WO2019006255A1 - Methods, materials, synthetic hosts and reagents for the biosynthesis of hydrocarbons and derivatives thereof - Google Patents

Methods, materials, synthetic hosts and reagents for the biosynthesis of hydrocarbons and derivatives thereof Download PDF

Info

Publication number
WO2019006255A1
WO2019006255A1 PCT/US2018/040213 US2018040213W WO2019006255A1 WO 2019006255 A1 WO2019006255 A1 WO 2019006255A1 US 2018040213 W US2018040213 W US 2018040213W WO 2019006255 A1 WO2019006255 A1 WO 2019006255A1
Authority
WO
WIPO (PCT)
Prior art keywords
bio
derived
genetically engineered
engineered host
fermentation
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2018/040213
Other languages
French (fr)
Inventor
Stephen Thomas CARTMAN
Jonathan Paul COMBE
Leonard Keith PATTENDEN
Andrew Shaw
Massimiliano ZAMPINI
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Invista North America LLC
Original Assignee
Invista North America LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Invista North America LLC filed Critical Invista North America LLC
Publication of WO2019006255A1 publication Critical patent/WO2019006255A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P5/00Preparation of hydrocarbons or halogenated hydrocarbons
    • C12P5/007Preparation of hydrocarbons or halogenated hydrocarbons containing one or more isoprene units, i.e. terpenes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/746Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for lactic acid bacteria (Streptococcus; Lactococcus; Lactobacillus; Pediococcus; Enterococcus; Leuconostoc; Propionibacterium; Bifidobacterium; Sporolactobacillus)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0006Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1025Acyltransferases (2.3)
    • C12N9/1029Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/12Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/12Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1229Phosphotransferases with a phosphate group as acceptor (2.7.4)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88Lyases (4.)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90Isomerases (5.)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y207/00Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/04Phosphotransferases with a phosphate group as acceptor (2.7.4)
    • C12Y207/04002Phosphomevalonate kinase (2.7.4.2)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y401/00Carbon-carbon lyases (4.1)
    • C12Y401/01Carboxy-lyases (4.1.1)
    • C12Y401/01033Diphosphomevalonate decarboxylase (4.1.1.33), i.e. mevalonate-pyrophosphate decarboxylase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y401/00Carbon-carbon lyases (4.1)
    • C12Y401/03Oxo-acid-lyases (4.1.3)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y402/00Carbon-oxygen lyases (4.2)
    • C12Y402/03Carbon-oxygen lyases (4.2) acting on phosphates (4.2.3)
    • C12Y402/03027Isoprene synthase (4.2.3.27)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y503/00Intramolecular oxidoreductases (5.3)
    • C12Y503/03Intramolecular oxidoreductases (5.3) transposing C=C bonds (5.3.3)
    • C12Y503/03002Isopentenyl-diphosphate DELTA-isomerase (5.3.3.2)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y101/00Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01034Hydroxymethylglutaryl-CoA reductase (NADPH) (1.1.1.34)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y203/00Acyltransferases (2.3)
    • C12Y203/01Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C12Y203/01009Acetyl-CoA C-acetyltransferase (2.3.1.9)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y203/00Acyltransferases (2.3)
    • C12Y203/03Acyl groups converted into alkyl on transfer (2.3.3)
    • C12Y203/0301Hydroxymethylglutaryl-CoA synthase (2.3.3.10)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y207/00Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/01Phosphotransferases with an alcohol group as acceptor (2.7.1)
    • C12Y207/01036Mevalonate kinase (2.7.1.36)
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02EREDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00Technologies for the production of fuel of non-fossil origin
    • Y02E50/30Fuel from waste, e.g. synthetic alcohol or diesel

Definitions

  • the present invention relates to recombinant host cells polynucleotides and polypeptides, methods for their
  • Hydrocarbons are important monomers for the production of specialty elastomers including motor mounts/fittings, surgical gloves, rubber bands, golf balls and shoes.
  • styrene-isoprene-styrene block copolymers form a key component of hot-melt pressure-sensitive adhesive formulations and cis- poly-isoprene is utilized in the manufacture of tires ( hited et al. Industrial Biotechnology 2010 6(3) :152-
  • biotechnology offers an alternative approach to the generation of industrially relevant products, via biocatalysis .
  • Biotechnology offers more sustainable methods for producing industrial intermediates, in particular isoprene and
  • isoprenoids Construction of recombinant microorganisms and methods o their use to produce hydrocarbons such as isoprene are known in the art. However, many of these methods and processes are unsatisfactory because they rely on agricultural commodities such as sugar cane and corn which can be volatile in supply and cost from time to time. The use of sugar derived from agricultural waste, often called biomass' has been proposed.
  • Biochem. 2002 66 ( 8 ): 1619-1627 ) both of which function in terpenoid synthesis in vivo. Both require the introduction of a non-native ISPS in order to divert carbon to isoprene production .
  • the mevalonate pathway generally occurs in higher eukaryotes and Archaea and incorporates a decarboxylase enzyme, mevalonate diphosphate decarboxylase (hereafter MDD) , that introduces the first vinyl-group into the precursors leading to isoprene.
  • MDD mevalonate diphosphate decarboxylase
  • the second vinyl-group is introduced by isoprene synthase in the final step in synthesizing
  • isoprene The non-mevalonate pathway or 2-C-methyl-D- erythritol 4-phosphate (MEP) pathway occurs in many bacteria and dimethylallyl-PP is generated alongside isopentenyl-PP, two molecules which are interconvertible via the action of isopentenyl pyrophosphate isomerase or isopentyl diphosphate isomerase (hereafter IDI) .
  • IDI isopentyl diphosphate isomerase
  • the mevalonate (MVA) dependent pathway can be split into two units; the upper pathway for the generation of mevalonic acid from central metabolism and the lower pathway for the conversion of mevalonic acid to IPP and DMAPP.
  • MVA mevalonate
  • the upper mevalonate pathway two molecules of acetyl-CoA are condensed to form acetoacetyl-CoA by the action of acetoacetyl-CoA C- acetyltransferase (AACT, EC 2.3.1.9).
  • Acetoacetyl-CoA is then converted to HMG-CoA by HMG-CoA synthase (HMGS, EC 2.3.3.10) and HMG-CoA reductase (HMGR, EC 1.1.1.34) catalyses the reduction of HMG-CoA to mevalonate. Mevalonate then feeds into the lower mevalonate pathway where sequential
  • MVK mevalonate kinase
  • MPK phosphomevalonate kinase
  • IPP decarboxylase (MDD, EC 4.1.1.33), converts mevalonate to IPP. IPP is then isomerised to DMAPP by isopentenyl diphosphate isomerase (IDI, EC 5.3.3.2) .
  • the methods, compositions and hosts are used to synthesize hydrocarbons comprising one or more isoprene units as depicted in Formula I
  • An aspect of the present invention relates to a
  • VMA mevalonate
  • Recombinant hosts of the present invention comprise at least one genome-integrated synthetic operon encoding an enzyme of the MVA pathway.
  • the genetically engineered host comprises a genome-integrated synthetic operon encoding a plurality of enzymes of the MVA pathway.
  • the genetically engineered host comprises a genome integrated synthetic operon encoding one or more enzymes of the upper MVA pathway.
  • the genetically engineered host comprises a genome-integrated synthetic operon encoding the Enterococcus faecalis upper MVA pathway.
  • the genetically engineered host comprises a genome integrated synthetic operon encoding one or more enzymes of the lower MVA pathway. In one nonlimiting embodiment, the genetically engineered host comprises a genome-integrated synthetic operon encoding Streptococcus pneumoniae lower MVA pathway.
  • the genetically engineered host comprises a genome-integrated synthetic operon encoding the Enterococcus faecalis upper MVA pathway and a genome- integrated synthetic operon encoding Streptococcus pneumoniae lower MVA pathway.
  • the genetically engineered host comprises a genome-integrated synthetic operon encoding mevalonate kinase (MK) , mevalonate phosphokinase (MPK) , and mevalonate decarboxylase (MDD) .
  • MK mevalonate kinase
  • MPK mevalonate phosphokinase
  • MDD mevalonate decarboxylase
  • the genetically engineered host may further comprise a genome-integrated transcription unit coding for an isoprene synthase.
  • the genetically engineered host may further comprise one or more plasmids encoding one or more enzymes of the upper and/or lower MVA pathways.
  • Another aspect of the present invention relates to a method for producing genetically engineered stable strains of host cells which produce hydrocarbons.
  • the hydrocarbon produced from the genetically engineered host comprises one or more isoprene units as de Formula I or a salt or derivative thereof.
  • at least one synthetic operon encoding an enzyme of the MVA pathway is integrated into the host genome.
  • At least one synthetic operon encoding a plurality of enzymes of the MVA pathway is integrated into the host genome.
  • a synthetic operon encoding one or more enzymes of the upper MVA pathway is integrated into the host genome.
  • a synthetic operon encoding all or part of the Enterococcus faecalis upper MVA pathway is integrated into the host genome.
  • a synthetic operon encoding one or more enzymes of the lower MVA pathway is integrated into the host genome.
  • a synthetic operon encoding all or part of the Streptococcus pneumoniae lower MVA pathway is integrated into the host genome.
  • MK mevalonate kinase
  • MPK mevalonate phosphokinase
  • MDD mevalonate decarboxylase
  • any of these nonlimiting embodiments of this method may further comprise integrating a transcription unit coding for an isoprene synthase into the host genome.
  • one or more plasmids encoding one or more enzymes of the upper and/or lower MVA pathways and/or an isoprene synthase may be
  • Another aspect of the present invention relates to methods for producing hydrocarbons in a genetically engineered host capable of stable hydrocarbon production.
  • hydrocarbons such as bioderived hydrocarbons, produced in or obtainable from a genetically engineered host capable of stable hydrocarbon production, such as a host as described herein .
  • Yet another aspect of the present invention relates to products such as bio-derived, bio-based, or fermentation- derived products, produced from or obtainable from any of the hosts or methods described herein.
  • FIGs . 1A through ID are plasmid maps for integration vectors pTc (ColElSacB) : : AphaB2C2: : ⁇ ⁇ : : S. pneumoniae L-MVA (FIG. 1A) and pTC(pl5ASacB) : :PcnBA D : :IspS401: :TT: :HMGR: :AACT : : P BAD (FIG. IB), Salix Sp . isoprene synthase expression plasmid pISP407 (FIG.
  • DxpS/IspS expression plasmid pBBRlMCS3- pBAD-His-Bs_DXS_OPT-ISPS (FIG. ID) and DxpS/IspS expression plasmid pBBRlMCS3- pBAD-His-Bs_DXS_OPT-ISPS (FIG. ID) .
  • Hatched arrows open reading frames (ORFs) Black arrows, knockin vector homology arms; Cross-hatched arrows, araBAD promoter; IspS, isoprene synthase; TT, transcriptional terminator; Grey arrow, E. coli origin of replication
  • FIGs. 2A and 2B shows de novo synthesis of isoprene and mevalonolactone in C. necator strains encoding genome- integrated gene copies of the E. faecalis upper MVA pathway and the S. pneumoniae lower MVA pathway.
  • FIG. 3 is a schematic of the MVA pathway.
  • the present invention provides genetically engineered hosts capable of producing hydrocarbons and derivatives thereof via a mevalonate (MVA) pathway as well as methods for production of these hosts and methods for their use in production of hydrocarbons and derivatives thereof.
  • MVA mevalonate
  • compositions and methods for their production comprising an engineered enzymatic pathway that catalyze the conversion of a gas to a hydrocarbon or derivative thereof, compositions and methods for their production, and methods for their use in production of hydrocarbons or derivatives thereof.
  • the compositions and methods comprising an engineered enzymatic pathway that catalyze the conversion of a gas to a hydrocarbon or derivative thereof, compositions and methods for their production, and methods for their use in production of hydrocarbons or derivatives thereof.
  • recombinant cells are introduced into a fermenter, mixed with gas feedstocks which are enzymatically converted to a hydrocarbon by the recombinant cells, and the
  • recombinant cell or “recombinant host” as used herein it is meant to encompass any genetically engineered cell or host as described herein and such terms as recombinant, engineered, and genetically engineered are used interchangeably herein.
  • hydrocarbon or hydrocarbons as used herein, it is meant to encompass any organic compound comprised of carbons and hydrogens which can be enzymatically synthesized from a gas and is inclusive of saturated as well as unsaturated structures with double or triple bonds formed between carbon atoms, ring structures, salts and derivatives thereof.
  • the hydrocarbon comprises one or more isoprene units as depicted in For
  • isoprenoid including, isoprene as well as isoprenoids,
  • terpenes and terpenoids as well as derivatives such as, but not limited to isoprenols, and salts thereof.
  • Nonlimiting examples of hydrocarbons comprising one or more isoprene units produced in accordance with the present invention include isoprene as well as any isoprenoid, terpene or terpenoid derivative of 5, including C5, CIO, C15, C20, C25, C30, C35, C40, C45, C50, etc.
  • hemiterpene include hemiterpene, monoterpene, diterpene, triterpene, tetraterpene , polyterpene, lycopene, abietadiene, amorphadiene, carene, alpha-farnesene, beta-farnesene, farnesol, geraniol, geranylgeraniol , isoprene, linalool, limonene, myrcene, nerolidol, ocimene, patchoulol, beta- pinene, sabinene, gamma-terpinene, terpinolene and valencene, as well as derivatives and salts thereof.
  • the mevalonate pathway for the conversion of acetyl-CoA to the isoprenoid precursors, IPP and DMAPP, is found in eukaryotes, archaea and some bacteria, but is absent from the facultative chemolithoautotrophic bacterium, Cupriavidus necator (previously called Hydrogenomonas eutrophus,
  • Cupriavidus necator is a Gram-negative
  • This hydrogen-oxidizing bacterium is capable of growing at the interface of anaerobic and aerobic environments and easily adapts between heterotrophic and autotrophic lifestyles.
  • Sources of energy for the bacterium include both organic compounds and hydrogen.
  • C. necator does not naturally contain genes for isoprene synthase (ISPS) and therefore does not express this enzyme. Additional properties of Cupriavidus necator include microaerophilicity, copper resistance (Makar and Casida; 1987), bacterial predation (Byrd et al., 1985; Sillman & Casida, 1986; Zeph & Casida, 1986) and
  • PHB polyhydrobutyrate
  • the host of the present invention is Cupriavidus necator, such as a genetically engineered strain of Cupriavidus necator capable of stable hydrocarbon production.
  • the present invention relates to Cupriavidus necator host capable of producing isoprenoids via a mevalonate (MVA) pathway, such as an isolated or substantially pure genetically engineered Cupriavidus necator host capable of producing isoprenoids via a mevalonate (MVA) pathway.
  • a nonlimiting example of a C. necator host useful in the present invention is a C. necator of the H16 strain. In one nonlimiting embodiment, a C.
  • necator host of the H16 strain with the phaCAB gene locus knocked out (phaCAB) is used.
  • a "substantially pure culture" of a recombinant host microorganism is a culture of that
  • microorganism in which less than about 40% (i.e., less than about 35%; 30%; 25%; 20%; 15%; 10%; 5%; 2%; 1%; 0.5%; 0.25%; 0.1%; 0.01%; 0.001%; 0.0001%; or even less) of the total number of viable cells in the culture are viable cells other than the recombinant microorganism, e.g., bacterial, fungal (including yeast), mycoplasmal, or protozoan cells.
  • viable cells other than the recombinant microorganism e.g., bacterial, fungal (including yeast), mycoplasmal, or protozoan cells.
  • the term "about” in this context means that the relevant percentage can be 15% of the specified percentage above or below the
  • Such a culture of recombinant microorganisms includes the cells and a growth, storage, or transport medium.
  • Media can be liquid, semi-solid (e.g., gelatinous media), or frozen.
  • the culture includes the cells growing in the liquid or in/on the semi-solid medium or being stored or transported in a storage or transport medium, including a frozen storage or transport medium.
  • the cultures are in a culture vessel or storage vessel or substrate (e.g., a culture dish, flask, or tube or a storage vial or tube) .
  • the host of the present invention is a genetically engineered host having one or more of the above-mentioned properties of Cupriavidus necator .
  • the host of the present invention is a genetically engineered host selected from non-pathogenic members of the genera Ralstonia,
  • Wausteria Cupriavidus, Alcaligenes, Burkholderia or
  • the present invention provides methods and compositions for synthesizing hydrocarbons in these genetically engineered cells .
  • a host of the invention such as organisms such as C. necator, as well as non-pathogenic members of the genera Ralstonia, Wausteria, Alcaligenes, Burkholderia and Pandoraea and other organisms having one or more of the above-mentioned properties of Cupriavidus necator can be used to synthesize hydrocarbons via a mevalonate (MVA) dependent pathway.
  • MVA mevalonate
  • Recombinant hosts of the present invention comprise at least one genome-integrated synthetic operon encoding an enzyme of the MVA pathway.
  • the host may comprise any one or more of these enzymes, such as at least two or at least three of these enzymes .
  • the recombinant host comprises at least two genome-integrated synthetic operons encoding enzymes of the MVA pathway.
  • the genetically engineered strain is produced by integration of a synthetic operon encoding one or more enzymes of the upper MVA pathway into the host genome. In one nonlimiting embodiment, the genetically engineered strain is produced by integration of a synthetic operon encoding one or more enzymes of the Enterococcus faecalis upper MVA pathway into the host genome.
  • the host genome comprises an operon encoding one or more enzymes of the Enterococcus faecalis upper MVA pathway.
  • the operon may be a synthetic operon.
  • the operon may be exogenous to the host.
  • One or more of the enzymes may be exogenous to the host.
  • the operon encodes at least one AACT and/or at least one HMGR and/or at least one HMGS .
  • the operon encodes at least one AACT and at least one HMGR and at least one HMGS.
  • the operon includes sequences encoding AACT, HMGR and HMGS, arranged in that order.
  • Nonlimiting examples of enzymes of upper MVA pathway include the polypeptides of AACT (e.g. SEQ ID NO:l and SEQ ID NO: 56), HMGR (e.g. SEQ ID NOs : 1, 58, 60, 62, 64 and 66) and HMGS (e.g.
  • SEQ ID NOs:2, 68, 70, 72 and 74 as well as polypeptides with similar enzymatic activities exhibiting at least 70%, 75%, 80, 85, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% sequence identity to an amino acid sequence set forth in SEQ ID NOs: 1, 56, 58, 60, 62, 64, 66, 2, 68, 70, 72 or 74 or a functional fragment thereof.
  • nucleic acid sequences encoding such enzymes which can be integrated into the host genome include the nucleic acid sequences of AACT (e.g. SEQ ID NO:23 and SEQ ID NO:55), HMGR (e.g.
  • the host may comprise any one or more of these enzymes, such as at least one AACT and/or at least one HMGR and/or at least one HMGS. In some non-limiting embodiments, the host comprises at least one AACT and at least one HMGR and at least one HMGS. In one nonlimiting
  • the nucleic acid sequence is codon optimized for C. necator expression.
  • the genetically engineered strain is produced by integration of a synthetic operon encoding one or more enzymes of the lower MVA pathway into the host genome.
  • the genetically engineered strain is produced by integration of a synthetic operon encoding one or more enzymes of the Streptococcus pneumoniae lower MVA pathway into the host genome.
  • the host genome comprises an operon encoding one or more enzymes of the Streptococcus pneumoniae lower MVA pathway.
  • the operon may be a synthetic operon.
  • the operon may be exogenous to the host.
  • One or more of the enzymes may be exogenous to the host.
  • the operon encodes one or more MVK and/or one or more MPK and/or one or more MDD and/or one or more IDI.
  • the operon encodes at least one MVK and at least one MPK and at least one MDD, or encodes at least one MVK and at least one MPK and at least one MDD and at least one IDI.
  • the operon comprises sequences coding for MVK, MPK and MDD, arranged in that order.
  • Nonlimiting examples of enzymes of the lower MVA pathway include mevalonate kinase (MVK; e.g. SEQ ID NO: 3), phosphomevalonate kinase (MPK; e.g. SEQ ID NO : ) , mevalonate diphosphate
  • MVK mevalonate kinase
  • MPK phosphomevalonate kinase
  • MDD decarboxylase
  • SEQ ID NO: 5 isopentenyl
  • diphosphate isomerase e.g. SEQ ID NO: 6
  • polypeptides with similar enzymatic activities exhibiting at least 70%, 75%, 80, 85, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% sequence identity to an amino acid sequence set forth in SEQ ID NOs : 3, 4, 5 or 6 or a functional fragment thereof.
  • nucleic acid sequences encoding such enzymes which can be integrated into the host genome include the nucleic acid sequences of MVK (e.g. SEQ ID NO:25), MPK (e.g. SEQ ID NO:26), MDD (e.g. SEQ ID NO:27) and IDI (e.g. SEQ ID NO:28) as well as nucleic acid sequences encoding polypeptides with similar enzymatic
  • the host may comprise any one or more of these enzymes, such as one or more MVK and/or one or more MPK and/or one or more MDD and/or one or more IDI.
  • the host comprises at least one MVK and at least one MPK and at least one MDD, or encodes at least one MVK and at least one MPK and at least one MDD and at least one IDI.
  • the nucleic acid sequence is codon optimized for C. necator expression.
  • the genetically engineered strain comprises a genome-integrated synthetic operon encoding the one or more enzymes of the upper MVA pathway and a genome- integrated synthetic operon encoding one or more enzymes of the lower MVA pathway. In one nonlimiting embodiment, the genetically engineered strain comprises a genome-integrated synthetic operon encoding the one or more enzymes of the
  • the host comprises any one or more enzymes of the upper MVA pathway as described above and any one or more enzymes of the lower MVA pathway as described above. In some non-limiting embodiments, these enzymes of the upper and/or lower MVA pathway are integrated into the genome of the host.
  • the genetically engineered strain is produced by integration of a synthetic operon encoding mevalonate kinase (MK) , mevalonate phosphokinase (MPK) , and mevalonate decarboxylase (MDD) into the host genome.
  • MK mevalonate kinase
  • MPK mevalonate phosphokinase
  • MDD mevalonate decarboxylase
  • polypeptides with similar enzymatic activities exhibiting at least 70%, 75%, 80, 85, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% sequence identity to an amino acid sequence set forth in SEQ ID NOs : 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 or a functional fragment thereof.
  • nucleic acid sequences encoding such enzymes which can be integrated into the host genome include the nucleic acid sequences of SEQ ID NO:s 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43 or 44 as well as nucleic acid sequences encoding polypeptides with similar enzymatic
  • the nucleic acid sequence is codon optimized for C. necator expression.
  • the genetically engineered strain is produced by integration of a synthetic operon comprising SEQ ID NO: 48, 49 or 50.
  • the recombinant host further comprises at least one additional plasmid encoding an enzyme of the MVA pathway.
  • the recombinant host further comprises a plurality of plasmids expressing enzymes of the lower and/or upper MVA pathway.
  • engineered strain may further comprise a sequence coding for an isoprene synthase enzyme, such as a genome-integrated transcription unit coding for an isoprene synthase enzyme.
  • isoprene synthase enzymes include the polypeptide sequence of Populus alba isoprene synthase (IspS), EC 4.2.3.27 (accession number Q50L36; SEQ ID NO:7), and the polypeptide sequence of Salix sp .
  • DG-2011 isoprene synthase IspS
  • EC 4.2.3.27 accession number AEK70970; SEQ ID NO:8
  • polypeptides with similar enzymatic activities exhibiting at least 70%, 75%, 80, 85, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% sequence identity to an amino acid sequence set forth in SEQ ID NOs : 7 or 8 or a functional fragment thereof.
  • nucleic acid set forth in SEQ ID NOs : 7 or 8 or a functional fragment thereof.
  • sequences encoding such enzymes which can be integrated into the host genome include the nucleic acid sequences of Populus alba isoprene synthase (SEQ ID NO: 29) and Salix s .
  • the nucleic acid sequence is codon optimized for C. necator expression.
  • Integration of the transcription unit coding for an isoprene synthase enzyme provides a convenient readout for DMAPP production in the host.
  • the percent identity (homology) between two amino acid sequences as disclosed herein can be determined as follows. First, the amino acid sequences are aligned using the BLAST 2 Sequences (Bl2seq) program from the stand-alone version of BLAST containing BLASTP version 2.0.14. This stand-alone version of BLAST can be obtained from the U.S. government's National Center for Biotechnology Information web site (www with the extension ncbi.nlm.nih.gov). Instructions explaining how to use the B12seq program can be found in the readme file accompanying BLASTZ . Bl2seq performs a comparison between two amino acid sequences using the BLASTP algorithm.
  • Bl2seq performs a comparison between two amino acid sequences using the BLASTP algorithm.
  • B12seq are set as follows: -i is set to a file containing the first amino acid sequence to be compared (e.g., C: ⁇ seql.txt); -j is set to a file containing the second amino acid sequence to be compared (e.g., C: ⁇ seq2.txt); -p is set to blastp; -o is set to any desired file name (e.g., C: ⁇ output.txt); and all other options are left at their default setting.
  • -i is set to a file containing the first amino acid sequence to be compared (e.g., C: ⁇ seql.txt)
  • -j is set to a file containing the second amino acid sequence to be compared (e.g., C: ⁇ seq2.txt)
  • -p is set to blastp
  • -o is set to any desired file name (e.g., C: ⁇ output.txt); and all other options are left
  • the following command can be used to generate an output file containing a comparison between two amino acid sequences: C: ⁇ Bl2seq-i c: ⁇ seql.txt-j c: ⁇ seq2.txt-p blastp-o c: ⁇ output.txt. If the two compared sequences share homology (identity) , then the two compared sequences share homology (identity) , then the two compared sequences share homology (identity) , then the
  • designated output file will present those regions of homology as aligned sequences. If the two compared sequences do not share homology (identity) , then the designated output file will not present aligned sequences. Similar procedures can be following for nucleic acid sequences except that blastn is used .
  • the number of matches is determined by counting the number of positions where an identical amino acid residue is presented in both sequences.
  • the percent identity (homology) is determined by dividing the number of matches by the length of the full-length polypeptide amino acid sequence followed by multiplying the resulting value by 100. It is noted that the percent identity (homology) value is rounded to the nearest tenth. For example, 90.11, 90.12, 90.13, and 90.14 is rounded down to 90.1, while 90.15, 90.16, 90.17, 90.18, and 90.19 is rounded up to 90.2. It also is noted that the length value will always be an integer.
  • nucleic acids can encode a polypeptide having a particular amino acid sequence.
  • the degeneracy of the genetic code is well known to the art; i.e., for many amino acids, there is more than one nucleotide triplet that serves as the codon for the amino acid.
  • codons in the coding sequence for a given enzyme can be modified such that optimal expression in a particular species (e.g., bacteria or fungus) is obtained, using
  • Functional fragments of any of the polypeptides or nucleic acid sequences described herein can also be used in the methods of the document.
  • the term "functional fragment” as used herein refers to a peptide fragment of a polypeptide or a nucleic acid sequence fragment encoding a peptide fragment of a polypeptide that has at least 25% (e.g., at least: 30%; 40%; 50%; 60%; 70%; 75%; 80%; 85%; 90%; 95%; 98%; 99%; 100%; or even greater than 100%) of the activity of the corresponding mature, full-length, polypeptide.
  • the functional fragment can generally, but not always, be comprised of a continuous region of the polypeptide, wherein the region has functional
  • Methods of the present invention can be performed in a host as described herein, such as a recombinant Cupriavidus necator host, as well as non-pathogenic members of the genera Ralstonia, austeria, Alcaligenes, Burkholderia and Pandoraea, and other organisms having one or more of the above-mentioned properties of Cupriavidus necator.
  • Recombinant hosts can naturally express none or some (e.g., one or more, two or more) of the enzymes of the
  • Endogenous genes of the recombinant hosts also can be disrupted to prevent the formation of undesirable metabolites or prevent the loss of intermediates in the pathway through other enzymes acting on such
  • Recombinant hosts can be referred to as
  • recombinant hosts can include exogenous nucleic acids encoding one or more of enzymes of the MVA pathway, as described herein.
  • recombinant host of the invention may be any genetically engineered cell or host as described herein.
  • exogenous refers to a nucleic acid that does not occur in (and cannot be obtained from) a cell of that particular type as it is found in nature or a protein encoded by such a nucleic acid.
  • a non-naturally- occurring nucleic acid is considered to be exogenous to a host once in the host. It is important to note that non-naturally- occurring nucleic acids can contain nucleic acid subsequences or fragments of nucleic acid sequences that are found in nature provided the nucleic acid as a whole does not exist in nature.
  • nucleic acid molecule containing a genomic DNA sequence within an expression vector is non- naturally-occurring nucleic acid, and thus is exogenous to a host cell once introduced into the host, since that nucleic acid molecule as a whole (genomic DNA plus vector DNA) does not exist in nature.
  • any vector autonomously
  • replicating plasmid, or virus e.g., retrovirus, adenovirus, or herpes virus
  • virus e.g., retrovirus, adenovirus, or herpes virus
  • restriction endonuclease treatment as well as cDNAs are considered to be non-naturally-occurring nucleic acid since they exist as separate molecules not found in nature. It also follows that any nucleic acid containing a promoter sequence and polypeptide-encoding sequence (e.g., cDNA or genomic DNA) in an arrangement not found in nature is non-naturally- occurring nucleic acid.
  • a nucleic acid that is naturally- occurring can be exogenous to a particular host microorganism. For example, an entire chromosome isolated from a cell of yeast x is an exogenous nucleic acid with respect to a cell of yeast y once that chromosome is introduced into a cell of yeast y.
  • endogenous as used herein with reference to a nucleic acid (e.g., a gene) (or a protein) and a host refers to a nucleic acid (or protein) that does occur in (and can be obtained from) that particular host as it is found in nature.
  • a cell “endogenously expressing” a nucleic acid (or protein) expresses that nucleic acid (or protein) as does a host of the same particular type as it is found in nature.
  • a host "endogenously producing” or that "endogenously produces” a nucleic acid, protein, or other compound produces that nucleic acid, protein, or compound as does a host of the same particular type as it is found in nature .
  • Populus alba isoprene synthase (IspS, EC 4.2.3.27) to provide a convenient readout for DMAPP production.
  • the E. faecalis upper MVA pathway and the S. pneumoniae lower MVA pathway were integrated into the C. necator til 6 genome by homologous recombination as two arabinose-inducible operons, together with a third synthetic gene encoding P. alba isoprene synthase to provide a readout for DMAPP production.
  • the resulting strain, BDISC_0921 was transformed with plasmid pISP407 expressing a second isoprene synthase gene from Salix Sp . , to ensure there was sufficient in vivo isoprene activity to draw carbon flux though the MVA pathway.
  • BDISC_0921 and its plasmid-containing derivative, BDISC_0990 were tested in an isoprene/mevalonolactone bioassay against a C. necator strain with enhanced DMAPP production through the overexpression of the non-mevalonate pathway enzyme, DxpS, and a control strain, BDISC_0913, containing only the upper MVA pathway with the P. alba IspS.
  • BDISC_0913 containing a genome-integrated copy of the upper MVA pathway in the absence of the mevalonate-consuming lower MVA pathway (see FIG. 2B) .
  • BDISC_0913 produced the highest mevalonolactone titre, of 4.5 mg/L/OD 60 o, with 0.2 g/L ammonium chloride.
  • Both the isoprene and mevalonolactone assay results are consistent with higher carbon flux going through the MVA pathway under nitrogen-limitation conditions used to induce the C. necator stringent response. Taken together these results confirm that the genome-integrated gene copies of the E. faecalis upper VA pathway and the S. pneumoniae lower MVA pathway are functional in C. necator and are able to support the detectable bioconversion of acetyl-CoA from central metabolism to isoprene.
  • Nucleic acid sequences used in identifying these variants include SEQ ID NO: 45, 46 and 47.
  • variants comprise the following combination of genes.
  • the present invention also provides methods for hydrocarbon production.
  • a method of hydrocarbon production as described herein is carried out using any host of the invention.
  • a host of the invention such as a recombinant or genetically engineered host as described herein, for the production of a hydrocarbon.
  • the use may involve any method of hydrocarbon production as described herein.
  • the hydrocarbon produced from the genetically engineered host comprises one or more isoprene units as de Formula I
  • Methods of the present invention can be performed in a recombinant Cupriavidus necator host, as well as nonpathogenic members of the genera Ralstonia, Wausteria,
  • the method comprises enzymatically converting mevalonate to isopentenyl- pyrophosphate in a genetically engineered host as described herein .
  • the hydrocarbon production method is performed using a genetically engineered host comprising at least one genome-integrated synthetic operon encoding an enzyme of the MVA pathway.
  • enzymes of this pathway include acetoacetyl-CoA C- acetyltransferase (AACT) , HMG-CoA reductase (HMGR) ,
  • HMGS hydroxymethylglutaryl-CoA synthase
  • MVK mevalonate kinase
  • MP phosphomevalonate kinase
  • MDD mevalonate diphosphate decarboxylase
  • IDI isopentenyl diphosphate isomerase
  • ISPS isoprene synthase
  • the hydrocarbon production method is performed using a genetically engineered host comprising at least two genome-integrated synthetic operons encoding enzymes of the MVA pathway.
  • the hydrocarbon production method is performed using a genetically engineered host comprising a synthetic operon encoding one or more enzymes of the upper MVA pathway into the host genome.
  • the hydrocarbon production method is performed using a genetically engineered host comprising a synthetic operon encoding one or more enzymes of the E. faecalis , C. necator, S. cerevisiae, L. monocytogenes , S. pneumonia r L. lactis or S. aureus upper MVA pathway into the host genome.
  • any of the nucleic acid sequences encoding a polypeptide having AACT e.g.
  • HMGR e.g. SEQ ID NOs : 1, 58, 60, 62, 64 and 66
  • HMGS e.g. SEQ ID NOs:2, 68, 70, 72 and 74
  • polypeptides with similar enzymatic activities exhibiting at least 70%, 75%, 80, 85, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% sequence identity to an amino acid sequence set forth in SEQ ID NOs: 1, 56, 58, 60, 62, 64, 66, 2, 68, 70, 72 or 74 or a functional fragment thereof, as described supra can be used.
  • Nonlimiting examples of nucleic acid sequences encoding such enzymes which can be integrated into the host genome include the nucleic acid sequences of AACT (e.g. SEQ ID NO: 23 and SEQ ID NO:55), HMGR (e.g. SEQ ID NOs: 23, 57, 59, 61, 63 and 65) and HMGS (e.g.
  • SEQ ID NO:24, 67, 69, 71 and 73 as well as nucleic acid sequences encoding polypeptides with similar enzymatic activities exhibiting at least 70%, 75%, 80, 85, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% sequence identity to the nucleic acid sequence set forth in SEQ ID NOs: 23, 55, 57, 59, 61, 63, 65, 24, 67, 69, 71 or 73 or a functional fragment thereof.
  • the hydrocarbon production method is performed using a genetically engineered host comprising a synthetic operon encoding one or more enzymes of the lower MVA pathway into the host genome.
  • the hydrocarbon production method is performed using a genetically engineered host comprising a synthetic operon encoding one or more enzymes of the Streptococcus pneumoniae lower MVA pathway into the host genome.
  • IDLI isopentenyl diphosphate isomerase
  • SEQ ID NO: 6 isopentenyl diphosphate isomerase
  • polypeptide with similar enzymatic activities exhibiting at least 70%, 75%, 80, 85, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% sequence identity to an amino acid sequence set forth in SEQ ID NOs: 3, 4, 5 or 6 or a functional fragment thereof as described supra can be used.
  • the method is
  • the method is performed using a genetically engineered host comprising one or more exogenous nucleic acid sequences encoding one or more enzymes of the upper MVA pathway and one or more exogenous nucleic acid sequences encoding one or more enzymes of the lower MVA pathway.
  • the method is performed using a genetically engineered host comprising one or more exogenous nucleic acid sequences encoding one or more enzymes of the Enterococcus faecalis upper MVA pathway as described supra and one or more exogenous nucleic acid sequences encoding one or more enzymes of the Streptococcus pneumoniae lower MVA pathway as described supra.
  • the hydrocarbon production method is performed using a genetically engineered strain produced by integration of a synthetic operon encoding mevalonate kinase (MK) , mevalonate phosphokinase (MPK) , and mevalonate decarboxylase (MDD) into the host genome.
  • MK mevalonate kinase
  • MPK mevalonate phosphokinase
  • MDD mevalonate decarboxylase
  • the hydrocarbon production method is performed using a genetically engineered strain comprising a nucleic acid sequence codon optimized for C.
  • the hydrocarbon production method is performed using a genetically engineered strain comprising a synthetic operon comprising SEQ ID NO: 48, 49 or 50.
  • the hydrocarbon is selected from:
  • production method is performed using a genetically engineered strain further comprising a plurality of plasmids expressing enzymes of the lower and/or upper MVA pathway.
  • engineered strain used in the hydrocarbon production methods may further comprise a genome-integrated transcription unit coding for an isoprene synthase enzyme as described supra.
  • the method comprises contacting a host of the invention with a suitable substrate under conditions such that the host is capable of producing a hydrocarbon from the substrate via a MVA pathway.
  • a method may comprise culturing a host of the invention in the presence of a suitable substrate.
  • the substrate is acetyl-CoA, or a substrate that can be converted to form acetyl-CoA by the host.
  • a fermentation strategy can be used that entails anaerobic, micro-aerobic or aerobic cultivation.
  • a fermentation strategy can entail nutrient limitation such as nitrogen, phosphate or oxygen limitation.
  • a cell retention strategy using a ceramic hollow fiber membrane can be employed to achieve and maintain a high cell density during fermentation.
  • the substrate, or the principal carbon source fed to the fermentation can be or can derive from a biological or non-biological feedstock.
  • the biological feedstock can be, or can derive from,
  • the non- biological feedstock can be, or can derive from, natural gas, syngas, CO 2 /H 2 , methanol, ethanol, non-volatile residue (NVR) a caustic wash waste stream from cyclohexane oxidation processes or waste stream from a chemical industry such as, but not limited to a carbon black industry or a hydrogen-refining industry, or petrochemical industry.
  • At least one of the enzymatic conversions of the hydrocarbon production method comprises gas fermentation within the recombinant Cupriavidus necator host, or a non-pathogenic member of the genera
  • the gas fermentation may comprise at least one of natural gas, syngas, CO 2 /H 2 , methanol, ethanol, non-volatile residue, caustic wash from cyclohexane oxidation processes, or waste stream from a chemical industry such as, but not limited to a carbon black industry or a hydrogen-refining industry, or petrochemical industry.
  • the gas fermentation comprises C0 2 /H 2 .
  • the substrate is a gas. In some non-limiting embodiments, the method comprises
  • the gas comprises at least one of natural gas, syngas, C0 2 /H 2 , methanol, ethanol, non-volatile residue, caustic wash from cyclohexane oxidation processes, or waste stream from a chemical industry such as, but not limited to a carbon black industry or a hydrogen-refining industry, or petrochemical industry.
  • the gas comprises The methods of the present invention may further comprise recovering produced hydrocarbons from the recombinant host.
  • the hydrocarbons may comprise one or more isoprene units, as described herein.
  • the hydrocarbon is selected from:
  • produced by a method of the invention is a gas.
  • the method further comprises recovering produced gaseous hydrocarbon from the host.
  • hydrocarbons can be recovered from the fermenter off-gas stream as a volatile product as the boiling point of isoprene is 34.1°C. At a typical fermentation temperature of approximately 30 °C, hydrocarbons have a high vapor pressure and can be stripped by the gas flow rate through the broth for recovery from the off-gas. Hydrocarbons can be selectively adsorbed onto, for example, an adsorbent and separated from the other off-gas components . Membrane separation technology may also be employed to separate
  • Hydrocarbons from the other off-gas compounds Hydrocarbons may be desorbed from the adsorbent using, for example, nitrogen and condensed at low temperature and high pressure.
  • the hydrocarbon has carbon isotope ratio that reflects an atmospheric carbon dioxide uptake source.
  • ratios include, but are not limited to, carbon-12, carbon-13, and carbon-14 isotopes.
  • the present invention provides a product such as a bio-derived, bio-based, or fermentation-derived product produced using the methods and/or compositions disclosed herein.
  • a product such as a bio-derived, bio-based, or fermentation-derived product produced using the methods and/or compositions disclosed herein.
  • examples of such products include, but are not limited to, compositions comprising at least one bio- derived, bio-based, or fermentation-derived compound or any combination thereof, as well as polymers, rubbers such as cis polyisoprene rubber, trans-polyisoprene rubber, or liquid polyisoprene rubber, molded substances, formulations and semi solid or non-semi-solid streams comprising one or more of the bio-derived, bio-based, or fermentation-derived compounds or compositions, combinations or products thereof.
  • the present invention provides methods of producing such a product.
  • the method comprises producing a hydrocarbon by a method of the invention and converting the hydrocarbon to said product.
  • a method of producing a polymer comprises the steps of producing a hydrocarbon by a method as described herein and forming a polymer from said hydrocarbon .
  • the MVA pathway was assembled in C. necator from genes encoding the enzymes of the E. faecalis upper MVA pathway (AACT and HMGR) and S. pneumoniae lower MVA pathway (MVK, MPK, MDD and IDI) .
  • AACT and HMGR genes encoding the enzymes of the E. faecalis upper MVA pathway
  • MVK microsomal protein
  • MPK microsomal protein
  • MDD MDD
  • IDI IDI
  • pneumoniae mevalonate pathway was monitored in live C. necator cells by converting DMAPP to isoprene with truncated versions of the Populus alba and Salix sp .
  • DG-2011 isoprene synthase IspS, EC 4.2.3.27, each containing a deletion of residues 1 to 36 encoding plastidic targeting sequences. Synthetic genes encoding these enzymes were codon optimized for expression in C. necator (see polypeptide and nucleotide sequences in
  • Example 2 Construction of the C. necator genome-integrated MVA pathway strain
  • Two knockin vectors were assembled for the targeted integration of the E. faecalis upper MVA pathway, the S.
  • S. pneumoniae L-MVA (FIG. 1A) consisted of a synthetic operon encoding the S. pneumoniae lower MVA pathway (MVK, MPK, MDD) under the control of the araBAD promoter, flanked by 1 kb homology arms to the
  • the knockin vector When introduced into C. necator H16 by conjugation, the knockin vector was designed to integrate the lower MVA pathway at the phaB2C2 locus of chromosome 1 by homologous recombination and delete the phaB2C2 operon.
  • the second knockin vector, pTC (pl5ASacB) : : AphaCAB : ⁇ PcnBAD ⁇ :IspS401: : TT : : HMGR : : AACT : : P BAD (FIG. IB) consisted of separate transcription units coding for the E. faecalis upper MVA pathway and P.
  • the P. alba IspS/E. faecalis upper MVA pathway double promoter cassette was designed to integrate at the phaClABl locus on chromosome 1 and delete the phaClABl operon encoding essential enzymes of the competing polyhydroxyalkanoate (PHA) pathway.
  • PHA polyhydroxyalkanoate
  • C. necator exconjugants derived from single cross-over events were selected on defined medium (1.15 g/L KH 2 P0 4 ; 1.15 g/L Na 2 HP0 4 ; 1 g/L NH 4 C1; 0.5 g/L MgS0 .7H 2 0; 0.062 g/L
  • sucrose- resistant colonies displaying a PHA-deficient visual phenotype were genotyped by colony PCR with primers BDIPRIM 2496 and 2543 (Table 1), to confirm the correct insertion of the
  • BDISC_0664 C. necator Hi 6 AphaClABl : : pBBRlMCS3-pBAD- His-Bs_DXS_OPT-ISPS, FIG. ID
  • P. alba IspS and Bacillus subtilis MEP pathway enzyme l-deoxy-D-xylulose-5- phosphate synthase, DxpS (EC 2.2.1.7) from an arabinose- inducible promoter.
  • plasmid pISP407 FIG. 1C
  • plasmid pISP407 expressing a second arabinose-inducible isoprene synthase
  • Table 1 provides the amplification primers used for genotyping C. necator H16 AphaB2C2 and AphaClABl gene knockin strains .
  • AphaClABl (SEQ ID NO: 53)
  • Example 4 De novo isoprene and mevalonate production from the C. necator genome-integrated MVA pathway strain
  • GC-MS chromatography-mass spectrometry
  • mevalonolactone bioassays were performed in defined media under nitrogen limitation conditions similar to those used for PHA production (Ishizaki, 2001) .
  • the optimal carbon to nitrogen ratio for isoprene/mevalonolactone production was tested by performing the bioassays in defined media with different ammonium chloride concentrations, ranging from 0.2 to 1.0 g/L.
  • the cultures were pelleted by centrifugation at 6000 g for 20 minutes and wet cell weight was measured for each cell pellet.
  • the density of each culture was normalized to 0.1 g WCW/ml by re-suspending the C. necator cells with the
  • an isoprene calibration series was set up in 10ml GC-MS vials containing 1990 ⁇ defined media with 10 ⁇ of 20 ppm to 1000 ppm of isoprene standards
  • spike-recovery vials were also set up containing 10 ⁇ of 1 ppm isoprene, for a random selection of the experimental conditions tested (one randomly selected strain for each NH 4 C1 concentration set up in duplicate) . All vials ( isoprene/mevalonolactone experimental, isoprene
  • Headspace isoprene measurements were performed by GC-MS on an Agilent Technologies 7890B gas chromatograph connected to an Agilent quadrupole 5977A MSD instrument with an
  • the instrument was equipped with a dual head MPS autosampler
  • Culture broths were clarified by centrifugation 10, 000 g for 10 minutes.
  • the resulting supernatant (0.4 ml) was acidified with 0.2 mL 0.5 M HC1, vortex for 10s and agitated at 1400 rpm for 15 minutes to convert all the mevalonic acid into mevalonolactone .
  • the mevalonolactone was extracted from the aqueous phase by the addition of 0.5 ml of MTBE ((Methyl tertiary butyl ether) and the samples were wortex for 10s agitated at 1400 rpm for a further 30 minutes.
  • the MTBE used for the extraction contained an internal standard,
  • mevalonolactone calibration series was set up by a diluting mevalonolactone standard in 400 ⁇ of defined media to final concentrations ranging from 1.5625 ppm to 100 ppm.
  • spike recovery samples were set up with selected samples. All samples, including the standards were treated in the same way. Following extraction, but leaving both phases in the same vial, 2 ⁇ of the top layer was injected onto the GCMS .
  • the GCMS parameters used to measure mevalonolactone are presented in Table 3.
  • the presence of mevalonolactone in samples was confirmed by comparison of retention time and ion ratios (Table 4) to those of the mevalonolactone standards, with the ion - 43 m/z being selected for quantification. All data from standards and samples were normalised to the internal standard caryophyllene (selected ion - 93 m/z) .
  • Ions used for analysis and quantification of mevalonolactone and the internal standard (caryophyllene) in selected ion monitoring (SIM) acquisition mode are listed in Table 4. Table 4. Ions used for mevalolactone and the internal standard (caryophyllene) for quantitation in selected ion monitoring (SIM) acquisition mode
  • MVK mevalonate kinase
  • MPK mevalonate phosphokinase
  • MDD mevalonate decarboxylase
  • MPK and MDD polypeptides of SEQ ID NO: 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 and nucleic acid sequences of SEQ ID NO: 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43 or 44) and flanked by appropriately designed overlaps
  • the activity of the assembled l-MVA pathway variants was assessed by a functional assay providing indirect information about E. coli cellular synthesis of isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP ) , two essential metabolites used as terpenoids building blocks and synthesized as the last products of the l-MVA pathway (or the MEP
  • the antibiotic fosmidomycin (inhibitor of DOXP reductase (dxr) , the second enzyme of the MEP pathway) was selected to inhibit the native E. coli MEP pathway that supplies the essential metabolites IPP and DMAPP.
  • NEB5oc competent cells were transformed with pBDISC0768-derivatives expressing the different l-MVA pathway variants, and then plated on LBA supplemented with tetracycline (10 ⁇ g/ml) , fosmidomycin (5 ⁇ g/ml) , and 1 mM (R) -mevalonic acid or (R) -Mevalonolactone .
  • (R) -Mevalonolactone produced the same results as the
  • Gas chromatography vials (screw cap headspace gas chromatography (GC) vials (Anatune 093640-040-00 and 093640- 038-00)) were prepared that contained with 1.96 ml of TSB-D supplemented with appropriate antibiotics as above, arabinose 1%, and 15 mM (R) -mevalonolactone, and inoculated with 40 ⁇ 1 of the respective ON cell culture.
  • GC headspace gas chromatography
  • Table 5 Genes used to perform the uMVA screen, with SEQ ID NO, organism of origin, gene function and GenBank/Uniprot identifier provided.
  • the uMVA pathway library was constructed by assembling a set of synthetic operons, under the control of the arabinose- inducible P BAD promoter, with the following order of DNA parts P BAD promoter-ISPS-PhaA-HMGR-HMGS-rrrnBT2 terminator.
  • ISPS isoprene synthase
  • PhaA acetoacetyl-CoA
  • HMGR hydroxymethylglutaryl-CoA reductase
  • HMGS hydroxymethylglutaryl-CoA reductase
  • HMGR - L monocytogenes HMGS -rrnBt2 pBBRl-lA-pBAD- Salix ISPS -C. necator phaA- L.
  • uMVA-pathway variants were expressed in a C. necator H16 derivative strain.
  • This strain possesses the AphaClABl and ⁇ 6_ ⁇ 0006-9 genotypes conferring a PHA- phenotype and improved transformation efficiency, respectively.
  • This strain also has an ispS
  • faecalis uMVA construct integrated into chromosome 1 at the phaClABl locus. It also has the S. pneumonia lMVA-idi
  • C. necator library strains were evaluated for de novo isoprene synthesis in bioassays based on gas chromatography- mass spectrometry (GC-MS) . Seeding cultures were prepared for each strain by inoculating a single colony into 20 ml of 27.5 g/L Tryptone Soya Broth without Dextrose containing the appropriate antibiotic when necessary. Unless otherwise stated, the seeding cultures were incubated at 30°C, 230rpm for 48 hours, then diluted by 1 in 50 into fresh TSB-D media (10 ml) in 50 ml sterile Falcon tubes and incubated for
  • MVA pathway and isoprene synthase expression was induced by adding arabinose to a final concentration of 0.4- 1 % w/v and the cultures were incubated for a further 16 hours (overnight) at 30°C, 230rpm.
  • the cultures were pelleted by centrifugation at 6000 g for 20 minutes and the density of each culture was normalized to either a standard optical density (OD 60 o) or wet cell weight ( CW) concentration (gWCW/ml) by re-suspending the C. necator cells with the appropriate volume of either minimal media or TSB media.
  • spike-recovery vials were also set up containing 10 ⁇ of 1 ppm isoprene, for a random selection of the
  • Headspace isoprene measurements were performed by GC-MS on an Agilent Technologies 7890B gas chromatograph connected to an Agilent quadrupole 5977A MSD instrument with an
  • the instrument was equipped with a dual head MPS autosampler
  • the GC-MS parameters were as described in Table 7.
  • the M-l ion was used for isoprene quantification.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The present invention relates to recombinant host cells polynucleotides and polypeptides, methods for their production, and methods for their use in production of hydrocarbons. Disclosed herein are methods, compositions and hosts for synthesizing hydrocarbons and derivatives thereof. In one non-limiting embodiment, the methods, compositions and hosts are used to synthesize hydrocarbons comprising one or more isoprene units as depicted in Formula I as well as salts or derivatives thereof. An aspect of the present invention relates to a genetically engineered host capable of producing hydrocarbons or derivatives thereof via a mevalonate (MVA) pathway.

Description

Methods, Materials, Synthetic Hosts and Reagents for the Biosynthesis of Hydrocarbons and Derivatives Thereof
This patent application claims the benefit of priority from U.S. Provisional Application Serial No. 62/527,595, filed June 30, 2017, the teachings of which are herein incorporated by reference in their entirety.
FIELD
The present invention relates to recombinant host cells polynucleotides and polypeptides, methods for their
production, and methods for their use in production of hydrocarbons .
BACKGROUND
Hydrocarbons are important monomers for the production of specialty elastomers including motor mounts/fittings, surgical gloves, rubber bands, golf balls and shoes. For example, styrene-isoprene-styrene block copolymers form a key component of hot-melt pressure-sensitive adhesive formulations and cis- poly-isoprene is utilized in the manufacture of tires ( hited et al. Industrial Biotechnology 2010 6(3) :152-
163) . Manufacturers of rubber goods depend on either imported natural rubber from the Brazilian rubber tree or petroleum- based synthetic rubber polymers (Whited et al . 2010, supra) .
Given an over-reliance on petrochemical feedstocks, biotechnology offers an alternative approach to the generation of industrially relevant products, via biocatalysis .
Biotechnology offers more sustainable methods for producing industrial intermediates, in particular isoprene and
isoprenoids . Construction of recombinant microorganisms and methods o their use to produce hydrocarbons such as isoprene are known in the art. However, many of these methods and processes are unsatisfactory because they rely on agricultural commodities such as sugar cane and corn which can be volatile in supply and cost from time to time. The use of sugar derived from agricultural waste, often called biomass' has been proposed.
There are known metabolic pathways leading to the synthesis of isoprene in eukaryotes such as Populus alba and some prokaryotes such as Bacillus subtilis have been reported to emit isoprene (Whited et al . 2010, supra) . Isoprene production in prokaryotes is however rare, and no prokaryotic isoprene synthase (hereafter ISPS) has been described to date
Generally, two metabolic routes have been described incorporating the molecule dimethylallyl-pyrophosphate, the precursor to isoprene. These are known as the mevalonate and the non-mevalonate pathways (Kuzuyama Biosci. Biotechnol .
Biochem. 2002 66 ( 8 ): 1619-1627 ) , both of which function in terpenoid synthesis in vivo. Both require the introduction of a non-native ISPS in order to divert carbon to isoprene production .
The mevalonate pathway generally occurs in higher eukaryotes and Archaea and incorporates a decarboxylase enzyme, mevalonate diphosphate decarboxylase (hereafter MDD) , that introduces the first vinyl-group into the precursors leading to isoprene. The second vinyl-group is introduced by isoprene synthase in the final step in synthesizing
isoprene. The non-mevalonate pathway or 2-C-methyl-D- erythritol 4-phosphate (MEP) pathway occurs in many bacteria and dimethylallyl-PP is generated alongside isopentenyl-PP, two molecules which are interconvertible via the action of isopentenyl pyrophosphate isomerase or isopentyl diphosphate isomerase (hereafter IDI) .
The mevalonate (MVA) dependent pathway can be split into two units; the upper pathway for the generation of mevalonic acid from central metabolism and the lower pathway for the conversion of mevalonic acid to IPP and DMAPP. In the upper mevalonate pathway, two molecules of acetyl-CoA are condensed to form acetoacetyl-CoA by the action of acetoacetyl-CoA C- acetyltransferase (AACT, EC 2.3.1.9). Acetoacetyl-CoA is then converted to HMG-CoA by HMG-CoA synthase (HMGS, EC 2.3.3.10) and HMG-CoA reductase (HMGR, EC 1.1.1.34) catalyses the reduction of HMG-CoA to mevalonate. Mevalonate then feeds into the lower mevalonate pathway where sequential
phosphorylation by mevalonate kinase (MVK, EC 2.7.1.36) and phosphomevalonate kinase (MPK, EC 2.7.4.2), followed by a decarboxylation reaction by mevalonate diphosphate
decarboxylase (MDD, EC 4.1.1.33), converts mevalonate to IPP. IPP is then isomerised to DMAPP by isopentenyl diphosphate isomerase (IDI, EC 5.3.3.2) .
There is a need for genetically engineered hosts capable of stable hydrocarbon production.
SUMMARY
Disclosed herein are methods, compositions and hosts for synthesizing hydrocarbons and derivatives thereof.
In one nonlimiting embodiment, the methods, compositions and hosts are used to synthesize hydrocarbons comprising one or more isoprene units as depicted in Formula I
Figure imgf000006_0001
(I)
as well as salts or derivatives thereof.
An aspect of the present invention relates to a
genetically engineered host capable of producing hydrocarbons or derivatives thereof via a mevalonate (MVA) pathway.
In one nonlimiting embodiment the hydrocarbon produced from the genetically engineered host comprises one or more isoprene units as d ormula I
Figure imgf000006_0002
(I)
or a salt or derivative thereof.
Recombinant hosts of the present invention comprise at least one genome-integrated synthetic operon encoding an enzyme of the MVA pathway.
In one nonlimiting embodiment, the genetically engineered host comprises a genome-integrated synthetic operon encoding a plurality of enzymes of the MVA pathway.
In one nonlimiting embodiment, the genetically engineered host comprises a genome integrated synthetic operon encoding one or more enzymes of the upper MVA pathway.
In one nonlimiting embodiment, the genetically engineered host comprises a genome-integrated synthetic operon encoding the Enterococcus faecalis upper MVA pathway.
In one nonlimiting embodiment, the genetically engineered host comprises a genome integrated synthetic operon encoding one or more enzymes of the lower MVA pathway. In one nonlimiting embodiment, the genetically engineered host comprises a genome-integrated synthetic operon encoding Streptococcus pneumoniae lower MVA pathway.
In one nonlimiting embodiment, the genetically engineered host comprises a genome-integrated synthetic operon encoding the Enterococcus faecalis upper MVA pathway and a genome- integrated synthetic operon encoding Streptococcus pneumoniae lower MVA pathway.
In one nonlimiting embodiment, the genetically engineered host comprises a genome-integrated synthetic operon encoding mevalonate kinase (MK) , mevalonate phosphokinase (MPK) , and mevalonate decarboxylase (MDD) .
In any of these nonlimiting embodiments, the genetically engineered host may further comprise a genome-integrated transcription unit coding for an isoprene synthase.
In any of these embodiments, the genetically engineered host may further comprise one or more plasmids encoding one or more enzymes of the upper and/or lower MVA pathways.
Another aspect of the present invention relates to a method for producing genetically engineered stable strains of host cells which produce hydrocarbons.
In one nonlimiting embodiment the hydrocarbon produced from the genetically engineered host comprises one or more isoprene units as de Formula I
Figure imgf000007_0001
or a salt or derivative thereof. In one nonlimitmg embodiment of this method, at least one synthetic operon encoding an enzyme of the MVA pathway is integrated into the host genome.
In one nonlimiting embodiment of this method, at least one synthetic operon encoding a plurality of enzymes of the MVA pathway is integrated into the host genome.
In one nonlimiting embodiment of this method, a synthetic operon encoding one or more enzymes of the upper MVA pathway is integrated into the host genome.
In one nonlimiting embodiment of this method, a synthetic operon encoding all or part of the Enterococcus faecalis upper MVA pathway is integrated into the host genome.
In one nonlimiting embodiment of this method, a synthetic operon encoding one or more enzymes of the lower MVA pathway is integrated into the host genome.
In one nonlimiting embodiment of this method, a synthetic operon encoding all or part of the Streptococcus pneumoniae lower MVA pathway is integrated into the host genome.
In one nonlimiting embodiment, a synthetic operon
encoding all or part of the the Enterococcus faecalis upper MVA pathway and a synthetic operon encoding all or part of the Streptococcus pneumoniae lower MVA pathway are integrated into the host genome.
In one nonlimiting embodiment, a synthetic operon
encoding mevalonate kinase (MK) , mevalonate phosphokinase (MPK) , and mevalonate decarboxylase (MDD) is integrated into the host genome.
Any of these nonlimiting embodiments of this method may further comprise integrating a transcription unit coding for an isoprene synthase into the host genome. Further, in any of these embodiments, one or more plasmids encoding one or more enzymes of the upper and/or lower MVA pathways and/or an isoprene synthase may be
incorporated into the host.
Another aspect of the present invention relates to methods for producing hydrocarbons in a genetically engineered host capable of stable hydrocarbon production.
In one nonlimiting embodiment the hydrocarbon produced from the genetically engineered host comprises one or more isoprene units as de ormula I
Figure imgf000009_0001
(I)
or a salt or derivative thereof.
Another aspect of the present invention relates to hydrocarbons such as bioderived hydrocarbons, produced in or obtainable from a genetically engineered host capable of stable hydrocarbon production, such as a host as described herein .
Yet another aspect of the present invention relates to products such as bio-derived, bio-based, or fermentation- derived products, produced from or obtainable from any of the hosts or methods described herein.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used to practice the
invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference m their entirety. In case of conflict, the present
specification, including definitions, will control. In
addition, the materials, methods, and examples are
illustrative only and not intended to be limiting.
The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the
invention will be apparent from the description and the drawings, and from the claims. The word "comprising" in the claims may be replaced by "consisting essentially of" or with "consisting of, " according to standard practice in patent law . BRIEF DESCRIPTION OF THE FIGURES
FIGs . 1A through ID are plasmid maps for integration vectors pTc (ColElSacB) : : AphaB2C2: : ΡΒΆΌ: : S. pneumoniae L-MVA (FIG. 1A) and pTC(pl5ASacB) : :PcnBAD: :IspS401: :TT: :HMGR: :AACT : : PBAD (FIG. IB), Salix Sp . isoprene synthase expression plasmid pISP407 (FIG. 1C) and DxpS/IspS expression plasmid pBBRlMCS3- pBAD-His-Bs_DXS_OPT-ISPS (FIG. ID) . Hatched arrows, open reading frames (ORFs) Black arrows, knockin vector homology arms; Cross-hatched arrows, araBAD promoter; IspS, isoprene synthase; TT, transcriptional terminator; Grey arrow, E. coli origin of replication
FIGs. 2A and 2B shows de novo synthesis of isoprene and mevalonolactone in C. necator strains encoding genome- integrated gene copies of the E. faecalis upper MVA pathway and the S. pneumoniae lower MVA pathway. C. necator MVA pathway strains and control strains were cultured at 30°C for 24 hours m 10 ml GC-MS vials containing 2 ml of defined medi with different ammonium chloride concentrations. Isoprene was measured in the headspace and mevalonolactone was measured in the culture supernatant by GC-MS (n=3 except for bars with an asterix where n=2 ) . Measurements were normalized to culture optical density (OD60o) · Error bars represent Standard
Deviation of the mean. ND, not done.
FIG. 3 is a schematic of the MVA pathway.
DETAILED DESCRIPTION
The present invention provides genetically engineered hosts capable of producing hydrocarbons and derivatives thereof via a mevalonate (MVA) pathway as well as methods for production of these hosts and methods for their use in production of hydrocarbons and derivatives thereof.
Accordingly, disclosed herein are recombinant cells comprising an engineered enzymatic pathway that catalyze the conversion of a gas to a hydrocarbon or derivative thereof, compositions and methods for their production, and methods for their use in production of hydrocarbons or derivatives thereof. The compositions and methods
disclosed herein provide low cost processes for
conversion of industrial gases to chemicals in a
fermenter. In the methods of the present invention,
recombinant cells are introduced into a fermenter, mixed with gas feedstocks which are enzymatically converted to a hydrocarbon by the recombinant cells, and the
hydrocarbon is then separated from the off-gases from the fermenter . By "recombinant cell" or "recombinant host" as used herein it is meant to encompass any genetically engineered cell or host as described herein and such terms as recombinant, engineered, and genetically engineered are used interchangeably herein.
By "hydrocarbon" or hydrocarbons" as used herein, it is meant to encompass any organic compound comprised of carbons and hydrogens which can be enzymatically synthesized from a gas and is inclusive of saturated as well as unsaturated structures with double or triple bonds formed between carbon atoms, ring structures, salts and derivatives thereof. In one nonlimiting embodiment, the hydrocarbon comprises one or more isoprene units as depicted in For
Figure imgf000012_0001
(I)
or a salt or derivative thereof.
By the phrase "one or more isoprene units as depicted in Formula I" it is meant to encompass any saturated or
unsaturated 5 carbon branched structure derived from an
isoprenoid including, isoprene as well as isoprenoids,
terpenes and terpenoids as well as derivatives such as, but not limited to isoprenols, and salts thereof.
Nonlimiting examples of hydrocarbons comprising one or more isoprene units produced in accordance with the present invention include isoprene as well as any isoprenoid, terpene or terpenoid derivative of 5, including C5, CIO, C15, C20, C25, C30, C35, C40, C45, C50, etc. Nonlimiting examples
include hemiterpene, monoterpene, diterpene, triterpene, tetraterpene , polyterpene, lycopene, abietadiene, amorphadiene, carene, alpha-farnesene, beta-farnesene, farnesol, geraniol, geranylgeraniol , isoprene, linalool, limonene, myrcene, nerolidol, ocimene, patchoulol, beta- pinene, sabinene, gamma-terpinene, terpinolene and valencene, as well as derivatives and salts thereof.
The mevalonate pathway for the conversion of acetyl-CoA to the isoprenoid precursors, IPP and DMAPP, is found in eukaryotes, archaea and some bacteria, but is absent from the facultative chemolithoautotrophic bacterium, Cupriavidus necator (previously called Hydrogenomonas eutrophus,
Alcaligenes eutropha, Ralstonia eutropha, and Wautersia eutropha) . Cupriavidus necator is a Gram-negative,
flagellated soil bacterium of the Betaproteobacteria class. This hydrogen-oxidizing bacterium is capable of growing at the interface of anaerobic and aerobic environments and easily adapts between heterotrophic and autotrophic lifestyles.
Sources of energy for the bacterium include both organic compounds and hydrogen. C. necator does not naturally contain genes for isoprene synthase (ISPS) and therefore does not express this enzyme. Additional properties of Cupriavidus necator include microaerophilicity, copper resistance (Makar and Casida; 1987), bacterial predation (Byrd et al., 1985; Sillman & Casida, 1986; Zeph & Casida, 1986) and
polyhydrobutyrate (PHB) synthesis. In addition, the cells have been reported to be capable of both aerobic and nitrate dependent anaerobic growth.
In one nonlimiting embodiment, the host of the present invention is Cupriavidus necator, such as a genetically engineered strain of Cupriavidus necator capable of stable hydrocarbon production. In one nonlimiting embodiment, the present invention relates to Cupriavidus necator host capable of producing isoprenoids via a mevalonate (MVA) pathway, such as an isolated or substantially pure genetically engineered Cupriavidus necator host capable of producing isoprenoids via a mevalonate (MVA) pathway. A nonlimiting example of a C. necator host useful in the present invention is a C. necator of the H16 strain. In one nonlimiting embodiment, a C.
necator host of the H16 strain with the phaCAB gene locus knocked out ( phaCAB) is used.
As used herein, a "substantially pure culture" of a recombinant host microorganism is a culture of that
microorganism in which less than about 40% (i.e., less than about 35%; 30%; 25%; 20%; 15%; 10%; 5%; 2%; 1%; 0.5%; 0.25%; 0.1%; 0.01%; 0.001%; 0.0001%; or even less) of the total number of viable cells in the culture are viable cells other than the recombinant microorganism, e.g., bacterial, fungal (including yeast), mycoplasmal, or protozoan cells. The term "about" in this context means that the relevant percentage can be 15% of the specified percentage above or below the
specified percentage. Thus, for example, about 20% can be 17% to 23%. Such a culture of recombinant microorganisms includes the cells and a growth, storage, or transport medium. Media can be liquid, semi-solid (e.g., gelatinous media), or frozen. The culture includes the cells growing in the liquid or in/on the semi-solid medium or being stored or transported in a storage or transport medium, including a frozen storage or transport medium. The cultures are in a culture vessel or storage vessel or substrate (e.g., a culture dish, flask, or tube or a storage vial or tube) . In another nonlimiting embodiment, the host of the present invention is a genetically engineered host having one or more of the above-mentioned properties of Cupriavidus necator .
In yet another nonlimiting embodiment, the host of the present invention is a genetically engineered host selected from non-pathogenic members of the genera Ralstonia,
Wausteria, Cupriavidus, Alcaligenes, Burkholderia or
Pandoraea .
The present invention provides methods and compositions for synthesizing hydrocarbons in these genetically engineered cells . In the methods and compositions of the present invention, a host of the invention, such as organisms such as C. necator, as well as non-pathogenic members of the genera Ralstonia, Wausteria, Alcaligenes, Burkholderia and Pandoraea and other organisms having one or more of the above-mentioned properties of Cupriavidus necator can be used to synthesize hydrocarbons via a mevalonate (MVA) dependent pathway.
Recombinant hosts of the present invention comprise at least one genome-integrated synthetic operon encoding an enzyme of the MVA pathway. Nonlimiting examples of enzymes o this pathway include acetoacetyl-CoA C-acetyltransferase (AACT, EC 2.3.1.9) that catalyzes the chemical reaction 2 acetyl-CoA => CoA + acetoacetyl-CoA, HMG-CoA reductase (HMGR, EC 1.1.1.34) that catalyzes the reaction HMG-CoA (3-hydroxy-3 methylglutaryl-CoA) => mevalonic acid, hydroxymethylglutaryl- CoA synthase (HMGS, EC 2.3.3.10) that catalyzes the reaction acetoacetyl-CoA => HMG-CoA, mevalonate kinase (MVK, EC
2.7.1.36) that catalyzes the reaction mevalonic acid => mevalonate-5-phosphate , phosphomevalonate kinase (MPK, EC 2.7.4.2) that catalyzes the reaction mevalonate-5-phosphate => mevalonate-5-diphosphate, mevalonate diphosphate decarboxylase (MDD, EC 4.1.1.33) that catalyzes the reaction mevalonate-5- diphosphate => isopentyl-5-pyrophosphate, isopentenyl
diphosphate isomerase (IDI, EC 5.3.3.2) that catalyzes the reaction isopentyl-5-pyrophosphate => dimethylallyl
pyrophosphate, and isoprene synthase (ISPS, EC .2.3.27 ) that catalyses the reaction dimethylallyl pyrophosphate => isoprene + diphosphate. The host may comprise any one or more of these enzymes, such as at least two or at least three of these enzymes .
In one nonlimiting embodiment, the recombinant host comprises at least two genome-integrated synthetic operons encoding enzymes of the MVA pathway.
In one nonlimiting embodiment, the genetically engineered strain is produced by integration of a synthetic operon encoding one or more enzymes of the upper MVA pathway into the host genome. In one nonlimiting embodiment, the genetically engineered strain is produced by integration of a synthetic operon encoding one or more enzymes of the Enterococcus faecalis upper MVA pathway into the host genome.
In one nonlimiting embodiment, the host genome comprises an operon encoding one or more enzymes of the Enterococcus faecalis upper MVA pathway. The operon may be a synthetic operon. The operon may be exogenous to the host. One or more of the enzymes may be exogenous to the host. In some non- limiting embodiments, the operon encodes at least one AACT and/or at least one HMGR and/or at least one HMGS . In some non-limiting embodiments, the operon encodes at least one AACT and at least one HMGR and at least one HMGS. In some non- limiting embodiments, the operon includes sequences encoding AACT, HMGR and HMGS, arranged in that order.
Nonlimiting examples of enzymes of upper MVA pathway, genes of which can be integrated into the host genome, include the polypeptides of AACT (e.g. SEQ ID NO:l and SEQ ID NO: 56), HMGR (e.g. SEQ ID NOs : 1, 58, 60, 62, 64 and 66) and HMGS (e.g. SEQ ID NOs:2, 68, 70, 72 and 74) as well as polypeptides with similar enzymatic activities exhibiting at least 70%, 75%, 80, 85, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% sequence identity to an amino acid sequence set forth in SEQ ID NOs: 1, 56, 58, 60, 62, 64, 66, 2, 68, 70, 72 or 74 or a functional fragment thereof. Nonlimiting examples of nucleic acid sequences encoding such enzymes which can be integrated into the host genome include the nucleic acid sequences of AACT (e.g. SEQ ID NO:23 and SEQ ID NO:55), HMGR (e.g. SEQ ID NOs: 23, 57, 59, 61, 63 and 65) and HMGS (e.g. SEQ ID NO:24, 67, 69, 71 and 73) as well as nucleic acid sequences encoding polypeptides with similar enzymatic
activities exhibiting at least 70%, 75%, 80, 85, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% sequence identity to the nucleic acid sequence set forth in SEQ ID NOs: 23, 55, 57, 59, 61, 63, 65, 24, 67, 69, 71 or 73 or a
functional fragment thereof. The host may comprise any one or more of these enzymes, such as at least one AACT and/or at least one HMGR and/or at least one HMGS. In some non-limiting embodiments, the host comprises at least one AACT and at least one HMGR and at least one HMGS. In one nonlimiting
embodiment, the nucleic acid sequence is codon optimized for C. necator expression. In one nonlimiting embodiment, the genetically engineered strain is produced by integration of a synthetic operon encoding one or more enzymes of the lower MVA pathway into the host genome. In one nonlimiting embodiment, the genetically engineered strain is produced by integration of a synthetic operon encoding one or more enzymes of the Streptococcus pneumoniae lower MVA pathway into the host genome.
In one nonlimiting embodiment, the host genome comprises an operon encoding one or more enzymes of the Streptococcus pneumoniae lower MVA pathway. The operon may be a synthetic operon. The operon may be exogenous to the host. One or more of the enzymes may be exogenous to the host. In some non- limiting embodiments, the operon encodes one or more MVK and/or one or more MPK and/or one or more MDD and/or one or more IDI. In some non-limiting embodiments, the operon encodes at least one MVK and at least one MPK and at least one MDD, or encodes at least one MVK and at least one MPK and at least one MDD and at least one IDI. In some non-limiting embodiments, the operon comprises sequences coding for MVK, MPK and MDD, arranged in that order.
Nonlimiting examples of enzymes of the lower MVA pathway, genes of which can be integrated into the host genome, include mevalonate kinase (MVK; e.g. SEQ ID NO: 3), phosphomevalonate kinase (MPK; e.g. SEQ ID NO : ) , mevalonate diphosphate
decarboxylase (MDD; e.g. SEQ ID NO: 5) and isopentenyl
diphosphate isomerase (IDI; e.g. SEQ ID NO: 6) as well as polypeptides with similar enzymatic activities exhibiting at least 70%, 75%, 80, 85, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% sequence identity to an amino acid sequence set forth in SEQ ID NOs : 3, 4, 5 or 6 or a functional fragment thereof. Nonlimiting examples of nucleic acid sequences encoding such enzymes which can be integrated into the host genome include the nucleic acid sequences of MVK (e.g. SEQ ID NO:25), MPK (e.g. SEQ ID NO:26), MDD (e.g. SEQ ID NO:27) and IDI (e.g. SEQ ID NO:28) as well as nucleic acid sequences encoding polypeptides with similar enzymatic
activities exhibiting at least 70%, 75%, 80, 85, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% sequence identity to the nucleic acid sequence set forth in SEQ ID NOs: 25, 26, 27 or 28 or a functional fragment thereof. The host may comprise any one or more of these enzymes, such as one or more MVK and/or one or more MPK and/or one or more MDD and/or one or more IDI. In some non-limiting embodiments, the host comprises at least one MVK and at least one MPK and at least one MDD, or encodes at least one MVK and at least one MPK and at least one MDD and at least one IDI.
In one nonlimiting embodiment, the nucleic acid sequence is codon optimized for C. necator expression.
In one nonlimiting embodiment, the genetically engineered strain comprises a genome-integrated synthetic operon encoding the one or more enzymes of the upper MVA pathway and a genome- integrated synthetic operon encoding one or more enzymes of the lower MVA pathway. In one nonlimiting embodiment, the genetically engineered strain comprises a genome-integrated synthetic operon encoding the one or more enzymes of the
Enterococcus faecalis upper MVA pathway and a genome- integrated synthetic operon encoding one or more enzymes of the Streptococcus pneumoniae lower MVA pathway.
In one non-limiting embodiment, the host comprises any one or more enzymes of the upper MVA pathway as described above and any one or more enzymes of the lower MVA pathway as described above. In some non-limiting embodiments, these enzymes of the upper and/or lower MVA pathway are integrated into the genome of the host.
In one nonlimiting embodiment, the genetically engineered strain is produced by integration of a synthetic operon encoding mevalonate kinase (MK) , mevalonate phosphokinase (MPK) , and mevalonate decarboxylase (MDD) into the host genome. Nonlimiting examples of mevalonate kinase (MK) , mevalonate phosphokinase (MPK) , and mevalonate decarboxylase (MDD) enzymes, genes of which can be integrated into the host genome, include the polypeptides of SEQ ID NO: 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 as well as
polypeptides with similar enzymatic activities exhibiting at least 70%, 75%, 80, 85, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% sequence identity to an amino acid sequence set forth in SEQ ID NOs : 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 or a functional fragment thereof. Nonlimiting examples of nucleic acid sequences encoding such enzymes which can be integrated into the host genome include the nucleic acid sequences of SEQ ID NO:s 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43 or 44 as well as nucleic acid sequences encoding polypeptides with similar enzymatic
activities exhibiting at least 70%, 75%, 80, 85, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% sequence identity to the nucleic acid sequence set forth in SEQ ID NOs: 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43 or 44 or a functional fragment thereof.
In one nonlimiting embodiment, the nucleic acid sequence is codon optimized for C. necator expression. In one nonlimiting embodiment, the genetically engineered strain is produced by integration of a synthetic operon comprising SEQ ID NO: 48, 49 or 50.
In some nonlimiting embodiments, the recombinant host further comprises at least one additional plasmid encoding an enzyme of the MVA pathway.
In some nonlimiting embodiments, the recombinant host further comprises a plurality of plasmids expressing enzymes of the lower and/or upper MVA pathway.
In some nonlimiting embodiments, the genetically
engineered strain may further comprise a sequence coding for an isoprene synthase enzyme, such as a genome-integrated transcription unit coding for an isoprene synthase enzyme. Nonlimiting examples of isoprene synthase enzymes include the polypeptide sequence of Populus alba isoprene synthase (IspS), EC 4.2.3.27 (accession number Q50L36; SEQ ID NO:7), and the polypeptide sequence of Salix sp . DG-2011 isoprene synthase (IspS), EC 4.2.3.27 (accession number AEK70970; SEQ ID NO:8) as well as polypeptides with similar enzymatic activities exhibiting at least 70%, 75%, 80, 85, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% sequence identity to an amino acid sequence set forth in SEQ ID NOs : 7 or 8 or a functional fragment thereof. Nonlimiting examples of nucleic acid
sequences encoding such enzymes which can be integrated into the host genome include the nucleic acid sequences of Populus alba isoprene synthase (SEQ ID NO: 29) and Salix s . Isoprene synthase (SEQ ID NO: 30) as well as nucleic acid sequences encoding polypeptides with similar enzymatic activities exhibiting at least 70%, 75%, 80, 85, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% sequence identity to the nucleic acid sequence set forth in SEQ ID NOs : 29 or 30 or a functional fragment thereof.
In one nonlimiting embodiment, the nucleic acid sequence is codon optimized for C. necator expression.
Integration of the transcription unit coding for an isoprene synthase enzyme provides a convenient readout for DMAPP production in the host.
The percent identity (homology) between two amino acid sequences as disclosed herein can be determined as follows. First, the amino acid sequences are aligned using the BLAST 2 Sequences (Bl2seq) program from the stand-alone version of BLAST containing BLASTP version 2.0.14. This stand-alone version of BLAST can be obtained from the U.S. government's National Center for Biotechnology Information web site (www with the extension ncbi.nlm.nih.gov). Instructions explaining how to use the B12seq program can be found in the readme file accompanying BLASTZ . Bl2seq performs a comparison between two amino acid sequences using the BLASTP algorithm. To compare two amino acid sequences, the options of B12seq are set as follows: -i is set to a file containing the first amino acid sequence to be compared (e.g., C:\seql.txt); -j is set to a file containing the second amino acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastp; -o is set to any desired file name (e.g., C:\output.txt); and all other options are left at their default setting. For example, the following command can be used to generate an output file containing a comparison between two amino acid sequences: C:\Bl2seq-i c:\seql.txt-j c:\seq2.txt-p blastp-o c:\output.txt. If the two compared sequences share homology (identity) , then the
designated output file will present those regions of homology as aligned sequences. If the two compared sequences do not share homology (identity) , then the designated output file will not present aligned sequences. Similar procedures can be following for nucleic acid sequences except that blastn is used .
Once aligned, the number of matches is determined by counting the number of positions where an identical amino acid residue is presented in both sequences. The percent identity (homology) is determined by dividing the number of matches by the length of the full-length polypeptide amino acid sequence followed by multiplying the resulting value by 100. It is noted that the percent identity (homology) value is rounded to the nearest tenth. For example, 90.11, 90.12, 90.13, and 90.14 is rounded down to 90.1, while 90.15, 90.16, 90.17, 90.18, and 90.19 is rounded up to 90.2. It also is noted that the length value will always be an integer.
It will be appreciated that a number of nucleic acids can encode a polypeptide having a particular amino acid sequence. The degeneracy of the genetic code is well known to the art; i.e., for many amino acids, there is more than one nucleotide triplet that serves as the codon for the amino acid. For example, codons in the coding sequence for a given enzyme can be modified such that optimal expression in a particular species (e.g., bacteria or fungus) is obtained, using
appropriate codon bias tables for that species.
Functional fragments of any of the polypeptides or nucleic acid sequences described herein can also be used in the methods of the document. The term "functional fragment" as used herein refers to a peptide fragment of a polypeptide or a nucleic acid sequence fragment encoding a peptide fragment of a polypeptide that has at least 25% (e.g., at least: 30%; 40%; 50%; 60%; 70%; 75%; 80%; 85%; 90%; 95%; 98%; 99%; 100%; or even greater than 100%) of the activity of the corresponding mature, full-length, polypeptide. The functional fragment can generally, but not always, be comprised of a continuous region of the polypeptide, wherein the region has functional
activity .
Methods of the present invention can be performed in a host as described herein, such as a recombinant Cupriavidus necator host, as well as non-pathogenic members of the genera Ralstonia, austeria, Alcaligenes, Burkholderia and Pandoraea, and other organisms having one or more of the above-mentioned properties of Cupriavidus necator.
Recombinant hosts can naturally express none or some (e.g., one or more, two or more) of the enzymes of the
pathways described herein. Endogenous genes of the recombinant hosts also can be disrupted to prevent the formation of undesirable metabolites or prevent the loss of intermediates in the pathway through other enzymes acting on such
intermediates. Recombinant hosts can be referred to as
recombinant host cells, engineered cells, genetically
engineered cells, genetically engineered hosts or engineered hosts. Thus, as described herein, recombinant hosts can include exogenous nucleic acids encoding one or more of enzymes of the MVA pathway, as described herein. The
recombinant host of the invention may be any genetically engineered cell or host as described herein.
The term "exogenous" as used herein with reference to a nucleic acid (or a protein) and a host refers to a nucleic acid that does not occur in (and cannot be obtained from) a cell of that particular type as it is found in nature or a protein encoded by such a nucleic acid. Thus, a non-naturally- occurring nucleic acid is considered to be exogenous to a host once in the host. It is important to note that non-naturally- occurring nucleic acids can contain nucleic acid subsequences or fragments of nucleic acid sequences that are found in nature provided the nucleic acid as a whole does not exist in nature. For example, a nucleic acid molecule containing a genomic DNA sequence within an expression vector is non- naturally-occurring nucleic acid, and thus is exogenous to a host cell once introduced into the host, since that nucleic acid molecule as a whole (genomic DNA plus vector DNA) does not exist in nature. Thus, any vector, autonomously
replicating plasmid, or virus (e.g., retrovirus, adenovirus, or herpes virus) that as a whole does not exist in nature is considered to be non-naturally-occurring nucleic acid. It follows that genomic DNA fragments produced by PCR or
restriction endonuclease treatment as well as cDNAs are considered to be non-naturally-occurring nucleic acid since they exist as separate molecules not found in nature. It also follows that any nucleic acid containing a promoter sequence and polypeptide-encoding sequence (e.g., cDNA or genomic DNA) in an arrangement not found in nature is non-naturally- occurring nucleic acid. A nucleic acid that is naturally- occurring can be exogenous to a particular host microorganism. For example, an entire chromosome isolated from a cell of yeast x is an exogenous nucleic acid with respect to a cell of yeast y once that chromosome is introduced into a cell of yeast y. In contrast, the term "endogenous" as used herein with reference to a nucleic acid (e.g., a gene) (or a protein) and a host refers to a nucleic acid (or protein) that does occur in (and can be obtained from) that particular host as it is found in nature. Moreover, a cell "endogenously expressing" a nucleic acid (or protein) expresses that nucleic acid (or protein) as does a host of the same particular type as it is found in nature. Moreover, a host "endogenously producing" or that "endogenously produces" a nucleic acid, protein, or other compound produces that nucleic acid, protein, or compound as does a host of the same particular type as it is found in nature .
The utility of the MVA pathway for stable hydrocarbon production in Cupriavidus necator was evaluated in a
genetically engineered strain containing two genome-integrated synthetic operons encoding the Enterococcus faecalis upper MVA pathway and Streptococcus pneumoniae lower MVA pathway, with a third genome-integrated transcription unit coding for the
Populus alba isoprene synthase (IspS, EC 4.2.3.27) to provide a convenient readout for DMAPP production.
The E. faecalis upper MVA pathway and the S. pneumoniae lower MVA pathway were integrated into the C. necator til 6 genome by homologous recombination as two arabinose-inducible operons, together with a third synthetic gene encoding P. alba isoprene synthase to provide a readout for DMAPP production. The resulting strain, BDISC_0921, was transformed with plasmid pISP407 expressing a second isoprene synthase gene from Salix Sp . , to ensure there was sufficient in vivo isoprene activity to draw carbon flux though the MVA pathway. BDISC_0921 and its plasmid-containing derivative, BDISC_0990, were tested in an isoprene/mevalonolactone bioassay against a C. necator strain with enhanced DMAPP production through the overexpression of the non-mevalonate pathway enzyme, DxpS, and a control strain, BDISC_0913, containing only the upper MVA pathway with the P. alba IspS.
To create a utilizable pool of acetyl-CoA for the
mevalonate pathway, the isoprene and mevalolactone bioassays were performed under nutrient-limitation conditions to induce the C. necator stringent response (Brigham et al. 2012) .
Following induction of the MVA/MEP pathway enzymes with
arabinose, the strains were cultured for 24 hours in a
titration series of defined media containing progressively lower concentrations of the main nitrogen source, ammonium chloride (See FIG. 2A) . Of the strains tested, the two MVA pathway strains, BDISC_0921 and BDISC_0990, produced the highest isoprene titers of 0.63 and 1.76 mg/L/OD6oo^
respectively, in media with the lowest ammonium chloride concentration of 0.2 g/L (see FIG. 2A) . By contrast, isoprene production from the MEP pathway strain, BDISC_0664, was
significantly lower, ranging from 0.05-0.23 mg/L/OD60o (see FIG. 2A) . Mevalonolactone was only detectable above 1 mg/L in
BDISC_0913, containing a genome-integrated copy of the upper MVA pathway in the absence of the mevalonate-consuming lower MVA pathway (see FIG. 2B) . As with isoprene production in the full MVA pathway strains, BDISC_0913 produced the highest mevalonolactone titre, of 4.5 mg/L/OD60o, with 0.2 g/L ammonium chloride. Both the isoprene and mevalonolactone assay results are consistent with higher carbon flux going through the MVA pathway under nitrogen-limitation conditions used to induce the C. necator stringent response. Taken together these results confirm that the genome-integrated gene copies of the E. faecalis upper VA pathway and the S. pneumoniae lower MVA pathway are functional in C. necator and are able to support the detectable bioconversion of acetyl-CoA from central metabolism to isoprene.
Further, several l-MVA variants were identified as being particularly effective in producing hydrocarbons as well.
Nucleic acid sequences used in identifying these variants include SEQ ID NO: 45, 46 and 47. The identified l-MVA
variants comprise the following combination of genes.
Figure imgf000028_0001
The full sequences of the operons for l-MVA- 9, l-MVA-11 and 1MVA-12 are depicted in SEQ ID NO : s 48, 49 and 50, respectively .
Thus, the present invention also provides methods for hydrocarbon production.
In a non-limiting embodiment, a method of hydrocarbon production as described herein is carried out using any host of the invention.
In a non-limiting embodiment is provided the use of a host of the invention, such as a recombinant or genetically engineered host as described herein, for the production of a hydrocarbon. The use may involve any method of hydrocarbon production as described herein. In one nonlimiting embodiment the hydrocarbon produced from the genetically engineered host comprises one or more isoprene units as de Formula I
Figure imgf000029_0001
(I)
or a salt or derivative thereof.
Methods of the present invention can be performed in a recombinant Cupriavidus necator host, as well as nonpathogenic members of the genera Ralstonia, Wausteria,
Alcaligenes, Burkholderia and Pandoraea, and other organisms having one or more of the above-mentioned properties of
Cupriavidus necator.
In one nonlimiting embodiment, the method comprises enzymatically converting mevalonate to isopentenyl- pyrophosphate in a genetically engineered host as described herein .
In one nonlimiting embodiment, the hydrocarbon production method is performed using a genetically engineered host comprising at least one genome-integrated synthetic operon encoding an enzyme of the MVA pathway. Nonlimiting examples of enzymes of this pathway include acetoacetyl-CoA C- acetyltransferase (AACT) , HMG-CoA reductase (HMGR) ,
hydroxymethylglutaryl-CoA synthase (HMGS), mevalonate kinase (MVK) , phosphomevalonate kinase (MP ) , mevalonate diphosphate decarboxylase (MDD) , isopentenyl diphosphate isomerase (IDI) and isoprene synthase (ISPS) .
In one nonlimiting embodiment, the hydrocarbon production method is performed using a genetically engineered host comprising at least two genome-integrated synthetic operons encoding enzymes of the MVA pathway.
In one nonlimiting embodiment, the hydrocarbon production method is performed using a genetically engineered host comprising a synthetic operon encoding one or more enzymes of the upper MVA pathway into the host genome. In one nonlimiting embodiment, the hydrocarbon production method is performed using a genetically engineered host comprising a synthetic operon encoding one or more enzymes of the E. faecalis , C. necator, S. cerevisiae, L. monocytogenes , S. pneumonia r L. lactis or S. aureus upper MVA pathway into the host genome. In this embodiment, any of the nucleic acid sequences encoding a polypeptide having AACT (e.g. SEQ ID NO:l and SEQ ID NO: 56), HMGR (e.g. SEQ ID NOs : 1, 58, 60, 62, 64 and 66) and HMGS (e.g. SEQ ID NOs:2, 68, 70, 72 and 74) as well as polypeptides with similar enzymatic activities exhibiting at least 70%, 75%, 80, 85, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% sequence identity to an amino acid sequence set forth in SEQ ID NOs: 1, 56, 58, 60, 62, 64, 66, 2, 68, 70, 72 or 74 or a functional fragment thereof, as described supra can be used. Nonlimiting examples of nucleic acid sequences encoding such enzymes which can be integrated into the host genome include the nucleic acid sequences of AACT (e.g. SEQ ID NO: 23 and SEQ ID NO:55), HMGR (e.g. SEQ ID NOs: 23, 57, 59, 61, 63 and 65) and HMGS (e.g. SEQ ID NO:24, 67, 69, 71 and 73) as well as nucleic acid sequences encoding polypeptides with similar enzymatic activities exhibiting at least 70%, 75%, 80, 85, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% sequence identity to the nucleic acid sequence set forth in SEQ ID NOs: 23, 55, 57, 59, 61, 63, 65, 24, 67, 69, 71 or 73 or a functional fragment thereof.
In one nonlimiting embodiment, the hydrocarbon production method is performed using a genetically engineered host comprising a synthetic operon encoding one or more enzymes of the lower MVA pathway into the host genome. In one nonlimiting embodiment, the hydrocarbon production method is performed using a genetically engineered host comprising a synthetic operon encoding one or more enzymes of the Streptococcus pneumoniae lower MVA pathway into the host genome. In this embodiment, any of the nucleic acid sequences encoding a polypeptide having mevalonate kinase (MVK; e.g. SEQ ID NO:3), phosphomevalonate kinase (MPK; e.g. SEQ ID NO : ) , mevalonate diphosphate decarboxylase (MDD; e.g. SEQ ID NO: 5) or
isopentenyl diphosphate isomerase (IDI; e.g. SEQ ID NO: 6) activity or a polypeptide with similar enzymatic activities exhibiting at least 70%, 75%, 80, 85, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% sequence identity to an amino acid sequence set forth in SEQ ID NOs: 3, 4, 5 or 6 or a functional fragment thereof as described supra can be used.
In another nonlimiting embodiment, the method is
performed using a genetically engineered host comprising one or more exogenous nucleic acid sequences encoding one or more enzymes of the upper MVA pathway and one or more exogenous nucleic acid sequences encoding one or more enzymes of the lower MVA pathway. In one nonlimiting embodiment, the method is performed using a genetically engineered host comprising one or more exogenous nucleic acid sequences encoding one or more enzymes of the Enterococcus faecalis upper MVA pathway as described supra and one or more exogenous nucleic acid sequences encoding one or more enzymes of the Streptococcus pneumoniae lower MVA pathway as described supra.
In another nonlimiting embodiment, the hydrocarbon production method is performed using a genetically engineered strain produced by integration of a synthetic operon encoding mevalonate kinase (MK) , mevalonate phosphokinase (MPK) , and mevalonate decarboxylase (MDD) into the host genome. In this embodiment, any of the nucleic acid sequences encoding a mevalonate kinase (MK) , mevalonate phosphokinase (MPK), and/or mevalonate decarboxylase (MDD) enzyme including the
polypeptides of SEQ ID NO: 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 or polypeptides exhibiting similar enzymatic activities exhibiting at least 70%, 75%, 80, 85, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% sequence identity to an amino acid sequence set forth in SEQ ID NOs: 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 or a functional fragment thereof as described supra can be used .
In one nonlimiting embodiment, the hydrocarbon production method is performed using a genetically engineered strain comprising a nucleic acid sequence codon optimized for C.
necator expression.
In one nonlimiting embodiment, the hydrocarbon production method is performed using a genetically engineered strain comprising a synthetic operon comprising SEQ ID NO: 48, 49 or 50.
In some nonlimiting embodiments, the hydrocarbon
production method is performed using a genetically engineered strain further comprising at least one additional plasmid encoding an enzyme of the MVA pathway. In some nonlimiting embodiments, the hydrocarbon
production method is performed using a genetically engineered strain further comprising a plurality of plasmids expressing enzymes of the lower and/or upper MVA pathway.
In some nonlimiting embodiments, the genetically
engineered strain used in the hydrocarbon production methods may further comprise a genome-integrated transcription unit coding for an isoprene synthase enzyme as described supra.
In some non-limiting embodiments, the method comprises contacting a host of the invention with a suitable substrate under conditions such that the host is capable of producing a hydrocarbon from the substrate via a MVA pathway. Such a method may comprise culturing a host of the invention in the presence of a suitable substrate. In some non-limiting embodiments, the substrate is acetyl-CoA, or a substrate that can be converted to form acetyl-CoA by the host.
In any the methods described herein, a fermentation strategy can be used that entails anaerobic, micro-aerobic or aerobic cultivation. A fermentation strategy can entail nutrient limitation such as nitrogen, phosphate or oxygen limitation. A cell retention strategy using a ceramic hollow fiber membrane can be employed to achieve and maintain a high cell density during fermentation. The substrate, or the principal carbon source fed to the fermentation, can be or can derive from a biological or non-biological feedstock. The biological feedstock can be, or can derive from,
monosaccharides, disaccharides , lignocellulose, hemicellulose, cellulose, lignin, levulinic acid and formic acid,
triglycerides, glycerol, fatty acids, agricultural waste, condensed distillers' solubles or municipal waste. The non- biological feedstock can be, or can derive from, natural gas, syngas, CO2/H2, methanol, ethanol, non-volatile residue (NVR) a caustic wash waste stream from cyclohexane oxidation processes or waste stream from a chemical industry such as, but not limited to a carbon black industry or a hydrogen-refining industry, or petrochemical industry.
In one nonlimiting embodiment, at least one of the enzymatic conversions of the hydrocarbon production method comprises gas fermentation within the recombinant Cupriavidus necator host, or a non-pathogenic member of the genera
Ralstonia, Wausteria, Alcaligenes, Burkholderia and Pandoraea, and other recombinant organism having one or more of the above-mentioned properties of Cupriavidus necator. In this embodiment, the gas fermentation may comprise at least one of natural gas, syngas, CO2/H2, methanol, ethanol, non-volatile residue, caustic wash from cyclohexane oxidation processes, or waste stream from a chemical industry such as, but not limited to a carbon black industry or a hydrogen-refining industry, or petrochemical industry. In one nonlimiting embodiment, the gas fermentation comprises C02/H2.
In some non-limiting embodiments the substrate is a gas. In some non-limiting embodiments, the method comprises
contacting the host with a gas. In some of these embodiments, the gas comprises at least one of natural gas, syngas, C02/H2, methanol, ethanol, non-volatile residue, caustic wash from cyclohexane oxidation processes, or waste stream from a chemical industry such as, but not limited to a carbon black industry or a hydrogen-refining industry, or petrochemical industry. In one non-limiting embodiment, the gas comprises The methods of the present invention may further comprise recovering produced hydrocarbons from the recombinant host. In these embodiments, the hydrocarbons may comprise one or more isoprene units, as described herein.
In some non-limiting embodiments, the hydrocarbon
produced by a method of the invention is a gas. In some non- limiting embodiments the method further comprises recovering produced gaseous hydrocarbon from the host.
Once produced, any method can be used to isolate
hydrocarbons. For example, hydrocarbons can be recovered from the fermenter off-gas stream as a volatile product as the boiling point of isoprene is 34.1°C. At a typical fermentation temperature of approximately 30 °C, hydrocarbons have a high vapor pressure and can be stripped by the gas flow rate through the broth for recovery from the off-gas. Hydrocarbons can be selectively adsorbed onto, for example, an adsorbent and separated from the other off-gas components . Membrane separation technology may also be employed to separate
hydrocarbons from the other off-gas compounds. Hydrocarbons may be desorbed from the adsorbent using, for example, nitrogen and condensed at low temperature and high pressure.
Because of the gaseous nature of isoprene, in embodiments of the present invention wherein the hydrocarbon produced is isoprene, an advantage is easy separation of the product.
Also provided by the present invention are hydrocarbons bioderived from, produced by, or obtainable from, a
recombinant host according to any of methods described herein. In one nonlimiting embodiment, the hydrocarbon has carbon isotope ratio that reflects an atmospheric carbon dioxide uptake source. Examples of such ratios include, but are not limited to, carbon-12, carbon-13, and carbon-14 isotopes.
In addition, the present invention provides a product such as a bio-derived, bio-based, or fermentation-derived product produced using the methods and/or compositions disclosed herein. Examples of such products include, but are not limited to, compositions comprising at least one bio- derived, bio-based, or fermentation-derived compound or any combination thereof, as well as polymers, rubbers such as cis polyisoprene rubber, trans-polyisoprene rubber, or liquid polyisoprene rubber, molded substances, formulations and semi solid or non-semi-solid streams comprising one or more of the bio-derived, bio-based, or fermentation-derived compounds or compositions, combinations or products thereof.
In addition, the present invention provides methods of producing such a product. In some non-limiting embodiments, the method comprises producing a hydrocarbon by a method of the invention and converting the hydrocarbon to said product. In one non-limiting embodiment, a method of producing a polymer comprises the steps of producing a hydrocarbon by a method as described herein and forming a polymer from said hydrocarbon .
Although specific advantages have been enumerated above, various embodiments may include some, none, or all of the enumerated advantages. Further, other technical advantages may become readily apparent to one of ordinary skill in the art after review of the figures and description herein. It should be understood at the outset that, although exemplary embodiments are illustrated in the figures and described herein, the principles of the present disclosure may be implemented using any number of techniques, whether currently known or not. The present disclosure should in no way be limited to the exemplary implementations and techniques illustrated in the drawings and described herein.
Unless otherwise specifically noted, articles depicted in the drawings are not necessarily drawn to scale.
Modifications, additions, or omissions may be made to the systems, apparatuses, and methods described herein without departing from the scope of the disclosure. For example, the components of the systems and apparatuses may be integrated or separated. Moreover, the operations of the systems and apparatuses disclosed herein may be performed by more, fewer, or other components and the methods described may include more, fewer, or other steps. Additionally, steps may be performed in any suitable order. As used in this document, "each" refers to each member of a set or each member of a subset of a set.
To aid the Patent Office and any readers of any patent issued on this application in interpreting the claims appended hereto, applicants wish to note that they do not intend any of the appended claims or claim elements to invoke 35 U.S.C.
112(f) unless the words "means for" or "step for" are
explicitly used in the particular claim.
The following section provides further illustration of the methods and compositions of the present invention. These working examples are illustrative only and are not intended to limit the scope of the invention in any way. Examples
Example 1 : Gene Selection
The MVA pathway was assembled in C. necator from genes encoding the enzymes of the E. faecalis upper MVA pathway (AACT and HMGR) and S. pneumoniae lower MVA pathway (MVK, MPK, MDD and IDI) . The performance of the E . faecalis/S .
pneumoniae mevalonate pathway was monitored in live C. necator cells by converting DMAPP to isoprene with truncated versions of the Populus alba and Salix sp . DG-2011 isoprene synthase (IspS, EC 4.2.3.27), each containing a deletion of residues 1 to 36 encoding plastidic targeting sequences. Synthetic genes encoding these enzymes were codon optimized for expression in C. necator (see polypeptide and nucleotide sequences in
Appendices 1 and 2) .
Example 2 : Construction of the C. necator genome-integrated MVA pathway strain
Two knockin vectors were assembled for the targeted integration of the E. faecalis upper MVA pathway, the S.
pneumoniae lower MVA pathway and P. alba isoprene synthase into the C. necator genome. Plasmid
pTc (ColElSacB) : : AphaB2C2: : PBAD: : S. pneumoniae L-MVA (FIG. 1A) consisted of a synthetic operon encoding the S. pneumoniae lower MVA pathway (MVK, MPK, MDD) under the control of the araBAD promoter, flanked by 1 kb homology arms to the
surrounding genes of phaB2C2 locus . When introduced into C. necator H16 by conjugation, the knockin vector was designed to integrate the lower MVA pathway at the phaB2C2 locus of chromosome 1 by homologous recombination and delete the phaB2C2 operon. The second knockin vector, pTC (pl5ASacB) : : AphaCAB : · PcnBAD · :IspS401: : TT : : HMGR : : AACT : : PBAD (FIG. IB) , consisted of separate transcription units coding for the E. faecalis upper MVA pathway and P. alba isoprene synthase under the control two facing PBAD promoters, flanked by 1.5kb homology arms to the phaClABl locus. The P. alba IspS/E. faecalis upper MVA pathway double promoter cassette was designed to integrate at the phaClABl locus on chromosome 1 and delete the phaClABl operon encoding essential enzymes of the competing polyhydroxyalkanoate (PHA) pathway.
The knockin vectors were introduced into C. necator H16 by conjugation, essentially as described by Slater et al., 1998. C. necator exconjugants derived from single cross-over events were selected on defined medium (1.15 g/L KH2P04; 1.15 g/L Na2HP04; 1 g/L NH4C1; 0.5 g/L MgS0 .7H20; 0.062 g/L
CaCl2.2H20; 2 g/L fructose; 15 mg/L FeS04.7H20; 2.4 mg/L
MnS04.H20; 2.4 mg/L ZnS04.7H20; 0.48 mg/L CuS04.5H20)
supplemented with 20 g/ml tetracycline. Marker recovery was then performed by sacB counter-selection on LB agar plates supplemented with 10% w/v sucrose and 2% w/v fructose. For the construction of the genome-integrated MVA pathway strain, the S. pneumoniae lower MVA pathway was first integrated into wild type C. necator H16. Following marker recovery, sucrose- resistant colonies were genotyped by colony PCR with primers BDIPRIM 4874 and 4875 (Table 1), to confirm the correct insertion of the PBAD::L-MVA pathway operon at the phaB2C2 locus. A PCR-positive clone containing the AphaClABl : : PBAD : : L- MVA pathway insertion was then mated with an E. coli S17-1 donor strain containing plasmid
pTC (pl5ASacB) : : AphaCAB: : PCNBAD : :IspS401: : TT : : HMGR: : AACT : :PBAD. Following a second round of sacB counter-selection, sucrose- resistant colonies displaying a PHA-deficient visual phenotype were genotyped by colony PCR with primers BDIPRIM 2496 and 2543 (Table 1), to confirm the correct insertion of the
IspS/U-MVA pathway cassette at the phaClABl locus. The resulting genome-integrated MVA pathway strain, BDISC_0921, was evaluated against two control strains, BDISC_0913
containing just the E. faecalis upper MVA pathway and IspS cassette integrated at the phaClABl locus and a plasmid-based strain, BDISC_0664 (C. necator Hi 6 AphaClABl : : pBBRlMCS3-pBAD- His-Bs_DXS_OPT-ISPS, FIG. ID) expressing P. alba IspS and Bacillus subtilis MEP pathway enzyme l-deoxy-D-xylulose-5- phosphate synthase, DxpS (EC 2.2.1.7), from an arabinose- inducible promoter. To increase isoprene titers from the genome-integrated MVA pathway, plasmid pISP407 (FIG. 1C) , expressing a second arabinose-inducible isoprene synthase
{Salix Sp. DG-2011 IspS), was introduced into BDISC_0921 by electroporation, creating C. necator strain BDISC_0990
(BDISC_0921: :pISP407) . Example 3: Primers
Table 1 provides the amplification primers used for genotyping C. necator H16 AphaB2C2 and AphaClABl gene knockin strains .
TABLE 1:
Figure imgf000040_0001
C. necator H16 AGAAGGCTGGGACGAAGTCT
BDIPRIM2496
AphaClABl (SEQ ID NO: 53)
Knockout/Knockin
BDIPRIM2543 genotyping R CAAATTTCCGACCGCTGGTATTC primers (SEQ ID NO:54)
Example 4 : De novo isoprene and mevalonate production from the C. necator genome-integrated MVA pathway strain
The genome-integrated MVA pathway strains r BDISC_0921 and BDISC_0990 ( BDISC_0921 : : pISP407 ) , were evaluated for de novo isoprene and mevalonolactone synthesis against control strains BDISC_0913 and BDISC_0664 in bioassays based on gas
chromatography-mass spectrometry (GC-MS). To maximize the carbon flux into the MVA pathway, the isoprene and
mevalonolactone bioassays were performed in defined media under nitrogen limitation conditions similar to those used for PHA production (Ishizaki, 2001) . The optimal carbon to nitrogen ratio for isoprene/mevalonolactone production was tested by performing the bioassays in defined media with different ammonium chloride concentrations, ranging from 0.2 to 1.0 g/L.
Seeding cultures were prepared for each strain by
inoculating a single colony into 20 ml of 27.5 g/L Tryptone Soya broth without Dextrose (TSB-D media, Sigma Aldrich catalogue number T3938-500G) containing the appropriate antibiotic when necessary. The seeding cultures were incubated at 30°C, 230rpm for 48 hours, then diluted by 1 in 50 into fresh TSB-D media (10 ml) in 50 ml sterile Falcon tubes and incubated for approximately 6 hours at 30°C, 230rpm. MVA pathway and isoprene synthase expression was induced by adding arabinose to a final concentration of 1 % w/v and the cultures were incubated for a further 16 hours (overnight) at 30°C, 230rpm. The cultures were pelleted by centrifugation at 6000 g for 20 minutes and wet cell weight was measured for each cell pellet. The density of each culture was normalized to 0.1 g WCW/ml by re-suspending the C. necator cells with the
appropriate volume of defined media (1.15 g/L KH2PO4; 1.15 g/L Na2HP04; 0.5 g/L MgS04.7H20; 0.062 g/L CaCl2.2H20; 2 g/L
fructose; 15 mg/L FeS0 .7H20; 2.4 mg/L nS04.H20; 2.4 mg/L
ZnS04.7H20; 0.48 mg/L CuS04.5H20) containing each of the NH4C1 concentrations tested (0.2, 0.4, 0.6, 0.8, 1 g/L) . For each experimental variable (strain and NHC1 concentration) ,
separate isoprene and mevalolactone bioassays were set up in triplicate in 10 ml GC-MS vials containing 2 ml fresh defined media (with 1 % w/v arabinose and appropriate antibiotics) and 40 μΐ of 0.1 g WCW/ml of either BDISC_0921, BDISC_0990,
BDISC 0913 or BDISC_0664.
For the isoprene bioassay, an isoprene calibration series was set up in 10ml GC-MS vials containing 1990 μΐ defined media with 10 μΐ of 20 ppm to 1000 ppm of isoprene standards
dissolved in 0.5 % v/v methanol at 4°C. To test isoprene assay robustness and precision, spike-recovery vials were also set up containing 10 μΐ of 1 ppm isoprene, for a random selection of the experimental conditions tested (one randomly selected strain for each NH4C1 concentration set up in duplicate) . All vials ( isoprene/mevalonolactone experimental, isoprene
standard and spike recovery vials) were incubated at 30 °C, 160 rpm, for 24 hours.
Example 5 : Measurement of headspace isoprene concentrations
Headspace isoprene measurements were performed by GC-MS on an Agilent Technologies 7890B gas chromatograph connected to an Agilent quadrupole 5977A MSD instrument with an
electronically controlled split/split-less injection port. The instrument was equipped with a dual head MPS autosampler
(Gerstel) for head Space analysis. GC separation was performed on a db-624 capillary column (60 m x 0.25mm xl .4μιτι J&W
Scientific) . The GC-MS parameters were as described in table 2. The M-l ion was used for isoprene quantification.
Table 2. GC S parameters for the measurement of head space isoprene concentrations
Figure imgf000043_0001
Concentration 0.1-5.0
range (pg/ml)
GC Column DB-624 122-1334 Agilent
(60m x 250 μπι x 1.4 μια)
Example 6 : Measurement of culture mevalolactone concentration
Culture broths were clarified by centrifugation 10, 000 g for 10 minutes. The resulting supernatant (0.4 ml) was acidified with 0.2 mL 0.5 M HC1, vortex for 10s and agitated at 1400 rpm for 15 minutes to convert all the mevalonic acid into mevalonolactone . The mevalonolactone was extracted from the aqueous phase by the addition of 0.5 ml of MTBE ((Methyl tertiary butyl ether) and the samples were wortex for 10s agitated at 1400 rpm for a further 30 minutes. The MTBE used for the extraction contained an internal standard,
carophyllene, at a concentration 10 ppm, for data
normalisation (Pitera et al . , 2006) . A Thermomixer from
Eppendorf was used for the 2 agitation spets . A
mevalonolactone calibration series was set up by a diluting mevalonolactone standard in 400 μΐ of defined media to final concentrations ranging from 1.5625 ppm to 100 ppm. To test assay robustness, spike recovery samples were set up with selected samples. All samples, including the standards were treated in the same way. Following extraction, but leaving both phases in the same vial, 2 μΐ of the top layer was injected onto the GCMS . The GCMS parameters used to measure mevalonolactone are presented in Table 3. The presence of mevalonolactone in samples was confirmed by comparison of retention time and ion ratios (Table 4) to those of the mevalonolactone standards, with the ion - 43 m/z being selected for quantification. All data from standards and samples were normalised to the internal standard caryophyllene (selected ion - 93 m/z) .
Table 3. GCMS parameters for the measurement of culture mevalonolactone concentrations
Figure imgf000045_0001
Ions used for analysis and quantification of mevalonolactone and the internal standard (caryophyllene) in selected ion monitoring (SIM) acquisition mode are listed in Table 4. Table 4. Ions used for mevalolactone and the internal standard (caryophyllene) for quantitation in selected ion monitoring (SIM) acquisition mode
Figure imgf000046_0001
Example 7 : Preparation of 1-MVA variants
Chemically competent cells were transformed with variants of the 1-MVA pathway which were designed to be arranged as single operons under the control of the wild type PBAD
promoter. The DNA assembly protocol used for this purpose was an optimized single-step overlap-extension PCR strategy. All operons contained the following genes in this specific order: i) mevalonate kinase (MVK) , ii) mevalonate phosphokinase (MPK) and iii) mevalonate decarboxylase (MDD) . Specifically, PCR products corresponding to each of the individual genes (MK,
MPK and MDD, polypeptides of SEQ ID NO: 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 and nucleic acid sequences of SEQ ID NO: 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43 or 44) and flanked by appropriately designed overlaps
introduced by PCR were gel-extracted and suspended in dH20 at a concentration of 1 ng/μΐ . One microliter of each of these DNA solutions was added (i.e. 3 μΐ in total) as DNA template to a PCR reaction, and a standard PCR procedure was carried out.
For the assembly of the combinatorial library the same strategy was used, but all the 17 different genes were pooled together simultaneously in a single 1.5 ml Eppendorf tube, for a total DNA concentration of approx. 30 ng/μΐ (about 1.8 ng/μΐ each gene) . One microliter of this solution was used as template DNA in a standard PCR reaction, and gel extraction was performed to isolate amplicons of fragment size of between 2.5 and 3.5 kb approximately. Gel-extracted DNA was digested with Ascl and Spel and cloned.
The activity of the assembled l-MVA pathway variants was assessed by a functional assay providing indirect information about E. coli cellular synthesis of isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate ( DMAPP ) , two essential metabolites used as terpenoids building blocks and synthesized as the last products of the l-MVA pathway (or the MEP
pathway) .
The antibiotic fosmidomycin (inhibitor of DOXP reductase (dxr) , the second enzyme of the MEP pathway) was selected to inhibit the native E. coli MEP pathway that supplies the essential metabolites IPP and DMAPP. NEB5oc competent cells were transformed with pBDISC0768-derivatives expressing the different l-MVA pathway variants, and then plated on LBA supplemented with tetracycline (10 μg/ml) , fosmidomycin (5 μg/ml) , and 1 mM (R) -mevalonic acid or (R) -Mevalonolactone . (R) -Mevalonolactone produced the same results as the
corresponding acid form (R) -mevalonic acid (also in the isoprene detection assay described below) , and it was selected as the substrate throughout both assays. As cells expressing a functional l-MVA pathway can grow in the presence of
inhibitory concentrations of fosmidomycin only when an
appropriate concentration of (R) -mevalonate is also provided, this type of medium was specifically selective for functional l-MVA pathway variants from a library. Isoprene production in the 1- VA pathway variants was also assessed. Specifically, pre-cultures of all C. necator strains tested were prepared in 20 ml TSB-D supplemented with appropriate antibiotics (tetracycline 10 ng/ μΐ, kanamycin 200 ng/μΐ) . After 48 hours of growth at 30°C, these pre-cultures were used to inoculate (2% v/v) 10 ml of the same medium and grown ON at 30°C at 230 rpm in a shaking incubator (induction with 1% (w/v) arabinose after 6-8 hours of growth) .
The next day cultures were centrifuged and the pellet was re-suspended in new TSB-D plus antibiotic/inducer at a concentration of 0.1 g wcw/ml (wet cell weight/ml) .
Gas chromatography vials (screw cap headspace gas chromatography (GC) vials (Anatune 093640-040-00 and 093640- 038-00)) were prepared that contained with 1.96 ml of TSB-D supplemented with appropriate antibiotics as above, arabinose 1%, and 15 mM (R) -mevalonolactone, and inoculated with 40μ1 of the respective ON cell culture. All samples and 5 additional positive controls (containing standard concentration of isoprene) were prepared in triplicate and incubate 24h at 30°C (160rpm), before being analysed by gas chromatography-mass spectrometry using an Agilent GCMS 7890B -5977A with a Gerstel MPS Autosampler, set with the parameters reported in the following two tables Table A and Table B.
Table Ά
Figure imgf000048_0001
Inj ector Split ratio Split 200:1
Temperature 150 °C
Detector Source 230 °C
Temperature
Quad Temperature 150 °C
Interface 260 °C
Gain 1
Scan Range m/z 28-200
Threshold 150
Scan Speed 4
2Λ2 (A/D samples)
Sampling Rate
2Λη=2Λ2
Mode SCAN and SIM
Solvent delay * 5.50min
Oven Temperature Initial T: 40 °C
x7.5min
Oven Ramp 120 °C/min to
260 °C for 5 min
Inj ection volume 300μ1 from the HS in the GC
2ml vial
Incubation time and T 15 min at 95°C
Agitator ON 500 rpm
Injection volume 300μ1 of the Head Space
Gas saver On after 2 min
Concentration range ( g/ml) 25-250PPM GC Column DB-624 122-1334 Agilent) 60m x 250 μτ x 1.4 μπι
Table B
Figure imgf000050_0001
Ions used for the Isoprene quantitation in selected ion monitoring (SIM) acquisition mode
Example 8 : Preparation of u-MVA variants
The selection of genes used to prepare u-MVA is provided in Table 5.
Table 5: Genes used to perform the uMVA screen, with SEQ ID NO, organism of origin, gene function and GenBank/Uniprot identifier provided.
Figure imgf000051_0001
uMVA pathway library cloning strategy
The uMVA pathway library was constructed by assembling a set of synthetic operons, under the control of the arabinose- inducible PBAD promoter, with the following order of DNA parts PBAD promoter-ISPS-PhaA-HMGR-HMGS-rrrnBT2 terminator. (ISPS = isoprene synthase; PhaA = acetoacetyl-CoA C-acetyltransferase HMGR= hydroxymethylglutaryl-CoA reductase and HMGS =
hydroxymethylglutaryl-CoA synthase) .
Individual genes were amplified by PCR and cloned using standard molecular biology techniques . The different operons assembled are listed in Table 6. The constructs were
transformed into chemically competent E. coli cells and correct clones were verified by colony PCR. Plasmids were recovered, and the presence of the insert was confirmed by sequencing. The correct constructs were transformed in C. necator and new strains were assessed by their ability to generate isoprene .
Table 6: Description of uMVA constructs generated. uMVA
Description
variant
pBBRl-lA-pBAD-Salix ISPS- C. neca tor phaA- uMVA 01
S.cerevisiae HMGR -S . cerevisiae HMGS-rrnBt2 pBBRl-lA-pBAD- Salix ISPS -C. necator phaA- uMVA_02
S. cerevisiae HMGR -L. monocytogenes HMGS-rrnBt2 pBBRl-lA-pBAD- Salix ISPS -C. necator phaA- uMVA 03
S . cerevisiae HMGR -L.lactis HMGS-rrnBt2
pBBRl-lA-pBAD- Salix ISPS -C. necator phaA- uMVA 04
S. cerevisiae HMGR -E . faecalis mvaS mutant-rrnBt2 pBBRl-lA-pBAD- Salix ISPS -C. necator phaA- L.
uMVA_05
monocytogenes HMGR - S. cerevisiae HMGS -rrnBt2 pBBRl-lA-pBAD- Salix ISPS -C. necator phaA- L.
uMVA 06
monocytogenes HMGR - L. monocytogenes HMGS -rrnBt2 pBBRl-lA-pBAD- Salix ISPS -C. necator phaA- L.
uMVA 07
monocytogenes HMGR - L.lactis HMGS -rrnBt2 uMVA 08 pBBRl-lA-pBAD- Salix ISPS -C. necator phaA- L. uMVA
Description
variant
monocytogenes HMGR - E. faecalis mvaS mutant rrnBt2 pBBRl-lA-pBAD- Salix ISPS -C.necator phaA- S.
uMVA 13
pneumoniae HMGR- S.cerevisiae HMGS -rrnBt2 pBBRl-lA-pBAD- Salix ISPS -C.necator phaA- S.
uMVA 14
pneumoniae HMGR - L. monocytogenes HMGS -rrnBt2 pBBRl-lA-pBAD- Salix ISPS -C. necator phaA- S.
uMVA 15
pneumoniae HMGR - L.lactis HMGS -rrnBt2
pBBRl-lA-pBAD- Salix ISPS -C. necator phaA- S.
uMVA 16
pneumoniae HMGR - E. faecalis mvaS mutant-rrnBt2 pBBRl-lA-pBAD- Salix ISPS -C. necator phaA- L.lactis uMVA 17
HMGR - S.cerevisiae HMGS -rrnBt2
pBBRl-lA-pBAD- Salix ISPS -C. necator phaA- L.lactis uMVA_l 8
HMGR - L. monocytogenes HMGS -rrnBt2
pBBRl-lA-pBAD- Salix ISPS -C. necator phaA- L.lactis uMVA 19
HMGR - L.lactis HMGS -rrnBt2
pBBRl-lA-pBAD- Salix ISPS -C. necator phaA- L.lactis uMVA 20
HMGR - E. faecalis mvaS mutant-rrnBt2
pBBRl - lA-pBAD- Salix ISPS -C.necator phaA- S. aureus uMVA 21
HMGR- S.cerevisiae HMGS -rrnBt2
pBBRl-lA-pBAD- Salix ISPS -C. necator phaA- S. aureus uMVA 22
HMGR - L. monocytogenes HMGS -rrnBt2
pBBRl-lA-pBAD- Salix ISPS -C.necator phaA- S. aureus uMVA 23
HMGR - L.lactis HMGS -rrnBt2
pBBRl-lA-pBAD- Salix ISPS -C. necator phaA- S. aureus uMVA 24
HMGR - E. faecalis mvaS mutant-rrnBt2
pBBRl-lA-pBAD- Salix ISPS - E. faecalis mvaE- E.
uMVA 25
faecalis mvaS -rrBt2
Isoprene Assay
To assess isoprene production in a C. necator strain with the whole MVA pathway and an isoprene synthase, uMVA-pathway variants were expressed in a C. necator H16 derivative strain. This strain possesses the AphaClABl and ΔΗΐ6_Α0006-9 genotypes conferring a PHA- phenotype and improved transformation efficiency, respectively. This strain also has an ispS
(encoding the isoprene synthase of P. alba) and the E.
faecalis uMVA construct integrated into chromosome 1 at the phaClABl locus. It also has the S. pneumonia lMVA-idi
construct integrated into chromosome 1 at the phaB2C2 locus. Expression of the plasmid-based uMVA-pathway variants in this genetic background supplemented the activity conferred by the integrated E. faecalis u VA construct. Therefore, it was possible to assess the impact (if any) of the different uMVA pathways on isoprene production.
C. necator library strains were evaluated for de novo isoprene synthesis in bioassays based on gas chromatography- mass spectrometry (GC-MS) . Seeding cultures were prepared for each strain by inoculating a single colony into 20 ml of 27.5 g/L Tryptone Soya Broth without Dextrose containing the appropriate antibiotic when necessary. Unless otherwise stated, the seeding cultures were incubated at 30°C, 230rpm for 48 hours, then diluted by 1 in 50 into fresh TSB-D media (10 ml) in 50 ml sterile Falcon tubes and incubated for
approximately 6-7 hours at 30°C, 230rpm. MVA pathway and isoprene synthase expression was induced by adding arabinose to a final concentration of 0.4- 1 % w/v and the cultures were incubated for a further 16 hours (overnight) at 30°C, 230rpm. The cultures were pelleted by centrifugation at 6000 g for 20 minutes and the density of each culture was normalized to either a standard optical density (OD60o) or wet cell weight ( CW) concentration (gWCW/ml) by re-suspending the C. necator cells with the appropriate volume of either minimal media or TSB media. For each experimental variable (strain and media conditions), separate isoprene bioassays were set up in triplicate in 10 ml GC-MS vials containing 2 ml fresh minimal or TSB media (with 1 % w/v arabinose and appropriate
antibiotics) and 40 μΐ- 60 μΐ of each cell suspension. An isoprene calibration series was set up in 10 ml GC-MS vials containing 1990 μΐ minimal/TSB media with 10 μΐ of 20 ppm to 1000 ppm of isoprene standards dissolved in 0.5 % v/v methanol at 4°C. To test isoprene assay robustness and
precision, spike-recovery vials were also set up containing 10 μΐ of 1 ppm isoprene, for a random selection of the
experimental conditions tested. All vials (isoprene
experimental, isoprene standard and spike recovery vials) were incubated at 30 °C, 160 rpm, for 24 hours. Measurement of headspace Isoprene concentrations
Headspace isoprene measurements were performed by GC-MS on an Agilent Technologies 7890B gas chromatograph connected to an Agilent quadrupole 5977A MSD instrument with an
electronically controlled split/split-less injection port. The instrument was equipped with a dual head MPS autosampler
(Gerstel) for head Space analysis. GC separation was performed on a db-624 capillary column (60 m x 0.25mm xl .4μπι J&W
Scientific) . The GC-MS parameters were as described in Table 7. The M-l ion was used for isoprene quantification.
Table 7. Typical GCMS parameters for the measurement of head space isoprene concentrations .
GCMS CONDITIONS
PARAMETER VALUE
Carrier Gas Helium at constant flow
(2.0ml/min)
Inj ector Split ratio Split 10:L
Temperature 150 °C Detector Source 230 °C
Temperature
Quad Temperature 150 °C
Interface 260 °C
Gain 1
Scan Range m/z 28-200
Threshold 150
Scan Speed 4
2Λ2 (A/D samples)
Sampling Rate
2Λη=2Λ2
Mode SCAN and
SIM
Solvent delay * 5.50min
Oven Temperature Initial T: 40 °C
x 6.9 min
Oven Ramp 120 °C/min to 260 °C for 6 min
Injection volume 500μ1 from the HS in the GC
2ml vial
Incubation time 13 min at 95°C
and T
Agitator ON 500 rpm
Injection volume 500 μΐ of the Head Space
Gas saver On after 2 min
Concentration 0.1-5.0
range {yig/ml)
GC Column DB-624 122-1334 Agilent
(60m x 250 μητι x 1.4 μηα)
A total of 11 strains yielded more isoprene than the benchmark strain (harbouring a plasmid expressing the Salix ISPS) with uMVA_22 and uMVA_21 variants producing highest isoprene titers. Nine variants are shown in Table 8 which show isoprene accumulation of more than 200 ppm. Table 8: Isoprene accumulation in BDISC0921 in parts per million (ppm) and peak area (response*) . Values represent average of 3 technical replicas (AV) and respective standard deviation (SD) - Strains are ranked according to response. BM, Benchmark strain is BDISC1079; ISPS is a negative control. Calibration curve: 10-lOOppm (linearity confirmed until 200ppm) .
Figure imgf000057_0001
Figure imgf000058_0001

Claims

What is Claimed is :
1. A genetically engineered host capable of producing hydrocarbons via a mevalonate (MVA) pathway.
2. The genetically engineered host of claim 1, wherein said hydrocarbon comprises one or more isoprene units as depicted in Formula I
Figure imgf000059_0001
or a salt or derivative thereof.
3. The genetically engineered host of claim 1 or claim 2 comprising at least one genome-integrated synthetic operon encoding an enzyme of the MVA pathway.
4. The genetically engineered host of claim 1 or claim
2 comprising a genome-integrated synthetic operon encoding a plurality of enzymes of the MVA pathway.
5. The genetically engineered host of any of the preceding claims encoding one or more enzymes selected from acetoacetyl-CoA C-acetyltransferase (AACT) , HMG-CoA reductase (HMGR) , hydroxymethylglutaryl-CoA synthase (HMGS) , mevalonate kinase (MVK) , phosphomevalonate kinase (MPK0, mevalonate diphosphate decarboxylase (MDD) , isopentenyl diphosphate isomerase (IDI) and isoprene synthase (ISPS).
6. The genetically engineered host of any of the preceding claims comprising a genome-integrated synthetic operon encoding one or more of enzymes of the upper VA pathway .
7. The genetically engineered host of any of the preceding claims comprising a genome-integrated synthetic operon encoding one or more of the enzymes of the Enterococcus faecalis upper MVA pathway.
8. The genetically engineered host of claim 6 or 7 comprising an exogenous nucleic acid sequence encoding a polypeptide having AACT, HMGR or HGMS enzyme activity.
9. The genetically engineered host of claim 8 wherein the polypeptide having AACT, HMGR or HGMS enzyme activity has at least 70% sequence identity to an amino acid sequence set forth in SEQ ID NO: 1, 56, 58, 60, 62, 64 66, 2, 68, 70, 72 or 74 or a functional fragment thereof.
10. The genetically engineered host of claim 8 wherein the polypeptide having AACT, HMGR or HGMS enzyme activity comprises an amino acid sequence set forth in SEQ ID NO: 1, 56, 58, 60, 62, 64 66, 2, 68, 70, 72 or 74 or a functional fragment thereof.
11. The genetically engineered host of claim 8 wherein the exogenous nucleic acid sequence has at least 70% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 23, 55, 57, 59, 61, 63, 65, 24, 67, 69, 71 or 73 or a
functional fragment thereof.
12. The genetically engineered host of claim 8 wherein the exogenous nucleic acid sequence comprises SEQ ID NO: 23, 55, 57, 59, 61, 63, 65, 24, 67, 69, 71 or 73 or a functional fragment thereof.
13. The genetically engineered host of any of the preceding claims comprising a genome-integrated synthetic operon encoding one or more enzymes of the lower MVA pathway.
14. The genetically engineered host of claim 13
comprising a genome-integrated synthetic operon encoding one or more enzymes of the Streptococcus pneumoniae lower MVA pathway .
15. The genetically engineered host of claim 13 or 14 comprising an exogenous nucleic acid sequence encoding a polypeptide having mevalonate kinase, phosphomevalonate kinase, mevalonate diphosphate decarboxylase or isopentenyl diphosphate isomerase enzyme activity.
16. The genetically engineered host of claim 15 wherein the polypeptide having mevalonate kinase, phosphomevalonate kinase, mevalonate diphosphate decarboxylase or isopentenyl diphosphate isomerase enzyme activity has at least 70% sequence identity to an amino acid sequence set forth in SEQ ID NOs : 3, 4, 5 or 6 or a functional fragment thereof.
17. The genetically engineered host of claim 15 wherein the polypeptide having mevalonate kinase, phosphomevalonate kinase, mevalonate diphosphate decarboxylase or isopentenyl diphosphate isomerase enzyme activity comprises an amino acid sequence set forth in SEQ ID NO: 3, 4, 5 or 6 or a functional fragment thereof.
18. The genetically engineered host of claim 15 wherein the exogenous nucleic acid seguence has at least 70% sequence identity to the nucleic acid sequence set forth in SEQ ID NO:
25, 26, 27 or 28 or a functional fragment thereof.
19. The genetically engineered host of claim 15 wherein the exogenous nucleic acid sequence comprises SEQ ID NO: 25,
26, 27 or 28 or a functional fragment thereof.
20. The genetically engineered host of any of claims 1-5 comprising a genome-integrated synthetic operon encoding polypeptides having mevalonate kinase (MK) , mevalonate phosphokinase (MPK) , and mevalonate decarboxylase (MDD) enzyme activities .
21. The genetically engineered host of claim 20
comprising exogenous nucleic acid sequences encoding
polypeptide having MK, MPK and MDD enzyme activities.
22. The genetically engineered host of claim 21 wherein the polypeptides having MK, MPK and MDD enzyme activity have at least 70% sequence identity to an amino acid sequence set forth in SEQ ID NO: 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 or a functional fragment thereof.
23. The genetically engineered host of claim 21 wherein the polypeptides having MK, MPK and MDD enzyme activity comprise amino acid sequences set forth in SEQ ID NO: 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 or a
functional fragment thereof.
24. The genetically engineered host of claim 21 wherein the exogenous nucleic acid sequences have at least 70% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43 or 44 or a functional fragment thereof.
25. The genetically engineered host of claim 21 wherein the exogenous nucleic acid sequences comprise SEQ ID NO: 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43 or 44 or a functional fragment thereof.
26. The genetically engineered host of any of claims 1-5 comprising a genome-integrated synthetic operon comprising SEQ ID NO: 48, 49 or 50.
27. The genetically engineered host of any of claims 1 through 26 further comprising a genome-integrated
transcription unit coding for an isoprene synthase enzyme.
28. The genetically engineered host of claim 27 wherein the isoprene synthase enzyme comprises a polypeptide having at least 70% sequence identity to an amino acid sequence set forth in SEQ ID NOs : 7 or 8 or a functional fragment thereof.
29. The genetically engineered host of claim 27 wherein the isoprene synthase enzyme comprises SEQ ID NOs: 7 or 8 or a functional fragment thereof.
30. The genetically engineered host of claim 27 wherein the isoprene synthase enzyme is encoded by a nucleic acid sequence having at least 70% sequence identity to SEQ ID NOs: 29 or 30 or a functional fragment thereof.
31. The genetically engineered host of claim 27 wherein the isoprene synthase enzyme is encoded by a nucleic acid sequence comprising SEQ ID NOs : 29 or 30 or a functional fragment thereof.
32. The genetically engineered host of any of the preceding claims further comprising one or more plasmids encoding one or more enzymes of the lower and/or upper VA pathways .
33. The genetically engineered host of any of the preceding claims having one or more properties of Cupriavidus necator.
34. The genetically engineered host of any of the preceding claims selected from non-pathogenic members of the genera Ralstonia, Wausteria, Cupriavidus, Alcaligenes,
Burkholderia or Pandoraea.
35. The recombinant host according to any of the preceding claims which is Cupriavidus necator.
36. A method for producing a genetically engineered host which produces hydrocarbons, said method comprising
integrating at least one synthetic operon encoding one or more enzymes of the MVA pathway into the host genome.
37. The method of claim 36 wherein the synthetic operon encodes a plurality of enzymes of the MVA pathway.
38. The method of claim 36 wherein the synthetic operon encodes one or more enzymes selected from acetoacetyl-CoA C- acetyltransferase (AACT) , HMG-CoA reductase (HMGR) , hydroxymethylglutaryl-CoA synthase (HMGS), mevalonate kinase (MVK) , phosphomevalonate kinase (MPKO, mevalonate diphosphate decarboxylase (MDD) , isopentenyl diphosphate isomerase (IDI) and isoprene synthase (ISPS).
39. The method of claim 36 comprising integrating a synthetic operon encoding the Enterococcus faecalis upper MVA pathway into the host genome.
40. The method of claim 36 or claim 39 comprising integrating a synthetic operon encoding Streptococcus
pneumoniae lower MVA pathway into the host genome.
41. The method of claim 36 comprising integrating a synthetic operon encoding polypeptides having mevalonate kinase (MK) , mevalonate phosphokinase (MPK) , and mevalonate decarboxylase (MDD) enzyme activities.
42. The method of any of claims 36 through 41 further comprising integrating a transcription unit coding for an isoprene synthase into the host genome.
43. The method of any of claims 36 through 42 further comprising incorporating one or plasmids encoding one or more enzymes of the upper and/or lower MVA pathways into the host.
44. A bioderived isoprenoid produced in a genetically engineered host according to any of claims 1 through 35.
45. A bio-derived, bio-based, or fermentation-derived product produced from any of the hosts of any of claims 1 to 35, wherein said product comprises:
(i) a composition comprising at least one bio-derived, bio-based, or fermentation-derived compound or any combination thereof;
(ii) a bio-derived, bio-based, or fermentation-derived polymer comprising the bio-derived, bio-based, or
fermentation-derived composition or compound of (i), or any combination thereof;
(iii) a bio-derived, bio-based, or fermentation-derived cis-polyisoprene rubber, trans-polyisoprene rubber, or liquid polyisoprene rubber, comprising the bio-derived, bio-based, or fermentation-derived compound or bio-derived, bio-based, or fermentation-derived composition of (i), or any combination thereof or the bio-derived, bio-based, or fermentation-derived polymer of (ii) , or any combination thereof;
(iv) a molded substance obtained by molding the bio- derived, bio-based, or fermentation-derived polymer of (ii), or the bio-derived, bio-based, or fermentation-derived rubber of (iii), or any combination thereof;
(v) a bio-derived, bio-based, or fermentation-derived formulation comprising the bio-derived, bio-based, or
fermentation-derived composition of (i) , the bio-derived, bio- based, or fermentation-derived compound of (i), the bio- derived, bio-based, or fermentation-derived polymer of (ii), the bio-derived, bio-based, or fermentation-derived rubber of (iii) , or the bio-derived, bio-based, or fermentation-derived molded substance of (iv) , or any combination thereof; or
(vi) a bio-derived, bio-based, or fermentation-derived semi-solid or a non-semi-solid stream, comprising the bio- derived, bio-based, or fermentation-derived composition of (i), the bio-derived, bio-based, or fermentation-derived compound of (i) , the bio-derived, bio-based, or fermentation- derived polymer of (ii), the bio-derived, bio-based, or fermentation-derived rubber of (iii), the bio-derived, bio- based, or fermentation-derived formulation of (iv), or the bio-derived, bio-based, or fermentation-derived molded substance of (v) , or any combination thereof.
46. A method for synthesizing a hydrocarbon in a genetically engineered host of any of claims 1 through 35, said method comprising enzymatically converting mevalonate to isopentenyl-pyrophosphate in the host.
47. The method of claim 46, wherein said hydrocarbon comprises one or more iso s as depicted in Formula I
Figure imgf000067_0001
(I)
or a salt or derivative thereof.
48. The method of claim 46, wherein at least one of the enzymatic conversions comprises fermentation of a biological or non-biological feedstock.
49. The method of claim 46, wherein at least one of the enzymatic conversions comprises gas fermentation within the genetically engineered host.
50. The method of claim 49, wherein the gas fermentation comprises at least one of natural gas, syngas, C02/H2,
methanol, ethanol, non-volatile residue, caustic wash from cyclohexane oxidation processes, or waste stream from a chemical or petrochemical industry.
51. The method of claim 49 wherein the gas fermentation comprises C02/H2.
52. The method of any of claims 46 through 51, further comprising recovering produced hydrocarbon.
53. The method of claim 52 wherein the hydrocarbon recovered is gaseous isoprene.
PCT/US2018/040213 2017-06-30 2018-06-29 Methods, materials, synthetic hosts and reagents for the biosynthesis of hydrocarbons and derivatives thereof Ceased WO2019006255A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201762527595P 2017-06-30 2017-06-30
US62/527,595 2017-06-30

Publications (1)

Publication Number Publication Date
WO2019006255A1 true WO2019006255A1 (en) 2019-01-03

Family

ID=64737901

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2018/040213 Ceased WO2019006255A1 (en) 2017-06-30 2018-06-29 Methods, materials, synthetic hosts and reagents for the biosynthesis of hydrocarbons and derivatives thereof

Country Status (2)

Country Link
US (1) US11634733B2 (en)
WO (1) WO2019006255A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11162115B2 (en) 2017-06-30 2021-11-02 Inv Nylon Chemicals Americas, Llc Methods, synthetic hosts and reagents for the biosynthesis of hydrocarbons
US11505809B2 (en) 2017-09-28 2022-11-22 Inv Nylon Chemicals Americas Llc Organisms and biosynthetic processes for hydrocarbon synthesis
US11634733B2 (en) 2017-06-30 2023-04-25 Inv Nylon Chemicals Americas, Llc Methods, materials, synthetic hosts and reagents for the biosynthesis of hydrocarbons and derivatives thereof

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019245895A1 (en) 2018-06-19 2019-12-26 Invista North America S.A.R.L. Methods for the synthesis of carbon products from non-biosynthetic streams
CN119403929A (en) 2022-06-21 2025-02-07 朗泽科技有限公司 Microorganisms and methods for continuous co-production of high-value specialty proteins and chemical products from C1 substrates

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006014837A1 (en) * 2004-07-27 2006-02-09 The Regents Of The University Of California Genetically modified host cells and use of same for producing isoprenoid compounds
US20140335576A1 (en) * 2011-10-07 2014-11-13 Danisco Us Inc. Methods for increasing microbial production of isoprene, isoprenoids, and isoprenoid precursor molecules using glucose and acetate co-metabolism
US20150284742A1 (en) * 2012-10-23 2015-10-08 Sekisui Chemical Co., Ltd. Recombinant cell, and method for producing isoprene
US20160002672A1 (en) * 2012-12-21 2016-01-07 Danisco Us Inc. Production of isoprene, isoprenoid, and isoprenoid precursors using an alternative lower mevalonate pathway
US20170145441A1 (en) * 2015-08-17 2017-05-25 INVISTA North America S.à.r.l. Methods, hosts, and reagents related thereto for production of unsaturated pentahydrocarbons, derivatives and intermediates thereof

Family Cites Families (76)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE3146084C2 (en) 1981-11-20 1983-10-20 Gesellschaft für Biotechnologische Forschung mbH (GBF), 3300 Braunschweig Continuous or batch process for fermenting liquid media containing carbohydrates and phosphates
US5830714A (en) 1996-04-17 1998-11-03 Molecular Biology Resources, Inc. Biologically active fragment of bacillus stearothermophilus DNA polymerase
DE60228439D1 (en) 2001-06-06 2008-10-02 Dsm Ip Assets Bv IMPROVED ISOPRENOID PRODUCTION
US7780525B2 (en) 2003-10-17 2010-08-24 Igt Systems and methods for determining a level of reward
WO2006119052A2 (en) 2005-05-03 2006-11-09 Anaerobe Systems Anaerobic production of hydrogen and other chemical products
CA2666968A1 (en) 2006-10-20 2008-10-30 Arizona Board Of Regents For And On Behalf Of Arizona State University Modified cyanobacteria
US7897369B2 (en) 2007-08-27 2011-03-01 Regents Of The University Of Minnesota Isoprenoid wax ester synthases, isoprenoid acyl CoA-synthetases, and uses thereof
CL2008002681A1 (en) 2007-09-18 2009-10-16 The Univ Of Tulsa Catalytic cracking process of algae oil by contact with a catalytic composition that comprises a zeolite molecular sieve with 12-membered rings.
US8309323B2 (en) 2007-11-13 2012-11-13 Synthetic Genomics, Inc. Dimethyloctane as an advanced biofuel
EP2285948B1 (en) 2008-03-03 2014-01-08 Joule Unlimited Technologies, Inc. Engineered co2 fixing microorganisms producing carbon-based products of interest
AU2009240505B2 (en) 2008-04-23 2013-09-05 Danisco Us Inc. Isoprene synthase variants for improved microbial production of isoprene
BRPI0913901A2 (en) 2008-06-17 2016-12-13 Genomatica Inc microorganisms and methods for fumarate, malate and acrylate biosynthesis
WO2010001078A2 (en) 2008-07-04 2010-01-07 Philippe Marliere Production of alkenes by enzymatic decarboxylation of 3-hydroxyalkanoic acids
CA2737158A1 (en) 2008-09-15 2010-03-18 Danisco Us Inc. Increased isoprene production using the archaeal lower mevalonate pathway
US20150140640A1 (en) 2008-11-06 2015-05-21 Kiverdi, Inc. Process for growing natural or engineered high lipid accumulating strain on crude glycerol and/or other sources of waste carbon for the production of oils, fuels, oleochemicals, and other valuable organic compounds
US20150017694A1 (en) * 2008-11-06 2015-01-15 Kiverdi, Inc. Engineered CO2-Fixing Chemotrophic Microorganisms Producing Carbon-Based Products and Methods of Using the Same
BRPI1008287A2 (en) 2009-02-24 2016-03-15 Gevo Inc renewable butadiene and isoprene preparation methods
JP5707344B2 (en) 2009-02-26 2015-04-30 コデクシス, インコーポレイテッド Transaminase biocatalyst
CN102369290A (en) 2009-04-03 2012-03-07 帝斯曼知识产权资产管理有限公司 Fermentation process
US8765431B2 (en) 2009-07-23 2014-07-01 The Regents Of The University Of Michigan Method for enzymatic production of decarboxylated polyketides and fatty acids
EP2336341A1 (en) 2009-12-21 2011-06-22 Philippe Marliere Method for producing an alkene comprising the step of converting an alcohol by an enzymatic dehydration step
EP2336340A1 (en) 2009-12-21 2011-06-22 Philippe Marliere Method for producing an alkene comprising the step of converting an alcohol by an enzymatic dehydration step
PL2516656T3 (en) 2009-12-22 2014-10-31 Global Bioenergies Process for the production of isoprenol from mevalonate employing a diphosphomevalonate decarboxylase
EP2857518A3 (en) 2009-12-23 2015-04-22 Danisco US Inc. Compositions and methods of PGL for the increased production of isoprene
CA2797409C (en) 2010-05-05 2019-12-24 Genomatica, Inc. Microorganisms and methods for the biosynthesis of butadiene
PH12013500158A1 (en) 2010-07-26 2013-03-11 Genomatica Inc Microorganisms and methods for the biosynthesis of aromatics, 2,4-pentadienoate and 1,3-butadiene
US20120045807A1 (en) 2010-08-19 2012-02-23 Lanzatech New Zealand Limited Process for producing chemicals using microbial fermentation of substrates comprising carbon monoxide
CN103261410B (en) 2010-10-19 2018-05-11 环球生物能源公司 Generation of alkenes by combinatorial enzymatic conversion of 3-hydroxyalkanoic acids
BR112013018316A2 (en) * 2010-12-22 2018-09-11 Danisco Us Inc compositions and methods for improved isoprene production using two types of ispg enzymes
JP5960729B2 (en) 2011-02-02 2016-08-02 ジェノマティカ, インコーポレイテッド Microorganisms and methods for butadiene biosynthesis
US9422578B2 (en) 2011-06-17 2016-08-23 Invista North America S.A.R.L. Methods for biosynthesizing 1,3 butadiene
CN107254492A (en) 2011-06-17 2017-10-17 英威达技术有限责任公司 The method for producing 1,3 butadiene
US8617862B2 (en) 2011-06-22 2013-12-31 Genomatica, Inc. Microorganisms for producing propylene and methods related thereto
RS54444B1 (en) 2011-07-12 2016-06-30 Scientist Of Fortune S.A. RECOMBINANT MICRO-ORGANISMS FOR THE PRODUCTION OF USEFUL METABOLITES
JP2014528705A (en) 2011-08-04 2014-10-30 ダニスコ・ユーエス・インク Production of isoprene, isoprenoid precursors, and isoprenoids using acetoacetyl CoA synthase
US20130109064A1 (en) 2011-08-19 2013-05-02 Robin E. Osterhout Microorganisms and methods for producing 2,4-pentadienoate, butadiene, propylene, 1,3-butanediol and related alcohols
WO2013036812A1 (en) 2011-09-07 2013-03-14 William Marsh Rice University Functionalized carboxylic acids and alcohols by riverse fatty acid oxidation
MX2014003212A (en) 2011-09-16 2015-03-19 Genomatica Inc Microorganisms and methods for producing alkenes.
BR112014008061A2 (en) 2011-10-19 2017-04-11 Scientist Of Fortune Sa method for enzymatic production of butadiene
WO2013074371A2 (en) 2011-11-08 2013-05-23 The Regents Of The University Of California Hybrid organic-inorganic system for producing biofuels
EP2785848A2 (en) 2011-12-02 2014-10-08 INVISTA Technologies S.à.r.l. Methods for biosynthesizing 1,3butadiene
WO2013090915A1 (en) 2011-12-16 2013-06-20 Braskem S.A. Modified microorganisms and methods of making butadiene using same
AU2012357857B2 (en) 2011-12-20 2016-01-21 Scientist Of Fortune S.A. Production of 1,3-dienes by enzymatic conversion of 3-hydroxyalk-4-enoates and/or 3-phosphonoxyalk-4-enoates
WO2013096863A1 (en) 2011-12-23 2013-06-27 The Regents Of The University Of California Constructs and methods for improved isoprene biosynthesis
EA031093B1 (en) 2012-01-31 2018-11-30 Ланцатек Нью Зилэнд Лимитед Recombinant carboxydotrophic acetogenic microorganism, method for the production thereof and method for the production of products using same
WO2013119340A1 (en) 2012-02-08 2013-08-15 Glycos Biotechnologies, Inc. Microorganism and process for isoprene production
CN104245945B (en) 2012-04-05 2018-10-09 环球生物能源 Process for the enzymatic production of 3-methylbut-3-en-1-ol using mevalonate as substrate
US8895277B2 (en) 2012-05-02 2014-11-25 Danisco Us Inc. Legume isoprene synthase for production of isoprene
BR112014028287A2 (en) 2012-05-16 2017-06-27 Glycos Biotechnologies Inc microorganisms and processes for the production of isoprene
WO2013179722A1 (en) 2012-05-30 2013-12-05 株式会社ブリヂストン Isoprene synthase and polynucleotide encoding same, and method for producing isoprene monomer
WO2013181647A2 (en) 2012-06-01 2013-12-05 Danisco Us Inc. Compositions and methods of producing isoprene and/or industrrial bio-products using anaerobic microorganisms
US20130323820A1 (en) 2012-06-01 2013-12-05 Lanzatech New Zealand Limited Recombinant microorganisms and uses therefor
EP2861745A2 (en) 2012-06-15 2015-04-22 Invista Technologies S.à.r.l. Methods for biosynthesizing 1,3 butadiene
BR112014031894A2 (en) 2012-06-18 2017-08-01 Braskem Sa method for co-producing butadiene and 1-propanol and / or 1,2-propanediol and microorganism
EP2867365A1 (en) 2012-06-29 2015-05-06 Scientist of Fortune S.A. Process for producing a c2-c10 monoalkene employing a terpene synthase or a prenyl transferase
WO2014015210A2 (en) 2012-07-20 2014-01-23 Glycos Biotechnologies, Inc. Microorganisms and processes for the conversion of glycerol to isoprene
US8703455B2 (en) 2012-08-29 2014-04-22 Scientist of Fourtune, S.A. Production of volatile dienes by enzymatic dehydration of light alkenols
US9803220B2 (en) 2012-10-25 2017-10-31 Global Bioenergies Production of alkenes from 3-hydroxy-1-carboxylic acids via 3-sulfonyloxy-1-carboxylic acids
AU2013347891A1 (en) * 2012-11-21 2015-06-11 Joshua BLAKESLEE Engineering plants to produce farnesene and other terpenoids
WO2014085612A1 (en) 2012-11-28 2014-06-05 INVISTA North America S.á r.l. Methods for biosynthesis of isobutene
JP2016508737A (en) 2013-03-07 2016-03-24 キャリスタ, インコーポレイテッド Compositions and methods for biological production of isoprene
WO2014193473A1 (en) 2013-05-31 2014-12-04 E. I. Du Pont De Nemours And Company Recombinant anaerobic acetogenic bacteria for production of isoprene and/or industrial bio-products using synthesis gas
KR20150006097A (en) 2013-07-05 2015-01-16 경상대학교산학협력단 Microorganism including genes coding enzymes involved in the production of mevalonate and preparing method for retinoid using the same
JP2016165225A (en) 2013-07-09 2016-09-15 味の素株式会社 Method for producing useful substance
US10294496B2 (en) * 2013-07-19 2019-05-21 Invista North America S.A.R.L. Methods for biosynthesizing 1,3 butadiene
WO2015021045A2 (en) 2013-08-05 2015-02-12 INVISTA North America S.á r.l. Methods for biosynthesis of isoprene
CN103602626B (en) 2013-10-12 2016-02-10 中国科学院青岛生物能源与过程研究所 A kind of take grease as the method for raw material production mevalonic acid and the genetic engineering bacterium of structure thereof
CA2936252C (en) 2014-01-30 2019-08-20 Lanzatech New Zealand Limited Recombinant acetogenic bacterium with mutated lactate biosynthesis pathway enzyme and methods of use thereof
EP2944696A1 (en) 2014-05-13 2015-11-18 Evonik Degussa GmbH Method of producing organic compounds
US10792339B2 (en) 2015-07-17 2020-10-06 Children's National Medical Center Methods and compositions for treating phenylketonuria
US10167487B2 (en) 2015-08-17 2019-01-01 INVISTA North America S.à.r.l. Methods, cells and reagents for production of isoprene, derivatives and intermediates thereof
CA3151149C (en) * 2015-10-13 2024-03-26 Lanzatech Nz, Inc. Genetically engineered bacterium comprising energy-generating fermentation pathway
US20190218577A1 (en) 2016-09-30 2019-07-18 Invista North America S.A.R.L. Methods, synthetic hosts and reagents for the biosynthesis of isoprene and derivatives
US11634733B2 (en) 2017-06-30 2023-04-25 Inv Nylon Chemicals Americas, Llc Methods, materials, synthetic hosts and reagents for the biosynthesis of hydrocarbons and derivatives thereof
US11162115B2 (en) 2017-06-30 2021-11-02 Inv Nylon Chemicals Americas, Llc Methods, synthetic hosts and reagents for the biosynthesis of hydrocarbons
US11505809B2 (en) 2017-09-28 2022-11-22 Inv Nylon Chemicals Americas Llc Organisms and biosynthetic processes for hydrocarbon synthesis

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006014837A1 (en) * 2004-07-27 2006-02-09 The Regents Of The University Of California Genetically modified host cells and use of same for producing isoprenoid compounds
US20140335576A1 (en) * 2011-10-07 2014-11-13 Danisco Us Inc. Methods for increasing microbial production of isoprene, isoprenoids, and isoprenoid precursor molecules using glucose and acetate co-metabolism
US20150284742A1 (en) * 2012-10-23 2015-10-08 Sekisui Chemical Co., Ltd. Recombinant cell, and method for producing isoprene
US20160002672A1 (en) * 2012-12-21 2016-01-07 Danisco Us Inc. Production of isoprene, isoprenoid, and isoprenoid precursors using an alternative lower mevalonate pathway
US20170145441A1 (en) * 2015-08-17 2017-05-25 INVISTA North America S.à.r.l. Methods, hosts, and reagents related thereto for production of unsaturated pentahydrocarbons, derivatives and intermediates thereof

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11162115B2 (en) 2017-06-30 2021-11-02 Inv Nylon Chemicals Americas, Llc Methods, synthetic hosts and reagents for the biosynthesis of hydrocarbons
US11634733B2 (en) 2017-06-30 2023-04-25 Inv Nylon Chemicals Americas, Llc Methods, materials, synthetic hosts and reagents for the biosynthesis of hydrocarbons and derivatives thereof
US11505809B2 (en) 2017-09-28 2022-11-22 Inv Nylon Chemicals Americas Llc Organisms and biosynthetic processes for hydrocarbon synthesis

Also Published As

Publication number Publication date
US20190002926A1 (en) 2019-01-03
US11634733B2 (en) 2023-04-25

Similar Documents

Publication Publication Date Title
US10538789B2 (en) Methods for biosynthesis of isoprene
US9169496B2 (en) Method for the enzymatic production of butadiene
US11634733B2 (en) Methods, materials, synthetic hosts and reagents for the biosynthesis of hydrocarbons and derivatives thereof
US9493791B2 (en) Utilization of phosphoketolase in the production of mevalonate, isoprenoid precursors, and isoprene
RU2609656C2 (en) Method of producing alkenes by combined enzymatic conversion of 3-hydroxyalkanoic acids
JP6513022B2 (en) Production of volatile dienes by enzymatic dehydration of light alkenols
US20180057843A1 (en) Methods for biosynthesis of isobutene
US20140234926A1 (en) Recombinant anaerobic acetogenic bacteria for production of isoprene and/or industrial bio-products using synthesis gas
US20140370565A1 (en) Production of 1,3-Dienes by Enzymatic Conversion of 3-Hydroxyalk-4-Enoates and/or 3-Phosphonoxyalk-4-Enoates
JP2017506078A (en) Recombinant microorganisms for improved production of mevalonic acid, isoprene, isoprenoid precursors, isoprenoids, and acetyl-CoA derived products
US20190271009A1 (en) Methods, cells and reagents for production of isoprene, derivatives and intermediates thereof
US20180291401A1 (en) Methods, hosts, and reagents related thereto for production of unsaturated pentahydrocarbons, derivatives and intermediates thereof
US11162115B2 (en) Methods, synthetic hosts and reagents for the biosynthesis of hydrocarbons
US10538788B2 (en) Methods, synthetic hosts and reagents for the biosynthesis of dienes and derivatives thereof
US20160237461A1 (en) Methods for biosynthesizing methacrylate
US10533193B2 (en) Methods for biosynthesis of isobutene

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18822810

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18822810

Country of ref document: EP

Kind code of ref document: A1