphenylphosphonium.

[0007] In one example the diameter of said gold nanoparticle is about 10nm to about 300nm, preferably about 10 nm.

[0008] In one aspect there is described a gold nanoparticle conjugated to triphenylphosphonium, wherein the diameter of said gold nanoparticle is about 10nm to about 300nm, preferably about 10 nm.

[0009] In one aspect there is described a method of differentiating a neural stem cell (NSC), comprising: illuminating one or more NSCs containing a gold nanoparticle according to any preceding claim with a laser configured to deliver about 1 mW to said NSC, wherein one or more differentiated cells are produced.

[0010] In one aspect there is described a method of generating reactive oxygen species (ROS) in a NSC, comprising: illuminating one or more NSCs containing a gold nanoparticle according to one of claims 1 to 5 with a laser configured to deliver about 1 mW to said NSC, wherein ROS are produced and wherein one or more differentiated cells are produced.

[0011] In one example the laser is configured to illuminate cells with a pulsed laser at about 20 Hz and 10% duty cycle.

[0012] In one example the laser illuminates the cells with a pulsed laser at about 20 Hz and 10% duty cycle to deliver about 1 mW of power.

[0013] In one example the cells are illuminated with a ultrasound, a microwave, or an acoustic source, configured to deliver about 1 mW of power.

[0014] In one example said one or more differentiated cells have altered mRNA levels for markers of differentiation, including one or more of Nestin, β- tubulin III , myelin basic protein (MBP), Olig2 and Glial fibrillary acidic protein (GFAP). [0015] In one example said one or more differentiated cells comprise one or more of neural stem/precursor cells, neuron, oligodendrocyte, or astrocytes.

[0016] In one example further comprising sorting the differentiated cells to obtain one or more enriched cell populations of differentiated cells.

[0017] In one example further comprising sorting the differentiated to cells to obtain an enriched population of neural stem/precursor cells, neuron, oligodendrocyte, or astrocytes.

[0018] In one aspect there is described a method of treating a subject having or suspected of having a neurological disorder, comprising: administering an enriched population of differentiated cells, said enriched population of cells obtained according to the method of any one of claims 6 to 14, to a subject in need thereof.

[0019] In one example said neurological disorder is multiple sclerosis.

[0020] In one example said neurological disorder is Parkinson's disease.

[0021] In one example said neurological disorder is Alzheimer's disease.

[0022] In one example said neurological disorder is epilepsy.

[0023] In one aspect there is described a method of inducing wound healing and/or tissue regeneration in a subject comprising administering an enriched population of differentiated cells, said enriched population of cells obtained according to the method of any one of claims 6 to 14 to a subject in need thereof.

[0024] In one example the subject is a human.

[0025] In one aspect there is described a kit comprising: an AuNP and 3-

Carboxypropyl)triphenylphosphonium bromide.

[0026] In one aspect there is described a kit comprising: an AuNP -TPP, and instructions for the use thereof.

[0027] In one aspect there is described a commercial package comprising an AuNP and 3- Carboxypropyl)triphenylphosphonium bromide.

[0028] In one aspect there is described a commercial package: an AuNP -

TPP, and instructions for the use thereof. BRIEF DESCRIPTION OF THE FIGURES

[0029] Embodiments of the present disclosure will now be described, by way of example only, with reference to the attached Figures.

[0030] Figure 1 . Physical characteristics of functionalized

triphenylphosphonium functionalized gold nanoparticles (AuNP-TPP); (a) The schematic representation of mitochondrial targeted gold nanoparticles (AuNPs) to localize electromagnetic field (EMF) for neural differentiation of neural stem cells (NSCs) (b) Transmission electron micrographs of functionalized AuNP-TPP (scale bar is 50 nm). (c) The hydrodynamic diameter of AuNP and AuNP-TPP as measured via dynamic light scattering method, (d) UV-Vis absorption spectra of AuNP and AuNP-TPP. (e) Distribution of electric field (E-field) and magnetic field (H-field) around the nanosphere with the diameter of 10 nm. The excitation field is a plane-wave propagating in direction of kexc. (f) The absorption cross-section of the nanosphere for diameters of 10, 1 1 , 12, 13 and 14 nm. (g) E-field

enhancement factor (|E|/|E_ex_C|) in the xy-plane crossing the center of the nanosphere. (h) E-field enhancement factor (|E|/|E_ex_C|) vs the radial distance from the center of AuNP of 10 nm diameter.

[0031] Figure 2. Mitochondrial targeting efficiencies, (a-d) Confocal laser scanning microscopy images on mitochondrial co-localization of (a,c) AuNP, and AuNP-TPP (b,d). The panels i-iii indicate the mitochondria stained with mitotracker (red), AuNPs labeled by fluorescein isothiocyanate (FITC) (green), and the overlay image of them (yellow) (scale bar is 20 μιη). (e) Cellular uptake of fluorescently labeled AuNP and AuNP-TPP using fluorescence-activated cell sorting (FACS) (left panel). Cellular uptake evaluated using inductively coupled plasma mass-spectrometry (ICP-MS) spectroscopy. Mitochondrial uptake portions are indicated within each bar. *p < 0.05 and **p < 0.01 between cellular/ mitochondrial uptake after 4 h and 1 h for AuNP and AuNP-TPP. ## p < 0.01 between mitochondrial uptake for AuNP-TPP and AuNP. (f) Cellular viability of NSC after 72 h incubation with AuNP and AuNP-TPP w/o irradiation. *p < 0.05 between each treatment group and cells treated with AuNP without irradiation [control (-)]. (g) In vial generation of reactive oxygen species (ROS) after laser irradiation, (h) Monitoring of intracellular ROS generation during 120 min of treatment with laser in the presence and absence of AuNPs. The empty triangles indicate the irradiation points. *p < 0.05 and **p < 0.01 between the sample with and without irradiation [negative controls].

[0032] Figure 3. Neural differentiation potential of Human, H9-Derived, neural stem cells (GIBCO; hNSCs) upon localized EMF treatment, (a-d) RT-PCR results of gene expressions of glial fibrillary acidic protein (GFAP) (a), β-tubulin III (b), Nestin (c) and myelin basic protein (MBP) (d). (e-g) Protein expression levels of NSCs after treatment. Western blot analyses of GFAP (e) and β-tubulin III (f) expression, (g) Confocal laser scanning microscope (CLSM) images of

differentiated cells stained against glial fibrillary acidic protein (GFAP) (green) and β-tubulin III (red) with 4',6-diamidine-2'-phenylindole dihydrochloride (DAPI) counterstaining for nuclei (blue) (scale bar is 20 μιη). The presented data is expressed as average ± SD. The results are statistically analyzed using unpaired t-tests. For all tests, the statistical significance was set at p < 0.05. p < 0.01 is considered as statistically very significant. *p < 0.05 and **p < 0.01 between each treatment group and NSC samples without any treatment [control (-)]. # p < 0.05 and ## p < 0.01 between each treatment group and NSC samples with regular neurodifferentiation treatment [control (+)]. °p < 0.05 and ⁰⁰p < 0.01 between two different types of AuTPP-based treatments (in panel (e) and (f)).

[0033] Figure 4. Functional evaluation of neurons; Current-voltage relationship for (a) Na+, and (b) K+ currents as a function of test potential for the differentiated cells, (c) Ca²⁺ imaging, (d) The change of relative fluorescence intensity for the differentiated cells (scale bar is 150 μιη). *p < 0.05 and **p < 0.01 between treated groups at day 21 and day 7.

[0034] Figure 5 (a). Representative nuclear magnetic resonance (NMR) corresponding to AuNP-TPP conjugates. The surface density of TPP groups on the surface of AuNPs can be controlled by changing the initial concentration at the reaction solution. 1 H NMR: δ 2.00 (2H, tt, J = 7.5, 7.4 Hz), 2.39 (2H, t, J = 7.4 Hz), 2.49 (2H, t, J = 7.5 Hz), 7.20-7.37 (9H, 7.25 (tt, J = 8.2, 1 .3 Hz), 7.32 (dddd, J = 8.4, 8.2, 1 .3, 0.4 Hz)), 7.30 (6H, dddd, J = 8.4, 1 .4, 1 .3, 0.4 Hz). [0035] Figure 6. Monitoring of intracellular reactive oxygen species (ROS) generation during 120 min of treatment with laser in the presence and absence of N-Acetyl-L-cysteine (NAC) as ROS scavenger. The empty triangles indicate the irradiation points.

[0036] Figure 7. Neural differentiation potential of localized electromagnetic field (EMF) treatment, (a-d) RT-PCR results of gene expressions of glial fibrillary acidic protein (GFAP) (a), β-tubulin III (b), and Nestin (c) in presence and absence of NAC as ROS scavenger. The presented data is expressed as average ± SD.

[0037] Figure 8. Neural differentiation potential of localized EMF treatment.

RT-PCR results of Olig2 gene expression. The presented data are expressed as average ± SD. The results are statistically analyzed using unpaired t-tests. For all tests, the statistical significance was set at p < 0.05. p < 0.01 is considered as statistically very significant. *p < 0.05 and **p < 0.01 between each treatment group and neural stem cell (NSC) samples without treatment [control (-)]. # p < 0.05 and ## p < 0.01 between each treatment group and NSC samples with regular neuro-differentiation treatment [control (+)].

[0038] Figure 9. Functional evaluation of neurons; Current-voltage relationship for (a) Na+, and (b) K+ currents as a function of test potential for differentiated cells after 21 days of treatment.

DETAILED DESCRIPTION

[0039] There is described herein compounds, compositions, kits, and methods, for inducing differentiation of neural stem cells (NSCs).

[0040] In some examples, the compounds, compositions, kits, and methods, may be used for inducing differentiation in NSCs may be used for the treatment of a subject having or suspect of having a neurological disorder.

[0041] In some examples, the compounds, compositions, kits, and methods, may be used for inducing differentiation in NSCs may be use for tissue regeneration in a subject in need thereof. [0042] In some examples, the compounds, compositions, kits, and methods, may be for inducing Reactive Oxygen Species (ROS) in NSCs, and inducing differentiation in NSCs.

[0043] NSC and differentiation

[0044] As used herein, the term, "neural stem cell" or "NSC" refers to a multipotential stem cell that can be functionally defined according to its capacity to differentiate into each of the three major cell types of the central nervous system (CNS) neurons, astrocytes, and oligodendrocytes. In some examples, NSCs may also refer to neural or neuronal progenitors, or neuroepithelial precursors.

[0045] In some examples, "NSC" refers to a cell that is capable of becoming neurons, astrocytes, oligodendrocytes, glial cells, and neural stem/precursor cells etc.

[0046] In some examples, NSCs, such as human neural stem cells, may be obtained from a neural stem cell line.

[0047] In some examples, NCSs may be isolated from any area of the CNS known to contain stem cells, such as the forebrain, cerebral cortex, cerebellum, midbrain, hippocampus, brainstem, spinal cord, and ventricular tissue, and specific sub-areas thereof, e.g., basal ganglia, anterior subventricular zone, diencephalon, telencephalon, or ependymal/subependymal zone.

[0048] As used herein, the term "isolated" with reference to a cell, refers to a cell that is in an environment different from that which the cell naturally occurs (e.g. where the cell naturally occurs in an organism) and the cell is removed from its natural environment.

[0049] In some examples, human neural stem cells may be obtained from an area which is naturally neurogenic for a desired population of neurons and from embryonic, fetal, post-natal, juvenile or adult tissue, neural tissue biopsies, or tissues removed during neurosurgery. The desired population of cells may include the cells of a specific neuronal phenotype.

[0050] Cells obtained from neural tissue can be maintained or proliferated in vitro by culturing in suspension or on a substrate, preferably with a defined medium to avoid differentiation of the cells. In some examples, this is referred to as cell culture.

[0051] As used herein, the term "cell culture" refers to any in vitro culture of cells. Included within this term are continuous cell lines, primary cell cultures, finite cell lines, and any other cell population maintained in vitro, including oocytes and embryos.

[0052] As used herein, the term "in vitro" refers to an artificial environment and to processes or reactions that occur within an artificial environment. In vitro environments can include, but are not limited to, test tubes and cell cultures.

[0053] The term "in vivo" refers to the natural environment (e.g., an animal or a cell) and to processes or reaction that occur within a natural environment.

[0054] As used herein, the term "differentiation" as used with respect to cells in a differentiating cell system refers to the process by which cells differentiate from one cell type (e.g., a multipotent, totipotent or pluripotent differentiate cell) to another cell type such as a target differentiated cell.

[0055] In some example, "cell differentiation" in reference to a pathway refers to a process by which a less specialized cell (i.e. stem cell) develops or matures or differentiates to possess a more distinct form and/or function into a more specialized cell or differentiated cell.

[0056] Functionalized Gold Nanoparticles

[0057] In one example, as described herein, gold nanoparticles (AuNPs) are functionalized with a mitochondrial targeting moiety.

[0058] In one example, the targeting moiety is a lipophilic phosphonium cation.

[0059] In a specific example, the mitochondrial targeting moiety is triphenylphosphonium.

[0060] In one example, there is described a gold nanoparticle (AuNP) functionalized with triphenylphosphonium, to generate triphenylphosphonium functionalized gold nanoparticles (AuNP-TPP).

[0061] In some examples, alternate targeting moieties may include, but are not limited to, Phosphonium salts such as methyltriphenylphosphonium , fluorescent lipophilic cations such as rhodamine 123, and 5,5',6,6'-tetrachloro- 1 , 1 ',3,3'-tetraethylbenzimidazolcarbocyanine iodide (JC-1 ). In other examples, peptide-based transporters (Synthetic Peptide and Amino Acid-Based) may be used for mitochondria targeting, which can display both efficient cellular uptake and mitochondrial localization. These mitochondriapenetrating peptides are either cationic (e.g., arginine, lysine) or hydrophobic (e.g., phenylalanine,

cyclohexylalanine). a nonhydrolysable tetraguanidinium oligomer (comprised of chiral bicyclic guanidinium subunits conjugated through thioether linkages) is an example in this class of mitochondrial localizer, which rely on the special properties of guanidinium moieties as delocalized cations.

[0062] In one example, the diameter of the gold nanoparticle is about 10 nm.

[0063] In other examples, the diameter of the gold nanoparticle is about 8 to about 300 nm.

[0064] It will be appreciated that in some examples the gold nanoparticle may be generally spherical or generally rod shaped.

[0065] Methods and Uses

[0066] In use, NSCs containing AuNP-TPP are illuminated with a laser configured to deliver about 1 mW to cells, wherein at least a portion of the NSCs undergo differentiation.

[0067] In use, NSCs containing AuNP-TPP are illuminated with a laser configured to deliver about 1 mW to cells, to generate reactive oxygen species (ROS) and wherein at least a portion of the NSCs undergo differentiation.

[0068] In one example, in use, NSCs are contacted with AuNP-TPP, and at least a portion of the AuNP-TPP are taken up by the NSCs, thereby producing NSCs containing AUNP-TPP.

[0069] The term "contact", "contacted", and "contacting" as used herein refers to placing cells, such as NSCs, and an agent, such as AuNP-TPP, in a mutual spatial relationship. The terms "treat", "treating", or "treatment" as applied to an isolated cell, refers to subjecting the cell to any kind of process or condition or performing any kind of manipulation or procedure on the cell. [0070] In one example, the NSCs are contacted with AuNP-TPP in vitro.

[0071] In one example, the NSCs are cultured in vitro and contacted with

AUNP-TPP

[0072] In one example, NSCs are contacted with AuNP-TPP at a

concentration of about 1 Mg.ml- to about 10 Mg.ml . In some examples, the concentration of AuNP-TPP is about 1 g.ml^"1 , about 2 g.ml^"1 , about 3 g.ml^"1 , about 4 μg.ml^"1 , about 5 μg.ml^"1 , about 6 μg.ml^"1 , about 7 μg.ml^"1 , about 8 μg.ml^"1 , about 9 μg.ml^"1 , about 10 μg.ml^"1.

[0073] In one example, about 1x10⁶ NSCs are incubated with AuNP-TPP.

[0074] In one example, NSCs containing AuNP-TPP are treated with a laser configured to deliver about 1 mW of power to the cells. In one example, NSCs containing AuNP-TPP are treated with a pulsed laser configured to deliver about 1 mW of power to the cells.

[0075] In a specific example, the laser is a 530 nm Green laser Diode.

[0076] In a specific example, the lasted is configured to illuminate the cells with a pulsed laser at about 20 Hz and 10% duty cycle.

[0077] In a specific example, NSC containing AuNP-TPP are illuminated with a pulsed laser at 20 Hz and 10% duty cycle to deliver about 1 mW to the cells. In a specific example, the cells are illuminated with a pulsed laser configure to deliver about 1 ±0.3 mW to the cells.

[0078] In another example, the cells are exposed to about 10 minutes about every three hours, over the course of the illumination.

[0079] It will be appreciated that in some examples conditions may be so as selected to provide the highest laser power which will not cause a temperature rise near the particles.

[0080] For example, the wavelength may be selected based on UC-vis absorption spectra of gold nanoparticles. In other examples, it methods such as ultrasound, acoustic or microwave systems may be used

[0081] As discussed above and herein, at least a portion of the NSCs containing AuNP-TPP treated with a laser will undergo differentiation. [0082] In some examples, at least a portion of the NSCs containing AuNP-

TPP have altered mRNA levels for markers of differentiation, including one or more of Nestin, β-tubulin III, myelin basic protein (MBP), Olig2 and Glial fibrillary acidic protein (GFAP).

[0083] In some examples, at least a portion of the NSCs containing AuNP-

TPP undergo differentiation to one or more of neural stem/precursor cells, neuron, oligodendrocyte, or astrocytes.

[0084] Selection and/or enriching cells

[0085] In some examples, the method may further comprise a selection or sorting step, to further isolate, enrich, and/or select for cell types, such as differentiated cells.

[0086] A variety of methods are known for selection or sorting cells based on antigen expression, and any of these may be used in the selection or sorting step described here. The selection or sorting may be achieved by means of flow cytometry.

[0087] As used herein, the term "flow cytometry", is understood to involve the separation of cells in a liquid sample. Generally the purpose of flow cytometry is to analyse the separated cells for one or more characteristics thereof. A fluid sample is directed through an apparatus such that a liquid stream passes through a sensing region. The cells pass the sensor one at a time and are categorized based on size, refraction, light scattering, opacity, roughness, shape,

fluorescence, etc. In the context of the present disclosure, the term "flow cytometry" is also understood to encompass cell sorting (fluorescence activated cell sorting; FACS).

[0088] FACS involves exposing cells to a reporter, such as a labelled antibody, which binds to and labels antigens expressed by the cell. Alternatively or additionally, magnetic cell sorting (MACS) may be employed to sort the cells.

[0089] In some example, a population of cells is enriched for neural stem/precursor cells, neuron, oligodendrocyte, or astrocytes, using a selecting or sorting method. It will be understood that the cells may comprise one or more additional cell surface markers, typically markers which are known to be express in neural stem/precursor cells, neuron, oligodendrocyte, or astrocytes.

[0090] In some example, the cells selected constitute a population of cells having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 87%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%, of neural stem/precursor cells, neuron, oligodendrocyte, or astrocytes.

[0091] Treatment

[0092] In some examples, an enriched population of cells obtained herein may be used in the treatment of a subject having or suspected of having a neurologic disorder.

[0093] In some examples, an enriched population of cells obtained herein may obtained may be used for tissue regeneration in a subject.

[0094] The term "treat", "treating", or "treatment", as applied to a subject, refers reduction in at least one symptom of the disease or disorder or an improvement in the disease or disorder, for example, beneficial or desired clinical results. Beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. Treating can refer to prolonging survival as compared to expected survival if not receiving treatment. Thus, one of skill in the art realizes that a treatment may improve the disease condition, but may not be a complete cure for the disease. As used herein, the term "treatment" includes prophylaxis. Alternatively, treatment is "effective" if the progression of a disease is reduced or halted. "Treatment" can also mean prolonging survival as compared to expected survival if not receiving treatment.

[0095] The term "subject", as used herein, refers to an animal, and can include, for example, domesticated animals, such as cats, dogs, etc., livestock (e.g., cattle, horses, pigs, sheep, goats, etc.), laboratory animals (e.g., mouse, rabbit, rat, guinea pig, etc.), mammals, non-human mammals, primates, non- human primates, rodents, birds, reptiles, amphibians, fish, and any other animal. In a specific example, the subject is a human.

[0096] Neurological disorders

[0097] As used herein, "neurological disorder" refers to an aberration from clinically normal neural cell activity, for example compromised neural cell activity.

[0098] In some examples, the methods may be useful in delaying development of a neurological disorder, and thus may be used in individuals who show no overt signs of disease but are, for example, at risk of developing disease.

[0099] In some example, the neurological disorder is Parkinson's disease or multiple sclerosis (MS). In some examples, the neurological disorder is

Alzheimer's disease. In some example, the neurological disorder is epilepsy.

[00100] In other example, examples of neurological disorders include, but are not limited to, neurodegenerative disease (of the CNS and/or PNS), neuropathies associated with toxicity (neurotoxicity) such as chemotherapy, and alcohol consumption, immune-mediated neurodiseases such as Guillain-Barre syndrome, hereditary neuropathies such as Charcot-Marie-Tooth neuropathies, injury due to trauma, and compromised function due to senescence.

[00101] The term "Parkinson disease" as used herein refers to a progressive disorder of the nervous system that affects movement. Although symptoms and signs may vary with the stages of the disease and from person to person, some of them are, but without limitation, tremor, slowed movement (bradykinesia), rigid muscles, impaired posture and balance, loss of automatic movements and speech and writing changes. In some examples, clinical characteristics of Parkinson disease in a subject may be assessed according to the Movement Disorder Society-sponsored revision of the Unified Parkinson's disease Rating Scale (MDS-UPDRS).

[00102] The term "multiple sclerosis" or "MS" refers to a disease of the central nervous system characterized by the progressive destruction of the myelin. There are four internationally recognized forms of MS, namely, primary

progressive multiple sclerosis (PPMS), relapsing-remitting multiple sclerosis (RRMS), secondary progressive multiple sclerosis (SPMS), and progressive relapsing multiple sclerosis (PRMS).

[00103] The term "Alzheimer's Disease" or "AD" as used herein, refers to a neurodegenerative disorder and encompasses familial and sporadic AD.

Symptoms indicative of AD in human subjects typically include, but are not limited to, mild to severe dementia, progressive impairment of memory (ranging from mild forgetfulness to disorientation and severe memory loss), poor visio-spatial skills, personality changes, poor impulse control, poor judgment, distrust of others, increased stubbornness, restlessness, poor planning ability, poor decision making, and social withdrawal. Hallmark pathologies within brain tissues include extracellular neuritic β-amyloid plaques, neurofibrillary tangles, neurofibrillary degeneration, granulovascular neuronal degeneration, synaptic loss, and extensive neuronal cell death.

[00104] In the case of a subject having Parkinson's disease or suspected of having Parkinson's disease, in some examples, NSCs containing AuNP-TPP may be differentiated as set out herein. The resulting differentiated cells may then be enriched for neurons, and more preferably dopamine-acting neurons. The enriched neuron or dopamine-acting neurons may be administered to the subject. Preferably, the enriched neuron or dopamine-acting neurons may be administered into the striate body of the subject.

[00105] In the case of a subject having MS, or suspected of having MS, NSCs containing AuNP-TPP may be differentiated as set out herein. The resulting differentiated cells may then be enriched for oligodendrocytes or progenitors of oligodendrocytes. The enriched oligodendrocytes or progenitors of oligodendrocytes may then be administered to the subject.

[00106] The actual amount(s) of the cells administered, and rate and time- course of administration, will depend on the nature and severity of the disease or disorder being treated.

[00107] The cells may be administered by any suitable means, including parenteral, topical, subcutaneous, intraperitoneal, intrapulmonary, intranasal, intrathecal and/or intralesional administration. Parenteral infusions include intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration. In some examples, administration is achieved by, including but not limited to, local infusion during surgery, by injection, by means of a catheter, or by means of an implant, said implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers.

[00108] Tissue reconstitution

[00109] In some example, the NSCs and differentiated cells made according to the methods and compositions described here, and particles derived therefrom, may be used for tissue reconstitution or regeneration in a subject in need thereof.

[00110] In some example, there is described a method of inducing wound healing and/or tissue regeneration in a subject comprising administering differentiated cells made according to the method and compositions as described herein.

[00111] In this example, the cells are administered in a manner that permits them to graft to the intended tissue site and reconstitute or regenerate the functionally deficient area. For example, cells may be transplanted directly into parenchymal or intrathecal sites of the central nervous system, according to the disease being treated.

[00112] Kits and commercial packages

[00113] Method of the invention are conveniently practiced by providing the compounds and/or compositions used in such method in the form of a kit. Such kit preferably contains the composition. Such a kit preferably contains instructions for the use thereof.

[00114] In one example, there is provided a kit comprising: an AuNP and 3- Carboxypropyl)triphenylphosphonium bromide.

[00115] In one example, there is provided a kit comprising: an AuNP -TPP, and instructions for the use thereof.

[00116] In one example, there is provided a commercial package comprising an AuNP and 3- Carboxypropyl)triphenylphosphonium bromide.

[00117] In one example, there is provided a commercial package: an AuNP -TPP, and instructions for the use thereof. [00118] To gain a better understanding of the invention described herein, the following examples are set forth. It should be understood that these examples are for illustrative purposes only. Therefore, they should not limit the scope of this invention in anyway.

[00119] EXAMPLES

[00120] The balance between self-renewal and differentiation is an important factor for determining NSC fate. Cells use different ways of communication to harmonize their activities. In fact, many cellular functions in SCs rely on both intrinsic and extrinsic signals. Therefore, SC fate can be controlled by interactions between extrinsic signals, derived from the microenvironment in which cells are located (their niche)^[6], and intrinsic signals (like transcriptional factors and cell cycle regulators)¹⁷¹. EMFs, in particular, influence intracellular communications via the transport of energy across cells and their microenvironment. EMFs, characterized based on their wavelength and energy^{18 91}, are known as low-level radiations (non-ionizing radiations) among the electromagnetic (EM) waves and do not break atomic bonds¹¹⁰¹. EM stimulations as extrinsic signals have a potential to direct the fate of SCs^[101. According to several reports, the EM nature of biological systems makes the transmission of EM signals possible for the control and regulation of cellular processes¹¹⁰¹. In fact, living cells consisting of biological polar units such as ions are capable of producing EMFs in the form of ultra-weak photons^19-111. Previous studies have demonstrated the influence of EMFs on some intracellular mechanisms and gene expressions¹¹²' ¹³· ^{1 ]}.

[00121] Moreover, many studies have reported the influence of externally applied EMFs on cells¹¹⁰¹. The observed effects (like differentiation) are strongly correlated to the cellular or intracellular physiological states and parameters of applied fields such as frequency, intensity and exposure time¹¹⁰' ^15]. Based on several studies on NSCs, EMFs can promote NSC differentiation into functional cells, for example the differentiating effect of extremely low frequency- electromagnetic fields (ELF-EMFs) on NSCs in rats^[161 and embryonic NSCs in mice¹¹⁷¹. Although these studies reported that EMFs can induce differentiation in NSCs, the mechanisms underlying these effects are not well understood. One possible mechanism for the activation of cell differentiation pathways through EM stimulations can be linked to the generation of free radical reactive oxygen species (ROS) and activation of pathways related to ROS^[13' ^18]. ROS are highly reactive molecules and one site for their generation is mitochondria where they are a byproduct of oxidative phosphorylation¹¹⁹' ^20]. Mitochondrial activities, as a cellular power source^{120 211}, play a regulatory role in cell functions^{121 221}. Therefore, it is reasonable to explore the effects of mitochondria on differentiation of SCs. The aim of this study is to investigate how localized generation of EMFs around mitochondria can regulate the fate of NSC and explore the feasibility of NSC differentiation through localized EMF.

[00122] Materials and methods

[00123] The numerical simulations were performed using the 3D finite difference time domain (FDTD) method by a commercial software package (Lumerical Inc.). The empirical data, recorded by Johnson and Christy¹¹¹, was used to model the permittivity of gold layers¹²¹. The simulation area was laid down by setting the perfectly-matched layer (PML) boundary conditions in the z- direction and Bloch boundary conditions in the x- and y-directions. The mesh size was kept at the fixed value of 4 nm in a 50 nm ^χ 50 nm ^χ 50 nm cubic area, centered on the nanosphere. A course adaptive mesh was used for outside this high-resolution zone. A plane-wave excitation propagating in z-direction was used to excite NPs (Fig. 1 e).

[00124] Chemicals and Reagents: Unless noted otherwise, all chemicals were purchased from Sigma-Aldrich, Inc. St. Louis, MO. All glassware was cleaned overnight using concentrated sulfuric acid and then thoroughly rinsed with Milli-Q water. All other cell culture reagents, solutions and dishes were obtained from Thermo Fisher Scientific (Waltham, MA) except as indicated.

[00125] Gold nanoparticles (AuNPs) of 10 nm-diameter were synthesized following previously reported procedures with some modifications[A3]. Briefly, gold(lll) chloride trihydrate (HAuCI -3H20; 0.1 mmol) was added to a solution of SH-PEG-NH2 (0.25 mmol) (Mn:2000 g.mol-1 ) prepared in 15 Milli-Q water. This mixture was stirred for 15 min until dissolving the dissolution of gold salt. For the reduction of gold salt, aqueous solution of sodium borohydride (1 .5 mmol, Sigma, St. Louis, MO) was added drop wise to the prepared solution using a syringe pump (Harvard PHD2000; Harvard Apparatus, Holliston, MA) under vigorous stirring, followed by moderate stirring the mixture for 16 h. The solution was dialyzed against phosphate buffer solution (PBS) (1X), sodium chloride (NaCI) solution (1 M, pH 7.2), and again against distilled water using a Biotech CE dialysis membrane (MWCO: 9-10kDa; Spectrum Laboratories, Inc., Rancho Dominguez, CA) for 24 h. The NPs were separated by centrifugation at 7000 rpm for 30 min. After centrifugation, the supernatant was kept and the pellet was discarded to obtain AuNP-Amine. Then, Amicon Ultra-15 centrifugal filter units (MWCO 5 kDa, EMD Millipore, Billerica, MA, USA) were used at 2000 rpm for 10 min to concentrate the AuNP-Amine.

[00126] For conjugation of (3- Carboxypropyl)triphenylphosphonium bromide (TPP; Sigma, St. Louis, MO) to AuNP-Amine, TPP was activated using 1 -Ethyl-3- (3-dimethylaminopropyl)-carbodiimide (EDC)/N-hydroxysuccinimide (NHS) (1 .5: 1 molar ratio) in anhydrous dimethyl sulfoxide (DMSO; Sigma, St. Louis, MO) and allowed to mix for 1 h at room temperature. Aqueous solution of AuNP-Amine was added to the activated TPP, and the reaction mixture was allowed to stir for 24 h at room temperature. The reaction mixture was dialyzed against PBS (1X), NaCI solution (1 M, pH 7.2), and again against Milli-Q water using a Biotech CE dialysis membrane (MWCO: 9-10kDa; Spectrum Laboratories, Inc., Rancho Dominguez, CA) for 2 days. Then, Amicon Ultra-15 centrifugal filter units (MWCO 5 kDa, EMD Millipore, Billerica, MA, USA) were used at 2000 rpm for 10 min to concentrate the AuNP-TPP conjugate. Fluorescing conjugated version of AuNP-Amine and AuNP- TPP was also synthesized following previously published procedures[A4]. The fluorescein isothiocyanate isomer I (FITC, Sigma, St. Louis, MO) and the conjugation reaction were performed in DMSO/water mixture for 24 h. The same purification and separation method were used as mentioned in AuNP-TPP synthesis section.

[00127] The size of AuNPs was examined by a transmission electron microscope (TEM; T12 cryo-electron microscope, FEI Inc., Hillsboro, OR, USA) in conjunction with ImageJ analysis software. Colloidal solutions of AuNPs were placed on the carbon-coated copper grid and then were dried at room

temperature. The average sizes were obtained from TEM images of five different locations on each sample. Dynamic light scattering (DLS) measurements were performed using a Zetasizer (Zetasizer 3000HS, Malvern Instruments Ltd., Worcestershire, UK) in backscattering mode at 173° for water diluted systems. UV-visible absorption spectra were recorded in a conventional quartz cell (light path 10 mm) by a Hewlett-Packard HP8453 diode-array UV/visible

spectrophotometer. Bruker AV 600 nuclear magnetic resonance (NMR) instrument was used for 1 H NMR measurement with 203 mm tubes and 0.37 mm wall.

Particles (1 ml of 1 mg/ml) were washed triple times with D20 and subjected to NMR measurement at 25°C.

[00128] In all cellular studies, human neural stem cells (hNSCs; Gibco, HQ- Derived) and cell culture conditions were used per manufacturer's instruction. All hNSC experiments were carried out within passages 3 to 8 (GIBCO® hNSCs retain their potential of differentiation into neurons and glial cells in multiple passages). Neural differentiation was initiated by removing the growth factors (bFGF and EGF) from the culture medium and the cells were allowed to differentiate for the desired time. The regular differentiation of NSCs was performed as a positive control by changing the medium to neural differentiation medium after 2 days, followed by refreshing the medium every three days. Neural differentiation medium was prepared according to the manufacturer's protocol using Neurobasal medium with B-27 Serum-Free Supplement and GlutaMAX-l.

[00129] For mitochondrial imaging of hNSCs, the cells were grown on glass- bottom culture dishes containing 1 ml_ of DMEM - Dulbecco's modified eagle medium (DMEM) and incubated at 37°C under a 5% C0₂ atmosphere for 24 h. The culture medium was replaced with fresh medium containing fluorescein isothiocyanate (FITC)-labeled AuNPs-Amine (10 μg.ml-1 ) or ITC-labeled AuNPs- TPP (10 g.ml^"1) for 1 and 4 h at 37 °C, and washed with PBS (pH 7.4). The mitochondria was further stained by MitoTracker (Invitrogen, mitochondria marker) for microscopy purposes. A volume of 500 μΙ_ of 20 nM MitoTracker solution was incubated with the cells for 30 min and then washed before imaging. The cells were imaged using a Leica TCS SP5 confocal laser scanning microscope (CLSM) using different excitation for each dye: the excitation wavelength of 488 nm for FITC-labeled AuNPs, and the excitation wave- length of 575 nm for MitoTracker.

[00130] The quantification of cellular uptakes of FITC-labeled AuNPs was performed by two independent methods: flow cytometry and inductively coupled plasma mass-spectrometry (ICP-MS). Au-NPs were added at a concentration of 10 μg.ml-1 (except for the unstained negative control) to hNSCs cells (1 *10⁶ cells), suspended in Eppendorf tubes. The cells were incubated for 1 -4 h in normal culture medium in a tissue culture incubator. The cells were then washed using ice-cold phosphate buffered saline (PBS) containing 10% fetal bovine serum (FBS). One part of cells was transferred into fluorescence-activated cell sorting (FACS) tubes and kept in ice until FACS analysis using SORP BD LSRII analytic flow cytometer system. The second part was subjected to the inductively coupled plasma mass spectrometry (ICP-MS) measurement (Agilent 7500c quadrupole ICP-MS). The cells were collected and digested in aqua fortis (nitric acid/ hydrochloric acid; 3: 1 v/v), followed by adding 2% nitric acid and 1 % hydrochloride acid (1 : 1 ) for adjusting the solution volume to 2 ml_. The gold assaying were then performed by ICP-MS measurement to determine the cellular uptake of AuNPs [5].

[00131] Mitochondrial isolation and quantification of NPs were also performed to quantify the mithochondrial targeting efficiencies. Mitochondrial isolation was performed using a commercially available MITOIS02 mitochondria isolation kit (Sigma, USA). The outer membrane integrity verified by measuring the cytochrome c oxidase activity (Sigma, USA) according to manufacturer protocols. The ICP-MS technique was used to quantify the NPs.

[00132] Standard MTT colorimetric assaying was carried out on NSCs to examine the cytotoxicity of AuNP-Amine and AuNP-TPP. To determine cell cytotoxicity/viability, the cells were plated at a density of 10,000 cells per well in 96 well plates and then incubated overnight. The cells were then incubated with AuNPs-Amine and AuNPs-TPP at a concentration range of 0.25-40 μg.ml^"1. The culture medium was then discarded after 24 hr and the cells were washed with PBS (pH 7.4) followed by incubation for 2 hr with 100 μΙ of 3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyltetrazolium bromide (MTT) solution in DMEM (500 Mg.ml-1 in phosphate buffer pH 7.4). The medium containing MTT was then replaced with 150 μΙ of dimethyl sulfoxide for each well. After shaking the plates for 10 min, the absorbance values of the wells were recorded with a microplate reader (BIO-TEK Synergy HT, USA) at the wavelength of 570 nm. The control culture medium contained no nanoparticles. All measurements were performed at room

temperature. The spectrophotometer was calibrated to zero absorbance using the control culture medium containing no cells. The relative cell viability (%) related to the control wells, containing cell culture medium without nanoparticles, was calculated by [A]test/[A]control χ 100, where [A]test is the absorbance of the test sample and [A]control is the absorbance of the control sample¹⁶¹.

[00133] For optoregulation experiments, a 530 nm Green Laser Diode with the maximum output power of 20 mW was used. Optical chopper system

(Thorlabs Inc, Newton, New Jersey, USA) with high precision blades (MC1 F2P10, Thorlabs Inc) was used to illuminate the samples with pulsed laser at 20 Hz and 10% duty cycle. The laser exposure was adjusted to deliver 1 ±0.3 mW to the cellular layer at the bottom of well plate. Cells were cultured on 96-well optical- bottom plates with cover glass base (Cell culture treated Black Nunc MicroWell) to achieve optimal exposure. The exposure explosion system was programmed to expose the samples for 10 min every 3 hr during the culture of cells inside C0₂ incubators (Thermo Fisher Scientific) over the course of irradiation. Our observations using thermal imaging camera (FLIR Systems; Nashua, NH, USA) revealed that the effect of irradiation on increasing the temperature of surrounding environment is ignorable.

[00134] The reactive oxygen species (ROS) generation was evaluated at cell-free environment (In vial) as reported by Yang et al.[A7]. Dihydrorhodamine- 123 (DHR123, non-fluorescent) was used as a ROS detecting agent. The oxidation of DHR123 by ROS resulted in the formation of fluorescent Rhodamine 123^[8]. 50 μΙ_ of diluted AuNP solutions at the concentration of 1 μg.ml-1 was mixed with 50 μΙ_ of protoporphyrin IX (PplX; 10 μΜ) to study the effect of NPs on the ROS formation. An equivalent amount of DHR123 (10 μΜ) was subsequently added to the mixture in darkness. The laser then irradiated the samples in 96-well plates for different time points. The fluorescence measurements were performed after 1 min irradiation using a multimode microplate reader at an excitation wavelength of 485/20 nm and an emission wavelength of 528/20 nm. N-Acetyl-L- cysteine (NAC) was used as ROS scavenger to confirm whether ROS generation using the laser irradiation is the cause of the proposed biological effects.

[00135] Flow cytometry was performed to determine the intracellular redox state and ROS levels. The cells were stained with a nonspecific indicator for intracellular ROS, dihydrorhodamine 123 (DHR123; Invitrogen; 1 M, 30 min)!⁹!. Staining was performed in Hanks' balanced salt solution (HBSS; Thermo Fisher Scientific) complemented with 14 mM HEPES (Thermo Fisher Scientific, Waltham, MA) and 0.9% NaCI (Sigma)[A2]. Mean fluorescence intensities in a total of 10,000 cells were determined in each sample using SORP BD LSRII analytic flow cytometer system (BD Biosciences). An unstained cell sample was used as a control for auto-fluorescence. Data was analyzed for three independent exposure experiments measured in triplicate. 1 mM hydrogen peroxide (Invitrogen) was used as positive controls.

[00136] Ribonucleic acid (RNA) was extracted from the treated cells with different approaches (non-treated, regular neural treated and laser-treated with/- out AuNPs) after 1 , 7 and 14 days per published methods [A10, A1 1 ]. Briefly, trypsinized cells were centrifuged at 1500 rpm for 5 min and the pellet was washed with PBS and centrifuged again. Total RNA was extracted using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA) according to the manufacturer's protocol. Single-stranded cDNA synthesis was performed with 100 ng total RNA using a Superscript II I cDNA synthesis kit (Thermo Fisher Scientific, Waltham, MA). Data was analyzed by the 2-AACt method with normalization to the Ct of the housekeeping gene GAPDH (glyceraldehyde 3-phosphate dehydrogenase).

Primer sequences are described in Table 1 . Table 1. The list of primers used for reverse transcription polymerase chain reaction (RT-PCR) analysis.

Gene Primer Sequence

F: f^■ - GGTGTGAACGGATTTGGCCGTAT -3 ^" (SEQ ID NO: 1)

GAPDH

R: - C TC AGC AC C AGC GTC AC C C C^'ATT -3 (SEQ ID NO: 2)

F: - C TC C TATGC C TC C TC C GAGAC GAT -3 (SEQ ID NO: 3)

GFAP

R: - GC TC GC TGGC C C GAGTC TC TT -3 (SEQ ID NO: 4)

F: - GTC C GC C TGC C TC TTC GTC TC TA -3 (SEQ ID NO: 5) p-Tuhulin III

R: - - GGC C C C TATC TGGTTGC C GC AC T -3 (SEQ ID NO: 6)

F: - C C GGGTC AAG AC GC T AG A AG A -3 (SEQ ID NO: 7) estin

R: - C TC C AGC TC^* TTC C GC AAGGTTGT (SEQ ID NO: 8)

F: - C GAC TC ATC TTTC C TTC TC TA A - (SEQ ID NO: 9)

OLIG:

R: -· - C GC AC TT AC C TCATC ATT G -3 (SEQ ID NO: 10)

F: - AC ATTGTGAC AC C TC GA AC AC C -3 ^' (SEQ ID NO: 11)

MBP

R: - GC C AAATC C TGGC TTC TGC -3^' (SEQ ID NO: 12)

[00137] After certain times (day 1 , 7, and 14) of treatment, the differentiation of hNSCs was analyzed using Western blot analysis as reported before[A10]. Cell pellets were obtained by centrifugation, washed twice with PBS, and lysed with protein extraction buffer (Bio-Rad, Irvine, CA) for 30 s. The supernatant was cleared by centrifugation and the protein concentration was determined based on a BCA assay (Pierce, Rockford, IL). Equal amounts of protein extracts were fractionated to size by electroporation in 10% sodium dodecyl sulfate- polyacrylamide gels (SDS-PAGE), and the size-resolved proteins were

electroblotted onto polyvinylidene difluoride (PVDF) membranes (Millipore, Bedford, MA). Membranes were blocked with 4% non-fat dried milk or with BSA, incubated with monoclonal antibodies for β-tubulin III (Abeam, Cambridge, MA, USA) and Glial fibrillary acidic protein (GFAP) (Abeam, Cambridge, MA, USA). Immune-protein complexes were detected using secondary antibodies. The SuperSignal West Dura as an enhanced chemiluminescence horse radish peroxidase (HRP) substrate reagent (Thermo Fisher Scientific, Waltham, MA) was added to the membrane for 1 min and exposed to x-ray film for varying periods to produce images and bands quantified with ImageQuant (GE Healthcare Bio- Sciences, Pittsburgh, PA).

[00138] For immunocytochemistry of differentiated hNSCs, the cells were first fixed for 15 min in 3% paraformaldehyde in PBS and permeabilized with 0.1 % Triton X-100 in PBS for 15 min, followed by overnight incubation at 4 °C in the following primary antibodies: anti- -tubulin III (1 : 100; Abeam, Cambridge, MA, USA) and anti-GFAP (1 :500; Abeam, Cambridge, MA, USA). The cells were washed with PBS, and incubated with either goat anti-rabbit FITC (1 :200; Sigma, MO, USA) or goat anti-mouse tetramethylrhodamine (TRITC) (1 :500; Sigma, MO, USA). Image-iT FX Signal Enhancer (Thermo Fisher Scientific) was used as the primary blocking agent and 5% BSA (in TBS Tween 20 Buffer) was used for all other blocking steps. The samples were subsequently mounted using an EMS Shield Mounting Medium with 4,6-diamidino-2-phenylindole (DAPI) and Propyl Gallate (Electron Microscopy Sciences; Hatfield, PA, USA). Fluorescent microscopy measurements were performed using a Leica TCS SP5 confocal laser scanning microscope.

[00139] Conventional whole-cell patch clamp recordings were performed in dissociated cells to record voltage-gated sodium and potassium ions

currents[A12]. Briefly, coverslips containing differentiated hNSCs were placed on the stage of a Leica DMi8 inverted microscope (Leica Microsystems Inc., Buffalo Grove, IL) for patch clamp recordings using an Axon 200A/B amplifiers (Molecular Devices, LLC Sunnyvale, CA). Recording electrodes of 4.5 to 8 ΜΩ were pulled from Kovar Sealing 7056 Corning (Glass Dynamics LLC) glass pipettes by a micropipette puller (P-97, Sutter. Instruments, Novato, CA). The offset potential of the tip was adjusted after immersion into recording solution. All single measure receptor currents were recorded at 70 mV holding potentials. The recording was performed at room temperature and pH 7.4. The extracellular physiological solution contained (in mM): 138 NaCI, 5 potassium chloride (KCI), 2 calcium chloride (CaCI₂), 1 .2 magnesium chloride (MgCI2), 10 glucose, 10 HEPES and 1 sodium pyruvate (pH 7.4 with NaOH). The pipette solution was (mM): 140 KCI, 1 .2 MgCI2, 5 EGTA, 10 HEPES (pH 7.4 with KOH) as the K+-electrode solution and 130 CsCI, 10 tetraethylammonium (TEA)-CI, 1 .2 MgCI₂, 2 ATP-Mg, 5 EGTA and 10 HEPES (pH 7.2 with CsOH) as the Cs+-electrode solution[A13].

[00140] Calcium imaging experiments were performed with confocal microscopy[A14]. At first, the culture medium was exchanged to the extracellular medium (pH 7.4, 136 mmol NaCI, 2.5 mmol KCI, 2 mmol CaCI₂, 1 .3 mmol MgCI₂, 10 mmol HEPES and 10 mmol Glucose). After washing the cells with fresh PBS, the cells were loaded with Fluo-4 AM dye (2.5 μιηοΙ, Invitrogen, CA, USA) for 30 min at room temperature, followed by washing. Time-lapse calcium level in live hNSCs was imaged using the Leica TCS SP5 confocal laser scanning microscope after electrical stimulation of cells over 10 min. ImageJ software was used for the quantitative analysis of fluorescence intensity for >20 individual cells.

[00141] All the experiments were conducted at least in triplicate. The statistical analysis of the experimental data was done using the t-test, and the results were presented as mean ±S.D. Statistical significance was accepted at a level of p < 0.05.

[00142] A localized EMF is generated around the gold nanoparticles

(AuNPs) in the target mitochondria site to examine how EMFs influence the differentiation behavior of NSCs (Figure 1 a)^{[23 241}. Biocompatibility, chemical stability and adjustable optical properties of AuNPs make them versatile for many biomedical applications^124"281. Besides, the possibility of surface modification on AuNPs allow to target specific regions within the cells, which makes the use of these particles a promising candidate for cellular investigations. AuNPs have also been successfully delivered into cells without affecting cell viability[29], and internalized in mitochondria with no reported apoptosis or necrosis^{130 311}.

[00143] The interaction of NPs with cells starts with the contact with plasma membrane followed by subsequent entry into cells via endocytosis or other means such as pores and channels on the plasma membrane¹²⁸' ^31_331. This complex interaction is highly dependent on the size, shape and surface property of NPs. After internalization, it is necessary to direct NPs to their specific target within cells. Conjugation of cationic groups to the surface of AuNPs results in water- dispersed NPs^{[3 ]}. Triphenylphosphonium (TPP) is a lipophilic phosphonium cation with a high affinity to mitochondria. TPP cations have been used for studying mitochondrial bioenergetics and free radicals^{127 31 351}. In this study, the AuNPs were functionalized with the phosphonium groups (TPP cations) for mitochondrial localization. The attachment of AuNPs to the TPP cations produced a mechanism targeting the mitochondria followed by their accumulation within the cells. This system enables studying the intracellular effects of localized EMFs by laser irradiation.

[00144] AuNPs were synthesized as detailed in Supporting Information, functionalized with TPP, and analyzed with UV-visible spectrophotometry, high resolution transmission electron microscopy (HR-TEM), and dynamic light scattering (DLS). The HR-TEM analysis of the AuNP-TPP (Figure 1 b) shows spherical and monodispersed functionalized NPs, corroborated with the size distribution analysis of particles using DLS, presenting an average particle size of approximately 10 nm (Figure 1 c). Particles with the size of 10 nm are selected in this study given their acceptable level of cellular uptake¹³¹' ³²¹ and the ease of tracing them inside the cells'³⁶¹. The UV-Vis absorption measurement of AuNPs (Figure 1 d) illustrates the maximum absorption wavelength at 529 nm

corresponding to the localized surface plasmon resonance (LSPR) of AuNPs¹³⁷¹, shifted to 520 nm after TPP conjugation. The refractive index around the particles changes after TPP binding, which consequently causes the shift in the wavelength of absorption peak, confirming the strong binding of TPP to the surface of AuNPs (Figure 1 -d). The successful conjugation of TPP on the surface of AuNP-Amine is also confirmed using 1 H NMR (Figure 5). It was demonstrated that the surface density of TPP on the surface of AuNPs can be controlled by changing the concentration of TPP in the reactant mixture.

[00145] The absorption cross-section, a_{a >s}, of the light-stimulated AuNPs is the equivalent surface area required to absorb the same amount of power in the absence of NPs. NPs typically have absorption cross-sections larger than their dimensions because of the localized surface plasmon polariton (SPP)

resonances¹³⁸¹. Increasing the size of nanospheres from 10 to 14 nm does not change the resonance wavelength considerably (/_res ~ 527 nm) but increases o_abs significantly (Figure 1 e). As an example, a NP with a radius of 5 nm has a o_abs of approximately 71 .84 nm² at 540 nm. Assuming the exposure of cells to 1 mW of laser power over a spot size diameter of 2 μιη, the power of approximately 22.87 pW is absorbed per NP (Figure 1 f-h). [00146] The intracellular localization and distribution of NPs were

investigated by confocal laser scanning microscopy (CLSM). Figures 2(a-d) illustrate the fluorescent images of incubated NSCs with non-functionalized AuNPs (Figure 2a, c) and functionalized AuNPs (Figure 2b, d) for 4 h at 37 °C. The green fluorescence image is related to the fluorescein isothiocyanate isomer (FITC) labeled NPs (panel i), while the red fluorescence image indicates

MitoTracker (panel ii). Panel iii with yellow spots shows the merged images of green and red, demonstrating the mitochondrial localization of NPs. The degree of colocalization is also demonstrated in Figures 2b and 2d for cells incubated with AuNPs and TPP-AuNPs, respectively. The confocal images reveals the high level of NPs internalization in NSCs and the successful colocalization of AuNP-TPP in mitochondria, concluded from yellow fluorescence signals in panel iii. The higher association between the red and green fluorescence channels, represented in intensity-based 3D reconstruction of fluorescent images (Figure 2d), also confirms a successful colocalization with TPP-AuNPs in comparison with unmodified AuNPs.

[00147] Additional spectrometric assays were performed to confirm and quantify the presence of TPP-AuNPs inside the cells. Cellular internalization of AuNPs and TPP-AuNPs were measured by the fluorescence activated cell sorting (FACS) method (Figure 2e(i)) and inductively coupled plasma mass spectrometry (ICP-MS) (Figure 2e(ii)). Although surface functionalization with TPP results in a slight decrease in cellular uptake compared to non-functionalized NPs, a high number of internalized NPs are observed in both functionalized and non- functionalized NPs. However, mitochondrial uptake, as quantified by mitochondria isolation, confirms a higher targeting efficiency of 75% for AuNP-TPP compared to 30% for AuNPs after 4 h co-culturing.

[00148] The examination of TPP-AuNPs cytotoxicity as one critical step after internalization was performed by the MTT assay. The viability of cells in the presence of AuNPs and TPP-AuNPs with and without irradiation (See Supporting Information for details) was measured, and statistically compared among various concentrations of NPs from 0.25 μg.ml^"1 to 40 μg.ml^"1 (Figure 2f). It seems that the viability of all treated cells (AuNPs-TPP and AuNPs-Amine with/-out irradiation) are quite high (> 95%) after the incubation with low concentrations of NPs (up to 1 μg.ml^"1). The results also indicate that the surface functionalization of NPs has a trivial impact on the toxicity of NPs. The increase in the concentration of AuNPs from 0.25 μg.ml^"1 to 40 μg.ml^"1 causes a significant cellular toxicity, especially in the presence of irradiation. The irradiated cells in both groups, incubated with AuNPs and TPP-AuNPs, show a lower cell viability compared to non-irradiated cells. A plausible explanation for the reduction in cell viability is the involvement of a higher production rate of ROS. The excessive concentration of ROS can lead to oxidative stress and cell death.¹³⁹' ⁰¹ The results indicate that the fraction of dead cells increases for cells loaded with high concentrations of NPs (above 5 μg.ml^"1) while the cell viability is above 90% at low concentrations of NPs (up to 5 μg.ml^"1). The dose-dependent results confirm that the cellular toxicity of NPs is trivial even after IR irradiations at concentrations below 2 μg.ml^"1. It should be noted that the optimal cell viability (> 95%) was achieved by setting the concentration of NPs to 1 μg.ml^"1 , even in the presence of irradiation selected for further experiments.

[00149] Despite the destructive effects of ROS, these active species can act as the second messenger in a wide variety of biological processes^139-411. A growing body of evidence indicates that ROS have mediatory roles in cell growth, proliferation and differentiation!^{39 42]}. The implication of ROS as the second- messengers in maintenance and growth of cells has been demonstrated for NSCs^[431. Interestingly, it has been reported that ROS can influence NSC differentiation and regulate neurogenesis.^{141 441} EMFs affect ROS generation as a factor influencing the SC fate. The stimulation of NADH-oxidase pathway and ROS production in mouse bone marrow-derived cells after applying extremely low frequency magnetic field (ELF-MF) (50 Hz, 1 mT); enhanced production of ROS in murine L929 fibrosarcoma cells exposed to the radiofrequency EMFs (at 900 MHz); increased ROS level in the rat lymphocytes under treatment with a combination of radiofrequency radiation and iron ions; and elevated ROS level and enhanced neural differentiation of human MSCs exposed to ELF-EMF (50 Hz, 1 mT), are some evidence of the EMF impact on ROS generation. It should be noted that EMFs can also influence the activation of antioxidant enzymes and prevent ROS generation. In rat's liver mitochondria, for example, the generation of free radicals was prevented upon the activation of antioxidant enzymes through EM pulse exposure (60 kV/m strength). An increase in the activity of SOD enzymes after the exposure of mice and rat brains, respectively, to the ELF- magnetic field of 60 Hz and 50 Hz are other indicators of the effect of EMF on antioxidant activities¹¹⁰¹. In a study on embryonic NSC, the messenger ribonucleic acid (mRNA) level of genes related to neuronal differentiation was affected after the treatment of cells with 50 Hz ELF-EMF (2 mT for 3 days)[45].

[00150] On the other hand, mitochondrial activity and the amount of ROS generation are closely related¹¹⁰¹. The rate of mitochondrial activity is higher in undifferentiated NSCs in contrast to differentiated neurons and glial cells while the rate of ROS generation is less¹⁴⁶¹. It is, therefore, suggested that the intracellular redox balance may be influenced after laser irradiation, and ROS may serve as a regulating factor in differentiation of NSCs.

[00151] To examine the effect of laser irradiation on intracellular redox state, the cellular ROS value was measured after laser irradiation. To detect ROS formation, the fluorescence intensity of dihydrorhodamine 123 (DHR123), as a ROS tracking agent, was measured using fluorescence spectrophotometry.

Figure. 2g shows the increase in the fluorescence intensity with irradiation time, indicating that the ROS concentration can be adjusted by tuning the irradiation time. Also, Figure. 2h shows the increase in the intracellular ROS concentrations within the cells after laser irradiation. The detected decline in the plateau level of the ROS intensity occurring after each peak in the graph can be attributed to the short lifetime of ROS and the activity of various redox systems inside the cells (like antioxidants¹⁴⁷¹ having a suppressive effect on the ROS) which balances the cellular oxidative stress¹²⁶¹.

[00152] The reverse transcription polymerase chain reaction (RT-PCR) technique was further employed to investigate neural differentiation of NSCs after treatment with NPs followed by laser irradiation. The RT-PCR data shows that NPs and laser irradiation induced differentiation of NSCs via altering the expression levels of Nestin, β-tubulin III, myelin basic protein (MBP), Olig2 and Glial fibrillary acidic protein (GFAP), as representative marker genes for neural stem/precursor cells, neuron, oligodendrocyte, and astrocytes, respectively. It is well-known that upon differentiation of NSCs, the expression of Nestin, a marker for undifferentiated NSCs, decreases progressively and the level of neuronal differentiation markers increases¹⁴⁸¹, implying the production of more mature cells, in agreement with RT-PCR data (Figure 3).

[00153] At three different stages (day 1 , 7 and 14), cells from different groups (treated with or without laser irradiation and TPP-AuNPs/AuNPs) were processed for gene expression analyses. The expression of each gene was plotted in Figure 3(a-d) and Figure 9 after normalizing to the expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA. For negative control group, the cells were cultured in normal culture medium without any treatment with NPs and irradiation. For positive control group, the cells were cultured in differentiation medium containing neurobasal medium with B-27 serum-Free supplement and GlutaMAX-l to induce neural differentiation. Under the negative control condition, NSCs express a high level of Nestin while neuronal differentiation markers (β-tubulin III, MBP, Olig2, and GFAP) stay at their lowest levels. As determined by RT-PCR, the expression of β-tubulin III, MBP, Olig2, and GFAP is up-regulated within two weeks of differentiation, and the expression of Nestin decreases in the differentiation groups compared to negative control.

[00154] The effect of laser irradiation on up-regulation of the differentiation markers like β-tubulin III, MBP and GFAP and down-regulation of the Nestin level are shown in Figure. 3(a-d). More importantly, the results indicate that changes in the expression of markers are most conspicuous when NSCs are treated with both NPs and laser irradiation. The exposure to laser irradiation increases the gene expression of β-tubulin III, MBP, Olig2 and GFAP and significantly decreases the Nestin expression, hinting at the potential of irradiation for differentiating NSCs into neurons, astrocytes and oligodendrocytes. After a two- week treatment with NPs and irradiation, a clear difference are observed in the expression of neuronal markers between the irradiated and non-irradiated cells containing NPs, which indicates that the low power laser irradiation (here 1 mW) has a strong impact on NSC differentiation. Note that the effect of irradiation is more prominent on the marker expression in the groups of cells loaded with TPP- AuNPs compared to the cells containing non-functionalized AuNPs. The expression of Nestin in irradiated NSCs containing TPP-AuNPs shows no significant difference respect to those of the positive control group with five times less expression of Nestin than the negative control group (Figure 3c). In contrast, the neuronal differentiation markers in the cells irradiated for two weeks show a significant up-regulation compared to the non-treated group, especially β-tubulin III and Olig2 expressed one-fold more than the negative control. The N-Acetyl-L- cysteine (NAC) as a ROS scavenger was also used to confirm whether ROS generation using the laser irradiation is the cause of the proposed biological effects. As shown in Figure 6, the ROS scavenger can eliminate ROS signals in vial. Evaluating the RT-PCR results of β-tubulin I II and Nestin expression compared to housekeeping gene (GFAP), it is found that the inhibition of ROS generation can prevent neural differentiation as expected (Supplementary Figure 7).

[00155] Western blotting assay and CLSM were used to verify the laser irradiation effect on NSC differentiation in the presence of TPP-AuNPs. In agreement with the RT-PCR results, the protein expression assay demonstrate the neural differentiation potential of NSCs containing NPs after the irradiation in which the cells are labeled for β-tubulin III and GFAP. The protein expression plot for β-tubulin III show the increasing number of β-tubulin III positive cells within 14 days after treatment with TPP-AuNPs in both groups of irradiated and non- irradiated, like what detected for the control group with normal neurodifferentiation treatment. As depicted in Figure. 3f, the number of β-tubulin III positive cells from the irradiated group is approximately twice the number of positive cells in the non- irradiated group. After 14 days, the number of β-tubulin I II positive cells reaches about 20 percent of the total cells in the irradiated group while that is close to the control group with normal neural differentiation treatment (See Supporting Information for more details). A similar trend is observed within 14 days for the GFAP expression. However, there is no significant difference between the irradiated, non-irradiated and control groups after 14 days. Overall, the protein expression plots show increased percentages of GFAP positive and β-tubulin III positive cells after irradiation of NSCs containing NPs, confirming the

differentiation of NSCs into neurons and astrocytes. Notably, NSCs containing NPs show more tendency toward glial differentiation with or without irradiation. Also the incidence of neuronal differentiation is also supported by the CLSM image of NSCs containing TPP-AuNPs after laser irradiation at 1 mW (Figure 3g). The cells are stained with antibodies against GFAP (green) and β-tubulin III (red) while the nuclei are counterstained with DAPI (blue). Both GFAP and β-tubulin III are detected in CLSM images, confirming the presence of GFAP+ and β-tubulin III+ cells, and the differentiation of cells at day 14.

[00156] To assess the functionality of differentiated cells, their neural activity was examined by measuring their electrophysiological properties, including the membrane currents and Ca²⁺ concentration. First, the presence of the voltage- gated channels was studied after stimulation of the differentiated cells with the depolarizing current injection using patch clamp whole-cell recording as described before¹⁴⁹¹. In voltage-dependent currents, recorded in the 7 and 21 -day (Figure 4a, b), the holding potential was set at -70 mV, and 20 ms depolarizing pulses were applied from -60 mV to +60 mV in 20 mV steps to evoke channel opening. The current-voltage relationship of sodium (Na+) currents in cells undergoing 7 and 21 days terminal differentiation show remarkable inward Na+ current with a mean peak of approximately -870 ± 50 pA at -20 mV for the second stage of maturation (day 21 ) (Figure 4a). The l-V relationship of the potassium (K+) current at two stages of maturation demonstrates an outward current (Figure 4b). These voltage- dependent Na+ and K+ currents in the stimulated cells indicate that voltage- sensitive ion channels exist in the differentiated cells, confirming the presence of physiologically active neuronal cells. However, NSCs treated with AuNP-TPP without irradiation fail to show the same level of voltage-dependent Na+ and K+ currents (Figure 9). [00157] Next, calcium imaging experiments were performed to monitor the change of Ca²⁺ level as a physiological marker of differentiation inside the differentiated cells. To verify intracellular Ca²⁺ concentration, the cells were electrically stimulated as described before¹⁵⁰¹. The calcium imaging represents a transient calcium increase in the stimulated cells (Figure 4c), which is quantified in Figure 4d. Based on the plot of the relative change (AF/F) of the cell fluorescence intensity versus the stimulation period, over 60% increase in the fluorescence intensity is observed after the stimulation, corroborating an increased intracellular Ca²⁺ concentration. This result implies the appearance of voltage-sensitive Ca²⁺ channels in the differentiated cells, which is a basic neuronal membrane characteristic. Thus, the voltage pulse stimuli open the Ca²⁺ channels and increase the Ca²⁺ concentration in the differentiated cells¹⁵¹¹. Overall, this study show that laser irradiation significantly increases the expression of neuronal differentiation genes in the presence of NPs, emphasizing the potential of EM exposure to enhance neuronal differentiation of NSCs.

[00158] Although researchers are struggling to bring up the mechanisms underlying EM exposure for SC differentiation, some reports have suggested the probable relationship between ROS production and underlying mechanisms of EM exposure for differentiation. Additionally, the relationship between ROS generation and mitochondrial activity of differentiated and undifferentiated NSCs suggests the control of SC fate through controlling ROS generation. Our results also show that ROS production increases in NSCs after the exposure to laser irradiation. It seems reasonable to suggest that ROS production is involved in the mechanisms underlying the interaction of EMF and NSCs.

[00159] It should be highlighted that EMF may cause differentiation in NSCs through the activation of ionic channels and alteration in ion concentration¹⁵²¹, changes in gene expression (transcriptional factors and pluripotency markers)¹⁵³¹ and influencing intracellular molecular mechanisms such as MAPK pathway¹¹⁴¹. However, the underlying mechanisms of EM exposure responsible for neural differentiation of NSCs is still unclear and need to be further clarified. [00160] However, our approach has been utilized as a technique

(nanoparticles and stimulatory EM generation) to promote the differentiation of NSCs in the absence of soluble cues (like exogenous proteins). This methodology can also potentially be helpful to investigate how localized generation of EMFs in a targeted site (mitochondria or cell membrane) can influence cell responses to explore the feasibility of NSC differentiation through localized EMF. Furthermore, our proposed system can be used as a research tool to study the intracellular effects of localized electromagnetic fields (EMFs) within the cells and identify genes and signaling pathways effective in regulation of NSC fate. This system can also be translated into better understanding how NSCs balance self-renewal versus differentiation to address an optimal treatment for neurodegenerative diseases like Alzheimer's and Parkinson's. Although we focused on NSCs differentiation, this technique could be extended to study and control the fate of other stem cells, from a variety of types, stages of differentiation and sources.

[00161] References

[00162] [1 ] S. Yamanaka, J. Li, G. Kania, S. Elliott, R. P. Wersto, J. Van Eyk, A. M. Wobus, K. R. Boheler, Cell and Tissue Research 2008, 331 , 5.

[00163] [2] S. N. B. Bernhard O. Palsson, Tissue Engineering, Pearson Prentice Hall,, 2004 ; B. Mead, A. Logan, M. Berry, W. Leadbeater, B. A.

Scheven, Stem Cells 2017, 35, 61 ; I. Lombaert, M. M. Movahednia, C. Adine, J. N. Ferreira, Stem Cells 2017, 35, 97.

[00164] [3] K. Reekmans, J. Praet, J. Daans, V. Reumers, P. Pauwels, A. Van der Linden, Z. N. Berneman, P. Ponsaerts, Stem Cell Reviews and Reports 2012, 8, 262.

[00165] [4] A. Chojnacki, S. Weiss, Nature Protocols 2008, 3, 935.

[00166] [5] G. Martino, S. Pluchino, Nature Reviews Neuroscience 2006, 7, 395; B. J. Cummings, N. Uchida, S. J. Tamaki, D. L. Salazar, M. Hooshmand, R. Summers, F. H. Gage, A. J. Anderson, Proceedings of the National Academy of Sciences of the United States of America 2005, 102, 14069.

[00167] [6] F. Gattazzo, A. Urciuolo, P. Bonaldo, Biochimica et

Biophysica Acta (BBA)-General Subjects 2014; F. M. Watt, W. T. Huck, Nature Reviews Molecular Cell Biology 2013, 14, 467; C. Wang, J. Chen, P. Wen, P. Sun, R. Xi, in Regenerative Medicine-from Protocol to Patient, Springer, 2016, 57.

[00168] [7] J. A. Knoblich, Cell 2008, 132, 583; H. Toledano, D. L. Jones, 2009.

[00169] [8] A. Markkanen, Kuopio Univ Environ Sci 2009, 253, 1 .

[00170] [9] C. Furse, D. A. Christensen, C. H. Durney, Basic Introduction to Bioelectromagnetics, CRC press, 2009.

[00171] [10] S. H. Tamrin, F. S. Majedi, M. Tondar, A. Sanati-Nezhad, M. M. Hasani-Sadrabadi, in Reviews of Physiology, Biochemistry and Pharmacology, Vol. 171 , (Eds: B. Nilius, P. de Tombe, T. Gudermann, R. Jahn, R. UN, O. H. Petersen), Springer International Publishing, Cham 2016, 63.

[00172] [1 1 ] M. Rahnama, J. A. Tuszynski, I. Bokkon, M. Cifra, P. Sardar, V. Salari, Journal of Integrative Neuroscience 201 1 , 10, 65.

[00173] [12] J. Zimmerman, M. Pennison, I. Brezovich, N. Yi, C. Yang, R. Ramaker, D. Absher, R. Myers, N. Kuster, F. Costa, British Journal of Cancer 2012, 106, 307; H. Sauer, G. Rahimi, J. Hescheler, M. Wartenberg, Journal of Cellular Biochemistry 1999, 75, 710; J. Friedman, S. Kraus, Y. Hauptman, Y. Schiff, R. Seger, Biochem. J 2007, 405, 559; M. Blank, R. Goodman,

Pathophysiology 2009, 16, 71 .

[00174] [13] S. Falone, M. R. Grossi, B. Cinque, B. D'Angelo, E.

Tettamanti, A. Cimini, C. Di llio, F. Amicarelli, The International Journal of

Biochemistry & Cell Biology 2007, 39, 2093.

[00175] [14] J. Arthur, Biochem. J 2007, 405, e5; H.-J. Li, L.-M. Guo, L.-L. Yang, Y.-C. Zhou, Y.-J. Zhang, J. Guo, X.-J. Xie, G.-Z. Guo, Toxicology letters 2013; D. Leszczynski, S. Joenvaara, J. Reivinen, R. Kuokka, Differentiation 2002, 70, 120.

[00176] [15] K. S. Kang, J. M. Hong, J. A. Kang, J.-W. Rhie, Y. H. Jeong, D.-W. Cho, Experimental & molecular medicine 2013, 45, e6; C. Consales, C. Merla, C. Marino, B. Benassi, International Journal of Cell Biology 2012, 2012.

[00177] [16] Q. Gao, The Hong Kong Polytechnic University, 2016. [00178] [17] Q. Ma, C. Chen, P. Deng, G. Zhu, M. Lin, L. Zhang, S. Xu, M. He, Y. Lu, W. Duan, PLoS One 2016, 1 1 , e0150923.

[00179] [18] J.-E. Park, Y.-K. Seo, H.-H. Yoon, C.-W. Kim, J.-K. Park, S. Jeon, Neurochemistry International 2013; J. C. St. John, J. Ramalho-Santos, H. L. Gray, P. Petrosko, V. Y. Rawe, C. S. Navara, C. R. Simerly, G. P. Schatten, Cloning and Stem Cells 2005, 7, 141 .

[00180] [19] A. Y. Andreyev, Y. E. Kushnareva, A. Starkov, Biochemistry (Moscow) 2005, 70, 200.

[00181] [20] V. Adam-Vizi, C. Chinopoulos, Trends in Pharmacological Sciences 2006, 27, 639.

[00182] [21 ] R. Loureiro, K. A Mesquita, P. J Oliveira, I. Vega-Naredo, Recent patents on endocrine, metabolic & immune drug discovery 2013, 7, 102.

[00183] [22] G. C. Parker, G. Acsadi, C. A. Brenner, Stem Cells and Development 2009, 18, 803; X. Q. Ye, Q. Li, G. H. Wang, F. F. Sun, G. J. Huang, X. W. Bian, S. C. Yu, G. S. Qian, International Journal of Cancer 201 1 , 129, 820; M. B. de Moura, L. S. dos Santos, B. Van Houten, Environmental and Molecular Mutagenesis 2010, 51 , 391 .

[00184] [23] L. Bergamini, V. Voliani, V. Cappello, R. Nifosl, S. Corni, Nanoscale 2015, 7, 13345.

[00185] [24] X. Huang, M. A. El-Sayed, Journal of Advanced Research 2010, 1 , 13.

[00186] [25] V. Raji, J. Kumar, C. Rejiya, M. Vibin, V. N. Shenoi, A.

Abraham, Experimental Cell Research 201 1 , 317, 2052.

[00187] [26] M. K. Khaing Oo, Y. Yang, Y. Hu, M. Gomez, H. Du, H.

Wang, ACS Nano 2012, 6, 1939.

[00188] [27] Y. Li, A. M. Gobin, G. W. Dryden, X. Kang, D. Xiao, S. P. Li, G. Zhang, R. C. Martin, Int J Nanomedicine 2013, 8, 2153.

[00189] [28] O. F. Karatas, E. Sezgin, O. Aydm, M. Qulha, Colloids and Surfaces B: Biointerfaces 2009, 71 , 315. [00190] [29] D. N. Grant, M. J. Cozad, D. A. Grant, R. A. White, S. A. Grant, Journal of Biomedical Materials Research Part B: Applied Biomaterials 2015, 103, 1532.

[00191] [30] R. R. Sathuluri, H. Yoshikawa, E. Shimizu, M. Saito, E.

Tamiya, PloS One 201 1 , 6, e22802.

[00192] [31 ] M. Kodiha, Y. M. Wang, E. Hutter, D. Maysinger, U. Stochaj, Theranostics 2015, 5, 357.

[00193] [32] A. Christofidou, University of Southampton, 2013.

[00194] [33] S. Soleimani, M. M. Hasani-Sadrabadi, F. S. Majedi, E.

Dashtimoghadam, M. Tondar, K. I. Jacob, Colloids and Surfaces B: Biointerfaces 2016.

[00195] [34] N. Lalwani, Y.-S. Chen, G. Brooke, N. A. Cross, D. W. Allen, A. Reynolds, J. Ojeda, G. J. Tizzard, S. J. Coles, N. Bricklebank, Chemical Communications 2015, 51 , 4109; Y. Ju-Nam, Y.-S. Chen, J. J. Ojeda, D. W. Allen, N. A. Cross, P. H. Gardiner, N. Bricklebank, RSC Advances 2012, 2, 10345.

[00196] [35] M. Ross, G. Kelso, F. Blaikie, A. James, H. Cocheme, A. Filipovska, T. Da Ros, T. Hurd, R. Smith, M. Murphy, Biochemistry (Moscow)

2005, 70, 222.

[00197] [36] B. D. Chithrani, A. A. Ghazani, W. C. Chan, Nano Letters

2006, 6, 662.

[00198] [37] T. El-Brolossy, T. Abdallah, M. B. Mohamed, S. Abdallah, K. Easawi, S. Negm, H. Talaat, The European Physical Journal Special Topics 2008, 153, 361 .

[00199] [38] C. E. Talley, J. B. Jackson, C. Oubre, N. K. Grady, C. W. Hollars, S. M. Lane, T. R. Huser, P. Nordlander, N. J. Halas, Nano letters 2005, 5, 1569; R. Bharadwaj, S. Mukherji, S. Mukherji, Plasmonics 2016, 1 1 , 753.

[00200] [39] T. Rharass, H. Lemcke, M. Lantow, S. A. Kuznetsov, D. G. Weiss, D. Panakova, Journal of Biological Chemistry 2014, 289, 27937.

[00201] [40] Z. Krpetic, P. Nativo, V. See, I. A. Prior, M. Brust, M. Volk, Nano letters 2010, 10, 4549. [00202] [41 ] B. C. Dickinson, C. J. Chang, Nature Chemical Biology 201 1 , 7, 504.

[00203] [42] M. Schieber, N. S. Chandel, Curr. Biol. 2014, 24, R453; W. Droge, Physiological Reviews 2002, 82, 47; H. Sauer, M. Wartenberg, J.

Hescheler, Cellular Physiology and Biochemistry 2001 , 1 1 , 173.

[00204] [43] Z. Radak, K. Suzuki, M. Higuchi, L. Balogh, I. Boldogh, E. Koltai, Free Radical Biology and Medicine 2016, 98, 187; M. Yoneyama, K.

Kawada, Y. Gotoh, T. Shiba, K. Ogita, Neurochemistry International 2010, 56, 740; J. E. Le Belle, N. M. Orozco, A. A. Paucar, J. P. Saxe, J. Mottahedeh, A. D. Pyle, H. Wu, H. I. Kornblum, Cell Stem Cell 201 1 , 8, 59.

[00205] [44] M. Tsatmali, E. C. Walcott, H. Makarenkova, K. L. Crossin, Molecular and Cellular Neuroscience 2006, 33, 345; K. A. Kennedy, S. D.

Sandiford, I. S. Skerjanc, S. S. C. Li, Cellular and Molecular Life Sciences 2012, 69, 215; H. L. Vieira, P. M. Alves, A. Vercelli, Progress in Neurobiology 201 1 , 93, 444.

[00206] [45] Q. Ma, P. Deng, G. Zhu, C. Liu, L. Zhang, Z. Zhou, X. Luo, M. Li, M. Zhong, Z. Yu, PloS One 2014, 9, e90041 .

[00207] [46] V. A. Rafalski, A. Brunei, Progress in Neurobiology 201 1 , 93, 182; J. Zhang, I . Khvorostov, J. S. Hong, Y. Oktay, L. Vergnes, E. Nuebel, P. N. Wahjudi, K. Setoguchi, G. Wang, A. Do, H. J. Jung, J. M. McCaffery, I. J. Kuriand, K. Reue, W. N. P. Lee, C. M. Koehler, M. A. Teitell, The EMBO Journal 201 1 , 30, 4860.

[00208] [47] L. Gallego-Villar, B. Perez, M. Ugarte, L. R. Desviat, E.

Richard, Biochemical and Biophysical Research Communications 2014, 452, 457; W. Van den Ende, D. Peshev, L. De Gara, Trends in Food Science & Technology 201 1 , 22, 689; K. Das, A. Roychoudhury, Frontiers in Environmental Science 2014, 2, 53.

[00209] [48] H. Cho, Y. K. Seo, H. H. Yoon, S. C. Kim, S. M. Kim, K. Y. Song, J. K. Park, Biotechnology Progress 2012, 28, 1329.

[00210] [49] O. P. Hamill, A. Marty, E. Neher, B. Sakmann, F. Sigworth, Pflugers Archiv 1981 , 391 , 85. [00211] [50] C. Y. Pan, L. S. Kao, Journal of Neurochemistry 1997, 69, 1085.

[00212] [51 ] S. Y. Park, J. Park, S. H. Sim, M. G. Sung, K. S. Kim, B. H. Hong, S. Hong, Advanced Materials 201 1 , 23.

[00213] [52] C. Grassi, M. D'Ascenzo, A. Torsello, G. Martinotti, F. Wolf, A. Cittadini, G. B. Azzena, Cell Calcium 2004, 35, 307; C. Baureus Koch, M. Sommarin, B. Persson, L. Salford, J. Eberhardt, Bioelectromagnetics 2003, 24, 395; R. Piacentini, C. Ripoli, D. Mezzogori, G. B. Azzena, C. Grassi, Journal of Cellular Physiology 2008, 215, 129.

[00214] [53] M. Maioli, S. Rinaldi, S. Santaniello, A. Castagna, G. Pigliaru,

S. Gualini, C. Cavallini, V. Fontani, C. Ventura, Cell Transplantation 2013, 22,

1227; M. Maioli, S. Rinaldi, S. Santaniello, A. Castagna, G. Pigliaru, S. Gualini, V.

Fontani, C. Ventura, Cell Transplantation 2012, 21 , 1225.

[00215] [A1 ] P. B. Johnson, R. W. Christy, Physical Review B 1972, 6,

4370.

[00216] [A2] T. Rharass, H. Lemcke, M. Lantow, S. A. Kuznetsov, D. G. Weiss, D. Panakova, Journal of Biological Chemistry 2014, 289, 27937.

[00217] [A3] S. Marrache, S. Dhar, Chemical Science 2015, 6, 1832.

[00218] [A4] E. R. Bielski, Q. Zhong, M. Brown, S. R. P. da Rocha, Molecular Pharmaceutics 2015, 12, 3043.

[00219] [A5] X. Cheng, X. Tian, A. Wu, J. Li, J. Tian, Y. Chong, Z. Chai, Y. Zhao, C. Chen, C. Ge, ACS Applied Materials & Interfaces 2015, 7, 20568.

[00220] [A6] F. S. Majedi, M. M. Hasani-Sadrabadi, J. J. VanDersarl, N. Mokarram, S. Hojjati-Emami, E. Dashtimoghadam, S. Bonakdar, M. A.

Shokrgozar, A. Bertsch, P. Renaud, Advanced Functional Materials 2014, 24, 432.

[00221] [A7] Y. Yang, Y. Hu, H. Du, H. Wang, Chemical Communications 2014, 50, 7287.

[00222] [A8] M. Forkink, J. A. M. Smeitink, R. Brock, P. H. G. M. Willems, W. J. H. Koopman, Biochimica et Biophysica Acta (BBA) - Bioenergetics 2010, 1797, 1034. [00223] [A9] B. Kalyanaraman, V. Darley-Usmar, K. J. Davies, P. A.

Dennery, H. J. Forman, M. B. Grisham, G. E. Mann, K. Moore, L. J. Roberts, H. Ischiropoulos, Free Radical Biology and Medicine 2012, 52, 1 .

[00224] [A10] A. Moshaverinia, X. Xu, C. Chen, S. Ansari, H. H. Zadeh, M. L. Snead, S. Shi, Biomaterials 2014, 35, 2642.

[00225] [A1 1 ] M. M. Hasani-Sadrabadi, S. Pour Hajrezaei, S. Hojjati Emami, G. Bahlakeh, L. Daneshmandi, E. Dashtimoghadam, E. Seyedjafari, K. I. Jacob, L. Tayebi, Nanomedicine: Nanotechnology, Biology and Medicine 2015, 1 1 , 1809.

[00226] [A12] K. Francis, L. Wei, Cell death & disease 2010, 1 , e22.

[00227] [A13] T. Ishida, R. Takei, S. H. Gautam, K.-i. Otsuguro, T. Ohta, S. Ito, Y. Habara, T. Saito, Neuroscience Letters 2008, 441 , 277.

[00228] [A14] M. J. Mahoney, K. S. Anseth, Biomaterials 2006, 27, 2265.

[00229] The embodiments described herein are intended to be examples only. Alterations, modifications and variations can be effected to the particular embodiments by those of skill in the art. The scope of the claims should not be limited by the particular embodiments set forth herein, but should be construed in a manner consistent with the specification as a whole.

[00230] All publications, patents and patent applications mentioned in this Specification are indicative of the level of skill those skilled in the art to which this invention pertains and are herein incorporated by reference to the same extent as if each individual publication patent, or patent application was specifically and individually indicated to be incorporated by reference.

[00231] The invention being thus described, it will be obvious that the same may be varied in many ways. Such variations are not to be regarded as a departure from the spirit and scope of the invention, and all such modification as would be obvious to one skilled in the art are intended to be included within the scope of the following claims.

Claims

WHAT IS CLAIMED IS:

1 . A gold nanoparticle (AuNP) comprising a mitochondria targeting moiety.

2. The gold nanoparticle of claim 1 , wherein the targeting moiety comprises a lipophilic phosphonium cation.

3. The gold nanoparticle of any preceding claim, wherein the targeting moiety comprises triphenylphosphonium.

4. The gold nanoparticle of any preceding claim, wherein the diameter of said gold nanoparticle is about 10nm to about 300nm, preferably about 10 nm.

5. A gold nanoparticle conjugated to triphenylphosphonium, wherein the diameter of said gold nanoparticle is about 10nm to about 300nm, preferably about 10 nm.

6. A method of differentiating a neural stem cell (NSC), comprising:

illuminating one or more NSCs containing a gold nanoparticle according to any preceding claim with a laser configured to deliver about 1 mW to said NSC, wherein one or more differentiated cells are produced.

7. A method of generating reactive oxygen species (ROS) in a NSC, comprising: illuminating one or more NSCs containing a gold nanoparticle according to one of claims 1 to 5 with a laser configured to deliver about 1 mW to said NSC, wherein ROS are produced and wherein one or more differentiated cells are produced.

8. The method of claims 6 or 7, wherein the laser is configured to illuminate cells with a pulsed laser at about 20 Hz and 10% duty cycle.

9. The method of any one of claims 6 to 8, wherein the laser illuminates the cells with a pulsed laser at about 20 Hz and 10% duty cycle to deliver about 1 mW of power.

10. The method of any one of claim 6 to 8, wherein the cells are illuminated with a ultrasound, a microwave, or an acoustic source, configured to deliver about 1 mW of power.

1 1 . The method of any one of claims 6 to 10, wherein said one or more differentiated cells have altered mRNA levels for markers of differentiation, including one or more of Nestin, β-tubulin III, myelin basic protein (MBP), Olig2 and Glial fibrillary acidic protein (GFAP).

12. The method of any one of claims 6 to 10, wherein said one or more differentiated cells comprise one or more of neural stem/precursor cells, neuron, oligodendrocyte, or astrocytes.

13. The method of any one of claims 6 to 12, further comprising sorting the differentiated cells to obtain one or more enriched cell populations of differentiated cells.

14. The method of any one of claims 6 to 13, further comprising sorting the differentiated to cells to obtain an enriched population of neural stem/precursor cells, neuron, oligodendrocyte, or astrocytes.

15. A method of treating a subject having or suspected of having a

neurological disorder, comprising: administering an enriched population of differentiated cells, said enriched population of cells obtained according to the method of any one of claims 6 to 14, to a subject in need thereof.

16. The method of claim 15, wherein said neurological disorder is multiple sclerosis.

17. The method of claim 15, wherein said neurological disorder is Parkinson's disease.

18. The method of claim 15, wherein said neurological disorder is Alzheimer's disease.

19. The method of claim 15, wherein said neurological disorder is epilepsy.

20. A method of inducing wound healing and/or tissue regeneration in a subject comprising administering an enriched population of differentiated cells, said enriched population of cells obtained according to the method of any one of claims 6 to 14 to a subject in need thereof.

21 . The method of any one of claims 6 to 20, wherein the subject is a human.

22. A kit comprising: an AuNP and 3-Carboxypropyl)triphenylphosphonium bromide.

23. A kit comprising: an AuNP -TPP, and instructions for the use thereof.

24. A commercial package comprising an AuNP and 3- Carboxypropyl)triphenylphosphonium bromide.

25. A commercial package: an AuNP -TPP, and instructions for the use thereof.