WO2019014663A1 - Modulating biomarkers to increase tumor immunity and improve the efficacy of cancer immunotherapy - Google Patents
Modulating biomarkers to increase tumor immunity and improve the efficacy of cancer immunotherapy Download PDFInfo
- Publication number
- WO2019014663A1 WO2019014663A1 PCT/US2018/042241 US2018042241W WO2019014663A1 WO 2019014663 A1 WO2019014663 A1 WO 2019014663A1 US 2018042241 W US2018042241 W US 2018042241W WO 2019014663 A1 WO2019014663 A1 WO 2019014663A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cancer
- agent
- activity
- biomarker
- subject
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/5751—Immunoassay; Biospecific binding assay; Materials therefor for cancer of the skin, e.g. melanoma
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/5758—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/112—Disease subtyping, staging or classification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
Definitions
- Loss-of-function genetic screens have been increasingly used to study the functional consequences of gene deletion on tumor cells (Howard et al. (2016) Functional Genomic Characterization of Cancer Genomes. Cold Spring Harb. Symp. Quant. Biol. (2016); Ebert et al. (2008) Nature 451 :335-339; Cowley et al. (2014) Scientific Data 1 : article number 140035).
- These approaches include pooled genetic screens using CRISPR-Cas9-mediated genome editing that simultaneously test the role of a large number of genes on tumor cell growth, viability or drug resistance (Wang et al. (2014) Science 343 :80-84; Shalem et al. (2014) Science 343 :84-87).
- the present invention is based, at least in part, on the discovery that inhibiting or blocking one or more biomarkers listed in Table 1, such as one or more regulators of T F signaling and/or F- ⁇ activation ⁇ e.g., receptor-interacting serine/threonine-protein kinase 1 (RIPK1), BIRC2, TBK1, TRAF3, RNF31, RBCK1, OTULIN, TRAF6, TAB2, and TNIP1), in combination with an immunotherapy, results in a synergistic therapeutic benefit for treating cancers that is unexpected given the lack of such benefit observed for the immunotherapy alone.
- one or more regulators of T F signaling and/or F- ⁇ activation e.g., receptor-interacting serine/threonine-protein kinase 1 (RIPK1), BIRC2, TBK1, TRAF3, RNF31, RBCK1, OTULIN, TRAF6, TAB2, and TNIP1
- a method of treating a subject afflicted with a cancer comprising administering to the subject a therapeutically effective amount of an agent that inhibits one or more biomarkers listed in Table 1 or a fragment thereof, in combination with an immunotherapy, is provided.
- the agent described herein decreases the copy number, the expression level, and/or the activity of one or more biomarkers in Table 1 (e.g., one or more regulators of TNF signaling and/or NF- ⁇ activation (e.g., RIPKl, BIRC2, TBKl, TRAF3, RNF31, RBCK1, OTULIN, TRAF6, TAB2, and TNIP1).
- one or more biomarkers in Table 1 e.g., one or more regulators of TNF signaling and/or NF- ⁇ activation (e.g., RIPKl, BIRC2, TBKl, TRAF3, RNF31, RBCK1, OTULIN, TRAF6, TAB2, and TNIP1).
- the agent selectively decreases the activity of one or more biomarkers in Table 1, such as decreasing the serine/threonine-protein kinase activity and/or the receptor-binding activity of one or more regulators of TNF signaling and/or NF- ⁇ activation (e.g., receptor- interacting serine/threonine-protein kinase 1 (RIPKl), BIRC2, TBKl, TRAF3, RNF31, RBCK1, OTULIN, TRAF6, TAB2, and TNIP1).
- one or more biomarkers in Table 1 such as decreasing the serine/threonine-protein kinase activity and/or the receptor-binding activity of one or more regulators of TNF signaling and/or NF- ⁇ activation (e.g., receptor- interacting serine/threonine-protein kinase 1 (RIPKl), BIRC2, TBKl, TRAF3, RNF31, RBCK1, OTULIN, TRAF6, TAB2, and TNIP
- the agent described herein is a small molecule inhibitor, CRISPR single-guide RNA (sgRNA), RNA interfering agent, antisense oligonucleotide, peptide or peptidomimetic inhibitor, aptamer, or intrabody.
- the RNA interfering agent is a small interfering RNA (siRNA), CRISPR RNA (crRNA), a small hairpin RNA (shRNA), a microRNA (miRNA), or a piwi-interacting RNA (piRNA).
- the RNA interfering agent is a CRISPR single-guide RNA (sgRNA).
- the sgRNA comprises a nucleic acid sequence selected from the group consisting of nucleic acid sequence listed in Table 2.
- the agent described herein comprises an intrabody, or an antigen binding fragment thereof, which specifically binds to the one or more biomarkers in Table 1 and/or a substrate of the one or more biomarkers in Table 1.
- the intrabody, or antigen binding fragment thereof is murine, chimeric, humanized, composite, or human.
- the intrabody, or antigen binding fragment thereof is detectably labeled, comprises an effector domain, comprises an Fc domain, and/or is selected from the group consisting of Fv, Fav, F(ab')2, Fab', dsFv, scFv, sc(Fv)2, and diabodies fragments.
- the intrabody, or antigen binding fragment thereof is conjugated to a cytotoxic agent.
- the cytotoxic agent is selected from the group consisting of a
- the agent described herein increases the sensitivity of the cancer cells to an immunotherapy.
- the immunotherapy and/or a cancer therapy is administered before, after, or concurrently with the agent.
- the immunotherapy comprises an anti-cancer vaccine and/or virus.
- the immunotherapy is cell-based.
- immunotherapy inhibits an immune checkpoint.
- the immune checkpoint is selected from the group consisting of CTLA-4, PD-1, VISTA, B7-H2, B7-H3, PD-L1, B7-H4, B7-H6, ICOS, HVEM, PD-L2, CD160, gp49B, PIR-B, KIR family receptors, TIM-1, TIM-3, TIM-4, LAG-3, GITR, 4-IBB, OX-40, BTLA, SIRP, CD47, CD48, 2B4 (CD244), B7.1, B7.2, ILT- 2, ILT-4, TIGIT, HHLA2, butyrophilins, IDO, CD39, CD73 and A2aR.
- the immune checkpoint is selected from the group consisting of PD-1, PD-Ll, and PD-L2. In yet another embodiment, the immune checkpoint is PD-1.
- the one or more biomarker described herein comprises a nucleic acid sequence having at least 95% identity to a nucleic acid sequence listed in Table 1 and/or encodes an amino acid sequence having at least 95% identity to an amino acid sequence listed in Table 1.
- the one or more biomarker is human, mouse, chimeric, or a fusion.
- the agent reduces the number of proliferating cells in the cancer and/or reduces the volume or size of a tumor comprising the cancer cells.
- the agent increases the sensitivity of the cancer to the immunotherapy.
- the one or more biomarkers comprise an amino acid sequence listed in Table 1, optionally wherein the amino acid sequence is selected from the group consisting of SEQ ID Nos: 2, 4, 6, 9, 11, 14, 16, 18, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 42, 44, 47, 49, 51, 54, 57, 60, 62, 64, 66, 68, 73, 76, 78, 80, 83, 86, and 88.
- the one or more biomarkers are encoded by a nucleic acid sequence listed in Table 1, optionally wherein the nucleic acid sequence is selected from the group consisting of SEQ ID Nos: 1, 3, 5, 7, 8, 10, 12, 13, 15, 17, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 41, 43, 45, 46, 48, 50, 52, 53, 55, 56, 58, 59, 61, 63, 65, 67, 69-72, 74, 75, 77, 79, 81, 82, 84, 85, and 87.
- the cancer is melanoma.
- the subject is an animal model of the cancer, preferably a mouse model, or a human.
- the method described herein further comprises administering to the subject at least one additional cancer therapy or regimen.
- the at least one additional cancer therapy or regimen is administered before, after, or concurrently with the agent and/or the immunotherapy.
- the agent described herein is administered in a pharmaceutically acceptable formulation.
- a method of killing cancer cells comprising contacting the cancer cells with an agent that inhibits the copy number, the expression level, and/or the activity of one or more biomarkers listed in Table 1 or a fragment thereof, in combination with an immunotherapy.
- the agent described herein decreases the copy number, the expression level, and/or the activity of one or more regulators of TNF signaling and/or F- ⁇ activation (e.g., RIPK1, BIRC2, TBK1, TRAF3, R F31, RBCK1, OTULIN, TRAF6, TAB2, and TNIP1).
- the agent selectively decreases activity of one or more biomarkers in Table 1, such as decreasing the phosphatase activity and/or the substrate binding activity of one or more kinase signaling inhibitors.
- the agent is a small molecule inhibitor, CRISPR single-guide RNA (sgRNA), RNA interfering agent, antisense oligonucleotide, peptide or
- the RNA interfering agent described herein is a small interfering RNA (siRNA), CRISPR RNA (crRNA), a small hairpin RNA (shRNA), a microRNA (miRNA), or a piwi-interacting RNA (piRNA).
- the RNA interfering agent is a CRISPR single-guide RNA
- the sgRNA comprises a nucleic acid sequence selected from the group consisting of nucleic acid sequence listed in Table 2.
- the agent described herein comprises an intrabody, or an antigen binding fragment thereof, which specifically binds to the one or more biomarkers in Table 1 and/or a substrate of the one or more biomarkers in Table 1.
- the intrabody, or antigen binding fragment thereof is murine, chimeric, humanized, composite, or human.
- the intrabody, or antigen binding fragment thereof is detectably labeled, comprises an effector domain, comprises an Fc domain, and/or is selected from the group consisting of Fv, Fav, F(ab')2, Fab', dsFv, scFv, sc(Fv)2, and diabodies fragments.
- the intrabody, or antigen binding fragment thereof is conjugated to a cytotoxic agent.
- the cytotoxic agent is selected from the group consisting of a chemotherapeutic agent, a biologic agent, a toxin, and a radioactive isotope.
- the agent described herein increases the sensitivity of the cancer cells to an immunotherapy.
- the cancer cells are contacted with an immunotherapy and/or a cancer therapy before, after, or concurrently with the agent.
- the immunotherapy comprises an anti-cancer vaccine and/or virus.
- the immunotherapy is cell-based.
- the immunotherapy inhibits an immune checkpoint.
- the immune checkpoint is selected from the group consisting of CTLA-4, PD- 1, VISTA, B7-H2, B7-H3, PD-L1, B7-H4, B7-H6, ICOS, HVEM, PD-L2, CD160, gp49B, PIR-B, KIR family receptors, TIM-1, TIM-3, TIM-4, LAG-3, GITR, 4-IBB, OX-40, BTLA, SIRP, CD47, CD48, 2B4 (CD244), B7.1, B7.2, ILT-2, ILT-4, TIGIT, HHLA2, butyrophilins, IDO, CD39, CD73 and A2aR.
- the immune checkpoint is selected from the group consisting of PD-1, PD-L1, and PD-L2. In one embodiment, the immune checkpoint is PD-1.
- the biomarker described herein comprises a nucleic acid sequence having at least 95% identity to a nucleic acid sequence listed in Table 1 and/or encodes an amino acid sequence having at least 95% identity to an amino acid sequence listed in Table 1.
- the one or more biomarker is human, mouse, chimeric, or a fusion.
- the agent described herein reduces the number of proliferating cells in the cancer and/or reduces the volume or size of a tumor comprising the cancer cells. In another embodiment, the agent increases the sensitivity of the cancer to the immunotherapy.
- the one or more biomarkers comprise an amino acid sequence listed in Table 1, optionally wherein the amino acid sequence is selected from the group consisting of SEQ ID Nos: 2, 4, 6, 9, 11, 14, 16, 18, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 42, 44, 47, 49, 51, 54, 57, 60, 62, 64, 66, 68, 73, 76, 78, 80, 83, 86, and 88.
- the one or more biomarkers are encoded by a nucleic acid sequence listed in Table 1, optionally wherein the nucleic acid sequence is selected from the group consisting of SEQ ID Nos: 1, 3, 5, 7, 8, 10, 12, 13, 15, 17, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 41, 43, 45, 46, 48, 50, 52, 53, 55, 56, 58, 59, 61, 63, 65, 67, 69-72, 74, 75, 77, 79, 81, 82, 84, 85, and 87.
- the cancer is melanoma.
- the subject is an animal model of the cancer, preferably a mouse model, or a human.
- the method described herein further comprises administering to the subject at least one additional cancer therapy or regimen.
- the at least one additional cancer therapy or regimen is administered before, after, or concurrently with the agent and/or the immunotherapy.
- the agent described herein is administered in a pharmaceutically acceptable formulation.
- a method of determining whether a subject afflicted with a cancer or at risk for developing a cancer would benefit from inhibiting the copy number, amount, and/or activity of at least one biomarker listed in Table 1 comprising a) obtaining a biological sample from the subject; b) determining the copy number, amount, and/or activity of at least one biomarker listed in Table 1; c) determining the copy number, amount, and/or activity of the at least one biomarker in a control; and d) comparing the copy number, amount, and/or activity of the at least one biomarker detected in steps b) and c); wherein the presence of, or a significant increase in, the copy number, amount, and/or activity of, the at least one biomarker listed in Table 1 in the subject sample relative to the control copy number, amount, and/or activity of the at least one biomarker indicates that the subject afflicted with the cancer or at risk for developing the cancer would benefit from inhibiting the copy number, amount
- the method described herein further comprises recommending, prescribing, or administering an agent that inhibits the at least one biomarker listed in Table 1 if the cancer is determined to benefit from the agent.
- the method described herein further comprises administering at least one additional cancer therapy that is administered before, after, or concurrently with the agent.
- the method described herein further comprises recommending, prescribing, or administering cancer therapy other than an agent that inhibits the at least one biomarker listed in Table 1 if the cancer is determined to not benefit from the agent.
- the cancer therapy is selected from the group consisting of immunotherapy, targeted therapy, chemotherapy, radiation therapy, hormonal therapy, an anti-cancer vaccine, an anti-cancer virus, and a checkpoint inhibitor.
- the control sample is determined from a cancerous or non-cancerous sample from either the patient or a member of the same species to which the patient belongs.
- the control sample comprises cells.
- a method for predicting the clinical outcome of a subject afflicted with a cancer expressing one or more biomarkers listed in Table 1 or a fragment thereof to treatment with an immunotherapy comprising a) determining the copy number, amount, and/or activity of at least one biomarker listed in Table 1 in a subject sample; b) determining the copy number, amount, and/or activity of the at least one biomarker in a control having a good clinical outcome; and c) comparing the copy number, amount, and/or activity of the at least one biomarker in the subject sample and in the control; wherein the presence of, or a significant increase in, the copy number, amount, and/or activity of, the at least one biomarker listed in Table 1 in the subject sample as compared to the copy number, amount and/or activity in the control, is an indication that the subject has a poor clinical outcome.
- a method for monitoring the progression of a cancer in a subject wherein the subject is administered a therapeutically effective amount of an agent that inhibits the copy number, amount, and/or activity of at least one biomarker listed in Table 1 and an immunotherapy is provided, the method comprising a) detecting in a subject sample at a first point in time the copy number, amount, and/or activity of at least one biomarker listed in Table 1; b) repeating step a) at a subsequent point in time; and c) comparing the amount or activity of at least one biomarker listed in Table 1 detected in steps a) and b) to monitor the progression of the cancer in the subject.
- a method of assessing the efficacy of an agent that inhibits the copy number, amount, and/or activity of at least one biomarker listed in Table 1 and an immunotherapy for treating a cancer in a subject comprising a) detecting in a subject sample at a first point in time the copy number, amount, and/or or activity of at least one biomarker listed in Table 1; b) repeating step a) during at least one subsequent point in time after administration of the agent and the immunotherapy; and c) comparing the copy number, amount, and/or activity detected in steps a) and b), wherein the absence of, or a significant decrease in, the copy number, amount, and/or activity of, the at least one biomarker listed in Table 1, in the subsequent sample as compared to the copy number, amount, and/or activity in the sample at the first point in time, indicates that the agent and immunotherapy treats the cancer in the subject.
- the subject has undergone treatment, completed treatment, and/or is in remission for the cancer.
- the cancer treatment is selected from the group consisting of immunotherapy, targeted therapy, chemotherapy, radiation therapy, hormonal therapy, an anti-cancer vaccine, an anti-cancer virus, and a checkpoint inhibitor.
- the first and/or at least one subsequent sample is selected from the group consisting of ex vivo and in vivo samples.
- the first and/or at least one subsequent sample is a portion of a single sample or pooled samples obtained from the subject.
- the sample described herein comprises cells, serum, peritumoral tissue, and/or intratumoral tissue obtained from the subject.
- the one or more biomarkers listed in Table 1 comprise RTPK1, BIRC2, TBK1, TRAF3, R F31, RBCK1, OTULIN, TRAF6, TAB2, and TNIP1.
- the cancer is melanoma.
- the cancer is in a subject and the subject is a mammal. In one embodiment, the mammal is a mouse or a human. In another embodiment, the mammal is a human.
- an agent that inhibits one or more biomarkers listed in Table 1, such as one or more regulators of TNF signaling and/or NF- ⁇ activation e.g., RIPKl, BIRC2, TBKl, TRAF3, RNF31, RBCKl, OTULIN, TRAF6, TAB2, and TNIP1
- Such agent may comprise a small molecule inhibitor, an RNA interfering agent, an antisense oligonucleotide, a peptide or peptidomimetic inhibitor, an aptamer, and/or an intrabody, as described herein.
- a vector comprising an agent that inhibits one or more biomarkers listed in Table 1, such as one or more regulators of TNF signaling and/or NF- KB activation (e.g., RIPKl, BIRC2, TBKl, TRAF3, RNF31, RBCKl, OTULIN, TRAF6, TAB2, and TNIP1), for treating a cancer in a subject, in combination with an agent that inhibits one or more biomarkers listed in Table 1, such as one or more regulators of TNF signaling and/or NF- KB activation (e.g., RIPKl, BIRC2, TBKl, TRAF3, RNF31, RBCKl, OTULIN, TRAF6, TAB2, and TNIP1), for treating a cancer in a subject, in combination with an agent that inhibits one or more biomarkers listed in Table 1, such as one or more regulators of TNF signaling and/or NF- KB activation (e.g., RIPKl, BIRC2,
- a host cell which comprises an agent that inhibits one or more biomarkers listed in Table 1, such as one or more regulators of TNF signaling and/or NF- KB activation (e.g., RIPKl, BIRC2, TBKl, TRAF3, RNF31, RBCKl, OTULIN, TRAF6, TAB2, and TNIP1), for treating a cancer in a subject, in combination with an agent that inhibits one or more biomarkers listed in Table 1, such as one or more regulators of TNF signaling and/or NF- KB activation (e.g., RIPKl, BIRC2, TBKl, TRAF3, RNF31, RBCKl, OTULIN, TRAF6, TAB2, and TNIP1), for treating a cancer in a subject, in combination with an agent that inhibits one or more biomarkers listed in Table 1, such as one or more regulators of TNF signaling and/or NF- KB activation (e.g., RIPKl, BIRC2,
- a host cell which comprises a vector comprising an agent that inhibits one or more biomarkers listed in Table 1, such as one or more regulators of TNF signaling and/or NF- ⁇ activation (e.g., RIPKl, BIRC2, TBKl, TRAF3, RNF31, RBCKl, OTULIN, TRAF6, TAB2, and TNIP1), for treating a cancer in a subject, in combination with an immunotherapy, is provided.
- an agent that inhibits one or more biomarkers listed in Table 1 such as one or more regulators of TNF signaling and/or NF- ⁇ activation (e.g., RIPKl, BIRC2, TBKl, TRAF3, RNF31, RBCKl, OTULIN, TRAF6, TAB2, and TNIP1)
- a device or kit comprising the agent that inhibits one or more biomarkers listed in Table 1, such as one or more regulators of TNF signaling and/or NF- KB activation (e.g., RIPKl, BIRC2, TBKl, TRAF3, RNF31, RBCKl, OTULIN, TRAF6, TAB2, and TNIP1), for treating a cancer in a subject, in combination with an
- one or more regulators of TNF signaling and/or NF- KB activation e.g., RIPKl, BIRC2, TBKl, TRAF3, RNF31, RBCKl, OTULIN, TRAF6, TAB2, and TNIP1
- Figure 1 includes 6 panels, identified as panels A, B, C, D, E, and F, which show that in vivo pooled loss-of-function screening using CRISPR/Cas9 in tumor cells recovers known mediators of immune evasion.
- Panel A shows a schematic diagram of the in vivo screening system using the B 16 transplantable tumor model. Tumor volumes (in mm 3 ) were compared under each conditions, averaged for each group at each time point (Panel B, left) or for individual animals on the day of sacrifice (Panel B, right). Bars represent means, while whiskers represent standard deviation.
- Enrichment analysis was carried out using a hypergeometric test to show functional classes of genes, (from the Gene Ontology Consortium database (GO)) targeted by sgRNAs, that were enriched or depleted in tumors in animals, including animals treated with irradiated tumor cell vaccine (GVAX) and anti- PD-1 antibody and the TCRa " " " animals (Panel C).
- GVAX irradiated tumor cell vaccine
- Panel C tumor cell vaccine
- Frequency histogram Panel D, top
- collapsed histograms Panel D, middle
- Enrichment/depletion scores are averaged from 10 mice per condition.
- sgRNAs targeting PD-L1 are indicated by the red lines (Panel D, middle). PD-L1 expression is compared among Cas9-expressing B16 tumor cells transfected with one of the four sgRNAs targeting PD-L1 (red) or a control sgRNA (grey) (Panel D, bottom). Similar to Panel D, Panel E shows the depletion of CD47 by its specific sgRNAs (indicated in red (top and middle) and CD47 expression after CRISPR editing with sgRNAs targeting CD47 (bottom).
- Figure 2 includes 6 panels, identified as panels A, B, C, D, E, and F, which show the performance analysis of the screening in Figure 1.
- Panel A shows Western blot of B 16 cell lysate for Cas9 and ⁇ -ACTIN with or without transduction with a lentiviral vector encoding Cas9.
- a pie chart shows the fraction of genes targeted in the screening in each of the GO term categories indicated (Panel B).
- Two-dimensional histograms show the pair- wise distribution of sgRNAs abundance (averaged for each condition) (Panel C).
- Figure 3 includes 3 panels, identified as panels A, B, and C, which show that loss of TNF signaling and/or NF- ⁇ activation regulators (e.g., Ripkl) causes resistance to immunotherapy.
- Panel A shows frequency histogram (top) and collapsed histograms (below) of enrichment or depletion (normalized as z scores) for all sgRNAs in GVAX+ PD- 1 blockade-treated mice relative to TCRa _/" mice, as in Figure 1. Red bars indicate the sgRNAs for the genes listed on the left.
- Representative flow plots show the frequencies of control or Ripkl null B16 cells for the conditions indicated (Panel B).
- negative regulators of one or more biomarkers listed in Table 1, such as one or more regulators of TNF signaling and/or NF- ⁇ activation ⁇ e.g., RIPK1, BIRC2, TBK1, TRAF3, RNF31, RBCK1, OTULIN, TRAF6, TAB2, and TNIPl) can be used to increase interferon sensing by tumor cells and augment tumor immunity and immunotherapies.
- the instant disclosure provides at least a method of treating cancers, e.g., those cancer types otherwise not responsive or weakly responsive to immunotherapies, with a combination of a negative regulator of one or more biomarkers listed in Table 1, such as one or more regulators of TNF signaling and/or NF- ⁇ activation (e.g., RIPK1, BIRC2, TBK1, TRAF3, RNF31, RBCK1, OTULIN, TRAF6, TAB2, and TNIPl), in combination with another immunotherapy.
- a negative regulator of one or more biomarkers listed in Table 1, such as one or more regulators of TNF signaling and/or NF- ⁇ activation (e.g., RIPK1, BIRC2, TBK1, TRAF3, RNF31, RBCK1, OTULIN, TRAF6, TAB2, and TNIPl) in combination with another immunotherapy.
- the present invention provides exemplary RNA interfering agents inhibiting one or more biomarkers listed in Table 1, such as one or more regulators of TNF signaling and/or NF- ⁇ activation (e.g., RIPK1, BIRC2, TBK1, TRAF3, RNF31, RBCK1, OTULIN, TRAF6, TAB2, and TNIPl), which may be used in the combination therapy and other methods described herein, such as agents that inhibit biomarker function and/or its ability to interact/bind to its substrates described herein, or by increasing its degradation and/or stability and/or interaction/binding to its inhibitors.
- one or more regulators of TNF signaling and/or NF- ⁇ activation e.g., RIPK1, BIRC2, TBK1, TRAF3, RNF31, RBCK1, OTULIN, TRAF6, TAB2, and TNIPl
- an element means one element or more than one element.
- altered amount refers to increased or decreased copy number (e.g., germline and/or somatic) of a biomarker nucleic acid, e.g., increased or decreased expression level in a cancer sample, as compared to the expression level or copy number of the biomarker nucleic acid in a control sample.
- altered amount of a biomarker also includes an increased or decreased protein level of a biomarker protein in a sample, e.g., a cancer sample, as compared to the corresponding protein level in a normal, control sample.
- an altered amount of a biomarker protein may be determined by detecting posttranslational modification such as methylation status of the marker, which may affect the expression or activity of the biomarker protein.
- the amount of a biomarker in a subject is "significantly" higher or lower than the normal amount of the biomarker, if the amount of the biomarker is greater or less, respectively, than the normal level by an amount greater than the standard error of the assay employed to assess amount, and preferably at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or than that amount.
- the amount of the biomarker in the subject can be considered “significantly” higher or lower than the normal amount if the amount is at least about two, and preferably at least about three, four, or five times, higher or lower, respectively, than the normal amount of the biomarker.
- Such "significance” can also be applied to any other measured parameter described herein, such as for expression, inhibition, cytotoxicity, cell growth, and the like.
- altered level of expression of a biomarker refers to an expression level or copy number of the biomarker in a test sample, e.g., a sample derived from a patient suffering from cancer, that is greater or less than the standard error of the assay employed to assess expression or copy number, and is preferably at least twice, and more preferably three, four, five or ten or more times the expression level or copy number of the biomarker in a control sample (e.g., sample from a healthy subjects not having the associated disease) and preferably, the average expression level or copy number of the biomarker in several control samples.
- a test sample e.g., a sample derived from a patient suffering from cancer
- a control sample e.g., sample from a healthy subjects not having the associated disease
- the altered level of expression is greater or less than the standard error of the assay employed to assess expression or copy number, and is preferably at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more times the expression level or copy number of the biomarker in a control sample (e.g., sample from a healthy subjects not having the associated disease) and preferably, the average expression level or copy number of the biomarker in several control samples.
- a control sample e.g., sample from a healthy subjects not having the associated disease
- the level of the biomarker refers to the level of the biomarker itself, the level of a modified biomarker (e.g., phosphorylated biomarker), or to the level of a biomarker relative to another measured variable, such as a control (e.g., phosphorylated biomarker relative to an unphosphorylated biomarker).
- a modified biomarker e.g., phosphorylated biomarker
- a control e.g., phosphorylated biomarker relative to an unphosphorylated biomarker
- altered activity of a biomarker refers to an activity of the biomarker which is increased or decreased in a disease state, e.g., in a cancer sample, as compared to the activity of the biomarker in a normal, control sample.
- Altered activity of the biomarker may be the result of, for example, altered expression of the biomarker, altered protein level of the biomarker, altered structure of the biomarker, or, e.g., an altered interaction with other proteins involved in the same or different pathway as the biomarker or altered interaction with transcriptional activators or inhibitors.
- altered structure of a biomarker refers to the presence of mutations or allelic variants within a biomarker nucleic acid or protein, e.g., mutations which affect expression or activity of the biomarker nucleic acid or protein, as compared to the normal or wild-type gene or protein.
- mutations include, but are not limited to substitutions, deletions, or addition mutations. Mutations may be present in the coding or non-coding region of the biomarker nucleic acid.
- antibody refers to antigen-binding portions adaptable to be expressed within cells as "intracellular antibodies.”
- intracellular antibodies include single-chain antibodies (scFvs), modification of immunoglobulin VL domains for hyperstability, modification of antibodies to resist the reducing intracellular environment, generating fusion proteins that increase intracellular stability and/or modulate intracellular localization, and the like.
- Intracellular antibodies can also be introduced and expressed in one or more cells, tissues or organs of a multicellular organism, for example for
- prophylactic and/or therapeutic purposes e.g., as a gene therapy
- prophylactic and/or therapeutic purposes e.g., as a gene therapy
- PCT Pubis. WO 08/020079, WO 94/02610, WO 95/22618, and WO 03/014960; U.S. Pat. No.
- Antibodies may be polyclonal or monoclonal; xenogeneic, allogeneic, or syngeneic; or modified forms thereof (e.g. humanized, chimeric, etc.). Antibodies may also be fully human. Preferably, antibodies of the present invention bind specifically or substantially specifically to a biomarker polypeptide or fragment thereof.
- monoclonal antibodies and “monoclonal antibody composition”, as used herein, refer to a population of antibody polypeptides that contain only one species of an antigen binding site capable of immunoreacting with a particular epitope of an antigen
- polyclonal antibodies and “polyclonal antibody composition” refer to a population of antibody polypeptides that contain multiple species of antigen binding sites capable of interacting with a particular antigen.
- a monoclonal antibody composition typically displays a single binding affinity for a particular antigen with which it immunoreacts.
- Antibodies may also be "humanized", which is intended to include antibodies made by a non-human cell having variable and constant regions which have been altered to more closely resemble antibodies that would be made by a human cell. For example, by altering the non-human antibody amino acid sequence to incorporate amino acids found in human germline immunoglobulin sequences.
- the humanized antibodies of the present invention may include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo), for example in the CDRs.
- humanized antibody also includes antibodies in which CDR sequences derived from the germline of another mammalian species, such as a mouse, have been grafted onto human framework sequences.
- assigned score refers to the numerical value designated for each of the biomarkers after being measured in a patient sample. The assigned score correlates to the absence, presence or inferred amount of the biomarker in the sample. The assigned score can be generated manually (e.g., by visual inspection) or with the aid of instrumentation for image acquisition and analysis. In certain embodiments, the assigned score is determined by a qualitative assessment, for example, detection of a fluorescent readout on a graded scale, or quantitative assessment.
- the aggregate score is a summation of assigned scores.
- combination of assigned scores involves performing mathematical operations on the assigned scores before combining them into an aggregate score.
- the aggregate score is also referred to herein as the "predictive score.”
- biomarker refers to a measurable entity of the present invention that has been determined to be predictive of combinatorial therapy effects on a cancer using one or more inhibitors of TNF signaling and/or F- ⁇ activation (e.g., RIPK1, BIRC2, TBK1, TRAF3, RNF31, RBCK1, OTULIN, TRAF6, TAB2, and TNIP1), in combination with an immunotherapy (e.g., immune checkpoint inhibitors).
- Biomarkers can include, without limitation, nucleic acids and proteins, including those shown in the Tables, the Examples, the Figures, and otherwise described herein. As described herein, any relevant
- characteristic of a biomarker can be used, such as the copy number, amount, activity, location, modification (e.g., phosphorylation), and the like.
- blocking antibody or an antibody “antagonist” is one which inhibits or reduces at least one biological activity of the antigen(s) it binds.
- the blocking antibodies or antagonist antibodies or fragments thereof described herein substantially or completely inhibit a given biological activity of the antigen(s).
- body fluid refers to fluids that are excreted or secreted from the body as well as fluids that are normally not (e.g. amniotic fluid, aqueous humor, bile, blood and blood plasma, cerebrospinal fluid, cerumen and earwax, cowper's fluid or pre-ejaculatory fluid, chyle, chyme, stool, female ejaculate, interstitial fluid, intracellular fluid, lymph, menses, breast milk, mucus, pleural fluid, pus, saliva, sebum, semen, serum, sweat, synovial fluid, tears, urine, vaginal lubrication, vitreous humor, vomit).
- fluids that are excreted or secreted from the body as well as fluids that are normally not (e.g. amniotic fluid, aqueous humor, bile, blood and blood plasma, cerebrospinal fluid, cerumen and earwax, cowper's fluid or pre-ejaculatory fluid, chyle,
- cancer or “tumor” or “hyperproliferative” refer to the presence of cells possessing characteristics typical of cancer-causing cells, such as uncontrolled proliferation, immortality, metastatic potential, rapid growth and proliferation rate, and certain characteristic morphological features. Unless otherwise stated, the terms include metaplasias.
- such cells exhibit such characteristics in part or in full due to the expression and activity of the signaling pathways regulated by one or more biomarkers listed in Table 1, such as one or more regulators of TNF signaling and/or NF- KB activation (e.g., RIPK1, BIRC2, TBK1, TRAF3, RNF31, RBCK1, OTULIN, TRAF6, TAB2, and TNIP1) (e.g., F-kappaB Signaling pathway, MAP kinase pathway, JAK- STAT signaling pathway, or other signaling pathways involving receptor tyrosine kinases, non-receptor tyrosine kinases, Src family kinases, and/or signal transducer and activator of transcription (STAT) proteins).
- TNF signaling and/or NF- KB activation e.g., RIPK1, BIRC2, TBK1, TRAF3, RNF31, RBCK1, OTULIN, TRAF6, TAB2, and TNIP1
- the cancer cells described herein are not sensitive to at least one of immunotherapies.
- Such insensitivity may be related to the inactivation or decreased activation, compared to control cells (e.g., normal and/or wild-type non-cancer cells, and/or cancer cells without this insensitivity to immunotherapies), of interferon signaling (e.g., IFNy signaling) in such cancer cells and/or other surrounding cells and/or cells localized near to such cancer cells.
- control cells e.g., normal and/or wild-type non-cancer cells, and/or cancer cells without this insensitivity to immunotherapies
- interferon signaling e.g., IFNy signaling
- the cancer cells are treatable with an agent capable of antagonizing one or more biomarkers listed in Table 1, such as one or more regulators of TNF signaling and/or NF- ⁇ activation (e.g., RIPK1, BIRC2, TBK1, TRAF3, RNF31, RBCK1 , OTULIN, TRAF6, TAB2, and TNIP1).
- an agent capable of antagonizing one or more biomarkers listed in Table 1 such as one or more regulators of TNF signaling and/or NF- ⁇ activation (e.g., RIPK1, BIRC2, TBK1, TRAF3, RNF31, RBCK1 , OTULIN, TRAF6, TAB2, and TNIP1).
- the treatment with the agent antagonizing one or more biomarkers listed in Table 1 as described herein would increase IFNy signaling in such cancer cells, compared to pre-treatment situations, or would restore IFNy signaling in such cancer cells to at least comparable to the levels in control cells, so that such cancer cells would
- interferon signaling refers to any cell signaling downstream and/or related to the interaction of interferon (e.g., IFNy) and their receptor(s).
- IFNy cell signaling include, without limitation, the activation of macrophages and/or induction of Class II major histocompatibility complex (MHC) molecule expression, and/or activation of multiple immune effector genes through the Janus kinase (JAK)-STAT signaling pathway (e.g., through STAT1 transcription factor).
- MHC major histocompatibility complex
- Cancer cells are often in the form of a tumor, but such cells may exist alone within an animal, or may be a non-tumorigenic cancer cell, such as a leukemia cell.
- cancer includes premalignant as well as malignant cancers.
- Cancers include, but are not limited to, B cell cancer, e.g., multiple myeloma, Waldenstrom's macroglobulinemia, the heavy chain diseases, such as, for example, alpha chain disease, gamma chain disease, and mu chain disease, benign monoclonal gammopathy, and immunocytic amyloidosis, melanomas, breast cancer, lung cancer, bronchus cancer, colorectal cancer, prostate cancer, pancreatic cancer, stomach cancer, ovarian cancer, urinary bladder cancer, brain or central nervous system cancer, peripheral nervous system cancer, esophageal cancer, cervical cancer, uterine or endometrial cancer, cancer of the oral cavity or pharynx, liver cancer, kidney cancer, testicular cancer, biliary tract cancer, small bowel or appendix cancer, salivary gland cancer, thyroid gland cancer, adrenal gland cancer, osteosarcoma, chondrosarcoma, cancer of hematologic tissues, and the like.
- myxosarcoma liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma,
- angiosarcoma endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, colorectal cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, liver cancer, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, cervical cancer, bone cancer, brain tumor, testicular cancer, lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma,
- leukemias e.g., acute lymphocytic leukemia and acute myelocytic leukemia (myeloblastic, promyelocytic, myelomonocytic, monocytic and erythroleukemia); chronic leukemia (chronic myelocytic (granulocytic) leukemia and chronic lymphocytic leukemia); and polycythemia vera, lymphoma (Hodgkin's disease and non-Hodgkin's disease), multiple myeloma, Waldenstrom's macroglobulinemia, and heavy chain disease.
- leukemias e.g., acute lymphocytic leukemia and acute myelocytic leukemia (myeloblastic, promyelocytic, myelomonocytic, monocytic and erythroleukemia); chronic leukemia (chronic myelocytic (granulocytic) leukemia and chronic lymphocytic leukemia);
- cancers are epithlelial in nature and include but are not limited to, bladder cancer, breast cancer, cervical cancer, colon cancer, gynecologic cancers, renal cancer, laryngeal cancer, lung cancer, oral cancer, head and neck cancer, ovarian cancer, pancreatic cancer, prostate cancer, or skin cancer.
- the cancer is breast cancer, prostate cancer, lung cancer, or colon cancer.
- the epithelial cancer is non-small-cell lung cancer, nonpapillary renal cell carcinoma, cervical carcinoma, ovarian carcinoma (e.g., serous ovarian carcinoma), or breast carcinoma.
- the epithelial cancers may be characterized in various other ways including, but not limited to, serous, endometrioid, mucinous, clear cell, Brenner, or undifferentiated.
- the cancer encompasses colorectal cancer (e.g., colorectal carcinoma).
- colonal cancer as used herein, is meant to include cancer of cells of the intestinal tract below the small intestine (e.g., the large intestine (colon), including the cecum, ascending colon, transverse colon, descending colon, and sigmoid colon, and rectum). Additionally, as used herein, the term “colorectal cancer” is meant to further include cancer of cells of the duodenum and small intestine (jejunum and ileum).
- Colorectal cancer also includes neoplastic diseases involving proliferation of a single clone of cells of the colon and includes adenocarcinoma and carcinoma of the colon whether in a primary site or metastasized.
- CRC Colorectal cancer
- CRC can present with two distinct genomic profiles that have been termed (i) chromosomal instability neoplasia (CIN), characterized by rampant structural and numerical chromosomal aberrations driven in part by telomere dysfunction (Artandi et al. (2000) Nature 406:641-645; Fodde et al. (2001) Nat. Rev. Cancer 1 :55-67; Maser and DePinho (2002) Science 297:565-569; Rudolph et al. (2001) Nat. Genet. 28: 155-159) and mitotic aberrations (Lengauer et al.
- CIN chromosomal instability neoplasia
- microsatellite instability neoplasia characterized by near diploid karyotypes with alterations at the nucleotide level due to mutations in mismatch repair (MMR) genes
- MMR mismatch repair
- Germline MMR mutations are highly penetrant lesions which drive the MIN phenotype in hereditary nonpolyposis colorectal cancers, accounting for 1-5% of CRC cases (de la Chapelle (2004) Nat. Rev. Cancer 4:769-780; Lynch and de la Chapelle (1999) J. Med. Genet. 36:801-818; Umar et a/. (2004) Nat. Rev. Cancer 4: 153-158). While CIN and MIN are mechanistically distinct, their genomic and genetic consequences emphasize the requirement of dominant mutator mechanisms to drive intestinal epithelial cells towards a threshold of oncogenic changes needed for malignant transformation.
- K-Ras mutations occur early in neoplastic progression and are present in approximately 50% of large adenomas (Fearon and Gruber (2001) Molecular abnormalities in colon and rectal cancer, ed. J. Mendelsohm, P.H., M. Israel, and L. Liotta, W.B. Saunders, Philadelphia).
- the BRAF serine/threonine kinase and PIK3CA lipid kinase are mutated in 5-18% and 28%> of sporadic CRCs, respectively (Samuels et al. (2004) Science 304:554; Davies et al. (2002) Nature 417:949- 954; Rajagopalan et al.
- the colorectal cancer is microsatellite instable (MSI) colorectal cancer (Llosa et al. (2014) Cancer Disc. CD-14-0863; published online Oct. 30, 2014).
- MSI represents about 15% of sporadic CRC and about 5-6% of stage IV CRCs.
- MSI is caused by epigenetic silencing or mutation of DNA mismatch repair genes and typically presents with lower stage disease than microsatellite stable subset (MSS) CRC.
- MSI highly express immune checkpoints, such as PD-1, PD-L1, CTLA-4, LAG-3, and IDO.
- the colorectal cancer is MSS CRC.
- the cancer encompasses melanoma.
- melanoma as used herein, is generally meant to include cancers that develop from the pigment- containing cells, known as melanocytes, in the basal layer of the epidermis. Melanomas typically occur in the skin but may rarely occur in the mouth, intestines, or eye. In women they most commonly occur on the legs, while in men they are most common on the back. Sometimes they develop from a mole with concerning changes including an increase in size, irregular edges, change in color, itchiness, or skin breakdown. Thus, the term
- cancer also includes cancers developing from these cells, tissues, and organs.
- Melanomas are among the most dangerous forms of skin cancer and develop when unrepaired DNA damage to skin cells (most often caused by ultraviolet radiation from sunshine or tanning beds) triggers gene mutations that lead the skin cells to multiply rapidly and form malignant tumors.
- the primary cause of melanoma is ultraviolet light (UV) exposure in those with low levels of skin pigment.
- UV ultraviolet light
- Melanomas often resemble moles; some develop from moles. Those with many moles, a history of affected family members, and who have poor immune function are at greater risk.
- a number of rare genetic defects such as xeroderma pigmentosum also increase risk (Azoury and Lange, 2014 Surg Clin North Am. 2014 94:945-962).
- Melanoma can be divided into different types, including, at least, lentigo maligna, lentigo maligna melanoma, superficial spreading melanoma, acral lentiginous melanoma, mucosal melanoma, nodular melanoma, polypoid melanoma, desmoplastic melanoma, amelanotic melanoma, soft-tissue melanoma, melanoma with small nevus-like cells, melanoma with features of a Spitz nevus, uveal melanoma, etc. (see James, et al., 2006 Andrews' Diseases of the Skin: clinical Dermatology. Saunders Elsevier, pp. 694-9)
- Diagnosis is by biopsy of any concerning skin lesion, including, at least, shave (tangential) biopsy, punch biopsy, incisional and excisional biopsies, "optical” biopsies (e.g., by reflectance confocal microscopy (RCM)), fine needle aspiration (FNA) biopsy, surgical lymph node biopsy, sentinel lymph node biopsy, etc.
- shave tangential
- punch biopsy punch biopsy
- incisional and excisional biopsies e.g., incisional and excisional biopsies
- optical biopsies e.g., by reflectance confocal microscopy (RCM)
- FNA fine needle aspiration
- visual inspection may also be used for diagnosis, such as a popular method for the signs and symptoms of melanoma as mnemonic "ABCDE": Asymmetrical skin lesion, Border of the lesion is irregular, Color: melanomas usually have multiple colors, Diameter: moles greater than 6 mm are more likely to be melanomas than smaller moles, and Enlarging: Enlarging or evolving. Another method as the "ugly duckling sign" is also known in the art (Mascaro and Mascaro, 1998 Arch Dermatol. 134: 1484-1485).
- Treatment of melanoma includes surgery, chemotherapy (such as temozolomide, dacarbazine (also termed DTIC), etc.), radiation therapy, oncolytic virotherapy (e.g., see Forbes et al., 2013 Front. Genet. 4: 184), and immunotherapy (e.g., interleukin-2 (IL-2), interferon, etc.).
- Targeted therapies ⁇ e.g., as in Maverakis et al., 2015 Acta Derm Venereol. 95: 516-524) may include: 1) adoptive cell therapy (ACT) using TILs immune cells (tumor infiltrating lymphocytes) isolated from a person's own melanoma tumor). Cells are grown in large numbers in a laboratory and returned to the patient after a treatment that temporarily reduces normal T cells in the patient's body. TIL therapy following
- lymphodepletion can result in durable complete response in a variety of setups (Besser et al., 2010 Clin. Cancer Res. 16:2646-2655); and 2) adoptive transfer of genetically altered (expressing T cell receptors (TCRs)) autologous lymphocytes into patient's lymphocytes, where the altered lymphocytes recognize and bind to the surface of melanoma cells and kill them.
- Other therapies include, at least, B-Raf inhibitors (such as vemurafenib, see
- coding region refers to regions of a nucleotide sequence comprising codons which are translated into amino acid residues
- noncoding region refers to regions of a nucleotide sequence that are not translated into amino acids ⁇ e.g., 5' and 3' untranslated regions
- an adenine residue of a first nucleic acid region is capable of forming specific hydrogen bonds ("base pairing") with a residue of a second nucleic acid region which is antiparallel to the first region if the residue is thymine or uracil.
- base pairing specific hydrogen bonds
- a cytosine residue of a first nucleic acid strand is capable of base pairing with a residue of a second nucleic acid strand which is antiparallel to the first strand if the residue is guanine.
- a first region of a nucleic acid is complementary to a second region of the same or a different nucleic acid if, when the two regions are arranged in an antiparallel fashion, at least one nucleotide residue of the first region is capable of base pairing with a residue of the second region.
- the first region comprises a first portion and the second region comprises a second portion, whereby, when the first and second portions are arranged in an antiparallel fashion, at least about 50%, and preferably at least about 75%, at least about 90%, or at least about 95% of the nucleotide residues of the first portion are capable of base pairing with nucleotide residues in the second portion. More preferably, all nucleotide residues of the first portion are capable of base pairing with nucleotide residues in the second portion.
- control refers to any reference standard suitable to provide a comparison to the expression products in the test sample.
- the control comprises obtaining a "control sample” from which expression product levels are detected and compared to the expression product levels from the test sample.
- a control sample may comprise any suitable sample, including but not limited to a sample from a control cancer patient (can be stored sample or previous sample measurement) with a known outcome; normal tissue or cells isolated from a subject, such as a normal patient or the cancer patient, cultured primary cells/tissues isolated from a subject such as a normal subject or the cancer patient, adjacent normal cells/tissues obtained from the same organ or body location of the cancer patient, a tissue or cell sample isolated from a normal subject, or a primary cells/tissues obtained from a depository.
- control may comprise a reference standard expression product level from any suitable source, including but not limited to housekeeping genes, an expression product level range from normal tissue (or other previously analyzed control sample), a previously determined expression product level range within a test sample from a group of patients, or a set of patients with a certain outcome (for example, survival for one, two, three, four years, etc.) or receiving a certain treatment (for example, standard of care cancer therapy).
- a certain outcome for example, survival for one, two, three, four years, etc.
- a certain treatment for example, standard of care cancer therapy
- control samples and reference standard expression product levels can be used in combination as controls in the methods of the present invention.
- control may comprise normal or non-cancerous cell/tissue sample.
- control may comprise an expression level for a set of patients, such as a set of cancer patients, or for a set of cancer patients receiving a certain treatment, or for a set of patients with one outcome versus another outcome.
- the specific expression product level of each patient can be assigned to a percentile level of expression, or expressed as either higher or lower than the mean or average of the reference standard expression level.
- control may comprise normal cells, cells from patients treated with combination chemotherapy, and cells from patients having benign cancer.
- control may also comprise a measured value for example, average level of expression of a particular gene in a population compared to the level of expression of a housekeeping gene in the same population.
- control comprises a ratio transformation of expression product levels, including but not limited to determining a ratio of expression product levels of two genes in the test sample and comparing it to any suitable ratio of the same two genes in a reference standard;
- control comprises a control sample which is of the same lineage and/or type as the test sample.
- control may comprise expression product levels grouped as percentiles within or based on a set of patient samples, such as all patients with cancer.
- a control expression product level is established wherein higher or lower levels of expression product relative to, for instance, a particular percentile, are used as the basis for predicting outcome.
- a control expression product level is established using expression product levels from cancer control patients with a known outcome, and the expression product levels from the test sample are compared to the control expression product level as the basis for predicting outcome.
- the methods of the present invention are not limited to use of a specific cut-point in comparing the level of expression product in the test sample to the control.
- the "copy number" of a biomarker nucleic acid refers to the number of DNA sequences in a cell (e.g., germline and/or somatic) encoding a particular gene product. Generally, for a given gene, a mammal has two copies of each gene. The copy number can be increased, however, by gene amplification or duplication, or reduced by deletion. For example, germline copy number changes include changes at one or more genomic loci, wherein said one or more genomic loci are not accounted for by the number of copies in the normal complement of germline copies in a control (e.g., the normal copy number in germline DNA for the same species as that from which the specific germline DNA and corresponding copy number were determined).
- Somatic copy number changes include changes at one or more genomic loci, wherein said one or more genomic loci are not accounted for by the number of copies in germline DNA of a control (e.g., copy number in germline DNA for the same subject as that from which the somatic DNA and corresponding copy number were determined).
- the "normal" copy number (e.g., germline and/or somatic) of a biomarker nucleic acid or "normal” level of expression of a biomarker nucleic acid or protein is the activity /level of expression or copy number in a biological sample, e.g., a sample containing tissue, whole blood, serum, plasma, buccal scrape, saliva, cerebrospinal fluid, urine, stool, and bone marrow, from a subject, e.g., a human, not afflicted with cancer, or from a corresponding non-cancerous tissue in the same subject who has cancer.
- a biological sample e.g., a sample containing tissue, whole blood, serum, plasma, buccal scrape, saliva, cerebrospinal fluid, urine, stool, and bone marrow
- costimulate with reference to activated immune cells includes the ability of a costimulatory molecule to provide a second, non-activating receptor mediated signal (a "costimulatory signal") that induces proliferation or effector function.
- a costimulatory signal can result in cytokine secretion, e.g., in a T cell that has received a T cell-receptor-mediated signal.
- Immune cells that have received a cell-receptor mediated signal, e.g., via an activating receptor are referred to herein as "activated immune cells.”
- determining a suitable treatment regimen for the subject is taken to mean the determination of a treatment regimen (i.e., a single therapy or a combination of different therapies that are used for the prevention and/or treatment of the cancer in the subject) for a subject that is started, modified and/or ended based or essentially based or at least partially based on the results of the analysis according to the present invention.
- a treatment regimen i.e., a single therapy or a combination of different therapies that are used for the prevention and/or treatment of the cancer in the subject
- a subject that is started, modified and/or ended based or essentially based or at least partially based on the results of the analysis according to the present invention.
- a treatment regimen i.e., a single therapy or a combination of different therapies that are used for the prevention and/or treatment of the cancer in the subject
- the determination can, in addition to the results of the analysis according to the present invention, be based on personal characteristics of the subject to be treated. In most cases, the actual determination of the suitable treatment
- diagnosing cancer includes the use of the methods, systems, and code of the present invention to determine the presence or absence of a cancer or subtype thereof in an individual.
- the term also includes methods, systems, and code for assessing the level of disease activity in an individual.
- a molecule is "fixed” or "affixed” to a substrate if it is covalently or non-covalently associated with the substrate such that the substrate can be rinsed with a fluid (e.g. standard saline citrate, pH 7.4) without a substantial fraction of the molecule dissociating from the substrate.
- a fluid e.g. standard saline citrate, pH 7.4
- expression signature refers to a group of one or more coordinately expressed biomarkers related to a measured phenotype.
- the genes, proteins, metabolites, and the like making up this signature may be expressed in a specific cell lineage, stage of differentiation, or during a particular biological response.
- the biomarkers can reflect biological aspects of the tumors in which they are expressed, such as the cell of origin of the cancer, the nature of the non-malignant cells in the biopsy, and the oncogenic mechanisms responsible for the cancer.
- Expression data and gene expression levels can be stored on computer readable media, e.g., the computer readable medium used in conjunction with a microarray or chip reading device. Such expression data can be manipulated to generate expression signatures.
- “Homologous” as used herein refers to nucleotide sequence similarity between two regions of the same nucleic acid strand or between regions of two different nucleic acid strands. When a nucleotide residue position in both regions is occupied by the same nucleotide residue, then the regions are homologous at that position. A first region is homologous to a second region if at least one nucleotide residue position of each region is occupied by the same residue. Homology between two regions is expressed in terms of the proportion of nucleotide residue positions of the two regions that are occupied by the same nucleotide residue.
- a region having the nucleotide sequence 5'- ATTGCC-3' and a region having the nucleotide sequence 5'-TATGGC-3' share 50% homology.
- the first region comprises a first portion and the second region comprises a second portion, whereby, at least about 50%, and preferably at least about 75%, at least about 90%, or at least about 95% of the nucleotide residue positions of each of the portions are occupied by the same nucleotide residue. More preferably, all nucleotide residue positions of each of the portions are occupied by the same nucleotide residue.
- Immune cell refers to cells that play a role in the immune response.
- Immune cells are of hematopoietic origin, and include lymphocytes, such as B cells and T cells; natural killer cells; myeloid cells, such as monocytes, macrophages, eosinophils, mast cells, basophils, and granulocytes.
- immunotherapy refers to any treatment that uses certain parts of a subject's immune system to fight diseases such as cancer.
- the subject's own immune system is stimulated (or suppressed), with or without administration of one or more agent for that purpose.
- Immunotherapies that are designed to elicit or amplify an immune response are referred to as “activation immunotherapies.”
- Immunotherapies that are designed to reduce or suppress an immune response are referred to as “suppression immunotherapies.” Any agent believed to have an immune system effect on the genetically modified transplanted cancer cells can be assayed to determine whether the agent is an immunotherapy and the effect that a given genetic modification has on the modulation of immune response.
- the immunotherapy is cancer cell-specific.
- immunotherapy can be "untargeted,” which refers to administration of agents that do not selectively interact with immune system cells, yet modulates immune system function.
- untargeted therapies include, without limitation, chemotherapy, gene therapy, and radiation therapy.
- Immunotherapy is one form of targeted therapy that may comprise, for example, the use of cancer vaccines and/or sensitized antigen presenting cells.
- an oncolytic virus is a virus that is able to infect and lyse cancer cells, while leaving normal cells unharmed, making them potentially useful in cancer therapy. Replication of oncolytic viruses both facilitates tumor cell destruction and also produces dose amplification at the tumor site. They may also act as vectors for anticancer genes, allowing them to be specifically delivered to the tumor site.
- the immunotherapy can involve passive immunity for short-term protection of a host, achieved by the administration of pre-formed antibody directed against a cancer antigen or disease antigen (e.g., administration of a monoclonal antibody, optionally linked to a chemotherapeutic agent or toxin, to a tumor antigen).
- a cancer antigen or disease antigen e.g., administration of a monoclonal antibody, optionally linked to a chemotherapeutic agent or toxin, to a tumor antigen.
- anti-VEGF and mTOR inhibitors are known to be effective in treating renal cell carcinoma.
- Immunotherapy can also focus on using the cytotoxic lymphocyte-recognized epitopes of cancer cell lines.
- antisense polynucleotides can be used to selectively modulate biomolecules that are linked to the initiation, progression, and/or pathology of a tumor or cancer.
- Immunotherapy can involve passive immunity for short-term protection of a host, achieved by the administration of pre-formed antibody directed against a cancer antigen or disease antigen (e.g., administration of a monoclonal antibody, optionally linked to a chemotherapeutic agent or toxin, to a tumor antigen). Immunotherapy can also focus on using the cytotoxic lymphocyte-recognized epitopes of cancer cell lines. Alternatively, antisense polynucleotides, ribozymes, RNA interference molecules, triple helix
- polynucleotides and the like can be used to selectively modulate biomolecules that are linked to the initiation, progression, and/or pathology of a tumor or cancer.
- the immunotherapy described herein comprises at least one of immunogenic chemotherapies.
- immunogenic chemotherapy refers to any chemotherapy that has been demonstrated to induce immunogenic cell death, a state that is detectable by the release of one or more damage-associated molecular pattern (DAMP) molecules, including, but not limited to, calreticulin, ATP and HMGB1 (Kroemer et al. (2013), Annu. Rev. Immunol., 31 :51-72).
- DAMP damage-associated molecular pattern
- Specific representative examples of consensus immunogenic chemotherapies include anthracyclines, such as doxorubicin and the platinum drug, oxaliplatin, 5'-fluorouracil, among others.
- immunotherapy comprises inhibitors of one or more immune checkpoints.
- immune checkpoint refers to a group of molecules on the cell surface of CD4+ and/or CD8+ T cells that fine-tune immune responses by down- modulating or inhibiting an anti-tumor immune response.
- Immune checkpoint proteins are well-known in the art and include, without limitation, CTLA-4, PD-1, VISTA, B7-H2, B7- H3, PD-L1, B7-H4, B7-H6, ICOS, HVEM, PD-L2, CD160, gp49B, PIR-B, KIR family receptors, TIM-1, TIM-3, TIM-4, LAG-3, GITR, 4-IBB, OX-40, BTLA, SIRP, CD47, CD48, 2B4 (CD244), B7.1, B7.2, ILT-2, ILT-4, TIGIT, HHLA2, butyrophilins, IDO, CD39, CD73 and A2aR (see, for example, WO 2012/177624).
- the term further encompasses biologically active protein fragment, as well as nucleic acids encoding full- length immune checkpoint proteins and biologically active protein fragments thereof. In some embodiment, the term further encompasses any fragment according to homology descriptions provided herein.
- the immune checkpoint is PD-1. Immune checkpoints and their sequences are well-known in the art and
- PD-1 refers to a member of the immunoglobulin gene superfamily that functions as a coinhibitory receptor having PD-L1 and PD-L2 as known ligands.
- PD-1 was previously identified using a subtraction cloning based approach to select for genes upregulated during TCR-induced activated T cell death.
- PD-1 is a member of the CD28/CTLA-4 family of molecules based on its ability to bind to PD-L1. Like CTLA-4, PD-1 is rapidly induced on the surface of T- cells in response to anti-CD3 (Agata et al. 25 (1996) Int. Immunol. 8:765).
- PD-1 is also induced on the surface of B-cells (in response to anti-IgM). PD-1 is also expressed on a subset of thymocytes and myeloid cells (Agata et al. (1996) supra; Nishimura et al. (1996) Int. Immunol. 8:773).
- PD-1 has an
- ITIM immunoreceptor tyrosine-based inhibitory motif
- ITMS immunoreceptor tyrosine-based switch motif
- immunoinhibitory receptors which also includes gp49B, PIR-B, and the killer inhibitory receptors (KIRs) (Vivier and Daeron (1997) Immunol. Today 18:286). It is often assumed that the tyrosyl phosphorylated ITEVI and ITSM motif of these receptors interacts with SH2-domain containing phosphatases, which leads to inhibitory signals.
- a subset of these immunoinhibitory receptors bind to MHC polypeptides, for example the KIRs, and CTLA4 binds to B7-1 and B7-2. It has been proposed that there is a phylogenetic relationship between the MHC and B7 genes (Henry et al. (1999) Immunol. Today 20(6):285-8).
- Nucleic acid and polypeptide sequences of PD-1 orthologs in organisms other than humans are well-known and include, for example, mouse PD-1 (NM_008798.2 and NP_032824.1), rat PD-1 (NM_001106927.1 and NP_001100397.1), dog PD-1 (XM_543338.3 and
- PD-1 polypeptides are inhibitory receptors capable of transmitting an inhibitory signal to an immune cell to thereby inhibit immune cell effector function, or are capable of promoting costimulation (e.g., by competitive inhibition) of immune cells, e.g., when present in soluble, monomeric form.
- Preferred PD-1 family members share sequence identity with PD-1 and bind to one or more B7 family members, e.g., B7-1, B7-2, PD-1 ligand, and/or other polypeptides on antigen presenting cells.
- PD-1 activity includes the ability of a PD-1 polypeptide to modulate an inhibitory signal in an activated immune cell, e.g., by engaging a natural PD-1 ligand on an antigen presenting cell. Modulation of an inhibitory signal in an immune cell results in modulation of proliferation of, and/or cytokine secretion by, an immune cell.
- PD-1 activity includes the ability of a PD-1 polypeptide to bind its natural ligand(s), the ability to modulate immune cell costimulatory or inhibitory signals, and the ability to modulate the immune response.
- PD-1 ligand refers to binding partners of the PD-1 receptor and includes both PD-Ll (Freeman et al. (2000j J. Exp. Med. 192: 1027-1034) and PD-L2 (Latchman et al. (2001) Nat. Immunol. 2:261). At least two types of human PD-1 ligand polypeptides exist. PD-1 ligand proteins comprise a signal sequence, and an IgV domain, an IgC domain, a transmembrane domain, and a short cytoplasmic tail. Both PD-Ll (See Freeman et al. (2000) for sequence data) and PD-L2 (See Latchman et al. (2001) Nat. Immunol.
- Both PD-Ll and PD-L2 are expressed in placenta, spleen, lymph nodes, thymus, and heart. Only PD-L2 is expressed in pancreas, lung and liver, while only PD-Ll is expressed in fetal liver. Both PD-1 ligands are upregulated on activated monocytes and dendritic cells, although PD-Ll expression is broader.
- PD-Ll is known to be constitutively expressed and upregulated to higher levels on murine hematopoietic cells ⁇ e.g., T cells, B cells, macrophages, dendritic cells (DCs), and bone marrow-derived mast cells) and non- hematopoietic cells ⁇ e.g., endothelial, epithelial, and muscle cells), whereas PD-L2 is inducibly expressed on DCs, macrophages, and bone marrow-derived mast cells (see Butte et al. (2007) Immunity 27: 111).
- murine hematopoietic cells e.g., T cells, B cells, macrophages, dendritic cells (DCs), and bone marrow-derived mast cells
- non- hematopoietic cells e.g., endothelial, epithelial, and muscle cells
- PD-L2 is inducibly expressed on DCs, macrophages, and bone marrow-
- PD-1 ligands comprise a family of polypeptides having certain conserved structural and functional features.
- family when used to refer to proteins or nucleic acid molecules, is intended to mean two or more proteins or nucleic acid molecules having a common structural domain or motif and having sufficient amino acid or nucleotide sequence homology, as defined herein.
- family members can be naturally or non- naturally occurring and can be from either the same or different species.
- a family can contain a first protein of human origin, as well as other, distinct proteins of human origin or alternatively, can contain homologues of non-human origin.
- Members of a family may also have common functional characteristics.
- PD-1 ligands are members of the B7 family of polypeptides.
- B7 family or "B7 polypeptides” as used herein includes costimulatory polypeptides that share sequence homology with B7 polypeptides, e.g., with B7-1, B7-2, B7h (Swallow et al. (1999) Immunity 11 :423), and/or PD-1 ligands ⁇ e.g., PD-L1 or PD-L2).
- B7-1 and B7-2 share approximately 26% amino acid sequence identity when compared using the BLAST program at NCBI with the default parameters (Blosum62 matrix with gap penalties set at existence 11 and extension 1 (See the NCBI website).
- B7 family also includes variants of these polypeptides which are capable of modulating immune cell function.
- IgV domains and the IgC domains are art-recognized Ig superfamily member domains. These domains correspond to structural units that have distinct folding patterns called Ig folds. Ig folds are comprised of a sandwich of two ⁇ sheets, each consisting of anti-parallel ⁇ strands of 5-10 amino acids with a conserved disulfide bond between the two sheets in most, but not all, IgC domains of Ig, TCR, and MHC molecules share the same types of sequence patterns and are called the CI -set within the Ig superfamily. Other IgC domains fall within other sets. IgV domains also share sequence patterns and are called V set domains. IgV domains are longer than IgC domains and contain an additional pair of ⁇ strands.
- B7 polypeptides are capable of providing costimulatory or inhibitory signals to immune cells to thereby promote or inhibit immune cell responses.
- B7 family members that bind to costimulatory receptors increase T cell activation and proliferation, while B7 family members that bind to inhibitory receptors reduce
- B7 family member may increase or decrease T cell costimulation.
- PD-1 ligand when bound to a costimulatory receptor, PD-1 ligand can induce costimulation of immune cells or can inhibit immune cell costimulation, e.g., when present in soluble form.
- PD-1 ligand polypeptides when bound to an inhibitory receptor, can transmit an inhibitory signal to an immune cell.
- Preferred B7 family members include B7-1, B7-2, B7h, PD-L1 or PD-L2 and soluble fragments or derivatives thereof.
- B7 family members bind to one or more receptors on an immune cell, e.g., CTLA4, CD28, ICOS, PD-1 and/or other receptors, and, depending on the receptor, have the ability to transmit an inhibitory signal or a costimulatory signal to an immune cell, preferably a T cell.
- an immune cell e.g., CTLA4, CD28, ICOS, PD-1 and/or other receptors, and, depending on the receptor, have the ability to transmit an inhibitory signal or a costimulatory signal to an immune cell, preferably a T cell.
- PD-1 ligand activity includes the ability of a PD-1 ligand polypeptide to bind its natural receptor(s) (e.g. PD-1 or B7-1), the ability to modulate immune cell costimulatory or inhibitory signals, and the ability to modulate the immune response.
- PD-Ll refers to a specific PD-1 ligand.
- Two forms of human PD-Ll molecules have been identified.
- One form is a naturally occurring PD-Ll soluble polypeptide, i.e., having a short hydrophilic domain and no transmembrane domain, and is referred to herein as PD-Ll S.
- the second form is a cell-associated polypeptide, i.e., having a transmembrane and cytoplasmic domain, referred to herein as PD-LIM.
- the nucleic acid and amino acid sequences of representative human PD-Ll biomarkers regarding PD-LIM are also available to the public at the GenBank database under M 014143.3 and
- PD-Ll proteins comprise a signal sequence, and an IgV domain and an IgC domain.
- the signal sequence of PD-Ll S contains about amino acid 1 to about amino acid 18.
- the signal sequence of PD-LIM contains about amino acid 1 to about amino acid 18.
- the IgV domain of PD-Ll S contains about amino acid 19 to about amino acid 134 and the IgV domain of PD-LIM contains about amino acid 19 to about amino acid 134.
- the IgC domain of PD-Ll S contains about amino acid 135 to about amino acid 227 and the IgC domain of PD-LIM contains about amino acid 135 to about amino acid 227.
- the hydrophilic tail of the PD-Ll exemplified in PD-Ll S comprises a hydrophilic tail shown from about amino acid 228 to about amino acid 245.
- the PD-Ll polypeptide exemplified in PD-LIM comprises a transmembrane domain shown from about amino acids 239 to about amino acid 259 of PD-LIM and a cytoplasmic domain shown from about 30 amino acid 260 to about amino acid 290 of PD-LIM.
- nucleic acid and polypeptide sequences of PD-Ll orthologs in organisms other than humans are well-known and include, for example, mouse PD-Ll ( M 021893.3 and P 068693.1), rat PD-Ll
- PD-L2 refers to another specific PD-1 ligand.
- PD-L2 is a B7 family member expressed on various APCs, including dendritic cells, macrophages and bone- marrow derived mast cells (Zhong et al. (2007) Eur. J. Immunol. 37:2405).
- APC-expressed PD-L2 is able to both inhibit T cell activation through ligation of PD-1 and costimulate T cell activation, through a PD-1 independent mechanism (Shin et al. (2005) J. Exp. Med. 201 : 1531).
- ligation of dendritic cell-expressed PD-L2 results in enhanced dendritic cell cytokine expression and survival (Radhakrishnan et al. (2003) J. Immunol. 37: 1827; Nguyen et al. (2002) J. Exp. Med. 196: 1393).
- the nucleic acid and amino acid sequences of representative human PD-L2 biomarkers are well-known in the art and are also available to the public at the GenBank database under NM 025239.3 and
- PD-L2 proteins are characterized by common structural elements.
- PD-L2 proteins include at least one or more of the following domains: a signal peptide domain, a transmembrane domain, an IgV domain, an IgC domain, an extracellular domain, a transmembrane domain, and a cytoplasmic domain.
- amino acids 1-19 of PD-L2 comprises a signal sequence.
- a "signal sequence” or “signal peptide” serves to direct a polypeptide containing such a sequence to a lipid bilayer, and is cleaved in secreted and membrane bound polypeptides and includes a peptide containing about 15 or more amino acids which occurs at the N-terminus of secretory and membrane bound polypeptides and which contains a large number of hydrophobic amino acid residues.
- a signal sequence contains at least about 10-30 amino acid residues, preferably about 15- 25 amino acid residues, more preferably about 18-20 amino acid residues, and even more preferably about 19 amino acid residues, and has at least about 35-65%, preferably about 38-50%, and more preferably about 40- 45%) hydrophobic amino acid residues ⁇ e.g., valine, leucine, isoleucine or phenylalanine).
- amino acid residues 220-243 of the native human PD-L2 polypeptide and amino acid residues 201-243 of the mature polypeptide comprise a transmembrane domain.
- transmembrane domain includes an amino acid sequence of about 15 amino acid residues in length which spans the plasma membrane. More preferably, a transmembrane domain includes about at least 20, 25, 30, 35, 40, or 45 amino acid residues and spans the plasma membrane. Transmembrane domains are rich in hydrophobic residues, and typically have an alpha-helical structure. In a preferred embodiment, at least 50%, 60%, 70%, 80%, 90%, 95% or more of the amino acids of a transmembrane domain are hydrophobic, e.g., leucines, isoleucines, tyrosines, or tryptophans. Transmembrane domains are described in, for example, Zaklakla, W. N.
- amino acid residues 20-120 of the native human PD-L2 polypeptide and amino acid residues 1-101 of the mature polypeptide comprise an IgV domain.
- Amino acid residues 121- 219 of the native human PD-L2 polypeptide and amino acid residues 102-200 of the mature polypeptide comprise an IgC domain.
- IgV and IgC domains are recognized in the art as Ig superfamily member domains. These domains correspond to structural units that have distinct folding patterns called Ig folds.
- Ig folds are comprised of a sandwich of two ⁇ sheets, each consisting of antiparallel (3 strands of 5-10 amino acids with a conserved disulfide bond between the two sheets in most, but not all, domains.
- IgC domains of Ig, TCR, and MHC molecules share the same types of sequence patterns and are called the CI set within the Ig superfamily. Other IgC domains fall within other sets.
- IgV domains also share sequence patterns and are called V set domains. IgV domains are longer than C- domains and form an additional pair of strands.
- amino acid residues 1-219 of the native human PD-L2 polypeptide and amino acid residues 1-200 of the mature polypeptide comprise an extracellular domain.
- extracellular domain represents the N-terminal amino acids which extend as a tail from the surface of a cell.
- An extracellular domain of the present invention includes an IgV domain and an IgC domain, and may include a signal peptide domain.
- amino acid residues 244-273 of the native human PD-L2 polypeptide and amino acid residues 225-273 of the mature polypeptide comprise a cytoplasmic domain.
- the term "cytoplasmic domain" represents the C-terminal amino acids which extend as a tail into the cytoplasm of a cell.
- nucleic acid and polypeptide sequences of PD-L2 orthologs in organisms other than humans are well-known and include, for example, mouse PD-L2 ( M_021396.2 and P_067371.1), rat PD-L2
- PD-L2 activity refers to an activity exerted by a PD-L2 protein, polypeptide or nucleic acid molecule on a PD-L2-responsive cell or tissue, or on a PD- L2 polypeptide binding partner, as determined in vivo, or in vitro, according to standard techniques.
- a PD-L2 activity is a direct activity, such as an association with a PD-L2 binding partner.
- a "target molecule” or “binding partner” is a molecule with which a PD-L2 polypeptide binds or interacts in nature, such that PD-L2-mediated function is achieved.
- a PD-L2 target molecule is the receptor RGMb.
- a PD-L2 activity is an indirect activity, such as a cellular signaling activity mediated by interaction of the PD- L2 polypeptide with its natural binding partner (i.e., physiologically relevant interacting macromolecule involved in an immune function or other biologically relevant function), e.g., RGMb.
- RGMb biologically relevant interacting macromolecule involved in an immune function or other biologically relevant function
- the PD-L2 polypeptides of the present invention can have one or more of the following activities: 1) bind to and/or modulate the activity of the receptor RGMb, PD-1, or other PD-L2 natural binding partners, 2) modulate intra-or intercellular signaling, 3) modulate activation of immune cells, e.g. , T lymphocytes, and 4) modulate the immune response of an organism, e.g., a mouse or human organism.
- Anti-immune checkpoint therapy refers to the use of agents that inhibit immune checkpoint nucleic acids and/or proteins. Inhibition of one or more immune checkpoints can block or otherwise neutralize inhibitory signaling to thereby upregulate an immune response in order to more efficaciously treat cancer.
- agents useful for inhibiting immune checkpoints include antibodies, small molecules, peptides, peptidomimetics, natural ligands, and derivatives of natural ligands, that can either bind and/or inactivate or inhibit immune checkpoint proteins, or fragments thereof; as well as RNA interference, antisense, nucleic acid aptamers, etc. that can downregulate the expression and/or activity of immune checkpoint nucleic acids, or fragments thereof.
- agents for upregulating an immune response include antibodies against one or more immune checkpoint proteins block the interaction between the proteins and its natural receptor(s); a non-activating form of one or more immune checkpoint proteins (e.g. , a dominant negative polypeptide); small molecules or peptides that block the interaction between one or more immune checkpoint proteins and its natural receptor(s); fusion proteins (e.g. the
- agents can directly block the interaction between the one or more immune checkpoints and its natural receptor(s) (e.g., antibodies) to prevent inhibitory signaling and upregulate an immune response.
- agents can indirectly block the interaction between one or more immune checkpoint proteins and its natural receptor(s) to prevent inhibitory signaling and upregulate an immune response.
- an immune checkpoint protein ligand such as a stabilized extracellular domain can binding to its receptor to indirectly reduce the effective concentration of the receptor to bind to an appropriate ligand.
- anti-PD-1 antibodies, anti-PD-Ll antibodies, and/or anti-PD-L2 antibodies are used to inhibit immune checkpoints. These embodiments are also applicable to specific therapy against particular immune checkpoints, such as the PD-1 pathway (e.g., anti-PD-1 pathway therapy, otherwise known as PD-1 pathway inhibitor therapy).
- RIPKl also known as receptor-interacting serine/threonine-protein kinase 1 and RIP-1, refers to a member of a group of proteins functioning in a variety of cellular pathways including the F- ⁇ pathway and programmed necrotic cell death (necroptosis). This group of serine-threonine kinases transduce inflammatory and cell- death signals (programmed necrosis) following death receptors ligation, activation of pathogen recognition receptors (PRRs), and DNA damage, affecting embryonic development, tissue homeostasis, immunity and inflammation.
- PRRs pathogen recognition receptors
- RIPKl is implicated in inflammatory and cell death signaling and its kinase activity is believed to drive RIPK3- mediated necroptosis (Kelliher et al. (1998) Immunity 8:297-303; Meylan et al. (2004) Nature Immunol.5:503-50”/ '; Chri staffer son et al. (2014) Annu. Rev. Physiol. 76: 129-150).
- TNFR1 RIPKl regulates whether the cell lives by activating F- ⁇ or dies by apoptosis or necroptosis, two distinct pathways of programmed cell death that may be activated to eliminate unwanted cells.
- RIPKl has an N-terminal Ser/Thr kinase domain and a C-terminal death domain.
- the kinase domain of RIPKl is involved in regulating necroptosis, and the death domain regulates RIPKl recruitment to the intracellular domain of T FR1 (Stanger et al. (1995) Cell 81 :513-523; Hsu et al. (1996) Immunity 4:387-396).
- RIPKl interacts with RIP3 kinase, a downstream mediator of RIPKl in the execution of necroptosis, via their RIP homotypic interaction motifs and activates F- ⁇ (YU et al. (1999) Curr. Biol.
- RIPKl -RIPK3 dimer Upon T F-induced necrosis, the RIPKl -RIPK3 dimer further interacts with PGAM5 and MLKL, forming a complex leading to PGAM5 phosphorylation and increased PGAM5 phosphatase activity.
- RIPKl also interacts with T FRSF6 and TRADD via their death domains, thus recruited by TRADD to TNFRSFIA in a TNF-dependent process.
- RIPKl further interacts (via kinase domain) with DAB2IP (via Ras-GAP domain), in a TNF-alpha-dependent manner.
- binding partners and/or those RIPKl interacts with include, e.g., R F216, EGFR, IKBKG, TRAF1, TRAF2, TRAF3, B LF1, SQSTM1, MAVS/IPS1, ZFA D5, BIRC2/c-IAPl, BIRC3/c-IAP2, XIAP/BIRC4, ARHGEF2, RFFL, R F34, TICAM1, CA11, CASP8, CFLAR, CRADD, R F11, T FRSF1 A, and UBC (Liao et al. (2008) Curr. Biol. 18:641-649; Kataoka et al. (2000) Curr. Biol. 10:640-648; Ahmad et al. (1997) Cancer Res.
- RIPKl and RIPK3 undergo reciprocal auto- and trans-phosphorylation. Phosphorylation of Ser-161 on RIPKl by RIPK3 is necessary for the formation of the necroptosis-inducing complex.
- RIPKl can be ubiquitinated by Lys-11-, Lys-48-, Lys-63- and linear-linked type ubiquitin. Polyubiquitination with Lys-63 -linked chains on by TRAF2 induces RIPKl association with the IKK complex.
- Lys-48-linked polyubiquitination by RFFL or RNF34 also promotes proteasomal degradation and negatively regulates TNF-alpha-induced NFkappa-B signaling.
- RIPKl can also be polyubiquitinated with Lys-48 and Lys-63-linked chains by BIRC2/c-IAPl and BIRC3/C-IAP2, leading to activation of NF-kappa-B (Bertrand et al. (2008) Mol. Cell. 30:689-700; Varfolomeev et al. (2008) J. Biol. Chem. 283 :24295-24299).
- the nucleic acid and amino acid sequences of a representative human RIPKl is available to the public at the GenBank database (Gene ID 8738) and is shown in Table 1. Human RIPKl isoforms include the longer isoform 1 (GenBank database numbers
- RTPKl polypeptide The domain structure of RTPKl polypeptide is well known and accessible in UniProtKB database under the accession number Q13546, including, in the order from the 5' terminus to the 3' terminus, a protein kinase domain comprising, e.g., amino acid positions 17-289 of NP 003795.2), an intermediate RIP homotypic interaction motif (RHIM) which is important for NF-kB activation and RHIM-dependent signaling and comprises, e.g., amino acid positions 531- 547 of NP 003795.2), and a death domain comprising, e.g., amino acid 583-669 of NP_003795.2.
- RHIM intermediate RIP homotypic interaction motif
- Nucleic acid and polypeptide sequences of RIPKl orthologs in organisms other than humans are well-known and include, for example, chimpanzee (Pan troglodytes) RIPKl (XM_016954826.1 and XP_016810315.1 ; XM_016954825.1 and XP_016810314.1;
- NP_001030184.1 Norway rat (Rattus norvegicus) RIPK 1 (NM_001107350.1 and
- NP_001100820.1 chicken RIPKl (NM_204402.2 and NP_989733.2), tropical clawed frog (Xenopus tropicalis) RIPKl (NM_001079035.1 and NP_001072503.1), zebrafish (Danio rerio) RIPKl (NM l 99674.2 and NP 955968.2), zebrafish (Danio rerio) RIPKl
- RIPKl activity includes the ability of a RIPKl polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein) to bind its substrate and/or catalyze serine/threonine-protein kinase activity.
- RIPKl activity may also include one or more of functions, such as those disclosed herein in the NF- ⁇ pathway and programmed necrotic cell death (necroptosis).
- RIPKl may interact with various proteins disclosed herein, such as RIP3 kinase, for its functions in signaling related to TNF-alpha, NFkappa-B, and/or necroptosis.
- RIPKl may also be proteolyticly modified, such as being cleaved, ubiquitinated, deubiquitinated, or otherwise disclosed herein, for it functions.
- RIPKl substrate(s) refers to binding partners of a RIPKl polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein), e.g., the proteins listed herein. Furthermore, RIPKl substrates may refer to downstream members in the signaling pathways where RIPKl has a functional role.
- RIPK1 -regulated signaling pathway(s) includes signaling pathways in which RIPK1 (and its fragments, domains, and/or motifs thereof, discussed herein) binds to at least one of its substrate, through which at least one cellular function and/or activity and/or cellular protein profiles is changed (e.g., through RIP3 kinases or by being proteolyticly modified).
- RIPK1 promotes ubiquitination and proteasome degradation for at least one of its substrates which bind to it.
- RJPK1 -regulated signaling pathways include at least those described herein, such as TNFR1 pathway, regulation by c-FLIP, activated TLR4 signaling, apoptosis modulation and signaling, TNF signaling (reactome), Death Receptor signaling, Fkappa-B pathway, P38 MAPK signaling pathway, etc.
- RIPKl inhibitor(s) includes any natural or non-natural agent prepared, synthesized, manufactured, and/or purified by human that is capable of reducing, inhibiting, blocking, preventing, and/or that inhibits the ability of a RIPKl polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein).
- such inhibitors may reduce or inhibit the binding/interaction between RIPKl and its substrates or other binding partners.
- such inhibitors may reduce or inhibit the catalytic function of RIPKl as a serine/threonine-protein kinase.
- RIPKl inhibitor(s) includes any natural or non-natural agent prepared, synthesized, manufactured, and/or purified by human that is capable of reducing, inhibiting, blocking, preventing, and/or that inhibits the ability of a RIPKl polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein).
- such inhibitors may reduce or inhibit the binding/interaction between RIPKl
- such inhibitors may increase or promote the turnover rate, reduce or inhibit the expression and/or the stability (e.g., the half-life), and/or change the cellular localization of RIPKl, resulting in at least a decrease in RIPKl levels and/or activity.
- Such inhibitors may be any molecule, including but not limited to small molecule compounds, antibodies or intrabodies, RNA interfering (RNAi) agents (including at least siRNAs, shRNAs, microRNAs (miRNAs), piwi, and other well-known agents).
- RNAi RNA interfering
- Such inhibitors may be specific to RIPKl or also inhibit at least one of other serine/threonine-protein kinases.
- Small molecule inhibitory compounds for RIPKl polypeptides are well known and commercially available (e.g., Necrostatin-1 (5-(lH-Indol-3-ylmethyl)-3-methyl-2-thioxo-4- imidazolidinone, Cat. # 2324, Tocris, Bristol, UK) prevents osmotic nephrosis (Linkermann et al. (2013) J Am Soc Nephrol. 24: 1545-1557; Cui et al. (2016) Sci Rep. 6,
- GSK481 (S)-5-benzyl-N-(5-methyl-4-oxo-2,3,4,5- tetrahydrobenzo[b][l,4]oxazepin-3-yl)isoxazole-3-carboxamide, Cat. # 1622849-58-4,
- RNA interference for RIPK1 polypeptides are well known and commercially available ⁇ e.g., human or mouse shRNA (Cat. # TG320591, TL320591, TL501905, TF320591, TR320591, and TF501905) and siRNA (Cat. #
- SR418761, SR305755, and SR509132 products and human or mouse gene knockout kit via CRISPR (Cat. # KN216024 and KN314840) from Origene (Rockville, MD, siRNA/shRNA products (Cat. # sc-37387, sc-37388, sc-36426, sc-44326, sc-36427, sc-36428, and sc- 36429) from Santa Cruz Biotechnology (Dallas, Texas), Ready-to-package AAV shRNA clones from Vigene Biosciences (Rockville, MD, etc.).
- Methods for detection, purification, and/or inhibition of RIPKl are also well known and commercially available (e.g., multiple anti-RIPKl antibodies from Origene (Cat. #
- AP00087PU-N, TA800325AM, and other about 70 antibodies Cell Signaling Technology (Danvers, MA, Cat. # 3493, 14577, 4926, etc.), abeam (Cambridge, MA, Cat. # ab72139, ab202985, abl25072, abl78420, abl37451, etc.), R&D Systems (Minneapolis, MN, Cat. # MAB3585), Santa Cruz Biotechnology (Cat. # sc- 133102), etc.).
- RIPKl knockout mouse strains and cell lines are also well known and available at the International Mouse Strain Resource (IMSR) (e.g., stain names Ripkl tmL1Vmd and Ripkl tmlLed ).
- IMSR International Mouse Strain Resource
- BIRC2 also known as baculoviral IAP repeat containing 2, c-IAPl, and apoptosis inhibitor 1
- BIRC2 refers to a member of a family of proteins that inhibits apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases.
- BIRC2 inhibits apoptosis induced by serum deprivation and menadione, a potent inducer of free radicals.
- BIRC2 regulates not only caspases and apoptosis, but also inflammatory signaling and immunity, mitogenic kinase signaling, and cell proliferation, as well as cell invasion and metastasis.
- BIRC2 acts as an E3 ubiquitin-protein ligase regulating F-kappa-B signaling and regulates both canonical and non-canonical NF-kappa-B signaling by acting in opposite directions: acts as a positive regulator of the canonical pathway and suppresses constitutive activation of non-canonical NF-kappa-B signaling.
- the target proteins for the E3 ubiquitin-protein ligase activity of BIRC2 include, at least RIPKl (leading to activation of NF-KB, see Bertrand et al. (2008) Mol. Cell. 30:689-700; Varfolomeev et al. (2008) J. Biol. Chem. 283 :24295-24299), RIPK2, RIPK3, RIPK4, CASP3, CASP7, CASP8, TRAF2, DIABLO/SMAC, MAP3K14/NIK, MAP3K5/ASK1, IKBKG/NEMO, IKBKE, and
- BIRC2 also functions as an E3 ubiquitin-protein ligase of the NEDD8 conjugation pathway, targeting effector caspases for neddylation and inactivation.
- BIRC2 is as an important regulator of innate immune signaling via regulation of Toll-like receptors (TLRs), Nodlike receptors (NLRs) and RIG-I like receptors (RLRs), collectively referred to as pattern recognition receptors (PRRs).
- TLRs Toll-like receptors
- NLRs Nodlike receptors
- RLRs RIG-I like receptors
- PRRs pattern recognition receptors
- BIRC2 suppresses ripoptosome formation by ubiquitinating RIPK1 and CASP8. BIRC2 also stimulates the transcriptional activity of E2F 1 and plays a role in the modulation of the cell cycle. BIRC2 interacts with DIABLO/SMAC and with PRSS25 and such interactions inhibit apoptotic suppressor activity. BIRC2 also interacts with CASP9, TRAF2, E2F 1, RIPK1, RIPK2, RIPK3, RIPK4, BIRC5/surviving, RAC1, TSGA10, ABHD17A, BIRC7, and USP19.
- BIRC2 functions in multiple pathways, including, at least, TNFR1 pathway (e.g., DR2 signaling, TWEAK pathway, Fas signaling, TNF-alpha/NF-kB Signaling Pathway, etc.), apoptosis modulation and signaling (e.g., death receptor signaling, apoptotic TNF-family pathways, etc.), activated Toll-like receptor 4 (TLR4) signaling (e.g., MyD88-independent
- TLR3/TLR4 cascade TNF signaling (REACTOME), regulation of activated PAK-2p34 by proteasome mediated degradation (e.g., TNFR2 non-canonical NF- ⁇ pathway), etc.
- BIRC2 is suggested to be related to lung cancers and lymphoma.
- Human BIRC2 isoforms include the predominant transcript variant 1 and the encoded longer isoform 1 (GenBank database numbers NM_001 166.4 and NP_001 157.1), a transcript variant 2, which differs in the 5' UTR compared to variant 1, and the encoded protein having the same sequence as isoform 1 (NM_001256163.1 and NP_001243092.1), and a transcript variant 3, having an alternate splice site in the 5' region resulting in a downstream AUG start codon compared to variant 1, and the encoded shorter isoform 2
- BIRC2 polypeptide (shorter at the N-terminus).
- the domain structure of BIRC2 polypeptide is well known and accessible in UniProtKB database under the accession number Q 13490, including, in the order from the 5' terminus to the 3 ' terminus, three BIR domain comprising, e.g., amino acid positions 46-1 13, 184-250, and 269-336 of NP_001 157.1, a caspase activation and recruitment domain (CARD) domain comprising, e.g., amino acid positions 453-543 of NP_001 157.1, and a Really Interesting New Gene (RING)-type zinc finger comprising, e.g., amino acid positions 571-606 of NP_001 157.1.
- CARD caspase activation and recruitment domain
- RING Really Interesting New Gene
- Nucleic acid and polypeptide sequences of BIRC2 orthologs in organisms other than humans are well-known and include, for example, chimpanzee ⁇ Pan troglodytes) BIRC2 (XM_016921873.1 and XP_016777362.1, XM_001152603.5 and XP_001152603.1, XM_016921875.1 and XP_016777364.1, XM_016921874.1 and XP_016777363.1, and XM_001152534.3 and XP_001152534.1), Rhesus monkey BIRC2 (NM_001261321.1 and NP_001248250.1), dog BIRC2 (NM_001048023.1 and NP_001041488.1), mouse BIRC2 (NM_007465.3 and NP_031491.2, representing the transcript variant 1 and the encoded isoform 1, and NM_001291503.1 and NP_001278432.1, representing transcript variant 2
- NP_001007823.1 tropical clawed frog (Xenopus tropicalis) BIRC2 (NM_001005449.1 and NP_001005449.1), zebrafish (Danio rerio) BIRC2 (NM_194395.2 and NP_919376.1), and fruit fly Diap2 (NM_176182.2 and NP_788362.1, and NM_057779.5 and
- BIRC2 activity includes the ability of a BIRC2 polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein) to bind its substrate and/or biological activity. BIRC2 activity may also include one or more of functions, such as those disclosed herein in the NF- ⁇ pathway and programmed necrotic cell death. For example, BIRC2 may interact with various proteins ⁇ e.g., its ubiquitination substrates) disclosed herein for its functions in signaling related to TNF-alpha, NFkappa-B, and/or necroptosis. BIRC2 may also be proteolyticly modified, such as being cleaved, ubiquitinated, deubiquitinated, or otherwise disclosed herein, for it functions.
- BIRC2 substrate(s) refers to binding partners of a BIRC2 polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein), e.g., the proteins listed herein. Furthermore, BIRC2 substrates may refer to downstream members in the signaling pathways where BIRC2 has a functional role.
- BIRC2-regulated signaling pathway(s) includes signaling pathways in which BIRC2 (and its fragments, domains, and/or motifs thereof, discussed herein) binds to at least one of its substrate, through which at least one cellular function and/or activity and/or cellular protein profiles is changed ⁇ e.g., through RIP3 kinases or by being proteolyticly modified).
- BIRC2 promotes ubiquitination and proteasome degradation for at least one of its substrates which bind to it.
- BIRC2-regulated signaling pathways include at least those described herein, such as TNFR1 pathway (e.g., DR2 signaling, TWEAK pathway, Fas signaling, T F-alpha/NF-kB Signaling Pathway, etc.), apoptosis modulation and signaling (e.g., death receptor signaling, apoptotic TNF- family pathways, etc.), activated Toll-like receptor 4 (TLR4) signaling (e.g., MyD88- independent TLR3/TLR4 cascade), T F signaling (REACTOME), regulation of activated PAK-2p34 by proteasome mediated degradation (e.g., T FR2 non-canonical F-KB pathway), etc.
- TNFR1 pathway e.g., DR2 signaling, TWEAK pathway, Fas signaling, T F-alpha/NF-kB Signaling Pathway, etc.
- apoptosis modulation and signaling e.g., death receptor signaling, apop
- BIRC2 inhibitor(s) includes any natural or non-natural agent prepared, synthesized, manufactured, and/or purified by human that is capable of reducing, inhibiting, blocking, preventing, and/or that inhibits the ability of a BIRC2 polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein). In one embodiment, such inhibitors may reduce or inhibit the binding/interaction between BIRC2 and its substrates or other binding partners. In another embodiment, such inhibitors may reduce or inhibit the catalytic function of BIRC2 as a ubiquitin ligase.
- inhibitors may increase or promote the turnover rate, reduce or inhibit the expression and/or the stability (e.g., the half-life), and/or change the cellular localization of BIRC2, resulting in at least a decrease in BIRC2 levels and/or its ubiquitin ligase activity).
- Such inhibitors may be any molecule, including but not limited to small molecule compounds, antibodies or intrabodies, RNA interfering (RNAi) agents (including at least siRNAs, shRNAs, microRNAs (miRNAs), piwi, and other well-known agents).
- RNAi RNA interfering
- Such inhibitors may be specific to BIRC2 or also inhibit at least one of other E3 ubiquitin ligases.
- RNA interference for BIRC2 polypeptides are well known and commercially available (e.g., GDC-0152, LCL161, Birinapant (TL3271 1), AT-406 (SM- 406), BV6, etc.).
- RNA interference for BIRC2 polypeptides are well known and commercially available (e.g., GDC-0152, LCL161, Birinapant (TL3271 1), AT-406 (SM- 406), BV6, etc.).
- BIRC2 e.g., by anti-BIRC2 antibodies
- Methods for detection, purification, and/or inhibition of BIRC2 are also well known and commercially available (e.g., multiple anti-BIRC2 antibodies from Origene (Cat. # TA307562, TA321297, TA306169, etc.), Cell Signaling Technology (Danvers, MA, Cat. # 7065, 4952, etc.), abeam (Cambridge, MA, Cat. # abl08361, ab201588, abl96592, etc.), and Santa Cruz
- TRAF1 also known as TRAF family member-associated NFKB activator (TANK)-binding kinase 1 and NFi B-activating kinase
- TANK TRAF family member-associated NFKB activator
- NFi B-activating kinase refers to a member of a family of serine/threonine protein kinases that plays an essential role in regulating inflammatory responses to foreign agents.
- TRAF3 and TANK phosphorylates interferon regulatory factors (IRFs) IRF3 and IRF7 as well as DDX3X, resulting in subsequent homodimerization and nuclear translocation of the IRFs and leading to transcriptional activation of pro-inflammatory and antiviral genes including IFNA and IFNB.
- IRFs interferon regulatory factors
- TBK1 functions as a NFKB effector by phosphorylating NFKB inhibitor alpha/NFKBIA, 1KB KB or RELA to translocate NFKB to the nucleus.
- TBK1 restricts bacterial proliferation by
- TBK1 also phosphorylates and activates AKTl .
- TBK1 is suggested to play a role in energy balance regulation by sustaining a state of chronic, low-grade inflammation in obesity, which leads to a negative impact on insulin sensitivity.
- TBK1 also attenuates retroviral budding by phosphorylating the endosomal sorting complex required for transport-I (ESCRT-I) subunit VPS37C.
- ESCRT-I transport-I
- phosphorylation substrates of TBK1 include, at least Borna disease virus (BDV) P protein.
- BDV Borna disease virus
- TBK1 interacts with, at least, NCK1 (Chou and Hanafusa (1995) J. Biol. Chem. 270:7359- 7364), TANK (Pomerantz and Baltimore (2000) EMBO J. 18:6694-6704; Bouwmeester et al. (2004) Nat. Cell Biol. 6:97-105), and TRAF2 (Bonnard et al. (2000) EMBO J. 19:4976- 4985).
- Transcriptional factors activated upon TBK1 activation include IRF3, IRF7, and ZEB1 (Liu (2014) Lab Invest. 94:362-370).
- TBK1 is also suggested to interact OPTN, TBKBP1, IRF3, IRF7, and TANK.
- TBK1 functions in multiple pathways, including, at least, RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways ⁇ e.g., RIG-I-like Receptor (RLR) signaling pathways, TRAF3 -dependent IFR activation pathway, TRAF6- mediated IRF7 activation, cytosolic DNA-sensing pathway, etc.), activated TLR4 signaling (e.g., MyD88-independent TLR3/TLR4 cascade, TRIF-mediated TLR3/TLR4 signaling, etc.), cytosolic sensors of pathogen-associated DNA (e.g., ZBP1(DAI) mediated induction of type I IFNs, IRF3-mediated induction of type I IFN, STING mediated induction of host immune responses, STAT6-mediated induction of chemokines, etc.), Toll
- TBK1 is suggested to be related to multiple diseases and disorders including, at least frontotemporal dementia and/or amyotrophic lateral sclerosis 1 and 4 (ftdals 1 and ftdals4), herpes simplex encephalitis, borna disease (enzootic encephalomyelitis), and crustacean allergy.
- the nucleic acid and amino acid sequences of a representative human TBK1 is available to the public at the GenBank database (Gene ID 29110) and is shown in Table 1 (e.g., NM_013254.3 and NP_037386.1).
- the domain structure of TBK1 polypeptide is well known and accessible in UniProtKB database under the accession number Q9UHD2, including, in the order from the 5' terminus to the 3' terminus, a protein kinase domain comprising, e.g., amino acid positions 9-310 of NP 037386.1, and a ubiquitin-like domain comprising, e.g., amino acid positions 309-385 of NP 037386.1.
- Nucleic acid and polypeptide sequences of TBK1 orthologs in organisms other than humans are well-known and include, for example, chimpanzee (Pan troglodytes) TBK1 (XM_509194.4 and XP_509194.2), Rhesus monkey TBK1 (NM_001261193.1 and
- NP_001179684.1 Norway rat (Rattus norvegicus) TBK1 (NM_001106786.1 and
- NP_001100256.1 chicken TBK1 (NM_001199558.1 and NP_001186487.1), tropical clawed frog (Xenopus tropicalis) TBK1 (NM_001142180.1 and NP_001135652.1), and zebrafish (Danio rerio) TBK1 (NM_001044748.2 and NP_001038213.2).
- TBK1 activity includes the ability of a TBK1 polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein) to bind its substrate and/or biological activity.
- TBK1 activity may also include one or more of functions, such as its serine/threonine protein kinase activity, and/or others disclosed herein in the NF-KB pathway and other related pathways.
- TBK1 may interact with various proteins (e.g., its substrates) disclosed herein for its functions in signaling.
- TBK1 may also be proteolyticly modified, such as being cleaved, ubiquitinated, deubiquitinated, or otherwise disclosed herein, for it functions.
- TBKl substrate(s) refers to binding partners of a TBKl polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein), e.g., the substrates described herein of TBKl as a serine/threonine protein kinase. Furthermore, TBKl substrates may refer to downstream members in the signaling pathways where TBKl has a functional role.
- TBKl -regulated signaling pathway(s) includes signaling pathways in which TBKl (and its fragments, domains, and/or motifs thereof, discussed herein) binds to at least one of its substrate, through which at least one cellular function and/or activity and/or cellular protein profiles is changed.
- TBKl is a signaling pathway in which TBKl (and its fragments, domains, and/or motifs thereof, discussed herein) binds to at least one of its substrate, through which at least one cellular function and/or activity and/or cellular protein profiles is changed.
- TBKl is a
- TBK1- regulated signaling pathways include at least those described herein, such as RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways (e.g., RIG-I-like Receptor (RLR) signaling pathways, TRAF3 -dependent IFR activation pathway, TRAF6-mediated IRF7 activation, cytosolic DNA-sensing pathway, etc.), activated TLR4 signaling (e.g., MyD88-independent TLR3/TLR4 cascade, TRIF-mediated TLR3/TLR4 signaling, etc.), cytosolic sensors of pathogen-associated DNA (e.g., ZBPl(DAI) mediated induction of type I IFNs, IRF3- mediated induction of type I IFN, STING mediated induction of host immune responses, STAT6-mediated induction of chemokines, etc.), Toll-like receptor
- TKl inhibitor(s) includes any natural or non-natural agent prepared, synthesized, manufactured, and/or purified by human that is capable of reducing, inhibiting, blocking, preventing, and/or that inhibits the ability of a TBKl polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein).
- such inhibitors may reduce or inhibit the binding/interaction between TBKl and its substrates or other binding partners.
- such inhibitors may reduce or inhibit the catalytic function of TBKl as a serine/threonine protein kinase.
- TBKl inhibitor(s) includes any natural or non-natural agent prepared, synthesized, manufactured, and/or purified by human that is capable of reducing, inhibiting, blocking, preventing, and/or that inhibits the ability of a TBKl polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein).
- such inhibitors may reduce or inhibit the binding/interaction between TBKl and its
- such inhibitors may increase or promote the turnover rate, reduce or inhibit the expression and/or the stability (e.g., the half-life), and/or change the cellular localization of TBKl, resulting in at least a decrease in TBKl levels and/or activity (e.g., its
- Such inhibitors may be any molecule, including but not limited to small molecule compounds, antibodies or intrabodies, RNA interfering (RNAi) agents (including at least siRNAs, shRNAs, microRNAs (miRNAs), piwi, and other well-known agents).
- RNA interfering agents including at least siRNAs, shRNAs, microRNAs (miRNAs), piwi, and other well-known agents.
- Such inhibitors may be specific to TBKl or also inhibit at least one of other serine/threonine-protein kinases.
- RNA interference for TBKl polypeptides are well known and commercially available (e.g., human, mouse, or rat shRNA (Cat. #
- TF320685, TL503203, TF705359, etc. siRNA (Cat. # SR309210, SR419607,
- SR505252, etc. products and human or mouse gene knockout kit via CRISPR (Cat. # KN317271 and KN205238) from Origene (Rockville, MD, siRNA/shRNA products (Cat. # sc-39058 and sc-39059) and CRISPR products (Cat. # sc-425191 and sc-401066) from Santa Cruz Biotechnology (Dallas, Texas), Ready-to-package AAV shRNA clones from Vigene Biosciences (Rockville, MD, Cat. # SH866073).
- Methods for detection, purification, and/or inhibition of TBKl are also well known and commercially available (e.g., multiple anti-TBKl antibodies from Origene (Cat. # TA336453, TA334468, TA320202, etc.), Cell Signaling Technology (Danvers, MA, Cat. # 3504, 3013, etc.), abeam (Cambridge, MA, Cat. # ab40676, ab l09735, ab l21 16, etc.), and Santa Cruz Biotechnology (Cat. # sc-9910, sc-9085, sc-52957, etc.)).
- Human TBKl knockout cell lines are also well known and available from Horizon Discovery (Cambridge, UK, Cat. # HZGHC000031c010).
- TRAF3 also known as TNF receptor-associated factor 3, LMP1- associated protein 1, CRAF 1, and CAPl, refers to a member of a family of TNF receptor associated factor (TRAF) protein family.
- TRAF proteins associate with, and mediate the signal transduction from, members of the TNF receptor (TNFR) superfamily.
- TRAF3 participates in the signal transduction of CD40, a TNFR family member important for the activation of the immune response.
- TRAF3 is found to be a critical component of the lymphotoxin-beta receptor (LTbetaR) signaling complex, which induces NF- ⁇ activation and cell death initiated by LTbeta ligation.
- LTBtaR lymphotoxin-beta receptor
- Epstein-Barr virus encoded latent infection membrane protein- 1 can interact with TRAF3 and several other members of the TRAF family, which may be essential for the oncogenic effects of LMP1.
- TRAF3 regulates pathways leading to the activation of NF- ⁇ and MAP kinases, and plays a central role in the regulation of B-cell survival, including, at least, producing cytokines and interferon.
- TRAF3 is required for normal antibody isotype switching from IgM to IgG and plays a role in T-cell dependent immune responses and regulation of antiviral responses.
- TRAF3 is an essential constituent of several E3 ubiquitin-protein ligase complexes.
- TRAF3 may have E3 ubiquitin-protein ligase activity and promote Lys-63- linked ubiquitination of target proteins. TRAF3 inhibits TRAF2-mediated activation of NF-KB and down-regulates proteolytic processing of NFKB2, and thereby inhibits non- canonical activation of NF- ⁇ . TRAF3 also promotes ubiquitination and proteasomal degradation of MAP3K14.
- TRAF3 can form heterotrimers with TRAF2 and TRAF5.
- TRAF3 interacts with, at least, TRAFDl, LTBR/TNFRSF3, TNFRSF4, TNFRSF 5/CD40, TNFRSF8/CD30, TNFRSF13C, TICAM1, TNFRSF 17/BCMA, TLR4, EDAR, MAP3K5, MAP3K14, TRAIP/TRIP, TDP2/TTRAP, TANK/ITRAF, TRAF3IP1, OTUB1, OTUB2, OTUD5, CARD 14,
- TRAF3 is also identified in a complex with TRAF2, MAP3K14 and BIRC3. Upon exposure to bacterial lipopolysaccharide (LPS), TRAF3 is recruited to a transient complex containing TLR4, TRAF3, TRAF6, IKBKG, MAP3K7, MYD88, TICAM1, BIRC2, BIRC3 and UBE2N.
- LPS bacterial lipopolysaccharide
- TRAF3 also interacts (via RING-type zinc finger domain) with SRC and interacts (via MATH domain) with PTPN22, which promotes TRAF3 polyubiquitination.
- TRAF3 functions in multiple pathways, including, at least, activated TLR4 signaling (e.g., MyD88- independent TLR3/TLR4 cascade, TLR3 and TLR4 cascade, etc.), RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways (e.g., RIG-I-like Receptor (RLR) signaling pathways, TRAF3 -dependent IRF activation pathway, etc.), RANK signaling in osteoclasts (e.g., APRIL pathway, BAFF in B-cell signaling, etc.), TNFRl pathway (TWEAK pathway, GITR pathway, etc.), NF- ⁇ signaling, apoptosis and autophagy, etc.
- TRAF3 is suggested to be related to multiple diseases and disorders including, at least,
- the nucleic acid and amino acid sequences of a representative human TRAF3 is available to the public at the GenBank database (Gene ID 7187) and is shown in Table 1 (e.g., NM_145725.2 and NP_663777.1, representing the longest transcript variant 1 and the longest isoform 1, NM_145726.2 and NP_663778.1, representing the transcript variant 2 (lacking an in-frame coding segment compared to variant 1) and the encoded isoform 2 (lacking an internal region compared to isoform 1), NM_003300.3 and NP_003291.2, representing the transcript variant 3 (differing in the 5'UTR compared to variant 1) and the encoded isoform 1 (i.e., having the same sequence as isoform 1), and NM_001199427.1 and NP OOl 186356.1, representing the transcript variant 4 (differing in the 5'UTR and lacking an in-frame coding segment compared to variant 1) and the encoded isoform 3 (lacking an internal
- TRAF3 polypeptide The domain structure of TRAF3 polypeptide is well known and accessible in UniProtKB database under the accession number Q13114, including, in the order from the 5' terminus to the 3' terminus, a RING- type zinc finger domain comprising, e.g., amino acid positions 68-77 of NP 663777.1, two TRAF-type zinc finger domains comprising, e.g., amino acid positions 135-190 and 191- 249 of NP 663777.1, a coiled coil region comprising, e.g., amino acid positions 267-338 of NP 663777.1, and a meprin and TRAF-C homology (MATH) domain comprising, e.g., amino acid positions 415-560 of NP_663777.1.
- MATH meprin and TRAF-C homology
- TRAF3 orthologs in organisms other than humans include, for example, chimpanzee (Pan troglodytes) TRAF3 (XM_016926751.1 and XP_016782240.1, XM_016926752.1 and
- NP 035762.2 representing the transcript variant 1 and the encoded longer isoform a
- NM_001286122.1 and NP_001273051.1 representing the transcript variant 3 (lacking an internal exon in the 5' UTR and an in-frame exon in the coding region, compared to variant 1) and the encoded shorter isoform b (lacking an internal segment, compared to isoform a)
- cattle TRAF3 NM_001205586.1 and NP_001192515.1
- TRAF3 NM_001108724.1 and NP_001102194.1
- chicken TRAF3 (XM_004936344.2 and XP_004936401.1, XM 004936341.2 and XP 004936398.1, XM_015287823.1 and XP_015143309.1, XM_015287819.1 and XP 015143305.1, XM_015287818.1 and
- TRAF3 activity includes the ability of a TRAF3 polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein) to bind its substrate and/or biological activity.
- TRAF3 activity may also include one or more of functions, such as forming E3 ubiquitin-protein ligase complexes, and/or others disclosed herein in the NF-KB pathway and other related pathways.
- TRAF3 may interact with various proteins disclosed herein for its functions in signaling.
- TRAF3 may also be proteolyticly modified, such as being cleaved, ubiquitinated, deubiquitinated, or otherwise disclosed herein, for its functions.
- TRAF3 substrate(s) refers to binding partners of a TRAF3 polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein), e.g., the binding partners described herein of TRAF3 for multiple signal transduction pathways.
- TRAF3 substrates may refer to downstream members in the signaling pathways where TRAF3 has a functional role.
- TRAF 3 -regulated signaling pathway(s) includes signaling pathways in which TRAF3 (and its fragments, domains, and/or motifs thereof, discussed herein) binds to at least one of its substrate, through which at least one cellular function and/or activity and/or cellular protein profiles is changed.
- TRAF 3 -regulated signaling pathways include at least those described herein, such as activated TLR4 signaling (e.g., MyD88-independent TLR3/TLR4 cascade, TLR3 and TLR4 cascade, etc.), RIG-I/MDA5 mediated induction of IFN-alpha eta pathways (e.g., RIG-I-like Receptor (RLR) signaling pathways, TRAF3- dependent IRF activation pathway, etc.), RANK signaling in osteoclasts (e.g., APRIL pathway, BAFF in B-cell signaling, etc.), TNFRl pathway (TWEAK pathway, GITR pathway, etc.), NF- ⁇ signaling, apoptosis and autophagy, etc.
- activated TLR4 signaling e.g., MyD88-independent TLR3/TLR4 cascade, TLR3 and TLR4 cascade, etc.
- TRAF3 inhibitor(s) includes any natural or non-natural agent prepared, synthesized, manufactured, and/or purified by human that is capable of reducing, inhibiting, blocking, preventing, and/or that inhibits the ability of a TRAF3 polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein).
- such inhibitors may reduce or inhibit the binding/interaction between TRAF3 and its substrates or other binding partners.
- such inhibitors may increase or promote the turnover rate, reduce or inhibit the expression and/or the stability (e.g., the half-life), and/or change the cellular localization of TRAF3, resulting in at least a decrease in TRAF3 levels and/or activity.
- Such inhibitors may be any molecule, including but not limited to small molecule compounds, antibodies or intrabodies, RNA interfering (RNAi) agents (including at least siRNAs, shRNAs, microRNAs (miRNAs), piwi, and other well- known agents). Such inhibitors may be specific to TRAF3 or also inhibit at least one of other TRAF family members and T F receptor (T FR) superfamily members.
- RNA interference for TRAF3 polypeptides are well known and commercially available (e.g., human, mouse, or rat shRNA (Cat. # TL502320 and TG300876) and siRNA (Cat. #
- SR304928 and SR417046 products and human or mouse gene knockout kit via CRISPR (Cat. # KN318123 and KN210417) from Origene (Rockville, MD), siRNA/shRNA products (Cat. # sc-29510, sc-36712, and sc-44277) and CRISPR products (Cat. # sc- 423494 and sc-400473) from Santa Cruz Biotechnology (Dallas, Texas), Ready-to-package AAV shRNA clones from Vigene Biosciences (Rockville, MD, Cat. # SH872930 and
- TRAF3 e.g., by anti- TRAF3 antibodies
- Methods for detection, purification, and/or inhibition of TRAF3 are also well known and commercially available (e.g., multiple anti- TRAF3 antibodies from Origene (Cat. # TA322870, TA322871, TA336438, etc.), Cell Signaling Technology (Danvers, MA, Cat. # 4729), abeam (Cambridge, MA, Cat. # ab36988, ab 155298, etc.), and Santa Cruz Biotechnology (Cat. # sc-949, sc-6933, sc-1828, etc.)).
- Human TRAF3 knockout cell lines are also well known and available from Horizon Discovery (Cambridge, UK, Cat. # HZGHC002608c001).
- R F31 also known as RING finger protein 31, HOIL-1 -interacting protein, ZIBRA, and HOIP, refers to a member of a family of proteins containing RING- type zinc fingers, a motif present in a variety of functionally distinct proteins and known to be involved in protein-DNA and protein-protein interactions.
- R F31 is an E3 ubiquitin- protein ligase component of the linear ubiquitin chain assembly complex (LUBAC), which conjugates linear (Met- 1 -linked) polyubiquitin chains to substrates and plays a key role in F-KB activation and regulation of inflammation.
- LUBAC conjugates linear polyubiquitin to IKBKG and RIPK1 and is involved in activation of the canonical F- ⁇ and the J K signaling pathways.
- Linear ubiquitination mediated by the LUBAC complex interferes with T F-induced cell death and thereby prevents inflammation.
- LUBAC is proposed to be recruited to the TNF-R1 signaling complex (TNF-RSC) following polyubiquitination of T F-RSC components by BIRC2 and/or BIRC3 and to conjugate linear polyubiquitin to IKBKG and possibly other components contributing to the stability of the complex.
- TNF-RSC TNF-R1 signaling complex
- R F31 binds polyubiquitin of different linkage types.
- LUBAC comprises SHARPIN, RBCK1 and RNF31, with a molecular weight of about 600 kDa, suggesting a heteromultimeric assembly of its subunits.
- RNF31 associates with the TNF-R1 signaling complex (T F-RSC) in a stimulation-dependent manner.
- RNF31 also interacts (via the PUB domain) with OTULIN (via the PIM motif) and interacts (via the PUB domain) with VCP (via the PIM motif).
- RNF31 also interacts with CYLD and MUSK.
- RNF31 functions in multiple pathways, including, at least, TNF signaling (REACTOME, e.g., death receptor signaling, TNFR1 -induced F- ⁇ pathway), Toll-Like receptor signaling pathways (e.g., NOD-like receptor signaling pathway), ubiquitination cascade pathway, GPCR signaling, etc.
- R F31 is suggested to be related to multiple diseases and disorders including, at least polyglucosan body myopathy 1 with or without immunodeficiency, otulipenia (e.g., autoinflammation, panniculitis and dermatosis syndrome), glycogen storage disease iv (e.g., amylopectinosis), hepatitis c virus infection, etc.
- the nucleic acid and amino acid sequences of a representative human RNF31 is available to the public at the GenBank database (Gene ID 55072) and is shown in Table 1 (e.g., M_017999.4 and P_060469.4, representing the longer transcript variant 1 and the encoded longer isoform 1, and M_001310332.1 and P_001297261.1, representing the shorter transcript variant 2 (using an alternate first exon and an alternate splice site in a 5' exon compared to variant 1, resulting in the use of a downstream translation initiation site) and the encoded shorter isoform 2 (having a distinct N-terminus)).
- GenBank database Gene ID 55072
- Table 1 e.g., M_017999.4 and P_060469.4, representing the longer transcript variant 1 and the encoded longer isoform 1, and M_001310332.1 and P_001297261.1, representing the shorter transcript variant 2 (using an alternate first exon and an alternate splice site in a 5
- R F31 polypeptide is well known and accessible in UniProtKB database under the accession number Q9UHD2, including, in the order from the 5' terminus to the 3' terminus, a PNGase/UBA or UBX (PUB) domain comprising, e.g., amino acid positions 71-142 of P 060469.4, and a UBA domain comprising, e.g., amino acid positions 564-615 of P 060469.4.
- PNGase/UBA or UBX (PUB) domain comprising, e.g., amino acid positions 71-142 of P 060469.4
- UBA domain comprising, e.g., amino acid positions 564-615 of P 060469.4.
- regions include, for example, a polyubiquitin-binding region comprising, e.g., amino acid positions 1-485 of P 060469.4, a region interacting with RBCKl comprising, e.g., amino acid positions 563-616 of NP 060469.4, and an linear ubiquitin chain determining domain (LDD) region comprising, e.g., amino acid positions 910-1072 of P 060469.4.
- a polyubiquitin-binding region comprising, e.g., amino acid positions 1-485 of P 060469.4
- RBCKl comprising, e.g., amino acid positions 563-616 of NP 060469.4
- LDD linear ubiquitin chain determining domain
- Multiple zinc finger domains on R F31 include three RanBP2- type zinc finger domains comprising, e.g., amino acid positions 299-329, 350-379, and 409- 438 of P 060469.4, one RING-type zinc finger comprising, e.g., amino acid positions 699-747 of P 060469.4, one IBR-type zinc finger comprising, e.g., amino acid positions 779-841 of P 060469.4, and another RING-type zinc finger comprising, e.g., amino acid positions 860-909 of NP 060469.4.
- the PUB domain of RNF31 mediates interaction with the PIM motifs of VCP and RNF31 , with a strong preference for RNF31.
- the RanBP2- type zinc fingers mediate the specific interaction with ubiquitin.
- the UBA domain mediates association with RBCKl/HOILl via interaction with its UBL domain.
- RING 1 and IBR zinc-fingers catalyze the first step transfer of ubiquitin from the E2 onto RING 2, to transiently form a HECT-like covalent thioester intermediate (Smit et al. (2012) EMBO J. 31 :3833-3844).
- the LDD domain mediates the final transfer of ubiquitin from RING 2 onto the N-terminus of a target ubiquitin.
- RNF31 orthologs in organisms other than humans include, for example, chimpanzee ⁇ Pan troglodytes) RNF31 (XM OO 1166671.4 and XP_001166671.2, XM_009427566.2 and
- XP_009425841.2 and XM_009427568.2 and XP_009425843.2
- Rhesus monkey RNF31 (XM_001112195.3 and XP_001112195.1, and XM_015143429.1 and XP_014998915.1)
- dog RNF31 (XM_005623255.2 and XP_005623312.1, XM_005623256.2 and
- XP_005623314.1 mouse RNF31 (NM_194346.2 and NP_919327.2), Norway rat (Rattus norvegicus) RNF31 (NM_001108868.1 and NP_001102338.2), and tropical clawed frog (Xenopus tropicalis) KNF31 (NM_001097175.1 and NP_001090644.1).
- RNF31 activity includes the ability of a RNF31 polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein) to bind its substrate and/or biological activity.
- RNF31 activity may also include one or more of functions, such as its E3 ubiquitin ligase activity, and/or others disclosed herein in the NF- ⁇ pathway and other related pathways.
- RNF31 may interact with various proteins (e.g., its ubiquitination substrates) disclosed herein for its functions in signaling.
- RNF31 may also be proteolyticly modified, such as being cleaved, ubiquitinated, deubiquitinated, or otherwise disclosed herein, for it functions.
- RNF31 substrate(s) refers to binding partners of a RNF31 polypeptide
- RNF31 substrates may refer to downstream members in the signaling pathways where RNF31 has a functional role.
- RNF31 -regulated signaling pathway(s) includes signaling pathways in which RNF31 (and its fragments, domains, and/or motifs thereof, discussed herein) binds to at least one of its substrate, through which at least one cellular function and/or activity and/or cellular protein profiles is changed.
- RNF31 is an E3 ubiquitin ligase and promotes ubiquitination of its substrates.
- RNF 31 -regulated signaling pathways include at least those described herein, such as TNF signaling (REACTOME, e.g., death receptor signaling, T FR1 -induced F- ⁇ pathway), Toll-Like receptor signaling pathways (e.g., NOD-like receptor signaling pathway), ubiquitination cascade pathway, GPCR signaling, etc.
- R F31 is suggested to be related to multiple diseases and disorders including, at least polyglucosan body myopathy 1 with or without
- otulipenia e.g., autoinflammation, panniculitis and dermatosis syndrome
- glycogen storage disease iv e.g., amylopectinosis
- hepatitis c virus infection etc.
- RNF31 inhibitor(s) includes any natural or non-natural agent prepared, synthesized, manufactured, and/or purified by human that is capable of reducing, inhibiting, blocking, preventing, and/or that inhibits the ability of a R F31 polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein). In one embodiment, such inhibitors may reduce or inhibit the binding/interaction between RNF31 and its substrates or other binding partners. In another embodiment, such inhibitors may reduce or inhibit the catalytic function of RNF31 as an E3 ubiquitin ligase.
- such inhibitors may increase or promote the turnover rate, reduce or inhibit the expression and/or the stability (e.g., the half-life), and/or change the cellular localization of R F31, resulting in at least a decrease in R F31 levels and/or activity (e.g., its E3 ubiquitin ligase activity).
- Such inhibitors may be any molecule, including but not limited to small molecule compounds, antibodies or intrabodies, RNA interfering (RNAi) agents (including at least siRNAs, shRNAs, microRNAs (miRNAs), piwi, and other well-known agents).
- RNAi RNA interfering
- Such inhibitors may be specific to R F31 or also inhibit at least one of other E3 ubiquitin ligases.
- RNA interference for RNF31 polypeptides are well known and commercially available (e.g., human, mouse, or rat shRNA (Cat. # TF320708, TF508054, TF707395, etc.) and siRNA (Cat. # SR421932 and SR310467) products and human or mouse gene knockout kit via CRISPR (Cat. # KN314948 and KN2041 17) from Origene (Rockville, MD), siRNA/shRNA products (Cat. # sc-92101 and sc-153046) and CRISPR products (Cat. # sc- 435274 and sc-412436) from Santa Cruz Biotechnology (Dallas, Texas), Ready-to-package AAV shRNA clones from Vigene Biosciences (Rockville, MD, Cat. # SH898682).
- CRISPR Cat. # KN314948 and KN2041 17
- siRNA/shRNA products Cat. # sc-92101 and sc-153046
- RNF31 e.g., by anti-RNF31 antibodies
- anti-RNF31 antibodies from Origene (Cat. # TA329873 and TA302821), R&D System (Minneapolis, MN, Cat. # MAB8039 and AF8039), abeam (Cambridge, MA, Cat. # ab40676, ab l09735, ab l21 16, etc.), and Novus Biologicals (Littleton, CO; Cat. # AF8039, MAB8039, BP2-27290, etc.)).
- Human R F31 knockout cell lines are also well known and available from Horizon Discovery (Cambridge, UK, Cat. # HZGHC004529c01 1).
- RBCKl also known as RanBP2-type and C3HC4-type zinc finger- containing protein 1, Hepatitis B Virus X- Associated Protein 4, RING Finger Protein 54, HOIL-1, and R F54, refers to a member of a family of proteins containing multiple types of zinc fingers, a motif present in a variety of functionally distinct proteins and known to be involved in protein-DNA and protein-protein interactions.
- RBCKl is also an E3 ubiquitin-protein ligase component of the linear ubiquitin chain assembly complex (LUBAC), which conjugates linear (Met- 1 -linked) polyubiquitin chains to substrates and plays a key role in NF- ⁇ activation and regulation of inflammation.
- LUBAC linear ubiquitin chain assembly complex
- Linear ubiquitination mediated by the LUBAC complex interferes with TNF -induced cell death and thereby prevents inflammation.
- LUBAC is proposed to be recruited to the TNF-R1 signaling complex (TNF-RSC) following polyubiquitination of TNF-RSC components by BIRC2 and/or BIRC3 and to conjugate linear polyubiquitin to IKBKG and possibly other components contributing to the stability of the complex.
- TNF-RSC TNF-R1 signaling complex
- the LUBAC complex regulates the canonical Wnt signaling during angiogenesis.
- LUBAC comprises SHARPEST, RBCKl and RNF31, with a molecular weight of about 600 kDa, suggesting a heteromultimeric assembly of its subunits.
- RBCKl promotes ubiquitination of oxidized IREB2, which requires both heme and oxygen.
- RBCKl also promotes ubiquitination of TAB2 and IRF3 and their degradation by the proteasome.
- RBCKl interacts with beta-I-type (PRKCB l), zeta-type protein kinase C (PRKCZ), UBE2L3, PRKCH, EYA1, TAB2, TAB3, MAP3K7, TRAF6, RIPK1, and IRF3.
- RBCKl interacts with the HBV pX/HBx protein, which is required to activate transcription of the viral genome.
- RBCKl associates with the TNF-Rl signaling complex (TNF-RSC) in a stimulation-dependent manner.
- TNF-RSC TNF-Rl signaling complex
- RBCKl functions in multiple pathways, including, at least, TNF signaling (REACTOME, e.g., death receptor signaling, TNFRl -induced NF- ⁇ pathway), Toll-Like receptor signaling pathways (e.g., NOD-like receptor signaling pathway), GPCR signaling, class I MHC mediated antigen processing and presentation (e.g., antigen processing through ubiquitination and proteasome degradation), adaptive immune system, etc.
- RBCKl is suggested to be related to multiple diseases and disorders including, at least, polyglucosan body myopathy 1 with or without immunodeficiency, branchiootic syndrome, and glycogen storage disease iv (e.g., amylopectinosis), etc.
- nucleic acid and amino acid sequences of a representative human RBCK1 is available to the public at the GenBank database (Gene ID 10616) and is shown in Table 1 (e.g., NM_006462.5 and NP_006453.1, representing transcript variant 1 and the encoded isoform 1, NM_031229.3 and NP_112506.2, representing transcript variant 2 and the encoded longest isoform 2, NM_001323956.1 and NP_001310885.1, representing transcript variant 3 and the encoded isoform 3, NM_001323958.1 and NP_001310887.1, representing transcript variant 4 and the encoded isoform 3, and NM_001323960.1 and
- NP 001310889.1 representing transcript variant 5 and the encoded isoform 4).
- the domain structure of RBCK1 polypeptide is well known and accessible in UniProtKB database under the accession number Q9BYM8, including, in the order from the 5' terminus to the 3' terminus, a ubiquitin-like (UBL) domain comprising, e.g., amino acid positions 55-119 of NP_112506.2, and a coiled coil domain comprising, e.g., amino acid positions 233-261 of NP l 12506.2.
- a region for RBCK1 interacting with TAB2 comprises, e.g., amino acid positions 1-270 of NP l 12506.2.
- a region for RBCK1 interacting with IRF3 comprises, e.g., amino acid positions 1-220 of NP_112506.2.
- a region for RBCK1 interacting with RNF31 comprises, e.g., amino acid positions 69-131 of NP l 12506.2.
- Multiple zinc finger domains on RBCK1 include one RanBP2-type zinc finger comprising, e.g., amino acid positions 193-222 of NP_112506.2, two RING-type zinc fingers comprising, e.g., amino acid positions 282-327 and 437-463 of NP_112506.2, and one IBR-type zinc finger comprising, e.g., amino acid positions 362-411 of
- the RanBP2-type zinc finger also called Npl4 zinc finger (NZF)
- NZF Npl4 zinc finger
- the UBL domain mediates association with RNF31 via interaction with its UBA domain (Ikeda et al. (2011) Nature 471 : 637-641).
- Nucleic acid and polypeptide sequences of RBCKl orthologs in organisms other than humans are well-known and include, for example, chimpanzee (Pan troglodytes) RBCKl (XM_001152050.5 and XP 001152050.1, XM_016937253.1 and
- XP_016792743.1, XM_016937252.1 and XP_016792741.1, and XM_016937255.1 and XP_016792744.1 Rhesus monkey RBCKl (NM_001266297.1 and NP_001253226.1), dog RBCKl (XM_542942.5 and XP_542942.4), mouse RBCKl (NM_001083921.1 and ⁇ _001077390.1, representing the longer transcript variant 1 and the encoded protein, and M_019705.3 and P_062679.2, representing the shorter transcript variant 2 (differing in the 5' UTR compared to variant 1) and the encoded same protein), cattle RBCKl
- RBCKl activity includes the ability of a RBCKl polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein) to bind its substrate and/or biological activity.
- RBCKl activity may also include one or more of functions, such as its E3 ubiquitin ligase activity, and/or others disclosed herein in the NF- ⁇ pathway and other related pathways.
- RBCKl may interact with various proteins ⁇ e.g., its ubiquitination substrates) disclosed herein for its functions in signaling.
- RBCKl may also be proteolyticly modified, such as being cleaved, ubiquitinated, deubiquitinated, or otherwise disclosed herein, for it functions.
- RBCKl substrate(s) refers to binding partners of a RBCKl polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein), e.g., the substrates described herein of RBCKl as an E3 ubiquitin ligase. Furthermore, RBCKl substrates may refer to downstream members in the signaling pathways where RBCKl has a functional role.
- RBCKl -regulated signaling pathway(s) includes signaling pathways in which RBCKl (and its fragments, domains, and/or motifs thereof, discussed herein) binds to at least one of its substrate, through which at least one cellular function and/or activity and/or cellular protein profiles is changed.
- RBCKl is an E3 ubiquitin ligase and promotes ubiquitination of its substrates.
- RBCKl -regulated signaling pathways include at least those described herein, such as TNF signaling (REACTOME, e.g., death receptor signaling, TNFR1 -induced NF- ⁇ pathway), Toll-Like receptor signaling pathways ⁇ e.g., NOD-like receptor signaling pathway), GPCR signaling, class I MHC mediated antigen processing and presentation ⁇ e.g., antigen processing through ubiquitination and proteasome degradation), adaptive immune system, etc.
- TNF signaling e.g., death receptor signaling, TNFR1 -induced NF- ⁇ pathway
- Toll-Like receptor signaling pathways ⁇ e.g., NOD-like receptor signaling pathway
- GPCR signaling class I MHC mediated antigen processing and presentation ⁇ e.g., antigen processing through ubiquitination and proteasome degradation
- adaptive immune system etc.
- RBCKl inhibitor(s) includes any natural or non-natural agent prepared, synthesized, manufactured, and/or purified by human that is capable of reducing, inhibiting, blocking, preventing, and/or that inhibits the ability of a RBCK1 polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein). In one embodiment, such inhibitors may reduce or inhibit the binding/interaction between RBCK1 and its substrates or other binding partners. In another embodiment, such inhibitors may reduce or inhibit the catalytic function of RBCK1 as an E3 ubiquitin ligase.
- inhibitors may increase or promote the turnover rate, reduce or inhibit the expression and/or the stability (e.g., the half-life), and/or change the cellular localization of RBCK1, resulting in at least a decrease in RBCK1 levels and/or activity (e.g., its E3 ubiquitin ligase activity).
- Such inhibitors may be any molecule, including but not limited to small molecule compounds, antibodies or intrabodies, RNA interfering (RNAi) agents (including at least siRNAs, shRNAs, microRNAs (miRNAs), piwi, and other well-known agents).
- RNAi RNA interfering
- Such inhibitors may be specific to RBCKl or also inhibit at least one of other E3 ubiquitin ligases.
- RNA interference for RBCKl polypeptides are well known and commercially available (e.g., human, mouse, or rat shRNA (Cat. # TR309920, TF502567, TF710513, etc.) and siRNA (Cat. # SR307231, SR416003, and SR503965) products and human or mouse gene knockout kit via CRISPR (Cat. # KN203906 and KN314537) from Origene (Rockville, MD), siRNA/shRNA products (Cat. # sc-61446 and sc-61447) and CRISPR products (Cat.
- RBCKl (e.g., by anti-RBCKl antibodies) are also well known and commercially available (e.g., anti-RBCKl antibodies from Origene (Cat. # API 1958PU-N), abeam (Cambridge, MA, Cat. # ab38540, ab219955, abl08479, etc.), Novus Biologicals (Littleton, CO; Cat. # NBP1-88301, H00010616-M01, NBP2-59048, etc.), and Santa Cruz Biotechnology (sc- 365523, sc-367525, sc-49718, etc.)).
- Human RBCKl knockout cell lines are also well known and available from Horizon Discovery (Cambridge, UK, Cat. # HZGHC10616).
- OTU Orthogonal Tumor domain-containing deubiquitinase with linear linkage specificity, ubiquitin thioesterase, Gumby, AIPDS, GUM, and FAM105B
- OTULIN specifically recognizes and removes Ml(Metl)-linked, or linear, ubiquitin chains from protein substrates, while linear ubiquitin chains are known to regulate the NF-kappa B signaling pathway in the context of immunity and inflammation. Mutations in Otulin cause a potentially fatal autoinflammatory syndrome in human patients.
- OTULIN acts as a regulator of angiogenesis and innate immune response. OTULIN also facilitates thiol-dependent hydrolysis of ester, thioester, amide, peptide and isopeptide bonds formed by the C-terminal Gly of ubiquitin (Mevissen et al. (2013) Cell 154: 169-184). OTULIN associates with the LUBAC complex via direct interaction with RNF31 and counteracts its action by cleaving linear polyubiquitin chains to substrates (Keusekotten et al. (2013) Cell 153 : 1312-1326).
- OTULIN acts as a negative regulator of NF- ⁇ by counteracting activity of the LUBAC complex and maintaining homeostasis of the LUBAC complex by restricting autoubiquination of the LUBAC complex subunit RNF31.
- OTULIN is required during angiogenesis, craniofacial and neuronal development by regulating the canonical Wnt signaling together with the LUBAC complex.
- OTULIN acts as a key negative regulator of inflammation by restricting spontaneous inflammation and maintaining immune homeostasis.
- OTULIN is required to prevent unwarranted secretion of cytokines leading to inflammation and autoimmunity by restricting linear polyubiquitin formation.
- OTULIN plays a key role in innate immune response by restricting linear polyubiquitin formation on RIPK2 in response to NOD2 stimulation, probably to limit NOD2-dependent proinflammatory signaling.
- OTULIN interacts with RNF31 (through the PFM motif of OTULIN and the PUB domain of RNF31), segment polarity protein disheveled homolog DVL2, transmembrane protein 239, protein FAM168A, Matrix protein 2, OTU domain-containing protein 1, OTU domain-containing protein 7B, and DAZ- associated protein 2 (Damgaard et al. (2016) Cell 166: 1215-1230).
- OTULIN functions in multiple pathways, including, at least, TNF signaling (REACTOME, e.g., death receptor signaling, TNFRl signaling), NF- ⁇ pathway, ubiquitination cascade pathway, metabolism of proteins ⁇ e.g., post-translational protein modification), GPCR signaling, etc.
- OTULIN is suggested to be related to multiple diseases and disorders including, at least, otulipenia ⁇ e.g., autoinflammation, panniculitis and dermatosis syndrome (AIPDS)), and panniculitis, etc.
- OTULIN The nucleic acid and amino acid sequences of a representative human OTULIN is available to the public at the GenBank database (Gene ID 90268) and is shown in Table 1 ⁇ e.g., NM_138348.5 and NP_612357.4).
- the domain structure of OTULIN polypeptide is well known and accessible in UniProtKB database under the accession number Q96BN8, including, an OTU-like cysteine protease domain comprising, e.g., amino acid positions 1 18-346 of P 612357.4.
- OTULIN comprises multiple linear diubiquitin binding motifs comprising, e.g., amino acid positions 95-96, 124-126, 255-259, 283-289, and 336-338 of P_612357.4.
- a PIM motif locates at, e.g., amino acid positions 52-57 of P 612357.4, responsible for binding to the PUB domain of RNF31 (Schaeffer et al.
- OTULIN orthologs in organisms other than humans include, for example, chimpanzee ⁇ Pan troglodytes) OTULIN (XM_009448807.2 and XP_009447082.2, and XM_517640.6 and XP_517640.3), Rhesus monkey OTULIN (NM_001 193800.1 and NP_001 180729.1), dog OTULIN
- OTULIN activity includes the ability of an OTULIN polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein) to bind its substrate and/or biological activity.
- OTULIN activity may also include one or more of functions, such as its deubiquitinase activity, and/or others disclosed herein in the NF- ⁇ pathway and other related pathways.
- OTULIN may interact with various proteins (e.g., its deubiquitination substrates) disclosed herein for its functions in signaling.
- OTULIN may also be proteolyticly modified, such as being cleaved, ubiquitinated, deubiquitinated, acetylated, phosphorylated, or otherwise disclosed herein, for it functions.
- OTULIN substrate(s) refers to binding partners of an OTULIN polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein), e.g., the substrates described herein of OTULIN as a deubiquitinase. Furthermore, OTULIN substrates may refer to downstream members in the signaling pathways where OTULIN has a functional role.
- OTULIN binds to at least one of its substrate, through which at least one cellular function and/or activity and/or cellular protein profiles is changed.
- OTULIN is a signaling pathway in which OTULIN (and its fragments, domains, and/or motifs thereof, discussed herein) binds to at least one of its substrate, through which at least one cellular function and/or activity and/or cellular protein profiles is changed.
- OTULIN is a
- OTULIN-regulated signaling pathways include at least those described herein, such as TNF signaling (REACTOME, e.g., death receptor signaling, TNFRl signaling), NF- ⁇ pathway, ubiquitination cascade pathway, metabolism of proteins (e.g., post-translational protein modification), GPCR signaling, etc.
- TNF signaling e.g., death receptor signaling, TNFRl signaling
- NF- ⁇ pathway e.g., NF- ⁇ pathway
- ubiquitination cascade pathway e.g., metabolism of proteins (e.g., post-translational protein modification), GPCR signaling, etc.
- OTULIN inhibitor(s) includes any natural or non-natural agent prepared, synthesized, manufactured, and/or purified by human that is capable of reducing, inhibiting, blocking, preventing, and/or that inhibits the ability of an OTULIN polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein). In one embodiment, such inhibitors may reduce or inhibit the binding/interaction between OTULIN and its substrates or other binding partners. In another embodiment, such inhibitors may reduce or inhibit the catalytic function of OTULIN as a deubiquitinase.
- such inhibitors may increase or promote the turnover rate, reduce or inhibit the expression and/or the stability (e.g., the half-life), and/or change the cellular localization of OTULIN, resulting in at least a decrease in OTULIN levels and/or activity(e.g-., its deubiquitinase activity).
- Such inhibitors may be any molecule, including but not limited to small molecule compounds, antibodies or intrabodies, RNA interfering (RNAi) agents (including at least siRNAs, shRNAs, microRNAs (miRNAs), piwi, and other well-known agents).
- RNAi RNA interfering
- Such inhibitors may be specific to OTULIN or also inhibit at least one of other deubiquitinase.
- RNA interference for OTULIN polypeptides are well known and commercially available (e.g., human or mouse shRNA (Cat. # TL304698 and TG517394) and siRNA (Cat. # SR313974 and SR405655) products and human or mouse gene knockout kit via CRISPR (Cat. # KN312688 and KN224840) from Origene (Rockville, MD, siRNA/shRNA products (Cat. # sc-91772 and sc-141659) and CRISPR products (Cat. # sc-407676 and sc-436617) from Santa Cruz Biotechnology (Dallas, Texas), Ready-to-package AAV shRNA clones from Vigene Biosciences (Rockville, MD, Cat.
- OTULIN OTULIN
- Anti-OTULIN antibodies e.g., by anti-OTULIN antibodies
- Methods for detection, purification, and/or inhibition of OTULIN are also well known and commercially available (e.g., anti-OTULIN antibodies from Origene (Cat. # TA335406), abeam (Cambridge, MA, Cat. # ab l 51 1 17, ab l 14137, ab l 82598, etc.), Novus Biologicals (Littleton, CO; Cat. # NBP2-14722, etc.), and Cell Signaling Technology
- TRAF6 also known as TNF receptor-associated factor 6, RNF85, and Interleukin-1 signal transducer, refers to a member of the TNF receptor associated factor (TRAF) protein family.
- TRAF proteins associate with, and mediate the signal transduction from, members of the TNF receptor (TNFR) superfamily.
- TRAF6 participates in the signal from members of the TNFR superfamily as well as the Toll/IL-1 family, such as CD40, TNFSF 1 1/RANCE and IL-1.
- TRAF6 interacts with various protein kinases including IRAKI/IRAK, SRC, and PKCzeta, which provides a link between distinct signaling pathways.
- TRAF6 functions as a signal transducer in the NF- ⁇ pathway that activates ⁇ kinase (IKK) in response to proinflammatory cytokines.
- IKK ⁇ kinase
- UBE2N/UBC 13 and UBE2V1/UEV1A which are ubiquitin conjugating enzymes catalyzing the formation of polyubiquitin chains, has been found to be required for IKK activation.
- TRAF6 also interacts with the transforming growth factor (TGF) beta receptor complex and is required for Smad-independent activation of the INK and p38 kinases.
- TGF transforming growth factor
- TRAF6 has an amino terminal RING domain which is followed by four zinc-finger motifs, a central coiled-coil region and a highly conserved carboxyl terminal domain, known as the TRAF-C domain. Two alternatively spliced transcript variants, encoding an identical protein, have been reported.
- TRAF6 is an E3 ubiquitin ligase that, together with UBE2N and UBE2V1, mediates the synthesis of Lys-63-linked-polyubiquitin chains conjugated to proteins, such as IKBKG, IRAKI, AKTl and AKT2. TRAF6 also mediates ubiquitination of free/unanchored polyubiquitin chain that leads to MAP3K7 activation.
- TRAF6 leads to the activation of NF-kappa-B and JUN and may be essential for the formation of functional osteoclasts.
- TRAF6 seems to also play a role in dendritic cells (DCs) maturation and/or activation.
- DCs dendritic cells
- TRAF6 represses c-Myb-mediated transactivation in B-lymphocytes.
- TRAF6 is an adapter protein that seems to play a role in signal transduction initiated via TNF receptor, IL-1 receptor and IL-17 receptor.
- TRAF6 regulates osteoclast differentiation by mediating the activation of adapter protein complex 1 (AP-1) and F- ⁇ , in response to RANK-L stimulation.
- AP-1 adapter protein complex 1
- F- ⁇ F- ⁇
- TRAF6 mediates CD40 signals that activate ERK in B-cells and macrophages, and thus may play a role in the regulation of immunoglobulin production.
- TRAF6 can form homotrimers and homooligomers.
- the N- terminal region of TRAF6 is dimeric, while the C-terminal region is trimeric.
- TRAF6 forms a complex with PELI1 , IRAK 1 , IRAK4 and MYD88, which then recruits MAP3K7/TAK1, TAB l and TAB 2 to mediate F- ⁇ activation.
- Direct binding of SMAD6 to PELI1 prevents the complex formation and hence negatively regulates IL1R- TLR signaling and eventually F-KB-mediated gene expression.
- TRAF6 binds to
- TRAF6 also interacts with IL17R, SQSTM1 bridging NTRK1 and NGFR and forms a ternary complex with SQSTM1 and PRKCZ.
- TRAF 6 further interacts with PELI2 and PELI3 and binds UBE2V1, TAX1BP1, ZNF675, ARRB 1, ARRB2, MAP3K7, and TAB 1/MAP3K7IP1 during IL-1 signaling.
- TRAF 6 also interacts with UBE2N, TGFBR1, HDAC1, RANGAPl, AKT1, AKT2, and AKT3, NUMBL,
- TRAF6 functions in multiple pathways, including, at least, activated TLR4 signaling (e.g., MyD88-independent TLR3/TLR4 cascade, TLR2, TLR3, TLR4, TLR 7/8, TLR 9, and TLR10 cascade, MAP kinase activation in TLR cascade, JNK (c-Jun kinases) phosphorylation and activation mediated by activated human TAKl, etc.), Toll comparative pathway (e.g., TLR-TRIF pathway, IL-1 pathway, and iNOS signaling), RANK signaling in osteoclasts (e.g., APRIL pathway, BAFF in B-cell signaling, etc.), and p75 NTR receptor-mediated signaling (e.g., cell death signaling via NRAGE, NRIF and NADE, NRIF signals cell death from the nucleus, NF- ⁇ activation, etc.).
- activated TLR4 signaling e.g., MyD88-independent TLR
- TRAF6 is suggested to be related to multiple diseases and disorders including, at least, ectodermal dysplasia 10a, hypohidrotic/hair/nail type, autosomal dominant, incontinentia pigmenti (e.g., bloch-sulzberger syndrome, bloch-siemens syndrome, etc.),
- immunodeficiency with hyper-igm type 3 (e.g., CD40 deficiency, hyper igm syndrome 3, etc.), toxoplasmosis, ectodermal dysplasia 10b, hypohidrotic/hair/tooth type, autosomal recessive (e.g., x-linked hypohidrotic ectodermal dysplasia), etc.
- type 3 e.g., CD40 deficiency, hyper igm syndrome 3, etc.
- toxoplasmosis ectodermal dysplasia 10b
- hypohidrotic/hair/tooth type e.g., hypohidrotic/hair/tooth type
- autosomal recessive e.g., x-linked hypohidrotic ectodermal dysplasia
- the nucleic acid and amino acid sequences of a representative human TRAF6 is available to the public at the GenBank database (Gene ID 7189) and is shown in Table 1 (e.g., NM_145803.2 and NP_665802.1, representing the longest transcript variant 1 and the encoded protein, and NM_004620.3 and NP_004611.1, representing the shorter transcript variant 2 (lacking a segment in the 5' UTR, compared to variant 1) and the encoded same protein).
- TRAF6 polypeptide The domain structure of TRAF6 polypeptide is well known and accessible in UniProtKB database under the accession number Q9Y4K3, including, in the order from the 5' terminus to the 3' terminus, a RING-type zinc finger domain comprising, e.g., amino acid positions 70-109 of NP 665802.1, two TRAF-type zinc finger domains comprising, e.g., amino acid positions 150-202 and 203-259 of NP_665802.1, a coiled coil region comprising, e.g., amino acid positions 288-348 of NP 665802.1, and a meprin and TRAF-C homology (MATH) domain comprising, e.g., amino acid positions 350-499 of
- the N-terminal fragment of TRAF6 (comprising, e.g., amino acid positions 1-354 of NP 665802.1) is capable of interacting with TAX1BP1 and the C-terminal fragment (comprising, e.g., amino acid positions 355-522 of NP_665802.1) is capable of interacting with TANK.
- TRAF6 orthologs in organisms other than humans include, for example, chimpanzee (Pan troglodytes) TRAF6 (XM_001154136.5 and XP_001154136.1, and XM_016920687.1 and
- XP_016776176.1 Rhesus monkey TRAF6 (NM_001135796.1 and NP_001129268.1 ), dog TRAF6 (XM_003432322.3 and XP_003432370.1), mouse TRAF6 (NM_009424.3 and NP 033450.2, representing the longer transcript variant 1 and the encoded protein, and NM_001303273.1 and NP_001290202.1, representing the shorter transcript variant 2 (lacking an exon in the 5' UTR, compared to variant 1) and the encoded same protein), cattle TRAF6 (NM_001034661.2 and NP_001029833.1), Norway rat (Rattus norvegicus) TRAF6 (NM_001107754.2 and NP_001101224.1), chicken TRAF6 (XM_004941548.2 and XP_004941605.1, XM_004941547.2 and XP 004941604.1, XM_004941546.2 and
- TRAF6 activity includes the ability of a TRAF6 polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein) to bind its substrate and/or biological activity.
- TRAF6 activity may also include one or more of functions, such as E3 ubiquitin-protein ligase activity, and/or others disclosed herein in the F- ⁇ pathway and other related pathways.
- TRAF6 may interact with various proteins disclosed herein for its functions in signaling.
- TRAF6 may also be proteolyticly modified, such as being cleaved, ubiquitinated, deubiquitinated, acetylated, phosphorylated, or otherwise disclosed herein, for its functions.
- TRAF6 substrate(s) refers to binding partners of a TRAF6 polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein), e.g., the binding partners described herein of TRAF6 for multiple signal transduction pathways.
- TRAF6 substrates may refer to downstream members in the signaling pathways where TRAF6 has a functional role.
- TRAF6-regulated signaling pathway(s) includes signaling pathways in which TRAF6 (and its fragments, domains, and/or motifs thereof, discussed herein) binds to at least one of its substrate, through which at least one cellular function and/or activity and/or cellular protein profiles is changed.
- TRAF6-regulated signaling pathways include at least those described herein, such as activated TLR4 signaling ⁇ e.g., MyD88-independent TLR3/TLR4 cascade, TLR2, TLR3, TLR4, TLR 7/8, TLR 9, and TLR10 cascade, MAP kinase activation in TLR cascade, INK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1, etc.), Toll comparative pathway ⁇ e.g., TLR-TRIF pathway, IL-1 pathway, and iNOS signaling), RANK signaling in osteoclasts ⁇ e.g., APRIL pathway, BAFF in B-cell signaling, etc.), and p75 NTR receptor-mediated signaling ⁇ e.g., cell death signaling via NRAGE, NRIF and NADE, NRIF signals cell death from the nucleus, NF- ⁇ activation, etc.).
- activated TLR4 signaling ⁇ e.g.
- TRAF6 inhibitor(s) includes any natural or non-natural agent prepared, synthesized, manufactured, and/or purified by human that is capable of reducing, inhibiting, blocking, preventing, and/or that inhibits the ability of a TRAF6 polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein).
- such inhibitors may reduce or inhibit the binding/interaction between TRAF6 and its substrates or other binding partners.
- such inhibitors may increase or promote the turnover rate, reduce or inhibit the expression and/or the stability (e.g., the half-life), and/or change the cellular localization of TRAF6, resulting in at least a decrease in TRAF6 levels and/or activity.
- Such inhibitors may be any molecule, including but not limited to small molecule compounds, antibodies or intrabodies, RNA interfering (RNAi) agents (including at least siRNAs, shRNAs, microRNAs (miRNAs), piwi, and other well- known agents). Such inhibitors may be specific to TRAF6 or also inhibit at least one of other TRAF family members and TNF receptor (T FR) superfamily members or related ubiquitin ligases.
- RNA interference for TRAF6 polypeptides are well known and commercially available (e.g., human, mouse, or rat shRNA (Cat. # TG515356, TF300871, and TF706303) and siRNA (Cat.
- CRISPR Cat. # KN206042 and KN318129
- siRNA/shRNA products Cat. # sc-36717, sc-44329, sc-36718, etc.
- CRISPR products Cat. # sc-423497) from Santa Cruz Biotechnology (Dallas, Texas), Ready-to-package AAV shRNA clones from Vigene Biosciences (Rockville, MD, Cat. # SH874771).
- TRAF6 e.g., by anti-TRAF6 antibodies
- Methods for detection, purification, and/or inhibition of TRAF6 are also well known and commercially available (e.g., multiple anti-TRAF6 antibodies from Origene (Cat. # TA321662, TA352399, AM26628AF-N, etc.), Cell Signaling Technology (Danvers, MA, Cat. # 8028), abeam (Cambridge, MA, Cat. # ab33915, ab94720, etc.), and Santa Cruz Biotechnology (Cat. # sc-33897, sc-8409, sc- 33895, etc.)).
- Human TRAF6 knockout cell lines are also well known and available from Horizon Discovery (Cambridge, UK, Cat. # HZGHC003466c008).
- TEB2 also known as TGF-Beta Activated Kinase 1/MAP3K7 Binding
- MAP3K7IP2 refers to a member of a family of activators of MAP3K7/TAK1, which is required for the IL-1 induced activation of NF- ⁇ and MAPK8/JNK.
- TAB2 forms a kinase complex with TRAF6, MAP3K7 and TAB l, thus serving as an adaptor that links MAP3K7 and TRAF6.
- TAB2 along with TAB l and MAP3K7, also participates in the signal transduction induced by TNFSF l 1/RANKL through the activation of the receptor activator of NF- ⁇ (TNFRSF l 1 A/RANK), which may regulate the development and function of osteoclasts.
- TNFRSF l 1 A/RANK receptor activator of NF- ⁇
- Studies of the related mouse protein indicate that TAB2 functions to protect against liver damage caused by chemical stressors. Mutations in Tab2 cause congenital heart defects, multiple types, 2 (CHTD2) (Thienpont et al. (2010) Am J Hum Genet. 86:839-849).
- TAB2 binds to Lys-63-linked polyubiquitin chains and promotes autophosphorylation of MAP3K7 at Thr-187.
- TAB 2 also interacts with NCOR1 and HDAC3 to form a ternary complex and interacts (via C-terminal) with NUMBL (via PTB domain) and with WDR34 (via WD domains).
- TAB2 has been shown to interact with RBCK1, TRAF6, TRFM5, HDAC3, MAP3K7IP1, MAP3K7IP3, MAP3K7, FKB1, NUMBL, Nuclear receptor co-repressor 1, and TRAF2 (Baek et al. (2002) Cell 110:55-67; Li et al. (2009) Mol. Cell 33 :30-42).
- TAB2 functions in multiple pathways, including, at least, activated TLR4 signaling (e.g., MyD88-independent TLR3/TLR4 cascade, TLR2, TLR3, TLR4, TLR 7/8, TLR 9, and TLR 10 cascade, MAP kinase activation in TLR cascade, JNK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1, etc.), Toll-like receptor signaling pathway (e.g., NOD-like receptor signaling pathways, IL-1 family signaling pathways, Mucin expression in CF via TLRs, EGFR signaling pathways, etc.), TRAF pathway, bacterial infections in CF airways (e.g., IL-1 beta-dependent CFTR expression, immune response TLR signaling pathways, etc.), NF-KB signaling, etc.
- activated TLR4 signaling e.g., MyD88-independent TLR3/TLR4 cascade, TLR2, TLR3, TLR4, TLR
- TAB2 is related to multiple diseases and disorders including, at least, congenital heart defects, nonsyndromic, 2, left ventricular outflow tract obstruction (e.g., aortic valve disease 2, coarctation of the aorta, hypoplastic left heart syndrome, etc.), pulmonary valve disease, ectodermal dysplasia 10b, hypohidrotic/hair/tooth type, autosomal recessive (e.g., xhed, est syndrome, etc.), etc.
- congenital heart defects e.g., nonsyndromic, 2, left ventricular outflow tract obstruction (e.g., aortic valve disease 2, coarctation of the aorta, hypoplastic left heart syndrome, etc.), pulmonary valve disease, ectodermal dysplasia 10b, hypohidrotic/hair/tooth type, autosomal recessive (e.g., xhed, est syndrome, etc.), etc.
- the nucleic acid and amino acid sequences of a representative human TAB2 is available to the public at the GenBank database (Gene ID 23118) and is shown in Table 1 (e.g., NM_015093.5 and NP_055908.1, representing the longest transcript variant 1 and the encoded longer isoform a, NM_001292034.2 and NP_001278963.1, representing the transcript variant 3 (differing in the 5' UTR compared to variant 1) and the encoded same isoform a, and NM_001292035.2 and NP_001278964.1, representing the transcript variant 4 (containing an alternate 5' exon structure, and thus differing in the 5' UTR and initiating translation at an alternate start codon, compared to variant 1) and the encoded shorter isoform b (having a distinct N-terminus)).
- Table 1 e.g., NM_015093.5 and NP_055908.1, representing the longest transcript variant 1 and the encoded longer isoform a
- TAB2 polypeptide The domain structure of TAB2 polypeptide is well known and accessible in UniProtKB database under the accession number Q9NYJ8, including, in the order from the 5' terminus to the 3' terminus, a CUE domain capable of binding ubiquitin comprising, e.g., amino acid positions 8-51 of NP 055908.1, a coiled coil region comprising, e.g., amino acid positions 532-619 of P 055908.1, and a RanBP2-type zinc finger domain capable of binding to two consecutive 'Lys-63 '-linked ubiquitins comprising, e.g., amino acid positions 663-693 of P 055908.1.
- TAB2 orthologs in organisms other than humans include, for example, chimpanzee (Pan troglodytes) TAB2 (XM_016956449.1 and XP 016811938.1, XM_009452188.2 and XP_009450463.2, XM_016956450.1 and XP 016811939.1, and XM_016956448.1 and XP 016811937.1), Rhesus monkey TAB2 (NM_001257790.2 and NP_001244719.1), dog TAB2
- mice TAB2 NM_138667.3 and NP_619608.1
- cattle TAB2 NM_001192372.1
- TAB2 activity includes the ability of a TAB2 polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein) to bind its substrate and/or biological activity.
- TAB2 activity may also include one or more of functions, such as activating kinases and promoting autophosphorylation, and/or others disclosed herein in the NF-KB pathway and other related pathways.
- TAB2 may interact with various proteins disclosed herein for its functions in signaling.
- TAB2 may also be proteolyticly modified, such as being cleaved, ubiquitinated, deubiquitinated, acetylated, phosphorylated, or otherwise disclosed herein, for its functions.
- TAB2 substrate(s) refers to binding partners of a TAB2 polypeptide
- TAB2 substrates may refer to downstream members in the signaling pathways where TAB2 has a functional role.
- TAB2-regulated signaling pathway(s) includes signaling pathways in which TAB2 (and its fragments, domains, and/or motifs thereof, discussed herein) binds to at least one of its substrate, through which at least one cellular function and/or activity and/or cellular protein profiles is changed.
- TAB2-regulated signaling pathways include at least those described herein, such as activated TLR4 signaling (e.g., MyD88-independent TLR3/TLR4 cascade, TLR2, TLR3, TLR4, TLR 7/8, TLR 9, and TLR10 cascade, MAP kinase activation in TLR cascade, INK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1, etc.), Toll-like receptor signaling pathway (e.g., NOD-like receptor signaling pathways, IL-1 family signaling pathways, Mucin expression in CF via TLRs, EGFR signaling pathways, etc.), TRAF pathway, bacterial infections in CF airways (e.g., IL-1 beta-dependent CFTR expression, immune response TLR signaling pathways, etc.), F- ⁇ Signaling, etc.
- activated TLR4 signaling e.g., MyD88-independent TLR3/TLR4 cascade, TLR2, TLR3, TLR
- TAB2 inhibitor(s) includes any natural or non-natural agent prepared, synthesized, manufactured, and/or purified by human that is capable of reducing, inhibiting, blocking, preventing, and/or that inhibits the ability of a TAB2 polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein).
- such inhibitors may reduce or inhibit the binding/interaction between TAB2 and its substrates or other binding partners.
- such inhibitors may increase or promote the turnover rate, reduce or inhibit the expression and/or the stability (e.g., the half-life), and/or change the cellular localization of TAB2, resulting in at least a decrease in TAB2 levels and/or activity.
- Such inhibitors may be any molecule, including but not limited to small molecule compounds, antibodies or intrabodies, RNA interfering (RNAi) agents (including at least siRNAs, shRNAs, microRNAs (miRNAs), piwi, and other well- known agents). Such inhibitors may be specific to TAB2 or also inhibit at least one of other related proteins.
- RNA interference for TAB2 polypeptides are well known and commercially available (e.g., human, mouse, or rat shRNA (Cat. # TL316993, TF504187, and TF701571) and siRNA (Cat. # SR308018, SR419201, and SR509887) products and human or mouse gene knockout kit via CRISPR (Cat.
- TNIPl also known as TNFAIP3 -interacting protein 1, NAF1, Nip40-1, and A20-Binding Inhibitor of NF- ⁇ Activation 1, refers to a member of a family of A20- binding proteins which plays a role in autoimmunity and tissue homeostasis through the regulation of NF- ⁇ activation.
- TNIPl inhibits NF- ⁇ activation and TNF-induced NF- ⁇ -dependent gene expression by regulating A20/TNFAIP3 -mediated deubiquitination of IKBKG, thus linking A20/TNFAIP3 to ubiquitinated IKBKG.
- TNIPl also regulates EGF- induced ERK1/ERK2 signaling pathway and blocks MAPK3/MAPK1 nuclear translocation and MAPKl -dependent transcription.
- TNIPl increases cell surface CD4(T4) antigen expression.
- TNIPl is involved in the anti-inflammatory response of macrophages and positively regulates TLR-induced activation of CEBPB.
- TNIPl is also involved in the prevention of autoimmunity and leukocyte integrin activation during inflammation
- TNIPl interacts with HIV-1 matrix protein and is packaged into virions, while its overexpression inhibits viral replication. TNIPl may regulate matrix nuclear localization, both nuclear import of PIC (Preintegration complex) and export of GAG polyprotein and viral genomic RNA during virion production. In case of infection, TNIPl promotes association of IKBKG with Shigella flexneri E3 ubiquitin-protein ligase ipah9.8 p, which in turn promotes polyubiquitination and proteasome degradation of IKBKG and perturbs NF- KB activation during bacterial infection.
- TNIPl interacts with TNFAIP3 (Heyninck et al. (1999) J. Cell Biol. 145: 1471-1482) and MAPKl (Zhang et al. (2002) Biochem. Biophys. Res. Commun. 297: 17-23).
- TNIPl also interacts with polyubiquitinated IKBKG and facilitates TNFAIP3 -mediated de-ubiquitination of NEMO/IKBKG.
- TNIPl further interacts with SELPLG, PIK3CD, IRAKI (polyubiquitinated), MYD88 (indicative for participation in an activated TLR-signaling complex).
- TNIPl functions in multiple pathways, including, at least, NF- ⁇ signaling, TRAF pathway ⁇ e.g., 14-3-3 induced apoptosis), deubiquitination and protein metabolism, IL-23 signaling pathway ⁇ e.g., angiopoietin-TIE2 signaling), etc.
- TNIPl is related to multiple diseases and disorders including, at least, psoriatic arthritis, chronic intestinal vascular insufficiency, HIV-1 infection/ AIDS, rheumatoid arthritis, and systemic lupus erythematosus.
- NM_001252385.1 and NP 001239314.1 representing the longest transcript variant 1 and the encoded isoform 1
- NM_001252386.1 and NP_001239315.1 representing the transcript variant 2 and the encoded isoform 2 (with a shorter N-terminus and a distinct C-terminus compared to isoform 1)
- NM_001252390.1 and NP_001239319.1 representing the transcript variant 3 (differing in the 5' UTR and using an alternate splice site in the 3' coding region, compared to variant 1)
- the encoded longest isoform 3 NM_001252391.1 and NP_001239320.1
- NM_001258454.1 and NP_001245383.1 representing the transcript variant 8 (differing in the 5' UTR compared to variant 1) and the encoded same isoform 3, NM 001258455.1 and NP_001245384.1, representing the transcript variant 9 (lacking an exon and using an alternate splice site in the 3' coding region which results in a frameshift compared to variant 1) and the encoded isoform 5 (shorter and having a distinct C-terminus compared to isoform 1), and NM_001258456.1 and NP_001245385.1, representing the transcript variant 10 (lacking two exons in the 3' coding region which results in a frameshift compared to variant 1) and the encoded isoform 6 (having a distinct C-terminus).
- TNIPl polypeptide The domain structure of TNIPl polypeptide is well known and accessible in UniProtKB database under the accession number Q 15025, including, in the order from the 5' terminus to the 3' terminus, a domain capable of binding NEF comprising, e.g., amino acid positions 94-412 of
- TNIPl contains three coiled coil regions comprising, e.g., amino acid positions 20-73, 196-258, and 294-535 of NP_006049.3.
- Nucleic acid and polypeptide sequences of TNIPl orthologs in organisms other than humans are well-known and include, for example, chimpanzee (Pan troglodytes) TNIPl (XM_003310917.4 and XP_003310965.1, XM_016954075.1 and XP_016809564.1, XM_016954073.1 and XP_016809562.1, XM_016954074.1 and XP_016809563.1, XM_003310918.4 and XP_003310966.1, XM_001167619.5 and XP_001167619.1, XM_518040.6 and XP_518040.3, XM_016954076.1 and XP_016809565.1, and
- XM_016954077.1 and XP_016809566.1 Rhesus monkey TNIPl (XM_002804583.2 and XP_002804629.1, XM_015141244.1 and XP_014996730.1, XM_015141246.1 and XP_014996732.1, XM_001109469.3 and XP_001109469.2, XM_001109428.3 and XP_001109428.1, XM_015141243.1 and XP_014996729.1, and XM_015141245.1 and XP_014996731.1), dog TNIPl (XM_546296.5 and XP_546296.3, and XM_014113057.1 and XP_013968532.1), mouse TNIPl (NM_021327.4 and NP_067302.2, representing the transcript variant 1 and the encoded longest isoform 1, NM_00119927
- NP OOl 186204.1 representing the transcript variant 2 (containing an alternate exon in the 5' UTR, compared to variant 1) and the encoded same isoform 1
- NM OOl 199276.2 and NP_001186205.1 representing the transcript variant 3 (differing in the 5' UTR, lacking a portion of the 5' coding region, and initiating translation at a downstream in-frame start codon, compared to variant 1) and the encoded isoform 2 (having a shorter N-terminus, compared to isoform 1)
- NM_001271455.1 and NP_001258384.1 representing the transcript variant 4 (differing in the 5' UTR, lacking a portion of the 5' coding region, and initiating translation at a downstream in-frame start codon, compared to variant 1) and the encoded same isoform 2
- NM_001271456.1 and NP_001258385.1 representing the transcript variant 5 (differing in the 5' UTR and using an alternate splice site in the
- TNIPl (NM_001024554.3 and NP_001019725.2), Norway rat (Rattus norvegicus) TNIPl (NM_001108826.1 and NP_001102296.1), chicken TNIPl (XM_004944944.2 and XP_004945001.1, XM_004944943.2 and XP_004945000.1, and XM_003642060.3 and XP_003642108.2), tropical clawed frog (Xenopus tropicalis) TNIPl (NM_001079235.1 and NP_001072703.1), and zebrafish TNIPl (NM_001079952.1 and NP_001073421.1).
- TNIPl activity includes the ability of a TNIPl polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein) to bind its substrate and/or biological activity.
- TNIPl activity may also include one or more of functions, such as promoting deubiquitination, inhibiting NF- ⁇ activation and gene expression, and/or others disclosed herein in the NF- ⁇ pathway and other related pathways.
- TNIPl may interact with various proteins disclosed herein for its functions in signaling.
- TNIPl may also be proteolyticly modified, such as being cleaved, ubiquitinated, deubiquitinated, acetylated, phosphorylated, or otherwise disclosed herein, for its functions.
- TNIPl substrate(s) refers to binding partners of a TNIPl polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein), e.g., the binding partners described herein of TNIPl for multiple signal transduction pathways.
- TNIPl substrates may refer to downstream members in the signaling pathways where TNIPl has a functional role.
- TNIPl -regulated signaling pathway(s) includes signaling pathways in which TNIPl (and its fragments, domains, and/or motifs thereof, discussed herein) binds to at least one of its substrate, through which at least one cellular function and/or activity and/or cellular protein profiles is changed.
- TNIPl -regulated signaling pathways include at least those described herein, such as NF- ⁇ signaling, TRAF pathway (e.g., 14-3-3 induced apoptosis), deubiquitination and protein metabolism, IL-23 signaling pathway (e.g., angiopoietin-TIE2 signaling), etc.
- TNIPl inhibitor(s) includes any natural or non-natural agent prepared, synthesized, manufactured, and/or purified by human that is capable of reducing, inhibiting, blocking, preventing, and/or that inhibits the ability of a TNIPl polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein).
- such inhibitors may reduce or inhibit the binding/interaction between TNIPl and its substrates or other binding partners.
- such inhibitors may increase or promote the turnover rate, reduce or inhibit the expression and/or the stability (e.g., the half-life), and/or change the cellular localization of TNIPl, resulting in at least a decrease in TNIPl levels and/or activity.
- Such inhibitors may be any molecule, including but not limited to small molecule compounds, antibodies or intrabodies, RNA interfering (RNAi) agents (including at least siRNAs, shRNAs, microRNAs (miRNAs), piwi, and other well- known agents). Such inhibitors may be specific to TNIPl or also inhibit at least one of other related proteins.
- RNA interference for TNIPl polypeptides are well known and commercially available (e.g., human, mouse, or rat shRNA (Cat. # TF308719, TF512490, and TF707355) and siRNA (Cat. # SR306991 and SR418640) products and human or mouse gene knockout kit via CRISPR (Cat.
- immune response includes T cell mediated and/or B cell mediated immune responses.
- exemplary immune responses include T cell responses, e.g., cytokine production and cellular cytotoxicity.
- immune response includes immune responses that are indirectly effected by T cell activation, e.g., antibody production (humoral responses) and activation of cytokine responsive cells, e.g., macrophages.
- immunotherapeutic agent can include any molecule, peptide, antibody or other agent which can stimulate a host immune system to generate an immune response to a tumor or cancer in the subj ect.
- Various immunotherapeutic agents are useful in the compositions and methods described herein.
- cancer includes the decrease, limitation, or blockage, of, for example a particular action, function, or interaction.
- cancer is "inhibited” if at least one symptom of the cancer is alleviated, terminated, slowed, or prevented.
- cancer is also “inhibited” if recurrence or metastasis of the cancer is reduced, slowed, delayed, or prevented.
- interaction when referring to an interaction between two molecules, refers to the physical contact (e.g., binding) of the molecules with one another. Generally, such an interaction results in an activity (which produces a biological effect) of one or both of said molecules.
- isolated protein refers to a protein that is substantially free of other proteins, cellular material, separation medium, and culture medium when isolated from cells or produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized.
- isolated or purified protein or biologically active portion thereof is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the antibody, polypeptide, peptide or fusion protein is derived, or substantially free from chemical precursors or other chemicals when chemically synthesized.
- substantially free of cellular material includes preparations of a biomarker polypeptide or fragment thereof, in which the protein is separated from cellular components of the cells from which it is isolated or recombinantly produced.
- the language "substantially free of cellular material” includes preparations of a biomarker protein or fragment thereof, having less than about 30% (by dry weight) of non-biomarker protein (also referred to herein as a "contaminating protein”), more preferably less than about 20% of non-biomarker protein, still more preferably less than about 10%) of non-biomarker protein, and most preferably less than about 5% non- biomarker protein.
- non-biomarker protein also referred to herein as a "contaminating protein”
- polypeptide, peptide or fusion protein or fragment thereof e.g., a biologically active fragment thereof
- it is also preferably substantially free of culture medium, i.e., culture medium represents less than about 20%, more preferably less than about 10%>, and most preferably less than about 5% of the volume of the protein preparation.
- isotype refers to the antibody class (e.g., IgM, IgGl, IgG2C, and the like) that is encoded by heavy chain constant region genes.
- KD is intended to refer to the dissociation equilibrium constant of a particular antibody-antigen interaction.
- the binding affinity of antibodies of the disclosed invention may be measured or determined by standard antibody-antigen assays, for example, competitive assays, saturation assays, or standard immunoassays such as ELISA or RIA.
- kits is any manufacture (e.g. a package or container) comprising at least one reagent, e.g. a probe or small molecule, for specifically detecting and/or affecting the expression of a marker of the present invention.
- the kit may be promoted, distributed, or sold as a unit for performing the methods of the present invention.
- the kit may comprise one or more reagents necessary to express a composition useful in the methods of the present invention.
- the kit may further comprise a reference standard, e.g., a nucleic acid encoding a protein that does not affect or regulate signaling pathways controlling cell growth, division, migration, survival or apoptosis.
- control proteins including, but not limited to, common molecular tags (e.g., green fluorescent protein and beta-galactosidase), proteins not classified in any of pathway encompassing cell growth, division, migration, survival or apoptosis by GeneOntology reference, or ubiquitous housekeeping proteins.
- Reagents in the kit may be provided in individual containers or as mixtures of two or more reagents in a single container.
- instructional materials which describe the use of the compositions within the kit can be included.
- neoadjuvant therapy refers to a treatment given before the primary treatment.
- neoadjuvant therapy can include chemotherapy, radiation therapy, and hormone therapy.
- chemotherapy for example, in treating breast cancer, neoadjuvant therapy can allows patients with large breast cancer to undergo breast-conserving surgery.
- the "normal" level of expression of a biomarker is the level of expression of the biomarker in cells of a subject, e.g., a human patient, not afflicted with a cancer.
- An “over- expression” or “significantly higher level of expression” of a biomarker refers to an expression level in a test sample that is greater than the standard error of the assay employed to assess expression, and is preferably at least 10%, and more preferably 1.2, 1.3,
- a control sample e.g., sample from a healthy subject not having the biomarker associated disease
- a control sample e.g., sample from a healthy subject not having the biomarker associated disease
- the average expression level of the biomarker in several control samples e.g., the average expression level of the biomarker in several control samples.
- a "significantly lower level of expression" of a biomarker refers to an expression level in a test sample that is at least 10%, and more preferably 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20 times or more lower than the expression level of the biomarker in a control sample (e.g., sample from a healthy subject not having the biomarker associated disease) and preferably, the average expression level of the biomarker in several control samples.
- a control sample e.g., sample from a healthy subject not having the biomarker associated disease
- an "over-expression” or “significantly higher level of expression” of a biomarker refers to an expression level in a test sample that is greater than the standard error of the assay employed to assess expression, and is preferably at least 10%, and more preferably 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20 times or more higher than the expression activity or level of the biomarker in a control sample (e.g., sample from a healthy subject not having the biomarker associated disease) and preferably, the average expression level of the biomarker in several control samples.
- a control sample e.g., sample from a healthy subject not having the biomarker associated disease
- a "significantly lower level of expression" of a biomarker refers to an expression level in a test sample that is at least 10%, and more preferably 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20 times or more lower than the expression level of the biomarker in a control sample (e.g., sample from a healthy subject not having the biomarker associated disease) and preferably, the average expression level of the biomarker in several control samples.
- a control sample e.g., sample from a healthy subject not having the biomarker associated disease
- pre-determined biomarker amount and/or activity measurement(s) may be a biomarker amount and/or activity measurement(s) used to, by way of example only, evaluate a subject that may be selected for a particular treatment, evaluate a response to a treatment such as inhibitors of one or more biomarkers listed in Table 1, in combination with an immunotherapy, and/or evaluate the disease state.
- a pre-determined biomarker amount and/or activity measurement(s) may be determined in populations of patients with or without cancer.
- the pre-determined biomarker amount and/or activity measurement s) can be a single number, equally applicable to every patient, or the pre-determined biomarker amount and/or activity measurement(s) can vary according to specific subpopulations of patients.
- Age, weight, height, and other factors of a subject may affect the pre-determined biomarker amount and/or activity measurement(s) of the individual.
- the pre-determined biomarker amount and/or activity can be determined for each subject individually.
- the amounts determined and/or compared in a method described herein are based on absolute measurements.
- the amounts determined and/or compared in a method described herein are based on relative measurements, such as ratios (e.g., serum biomarker normalized to the expression of housekeeping or otherwise generally constant biomarker).
- the pre-determined biomarker amount and/or activity measurement(s) can be any suitable standard.
- the pre-determined biomarker amount and/or activity measurement(s) can be obtained from the same or a different human for whom a patient selection is being assessed.
- the pre-determined biomarker amount and/or activity measurement s) can be obtained from a previous assessment of the same patient. In such a manner, the progress of the selection of the patient can be monitored over time.
- the control can be obtained from an assessment of another human or multiple humans, e.g., selected groups of humans, if the subject is a human.
- the extent of the selection of the human for whom selection is being assessed can be compared to suitable other humans, e.g., other humans who are in a similar situation to the human of interest, such as those suffering from similar or the same condition(s) and/or of the same ethnic group.
- predictive includes the use of a biomarker nucleic acid and/or protein status, e.g., over- or under- activity, emergence, expression, growth, remission, recurrence or resistance of tumors before, during or after therapy, for determining the likelihood of response of a cancer to inhibitors of one or more biomarkers listed in Table 1, in
- biomarker may be confirmed by, e.g., (1) increased or decreased copy number (e.g., by FISH, FISH plus SKY, single-molecule sequencing, e.g., as described in the art at least at J.
- Biotechnol., 86:289-301, or qPCR overexpression or underexpression of a biomarker nucleic acid (e.g., by ISH, Northern Blot, or qPCR), increased or decreased biomarker protein (e.g., by IHC), or increased or decreased activity, e.g., in more than about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 100%, or more of assayed human cancers types or cancer samples; (2) its absolute or relatively modulated presence or absence in a biological sample, e.g., a sample containing tissue, whole blood, serum, plasma, buccal scrape, saliva, cerebrospinal fluid, urine, stool, or bone marrow, from a subject, e.g.
- a biological sample e.g., a sample containing tissue, whole blood, serum, plasma, buccal
- a human, afflicted with cancer (3) its absolute or relatively modulated presence or absence in clinical subset of patients with cancer (e.g., those responding to a particular inhibitor of one or more biomarkers listed in Table 1, in combination with an immunotherapy or those developing resistance thereto).
- pre-malignant lesions refers to a lesion that, while not cancerous, has potential for becoming cancerous. It also includes the term "pre- malignant disorders” or “potentially malignant disorders.” In particular this refers to a benign, morphologically and/or histologically altered tissue that has a greater than normal risk of malignant transformation, and a disease or a patient's habit that does not necessarily alter the clinical appearance of local tissue but is associated with a greater than normal risk of precancerous lesion or cancer development in that tissue (leukoplakia, erythroplakia, erytroleukoplakia lichen planus (lichenoid reaction) and any lesion or an area which histological examination showed atypia of cells or dysplasia.
- a metaplasia is a pre-malignant lesion.
- prevent refers to reducing the probability of developing a disease, disorder, or condition in a subject, who does not have, but is at risk of or susceptible to developing a disease, disorder, or condition.
- probe refers to any molecule which is capable of selectively binding to a specifically intended target molecule, for example, a nucleotide transcript or protein encoded by or corresponding to a biomarker nucleic acid. Probes can be either synthesized by one skilled in the art, or derived from appropriate biological preparations. For purposes of detection of the target molecule, probes may be specifically designed to be labeled, as described herein. Examples of molecules that can be utilized as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules.
- prognosis includes a prediction of the probable course and outcome of cancer or the likelihood of recovery from the disease.
- use of statistical algorithms provides a prognosis of cancer in an individual.
- the prognosis can be surgery, development of a clinical subtype of cancer (e.g., solid tumors, such as esophageal cancer and gastric cancer), development of one or more clinical factors, or recovery from the disease.
- response to immunotherapy or “response to inhibitors of one or more biomarkers/immunotherapy combination therapy” relates to any response of the
- hyperproliferative disorder e.g., cancer
- an anti-cancer agent such as an an inhibitor of one or more biomarkers listed in Table 1
- an immunotherapy preferably to a change in tumor mass and/or volume after initiation of neoadjuvant or adjuvant therapy.
- Hyperproliferative disorder response may be assessed, for example for efficacy or in a neoadjuvant or adjuvant situation, where the size of a tumor after systemic intervention can be compared to the initial size and dimensions as measured by CT, PET, mammogram, ultrasound or palpation. Responses may also be assessed by caliper measurement or pathological examination of the tumor after biopsy or surgical resection. Response may be recorded in a quantitative fashion like percentage change in tumor volume or in a qualitative fashion like "pathological complete response" (pCR), "clinical complete remission” (cCR), “clinical partial remission” (cPR), “clinical stable disease” (cSD), “clinical progressive disease” (cPD) or other qualitative criteria.
- pCR pathological complete response
- cCR clinical complete remission
- cPR clinical partial remission
- cSD clinical stable disease
- cPD clinical progressive disease
- Assessment of hyperproliferative disorder response may be done early after the onset of neoadjuvant or adjuvant therapy, e.g., after a few hours, days, weeks or preferably after a few months.
- a typical endpoint for response assessment is upon termination of neoadjuvant chemotherapy or upon surgical removal of residual tumor cells and/or the tumor bed. This is typically three months after initiation of neoadjuvant therapy.
- clinical efficacy of the therapeutic treatments described herein may be determined by measuring the clinical benefit rate (CBR).
- the clinical benefit rate is measured by determining the sum of the percentage of patients who are in complete remission (CR), the number of patients who are in partial remission (PR) and the number of patients having stable disease (SD) at a time point at least 6 months out from the end of therapy.
- CR complete remission
- PR partial remission
- SD stable disease
- the CBR for a particular cancer therapeutic regimen is at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%), 80%), 85%), or more.
- Additional criteria for evaluating the response to cancer therapies are related to "survival,” which includes all of the following: survival until mortality, also known as overall survival (wherein said mortality may be either irrespective of cause or tumor related); "recurrence-free survival" (wherein the term recurrence shall include both localized and distant recurrence); metastasis free survival; disease free survival (wherein the term disease shall include cancer and diseases associated therewith).
- the length of said survival may be calculated by reference to a defined start point (e.g., time of diagnosis or start of treatment) and end point (e.g., death, recurrence or metastasis).
- criteria for efficacy of treatment can be expanded to include response to chemotherapy, probability of survival, probability of metastasis within a given time period, and probability of tumor recurrence.
- a particular cancer therapeutic regimen can be administered to a population of subjects and the outcome can be correlated to biomarker measurements that were determined prior to administration of any cancer therapy.
- the outcome measurement may be pathologic response to therapy given in the neoadjuvant setting.
- outcome measures such as overall survival and disease-free survival can be monitored over a period of time for subjects following cancer therapy for which biomarker measurement values are known.
- the doses administered are standard doses known in the art for cancer therapeutic agents.
- the period of time for which subjects are monitored can vary. For example, subjects may be monitored for at least 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 25, 30, 35, 40, 45, 50, 55, or 60 months.
- Biomarker measurement threshold values that correlate to outcome of a cancer therapy can be determined using well-known methods in the art, such as those described in the Examples section.
- resistance refers to an acquired or natural resistance of a cancer sample or a mammal to a cancer therapy (i.e., being nonresponsive to or having reduced or limited response to the therapeutic treatment), such as having a reduced response to a therapeutic treatment by 25% or more, for example, 30%, 40%, 50%, 60%, 70%, 80%, or more, to 2- fold, 3-fold, 4-fold, 5-fold, 10-fold, 15-fold, 20-fold or more.
- the reduction in response can be measured by comparing with the same cancer sample or mammal before the resistance is acquired, or by comparing with a different cancer sample or a mammal that is known to have no resistance to the therapeutic treatment.
- multidrug resistance A typical acquired resistance to chemotherapy is called "multidrug resistance.”
- the multidrug resistance can be mediated by P-glycoprotein or can be mediated by other mechanisms, or it can occur when a mammal is infected with a multi-drug-resistant microorganism or a combination of microorganisms.
- the term "reverses resistance” means that the use of a second agent in combination with a primary cancer therapy ⁇ e.g., chemotherapeutic or radiation therapy) is able to produce a significant decrease in tumor volume at a level of statistical significance ⁇ e.g., p ⁇ 0.05) when compared to tumor volume of untreated tumor in the circumstance where the primary cancer therapy ⁇ e.g., chemotherapeutic or radiation therapy) alone is unable to produce a statistically significant decrease in tumor volume compared to tumor volume of untreated tumor. This generally applies to tumor volume measurements made at a time when the untreated tumor is growing log rhythmically.
- response refers to an anti-cancer response, e.g. in the sense of reduction of tumor size or inhibiting tumor growth.
- the terms can also refer to an improved prognosis, for example, as reflected by an increased time to recurrence, which is the period to first recurrence censoring for second primary cancer as a first event or death without evidence of recurrence, or an increased overall survival, which is the period from treatment to death from any cause.
- To respond or to have a response means there is a beneficial endpoint attained when exposed to a stimulus. Alternatively, a negative or detrimental symptom is minimized, mitigated or attenuated on exposure to a stimulus. It will be appreciated that evaluating the likelihood that a tumor or subject will exhibit a favorable response is equivalent to evaluating the likelihood that the tumor or subject will not exhibit favorable response (i.e., will exhibit a lack of response or be non-responsive).
- RNA interfering agent is defined as any agent which interferes with or inhibits expression of a target biomarker gene by RNA interference (RNAi).
- RNA interfering agents include, but are not limited to, nucleic acid molecules including RNA molecules which are homologous to the target biomarker gene of the present invention, or a fragment thereof, short interfering RNA (siRNA), and small molecules which interfere with or inhibit expression of a target biomarker nucleic acid by RNA interference (RNAi).
- RNA interference is an evolutionally conserved process whereby the expression or introduction of RNA of a sequence that is identical or highly similar to a target biomarker nucleic acid results in the sequence specific degradation or specific post- transcriptional gene silencing (PTGS) of messenger RNA (mRNA) transcribed from that targeted gene (see Coburn and Cullen (2002) J. Virol. 76:9225), thereby inhibiting expression of the target biomarker nucleic acid.
- mRNA messenger RNA
- dsRNA double stranded RNA
- RNAi is initiated by the dsRNA-specific endonuclease Dicer, which promotes processive cleavage of long dsRNA into double-stranded fragments termed siRNAs.
- siRNAs are incorporated into a protein complex that recognizes and cleaves target mRNAs.
- RNAi can also be initiated by introducing nucleic acid molecules, e.g., synthetic siRNAs or RNA interfering agents, to inhibit or silence the expression of target biomarker nucleic acids.
- inhibiting target biomarker nucleic acid expression includes any decrease in expression or protein activity or level of the target biomarker nucleic acid or protein encoded by the target biomarker nucleic acid.
- the decrease may be of at least 30%, 40%, 50%, 60%, 70%, 80%, 90%), 95%) or 99%) or more as compared to the expression of a target biomarker nucleic acid or the activity or level of the protein encoded by a target biomarker nucleic acid which has not been targeted by an RNA interfering agent.
- sample used for detecting or determining the presence or level of at least one biomarker is typically brain tissue, cerebrospinal fluid, whole blood, plasma, serum, saliva, urine, stool (e.g., feces), tears, and any other bodily fluid (e.g., as described above under the definition of "body fluids"), or a tissue sample (e.g., biopsy) such as a small intestine, colon sample, or surgical resection tissue.
- the method of the present invention further comprises obtaining the sample from the individual prior to detecting or determining the presence or level of at least one marker in the sample.
- cancer means to alter cancer cells or tumor cells in a way that allows for more effective treatment of the associated cancer with a cancer therapy (e.g., anti- immune checkpoint, chemotherapeutic, and/or radiation therapy).
- a cancer therapy e.g., anti- immune checkpoint, chemotherapeutic, and/or radiation therapy.
- normal cells are not affected to an extent that causes the normal cells to be unduly injured by the therapies.
- An increased sensitivity or a reduced sensitivity to a therapeutic treatment is measured according to a known method in the art for the particular treatment and methods described herein below, including, but not limited to, cell proliferative assays (Tanigawa N, Kern D H, Kikasa Y, Morton D L, Cancer Res 1982; 42: 2159-2164), cell death assays (Weisenthal L M, Shoemaker R H, Marsden J A, Dill P L, Baker J A, Moran E M, Cancer Res 1984; 94: 161-173; Weisenthal L M, Lippman M E, Cancer Treat Rep 1985; 69: 615-632; Weisenthal L M, In: Kaspers G J L, Pieters R, Twentyman P R, Weisenthal L M, Veerman A J P, eds.
- the sensitivity or resistance may also be measured in animal by measuring the tumor size reduction over a period of time, for example, 6 month for human and 4-6 weeks for mouse.
- a composition or a method sensitizes response to a therapeutic treatment if the increase in treatment sensitivity or the reduction in resistance is 25% or more, for example, 30%, 40%, 50%, 60%, 70%, 80%, or more, to 2-fold, 3-fold, 4-fold, 5- fold, 10-fold, 15-fold, 20-fold or more, compared to treatment sensitivity or resistance in the absence of such composition or method.
- sensitivity or resistance to a therapeutic treatment is routine in the art and within the skill of an ordinarily skilled clinician. It is to be understood that any method described herein for enhancing the efficacy of a cancer therapy can be equally applied to methods for sensitizing hyperproliferative or otherwise cancerous cells (e.g., resistant cells) to the cancer therapy.
- siRNA Short interfering RNA
- small interfering RNA is defined as an agent which functions to inhibit expression of a target biomarker nucleic acid, e.g., by RNAi.
- An siRNA may be chemically synthesized, may be produced by in vitro transcription, or may be produced within a host cell.
- siRNA is a double stranded RNA (dsRNA) molecule of about 15 to about 40 nucleotides in length, preferably about 15 to about 28 nucleotides, more preferably about 19 to about 25 nucleotides in length, and more preferably about 19, 20, 21, or 22 nucleotides in length, and may contain a 3' and/or 5' overhang on each strand having a length of about 0, 1, 2, 3, 4, or 5 nucleotides.
- the length of the overhang is independent between the two strands, i.e., the length of the overhang on one strand is not dependent on the length of the overhang on the second strand.
- the siRNA is capable of promoting RNA interference through degradation or specific post-transcriptional gene silencing (PTGS) of the target messenger RNA (mRNA).
- PTGS post-transcriptional gene silencing
- an siRNA is a small hairpin (also called stem loop) RNA (shRNA).
- shRNAs are composed of a short ⁇ e.g., 19-25 nucleotide) antisense strand, followed by a 5-9 nucleotide loop, and the analogous sense strand.
- the sense strand may precede the nucleotide loop structure and the antisense strand may follow.
- shRNAs may be contained in plasmids, retroviruses, and lentiviruses and expressed from, for example, the pol III U6 promoter, or another promoter ⁇ see, e.g., Stewart, et al. (2003) RNA Apr;9(4):493-501 incorporated by reference herein).
- RNA interfering agents e.g., siRNA molecules
- RNA interfering agents may be administered to a patient having or at risk for having cancer, to inhibit expression of a biomarker gene which is overexpressed in cancer and thereby treat, prevent, or inhibit cancer in the subject.
- small molecule is a term of the art and includes molecules that are less than about 1000 molecular weight or less than about 500 molecular weight. In one embodiment, small molecules do not exclusively comprise peptide bonds. In another embodiment, small molecules are not oligomeric. Exemplary small molecule compounds which can be screened for activity include, but are not limited to, peptides,
- peptidomimetics nucleic acids, carbohydrates, small organic molecules ⁇ e.g., polyketides) (Cane et al. (1998) Science 282:63), and natural product extract libraries.
- the compounds are small, organic non-peptidic compounds.
- a small molecule is not biosynthetic.
- the term “specific binding” refers to antibody binding to a predetermined antigen.
- the antibody binds with an affinity (KD) of approximately less than 10 "7 M, such as approximately less than 10 "8 M, 10 "9 M or 10 "10 M or even lower when determined by surface plasm on resonance (SPR) technology in a BIACORE® assay instrument using an antigen of interest as the analyte and the antibody as the ligand, and binds to the affinity (KD) of approximately less than 10 "7 M, such as approximately less than 10 "8 M, 10 "9 M or 10 "10 M or even lower when determined by surface plasm on resonance (SPR) technology in a BIACORE® assay instrument using an antigen of interest as the analyte and the antibody as the ligand, and binds to the affinity (KD) of approximately less than 10 "7 M, such as approximately less than 10 "8 M, 10 "9 M or 10 "10 M or even lower when determined by surface plasm on resonance (SPR) technology in
- predetermined antigen with an affinity that is at least 1.1-, 1.2-, 1.3-, 1.4-, 1.5-, 1.6-, 1.7-, 1.8-, 1.9-, 2.0-, 2.5-, 3.0-, 3.5-, 4.0-, 4.5-, 5.0-, 6.0-, 7.0-, 8.0-, 9.0-, or 10.0-fold or greater than its affinity for binding to a non-specific antigen (e.g., BSA, casein) other than the predetermined antigen or a closely-related antigen.
- a non-specific antigen e.g., BSA, casein
- an antibody recognizing an antigen and "an antibody specific for an antigen” are used interchangeably herein with the term “an antibody which binds specifically to an antigen.”
- Selective binding is a relative term refering to the ability of an antibody to discriminate the binding of one antigen over another.
- subject refers to any healthy animal, mammal or human, or any animal, mammal or human afflicted with a cancer, e.g., brain, lung, ovarian, pancreatic, liver, breast, prostate, and/or colorectal cancers, melanoma, multiple myeloma, and the like.
- a cancer e.g., brain, lung, ovarian, pancreatic, liver, breast, prostate, and/or colorectal cancers, melanoma, multiple myeloma, and the like.
- subject is interchangeable with “patient.”
- survival includes all of the following: survival until mortality, also known as overall survival (wherein said mortality may be either irrespective of cause or tumor related); "recurrence-free survival” (wherein the term recurrence shall include both localized and distant recurrence); metastasis free survival; disease free survival (wherein the term disease shall include cancer and diseases associated therewith).
- the length of said survival may be calculated by reference to a defined start point (e.g. time of diagnosis or start of treatment) and end point (e.g. death, recurrence or metastasis).
- criteria for efficacy of treatment can be expanded to include response to chemotherapy, probability of survival, probability of metastasis within a given time period, and probability of tumor recurrence.
- the term "synergistic effect” refers to the combined effect of two or more anticancer agents (e.g., inhibitors of one or more biomarkers listed in Table 1, in combination with an immunotherapy) can be greater than the sum of the separate effects of the anticancer agents/therapies alone.
- T cell includes CD4 + T cells and CD8 + T cells.
- T cell also includes both T helper 1 type T cells and T helper 2 type T cells.
- antigen presenting cell includes professional antigen presenting cells (e.g., B lymphocytes, monocytes, dendritic cells, Langerhans cells), as well as other antigen presenting cells (e.g., keratinocytes, endothelial cells, astrocytes, fibroblasts, and oligodendrocytes).
- therapeutic effect refers to a local or systemic effect in animals, particularly mammals, and more particularly humans, caused by a pharmacologically active substance.
- the term thus means any substance intended for use in the diagnosis, cure, mitigation, treatment or prevention of disease or in the enhancement of desirable physical or mental development and conditions in an animal or human.
- therapeutically- effective amount means that amount of such a substance that produces some desired local or systemic effect at a reasonable benefit/risk ratio applicable to any treatment.
- a therapeutically effective amount of a compound will depend on its therapeutic index, solubility, and the like.
- certain compounds discovered by the methods of the present invention may be administered in a sufficient amount to produce a reasonable benefit/risk ratio applicable to such treatment.
- terapéuticaally-effective amount and “effective amount” as used herein means that amount of a compound, material, or composition comprising a compound of the present invention which is effective for producing some desired therapeutic effect in at least a sub-population of cells in an animal at a reasonable benefit/risk ratio applicable to any medical treatment.
- Toxicity and therapeutic efficacy of subject compounds may be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 and the ED50. Compositions that exhibit large therapeutic indices are preferred.
- the LD50 lethal dosage
- the LD50 can be measured and can be, for example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more reduced for the agent relative to no administration of the agent.
- the ED50 i.e., the concentration which achieves a half-maximal inhibition of symptoms
- the ED50 can be measured and can be, for example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more increased for the agent relative to no administration of the agent.
- the ICso i.e., the concentration which achieves half-maximal cytotoxic or cytostatic effect on cancer cells
- the ICso can be measured and can be, for example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more increased for the agent relative to no administration of the agent.
- cancer cell growth in an assay can be inhibited by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or even 100%.
- At least about a 10% , 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or even 100% decrease in a solid malignancy can be achieved.
- a “transcribed polynucleotide” or “nucleotide transcript” is a polynucleotide (e.g. an mRNA, hnRNA, a cDNA, or an analog of such RNA or cDNA) which is complementary to or homologous with all or a portion of a mature mRNA made by transcription of a biomarker nucleic acid and normal post-transcriptional processing (e.g. splicing), if any, of the RNA transcript, and reverse transcription of the RNA transcript.
- a polynucleotide e.g. an mRNA, hnRNA, a cDNA, or an analog of such RNA or cDNA
- the term "unresponsiveness” includes refractivity of cancer cells to therapy or refractivity of therapeutic cells, such as immune cells, to stimulation, e.g., stimulation via an activating receptor or a cytokine. Unresponsiveness can occur, e.g., because of exposure to immunosuppressants or exposure to high doses of antigen.
- the term “anergy” or “tolerance” includes refractivity to activating receptor- mediated stimulation. Such refractivity is generally antigen-specific and persists after exposure to the tolerizing antigen has ceased. For example, anergy in T cells (as opposed to unresponsiveness) is characterized by lack of cytokine production, e.g., IL-2.
- T cell anergy occurs when T cells are exposed to antigen and receive a first signal (a T cell receptor or CD-3 mediated signal) in the absence of a second signal (a costimulatory signal). Under these conditions, reexposure of the cells to the same antigen (even if reexposure occurs in the presence of a costimulatory polypeptide) results in failure to produce cytokines and, thus, failure to proliferate.
- Anergic T cells can, however, proliferate if cultured with cytokines (e.g., IL-2).
- cytokines e.g., IL-2
- T cell anergy can also be observed by the lack of IL-2 production by T lymphocytes as measured by ELISA or by a proliferation assay using an indicator cell line.
- a reporter gene construct can be used.
- anergic T cells fail to initiate IL-2 gene transcription induced by a heterologous promoter under the control of the 5' IL-2 gene enhancer or by a multimer of the API sequence that can be found within the enhancer (Kang et al. (1992) Science 257: 1134).
- Arginine AGA, ACG, CGA, CGC, CGG, CGT
- Glycine Gly, G
- GGC GGG, GGT
- Serine (Ser, S) AGC, AGT, TCA, TCC, TCG, TCT
- nucleotide triplet An important and well-known feature of the genetic code is its redundancy, whereby, for most of the amino acids used to make proteins, more than one coding nucleotide triplet may be employed (illustrated above). Therefore, a number of different nucleotide sequences may code for a given amino acid sequence. Such nucleotide sequences are considered functionally equivalent since they result in the production of the same amino acid sequence in all organisms (although certain organisms may translate some sequences more efficiently than they do others). Moreover, occasionally, a methylated variant of a purine or pyrimidine may be found in a given nucleotide sequence. Such methylations do not affect the coding relationship between the trinucleotide codon and the corresponding amino acid.
- nucleotide sequence of a DNA or RNA encoding a biomarker nucleic acid can be used to derive the polypeptide amino acid sequence, using the genetic code to translate the DNA or RNA into an amino acid sequence.
- polypeptide amino acid sequence corresponding nucleotide sequences that can encode the polypeptide can be deduced from the genetic code (which, because of its redundancy, will produce multiple nucleic acid sequences for any given amino acid sequence).
- description and/or disclosure herein of a nucleotide sequence which encodes a polypeptide should be considered to also include description and/or disclosure of the amino acid sequence encoded by the nucleotide sequence.
- description and/or disclosure of a polypeptide amino acid sequence herein should be considered to also include description and/or disclosure of all possible nucleotide sequences that can encode the amino acid sequence.
- nucleic acid and amino acid sequence information for the loci and biomarkers of the present invention are well- known in the art and readily available on publicly available databases, such as the National Center for Biotechnology Information (NCBI).
- NCBI National Center for Biotechnology Information
- exemplary nucleic acid and amino acid sequences derived from publicly available sequence databases are provided below and include, for example, PCT Publ. WO 2014/022759, which is incorporated herein in its entirety by this reference.
- RNA nucleic acid molecules e.g., thymines replaced with uredines
- nucleic acid molecules encoding orthologs of the encoded proteins as well as DNA or RNA nucleic acid sequences comprising a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or more identity across their full length with the nucleic acid sequence of any SEQ ID NO listed in Table 1, or a portion thereof.
- nucleic acid molecules can have a function of the full-length nucleic acid as described further herein.
- the subject for whom predicted likelihood of efficacy of an inhibitor of one or more biomarkers listed in Table 1 and an immunotherapy combination treatment is determined is a mammal (e.g., mouse, rat, primate, non-human mammal, domestic animal, such as a dog, cat, cow, horse, and the like), and is preferably a human.
- the subject is an animal model of cancer.
- the animal model can be an orthotopic xenograft animal model of a human-derived cancer.
- the subject has not undergone treatment, such as chemotherapy, radiation therapy, targeted therapy, and/or immunotherapies.
- the subject has undergone treatment, such as chemotherapy, radiation therapy, targeted therapy, and/or immunotherapies.
- the subject has had surgery to remove cancerous or precancerous tissue.
- the cancerous tissue has not been removed, e.g., the cancerous tissue may be located in an inoperable region of the body, such as in a tissue that is essential for life, or in a region where a surgical procedure would cause considerable risk of harm to the patient.
- the methods of the present invention can be used to determine the responsiveness to inhibitors of one or more biomarkers listed in Table 1 and immunotherapy combination treatment of many different cancers in subjects such as those described herein.
- biomarker amount and/or activity measurement(s) in a sample from a subject is compared to a predetermined control (standard) sample.
- the sample from the subject is typically from a diseased tissue, such as cancer cells or tissues.
- the control sample can be from the same subject or from a different subject.
- the control sample is typically a normal, non-diseased sample.
- the control sample can be from a diseased tissue.
- the control sample can be a combination of samples from several different subjects.
- the biomarker amount and/or activity measurement(s) from a subject is compared to a pre-determined level. This pre-determined level is typically obtained from normal samples.
- a "pre-determined" biomarker amount and/or activity measurement(s) may be a biomarker amount and/or activity measurement(s) used to, by way of example only, evaluate a subject that may be selected for treatment (e.g., based on the number of genomic mutations and/or the number of genomic mutations causing non-functional proteins for DNA repair genes), evaluate a response to an inhibitor of one or more biomarkers listed in Table 1 and an immunotherapy combination treatment, and/or evaluate a response to inhibitors of one or more biomarkers listed in Table 1, in combination with an immunotherapy with or without additional anti- cancer therapies.
- a pre-determined biomarker amount and/or activity measurement s) may be determined in populations of patients with or without cancer.
- the pre-determined biomarker amount and/or activity measurement(s) can be a single number, equally applicable to every patient, or the pre-determined biomarker amount and/or activity measurement(s) can vary according to specific subpopulations of patients. Age, weight, height, and other factors of a subject may affect the pre-determined biomarker amount and/or activity measurement(s) of the individual. Furthermore, the pre-determined biomarker amount and/or activity can be determined for each subject individually. In one embodiment, the amounts determined and/or compared in a method described herein are based on absolute measurements.
- the amounts determined and/or compared in a method described herein are based on relative measurements, such as ratios (e.g., biomarker copy numbers, level, and/or activity before a treatment vs. after a treatment, such biomarker measurements relative to a spiked or man-made control, such biomarker measurements relative to the expression of a housekeeping gene, and the like).
- the relative analysis can be based on the ratio of pre-treatment biomarker measurement as compared to post-treatment biomarker measurement.
- Pre-treatment biomarker measurement can be made at any time prior to initiation of anti-cancer therapy.
- Post-treatment biomarker measurement can be made at any time after initiation of anti-cancer therapy.
- post-treatment biomarker measurements are made 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 weeks or more after initiation of anti-cancer therapy, and even longer toward indefinitely for continued monitoring.
- Treatment can comprise anti-cancer therapy, such as a therapeutic regimen comprising one or more inhibitors of one or more biomarkers listed in Table 1 and immunotherapy combination treatment alone or in combination with other anti-cancer agents, such as with immune checkpoint inhibitors.
- the pre-determined biomarker amount and/or activity measurement(s) can be any suitable standard.
- the pre-determined biomarker amount and/or activity measurement(s) can be obtained from the same or a different human for whom a patient selection is being assessed.
- the pre-determined biomarker amount and/or activity measurement s) can be obtained from a previous assessment of the same patient. In such a manner, the progress of the selection of the patient can be monitored over time.
- the control can be obtained from an assessment of another human or multiple humans, e.g., selected groups of humans, if the subject is a human.
- the extent of the selection of the human for whom selection is being assessed can be compared to suitable other humans, e.g., other humans who are in a similar situation to the human of interest, such as those suffering from similar or the same condition(s) and/or of the same ethnic group.
- the change of biomarker amount and/or activity measurement s) from the pre-determined level is about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, or 5.0 fold or greater, or any range in between, inclusive.
- cutoff values apply equally when the measurement is based on relative changes, such as based on the ratio of pre-treatment biomarker measurement as compared to post-treatment biomarker measurement.
- Body fluids refer to fluids that are excreted or secreted from the body as well as fluids that are normally not (e.g., amniotic fluid, aqueous humor, bile, blood and blood plasma, cerebrospinal fluid, cerumen and earwax, cowper's fluid or pre-ejaculatory fluid, chyle, chyme, stool, female ejaculate, interstitial fluid, intracellular fluid, lymph, menses, breast milk, mucus, pleural fluid, pus, saliva, sebum, semen, serum, sweat, synovial fluid, tears, urine, vaginal lubrication, vitreous humor, vomit).
- the subject and/or control sample is selected from the group consisting of cells, cell lines, histological slides, paraffin embedded tissues, biopsies, whole blood, nipple aspirate, serum, plasma, buccal scrape, saliva, cerebrospinal fluid, urine, stool, and bone marrow.
- the sample is serum, plasma, or urine.
- the sample is serum.
- the samples can be collected from individuals repeatedly over a longitudinal period of time (e.g., once or more on the order of days, weeks, months, annually, biannually, etc.). Obtaining numerous samples from an individual over a period of time can be used to verify results from earlier detections and/or to identify an alteration in biological pattern as a result of, for example, disease progression, drug treatment, etc. For example, subject samples can be taken and monitored every month, every two months, or combinations of one, two, or three month intervals according to the present invention.
- biomarker amount and/or activity measurements of the subject obtained over time can be conveniently compared with each other, as well as with those of normal controls during the monitoring period, thereby providing the subject's own values, as an internal, or personal, control for long-term monitoring.
- Sample preparation and separation can involve any of the procedures, depending on the type of sample collected and/or analysis of biomarker measurement(s).
- Such procedures include, by way of example only, concentration, dilution, adjustment of pH, removal of high abundance polypeptides (e.g., albumin, gamma globulin, and transferrin, etc.), addition of preservatives and calibrants, addition of protease inhibitors, addition of denaturants, desalting of samples, concentration of sample proteins, extraction and purification of lipids.
- the sample preparation can also isolate molecules that are bound in non-covalent complexes to other protein (e.g., carrier proteins).
- carrier proteins e.g., albumin
- This process may isolate those molecules bound to a specific carrier protein (e.g., albumin), or use a more general process, such as the release of bound molecules from all carrier proteins via protein denaturation, for example using an acid, followed by removal of the carrier proteins.
- undetectable proteins from a sample can be achieved using high affinity reagents, high molecular weight filters, ultracentrifugation and/or electrodialysis.
- High affinity reagents include antibodies or other reagents (e.g., aptamers) that selectively bind to high abundance proteins.
- Sample preparation could also include ion exchange chromatography, metal ion affinity chromatography, gel filtration, hydrophobic chromatography, chromatofocusing, adsorption chromatography, isoelectric focusing and related techniques.
- Molecular weight filters include membranes that separate molecules on the basis of size and molecular weight. Such filters may further employ reverse osmosis, nanofiltration, ultrafiltration and microfiltration.
- Ultracentrifugation is a method for removing undesired polypeptides from a sample. Ultracentrifugation is the centrifugation of a sample at about 15,000-60,000 rpm while monitoring with an optical system the sedimentation (or lack thereof) of particles.
- Electrodialysis is a procedure which uses an electromembrane or semipermable membrane in a process in which ions are transported through semi-permeable membranes from one solution to another under the influence of a potential gradient. Since the membranes used in electrodialysis may have the ability to selectively transport ions having positive or negative charge, reject ions of the opposite charge, or to allow species to migrate through a semipermable membrane based on size and charge, it renders electrodialysis useful for concentration, removal, or separation of electrolytes.
- Separation and purification in the present invention may include any procedure known in the art, such as capillary electrophoresis (e.g., in capillary or on-chip) or chromatography (e.g., in capillary, column or on a chip).
- Electrophoresis is a method which can be used to separate ionic molecules under the influence of an electric field.
- Electrophoresis can be conducted in a gel, capillary, or in a microchannel on a chip.
- gels used for electrophoresis include starch, acrylamide, polyethylene oxides, agarose, or combinations thereof.
- a gel can be modified by its cross-linking, addition of detergents, or denaturants, immobilization of enzymes or antibodies (affinity
- capillaries used for electrophoresis include capillaries that interface with an electrospray.
- CE Capillary electrophoresis
- CZE capillary zone electrophoresis
- CIEF capillary isoelectric focusing
- cITP capillary isotachophoresis
- CEC capillary electrochromatography
- Capillary isotachophoresis is a technique in which the analytes move through the capillary at a constant speed but are nevertheless separated by their respective mobilities.
- Capillary zone electrophoresis also known as free-solution CE (FSCE)
- FSCE free-solution CE
- CIEF Capillary isoelectric focusing
- CEC is a hybrid technique between traditional high performance liquid chromatography (UPLC) and CE.
- Chromatography can be based on the differential adsorption and elution of certain analytes or partitioning of analytes between mobile and stationary phases.
- Different examples of chromatography include, but not limited to, liquid chromatography (LC), gas chromatography (GC), high performance liquid chromatography (UPLC), etc.
- nucleic acid molecule is intended to include DNA molecules (e.g., cDNA or genomic DNA) and RNA molecules (e.g., mPvNA) and analogs of the DNA or RNA generated using nucleotide analogs.
- the nucleic acid molecule can be single-stranded or double-stranded, but preferably is double- stranded DNA.
- nucleic acid molecule is one which is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid molecule.
- an "isolated" nucleic acid molecule is free of sequences (preferably protein- encoding sequences) which naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived.
- the isolated nucleic acid molecule can contain less than about 5 kB, 4 kB, 3 kB, 2 kB, 1 kB, 0.5 kB or 0.1 kB of nucleotide sequences which naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived.
- an "isolated" nucleic acid molecule such as a cDNA molecule, can be substantially free of other cellular material or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.
- a biomarker nucleic acid molecule of the present invention can be isolated using standard molecular biology techniques and the sequence information in the database records described herein. Using all or a portion of such nucleic acid sequences, nucleic acid molecules of the present invention can be isolated using standard hybridization and cloning techniques (e.g., as described in Sambrook et al, ed., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989).
- a nucleic acid molecule of the present invention can be amplified using cDNA, mRNA, or genomic DNA as a template and appropriate oligonucleotide primers according to standard PCR amplification techniques.
- the nucleic acid molecules so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis.
- oligonucleotides corresponding to all or a portion of a nucleic acid molecule of the present invention can be prepared by standard synthetic techniques, e.g., using an automated DNA synthesizer.
- nucleic acid molecule of the present invention can comprise only a portion of a nucleic acid sequence, wherein the full length nucleic acid sequence comprises a marker of the present invention or which encodes a polypeptide corresponding to a marker of the present invention.
- nucleic acid molecules can be used, for example, as a probe or primer.
- the probe/primer typically is used as one or more substantially purified oligonucleotides.
- the oligonucleotide typically comprises a region of nucleotide sequence that hybridizes under stringent conditions to at least about 7, preferably about 15, more preferably about 25, 50, 75, 100, 125, 150, 175, 200, 250, 300, 350, or 400 or more consecutive nucleotides of a biomarker nucleic acid sequence.
- Probes based on the sequence of a biomarker nucleic acid molecule can be used to detect transcripts or genomic sequences corresponding to one or more markers of the present invention.
- the probe comprises a label group attached thereto, e.g., a radioisotope, a fluorescent compound, an enzyme, or an enzyme co-factor.
- a biomarker nucleic acid molecules that differ, due to degeneracy of the genetic code, from the nucleotide sequence of nucleic acid molecules encoding a protein which corresponds to the biomarker, and thus encode the same protein, are also contemplated.
- DNA sequence polymorphisms that lead to changes in the amino acid sequence can exist within a population (e.g., the human population). Such genetic polymorphisms can exist among individuals within a population due to natural allelic variation. An allele is one of a group of genes which occur alternatively at a given genetic locus.
- DNA polymorphisms that affect RNA expression levels can also exist that may affect the overall expression level of that gene (e.g., by affecting regulation or degradation).
- allele refers to alternative forms of a gene or portions thereof. Alleles occupy the same locus or position on homologous chromosomes. When a subject has two identical alleles of a gene, the subject is said to be homozygous for the gene or allele. When a subject has two different alleles of a gene, the subject is said to be heterozygous for the gene or allele.
- biomarker alleles can differ from each other in a single nucleotide, or several nucleotides, and can include substitutions, deletions, and insertions of nucleotides.
- An allele of a gene can also be a form of a gene containing one or more mutations.
- allelic variant of a polymorphic region of gene refers to an alternative form of a gene having one of several possible nucleotide sequences found in that region of the gene in the population.
- allelic variant is meant to encompass functional allelic variants, non-functional allelic variants, SNPs, mutations and polymorphisms.
- single nucleotide polymorphism S P refers to a polymorphic site occupied by a single nucleotide, which is the site of variation between allelic sequences.
- the site is usually preceded by and followed by highly conserved sequences of the allele (e.g., sequences that vary in less than 1/100 or 1/1000 members of a population).
- a SNP usually arises due to substitution of one nucleotide for another at the polymorphic site.
- SNPs can also arise from a deletion of a nucleotide or an insertion of a nucleotide relative to a reference allele.
- the polymorphic site is occupied by a base other than the reference base.
- the altered allele can contain a "C” (cytidine), “G” (guanine), or "A” (adenine) at the polymorphic site.
- SNP's may occur in protein-coding nucleic acid sequences, in which case they may give rise to a defective or otherwise variant protein, or genetic disease. Such a SNP may alter the coding sequence of the gene and therefore specify another amino acid (a "missense” SNP) or a SNP may introduce a stop codon (a "nonsense” SNP).
- SNP When a SNP does not alter the amino acid sequence of a protein, the SNP is called "silent.” SNP's may also occur in noncoding regions of the nucleotide sequence. This may result in defective protein expression, e.g., as a result of alternative spicing, or it may have no effect on the function of the protein.
- the terms "gene” and “recombinant gene” refer to nucleic acid molecules comprising an open reading frame encoding a polypeptide corresponding to a marker of the present invention. Such natural allelic variations can typically result in 1-5% variance in the nucleotide sequence of a given gene. Alternative alleles can be identified by sequencing the gene of interest in a number of different individuals. This can be readily carried out by using hybridization probes to identify the same genetic locus in a variety of individuals. Any and all such nucleotide variations and resulting amino acid
- polymorphisms or variations that are the result of natural allelic variation and that do not alter the functional activity are intended to be within the scope of the present invention.
- a biomarker nucleic acid molecule is at least 7, 15, 20, 25, 30, 40, 60, 80, 100, 150, 200, 250, 300, 350, 400, 450, 550, 650, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2200, 2400, 2600, 2800, 3000, 3500, 4000, 4500, or more nucleotides in length and hybridizes under stringent conditions to a nucleic acid molecule corresponding to a marker of the present invention or to a nucleic acid molecule encoding a protein corresponding to a marker of the present invention.
- hybridizes under stringent conditions is intended to describe conditions for hybridization and washing under which nucleotide sequences at least 60% (65%, 70%), 75%), 80%), preferably 85%>) identical to each other typically remain hybridized to each other.
- stringent conditions are known to those skilled in the art and can be found in sections 6.3.1-6.3.6 of Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989).
- a preferred, non-limiting example of stringent hybridization conditions are hybridization in 6X sodium chloride/sodium citrate (SSC) at about 45°C, followed by one or more washes in 0.2X SSC, 0.1% SDS at 50-65°C.
- allelic variants of a nucleic acid molecule of the present invention that can exist in the population, the skilled artisan will further appreciate that sequence changes can be introduced by mutation thereby leading to changes in the amino acid sequence of the encoded protein, without altering the biological activity of the protein encoded thereby.
- sequence changes can be introduced by mutation thereby leading to changes in the amino acid sequence of the encoded protein, without altering the biological activity of the protein encoded thereby.
- a "non-essential" amino acid residue is a residue that can be altered from the wild-type sequence without altering the biological activity, whereas an "essential" amino acid residue is required for biological activity.
- amino acid residues that are not conserved or only semi-conserved among homologs of various species may be non-essential for activity and thus would be likely targets for alteration.
- amino acid residues that are conserved among the homologs of various species ⁇ e.g., murine and human
- amino acid residues that are conserved among the homologs of various species may be essential for activity and thus would not be likely targets for alteration.
- nucleic acid molecules encoding a polypeptide of the present invention that contain changes in amino acid residues that are not essential for activity.
- polypeptides differ in amino acid sequence from the naturally-occurring proteins which correspond to the markers of the present invention, yet retain biological activity.
- a biomarker protein has an amino acid sequence that is at least about 40% identical, 50%, 60%>, 70%, 75%, 80%, 83%, 85%, 87.5%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or identical to the amino acid sequence of a biomarker protein described herein.
- An isolated nucleic acid molecule encoding a variant protein can be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence of nucleic acids of the present invention, such that one or more amino acid residue substitutions, additions, or deletions are introduced into the encoded protein. Mutations can be introduced by standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis. Preferably, conservative amino acid substitutions are made at one or more predicted non-essential amino acid residues.
- a "conservative amino acid substitution” is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art.
- amino acids with basic side chains e.g., lysine, arginine, histidine
- acidic side chains e.g., aspartic acid, glutamic acid
- uncharged polar side chains e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine
- non-polar side chains e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan
- beta-branched side chains e.g., threonine, valine, isoleucine
- aromatic side chains e.g., tyrosine, phenylalanine, tryptophan, histidine
- mutations can be introduced randomly along all or part of the coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for biological activity to identify mutants that retain activity.
- the encoded protein can be expressed recombinantly and the activity of the protein can be determined.
- the present invention further contemplates the use of anti- biomarker antisense nucleic acid molecules, i.e., molecules which are complementary to a sense nucleic acid of the present invention, e.g., complementary to the coding strand of a double-stranded cDNA molecule corresponding to a marker of the present invention or complementary to an mRNA sequence corresponding to a marker of the present invention.
- an antisense nucleic acid molecule of the present invention can hydrogen bond to (i.e. anneal with) a sense nucleic acid of the present invention.
- the antisense nucleic acid can be complementary to an entire coding strand, or to only a portion thereof, e.g., all or part of the protein coding region (or open reading frame).
- An antisense nucleic acid molecule can also be antisense to all or part of a non-coding region of the coding strand of a nucleotide sequence encoding a polypeptide of the present invention.
- the non- coding regions (“5' and 3' untranslated regions") are the 5' and 3' sequences which flank the coding region and are not translated into amino acids.
- An antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 or more nucleotides in length.
- An antisense nucleic acid can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art.
- an antisense nucleic acid e.g., an antisense oligonucleotide
- an antisense nucleic acid e.g., an antisense oligonucleotide
- modified nucleotides which can be used to generate the antisense nucleic acid include 5- fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4- acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2- thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
- the antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been sub-cloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest, described further in the following subsection).
- the antisense nucleic acid molecules of the present invention are typically administered to a subject or generated in situ such that they hybridize with or bind to cellular mRNA and/or genomic DNA encoding a polypeptide corresponding to a selected marker of the present invention to thereby inhibit expression of the marker, e.g., by inhibiting transcription and/or translation.
- the hybridization can be by conventional nucleotide complementarity to form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule which binds to DNA duplexes, through specific interactions in the major groove of the double helix.
- antisense nucleic acid molecules of the present invention examples include direct injection at a tissue site or infusion of the antisense nucleic acid into a blood- or bone marrow-associated body fluid.
- antisense nucleic acid molecules can be modified to target selected cells and then administered systemically.
- antisense molecules can be modified such that they specifically bind to receptors or antigens expressed on a selected cell surface, e.g., by linking the antisense nucleic acid molecules to peptides or antibodies which bind to cell surface receptors or antigens.
- the antisense nucleic acid molecules can also be delivered to cells using the vectors described herein. To achieve sufficient intracellular concentrations of the antisense molecules, vector constructs in which the antisense nucleic acid molecule is placed under the control of a strong pol II or pol III promoter are preferred.
- An antisense nucleic acid molecule of the present invention can be an a-anomeric nucleic acid molecule.
- An a-anomeric nucleic acid molecule forms specific double- stranded hybrids with complementary RNA in which, contrary to the usual a-units, the strands run parallel to each other (Gaultier et al, 1987, Nucleic Acids Res. 15:6625-6641).
- the antisense nucleic acid molecule can also comprise a 2'-o-methylribonucleotide (Inoue et al, 1987 ', Nucleic Acids Res. 15:6131-6148) or a chimeric RNA-DNA analogue (Inoue et al, 1987, FEBSLett. 215:327-330).
- Ribozymes are catalytic RNA molecules with ribonuclease activity which are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region.
- ribozymes ⁇ e.g., hammerhead ribozymes as described in Haselhoff and Gerlach, 1988, Nature 334:585-591) can be used to catalytically cleave mRNA transcripts to thereby inhibit translation of the protein encoded by the mRNA.
- a ribozyme having specificity for a nucleic acid molecule encoding a polypeptide corresponding to a marker of the present invention can be designed based upon the nucleotide sequence of a cDNA corresponding to the marker.
- a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved (see Cech et al. U.S. Patent No. 4,987,071; and Cech et al. U.S. Patent No. 5,116,742).
- an mRNA encoding a polypeptide of the present invention can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules (see, e.g., Bartel and Szostak, 1993, Science 261 : 1411-1418).
- the present invention also encompasses nucleic acid molecules which form triple helical structures.
- expression of a biomarker protein can be inhibited by targeting nucleotide sequences complementary to the regulatory region of the gene encoding the polypeptide ⁇ e.g., the promoter and/or enhancer) to form triple helical structures that prevent transcription of the gene in target cells.
- nucleotide sequences complementary to the regulatory region of the gene encoding the polypeptide e.g., the promoter and/or enhancer
- the nucleic acid molecules of the present invention can be modified at the base moiety, sugar moiety or phosphate backbone to improve, e.g., the stability, hybridization, or solubility of the molecule.
- the deoxyribose phosphate backbone of the nucleic acid molecules can be modified to generate peptide nucleic acid molecules (see Hyrup et al, 1996, Bioorganic & Medicinal Chemistry 4(1): 5- 23).
- peptide nucleic acids refer to nucleic acid mimics, e.g., DNA mimics, in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleobases are retained.
- the neutral backbone of PNAs has been shown to allow for specific hybridization to DNA and RNA under conditions of low ionic strength.
- the synthesis of PNA oligomers can be performed using standard solid phase peptide synthesis protocols as described in Hyrup et al. (1996), supra; Perry-O'Keefe et al. (1996) Proc. Natl. Acad. Sci. USA 93 : 14670-675.
- PNAs can be used in therapeutic and diagnostic applications.
- PNAs can be used as antisense or antigene agents for sequence-specific modulation of gene expression by, e.g. , inducing transcription or translation arrest or inhibiting replication.
- PNAs can also be used, e.g., in the analysis of single base pair mutations in a gene by, e.g., PNA directed PCR clamping; as artificial restriction enzymes when used in combination with other enzymes, e.g., SI nucleases (Hyrup (1996), supra; or as probes or primers for DNA sequence and hybridization (Hyrup, 1996, supra; Perry-O'Keefe et al, 1996, Proc. Natl. Acad. Sci. USA 93 : 14670-675).
- PNAs can be modified, e.g., to enhance their stability or cellular uptake, by attaching lipophilic or other helper groups to PNA, by the formation of PNA-DNA chimeras, or by the use of liposomes or other techniques of drug delivery known in the art.
- PNA-DNA chimeras can be generated which can combine the advantageous properties of PNA and DNA.
- Such chimeras allow DNA recognition enzymes, e.g., RNASE H and DNA polymerases, to interact with the DNA portion while the PNA portion would provide high binding affinity and specificity.
- PNA-DNA chimeras can be linked using linkers of appropriate lengths selected in terms of base stacking, number of bonds between the nucleobases, and orientation (Hyrup, 1996, supra).
- the synthesis of PNA-DNA chimeras can be performed as described in Hyrup (1996), supra, and Finn et al. (1996) Nucleic Acids Res. 24(17):3357-63.
- a DNA chain can be synthesized on a solid support using standard phosphoramidite coupling chemistry and modified nucleoside analogs.
- the oligonucleotide can include other appended groups such as peptides ⁇ e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al, 1989, Proc. Natl. Acad. Sci. USA 86:6553-6556; Lemaitre et al, 1987, Proc. Natl. Acad. Sci. USA 84:648-652; PCT
- oligonucleotides can be modified with hybridization-triggered cleavage agents (see, e.g., Krol et al, 1988, Bio/Techniques 6:958-976) or intercalating agents (see, e.g., Zon, 1988, Pharm. Res. 5:539-549).
- the oligonucleotide can be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc.
- Another aspect of the present invention pertains to the use of biomarker proteins and biologically active portions thereof.
- the native polypeptide in one embodiment, the native polypeptide
- polypeptides corresponding to a marker can be isolated from cells or tissue sources by an appropriate purification scheme using standard protein purification techniques.
- polypeptides corresponding to a marker of the present invention are produced by
- a polypeptide corresponding to a marker of the present invention can be synthesized chemically using standard peptide synthesis techniques.
- an “isolated” or “purified” protein or biologically active portion thereof is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the protein is derived, or substantially free of chemical precursors or other chemicals when chemically synthesized.
- the language “substantially free of cellular material” includes preparations of protein in which the protein is separated from cellular components of the cells from which it is isolated or recombinantly produced.
- protein that is substantially free of cellular material includes preparations of protein having less than about 30%, 20%, 10%, or 5% (by dry weight) of heterologous protein (also referred to herein as a "contaminating protein").
- the protein or biologically active portion thereof is recombinantly produced, it is also preferably substantially free of culture medium, i.e., culture medium represents less than about 20%, 10%, or 5% of the volume of the protein preparation.
- culture medium represents less than about 20%, 10%, or 5% of the volume of the protein preparation.
- the protein is produced by chemical synthesis, it is preferably substantially free of chemical precursors or other chemicals, i.e., it is separated from chemical precursors or other chemicals which are involved in the synthesis of the protein. Accordingly such preparations of the protein have less than about 30%, 20%, 10%, 5% (by dry weight) of chemical precursors or compounds other than the polypeptide of interest.
- Biomarker polypeptides include polypeptides comprising amino acid sequences sufficiently identical to or derived from a biomarker protein amino acid sequence described herein, but which includes fewer amino acids than the full length protein, and exhibit at least one activity of the corresponding full-length protein.
- biologically active portions comprise a domain or motif with at least one activity of the corresponding protein.
- a biologically active portion of a protein of the present invention can be a polypeptide which is, for example, 10, 25, 50, 100 or more amino acids in length.
- other biologically active portions, in which other regions of the protein are deleted can be prepared by recombinant techniques and evaluated for one or more of the functional activities of the native form of a polypeptide of the present invention.
- Preferred polypeptides have an amino acid sequence of a biomarker protein encoded by a nucleic acid molecule described herein.
- Other useful proteins are substantially identical (e.g., at least about 40%, preferably 50%, 60%, 70%, 75%, 80%, 83%, 85%, 88%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) to one of these sequences and retain the functional activity of the protein of the corresponding naturally-occurring protein yet differ in amino acid sequence due to natural allelic variation or mutagenesis.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Urology & Nephrology (AREA)
- Biomedical Technology (AREA)
- Hematology (AREA)
- Medicinal Chemistry (AREA)
- Hospice & Palliative Care (AREA)
- Cell Biology (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Physics & Mathematics (AREA)
- Food Science & Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The present invention relates, in part, to methods of treating a cancer in a subject comprising administering to the subject a therapeutically effective amount of an agent that inhibits one or more biomarkers listed in Table 1, such as regulators of TNF signaling/NF-κB activation (e.g., RIPK1, BIRC2, TBK1, TRAF3, RNF31, RBCK1, OTULIN, TRAF6, TAB2, and TNIP1), in combination with an immunotherapy.
Description
MODULATING BIOMARKERS TO INCREASE TUMOR IMMUNITY AND IMPROVE THE EFFICACY OF CANCER IMMUNOTHERAPY
Cross-Reference to Related Applications
This application claims the benefit of U.S. Provisional Application No. 62/532,593, filed on 14 July 2017; the entire contents of said application are incorporated herein in their entirety by this reference.
Background of the Invention
The striking clinical success of cancer immunotherapy with checkpoint blockade suggests it is likely to form the foundation of curative therapy for many malignancies (Reck et al. (2016) N. Engl. J. Med. 375: 1823-1833; Hodi et al. (2010) N. Engl. J. Med. 363 :711- 723; Postow et al. (2015) N. Engl. J. Med. 372:2006-2017; Wolchok et al. (2013) N. Engl. J. Med. 369: 122-133; Ferris et al. (2016) N. Engl. J. Med. 375: 1856-1867; Brahmer et al. (2012) N. Engl. J. Med. 366:2455-2465; Nghiem et al. (2016) N. Engl. J. Med. 374:2542- 2552; Topalian et al. (2012) N. Engl. J. Med. 366:2443-2454); Motzer et al. (2015) N. Engl. J. Med. 373 : 1803-1813). However, despite these successes, checkpoint blockade does not achieve sustained clinical response in most patients (Tumeh et al. (2014) Nature 515:568- 571; Kelderman et al. (2014) Mol. Oncol. 8: 1132-1139; Zaretsky et al. (2016) N. Engl. J. Med. 375:819-829). Additional therapeutic strategies are therefore needed to increase the clinical efficacy of immunotherapy. Moreover, the optimal strategy for combining emerging cancer immunotherapies with checkpoint blockade remains uncertain.
A relatively small number of genes, such as PD-L1, that enable tumors to evade the immune system have been discovered and most of these are already the focus of intense efforts to develop new immunotherapies (Freeman et al. (2000) J. Exp. Med. 192: 1027-
1034; Hirano et al. (2005) Cancer Res. 65: 1089-1096; Dong et al. (2002) Nat. Med. 8:793- 800; Balachandran et al. (2011) Nat. Med. 17: 1094-1100; Spranger et al. (2013) Sci Transl Med. 5:200ral l6; Holmgaard et al. (2013) J. Exp. Med. 210: 1389-1402; Sockolosky et al. (2016) Proc. Natl. Acad. Sci. U.S.A. 113 :E2646-654; Liu et al. (2015) Nat. Med. 21 : 1209- 1215; Weiskopf et al. (2016) J. Clin. Invest. 126:2610-2620; Tseng et al. (2013) Proc. Natl. Acad. Sci. U.S.A. 110: 11103-11108; Sica et a/. (2003) Immunity 18:849-861; Zang et al. (2007) Proc. Natl. Acad. Sci. U.S.A. 104, 19458-19463). Although cancer cells could, in
theory, express many more genes that regulate their response or resistance to tumor immunity, strategies to systematically discover such genes are lacking.
Loss-of-function genetic screens have been increasingly used to study the functional consequences of gene deletion on tumor cells (Howard et al. (2016) Functional Genomic Characterization of Cancer Genomes. Cold Spring Harb. Symp. Quant. Biol. (2016); Ebert et al. (2008) Nature 451 :335-339; Cowley et al. (2014) Scientific Data 1 : article number 140035). These approaches include pooled genetic screens using CRISPR-Cas9-mediated genome editing that simultaneously test the role of a large number of genes on tumor cell growth, viability or drug resistance (Wang et al. (2014) Science 343 :80-84; Shalem et al. (2014) Science 343 :84-87). However, these screens have generally been conducted in vitro, where the contribution of the immune system is absent, or have studied phenotypes such as metastasis that do not directly evaluate the role of tumor immunity (Hart et al. (2015) Cell 163 : 1515-1526; Yu et al. (2016) Nat. Biotechnol. 34:419-423; Chen et al. (2015) Cell 160: 1246-1260).
Despite the dramatic clinical success of cancer immunotherapy with PD-1 checkpoint blockade, most patients do not experience sustained clinical benefit from treatment. Accordingly a great need in the art exists for additional therapeutic strategies.
Summary of the Invention
The present invention is based, at least in part, on the discovery that inhibiting or blocking one or more biomarkers listed in Table 1, such as one or more regulators of T F signaling and/or F-κΒ activation {e.g., receptor-interacting serine/threonine-protein kinase 1 (RIPK1), BIRC2, TBK1, TRAF3, RNF31, RBCK1, OTULIN, TRAF6, TAB2, and TNIP1), in combination with an immunotherapy, results in a synergistic therapeutic benefit for treating cancers that is unexpected given the lack of such benefit observed for the immunotherapy alone.
In one aspect, a method of treating a subject afflicted with a cancer comprising administering to the subject a therapeutically effective amount of an agent that inhibits one or more biomarkers listed in Table 1 or a fragment thereof, in combination with an immunotherapy, is provided.
Numerous embodiments are further provided that can be applied to any aspect of the present invention and/or combined with any other embodiment described herein. For example, in one embodiment, the agent described herein decreases the copy number, the
expression level, and/or the activity of one or more biomarkers in Table 1 (e.g., one or more regulators of TNF signaling and/or NF-κΒ activation (e.g., RIPKl, BIRC2, TBKl, TRAF3, RNF31, RBCK1, OTULIN, TRAF6, TAB2, and TNIP1). In another embodiment, the agent selectively decreases the activity of one or more biomarkers in Table 1, such as decreasing the serine/threonine-protein kinase activity and/or the receptor-binding activity of one or more regulators of TNF signaling and/or NF-κΒ activation (e.g., receptor- interacting serine/threonine-protein kinase 1 (RIPKl), BIRC2, TBKl, TRAF3, RNF31, RBCK1, OTULIN, TRAF6, TAB2, and TNIP1). In still another embodiment, the agent described herein is a small molecule inhibitor, CRISPR single-guide RNA (sgRNA), RNA interfering agent, antisense oligonucleotide, peptide or peptidomimetic inhibitor, aptamer, or intrabody. In another embodiment, the RNA interfering agent is a small interfering RNA (siRNA), CRISPR RNA (crRNA), a small hairpin RNA (shRNA), a microRNA (miRNA), or a piwi-interacting RNA (piRNA). In still another embodiment, the RNA interfering agent is a CRISPR single-guide RNA (sgRNA). In yet another embodiment, the sgRNA comprises a nucleic acid sequence selected from the group consisting of nucleic acid sequence listed in Table 2. In one embodiment, the agent described herein comprises an intrabody, or an antigen binding fragment thereof, which specifically binds to the one or more biomarkers in Table 1 and/or a substrate of the one or more biomarkers in Table 1. In another embodiment, the intrabody, or antigen binding fragment thereof, is murine, chimeric, humanized, composite, or human. In still another embodiment, the intrabody, or antigen binding fragment thereof, is detectably labeled, comprises an effector domain, comprises an Fc domain, and/or is selected from the group consisting of Fv, Fav, F(ab')2, Fab', dsFv, scFv, sc(Fv)2, and diabodies fragments. In yet another embodiment, the intrabody, or antigen binding fragment thereof, is conjugated to a cytotoxic agent. In one embodiment, the cytotoxic agent is selected from the group consisting of a
chemotherapeutic agent, a biologic agent, a toxin, and a radioactive isotope. In still another embodiment, the agent described herein increases the sensitivity of the cancer cells to an immunotherapy. In another embodiment, the immunotherapy and/or a cancer therapy is administered before, after, or concurrently with the agent. In still another embodiment, the immunotherapy comprises an anti-cancer vaccine and/or virus. In yet embodiment, the immunotherapy is cell-based. In one embodiment, immunotherapy inhibits an immune checkpoint. In another embodiment, the immune checkpoint is selected from the group consisting of CTLA-4, PD-1, VISTA, B7-H2, B7-H3, PD-L1, B7-H4, B7-H6, ICOS,
HVEM, PD-L2, CD160, gp49B, PIR-B, KIR family receptors, TIM-1, TIM-3, TIM-4, LAG-3, GITR, 4-IBB, OX-40, BTLA, SIRP, CD47, CD48, 2B4 (CD244), B7.1, B7.2, ILT- 2, ILT-4, TIGIT, HHLA2, butyrophilins, IDO, CD39, CD73 and A2aR. In still another embodiment, the immune checkpoint is selected from the group consisting of PD-1, PD-Ll, and PD-L2. In yet another embodiment, the immune checkpoint is PD-1. In another embodiment, the one or more biomarker described herein comprises a nucleic acid sequence having at least 95% identity to a nucleic acid sequence listed in Table 1 and/or encodes an amino acid sequence having at least 95% identity to an amino acid sequence listed in Table 1. In still another embodiment, the one or more biomarker is human, mouse, chimeric, or a fusion. In yet another embodiment, the agent reduces the number of proliferating cells in the cancer and/or reduces the volume or size of a tumor comprising the cancer cells. In another embodiment, the agent increases the sensitivity of the cancer to the immunotherapy. In still another embodiment, the one or more biomarkers comprise an amino acid sequence listed in Table 1, optionally wherein the amino acid sequence is selected from the group consisting of SEQ ID Nos: 2, 4, 6, 9, 11, 14, 16, 18, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 42, 44, 47, 49, 51, 54, 57, 60, 62, 64, 66, 68, 73, 76, 78, 80, 83, 86, and 88. In yet another embodiment, the one or more biomarkers are encoded by a nucleic acid sequence listed in Table 1, optionally wherein the nucleic acid sequence is selected from the group consisting of SEQ ID Nos: 1, 3, 5, 7, 8, 10, 12, 13, 15, 17, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 41, 43, 45, 46, 48, 50, 52, 53, 55, 56, 58, 59, 61, 63, 65, 67, 69-72, 74, 75, 77, 79, 81, 82, 84, 85, and 87. In one embodiment, the cancer is melanoma. In another embodiment, the subject is an animal model of the cancer, preferably a mouse model, or a human. In still another embodiment, the method described herein further comprises administering to the subject at least one additional cancer therapy or regimen. In another embodiment, the at least one additional cancer therapy or regimen is administered before, after, or concurrently with the agent and/or the immunotherapy. In yet another embodiment, the agent described herein is administered in a pharmaceutically acceptable formulation.
In another aspect, a method of killing cancer cells comprising contacting the cancer cells with an agent that inhibits the copy number, the expression level, and/or the activity of one or more biomarkers listed in Table 1 or a fragment thereof, in combination with an immunotherapy, is provided.
As described above, numerous embodiments are further provided that can be applied to any aspect of the present invention and/or combined with any other embodiment described herein. For example, in one embodiment, the agent described herein decreases the copy number, the expression level, and/or the activity of one or more regulators of TNF signaling and/or F-κΒ activation (e.g., RIPK1, BIRC2, TBK1, TRAF3, R F31, RBCK1, OTULIN, TRAF6, TAB2, and TNIP1). In another embodiment, the agent selectively decreases activity of one or more biomarkers in Table 1, such as decreasing the phosphatase activity and/or the substrate binding activity of one or more kinase signaling inhibitors. In still another embodiment, the agent is a small molecule inhibitor, CRISPR single-guide RNA (sgRNA), RNA interfering agent, antisense oligonucleotide, peptide or
peptidomimetic inhibitor, aptamer, or intrabody. In one embodiment, the RNA interfering agent described herein is a small interfering RNA (siRNA), CRISPR RNA (crRNA), a small hairpin RNA (shRNA), a microRNA (miRNA), or a piwi-interacting RNA (piRNA). In another embodiment, the RNA interfering agent is a CRISPR single-guide RNA
(sgRNA). In still another embodiment, the sgRNA comprises a nucleic acid sequence selected from the group consisting of nucleic acid sequence listed in Table 2. In one embodiment, the agent described herein comprises an intrabody, or an antigen binding fragment thereof, which specifically binds to the one or more biomarkers in Table 1 and/or a substrate of the one or more biomarkers in Table 1. In another embodiment, the intrabody, or antigen binding fragment thereof, is murine, chimeric, humanized, composite, or human. In still another embodiment, the intrabody, or antigen binding fragment thereof, is detectably labeled, comprises an effector domain, comprises an Fc domain, and/or is selected from the group consisting of Fv, Fav, F(ab')2, Fab', dsFv, scFv, sc(Fv)2, and diabodies fragments. In yet another embodiment, the intrabody, or antigen binding fragment thereof, is conjugated to a cytotoxic agent. In one embodiment, the cytotoxic agent is selected from the group consisting of a chemotherapeutic agent, a biologic agent, a toxin, and a radioactive isotope. In one embodiment, the agent described herein increases the sensitivity of the cancer cells to an immunotherapy. In another embodiment, the cancer cells are contacted with an immunotherapy and/or a cancer therapy before, after, or concurrently with the agent. In still another embodiment, the immunotherapy comprises an anti-cancer vaccine and/or virus. In one embodiment, the immunotherapy is cell-based. In another embodiment, the immunotherapy inhibits an immune checkpoint. In still another embodiment, the immune checkpoint is selected from the group consisting of CTLA-4, PD-
1, VISTA, B7-H2, B7-H3, PD-L1, B7-H4, B7-H6, ICOS, HVEM, PD-L2, CD160, gp49B, PIR-B, KIR family receptors, TIM-1, TIM-3, TIM-4, LAG-3, GITR, 4-IBB, OX-40, BTLA, SIRP, CD47, CD48, 2B4 (CD244), B7.1, B7.2, ILT-2, ILT-4, TIGIT, HHLA2, butyrophilins, IDO, CD39, CD73 and A2aR. In yet another embodiment, the immune checkpoint is selected from the group consisting of PD-1, PD-L1, and PD-L2. In one embodiment, the immune checkpoint is PD-1. In another embodiment, the biomarker described herein comprises a nucleic acid sequence having at least 95% identity to a nucleic acid sequence listed in Table 1 and/or encodes an amino acid sequence having at least 95% identity to an amino acid sequence listed in Table 1. In still another embodiment, the one or more biomarker is human, mouse, chimeric, or a fusion. In one embodiment, the agent described herein reduces the number of proliferating cells in the cancer and/or reduces the volume or size of a tumor comprising the cancer cells. In another embodiment, the agent increases the sensitivity of the cancer to the immunotherapy. In still another embodiment, the one or more biomarkers comprise an amino acid sequence listed in Table 1, optionally wherein the amino acid sequence is selected from the group consisting of SEQ ID Nos: 2, 4, 6, 9, 11, 14, 16, 18, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 42, 44, 47, 49, 51, 54, 57, 60, 62, 64, 66, 68, 73, 76, 78, 80, 83, 86, and 88. In yet another embodiment, the one or more biomarkers are encoded by a nucleic acid sequence listed in Table 1, optionally wherein the nucleic acid sequence is selected from the group consisting of SEQ ID Nos: 1, 3, 5, 7, 8, 10, 12, 13, 15, 17, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 41, 43, 45, 46, 48, 50, 52, 53, 55, 56, 58, 59, 61, 63, 65, 67, 69-72, 74, 75, 77, 79, 81, 82, 84, 85, and 87. In one embodiment, the cancer is melanoma. In another embodiment, the subject is an animal model of the cancer, preferably a mouse model, or a human. In still another embodiment, the method described herein further comprises administering to the subject at least one additional cancer therapy or regimen. In yet another embodiment, the at least one additional cancer therapy or regimen is administered before, after, or concurrently with the agent and/or the immunotherapy. In another embodiment, the agent described herein is administered in a pharmaceutically acceptable formulation.
In still another aspect, a method of determining whether a subject afflicted with a cancer or at risk for developing a cancer would benefit from inhibiting the copy number, amount, and/or activity of at least one biomarker listed in Table 1 is provided, the method comprising a) obtaining a biological sample from the subject; b) determining the copy number, amount, and/or activity of at least one biomarker listed in Table 1; c) determining
the copy number, amount, and/or activity of the at least one biomarker in a control; and d) comparing the copy number, amount, and/or activity of the at least one biomarker detected in steps b) and c); wherein the presence of, or a significant increase in, the copy number, amount, and/or activity of, the at least one biomarker listed in Table 1 in the subject sample relative to the control copy number, amount, and/or activity of the at least one biomarker indicates that the subject afflicted with the cancer or at risk for developing the cancer would benefit from inhibiting the copy number, amount, and/or activity of the at least one biomarker listed in Table 1. In one embodiment, the method described herein further comprises recommending, prescribing, or administering an agent that inhibits the at least one biomarker listed in Table 1 if the cancer is determined to benefit from the agent. In another embodiment, the method described herein further comprises administering at least one additional cancer therapy that is administered before, after, or concurrently with the agent. In still another embodiment, the method described herein further comprises recommending, prescribing, or administering cancer therapy other than an agent that inhibits the at least one biomarker listed in Table 1 if the cancer is determined to not benefit from the agent. In yet another embodiment, the cancer therapy is selected from the group consisting of immunotherapy, targeted therapy, chemotherapy, radiation therapy, hormonal therapy, an anti-cancer vaccine, an anti-cancer virus, and a checkpoint inhibitor. In one embodiment, the control sample is determined from a cancerous or non-cancerous sample from either the patient or a member of the same species to which the patient belongs. In another embodiment, the control sample comprises cells.
In yet another aspect, a method for predicting the clinical outcome of a subject afflicted with a cancer expressing one or more biomarkers listed in Table 1 or a fragment thereof to treatment with an immunotherapy is provided, the method comprising a) determining the copy number, amount, and/or activity of at least one biomarker listed in Table 1 in a subject sample; b) determining the copy number, amount, and/or activity of the at least one biomarker in a control having a good clinical outcome; and c) comparing the copy number, amount, and/or activity of the at least one biomarker in the subject sample and in the control; wherein the presence of, or a significant increase in, the copy number, amount, and/or activity of, the at least one biomarker listed in Table 1 in the subject sample as compared to the copy number, amount and/or activity in the control, is an indication that the subject has a poor clinical outcome.
In another aspect, a method for monitoring the progression of a cancer in a subject, wherein the subject is administered a therapeutically effective amount of an agent that inhibits the copy number, amount, and/or activity of at least one biomarker listed in Table 1 and an immunotherapy is provided, the method comprising a) detecting in a subject sample at a first point in time the copy number, amount, and/or activity of at least one biomarker listed in Table 1; b) repeating step a) at a subsequent point in time; and c) comparing the amount or activity of at least one biomarker listed in Table 1 detected in steps a) and b) to monitor the progression of the cancer in the subject.
In still another aspect, a method of assessing the efficacy of an agent that inhibits the copy number, amount, and/or activity of at least one biomarker listed in Table 1 and an immunotherapy for treating a cancer in a subject is provided, comprising a) detecting in a subject sample at a first point in time the copy number, amount, and/or or activity of at least one biomarker listed in Table 1; b) repeating step a) during at least one subsequent point in time after administration of the agent and the immunotherapy; and c) comparing the copy number, amount, and/or activity detected in steps a) and b), wherein the absence of, or a significant decrease in, the copy number, amount, and/or activity of, the at least one biomarker listed in Table 1, in the subsequent sample as compared to the copy number, amount, and/or activity in the sample at the first point in time, indicates that the agent and immunotherapy treats the cancer in the subject.
As described above, numerous embodiments can be applied to any aspect of the present invention. For example, in one embodiment, between the first point in time and the subsequent point in time, the subject has undergone treatment, completed treatment, and/or is in remission for the cancer. In another embodiment, the cancer treatment is selected from the group consisting of immunotherapy, targeted therapy, chemotherapy, radiation therapy, hormonal therapy, an anti-cancer vaccine, an anti-cancer virus, and a checkpoint inhibitor. In still another embodiment, the first and/or at least one subsequent sample is selected from the group consisting of ex vivo and in vivo samples. In yet another embodiment, the first and/or at least one subsequent sample is a portion of a single sample or pooled samples obtained from the subject. In another embodiment, the sample described herein comprises cells, serum, peritumoral tissue, and/or intratumoral tissue obtained from the subject. In another embodiment, the one or more biomarkers listed in Table 1 comprise RTPK1, BIRC2, TBK1, TRAF3, R F31, RBCK1, OTULIN, TRAF6, TAB2, and TNIP1. In still another embodiment, the cancer is melanoma. In yet another embodiment, the cancer is in
a subject and the subject is a mammal. In one embodiment, the mammal is a mouse or a human. In another embodiment, the mammal is a human.
In still another aspect, an agent that inhibits one or more biomarkers listed in Table 1, such as one or more regulators of TNF signaling and/or NF-κΒ activation (e.g., RIPKl, BIRC2, TBKl, TRAF3, RNF31, RBCKl, OTULIN, TRAF6, TAB2, and TNIP1), is provided for treating a cancer in a subject, in combination with an immunotherapy. Such agent may comprise a small molecule inhibitor, an RNA interfering agent, an antisense oligonucleotide, a peptide or peptidomimetic inhibitor, an aptamer, and/or an intrabody, as described herein.
In yet another aspect, a vector comprising an agent that inhibits one or more biomarkers listed in Table 1, such as one or more regulators of TNF signaling and/or NF- KB activation (e.g., RIPKl, BIRC2, TBKl, TRAF3, RNF31, RBCKl, OTULIN, TRAF6, TAB2, and TNIP1), for treating a cancer in a subject, in combination with an
immunotherapy, is provided.
In another aspect, a host cell which comprises an agent that inhibits one or more biomarkers listed in Table 1, such as one or more regulators of TNF signaling and/or NF- KB activation (e.g., RIPKl, BIRC2, TBKl, TRAF3, RNF31, RBCKl, OTULIN, TRAF6, TAB2, and TNIP1), for treating a cancer in a subject, in combination with an
immunotherapy, is provided.
In still another aspect, a host cell which comprises a vector comprising an agent that inhibits one or more biomarkers listed in Table 1, such as one or more regulators of TNF signaling and/or NF-κΒ activation (e.g., RIPKl, BIRC2, TBKl, TRAF3, RNF31, RBCKl, OTULIN, TRAF6, TAB2, and TNIP1), for treating a cancer in a subject, in combination with an immunotherapy, is provided.
In yet another aspect, a device or kit comprising the agent that inhibits one or more biomarkers listed in Table 1, such as one or more regulators of TNF signaling and/or NF- KB activation (e.g., RIPKl, BIRC2, TBKl, TRAF3, RNF31, RBCKl, OTULIN, TRAF6, TAB2, and TNIP1), for treating a cancer in a subject, in combination with an
immunotherapy, is provided.
Brief Description of the Drawings
Figure 1 includes 6 panels, identified as panels A, B, C, D, E, and F, which show that in vivo pooled loss-of-function screening using CRISPR/Cas9 in tumor cells recovers
known mediators of immune evasion. Panel A shows a schematic diagram of the in vivo screening system using the B 16 transplantable tumor model. Tumor volumes (in mm3) were compared under each conditions, averaged for each group at each time point (Panel B, left) or for individual animals on the day of sacrifice (Panel B, right). Bars represent means, while whiskers represent standard deviation. Enrichment analysis was carried out using a hypergeometric test to show functional classes of genes, (from the Gene Ontology Consortium database (GO)) targeted by sgRNAs, that were enriched or depleted in tumors in animals, including animals treated with irradiated tumor cell vaccine (GVAX) and anti- PD-1 antibody and the TCRa" " animals (Panel C). Frequency histogram (Panel D, top) and collapsed histograms (Panel D, middle) of enrichment or depletion (normalized as Z scores) are shown for all 9,992 sgRNAs screened. Enrichment/depletion scores are averaged from 10 mice per condition. sgRNAs targeting PD-L1 are indicated by the red lines (Panel D, middle). PD-L1 expression is compared among Cas9-expressing B16 tumor cells transfected with one of the four sgRNAs targeting PD-L1 (red) or a control sgRNA (grey) (Panel D, bottom). Similar to Panel D, Panel E shows the depletion of CD47 by its specific sgRNAs (indicated in red (top and middle) and CD47 expression after CRISPR editing with sgRNAs targeting CD47 (bottom). Panel F compares tumor volumes over time between CD47 null (red) and control (grey) tumors growing in mice treated with GVAX and PD-1 blockade (average and standard error of the mean; n = 10 animals per group). ** p < 0.01; *** , < 0.001; **** p < 0.0001.
Figure 2 includes 6 panels, identified as panels A, B, C, D, E, and F, which show the performance analysis of the screening in Figure 1. Panel A shows Western blot of B 16 cell lysate for Cas9 and β-ACTIN with or without transduction with a lentiviral vector encoding Cas9. A pie chart shows the fraction of genes targeted in the screening in each of the GO term categories indicated (Panel B). Two-dimensional histograms show the pair- wise distribution of sgRNAs abundance (averaged for each condition) (Panel C).
Saturation analysis of animal replicates from the three in vivo screening conditions is shown in Panel D. Pearson correlations are calculated for the library distribution in one animal vs. any other animal, then for two animals averaged versus any other two averaged, and so on. Saturation approaches r = 0.95. A matrix of the Pearson correlations of the library distribution from one animal compared to any other animal for B 16 Pool 1 is shown (Panel E). Expression of CD47 by B16 cells transfected with either CD47-targeting (red) or control (grey) sgRNA is compared (Panel F).
Figure 3 includes 3 panels, identified as panels A, B, and C, which show that loss of TNF signaling and/or NF-κΒ activation regulators (e.g., Ripkl) causes resistance to immunotherapy. Panel A shows frequency histogram (top) and collapsed histograms (below) of enrichment or depletion (normalized as z scores) for all sgRNAs in GVAX+ PD- 1 blockade-treated mice relative to TCRa_/" mice, as in Figure 1. Red bars indicate the sgRNAs for the genes listed on the left. Representative flow plots show the frequencies of control or Ripkl null B16 cells for the conditions indicated (Panel B). Specifically, mixtures of Ripkl null tumors and control tumors (in a 1 : 10 ratio) were tested in vitro, in TCRa"/_ mice, or GVAX + PD-1 blockade-treated wild-type mice. The B16 cell numbers in immunotherapy -treated wild-type mice (treated with different sgRNAs) were compared relative to those in TCRa_/" mice, the change in the ratios (log2 normalized fold change) is shown in Panel C (mean and standard deviation; n = 8-10 mice per group). **** p < 0.0001. Detailed Description of the Invention
It has been determined herein that negative regulators of one or more biomarkers listed in Table 1, such as one or more regulators of TNF signaling and/or NF-κΒ activation {e.g., RIPK1, BIRC2, TBK1, TRAF3, RNF31, RBCK1, OTULIN, TRAF6, TAB2, and TNIPl) can be used to increase interferon sensing by tumor cells and augment tumor immunity and immunotherapies. Thus, the instant disclosure provides at least a method of treating cancers, e.g., those cancer types otherwise not responsive or weakly responsive to immunotherapies, with a combination of a negative regulator of one or more biomarkers listed in Table 1, such as one or more regulators of TNF signaling and/or NF-κΒ activation (e.g., RIPK1, BIRC2, TBK1, TRAF3, RNF31, RBCK1, OTULIN, TRAF6, TAB2, and TNIPl), in combination with another immunotherapy. The results described herein are unexpected given that analyses of RIPK1 function has heretofore been largely confined to hematopoietic cells and not examined in cancer cells, as well as the fact that modulating sensitivity to immunotherapy is critical for immunotherapy effects rather than simply modulating interferon availability since interferon therapy is known to not significantly augment immunotherapy effects. Accordingly, the present invention provides exemplary RNA interfering agents inhibiting one or more biomarkers listed in Table 1, such as one or more regulators of TNF signaling and/or NF-κΒ activation (e.g., RIPK1, BIRC2, TBK1, TRAF3, RNF31, RBCK1, OTULIN, TRAF6, TAB2, and TNIPl), which may be used in
the combination therapy and other methods described herein, such as agents that inhibit biomarker function and/or its ability to interact/bind to its substrates described herein, or by increasing its degradation and/or stability and/or interaction/binding to its inhibitors.
Similarly, methods of screening for biomarker inhibitors and methods of diagnosing, prognosing, and monitoring cancer involving biomarker/immunotherapy combination therapies are provided.
I. Definitions
The articles "a" and "an" are used herein to refer to one or to more than one (i.e. to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.
The term "altered amount" or "altered level" refers to increased or decreased copy number (e.g., germline and/or somatic) of a biomarker nucleic acid, e.g., increased or decreased expression level in a cancer sample, as compared to the expression level or copy number of the biomarker nucleic acid in a control sample. The term "altered amount" of a biomarker also includes an increased or decreased protein level of a biomarker protein in a sample, e.g., a cancer sample, as compared to the corresponding protein level in a normal, control sample. Furthermore, an altered amount of a biomarker protein may be determined by detecting posttranslational modification such as methylation status of the marker, which may affect the expression or activity of the biomarker protein.
The amount of a biomarker in a subject is "significantly" higher or lower than the normal amount of the biomarker, if the amount of the biomarker is greater or less, respectively, than the normal level by an amount greater than the standard error of the assay employed to assess amount, and preferably at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or than that amount. Alternately, the amount of the biomarker in the subject can be considered "significantly" higher or lower than the normal amount if the amount is at least about two, and preferably at least about three, four, or five times, higher or lower, respectively, than the normal amount of the biomarker. Such "significance" can also be applied to any other measured parameter described herein, such as for expression, inhibition, cytotoxicity, cell growth, and the like.
The term "altered level of expression" of a biomarker refers to an expression level or copy number of the biomarker in a test sample, e.g., a sample derived from a patient suffering from cancer, that is greater or less than the standard error of the assay employed
to assess expression or copy number, and is preferably at least twice, and more preferably three, four, five or ten or more times the expression level or copy number of the biomarker in a control sample (e.g., sample from a healthy subjects not having the associated disease) and preferably, the average expression level or copy number of the biomarker in several control samples. The altered level of expression is greater or less than the standard error of the assay employed to assess expression or copy number, and is preferably at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 300%, 350%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more times the expression level or copy number of the biomarker in a control sample (e.g., sample from a healthy subjects not having the associated disease) and preferably, the average expression level or copy number of the biomarker in several control samples. In some embodiments, the level of the biomarker refers to the level of the biomarker itself, the level of a modified biomarker (e.g., phosphorylated biomarker), or to the level of a biomarker relative to another measured variable, such as a control (e.g., phosphorylated biomarker relative to an unphosphorylated biomarker).
The term "altered activity" of a biomarker refers to an activity of the biomarker which is increased or decreased in a disease state, e.g., in a cancer sample, as compared to the activity of the biomarker in a normal, control sample. Altered activity of the biomarker may be the result of, for example, altered expression of the biomarker, altered protein level of the biomarker, altered structure of the biomarker, or, e.g., an altered interaction with other proteins involved in the same or different pathway as the biomarker or altered interaction with transcriptional activators or inhibitors.
The term "altered structure" of a biomarker refers to the presence of mutations or allelic variants within a biomarker nucleic acid or protein, e.g., mutations which affect expression or activity of the biomarker nucleic acid or protein, as compared to the normal or wild-type gene or protein. For example, mutations include, but are not limited to substitutions, deletions, or addition mutations. Mutations may be present in the coding or non-coding region of the biomarker nucleic acid.
Unless otherwise specified here within, the terms "antibody" and "antibodies" refers to antigen-binding portions adaptable to be expressed within cells as "intracellular antibodies." (Chen et al. (19 ) Human Gene Ther. 5:595-601). Methods are well-known in the art for adapting antibodies to target (e.g., inhibit) intracellular moieties, such as the use of single-chain antibodies (scFvs), modification of immunoglobulin VL domains for
hyperstability, modification of antibodies to resist the reducing intracellular environment, generating fusion proteins that increase intracellular stability and/or modulate intracellular localization, and the like. Intracellular antibodies can also be introduced and expressed in one or more cells, tissues or organs of a multicellular organism, for example for
prophylactic and/or therapeutic purposes (e.g., as a gene therapy) (see, at least PCT Pubis. WO 08/020079, WO 94/02610, WO 95/22618, and WO 03/014960; U.S. Pat. No.
7,004,940; Cattaneo and Biocca (1997) Intracellular Antibodies: Development and
Applications (Landes and Springer- Verlag pubis.); Kontermann (2004) Methods 34: 163- 170; Cohen et al. (1998) Oncogene 17:2445-2456; Auf der Maur et al. (2001) FEBS Lett. 508:407-412; Shaki-Loewenstein et al. (2005) J. Immunol. Meth. 303 : 19-39).
Antibodies may be polyclonal or monoclonal; xenogeneic, allogeneic, or syngeneic; or modified forms thereof (e.g. humanized, chimeric, etc.). Antibodies may also be fully human. Preferably, antibodies of the present invention bind specifically or substantially specifically to a biomarker polypeptide or fragment thereof. The terms "monoclonal antibodies" and "monoclonal antibody composition", as used herein, refer to a population of antibody polypeptides that contain only one species of an antigen binding site capable of immunoreacting with a particular epitope of an antigen, whereas the term "polyclonal antibodies" and "polyclonal antibody composition" refer to a population of antibody polypeptides that contain multiple species of antigen binding sites capable of interacting with a particular antigen. A monoclonal antibody composition typically displays a single binding affinity for a particular antigen with which it immunoreacts.
Antibodies may also be "humanized", which is intended to include antibodies made by a non-human cell having variable and constant regions which have been altered to more closely resemble antibodies that would be made by a human cell. For example, by altering the non-human antibody amino acid sequence to incorporate amino acids found in human germline immunoglobulin sequences. The humanized antibodies of the present invention may include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo), for example in the CDRs. The term "humanized antibody", as used herein, also includes antibodies in which CDR sequences derived from the germline of another mammalian species, such as a mouse, have been grafted onto human framework sequences.
The term "assigned score" refers to the numerical value designated for each of the biomarkers after being measured in a patient sample. The assigned score correlates to the absence, presence or inferred amount of the biomarker in the sample. The assigned score can be generated manually (e.g., by visual inspection) or with the aid of instrumentation for image acquisition and analysis. In certain embodiments, the assigned score is determined by a qualitative assessment, for example, detection of a fluorescent readout on a graded scale, or quantitative assessment. In one embodiment, an "aggregate score," which refers to the combination of assigned scores from a plurality of measured biomarkers, is determined. In one embodiment the aggregate score is a summation of assigned scores. In another embodiment, combination of assigned scores involves performing mathematical operations on the assigned scores before combining them into an aggregate score. In certain, embodiments, the aggregate score is also referred to herein as the "predictive score."
The term "biomarker" refers to a measurable entity of the present invention that has been determined to be predictive of combinatorial therapy effects on a cancer using one or more inhibitors of TNF signaling and/or F-κΒ activation (e.g., RIPK1, BIRC2, TBK1, TRAF3, RNF31, RBCK1, OTULIN, TRAF6, TAB2, and TNIP1), in combination with an immunotherapy (e.g., immune checkpoint inhibitors). Biomarkers can include, without limitation, nucleic acids and proteins, including those shown in the Tables, the Examples, the Figures, and otherwise described herein. As described herein, any relevant
characteristic of a biomarker can be used, such as the copy number, amount, activity, location, modification (e.g., phosphorylation), and the like.
A "blocking" antibody or an antibody "antagonist" is one which inhibits or reduces at least one biological activity of the antigen(s) it binds. In certain embodiments, the blocking antibodies or antagonist antibodies or fragments thereof described herein substantially or completely inhibit a given biological activity of the antigen(s).
The term "body fluid" refers to fluids that are excreted or secreted from the body as well as fluids that are normally not (e.g. amniotic fluid, aqueous humor, bile, blood and blood plasma, cerebrospinal fluid, cerumen and earwax, cowper's fluid or pre-ejaculatory fluid, chyle, chyme, stool, female ejaculate, interstitial fluid, intracellular fluid, lymph, menses, breast milk, mucus, pleural fluid, pus, saliva, sebum, semen, serum, sweat, synovial fluid, tears, urine, vaginal lubrication, vitreous humor, vomit).
The terms "cancer" or "tumor" or "hyperproliferative" refer to the presence of cells possessing characteristics typical of cancer-causing cells, such as uncontrolled proliferation,
immortality, metastatic potential, rapid growth and proliferation rate, and certain characteristic morphological features. Unless otherwise stated, the terms include metaplasias. In some embodiments, such cells exhibit such characteristics in part or in full due to the expression and activity of the signaling pathways regulated by one or more biomarkers listed in Table 1, such as one or more regulators of TNF signaling and/or NF- KB activation (e.g., RIPK1, BIRC2, TBK1, TRAF3, RNF31, RBCK1, OTULIN, TRAF6, TAB2, and TNIP1) (e.g., F-kappaB Signaling pathway, MAP kinase pathway, JAK- STAT signaling pathway, or other signaling pathways involving receptor tyrosine kinases, non-receptor tyrosine kinases, Src family kinases, and/or signal transducer and activator of transcription (STAT) proteins). In some embodiments, the cancer cells described herein are not sensitive to at least one of immunotherapies. Such insensitivity, without limitation, may be related to the inactivation or decreased activation, compared to control cells (e.g., normal and/or wild-type non-cancer cells, and/or cancer cells without this insensitivity to immunotherapies), of interferon signaling (e.g., IFNy signaling) in such cancer cells and/or other surrounding cells and/or cells localized near to such cancer cells. In some
embodiments, the cancer cells are treatable with an agent capable of antagonizing one or more biomarkers listed in Table 1, such as one or more regulators of TNF signaling and/or NF-κΒ activation (e.g., RIPK1, BIRC2, TBK1, TRAF3, RNF31, RBCK1 , OTULIN, TRAF6, TAB2, and TNIP1). In some embodiments, the treatment with the agent antagonizing one or more biomarkers listed in Table 1 as described herein would increase IFNy signaling in such cancer cells, compared to pre-treatment situations, or would restore IFNy signaling in such cancer cells to at least comparable to the levels in control cells, so that such cancer cells would regain sensitivity to immunotherapies. The term "interferon signaling" or "IFNy signaling" used herein refers to any cell signaling downstream and/or related to the interaction of interferon (e.g., IFNy) and their receptor(s). Some exemplary IFNy cell signaling include, without limitation, the activation of macrophages and/or induction of Class II major histocompatibility complex (MHC) molecule expression, and/or activation of multiple immune effector genes through the Janus kinase (JAK)-STAT signaling pathway (e.g., through STAT1 transcription factor).
Cancer cells are often in the form of a tumor, but such cells may exist alone within an animal, or may be a non-tumorigenic cancer cell, such as a leukemia cell. As used herein, the term "cancer" includes premalignant as well as malignant cancers. Cancers include, but are not limited to, B cell cancer, e.g., multiple myeloma, Waldenstrom's
macroglobulinemia, the heavy chain diseases, such as, for example, alpha chain disease, gamma chain disease, and mu chain disease, benign monoclonal gammopathy, and immunocytic amyloidosis, melanomas, breast cancer, lung cancer, bronchus cancer, colorectal cancer, prostate cancer, pancreatic cancer, stomach cancer, ovarian cancer, urinary bladder cancer, brain or central nervous system cancer, peripheral nervous system cancer, esophageal cancer, cervical cancer, uterine or endometrial cancer, cancer of the oral cavity or pharynx, liver cancer, kidney cancer, testicular cancer, biliary tract cancer, small bowel or appendix cancer, salivary gland cancer, thyroid gland cancer, adrenal gland cancer, osteosarcoma, chondrosarcoma, cancer of hematologic tissues, and the like. Other non-limiting examples of types of cancers applicable to the methods encompassed by the present invention include human sarcomas and carcinomas, e.g., fibrosarcoma,
myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma,
angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, colorectal cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, liver cancer, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, cervical cancer, bone cancer, brain tumor, testicular cancer, lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma,
hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, retinoblastoma; leukemias, e.g., acute lymphocytic leukemia and acute myelocytic leukemia (myeloblastic, promyelocytic, myelomonocytic, monocytic and erythroleukemia); chronic leukemia (chronic myelocytic (granulocytic) leukemia and chronic lymphocytic leukemia); and polycythemia vera, lymphoma (Hodgkin's disease and non-Hodgkin's disease), multiple myeloma, Waldenstrom's macroglobulinemia, and heavy chain disease. In some embodiments, cancers are epithlelial in nature and include but are not limited to, bladder cancer, breast cancer, cervical cancer, colon cancer, gynecologic cancers, renal cancer, laryngeal cancer, lung cancer, oral cancer, head and neck cancer, ovarian cancer, pancreatic cancer, prostate cancer, or skin cancer. In other embodiments, the cancer is breast cancer, prostate cancer, lung cancer, or colon cancer. In still other
embodiments, the epithelial cancer is non-small-cell lung cancer, nonpapillary renal cell carcinoma, cervical carcinoma, ovarian carcinoma (e.g., serous ovarian carcinoma), or breast carcinoma. The epithelial cancers may be characterized in various other ways including, but not limited to, serous, endometrioid, mucinous, clear cell, Brenner, or undifferentiated.
In certain embodiments, the cancer encompasses colorectal cancer (e.g., colorectal carcinoma).
The term "colorectal cancer" as used herein, is meant to include cancer of cells of the intestinal tract below the small intestine (e.g., the large intestine (colon), including the cecum, ascending colon, transverse colon, descending colon, and sigmoid colon, and rectum). Additionally, as used herein, the term "colorectal cancer" is meant to further include cancer of cells of the duodenum and small intestine (jejunum and ileum).
Colorectal cancer also includes neoplastic diseases involving proliferation of a single clone of cells of the colon and includes adenocarcinoma and carcinoma of the colon whether in a primary site or metastasized.
Colorectal cancer (CRC) is the third most commonly diagnosed cancer and ranks second in cancer mortality. Extensive genetic and genomic analysis of human CRC has uncovered germline and somatic mutations relevant to CRC biology and malignant transformation (Fearon et al. (1990) Cell 61, 759-767). These mutations have been linked to well-defined disease stages from aberrant crypt proliferation or hyperplasic lesions to benign adenomas, to carcinoma in situ, and finally to invasive and metastatic disease, thereby establishing a genetic paradigm for cancer initiation and progression. Genetic and genomic instability are catalysts for colon carcinogenesis (Lengauer et al. (1998) Nature 396:643-649). CRC can present with two distinct genomic profiles that have been termed (i) chromosomal instability neoplasia (CIN), characterized by rampant structural and numerical chromosomal aberrations driven in part by telomere dysfunction (Artandi et al. (2000) Nature 406:641-645; Fodde et al. (2001) Nat. Rev. Cancer 1 :55-67; Maser and DePinho (2002) Science 297:565-569; Rudolph et al. (2001) Nat. Genet. 28: 155-159) and mitotic aberrations (Lengauer et al. (1998) Nature 396:643-649) and (ii) microsatellite instability neoplasia (MIN), characterized by near diploid karyotypes with alterations at the nucleotide level due to mutations in mismatch repair (MMR) genes (Fishel et al. (1993) Cell 75: 1027-1038; Ilyas et al. (\999) Eur. J. Cancer 35:335-351; Modrich (\99\) Annu. Rev. Genet. 25:229-253; Parsons et al. (1995) Science 268:738-740; Parsons et al. (1993)
Cell 75: 1227-1236). Germline MMR mutations are highly penetrant lesions which drive the MIN phenotype in hereditary nonpolyposis colorectal cancers, accounting for 1-5% of CRC cases (de la Chapelle (2004) Nat. Rev. Cancer 4:769-780; Lynch and de la Chapelle (1999) J. Med. Genet. 36:801-818; Umar et a/. (2004) Nat. Rev. Cancer 4: 153-158). While CIN and MIN are mechanistically distinct, their genomic and genetic consequences emphasize the requirement of dominant mutator mechanisms to drive intestinal epithelial cells towards a threshold of oncogenic changes needed for malignant transformation.
A growing number of genetic mutations have been identified and functionally validated in CRC pathogenesis. Activation of the WNT signaling pathway is an early requisite event for adenoma formation. Somatic alterations are present in APC in greater than 70%) of nonfamilial sporadic cases and appear to contribute to genomic instability and induce the expression of c-myc and Cyclin Dl (Fodde et al. (2001) Nat. Rev. Cancer 1 :55- 67), while activating β-catenin mutations represent an alternative means of WNT pathway deregulation in CRC (Morin (1997) Science 275: 1787-1790). K-Ras mutations occur early in neoplastic progression and are present in approximately 50% of large adenomas (Fearon and Gruber (2001) Molecular abnormalities in colon and rectal cancer, ed. J. Mendelsohm, P.H., M. Israel, and L. Liotta, W.B. Saunders, Philadelphia). The BRAF serine/threonine kinase and PIK3CA lipid kinase are mutated in 5-18% and 28%> of sporadic CRCs, respectively (Samuels et al. (2004) Science 304:554; Davies et al. (2002) Nature 417:949- 954; Rajagopalan et al. (2002) Nature 418:934; Yuen et al. (2002) Cancer Res. 62:6451- 6455). BRAF and K-ras mutations are mutually exclusive in CRC, suggesting over-lapping oncogenic activities (Davies et al. (2002) Nature 417:949-954; Rajagopalan et al. (2002) Nature 418:934). Mutations associated with CRC progression, specifically the adenoma-to- carcinoma transition, target the TP53 and the TGF-β pathways (Markowitz et al. (2002) Cancer Cell 1 :233-236). Greater than 50% of CRCs harbor TP53 inactivating mutations (Fearon and Gruber (2001) Molecular abnormalities in colon and rectal cancer, ed. J.
Mendelsohm, P.H., M. Israel, and L. Liotta, W.B. Saunders, Philadelphia) and 30%> of cases possess TGFfi-RII mutations (Markowitz (2000) Biochim. Biophys. Acta 1470:M13-M20; Markowitz et al. (1995) Science 268: 1336-1338). MIN cancers consistently inactivate TGFfi-RII by frameshift mutations, whereas CIN cancers target the pathway via inactivating somatic mutations in the TGFfi-RII kinase domain (15%>) or in the downstream signaling components of the pathway, including SMAD4 (15%>) or SMAD2 (5%>) transcription factors (Markowitz (2000) Biochim. Biophys. Acta 1470:M13-M20). In some embodiments, the
colorectal cancer is microsatellite instable (MSI) colorectal cancer (Llosa et al. (2014) Cancer Disc. CD-14-0863; published online Oct. 30, 2014). MSI represents about 15% of sporadic CRC and about 5-6% of stage IV CRCs. MSI is caused by epigenetic silencing or mutation of DNA mismatch repair genes and typically presents with lower stage disease than microsatellite stable subset (MSS) CRC. MSI highly express immune checkpoints, such as PD-1, PD-L1, CTLA-4, LAG-3, and IDO. In other embodiments, the colorectal cancer is MSS CRC.
In certain embodiments, the cancer encompasses melanoma. The term "melanoma" as used herein, is generally meant to include cancers that develop from the pigment- containing cells, known as melanocytes, in the basal layer of the epidermis. Melanomas typically occur in the skin but may rarely occur in the mouth, intestines, or eye. In women they most commonly occur on the legs, while in men they are most common on the back. Sometimes they develop from a mole with concerning changes including an increase in size, irregular edges, change in color, itchiness, or skin breakdown. Thus, the term
"melanoma" also includes cancers developing from these cells, tissues, and organs.
Melanomas are among the most dangerous forms of skin cancer and develop when unrepaired DNA damage to skin cells (most often caused by ultraviolet radiation from sunshine or tanning beds) triggers gene mutations that lead the skin cells to multiply rapidly and form malignant tumors. The primary cause of melanoma is ultraviolet light (UV) exposure in those with low levels of skin pigment. Melanomas often resemble moles; some develop from moles. Those with many moles, a history of affected family members, and who have poor immune function are at greater risk. A number of rare genetic defects such as xeroderma pigmentosum also increase risk (Azoury and Lange, 2014 Surg Clin North Am. 2014 94:945-962).
Melanoma can be divided into different types, including, at least, lentigo maligna, lentigo maligna melanoma, superficial spreading melanoma, acral lentiginous melanoma, mucosal melanoma, nodular melanoma, polypoid melanoma, desmoplastic melanoma, amelanotic melanoma, soft-tissue melanoma, melanoma with small nevus-like cells, melanoma with features of a Spitz nevus, uveal melanoma, etc. (see James, et al., 2006 Andrews' Diseases of the Skin: clinical Dermatology. Saunders Elsevier, pp. 694-9)
Diagnosis is by biopsy of any concerning skin lesion, including, at least, shave (tangential) biopsy, punch biopsy, incisional and excisional biopsies, "optical" biopsies (e.g., by reflectance confocal microscopy (RCM)), fine needle aspiration (FNA) biopsy,
surgical lymph node biopsy, sentinel lymph node biopsy, etc. In addition, visual inspection may also be used for diagnosis, such as a popular method for the signs and symptoms of melanoma as mnemonic "ABCDE": Asymmetrical skin lesion, Border of the lesion is irregular, Color: melanomas usually have multiple colors, Diameter: moles greater than 6 mm are more likely to be melanomas than smaller moles, and Enlarging: Enlarging or evolving. Another method as the "ugly duckling sign" is also known in the art (Mascaro and Mascaro, 1998 Arch Dermatol. 134: 1484-1485).
Treatment of melanoma includes surgery, chemotherapy (such as temozolomide, dacarbazine (also termed DTIC), etc.), radiation therapy, oncolytic virotherapy (e.g., see Forbes et al., 2013 Front. Genet. 4: 184), and immunotherapy (e.g., interleukin-2 (IL-2), interferon, etc.). Targeted therapies {e.g., as in Maverakis et al., 2015 Acta Derm Venereol. 95: 516-524) may include: 1) adoptive cell therapy (ACT) using TILs immune cells (tumor infiltrating lymphocytes) isolated from a person's own melanoma tumor). Cells are grown in large numbers in a laboratory and returned to the patient after a treatment that temporarily reduces normal T cells in the patient's body. TIL therapy following
lymphodepletion can result in durable complete response in a variety of setups (Besser et al., 2010 Clin. Cancer Res. 16:2646-2655); and 2) adoptive transfer of genetically altered (expressing T cell receptors (TCRs)) autologous lymphocytes into patient's lymphocytes, where the altered lymphocytes recognize and bind to the surface of melanoma cells and kill them. Other therapies include, at least, B-Raf inhibitors (such as vemurafenib, see
Chapman et al., 2011 N. Engl. J. Med. 364:2507-2516) and ipilimumab (alone or in combination with dacarbazine, see, e.g., Robert et al. (2011) N. Engl. J. Med. 364:2517- 2526).
The term "coding region" refers to regions of a nucleotide sequence comprising codons which are translated into amino acid residues, whereas the term "noncoding region" refers to regions of a nucleotide sequence that are not translated into amino acids {e.g., 5' and 3' untranslated regions).
The term "complementary" refers to the broad concept of sequence
complementarity between regions of two nucleic acid strands or between two regions of the same nucleic acid strand. It is known that an adenine residue of a first nucleic acid region is capable of forming specific hydrogen bonds ("base pairing") with a residue of a second nucleic acid region which is antiparallel to the first region if the residue is thymine or uracil. Similarly, it is known that a cytosine residue of a first nucleic acid strand is capable
of base pairing with a residue of a second nucleic acid strand which is antiparallel to the first strand if the residue is guanine. A first region of a nucleic acid is complementary to a second region of the same or a different nucleic acid if, when the two regions are arranged in an antiparallel fashion, at least one nucleotide residue of the first region is capable of base pairing with a residue of the second region. Preferably, the first region comprises a first portion and the second region comprises a second portion, whereby, when the first and second portions are arranged in an antiparallel fashion, at least about 50%, and preferably at least about 75%, at least about 90%, or at least about 95% of the nucleotide residues of the first portion are capable of base pairing with nucleotide residues in the second portion. More preferably, all nucleotide residues of the first portion are capable of base pairing with nucleotide residues in the second portion.
The term "control" refers to any reference standard suitable to provide a comparison to the expression products in the test sample. In one embodiment, the control comprises obtaining a "control sample" from which expression product levels are detected and compared to the expression product levels from the test sample. Such a control sample may comprise any suitable sample, including but not limited to a sample from a control cancer patient (can be stored sample or previous sample measurement) with a known outcome; normal tissue or cells isolated from a subject, such as a normal patient or the cancer patient, cultured primary cells/tissues isolated from a subject such as a normal subject or the cancer patient, adjacent normal cells/tissues obtained from the same organ or body location of the cancer patient, a tissue or cell sample isolated from a normal subject, or a primary cells/tissues obtained from a depository. In another preferred embodiment, the control may comprise a reference standard expression product level from any suitable source, including but not limited to housekeeping genes, an expression product level range from normal tissue (or other previously analyzed control sample), a previously determined expression product level range within a test sample from a group of patients, or a set of patients with a certain outcome (for example, survival for one, two, three, four years, etc.) or receiving a certain treatment (for example, standard of care cancer therapy). It will be understood by those of skill in the art that such control samples and reference standard expression product levels can be used in combination as controls in the methods of the present invention. In one embodiment, the control may comprise normal or non-cancerous cell/tissue sample. In another preferred embodiment, the control may comprise an expression level for a set of patients, such as a set of cancer patients, or for a set of cancer patients receiving a certain
treatment, or for a set of patients with one outcome versus another outcome. In the former case, the specific expression product level of each patient can be assigned to a percentile level of expression, or expressed as either higher or lower than the mean or average of the reference standard expression level. In another preferred embodiment, the control may comprise normal cells, cells from patients treated with combination chemotherapy, and cells from patients having benign cancer. In another embodiment, the control may also comprise a measured value for example, average level of expression of a particular gene in a population compared to the level of expression of a housekeeping gene in the same population. Such a population may comprise normal subjects, cancer patients who have not undergone any treatment (i.e., treatment naive), cancer patients undergoing standard of care therapy, or patients having benign cancer. In another preferred embodiment, the control comprises a ratio transformation of expression product levels, including but not limited to determining a ratio of expression product levels of two genes in the test sample and comparing it to any suitable ratio of the same two genes in a reference standard;
determining expression product levels of the two or more genes in the test sample and determining a difference in expression product levels in any suitable control; and determining expression product levels of the two or more genes in the test sample, normalizing their expression to expression of housekeeping genes in the test sample, and comparing to any suitable control. In particularly preferred embodiments, the control comprises a control sample which is of the same lineage and/or type as the test sample. In another embodiment, the control may comprise expression product levels grouped as percentiles within or based on a set of patient samples, such as all patients with cancer. In one embodiment a control expression product level is established wherein higher or lower levels of expression product relative to, for instance, a particular percentile, are used as the basis for predicting outcome. In another preferred embodiment, a control expression product level is established using expression product levels from cancer control patients with a known outcome, and the expression product levels from the test sample are compared to the control expression product level as the basis for predicting outcome. As demonstrated by the data below, the methods of the present invention are not limited to use of a specific cut-point in comparing the level of expression product in the test sample to the control.
The "copy number" of a biomarker nucleic acid refers to the number of DNA sequences in a cell (e.g., germline and/or somatic) encoding a particular gene product.
Generally, for a given gene, a mammal has two copies of each gene. The copy number can be increased, however, by gene amplification or duplication, or reduced by deletion. For example, germline copy number changes include changes at one or more genomic loci, wherein said one or more genomic loci are not accounted for by the number of copies in the normal complement of germline copies in a control (e.g., the normal copy number in germline DNA for the same species as that from which the specific germline DNA and corresponding copy number were determined). Somatic copy number changes include changes at one or more genomic loci, wherein said one or more genomic loci are not accounted for by the number of copies in germline DNA of a control (e.g., copy number in germline DNA for the same subject as that from which the somatic DNA and corresponding copy number were determined).
The "normal" copy number (e.g., germline and/or somatic) of a biomarker nucleic acid or "normal" level of expression of a biomarker nucleic acid or protein is the activity /level of expression or copy number in a biological sample, e.g., a sample containing tissue, whole blood, serum, plasma, buccal scrape, saliva, cerebrospinal fluid, urine, stool, and bone marrow, from a subject, e.g., a human, not afflicted with cancer, or from a corresponding non-cancerous tissue in the same subject who has cancer.
As used herein, the term "costimulate" with reference to activated immune cells includes the ability of a costimulatory molecule to provide a second, non-activating receptor mediated signal (a "costimulatory signal") that induces proliferation or effector function. For example, a costimulatory signal can result in cytokine secretion, e.g., in a T cell that has received a T cell-receptor-mediated signal. Immune cells that have received a cell-receptor mediated signal, e.g., via an activating receptor are referred to herein as "activated immune cells."
The term "determining a suitable treatment regimen for the subject" is taken to mean the determination of a treatment regimen (i.e., a single therapy or a combination of different therapies that are used for the prevention and/or treatment of the cancer in the subject) for a subject that is started, modified and/or ended based or essentially based or at least partially based on the results of the analysis according to the present invention. One example is starting an adjuvant therapy after surgery whose purpose is to decrease the risk of recurrence, another would be to modify the dosage of a particular chemotherapy. The determination can, in addition to the results of the analysis according to the present invention, be based on personal characteristics of the subject to be treated. In most cases,
the actual determination of the suitable treatment regimen for the subject will be performed by the attending physician or doctor.
The term "diagnosing cancer" includes the use of the methods, systems, and code of the present invention to determine the presence or absence of a cancer or subtype thereof in an individual. The term also includes methods, systems, and code for assessing the level of disease activity in an individual.
A molecule is "fixed" or "affixed" to a substrate if it is covalently or non-covalently associated with the substrate such that the substrate can be rinsed with a fluid (e.g. standard saline citrate, pH 7.4) without a substantial fraction of the molecule dissociating from the substrate.
The term "expression signature" or "signature" refers to a group of one or more coordinately expressed biomarkers related to a measured phenotype. For example, the genes, proteins, metabolites, and the like making up this signature may be expressed in a specific cell lineage, stage of differentiation, or during a particular biological response. The biomarkers can reflect biological aspects of the tumors in which they are expressed, such as the cell of origin of the cancer, the nature of the non-malignant cells in the biopsy, and the oncogenic mechanisms responsible for the cancer. Expression data and gene expression levels can be stored on computer readable media, e.g., the computer readable medium used in conjunction with a microarray or chip reading device. Such expression data can be manipulated to generate expression signatures.
"Homologous" as used herein, refers to nucleotide sequence similarity between two regions of the same nucleic acid strand or between regions of two different nucleic acid strands. When a nucleotide residue position in both regions is occupied by the same nucleotide residue, then the regions are homologous at that position. A first region is homologous to a second region if at least one nucleotide residue position of each region is occupied by the same residue. Homology between two regions is expressed in terms of the proportion of nucleotide residue positions of the two regions that are occupied by the same nucleotide residue. By way of example, a region having the nucleotide sequence 5'- ATTGCC-3' and a region having the nucleotide sequence 5'-TATGGC-3' share 50% homology. Preferably, the first region comprises a first portion and the second region comprises a second portion, whereby, at least about 50%, and preferably at least about 75%, at least about 90%, or at least about 95% of the nucleotide residue positions of each of the
portions are occupied by the same nucleotide residue. More preferably, all nucleotide residue positions of each of the portions are occupied by the same nucleotide residue.
The term "immune cell" refers to cells that play a role in the immune response. Immune cells are of hematopoietic origin, and include lymphocytes, such as B cells and T cells; natural killer cells; myeloid cells, such as monocytes, macrophages, eosinophils, mast cells, basophils, and granulocytes.
The term "immunotherapy" or "immunotherapies" refer to any treatment that uses certain parts of a subject's immune system to fight diseases such as cancer. The subject's own immune system is stimulated (or suppressed), with or without administration of one or more agent for that purpose. Immunotherapies that are designed to elicit or amplify an immune response are referred to as "activation immunotherapies." Immunotherapies that are designed to reduce or suppress an immune response are referred to as "suppression immunotherapies." Any agent believed to have an immune system effect on the genetically modified transplanted cancer cells can be assayed to determine whether the agent is an immunotherapy and the effect that a given genetic modification has on the modulation of immune response. In some embodiments, the immunotherapy is cancer cell-specific. In some embodiments, immunotherapy can be "untargeted," which refers to administration of agents that do not selectively interact with immune system cells, yet modulates immune system function. Representative examples of untargeted therapies include, without limitation, chemotherapy, gene therapy, and radiation therapy.
Immunotherapy is one form of targeted therapy that may comprise, for example, the use of cancer vaccines and/or sensitized antigen presenting cells. For example, an oncolytic virus is a virus that is able to infect and lyse cancer cells, while leaving normal cells unharmed, making them potentially useful in cancer therapy. Replication of oncolytic viruses both facilitates tumor cell destruction and also produces dose amplification at the tumor site. They may also act as vectors for anticancer genes, allowing them to be specifically delivered to the tumor site. The immunotherapy can involve passive immunity for short-term protection of a host, achieved by the administration of pre-formed antibody directed against a cancer antigen or disease antigen (e.g., administration of a monoclonal antibody, optionally linked to a chemotherapeutic agent or toxin, to a tumor antigen). For example, anti-VEGF and mTOR inhibitors are known to be effective in treating renal cell carcinoma. Immunotherapy can also focus on using the cytotoxic lymphocyte-recognized epitopes of cancer cell lines. Alternatively, antisense polynucleotides, ribozymes, RNA
interference molecules, triple helix polynucleotides and the like, can be used to selectively modulate biomolecules that are linked to the initiation, progression, and/or pathology of a tumor or cancer.
Immunotherapy can involve passive immunity for short-term protection of a host, achieved by the administration of pre-formed antibody directed against a cancer antigen or disease antigen (e.g., administration of a monoclonal antibody, optionally linked to a chemotherapeutic agent or toxin, to a tumor antigen). Immunotherapy can also focus on using the cytotoxic lymphocyte-recognized epitopes of cancer cell lines. Alternatively, antisense polynucleotides, ribozymes, RNA interference molecules, triple helix
polynucleotides and the like, can be used to selectively modulate biomolecules that are linked to the initiation, progression, and/or pathology of a tumor or cancer.
In some embodiments, the immunotherapy described herein comprises at least one of immunogenic chemotherapies. The term "immunogenic chemotherapy" refers to any chemotherapy that has been demonstrated to induce immunogenic cell death, a state that is detectable by the release of one or more damage-associated molecular pattern (DAMP) molecules, including, but not limited to, calreticulin, ATP and HMGB1 (Kroemer et al. (2013), Annu. Rev. Immunol., 31 :51-72). Specific representative examples of consensus immunogenic chemotherapies include anthracyclines, such as doxorubicin and the platinum drug, oxaliplatin, 5'-fluorouracil, among others.
In some embodiments, immunotherapy comprises inhibitors of one or more immune checkpoints. The term "immune checkpoint" refers to a group of molecules on the cell surface of CD4+ and/or CD8+ T cells that fine-tune immune responses by down- modulating or inhibiting an anti-tumor immune response. Immune checkpoint proteins are well-known in the art and include, without limitation, CTLA-4, PD-1, VISTA, B7-H2, B7- H3, PD-L1, B7-H4, B7-H6, ICOS, HVEM, PD-L2, CD160, gp49B, PIR-B, KIR family receptors, TIM-1, TIM-3, TIM-4, LAG-3, GITR, 4-IBB, OX-40, BTLA, SIRP, CD47, CD48, 2B4 (CD244), B7.1, B7.2, ILT-2, ILT-4, TIGIT, HHLA2, butyrophilins, IDO, CD39, CD73 and A2aR (see, for example, WO 2012/177624). The term further encompasses biologically active protein fragment, as well as nucleic acids encoding full- length immune checkpoint proteins and biologically active protein fragments thereof. In some embodiment, the term further encompasses any fragment according to homology descriptions provided herein. In one embodiment, the immune checkpoint is PD-1.
Immune checkpoints and their sequences are well-known in the art and
representative embodiments are described below. For example, the term "PD-1" refers to a member of the immunoglobulin gene superfamily that functions as a coinhibitory receptor having PD-L1 and PD-L2 as known ligands. PD-1 was previously identified using a subtraction cloning based approach to select for genes upregulated during TCR-induced activated T cell death. PD-1 is a member of the CD28/CTLA-4 family of molecules based on its ability to bind to PD-L1. Like CTLA-4, PD-1 is rapidly induced on the surface of T- cells in response to anti-CD3 (Agata et al. 25 (1996) Int. Immunol. 8:765). In contrast to CTLA-4, however, PD-1 is also induced on the surface of B-cells (in response to anti-IgM). PD-1 is also expressed on a subset of thymocytes and myeloid cells (Agata et al. (1996) supra; Nishimura et al. (1996) Int. Immunol. 8:773).
The nucleic acid and amino acid sequences of a representative human PD-1 biomarker is available to the public at the GenBank database under NM 005018.2 and NP_005009.2 and is shown in Table 1 (see also Ishida et al. (1992) 20 EMBO J 11 :3887; Shinohara et al. (1994) Genomics 23 :704; U.S. Patent 5,698,520). PD-1 has an
extracellular region containing immunoglobulin superfamily domain, a transmembrane domain, and an intracellular region including an immunoreceptor tyrosine-based inhibitory motif (ITIM) (Ishida et al. (1992) EMBO J. 11 :3887; Shinohara et al. (1994) Genomics 23 :704; and U.S. Patent 5,698,520) and an immunoreceptor tyrosine-based switch motif (ITSM). These features also define a larger family of polypeptides, called the
immunoinhibitory receptors, which also includes gp49B, PIR-B, and the killer inhibitory receptors (KIRs) (Vivier and Daeron (1997) Immunol. Today 18:286). It is often assumed that the tyrosyl phosphorylated ITEVI and ITSM motif of these receptors interacts with SH2-domain containing phosphatases, which leads to inhibitory signals. A subset of these immunoinhibitory receptors bind to MHC polypeptides, for example the KIRs, and CTLA4 binds to B7-1 and B7-2. It has been proposed that there is a phylogenetic relationship between the MHC and B7 genes (Henry et al. (1999) Immunol. Today 20(6):285-8).
Nucleic acid and polypeptide sequences of PD-1 orthologs in organisms other than humans are well-known and include, for example, mouse PD-1 (NM_008798.2 and NP_032824.1), rat PD-1 (NM_001106927.1 and NP_001100397.1), dog PD-1 (XM_543338.3 and
XP_543338.3), cow PD-1 (NM_001083506.1 and NP_001076975.1), and chicken PD-1 (XM_422723.3 and XP_422723.2).
PD-1 polypeptides are inhibitory receptors capable of transmitting an inhibitory signal to an immune cell to thereby inhibit immune cell effector function, or are capable of promoting costimulation (e.g., by competitive inhibition) of immune cells, e.g., when present in soluble, monomeric form. Preferred PD-1 family members share sequence identity with PD-1 and bind to one or more B7 family members, e.g., B7-1, B7-2, PD-1 ligand, and/or other polypeptides on antigen presenting cells.
The term "PD-1 activity," includes the ability of a PD-1 polypeptide to modulate an inhibitory signal in an activated immune cell, e.g., by engaging a natural PD-1 ligand on an antigen presenting cell. Modulation of an inhibitory signal in an immune cell results in modulation of proliferation of, and/or cytokine secretion by, an immune cell. Thus, the term "PD-1 activity" includes the ability of a PD-1 polypeptide to bind its natural ligand(s), the ability to modulate immune cell costimulatory or inhibitory signals, and the ability to modulate the immune response.
The term "PD-1 ligand" refers to binding partners of the PD-1 receptor and includes both PD-Ll (Freeman et al. (2000j J. Exp. Med. 192: 1027-1034) and PD-L2 (Latchman et al. (2001) Nat. Immunol. 2:261). At least two types of human PD-1 ligand polypeptides exist. PD-1 ligand proteins comprise a signal sequence, and an IgV domain, an IgC domain, a transmembrane domain, and a short cytoplasmic tail. Both PD-Ll (See Freeman et al. (2000) for sequence data) and PD-L2 (See Latchman et al. (2001) Nat. Immunol. 2:261 for sequence data) are members of the B7 family of polypeptides. Both PD-Ll and PD-L2 are expressed in placenta, spleen, lymph nodes, thymus, and heart. Only PD-L2 is expressed in pancreas, lung and liver, while only PD-Ll is expressed in fetal liver. Both PD-1 ligands are upregulated on activated monocytes and dendritic cells, although PD-Ll expression is broader. For example, PD-Ll is known to be constitutively expressed and upregulated to higher levels on murine hematopoietic cells {e.g., T cells, B cells, macrophages, dendritic cells (DCs), and bone marrow-derived mast cells) and non- hematopoietic cells {e.g., endothelial, epithelial, and muscle cells), whereas PD-L2 is inducibly expressed on DCs, macrophages, and bone marrow-derived mast cells (see Butte et al. (2007) Immunity 27: 111).
PD-1 ligands comprise a family of polypeptides having certain conserved structural and functional features. The term "family" when used to refer to proteins or nucleic acid molecules, is intended to mean two or more proteins or nucleic acid molecules having a common structural domain or motif and having sufficient amino acid or nucleotide
sequence homology, as defined herein. Such family members can be naturally or non- naturally occurring and can be from either the same or different species. For example, a family can contain a first protein of human origin, as well as other, distinct proteins of human origin or alternatively, can contain homologues of non-human origin. Members of a family may also have common functional characteristics. PD-1 ligands are members of the B7 family of polypeptides. The term "B7 family" or "B7 polypeptides" as used herein includes costimulatory polypeptides that share sequence homology with B7 polypeptides, e.g., with B7-1, B7-2, B7h (Swallow et al. (1999) Immunity 11 :423), and/or PD-1 ligands {e.g., PD-L1 or PD-L2). For example, human B7-1 and B7-2 share approximately 26% amino acid sequence identity when compared using the BLAST program at NCBI with the default parameters (Blosum62 matrix with gap penalties set at existence 11 and extension 1 (See the NCBI website). The term B7 family also includes variants of these polypeptides which are capable of modulating immune cell function. The B7 family of molecules share a number of conserved regions, including signal domains, IgV domains and the IgC domains. IgV domains and the IgC domains are art-recognized Ig superfamily member domains. These domains correspond to structural units that have distinct folding patterns called Ig folds. Ig folds are comprised of a sandwich of two β sheets, each consisting of anti-parallel β strands of 5-10 amino acids with a conserved disulfide bond between the two sheets in most, but not all, IgC domains of Ig, TCR, and MHC molecules share the same types of sequence patterns and are called the CI -set within the Ig superfamily. Other IgC domains fall within other sets. IgV domains also share sequence patterns and are called V set domains. IgV domains are longer than IgC domains and contain an additional pair of β strands.
Preferred B7 polypeptides are capable of providing costimulatory or inhibitory signals to immune cells to thereby promote or inhibit immune cell responses. For example, B7 family members that bind to costimulatory receptors increase T cell activation and proliferation, while B7 family members that bind to inhibitory receptors reduce
costimulation. Moreover, the same B7 family member may increase or decrease T cell costimulation. For example, when bound to a costimulatory receptor, PD-1 ligand can induce costimulation of immune cells or can inhibit immune cell costimulation, e.g., when present in soluble form. When bound to an inhibitory receptor, PD-1 ligand polypeptides can transmit an inhibitory signal to an immune cell. Preferred B7 family members include B7-1, B7-2, B7h, PD-L1 or PD-L2 and soluble fragments or derivatives thereof. In one
embodiment, B7 family members bind to one or more receptors on an immune cell, e.g., CTLA4, CD28, ICOS, PD-1 and/or other receptors, and, depending on the receptor, have the ability to transmit an inhibitory signal or a costimulatory signal to an immune cell, preferably a T cell.
Modulation of a costimulatory signal results in modulation of effector function of an immune cell. Thus, the term "PD-1 ligand activity" includes the ability of a PD-1 ligand polypeptide to bind its natural receptor(s) (e.g. PD-1 or B7-1), the ability to modulate immune cell costimulatory or inhibitory signals, and the ability to modulate the immune response.
The term "PD-Ll" refers to a specific PD-1 ligand. Two forms of human PD-Ll molecules have been identified. One form is a naturally occurring PD-Ll soluble polypeptide, i.e., having a short hydrophilic domain and no transmembrane domain, and is referred to herein as PD-Ll S. The second form is a cell-associated polypeptide, i.e., having a transmembrane and cytoplasmic domain, referred to herein as PD-LIM. The nucleic acid and amino acid sequences of representative human PD-Ll biomarkers regarding PD-LIM are also available to the public at the GenBank database under M 014143.3 and
P 054862.1. PD-Ll proteins comprise a signal sequence, and an IgV domain and an IgC domain. The signal sequence of PD-Ll S contains about amino acid 1 to about amino acid 18. The signal sequence of PD-LIM contains about amino acid 1 to about amino acid 18. The IgV domain of PD-Ll S contains about amino acid 19 to about amino acid 134 and the IgV domain of PD-LIM contains about amino acid 19 to about amino acid 134. The IgC domain of PD-Ll S contains about amino acid 135 to about amino acid 227 and the IgC domain of PD-LIM contains about amino acid 135 to about amino acid 227. The hydrophilic tail of the PD-Ll exemplified in PD-Ll S comprises a hydrophilic tail shown from about amino acid 228 to about amino acid 245. The PD-Ll polypeptide exemplified in PD-LIM comprises a transmembrane domain shown from about amino acids 239 to about amino acid 259 of PD-LIM and a cytoplasmic domain shown from about 30 amino acid 260 to about amino acid 290 of PD-LIM. In addition, nucleic acid and polypeptide sequences of PD-Ll orthologs in organisms other than humans are well-known and include, for example, mouse PD-Ll ( M 021893.3 and P 068693.1), rat PD-Ll
( M_001191954.1 and P_001178883.1), dog PD-Ll (XM_541302.3 and XP_541302.3), cow PD-Ll ( M_001163412.1 and P_001156884.1), and chicken PD-Ll (XM_424811.3 and XP_424811.3).
The term "PD-L2" refers to another specific PD-1 ligand. PD-L2 is a B7 family member expressed on various APCs, including dendritic cells, macrophages and bone- marrow derived mast cells (Zhong et al. (2007) Eur. J. Immunol. 37:2405). APC-expressed PD-L2 is able to both inhibit T cell activation through ligation of PD-1 and costimulate T cell activation, through a PD-1 independent mechanism (Shin et al. (2005) J. Exp. Med. 201 : 1531). In addition, ligation of dendritic cell-expressed PD-L2 results in enhanced dendritic cell cytokine expression and survival (Radhakrishnan et al. (2003) J. Immunol. 37: 1827; Nguyen et al. (2002) J. Exp. Med. 196: 1393). The nucleic acid and amino acid sequences of representative human PD-L2 biomarkers are well-known in the art and are also available to the public at the GenBank database under NM 025239.3 and
NP 079515.2. PD-L2 proteins are characterized by common structural elements. In some embodiments, PD-L2 proteins include at least one or more of the following domains: a signal peptide domain, a transmembrane domain, an IgV domain, an IgC domain, an extracellular domain, a transmembrane domain, and a cytoplasmic domain. For example, amino acids 1-19 of PD-L2 comprises a signal sequence. As used herein, a "signal sequence" or "signal peptide" serves to direct a polypeptide containing such a sequence to a lipid bilayer, and is cleaved in secreted and membrane bound polypeptides and includes a peptide containing about 15 or more amino acids which occurs at the N-terminus of secretory and membrane bound polypeptides and which contains a large number of hydrophobic amino acid residues. For example, a signal sequence contains at least about 10-30 amino acid residues, preferably about 15- 25 amino acid residues, more preferably about 18-20 amino acid residues, and even more preferably about 19 amino acid residues, and has at least about 35-65%, preferably about 38-50%, and more preferably about 40- 45%) hydrophobic amino acid residues {e.g., valine, leucine, isoleucine or phenylalanine). In another embodiment, amino acid residues 220-243 of the native human PD-L2 polypeptide and amino acid residues 201-243 of the mature polypeptide comprise a transmembrane domain. As used herein, the term "transmembrane domain" includes an amino acid sequence of about 15 amino acid residues in length which spans the plasma membrane. More preferably, a transmembrane domain includes about at least 20, 25, 30, 35, 40, or 45 amino acid residues and spans the plasma membrane. Transmembrane domains are rich in hydrophobic residues, and typically have an alpha-helical structure. In a preferred embodiment, at least 50%, 60%, 70%, 80%, 90%, 95% or more of the amino acids of a transmembrane domain are hydrophobic, e.g., leucines, isoleucines, tyrosines, or
tryptophans. Transmembrane domains are described in, for example, Zagotta, W. N. et al. (1996) Annu. Rev. Neurosci. 19: 235-263. In still another embodiment, amino acid residues 20-120 of the native human PD-L2 polypeptide and amino acid residues 1-101 of the mature polypeptide comprise an IgV domain. Amino acid residues 121- 219 of the native human PD-L2 polypeptide and amino acid residues 102-200 of the mature polypeptide comprise an IgC domain. As used herein, IgV and IgC domains are recognized in the art as Ig superfamily member domains. These domains correspond to structural units that have distinct folding patterns called Ig folds. Ig folds are comprised of a sandwich of two β sheets, each consisting of antiparallel (3 strands of 5-10 amino acids with a conserved disulfide bond between the two sheets in most, but not all, domains. IgC domains of Ig, TCR, and MHC molecules share the same types of sequence patterns and are called the CI set within the Ig superfamily. Other IgC domains fall within other sets. IgV domains also share sequence patterns and are called V set domains. IgV domains are longer than C- domains and form an additional pair of strands. In yet another embodiment, amino acid residues 1-219 of the native human PD-L2 polypeptide and amino acid residues 1-200 of the mature polypeptide comprise an extracellular domain. As used herein, the term
"extracellular domain" represents the N-terminal amino acids which extend as a tail from the surface of a cell. An extracellular domain of the present invention includes an IgV domain and an IgC domain, and may include a signal peptide domain. In still another embodiment, amino acid residues 244-273 of the native human PD-L2 polypeptide and amino acid residues 225-273 of the mature polypeptide comprise a cytoplasmic domain. As used herein, the term "cytoplasmic domain" represents the C-terminal amino acids which extend as a tail into the cytoplasm of a cell. In addition, nucleic acid and polypeptide sequences of PD-L2 orthologs in organisms other than humans are well-known and include, for example, mouse PD-L2 ( M_021396.2 and P_067371.1), rat PD-L2
( M_001107582.2 and P_001101052.2), dog PD-L2 (XM_847012.2 and XP_852105.2), cow PD-L2 (XM_586846.5 and XP_586846.3), and chimpanzee PD-L2 (XM_001140776.2 and XP_001140776.1).
The term "PD-L2 activity," "biological activity of PD-L2," or "functional activity of PD-L2," refers to an activity exerted by a PD-L2 protein, polypeptide or nucleic acid molecule on a PD-L2-responsive cell or tissue, or on a PD- L2 polypeptide binding partner, as determined in vivo, or in vitro, according to standard techniques. In one embodiment, a PD-L2 activity is a direct activity, such as an association with a PD-L2 binding partner. As
used herein, a "target molecule" or "binding partner" is a molecule with which a PD-L2 polypeptide binds or interacts in nature, such that PD-L2-mediated function is achieved. In an exemplary embodiment, a PD-L2 target molecule is the receptor RGMb. Alternatively, a PD-L2 activity is an indirect activity, such as a cellular signaling activity mediated by interaction of the PD- L2 polypeptide with its natural binding partner (i.e., physiologically relevant interacting macromolecule involved in an immune function or other biologically relevant function), e.g., RGMb. The biological activities of PD-L2 are described herein. For example, the PD-L2 polypeptides of the present invention can have one or more of the following activities: 1) bind to and/or modulate the activity of the receptor RGMb, PD-1, or other PD-L2 natural binding partners, 2) modulate intra-or intercellular signaling, 3) modulate activation of immune cells, e.g. , T lymphocytes, and 4) modulate the immune response of an organism, e.g., a mouse or human organism.
"Anti-immune checkpoint therapy" refers to the use of agents that inhibit immune checkpoint nucleic acids and/or proteins. Inhibition of one or more immune checkpoints can block or otherwise neutralize inhibitory signaling to thereby upregulate an immune response in order to more efficaciously treat cancer. Exemplary agents useful for inhibiting immune checkpoints include antibodies, small molecules, peptides, peptidomimetics, natural ligands, and derivatives of natural ligands, that can either bind and/or inactivate or inhibit immune checkpoint proteins, or fragments thereof; as well as RNA interference, antisense, nucleic acid aptamers, etc. that can downregulate the expression and/or activity of immune checkpoint nucleic acids, or fragments thereof. Exemplary agents for upregulating an immune response include antibodies against one or more immune checkpoint proteins block the interaction between the proteins and its natural receptor(s); a non-activating form of one or more immune checkpoint proteins (e.g. , a dominant negative polypeptide); small molecules or peptides that block the interaction between one or more immune checkpoint proteins and its natural receptor(s); fusion proteins (e.g. the
extracellular portion of an immune checkpoint inhibition protein fused to the Fc portion of an antibody or immunoglobulin) that bind to its natural receptor(s); nucleic acid molecules that block immune checkpoint nucleic acid transcription or translation; and the like. Such agents can directly block the interaction between the one or more immune checkpoints and its natural receptor(s) (e.g., antibodies) to prevent inhibitory signaling and upregulate an immune response. Alternatively, agents can indirectly block the interaction between one or more immune checkpoint proteins and its natural receptor(s) to prevent inhibitory signaling
and upregulate an immune response. For example, a soluble version of an immune checkpoint protein ligand such as a stabilized extracellular domain can binding to its receptor to indirectly reduce the effective concentration of the receptor to bind to an appropriate ligand. In one embodiment, anti-PD-1 antibodies, anti-PD-Ll antibodies, and/or anti-PD-L2 antibodies, either alone or in combination, are used to inhibit immune checkpoints. These embodiments are also applicable to specific therapy against particular immune checkpoints, such as the PD-1 pathway (e.g., anti-PD-1 pathway therapy, otherwise known as PD-1 pathway inhibitor therapy).
The term "RIPKl," also known as receptor-interacting serine/threonine-protein kinase 1 and RIP-1, refers to a member of a group of proteins functioning in a variety of cellular pathways including the F-κΒ pathway and programmed necrotic cell death (necroptosis). This group of serine-threonine kinases transduce inflammatory and cell- death signals (programmed necrosis) following death receptors ligation, activation of pathogen recognition receptors (PRRs), and DNA damage, affecting embryonic development, tissue homeostasis, immunity and inflammation. RIPKl is implicated in inflammatory and cell death signaling and its kinase activity is believed to drive RIPK3- mediated necroptosis (Kelliher et al. (1998) Immunity 8:297-303; Meylan et al. (2004) Nature Immunol.5:503-50"/ '; Chri staffer son et al. (2014) Annu. Rev. Physiol. 76: 129-150). When the proinflammatory cytokine T Fa stimulates its receptor, TNFR1, RIPKl regulates whether the cell lives by activating F-κΒ or dies by apoptosis or necroptosis, two distinct pathways of programmed cell death that may be activated to eliminate unwanted cells. RIPKl has an N-terminal Ser/Thr kinase domain and a C-terminal death domain. The kinase domain of RIPKl is involved in regulating necroptosis, and the death domain regulates RIPKl recruitment to the intracellular domain of T FR1 (Stanger et al. (1995) Cell 81 :513-523; Hsu et al. (1996) Immunity 4:387-396). RIPKl interacts with RIP3 kinase, a downstream mediator of RIPKl in the execution of necroptosis, via their RIP homotypic interaction motifs and activates F-κΒ (YU et al. (1999) Curr. Biol. 9:539- 542; Li et al. (2012) Cell 150:339-350). Upon T F-induced necrosis, the RIPKl -RIPK3 dimer further interacts with PGAM5 and MLKL, forming a complex leading to PGAM5 phosphorylation and increased PGAM5 phosphatase activity. RIPKl also interacts with T FRSF6 and TRADD via their death domains, thus recruited by TRADD to TNFRSFIA in a TNF-dependent process. RIPKl further interacts (via kinase domain) with DAB2IP (via Ras-GAP domain), in a TNF-alpha-dependent manner. Other binding partners and/or
those RIPKl interacts with include, e.g., R F216, EGFR, IKBKG, TRAF1, TRAF2, TRAF3, B LF1, SQSTM1, MAVS/IPS1, ZFA D5, BIRC2/c-IAPl, BIRC3/c-IAP2, XIAP/BIRC4, ARHGEF2, RFFL, R F34, TICAM1, CA11, CASP8, CFLAR, CRADD, R F11, T FRSF1 A, and UBC (Liao et al. (2008) Curr. Biol. 18:641-649; Kataoka et al. (2000) Curr. Biol. 10:640-648; Ahmad et al. (1997) Cancer Res. 57:615-619; Shembade et al. (2009) EMBO J. 28:513-522; Chen et al. (2002) J. Biol. Chem. 277: 15985-15991; Sanz et al. (1999) EMBO J. 18:3044-3053). Proteolytic processing of RIPKl, through both caspase-dependent and -independent mechanisms, triggers lethality that is dependent on the generation of one or more specific C-terminal cleavage product(s) of RIPkl upon stress. For example, caspase-8 proteolytically cleaves RIPKl during T F-induced apoptosis
(Chaudhary et al. (2000) Oncogene 19:4451-4460). Such cleavage abolishes F-kappa-B activation and enhances pro-apoptotic signaling through the TRADD-FADD interaction. RIPKl and RIPK3 undergo reciprocal auto- and trans-phosphorylation. Phosphorylation of Ser-161 on RIPKl by RIPK3 is necessary for the formation of the necroptosis-inducing complex. RIPKl can be ubiquitinated by Lys-11-, Lys-48-, Lys-63- and linear-linked type ubiquitin. Polyubiquitination with Lys-63 -linked chains on by TRAF2 induces RIPKl association with the IKK complex. Deubiquitination of Lys-63 -linked chains and polyubiquitination with Lys-48-linked chains by TNFAIP3 leads to RIPKl proteasomal degradation and consequently down-regulates T F-alpha-induced F-kappaB signaling. Lys-48-linked polyubiquitination by RFFL or RNF34 also promotes proteasomal degradation and negatively regulates TNF-alpha-induced NFkappa-B signaling. RIPKl can also be polyubiquitinated with Lys-48 and Lys-63-linked chains by BIRC2/c-IAPl and BIRC3/C-IAP2, leading to activation of NF-kappa-B (Bertrand et al. (2008) Mol. Cell. 30:689-700; Varfolomeev et al. (2008) J. Biol. Chem. 283 :24295-24299).
The nucleic acid and amino acid sequences of a representative human RIPKl is available to the public at the GenBank database (Gene ID 8738) and is shown in Table 1. Human RIPKl isoforms include the longer isoform 1 (GenBank database numbers
NM_003804.4 and NP_003795.2, encoded by the shorter transcript variant 1), and the shorter isoforms 2 (NM_001317061.1 and NP_001303990.1, encoded by a longer transcript variant 2, which contains two alternate exons in the 5' UTR, resulting in the use of a downstream start codon, compared to variant 1). The domain structure of RTPKl polypeptide is well known and accessible in UniProtKB database under the accession number Q13546, including, in the order from the 5' terminus to the 3' terminus, a protein
kinase domain comprising, e.g., amino acid positions 17-289 of NP 003795.2), an intermediate RIP homotypic interaction motif (RHIM) which is important for NF-kB activation and RHIM-dependent signaling and comprises, e.g., amino acid positions 531- 547 of NP 003795.2), and a death domain comprising, e.g., amino acid 583-669 of NP_003795.2.
Nucleic acid and polypeptide sequences of RIPKl orthologs in organisms other than humans are well-known and include, for example, chimpanzee (Pan troglodytes) RIPKl (XM_016954826.1 and XP_016810315.1 ; XM_016954825.1 and XP_016810314.1;
XM_016954824.1 and XP_016810313.1; XM_001160973.3 and XP_001160973.2; and XM_016954827.1 and XP 016810316.1), Rhesus monkey RIPKl (XM_015135437.1 and XP_014990923.1; XM_015135438.1 and XP_014990924.1; XM_015135434.1 and XP_014990920.1; XM_001091986.3 and XP 001091986.1; XM_015135435.1 and XP_014990921.1; XM_015135436.1 and XP_014990922.1; and XM_015135439.1 and XP 014990925.1), dog RIPKl (XM 005639981.2 and XP 005640038.1), mouse RIPKl (NM_009068.3 and NP_033094.3), cattle RIPKl (NM_001035012.1 and
NP_001030184.1), Norway rat (Rattus norvegicus) RIPK 1 (NM_001107350.1 and
NP_001100820.1), chicken RIPKl (NM_204402.2 and NP_989733.2), tropical clawed frog (Xenopus tropicalis) RIPKl (NM_001079035.1 and NP_001072503.1), zebrafish (Danio rerio) RIPKl (NM l 99674.2 and NP 955968.2), zebrafish (Danio rerio) RIPKl
(NM_001043350.1 and NP_001036815.1),
The term "RIPKl activity" includes the ability of a RIPKl polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein) to bind its substrate and/or catalyze serine/threonine-protein kinase activity. RIPKl activity may also include one or more of functions, such as those disclosed herein in the NF-κΒ pathway and programmed necrotic cell death (necroptosis). For example, RIPKl may interact with various proteins disclosed herein, such as RIP3 kinase, for its functions in signaling related to TNF-alpha, NFkappa-B, and/or necroptosis. RIPKl may also be proteolyticly modified, such as being cleaved, ubiquitinated, deubiquitinated, or otherwise disclosed herein, for it functions.
The term "RIPKl substrate(s)" refers to binding partners of a RIPKl polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein), e.g., the proteins listed herein. Furthermore, RIPKl substrates may refer to downstream members in the signaling pathways where RIPKl has a functional role.
The term "RIPK1 -regulated signaling pathway(s)" includes signaling pathways in which RIPK1 (and its fragments, domains, and/or motifs thereof, discussed herein) binds to at least one of its substrate, through which at least one cellular function and/or activity and/or cellular protein profiles is changed (e.g., through RIP3 kinases or by being proteolyticly modified). In some embodiments, RIPK1 promotes ubiquitination and proteasome degradation for at least one of its substrates which bind to it. RJPK1 -regulated signaling pathways include at least those described herein, such as TNFR1 pathway, regulation by c-FLIP, activated TLR4 signaling, apoptosis modulation and signaling, TNF signaling (reactome), Death Receptor signaling, Fkappa-B pathway, P38 MAPK signaling pathway, etc.
The term "RIPKl inhibitor(s)" includes any natural or non-natural agent prepared, synthesized, manufactured, and/or purified by human that is capable of reducing, inhibiting, blocking, preventing, and/or that inhibits the ability of a RIPKl polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein). In one embodiment, such inhibitors may reduce or inhibit the binding/interaction between RIPKl and its substrates or other binding partners. In another embodiment, such inhibitors may reduce or inhibit the catalytic function of RIPKl as a serine/threonine-protein kinase. In still another
embodiment, such inhibitors may increase or promote the turnover rate, reduce or inhibit the expression and/or the stability (e.g., the half-life), and/or change the cellular localization of RIPKl, resulting in at least a decrease in RIPKl levels and/or activity. Such inhibitors may be any molecule, including but not limited to small molecule compounds, antibodies or intrabodies, RNA interfering (RNAi) agents (including at least siRNAs, shRNAs, microRNAs (miRNAs), piwi, and other well-known agents). Such inhibitors may be specific to RIPKl or also inhibit at least one of other serine/threonine-protein kinases. Small molecule inhibitory compounds for RIPKl polypeptides are well known and commercially available (e.g., Necrostatin-1 (5-(lH-Indol-3-ylmethyl)-3-methyl-2-thioxo-4- imidazolidinone, Cat. # 2324, Tocris, Bristol, UK) prevents osmotic nephrosis (Linkermann et al. (2013) J Am Soc Nephrol. 24: 1545-1557; Cui et al. (2016) Sci Rep. 6,
doi: 10.1038/srep33803). In addition, GSK481 ((S)-5-benzyl-N-(5-methyl-4-oxo-2,3,4,5- tetrahydrobenzo[b][l,4]oxazepin-3-yl)isoxazole-3-carboxamide, Cat. # 1622849-58-4,
APExBio, Bristol, UK) showed complete specificity for RIP1 kinase against all other tested kinases when profiled over both a P33 radiolabeled assay screen and inhibits SI 66 phosphorylation in wild-type human RIPKl but not wild-type mouse RIPKl (Harris et al.
(2016) J Med Chem 59:2163-2178)). RNA interference for RIPK1 polypeptides are well known and commercially available {e.g., human or mouse shRNA (Cat. # TG320591, TL320591, TL501905, TF320591, TR320591, and TF501905) and siRNA (Cat. #
SR418761, SR305755, and SR509132) products and human or mouse gene knockout kit via CRISPR (Cat. # KN216024 and KN314840) from Origene (Rockville, MD, siRNA/shRNA products (Cat. # sc-37387, sc-37388, sc-36426, sc-44326, sc-36427, sc-36428, and sc- 36429) from Santa Cruz Biotechnology (Dallas, Texas), Ready-to-package AAV shRNA clones from Vigene Biosciences (Rockville, MD, etc.). Methods for detection, purification, and/or inhibition of RIPKl (e.g., by anti-RIPKl antibodies) are also well known and commercially available (e.g., multiple anti-RIPKl antibodies from Origene (Cat. #
AP00087PU-N, TA800325AM, and other about 70 antibodies), Cell Signaling Technology (Danvers, MA, Cat. # 3493, 14577, 4926, etc.), abeam (Cambridge, MA, Cat. # ab72139, ab202985, abl25072, abl78420, abl37451, etc.), R&D Systems (Minneapolis, MN, Cat. # MAB3585), Santa Cruz Biotechnology (Cat. # sc- 133102), etc.). RIPKl knockout mouse strains and cell lines are also well known and available at the International Mouse Strain Resource (IMSR) (e.g., stain names RipkltmL1Vmd and RipkltmlLed).
The term "BIRC2," also known as baculoviral IAP repeat containing 2, c-IAPl, and apoptosis inhibitor 1, refers to a member of a family of proteins that inhibits apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. BIRC2 inhibits apoptosis induced by serum deprivation and menadione, a potent inducer of free radicals. As a multi-functional protein, BIRC2 regulates not only caspases and apoptosis, but also inflammatory signaling and immunity, mitogenic kinase signaling, and cell proliferation, as well as cell invasion and metastasis. BIRC2 acts as an E3 ubiquitin-protein ligase regulating F-kappa-B signaling and regulates both canonical and non-canonical NF-kappa-B signaling by acting in opposite directions: acts as a positive regulator of the canonical pathway and suppresses constitutive activation of non-canonical NF-kappa-B signaling. The target proteins for the E3 ubiquitin-protein ligase activity of BIRC2 include, at least RIPKl (leading to activation of NF-KB, see Bertrand et al. (2008) Mol. Cell. 30:689-700; Varfolomeev et al. (2008) J. Biol. Chem. 283 :24295-24299), RIPK2, RIPK3, RIPK4, CASP3, CASP7, CASP8, TRAF2, DIABLO/SMAC, MAP3K14/NIK, MAP3K5/ASK1, IKBKG/NEMO, IKBKE, and
MXDl/MADl . BIRC2 also functions as an E3 ubiquitin-protein ligase of the NEDD8 conjugation pathway, targeting effector caspases for neddylation and inactivation. BIRC2
is as an important regulator of innate immune signaling via regulation of Toll-like receptors (TLRs), Nodlike receptors (NLRs) and RIG-I like receptors (RLRs), collectively referred to as pattern recognition receptors (PRRs). BIRC2 protects cells from spontaneous formation of the ripoptosome, a large multi-protein complex that has the capability to kill cancer cells in a caspase-dependent and caspase-independent manner. BIRC2 suppresses ripoptosome formation by ubiquitinating RIPK1 and CASP8. BIRC2 also stimulates the transcriptional activity of E2F 1 and plays a role in the modulation of the cell cycle. BIRC2 interacts with DIABLO/SMAC and with PRSS25 and such interactions inhibit apoptotic suppressor activity. BIRC2 also interacts with CASP9, TRAF2, E2F 1, RIPK1, RIPK2, RIPK3, RIPK4, BIRC5/surviving, RAC1, TSGA10, ABHD17A, BIRC7, and USP19. BIRC2 functions in multiple pathways, including, at least, TNFR1 pathway (e.g., DR2 signaling, TWEAK pathway, Fas signaling, TNF-alpha/NF-kB Signaling Pathway, etc.), apoptosis modulation and signaling (e.g., death receptor signaling, apoptotic TNF-family pathways, etc.), activated Toll-like receptor 4 (TLR4) signaling (e.g., MyD88-independent
TLR3/TLR4 cascade), TNF signaling (REACTOME), regulation of activated PAK-2p34 by proteasome mediated degradation (e.g., TNFR2 non-canonical NF-κΒ pathway), etc.
BIRC2 is suggested to be related to lung cancers and lymphoma.
The nucleic acid and amino acid sequences of a representative human BIRC2 is available to the public at the GenBank database (Gene ID 329) and is shown in Table 1. Human BIRC2 isoforms include the predominant transcript variant 1 and the encoded longer isoform 1 (GenBank database numbers NM_001 166.4 and NP_001 157.1), a transcript variant 2, which differs in the 5' UTR compared to variant 1, and the encoded protein having the same sequence as isoform 1 (NM_001256163.1 and NP_001243092.1), and a transcript variant 3, having an alternate splice site in the 5' region resulting in a downstream AUG start codon compared to variant 1, and the encoded shorter isoform 2
(shorter at the N-terminus). The domain structure of BIRC2 polypeptide is well known and accessible in UniProtKB database under the accession number Q 13490, including, in the order from the 5' terminus to the 3 ' terminus, three BIR domain comprising, e.g., amino acid positions 46-1 13, 184-250, and 269-336 of NP_001 157.1, a caspase activation and recruitment domain (CARD) domain comprising, e.g., amino acid positions 453-543 of NP_001 157.1, and a Really Interesting New Gene (RING)-type zinc finger comprising, e.g., amino acid positions 571-606 of NP_001 157.1.
Nucleic acid and polypeptide sequences of BIRC2 orthologs in organisms other than humans are well-known and include, for example, chimpanzee {Pan troglodytes) BIRC2 (XM_016921873.1 and XP_016777362.1, XM_001152603.5 and XP_001152603.1, XM_016921875.1 and XP_016777364.1, XM_016921874.1 and XP_016777363.1, and XM_001152534.3 and XP_001152534.1), Rhesus monkey BIRC2 (NM_001261321.1 and NP_001248250.1), dog BIRC2 (NM_001048023.1 and NP_001041488.1), mouse BIRC2 (NM_007465.3 and NP_031491.2, representing the transcript variant 1 and the encoded isoform 1, and NM_001291503.1 and NP_001278432.1, representing transcript variant 2 and the encoding protein having the same sequence as isoform 1), cattle BIRC2
(XM_015474583.1 and XP_015330069.1), Norway rat (Rattus norvegicus) BIRC2
(NM_021752.2 and NP_068520.2), chicken BIRC2 (NM_001007822.1 and
NP_001007823.1), tropical clawed frog (Xenopus tropicalis) BIRC2 (NM_001005449.1 and NP_001005449.1), zebrafish (Danio rerio) BIRC2 (NM_194395.2 and NP_919376.1), and fruit fly Diap2 (NM_176182.2 and NP_788362.1, and NM_057779.5 and
NP_477127.1).
The term "BIRC2 activity" includes the ability of a BIRC2 polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein) to bind its substrate and/or biological activity. BIRC2 activity may also include one or more of functions, such as those disclosed herein in the NF-κΒ pathway and programmed necrotic cell death. For example, BIRC2 may interact with various proteins {e.g., its ubiquitination substrates) disclosed herein for its functions in signaling related to TNF-alpha, NFkappa-B, and/or necroptosis. BIRC2 may also be proteolyticly modified, such as being cleaved, ubiquitinated, deubiquitinated, or otherwise disclosed herein, for it functions.
The term "BIRC2 substrate(s)" refers to binding partners of a BIRC2 polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein), e.g., the proteins listed herein. Furthermore, BIRC2 substrates may refer to downstream members in the signaling pathways where BIRC2 has a functional role.
The term "BIRC2-regulated signaling pathway(s)" includes signaling pathways in which BIRC2 (and its fragments, domains, and/or motifs thereof, discussed herein) binds to at least one of its substrate, through which at least one cellular function and/or activity and/or cellular protein profiles is changed {e.g., through RIP3 kinases or by being proteolyticly modified). In some embodiments, BIRC2 promotes ubiquitination and proteasome degradation for at least one of its substrates which bind to it. BIRC2-regulated
signaling pathways include at least those described herein, such as TNFR1 pathway (e.g., DR2 signaling, TWEAK pathway, Fas signaling, T F-alpha/NF-kB Signaling Pathway, etc.), apoptosis modulation and signaling (e.g., death receptor signaling, apoptotic TNF- family pathways, etc.), activated Toll-like receptor 4 (TLR4) signaling (e.g., MyD88- independent TLR3/TLR4 cascade), T F signaling (REACTOME), regulation of activated PAK-2p34 by proteasome mediated degradation (e.g., T FR2 non-canonical F-KB pathway), etc.
The term "BIRC2 inhibitor(s)" includes any natural or non-natural agent prepared, synthesized, manufactured, and/or purified by human that is capable of reducing, inhibiting, blocking, preventing, and/or that inhibits the ability of a BIRC2 polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein). In one embodiment, such inhibitors may reduce or inhibit the binding/interaction between BIRC2 and its substrates or other binding partners. In another embodiment, such inhibitors may reduce or inhibit the catalytic function of BIRC2 as a ubiquitin ligase. In still another embodiment, such inhibitors may increase or promote the turnover rate, reduce or inhibit the expression and/or the stability (e.g., the half-life), and/or change the cellular localization of BIRC2, resulting in at least a decrease in BIRC2 levels and/or
its ubiquitin ligase activity). Such inhibitors may be any molecule, including but not limited to small molecule compounds, antibodies or intrabodies, RNA interfering (RNAi) agents (including at least siRNAs, shRNAs, microRNAs (miRNAs), piwi, and other well-known agents). Such inhibitors may be specific to BIRC2 or also inhibit at least one of other E3 ubiquitin ligases. Small molecule inhibitory compounds for BIRC2 polypeptides are well known and commercially available (e.g., GDC-0152, LCL161, Birinapant (TL3271 1), AT-406 (SM- 406), BV6, etc.). RNA interference for BIRC2 polypeptides are well known and
commercially available (e.g., human or mouse shRNA (Cat. # TR314474, TF5001 14, TF710504, TG314474, etc.) and siRNA (Cat. # SR418175, SR300231, and SR509801) products and human or mouse gene knockout kit via CRISPR (Cat. # KN205373 and KN302170) from Origene (Rockville, MD), siRNA/shRNA products (Cat. # sc-29848 and sc-29849) and CRISPR products (Cat. # sc-419151) from Santa Cruz Biotechnology (Dallas, Texas), Ready-to-package AAV shRNA clones from Vigene Biosciences
(Rockville, MD, Cat. # SH877067). Methods for detection, purification, and/or inhibition of BIRC2 (e.g., by anti-BIRC2 antibodies) are also well known and commercially available (e.g., multiple anti-BIRC2 antibodies from Origene (Cat. # TA307562, TA321297,
TA306169, etc.), Cell Signaling Technology (Danvers, MA, Cat. # 7065, 4952, etc.), abeam (Cambridge, MA, Cat. # abl08361, ab201588, abl96592, etc.), and Santa Cruz
Biotechnology (Cat. # sc-271419, sc-7943, etc.). Human BIRC2 knockout cell lines are also well known and available from Horizon Discovery (Cambridge, UK, Cat. #
HZGHC002590c010).
The term "TBK1," also known as TRAF family member-associated NFKB activator (TANK)-binding kinase 1 and NFi B-activating kinase, refers to a member of a family of serine/threonine protein kinases that plays an essential role in regulating inflammatory responses to foreign agents. Following activation of toll-like receptors by viral or bacterial components, TBK1 associates with TRAF3 and TANK and phosphorylates interferon regulatory factors (IRFs) IRF3 and IRF7 as well as DDX3X, resulting in subsequent homodimerization and nuclear translocation of the IRFs and leading to transcriptional activation of pro-inflammatory and antiviral genes including IFNA and IFNB. In order to establish such an antiviral state, TBK1 form several different complexes whose
composition depends on the type of cell and cellular stimuli. Thus, several scaffolding molecules including FADD, TRADD, MAVS, AZI2, TANK or TBKBPl/SINTBAD can be recruited to the TBKl-containing-complexes. Under particular conditions, TBK1 functions as a NFKB effector by phosphorylating NFKB inhibitor alpha/NFKBIA, 1KB KB or RELA to translocate NFKB to the nucleus. TBK1 restricts bacterial proliferation by
phosphorylating the autophagy receptor OPTN/Optineurin on Ser-177, thus enhancing LC3 binding affinity and antibacterial autophagy. TBK1 also phosphorylates and activates AKTl . TBK1 is suggested to play a role in energy balance regulation by sustaining a state of chronic, low-grade inflammation in obesity, which leads to a negative impact on insulin sensitivity. TBK1 also attenuates retroviral budding by phosphorylating the endosomal sorting complex required for transport-I (ESCRT-I) subunit VPS37C. Other
phosphorylation substrates of TBK1 include, at least Borna disease virus (BDV) P protein. TBK1 interacts with, at least, NCK1 (Chou and Hanafusa (1995) J. Biol. Chem. 270:7359- 7364), TANK (Pomerantz and Baltimore (2000) EMBO J. 18:6694-6704; Bouwmeester et al. (2004) Nat. Cell Biol. 6:97-105), and TRAF2 (Bonnard et al. (2000) EMBO J. 19:4976- 4985). Transcriptional factors activated upon TBK1 activation include IRF3, IRF7, and ZEB1 (Liu (2014) Lab Invest. 94:362-370). TBK1 is also suggested to interact OPTN, TBKBP1, IRF3, IRF7, and TANK. TBK1 functions in multiple pathways, including, at least, RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways {e.g., RIG-I-like
Receptor (RLR) signaling pathways, TRAF3 -dependent IFR activation pathway, TRAF6- mediated IRF7 activation, cytosolic DNA-sensing pathway, etc.), activated TLR4 signaling (e.g., MyD88-independent TLR3/TLR4 cascade, TRIF-mediated TLR3/TLR4 signaling, etc.), cytosolic sensors of pathogen-associated DNA (e.g., ZBP1(DAI) mediated induction of type I IFNs, IRF3-mediated induction of type I IFN, STING mediated induction of host immune responses, STAT6-mediated induction of chemokines, etc.), Toll-like receptor signaling pathway, Influenza A or herpes simplex virus infection, Notch signaling pathway, NF-kB (NFKB) pathway, etc. TBK1 is suggested to be related to multiple diseases and disorders including, at least frontotemporal dementia and/or amyotrophic lateral sclerosis 1 and 4 (ftdals 1 and ftdals4), herpes simplex encephalitis, borna disease (enzootic encephalomyelitis), and crustacean allergy.
The nucleic acid and amino acid sequences of a representative human TBK1 is available to the public at the GenBank database (Gene ID 29110) and is shown in Table 1 (e.g., NM_013254.3 and NP_037386.1). The domain structure of TBK1 polypeptide is well known and accessible in UniProtKB database under the accession number Q9UHD2, including, in the order from the 5' terminus to the 3' terminus, a protein kinase domain comprising, e.g., amino acid positions 9-310 of NP 037386.1, and a ubiquitin-like domain comprising, e.g., amino acid positions 309-385 of NP 037386.1.
Nucleic acid and polypeptide sequences of TBK1 orthologs in organisms other than humans are well-known and include, for example, chimpanzee (Pan troglodytes) TBK1 (XM_509194.4 and XP_509194.2), Rhesus monkey TBK1 (NM_001261193.1 and
NP_001248122.1), dog TBK1 (XM_538266.5 and XP_538266.3), mouse TBK1
(NM_019786.4 and NP_062760.3), cattle TBK1 (NM_001192755.1 and
NP_001179684.1), Norway rat (Rattus norvegicus) TBK1 (NM_001106786.1 and
NP_001100256.1), chicken TBK1 (NM_001199558.1 and NP_001186487.1), tropical clawed frog (Xenopus tropicalis) TBK1 (NM_001142180.1 and NP_001135652.1), and zebrafish (Danio rerio) TBK1 (NM_001044748.2 and NP_001038213.2).
The term "TBK1 activity" includes the ability of a TBK1 polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein) to bind its substrate and/or biological activity. TBK1 activity may also include one or more of functions, such as its serine/threonine protein kinase activity, and/or others disclosed herein in the NF-KB pathway and other related pathways. For example, TBK1 may interact with various proteins (e.g., its substrates) disclosed herein for its functions in signaling. TBK1 may also
be proteolyticly modified, such as being cleaved, ubiquitinated, deubiquitinated, or otherwise disclosed herein, for it functions.
The term "TBKl substrate(s)" refers to binding partners of a TBKl polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein), e.g., the substrates described herein of TBKl as a serine/threonine protein kinase. Furthermore, TBKl substrates may refer to downstream members in the signaling pathways where TBKl has a functional role.
The term "TBKl -regulated signaling pathway(s)" includes signaling pathways in which TBKl (and its fragments, domains, and/or motifs thereof, discussed herein) binds to at least one of its substrate, through which at least one cellular function and/or activity and/or cellular protein profiles is changed. In some embodiments, TBKl is a
serine/threonine protein kinase and phosphorylates and activates its substrates. TBK1- regulated signaling pathways include at least those described herein, such as RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways (e.g., RIG-I-like Receptor (RLR) signaling pathways, TRAF3 -dependent IFR activation pathway, TRAF6-mediated IRF7 activation, cytosolic DNA-sensing pathway, etc.), activated TLR4 signaling (e.g., MyD88-independent TLR3/TLR4 cascade, TRIF-mediated TLR3/TLR4 signaling, etc.), cytosolic sensors of pathogen-associated DNA (e.g., ZBPl(DAI) mediated induction of type I IFNs, IRF3- mediated induction of type I IFN, STING mediated induction of host immune responses, STAT6-mediated induction of chemokines, etc.), Toll-like receptor signaling pathway, Influenza A or herpes simplex virus infection, Notch signaling pathway, NF-kB (NFKB) pathway, etc.
The term "TBKl inhibitor(s)" includes any natural or non-natural agent prepared, synthesized, manufactured, and/or purified by human that is capable of reducing, inhibiting, blocking, preventing, and/or that inhibits the ability of a TBKl polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein). In one embodiment, such inhibitors may reduce or inhibit the binding/interaction between TBKl and its substrates or other binding partners. In another embodiment, such inhibitors may reduce or inhibit the catalytic function of TBKl as a serine/threonine protein kinase. In still another
embodiment, such inhibitors may increase or promote the turnover rate, reduce or inhibit the expression and/or the stability (e.g., the half-life), and/or change the cellular localization of TBKl, resulting in at least a decrease in TBKl levels and/or activity (e.g., its
serine/threonine protein kinase activity). Such inhibitors may be any molecule, including
but not limited to small molecule compounds, antibodies or intrabodies, RNA interfering (RNAi) agents (including at least siRNAs, shRNAs, microRNAs (miRNAs), piwi, and other well-known agents). Such inhibitors may be specific to TBKl or also inhibit at least one of other serine/threonine-protein kinases. RNA interference for TBKl polypeptides are well known and commercially available (e.g., human, mouse, or rat shRNA (Cat. #
TF320685, TL503203, TF705359, etc.) and siRNA (Cat. # SR309210, SR419607,
SR505252, etc.) products and human or mouse gene knockout kit via CRISPR (Cat. # KN317271 and KN205238) from Origene (Rockville, MD, siRNA/shRNA products (Cat. # sc-39058 and sc-39059) and CRISPR products (Cat. # sc-425191 and sc-401066) from Santa Cruz Biotechnology (Dallas, Texas), Ready-to-package AAV shRNA clones from Vigene Biosciences (Rockville, MD, Cat. # SH866073). Methods for detection, purification, and/or inhibition of TBKl (e.g., by anti-TBKl antibodies) are also well known and commercially available (e.g., multiple anti-TBKl antibodies from Origene (Cat. # TA336453, TA334468, TA320202, etc.), Cell Signaling Technology (Danvers, MA, Cat. # 3504, 3013, etc.), abeam (Cambridge, MA, Cat. # ab40676, ab l09735, ab l21 16, etc.), and Santa Cruz Biotechnology (Cat. # sc-9910, sc-9085, sc-52957, etc.)). Human TBKl knockout cell lines are also well known and available from Horizon Discovery (Cambridge, UK, Cat. # HZGHC000031c010).
The term "TRAF3," also known as TNF receptor-associated factor 3, LMP1- associated protein 1, CRAF 1, and CAPl, refers to a member of a family of TNF receptor associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from, members of the TNF receptor (TNFR) superfamily. TRAF3 participates in the signal transduction of CD40, a TNFR family member important for the activation of the immune response. TRAF3 is found to be a critical component of the lymphotoxin-beta receptor (LTbetaR) signaling complex, which induces NF-κΒ activation and cell death initiated by LTbeta ligation. Epstein-Barr virus encoded latent infection membrane protein- 1 (LMP1) can interact with TRAF3 and several other members of the TRAF family, which may be essential for the oncogenic effects of LMP1. TRAF3 regulates pathways leading to the activation of NF-κΒ and MAP kinases, and plays a central role in the regulation of B-cell survival, including, at least, producing cytokines and interferon. TRAF3 is required for normal antibody isotype switching from IgM to IgG and plays a role in T-cell dependent immune responses and regulation of antiviral responses. TRAF3 is an essential constituent of several E3 ubiquitin-protein ligase
complexes. TRAF3 may have E3 ubiquitin-protein ligase activity and promote Lys-63- linked ubiquitination of target proteins. TRAF3 inhibits TRAF2-mediated activation of NF-KB and down-regulates proteolytic processing of NFKB2, and thereby inhibits non- canonical activation of NF-κΒ. TRAF3 also promotes ubiquitination and proteasomal degradation of MAP3K14.
TRAF3 can form heterotrimers with TRAF2 and TRAF5. TRAF3 interacts with, at least, TRAFDl, LTBR/TNFRSF3, TNFRSF4, TNFRSF 5/CD40, TNFRSF8/CD30, TNFRSF13C, TICAM1, TNFRSF 17/BCMA, TLR4, EDAR, MAP3K5, MAP3K14, TRAIP/TRIP, TDP2/TTRAP, TANK/ITRAF, TRAF3IP1, OTUB1, OTUB2, OTUD5, CARD 14,
RNF216, MAVS, OPTN, BIRC2, BIRC3, and TBK1. Its interaction with TNFRSF 5/CD40 is modulated by TANK/ITRAF, which competes for the same binding site. TRAF3 is also identified in a complex with TRAF2, MAP3K14 and BIRC3. Upon exposure to bacterial lipopolysaccharide (LPS), TRAF3 is recruited to a transient complex containing TLR4, TRAF3, TRAF6, IKBKG, MAP3K7, MYD88, TICAM1, BIRC2, BIRC3 and UBE2N. TRAF3 also interacts (via RING-type zinc finger domain) with SRC and interacts (via MATH domain) with PTPN22, which promotes TRAF3 polyubiquitination. TRAF3 functions in multiple pathways, including, at least, activated TLR4 signaling (e.g., MyD88- independent TLR3/TLR4 cascade, TLR3 and TLR4 cascade, etc.), RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways (e.g., RIG-I-like Receptor (RLR) signaling pathways, TRAF3 -dependent IRF activation pathway, etc.), RANK signaling in osteoclasts (e.g., APRIL pathway, BAFF in B-cell signaling, etc.), TNFRl pathway (TWEAK pathway, GITR pathway, etc.), NF-κΒ signaling, apoptosis and autophagy, etc. TRAF3 is suggested to be related to multiple diseases and disorders including, at least, herpes simplex encephalitis 3, herpes simplex meningo-encephalitis, splenic marginal zone lymphoma, etc.
The nucleic acid and amino acid sequences of a representative human TRAF3 is available to the public at the GenBank database (Gene ID 7187) and is shown in Table 1 (e.g., NM_145725.2 and NP_663777.1, representing the longest transcript variant 1 and the longest isoform 1, NM_145726.2 and NP_663778.1, representing the transcript variant 2 (lacking an in-frame coding segment compared to variant 1) and the encoded isoform 2 (lacking an internal region compared to isoform 1), NM_003300.3 and NP_003291.2, representing the transcript variant 3 (differing in the 5'UTR compared to variant 1) and the encoded isoform 1 (i.e., having the same sequence as isoform 1), and NM_001199427.1 and NP OOl 186356.1, representing the transcript variant 4 (differing in the 5'UTR and
lacking an in-frame coding segment compared to variant 1) and the encoded isoform 3 (lacking an internal region compared to isoform 1). The domain structure of TRAF3 polypeptide is well known and accessible in UniProtKB database under the accession number Q13114, including, in the order from the 5' terminus to the 3' terminus, a RING- type zinc finger domain comprising, e.g., amino acid positions 68-77 of NP 663777.1, two TRAF-type zinc finger domains comprising, e.g., amino acid positions 135-190 and 191- 249 of NP 663777.1, a coiled coil region comprising, e.g., amino acid positions 267-338 of NP 663777.1, and a meprin and TRAF-C homology (MATH) domain comprising, e.g., amino acid positions 415-560 of NP_663777.1.
Nucleic acid and polypeptide sequences of TRAF3 orthologs in organisms other than humans are well-known and include, for example, chimpanzee (Pan troglodytes) TRAF3 (XM_016926751.1 and XP_016782240.1, XM_016926752.1 and
XP_016782241.1, XM_016926754.1 and XP_016782243.1, and XM_016926753.1 and XP_016782242.1), Rhesus monkey TRAF3 (XM_015144530.1 and XP_015000016.1, XM_001082535.3 and XP_001082535.3, XM_015144532.1 and XP_015000018.1,
XM_015144534.1 and XP_015000020.1, XM 015144531.1 and XP_015000017.1, and XM_015144529.1 and XP_015000015.1), dog TRAF3 (XM_849522.4 and XP_854615.1, and XM_003435066.3 and XP_003435114.1), mouse TRAF3 (NM_011632.3 and
NP 035762.2, representing the transcript variant 1 and the encoded longer isoform a, and NM_001286122.1 and NP_001273051.1, representing the transcript variant 3 (lacking an internal exon in the 5' UTR and an in-frame exon in the coding region, compared to variant 1) and the encoded shorter isoform b (lacking an internal segment, compared to isoform a)), cattle TRAF3 (NM_001205586.1 and NP_001192515.1), Norway rat {Rattus norvegicus) TRAF3 (NM_001108724.1 and NP_001102194.1), chicken TRAF3 (XM_004936344.2 and XP_004936401.1, XM 004936341.2 and XP 004936398.1, XM_015287823.1 and XP_015143309.1, XM_015287819.1 and XP 015143305.1, XM_015287818.1 and XP_015143304.1, XM_004936343.2 and XP 004936400.1, XM_015287825.1 and XP_015143311.1, XM_015287827.1 and XP_015143313.1, XM_015287820.1 and XP_015143306.1, XM_015287821.1 and XP 015143307.1, XM_015287822.1 and XP_015143308.1, and XM_015287826.1 and XP_015143312.1), tropical clawed frog (Xenopus tropicalis) TRAF3 (XM_002937990.4 and XP_002938036.2), and zebrafish (Danio rerio) TRAF3 (NM_001003513.1 and NP_001003513.1).
The term "TRAF3 activity" includes the ability of a TRAF3 polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein) to bind its substrate and/or biological activity. TRAF3 activity may also include one or more of functions, such as forming E3 ubiquitin-protein ligase complexes, and/or others disclosed herein in the NF-KB pathway and other related pathways. For example, TRAF3 may interact with various proteins disclosed herein for its functions in signaling. TRAF3 may also be proteolyticly modified, such as being cleaved, ubiquitinated, deubiquitinated, or otherwise disclosed herein, for its functions.
The term "TRAF3 substrate(s)" refers to binding partners of a TRAF3 polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein), e.g., the binding partners described herein of TRAF3 for multiple signal transduction pathways.
Furthermore, TRAF3 substrates may refer to downstream members in the signaling pathways where TRAF3 has a functional role.
The term "TRAF 3 -regulated signaling pathway(s)" includes signaling pathways in which TRAF3 (and its fragments, domains, and/or motifs thereof, discussed herein) binds to at least one of its substrate, through which at least one cellular function and/or activity and/or cellular protein profiles is changed. TRAF 3 -regulated signaling pathways include at least those described herein, such as activated TLR4 signaling (e.g., MyD88-independent TLR3/TLR4 cascade, TLR3 and TLR4 cascade, etc.), RIG-I/MDA5 mediated induction of IFN-alpha eta pathways (e.g., RIG-I-like Receptor (RLR) signaling pathways, TRAF3- dependent IRF activation pathway, etc.), RANK signaling in osteoclasts (e.g., APRIL pathway, BAFF in B-cell signaling, etc.), TNFRl pathway (TWEAK pathway, GITR pathway, etc.), NF-κΒ signaling, apoptosis and autophagy, etc.
The term "TRAF3 inhibitor(s)" includes any natural or non-natural agent prepared, synthesized, manufactured, and/or purified by human that is capable of reducing, inhibiting, blocking, preventing, and/or that inhibits the ability of a TRAF3 polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein). In one embodiment, such inhibitors may reduce or inhibit the binding/interaction between TRAF3 and its substrates or other binding partners. In still another embodiment, such inhibitors may increase or promote the turnover rate, reduce or inhibit the expression and/or the stability (e.g., the half-life), and/or change the cellular localization of TRAF3, resulting in at least a decrease in TRAF3 levels and/or activity. Such inhibitors may be any molecule, including but not limited to small molecule compounds, antibodies or intrabodies, RNA interfering (RNAi)
agents (including at least siRNAs, shRNAs, microRNAs (miRNAs), piwi, and other well- known agents). Such inhibitors may be specific to TRAF3 or also inhibit at least one of other TRAF family members and T F receptor (T FR) superfamily members. RNA interference for TRAF3 polypeptides are well known and commercially available (e.g., human, mouse, or rat shRNA (Cat. # TL502320 and TG300876) and siRNA (Cat. #
SR304928 and SR417046) products and human or mouse gene knockout kit via CRISPR (Cat. # KN318123 and KN210417) from Origene (Rockville, MD), siRNA/shRNA products (Cat. # sc-29510, sc-36712, and sc-44277) and CRISPR products (Cat. # sc- 423494 and sc-400473) from Santa Cruz Biotechnology (Dallas, Texas), Ready-to-package AAV shRNA clones from Vigene Biosciences (Rockville, MD, Cat. # SH872930 and
SH800612). Methods for detection, purification, and/or inhibition of TRAF3 (e.g., by anti- TRAF3 antibodies) are also well known and commercially available (e.g., multiple anti- TRAF3 antibodies from Origene (Cat. # TA322870, TA322871, TA336438, etc.), Cell Signaling Technology (Danvers, MA, Cat. # 4729), abeam (Cambridge, MA, Cat. # ab36988, ab 155298, etc.), and Santa Cruz Biotechnology (Cat. # sc-949, sc-6933, sc-1828, etc.)). Human TRAF3 knockout cell lines are also well known and available from Horizon Discovery (Cambridge, UK, Cat. # HZGHC002608c001).
The term "RNF31," also known as RING finger protein 31, HOIL-1 -interacting protein, ZIBRA, and HOIP, refers to a member of a family of proteins containing RING- type zinc fingers, a motif present in a variety of functionally distinct proteins and known to be involved in protein-DNA and protein-protein interactions. R F31 is an E3 ubiquitin- protein ligase component of the linear ubiquitin chain assembly complex (LUBAC), which conjugates linear (Met- 1 -linked) polyubiquitin chains to substrates and plays a key role in F-KB activation and regulation of inflammation. LUBAC conjugates linear polyubiquitin to IKBKG and RIPK1 and is involved in activation of the canonical F-κΒ and the J K signaling pathways. Linear ubiquitination mediated by the LUBAC complex interferes with T F-induced cell death and thereby prevents inflammation. LUBAC is proposed to be recruited to the TNF-R1 signaling complex (TNF-RSC) following polyubiquitination of T F-RSC components by BIRC2 and/or BIRC3 and to conjugate linear polyubiquitin to IKBKG and possibly other components contributing to the stability of the complex.
Together with OTULIN, the LUBAC complex regulates the canonical Wnt signaling during angiogenesis. R F31 binds polyubiquitin of different linkage types. LUBAC comprises SHARPIN, RBCK1 and RNF31, with a molecular weight of about 600 kDa, suggesting a
heteromultimeric assembly of its subunits. RNF31 associates with the TNF-R1 signaling complex (T F-RSC) in a stimulation-dependent manner. RNF31 also interacts (via the PUB domain) with OTULIN (via the PIM motif) and interacts (via the PUB domain) with VCP (via the PIM motif). RNF31 also interacts with CYLD and MUSK. RNF31 functions in multiple pathways, including, at least, TNF signaling (REACTOME, e.g., death receptor signaling, TNFR1 -induced F-κΒ pathway), Toll-Like receptor signaling pathways (e.g., NOD-like receptor signaling pathway), ubiquitination cascade pathway, GPCR signaling, etc. R F31 is suggested to be related to multiple diseases and disorders including, at least polyglucosan body myopathy 1 with or without immunodeficiency, otulipenia (e.g., autoinflammation, panniculitis and dermatosis syndrome), glycogen storage disease iv (e.g., amylopectinosis), hepatitis c virus infection, etc.
The nucleic acid and amino acid sequences of a representative human RNF31 is available to the public at the GenBank database (Gene ID 55072) and is shown in Table 1 (e.g., M_017999.4 and P_060469.4, representing the longer transcript variant 1 and the encoded longer isoform 1, and M_001310332.1 and P_001297261.1, representing the shorter transcript variant 2 (using an alternate first exon and an alternate splice site in a 5' exon compared to variant 1, resulting in the use of a downstream translation initiation site) and the encoded shorter isoform 2 (having a distinct N-terminus)). The domain structure of R F31 polypeptide is well known and accessible in UniProtKB database under the accession number Q9UHD2, including, in the order from the 5' terminus to the 3' terminus, a PNGase/UBA or UBX (PUB) domain comprising, e.g., amino acid positions 71-142 of P 060469.4, and a UBA domain comprising, e.g., amino acid positions 564-615 of P 060469.4. Other regions include, for example, a polyubiquitin-binding region comprising, e.g., amino acid positions 1-485 of P 060469.4, a region interacting with RBCKl comprising, e.g., amino acid positions 563-616 of NP 060469.4, and an linear ubiquitin chain determining domain (LDD) region comprising, e.g., amino acid positions 910-1072 of P 060469.4. Multiple zinc finger domains on R F31 include three RanBP2- type zinc finger domains comprising, e.g., amino acid positions 299-329, 350-379, and 409- 438 of P 060469.4, one RING-type zinc finger comprising, e.g., amino acid positions 699-747 of P 060469.4, one IBR-type zinc finger comprising, e.g., amino acid positions 779-841 of P 060469.4, and another RING-type zinc finger comprising, e.g., amino acid positions 860-909 of NP 060469.4. The PUB domain of RNF31 mediates interaction with the PIM motifs of VCP and RNF31 , with a strong preference for RNF31. The RanBP2-
type zinc fingers mediate the specific interaction with ubiquitin. The UBA domain mediates association with RBCKl/HOILl via interaction with its UBL domain. RING 1 and IBR zinc-fingers catalyze the first step transfer of ubiquitin from the E2 onto RING 2, to transiently form a HECT-like covalent thioester intermediate (Smit et al. (2012) EMBO J. 31 :3833-3844). The LDD domain mediates the final transfer of ubiquitin from RING 2 onto the N-terminus of a target ubiquitin.
Nucleic acid and polypeptide sequences of RNF31 orthologs in organisms other than humans are well-known and include, for example, chimpanzee {Pan troglodytes) RNF31 (XM OO 1166671.4 and XP_001166671.2, XM_009427566.2 and
XP_009425841.2, and XM_009427568.2 and XP_009425843.2), Rhesus monkey RNF31 (XM_001112195.3 and XP_001112195.1, and XM_015143429.1 and XP_014998915.1), dog RNF31 (XM_005623255.2 and XP_005623312.1, XM_005623256.2 and
XP_005623313.1, XM_537383.5 and XP_537383.2, and XM_005623257.2 and
XP_005623314.1), mouse RNF31 (NM_194346.2 and NP_919327.2), Norway rat (Rattus norvegicus) RNF31 (NM_001108868.1 and NP_001102338.2), and tropical clawed frog (Xenopus tropicalis) KNF31 (NM_001097175.1 and NP_001090644.1).
The term "RNF31 activity" includes the ability of a RNF31 polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein) to bind its substrate and/or biological activity. RNF31 activity may also include one or more of functions, such as its E3 ubiquitin ligase activity, and/or others disclosed herein in the NF-κΒ pathway and other related pathways. For example, RNF31 may interact with various proteins (e.g., its ubiquitination substrates) disclosed herein for its functions in signaling. RNF31 may also be proteolyticly modified, such as being cleaved, ubiquitinated, deubiquitinated, or otherwise disclosed herein, for it functions.
The term "RNF31 substrate(s)" refers to binding partners of a RNF31 polypeptide
(and its fragments, domains, and/or motifs thereof, discussed herein), e.g., the substrates described herein of RNF31 as an E3 ubiquitin ligase. Furthermore, RNF31 substrates may refer to downstream members in the signaling pathways where RNF31 has a functional role.
The term "RNF31 -regulated signaling pathway(s)" includes signaling pathways in which RNF31 (and its fragments, domains, and/or motifs thereof, discussed herein) binds to at least one of its substrate, through which at least one cellular function and/or activity and/or cellular protein profiles is changed. In some embodiments, RNF31 is an E3
ubiquitin ligase and promotes ubiquitination of its substrates. RNF 31 -regulated signaling pathways include at least those described herein, such as TNF signaling (REACTOME, e.g., death receptor signaling, T FR1 -induced F-κΒ pathway), Toll-Like receptor signaling pathways (e.g., NOD-like receptor signaling pathway), ubiquitination cascade pathway, GPCR signaling, etc. R F31 is suggested to be related to multiple diseases and disorders including, at least polyglucosan body myopathy 1 with or without
immunodeficiency, otulipenia (e.g., autoinflammation, panniculitis and dermatosis syndrome), glycogen storage disease iv (e.g., amylopectinosis), hepatitis c virus infection, etc.
The term "RNF31 inhibitor(s)" includes any natural or non-natural agent prepared, synthesized, manufactured, and/or purified by human that is capable of reducing, inhibiting, blocking, preventing, and/or that inhibits the ability of a R F31 polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein). In one embodiment, such inhibitors may reduce or inhibit the binding/interaction between RNF31 and its substrates or other binding partners. In another embodiment, such inhibitors may reduce or inhibit the catalytic function of RNF31 as an E3 ubiquitin ligase. In still another embodiment, such inhibitors may increase or promote the turnover rate, reduce or inhibit the expression and/or the stability (e.g., the half-life), and/or change the cellular localization of R F31, resulting in at least a decrease in R F31 levels and/or activity (e.g., its E3 ubiquitin ligase activity). Such inhibitors may be any molecule, including but not limited to small molecule compounds, antibodies or intrabodies, RNA interfering (RNAi) agents (including at least siRNAs, shRNAs, microRNAs (miRNAs), piwi, and other well-known agents). Such inhibitors may be specific to R F31 or also inhibit at least one of other E3 ubiquitin ligases. RNA interference for RNF31 polypeptides are well known and commercially available (e.g., human, mouse, or rat shRNA (Cat. # TF320708, TF508054, TF707395, etc.) and siRNA (Cat. # SR421932 and SR310467) products and human or mouse gene knockout kit via CRISPR (Cat. # KN314948 and KN2041 17) from Origene (Rockville, MD), siRNA/shRNA products (Cat. # sc-92101 and sc-153046) and CRISPR products (Cat. # sc- 435274 and sc-412436) from Santa Cruz Biotechnology (Dallas, Texas), Ready-to-package AAV shRNA clones from Vigene Biosciences (Rockville, MD, Cat. # SH898682).
Methods for detection, purification, and/or inhibition of RNF31 (e.g., by anti-RNF31 antibodies) are also well known and commercially available (e.g., anti-RNF31 antibodies from Origene (Cat. # TA329873 and TA302821), R&D System (Minneapolis, MN, Cat. #
MAB8039 and AF8039), abeam (Cambridge, MA, Cat. # ab40676, ab l09735, ab l21 16, etc.), and Novus Biologicals (Littleton, CO; Cat. # AF8039, MAB8039, BP2-27290, etc.)). Human R F31 knockout cell lines are also well known and available from Horizon Discovery (Cambridge, UK, Cat. # HZGHC004529c01 1).
The term "RBCKl," also known as RanBP2-type and C3HC4-type zinc finger- containing protein 1, Hepatitis B Virus X- Associated Protein 4, RING Finger Protein 54, HOIL-1, and R F54, refers to a member of a family of proteins containing multiple types of zinc fingers, a motif present in a variety of functionally distinct proteins and known to be involved in protein-DNA and protein-protein interactions. Like RNF31, RBCKl is also an E3 ubiquitin-protein ligase component of the linear ubiquitin chain assembly complex (LUBAC), which conjugates linear (Met- 1 -linked) polyubiquitin chains to substrates and plays a key role in NF-κΒ activation and regulation of inflammation. LUBAC conjugates linear polyubiquitin to IKBKG and RIPK1 and is involved in activation of the canonical NF-KB and the INK signaling pathways. Linear ubiquitination mediated by the LUBAC complex interferes with TNF -induced cell death and thereby prevents inflammation.
LUBAC is proposed to be recruited to the TNF-R1 signaling complex (TNF-RSC) following polyubiquitination of TNF-RSC components by BIRC2 and/or BIRC3 and to conjugate linear polyubiquitin to IKBKG and possibly other components contributing to the stability of the complex. Together with OTULIN, the LUBAC complex regulates the canonical Wnt signaling during angiogenesis. LUBAC comprises SHARPEST, RBCKl and RNF31, with a molecular weight of about 600 kDa, suggesting a heteromultimeric assembly of its subunits. RBCKl promotes ubiquitination of oxidized IREB2, which requires both heme and oxygen. RBCKl also promotes ubiquitination of TAB2 and IRF3 and their degradation by the proteasome. RBCKl interacts with beta-I-type (PRKCB l), zeta-type protein kinase C (PRKCZ), UBE2L3, PRKCH, EYA1, TAB2, TAB3, MAP3K7, TRAF6, RIPK1, and IRF3. RBCKl interacts with the HBV pX/HBx protein, which is required to activate transcription of the viral genome. RBCKl associates with the TNF-Rl signaling complex (TNF-RSC) in a stimulation-dependent manner. RBCKl functions in multiple pathways, including, at least, TNF signaling (REACTOME, e.g., death receptor signaling, TNFRl -induced NF-κΒ pathway), Toll-Like receptor signaling pathways (e.g., NOD-like receptor signaling pathway), GPCR signaling, class I MHC mediated antigen processing and presentation (e.g., antigen processing through ubiquitination and proteasome degradation), adaptive immune system, etc. RBCKl is suggested to be related to multiple
diseases and disorders including, at least, polyglucosan body myopathy 1 with or without immunodeficiency, branchiootic syndrome, and glycogen storage disease iv (e.g., amylopectinosis), etc.
The nucleic acid and amino acid sequences of a representative human RBCK1 is available to the public at the GenBank database (Gene ID 10616) and is shown in Table 1 (e.g., NM_006462.5 and NP_006453.1, representing transcript variant 1 and the encoded isoform 1, NM_031229.3 and NP_112506.2, representing transcript variant 2 and the encoded longest isoform 2, NM_001323956.1 and NP_001310885.1, representing transcript variant 3 and the encoded isoform 3, NM_001323958.1 and NP_001310887.1, representing transcript variant 4 and the encoded isoform 3, and NM_001323960.1 and
NP 001310889.1, representing transcript variant 5 and the encoded isoform 4). The domain structure of RBCK1 polypeptide is well known and accessible in UniProtKB database under the accession number Q9BYM8, including, in the order from the 5' terminus to the 3' terminus, a ubiquitin-like (UBL) domain comprising, e.g., amino acid positions 55-119 of NP_112506.2, and a coiled coil domain comprising, e.g., amino acid positions 233-261 of NP l 12506.2. A region for RBCK1 interacting with TAB2 comprises, e.g., amino acid positions 1-270 of NP l 12506.2. A region for RBCK1 interacting with IRF3 comprises, e.g., amino acid positions 1-220 of NP_112506.2. A region for RBCK1 interacting with RNF31 comprises, e.g., amino acid positions 69-131 of NP l 12506.2. Multiple zinc finger domains on RBCK1 include one RanBP2-type zinc finger comprising, e.g., amino acid positions 193-222 of NP_112506.2, two RING-type zinc fingers comprising, e.g., amino acid positions 282-327 and 437-463 of NP_112506.2, and one IBR-type zinc finger comprising, e.g., amino acid positions 362-411 of
NP_112506.2. The RanBP2-type zinc finger, also called Npl4 zinc finger (NZF), mediates binding to 'Met- 1 '-linked polyubiquitins. The UBL domain mediates association with RNF31 via interaction with its UBA domain (Ikeda et al. (2011) Nature 471 : 637-641).
Nucleic acid and polypeptide sequences of RBCKl orthologs in organisms other than humans are well-known and include, for example, chimpanzee (Pan troglodytes) RBCKl (XM_001152050.5 and XP 001152050.1, XM_016937253.1 and
XP_016792742.1, XM_009436647.2 and XP_009434922.1, XM_016937254.1 and
XP_016792743.1, XM_016937252.1 and XP_016792741.1, and XM_016937255.1 and XP_016792744.1), Rhesus monkey RBCKl (NM_001266297.1 and NP_001253226.1), dog RBCKl (XM_542942.5 and XP_542942.4), mouse RBCKl (NM_001083921.1 and
ΝΡ_001077390.1, representing the longer transcript variant 1 and the encoded protein, and M_019705.3 and P_062679.2, representing the shorter transcript variant 2 (differing in the 5' UTR compared to variant 1) and the encoded same protein), cattle RBCKl
(NM_001075161.1 and P_001068629.1), pig RBCKl (XM_021078286.1 and
XP_020933945.1, and XM_021078287.1 and XP_020933946.1), Norway rat (Rattus norvegicus) RBCKl (NM_021764.1 and NP_068532.2), and tropical clawed frog (Xenopus tropicalis) RBCKl (NM_001097175.1 and NP_001090644.1), and zebrafish RBCKl (NM_001002168.1 and NP_001002168.1).
The term "RBCKl activity" includes the ability of a RBCKl polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein) to bind its substrate and/or biological activity. RBCKl activity may also include one or more of functions, such as its E3 ubiquitin ligase activity, and/or others disclosed herein in the NF-κΒ pathway and other related pathways. For example, RBCKl may interact with various proteins {e.g., its ubiquitination substrates) disclosed herein for its functions in signaling. RBCKl may also be proteolyticly modified, such as being cleaved, ubiquitinated, deubiquitinated, or otherwise disclosed herein, for it functions.
The term "RBCKl substrate(s)" refers to binding partners of a RBCKl polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein), e.g., the substrates described herein of RBCKl as an E3 ubiquitin ligase. Furthermore, RBCKl substrates may refer to downstream members in the signaling pathways where RBCKl has a functional role.
The term "RBCKl -regulated signaling pathway(s)" includes signaling pathways in which RBCKl (and its fragments, domains, and/or motifs thereof, discussed herein) binds to at least one of its substrate, through which at least one cellular function and/or activity and/or cellular protein profiles is changed. In some embodiments, RBCKl is an E3 ubiquitin ligase and promotes ubiquitination of its substrates. RBCKl -regulated signaling pathways include at least those described herein, such as TNF signaling (REACTOME, e.g., death receptor signaling, TNFR1 -induced NF-κΒ pathway), Toll-Like receptor signaling pathways {e.g., NOD-like receptor signaling pathway), GPCR signaling, class I MHC mediated antigen processing and presentation {e.g., antigen processing through ubiquitination and proteasome degradation), adaptive immune system, etc.
The term "RBCKl inhibitor(s)" includes any natural or non-natural agent prepared, synthesized, manufactured, and/or purified by human that is capable of reducing, inhibiting,
blocking, preventing, and/or that inhibits the ability of a RBCK1 polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein). In one embodiment, such inhibitors may reduce or inhibit the binding/interaction between RBCK1 and its substrates or other binding partners. In another embodiment, such inhibitors may reduce or inhibit the catalytic function of RBCK1 as an E3 ubiquitin ligase. In still another embodiment, such inhibitors may increase or promote the turnover rate, reduce or inhibit the expression and/or the stability (e.g., the half-life), and/or change the cellular localization of RBCK1, resulting in at least a decrease in RBCK1 levels and/or activity (e.g., its E3 ubiquitin ligase activity). Such inhibitors may be any molecule, including but not limited to small molecule compounds, antibodies or intrabodies, RNA interfering (RNAi) agents (including at least siRNAs, shRNAs, microRNAs (miRNAs), piwi, and other well-known agents). Such inhibitors may be specific to RBCKl or also inhibit at least one of other E3 ubiquitin ligases. RNA interference for RBCKl polypeptides are well known and commercially available (e.g., human, mouse, or rat shRNA (Cat. # TR309920, TF502567, TF710513, etc.) and siRNA (Cat. # SR307231, SR416003, and SR503965) products and human or mouse gene knockout kit via CRISPR (Cat. # KN203906 and KN314537) from Origene (Rockville, MD), siRNA/shRNA products (Cat. # sc-61446 and sc-61447) and CRISPR products (Cat. # sc-423985 and sc-402044) from Santa Cruz Biotechnology (Dallas, Texas), Ready-to-package AAV shRNA clones from Vigene Biosciences (Rockville, MD, Cat. # SH865441 and SH819112). Methods for detection, purification, and/or inhibition of
RBCKl (e.g., by anti-RBCKl antibodies) are also well known and commercially available (e.g., anti-RBCKl antibodies from Origene (Cat. # API 1958PU-N), abeam (Cambridge, MA, Cat. # ab38540, ab219955, abl08479, etc.), Novus Biologicals (Littleton, CO; Cat. # NBP1-88301, H00010616-M01, NBP2-59048, etc.), and Santa Cruz Biotechnology (sc- 365523, sc-367525, sc-49718, etc.)). Human RBCKl knockout cell lines are also well known and available from Horizon Discovery (Cambridge, UK, Cat. # HZGHC10616).
The term "OTULIN," also known as OTU (Ovarian Tumor) domain-containing deubiquitinase with linear linkage specificity, ubiquitin thioesterase, Gumby, AIPDS, GUM, and FAM105B, refers to a member of a group of ubiquitin isopeptidases in the peptidase C65 family. OTULIN specifically recognizes and removes Ml(Metl)-linked, or linear, ubiquitin chains from protein substrates, while linear ubiquitin chains are known to regulate the NF-kappa B signaling pathway in the context of immunity and inflammation. Mutations in Otulin cause a potentially fatal autoinflammatory syndrome in human patients.
As a deubiquitinase, OTULIN acts as a regulator of angiogenesis and innate immune response. OTULIN also facilitates thiol-dependent hydrolysis of ester, thioester, amide, peptide and isopeptide bonds formed by the C-terminal Gly of ubiquitin (Mevissen et al. (2013) Cell 154: 169-184). OTULIN associates with the LUBAC complex via direct interaction with RNF31 and counteracts its action by cleaving linear polyubiquitin chains to substrates (Keusekotten et al. (2013) Cell 153 : 1312-1326). Thus, OTULIN acts as a negative regulator of NF-κΒ by counteracting activity of the LUBAC complex and maintaining homeostasis of the LUBAC complex by restricting autoubiquination of the LUBAC complex subunit RNF31. OTULIN is required during angiogenesis, craniofacial and neuronal development by regulating the canonical Wnt signaling together with the LUBAC complex. Some reports show that OTULIN function is restricted to homeostasis of the LUBAC complex, because it is not stably associated with TNF or NOD2 receptor signaling complexes (RSCs). However, further report have shown that it plays active roles in receptor signaling. For example, OTULIN acts as a key negative regulator of inflammation by restricting spontaneous inflammation and maintaining immune homeostasis. In myeloid cell, OTULIN is required to prevent unwarranted secretion of cytokines leading to inflammation and autoimmunity by restricting linear polyubiquitin formation. OTULIN plays a key role in innate immune response by restricting linear polyubiquitin formation on RIPK2 in response to NOD2 stimulation, probably to limit NOD2-dependent proinflammatory signaling. OTULIN interacts with RNF31 (through the PFM motif of OTULIN and the PUB domain of RNF31), segment polarity protein disheveled homolog DVL2, transmembrane protein 239, protein FAM168A, Matrix protein 2, OTU domain-containing protein 1, OTU domain-containing protein 7B, and DAZ- associated protein 2 (Damgaard et al. (2016) Cell 166: 1215-1230). OTULIN functions in multiple pathways, including, at least, TNF signaling (REACTOME, e.g., death receptor signaling, TNFRl signaling), NF-κΒ pathway, ubiquitination cascade pathway, metabolism of proteins {e.g., post-translational protein modification), GPCR signaling, etc. OTULIN is suggested to be related to multiple diseases and disorders including, at least, otulipenia {e.g., autoinflammation, panniculitis and dermatosis syndrome (AIPDS)), and panniculitis, etc.
The nucleic acid and amino acid sequences of a representative human OTULIN is available to the public at the GenBank database (Gene ID 90268) and is shown in Table 1 {e.g., NM_138348.5 and NP_612357.4). The domain structure of OTULIN polypeptide is
well known and accessible in UniProtKB database under the accession number Q96BN8, including, an OTU-like cysteine protease domain comprising, e.g., amino acid positions 1 18-346 of P 612357.4. In addition, OTULIN comprises multiple linear diubiquitin binding motifs comprising, e.g., amino acid positions 95-96, 124-126, 255-259, 283-289, and 336-338 of P_612357.4. A PIM motif locates at, e.g., amino acid positions 52-57 of P 612357.4, responsible for binding to the PUB domain of RNF31 (Schaeffer et al.
(2014) Mol. Cell 54:349-361).
Nucleic acid and polypeptide sequences of OTULIN orthologs in organisms other than humans are well-known and include, for example, chimpanzee {Pan troglodytes) OTULIN (XM_009448807.2 and XP_009447082.2, and XM_517640.6 and XP_517640.3), Rhesus monkey OTULIN (NM_001 193800.1 and NP_001 180729.1), dog OTULIN
(XM_005639659.2 and XP_005639716.1, XM_843160.4 and XP_848253.2,
XM_0141 10329.1 and XP_013965804.1, and XM_005639660.2 and XP_005639717.1), mouse OTULIN (NM_001013792.2 and NP_001013814.2), cattle OTULIN
(NM_001 100328.1 and NP_001093798.1), chicken OTULIN (XM_015282228.1 and XP_015137714.1, XM_0049351 1 1.2 and XP_004935168.2, XM_015282238.1 and
XP_015137724.1, XM_015282229.1 and XP_015137715.1, XM_015282239.1 and
XP_015137725.1, XM_015282236.1 and XP_015137722.1, XM_015282233.1 and XP_015137719.1, XM_015282230.1 and XP_015137716.1, XM_004935105.2 and
XP_004935162.2, XM_004935104.2 and XP_004935161.2, XM_003640779.3 and
XP_003640827.3, XM_015282235.1 and XP_015137721.1, XM_015282237.1 and
XP_015137723.1, XM_015282231.1 and XP_015137717.1, and XM_015282232.1 and XP_015137718.1), Norway rat (Rattus norvegicus) OTULIN (NM_001302889.1 and NP OO 1289818.1), and tropical clawed frog (Xenopus tropicalis) OTULIN
(XM_018094965.1 and XP_017950454.1, XM_004915327.3 and XP_004915384.1, XM_004915328.3 and XP_004915385.1, XM_004915329.3 and XP_004915386.1, XM_004915330.3 and XP_004915387.1, XM_018094966.1 and XP_017950455.1, XM_002933121.4 and XP_002933167.3, and XM_004915325.3 and XP_004915382.2), and zebrafish OTULIN (NM_001 166015.1 and NP_001 159487.1).
The term "OTULIN activity" includes the ability of an OTULIN polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein) to bind its substrate and/or biological activity. OTULIN activity may also include one or more of functions, such as its deubiquitinase activity, and/or others disclosed herein in the NF-κΒ pathway and other
related pathways. For example, OTULIN may interact with various proteins (e.g., its deubiquitination substrates) disclosed herein for its functions in signaling. OTULIN may also be proteolyticly modified, such as being cleaved, ubiquitinated, deubiquitinated, acetylated, phosphorylated, or otherwise disclosed herein, for it functions.
The term "OTULIN substrate(s)" refers to binding partners of an OTULIN polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein), e.g., the substrates described herein of OTULIN as a deubiquitinase. Furthermore, OTULIN substrates may refer to downstream members in the signaling pathways where OTULIN has a functional role.
The term "OTULIN-regulated signaling pathway(s)" includes signaling pathways in which OTULIN (and its fragments, domains, and/or motifs thereof, discussed herein) binds to at least one of its substrate, through which at least one cellular function and/or activity and/or cellular protein profiles is changed. In some embodiments, OTULIN is a
deubiquitinase and removes ubiquitin from and/or restricts linear polyubiquitination formation on its substrates. OTULIN-regulated signaling pathways include at least those described herein, such as TNF signaling (REACTOME, e.g., death receptor signaling, TNFRl signaling), NF-κΒ pathway, ubiquitination cascade pathway, metabolism of proteins (e.g., post-translational protein modification), GPCR signaling, etc.
The term "OTULIN inhibitor(s)" includes any natural or non-natural agent prepared, synthesized, manufactured, and/or purified by human that is capable of reducing, inhibiting, blocking, preventing, and/or that inhibits the ability of an OTULIN polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein). In one embodiment, such inhibitors may reduce or inhibit the binding/interaction between OTULIN and its substrates or other binding partners. In another embodiment, such inhibitors may reduce or inhibit the catalytic function of OTULIN as a deubiquitinase. In still another embodiment, such inhibitors may increase or promote the turnover rate, reduce or inhibit the expression and/or the stability (e.g., the half-life), and/or change the cellular localization of OTULIN, resulting in at least a decrease in OTULIN levels and/or activity(e.g-., its deubiquitinase activity). Such inhibitors may be any molecule, including but not limited to small molecule compounds, antibodies or intrabodies, RNA interfering (RNAi) agents (including at least siRNAs, shRNAs, microRNAs (miRNAs), piwi, and other well-known agents). Such inhibitors may be specific to OTULIN or also inhibit at least one of other deubiquitinase. RNA interference for OTULIN polypeptides are well known and commercially available
(e.g., human or mouse shRNA (Cat. # TL304698 and TG517394) and siRNA (Cat. # SR313974 and SR405655) products and human or mouse gene knockout kit via CRISPR (Cat. # KN312688 and KN224840) from Origene (Rockville, MD, siRNA/shRNA products (Cat. # sc-91772 and sc-141659) and CRISPR products (Cat. # sc-407676 and sc-436617) from Santa Cruz Biotechnology (Dallas, Texas), Ready-to-package AAV shRNA clones from Vigene Biosciences (Rockville, MD, Cat. # SH81 1464). Methods for detection, purification, and/or inhibition of OTULIN (e.g., by anti-OTULIN antibodies) are also well known and commercially available (e.g., anti-OTULIN antibodies from Origene (Cat. # TA335406), abeam (Cambridge, MA, Cat. # ab l 51 1 17, ab l 14137, ab l 82598, etc.), Novus Biologicals (Littleton, CO; Cat. # NBP2-14722, etc.), and Cell Signaling Technology
(Danvers, MA, Cat. # 14127)). Human OTULIN knockout cell lines are also well known and available from Horizon Discovery (Cambridge, UK, Cat. # HZGHC90268).
The term "TRAF6," also known as TNF receptor-associated factor 6, RNF85, and Interleukin-1 signal transducer, refers to a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from, members of the TNF receptor (TNFR) superfamily. TRAF6 participates in the signal from members of the TNFR superfamily as well as the Toll/IL-1 family, such as CD40, TNFSF 1 1/RANCE and IL-1. TRAF6 interacts with various protein kinases including IRAKI/IRAK, SRC, and PKCzeta, which provides a link between distinct signaling pathways. TRAF6 functions as a signal transducer in the NF-κΒ pathway that activates ΙκΒ kinase (IKK) in response to proinflammatory cytokines. The interaction of TRAF6 with UBE2N/UBC 13, and UBE2V1/UEV1A, which are ubiquitin conjugating enzymes catalyzing the formation of polyubiquitin chains, has been found to be required for IKK activation. TRAF6 also interacts with the transforming growth factor (TGF) beta receptor complex and is required for Smad-independent activation of the INK and p38 kinases.
TRAF6 has an amino terminal RING domain which is followed by four zinc-finger motifs, a central coiled-coil region and a highly conserved carboxyl terminal domain, known as the TRAF-C domain. Two alternatively spliced transcript variants, encoding an identical protein, have been reported. TRAF6 is an E3 ubiquitin ligase that, together with UBE2N and UBE2V1, mediates the synthesis of Lys-63-linked-polyubiquitin chains conjugated to proteins, such as IKBKG, IRAKI, AKTl and AKT2. TRAF6 also mediates ubiquitination of free/unanchored polyubiquitin chain that leads to MAP3K7 activation. TRAF6 leads to the activation of NF-kappa-B and JUN and may be essential for the formation of functional
osteoclasts. TRAF6 seems to also play a role in dendritic cells (DCs) maturation and/or activation. TRAF6 represses c-Myb-mediated transactivation in B-lymphocytes. TRAF6 is an adapter protein that seems to play a role in signal transduction initiated via TNF receptor, IL-1 receptor and IL-17 receptor. TRAF6 regulates osteoclast differentiation by mediating the activation of adapter protein complex 1 (AP-1) and F-κΒ, in response to RANK-L stimulation. Together with MAP3K8, TRAF6 mediates CD40 signals that activate ERK in B-cells and macrophages, and thus may play a role in the regulation of immunoglobulin production. TRAF6 can form homotrimers and homooligomers. The N- terminal region of TRAF6 is dimeric, while the C-terminal region is trimeric. Upon IL1B treatment, TRAF6 forms a complex with PELI1 , IRAK 1 , IRAK4 and MYD88, which then recruits MAP3K7/TAK1, TAB l and TAB 2 to mediate F-κΒ activation. Direct binding of SMAD6 to PELI1 prevents the complex formation and hence negatively regulates IL1R- TLR signaling and eventually F-KB-mediated gene expression. TRAF6 binds to
T FRSF5/CD40, TNFRSF 1 1 A/RANK, NGFR, T FRSF 17, IRAK2, IRAK3, RIPK2, MAP3K1, MAP3K5, MAP3K14, CSK, TRAF, TRAF-interacting protein TRIP, and TNF receptor associated protein TDP2. TRAF6 also interacts with IL17R, SQSTM1 bridging NTRK1 and NGFR and forms a ternary complex with SQSTM1 and PRKCZ. TRAF 6 further interacts with PELI2 and PELI3 and binds UBE2V1, TAX1BP1, ZNF675, ARRB 1, ARRB2, MAP3K7, and TAB 1/MAP3K7IP1 during IL-1 signaling. TRAF 6 also interacts with UBE2N, TGFBR1, HDAC1, RANGAPl, AKT1, AKT2, and AKT3, NUMBL,
RBCK1, TRAF3IP2, LIMD1, RSAD2/viperin, EIF2AK2/PKR (via the kinase catalytic domain), ZFAND5, ILIRLI, TRAFDl, AJUBA, MAVS/IPS l, WDR34 (via WD domains), IFIT3 (via N-terminus), TICAM2, CARD 14, CD40, MAP3K8 (which is required for ERK activation), TICAMl (this interaction is enhanced in the presence of WDFY1), TANK (which increases in response to DNA damage), USP10 (this interaction increases in response to DNA damage), and ZC3H12A (this interaction increases in response to DNA damage and is stimulated by TANK). TRAF6 functions in multiple pathways, including, at least, activated TLR4 signaling (e.g., MyD88-independent TLR3/TLR4 cascade, TLR2, TLR3, TLR4, TLR 7/8, TLR 9, and TLR10 cascade, MAP kinase activation in TLR cascade, JNK (c-Jun kinases) phosphorylation and activation mediated by activated human TAKl, etc.), Toll comparative pathway (e.g., TLR-TRIF pathway, IL-1 pathway, and iNOS signaling), RANK signaling in osteoclasts (e.g., APRIL pathway, BAFF in B-cell signaling, etc.), and p75 NTR receptor-mediated signaling (e.g., cell death signaling via NRAGE,
NRIF and NADE, NRIF signals cell death from the nucleus, NF-κΒ activation, etc.).
TRAF6 is suggested to be related to multiple diseases and disorders including, at least, ectodermal dysplasia 10a, hypohidrotic/hair/nail type, autosomal dominant, incontinentia pigmenti (e.g., bloch-sulzberger syndrome, bloch-siemens syndrome, etc.),
immunodeficiency with hyper-igm, type 3 (e.g., CD40 deficiency, hyper igm syndrome 3, etc.), toxoplasmosis, ectodermal dysplasia 10b, hypohidrotic/hair/tooth type, autosomal recessive (e.g., x-linked hypohidrotic ectodermal dysplasia), etc.
The nucleic acid and amino acid sequences of a representative human TRAF6 is available to the public at the GenBank database (Gene ID 7189) and is shown in Table 1 (e.g., NM_145803.2 and NP_665802.1, representing the longest transcript variant 1 and the encoded protein, and NM_004620.3 and NP_004611.1, representing the shorter transcript variant 2 (lacking a segment in the 5' UTR, compared to variant 1) and the encoded same protein). The domain structure of TRAF6 polypeptide is well known and accessible in UniProtKB database under the accession number Q9Y4K3, including, in the order from the 5' terminus to the 3' terminus, a RING-type zinc finger domain comprising, e.g., amino acid positions 70-109 of NP 665802.1, two TRAF-type zinc finger domains comprising, e.g., amino acid positions 150-202 and 203-259 of NP_665802.1, a coiled coil region comprising, e.g., amino acid positions 288-348 of NP 665802.1, and a meprin and TRAF-C homology (MATH) domain comprising, e.g., amino acid positions 350-499 of
NP 665802.1. The N-terminal fragment of TRAF6 (comprising, e.g., amino acid positions 1-354 of NP 665802.1) is capable of interacting with TAX1BP1 and the C-terminal fragment (comprising, e.g., amino acid positions 355-522 of NP_665802.1) is capable of interacting with TANK.
Nucleic acid and polypeptide sequences of TRAF6 orthologs in organisms other than humans are well-known and include, for example, chimpanzee (Pan troglodytes) TRAF6 (XM_001154136.5 and XP_001154136.1, and XM_016920687.1 and
XP_016776176.1 ), Rhesus monkey TRAF6 (NM_001135796.1 and NP_001129268.1 ), dog TRAF6 (XM_003432322.3 and XP_003432370.1), mouse TRAF6 (NM_009424.3 and NP 033450.2, representing the longer transcript variant 1 and the encoded protein, and NM_001303273.1 and NP_001290202.1, representing the shorter transcript variant 2 (lacking an exon in the 5' UTR, compared to variant 1) and the encoded same protein), cattle TRAF6 (NM_001034661.2 and NP_001029833.1), Norway rat (Rattus norvegicus) TRAF6 (NM_001107754.2 and NP_001101224.1), chicken TRAF6 (XM_004941548.2 and
XP_004941605.1, XM_004941547.2 and XP 004941604.1, XM_004941546.2 and
XP_004941603.1, XM_004941545.2 and XP_004941602.1, and XM_015287208.1 and XP_015142694.1), tropical clawed frog (Xenopus tropicalis) TRAF6 (NM_001008161.2 and P_001008162.2), fruit fly TRAF6 ( M_078525.4 and P_511080.2), and zebrafish (Danio rerio) TRAF6 ( M_001044752.1 and P_001038217.1).
The term "TRAF6 activity" includes the ability of a TRAF6 polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein) to bind its substrate and/or biological activity. TRAF6 activity may also include one or more of functions, such as E3 ubiquitin-protein ligase activity, and/or others disclosed herein in the F-κΒ pathway and other related pathways. For example, TRAF6 may interact with various proteins disclosed herein for its functions in signaling. TRAF6 may also be proteolyticly modified, such as being cleaved, ubiquitinated, deubiquitinated, acetylated, phosphorylated, or otherwise disclosed herein, for its functions.
The term "TRAF6 substrate(s)" refers to binding partners of a TRAF6 polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein), e.g., the binding partners described herein of TRAF6 for multiple signal transduction pathways.
Furthermore, TRAF6 substrates may refer to downstream members in the signaling pathways where TRAF6 has a functional role.
The term "TRAF6-regulated signaling pathway(s)" includes signaling pathways in which TRAF6 (and its fragments, domains, and/or motifs thereof, discussed herein) binds to at least one of its substrate, through which at least one cellular function and/or activity and/or cellular protein profiles is changed. TRAF6-regulated signaling pathways include at least those described herein, such as activated TLR4 signaling {e.g., MyD88-independent TLR3/TLR4 cascade, TLR2, TLR3, TLR4, TLR 7/8, TLR 9, and TLR10 cascade, MAP kinase activation in TLR cascade, INK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1, etc.), Toll comparative pathway {e.g., TLR-TRIF pathway, IL-1 pathway, and iNOS signaling), RANK signaling in osteoclasts {e.g., APRIL pathway, BAFF in B-cell signaling, etc.), and p75 NTR receptor-mediated signaling {e.g., cell death signaling via NRAGE, NRIF and NADE, NRIF signals cell death from the nucleus, NF-κΒ activation, etc.).
The term "TRAF6 inhibitor(s)" includes any natural or non-natural agent prepared, synthesized, manufactured, and/or purified by human that is capable of reducing, inhibiting, blocking, preventing, and/or that inhibits the ability of a TRAF6 polypeptide (and its
fragments, domains, and/or motifs thereof, discussed herein). In one embodiment, such inhibitors may reduce or inhibit the binding/interaction between TRAF6 and its substrates or other binding partners. In still another embodiment, such inhibitors may increase or promote the turnover rate, reduce or inhibit the expression and/or the stability (e.g., the half-life), and/or change the cellular localization of TRAF6, resulting in at least a decrease in TRAF6 levels and/or activity. Such inhibitors may be any molecule, including but not limited to small molecule compounds, antibodies or intrabodies, RNA interfering (RNAi) agents (including at least siRNAs, shRNAs, microRNAs (miRNAs), piwi, and other well- known agents). Such inhibitors may be specific to TRAF6 or also inhibit at least one of other TRAF family members and TNF receptor (T FR) superfamily members or related ubiquitin ligases. RNA interference for TRAF6 polypeptides are well known and commercially available (e.g., human, mouse, or rat shRNA (Cat. # TG515356, TF300871, and TF706303) and siRNA (Cat. # SR416822, SR510754, and SR322090) products and human or mouse gene knockout kit via CRISPR (Cat. # KN206042 and KN318129) from Origene (Rockville, MD), siRNA/shRNA products (Cat. # sc-36717, sc-44329, sc-36718, etc.) and CRISPR products (Cat. # sc-423497) from Santa Cruz Biotechnology (Dallas, Texas), Ready-to-package AAV shRNA clones from Vigene Biosciences (Rockville, MD, Cat. # SH874771). Methods for detection, purification, and/or inhibition of TRAF6 (e.g., by anti-TRAF6 antibodies) are also well known and commercially available (e.g., multiple anti-TRAF6 antibodies from Origene (Cat. # TA321662, TA352399, AM26628AF-N, etc.), Cell Signaling Technology (Danvers, MA, Cat. # 8028), abeam (Cambridge, MA, Cat. # ab33915, ab94720, etc.), and Santa Cruz Biotechnology (Cat. # sc-33897, sc-8409, sc- 33895, etc.)). Human TRAF6 knockout cell lines are also well known and available from Horizon Discovery (Cambridge, UK, Cat. # HZGHC003466c008).
The term "TAB2," also known as TGF-Beta Activated Kinase 1/MAP3K7 Binding
Protein 2, Mitogen-Activated Protein Kinase Kinase Kinase 7-Interacting Protein 2, CHTD2, and MAP3K7IP2, refers to a member of a family of activators of MAP3K7/TAK1, which is required for the IL-1 induced activation of NF-κΒ and MAPK8/JNK. TAB2 forms a kinase complex with TRAF6, MAP3K7 and TAB l, thus serving as an adaptor that links MAP3K7 and TRAF6. TAB2, along with TAB l and MAP3K7, also participates in the signal transduction induced by TNFSF l 1/RANKL through the activation of the receptor activator of NF-κΒ (TNFRSF l 1 A/RANK), which may regulate the development and function of osteoclasts. Studies of the related mouse protein indicate that TAB2 functions
to protect against liver damage caused by chemical stressors. Mutations in Tab2 cause congenital heart defects, multiple types, 2 (CHTD2) (Thienpont et al. (2010) Am J Hum Genet. 86:839-849). TAB2 binds to Lys-63-linked polyubiquitin chains and promotes autophosphorylation of MAP3K7 at Thr-187. TAB 2 also interacts with NCOR1 and HDAC3 to form a ternary complex and interacts (via C-terminal) with NUMBL (via PTB domain) and with WDR34 (via WD domains). TAB2 has been shown to interact with RBCK1, TRAF6, TRFM5, HDAC3, MAP3K7IP1, MAP3K7IP3, MAP3K7, FKB1, NUMBL, Nuclear receptor co-repressor 1, and TRAF2 (Baek et al. (2002) Cell 110:55-67; Li et al. (2009) Mol. Cell 33 :30-42). TAB2 functions in multiple pathways, including, at least, activated TLR4 signaling (e.g., MyD88-independent TLR3/TLR4 cascade, TLR2, TLR3, TLR4, TLR 7/8, TLR 9, and TLR 10 cascade, MAP kinase activation in TLR cascade, JNK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1, etc.), Toll-like receptor signaling pathway (e.g., NOD-like receptor signaling pathways, IL-1 family signaling pathways, Mucin expression in CF via TLRs, EGFR signaling pathways, etc.), TRAF pathway, bacterial infections in CF airways (e.g., IL-1 beta-dependent CFTR expression, immune response TLR signaling pathways, etc.), NF-KB signaling, etc. TAB2 is related to multiple diseases and disorders including, at least, congenital heart defects, nonsyndromic, 2, left ventricular outflow tract obstruction (e.g., aortic valve disease 2, coarctation of the aorta, hypoplastic left heart syndrome, etc.), pulmonary valve disease, ectodermal dysplasia 10b, hypohidrotic/hair/tooth type, autosomal recessive (e.g., xhed, est syndrome, etc.), etc.
The nucleic acid and amino acid sequences of a representative human TAB2 is available to the public at the GenBank database (Gene ID 23118) and is shown in Table 1 (e.g., NM_015093.5 and NP_055908.1, representing the longest transcript variant 1 and the encoded longer isoform a, NM_001292034.2 and NP_001278963.1, representing the transcript variant 3 (differing in the 5' UTR compared to variant 1) and the encoded same isoform a, and NM_001292035.2 and NP_001278964.1, representing the transcript variant 4 (containing an alternate 5' exon structure, and thus differing in the 5' UTR and initiating translation at an alternate start codon, compared to variant 1) and the encoded shorter isoform b (having a distinct N-terminus)). The domain structure of TAB2 polypeptide is well known and accessible in UniProtKB database under the accession number Q9NYJ8, including, in the order from the 5' terminus to the 3' terminus, a CUE domain capable of binding ubiquitin comprising, e.g., amino acid positions 8-51 of NP 055908.1, a coiled coil
region comprising, e.g., amino acid positions 532-619 of P 055908.1, and a RanBP2-type zinc finger domain capable of binding to two consecutive 'Lys-63 '-linked ubiquitins comprising, e.g., amino acid positions 663-693 of P 055908.1.
Nucleic acid and polypeptide sequences of TAB2 orthologs in organisms other than humans are well-known and include, for example, chimpanzee (Pan troglodytes) TAB2 (XM_016956449.1 and XP 016811938.1, XM_009452188.2 and XP_009450463.2, XM_016956450.1 and XP 016811939.1, and XM_016956448.1 and XP 016811937.1), Rhesus monkey TAB2 (NM_001257790.2 and NP_001244719.1), dog TAB2
(XM_005615502.2 and XP_005615559.1, XM_014112730.1 and XP_013968205.1, XM_541145.5 and XP_541145.2, and XM_005615503.2 and XP_005615560.1), mouse TAB2 (NM_138667.3 and NP_619608.1), cattle TAB2 (NM_001192372.1 and
NP_001179301.1), Norway rat (Rattus norvegicus) TAB2 (NM_001012062.1 and
NP_001012062.1), chicken TAB2 (XM_015284276.1 and XP_015139762.1,
XM_004935601.2 and XP_004935658.1, XM_419660.3 and XP_419660.1,
XM_015284275.1 and XP_015139761.1 ), and tropical clawed frog (Xenopus tropicalis) TAB2 (NM_001097294.1 and NP_001090763.1).
The term "TAB2 activity" includes the ability of a TAB2 polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein) to bind its substrate and/or biological activity. TAB2 activity may also include one or more of functions, such as activating kinases and promoting autophosphorylation, and/or others disclosed herein in the NF-KB pathway and other related pathways. For example, TAB2 may interact with various proteins disclosed herein for its functions in signaling. TAB2 may also be proteolyticly modified, such as being cleaved, ubiquitinated, deubiquitinated, acetylated, phosphorylated, or otherwise disclosed herein, for its functions.
The term "TAB2 substrate(s)" refers to binding partners of a TAB2 polypeptide
(and its fragments, domains, and/or motifs thereof, discussed herein), e.g., the binding partners described herein of TAB2 for multiple signal transduction pathways. Furthermore, TAB2 substrates may refer to downstream members in the signaling pathways where TAB2 has a functional role.
The term "TAB2-regulated signaling pathway(s)" includes signaling pathways in which TAB2 (and its fragments, domains, and/or motifs thereof, discussed herein) binds to at least one of its substrate, through which at least one cellular function and/or activity and/or cellular protein profiles is changed. TAB2-regulated signaling pathways include at
least those described herein, such as activated TLR4 signaling (e.g., MyD88-independent TLR3/TLR4 cascade, TLR2, TLR3, TLR4, TLR 7/8, TLR 9, and TLR10 cascade, MAP kinase activation in TLR cascade, INK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1, etc.), Toll-like receptor signaling pathway (e.g., NOD-like receptor signaling pathways, IL-1 family signaling pathways, Mucin expression in CF via TLRs, EGFR signaling pathways, etc.), TRAF pathway, bacterial infections in CF airways (e.g., IL-1 beta-dependent CFTR expression, immune response TLR signaling pathways, etc.), F-κΒ Signaling, etc.
The term "TAB2 inhibitor(s)" includes any natural or non-natural agent prepared, synthesized, manufactured, and/or purified by human that is capable of reducing, inhibiting, blocking, preventing, and/or that inhibits the ability of a TAB2 polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein). In one embodiment, such inhibitors may reduce or inhibit the binding/interaction between TAB2 and its substrates or other binding partners. In still another embodiment, such inhibitors may increase or promote the turnover rate, reduce or inhibit the expression and/or the stability (e.g., the half-life), and/or change the cellular localization of TAB2, resulting in at least a decrease in TAB2 levels and/or activity. Such inhibitors may be any molecule, including but not limited to small molecule compounds, antibodies or intrabodies, RNA interfering (RNAi) agents (including at least siRNAs, shRNAs, microRNAs (miRNAs), piwi, and other well- known agents). Such inhibitors may be specific to TAB2 or also inhibit at least one of other related proteins. RNA interference for TAB2 polypeptides are well known and commercially available (e.g., human, mouse, or rat shRNA (Cat. # TL316993, TF504187, and TF701571) and siRNA (Cat. # SR308018, SR419201, and SR509887) products and human or mouse gene knockout kit via CRISPR (Cat. # KN207721 and KN3171 18) from Origene (Rockville, MD), siRNA/shRNA products (Cat. # sc-41049, sc-41050, etc.) and CRISPR products (Cat. # sc-401596) from Santa Cruz Biotechnology (Dallas, Texas), Ready-to-package AAV shRNA clones from Vigene Biosciences (Rockville, MD, Cat. # SH888308). Methods for detection, purification, and/or inhibition of TAB2 (e.g., by anti- TAB2 antibodies) are also well known and commercially available (e.g., multiple anti- TAB2 antibodies from Origene (Cat. # AM06537SU-N, TA330285, TA319843, etc.), Cell Signaling Technology (Danvers, MA, Cat. # 3745 and 3744), abeam (Cambridge, MA, Cat. # ab l72412, ab 140201, etc.), and Santa Cruz Biotechnology (Cat. # sc-20756, sc-1 1851, sc-
398188, etc.)). Human TAB2 knockout cell lines are also well known and available from Horizon Discovery (Cambridge, UK, Cat. # HZGHC002592c005).
The term "TNIPl," also known as TNFAIP3 -interacting protein 1, NAF1, Nip40-1, and A20-Binding Inhibitor of NF-κΒ Activation 1, refers to a member of a family of A20- binding proteins which plays a role in autoimmunity and tissue homeostasis through the regulation of NF-κΒ activation. TNIPl inhibits NF-κΒ activation and TNF-induced NF- κΒ-dependent gene expression by regulating A20/TNFAIP3 -mediated deubiquitination of IKBKG, thus linking A20/TNFAIP3 to ubiquitinated IKBKG. TNIPl also regulates EGF- induced ERK1/ERK2 signaling pathway and blocks MAPK3/MAPK1 nuclear translocation and MAPKl -dependent transcription. TNIPl increases cell surface CD4(T4) antigen expression. TNIPl is involved in the anti-inflammatory response of macrophages and positively regulates TLR-induced activation of CEBPB. TNIPl is also involved in the prevention of autoimmunity and leukocyte integrin activation during inflammation
(mediated by association with SELPLG and dependent on phosphorylation by SRC-family kinases). TNIPl interacts with HIV-1 matrix protein and is packaged into virions, while its overexpression inhibits viral replication. TNIPl may regulate matrix nuclear localization, both nuclear import of PIC (Preintegration complex) and export of GAG polyprotein and viral genomic RNA during virion production. In case of infection, TNIPl promotes association of IKBKG with Shigella flexneri E3 ubiquitin-protein ligase ipah9.8 p, which in turn promotes polyubiquitination and proteasome degradation of IKBKG and perturbs NF- KB activation during bacterial infection. TNIPl interacts with TNFAIP3 (Heyninck et al. (1999) J. Cell Biol. 145: 1471-1482) and MAPKl (Zhang et al. (2002) Biochem. Biophys. Res. Commun. 297: 17-23). TNIPl also interacts with polyubiquitinated IKBKG and facilitates TNFAIP3 -mediated de-ubiquitination of NEMO/IKBKG. TNIPl further interacts with SELPLG, PIK3CD, IRAKI (polyubiquitinated), MYD88 (indicative for participation in an activated TLR-signaling complex). TNIPl functions in multiple pathways, including, at least, NF-κΒ signaling, TRAF pathway {e.g., 14-3-3 induced apoptosis), deubiquitination and protein metabolism, IL-23 signaling pathway {e.g., angiopoietin-TIE2 signaling), etc. TNIPl is related to multiple diseases and disorders including, at least, psoriatic arthritis, chronic intestinal vascular insufficiency, HIV-1 infection/ AIDS, rheumatoid arthritis, and systemic lupus erythematosus.
The nucleic acid and amino acid sequences of a representative human TNIPl is available to the public at the GenBank database (Gene ID 10318) and is shown in Table 1.
Multiple transcript variants and resulting proteins of TNIPl include, e.g., NM_001252385.1 and NP 001239314.1, representing the longest transcript variant 1 and the encoded isoform 1, NM_001252386.1 and NP_001239315.1, representing the transcript variant 2 and the encoded isoform 2 (with a shorter N-terminus and a distinct C-terminus compared to isoform 1), NM_001252390.1 and NP_001239319.1, representing the transcript variant 3 (differing in the 5' UTR and using an alternate splice site in the 3' coding region, compared to variant 1) and the encoded longest isoform 3, NM_001252391.1 and NP_001239320.1, representing the transcript variant 4 (differing in the 5' UTR and using an alternate splice site in the 3' coding region compared to variant 1) and the encoded same isoform 3, NM_006058.4 and NP_006049.3, representing the transcript variant 5 (using an alternate splice site in the 3' coding region compared to variant 1) and the encoded same isoform 3, NM_001252392.1 and NP_001239321.1, representing the transcript variant 6 (using an alternate splice site in the 3' coding region compared to variant 1) and the encoded isoform 4 (longer and having a distinct C-terminus, compared to isoform 1), NM_001252393.1 and NP_001239322.1, representing the transcript variant 7 (using two alternate splice sites in the 3' coding region, compared to variant 1) and the encoded same isoform 4,
NM_001258454.1 and NP_001245383.1, representing the transcript variant 8 (differing in the 5' UTR compared to variant 1) and the encoded same isoform 3, NM 001258455.1 and NP_001245384.1, representing the transcript variant 9 (lacking an exon and using an alternate splice site in the 3' coding region which results in a frameshift compared to variant 1) and the encoded isoform 5 (shorter and having a distinct C-terminus compared to isoform 1), and NM_001258456.1 and NP_001245385.1, representing the transcript variant 10 (lacking two exons in the 3' coding region which results in a frameshift compared to variant 1) and the encoded isoform 6 (having a distinct C-terminus). The domain structure of TNIPl polypeptide is well known and accessible in UniProtKB database under the accession number Q 15025, including, in the order from the 5' terminus to the 3' terminus, a domain capable of binding NEF comprising, e.g., amino acid positions 94-412 of
NP 006049.3, a domain capable of binding Shigella flexneri ipah9.8 comprising, e.g., amino acid positions 351-367 of NP 006049.3, a domain for inhibitory activity of TNF- induced NF-κΒ activation comprising, e.g., amino acid positions 431-588 of NP 006049.3, a ubiquitin-binding domain (UBD) comprising, e.g., amino acid positions 452-510 of NP 006049.3, and a nuclear localization signal comprising, e.g., amino acid positions 524-
530 of NP 006049.3. TNIPl contains three coiled coil regions comprising, e.g., amino acid positions 20-73, 196-258, and 294-535 of NP_006049.3.
Nucleic acid and polypeptide sequences of TNIPl orthologs in organisms other than humans are well-known and include, for example, chimpanzee (Pan troglodytes) TNIPl (XM_003310917.4 and XP_003310965.1, XM_016954075.1 and XP_016809564.1, XM_016954073.1 and XP_016809562.1, XM_016954074.1 and XP_016809563.1, XM_003310918.4 and XP_003310966.1, XM_001167619.5 and XP_001167619.1, XM_518040.6 and XP_518040.3, XM_016954076.1 and XP_016809565.1, and
XM_016954077.1 and XP_016809566.1), Rhesus monkey TNIPl (XM_002804583.2 and XP_002804629.1, XM_015141244.1 and XP_014996730.1, XM_015141246.1 and XP_014996732.1, XM_001109469.3 and XP_001109469.2, XM_001109428.3 and XP_001109428.1, XM_015141243.1 and XP_014996729.1, and XM_015141245.1 and XP_014996731.1), dog TNIPl (XM_546296.5 and XP_546296.3, and XM_014113057.1 and XP_013968532.1), mouse TNIPl (NM_021327.4 and NP_067302.2, representing the transcript variant 1 and the encoded longest isoform 1, NM_001199275.2 and
NP OOl 186204.1, representing the transcript variant 2 (containing an alternate exon in the 5' UTR, compared to variant 1) and the encoded same isoform 1, NM OOl 199276.2 and NP_001186205.1, representing the transcript variant 3 (differing in the 5' UTR, lacking a portion of the 5' coding region, and initiating translation at a downstream in-frame start codon, compared to variant 1) and the encoded isoform 2 (having a shorter N-terminus, compared to isoform 1), NM_001271455.1 and NP_001258384.1, representing the transcript variant 4 (differing in the 5' UTR, lacking a portion of the 5' coding region, and initiating translation at a downstream in-frame start codon, compared to variant 1) and the encoded same isoform 2, and NM_001271456.1 and NP_001258385.1, representing the transcript variant 5 (differing in the 5' UTR and using an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1) and the encoded isoform 3 (having a distinct C-terminus, compared to isoform 1)), cattle TNIPl
(NM_001024554.3 and NP_001019725.2), Norway rat (Rattus norvegicus) TNIPl (NM_001108826.1 and NP_001102296.1), chicken TNIPl (XM_004944944.2 and XP_004945001.1, XM_004944943.2 and XP_004945000.1, and XM_003642060.3 and XP_003642108.2), tropical clawed frog (Xenopus tropicalis) TNIPl (NM_001079235.1 and NP_001072703.1), and zebrafish TNIPl (NM_001079952.1 and NP_001073421.1).
The term "TNIPl activity" includes the ability of a TNIPl polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein) to bind its substrate and/or biological activity. TNIPl activity may also include one or more of functions, such as promoting deubiquitination, inhibiting NF-κΒ activation and gene expression, and/or others disclosed herein in the NF-κΒ pathway and other related pathways. For example, TNIPl may interact with various proteins disclosed herein for its functions in signaling. TNIPl may also be proteolyticly modified, such as being cleaved, ubiquitinated, deubiquitinated, acetylated, phosphorylated, or otherwise disclosed herein, for its functions.
The term "TNIPl substrate(s)" refers to binding partners of a TNIPl polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein), e.g., the binding partners described herein of TNIPl for multiple signal transduction pathways.
Furthermore, TNIPl substrates may refer to downstream members in the signaling pathways where TNIPl has a functional role.
The term "TNIPl -regulated signaling pathway(s)" includes signaling pathways in which TNIPl (and its fragments, domains, and/or motifs thereof, discussed herein) binds to at least one of its substrate, through which at least one cellular function and/or activity and/or cellular protein profiles is changed. TNIPl -regulated signaling pathways include at least those described herein, such as NF-κΒ signaling, TRAF pathway (e.g., 14-3-3 induced apoptosis), deubiquitination and protein metabolism, IL-23 signaling pathway (e.g., angiopoietin-TIE2 signaling), etc.
The term "TNIPl inhibitor(s)" includes any natural or non-natural agent prepared, synthesized, manufactured, and/or purified by human that is capable of reducing, inhibiting, blocking, preventing, and/or that inhibits the ability of a TNIPl polypeptide (and its fragments, domains, and/or motifs thereof, discussed herein). In one embodiment, such inhibitors may reduce or inhibit the binding/interaction between TNIPl and its substrates or other binding partners. In still another embodiment, such inhibitors may increase or promote the turnover rate, reduce or inhibit the expression and/or the stability (e.g., the half-life), and/or change the cellular localization of TNIPl, resulting in at least a decrease in TNIPl levels and/or activity. Such inhibitors may be any molecule, including but not limited to small molecule compounds, antibodies or intrabodies, RNA interfering (RNAi) agents (including at least siRNAs, shRNAs, microRNAs (miRNAs), piwi, and other well- known agents). Such inhibitors may be specific to TNIPl or also inhibit at least one of other related proteins. RNA interference for TNIPl polypeptides are well known and
commercially available (e.g., human, mouse, or rat shRNA (Cat. # TF308719, TF512490, and TF707355) and siRNA (Cat. # SR306991 and SR418640) products and human or mouse gene knockout kit via CRISPR (Cat. # KN204210 and KN318006) from Origene (Rockville, MD), siRNA/shRNA products (Cat. # sc-92019 and sc- 140779) and CRISPR products (Cat. # sc-425441) from Santa Cruz Biotechnology (Dallas, Texas), Ready-to- package AAV shRNA clones from Vigene Biosciences (Rockville, MD, Cat. # SH886816). Methods for detection, purification, and/or inhibition of TNIP1 (e.g., by anti-TNTPl antibodies) are also well known and commercially available (e.g., anti-TNTPl antibodies from Origene (Cat. # AP54318PU-N and TA351831), Cell Signaling Technology (Danvers, MA, Cat. # 4664), abeam (Cambridge, MA, Cat. # ab207584, ab70152, etc.), and Santa Cruz Biotechnology (Cat. # sc- 134660)). Human ΤΝΊΡ1 knockout cell lines are also well known and available from Horizon Discovery (Cambridge, UK, Cat. # HZGHC 10318).
The term "immune response" includes T cell mediated and/or B cell mediated immune responses. Exemplary immune responses include T cell responses, e.g., cytokine production and cellular cytotoxicity. In addition, the term immune response includes immune responses that are indirectly effected by T cell activation, e.g., antibody production (humoral responses) and activation of cytokine responsive cells, e.g., macrophages.
The term "immunotherapeutic agent" can include any molecule, peptide, antibody or other agent which can stimulate a host immune system to generate an immune response to a tumor or cancer in the subj ect. Various immunotherapeutic agents are useful in the compositions and methods described herein.
The term "inhibit" includes the decrease, limitation, or blockage, of, for example a particular action, function, or interaction. In some embodiments, cancer is "inhibited" if at least one symptom of the cancer is alleviated, terminated, slowed, or prevented. As used herein, cancer is also "inhibited" if recurrence or metastasis of the cancer is reduced, slowed, delayed, or prevented.
The term "interaction", when referring to an interaction between two molecules, refers to the physical contact (e.g., binding) of the molecules with one another. Generally, such an interaction results in an activity (which produces a biological effect) of one or both of said molecules.
An "isolated protein" refers to a protein that is substantially free of other proteins, cellular material, separation medium, and culture medium when isolated from cells or
produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized. An "isolated" or "purified" protein or biologically active portion thereof is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the antibody, polypeptide, peptide or fusion protein is derived, or substantially free from chemical precursors or other chemicals when chemically synthesized. The language "substantially free of cellular material" includes preparations of a biomarker polypeptide or fragment thereof, in which the protein is separated from cellular components of the cells from which it is isolated or recombinantly produced. In one embodiment, the language "substantially free of cellular material" includes preparations of a biomarker protein or fragment thereof, having less than about 30% (by dry weight) of non-biomarker protein (also referred to herein as a "contaminating protein"), more preferably less than about 20% of non-biomarker protein, still more preferably less than about 10%) of non-biomarker protein, and most preferably less than about 5% non- biomarker protein. When antibody, polypeptide, peptide or fusion protein or fragment thereof, e.g., a biologically active fragment thereof, is recombinantly produced, it is also preferably substantially free of culture medium, i.e., culture medium represents less than about 20%, more preferably less than about 10%>, and most preferably less than about 5% of the volume of the protein preparation.
As used herein, the term "isotype" refers to the antibody class (e.g., IgM, IgGl, IgG2C, and the like) that is encoded by heavy chain constant region genes.
As used herein, the term "KD" is intended to refer to the dissociation equilibrium constant of a particular antibody-antigen interaction. The binding affinity of antibodies of the disclosed invention may be measured or determined by standard antibody-antigen assays, for example, competitive assays, saturation assays, or standard immunoassays such as ELISA or RIA.
A "kit" is any manufacture (e.g. a package or container) comprising at least one reagent, e.g. a probe or small molecule, for specifically detecting and/or affecting the expression of a marker of the present invention. The kit may be promoted, distributed, or sold as a unit for performing the methods of the present invention. The kit may comprise one or more reagents necessary to express a composition useful in the methods of the present invention. In certain embodiments, the kit may further comprise a reference standard, e.g., a nucleic acid encoding a protein that does not affect or regulate signaling pathways controlling cell growth, division, migration, survival or apoptosis. One skilled in
the art can envision many such control proteins, including, but not limited to, common molecular tags (e.g., green fluorescent protein and beta-galactosidase), proteins not classified in any of pathway encompassing cell growth, division, migration, survival or apoptosis by GeneOntology reference, or ubiquitous housekeeping proteins. Reagents in the kit may be provided in individual containers or as mixtures of two or more reagents in a single container. In addition, instructional materials which describe the use of the compositions within the kit can be included.
The term "neoadjuvant therapy" refers to a treatment given before the primary treatment. Examples of neoadjuvant therapy can include chemotherapy, radiation therapy, and hormone therapy. For example, in treating breast cancer, neoadjuvant therapy can allows patients with large breast cancer to undergo breast-conserving surgery.
The "normal" level of expression of a biomarker is the level of expression of the biomarker in cells of a subject, e.g., a human patient, not afflicted with a cancer. An "over- expression" or "significantly higher level of expression" of a biomarker refers to an expression level in a test sample that is greater than the standard error of the assay employed to assess expression, and is preferably at least 10%, and more preferably 1.2, 1.3,
1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.5, 4, 4.5, 5,
5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20 times or more higher than the expression activity or level of the biomarker in a control sample (e.g., sample from a healthy subject not having the biomarker associated disease) and preferably, the average expression level of the biomarker in several control samples. A "significantly lower level of expression" of a biomarker refers to an expression level in a test sample that is at least 10%, and more preferably 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20 times or more lower than the expression level of the biomarker in a control sample (e.g., sample from a healthy subject not having the biomarker associated disease) and preferably, the average expression level of the biomarker in several control samples.
An "over-expression" or "significantly higher level of expression" of a biomarker refers to an expression level in a test sample that is greater than the standard error of the assay employed to assess expression, and is preferably at least 10%, and more preferably 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20 times
or more higher than the expression activity or level of the biomarker in a control sample (e.g., sample from a healthy subject not having the biomarker associated disease) and preferably, the average expression level of the biomarker in several control samples. A "significantly lower level of expression" of a biomarker refers to an expression level in a test sample that is at least 10%, and more preferably 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20 times or more lower than the expression level of the biomarker in a control sample (e.g., sample from a healthy subject not having the biomarker associated disease) and preferably, the average expression level of the biomarker in several control samples.
The term "pre-determined" biomarker amount and/or activity measurement(s) may be a biomarker amount and/or activity measurement(s) used to, by way of example only, evaluate a subject that may be selected for a particular treatment, evaluate a response to a treatment such as inhibitors of one or more biomarkers listed in Table 1, in combination with an immunotherapy, and/or evaluate the disease state. A pre-determined biomarker amount and/or activity measurement(s) may be determined in populations of patients with or without cancer. The pre-determined biomarker amount and/or activity measurement s) can be a single number, equally applicable to every patient, or the pre-determined biomarker amount and/or activity measurement(s) can vary according to specific subpopulations of patients. Age, weight, height, and other factors of a subject may affect the pre-determined biomarker amount and/or activity measurement(s) of the individual. Furthermore, the pre-determined biomarker amount and/or activity can be determined for each subject individually. In one embodiment, the amounts determined and/or compared in a method described herein are based on absolute measurements. In another embodiment, the amounts determined and/or compared in a method described herein are based on relative measurements, such as ratios (e.g., serum biomarker normalized to the expression of housekeeping or otherwise generally constant biomarker). The pre-determined biomarker amount and/or activity measurement(s) can be any suitable standard. For example, the pre-determined biomarker amount and/or activity measurement(s) can be obtained from the same or a different human for whom a patient selection is being assessed. In one embodiment, the pre-determined biomarker amount and/or activity measurement s) can be obtained from a previous assessment of the same patient. In such a manner, the progress of the selection of the patient can be monitored over time. In addition, the control
can be obtained from an assessment of another human or multiple humans, e.g., selected groups of humans, if the subject is a human. In such a manner, the extent of the selection of the human for whom selection is being assessed can be compared to suitable other humans, e.g., other humans who are in a similar situation to the human of interest, such as those suffering from similar or the same condition(s) and/or of the same ethnic group.
The term "predictive" includes the use of a biomarker nucleic acid and/or protein status, e.g., over- or under- activity, emergence, expression, growth, remission, recurrence or resistance of tumors before, during or after therapy, for determining the likelihood of response of a cancer to inhibitors of one or more biomarkers listed in Table 1, in
combination with an immunotherapy (e.g., treatment with a combination of an inhibitor of one or more biomarkers listed in Table 1 and an immunotherapy, such as an immune checkpoint inhibitor). Such predictive use of the biomarker may be confirmed by, e.g., (1) increased or decreased copy number (e.g., by FISH, FISH plus SKY, single-molecule sequencing, e.g., as described in the art at least at J. Biotechnol., 86:289-301, or qPCR), overexpression or underexpression of a biomarker nucleic acid (e.g., by ISH, Northern Blot, or qPCR), increased or decreased biomarker protein (e.g., by IHC), or increased or decreased activity, e.g., in more than about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 100%, or more of assayed human cancers types or cancer samples; (2) its absolute or relatively modulated presence or absence in a biological sample, e.g., a sample containing tissue, whole blood, serum, plasma, buccal scrape, saliva, cerebrospinal fluid, urine, stool, or bone marrow, from a subject, e.g. a human, afflicted with cancer; (3) its absolute or relatively modulated presence or absence in clinical subset of patients with cancer (e.g., those responding to a particular inhibitor of one or more biomarkers listed in Table 1, in combination with an immunotherapy or those developing resistance thereto).
The term "pre-malignant lesions" as described herein refers to a lesion that, while not cancerous, has potential for becoming cancerous. It also includes the term "pre- malignant disorders" or "potentially malignant disorders." In particular this refers to a benign, morphologically and/or histologically altered tissue that has a greater than normal risk of malignant transformation, and a disease or a patient's habit that does not necessarily alter the clinical appearance of local tissue but is associated with a greater than normal risk of precancerous lesion or cancer development in that tissue (leukoplakia, erythroplakia, erytroleukoplakia lichen planus (lichenoid reaction) and any lesion or an area which
histological examination showed atypia of cells or dysplasia. In one embodiment, a metaplasia is a pre-malignant lesion.
The terms "prevent," "preventing," "prevention," "prophylactic treatment," and the like refer to reducing the probability of developing a disease, disorder, or condition in a subject, who does not have, but is at risk of or susceptible to developing a disease, disorder, or condition.
The term "probe" refers to any molecule which is capable of selectively binding to a specifically intended target molecule, for example, a nucleotide transcript or protein encoded by or corresponding to a biomarker nucleic acid. Probes can be either synthesized by one skilled in the art, or derived from appropriate biological preparations. For purposes of detection of the target molecule, probes may be specifically designed to be labeled, as described herein. Examples of molecules that can be utilized as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules.
The term "prognosis" includes a prediction of the probable course and outcome of cancer or the likelihood of recovery from the disease. In some embodiments, the use of statistical algorithms provides a prognosis of cancer in an individual. For example, the prognosis can be surgery, development of a clinical subtype of cancer (e.g., solid tumors, such as esophageal cancer and gastric cancer), development of one or more clinical factors, or recovery from the disease.
The term "response to immunotherapy" or "response to inhibitors of one or more biomarkers/immunotherapy combination therapy" relates to any response of the
hyperproliferative disorder (e.g., cancer) to an anti-cancer agent, such as an an inhibitor of one or more biomarkers listed in Table 1, and an immunotherapy, preferably to a change in tumor mass and/or volume after initiation of neoadjuvant or adjuvant therapy.
Hyperproliferative disorder response may be assessed, for example for efficacy or in a neoadjuvant or adjuvant situation, where the size of a tumor after systemic intervention can be compared to the initial size and dimensions as measured by CT, PET, mammogram, ultrasound or palpation. Responses may also be assessed by caliper measurement or pathological examination of the tumor after biopsy or surgical resection. Response may be recorded in a quantitative fashion like percentage change in tumor volume or in a qualitative fashion like "pathological complete response" (pCR), "clinical complete remission" (cCR), "clinical partial remission" (cPR), "clinical stable disease" (cSD), "clinical progressive disease" (cPD) or other qualitative criteria. Assessment of
hyperproliferative disorder response may be done early after the onset of neoadjuvant or adjuvant therapy, e.g., after a few hours, days, weeks or preferably after a few months. A typical endpoint for response assessment is upon termination of neoadjuvant chemotherapy or upon surgical removal of residual tumor cells and/or the tumor bed. This is typically three months after initiation of neoadjuvant therapy. In some embodiments, clinical efficacy of the therapeutic treatments described herein may be determined by measuring the clinical benefit rate (CBR). The clinical benefit rate is measured by determining the sum of the percentage of patients who are in complete remission (CR), the number of patients who are in partial remission (PR) and the number of patients having stable disease (SD) at a time point at least 6 months out from the end of therapy. The shorthand for this formula is
CBR=CR+PR+SD over 6 months. In some embodiments, the CBR for a particular cancer therapeutic regimen is at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%), 80%), 85%), or more. Additional criteria for evaluating the response to cancer therapies are related to "survival," which includes all of the following: survival until mortality, also known as overall survival (wherein said mortality may be either irrespective of cause or tumor related); "recurrence-free survival" (wherein the term recurrence shall include both localized and distant recurrence); metastasis free survival; disease free survival (wherein the term disease shall include cancer and diseases associated therewith). The length of said survival may be calculated by reference to a defined start point (e.g., time of diagnosis or start of treatment) and end point (e.g., death, recurrence or metastasis). In addition, criteria for efficacy of treatment can be expanded to include response to chemotherapy, probability of survival, probability of metastasis within a given time period, and probability of tumor recurrence. For example, in order to determine appropriate threshold values, a particular cancer therapeutic regimen can be administered to a population of subjects and the outcome can be correlated to biomarker measurements that were determined prior to administration of any cancer therapy. The outcome measurement may be pathologic response to therapy given in the neoadjuvant setting. Alternatively, outcome measures, such as overall survival and disease-free survival can be monitored over a period of time for subjects following cancer therapy for which biomarker measurement values are known. In certain embodiments, the doses administered are standard doses known in the art for cancer therapeutic agents. The period of time for which subjects are monitored can vary. For example, subjects may be monitored for at least 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 25, 30, 35, 40, 45, 50, 55, or 60 months. Biomarker measurement threshold
values that correlate to outcome of a cancer therapy can be determined using well-known methods in the art, such as those described in the Examples section.
The term "resistance" refers to an acquired or natural resistance of a cancer sample or a mammal to a cancer therapy ( i.e., being nonresponsive to or having reduced or limited response to the therapeutic treatment), such as having a reduced response to a therapeutic treatment by 25% or more, for example, 30%, 40%, 50%, 60%, 70%, 80%, or more, to 2- fold, 3-fold, 4-fold, 5-fold, 10-fold, 15-fold, 20-fold or more. The reduction in response can be measured by comparing with the same cancer sample or mammal before the resistance is acquired, or by comparing with a different cancer sample or a mammal that is known to have no resistance to the therapeutic treatment. A typical acquired resistance to chemotherapy is called "multidrug resistance." The multidrug resistance can be mediated by P-glycoprotein or can be mediated by other mechanisms, or it can occur when a mammal is infected with a multi-drug-resistant microorganism or a combination of microorganisms. The determination of resistance to a therapeutic treatment is routine in the art and within the skill of an ordinarily skilled clinician, for example, can be measured by cell proliferative assays and cell death assays as described herein as "sensitizing." In some embodiments, the term "reverses resistance" means that the use of a second agent in combination with a primary cancer therapy {e.g., chemotherapeutic or radiation therapy) is able to produce a significant decrease in tumor volume at a level of statistical significance {e.g., p<0.05) when compared to tumor volume of untreated tumor in the circumstance where the primary cancer therapy {e.g., chemotherapeutic or radiation therapy) alone is unable to produce a statistically significant decrease in tumor volume compared to tumor volume of untreated tumor. This generally applies to tumor volume measurements made at a time when the untreated tumor is growing log rhythmically.
The terms "response" or "responsiveness" refers to an anti-cancer response, e.g. in the sense of reduction of tumor size or inhibiting tumor growth. The terms can also refer to an improved prognosis, for example, as reflected by an increased time to recurrence, which is the period to first recurrence censoring for second primary cancer as a first event or death without evidence of recurrence, or an increased overall survival, which is the period from treatment to death from any cause. To respond or to have a response means there is a beneficial endpoint attained when exposed to a stimulus. Alternatively, a negative or detrimental symptom is minimized, mitigated or attenuated on exposure to a stimulus. It will be appreciated that evaluating the likelihood that a tumor or subject will exhibit a
favorable response is equivalent to evaluating the likelihood that the tumor or subject will not exhibit favorable response (i.e., will exhibit a lack of response or be non-responsive).
An "RNA interfering agent" as used herein, is defined as any agent which interferes with or inhibits expression of a target biomarker gene by RNA interference (RNAi). Such RNA interfering agents include, but are not limited to, nucleic acid molecules including RNA molecules which are homologous to the target biomarker gene of the present invention, or a fragment thereof, short interfering RNA (siRNA), and small molecules which interfere with or inhibit expression of a target biomarker nucleic acid by RNA interference (RNAi).
"RNA interference (RNAi)" is an evolutionally conserved process whereby the expression or introduction of RNA of a sequence that is identical or highly similar to a target biomarker nucleic acid results in the sequence specific degradation or specific post- transcriptional gene silencing (PTGS) of messenger RNA (mRNA) transcribed from that targeted gene (see Coburn and Cullen (2002) J. Virol. 76:9225), thereby inhibiting expression of the target biomarker nucleic acid. In one embodiment, the RNA is double stranded RNA (dsRNA). This process has been described in plants, invertebrates, and mammalian cells. In nature, RNAi is initiated by the dsRNA-specific endonuclease Dicer, which promotes processive cleavage of long dsRNA into double-stranded fragments termed siRNAs. siRNAs are incorporated into a protein complex that recognizes and cleaves target mRNAs. RNAi can also be initiated by introducing nucleic acid molecules, e.g., synthetic siRNAs or RNA interfering agents, to inhibit or silence the expression of target biomarker nucleic acids. As used herein, "inhibition of target biomarker nucleic acid expression" or "inhibition of marker gene expression" includes any decrease in expression or protein activity or level of the target biomarker nucleic acid or protein encoded by the target biomarker nucleic acid. The decrease may be of at least 30%, 40%, 50%, 60%, 70%, 80%, 90%), 95%) or 99%) or more as compared to the expression of a target biomarker nucleic acid or the activity or level of the protein encoded by a target biomarker nucleic acid which has not been targeted by an RNA interfering agent.
The term "sample" used for detecting or determining the presence or level of at least one biomarker is typically brain tissue, cerebrospinal fluid, whole blood, plasma, serum, saliva, urine, stool (e.g., feces), tears, and any other bodily fluid (e.g., as described above under the definition of "body fluids"), or a tissue sample (e.g., biopsy) such as a small intestine, colon sample, or surgical resection tissue. In certain instances, the method of the
present invention further comprises obtaining the sample from the individual prior to detecting or determining the presence or level of at least one marker in the sample.
The term "sensitize" means to alter cancer cells or tumor cells in a way that allows for more effective treatment of the associated cancer with a cancer therapy (e.g., anti- immune checkpoint, chemotherapeutic, and/or radiation therapy). In some embodiments, normal cells are not affected to an extent that causes the normal cells to be unduly injured by the therapies. An increased sensitivity or a reduced sensitivity to a therapeutic treatment is measured according to a known method in the art for the particular treatment and methods described herein below, including, but not limited to, cell proliferative assays (Tanigawa N, Kern D H, Kikasa Y, Morton D L, Cancer Res 1982; 42: 2159-2164), cell death assays (Weisenthal L M, Shoemaker R H, Marsden J A, Dill P L, Baker J A, Moran E M, Cancer Res 1984; 94: 161-173; Weisenthal L M, Lippman M E, Cancer Treat Rep 1985; 69: 615-632; Weisenthal L M, In: Kaspers G J L, Pieters R, Twentyman P R, Weisenthal L M, Veerman A J P, eds. Drug Resistance in Leukemia and Lymphoma. Langhorne, P A: Harwood Academic Publishers, 1993 : 415-432; Weisenthal L M, Contrib Gynecol Obstet 1994; 19: 82-90). The sensitivity or resistance may also be measured in animal by measuring the tumor size reduction over a period of time, for example, 6 month for human and 4-6 weeks for mouse. A composition or a method sensitizes response to a therapeutic treatment if the increase in treatment sensitivity or the reduction in resistance is 25% or more, for example, 30%, 40%, 50%, 60%, 70%, 80%, or more, to 2-fold, 3-fold, 4-fold, 5- fold, 10-fold, 15-fold, 20-fold or more, compared to treatment sensitivity or resistance in the absence of such composition or method. The determination of sensitivity or resistance to a therapeutic treatment is routine in the art and within the skill of an ordinarily skilled clinician. It is to be understood that any method described herein for enhancing the efficacy of a cancer therapy can be equally applied to methods for sensitizing hyperproliferative or otherwise cancerous cells (e.g., resistant cells) to the cancer therapy.
"Short interfering RNA" (siRNA), also referred to herein as "small interfering RNA" is defined as an agent which functions to inhibit expression of a target biomarker nucleic acid, e.g., by RNAi. An siRNA may be chemically synthesized, may be produced by in vitro transcription, or may be produced within a host cell. In one embodiment, siRNA is a double stranded RNA (dsRNA) molecule of about 15 to about 40 nucleotides in length, preferably about 15 to about 28 nucleotides, more preferably about 19 to about 25 nucleotides in length, and more preferably about 19, 20, 21, or 22 nucleotides in length,
and may contain a 3' and/or 5' overhang on each strand having a length of about 0, 1, 2, 3, 4, or 5 nucleotides. The length of the overhang is independent between the two strands, i.e., the length of the overhang on one strand is not dependent on the length of the overhang on the second strand. Preferably the siRNA is capable of promoting RNA interference through degradation or specific post-transcriptional gene silencing (PTGS) of the target messenger RNA (mRNA).
In another embodiment, an siRNA is a small hairpin (also called stem loop) RNA (shRNA). In one embodiment, these shRNAs are composed of a short {e.g., 19-25 nucleotide) antisense strand, followed by a 5-9 nucleotide loop, and the analogous sense strand. Alternatively, the sense strand may precede the nucleotide loop structure and the antisense strand may follow. These shRNAs may be contained in plasmids, retroviruses, and lentiviruses and expressed from, for example, the pol III U6 promoter, or another promoter {see, e.g., Stewart, et al. (2003) RNA Apr;9(4):493-501 incorporated by reference herein).
RNA interfering agents, e.g., siRNA molecules, may be administered to a patient having or at risk for having cancer, to inhibit expression of a biomarker gene which is overexpressed in cancer and thereby treat, prevent, or inhibit cancer in the subject.
The term "small molecule" is a term of the art and includes molecules that are less than about 1000 molecular weight or less than about 500 molecular weight. In one embodiment, small molecules do not exclusively comprise peptide bonds. In another embodiment, small molecules are not oligomeric. Exemplary small molecule compounds which can be screened for activity include, but are not limited to, peptides,
peptidomimetics, nucleic acids, carbohydrates, small organic molecules {e.g., polyketides) (Cane et al. (1998) Science 282:63), and natural product extract libraries. In another embodiment, the compounds are small, organic non-peptidic compounds. In a further embodiment, a small molecule is not biosynthetic.
The term "specific binding" refers to antibody binding to a predetermined antigen. Typically, the antibody binds with an affinity (KD) of approximately less than 10"7 M, such as approximately less than 10"8 M, 10"9 M or 10"10 M or even lower when determined by surface plasm on resonance (SPR) technology in a BIACORE® assay instrument using an antigen of interest as the analyte and the antibody as the ligand, and binds to the
predetermined antigen with an affinity that is at least 1.1-, 1.2-, 1.3-, 1.4-, 1.5-, 1.6-, 1.7-, 1.8-, 1.9-, 2.0-, 2.5-, 3.0-, 3.5-, 4.0-, 4.5-, 5.0-, 6.0-, 7.0-, 8.0-, 9.0-, or 10.0-fold or greater
than its affinity for binding to a non-specific antigen (e.g., BSA, casein) other than the predetermined antigen or a closely-related antigen. The phrases "an antibody recognizing an antigen" and "an antibody specific for an antigen" are used interchangeably herein with the term "an antibody which binds specifically to an antigen." Selective binding is a relative term refering to the ability of an antibody to discriminate the binding of one antigen over another.
The term "subject" refers to any healthy animal, mammal or human, or any animal, mammal or human afflicted with a cancer, e.g., brain, lung, ovarian, pancreatic, liver, breast, prostate, and/or colorectal cancers, melanoma, multiple myeloma, and the like. The term "subject" is interchangeable with "patient."
The term "survival" includes all of the following: survival until mortality, also known as overall survival (wherein said mortality may be either irrespective of cause or tumor related); "recurrence-free survival" (wherein the term recurrence shall include both localized and distant recurrence); metastasis free survival; disease free survival (wherein the term disease shall include cancer and diseases associated therewith). The length of said survival may be calculated by reference to a defined start point (e.g. time of diagnosis or start of treatment) and end point (e.g. death, recurrence or metastasis). In addition, criteria for efficacy of treatment can be expanded to include response to chemotherapy, probability of survival, probability of metastasis within a given time period, and probability of tumor recurrence.
The term "synergistic effect" refers to the combined effect of two or more anticancer agents (e.g., inhibitors of one or more biomarkers listed in Table 1, in combination with an immunotherapy) can be greater than the sum of the separate effects of the anticancer agents/therapies alone.
The term "T cell" includes CD4+ T cells and CD8+ T cells. The term T cell also includes both T helper 1 type T cells and T helper 2 type T cells. The term "antigen presenting cell" includes professional antigen presenting cells (e.g., B lymphocytes, monocytes, dendritic cells, Langerhans cells), as well as other antigen presenting cells (e.g., keratinocytes, endothelial cells, astrocytes, fibroblasts, and oligodendrocytes).
The term "therapeutic effect" refers to a local or systemic effect in animals, particularly mammals, and more particularly humans, caused by a pharmacologically active substance. The term thus means any substance intended for use in the diagnosis, cure, mitigation, treatment or prevention of disease or in the enhancement of desirable physical
or mental development and conditions in an animal or human. The phrase "therapeutically- effective amount" means that amount of such a substance that produces some desired local or systemic effect at a reasonable benefit/risk ratio applicable to any treatment. In certain embodiments, a therapeutically effective amount of a compound will depend on its therapeutic index, solubility, and the like. For example, certain compounds discovered by the methods of the present invention may be administered in a sufficient amount to produce a reasonable benefit/risk ratio applicable to such treatment.
The terms "therapeutically-effective amount" and "effective amount" as used herein means that amount of a compound, material, or composition comprising a compound of the present invention which is effective for producing some desired therapeutic effect in at least a sub-population of cells in an animal at a reasonable benefit/risk ratio applicable to any medical treatment. Toxicity and therapeutic efficacy of subject compounds may be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 and the ED50. Compositions that exhibit large therapeutic indices are preferred. In some embodiments, the LD50 (lethal dosage) can be measured and can be, for example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more reduced for the agent relative to no administration of the agent. Similarly, the ED50 (i.e., the concentration which achieves a half-maximal inhibition of symptoms) can be measured and can be, for example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more increased for the agent relative to no administration of the agent. Also, Similarly, the ICso (i.e., the concentration which achieves half-maximal cytotoxic or cytostatic effect on cancer cells) can be measured and can be, for example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000% or more increased for the agent relative to no administration of the agent. In some embodiments, cancer cell growth in an assay can be inhibited by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or even 100%. In another embodiment, at least about a 10% , 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or even 100% decrease in a solid malignancy can be achieved.
A "transcribed polynucleotide" or "nucleotide transcript" is a polynucleotide (e.g. an mRNA, hnRNA, a cDNA, or an analog of such RNA or cDNA) which is complementary
to or homologous with all or a portion of a mature mRNA made by transcription of a biomarker nucleic acid and normal post-transcriptional processing (e.g. splicing), if any, of the RNA transcript, and reverse transcription of the RNA transcript.
As used herein, the term "unresponsiveness" includes refractivity of cancer cells to therapy or refractivity of therapeutic cells, such as immune cells, to stimulation, e.g., stimulation via an activating receptor or a cytokine. Unresponsiveness can occur, e.g., because of exposure to immunosuppressants or exposure to high doses of antigen. As used herein, the term "anergy" or "tolerance" includes refractivity to activating receptor- mediated stimulation. Such refractivity is generally antigen-specific and persists after exposure to the tolerizing antigen has ceased. For example, anergy in T cells (as opposed to unresponsiveness) is characterized by lack of cytokine production, e.g., IL-2. T cell anergy occurs when T cells are exposed to antigen and receive a first signal (a T cell receptor or CD-3 mediated signal) in the absence of a second signal (a costimulatory signal). Under these conditions, reexposure of the cells to the same antigen (even if reexposure occurs in the presence of a costimulatory polypeptide) results in failure to produce cytokines and, thus, failure to proliferate. Anergic T cells can, however, proliferate if cultured with cytokines (e.g., IL-2). For example, T cell anergy can also be observed by the lack of IL-2 production by T lymphocytes as measured by ELISA or by a proliferation assay using an indicator cell line. Alternatively, a reporter gene construct can be used. For example, anergic T cells fail to initiate IL-2 gene transcription induced by a heterologous promoter under the control of the 5' IL-2 gene enhancer or by a multimer of the API sequence that can be found within the enhancer (Kang et al. (1992) Science 257: 1134).
There is a known and definite correspondence between the amino acid sequence of a particular protein and the nucleotide sequences that can code for the protein, as defined by the genetic code (shown below). Likewise, there is a known and definite correspondence between the nucleotide sequence of a particular nucleic acid and the amino acid sequence encoded by that nucleic acid, as defined by the genetic code.
GENETIC CODE
Alanine (Ala, A) GCA, GCC, GCG, GCT
Arginine (Arg, R) AGA, ACG, CGA, CGC, CGG, CGT
Asparagine (Asn, N) AAC, AAT
Aspartic acid (Asp, D) GAC, GAT
Cysteine (Cys, C) TGC, TGT
Glutamic acid (Glu, E) GAA, GAG
Glutamine (Gin, Q) CAA, CAG
Glycine (Gly, G) GGA, GGC, GGG, GGT
Histidine (His, H) CAC, CAT
Isoleucine (He, I) ATA, ATC, ATT
Leucine (Leu, L) CTA, CTC, CTG, CTT, TTA, TTG
Lysine (Lys, K) AAA, AAG
Methionine (Met, M) ATG
Phenylalanine (Phe, Έ) TTC, TTT
Proline (Pro, P) CCA, CCC, CCG, CCT
Serine (Ser, S) AGC, AGT, TCA, TCC, TCG, TCT
Threonine (Thr, T) ACA, ACC, ACG, ACT
Tryptophan (Trp, W) TGG
Tyrosine (Tyr, Y) TAC, TAT
Valine (Val, V) GTA, GTC, GTG, GTT
Termination signal (end) TAA, TAG, TGA
An important and well-known feature of the genetic code is its redundancy, whereby, for most of the amino acids used to make proteins, more than one coding nucleotide triplet may be employed (illustrated above). Therefore, a number of different nucleotide sequences may code for a given amino acid sequence. Such nucleotide sequences are considered functionally equivalent since they result in the production of the same amino acid sequence in all organisms (although certain organisms may translate some sequences more efficiently than they do others). Moreover, occasionally, a methylated variant of a purine or pyrimidine may be found in a given nucleotide sequence. Such methylations do not affect the coding relationship between the trinucleotide codon and the corresponding amino acid.
In view of the foregoing, the nucleotide sequence of a DNA or RNA encoding a biomarker nucleic acid (or any portion thereof) can be used to derive the polypeptide amino acid sequence, using the genetic code to translate the DNA or RNA into an amino acid sequence. Likewise, for polypeptide amino acid sequence, corresponding nucleotide sequences that can encode the polypeptide can be deduced from the genetic code (which, because of its redundancy, will produce multiple nucleic acid sequences for any given amino acid sequence). Thus, description and/or disclosure herein of a nucleotide sequence
which encodes a polypeptide should be considered to also include description and/or disclosure of the amino acid sequence encoded by the nucleotide sequence. Similarly, description and/or disclosure of a polypeptide amino acid sequence herein should be considered to also include description and/or disclosure of all possible nucleotide sequences that can encode the amino acid sequence.
Finally, nucleic acid and amino acid sequence information for the loci and biomarkers of the present invention (e.g., biomarkers listed in Tables 1 and 2) are well- known in the art and readily available on publicly available databases, such as the National Center for Biotechnology Information (NCBI). For example, exemplary nucleic acid and amino acid sequences derived from publicly available sequence databases are provided below and include, for example, PCT Publ. WO 2014/022759, which is incorporated herein in its entirety by this reference.
Table 1
SEP ID NO: 1 Human RIPK1 Variant 1 cDNA Sequence (NM 003804.4, CDS region from position 233-2248)
1 agactgctcg tcaagtgtgg gaaaagctcc gtggcgtcac aagctactat ataaaaggcg 61 gtgcccgccg gggccgagtg ggagtccgcg gcgagcgcag cagcagggcc cggtcctgcg 121 cctcgggagt cggcgtccag gctcggagcg cgacacggag actaggtggc agggtacagc 181 tctgccgggg ggggaaaaag tggtaccatt ttgggcgttc ttgagcttca gaatgcaacc 241 agacatgtcc ttgaatgtca ttaagatgaa atccagtgac ttcctggaga gtgcagaact 301 ggacagcgga ggctttggga aggtgtctct gtgtttccac agaacccagg gactcatgat 361 catgaaaaca gtgtacaagg ggcccaactg cattgagcac aacgaggccc tcttggagga 421 ggcgaagatg atgaacagac tgagacacag ccgggtggtg aagctcctgg gcgtcatcat 481 agaggaaggg aagtactccc tggtgatgga gtacatggag aagggcaacc tgatgcacgt 541 gctgaaagcc gagatgagta ctccgctttc tgtaaaagga aggataattt tggaaatcat 601 tgaaggaatg tgctacttac atggaaaagg cgtgatacac aaggacctga agcctgaaaa 661 tatccttgtt gataatgact tccacattaa gatcgcagac ctcggccttg cctcctttaa 721 gatgtggagc aaactgaata atgaagagca caatgagctg agggaagtgg acggcaccgc 781 taagaagaat ggcggcaccc tctactacat ggcgcccgag cacctgaatg acgtcaacgc 841 aaagcccaca gagaagtcgg atgtgtacag ctttgctgta gtactctggg cgatatttgc 901 aaataaggag ccatatgaaa atgctatctg tgagcagcag ttgataatgt gcataaaatc 961 tgggaacagg ccagatgtgg atgacatcac tgagtactgc ccaagagaaa ttatcagtct 1021 catgaagctc tgctgggaag cgaatccgga agctcggccg acatttcctg gcattgaaga 1081 aaaatttagg cctttttatt taagtcaatt agaagaaagt gtagaagagg acgtgaagag 1141 tttaaagaaa gagtattcaa acgaaaatgc agttgtgaag agaatgcagt ctcttcaact 1201 tgattgtgtg gcagtacctt caagccggtc aaattcagcc acagaacagc ctggttcact 1261 gcacagttcc cagggacttg ggatgggtcc tgtggaggag tcctggtttg ctccttccct 1321 ggagcaccca caagaagaga atgagcccag cctgcagagt aaactccaag acgaagccaa 1381 ctaccatctt tatggcagcc gcatggacag gcagacgaaa cagcagccca gacagaatgt 1441 ggcttacaac agagaggagg aaaggagacg cagggtctcc catgaccctt ttgcacagca 1501 aagaccttac gagaattttc agaatacaga gggaaaaggc actgcttatt ccagtgcagc 1561 cagtcatggt aatgcagtgc accagccctc agggctcacc agccaacctc aagtactgta 1621 tcagaacaat ggattatata gctcacatgg ctttggaaca agaccactgg atccaggaac 1681 agcaggtccc agagtttggt acaggccaat tccaagtcat atgcctagtc tgcataatat 1741 cccagtgcct gagaccaact atctaggaaa tacacccacc atgccattca gctccttgcc 1801 accaacagat gaatctataa aatataccat atacaatagt actggcattc agattggagc 1861 ctacaattat atggagattg gtgggacgag ttcatcacta ctagacagca caaatacgaa 1921 cttcaaagaa gagccagctg ctaagtacca agctatcttt gataatacca ctagtctgac
1981 ggataaacac ctggacccaa tcagggaaaa tctgggaaag cactggaaaa actgtgcccg 2041 taaactgggc ttcacacagt ctcagattga tgaaattgac catgactatg agcgagatgg 2101 actgaaagaa aaggtttacc agatgctcca aaagtgggtg atgagggaag gcataaaggg 2161 agccacggtg gggaagctgg cccaggcgct ccaccagtgt tccaggatcg accttctgag 2221 cagcttgatt tacgtcagcc agaactaacc ctggatgggc tacggcagct gaagtggacg 2281 cctcacttag tggataaccc cagaaagttg gctgcctcag agcattcaga attctgtcct 2341 cactgatagg ggttctgtgt ctgcagaaat tttgtttcct gtacttcata gctggagaat 2401 ggggaaagaa atctgcagca aaggggtctc actctgttgc caggctggtc tcaaacttct 2461 ggactcaagt gatcctcccg cctcggcctt ccaaagtgct gggatatcag gcactgagcc 2521 actgcgccca gccaacaatc cgctctgagg aaagcgtaag caggaagacc tcttaatggc 2581 atagcaccaa taaaaaaatg actcctagtt gtgtttggaa agggagagaa gagatgtctg 2641 aggaaggtca tgttctttca gcttatggca tttcctagag ttttgttgaa gcaagaagaa 2701 aaactcagag aatataaaat caacttttaa aattgtgtgc tctcttcttc acgtaggctc 2761 ctgttaaaaa caaagtgcag tcagattcta agccctgttc agagacttcg tggatcacag 2821 ctgcagctca ccgccacatc acaggatccg ttaacgttaa tacccaatac tctgtcagcc 2881 actgtaggct ctaagaacca cgtgcagtct tcagcccatt aaattatcga ttatttttta 2941 atgaattgaa tttatattga gtcttcaaat taactgaatg gatttaaagg ggtaccaagg 3001 aggggggaaa catcagaatt tcccaggcag ttgttgcaag gaattggtac taaccgtgac 3061 tacaacaaaa attcttgatt gacttttaaa gttatttcct ggcattctgg taccttcacc 3121 cagcctgagt gccctggaga gggaacagga aatgctgatc tctacccctg ggtgagacca 3181 gaacctcagg gctgatactg ttgagtggct tcctcggttt actctgtgta ctgtgaaagt 3241 attttcatat tttttctgtg tgccagagtg aaaaaggaca gcttctgagt gtggtaattg 3301 tgcctctagc acccagcctt tcaaagccca cctgaaacct gggggtggat gaaagaacta 3361 gaatagaaga ctgaagctgg gtaggccgct cagtgtccac tggcattttg ctaaaccgac 3421 aaggaaggct gtgtgcttag ctctccccag agggagggcg agaagggtgt ggtgatggtc 3481 aatctggctg tcggaacaga ttctggtgtc ttgggctgat aacagtgttg ttgattctga 3541 ttgtgaatcc cctcaactct agcagacaca tacacacccc tgaaatgggg ctgcagagca 3601 ggctgtctca gccttgccac tgtcggcatc tcggcctggg taattctgtt gtggggactg 3661 tcctgttcct tgtaggatgt ttagtagcat ccctgccccc acctactaga tgccaggggc 3721 actgttctcc ccagcccccc gccccagttg tgacaatagt ctctaaacat tgtcaaatgg 3781 tccaaggaaa ggggaaaatt gccccggttg agaagagcac tgctgtaaag taatgagcct 3841 cggctctcct gtctgcacct gtccggttac tacttggcca ccacgcagcc ttggctccta 3901 cagcccaaaa gggagaatgg agggaggctc caggctttgc tggaggggcc tgggtgagtt 3961 ctgtttgctc cttgtaccac catccaaatg gtgttatcaa atctcttaga ttccaaagag 4021 gttgaataat taatgttcaa aggcaagagg gcaaggcatt ttttaacact ttttaaaata 4081 aaaatttata ccacaa
SEP ID NO: 2 Human RIPK1 isoform 1 Amino Acid Sequence (NP 003795.2)
1 mqpdmslnvi kmkssdfles aeldsggfgk vslcfhrtqg lmimktvykg pnciehneal
61 leeakmmnrl rhsrvvkllg viieegkysl vmeymekgnl mhvlkaemst plsvkgriil
121 eiiegmcylh gkgvihkdlk penilvdndf hikiadlgla sfkmwsklnn eehnelrevd
181 gtakknggtl yymapehlnd vnakpteksd vysfavvlwa ifankepyen aiceqqlimc
241 iksgnrpdvd diteycprei islmklcwea npearptfpg ieekfrpfyl sqleesveed
301 vkslkkeysn enavvkrmqs lqldcvavps srsnsateqp gslhssqglg mgpveeswfa
361 pslehpqeen epslqsklqd eanyhlygsr mdrqtkqqpr qnvaynreee rrrrvshdpf
421 aqqrpyenfq ntegkgtays saashgnavh qpsgltsqpq vlyqnnglys shgfgtrpld
481 pgtagprvwy rpipshmpsl hnipvpetny lgntptmpfs slpptdesik ytiynstgiq
541 igaynymeig gtssslldst ntnfkeepaa kyqaifdntt sltdkhldpi renlgkhwkn
601 carklgftqs qideidhdye rdglkekvyq mlqkwvmreg ikgatvgkla qalhqcsrid
661 llssliyvsq n
SEP ID NO: 3 Human RIPK1 Variant 2 cDNA Sequence (NM 001317061.1, CDS region from position 1000-2526)
1 agactgctcg tcaagtgtgg gaaaagctcc gtggcgtcac aagctactat ataaaaggcg
61 gtgcccgccg gggccgagtg ggagtccgcg gcgagcgcag cagcagggcc cggtcctgcg
121 cctcgggagt cggcgtccag gctcggagcg cgacacggag actaggtggc aggaaagaag
181 gcccataggt gctgctgtat gagcttcctc cgctagacag agctggcccc agcctttaga
241 tgaggtgtag aaggctggtt acccgggtca cctgtagccg gccactgtgc aacaccatgg
301 gcagcctagg agtttccaga gtcccctctc cccaagggta cagctctgcc ggggggggaa
361 aaagtggtac cattttgggc gttcttgagc ttcagaatgc aaccagacat gtccttgaat
421 gtcattaaga tgaaatccag tgacttcctg gagagtgcag aactggacag cggaggcttt 481 gggaaggtgt ctctgtgttt ccacagaacc cagggactca tgatcatgaa aacagtgtac 541 aaggggccca actgcattga gcacaacgag gccctcttgg aggaggcgaa gatgatgaac 601 agactgagac acagccgggt ggtgaagctc ctgggcgtca tcatagagga agggaagtac 661 tccctggtga tggagtacat ggagaagggc aacctgatgc acgtgctgaa agccgagatg 721 agtactccgc tttctgtaaa aggaaggata attttggaaa tcattgaagg aatgtgctac 781 ttacatggaa aaggcgtgat acacaaggac ctgaagcctg aaaatatcct tgttgataat 841 gacttccaca ttaaggttca ggctacagct caaaacaagc aacactgcag tccttatcct 901 cagtgtgtct ttgggatcct tggacacttg catccatggg cctctggacg ccatttgggg 961 aaatagaaga tcgcagacct cggccttgcc tcctttaaga tgtggagcaa actgaataat 1021 gaagagcaca atgagctgag ggaagtggac ggcaccgcta agaagaatgg cggcaccctc 1081 tactacatgg cgcccgagca cctgaatgac gtcaacgcaa agcccacaga gaagtcggat 1141 gtgtacagct ttgctgtagt actctgggcg atatttgcaa ataaggagcc atatgaaaat 1201 gctatctgtg agcagcagtt gataatgtgc ataaaatctg ggaacaggcc agatgtggat 1261 gacatcactg agtactgccc aagagaaatt atcagtctca tgaagctctg ctgggaagcg 1321 aatccggaag ctcggccgac atttcctggc attgaagaaa aatttaggcc tttttattta 1381 agtcaattag aagaaagtgt agaagaggac gtgaagagtt taaagaaaga gtattcaaac 1441 gaaaatgcag ttgtgaagag aatgcagtct cttcaacttg attgtgtggc agtaccttca 1501 agccggtcaa attcagccac agaacagcct ggttcactgc acagttccca gggacttggg 1561 atgggtcctg tggaggagtc ctggtttgct ccttccctgg agcacccaca agaagagaat 1621 gagcccagcc tgcagagtaa actccaagac gaagccaact accatcttta tggcagccgc 1681 atggacaggc agacgaaaca gcagcccaga cagaatgtgg cttacaacag agaggaggaa 1741 aggagacgca gggtctccca tgaccctttt gcacagcaaa gaccttacga gaattttcag 1801 aatacagagg gaaaaggcac tgcttattcc agtgcagcca gtcatggtaa tgcagtgcac 1861 cagccctcag ggctcaccag ccaacctcaa gtactgtatc agaacaatgg attatatagc 1921 tcacatggct ttggaacaag accactggat ccaggaacag caggtcccag agtttggtac 1981 aggccaattc caagtcatat gcctagtctg cataatatcc cagtgcctga gaccaactat 2041 ctaggaaata cacccaccat gccattcagc tccttgccac caacagatga atctataaaa 2101 tataccatat acaatagtac tggcattcag attggagcct acaattatat ggagattggt 2161 gggacgagtt catcactact agacagcaca aatacgaact tcaaagaaga gccagctgct 2221 aagtaccaag ctatctttga taataccact agtctgacgg ataaacacct ggacccaatc 2281 agggaaaatc tgggaaagca ctggaaaaac tgtgcccgta aactgggctt cacacagtct 2341 cagattgatg aaattgacca tgactatgag cgagatggac tgaaagaaaa ggtttaccag 2401 atgctccaaa agtgggtgat gagggaaggc ataaagggag ccacggtggg gaagctggcc 2461 caggcgctcc accagtgttc caggatcgac cttctgagca gcttgattta cgtcagccag 2521 aactaaccct ggatgggcta cggcagctga agtggacgcc tcacttagtg gataacccca 2581 gaaagttggc tgcctcagag cattcagaat tctgtcctca ctgatagggg ttctgtgtct 2641 gcagaaattt tgtttcctgt acttcatagc tggagaatgg ggaaagaaat ctgcagcaaa 2701 ggggtctcac tctgttgcca ggctggtctc aaacttctgg actcaagtga tcctcccgcc 2761 tcggccttcc aaagtgctgg gatatcaggc actgagccac tgcgcccagc caacaatccg 2821 ctctgaggaa agcgtaagca ggaagacctc ttaatggcat agcaccaata aaaaaatgac 2881 tcctagttgt gtttggaaag ggagagaaga gatgtctgag gaaggtcatg ttctttcagc 2941 ttatggcatt tcctagagtt ttgttgaagc aagaagaaaa actcagagaa tataaaatca 3001 acttttaaaa ttgtgtgctc tcttcttcac gtaggctcct gttaaaaaca aagtgcagtc 3061 agattctaag ccctgttcag agacttcgtg gatcacagct gcagctcacc gccacatcac 3121 aggatccgtt aacgttaata cccaatactc tgtcagccac tgtaggctct aagaaccacg 3181 tgcagtcttc agcccattaa attatcgatt attttttaat gaattgaatt tatattgagt 3241 cttcaaatta actgaatgga tttaaagggg taccaaggag gggggaaaca tcagaatttc 3301 ccaggcagtt gttgcaagga attggtacta accgtgacta caacaaaaat tcttgattga 3361 cttttaaagt tatttcctgg cattctggta ccttcaccca gcctgagtgc cctggagagg 3421 gaacaggaaa tgctgatctc tacccctggg tgagaccaga acctcagggc tgatactgtt 3481 gagtggcttc ctcggtttac tctgtgtact gtgaaagtat tttcatattt tttctgtgtg 3541 ccagagtgaa aaaggacagc ttctgagtgt ggtaattgtg cctctagcac ccagcctttc 3601 aaagcccacc tgaaacctgg gggtggatga aagaactaga atagaagact gaagctgggt 3661 aggccgctca gtgtccactg gcattttgct aaaccgacaa ggaaggctgt gtgcttagct 3721 ctccccagag ggagggcgag aagggtgtgg tgatggtcaa tctggctgtc ggaacagatt 3781 ctggtgtctt gggctgataa cagtgttgtt gattctgatt gtgaatcccc tcaactctag 3841 cagacacata cacacccctg aaatggggct gcagagcagg ctgtctcagc cttgccactg 3901 tcggcatctc ggcctgggta attctgttgt ggggactgtc ctgttccttg taggatgttt 3961 agtagcatcc ctgcccccac ctactagatg ccaggggcac tgttctcccc agccccccgc 4021 cccagttgtg acaatagtct ctaaacattg tcaaatggtc caaggaaagg ggaaaattgc
4081 cccggttgag aagagcactg ctgtaaagta atgagcctcg gctctcctgt ctgcacctgt
4141 ccggttacta cttggccacc acgcagcctt ggctcctaca gcccaaaagg gagaatggag
4201 ggaggctcca ggctttgctg gaggggcctg ggtgagttct gtttgctcct tgtaccacca
4261 tccaaatggt gttatcaaat ctcttagatt ccaaagaggt tgaataatta atgttcaaag
4321 gcaagagggc aaggcatttt ttaacacttt ttaaaataaa aatttatacc acaa
SEP ID NO: 4 Human RIPK1 isoform 2 Amino Acid Sequence
(NP 001303990.1)
1 mwsklnneeh nelrevdgta kknggtlyym apehlndvna kpteksdvys fawlwaifa 61 nkepyenaic eqqlimciks gnrpdvddit eycpreiisl mklcweanpe arptfpgiee 121 kfrpfylsql eesveedvks lkkeysnena vvkrmqslql dcvavpssrs nsateqpgsl 181 hssqglgmgp veeswfapsl ehpqeeneps lqsklqdean yhlygsrmdr qtkqqprqnv 241 aynreeerrr rvshdpfaqq rpyenfqnte gkgtayssaa shgnavhqps gltsqpqvly 301 qnnglysshg fgtrpldpgt agprvwyrpi pshmpslhni pvpetnylgn tptmpfsslp 361 ptdesikyti ynstgiqiga ynymeiggts sslldstntn fkeepaakyq aifdnttslt 421 dkhldpiren lgkhwkncar klgftqsqid eidhdyerdg lkekvyqmlq kwvmregikg 481 atvgklaqal hqcsridlls sliyvsqn
SEP ID NO: 5 Mouse RIPK1 cDNA Sequence (NM 009068.3, CDS region from position 137-2107)
1 cgaaaagcgc ggaacttgct gtcatctagc gggaggttgg actcttcttg aggtcgtttt 61 agctcaagtc gagactgaag gacacagcac taagcaagaa ccaaaagtgg tgtgttggag 121 attctgagca atcaaaatgc aaccagacat gtccttggac aatattaaga tggcatccag 181 tgacctgctg gagaagacag acctagacag cggaggcttc gggaaggtgt ccttgtgtta 241 ccacagaagc catggatttg tcatcctgaa aaaagtatac acagggccca accgcgctga 301 gtacaatgag gttctcttgg aagaggggaa gatgatgcac agactgagac acagtcgagt 361 ggtgaagcta ctgggcatca tcatagaaga agggaactat tcgctggtga tggagtacat 421 ggagaagggc aacctgatgc acgtgctaaa gacccagata gatgtcccac tttcattgaa 481 aggaaggata atcgtggagg ccatagaagg catgtgctac ttacatgaca aaggtgtgat 541 acacaaggac ctgaagcctg agaatatcct cgttgatcgt gactttcaca ttaagatagc 601 cgatcttggt gtggcttcct ttaagacatg gagcaaactg actaaggaga aagacaacaa 661 gcagaaagaa gtgagcagca ccactaagaa gaacaatggt ggtacccttt actacatggc 721 acccgaacac ctgaatgaca tcaatgcaaa gcccacggag aagtcggacg tgtacagctt 781 tggcattgtc ctttgggcaa tatttgcaaa aaaggagccc tatgagaatg tcatctgtac 841 tgagcagttc gtgatctgca taaaatctgg gaacaggcca aatgtagagg aaatccttga 901 gtactgtcca agggagatca tcagcctcat ggagcggtgc tggcaggcga tcccagaaga 961 caggccaaca tttcttggca ttgaagaaga atttaggcct ttttacttaa gtcattttga 1021 agaatatgta gaagaggatg tggcaagttt aaagaaagag tatccagatc aaagcccagt 1081 gctgcagaga atgttttcac tgcagcatga ctgtgtaccc ttacctccga gcaggtcaaa 1141 ttcagaacaa cctggatcgc tgcacagttc ccaggggctc cagatgggtc ctgtggagga 1201 gtcctggttt tcttcctccc cagagtaccc acaggacgag aatgatcgca gtgtgcaggc 1261 taagctgcaa gaggaagcca gctatcatgc ttttggaata tttgcagaga aacagacaaa 1321 accgcagcca aggcagaatg aggcttacaa cagagaggag gaaaggaaac gaagggtctc 1381 tcatgacccc tttgcacagc agagagctcg tgagaatatt aagagtgcag gagcaagagg 1441 tcattctgat cccagcacaa cgagtcgtgg aattgcagtg caacagctgt catggccagc 1501 cacccaaaca gtttggaaca atggattgta taatcagcat ggatttggaa ctacaggtac 1561 aggagtttgg tatccgccaa atctaagcca aatgtatagt acttataaaa ctccagtgcc 1621 agagaccaac ataccgggaa gcacacccac catgccatac ttctctgggc cagtagcaga 1681 tgacctcata aaatatacta tattcaatag ttctggtatt cagattggaa accacaatta 1741 tatggatgtt ggactgaatt cacaaccacc aaacaatact tgcaaagaag agtcgacttc 1801 cagacaccaa gccatctttg ataacaccac tagtctgact gatgaacacc tgaaccctat 1861 cagggaaaac ctgggaaggc agtggaaaaa ctgtgcccgc aagctgggct tcactgagtc 1921 tcagatcgat gaaatcgacc atgactatga aagagatgga ctgaaagaga aagtttacca 1981 aatgcttcag aagtggctga tgcgggaagg caccaaaggg gccacagtgg gaaagttggc 2041 ccaggcactt caccaatgtt gcaggataga cctgctgaac cacttgattc gtgccagcca 2101 gagctaagcc tgggcaggct ctggcagtgg gaagcaaact atttgtctgg tgcacaaacc 2161 ccgtttgccc actagccttc agaactctat ctcagcatga gctctgcatt tgagcacaca 2221 gggtcatgca gtttggaact ggtggatggg aagagaaatc tgaagcccac agtgattctt 2281 cagaacatgc aagcataaag accgctgaat gaatggtcgg tccatgacca gtaggaggaa 2341 aaaaattaaa aatacagtgt attgagtttt caaagggaga gaagatgttg ggggaaggtg
2401 gccttcgttc agcttgtgtc atagtcatca cttaggttat ttgctcagtt tcctgtggtt 2461 tcattgggta aggggaaaac aaacaaaaaa cattcaaaga atgtaaaatc agctagcttc 2521 ccgcttcatg gactgtgagt cagaaaagtt ctgctcaaat gccttctatg agccacggct 2581 cttctaaaaa ctataggatc tgttaacttg agcatccaat gctgtactgt caccttaagc 2641 tttaagaatc atgtgtaatt ctagtctatc aaattatcaa ttagtgagag atttttaagg 2701 agtgctaagg agaaaaaggt gcagggcaga gagagatctt caggtactgg ctgtcattgc 2761 agctcaggta ctggctgtca ttgcagagct gctgctggtt ctggctgctg taaaaagtct 2821 acttttaagt ttctaaagtt tctctaccat tctggcgctt catgcagttt cccaccctgt 2881 gagccccaca gagggaacag atgtgcagga aacactgatc gggaaatacc atctcctcct 2941 ctctggatat gactggtgcc ttagcactgt tccctgtgcc caataaactg tttcctcagt 3001 tttctccagt gtgctgtaca aatatgtttc ttctgtgtgc caccaatcaa gaaaggacag 3061 cttcagagtc atcttgtgcc tttaggaagc ccatattgca acctacaagt gagtgaagga 3121 gctagggtag aagactgaag ccgcctacac cagccacagt cactgttagg atgggctgca 3181 cagccgcttt ggccttgttg gccattctgg cactcattgg cacttcatcc tcctttgttg 3241 ggctatcctg tactcagtag gatatttggg aacattcctg gcctccatct gcaagatgcc 3301 aacagtacaa gtcaacctca caacacccac caggtgtgag aaaaataact agatattgct 3361 acatgttctt tggagggact ctcctgtaac gttatttccc ccatccccag acaaggtttc 3421 tcagttctcg ctgtcctgga actcactttg tagaccagat tggtctccca attcagagat 3481 ctgcctgcct ctgcctcctg agtgctggga ataaaggcat gtgccaccac cacccagctt 3541 cctgctgtaa gtttatatgc cttacttctc ctgtcacaca ggctaggcca tcattaacag 3601 catggaacat gcacagtgga agggaattgg agcagggaag gttccaggct ttcctgaagg 3661 agcctgcata gtctttaaaa aatgttttct ttttaacttc taatgctgtt ttaagaagac 3721 agaattagaa actgcttcta gtggagtttt aaggagaata aaatagcaag ggaggccaga 3781 gctggttttg gaattgcagt agcaatcagg gtcctagtat taaaatcatg tctgttagtg 3841 ttcagtaggg gaagacttgt gtgtccactg ctgaagatag gtgcttcaga tccaggcctg 3901 gattgtgacc acagactttc agatcttttc caggctcacc actgacagcc agacaatggc 3961 ttggcacctc gagttgtggc tgagcctgta tgagttgaag gatggtcagt agatgaagcc 4021 gtttactctc atggtgtgtg cccttgtaca agagatctgg gcgcgtgaca caaagccagt 4081 cattgacagg ctagacccaa agacctttaa gcactcccat ttgcttccgc tgtatcacaa 4141 taactgatga ctttgtagtc agtggtacct gctccgaaca agtacgtgga gtgtgggagt 4201 ccctctggga gcccagcgtg gaattagaac acctctttaa agccacctcc taagccgagc 4261 agaatgcagt ggactggggt acaagtcaga cctgagtgtc attgtccaca tcatggaaaa 4321 acaagatggc caccagaaca ctgaaggcct gaggagacta accctgttcc cagaactcag 4381 agttctgttt ggttctgttt ttaataagat aacctttctt taatgtatac atatgcatat 4441 acatatatat ttgtacttta aatacagagt actgaataaa atttatgtga ctataaaaaa 4501 aaaaaaaaaa aa
SEP ID NO: 6 Mouse RIPK1 Amino Acid Sequence (NP 033094.3)
1 mqpdmsldni kmassdllek tdldsggfgk vslcyhrshg fvilkkvytg pnraeynevl
61 leegkmmhrl rhsrvvkllg iiieegnysl vmeymekgnl mhvlktqidv plslkgriiv
121 eaiegmcylh dkgvihkdlk penilvdrdf hikiadlgva sfktwskltk ekdnkqkevs
181 sttkknnggt lyymapehln dinakpteks dvysfgivlw aifakkepye nvicteqfvi
241 ciksgnrpnv eeileycpre iislmercwq aipedrptfl gieeefrpfy lshfeeyvee
301 dvaslkkeyp dqspvlqrmf slqhdcvplp psrsnseqpg slhssqglqm gpveeswfss
361 speypqdend rsvqaklqee asyhafgifa ekqtkpqprq neaynreeer krrvshdpfa
421 qqrareniks agarghsdps ttsrgiavqq lswpatqtvw nnglynqhgf gttgtgvwyp
481 pnlsqmysty ktpvpetnip gstptmpyfs gpvaddliky tifnssgiqi gnhnymdvgl
541 nsqppnntck eestsrhqai fdnttsltde hlnpirenlg rqwkncarkl gftesqidei
601 dhdyerdglk ekvyqmlqkw lmregtkgat vgklaqalhq ccridllnhl irasqs
SEP ID NO: 7 Human BIRC2 Transcript Variant 1 cDNA Sequence (NM 001166.4, CDS region from position 1453-3309)
1 aacgctggtc ctcggccggg cgcgctgacg tcatcgtgcg tcagagtgag cccggatggg 61 gcggcgggct tcgggagcgc ccgggctgat ccgagccgag cgggccgtat ctccttgtcg 121 gcgccgctga ttcccggctc tgcggaggcc tctaggcagc cgcgcagctt ccgtgtttgc 181 tgcgcccgca ctgcgattta caaccctgaa gaatctccct atccctattt tgtccccctg 241 cagtaataaa tcccattatg gagatctcga aactttataa agggatatag tttgaattct 301 atggagtgta attttgtgta tgaattatat ttttaaaaca ttgaagagtt ttcagaaaga 361 aggctagtag agttgattac tgatacttta tgctaagcag tacttttttg gtagtacaat 421 attttgttag gcgtttctga taacactaga aaggacaagt tttatcttgt gataaattga
481 ttaatgttta caacatgact gataattata gctgaatagt ccttaaatga tgaacaggtt 541 atttagtttt taaatgcagt gtaaaaagtg tgctgtggaa attttatggc taactaagtt 601 tatggagaaa ataccttcag ttgatcaaga ataatagtgg tatacaaagt taggaagaaa 661 gtcaacatga tgctgcagga aatggaaaca aatacaaatg atatttaaca aagatagagt 721 ttacagtttt tgaactttaa gccaaattca tttgacatca agcactatag caggcacagg 781 ttcaacaaag cttgtgggta ttgacttccc ccaaaagttg tcagctgaag taatttagcc 841 cacttaagta aatactatga tgataagctg tgtgaactta gcttttaaat agtgtgacca 901 tatgaaggtt ttaattactt ttgtttattg gaataaaatg agattttttg ggttgtcatg 961 ttaaagtgct tatagggaaa gaagcctgca tataattttt taccttgtgg cataatcagt 1021 aattggtctg ttattcaggc ttcatagctt gtaaccaaat ataaataaaa ggcataattt 1081 aggtattcta tagttgctta gaattttgtt aatataaatc tctgtgaaaa atcaaggagt 1141 tttaatattt tcagaagtgc atccaccttt cagggcttta agttagtatt actcaagatt 1201 atgaacaaat agcacttagg ttacctgaaa gagttactac aaccccaaag agttgtgttc 1261 taagtagtat cttggtaatt cagagagata ctcatcctac ctgaatataa actgagataa 1321 atccagtaaa gaaagtgtag taaattctac ataagagtct atcattgatt tctttttgtg 1381 gtaaaaatct tagttcatgt gaagaaattt catgtgaatg ttttagctat caaacagtac 1441 tgtcacctac tcatgcacaa aactgcctcc caaagacttt tcccaggtcc ctcgtatcaa 1501 aacattaaga gtataatgga agatagcacg atcttgtcag attggacaaa cagcaacaaa 1561 caaaaaatga agtatgactt ttcctgtgaa ctctacagaa tgtctacata ttcaactttc 1621 cccgccgggg tgcctgtctc agaaaggagt cttgctcgtg ctggttttta ttatactggt 1681 gtgaatgaca aggtcaaatg cttctgttgt ggcctgatgc tggataactg gaaactagga 1741 gacagtccta ttcaaaagca taaacagcta tatcctagct gtagctttat tcagaatctg 1801 gtttcagcta gtctgggatc cacctctaag aatacgtctc caatgagaaa cagttttgca 1861 cattcattat ctcccacctt ggaacatagt agcttgttca gtggttctta ctccagcctt 1921 tctccaaacc ctcttaattc tagagcagtt gaagacatct cttcatcgag gactaacccc 1981 tacagttatg caatgagtac tgaagaagcc agatttctta cctaccatat gtggccatta 2041 acttttttgt caccatcaga attggcaaga gctggttttt attatatagg acctggagat 2101 agggtagcct gctttgcctg tggtgggaag ctcagtaact gggaaccaaa ggatgatgct 2161 atgtcagaac accggaggca ttttcccaac tgtccatttt tggaaaattc tctagaaact 2221 ctgaggttta gcatttcaaa tctgagcatg cagacacatg cagctcgaat gagaacattt 2281 atgtactggc catctagtgt tccagttcag cctgagcagc ttgcaagtgc tggtttttat 2341 tatgtgggtc gcaatgatga tgtcaaatgc ttttgttgtg atggtggctt gaggtgttgg 2401 gaatctggag atgatccatg ggtagaacat gccaagtggt ttccaaggtg tgagttcttg 2461 atacgaatga aaggccaaga gtttgttgat gagattcaag gtagatatcc tcatcttctt 2521 gaacagctgt tgtcaacttc agataccact ggagaagaaa atgctgaccc accaattatt 2581 cattttggac ctggagaaag ttcttcagaa gatgctgtca tgatgaatac acctgtggtt 2641 aaatctgcct tggaaatggg ctttaataga gacctggtga aacaaacagt tcaaagtaaa 2701 atcctgacaa ctggagagaa ctataaaaca gttaatgata ttgtgtcagc acttcttaat 2761 gctgaagatg aaaaaagaga agaggagaag gaaaaacaag ctgaagaaat ggcatcagat 2821 gatttgtcat taattcggaa gaacagaatg gctctctttc aacaattgac atgtgtgctt 2881 cctatcctgg ataatctttt aaaggccaat gtaattaata aacaggaaca tgatattatt 2941 aaacaaaaaa cacagatacc tttacaagcg agagaactga ttgataccat tttggttaaa 3001 ggaaatgctg cggccaacat cttcaaaaac tgtctaaaag aaattgactc tacattgtat 3061 aagaacttat ttgtggataa gaatatgaag tatattccaa cagaagatgt ttcaggtctg 3121 tcactggaag aacaattgag gaggttgcaa gaagaacgaa cttgtaaagt gtgtatggac 3181 aaagaagttt ctgttgtatt tattccttgt ggtcatctgg tagtatgcca ggaatgtgcc 3241 ccttctctaa gaaaatgccc tatttgcagg ggtataatca agggtactgt tcgtacattt 3301 ctctcttaaa gaaaaatagt ctatatttta acctgcataa aaaggtcttt aaaatattgt 3361 tgaacacttg aagccatcta aagtaaaaag ggaattatga gtttttcaat tagtaacatt 3421 catgttctag tctgctttgg tactaataat cttgtttctg aaaagatggt atcatatatt 3481 taatcttaat ctgtttattt acaagggaag atttatgttt ggtgaactat attagtatgt 3541 atgtgtacct aagggagtag tgtcactgct tgttatgcat catttcagga gttactggat 3601 ttgttgttct ttcagaaagc tttgaatact aaattatagt gtagaaaaga actggaaacc 3661 aggaactctg gagttcatca gagttatggt gccgaattgt ctttggtgct tttcacttgt 3721 gttttaaaat aaggattttt ctcttatttc tccccctagt ttgtgagaaa catctcaata 3781 aagtgcttta aaaagaaaaa aaaaaaaaaa aaal
SEP ID NO: 8 Human BIRC2 Transcript Variant 2 cDNA Sequence (NM 001256163.1, CDS region from position 1730-3586)
1 gcggtgagtg ctgctccttc cgggctcggg cggcgtgggg cgggtgggga cgcgagggcc
61 cgcgggggcc cacttccctg atgtggcggc gaacgaggaa ggacggggcc tgaggccctt 121 cggccaaggg tcgagggtcg ccgggggctc tctgctttct actctcgcca aggttttatt 181 ggattcggaa gccccaactt cgagacttgc agtcaaagcg atttttaaaa tgacttgttt 241 tcaagcctct ggccgccgcc cactcttctg gcccttggac tttgaccaag atgttttctc 301 gcagtttttg caaggtttta aacttagccc tcggcgttct tttaatgtaa tacattgaaa 361 cgaagatatt tcggtggcgg cgatatttca tatttcatag ttgccactgc gctctgtcat 421 tccagtagtc gtctgttgtg tattgtgaga agcaactctg ggaaattatt ggatttacaa 481 ccctgaagaa tctccctatc cctattttgt ccccctgcag taataaatcc cattatggag 541 atctcgaaac tttataaagg gatatagttt gaattctatg gagtgtaatt ttgtgtatga 601 attatatttt taaaacattg aagagttttc agaaagaagg ctagtagagt tgattactga 661 tactttatgc taagcagtac ttttttggta gtacaatatt ttgttaggcg tttctgataa 721 cactagaaag gacaagtttt atcttgtgat aaattgatta atgtttacaa catgactgat 781 aattatagct gaatagtcct taaatgatga acaggttatt tagtttttaa atgcagtgta 841 aaaagtgtgc tgtggaaatt ttatggctaa ctaagtttat ggagaaaata ccttcagttg 901 atcaagaata atagtggtat acaaagttag gaagaaagtc aacatgatgc tgcaggaaat 961 ggaaacaaat acaaatgata tttaacaaag atagagttta cagtttttga actttaagcc 1021 aaattcattt gacatcaagc actatagcag gcacaggttc aacaaagctt gtgggtattg 1081 acttccccca aaagttgtca gctgaagtaa tttagcccac ttaagtaaat actatgatga 1141 taagctgtgt gaacttagct tttaaatagt gtgaccatat gaaggtttta attacttttg 1201 tttattggaa taaaatgaga ttttttgggt tgtcatgtta aagtgcttat agggaaagaa 1261 gcctgcatat aattttttac cttgtggcat aatcagtaat tggtctgtta ttcaggcttc 1321 atagcttgta accaaatata aataaaaggc ataatttagg tattctatag ttgcttagaa 1381 ttttgttaat ataaatctct gtgaaaaatc aaggagtttt aatattttca gaagtgcatc 1441 cacctttcag ggctttaagt tagtattact caagattatg aacaaatagc acttaggtta 1501 cctgaaagag ttactacaac cccaaagagt tgtgttctaa gtagtatctt ggtaattcag 1561 agagatactc atcctacctg aatataaact gagataaatc cagtaaagaa agtgtagtaa 1621 attctacata agagtctatc attgatttct ttttgtggta aaaatcttag ttcatgtgaa 1681 gaaatttcat gtgaatgttt tagctatcaa acagtactgt cacctactca tgcacaaaac 1741 tgcctcccaa agacttttcc caggtccctc gtatcaaaac attaagagta taatggaaga 1801 tagcacgatc ttgtcagatt ggacaaacag caacaaacaa aaaatgaagt atgacttttc 1861 ctgtgaactc tacagaatgt ctacatattc aactttcccc gccggggtgc ctgtctcaga 1921 aaggagtctt gctcgtgctg gtttttatta tactggtgtg aatgacaagg tcaaatgctt 1981 ctgttgtggc ctgatgctgg ataactggaa actaggagac agtcctattc aaaagcataa 2041 acagctatat cctagctgta gctttattca gaatctggtt tcagctagtc tgggatccac 2101 ctctaagaat acgtctccaa tgagaaacag ttttgcacat tcattatctc ccaccttgga 2161 acatagtagc ttgttcagtg gttcttactc cagcctttct ccaaaccctc ttaattctag 2221 agcagttgaa gacatctctt catcgaggac taacccctac agttatgcaa tgagtactga 2281 agaagccaga tttcttacct accatatgtg gccattaact tttttgtcac catcagaatt 2341 ggcaagagct ggtttttatt atataggacc tggagatagg gtagcctgct ttgcctgtgg 2401 tgggaagctc agtaactggg aaccaaagga tgatgctatg tcagaacacc ggaggcattt 2461 tcccaactgt ccatttttgg aaaattctct agaaactctg aggtttagca tttcaaatct 2521 gagcatgcag acacatgcag ctcgaatgag aacatttatg tactggccat ctagtgttcc 2581 agttcagcct gagcagcttg caagtgctgg tttttattat gtgggtcgca atgatgatgt 2641 caaatgcttt tgttgtgatg gtggcttgag gtgttgggaa tctggagatg atccatgggt 2701 agaacatgcc aagtggtttc caaggtgtga gttcttgata cgaatgaaag gccaagagtt 2761 tgttgatgag attcaaggta gatatcctca tcttcttgaa cagctgttgt caacttcaga 2821 taccactgga gaagaaaatg ctgacccacc aattattcat tttggacctg gagaaagttc 2881 ttcagaagat gctgtcatga tgaatacacc tgtggttaaa tctgccttgg aaatgggctt 2941 taatagagac ctggtgaaac aaacagttca aagtaaaatc ctgacaactg gagagaacta 3001 taaaacagtt aatgatattg tgtcagcact tcttaatgct gaagatgaaa aaagagaaga 3061 ggagaaggaa aaacaagctg aagaaatggc atcagatgat ttgtcattaa ttcggaagaa 3121 cagaatggct ctctttcaac aattgacatg tgtgcttcct atcctggata atcttttaaa 3181 ggccaatgta attaataaac aggaacatga tattattaaa caaaaaacac agataccttt 3241 acaagcgaga gaactgattg ataccatttt ggttaaagga aatgctgcgg ccaacatctt 3301 caaaaactgt ctaaaagaaa ttgactctac attgtataag aacttatttg tggataagaa 3361 tatgaagtat attccaacag aagatgtttc aggtctgtca ctggaagaac aattgaggag 3421 gttgcaagaa gaacgaactt gtaaagtgtg tatggacaaa gaagtttctg ttgtatttat 3481 tccttgtggt catctggtag tatgccagga atgtgcccct tctctaagaa aatgccctat 3541 ttgcaggggt ataatcaagg gtactgttcg tacatttctc tcttaaagaa aaatagtcta 3601 tattttaacc tgcataaaaa ggtctttaaa atattgttga acacttgaag ccatctaaag 3661 taaaaaggga attatgagtt tttcaattag taacattcat gttctagtct gctttggtac
3721 taataatctt gtttctgaaa agatggtatc atatatttaa tcttaatctg tttatttaca
3781 agggaagatt tatgtttggt gaactatatt agtatgtatg tgtacctaag ggagtagtgt
3841 cactgcttgt tatgcatcat ttcaggagtt actggatttg ttgttctttc agaaagcttt
3901 gaatactaaa ttatagtgta gaaaagaact ggaaaccagg aactctggag ttcatcagag
3961 ttatggtgcc gaattgtctt tggtgctttt cacttgtgtt ttaaaataag gatttttctc
4021 ttatttctcc ccctagtttg tgagaaacat ctcaataaag tgctttaaaa agaaaaaaaa
4081 aaaaaaaa
SEP ID NO: 9 Human BIRC2 Isoform 1 Amino Acid Sequence (NP 001157.1)
1 mhktasqrlf pgpsyqniks imedstilsd wtnsnkqkmk ydfscelyrm stystfpagv 61 pvserslara gfyytgvndk vkcfccglml dnwklgdspi qkhkqlypsc s fiqnlvsas 121 lgstskntsp mrns fahsls ptlehsslfs gsysslspnp lnsravedis ssrtnpysya 181 msteearfIt yhmwpltfIs pselaragfy yigpgdrvac facggklsnw epkddamseh 241 rrhfpncpf1 ensletlrfs isnlsmqtha armrtfmywp ssvpvqpeql asagfyyvgr 301 nddvkcfccd gglrcwesgd dpwvehakwf prceflirmk gqefvdeiqg ryphlleqll 361 stsdttgeen adppiihfgp gesssedavm mntpvvksal emgfnrdlvk qtvqskiltt 421 genyktvndi vsallnaede kreeekekqa eemasddlsl irknrmalfq qltcvlpild 481 nllkanvink qehdiikqkt qiplqareli dtilvkgnaa anifknclke idstlyknlf 541 vdknmkyipt edvsglslee qlrrlqeert ckvcmdkevs vvfipcghlv vcqecapslr 601 kcpicrgiik gtvrtfIs
SEP ID NO: 10 Human BIRC2 Transcript Variant 3 cDNA Sequence
(NM 001256166.1, CDS region from position 197-1906)
1 aacgctggtc ctcggccggg cgcgctgacg tcatcgtgcg tcagagtgag cccggatggg 61 gcggcgggct tcgggagcgc ccgggctgat ccgagccgag cgggccgtat ctccttgtcg 121 gcgccgctga ttcccggctc tgcggaggcc tctaggcagc cgcgcagctt ccgtgtttgc 181 tgcgcccgca ctgcgaatgt ctacatattc aactttcccc gccggggtgc ctgtctcaga 241 aaggagtctt gctcgtgctg gtttttatta tactggtgtg aatgacaagg tcaaatgctt 301 ctgttgtggc ctgatgctgg ataactggaa actaggagac agtcctattc aaaagcataa 361 acagctatat cctagctgta gctttattca gaatctggtt tcagctagtc tgggatccac 421 ctctaagaat acgtctccaa tgagaaacag ttttgcacat tcattatctc ccaccttgga 481 acatagtagc ttgttcagtg gttcttactc cagcctttct ccaaaccctc ttaattctag 541 agcagttgaa gacatctctt catcgaggac taacccctac agttatgcaa tgagtactga 601 agaagccaga tttcttacct accatatgtg gccattaact tttttgtcac catcagaatt 661 ggcaagagct ggtttttatt atataggacc tggagatagg gtagcctgct ttgcctgtgg 721 tgggaagctc agtaactggg aaccaaagga tgatgctatg tcagaacacc ggaggcattt 781 tcccaactgt ccatttttgg aaaattctct agaaactctg aggtttagca tttcaaatct 841 gagcatgcag acacatgcag ctcgaatgag aacatttatg tactggccat ctagtgttcc 901 agttcagcct gagcagcttg caagtgctgg tttttattat gtgggtcgca atgatgatgt 961 caaatgcttt tgttgtgatg gtggcttgag gtgttgggaa tctggagatg atccatgggt 1021 agaacatgcc aagtggtttc caaggtgtga gttcttgata cgaatgaaag gccaagagtt 1081 tgttgatgag attcaaggta gatatcctca tcttcttgaa cagctgttgt caacttcaga 1141 taccactgga gaagaaaatg ctgacccacc aattattcat tttggacctg gagaaagttc 1201 ttcagaagat gctgtcatga tgaatacacc tgtggttaaa tctgccttgg aaatgggctt 1261 taatagagac ctggtgaaac aaacagttca aagtaaaatc ctgacaactg gagagaacta 1321 taaaacagtt aatgatattg tgtcagcact tcttaatgct gaagatgaaa aaagagaaga 1381 ggagaaggaa aaacaagctg aagaaatggc atcagatgat ttgtcattaa ttcggaagaa 1441 cagaatggct ctctttcaac aattgacatg tgtgcttcct atcctggata atcttttaaa 1501 ggccaatgta attaataaac aggaacatga tattattaaa caaaaaacac agataccttt 1561 acaagcgaga gaactgattg ataccatttt ggttaaagga aatgctgcgg ccaacatctt 1621 caaaaactgt ctaaaagaaa ttgactctac attgtataag aacttatttg tggataagaa 1681 tatgaagtat attccaacag aagatgtttc aggtctgtca ctggaagaac aattgaggag 1741 gttgcaagaa gaacgaactt gtaaagtgtg tatggacaaa gaagtttctg ttgtatttat 1801 tccttgtggt catctggtag tatgccagga atgtgcccct tctctaagaa aatgccctat 1861 ttgcaggggt ataatcaagg gtactgttcg tacatttctc tcttaaagaa aaatagtcta 1921 tattttaacc tgcataaaaa ggtctttaaa atattgttga acacttgaag ccatctaaag 1981 taaaaaggga attatgagtt tttcaattag taacattcat gttctagtct gctttggtac 2041 taataatctt gtttctgaaa agatggtatc atatatttaa tcttaatctg tttatttaca 2101 agggaagatt tatgtttggt gaactatatt agtatgtatg tgtacctaag ggagtagtgt 2161 cactgcttgt tatgcatcat ttcaggagtt actggatttg ttgttctttc agaaagcttt
2221 gaatactaaa ttatagtgta gaaaagaact ggaaaccagg aactctggag ttcatcagag
2281 ttatggtgcc gaattgtctt tggtgctttt cacttgtgtt ttaaaataag gatttttctc
2341 ttatttctcc ccctagtttg tgagaaacat ctcaataaag tgctttaaaa agaaaaaaaa
2401 aaaaaaaa
SEP ID NO: 11 Human BIRC2 Isoform 2 Amino Acid Sequence
(NP 001243095.1)
1 mstystfpag vpvserslar agfyytgvnd kvkcfccglm ldnwklgdsp iqkhkqlyps 61 cs fiqnlvsa slgstsknts pmrns fahsl sptlehsslf sgsysslspn plnsravedi 121 sssrtnpysy amsteearf1 tyhmwpltf1 spselaragf yyigpgdrva cfacggklsn 181 wepkddamse hrrhfpncpf lensletlrf sisnlsmqth aarmrtfmyw pssvpvqpeq 241 lasagfyyvg rnddvkcfcc dgglrcwesg ddpwvehakw fprceflirm kgqefvdeiq 301 gryphlleql lstsdttgee nadppiihfg pgesssedav mmntpvvksa lemgfnrdlv 361 kqtvqskilt tgenyktvnd ivsallnaed ekreeekekq aeemasddls lirknrmalf 421 qqltcvlpil dnllkanvin kqehdiikqk tqiplqarel idtilvkgna aanifknclk 481 eidstlyknl fvdknmkyip tedvsglsle eqlrrlqeer tckvcmdkev svvfipcghl 541 vvcqecapsl rkcpicrgii kgtvrtfIs
SEP ID NO: 12 Mouse BIRC2 Transcript Variant 1 cDNA Sequence
(NM 007465.3, CDS region from position 970-2808)
1 ttttgggaag gctgcggatc aacaatcagg cgcctctgct tccagggcgc cgggggcctg 61 actcggtgat tgatagtcct caagagtctt catgttctct tatgtttttc tagaaatcag 121 cccactcatg gacatctgaa catttctata agacgctgcg gtttgctttg cagtgtgttc 181 ttgtgtatga ttagttatat aaaatacgaa gttttcaaaa agaaggctag tgcaacagaa 241 aagctttgct aaaacagatt cttagttatt tgaggtaaca aaagaaagcc atgtcttgaa 301 ttgattcgtt cttaattata acagacttat agtggaaagg gccttaaaca caggcggact 361 ttataaaatg cagtcttagg tttatgtgca aaatactgtc tgttgaccag atgtattcac 421 atgatatata cagagtcaag gtggtgatat agaagattta acagtgaggg agttaacagt 481 ctgtgcttta agcgcagttc ctttacagtg aatactgtag tcttaataga cctgagctga 541 ctgctgcagt tgatgtaacc cactttagag aatactgtat gacatcttct ctaaggaaaa 601 ccagctgcag acttcactca gttcctttca tttcatagga aaaggagtag ttcagatgtc 661 atgtttaagt ccttataagg gaaaagagcc tgaatatatg ccctagtacc taggcttcat 721 aactagtaat aagaagttag ttatgggtaa atagatctca ggttacccag aagagttcat 781 gtgaccccca aagagtccta actagtgtct tggcaagtga gacagatttg tcctgtgagg 841 gtgtcaattc accagtccaa gcagaagaca atgaatctat ccagtcaggt gtctgtggtg 901 gagatctagt gtcaagtggt gagaaacttc atctggaagt ttaagcggtc agaaatacta 961 ttactactca tggacaaaac tgtctcccag agactcggcc aaggtacctt acaccaaaaa 1021 cttaaacgta taatggagaa gagcacaatc ttgtcaaatt ggacaaagga gagcgaagaa 1081 aaaatgaagt ttgacttttc gtgtgaactc taccgaatgt ctacatattc agcttttccc 1141 aggggagttc ctgtctcaga gaggagtctg gctcgtgctg gcttttatta tacaggtgtg 1201 aatgacaaag tcaagtgctt ctgctgtggc ctgatgttgg ataactggaa acaaggggac 1261 agtcctgttg aaaagcacag acagttctat cccagctgca gctttgtaca gactctgctt 1321 tcagccagtc tgcagtctcc atctaagaat atgtctcctg tgaaaagtag atttgcacat 1381 tcgtcacctc tggaacgagg tggcattcac tccaacctgt gctctagccc tcttaattct 1441 agagcagtgg aagacttctc atcaaggatg gatccctgca gctatgccat gagtacagaa 1501 gaggccagat ttcttactta cagtatgtgg cctttaagtt ttctgtcacc agcagagctg 1561 gccagagctg gcttctatta catagggcct ggagacaggg tggcctgttt tgcctgtggt 1621 gggaaactga gcaactggga accaaaggat gatgctatgt cagagcaccg cagacatttt 1681 ccccactgtc catttctgga aaatacttca gaaacacaga ggtttagtat atcaaatcta 1741 agtatgcaga cacactctgc tcgattgagg acatttctgt actggccacc tagtgttcct 1801 gttcagcccg agcagcttgc aagtgctgga ttctattacg tggatcgcaa tgatgatgtc 1861 aagtgctttt gttgtgatgg tggcttgaga tgttgggaac ctggagatga cccctggata 1921 gaacacgcca aatggtttcc aaggtgtgag ttcttgatac ggatgaaggg tcaggagttt 1981 gttgatgaga ttcaagctag atatcctcat cttcttgagc agctgttgtc cacttcagac 2041 accccaggag aagaaaatgc tgaccctaca gagacagtgg tgcattttgg ccctggagaa 2101 agttcggaag atgtcgtcat gatgagcacg cctgtggtta aagcagcctt ggaaatgggc 2161 ttcagtagga gcctggtgag acagacggtt cagcggcaga tcctggccac tggtgagaac 2221 tacaggaccg tcaatgatat tgtctcagta cttttgaatg ctgaagatga gagaagagaa 2281 gaggagaagg aaagacagac tgaagagatg gcatcaggtg acttatcact gattcggaag 2341 aatagaatgg ccctctttca acagttgaca catgtccttc ctatcctgga taatcttctt
2401 gaggccagtg taattacaaa acaggaacat gatattatta gacagaaaac acagataccc 2461 ttacaagcaa gagagcttat tgacaccgtt ttagtcaagg gaaatgctgc agccaacatc 2521 ttcaaaaact ctctgaagga aattgactcc acgttatatg aaaacttatt tgtggaaaag 2581 aatatgaagt atattccaac agaagacgtt tcaggcttgt cattggaaga gcagttgcgg 2641 agattacaag aagaacgaac ttgcaaagtg tgtatggaca gagaggtttc tattgtgttc 2701 attccgtgtg gtcatctagt agtctgccag gaatgtgccc cttctctaag gaagtgcccc 2761 atctgcaggg ggacaatcaa ggggactgtg cgcacatttc tctcatgagt gaagaatggt 2821 ctgaaagtat tgttggacat cagaagctgt cagaacaaag aatgaactac tgatttcagc 2881 tcttcagcag gacattctac tctctttcaa gattagtaat cttgctttat gaagggtagc 2941 attgtatatt taagcttagt ctgttgcaag ggaaggtcta tgctgttgag ctacaggact 3001 gtgtctgttc cagagcagga gttgggatgc ttgctgtatg tccttcagga cttcttggat 3061 ttggaatttg tgaaagcttt ggattcaggt gatgtggagc tcagaaatcc tgaaaccagt 3121 ggctctggta ctcagtagtt agggtaccct gtgcttcttg gtgcttttcc tttctggaaa 3181 ataaggattt ttctgctact ggtaaatatt ttctgtttgt gagaaatata ttaaagtgtt 3241 tcttttaaag gcgtgcatca ttgtagtgtg tgcagggatg tatgcaggca aaacactgtg 3301 tatataataa ataaatcttt ttaaaaagtg tta
SEP ID NO: 13 Mouse BIRC2 Transcript Variant 2 cDNA Sequence
(NM 001291503.1, CDS region from position 1014-2852)
1 cagtcaaccc aggctagtct cgaatttgcg gcaatcctcc tgcctccaat cgttctaggt
61 gctgggatta ctggtgtgca gcacctcggc tgtctcttca gattttctgc agattgatag 121 tcctcaagag tcttcatgtt ctcttatgtt tttctagaaa tcagcccact catggacatc 181 tgaacatttc tataagacgc tgcggtttgc tttgcagtgt gttcttgtgt atgattagtt 241 atataaaata cgaagttttc aaaaagaagg ctagtgcaac agaaaagctt tgctaaaaca 301 gattcttagt tatttgaggt aacaaaagaa agccatgtct tgaattgatt cgttcttaat 361 tataacagac ttatagtgga aagggcctta aacacaggcg gactttataa aatgcagtct 421 taggtttatg tgcaaaatac tgtctgttga ccagatgtat tcacatgata tatacagagt 481 caaggtggtg atatagaaga tttaacagtg agggagttaa cagtctgtgc tttaagcgca 541 gttcctttac agtgaatact gtagtcttaa tagacctgag ctgactgctg cagttgatgt 601 aacccacttt agagaatact gtatgacatc ttctctaagg aaaaccagct gcagacttca 661 ctcagttcct ttcatttcat aggaaaagga gtagttcaga tgtcatgttt aagtccttat 721 aagggaaaag agcctgaata tatgccctag tacctaggct tcataactag taataagaag 781 ttagttatgg gtaaatagat ctcaggttac ccagaagagt tcatgtgacc cccaaagagt 841 cctaactagt gtcttggcaa gtgagacaga tttgtcctgt gagggtgtca attcaccagt 901 ccaagcagaa gacaatgaat ctatccagtc aggtgtctgt ggtggagatc tagtgtcaag 961 tggtgagaaa cttcatctgg aagtttaagc ggtcagaaat actattacta ctcatggaca 1021 aaactgtctc ccagagactc ggccaaggta ccttacacca aaaacttaaa cgtataatgg 1081 agaagagcac aatcttgtca aattggacaa aggagagcga agaaaaaatg aagtttgact 1141 tttcgtgtga actctaccga atgtctacat attcagcttt tcccagggga gttcctgtct 1201 cagagaggag tctggctcgt gctggctttt attatacagg tgtgaatgac aaagtcaagt 1261 gcttctgctg tggcctgatg ttggataact ggaaacaagg ggacagtcct gttgaaaagc 1321 acagacagtt ctatcccagc tgcagctttg tacagactct gctttcagcc agtctgcagt 1381 ctccatctaa gaatatgtct cctgtgaaaa gtagatttgc acattcgtca cctctggaac 1441 gaggtggcat tcactccaac ctgtgctcta gccctcttaa ttctagagca gtggaagact 1501 tctcatcaag gatggatccc tgcagctatg ccatgagtac agaagaggcc agatttctta 1561 cttacagtat gtggccttta agttttctgt caccagcaga gctggccaga gctggcttct 1621 attacatagg gcctggagac agggtggcct gttttgcctg tggtgggaaa ctgagcaact 1681 gggaaccaaa ggatgatgct atgtcagagc accgcagaca ttttccccac tgtccatttc 1741 tggaaaatac ttcagaaaca cagaggttta gtatatcaaa tctaagtatg cagacacact 1801 ctgctcgatt gaggacattt ctgtactggc cacctagtgt tcctgttcag cccgagcagc 1861 ttgcaagtgc tggattctat tacgtggatc gcaatgatga tgtcaagtgc ttttgttgtg 1921 atggtggctt gagatgttgg gaacctggag atgacccctg gatagaacac gccaaatggt 1981 ttccaaggtg tgagttcttg atacggatga agggtcagga gtttgttgat gagattcaag 2041 ctagatatcc tcatcttctt gagcagctgt tgtccacttc agacacccca ggagaagaaa 2101 atgctgaccc tacagagaca gtggtgcatt ttggccctgg agaaagttcg gaagatgtcg 2161 tcatgatgag cacgcctgtg gttaaagcag ccttggaaat gggcttcagt aggagcctgg 2221 tgagacagac ggttcagcgg cagatcctgg ccactggtga gaactacagg accgtcaatg 2281 atattgtctc agtacttttg aatgctgaag atgagagaag agaagaggag aaggaaagac 2341 agactgaaga gatggcatca ggtgacttat cactgattcg gaagaataga atggccctct 2401 ttcaacagtt gacacatgtc cttcctatcc tggataatct tcttgaggcc agtgtaatta
2461 caaaacagga acatgatatt attagacaga aaacacagat acccttacaa gcaagagagc 2521 ttattgacac cgttttagtc aagggaaatg ctgcagccaa catcttcaaa aactctctga 2581 aggaaattga ctccacgtta tatgaaaact tatttgtgga aaagaatatg aagtatattc 2641 caacagaaga cgtttcaggc ttgtcattgg aagagcagtt gcggagatta caagaagaac 2701 gaacttgcaa agtgtgtatg gacagagagg tttctattgt gttcattccg tgtggtcatc 2761 tagtagtctg ccaggaatgt gccccttctc taaggaagtg ccccatctgc agggggacaa 2821 tcaaggggac tgtgcgcaca tttctctcat gagtgaagaa tggtctgaaa gtattgttgg 2881 acatcagaag ctgtcagaac aaagaatgaa ctactgattt cagctcttca gcaggacatt 2941 ctactctctt tcaagattag taatcttgct ttatgaaggg tagcattgta tatttaagct 3001 tagtctgttg caagggaagg tctatgctgt tgagctacag gactgtgtct gttccagagc 3061 aggagttggg atgcttgctg tatgtccttc aggacttctt ggatttggaa tttgtgaaag 3121 ctttggattc aggtgatgtg gagctcagaa atcctgaaac cagtggctct ggtactcagt 3181 agttagggta ccctgtgctt cttggtgctt ttcctttctg gaaaataagg atttttctgc 3241 tactggtaaa tattttctgt ttgtgagaaa tatattaaag tgtttctttt aaaggcgtgc 3301 atcattgtag tgtgtgcagg gatgtatgca ggcaaaacac tgtgtatata ataaataaat 3361 ctttttaaaa agtgtta
SEP ID NO: 14 Mouse BIRC2 Amino Acid Sequence (NP 001278432.1)
1 mdktvsqrlg qgtlhqklkr imekstilsn wtkeseekmk fdfscelyrm stysafprgv
61 pvserslara gfyytgvndk vkcfccglml dnwkqgdspv ekhrqfypsc sfvqtllsas
121 lqspsknmsp vksrfahssp lerggihsnl cssplnsrav edfssrmdpc syamsteear
181 fltysmwpls flspaelara gfyyigpgdr vacfacggkl snwepkddam sehrrhfphc
241 pflentsetq rfsisnlsmq thsarlrtfl ywppsvpvqp eqlasagfyy vdrnddvkcf
301 ccdgglrcwe pgddpwieha kwfprcefli rmkgqefvde iqaryphlle qllstsdtpg
361 eenadptetv vhfgpgesse dvvmmstpvv kaalemgfsr slvrqtvqrq ilatgenyrt
421 vndivsvlln aederreeek erqteemasg dlslirknrm alfqqlthvl pildnlleas
481 vitkqehdii rqktqiplqa relidtvlvk gnaaanifkn slkeidstly enlfveknmk
541 yiptedvsgl sleeqlrrlq eertckvcmd revsivfipc ghlvvcqeca pslrkcpicr
601 gtikgtvrtf Is
SEP ID NO: 15 Human TBK1 cDNA Sequence (NM 013254.3, CDS region from position 160-2349)
1 gcacccgcac cggcgcgccg gccgtcggtc acgtggcctc cggccagggc ttgcgaagcc 61 ggaagtgtcc tgagtctcga ggaggccgcg ggagcccgcc ggcggtggcg cggcggagac 121 ccggctggta taacaagagg attgcctgat ccagccaaga tgcagagcac ttctaatcat 181 ctgtggcttt tatctgatat tttaggccaa ggagctactg caaatgtctt tcgtggaaga 241 cataagaaaa ctggtgattt atttgctatc aaagtattta ataacataag cttccttcgt 301 ccagtggatg ttcaaatgag agaatttgaa gtgttgaaaa aactcaatca caaaaatatt 361 gtcaaattat ttgctattga agaggagaca acaacaagac ataaagtact tattatggaa 421 ttttgtccat gtgggagttt atacactgtt ttagaagaac cttctaatgc ctatggacta 481 ccagaatctg aattcttaat tgttttgcga gatgtggtgg gtggaatgaa tcatctacga 541 gagaatggta tagtgcaccg tgatatcaag ccaggaaata tcatgcgtgt tataggggaa 601 gatggacagt ctgtgtacaa actcacagat tttggtgcag ctagagaatt agaagatgat 661 gagcagtttg tttctctgta tggcacagaa gaatatttgc accctgatat gtatgagaga 721 gcagtgctaa gaaaagatca tcagaagaaa tatggagcaa cagttgatct ttggagcatt 781 ggggtaacat tttaccatgc agctactgga tcactgccat ttagaccctt tgaagggcct 841 cgtaggaata aagaagtgat gtataaaata attacaggaa agccttctgg tgcaatatct 901 ggagtacaga aagcagaaaa tggaccaatt gactggagtg gagacatgcc tgtttcttgc 961 agtctttctc ggggtcttca ggttctactt acccctgttc ttgcaaacat ccttgaagca 1021 gatcaggaaa agtgttgggg ttttgaccag ttttttgcag aaactagtga tatacttcac 1081 cgaatggtaa ttcatgtttt ttcgctacaa caaatgacag ctcataagat ttatattcat 1141 agctataata ctgctactat atttcatgaa ctggtatata aacaaaccaa aattatttct 1201 tcaaatcaag aacttatcta cgaagggcga cgcttagtct tagaacctgg aaggctggca 1261 caacatttcc ctaaaactac tgaggaaaac cctatatttg tagtaagccg ggaacctctg 1321 aataccatag gattaatata tgaaaaaatt tccctcccta aagtacatcc acgttatgat 1381 ttagacgggg atgctagcat ggctaaggca ataacagggg ttgtgtgtta tgcctgcaga 1441 attgccagta ccttactgct ttatcaggaa ttaatgcgaa aggggatacg atggctgatt 1501 gaattaatta aagatgatta caatgaaact gttcacaaaa agacagaagt tgtgatcaca 1561 ttggatttct gtatcagaaa cattgaaaaa actgtgaaag tatatgaaaa gttgatgaag
1621 atcaacctgg aagcggcaga gttaggtgaa atttcagaca tacacaccaa attgttgaga 1681 ctttccagtt ctcagggaac aatagaaacc agtcttcagg atatcgacag cagattatct 1741 ccaggtggat cactggcaga cgcatgggca catcaagaag gcactcatcc gaaagacaga 1801 aatgtagaaa aactacaagt cctgttaaat tgcatgacag agatttacta tcagttcaaa 1861 aaagacaaag cagaacgtag attagcttat aatgaagaac aaatccacaa atttgataag 1921 caaaaactgt attaccatgc cacaaaagct atgacgcact ttacagatga atgtgttaaa 1981 aagtatgagg catttttgaa taagtcagaa gaatggataa gaaagatgct tcatcttagg 2041 aaacagttat tatcgctgac taatcagtgt tttgatattg aagaagaagt atcaaaatat 2101 caagaatata ctaatgagtt acaagaaact ctgcctcaga aaatgtttac agcttccagt 2161 ggaatcaaac ataccatgac cccaatttat ccaagttcta acacattagt agaaatgact 2221 cttggtatga agaaattaaa ggaagagatg gaaggggtgg ttaaagaact tgctgaaaat 2281 aaccacattt tagaaaggtt tggctcttta accatggatg gtggccttcg caacgttgac 2341 tgtctttagc tttctaatag aagtttaaga aaagtttccg tttgcacaag aaaataacgc 2401 ttgggcatta aatgaatgcc tttatagata gtcacttgtt tctacaattc agtatttgat 2461 gtggtcgtgt aaatatgtac aatattgtaa atacataaaa aatatacaaa tttttggctg 2521 ctgtgaagat gtaattttat cttttaacat ttataattat atgaggaaat ttgacctcag 2581 tgatcacgag aagaaagcca tgaccgacca atatgttgac atactgatcc tctactctga 2641 gtggggctaa ataagttatt ttctctgacc gcctactgga aatattttta agtggaacca 2701 aaataggcat ccttacaaat caggaagact gacttgacac gtttgtaaat ggtagaacgg 2761 tggctactgt gagtggggag cagaaccgca ccactgttat actgggataa caattttttt 2821 gagaaggata aagtggcatt attttatttt acaaggtgcc cagatcccag ttatccttgt 2881 atccatgtaa tttcagatga attattaagc aaacatttta aagtgaattc attattaaaa 2941 actattcatt tttttccttt ggccataaat gtgtaattgt cattaaaatt ctaaggtcat 3001 ttcaactgtt ttaagctgta tatttcttta attctgctta ctatttcatg gaaaaaaata 3061 aatttctcaa ttttaatgta aagagttaaa aaaaaaaa
SEP ID NO: 16 Human TBK1 Amino Acid Sequence (NP 037386.1)
1 mqstsnhlwl lsdilgqgat anvfrgrhkk tgdlfaikvf nnisflrpvd vqmrefevlk
61 klnhknivkl faieeetttr hkvlimefcp cgslytvlee psnayglpes eflivlrdvv
121 ggmnhlreng ivhrdikpgn imrvigedgq svykltdfga areleddeqf vslygteeyl
181 hpdmyeravl rkdhqkkyga tvdlwsigvt fyhaatgslp frpfegprrn kevmykiitg
241 kpsgaisgvq kaengpidws gdmpvscsls rglqvlltpv lanileadqe kcwgfdqffa
301 etsdilhrmv ihvfslqqmt ahkiyihsyn tatifhelvy kqtkiissnq eliyegrrlv
361 lepgrlaqhf pktteenpif vvsreplnti gliyekislp kvhprydldg dasmakaitg
421 vvcyacrias tlllyqelmr kgirwlieli kddynetvhk ktevvitldf cirniektvk
481 vyeklmkinl eaaelgeisd ihtkllrlss sqgtietslq didsrlspgg sladawahqe
541 gthpkdrnve klqvllncmt eiyyqfkkdk aerrlaynee qihkfdkqkl yyhatkamth
601 ftdecvkkye aflnkseewi rkmlhlrkql lsltnqcfdi eeevskyqey tnelqetlpq
661 kmftassgik htmtpiypss ntlvemtlgm kklkeemegv vkelaennhi lerfgsltmd
721 gglrnvdcl
SEP ID NO: 17 Mouse TBK1 cDNA Sequence (NM 019786.4, CDS region from position 160-2349)
1 tcggtcacgt gctccgtggc ccgggctggc gaagccggaa gtagcctggg gcgcgagaag 61 gcccgggagc cgcgggctgt acgcggcgga cactcgcggg catacatgca aatctcttct 121 tcccccttat cgtgaggaga agcgcctgga caagccgaga tgcagagcac ctccaaccat 181 ctgtggctcc tgtctgatat cctaggccag ggggccactg caaatgtctt ccgaggaagg 241 cataagaaaa ctggtgatct ctatgctgtc aaagtattta ataacataag cttccttcgc 301 ccagtggatg ttcaaatgag agaatttgaa gtgttaaaaa aactcaatca caaaaacatt 361 gtcaagttat ttgctattga agaggagaca acaacaagac ataaagtgct tattatggag 421 ttttgtccct gtgggagttt atacactgtt ctagaggagc cgtccaatgc gtatggactt 481 ccagaatcag aatttctcat tgtcttacga gatgtggtgg gcgggatgaa tcatctccga 541 gagaacggca tagtgcaccg agatatcaag ccaggcaaca tcatgcgcgt cataggggag 601 gacggccagt ctgtgtacaa actcacggat ttcggcgccg ctcgagagct ggaggacgat 661 gagcagtttg tgtctctgta cggcacagaa gagtacctgc atccggacat gtatgaaagg 721 gcagtgctaa gaaaggacca tcagaagaag tacggggcta ccgttgatct gtggagtgtt 781 ggagtgacat tctaccatgc agccacgggg tcgctgccgt ttagaccctt cgaggggcct 841 cggaggaaca aagaagtaat gtataaaata atcactggga agccgtctgg tgcaatatct 901 ggagtacaga aagcagaaaa cggaccaatt gactggagtg gagacatgcc tctctcctgt 961 agtctttctc agggtcttca ggcactgctt accccagttc ttgcaaacat acttgaagct
1021 gatcaggaga agtgctgggg ttttgaccag ttctttgcag agaccagtga tgtgcttcac 1081 cgaatggtga tccatgtctt ctcgctacaa cacatgacgg cgcataagat ttacattcac 1141 agctataaca ctgctgctgt gttccatgaa ctggtctata aacaaaccaa gattgtttcc 1201 tcaaatcaag aacttatcta cgaaggacga cgcttagtcc tagaactcgg acgactagcc 1261 cagcattttc ctaaaaccac agaggaaaat cctatctttg tcacgagccg ggaacaactc 1321 aataccgtag gactgagata tgaaaaaatt tccctcccta aaatacatcc acgctatgat 1381 ctggatgggg acgccagcat ggccaaggca gtgacggggg ttgtgtgcta cgcctgcaga 1441 actgccagta ccctgctgct ctatcaagaa ttaatgcgaa agggggtacg gtggctggtt 1501 gaactggtta aggatgatta caacgagacc gtccacaaga agacggaggt agtgatcaca 1561 ctggatttct gcatcaggaa cattgagaag actgtgaaag tgtatgagaa gttgatgaag 1621 gtcaacctgg aagccgcaga gctgggtgag atttcagaca tacacaccaa gctgctgaga 1681 ctttccagtt ctcagggaac aatagaaagc agtcttcagg acatcagcag caggctgtct 1741 ccagggggct tgctggccga cacctgggca catcaagaag gcacgcatcc aagagacagg 1801 aatgtagaaa aactgcaggt cctgttgaac tgcatcacag agatttacta tcagttcaaa 1861 aaagacaaag cagaacgcag actagcttat aatgaagaac agatccacaa atttgataag 1921 caaaaattgt attaccatgc cacaaaagca atgagccact tctcagaaga atgtgttaga 1981 aagtatgaag cgtttaaaga taagtcggaa gagtggatga gaaagatgct tcatcttagg 2041 aagcagctgt tatcgctaac taatcagtgt ttcgatatcg aagaggaagt gtccaagtat 2101 caagactata ctaacgagtt acaagaaact ctgcctcaga aaatgctcgc agcctccggc 2161 ggcgtcaagc acgccatggc cccgatctac cccagctcta acaccttagt ggagatgact 2221 cttggtatga agaagttaaa ggaggagatg gaaggcgtgg ttaaggagct ggccgagaac 2281 aatcatattt tagaaaggtt tgggtcttta acaatggatg gtggccttcg caatgtggac 2341 tgtctttagc ttcctaggga gtctgggaag ttctagtttg cacaagaaga taacactggg 2401 gcacgaaatg aacacctttg tgaatggagt tcttatttct acacttcagt atttgatgag 2461 gtcatgtaaa tatgtacagt ttgtaaatac atatacatat atatatatat atatgaattt 2521 tggctgctgt aacaaagaca gattgacctc agcgagctgt agaagaaagc catgaccagc 2581 cagtgctttg gggtgctctc cctaattctt cacataaggc tggagaaatc aattgcttgg 2641 tgcctaaaga aagtattttt tgaattggca ttcttaaaat tttgaaagga ctgatagtcg 2701 acacagtgta actggaggag acacagggct ttgtgacggg aacagaaccg cggtttaacc 2761 acagtcggtt ccctgacaag gataaagtgg cattatctca tttgaccggg tgcccaaatc 2821 tcagttttcc tcggatgttt gattttaggt gaattattga gcaaaaactt taaagtgaat 2881 tcattgttta aactattcat ttttcctttg gtcatgaatg tgtaattgtc attcagatcc 2941 tagtatcatt tcaattgtct taagatgtat atttctgtac tttaattctg ctatttcatg 3001 aaaaaataaa tttctcaatt ttaatgtaaa a
SEP ID NO: 18 Mouse TBK1 Amino Acid Sequence (NP 062760, 31
1 mqstsnhlwl lsdilgqgat anvfrgrhkk tgdlyavkvf nnis flrpvd vqmrefevlk 61 klnhknivkl faieeetttr hkvlimefcp cgslytvlee psnayglpes eflivlrdvv 121 ggmnhlreng ivhrdikpgn imrvigedgq svykltdfga areleddeqf vslygteeyl 181 hpdmyeravl rkdhqkkyga tvdlwsvgvt fyhaatgslp frpfegprrn kevmykiitg 241 kpsgaisgvq kaengpidws gdmplscsls qglqalltpv lanileadqe kcwgfdqffa 301 etsdvlhrmv ihvfslqhmt ahkiyihsyn taavfhelvy kqtkivssnq eliyegrrlv 361 lelgrlaqhf pktteenpif vtsreqlntv glryekislp kihprydldg dasmakavtg 421 vvcyacrtas tlllyqelmr kgvrwlvelv kddynetvhk ktevvitldf cirniektvk 481 vyeklmkvnl eaaelgeisd ihtkllrlss sqgtiesslq dissrlspgg lladtwahqe 541 gthprdrnve klqvllncit eiyyqfkkdk aerrlaynee qihkfdkqkl yyhatkamsh 601 fseecvrkye afkdkseewm rkmlhlrkql lsltnqcfdi eeevskyqdy tnelqetlpq 661 kmlaasggvk hamapiypss ntlvemtlgm kklkeemegv vkelaennhi lerfgsltmd 721 gglrnvdcl
SEP ID NO: 19 Human TRAF3 Transcript Variant 1 cDNA Sequence (NM 145725.2, CDS region from position 354-2060)
1 gggagcgcgg cgcggccgcc gcgtgcgcga gccggggttg cagcccagcc gggactttcc 61 agccggcggc agccgcggcg gccgccggct cttccccgcc ccccgccatg gggcagcccg 121 gggagcagaa cgctgcggac cgcggcggag gacgcgcccg gcgcccctga gccggccgag 181 cggcgacgga ccgcgagatg aggaaaatga ggcccaaaga agtgatgcca cttggttaag 241 gtcccagagc aggtcagaat cagacctagg atcagaaacc tggctcctgg ctcctggctc 301 cctactcttc taaggatcgc tgtcctgaca gaagagaact cctctttcct aaaatggagt 361 cgagtaaaaa gatggactct cctggcgcgc tgcagactaa cccgccgcta aagctgcaca 421 ctgaccgcag tgctgggacg ccagtttttg tccctgaaca aggaggttac aaggaaaagt
481 ttgtgaagac cgtggaggac aagtacaagt gtgagaagtg ccacctggtg ctgtgcagcc 541 cgaagcagac cgagtgtggg caccgcttct gcgagagctg catggcggcc ctgctgagct 601 cttcaagtcc aaaatgtaca gcgtgtcaag agagcatcgt taaagataag gtgtttaagg 661 ataattgctg caagagagaa attctggctc ttcagatcta ttgtcggaat gaaagcagag 721 gttgtgcaga gcagttaatg ctgggacatc tgctggtgca tttaaaaaat gattgccatt 781 ttgaagaact tccatgtgtg cgtcctgact gcaaagaaaa ggtcttgagg aaagacctgc 841 gagaccacgt ggagaaggcg tgtaaatacc gggaagccac atgcagccac tgcaagagtc 901 aggttccgat gatcgcgctg cagaaacacg aagacaccga ctgtccctgc gtggtggtgt 961 cctgccctca caagtgcagc gtccagactc tcctgaggag cgagttgagt gcacacttgt 1021 cagagtgtgt caatgccccc agcacctgta gttttaagcg ctatggctgc gtttttcagg 1081 ggacaaacca gcagatcaag gcccacgagg ccagctccgc cgtgcagcac gtcaacctgc 1141 tgaaggagtg gagcaactcg ctcgaaaaga aggtttcctt gttgcagaat gaaagtgtag 1201 aaaaaaacaa gagcatacaa agtttgcaca atcagatatg tagctttgaa attgaaattg 1261 agagacaaaa ggaaatgctt cgaaataatg aatccaaaat ccttcattta cagcgagtga 1321 tagacagcca agcagagaaa ctgaaggagc ttgacaagga gatccggccc ttccggcaga 1381 actgggagga agcagacagc atgaagagca gcgtggagtc cctccagaac cgcgtgaccg 1441 agctggagag cgtggacaag agcgcggggc aagtggctcg gaacacaggc ctgctggagt 1501 cccagctgag ccggcatgac cagatgctga gtgtgcacga catccgccta gccgacatgg 1561 acctgcgctt ccaggtcctg gagaccgcca gctacaatgg agtgctcatc tggaagattc 1621 gcgactacaa gcggcggaag caggaggccg tcatggggaa gaccctgtcc ctttacagcc 1681 agcctttcta cactggttac tttggctata agatgtgtgc cagggtctac ctgaacgggg 1741 acgggatggg gaaggggacg cacttgtcgc tgttttttgt catcatgcgt ggagaatatg 1801 atgccctgct tccttggccg tttaagcaga aagtgacact catgctgatg gatcaggggt 1861 cctctcgacg tcatttggga gatgcattca agcccgaccc caacagcagc agcttcaaga 1921 agcccactgg agagatgaat atcgcctctg gctgcccagt ctttgtggcc caaactgttc 1981 tagaaaatgg gacatatatt aaagatgata caatttttat taaagtcata gtggatactt 2041 cggatctgcc cgatccctga taagtagctg gggaggtgga tttagcagaa ggcaactcct 2101 ctgggggatt tgaaccggtc tgtcttcact gaggtcctcg cgctcagaaa aggaccttgt 2161 gagacggagg aagcggcaga aggcggacgc gtgccggcgg gaggagccac gcgtgagcac 2221 acctgacacg ttttataata gactagccac acttcactct gaagaattat ttatccttca 2281 acaagataaa tattgctgtc agagaaggtt ttcattttca tttttaaaga tctagttaat 2341 taaggtggaa aacatatatg ctaaacaaaa gaaacatgat ttttcttcct taaacttgaa 2401 caccaaaaaa acacacacac acacacacgt ggggatagct ggacatgtca gcatgttaag 2461 taaaaggaga atttatgaaa tagtaatgca attctgatat cttctttcta aaattcaaga 2521 gtgcaatttt gtttcaaata cagtatattg tctattttta aggcctcatc tggtctctgt 2581 tttaataatt tgtttgtcag aagaccctga agtatatacc taggtctttt ttttgaaagt 2641 ctctaaattc agaatcattt tttaatttaa agttctacaa ataattgtta ctgcaaacat 2701 tttattttaa aacgttgata gactgatatt tcttggaaga aaatataaaa tatcaaacac 2761 tggttatcac ttgtgatagg aaagagaata ttcaacctgt tgttatttct cgttagaaat 2821 gtaaaccttc aaatatctgt cgtagttaat gacacgactt cacaattctg aacggagcct 2881 cgctcatgga tgctgtgcat cattttcaga tttataattg ttttcaccct aaaatagggc 2941 atccgttgaa ctttggagtt ctaaacaaaa tcctgtaggt gtttggattc tgccccatgt 3001 gttcggacga gctctctgtt gctgacagca ccggccttcg gtctccatgt caggggtggg 3061 cgggtgactg ctgagggagg cccgcaggtg tgtttctcca tcccgtcatc ttgctgcatg 3121 ccgtcaacgg tctccgaaag caacgttgtg cgtagagctg gtggcatacg gcccacgtgc 3181 cttagatggg acatgctgct tctccaccct gggtttgcat tgagcatcat tctagaaagt 3241 gctagtttaa ccagactttt ctctccacca ctagatcttt gtctctacaa gggccctcag 3301 acacctctgc acctgctgag gggaagccag gctccaccgt cggcttctgg agcctccgct 3361 gcttaattac cacagattcc aaatctctag gccccacgag tgagccgcct ggtccaagta 3421 cggcctggtc ccaccctgag ggaggcaggt gtggaacaga agccgagcct ctccgtgtcc 3481 ccaccggggc cgtgggcacc cccacagccc gaagcagaac cctctgagca ttccagagac 3541 cgctgctcgg gggcctgccc aggctgacca acgggcgctc ctgaccacca ccctggcggg 3601 aagggtggcc acggggcccg tcgtcccagc ctgtgcctgc ccagatggca ttttctcaac 3661 tcactgttta ctgtctctca gtgtccaact gtgattagaa gcctggagcc tgccccctgc 3721 accccttttg ctatgcacca cgcttcatgg tgctcttacc actgatgggt gctacacgcg 3781 acgggtgctt cttaggcaaa accaatgtgt gcgaactgtc acacctgtgc cactcgccca 3841 caagccgcgc ccacaattgg ccagctgggc cgtgcacgtc agactgcctg cctcggctct 3901 ccccgtggcc gcgcggggac agcttggtgg gtgcccggtg gcccacctgt ctctggtgct 3961 gccatctgtc ctgggtgtgc cttcgcccca gtgcctgctg gaagtgccct ccgtcgcacc 4021 cctgtgccct gagctcccgt gaggggcccg ccgcgccctt tcgcggtcga agcgttccgt 4081 tgttcttatc tgcctttcct ttccccgctc tcctgggatt actttggggg aatgagtatc
4141 cttggttctg ccctgtgagg gagtcgtgtg tccctgctca taaaggaagg acttcctgca 4201 gaagctgcgg aaaactactg ttccctcgaa ggtgtccccc acctgaggcc tgtcccctac 4261 ctgccctcag gtagttttcc tgaggccagg ggttaacaac agggacatcc ctgcaacttc 4321 cccttcacaa aatgtataat attagatgaa ggatatgcaa catcttggtc tagtaagaac 4381 cgtttcctcc cctctgggtt gaagtcctgg tgtggccccc agaagcagca gtgcgtgtca 4441 ctgggacgtc tccagtagcc cttcccaggc agacgctcct ggcgggacgc catggggccc 4501 acctgagggt cccacagacg taacctgagt gacaggagtc cttgaggatg ggatggccta 4561 tgtcacacac tttgtccttg aacctgagtg atgggggtcc ttgaggatgg gatggcctgt 4621 gtcacgcgct ttgtctttgt gtttggttgt atcggggtct ctgttctgag tgtgtcttcc 4681 tctcatgtac tcaacacagt gggcagcagc ctgggacggc gtcccctctc ccggcggcgg 4741 gcaagccttg cgctgctcca ccctcggcct gggcaccctc acttggcgct ggccacctgg 4801 gccagcctgg ggccatggtc tctctgcagc tgaggcccag tggccccttg ggcagtgatc 4861 ggccctcccc gcatcacagg gccctggcag caagcgggaa atgggggcgc acactgtgtg 4921 cttgggggtg ctgcttgttt accacacatg accagactcc cagcaggaca gagctgctca 4981 gtactttaca gaaaccaact gagtcgtttg tgcatgaatt aagccggtct gcttccccgt 5041 caccttcgta acaaaacaac gtcccctctc ccctcgcctc gagcagtttc ttcaggacac 5101 cgtggctcgg gctgctccct gctgccaggc acgctggttg gctggcctgg gcccggctca 5161 cgtgaagggc actggctctt gtgaccacac tgagccacgt gcaagccgca gccgggcctg 5221 gaagcctgac cctctggttc tagggcttgt cccgcggagc ctgcagagct agacgttggg 5281 gtgtgtccgt gatgatatgg gggccaggct gggagtaggg cctttctagc agggttgggt 5341 ggctcagtga gggtgtggaa gtgggggacc cacggggcct ggctttggga ctagacatgc 5401 cagccccagc tgggctggag ggagcctgag tgagccccga catacgctgg gcctttcagc 5461 tcgccgtgct ctggtgacac acaggcggcc aggttgggat ttgtgtcaat tctaggagcc 5521 atcaagcatg aatgtggttc tgtctcctga gcgcaagcct cgccggaccc ctgggcgaag 5581 gcctggactt gcagatgtgt gttccctgtg cgggtggaca gagggggccc ttatgaccca 5641 cattgcagcc ccattccacc accccttcct ccccagagca gtctctgccg agggacagca 5701 cctgtgtccc ttcgatgcca caacagccag ttgaacaggg gagccctttg ctcaggcagc 5761 ttctcctgcc tctccctcct ttctccttcc ctgccccatc cccgtgccct tcttggcctg 5821 tggcgctggg gagccatggt gtggcatact ggggctcctg ctccttgggc cacttcctca 5881 gcccgggccc cacaggccca ccacctgcca gggctcccac tgcactggct gtggcaggag 5941 gcttccccat gaccccgtgt ggcccagctc ggtgaggatg cagttctagg cacagcccct 6001 gggacagcca gctgcctccc agaccacgtc agcctgctcc agggtcctca gtcaccctgg 6061 gccaggggcc acgtgtccca tggatgtcga ccatgccaac gtcacattcc agcacccctt 6121 ttgcttgatg gcgtctggtg gtagtcagca tggtggaccc acatcctaca gccagaggtg 6181 atgttggaca aaggaagggg agtctggatg ggtccttaaa cgaccattct gtccgcagcg 6241 gggtcattcc ttgtcagccc aagggagggc cggggagtac actgatccca acagctgggc 6301 tgacacctcc tttctcccct gcacggggag gattggcctg aggaccgtca ccctgtgcac 6361 agccccagta gggtggcagt gccactgtct ccttgggccg ttgcaggatt gggcgggtgc 6421 agactcccct tgcgggcccc ttgctcaatc cccggccctc ccagactcct ccctctactg 6481 ggggtaattt gtgtgtcaga agggctctgg cagagctgta aaatactgtt ttttaaaaat 6541 tttagtccag atctttactt attagactgc agaaggagag ctagggagag tgggggaagc 6601 ccccttgctt ttgtatctgt gaggtgaatg agggtctgtc acccaaatct acttctcagc 6661 ccatgaccat agttctgttt tccgtttgca aatctcagta gctctgtttt ctccaaagta 6721 gaatgtgcgc accggggtcc tagccaggcg aggtcagtgt cggcaggcta cctggtcatt 6781 attgctgcct cgtccaggct gatgctgatg gtcacaggca cggtggcatc agggagccgg 6841 gccagcaggc ggcgtgaggc ggggccagca gctcactgca agggcatttt ccacctgatc 6901 ctggtgtgcc ccacatgcgg tggcagggca gacgtgtgaa gcctcggccg tctcggggct 6961 ggcaggtgtg cgggtgagga ggccccggtg gccaagcaga gcctgcgttt catttctcct 7021 gctgcactgt gtctagtctg tcttgtgaac tctcaccgtg aaaagaggct agaagtccag 7081 gatcgctgta ccgctcctgt aattaggtga tgactggatt tgacaactta gtcccctcag 7141 acaagtaaga taccctccaa cagcaaattc aatgacttaa ttggaaaaca cacaagctgg 7201 catgatgtcc ggtgatttct gtaagaaatg cctgtaggag aaggtctgtg aagtgtggag 7261 ggcagtgtcg acgctgcaca gcatctgcag attcgcagcc tcttctctgc cggtgcctct 7321 gttcggttct gttacccaaa aacaaagacc aaagaaggcc aatctctcat ttgaccctgt 7381 ctttttaatc tgcctgtttt aaaagttgcg tctgtagtag ccgcttgctg tgaagacaca 7441 tcttgacagt ccaagtgatt ttgtgaccag tgatttgggt cctgttttcc gctcttctaa 7501 gaaaaaacaa aaagaccgtg agttattgcc cagcaataat catgttgtta ctgtgagtta 7561 gcaacatgcc tgacttcctg atagcattac tgttttctag ttttgtttat tgtatattat 7621 gtgtggtttt atttggtatt tatttgtgtt ttgaggtctt gcaatgtttt tgtgtttctg 7681 atgctaataa ctaaagtttg taagactgta gaatgcaaaa ctcggagatg ctaaactgtc 7741 ttattagagg aaaataaatc tgattatgga gtctcaaaaa aaaaaaaaaa aaa
SEP ID NO: 20 Human TRAF3 Transcript Variant 3 cDNA Sequence (NM 003300.3, CDS region from position 215-1921)
1 gggagcgcgg cgcggccgcc gcgtgcgcga gccggggttg cagcccagcc gggactttcc 61 agccggcggc agccgcggcg gccgccggct cttccccgcc ccccgccatg gggcagcccg
121 gggagcagaa cgctgcggac cgcggcggag gacgcgcccg gcgcccctga gccggccgag 181 cggcgacgga ccgcgagaac tcctctttcc taaaatggag tcgagtaaaa agatggactc 241 tcctggcgcg ctgcagacta acccgccgct aaagctgcac actgaccgca gtgctgggac 301 gccagttttt gtccctgaac aaggaggtta caaggaaaag tttgtgaaga ccgtggagga 361 caagtacaag tgtgagaagt gccacctggt gctgtgcagc ccgaagcaga ccgagtgtgg 421 gcaccgcttc tgcgagagct gcatggcggc cctgctgagc tcttcaagtc caaaatgtac 481 agcgtgtcaa gagagcatcg ttaaagataa ggtgtttaag gataattgct gcaagagaga 541 aattctggct cttcagatct attgtcggaa tgaaagcaga ggttgtgcag agcagttaat 601 gctgggacat ctgctggtgc atttaaaaaa tgattgccat tttgaagaac ttccatgtgt 661 gcgtcctgac tgcaaagaaa aggtcttgag gaaagacctg cgagaccacg tggagaaggc 721 gtgtaaatac cgggaagcca catgcagcca ctgcaagagt caggttccga tgatcgcgct 781 gcagaaacac gaagacaccg actgtccctg cgtggtggtg tcctgccctc acaagtgcag 841 cgtccagact ctcctgagga gcgagttgag tgcacacttg tcagagtgtg tcaatgcccc 901 cagcacctgt agttttaagc gctatggctg cgtttttcag gggacaaacc agcagatcaa 961 ggcccacgag gccagctccg ccgtgcagca cgtcaacctg ctgaaggagt ggagcaactc 1021 gctcgaaaag aaggtttcct tgttgcagaa tgaaagtgta gaaaaaaaca agagcataca 1081 aagtttgcac aatcagatat gtagctttga aattgaaatt gagagacaaa aggaaatgct 1141 tcgaaataat gaatccaaaa tccttcattt acagcgagtg atagacagcc aagcagagaa 1201 actgaaggag cttgacaagg agatccggcc cttccggcag aactgggagg aagcagacag 1261 catgaagagc agcgtggagt ccctccagaa ccgcgtgacc gagctggaga gcgtggacaa 1321 gagcgcgggg caagtggctc ggaacacagg cctgctggag tcccagctga gccggcatga 1381 ccagatgctg agtgtgcacg acatccgcct agccgacatg gacctgcgct tccaggtcct 1441 ggagaccgcc agctacaatg gagtgctcat ctggaagatt cgcgactaca agcggcggaa 1501 gcaggaggcc gtcatgggga agaccctgtc cctttacagc cagcctttct acactggtta 1561 ctttggctat aagatgtgtg ccagggtcta cctgaacggg gacgggatgg ggaaggggac 1621 gcacttgtcg ctgttttttg tcatcatgcg tggagaatat gatgccctgc ttccttggcc 1681 gtttaagcag aaagtgacac tcatgctgat ggatcagggg tcctctcgac gtcatttggg 1741 agatgcattc aagcccgacc ccaacagcag cagcttcaag aagcccactg gagagatgaa 1801 tatcgcctct ggctgcccag tctttgtggc ccaaactgtt ctagaaaatg ggacatatat 1861 taaagatgat acaattttta ttaaagtcat agtggatact tcggatctgc ccgatccctg 1921 ataagtagct ggggaggtgg atttagcaga aggcaactcc tctgggggat ttgaaccggt 1981 ctgtcttcac tgaggtcctc gcgctcagaa aaggaccttg tgagacggag gaagcggcag 2041 aaggcggacg cgtgccggcg ggaggagcca cgcgtgagca cacctgacac gttttataat 2101 agactagcca cacttcactc tgaagaatta tttatccttc aacaagataa atattgctgt 2161 cagagaaggt tttcattttc atttttaaag atctagttaa ttaaggtgga aaacatatat 2221 gctaaacaaa agaaacatga tttttcttcc ttaaacttga acaccaaaaa aacacacaca 2281 cacacacacg tggggatagc tggacatgtc agcatgttaa gtaaaaggag aatttatgaa 2341 atagtaatgc aattctgata tcttctttct aaaattcaag agtgcaattt tgtttcaaat 2401 acagtatatt gtctattttt aaggcctcat ctggtctctg ttttaataat ttgtttgtca 2461 gaagaccctg aagtatatac ctaggtcttt tttttgaaag tctctaaatt cagaatcatt 2521 ttttaattta aagttctaca aataattgtt actgcaaaca ttttatttta aaacgttgat 2581 agactgatat ttcttggaag aaaatataaa atatcaaaca ctggttatca cttgtgatag 2641 gaaagagaat attcaacctg ttgttatttc tcgttagaaa tgtaaacctt caaatatctg 2701 tcgtagttaa tgacacgact tcacaattct gaacggagcc tcgctcatgg atgctgtgca 2761 tcattttcag atttataatt gttttcaccc taaaataggg catccgttga actttggagt 2821 tctaaacaaa atcctgtagg tgtttggatt ctgccccatg tgttcggacg agctctctgt 2881 tgctgacagc accggccttc ggtctccatg tcaggggtgg gcgggtgact gctgagggag 2941 gcccgcaggt gtgtttctcc atcccgtcat cttgctgcat gccgtcaacg gtctccgaaa 3001 gcaacgttgt gcgtagagct ggtggcatac ggcccacgtg ccttagatgg gacatgctgc 3061 ttctccaccc tgggtttgca ttgagcatca ttctagaaag tgctagttta accagacttt 3121 tctctccacc actagatctt tgtctctaca agggccctca gacacctctg cacctgctga 3181 ggggaagcca ggctccaccg tcggcttctg gagcctccgc tgcttaatta ccacagattc 3241 caaatctcta ggccccacga gtgagccgcc tggtccaagt acggcctggt cccaccctga 3301 gggaggcagg tgtggaacag aagccgagcc tctccgtgtc cccaccgggg ccgtgggcac 3361 ccccacagcc cgaagcagaa ccctctgagc attccagaga ccgctgctcg ggggcctgcc
3421 caggctgacc aacgggcgct cctgaccacc accctggcgg gaagggtggc cacggggccc 3481 gtcgtcccag cctgtgcctg cccagatggc attttctcaa ctcactgttt actgtctctc 3541 agtgtccaac tgtgattaga agcctggagc ctgccccctg cacccctttt gctatgcacc 3601 acgcttcatg gtgctcttac cactgatggg tgctacacgc gacgggtgct tcttaggcaa 3661 aaccaatgtg tgcgaactgt cacacctgtg ccactcgccc acaagccgcg cccacaattg 3721 gccagctggg ccgtgcacgt cagactgcct gcctcggctc tccccgtggc cgcgcgggga 3781 cagcttggtg ggtgcccggt ggcccacctg tctctggtgc tgccatctgt cctgggtgtg 3841 ccttcgcccc agtgcctgct ggaagtgccc tccgtcgcac ccctgtgccc tgagctcccg 3901 tgaggggccc gccgcgccct ttcgcggtcg aagcgttccg ttgttcttat ctgcctttcc 3961 tttccccgct ctcctgggat tactttgggg gaatgagtat ccttggttct gccctgtgag 4021 ggagtcgtgt gtccctgctc ataaaggaag gacttcctgc agaagctgcg gaaaactact 4081 gttccctcga aggtgtcccc cacctgaggc ctgtccccta cctgccctca ggtagttttc 4141 ctgaggccag gggttaacaa cagggacatc cctgcaactt ccccttcaca aaatgtataa 4201 tattagatga aggatatgca acatcttggt ctagtaagaa ccgtttcctc ccctctgggt 4261 tgaagtcctg gtgtggcccc cagaagcagc agtgcgtgtc actgggacgt ctccagtagc 4321 ccttcccagg cagacgctcc tggcgggacg ccatggggcc cacctgaggg tcccacagac 4381 gtaacctgag tgacaggagt ccttgaggat gggatggcct atgtcacaca ctttgtcctt 4441 gaacctgagt gatgggggtc cttgaggatg ggatggcctg tgtcacgcgc tttgtctttg 4501 tgtttggttg tatcggggtc tctgttctga gtgtgtcttc ctctcatgta ctcaacacag 4561 tgggcagcag cctgggacgg cgtcccctct cccggcggcg ggcaagcctt gcgctgctcc 4621 accctcggcc tgggcaccct cacttggcgc tggccacctg ggccagcctg gggccatggt 4681 ctctctgcag ctgaggccca gtggcccctt gggcagtgat cggccctccc cgcatcacag 4741 ggccctggca gcaagcggga aatgggggcg cacactgtgt gcttgggggt gctgcttgtt 4801 taccacacat gaccagactc ccagcaggac agagctgctc agtactttac agaaaccaac 4861 tgagtcgttt gtgcatgaat taagccggtc tgcttccccg tcaccttcgt aacaaaacaa 4921 cgtcccctct cccctcgcct cgagcagttt cttcaggaca ccgtggctcg ggctgctccc 4981 tgctgccagg cacgctggtt ggctggcctg ggcccggctc acgtgaaggg cactggctct 5041 tgtgaccaca ctgagccacg tgcaagccgc agccgggcct ggaagcctga ccctctggtt 5101 ctagggcttg tcccgcggag cctgcagagc tagacgttgg ggtgtgtccg tgatgatatg 5161 ggggccaggc tgggagtagg gcctttctag cagggttggg tggctcagtg agggtgtgga 5221 agtgggggac ccacggggcc tggctttggg actagacatg ccagccccag ctgggctgga 5281 gggagcctga gtgagccccg acatacgctg ggcctttcag ctcgccgtgc tctggtgaca 5341 cacaggcggc caggttggga tttgtgtcaa ttctaggagc catcaagcat gaatgtggtt 5401 ctgtctcctg agcgcaagcc tcgccggacc cctgggcgaa ggcctggact tgcagatgtg 5461 tgttccctgt gcgggtggac agagggggcc cttatgaccc acattgcagc cccattccac 5521 caccccttcc tccccagagc agtctctgcc gagggacagc acctgtgtcc cttcgatgcc 5581 acaacagcca gttgaacagg ggagcccttt gctcaggcag cttctcctgc ctctccctcc 5641 tttctccttc cctgccccat ccccgtgccc ttcttggcct gtggcgctgg ggagccatgg 5701 tgtggcatac tggggctcct gctccttggg ccacttcctc agcccgggcc ccacaggccc 5761 accacctgcc agggctccca ctgcactggc tgtggcagga ggcttcccca tgaccccgtg 5821 tggcccagct cggtgaggat gcagttctag gcacagcccc tgggacagcc agctgcctcc 5881 cagaccacgt cagcctgctc cagggtcctc agtcaccctg ggccaggggc cacgtgtccc 5941 atggatgtcg accatgccaa cgtcacattc cagcacccct tttgcttgat ggcgtctggt 6001 ggtagtcagc atggtggacc cacatcctac agccagaggt gatgttggac aaaggaaggg 6061 gagtctggat gggtccttaa acgaccattc tgtccgcagc ggggtcattc cttgtcagcc 6121 caagggaggg ccggggagta cactgatccc aacagctggg ctgacacctc ctttctcccc 6181 tgcacgggga ggattggcct gaggaccgtc accctgtgca cagccccagt agggtggcag 6241 tgccactgtc tccttgggcc gttgcaggat tgggcgggtg cagactcccc ttgcgggccc 6301 cttgctcaat ccccggccct cccagactcc tccctctact gggggtaatt tgtgtgtcag 6361 aagggctctg gcagagctgt aaaatactgt tttttaaaaa ttttagtcca gatctttact 6421 tattagactg cagaaggaga gctagggaga gtgggggaag cccccttgct tttgtatctg 6481 tgaggtgaat gagggtctgt cacccaaatc tacttctcag cccatgacca tagttctgtt 6541 ttccgtttgc aaatctcagt agctctgttt tctccaaagt agaatgtgcg caccggggtc 6601 ctagccaggc gaggtcagtg tcggcaggct acctggtcat tattgctgcc tcgtccaggc 6661 tgatgctgat ggtcacaggc acggtggcat cagggagccg ggccagcagg cggcgtgagg 6721 cggggccagc agctcactgc aagggcattt tccacctgat cctggtgtgc cccacatgcg 6781 gtggcagggc agacgtgtga agcctcggcc gtctcggggc tggcaggtgt gcgggtgagg 6841 aggccccggt ggccaagcag agcctgcgtt tcatttctcc tgctgcactg tgtctagtct 6901 gtcttgtgaa ctctcaccgt gaaaagaggc tagaagtcca ggatcgctgt accgctcctg 6961 taattaggtg atgactggat ttgacaactt agtcccctca gacaagtaag ataccctcca 7021 acagcaaatt caatgactta attggaaaac acacaagctg gcatgatgtc cggtgatttc
7081 tgtaagaaat gcctgtagga gaaggtctgt gaagtgtgga gggcagtgtc gacgctgcac 7141 agcatctgca gattcgcagc ctcttctctg ccggtgcctc tgttcggttc tgttacccaa 7201 aaacaaagac caaagaaggc caatctctca tttgaccctg tctttttaat ctgcctgttt 7261 taaaagttgc gtctgtagta gccgcttgct gtgaagacac atcttgacag tccaagtgat 7321 tttgtgacca gtgatttggg tcctgttttc cgctcttcta agaaaaaaca aaaagaccgt 7381 gagttattgc ccagcaataa tcatgttgtt actgtgagtt agcaacatgc ctgacttcct 7441 gatagcatta ctgttttcta gttttgttta ttgtatatta tgtgtggttt tatttggtat 7501 ttatttgtgt tttgaggtct tgcaatgttt ttgtgtttct gatgctaata actaaagttt 7561 gtaagactgt agaatgcaaa actcggagat gctaaactgt cttattagag gaaaataaat 7621 ctgattatgg agtctcaaaa aaaaaaaaaa aaaa
SEP ID NO: 21 Human TRAF3 Isoform 1 Amino Acid Sequence (NP 663777.1)
1 messkkmdsp galqtnpplk lhtdrsagtp vfvpeqggyk ekfvktvedk ykcekchlvl
61 cspkqtecgh rfcescmaal lsssspkcta cqesivkdkv fkdncckrei lalqiycrne
121 srgcaeqlml ghllvhlknd chfeelpcvr pdckekvlrk dlrdhvekac kyreatcshc
181 ksqvpmialq khedtdcpcv vvscphkcsv qtllrselsa hlsecvnaps tcs fkrygcv
241 fqgtnqqika heassavqhv nllkewsnsl ekkvsllqne sveknksiqs lhnqics fei
301 eierqkemlr nneskilhlq rvidsqaekl keldkeirpf rqnweeadsm kssveslqnr
361 vtelesvdks agqvarntgl lesqlsrhdq mlsvhdirla dmdlrfqvle tasyngvliw
421 kirdykrrkq eavmgktlsl ysqpfytgyf gykmcarvyl ngdgmgkgth lslffvimrg
481 eydallpwpf kqkvtlmlmd qgssrrhlgd afkpdpnsss fkkptgemni asgcpvfvaq
541 tvlengtyik ddtifikviv dtsdlpdp
SEP ID NO: 22 Human TRAF3 Transcript Variant 2 cDNA Sequence
(NM 145726.2, CDS region from position 354-1985)
1 gggagcgcgg cgcggccgcc gcgtgcgcga gccggggttg cagcccagcc gggactttcc 61 agccggcggc agccgcggcg gccgccggct cttccccgcc ccccgccatg gggcagcccg 121 gggagcagaa cgctgcggac cgcggcggag gacgcgcccg gcgcccctga gccggccgag 181 cggcgacgga ccgcgagatg aggaaaatga ggcccaaaga agtgatgcca cttggttaag 241 gtcccagagc aggtcagaat cagacctagg atcagaaacc tggctcctgg ctcctggctc 301 cctactcttc taaggatcgc tgtcctgaca gaagagaact cctctttcct aaaatggagt 361 cgagtaaaaa gatggactct cctggcgcgc tgcagactaa cccgccgcta aagctgcaca 421 ctgaccgcag tgctgggacg ccagtttttg tccctgaaca aggaggttac aaggaaaagt 481 ttgtgaagac cgtggaggac aagtacaagt gtgagaagtg ccacctggtg ctgtgcagcc 541 cgaagcagac cgagtgtggg caccgcttct gcgagagctg catggcggcc ctgctgagct 601 cttcaagtcc aaaatgtaca gcgtgtcaag agagcatcgt taaagataag gtgtttaagg 661 ataattgctg caagagagaa attctggctc ttcagatcta ttgtcggaat gaaagcagag 721 gttgtgcaga gcagttaatg ctgggacatc tgctggtgca tttaaaaaat gattgccatt 781 ttgaagaact tccatgtgtg cgtcctgact gcaaagaaaa ggtcttgagg aaagacctgc 841 gagaccacgt ggagaaggcg tgtaaatacc gggaagccac atgcagccac tgcaagagtc 901 aggttccgat gatcgcgctg cagaaacacg aagacaccga ctgtccctgc gtggtggtgt 961 cctgccctca caagtgcagc gtccagactc tcctgaggag cgaggggaca aaccagcaga 1021 tcaaggccca cgaggccagc tccgccgtgc agcacgtcaa cctgctgaag gagtggagca 1081 actcgctcga aaagaaggtt tccttgttgc agaatgaaag tgtagaaaaa aacaagagca 1141 tacaaagttt gcacaatcag atatgtagct ttgaaattga aattgagaga caaaaggaaa 1201 tgcttcgaaa taatgaatcc aaaatccttc atttacagcg agtgatagac agccaagcag 1261 agaaactgaa ggagcttgac aaggagatcc ggcccttccg gcagaactgg gaggaagcag 1321 acagcatgaa gagcagcgtg gagtccctcc agaaccgcgt gaccgagctg gagagcgtgg 1381 acaagagcgc ggggcaagtg gctcggaaca caggcctgct ggagtcccag ctgagccggc 1441 atgaccagat gctgagtgtg cacgacatcc gcctagccga catggacctg cgcttccagg 1501 tcctggagac cgccagctac aatggagtgc tcatctggaa gattcgcgac tacaagcggc 1561 ggaagcagga ggccgtcatg gggaagaccc tgtcccttta cagccagcct ttctacactg 1621 gttactttgg ctataagatg tgtgccaggg tctacctgaa cggggacggg atggggaagg 1681 ggacgcactt gtcgctgttt tttgtcatca tgcgtggaga atatgatgcc ctgcttcctt 1741 ggccgtttaa gcagaaagtg acactcatgc tgatggatca ggggtcctct cgacgtcatt 1801 tgggagatgc attcaagccc gaccccaaca gcagcagctt caagaagccc actggagaga 1861 tgaatatcgc ctctggctgc ccagtctttg tggcccaaac tgttctagaa aatgggacat 1921 atattaaaga tgatacaatt tttattaaag tcatagtgga tacttcggat ctgcccgatc 1981 cctgataagt agctggggag gtggatttag cagaaggcaa ctcctctggg ggatttgaac 2041 cggtctgtct tcactgaggt cctcgcgctc agaaaaggac cttgtgagac ggaggaagcg
2101 gcagaaggcg gacgcgtgcc ggcgggagga gccacgcgtg agcacacctg acacgtttta 2161 taatagacta gccacacttc actctgaaga attatttatc cttcaacaag ataaatattg 2221 ctgtcagaga aggttttcat tttcattttt aaagatctag ttaattaagg tggaaaacat 2281 atatgctaaa caaaagaaac atgatttttc ttccttaaac ttgaacacca aaaaaacaca 2341 cacacacaca cacgtgggga tagctggaca tgtcagcatg ttaagtaaaa ggagaattta 2401 tgaaatagta atgcaattct gatatcttct ttctaaaatt caagagtgca attttgtttc 2461 aaatacagta tattgtctat ttttaaggcc tcatctggtc tctgttttaa taatttgttt 2521 gtcagaagac cctgaagtat atacctaggt cttttttttg aaagtctcta aattcagaat 2581 cattttttaa tttaaagttc tacaaataat tgttactgca aacattttat tttaaaacgt 2641 tgatagactg atatttcttg gaagaaaata taaaatatca aacactggtt atcacttgtg 2701 ataggaaaga gaatattcaa cctgttgtta tttctcgtta gaaatgtaaa ccttcaaata 2761 tctgtcgtag ttaatgacac gacttcacaa ttctgaacgg agcctcgctc atggatgctg 2821 tgcatcattt tcagatttat aattgttttc accctaaaat agggcatccg ttgaactttg 2881 gagttctaaa caaaatcctg taggtgtttg gattctgccc catgtgttcg gacgagctct 2941 ctgttgctga cagcaccggc cttcggtctc catgtcaggg gtgggcgggt gactgctgag 3001 ggaggcccgc aggtgtgttt ctccatcccg tcatcttgct gcatgccgtc aacggtctcc 3061 gaaagcaacg ttgtgcgtag agctggtggc atacggccca cgtgccttag atgggacatg 3121 ctgcttctcc accctgggtt tgcattgagc atcattctag aaagtgctag tttaaccaga 3181 cttttctctc caccactaga tctttgtctc tacaagggcc ctcagacacc tctgcacctg 3241 ctgaggggaa gccaggctcc accgtcggct tctggagcct ccgctgctta attaccacag 3301 attccaaatc tctaggcccc acgagtgagc cgcctggtcc aagtacggcc tggtcccacc 3361 ctgagggagg caggtgtgga acagaagccg agcctctccg tgtccccacc ggggccgtgg 3421 gcacccccac agcccgaagc agaaccctct gagcattcca gagaccgctg ctcgggggcc 3481 tgcccaggct gaccaacggg cgctcctgac caccaccctg gcgggaaggg tggccacggg 3541 gcccgtcgtc ccagcctgtg cctgcccaga tggcattttc tcaactcact gtttactgtc 3601 tctcagtgtc caactgtgat tagaagcctg gagcctgccc cctgcacccc ttttgctatg 3661 caccacgctt catggtgctc ttaccactga tgggtgctac acgcgacggg tgcttcttag 3721 gcaaaaccaa tgtgtgcgaa ctgtcacacc tgtgccactc gcccacaagc cgcgcccaca 3781 attggccagc tgggccgtgc acgtcagact gcctgcctcg gctctccccg tggccgcgcg 3841 gggacagctt ggtgggtgcc cggtggccca cctgtctctg gtgctgccat ctgtcctggg 3901 tgtgccttcg ccccagtgcc tgctggaagt gccctccgtc gcacccctgt gccctgagct 3961 cccgtgaggg gcccgccgcg ccctttcgcg gtcgaagcgt tccgttgttc ttatctgcct 4021 ttcctttccc cgctctcctg ggattacttt gggggaatga gtatccttgg ttctgccctg 4081 tgagggagtc gtgtgtccct gctcataaag gaaggacttc ctgcagaagc tgcggaaaac 4141 tactgttccc tcgaaggtgt cccccacctg aggcctgtcc cctacctgcc ctcaggtagt 4201 tttcctgagg ccaggggtta acaacaggga catccctgca acttcccctt cacaaaatgt 4261 ataatattag atgaaggata tgcaacatct tggtctagta agaaccgttt cctcccctct 4321 gggttgaagt cctggtgtgg cccccagaag cagcagtgcg tgtcactggg acgtctccag 4381 tagcccttcc caggcagacg ctcctggcgg gacgccatgg ggcccacctg agggtcccac 4441 agacgtaacc tgagtgacag gagtccttga ggatgggatg gcctatgtca cacactttgt 4501 ccttgaacct gagtgatggg ggtccttgag gatgggatgg cctgtgtcac gcgctttgtc 4561 tttgtgtttg gttgtatcgg ggtctctgtt ctgagtgtgt cttcctctca tgtactcaac 4621 acagtgggca gcagcctggg acggcgtccc ctctcccggc ggcgggcaag ccttgcgctg 4681 ctccaccctc ggcctgggca ccctcacttg gcgctggcca cctgggccag cctggggcca 4741 tggtctctct gcagctgagg cccagtggcc ccttgggcag tgatcggccc tccccgcatc 4801 acagggccct ggcagcaagc gggaaatggg ggcgcacact gtgtgcttgg gggtgctgct 4861 tgtttaccac acatgaccag actcccagca ggacagagct gctcagtact ttacagaaac 4921 caactgagtc gtttgtgcat gaattaagcc ggtctgcttc cccgtcacct tcgtaacaaa 4981 acaacgtccc ctctcccctc gcctcgagca gtttcttcag gacaccgtgg ctcgggctgc 5041 tccctgctgc caggcacgct ggttggctgg cctgggcccg gctcacgtga agggcactgg 5101 ctcttgtgac cacactgagc cacgtgcaag ccgcagccgg gcctggaagc ctgaccctct 5161 ggttctaggg cttgtcccgc ggagcctgca gagctagacg ttggggtgtg tccgtgatga 5221 tatgggggcc aggctgggag tagggccttt ctagcagggt tgggtggctc agtgagggtg 5281 tggaagtggg ggacccacgg ggcctggctt tgggactaga catgccagcc ccagctgggc 5341 tggagggagc ctgagtgagc cccgacatac gctgggcctt tcagctcgcc gtgctctggt 5401 gacacacagg cggccaggtt gggatttgtg tcaattctag gagccatcaa gcatgaatgt 5461 ggttctgtct cctgagcgca agcctcgccg gacccctggg cgaaggcctg gacttgcaga 5521 tgtgtgttcc ctgtgcgggt ggacagaggg ggcccttatg acccacattg cagccccatt 5581 ccaccacccc ttcctcccca gagcagtctc tgccgaggga cagcacctgt gtcccttcga 5641 tgccacaaca gccagttgaa caggggagcc ctttgctcag gcagcttctc ctgcctctcc 5701 ctcctttctc cttccctgcc ccatccccgt gcccttcttg gcctgtggcg ctggggagcc
5761 atggtgtggc atactggggc tcctgctcct tgggccactt cctcagcccg ggccccacag 5821 gcccaccacc tgccagggct cccactgcac tggctgtggc aggaggcttc cccatgaccc 5881 cgtgtggccc agctcggtga ggatgcagtt ctaggcacag cccctgggac agccagctgc 5941 ctcccagacc acgtcagcct gctccagggt cctcagtcac cctgggccag gggccacgtg 6001 tcccatggat gtcgaccatg ccaacgtcac attccagcac cccttttgct tgatggcgtc 6061 tggtggtagt cagcatggtg gacccacatc ctacagccag aggtgatgtt ggacaaagga 6121 aggggagtct ggatgggtcc ttaaacgacc attctgtccg cagcggggtc attccttgtc 6181 agcccaaggg agggccgggg agtacactga tcccaacagc tgggctgaca cctcctttct 6241 cccctgcacg gggaggattg gcctgaggac cgtcaccctg tgcacagccc cagtagggtg 6301 gcagtgccac tgtctccttg ggccgttgca ggattgggcg ggtgcagact ccccttgcgg 6361 gccccttgct caatccccgg ccctcccaga ctcctccctc tactgggggt aatttgtgtg 6421 tcagaagggc tctggcagag ctgtaaaata ctgtttttta aaaattttag tccagatctt 6481 tacttattag actgcagaag gagagctagg gagagtgggg gaagccccct tgcttttgta 6541 tctgtgaggt gaatgagggt ctgtcaccca aatctacttc tcagcccatg accatagttc 6601 tgttttccgt ttgcaaatct cagtagctct gttttctcca aagtagaatg tgcgcaccgg 6661 ggtcctagcc aggcgaggtc agtgtcggca ggctacctgg tcattattgc tgcctcgtcc 6721 aggctgatgc tgatggtcac aggcacggtg gcatcaggga gccgggccag caggcggcgt 6781 gaggcggggc cagcagctca ctgcaagggc attttccacc tgatcctggt gtgccccaca 6841 tgcggtggca gggcagacgt gtgaagcctc ggccgtctcg gggctggcag gtgtgcgggt 6901 gaggaggccc cggtggccaa gcagagcctg cgtttcattt ctcctgctgc actgtgtcta 6961 gtctgtcttg tgaactctca ccgtgaaaag aggctagaag tccaggatcg ctgtaccgct 7021 cctgtaatta ggtgatgact ggatttgaca acttagtccc ctcagacaag taagataccc 7081 tccaacagca aattcaatga cttaattgga aaacacacaa gctggcatga tgtccggtga 7141 tttctgtaag aaatgcctgt aggagaaggt ctgtgaagtg tggagggcag tgtcgacgct 7201 gcacagcatc tgcagattcg cagcctcttc tctgccggtg cctctgttcg gttctgttac 7261 ccaaaaacaa agaccaaaga aggccaatct ctcatttgac cctgtctttt taatctgcct 7321 gttttaaaag ttgcgtctgt agtagccgct tgctgtgaag acacatcttg acagtccaag 7381 tgattttgtg accagtgatt tgggtcctgt tttccgctct tctaagaaaa aacaaaaaga 7441 ccgtgagtta ttgcccagca ataatcatgt tgttactgtg agttagcaac atgcctgact 7501 tcctgatagc attactgttt tctagttttg tttattgtat attatgtgtg gttttatttg 7561 gtatttattt gtgttttgag gtcttgcaat gtttttgtgt ttctgatgct aataactaaa 7621 gtttgtaaga ctgtagaatg caaaactcgg agatgctaaa ctgtcttatt agaggaaaat 7681 aaatctgatt atggagtctc aaaaaaaaaa aaaaaaaa
SEP ID NO: 23 Human TRAF3 Isoform 2 Amino Acid Sequence (NP 663778.1)
1 messkkmdsp galqtnpplk lhtdrsagtp vfvpeqggyk ekfvktvedk ykcekchlvl 61 cspkqtecgh rfcescmaal lsssspkcta cqesivkdkv fkdncckrei lalqiycrne 121 srgcaeqlml ghllvhlknd chfeelpcvr pdckekvlrk dlrdhvekac kyreatcshc 181 ksqvpmialq khedtdcpcv vvscphkcsv qtllrsegtn qqikaheass avqhvnllke 241 wsnslekkvs llqnesvekn ksiqslhnqi csfeieierq kemlrnnesk ilhlqrvids 301 qaeklkeldk eirpfrqnwe eadsmkssve slqnrvtele svdksagqva rntgllesql 361 srhdqmlsvh dirladmdlr fqvletasyn gvliwkirdy krrkqeavmg ktlslysqpf 421 ytgyfgykmc arvylngdgm gkgthlslff vimrgeydal lpwpfkqkvt lmlmdqgssr 481 rhlgdafkpd pnsssfkkpt gemniasgcp vfvaqtvlen gtyikddtif ikvivdtsdl 541 pdp
SEP ID NO: 24 Human TRAF3 Transcript Variant 4 cDNA Sequence
(NM 001199427.1, CDS region from position 215-1672)
1 gggagcgcgg cgcggccgcc gcgtgcgcga gccggggttg cagcccagcc gggactttcc 61 agccggcggc agccgcggcg gccgccggct cttccccgcc ccccgccatg gggcagcccg 121 gggagcagaa cgctgcggac cgcggcggag gacgcgcccg gcgcccctga gccggccgag 181 cggcgacgga ccgcgagaac tcctctttcc taaaatggag tcgagtaaaa agatggactc 241 tcctggcgcg ctgcagacta acccgccgct aaagctgcac actgaccgca gtgctgggac 301 gccagttttt gtccctgaac aaggaggtta caaggaaaag tttgtgaaga ccgtggagga 361 caagtacaag tgtgagaagt gccacctggt gctgtgcagc ccgaagcaga ccgagtgtgg 421 gcaccgcttc tgcgagagct gcatggcggc cctgctgagc tcttcaagtc caaaatgtac 481 agcgtgtcaa gagagcatcg ttaaagataa ggtgtttaag gataattgct gcaagagaga 541 aattctggct cttcagatct attgtcggaa tgaaagcaga ggttgtgcag agcagttaat 601 gctgggacat ctgctggtgc atttaaaaaa tgattgccat tttgaagaac ttccatgtgt 661 gcgtcctgac tgcaaagaaa aggtcttgag gaaagacctg cgagaccacg tggagaaggc
721 gtgtaaatac cgggaagcca catgcagcca ctgcaagagt caggttccga tgatcgcgct 781 gcaggtttcc ttgttgcaga atgaaagtgt agaaaaaaac aagagcatac aaagtttgca 841 caatcagata tgtagctttg aaattgaaat tgagagacaa aaggaaatgc ttcgaaataa 901 tgaatccaaa atccttcatt tacagcgagt gatagacagc caagcagaga aactgaagga 961 gcttgacaag gagatccggc ccttccggca gaactgggag gaagcagaca gcatgaagag 1021 cagcgtggag tccctccaga accgcgtgac cgagctggag agcgtggaca agagcgcggg 1081 gcaagtggct cggaacacag gcctgctgga gtcccagctg agccggcatg accagatgct 1141 gagtgtgcac gacatccgcc tagccgacat ggacctgcgc ttccaggtcc tggagaccgc 1201 cagctacaat ggagtgctca tctggaagat tcgcgactac aagcggcgga agcaggaggc 1261 cgtcatgggg aagaccctgt ccctttacag ccagcctttc tacactggtt actttggcta 1321 taagatgtgt gccagggtct acctgaacgg ggacgggatg gggaagggga cgcacttgtc 1381 gctgtttttt gtcatcatgc gtggagaata tgatgccctg cttccttggc cgtttaagca 1441 gaaagtgaca ctcatgctga tggatcaggg gtcctctcga cgtcatttgg gagatgcatt 1501 caagcccgac cccaacagca gcagcttcaa gaagcccact ggagagatga atatcgcctc 1561 tggctgccca gtctttgtgg cccaaactgt tctagaaaat gggacatata ttaaagatga 1621 tacaattttt attaaagtca tagtggatac ttcggatctg cccgatccct gataagtagc 1681 tggggaggtg gatttagcag aaggcaactc ctctggggga tttgaaccgg tctgtcttca 1741 ctgaggtcct cgcgctcaga aaaggacctt gtgagacgga ggaagcggca gaaggcggac 1801 gcgtgccggc gggaggagcc acgcgtgagc acacctgaca cgttttataa tagactagcc 1861 acacttcact ctgaagaatt atttatcctt caacaagata aatattgctg tcagagaagg 1921 ttttcatttt catttttaaa gatctagtta attaaggtgg aaaacatata tgctaaacaa 1981 aagaaacatg atttttcttc cttaaacttg aacaccaaaa aaacacacac acacacacac 2041 gtggggatag ctggacatgt cagcatgtta agtaaaagga gaatttatga aatagtaatg 2101 caattctgat atcttctttc taaaattcaa gagtgcaatt ttgtttcaaa tacagtatat 2161 tgtctatttt taaggcctca tctggtctct gttttaataa tttgtttgtc agaagaccct 2221 gaagtatata cctaggtctt ttttttgaaa gtctctaaat tcagaatcat tttttaattt 2281 aaagttctac aaataattgt tactgcaaac attttatttt aaaacgttga tagactgata 2341 tttcttggaa gaaaatataa aatatcaaac actggttatc acttgtgata ggaaagagaa 2401 tattcaacct gttgttattt ctcgttagaa atgtaaacct tcaaatatct gtcgtagtta 2461 atgacacgac ttcacaattc tgaacggagc ctcgctcatg gatgctgtgc atcattttca 2521 gatttataat tgttttcacc ctaaaatagg gcatccgttg aactttggag ttctaaacaa 2581 aatcctgtag gtgtttggat tctgccccat gtgttcggac gagctctctg ttgctgacag 2641 caccggcctt cggtctccat gtcaggggtg ggcgggtgac tgctgaggga ggcccgcagg 2701 tgtgtttctc catcccgtca tcttgctgca tgccgtcaac ggtctccgaa agcaacgttg 2761 tgcgtagagc tggtggcata cggcccacgt gccttagatg ggacatgctg cttctccacc 2821 ctgggtttgc attgagcatc attctagaaa gtgctagttt aaccagactt ttctctccac 2881 cactagatct ttgtctctac aagggccctc agacacctct gcacctgctg aggggaagcc 2941 aggctccacc gtcggcttct ggagcctccg ctgcttaatt accacagatt ccaaatctct 3001 aggccccacg agtgagccgc ctggtccaag tacggcctgg tcccaccctg agggaggcag 3061 gtgtggaaca gaagccgagc ctctccgtgt ccccaccggg gccgtgggca cccccacagc 3121 ccgaagcaga accctctgag cattccagag accgctgctc gggggcctgc ccaggctgac 3181 caacgggcgc tcctgaccac caccctggcg ggaagggtgg ccacggggcc cgtcgtccca 3241 gcctgtgcct gcccagatgg cattttctca actcactgtt tactgtctct cagtgtccaa 3301 ctgtgattag aagcctggag cctgccccct gcaccccttt tgctatgcac cacgcttcat 3361 ggtgctctta ccactgatgg gtgctacacg cgacgggtgc ttcttaggca aaaccaatgt 3421 gtgcgaactg tcacacctgt gccactcgcc cacaagccgc gcccacaatt ggccagctgg 3481 gccgtgcacg tcagactgcc tgcctcggct ctccccgtgg ccgcgcgggg acagcttggt 3541 gggtgcccgg tggcccacct gtctctggtg ctgccatctg tcctgggtgt gccttcgccc 3601 cagtgcctgc tggaagtgcc ctccgtcgca cccctgtgcc ctgagctccc gtgaggggcc 3661 cgccgcgccc tttcgcggtc gaagcgttcc gttgttctta tctgcctttc ctttccccgc 3721 tctcctggga ttactttggg ggaatgagta tccttggttc tgccctgtga gggagtcgtg 3781 tgtccctgct cataaaggaa ggacttcctg cagaagctgc ggaaaactac tgttccctcg 3841 aaggtgtccc ccacctgagg cctgtcccct acctgccctc aggtagtttt cctgaggcca 3901 ggggttaaca acagggacat ccctgcaact tccccttcac aaaatgtata atattagatg 3961 aaggatatgc aacatcttgg tctagtaaga accgtttcct cccctctggg ttgaagtcct 4021 ggtgtggccc ccagaagcag cagtgcgtgt cactgggacg tctccagtag cccttcccag 4081 gcagacgctc ctggcgggac gccatggggc ccacctgagg gtcccacaga cgtaacctga 4141 gtgacaggag tccttgagga tgggatggcc tatgtcacac actttgtcct tgaacctgag 4201 tgatgggggt ccttgaggat gggatggcct gtgtcacgcg ctttgtcttt gtgtttggtt 4261 gtatcggggt ctctgttctg agtgtgtctt cctctcatgt actcaacaca gtgggcagca 4321 gcctgggacg gcgtcccctc tcccggcggc gggcaagcct tgcgctgctc caccctcggc
4381 ctgggcaccc tcacttggcg ctggccacct gggccagcct ggggccatgg tctctctgca 4441 gctgaggccc agtggcccct tgggcagtga tcggccctcc ccgcatcaca gggccctggc 4501 agcaagcggg aaatgggggc gcacactgtg tgcttggggg tgctgcttgt ttaccacaca 4561 tgaccagact cccagcagga cagagctgct cagtacttta cagaaaccaa ctgagtcgtt 4621 tgtgcatgaa ttaagccggt ctgcttcccc gtcaccttcg taacaaaaca acgtcccctc 4681 tcccctcgcc tcgagcagtt tcttcaggac accgtggctc gggctgctcc ctgctgccag 4741 gcacgctggt tggctggcct gggcccggct cacgtgaagg gcactggctc ttgtgaccac 4801 actgagccac gtgcaagccg cagccgggcc tggaagcctg accctctggt tctagggctt 4861 gtcccgcgga gcctgcagag ctagacgttg gggtgtgtcc gtgatgatat gggggccagg 4921 ctgggagtag ggcctttcta gcagggttgg gtggctcagt gagggtgtgg aagtggggga 4981 cccacggggc ctggctttgg gactagacat gccagcccca gctgggctgg agggagcctg 5041 agtgagcccc gacatacgct gggcctttca gctcgccgtg ctctggtgac acacaggcgg 5101 ccaggttggg atttgtgtca attctaggag ccatcaagca tgaatgtggt tctgtctcct 5161 gagcgcaagc ctcgccggac ccctgggcga aggcctggac ttgcagatgt gtgttccctg 5221 tgcgggtgga cagagggggc ccttatgacc cacattgcag ccccattcca ccaccccttc 5281 ctccccagag cagtctctgc cgagggacag cacctgtgtc ccttcgatgc cacaacagcc 5341 agttgaacag gggagccctt tgctcaggca gcttctcctg cctctccctc ctttctcctt 5401 ccctgcccca tccccgtgcc cttcttggcc tgtggcgctg gggagccatg gtgtggcata 5461 ctggggctcc tgctccttgg gccacttcct cagcccgggc cccacaggcc caccacctgc 5521 cagggctccc actgcactgg ctgtggcagg aggcttcccc atgaccccgt gtggcccagc 5581 tcggtgagga tgcagttcta ggcacagccc ctgggacagc cagctgcctc ccagaccacg 5641 tcagcctgct ccagggtcct cagtcaccct gggccagggg ccacgtgtcc catggatgtc 5701 gaccatgcca acgtcacatt ccagcacccc ttttgcttga tggcgtctgg tggtagtcag 5761 catggtggac ccacatccta cagccagagg tgatgttgga caaaggaagg ggagtctgga 5821 tgggtcctta aacgaccatt ctgtccgcag cggggtcatt ccttgtcagc ccaagggagg 5881 gccggggagt acactgatcc caacagctgg gctgacacct cctttctccc ctgcacgggg 5941 aggattggcc tgaggaccgt caccctgtgc acagccccag tagggtggca gtgccactgt 6001 ctccttgggc cgttgcagga ttgggcgggt gcagactccc cttgcgggcc ccttgctcaa 6061 tccccggccc tcccagactc ctccctctac tgggggtaat ttgtgtgtca gaagggctct 6121 ggcagagctg taaaatactg ttttttaaaa attttagtcc agatctttac ttattagact 6181 gcagaaggag agctagggag agtgggggaa gcccccttgc ttttgtatct gtgaggtgaa 6241 tgagggtctg tcacccaaat ctacttctca gcccatgacc atagttctgt tttccgtttg 6301 caaatctcag tagctctgtt ttctccaaag tagaatgtgc gcaccggggt cctagccagg 6361 cgaggtcagt gtcggcaggc tacctggtca ttattgctgc ctcgtccagg ctgatgctga 6421 tggtcacagg cacggtggca tcagggagcc gggccagcag gcggcgtgag gcggggccag 6481 cagctcactg caagggcatt ttccacctga tcctggtgtg ccccacatgc ggtggcaggg 6541 cagacgtgtg aagcctcggc cgtctcgggg ctggcaggtg tgcgggtgag gaggccccgg 6601 tggccaagca gagcctgcgt ttcatttctc ctgctgcact gtgtctagtc tgtcttgtga 6661 actctcaccg tgaaaagagg ctagaagtcc aggatcgctg taccgctcct gtaattaggt 6721 gatgactgga tttgacaact tagtcccctc agacaagtaa gataccctcc aacagcaaat 6781 tcaatgactt aattggaaaa cacacaagct ggcatgatgt ccggtgattt ctgtaagaaa 6841 tgcctgtagg agaaggtctg tgaagtgtgg agggcagtgt cgacgctgca cagcatctgc 6901 agattcgcag cctcttctct gccggtgcct ctgttcggtt ctgttaccca aaaacaaaga 6961 ccaaagaagg ccaatctctc atttgaccct gtctttttaa tctgcctgtt ttaaaagttg 7021 cgtctgtagt agccgcttgc tgtgaagaca catcttgaca gtccaagtga ttttgtgacc 7081 agtgatttgg gtcctgtttt ccgctcttct aagaaaaaac aaaaagaccg tgagttattg 7141 cccagcaata atcatgttgt tactgtgagt tagcaacatg cctgacttcc tgatagcatt 7201 actgttttct agttttgttt attgtatatt atgtgtggtt ttatttggta tttatttgtg 7261 ttttgaggtc ttgcaatgtt tttgtgtttc tgatgctaat aactaaagtt tgtaagactg 7321 tagaatgcaa aactcggaga tgctaaactg tcttattaga ggaaaataaa tctgattatg 7381 gagtctcaaa aaaaaaaaaa aaaaa
SEP ID NO: 25 Human TRAF3 Isoform 3 Amino Acid Sequence
(NP 001186356.1)
1 messkkmdsp galqtnpplk lhtdrsagtp vfvpeqggyk ekfvktvedk ykcekchlvl
61 cspkqtecgh rfcescmaal lsssspkcta cqesivkdkv fkdncckrei lalqiycrne
121 srgcaeqlml ghllvhlknd chfeelpcvr pdckekvlrk dlrdhvekac kyreatcshc
181 ksqvpmialq vsllqnesve knksiqslhn qicsfeieie rqkemlrnne skilhlqrvi
241 dsqaeklkel dkeirpfrqn weeadsmkss veslqnrvte lesvdksagq varntglles
301 qlsrhdqmls vhdirladmd lrfqvletas yngvliwkir dykrrkqeav mgktlslysq
361 pfytgyfgyk mcarvylngd gmgkgthlsl ffvimrgeyd allpwpfkqk vtlmlmdqgs 421 srrhlgdafk pdpnsssfkk ptgemniasg cpvfvaqtvl engtyikddt ifikvivdts 481 dlpdp
SEP ID NO: 26 Mouse TRAF3 Transcript Variant 1 cDNA Sequence (NM 011632.3, CDS region from position 362-2065)
1 agcgcgcgag aggaagtgcc agcgcgaggg tgcgtgaggc ggcgcggccg gcggccgccg 61 cgtgcgcgag ccgggttgca gcccagcagg gactttccag ccggcggcgg cggcggcggc 121 cgccggccct tccccgcccc ccgacatggg gctgcccggg gagctggacg ctgcagaagg 181 cggcggagga tgcgcgcggc gcccctgagc cggccgaacg ggcgggcctc ggggtacagg 241 gtccccatta cttgaaggat aaggctggca cggctccgac gtctgtgtgg aagcttctcc 301 ctcccttctg agcttctcta gactccttac agcgcacggc acagaatttc agtttcctaa 361 gatggagtca agcaaaaaga tggatgctgc tggcacactg cagcctaacc cacccctaaa 421 gctgcagcct gatcgcggcg cagggtccgt gctcgtgccg gagcaaggag gctacaagga 481 gaagtttgtg aagacggtgg aagacaagta caagtgcgag aagtgccgcc tggtgctgtg 541 caacccgaag cagacggagt gtggccaccg gttctgcgag agctgcatgg ccgccctgct 601 gagctcctcc agtccaaaat gcacagcgtg ccaagaaagc atcatcaaag acaaggtgtt 661 taaggataat tgctgcaaga gagagattct ggcccttcag gtctactgtc ggaatgaagg 721 cagaggttgt gcggagcagc tgactctggg acatctgctg gtgcacctaa aaaatgaatg 781 tcagtttgag gaacttccct gtctgcgtgc cgactgcaaa gaaaaagtac tgagaaaaga 841 cttgcgggat cacgtggaaa aggcctgtaa ataccgcgag gccacgtgca gtcactgcaa 901 gagccaagtg cccatgatca aactgcagaa acatgaagac acagattgtc cctgtgtggt 961 ggtatcctgc cctcacaagt gcagcgttca gactcttcta aggagtgagt tgagtgcaca 1021 cttgtccgag tgtgtcaatg cccccagcac ctgtagtttt aagcgctatg gctgcgtttt 1081 tcagggtaca aaccagcaga tcaaggccca tgaggccagc tccgcggtac agcacgtgaa 1141 cctgctgaag gagtggagca actccctgga gaagaaggtt tccctgctgc agaatgaaag 1201 tgttgagaaa aacaagagca tccaaagcct gcacaaccag atctgcagct ttgagatcga 1261 gattgagagg cagaaggaga tgctccgaaa caacgagtcc aagatccttc acctgcagcg 1321 ggtaatcgac agccaagcag agaaactgaa agaactggac aaggagatcc gtcccttccg 1381 gcagaactgg gaggaagcgg acagcatgaa gagcagtgtg gagtccctcc agaaccgagt 1441 gactgagctg gagagcgtag acaaaagtgc ggggcaggcg gctcgcaaca caggcttgct 1501 ggagtcccag ctgagccggc atgaccagat gttgagtgtt catgacatcc gcttggccga 1561 catggacctg cggttccagg tcctcgagac cgccagctac aacggggtgc tgatctggaa 1621 gatccgtgac tacaagcgcc ggaagcagga ggccgtcatg gggaagaccc tgtctctcta 1681 cagccagcct ttctacacag gttattttgg ctataagatg tgtgccaggg tctacctgaa 1741 tggggacgga atggggaaag ggacacactt gtcgctgttt tttgtcatta tgcgtggaga 1801 atatgatgct ctgttgccat ggccgttcaa gcagaaagtg acacttatgc tgatggatca 1861 ggggtcctct cgccgtcatc tgggagatgc gttcaagcct gaccccaaca gcagcagctt 1921 caagaaaccc accggagaga tgaatatcgc ctctggctgc ccagtctttg tcgcccaaac 1981 tgttctagag aacgggacgt atattaaaga tgatacaatc tttattaagg tcatagtgga 2041 tacctcggat ctgcctgacc cctgacaaga aagcagggcg gtggattcag cagaaggtaa 2101 ctcctctggg ggggtgagct agtgtcttca cggaggtcct cgccctcaga aaggaccttg 2161 tgggacagag gaagcagccg gaggaggaga aggaggtcga gtggctggca ggagagccac 2221 atgtgaaaac agaccccaac ggattttcta atagactagc cacacccact ctgaaggatt 2281 atttatccat caacaagata aatactgctg tcagagaagg ttttcatttt cattttaaaa 2341 gatctagtta attaaggtgg gaacatatat gctaaaaaga aacatgattt ttcttcctta 2401 acttaaacac caaaaagaga acacatgtgg gggtagctgg atgtgtcagc atgttaacct 2461 acgaggagaa cttatgaaat cataacacaa tccccatata ctcatcctaa aattcaagag 2521 tgcaatcttg tttcaaatat agtatattgt ctatttttaa ggcctcatct ggtctctgtt 2581 ttaataattt gtttgtcaga agaccctgag taggcagaag gtctctaaat tcagaagtca 2641 tttttaattt aaagttctac aaataattgt tactgcaaac attttgtttt aaaacgttga 2701 tagactgata tttcttggaa gaaaatgtaa aatatcaaac actggttatc acttgtgata 2761 ggaaagagaa tattgaacct gctgttattt ctcgttagaa atgtaaccct tcgatatctg 2821 tcgtagttag tgacactact tcacaatgac tatgagaggg acaatgctca tggatgctgt 2881 gcatcatttc agacttaaca attgttttca ccctaaaata gggcattagt tgaactttgg 2941 agttctaaac aaaatcctat aggtttttac aattctgccc catgtttaga caagctctgt 3001 tgctgacagc accagccttg gtctccagtg tcggtgtccg gggataggca ggtgacccgt 3061 gccgcaggca ggaggcccca gcgagcatcc catcctgtca tactgctgca tccggctagc 3121 gcgctccgaa agcaacatcc gtgctcagag atggtggcat acggtacttg tgccttagat 3181 gtgacatgct gcttcttgtc cctgggtttg cgttcaccat ggttctagaa agtgtcagtt
3241 taaccagatc tctctccacc accagaactt tgtctctgcc agggccctca ggcaactctg 3301 aacctgcctg gggatgccag gcctccattg gcagctcttg aagcctctgc tgctaaatat 3361 tcacagattc caaccgtagg cccctaagag cagctcagtc ccactccaag ggagggaggt 3421 gtgagcagaa gccacaccct tccaggtctc tgcaagggcc ctgaaatccc cacagcatga 3481 aggagaagtg ccctagtccc aagcgttccc gagaccactg gtctggggcc tgcccgggct 3541 ggcagcagca accctggcct ccctgtgagg agggcagcca gctgatgccc agcctgtgag 3601 tgcagaggcc cgccctctca gctcactgtt cccactgtga tgagaagcct ggagccctgc 3661 cccggtgccc cttttgctat gcaccacact tcacggtgct ctacactgat gggtgctaca 3721 cgcgacaggt gcttcttagg caaaaccaat gtgtgcaaac caccacatct gtgccacttg 3781 cccaaaaggc gcgcccacaa ttggccagct gggcctgcgc ttcagactgc ctgcctctgg 3841 gctctcccca tggtcgcacg gggacagctg ggttggtgcc cggtagccca ccttgtctct 3901 ggtgctgcca tctgtcctgg gtgtgccttc gccccagtgc ctgctggaag tgccctcctc 3961 tcgcacacct gtccccgtgc ttccatgagc gacctcttgg tttcgagcac tcaccctgcc 4021 cttccatggc tgaagcgttt ggtttgtcct ctgctccccg cttctctcca ttatgctggg 4081 attgctttgg ggtaagtcag caaccttggt tctgcccaca aggaaagacc gcagagctca 4141 agttctttca aaggtgccct cctcttcctc taggcctgtc accagggttc ctcccccaaa 4201 gacctggagt tggggggaac acccagcagt ccttggctgg cttcaggaag cttttctgtg 4261 gccagatgtc agcaacgggg ccatccctgt agctcccccc ttcagagaaa tcagtgcagt 4321 atcaacaggt gtaggccagc agcatcgtgt ctgacaaaaa gcatgtctgt ccttagtttc 4381 agacccttgt atgagggtga ccctgacatg tcctcgggcc cgtcctccct tttagtgaga 4441 cttggtcaag gctccttcct atgcgaggtg gccctcctgg cttcccccgt gcctgtaggg 4501 tgtgtgtaaa gtaagtgact gctcccctgg gatgagggcc ctgaacaatg tcacagcttc 4561 ctgtagtgtg ttgtgtctat tgcatttctc ggtaactgta gaatagtggg caagcttgcc 4621 cctctgtgcc ctgtctcagt gtgtgaaggg catctcctgg gaggtgtgga gcaggctgcg 4681 tcctgcctgg gtgtgccttg ctctgctcca tctcagcatt ccttggtgct caccacccgg 4741 gggtgtgggg cattgttggg ctgtggtctc agcatagctg tggctaccag tcctagcagc 4801 tagccctcac catatcacag ggtcctggcc atgagaagta tggggtgtca tgcggcgtgt 4861 gtacctggct gtgcaaaagt gtcaagtgct catcttttaa gaggccggta gttgcatggc 4921 ctctgtgggg aaattggata caactcctgc ttgccggggt ggtgtttgta cctgctcaca 4981 gctgaccctg ggaagatggc agccactaac tagcagtgtg tcctgaggcc cagcctgcag 5041 ttttttgtga atagctgaaa gcttgtgtca gtaacaaccc agggccttcc accttcgttg 5101 gtcagggaga agaaggtagc ctggggtgcc ctggccgagc ctccttcacc tcttggggat 5161 agacagagcc agcggaggcc acacatgtag gccgcgtgtg agagggatgg gtgagactgt 5221 gaatgagtgt aacacactga gtgtgagctg ggctcacaca ggagagcaga gcccatgccc 5281 agcattccag gaagcaaagg gctgtgagag ggtccgcatc ctcttccttt ctaaagtagc 5341 ctgtgcacag atggcgccat gtccctaaga cagcacaaca gtcagacagc acagccatga 5401 gctgagggag gtgtctgctt acagccaccg tccgcctcct ttctttctct gctcttttcc 5461 cgtttattcc aaggactggg cagcctccag cagggccttc agacccaccc ccaccagatc 5521 cctttgaaat atgtggtcag cctcatgaga acctagctgt cagccccctg tggatagcta 5581 gccaccttcc catccctcct tagtcagccc ctgtcccacc aggagttggg acctcatgcc 5641 tgctatcttg ggcctgacat taactgaaca gtatacatag cagtcaccca cggcagacct 5701 ggcaaccagt ggacagcatc cagcaaagat gaggatgtct gggcacgcca agtaacgggg 5761 tcctaggtgg accactcctg ccggcccaag aggagaccag ggggagtgcc agggtcagca 5821 gcatggccct tgctgcccct ccccctgtgc actgccatgc attgcaggga cttttgtacc 5881 tggccaaggc atttcccccg acaggtgaca gggttggtca gtcctcactc tcccatacat 5941 ccctctgctt gggagcatca gtgaatagag aagggcttga tggtgcttag gggactattt 6001 ttttactttc aatccagaag agctagtgtg ggcttcatgc catcatgtcc tgagtgtgtg 6061 tgacaaatga gggtctgact ctcgaatctc ctcagaccaa gactctatct tctatttgca 6121 cacccatagc agctgttttc tccaagctca aatgtgccca cgggggtctg atcaggtgag 6181 gtgatcattg gcaagtgacc cagccgttgc cagctctccc accccggctg ctgctgctag 6241 ccacgaggac tgtggcgtcc aggagcccat cccccaacct ggacctatcc tagcctgttg 6301 tctgcttggg caccattact aggtaggcag gcaaggcagt gacccacacc aaagccagcc 6361 ctacagctga gcatgcccca gcacccaagc agcgggtatg atccaattcc ctaaccgcac 6421 cacgtctgga gtctgtcctg tgagctcact gtggaaagga ggttacaagc ccaggtcact 6481 gtgccactcc atagtcagtg gcgaccagcg tgcaccccta atccccttag tcacttaaga 6541 aaaccttcaa aggcaaataa atgacctaat tggaaaacac aaaagccggc cttcctccca 6601 aggattccct aagaatctgt gggcgctctg actgagtagg ttggggtcag tgcagacagc 6661 tgcagactgt tctaaagttc cgttcttatc tctgatggca cacctctcgt gttcagttct 6721 attacccaaa aaacaaagac caaagaaggc caatctctca tttgaccgta tttttaatct 6781 gcctgttttg acacatgccg tctgtagtaa ccgctcgctg tgaggcccca tcttgacagt 6841 ccaagtgatc gtgaccagtg attagcgtcc cgtgttctaa tgctcttcta agaaactgag
- Ill -
6901 acagtgtgaa ttattgctca gcaataatca tgtcaccagg agttagcagc acgcctcatc
6961 tcctgatagc attatgatgt ttcgtgtttt gtttaccgtg tgttacatgt aaggtttcat
7021 ttggtattta tttgtgtttt gaggtcttgc gatgtttctg ttctgctgct aataataaag
7081 tttgtaagac tgtagaatgc agaattttgt aatgctcaag tgtctattag aggaaaataa
7141 agctgattca agagtccggc aaaa
SEP ID NO: 27 Mouse TRAF3 Isoform a Amino Acid Sequence (NP 035762.2)
1 messkkmdaa gtlqpnpplk lqpdrgagsv lvpeqggyke kfvktvedky kcekcrlvlc
61 npkqtecghr fcescmaall sssspkctac qesiikdkvf kdncckreil alqvycrneg
121 rgcaeqltlg hllvhlknec qfeelpclra dckekvlrkd lrdhvekack yreatcshck
181 sqvpmiklqk hedtdcpcvv vscphkcsvq tllrselsah lsecvnapst cs fkrygcvf
241 qgtnqqikah eassavqhvn llkewsnsle kkvsllqnes veknksiqsl hnqics feie
301 ierqkemlrn neskilhlqr vidsqaeklk eldkeirpfr qnweeadsmk ssveslqnrv
361 telesvdksa gqaarntgll esqlsrhdqm lsvhdirlad mdlrfqvlet asyngvliwk
421 irdykrrkqe avmgktlsly sqpfytgyfg ykmcarvyln gdgmgkgthl slffvimrge
481 ydallpwpfk qkvtlmlmdq gssrrhlgda fkpdpnsssf kkptgemnia sgcpvfvaqt
541 vlengtyikd dtifikvivd tsdlpdp
SEP ID NO: 28 Mouse TRAF3 Transcript Variant 2 cDNA Sequence
(NM 001286122.1, CDS region from position 251-1879)
1 agcgcgcgag aggaagtgcc agcgcgaggg tgcgtgaggc ggcgcggccg gcggccgccg 61 cgtgcgcgag ccgggttgca gcccagcagg gactttccag ccggcggcgg cggcggcggc 121 cgccggccct tccccgcccc ccgacatggg gctgcccggg gagctggacg ctgcagaagg 181 cggcggagga tgcgcgcggc gcccctgagc cggccgaacg ggcgggcctc gggaatttca 241 gtttcctaag atggagtcaa gcaaaaagat ggatgctgct ggcacactgc agcctaaccc 301 acccctaaag ctgcagcctg atcgcggcgc agggtccgtg ctcgtgccgg agcaaggagg 361 ctacaaggag aagtttgtga agacggtgga agacaagtac aagtgcgaga agtgccgcct 421 ggtgctgtgc aacccgaagc agacggagtg tggccaccgg ttctgcgaga gctgcatggc 481 cgccctgctg agctcctcca gtccaaaatg cacagcgtgc caagaaagca tcatcaaaga 541 caaggtgttt aaggataatt gctgcaagag agagattctg gcccttcagg tctactgtcg 601 gaatgaaggc agaggttgtg cggagcagct gactctggga catctgctgg tgcacctaaa 661 aaatgaatgt cagtttgagg aacttccctg tctgcgtgcc gactgcaaag aaaaagtact 721 gagaaaagac ttgcgggatc acgtggaaaa ggcctgtaaa taccgcgagg ccacgtgcag 781 tcactgcaag agccaagtgc ccatgatcaa actgcagaaa catgaagaca cagattgtcc 841 ctgtgtggtg gtatcctgcc ctcacaagtg cagcgttcag actcttctaa ggagtgaggg 901 tacaaaccag cagatcaagg cccatgaggc cagctccgcg gtacagcacg tgaacctgct 961 gaaggagtgg agcaactccc tggagaagaa ggtttccctg ctgcagaatg aaagtgttga 1021 gaaaaacaag agcatccaaa gcctgcacaa ccagatctgc agctttgaga tcgagattga 1081 gaggcagaag gagatgctcc gaaacaacga gtccaagatc cttcacctgc agcgggtaat 1141 cgacagccaa gcagagaaac tgaaagaact ggacaaggag atccgtccct tccggcagaa 1201 ctgggaggaa gcggacagca tgaagagcag tgtggagtcc ctccagaacc gagtgactga 1261 gctggagagc gtagacaaaa gtgcggggca ggcggctcgc aacacaggct tgctggagtc 1321 ccagctgagc cggcatgacc agatgttgag tgttcatgac atccgcttgg ccgacatgga 1381 cctgcggttc caggtcctcg agaccgccag ctacaacggg gtgctgatct ggaagatccg 1441 tgactacaag cgccggaagc aggaggccgt catggggaag accctgtctc tctacagcca 1501 gcctttctac acaggttatt ttggctataa gatgtgtgcc agggtctacc tgaatgggga 1561 cggaatgggg aaagggacac acttgtcgct gttttttgtc attatgcgtg gagaatatga 1621 tgctctgttg ccatggccgt tcaagcagaa agtgacactt atgctgatgg atcaggggtc 1681 ctctcgccgt catctgggag atgcgttcaa gcctgacccc aacagcagca gcttcaagaa 1741 acccaccgga gagatgaata tcgcctctgg ctgcccagtc tttgtcgccc aaactgttct 1801 agagaacggg acgtatatta aagatgatac aatctttatt aaggtcatag tggatacctc 1861 ggatctgcct gacccctgac aagaaagcag ggcggtggat tcagcagaag gtaactcctc 1921 tgggggggtg agctagtgtc ttcacggagg tcctcgccct cagaaaggac cttgtgggac 1981 agaggaagca gccggaggag gagaaggagg tcgagtggct ggcaggagag ccacatgtga 2041 aaacagaccc caacggattt tctaatagac tagccacacc cactctgaag gattatttat 2101 ccatcaacaa gataaatact gctgtcagag aaggttttca ttttcatttt aaaagatcta 2161 gttaattaag gtgggaacat atatgctaaa aagaaacatg atttttcttc cttaacttaa 2221 acaccaaaaa gagaacacat gtgggggtag ctggatgtgt cagcatgtta acctacgagg 2281 agaacttatg aaatcataac acaatcccca tatactcatc ctaaaattca agagtgcaat 2341 cttgtttcaa atatagtata ttgtctattt ttaaggcctc atctggtctc tgttttaata
2401 atttgtttgt cagaagaccc tgagtaggca gaaggtctct aaattcagaa gtcattttta 2461 atttaaagtt ctacaaataa ttgttactgc aaacattttg ttttaaaacg ttgatagact 2521 gatatttctt ggaagaaaat gtaaaatatc aaacactggt tatcacttgt gataggaaag 2581 agaatattga acctgctgtt atttctcgtt agaaatgtaa cccttcgata tctgtcgtag 2641 ttagtgacac tacttcacaa tgactatgag agggacaatg ctcatggatg ctgtgcatca 2701 tttcagactt aacaattgtt ttcaccctaa aatagggcat tagttgaact ttggagttct 2761 aaacaaaatc ctataggttt ttacaattct gccccatgtt tagacaagct ctgttgctga 2821 cagcaccagc cttggtctcc agtgtcggtg tccggggata ggcaggtgac ccgtgccgca 2881 ggcaggaggc cccagcgagc atcccatcct gtcatactgc tgcatccggc tagcgcgctc 2941 cgaaagcaac atccgtgctc agagatggtg gcatacggta cttgtgcctt agatgtgaca 3001 tgctgcttct tgtccctggg tttgcgttca ccatggttct agaaagtgtc agtttaacca 3061 gatctctctc caccaccaga actttgtctc tgccagggcc ctcaggcaac tctgaacctg 3121 cctggggatg ccaggcctcc attggcagct cttgaagcct ctgctgctaa atattcacag 3181 attccaaccg taggccccta agagcagctc agtcccactc caagggaggg aggtgtgagc 3241 agaagccaca cccttccagg tctctgcaag ggccctgaaa tccccacagc atgaaggaga 3301 agtgccctag tcccaagcgt tcccgagacc actggtctgg ggcctgcccg ggctggcagc 3361 agcaaccctg gcctccctgt gaggagggca gccagctgat gcccagcctg tgagtgcaga 3421 ggcccgccct ctcagctcac tgttcccact gtgatgagaa gcctggagcc ctgccccggt 3481 gccccttttg ctatgcacca cacttcacgg tgctctacac tgatgggtgc tacacgcgac 3541 aggtgcttct taggcaaaac caatgtgtgc aaaccaccac atctgtgcca cttgcccaaa 3601 aggcgcgccc acaattggcc agctgggcct gcgcttcaga ctgcctgcct ctgggctctc 3661 cccatggtcg cacggggaca gctgggttgg tgcccggtag cccaccttgt ctctggtgct 3721 gccatctgtc ctgggtgtgc cttcgcccca gtgcctgctg gaagtgccct cctctcgcac 3781 acctgtcccc gtgcttccat gagcgacctc ttggtttcga gcactcaccc tgcccttcca 3841 tggctgaagc gtttggtttg tcctctgctc cccgcttctc tccattatgc tgggattgct 3901 ttggggtaag tcagcaacct tggttctgcc cacaaggaaa gaccgcagag ctcaagttct 3961 ttcaaaggtg ccctcctctt cctctaggcc tgtcaccagg gttcctcccc caaagacctg 4021 gagttggggg gaacacccag cagtccttgg ctggcttcag gaagcttttc tgtggccaga 4081 tgtcagcaac ggggccatcc ctgtagctcc ccccttcaga gaaatcagtg cagtatcaac 4141 aggtgtaggc cagcagcatc gtgtctgaca aaaagcatgt ctgtccttag tttcagaccc 4201 ttgtatgagg gtgaccctga catgtcctcg ggcccgtcct cccttttagt gagacttggt 4261 caaggctcct tcctatgcga ggtggccctc ctggcttccc ccgtgcctgt agggtgtgtg 4321 taaagtaagt gactgctccc ctgggatgag ggccctgaac aatgtcacag cttcctgtag 4381 tgtgttgtgt ctattgcatt tctcggtaac tgtagaatag tgggcaagct tgcccctctg 4441 tgccctgtct cagtgtgtga agggcatctc ctgggaggtg tggagcaggc tgcgtcctgc 4501 ctgggtgtgc cttgctctgc tccatctcag cattccttgg tgctcaccac ccgggggtgt 4561 ggggcattgt tgggctgtgg tctcagcata gctgtggcta ccagtcctag cagctagccc 4621 tcaccatatc acagggtcct ggccatgaga agtatggggt gtcatgcggc gtgtgtacct 4681 ggctgtgcaa aagtgtcaag tgctcatctt ttaagaggcc ggtagttgca tggcctctgt 4741 ggggaaattg gatacaactc ctgcttgccg gggtggtgtt tgtacctgct cacagctgac 4801 cctgggaaga tggcagccac taactagcag tgtgtcctga ggcccagcct gcagtttttt 4861 gtgaatagct gaaagcttgt gtcagtaaca acccagggcc ttccaccttc gttggtcagg 4921 gagaagaagg tagcctgggg tgccctggcc gagcctcctt cacctcttgg ggatagacag 4981 agccagcgga ggccacacat gtaggccgcg tgtgagaggg atgggtgaga ctgtgaatga 5041 gtgtaacaca ctgagtgtga gctgggctca cacaggagag cagagcccat gcccagcatt 5101 ccaggaagca aagggctgtg agagggtccg catcctcttc ctttctaaag tagcctgtgc 5161 acagatggcg ccatgtccct aagacagcac aacagtcaga cagcacagcc atgagctgag 5221 ggaggtgtct gcttacagcc accgtccgcc tcctttcttt ctctgctctt ttcccgttta 5281 ttccaaggac tgggcagcct ccagcagggc cttcagaccc acccccacca gatccctttg 5341 aaatatgtgg tcagcctcat gagaacctag ctgtcagccc cctgtggata gctagccacc 5401 ttcccatccc tccttagtca gcccctgtcc caccaggagt tgggacctca tgcctgctat 5461 cttgggcctg acattaactg aacagtatac atagcagtca cccacggcag acctggcaac 5521 cagtggacag catccagcaa agatgaggat gtctgggcac gccaagtaac ggggtcctag 5581 gtggaccact cctgccggcc caagaggaga ccagggggag tgccagggtc agcagcatgg 5641 cccttgctgc ccctccccct gtgcactgcc atgcattgca gggacttttg tacctggcca 5701 aggcatttcc cccgacaggt gacagggttg gtcagtcctc actctcccat acatccctct 5761 gcttgggagc atcagtgaat agagaagggc ttgatggtgc ttaggggact atttttttac 5821 tttcaatcca gaagagctag tgtgggcttc atgccatcat gtcctgagtg tgtgtgacaa 5881 atgagggtct gactctcgaa tctcctcaga ccaagactct atcttctatt tgcacaccca 5941 tagcagctgt tttctccaag ctcaaatgtg cccacggggg tctgatcagg tgaggtgatc 6001 attggcaagt gacccagccg ttgccagctc tcccaccccg gctgctgctg ctagccacga
6061 ggactgtggc gtccaggagc ccatccccca acctggacct atcctagcct gttgtctgct 6121 tgggcaccat tactaggtag gcaggcaagg cagtgaccca caccaaagcc agccctacag 6181 ctgagcatgc cccagcaccc aagcagcggg tatgatccaa ttccctaacc gcaccacgtc 6241 tggagtctgt cctgtgagct cactgtggaa aggaggttac aagcccaggt cactgtgcca 6301 ctccatagtc agtggcgacc agcgtgcacc cctaatcccc ttagtcactt aagaaaacct 6361 tcaaaggcaa ataaatgacc taattggaaa acacaaaagc cggccttcct cccaaggatt 6421 ccctaagaat ctgtgggcgc tctgactgag taggttgggg tcagtgcaga cagctgcaga 6481 ctgttctaaa gttccgttct tatctctgat ggcacacctc tcgtgttcag ttctattacc 6541 caaaaaacaa agaccaaaga aggccaatct ctcatttgac cgtattttta atctgcctgt 6601 tttgacacat gccgtctgta gtaaccgctc gctgtgaggc cccatcttga cagtccaagt 6661 gatcgtgacc agtgattagc gtcccgtgtt ctaatgctct tctaagaaac tgagacagtg 6721 tgaattattg ctcagcaata atcatgtcac caggagttag cagcacgcct catctcctga 6781 tagcattatg atgtttcgtg ttttgtttac cgtgtgttac atgtaaggtt tcatttggta 6841 tttatttgtg ttttgaggtc ttgcgatgtt tctgttctgc tgctaataat aaagtttgta 6901 agactgtaga atgcagaatt ttgtaatgct caagtgtcta ttagaggaaa ataaagctga 6961 ttcaagagtc cggcaaaa
SEP ID NO: 29 Mouse TRAF3 Isoform b Amino Acid Sequence
(NP 001273051.1)
1 messkkmdaa gtlqpnpplk lqpdrgagsv lvpeqggyke kfvktvedky kcekcrlvlc 61 npkqtecghr fcescmaall sssspkctac qesiikdkvf kdncckreil alqvycrneg 121 rgcaeqltlg hllvhlknec qfeelpclra dckekvlrkd lrdhvekack yreatcshck 181 sqvpmiklqk hedtdcpcvv vscphkcsvq tllrsegtnq qikaheassa vqhvnllkew 241 snslekkvsl lqnesveknk siqslhnqic s feieierqk emlrnneski lhlqrvidsq 301 aeklkeldke irpfrqnwee adsmkssves lqnrvteles vdksagqaar ntgllesqls 361 rhdqmlsvhd irladmdlrf qvletasyng vliwkirdyk rrkqeavmgk tlslysqpfy 421 tgyfgykmca rvylngdgmg kgthlslffv imrgeydall pwpfkqkvtl mlmdqgssrr 481 hlgdafkpdp nsssfkkptg emniasgcpv fvaqtvleng tyikddtifi kvivdtsdlp 541 dp
SEP ID NO: 30 Human RNF31 Transcript Variant 1 cDNA Sequence (NM 017999.4, CDS region from position 250-3468)
1 aagccccgcc cgttcctccg aaattgggtc gcagtcccac cctctctcct agtacttcct 61 gttctcggct aaccctggcg ctgggccggg ggctggagag tgaccgtggt ctgagtgacc 121 tggggcggct gcgtgggccg gggtgggcct caaagccggg caccagacgg gaggggcggc 181 gctcgggccg cgcgctgccc gcgccgggtc ctggcgggcg gcgaggctgg ggctgactcc 241 tgcctcagga tgccggggga ggaagaggag cgggccttcc tggtggcccg cgaggagctg 301 gcgagcgccc tgaggaggga ttccgggcag gcgttttccc tggagcagct ccggccgcta 361 ctagccagct ctctgccgct agccgcccgc tacctgcagc tggacgccgc acgccttgtc 421 cgctgcaacg ctcatgggga gccccgaaac tacctcaaca ccctgtccac ggctctgaac 481 atcctggaga aatacggccg caaccttctc agccctcagc ggcctcggta ctggcgtggt 541 gtcaagttta ataaccctgt ctttcgcagc acggtggatg ctgtgcaggg gggccgagat 601 gtgctgcgat tatatggcta cacagaggag caaccagatg ggttgagctt ccccgaaggg 661 caggaggagc cagatgagca ccaggttgct acagtcacac tggaagtact gctgcttcgg 721 acagagctca gcctgctatt gcagaatact catccaagac agcaggcact ggagcagctg 781 ttggaagaca aggttgaaga tgatatgctg cagctttcag aatttgaccc cctattgaga 841 gagattgctc ctggccccct caccacaccc tctgtcccag gctccactcc tggtccctgc 901 ttcctctgtg gttctgcccc aggcacactg cactgcccat cctgtaaaca ggccctgtgt 961 ccagcctgtg accacctgtt ccatggacac ccatcccgtg ctcatcacct ccgccagacc 1021 ctgcctgggg tcctgcaggg tacccacctg agccccagtt tacctgcctc agcccaacca 1081 cggccccagt cgacctccct gctggccctg ggagacagct ctctttcttc ccctaatcct 1141 gcaagtgctc atttgccctg gcactgtgct gcctgtgcca tgctaaatga gccttgggca 1201 gtgctctgtg tggcctgtga tcggccccga ggctgtaagg ggttggggtt gggaactgag 1261 ggtccccaag gaactggagg cctagaacct gatcttgcac ggggtcggtg ggcctgccag 1321 agctgtacct ttgagaatga ggcagctgct gtgctatgtt ccatatgtga gcgacctcgg 1381 ctggcccagc ctcccagctt ggtggtggat tcccgagatg ctggcatttg cctgcaaccc 1441 cttcagcagg gggatgcttt gctggcctct gcccagagtc aagtctggta ctgtattcac 1501 tgtaccttct gcaactcgag ccctggctgg gtgtgtgtta tgtgcaaccg gactagtagc 1561 cccattccag cacaacatgc cccccggccc tatgccagct ctttggaaaa gggacccccc 1621 aagcctgggc ccccacgacg ccttagtgcc cccctgccca gttcctgtgg agatcctgag
1681 aagcagcgcc aagacaagat gcgggaagaa ggcctccagc tagtgagcat gatccgggaa 1741 ggggaagccg caggtgcctg tccagaggag atcttctcgg ctctgcagta ctcgggcact 1801 gaggtgcctc tgcagtggtt gcgctcagaa ctgccctacg tcctggagat ggtggctgag 1861 ctggctggac agcaggaccc tgggctgggt gccttttcct gtcaggaggc ccggagagcc 1921 tggctggatc gtcatggcaa ccttgatgaa gctgtggagg agtgtgtgag gaccaggcga 1981 aggaaggtgc aggagctcca gtctctaggc tttgggcctg aggaggggtc tctccaggca 2041 ttgttccagc acggaggtga tgtgtcacgg gccctgactg agctacagcg ccaacgccta 2101 gagcccttcc gccagcgcct ctgggacagt ggccctgagc ccaccccttc ctgggatggg 2161 ccagacaagc agagcctggt caggcggctt ttggcagtct acgcactccc cagctggggc 2221 cgggcagagc tggcactgtc actgctgcag gagacaccca ggaactatga gttgggggat 2281 gtggtagaag ctgtgaggca cagccaggac cgggccttcc tgcgccgctt gcttgcccag 2341 gagtgtgccg tgtgtggctg ggccctgccc cacaaccgga tgcaggccct gacttcctgt 2401 gagtgcacca tctgtcctga ctgcttccgc cagcacttca ccatcgcctt gaaggagaag 2461 cacatcacag acatggtgtg ccctgcctgt ggccgccccg acctcaccga tgacacacag 2521 ttgctcagct acttctctac ccttgacatc cagcttcgcg agagcctaga gccagatgcc 2581 tatgcgttgt tccataagaa gctgaccgag ggtgtgctga tgcgggaccc caagttcttg 2641 tggtgtgccc agtgctcctt tggcttcata tatgagcgtg agcagctgga ggcaacttgt 2701 ccccagtgtc accagacctt ctgtgtgcgc tgcaagcgcc agtgggagga gcagcaccga 2761 ggtcggagct gtgaggactt ccagaactgg aaacgcatga acgacccaga ataccaggcc 2821 cagggcctag caatgtatct tcaggaaaac ggcattgact gccccaaatg caagttctcg 2881 tacgccctgg cccgaggagg ctgcatgcac tttcactgta cccagtgccg ccaccagttc 2941 tgcagcggct gctacaatgc cttttacgcc aagaataaat gtccagagcc taactgcagg 3001 gtgaaaaagt ccctgcacgg ccaccaccct cgagactgcc tcttctacct gcgggactgg 3061 actgctctcc ggcttcagaa gctgctacag gacaataacg tcatgtttaa tacagagcct 3121 ccagctgggg cccgggcagt ccctggaggc ggctgccgag tgatagagca gaaggaggtt 3181 cccaatgggc tcagggacga agcttgtggc aaggaaactc cagctggcta tgccggcctg 3241 tgccaggcac actacaaaga gtatcttgtg agcctcatca atgcccactc gctggaccca 3301 gccaccttgt atgaggtgga agagctggag acggccactg agcgctacct gcacgtacgc 3361 ccccagcctt tggctggaga ggatccccct gcttaccagg cccgcttgtt acagaagctg 3421 acagaagagg tacccttggg acagagtatc ccccgcaggc ggaagtagct gagggcaagg 3481 gtcccgatga gggtcccatg gcctgctccc tcaggaacag ctccagcacc aataaagagg 3541 catcttacca cccaggaaaa aaaaaaaaaa a
SEP ID NO: 31 Human RNF31 Isoform 1 Amino Acid Sequence (NP 060469.4)
1 mpgeeeeraf lvareelasa lrrdsgqafs leqlrpllas slplaarylq ldaarlvrcn
61 ahgeprnyln tlstalnile kygrnllspq rprywrgvkf nnpvfrstvd avqggrdvlr
121 lygyteeqpd glsfpegqee pdehqvatvt levlllrtel slllqnthpr qqaleqlled
181 kveddmlqls efdpllreia pgplttpsvp gstpgpcflc gsapgtlhcp sckqalcpac
241 dhlfhghpsr ahhlrqtlpg vlqgthlsps lpasaqprpq stsllalgds slsspnpasa
301 hlpwhcaaca mlnepwavlc vacdrprgck glglgtegpq gtgglepdla rgrwacqsct
361 feneaaavlc sicerprlaq ppslvvdsrd agiclqplqq gdallasaqs qvwycihctf
421 cnsspgwvcv mcnrtsspip aqhaprpyas slekgppkpg pprrlsaplp sscgdpekqr
481 qdkmreeglq lvsmiregea agacpeeifs alqysgtevp lqwlrselpy vlemvaelag
541 qqdpglgafs cqearrawld rhgnldeave ecvrtrrrkv qelqslgfgp eegslqalfq
601 hggdvsralt elqrqrlepf rqrlwdsgpe ptpswdgpdk qslvrrllav yalpswgrae
661 lalsllqetp rnyelgdvve avrhsqdraf lrrllaqeca vcgwalphnr mqaltscect
721 icpdcfrqhf tialkekhit dmvcpacgrp dltddtqlls yfstldiqlr eslepdayal
781 fhkkltegvl mrdpkflwca qcsfgfiyer eqleatcpqc hqtfcvrckr qweeqhrgrs
841 cedfqnwkrm ndpeyqaqgl amylqengid cpkckfsyal arggcmhfhc tqcrhqfcsg
901 cynafyaknk cpepncrvkk slhghhprdc lfylrdwtal rlqkllqdnn vmfnteppag
961 aravpgggcr vieqkevpng lrdeacgket pagyaglcqa hykeylvsli nahsldpatl
1021 yeveeletat erylhvrpqp lagedppayq arllqkltee vplgqsiprr rk
SEP ID NO: 32 Human RNF31 Transcript Variant 2 cDNA Sequence
(NM 001310332.1, CDS region from position 359-3124)
1 atagctaggg ccaactggaa gtccagggtt gggccccgaa actacctcaa caccctgtcc 61 acggctctga acatcctgga gaaatacggc cgcaaccttc tcagccctca gcggcctcgg 121 tactggcgtg gtgtcaagtt taataaccct gtctttcgca gcacggtgga tgctgtgcag 181 gggggccgag atgtgctgcg attatatggc tacacagagg agcaaccaga tgggttgagc 241 ttccccgaag ggcaggagga gccagatgag caccaggttg ctacagtcac actggaagta
301 ctgctgcttc ggacagagct cagcctgcta ttgcaggtga gatgctcctc tagtcttgat 361 ggacttatgc accagggctg gggagcccag cctaactcaa aatactcatc caagacagca 421 ggcactggag cagctgttgg aagacaaggt tgaagatgat atgctgcagc tttcagaatt 481 tgacccccta ttgagagaga ttgctcctgg ccccctcacc acaccctctg tcccaggctc 541 cactcctggt ccctgcttcc tctgtggttc tgccccaggc acactgcact gcccatcctg 601 taaacaggcc ctgtgtccag cctgtgacca cctgttccat ggacacccat cccgtgctca 661 tcacctccgc cagaccctgc ctggggtcct gcagggtacc cacctgagcc ccagtttacc 721 tgcctcagcc caaccacggc cccagtcgac ctccctgctg gccctgggag acagctctct 781 ttcttcccct aatcctgcaa gtgctcattt gccctggcac tgtgctgcct gtgccatgct 841 aaatgagcct tgggcagtgc tctgtgtggc ctgtgatcgg ccccgaggct gtaaggggtt 901 ggggttggga actgagggtc cccaaggaac tggaggccta gaacctgatc ttgcacgggg 961 tcggtgggcc tgccagagct gtacctttga gaatgaggca gctgctgtgc tatgttccat 1021 atgtgagcga cctcggctgg cccagcctcc cagcttggtg gtggattccc gagatgctgg 1081 catttgcctg caaccccttc agcaggggga tgctttgctg gcctctgccc agagtcaagt 1141 ctggtactgt attcactgta ccttctgcaa ctcgagccct ggctgggtgt gtgttatgtg 1201 caaccggact agtagcccca ttccagcaca acatgccccc cggccctatg ccagctcttt 1261 ggaaaaggga ccccccaagc ctgggccccc acgacgcctt agtgcccccc tgcccagttc 1321 ctgtggagat cctgagaagc agcgccaaga caagatgcgg gaagaaggcc tccagctagt 1381 gagcatgatc cgggaagggg aagccgcagg tgcctgtcca gaggagatct tctcggctct 1441 gcagtactcg ggcactgagg tgcctctgca gtggttgcgc tcagaactgc cctacgtcct 1501 ggagatggtg gctgagctgg ctggacagca ggaccctggg ctgggtgcct tttcctgtca 1561 ggaggcccgg agagcctggc tggatcgtca tggcaacctt gatgaagctg tggaggagtg 1621 tgtgaggacc aggcgaagga aggtgcagga gctccagtct ctaggctttg ggcctgagga 1681 ggggtctctc caggcattgt tccagcacgg aggtgatgtg tcacgggccc tgactgagct 1741 acagcgccaa cgcctagagc ccttccgcca gcgcctctgg gacagtggcc ctgagcccac 1801 cccttcctgg gatgggccag acaagcagag cctggtcagg cggcttttgg cagtctacgc 1861 actccccagc tggggccggg cagagctggc actgtcactg ctgcaggaga cacccaggaa 1921 ctatgagttg ggggatgtgg tagaagctgt gaggcacagc caggaccggg ccttcctgcg 1981 ccgcttgctt gcccaggagt gtgccgtgtg tggctgggcc ctgccccaca accggatgca 2041 ggccctgact tcctgtgagt gcaccatctg tcctgactgc ttccgccagc acttcaccat 2101 cgccttgaag gagaagcaca tcacagacat ggtgtgccct gcctgtggcc gccccgacct 2161 caccgatgac acacagttgc tcagctactt ctctaccctt gacatccagc ttcgcgagag 2221 cctagagcca gatgcctatg cgttgttcca taagaagctg accgagggtg tgctgatgcg 2281 ggaccccaag ttcttgtggt gtgcccagtg ctcctttggc ttcatatatg agcgtgagca 2341 gctggaggca acttgtcccc agtgtcacca gaccttctgt gtgcgctgca agcgccagtg 2401 ggaggagcag caccgaggtc ggagctgtga ggacttccag aactggaaac gcatgaacga 2461 cccagaatac caggcccagg gcctagcaat gtatcttcag gaaaacggca ttgactgccc 2521 caaatgcaag ttctcgtacg ccctggcccg aggaggctgc atgcactttc actgtaccca 2581 gtgccgccac cagttctgca gcggctgcta caatgccttt tacgccaaga ataaatgtcc 2641 agagcctaac tgcagggtga aaaagtccct gcacggccac caccctcgag actgcctctt 2701 ctacctgcgg gactggactg ctctccggct tcagaagctg ctacaggaca ataacgtcat 2761 gtttaataca gagcctccag ctggggcccg ggcagtccct ggaggcggct gccgagtgat 2821 agagcagaag gaggttccca atgggctcag ggacgaagct tgtggcaagg aaactccagc 2881 tggctatgcc ggcctgtgcc aggcacacta caaagagtat cttgtgagcc tcatcaatgc 2941 ccactcgctg gacccagcca ccttgtatga ggtggaagag ctggagacgg ccactgagcg 3001 ctacctgcac gtacgccccc agcctttggc tggagaggat ccccctgctt accaggcccg 3061 cttgttacag aagctgacag aagaggtacc cttgggacag agtatccccc gcaggcggaa 3121 gtagctgagg gcaagggtcc cgatgagggt cccatggcct gctccctcag gaacagctcc 3181 agcaccaata aagaggcatc ttaccaccca ggaaaaaaaa aaaaaaa
SEP ID NO: 33 Human RNF31 Isoform 2 Amino Acid Sequence
(NP 001297261.1)
1 mdlctragep sltqnthprq qaleqlledk veddmlqlse fdpllreiap gplttpsvpg 61 stpgpcflcg sapgtlhcps ckqalcpacd hlfhghpsra hhlrqtlpgv lqgthlspsl 121 pasaqprpqs tsllalgdss lsspnpasah lpwhcaacam lnepwavlcv acdrprgckg 181 lglgtegpqg tgglepdlar grwacqsctf eneaaavlcs icerprlaqp pslvvdsrda 241 giclqplqqg dallasaqsq vwycihctfc nsspgwvcvm cnrtsspipa qhaprpyass 301 lekgppkpgp prrlsaplps scgdpekqrq dkmreeglql vsmiregeaa gacpeeifsa 361 lqysgtevpl qwlrselpyv lemvaelagq qdpglgafsc qearrawldr hgnldeavee 421 cvrtrrrkvq elqslgfgpe egslqalfqh ggdvsralte lqrqrlepfr qrlwdsgpep
481 tpswdgpdkq slvrrllavy alpswgrael alsllqetpr nyelgdvvea vrhsqdrafl 541 rrllaqecav cgwalphnrm qaltscecti cpdcfrqhft ialkekhitd mvcpacgrpd 601 ltddtqllsy fstldiqlre slepdayalf hkkltegvlm rdpkflwcaq csfgfiyere 661 qleatcpqch qtfcvrckrq weeqhrgrsc edfqnwkrmn dpeyqaqgla mylqengidc 721 pkckfsyala rggcmhfhct qcrhqfcsgc ynafyaknkc pepncrvkks lhghhprdcl 781 fylrdwtalr lqkllqdnnv mfnteppaga ravpgggcrv ieqkevpngl rdeacgketp 841 agyaglcqah ykeylvslin ahsldpatly eveeletate rylhvrpqpl agedppayqa 901 rllqklteev plgqsiprrr k
SEP ID NO: 34 Mouse RNF31 cDNA Sequence (NM 194346.2, CDS region from position 95-3295)
1 gcggtggctt aagtgacccg ggctgctgtg gcgccgcgcg cacctgcgcc agcccctgga 61 gggcagagaa gctgagcctg tctccagtct caggatgccg ggagacgagg agcgaggctt 121 cctggcggcc cgcgaggagc tggcgagcgc cctgaggtgg gattctgcgc aggtttttcc 181 cctggagcag ctcatgccgc ttctggccac ctctctgcca ccagccgccc gctacctgca 241 gctggacgcc ggacgcttgg tccgctgcaa cgctcatggg gagcctcgaa actacctcaa 301 caccctatcc acggccctga acatcctgga aaaatatggt cgcaacctcc tcagcccgca 361 gcggccccgg tattggcgct cagtgaagtt taataacccc gtctttcgca gcacggtgga 421 tgctgtgcag ggtggccggg atgtactacg gttgtatggc tatactgagg agcgcccaga 481 tggattgagt ttccccgaag ggcaggagga accagatgaa taccaggttg ctgttgtcac 541 actagaagta ctgctgcttc gcaccgagct cagtttgctg ttgcagaata ctcatcccag 601 acagaatgca ctggaccagc tgctaagaga gagcgttgaa gatggtatgc tgcagctttc 661 agagtttcac ccccttctga gggagattgt tcctggcccc cgcccctctg cccaaggctc 721 cactcctggt ccctgtttcc tctgtggttc tgccccaggc acactgcact gtccagcctg 781 taaccaagtc tcgtgcccag cttgtgacat tttgttccat gggcatccgt cccgtgcaca 841 tcaccttcgc caagccctgc ctgggtccca ccagactgcc agcctgagct ctagtttacc 901 tgcctcgtcc caaccacggc ccccctcctc ctccttggcc ctgggagata gctctctttc 961 ttcccctgac cctgcaaatg cctgtctgcc ctggcattgt cttacctgtg ccacactaaa 1021 tgagccttgg gcagtgttct gtgcagtctg tagtcagccc aaaggctgca aggtgccggg 1081 aatagagggt tcccatggaa ccgggggcct agaacctgag cctgcacggg atcaatgggc 1141 ctgccagagc tgtacctttg agaatgaggc agcagctgtg ctatgcgcca tatgtgagcg 1201 acctcggctg gcccagcctc ccagcttggt ggtggattcc catgatgctg gtgtttgcca 1261 acagtccctt aagcaggagg atcctttgct caccgctgcc cagcctcagg tgtggtactg 1321 tgaccattgt accttctgca attcaggccc tgtctgggtg tgtgccatgt gcaaccgaac 1381 ccgagacccc atccctacac agcctgccct ccagtcctat cccagctctt tggaaaaggg 1441 acgcccaaag ccagggtcct cacaacacct tggttcctcc ctgcctgctt cctgtggaga 1501 cccagagaaa caacgccaag ataagatgcg gaaggaaggt ctccagctcg tgagcatgat 1561 ccaggaagga gaaactgcgg gtgccagtcc agaagaggtc ttctcagctc tccaatactc 1621 aggcacagag gtgcccctcc agtggttgcg ttcagagctg tcctacgtcc tggagatggt 1681 ggctgagctt gctggacaac aggatccaga gctgggggcc ttttcctgtc aggaagcccg 1741 gaaagcctgg cttgatcgcc atggcaacct ggatgaagct gtagaggagt gtgtgagggc 1801 caggaggagg aaggtgcacg agctgcagtc cctgggcttt gggcctaagg aagggtcact 1861 acaggcattg ttccagcatg ggggtgacgt ggctcgggcc ctgactgagt tacagcgcca 1921 gcgcctggag cccttccatc agcgcctatg ggacagagac cctgaaccca ctccctgctg 1981 ggatgggctg gacagacaga gcttggtcag acgccttctg gccgtctaca cactccccag 2041 ctggggccga gcagagctgg cgctggcgct gctgcaggag acacccagga actatgagtt 2101 gttggacgtg gtggaggctg tgaggcacag ccaggaccgg gcctttctgc gtcgactgct 2161 tgcccaggaa tgtgctgtgt gcgggtgggc ccttccccgc aaccggatgc aggccctgat 2221 ctcctgtgag tgcaccatat gtcccgaatg cttccgccaa cacttcacca ttgccctgaa 2281 ggagaagcac atcacagaca tggtgtgccc tgcctgtggc cgccctgacc tcactgatga 2341 cgctcagtta ctcagctact tctccaccct tgacatccag ctcagagaga gcctagaccc 2401 cgatgcatat gccctgtttc acaagaagct gaccgaggct gtgcttatgc gagaccccaa 2461 gttcttgtgg tgcgcccagt gttcctttgg cttcatctat gaacgcgaac agctggaggc 2521 gacgtgtccc cagtgtcacc agaccttctg tgtgcgctgc aagcgccagt gggaggagca 2581 gcacagagga cggagttgtg aggatttcca gaactggaaa cgcaccaatg acccagagta 2641 ccaggctcaa ggcttggcca tgtaccttca ggaaaacggc attgactgtc cgaaatgcaa 2701 gttctcgtac gcactggccc ggggaggctg catgcacttc cactgcacgc agtgtcgaca 2761 ccagttctgc agtggctgct acaacgcctt ttacgccaag aataaatgtc cagaccctaa 2821 ctgcaaggtg aaaaagtccc tgcatggcca ccaccctcga gactgcctct tctacctacg 2881 ggactggact gctgcccgcc tccagaaact gttgcaggac aataatgtca tgtttaatac
2941 agagcctcca gctgggacac gggcagtccc tggagggggc tgcagagtga tggagcagaa
3001 ggaggtccat agtgggttca gggatgaagc ttgcggcaag gaaactccac ctggctatgc
3061 cggcctatgt caggcacact acaaagagta tctcgtgagc ctcatcaatg cccattcact
3121 ggacccagct accttgtatg aagtggagga gctggagaca gccactattc gctacctaca
3181 tttagctcct cagcccgcgg atggagagga tctgcctgct taccaggccc ggctattaca
3241 gaagctgaga gaagaggtac ccttgggaca gagtattgcc cgcagaagaa agtagtagca
3301 gagagccggg tcctgatggg acttcctgac ccaggcctca gcagcagttc cagcaccaat
3361 aaagaggcat cttatggcct aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
3421 aaaaaaaaaa aaaaaaaaaa aaa
SEP ID NO: 35 Mouse RNF31 Amino Acid Sequence (NP 919327.2)
1 mpgdeergf1 aareelasal rwdsaqvfpl eqlmpllats lppaarylql dagrlvrcna 61 hgeprnylnt lstalnilek ygrnllspqr prywrsvkfn npvfrstvda vqggrdvlrl 121 ygyteerpdg Is fpegqeep deyqvavvtl evlllrtels lllqnthprq naldqllres 181 vedgmlqlse fhpllreivp gprpsaqgst pgpcflegsa pgtlhcpacn qvscpacdil 241 fhghpsrahh lrqalpgshq taslssslpa ssqprppsss lalgdsslss pdpanaclpw 301 hcltcatlne pwavfcaves qpkgckvpgi egshgtggle pepardqwac qsctfeneaa 361 avlcaicerp rlaqppslvv dshdagvcqq slkqedpllt aaqpqvwycd hctfensgpv 421 wvcamcnrtr dpiptqpalq sypsslekgr pkpgssqhlg sslpascgdp ekqrqdkmrk 481 eglqlvsmiq egetagaspe evfsalqysg tevplqwlrs elsyvlemva elagqqdpel 541 gafscqeark awldrhgnld eaveeevrar rrkvhelqsl gfgpkegslq alfqhggdva 601 raltelqrqr lepfhqrlwd rdpeptpewd gldrqslvrr llavytlpsw graelalall 661 qetprnyell dvveavrhsq draflrrlla qecavcgwal prnrmqalis cecticpecf 721 rqhftialke khitdmvcpa cgrpdltdda qllsyfstld iqlresldpd ayalfhkklt 781 eavlmrdpkf lwcaqcs fgf iyereqleat cpqchqtfcv rckrqweeqh rgrscedfqn 841 wkrtndpeyq aqglamylqe ngidcpkckf syalarggcm hfhctqcrhq fcsgcynafy 901 aknkcpdpnc kvkkslhghh prdclfylrd wtaarlqkll qdnnvmfnte ppagtravpg 961 ggcrvmeqke vhsgfrdeac gketppgyag lcqahykeyl vslinahsld patlyeveel 1021 etatirylhl apqpadgedl payqarllqk lreevplgqs iarrrk
SEP ID NO: 36 Human RBCK1 Transcript Variant 1 cDNA Sequence (NM 006462.5, CDS region from position 690-2096)
1 ccccgcctgc ggcccagctc cttcccgcgg etctgegatg cggcccgcag ggtgacccgg 61 gegggagtec ggggacccgc gatcagcccc ggaggacggg gtggggtcgc cccaaacagg 121 agegceggga ccgctgggac cccgcactcg gcgtccgccg ccgccgggta geegggcagt 181 ggaggtcccg gatgaggega caatttttcc ggccccccct cccagtcccg ccccacttcc 241 ggggccgcca ctttcacttt ctcttccgcc gaagccgctc cccttgcgaa gaactggggc 301 ctcccgggag gagagagggc tttgccttga aacccgggac gecaggggeg ctcccgcaag 361 tgggggtcct ccgggacttg gaacgccccg gctgggtggt gtccgggcgt cctttccccg 421 cttcttccca cctcggctgg tcccgtttcc tcctgcgccc agtgcggacc tgtctcggcg 481 cccgctgccc tctcaccgcc ccacgcagga tcccggcctg gtcaccgggc agtgtgatgc 541 ttcccgactg ccgcggggac agegaggcac acacagggct tgggccgcgc cggaggccac 601 acggcctggc tgagttgctc ctggtctccc gcctctccca ggcgacccgg aggtagcatt 661 tcccaggagg cacggtcccc cccaggggga tgggcacagc cacgccagat ggacgagaag 721 accaagaaag gctgtgggtg agcgtggagg atgetcagat gcacaccgtc accatctggc 781 tcacagtgcg ccctgatatg acagtggcgt ctctcaagga catggttttt ctggactatg 841 gcttcccacc agtcttgcag cagtgggtga ttgggcagcg gctggcacga gaccaggaga 901 ccctgcactc ccatggggtg eggcagaatg gggacagtgc ctacctctat ctgctgtcag 961 cccgcaacac ctccctcaac cctcaggagc tgcagcggga gcggcagctg eggatgetgg 1021 aagatctggg cttcaaggac ctcacgctgc agecgegggg ccctctggag ccaggccccc 1081 caaagcccgg ggtcccccag gaacccggac gggggcagee agatgeagtg cctgagcccc 1141 caccggtggg ctggcagtgc cccgggtgca ccttcatcaa caagcccacg cggcctggct 1201 gtgagatgtg ctgccgggcg cgccccgagg cctaccaggt ccccgcctca taccagcccg 1261 acgaggagga gcgagcgcgc ctggcgggcg aggaggaggc getgegtcag taccagcagc 1321 ggaagcagca gcagcaggag gggaactacc tgcagcacgt ccagctggac cagaggagee 1381 tggtgctgaa cacggagccc gccgagtgcc ccgtgtgcta ctcggtgctg gcgcccggcg 1441 aggccgtggt getgegtgag tgtctgeaca ccttctgcag ggagtgcctg cagggcacca 1501 tccgcaacag ecaggaggeg gaggtctcct gccccttcat tgacaacacc tactegtget 1561 egggcaaget gctggagagg gagatcaagg cgctcctgac ccctgaggat taccagegat 1621 ttctagacct gggcatctcc attgetgaaa accgcagtgc cttcagctac cattgeaaga
1681 ccccagattg caagggatgg tgcttctttg aggatgatgt caatgagttc acctgccctg 1741 tgtgtttcca cgtcaactgc ctgctctgca aggccatcca tgagcagatg aactgcaagg 1801 agtatcagga ggacctggcc ctgcgggctc agaacgatgt ggctgcccgg cagacgacag 1861 agatgctgaa ggtgatgctg cagcagggcg aggccatgcg ctgcccccag tgccagatcg 1921 tggtacagaa gaaggacggc tgcgactgga tccgctgcac cgtctgccac accgagatct 1981 gctgggtcac caagggccca cgctggggcc ctgggggccc aggagacacc agcgggggct 2041 gccgctgcag ggtaaatggg attccttgcc acccaagctg tcagaactgc cactgagcta 2101 aagatggtgg ggccacatgc tgacccagcc ccacatccac attctgttag aatgtagctc 2161 agggagcttc gtggacggcc ttgcttgctg tagcgttgta ggggccctgc ctgcactgcg 2221 gttgtccacg gtcacatctg ccccagtgcc tttgtccttc ccttggggct tgccggccag 2281 acttctctcc cctgcggctc ccacctctgc ctgaccccag ccttaaacat agcccctggc 2341 cagaggcctt gctgggtgga gcctctgtgt gactccatac tcctcccacc acaacactca 2401 tctgtcaaac accaagcact ctcagcctcc ccgccttcag ctgtcagctt tctggggcta 2461 acttctctgc ctttgtggtt ggaggcctga ggcctcttgg aactcttgct aacctgttca 2521 gagccaggaa ggagactgca cagttttgaa agcacagccc gtcaggtccg gctctgcgtc 2581 tccctctctg cagcctgtgt aagctattat aattaaaatg gttttccggg aagggatgag 2641 tgtgatgtcc ttgagaggaa atgaatgtcc tggcctggga ctctacacac aggcaggatc 2701 ctgaggtctc tgggaactgc atcagaaagt tgacttgtca gtccatctgt ggtagaatga 2761 ggctgtgact gagcactggg acctttctac cagatgtgga ccccatgccc agcctcaggg 2821 gcaaggatgc tcttgggtca ccgtcagcca ggacaggtgg agtgtgcagt gtgtcaagtc 2881 tgcagagaag gatgggctta ggggcgggag gggaagtctt gccactcctg ctcccttttg 2941 acctctcagc aggcatctag ggttggcagg tagatagttc aagaaggaac gaagctgctg 3001 cagttgaggg gtggggttgt ccatcctatt ttctcgtctc aagcaagatg gcacagtatc 3061 gattcagcag tatttactag aacccactct gtgctggtcg gaggttacta agacagggtc 3121 ctgggatgtt cattctctaa gtctttcctc cgctctgtga cccaccctcc ttcccctttt 3181 gagatctggt atttgatgcc caacacattg tccacgctgt gacgtgacca tcatcatagc 3241 aggcagaggg cgcctctgct gctgaaggcc tgtgattttg tggggaaggg cctgttctag 3301 caactggaaa ggcactgcca cctgccgttg gatgccagga ctcaagagct ggccccagtc 3361 actgtgcgca gagctgtctg agaatgtgtg agtggactgg gtccttcggc actgcctgca 3421 ttggctcagg gcagtcaacc gtcgcagagg atgaggggca cactcaggca gcctccccgg 3481 ccctggaggc agaaaggccc aggcagaacc actgactggg aggaaacaga aaaagcagag 3541 gagagccagg ctgcaggcgt gtggatggga ccagctcagg cagacgctgt ctcataccca 3601 ctctcccctc tcttgccagg gcctggcctg gtgtctctca ggagcctggg catgagacaa 3661 aagcagagat tgttctcttg tggtaccaca ggctgtaacc agtccaccca gtgttgtttt 3721 agaaatttaa atcggttgcc catcttttta aattggcaac atcgtttacc acattaaaat 3781 ctagatgccc tgcttctctt gaaaaaaaaa aaaaaaaa
SEP ID NO: 37 Human RBCK1 Isoform 1 Amino Acid Sequence (NP 006453.1)
1 mgtatpdgre dqerlwvsve daqmhtvtiw ltvrpdmtva slkdmvfldy gfppvlqqwv
61 igqrlardqe tlhshgvrqn gdsaylylls arntslnpqe lqrerqlrml edlgfkdltl
121 qprgplepgp pkpgvpqepg rgqpdavpep ppvgwqcpgc tfinkptrpg cemccrarpe
181 ayqvpasyqp deeerarlag eeealrqyqq rkqqqqegny Iqhvqldqrs Ivlntepaec
241 pvcysvlapg eavvlreclh tfcreclqgt irnsqeaevs cpfidntysc sgkllereik
301 alltpedyqr fldlgisiae nrsafsyhck tpdckgwcff eddvneftcp vcfhvncllc
361 kaiheqmnck eyqedlalra qndvaarqtt emlkvmlqqg eamrcpqcqi vvqkkdgcdw
421 irctvchtei cwvtkgprwg pggpgdtsgg crcrvngipc hpscqnch
SEP ID NO: 38 Human RBCK1 Transcript Variant 2 cDNA Sequence
(NM 031229.3, CDS region from position 709-2241)
1 ccccgcctgc ggcccagctc cttcccgcgg ctctgcgatg cggcccgcag ggtgacccgg 61 gcgggagtcc ggggacccgc gatcagcccc ggaggacggg gtggggtcgc cccaaacagg 121 agcgccggga ccgctgggac cccgcactcg gcgtccgccg ccgccgggta gccgggcagt 181 ggaggtcccg gatgaggcga caatttttcc ggccccccct cccagtcccg ccccacttcc 241 ggggccgcca ctttcacttt ctcttccgcc gaagccgctc cccttgcgaa gaactggggc 301 ctcccgggag gagagagggc tttgccttga aacccgggac gccaggggcg ctcccgcaag 361 tgggggtcct ccgggacttg gaacgccccg gctgggtggt gtccgggcgt cctttccccg 421 cttcttccca cctcggctgg tcccgtttcc tcctgcgccc agtgcggacc tgtctcggcg 481 cccgctgccc tctcaccgcc ccacgcagga tcccggcctg gtcaccgggc agtgtgatgc 541 ttcccgactg ccgcggggac agcgaggcac acacagggct tgggccgcgc cggaggccac 601 acggcctggc tgagttgctc ctggtctccc gcctctccca ggcgacccgg aggtagcatt
661 tcccaggagg cacggtcccc cccaggggga tgggcacagc cacgccagat ggacgagaag 721 accaagaaag cagaggaaat ggccctgagc ctcacccgag cagtggcggg cggggatgaa 781 caggtggcaa tgaagtgtgc catctggctg gcagagcaac gggtgcccct gagtgtgcaa 841 ctgaagcctg aggtctcccc aacgcaggac atcaggctgt gggtgagcgt ggaggatgct 901 cagatgcaca ccgtcaccat ctggctcaca gtgcgccctg atatgacagt ggcgtctctc 961 aaggacatgg tttttctgga ctatggcttc ccaccagtct tgcagcagtg ggtgattggg 1021 cagcggctgg cacgagacca ggagaccctg cactcccatg gggtgcggca gaatggggac 1081 agtgcctacc tctatctgct gtcagcccgc aacacctccc tcaaccctca ggagctgcag 1141 cgggagcggc agctgcggat gctggaagat ctgggcttca aggacctcac gctgcagccg 1201 cggggccctc tggagccagg ccccccaaag cccggggtcc cccaggaacc cggacggggg 1261 cagccagatg cagtgcctga gcccccaccg gtgggctggc agtgccccgg gtgcaccttc 1321 atcaacaagc ccacgcggcc tggctgtgag atgtgctgcc gggcgcgccc cgaggcctac 1381 caggtccccg cctcatacca gcccgacgag gaggagcgag cgcgcctggc gggcgaggag 1441 gaggcgctgc gtcagtacca gcagcggaag cagcagcagc aggaggggaa ctacctgcag 1501 cacgtccagc tggaccagag gagcctggtg ctgaacacgg agcccgccga gtgccccgtg 1561 tgctactcgg tgctggcgcc cggcgaggcc gtggtgctgc gtgagtgtct gcacaccttc 1621 tgcagggagt gcctgcaggg caccatccgc aacagccagg aggcggaggt ctcctgcccc 1681 ttcattgaca acacctactc gtgctcgggc aagctgctgg agagggagat caaggcgctc 1741 ctgacccctg aggattacca gcgatttcta gacctgggca tctccattgc tgaaaaccgc 1801 agtgccttca gctaccattg caagacccca gattgcaagg gatggtgctt ctttgaggat 1861 gatgtcaatg agttcacctg ccctgtgtgt ttccacgtca actgcctgct ctgcaaggcc 1921 atccatgagc agatgaactg caaggagtat caggaggacc tggccctgcg ggctcagaac 1981 gatgtggctg cccggcagac gacagagatg ctgaaggtga tgctgcagca gggcgaggcc 2041 atgcgctgcc cccagtgcca gatcgtggta cagaagaagg acggctgcga ctggatccgc 2101 tgcaccgtct gccacaccga gatctgctgg gtcaccaagg gcccacgctg gggccctggg 2161 ggcccaggag acaccagcgg gggctgccgc tgcagggtaa atgggattcc ttgccaccca 2221 agctgtcaga actgccactg agctaaagat ggtggggcca catgctgacc cagccccaca 2281 tccacattct gttagaatgt agctcaggga gcttcgtgga cggccttgct tgctgtagcg 2341 ttgtaggggc cctgcctgca ctgcggttgt ccacggtcac atctgcccca gtgcctttgt 2401 ccttcccttg gggcttgccg gccagacttc tctcccctgc ggctcccacc tctgcctgac 2461 cccagcctta aacatagccc ctggccagag gccttgctgg gtggagcctc tgtgtgactc 2521 catactcctc ccaccacaac actcatctgt caaacaccaa gcactctcag cctccccgcc 2581 ttcagctgtc agctttctgg ggctaacttc tctgcctttg tggttggagg cctgaggcct 2641 cttggaactc ttgctaacct gttcagagcc aggaaggaga ctgcacagtt ttgaaagcac 2701 agcccgtcag gtccggctct gcgtctccct ctctgcagcc tgtgtaagct attataatta 2761 aaatggtttt ccgggaaggg atgagtgtga tgtccttgag aggaaatgaa tgtcctggcc 2821 tgggactcta cacacaggca ggatcctgag gtctctggga actgcatcag aaagttgact 2881 tgtcagtcca tctgtggtag aatgaggctg tgactgagca ctgggacctt tctaccagat 2941 gtggacccca tgcccagcct caggggcaag gatgctcttg ggtcaccgtc agccaggaca 3001 ggtggagtgt gcagtgtgtc aagtctgcag agaaggatgg gcttaggggc gggaggggaa 3061 gtcttgccac tcctgctccc ttttgacctc tcagcaggca tctagggttg gcaggtagat 3121 agttcaagaa ggaacgaagc tgctgcagtt gaggggtggg gttgtccatc ctattttctc 3181 gtctcaagca agatggcaca gtatcgattc agcagtattt actagaaccc actctgtgct 3241 ggtcggaggt tactaagaca gggtcctggg atgttcattc tctaagtctt tcctccgctc 3301 tgtgacccac cctccttccc cttttgagat ctggtatttg atgcccaaca cattgtccac 3361 gctgtgacgt gaccatcatc atagcaggca gagggcgcct ctgctgctga aggcctgtga 3421 ttttgtgggg aagggcctgt tctagcaact ggaaaggcac tgccacctgc cgttggatgc 3481 caggactcaa gagctggccc cagtcactgt gcgcagagct gtctgagaat gtgtgagtgg 3541 actgggtcct tcggcactgc ctgcattggc tcagggcagt caaccgtcgc agaggatgag 3601 gggcacactc aggcagcctc cccggccctg gaggcagaaa ggcccaggca gaaccactga 3661 ctgggaggaa acagaaaaag cagaggagag ccaggctgca ggcgtgtgga tgggaccagc 3721 tcaggcagac gctgtctcat acccactctc ccctctcttg ccagggcctg gcctggtgtc 3781 tctcaggagc ctgggcatga gacaaaagca gagattgttc tcttgtggta ccacaggctg 3841 taaccagtcc acccagtgtt gttttagaaa tttaaatcgg ttgcccatct ttttaaattg 3901 gcaacatcgt ttaccacatt aaaatctaga tgccctgctt ctcttgaaaa aaaaaaaaaa 3961 aaa
SEP ID NO: 39 Human RBCK1 Isoform 2 Amino Acid Sequence (NP 006453.1)
1 mdektkkaee malsltrava ggdeqvamkc aiwlaeqrvp lsvqlkpevs ptqdirlwvs
61 vedaqmhtvt iwltvrpdmt vaslkdmvfl dygfppvlqq wvigqrlard qetlhshgvr
121 qngdsaylyl lsarntslnp qelqrerqlr mledlgfkdl tlqprgplep gppkpgvpqe
181 pgrgqpdavp epppvgwqcp gctfinkptr pgcemccrar peayqvpasy qpdeeerarl
241 ageeealrqy qqrkqqqqeg nylqhvqldq rslvlntepa ecpvcysvla pgeavvlrec
301 lhtfcreclq gtirnsqeae vscpfidnty scsgkllere ikalltpedy qrfldlgisi
361 aenrsafsyh cktpdckgwc ffeddvneft cpvcfhvncl lckaiheqmn ckeyqedlal
421 raqndvaarq ttemlkvmlq qgeamrcpqc qivvqkkdgc dwirctvcht eicwvtkgpr
481 wgpggpgdts ggcrcrvngi pchpscqnch
SEP ID NO: 40 Human RBCK1 Transcript Variant 3 cDNA Sequence (NM 001323956.1, CDS region from position 1058-2080)
1 ccccgcctgc ggcccagctc cttcccgcgg ctctgcgatg cggcccgcag ggtgacccgg 61 gcgggagtcc ggggacccgc gatcagcccc ggaggacggg gtggggtcgc cccaaacagg 121 agcgccggga ccgctgggac cccgcactcg gcgtccgccg ccgccgggta gccgggcagt 181 ggaggtcccg gatgaggcga caatttttcc ggccccccct cccagtcccg ccccacttcc 241 ggggccgcca ctttcacttt ctcttccgcc gaagccgctc cccttgcgaa gaactggggc 301 ctcccgggag gagagagggc tttgccttga aacccgggac gccaggggcg ctcccgcaag 361 tgggggtcct ccgggacttg gaacgccccg gctgggtggt gtccgggcgt cctttccccg 421 cttcttccca cctcggctgg tcccgtttcc tcctgcgccc agtgcggacc tgtctcggcg 481 cccgctgccc tctcaccgcc ccacgcagga tcccggcctg gtcaccgggc agtgtgatgc 541 ttcccgactg ccgcggggac agcgaggcac acacagggct tgggccgcgc cggaggccac 601 acggcctggc tgagttgctc ctggtctccc gcctctccca ggcgacccgg aggtagcatt 661 tcccaggagg cacggtcccc cccaggggga tgggcacagc cacgccagat ggacgagaag 721 accaagaaag cagaggaaat ggccctgagc ctcacccgag cagtggcggg cggggatgaa 781 caggtggcaa tgaagtgtgc catctggctg gcagagcaac gggtgcccct gagtgtgcaa 841 ctgaagcctg aggtctcccc aacgcaggac atcaggctgt gggtgagcgt ggaggatgct 901 cagatgcaca ccgtcaccat ctggctcaca gtgcgccctg atatgacagt ggcgtctctc 961 aaggacatgg tttttctgga ctatggcttc ccaccagtct tgcagcagtg ggtgattggg 1021 cagcggctgg cacgagacca ggagaccctg cactcccatg gggtgcggca gaatggggac 1081 agtgcctacc tctatctgct gtcagcccgc aacacctccc tcaaccctca ggagctgcag 1141 cgggagcggc agctgcggat gctggaagat ctgggcttca aggacctcac gctgcagccg 1201 cggggccctc tggagccagg ccccccaaag cccggggtcc cccaggaacc cggacggggg 1261 cagccagatg cagtgcctga gcccccaccg gtgggctggc agtgccccgg gtgcaccttc 1321 atcaacaagc ccacgcggcc tggctgtgag atgtgctgcc gggcgcgccc cgaggcctac 1381 caggtccccg cctcatacca gcccgacgag gaggagcgag cgcgcctggc gggcgaggag 1441 gaggcgctgc gtcagtacca gcagggagtg cctgcagggc accatccgca acagccagga 1501 ggcggaggtc tcctgcccct tcattgacaa cacctactcg tgctcgggca agctgctgga 1561 gagggagatc aaggcgctcc tgacccctga ggattaccag cgatttctag acctgggcat 1621 ctccattgct gaaaaccgca gtgccttcag ctaccattgc aagaccccag attgcaaggg 1681 atggtgcttc tttgaggatg atgtcaatga gttcacctgc cctgtgtgtt tccacgtcaa 1741 ctgcctgctc tgcaaggcca tccatgagca gatgaactgc aaggagtatc aggaggacct 1801 ggccctgcgg gctcagaacg atgtggctgc ccggcagacg acagagatgc tgaaggtgat 1861 gctgcagcag ggcgaggcca tgcgctgccc ccagtgccag atcgtggtac agaagaagga 1921 cggctgcgac tggatccgct gcaccgtctg ccacaccgag atctgctggg tcaccaaggg 1981 cccacgctgg ggccctgggg gcccaggaga caccagcggg ggctgccgct gcagggtaaa 2041 tgggattcct tgccacccaa gctgtcagaa ctgccactga gctaaagatg gtggggccac 2101 atgctgaccc agccccacat ccacattctg ttagaatgta gctcagggag cttcgtggac 2161 ggccttgctt gctgtagcgt tgtaggggcc ctgcctgcac tgcggttgtc cacggtcaca 2221 tctgccccag tgcctttgtc cttcccttgg ggcttgccgg ccagacttct ctcccctgcg 2281 gctcccacct ctgcctgacc ccagccttaa acatagcccc tggccagagg ccttgctggg 2341 tggagcctct gtgtgactcc atactcctcc caccacaaca ctcatctgtc aaacaccaag 2401 cactctcagc ctccccgcct tcagctgtca gctttctggg gctaacttct ctgcctttgt 2461 ggttggaggc ctgaggcctc ttggaactct tgctaacctg ttcagagcca ggaaggagac 2521 tgcacagttt tgaaagcaca gcccgtcagg tccggctctg cgtctccctc tctgcagcct 2581 gtgtaagcta ttataattaa aatggttttc cgggaaggga tgagtgtgat gtccttgaga 2641 ggaaatgaat gtcctggcct gggactctac acacaggcag gatcctgagg tctctgggaa 2701 ctgcatcaga aagttgactt gtcagtccat ctgtggtaga atgaggctgt gactgagcac 2761 tgggaccttt ctaccagatg tggaccccat gcccagcctc aggggcaagg atgctcttgg 2821 gtcaccgtca gccaggacag gtggagtgtg cagtgtgtca agtctgcaga gaaggatggg 2881 cttaggggcg ggaggggaag tcttgccact cctgctccct tttgacctct cagcaggcat 2941 ctagggttgg caggtagata gttcaagaag gaacgaagct gctgcagttg aggggtgggg 3001 ttgtccatcc tattttctcg tctcaagcaa gatggcacag tatcgattca gcagtattta
3061 ctagaaccca ctctgtgctg gtcggaggtt actaagacag ggtcctggga tgttcattct 3121 ctaagtcttt cctccgctct gtgacccacc ctccttcccc ttttgagatc tggtatttga 3181 tgcccaacac attgtccacg ctgtgacgtg accatcatca tagcaggcag agggcgcctc 3241 tgctgctgaa ggcctgtgat tttgtgggga agggcctgtt ctagcaactg gaaaggcact 3301 gccacctgcc gttggatgcc aggactcaag agctggcccc agtcactgtg cgcagagctg 3361 tctgagaatg tgtgagtgga ctgggtcctt cggcactgcc tgcattggct cagggcagtc 3421 aaccgtcgca gaggatgagg ggcacactca ggcagcctcc ccggccctgg aggcagaaag 3481 gcccaggcag aaccactgac tgggaggaaa cagaaaaagc agaggagagc caggctgcag 3541 gcgtgtggat gggaccagct caggcagacg ctgtctcata cccactctcc cctctcttgc 3601 cagggcctgg cctggtgtct ctcaggagcc tgggcatgag acaaaagcag agattgttct 3661 cttgtggtac cacaggctgt aaccagtcca cccagtgttg ttttagaaat ttaaatcggt 3721 tgcccatctt tttaaattgg caacatcgtt taccacatta aaatctagat gccctgcttc 3781 tcttgaaaaa aaaaaaaaaa aa
SEP ID NO: 41 Human RBCK1 Transcript Variant 4 cDNA Sequence (NM 001323958.1, CDS region from position 913-1935)
1 ccccgcctgc ggcccagctc cttcccgcgg ctctgcgatg cggcccgcag ggtgacccgg 61 gcgggagtcc ggggacccgc gatcagcccc ggaggacggg gtggggtcgc cccaaacagg 121 agcgccggga ccgctgggac cccgcactcg gcgtccgccg ccgccgggta gccgggcagt 181 ggaggtcccg gatgaggcga caatttttcc ggccccccct cccagtcccg ccccacttcc 241 ggggccgcca ctttcacttt ctcttccgcc gaagccgctc cccttgcgaa gaactggggc 301 ctcccgggag gagagagggc tttgccttga aacccgggac gccaggggcg ctcccgcaag 361 tgggggtcct ccgggacttg gaacgccccg gctgggtggt gtccgggcgt cctttccccg 421 cttcttccca cctcggctgg tcccgtttcc tcctgcgccc agtgcggacc tgtctcggcg 481 cccgctgccc tctcaccgcc ccacgcagga tcccggcctg gtcaccgggc agtgtgatgc 541 ttcccgactg ccgcggggac agcgaggcac acacagggct tgggccgcgc cggaggccac 601 acggcctggc tgagttgctc ctggtctccc gcctctccca ggcgacccgg aggtagcatt 661 tcccaggagg cacggtcccc cccaggggga tgggcacagc cacgccagat ggacgagaag 721 accaagaaag gctgtgggtg agcgtggagg atgctcagat gcacaccgtc accatctggc 781 tcacagtgcg ccctgatatg acagtggcgt ctctcaagga catggttttt ctggactatg 841 gcttcccacc agtcttgcag cagtgggtga ttgggcagcg gctggcacga gaccaggaga 901 ccctgcactc ccatggggtg cggcagaatg gggacagtgc ctacctctat ctgctgtcag 961 cccgcaacac ctccctcaac cctcaggagc tgcagcggga gcggcagctg cggatgctgg 1021 aagatctggg cttcaaggac ctcacgctgc agccgcgggg ccctctggag ccaggccccc 1081 caaagcccgg ggtcccccag gaacccggac gggggcagcc agatgcagtg cctgagcccc 1141 caccggtggg ctggcagtgc cccgggtgca ccttcatcaa caagcccacg cggcctggct 1201 gtgagatgtg ctgccgggcg cgccccgagg cctaccaggt ccccgcctca taccagcccg 1261 acgaggagga gcgagcgcgc ctggcgggcg aggaggaggc gctgcgtcag taccagcagg 1321 gagtgcctgc agggcaccat ccgcaacagc caggaggcgg aggtctcctg ccccttcatt 1381 gacaacacct actcgtgctc gggcaagctg ctggagaggg agatcaaggc gctcctgacc 1441 cctgaggatt accagcgatt tctagacctg ggcatctcca ttgctgaaaa ccgcagtgcc 1501 ttcagctacc attgcaagac cccagattgc aagggatggt gcttctttga ggatgatgtc 1561 aatgagttca cctgccctgt gtgtttccac gtcaactgcc tgctctgcaa ggccatccat 1621 gagcagatga actgcaagga gtatcaggag gacctggccc tgcgggctca gaacgatgtg 1681 gctgcccggc agacgacaga gatgctgaag gtgatgctgc agcagggcga ggccatgcgc 1741 tgcccccagt gccagatcgt ggtacagaag aaggacggct gcgactggat ccgctgcacc 1801 gtctgccaca ccgagatctg ctgggtcacc aagggcccac gctggggccc tgggggccca 1861 ggagacacca gcgggggctg ccgctgcagg gtaaatggga ttccttgcca cccaagctgt 1921 cagaactgcc actgagctaa agatggtggg gccacatgct gacccagccc cacatccaca 1981 ttctgttaga atgtagctca gggagcttcg tggacggcct tgcttgctgt agcgttgtag 2041 gggccctgcc tgcactgcgg ttgtccacgg tcacatctgc cccagtgcct ttgtccttcc 2101 cttggggctt gccggccaga cttctctccc ctgcggctcc cacctctgcc tgaccccagc 2161 cttaaacata gcccctggcc agaggccttg ctgggtggag cctctgtgtg actccatact 2221 cctcccacca caacactcat ctgtcaaaca ccaagcactc tcagcctccc cgccttcagc 2281 tgtcagcttt ctggggctaa cttctctgcc tttgtggttg gaggcctgag gcctcttgga 2341 actcttgcta acctgttcag agccaggaag gagactgcac agttttgaaa gcacagcccg 2401 tcaggtccgg ctctgcgtct ccctctctgc agcctgtgta agctattata attaaaatgg 2461 ttttccggga agggatgagt gtgatgtcct tgagaggaaa tgaatgtcct ggcctgggac 2521 tctacacaca ggcaggatcc tgaggtctct gggaactgca tcagaaagtt gacttgtcag 2581 tccatctgtg gtagaatgag gctgtgactg agcactggga cctttctacc agatgtggac
2641 cccatgccca gcctcagggg caaggatgct cttgggtcac cgtcagccag gacaggtgga 2701 gtgtgcagtg tgtcaagtct gcagagaagg atgggcttag gggcgggagg ggaagtcttg 2761 ccactcctgc tcccttttga cctctcagca ggcatctagg gttggcaggt agatagttca 2821 agaaggaacg aagctgctgc agttgagggg tggggttgtc catcctattt tctcgtctca 2881 agcaagatgg cacagtatcg attcagcagt atttactaga acccactctg tgctggtcgg 2941 aggttactaa gacagggtcc tgggatgttc attctctaag tctttcctcc gctctgtgac 3001 ccaccctcct tccccttttg agatctggta tttgatgccc aacacattgt ccacgctgtg 3061 acgtgaccat catcatagca ggcagagggc gcctctgctg ctgaaggcct gtgattttgt 3121 ggggaagggc ctgttctagc aactggaaag gcactgccac ctgccgttgg atgccaggac 3181 tcaagagctg gccccagtca ctgtgcgcag agctgtctga gaatgtgtga gtggactggg 3241 tccttcggca ctgcctgcat tggctcaggg cagtcaaccg tcgcagagga tgaggggcac 3301 actcaggcag cctccccggc cctggaggca gaaaggccca ggcagaacca ctgactggga 3361 ggaaacagaa aaagcagagg agagccaggc tgcaggcgtg tggatgggac cagctcaggc 3421 agacgctgtc tcatacccac tctcccctct cttgccaggg cctggcctgg tgtctctcag 3481 gagcctgggc atgagacaaa agcagagatt gttctcttgt ggtaccacag gctgtaacca 3541 gtccacccag tgttgtttta gaaatttaaa tcggttgccc atctttttaa attggcaaca 3601 tcgtttacca cattaaaatc tagatgccct gcttctcttg aaaaaaaaaa aaaaaaa
SEP ID NO: 42 Human RBCK1 Isoform 3 Amino Acid Sequence (NP 006453.1)
1 mgcgrmgtvp tsiccqpatp pstlrscsgs gscgcwkiwa srtsrcsrga lwsqapqspg
61 sprnpdggsq mqclsphrwa gsapgapsst sprglavrca agraprptrs pphtsptrrs
121 erawrarrrr cvstsreclq gtirnsqeae vscpfidnty scsgkllere ikalltpedy
181 qrfldlgisi aenrsafsyh cktpdckgwc ffeddvneft cpvcfhvncl lckaiheqmn
241 ckeyqedlal raqndvaarq ttemlkvmlq qgeamrcpqc qivvqkkdgc dwirctvcht
301 eicwvtkgpr wgpggpgdts ggcrcrvngi pchpscqnch
SEP ID NO: 43 Human RBCK1 Transcript Variant 5 cDNA Sequence
(NM 001323960.1, CDS region from position 709-1026)
1 ccccgcctgc ggcccagctc cttcccgcgg ctctgcgatg cggcccgcag ggtgacccgg 61 gcgggagtcc ggggacccgc gatcagcccc ggaggacggg gtggggtcgc cccaaacagg 121 agcgccggga ccgctgggac cccgcactcg gcgtccgccg ccgccgggta gccgggcagt 181 ggaggtcccg gatgaggcga caatttttcc ggccccccct cccagtcccg ccccacttcc 241 ggggccgcca ctttcacttt ctcttccgcc gaagccgctc cccttgcgaa gaactggggc 301 ctcccgggag gagagagggc tttgccttga aacccgggac gccaggggcg ctcccgcaag 361 tgggggtcct ccgggacttg gaacgccccg gctgggtggt gtccgggcgt cctttccccg 421 cttcttccca cctcggctgg tcccgtttcc tcctgcgccc agtgcggacc tgtctcggcg 481 cccgctgccc tctcaccgcc ccacgcagga tcccggcctg gtcaccgggc agtgtgatgc 541 ttcccgactg ccgcggggac agcgaggcac acacagggct tgggccgcgc cggaggccac 601 acggcctggc tgagttgctc ctggtctccc gcctctccca ggcgacccgg aggtagcatt 661 tcccaggagg cacggtcccc cccaggggga tgggcacagc cacgccagat ggacgagaag 721 accaagaaag cagaggaaat ggccctgagc ctcacccgag cagtggcggg cggggatgaa 781 caggtggcaa tgaagtgtgc catctggctg gcagagcaac gggtgcccct gagtgtgcaa 841 ctgaagcctg aggtctcccc aacgcaggac atcagattcc tcatggtgca aaatggccat 901 tccagctcca tccagccatc acatcacagg aggaagggaa gaaagacacc cctccacact 961 cttctaaaga gcatagctca aaaattgtac acacttcttc cgttaattcc tgtggaccag 1021 aactgattcc cacagctaca gttcagcttg aggggagact gtatagccaa gatattcagc 1081 tagaattcag gggttcgctt ggtaagggaa gggaagagaa tggatactgt cggtctgtgc 1141 tccaggagac ttaaactcaa tgctgaaaca ctttgcacaa tgcctggcgt gttatgcact 1201 caataataaa cattagtgtc tatcgttaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1261 aaaaaaaaaa aaaa
SEP ID NP: 44 Human RBCK1 Isoform 4 Amino Acid Sequence
(NP 001310889.1)
1 mdektkkaee malsltrava ggdeqvamkc aiwlaeqrvp lsvqlkpevs ptqdirflmv 61 qnghsssiqp shhrrkgrkt plhtllksia qklytllpli pvdqn
SEP ID NP: 45 Mouse RBCK1 Transcript Variant 1 cDNA Sequence
(NM 001083921.1, CDS region from position 371-1897)
1 cgctgctcgc gctgtcttcc gggtagcgcg agcctccggg ctggggttcc ggacgctagg
61 gcgcccgcgc cggctggctg gccggcctcc ctccgtccct cgcttttggg tcgtggttac 121 tcatcgccct ttgcagactt ggctcggggc ctccttcgct gtccgtgtcc ctcgcggggc 181 cccattggtt cccagtgccc ggcctcgggc cctgggcagt gtgatgctgc ccgagtgcgg 241 actggaacac acgcacgagg ccggctaggg cagagttgct tctaccttcc cgctctctcc 301 caggttacct caaagtagcg ttttccggaa gcagcagccc tttctgaggg gatgggcgca 361 gccaggccag atggacgaga agaccaagaa agcagaggag atggccctga gccttgcccg 421 ggcagtggct ggcggagatg aacaggctgc tatcaagtat gccacctggc tggcagagca 481 gagggtgccc ctcagggtgc aagtaaaacc cgaggtctcc ccaacacagg acatcaggct 541 ctgtgtgagt gtggaggatg cgtacatgca caccgtcacc atttggctca cagtacgccc 601 ggatatgaca gtggcctccc ttaaggacat ggtattcctg gactatggct tcccacctag 661 cctgcagcag tgggtggttg gacagaggct ggcacgagac caggagacct tgcattcaca 721 cggcattcgg cggaatggag acggtgccta tctctacctg ctgtcagccc gcaacacgtc 781 actcaaccca caagagctgc agcggcagcg gcaactgcga atgttggaag atttgggctt 841 caaggacctc acccttcagt cacgggggcc cttggaacct gtccttccga agcccaggac 901 caaccaggag ccgggacagc cagatgcagc accggagtca ccaccggtgg gctggcagtg 961 ccctggctgc actttcatca acaaacccac acggcctggg tgtgagatgt gctgtcgtgc 1021 aaggcctgag acctaccaga tacctgcttc ataccagcct gacgaggaag agcgagcacg 1081 cctggccggc gaggaggagg cgctgcgcca gtaccagcag cggaaacagc agcagcagga 1141 ggggaactac ctgcagcacg tgcagctgga gcagaggagc ctggtgctga acaccgaacc 1201 tactgagtgc cctgtgtgct actcagtgct ggcacccggc gaggccgtgg tgctgcgtga 1261 gtgtctgcac accttctgca gggagtgcct gcagggcacc atccgaaaca gccaggaggc 1321 ggaggtggct tgccccttca ttgacagcac ctactcatgc cccggcaagc tgctggagag 1381 agagatccgg gcgctcctgt cccctgagga ctaccagcgt ttcctggatc tgggtgtgtc 1441 catcgcagag aaccgaagca ccttgagcta ccactgcaag acccccgact gcaggggttg 1501 gtgcttcttt gaggatgatg tcaacgagtt cacctgtcct gtgtgcaccc gtgtcaactg 1561 cctgctctgc aaggccatcc atgagcacat gaattgcagg gagtaccaag acgacctggc 1621 cctgcgggct cagaatgatg tggctgcccg gcagacgaca gagatgctaa aggtaatgct 1681 gcagcagggc gaggccatgc actgcccaca gtgccggatt gtggtgcaga agaaggacgg 1741 ctgtgactgg atccgctgta cagtctgcca cactgagatc tgctgggtca ccaagggccc 1801 acgctggggc ccagggggcc caggggacac cagtggtggc tgccgctgcc gggtcaatgg 1861 gattccatgc cacccaagct gtcaaaactg ccactaagtc gacgatggtg gctctcatac 1921 tgacccagcc ccacatgtat agcagtgaac agcagggcta ggcaagggac tggcctggtt 1981 tggccccata cctttaggct tggtaaggga gaaagcccga gctgtactgc agtctgattg 2041 ctgtgttaca aggacccagc tgagctgatg tcattcgcac tgcctctgtt gcttctggct 2101 gaccagacct catggccctg cactagacac ccgaccctta ctagccacca gccttaatta 2161 aacacggcct tggcctaagg cctggctggc tagtgctctg agtgactcta ttttccctga 2221 gcttgctccc tgaggaccca ccacagcctc atcctttgcc ttgctggctt tctgggcacg 2281 tcttaaagct gatgtgaatc catccagggc ctaggtagat tggtaagtca ggaaacagcc 2341 catggggttc agctctgcat cctcctcttt aagtgaatta aagtggtttt cccagaaaaa 2401 aaaaaaaaaa
SEP ID NO: 46 Mouse RBCK1 Transcript Variant 2 cDNA Sequence (NM 019705.3, CDS region from position 212-1738)
1 gcctggagtc ggccgggtgg gggagagggg ggggatcatg ggtccctaga ccaagtgact 61 ctggtccgcc caaccaagtg tggcgcgaaa gtgccaggag cagtctagag gtctgcccca 121 gttggtgacc ctgcagagtc tcgggttacc tcaaagtagc gttttccgga agcagcagcc 181 ctttctgagg ggatgggcgc agccaggcca gatggacgag aagaccaaga aagcagagga 241 gatggccctg agccttgccc gggcagtggc tggcggagat gaacaggctg ctatcaagta 301 tgccacctgg ctggcagagc agagggtgcc cctcagggtg caagtaaaac ccgaggtctc 361 cccaacacag gacatcaggc tctgtgtgag tgtggaggat gcgtacatgc acaccgtcac 421 catttggctc acagtacgcc cggatatgac agtggcctcc cttaaggaca tggtattcct 481 ggactatggc ttcccaccta gcctgcagca gtgggtggtt ggacagaggc tggcacgaga 541 ccaggagacc ttgcattcac acggcattcg gcggaatgga gacggtgcct atctctacct 601 gctgtcagcc cgcaacacgt cactcaaccc acaagagctg cagcggcagc ggcaactgcg 661 aatgttggaa gatttgggct tcaaggacct cacccttcag tcacgggggc ccttggaacc 721 tgtccttccg aagcccagga ccaaccagga gccgggacag ccagatgcag caccggagtc 781 accaccggtg ggctggcagt gccctggctg cactttcatc aacaaaccca cacggcctgg 841 gtgtgagatg tgctgtcgtg caaggcctga gacctaccag atacctgctt cataccagcc 901 tgacgaggaa gagcgagcac gcctggccgg cgaggaggag gcgctgcgcc agtaccagca 961 gcggaaacag cagcagcagg aggggaacta cctgcagcac gtgcagctgg agcagaggag
1021 cctggtgctg aacaccgaac ctactgagtg ccctgtgtgc tactcagtgc tggcacccgg 1081 cgaggccgtg gtgctgcgtg agtgtctgca caccttctgc agggagtgcc tgcagggcac 1141 catccgaaac agccaggagg cggaggtggc ttgccccttc attgacagca cctactcatg 1201 ccccggcaag ctgctggaga gagagatccg ggcgctcctg tcccctgagg actaccagcg 1261 tttcctggat ctgggtgtgt ccatcgcaga gaaccgaagc accttgagct accactgcaa 1321 gacccccgac tgcaggggtt ggtgcttctt tgaggatgat gtcaacgagt tcacctgtcc 1381 tgtgtgcacc cgtgtcaact gcctgctctg caaggccatc catgagcaca tgaattgcag 1441 ggagtaccaa gacgacctgg ccctgcgggc tcagaatgat gtggctgccc ggcagacgac 1501 agagatgcta aaggtaatgc tgcagcaggg cgaggccatg cactgcccac agtgccggat 1561 tgtggtgcag aagaaggacg gctgtgactg gatccgctgt acagtctgcc acactgagat 1621 ctgctgggtc accaagggcc cacgctgggg cccagggggc ccaggggaca ccagtggtgg 1681 ctgccgctgc cgggtcaatg ggattccatg ccacccaagc tgtcaaaact gccactaagt 1741 cgacgatggt ggctctcata ctgacccagc cccacatgta tagcagtgaa cagcagggct 1801 aggcaaggga ctggcctggt ttggccccat acctttaggc ttggtaaggg agaaagcccg 1861 agctgtactg cagtctgatt gctgtgttac aaggacccag ctgagctgat gtcattcgca 1921 ctgcctctgt tgcttctggc tgaccagacc tcatggccct gcactagaca cccgaccctt 1981 actagccacc agccttaatt aaacacggcc ttggcctaag gcctggctgg ctagtgctct 2041 gagtgactct attttccctg agcttgctcc ctgaggaccc accacagcct catcctttgc 2101 cttgctggct ttctgggcac gtcttaaagc tgatgtgaat ccatccaggg cctaggtaga 2161 ttggtaagtc aggaaacagc ccatggggtt cagctctgca tcctcctctt taagtgaatt 2221 aaagtggttt tcccagaaaa aaaaaaaaaa al
SEP ID NO: 47 Mouse RBCK1 Amino Acid Sequence (NP 001077390.1)
1 mdektkkaee malslarava ggdeqaaiky atwlaeqrvp lrvqvkpevs ptqdirlcvs
61 vedaymhtvt iwltvrpdmt vaslkdmvfl dygfppslqq wvvgqrlard qetlhshgir
121 rngdgaylyl lsarntslnp qelqrqrqlr mledlgfkdl tlqsrgplep vlpkprtnqe
181 pgqpdaapes ppvgwqcpgc tfinkptrpg cemccrarpe tyqipasyqp deeerarlag
241 eeealrqyqq rkqqqqegny Iqhvqleqrs Ivlnteptec pvcysvlapg eavvlreclh
301 tfcreclqgt irnsqeaeva cpfidstysc pgkllereir allspedyqr fldlgvsiae
421 qndvaarqtt emlkvmlqqg eamhcpqcri vvqkkdgcdw irctvchtei cwvtkgprwg
481 pggpgdtsgg crcrvngipc hpscqnch
SEP ID NO: 48 Human OTULIN cDNA Sequence (NM 138348.5, CDS region from position 182-1240)
1 cacctcctcg cgcagggtca gaggccgtgg ggcgggccac ggtgacgcgc gcggaagcgc 61 tctgcgggcc ctcggaaacc gccccggcgg ctgagaggct gcggccactg cctggcaccc 121 cgacgggagg ggctccggat cgttcggagc cggctgaacc ccttcggccg cgagcgaccg 181 catgagtcgg gggactatgc cccagcccga agcgtggcca ggcgcgagct gcgccgagac 241 gccggcgcgg gaggcggcgg ccacggcgcg ggacggcggg aaggcggcgg ccagcgggca 301 gccgcggccc gagatgcagt gcccggccga gcatgaggag gacatgtacc gtgctgcaga 361 tgaaatagaa aaggagaaag aattgcttat acatgaaaga ggggcatcag aaccgagatt 421 aagcgtagct cctgaaatgg atatcatgga ctactgcaaa aaagaatgga gaggaaatac 481 acagaaagca acgtgtatga aaatgggcta tgaagaggtt tctcagaagt tcacctccat 541 acggcgagtc cgtggtgata attactgtgc actgagggcc acgctgttcc aggccatgag 601 ccaggctgtg gggctgccgc cctggctgca ggacccggag ctcatgctgt taccagaaaa 661 actcataagc aaatacaact ggatcaagca atggaaactt ggactgaaat ttgatgggaa 721 gaatgaggac ctggttgata aaattaaaga gtcccttact ctgctgagga agaagtgggc 781 aggcttggct gaaatgagaa ctgctgaagc aagacagata gcttgtgatg aactattcac 841 aaatgaggcg gaggaatata gcctctatga agctgtaaaa tttctaatgc taaacagagc 901 cattgaacta tataatgata aagagaaagg aaaggaagta ccatttttct ctgtgcttct 961 gtttgctcgg gacacatcaa atgacccagg acagcttctg aggaaccacc tcaaccaggt 1021 gggacacact ggtggtcttg aacaggttga aatgttcctt cttgcctatg ctgtgcgcca 1081 caccatccag gtgtaccggc tctccaagta caacacggaa gaattcatca cagtctaccc 1141 caccgaccca cccaaggact ggccagtggt aacgctcatt gctgaggacg atcggcacta 1201 taacatcccc gtcagagtgt gtgaggagac cagtctatga gagacgcatg ctcctgacag 1261 cctggcgacg tggcgaagat gcacaggtgg ctcctgggct tgggctgcag gtttgggggt 1321 ctctaagaac aatctctgag aagaaccctt gggcccctgg gagccaagtt ggacaggatg 1381 tcctgaagac tagcttttga taagagaaat taaccaagtc tttcccctca tctatgatgc 1441 aatatatttc agtgggggcc ttcagagcac acctgttgga cggtgcaaac catatcttct 1501 ccagaaggca aatacttttg tatcagagga aactcagttt tggagaggaa tatgttcttt
1561 atgtctcaaa tcaaaactct ctctaatggt aaactggctt ctaatttttt taagtacagt 1621 attttttttt cccctttagt agtaacgggt ttctatagat cttcctatac agtctgcttt 1681 aactcaggac cttgagatta tgagactgac gtgctgccca ctgcactgag ggggcttcta 1741 acagtctgct ttaagtggta taattctggg atagatctgt tactggcata gtcatgacaa 1801 cctctggtaa tcttaccttc tcctttttat gaagggaaga gcaatggttt ggacttacat 1861 cttaattaag gctattttaa gcagattgtt ttgcaacaga ttaagaattg ggtcccaaag 1921 tgggttattt caaggcattt ttgaagactg gaggagcgta ggagggagtg gtgagggaac 1981 ctagaacttc ttgctccttg tgactatgac agatgtctga tgcccccagc gcactggagt 2041 ctggggcttg gtgcaggtgg tgccccatca gtgtggacag acactacttg cctttgtggt 2101 ttagtgttgg aagctttaat tattctacag ttccatagat tcacaatttt atagccaaac 2161 agtttgtatc cacctgcttt cagaggagga accaaaggcc aaattacttt gaggtagggc 2221 ttagctggac ctgggttttc ctatgctctt ttcatgctgt gttggagggt gtgtccactg 2281 ccagatctgt gtaacccgtc tgggtcaggg gatgagtgac agcaaaccat cttaaaattt 2341 ttcatgagta catttaagcg gaagcatacg ggaatatgag tgcaaaagtg tggctgagcc 2401 gcgtatgccc ttgattggtt ttgggaagcc tgagggaggc agccttcctg gctatgagcc 2461 atcgcctgcc caatcaggct aagggtggtg actggggtgg tgaaggggca gctctgctga 2521 gcatggtctg ccttatggcc tgaattgtcc tcaaggggtg tggactgcag atggtgttca 2581 catgaaccgg agacatcact ctttaggatt ctactggcag cccctgaatt ggctcaacgt 2641 ttgtggaggt ggtatttccc tgaagtactg agctttgttt tataataatt aaaatcctta 2701 tttggtccaa tttaatatag tttagaagct attttttttg aggcaaaccg tttttgaaaa 2761 tgtaaatttt gtttttaatt aaaaataaag tcttagttaa gaaaactcag gatgcacaaa 2821 actattcaga ctgttacttt agctttctcc cattacctca tcagtaatat tcaccacatt 2881 ttgctaaata tttattgatt agagtgttga aatcaaattc tgctctaaat gtgtgtgaat 2941 atgttggaga ggctttgtgt tcttcactgt gaaatgcaat tgtgccttga ataagaaggt 3001 acctagaagc caaattaaag taataatgac ttcttattgg ctttgatttt tcattgcagt 3061 atatgggatt gtacagcagg aaatgcttat cattaatttc tgatgttttt taaagcacaa 3121 ctcgaaacat ttcgatcata catacatagc agtagagatc tgtgcccttc aggtacattg 3181 aatctgacca tcagtttata tatgtcattg aattttaaga atactcatgt taataatagt 3241 catctatcct tgcattttga aactgttcta atcttagtga acttgaattg gatttctggg 3301 taaaagaatg tgtttctttt atgttgctta tgtccgaagg ccttgtcaga atctgtcaga 3361 ctcttgttta ggtttagtgt gatcatggcg tcagagaagc aaagctttca aataaatagt 3421 acttcaggaa atagaaatga ttgaccaact ttaaaaataa ttttttttta attgcaatat 3481 gcagcttcag ttgcccagaa tcttagttcc gtttctcatt cttggtcttg agctggtcag 3541 gtgacatcag cagattagaa gttgaatgga gattaagtgg attcaggagg atgttccact 3601 tagagcagtc ttcaaaatga taaggtgttc tagaagaaag gaatgtagta ggaactatac 3661 tatgcctaac tttctatccc agagtgtctt gcaagagttt aggagttttg gaccctgtgt 3721 attggcagaa aagttatctc catcttaagc aggcatgact tttatacctg tgagctcatt 3781 taaggtgcat ttaaacctaa aataatttcc ctgtattatg cttcatggga ttaacactgc 3841 ttttccagaa cattttcaga ttcccctcct tacatcctga gctccttctg tatatacatc 3901 tgttgatttt atccatccac aaggaacaat gatagtcaca ttagagaaca agaaaccagt 3961 aatacatggt ctctaactga tgattcgggc ctggatttga ttgaaagtgt ttgcagttcc 4021 tcttccgtag aatacagagt ggatgaaaat gttttcaatg cacagaacag gatgaatcct 4081 tttttcttta tttagcgatt tacacttttg ttactctatt atatattcag ttagtgtctg 4141 ataagatttt ctttgcttaa ggagaacgga cattgccttg gtatgttttt tttttttttt 4201 ccctccactt ttggagctta tcaggtaaaa atctcaagcc acatgaattg ttaacacctc 4261 tgttgggaaa agcctttgtg agtttttatg tacttggtct ttgtttttgt tattcatcct 4321 gtgtcctccc tcttcccgat gtgctgtttt acctaggagt tagtctgctt tctgaggatc 4381 ttttagagag aggctgtgaa gtgctgaatc acctttaatg atacagcact tctgccatct 4441 cagcatctac ataggactta catagacttc ctgaatgtgt cttcttcaga tactaaagta 4501 cagttggatc attttcttat ctccttttct taagcagtac tttgcaggta ctcccctttg 4561 aaagccagaa gcataaacca ttggggaatc ttaacttgta gacatgcagt aaaagaaatg 4621 catttatgta agatctgtga gtacttaaaa agaaagccct cagtgtgtgt gaagtgaatg 4681 tgaaatgtgt gtgaaataca tagaattccc aaatagttta gcaaaggcag ggcgcaatat 4741 caagtaattt aaaaatggtc caaggaactg taagaaggag gaactaattc tagaataaat 4801 gttaaaatgc cattcaagaa caaaaccaca gatgccatac agacctcctg tgcttaagtt 4861 atagaagaat aaaaatctga atgaatggaa ggccttacgt gtatacagtt tacaaattcc 4921 tatttctaaa atttaagtcc cttatttaac agaagtatgt attttaatgc ttaactgtct 4981 cgggaaacct catttgtgac atcatctaag gggatgggaa gactagggag ccagtgccac 5041 gttgaacaga acagtggttt agtgaatgtg tgaggaaaga catgggcaac tgattattaa 5101 tgtttttgta attcagttta taacttggaa ccaatgaaaa gcaacaaaac taaactggtt 5161 tgacagcctg ccacttctgg catttcctgt aagtcactag cagtaggtgt gaggtgggct
5221 tgcccatgac caggaggggt gtgtgtgtgt gtgtgcatgt gtgtatatgc gtgttggtct 5281 gcagtcacag cataccttta tgtgcatgtg tcctcgcagc ttgggactca gcagtattct 5341 gggagggtgg aggtgaactg tcccatgtat tgtattatat attttttgag atggggtctt 5401 gctctgttgc ccaggctgga gtgcagtggt gcgatctcag ctcactgcaa cttttgcctc 5461 ctggttcaag cagttctcct gcctcagcct gccaaatagc tgggattaca ggtgtgtacc 5521 accactccca gctaattttt gtatttttag tagagatggg gttttaccat gttggccagg 5581 ctggtctcga gctcctggcc tcaggtgatc cacctgcttt ggcctcccaa agtgctgaga 5641 ttacaggcgt gaactaccgc gcctggcccc atgtattgta tttttttcag gttatattga 5701 aatctactac caggaatgtc ggaatgggtt ttggtatgta taatggaaat agatagagtg 5761 gttaagtcta gaaacacata cattaattgt attgaaatgt tatatcaata catcatttat 5821 gatgtgtgtg tggtcccaga cctcatggcc accagtttgt ttaagcattg tgaatgcttt 5881 ttaatagcat tcattagcat taatggagga ggacactgtg ttttctcaat taatctcatt 5941 gatttgtttg gtataagttt gggtcagaaa tgaaactgcc aaaacatcga tcagtacaag 6001 gaagggacac agggcttaaa atgtccacag tcttggcagt ggacttggca gttctcccag 6061 taagcagaag tacttgagct taattctgaa cttcaaagta atattttata cttaatttta 6121 ggagttttca tttacatatt gaaaaatgcc ttgactgtat tcacataaat ggtgctaaaa 6181 cattgtaccc cttataagaa ctgcagcaat ccacagtaat gttggttact tctgagtatt 6241 tgataaagga acaaagtcaa aatgaatgta tttaataagc ttctttctca tttccattgt 6301 ttttataaaa atattttggt attgttgcct gcattttagc cacttctaac tttttgtatt 6361 atgaatttgg agaggataac aagccaactt tagaccctct gccagtggcg atggtgtttt 6421 tcttccatgg gtaagccatt gtgaatggag gctggtggag cagcacactg tgtgaacctg 6481 gcagcgctca tcttggcttg tttagcagtg cctctgttta caccataaga tgttccgcat 6541 gtgtccaaaa tttcgcctgc tctgaaaaac atgcccccga ggctctgtgc agtttggggc 6601 cttggttccc acctgcagat gcggtcagtt gcctggctcc tggggccaga gtttcctctg 6661 ttacttgttg agtctcttgt cttcactgtc agaagctgaa ctgacttggg ggctttgctg 6721 ttgatccact ttagcaaacc ctgctgcaga ggactgtaaa aacaaataac taaaaataaa 6781 cttagaaaat acaactcaga agcctggctc tgttgctgtg gtcaaatgct tgcctttgag 6841 gactttggca gattgtgcta ttacattggg ctctaacttt ctggcacccg caaggcagac 6901 ctatgatgtc cacatggctg actcttgacc cctggccatt gtgagcagag gaatcaaggg 6961 tttagggagg cagtattggg cagtgtggaa gagttagatg agatgaagca gttagcacag 7021 tgcttaaccc atactaagtg cccccaaccc tgccagccaa attaggtgca tagttttcag 7081 cttgggtctg gattcaacag cattcccgct gcccactaaa agggtgggct tggacagttc 7141 ctgaacctcc ctaaatctgt ttcttcatct ttaccacaca cagtctgtct cagtggtggt 7201 gtggattaag tgaggtgcta gcacttatta ggggaagatc ctccagacct gcaaagcagg 7261 gctgcagccc caattctgac ccagccctgc tgtgtgtttg ccgcaaagag gtttggtgtg 7321 tgcgagacat ttctttatga accatttaca ctgctggaaa tgtacccact aatgtgatgg 7381 caagaacttc aacaaattgc ttatgaatca ggctctcaat ggaagaagtt aatcctctga 7441 agagggggaa gactggactt tcagaagtat gttggggata gagaatgaag tttgagtcag 7501 cagagctctg ccttcctgtt tgtcaaagaa ctagagtctg ggagtcttgc aagatggagc 7561 tgggcttctg aagaacccag tgggtaggta ctgggcatcc attagacggc agtgctaagt 7621 cggtcatgtg cagcagaaag acctccccac tgtgaacaac aaaccacttt cctcctccag 7681 tggcccattc atttggattg atacactttt tcagtgtcag aaatgcactt tctccctcta 7741 cttgtctgaa ttacgatgct ctgctcaact ctgtggacag tgtttcttga atttcctttt 7801 ccaccgcctt ttcccactca agaaagtgga gagaaaaaca gggatgcagg ctgtgggtct 7861 tgtggaagcc ctttacaacc attaaataaa gaacaccagc tgcattatgt gtgtttagaa 7921 cgagaagttg tttgtacagt atttttctat tgaccgcttc cgtcttgcct gaaacctggg 7981 cattctttct gtagtttctc tgaattttct gtctcacctc ctcaccccta cccttgcctt 8041 tt
SEP ID NO: 49 Human OTULIN Amino Acid Sequence (NP 612357.4)
1 msrgtmpqpe awpgascaet pareaaatar dggkaaasgq prpemqcpae heedmyraad
61 eiekekelli hergaseprl svapemdimd yckkewrgnt qkatcmkmgy eevsqkftsi
121 rrvrgdnyca lratlfqams qavglppwlq dpelmllpek liskynwikq wklglkfdgk
181 nedlvdkike sltllrkkwa glaemrtaea rqiacdelft neaeeyslye avkflmlnra
241 ielyndkekg kevpffsvll fardtsndpg qllrnhlnqv ghtggleqve mfllayavrh
301 tiqvyrlsky nteefitvyp tdppkdwpvv tliaeddrhy nipvrvceet si
SEP ID NO: 50 Mouse OTULIN cDNA Sequence (NM 001013792.2, CDS region from position 85-1143)
1 aagcgctctg cggacctcgc ggggtgcggg gcagcgcagc cacggctccg gacggcggga
61 cggcagggcc cggcgtggcc gcggatgagt cggggaacca tgccccagcc cggagcgtgg 121 cccggtgcaa gctgcgccga gacgccggcg cgcgaggccg gggccgcggc gcgggacggc 181 gggaaggtga cggccggcgc gcagccccgg gccgcgacgc gatgcccggc cgagcacgag 241 gaggacatgt accgtgctgc agatgaaata gaaaaggaga aagaattgct aatacatgaa 301 agagggatat cagaacccag gttaagtgtg gctcctgaaa tggatatcat ggactactgc 361 aaaaaagaat ggagaggaaa tactcagaaa gccacatgta tgaaaaaggg ctatgaggaa 421 gtgtctcaga aattcacttc cataaggcga gtccgtggtg ataactactg tgcactgagg 481 gccacactgt tccaggccat gagccagctg gccgagctgc ccccctggct gcaggacttg 541 gagctcatac tgttaccaga gaagctgata aacaagtata cctggatcaa gcagtggaaa 601 cttggactga aatttgatgg gaagagtgag gacctggttg aaaaaattaa ggaatccctt 661 gccctgctaa ggaagaagtg ggtaagcctg gctgcaatga aaactgctga agcgaggcag 721 acagcttgtg atgagctgtt caccaacgaa gaggaggagt acagcctcta cgaagctgtg 781 aagttcctga tgttaaacag agccatcgaa ctgtacgatg acaaggagaa gggaaaggaa 841 gtgccgttct tctctgtgct cttgtttgcc cgagacacat ccaatgaccc tgaacagctc 901 ctgaggaacc acctaaacca ggtgggacac acggggggcc ttgagcaggt tgagatgttc 961 cttcttgcct atgctgtccg ccacagcatc cgggtgtacc ggctgtccaa gtataacaca 1021 gaggagttca tcacagtcta ccccactgat ccccccaagg actggccaat ggtgaccctc 1081 atagctgagg atgatcggca ctataacatc cctgtcagag tgtgtgagga gaccagtgtg 1141 tgagggacac acatgtgact gccaagagat gcgcatgtgc agctcctcct ctgggggcct 1201 cagatctgca ggtctccaag gacaatctgg gagaactctc gggcccctgg agccaacttt 1261 ggaccattat gttctgaaga ctagctgttg ataatgagaa ttaattagcc aagccttcac 1321 tccttgttct gttatgcagt gtgttccact gggggcttca gcacgtgcct ttggaaggtg 1381 caaactatgt ctccataagg cggatgcttt tgggtcaaag aaaactgttt ggaaaggaat 1441 ctgtccaatg aaagttctga cggtaaactg gttttacttc tctttttaaa a
SEP ID NO: 51 Mouse OTULIN Amino Acid Sequence (NP 001013814.2)
1 msrgtmpqpg awpgascaet pareagaaar dggkvtagaq praatrcpae heedmyraad
61 eiekekelli hergiseprl svapemdimd yckkewrgnt qkatcmkkgy eevsqkftsi
121 rrvrgdnyca Iratlfqams qlaelppwlq dlelillpek linkytwikq wklglkfdgk
181 sedlvekike slallrkkwv slaamktaea rqtacdelft neeeeyslye avkflmlnra
241 ielyddkekg kevpffsvll fardtsndpe qllrnhlnqv ghtggleqve mfllayavrh
301 sirvyrlsky nteefitvyp tdppkdwpmv tliaeddrhy nipvrvceet sv
SEP ID NO: 52 Human TRAF6 Transcript Variant 1 cDNA Sequence (NM 145803.2, CDS region from position 382-1950)
1 ctcctccccg gcgcgctccc tgcccctcgc tccccgcagc cagcagagaa ggcggaagca 61 gtggcgtccg cagctggggc ttggcctgcg ggcggccagc gaaggtggcg aaggctccca 121 ctggatccag agtttgccgt ccaagcagcc tcgtctcggc gcgcagtgtc tgtgtccgtc 181 ctctaccagc gccttggctg agcggagtcg tgcggttggt gggggagccc tgccctcctg 241 gttcggcctc cccgcgcact agaacgatca tgaacttctg aagggaccca gctttctttg 301 tgtgctccaa gtgatttgca caaataataa tatatatatt tattgaagga gagaatcaga 361 gcaagtgata atcaagttac tatgagtctg ctaaactgtg aaaacagctg tggatccagc 421 cagtctgaaa gtgactgctg tgtggccatg gccagctcct gtagcgctgt aacaaaagat 481 gatagtgtgg gtggaactgc cagcacgggg aacctctcca gctcatttat ggaggagatc 541 cagggatatg atgtagagtt tgacccaccc ctggaaagca agtatgaatg ccccatctgc 601 ttgatggcat tacgagaagc agtgcaaacg ccatgcggcc ataggttctg caaagcctgc 661 atcataaaat caataaggga tgcaggtcac aaatgtccag ttgacaatga aatactgctg 721 gaaaatcaac tatttccaga caattttgca aaacgtgaga ttctttctct gatggtgaaa 781 tgtccaaatg aaggttgttt gcacaagatg gaactgagac atcttgagga tcatcaagca 841 cattgtgagt ttgctcttat ggattgtccc caatgccagc gtcccttcca aaaattccat 901 attaatattc acattctgaa ggattgtcca aggagacagg tttcttgtga caactgtgct 961 gcatcaatgg catttgaaga taaagagatc catgaccaga actgtccttt ggcaaatgtc 1021 atctgtgaat actgcaatac tatactcatc agagaacaga tgcctaatca ttatgatcta 1081 gactgcccta cagccccaat tccatgcaca ttcagtactt ttggttgcca tgaaaagatg 1141 cagaggaatc acttggcacg ccacctacaa gagaacaccc agtcacacat gagaatgttg 1201 gcccaggctg ttcatagttt gagcgttata cccgactctg ggtatatctc agaggtccgg 1261 aatttccagg aaactattca ccagttagag ggtcgccttg taagacaaga ccatcaaatc 1321 cgggagctga ctgctaaaat ggaaactcag agtatgtatg taagtgagct caaacgaacc 1381 attcgaaccc ttgaggacaa agttgctgaa atcgaagcac agcagtgcaa tggaatttat 1441 atttggaaga ttggcaactt tggaatgcat ttgaaatgtc aagaagagga gaaacctgtt
1501 gtgattcata gccctggatt ctacactggc aaacccgggt acaaactgtg catgcgcttg 1561 caccttcagt taccgactgc tcagcgctgt gcaaactata tatccctttt tgtccacaca 1621 atgcaaggag aatatgacag ccacctccct tggcccttcc agggtacaat acgccttaca 1681 attcttgatc agtctgaagc acctgtaagg caaaaccacg aagagataat ggatgccaaa 1741 ccagagctgc ttgctttcca gcgacccaca atcccacgga acccaaaagg ttttggctat 1801 gtaactttta tgcatctgga agccctaaga caaagaactt tcattaagga tgacacatta 1861 ttagtgcgct gtgaggtctc cacccgcttt gacatgggta gccttcggag ggagggtttt 1921 cagccacgaa gtactgatgc aggggtatag cttgccctca cttgctcaaa aacaactacc 1981 tggagaaaac agtgcctttc cttgccctgt tctcaataac atgcaaacaa acaagccacg 2041 ggaaatatgt aatatctact agtgagtgtt gttagagagg tcacttacta tttcttcctg 2101 ttacaaatga tctgaggcag ttttttcctg ggaatccaca cgttccatgc tttttcagaa 2161 atgttaggcc tgaagtgcct gtggcatgtt gcagcagcta ttttgccagt tagtatacct 2221 ctttgttgta ctttcttggg cttttgctct ggtgtatttt attgtcagaa agtccagact 2281 caagagtact aaacttttaa taataatgga ttttccttaa aacttcagtc tttttgtagt 2341 attatatgta atatattaaa agtgaaaatc actaccgcct tgtgctagtg ccctcgagaa 2401 gagttattgc tctagaaagt tgagttctca tttttttaac ctgttataga tttcagagga 2461 tttgaaccat aatccttgga aaacttaagt tctcattcac cccagttttt cctccaggtt 2521 gttactaagg atattcaggg atgagtttaa accctaaata taaccttaat tatttagtgt 2581 aaacatgtct gttgaataat acttgtttaa gtgttccttc tgccttgctt acttatttcc 2641 ttgaggttac gaagtagcat cttccccaga gtttataatg ctgagaacca cgtggatacc 2701 aactgctcat tgttatgcta tgtaaccctt tttgtctatt cagtgcagag tgaatttcac 2761 agctctgcat atgtcttcat ttgtttaatg cttacaagac aggagatgca cacatacaat 2821 cagcaacata aaaattaaaa gtgacccaag tagtcagcgc atgtggcatc tcattggtgg 2881 tgacagaagc tatgtgagcc agaagttttc agctcttttg aataccctct ggtttatttc 2941 gattaaaaag aacaaaattg atttcctaaa atcagaattt tttaaaactt gggagatgat 3001 tggagatacc taggaggtca ccaaactagg attagaagtc acagtggttg tatcacaact 3061 tagcttgagt atgttgctgt agcctaacaa ctgcaggttc tgagaaggat cctgtagaat 3121 cctggaagta accagatttt cctaataggg agatgatttt tttgtgtgcc atcatgtatt 3181 tgttaaaggc ctatatatag atataaaata tcgtggaatc tagttctcag ggagacccgc 3241 aactagtata agcttataaa ggatctaaag atccatccac catttaaagt tgtctggtaa 3301 tgagagatga cattgtatcc cccagagagg ccaaatcaga gtcgccagcc agcgttctag 3361 atcagcctta atttcaagag aaagccaagg acctcatctg caggggagtg tggttttcag 3421 ccccagcgag tgtcactttg aactttccct ttgctttttt ctctcttctc cctccccacc 3481 cacccttagg ctcctgatct ggtgagtttg ttatggagtg aaaataaaag tcaagcagag 3541 accttgtttc ccgtgccacc attagtacca caagctcatg gctagttacc acattacttc 3601 ctggcagttt gtgtccctca gctgtgcctt ccaaccagcg cctgagaatc actgcatacc 3661 accctctagg tagggaaacc tacactgctg ctgttcctgt gattatttta caatgaataa 3721 ataattgtca agttccattt aaaaactgaa cagtagtatt tttgtatttg cgtagaaaaa 3781 gcctgaagga aatatactaa actttttgtt ggcttatttt cctttgcgct tgcttatatt 3841 ttttacattt tctacaataa atgtgtactt ttatcggaga aaaaaattaa atgttgccac 3901 aaaacattta atctccacgc ccccagctca aaaaaggaaa tgatatttaa aagcttcctg 3961 gtcagatttc tattaaaagc actggctgtg cattagatac aaagaggagt catttcctgc 4021 cttggtgata ctattttttt ctactaactc aagagtcttt attaaaaaaa aaagttgttt 4081 tgcctaattt cagcttttag caagcttccc atctgtaaaa tgatttggac cagatatttc 4141 tagagtcccc tccagccata acattctgtc tcaaattaag ttccaaccag cagaacaatg 4201 acaatactta ggaaagtatt ttgccagtat aaaatgtctt taacttactc tttgctgaca 4261 ctgatacttt cctctaattt agtgtctatc agctgggtca catcttaagt aaaatgagca 4321 attttaaccc ccaacatttg gcattttgtc ataaaccagc cagttatttt atgctggtca 4381 ttcatcttga ctacaaagta gaatagtcaa gctgtcattc caaatagaaa actttttact 4441 tcaatcagaa ttaagcctta acctggaaag ttggtttctt ccttacattt tcccaatctc 4501 ctactctatt cttaaacatg ctagtttcac tcagttgggt atacaagcct ttgggcttta 4561 tgttgtatgt tactaaccac cttttaccat atttatcttt tggcatcatt ctgggacatt 4621 gctaaattaa aaaagaaatt gtttccactt ttttctggag atgttcaact aaaggttgtt 4681 ttgttttgtt ttttgttttg agacagtctc accctgacgc tcaggctgga gtgcagtggt 4741 gcaacctcgg ctcactgcaa cctccacctc ccgggctcaa gccattctcc tgcctcagcc 4801 tcccaagcag ctgggattac aggcacccgc caccacgccc agctaatttt tttgtatttt 4861 gagtagagac cgggtttcac catattggcc agtctcgtct ggaactcctg acctcagatg 4921 atccgcccgc ctcagcctcc caaagtgctg ggattacagg catgagccac cacgcccagc 4981 gtccaaccca ctgttggatg aaacttgctg cacgtcatac attttgctgt tggcaaacaa 5041 gtctgaatgt tgatttgaag tttggtagtt tattactatc tattggcagc aaagactgtt 5101 tattggtata ctacaatatg atttaacttt tattttgggg ataaatagta gaaaaaagtg
5161 aaacagaatg aaggcaggtg ttttttattc taatgatgga ataatacaga gatactggac 5221 gatctctagc agttaattat tgtgacccat ataaaattat acaggtcaca gtataattct 5281 ctattaccgt ttttacacca gtaagtctta gataaactaa gcatgcttat gaattatgta 5341 tacagttaga atgcattatt tttacagagg aacaattgct tgtatgtact aacactgttc 5401 tcttggcttg cctcaagttc tactcattat tttatataaa atactattag gctgggcacg 5461 gtggctcacg cctataatcc cagcactttg ggaggtggag gctggcggat tacttgaagc 5521 caggagttcg agaccagcct ggccaaaatg gtgaaacccc atctctataa aaatacaaaa 5581 attagccagg tgtcatgata catgcctgta atcccagctt cttgggaggc tgaggcacgg 5641 gaatcgcttg aacccgggaa gcacaggttg cagtgagcca agatcatgcc actgcacccc 5701 cagcctgggt gacagagtgc aacactgtct cacaaaacaa aacaaaaaca tcagattctg 5761 tttgtgatgc ctagttgctt acaacctaaa cagtgcaatg ccttaaggaa atgaaaagga 5821 gccataagta gtcatttata tttttatttt gaagtgtgct ttttctaaac tcccagattg 5881 acatgatgga ctgtaagtta gtttctctgt ttctgtcttt gtgcctgtag agtgtacttg 5941 gcacttacaa attcccagta tccagaaaga tgatctgatg aaatcaaatt ggatggatct 6001 tggcagactg tgacactcaa ttacagcctt cactttcagt caaaaacgga cacttggcaa 6061 ggaggtgcct ggttgtttca ctaaatgtca cttgtgtgtg taatatttta aagctttttc 6121 cccacaggaa attcgggtca taaaatcctg aaaaataatt ctaggtggga aaagcatttt 6181 aggaaatgag agatgtggtg ctgcttttct tctctcagag tgctttctca gcaggacact 6241 agccctgcct ttaagatggg gaagttgggg catgtgcctc tgctcttact gtctgcagct 6301 ctgaaggtag gtgctgtccc actcggacaa tcgcccaagc agcagtgacc atagttctct 6361 tctatgcaag tccccaggag aaggtaaact gtgtggaatg gggatgtgtt ctggttgctg 6421 ctgaatcccc tcttcttacc acagtgcctg gcacgttgca cacactcaaa tacgtaataa 6481 tgaacattta ttgaaagcag cagttgaagc tgaccaattt ctggtacctt gtcatgtaaa 6541 ttttagatgg taaggcgcag atgttacttt ttttgctttt tttcttcagc acttgatgaa 6601 atttcccaaa catgcagaaa tgttgaaaga cttgtatagt gaacatctac gacctagaat 6661 ctgcagtaat attatgttac atttgcttta tcacttgata gatgttactt ttaatgagac 6721 ttcaagtttg gtttctctaa acaaaatatt ctaaaataac tgaacaactt taatcaattt 6781 gtcttaagtt ctttggggga acttgggaca tttgctttgt aactggaatt gcagccctca 6841 cgttaagcta attttaaact ttgcaaattt gttatgctga atttcagtct tatttatttt 6901 gcctgaaggg gtattttttg taatggattt atttgaaggt ccttgataaa ttgtgcagaa 6961 tattctcgtg ttctttttgc acttgataaa ttatctaatt tctgtggtga gaatgtaatt 7021 tggggcctat tttgtttata caagcttcca gaattatgtt ctcagaggga tgaaaaggtg 7081 taatttagca tataggtcac taaattagga gctaagacac attttctcct gactgaccat 7141 gggtcaatca gttttgtctt cgtgtccttt tccttgtaaa gtagaaacta gaatttgaaa 7201 tttaaatatt aaataatggg taacattcat taatgtatga ctctattaag aaagacactg 7261 tgaatccagg gaggattctc ataattctgt aaactgtatg acaagctgtg gaatgaaatc 7321 tgacttttga aaattgaaag acatccagtg gtcttatcac aaagcctgct tttcctcaga 7381 acttaactat tgccatggaa tttgtaagca gttatcctaa tccatctgga ctctgaaaat 7441 gcatccttta tgagagggag tgaatgcaaa gataagggtg gggaaacact aatcatgaaa 7501 agaatgaaaa tcagtgttca gttttaagag caggttgtat tgaaggaagg gattaaagga 7561 attatccaga tttgaggtgg cacatcttcc accactccct gcaccatcag catgcacgga 7621 gcgcataaaa caagccctgc tcctaatggc agtgaaacct cggatggcct ccatcaggtc 7681 aatacaactg aattgctggg ctgacttaag attgaaggac tccattttag taagtagaga 7741 agtgtgacct ttctcaaccc aggttgtgaa tgtggattca cacttatctc aaaaaggcac 7801 ctggagtttt aactttatgt catgtctcag tactggttgc aaggtatgac caaaagtgtt 7861 ccttgaatgg cacctttttg aatattaatt tagaagaaaa catgccagac tgacatactt 7921 accccctccg cactgttact acttccttac cagccctatg tactgcatca atgtctacaa 7981 gaaagcactc ttcattaaaa tgaaatatat atattaaaat aaaaaaaaaa aaaaaaaaaal
SEP ID NO: 53 Human TRAF6 Transcript Variant 2 cDNA Sequence (NM 004620.3, CDS region from position 289-1857)
1 ctcctccccg gcgcgctccc tgcccctcgc tccccgcagc cagcagagaa ggcggaagca 61 gtggcgtccg cagctggggc ttggcctgcg ggcggccagc gaaggtggcg aaggctccca 121 ctggatccag agtttgccgt ccaagcagcc tcgtctcggc gcgcagtgtc tgtgtccgtc 181 ctctaccagc gccttggctg agcggagtcg tgcggttggt gggggagccc tgccctcctg 241 gttcggcctc cccgcgcact agaacgagca agtgataatc aagttactat gagtctgcta 301 aactgtgaaa acagctgtgg atccagccag tctgaaagtg actgctgtgt ggccatggcc 361 agctcctgta gcgctgtaac aaaagatgat agtgtgggtg gaactgccag cacggggaac 421 ctctccagct catttatgga ggagatccag ggatatgatg tagagtttga cccacccctg 481 gaaagcaagt atgaatgccc catctgcttg atggcattac gagaagcagt gcaaacgcca
541 tgcggccata ggttctgcaa agcctgcatc ataaaatcaa taagggatgc aggtcacaaa 601 tgtccagttg acaatgaaat actgctggaa aatcaactat ttccagacaa ttttgcaaaa 661 cgtgagattc tttctctgat ggtgaaatgt ccaaatgaag gttgtttgca caagatggaa 721 ctgagacatc ttgaggatca tcaagcacat tgtgagtttg ctcttatgga ttgtccccaa 781 tgccagcgtc ccttccaaaa attccatatt aatattcaca ttctgaagga ttgtccaagg 841 agacaggttt cttgtgacaa ctgtgctgca tcaatggcat ttgaagataa agagatccat 901 gaccagaact gtcctttggc aaatgtcatc tgtgaatact gcaatactat actcatcaga 961 gaacagatgc ctaatcatta tgatctagac tgccctacag ccccaattcc atgcacattc 1021 agtacttttg gttgccatga aaagatgcag aggaatcact tggcacgcca cctacaagag 1081 aacacccagt cacacatgag aatgttggcc caggctgttc atagtttgag cgttataccc 1141 gactctgggt atatctcaga ggtccggaat ttccaggaaa ctattcacca gttagagggt 1201 cgccttgtaa gacaagacca tcaaatccgg gagctgactg ctaaaatgga aactcagagt 1261 atgtatgtaa gtgagctcaa acgaaccatt cgaacccttg aggacaaagt tgctgaaatc 1321 gaagcacagc agtgcaatgg aatttatatt tggaagattg gcaactttgg aatgcatttg 1381 aaatgtcaag aagaggagaa acctgttgtg attcatagcc ctggattcta cactggcaaa 1441 cccgggtaca aactgtgcat gcgcttgcac cttcagttac cgactgctca gcgctgtgca 1501 aactatatat ccctttttgt ccacacaatg caaggagaat atgacagcca cctcccttgg 1561 cccttccagg gtacaatacg ccttacaatt cttgatcagt ctgaagcacc tgtaaggcaa 1621 aaccacgaag agataatgga tgccaaacca gagctgcttg ctttccagcg acccacaatc 1681 ccacggaacc caaaaggttt tggctatgta acttttatgc atctggaagc cctaagacaa 1741 agaactttca ttaaggatga cacattatta gtgcgctgtg aggtctccac ccgctttgac 1801 atgggtagcc ttcggaggga gggttttcag ccacgaagta ctgatgcagg ggtatagctt 1861 gccctcactt gctcaaaaac aactacctgg agaaaacagt gcctttcctt gccctgttct 1921 caataacatg caaacaaaca agccacggga aatatgtaat atctactagt gagtgttgtt 1981 agagaggtca cttactattt cttcctgtta caaatgatct gaggcagttt tttcctggga 2041 atccacacgt tccatgcttt ttcagaaatg ttaggcctga agtgcctgtg gcatgttgca 2101 gcagctattt tgccagttag tatacctctt tgttgtactt tcttgggctt ttgctctggt 2161 gtattttatt gtcagaaagt ccagactcaa gagtactaaa cttttaataa taatggattt 2221 tccttaaaac ttcagtcttt ttgtagtatt atatgtaata tattaaaagt gaaaatcact 2281 accgccttgt gctagtgccc tcgagaagag ttattgctct agaaagttga gttctcattt 2341 ttttaacctg ttatagattt cagaggattt gaaccataat ccttggaaaa cttaagttct 2401 cattcacccc agtttttcct ccaggttgtt actaaggata ttcagggatg agtttaaacc 2461 ctaaatataa ccttaattat ttagtgtaaa catgtctgtt gaataatact tgtttaagtg 2521 ttccttctgc cttgcttact tatttccttg aggttacgaa gtagcatctt ccccagagtt 2581 tataatgctg agaaccacgt ggataccaac tgctcattgt tatgctatgt aacccttttt 2641 gtctattcag tgcagagtga atttcacagc tctgcatatg tcttcatttg tttaatgctt 2701 acaagacagg agatgcacac atacaatcag caacataaaa attaaaagtg acccaagtag 2761 tcagcgcatg tggcatctca ttggtggtga cagaagctat gtgagccaga agttttcagc 2821 tcttttgaat accctctggt ttatttcgat taaaaagaac aaaattgatt tcctaaaatc 2881 agaatttttt aaaacttggg agatgattgg agatacctag gaggtcacca aactaggatt 2941 agaagtcaca gtggttgtat cacaacttag cttgagtatg ttgctgtagc ctaacaactg 3001 caggttctga gaaggatcct gtagaatcct ggaagtaacc agattttcct aatagggaga 3061 tgattttttt gtgtgccatc atgtatttgt taaaggccta tatatagata taaaatatcg 3121 tggaatctag ttctcaggga gacccgcaac tagtataagc ttataaagga tctaaagatc 3181 catccaccat ttaaagttgt ctggtaatga gagatgacat tgtatccccc agagaggcca 3241 aatcagagtc gccagccagc gttctagatc agccttaatt tcaagagaaa gccaaggacc 3301 tcatctgcag gggagtgtgg ttttcagccc cagcgagtgt cactttgaac tttccctttg 3361 cttttttctc tcttctccct ccccacccac ccttaggctc ctgatctggt gagtttgtta 3421 tggagtgaaa ataaaagtca agcagagacc ttgtttcccg tgccaccatt agtaccacaa 3481 gctcatggct agttaccaca ttacttcctg gcagtttgtg tccctcagct gtgccttcca 3541 accagcgcct gagaatcact gcataccacc ctctaggtag ggaaacctac actgctgctg 3601 ttcctgtgat tattttacaa tgaataaata attgtcaagt tccatttaaa aactgaacag 3661 tagtattttt gtatttgcgt agaaaaagcc tgaaggaaat atactaaact ttttgttggc 3721 ttattttcct ttgcgcttgc ttatattttt tacattttct acaataaatg tgtactttta 3781 tcggagaaaa aaattaaatg ttgccacaaa acatttaatc tccacgcccc cagctcaaaa 3841 aaggaaatga tatttaaaag cttcctggtc agatttctat taaaagcact ggctgtgcat 3901 tagatacaaa gaggagtcat ttcctgcctt ggtgatacta tttttttcta ctaactcaag 3961 agtctttatt aaaaaaaaaa gttgttttgc ctaatttcag cttttagcaa gcttcccatc 4021 tgtaaaatga tttggaccag atatttctag agtcccctcc agccataaca ttctgtctca 4081 aattaagttc caaccagcag aacaatgaca atacttagga aagtattttg ccagtataaa 4141 atgtctttaa cttactcttt gctgacactg atactttcct ctaatttagt gtctatcagc
4201 tgggtcacat cttaagtaaa atgagcaatt ttaaccccca acatttggca ttttgtcata 4261 aaccagccag ttattttatg ctggtcattc atcttgacta caaagtagaa tagtcaagct 4321 gtcattccaa atagaaaact ttttacttca atcagaatta agccttaacc tggaaagttg 4381 gtttcttcct tacattttcc caatctccta ctctattctt aaacatgcta gtttcactca 4441 gttgggtata caagcctttg ggctttatgt tgtatgttac taaccacctt ttaccatatt 4501 tatcttttgg catcattctg ggacattgct aaattaaaaa agaaattgtt tccacttttt 4561 tctggagatg ttcaactaaa ggttgttttg ttttgttttt tgttttgaga cagtctcacc 4621 ctgacgctca ggctggagtg cagtggtgca acctcggctc actgcaacct ccacctcccg 4681 ggctcaagcc attctcctgc ctcagcctcc caagcagctg ggattacagg cacccgccac 4741 cacgcccagc taattttttt gtattttgag tagagaccgg gtttcaccat attggccagt 4801 ctcgtctgga actcctgacc tcagatgatc cgcccgcctc agcctcccaa agtgctggga 4861 ttacaggcat gagccaccac gcccagcgtc caacccactg ttggatgaaa cttgctgcac 4921 gtcatacatt ttgctgttgg caaacaagtc tgaatgttga tttgaagttt ggtagtttat 4981 tactatctat tggcagcaaa gactgtttat tggtatacta caatatgatt taacttttat 5041 tttggggata aatagtagaa aaaagtgaaa cagaatgaag gcaggtgttt tttattctaa 5101 tgatggaata atacagagat actggacgat ctctagcagt taattattgt gacccatata 5161 aaattataca ggtcacagta taattctcta ttaccgtttt tacaccagta agtcttagat 5221 aaactaagca tgcttatgaa ttatgtatac agttagaatg cattattttt acagaggaac 5281 aattgcttgt atgtactaac actgttctct tggcttgcct caagttctac tcattatttt 5341 atataaaata ctattaggct gggcacggtg gctcacgcct ataatcccag cactttggga 5401 ggtggaggct ggcggattac ttgaagccag gagttcgaga ccagcctggc caaaatggtg 5461 aaaccccatc tctataaaaa tacaaaaatt agccaggtgt catgatacat gcctgtaatc 5521 ccagcttctt gggaggctga ggcacgggaa tcgcttgaac ccgggaagca caggttgcag 5581 tgagccaaga tcatgccact gcacccccag cctgggtgac agagtgcaac actgtctcac 5641 aaaacaaaac aaaaacatca gattctgttt gtgatgccta gttgcttaca acctaaacag 5701 tgcaatgcct taaggaaatg aaaaggagcc ataagtagtc atttatattt ttattttgaa 5761 gtgtgctttt tctaaactcc cagattgaca tgatggactg taagttagtt tctctgtttc 5821 tgtctttgtg cctgtagagt gtacttggca cttacaaatt cccagtatcc agaaagatga 5881 tctgatgaaa tcaaattgga tggatcttgg cagactgtga cactcaatta cagccttcac 5941 tttcagtcaa aaacggacac ttggcaagga ggtgcctggt tgtttcacta aatgtcactt 6001 gtgtgtgtaa tattttaaag ctttttcccc acaggaaatt cgggtcataa aatcctgaaa 6061 aataattcta ggtgggaaaa gcattttagg aaatgagaga tgtggtgctg cttttcttct 6121 ctcagagtgc tttctcagca ggacactagc cctgccttta agatggggaa gttggggcat 6181 gtgcctctgc tcttactgtc tgcagctctg aaggtaggtg ctgtcccact cggacaatcg 6241 cccaagcagc agtgaccata gttctcttct atgcaagtcc ccaggagaag gtaaactgtg 6301 tggaatgggg atgtgttctg gttgctgctg aatcccctct tcttaccaca gtgcctggca 6361 cgttgcacac actcaaatac gtaataatga acatttattg aaagcagcag ttgaagctga 6421 ccaatttctg gtaccttgtc atgtaaattt tagatggtaa ggcgcagatg ttactttttt 6481 tgcttttttt cttcagcact tgatgaaatt tcccaaacat gcagaaatgt tgaaagactt 6541 gtatagtgaa catctacgac ctagaatctg cagtaatatt atgttacatt tgctttatca 6601 cttgatagat gttactttta atgagacttc aagtttggtt tctctaaaca aaatattcta 6661 aaataactga acaactttaa tcaatttgtc ttaagttctt tgggggaact tgggacattt 6721 gctttgtaac tggaattgca gccctcacgt taagctaatt ttaaactttg caaatttgtt 6781 atgctgaatt tcagtcttat ttattttgcc tgaaggggta ttttttgtaa tggatttatt 6841 tgaaggtcct tgataaattg tgcagaatat tctcgtgttc tttttgcact tgataaatta 6901 tctaatttct gtggtgagaa tgtaatttgg ggcctatttt gtttatacaa gcttccagaa 6961 ttatgttctc agagggatga aaaggtgtaa tttagcatat aggtcactaa attaggagct 7021 aagacacatt ttctcctgac tgaccatggg tcaatcagtt ttgtcttcgt gtccttttcc 7081 ttgtaaagta gaaactagaa tttgaaattt aaatattaaa taatgggtaa cattcattaa 7141 tgtatgactc tattaagaaa gacactgtga atccagggag gattctcata attctgtaaa 7201 ctgtatgaca agctgtggaa tgaaatctga cttttgaaaa ttgaaagaca tccagtggtc 7261 ttatcacaaa gcctgctttt cctcagaact taactattgc catggaattt gtaagcagtt 7321 atcctaatcc atctggactc tgaaaatgca tcctttatga gagggagtga atgcaaagat 7381 aagggtgggg aaacactaat catgaaaaga atgaaaatca gtgttcagtt ttaagagcag 7441 gttgtattga aggaagggat taaaggaatt atccagattt gaggtggcac atcttccacc 7501 actccctgca ccatcagcat gcacggagcg cataaaacaa gccctgctcc taatggcagt 7561 gaaacctcgg atggcctcca tcaggtcaat acaactgaat tgctgggctg acttaagatt 7621 gaaggactcc attttagtaa gtagagaagt gtgacctttc tcaacccagg ttgtgaatgt 7681 ggattcacac ttatctcaaa aaggcacctg gagttttaac tttatgtcat gtctcagtac 7741 tggttgcaag gtatgaccaa aagtgttcct tgaatggcac ctttttgaat attaatttag 7801 aagaaaacat gccagactga catacttacc ccctccgcac tgttactact tccttaccag
7861 ccctatgtac tgcatcaatg tctacaagaa agcactcttc attaaaatga aatatatata 7921 ttaaaataaa aaaaaaaaaa aaaaaaal
SEP ID NO: 54 Human TRAF6 Amino Acid Sequence (NP 665802.1)
1 msllncensc gssqsesdcc vamasscsav tkddsvggta stgnlsssfm eeiqgydvef
61 dppleskyec piclmalrea vqtpcghrfc kaciiksird aghkcpvdne illenqlfpd
121 nfakreilsl mvkcpnegcl hkmelrhled hqahcefaim dcpqcqrpfq kfhinihilk
181 dcprrqvscd ncaasmafed keihdqncpl anviceycnt ilireqmpnh ydldcptapi
241 pctfstfgch ekmqrnhlar hlqentqshm rmlaqavhsl svipdsgyis evrnfqetih
301 qlegrlvrqd hqireltakm etqsmyvsel krtirtledk vaeieaqqcn giyiwkignf
361 gmhlkcqeee kpvvihspgf ytgkpgyklc mrlhlqlpta qrcanyislf vhtmqgeyds
421 hlpwpfqgti rltildqsea pvrqnheeim dakpellafq rptiprnpkg fgyvtfmhle
481 alrqrtfikd dtllvrcevs trfdmgslrr egfqprstda gv
SEP ID NO: 55 Mouse TRAF6 Transcript Variant 1 cDNA Sequence (NM 009424.3, CDS region from position 427-2019)
1 tagcgagctg agaaggcgga agcagcggcg gccgcggctg gggctgaggc tccggccgtc 61 ggcggacgca gcagccgcgg cccacgagcc gggagtttgg cgtcggagcc acttggtctc 121 ggagtgccgt gtatgtaggc gacgcggcgc agcccgggga agccttccca gttggttgtg 181 aagtctcagc gtgtacgatc gggttgtgtg tgtctgtgta tgcctcatga gtgtagccca 241 cgaaagccag aagaaggtgt cagatccctt ggagctgaag ggatagttgg taataagcct 301 tctgacgtgg atgctggcac ggaaacttgg gtcttctgga agaactacag ttgttcttag 361 ctgctggggt gtctctgcag ctcccaagga gggatcctga gcagatcgac tgacaacaga 421 gctactatga gtctcttaaa ctgtgagaac agctgcgggt ccagccagtc gtccagtgac 481 tgctgcgctg ccatggccgc ctcctgcagc gctgcagtga aagatgacag cgtgagtggc 541 tctgccagca ccgggaacct ctccagctcc ttcatggagg agatccaggg ctacgatgtg 601 gagtttgacc cacctctgga gagcaagtat gagtgtccca tctgcttgat ggctttacgg 661 gaagcagtgc aaacaccatg tggccacagg ttctgcaaag cctgcatcat caaatccata 721 agggatgcag ggcacaagtg cccagttgac aatgaaatac tgctggaaaa tcaactgttt 781 cccgacaatt ttgcaaagcg agagattctt tccctgacgg taaagtgccc aaataaaggc 841 tgtttgcaaa agatggaact gagacatctc gaggatcatc aagtacattg tgaatttgct 901 ctagtgaatt gtccccagtg ccaacgtcct ttccagaagt gccaggttaa tacacacatt 961 attgaggatt gtcccaggag gcaggtttct tgtgtaaact gtgctgtgtc catggcatat 1021 gaagagaaag agatccatga tcaaagctgt cctctggcaa atatcatctg tgaatactgt 1081 ggtacaatcc tcatcagaga acagatgcct aatcattatg atctggactg cccaacagct 1141 ccaatccctt gcacattcag tgtttttggc tgtcatgaaa agatgcagag gaatcacttg 1201 gcacgacact tgcaagagaa tacccagttg cacatgagac tgttggccca ggctgttcat 1261 aatgttaacc ttgctttgcg tccgtgcgat gccgcctctc catcccgggg atgtcgtcca 1321 gaggacccaa attatgagga aactatcaaa cagttggaga gtcgcctagt aagacaggac 1381 catcagatcc gggagctgac tgccaaaatg gaaactcaga gtatgtacgt gggcgagctc 1441 aaacggacca ttcggaccct ggaggacaag gttgccgaaa tggaagcaca gcagtgtaac 1501 gggatctaca tttggaagat tggcaacttt gggatgcact tgaaatccca agaagaggaa 1561 agacctgttg tcatccatag ccctggattc tacacaggca gacctgggta caagctgtgc 1621 atgcgcctgc atcttcagtt accgacagct cagcgctgtg caaactatat atcccttttt 1681 gtccacacaa tgcaaggaga atatgacagc cacctcccct ggcccttcca gggtacaata 1741 cgccttacaa ttctcgacca gtctgaagca cttataaggc aaaaccacga agaggtcatg 1801 gacgccaaac cagaactgct tgcctttcag cgacccacaa tcccacggaa ccccaaaggt 1861 tttggctatg taacatttat gcacctggaa gccttaagac agggaacctt cattaaggat 1921 gatacattac tagtgcgctg tgaagtctct acccgctttg acatgggtgg ccttcggaag 1981 gagggtttcc agccacgaag tactgatgcg ggggtgtagc gtccatgtac ttgtgttcaa 2041 aaactaggaa ccatatggga aaaccgtgcc ttccatgcct ggccccagta aacaatgttc 2101 aaacaagcag tgggagaggt gtaaggccta gcagcagatg tcatcagtga ggtcacgagc 2161 cacttcttac tgttaacaaa tacctgaggc agttcccatg ggaacctaca tgtcccctgt 2221 atcttcaaaa cgtcaacatt tgaagggcct gtggctcatc tgtctgtcag ggtacccctt 2281 cactgtgctt ccatgggcta ttttgtccgt gtactttact gtaaaaaagg ccagacttag 2341 cgtgctgcag ctcaatcgtt taataagacc ggtgccttaa aaacttgagg ggtttttagg 2401 acactgatta ctatattaaa catgaaaatc accactgcct gtgctggtgc cagtagagaa 2461 gttaccgctc tggtgttgag ttctcattta gttgactcct gtgaatttca gaggctttga 2521 accatgatcc ctggaaggct taagttctca agtactccct cctctatagt tcactaagga 2581 tccagggact ggtttaaccc ttacttagtg tgaatgtatt gtccactgaa caccaagcat
2641 cccccactac tttcctgttt tgaaatatgc tccaggcggc ctcttcccag tctgtaagac 2701 cgcggtcatg tgcttgccaa ctgctgagtg ttactgccat ggaacctttc ttgtctgtcc 2761 cgtgcagctt ggtttccaca gccggttgca tatcttctgt tgcttgcaaa cacaaaatca 2821 ccagcccaaa cgagtgattt agctcactag ccattaaatg gcatctcgtg gatgatgaca 2881 gcaactctta cagccaggaa acttcagccc ctcttaacta gcttttgatt tagcttataa 2941 ggttaattga aataaaattg atttttctca aggggttgga gaattggctc agtggttaag 3001 agccttggct gctcttccag aggatcccca gtctgtaact ccagttccag ggcatctgac 3061 accctcatac agacactcat gcaggcaaaa caccagtgca cataaaatta aacaaacaaa 3121 taaataaata aattgatttc ctcaaaacag aatttattgg aacttgggaa attgtaggta 3181 cctgagagat gcctaaacca aggttggcta tcacggttgt gtggacactc agcttgagtg 3241 gtggctttgt ccagctcagt agaggttctg atctgtgacc ctaatgtgga gaggtgactg 3301 tcgtgctgct gtgtatttgt taatgtcctg tacatataca gtactttgga gtctagttct 3361 cagggagccc tacgactagt tagagccttt gtaaggaagc agaggggatc ctctcctgct 3421 gtttacacaa gatcagctat gtgttctggt ggtaagaaag gcatccgtgc cttcagctga 3481 atcagagacc cgagcagtgc tctgacctgc cctgttccca gagaacgctc agagcctcca 3541 ccaaggagtc tgtttctcag ctgtagccag ccagggccac tttgacctct tcattttccc 3601 ctgcttccat ccttccccta taaaggtgag gggaagacct tgtcccctac cattatcaca 3661 agctcatcac aggtctcttc tgttggatcc aggaaatgtg tgtcccttag ctgtgcctcc 3721 agcagccctg agctgcttgt agcaacttct gcctaaggag cactgcatgg tcttatactg 3781 tagttgtttc ccagtggagt aataaatgtg ggcttgtttg ttgtttcttt aaagcaagca 3841 gtagctgtgt ctatatttat ttagaaattg cctgaagaag attactcaac tatttgaaga 3901 cttattttct atatgccttt cttaattttt ttatgttata tgtcaccaca aaaatatgaa 3961 ctccccaacc ccctctccgt tttttgaaaa aggaaatgac atttaagaac ttcctcatca 4021 gatttctctt tttaaaatat ctgtattagg aagagcagtc gtttcctgcc gtggttttga 4081 ctttttttaa aaaaaactct aacatctttt aaagtttttt tgcataagtt aaactgttcc 4141 cagctttaaa ttgtcctccc tatagggcaa gttggactag gtgtttctag tatccgcatt 4201 gagaagccca gtgctgagcc acaatactca ctaaaaggct ttccccgtag aggtgtgact 4261 gcccctaact gctaacacgg atggttcact gcagtgtaat gtccatccgc tagaatacac 4321 ctcaggtagt tttagaactt gcagcatttg gtgtttgtaa taagccaacc agttacttta 4381 tgttactcaa ttgccacgaa tgcagagtaa aactaatcaa gctgacattc aaggtcaaca 4441 cttagtaagg tcaactcagg atcaagtctt agcctagaaa gccgctttct ttacttcacc 4501 actttctgaa cattctcttt gtaccaatgg gcctataaga atccgtatag tccagagtgc 4561 attggccatc tttccttacc aatctagaac actgctgaat ttaaagttgt ttcttcttag 4621 aaaaatgcct accttactat tgaagatttt tccccaagtc atatatttcc ctcttagaaa 4681 tcaggccaga cggcagttct agtttggaag ttggttacag tcctttggct gttaccatct 4741 ctagccattc tgctttcttc tggagaatga agaggagaaa agtgcattaa agtacaaaag 4801 gtgtcctctc accctcggaa gatcaactga caggtgttgg atgatctcca acaagtaaat 4861 tttgtgacca gtataaagtt gaatttgtac caatatcaaa caaagtctga ccaatgtaaa 4921 ttatgtgcac aattagaata tcttctcctt aaggagaggt tgcttgtttc tgctttacct 4981 ggagtttcct tctttcgcat gtgactggaa aacgttttaa ctttaactat cgaggtgatt 5041 cttacttaag actttgaagt gcttttctct ctttttctgt cgttaacaca catcttttct 5101 tgacttgact caaattctcg ccattgttac agttttttat ggggtgtttg gtgattagtt 5161 tgctggctgc cttgagggag tgaacagggc acggtcaagc gtcgtttgat tgtctgttga 5221 aatactcttt aaatgtcggc attctcaggg taactgtcat ttgtttcaaa gttgatgtga 5281 ttgtctggga aatggatgga tgcttcccaa ttcccagaat ccagaaaaat gaaaccagat 5341 gtgatcaacc tgaacttggg acactctcgg tcacaagcgt tgaagtcact caaaaaggac 5401 taagctagtt atttctctgt gggtcctctg tgtctttgat gttttaaatt gctcagcccc 5461 gccccaataa ataaataaat aaataagaaa agaaaagagt tgtagttttt cacattgtgg 5521 aatgtggaga ggaactcctt ttcctgtcct gtgtctcctc agcggagccc agccctgcct 5581 gacacaggag aaaagggtgg cctgttggtc acctgccctt cagaatgtag ccccatctga 5641 ctcctaaaac cccagtttcc ttcagtgcag gctccaggag agggcagaga ccccattctg 5701 gtcactgctg aacccctgtt tttagcatac tgtgcatggg cctggccaat agtcacaagc 5761 tttaatggga gccagggcag aagctgactg gctgctgggt agcctacttg tcatgtaagt 5821 cagttggtaa agtgagagtg ttcttttttc tgcttttctc ccgggacttt gctactgcag 5881 ttctcaaaca tggaagtgag tttaagacct agtgaacacc tcccacctag gatctgcagt 5941 gacattgggt gtgctctgat ttaatgcttc tatcatgtaa attctaattt ctccttaagg 6001 ctgttcaatc ctgaaataat taaacaactt gaagttgtat aaaattctcc ttggaaactt 6061 gtgatatttt attgtaattt atcttgtagc ttctgcttta tgccaactta aaatttgtgg 6121 aaatgttgtg aggaacttta ctcttatgtc tttgtctaca ggagtatttt tataaaggat 6181 ttatttgc
SEP ID NO: 56 Mouse TRAF6 Transcript Variant 2 cDNA Sequence (NM 001303273.1, CDS region from position 224-1816)
1 tagcgagctg agaaggcgga agcagcggcg gccgcggctg gggctgaggc tccggccgtc 61 ggcggacgca gcagccgcgg cccacgagcc gggagtttgg cgtcggagcc acttggtctc
121 ggagtgccgt gtatgtaggc gacgcggcgc agcccgggga agccttccca gttggttgtg 181 aagtctcagc gtgtacgatc gatcgactga caacagagct actatgagtc tcttaaactg 241 tgagaacagc tgcgggtcca gccagtcgtc cagtgactgc tgcgctgcca tggccgcctc 301 ctgcagcgct gcagtgaaag atgacagcgt gagtggctct gccagcaccg ggaacctctc 361 cagctccttc atggaggaga tccagggcta cgatgtggag tttgacccac ctctggagag 421 caagtatgag tgtcccatct gcttgatggc tttacgggaa gcagtgcaaa caccatgtgg 481 ccacaggttc tgcaaagcct gcatcatcaa atccataagg gatgcagggc acaagtgccc 541 agttgacaat gaaatactgc tggaaaatca actgtttccc gacaattttg caaagcgaga 601 gattctttcc ctgacggtaa agtgcccaaa taaaggctgt ttgcaaaaga tggaactgag 661 acatctcgag gatcatcaag tacattgtga atttgctcta gtgaattgtc cccagtgcca 721 acgtcctttc cagaagtgcc aggttaatac acacattatt gaggattgtc ccaggaggca 781 ggtttcttgt gtaaactgtg ctgtgtccat ggcatatgaa gagaaagaga tccatgatca 841 aagctgtcct ctggcaaata tcatctgtga atactgtggt acaatcctca tcagagaaca 901 gatgcctaat cattatgatc tggactgccc aacagctcca atcccttgca cattcagtgt 961 ttttggctgt catgaaaaga tgcagaggaa tcacttggca cgacacttgc aagagaatac 1021 ccagttgcac atgagactgt tggcccaggc tgttcataat gttaaccttg ctttgcgtcc 1081 gtgcgatgcc gcctctccat cccggggatg tcgtccagag gacccaaatt atgaggaaac 1141 tatcaaacag ttggagagtc gcctagtaag acaggaccat cagatccggg agctgactgc 1201 caaaatggaa actcagagta tgtacgtggg cgagctcaaa cggaccattc ggaccctgga 1261 ggacaaggtt gccgaaatgg aagcacagca gtgtaacggg atctacattt ggaagattgg 1321 caactttggg atgcacttga aatcccaaga agaggaaaga cctgttgtca tccatagccc 1381 tggattctac acaggcagac ctgggtacaa gctgtgcatg cgcctgcatc ttcagttacc 1441 gacagctcag cgctgtgcaa actatatatc cctttttgtc cacacaatgc aaggagaata 1501 tgacagccac ctcccctggc ccttccaggg tacaatacgc cttacaattc tcgaccagtc 1561 tgaagcactt ataaggcaaa accacgaaga ggtcatggac gccaaaccag aactgcttgc 1621 ctttcagcga cccacaatcc cacggaaccc caaaggtttt ggctatgtaa catttatgca 1681 cctggaagcc ttaagacagg gaaccttcat taaggatgat acattactag tgcgctgtga 1741 agtctctacc cgctttgaca tgggtggcct tcggaaggag ggtttccagc cacgaagtac 1801 tgatgcgggg gtgtagcgtc catgtacttg tgttcaaaaa ctaggaacca tatgggaaaa 1861 ccgtgccttc catgcctggc cccagtaaac aatgttcaaa caagcagtgg gagaggtgta 1921 aggcctagca gcagatgtca tcagtgaggt cacgagccac ttcttactgt taacaaatac 1981 ctgaggcagt tcccatggga acctacatgt cccctgtatc ttcaaaacgt caacatttga 2041 agggcctgtg gctcatctgt ctgtcagggt accccttcac tgtgcttcca tgggctattt 2101 tgtccgtgta ctttactgta aaaaaggcca gacttagcgt gctgcagctc aatcgtttaa 2161 taagaccggt gccttaaaaa cttgaggggt ttttaggaca ctgattacta tattaaacat 2221 gaaaatcacc actgcctgtg ctggtgccag tagagaagtt accgctctgg tgttgagttc 2281 tcatttagtt gactcctgtg aatttcagag gctttgaacc atgatccctg gaaggcttaa 2341 gttctcaagt actccctcct ctatagttca ctaaggatcc agggactggt ttaaccctta 2401 cttagtgtga atgtattgtc cactgaacac caagcatccc ccactacttt cctgttttga 2461 aatatgctcc aggcggcctc ttcccagtct gtaagaccgc ggtcatgtgc ttgccaactg 2521 ctgagtgtta ctgccatgga acctttcttg tctgtcccgt gcagcttggt ttccacagcc 2581 ggttgcatat cttctgttgc ttgcaaacac aaaatcacca gcccaaacga gtgatttagc 2641 tcactagcca ttaaatggca tctcgtggat gatgacagca actcttacag ccaggaaact 2701 tcagcccctc ttaactagct tttgatttag cttataaggt taattgaaat aaaattgatt 2761 tttctcaagg ggttggagaa ttggctcagt ggttaagagc cttggctgct cttccagagg 2821 atccccagtc tgtaactcca gttccagggc atctgacacc ctcatacaga cactcatgca 2881 ggcaaaacac cagtgcacat aaaattaaac aaacaaataa ataaataaat tgatttcctc 2941 aaaacagaat ttattggaac ttgggaaatt gtaggtacct gagagatgcc taaaccaagg 3001 ttggctatca cggttgtgtg gacactcagc ttgagtggtg gctttgtcca gctcagtaga 3061 ggttctgatc tgtgacccta atgtggagag gtgactgtcg tgctgctgtg tatttgttaa 3121 tgtcctgtac atatacagta ctttggagtc tagttctcag ggagccctac gactagttag 3181 agcctttgta aggaagcaga ggggatcctc tcctgctgtt tacacaagat cagctatgtg 3241 ttctggtggt aagaaaggca tccgtgcctt cagctgaatc agagacccga gcagtgctct 3301 gacctgccct gttcccagag aacgctcaga gcctccacca aggagtctgt ttctcagctg 3361 tagccagcca gggccacttt gacctcttca ttttcccctg cttccatcct tcccctataa
3421 aggtgagggg aagaccttgt cccctaccat tatcacaagc tcatcacagg tctcttctgt 3481 tggatccagg aaatgtgtgt cccttagctg tgcctccagc agccctgagc tgcttgtagc 3541 aacttctgcc taaggagcac tgcatggtct tatactgtag ttgtttccca gtggagtaat 3601 aaatgtgggc ttgtttgttg tttctttaaa gcaagcagta gctgtgtcta tatttattta 3661 gaaattgcct gaagaagatt actcaactat ttgaagactt attttctata tgcctttctt 3721 aattttttta tgttatatgt caccacaaaa atatgaactc cccaaccccc tctccgtttt 3781 ttgaaaaagg aaatgacatt taagaacttc ctcatcagat ttctcttttt aaaatatctg 3841 tattaggaag agcagtcgtt tcctgccgtg gttttgactt tttttaaaaa aaactctaac 3901 atcttttaaa gtttttttgc ataagttaaa ctgttcccag ctttaaattg tcctccctat 3961 agggcaagtt ggactaggtg tttctagtat ccgcattgag aagcccagtg ctgagccaca 4021 atactcacta aaaggctttc cccgtagagg tgtgactgcc cctaactgct aacacggatg 4081 gttcactgca gtgtaatgtc catccgctag aatacacctc aggtagtttt agaacttgca 4141 gcatttggtg tttgtaataa gccaaccagt tactttatgt tactcaattg ccacgaatgc 4201 agagtaaaac taatcaagct gacattcaag gtcaacactt agtaaggtca actcaggatc 4261 aagtcttagc ctagaaagcc gctttcttta cttcaccact ttctgaacat tctctttgta 4321 ccaatgggcc tataagaatc cgtatagtcc agagtgcatt ggccatcttt ccttaccaat 4381 ctagaacact gctgaattta aagttgtttc ttcttagaaa aatgcctacc ttactattga 4441 agatttttcc ccaagtcata tatttccctc ttagaaatca ggccagacgg cagttctagt 4501 ttggaagttg gttacagtcc tttggctgtt accatctcta gccattctgc tttcttctgg 4561 agaatgaaga ggagaaaagt gcattaaagt acaaaaggtg tcctctcacc ctcggaagat 4621 caactgacag gtgttggatg atctccaaca agtaaatttt gtgaccagta taaagttgaa 4681 tttgtaccaa tatcaaacaa agtctgacca atgtaaatta tgtgcacaat tagaatatct 4741 tctccttaag gagaggttgc ttgtttctgc tttacctgga gtttccttct ttcgcatgtg 4801 actggaaaac gttttaactt taactatcga ggtgattctt acttaagact ttgaagtgct 4861 tttctctctt tttctgtcgt taacacacat cttttcttga cttgactcaa attctcgcca 4921 ttgttacagt tttttatggg gtgtttggtg attagtttgc tggctgcctt gagggagtga 4981 acagggcacg gtcaagcgtc gtttgattgt ctgttgaaat actctttaaa tgtcggcatt 5041 ctcagggtaa ctgtcatttg tttcaaagtt gatgtgattg tctgggaaat ggatggatgc 5101 ttcccaattc ccagaatcca gaaaaatgaa accagatgtg atcaacctga acttgggaca 5161 ctctcggtca caagcgttga agtcactcaa aaaggactaa gctagttatt tctctgtggg 5221 tcctctgtgt ctttgatgtt ttaaattgct cagccccgcc ccaataaata aataaataaa 5281 taagaaaaga aaagagttgt agtttttcac attgtggaat gtggagagga actccttttc 5341 ctgtcctgtg tctcctcagc ggagcccagc cctgcctgac acaggagaaa agggtggcct 5401 gttggtcacc tgcccttcag aatgtagccc catctgactc ctaaaacccc agtttccttc 5461 agtgcaggct ccaggagagg gcagagaccc cattctggtc actgctgaac ccctgttttt 5521 agcatactgt gcatgggcct ggccaatagt cacaagcttt aatgggagcc agggcagaag 5581 ctgactggct gctgggtagc ctacttgtca tgtaagtcag ttggtaaagt gagagtgttc 5641 ttttttctgc ttttctcccg ggactttgct actgcagttc tcaaacatgg aagtgagttt 5701 aagacctagt gaacacctcc cacctaggat ctgcagtgac attgggtgtg ctctgattta 5761 atgcttctat catgtaaatt ctaatttctc cttaaggctg ttcaatcctg aaataattaa 5821 acaacttgaa gttgtataaa attctccttg gaaacttgtg atattttatt gtaatttatc 5881 ttgtagcttc tgctttatgc caacttaaaa tttgtggaaa tgttgtgagg aactttactc 5941 ttatgtcttt gtctacagga gtatttttat aaaggattta tttgc
SEP ID NO: 57 Mouse TRAF6 Amino Acid Sequence (NP 033450.2)
1 msllncensc gssqsssdcc aamaascsaa vkddsvsgsa stgnlsssfm eeiqgydvef
61 dppleskyec piclmalrea vqtpcghrfc kaciiksird aghkcpvdne illenqlfpd
121 nfakreilsl tvkcpnkgcl qkmelrhled hqvhcefalv ncpqcqrpfq kcqvnthiie
181 dcprrqvscv ncavsmayee keihdqscpl aniiceycgt ilireqmpnh ydldcptapi
241 pctfsvfgch ekmqrnhlar hlqentqlhm rllaqavhnv nlalrpcdaa spsrgcrped
301 pnyeetikql esrlvrqdhq ireltakmet qsmyvgelkr tirtledkva emeaqqcngi
361 yiwkignfgm hlksqeeerp vvihspgfyt grpgyklcmr lhlqlptaqr canyislfvh
421 tmqgeydshl pwpfqgtirl tildqseali rqnheevmda kpellafqrp tiprnpkgfg
481 yvtfmhleal rqgtfikddt llvrcevstr fdmgglrkeg fqprstdagv
SEP ID NO: 58 Human TAB2 Transcript Variant 1 cDNA Sequence
(NM 015093.5, CDS region from position 422-2503)
1 atcgagcgcc taggagagcc ccgggtgggg gagggcgcaa ggggctcggg agggcccctc 61 cctgcgtcgg cgcccctgac ccgcccccag aggcagggtt ttgctgtatt gcacaggcta 121 gtctcaaact ccttggctca agtgatcctc ttgctttggt ctcccaaagt gctgcgatta
181 caggctccag acccagttcc tggacctgcc ctggaaaaga agtatcccgt agagatgagc 241 tcactgcagt tacttaatta acaatttgta agctgcaaaa atggcaatgg gccaaccaag 301 aacagctaca atttgaattt ttctatttcc agaaaatgct tggacagaag agatgagtac 361 tatttccact aaggcctaga attgcctact gtacaaatag tcctgatcag gcaatatacg 421 aatggcccaa ggaagccacc aaattgattt tcaggtttta catgacctgc gacaaaaatt 481 ccctgaagta cctgaagttg ttgtatccag gtgcatgtta cagaataata ataacctgga 541 tgcctgctgt gctgttctct ctcaggagag tacaagatat ctttatggtg aaggagactt 601 gaatttttca gatgattctg gaatttctgg tctacgcaat cacatgactt ctctcaactt 661 ggacttgcaa tcacagaaca tttaccacca tggaagagaa ggaagtagga tgaatggaag 721 taggactcta acgcacagca ttagtgatgg acaacttcaa ggtggccagt ccaatagtga 781 actatttcag caggagccac agacagcacc agctcaagtt cctcaaggct ttaatgtttt 841 tggaatgtcc agttcctctg gtgcttcaaa ttcagcacca catcttggat ttcacttagg 901 cagcaaagga acatctagcc tttctcaaca aactcccaga tttaatccca ttatggtaac 961 tttagcccca aatatccaga ctggtcgtaa tactcctaca tctttgcaca tacatggtgt 1021 acctccacct gtacttaaca gtccacaggg aaattctatc tatattaggc cttacattac 1081 aactcctggt ggtacaactc gacagacaca acagcattct ggctgggtat ctcagtttaa 1141 tcccatgaac cctcagcaag tttatcagcc ttcacagcct ggtccctgga ctacttgtcc 1201 tgcatctaat cctctgtcac atacctcatc tcaacagcca aatcagcaag gccaccagac 1261 ctctcatgtc tacatgccaa tcagttcacc tactacttca caaccaccaa ccattcattc 1321 atctggtagc tcacagtctt ctgcccatag ccaatataac attcagaata tttcaacagg 1381 acctcgaaaa aaccagattg aaatcaaact tgaaccccca caaagaaata attcttcaaa 1441 actgcgttct tctggacctc gaacctccag cacttcctct tcagtcaata gccagacctt 1501 aaacagaaat cagcccactg tttacatagc tgccagcccc ccaaatacgg atgagctgat 1561 gtcccgtagt caacctaagg tctatatttc agcgaatgct gccacaggag atgaacaggt 1621 catgcggaat cagcccacac tcttcatatc cacaaactct ggagcatctg ctgcctccag 1681 gaacatgtct gggcaagtga gcatgggtcc tgcctttatt catcaccatc ctcccaaaag 1741 tcgagcaata ggcaataact ctgcaacctc tcctcgagtg gtagtcactc agcccaatac 1801 gaaatacact ttcaaaatta cagtctctcc caataagccc cctgcagttt caccaggggt 1861 ggtgtcccct acctttgaac ttacaaatct tcttaatcat cctgatcatt atgtagaaac 1921 cgagaatatt cagcacctca cggaccctac attagcacat gtggatagaa taagtgaaac 1981 acggaaactg agtatgggat ctgatgatgc tgcctacaca caagctcttt tggtacacca 2041 gaaggccaga atggaacgac ttcaaagaga acttgagatt caaaagaaaa agctggataa 2101 attaaaatct gaggttaatg aaatggaaaa taatctaact cgaaggcgcc tgaaaagatc 2161 aaattctata tcccagatac cttcccttga agaaatgcag cagctgagaa gttgtaatag 2221 acaactccag attgacattg actgcttaac caaagaaatt gatctttttc aagcccgagg 2281 accacatttt aaccccagcg ctattcataa cttttatgac aatattggat ttgtaggtcc 2341 tgtgccacca aaacccaaag atcaaaggtc catcatcaaa acaccaaaga ctcaagacac 2401 agaagatgat gagggagctc agtggaattg taccgcctgt acttttttga accatccagc 2461 cttaattcgc tgtgaacagt gtgagatgcc aaggcatttc tgagccaaat ggccctgtat 2521 cttctctaaa accacatcta aagttcaaga aactagtctg tcatcgggaa aaagtttcac 2581 tgctacatag gattttgtca aattgaaggt gtgacaagat ggtgttctgc taatgttaaa 2641 tgtcagccca cagagctaat aatacctcag tataatgtca tgagcagttg aaattcatca 2701 catgaaaagt aatctgctga aagacttggt tgcccactgc ctaactgtgt acagtgttac 2761 cagtgtccca ttatggataa ttctcaatat gttaacacct aggtgttccc aatacctttt 2821 tcccctcatg tcactactga attttgacag gaggaaggaa tagaatgata gcttgtttta 2881 tttgtaaagc tttcagtgaa acactacata cacgaagaaa aggaacaagg tttaactatt 2941 taagaaccat ttgctgccgc atagtgccat tggataggga agaacttcag aaatctgtgg 3001 tactcttggc cttgtctttg tcttccctga acgtgtctcc actctgtgaa gccagcatct 3061 aggggctaaa gatgcaaagg aaagcagcat gcattgtctg tacaaatgtg cagcgaaata 3121 ccccaaagct tttcctactg tacagatctc tcgagtctgc tttaagtgat ttcttttctt 3181 cttgattatt ttcttatatt tctatatgta tagtgtaata gccttttgtt aactaatttt 3241 cttttttcct tttagtaatt aagcacgatc atgtcccttt ttaagcctta cctgagagga 3301 acaatgcctt aaaataaaaa agcattaatg agatgaaagt atgcacagaa taactttcct 3361 ctacttattc tgtactttgc cctcatgagt tccaatgttg tgtgaagaca ggcagatgct 3421 gcacagtgaa ttgcagatga tattacagaa gtgatgtctg taggtcacat taaatactga 3481 cttgagcagt gggtgacaca acacagtgtt tgtcttccac agggaagctt aaaacaaaag 3541 atatttttaa cccactgaca gaacaacaag gttaagcttc atctgcttgg tgtcccacag 3601 aacttgcaca agcagttgtt attgggaaag tacagtctca aaaccagcaa cagcagcagt 3661 acctacagcc ctttttttgg agagaagttt aaatgcttta ctgttggggc agtccatttc 3721 taatcctgac ttggtgacag tatcatgtgt atttataaaa caaggctagc catatttagg 3781 acaactgaag aaaagctgga aaaaaaaaca agcaaacttg aacactgaag caacctcaag
3841 catctcttta ttttgatgat atatttttgt aaggaaaata ttcagatgat caggaatgta 3901 tataactgaa atcaagaaaa agaacagtat gcatttaaaa agacagaatt atgaaattat 3961 atgagtgctt agaatggggc taagggaagt gctgaaatag agcaaaggat ggaagataat 4021 atagactacc acccactgta aatgtttgca agtggctgtg ttttaaatgg gattattaca 4081 gttgatctct atgaatgtca gagccctaac tttcaggctt tgcattttgt atatgggaag 4141 aaatatgaca atcctaggta attaaaccat agacccaaag cccttacgtt tgatgcaatt 4201 tatttttaaa ataggccttg tttttcagct tcatctgcag ttctatgtga agattgataa 4261 atcagttttt acttgtttta ttaataaaac gtaatttgga tatcttgagt tgatggtttt 4321 gtgatttagc tgggtaaact atctttgtaa cagataagtt atttataaaa attaaaaaac 4381 ttatattcta atgtggaaaa aaaaaaaaaa aaaa
SEP ID NO: 59 Human TAB2 Transcript Variant 3 cDNA Sequence
(NM 001292034.2, CDS region from position 179-2260)
1 ggaggcgacg gtggagacgg ctgccctagt gggagaggcg gcggcggcgg cggccgagga 61 ggaggagggg gaagcggcgg cggcaaagga aaatgcttgg acagaagaga tgagtactat
121 ttccactaag gcctagaatt gcctactgta caaatagtcc tgatcaggca atatacgaat 181 ggcccaagga agccaccaaa ttgattttca ggttttacat gacctgcgac aaaaattccc 241 tgaagtacct gaagttgttg tatccaggtg catgttacag aataataata acctggatgc 301 ctgctgtgct gttctctctc aggagagtac aagatatctt tatggtgaag gagacttgaa 361 tttttcagat gattctggaa tttctggtct acgcaatcac atgacttctc tcaacttgga 421 cttgcaatca cagaacattt accaccatgg aagagaagga agtaggatga atggaagtag 481 gactctaacg cacagcatta gtgatggaca acttcaaggt ggccagtcca atagtgaact 541 atttcagcag gagccacaga cagcaccagc tcaagttcct caaggcttta atgtttttgg 601 aatgtccagt tcctctggtg cttcaaattc agcaccacat cttggatttc acttaggcag 661 caaaggaaca tctagccttt ctcaacaaac tcccagattt aatcccatta tggtaacttt 721 agccccaaat atccagactg gtcgtaatac tcctacatct ttgcacatac atggtgtacc 781 tccacctgta cttaacagtc cacagggaaa ttctatctat attaggcctt acattacaac 841 tcctggtggt acaactcgac agacacaaca gcattctggc tgggtatctc agtttaatcc 901 catgaaccct cagcaagttt atcagccttc acagcctggt ccctggacta cttgtcctgc 961 atctaatcct ctgtcacata cctcatctca acagccaaat cagcaaggcc accagacctc 1021 tcatgtctac atgccaatca gttcacctac tacttcacaa ccaccaacca ttcattcatc 1081 tggtagctca cagtcttctg cccatagcca atataacatt cagaatattt caacaggacc 1141 tcgaaaaaac cagattgaaa tcaaacttga acccccacaa agaaataatt cttcaaaact 1201 gcgttcttct ggacctcgaa cctccagcac ttcctcttca gtcaatagcc agaccttaaa 1261 cagaaatcag cccactgttt acatagctgc cagcccccca aatacggatg agctgatgtc 1321 ccgtagtcaa cctaaggtct atatttcagc gaatgctgcc acaggagatg aacaggtcat 1381 gcggaatcag cccacactct tcatatccac aaactctgga gcatctgctg cctccaggaa 1441 catgtctggg caagtgagca tgggtcctgc ctttattcat caccatcctc ccaaaagtcg 1501 agcaataggc aataactctg caacctctcc tcgagtggta gtcactcagc ccaatacgaa 1561 atacactttc aaaattacag tctctcccaa taagccccct gcagtttcac caggggtggt 1621 gtcccctacc tttgaactta caaatcttct taatcatcct gatcattatg tagaaaccga 1681 gaatattcag cacctcacgg accctacatt agcacatgtg gatagaataa gtgaaacacg 1741 gaaactgagt atgggatctg atgatgctgc ctacacacaa gctcttttgg tacaccagaa 1801 ggccagaatg gaacgacttc aaagagaact tgagattcaa aagaaaaagc tggataaatt 1861 aaaatctgag gttaatgaaa tggaaaataa tctaactcga aggcgcctga aaagatcaaa 1921 ttctatatcc cagatacctt cccttgaaga aatgcagcag ctgagaagtt gtaatagaca 1981 actccagatt gacattgact gcttaaccaa agaaattgat ctttttcaag cccgaggacc 2041 acattttaac cccagcgcta ttcataactt ttatgacaat attggatttg taggtcctgt 2101 gccaccaaaa cccaaagatc aaaggtccat catcaaaaca ccaaagactc aagacacaga 2161 agatgatgag ggagctcagt ggaattgtac cgcctgtact tttttgaacc atccagcctt 2221 aattcgctgt gaacagtgtg agatgccaag gcatttctga gccaaatggc cctgtatctt 2281 ctctaaaacc acatctaaag ttcaagaaac tagtctgtca tcgggaaaaa gtttcactgc 2341 tacataggat tttgtcaaat tgaaggtgtg acaagatggt gttctgctaa tgttaaatgt 2401 cagcccacag agctaataat acctcagtat aatgtcatga gcagttgaaa ttcatcacat 2461 gaaaagtaat ctgctgaaag acttggttgc ccactgccta actgtgtaca gtgttaccag 2521 tgtcccatta tggataattc tcaatatgtt aacacctagg tgttcccaat acctttttcc 2581 cctcatgtca ctactgaatt ttgacaggag gaaggaatag aatgatagct tgttttattt 2641 gtaaagcttt cagtgaaaca ctacatacac gaagaaaagg aacaaggttt aactatttaa 2701 gaaccatttg ctgccgcata gtgccattgg atagggaaga acttcagaaa tctgtggtac 2761 tcttggcctt gtctttgtct tccctgaacg tgtctccact ctgtgaagcc agcatctagg
2821 ggctaaagat gcaaaggaaa gcagcatgca ttgtctgtac aaatgtgcag cgaaataccc 2881 caaagctttt cctactgtac agatctctcg agtctgcttt aagtgatttc ttttcttctt 2941 gattattttc ttatatttct atatgtatag tgtaatagcc ttttgttaac taattttctt 3001 ttttcctttt agtaattaag cacgatcatg tcccttttta agccttacct gagaggaaca 3061 atgccttaaa ataaaaaagc attaatgaga tgaaagtatg cacagaataa ctttcctcta 3121 cttattctgt actttgccct catgagttcc aatgttgtgt gaagacaggc agatgctgca 3181 cagtgaattg cagatgatat tacagaagtg atgtctgtag gtcacattaa atactgactt 3241 gagcagtggg tgacacaaca cagtgtttgt cttccacagg gaagcttaaa acaaaagata 3301 tttttaaccc actgacagaa caacaaggtt aagcttcatc tgcttggtgt cccacagaac 3361 ttgcacaagc agttgttatt gggaaagtac agtctcaaaa ccagcaacag cagcagtacc 3421 tacagccctt tttttggaga gaagtttaaa tgctttactg ttggggcagt ccatttctaa 3481 tcctgacttg gtgacagtat catgtgtatt tataaaacaa ggctagccat atttaggaca 3541 actgaagaaa agctggaaaa aaaaacaagc aaacttgaac actgaagcaa cctcaagcat 3601 ctctttattt tgatgatata tttttgtaag gaaaatattc agatgatcag gaatgtatat 3661 aactgaaatc aagaaaaaga acagtatgca tttaaaaaga cagaattatg aaattatatg 3721 agtgcttaga atggggctaa gggaagtgct gaaatagagc aaaggatgga agataatata 3781 gactaccacc cactgtaaat gtttgcaagt ggctgtgttt taaatgggat tattacagtt 3841 gatctctatg aatgtcagag ccctaacttt caggctttgc attttgtata tgggaagaaa 3901 tatgacaatc ctaggtaatt aaaccataga cccaaagccc ttacgtttga tgcaatttat 3961 ttttaaaata ggccttgttt ttcagcttca tctgcagttc tatgtgaaga ttgataaatc 4021 agtttttact tgttttatta ataaaacgta atttggatat cttgagttga tggttttgtg 4081 atttagctgg gtaaactatc tttgtaacag ataagttatt tataaaaatt aaaaaactta 4141 tattctaatg tggaaaaaaa aaaaaaaaaa a
SEP ID NO: 60 Human TAB2 Isoform a Amino Acid Sequence (NP 055908.1)
1 maqgshqidf qvlhdlrqkf pevpevvvsr cmlqnnnnld accavlsqes trylygegdl
61 nfsddsgisg lrnhmtslnl dlqsqniyhh gregsrmngs rtlthsisdg qlqggqsnse
121 lfqqepqtap aqvpqgfnvf gmssssgasn saphlgfhlg skgtsslsqq tprfnpimvt
181 lapniqtgrn tptslhihgv pppvlnspqg nsiyirpyit tpggttrqtq qhsgwvsqfn
241 pmnpqqvyqp sqpgpwttcp asnplshtss qqpnqqghqt shvympissp ttsqpptihs
301 sgssqssahs qyniqnistg prknqieikl eppqrnnssk lrssgprtss tsssvnsqtl
361 nrnqptvyia asppntdelm srsqpkvyis anaatgdeqv mrnqptlfis tnsgasaasr
421 nmsgqvsmgp afihhhppks raignnsats prvvvtqpnt kytfkitvsp nkppavspgv
481 vsptfeltnl lnhpdhyvet eniqhltdpt lahvdriset rklsmgsdda aytqallvhq
541 karmerlqre leiqkkkldk lksevnemen nltrrrlkrs nsisqipsle emqqlrscnr
601 qlqididclt keidlfqarg phfnpsaihn fydnigfvgp vppkpkdqrs iiktpktqdt
661 eddegaqwnc tactflnhpa lirceqcemp rhf
SEP ID NO: 61 Human TAB2 Transcript Variant 4 cDNA Sequence
(NM 001292035.2, CDS region from position 310-2295)
1 tcctttctgg agtctgaaat gttaagtatg gaggcaaaag ctgaagctgg agcaacagtc 61 tcagaatatg acaacaacca tgagaatgga ggccattcat agcagaacta cgagacaaga 121 ggagcctagg tccctgagct gcagaactgc atactaacct gatgagaaga ctaatgctca 181 gtgaggtgaa ctccttcagg gccacaggct gtaaagatct aaacaccatc tgatccagtt 241 tcaatatgac tgcctggatg aagaaggatt tgagactaag tttattcctc caaagcaaac 301 caactgagaa tgcagaataa taataacctg gatgcctgct gtgctgttct ctctcaggag 361 agtacaagat atctttatgg tgaaggagac ttgaattttt cagatgattc tggaatttct 421 ggtctacgca atcacatgac ttctctcaac ttggacttgc aatcacagaa catttaccac 481 catggaagag aaggaagtag gatgaatgga agtaggactc taacgcacag cattagtgat 541 ggacaacttc aaggtggcca gtccaatagt gaactatttc agcaggagcc acagacagca 601 ccagctcaag ttcctcaagg ctttaatgtt tttggaatgt ccagttcctc tggtgcttca 661 aattcagcac cacatcttgg atttcactta ggcagcaaag gaacatctag cctttctcaa 721 caaactccca gatttaatcc cattatggta actttagccc caaatatcca gactggtcgt 781 aatactccta catctttgca catacatggt gtacctccac ctgtacttaa cagtccacag 841 ggaaattcta tctatattag gccttacatt acaactcctg gtggtacaac tcgacagaca 901 caacagcatt ctggctgggt atctcagttt aatcccatga accctcagca agtttatcag 961 ccttcacagc ctggtccctg gactacttgt cctgcatcta atcctctgtc acatacctca 1021 tctcaacagc caaatcagca aggccaccag acctctcatg tctacatgcc aatcagttca 1081 cctactactt cacaaccacc aaccattcat tcatctggta gctcacagtc ttctgcccat 1141 agccaatata acattcagaa tatttcaaca ggacctcgaa aaaaccagat tgaaatcaaa
1201 cttgaacccc cacaaagaaa taattcttca aaactgcgtt cttctggacc tcgaacctcc 1261 agcacttcct cttcagtcaa tagccagacc ttaaacagaa atcagcccac tgtttacata 1321 gctgccagcc ccccaaatac ggatgagctg atgtcccgta gtcaacctaa ggtctatatt 1381 tcagcgaatg ctgccacagg agatgaacag gtcatgcgga atcagcccac actcttcata 1441 tccacaaact ctggagcatc tgctgcctcc aggaacatgt ctgggcaagt gagcatgggt 1501 cctgccttta ttcatcacca tcctcccaaa agtcgagcaa taggcaataa ctctgcaacc 1561 tctcctcgag tggtagtcac tcagcccaat acgaaataca ctttcaaaat tacagtctct 1621 cccaataagc cccctgcagt ttcaccaggg gtggtgtccc ctacctttga acttacaaat 1681 cttcttaatc atcctgatca ttatgtagaa accgagaata ttcagcacct cacggaccct 1741 acattagcac atgtggatag aataagtgaa acacggaaac tgagtatggg atctgatgat 1801 gctgcctaca cacaagctct tttggtacac cagaaggcca gaatggaacg acttcaaaga 1861 gaacttgaga ttcaaaagaa aaagctggat aaattaaaat ctgaggttaa tgaaatggaa 1921 aataatctaa ctcgaaggcg cctgaaaaga tcaaattcta tatcccagat accttccctt 1981 gaagaaatgc agcagctgag aagttgtaat agacaactcc agattgacat tgactgctta 2041 accaaagaaa ttgatctttt tcaagcccga ggaccacatt ttaaccccag cgctattcat 2101 aacttttatg acaatattgg atttgtaggt cctgtgccac caaaacccaa agatcaaagg 2161 tccatcatca aaacaccaaa gactcaagac acagaagatg atgagggagc tcagtggaat 2221 tgtaccgcct gtactttttt gaaccatcca gccttaattc gctgtgaaca gtgtgagatg 2281 ccaaggcatt tctgagccaa atggccctgt atcttctcta aaaccacatc taaagttcaa 2341 gaaactagtc tgtcatcggg aaaaagtttc actgctacat aggattttgt caaattgaag 2401 gtgtgacaag atggtgttct gctaatgtta aatgtcagcc cacagagcta ataatacctc 2461 agtataatgt catgagcagt tgaaattcat cacatgaaaa gtaatctgct gaaagacttg 2521 gttgcccact gcctaactgt gtacagtgtt accagtgtcc cattatggat aattctcaat 2581 atgttaacac ctaggtgttc ccaatacctt tttcccctca tgtcactact gaattttgac 2641 aggaggaagg aatagaatga tagcttgttt tatttgtaaa gctttcagtg aaacactaca 2701 tacacgaaga aaaggaacaa ggtttaacta tttaagaacc atttgctgcc gcatagtgcc 2761 attggatagg gaagaacttc agaaatctgt ggtactcttg gccttgtctt tgtcttccct 2821 gaacgtgtct ccactctgtg aagccagcat ctaggggcta aagatgcaaa ggaaagcagc 2881 atgcattgtc tgtacaaatg tgcagcgaaa taccccaaag cttttcctac tgtacagatc 2941 tctcgagtct gctttaagtg atttcttttc ttcttgatta ttttcttata tttctatatg 3001 tatagtgtaa tagccttttg ttaactaatt ttcttttttc cttttagtaa ttaagcacga 3061 tcatgtccct ttttaagcct tacctgagag gaacaatgcc ttaaaataaa aaagcattaa 3121 tgagatgaaa gtatgcacag aataactttc ctctacttat tctgtacttt gccctcatga 3181 gttccaatgt tgtgtgaaga caggcagatg ctgcacagtg aattgcagat gatattacag 3241 aagtgatgtc tgtaggtcac attaaatact gacttgagca gtgggtgaca caacacagtg 3301 tttgtcttcc acagggaagc ttaaaacaaa agatattttt aacccactga cagaacaaca 3361 aggttaagct tcatctgctt ggtgtcccac agaacttgca caagcagttg ttattgggaa 3421 agtacagtct caaaaccagc aacagcagca gtacctacag cccttttttt ggagagaagt 3481 ttaaatgctt tactgttggg gcagtccatt tctaatcctg acttggtgac agtatcatgt 3541 gtatttataa aacaaggcta gccatattta ggacaactga agaaaagctg gaaaaaaaaa 3601 caagcaaact tgaacactga agcaacctca agcatctctt tattttgatg atatattttt 3661 gtaaggaaaa tattcagatg atcaggaatg tatataactg aaatcaagaa aaagaacagt 3721 atgcatttaa aaagacagaa ttatgaaatt atatgagtgc ttagaatggg gctaagggaa 3781 gtgctgaaat agagcaaagg atggaagata atatagacta ccacccactg taaatgtttg 3841 caagtggctg tgttttaaat gggattatta cagttgatct ctatgaatgt cagagcccta 3901 actttcaggc tttgcatttt gtatatggga agaaatatga caatcctagg taattaaacc 3961 atagacccaa agcccttacg tttgatgcaa tttattttta aaataggcct tgtttttcag 4021 cttcatctgc agttctatgt gaagattgat aaatcagttt ttacttgttt tattaataaa 4081 acgtaatttg gatatcttga gttgatggtt ttgtgattta gctgggtaaa ctatctttgt 4141 aacagataag ttatttataa aaattaaaaa acttatattc taatgtggaa aaaaaaaaaa 4201 aaaaaa
SEP ID NO: 62 Human TAB2 Isoform b Amino Acid Sequence
(NP 001278964.1)
1 mqnnnnldac cavlsqestr ylygegdlnf sddsgisglr nhmtslnldl qsqniyhhgr
61 egsrmngsrt lthsisdgql qggqsnself qqepqtapaq vpqgfnvfgm ssssgasnsa 121 phlgfhlgsk gtsslsqqtp rfnpimvtla pniqtgrntp tslhihgvpp pvlnspqgns 181 iyirpyittp ggttrqtqqh sgwvsqfnpm npqqvyqpsq pgpwttcpas nplshtssqq 241 pnqqghqtsh vympissptt sqpptihssg ssqssahsqy niqnistgpr knqieiklep 301 pqrnnssklr ssgprtssts ssvnsqtlnr nqptvyiaas ppntdelmsr sqpkvyisan
361 aatgdeqvmr nqptlfistn sgasaasrnm sgqvsmgpaf ihhhppksra ignnsatspr
421 vvvtqpntky tfkitvspnk ppavspgvvs ptfeltnlln hpdhyveten iqhltdptla
481 hvdrisetrk lsmgsddaay tqallvhqka rmerlqrele iqkkkldklk sevnemennl
541 trrrlkrsns isqipsleem qqlrscnrql qididcltke idlfqargph fnpsaihnfy 601 dnigfvgpvp pkpkdqrsii ktpktqdted degaqwncta ctflnhpali rceqcemprh
661 f
SEP ID NO: 63 Mouse TAB2 cDNA Sequence (NM 138667.3, CDS region from position 410-2491)
1 gtgcgagccg gagccgagca gcgggccgcg gcgacgccgc cccggccatc gctttgatcc
61 gcggcaggcg ccggcggcgg ggcgccccag gccgaccccc tcccctcccc ctcagccgcg 121 agcggcggcg gcggccggag ggagttggcg gcggccgggc ggagggggcc gagcggggag 181 ggagggaggg ctgaggtgtc ccccctgccg ggtggaatcg gcgctggcgg cggccgcggt 241 gacgacgggg gagacggctg cccaagtggg agaggcggcg gcggcggacg aggaggaggg 301 ggaagccgcg gcggcggcga aggaaaatgc ttggccagaa gagatgagta ctaattccac 361 tcaggcctag aattgcctat tgagatagac ctgagcaggc gacatacgaa tggcccaagg 421 aagccaccaa attgattttc aggttttaca tgacctgcga caaaaattcc cagaagtgcc 481 tgaagttgtt gtatccaggt gcatgttaca gaacaataat aacctggatg cctgctgcgc 541 tgttctctct caggagagta caaggtatct ttatggtgaa ggagacctga atttttcaga 601 tgagtctgga atttctggtc tacgcaatca catgacttct ctcaacttgg acttgcagtc 661 acagaatgtt taccaccatg gaagagaagg aagtcgagtg aatggaagca ggactttaac 721 acacagcgtt agtgatggac agcttcacgg tgggcagtcc aataacgaac tgtttcagca 781 agagccacag acagcaccag ctcaagttcc tcaaggcttt aatgtttttg gaatgcccag 841 tacatctggt gcttcaaact caacaccgca tcttggattt cacctaggca gcaaagggac 901 atcaaacctt tctcaacaga ctcccaggtt caatcctatt atggtaactt tagccccaaa 961 catacagact ggccgtagta ctcctacatc tttgcacata catggtgtac ctccgcctgt 1021 actgaacagt ccacagggaa attctatcta tattaggcct tatattacaa ctcctagtgg 1081 tacagctcgg cagacacaac aacattctgg ctgggtgtct cagtttaatc ccatgaaccc 1141 tcagcaagcc tatcaacctt cacagcctgg accttggact acttatcctg catccaatcc 1201 tttgccacat acctcaaccc agcagccgaa tcagcagggc catcagacct ctcatgtcta 1261 catgcctatc agttcgccaa ctactccaca accgccaacc attcactcat ctgggagctc 1321 tcagtcttct gcccatagcc aatataacat tcagaatatt tcaacaggac ctcgaaagaa 1381 ccagatagaa atcaaacttg aacccccaca aagaaacagt tcttcaaaat tacgttcttc 1441 tggacctcga actgccagca cttcctcatt ggtcaacagc cagaccttaa atagaaatca 1501 gcccactgtt tacatagctg ccagtcctcc aaatactgat gagatgatct cccgtagtca 1561 acccaaggtc tatatttcag ccaatgccac cgcaggagat gagcaaggca tgcggaatca 1621 accgacactc ttcatatcta caaactctgg gccatctgca gcctccagga acatgtctgg 1681 gcaagtgagc atgggtcctg cctttatcca tcaccatcca cccaaaagcc gagtgttagg 1741 tggtaactct gcaacgtctc ctcgagtggt ggtcactcaa cccaacacaa aatatacttt 1801 caaaattaca gtttccccca ataagccccc tgctgtttcc ccgggggtgg tctccccaac 1861 ctttgaactt acaaatcttc taaatcatcc tgaccattat gtagaaacag agaacattca 1921 gcatctcaca gacccggctc tagcacatgt ggatagaata agcgaagccc ggaaactgag 1981 tatgggatct gatgatgctg cctacacaca agctctgctg gtgcaccaga aggccaggat 2041 ggaacggctt caaagagagc tcgagatgca aaagaaaaag ctggataaac tcaaatctga 2101 ggtcaatgag atggaaaata atctaactcg aaggcgcctg aagagatcaa attccatttc 2161 ccagataccg tcactcgaag aaatgcagca gttgagaagt tgtaatagac aactccagat 2221 tgacattgac tgcttaacca aagaaattga tctttttcaa gcccgaggac cacattttaa 2281 ccccagcgct attcataact tttatgacaa tattggattt gtaggccctg tgccaccaaa 2341 acccaaagat caaaggtcca ccatcaaagc accaaagacc caagacgcag aggatgagga 2401 aggtgctcag tggaattgca ctgcctgtac gtttctgaat cacccggcct taatccgctg 2461 tgaacagtgt gagatgcctc ggcatttctg agccaaaggc cccgccttcc tctgaaacca 2521 catctaaagt tcaagaaggt cgcctgtcat cgggaaagtg tttcaccgcc acaggagtta 2581 gtccagttga aggtgtgacg agacagtggt gtgctgtgtt gagtgtcagc ccacagagct 2641 aatgatacct caatctaatg tcatgggcag tgagattcat cacctgaaag gcctgagaga 2701 ccgggctgcc tgctgcctga ccatgtccag tgtcacgtgt cagtgcctag gtgttcccag 2761 gactcctccc ctcttgtcac cactgatcct gacgggagga agggagagac aggatgattg 2821 ctttttgtgt tgttagagct tttggtgaaa cactacatac acaaagagaa ggaacaaggt 2881 ttgactgaga actctgctgc cacatagtgc cagtagatgt gggaaacgcc acaaatctgg 2941 ggtacttttg gccctgtcct ctgtcttctg aggacatctc tgtgaagcca gcatttaggt 3001 gtgagataaa aggaaagctg tgtctgtctg tacatccaca gtgcgctccc caagcctctc
3061 ctactgtaca gatgtctcac gtctgctttg atttctccat tatcttctta tatttctata 3121 tgtatagtgt aatagacttg tgttaactag tgtccttttc ccttttagta agcacgatca 3181 tgctcctttt aagccttacc tgagaaaagc aatgccataa ggtagaaagc attaatgaaa 3241 tgaaactgtg cacaacataa ctccctctcc ccttcctcct cctgtccttt gtcccttggt 3301 gccaatgctc tgagaagaca tgcaggtgct gcatgtgagt cactgcaaga aacactgcag 3361 ccatcggacg gtcgaggtca cgctgtacac tgacttgagc agtgggtgac caaacatgtc 3421 gttttgtctt ctccagcagc ttaaagcaga aagtatttaa acccactgcc atcttgcccc 3481 atctgtgtgg tatcccatag aactccatgg gaggctcttg ttgggaaaat gcagttttaa 3541 gaagcagcct cagcagccgt tcccgcagcc tcttcttccc gggaagaagt gtggctgtcg 3601 gactgttggc acagtcatgt gtatttataa agcatagtca tctttaggac aactgaagaa 3661 aagctggaaa aaagaaagaa aacaagcaga cttgaacact gaagcaacct cagacatctc 3721 tttattttga tgatatattt ttgtaaggaa aataaatatt catatgatca ggaatgtata 3781 taactaaatg aaatcaagaa aaaataacca tatgcatttt aaaagaatta tgaaattatc 3841 agtgcttgga atggggctaa gggaagtgct gaaatataag aaaaaaatag gaaataatgt 3901 agattgtccc actgtaaatg ttcacaagtg gctatgtttt aaataaacag gattattatg 3961 aatgagcgtt aagaaggtca gagcctggcc ttccgggctt tgcactgtga gtatggaaag 4021 agatacggca accataggtc actaggcaac agaccccaaa actcgtacat ttgatgcatt 4081 gtgttttaaa agtaggcctt gtttttcagc ttcctctgca gttctatgtg aagattgata 4141 aatcagtttt tacttgtttt attaataaaa cgtaatttgg atatcttgag ttgatggttt 4201 tgtgatttag ctgggtaaac tatctttgta acagataagt tatttataaa aattaaaaaa 4261 acttatattc taatgtgg
SEP ID NO: 64 Mouse TAB2 Amino Acid Sequence (NP 619608. 11
1 maqgshqidf qvlhdlrqkf pevpevvvsr cmlqnnnnld accavlsqes trylygegdl 61 nfsdesgisg lrnhmtslnl dlqsqnvyhh gregsrvngs rtlthsvsdg qlhggqsnne 121 Ifqqepqtap aqvpqgfnvf gmpstsgasn stphlgfhlg skgtsnlsqq tprfnpimvt 181 lapniqtgrs tptslhihgv pppvlnspqg nsiyirpyit tpsgtarqtq qhsgwvsqfn 241 pmnpqqayqp sqpgpwttyp asnplphtst qqpnqqghqt shvympissp ttpqpptihs 301 sgssqssahs qyniqnistg prknqieikl eppqrnsssk lrssgprtas tsslvnsqtl 361 nrnqptvyia asppntdemi srsqpkvyis anatagdeqg mrnqptlfis tnsgpsaasr 421 nmsgqvsmgp afihhhppks rvlggnsats prvvvtqpnt kytfkitvsp nkppavspgv 481 vsptfeltnl lnhpdhyvet eniqhltdpa lahvdrisea rklsmgsdda aytqallvhq 541 karmerlqre lemqkkkldk lksevnemen nltrrrlkrs nsisqipsle emqqlrscnr 601 qlqididclt keidlfqarg phfnpsaihn fydnigfvgp vppkpkdqrs tikapktqda 661 edeegaqwnc tactflnhpa lirceqcemp rhf
SEP ID NO: 65 Human TNIP1 Transcript Variant 1 cDNA Sequence (NM 001252385.1, CDS region from position 242-2101)
1 agtctccggg gactttccca ggggtggggc ggcccggcca ggcccccggc acttcctcgt 61 cctcggcccg ggtgccctgc ccccgtccag gagccctagg agtgctacgg ggggccggag 121 ccttgcccgg gccgctgccc cgtccctgga ttcggggctg gacgcagcaa gcggggcgct 181 gtgtccccaa gctccccgtc ctcggccagg cgggcaccac ggcaggggct gagctaccct 241 catggaaggg agaggaccgt accggatcta cgaccctggg ggcagcgtgc cctcaggaga 301 ggcatccgca gcttttgagc gcctagtgaa ggagaattcc cggctgaagg aaaaaatgca 361 agggataaag atgttagggg agcttttgga agagtcccag atggaagcga ccaggctccg 421 gcagaaggca gaggagctag tgaaggacaa cgagctgctc ccaccacctt ctccctcctt 481 gggctccttc gaccccctgg ctgagctcac aggaaaggac tcaaatgtca cagcatctcc 541 cacagcccct gcatgcccca gtgacaagcc agcaccagtc cagaagcctc catccagtgg 601 cacctcctct gaatttgaag tggtcactcc tgaggagcag aattcaccag agagcagcag 661 ccatgccaat gcgatggcgc tgggccccct gccccgtgag gacggcaacc tgatgctgca 721 cctgcagcgc ctggagacca cgctgagtgt gtgtgccgag gagccggacc acggccagct 781 cttcacccac ctgggccgca tggccctgga gttcaaccga ctggcatcca aggtgcacaa 841 gaatgagcag cgcacctcca ttctgcagac cctgtgtgag cagcttcgga aggagaacga 901 ggctctgaag gccaagttgg ataagggcct ggaacagcgg gatcaggctg ccgagaggct 961 gcgggaggaa aatttggagc tcaagaagtt gttgatgagc aatggcaaca aagagggtgc 1021 gtctgggcgg ccaggctcac cgaagatgga agggacaggc aagaaggcag tggctggaca 1081 gcagcaggct agtgtgacgg caggtaaggt cccagaggtg gtggccttgg gcgcagccga 1141 gaagaaggtg aagatgctgg agcagcagcg cagtgagctg ctggaagtga acaagcagtg 1201 ggaccagcat ttccggtcca tgaagcagca gtatgagcag aagatcactg agctgcgtca 1261 gaagctggct gatttgcaga agcaggtgac tgacctggag gccgagcggg agcagaagca
1321 gcgtgacttt gaccgcaagc tcctcctggc caagtccaag attgaaatgg aggagaccga 1381 caaggagcag ctgacagcag aggccaagga gctgcgccaa aaggtcaagt acctgcagga 1441 tcagctgagc ccactcaccc gacagcgtga gtaccaggaa aaggagatcc agcggctcaa 1501 caaggccctg gaggaagcac tgagcatcca aaccccgcca tcatctccac caacagcatt 1561 tgggagccca gaaggagcag gggccctcct aaggaaacag gagctggtca cgcagaatga 1621 gttgctgaaa cagcaggtga agatcttcga ggaggacttc cagagggagc gcagtgatcg 1681 tgagcgcatg aatgaggaga aggaagagct gaagaagcaa gtggagaagc tgcaggccca 1741 ggtcaccctg tcaaatgccc agctaaaagc attcaaagat gaggagaagg caagagaagc 1801 cctcagacag cagaagagga aagcaaaggc ctcaggagag cgttaccatg tggagcccca 1861 cccagaacat ctctgcgggg cctaccccta cgcctacccg cccatgccag ccatggtgcc 1921 acaccatggc ttcgaggact ggtcccagat ccgctacccc cctcccccca tggccatgga 1981 gcacccgccc ccactcccca actcgcgcct cttccatctg caccagtttt gtcgcagccg 2041 gaatacacct ggcgtctacc ctgtggaggg gttcgaaatc caaatcagag ctcccaagtg 2101 atggaccctc ccacagccag gcctacagaa ccagagtctc caaaaaatga ccgtgagggg 2161 cctcagtgag accagattgt gtcatttggc tccaccttca tcttgcagag ccagctgatc 2221 tcagattgcc aagaaactag aagccacttg cacggtgtgg ccagagcctc agctggatga 2281 gaggctgaga tgggtggcca gcttgtacac cagtccctga actgagctgt ttacaggact 2341 ggggaggctc cacccagaag gctttcattt gtactctgct gggagtgact gggaaaaact 2401 ccttccctgc tgctgagtgg agagaggcct catccggctt tgacccacca tccgttgcag 2461 aagcctccag gagcagcaat cctaagagtg ggaggcagcc aagaccccct tccttcaaaa 2521 cctcccggaa gtggtttcag gccctctagt tgccatgacc aatttgtgtg tgtgtttaat 2581 ttttgcttca agctctgtag caggacctgc cccacgcaca cccctacccc tctgtgagga 2641 gctgtgggaa gtgtgggttt gtctccagaa cagaagagaa tgatggatat tctggctctg 2701 gggccctctc caccaccact cacagtagcc ttgctgaagc catcacagat gggagaaggc 2761 catgccagcc acgtccgccg aggggcgcca gcctgaagct gccaggccct gaggttcaga 2821 ccctggaccc catagctgga ggcctgtggt gccagaagcc cagattaggg tggctgtcca 2881 tccctggata gctatttgca cgaatcatgg acataaatcc aagttgaaga agatcaacaa 2941 aaaaaaaaaal SEP ID NO: 66 Human TNIP1 Isoform 1 Amino Acid Sequence
(NP 001239314.1)
1 megrgpyriy dpggsvpsge asaaferlvk ensrlkekmq gikmlgelle esqmeatrlr 61 qkaeelvkdn ellpppspsl gsfdplaelt gkdsnvtasp tapacpsdkp apvqkppssg 121 tssefevvtp eeqnspesss hanamalgpl predgnlmlh lqrlettlsv caeepdhgql 181 fthlgrmale fnrlaskvhk neqrtsilqt lceqlrkene alkakldkgl eqrdqaaerl 241 reenlelkkl Imsngnkega sgrpgspkme gtgkkavagq qqasvtagkv pevvalgaae 301 kkvkmleqqr sellevnkqw dqhfrsmkqq yeqkitelrq kladlqkqvt dleaereqkq 361 rdfdrkllla kskiemeetd keqltaeake Irqkvkylqd qlspltrqre yqekeiqrln 421 kaleealsiq tppsspptaf gspegagall rkqelvtqne llkqqvkife edfqrersdr 481 ermneekeel kkqveklqaq vtlsnaqlka fkdeekarea Irqqkrkaka sgeryhveph 541 pehlcgaypy ayppmpamvp hhgfedwsqi ryppppmame hppplpnsrl fhlhqfcrsr 601 ntpgvypveg feiqirapk
SEP ID NO: 67 Human TNIP1 Transcript Variant 2 cDNA Sequence (NM 001252386.1, CDS region from position 229-1980)
1 agtctccggg gactttccca ggggtggggc ggcccggcca ggcccccggc acttcctcgt 61 cctcggcccg ggtgccctgc ccccgtccag gagccctagg agtgctacgg ggggccggag 121 ccttgcccgg gccgctgccc cgtccctgga ttcggggctg gacgcagcaa gcggggcgct 181 gtgtccccaa gctccccgtc ctcgggggag cttttggaag agtcccagat ggaagcgacc 241 aggctccggc agaaggcaga ggagctagtg aaggacaacg agctgctccc accaccttct 301 ccctccttgg gctccttcga ccccctggct gagctcacag gaaaggactc aaatgtcaca 361 gcatctccca cagcccctgc atgccccagt gacaagccag caccagtcca gaagcctcca 421 tccagtggca cctcctctga atttgaagtg gtcactcctg aggagcagaa ttcaccagag 481 agcagcagcc atgccaatgc gatggcgctg ggccccctgc cccgtgagga cggcaacctg 541 atgctgcacc tgcagcgcct ggagaccacg ctgagtgtgt gtgccgagga gccggaccac 601 ggccagctct tcacccacct gggccgcatg gccctggagt tcaaccgact ggcatccaag 661 gtgcacaaga atgagcagcg cacctccatt ctgcagaccc tgtgtgagca gcttcggaag 721 gagaacgagg ctctgaaggc caagttggat aagggcctgg aacagcggga tcaggctgcc 781 gagaggctgc gggaggaaaa tttggagctc aagaagttgt tgatgagcaa tggcaacaaa 841 gagggtgcgt ctgggcggcc aggctcaccg aagatggaag ggacaggcaa gaaggcagtg
901 gctggacagc agcaggctag tgtgacggca ggtaaggtcc cagaggtggt ggccttgggc 961 gcagccgaga agaaggtgaa gatgctggag cagcagcgca gtgagctgct ggaagtgaac 1021 aagcagtggg accagcattt ccggtccatg aagcagcagt atgagcagaa gatcactgag 1081 ctgcgtcaga agctggctga tttgcagaag caggtgactg acctggaggc cgagcgggag 1141 cagaagcagc gtgactttga ccgcaagctc ctcctggcca agtccaagat tgaaatggag 1201 gagaccgaca aggagcagct gacagcagag gccaaggagc tgcgccaaaa ggtcaagtac 1261 ctgcaggatc agctgagccc actcacccga cagcgtgagt accaggaaaa ggagatccag 1321 cggctcaaca aggccctgga ggaagcactg agcatccaaa ccccgccatc atctccacca 1381 acagcatttg ggagcccaga aggagcaggg gccctcctaa ggaaacagga gctggtcacg 1441 cagaatgagt tgctgaaaca gcaggtgaag atcttcgagg aggacttcca gagggagcgc 1501 agtgatcgtg agcgcatgaa tgaggagaag gaagagctga agaagcaagt ggagaagctg 1561 caggcccagg tcaccctgtc aaatgcccag ctaaaagcat tcaaagatga ggagaaggca 1621 agagaagccc tcagacagca gaagaggaaa gcaaaggcct caggagagcg ttaccatgtg 1681 gagccccacc cagaacatct ctgcggggcc tacccctacg cctacccgcc catgccagcc 1741 atggtgccac accatggctt cgaggactgg tcccagatcc gctacccccc tccccccatg 1801 gccatggagc acccgccccc actccccaac tcgcgcctct tccatctgcc ggaatacacc 1861 tggcgtctac cctgtggagg ggttcgaaat ccaaatcaga gctcccaagt gatggaccct 1921 cccacagcca ggcctacaga accagagtct ccaaaaaatg accgtgaggg gcctcagtga 1981 gaccagattg tgtcatttgg ctccaccttc atcttgcaga gccagctgat ctcagattgc 2041 caagaaacta gaagccactt gcacggtgtg gccagagcct cagctggatg agaggctgag 2101 atgggtggcc agcttgtaca ccagtccctg aactgagctg tttacaggac tggggaggct 2161 ccacccagaa ggctttcatt tgtactctgc tgggagtgac tgggaaaaac tccttccctg 2221 ctgctgagtg gagagaggcc tcatccggct ttgacccacc atccgttgca gaagcctcca 2281 ggagcagcaa tcctaagagt gggaggcagc caagaccccc ttccttcaaa acctcccgga 2341 agtggtttca ggccctctag ttgccatgac caatttgtgt gtgtgtttaa tttttgcttc 2401 aagctctgta gcaggacctg ccccacgcac acccctaccc ctctgtgagg agctgtggga 2461 agtgtgggtt tgtctccaga acagaagaga atgatggata ttctggctct ggggccctct 2521 ccaccaccac tcacagtagc cttgctgaag ccatcacaga tgggagaagg ccatgccagc 2581 cacgtccgcc gaggggcgcc agcctgaagc tgccaggccc tgaggttcag accctggacc 2641 ccatagctgg aggcctgtgg tgccagaagc ccagattagg gtggctgtcc atccctggat 2701 agctatttgc acgaatcatg gacataaatc caagttgaag aagatcaaca aaaaaaaaaa 2761 a
SEP ID NO: 68 Human TNIP1 Isoform 2 Amino Acid Sequence
(NP 001239315.1)
1 meatrlrqka eelvkdnell pppspslgs f dplaeltgkd snvtasptap acpsdkpapv 61 qkppssgtss efevvtpeeq nspessshan amalgplpre dgnlmlhlqr lettlsvcae 121 epdhgqlfth lgrmalefnr laskvhkneq rtsilqtlce qlrkenealk akldkgleqr 181 dqaaerlree nlelkkllms ngnkegasgr pgspkmegtg kkavagqqqa svtagkvpev 241 valgaaekkv kmleqqrsel levnkqwdqh frsmkqqyeq kitelrqkla dlqkqvtdle 301 aereqkqrdf drklllaksk iemeetdkeq ltaeakelrq kvkylqdqls pltrqreyqe 361 keiqrlnkal eealsiqtpp sspptafgsp egagallrkq elvtqnellk qqvkifeedf 421 qrersdrerm neekeelkkq veklqaqvtl snaqlkafkd eekarealrq qkrkakasge 481 ryhvephpeh lcgaypyayp pmpamvphhg fedwsqiryp pppmamehpp plpnsrlfhl 541 peytwrlpcg gvrnpnqssq vmdpptarpt epespkndre gpq
SEP ID NO: 69 Human TNIP1 Transcript Variant 3 cDNA Sequence (NM 001252390.1, CDS region from position 107-2017)
1 atgcaccaag gaaggagtgg gccccttctt cactatggat ggagaagcct cagagagtaa 61 gtggcaacag ccaggcgggc accacggcag gggctgagct accctcatgg aagggagagg 121 accgtaccgg atctacgacc ctgggggcag cgtgccctca ggagaggcat ccgcagcttt 181 tgagcgccta gtgaaggaga attcccggct gaaggaaaaa atgcaaggga taaagatgtt 241 aggggagctt ttggaagagt cccagatgga agcgaccagg ctccggcaga aggcagagga 301 gctagtgaag gacaacgagc tgctcccacc accttctccc tccttgggct ccttcgaccc 361 cctggctgag ctcacaggaa aggactcaaa tgtcacagca tctcccacag cccctgcatg 421 ccccagtgac aagccagcac cagtccagaa gcctccatcc agtggcacct cctctgaatt 481 tgaagtggtc actcctgagg agcagaattc accagagagc agcagccatg ccaatgcgat 541 ggcgctgggc cccctgcccc gtgaggacgg caacctgatg ctgcacctgc agcgcctgga 601 gaccacgctg agtgtgtgtg ccgaggagcc ggaccacggc cagctcttca cccacctggg 661 ccgcatggcc ctggagttca accgactggc atccaaggtg cacaagaatg agcagcgcac
721 ctccattctg cagaccctgt gtgagcagct tcggaaggag aacgaggctc tgaaggccaa 781 gttggataag ggcctggaac agcgggatca ggctgccgag aggctgcggg aggaaaattt 841 ggagctcaag aagttgttga tgagcaatgg caacaaagag ggtgcgtctg ggcggccagg 901 ctcaccgaag atggaaggga caggcaagaa ggcagtggct ggacagcagc aggctagtgt 961 gacggcaggt aaggtcccag aggtggtggc cttgggcgca gccgagaaga aggtgaagat 1021 gctggagcag cagcgcagtg agctgctgga agtgaacaag cagtgggacc agcatttccg 1081 gtccatgaag cagcagtatg agcagaagat cactgagctg cgtcagaagc tggctgattt 1141 gcagaagcag gtgactgacc tggaggccga gcgggagcag aagcagcgtg actttgaccg 1201 caagctcctc ctggccaagt ccaagattga aatggaggag accgacaagg agcagctgac 1261 agcagaggcc aaggagctgc gccaaaaggt caagtacctg caggatcagc tgagcccact 1321 cacccgacag cgtgagtacc aggaaaagga gatccagcgg ctcaacaagg ccctggagga 1381 agcactgagc atccaaaccc cgccatcatc tccaccaaca gcatttggga gcccagaagg 1441 agcaggggcc ctcctaagga aacaggagct ggtcacgcag aatgagttgc tgaaacagca 1501 ggtgaagatc ttcgaggagg acttccagag ggagcgcagt gatcgtgagc gcatgaatga 1561 ggagaaggaa gagctgaaga agcaagtgga gaagctgcag gcccaggtca ccctgtcaaa 1621 tgcccagcta aaagcattca aagatgagga gaaggcaaga gaagccctca gacagcagaa 1681 gaggaaagca aaggcctcag gagagcgtta ccatgtggag ccccacccag aacatctctg 1741 cggggcctac ccctacgcct acccgcccat gccagccatg gtgccacacc atggcttcga 1801 ggactggtcc cagatccgct acccccctcc ccccatggcc atggagcacc cgcccccact 1861 ccccaactcg cgcctcttcc atctgccgga atacacctgg cgtctaccct gtggaggggt 1921 tcgaaatcca aatcagagct cccaagtgat ggaccctccc acagccaggc ctacagaacc 1981 agagtctcca aaaaatgacc gtgaggggcc tcagtgagac cagattgtgt catttggctc 2041 caccttcatc ttgcagagcc agctgatctc agattgccaa gaaactagaa gccacttgca 2101 cggtgtggcc agagcctcag ctggatgaga ggctgagatg ggtggccagc ttgtacacca 2161 gtccctgaac tgagctgttt acaggactgg ggaggctcca cccagaaggc tttcatttgt 2221 actctgctgg gagtgactgg gaaaaactcc ttccctgctg ctgagtggag agaggcctca 2281 tccggctttg acccaccatc cgttgcagaa gcctccagga gcagcaatcc taagagtggg 2341 aggcagccaa gacccccttc cttcaaaacc tcccggaagt ggtttcaggc cctctagttg 2401 ccatgaccaa tttgtgtgtg tgtttaattt ttgcttcaag ctctgtagca ggacctgccc 2461 cacgcacacc cctacccctc tgtgaggagc tgtgggaagt gtgggtttgt ctccagaaca 2521 gaagagaatg atggatattc tggctctggg gccctctcca ccaccactca cagtagcctt 2581 gctgaagcca tcacagatgg gagaaggcca tgccagccac gtccgccgag gggcgccagc 2641 ctgaagctgc caggccctga ggttcagacc ctggacccca tagctggagg cctgtggtgc 2701 cagaagccca gattagggtg gctgtccatc cctggatagc tatttgcacg aatcatggac 2761 ataaatccaa gttgaagaag atcaacaaaa aaaaaaaa
SEP ID NO: 70 Human TNIP1 Transcript Variant 4 cDNA Sequence (NM 001252391.1, CDS region from position 139-2049)
1 agcccagccc tccttcctgc agaagcacag tgagccgagg agccttcata gggacagccg 61 cccctggtgc acacaccctc gtattctcct gcccttcccc agccaggcgg gcaccacggc
121 aggggctgag ctaccctcat ggaagggaga ggaccgtacc ggatctacga ccctgggggc 181 agcgtgccct caggagaggc atccgcagct tttgagcgcc tagtgaagga gaattcccgg 241 ctgaaggaaa aaatgcaagg gataaagatg ttaggggagc ttttggaaga gtcccagatg 301 gaagcgacca ggctccggca gaaggcagag gagctagtga aggacaacga gctgctccca 361 ccaccttctc cctccttggg ctccttcgac cccctggctg agctcacagg aaaggactca 421 aatgtcacag catctcccac agcccctgca tgccccagtg acaagccagc accagtccag 481 aagcctccat ccagtggcac ctcctctgaa tttgaagtgg tcactcctga ggagcagaat 541 tcaccagaga gcagcagcca tgccaatgcg atggcgctgg gccccctgcc ccgtgaggac 601 ggcaacctga tgctgcacct gcagcgcctg gagaccacgc tgagtgtgtg tgccgaggag 661 ccggaccacg gccagctctt cacccacctg ggccgcatgg ccctggagtt caaccgactg 721 gcatccaagg tgcacaagaa tgagcagcgc acctccattc tgcagaccct gtgtgagcag 781 cttcggaagg agaacgaggc tctgaaggcc aagttggata agggcctgga acagcgggat 841 caggctgccg agaggctgcg ggaggaaaat ttggagctca agaagttgtt gatgagcaat 901 ggcaacaaag agggtgcgtc tgggcggcca ggctcaccga agatggaagg gacaggcaag 961 aaggcagtgg ctggacagca gcaggctagt gtgacggcag gtaaggtccc agaggtggtg 1021 gccttgggcg cagccgagaa gaaggtgaag atgctggagc agcagcgcag tgagctgctg 1081 gaagtgaaca agcagtggga ccagcatttc cggtccatga agcagcagta tgagcagaag 1141 atcactgagc tgcgtcagaa gctggctgat ttgcagaagc aggtgactga cctggaggcc 1201 gagcgggagc agaagcagcg tgactttgac cgcaagctcc tcctggccaa gtccaagatt 1261 gaaatggagg agaccgacaa ggagcagctg acagcagagg ccaaggagct gcgccaaaag
1321 gtcaagtacc tgcaggatca gctgagccca ctcacccgac agcgtgagta ccaggaaaag 1381 gagatccagc ggctcaacaa ggccctggag gaagcactga gcatccaaac cccgccatca 1441 tctccaccaa cagcatttgg gagcccagaa ggagcagggg ccctcctaag gaaacaggag 1501 ctggtcacgc agaatgagtt gctgaaacag caggtgaaga tcttcgagga ggacttccag 1561 agggagcgca gtgatcgtga gcgcatgaat gaggagaagg aagagctgaa gaagcaagtg 1621 gagaagctgc aggcccaggt caccctgtca aatgcccagc taaaagcatt caaagatgag 1681 gagaaggcaa gagaagccct cagacagcag aagaggaaag caaaggcctc aggagagcgt 1741 taccatgtgg agccccaccc agaacatctc tgcggggcct acccctacgc ctacccgccc 1801 atgccagcca tggtgccaca ccatggcttc gaggactggt cccagatccg ctacccccct 1861 ccccccatgg ccatggagca cccgccccca ctccccaact cgcgcctctt ccatctgccg 1921 gaatacacct ggcgtctacc ctgtggaggg gttcgaaatc caaatcagag ctcccaagtg 1981 atggaccctc ccacagccag gcctacagaa ccagagtctc caaaaaatga ccgtgagggg 2041 cctcagtgag accagattgt gtcatttggc tccaccttca tcttgcagag ccagctgatc 2101 tcagattgcc aagaaactag aagccacttg cacggtgtgg ccagagcctc agctggatga 2161 gaggctgaga tgggtggcca gcttgtacac cagtccctga actgagctgt ttacaggact 2221 ggggaggctc cacccagaag gctttcattt gtactctgct gggagtgact gggaaaaact 2281 ccttccctgc tgctgagtgg agagaggcct catccggctt tgacccacca tccgttgcag 2341 aagcctccag gagcagcaat cctaagagtg ggaggcagcc aagaccccct tccttcaaaa 2401 cctcccggaa gtggtttcag gccctctagt tgccatgacc aatttgtgtg tgtgtttaat 2461 ttttgcttca agctctgtag caggacctgc cccacgcaca cccctacccc tctgtgagga 2521 gctgtgggaa gtgtgggttt gtctccagaa cagaagagaa tgatggatat tctggctctg 2581 gggccctctc caccaccact cacagtagcc ttgctgaagc catcacagat gggagaaggc 2641 catgccagcc acgtccgccg aggggcgcca gcctgaagct gccaggccct gaggttcaga 2701 ccctggaccc catagctgga ggcctgtggt gccagaagcc cagattaggg tggctgtcca 2761 tccctggata gctatttgca cgaatcatgg acataaatcc aagttgaaga agatcaacaa 2821 aaaaaaaaaa
SEP ID NO: 71 Human TNIP1 Transcript Variant 5 cDNA Sequence (NM 006058.4, CDS region from position 242-2152)
1 agtctccggg gactttccca ggggtggggc ggcccggcca ggcccccggc acttcctcgt
61 cctcggcccg ggtgccctgc ccccgtccag gagccctagg agtgctacgg ggggccggag 121 ccttgcccgg gccgctgccc cgtccctgga ttcggggctg gacgcagcaa gcggggcgct 181 gtgtccccaa gctccccgtc ctcggccagg cgggcaccac ggcaggggct gagctaccct 241 catggaaggg agaggaccgt accggatcta cgaccctggg ggcagcgtgc cctcaggaga 301 ggcatccgca gcttttgagc gcctagtgaa ggagaattcc cggctgaagg aaaaaatgca 361 agggataaag atgttagggg agcttttgga agagtcccag atggaagcga ccaggctccg 421 gcagaaggca gaggagctag tgaaggacaa cgagctgctc ccaccacctt ctccctcctt 481 gggctccttc gaccccctgg ctgagctcac aggaaaggac tcaaatgtca cagcatctcc 541 cacagcccct gcatgcccca gtgacaagcc agcaccagtc cagaagcctc catccagtgg 601 cacctcctct gaatttgaag tggtcactcc tgaggagcag aattcaccag agagcagcag 661 ccatgccaat gcgatggcgc tgggccccct gccccgtgag gacggcaacc tgatgctgca 721 cctgcagcgc ctggagacca cgctgagtgt gtgtgccgag gagccggacc acggccagct 781 cttcacccac ctgggccgca tggccctgga gttcaaccga ctggcatcca aggtgcacaa 841 gaatgagcag cgcacctcca ttctgcagac cctgtgtgag cagcttcgga aggagaacga 901 ggctctgaag gccaagttgg ataagggcct ggaacagcgg gatcaggctg ccgagaggct 961 gcgggaggaa aatttggagc tcaagaagtt gttgatgagc aatggcaaca aagagggtgc 1021 gtctgggcgg ccaggctcac cgaagatgga agggacaggc aagaaggcag tggctggaca 1081 gcagcaggct agtgtgacgg caggtaaggt cccagaggtg gtggccttgg gcgcagccga 1141 gaagaaggtg aagatgctgg agcagcagcg cagtgagctg ctggaagtga acaagcagtg 1201 ggaccagcat ttccggtcca tgaagcagca gtatgagcag aagatcactg agctgcgtca 1261 gaagctggct gatttgcaga agcaggtgac tgacctggag gccgagcggg agcagaagca 1321 gcgtgacttt gaccgcaagc tcctcctggc caagtccaag attgaaatgg aggagaccga 1381 caaggagcag ctgacagcag aggccaagga gctgcgccaa aaggtcaagt acctgcagga 1441 tcagctgagc ccactcaccc gacagcgtga gtaccaggaa aaggagatcc agcggctcaa 1501 caaggccctg gaggaagcac tgagcatcca aaccccgcca tcatctccac caacagcatt 1561 tgggagccca gaaggagcag gggccctcct aaggaaacag gagctggtca cgcagaatga 1621 gttgctgaaa cagcaggtga agatcttcga ggaggacttc cagagggagc gcagtgatcg 1681 tgagcgcatg aatgaggaga aggaagagct gaagaagcaa gtggagaagc tgcaggccca 1741 ggtcaccctg tcaaatgccc agctaaaagc attcaaagat gaggagaagg caagagaagc 1801 cctcagacag cagaagagga aagcaaaggc ctcaggagag cgttaccatg tggagcccca
1861 cccagaacat ctctgcgggg cctaccccta cgcctacccg cccatgccag ccatggtgcc 1921 acaccatggc ttcgaggact ggtcccagat ccgctacccc cctcccccca tggccatgga 1981 gcacccgccc ccactcccca actcgcgcct cttccatctg ccggaataca cctggcgtct 2041 accctgtgga ggggttcgaa atccaaatca gagctcccaa gtgatggacc ctcccacagc 2101 caggcctaca gaaccagagt ctccaaaaaa tgaccgtgag gggcctcagt gagaccagat 2161 tgtgtcattt ggctccacct tcatcttgca gagccagctg atctcagatt gccaagaaac 2221 tagaagccac ttgcacggtg tggccagagc ctcagctgga tgagaggctg agatgggtgg 2281 ccagcttgta caccagtccc tgaactgagc tgtttacagg actggggagg ctccacccag 2341 aaggctttca tttgtactct gctgggagtg actgggaaaa actccttccc tgctgctgag 2401 tggagagagg cctcatccgg ctttgaccca ccatccgttg cagaagcctc caggagcagc 2461 aatcctaaga gtgggaggca gccaagaccc ccttccttca aaacctcccg gaagtggttt 2521 caggccctct agttgccatg accaatttgt gtgtgtgttt aatttttgct tcaagctctg 2581 tagcaggacc tgccccacgc acacccctac ccctctgtga ggagctgtgg gaagtgtggg 2641 tttgtctcca gaacagaaga gaatgatgga tattctggct ctggggccct ctccaccacc 2701 actcacagta gccttgctga agccatcaca gatgggagaa ggccatgcca gccacgtccg 2761 ccgaggggcg ccagcctgaa gctgccaggc cctgaggttc agaccctgga ccccatagct 2821 ggaggcctgt ggtgccagaa gcccagatta gggtggctgt ccatccctgg atagctattt 2881 gcacgaatca tggacataaa tccaagttga agaagatcaa caaaaaaaaa aaa SEP ID NO: 72 Human TNIP1 Transcript Variant 8 cDNA Sequence (NM 001258454.1, CDS region from position 242-2152)
1 tgccagtctc cggggacttt cccaggggtg gggcggcccg gccaggcccc cggcacttcc 61 tcgtcctcgg cccgggtgcc ctgcccccgt ccaggagccc taggagtgct acggggggcc 121 ggagccttgc ccgggccgct gccccgtccc tggattcggg gctggacgca gcaagcgggg 181 cgctgtgtcc ccaagctccc cgtcctcggg cgggcaccac ggcaggggct gagctaccct 241 catggaaggg agaggaccgt accggatcta cgaccctggg ggcagcgtgc cctcaggaga 301 ggcatccgca gcttttgagc gcctagtgaa ggagaattcc cggctgaagg aaaaaatgca 361 agggataaag atgttagggg agcttttgga agagtcccag atggaagcga ccaggctccg 421 gcagaaggca gaggagctag tgaaggacaa cgagctgctc ccaccacctt ctccctcctt 481 gggctccttc gaccccctgg ctgagctcac aggaaaggac tcaaatgtca cagcatctcc 541 cacagcccct gcatgcccca gtgacaagcc agcaccagtc cagaagcctc catccagtgg 601 cacctcctct gaatttgaag tggtcactcc tgaggagcag aattcaccag agagcagcag 661 ccatgccaat gcgatggcgc tgggccccct gccccgtgag gacggcaacc tgatgctgca 721 cctgcagcgc ctggagacca cgctgagtgt gtgtgccgag gagccggacc acggccagct 781 cttcacccac ctgggccgca tggccctgga gttcaaccga ctggcatcca aggtgcacaa 841 gaatgagcag cgcacctcca ttctgcagac cctgtgtgag cagcttcgga aggagaacga 901 ggctctgaag gccaagttgg ataagggcct ggaacagcgg gatcaggctg ccgagaggct 961 gcgggaggaa aatttggagc tcaagaagtt gttgatgagc aatggcaaca aagagggtgc 1021 gtctgggcgg ccaggctcac cgaagatgga agggacaggc aagaaggcag tggctggaca 1081 gcagcaggct agtgtgacgg caggtaaggt cccagaggtg gtggccttgg gcgcagccga 1141 gaagaaggtg aagatgctgg agcagcagcg cagtgagctg ctggaagtga acaagcagtg 1201 ggaccagcat ttccggtcca tgaagcagca gtatgagcag aagatcactg agctgcgtca 1261 gaagctggct gatttgcaga agcaggtgac tgacctggag gccgagcggg agcagaagca 1321 gcgtgacttt gaccgcaagc tcctcctggc caagtccaag attgaaatgg aggagaccga 1381 caaggagcag ctgacagcag aggccaagga gctgcgccaa aaggtcaagt acctgcagga 1441 tcagctgagc ccactcaccc gacagcgtga gtaccaggaa aaggagatcc agcggctcaa 1501 caaggccctg gaggaagcac tgagcatcca aaccccgcca tcatctccac caacagcatt 1561 tgggagccca gaaggagcag gggccctcct aaggaaacag gagctggtca cgcagaatga 1621 gttgctgaaa cagcaggtga agatcttcga ggaggacttc cagagggagc gcagtgatcg 1681 tgagcgcatg aatgaggaga aggaagagct gaagaagcaa gtggagaagc tgcaggccca 1741 ggtcaccctg tcaaatgccc agctaaaagc attcaaagat gaggagaagg caagagaagc 1801 cctcagacag cagaagagga aagcaaaggc ctcaggagag cgttaccatg tggagcccca 1861 cccagaacat ctctgcgggg cctaccccta cgcctacccg cccatgccag ccatggtgcc 1921 acaccatggc ttcgaggact ggtcccagat ccgctacccc cctcccccca tggccatgga 1981 gcacccgccc ccactcccca actcgcgcct cttccatctg ccggaataca cctggcgtct 2041 accctgtgga ggggttcgaa atccaaatca gagctcccaa gtgatggacc ctcccacagc 2101 caggcctaca gaaccagagt ctccaaaaaa tgaccgtgag gggcctcagt gagaccagat 2161 tgtgtcattt ggctccacct tcatcttgca gagccagctg atctcagatt gccaagaaac 2221 tagaagccac ttgcacggtg tggccagagc ctcagctgga tgagaggctg agatgggtgg 2281 ccagcttgta caccagtccc tgaactgagc tgtttacagg actggggagg ctccacccag
2341 aaggctttca tttgtactct gctgggagtg actgggaaaa actccttccc tgctgctgag 2401 tggagagagg cctcatccgg ctttgaccca ccatccgttg cagaagcctc caggagcagc 2461 aatcctaaga gtgggaggca gccaagaccc ccttccttca aaacctcccg gaagtggttt 2521 caggccctct agttgccatg accaatttgt gtgtgtgttt aatttttgct tcaagctctg 2581 tagcaggacc tgccccacgc acacccctac ccctctgtga ggagctgtgg gaagtgtggg 2641 tttgtctcca gaacagaaga gaatgatgga tattctggct ctggggccct ctccaccacc 2701 actcacagta gccttgctga agccatcaca gatgggagaa ggccatgcca gccacgtccg 2761 ccgaggggcg ccagcctgaa gctgccaggc cctgaggttc agaccctgga ccccatagct 2821 ggaggcctgt ggtgccagaa gcccagatta gggtggctgt ccatccctgg atagctattt 2881 gcacgaatca tggacataaa tccaagttga agaagatcaa ca
SEP ID NO: 73 Human TNIP1 Isoform 3 Amino Acid Sequence
(NP 001239319.1)
1 megrgpyriy dpggsvpsge asaaferlvk ensrlkekmq gikmlgelle esqmeatrlr 61 qkaeelvkdn ellpppspsl gsfdplaelt gkdsnvtasp tapacpsdkp apvqkppssg
121 tssefevvtp eeqnspesss hanamalgpl predgnlmlh lqrlettlsv caeepdhgql 181 fthlgrmale fnrlaskvhk neqrtsilqt lceqlrkene alkakldkgl eqrdqaaerl 241 reenlelkkl Imsngnkega sgrpgspkme gtgkkavagq qqasvtagkv pevvalgaae 301 kkvkmleqqr sellevnkqw dqhfrsmkqq yeqkitelrq kladlqkqvt dleaereqkq 361 rdfdrkllla kskiemeetd keqltaeake lrqkvkylqd qlspltrqre yqekeiqrln 421 kaleealsiq tppsspptaf gspegagall rkqelvtqne llkqqvkife edfqrersdr 481 ermneekeel kkqveklqaq vtlsnaqlka fkdeekarea Irqqkrkaka sgeryhveph 541 pehlcgaypy ayppmpamvp hhgfedwsqi ryppppmame hppplpnsrl fhlpeytwrl 601 pcggvrnpnq ssqvmdppta rptepespkn dregpq
SEP ID NO: 74 Human TNIP1 Transcript Variant 6 cDNA Sequence (NM 001252392.1, CDS region from position 139-2046)
1 agcccagccc tccttcctgc agaagcacag tgagccgagg agccttcata gggacagccg 61 cccctggtgc acacaccctc gtattctcct gcccttcccc agccaggcgg gcaccacggc 121 aggggctgag ctaccctcat ggaagggaga ggaccgtacc ggatctacga ccctgggggc 181 agcgtgccct caggagaggc atccgcagct tttgagcgcc tagtgaagga gaattcccgg 241 ctgaaggaaa aaatgcaagg gataaagatg ttaggggagc ttttggaaga gtcccagatg 301 gaagcgacca ggctccggca gaaggcagag gagctagtga aggacaacga gctgctccca 361 ccaccttctc cctccttggg ctccttcgac cccctggctg agctcacagg aaaggactca 421 aatgtcacag catctcccac agcccctgca tgccccagtg acaagccagc accagtccag 481 aagcctccat ccagtggcac ctcctctgaa tttgaagtgg tcactcctga ggagcagaat 541 tcaccagaga gcagcagcca tgccaatgcg atggcgctgg gccccctgcc ccgtgaggac 601 ggcaacctga tgctgcacct gcagcgcctg gagaccacgc tgagtgtgtg tgccgaggag 661 ccggaccacg gccagctctt cacccacctg ggccgcatgg ccctggagtt caaccgactg 721 gcatccaagg tgcacaagaa tgagcagcgc acctccattc tgcagaccct gtgtgagcag 781 cttcggaagg agaacgaggc tctgaaggcc aagttggata agggcctgga acagcgggat 841 caggctgccg agaggctgcg ggaggaaaat ttggagctca agaagttgtt gatgagcaat 901 ggcaacaaag agggtgcgtc tgggcggcca ggctcaccga agatggaagg gacaggcaag 961 aaggcagtgg ctggacagca gcaggctagt gtgacggcag gtaaggtccc agaggtggtg 1021 gccttgggcg cagccgagaa gaaggtgaag atgctggagc agcagcgcag tgagctgctg 1081 gaagtgaaca agcagtggga ccagcatttc cggtccatga agcagcagta tgagcagaag 1141 atcactgagc tgcgtcagaa gctggctgat ttgcagaagc aggtgactga cctggaggcc 1201 gagcgggagc agaagcagcg tgactttgac cgcaagctcc tcctggccaa gtccaagatt 1261 gaaatggagg agaccgacaa ggagcagctg acagcagagg ccaaggagct gcgccaaaag 1321 gtcaagtacc tgcaggatca gctgagccca ctcacccgac agcgtgagta ccaggaaaag 1381 gagatccagc ggctcaacaa ggccctggag gaagcactga gcatccaaac cccgccatca 1441 tctccaccaa cagcatttgg gagcccagaa ggagcagggg ccctcctaag gaaacaggag 1501 ctggtcacgc agaatgagtt gctgaaacag caggtgaaga tcttcgagga ggacttccag 1561 agggagcgca gtgatcgtga gcgcatgaat gaggagaagg aagagctgaa gaagcaagtg 1621 gagaagctgc aggcccaggt caccctgtca aatgcccagc taaaagcatt caaagatgag 1681 gagaaggcaa gagaagccct cagacagcag aagaggaaag caaaggcctc aggagagcgt 1741 taccatgtgg agccccaccc agaacatctc tgcggggcct acccctacgc ctacccgccc 1801 atgccagcca tggtgccaca ccatggcttc gaggactggt cccagatccg ctacccccct 1861 ccccccatgg ccatggagca cccgccccca ctccccaact cgcgcctctt ccatctgccg 1921 gaatacacct ggcgtctacc ctgtggaggg gttcgaaatc caaatcagag ctcccaagtg
1981 atggaccctc ccacagccag gcctacagaa ccagagccag ctgatctcag attgccaaga 2041 aactagaagc cacttgcacg gtgtggccag agcctcagct ggatgagagg ctgagatggg 2101 tggccagctt gtacaccagt ccctgaactg agctgtttac aggactgggg aggctccacc 2161 cagaaggctt tcatttgtac tctgctggga gtgactggga aaaactcctt ccctgctgct 2221 gagtggagag aggcctcatc cggctttgac ccaccatccg ttgcagaagc ctccaggagc 2281 agcaatccta agagtgggag gcagccaaga cccccttcct tcaaaacctc ccggaagtgg 2341 tttcaggccc tctagttgcc atgaccaatt tgtgtgtgtg tttaattttt gcttcaagct 2401 ctgtagcagg acctgcccca cgcacacccc tacccctctg tgaggagctg tgggaagtgt 2461 gggtttgtct ccagaacaga agagaatgat ggatattctg gctctggggc cctctccacc 2521 accactcaca gtagccttgc tgaagccatc acagatggga gaaggccatg ccagccacgt 2581 ccgccgaggg gcgccagcct gaagctgcca ggccctgagg ttcagaccct ggaccccata 2641 gctggaggcc tgtggtgcca gaagcccaga ttagggtggc tgtccatccc tggatagcta 2701 tttgcacgaa tcatggacat aaatccaagt tgaagaagat caacaaaaaa aaaaaa SEP ID NO: 75 Human TNIP1 Transcript Variant 7 cDNA Sequence (NM 001252393.1, CDS region from position 242-2149)
1 agtctccggg gactttccca ggggtggggc ggcccggcca ggcccccggc acttcctcgt 61 cctcggcccg ggtgccctgc ccccgtccag gagccctagg agtgctacgg ggggccggag 121 ccttgcccgg gccgctgccc cgtccctgga ttcggggctg gacgcagcaa gcggggcgct 181 gtgtccccaa gctccccgtc ctcggccagg cgggcaccac ggcaggggct gagctaccct 241 catggaaggg agaggaccgt accggatcta cgaccctggg ggcagcgtgc cctcaggaga 301 ggcatccgca gcttttgagc gcctagtgaa ggagaattcc cggctgaagg aaaaaatgca 361 agggataaag atgttagggg agcttttgga agagtcccag atggaagcga ccaggctccg 421 gcagaaggca gaggagctag tgaaggacaa cgagctgctc ccaccacctt ctccctcctt 481 gggctccttc gaccccctgg ctgagctcac aggaaaggac tcaaatgtca cagcatctcc 541 cacagcccct gcatgcccca gtgacaagcc agcaccagtc cagaagcctc catccagtgg 601 cacctcctct gaatttgaag tggtcactcc tgaggagcag aattcaccag agagcagcag 661 ccatgccaat gcgatggcgc tgggccccct gccccgtgag gacggcaacc tgatgctgca 721 cctgcagcgc ctggagacca cgctgagtgt gtgtgccgag gagccggacc acggccagct 781 cttcacccac ctgggccgca tggccctgga gttcaaccga ctggcatcca aggtgcacaa 841 gaatgagcag cgcacctcca ttctgcagac cctgtgtgag cagcttcgga aggagaacga 901 ggctctgaag gccaagttgg ataagggcct ggaacagcgg gatcaggctg ccgagaggct 961 gcgggaggaa aatttggagc tcaagaagtt gttgatgagc aatggcaaca aagagggtgc 1021 gtctgggcgg ccaggctcac cgaagatgga agggacaggc aagaaggcag tggctggaca 1081 gcagcaggct agtgtgacgg caggtaaggt cccagaggtg gtggccttgg gcgcagccga 1141 gaagaaggtg aagatgctgg agcagcagcg cagtgagctg ctggaagtga acaagcagtg 1201 ggaccagcat ttccggtcca tgaagcagca gtatgagcag aagatcactg agctgcgtca 1261 gaagctggct gatttgcaga agcaggtgac tgacctggag gccgagcggg agcagaagca 1321 gcgtgacttt gaccgcaagc tcctcctggc caagtccaag attgaaatgg aggagaccga 1381 caaggagcag ctgacagcag aggccaagga gctgcgccaa aaggtcaagt acctgcagga 1441 tcagctgagc ccactcaccc gacagcgtga gtaccaggaa aaggagatcc agcggctcaa 1501 caaggccctg gaggaagcac tgagcatcca aaccccgcca tcatctccac caacagcatt 1561 tgggagccca gaaggagcag gggccctcct aaggaaacag gagctggtca cgcagaatga 1621 gttgctgaaa cagcaggtga agatcttcga ggaggacttc cagagggagc gcagtgatcg 1681 tgagcgcatg aatgaggaga aggaagagct gaagaagcaa gtggagaagc tgcaggccca 1741 ggtcaccctg tcaaatgccc agctaaaagc attcaaagat gaggagaagg caagagaagc 1801 cctcagacag cagaagagga aagcaaaggc ctcaggagag cgttaccatg tggagcccca 1861 cccagaacat ctctgcgggg cctaccccta cgcctacccg cccatgccag ccatggtgcc 1921 acaccatggc ttcgaggact ggtcccagat ccgctacccc cctcccccca tggccatgga 1981 gcacccgccc ccactcccca actcgcgcct cttccatctg ccggaataca cctggcgtct 2041 accctgtgga ggggttcgaa atccaaatca gagctcccaa gtgatggacc ctcccacagc 2101 caggcctaca gaaccagagc cagctgatct cagattgcca agaaactaga agccacttgc 2161 acggtgtggc cagagcctca gctggatgag aggctgagat gggtggccag cttgtacacc 2221 agtccctgaa ctgagctgtt tacaggactg gggaggctcc acccagaagg ctttcatttg 2281 tactctgctg ggagtgactg ggaaaaactc cttccctgct gctgagtgga gagaggcctc 2341 atccggcttt gacccaccat ccgttgcaga agcctccagg agcagcaatc ctaagagtgg 2401 gaggcagcca agaccccctt ccttcaaaac ctcccggaag tggtttcagg ccctctagtt 2461 gccatgacca atttgtgtgt gtgtttaatt tttgcttcaa gctctgtagc aggacctgcc 2521 ccacgcacac ccctacccct ctgtgaggag ctgtgggaag tgtgggtttg tctccagaac 2581 agaagagaat gatggatatt ctggctctgg ggccctctcc accaccactc acagtagcct
2641 tgctgaagcc atcacagatg ggagaaggcc atgccagcca cgtccgccga ggggcgccag 2701 cctgaagctg ccaggccctg aggttcagac cctggacccc atagctggag gcctgtggtg 2761 ccagaagccc agattagggt ggctgtccat ccctggatag ctatttgcac gaatcatgga 2821 cataaatcca agttgaagaa gatcaacaaa aaaaaaaaa
SEP ID NO: 76 Human TNIP1 Isoform 4 Amino Acid Sequence
(NP 001239321.1)
1 megrgpyriy dpggsvpsge asaaferlvk ensrlkekmq gikmlgelle esqmeatrlr 61 qkaeelvkdn ellpppspsl gsfdplaelt gkdsnvtasp tapacpsdkp apvqkppssg 121 tssefevvtp eeqnspesss hanamalgpl predgnlmlh lqrlettlsv caeepdhgql 181 fthlgrmale fnrlaskvhk neqrtsilqt lceqlrkene alkakldkgl eqrdqaaerl 241 reenlelkkl Imsngnkega sgrpgspkme gtgkkavagq qqasvtagkv pevvalgaae 301 kkvkmleqqr sellevnkqw dqhfrsmkqq yeqkitelrq kladlqkqvt dleaereqkq 361 rdfdrkllla kskiemeetd keqltaeake lrqkvkylqd qlspltrqre yqekeiqrln 421 kaleealsiq tppsspptaf gspegagall rkqelvtqne llkqqvkife edfqrersdr 481 ermneekeel kkqveklqaq vtlsnaqlka fkdeekarea Irqqkrkaka sgeryhveph 541 pehlcgaypy ayppmpamvp hhgfedwsqi ryppppmame hppplpnsrl fhlpeytwrl 601 pcggvrnpnq ssqvmdppta rptepepadl rlprn SEP ID NO: 77 Human TNIP1 Transcript Variant 9 cDNA Sequence (NM 001258455.1, CDS region from position 37-1755)
1 ccaggcgggc accacggcag gggctgagct accctcatgg aagggagagg accgtaccgg 61 atctacgacc ctgggggcag cgtgccctca ggagaggcat ccgcagcttt tgagcgccta 121 gtgaaggaga attcccggct gaaggaaaaa atgcaaggga taaagatgtt aggggagctt 181 ttggaagagt cccagatgga agcgaccagg ctccggcaga aggcagagga gctagtgaag 241 gacaacgagc tgctcccacc accttctccc tccttgggct ccttcgaccc cctggctgag 301 ctcacaggaa aggactcaaa tgtcacagca tctcccacag cccctgcatg ccccagtgac 361 aagccagcac cagtccagaa gcctccatcc agtggcacct cctctgaatt tgaagtggtc 421 actcctgagg agcagaattc accagagagc agcagccatg ccaatgcgat ggcgctgggc 481 cccctgcccc gtgaggacgg caacctgatg ctgcacctgc agcgcctgga gaccacgctg 541 agtgtgtgtg ccgaggagcc ggaccacggc cagctcttca cccacctggg ccgcatggcc 601 ctggagttca accgactggc atccaaggtg cacaagaatg agcagcgcac ctccattctg 661 cagaccctgt gtgagcagct tcggaaggag aacgaggctc tgaaggccaa gttggataag 721 ggcctggaac agcgggatca ggctgccgag aggctgcggg aggaaaattt ggagctcaag 781 aagttgttga tgagcaatgg caacaaagag ggtgcgtctg ggcggccagg ctcaccgaag 841 atggaaggga caggcaagaa ggcagtggct ggacagcagc aggctagtgt gacggcaggt 901 aaggtcccag aggtggtggc cttgggcgca gccgagaaga aggtgaagat gctggagcag 961 cagcgcagtg agctgctgga agtgaacaag cagtgggacc agcatttccg gtccatgaag 1021 cagcagtatg agcagaagat cactgagctg cgtcagaagc tggctgattt gcagaagcag 1081 gtgactgacc tggaggccga gcgggagcag aagcagcgtg actttgaccg caagctcctc 1141 ctggccaagt ccaagattga aatggaggag accgacaagg agcagctgac agcagaggcc 1201 aaggagctgc gccaaaaggt caagtacctg caggatcagc tgagcccact cacccgacag 1261 cgtgagtacc aggaaaagga gatccagcgg ctcaacaagg ccctggagga agcactgagc 1321 atccaaaccc cgccatcatc tccaccaaca gcatttggga gcccagaagg agcaggggcc 1381 ctcctaagga aacaggagct ggtcacgcag aatgagttgc tgaaacagca ggtgaagatc 1441 ttcgaggagg acttccagag ggagcgcagt gatcgtgagc gcatgaatga ggagaaggaa 1501 gagctgaaga agcaagtgga gaagctgcag gcccaggtca ccctgtcaaa tgcccagcta 1561 aaagcattca aagatgagga gaaggcaaga gaagccctca gacagcagaa gaggaaagca 1621 aagccggaat acacctggcg tctaccctgt ggaggggttc gaaatccaaa tcagagctcc 1681 caagtgatgg accctcccac agccaggcct acagaaccag agtctccaaa aaatgaccgt 1741 gaggggcctc agtgagacca gattgtgtca tttggctcca ccttcatctt gcagagccag 1801 ctgatctcag attgccaaga aactagaagc cacttgcacg gtgtggccag agcctcagct 1861 ggatgagagg ctgagatggg tggccagctt gtacaccagt ccctgaactg agctgtttac 1921 aggactgggg aggctccacc cagaaggctt tcatttgtac tctgctggga gtgactggga 1981 aaaactcctt ccctgctgct gagtggagag aggcctcatc cggctttgac ccaccatccg 2041 ttgcagaagc ctccaggagc agcaatccta agagtgggag gcagccaaga cccccttcct 2101 tcaaaacctc ccggaagtgg tttcaggccc tctagttgcc atgaccaatt tgtgtgtgtg 2161 tttaattttt gcttcaagct ctgtagcagg acctgcccca cgcacacccc tacccctctg 2221 tgaggagctg tgggaagtgt gggtttgtct ccagaacaga agagaatgat ggatattctg 2281 gctctggggc cctctccacc accactcaca gtagccttgc tgaagccatc acagatggga
2341 gaaggccatg ccagccacgt ccgccgaggg gcgccagcct gaagctgcca ggccctgagg
2401 ttcagaccct ggaccccata gctggaggcc tgtggtgcca gaagcccaga ttagggtggc
2461 tgtccatccc tggatagcta tttgcacgaa tcatggacat aaatccaagt tgaagaagat
2521 caaca
SEP ID NO: 78 Human TNIP1 Isoform 5 Amino Acid Sequence
(NP 001245384.1)
1 megrgpyriy dpggsvpsge asaaferlvk ensrlkekmq gikmlgelle esqmeatrlr 61 qkaeelvkdn ellpppspsl gs fdplaelt gkdsnvtasp tapacpsdkp apvqkppssg 121 tssefevvtp eeqnspesss hanamalgpl predgnlmlh lqrlettlsv caeepdhgql 181 fthlgrmale fnrlaskvhk neqrtsilqt lceqlrkene alkakldkgl eqrdqaaerl 241 reenlelkkl lmsngnkega sgrpgspkme gtgkkavagq qqasvtagkv pevvalgaae 301 kkvkmleqqr sellevnkqw dqhfrsmkqq yeqkitelrq kladlqkqvt dleaereqkq 361 rdfdrkllla kskiemeetd keqltaeake lrqkvkylqd qlspltrqre yqekeiqrln 421 kaleealsiq tppsspptaf gspegagall rkqelvtqne llkqqvkife edfqrersdr 481 ermneekeel kkqveklqaq vtlsnaqlka fkdeekarea lrqqkrkakp eytwrlpcgg 541 vrnpnqssqv mdpptarpte pespkndreg pq
SEP ID NO: 79 Human TNIP1 Transcript Variant 10 cDNA Sequence (NM 001258456.1, CDS region from position 37-1707)
1 ccaggcgggc accacggcag gggctgagct accctcatgg aagggagagg accgtaccgg 61 atctacgacc ctgggggcag cgtgccctca ggagaggcat ccgcagcttt tgagcgccta 121 gtgaaggaga attcccggct gaaggaaaaa atgcaaggga taaagatgtt aggggagctt 181 ttggaagagt cccagatgga agcgaccagg ctccggcaga aggcagagga gctagtgaag 241 gacaacgagc tgctcccacc accttctccc tccttgggct ccttcgaccc cctggctgag 301 ctcacaggaa aggactcaaa tgtcacagca tctcccacag cccctgcatg ccccagtgac 361 aagccagcac cagtccagaa gcctccatcc agtggcacct cctctgaatt tgaagtggtc 421 actcctgagg agcagaattc accagagagc agcagccatg ccaatgcgat ggcgctgggc 481 cccctgcccc gtgaggacgg caacctgatg ctgcacctgc agcgcctgga gaccacgctg 541 agtgtgtgtg ccgaggagcc ggaccacggc cagctcttca cccacctggg ccgcatggcc 601 ctggagttca accgactggc atccaaggtg cacaagaatg agcagcgcac ctccattctg 661 cagaccctgt gtgagcagct tcggaaggag aacgaggctc tgaaggccaa gttggataag 721 ggcctggaac agcgggatca ggctgccgag aggctgcggg aggaaaattt ggagctcaag 781 aagttgttga tgagcaatgg caacaaagag ggtgcgtctg ggcggccagg ctcaccgaag 841 atggaaggga caggcaagaa ggcagtggct ggacagcagc aggctagtgt gacggcaggt 901 aaggtcccag aggtggtggc cttgggcgca gccgagaaga aggtgaagat gctggagcag 961 cagcgcagtg agctgctgga agtgaacaag cagtgggacc agcatttccg gtccatgaag 1021 cagcagtatg agcagaagat cactgagctg cgtcagaagc tggctgattt gcagaagcag 1081 gtgactgacc tggaggccga gcgggagcag aagcagcgtg actttgaccg caagctcctc 1141 ctggccaagt ccaagattga aatggaggag accgacaagg agcagctgac agcagaggcc 1201 aaggagctgc gccaaaaggt caagtacctg caggatcagc tgagcccact cacccgacag 1261 cgtgagtacc aggaaaagga gatccagcgg ctcaacaagg ccctggagga agcactgagc 1321 atccaaaccc cgccatcatc tccaccaaca gcatttggga gcccagaagg agcaggggcc 1381 ctcctaagga aacaggagct ggtcacgcag aatgagttgc tgaaacagca ggtgaagatc 1441 ttcgaggagg acttccagag ggagcgcagt gatcgtgagc gcatgaatga ggagaaggaa 1501 gagctgaaga agcaagtgga gaagctgcag gcccaggtca ccctgtcaaa tgcccagcta 1561 aaagcattca aagatgagga gaaggcaaga gaagccctca gacagcagaa gaggaaagca 1621 aagagtctcc aaaaaatgac cgtgaggggc ctcagtgaga ccagattgtg tcatttggct 1681 ccaccttcat cttgcagagc cagctgatct cagattgcca agaaactaga agccacttgc 1741 acggtgtggc cagagcctca gctggatgag aggctgagat gggtggccag cttgtacacc 1801 agtccctgaa ctgagctgtt tacaggactg gggaggctcc acccagaagg ctttcatttg 1861 tactctgctg ggagtgactg ggaaaaactc cttccctgct gctgagtgga gagaggcctc 1921 atccggcttt gacccaccat ccgttgcaga agcctccagg agcagcaatc ctaagagtgg 1981 gaggcagcca agaccccctt ccttcaaaac ctcccggaag tggtttcagg ccctctagtt 2041 gccatgacca atttgtgtgt gtgtttaatt tttgcttcaa gctctgtagc aggacctgcc 2101 ccacgcacac ccctacccct ctgtgaggag ctgtgggaag tgtgggtttg tctccagaac 2161 agaagagaat gatggatatt ctggctctgg ggccctctcc accaccactc acagtagcct 2221 tgctgaagcc atcacagatg ggagaaggcc atgccagcca cgtccgccga ggggcgccag 2281 cctgaagctg ccaggccctg aggttcagac cctggacccc atagctggag gcctgtggtg 2341 ccagaagccc agattagggt ggctgtccat ccctggatag ctatttgcac gaatcatgga
2401 cataaatcca agttgaagaa gatcaacal
SEP ID NO: 80 Human TNIP1 Isoform 6 Amino Acid Sequence
(NP 001245385.1)
1 megrgpyriy dpggsvpsge asaaferlvk ensrlkekmq gikmlgelle esqmeatrlr 61 qkaeelvkdn ellpppspsl gs fdplaelt gkdsnvtasp tapacpsdkp apvqkppssg 121 tssefevvtp eeqnspesss hanamalgpl predgnlmlh lqrlettlsv caeepdhgql 181 fthlgrmale fnrlaskvhk neqrtsilqt lceqlrkene alkakldkgl eqrdqaaerl 241 reenlelkkl Imsngnkega sgrpgspkme gtgkkavagq qqasvtagkv pevvalgaae 301 kkvkmleqqr sellevnkqw dqhfrsmkqq yeqkitelrq kladlqkqvt dleaereqkq 361 rdfdrkllla kskiemeetd keqltaeake Irqkvkylqd qlspltrqre yqekeiqrln 421 kaleealsiq tppsspptaf gspegagall rkqelvtqne llkqqvkife edfqrersdr 481 ermneekeel kkqveklqaq vtlsnaqlka fkdeekarea lrqqkrkaks lqkmtvrgls 541 etrlchlapp
SEP ID NO: 81 Mouse TNIP1 Transcript Variant 1 cDNA Sequence
(NM 021327.4, CDS region from position 145-2088)
1 tcagaaagcc cagcaacctt cacagggaca cagggaggca tggccgcact cactgggcac 61 atcttcagat cacctcgtgc attctcggat gagtgacctg ggctgaagct aggcggccgt 121 cacggcaggg gttgagccac cctcatggaa gggagaggac cctacgggat ctacgaccca 181 gggggcagca cgcctctggg agaggtgtcc gcagcttttg aacgtctagt ggaggagaat 241 actcggctga agggaaaaat gcaagggata aagatgttag gggagcttct ggaggagtct 301 cagatggaag cgtccagact ccggcagaag gcagaggagc tggtcaagga cagcgagctg 361 tcaccaccga catctgcccc ctccttggtc tcctttgatg acctggctga gctcacagga 421 caggatacaa aggtccaggt acatcctgct accagcactg ccgccaccac caccgccacc 481 gccaccacgg gaaactccat ggagaagccc gagccagcct ccaaatctcc gtccaatggc 541 gcctcctcgg actttgaagt ggtccctact gaggagcaga attcacccga aactggcagc 601 caccctacga acatgatgga cctggggccc ccacccccag aggacagcaa cctgaagctc 661 cacctgcagc gcctggagac cacccttagc gtgtgtgcag aggagccaga ccacagccag 721 ctcttcaccc acctgggccg catggccctc gagttcaaca ggttggcctc caaagtgcat 781 aaaaatgagc agcgcacctc catcctgcag accttatgtg agcagctgcg ccaggagaat 841 gaagccctga aggccaagct ggacaagggc ctggaacagc gggatctggc tgctgagagg 901 ctgcgggagg aaaacacgga gctcaagaaa ctgttgatga acagcagctg caaagaggga 961 ctctgtgggc agcccagctc cccaaagcca gagggtgctg gcaagaaggg cgtggctgga 1021 cagcagcagg ccagtgtgat ggcgagtaaa gtccctgaag cgggggcctt tggagcagct 1081 gagaagaagg tgaagttgct agaacagcaa cgcatggagc tgctggaagt gaacaagcag 1141 tgggaccagc atttccggtc catgaagcag cagtatgagc agaagatcac agagcttcgc 1201 cagaagctgg tggacctgca gaaacaggta actgagctgg aggccgaacg ggagcagaag 1261 cagcgtgact ttgaccggaa actcctcctg gccaaatcga agatagagat ggaagagacc 1321 gacaaggagc agctgacagc agaggccaag gaactgcgcc agaaggtcag gtacctacag 1381 gatcagctga gcccgctcac aaggcaacga gaataccagg agaaggagat ccagcggctc 1441 aataaggccc tggaggaggc cctcagcatc caggcctctc catcatctcc gcctgcagct 1501 tttgggagtc cagaaggcgt tgggggccat ctgaggaagc aggaactagt gacacagaat 1561 gagttgctga aacagcaggt aaagatcttt gaagaggact tccagaggga acggagtgac 1621 cgtgaacgca tgaatgaaga gaaggaggag ctgaagaagc aagtagagaa gctgcaggcc 1681 caggtcaccc tgactaatgc ccagctcaaa actctcaaag aggaggagaa ggccaaggaa 1741 gccctcaaac agcagaagag gaaagcaaag gcttcgggag agcgctacca catggaaccc 1801 caccctgagc acgtctgcgg cgcctatccc tatgcctacc cacccatgcc agccatggta 1861 cctcaccatg cctacaagga ctggtcccag atccgatacc ctccaccccc tgtgcccatg 1921 gagcacccgc ccccacaccc caactctcgc ctcttccatc tgccggagta cacctggcgt 1981 ccaccctgtg cagggattcg gaatcagagc tctcaagtga tggacccgcc cccagacagg 2041 cctgcagagc cagagtctgc agacaatgac tgtgatgggc cccagtgagg ctgcagtggg 2101 tcatttggtt ccaccttcat ctttcagagc cagctgacct cagattgcca aaagtttgaa 2161 ggccatgtgc atgttctgtg tgacccaagc cttggcagag gagaggctgg gatgggtagc 2221 tggctcacat ccccagccaa gcctcgaact gttgacaaga ccagggagaa tccacccatg 2281 ggcgcccacc aggttcttat ggatgcaagc aggagaagct caacaccctg cctcttgcca 2341 agacaaggaa gcctcacctg gctttgacct gccatccgtt gctgaggcca ctggcttcca 2401 tcctaagaat gaggtgcaac aagaccccat tctcacagaa cctcaaagac ttggttccag 2461 gctctccaga gaccataccc aactcatgtg catgtgccgt ttttgcttca agctcagtag 2521 caggacctgc cccgagcccc ctgctccttg cccctctgtg aggagttacg gagagggctt
2581 tgtctctaga gcagaagaga atgatgggac ggcctgatgc tgtcatgctc tccactgcac 2641 ctgtggcagc ctcctgagag ccaccaagat ctgggatgaa ggccacacca gccatgtctg 2701 ctgaagggcc ccagactgag atgactccgg cctccacagt tagatgttta tggtgccaga 2761 ggtctatatt aaggtagctg tctgttgcta ggcagccgtt tgcacaaatc ttggacataa 2821 atccaacttg aagatcaa
SEP ID NO: 82 Mouse TNIP1 Transcript Variant 2 cDNA Sequence
(NM 001199275.2, CDS region from position 303-2246)
1 tcagaaagcc cagcaacctt cacagggaca cagggaggca tggccgcact cactgggcac 61 atcttcagat cacctcgtgc attctcggat gagtgacctg ggctgaagac cccgccccgg
121 cgcccagcgc gcaacgccat tggacagacc gtacatcggt ctccggggac tttcccaggg 181 gcgtggcgtg gccctggcat ttcctggtac cgaccggagc ttagattctg cgagtctggc 241 cccggccccg aagctctcgt cctaggctag gcggccgtca cggcaggggt tgagccaccc 301 tcatggaagg gagaggaccc tacgggatct acgacccagg gggcagcacg cctctgggag 361 aggtgtccgc agcttttgaa cgtctagtgg aggagaatac tcggctgaag ggaaaaatgc 421 aagggataaa gatgttaggg gagcttctgg aggagtctca gatggaagcg tccagactcc 481 ggcagaaggc agaggagctg gtcaaggaca gcgagctgtc accaccgaca tctgccccct 541 ccttggtctc ctttgatgac ctggctgagc tcacaggaca ggatacaaag gtccaggtac 601 atcctgctac cagcactgcc gccaccacca ccgccaccgc caccacggga aactccatgg 661 agaagcccga gccagcctcc aaatctccgt ccaatggcgc ctcctcggac tttgaagtgg 721 tccctactga ggagcagaat tcacccgaaa ctggcagcca ccctacgaac atgatggacc 781 tggggccccc acccccagag gacagcaacc tgaagctcca cctgcagcgc ctggagacca 841 cccttagcgt gtgtgcagag gagccagacc acagccagct cttcacccac ctgggccgca 901 tggccctcga gttcaacagg ttggcctcca aagtgcataa aaatgagcag cgcacctcca 961 tcctgcagac cttatgtgag cagctgcgcc aggagaatga agccctgaag gccaagctgg 1021 acaagggcct ggaacagcgg gatctggctg ctgagaggct gcgggaggaa aacacggagc 1081 tcaagaaact gttgatgaac agcagctgca aagagggact ctgtgggcag cccagctccc 1141 caaagccaga gggtgctggc aagaagggcg tggctggaca gcagcaggcc agtgtgatgg 1201 cgagtaaagt ccctgaagcg ggggcctttg gagcagctga gaagaaggtg aagttgctag 1261 aacagcaacg catggagctg ctggaagtga acaagcagtg ggaccagcat ttccggtcca 1321 tgaagcagca gtatgagcag aagatcacag agcttcgcca gaagctggtg gacctgcaga 1381 aacaggtaac tgagctggag gccgaacggg agcagaagca gcgtgacttt gaccggaaac 1441 tcctcctggc caaatcgaag atagagatgg aagagaccga caaggagcag ctgacagcag 1501 aggccaagga actgcgccag aaggtcaggt acctacagga tcagctgagc ccgctcacaa 1561 ggcaacgaga ataccaggag aaggagatcc agcggctcaa taaggccctg gaggaggccc 1621 tcagcatcca ggcctctcca tcatctccgc ctgcagcttt tgggagtcca gaaggcgttg 1681 ggggccatct gaggaagcag gaactagtga cacagaatga gttgctgaaa cagcaggtaa 1741 agatctttga agaggacttc cagagggaac ggagtgaccg tgaacgcatg aatgaagaga 1801 aggaggagct gaagaagcaa gtagagaagc tgcaggccca ggtcaccctg actaatgccc 1861 agctcaaaac tctcaaagag gaggagaagg ccaaggaagc cctcaaacag cagaagagga 1921 aagcaaaggc ttcgggagag cgctaccaca tggaacccca ccctgagcac gtctgcggcg 1981 cctatcccta tgcctaccca cccatgccag ccatggtacc tcaccatgcc tacaaggact 2041 ggtcccagat ccgataccct ccaccccctg tgcccatgga gcacccgccc ccacacccca 2101 actctcgcct cttccatctg ccggagtaca cctggcgtcc accctgtgca gggattcgga 2161 atcagagctc tcaagtgatg gacccgcccc cagacaggcc tgcagagcca gagtctgcag 2221 acaatgactg tgatgggccc cagtgaggct gcagtgggtc atttggttcc accttcatct 2281 ttcagagcca gctgacctca gattgccaaa agtttgaagg ccatgtgcat gttctgtgtg 2341 acccaagcct tggcagagga gaggctggga tgggtagctg gctcacatcc ccagccaagc 2401 ctcgaactgt tgacaagacc agggagaatc cacccatggg cgcccaccag gttcttatgg 2461 atgcaagcag gagaagctca acaccctgcc tcttgccaag acaaggaagc ctcacctggc 2521 tttgacctgc catccgttgc tgaggccact ggcttccatc ctaagaatga ggtgcaacaa 2581 gaccccattc tcacagaacc tcaaagactt ggttccaggc tctccagaga ccatacccaa 2641 ctcatgtgca tgtgccgttt ttgcttcaag ctcagtagca ggacctgccc cgagccccct 2701 gctccttgcc cctctgtgag gagttacgga gagggctttg tctctagagc agaagagaat 2761 gatgggacgg cctgatgctg tcatgctctc cactgcacct gtggcagcct cctgagagcc 2821 accaagatct gggatgaagg ccacaccagc catgtctgct gaagggcccc agactgagat 2881 gactccggcc tccacagtta gatgtttatg gtgccagagg tctatattaa ggtagctgtc 2941 tgttgctagg cagccgtttg cacaaatctt ggacataaat ccaacttgaa gatcaa
SEP ID NO: 83 Mouse TNIP1 Isoform 1 Amino Acid Sequence (NP 067302.2)
1 megrgpygiy dpggstplge vsaaferlve entrlkgkmq gikmlgelle esqmeasrlr
61 qkaeelvkds elspptsaps lvs fddlael tgqdtkvqvh patstaattt atattgnsme
121 kpepasksps ngassdfevv pteeqnspet gshptnmmdl gppppedsnl klhlqrlett
181 lsvcaeepdh sqlfthlgrm alefnrlask vhkneqrtsi lqtlceqlrq enealkakld
241 kgleqrdlaa erlreentel kkllmnssck eglcgqpssp kpegagkkgv agqqqasvma
301 skvpeagafg aaekkvklle qqrmellevn kqwdqhfrsm kqqyeqkite lrqklvdlqk
361 qvteleaere qkqrdfdrkl llakskieme etdkeqltae akelrqkvry lqdqlspltr
421 qreyqekeiq rlnkaleeal siqaspsspp aafgspegvg ghlrkqelvt qnellkqqvk
481 ifeedfqrer sdrermneek eelkkqvekl qaqvtltnaq lktlkeeeka kealkqqkrk
541 akasgeryhm ephpehvcga ypyayppmpa mvphhaykdw sqiryppppv pmehppphpn
601 srlfhlpeyt wrppcagirn qssqvmdppp drpaepesad ndcdgpq
SEP ID NO: 84 Mouse TNIP1 Transcript Variant 3 cDNA Sequence
(NM 001199276.2, CDS region from position 132-1916)
1 tcagaaagcc cagcaacctt cacagggaca cagggaggca tggccgcact cactgggcac 61 atcttcagat cacctcgtgc attctcggat gagtgacctg ggctgaaggg gagcttctgg 121 aggagtctca gatggaagcg tccagactcc ggcagaaggc agaggagctg gtcaaggaca 181 gcgagctgtc accaccgaca tctgccccct ccttggtctc ctttgatgac ctggctgagc 241 tcacaggaca ggatacaaag gtccaggtac atcctgctac cagcactgcc gccaccacca 301 ccgccaccgc caccacggga aactccatgg agaagcccga gccagcctcc aaatctccgt 361 ccaatggcgc ctcctcggac tttgaagtgg tccctactga ggagcagaat tcacccgaaa 421 ctggcagcca ccctacgaac atgatggacc tggggccccc acccccagag gacagcaacc 481 tgaagctcca cctgcagcgc ctggagacca cccttagcgt gtgtgcagag gagccagacc 541 acagccagct cttcacccac ctgggccgca tggccctcga gttcaacagg ttggcctcca 601 aagtgcataa aaatgagcag cgcacctcca tcctgcagac cttatgtgag cagctgcgcc 661 aggagaatga agccctgaag gccaagctgg acaagggcct ggaacagcgg gatctggctg 721 ctgagaggct gcgggaggaa aacacggagc tcaagaaact gttgatgaac agcagctgca 781 aagagggact ctgtgggcag cccagctccc caaagccaga gggtgctggc aagaagggcg 841 tggctggaca gcagcaggcc agtgtgatgg cgagtaaagt ccctgaagcg ggggcctttg 901 gagcagctga gaagaaggtg aagttgctag aacagcaacg catggagctg ctggaagtga 961 acaagcagtg ggaccagcat ttccggtcca tgaagcagca gtatgagcag aagatcacag 1021 agcttcgcca gaagctggtg gacctgcaga aacaggtaac tgagctggag gccgaacggg 1081 agcagaagca gcgtgacttt gaccggaaac tcctcctggc caaatcgaag atagagatgg 1141 aagagaccga caaggagcag ctgacagcag aggccaagga actgcgccag aaggtcaggt 1201 acctacagga tcagctgagc ccgctcacaa ggcaacgaga ataccaggag aaggagatcc 1261 agcggctcaa taaggccctg gaggaggccc tcagcatcca ggcctctcca tcatctccgc 1321 ctgcagcttt tgggagtcca gaaggcgttg ggggccatct gaggaagcag gaactagtga 1381 cacagaatga gttgctgaaa cagcaggtaa agatctttga agaggacttc cagagggaac 1441 ggagtgaccg tgaacgcatg aatgaagaga aggaggagct gaagaagcaa gtagagaagc 1501 tgcaggccca ggtcaccctg actaatgccc agctcaaaac tctcaaagag gaggagaagg 1561 ccaaggaagc cctcaaacag cagaagagga aagcaaaggc ttcgggagag cgctaccaca 1621 tggaacccca ccctgagcac gtctgcggcg cctatcccta tgcctaccca cccatgccag 1681 ccatggtacc tcaccatgcc tacaaggact ggtcccagat ccgataccct ccaccccctg 1741 tgcccatgga gcacccgccc ccacacccca actctcgcct cttccatctg ccggagtaca 1801 cctggcgtcc accctgtgca gggattcgga atcagagctc tcaagtgatg gacccgcccc 1861 cagacaggcc tgcagagcca gagtctgcag acaatgactg tgatgggccc cagtgaggct 1921 gcagtgggtc atttggttcc accttcatct ttcagagcca gctgacctca gattgccaaa 1981 agtttgaagg ccatgtgcat gttctgtgtg acccaagcct tggcagagga gaggctggga 2041 tgggtagctg gctcacatcc ccagccaagc ctcgaactgt tgacaagacc agggagaatc 2101 cacccatggg cgcccaccag gttcttatgg atgcaagcag gagaagctca acaccctgcc 2161 tcttgccaag acaaggaagc ctcacctggc tttgacctgc catccgttgc tgaggccact 2221 ggcttccatc ctaagaatga ggtgcaacaa gaccccattc tcacagaacc tcaaagactt 2281 ggttccaggc tctccagaga ccatacccaa ctcatgtgca tgtgccgttt ttgcttcaag 2341 ctcagtagca ggacctgccc cgagccccct gctccttgcc cctctgtgag gagttacgga 2401 gagggctttg tctctagagc agaagagaat gatgggacgg cctgatgctg tcatgctctc 2461 cactgcacct gtggcagcct cctgagagcc accaagatct gggatgaagg ccacaccagc 2521 catgtctgct gaagggcccc agactgagat gactccggcc tccacagtta gatgtttatg 2581 gtgccagagg tctatattaa ggtagctgtc tgttgctagg cagccgtttg cacaaatctt
2641 ggacataaat ccaacttgaa gatcaa
SEP ID NO: 85 Mouse TNIP1 Transcript Variant 4 cDNA Sequence
(NM 001271455.1, CDS region from position 185-1969)
1 tcagaaagcc cagcaacctt cacagggaca ccaaggggggaaggggcca; tggccgcact cactgggcac 61 atcttcagat cacctcgtgc attctcggat gagtgacctg ggctgaagga gacagaggaa
121 ggcagatctc tctgacttca aggcccgcct gatctccaac cgggagcttc tggaggagtc 181 tcagatggaa gcgtccagac tccggcagaa ggcagaggag ctggtcaagg acagcgagct 241 gtcaccaccg acatctgccc cctccttggt ctcctttgat gacctggctg agctcacagg 301 acaggataca aaggtccagg tacatcctgc taccagcact gccgccacca ccaccgccac 361 cgccaccacg ggaaactcca tggagaagcc cgagccagcc tccaaatctc cgtccaatgg 421 cgcctcctcg gactttgaag tggtccctac tgaggagcag aattcacccg aaactggcag 481 ccaccctacg aacatgatgg acctggggcc cccaccccca gaggacagca acctgaagct 541 ccacctgcag cgcctggaga ccacccttag cgtgtgtgca gaggagccag accacagcca 601 gctcttcacc cacctgggcc gcatggccct cgagttcaac aggttggcct ccaaagtgca 661 taaaaatgag cagcgcacct ccatcctgca gaccttatgt gagcagctgc gccaggagaa 721 tgaagccctg aaggccaagc tggacaaggg cctggaacag cgggatctgg ctgctgagag 781 gctgcgggag gaaaacacgg agctcaagaa actgttgatg aacagcagct gcaaagaggg 841 actctgtggg cagcccagct ccccaaagcc agagggtgct ggcaagaagg gcgtggctgg 901 acagcagcag gccagtgtga tggcgagtaa agtccctgaa gcgggggcct ttggagcagc 961 tgagaagaag gtgaagttgc tagaacagca acgcatggag ctgctggaag tgaacaagca 1021 gtgggaccag catttccggt ccatgaagca gcagtatgag cagaagatca cagagcttcg 1081 ccagaagctg gtggacctgc agaaacaggt aactgagctg gaggccgaac gggagcagaa 1141 gcagcgtgac tttgaccgga aactcctcct ggccaaatcg aagatagaga tggaagagac 1201 cgacaaggag cagctgacag cagaggccaa ggaactgcgc cagaaggtca ggtacctaca 1261 ggatcagctg agcccgctca caaggcaacg agaataccag gagaaggaga tccagcggct 1321 caataaggcc ctggaggagg ccctcagcat ccaggcctct ccatcatctc cgcctgcagc 1381 ttttgggagt ccagaaggcg ttgggggcca tctgaggaag caggaactag tgacacagaa 1441 tgagttgctg aaacagcagg taaagatctt tgaagaggac ttccagaggg aacggagtga 1501 ccgtgaacgc atgaatgaag agaaggagga gctgaagaag caagtagaga agctgcaggc 1561 ccaggtcacc ctgactaatg cccagctcaa aactctcaaa gaggaggaga aggccaagga 1621 agccctcaaa cagcagaaga ggaaagcaaa ggcttcggga gagcgctacc acatggaacc 1681 ccaccctgag cacgtctgcg gcgcctatcc ctatgcctac ccacccatgc cagccatggt 1741 acctcaccat gcctacaagg actggtccca gatccgatac cctccacccc ctgtgcccat 1801 ggagcacccg cccccacacc ccaactctcg cctcttccat ctgccggagt acacctggcg 1861 tccaccctgt gcagggattc ggaatcagag ctctcaagtg atggacccgc ccccagacag 1921 gcctgcagag ccagagtctg cagacaatga ctgtgatggg ccccagtgag gctgcagtgg 1981 gtcatttggt tccaccttca tctttcagag ccagctgacc tcagattgcc aaaagtttga 2041 aggccatgtg catgttctgt gtgacccaag ccttggcaga ggagaggctg ggatgggtag 2101 ctggctcaca tccccagcca agcctcgaac tgttgacaag accagggaga atccacccat 2161 gggcgcccac caggttctta tggatgcaag caggagaagc tcaacaccct gcctcttgcc 2221 aagacaagga agcctcacct ggctttgacc tgccatccgt tgctgaggcc actggcttcc 2281 atcctaagaa tgaggtgcaa caagacccca ttctcacaga acctcaaaga cttggttcca 2341 ggctctccag agaccatacc caactcatgt gcatgtgccg tttttgcttc aagctcagta 2401 gcaggacctg ccccgagccc cctgctcctt gcccctctgt gaggagttac ggagagggct 2461 ttgtctctag agcagaagag aatgatggga cggcctgatg ctgtcatgct ctccactgca 2521 cctgtggcag cctcctgaga gccaccaaga tctgggatga aggccacacc agccatgtct 2581 gctgaagggc cccagactga gatgactccg gcctccacag ttagatgttt atggtgccag 2641 aggtctatat taaggtagct gtctgttgct aggcagccgt ttgcacaaat cttggacata 2701 aatccaactt gaagatcaa
SEP ID NO: 86 Mouse TNIP1 Isoform 2 Amino Acid Sequence
(NP 001186205.1)
1 measrlrqka eelvkdsels pptsapslvs fddlaeltgq dtkvqvhpat staatttata
61 ttgnsmekpe paskspsnga ssdfevvpte eqnspetgsh ptnmmdlgpp ppedsnlklh
121 lqrlettlsv caeepdhsql fthlgrmale fnrlaskvhk neqrtsilqt lceqlrqene
181 alkakldkgl eqrdlaaerl reentelkkl lmnssckegl cgqpsspkpe gagkkgvagq
241 qqasvmaskv peagafgaae kkvklleqqr mellevnkqw dqhfrsmkqq yeqkitelrq
301 klvdlqkqvt eleaereqkq rdfdrkllla kskiemeetd keqltaeake Irqkvrylqd
361 qlspltrqre yqekeiqrln kaleealsiq aspssppaaf gspegvgghl rkqelvtqne
421 llkqqvkife edfqrersdr ermneekeel kkqveklqaq vtltnaqlkt lkeeekakea 481 lkqqkrkaka sgeryhmeph pehvcgaypy ayppmpamvp hhaykdwsqi ryppppvpme 541 hppphpnsrl fhlpeytwrp pcagirnqss qvmdpppdrp aepesadndc dgpq SEP ID NO: 87 Mouse TNIP1 Transcript Variant 5 cDNA Sequence
(NM 001271456.1, CDS region from position 198-2138)
1 tcagaaagcc cagcaacctt cacagggaca cagggaggca tggccgcact cactgggcac 61 atcttcagat cacctcgtgc attctcggat gagtgacctg ggctgaagga gacagaggaa 121 ggcagatctc tctgacttca aggcccgcct gatctccaac cctaggcggc cgtcacggca 181 ggggttgagc caccctcatg gaagggagag gaccctacgg gatctacgac ccagggggca 241 gcacgcctct gggagaggtg tccgcagctt ttgaacgtct agtggaggag aatactcggc 301 tgaagggaaa aatgcaaggg ataaagatgt taggggagct tctggaggag tctcagatgg 361 aagcgtccag actccggcag aaggcagagg agctggtcaa ggacagcgag ctgtcaccac 421 cgacatctgc cccctccttg gtctcctttg atgacctggc tgagctcaca ggacaggata 481 caaaggtcca ggtacatcct gctaccagca ctgccgccac caccaccgcc accgccacca 541 cgggaaactc catggagaag cccgagccag cctccaaatc tccgtccaat ggcgcctcct 601 cggactttga agtggtccct actgaggagc agaattcacc cgaaactggc agccacccta 661 cgaacatgat ggacctgggg cccccacccc cagaggacag caacctgaag ctccacctgc 721 agcgcctgga gaccaccctt agcgtgtgtg cagaggagcc agaccacagc cagctcttca 781 cccacctggg ccgcatggcc ctcgagttca acaggttggc ctccaaagtg cataaaaatg 841 agcagcgcac ctccatcctg cagaccttat gtgagcagct gcgccaggag aatgaagccc 901 tgaaggccaa gctggacaag ggcctggaac agcgggatct ggctgctgag aggctgcggg 961 aggaaaacac ggagctcaag aaactgttga tgaacagcag ctgcaaagag ggactctgtg 1021 ggcagcccag ctccccaaag ccagagggtg ctggcaagaa gggcgtggct ggacagcagc 1081 aggccagtgt gatggcgagt aaagtccctg aagcgggggc ctttggagca gctgagaaga 1141 aggtgaagtt gctagaacag caacgcatgg agctgctgga agtgaacaag cagtgggacc 1201 agcatttccg gtccatgaag cagcagtatg agcagaagat cacagagctt cgccagaagc 1261 tggtggacct gcagaaacag gtaactgagc tggaggccga acgggagcag aagcagcgtg 1321 actttgaccg gaaactcctc ctggccaaat cgaagataga gatggaagag accgacaagg 1381 agcagctgac agcagaggcc aaggaactgc gccagaaggt caggtaccta caggatcagc 1441 tgagcccgct cacaaggcaa cgagaatacc aggagaagga gatccagcgg ctcaataagg 1501 ccctggagga ggccctcagc atccaggcct ctccatcatc tccgcctgca gcttttggga 1561 gtccagaagg cgttgggggc catctgagga agcaggaact agtgacacag aatgagttgc 1621 tgaaacagca ggtaaagatc tttgaagagg acttccagag ggaacggagt gaccgtgaac 1681 gcatgaatga agagaaggag gagctgaaga agcaagtaga gaagctgcag gcccaggtca 1741 ccctgactaa tgcccagctc aaaactctca aagaggagga gaaggccaag gaagccctca 1801 aacagcagaa gaggaaagca aaggcttcgg gagagcgcta ccacatggaa ccccaccctg 1861 agcacgtctg cggcgcctat ccctatgcct acccacccat gccagccatg gtacctcacc 1921 atgcctacaa ggactggtcc cagatccgat accctccacc ccctgtgccc atggagcacc 1981 cgcccccaca ccccaactct cgcctcttcc atctgccgga gtacacctgg cgtccaccct 2041 gtgcagggat tcggaatcag agctctcaag tgatggaccc gcccccagac aggcctgcag 2101 agccagagcc agctgacctc agattgccaa aagtttgaag gccatgtgca tgttctgtgt 2161 gacccaagcc ttggcagagg agaggctggg atgggtagct ggctcacatc cccagccaag 2221 cctcgaactg ttgacaagac cagggagaat ccacccatgg gcgcccacca ggttcttatg 2281 gatgcaagca ggagaagctc aacaccctgc ctcttgccaa gacaaggaag cctcacctgg 2341 ctttgacctg ccatccgttg ctgaggccac tggcttccat cctaagaatg aggtgcaaca 2401 agaccccatt ctcacagaac ctcaaagact tggttccagg ctctccagag accataccca 2461 actcatgtgc atgtgccgtt tttgcttcaa gctcagtagc aggacctgcc ccgagccccc 2521 tgctccttgc ccctctgtga ggagttacgg agagggcttt gtctctagag cagaagagaa 2581 tgatgggacg gcctgatgct gtcatgctct ccactgcacc tgtggcagcc tcctgagagc 2641 caccaagatc tgggatgaag gccacaccag ccatgtctgc tgaagggccc cagactgaga 2701 tgactccggc ctccacagtt agatgtttat ggtgccagag gtctatatta aggtagctgt 2761 ctgttgctag gcagccgttt gcacaaatct tggacataaa tccaacttga agatcaa SEP ID NO: 88 Mouse TNIP1 Isoform 3 Amino Acid Sequence
(NP 001258385.1)
1 megrgpygiy dpggstplge vsaaferlve entrlkgkmq gikmlgelle esqmeasrlr 61 qkaeelvkds elspptsaps lvsfddlael tgqdtkvqvh patstaattt atattgnsme 121 kpepasksps ngassdfevv pteeqnspet gshptnmmdl gppppedsnl klhlqrlett 181 lsvcaeepdh sqlfthlgrm alefnrlask vhkneqrtsi lqtlceqlrq enealkakld
241 kgleqrdlaa erlreentel kkllmnssck eglcgqpssp kpegagkkgv agqqqasvma 301 skvpeagafg aaekkvklle qqrmellevn kqwdqhfrsm kqqyeqkite lrqklvdlqk 361 qvteleaere qkqrdfdrkl llakskieme etdkeqltae akelrqkvry lqdqlspltr 421 qreyqekeiq rlnkaleeal siqaspsspp aafgspegvg ghlrkqelvt qnellkqqvk 481 ifeedfqrer sdrermneek eelkkqvekl qaqvtltnaq lktlkeeeka kealkqqkrk 541 akasgeryhm ephpehvcga ypyayppmpa mvphhaykdw sqiryppppv pmehppphpn 601 srlfhlpeyt wrppcagirn qssqvmdppp drpaepepad lrlpkv
* Included in Table 1 are RNA nucleic acid molecules (e.g., thymines replaced with uredines), nucleic acid molecules encoding orthologs of the encoded proteins, as well as DNA or RNA nucleic acid sequences comprising a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or more identity across their full length with the nucleic acid sequence of any SEQ ID NO listed in Table 1, or a portion thereof. Such nucleic acid molecules can have a function of the full-length nucleic acid as described further herein.
* Included in Table 1 are orthologs of the proteins, as well as polypeptide molecules comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or more identity across their full length with an amino acid sequence of any SEQ ID NO listed in Table 1, or a portion thereof. Such polypeptides can have a function of the full-length polypeptide as described further herein. II. Subjects
In one embodiment, the subject for whom predicted likelihood of efficacy of an inhibitor of one or more biomarkers listed in Table 1 and an immunotherapy combination treatment is determined, is a mammal (e.g., mouse, rat, primate, non-human mammal, domestic animal, such as a dog, cat, cow, horse, and the like), and is preferably a human. In another embodiment, the subject is an animal model of cancer. For example, the animal model can be an orthotopic xenograft animal model of a human-derived cancer.
In another embodiment of the methods of the present invention, the subject has not undergone treatment, such as chemotherapy, radiation therapy, targeted therapy, and/or immunotherapies. In still another embodiment, the subject has undergone treatment, such as chemotherapy, radiation therapy, targeted therapy, and/or immunotherapies.
In certain embodiments, the subject has had surgery to remove cancerous or precancerous tissue. In other embodiments, the cancerous tissue has not been removed, e.g., the cancerous tissue may be located in an inoperable region of the body, such as in a
tissue that is essential for life, or in a region where a surgical procedure would cause considerable risk of harm to the patient.
The methods of the present invention can be used to determine the responsiveness to inhibitors of one or more biomarkers listed in Table 1 and immunotherapy combination treatment of many different cancers in subjects such as those described herein.
III. Sample Collection, Preparation and Separation
In some embodiments, biomarker amount and/or activity measurement(s) in a sample from a subject is compared to a predetermined control (standard) sample. The sample from the subject is typically from a diseased tissue, such as cancer cells or tissues. The control sample can be from the same subject or from a different subject. The control sample is typically a normal, non-diseased sample. However, in some embodiments, such as for staging of disease or for evaluating the efficacy of treatment, the control sample can be from a diseased tissue. The control sample can be a combination of samples from several different subjects. In some embodiments, the biomarker amount and/or activity measurement(s) from a subject is compared to a pre-determined level. This pre-determined level is typically obtained from normal samples. As described herein, a "pre-determined" biomarker amount and/or activity measurement(s) may be a biomarker amount and/or activity measurement(s) used to, by way of example only, evaluate a subject that may be selected for treatment (e.g., based on the number of genomic mutations and/or the number of genomic mutations causing non-functional proteins for DNA repair genes), evaluate a response to an inhibitor of one or more biomarkers listed in Table 1 and an immunotherapy combination treatment, and/or evaluate a response to inhibitors of one or more biomarkers listed in Table 1, in combination with an immunotherapy with or without additional anti- cancer therapies. A pre-determined biomarker amount and/or activity measurement s) may be determined in populations of patients with or without cancer. The pre-determined biomarker amount and/or activity measurement(s) can be a single number, equally applicable to every patient, or the pre-determined biomarker amount and/or activity measurement(s) can vary according to specific subpopulations of patients. Age, weight, height, and other factors of a subject may affect the pre-determined biomarker amount and/or activity measurement(s) of the individual. Furthermore, the pre-determined biomarker amount and/or activity can be determined for each subject individually. In one
embodiment, the amounts determined and/or compared in a method described herein are based on absolute measurements.
In another embodiment, the amounts determined and/or compared in a method described herein are based on relative measurements, such as ratios (e.g., biomarker copy numbers, level, and/or activity before a treatment vs. after a treatment, such biomarker measurements relative to a spiked or man-made control, such biomarker measurements relative to the expression of a housekeeping gene, and the like). For example, the relative analysis can be based on the ratio of pre-treatment biomarker measurement as compared to post-treatment biomarker measurement. Pre-treatment biomarker measurement can be made at any time prior to initiation of anti-cancer therapy. Post-treatment biomarker measurement can be made at any time after initiation of anti-cancer therapy. In some embodiments, post-treatment biomarker measurements are made 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 weeks or more after initiation of anti-cancer therapy, and even longer toward indefinitely for continued monitoring. Treatment can comprise anti-cancer therapy, such as a therapeutic regimen comprising one or more inhibitors of one or more biomarkers listed in Table 1 and immunotherapy combination treatment alone or in combination with other anti-cancer agents, such as with immune checkpoint inhibitors.
The pre-determined biomarker amount and/or activity measurement(s) can be any suitable standard. For example, the pre-determined biomarker amount and/or activity measurement(s) can be obtained from the same or a different human for whom a patient selection is being assessed. In one embodiment, the pre-determined biomarker amount and/or activity measurement s) can be obtained from a previous assessment of the same patient. In such a manner, the progress of the selection of the patient can be monitored over time. In addition, the control can be obtained from an assessment of another human or multiple humans, e.g., selected groups of humans, if the subject is a human. In such a manner, the extent of the selection of the human for whom selection is being assessed can be compared to suitable other humans, e.g., other humans who are in a similar situation to the human of interest, such as those suffering from similar or the same condition(s) and/or of the same ethnic group.
In some embodiments of the present invention the change of biomarker amount and/or activity measurement s) from the pre-determined level is about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, or 5.0 fold or greater, or any range in
between, inclusive. Such cutoff values apply equally when the measurement is based on relative changes, such as based on the ratio of pre-treatment biomarker measurement as compared to post-treatment biomarker measurement.
Biological samples can be collected from a variety of sources from a patient including a body fluid sample, cell sample, or a tissue sample comprising nucleic acids and/or proteins. "Body fluids" refer to fluids that are excreted or secreted from the body as well as fluids that are normally not (e.g., amniotic fluid, aqueous humor, bile, blood and blood plasma, cerebrospinal fluid, cerumen and earwax, cowper's fluid or pre-ejaculatory fluid, chyle, chyme, stool, female ejaculate, interstitial fluid, intracellular fluid, lymph, menses, breast milk, mucus, pleural fluid, pus, saliva, sebum, semen, serum, sweat, synovial fluid, tears, urine, vaginal lubrication, vitreous humor, vomit). In a preferred embodiment, the subject and/or control sample is selected from the group consisting of cells, cell lines, histological slides, paraffin embedded tissues, biopsies, whole blood, nipple aspirate, serum, plasma, buccal scrape, saliva, cerebrospinal fluid, urine, stool, and bone marrow. In one embodiment, the sample is serum, plasma, or urine. In another
embodiment, the sample is serum.
The samples can be collected from individuals repeatedly over a longitudinal period of time (e.g., once or more on the order of days, weeks, months, annually, biannually, etc.). Obtaining numerous samples from an individual over a period of time can be used to verify results from earlier detections and/or to identify an alteration in biological pattern as a result of, for example, disease progression, drug treatment, etc. For example, subject samples can be taken and monitored every month, every two months, or combinations of one, two, or three month intervals according to the present invention. In addition, the biomarker amount and/or activity measurements of the subject obtained over time can be conveniently compared with each other, as well as with those of normal controls during the monitoring period, thereby providing the subject's own values, as an internal, or personal, control for long-term monitoring.
Sample preparation and separation can involve any of the procedures, depending on the type of sample collected and/or analysis of biomarker measurement(s). Such procedures include, by way of example only, concentration, dilution, adjustment of pH, removal of high abundance polypeptides (e.g., albumin, gamma globulin, and transferrin, etc.), addition of preservatives and calibrants, addition of protease inhibitors, addition of denaturants, desalting of samples, concentration of sample proteins, extraction and
purification of lipids.
The sample preparation can also isolate molecules that are bound in non-covalent complexes to other protein (e.g., carrier proteins). This process may isolate those molecules bound to a specific carrier protein (e.g., albumin), or use a more general process, such as the release of bound molecules from all carrier proteins via protein denaturation, for example using an acid, followed by removal of the carrier proteins.
Removal of undesired proteins (e.g. , high abundance, uninformative, or
undetectable proteins) from a sample can be achieved using high affinity reagents, high molecular weight filters, ultracentrifugation and/or electrodialysis. High affinity reagents include antibodies or other reagents (e.g., aptamers) that selectively bind to high abundance proteins. Sample preparation could also include ion exchange chromatography, metal ion affinity chromatography, gel filtration, hydrophobic chromatography, chromatofocusing, adsorption chromatography, isoelectric focusing and related techniques. Molecular weight filters include membranes that separate molecules on the basis of size and molecular weight. Such filters may further employ reverse osmosis, nanofiltration, ultrafiltration and microfiltration.
Ultracentrifugation is a method for removing undesired polypeptides from a sample. Ultracentrifugation is the centrifugation of a sample at about 15,000-60,000 rpm while monitoring with an optical system the sedimentation (or lack thereof) of particles.
Electrodialysis is a procedure which uses an electromembrane or semipermable membrane in a process in which ions are transported through semi-permeable membranes from one solution to another under the influence of a potential gradient. Since the membranes used in electrodialysis may have the ability to selectively transport ions having positive or negative charge, reject ions of the opposite charge, or to allow species to migrate through a semipermable membrane based on size and charge, it renders electrodialysis useful for concentration, removal, or separation of electrolytes.
Separation and purification in the present invention may include any procedure known in the art, such as capillary electrophoresis (e.g., in capillary or on-chip) or chromatography (e.g., in capillary, column or on a chip). Electrophoresis is a method which can be used to separate ionic molecules under the influence of an electric field.
Electrophoresis can be conducted in a gel, capillary, or in a microchannel on a chip.
Examples of gels used for electrophoresis include starch, acrylamide, polyethylene oxides, agarose, or combinations thereof. A gel can be modified by its cross-linking, addition of
detergents, or denaturants, immobilization of enzymes or antibodies (affinity
electrophoresis) or substrates (zymography) and incorporation of a pH gradient. Examples of capillaries used for electrophoresis include capillaries that interface with an electrospray.
Capillary electrophoresis (CE) is preferred for separating complex hydrophilic molecules and highly charged solutes. CE technology can also be implemented on microfluidic chips. Depending on the types of capillary and buffers used, CE can be further segmented into separation techniques such as capillary zone electrophoresis (CZE), capillary isoelectric focusing (CIEF), capillary isotachophoresis (cITP) and capillary electrochromatography (CEC). An embodiment to couple CE techniques to electrospray ionization involves the use of volatile solutions, for example, aqueous mixtures containing a volatile acid and/or base and an organic such as an alcohol or acetonitrile.
Capillary isotachophoresis (cITP) is a technique in which the analytes move through the capillary at a constant speed but are nevertheless separated by their respective mobilities. Capillary zone electrophoresis (CZE), also known as free-solution CE (FSCE), is based on differences in the electrophoretic mobility of the species, determined by the charge on the molecule, and the frictional resistance the molecule encounters during migration which is often directly proportional to the size of the molecule. Capillary isoelectric focusing (CIEF) allows weakly-ionizable amphoteric molecules, to be separated by electrophoresis in a pH gradient. CEC is a hybrid technique between traditional high performance liquid chromatography (UPLC) and CE.
Separation and purification techniques used in the present invention include any chromatography procedures known in the art. Chromatography can be based on the differential adsorption and elution of certain analytes or partitioning of analytes between mobile and stationary phases. Different examples of chromatography include, but not limited to, liquid chromatography (LC), gas chromatography (GC), high performance liquid chromatography (UPLC), etc.
IV. Biomarker Nucleic Acids and Polypeptides
One aspect of the present invention pertains to the use of isolated nucleic acid molecules that correspond to biomarker nucleic acids that encode a biomarker polypeptide or a portion of such a polypeptide. As used herein, the term "nucleic acid molecule" is intended to include DNA molecules (e.g., cDNA or genomic DNA) and RNA molecules (e.g., mPvNA) and analogs of the DNA or RNA generated using nucleotide analogs. The
nucleic acid molecule can be single-stranded or double-stranded, but preferably is double- stranded DNA.
An "isolated" nucleic acid molecule is one which is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid molecule.
Preferably, an "isolated" nucleic acid molecule is free of sequences (preferably protein- encoding sequences) which naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, the isolated nucleic acid molecule can contain less than about 5 kB, 4 kB, 3 kB, 2 kB, 1 kB, 0.5 kB or 0.1 kB of nucleotide sequences which naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived. Moreover, an "isolated" nucleic acid molecule, such as a cDNA molecule, can be substantially free of other cellular material or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.
A biomarker nucleic acid molecule of the present invention can be isolated using standard molecular biology techniques and the sequence information in the database records described herein. Using all or a portion of such nucleic acid sequences, nucleic acid molecules of the present invention can be isolated using standard hybridization and cloning techniques (e.g., as described in Sambrook et al, ed., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989).
A nucleic acid molecule of the present invention can be amplified using cDNA, mRNA, or genomic DNA as a template and appropriate oligonucleotide primers according to standard PCR amplification techniques. The nucleic acid molecules so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis.
Furthermore, oligonucleotides corresponding to all or a portion of a nucleic acid molecule of the present invention can be prepared by standard synthetic techniques, e.g., using an automated DNA synthesizer.
Moreover, a nucleic acid molecule of the present invention can comprise only a portion of a nucleic acid sequence, wherein the full length nucleic acid sequence comprises a marker of the present invention or which encodes a polypeptide corresponding to a marker of the present invention. Such nucleic acid molecules can be used, for example, as a probe or primer. The probe/primer typically is used as one or more substantially purified
oligonucleotides. The oligonucleotide typically comprises a region of nucleotide sequence that hybridizes under stringent conditions to at least about 7, preferably about 15, more preferably about 25, 50, 75, 100, 125, 150, 175, 200, 250, 300, 350, or 400 or more consecutive nucleotides of a biomarker nucleic acid sequence. Probes based on the sequence of a biomarker nucleic acid molecule can be used to detect transcripts or genomic sequences corresponding to one or more markers of the present invention. The probe comprises a label group attached thereto, e.g., a radioisotope, a fluorescent compound, an enzyme, or an enzyme co-factor.
A biomarker nucleic acid molecules that differ, due to degeneracy of the genetic code, from the nucleotide sequence of nucleic acid molecules encoding a protein which corresponds to the biomarker, and thus encode the same protein, are also contemplated.
In addition, it will be appreciated by those skilled in the art that DNA sequence polymorphisms that lead to changes in the amino acid sequence can exist within a population (e.g., the human population). Such genetic polymorphisms can exist among individuals within a population due to natural allelic variation. An allele is one of a group of genes which occur alternatively at a given genetic locus. In addition, it will be appreciated that DNA polymorphisms that affect RNA expression levels can also exist that may affect the overall expression level of that gene (e.g., by affecting regulation or degradation).
The term "allele," which is used interchangeably herein with "allelic variant," refers to alternative forms of a gene or portions thereof. Alleles occupy the same locus or position on homologous chromosomes. When a subject has two identical alleles of a gene, the subject is said to be homozygous for the gene or allele. When a subject has two different alleles of a gene, the subject is said to be heterozygous for the gene or allele. For example, biomarker alleles can differ from each other in a single nucleotide, or several nucleotides, and can include substitutions, deletions, and insertions of nucleotides. An allele of a gene can also be a form of a gene containing one or more mutations.
The term "allelic variant of a polymorphic region of gene" or "allelic variant", used interchangeably herein, refers to an alternative form of a gene having one of several possible nucleotide sequences found in that region of the gene in the population. As used herein, allelic variant is meant to encompass functional allelic variants, non-functional allelic variants, SNPs, mutations and polymorphisms.
The term "single nucleotide polymorphism" (S P) refers to a polymorphic site occupied by a single nucleotide, which is the site of variation between allelic sequences. The site is usually preceded by and followed by highly conserved sequences of the allele (e.g., sequences that vary in less than 1/100 or 1/1000 members of a population). A SNP usually arises due to substitution of one nucleotide for another at the polymorphic site. SNPs can also arise from a deletion of a nucleotide or an insertion of a nucleotide relative to a reference allele. Typically the polymorphic site is occupied by a base other than the reference base. For example, where the reference allele contains the base "T" (thymidine) at the polymorphic site, the altered allele can contain a "C" (cytidine), "G" (guanine), or "A" (adenine) at the polymorphic site. SNP's may occur in protein-coding nucleic acid sequences, in which case they may give rise to a defective or otherwise variant protein, or genetic disease. Such a SNP may alter the coding sequence of the gene and therefore specify another amino acid (a "missense" SNP) or a SNP may introduce a stop codon (a "nonsense" SNP). When a SNP does not alter the amino acid sequence of a protein, the SNP is called "silent." SNP's may also occur in noncoding regions of the nucleotide sequence. This may result in defective protein expression, e.g., as a result of alternative spicing, or it may have no effect on the function of the protein.
As used herein, the terms "gene" and "recombinant gene" refer to nucleic acid molecules comprising an open reading frame encoding a polypeptide corresponding to a marker of the present invention. Such natural allelic variations can typically result in 1-5% variance in the nucleotide sequence of a given gene. Alternative alleles can be identified by sequencing the gene of interest in a number of different individuals. This can be readily carried out by using hybridization probes to identify the same genetic locus in a variety of individuals. Any and all such nucleotide variations and resulting amino acid
polymorphisms or variations that are the result of natural allelic variation and that do not alter the functional activity are intended to be within the scope of the present invention.
In another embodiment, a biomarker nucleic acid molecule is at least 7, 15, 20, 25, 30, 40, 60, 80, 100, 150, 200, 250, 300, 350, 400, 450, 550, 650, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2200, 2400, 2600, 2800, 3000, 3500, 4000, 4500, or more nucleotides in length and hybridizes under stringent conditions to a nucleic acid molecule corresponding to a marker of the present invention or to a nucleic acid molecule encoding a protein corresponding to a marker of the present invention. As used herein, the term "hybridizes under stringent conditions" is intended to describe
conditions for hybridization and washing under which nucleotide sequences at least 60% (65%, 70%), 75%), 80%), preferably 85%>) identical to each other typically remain hybridized to each other. Such stringent conditions are known to those skilled in the art and can be found in sections 6.3.1-6.3.6 of Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989). A preferred, non-limiting example of stringent hybridization conditions are hybridization in 6X sodium chloride/sodium citrate (SSC) at about 45°C, followed by one or more washes in 0.2X SSC, 0.1% SDS at 50-65°C.
In addition to naturally-occurring allelic variants of a nucleic acid molecule of the present invention that can exist in the population, the skilled artisan will further appreciate that sequence changes can be introduced by mutation thereby leading to changes in the amino acid sequence of the encoded protein, without altering the biological activity of the protein encoded thereby. For example, one can make nucleotide substitutions leading to amino acid substitutions at "non-essential" amino acid residues. A "non-essential" amino acid residue is a residue that can be altered from the wild-type sequence without altering the biological activity, whereas an "essential" amino acid residue is required for biological activity. For example, amino acid residues that are not conserved or only semi-conserved among homologs of various species may be non-essential for activity and thus would be likely targets for alteration. Alternatively, amino acid residues that are conserved among the homologs of various species {e.g., murine and human) may be essential for activity and thus would not be likely targets for alteration.
Accordingly, another aspect of the present invention pertains to nucleic acid molecules encoding a polypeptide of the present invention that contain changes in amino acid residues that are not essential for activity. Such polypeptides differ in amino acid sequence from the naturally-occurring proteins which correspond to the markers of the present invention, yet retain biological activity. In one embodiment, a biomarker protein has an amino acid sequence that is at least about 40% identical, 50%, 60%>, 70%, 75%, 80%, 83%, 85%, 87.5%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or identical to the amino acid sequence of a biomarker protein described herein.
An isolated nucleic acid molecule encoding a variant protein can be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence of nucleic acids of the present invention, such that one or more amino acid residue substitutions, additions, or deletions are introduced into the encoded protein. Mutations can be introduced by standard techniques, such as site-directed mutagenesis and PCR-mediated
mutagenesis. Preferably, conservative amino acid substitutions are made at one or more predicted non-essential amino acid residues. A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Alternatively, mutations can be introduced randomly along all or part of the coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for biological activity to identify mutants that retain activity. Following mutagenesis, the encoded protein can be expressed recombinantly and the activity of the protein can be determined.
In some embodiments, the present invention further contemplates the use of anti- biomarker antisense nucleic acid molecules, i.e., molecules which are complementary to a sense nucleic acid of the present invention, e.g., complementary to the coding strand of a double-stranded cDNA molecule corresponding to a marker of the present invention or complementary to an mRNA sequence corresponding to a marker of the present invention. Accordingly, an antisense nucleic acid molecule of the present invention can hydrogen bond to (i.e. anneal with) a sense nucleic acid of the present invention. The antisense nucleic acid can be complementary to an entire coding strand, or to only a portion thereof, e.g., all or part of the protein coding region (or open reading frame). An antisense nucleic acid molecule can also be antisense to all or part of a non-coding region of the coding strand of a nucleotide sequence encoding a polypeptide of the present invention. The non- coding regions ("5' and 3' untranslated regions") are the 5' and 3' sequences which flank the coding region and are not translated into amino acids.
An antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 or more nucleotides in length. An antisense nucleic acid can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art. For example, an antisense nucleic acid (e.g., an antisense oligonucleotide) can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the
physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used. Examples of modified nucleotides which can be used to generate the antisense nucleic acid include 5- fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4- acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2- thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2- methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7- methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D- mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6- isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2- thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5- oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-
3- N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine. Alternatively, the antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been sub-cloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest, described further in the following subsection).
The antisense nucleic acid molecules of the present invention are typically administered to a subject or generated in situ such that they hybridize with or bind to cellular mRNA and/or genomic DNA encoding a polypeptide corresponding to a selected marker of the present invention to thereby inhibit expression of the marker, e.g., by inhibiting transcription and/or translation. The hybridization can be by conventional nucleotide complementarity to form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule which binds to DNA duplexes, through specific interactions in the major groove of the double helix. Examples of a route of administration of antisense nucleic acid molecules of the present invention includes direct injection at a tissue site or infusion of the antisense nucleic acid into a blood- or bone marrow-associated body fluid. Alternatively, antisense nucleic acid molecules can be modified to target selected cells and then administered systemically. For example, for systemic administration, antisense molecules can be modified such that they specifically bind to receptors or antigens expressed on a selected cell surface, e.g., by linking the antisense nucleic acid molecules to peptides or antibodies which bind to cell surface receptors or antigens. The antisense
nucleic acid molecules can also be delivered to cells using the vectors described herein. To achieve sufficient intracellular concentrations of the antisense molecules, vector constructs in which the antisense nucleic acid molecule is placed under the control of a strong pol II or pol III promoter are preferred.
An antisense nucleic acid molecule of the present invention can be an a-anomeric nucleic acid molecule. An a-anomeric nucleic acid molecule forms specific double- stranded hybrids with complementary RNA in which, contrary to the usual a-units, the strands run parallel to each other (Gaultier et al, 1987, Nucleic Acids Res. 15:6625-6641). The antisense nucleic acid molecule can also comprise a 2'-o-methylribonucleotide (Inoue et al, 1987 ', Nucleic Acids Res. 15:6131-6148) or a chimeric RNA-DNA analogue (Inoue et al, 1987, FEBSLett. 215:327-330).
The present invention also encompasses ribozymes. Ribozymes are catalytic RNA molecules with ribonuclease activity which are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region. Thus, ribozymes {e.g., hammerhead ribozymes as described in Haselhoff and Gerlach, 1988, Nature 334:585-591) can be used to catalytically cleave mRNA transcripts to thereby inhibit translation of the protein encoded by the mRNA. A ribozyme having specificity for a nucleic acid molecule encoding a polypeptide corresponding to a marker of the present invention can be designed based upon the nucleotide sequence of a cDNA corresponding to the marker. For example, a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved (see Cech et al. U.S. Patent No. 4,987,071; and Cech et al. U.S. Patent No. 5,116,742). Alternatively, an mRNA encoding a polypeptide of the present invention can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules (see, e.g., Bartel and Szostak, 1993, Science 261 : 1411-1418).
The present invention also encompasses nucleic acid molecules which form triple helical structures. For example, expression of a biomarker protein can be inhibited by targeting nucleotide sequences complementary to the regulatory region of the gene encoding the polypeptide {e.g., the promoter and/or enhancer) to form triple helical structures that prevent transcription of the gene in target cells. See generally Helene (1991) Anticancer Drug Des. 6(6):569-84; Helene (1992) Ann. NY. Acad. Sci. 660:27-36; and Maher ( 1992) Bioassays 14( 12) : 807- 15.
In various embodiments, the nucleic acid molecules of the present invention can be modified at the base moiety, sugar moiety or phosphate backbone to improve, e.g., the stability, hybridization, or solubility of the molecule. For example, the deoxyribose phosphate backbone of the nucleic acid molecules can be modified to generate peptide nucleic acid molecules (see Hyrup et al, 1996, Bioorganic & Medicinal Chemistry 4(1): 5- 23). As used herein, the terms "peptide nucleic acids" or "PNAs" refer to nucleic acid mimics, e.g., DNA mimics, in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleobases are retained. The neutral backbone of PNAs has been shown to allow for specific hybridization to DNA and RNA under conditions of low ionic strength. The synthesis of PNA oligomers can be performed using standard solid phase peptide synthesis protocols as described in Hyrup et al. (1996), supra; Perry-O'Keefe et al. (1996) Proc. Natl. Acad. Sci. USA 93 : 14670-675.
PNAs can be used in therapeutic and diagnostic applications. For example, PNAs can be used as antisense or antigene agents for sequence-specific modulation of gene expression by, e.g. , inducing transcription or translation arrest or inhibiting replication.
PNAs can also be used, e.g., in the analysis of single base pair mutations in a gene by, e.g., PNA directed PCR clamping; as artificial restriction enzymes when used in combination with other enzymes, e.g., SI nucleases (Hyrup (1996), supra; or as probes or primers for DNA sequence and hybridization (Hyrup, 1996, supra; Perry-O'Keefe et al, 1996, Proc. Natl. Acad. Sci. USA 93 : 14670-675).
In another embodiment, PNAs can be modified, e.g., to enhance their stability or cellular uptake, by attaching lipophilic or other helper groups to PNA, by the formation of PNA-DNA chimeras, or by the use of liposomes or other techniques of drug delivery known in the art. For example, PNA-DNA chimeras can be generated which can combine the advantageous properties of PNA and DNA. Such chimeras allow DNA recognition enzymes, e.g., RNASE H and DNA polymerases, to interact with the DNA portion while the PNA portion would provide high binding affinity and specificity. PNA-DNA chimeras can be linked using linkers of appropriate lengths selected in terms of base stacking, number of bonds between the nucleobases, and orientation (Hyrup, 1996, supra). The synthesis of PNA-DNA chimeras can be performed as described in Hyrup (1996), supra, and Finn et al. (1996) Nucleic Acids Res. 24(17):3357-63. For example, a DNA chain can be synthesized on a solid support using standard phosphoramidite coupling chemistry and modified nucleoside analogs. Compounds such as 5'-(4-methoxytrityl)amino-5'-deoxy-
thymidine phosphoramidite can be used as a link between the PNA and the 5' end of DNA (Mag et al, 1989, Nucleic Acids Res. 17:5973-88). PNA monomers are then coupled in a step-wise manner to produce a chimeric molecule with a 5' PNA segment and a 3' DNA segment (Finn et al, 1996, Nucleic Acids Res. 24(17):3357-63). Alternatively, chimeric molecules can be synthesized with a 5' DNA segment and a 3' PNA segment (Peterser et al, 1975, Bioorganic Med. Chem. Lett. 5: 1119-11124).
In other embodiments, the oligonucleotide can include other appended groups such as peptides {e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al, 1989, Proc. Natl. Acad. Sci. USA 86:6553-6556; Lemaitre et al, 1987, Proc. Natl. Acad. Sci. USA 84:648-652; PCT
Publication No. WO 88/09810) or the blood-brain barrier (see, e.g., PCT Publication No. WO 89/10134). In addition, oligonucleotides can be modified with hybridization-triggered cleavage agents (see, e.g., Krol et al, 1988, Bio/Techniques 6:958-976) or intercalating agents (see, e.g., Zon, 1988, Pharm. Res. 5:539-549). To this end, the oligonucleotide can be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc.
Another aspect of the present invention pertains to the use of biomarker proteins and biologically active portions thereof. In one embodiment, the native polypeptide
corresponding to a marker can be isolated from cells or tissue sources by an appropriate purification scheme using standard protein purification techniques. In another embodiment, polypeptides corresponding to a marker of the present invention are produced by
recombinant DNA techniques. Alternative to recombinant expression, a polypeptide corresponding to a marker of the present invention can be synthesized chemically using standard peptide synthesis techniques.
An "isolated" or "purified" protein or biologically active portion thereof is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the protein is derived, or substantially free of chemical precursors or other chemicals when chemically synthesized. The language "substantially free of cellular material" includes preparations of protein in which the protein is separated from cellular components of the cells from which it is isolated or recombinantly produced. Thus, protein that is substantially free of cellular material includes preparations of protein having less than about 30%, 20%, 10%, or 5% (by dry weight) of heterologous protein (also referred to herein as a "contaminating protein"). When the protein or biologically active portion
thereof is recombinantly produced, it is also preferably substantially free of culture medium, i.e., culture medium represents less than about 20%, 10%, or 5% of the volume of the protein preparation. When the protein is produced by chemical synthesis, it is preferably substantially free of chemical precursors or other chemicals, i.e., it is separated from chemical precursors or other chemicals which are involved in the synthesis of the protein. Accordingly such preparations of the protein have less than about 30%, 20%, 10%, 5% (by dry weight) of chemical precursors or compounds other than the polypeptide of interest.
Biologically active portions of a biomarker polypeptide include polypeptides comprising amino acid sequences sufficiently identical to or derived from a biomarker protein amino acid sequence described herein, but which includes fewer amino acids than the full length protein, and exhibit at least one activity of the corresponding full-length protein. Typically, biologically active portions comprise a domain or motif with at least one activity of the corresponding protein. A biologically active portion of a protein of the present invention can be a polypeptide which is, for example, 10, 25, 50, 100 or more amino acids in length. Moreover, other biologically active portions, in which other regions of the protein are deleted, can be prepared by recombinant techniques and evaluated for one or more of the functional activities of the native form of a polypeptide of the present invention.
Preferred polypeptides have an amino acid sequence of a biomarker protein encoded by a nucleic acid molecule described herein. Other useful proteins are substantially identical (e.g., at least about 40%, preferably 50%, 60%, 70%, 75%, 80%, 83%, 85%, 88%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) to one of these sequences and retain the functional activity of the protein of the corresponding naturally-occurring protein yet differ in amino acid sequence due to natural allelic variation or mutagenesis.
To determine the percent identity of two amino acid sequences or of two nucleic acids, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first amino acid or nucleic acid sequence for optimal alignment with a second amino or nucleic acid sequence). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is
a function of the number of identical positions shared by the sequences (i.e., % identity = # of identical positions/total # of positions (e.g., overlapping positions) xlOO). In one embodiment the two sequences are the same length.
The determination of percent identity between two sequences can be accomplished using a mathematical algorithm. A preferred, non-limiting example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264-2268, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877. Such an algorithm is incorporated into the BLAST and XBLAST programs of Altschul, et al. (1990) J. Mol. Biol. 215:403-410. BLAST nucleotide searches can be performed with the NBLAST program, score = 100, wordlength = 12 to obtain nucleotide sequences homologous to a nucleic acid molecules of the present invention. BLAST protein searches can be performed with the XBLAST program, score = 50, wordlength = 3 to obtain amino acid sequences homologous to a protein molecules of the present invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402. Alternatively, PSI-Blast can be used to perform an iterated search which detects distant relationships between molecules. When utilizing BLAST, Gapped BLAST, and PSI-Blast programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. See http://www.ncbi.nlm.nih.gov. Another preferred, non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller, (1988) Comput Appl Biosci, 4: 11-7. Such an algorithm is incorporated into the ALIGN program (version 2.0) which is part of the GCG sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used. Yet another useful algorithm for identifying regions of local sequence similarity and alignment is the FASTA algorithm as described in Pearson and Lipman (1988) Proc. Natl. Acad. Sci. USA 85:2444-2448. When using the FASTA algorithm for comparing nucleotide or amino acid sequences, a PAM120 weight residue table can, for example, be used with a £-tuple value of 2.
The percent identity between two sequences can be determined using techniques similar to those described above, with or without allowing gaps. In calculating percent identity, only exact matches are counted.
The present invention also provides chimeric or fusion proteins corresponding to a biomarker protein. As used herein, a "chimeric protein" or "fusion protein" comprises all or part (preferably a biologically active part) of a polypeptide corresponding to a marker of the present invention operably linked to a heterologous polypeptide (i.e., a polypeptide other than the polypeptide corresponding to the marker). Within the fusion protein, the term "operably linked" is intended to indicate that the polypeptide of the present invention and the heterologous polypeptide are fused in-frame to each other. The heterologous polypeptide can be fused to the amino-terminus or the carboxyl-terminus of the polypeptide of the present invention.
One useful fusion protein is a GST fusion protein in which a polypeptide corresponding to a marker of the present invention is fused to the carboxyl terminus of GST sequences. Such fusion proteins can facilitate the purification of a recombinant polypeptide of the present invention.
In another embodiment, the fusion protein contains a heterologous signal sequence, immunoglobulin fusion protein, toxin, or other useful protein sequence. Chimeric and fusion proteins of the present invention can be produced by standard recombinant DNA techniques. In another embodiment, the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and re-amplified to generate a chimeric gene sequence (see, e.g., Ausubel et al, supra). Moreover, many expression vectors are commercially available that already encode a fusion moiety {e.g., a GST polypeptide). A nucleic acid encoding a polypeptide of the present invention can be cloned into such an expression vector such that the fusion moiety is linked in-frame to the polypeptide of the present invention.
A signal sequence can be used to facilitate secretion and isolation of the secreted protein or other proteins of interest. Signal sequences are typically characterized by a core of hydrophobic amino acids which are generally cleaved from the mature protein during secretion in one or more cleavage events. Such signal peptides contain processing sites that allow cleavage of the signal sequence from the mature proteins as they pass through the secretory pathway. Thus, the present invention pertains to the described polypeptides having a signal sequence, as well as to polypeptides from which the signal sequence has been proteolytically cleaved {i.e., the cleavage products). In one embodiment, a nucleic
acid sequence encoding a signal sequence can be operably linked in an expression vector to a protein of interest, such as a protein which is ordinarily not secreted or is otherwise difficult to isolate. The signal sequence directs secretion of the protein, such as from a eukaryotic host into which the expression vector is transformed, and the signal sequence is subsequently or concurrently cleaved. The protein can then be readily purified from the extracellular medium by art recognized methods. Alternatively, the signal sequence can be linked to the protein of interest using a sequence which facilitates purification, such as with a GST domain.
The present invention also pertains to variants of the biomarker polypeptides described herein. Such variants have an altered amino acid sequence which can function as either agonists (mimetics) or as antagonists. Variants can be generated by mutagenesis, e.g., discrete point mutation or truncation. An agonist can retain substantially the same, or a subset, of the biological activities of the naturally occurring form of the protein. An antagonist of a protein can inhibit one or more of the activities of the naturally occurring form of the protein by, for example, competitively binding to a downstream or upstream member of a cellular signaling cascade which includes the protein of interest. Thus, specific biological effects can be elicited by treatment with a variant of limited function. Treatment of a subject with a variant having a subset of the biological activities of the naturally occurring form of the protein can have fewer side effects in a subject relative to treatment with the naturally occurring form of the protein.
Variants of a biomarker protein which function as either agonists (mimetics) or as antagonists can be identified by screening combinatorial libraries of mutants, e.g., truncation mutants, of the protein of the present invention for agonist or antagonist activity. In one embodiment, a variegated library of variants is generated by combinatorial mutagenesis at the nucleic acid level and is encoded by a variegated gene library. A variegated library of variants can be produced by, for example, enzymatically ligating a mixture of synthetic oligonucleotides into gene sequences such that a degenerate set of potential protein sequences is expressible as individual polypeptides, or alternatively, as a set of larger fusion proteins (e.g., for phage display). There are a variety of methods which can be used to produce libraries of potential variants of the polypeptides of the present invention from a degenerate oligonucleotide sequence. Methods for synthesizing degenerate oligonucleotides are known in the art (see, e.g., Narang, 1983, Tetrahedron
39:3; Itakura et al., 1984, Annu. Rev. Biochem. 53 :323; Itakura et al., 1984, Science 198: 1056; Ike et al, 1983 Nucleic Acid Res. 11 :477).
In addition, libraries of fragments of the coding sequence of a polypeptide corresponding to a marker of the present invention can be used to generate a variegated population of polypeptides for screening and subsequent selection of variants. For example, a library of coding sequence fragments can be generated by treating a double stranded PCR fragment of the coding sequence of interest with a nuclease under conditions wherein nicking occurs only about once per molecule, denaturing the double stranded DNA, renaturing the DNA to form double stranded DNA which can include sense/antisense pairs from different nicked products, removing single stranded portions from reformed duplexes by treatment with SI nuclease, and ligating the resulting fragment library into an expression vector. By this method, an expression library can be derived which encodes amino terminal and internal fragments of various sizes of the protein of interest.
Several techniques are known in the art for screening gene products of
combinatorial libraries made by point mutations or truncation, and for screening cDNA libraries for gene products having a selected property. The most widely used techniques, which are amenable to high throughput analysis, for screening large gene libraries typically include cloning the gene library into replicable expression vectors, transforming appropriate cells with the resulting library of vectors, and expressing the combinatorial genes under conditions in which detection of a desired activity facilitates isolation of the vector encoding the gene whose product was detected. Recursive ensemble mutagenesis (REM), a technique which enhances the frequency of functional mutants in the libraries, can be used in combination with the screening assays to identify variants of a protein of the present invention (Arkin and Yourvan, 1992, Proc. Natl. Acad. Sci. USA 59:7811-7815; Delgrave et al, 1993, Protein Engineering 6(3):327- 331).
An isolated polypeptide or a fragment thereof (or a nucleic acid encoding such a polypeptide) corresponding to one or more biomarkers of the invention, including the biomarkers listed in Table 1 or fragments thereof, can be used as an immunogen to generate antibodies that bind to said immunogen, using standard techniques for polyclonal and monoclonal antibody preparation according to well-known methods in the art. An antigenic peptide comprises at least 8 amino acid residues and encompasses an epitope present in the respective full length molecule such that an antibody raised against the peptide forms a specific immune complex with the respective full length molecule. Preferably, the
antigenic peptide comprises at least 10 amino acid residues. In one embodiment such epitopes can be specific for a given polypeptide molecule from one species, such as mouse or human (i.e., an antigenic peptide that spans a region of the polypeptide molecule that is not conserved across species is used as immunogen; such non conserved residues can be determined using an alignment such as that provided herein).
In some embodiments, the immunotherapy utilizes an inhibitor of at least one immune checkpoint, such as an antibody binds substantially specifically to an immune checkpoint, such as PD-1, and inhibits or blocks its immunoinhibitory function, such as by interrupting its interaction with a binding partner of the immune checkpoint, such as PD-Ll and/or PD-L2 binding partners of PD-1. In one embodiment, an antibody, especially an intrbody, binds substantially specifically to one or more biomarkers listed in Table 1 and inhibits or blocks its biological function, such as by interrupting its interaction with a substrate like STAT or JAK proteins. In another embodiment, an antibody, especially an intrbody, binds substantially specifically to a biomarker binding partner, such as biomarker substrates descrbied herein, and inhibits or blocks its biological function, such as by interrupting its interaction to one or more biomarkers listed in Table 1.
For example, a polypeptide immunogen typically is used to prepare antibodies by immunizing a suitable subject (e.g., rabbit, goat, mouse or other mammal) with the immunogen. A preferred animal is a mouse deficeint in the desired target antigen. For example, a PD-1 knockout mouse if the desired antibody is an anti-PD-1 antibody, may be used. This results in a wider spectrum of antibody recognition possibilities as antibodies reactive to common mouse and human epitopes are not removed by tolerance mechanisms. An appropriate immunogenic preparation can contain, for example, a recombinantly expressed or chemically synthesized molecule or fragment thereof to which the immune response is to be generated. The preparation can further include an adjuvant, such as Freund's complete or incomplete adjuvant, or similar immunostimulatory agent.
Immunization of a suitable subject with an immunogenic preparation induces a polyclonal antibody response to the antigenic peptide contained therein.
Polyclonal antibodies can be prepared as described above by immunizing a suitable subject with a polypeptide immunogen. The polypeptide antibody titer in the immunized subject can be monitored over time by standard techniques, such as with an enzyme linked immunosorbent assay (ELISA) using immobilized polypeptide. If desired, the antibody directed against the antigen can be isolated from the mammal (e.g., from the blood) and
further purified by well-known techniques, such as protein A chromatography, to obtain the IgG fraction. At an appropriate time after immunization, e.g., when the antibody titers are highest, antibody -producing cells can be obtained from the subject and used to prepare monoclonal antibodies by standard techniques, such as the hybridoma technique (originally described by Kohler and Milstein (1975) Nature 256:495-497) (see also Brown et al. (1981) J. Immunol. 127:539-46; Brown et al. (1980) J. Biol. Chem. 255:4980-83; Yeh et al. (1976) Proc. Natl. Acad. Sci. 76:2927-31; Yeh et al. (1982) Int. J. Cancer 29:269-75), the more recent human B cell hybridoma technique (Kozbor et al. (1983) Immunol. Today 4:72), the EBV-hybridoma technique (Cole et al. (1985) Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96) or trioma techniques. The technology for producing monoclonal antibody hybridomas is well-known (see generally Kenneth, R. H. in
Monoclonal Antibodies: A New Dimension In Biological Analyses, Plenum Publishing Corp., New York, New York (1980); Lerner, E. A. (1981) Yale J. Biol. Med. 54:387-402; Gefter, M. L. et al. (1977) Somatic Cell Genet. 3 :231-36). Briefly, an immortal cell line (typically a myeloma) is fused to lymphocytes (typically splenocytes) from a mammal immunized with an immunogen as described above, and the culture supernatants of the resulting hybridoma cells are screened to identify a hybridoma producing a monoclonal antibody that binds to the polypeptide antigen, preferably specifically. In some
embodiments, the immunization is performed in a cell or animal host that has a knockout of a target antigen of interest {e.g. , does not produce the antigen prior to immunization).
Any of the many well-known protocols used for fusing lymphocytes and
immortalized cell lines can be applied for the purpose of generating a monoclonal antibody against one or more biomarkers of the invention, including the biomarkers listed in Table 1, or a fragment thereof (see, e.g., Galfire, G. et al. (1977) Nature 266:55052; Gefter et al. (1977) supra; Lerner (1981) supra; Kenneth (1980) supra). Moreover, the ordinary skilled worker will appreciate that there are many variations of such methods which also would be useful. Typically, the immortal cell line {e.g., a myeloma cell line) is derived from the same mammalian species as the lymphocytes. For example, murine hybridomas can be made by fusing lymphocytes from a mouse immunized with an immunogenic preparation of the present invention with an immortalized mouse cell line. Preferred immortal cell lines are mouse myeloma cell lines that are sensitive to culture medium containing hypoxanthine, aminopterin and thymidine ("HAT medium"). Any of a number of myeloma cell lines can be used as a fusion partner according to standard techniques, e.g., the P3-NSl/l-Ag4-l, P3-
x63-Ag8.653 or Sp2/0-Agl4 myeloma lines. These myeloma lines are available from the American Type Culture Collection (ATCC), Rockville, MD. Typically, HAT-sensitive mouse myeloma cells are fused to mouse splenocytes using polyethylene glycol ("PEG"). Hybridoma cells resulting from the fusion are then selected using HAT medium, which kills unfused and unproductively fused myeloma cells (unfused splenocytes die after several days because they are not transformed). Hybridoma cells producing a monoclonal antibody of the invention are detected by screening the hybridoma culture supernatants for antibodies that bind a given polypeptide, e.g., using a standard ELISA assay.
As an alternative to preparing monoclonal antibody-secreting hybridomas, a monoclonal specific for one of the above described polypeptides can be identified and isolated by screening a recombinant combinatorial immunoglobulin library (e.g., an antibody phage display library) with the appropriate polypeptide to thereby isolate immunoglobulin library members that bind the polypeptide. Kits for generating and screening phage display libraries are commercially available (e.g., the Pharmacia
Recombinant Phage Antibody System, Catalog No. 27-9400-01; and the Stratagene
SurfZAP™ Phage Display Kit, Catalog No. 240612). Additionally, examples of methods and reagents particularly amenable for use in generating and screening an antibody display library can be found in, for example, Ladner et al. U.S. Patent No. 5,223,409; Kang et al. International Publication No. WO 92/18619; Dower et al. International Publication No. WO 91/17271 ; Winter et al. International Publication WO 92/20791 ; Markland et al.
International Publication No. WO 92/15679; Breitling et al. International Publication WO 93/01288; McCafferty et al. International Publication No. WO 92/01047; Garrard et al. International Publication No. WO 92/09690; Ladner et al. International Publication No. WO 90/02809; Fuchs et al. (1991) Biotechnology (NY) 9: 1369-1372; Hay et al. (1992) Hum. Antibod. Hybridomas 3 :81-85; Huse et al. (1989) Science 246: 1275-1281; Griffiths et al. (1993) EMBO J. 12:725-734; Hawkins et al. (1992) J. Mol. Biol. 226:889-896; Clarkson et al. (1991) Nature 352:624-628; Gram et al. (1992) Proc. Natl. Acad. Sci. USA 89:3576- 3580; Garrard et al. (1991) Biotechnology (NY) 9: 1373-1377; Hoogenboom et al. (1991) Nucleic Acids Res. 19:4133-4137; Barbas et al. (1991) Proc. Natl. Acad. Sci. USA 88:7978- 7982; and McCafferty et al. (1990) Nature 348:552-554.
Since it is well-known in the art that antibody heavy and light chain CDR3 domains play a particularly important role in the binding specificity/affinity of an antibody for an antigen, the recombinant monoclonal antibodies of the present invention prepared as set
forth above preferably comprise the heavy and light chain CDR3s of variable regions of the antibodies described herein and well-known in the art. Similarly, the antibodies can further comprise the CDR2s of variable regions of said antibodies. The antibodies can further comprise the CDRl s of variable regions of said antibodies. In other embodiments, the antibodies can comprise any combinations of the CDRs.
The CDR1, 2, and/or 3 regions of the engineered antibodies described above can comprise the exact amino acid sequence(s) as those of variable regions of the present invention described herein. However, the ordinarily skilled artisan will appreciate that some deviation from the exact CDR sequences may be possible while still retaining the ability of the antibody, especially an introbody, to bind a desired target, such as one or more biomarkers listed in Table 1 and/or a binding partner thereof, either alone or in combination with an immunotherapy, such as one or more biomarkers listed in Table 1, biomarker binding partners/substrates, or an immunotherapy effectively (e.g., conservative sequence modifications). Accordingly, in another embodiment, the engineered antibody may be composed of one or more CDRs that are, for example, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to one or more CDRs of the present invention described herein or otherwise publicly available.
For example, the structural features of non-human or human antibodies (e.g., a rat anti-mouse/anti-human antibody) can be used to create structurally related human antibodies, especially introbodies, that retain at least one functional property of the antibodies of the present invention, such as binding to one or more biomarkers listed in Table 1, biomarker binding partners/substrates, and/or an immune checkpoint. Another functional property includes inhibiting binding of the original known, non-human or human antibodies in a competition ELISA assay.
Antibodies, immunoglobulins, and polypeptides of the invention can be used in an isolated (e.g., purified) form or contained in a vector, such as a membrane or lipid vesicle (e.g. a liposome). Moreover, amino acid sequence modification(s) of the antibodies described herein are contemplated. For example, it may be desirable to improve the binding affinity and/or other biological properties of the antibody. It is known that when a humanized antibody is produced by simply grafting only CDRs in VH and VL of an antibody derived from a non-human animal in FRs of the VH and VL of a human antibody, the antigen binding activity is reduced in comparison with that of the original antibody derived from a non-human animal. It is considered that several amino acid residues of the
VH and VL of the non-human antibody, not only in CDRs but also in FRs, are directly or indirectly associated with the antigen binding activity. Hence, substitution of these amino acid residues with different amino acid residues derived from FRs of the VH and VL of the human antibody would reduce binding activity and can be corrected by replacing the amino acids with amino acid residues of the original antibody derived from a non-human animal.
Similarly, modifications and changes may be made in the structure of the antibodies described herein, and in the DNA sequences encoding them, and still obtain a functional molecule that encodes an antibody and polypeptide with desirable characteristics. For example, antibody glycosylation patterns can be modulated to, for example, increase stability. By "altering" is meant deleting one or more carbohydrate moieties found in the antibody, and/or adding one or more glycosylation sites that are not present in the antibody. Glycosylation of antibodies is typically N-linked. "N-linked" refers to the attachment of the carbohydrate moiety to the side chain of an asparagine residue. The tripeptide sequences asparagine-X-serine and asparagines-X-threonine, where X is any amino acid except proline, are the recognition sequences for enzymatic attachment of the carbohydrate moiety to the asparagine side chain. Thus, the presence of either of these tripeptide sequences in a polypeptide creates a potential glycosylation site. Addition of glycosylation sites to the antibody is conveniently accomplished by altering the amino acid sequence such that it contains one or more of the above-described tripeptide sequences (for N-linked
glycosylation sites). Another type of covalent modification involves chemically or enzymatically coupling glycosides to the antibody. These procedures are advantageous in that they do not require production of the antibody in a host cell that has glycosylation capabilities for N- or O-linked glycosylation. Depending on the coupling mode used, the sugar(s) may be attached to (a) arginine and histidine, (b) free carboxyl groups, (c) free sulfhydryl groups such as those of cysteine, (d) free hydroxyl groups such as those of serine, threonine, orhydroxyproline, (e) aromatic residues such as those of phenylalanine, tyrosine, or tryptophan, or (f) the amide group of glutamine. For example, such methods are described in WO87/05330.
Similarly, removal of any carbohydrate moieties present on the antibody may be accomplished chemically or enzymatically. Chemical deglycosylation requires exposure of the antibody to the compound trifluoromethanesulfonic acid, or an equivalent compound. This treatment results in the cleavage of most or all sugars except the linking sugar (N- acetylglucosamine or N-acetylgalactosamine), while leaving the antibody intact. Chemical
deglycosylation is described by Sojahr et al. (1987) and by Edge et al. (1981). Enzymatic cleavage of carbohydrate moieties on antibodies can be achieved by the use of a variety of endo- and exo-glycosidases as described by Thotakura et al. (1987).
Other modifications can involve the formation of immunoconjugates. For example, in one type of covalent modification, antibodies or proteins are covalently linked to one of a variety of non proteinaceous polymers, e.g., polyethylene glycol, polypropylene glycol, or polyoxyalkylenes, in the manner set forth in U.S. Pat. No. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192 or 4, 179,337.
Conjugation of antibodies or other proteins of the present invention with
heterologous agents can be made using a variety of bifunctional protein coupling agents including but not limited to N-succinimidyl (2-pyridyldithio) propionate (SPDP), succinimidyl (N-maleimidomethyl)cyclohexane-l-carboxylate, iminothiolane (IT), bifunctional derivatives of imidoesters (such as dimethyl adipimidate HCL), active esters (such as disuccinimidyl suberate), aldehydes (such as glutaraldehyde), bis-azido
compounds (such as bis (p-azidobenzoyl) hexanediamine), bis-diazonium derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine), diisocyanates (such as toluene
2,6diisocyanate), and bis-active fluorine compounds (such as l,5-difluoro-2,4- dinitrobenzene). For example, carbon labeled 1-isothiocyanatobenzyl methyldi ethylene triaminepentaacetic acid (MX-DTPA) is an exemplary chelating agent for conjugation of radionucleotide to the antibody (WO 94/11026).
In another aspect, the present invention features antibodies conjugated to a therapeutic moiety, such as a cytotoxin, a drug, and/or a radioisotope. When conjugated to a cytotoxin, these antibody conjugates are referred to as "immunotoxins." A cytotoxin or cytotoxic agent includes any agent that is detrimental to {e.g., kills) cells. Examples include taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin and analogs or homologs thereof. Therapeutic agents include, but are not limited to, antimetabolites {e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating agents {e.g., mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II) (DDP) cisplatin),
anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), and anti -mitotic agents (e.g., vincristine and vinblastine). An antibody of the present invention can be conjugated to a radioisotope, e.g., radioactive iodine, to generate cytotoxic radiopharmaceuticals for treating a related disorder, such as a cancer.
Conjugated antibodies, in addition to therapeutic utility, can be useful for diagnostically or prognostically to monitor polypeptide levels in tissue as part of a clinical testing procedure, e.g., to determine the efficacy of a given treatment regimen. Detection can be facilitated by coupling (i e., physically linking) the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate (FITC), rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin (PE); an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin, and examples of suitable radioactive material include 125I, 131I, 35S, or 3H. [0134] As used herein, the term "labeled", with regard to the antibody, is intended to encompass direct labeling of the antibody by coupling (i.e., physically linking) a detectable substance, such as a radioactive agent or a fluorophore (e.g.
fluorescein isothiocyanate (FITC) or phycoerythrin (PE) or Indocyanine (Cy5)) to the antibody, as well as indirect labeling of the antibody by reactivity with a detectable substance.
The antibody conjugates of the present invention can be used to modify a given biological response. The therapeutic moiety is not to be construed as limited to classical chemical therapeutic agents. For example, the drug moiety may be a protein or polypeptide possessing a desired biological activity. Such proteins may include, for example, an enzymatically active toxin, or active fragment thereof, such as abrin, ricin A, Pseudomonas exotoxin, or diphtheria toxin; a protein such as tumor necrosis factor or interferon-. gamma.; or, biological response modifiers such as, for example, lymphokines, interleukin-1 ("IL-l"), interleukin-2 ("IL-2"), interleukin-6 ("IL-6"), granulocyte macrophage colony stimulating
factor ("GM-CSF"), granulocyte colony stimulating factor ("G-CSF"), or other cytokines or growth factors.
In one embodiment, an antibody for use in the instant invention is a bispecific or multispecific antibody. A bispecific antibody has binding sites for two different antigens within a single antibody polypeptide. Antigen binding may be simultaneous or sequential. Triomas and hybrid hybridomas are two examples of cell lines that can secrete bispecific antibodies. Examples of bispecific antibodies produced by a hybrid hybridoma or a trioma are disclosed in U.S. Patent 4,474,893. Bispecific antibodies have been constructed by chemical means (Staerz et al. (1985) Nature 314:628, and Perez et al. (1985) Nature 316:354) and hybridoma technology (Staerz and Bevan (1986) Proc. Natl. Acad. Sci. USA, 83 : 1453, and Staerz and Bevan (1986) Immunol. Today 7:241). Bispecific antibodies are also described in U.S. Patent 5,959,084. Fragments of bispecific antibodies are described in U.S. Patent 5,798,229.
Bispecific agents can also be generated by making heterohybridomas by fusing hybridomas or other cells making different antibodies, followed by identification of clones producing and co-assembling both antibodies. They can also be generated by chemical or genetic conjugation of complete immunoglobulin chains or portions thereof such as Fab and Fv sequences. The antibody component can bind to a polypeptide or a fragment thereof of one or more biomarkers of the invention, including one or more biomarkers listed in Table 1, or a fragment thereof. In one embodiment, the bispecific antibody could specifically bind to both a polypeptide or a fragment thereof and its natural binding partner(s) or a fragment(s) thereof.
Techniques for modulating antibodies, such as humanization, conjugation, recombinant techniques, and the like are well-known in the art.
In another aspect of this invention, peptides or peptide mimetics can be used to antagonize the activity of one or more biomarkers of the invention, including one or more biomarkers listed in Table 1, or a fragment(s) thereof. In one embodiment, variants of one or more biomarkers listed in Table 1 which function as a modulating agent for the respective full length protein, can be identified by screening combinatorial libraries of mutants, e.g., truncation mutants, for antagonist activity. In one embodiment, a variegated library of variants is generated by combinatorial mutagenesis at the nucleic acid level and is encoded by a variegated gene library. A variegated library of variants can be produced, for instance, by enzymatically ligating a mixture of synthetic oligonucleotides into gene
sequences such that a degenerate set of potential polypeptide sequences is expressible as individual polypeptides containing the set of polypeptide sequences therein. There are a variety of methods which can be used to produce libraries of polypeptide variants from a degenerate oligonucleotide sequence. Chemical synthesis of a degenerate gene sequence can be performed in an automatic DNA synthesizer, and the synthetic gene then ligated into an appropriate expression vector. Use of a degenerate set of genes allows for the provision, in one mixture, of all of the sequences encoding the desired set of potential polypeptide sequences. Methods for synthesizing degenerate oligonucleotides are known in the art (see, e.g., Narang, S. A. (1983) Tetrahedron 39:3; Itakura et a/. (1984) Annu. Rev. Biochem. 53 :323; Itakura et al. (1984) Science 198: 1056; Ike et al. (1983) Nucleic Acid Res. 11 :477.
In addition, libraries of fragments of a polypeptide coding sequence can be used to generate a variegated population of polypeptide fragments for screening and subsequent selection of variants of a given polypeptide. In one embodiment, a library of coding sequence fragments can be generated by treating a double stranded PCR fragment of a polypeptide coding sequence with a nuclease under conditions wherein nicking occurs only about once per polypeptide, denaturing the double stranded DNA, renaturing the DNA to form double stranded DNA which can include sense/antisense pairs from different nicked products, removing single stranded portions from reformed duplexes by treatment with SI nuclease, and ligating the resulting fragment library into an expression vector. By this method, an expression library can be derived which encodes N-terminal, C-terminal and internal fragments of various sizes of the polypeptide.
Several techniques are known in the art for screening gene products of
combinatorial libraries made by point mutations or truncation, and for screening cDNA libraries for gene products having a selected property. Such techniques are adaptable for rapid screening of the gene libraries generated by the combinatorial mutagenesis of polypeptides. The most widely used techniques, which are amenable to high through-put analysis, for screening large gene libraries typically include cloning the gene library into replicable expression vectors, transforming appropriate cells with the resulting library of vectors, and expressing the combinatorial genes under conditions in which detection of a desired activity facilitates isolation of the vector encoding the gene whose product was detected. Recursive ensemble mutagenesis (REM), a technique which enhances the frequency of functional mutants in the libraries, can be used in combination with the screening assays to identify variants of interest (Arkin and Youvan (1992) Proc. Natl. Acad.
Sci. USA 89:7811-7815; Delagrave et al. (1993) Protein Eng. 6(3):327-331). In one embodiment, cell based assays can be exploited to analyze a variegated polypeptide library. For example, a library of expression vectors can be transfected into a cell line which ordinarily synthesizes one or more biomarkers of the invention, including one or more biomarkers listed in Table 1, or a fragment thereof. The transfected cells are then cultured such that the full length polypeptide and a particular mutant polypeptide are produced and the effect of expression of the mutant on the full length polypeptide activity in cell supernatants can be detected, e.g., by any of a number of functional assays. Plasmid DNA can then be recovered from the cells which score for inhibition, or alternatively,
potentiation of full length polypeptide activity, and the individual clones further
characterized.
Systematic substitution of one or more amino acids of a polypeptide amino acid sequence with a D-amino acid of the same type {e.g., D-lysine in place of L-lysine) can be used to generate more stable peptides. In addition, constrained peptides comprising a polypeptide amino acid sequence of interest or a substantially identical sequence variation can be generated by methods known in the art (Rizo and Gierasch (1992) Annu. Rev.
Biochem. 61 :387, incorporated herein by reference); for example, by adding internal cysteine residues capable of forming intramolecular disulfide bridges which cyclize the peptide.
The amino acid sequences described herein will enable those of skill in the art to produce polypeptides corresponding peptide sequences and sequence variants thereof. Such polypeptides can be produced in prokaryotic or eukaryotic host cells by expression of polynucleotides encoding the peptide sequence, frequently as part of a larger polypeptide. Alternatively, such peptides can be synthesized by chemical methods. Methods for expression of heterologous proteins in recombinant hosts, chemical synthesis of
polypeptides, and in vitro translation are well-known in the art and are described further in Maniatis et al. Molecular Cloning: A Laboratory Manual (1989), 2nd Ed., Cold Spring Harbor, N.Y.; Berger and Kimmel, Methods in Enzymology, Volume 152, Guide to Molecular Cloning Techniques (1987), Academic Press, Inc., San Diego, Calif; Merrifield, J. (1969) J. Am. Chem. Soc. 91 :501; Chaiken I. M. (1981) CRC Crit. Rev. Biochem. 11 :
255; Kaiser et al. (1989) Science 243 : 187; Merrifield, B. (1986) Science 232:342; Kent, S. B. H. (1988) Annu. Rev. Biochem. 57:957; and Offord, R. E. (1980) Semisynthetic Proteins, Wiley Publishing, which are incorporated herein by reference).
Peptides can be produced, typically by direct chemical synthesis. Peptides can be produced as modified peptides, with nonpeptide moieties attached by covalent linkage to the N-terminus and/or C-terminus. In certain preferred embodiments, either the carboxy- terminus or the amino-terminus, or both, are chemically modified. The most common modifications of the terminal amino and carboxyl groups are acetylation and amidation, respectively. Amino-terminal modifications such as acylation (e.g., acetylation) or alkylation (e.g., methylation) and carboxy -terminal-modifications such as amidation, as well as other terminal modifications, including cyclization, can be incorporated into various embodiments of the invention. Certain amino-terminal and/or carboxy-terminal modifications and/or peptide extensions to the core sequence can provide advantageous physical, chemical, biochemical, and pharmacological properties, such as: enhanced stability, increased potency and/or efficacy, resistance to serum proteases, desirable pharmacokinetic properties, and others. Peptides described herein can be used
therapeutically to treat disease, e.g., by altering costimulation in a patient.
Peptidomimetics (Fauchere (1986) Adv. Drug Res. 15:29; Veber and Freidinger
(1985) TINS p.392; and Evans et al. (1987) J. Med. Chem. 30: 1229, which are
incorporated herein by reference) are usually developed with the aid of computerized molecular modeling. Peptide mimetics that are structurally similar to therapeutically useful peptides can be used to produce an equivalent therapeutic or prophylactic effect. Generally, peptidomimetics are structurally similar to a paradigm polypeptide (i.e., a polypeptide that has a biological or pharmacological activity), but have one or more peptide linkages optionally replaced by a linkage selected from the group consisting of: - CH2NH-, -CH2S-, -CH2-CH2-, -CH=CH- (cis and trans), -COCH2-, -CH(OH)CH2-, and - CH2SO-, by methods known in the art and further described in the following references: Spatola, A. F. in "Chemistry and Biochemistry of Amino Acids, Peptides, and Protei " Weinstein, B., ed., Marcel Dekker, New York, p. 267 (1983); Spatola, A. F., Vega Data (March 1983), Vol. 1, Issue 3, "Peptide Backbone Modifications" (general review);
Morley, J. S. (1980) Trends Pharm. Sci. pp. 463-468 (general review); Hudson, D. et al. (1979) Int. J. Pept. Prot. Res. 14: 177-185 (-CH2NH-, CH2CH2-); Spatola, A. F. et al. (1986) Life Sci. 38: 1243-1249 (-CH2-S); Hann, M. M. (1982) J. Chem. Soc. Perkin Trans. I. 307-314 (-CH-CH-, cis and trans); Almquist, R. G. et al. (190) J. Med. Chem. 23 : 1392- 1398 (-COCH2-); Jennings-White, C. et al. (1982) Tetrahedron Lett. 23 :2533 (-COCH2-); Szelke, M. et al. European Appln. EP 45665 (1982) CA: 97:39405 (1982)(-CH(OH)CH2-
); Holladay, M. W. et al. (1983) Tetrahedron Lett. (1983) 24:4401-4404 (-C(OH)CH2-); and Hruby, V. J. (1982) Life Sci. (1982) 31 : 189-199 (-CH2-S-); each of which is incorporated herein by reference. A particularly preferred non-peptide linkage is - CH2NH-. Such peptide mimetics may have significant advantages over polypeptide embodiments, including, for example: more economical production, greater chemical stability, enhanced pharmacological properties (half-life, absorption, potency, efficacy, etc.), altered specificity {e.g., a broad-spectrum of biological activities), reduced
antigenicity, and others. Labeling of peptidomimetics usually involves covalent attachment of one or more labels, directly or through a spacer {e.g., an amide group), to non-interfering position(s) on the peptidomimetic that are predicted by quantitative structure-activity data and/or molecular modeling. Such non-interfering positions generally are positions that do not form direct contacts with the macropolypeptides(s) to which the peptidomimetic binds to produce the therapeutic effect. Derivatization {e.g., labeling) of peptidomimetics should not substantially interfere with the desired biological or pharmacological activity of the peptidomimetic.
Also encompassed by the present invention are small molecules which can modulate (either enhance or inhibit) interactions, e.g., between biomarkers described herein or listed in Table 1 and their natural binding partners. The small molecules of the present invention can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the One-bead one- compound' library method; and synthetic library methods using affinity chromatography selection. (Lam, K. S. (1997) Anticancer Drug Des. 12: 145).
Examples of methods for the synthesis of molecular libraries can be found in the art, for example in: DeWitt et al. (1993) Proc. Natl. Acad. Sci. USA 90:6909; Erb et al. (1994) Proc. Natl. Acad. Sci. USA 91 : 11422; Zuckermann et al. (1994) J. Med. Chem. 37:2678; Cho et al. (1993) Science 261 : 1303; Carrell et al. (1994) Angew. Chem. Int. Ed. Engl.
33 :2059; Carell et al. (1994) Angew. Chem. Int. Ed. Engl. 33 :2061; and in Gallop et al. (1994) J. Med. Chem. 37: 1233.
Libraries of compounds can be presented in solution {e.g., Houghten (1992)
Biotechniques 13 :412-421), or on beads (Lam (1991) Nature 354:82-84), chips (Fodor (1993) Nature 364:555-556), bacteria (Ladner USP 5,223,409), spores (Ladner USP '409), plasmids (Cull et al. (1992) Proc. Natl. Acad. Sci. USA 89: 1865-1869) or on phage (Scott
and Smith (1990) Science 249:386-390); (Devlin (1990) Science 249:404-406); (Cwirla et al. (1990) Proc. Natl. Acad. Sci. USA 87:6378-6382); (Felici (1991) J. Mol. Biol. 222:301- 310); (Ladner supra.). Compounds can be screened in cell based or non-cell based assays. Compounds can be screened in pools {e.g. multiple compounds in each testing sample) or as individual compounds.
Chimeric or fusion proteins can be prepared for the biomarker inhibitors and/or agents for the immunotherapies described herein, such as inhibitors to the biomarkers of the invention, including the biomarkers listed in Table 1, or fragments thereof. As used herein, a "chimeric protein" or "fusion protein" comprises one or more biomarkers of the invention, including one or more biomarkers listed in Table 1, or a fragment thereof, operatively linked to another polypeptide having an amino acid sequence corresponding to a protein which is not substantially homologous to the respective biomarker. In a preferred embodiment, the fusion protein comprises at least one biologically active portion of one or more biomarkers of the invention, including one or more biomarkers listed in Table 1, or fragments thereof. Within the fusion protein, the term "operatively linked" is intended to indicate that the biomarker sequences and the non-biomarker sequences are fused in-frame to each other in such a way as to preserve functions exhibited when expressed
independently of the fusion. The "another" sequences can be fused to the N-terminus or C- terminus of the biomarker sequences, respectively.
Such a fusion protein can be produced by recombinant expression of a nucleotide sequence encoding the first peptide and a nucleotide sequence encoding the second peptide. The second peptide may optionally correspond to a moiety that alters the solubility, affinity, stability or valency of the first peptide, for example, an immunoglobulin constant region. In another preferred embodiment, the first peptide consists of a portion of a biologically active molecule {e.g. the extracellular portion of the polypeptide or the ligand binding portion). The second peptide can include an immunoglobulin constant region, for example, a human Cyl domain or Cy4 domain {e.g., the hinge, CH2 and CH3 regions of human IgCy 1, or human IgCy4, see e.g., Capon et al. U.S. Patents 5,116,964; 5,580,756; 5,844,095 and the like, incorporated herein by reference). Such constant regions may retain regions which mediate effector function {e.g. Fc receptor binding) or may be altered to reduce effector function. A resulting fusion protein may have altered solubility, binding affinity, stability and/or valency {i.e., the number of binding sites available per polypeptide) as compared to the independently expressed first peptide, and may increase the efficiency of protein
purification. Fusion proteins and peptides produced by recombinant techniques can be secreted and isolated from a mixture of cells and medium containing the protein or peptide. Alternatively, the protein or peptide can be retained cytoplasmically and the cells harvested, lysed and the protein isolated. A cell culture typically includes host cells, media and other byproducts. Suitable media for cell culture are well-known in the art. Protein and peptides can be isolated from cell culture media, host cells, or both using techniques known in the art for purifying proteins and peptides. Techniques for transfecting host cells and purifying proteins and peptides are known in the art.
Preferably, a fusion protein of the invention is produced by standard recombinant DNA techniques. For example, DNA fragments coding for the different polypeptide sequences are ligated together in-frame in accordance with conventional techniques, for example employing blunt-ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation. In another embodiment, the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and reamplified to generate a chimeric gene sequence (see, for example, Current Protocols in Molecular Biology, eds. Ausubel et al. John Wiley & Sons: 1992).
The fusion proteins of the invention can be used as immunogens to produce antibodies in a subject. Such antibodies may be used to purify the respective natural polypeptides from which the fusion proteins were generated, or in screening assays to identify polypeptides which inhibit the interactions between one or more biomarkers polypeptide or a fragment thereof and its natural binding partner(s) or a fragment(s) thereof.
Also provided herein are compositions comprising one or more nucleic acids comprising or capable of expressing at least 1, 2, 3, 4, 5, 10, 20 or more small nucleic acids or antisense oligonucleotides or derivatives thereof, wherein said small nucleic acids or antisense oligonucleotides or derivatives thereof in a cell specifically hybridize {e.g., bind) under cellular conditions, with cellular nucleic acids {e.g., small non-coding RNAS such as miRNAs, pre-miRNAs, pri-miRNAs, miRNA*, anti-miRNA, a miRNA binding site, a variant and/or functional variant thereof, cellular mRNAs or a fragments thereof). In one embodiment, expression of the small nucleic acids or antisense oligonucleotides or
derivatives thereof in a cell can inhibit expression or biological activity of cellular nucleic acids and/or proteins, e.g., by inhibiting transcription, translation and/or small nucleic acid processing of, for example, one or more biomarkers of the invention, including one or more biomarkers listed in Table 1, or fragment(s) thereof. In one embodiment, the small nucleic acids or antisense oligonucleotides or derivatives thereof are small RNAs (e.g.,
microRNAs) or complements of small RNAs. In another embodiment, the small nucleic acids or antisense oligonucleotides or derivatives thereof can be single or double stranded and are at least six nucleotides in length and are less than about 1000, 900, 800, 700, 600, 500, 400, 300, 200, 100, 50, 40, 30, 25, 24, 23, 22, 21,20, 19, 18, 17, 16, 15, or 10 nucleotides in length. In another embodiment, a composition may comprise a library of nucleic acids comprising or capable of expressing small nucleic acids or antisense oligonucleotides or derivatives thereof, or pools of said small nucleic acids or antisense oligonucleotides or derivatives thereof. A pool of nucleic acids may comprise about 2-5, 5- 10, 10-20, 10-30 or more nucleic acids comprising or capable of expressing small nucleic acids or antisense oligonucleotides or derivatives thereof.
In one embodiment, binding may be by conventional base pair complementarity, or, for example, in the case of binding to DNA duplexes, through specific interactions in the major groove of the double helix. In general, "antisense" refers to the range of techniques generally employed in the art, and includes any process that relies on specific binding to oligonucleotide sequences.
It is well-known in the art that modifications can be made to the sequence of a miRNA or a pre-miRNA without disrupting miRNA activity. As used herein, the term "functional variant" of a miRNA sequence refers to an oligonucleotide sequence that varies from the natural miRNA sequence, but retains one or more functional characteristics of the miRNA (e.g. cancer cell proliferation inhibition, induction of cancer cell apoptosis, enhancement of cancer cell susceptibility to chemotherapeutic agents, specific miRNA target inhibition). In some embodiments, a functional variant of a miRNA sequence retains all of the functional characteristics of the miRNA. In certain embodiments, a functional variant of a miRNA has a nucleobase sequence that is a least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the miRNA or precursor thereof over a region of about 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more nucleobases, or that the functional variant hybridizes to the complement of the
miRNA or precursor thereof under stringent hybridization conditions. Accordingly, in certain embodiments the nucleobase sequence of a functional variant is capable of hybridizing to one or more target sequences of the miRNA.
miRNAs and their corresponding stem-loop sequences described herein may be found in miRBase, an online searchable database of miRNA sequences and annotation, found on the world wide web at microrna.sanger.ac.uk. Entries in the miRBase Sequence database represent a predicted hairpin portion of a miRNA transcript (the stem-loop), with information on the location and sequence of the mature miRNA sequence. The miRNA stem-loop sequences in the database are not strictly precursor miRNAs (pre-miRNAs), and may in some instances include the pre-miRNA and some flanking sequence from the presumed primary transcript. The miRNA nucleobase sequences described herein encompass any version of the miRNA, including the sequences described in Release 10.0 of the miRBase sequence database and sequences described in any earlier Release of the miRBase sequence database. A sequence database release may result in the re-naming of certain miRNAs. A sequence database release may result in a variation of a mature miRNA sequence.
In some embodiments, miRNA sequences of the invention may be associated with a second RNA sequence that may be located on the same RNA molecule or on a separate RNA molecule as the miRNA sequence. In such cases, the miRNA sequence may be referred to as the active strand, while the second RNA sequence, which is at least partially complementary to the miRNA sequence, may be referred to as the complementary strand. The active and complementary strands are hybridized to create a double-stranded RNA that is similar to a naturally occurring miRNA precursor. The activity of a miRNA may be optimized by maximizing uptake of the active strand and minimizing uptake of the complementary strand by the miRNA protein complex that regulates gene translation. This can be done through modification and/or design of the complementary strand.
In some embodiments, the complementary strand is modified so that a chemical group other than a phosphate or hydroxyl at its 5' terminus. The presence of the 5' modification apparently eliminates uptake of the complementary strand and subsequently favors uptake of the active strand by the miRNA protein complex. The 5' modification can be any of a variety of molecules known in the art, including NH2, NHCOCH3, and biotin.
In another embodiment, the uptake of the complementary strand by the miRNA pathway is reduced by incorporating nucleotides with sugar modifications in the first 2-6
nucleotides of the complementary strand. It should be noted that such sugar modifications can be combined with the 5' terminal modifications described above to further enhance miRNA activities.
In some embodiments, the complementary strand is designed so that nucleotides in the 3' end of the complementary strand are not complementary to the active strand. This results in double-strand hybrid RNAs that are stable at the 3' end of the active strand but relatively unstable at the 5' end of the active strand. This difference in stability enhances the uptake of the active strand by the miRNA pathway, while reducing uptake of the complementary strand, thereby enhancing miRNA activity.
Small nucleic acid and/or antisense constructs of the methods and compositions presented herein can be delivered, for example, as an expression plasmid which, when transcribed in the cell, produces RNA which is complementary to at least a unique portion of cellular nucleic acids (e.g., small RNAs, mRNA, and/or genomic DNA). Alternatively, the small nucleic acid molecules can produce RNA which encodes mRNA, miRNA, pre- miRNA, pri-miRNA, miRNA*, anti-miRNA, or a miRNA binding site, or a variant thereof. For example, selection of plasmids suitable for expressing the miRNAs, methods for inserting nucleic acid sequences into the plasmid, and methods of delivering the
recombinant plasmid to the cells of interest are within the skill in the art. See, for example, Zeng et al. (2002) Mol. Cell 9: 1327-1333; Tuschl (2002), Nat. Biotechnol. 20:446-448; Brummelkamp et al. (2002) Science 296:550-553; Miyagishi et al. (2002) Nat. Biotechnol. 20:497-500; Paddison et al. (2002) Genes Dev. 16:948-958; Lee et al. (2002) Nat.
Biotechnol. 20:500-505; and Paul et al. (2002) Nat. Biotechnol. 20:505-508, the entire disclosures of which are herein incorporated by reference.
Alternatively, small nucleic acids and/or antisense constructs are oligonucleotide probes that are generated ex vivo and which, when introduced into the cell, results in hybridization with cellular nucleic acids. Such oligonucleotide probes are preferably modified oligonucleotides that are resistant to endogenous nucleases, e.g., exonucleases and/or endonucleases, and are therefore stable in vivo. Exemplary nucleic acid molecules for use as small nucleic acids and/or antisense oligonucleotides are phosphoramidate, phosphothioate and methylphosphonate analogs of DNA (see also U.S. Patents 5,176,996; 5,264,564; and 5,256,775). Additionally, general approaches to constructing oligomers useful in antisense therapy have been reviewed, for example, by Van der Krol et al. (1988) BioTechniques 6:958-976; and Stein et al. (1988) Cancer Res 48:2659-2668.
Antisense approaches may involve the design of oligonucleotides (either DNA or RNA) that are complementary to cellular nucleic acids (e.g., complementary to biomarkers listed in Table 1). Absolute complementarity is not required. In the case of double- stranded antisense nucleic acids, a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed. The ability to hybridize will depend on both the degree of complementarity and the length of the antisense nucleic acid. Generally, the longer the hybridizing nucleic acid, the more base mismatches with a nucleic acid (e.g., RNA) it may contain and still form a stable duplex (or triplex, as the case may be). One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex.
Oligonucleotides that are complementary to the 5' end of the mRNA, e.g., the 5' untranslated sequence up to and including the AUG initiation codon, should work most efficiently at inhibiting translation. However, sequences complementary to the 3' untranslated sequences of mRNAs have recently been shown to be effective at inhibiting translation of mRNAs as well (Wagner (1994) Nature 372:333). Therefore,
oligonucleotides complementary to either the 5' or 3' untranslated, non-coding regions of genes could be used in an antisense approach to inhibit translation of endogenous mRNAs. Oligonucleotides complementary to the 5' untranslated region of the mRNA may include the complement of the AUG start codon. Antisense oligonucleotides complementary to mRNA coding regions are less efficient inhibitors of translation but could also be used in accordance with the methods and compositions presented herein. Whether designed to hybridize to the 5', 3' or coding region of cellular mRNAs, small nucleic acids and/or antisense nucleic acids should be at least six nucleotides in length, and can be less than about 1000, 900, 800, 700, 600, 500, 400, 300, 200, 100, 50, 40, 30, 25, 24, 23, 22, 21,20, 19, 18, 17, 16, 15, or 10 nucleotides in length.
Regardless of the choice of target sequence, it is preferred that in vitro studies are first performed to quantitate the ability of the antisense oligonucleotide to inhibit gene expression. In one embodiment these studies utilize controls that distinguish between antisense gene inhibition and nonspecific biological effects of oligonucleotides. In another embodiment these studies compare levels of the target nucleic acid or protein with that of an internal control nucleic acid or protein. Additionally, it is envisioned that results obtained using the antisense oligonucleotide are compared with those obtained using a control oligonucleotide. It is preferred that the control oligonucleotide is of approximately
the same length as the test oligonucleotide and that the nucleotide sequence of the oligonucleotide differs from the antisense sequence no more than is necessary to prevent specific hybridization to the target sequence.
Small nucleic acids and/or antisense oligonucleotides can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single-stranded or double- stranded. Small nucleic acids and/or antisense oligonucleotides can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, hybridization, etc., and may include other appended groups such as peptides (e.g., for targeting host cell receptors), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al. (1989) Proc. Natl. Acad. Sci. U.S.A. 86:6553-6556; Lemaitre et al. (1987) Proc. Natl. Acad. Sci. U.S.A. 84:648-652; PCT Publication No. W088/09810) or the blood-brain barrier (see, e.g., PCT Publication No. W089/10134), hybridization-triggered cleavage agents. (See, e.g., Krol et al. (1988) BioTech. 6:958-976) or intercalating agents. (See, e.g., Zon (1988) Pharm. Res. 5:539-549). To this end, small nucleic acids and/or antisense oligonucleotides may be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization- triggered cleavage agent, etc.
Small nucleic acids and/or antisense oligonucleotides may comprise at least one modified base moiety which is selected from the group including but not limited to 5- fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xantine, 4- acetylcytosine, 5-(carboxyhydroxytiethyl) uracil, 5-carboxymethylaminomethyl-2- thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta- D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6- isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5- oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino- 3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine. Small nucleic acids and/or antisense oligonucleotides may also comprise at least one modified sugar moiety selected from the group including but not limited to arabinose, 2-fluoroarabinose, xylulose, and hexose.
In certain embodiments, a compound comprises an oligonucleotide (e.g., a miRNA or miRNA encoding oligonucleotide) conjugated to one or more moieties which enhance the activity, cellular distribution or cellular uptake of the resulting oligonucleotide. In certain such embodiments, the moiety is a cholesterol moiety (e.g., antagomirs) or a lipid moiety or liposome conjugate. Additional moieties for conjugation include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. In certain embodiments, a conjugate group is attached directly to the oligonucleotide. In certain embodiments, a conjugate group is attached to the oligonucleotide by a linking moiety selected from amino, hydroxyl, carboxylic acid, thiol, unsaturations (e.g., double or triple bonds), 8-amino-3,6- dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidom ethyl) cyclohexane-1- carboxylate (SMCC), 6-aminohexanoic acid (AHEX or AHA), substituted CI -CIO alkyl, substituted or unsubstituted C2-C10 alkenyl, and substituted or unsubstituted C2-C 10 alkynyl. In certain such embodiments, a substituent group is selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.
In certain such embodiments, the compound comprises the oligonucleotide having one or more stabilizing groups that are attached to one or both termini of the
oligonucleotide to enhance properties such as, for example, nuclease stability. Included in stabilizing groups are cap structures. These terminal modifications protect the
oligonucleotide from exonuclease degradation, and can help in delivery and/or localization within a cell. The cap can be present at the 5'-terminus (5'-cap), or at the 3'-terminus (3'- cap), or can be present on both termini. Cap structures include, for example, inverted deoxy abasic caps.
Suitable cap structures include a 4',5'-methylene nucleotide, a l-(beta-D- erythrofuranosyl) nucleotide, a 4'-thio nucleotide, a carbocyclic nucleotide, a 1,5- anhydrohexitol nucleotide, an L-nucleotide, an alpha-nucleotide, a modified base nucleotide, a phosphorodithioate linkage, a threo-pentofuranosyl nucleotide, an acyclic 3',4'-seco nucleotide, an acyclic 3,4-dihydroxybutyl nucleotide, an acyclic 3,5- dihydroxypentyl nucleotide, a 3 '-3 '-inverted nucleotide moiety, a 3 '-3 '-inverted abasic moiety, a 3'-2'-inverted nucleotide moiety, a 3'-2'-inverted abasic moiety, a 1,4-butanediol phosphate, a 3'-phosphoramidate, a hexylphosphate, an aminohexyl phosphate, a 3'- phosphate, a 3'-phosphorothioate, a phosphorodithioate, a bridging methylphosphonate
moiety, and a non-bridging methylphosphonate moiety 5'-amino-alkyl phosphate, a 1,3- diamino-2-propyl phosphate, 3-aminopropyl phosphate, a 6-aminohexyl phosphate, a 1,2- aminododecyl phosphate, a hydroxypropyl phosphate, a 5'-5'-inverted nucleotide moiety, a 5'-5'-inverted abasic moiety, a 5'-phosphoramidate, a 5'-phosphorothioate, a 5'-amino, a bridging and/or non-bridging 5'-phosphoramidate, a phosphorothioate, and a 5'-mercapto moiety.
Small nucleic acids and/or antisense oligonucleotides can also contain a neutral peptide-like backbone. Such molecules are termed peptide nucleic acid (PNA)-oligomers and are described, e.g., in Perry-O'Keefe et al. (1996) Proc. Natl. Acad. Sci. U.S.A.
93 : 14670 and in Eglom et al. (1993) Nature 365:566. One advantage of PNA oligomers is their capability to bind to complementary DNA essentially independently from the ionic strength of the medium due to the neutral backbone of the DNA. In yet another
embodiment, small nucleic acids and/or antisense oligonucleotides comprises at least one modified phosphate backbone selected from the group consisting of a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof.
In a further embodiment, small nucleic acids and/or antisense oligonucleotides are a-anomeric oligonucleotides. An a-anomeric oligonucleotide forms specific double- stranded hybrids with complementary RNA in which, contrary to the usual b-units, the strands run parallel to each other (Gautier et al. (1987) Nucl. Acids Res. 15:6625-6641). The oligonucleotide is a 2'-0-methylribonucleotide (Inoue et al. (1987) Nucl. Acids Res. 15:6131-6148), or a chimeric RNA-DNA analogue (Inoue et al. (1987) FEBS Lett.
215:327-330).
Small nucleic acids and/or antisense oligonucleotides of the methods and compositions presented herein may be synthesized by standard methods known in the art, e.g., by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosystems, etc.). As examples, phosphorothioate oligonucleotides may be synthesized by the method of Stein et al. (1988) Nucl. Acids Res. 16:3209, methylphosphonate oligonucleotides can be prepared by use of controlled pore glass polymer supports (Sarin et al. (1988) Proc. Natl. Acad. Sci. U.S.A. 85:7448-7451), etc. For example, an isolated miRNA can be chemically synthesized or recombinantly produced using methods known in the art. In some instances, miRNA are chemically synthesized using appropriately protected ribonucleoside phosphoramidites and a conventional
DNA/RNA synthesizer. Commercial suppliers of synthetic RNA molecules or synthesis reagents include, e.g., Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, Colo., USA), Pierce Chemical (part of Perbio Science, Rockford, 111., USA), Glen Research (Sterling, Va., USA), Chem Genes (Ashland, Mass., USA), Cruachem (Glasgow, UK), and Exiqon (Vedbaek, Denmark).
Small nucleic acids and/or antisense oligonucleotides can be delivered to cells in vivo. A number of methods have been developed for delivering small nucleic acids and/or antisense oligonucleotides DNA or RNA to cells; e.g., antisense molecules can be injected directly into the tissue site, or modified antisense molecules, designed to target the desired cells {e.g., antisense linked to peptides or antibodies that specifically bind receptors or antigens expressed on the target cell surface) can be administered systematically.
In one embodiment, small nucleic acids and/or antisense oligonucleotides may comprise or be generated from double stranded small interfering RNAs (siRNAs), in which sequences fully complementary to cellular nucleic acids {e.g. mRNAs) sequences mediate degradation or in which sequences incompletely complementary to cellular nucleic acids {e.g., mRNAs) mediate translational repression when expressed within cells, or piwiRNAs. In another embodiment, double stranded siRNAs can be processed into single stranded antisense RNAs that bind single stranded cellular RNAs {e.g., microRNAs) and inhibit their expression. RNA interference (RNAi) is the process of sequence-specific, post- transcriptional gene silencing in animals and plants, initiated by double-stranded RNA (dsRNA) that is homologous in sequence to the silenced gene, in vivo, long dsRNA is cleaved by ribonuclease III to generate 21- and 22-nucleotide siRNAs. It has been shown that 21 -nucleotide siRNA duplexes specifically suppress expression of endogenous and heterologous genes in different mammalian cell lines, including human embryonic kidney (293) and HeLa cells (Elbashir et al. (2001) Nature 411 :494-498). Accordingly, translation of a gene in a cell can be inhibited by contacting the cell with short double stranded RNAs having a length of about 15 to 30 nucleotides or of about 18 to 21 nucleotides or of about 19 to 21 nucleotides. Alternatively, a vector encoding for such siRNAs or short hairpin RNAs (shRNAs) that are metabolized into siRNAs can be introduced into a target cell (see, e.g., McManus et al. (2002) RNA 8:842; Xia et al. (2002) Nat. Biotechnol. 20: 1006; and Brummelkamp et al. (2002) Science 296:550). Vectors that can be used are commercially available, e.g., from OligoEngine under the name pSuper RNAi System™
Ribozyme molecules designed to catalytically cleave cellular mRNA transcripts can also be used to prevent translation of cellular mRNAs and expression of cellular polypeptides, or both (See, e.g., PCT International Publication WO90/11364, published October 4, 1990; Sarver et al. (1990) Science 247: 1222-1225 and U.S. Patent No.
5,093,246). While ribozymes that cleave mRNA at site specific recognition sequences can be used to destroy cellular mRNAs, the use of hammerhead ribozymes is preferred.
Hammerhead ribozymes cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target mRNA. The sole requirement is that the target mRNA have the following sequence of two bases: 5'-UG-3' . The construction and production of hammerhead ribozymes is well-known in the art and is described more fully in Haseloff and Gerlach (1988) Nature 334:585-591. The ribozyme may be engineered so that the cleavage recognition site is located near the 5' end of cellular mRNAs; i.e., to increase efficiency and minimize the intracellular accumulation of non-functional mRNA transcripts.
The ribozymes of the methods presented herein also include RNA
endoribonucleases (hereinafter "Cech-type ribozymes") such as the one which occurs naturally in Tetrahymena thermophila (known as the IVS, or L-19 IVS RNA) and which has been extensively described by Thomas Cech and collaborators (Zaug et al. (1984) Science 224:574-578; Zaug et al. (1986) Science 231 :470-475; Zaug et al. (1986) Nature 324:429-433; WO 88/04300; and Been et al. (1986) Cell 47:207-216). The Cech-type ribozymes have an eight base pair active site which hybridizes to a target RNA sequence whereafter cleavage of the target RNA takes place. The methods and compositions presented herein encompasses those Cech-type ribozymes which target eight base-pair active site sequences that are present in cellular genes.
As in the antisense approach, the ribozymes can be composed of modified oligonucleotides {e.g., for improved stability, targeting, etc.). A preferred method of delivery involves using a DNA construct "encoding" the ribozyme under the control of a strong constitutive pol III or pol II promoter, so that transfected cells will produce sufficient quantities of the ribozyme to destroy endogenous cellular messages and inhibit translation. Because ribozymes unlike antisense molecules, are catalytic, a lower intracellular concentration is required for efficiency.
Nucleic acid molecules to be used in triple helix formation for the inhibition of transcription of cellular genes are preferably single stranded and composed of
deoxyribonucleotides. The base composition of these oligonucleotides should promote triple helix formation via Hoogsteen base pairing rules, which generally require sizable stretches of either purines or pyrimidines to be present on one strand of a duplex.
Nucleotide sequences may be pyrimidine-based, which will result in TAT and CGC triplets across the three associated strands of the resulting triple helix. The pyrimidine-rich molecules provide base complementarity to a purine-rich region of a single strand of the duplex in a parallel orientation to that strand. In addition, nucleic acid molecules may be chosen that are purine-rich, for example, containing a stretch of G residues. These molecules will form a triple helix with a DNA duplex that is rich in GC pairs, in which the majority of the purine residues are located on a single strand of the targeted duplex, resulting in CGC triplets across the three strands in the triplex.
Alternatively, the potential sequences that can be targeted for triple helix formation may be increased by creating a so called "switchback" nucleic acid molecule. Switchback molecules are synthesized in an alternating 5'-3', 3'-5' manner, such that they base pair with first one strand of a duplex and then the other, eliminating the necessity for a sizable stretch of either purines or pyrimidines to be present on one strand of a duplex.
Small nucleic acids (e.g., miRNAs, pre-miRNAs, pri-miRNAs, miRNA*, anti- miRNA, or a miRNA binding site, or a variant thereof), antisense oligonucleotides, ribozymes, and triple helix molecules of the methods and compositions presented herein may be prepared by any method known in the art for the synthesis of DNA and RNA molecules. These include techniques for chemically synthesizing
oligodeoxyribonucleotides and oligoribonucleotides well-known in the art such as for example solid phase phosphoramidite chemical synthesis. Alternatively, RNA molecules may be generated by in vitro and in vivo transcription of DNA sequences encoding the antisense RNA molecule. Such DNA sequences may be incorporated into a wide variety of vectors which incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters. Alternatively, antisense cDNA constructs that synthesize antisense RNA constitutively or inducibly, depending on the promoter used, can be introduced stably into cell lines.
Moreover, various well-known modifications to nucleic acid molecules may be introduced as a means of increasing intracellular stability and half-life. Possible modifications include but are not limited to the addition of flanking sequences of ribonucleotides or deoxyribonucleotides to the 5' and/or 3' ends of the molecule or the use
of phosphorothioate or 2' O-methyl rather than phosphodiesterase linkages within the oligodeoxyribonucleotide backbone. One of skill in the art will readily understand that polypeptides, small nucleic acids, and antisense oligonucleotides can be further linked to another peptide or polypeptide (e.g., a heterologous peptide), e.g., that serves as a means of protein detection. Non-limiting examples of label peptide or polypeptide moieties useful for detection in the invention include, without limitation, suitable enzymes such as horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase; epitope tags, such as FLAG, MYC, HA, or HIS tags; fluorophores such as green fluorescent protein; dyes; radioisotopes; digoxygenin; biotin; antibodies; polymers; as well as others known in the art, for example, in Principles of Fluorescence Spectroscopy, Joseph R.
Lakowicz (Editor), Plenum Pub Corp, 2nd edition (July 1999).
The modulatory agents described herein (e.g., antibodies, small molecules, peptides, fusion proteins, or small nucleic acids) can be incorporated into pharmaceutical
compositions and administered to a subject in vivo. The compositions may contain a single such molecule or agent or any combination of agents described herein. "Single active agents" described herein can be combined with other pharmacologically active compounds ("second active agents") known in the art according to the methods and compositions provided herein.
The production and use of biomarker nucleic acid and/or biomarker polypeptide molecules described herein can be facilitated by using standard recombinant techniques. In some embodiments, such techniques use vectors, preferably expression vectors, containing a nucleic acid encoding a biomarker polypeptide or a portion of such a polypeptide. As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid", which refers to a circular double stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors, namely expression vectors, are capable of directing the expression of genes to which they are operably linked. In general, expression vectors of utility in recombinant DNA
techniques are often in the form of plasmids (vectors). However, the present invention is intended to include such other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses), which serve equivalent functions.
The recombinant expression vectors of the present invention comprise a nucleic acid of the present invention in a form suitable for expression of the nucleic acid in a host cell. This means that the recombinant expression vectors include one or more regulatory sequences, selected on the basis of the host cells to be used for expression, which is operably linked to the nucleic acid sequence to be expressed. Within a recombinant expression vector, "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the regulatory sequence(s) in a manner which allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell). The term "regulatory sequence" is intended to include promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are described, for example, in
Goeddel, Methods in Enzymology: Gene Expression Technology vol.185, Academic Press, San Diego, CA (1991). Regulatory sequences include those which direct constitutive expression of a nucleotide sequence in many types of host cell and those which direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, and the like. The expression vectors of the present invention can be introduced into host cells to thereby produce proteins or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein.
The recombinant expression vectors for use in the present invention can be designed for expression of a polypeptide corresponding to a marker of the present invention in prokaryotic (e.g., E. coli) or eukaryotic cells (e.g., insect cells {using baculovirus expression vectors}, yeast cells or mammalian cells). Suitable host cells are discussed further in Goeddel, supra. Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.
Expression of proteins in prokaryotes is most often carried out in E. coli with vectors containing constitutive or inducible promoters directing the expression of either fusion or non-fusion proteins. Fusion vectors add a number of amino acids to a protein encoded therein, usually to the amino terminus of the recombinant protein. Such fusion vectors typically serve three purposes: 1) to increase expression of recombinant protein; 2) to increase the solubility of the recombinant protein; and 3) to aid in the purification of the recombinant protein by acting as a ligand in affinity purification. Often, in fusion expression vectors, a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to enable separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein. Such enzymes, and their cognate recognition sequences, include Factor Xa, thrombin and enterokinase. Typical fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith and Johnson, 1988, Gene 67:31-40), pMAL (New England Biolabs, Beverly, MA) and pRIT5 (Pharmacia, Piscataway, NJ) which fuse glutathione S-transferase (GST), maltose E binding protein, or protein A, respectively, to the target recombinant protein.
Examples of suitable inducible non-fusion E. coli expression vectors include pTrc (Amann et a/., 1988, Gene 69:301-315) and pET l id (Studier et al., p. 60-89, In Gene Expression Technology: Methods in Enzymology vol.185, Academic Press, San Diego, CA, 1991). Target biomarker nucleic acid expression from the pTrc vector relies on host RNA polymerase transcription from a hybrid trp-lac fusion promoter. Target biomarker nucleic acid expression from the pET l id vector relies on transcription from a T7 gnlO-lac fusion promoter mediated by a co-expressed viral RNA polymerase (T7 gnl). This viral polymerase is supplied by host strains BL21 (DE3) or HMS174(DE3) from a resident prophage harboring a T7 gnl gene under the transcriptional control of the lacUV 5 promoter.
One strategy to maximize recombinant protein expression in E. coli is to express the protein in a host bacterium with an impaired capacity to proteolytically cleave the recombinant protein (Gottesman, p. 119-128, In Gene Expression Technology: Methods in Enzymology vol. 185, Academic Press, San Diego, CA, 1990. Another strategy is to alter the nucleic acid sequence of the nucleic acid to be inserted into an expression vector so that the individual codons for each amino acid are those preferentially utilized in E. coli (Wada et al, 1992, Nucleic Acids Res. 20:2111-2118). Such alteration of nucleic acid sequences of the present invention can be carried out by standard DNA synthesis techniques.
In another embodiment, the expression vector is a yeast expression vector.
Examples of vectors for expression in yeast S. cerevisiae include pYepSecl (Baldari et al, 1987, EMBO J. 6:229-234), pMFa (Kurjan and Herskowitz, 1982, Cell 30:933-943), pJRY88 (Schultz et al, 1987, Gene 54: 113-123), pYES2 (Invitrogen Corporation, San Diego, CA), and pPicZ (Invitrogen Corp, San Diego, CA).
Alternatively, the expression vector is a baculovirus expression vector. Baculovirus vectors available for expression of proteins in cultured insect cells {e.g., Sf 9 cells) include the pAc series (Smith et al, 1983, Mol. Cell Biol. 3 :2156-2165) and the pVL series (Lucklow and Summers, 1989, Virology 170:31-39).
In yet another embodiment, a nucleic acid of the present invention is expressed in mammalian cells using a mammalian expression vector. Examples of mammalian expression vectors include pCDM8 (Seed, 1987, Nature 329:840) and pMT2PC (Kaufman et al, 1987, EMBO J. 6: 187-195). When used in mammalian cells, the expression vector's control functions are often provided by viral regulatory elements. For example, commonly used promoters are derived from polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40. For other suitable expression systems for both prokaryotic and eukaryotic cells see chapters 16 and 17 of Sambrook et al, supra.
In another embodiment, the recombinant mammalian expression vector is capable of directing expression of the nucleic acid preferentially in a particular cell type {e.g., tissue- specific regulatory elements are used to express the nucleic acid). Tissue-specific regulatory elements are known in the art. Non-limiting examples of suitable tissue-specific promoters include the albumin promoter (liver-specific; Pinkert et al, 1987, Genes Dev. 1 :268-277), lymphoid-specific promoters (Calame and Eaton, 1988, Adv. Immunol. 43 :235- 275), in particular promoters of T cell receptors (Winoto and Baltimore, 1989, EMBO J. 8:729-733) and immunoglobulins (Banerji et al, 1983, Cell 33 :729-740; Queen and Baltimore, 1983, Cell 33 :741-748), neuron-specific promoters {e.g., the neurofilament promoter; Byrne and Ruddle, 1989, Proc. Natl. Acad. Sci. USA 86:5473-5477), pancreas- specific promoters (Edlund et al, 1985, Science 230:912-916), and mammary gland- specific promoters {e.g., milk whey promoter; U.S. Patent No. 4,873,316 and European Application Publication No. 264,166). Developmentally-regulated promoters are also encompassed, for example the murine hox promoters (Kessel and Gruss, 1990, Science 249:374-379) and the a-fetoprotein promoter (Camper and Tilghman, 1989, Genes Dev. 3 :537-546).
The present invention further provides a recombinant expression vector comprising a DNA molecule cloned into the expression vector in an antisense orientation. That is, the DNA molecule is operably linked to a regulatory sequence in a manner which allows for expression (by transcription of the DNA molecule) of an RNA molecule which is antisense to the mRNA encoding a polypeptide of the present invention. Regulatory sequences operably linked to a nucleic acid cloned in the antisense orientation can be chosen which direct the continuous expression of the antisense RNA molecule in a variety of cell types, for instance viral promoters and/or enhancers, or regulatory sequences can be chosen which direct constitutive, tissue-specific or cell type specific expression of antisense RNA. The antisense expression vector can be in the form of a recombinant plasmid, phagemid, or attenuated virus in which antisense nucleic acids are produced under the control of a high efficiency regulatory region, the activity of which can be determined by the cell type into which the vector is introduced. For a discussion of the regulation of gene expression using antisense genes (see Weintraub et al, 1986, Trends in Genetics, Vol. 1(1)).
Another aspect of the present invention pertains to host cells into which a recombinant expression vector of the present invention has been introduced. The terms "host cell" and "recombinant host cell" are used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.
A host cell can be any prokaryotic {e.g., E. coli) or eukaryotic cell {e.g., insect cells, yeast or mammalian cells).
Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. As used herein, the terms "transformation" and "transfection" are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid into a host cell, including calcium phosphate or calcium chloride co- precipitation, DEAE-dextran-mediated transfection, lipofection, or electroporation.
Suitable methods for transforming or transfecting host cells can be found in Sambrook, et al. {supra), and other laboratory manuals.
For stable transfection of mammalian cells, it is known that, depending upon the expression vector and transfection technique used, only a small fraction of cells may integrate the foreign DNA into their genome. In order to identify and select these
integrants, a gene that encodes a selectable marker (e.g., for resistance to antibiotics) is generally introduced into the host cells along with the gene of interest. Preferred selectable markers include those which confer resistance to drugs, such as G418, hygromycin and methotrexate. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells that have incorporated the selectable marker gene will survive, while the other cells die).
V. Analyzing Biomarker Nucleic Acids and Polypeptides
Biomarker nucleic acids and/or biomarker polypeptides can be analyzed according to the methods described herein and techniques known to the skilled artisan to identify such genetic or expression alterations useful for the present invention including, but not limited to, 1) an alteration in the level of a biomarker transcript or polypeptide, 2) a deletion or addition of one or more nucleotides from a biomarker gene, 4) a substitution of one or more nucleotides of a biomarker gene, 5) aberrant modification of a biomarker gene, such as an expression regulatory region, and the like.
a. Methods for Detection of Copy Number
Methods of evaluating the copy number of a biomarker nucleic acid are well-known to those of skill in the art. The presence or absence of chromosomal gain or loss can be evaluated simply by a determination of copy number of the regions or markers identified herein.
In one embodiment, a biological sample is tested for the presence of copy number changes in genomic loci containing the genomic marker. A copy number of at least 3, 4, 5, 6, 7, 8, 9, or 10 is predictive of poorer outcome of biomarker inhibitor and immunotherapy combination treatments.
Methods of evaluating the copy number of a biomarker locus include, but are not limited to, hybridization-based assays. Hybridization-based assays include, but are not limited to, traditional "direct probe" methods, such as Southern blots, in situ hybridization (e.g., FISH and FISH plus SKY) methods, and "comparative probe" methods, such as comparative genomic hybridization (CGH), e.g., cDNA-based or oligonucleotide-based CGH. The methods can be used in a wide variety of formats including, but not limited to, substrate (e.g. membrane or glass) bound methods or array-based approaches.
In one embodiment, evaluating the biomarker gene copy number in a sample involves a Southern Blot. In a Southern Blot, the genomic DNA (typically fragmented and
separated on an electrophoretic gel) is hybridized to a probe specific for the target region. Comparison of the intensity of the hybridization signal from the probe for the target region with control probe signal from analysis of normal genomic DNA (e.g., a non-amplified portion of the same or related cell, tissue, organ, etc.) provides an estimate of the relative copy number of the target nucleic acid. Alternatively, a Northern blot may be utilized for evaluating the copy number of encoding nucleic acid in a sample. In a Northern blot, mRNA is hybridized to a probe specific for the target region. Comparison of the intensity of the hybridization signal from the probe for the target region with control probe signal from analysis of normal RNA (e.g., a non-amplified portion of the same or related cell, tissue, organ, etc.) provides an estimate of the relative copy number of the target nucleic acid. Alternatively, other methods well-known in the art to detect RNA can be used, such that higher or lower expression relative to an appropriate control (e.g., a non-amplified portion of the same or related cell tissue, organ, etc.) provides an estimate of the relative copy number of the target nucleic acid.
An alternative means for determining genomic copy number is in situ hybridization
(e.g., Angerer (1987) et/z. Enzymol 152: 649). Generally, in situ hybridization comprises the following steps: (1) fixation of tissue or biological structure to be analyzed; (2) prehybridization treatment of the biological structure to increase accessibility of target DNA, and to reduce nonspecific binding; (3) hybridization of the mixture of nucleic acids to the nucleic acid in the biological structure or tissue; (4) post-hybridization washes to remove nucleic acid fragments not bound in the hybridization and (5) detection of the hybridized nucleic acid fragments. The reagent used in each of these steps and the conditions for use vary depending on the particular application. In a typical in situ hybridization assay, cells are fixed to a solid support, typically a glass slide. If a nucleic acid is to be probed, the cells are typically denatured with heat or alkali. The cells are then contacted with a hybridization solution at a moderate temperature to permit annealing of labeled probes specific to the nucleic acid sequence encoding the protein. The targets (e.g., cells) are then typically washed at a predetermined stringency or at an increasing stringency until an appropriate signal to noise ratio is obtained. The probes are typically labeled, e.g., with radioisotopes or fluorescent reporters. In one embodiment, probes are sufficiently long so as to specifically hybridize with the target nucleic acid(s) under stringent conditions. Probes generally range in length from about 200 bases to about 1000 bases. In some applications it is necessary to block the hybridization capacity of repetitive sequences.
Thus, in some embodiments, tRNA, human genomic DNA, or Cot-I DNA is used to block non-specific hybridization.
An alternative means for determining genomic copy number is comparative genomic hybridization. In general, genomic DNA is isolated from normal reference cells, as well as from test cells (e.g., tumor cells) and amplified, if necessary. The two nucleic acids are differentially labeled and then hybridized in situ to metaphase chromosomes of a reference cell. The repetitive sequences in both the reference and test DNAs are either removed or their hybridization capacity is reduced by some means, for example by prehybridization with appropriate blocking nucleic acids and/or including such blocking nucleic acid sequences for said repetitive sequences during said hybridization. The bound, labeled DNA sequences are then rendered in a visualizable form, if necessary.
Chromosomal regions in the test cells which are at increased or decreased copy number can be identified by detecting regions where the ratio of signal from the two DNAs is altered. For example, those regions that have decreased in copy number in the test cells will show relatively lower signal from the test DNA than the reference compared to other regions of the genome. Regions that have been increased in copy number in the test cells will show relatively higher signal from the test DNA. Where there are chromosomal deletions or multiplications, differences in the ratio of the signals from the two labels will be detected and the ratio will provide a measure of the copy number. In another embodiment of CGH, array CGH (aCGH), the immobilized chromosome element is replaced with a collection of solid support bound target nucleic acids on an array, allowing for a large or complete percentage of the genome to be represented in the collection of solid support bound targets. Target nucleic acids may comprise cDNAs, genomic DNAs, oligonucleotides {e.g., to detect single nucleotide polymorphisms) and the like. Array-based CGH may also be performed with single-color labeling (as opposed to labeling the control and the possible tumor sample with two different dyes and mixing them prior to hybridization, which will yield a ratio due to competitive hybridization of probes on the arrays). In single color CGH, the control is labeled and hybridized to one array and absolute signals are read, and the possible tumor sample is labeled and hybridized to a second array (with identical content) and absolute signals are read. Copy number difference is calculated based on absolute signals from the two arrays. Methods of preparing immobilized chromosomes or arrays and performing comparative genomic hybridization are well-known in the art (see, e.g., U.S. Pat. Nos: 6,335,167; 6,197,501; 5,830,645; and 5,665,549 and Albertson (1984)
EMBO J. 3 : 1227-1234; Pinkel (1988) Proc. Natl. Acad. Sci. USA 85: 9138-9142; EPO Pub. No. 430,402; Methods in Molecular Biology, Vol. 33 : In situ Hybridization Protocols, Choo, ed., Humana Press, Totowa, N.J. (1994), etc.) In another embodiment, the hybridization protocol of Pinkel, et al. (1998) Nature Genetics 20: 207-211, or of
Kallioniemi (1992) Proc. Natl Acad Sci USA 89:5321-5325 (1992) is used.
In still another embodiment, amplification-based assays can be used to measure copy number. In such amplification-based assays, the nucleic acid sequences act as a template in an amplification reaction (e.g., Polymerase Chain Reaction (PCR). In a quantitative amplification, the amount of amplification product will be proportional to the amount of template in the original sample. Comparison to appropriate controls, e.g. healthy tissue, provides a measure of the copy number.
Methods of "quantitative" amplification are well-known to those of skill in the art. For example, quantitative PCR involves simultaneously co-amplifying a known quantity of a control sequence using the same primers. This provides an internal standard that may be used to calibrate the PCR reaction. Detailed protocols for quantitative PCR are provided in Innis, et al. (1990) PCR Protocols, A Guide to Methods and Applications, Academic Press, Inc. N.Y.). Measurement of DNA copy number at microsatellite loci using quantitative PCR analysis is described in Ginzonger, et al. (2000) Cancer Research 60:5405-5409. The known nucleic acid sequence for the genes is sufficient to enable one of skill in the art to routinely select primers to amplify any portion of the gene. Fluorogenic quantitative PCR may also be used in the methods of the present invention. In fluorogenic quantitative PCR, quantitation is based on amount of fluorescence signals, e.g., TaqMan and SYBR green.
Other suitable amplification methods include, but are not limited to, ligase chain reaction (LCR) (see Wu and Wallace (1989) Genomics 4: 560, Landegren, et al. (1988) Science 241 : 1077, and Barringer et al. (1990) Gene 89: 117), transcription amplification (Kwoh, et al. (1989) Proc. Natl. Acad. Sci. USA 86: 1173), self-sustained sequence replication (Guatelli, et al. (1990) Proc. Nat. Acad. Sci. USA 87: 1874), dot PCR, and linker adapter PCR, etc.
Loss of heterozygosity (LOH) and major copy proportion (MCP) mapping (Wang, Z.C., et al. (2004) Cancer Res 64(1):64-71; Seymour, A. B., et al. (1994) Cancer Res 54, 2761-4; Hahn, S. A., et al. (1995) Cancer Res 55, 4670-5; Kimura, M., et al. (1996) Genes Chromosomes Cancer 17, 88-93; Li et al, (2008) MBC Bioinform. 9, 204-219) may also be used to identify regions of amplification or deletion.
b. Methods for Detection of Biomarker Nucleic Acid Expression Biomarker expression may be assessed by any of a wide variety of well-known methods for detecting expression of a transcribed molecule or protein. Non-limiting examples of such methods include immunological methods for detection of secreted, cell- surface, cytoplasmic, or nuclear proteins, protein purification methods, protein function or activity assays, nucleic acid hybridization methods, nucleic acid reverse transcription methods, and nucleic acid amplification methods.
In preferred embodiments, activity of a particular gene is characterized by a measure of gene transcript (e.g. mRNA), by a measure of the quantity of translated protein, or by a measure of gene product activity. Marker expression can be monitored in a variety of ways, including by detecting mRNA levels, protein levels, or protein activity, any of which can be measured using standard techniques. Detection can involve quantification of the level of gene expression (e.g., genomic DNA, cDNA, mRNA, protein, or enzyme activity), or, alternatively, can be a qualitative assessment of the level of gene expression, in particular in comparison with a control level. The type of level being detected will be clear from the context.
In another embodiment, detecting or determining expression levels of a biomarker and functionally similar homologs thereof, including a fragment or genetic alteration thereof (e.g., in regulatory or promoter regions thereof) comprises detecting or determining RNA levels for the marker of interest. In one embodiment, one or more cells from the subject to be tested are obtained and RNA is isolated from the cells. In a preferred embodiment, a sample of breast tissue cells is obtained from the subject.
In one embodiment, RNA is obtained from a single cell. For example, a cell can be isolated from a tissue sample by laser capture microdissection (LCM). Using this technique, a cell can be isolated from a tissue section, including a stained tissue section, thereby assuring that the desired cell is isolated (see, e.g., Bonner et al. (1997) Science 278: 1481; Emmert-Buck et al. (1996) Science 274:998; Fend et al. (1999) Am. J. Path. 154: 61 and Murakami et al. (2000) Kidney Int. 58: 1346). For example, Murakami et al, supra, describe isolation of a cell from a previously immunostained tissue section.
It is also be possible to obtain cells from a subject and culture the cells in vitro, such as to obtain a larger population of cells from which RNA can be extracted. Methods for establishing cultures of non-transformed cells, i.e., primary cell cultures, are known in the art.
When isolating RNA from tissue samples or cells from individuals, it may be important to prevent any further changes in gene expression after the tissue or cells has been removed from the subject. Changes in expression levels are known to change rapidly following perturbations, e.g., heat shock or activation with lipopolysaccharide (LPS) or other reagents. In addition, the RNA in the tissue and cells may quickly become degraded. Accordingly, in a preferred embodiment, the tissue or cells obtained from a subject is snap frozen as soon as possible.
RNA can be extracted from the tissue sample by a variety of methods, e.g., the guanidium thiocyanate lysis followed by CsCl centrifugation (Chirgwin et al, 1979, Biochemistry 18:5294-5299). RNA from single cells can be obtained as described in methods for preparing cDNA libraries from single cells, such as those described in Dulac, C. (1998) Curr. Top. Dev. Biol. 36, 245 and Jena et al. (1996) J. Immunol. Methods 190: 199. Care to avoid RNA degradation must be taken, e.g., by inclusion of RNAsin.
The RNA sample can then be enriched in particular species. In one embodiment, poly(A)+ RNA is isolated from the RNA sample. In general, such purification takes advantage of the poly-A tails on mRNA. In particular and as noted above, poly-T oligonucleotides may be immobilized within on a solid support to serve as affinity ligands for mRNA. Kits for this purpose are commercially available, e.g., the MessageMaker kit (Life Technologies, Grand Island, NY).
In a preferred embodiment, the RNA population is enriched in marker sequences.
Enrichment can be undertaken, e.g., by primer-specific cDNA synthesis, or multiple rounds of linear amplification based on cDNA synthesis and template-directed in vitro
transcription {see, e.g., Wang et al. (1989) Proc. Natl. Acad. Sci. U.S.A. 86: 9717; Dulac et al, supra, and Jena et al, supra).
The population of RNA, enriched or not in particular species or sequences, can further be amplified. As defined herein, an "amplification process" is designed to strengthen, increase, or augment a molecule within the RNA. For example, where RNA is mRNA, an amplification process such as RT-PCR can be utilized to amplify the mRNA, such that a signal is detectable or detection is enhanced. Such an amplification process is beneficial particularly when the biological, tissue, or tumor sample is of a small size or volume.
Various amplification and detection methods can be used. For example, it is within the scope of the present invention to reverse transcribe mRNA into cDNA followed by
polymerase chain reaction (RT-PCR); or, to use a single enzyme for both steps as described in U.S. Pat. No. 5,322,770, or reverse transcribe mRNA into cDNA followed by symmetric gap ligase chain reaction (RT-AGLCR) as described by R. L. Marshall, et al, PCR
Methods and Applications 4: 80-84 (1994). Real time PCR may also be used.
Other known amplification methods which can be utilized herein include but are not limited to the so-called "NASBA" or "3SR" technique described in PNAS USA 87: 1874- 1878 (1990) and also described in Nature 350 (No. 6313): 91-92 (1991); Q-beta
amplification as described in published European Patent Application (EPA) No. 4544610; strand displacement amplification (as described in G. T. Walker et al., Clin. Chem. 42: 9-13 (1996) and European Patent Application No. 684315; target mediated amplification, as described by PCT Publication W09322461; PCR; ligase chain reaction (LCR) (see, e.g., Wu and Wallace, Genomics 4, 560 (1989), Landegren et al., Science 241, 1077 (1988)); self-sustained sequence replication (SSR) (see, e.g., Guatelli et al, Proc. Nat. Acad. Sci. USA, 87, 1874 (1990)); and transcription amplification (see, e.g., Kwoh et al, Proc. Natl. Acad. Sci. USA 86, 1173 (1989)).
Many techniques are known in the state of the art for determining absolute and relative levels of gene expression, commonly used techniques suitable for use in the present invention include Northern analysis, RNase protection assays (RPA), microarrays and PCR- based techniques, such as quantitative PCR and differential display PCR. For example, Northern blotting involves running a preparation of RNA on a denaturing agarose gel, and transferring it to a suitable support, such as activated cellulose, nitrocellulose or glass or nylon membranes. Radiolabeled cDNA or RNA is then hybridized to the preparation, washed and analyzed by autoradiography.
In situ hybridization visualization may also be employed, wherein a radioactively labeled antisense RNA probe is hybridized with a thin section of a biopsy sample, washed, cleaved with RNase and exposed to a sensitive emulsion for autoradiography. The samples may be stained with hematoxylin to demonstrate the histological composition of the sample, and dark field imaging with a suitable light filter shows the developed emulsion. Non-radioactive labels such as digoxigenin may also be used.
Alternatively, mRNA expression can be detected on a DNA array, chip or a microarray. Labeled nucleic acids of a test sample obtained from a subject may be hybridized to a solid surface comprising biomarker DNA. Positive hybridization signal is obtained with the sample containing biomarker transcripts. Methods of preparing DNA
arrays and their use are well-known in the art (see, e.g., U.S. Pat. Nos: 6,618,6796;
6,379,897; 6,664,377; 6,451,536; 548,257; U.S. 20030157485 and Schena et a/. (1995) Science 20, 467-470; Gerhold et al. (1999) Trends In Biochem. Sci. 24, 168-173; and Lennon et al. (2000) Drug Discovery Today 5, 59-65, which are herein incorporated by reference in their entirety). Serial Analysis of Gene Expression (SAGE) can also be performed (See for example U.S. Patent Application 20030215858).
To monitor mRNA levels, for example, mRNA is extracted from the biological sample to be tested, reverse transcribed, and fluorescently-labeled cDNA probes are generated. The microarrays capable of hybridizing to marker cDNA are then probed with the labeled cDNA probes, the slides scanned and fluorescence intensity measured. This intensity correlates with the hybridization intensity and expression levels.
Types of probes that can be used in the methods described herein include cDNA, riboprobes, synthetic oligonucleotides and genomic probes. The type of probe used will generally be dictated by the particular situation, such as riboprobes for in situ hybridization, and cDNA for Northern blotting, for example. In one embodiment, the probe is directed to nucleotide regions unique to the RNA. The probes may be as short as is required to differentially recognize marker mRNA transcripts, and may be as short as, for example, 15 bases; however, probes of at least 17, 18, 19 or 20 or more bases can be used. In one embodiment, the primers and probes hybridize specifically under stringent conditions to a DNA fragment having the nucleotide sequence corresponding to the marker. As herein used, the term "stringent conditions" means hybridization will occur only if there is at least 95% identity in nucleotide sequences. In another embodiment, hybridization under "stringent conditions" occurs when there is at least 97% identity between the sequences.
The form of labeling of the probes may be any that is appropriate, such as the use of radioisotopes, for example, 32P and 35S. Labeling with radioisotopes may be achieved, whether the probe is synthesized chemically or biologically, by the use of suitably labeled bases.
In one embodiment, the biological sample contains polypeptide molecules from the test subject. Alternatively, the biological sample can contain mRNA molecules from the test subject or genomic DNA molecules from the test subject.
In another embodiment, the methods further involve obtaining a control biological sample from a control subject, contacting the control sample with a compound or agent capable of detecting marker polypeptide, mRNA, genomic DNA, or fragments thereof, such
that the presence of the marker polypeptide, mRNA, genomic DNA, or fragments thereof, is detected in the biological sample, and comparing the presence of the marker polypeptide, mRNA, genomic DNA, or fragments thereof, in the control sample with the presence of the marker polypeptide, mRNA, genomic DNA, or fragments thereof in the test sample.
c. Methods for Detection of Biomarker Protein Expression
The activity or level of a biomarker protein can be detected and/or quantified by detecting or quantifying the expressed polypeptide. The polypeptide can be detected and quantified by any of a number of means well-known to those of skill in the art. Aberrant levels of polypeptide expression of the polypeptides encoded by a biomarker nucleic acid and functionally similar homologs thereof, including a fragment or genetic alteration thereof (e.g., in regulatory or promoter regions thereof) are associated with the likelihood of response of a cancer to biomarker inhibitor and immunotherapy combination treatments. Any method known in the art for detecting polypeptides can be used. Such methods include, but are not limited to, immunodiffusion, Immunoelectrophoresis,
radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISAs),
immunofluorescent assays, Western blotting, binder-ligand assays, immunohistochemical techniques, agglutination, complement assays, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, and the like (e.g., Basic and Clinical Immunology, Sites and Terr, eds., Appleton and Lange, Norwalk, Conn, pp 217-262, 1991 which is incorporated by reference). Preferred are binder-ligand immunoassay methods including reacting antibodies with an epitope or epitopes and competitively displacing a labeled polypeptide or derivative thereof.
For example, ELISA and RIA procedures may be conducted such that a desired biomarker protein standard is labeled (with a radioisotope such as 125I or 35S, or an assayable enzyme, such as horseradish peroxidase or alkaline phosphatase), and, together with the unlabeled sample, brought into contact with the corresponding antibody, whereon a second antibody is used to bind the first, and radioactivity or the immobilized enzyme assayed (competitive assay). Alternatively, the biomarker protein in the sample is allowed to react with the corresponding immobilized antibody, radioisotope- or enzyme-labeled anti-biomarker protein antibody is allowed to react with the system, and radioactivity or the enzyme assayed (ELISA-sandwich assay). Other conventional methods may also be employed as suitable.
The above techniques may be conducted essentially as a "one-step" or "two-step"
assay. A "one-step" assay involves contacting antigen with immobilized antibody and, without washing, contacting the mixture with labeled antibody. A "two-step" assay involves washing before contacting, the mixture with labeled antibody. Other conventional methods may also be employed as suitable.
In one embodiment, a method for measuring biomarker protein levels comprises the steps of: contacting a biological specimen with an antibody or variant (e.g., fragment) thereof which selectively binds the biomarker protein, and detecting whether said antibody or variant thereof is bound to said sample and thereby measuring the levels of the biomarker protein.
Enzymatic and radiolabeling of biomarker protein and/or the antibodies may be effected by conventional means. Such means will generally include covalent linking of the enzyme to the antigen or the antibody in question, such as by glutaraldehyde, specifically so as not to adversely affect the activity of the enzyme, by which is meant that the enzyme must still be capable of interacting with its substrate, although it is not necessary for all of the enzyme to be active, provided that enough remains active to permit the assay to be effected. Indeed, some techniques for binding enzyme are non-specific (such as using formaldehyde), and will only yield a proportion of active enzyme.
It is usually desirable to immobilize one component of the assay system on a support, thereby allowing other components of the system to be brought into contact with the component and readily removed without laborious and time-consuming labor. It is possible for a second phase to be immobilized away from the first, but one phase is usually sufficient.
It is possible to immobilize the enzyme itself on a support, but if solid-phase enzyme is required, then this is generally best achieved by binding to antibody and affixing the antibody to a support, models and systems for which are well-known in the art. Simple polyethylene may provide a suitable support.
Enzymes employable for labeling are not particularly limited, but may be selected from the members of the oxidase group, for example. These catalyze production of hydrogen peroxide by reaction with their substrates, and glucose oxidase is often used for its good stability, ease of availability and cheapness, as well as the ready availability of its substrate (glucose). Activity of the oxidase may be assayed by measuring the concentration of hydrogen peroxide formed after reaction of the enzyme-labeled antibody with the substrate under controlled conditions well-known in the art.
Other techniques may be used to detect biomarker protein according to a practitioner's preference based upon the present disclosure. One such technique is Western blotting (Towbin et at., Proc. Nat. Acad. Sci. 76:4350 (1979)), wherein a suitably treated sample is run on an SDS-PAGE gel before being transferred to a solid support, such as a nitrocellulose filter. Anti-biomarker protein antibodies (unlabeled) are then brought into contact with the support and assayed by a secondary immunological reagent, such as labeled protein A or anti-immunoglobulin (suitable labels including 125I, horseradish peroxidase and alkaline phosphatase). Chromatographic detection may also be used.
Immunohistochemistry may be used to detect expression of biomarker protein, e.g., in a biopsy sample. A suitable antibody is brought into contact with, for example, a thin layer of cells, washed, and then contacted with a second, labeled antibody. Labeling may be by fluorescent markers, enzymes, such as peroxidase, avidin, or radiolabeling. The assay is scored visually, using microscopy.
Anti-biomarker protein antibodies, such as intrabodies, may also be used for imaging purposes, for example, to detect the presence of biomarker protein in cells and tissues of a subject. Suitable labels include radioisotopes, iodine (125I, 121I), carbon (14C), sulphur (35S), tritium (3H), indium (112In), and technetium (99mTc), fluorescent labels, such as fluorescein and rhodamine, and biotin.
For in vivo imaging purposes, antibodies are not detectable, as such, from outside the body, and so must be labeled, or otherwise modified, to permit detection. Markers for this purpose may be any that do not substantially interfere with the antibody binding, but which allow external detection. Suitable markers may include those that may be detected by X-radiography, NMR or MRI. For X-radiographic techniques, suitable markers include any radioisotope that emits detectable radiation but that is not overtly harmful to the subject, such as barium or cesium, for example. Suitable markers for NMR and MRI generally include those with a detectable characteristic spin, such as deuterium, which may be incorporated into the antibody by suitable labeling of nutrients for the relevant hybridoma, for example.
The size of the subject, and the imaging system used, will determine the quantity of imaging moiety needed to produce diagnostic images. In the case of a radioisotope moiety, for a human subject, the quantity of radioactivity injected will normally range from about 5 to 20 millicuries of technetium-99. The labeled antibody or antibody fragment will then
preferentially accumulate at the location of cells which contain biomarker protein. The labeled antibody or antibody fragment can then be detected using known techniques.
Antibodies that may be used to detect biomarker protein include any antibody, whether natural or synthetic, full length or a fragment thereof, monoclonal or polyclonal, that binds sufficiently strongly and specifically to the biomarker protein to be detected. An antibody may have a Kd of at most about 10"6M, 10"7M, 10"8M, 10"9M, 1()-10Μ, 10_11Μ, 10" 12Μ. The phrase "specifically binds" refers to binding of, for example, an antibody to an epitope or antigen or antigenic determinant in such a manner that binding can be displaced or competed with a second preparation of identical or similar epitope, antigen or antigenic determinant. An antibody may bind preferentially to the biomarker protein relative to other proteins, such as related proteins.
Antibodies are commercially available or may be prepared according to methods known in the art.
Antibodies and derivatives thereof that may be used encompass polyclonal or monoclonal antibodies, chimeric, human, humanized, primatized (CDR-grafted), veneered or single-chain antibodies as well as functional fragments, i.e., biomarker protein binding fragments, of antibodies. For example, antibody fragments capable of binding to a biomarker protein or portions thereof, including, but not limited to, Fv, Fab, Fab' and F(ab') 2 fragments can be used. Such fragments can be produced by enzymatic cleavage or by recombinant techniques. For example, papain or pepsin cleavage can generate Fab or F(ab') 2 fragments, respectively. Other proteases with the requisite substrate specificity can also be used to generate Fab or F(ab') 2 fragments. Antibodies can also be produced in a variety of truncated forms using antibody genes in which one or more stop codons have been introduced upstream of the natural stop site. For example, a chimeric gene encoding a F(ab') 2 heavy chain portion can be designed to include DNA sequences encoding the CH, domain and hinge region of the heavy chain.
Synthetic and engineered antibodies are described in, e.g. , Cabilly et al, U. S. Pat. No. 4,816,567 Cabilly et al , European Patent No. 0, 125,023 B l ; Boss et al , U. S. Pat. No. 4,816,397; Boss et al , European Patent No. 0, 120,694 B l ; Neuberger, M. S. et al , WO 86/01533; Neuberger, M. S. et al , European Patent No. 0, 194,276 B l ; Winter, U. S. Pat. No. 5,225,539; Winter, European Patent No. 0,239,400 B l ; Queen et al, European Patent No. 0451216 B l ; and Padlan, E. A. et al , EP 0519596 Al . See also, Newman, R. et al, BioTechnology, 10: 1455-1460 (1992), regarding primatized antibody, and Ladner et al,
U.S. Pat. No. 4,946,778 and Bird, R. E. et al, Science, 242: 423-426 (1988)) regarding single-chain antibodies. Antibodies produced from a library, e.g., phage display library, may also be used.
In some embodiments, agents that specifically bind to a biomarker protein other than antibodies are used, such as peptides. Peptides that specifically bind to a biomarker protein can be identified by any means known in the art. For example, specific peptide binders of a biomarker protein can be screened for using peptide phage display libraries, d. Methods for Detection of Biomarker Structural Alterations
The following illustrative methods can be used to identify the presence of a structural alteration in a biomarker nucleic acid and/or biomarker polypeptide molecule in order to, for example, identify one or more biomarkers listed in Table 1 or other biomarkers used in the immunotherapies described herein that are overexpressed, overfunctional, and the like.
In certain embodiments, detection of the alteration involves the use of a
probe/primer in a polymerase chain reaction (PCR) (see, e.g., U.S. Pat. Nos. 4,683, 195 and 4,683,202), such as anchor PCR or RACE PCR, or, alternatively, in a ligation chain reaction (LCR) (see, e.g., Landegran et al. (1988) Science 241 : 1077-1080; and Nakazawa et al. (1994) Proc. Natl. Acad. Sci. USA 91 :360-364), the latter of which can be particularly useful for detecting point mutations in a biomarker nucleic acid such as a biomarker gene (see Abravaya et al. (1995) Nucleic Acids Res. 23 :675-682). This method can include the steps of collecting a sample of cells from a subject, isolating nucleic acid {e.g., genomic, mRNA or both) from the cells of the sample, contacting the nucleic acid sample with one or more primers which specifically hybridize to a biomarker gene under conditions such that hybridization and amplification of the biomarker gene (if present) occurs, and detecting the presence or absence of an amplification product, or detecting the size of the amplification product and comparing the length to a control sample. It is anticipated that PCR and/or LCR may be desirable to use as a preliminary amplification step in conjunction with any of the techniques used for detecting mutations described herein.
Alternative amplification methods include: self-sustained sequence replication (Guatelli, J. C. et al. (1990) Proc. Natl. Acad. Sci. USA 87: 1874-1878), transcriptional amplification system (Kwoh, D. Y. et al. (1989) Proc. Natl. Acad. Sci. USA 86: 1173-1177), Q-Beta Replicase (Lizardi, P. M. et al. (1988) Bio-Technology 6: 1197), or any other nucleic acid amplification method, followed by the detection of the amplified molecules
using techniques well-known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers.
In an alternative embodiment, mutations in a biomarker nucleic acid from a sample cell can be identified by alterations in restriction enzyme cleavage patterns. For example, sample and control DNA is isolated, amplified (optionally), digested with one or more restriction endonucleases, and fragment length sizes are determined by gel electrophoresis and compared. Differences in fragment length sizes between sample and control DNA indicates mutations in the sample DNA. Moreover, the use of sequence specific ribozymes (see, for example, U.S. Pat. No. 5,498,531) can be used to score for the presence of specific mutations by development or loss of a ribozyme cleavage site.
In other embodiments, genetic mutations in biomarker nucleic acid can be identified by hybridizing a sample and control nucleic acids, e.g., DNA or RNA, to high density arrays containing hundreds or thousands of oligonucleotide probes (Cronin, M. T. et al. (1996) Hum. Mutat. 7:244-255; Kozal, M. J. et al. (1996) Nat. Med. 2:753-759). For example, biomarker genetic mutations can be identified in two dimensional arrays containing light-generated DNA probes as described in Cronin et al. (1996) supra. Briefly, a first hybridization array of probes can be used to scan through long stretches of DNA in a sample and control to identify base changes between the sequences by making linear arrays of sequential, overlapping probes. This step allows the identification of point mutations. This step is followed by a second hybridization array that allows the characterization of specific mutations by using smaller, specialized probe arrays complementary to all variants or mutations detected. Each mutation array is composed of parallel probe sets, one complementary to the wild-type gene and the other complementary to the mutant gene. Such biomarker genetic mutations can be identified in a variety of contexts, including, for example, germline and somatic mutations.
In yet another embodiment, any of a variety of sequencing reactions known in the art can be used to directly sequence a biomarker gene and detect mutations by comparing the sequence of the sample biomarker with the corresponding wild-type (control) sequence. Examples of sequencing reactions include those based on techniques developed by Maxam and Gilbert (1977) Proc. Natl. Acad. Sci. USA 74:560 or Sanger (1977) Proc. Natl. Acad Sci. USA 74:5463. It is also contemplated that any of a variety of automated sequencing procedures can be utilized when performing the diagnostic assays (Naeve (1995)
Biotechniques 19:448-53), including sequencing by mass spectrometry (see, e.g., PCT International Publication No. WO 94/16101; Cohen et al. (1996) Adv. Chromatogr. 36: 127- 162; and Griffin et al. (1993) Appl. Biochem. Biotechnol. 38: 147-159).
Other methods for detecting mutations in a biomarker gene include methods in which protection from cleavage agents is used to detect mismatched bases in RNA/RNA or RNA/DNA heteroduplexes (Myers et al. (1985) Science 230: 1242). In general, the art technique of "mismatch cleavage" starts by providing heteroduplexes formed by hybridizing (labeled) RNA or DNA containing the wild-type biomarker sequence with potentially mutant RNA or DNA obtained from a tissue sample. The double-stranded duplexes are treated with an agent which cleaves single-stranded regions of the duplex such as which will exist due to base pair mismatches between the control and sample strands. For instance, RNA/DNA duplexes can be treated with RNase and DNA/DNA hybrids treated with SI nuclease to enzymatically digest the mismatched regions. In other embodiments, either DNA/DNA or RNA/DNA duplexes can be treated with hydroxylamine or osmium tetroxide and with piped dine in order to digest mismatched regions. After digestion of the mismatched regions, the resulting material is then separated by size on denaturing polyacrylamide gels to determine the site of mutation. See, for example, Cotton et al. (1988) Proc. Natl. Acad. Sci. USA 85:4397 and Saleeba et al. (1992) Methods Enzymol. 217:286-295. In a preferred embodiment, the control DNA or RNA can be labeled for detection.
In still another embodiment, the mismatch cleavage reaction employs one or more proteins that recognize mismatched base pairs in double-stranded DNA (so called "DNA mismatch repair" enzymes) in defined systems for detecting and mapping point mutations in biomarker cDNAs obtained from samples of cells. For example, the mutY enzyme of E. coli cleaves A at G/A mismatches and the thymidine DNA glycosylase from HeLa cells cleaves T at G/T mismatches (Hsu et al. (1994) Carcinogenesis 15: 1657-1662). According to an exemplary embodiment, a probe based on a biomarker sequence, e.g., a wild-type biomarker treated with a DNA mismatch repair enzyme, and the cleavage products, if any, can be detected from electrophoresis protocols or the like {e.g., U.S. Pat. No. 5,459,039.) In other embodiments, alterations in electrophoretic mobility can be used to identify mutations in biomarker genes. For example, single strand conformation polymorphism (SSCP) may be used to detect differences in electrophoretic mobility between mutant and wild type nucleic acids (Orita et al. (1989) Proc Natl. Acad. Sci USA 86:2766; see also
Cotton (1993) Mutat. Res. 285: 125-144 and Hayashi (1992) Genet. Anal. Tech. Appl. 9:73- 79). Single-stranded DNA fragments of sample and control biomarker nucleic acids will be denatured and allowed to renature. The secondary structure of single-stranded nucleic acids varies according to sequence, the resulting alteration in electrophoretic mobility enables the detection of even a single base change. The DNA fragments may be labeled or detected with labeled probes. The sensitivity of the assay may be enhanced by using RNA (rather than DNA), in which the secondary structure is more sensitive to a change in sequence. In a preferred embodiment, the subject method utilizes heteroduplex analysis to separate double stranded heteroduplex molecules on the basis of changes in electrophoretic mobility (Keen et al. ( 1991 ) Trends Genet. 7:5).
In yet another embodiment the movement of mutant or wild-type fragments in polyacrylamide gels containing a gradient of denaturant is assayed using denaturing gradient gel electrophoresis (DGGE) (Myers et al. (1985) Nature 313 :495). When DGGE is used as the method of analysis, DNA will be modified to ensure that it does not completely denature, for example by adding a GC clamp of approximately 40 bp of high- melting GC-rich DNA by PCR. In a further embodiment, a temperature gradient is used in place of a denaturing gradient to identify differences in the mobility of control and sample DNA (Rosenbaum and Reissner (1987) Biophys. Chem. 265: 12753).
Examples of other techniques for detecting point mutations include, but are not limited to, selective oligonucleotide hybridization, selective amplification, or selective primer extension. For example, oligonucleotide primers may be prepared in which the known mutation is placed centrally and then hybridized to target DNA under conditions which permit hybridization only if a perfect match is found (Saiki et al. (1986) Nature 324: 163; Saiki et al. (1989) Proc. Natl. Acad. Sci. USA 86:6230). Such allele specific oligonucleotides are hybridized to PCR amplified target DNA or a number of different mutations when the oligonucleotides are attached to the hybridizing membrane and hybridized with labeled target DNA.
Alternatively, allele specific amplification technology which depends on selective PCR amplification may be used in conjunction with the instant invention. Oligonucleotides used as primers for specific amplification may carry the mutation of interest in the center of the molecule (so that amplification depends on differential hybridization) (Gibbs et al. (1989) Nucleic Acids Res. 17:2437-2448) or at the extreme 3' end of one primer where, under appropriate conditions, mismatch can prevent, or reduce polymerase extension
(Prossner (1993) Tibtech 11 :238). In addition it may be desirable to introduce a novel restriction site in the region of the mutation to create cleavage-based detection (Gasparini et al. (1992) Mol. Cell Probes 6: 1). It is anticipated that in certain embodiments amplification may also be performed using Taq ligase for amplification (Barany (1991) Proc. Natl. Acad. Sci USA 88: 189). In such cases, ligation will occur only if there is a perfect match at the 3' end of the 5' sequence making it possible to detect the presence of a known mutation at a specific site by looking for the presence or absence of amplification.
3. Anti-Cancer Therapies
The efficacy of inhibitors of one or more biomarkers listed in Table 1, in
combination with an immunotherapy is predicted according to biomarker amount and/or activity associated with a cancer in a subject according to the methods described herein. In one embodiment, such biomarker inhibitor and immunotherapy combination treatments {e.g., one or more biomarker inhibitor and immunotherapy combination treatment in combination with one or more additional anti-cancer therapies, such as another immune checkpoint inhibitor) can be administered, particularly if a subject has first been indicated as being a likely responder to biomarker inhibitor and immunotherapy combination treatment. In another embodiment, such biomarker inhibitor and immunotherapy combination treatment can be avoided once a subject is indicated as not being a likely responder to biomarker inhibitor and immunotherapy combination treatment and an alternative treatment regimen, such as targeted and/or untargeted anti-cancer therapies can be administered. Combination therapies are also contemplated and can comprise, for example, one or more chemotherapeutic agents and radiation, one or more
chemotherapeutic agents and immunotherapy, or one or more chemotherapeutic agents, radiation and chemotherapy, each combination of which can be with anti-immune checkpoint therapy. In addition, any representative embodiment of an agent to modulate a particular target can be adapted to any other target described herein by the ordinarily skilled artisn {e.g., direct and indirect PD-1 inhibitors described herein can be applied to other immune checkpoint inhibitors and/or one or more biomarkers listed in Table 1, such as monospecific antibodies, bispecific antibodies, non-activiting forms, small molecules, peptides, interfering nucleic acids, and the like).
The term "targeted therapy" refers to administration of agents that selectively interact with a chosen biomolecule to thereby treat cancer. One example includes
immunotherapies such as immune checkpoint inhibitors, which are well-known in the art. For example, anti-PD-1 pathway agents, such as therapeutic monoclonal blocking antibodies, which are well-known in the art and described above, can be used to target tumor microenvironments and cells expressing unwanted components of the PD-1 pathway, such as PD- 1 , PD-L 1 , and/or PD-L2.
For example, the term "PD-1 pathway" refers to the PD-1 receptor and its ligands, PD-Ll and PD-L2. "PD-1 pathway inhibitors" block or otherwise reduce the interaction between PD-1 and one or both of its ligands such that the immunoinhibitory signaling otherwise generated by the interaction is blocked or otherwise reduced. Anti-immune checkpoint inhibitors can be direct or indirect. Direct anti -immune checkpoint inhibitors block or otherwise reduce the interaction between an immune checkpoint and at least one of its ligands. For example, PD-1 inhibitors can block PD-1 binding with one or both of its ligands. Direct PD-1 combination inhibitors are well-known in the art, especially since the natural binding partners of PD-1 (e.g., PD-Ll and PD-L2), PD-Ll (e.g., PD-1 and B7-1), and PD-L2 (e.g. , PD- 1 and RGMb) are known.
For example, agents which directly block the interaction between PD-1 and PD-Ll, PD-1 and PD-L2, PD-1 and both PD-Ll and PD-L2, such as a bispecific antibody, can prevent inhibitory signaling and upregulate an immune response (i.e., as a PD-1 pathway inhibitor). Alternatively, agents that indirectly block the interaction between PD-1 and one or both of its ligands can prevent inhibitory signaling and upregulate an immune response. For example, B7-1 or a soluble form thereof, by binding to a PD-Ll polypeptide indirectly reduces the effective concentration of PD-Ll polypeptide available to bind to PD-1.
Exemplary agents include monospecific or bispecific blocking antibodies against PD-1, PD-Ll, and/or PD-L2 that block the interaction between the receptor and ligand(s); a non- activating form of PD-1, PD-Ll, and/or PD-L2 (e.g., a dominant negative or soluble polypeptide), small molecules or peptides that block the interaction between PD-1, PD-Ll, and/or PD-L2; fusion proteins (e.g. the extracellular portion of PD-1, PD-Ll, and/or PD-L2, fused to the Fc portion of an antibody or immunoglobulin) that bind to PD-1, PD-Ll, and/or PD-L2 and inhibit the interaction between the receptor and ligand(s); a non-activating form of a natural PD-1, PD-L2, and/or PD-L2 ligand, and a soluble form of a natural PD-1, PD- L2, and/or PD-L2 ligand.
Indirect anti-immune checkpoint inhibitors block or otherwise reduce the immunoinhibitory signaling generated by the interaction between the immune checkpoint
and at least one of its ligands. For example, an inhibitor can block the interaction between PD-1 and one or both of its ligands without necessarily directly blocking the interaction between PD-1 and one or both of its ligands. For example, indirect inhibitors include intrabodies that bind the intracellular portion of PD-1 and/or PD-L1 required to signal to block or otherwise reduce the immunoinhibitory signaling. Similarly, nucleic acids that reduce the expression of PD-1, PD-L1, and/or PD-L2 can indirectly inhibit the interaction between PD-1 and one or both of its ligands by removing the availability of components for interaction. Such nucleic acid molecules can block PD-L1, PD-L2, and/or PD-L2 transcription or translation.
Similary, agents which directly block the interaction between one or more biomarkers listed in Table 1 and their binding partners/substrates, and the like, can remove the inhibition to biomarker-regulated signaling and its downstream immune responses, such as increasing sensitivity to interferon signaling. Alternatively, agents that indirectly block the interaction between one or more biomarkers listed in Table 1 and their binding partners/substrates can remove the inhibition to biomarker-regulated signaling and its downstream immune responses. For example, a truncated or dominant negative form of one or more biomarkers listed in Table 1, such as biomarker fragments without phosphatase activity, by binding to a biomarker substrate indirectly reduces the effective concentration of such substrate available to bind to one or more biomarkers listed in Table 1 in cell.
Exemplary agents include monospecific or bispecific blocking antibodies, especially intrbodies, against one or more biomarkers listed in Table 1 and/or biomarker substrate(s) that block the interaction between the biomarker and its substrate(s); a non-active form of one or more biomarkers listed in Table 1 and/or biomarker substrate(s) (e.g., a dominant negative polypeptide), small molecules or peptides that block the interaction between one or more biomarkers listed in Table 1 and their substrate(s) or the catalytic activity of one or more biomarkers listed in Table 1 ; and a non-activating form of a natural biomarker and/or its substrate(s).
Immunotherapies that are designed to elicit or amplify an immune response are referred to as "activation immunotherapies." Immunotherapies that are designed to reduce or suppress an immune response are referred to as "suppression immunotherapies." Any agent believed to have an immune system effect on the genetically modified transplanted cancer cells can be assayed to determine whether the agent is an immunotherapy and the effect that a given genetic modification has on the modulation of immune response. In
some embodiments, the immunotherapy is cancer cell-specific. In some embodiments, immunotherapy can be "untargeted," which refers to administration of agents that do not selectively interact with immune system cells, yet modulates immune system function. Representative examples of untargeted therapies include, without limitation, chemotherapy, gene therapy, and radiation therapy.
Immunotherapy can involve passive immunity for short-term protection of a host, achieved by the administration of pre-formed antibody directed against a cancer antigen or disease antigen (e.g., administration of a monoclonal antibody, optionally linked to a chemotherapeutic agent or toxin, to a tumor antigen). Immunotherapy can also focus on using the cytotoxic lymphocyte-recognized epitopes of cancer cell lines. Alternatively, antisense polynucleotides, ribozymes, RNA interference molecules, triple helix
polynucleotides and the like, can be used to selectively modulate biomolecules that are linked to the initiation, progression, and/or pathology of a tumor or cancer.
In one embodiment, immunotherapy comprises adoptive cell-based
immunotherapies. Well-known adoptive cell-based immunotherapeutic modalities, including, without limitation, Irradiated autologous or allogeneic tumor cells, tumor lysates or apoptotic tumor ceils, antigen-presenting cell-based immunotherapy, dendritic cell-based immunotherapy, adoptive T cell transfer, adoptive CAR T cell therapy, autologous immune enhancement therapy (AIET), cancer vaccines, and/or antigen presenting cells. Such cell- based immunotherapies can be further modified to express one or more gene products to further modulate immune responses, such as expressing cytokines like GM-CSF, and/or to express tumor-associated antigen (TAA) antigens, such as Mage-1, gp-100, patient-specific neoantigen vaccines, and the like.
In another embodiment, immunotherapy comprises non-cell-based
immunotherapies. In one embodiment, compositions comprising antigens with or without vaccine-enhancing adjuvants are used. Such compositions exist in many well-known forms, such as peptide compositions, oncolytic viruses, recombinant antigen comprising fusion proteins, and the like. In still another embodiment, immunomodulatory interleukins, such as IL-2, IL-6, IL-7, IL-12, IL-17, IL-23, and the like, as well as modulators thereof (e.g., blocking antibodies or more potent or longer lasting forms) are used. In yet another embodiment, immunomodulatory cytokines, such as interferons, G-CSF, imiquimod, T F alpha, and the like, as well as modulators thereof (e.g., blocking antibodies or more potent or longer lasting forms) are used. In another embodiment, immunomodulatory
chemokines, such as CCL3, CCL26, and CXCL7, and the like, as well as modulators thereof (e.g., blocking antibodies or more potent or longer lasting forms) are used. In another embodiment, immunomodulatory molecules targeting immunosuppression, such as STAT3 signaling modulators, FkappaB signaling modulators, and immune checkpoint modulators, are used. The terms "immune checkpoint" and "anti-immune checkpoint therapy" are described above.
In still another embodiment, immunomodulatory drugs, such as immunocytostatic drugs, glucocorticoids, cytostatics, immunophilins and modulators thereof (e.g., rapamycin, a calcineurin inhibitor, tacrolimus, ciclosporin (cyclosporin), pimecrolimus, abetimus, gusperimus, ridaforolimus, everolimus, temsirolimus, zotarolimus, etc.), hydrocortisone
(Cortisol), cortisone acetate, prednisone, prednisolone, methylprednisolone, dexamethasone, betamethasone, triamcinolone, beclometasone, fludrocortisone acetate, deoxycorticosterone acetate (doca) aldosterone, a non-glucocorticoid steroid, a pyrimidine synthesis inhibitor, leflunomide, teriflunomide, a folic acid analog, methotrexate, anti-thymocyte globulin, anti- lymphocyte globulin, thalidomide, lenalidomide, pentoxifylline, bupropion, curcumin, catechin, an opioid, an EVIPDH inhibitor, mycophenolic acid, myriocin, fingolimod, an NF- xB inhibitor, raloxifene, drotrecogin alfa, denosumab, an F-xB signaling cascade inhibitor, disulfiram, olmesartan, dithiocarbamate, a proteasome inhibitor, bortezomib, MG132, Prol, PI-0052, curcumin, genistein, resveratrol, parthenolide, thalidomide, lenalidomide, flavopiridol, non-steroidal anti-inflammatory drugs (NSAIDs), arsenic tri oxide, dehydroxymethylepoxyquinomycin (DHMEQ), I3C(indole-3-carbinol)/DIM(di- indolmethane) (13C/DIM), Bay 1 1-7082, luteolin, cell permeable peptide SN-50, IKBa - super repressor overexpression, FKB decoy oligodeoxynucleotide (ODN), or a derivative or analog of any thereo, are used. In yet another embodiment, immunomodulatory antibodies or protein are used. For example, antibodies that bind to CD40, Toll-like receptor (TLR), OX40, GITR, CD27, or to 4-lBB, T-cell bispecific antibodies, an anti-IL-2 receptor antibody, an anti-CD3 antibody, OKT3 (muromonab), otelixizumab, teplizumab, visilizumab, an anti-CD4 antibody, clenoliximab, keliximab, zanolimumab, an anti-CDl l a antibody, efalizumab, an anti-CD 18 antibody, erlizumab, rovelizumab, an anti-CD20 antibody, afutuzumab, ocrelizumab, ofatumumab, pascolizumab, rituximab, an anti-CD23 antibody, lumiliximab, an anti-CD40 antibody, teneliximab, toralizumab, an anti-CD40L antibody, ruplizumab, an anti-CD62L antibody, aselizumab, an anti-CD80 antibody, galiximab, an anti-CD147 antibody, gavilimomab, a B-Lymphocyte stimulator (BLyS)
inhibiting antibody, belimumab, an CTLA4-Ig fusion protein, abatacept, belatacept, an anti- CTLA4 antibody, ipilimumab, tremelimumab, an anti-eotaxin 1 antibody, bertilimumab, an anti-a4-integrin antibody, natalizumab, an anti-IL-6R antibody, tocilizumab, an anti-LFA-1 antibody, odulimomab, an anti-CD25 antibody, basiliximab, daclizumab, inolimomab, an anti-CD5 antibody, zolimomab, an anti-CD2 antibody, siplizumab, nerelimomab, faralimomab, atlizumab, atorolimumab, cedelizumab, dorlimomab aritox, dorlixizumab, fontolizumab, gantenerumab, gomiliximab, lebrilizumab, maslimomab, morolimumab, pexelizumab, reslizumab, rovelizumab, talizumab, telimomab aritox, vapaliximab, vepalimomab, aflibercept, alefacept, rilonacept, an IL-1 receptor antagonist, anakinra, an anti-IL-5 antibody, mepolizumab, an IgE inhibitor, omalizumab, talizumab, an IL12 inhibitor, an IL23 inhibitor, ustekinumab, and the like.
Nutritional supplements that enhance immune responses, such as vitamin A, vitamin E, vitamin C, and the like, are well-known in the art (see, for example, U. S. Pat. Nos.
4,981,844 and 5,230,902 and PCT Publ. No. WO 2004/004483) can be used in the methods described herein.
Similarly, agents and therapies other than immunotherapy or in combination thereof can be used with in combination with inhibitors of one or more biomarkers listed in Table 1 and immunotherapies to stimulate an immune response to thereby treat a condition that would benefit therefrom. For example, chemotherapy, radiation, epigenetic modifiers (e.g., histone deacetylase (HDAC) modifiers, methylation modifiers, phosphorylation modifiers, and the like), targeted therapy, and the like are well-known in the art.
The term "untargeted therapy" refers to administration of agents that do not selectively interact with a chosen biomolecule yet treat cancer. Representative examples of untargeted therapies include, without limitation, chemotherapy, gene therapy, and radiation therapy.
In one embodiment, chemotherapy is used. Chemotherapy includes the
administration of a chemotherapeutic agent. Such a chemotherapeutic agent may be, but is not limited to, those selected from among the following groups of compounds: platinum compounds, cytotoxic antibiotics, antimetabolites, anti-mitotic agents, alkylating agents, arsenic compounds, DNA topoisomerase inhibitors, taxanes, nucleoside analogues, plant alkaloids, and toxins; and synthetic derivatives thereof. Exemplary compounds include, but are not limited to, alkylating agents: cisplatin, treosulfan, and trofosfamide; plant alkaloids: vinblastine, paclitaxel, docetaxol; DNA topoisomerase inhibitors: teniposide, crisnatol, and
mitomycin; anti -folates: methotrexate, mycophenolic acid, and hydroxyurea; pyrimidine analogs: 5-fluorouracil, doxifluridine, and cytosine arabinoside; purine analogs:
mercaptopurine and thioguanine; DNA antimetabolites: 2'-deoxy-5-fluorouridine, aphidicolin glycinate, and pyrazoloimidazole; and antimitotic agents: halichondrin, colchicine, and rhizoxin. Compositions comprising one or more chemotherapeutic agents (e.g., FLAG, CHOP) may also be used. FLAG comprises fludarabine, cytosine arabinoside (Ara-C) and G-CSF. CHOP comprises cyclophosphamide, vincristine, doxorubicin, and prednisone. In another embodiments, PARP (e.g., PARP-1 and/or PARP-2) inhibitors are used and such inhibitors are well-known in the art (e.g., Olaparib, ABT-888, BSI-201, BGP-15 (N-Gene Research Laboratories, Inc.); INO-1001 (Inotek Pharmaceuticals Inc.); PJ34 (Soriano et al, 2001; Pacher et al, 2002b); 3-aminobenzamide (Trevigen); 4-amino- 1,8-naphthalimide; (Trevigen); 6(5H)-phenanthridinone (Trevigen); benzamide (U.S. Pat. Re. 36,397); and NU1025 (Bowman et al). The mechanism of action is generally related to the ability of PARP inhibitors to bind PARP and decrease its activity. PARP catalyzes the conversion of .beta. -nicotinamide adenine dinucleotide (NAD+) into nicotinamide and poly-ADP-ribose (PAR). Both poly (ADP-ribose) and PARP have been linked to regulation of transcription, cell proliferation, genomic stability, and carcinogenesis (Bouchard V. J. et.al. Experimental Hematology, Volume 31, Number 6, June 2003, pp. 446-454(9); Herceg Z.; Wang Z.-Q. Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis, Volume 477, Number 1, 2 Jun. 2001, pp. 97-110(14)).
Poly(ADP-ribose) polymerase 1 (PARPl) is a key molecule in the repair of DNA single- strand breaks (SSBs) (de Murcia J. et al. 1997. Proc Natl Acad Sci USA 94:7303-7307; Schreiber V, Dantzer F, Ame J C, de Murcia G (2006) Nat Rev Mol Cell Biol 7:517-528; Wang Z Q, et al. (1997) Genes Dev 11 :2347-2358). Knockout of SSB repair by inhibition of PARPl function induces DNA double-strand breaks (DSBs) that can trigger synthetic lethality in cancer cells with defective homology-directed DSB repair (Bryant H E, et al. (2005) Nature 434:913-917; Farmer H, et al. (2005) Nature 434:917-921). The foregoing examples of chemotherapeutic agents are illustrative, and are not intended to be limiting.
In another embodiment, radiation therapy is used. The radiation used in radiation therapy can be ionizing radiation. Radiation therapy can also be gamma rays, X-rays, or proton beams. Examples of radiation therapy include, but are not limited to, external-beam radiation therapy, interstitial implantation of radioisotopes (1-125, palladium, iridium), radioisotopes such as strontium-89, thoracic radiation therapy, intraperitoneal P-32
radiation therapy, and/or total abdominal and pelvic radiation therapy. For a general overview of radiation therapy, see Hellman, Chapter 16: Principles of Cancer Management: Radiation Therapy, 6th edition, 2001, DeVita et al, eds., J. B. Lippencott Company, Philadelphia. The radiation therapy can be administered as external beam radiation or teletherapy wherein the radiation is directed from a remote source. The radiation treatment can also be administered as internal therapy or brachytherapy wherein a radioactive source is placed inside the body close to cancer cells or a tumor mass. Also encompassed is the use of photodynamic therapy comprising the administration of photosensitizers, such as hematoporphyrin and its derivatives, Vertoporfin (BPD-MA), phthalocyanine,
photosensitizer Pc4, demethoxy-hypocrellin A; and 2BA-2-DMHA.
In another embodiment, surgical intervention can occur to physically remove cancerous cells and/or tissues.
In still another embodiment, hormone therapy is used. Hormonal therapeutic treatments can comprise, for example, hormonal agonists, hormonal antagonists (e.g., flutamide, bicalutamide, tamoxifen, raloxifene, leuprolide acetate (LUPRON), LH-RH antagonists), inhibitors of hormone biosynthesis and processing, and steroids (e.g., dexamethasone, retinoids, deltoids, betamethasone, Cortisol, cortisone, prednisone, dehydrotestosterone, glucocorticoids, mineralocorticoids, estrogen, testosterone, progestins), vitamin A derivatives (e.g., all-trans retinoic acid (ATRA)); vitamin D3 analogs; antigestagens (e.g., mifepristone, onapristone), or antiandrogens (e.g., cyproterone acetate).
In yet another embodiment, hyperthermia, a procedure in which body tissue is exposed to high temperatures (up to 106°F.) is used. Heat may help shrink tumors by damaging cells or depriving them of substances they need to live. Hyperthermia therapy can be local, regional, and whole-body hyperthermia, using external and internal heating devices. Hyperthermia is almost always used with other forms of therapy (e.g., radiation therapy, chemotherapy, and biological therapy) to try to increase their effectiveness. Local hyperthermia refers to heat that is applied to a very small area, such as a tumor. The area may be heated externally with high-frequency waves aimed at a tumor from a device outside the body. To achieve internal heating, one of several types of sterile probes may be used, including thin, heated wires or hollow tubes filled with warm water; implanted microwave antennae; and radiofrequency electrodes. In regional hyperthermia, an organ or a limb is heated. Magnets and devices that produce high energy are placed over the region
to be heated. In another approach, called perfusion, some of the patient's blood is removed, heated, and then pumped (perfused) into the region that is to be heated internally. Whole- body heating is used to treat metastatic cancer that has spread throughout the body. It can be accomplished using warm-water blankets, hot wax, inductive coils (like those in electric blankets), or thermal chambers (similar to large incubators). Hyperthermia does not cause any marked increase in radiation side effects or complications. Heat applied directly to the skin, however, can cause discomfort or even significant local pain in about half the patients treated. It can also cause blisters, which generally heal rapidly.
In still another embodiment, photodynamic therapy (also called PDT, photoradiation therapy, phototherapy, or photochemotherapy) is used for the treatment of some types of cancer. It is based on the discovery that certain chemicals known as photosensitizing agents can kill one-celled organisms when the organisms are exposed to a particular type of light. PDT destroys cancer cells through the use of a fixed-frequency laser light in combination with a photosensitizing agent. In PDT, the photosensitizing agent is injected into the bloodstream and absorbed by cells all over the body. The agent remains in cancer cells for a longer time than it does in normal cells. When the treated cancer cells are exposed to laser light, the photosensitizing agent absorbs the light and produces an active form of oxygen that destroys the treated cancer cells. Light exposure must be timed carefully so that it occurs when most of the photosensitizing agent has left healthy cells but is still present in the cancer cells. The laser light used in PDT can be directed through a fiberoptic (a very thin glass strand). The fiber-optic is placed close to the cancer to deliver the proper amount of light. The fiber-optic can be directed through a bronchoscope into the lungs for the treatment of lung cancer or through an endoscope into the esophagus for the treatment of esophageal cancer. An advantage of PDT is that it causes minimal damage to healthy tissue. However, because the laser light currently in use cannot pass through more than about 3 centimeters of tissue (a little more than one and an eighth inch), PDT is mainly used to treat tumors on or just under the skin or on the lining of internal organs.
Photodynamic therapy makes the skin and eyes sensitive to light for 6 weeks or more after treatment. Patients are advised to avoid direct sunlight and bright indoor light for at least 6 weeks. If patients must go outdoors, they need to wear protective clothing, including sunglasses. Other temporary side effects of PDT are related to the treatment of specific areas and can include coughing, trouble swallowing, abdominal pain, and painful breathing or shortness of breath. In December 1995, the U.S. Food and Drug Administration (FDA)
approved a photosensitizing agent called porfimer sodium, or Photofrin®, to relieve symptoms of esophageal cancer that is causing an obstruction and for esophageal cancer that cannot be satisfactorily treated with lasers alone. In January 1998, the FDA approved porfimer sodium for the treatment of early non-small cell lung cancer in patients for whom the usual treatments for lung cancer are not appropriate. The National Cancer Institute and other institutions are supporting clinical trials (research studies) to evaluate the use of photodynamic therapy for several types of cancer, including cancers of the bladder, brain, larynx, and oral cavity.
In yet another embodiment, laser therapy is used to harness high-intensity light to destroy cancer cells. This technique is often used to relieve symptoms of cancer such as bleeding or obstruction, especially when the cancer cannot be cured by other treatments. It may also be used to treat cancer by shrinking or destroying tumors. The term "laser" stands for light amplification by stimulated emission of radiation. Ordinary light, such as that from a light bulb, has many wavelengths and spreads in all directions. Laser light, on the other hand, has a specific wavelength and is focused in a narrow beam. This type of high- intensity light contains a lot of energy. Lasers are very powerful and may be used to cut through steel or to shape diamonds. Lasers also can be used for very precise surgical work, such as repairing a damaged retina in the eye or cutting through tissue (in place of a scalpel). Although there are several different kinds of lasers, only three kinds have gained wide use in medicine: Carbon dioxide (CO2) laser—This type of laser can remove thin layers from the skin's surface without penetrating the deeper layers. This technique is particularly useful in treating tumors that have not spread deep into the skin and certain precancerous conditions. As an alternative to traditional scalpel surgery, the CO2 laser is also able to cut the skin. The laser is used in this way to remove skin cancers.
Neodymium:yttrium-aluminum-garnet (Nd:YAG) laser— Light from this laser can penetrate deeper into tissue than light from the other types of lasers, and it can cause blood to clot quickly. It can be carried through optical fibers to less accessible parts of the body. This type of laser is sometimes used to treat throat cancers. Argon laser— This laser can pass through only superficial layers of tissue and is therefore useful in dermatology and in eye surgery. It also is used with light-sensitive dyes to treat tumors in a procedure known as photodynamic therapy (PDT). Lasers have several advantages over standard surgical tools, including: Lasers are more precise than scalpels. Tissue near an incision is protected, since there is little contact with surrounding skin or other tissue. The heat produced by lasers
sterilizes the surgery site, thus reducing the risk of infection. Less operating time may be needed because the precision of the laser allows for a smaller incision. Healing time is often shortened; since laser heat seals blood vessels, there is less bleeding, swelling, or scarring. Laser surgery may be less complicated. For example, with fiber optics, laser light can be directed to parts of the body without making a large incision. More procedures may be done on an outpatient basis. Lasers can be used in two ways to treat cancer: by shrinking or destroying a tumor with heat, or by activating a chemical—known as a photosensitizing agent—that destroys cancer cells. In PDT, a photosensitizing agent is retained in cancer cells and can be stimulated by light to cause a reaction that kills cancer cells. CO2 and Nd:YAG lasers are used to shrink or destroy tumors. They may be used with endoscopes, tubes that allow physicians to see into certain areas of the body, such as the bladder. The light from some lasers can be transmitted through a flexible endoscope fitted with fiber optics. This allows physicians to see and work in parts of the body that could not otherwise be reached except by surgery and therefore allows very precise aiming of the laser beam. Lasers also may be used with low-power microscopes, giving the doctor a clear view of the site being treated. Used with other instruments, laser systems can produce a cutting area as small as 200 microns in diameter— less than the width of a very fine thread. Lasers are used to treat many types of cancer. Laser surgery is a standard treatment for certain stages of glottis (vocal cord), cervical, skin, lung, vaginal, vulvar, and penile cancers. In addition to its use to destroy the cancer, laser surgery is also used to help relieve symptoms caused by cancer (palliative care). For example, lasers may be used to shrink or destroy a tumor that is blocking a patient's trachea (windpipe), making it easier to breathe. It is also sometimes used for palliation in colorectal and anal cancer. Laser- induced interstitial thermotherapy (LITT) is one of the most recent developments in laser therapy. LITT uses the same idea as a cancer treatment called hyperthermia; that heat may help shrink tumors by damaging cells or depriving them of substances they need to live. In this treatment, lasers are directed to interstitial areas (areas between organs) in the body. The laser light then raises the temperature of the tumor, which damages or destroys cancer cells.
The duration and/or dose of treatment with therapies may vary according to the particular therapeutic agent or combination thereof. An appropriate treatment time for a particular cancer therapeutic agent will be appreciated by the skilled artisan. The present invention contemplates the continued assessment of optimal treatment schedules for each
cancer therapeutic agent, where the phenotype of the cancer of the subject as determined by the methods of the present invention is a factor in determining optimal treatment doses and schedules.
Any means for the introduction of a polynucleotide into mammals, human or non- human, or cells thereof may be adapted to the practice of this invention for the delivery of the various constructs of the present invention into the intended recipient. In one embodiment of the present invention, the DNA constructs are delivered to cells by transfection, i.e., by delivery of "naked" DNA or in a complex with a colloidal dispersion system. A colloidal system includes macromolecule complexes, nanocapsules,
microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. The preferred colloidal system of this invention is a lipid- complexed or liposome-formulated DNA. In the former approach, prior to formulation of DNA, e.g., with lipid, a plasmid containing a transgene bearing the desired DNA constructs may first be experimentally optimized for expression {e.g., inclusion of an intron in the 5' untranslated region and elimination of unnecessary sequences (Feigner, et al, Ann NY Acad Sci 126-139, 1995). Formulation of DNA, e.g. with various lipid or liposome materials, may then be effected using known methods and materials and delivered to the recipient mammal. See, e.g., Canonico et al, Am J Respir Cell Mol Biol 10:24-29, 1994; Tsan et al, Am J Physiol 268; Alton et al, Nat Genet. 5: 135-142, 1993 and U.S. patent No. 5,679,647 by Carson et al.
The targeting of liposomes can be classified based on anatomical and mechanistic factors. Anatomical classification is based on the level of selectivity, for example, organ- specific, cell-specific, and organelle-specific. Mechanistic targeting can be distinguished based upon whether it is passive or active. Passive targeting utilizes the natural tendency of liposomes to distribute to cells of the reticulo-endothelial system (RES) in organs, which contain sinusoidal capillaries. Active targeting, on the other hand, involves alteration of the liposome by coupling the liposome to a specific ligand such as a monoclonal antibody, sugar, glycolipid, or protein, or by changing the composition or size of the liposome in order to achieve targeting to organs and cell types other than the naturally occurring sites of localization.
The surface of the targeted delivery system may be modified in a variety of ways. In the case of a liposomal targeted delivery system, lipid groups can be incorporated into the lipid bilayer of the liposome in order to maintain the targeting ligand in stable
association with the liposomal bilayer. Various linking groups can be used for joining the lipid chains to the targeting ligand. Naked DNA or DNA associated with a delivery vehicle, e.g., liposomes, can be administered to several sites in a subject (see below).
Nucleic acids can be delivered in any desired vector. These include viral or non- viral vectors, including adenovirus vectors, adeno-associated virus vectors, retrovirus vectors, lentivirus vectors, and plasmid vectors. Exemplary types of viruses include HSV (herpes simplex virus), AAV (adeno associated virus), HIV (human immunodeficiency virus), BIV (bovine immunodeficiency virus), and MLV (murine leukemia virus). Nucleic acids can be administered in any desired format that provides sufficiently efficient delivery levels, including in virus particles, in liposomes, in nanoparticles, and complexed to polymers.
The nucleic acids encoding a protein or nucleic acid of interest may be in a plasmid or viral vector, or other vector as is known in the art. Such vectors are well-known and any can be selected for a particular application. In one embodiment of the present invention, the gene delivery vehicle comprises a promoter and a demethylase coding sequence.
Preferred promoters are tissue-specific promoters and promoters which are activated by cellular proliferation, such as the thymidine kinase and thymidylate synthase promoters. Other preferred promoters include promoters which are activatable by infection with a virus, such as the a- and β-interferon promoters, and promoters which are activatable by a hormone, such as estrogen. Other promoters which can be used include the Moloney virus LTR, the CMV promoter, and the mouse albumin promoter. A promoter may be constitutive or inducible.
In another embodiment, naked polynucleotide molecules are used as gene delivery vehicles, as described in WO 90/11092 and U.S. Patent 5,580,859. Such gene delivery vehicles can be either growth factor DNA or RNA and, in certain embodiments, are linked to killed adenovirus. Curiel et al, Hum. Gene. Ther. 3 : 147-154, 1992. Other vehicles which can optionally be used include DNA-ligand (Wu et al, J. Biol. Chem.
264: 16985-16987, 1989), lipid-DNA combinations (Feigner et al., Proc. Natl. Acad. Sci. USA 84:7413 7417, 1989), liposomes (Wang et al., Proc. Natl. Acad. Sci. 84:7851-7855, 1987) and microprojectiles (Williams et al, Proc. Natl. Acad. Sci. 88:2726-2730, 1991).
A gene delivery vehicle can optionally comprise viral sequences such as a viral origin of replication or packaging signal. These viral sequences can be selected from viruses such as astrovirus, coronavirus, orthomyxovirus, papovavirus, paramyxovirus,
parvovirus, picornavirus, poxvirus, retrovirus, togavirus or adenovirus. In a preferred embodiment, the growth factor gene delivery vehicle is a recombinant retroviral vector. Recombinant retroviruses and various uses thereof have been described in numerous references including, for example, Mann et a/., Cell 33 : 153, 1983, Cane and Mulligan, Proc. Nat'l. Acad. Sci. USA 81 :6349, 1984, Miller et a/., Human Gene Therapy 1 :5-14, 1990, U.S. Patent Nos. 4,405,712, 4,861,719, and 4,980,289, and PCT Application Nos. WO 89/02,468, WO 89/05,349, and WO 90/02,806. Numerous retroviral gene delivery vehicles can be utilized in the present invention, including for example those described in EP 0,415,731; WO 90/07936; WO 94/03622; WO 93/25698; WO 93/25234; U.S. Patent No. 5,219,740; WO 9311230; WO 9310218; Vile and Hart, Cancer Res. 53 :3860-3864, 1993; Vile and Hart, Cancer Res. 53 :962-967, 1993; Ram et al., Cancer Res. 53 :83-88, 1993; Takamiya et a/., J. Neurosci. Res. 33 :493-503, 1992; Baba et a/., J. Neurosurg.
79:729-735, 1993 (U.S. Patent No. 4,777,127, GB 2,200,651, EP 0,345,242 and
WO91/02805).
Other viral vector systems that can be used to deliver a polynucleotide of the present invention have been derived from herpes virus, e.g., Herpes Simplex Virus (U.S. Patent No. 5,631,236 by Woo et al, issued May 20, 1997 and WO 00/08191 by Neurovex), vaccinia virus (Ridgeway (1988) Ridgeway, "Mammalian expression vectors," In: Rodriguez R L, Denhardt D T, ed. Vectors: A survey of molecular cloning vectors and their uses.
Stoneham: Butterworth,; Baichwal and Sugden (1986) "Vectors for gene transfer derived from animal DNA viruses: Transient and stable expression of transferred genes," In:
Kucherlapati R, ed. Gene transfer. New York: Plenum Press; Coupar et al. (1988) Gene, 68: 1-10), and several RNA viruses. Preferred viruses include an alphavirus, a poxivirus, an arena virus, a vaccinia virus, a polio virus, and the like. They offer several attractive features for various mammalian cells (Friedmann (1989) Science, 244: 1275-1281;
Ridgeway, 1988, supra; Baichwal and Sugden, 1986, supra; Coupar et a/., 1988; Horwich et a/.(1990) J.Virol., 64:642-650).
In other embodiments, target DNA in the genome can be manipulated using well- known methods in the art. For example, the target DNA in the genome can be manipulated by deletion, insertion, and/or mutation are retroviral insertion, artificial chromosome techniques, gene insertion, random insertion with tissue specific promoters, gene targeting, transposable elements and/or any other method for introducing foreign DNA or producing modified DNA/modified nuclear DNA. Other modification techniques include deleting
DNA sequences from a genome and/or altering nuclear DNA sequences. Nuclear DNA sequences, for example, may be altered by site-directed mutagenesis.
In other embodiments, recombinant biomarker polypeptides, and fragments thereof, can be administered to subjects. In some embodiments, fusion proteins can be constructed and administered which have enhanced biological properties. In addition, the biomarker polypeptides, and fragment thereof, can be modified according to well-known
pharmacological methods in the art (e.g., pegylation, glycosylation, oligomerization, etc.) in order to further enhance desirable biological activities, such as increased bioavailability and decreased proteolytic degradation.
4. Clincal Efficacy
Clinical efficacy can be measured by any method known in the art. For example, the response to a therapy, such as inhibitors of one or more biomarkers listed in Table 1 and immunotherapy combination treatment, relates to any response of the cancer, e.g., a tumor, to the therapy, preferably to a change in tumor mass and/or volume after initiation of neoadjuvant or adjuvant chemotherapy. Tumor response may be assessed in a neoadjuvant or adjuvant situation where the size of a tumor after systemic intervention can be compared to the initial size and dimensions as measured by CT, PET, mammogram, ultrasound or palpation and the cellularity of a tumor can be estimated histologically and compared to the cellularity of a tumor biopsy taken before initiation of treatment. Response may also be assessed by caliper measurement or pathological examination of the tumor after biopsy or surgical resection. Response may be recorded in a quantitative fashion like percentage change in tumor volume or cellularity or using a semi-quantitative scoring system such as residual cancer burden (Symmans et al, J. Clin. Oncol. (2007) 25:4414-4422) or Miller- Payne score (Ogston et al, (2003) Breast (Edinburgh, Scotland) 12:320-327) in a qualitative fashion like "pathological complete response" (pCR), "clinical complete remission" (cCR), "clinical partial remission" (cPR), "clinical stable disease" (cSD), "clinical progressive disease" (cPD) or other qualitative criteria. Assessment of tumor response may be performed early after the onset of neoadjuvant or adjuvant therapy, e.g., after a few hours, days, weeks or preferably after a few months. A typical endpoint for response assessment is upon termination of neoadjuvant chemotherapy or upon surgical removal of residual tumor cells and/or the tumor bed.
In some embodiments, clinical efficacy of the therapeutic treatments described herein may be determined by measuring the clinical benefit rate (CBR). The clinical benefit rate is measured by determining the sum of the percentage of patients who are in complete remission (CR), the number of patients who are in partial remission (PR) and the number of patients having stable disease (SD) at a time point at least 6 months out from the end of therapy. The shorthand for this formula is CBR=CR+PR+SD over 6 months. In some embodiments, the CBR for a particular anti-immune checkpoint therapeutic regimen is at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or more.
Additional criteria for evaluating the response to immunotherapies, such as anti- immune checkpoint therapies, are related to "survival," which includes all of the following: survival until mortality, also known as overall survival (wherein said mortality may be either irrespective of cause or tumor related); "recurrence-free survival" (wherein the term recurrence shall include both localized and distant recurrence); metastasis free survival; disease free survival (wherein the term disease shall include cancer and diseases associated therewith). The length of said survival may be calculated by reference to a defined start point (e.g., time of diagnosis or start of treatment) and end point (e.g., death, recurrence or metastasis). In addition, criteria for efficacy of treatment can be expanded to include response to chemotherapy, probability of survival, probability of metastasis within a given time period, and probability of tumor recurrence.
For example, in order to determine appropriate threshold values, a particular anticancer therapeutic regimen can be administered to a population of subjects and the outcome can be correlated to biomarker measurements that were determined prior to administration of any immunotherapy, such as anti-immune checkpoint therapy. The outcome
measurement may be pathologic response to therapy given in the neoadjuvant setting.
Alternatively, outcome measures, such as overall survival and disease-free survival can be monitored over a period of time for subjects following immunotherapies for whom biomarker measurement values are known. In certain embodiments, the same doses of immunotherapy agents, if any, are administered to each subject. In related embodiments, the doses administered are standard doses known in the art for those agents used in immunotherapies. The period of time for which subjects are monitored can vary. For example, subjects may be monitored for at least 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 25, 30, 35, 40, 45, 50, 55, or 60 months. Biomarker measurement threshold values that correlate to
outcome of an immunotherapy can be determined using methods such as those described in the Examples section.
5. Further Uses and Methods of the Present Invention
The compositions described herein can be used in a variety of diagnostic, prognostic, and therapeutic applications. In any method described herein, such as a diagnostic method, prognostic method, therapeutic method, or combination thereof, all steps of the method can be performed by a single actor or, alternatively, by more than one actor. For example, diagnosis can be performed directly by the actor providing therapeutic treatment. Alternatively, a person providing a therapeutic agent can request that a diagnostic assay be performed. The diagnostician and/or the therapeutic interventionist can interpret the diagnostic assay results to determine a therapeutic strategy. Similarly, such alternative processes can apply to other assays, such as prognostic assays,
a. Screening Methods
One aspect of the present invention relates to screening assays, including non-cell based assays and xenograft animal model assays. In one embodiment, the assays provide a method for identifying whether a cancer is likely to respond to inhibitors of one or more biomarkers listed in Table 1, in combination with an immunotherapy, such as in a human by using a xenograft animal model assay, and/or whether an agent can inhibit the growth of or kill a cancer cell that is unlikely to respond to biomarker inhibitor and immunotherapy combination treatments.
In one embodiment, the present invention relates to assays for screening test agents which bind to, or modulate the biological activity of, at least one biomarker described herein (e.g., in the tables, figures, examples, or otherwise in the specification). In one embodiment, a method for identifying such an agent entails determining the ability of the agent to modulate, e.g. inhibit, the at least one biomarker described herein.
In one embodiment, an assay is a cell-free or cell-based assay, comprising contacting at least one biomarker described herein, with a test agent, and determining the ability of the test agent to modulate (e.g., inhibit) the enzymatic activity of the biomarker, such as by measuring direct binding of substrates or by measuring indirect parameters as described below.
For example, in a direct binding assay, biomarker protein (or their respective target polypeptides or molecules) can be coupled with a radioisotope or enzymatic label such that
binding can be determined by detecting the labeled protein or molecule in a complex. For example, the targets can be labeled with 1251, 35 S, 14C, or 3H, either directly or indirectly, and the radioisotope detected by direct counting of radioemmission or by scintillation counting. Alternatively, the targets can be enzymatically labeled with, for example, horseradish peroxidase, alkaline phosphatase, or luciferase, and the enzymatic label detected by determination of conversion of an appropriate substrate to product.
Determining the interaction between biomarker and substrate can also be accomplished using standard binding or enzymatic analysis assays. In one or more embodiments of the above described assay methods, it may be desirable to immobilize polypeptides or molecules to facilitate separation of complexed from uncomplexed forms of one or both of the proteins or molecules, as well as to accommodate automation of the assay.
Binding of a test agent to a target can be accomplished in any vessel suitable for containing the reactants. Non-limiting examples of such vessels include microtiter plates, test tubes, and micro-centrifuge tubes. Immobilized forms of the antibodies described herein can also include antibodies bound to a solid phase like a porous, microporous (with an average pore diameter less than about one micron) or macroporous (with an average pore diameter of more than about 10 microns) material, such as a membrane, cellulose, nitrocellulose, or glass fibers; a bead, such as that made of agarose or polyacrylamide or latex; or a surface of a dish, plate, or well, such as one made of polystyrene.
In an alternative embodiment, determining the ability of the agent to modulate the interaction between the biomarker and a substrate or a biomarker and its natural binding partner can be accomplished by determining the ability of the test agent to modulate the activity of a polypeptide or other product that functions downstream or upstream of its position within the signaling pathway (e.g., feedback loops). Such feedback loops are well- known in the art (see, for example, Chen and Guillemin (2009) Int. J. Tryptophan Res. 2: 1- 19).
The present invention further pertains to novel agents identified by the above- described screening assays. Accordingly, it is within the scope of this invention to further use an agent identified as described herein, such as in an appropriate animal model. For example, an agent identified as described herein can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such an agent.
Alternatively, an antibody identified as described herein can be used in an animal model to determine the mechanism of action of such an agent.
b. Predictive Medicine
The present invention also pertains to the field of predictive medicine in which diagnostic assays, prognostic assays, and monitoring clinical trials are used for prognostic (predictive) purposes to thereby treat an individual prophylactically. Accordingly, one aspect of the present invention relates to diagnostic assays for determining the amount and/or activity level of a biomarker described herein in the context of a biological sample (e.g., blood, serum, cells, or tissue) to thereby determine whether an individual afflicted with a cancer is likely to respond to inhibitors of one or more biomarkers listed in Table 1, in combination with an immunotherapy , such as in a cancer. Such assays can be used for prognostic or predictive purpose alone, or can be coupled with a therapeutic intervention to thereby prophylactically treat an individual prior to the onset or after recurrence of a disorder characterized by or associated with biomarker polypeptide, nucleic acid expression or activity. The skilled artisan will appreciate that any method can use one or more (e.g., combinations) of biomarkers described herein, such as those in the tables, figures, examples, and otherwise described in the specification.
Another aspect of the present invention pertains to monitoring the influence of agents (e.g., drugs, compounds, and small nucleic acid-based molecules) on the expression or activity of a biomarker described herein. These and other agents are described in further detail in the following sections.
The skilled artisan will also appreciated that, in certain embodiments, the methods of the present invention implement a computer program and computer system. For example, a computer program can be used to perform the algorithms described herein. A computer system can also store and manipulate data generated by the methods of the present invention which comprises a plurality of biomarker signal changes/profiles which can be used by a computer system in implementing the methods of this invention. In certain embodiments, a computer system receives biomarker expression data; (ii) stores the data; and (iii) compares the data in any number of ways described herein (e.g., analysis relative to appropriate controls) to determine the state of informative biomarkers from cancerous or pre-cancerous tissue. In other embodiments, a computer system (i) compares the determined expression biomarker level to a threshold value; and (ii) outputs an indication of whether said biomarker level is significantly modulated (e.g., above or below) the threshold value, or a phenotype based on said indication.
In certain embodiments, such computer systems are also considered part of the present invention. Numerous types of computer systems can be used to implement the analytic methods of this invention according to knowledge possessed by a skilled artisan in the bioinformatics and/or computer arts. Several software components can be loaded into memory during operation of such a computer system. The software components can comprise both software components that are standard in the art and components that are special to the present invention (e.g., dCHIP software described in Lin et al. (2004) Bioinformatics 20, 1233-1240; radial basis machine learning algorithms (RBM) known in the art).
The methods of the present invention can also be programmed or modeled in mathematical software packages that allow symbolic entry of equations and high-level specification of processing, including specific algorithms to be used, thereby freeing a user of the need to procedurally program individual equations and algorithms. Such packages include, e.g., Matlab from Mathworks (Natick, Mass.), Mathematica from Wolfram
Research (Champaign, 111.) or S-Plus from MathSoft (Seattle, Wash.).
In certain embodiments, the computer comprises a database for storage of biomarker data. Such stored profiles can be accessed and used to perform comparisons of interest at a later point in time. For example, biomarker expression profiles of a sample derived from the non-cancerous tissue of a subject and/or profiles generated from population-based distributions of informative loci of interest in relevant populations of the same species can be stored and later compared to that of a sample derived from the cancerous tissue of the subject or tissue suspected of being cancerous of the subject.
In addition to the exemplary program structures and computer systems described herein, other, alternative program structures and computer systems will be readily apparent to the skilled artisan. Such alternative systems, which do not depart from the above described computer system and programs structures either in spirit or in scope, are therefore intended to be comprehended within the accompanying claims,
c. Diagnostic Assays
The present invention provides, in part, methods, systems, and code for accurately classifying whether a biological sample is associated with a cancer that is likely to respond to inhibitors of one or more biomarkers listed in Table 1, in combination with an immunotherapy. In some embodiments, the present invention is useful for classifying a sample {e.g., from a subject) as associated with or at risk for responding to or not
responding to such biomarker inhibitor and immunotherapy combination treatments using a statistical algorithm and/or empirical data (e.g., the amount or activity of a biomarker described herein, such as in the tables, figures, examples, and otherwise described in the specification).
An exemplary method for detecting the amount or activity of a biomarker described herein, and thus useful for classifying whether a sample is likely or unlikely to respond to such biomarker inhibitor and immunotherapy combination treatments involves obtaining a biological sample from a test subject and contacting the biological sample with an agent, such as a protein-binding agent like an antibody or antigen-binding fragment thereof, or a nucleic acid-binding agent like an oligonucleotide, capable of detecting the amount or activity of the biomarker in the biological sample. In some embodiments, at least one antibody or antigen-binding fragment thereof is used, wherein two, three, four, five, six, seven, eight, nine, ten, or more such antibodies or antibody fragments can be used in combination (e.g., in sandwich ELISAs) or in serial. In certain instances, the statistical algorithm is a single learning statistical classifier system. For example, a single learning statistical classifier system can be used to classify a sample as a based upon a prediction or probability value and the presence or level of the biomarker. The use of a single learning statistical classifier system typically classifies the sample as, for example, a likely immunotherapy responder or progressor sample with a sensitivity, specificity, positive predictive value, negative predictive value, and/or overall accuracy of at least about 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.
Other suitable statistical algorithms are well-known to those of skill in the art. For example, learning statistical classifier systems include a machine learning algorithmic technique capable of adapting to complex data sets (e.g., panel of markers of interest) and making decisions based upon such data sets. In some embodiments, a single learning statistical classifier system such as a classification tree (e.g., random forest) is used. In other embodiments, a combination of 2, 3, 4, 5, 6, 7, 8, 9, 10, or more learning statistical classifier systems are used, preferably in tandem. Examples of learning statistical classifier systems include, but are not limited to, those using inductive learning (e.g.,
decision/classification trees such as random forests, classification and regression trees (C&RT), boosted trees, etc.), Probably Approximately Correct (PAC) learning,
connectionist learning (e.g., neural networks (NN), artificial neural networks (ANN), neuro
fuzzy networks (NF ), network structures, perceptrons such as multi-layer perceptrons, multi-layer feed-forward networks, applications of neural networks, Bayesian learning in belief networks, etc.), reinforcement learning (e.g., passive learning in a known
environment such as naive learning, adaptive dynamic learning, and temporal difference learning, passive learning in an unknown environment, active learning in an unknown environment, learning action-value functions, applications of reinforcement learning, etc.), and genetic algorithms and evolutionary programming. Other learning statistical classifier systems include support vector machines (e.g., Kernel methods), multivariate adaptive regression splines (MARS), Levenberg-Marquardt algorithms, Gauss-Newton algorithms, mixtures of Gaussians, gradient descent algorithms, and learning vector quantization (LVQ). In certain embodiments, the method of the present invention further comprises sending the sample classification results to a clinician, e.g., an oncologist.
In another embodiment, the diagnosis of a subject is followed by administering to the individual a therapeutically effective amount of a defined treatment based upon the diagnosis.
In one embodiment, the methods further involve obtaining a control biological sample (e.g., biological sample from a subject who does not have a cancer or whose cancer is susceptible to biomarker inhibitor and immunotherapy combination treatments), a biological sample from the subject during remission, or a biological sample from the subject during treatment for developing a cancer progressing despite biomarker inhibitor and immunotherapy combination treatments.
d. Prognostic Assays
The diagnostic methods described herein can furthermore be utilized to identify subjects having or at risk of developing a cancer that is likely or unlikely to be responsive to biomarker inhibitor and immunotherapy combination treatments. The assays described herein, such as the preceding diagnostic assays or the following assays, can be utilized to identify a subject having or at risk of developing a disorder associated with a misregulation of the amount or activity of at least one biomarker described herein, such as in cancer. Alternatively, the prognostic assays can be utilized to identify a subject having or at risk for developing a disorder associated with a misregulation of the at least one biomarker described herein, such as in cancer. Furthermore, the prognostic assays described herein can be used to determine whether a subject can be administered an agent (e.g., an agonist, antagonist, peptidomimetic, polypeptide, peptide, nucleic acid, small molecule, or other
drug candidate) to treat a disease or disorder associated with the aberrant biomarker expression or activity.
e. Treatment Methods
The therapeutic compositions described herein, such as the combination of inhibitors of one or more biomarkers listed in Table 1 and immunotherapy, can be used in a variety of in vitro and in vivo therapeutic applications using the formulations and/or combinations described herein. In one embodiment, the therapeutic agents can be used to treat cancers determined to be responsive thereto. For example, single or multiple agents that inhibit or block both a biomarker inhibitor and an immunotherapy can be used to treat cancers in subjects identified as likely responders thereto.
Modulatory methods of the present invention involve contacting a cell, such as an immune cell with an agent that inhibits or blocks the expression and/or activity of one or more biomarkers listed in Table 1 and an immunotherapy, such as an immune checkpoint inhibitor {e.g., PD-1). Exemplary agents useful in such methods are described above. Such agents can be administered in vitro or ex vivo {e.g., by contacting the cell with the agent) or, alternatively, in vivo {e.g., by administering the agent to a subject). As such, the present invention provides methods useful for treating an individual afflicted with a condition that would benefit from an increased immune response, such as an infection or a cancer like colorectal cancer.
Agents that upregulate immune responses can be in the form of enhancing an existing immune response or eliciting an initial immune response. Thus, enhancing an immune response using the subject compositions and methods is useful for treating cancer, but can also be useful for treating an infectious disease {e.g., bacteria, viruses, or parasites), a parasitic infection, and an immunosuppressive disease.
Exemplary infectious disorders include viral skin diseases, such as Herpes or shingles, in which case such an agent can be delivered topically to the skin. In addition, systemic viral diseases, such as influenza, the common cold, and encephalitis might be alleviated by systemic administration of such agents. In one preferred embodiment, agents that upregulate the immune response described herein are useful for modulating the arginase/iNOS balance during Trypanosoma cruzi infection in order to facilitate a protective immune response against the parasite.
Immune responses can also be enhanced in an infected patient through an ex vivo approach, for instance, by removing immune cells from the patient, contacting immune
cells in vitro with an agent described herein and reintroducing the in vitro stimulated immune cells into the patient.
In certain instances, it may be desirable to further administer other agents that upregulate immune responses, for example, forms of other B7 family members that transduce signals via costimulatory receptors, in order to further augment the immune response. Such additional agents and therapies are described further below.
Agents that upregulate an immune response can be used prophylactically in vaccines against various polypeptides {e.g., polypeptides derived from pathogens).
Immunity against a pathogen {e.g., a virus) can be induced by vaccinating with a viral protein along with an agent that upregulates an immune response, in an appropriate adjuvant.
In another embodiment, upregulation or enhancement of an immune response function, as described herein, is useful in the induction of tumor immunity.
In another embodiment, the immune response can be stimulated by the methods described herein, such that preexisting tolerance, clonal deletion, and/or exhaustion {e.g., T cell exhaustion) is overcome. For example, immune responses against antigens to which a subject cannot mount a significant immune response, e.g., to an autologous antigen, such as a tumor specific antigens can be induced by administering appropriate agents described herein that upregulate the immune response. In one embodiment, an autologous antigen, such as a tumor-specific antigen, can be coadministered. In another embodiment, the subject agents can be used as adjuvants to boost responses to foreign antigens in the process of active immunization.
In one embodiment, immune cells are obtained from a subject and cultured ex vivo in the presence of an agent as described herein, to expand the population of immune cells and/or to enhance immune cell activation. In a further embodiment the immune cells are then administered to a subject. Immune cells can be stimulated in vitro by, for example, providing to the immune cells a primary activation signal and a costimulatory signal, as is known in the art. Various agents can also be used to costimulate proliferation of immune cells. In one embodiment immune cells are cultured ex vivo according to the method described in PCT Application No. WO 94/29436. The costimulatory polypeptide can be soluble, attached to a cell membrane, or attached to a solid surface, such as a bead.
6. Administration of Agents
The immune modulating agents of the invention are administered to subjects in a biologically compatible form suitable for pharmaceutical administration in vivo, to enhance immune cell mediated immune responses. By "biologically compatible form suitable for administration in vivo" is meant a form to be administered in which any toxic effects are outweighed by the therapeutic effects. The term "subject" is intended to include living organisms in which an immune response can be elicited, e.g., mammals. Examples of subjects include humans, dogs, cats, mice, rats, and transgenic species thereof.
Administration of an agent as described herein can be in any pharmacological form including a therapeutically active amount of an agent alone or in combination with a pharmaceutically acceptable carrier.
Administration of a therapeutically active amount of the therapeutic composition of the present invention is defined as an amount effective, at dosages and for periods of time necessary, to achieve the desired result. For example, a therapeutically active amount of an agent may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of peptide to elicit a desired response in the individual. Dosage regimens can be adjusted to provide the optimum therapeutic response. For example, several divided doses can be administered daily or the dose can be proportionally reduced as indicated by the exigencies of the therapeutic situation.
Inhibiting or blocking biomarker expression and/or activity, alone or in combination with an immunotherapy, can be accomplished by combination therapy with the modulatory agents described herein. Combination therapy describes a therapy in which one or more biomarkers listed in Table 1 is inhibited or blocked with an immunotherapy simultaneously. This may be achieved by administration of the modulatory agent described herein swith the immunotherapy imultaneously {e.g., in a combination dosage form or by simultaneous administration of single agents) or by administration of single inhibitory agent for one or more biomarkers listed in Table 1 and the immunotherapy, according to a schedule that results in effective amounts of each modulatory agent present in the patient at the same time.
The therapeutic agents described herein can be administered in a convenient manner such as by injection (subcutaneous, intravenous, etc.), oral administration, inhalation, transdermal application, or rectal administration. Depending on the route of administration, the active compound can be coated in a material to protect the compound from the action of enzymes, acids and other natural conditions which may inactivate the compound. For
example, for administration of agents, by other than parenteral administration, it may be desirable to coat the agent with, or co-administer the agent with, a material to prevent its inactivation.
An agent can be administered to an individual in an appropriate carrier, diluent or adjuvant, co-administered with enzyme inhibitors or in an appropriate carrier such as liposomes. Pharmaceutically acceptable diluents include saline and aqueous buffer solutions. Adjuvant is used in its broadest sense and includes any immune stimulating compound such as interferon. Adjuvants contemplated herein include resorcinols, non- ionic surfactants such as polyoxyethylene oleyl ether and n-hexadecyl polyethylene ether. Enzyme inhibitors include pancreatic trypsin inhibitor, diisopropylfluorophosphate (DEEP) and trasylol. Liposomes include water-in-oil-in-water emulsions as well as conventional liposomes (Sterna et al. (1984) J. Neuroimmunol. 7:27).
As described in detail below, the pharmaceutical compositions of the present invention may be specially formulated for administration in solid or liquid form, including those adapted for the following: (1) oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, boluses, powders, granules, pastes; (2) parenteral administration, for example, by subcutaneous, intramuscular or intravenous injection as, for example, a sterile solution or suspension; (3) topical application, for example, as a cream, ointment or spray applied to the skin; (4) intravaginally or
intrarectally, for example, as a pessary, cream or foam; or (5) aerosol, for example, as an aqueous aerosol, liposomal preparation or solid particles containing the compound.
The phrase "therapeutically-effective amount" as used herein means that amount of an agent that modulates {e.g., inhibits) biomarker expression and/or activity, or expression and/or activity of the complex, or composition comprising an agent that modulates {e.g., inhibits) biomarker expression and/or activity, or expression and/or activity of the complex, which is effective for producing some desired therapeutic effect, e.g., cancer treatment, at a reasonable benefit/risk ratio.
The phrase "pharmaceutically acceptable" is employed herein to refer to those agents, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
The phrase "pharmaceutically-acceptable carrier" as used herein means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting the subject chemical from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and
polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) phosphate buffer solutions; and (21) other non-toxic compatible substances employed in pharmaceutical formulations.
The term "pharmaceutically-acceptable salts" refers to the relatively non-toxic, inorganic and organic acid addition salts of the agents that modulates (e.g., inhibits) biomarker expression and/or activity, or expression and/or activity of the complex encompassed by the present invention. These salts can be prepared in situ during the final isolation and purification of the therapeutic agents, or by separately reacting a purified therapeutic agent in its free base form with a suitable organic or inorganic acid, and isolating the salt thus formed. Representative salts include the hydrobromide,
hydrochloride, sulfate, bisulfate, phosphate, nitrate, acetate, valerate, oleate, palmitate, stearate, laurate, benzoate, lactate, phosphate, tosylate, citrate, maleate, fumarate, succinate, tartrate, napthylate, mesylate, glucoheptonate, lactobionate, and laurylsulphonate salts and the like (See, for example, Berge et al. (1977) "Pharmaceutical Salts", J. Pharm. Sci. 66: 1- 19).
In other cases, the agents useful in the methods of the present invention may contain one or more acidic functional groups and, thus, are capable of forming pharmaceutically- acceptable salts with pharmaceutically-acceptable bases. The term "pharmaceutically-
acceptable salts" in these instances refers to the relatively non-toxic, inorganic and organic base addition salts of agents that modulates (e.g., inhibits) biomarker expression and/or activity, or expression and/or activity of the complex. These salts can likewise be prepared in situ during the final isolation and purification of the therapeutic agents, or by separately reacting the purified therapeutic agent in its free acid form with a suitable base, such as the hydroxide, carbonate or bicarbonate of a pharmaceutically-acceptable metal cation, with ammonia, or with a pharmaceutically-acceptable organic primary, secondary or tertiary amine. Representative alkali or alkaline earth salts include the lithium, sodium, potassium, calcium, magnesium, and aluminum salts and the like. Representative organic amines useful for the formation of base addition salts include ethylamine, diethylamine, ethylenediamine, ethanolamine, diethanolamine, piperazine and the like (see, for example, Berge et al., supra).
Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions.
Examples of pharmaceutically-acceptable antioxidants include: (1) water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabi sulfite, sodium sulfite and the like; (2) oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and (3) metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.
Formulations useful in the methods of the present invention include those suitable for oral, nasal, topical (including buccal and sublingual), rectal, vaginal, aerosol and/or parenteral administration. The formulations may conveniently be presented in unit dosage form and may be prepared by any methods well-known in the art of pharmacy. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated, the particular mode of administration. The amount of active ingredient, which can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound which produces a therapeutic effect. Generally, out of one hundred per cent, this amount will range from about 1 per cent to about ninety-nine percent of active ingredient,
preferably from about 5 per cent to about 70 per cent, most preferably from about 10 per cent to about 30 per cent.
Methods of preparing these formulations or compositions include the step of bringing into association an agent that modulates (e.g., inhibits) biomarker expression and/or activity, with the carrier and, optionally, one or more accessory ingredients. In general, the formulations are prepared by uniformly and intimately bringing into association a therapeutic agent with liquid carriers, or finely divided solid carriers, or both, and then, if necessary, shaping the product.
Formulations suitable for oral administration may be in the form of capsules, cachets, pills, tablets, lozenges (using a flavored basis, usually sucrose and acacia or tragacanth), powders, granules, or as a solution or a suspension in an aqueous or nonaqueous liquid, or as an oil-in-water or water-in-oil liquid emulsion, or as an elixir or syrup, or as pastilles (using an inert base, such as gelatin and glycerin, or sucrose and acacia) and/or as mouth washes and the like, each containing a predetermined amount of a therapeutic agent as an active ingredient. A compound may also be administered as a bolus, electuary or paste.
In solid dosage forms for oral administration (capsules, tablets, pills, dragees, powders, granules and the like), the active ingredient is mixed with one or more
pharmaceutically-acceptable carriers, such as sodium citrate or dicalcium phosphate, and/or any of the following: (1) fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and/or silicic acid; (2) binders, such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, sucrose and/or acacia; (3) humectants, such as glycerol; (4) disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; (5) solution retarding agents, such as paraffin; (6) absorption accelerators, such as quaternary ammonium compounds; (7) wetting agents, such as, for example, acetyl alcohol and glycerol monostearate; (8) absorbents, such as kaolin and bentonite clay; (9) lubricants, such a talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof; and (10) coloring agents. In the case of capsules, tablets and pills, the
pharmaceutical compositions may also comprise buffering agents. Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugars, as well as high molecular weight polyethylene glycols and the like.
A tablet may be made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared using binder (for example, gelatin or hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative, disintegrant (for example, sodium starch glycolate or cross-linked sodium carboxymethyl cellulose), surface-active or dispersing agent. Molded tablets may be made by molding in a suitable machine a mixture of the powdered peptide or peptidomimetic moistened with an inert liquid diluent.
Tablets, and other solid dosage forms, such as dragees, capsules, pills and granules, may optionally be scored or prepared with coatings and shells, such as enteric coatings and other coatings well-known in the pharmaceutical-formulating art. They may also be formulated so as to provide slow or controlled release of the active ingredient therein using, for example, hydroxypropylmethyl cellulose in varying proportions to provide the desired release profile, other polymer matrices, liposomes and/or microspheres. They may be sterilized by, for example, filtration through a bacteria-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions, which can be dissolved in sterile water, or some other sterile injectable medium immediately before use. These compositions may also optionally contain opacifying agents and may be of a composition that they release the active ingredient(s) only, or preferentially, in a certain portion of the
gastrointestinal tract, optionally, in a delayed manner. Examples of embedding
compositions, which can be used include polymeric substances and waxes. The active ingredient can also be in micro-encapsulated form, if appropriate, with one or more of the above-described excipients.
Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. In addition to the active ingredient, the liquid dosage forms may contain inert diluents commonly used in the art, such as, for example, water or other solvents, solubilizing agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor and sesame oils), glycerol, tetrahydrofuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof.
Besides inert diluents, the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, coloring, perfuming and preservative agents.
Suspensions, in addition to the active agent may contain suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, and mixtures thereof.
Formulations for rectal or vaginal administration may be presented as a suppository, which may be prepared by mixing one or more therapeutic agents with one or more suitable nonirritating excipients or carriers comprising, for example, cocoa butter, polyethylene glycol, a suppository wax or a salicylate, and which is solid at room temperature, but liquid at body temperature and, therefore, will melt in the rectum or vaginal cavity and release the active agent.
Formulations which are suitable for vaginal administration also include pessaries, tampons, creams, gels, pastes, foams or spray formulations containing such carriers as are known in the art to be appropriate.
Dosage forms for the topical or transdermal administration of an agent that modulates (e.g., inhibits) biomarker expression and/or activity include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and inhalants. The active component may be mixed under sterile conditions with a pharmaceutically-acceptable carrier, and with any preservatives, buffers, or propellants which may be required.
The ointments, pastes, creams and gels may contain, in addition to a therapeutic agent, excipients, such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide, or mixtures thereof.
Powders and sprays can contain, in addition to an agent that modulates (e.g., inhibits) biomarker expression and/or activity, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates and polyamide powder, or mixtures of these substances. Sprays can additionally contain customary propellants, such as
chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons, such as butane and propane.
The agent that modulates (e.g., inhibits) biomarker expression and/or activity, can be alternatively administered by aerosol. This is accomplished by preparing an aqueous aerosol, liposomal preparation or solid particles containing the compound. A nonaqueous (e.g., fluorocarbon propellant) suspension could be used. Sonic nebulizers are preferred
because they minimize exposing the agent to shear, which can result in degradation of the compound.
Ordinarily, an aqueous aerosol is made by formulating an aqueous solution or suspension of the agent together with conventional pharmaceutically acceptable carriers and stabilizers. The carriers and stabilizers vary with the requirements of the particular compound, but typically include nonionic surfactants (Tweens, Pluronics, or polyethylene glycol), innocuous proteins like serum albumin, sorbitan esters, oleic acid, lecithin, amino acids such as glycine, buffers, salts, sugars or sugar alcohols. Aerosols generally are prepared from isotonic solutions.
Transdermal patches have the added advantage of providing controlled delivery of a therapeutic agent to the body. Such dosage forms can be made by dissolving or dispersing the agent in the proper medium. Absorption enhancers can also be used to increase the flux of the peptidomimetic across the skin. The rate of such flux can be controlled by either providing a rate controlling membrane or dispersing the peptidomimetic in a polymer matrix or gel.
Ophthalmic formulations, eye ointments, powders, solutions and the like, are also contemplated as being within the scope of this invention.
Pharmaceutical compositions of this invention suitable for parenteral administration comprise one or more therapeutic agents in combination with one or more
pharmaceutically-acceptable sterile isotonic aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, or sterile powders which may be reconstituted into sterile injectable solutions or dispersions just prior to use, which may contain antioxidants, buffers, bacteriostats, solutes which render the formulation isotonic with the blood of the intended recipient or suspending or thickening agents.
Examples of suitable aqueous and nonaqueous carriers which may be employed in the pharmaceutical compositions of the present invention include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
These compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of the action of
microorganisms may be ensured by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption such as aluminum monostearate and gelatin.
In some cases, in order to prolong the effect of a drug, it is desirable to slow the absorption of the drug from subcutaneous or intramuscular injection. This may be accomplished by the use of a liquid suspension of crystalline or amorphous material having poor water solubility. The rate of absorption of the drug then depends upon its rate of dissolution, which, in turn, may depend upon crystal size and crystalline form.
Alternatively, delayed absorption of a parenterally-administered drug form is accomplished by dissolving or suspending the drug in an oil vehicle.
Injectable depot forms are made by forming microencapsule matrices of an agent that modulates (e.g., inhibits) biomarker expression and/or activity, in biodegradable polymers such as polylactide-polyglycolide. Depending on the ratio of drug to polymer, and the nature of the particular polymer employed, the rate of drug release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions, which are compatible with body tissue.
When the therapeutic agents of the present invention are administered as pharmaceuticals, to humans and animals, they can be given per se or as a pharmaceutical composition containing, for example, 0.1 to 99.5% (more preferably, 0.5 to 90%) of active ingredient in combination with a pharmaceutically acceptable carrier.
Actual dosage levels of the active ingredients in the pharmaceutical compositions of this invention may be determined by the methods of the present invention so as to obtain an amount of the active ingredient, which is effective to achieve the desired therapeutic response for a particular subject, composition, and mode of administration, without being toxic to the subject.
The nucleic acid molecules of the present invention can be inserted into vectors and used as gene therapy vectors. Gene therapy vectors can be delivered to a subject by, for example, intravenous injection, local administration (see U.S. Pat. No. 5,328,470) or by stereotactic injection (see e.g., Chen et al. (1994) Proc. Natl. Acad. Sci. USA 91 :3054-
3057). The pharmaceutical preparation of the gene therapy vector can include the gene therapy vector in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is imbedded. Alternatively, where the complete gene delivery vector can be produced intact from recombinant cells, e.g., retroviral vectors, the pharmaceutical preparation can include one or more cells which produce the gene delivery system.
In one embodiment, an agent of the invention is an antibody. As defined herein, a therapeutically effective amount of antibody (i.e., an effective dosage) ranges from about 0.001 to 30 mg/kg body weight, preferably about 0.01 to 25 mg/kg body weight, more preferably about 0.1 to 20 mg/kg body weight, and even more preferably about 1 to 10 mg/kg, 2 to 9 mg/kg, 3 to 8 mg/kg, 4 to 7 mg/kg, or 5 to 6 mg/kg body weight. The skilled artisan will appreciate that certain factors may influence the dosage required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present.
Moreover, treatment of a subject with a therapeutically effective amount of an antibody can include a single treatment or, preferably, can include a series of treatments. In a preferred example, a subject is treated with antibody in the range of between about 0.1 to 20 mg/kg body weight, one time per week for between about 1 to 10 weeks, preferably between 2 to 8 weeks, more preferably between about 3 to 7 weeks, and even more preferably for about 4, 5, or 6 weeks. It will also be appreciated that the effective dosage of antibody used for treatment may increase or decrease over the course of a particular treatment. Changes in dosage may result from the results of diagnostic assays.
7. Kits
The present invention also encompasses kits for detecting and/or modulating biomarkers described herein. A kit of the present invention may also include instructional materials disclosing or describing the use of the kit or an antibody of the disclosed invention in a method of the disclosed invention as provided herein. A kit may also include additional components to facilitate the particular application for which the kit is designed. For example, a kit may additionally contain means of detecting the label (e.g., enzyme substrates for enzymatic labels, filter sets to detect fluorescent labels, appropriate secondary labels such as a sheep anti-mouse-HRP, etc.) and reagents necessary for controls (e.g., control biological samples or standards). A kit may additionally include buffers and other
reagents recognized for use in a method of the disclosed invention. Non-limiting examples include agents to reduce non-specific binding, such as a carrier protein or a detergent.
EXAMPLES
Example 1: Materials and methods for Examples 2-4
a. In vivo CRISPR screening in B16 tumor cells
A Cas9-expressing version of the B 16 melanoma cell line was created and confirmed that it could edit DNA efficiently with CRISPR using sgRNAs targeting the PD- Ll gene. For screening the B 16-Cas9 cell line, a library of 9,992 optimized sgRNAs was created to target 2,398 genes, selected from the GO term categories: kinase, phosphatase, cell surface, plasma membrane, antigen processing and presentation, immune system process, and chromatin remodeling. The transcript abundance of the genes in these categories were then filtered to include only those that were expressed > RPKM (log2) = 0.9. These genes were then ranked for expression in the B16 cell line using RNAseq to select for the top 2,398 expressed genes. The library was divided into 4 sub-pools, each containing one sgRNA per gene and 100 non-targeting control sgRNAs. The 4 sub-pools were screened individually and sgRNAs were delivered to B 16-Cas9 cells via lentiviral infection at an infection rate of 30%. Transduced B 16 cells were purified using a hCD19 reporter by positive magnetic selection (Miltenyi Biotech, Cambridge, MA) and then expanded in vitro before being implanted into animals. For each sub-pool, B16 cells were implanted into 10 TCRa"/_ mice, 10 WT mice treated with GVAX, and 10 WT mice treated with GVAX and PD-1 blockade (see below for treatment protocols). B 16 cells transduced with libraries were also grown in vitro at approximately 2000 x library coverage for the same time period as the animal experiment. Mice were sacrificed 12-14 days after tumor implantation tumor genomic DNA was prepared from whole tumor tissue using the Qiagen DNA Blood Midi kit (Qiagen, Hilden, Germany). PCR was used to amplify the sgRNA region and sequencing to determine sgRNA abundance was performed on an Illumina HiSeq system (Illumina, San Diego, CA). Significantly enriched or depleted sgRNAs from any comparison of conditions were identified using the STARS algorithm (Doench et al. (2014) Nat. Biotechnol. 32: 1262-1267).
b. Animal treatment and tumor challenges
The designs of these animal studies and procedures were approved by the Dana Farber Cancer Institute IACUC committee. Dana Farber's specific-pathogen free facility
was used for the storage and care of all mice. Seven-week old wild-type female C57BL/6J mice were obtained from Jackson laboratories (Bar Harbor, ME). A colony of B6.129S2- jcratmiMonyj (jcra) T cell-deficient mice were bred on site. Mice were aged matched to be 7-12 weeks old at the time of tumor inoculation. For screening, 2.0 x 106 library- transduced B 16-Cas9 cells resuspended in Hanks Balanced Salt Solution (Gibco, Thermo Fisher Scientific, Waltham, MA) were mixed 1 : 1 by volume with Matrigel® (Corning, Corning, NY) and subcutaneously injected into the right flank on day 0. Mice were vaccinated with 1.0 x 106 GM-CSF-secreting B 16 (GVAX) cells that had been irradiated with 3500 Gy on days 1 and 4 to elicit an anti -tumor immune response. Subsequently, mice were treated with 100 μg of rat monoclonal anti-PDl antibody (clone: 29F.1A12) on days 9 and 12 via intraperitoneal injection. For validation assays, 1.0 x 106 tumor cells were subcutaneously injected into the right flank without matrigel. Tumors were measured every 3 days beginning on day 6 after challenge until time of death. Measurements were taken manually by collecting the longest dimension (length) and the longest perpendicular dimension (width). Tumor volume was estimated with the formula: (L x W2)/2. CO2 inhalation was used to euthanize mice on the day of sacrifice.
c. Creation of CRISPR edited tumor cell lines
Transient transfection of Cas9-sgRNA plasmid (pX459, Addgene, Cambridge, MA) was used to edit B 16 and Braf/Pten melanoma cell lines. pX459 was digested with the enzyme Bpil (Thermo Fisher Scientific) as per the manufacturer's instructions and sgRNA oligos were cloned in using standard molecular cloning. For B 16 cells, 5 x 105 cells were plated in a well of a 6-well plate and were transfected the following day using 2 μg of pX459 plasmid DNA and Turbofect™ (3 : 1 ratio, Thermo Fisher Scientific). Twenty -four hours after transfection, transfectants were selected in puromycin (6 μg/mL, Thermo Fisher Scientific). For Braf/Pten melanoma cells, 5 x 105 cells were plated in a well of a 6-well plate and were transfected the following day using 4 μg of pX459 plasmid DNA and Turbofect™ (3 : 1 ratio). After selection, cells were grown for 14 days in vitro before being implanted into mice.
d. In vivo competition assays
B16 cells were engineered to express GFP or TdTomato by lentiviral transduction to differentiate populations. Cas9-target sgRNA-transfected cells and Cas9-control sgRNA- transfected cells were mixed and then grown for at least two passages in vitro before implantation into mice. Mixes were analyzed by flow cytometry on the day of tumor
inoculation. Mice were euthanized 15-21 days after tumor inoculation for tumor harvest. Tumors were macerated on ice and incubated in collagenase P (2 mg/mL, Sigma, St. Louis, MO) and DNase I (50 μg/mL, Sigma) supplemented DMEM for 10 minutes at 37°C. After incubation, tumor cells were passed through 70μιη filters to remove undigested tumor. Tumor cells were washed with ice-cold MACS media and stained with Near-IR
LIVE/DEAD® (1 : 1000, BD Biosciences, Franklin Lakes, NJ) for 10 minutes on ice. Tumor cells were then washed and resuspended in ice-cold PBS with 2% FBS. An Accuri™ C6 flow cytometry system (BD Biosiences) was used to analyze final GFP/TdTomato tumor cell ratios.
e. Analysis tumor-infiltrating lymphocytes by flow cytometry
Mice were injected subcutaneously (s.c.) with 1.0 x 106 CRISPR/Cas9 modified B16 cells and treated with GVAX + anti-PD-1 mAb as described above. Tumors were harvested on day 12-13, weighed, mechanically diced, incubated with collagenase P (2 mg/mL, Sigma Aldrich) and DNAse I (50 μg/mL, Sigma Aldrich) for 10 minutes, and pipetted into a single-cell suspension. After filtering through a 70 μπι filter, cells were blocked with anti-mouse CD 16/32 antibody (BioLegend, San Diego, CA) and stained with indicated antibodies for 30 minutes on ice. Dead cells were excluded using Aqua
Live/Dead® (1 : 1000, ThermoFisher Scientific) added concurrently with surface antibodies. After washing, cells were fixed with Foxp3/transcription factor staining buffer set
(eBiosciences, San Diego, CA) as per manufacturer's instructions, blocked with mouse and rat serum, then stained with intracellular antibodies. AccuCount Fluorescent particles (Spherotech, Lake Forest, IL) were added for cell quantification prior to analysis on an LSR Fortessa™ cell analyzer (BD Biosciences) using single-color compensation controls and fluorescence-minus-one thresholds to set gate margins. Comparisons between groups performed using Student' s t test.
f. Flow cytometry analysis of B16 tumor cells
B16 cells were trypsinized and washed in PBS + 2% FBS, stained with antibodies for cell surface proteins as per the manufacturer's instructions and then analyzed on an Accuri™ C6 flow cytometry system (BD Biosciences).
g. RNAseq analysis of tumor cells
Null or control sgRNA-transfected B16 cells were stimulated with∑FNy (100 ng/mL, Cell Signaling Technology), TNFa (10 ng/mL, Peprotech) or both for 48 hours. RNA was extracted from cell pellets using the Qiagen RNeasy Mini kit according to
manufacturer's instructions. First-strand Illumina-barcoded libraries were generated using the NEB RNA Ultra™ Directional kit according to manufacturer's instructions, including a 12-cycle PCR enrichment. Libraries were sequenced on an Illumina NextSeq™ 500 instrument using paired-end 37bp reads. Data were trimmed for quality using the
Trimmomatic pipeline with the following parameters: LEADING: 15 TRAILING: 15 SLIDINGWINDOW:4: 15 MINLEN: 16. Data were aligned to mouse reference genome mm 10 using the Bowtie 2 aligning sequencing tool (available at the World Wide Web website of Johns Hopkins University). HTSeq was used to map aligned reads to genes and to generate a gene count matrix and it is available at the World Wide Web address of www- huber.embl.de/users/anders/HTSeq/doc/overview.html. Normalized counts and differential expression analysis was performed using the DESeq2 R package. The gene set enrichment analysis was performed as described previously in Subramanian et al. (2005) Proc Natl Acad Sci USA 102: 15545-15550. Principle Components Analysis (PCA) was performed on the normalized gene counts including all genes that passed a minimal expression filter. Signature scores for the individual samples were generated using FastProject (available at the World Wide Web address of
bmcbioinformatics.biomedcentral.com/articles/10.1186/sl2859-016-l 176-5) and the Hallmark gene signature collection (Liberzon et al. (2015) Cell Sys. 1 :417-425). Pearson correlation coefficients were calculated between the Hallmark gene signatures and PCI and PC2. Selected signatures were plotted on a normalized PCA projection of the dataset. h. Western blotting
Whole cell lysates were prepared in lysis buffer (60 mM Tris HC1, 2% SDS, 10% glycerol, complete EDTA-free protease-inhibitor (Roche, Basel, Switzerland), and 500 U/mL benzonase nuclease (Novagen, Merck, Darmstadt, Germany)). Samples were boiled at 100°C and clarified by centrifugation. Protein concentration was measured with a BCA protein assay kit (Pierce, Dallas, Texas). Fifty to one hundred and fifty micrograms of protein was loaded on 4-12% Bolt® Bis-Tris Plus gels (Life Technologies, Carlsbad, CA) in MES buffer (Life Technologies). Protein was transferred to 0.45 μπι nitrocellulose membranes (Bio-Rad, Hercules, CA). Membranes were blocked in Tris-buffered saline plus 0.1% Tween 20 (TBS-T) containing 5% non-fat dry milk for 1 hour at room
temperature followed by overnight incubation with primary antibody at 4°C. Membranes were washed with TBS-T and incubated with HRP-conjugated secondary antibodies for 1 hour at room temperature. HRP was activated with Supersignal® West Dura Extended
Duration Substrate (Pierce) and visualized with a chemiluminscent detection system using Fuji ImageQuant™ LAS4000 (GE Healthcare Life Sciences, Pittsburgh, PA). Blots were then analyzed using ImageJ and Adobe® Photoshop® software,
i. Antibodies
For Western blotting, primary antibodies against β-ACTIN (Abeam, Cambridge,
UK, Cat. #8227) and FLAG (clone M2, Sigma Aldrich) were used. Peroxidase-conjugated secondaries against Rabbit-IgG (Cat. #111-035-046) and Mouse-IgG (Cat. #115-035-174) were purchased from Jackson Laboratories (Bar Harbor, ME).
For flow cytometry, the following anti-mouse (m) fluorochrome-conjugated antibodies were used: CD47 (clone miap301, BioLegend), Granzyme B (clone GB11, BioLegend), and PD-1 (clone RPMI-30, BioLegend).
i . CRISPR sgRNA sequences.
Gene Name/sg# sgRNA Sequence
Cd274 sgRNA 1 GCCTGCTGTCACTTGCTACG (SEQ ID NO 89)
Cd274 sgRNA 2 AATCAACCAGAGAATTTCCG (SEQ ID NO 90)
Cd274 sgRNA 3 GGTCCAGCTCCCGTTCTACA (SEQ ID NO 91)
Cd274 sgRNA 4 GTATGGCAGCAACGTCACGA (SEQ ID NO 92)
Cd47 sgRNA 1 TATAGAGCTGAAAAACCGCA (SEQ ID NO 93)
Cd47 sgRNA 2 CCACATTACGGACGATGCAA (SEQ ID NO 94)
Cd47 sgRNA 3 TCTTACGAGGAGGAGAAAGG (SEQ ID NO 95)
Cd47 sgRNA 4 GCAAGTGTAGTTTCCCACCA (SEQ ID NO 96)
control sgRNA 1 GCGAGGTATTCGGCTCCGCG (SEQ ID NO 97)
control sgRNA 2 GCTTTCACGGAGGTTCGACG (SEQ ID NO 98)
control sgRNA 3 ATGTTGCAGTTCGGCTCGAT (SEQ ID NO 99)
control sgRNA 4 ACGTGTAAGGCGAACGCCTT (SEQ ID NO 100) control sgRNA 5 ATTGTTCGACCGTCTACGGG (SEQ ID NO 101)
Ripkl sgRNA 1 CACCGTACACGTCCGACTTCTCCG (SEQ ID NO: 102)
Examples 2-4 disclose the development of a pooled loss-of-function in vivo genetic screening approach that uses CRISPR-Cas9 genome editing to discover genes that increase sensitivity or cause resistance to immunotherapy in a mouse transplantable tumor model. About 2,400 genes expressed by tumor cells were screened in the B 16 murine melanoma model to identify those that increase or decrease sensitivity to immunotherapy with tumor vaccination and PD-1 checkpoint blockade. The screen identified known immune evasion
molecules PD-L1 and CD47, as tumor cells bearing sgRNAs for these targets were significantly depleted in animals treated with immunotherapy. In contrast, loss of function of any of the genes that sense or signal in response to interferon-γ (IFNy) rendered cells resistant to immunotherapy with PD-1 checkpoint blockade and vaccination recapitulating resistance mutations identified in melanoma patients (Zaretsky et al. (2016) N. Engl. J.
Med. 375:819-829; Gao et al. (2016) Cell 167:397-404.e9). It was discovered that deletion of one or more regulators of TNF signaling and/or F-κΒ activation, preferably RIPK1, BIRC2, TBK1, TRAF3, R F31, RBCK1, OTULIN, TRAF6, TAB2, and
TNIP1 significantly increased sensitivity of tumor cells to immunotherapy by increasing IFNy-mediated effects on antigen presentation and cell growth. These findings reveal that therapeutic strategies, such as Ripkl inhibition, that sensitize tumor cells to the effects of IFNy are capable of increasing the efficacy of cancer immunotherapy. Moreover, this screening approach can discover new immunotherapy targets and prioritize their combination with existing immunotherapies.
Example 2: A pooled loss-of-function in vivo genetic screen recovers known immune evasion molecules expressed by tumors
In order to systematically identify new cancer immunotherapy targets and resistance mechanisms, a pooled genetic screening approach was developed to identify genes that increase or decrease the fitness of tumor cells growing in vivo in animals treated with immunotherapy (Figure 1A). First, a B16 melanoma cell line was engineered to express Cas9 (Figure 2A), confirmed of efficient DNA editing using sgRNAs targeting PD-L1 (Figure ID). Next, a library of lentiviral vectors was created to encode 9,992 sgRNAs targeting 2,398 genes from relevant functional classes that were expressed at detectable levels in the tumor cell line (Figure 2B). After transduction and in vitro passage to allow gene editing to take place, the tumor cells were transplanted into animals that were then treated with either a GM-CSF-secreting, irradiated tumor cell vaccine (GVAX) or GVAX plus PD-1 blockade using a monoclonal antibody for PD-1, in order to apply immune selective pressure on the tumor cells (Figure IB) (see Dranoff (2003) Oncogene 22:3188- 3192; Dranoff et al. (1993) Proc. Natl. Acad. Sci. U.S.A. 90:3539-3543; and Duraiswamy et al. (2013) Cancer Res. 73 :3591-3603). In parallel, the library-transduced tumor cells were transplanted into TCRa_/" mice, which lack CD4+ and CD8+ T cells and were therefore unable to apply adaptive immune selective pressure on the tumors. This allowed to
distinguish the effect of immune selective pressure on library representation from nonspecific effects on tumor cell viability. After 12 - 14 days, tumors were harvested (Figure IB), with all sgRNAs recovered from each animal with good inter-animal reproducibility (Figures 2C-2E).
The library representation in tumors from immunotherapy -treated wild-type (WT) animals were compared with that found in tumors growing in TCRa_/" mice, in which deletion of genes that result in resistance to immunotherapy would be expected to increase tumor sgRNA representation in WT animals, while deletion of genes that result in increased sensitivity of tumors to immunotherapy would decrease sgRNA representation. Analysis of sgRNAs enriched by immune selective pressure revealed those targeting genes involved in cytokine-mediating signaling and immune-system processes (Figure 1C). sgRNAs depleted by immunotherapy included those targeting genes involved in antigen processing, necroptosis, and regulation of immune responses (Figure 1C). These results indicate that the genetic screening approach used here identified genes expressed by tumors cells that play a role in interaction with the immune system.
Inspection of the list of genes targeted by sgRNAs depleted from tumors treated with immunotherapy revealed the known immune evasion molecule PD-Ll, indicating that loss of PD-Ll increased the sensitivity of tumor cells to immune attack. sgRNAs targeting PD-Ll were not depleted from tumors in TCRa_/" mice relative to cells growing in vitro, presumably due to the absence of T cell-mediated selective pressure (Figure ID), but were significantly depleted in WT mice treated with GVAX relative to TCRa_/" mice (FDR = 0.004). However, the depletion of PD-Ll -targeting sgRNAs seen in GVAX-treated tumors was not observed in tumors treated with GVAX and anti-PD-1, indicating that loss of PD- Ll does not confer a selective disadvantage to tumors when PD-Ll :PD-1 interactions are blocked (Figure ID).
It was also found that sgRNAs targeting CD47, which enables immune evasion by impairing engulfment of tumors cells by phagocytes (as in Liu et al. (2015) Nat. Med. 21 : 1209-1215; Weiskopf et al. (2016) 7. Clin. Invest. 126:2610-2620; and Tseng et al. (2013) Proc. Natl. Acad. Sci. U.S.A. 110: 11103-11108), were markedly depleted in tumors treated with either GVAX or with GVAX plus PD-1 blockade (FDR = 0.005, 0.002 respectively) (Figure IE). To confirm that CD47 null tumors were more susceptible to GVAX and PD-1 blockade, CD47 null B16 melanoma cells were generated using transient transfection of a Cas9-sgRNA plasmid (as in Ran et al. (2013) Nat. Protoc. 8:2281-2308)
(Figure 2F). It was found that loss of CD47 significantly improved control of tumor growth mediated by GVAX plus anti-PD-1 immunotherapy (Figure 1F, / 0.01).
Using the pooled loss-of-function in vivo genetic screen for identifying immune evasion molecules expressed by tumors described above, genes that increase or decrease the fitness of MC38 colon cancer cells growing in vivo in animal treated with immunotherapy.
Thus, in vivo genetic screening recovered genes known to confer tumor evasion properties on cancer cells.
Example 3: Discovery of novel gene targets to increase the efficacy of
immunotherapy
Deletion of novel candidate immunotherapy targets was found to increase sensitivity of tumor cells to immunotherapy. sgRNAs targeting genes involved in T F signaling and/or F-κΒ activation (e.g., RIPKl, BIRC2, TBKl, TRAF3, R F31, RBCKl, OTULIN, TRAF6, TAB2, and TNIP1) were markedly depleted in mice treated with GVAX and PD-1 blockade (Figure 3 A) relative to growth in TCRa_/" mice. In many cases, multiple members of the same pathway (e.g., Ripkl) or even the same multi -protein complex were depleted under immune selective pressure, underscoring the importance of these diverse biological pathways. Example 4: In vivo validation of RIPKl as a target for combination with
immunotherapy
Representative genes as regulators of TNF signaling and/or NF-κΒ activation, e.g., Ripkl, were selected to validate based on their highest cumulative score as ranked by the STARS algorithm (Doench et al. (2014) Nat. Biotechnol. 32: 1262-1267). In vivo competition assays showed that tumor cells deleted for Stubl were strongly selected against in WT animals treated with immunotherapy but grew at equivalent rates to control tumor cells in vitro and in TCRa_/" mice (Figure 3B and 3C; 0.0001, Student's t test). This suggests that regulators of TNF signaling and/or NF-κΒ pathways, e.g., Ripkl, are synthetically lethal with an anti-tumor immune response, rendering tumor cells more sensitive to immunotherapy but not altering their cell growth or survival in the absence of T cells.
One of the central challenges in cancer biology is to identify the genes that underlie the hallmarks of cancer. To date, functional genomic approaches using genome editing
have largely focused on identifying genes required by tumor cells for the cancer hallmarks of growth, metastasis and drug resistance (Ebert et al. (2008) Nature 451 :335-339; Hart et al. (2015) Cell 163 : 1515-1526; Yu et al. (2016) Nat. Biotechnol. 34:419-423; Chen et al. (2015) Cell 160: 1246-1260). This study extends this approach to the interrogation of the interaction of the tumor cell with the immune system, which can be broadly applied to multiple tumor models and immunotherapy modalities to systematically define genes that govern interactions between cancer cells and the immune system.
As described above, Ripkl (Receptor-Interacting Protein Kinase 1) is a regulatory protein important for: i) mediating inflammation and ii) regulating apoptotic and necroptotic cell death (Ofengeim and Yaun (2013) Nat. Rev. 14:727). Using murine in vivo CRISPR/Cas9 genetic screening, it has been determined herein that Ripkl is an
immunotherapy target that sensitizes tumors cells to the immune effects of anti-PD-1 checkpoint blockade. RzpAJ -deficient B16 melanoma cancer cells were significantly more sensitive to anti-PD-1 checkpoint blockade as demonstrated by dramatic overall decrease in tumor burden and increase in animal survival. Thus, inhibition of RIPKl and other associated proteins is believed to provide a potent strategy for increasing clinical efficacy of anti-PD-1 checkpoint blockade in patients.
Following the discovery of the key role Ripkl plays in mediating F-KB-driven inflammation and necroptosis upon TNF or TLR activation, Ripkl has been speculated as a promising therapeutic target for chronic inflammatory pathology (Fauster et al. (2015) Cell Death and Disease 6:el767; Danneppal et al. (2014) Nature 513 :90-94). However, RIPKl inhibition has been reported to have both pro- and anti-inflammatory effects. In some cases, targeted inhibition of Ripkl reduces TNF-driven inflammation in mice (Bullock and Degtreve (2015) Oncotarget 6:34057-34058; Fauster et al. (2015), supra). However, loss of Ripkl function in vivo is highly correlated with chronic gastrointestinal and other systemic inflammatory and/or cell death-associated diseases in both mice and humans (Danneppal et al. (2014), supra). This may be due to the fact Ripkl enzymatic function is sufficient for activating F-κΒ transcription, but is not necessary for inducing necroptosis or apoptosis (Danneppal et al. (2014), supra). Furthermore, Ripkl can be ubiquitylated at multiple residues, most notably on Lys-337 through Lys-63-linked ubiquitylation (a.k.a., ubiquitination) during F-κΒ induction (Ofengeim and Yuan (2013), supra), suggesting complex regulations of Ripkl functions. Thus, it was unexpected that inhibition of RIPKl function would be beneficial for the immune response to cancer.
Ripkl was the top depleted screening hit when comparing guide abundance between TCRa and anti-PDl checkpoint blockade treated mice (FDR = <0.0001). In addition, a number of other genes were identified that form a multi-protien complex with Ripkl or are in the same pathway, such as Sharpin, Tab2, A20, and Caspase 8. Preliminary pre-clinical validation efforts have shown that ablation of Ripkl in murine B16 cancer cells
dramatically improves in vivo efficacy of anti-PD-1 monoclonal antibody therapy in WT C57bl/6j mice. Mice injected with Ripkl -ablated tumor cells show decreased tumor burden when treated with anti-PD-1 checkpoint blockade. These result are further validated by competitive assay data in which 50% of cancer cells transplanted are Ripkl deficient and are dramatically out-competed by wild-type cells 14 days post injection, indicating a severe competitive disadvantage for Ripkl-ablated cells in the presence of effective immunity. By contrast, RzpAJ-ablated cells show no competitive disadvantage in TCRa mice which lack functional CD8 T cells, suggesting that the phenotype is T cell-dependent. Incorporation by Reference
All publications, patents, and patent applications mentioned herein are hereby incorporated by reference in their entirety as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference. In case of conflict, the present application, including any definitions herein, will control.
Also incorporated by reference in their entirety are any polynucleotide and polypeptide sequences which reference an accession number correlating to an entry in a public database, such as those maintained by The Institute for Genomic Research (TIGR) on the world wide web at tigr.org and/or the National Center for Biotechnology Information (NCBI) on the World Wide Web at ncbi.nlm.nih.gov.
Equivalents
Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.
Claims
1. A method of treating a subject afflicted with a cancer comprising administering to the subject a therapeutically effective amount of an agent that inhibits the copy number, the expression level, and/or the activity of one or more biomarkers listed in Table 1 or a fragment thereof, in combination with an immunotherapy.
2. The method of claim 1, wherein the agent decreases the copy number, the expression level, and/or the activity of one or more regulators of TNF signaling and/or NF- KB activation, preferably RIPK1, BIRC2, TBK1, TRAF3, RNF31, RBCK1, OTULIN, TRAF6, TAB2, and TNIP1.
3. The method of claim 1 or 2, wherein the agent selectively decreases the biological activity and/or the substrate binding activity of RIPK1, preferably the serine/threonine- protein kinase activity and/or the receptor binding activity of RIPK1.
4. The method of any one of claims 1-3, wherein the agent is a small molecule inhibitor, CRISPR single-guide RNA (sgRNA), RNA interfering agent, antisense oligonucleotide, peptide or peptidomimetic inhibitor, aptamer, or intrabody.
5. The method of claim 4, wherein the RNA interfering agent is a small interfering RNA (siRNA), CRISPR RNA (crRNA), a small hairpin RNA (shRNA), a microRNA (miRNA), or a piwi-interacting RNA (piRNA).
6. The method of claim 5, wherein the RNA interfering agent is a CRISPR single- guide RNA (sgRNA).
7. The method of claim 6, wherein the sgRNA comprises a nucleic acid sequence selected from the group consisting of nucleic acid sequence listed in Table 2.
8. The method of claim 4, wherein the agent comprises an intrabody, or an antigen binding fragment thereof, which specifically binds to the one or more biomarkers and/or a substrate of the one or more biomarkers.
9. The method of claim 8, wherein the intrabody, or antigen binding fragment thereof, is murine, chimeric, humanized, composite, or human.
10. The method of claim 8 or 9, wherein the intrabody, or antigen binding fragment thereof, is detectably labeled, comprises an effector domain, comprises an Fc domain, and/or is selected from the group consisting of Fv, Fav, F(ab')2, Fab', dsFv, scFv, sc(Fv)2, and diabodies fragments.
11. The method of any one of claims 8-10, wherein the intrabody, or antigen binding fragment thereof, is conjugated to a cytotoxic agent.
12. The method of claim 11, wherein the cytotoxic agent is selected from the group consisting of a chemotherapeutic agent, a biologic agent, a toxin, and a radioactive isotope.
13. The method of any one of claims 1-12, wherein the agent increases the sensitivity of the cancer cells to an immunotherapy.
14. The method of any one of claims 1-13, wherein the immunotherapy and/or a cancer therapy is administered before, after, or concurrently with the agent.
15. The method of claim 13 or 14, wherein the immunotherapy comprises an anticancer vaccine and/or virus.
16. The method of any one of claims 13-15, wherein the immunotherapy is cell-based.
17. The method of any one of claims 13-16, wherein the immunotherapy inhibits an immune checkpoint.
18. The method of claim 17, wherein the immune checkpoint is selected from the group consisting of CTLA-4, PD-1, VISTA, B7-H2, B7-H3, PD-Ll, B7-H4, B7-H6, ICOS, HVEM, PD-L2, CD160, gp49B, PIR-B, KIR family receptors, TIM-1, TEVI-3, TEVI-4, LAG-3, GITR, 4-IBB, OX-40, BTLA, SIRP, CD47, CD48, 2B4 (CD244), B7.1, B7.2, ILT- 2, ILT-4, TIGIT, HHLA2, butyrophilins, IDO, CD39, CD73 and A2aR.
19. The method of claim 18, wherein the immune checkpoint is selected from the group consisting of PD-1, PD-Ll, and PD-L2, optionally wherein the immune checkpoint is PD-1.
20. The method of any one of claims 1-19, wherein the one or more biomarkers comprise a nucleic acid sequence having at least 95% identity to a nucleic acid sequence
listed in Table 1 and/or an amino acid sequence having at least 95% identity to an amino acid sequence listed in Table 1.
21. The method of any one of claims 1-20, wherein the one or more biomarkers are human, mouse, chimeric, or a fusion.
22. The method of any one of claims 1-21, wherein the agent reduces the number of proliferating cells in the cancer and/or reduces the volume or size of a tumor comprising the cancer cells.
23. The method of any one of claims 1-22, wherein the one or more biomarkers comprise an amino acid sequence listed in Table 1, optionally wherein the amino acid sequence is selected from the group consisting of SEQ ID Nos: 2, 4, 6, 9, 11, 14, 16, 18, 21,
23. 25, 27, 29, 31, 33, 35, 37, 39, 42, 44, 47, 49, 51, 54, 57, 60, 62, 64, 66, 68, 73, 76, 78, 80, 83, 86, and 88.
24. The method of any one of claims 1-23, wherein the one or more biomarkers are encoded by a nucleic acid sequence listed in Table 1, optionally wherein the nucleic acid sequence is selected from the group consisting of SEQ ID Nos: 1, 3, 5, 7, 8, 10, 12, 13, 15, 17, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 41, 43, 45, 46, 48, 50, 52, 53, 55, 56, 58, 59, 61, 63, 65, 67, 69-72, 74, 75, 77, 79, 81, 82, 84, 85, and 87.
25. The method of any one of claims 1-24, wherein the cancer is melanoma.
26. The method of any one of claims 1-25, wherein the subject is an animal model of the cancer, preferably a mouse model, or a human.
27. The method of any one of claims 1-26, further comprising administering to the subject at least one additional cancer therapy or regimen, optionally wherein the at least one additional cancer therapy or regimen is administered before, after, or concurrently with the agent and/or the immunotherapy.
28. The method of any one of claims 1-27, wherein the agent is administered in a pharmaceutically acceptable formulation.
29. A method of killing cancer cells comprising contacting the cancer cells with an agent that inhibits the copy number, the expression level, and/or the activity of one or more biomarkers listed in Table 1 or a fragment thereof, in combination with an immunotherapy.
30. The method of claim 29, wherein the agent decreases the copy number, the expression level, and/or the activity of one or more regulators of TNF signaling and/or NF- KB activation, preferably RIPK1, BIRC2, TBK1, TRAF3, RNF31, RBCK1, OTULIN, TRAF6, TAB2, and TNIP1.
31. The method of claim 29 or 30, wherein the agent selectively decreases the biological activity and/or the substrate binding activity of RIPK1, preferably the serine/threonine- protein kinase activity and/or the receptor binding activity of RIPK1.
32. The method of any one of claims 29-31, wherein the agent is a small molecule inhibitor, CRISPR single-guide RNA (sgRNA), RNA interfering agent, antisense oligonucleotide, peptide or peptidomimetic inhibitor, aptamer, or intrabody.
33. The method of claim 32, wherein the RNA interfering agent is a small interfering RNA (siRNA), CRISPR RNA (crRNA), a small hairpin RNA (shRNA), a microRNA (miRNA), or a piwi-interacting RNA (piRNA).
34. The method of claim 33, wherein the RNA interfering agent is a CRISPR single- guide RNA (sgRNA).
35. The method of claim 34, wherein the sgRNA comprises a nucleic acid sequence selected from the group consisting of nucleic acid sequence listed in Table 2.
36. The method of claim 32, wherein the agent comprises an intrabody, or an antigen binding fragment thereof, which specifically binds to the one or more biomarkers and/or a substrate of the one or more biomarkers.
37. The method of claim 36, wherein the intrabody, or antigen binding fragment thereof,
is murine, chimeric, humanized, composite, or human.
38. The method of claim 36 or 37, wherein the intrabody, or antigen binding fragment thereof, is detectably labeled, comprises an effector domain, comprises an Fc domain, and/or is selected from the group consisting of Fv, Fav, F(ab')2, Fab', dsFv, scFv, sc(Fv)2, and diabodies fragments.
39. The method of any one of claims 36-38, wherein the intrabody, or antigen binding fragment thereof, is conjugated to a cytotoxic agent.
40. The method of claim 39, wherein the cytotoxic agent is selected from the group consisting of a chemotherapeutic agent, a biologic agent, a toxin, and a radioactive isotope.
41. The method of any one of claims 29-40, wherein the agent increases the sensitivity of the cancer cells to an immunotherapy.
42. The method of any one of claims 29-41, wherein the cancer cells are contacted with an immunotherapy and/or a cancer therapy before, after, or concurrently with the agent.
43. The method of claim 41 or 42, wherein the immunotherapy comprises an anticancer vaccine and/or virus.
44. The method of any one of claims 41-43, wherein the immunotherapy is cell-based.
45. The method of any one of claims 41-44, wherein the immunotherapy inhibits an immune checkpoint.
46. The method of claim 45, wherein the immune checkpoint is selected from the group consisting of CTLA-4, PD-1, VISTA, B7-H2, B7-H3, PD-Ll, B7-H4, B7-H6, ICOS, HVEM, PD-L2, CD160, gp49B, PIR-B, KIR family receptors, TIM-1, TEVI-3, TEVI-4, LAG-3, GITR, 4-IBB, OX-40, BTLA, SIRP, CD47, CD48, 2B4 (CD244), B7.1, B7.2, ILT- 2, ILT-4, TIGIT, HHLA2, butyrophilins, IDO, CD39, CD73 and A2aR.
47. The method of claim 46, wherein the immune checkpoint is selected from the group consisting of PD-1, PD-Ll, and PD-L2, optionally wherein the immune checkpoint is PD-1.
48. The method of any one of claims 29-47, wherein the one or more biomarker comprise a nucleic acid sequence having at least 95% identity to a nucleic acid sequence
listed in Table 1 and/or an amino acid sequence having at least 95% identity to an amino acid sequence listed in Table 1.
49. The method of any one of claims 29-48, wherein the one or more biomarkers are human, mouse, chimeric, or a fusion.
50. The method of any one of claims 29-49, wherein the agent reduces the number of proliferating cells in the cancer and/or reduces the volume or size of a tumor comprising the cancer cells.
51. The method of any one of claims 29-50, wherein the one or more biomarkers comprise an amino acid sequence listed in Table 1, optionally wherein the amino acid sequence is selected from the group consisting of SEQ ID Nos: 2, 4, 6, 9, 11, 14, 16, 18, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 42, 44, 47, 49, 51, 54, 57, 60, 62, 64, 66, 68, 73, 76, 78, 80, 83, 86, and 88.
52. The method of any one of claims 29-51, wherein the one or more biomarkers are encoded by a nucleic acid sequence listed in Table 1, optionally wherein the nucleic acid sequence is selected from the group consisting of SEQ ID Nos: 1, 3, 5, 7, 8, 10, 12, 13, 15, 17, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 41, 43, 45, 46, 48, 50, 52, 53, 55, 56, 58, 59, 61, 63, 65, 67, 69-72, 74, 75, 77, 79, 81, 82, 84, 85, and 87.
53. The method of any one of claims 29-52, wherein the cancer is melanoma.
54. The method of any one of claims 29-53, wherein the subject is an animal model of the cancer, preferably a mouse model, or a human.
55. The method of any one of claims 29-54, further comprising administering to the subject at least one additional cancer therapy or regimen, optionally wherein the at least one additional cancer therapy or regimen is administered before, after, or concurrently with the agent and/or the immunotherapy.
56. The method of any one of claims 29-55, wherein the agent is administered in a pharmaceutically acceptable formulation.
57. A method of determining whether a subject afflicted with a cancer or at risk for developing a cancer would benefit from inhibiting the copy number, amount, and/or activity of at least one biomarker listed in Table 1, the method comprising:
a) obtaining a biological sample from the subject;
b) determining the copy number, amount, and/or activity of at least one biomarker listed in Table 1;
c) determining the copy number, amount, and/or activity of the at least one biomarker in a control; and
d) comparing the copy number, amount, and/or activity of the at least one biomarker detected in steps b) and c);
wherein the presence of, or a significant increase in, the copy number, amount, and/or activity of, the at least one biomarker listed in Table 1 in the subject sample relative to the control copy number, amount, and/or activity of the at least one biomarker indicates that the subject afflicted with the cancer or at risk for developing the cancer would benefit from inhibiting the copy number, amount, and/or activity of the at least one biomarker listed in Table 1.
58. The method of claim 57, further comprising recommending, prescribing, or administering an agent that inhibits the at least one biomarker listed in Table 1 if the cancer is determined to benefit from the agent, optionally further administering at least one additional cancer therapy that is administered before, after, or concurrently with the agent.
59. The method of claim 57, further comprising recommending, prescribing, or administering cancer therapy other than an agent that inhibits the at least one biomarker listed in Table 1 if the cancer is determined to not benefit from the agent.
60. The method of claim 58 or 59, wherein the cancer therapy is selected from the group consisting of immunotherapy, targeted therapy, chemotherapy, radiation therapy, hormonal therapy, an anti-cancer vaccine, an anti-cancer virus, and a checkpoint inhibitor.
61. The method of any one of claims 57-60, wherein the control sample is determined from a cancerous or non-cancerous sample from either the patient or a member of the same species to which the patient belongs.
62. The method of any one of claims 57-61, wherein the control sample comprises cells.
63. A method for predicting the clinical outcome of a subject afflicted with a cancer expressing one or more biomarkers listed in Table 1 or a fragment thereof to treatment with an immunotherapy, the method comprising:
a) determining the copy number, amount, and/or activity of at least one biomarker listed in Table 1 in a subject sample;
b) determining the copy number, amount, and/or activity of the at least one biomarker in a control having a good clinical outcome; and
c) comparing the copy number, amount, and/or activity of the at least one biomarker in the subject sample and in the control;
wherein the presence of, or a significant increase in, the copy number, amount, and/or activity of, the at least one biomarker listed in Table 1 in the subject sample as compared to the copy number, amount and/or activity in the control, is an indication that the subject has a poor clinical outcome.
64. A method for monitoring the progression of a cancer in a subject, wherein the subject is administered a therapeutically effective amount of an agent that inhibits the copy number, amount, and/or activity of at least one biomarker listed in Table 1 and an immunotherapy, the method comprising:
a) detecting in a subject sample at a first point in time the copy number, amount, and/or activity of at least one biomarker listed in Table 1;
b) repeating step a) at a subsequent point in time; and
c) comparing the amount or activity of at least one biomarker listed in Table 1 detected in steps a) and b) to monitor the progression of the cancer in the subject.
65. A method of assessing the efficacy of an agent that inhibits the copy number, amount, and/or activity of at least one biomarker listed in Table 1 and an immunotherapy for treating a cancer in a subject, comprising:
a) detecting in a subject sample at a first point in time the copy number, amount, and/or or activity of at least one biomarker listed in Table 1;
b) repeating step a) during at least one subsequent point in time after administration of the agent and the immunotherapy; and
c) comparing the copy number, amount, and/or activity detected in steps a) and b), wherein the absence of, or a significant decrease in, the copy number, amount, and/or activity of, the at least one biomarker listed in Table 1, in the subsequent sample as
compared to the copy number, amount, and/or activity in the sample at the first point in time, indicates that the agent and immunotherapy treats the cancer in the subject.
66. The method of claim 64 or 65, wherein between the first point in time and the subsequent point in time, the subject has undergone treatment, completed treatment, and/or is in remission for the cancer.
67. The method of claim 66, wherein the cancer treatment is selected from the group consisting of immunotherapy, targeted therapy, chemotherapy, radiation therapy, hormonal therapy, an anti-cancer vaccine, an anti-cancer virus, and a checkpoint inhibitor.
68. The method of any one of claims 64-67, wherein the first and/or at least one subsequent sample is selected from the group consisting of ex vivo and in vivo samples.
69. The method of any one of claims 64-68, wherein the first and/or at least one subsequent sample is a portion of a single sample or pooled samples obtained from the subject.
70. The method of any one of claims 57-69, wherein the sample comprises cells, serum, peritumoral tissue, and/or intratumoral tissue obtained from the subject.
71. The method of any one of claims 57-70, wherein the one or more biomarkers listed in Table 1 comprise RIPKl, BIRC2, TBKl, TRAF3, RNF31, RBCKl, OTULIN, TRAF6,
TAB2, and/or TNIP1.
72. The method of any one of claims 57-71, wherein the cancer is melanoma.
73. The method of any one of claims 57-72, wherein the cancer is in a subject and the subject is a mammal.
74. The method of claim 73, wherein the mammal is a mouse or a human.
75. The method of claim 74, wherein the mammal is a human.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US16/629,173 US20200300859A1 (en) | 2017-07-14 | 2018-07-16 | Modulating biomarkers to increase tumor immunity and improve the efficacy of cancer immunotherapy |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201762532593P | 2017-07-14 | 2017-07-14 | |
| US62/532,593 | 2017-07-14 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2019014663A1 true WO2019014663A1 (en) | 2019-01-17 |
Family
ID=65001837
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2018/042241 Ceased WO2019014663A1 (en) | 2017-07-14 | 2018-07-16 | Modulating biomarkers to increase tumor immunity and improve the efficacy of cancer immunotherapy |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US20200300859A1 (en) |
| WO (1) | WO2019014663A1 (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111690742A (en) * | 2020-04-14 | 2020-09-22 | 王继龙 | Application of de-linear ubiquitination enzyme FAM105B in diagnosis, treatment and prognosis judgment of liver cancer |
| WO2021178525A1 (en) * | 2020-03-03 | 2021-09-10 | The University Of Chicago | Compositions and methods for treating or preventing cancer using deubiquitinase inhibitors |
| US11591390B2 (en) | 2018-09-27 | 2023-02-28 | Celgene Corporation | SIRP-α binding proteins and methods of use thereof |
| US12084499B2 (en) | 2018-09-27 | 2024-09-10 | Celgene Corporation | SIRP-α binding proteins and methods of use thereof |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114765061B (en) * | 2021-01-15 | 2024-12-27 | 深圳哲源生物科技有限责任公司 | Data processing system and method for adverse prognosis of PD-1/PD-L1 inhibitors |
| CN113917150B (en) * | 2021-09-10 | 2023-03-07 | 北京大学 | Tumor marker related to acetylation of K264 site of p62 and application thereof |
| CN113913511B (en) * | 2021-11-19 | 2023-05-23 | 中国人民解放军军事科学院军事医学研究院 | Application of OTULINs in preparation of reagent for diagnosing and treating cilia-related diseases |
| CN114487405B (en) * | 2022-01-14 | 2025-02-11 | 南昌大学第二附属医院 | Application of E3 ubiquitin ligase RBCK1 in the preparation of drugs for treating liver cancer |
| CN116004543B (en) * | 2022-09-26 | 2025-03-11 | 南通大学 | Application of TRAF6 inhibitor in preparation of medicines for treating human malignant melanoma |
| CN118222574A (en) * | 2024-04-25 | 2024-06-21 | 河南农业大学 | A Neuro-2a cell model with targeted knockout of RIPK1 gene and its application |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070105133A1 (en) * | 2005-06-13 | 2007-05-10 | The Regents Of The University Of Michigan | Compositions and methods for treating and diagnosing cancer |
| US20140010825A1 (en) * | 2012-07-05 | 2014-01-09 | The Terasaki Family Foundation | Diagnostic and therapeutic potential of HLA-E monospecific monoclonal IgG antibodies directed against tumor cell surface and soluble HLA-E |
| WO2016023918A1 (en) * | 2014-08-13 | 2016-02-18 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Prevention of tumour metastasis by inhibition of necroptosis |
| US20160122829A1 (en) * | 2013-06-06 | 2016-05-05 | Dana-Farber Cancer Institute, Inc. | Compositions and Methods for Identification, Assessment, Prevention, and Treatment of Cancer Using PD-L1 Isoforms |
| WO2017022962A1 (en) * | 2015-07-07 | 2017-02-09 | 가톨릭대학교 산학협력단 | Composition for preventing or treating immune disease, comprising ripk inhibitor as active ingredient |
-
2018
- 2018-07-16 WO PCT/US2018/042241 patent/WO2019014663A1/en not_active Ceased
- 2018-07-16 US US16/629,173 patent/US20200300859A1/en not_active Abandoned
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070105133A1 (en) * | 2005-06-13 | 2007-05-10 | The Regents Of The University Of Michigan | Compositions and methods for treating and diagnosing cancer |
| US20140010825A1 (en) * | 2012-07-05 | 2014-01-09 | The Terasaki Family Foundation | Diagnostic and therapeutic potential of HLA-E monospecific monoclonal IgG antibodies directed against tumor cell surface and soluble HLA-E |
| US20160122829A1 (en) * | 2013-06-06 | 2016-05-05 | Dana-Farber Cancer Institute, Inc. | Compositions and Methods for Identification, Assessment, Prevention, and Treatment of Cancer Using PD-L1 Isoforms |
| WO2016023918A1 (en) * | 2014-08-13 | 2016-02-18 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Prevention of tumour metastasis by inhibition of necroptosis |
| WO2017022962A1 (en) * | 2015-07-07 | 2017-02-09 | 가톨릭대학교 산학협력단 | Composition for preventing or treating immune disease, comprising ripk inhibitor as active ingredient |
Non-Patent Citations (1)
| Title |
|---|
| MANGUSO ET AL.: "In vivo CRISPR screening identifies Ptpn2 as a cancer immunotherapy target", NATURE, vol. 547, no. 7664, 19 July 2017 (2017-07-19), pages 413 - 418, XP055566515 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11591390B2 (en) | 2018-09-27 | 2023-02-28 | Celgene Corporation | SIRP-α binding proteins and methods of use thereof |
| US12084499B2 (en) | 2018-09-27 | 2024-09-10 | Celgene Corporation | SIRP-α binding proteins and methods of use thereof |
| WO2021178525A1 (en) * | 2020-03-03 | 2021-09-10 | The University Of Chicago | Compositions and methods for treating or preventing cancer using deubiquitinase inhibitors |
| CN111690742A (en) * | 2020-04-14 | 2020-09-22 | 王继龙 | Application of de-linear ubiquitination enzyme FAM105B in diagnosis, treatment and prognosis judgment of liver cancer |
| CN111690742B (en) * | 2020-04-14 | 2023-06-02 | 王继龙 | Application of delinear ubiquitinase FAM105B in the diagnosis, treatment and prognosis of liver cancer |
Also Published As
| Publication number | Publication date |
|---|---|
| US20200300859A1 (en) | 2020-09-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2019201577B2 (en) | Cancer diagnostics using biomarkers | |
| US20200300859A1 (en) | Modulating biomarkers to increase tumor immunity and improve the efficacy of cancer immunotherapy | |
| US11873486B2 (en) | Modulating dsRNA editing, sensing, and metabolism to increase tumor immunity and improve the efficacy of cancer immunotherapy and/or modulators of intratumoral interferon | |
| US12404557B2 (en) | Biomarkers predictive of anti-immune checkpoint response | |
| AU2017235661B2 (en) | Oligonucleotide probes and uses thereof | |
| KR102301464B1 (en) | Methods and compositions for reducing immunosupression by tumor cells | |
| EP4161658A1 (en) | Methods for modulating mhc-i expression and immunotherapy uses thereof | |
| US11740242B2 (en) | Modulating biomarkers to increase tumor immunity and improve the efficacy of cancer immunotherapy | |
| CN113383085A (en) | Method and system for analyzing nucleic acid molecules | |
| US20250283871A1 (en) | Compositions and methods for modulating the interaction between ss18-ssx fusion oncoprotein and nucleosomes | |
| WO2021150925A1 (en) | Uses of biomarkers for improving immunotherapy | |
| WO2018148378A1 (en) | Modulating biomarkers to increase tumor immunity and improve the efficiacy of cancer immunotherapy | |
| KR20110015409A (en) | Gene Expression Markers for Inflammatory Bowel Disease | |
| KR20160117606A (en) | Molecular diagnostic test for predicting response to anti-angiogenic drugs and prognosis of cancer | |
| KR20140140069A (en) | Compositions and methods for diagnosis and treatment of pervasive developmental disorder | |
| KR20230110373A (en) | Genetically modified cells, tissues, and organs for treating disease | |
| WO2021162981A2 (en) | Methods and compositions for identifying castration resistant neuroendocrine prostate cancer | |
| US20200149042A1 (en) | Modulating biomarkers to increase tumor immunity and improve the efficacy of cancer immunotherapy | |
| US20210032334A1 (en) | Methods for treating cancer using combinations of anti-btnl2 and immune checkpoint blockade agents | |
| US10947596B2 (en) | Compositions and methods for identification, assessment, prevention, and treatment of cancer using NFS1 biomarkers and modulators | |
| WO2019143880A1 (en) | Biomarkers predictive of anti-immune checkpoint response | |
| US12050219B2 (en) | Modulating biomarkers such as SPP to increase tumor immunity and improve the efficacy of cancer immunotherapy | |
| US20220289854A1 (en) | Methods for treating cancer using combinations of anti-cx3cr1 and immune checkpoint blockade agents | |
| US12478665B2 (en) | Cancer vaccine compositions and methods for using same to prevent and/or treat cancer | |
| CN115698719A (en) | Methods and compositions for cancer immunotherapy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18831371 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 18831371 Country of ref document: EP Kind code of ref document: A1 |