WO2019014464A1 - Methods for generating pluripotent stem cells - Google Patents
Methods for generating pluripotent stem cells Download PDFInfo
- Publication number
- WO2019014464A1 WO2019014464A1 PCT/US2018/041851 US2018041851W WO2019014464A1 WO 2019014464 A1 WO2019014464 A1 WO 2019014464A1 US 2018041851 W US2018041851 W US 2018041851W WO 2019014464 A1 WO2019014464 A1 WO 2019014464A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cells
- ipscs
- increased
- treatment
- pluripotent
- Prior art date
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/48—Reproductive organs
- A61K35/54—Ovaries; Ova; Ovules; Embryos; Foetal cells; Germ cells
- A61K35/545—Embryonic stem cells; Pluripotent stem cells; Induced pluripotent stem cells; Uncharacterised stem cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0696—Artificially induced pluripotent stem cells, e.g. iPS
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2500/00—Specific components of cell culture medium
- C12N2500/30—Organic components
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/60—Transcription factors
- C12N2501/602—Sox-2
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/60—Transcription factors
- C12N2501/603—Oct-3/4
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/60—Transcription factors
- C12N2501/604—Klf-4
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/60—Transcription factors
- C12N2501/606—Transcription factors c-Myc
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
Definitions
- iPSCs induced pluripotent stem cells
- the present technology relates generally to methods for generating iPSCs from non- pluripotent cells, such as aged somatic cells, wherein the iPSCs are characterized by improved genomic stability, improved DNA damage response, increased ZSCAN10 expression, reduced glutathione synthetase (GSS) expression, and/or increased reprogramming efficiency.
- iPSCs Induced pluripotent stem cells hold enormous potential for generating histocompatible transplantable tissue using a patient' s own somatic cells. While older patients are more likely to suffer from degenerative diseases and benefit from iPSC-based therapies, both basic and clinical researchers have reported mitochondrial and genomic mutations or instability of iPSC generated from aged donor tissue (A-iPSC).
- a clinical trial reported two cases of transplantation of retinal pigment epithelium (RPE) differentiated from autologous iPSC to treat age-related macular degeneration (AMD).
- RPE retinal pigment epithelium
- AMD age-related macular degeneration
- the present disclosure provides a method of producing induced pluripotent stem cells (iPSCs) from mammalian non-pluripotent cells, wherein the iPSCs are characterized by one or more of increased genomic stability, increased DNA damage response, increased ZSCAN10 expression, and reduced glutathione synthetase (GSS) expression, the method comprising: culturing non-pluripotent cells treated with an effective amount of glutathione or derivatives thereof prior to the initiation of reprogramming, during
- iPSCs reprogramming, and/or after reprogramming of the non-pluripotent cells under conditions that allow for the production of iPSCs, thereby producing iPSCs with one or more of increased genomic stability, increased DNA damage response, increased ZSCAN10 expression, and reduced GSS expression as compared to iPSCs produced from untreated control non-pluripotent cells grown under similar conditions.
- the method further comprises identifying non-pluripotent cells for treatment with glutathione or derivatives thereof, wherein the non-pluripotent cells identified for treatment express an elevated cellular reactive oxygen species (ROS) level prior to treatment relative to that observed in untreated control non-pluripotent cells, wherein the elevated cellular ROS level identifies the non-pluripotent cells for treatment with glutathione or derivatives thereof and the lack of the elevated cellular ROS level does not identify the non-pluripotent cells for treatment with glutathione or derivatives thereof.
- ROS reactive oxygen species
- the efficiency of reprogramming the non-pluripotent cells treated with glutathione or derivatives thereof is increased relative to untreated control non- pluripotent cells.
- treatment with the glutathione or derivatives thereof increases the efficiency of reprogramming the non-pluripotent cells into iPSCs by at least 10-fold relative to untreated control non-pluripotent cells.
- treatment with glutathione or derivatives thereof restores ZSCAN10 expression levels in iPSCs to about 50% or more of the respective expression levels of embryonic stem cells (ESCs).
- ESCs embryonic stem cells
- the mammalian non-pluripotent cells are somatic cells.
- the somatic cells are aged somatic cells.
- the somatic cells are somatic cells from an embryonic stage.
- the somatic cells express an increased cellular ROS level relative to that observed in young somatic cells.
- the somatic cells are incapable of generating iPSCs.
- the somatic cells are selected from the group consisting of: fibroblast cells, cells from blood, cells from ocular tissue, epithelial cells, osteocytes,
- the mammalian non- pluripotent cells are progenitor cells.
- the present disclosure provides induced pluripotent stem cells (iPSCs) produced by a method of producing iPSCs from mammalian non-pluripotent cells, wherein the iPSCs are characterized by one or more of increased genomic stability, increased DNA damage response, increased ZSCANIO expression, and reduced glutathione synthetase (GSS) expression, the method comprising: culturing non-pluripotent cells treated with an effective amount of glutathione or derivatives thereof prior to the initiation of reprogramming, during
- iPSCs produced from the non-pluripotent cells treated with glutathione or derivatives thereof are characterized by one or more of increased genomic stability, increased DNA damage response, increased iPSC reprogramming efficiency, increased ZSCANIO expression, and reduced GSS expression as compared to iPSCs produced from untreated control non-pluripotent cells grown under similar conditions.
- the iPSCs are characterized by increased genomic stability as compared to iPSCs produced from untreated control non-pluripotent cells grown under similar conditions.
- the iPSCs are characterized by increased DNA damage response as compared to iPSCs produced from untreated control non-pluripotent cells grown under similar conditions.
- the iPSCs are characterized by increased ZSCANIO expression as compared to iPSCs produced from untreated control non-pluripotent cells grown under similar conditions.
- the iPSCs are characterized by reduced GSS expression as compared to iPSCs produced from untreated control non-pluripotent cells grown under similar conditions.
- the iPSCs are characterized by increased iPSC reprogramming efficiency as compared to iPSCs produced from untreated control non-pluripotent cells grown under similar conditions.
- the glutathione is glutathione reduced ethyl ester.
- the present disclosure provides a method of producing induced pluripotent stem cells derived from aged somatic cells (A-iPSCs) having one or more of increased genomic stability, increased DNA damage response, increased ZSCAN10 expression, and reduced glutathione synthetase (GSS) expression, the method comprising: culturing aged somatic cells treated with an effective amount of glutathione or derivatives thereof prior to the initiation of reprogramming, during reprogramming, and/or after reprogramming of the aged somatic cells under conditions that allow for the production of A-iPSCs, thereby producing A- iPSCs with one or more of increased genomic stability, increased DNA damage response, increased iPSC reprogramming efficiency, increased ZSCAN10 expression, and reduced GSS expression as compared to that observed in A-iPSCs produced from untreated control aged somatic cells grown under similar conditions and/or comparable to that observed in young iPSCs (Y-iPSCs) or ESCs.
- A-iPSCs aged so
- the method further comprises identifying aged somatic cells for treatment with glutathione or derivatives thereof, wherein the aged somatic cells identified for treatment express an elevated cellular reactive oxygen species (ROS) level prior to treatment relative to one or more of untreated control aged somatic cells, young somatic cells, and ESCs, wherein the elevated cellular ROS level identifies the aged somatic cells for treatment with glutathione or derivatives thereof and the lack of the elevated cellular ROS level does not identify the aged somatic cells for treatment with glutathione or derivatives thereof.
- ROS reactive oxygen species
- the present disclosure provides A-iPSCs produced by a method of producing A-iPSCs having one or more of increased genomic stability, increased DNA damage response, increased iPSC reprogramming efficiency, increased ZSCAN10 expression, and reduced glutathione synthetase (GSS) expression, the method comprising: culturing aged somatic cells treated with an effective amount of glutathione or derivatives thereof prior to the initiation of reprogramming, during reprogramming, and/or after reprogramming of the aged somatic cells under conditions that allow for the production of A-iPSCs, wherein the A-iPSCs produced from the aged somatic cells treated with glutathione or derivatives thereof are characterized by one or more of increased genomic stability, increased DNA damage response, increased iPSC reprogramming efficiency, increased ZSCAN10 expression, and reduced GSS expression as compared to that observed in A-iPSCs produced from untreated control aged somatic cells grown under similar conditions and/or comparable to that observed in young
- the A- iPSCs are characterized by increased genomic stability as compared to A-iPSCs produced from untreated control aged somatic cells grown under similar conditions and/or comparable to that observed in young iPSCs (Y-iPSCs) or ESCs.
- the A- iPSCs are characterized by increased DNA damage response as compared to A-iPSCs produced from untreated control aged somatic cells grown under similar conditions and/or comparable to that observed in young iPSCs (Y-iPSCs) or ESCs.
- the A- iPSCs are characterized by increased iPSC
- the A- iPSCs are characterized by increased ZSCAN10 expression as compared to A-iPSCs produced from untreated control aged somatic cells grown under similar conditions and/or comparable to that observed in young iPSCs (Y-iPSCs) or ESCs.
- the A- iPSCs are characterized by reduced glutathione synthetase (GSS) expression as compared to A-iPSCs produced from untreated control aged somatic cells grown under similar conditions and/or comparable to that observed in young iPSCs (Y-iPSCs) or ESCs.
- GSS glutathione synthetase
- the glutathione is glutathione reduced ethyl ester.
- the present disclosure provides a method of producing pluripotent stem cells including embryonic stem cell derivation from blastocyst, parthenogenetic ES cells, nuclear transferred ES cells to improve genomic stability, derivation efficiency, and reprogramming quality comprising: culturing embryos treated with an effective amount of glutathione or derivatives thereof prior to the initiation of reprogramming and/or during reprogramming of the embryos under conditions that allow for the production of ES cells, parthenogenetic ES cells, nuclear transferred ES cells to minimize the oxidative stress (ROS)-mediated inhibitory effects during reprogramming of the pluripotent stem cells, thereby producing pluripotent stem cells with one or more of improved genomic stability, improved DNA damage response,
- ROS oxidative stress
- the present disclosure provides a method for stem cell therapy comprising: (a) isolating a non-pluripotent cell from a subject; (b) producing an iPSC by a method of producing iPSCs from mammalian non-pluripotent cells, wherein the iPSCs are characterized by one or more of increased genomic stability, increased DNA damage response, increased ZSCANIO expression, and reduced glutathione synthetase (GSS) expression, the method comprising: culturing non-pluripotent cells treated with an effective amount of glutathione or derivatives thereof prior to the initiation of reprogramming, during
- iPSCs produced from the non-pluripotent cells treated with glutathione or derivatives thereof are characterized by one or more of increased genomic stability, increased DNA damage response, increased iPSC reprogramming efficiency, increased ZSCANIO expression, and reduced GSS expression as compared to iPSCs produced from untreated control non-pluripotent cells grown under similar conditions; (c) differentiating the iPSC ex vivo into a differentiated cell; and (d) administering the differentiated cell to the subject.
- the present disclosure provides a method for stem cell therapy comprising: (a) isolating an aged somatic cell from a subject; (b) producing an A-iPSC by a method of producing A-iPSCs having one or more of increased genomic stability, increased DNA damage response, increased iPSC reprogramming efficiency, increased ZSCANIO expression, and reduced glutathione synthetase (GSS) expression, the method comprising: culturing aged somatic cells treated with an effective amount of glutathione or derivatives thereof prior to the initiation of reprogramming, during reprogramming, and/or after reprogramming of the aged somatic cells under conditions that allow for the production of A- iPSCs, wherein the A-iPSCs produced from the aged somatic cells treated with glutathione or derivatives thereof are characterized by one or more of increased genomic stability, increased DNA damage response, increased iPSC reprogramming efficiency, increased ZSCANIO expression, and reduced GSS expression as compared to
- the elevated cellular ROS level of the non-pluripotent cells identified for treatment is defined by a metabolic profile comprising one or more metabolites exhibiting increased levels relative to that observed in untreated control non-pluripotent cells.
- the one or more metabolites exhibiting increased levels is selected from the group consisting of adenosine, cytidine, xanthine, and cytidine 3'
- the elevated cellular ROS level of the non-pluripotent cells identified for treatment is defined by an increased gene expression level of one or more genes selected from the group consisting of ST6GALNAC6, IGFBP5, PDGFD, SURF4, BOC, ADGRDl, MPDUl, RPS4Y1, MME, SET, DOKl, COLEC12, HOXCIO, SULF2, ADAMTSLl, ELN, MGRN1, COL15A1, ZEB1, SFRP1, CLDN11, LGALS3BP, CHI3L1, SPG21, PI16, and MCFD2 relative to that observed in untreated control non-pluripotent cells.
- genes selected from the group consisting of ST6GALNAC6, IGFBP5, PDGFD, SURF4, BOC, ADGRDl, MPDUl, RPS4Y1, MME, SET, DOKl, COLEC12, HOXCIO, SULF2, ADAMTSLl, ELN, MGRN1,
- the gene expression level of the one or more genes in the non- pluripotent cells identified for treatment is increased by about 2-fold to about 5-fold relative to that observed in untreated control non-pluripotent cells.
- the gene expression level of the one or more genes in the non- pluripotent cells identified for treatment is increased by about 5-fold relative to that observed in untreated control non-pluripotent cells.
- the elevated cellular ROS level of the non-pluripotent cells identified for treatment is defined by an increased cellular G-quadruplex (G4) DNA structure formation relative to that observed in untreated control non-pluripotent cells.
- G4 G-quadruplex
- the G4 DNA structure formation in the non-pluripotent cells identified for treatment is increased by about 2-fold relative to that observed in untreated control non-pluripotent cells.
- the elevated cellular ROS level of the non-pluripotent cells identified for treatment is defined by an increased 8-oxo-guanine (oxoG) formation relative to that observed in untreated control non-pluripotent cells.
- oxoG 8-oxo-guanine
- the oxoG formation in the non-pluripotent cells identified for treatment is increased by about 2-fold to about 3-fold relative to that observed in untreated control non-pluripotent cells.
- the elevated cellular ROS level of the aged somatic cells identified for treatment is defined by a metabolic profile comprising one or more metabolites exhibiting increased levels relative to that observed in one or more of untreated control aged somatic cells, young somatic cells, and ESCs.
- the one or more metabolites exhibiting increased levels is selected from the group consisting of adenosine, cytidine, xanthine, and cytidine 3'
- the elevated cellular ROS level of the aged somatic cells identified for treatment is defined by an increased gene expression level of one or more genes selected from the group consisting of ST6GALNAC6, IGFBP5, PDGFD, SURF4, BOC, ADGRDl, MPDUl, RPS4Y1, MME, SET, DOKl, COLEC12, HOXCIO, SULF2, ADAMTSLl, ELN, MGRN1, COL15A1, ZEB1, SFRP1, CLDN11, LGALS3BP, CHI3L1, SPG21, PI16, and MCFD2 relative to that observed in one or more of untreated control aged somatic cells, young somatic cells, and ESCs.
- genes selected from the group consisting of ST6GALNAC6, IGFBP5, PDGFD, SURF4, BOC, ADGRDl, MPDUl, RPS4Y1, MME, SET, DOKl, COLEC12, HOXCIO, SULF2, ADAMTSLl,
- the gene expression level of the one or more genes in the aged somatic cells identified for treatment is increased by about 2-fold to about 5-fold relative to that observed in one or more of untreated control aged somatic cells, young somatic cells, and ESCs.
- the gene expression level of the one or more genes in the aged somatic cells identified for treatment is increased by about 5-fold relative to that observed in one or more of untreated control aged somatic cells, young somatic cells, and ESCs.
- the elevated cellular ROS level of the aged somatic cells identified for treatment is defined by an increased cellular G-quadruplex (G4) DNA structure formation relative to that observed in one or more of untreated control aged somatic cells, young somatic cells, and ESCs.
- G4 G-quadruplex
- the G4 DNA structure formation in the aged somatic cells identified for treatment is increased by about 2-fold relative to that observed in one or more of untreated control aged somatic cells, young somatic cells, and ESCs.
- the elevated cellular ROS level of the aged somatic cells identified for treatment is defined by an increased 8-oxo-guanine (oxoG) formation relative to that observed in one or more of untreated control aged somatic cells, young somatic cells, and ESCs.
- the oxoG formation in the aged somatic cells identified for treatment is increased by about 2-fold to about 3-fold relative to that observed in one or more of untreated control aged somatic cells, young somatic cells, and ESCs.
- the method further comprises identifying embryonic stem cell derivation from blastocyst, parthenogenetic ES cells, or nuclear transferred ES cells for treatment with glutathione or derivatives thereof, wherein the embryonic stem cell derivation from blastocyst, parthenogenetic ES cells, or nuclear transferred ES cells identified for treatment express an elevated reactive oxygen species (ROS) level prior to treatment relative to one or more of untreated control embryonic stem cell derivation from blastocyst, parthenogenetic ES cells, or nuclear transferred ES cells, wherein the elevated cellular ROS level identifies the embryonic stem cell derivation from blastocyst, parthenogenetic ES cells, or nuclear transferred ES cells for treatment with glutathione or derivatives thereof and the lack of the elevated cellular ROS level does not identify the embryonic stem cell derivation from blastocyst, parthenogenetic ES cells, or nuclear transferred ES cells for treatment with glutathione or derivatives thereof.
- ROS reactive oxygen species
- the elevated cellular ROS level of the embryonic stem cell derivation from blastocyst, parthenogenetic ES cells, or nuclear transferred ES cells identified for treatment is defined by a metabolic profile comprising one or more metabolites exhibiting increased levels relative to that observed in one or more of untreated control embryonic stem cell derivation from blastocyst, parthenogenetic ES cells, or nuclear transferred ES cells.
- the one or more metabolites exhibiting increased levels is selected from the group consisting of adenosine, cytidine, xanthine, and cytidine 3'
- the elevated cellular ROS level of the embryonic stem cell derivation from blastocyst, parthenogenetic ES cells, or nuclear transferred ES cells identified for treatment is defined by an increased gene expression level of one or more genes selected from the group consisting of ST6GALNAC6, IGFBP5, PDGFD, SURF4, BOC, ADGRD1, MPDU1, RPS4Y1, MME, SET, DOK1, COLEC12, HOXC10, SULF2, ADAMTSL1, ELN, MGRN1, COL15A1, ZEB1, SFRP1, CLDN11, LGALS3BP, CHI3L1, SPG21, PI16, and MCFD2 relative to that observed in one or more of untreated control embryonic stem cell derivation from blastocyst, parthenogenetic ES cells, or nuclear transferred ES cells.
- the gene expression level of the one or more genes in the embryonic stem cell derivation from blastocyst, parthenogenetic ES cells, or nuclear transferred ES cells identified for treatment is increased by about 2-fold to about 5-fold relative to that observed in one or more of untreated control embryonic stem cell derivation from blastocyst, parthenogenetic ES cells, or nuclear transferred ES cells.
- the gene expression level of the one or more genes in the embryonic stem cell derivation from blastocyst, parthenogenetic ES cells, or nuclear transferred ES cells identified for treatment is increased by about 5-fold relative to that observed in one or more of untreated control embryonic stem cell derivation from blastocyst, parthenogenetic ES cells, or nuclear transferred ES cells.
- the elevated cellular ROS level of the embryonic stem cell derivation from blastocyst, parthenogenetic ES cells, or nuclear transferred ES cells identified for treatment is defined by an increased cellular G-quadruplex (G4) DNA structure formation relative to that observed in one or more of untreated control embryonic stem cell derivation from blastocyst, parthenogenetic ES cells, or nuclear transferred ES cells.
- G4 G-quadruplex
- the G4 DNA structure formation in the embryonic stem cell derivation from blastocyst, parthenogenetic ES cells, or nuclear transferred ES cells identified for treatment is increased by about 2-fold relative to that observed in one or more of untreated control embryonic stem cell derivation from blastocyst, parthenogenetic ES cells, or nuclear transferred ES cells.
- the elevated ROS level of the embryonic stem cell derivation from blastocyst, parthenogenetic ES cells, or nuclear transferred ES cells identified for treatment is defined by an increased 8-oxo-guanine (oxoG) formation relative to that observed in one or more of untreated control embryonic stem cell derivation from blastocyst, parthenogenetic ES cells, or nuclear transferred ES cells.
- oxoG 8-oxo-guanine
- the oxoG formation in the embryonic stem cell derivation from blastocyst, parthenogenetic ES cells, or nuclear transferred ES cells identified for treatment is increased by about 2-fold to about 3-fold relative to that observed in one or more of untreated control embryonic stem cell derivation from blastocyst, parthenogenetic ES cells, or nuclear transferred ES cells.
- the present disclosure provides a method for stem cell therapy
- iPSCs produced from the non-pluripotent cells treated with glutathione or derivatives thereof are characterized by one or more of increased genomic stability, increased DNA damage response, increased iPSC reprogramming efficiency, increased ZSCAN10 expression, and reduced GSS expression as compared to iPSCs produced from untreated control non-pluripotent cells grown under similar conditions, wherein the non- pluripotent cells identified for treatment express an elevated cellular reactive oxygen species (ROS) level prior to treatment relative to that observed in untreated control non-pluripotent cells, wherein the elevated cellular ROS level identifies the non-pluripotent cells for treatment with glutathione or derivatives thereof and the lack of the elevated cellular ROS level does not identify the non-pluripotent cells for treatment with glutathione or derivatives thereof; (c) differentiating the iPSC ex vivo
- ROS reactive oxygen species
- the elevated cellular ROS level of the non-pluripotent cells identified for treatment is defined by a metabolic profile comprising one or more metabolites exhibiting increased levels relative to that observed in untreated control non-pluripotent cells.
- the one or more metabolites exhibiting increased levels is selected from the group consisting of adenosine, cytidine, xanthine, and cytidine 3'
- the elevated cellular ROS level of the non-pluripotent cells identified for treatment is defined by an increased gene expression level of one or more genes selected from the group consisting of ST6GALNAC6, IGFBP5, PDGFD, SURF4, BOC, ADGRDl, MPDUl, RPS4Y1, MME, SET, DOKl, COLEC12, HOXCIO, SULF2, ADAMTSLl, ELN, MGRNl, COL15A1, ZEBl, SFRPl, CLDNl l, LGALS3BP, CHI3L1, SPG21, PI16, and MCFD2 relative to that observed in untreated control non-pluripotent cells.
- genes selected from the group consisting of ST6GALNAC6, IGFBP5, PDGFD, SURF4, BOC, ADGRDl, MPDUl, RPS4Y1, MME, SET, DOKl, COLEC12, HOXCIO, SULF2, ADAMTSLl, ELN
- the gene expression level of the one or more genes in the non- pluripotent cells identified for treatment is increased by about 2-fold to about 5-fold relative to that observed in untreated control non-pluripotent cells.
- the gene expression level of the one or more genes in the non- pluripotent cells identified for treatment is increased by about 5-fold relative to that observed in untreated control non-pluripotent cells.
- the elevated cellular ROS level of the non-pluripotent cells identified for treatment is defined by an increased cellular G-quadruplex (G4) DNA structure formation relative to that observed in untreated control non-pluripotent cells.
- G4 G-quadruplex
- the G4 DNA structure formation in the non-pluripotent cells identified for treatment is increased by about 2-fold relative to that observed in untreated control non-pluripotent cells.
- the elevated cellular ROS level of the non-pluripotent cells identified for treatment is defined by an increased 8-oxo-guanine (oxoG) formation relative to that observed in untreated control non-pluripotent cells.
- oxoG 8-oxo-guanine
- the oxoG formation in the non-pluripotent cells identified for treatment is increased by about 2-fold to about 3-fold relative to that observed in untreated control non-pluripotent cells.
- the present disclosure provides a method for stem cell therapy comprising: (a) isolating an aged somatic cell from a subject; (b) producing an A-iPSC by a method of producing A-iPSCs having one or more of increased genomic stability, increased DNA damage response, increased iPSC reprogramming efficiency, increased ZSCAN10 expression, and reduced glutathione synthetase (GSS) expression, the method comprising:
- the aged somatic cells identified for treatment express an elevated cellular reactive oxygen species (ROS) level prior to treatment relative to one or more of untreated control aged somatic cells, young somatic cells, and ESCs, wherein the elevated cellular ROS level identifies the aged somatic cells for treatment with glutathione or derivatives thereof and the lack of the elevated cellular ROS level does not identify the aged somatic cells for treatment with glutathione or derivatives thereof;
- ROS reactive oxygen species
- the elevated cellular ROS level of the aged somatic cells identified for treatment is defined by a metabolic profile comprising one or more metabolites exhibiting increased levels relative to that observed in one or more of untreated control aged somatic cells, young somatic cells, and ESCs.
- the one or more metabolites exhibiting increased levels is selected from the group consisting of adenosine, cytidine, xanthine, and cytidine 3'
- the elevated cellular ROS level of the aged somatic cells identified for treatment is defined by an increased gene expression level of one or more genes selected from the group consisting of ST6GALNAC6, IGFBP5, PDGFD, SURF4, BOC, ADGRDl, MPDUl, RPS4Y1, MME, SET, DOKl, COLEC12, HOXCIO, SULF2, ADAMTSLl, ELN, MGRN1, COL15A1, ZEB1, SFRP1, CLDN11, LGALS3BP, CHI3L1, SPG21, PI16, and MCFD2 relative to that observed in one or more of untreated control aged somatic cells, young somatic cells, and ESCs.
- genes selected from the group consisting of ST6GALNAC6, IGFBP5, PDGFD, SURF4, BOC, ADGRDl, MPDUl, RPS4Y1, MME, SET, DOKl, COLEC12, HOXCIO, SULF2, ADAMTSLl,
- the gene expression level of the one or more genes in the aged somatic cells identified for treatment is increased by about 2-fold to about 5-fold relative to that observed in one or more of untreated control aged somatic cells, young somatic cells, and ESCs.
- the gene expression level of the one or more genes in the aged somatic cells identified for treatment is increased by about 5-fold relative to that observed in one or more of untreated control aged somatic cells, young somatic cells, and ESCs.
- the elevated cellular ROS level of the aged somatic cells identified for treatment is defined by an increased cellular G-quadruplex (G4) DNA structure formation relative to that observed in one or more of untreated control aged somatic cells, young somatic cells, and ESCs.
- G4 G-quadruplex
- the G4 DNA structure formation in the aged somatic cells identified for treatment is increased by about 2-fold relative to that observed in one or more of untreated control aged somatic cells, young somatic cells, and ESCs.
- the elevated cellular ROS level of the aged somatic cells identified for treatment is defined by an increased 8-oxo-guanine (oxoG) formation relative to that observed in one or more of untreated control aged somatic cells, young somatic cells, and ESCs.
- oxoG 8-oxo-guanine
- the oxoG formation in the aged somatic cells identified for treatment is increased by about 2-fold to about 3-fold relative to that observed in one or more of untreated control aged somatic cells, young somatic cells, and ESCs.
- the present disclosure provides a kit comprising glutathione reduced ethyl ester, reprogramming factors, and instructions for reprogramming a plurality of non-pluripotent cells.
- Figure 1 Impaired genomic integrity and DNA damage response of mouse A-iPSC compared to Y-iPSC and ESC, and recovery following transient expression of ZSCAN10.
- A Number of chromosomal abnormalities observed by cytogenetic analysis in each A-iPSC clone, and recovery with ZSCAN10 expression. Error bars indicate standard error of the mean of independent clones analyzed per group. The total number of metaphases analyzed is indicated in each group. Statistical significance was determined by two-sided t-test.
- A-iPSC show fewer cells staining for cell death compared to ESC, Y-iPSC, and A-iPSC-ZSCAN10.
- the negative control is Y-iPSC treated with dye in the absence of enzymatic reaction. Nuclei are stained with DAPI. Scale bar indicates 100 ⁇ .
- C Quantification by image-analysis of apoptotic response by DNA fragmentation assay after phleomycin treatment.
- Figure 2 Evaluation of ZSCANIO function on DNA damage response and genomic stability of mouse A-iPSC compared to Y-iPSC and ESC.
- A pATM immunoblot illustrating the differential DNA damage response of A-ntESC and A-iPSC generated from an aged tissue donor. Three independent clones of A-ntESC show a normal DNA damage response after phleomycin treatment.
- B Q-PCR of ZSCANIO mRNA levels showing poor activation of ZSCANIO expression in A-iPSC and complete activation with transient expression of
- ZSCANIO Endogenous ZSCANIO levels normalized to ⁇ -actin. Error bars indicate standard error of the mean of two technical replicates with three independent clones in each sample group. Statistical significance was determined by two-sided t-test.
- C Immunoblot showing impaired ATM/H2AX/p53 DNA damage response in Y-iPSC with ZSCANIO shRNA expression in three independent clones after phleomycin treatment (2 h, 30 ⁇ g/ml).
- D ATM/H2AX/p53-mediated DNA damage response after irradiation. ESC and Y-iPSC, but not A-iPSC, show an increase in ⁇ / ⁇ - ⁇ 2 ⁇ / ⁇ 53 level after irradiation.
- the ATM/H2AX/p53 response to irradiation in A- iPSC is recovered by transient expression of ZSCANIO.
- E Estimation of higher mutation rate in A-iPSC, and recovery with ZSCANIO expression. The mutation frequency was estimated by the inactivation of HPRT promoter activity in the presence of 6-thioguanine-mediated negative selection, and confirmed by Q-PCR. Error bars indicate standard error of the mean of three biological replicates with four independent clones in each sample group. Statistical significance was determined by two-sided t-test.
- FIG. 3 Imbalance of ROS-glutathione homeostasis in mouse A-iPSC, and recovery by ZSCANIO expression via reduction of excessively activated GSS.
- A-B ZSCANIO expression in A-iPSC influences the expression of pluripotency genes, making the A-iPSC gene expression profile more similar to that of Y-iPSC.
- Whole-genome expression profiles of aged and young fibroblast cells (A-SC, Y-SC), ESC, Y-iPSC, A-iPSC, and A-iPSC-ZSCANIO with independent clones for each somatic cells and pluripotent cells as biological repeats (n>2) were included in the analysis (A).
- PCA Principal Component Analysis
- B Heatmap shows the hierarchical clustering of samples and pairwise gene expression similarities measured by Pearson correlation coefficient.
- C Q-PCR of GSS mRNA levels indicating excessive expression in A-iPSC and downregulation with ZSCAN10
- a lower apoptotic response (DNA fragmentation assay) is seen 15 h after the end of phleomycin treatment (2 hours, 30 ⁇ g/ml) in A-iPSC, and is recovered with GSS
- FIG. 5 Impaired DNA damage response in human A-hiPSC caused by deregulation of ZSCANIO and GSS and recovered by ZSCANIO expression.
- A Excessive oxidation capacity with elevated glutathione in A-hiPSC, and recovery by ZSCANIO expression. The total glutathione level was measured to determine the maximum oxidation capacity.
- Excessive oxidation capacity of glutathione in A-hiPSC is normalized to the level of hESC and Y-hiPSC by transient expression of ZSCANIO.
- Glutathione analysis was conducted with the Glutathione Fluorometnc Assay. Mean ⁇ standard deviation is plotted for three biological replicates with two independent clones in each sample group from each condition.
- E-G Copy number profiling analysis of human iPSC. Schematic diagrams represent seven rearranged A-hiPSC, four non-rearranged A-hiPSC, and five non-rearranged A-hiPSC-ZSCAN10 in the genetically controlled setting of A-hiPSC.
- Y-hiPSC Ten non- rearranged Y-hiPSC, which were generated from different tissue donors, were also included.
- the number in parenthesis represents detected rearrangements and p and p* are the observed and estimated likelihoods of detecting no rearrangements in the absence of lineage effects using a binomial distribution, respectively.
- Schematic diagrams represent 10 non-rearranged A- iPSC with glutathione treatment, compared with seven rearranged A-iPSC from 11 clones without glutathione treatment.
- E Immunoblot of pATM showing that A-iPSC with glutathione treatment impairs the DNA damage response in the biologically independent clones after phleomycin treatment.
- Figure 7 Higher somatic cell ROS among the tissue donors as a causative origin of the genomic instability in A-iPSC and recovery by glutathione treatment in the early stage of A- iPSC reprogramming.
- A-B Somatic cell ROS measured by MitoSOX staining.
- Mitochondrial Superoxide Indicator MitoSOX Red dye (Therm oFisher, M36008) was used to measure somatic cell ROS from young somatic cells (Y-SC) from B6CBA mouse and aged somatic cells (A-SC) from B6129 and B6CBA mice (A), and human young somatic cells (Y-SC) from MRC5 donor and human aged somatic cells (A-SC) from LS and AG4 donors (B).
- FIG. 1 Immunoblot of pATM showing that A-iPSC with glutathione treatment recover the DNA damage response in the biologically independent clones after phleomycin treatment.
- A-iPSC were generated with the treatment of 3 mM glutathione reduced ethyl ester prior to and during the early stage of reprogramming (from one day before reprogramming virus infection to 10 days post reprogramming virus infection).
- H Copy number profiling analysis of human A-iPSC with glutathione treatment from 10 clones (upper panel). Schematic diagrams represent 10 non-rearranged A-iPSC with glutathione treatment, compared with seven rearranged A-iPSC from 11 clones (lower panel) without glutathione treatment in Fig.
- Figure 8 Immunoblot of pATM showing recovery of the DNA damage response after phleomycin treatment in ten independent clones of A-iPSC with BSO (0.5 mM)-mediated inhibition of GSS.
- Figures 9A-9C show an HT12 Illumina Mircroarray gene expression analysis between Aged somatic cells (A-SC (AG4)) and Young somatic cells (Y-SC (MRC5)).
- Figure 9B lists the differentially expressed genes between Aged somatic cells (AG4) and Young somatic cells (MRC5).
- Figure 9C is a pie chart dividing the differentially expressed genes between the Aged somatic cells and Young somatic cells based on molecular function.
- One gene, PRDX2 was found to be involved in redox regulation (GO: 0016209).
- Figure 10 is a table comparing the reprogramming efficiency for AG4 cells and AG4 cells treated with glutathione reduced ethyl ester according to the methods of the present technology.
- Figure 11 demonstrates the variation of oxidative stress among the human population, and oxidative stress control of the G-quadruplex DNA structure. Basal oxidative stress levels in somatic cells (fibroblasts from different human tissue donors; 80-100 years of age) were measured by MitoSOX RED staining.
- Figure 12A-12B Figure 12 shows a metabolic profiling analysis of the top 50 differential metabolites. Eleven dermal fibroblasts were randomly selected from aged human donors with high, intermediate, and low oxidative stress. All samples were analyzed in a mass- spectrometry based analysis using both, positive ( Figure 12A) and negative ( Figure 12B) heated electrospray ionization.
- Figure 13A-13B Figure 13 shows the variation of oxidative stress among the human population, and oxidative stress control of the G-quadruplex DNA structure.
- Figure 13A demonstrates higher G4 IHC staining of fibroblasts with higher ROS and lower G4 IHC staining of fibroblasts with lower ROS.
- Figure 13B demonstrates the quantification of G4 IHC staining.
- Figure 14A-14B Figure 14 shows the variation of oxidative stress among the human population, and oxidative stress control of the G-quadruplex DNA structure.
- Figure 14A shows the variation of oxidative stress among the human population, and oxidative stress control of the G-quadruplex DNA structure.
- Figure 15A-15B Figure 15 shows G4 profiling signatures on enhancer regions.
- Comparative G4-antibody based ChlP-seq was performed with somatic cells with high and low oxidative stress. Elevation of oxidative stress is associated with a significant reduction of G4 markers on enhancer regions.
- Figure 15A shows samples with high oxidative stress and reduction of oxidative stress by GSH [3 mM, 4 hours] treated somatic cells in high oxidative stress.
- Figure 15B shows samples with low oxidative stress and elevation of oxidative stress by BSO [0.5 mM, 4 hours] treated somatic cells in low oxidative stress.
- Figure 16A-16B Figure 16 shows an IHC -based 8-oxo-guanine (oxoG) quantification using a specific antibody.
- Figure 16A shows higher oxoG IHC staining of A-SC with higher ROS vs. lower ROS.
- Figure 16B shows the quantification of oxoG IHC staining by ImageJ software analysis in 3 independent clones with multiple replicate samples. Statistical significance was determined by two-sided t-test [0098]
- Figure 17A-17B Figure 17A is a table summarizing the positions of G4 structures in pluripotency genes. Figure discloses SEQ ID NOs: 19-26, in order of appearance.
- Figure 17B shows quantitative PCR for pluripotency genes OCT4, KLF4, ZSCAN10, LIN28A, SOX2, CMYC, NANOG, and for the gene LIN28B in human ES after 72 hours of the G4 structure stabilizer PYRIDOSTATIN with various concentrations.
- Figure 18 is a table summarizing the 27 potential genes upstream of ROS that were not influenced by GEE/BSO treatment.
- Figure 19A-19B Figure 19A demonstrates MitoSOX Red staining of control fibroblasts with high ROS and fibroblasts with high ROS treated with shCHD.
- Figure 19B demonstrates the quantification of the MitoSOX Red staining.
- Figure 20A-20B Figure 20 shows a proposed model on the development of radiation/chemotherapy resistance.
- Figure 20A shows a mechanism by which elevated glutathione overcomes the inhibitory function of oxidative stress-associated somatic cell epigenetic markers, leading to the development of iPSC or Tumour initiating cells with radiation/chemotherapy resistance and higher tumorigenicity.
- Figure 20B shows high and low ROS fibroblasts will be mixed with melanoma organoids, followed by monitoring of melanoma cancer progression, elevation of glutathione, and radiation/chemotherapy agent resistance in vitro and in vivo.
- aged somatic cell refers to a somatic cell isolated from an aged donor (e.g., a mouse aged > 1.4 years, or a human aged > 50 years) or exhibiting a profile (e.g., basal ROS level, DNA damage response, genomic stability, ZSCANIO expression level, GSS expression level) that is comparable to a somatic cell isolated from an aged donor.
- Aged somatic cells include somatic cells, either isolated from an aged donor or exhibiting a profile comparable to a somatic cell isolated from an aged donor, which cannot generate iPSCs due to the inhibitory effects of high cellular ROS levels on pluripotent stem cell reprogramming.
- A-iPSC aged-induced pluripotent stem cell
- A-iPSC refers to an iPSC derived from a non-pluripotent cell, such as a somatic cell, isolated from an aged donor or exhibiting a profile (e.g., basal ROS level, DNA damage response, genomic stability, ZSCANIO expression level, GSS expression level) that is comparable to an iPSC derived from a non-pluripotent cell, such as a somatic cell, isolated from an aged donor.
- a profile e.g., basal ROS level, DNA damage response, genomic stability, ZSCANIO expression level, GSS expression level
- chromosomal structural abnormalities refers to any change in the normal structure of a chromosome. Chromosomal structural abnormalities include, but are not limited to duplications, deletions, translocations, inversions, and insertions.
- DNA damage response refers to any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus, indicating damage to its DNA from environmental insults or errors during metabolism.
- the term “differentiates” or “differentiated” refers to a cell that takes on a more committed (“differentiated”) position within a given cell lineage.
- an "effective amount” or a “therapeutically effective amount” of a compound refers to composition, compound, or agent levels in which the physiological effects of a disease or disorder are, at a minimum, ameliorated, or an amount that results in one or more desired outcomes in reprogrammed iPSCs including, but not limited to, increased
- a compound such as glutathione or BSO
- a compound can be delivered to a cell or cell culture in an amount that results in one or more desired outcomes in reprogrammed iPSCs including, but not limited to, increased reprogramming efficiency of non-pluripotent cells into iPSCs, improved genomic stability, improved DNA damage response, increased Z SCAN 10 expression, and reduced glutathione synthetase (GSS) expression, relative to reprogrammed iPSCs that were not contacted with the glutathione or BSO.
- a therapeutically effective amount can be given in one or more
- a compound which constitutes a therapeutically effective amount will vary depending on the compound, the disorder and its severity, and the general health, age, sex, body weight and tolerance to drugs of the subject to be treated, but can be determined routinely by one of ordinary skill in the art.
- an effective amount of an agent such as glutathione reduced ethyl ester
- an agent such as glutathione reduced ethyl ester
- a condition such as the level of cellular reactive oxygen species (ROS), observed in a target population of non-pluripotent cells, such as somatic cells, obtained from a subject.
- ROS reactive oxygen species
- instability refers to an increase in structural chromosomal alterations (e.g., deletions, amplifications, translocations), numerical chromosomal aneuploidy, or mutations on DNA sequence within the genome of a cellular lineage.
- glutathione encompasses glutathione derivatives and stabilized forms of glutathione, such as glutathione reduced ethyl ester ("GSH” or "GEE").
- iPSCs induced pluripotent stem cells
- ESCs embryonic stem cells
- differentiated, non-pluripotent cells typically adult somatic cells.
- oncogenic potential means the likelihood that a cell after its transplantation into a host will generate malignant tumors in the host.
- the term is applied for example to induced pluripotent stem cells (iPSCs), and to their propensity to generate malignant tumors upon differentiation and transplantation into an animal or human.
- Phenotypic traits such as genomic instability and impaired DNA damage response indicate elevated oncogenic potential regardless of whether the iPSC has been derived from an aged donor.
- pluripotent stem cell refers to a cell capable of continued self-renewal, and, under appropriate conditions, of producing progeny of several different cell types. PSCs are capable of producing progeny that are derivatives of each of the three germ layers: endoderm, mesoderm, and ectoderm, according to a standard art-accepted test, such as the ability to form a teratoma in a suitable host, or the ability to differentiate into cells stainable for markers representing tissue types of all three germ layers in culture.
- PSCs embryonic stem cells of various types, such as embryonic stem cells (ESCs), as well as induced pluripotent stem cells (iPSCs) that have been reprogrammed from non- pluripotent cells, such as adult somatic cells.
- ESCs embryonic stem cells
- iPSCs induced pluripotent stem cells
- PSCs include primary tissue and established lines that bear phenotypic characteristics of PSCs, and derivatives of such lines that still have the capacity of producing progeny of each of the three germ layers.
- PSC cultures are described as "undifferentiated” or “substantially undifferentiated” when a substantial proportion of stem cells and their derivatives in the population display morphological characteristics of undifferentiated cells, clearly distinguishing them from differentiated cells of embryo or adult origin.
- Undifferentiated PSCs are easily recognized by those skilled in the art, and typically appear in the two dimensions of a microscopic view with high nuclear/cytoplasmic ratios and prominent nucleoli. It is understood that colonies of undifferentiated cells within the population will often be surrounded by neighboring cells that are differentiated.
- prevention refers to one or more compounds that, in a statistical sample, reduces the occurrence of the disorder or condition in the treated sample relative to an untreated control sample, or delays the onset of one or more symptoms of the disorder or condition relative to the untreated control sample.
- reprogramming and grammatical equivalents refer to a process that alters or reverses the differentiation status of a somatic cell that is either partially or terminally differentiated. Reprogramming of a somatic cell may be a partial or complete reversion of the differentiation status of the somatic cell. In some embodiments, reprogramming is complete when a somatic cell is reprogrammed into an induced pluripotent stem cell.
- reprogramming may be partial, such as reversion into any less differentiated state. For example, reverting a terminally differentiated cell into a cell of a less differentiated state, such as a multipotent cell.
- reprogramming efficiency refers to the number of iPSC colonies generated per somatic or donor input cell. For example, reprogramming efficiency can be provided by the ratio between the number of donor cells receiving the full set of reprogramming factors and the number of reprogrammed colonies generated.
- reprogramming factor refers to a molecule, such as a transcription factor, which when contacted with a cell (e.g., expressed by a cell, transformed into a cell for expression, exogenously provided to a cell, etc.), can, either alone or in combination with other molecules, cause reprogramming (e.g., reprogram somatic cells to cells with a pluripotent state).
- reprogramming factors include, but are not limited to Oct3 protein, Oct4 protein, Myo-D-Oct4 (M 3 0) protein, Soxl protein, Sox2 protein, Sox3 protein, Soxl 5 protein, Klfl, protein, Klf2 protein, Klf3 protein, Klf4 protein, Klf5 protein, c-Myc protein, L-Myc protein, N-Myc protein, Nanog protein, Lin28A protein, Tert protein, Utfl protein, Aicda protein, Glisl, Sall4, Esrrb, Tetl, Tet2, Zfp42, Prdml4, Nr5a2, Gata6, Sox7, Paxl, Gata4, Gata3, cEBPa, HNF4a, GMNN, SNAIL, Grb2, Trim71, and biologically active fragments, analogues, variants, and family members thereof.
- M 3 0 Myo-D-Oct4
- the reprogramming factors comprise Oct4, Sox2, Klf4, and c-Myc (also known as the Yamanaka reprogramming factors).
- Nanog and Lin28 replace Klf4 and c-Myc
- esrrb replaces Klf4
- SV40 LT (T) replaces Klf4, c-Myc, Lin28, and Nanog
- BIX-01294 replaces Sox2 and Oct4
- VP A replaces Klf4 and c-Myc.
- somatic cell refers to any cell other than pluripotent stem cells or germ cells.
- the cells may be any type of somatic cells, of any origin, including cells derived from humans or animals.
- somatic cells may include, but are not limited to fibroblast cells, epithelial cells, osteocytes, chondrocytes, neurons, muscle cells, hepatic cells, intestinal cells, spleen cells, and adult stem cells, including, but not limited to hematopoietic stem cells, vascular endothelial stem cells, cardiac stem cells, muscle-derived stem cells, mesenchymal stem cells, epidermal stem cells, adipose-derived stem cells, intestinal stem cells, neural stem cells, germ line stem cells, and hepatic stem cells.
- the terms "subject,” “individual,” or “patient” can be an individual organism, a vertebrate, a mammal, or a human.
- Treating,” “treat,” “treated,” or “treatment” as used herein covers the treatment of a disease or disorder described herein, in a subject, such as a human, and includes: (i) inhibiting a disease or disorder, i.e., arresting its development; (ii) relieving a disease or disorder, i.e., causing regression of the disorder; (iii) slowing progression of the disorder; and/or (iv) inhibiting, relieving, or slowing progression of one or more symptoms of the disease or disorder.
- treating covers contacting cells, cell cultures, tissues, or tissue cultures with an agent, such as glutathione reduced ethyl ester, and describes cells, cell cultures, tissues, and tissue cultures that have been contacted with the agent.
- Y-SC young somatic cell
- a young donor e.g., a mouse aged ⁇ 5 days, or a human aged ⁇ 16 years
- a profile e.g., basal ROS level, DNA damage response, genomic stability, ZSCANIO expression level, GSS expression level
- Y-iPSC young-induced pluripotent stem cell
- Y-iPSC refers to an iPSC derived from a non-pluripotent cell, such as a somatic cell, isolated from a young donor or exhibiting a profile (e.g., basal ROS level, DNA damage response, genomic stability, ZSCANIO expression level, GSS expression level) that is comparable to an iPSC derived from a non-pluripotent cell, such as a somatic cell, isolated from a young donor.
- a profile e.g., basal ROS level, DNA damage response, genomic stability, ZSCANIO expression level, GSS expression level
- the present disclosure provides methods for producing induced pluripotent stem cells (iPSCs) from non-pluripotent cells.
- the methods include culturing the non-pluripotent cells with an effective amount of glutathione prior to the initiation of reprogramming, during reprogramming, and/or following reprogramming to produce genome-stable iPSCs.
- the methods of the present technology include producing iPSCs characterized by one or more of increased genomic stability, increased DNA damage response, increased ZSCANI O, reduced GSS expression, and/or increased
- the methods of the present technology allow for reprogramming of non-pluripotent cells, such as aged somatic cells, which are otherwise resistant to reprogramming and/or generate iPSCs at low efficiency, if at all.
- the present disclosure provides iPSCs and somatic cells differentiated from these iPSCs.
- the iPSCs can be produced from somatic cells derived from a donor displaying an aged profile (A-iPSC), which may result from the aging process and/or lifestyle factors that contribute to an aged phenotype (e.g., smoking, excessive alcohol intake), and used to generate histocompatible transplantable tissue.
- A-iPSC aged profile
- lifestyle factors that contribute to an aged phenotype (e.g., smoking, excessive alcohol intake)
- iPSCs can be generated from non- pluripotent cells (e.g., somatic cells) without the need for the addition of an exogenous nucleic acid or genetic modification beyond those introduced by the factors typically employed for iPSC reprogramming (e.g., Yamanaka factors Oct4, Sox2, Klf4, and c-Myc).
- the ability to reprogram cells, such as those derived from aged tissues, without the need for an additional nucleic acid transfection may be particularly advantageous in the clinical setting.
- the use of biomarkers that predict the genomic stability of derived iPSCs can assist the clinician in identifying non-pluripotent cells for treatment with glutathione according to the methods described herein.
- ROS reactive oxygen species
- ESCs embryonic stem cells
- ZSCAN10 and/or GSS expression levels observed in non-pluripotent cells, such as aged somatic cells, relative to those observed in control aged somatic cells, young somatic cells, or ESCs can be used to identify non- pluripotent cells for treatment with glutathione.
- gene expression levels of GSS and/or ZSCAN10 and metabolite levels of ROS and/or glutathione can serve as biomarkers to predict the genomic stability in reprogrammed iPSCs.
- biomarkers such as an increased Prdx2 expression in non-pluripotent cells that generate genome-unstable A-iPSCs relative to that observed in non-pluripotent cells that generate genome-stable A-iPSCs, can also be used to identify non-pluripotent cells for treatment with glutathione.
- biomarkers such as cellular ROS levels, ZSCAN10/GSS expression levels, and Prdx2 expression levels
- the reprogramming protocol can be tailored (e.g., using the standard Yamanaka factors with or without glutathione treatment) to increase efficiency and produce genome-stable iPSCs.
- A-iPSC show impaired genomic integrity and are defective in apoptosis and DNA
- Y-iPSC using mouse skin fibroblasts from El 7.5 embryos to 5-day-old neonates
- A-iPSC using mouse skin fibroblasts from 1.5-year-old adults
- a minimum of 12 iPSC clones was randomly selected to undergo a series of common pluripotency tests previously used to characterize mouse and human iPSC including teratoma/chimera analysis and pluripotent gene expression analysis.
- Q-PCR analysis of these clones was performed to confirm silencing of the reprogramming factors.
- A-iPSC showed better survival following manipulative stress, such as passaging and thawing, compared to Y-iPSC or ESC.
- manipulative stress such as passaging and thawing
- Y-iPSC a structural analogue of bleomycin with higher potency
- phleomycin a structural analogue of bleomycin with higher potency
- a defect in the apoptotic response to DNA damage in A-iPSC would result in a greater number of cells with genetic abnormalities, reflecting a defect in the elimination of damaged cells.
- A-iPSCs consistently exhibit poor activation of the ATM-H2AX-p53 pathway, indicating that the normal cellular mechanisms involved in the DNA damage response are attenuated in A-iPSCs, leading to a failure to eliminate cells with aberrant genomic content.
- the poor DNA damage response in A- iPSCs has been shown to persist during extended tissue culture (up to passage 19).
- A-iPSCs generated from two additional tissue types (lung and bone marrow) have also been shown to exhibit similar defects in the DNA damage response.
- ZSCAN10 recovers the DNA damage response and genomic stability of mouse A-iPSC
- Nuclear transfer is an alternative reprogramming method to create patient-specific pluripotent stem cells (ntESC).
- Mouse ntESCs were generated by inserting nuclei from aged tissue donors into enucleated oocytes to produce A-ntESCs.
- the A-ntESCs showed a normal DNA damage response with a normal cytogenetic signature.
- oocytes likely contain other reprogramming factors in addition to the four Yamanaka factors employed to generate iPSCs, additional pluripotency factors— present in the enucleated oocyte but absent from aged somatic cells— may be required for a normal DNA damage response.
- Such factors may also be present in Y-iPSC and ESC because they have a normal DNA damage response.
- ZSCANIO a known zinc finger transcription factor specifically expressed in ESC has been identified.
- ZSCANIO is an integrated part of the transcriptional regulatory network with SOX2, OCT4, and NANOG.
- Time-lapse imaging experiments in fibroblasts have shown that ZSCANIO expression was detectable starting on day 6 of reprogramming and was strongly expressed at the time iPSC colonies were formed.
- endogenous ZSCANIO expression is high in Y- iPSC and ESC, but low in A-iPSC.
- ZSCANIO restores ROS -glutathione homeostasis in mouse A-iPSC via reduction of excessively activated GSS
- A-iPSC have excessive levels of glutathione (Figure 3D) and elevated ROS scavenging activity (Figure 3E) relative to Y-iPSC or ESC. While ROS levels in A-iPSC were increased by treatment with DNA damaging agents ( Figure 3E) and this might be sufficient to cause direct DNA damage and genomic instability, improper scavenging of ROS by excess glutathione would limit the ROS cellular stress signal needed to induce the DNA damage response, which would in turn reduce apoptosis and increase A-iPSC exposure to additional genotoxic stress, allowing accumulation of mutations and other genomic alterations.
- a similar variability in A-iPSC derived from mice of different genetic backgrounds was observed: more A-iPSC clones from B6129 mice showed genomic stability with a normal DNA damage response, higher ZSCAN10 expression, and lower GSS expression (data not shown), compared to A-iPSC from B6CBA mice ( Figures 1, 2B, 3C). Together, these observations underscore the idea that, even as mechanisms that contribute to the aging phenotype in A-iPSC are uncovered, differences in genetic polymorphisms and lifestyle play critical roles in aging and its biological effects on iPSC reprogramming in both mouse and human models.
- A-hiPSC were generated in the presence and absence of human ZSCAN10 expression using a doxycycline system. Each A-hiPSC clone was put through a series of pluripotency tests and compared to hESC and Y-hiPSC derived from fibroblasts. As we observed in mouse A-iPSC, endogenous ZSCAN10 expression was significantly lower in A-hiPSC than Y-hiPSC or hESC ( Figure 4B).
- A-hiPSC also showed a blunted DNA damage response (pATM; Figure 4D) and a poorer apoptotic response to phleomycin (data not shown) compared to Y-hiPSC or hESC. Poor DNA damage response in A-hiPSC was confirmed with various reprogramming vectors such as lentivirus reprogramming without MYC and an integration-free episomal vector system (data not shown), indicating that the observed phenotype of A-hiPSC is not caused by reprogramming vector systems or viral vector integration.
- transient expression of ZSCAN10 during reprogramming days 5 through 15 in A-hiPSC (A-hiPSC-ZSCAN10) persistently increased endogenous ZSCAN10 expression to levels similar to those in Y-hiPSC and hESC ( Figure 4B).
- Increased ZSCAN10 expression recovered the DNA damage response ( Figure 4D) and the apoptosis defect (data not shown) in A-hiPSC.
- A-hiPSC express higher levels of GSS ( Figure 4C), which were normalized by increased expression of ZSCAN10 ( Figure 4C).
- shRNA knockdown of ZSCAN10 in Y-hiPSC impaired the DNA damage response ( Figure 4E) and genomic stability ( Figure 4F).
- shRNA knockdown of ZSCAN10 in hiPSC generated from a previously reported secondary reprogramming system in which HI hESC-derived fibroblasts were reprogrammed into hiPSC (equivalent to Y-hiPSC) by pre-integrated doxycycline-inducible reprogramming lentivirus, impaired the DNA damage response (data not shown).
- ChlP-Q-PCR confirmed that ZSCAN10 directly binds to the ZSCAN10 DNA binding motif on the human GSS promoter (data not shown) to suppress GSS expression ( Figure 4C).
- A-hiPSC had excessive levels of glutathione (Figure 5A) and elevated ROS scavenging activity (Figure 5B) relative to Y-hiPSC or hESC, as we observed in the mouse.
- ZSCAN4 Another member of the ZSCAN family, ZSCAN4, may help maintain genomic integrity of Y-iPSC and may function synergistically with ZSCAN10 in protecting the genome.
- Somatic cell ROS as a causative origin of the genomic instability in A-iPSC and recovery by glutathione treatment
- the methods disclosed herein can also generate A-iPSCs with increased genomic stability (Figure 7H), increased DNA damage response (Figure 7G), increased ZSCAN10 expression levels (Figure 71), and reduced GSS expression levels (Figure 7 J) as compared to that observed in A-iPSCs produced from untreated control aged somatic cells grown under similar conditions and/or comparable to that observed in Y-iPSCs or ESCs.
- non-pluripotent cells e.g., somatic cells
- somatic cells may be mature somatic cells.
- somatic cells are from an embryonic stage.
- somatic cells are aged somatic cells.
- the somatic cells are incapable of generating iPSCs.
- somatic cells may be primary cells (non-immortalized cells), such as those freshly isolated from an animal, or may be derived from a cell line (immortalized cells).
- the somatic cells are mammalian cells, such as, for example, human cells or mouse cells.
- somatic cells may be obtained by well-known methods, from different organs, such as, but not limited to, skin, eye, lung, pancreas, liver, stomach, intestine, heart, reproductive organs, bladder, kidney, urethra and other urinary organs, or generally from any organ or tissue containing living somatic cells, or from blood cells.
- fibroblasts are used.
- cells isolated from the blood and/or bone marrow which include, but are not limited to, endothelial cells, lymphocytes, myeloid cells, leukocytes, mesenchymal stem cells, and hematopoietic stem cells
- mesenchymal stem cells are used.
- somatic cell is also intended to include adult stem cells. i. Biomarkers defining elevated cellular ROS levels
- the non-pluripotent cells are selected for treatment with glutathione or derivatives thereof based on the detection of oxidative stress- associated (i.e., elevated cellular ROS level) biomarkers in donor non-pluripotent stem cells (e.g., somatic cells).
- the non-pluripotent cells are selected for treatment with glutathione or derivatives thereof based on the detection of additional oxidative stress-associated biomarkers in the non-pluripotent cells that lead to aging phenotypes in A-iPSC and in tumor-initiating cells (TIC).
- these markers may predict decreased reprogramming efficiency, elevated tumorigenicity, and/or the development of radiation/chemotherapy resistance in iPSCs generated from somatic cell donors or TIC in aged individuals.
- the present technology relates to methods for characterizing the genomic stability of A-iPSC based on biomarkers of somatic cells from aged donors to tailor the reprogramming protocol (e.g., reprogramming somatic cells with the standard Yamanaka factors with or without glutathione treatment) to produce iPSCs characterized by one or more of increased genomic stability, increased DNA damage response, increased ZSCAN10 expression, and reduced glutathione synthetase (GSS) expression.
- the reprogramming protocol e.g., reprogramming somatic cells with the standard Yamanaka factors with or without glutathione treatment
- the non-pluripotent cells are selected for treatment with glutathione based on the expression level of cellular ROS in a sample of the non- pluripotent cells.
- aged somatic cells are selected for treatment with glutathione or derivatives thereof according to the methods of the present technology based on an elevated cellular ROS level prior to treatment relative to one or more of untreated control aged somatic cells, young somatic cells, and ESCs, wherein an elevated cellular ROS level identifies the aged somatic cells for treatment with glutathione or derivatives thereof and the lack of elevated cellular ROS level does not identify the aged somatic cells for treatment with ROS or derivatives thereof.
- the non-pluripotent cells are selected for treatment with glutathione or derivatives thereof based on the expression level of a biomarker, such as Prdx2.
- a biomarker such as Prdx2.
- aged somatic cells are selected for treatment with glutathione or derivatives thereof according to the methods of the present technology based on Prdx2 expression levels.
- Prdx2 was identified as a biomarker based on the results of a microarray gene expression analysis between Aged somatic cells and Young somatic cells (Figure 9A). The results of the microarray analysis shown in Figure 9A revealed 255 differentially expressed genes between an Aged somatic cell line (AG4) and a Young somatic cell line (MRC5) ( Figure 9B).
- Prdx2 was found to be involved in redox regulation (GO: 0016209) in the cell ( Figure 9C). Prdx2 levels were found to be 10 times higher in MRC5 fibroblasts than in AG4 fibroblasts.
- cells are reprogrammed for an intended therapeutic use, and are derived from the patient subject ⁇ i.e., autologous).
- Somatic cells can be derived from a healthy or diseased subject.
- Somatic cells can be derived from a young donor (Y-SC) ⁇ e.g., a mouse aged ⁇ 5 days, or a human aged ⁇ 16 years) or exhibiting a profile ⁇ e.g., basal ROS level, DNA damage response, genomic stability, ZSCAN10 expression level, GSS expression level) that is comparable to a somatic cell isolated from a young donor.
- Y-SC young donor
- a profile e.g., basal ROS level, DNA damage response, genomic stability, ZSCAN10 expression level, GSS expression level
- Y-iPSC young-induced pluripotent stem cell
- Y-iPSC refers to an iPSC derived from a non-pluripotent cell, such as a somatic cell, isolated from a young donor or exhibiting a profile ⁇ e.g., basal ROS level, DNA damage response, genomic stability, ZSCAN10 expression level, GSS expression level) that is comparable to an iPSC derived from a non-pluripotent cell, such as a somatic cell, isolated from a young donor.
- the somatic cells are derived from an aged donor (A-SC) ⁇ e.g., a mouse aged > 1.4 years, or a human aged > 50 years) or exhibiting a profile ⁇ e.g., basal ROS level, DNA damage response, genomic stability, ZSCAN10 expression level, GSS expression level) that is comparable to a somatic cell isolated from an aged donor.
- A-SC aged donor
- a profile e.g., basal ROS level, DNA damage response, genomic stability, ZSCAN10 expression level, GSS expression level
- A-iPSC aged-induced pluripotent stem cell
- A-iPSC refers to an iPSC derived from a non-pluripotent cell, such as a somatic cell, isolated from an aged donor or exhibiting a profile ⁇ e.g., basal ROS level, DNA damage response, genomic stability, ZSCAN10 expression level, GSS expression level) that is comparable to an iPSC derived from a non-pluripotent cell, such as a somatic cell, isolated from an aged donor.
- the non-pluripotent cells ⁇ e.g., somatic cells
- the results of the metabolic profiling analyses described herein demonstrate that cells ⁇ e.g., somatic fibroblasts) derived from aged donors have distinct profiles based on cellular ROS levels ( Figures 12 A and 12B).
- the results of the metabolic profiling analysis comparing the metabolome from high ROS donor cells to low ROS donor cells revealed 41 significantly altered metabolites, four of which have been characterized.
- Donor somatic cells exhibiting a metabolic profile similar to that of high ROS control somatic cells may be selected for glutathione treatment.
- the measurement of a metabolic profile in donor somatic cells provides a method for detecting elevated ROS levels that is more stable than directly measuring cellular ROS levels.
- the non-pluripotent cells are selected for treatment with glutathione or derivatives thereof based on the levels of 8-oxo-guanine (oxoG) and guanine-quadruplex (G4) structure formation levels relative to those found in high ROS control somatic cells.
- oxoG 8-oxo-guanine
- G4 and oxoG are two examples of ROS-induced direct chemical alterations.
- Guanine is the primary oxidation target of ROS, which generates oxoG. This stabilizes a three-dimensional G4 structure on promoter regions that inhibits gene expression.
- the G4 structure is located in the regulatory regions of several pluripotent genes including SOX2, CMYC, NANOG, and others ( Figures 17A and 17B).
- G4 structure formation ( Figures 13A, 13B, 15A, and 15B) and oxoG formation ( Figures 16A and 16B) are elevated in high ROS cells relative to low ROS cells. Accordingly, G4 structure formation and/or oxoG formation can be used as an evaluation tool for detecting DNA damage resulting from ROS. In some instances the measurement of G4 structure formation and/or oxoG formation in somatic donor cells provides a method for detecting DNA damage resulting from ROS that is more stable than directly measuring cellular ROS levels.
- the non-pluripotent cells are selected for treatment based on a transcriptome profile.
- the results of the transcriptome analyses described herein demonstrate that a panel of genes functioning as upstream regulators of ROS formation exhibit altered gene expression in somatic cells derived from aged donors ( Figure 18).
- the present technology relates to the use of methods decreasing cellular ROS levels by suppressing the expression of one or more genes that positively regulate ROS production.
- ROS production may be reduced in the somatic cells during reprogramming by suppression of an endogenous target gene encoding a gene product that positively regulates ROS production using the target gene sequence in a number of ways generally known in the art, including, but not limited to, RNAi (siRNA, shRNA) techniques, microRNA, and CRISPR-Cas.
- the present technology provides a method for decreasing cellular ROS levels by suppressing a gene encoding a gene product that positively regulates ROS production, such as ST6GALNAC6, IGFBP5, PDGFD, SURF4, BOC, ADGRDl, MPDU1, RPS4Y1, MME, SET, DOKl, COLEC12, HOXCIO, SULF2, ADAMTSLl, ELN, MGRNl, COL15A1, ZEBl, SFRPl, CLDN11, LGALS3BP, CHI3L1, SPG21, PI16, and MCFD2.
- Suppressing more than one genes encoding a gene product that positively regulates ROS production may further decrease ROS levels in a cell.
- the one or more genes is targeted for down-regulation when the expression level is found to be at least 2-fold to 5-fold upregulated in a high ROS cell as compared to a low ROS cell. In some embodiments, the one or more genes is targeted for down-regulation when the expression level is found to be at least 5-fold upregulated in a high ROS cell as compared to a low ROS cell.
- methods for obtaining somatic cells include obtaining a cellular sample, e.g., by a biopsy ⁇ e.g., a skin sample).
- the methods of the present technology relate to treating oocytes, including aged oocytes, with glutathione or derivatives thereof.
- the treated oocytes may be used for in vitro fertilization (IVF) applications and may improve the success rate of IVF.
- the treated oocytes increase the efficiency of in vitro embryo production and embryo quality.
- the oocytes are selected for treatment with glutathione or derivatives thereof based on elevated ROS levels within the oocyte.
- the methods of the present technology comprise treating non- pluripotent cells with glutathione or derivatives thereof to produce iPSCs.
- the glutathione is glutathione reduced ethyl ester, a stabilized form of glutathione.
- the methods of the present technology comprise treating non- pluripotent cells with L-Buthionine-sulfoximine (BSO) or derivatives thereof to generate iPSCs (Figure 8)
- the agent is glutathione or derivatives thereof.
- the agent is glutathione reduced ethyl ester.
- the agent is L-Buthionine-sulfoximine (BSO) or derivatives thereof.
- BSO L-Buthionine-sulfoximine
- the donor cell or tissue samples are contacted with 0.01 to 10 mM glutathione reduced ethyl ester. In some embodiments, the donor cell or tissue samples are contacted with 0.1 mM glutathione reduced ethyl ester. In some
- the donor cell or tissue samples are contacted with 0.5 mM glutathione reduced ethyl ester. In some embodiments, the donor cell or tissue samples are contacted with 1 mM glutathione reduced ethyl ester. In some embodiments, the donor cell or tissue samples are contacted with 2 mM glutathione reduced ethyl ester. In some embodiments, the donor cell or tissue samples are contacted with 3 mM glutathione reduced ethyl ester. In some embodiments, the donor cell or tissue samples are contacted with 4 mM glutathione reduced ethyl ester. In some embodiments, the donor cell or tissue samples are contacted with 5 mM glutathione reduced ethyl ester.
- the donor cell or tissue samples are contacted with 6 mM glutathione reduced ethyl ester. In some embodiments, the donor cell or tissue samples are contacted with 7 mM glutathione reduced ethyl ester. In some embodiments, the donor cell or tissue samples are contacted with 8 mM glutathione reduced ethyl ester. In some embodiments, the donor cell or tissue samples are contacted with 9 mM glutathione reduced ethyl ester. In some embodiments, the donor cell or tissue samples are contacted with 10 mM glutathione reduced ethyl ester or more.
- the donor cell or tissue samples are contacted with 0.01 to 10 mM L-Buthionine-sulfoximine (BSO). In some embodiments, the donor cell or tissue samples are contacted with 0.1 mM BSO. In some embodiments, the donor cell or tissue samples are contacted with 0.5 mM BSO. In some embodiments, the donor cell or tissue samples are contacted with 1 mM BSO. In some embodiments, the donor cell or tissue samples are contacted with 2 mM BSO. In some embodiments, the donor cell or tissue samples are contacted with 3 mM BSO. In some embodiments, the donor cell or tissue samples are contacted with 4 mM BSO.
- BSO L-Buthionine-sulfoximine
- the donor cell or tissue samples are contacted with 5 mM BSO. In some embodiments, the donor cell or tissue samples are contacted with 6 mM BSO. In some embodiments, the donor cell or tissue samples are contacted with 7 mM BSO. In some embodiments, the donor cell or tissue samples are contacted with 8 mM BSO. In some embodiments, the donor cell or tissue samples are contacted with 9 mM BSO. In some embodiments, the donor cell or tissue samples are contacted with 10 mM BSO or more. [0165] Considering the day of transduction of reprogramming factors as day 0 (initiation of reprogramming), in some embodiments, the dosage regimen comprises treating the donor cells or tissue with glutathione from day -1 to 10.
- the dosage regimen comprises treating the donor cells with glutathione from day -10 to 0, from day -9 to 0, from day -8 to 0, from day-7 to 0, from day -6 to 0, from day -5 to 0, from day -4 to 0, from day -3 to 0, from day - 2 to 0, from day -1 to 0, from day 0 to 1, from day 0 to 2, from day 0 to 3, from day 0 to 4, from day 0 to 5, from day 0 to 6, from day 0 to 7, from day 0 to 8, from day 0 to 9, from day 0 to 10, or from any interval between days -10 to 10.
- the iPSCs generated by the methods described herein have a variety of applications and therapeutic uses.
- the methods disclosed herein are directed to the generation of iPSCs suitable for therapeutic applications, including
- the methods of the present technology yield iPSCs that have a reduced oncogenic potential as they exhibit genomic stability and DNA damage repair signaling.
- cancer stem cells CSC; or tumor-initiating cells (TIC)
- CSC cancer stem cells
- TIC tumor-initiating cells
- the biomarkers described herein may predict higher tumorigenicity and the development of radiation/chemotherapy resistance in iPSC generated from somatic cell donors or TIC in individuals, thereby identifying those cells for treatment with glutathione or derivatives thereof.
- kits for generating iPSCs from non-pluripotent cells include glutathione reduced ethyl ester, reprogramming factors, and instructions for reprogramming a plurality of non-pluripotent cells, such as somatic cells derived from aged donors to generate A-iPSCs.
- ESC and iPSC were cultured in ESC media containing 10% FBS and 1,000 U/mL of LIP (ESGRO ® Leukemia Inhibitory Factor [LIF], 1 million units/1 mL).
- LIP Leukemia Inhibitory Factor
- LIF Leukemia Inhibitory Factor
- iPSC reprogramming of somatic cells retrovirus expressing Oct4, Sox2, Klf4, and c-Myc were introduced.
- somatic cells containing inducible reprogramming factors the media was supplemented with 2 ⁇ g/mL doxycycline (MP Biomedicals, doxycycline hyclate).
- ESC or iPSC were trypsinized and replated onto new tissue culture dishes for 30 min to remove feeder cells, and nucleic acids were extracted from the non-adherent cell suspension.
- mice were collected from B6CBA and B6129 mice, 5-day-old tail tip skin, and 1.4-year old tail tip skin; infected with retrovirus generated from pMX-mOCT4, pMX-SOX2, pMX-mKLF4,2, and pEYK-mMYC3 in 6-well dishes with 0.5 mL of each virul supernatant (total 2 mL per well; and spun at 2500 rpm at RT for 90 min (BenchTop Centrifuge,
- the cells were contacted with 3 mM glutathione reduced ethyl ester prior to and during the early stage of reprogramming (from one day before reprogramming virus infection to 10 days post reprogramming virus infection).
- Y-SC young somatic cells
- A-SC aged somatic cells
- LS and AG4 donors aged 80 to 100 years were infected with retrovirus generated from the tetracistronic SFG-SV2 vector encoding for hOCT4, hSOX2, hKLF4, and hMYC in 6-well dishes with 0.5 mL of each viral supernatant (total 2 mL per well); and spun at 2500 rpm at RT for 90 min (BenchTop Centrifuge,
- the cells were contacted with 3 mM glutathione reduced ethyl ester prior to and during the early stage of reprogramming (from one day before reprogramming virus infection to 10 days post reprogramming virus infection).
- RNAs (1 ⁇ g) were reverse-transcribed in a volume of 20 uL using the M-MuLV Reverse Transcriptase system (New England Biolabs), and the resulting cDNA was diluted into a total volume of 200 [iL. 10 ⁇ ⁇ of this synthesized cDNA solution was used for analysis.
- each reaction was performed in a 25-[iL volume using the Power SYBR Green PCR mastermix (Applied Biosystems).
- the conditions were programmed as follows: initial denaturation at 95°C for 10 min followed by 40 cycles of 30 sec at 95°C, 1 min at 55°C, and 1 min at 72°C; then 1 min at 95°C, 30 s at 55°C, and 30 sec at 95°C. All of the samples were duplicated, and the PCR reaction was performed using an Mx3005 reader
- Phleomycin (Sigma) was added at 30 ⁇ g/mL for 2 hours. Cells were processed for analysis 30 min after phleomycin treatment unless indicated otherwise. After the 3-min recovery in ESC media, the cells were collected and processed for following experiments. For the detection of DNA damage response in the extended period, the cells were given 6 hours to recover after phleomycin treatment and were processed for H2AX immunostaining. In the DNA fragmentation assay, the cells were given 15 hours to recover. To check the mutatgenesis potential, the cells were treated with phleomycin 30 ⁇ g/mL for 2 hours and cultured for one passage after each treatment.
- Samples were adjusted to the same concentration with RIPA buffer (3000 ⁇ g/mL) and were combined with Laemmli Sample Buffer (Biorad) and ⁇ -Mercaptoethanol (Sigma) then heated at 95°C for 5 min and loaded onto a 4-15% Mini Protean TGX SDS-PAGE gel (BioRad). Samples on the SDS-PAGE gel were transferred to a 0.2-mm PVDF membrane at 100 V for 1 h, using a wet electro-transfer method (0.2 M glycine, 25 mM Tris, and 20% methanol).
- the membrane was blocked with 5% GSA in PBS-T (1 h at 4°C), followed by incubation with primary antibodies anti-H2AX (Millipore, 05-636) (1 : 1000), anti-p53 (Leic Biosystems, P53- CM5P) (1 : 1000) anti-phospho-ATM (Pierce, MAI-2020) or anti-beta actin (Cell Signaling #4967) (1 :5000) in blocking solution (5% BSA in phosphate-buffered saline containing Tween- 20 [1 : 1000] PBS-T, overnight at 4°C). After primary antibody incubation, membranes were washed three times in PBS-T prior to addition of secondary antibody labelled with peroxidase. Secondary antibodies were from Cell Signaling (1 : 10,000).
- Copy number profiling analysis was performed according to a published protocol (Baslan et al., Genome Research 25: 1-11 (2015)).
- ROS Reactive oxygen species
- MitoSOXTM Red reagent permeates live cells where it selectively targets mitochondria. It is rapidly oxidized by superoxide but not by other reactive oxygen species (ROS) and reactive nitrogen species (RNS). The oxidized product is highly fluorescent upon binding to nucleic acid. Fluorescence microscopy was used to visualize the fluorescence and imaging software (Image J) was used to quantify the staining of the different cell lines.
- ROS reactive oxygen species
- RNS reactive nitrogen species
- BSO treatment BSO-A-iPSC were generated in the presence of 500 ⁇ of L- Buthionine-sulfoximine (BSO, Sigma, B2515) starting on the end of reprogramming day 5. The treatment was kept throughout the end of reprogramming process and after picking the colonies.
- BSO L- Buthionine-sulfoximine
- MitoSOX RED Staining MitoSOX Red staining (MitoSOXTM Red mitochondrial superoxide indicator *for live-cell Imaging, M36008, ThermoFisher Scientific, Waltham, MA) was performed according to Molecular Probes/Thermo Scientific protocol. Briefly, the
- MitoSOXTM reagent stock solution (5 mM, prepared in HBSS/Ca/Mg or suitable buffer) was diluted to make a 5 ⁇ MitoSOXTM reagent working solution. 1.0-2.0 mL of the 5 ⁇
- MitoSOXTM reagent working solution was applied to cover cells adhering to coverslip(s). Cells were incubated for 10 minutes at 37°C, protected from light. Cells were washed before imaging.
- High ROS fibroblasts were treated by adding glutathione reduced ethyl ester (3 mM, GEE; Gold Biotechnology Inc., St. Louis, MO) to the media. Treated High ROS fibroblasts were then fixed and processed for staining at multiple timepoints.
- Low ROS fibroblasts were treated with L-Buthionine-sulfoximine (500 ⁇ , BSO; Sigma, St. Louis, MO) to the media. Treated Low ROS fibroblasts were then fixed and processed for staining at multiple timepoints.
- Quantitative Real Time-PCR (Q-PCR) Analysis The expression levels of genes were quantified by Q-PCR.
- Total RNA (1 ⁇ g) was reverse transcribed in a volume of 20 ⁇ ⁇ using the M-MuLV Reverse Transcriptase system (New England Biolabs, Ipswich, MA), and the resulting cDNA was diluted into a total volume of 200 ⁇ ⁇ . 10 ⁇ ⁇ of this synthesized cDNA solution was used for analysis. Each reaction was performed in a 25 ⁇ ⁇ volume using the Power SYBR Green PCR Mastermix (Applied Biosystems, Foster City, CA).
- the conditions were programmed as follows: initial denaturation at 95°C for 10 min followed by 40 cycles of 30 sec at 95°C, 1 min at 55°C, 1 min at 72°C, 1 min at 95°C, 30 s at 55°C, and 30 sec at 95°C. All of the samples were duplicated, and the PCR reaction was performed using a Mx3005P reader (Stratagene, San Diego, CA), which can detect the amount of synthesized signals during each PCR cycle. The relative amounts of the mRNAs were determined using the MxPro program (Stratagene). The amount of PCR product was normalized to a percentage of the expression level of GAPDH. The PCR products were also evaluated on 1.2% agarose gels after staining with ethidium bromide. The primers used to amplify the cDNA were the following: hGAPDH: CACCGTCAAGGCTGAGAACG (SEQ ID NO: 1) and
- GCCCCACTTGATTTTGGAGG SEQ ID NO: 2
- hZSCANIO CCTTACTCTCAGGAGCGCAG (SEQ ID NO: 3)
- hOCT4 CCTCACTTCACTGCACTGTA (SEQ ID NO: 5)
- CAGGTTTTCTTTCCCTAGCT (SEQ ID NO: 6)
- hSOX2 CCCAGCAGACTTCACATGT (SEQ ID NO: 7)
- GATTGAAATTCTGTGTAACTGC SEQ ID NO: 10
- hKLF4 GATGAACTGACCAGGCACTA (SEQ ID NO: 11)
- GTGGGTCATATCCACTGTCT SEQ ID NO: 12
- LIN28B GAGAGGGAAGCCCCTTGGAT (SEQ ID NO : 15)
- Example 1 Glutathione recovers genomic stability in A-iPSC.
- ZSCAN10 levels in the A-iPSC were elevated with glutathione reduced ethyl ester treatment ( Figure 71), indicating that glutathione treatment also influences the epigenetic changes and pluripotent gene expression during iPSC reprogramming.
- GSS levels in the A-iPSC were reduced with glutathione reduced ethyl ester treatment ( Figure 7 J).
- a control group of AG4 fibroblast (AG4) cells and a treatment group of glutathione reduced ethyl ester-AG4 fibroblast (AG4-GSH) cells were cultured and reprogrammed according to the methods described herein.
- AG4-GSH glutathione reduced ethyl ester-AG4 fibroblast
- iPSC colonies were counted and the reprogramming efficiency was determined by the ratio between the number of donor cells receiving the full set of reprogramming factors and the number of reprogrammed colonies generated.
- the results shown in Figure 10 demonstrate that treatment of aged somatic cells with glutathione reduced ethyl ester increased reprogramming efficiency by approximately 10-fold.
- BSO-A-iPSC were generated in the presence of 500 ⁇ of L-Buthionine-sulfoximine (BSO, Sigma B2515) starting on the end of reprogramming day 5 as previously described (see, e.g., Ji, et al. Experimental & Molecular Medicine 42: 175-186 (2010)).
- Immunoblot of pATM shows recovery of the DNA damage response after phleomycin treatment in ten indepent clones of A-iPSC with BSO (0.5 mM)-mediated inhibition of GSS (Figure 8).
- Example 3 Epigenetic and expression regulatory landscape in somatic cells with high and low ROS by RNA-Seq.
- Regulatory pathways downstream were then differentiated from upstream regulatory pathways by comparing the differentially regulated genes between high- and low-ROS somatic cells without GEE or BSO treatment (i.e., subtraction of the downstream targets regulated by GEE and BSO treatment from all differentially regulated genes between the somatic cells with high and low ROS will identify the potential upstream targets of ROS regulatory pathways).
- Two high-ROS and two low-ROS donor somatic cells were treated with GEE/BSO and analyzed.
- Non-pluripotent donor cells e.g., somatic cells
- oxidative-stress related biomarkers in the donor cells which may predict decreased
- Somatic donor cells which may be identified to have elevated oxidative-stress profiles may be selected for treatment with glutathione or a derivative thereof. Somatic donor cells will undergo metabolomic profiling analyses to determine the cellular ROS levels based on the metabolic profile signature. Additionally or alternatively, following metabolic analysis, non-pluripotent donor cells (e.g., somatic cells) will be analyzed using RNA-Seq to determine gene expression profiles both upstream and downstream of regulatory ROS pathways. Somatic donor cells which may be identified to have elevated gene expression profiles upstream of ROS, may be selected for treatment with glutathione or a derivative thereof.
- nuclear oxidative stress will be analyzed using known immunohistochemical analyses.
- non- pluripotent donor cells e.g., somatic cells
- 8-oxo-guanosine antibody which binds to oxidized DNA in the nucleus due to high levels of ROS.
- Somatic donor cells which may be identified to have elevated levels of ROS, may be selected for treatment with glutathione or a derivative thereof.
- non-pluripotent donor cells e.g., somatic cells
- somatic cells will also be analyzed for endogenous levels of G4 DNA levels using ChlP-Seq with an anti-G4 antibody.
- donor cells with elevated levels of ROS should have elevated levels of G4 DNA.
- Somatic donor cells which may be identified to have elevated levels of ROS may be selected for treatment with glutathione or a derivative thereof.
- Identified but uncharacterized features from the high ROS and low ROS donor cells can be identified by searching against know libraries, filtering for metabolites, and running standards to confirm the identification of the metabolite.
- Donor somatic cells exhibiting a metabolic profile similar to that of high ROS control somatic cells may be selected for glutathione treatment.
- Butyrylcarnitine 1.22E+05 1 .20E+05 1.02E+00
- 6-PHOSPHOGLUCONIC ACID 9. 97E+05 5 .66E+05 1 .76E+00
- N-ACETYL-D-MANNOSAMINE 2. 58E+05 2 .00E+05 1 .29E+00
- Transcriptome analysis has revealed a number of genes as differentially expressed (more than 5-fold) between high ROS and low ROS fibroblasts.
- the 26 genes shown in Figure 18 have been identified as potential genes upstream of ROS.
- these results demonstrate that targeting genes implicated in cellular ROS modulation may be useful in methods for generating iPSCs characterized by one or more of increased genomic stability, increased DNA damage response, increased ZSCAN10 expression, and reduced glutathione synthetase (GSS) expression compared to iPSCs produced from untreated control somatic cells grown under similar conditions.
- GSS glutathione synthetase
- these results demonstrate that donor cells exhibiting altered expression levels in one or more of the differentially expressed genes may identify those cells as candidates for treatment with glutathione or derivatives thereof before, during, or after reprogramming.
- Garber K. RIKEN suspends first clinical trial involving induced pluripotent stem cells.
- PubMed PMID WOS:000359512900003.
- Kang E Wu J, Gutierrez NM, Koski A, Tippner-Hedges R, Agaronyan K, Platero- Luengo A, Martinez-Redondo P, Ma H, Lee Y, Hayama T, Van Dyken C, Wang X, Luo S, Ahmed R, Li Y, Ji D, Kayali R, Cinnioglu C, Olson S, Jensen J, Battaglia D, Lee D, Wu D, Huang T, Wolf DP, Temiakov D, Belmonte JC, Amato P, Mitalipov S.
- Pastor MD Nogal A, Molina-Pinelo S, Melendez R, Salinas A, Gonzalez De la Pena M, Martin- Juan J, Corral J, Garcia-Carbonero R, Carnero A, Paz-Ares L. Identification of proteomic signatures associated with lung cancer and COPD. J Proteomics . 2013;89:227- 37. doi: 10.1016/j .jprot.2013.04.037. PubMed PMID: 23665002. Finkel T, Holbrook NJ. Oxidants, oxidative stress and the biology of ageing. Nature.
- PubMed PMID 11089981. Shaw PX, Werstuck G, Chen Y. Oxidative stress and aging diseases. Oxidative medicine and cellular longevity. 2014;2014:569146. doi: 10.1155/2014/569146. PubMed PMID: 24959310; PMCID: 4052780. Holmstrom KM, Finkel T. Cellular mechanisms and physiological consequences of redox-dependent signalling. Nature reviews Molecular cell biology. 2014; 15(6):411-21. doi: 10.1038/nrm3801. PubMed PMID: 24854789. Bigarella CL, Liang R, Ghaffari S. Stem cells and the impact of ROS signaling.
- Harris IS Treloar AE, Inoue S, Sasaki M, Gorrini C, Lee KC, Yung KY, Brenner D, Knobbe-Thomsen CB, Cox MA, Elia A, Berger T, Cescon DW, Adeoye A, Housele A, Molyneux SD, Mason JM, Li WY, Yamamoto K, Wakeham A, Berman HK, Khokha R, Done SJ, Kavanagh TJ, Lam CW, Mak TW. Glutathione and thioredoxin antioxidant pathways synergize to drive cancer initiation and progression. Cancer cell.
- PubMed PMID 25620030. Guo Z, Kozlov S, Lavin MF, Person MD, Paull TT. ATM activation by oxidative stress. Science. 2010;330(6003):517-21. Epub 2010/10/23. doi: 10.1126/science.1192912. PubMed PMID: 20966255. Takahashi K, Yamanaka S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 2006; 126(4):663-76. Epub
- PubMed PMID 16904174. Smith KP, Luong MX, Stein GS. Pluripotency: toward a gold standard for human ES and iPS cells. J Cell Physiol. 2009;220(l):21-9. Epub 2009/03/28. doi: 10.1002/jcp.21681. PubMed PMID: 19326392.
- Zhivotovsky B Kroemer G. Apoptosis and genomic instability. ature reviews
- Cowan CA Atienza J, Melton DA, Eggan K. Nuclear reprogramming of somatic cells after fusion with human embryonic stem cells. Science. 2005;309(5739): 1369-73. Epub 2005/08/27. doi: 10.1126/science.1116447. PubMed PMID: 16123299. Kim J, Chu J, Shen X, Wang J, Orkin SH. An extended transcriptional network for pluripotency of embryonic stem cells. Cell. 2008;132(6): 1049-61. Epub 2008/03/25. doi: 10.1016/j .cell.2008.02.039. PubMed PMID: 18358816; PMCID: 3837340. Polo SE, Jackson SP. Dynamics of DNA damage response proteins at DNA breaks: a focus on protein modifications.
- PubMed PMID 19740739; PMCID: 2781530.
- Ford J, Ahmed S, Allison S, Jiang M Milner J. JNK2-dependent regulation of SIRT1 protein stability. Cell Cycle. 2008;7(19):3091-7. Epub 2008/10/08.
- Jiang J, Lv W, Ye X, Wang L, Zhang M, Yang H, Okuka M, Zhou C, Zhang X, Liu L, Li J. Zscan4 promotes genomic stability during reprogramming and dramatically improves the quality of iPS cells as demonstrated by tetraploid complementation. Cell research. 2013;23(1):92-106. doi: 10.1038/cr.2012.157.
- PubMed PMID 24315443; PMCID: 4153390.
- Kyttala A Moraghebi R, Valensisi C, Kettunen J, Andrus C, Pasumarthy KK, Nakanishi M, Nishimura K, Ohtaka M, Weltner J, Van Handel B, Parkkonen O, Sinisalo J, Jalanko A, Hawkins RD, Woods NB, Otonkoski T, Trokovic R. Genetic Variability Overrides the Impact of Parental Cell Type and Determines iPSC Differentiation Potential. Stem cell reports. 2016;6(2):200-12. doi: 10.1016/j .stemcr.2015.12.009. PubMed PMID:
- PubMed PMID 25858951; PMCID: 4417119. Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K, Yamanaka S. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell. 2007;131(5):861-72. doi: 10.1016/j .cell.2007.11.019. PubMed PMID: 18035408.
- PubMed PMID 25316190; PMCID: 4235745.
- Yamamoto S Nagao Y, Kuroiwa K, Hakamata Y, Ichida M, Saito-Ohara F, Tominaga K, Endo H. Rapid selection of XO embryonic stem cells using Y chromosome-linked GFP transgenic mice. Transgenic research. 2014;23(5):757-65. doi: 10.1007/sl 1248-014- 9813-0. PubMed PMID: 25008421.
- PubMed PMID 16517421. Traverso N, Ricciarelli R, Nitti M, Marengo B, Furfaro AL, Pronzato MA, Marinari UM, Domenicotti C. Role of glutathione in cancer progression and chemoresistance. Oxidative medicine and cellular longevity. 2013;2013 :972913. doi: 10.1155/2013/972913. PubMed PMID: 23766865; PMCID: 3673338. An G, Xu Y, Shi L, Shizhen Z, Deng S, Xie Z, Sui W, Zhan F, Qiu L.
- PubMed PMID 25578876. Yuan ZF, Lin S, Molden RC, Cao XJ, Bhanu NV, Wang X, Sidoli S, Liu S, Garcia B A. EpiProfile Quantifies Histone Peptides With Modifications by Extracting Retention Time and Intensity in High-resolution Mass Spectra. Mol Cell Proteomics. 2015; 14(6): 1696- 707. doi: 10.1074/mcp.Ml 14.046011. PubMed PMID: 25805797; PMCID:
- a range includes each individual member.
- a group having 1-3 cells refers to groups having 1, 2, or 3 cells.
- a group having 1-5 cells refers to groups having 1, 2, 3, 4, or 5 cells, and so forth.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Chemical & Material Sciences (AREA)
- Developmental Biology & Embryology (AREA)
- Cell Biology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Veterinary Medicine (AREA)
- Microbiology (AREA)
- Transplantation (AREA)
- General Engineering & Computer Science (AREA)
- Public Health (AREA)
- Immunology (AREA)
- Virology (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Reproductive Health (AREA)
- Gynecology & Obstetrics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
Description
Claims
Priority Applications (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CA3069865A CA3069865A1 (en) | 2017-07-12 | 2018-07-12 | Methods for generating pluripotent stem cells |
EP18832447.9A EP3651779A4 (en) | 2017-07-12 | 2018-07-12 | Methods for generating pluripotent stem cells |
JP2020501461A JP2020532290A (en) | 2017-07-12 | 2018-07-12 | How to make pluripotent stem cells |
US16/630,420 US20210147814A1 (en) | 2017-07-12 | 2018-07-12 | Methods for generating pluripotent stem cells |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US201762531672P | 2017-07-12 | 2017-07-12 | |
US62/531,672 | 2017-07-12 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2019014464A1 true WO2019014464A1 (en) | 2019-01-17 |
Family
ID=65001477
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2018/041851 WO2019014464A1 (en) | 2017-07-12 | 2018-07-12 | Methods for generating pluripotent stem cells |
Country Status (5)
Country | Link |
---|---|
US (1) | US20210147814A1 (en) |
EP (1) | EP3651779A4 (en) |
JP (1) | JP2020532290A (en) |
CA (1) | CA3069865A1 (en) |
WO (1) | WO2019014464A1 (en) |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20120220030A1 (en) * | 2009-08-21 | 2012-08-30 | Reijo Pera Renee A | Enhanced Efficiency of Induced Pluripotent Stem Cell Generation from Human Somatic Cells |
WO2016057574A1 (en) * | 2014-10-06 | 2016-04-14 | Memorial Sloan-Kettering Cancer Center | Method to reduce oncogenic potential of induced pluripotent stem cells from aged donors |
WO2016115407A1 (en) * | 2015-01-14 | 2016-07-21 | Memorial Sloan-Kettering Cancer Center | Age-modified cells and methods for making age-modified cells |
-
2018
- 2018-07-12 JP JP2020501461A patent/JP2020532290A/en active Pending
- 2018-07-12 EP EP18832447.9A patent/EP3651779A4/en active Pending
- 2018-07-12 US US16/630,420 patent/US20210147814A1/en active Pending
- 2018-07-12 CA CA3069865A patent/CA3069865A1/en active Pending
- 2018-07-12 WO PCT/US2018/041851 patent/WO2019014464A1/en unknown
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20120220030A1 (en) * | 2009-08-21 | 2012-08-30 | Reijo Pera Renee A | Enhanced Efficiency of Induced Pluripotent Stem Cell Generation from Human Somatic Cells |
WO2016057574A1 (en) * | 2014-10-06 | 2016-04-14 | Memorial Sloan-Kettering Cancer Center | Method to reduce oncogenic potential of induced pluripotent stem cells from aged donors |
WO2016115407A1 (en) * | 2015-01-14 | 2016-07-21 | Memorial Sloan-Kettering Cancer Center | Age-modified cells and methods for making age-modified cells |
Non-Patent Citations (6)
Title |
---|
CHEN ET AL.: "Rational optimization of reprogramming culture conditions for the generation of induced pluripotent stem cells with ultra-high efficiency and fast kinetics", CELL RESEARCH, vol. 21, no. 6, 29 March 2011 (2011-03-29), pages 884 - 894, XP055565223, Retrieved from the Internet <URL:doi:10.1038/cr.2011.51> * |
FEDELES, B.I.: "G-quadruplex-formingpromoter sequences enable transcriptional activation in response to oxidative stress", PROC. NATL. ACAD. SCI. U.S.A, vol. 114, no. 11, 6 March 2017 (2017-03-06), pages 2788 - 2790, XP055565236, Retrieved from the Internet <URL:https://doi.org/10.1073/pnas.1701244114> * |
KIM ET AL.: "Induction of Cellular Senescence by Insulin-like Growth Factor Binding Protein-5 through a p53-dependent Mechanism", MOLECULAR BIOLOGY, vol. 18, no. 11, 5 September 2007 (2007-09-05), pages 4543 - 4552, XP055565233, Retrieved from the Internet <URL:doi:10.1091/mbc.E07-03-0280> * |
MARSBOOM ET AL.: "Glutamine Metabolism Regulates the Pluripotency Transcription Factor OCT4", CELL REPORTS, vol. 16, no. 2, 12 July 2016 (2016-07-12), pages 323 - 332, XP055565228, Retrieved from the Internet <URL:DOI:10.1016/j.celrep.2016.05.089> * |
See also references of EP3651779A4 * |
SKAMAGKI ET AL.: "ZSCAN10 expression corrects the genomic instability of iPSCs from aged donors", NAT CELL BIOL, vol. 19, no. 9, 28 August 2017 (2017-08-28), pages 1037 - 1048, XP055565241, Retrieved from the Internet <URL:doi:10.1038/ncb3598> * |
Also Published As
Publication number | Publication date |
---|---|
JP2020532290A (en) | 2020-11-12 |
US20210147814A1 (en) | 2021-05-20 |
EP3651779A1 (en) | 2020-05-20 |
EP3651779A4 (en) | 2021-09-01 |
CA3069865A1 (en) | 2019-01-17 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Yoffe et al. | Cap-independent translation by DAP5 controls cell fate decisions in human embryonic stem cells | |
Li et al. | The role of N6-methyladenosine mRNA in the tumor microenvironment | |
Zhang et al. | Biological significance of the suppression of oxidative phosphorylation in induced pluripotent stem cells | |
Wang et al. | Acetylation of PHF5A modulates stress responses and colorectal carcinogenesis through alternative splicing-mediated upregulation of KDM3A | |
Ryall et al. | The NAD+-dependent SIRT1 deacetylase translates a metabolic switch into regulatory epigenetics in skeletal muscle stem cells | |
Stegen et al. | Glutamine metabolism controls chondrocyte identity and function | |
Qin et al. | The m6A methyltransferase METTL3 promotes hypoxic pulmonary arterial hypertension | |
Bach‐Ngohou et al. | Enteric glia modulate epithelial cell proliferation and differentiation through 15‐deoxy‐Δ12, 14‐prostaglandin J2 | |
Huang et al. | Piwil1 regulates glioma stem cell maintenance and glioblastoma progression | |
Sun et al. | The long noncoding RNA Lncenc1 maintains naive states of mouse ESCs by promoting the glycolysis pathway | |
AU2020233697A1 (en) | Age-modified cells and methods for making age-modified cells | |
CA2774999A1 (en) | Methods for modulation of autophagy through the modulation of autophagy-enhancing gene products | |
Zhao et al. | High‐mobility‐group protein 2 regulated by microRNA‐127 and small heterodimer partner modulates pluripotency of mouse embryonic stem cells and liver tumor initiating cells | |
García-García et al. | Intermediate progenitors are increased by lengthening of the cell cycle through calcium signaling and p53 expression in human neural progenitors | |
CN111868078A (en) | Reagents and methods for generating and expanding cardiomyocytes using WNT agonists and bioactive lipids | |
Hofsteen et al. | ALPK2 promotes cardiogenesis in zebrafish and human pluripotent stem cells | |
Li et al. | Generation of Human Lens Epithelial‐Like Cells From Patient‐Specific Induced Pluripotent Stem Cells | |
Cho et al. | The BRPF2/BRD1-MOZ complex is involved in retinoic acid-induced differentiation of embryonic stem cells | |
EP2876160A1 (en) | Differentiation marker for and differentiation control for ocular cells | |
Liu et al. | Canonical microRNAs enable differentiation, protect against DNA damage, and promote cholesterol biosynthesis in neural stem cells | |
US20210147814A1 (en) | Methods for generating pluripotent stem cells | |
Zhang et al. | Visualizing Single-Stranded DNA Foci in the G1 Phase of the Cell Cycle | |
Bachman et al. | Glucocorticoids preferentially influence expression of nucleoskeletal actin network and cell adhesive proteins in human trabecular meshwork cells | |
Mota | Deficiency of Tumor Suppressor Merlin Induces Metabolic Reprogramming in Breast Cancer | |
Gong et al. | CircADSS contributes to hepatocellular carcinoma development by regulating miR‐431‐5p/TOP2A |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18832447 Country of ref document: EP Kind code of ref document: A1 |
|
ENP | Entry into the national phase |
Ref document number: 3069865 Country of ref document: CA |
|
ENP | Entry into the national phase |
Ref document number: 2020501461 Country of ref document: JP Kind code of ref document: A |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
ENP | Entry into the national phase |
Ref document number: 2018832447 Country of ref document: EP Effective date: 20200212 |