WO2019018845A1 - Growth and sporulation of arbuscular mycorrhizal fungi - Google Patents

Abstract

Compositions and methods for promoting growth and sporulation of mycorrhizal fungi are disclosed.

Description

GROWTH AND SPORULATION OF ARBUSCULAR MYCORRHIZAL FUNGI

By:

Maria J. Harrison

Armando Bravo

This application claims priority to US Provisional Application No. 62/535,476 filed July 21, 2017, the entire contents being incorporated herein by reference.

This invention was made with government support under National Research Initiative Competitive Grant 2008-35301-19039 from the USDA National Institute of Food and Agriculture, U.S. National Science Foundation grant IOS-1127155, and U.S. Department of Energy, Office of Science (BER) grant DE-SC0012460. The government has certain rights in the invention.

FIELD OF THE INVENTION

The present invention relates to promoting or improving the growth and sporulation of symbiotic fungi. Compositions and methods for enhancing colonization of plant roots are provided. Methods for promoting sporulation and preparation of inoculums and formulations for colonization of plant roots with symbiotic fungi are also provided.

BACKGROUND OF THE INVENTION

Several publications and patent documents are cited throughout the specification in order to describe the state of the art to which this invention pertains. Each of these citations is incorporated herein by reference as though set forth in full.

Plants have evolved several mechanisms to interact with microorganisms to acquire nutrients from the soil. One of the most widespread mutualistic interactions is arbuscular mycorrhizal symbiosis (AMS), which is formed by the majority of land plants in association with arbuscular mycorrhizal (AM) fungi. During AMS, plants obtain mineral nutrients from the fungus in exchange for organic carbon that is produced during photosynthesis. AMS is an endosymbiosis whereby the AM fungi, which are obligate biotrophs, grow inside the cells of the root. Inside individual cortical cells, AM fungi form highly branched hyphae called arbuscules, which ultimately deliver mineral nutrients to the cortical cell and likely also function in carbon acquisition (Smith & Read, 2008). Each arbuscule is surrounded by a plant-derived membrane called the periarbuscular membrane (PAM) which has a unique transport protein composition that allows the exchange of nutrients with the fungal symbiont (Harrison et al., 2002; Javot et al., 2007; Kobae & Hata, 2010; Yang et al., 2012a; Krajinski et al., 2014; Wang et al., 2014). The area of the PAM has been estimated to be several-fold greater than the plasma membrane of the cell and therefore generation of the PAM requires extensive amounts of plant lipids (Cox & Tinker, 1976; Dickson & Kolesik, 1999). The proliferation of plastids and the formation of a plastid membrane network around the arbuscule (Fester et al., 2001) has been equated with metabolic activity, which could include lipid biosynthesis. Many plant lipid metabolism genes are up-regulated during AMS (Gomez et al., 2009; Gaude et al., 2012a; Tisserant et al., 2012; Hogekamp & Kuster, 2013; Tang et al., 2016), with specific increases in arbuscule-containing cells (Gaude et al., 2012b).

Furthermore, several genes involved in lipid metabolism are conserved exclusively in plants that engage in AMS (Bravo et al., 2016) and lipid profiling reveals extensive changes in lipid content during AMS (Stumpe et al., 2005; Schliemann et al., 2008; Wewer et al., 2014). It has been estimated that up to 20% of the carbon fixed during photosynthesis is transferred to the AM fungal symbiont (Bago et al., 2000). AM fungi import sugars, such as hexoses and xylose (Pfeffer et al., 1999; Helber et al., 2011). However, in the fungus carbon is moved long-distance through the mycelium in the form of lipids (Bago et al., 2002), and

triacylglycerols are the most abundant form of stored carbon in the fungus (Jabaji-Hare, 1988). Labelling experiments indicated that de novo fatty acid biosynthesis occurs in mycorrhizal roots but not in spores or extraradical hyphae (Pfeffer et al., 1999; Bago et al., 1999), although elongation and desaturation of pre-existing fatty acids was detected throughout the fungal mycelium (Trepanier et al., 2005). Based on these findings, Trepanier et al. considered two scenarios; firstly, that de novo fatty acid biosynthesis occurs exclusively in the plant and that the plant supplies fatty acids to the fungus or alternatively, that de novo fatty acid biosynthesis occurs in the fungus but only in the intraradical hyphae. At that time, Trepanier et al. favored the latter hypothesis; however, recent analyses of the Rhizophagus irregularis (formerly Glomus intraradices) genome and Gigaspora rosea transcriptome suggest that type 1 fatty acid synthase (FAS), the multi-domain enzyme required for de novo synthesis of most fatty acids, is absent from these AM fungi (Wewer et al., 2014; Tang et al., 2016). This raises the possibility that AM fungi may indeed depend on fatty acids produced by the host plant (Wewer et al., 2014).

In plants, de novo fatty acid biosynthesis takes place inside plastids and begins with the transfer of the malonyl group from malonyl-coenzyme A (CoA) onto an acyl carrier protein (ACP). Malonyl- ACP is then used, together with acetyl-CoA, by the multi-subunit FAS enzymes (type II) to produce long chain fatty acids (16- or 18-carbon molecules). De novo fatty acid biosynthesis can be terminated by the hydrolysis of acyl-ACP which releases the soluble ACP and the acyl group (Jones et al., 1995). This reaction is catalyzed by acyl- ACP thioesterases that, in some land plants, are encoded by two genes, Fat A and FatB (Jones et al., 1995; Salas & Ohlrogge, 2002; Bonaventure et al., 2003; Moreno-Perez et al., 2012). However, plants that are able to engage in AMS have an additional Fat gene called FatM. Lack of FatM function impairs AMS, and although the fatm mutant is colonized by AM fungi, arbuscule formation is defective (Bravo et al., 2016).

The presence of AM fungi is associated with plant increased plant growth and nutrient sharing. Compositions and methods that promote this process are highly desirable.

SUMMARY OF THE INVENTION

In accordance with the present invention, compositions and methods for modulating, enhancing, and/or improving growth and sporulation of symbiotic fungi are provided. An exemplary method entails contacting arbuscular mycorrizal fungi with a composition comprising a β-monoacylglycerol, or a derivative thereof. In a preferred embodiment, the fatty acid is 2-palmitoylglycerol (2-PG). In a particularly preferred embodiment the arbuscular mycorrizal fungi is Rhizophagus irregularis. In yet another embodiment, the fungi are associated with plant roots. Another aspect of the invention includes the addition of TWEEN 40 (Polyoxyethylenesorbitan monopalmitate) directly to the agar or other substrate (e.g., soil, sand or vermiculite) to promote hyphal growth.

In another embodiment of the invention, a biofertilizer composition comprising β- monoacylglycerol, or a derivative thereof and Rhizophagus irregularis is provided. The inventive biofertilizer of the invention may further comprise one or more of of urea, ammonia, ammonium nitrate, ammonium sulfate, calcium nitrate, diammonium phosphate, monoammonium phosphate, potassium nitrate and sodium nitrate, monopotassium phosphate, dipotassium phosphate, tetrapotassium pyrophosphate, and potassium metaphosphate. The biofertilizer of the invention can also comprise a macronutrient or micronutrient selected from the group consisting of sulfur, calcium, magnesium, boron, copper, iron, manganese, molybdenum and zinc. In yet another aspect, the biofertilizer composition further comprises a dispersing agent. BRIEF DESCRIPTIONS OF THE DRAWING

FIGURES 1A-1L. Arbuscule development is impaired in fatm and FatM is localized in plastids of cells with arbuscules. (FIG. 1A-1F) Confocal microscopy images showing arbuscules in M. truncatula WT segregant and fatm roots colonized with G. versiforme and stained with WGA-Alexa488. Fluorescence and differential interference contrast (DIC) merged images show arbuscules in (FIG. 1A, 1C, IE) FatM-WT and (FIG. IB, ID, IF) fatm at developmental stages that are most prevalent for each genotype: (FIG. 1A, IB) young arbuscules; (FIG. 1C, IE) mature arbuscules; (FIG. ID) small and collapsing arbuscules; (FIG. IF) collapsed arbuscules. Each image is a projection of 7 optical sections on the Z axis taken at 0.5 μιη intervals. White arrows point to fine branches that are collapsing. Scale bar, 10 μιη. (FIG. 1G, 1H) FatM is expressed in cells containing arbuscules. WT M. truncatula roots expressing FatMp: inlGFP colonized with G. versiforme. Fluorescence and DIC merged images. White arrowheads point to cells with arbuscules. Arbuscules are marked by asterisks. Scale bar = 50 μιη. (FIG. II- 1L) FatM is localized in stromulated plastids. M. truncatula roots expressing FatMp: :FatM-GFP and the plastid marker 35Sp::RUBlsp-mCherry (Ivanov & Harrison 2014) colonized with G. versiforme, 3 wpp. (FIG. II) DIC image; (FIG. 1J-L) fluorescence images showing mCherry, GFP and both merged, respectively. Yellow arrow points to stromulated plastids; red arrow points to disc-shaped plastids. The arbuscule is marked by an asterisk. Bars, 25 μιη.

FIGURE 2. Phylogenetic tree of Fat proteins. The phylogeny is based on Fat amino acid sequences and was constructed using 50 land plant genomes and 16 green algal species. Tree branches are colored based on taxonomic groups as follows: Red, Monocotyledons; blue, Eudicotyledons; yellow, basal Magnoliophyte (Amborellales); black, non-flowering land plants; dark green, Charophyta; light green, green algae. Pink arrows point to Medicago truncatula genes, and cyan arrows point to Arabidopsis thaliana genes. The tree is rooted using the green algal groups, and groups of genes from flowering plants are encircled in grey. Scale bar represents amino acid substitutions per site. FIGURES 3A-3B. Expression profile of Fat genes in M. truncatula. (FIG. 3 A) Microarray data from the Medicago truncatula Gene Expression Atlas (MtGEA). Each dot represents a different condition or tissue. An inset showing mycorrhizal samples is presented below the overview. (FIG. 3B) Transcript levels of FatM and FatC in WT (A17) plants non-colonized (control) and colonized with Gv, Glomus versiforme measured by qRT-PCR. FIGURES 4A-4B. Complementation of fatm by Medicago truncatula Fat genes expressed from the FatM promoter, fatm roots expressing different Fat genes or controls (nlGFP-GUS or RUB 1 sp-mCherry) expressed from the FatM promoter 5 wpp with G. versiforme. nlGFP- GUS, nuclear localized GFP-GUS; RUBlsp-mCherry, signal peptide of small subunit of Rubisco. (FIG. 4A) Colonization levels. (FIG. 4B) The percentage of colonized root segments with four different categories of fungal structures. Hyphae-only, intracellular hyphae without arbuscules; collapsed arb, fully collapsed arbuscules that appear as amorphous clumps as shown in FIG. IF; small arb, small arbuscules collapsing from the branch tips as shown in FIG. ID; WT arb, fully branched, mature arbuscules as shown in FIG. 1C, D. Data are averages + SEM (n > 4, where n denotes the number of independent biological replicates). Different letters in (FIG. 4A) indicate significant differences between the lines in each group of transformed roots (all pairs; Tukey's HSD mean-separation test; P, < 0.05).

FIGURE 5. Subcellular localization of Fat-GFP fusion proteins. M. truncatula roots colonized with G. versiforme (3 wpp) expressing FatMp: :FatM-GFP, FatMp ::FatA-GFP, FatMp: :FatB-GFP and FatMp: :FatC-GFP . Each image is a projection of 15 optical sections on the Z axis taken at 0.5 μιη intervals. White arrows point to stromulated plastids.

Arbuscules are marked by asterisks.

FIGURE 6. Gene structure of RAM2 showing the position of the Tntl insertion in ram2-2. Exons are shown as orange boxes. Localization of Tntl insertion is represented as a blue line with a blue triangle on top. The Tntl insertion is located 398 bp downstream of the start codon, resulting in the expression of a truncated protein with 112 amino acids. For comparison, ram2-l is a 120 kb deletion spanning 23 predicted genes including the complete RAM2 gene (Wang et al. 2012).

FIGURE 7. Biosynthesis pathway of glycerolipids during AMS. Diagram showing fatty acid, membrane and storage lipid biosynthesis pathway. (FIG. 7 A) Non-mycorrhizal cell (WT). (FIG. 7B) Mycorrhizal cell (WT). Lipids are shown in bold black letters and enzymes are shown in red letters. The position of FatM and RAM2 are shown in yellow boxes. Currently, the ABC transporter is hypothetical and STR is proposed as a candidate. FAS, fatty acid synthase; KASII, ketoacyl-ACP Synthase II; SAD, stearoyl-ACP desaturase; FatA, acyl-ACP thioesterase A; FatB, acyl-ACP thioesterase B; FatC, acyl-ACP thioesterase C; FatM, acyl- ACP thioesterase M; GPAT, glycerol-3 -phosphate acyltransferase; ABC transporter, ATP binding cassette transporter. 16:0-ACP, palmitoyl-Acyl Carrier Protein; 18:0-ACP, stearoyl- Acyl Carrier Protein; 18:1-ACP, oleoyl-Acyl Carrier Protein; 16:0, palmitic acid; 18:0, stearic acid; 18:1, oleic acid; CoA, Coenzyme A; Acyl-CoA, acyl-Coenzyme A; G3P, glycerol- 3 -phosphate; MAG, monoacylglycerol; LPA, lysophosphatidic acid; PA, phosphatidic acid; DAG, diacylglycerol; TAG, triacylglycerol; PC, phosphatidylcholine; PE, phosphatidylethanolamine; PS, phosphatidylserine; CDP-DAG, cytidine diphosphate diacylglycerol; PGP, phosphatidylglycerol-phosphate; PI, phosphatidylinositol; PG, phosphatidylglycerol.

FIGURE 8. Arbuscule development is impaired in fatm, rami and str. Colonization levels in fatm, rami and str inoculated with G. versiforme. (a) Colonization levels in mutants and corresponding WT segregants at two time points (3 and 5 wpp) grown with 20 μΜ Pi. (b) Quantification of the arbuscule phenotypes as a percentage of colonized root segments. Data are averages + SEM (n = 4, where n denotes the number of independent biological replicates). *p < 0.05, Student's t-test of mutant vs WT control. Hyphae-only, intracellular hyphae without arbuscules; collapsed arb, fully collapsed arbuscules that appear as amorphous clumps as shown in Fig. If; small arb, small arbuscules collapsing from the branch tips as shown in Fig. Id; WT arb, fully branched, mature arbuscules as shown in Fig. lc, d.

FIGURE 9. Numbers of hyphopodia in WT, im, rami, and str. Hyphopodia per cm of colonized root. Data are averages + SEM (n > 4, where n denotes the number of independent biological replicates). *p < 0.05, Student's t-test of mutant vs WT control. There are no significant differences between WT and mutants.

FIGURE 10. Arbuscule phenotype in WT, im, rami, and str mutants. Confocal microscopy images showing M. truncatula roots of WT and mutant plants colonized with G. versiforme at 3 wpp. Representative arbuscules of early, intermediate or mature stages are presented for A17. Images representing the range of arbuscules observed in the mutants are shown. Each image is a projection of 20 optical sections on the Z axis taken at 0.5 μιη intervals. Bar, 25 μιη. FIGURE 11. Relative transcript levels of AMS marker genes and three Fat genes in ram2-2 and fatm. Relative transcript levels of AMS-induced genes that are considered markers of AMS in M. truncatula, and also three Fat genes, whose expression does not change during AMS, in roots colonized with G. versiforme at 3wpp. Transcript levels are relative to the FatM-WT. Data are averages + SEM (n > 4, where n denotes the number of independent biological replicates). * p < 0.05, Student's t-test of mutant vs WT control.

FIGURE 12. Mycorrhizal roots of phosphate- starved mutants accumulate less phospholipids than WT roots. Phospholipids and galactolipids in mutants and their WT segregants at 3 wpp with G. versiforme presented as a proportion of the total lipids. Data are averages + SEM (n = 5, where n denotes the number of independent biological replicates). *p < 0.05, Student's t- test of mutant vs WT control. MGDG, monogalactosyl diacylglycerol; DGDG, digalactosyl diacylglycerol; SQDG, sulfoquinovosyl diacylglycerol; PC, phosphatidylcholine; PE, Phosphatidylethanolamine; PG, phosphatidylglycerol; PI, phosphatidylinositol; PA, phosphatidic acid; PS, phosphatidylserine.

FIGURES 13A-13D. Low levels of fungal- specific fatty acids in the mutants reflect impairment in AMS. Total fatty acids in mutant and WT M. truncatula roots colonized with G. versiforme (5 wpp) were converted into fatty acid methyl esters and measured by GC-FID. (FIG. 13A) Composition of fatty acids detected. (FIG. 13B) 16: 1 co5, (FIG. 13C) 18: 1 Δ9 and (FIG. 13D) 18: 1 co7 fatty acid levels. Data are averages + SEM (n > 4, where n denotes the number of independent biological replicates). *p < 0.05, Student's t-test of mutant vs WT control. FIGURE 14. Free fatty acid levels in mutant and WT M. truncatula roots colonized with G. versiforme (5 wpp). Free fatty acids in mutant and WT M. truncatula roots colonized with G. versiforme (5 wpp). Data are averages + SEM (n > 4, where n denotes the number of independent biological replicates). *p < 0.05, Student's t-test of mutant vs WT control. FIGURES 15A-15D. Low levels of fungal- specific triacylglycerols (TAG) in the mutants reflect impairment in AMS. Selected species of TAG lipids in mutant and WT M. truncatula roots colonized with G. versiforme (5 wpp). TAG species containing 16:0 and 16: 1 are presented. (FIG. 15A) 48: 1, (FIG. 15B) 48:2, (FIG. 15C) 48:0 and (FIG. 15D) 48:3 TAG. The complete set of TAG species is presented in Fig. S9. Data are averages + SEM (n > 4, where n denotes the number of independent biological replicates). *p < 0.05, Student's t-test of mutant vs WT control. WT and WT segregants are depicted with grey bars, and mutants with red and pink bars. The position of the double bond in 16: 1 of DAG and TAG is unknown as we do not obtain this information from the MS/MS experiments of the Q-TOF analysis. The 16: 1 in DAG and TAG is very likely 16: lco5, as DAG or TAG molecular species with 32: 1, 32:2 or with 48: 1, 48:2, 48:3, respectively, are absent from mock-infected roots and massively accumulate in mycorrhizal roots, to the same amount as 16: 1 co5 fatty acid in total fatty acids (as measured via GC-MS) (Wewer et al, 2014). FIGURE 16. Molecular species composition of triacylglycerolipids (TAGs) in mutant and WT M. truncatula roots colonized with G. versiforme (5 wpp). Data are averages (n > 4, where n denotes the number of independent biological replicates). Red arrows point to TAG species that contain 16:0 and 16: 1. FIGURES 17A-17B. Molecular species composition of diacylglycerol (DAG) lipids in mutant and WT M. truncatula roots colonized with G. versiforme (5 wpp). (FIG. 17A) Content of all DAG species. Red arrows point to DAG species that contain 16:0, 16: 1 and 16:0-18: 1. (FIG. 17B) Content of selected DAG species. Data are averages + SEM (n > 4, where n denotes the number of independent biological replicates). * p < 0.05, Student's t-test of mutant vs WT control.

FIGURE 18. Molecular species composition of phosphatidylcholine (PC) in mutant and WT M. truncatula roots colonized with G. versiforme (5 wpp). Red arrow points to 32:0 PC species that accumulate to higher levels in both rami alleles relative to their WT controls, shown in FIG. 18. Data are averages + SEM (n = 5, where n denotes the number of independent biological replicates).

FIGURE 19. 38:X and 40:X phospholipid (PE, PA and PS) species in mutant and WT M. truncatula roots colonized with G. versiforme (5 wpp). Data are averages + SEM (n = 5, where n denotes the number of independent roots samples).

FIGURE 20. sn-1 monoacylglycerol (aMAG) lipids in mutant and WT M. truncatula roots colonized with G. versiforme (5 wpp). The data were obtained in two separate measurements and are thus represented in separate graphs. Data are averages + SEM (n > 4, where n denotes the number of independent biological replicates). Black asterisk * p < 0.05, Student's t test of mutant vs WT; red asterisk * p < 0.05, Student's t test of ram2-l vs str.

FIGURES 21A-21B. βΜΑϋ levels are reduced in fatm and rami but not in str relative to their corresponding WTs. Distribution of sn-2 monoacylglycerol (βΜΑϋ) species in mutant and WT M. truncatula roots colonized with G. versiforme (5 wpp). The data were obtained in two separate measurements and are thus represented in two graphs with plants in the R108 genetic background shown in FIG. 21A and plants in the A17 genetic background shown in FIG. 21B. Data are averages + SEM (n > 4, where n denotes the number of independent biological replicates). Black asterisk *p < 0.05, Student's t-test of mutant vs WT; red asterisk *p < 0.05, Student's t-test of ram2-l vs str.

FIGURES 22A-22D. 16:0-16:0 phospholipids levels are substantially higher in ram2 than in WT. 16:0-16:0 (32:0) phospholipids in mutant and WT M. truncatula roots colonized with G. versiforme (5 wpp). (FIG. 22A) 32:0 PC, (FIG. 22B) 32:0 PA, (FIG. 22C) 32:0 PI and (FIG. 22D) 32:0 PG levels. Data are averages + SEM (n > 4, where n denotes the number of independent biological replicates). *p < 0.05, Student's t-test of mutant vs WT.

FIGURES 23A-23C. Lipid metabolism in colonized root cells in the three mutants (FIG. 23 A) fatm; (FIG. 23B) ram2; (FIG. 23C) str. (+) and (-) indicate changes compared to WT. Red arrows highlight the metabolism of 16:0- ACP into 16:0 βΜΑϋ. Thick red arrows represent the hypothesized increases in flux. FatM, RAM2 and STR (ABC transporter) are highlighted in yellow. The decrease in βΜΑϋ in rami applies only to the 16:0-βΜΑΟ. The increase in PA, DAG, TAG, PE, PC, PS in rami applies only to the 32:0 species. The total amounts of any given class of lipids does not increase.

FIGURE 24. Relative transcript levels of AMS-induced genes in str. Relative transcript levels of AMS-induced genes in A17 and str roots colonized with Rhizophagus irregularis. Transcript levels are relative to the A17 control. Data are averages + SEM (n > 4, where n denotes the number of independent biological replicates). * p < 0.05, Student's t-test of mutant vs WT control.

FIGURES 25A-25C. Addition of 2-PG increases hyphae growth and sporulation. (FIG. 25A) Photographs of petri plates containing Rhizophagus irregularis hyphae at day 0 and day 35 following addition of ΙΟμηι 2-PG. (FIG. 25B) Photographs of petri plates containing Rhizophagus irregularis hyphae at day 2 and day 8 following addition of ethanol (negative control), 50μηι 2-PG, or 200μηι 2-PG. (FIG. 25C) Photographs of two-compartment cultures at day 0 and day 11 following addition of ethanol or 200μιη 2-PG.

DETAILED DESCRIPTION OF THE INVENTION

During AMS, considerable amounts of lipids are generated, modified and moved within the cell to accommodate the fungus in the root. It has also been suggested that lipids are delivered to the fungus. To determine the mechanisms by which root cells redirect lipid biosynthesis during AMS, we analyzed the roles of two lipid biosynthetic enzymes (FatM and RAM2) and an ABC transporter (STR), which are required for symbiosis and conserved uniquely in plants that engage in AMS.

Complementation analyses indicate that the biochemical function of FatM overlaps with that of other Fat thioesterases, in particular FatB. The essential role of FatM in AMS is a consequence of timing and magnitude of its expression. Lipid profiles of fatm and rami indicate that FatM increases the outflow of 16:0 fatty acids from the plastid, for subsequent use by RAM2 to produce 16:0 β-monoacylglycerol. Thus during AMS, high-level, specific expression of key lipid biosynthetic enzymes located in the plastid and the endoplasmic reticulum, enables the root cell to fine-tune lipid biosynthesis to increase the production of β- monoacylglycerols.

We have shown that addition of 2-palmitoyl glycerol (2-PG) to extraradical hyphae of AM fungi promotes growth and sporulation. Accordingly, formulations and methods have been identified that are useful for promoting the growth of AM fungi associated with a plant or in the absence a plant.

Definitions

The singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

As used herein, the term "isolated" as applied to a microorganism refers to a microorganism which has been removed and/or purified from an environment in which it naturally occurs. The terms "isolated" is not meant to exclude artificial or synthetic mixtures with other compounds or materials, or the presence of impurities that do not interfere with the fundamental activity, and that may be present, for example, due to incomplete purification, or the addition of stabilizers. Further, the term "isolated" does not necessarily reflect the extent to which the microbe has been purified. Note that a strain associated with other strains, or with compounds or materials that it is not normally found with in nature, is still defined as "isolated."

The term "effective amount" as used herein refers to an amount effective at concentrations and for periods of time necessary to achieve the desired result, for example an amount sufficient to confer, for example, increased fungi growth or sporulation.

A "carrier" refers to, for example, a diluent, adjuvant, preservative, anti-oxidant, solubilizer (e.g., Polysorbate 80), emulsifier, buffer (e.g., Tris HC1, acetate, phosphate), water, aqueous solutions, oils, bulking substance (e.g., lactose, mannitol), excipient, auxilliary agent or vehicle with which an active agent of the present invention is administered and/or maintained.

The term "colonize" as used herein refers to a condition wherein AMF grow on plant root material.

"Arbuscular mycorrhizal fungi material" or "AMF material" as used herein refers to, but is not limited to, AMF mycelium, hyphae, vesicles, arbuscules and/or other propagules.

An "inoculum" that is used to initiate AMF growth on roots in vivo or in vitro preferably comprises AMF propagules. It may further comprise other AMF material, root material and/or residual culture medium or substrate.

The terms "cultivation" and "culturing" as used herein refer to the production of fungal or root material by culture. Culture conditions and media additives to enhance growth of such fungi are known and exemplified herein. Other additives could be employed and include without limitation, vitamins, amino acids, fatty acids, surfactants, sterols. Other useful additives include conjugates that render the fatty acid more available to the culture, e.g., fatty acids conjugated to BSA.

A "spore" or a population of "spores" refers to fungi that are generally viable, more resistant to environmental influences such as heat and bactericidal or fungicidal agents than other forms of the same fungi, and typically capable of germination and out-growth. Fungi that are "capable of forming spores" are those fungi comprising the genes and other necessary abilities to produce spores under suitable environmental conditions.

The terms "promoting plant growth" and "stimulating plant growth" are used interchangeably herein, and refer to the ability to enhance or increase at least one of the plant's height, weight, leaf size, root size, or stem size, to increase protein yield from the plant or to increase grain yield of the plant. "Biomass" refers to the total mass or weight (fresh or dry), at a given time, of a plant tissue, plant tissues, an entire plant, or population of plants. Biomass is usually given as weight per unit area. The term may also refer to all the plants or species in the community (community biomass).

A "host plant" includes any plant, particularly a plant of agronomic importance, which, for example, arbuscular mycorrhizal fungi can colonize.

An "increased yield" can refer to any increase in biomass or seed or fruit weight, seed size, seed number per plant, seed number per unit area, bushels per acre, tons per acre, kilo per hectare, or carbohydrate yield. Typically, the particular characteristic is designated when referring to increased yield, e.g., increased grain yield or increased seed size.

"Target crop" to be protected within the scope of this invention comprise, for example, the following species of plants: cereals (wheat, barley, rye, oats, rice, maize, sorghum and related species); beet (sugar beet and fodder beet); pomes, stone fruit and soft fruit (apples, pears, plums, peaches, almonds, cherries, strawberries, raspberries and blackberries); leguminous plants (beans, lentils, peas, soybeans); oil plants (rape, mustard, poppy, olives, sunflowers, coconut, castor oil plants, cocoa beans, groundnuts); cucurbitaceae (marrows, cucumbers, melons); fiber plants (cotton, flax, hemp, jute); citrus fruit (oranges, lemons, grapefruit, mandarins); vegetables (spinach, lettuce, asparagus, cabbages, carrots, onions, tomatoes, potatoes, paprika); lauraceae (avocado, cinnamon, camphor) and plants such as tobacco, nuts, coffee, sugar cane, tea, pepper, vines, hops, bananas and natural rubber plants, and also ornamentals.

Particular formulations to be applied in spraying forms such as water dispersible concentrates or wettable powders may contain surfactant such as wetting and dispersing agents, e.g., the condensation product of formaldehyde with naphthalene sulphonate, an alkyl-aryl-sulphonate, a lignin sulphonate, a fatty alkyl sulphate an ethoxylated alkylphenol and an ethoxylated fatty alcohol.

As used herein the terms "spray" or "spraying" include the technique of applying to an exterior surface an ejected liquid material.

As used herein, the terms "coat" or "coating" include application, typically of a liquid or flowable solid, to an exterior surface such as a seed.

As used herein, a "stabilizer" includes a chemical compound that can be added to a formulation to prolong the stability and/or viability of components of the formulation, a critical aspect of product shelf-stability. A stabilizer can be one of a variety of compounds, such as a dessicant. As used herein, a "preservative" includes any chemical compound and/or physical conditions that prevent the decomposition of organic constituents of seeds treated with formulations. Chemical preservatives could include, for example, synthetic or non-synthetic antioxidants and physical preservatives could include, for example, refrigeration, freeze- drying or drying.

According to an embodiment the at least one dispersing agent can be in the range of about 2% to about 60% on a dry weight by weight basis. Various dispersing agents are commercially available for use in agricultural compositions, such as those marketed by Rhone Poulenc, Witco, Westvaco, International Speciality products, Croda chemicals, Borregaard, BASF, Rhodia, etc. According to an embodiment the dispersing agents which can be used in the agricultural composition can be chosen from a group comprising polyvinylpyrrolidone, polyvinylalcohol, lignosulphonates, phenyl naphthalene sulphonates, ethoxylated alkyl phenols, ethoxylated fatty acids, alkoxylated linear alcohols, polyaromatic sulfonates, sodium alkyl aryl sulfonates, glyceryl esters, maleic anhydride copolymers, phosphate esters, condensation products of aryl sulphonic acids and formaldehyde, condensation products of alkylaryl sulphonic acids and formaldehyde, addition products of ethylene oxide and fatty acid esters, salts of addition products, of ethylene oxide and fatty acid esters, sulfonates of condensed naphthalene, addition products of ethylene oxide and fatty acid esters, salts of addition products of ethylene oxide and fatty acid esters, lignin derivatives, naphthalene formaldehyde condensates, sodium salt of isodecylsulfosuccinic acid half ester, polycarboxylates, sodium alkylbenzenesulfonates, sodium salts of sulfonated naphthalene, ammonium salts of sulfonated naphthalene, salts of polyacrylic acids, salts of phenolsulfonic acids and salts of naphthalene sulfonic acids. However, those skilled in the art will appreciate that it is possible to utilize other dispersing agents known in the art without departing from the scope of the claims of the present invention.

As used herein, a "container" includes a bag or box or other packaging suitable for storing and shipping a formulation that contains, for example, beneficial fungi and/or treatment. The container may create environmental conditions conducive to the long term stability of the formulation components. The container can include a label that consists of information about the formulation.

As used herein the phrase "adjacent to vegetation" means within 36 inches (e.g., within 24 inches, within 12 inches, within 6 inches, within 4 increase, within 2 inches, or within 1 inch) of a circle defined around the main plant body. The following example describes an illustrative method of practicing the instant invention and is not intended to limit the scope of the invention in any way.

EXAMPLE I

Lipid biosynthesis during arbuscular mycorrhizal symbiosis Materials and Methods

Plant and fungal growth conditions

These studies used truncatula ssp. truncatula ecotype Jemalong (A17) and M. truncatula ssp. tricycla (R108). Wild-type (WT) segregant (FatM-WT) and fatm plants are segregants from Tntl insertion line 7660 (R108 background) (Bravo et al, 2016). ram2-l (Wang et al, lull) and str (Zhang et al, 2010) and both are in the A17 background. ram2-2 (NF9247) was identified from the Noble Foundation Tntl insertion collection (available online at bioinfo4.noble.org/mutant/) and has an insertion in the first exon of RAM2.

Genotyping primers are listed in Table 1. From a ram2-2 segregating population, we collected seeds from two homozygous WT (RAM2-2-WT) and three homozygous ram2-2 plants. Seeds from the two WT segregants were pooled and seeds from the three mutant ram2-2 plants were pooled for use in the experiments.

Seeds were germinated and plants grown and inoculated as described previously (Liu et al, 2004; Bravo et al, 2016). Cones were filled with a mixture of sand and gravel in a 1:1 ratio, with a 2 cm layer of fine sand and 100 surface- sterilized G. versiforme spores (Liu et al , 2004) positioned 6 cm below the top of the cone. Three seedlings were planted into each cone and grown in a growth chamber with 16-h light (25°C)/8-h dark (22°C). Cones were fertilized twice weekly with a modified ½ strength Hoagland's solution containing 200 μΜ potassium phosphate. Plants were harvested at 3 or 5 weeks post planting (wpp), and only the part of the root system comprising 2 cm above and 2 cm below the spore layer was harvested for further analyses. When required, root material was cut in half and one part was frozen in liquid nitrogen for RNA extraction or lipid analyses.

Table 1. List of oligonucleotides used in this study. Oligonucleotides used for genotyping ram2-2, cloning vectors and qRT-PCR are listed.

ID Sequence Use

B2588 TACAAATCAATCCAGTAGCTCTTCC Genotyping ram2-2 insertion line B1473 AGAAATCACCATCATCACCATG Genotyping ram2-2 insertion line

B870 ATGTCCATCTCATTGAAGAAGTA Genotyping ram2-2 insertion line

Plasmid construction

B4653 GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGTTCATACTCTCGTGTATTGCCA Clone FatM genomic DNA for Gateway attBl-attB2

B4654 GGGGACCACTTTGTACAAGAAAGCTGGGTCTTTCTCTTGTCCCTTGTCTCCA Clone FatM genomic DNA for Gateway attBl-attB2

B4673 GGGGACAACTTTGTATAGAAAAGTTGGTTCATACTCTCGTGTATTGCCA Clone FatM promoter for Gateway attB4-attBlr

B4674 GGGGACTGCTTTTTTGTACAMCTTGCTGTTCTGTTCCTTTTTTTATTTTTTCACTTTC Clone FatM promoter for Gateway attB4-attBlr

B4649 GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGCTGTTACTAATTTTACATGTTC Clone FatM CDS for Gateway attBl-attB2

B4650 GGGGACCACTTTGTACAAGAAAGCTGGGTCTGTAGAAAATGGACATGTAGTGAA Clone FatM CDS for Gateway attBl-attB2

B4675 GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGTTGAAACTTCCATGCAATG Clone FaTA CDS for Gateway attBl-attB2

B4676 GGGGACCACTTTGTACAAGAAAGCTGGGTCTCTAGCCGCCTTTTTTCTCCATT Clone FaTA CDS for Gateway attBl-attB2

B4677 GGGGACAAGTTTGTACAAAAAAGCAGGCTTCAATCTCATTATGGTGGCCGCT Clone FaTB CDS for Gateway attBl-attB2

B4678 GGGGACCACTTTGTACAAGAAAGCTGGGTCGGTGCTTCCTGCTGGAAC Clone FaTB CDS for Gateway attBl-attB2

B4679 GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGCAACAATCAGCAACATT Clone FaTC CDS for Gateway attBl-attB2

B4680 GGGGACCACrrTGTACAAGAAAGCTGGGTCTTGTTGATTTTGCTTTAAATTCCATTCAG Clone FaTC CDS for Gateway attBl-attB2

qRT-PCR

ql439 TCTCCAATGCGGCCAAATCT qRT Gv alpha Tubulin

ql440 CAAAGTTCAACGCGCTGTGT qRT Gv alpha Tubulin

ql501 GAGACCCACAGACAAGCC qRT EFla R108 (Medtr6g021800) ql502 ACTGGCACAGTTCCAATACC qRT EFla R108 (Medtr6g021800) ql744 GGATCGGTCTTGGACAGTGG qRT ASPP (Medtr4g095270)

ql745 TGGACCGCTGATTTGACTGA qRT ASPP (Medtr4g095270)

ql746 CGGATTCGTTTGACACAACATCT qRT ABCD1 (Medtr3g087350)

ql747 TCCTCTGATCTGCGTCAACAC qRT ABCD1 (Medtr3g087350)

ql748 GGATAAGGTGGATGGTGATCG qRT TRF (Medtrlg087790)

ql749 TCTGCCTCTCGTCGTTTTTGT qRT TRF (Medtrlg087790)

ql737 GTTAGAGGAAAGACTACATGGAAGAG qRT FatM (Medtrlgl09110)

B4157 GCACACCACACACCATAGTA qRT FatM (Medtrlgl09110)

q2012 TAATC AA AG ACTACG CA ACC AATG qRT FatA (Medtr7g056233)

q2013 TTTGTAGTCGCCTTGTGTCC qRT FatA (Medtr7g056233)

q2014 TGACGAGAGCCTCCAGTGTT qRT FatB (Medtr4gll2970)

q2015 GCAGATTCCACAAAATAAGAACCT qRT FatB (Medtr4gll2970)

ql058 GACACGAGGCGCTTTCATAGCAGC qRT PT4 (Medtrlg028600)

ql059 GTCATCGCAGCTGGAACAGCACCG qRT PT4 (Medtrlg028600)

q39 AACAATGATGCCAATAACAAGC qRT CP3 (Medtr4gl07930)

q40 GGAGCACATATGACCCTTGA qRT CP3 (Medtr4gl07930)

ql429 AAGCCATTTTCGAGGCGTTT qRT RAM I (Medtr7g027190)

ql430 CGTTAAGCATCGTCCGGTTT qRT RAM I (Medtr7g027190)

B4218 AAACCTGGAATACTTGTTGGAGA qRT RAM 2 (Medtrlg040500)

B4219 TGTTACCTTTGGCTTTGCTG qRT RAM 2 (Medtrlg040500)

q283 TCAAGTTGCTGAAACACATGAT qRT LEC5 (Medtr5g031030)

q284 GAGCAGAACCATTGCAACAA qRT LEC5 (Medtr5g031030)

q817 TTCCAATGATGCAGTCCCA qRT STR (Medtr8gl07450)

B1219 TGGTTATGACTGCAAATGTGAG qRT STR (Medtr8gl07450)

ql519 GCCAGTTGCATTTAGGATTCA qRT VAPYRIN (Medtr6g027840) ql520 GCACCTGGAGCAAGAACACT qRT VAPYRIN (Medtr6g027840)

Cloning and plasmid construction

The promoter region of FatM, comprising 1.1 kb immediately 5' of the start codon was amplified from M. truncatula genomic DNA. The coding sequence of each Fat gene was amplified from cDNA of M. truncatula roots colonized with Glomus versiforme. Each primer contained attBl and attB2R recombination sequences at each 5' end to allow for Gateway recombination (Table 1). The fragments of all plasmids were sequenced.

To create the Entry clones, each purified DNA fragment was recombined in a BP gateway reaction (Thermo Fisher Scientific, www.thermofisher.com) with the corresponding pDONR plasmids: pDONR-P4PlR for the FatM promoter with attB4-attBlR sites, and pDONR221 for all Fat CDS fragments with attB l-attB2R sites. Plasmids marked with an asterisk in Table 2 were described previously (Ivanov & Harrison, 2014). Expression vectors controlled by the FatM promoter harboring Fat genes and controls were created by recombining the pK7m34GW-RedRoot destination vector through a three way multiple LR Gateway reaction with three entry clones. A version of each Fat gene fused to eGFP was also created. The plasmids used in each recombination reaction are listed in Table 2.

Table 2. List of MultiSite gateway constructs generated. Four components used in the multisite gateway recombination reaction are listed. Entry vector plasmids marked by an asterisk were previously described (Ivanov & Harrison, 2014).

Construct Destination Entry 4-1 Entry 1-2 Entry 2-3

FatMp::n lG FP-G US pK7m34GW_RR FatMp nIG FP-GUS STOP-term35S*

FatMp::FatMg pK7m34GW_RR Empty FatMgenomic STOP-term35S*

FatMp::FatM pK7m34GW_RR FatMp FatM STOP-term35S*

FatMp::FatA pK7m34GW_RR FatMp FatA STOP-term35S*

FatMp::FatB pK7m34GW_RR FatMp FatB STOP-term35S*

FatMp::FatC pK7m34GW_RR FatMp FatC STOP-term35S*

FatMp::RU Blsp-mCherry pK7m34GW_RR FatMp RU Blsp-mCherry* STOP-term35S*

FatMp::FatM-GFP pK7m34GW_RR FatMp FatM eG FP*

FatMp::FatA-GFP pK7m34GW_RR FatMp FatA eG FP*

FatMp::FatB-GFP pK7m34GW_RR FatMp FatB eG FP*

FatMp::FatC-G FP pK7m34GW_RR FatMp FatC eG FP*

Staining and microscopy

To visualize the fungus, roots were stained with WGA-Alexa fluor 488 (Bravo et al., 2016). GFP expressing roots were imaged as described previously (Ivanov & Harrison, 2014) using a Leica TCS-SP5 confocal microscope and 63X water-immersion objective. Images are single optical sections, except where otherwise noted.

Quantification of colonization

Colonization levels were assessed by the modified gridline intersect method

(McGonigle et al., 1990) and a minimum of 100 intersections were evaluated. Colonized segments of roots were scored using four categories: hyphal structures only, collapsed arbuscules, small arbuscules and wild type (WT) arbuscules. The data were expressed as percentages by dividing the count of each category by the total number of colonized root intersections.

RNA extraction and real-time RT-PCR

RNA extraction and quantitative RT-PCR was performed as described previously (Bravo et al., 2016). Phylogenetic analyses

Phylogenetic trees were constructed as described previously (Bravo et al., 2016). Lipid extraction and measurement via Q-TOF MS/MS

Lipids were extracted from 10 replicates for each WT and mutant line. Five replicates were used for phosphoglycerolipid, glycoglycerolipid, diacylglycerol (DAG) and triacylglycerol (TAG) measurements and five replicates were used for analysis of fatty acids from total lipids, free fatty acids (FFA) and monoacylglycerol (MAG).

Lipid extraction from colonized roots was performed as previously described (Wewer et al., 2014). Briefly, after addition of chloroform/methanol/formic acid (1:1:0.1, v/v/v) and 1M KC1 / 0.2 M H3PO4 to the homogenized sample, phase separation was achieved by centrifugation and the lipid-containing organic phase was harvested. Internal standards were added prior to phase separation except for phosphoglycerolipid and glycoglycerolipid standards which were added at the end.

DAG and TAG were purified by application to silica columns for solid phase extraction (SPE; 1 ml bed volume; Phenomenex) and elution with chloroform.

Phosphoglycerolipids, glycoglycerolipids, DAG and TAG were analyzed in positive mode by direct infusion nanospray Q-TOF MS/MS in relation to internal standards on an Agilent 6530 Q-TOF instrument as described previously (Gasulla et al., 2013).

Analysis of total fatty acids, free fatty acids and monoacylglycerols

Total lipid extracts were generated from five replicates as described above. 100 μΐ of total lipid extracts were taken for total lipid fatty acids analysis and the remaining 900 μΐ were used for enrichment of MAGs and FFAs using SPE on silica columns with a n- hexane:diethylether gradient. Fractions containing FFAs (92:8 n-hexane :diethylether (v/v)) and MAGs (100% diethylether) were collected.

Fatty acid methyl esters (FAMEs) were generated from 100 μΐ of dried total lipid extract and from the collected FFA SPE-fraction by incubation with IN methanolic HC1 (Sigma) at 80°C for 30 min. FAMEs were extracted with n-hexane and 0.9 % (w/v) NaCl and analyzed on a gas chromatograph with flame-ionization detector (GC-FID, Agilent 7890A Plus GC) in relation to 5 μg internal standard (pentadecanoic acid) as described previously (Wewer et al., 2013).

The MAG SPE fraction was dried and dissolved in pyridine:N-methyl-N- (trimethylsilyl) trifluoroacetamide (1:4 v/v; CS Chromatography), incubated at 80°C for 30 minutes, dried and dissolved in n-hexane prior to analysis by a gas chromatograph coupled to a mass spectrometer (6975C inert XL MSD with Triple-Axis Detector, Agilent Technologies with 7890A GC System). Separation was achieved on a HP 5-MS column (Agilent J&W GC Columns, 30m X 0.25 mm, 0.25 μιη film) using a temperature gradient starting at 120 °C for 4 min , increased to 300 °C by 10 °C /min, held for 2 min and reduced to 120 °C by 15 °C/min. MAG regio-isomers were quantified by single ion monitoring using the fragments of [M⁺-103] for a-MAGs (sn-V sn-3) and [M⁺-161] for β-MAGs (sn-2) as diagnostic ions (Destaillats et al., 2010). For quantification, 2.42 nmol of a mixture containing 2- monopentadecanoin (sn-2 15:0-MAG) and 1-monopentadecanoin (sn-1 15:0 MAG, Larodan) was used as internal standard. Results

FatM encodes an acyl-(acyl carrier protein) thioesterase-like protein dedicated to AMS

Previously, we reported that arbuscule development is impaired in a M. truncatula fatm mutant (Bravo et al., 2016). To further examine the role of FatM during AMS, we undertook a more detailed microscopical analysis of fatm during association with the AM fungus, Glomus versiforme. At 3 weeks post planting (wpp), arbuscules in fatm showed first- and second-order branches and occasionally a few higher order branches but the arbuscule never filled the entire volume of the cell (FIG. 1A-1F). Furthermore, arbuscules with fine branches always showed signs of collapse at the branch tips in fatm roots. In contrast, arbuscules in the corresponding WT developed higher order branches that completely filled the colonized cell. As reported previously, the proportion of degenerating arbuscules was much higher in fatm than WT plants (Bravo et al. , 2016). Based on these observations, we conclude that AMS in fatm is impaired due to a premature collapse of arbuscules. We did not observe any other abnormal developmental phenotypes in roots or shoots of fatm.

To examine the spatial expression patterns of FatM during AMS, we fused 1.1 Kb of the 5 ' sequence upstream of the start codon of FatM with a nuclear- localized version of GFP- GUS (FatMp: :nlGFP-GUS). In roots colonized with G. versiforme, we observed GFP fluorescence in the nuclei only in colonized parts of the roots. Strong GFP fluorescence was observed in cells containing developed arbuscules (FIG. 1G-1H). These results correlate with the expression profile of FatM reported in the M. truncatula Gene Expression Atlas

(Benedito et al. , 2008; He et al. , 2009), where FatM transcripts are present only in roots colonized with AM fungi. In addition to FatM (Medtrlgl09110), the M. truncatula genome harbors three additional Fat genes, named MtFatA (Medtr7g056233), MtFatB

(Medtr4gl 12970) and MtFatC (Medtr3g099020) each of which belongs to a distinct clade that includes members from most flowering plants (FIG. 2). Phylogenetic analyses showed that the FatA clade is more closely related to algal Fat genes than are the other three flowering plant Fat genes, suggesting a more ancient origin for FatA. Based on the Medicago truncatula Gene Expression Atlas, MtFatA and MtFatB, are expressed in a wide variety of tissues and conditions, including mycorrhizal roots, but gene expression is not up-regulated during AMS (FIG. 3A). MtFatC is not represented on the Atlas but qRT-PCR indicates that this gene is likewise not up-regulated during AMS (FIG. 3B). Consequently, we conclude that FatM is the only Fat gene in M. truncatula that is up-regulated during AMS, and that it shows maximum gene expression in cells that contain arbuscules.

In Arabidopsis, the FatA and FatB Acyl-ACP thioesterases are plastid- targeted soluble enzymes (Joyard et al., 2010; Wang et al., 2013). To determine the subcellular localization of FatM during AMS, we fused GFP to the C-terminal end of FatM and expressed the gene fusion from the native FatM promoter. The fusion construct was co- expressed in M. truncatula roots with a plastid marker RUB lsp-mCherry (Ivanov &

Harrison, 2014). Fluorescence from FatM-GFP was observed in stromulated plastids in cells containing arbuscules and the GFP signal co-localized with the RUBlsp-mCherry signal (FIG. 1I-1L). This plastid shape in arbuscule-containing cells is consistent with a previous report in which this plastid marker was examined (Ivanov & Harrison, 2014). In all cases, GFP fluorescence was observed only in plastids of cells that contained arbuscules. Thus, FatM is expressed only during AMS, specifically in cells with arbuscules and the FatM protein is located in plastids.

Medicago truncatula FatA, FatB and FatC complement the arbuscule development defect in fatm

In Arabidopsis, there is partial overlap in the in vitro biochemical activities of FatA and FatB. FatA has a substrate preference for 18: 1-ACP, although it can also hydrolyze saturated 16:0-ACP and 18:0-ACP, whereas Arabidopsis FatB has a broad activity but acts preferentially on 16:0-ACP (Voelker et al., 1992; Dormann et al., 1995; Jones et al., 1995; Salas & Ohlrogge, 2002; Jing et al., 2011). Additionally, many Fats show an overlap in fatty acid specificities when expressed in E. coli, including the FatM orthologue from sorghum (EES11622) (Jing et al., 2011). However, it should be noted that the acyl-ACP content of E. coli and plastids may differ substantially (Salas & Ohlrogge, 2002). Given its specific expression pattern during symbiosis and its membership of a distinct clade within the acyl ACP thioesterase family, we hypothesized that FatM might produce a fatty acid that is required exclusively during AMS. To test this hypothesis, we evaluated the ability of MtFatA, MtFatB and MtFatC to complement the fatm mutant. Each of the four M. truncatula Fat genes, and two negative controls (the Rubisco plastid-targeting signal RUBlsp-mCherry and also a gene encoding nuclear-localized n\GFP-GUS fusion protein) were expressed in fatm roots under the control of the FatM promoter. Following colonization with G. versiforme, the fatm mutant roots expressing FatM or FatB showed high levels of colonization with a high proportion of fully developed arbuscules (FIG. 4A-4B). In contrast, both negative controls did not restore any wild type arbuscules in fatm and colonization levels were low. Fat A and FatC partially rescued the fatm mutant phenotype, with Fat A showing the least ability to complement the arbuscule phenotype and colonization level (FIG. 4B). To check that the Fat proteins were localized to plastids during AMS, we expressed GFP fusions of each M.

truncatula Fat gene under the control of the FatM promoter in the fatm mutant. In all cases we observed GFP-labeled plastids in cells containing arbuscules (FIG. 5). Taken together, these data indicate that FatM and FatB have similar fatty acid specificities. However, all four Fats enabled some arbuscule formation in fatm and therefore have some level of biochemical activity capable of producing the fatty acids that are required during AMS. Consequently, we conclude that FatM has not acquired a novel biochemical activity but rather modulation of its promoter enables its specific role in AMS by achieving a high level of expression in colonized cells to increase the release of fatty acids, mostly likely 16:0. The arbuscule phenotype of fatm is similar to rami and str

Previously, Wang et al. reported the identification of RAM2, a GPAT that is required for AMS (Wang et al, 2012). As rami shows an aberrant arbuscule phenotype (Gobbato et al., 2013) and is anticipated to have a lipid-biosynthesis defect, we compared the rami and fatm mutants, rami (renamed raml-1 hereafter) is in the Jemalong A17 background while fatm is in the R108 background. Therefore we included a second rami allele, raml-2, (R108 background) in these experiments, raml-2 (line NF9247) has a Tntl retrotransposon insertion in the first exon of RAM2, which is predicted to result in the expression of a truncated protein of only 114 amino acids (FIG. 6). In addition, we included the str mutant in these experiments as it also shows an arbuscule defect and belongs to an ABC transporter family whose members are involved in lipid transport. A schematic diagram showing the positions of FatM and RAM2 in the lipid biosynthetic pathway is shown in FIG. 3A-3B.

We evaluated the mycorrhizal phenotype of fatm, rami and str at 3 and 5 wpp in a low phosphate substrate containing G. versiforme. The colonization levels were comparable in all mutants at both time points and, with the exception of fatm (3 wpp), they were substantially lower than their respective WT controls (FIG. 4A-4B). There was no difference between mutant and WT roots in the number of hyphopodia per cm of colonized root (FIG. 9), indicating that the reduced colonization levels result from a reduction in ability to spread within the root cortex and not in entry into the root system. A microscopic evaluation of the colonized sections of the roots revealed that in both rami alleles, str and fatm, the initial phases of arbuscule development occur as in WT roots (FIG. 10). Additionally, in all mutants we could observe arbuscules with first- and second-order branches, arbuscules that contained finer branches that were collapsing and arbuscules that were completely collapsed. However, at 3 wpp, the proportion of collapsed arbuscules was much higher in ram2-l, ram2-2 and str than in fatm, and small arbuscules that were not yet fully collapsed were more abundant in fatm (FIG. 8 and FIG. 11). Nevertheless, by 5 wpp, the majority of arbuscules in fatm were fully collapsed, similar to both rami alleles and to str. Thus, all mutants show an inability to sustain full arbuscule development but this manifests earlier in str and rami than in fatm.

To evaluate the phenotypes at the molecular level, we examined the transcript levels of eight AMS- induced genes. Consistent with the reduction in colonization, transcript levels for these genes were reduced in both fatm and ram2-2 relative to their WT controls (FIG. 11). Additionally, we evaluated transcript levels of FatA, FatB and FatC. These were not altered in either mutant. Despite the difference in severity of the AMS mutant phenotype at 3wpp, gene expression patterns in fatm and ram2-2 are similar.

Lipid profiles reflect impairment of AMS in fatm, rami and str

To further characterize fatm, rami and str, we analyzed the lipid profiles of their roots during symbiosis with G. versiforme during growth in low phosphate conditions. Nonpolar glycerolipids (TAG, DAG), phospholipids, glycolipids, and total and free fatty acids were analyzed. Previous analyses have shown that during phosphate deficiency, phospholipids are partially replaced by glycolipids and this response is reversed during a successful AMS (Wewer et al., 2014). Consistent with their impaired symbioses, the levels of the glycolipid digalactosyldiacylglycerol (DGDG) were higher, and the levels of the phospholipids phosphatidylcholine (PC) and phosphatidylethanolamine (PE), were lower, in all the mutants compared to their WT controls (FIG. 12).

In all of these analyses, a combination of fungal and plant lipids is measured and the origin of the lipids is known only when the lipid contains a fatty acid that is produced uniquely by one of the symbionts. The two major fatty acids found in Glomus species are 16:0 (palmitic acid) and 16:1 co5 (palmitvaccenic acid) (Nordby et al., 1981; Graham et al., 1995; Olsson & Johansen, 2000; Wewer et al., 2014). Of these, 16:1 co5 is uniquely of fungal origin and is considered an AMF marker lipid. In addition, 18:1 co7 and 20:1 All acyl groups accumulate in colonized roots and are considered specific for the fungus (Larsen et al., 1998; Stumpe et al., 2005).

We analyzed the total fatty acid content, representing free fatty acids and acyl groups bound to lipids, in roots colonized by G. versiforme and observed that monounsaturated fatty acids 16:1 co5, 18: 1 Δ9, 18:1 co7 were reduced in all of the mutants relative to their WT controls (FIG. 13A-13D). This is consistent with the low levels of AM fungi in the mutant roots (FIG. 8A-8B). Measurements of free fatty acids revealed a reduction in 16:1 co5 content in all the mutants and a reduction in 18:1 Δ9 free fatty acids in fatm relative to WT controls (FIG. 14). Free fatty acid measurements reflect de novo fatty acids produced in plastids as well as free acyl groups produced during membrane and storage lipid metabolism. Therefore the free and total fatty acid accumulation patterns may differ from each other (Stumpe et al., 2005). An increase in the content of 18:3 free fatty acids was observed in str relative to WT. The accumulation of 18:3 might represent an indirect consequence of alterations in lipid synthesis as observed in other lipid mutants (Focks & Benning, 1998; Moreno-Perez et al., 2012).

In all mutants, the amounts of triacylglycerol (TAG) species containing 16: 1 (48:1, 16:0-16:0-16:1 and 48:2, 16:0-16: 1-16:1) were substantially lower than in the corresponding WT (FIG. 15A-15D and FIG. 16). The only exception was 48:3 TAG (16:1-16: 1-16:1), which was low in all mutants except ram2-2. The precursors of TAG lipids are

diacylglycerols (DAGs), and we found that 32:1 DAG (16:0-16:1), one of the precursors for 48:1 and 48:2 TAG, was also low in all mutants (FIG. 17A-17B). Although the position of the double bond cannot be determined in these analyses, the 16:1 is very likely 16:lco5, as observed previously (Wewer et al., 2014).

The PC and PE species 38:4, 38:5, 38:6, 40:6, 40:7 and 40:8 accumulate specifically in Lotus japonicus roots colonized with AM fungi (Wewer et al., 2014). Likewise we found that these 38:X and 40 :X molecular species of PC, PE, phosphatidic acid (PA) and phosphatidylserine (PS) species accumulated to lower levels in all mutants relative to their corresponding WT controls (FIG. 18 and FIG. 19). Taken together, the low levels of fungal- specific lipids in the fatm, rami and str mutants are consistent with their inability to fully develop AMS and consequently, low colonization levels. Fine-tuning of the ER-localized lipid biosynthesis pathway by FatM, RAM2 and STR during AMS

Free fatty acids released from the plastids by the action of the Fat thioesterases can be converted into acyl-CoA esters and serve as substrates for GPATs in the ER (Li-Beisson et al., 2010). RAM2 is expressed in cells containing arbuscules (Gobbato et al., 2013) and is conserved only in plants that form AMS (Wang et al., 2012; Bravo et al., 2016). Based on its similarity to Arabidopsis GPAT6, RAM2 is predicted to have a functional phosphatase domain and to produce β-monoacylglycerols (PMAGs). The expression patterns of the FatM and RAM2 genes and the similarity between the phenotypes of fatm and rami led us to hypothesize that fatty acids released by FatM might ultimately serve as substrates for RAM2. To test this hypothesis, we profiled MAGs in WT and mutants by GC-MS. We were able to discriminate between the two types of MAGs: aMAGs (sn-l and sn-3) and the less abundant MAGs (sn-2). Several molecular species of aMAGs were detected in mutant and WT colonized roots (FIG. 20). While the amounts of the saturated and highly unsaturated (18:2 and 18:3) aMAGs were comparable in WT and mutants, the monounsaturated fungal- specific aMAGs (16:1 co5 and 18:1 co7) were lower in fatm, rami and str relative to their WT controls, which again correlates with low colonization.

The amounts of MAGs were lower than the aMAGs and fewer molecular species were detected. We could identify only 16:0, 18:0, 20:0 and 22:0 saturated MAGs and 18:1 Δ9, 18:2 and 18:3, unsaturated MAGs. In A17 control, ram2-l and str we could not detect 20:0 nor 18:1 Δ9 MAGs. In comparison with their respective WT controls, the levels of 16:0 MAGs were strongly reduced in fatm and in both alleles of rami but not in str. (FIG. 21A- 2 IB). In contrast, there were no differences between mutants and wild type for the other MAGs apart from 18:1 Δ9 βΜΑϋ which showed a small reduction in fatm relative to WT.

During the biosynthesis of glycerolipids, including TAG, PC plays a major role in the flux of lipids by serving as a fatty acid pool. When we analyzed the composition of fatty acids in PC, we observed large increases in the unusual molecular species 16:0-16:0 (32:0) PC and 16:0-16:0 (32:0) PA in both rami alleles relative to WT (FIG. 22A-22D).

Additionally, we detected smaller increases in 32:0 PI and 32:0 PG although the increases were significant only for one of the rami alleles relative to WT. The likely explanation for these findings is that, in the absence of RAM2 activity, the fatty acid from 16:0-CoA is redirected into phospholipids. Moreover, the levels of 16:0-16:0 (32:0) DAG in rami are higher than those in WT or in the fatm and str mutants (FIG. 17A-17B), suggesting a change in the flux of 16:0 towards storage lipids as well. The reduction of 16:0 MAGs in rami together with the increases of 32:0 phospholipids and 32:0 DAG in rami relative to WT supports the idea that 16:0 βΜΑϋ is the major product of RAM2. Furthermore, the reduction of 16:0 βΜΑϋ (FIG. 21A-21B), and of 16:0-16:0 (FIG. 22A-22D) species of PC in fatm relative to WT, is consistent with the hypothesis that FatM releases 16:0 fatty acids from plastids. Thus we propose that the 16:0 fatty acids released by FatM are fed into the production of 16:0 MAGs that are required for AMS (FIG. 23A-23C).

Could STR be involved in lipid transport across the periarbuscular membrane?

Many plant ABC transporters in the G sub-family are involved in lipid export (Hwang et al., 2016) including those that are closely related to STR and STR2 (Yadav et al., 2014). Currently, the substrate of the STR transporter is unknown, but one possibility is that STR exports the 16:0 βΜΑϋ produced by RAM2 across the periarbuscular membrane for subsequent use by the fungus. If the 16:0 βΜΑϋ is not further modified into a different lipid or degraded, and if flux through the pathway is not slowed by low expression of FatM or RAM2, then these molecules might accumulate in str cortical cells when colonized by AM fungi. The MAG analyses showed that fungal-specific aMAG species (16:1 co5) were reduced in str relative to WT (FIG. 20) and correlated with low colonization (FIG. 21A-21B). In contrast, the level of 16:0 βΜΑϋ in str was similar to that of the WT control and significantly higher than that of rami. We did not detect an accumulation of any 16:0-16:0 containing phospholipids in str (FIG. 22A-22D), which means that, unlike rami, there is no redirection of fatty acids towards the production of 16:0-16:0 containing PC or other phospholipids. These data alone do not prove that STR transports 16:0 βΜΑϋ; however, fungal colonization levels are similar in fatm, rami and str (FIG. 8A-8B) and many other lipids accumulate to similar levels in all three mutants (FIG. 13-13D, 15A-15D, 21A-21B, 23A-23C), therefore the observation that 16:0 βΜΑϋ is not reduced in str, but instead accumulates to almost WT levels, makes this molecule a potential substrate for the

STR/STR2 transporter.

Results

During symbiosis, the colonized cortical cells show a massive increase in expression of some lipid biosynthesis genes, including the thioesterase, FatM and the GPAT, RAM2. Here, further analysis of the fatm mutant, and detailed comparisons of the arbuscule phenotypes and lipid profiles of fatm, rami and str provide data to support the proposal that FatM and RAM2 redirect lipid biosynthesis in the colonized cell for the production of 16:0 βΜΑϋ. This molecule also appears to be exported from the cell, possibly through the STR/STR2 transporter, for utilization by the fungus.

We profiled a broad range of lipid molecules and in the majority of cases, the content of fungal-specific lipids in the mutant mycorrhizal roots was much lower than that of the corresponding WT mycorrhizal roots, which correlates with low colonization levels and low fungal biomass in the mutants. However, the accumulation patterns of some lipids deviate from this expected pattern and therefore provide insights into altered metabolism in the mutants. In this regard, perhaps the most informative profiles are the MAGs. The broad range of aMAGs include several fungal- specific aMAGs and as observed for other fungal- specific lipids, their levels in the mutant mycorrhizal roots are low and correlate with low fungal colonization. However, the MAGs, showed a different pattern. A significant decrease in 16:0 βΜΑϋ content was observed in fatm and rami relative to WT but this did not occur in str, where the 16:0 βΜΑϋ content was similar to that of WT. Based on its sequence similarity to AtGPAT6, RAM2 is predicted to produce MAGs, and the rami lipid profile is consistent with a role in production of 16:0 βΜΑϋ. But is the 16:0 βΜΑϋ that we measure of plant origin? In principle, the low level of 16:0 βΜΑϋ in rami could be simply a reflection of low fungal biomass in the rami roots, as observed for the fungal- specific aMAGs or other fungal- specific lipids. However, the observation that 16:0 βΜΑϋ remains high in str, at levels that do not differ from WT, argues that the 16:0 βΜΑϋ is unlikely to be a fungal lipid. In further support of this, no βΜΑϋ molecules with fungal- specific acyl groups (in particular 16:1 co5) were detected (unlike aMAGs) suggesting either that the fungus does not make βΜΑϋ8 or that they exist at levels below the limits of detection.

Previously Yang et al (Yang et al., 2012b) had noted that the sn-2-GPATs were present only in land plants and were not identified in other eukaryotes, which also supports a plant origin for the 16:0 βΜΑϋ.

The PC and DAG lipid profiles also showed unexpected results and revealed that rami accumulated 32:0 PC and DAG species to levels much greater than WT, and that this did not occur in fatm or str. Accumulation in rami could arise through the redirection of the excess 16:0 acyl molecules into the membrane and storage lipid pathways, possibly via other GPATs, such as GPAT9 whose expression occurs at basal levels in mycorrhizal roots

(MtGEA gene atlas). The lipid biosynthetic pathways are highly interconnected and when perturbed, redirection of lipids is a common phenomenon (Li-Beisson et al., 2010).

Coupled with the similarities in mycorrhizal phenotypes, the observation that fatm and rami both show a significant decrease in 16:0 βΜΑϋ relative to WT is consistent with the idea that the FatM promotes the release of 16:0 fatty acids that subsequently become the substrates for RAM2. A role for FatM in the release of 16:0 fatty acids is supported by the fatm cross- complementation studies which showed that FatB, whose ortholog in Arabidopsis shows a substrate preference for 16:0 fatty acids (Salas & Ohlrogge, 2002) complements fatm as effectively as the native FatM. The appearance of high levels of 32:0 membrane and storage lipids in rami, where 16:0 metabolism to 16:0 βΜΑϋ is blocked, suggests a substantial increase in export of 16:0 fatty acids from the plastids in these cells. There is a major increase in FatM expression during symbiosis and the cross-complementation experiments indicate that this increase in Fat thioesterase activity is essential for symbiosis. The endogenous levels of the other 3 Fat genes (FatA, FatB and FatC) are insufficient to sustain arbuscule development, even partially, unless artificially boosted by expression from the FatM promoter.

The profile of MAGs in str indicated that despite low colonization, the 16:0 βΜΑϋ content was close to that of WT which could be explained by lack of export through the PAM. If the 16:0 βΜΑϋ cannot be transported out of the cell, it might be questioned why the levels are not higher in str, relative to WT, particularly given the large flux through FatM and RAM2. One possibility is that the 16:0βΜΑϋ is degraded and remobilized. A second possibility is that high levels of FatM and RAM2 are not sustained in str, as the arbuscule dies very rapidly. In support of this second hypothesis, FatM and RAM2 transcript levels are low in str (FIG. 24) as noted previously for PT4 (Zhang et al., 2010).

In Arabidopsis, it has been clearly demonstrated that βΜΑϋ species are not destined for membrane or storage lipid biosynthesis but rather exported to the cell surfaces where they form extracellular lipid polymers such as cutin and suberin (Li et al., 2007). Consequently, the 16:0 βΜΑϋ generated in cells with arbuscules is also likely to be an export product and could in theory be exported across either the plasma membrane or the periarbuscular membrane. The presence of the STR/STR2 transporter, which is located exclusively in the periarbuscular membrane (Zhang et al., 2010) provides an avenue to direct the product specifically to the periarbuscular apoplast for access by the arbuscule. The STR/STR2 is an attractive candidate for exporting βΜΑϋ8 because most of the half ABCG transporters characterized so far are exporters of ω-oxidized fatty acyl-containing MAGs. This includes the A. thaliana transporters that are phylogenetically the most closely related to STR/STR2 (Yadav et al., 2014). In the case of the Arabidopsis transporters, the evidence is based on the phenotypes of the mutant plants, rather than direct transport evidence, mainly because these transport assays are particularly challenging (Lefevre et al., 2015). If indeed STR/STR2 exports 16:0 βΜΑϋ to the periarbuscular apoplast, the polar nature of this lipid molecule would ensure its solubility and movement across the aqueous environment of the

periarbuscular space for subsequent access by the fungus.

During symbiosis increased fatty acid production in the colonized cells may be needed to support development of the extensive periarbuscular membrane and/or possibly to supply lipid to the fungus, and it seems likely that loss of either of those could result in a defect in arbuscule development. The PC and DAG lipid profiles of rami showed an increase in membrane and storage lipids which suggests that lipids for building the periarbuscular membrane are not lacking in rami. Consequently, the inability of the fungus to develop arbuscules in rami arises because the fungus lacks a source of fatty acids from which to build its membranes. As the ram2,fatm and str phenotypes are very similar, we infer that this is also the explanation for defective arbuscule development in fatm and str. The plasma membrane of the arbuscule is likely a similar size to the periarbuscular membrane so it can be anticipated that substantial quantities of lipids are needed for membrane development. The fungus can acquire hexoses from the plant (Ratcliffe & Shachar-Hill, 2001; Helber et al.,

2011) and labeling studies indicate that hexoses are rapidly incorporated into lipids (Pfeffer et al., 1999). However, as the fungus apparently lacks type-I FAS, it is unlikely that it uses hexoses for de novo fatty acid biosynthesis but rather to support subsequent elongation and modification reactions (Wewer et al., 2014). Consequently, a source of fatty acids, of chain lengths up to C16, is needed to begin this process. While labeling experiments will provide the ultimate proof of lipid transfer to the fungus and the identity of the molecule(s) transferred, our data provide initial evidence in favor of 16:0 βΜΑϋ.

EXAMPLE II

Addition of 2-palmitoyl glycerol (2-PG) to extraradical hyphae of AM fungi promotes growth and sporulation

AM fungi are considered obligate symbionts and are able to grow and sporulate only when associated with plant roots. Consequently, this limits production of AM fungi spores and prevents large-scale production of AM fungal inoculum in a cost-effective manner. The difficulty with production of spores and the cost associated with their production has made commercialization largely impractical. Enhanced growth and sporulation of AM fungi would allow for commercial production of inoculums, and use of AM fungi in agriculture would reduce fertilizer inputs, which would have both economic and environmental benefits. The AM fungus, Rhizophagus irregularis, can be cultured in association with excised carrot roots on petri plates and this method is used widely for the production of spores (see Maldonado-Mendoza & Harrison, 2001). To produce spores, the carrot roots are grown on one side of a two-compartment petri plate and inoculated with AM fungi. The fungi colonize the roots and the extra-radical hyphae extend into the surrounding media and then into the second compartment, which contains media lacking sugar and is where sporulation occurs.

Having determined that plants supply C16:0 β-monoacyl glycerol to feed AM fungi, we decided to assess whether the addition of lipid to the 'fungus only' side of these plates would improve growth and sporulation. Accordingly, 2-PG (which is C16:0 β-monoacyl glycerol) was added at different concentrations to split petri plates with hyphae from

Rhizophagus irregularis. The 2-PG was dissolved in 100% ethanol and 200 μΐ were added on top of the agar on the half without carrot roots (i.e., the fungus-only half).

In a first experiment, 10 μΜ 2-PG was added to 6 petri plates and after 4 days there was an increase in the number of spores present. Although there was some variability between plates, all 6 plates showed an increase in the amount of spores.

In a second experiment, 10 μΜ 2-PG was added to 5 petri plates and 100% ethanol (solvent control) to an additional 5 petri plates as a negative control (FIG. 25 A). Pictures of the plates were taken on days 7 and 35 to record growth. All 5 petri plates receiving 2-PG showed an increase in the number of spores. However, 2 negative controls also showed an increase in the number of spores.

In a third experiment, 50 μΜ 2-PG was added to 4 petri plates, 200 μΜ 2-PG was added to 2 plates and 100% ethanol was added to 4 plates (FIG. 25B-26C). Pictures of the plates were taken on days 2, 4, 6, 8, 11 & 14 to record growth after adding the treatment. In all but one of the petri plates with 2-PG there was a substantial increase in the number of spores and hyphae. Furthermore, the plates with a higher concentration of 2-PG showed an even higher number of spores than the lower concentration of 2-PG. There were only very small increases of spores in the control plates with ethanol.

In a fourth experiment, we evaluated the effects of adding Tween 40

(Polyoxyethylenesorbitan monopalmitate) to the agar at 0.5%, 0.05% and 0.005%. This promoted hyphal growth in a concentration dependent manner.

Also, based on transcriptome data that identified transport systems that the fungus is using to obtain nutrients from the plant, it is likely that including Vitamins B5 and/or biotin would be beneficial for growth and sporulation. EXAMPLE III

Formulations for treating plants to promote arbuscular mycorrhiza growth and development

Based on the foregoing examples, it is clear that 2-PG is very effective in promoting the growth of AM fungi. Accordingly, formulations comprising 2-PG for application to plants of interest where growth of AM fungi is desired are provided. A first formulation comprises a mixture of between 50, 60, 75, 100, 150, 200, 250 μΜ 2-PG in agar. A second formulation comprises similar concentrations of 2-PG and between .5%, .05%, .005% Tween 40 (Polyoxyethylenesorbitan monopalmitate) in agar. Other fatty acids for use in the formulations can include one or more of palmitic, strearic, oleic and linoleic fatty acids. These formulations can be applied directly to extraradical hyphae or applied to substrates where extraradical hyphae can be propagated. Suitable substrates include without limitation, sand, soil and vermiculite. In other embodiments the formulations are sprayed directly onto soil.

The formulations described above can also be added to certain fertilizer compositions, such as the controlled release fertilizer composition described in US Patent 9,266,787. Such fertilizer compositions can optionally comprise one or more reagents selected from urea, ammonia, ammonium nitrate, ammonium sulfate, calcium nitrate, diammonium phosphate, monoammonium phosphate, potassium nitrate and sodium nitrate, monopotassium phosphate, dipotassium phosphate, tetrapotassium pyrophosphate, and potassium

metaphosphate and optionally a macronutrient selected from the group consisting of sulfur, calcium and magnesium and/or micronutrients including boron, copper, iron, manganese, molybdenum and zinc provided that such reagent does not interfere with the growth promoting action of 2-PG.

These aforementioned formulations and compositions can further comprise a dispersing agent, such as those disclosed in US Patent 8,241,387.

References

Bago B, Pfeffer PE, Douds DD, Brouillette J, Becard G, Shachar-Hill Y. 1999. Carbon

metabolism in spores of the arbuscular mycorrhizal fungus Glomus intraradices as revealed by nuclear magnetic resonance spectroscopy. Plant physiology 121 : 263-72. Bago B, Pfeffer PE, Shachar-hill Y. 2000. Carbon Metabolism and Transport in Arbuscular Mycorrhizas. Plant physiology 124: 949-957. Bago B, Pfeffer PE, Zipfel W, Lammers P, Shachar-Hill Y. 2002. Tracking metabolism and imaging transport in arbuscular mycorrhizal fungi. Plant and Soil 244: 189-197.

Benedito V a, Torres-Jerez I, Murray JD, Andriankaja A, Allen S, Kakar K, Wandrey M,

Verdier J, Zuber H, Ott T, et al. 2008. A gene expression atlas of the model legume Medicago truncatula. The Plant journal : for cell and molecular biology 55: 504-13. Bona venture G, Salas JJ, Pollard MR, Ohlrogge JB. 2003. Disruption of the FATB gene in

Arabidopsis demonstrates an essential role of saturated fatty acids in plant growth. Plant cell 15: 1020-1033.

Bravo A, York T, Pumplin N, Mueller LA, Harrison MJ. 2016. Genes conserved for

arbuscular mycorrhizal symbiosis identified through phylogenomics. Nature plants 2: 15208.

Cox G, Tinker PB. 1976. Translocation and Transfer of Nutrients in Vesicular-Arbuscular Mycorrhizas . I . The Arbuscule and Phosphorus Transfer : A Quantitative Ultrastructural Study. The New phytologist 77: 371-378.

Destaillats F, Cruz-Hernandez C, Nagy K, Dionisi F. 2010. Identification of

monoacylglycerol regio-isomers by gas chromatography-mass spectrometry. Journal of chromatography. A 1217: 1543-8.

Dickson S, Kolesik P. 1999. Visualisation of mycorrhizal fungal structures and quantification of their surface area and volume using laser scanning confocal microscopy. Mycorrhiza 9: 205-213.

Dormann P, Voelker TA, Ohlrogge JB. 1995. Cloning and expression in Escherichia coli of a novel thioesterase from Arabidopsis thaliana specific for long-chain acyl-acyl carrier proteins. Archives of biochemistry and biophysics 316: 612-8.

Fester T, Strack D, Hause B. 2001. Reorganization of tobacco root plastids during arbuscule development. Planta 213: 864-868.

Focks N, Benning C. 1998. wrinkledl: A novel, low-seed-oil mutant of Arabidopsis with a deficiency in the seed-specific regulation of carbohydrate metabolism. Plant Physiology

118: 91-101.

Gasulla F, Vom Dorp K, Dombrink I, Zahringer U, Gisch N, Dormann P, Bartels D. 2013.

The role of lipid metabolism in the acquisition of desiccation tolerance in Craterostigma plantagineum: a comparative approach. The Plant journal : for cell and molecular biology 75: 726-41.

Gaude N, Bortfeld S, Duensing N, Lohse M, Krajinski F. 2012a. Arbuscule-containing and non-colonized cortical cells of mycorrhizal roots undergo extensive and specific reprograrnming during arbuscular mycorrhizal development. The Plant Journal 69: 510— 528.

Gaude N, Schulze WX, Franken P, Krajinski F. 2012b. Cell type-specific protein and

transcription profiles implicate periarbuscular membrane synthesis as an important carbon sink in the mycorrhizal symbiosis. Plant Signaling & Behavior 7: 461^464.

Gobbato E, Wang E, Higgins G, Bano SA, Henry C, Schultze M, Oldroyd GED. 2013.

RAMI and RAM2 function and expression during arbuscular mycorrhizal symbiosis and Aphanomyces euteiches colonization. Plant signaling & behavior 8: 1-5.

Gomez SK, Javot H, Deewatthanawong P, Torres-Jerez I, Tang Y, Blancaflor EB, Udvardi MK, Harrison MJ. 2009. Medicago truncatula and Glomus intraradices gene expression in cortical cells harboring arbuscules in the arbuscular mycorrhizal symbiosis. BMC Plant Biology 9: 10.

Graham JH, Hodge NC, Morton JB. 1995. Fatty Acid methyl ester profiles for

characterization of glomalean fungi and their endomycorrhizae. Applied and

environmental microbiology 61: 58-64.

Gutjahr C, Radovanovic D, Geoffroy J, Zhang Q, Siegler H, Chiapello M, Casieri L, An K, An G, Guiderdoni E, et al. 2012. The half-size ABC transporters STR1 and STR2 are indispensable for mycorrhizal arbuscule formation in rice. The Plant Journal 69: 906- 920.

Harrison MJ, Dewbre GR, Liu J. 2002. A phosphate transporter from Medicago truncatula involved in the acquisition of phosphate released by arbuscular mycorrhizal fungi. The

Plant cell 14: 2413-29.

He J, Benedito V a, Wang M, Murray JD, Zhao PX, Tang Y, Udvardi MK. 2009. The

Medicago truncatula gene expression atlas web server. BMC bioinformatics 10: 441. Helber N, Wippel K, Sauer N, Schaarschmidt S, Hause B, Requena N. 2011. A versatile monosaccharide transporter that operates in the arbuscular mycorrhizal fungus Glomus sp is crucial for the symbiotic relationship with plants. The Plant cell 23: 3812-23.

Hogekamp C, Kiister H. 2013. A roadmap of cell-type specific gene expression during

sequential stages of the arbuscular mycorrhiza symbiosis. BMC genomics 14: 306.

Hwang J-U, Song W-Y, Hong D, Ko D, Yamaoka Y, Jang S, Yim S, Lee E, Khare D, Kim K, et al. 2016. Plant ABC Transporters Enable Many Unique Aspects of a Terrestrial Plant's

Lifestyle. Molecular plant 9: 338-55.

Ivanov S, Harrison MJ. 2014. A set of fluorescent protein-based markers expressed from

constitutive and arbuscular mycorrhiza-inducible promoters to label organelles, membranes and cytoskeletal elements in Medicago truncatula. The Plant Journal 80: 1151-1163.

Jabaji-Hare S. 1988. Lipid and Fatty Acid Profiles of Some Vesicular- Arbuscular

Mycorrhizal Fungi: Contribution to Taxonomy. Mycologia 80: 622.

Javot H, Penmetsa RV, Terzaghi N, Cook DR, Harrison MJ. 2007. A Medicago truncatula phosphate transporter indispensable for the arbuscular mycorrhizal symbiosis.

Proceedings of the National Academy of Sciences of the United States of America 104: 1720-5.

Jing F, Cantu DC, Tvaruzkova J, Chipman JP, Nikolau BJ, Yandeau-Nelson MD, Reilly PJ.

2011. Phylogenetic and experimental characterization of an acyl-ACP thioesterase family reveals significant diversity in enzymatic specificity and activity. BMC biochemistry 12: 44.

Jones A, Davies HM, Voelker TA. 1995. Palmitoyl-acyl carrier protein (ACP) thioesterase and the evolutionary origin of plant acyl-ACP thioesterases. The Plant cell 7: 359-71. Joyard J, Ferro M, Masselon C, Seigneurin-Berny D, Salvi D, Garin J, Rolland N. 2010.

Chloroplast proteomics highlights the subcellular compartmentation of lipid metabolism. Progress in Lipid Research 49: 128-158.

Kobae Y, Hata S. 2010. Dynamics of periarbuscular membranes visualized with a fluorescent phosphate transporter in arbuscular mycorrhizal roots of rice. Plant & cell physiology 51 : 341-53.

Krajinski F, Courty P-E, Sieh D, Franken P, Zhang H, Bucher M, Gerlach N, Kryvoruchko I, Zoeller D, Udvardi MK, et al. 2014. The H+-ATPase HA1 of Medicago truncatula Is Essential for Phosphate Transport and Plant Growth during Arbuscular Mycorrhizal Symbiosis. The Plant cell 26: 1808-1817.

Larsen J, Olsson PA, Jakobsen I. 1998. The use of fatty acid signatures to study mycelial interactions between the arbuscular mycorrhizal fungus Glomus intraradices and the saprotrophic fungus Fusarium culmorum in root-free soil. Mycological Research 102: 1491-1496.

Lefevre F, Baijot A, Boutry M. 2015. Plant ABC transporters: time for biochemistry?

Biochemical Society Transactions 43: 931-936.

Li-Beisson Y, Shorrosh B, Beisson F, Andersson MX, Arondel V, Bates PD, Baud S, Bird D,

DeBono A, Durrett TP, et al. 2010. Acyl-Lipid Metabolism. The Arabidopsis Book 8: e0133. Li Y, Beisson F, Ohlrogge J, Pollard M. 2007. Monoacylglycerols are components of root waxes and can be produced in the aerial cuticle by ectopic expression of a suberin- associated acyltransferase. Plant physiology 144: 1267-77.

Liu J, Blaylock L, Harrison MJ. 2004. cDNA arrays as a tool to identify mycorrhiza- regulated genes: identification of mycorrhiza-induced genes that encode or generate signaling molecules implicated in the control of root growth. Canadian Journal of Botany

82: 1177-1185.

Maldonado-Mendoza IE, Dewbre GR, Harrison MJ. 2001. A phosphate transporter gene from the extra-radical mycelium of an arbuscular mycorrhizal fungus Glomus intraradices is regulated in response to phosphate in the environment. Mol Plant Microbe Interact. 14(10): 1140-8.

McGonigle TP, Miller MH, Evans DG, Fairchild GL, Swan J a. 1990. A new method which gives an objective measure of colonization of roots by vesicular-arbuscular mycorrhizal fungi. New Phytolo gist 115: 495-501.

Moreno-Perez AJ, Venegas-Caleron M, Vaistij FE, Salas JJ, Larson TR, Garces R, Graham I a., Martinez-Force E. 2012. Reduced expression of FatA thioesterases in Arabidopsis affects the oil content and fatty acid composition of the seeds. Planta 235: 629-639. Nordby HE, Nemec S, Nagy S. 1981. Fatty acids and sterols associated with citrus root

mycorrhizae. Journal of Agricultural and Food Chemistry 29: 396-401.

Olsson PA, Johansen A. 2000. Lipid and fatty acid composition of hyphae and spores of arbuscular mycorrhizal fungi at different growth stages. Mycological Research 104: 429-

434.

Pfeffer, Douds Jr DD, Becard, Shachar-Hill. 1999. Carbon uptake and the metabolism and transport of lipids in an arbuscular mycorrhiza. Plant physiology 120: 587-98.

Ratcliffe RG, Shachar-Hill Y. 2001. Probing plant metabolism with NMR. Annual review of plant physiology and plant molecular biology 52: 499-526.

Salas JJ, Ohlrogge JB. 2002. Characterization of substrate specificity of plant FatA and FatB acyl-ACP thioesterases. Archives of biochemistry and biophysics 403: 25-34.

Schliemann W, Ammer C, Strack D. 2008. Metabolite profiling of mycorrhizal roots of Medicago truncatula. Phytochemistry 69: 112-46.

Smith SE, Read D. 2008. Mycorrhizal Symbiosis. San Diego, CA: Academic Press, Inc. Stumpe M, Carsjens J-G, Stenzel I, Gobel C, Lang I, Pawlowski K, Hause B, Feussner I.

2005. Lipid metabolism in arbuscular mycorrhizal roots of Medicago truncatula.

Phytochemistry 66: 781-91. Tang N, San Clemente H, Roy S, Becard G, Zhao B, Roux C. 2016. A Survey of the Gene

Repertoire of Gigaspora rosea Unravels Conserved Features among Glomeromycota for

Obligate Biotrophy. Frontiers in Microbiology 7: 1-16.

Tisserant E, Kohler A, Dozolme-Seddas P, Balestrini R, Benabdellah K, Colard A, Croll D, Da Silva C, Gomez SK, Koul R, et al. 2012. The transcriptome of the arbuscular mycorrhizal fungus Glomus intraradices (DAOM 197198) reveals functional tradeoffs in an obligate symbiont. New Phytologist 193: 755-69.

Trepanier M, Becard G, Moutoglis P, Willemot C, Gagne S, Avis TJ, Rioux J-A. 2005.

Dependence of arbuscular-mycorrhizal fungi on their plant host for palmitic acid synthesis. Applied and environmental microbiology 71 : 5341-7.

Voelker TA, Worrell AC, Anderson L, Bleibaum J, Fan C, Hawkins DJ, Radke SE, Davies

HM. 1992. Fatty Acid Biosynthesis redirected to Medium Chains in Transgenic Oilseed

Plants. Science (New York, N Y.) 257: 72-74.

Wang Q, Huang W, Jiang Q, Lian J, Sun J, Xu H, Zhao H, Liu Z. 2013. Lower Levels of Expression of FATA2 Gene Promote Longer Siliques with Modified Seed Oil Content in

Arabidopsis thaliana. Plant Molecular Biology Reporter 31: 1368-1375.

Wang E, Schornack S, Marsh JF, Gobbato E, Schwessinger B, Eastmond P, Schultze M,

Kamoun S, Oldroyd GED. 2012. A common signaling process that promotes mycorrhizal and oomycete colonization of plants. Current biology 22: 2242-6.

Wang E, Yu N, Bano SA, Liu C, Miller AJ, Cousins D, Zhang X, Ratet P, Tadege M, Mysore

KS, et al. 2014. A H+-ATPase That Energizes Nutrient Uptake during Mycorrhizal

Symbioses in Rice and Medicago truncatula. The Plant cell 26: 1818-1830.

Wewer V, Brands M, Dormann P. 2014. Fatty acid synthesis and lipid metabolism in the obligate biotrophic fungus Rhizophagus irregularis during mycorrhization of Lotus japonicus. The Plant journal : for cell and molecular biology 79: 398-412.

Wewer V, Dormann P, Holzl G. 2013. Analysis and quantification of plant membrane lipids by thin-layer chromatography and gas chromatography. Methods in molecular biology

(Clifton, N.J.) 1009: 69-78.

Yadav V, Molina I, Ranathunge K, Castillo IQ, Rothstein SJ, Reed JW. 2014. ABCG

Transporters Are Required for Suberin and Pollen Wall Extracellular Barriers in

Arabidopsis. The Plant Cell 26: 3569-3588.

Yang S-Y, Gr0nlund M, Jakobsen I, Grotemeyer MS, Rentsch D, Miyao A, Hirochika H,

Kumar CS, Sundaresan V, Salamin N, et al. 2012a. Nonredundant regulation of rice arbuscular mycorrhizal symbiosis by two members of the PHOSPHATE TRANSPORTER! gene family. The Plant cell 24: 4236-51.

Yang W, Pollard M, Li-Beisson Y, Beisson F, Feig M, Ohlrogge J. 2010. A distinct type of glycerol-3 -phosphate acyltransferase with sn-2 preference and phosphatase activity producing 2-monoacylglycerol. Proceedings of the National Academy of Sciences of the United States of America 107: 12040-5.

Yang W, Simpson JP, Li-Beisson Y, Beisson F, Pollard MR, Ohlrogge JB. 2012b. A Land- Plant- Specific Glycerol-3 -Phosphate Acyltransferase Family in Arabidopsis: Substrate Specificity, sn-2 Preference and Evolution. Plant physiology 160: 638-652.

Zhang Q, Blaylock L a, Harrison MJ. 2010. Two Medicago truncatula half- ABC transporters are essential for arbuscule development in arbuscular mycorrhizal symbiosis. The Plant cell 22: 1483-97.

While certain of the preferred embodiments of the present invention have been described and specifically exemplified above, it is not intended that the invention be limited to such embodiments. Various modifications may be made thereto without departing from the scope and spirit of the present invention, as set forth in the following claims.

Claims

What is claimed is:

1. A method for enhancing growth or sporulation of arbuscular mycorrizal fungi comprising treating said fungi with a composition comprising a β-monoacylglycerol, or a derivative thereof.

2. The method of claim 1, wherein said β-monoacylglycerol is 2-palmitoylglycerol (2-PG).

3. The method of claim 1, wherein said arbuscular mycorrizal fungi is Rhizophagus irregularis.

4. The method of claim 1, wherein said fungi are associated with plant roots.

5. A biofertilizer composition comprising β-monoacylglycerol, or a derivative thereof and Rhizophagus irregularis.

6. The biofertilizwer composition of claim 5, further comprising one or more of urea, ammonia, ammonium nitrate, ammonium sulfate, calcium nitrate, diammonium phosphate, monoammonium phosphate, potassium nitrate and sodium nitrate, monopotassium phosphate, dipotassium phosphate, tetrapotassium pyrophosphate, and potassium metaphosphate.

7. The biofertilizer composition of claim 5 further comprising a macronutrient or

micronutrient selected from the group consisting of sulfur, calcium, magnesium, boron, copper, iron, manganese, molybdenum and zinc.

8. The biofertilizer composition of claim 5, further comprising a dispersing agent.

9. The bioferitizler composition of claim 5, further comprising one or more fatty acids, one or more amino acids, one or more vitamins, one or more fatty acid conjugates and one or more surfactants and one or more sterols.