WO2019000028A1 - Mosquito-adapted bacterium against highly infectious mosquito-borne viruses - Google Patents

Mosquito-adapted bacterium against highly infectious mosquito-borne viruses Download PDF

Info

Publication number
WO2019000028A1
WO2019000028A1 PCT/AU2018/050643 AU2018050643W WO2019000028A1 WO 2019000028 A1 WO2019000028 A1 WO 2019000028A1 AU 2018050643 W AU2018050643 W AU 2018050643W WO 2019000028 A1 WO2019000028 A1 WO 2019000028A1
Authority
WO
WIPO (PCT)
Prior art keywords
mosquito
mosquitoes
wmelcs
virus
population
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/AU2018/050643
Other languages
French (fr)
Inventor
Johanna Elisabeth FRASER
Jyotika Taneja DE BRUYNE
Iñaki ITURBE-ORMAETXE
Heather Ann FLORES
Scott Lesie O’NEILL
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Monash University
Original Assignee
Monash University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AU2017902499A external-priority patent/AU2017902499A0/en
Application filed by Monash University filed Critical Monash University
Publication of WO2019000028A1 publication Critical patent/WO2019000028A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01NPRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N63/00Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
    • A01N63/20Bacteria; Substances produced thereby or obtained therefrom
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • C12N1/205Bacterial isolates
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2207/00Modified animals
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12RINDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00Microorganisms ; Processes using microorganisms
    • C12R2001/01Bacteria or Actinomycetales ; using bacteria or Actinomycetales

Definitions

  • FIELD OF THE INVENTION relates to environmental control of mosquito-transmitted diseases. More particularly, this invention relates to a Wolbachia strain that is particularly useful in modifying mosquitoes that harbour highly infectious, disease causing viruses.
  • Arboviruses transmitted by the Aedes aegypti mosquito including dengue (DENV), Zika (ZIKV) and chikungunya (CHIKV) are emerging threats that impose an increasing health burden on tropical and subtropical regions of the world. While these viruses usually cause self-limiting febrile disease, severe manifestations such as hemorrhagic shock can lead to death. In the absence of specific antiviral therapeutics and suboptimal vaccines (1-4), treatment is supportive only and limiting virus transmission has been largely dependent on vector control. The increasing global incidence of these diseases demonstrates the lack of effectiveness of current control programs and the need for novel, efficacious and cost-effective alternatives (5).
  • Wolbachia is a gram negative, obligate endosymbiont that is maternally transmitted and can impart antiviral properties to arthropod hosts. It is estimated that at least 40% of all terrestrial arthropod species are infected with Wolbachia (6) which can also manipulate host biology to induce feminization, parthenogenesis, cytoplasmic incompatibility (CI) and male-killing (7, 8).
  • CI is probably the most common, driven by many Wolbachia strains, and enables the spread of Wolbachia into a host population by providing females with Wolbachia an indirect reproductive advantage.
  • CI results in the embryonic lethality of offspring.
  • Wolbachia- ' fected females can mate with both infected and uninfected males successfully.
  • CI coupled with the maternal transmission of Wolbachia leads to the rapid invasion of the host population (7, 8).
  • the antiviral activity Wolbachia can provide to its host is a more recently described phenomenon.
  • the mechanism that drives this protection is not well understood but may involve priming of the insect innate immune response pathways in new Wolbachia infections, and competition for resources such as cholesterol (9-11).
  • Field trials to date have utilized Ae. aegypti transinfected with the Drosophila melanogaster native Wolbachia strain, wMel, and a more pathogenic form, wMelPop-CLA, isolated from a mutant lab strain of D. melanogaster (12-14). While these strains have been shown to restrict replication and dissemination of several virus genera including flaviviruses and alphaviruses in Ae. aegypti, due to the technical difficulties of introducing Wolbachia into a new species, the full potential of using alternative Wolbachia strains has remained largely unexplored.
  • the present invention relates to the use of a mosquito-adapted Wolbachia strain wMelCS bacterium to modify mosquitoes for release into areas where high titre, disease-causing viruses are endemic, to thereby at least partly prevent or inhibit viral disease transmission by mosquitoes.
  • the invention relates to a mosquito-adapted wMelCS bacterium for use in modifying mosquitoes capable of transmitting highly infectious viruses.
  • the wMelCS bacterium is Wolbachia pipientis var wMelCS deposited at the National Measurement Institute, 1/153 Bertie St. Port Melbourne, Victoria, 3207, Australia under accession number V17/025608 on 14 November 2017.
  • the invention provides a mosquito infected with a mosquito-adapted wMelCS bacterium and optionally infected with a highly infectious virus.
  • the invention provides a population of mosquitoes that include one or more mosquitoes infected with a highly infectious virus and one or more mosquitoes that comprise wMelCS bacteria.
  • the invention provides a method of modifying an environment that comprises mosquitoes harbouring a highly infectious virus capable of being transmitted by one or more of the mosquitoes in the environment, including the step of introducing one or more mosquitoes that comprise wMelCS bacteria into the environment to thereby modify the environment.
  • the invention provides a method of modifying a mosquito population, including the step of introducing one or more mosquitoes that comprise wMelCS bacteria into the mosquito population to thereby modify the mosquito population, wherein the mosquito population comprises mosquitoes that harbour a highly infectious virus capable of being transmitted by one or more mosquitoes.
  • the invention provides a method of at least partly suppressing or inhibiting transmission of a highly infectious virus within a vertebrate host population having one or more vertebrate host individuals harbouring the highly infectious virus, including the step of introducing one or more mosquitoes that comprise wMelCS bacteria into an environment comprising the vertebrate host population to thereby at least partly suppress or inhibit transmission of the highly infectious virus within the vertebrate host population.
  • the invention provides of at least partly preventing, reducing or eliminating a disease caused by, or associated with, a highly infectious mosquito-borne virus, said method including the step of introducing one or more mosquitoes that comprise wMelCS bacteria into an environment where the highly infectious mosquito-borne virus is, or may become, present to thereby at least partly prevent, reduce or eliminate the incidence of the disease in said environment.
  • the invention provides a mosquito-adapted bacterium which is Wolbachia pipientis var wMelCS deposited at the National Measurement Institute, Port Melbourne, Victoria, Australia under accession number V17/025608 on 14 November 2017.
  • said mosquito is of the genus Aedes.
  • said mosquito is of the species Aedes aegypti.
  • Non-limiting examples of viruses include dengue virus, Zika virus and chikungunya virus, inclusive of all strains and serotypes of these viruses.
  • the wMelCS-infected mosquitoes display substantially repressed or inhibited virus replication, substantially normal maternal transmission and/or substantially normal cytoplasmic incompatibility (CI), preferably at minimal fitness cost to the mosquito.
  • indefinite articles “a” and “an” are not to be read as singular indefinite articles or as otherwise excluding more than one or more than a single subject to which the indefinite article refers.
  • a mosquito includes one mosquito, one or more mosquitoes or a plurality of mosquitoes.
  • FIG. 1 CI, fecundity and egg diapause viability in wMelCS, w>Ri, and wPip transinfected Ae. aegypti.
  • A Hatch rates for crosses between infected and uninfected mosquitoes show CI and successful hatching. Bars are the mean percentage of eggs hatched +/- SEM from >40 females (individual data points are superimposed). Symbols for tetracycline-treated mosquitoes (uninfected) are in black, Wolbachia-m ' fected are in red.
  • wPip hatch rate was significantly reduced at all weeks compared to wPip.Tet (p ⁇ 0.0001).
  • wMel hatch rate was significantly reduced at weeks 4, 8, 10, (p ⁇ 0.05) and 12 (pO.0001) compared to wMel.Tet.
  • wMelCS had a significantly reduced hatch rate at weeks 10 and 12 compared to wMelCS.Tet (p ⁇ 0.01 and p ⁇ 0.0001, respectively).
  • wRi had a significantly reduced hatch rate at week 12 only, compared to wRi.Tet (pO.0001).
  • wMelCS provides superior blocking of DENV-3 genome replication in a mosquito injection challenge model.
  • DENV-3 was injected into the thorax of 6 or 7-day old female mosquitoes at 2.5 l.0 6 TQDso/ml (undiluted) or 10, 100 or 1000-fold dilutions thereof.
  • RNA was extracted from whole mosquito bodies 7-days post infection and virus replication was quantified by qRT-PCR Data are the mean number of genome copies per mosquito +/- SEM. Number of DENV-3 positive mosquitoes/total n are indicated above each bar. ** p ⁇ 0.01, ** * *p ⁇ 0.0001 , Mann-Whitney test.
  • (B) The mean DENY genome copies and SE : from (A) are repiotted as a function of virus concentration injected. Significant differences in the mean RNA copies of w el and wMelCS lines are indicated by ** (p ⁇ 0.01). Significant differences in the mean RNA copies of wMel.Tet and wMelCS.Tet lines are indicated by $ (p ⁇ 0.05), Mann-Whitney test.
  • the present invention is predicated on the surprising discovery that mosquito adaptation of the Drosophila melanogaster-m ' fect g bacterium wMel CS results in a mosquito-adapted bacterium that is particularly useful for infecting mosquitoes to at least partly reduce or eliminate transmission of highly infectious viruses carried by mosquitoes. This occurs with no substantial fitness cost or loss of cytoplasmic incompatibility (CI).
  • CI cytoplasmic incompatibility
  • the mosquito- adapted wMelCS strain may prove to have higher viral blocking characteristics in the field than other commonly used strains, such as wMel and wMelPop-CLA, without the fitness costs and loss of CI that prevent field establishment of some strains.
  • the mosquito-adapted wMelCS strain bacterium is Wolbachia pipientis var wMelCS deposited at the National Measurement Institute, Port Melbourne, Victoria, Australia under accession number V17/025608 on 14 November 2017.
  • isolated material that has been removed from its natural state or otherwise been subjected to human manipulation. Isolated material may be substantially or essentially free from components that normally accompany it in its natural state, or may be manipulated so as to be in an artificial state together with components that normally accompany it in its natural state.
  • mosquitoes include insects of the family Culicidae.
  • mosquitoes are of the sub-families Anophelinae and Culicinae.
  • mosquitoes are capable of transmitting disease- causing pathogens, including viruses, protozoa, worms ⁇ e.g. nematodes) and bacteria to a mammalian host.
  • disease- causing pathogens including viruses, protozoa, worms ⁇ e.g. nematodes
  • Non-limiting examples include species of the genus Anopheles which transmit malaria pathogens, species of the genus Culex, and species of the genus Aedes (e.g.
  • Aedes aegypti, Aedes albopictus and Aedes polynesiensis which transmit nematode worm pathogens, arbovirus pathogens such as Alphaviruses (e.g. Eastern Equine encephalitis, Western Equine encephalitis, Venezuelan equine encephalitis and Chikungunya virus), Flavivirus pathogens that cause diseases such as Japanese encephalitis, Murray Valley Encephalitis, West Nile fever, Yellow fever, Dengue fever and Zika virus- associated conditions such as Zika fever, microencephaly and Guillain-Barre syndrome, and Bunyavirus pathogens that cause diseases such as LaCrosse encephalitis, Rift Valley Fever, and Colorado tick fever, although without limitation thereto.
  • Alphaviruses e.g. Eastern Equine encephalitis, Western Equine encephalitis, Venezuelan equine encephalitis and Chikungunya virus
  • Flavivirus pathogens that cause diseases such as
  • Non-limiting examples of pathogens that may be transmitted by Aedes aegypti are dengue virus, Zika virus, yellow fever virus, chikungunya virus and heartworm (Dirofilaria immitis).
  • pathogens that may be transmitted by Aedes albopictus include West Nile Virus, yellow fever virus, St Louis Encephalitis virus, dengue virus, Zika virus and chikungunya virus although without limitation thereto.
  • said mosquito is of the genus Aedes.
  • said mosquito is of the species Aedes aegypti.
  • virus pathogens include dengue virus, Zika virus and chikungunya virus, inclusive of all strains and serotypes of these viruses.
  • the invention relates to a mosquito-adapted wMelCS strain bacterium and/or its use to infect mosquitoes that are capable of harbouring and/or transmitting highly infectious viruses.
  • mosquito-adapted bacterium is meant a bacterium that has been taken out of its native host environment and adapted to a mosquito host, in which environment said bacterium does not naturally reside.
  • wMelCS is a mosquito-adapted Wolbachia pipientis bacterium that has been isolated from its native host ⁇ i.e. Drosophila melanogaster) and adapted to infect, colonize or reside in a mosquito.
  • wMelCS- infected mosquitoes are introduced into an environment that has, or could have, a population of wild mosquitoes that are infected with a highly infectious virus such as hereinbefore described.
  • the wMelCS-infected mosquitoes may be particularly efficient with regard to reducing or eliminating virus transmission by the mosquitoes to a vertebrate host population in that environment. This may result in at least partial reduction or elimination of the incidence of the viral disease in the host population.
  • a "vertebrate hosf may be any vertebrate animal upon which a mosquito feeds and/or to which a mosquito is capable of transmitting a disease-causing pathogen.
  • Non-limiting examples of vertebrate hosts are mammals such as humans, domesticated pets ⁇ e.g. dogs and cats), wild animals ⁇ e.g. monkeys, rodents and wild cats) livestock animals ⁇ e.g. sheep, pigs, cattle, and horses) and avians such as poultry ⁇ e.g. chickens, turkeys and ducks), although without limitation thereto.
  • mammals such as humans, domesticated pets ⁇ e.g. dogs and cats), wild animals ⁇ e.g. monkeys, rodents and wild cats) livestock animals ⁇ e.g. sheep, pigs, cattle, and horses) and avians such as poultry ⁇ e.g. chickens, turkeys and ducks), although without limitation thereto.
  • the disease is caused by, or associated with, a virus pathogen which is a "highly infectious" virus.
  • highly infectious is meant a virus which is present at, or is capable of being present at, a load, titre, concentration or amount in a vertebrate host ⁇ e.g following infection and/or replication) to the extent that the transmission rate of virus to wild-type ⁇ i.e not modified wMelCS) mosquitoes feeding on the vertebrate host is at least 30%, 40%, 50%, 60%, 70% or more.
  • the viral titre or load that relates to an at least 30% transmission rate to mosquitoes may vary between different viruses and/or between different isolates or serotypes of the same virus.
  • wMelCS-modified mosquitoes feeding on a vertebrate host infected with a highly infectious virus will inhibit or suppress viral replication more so than a wild-type mosquito ⁇ i.e not modified by wMelCS), thereby inhibiting or suppressing viral transmission to other vertebrate hosts.
  • the wMelCS bacteria do not produce or elicit a substantial fitness cost to wMelCS-infected mosquitoes.
  • fitness costs include impaired egg viability and larval development, although without limitation thereto.
  • the wMelCS-infected mosquitoes display substantially repressed or inhibited virus replication, near-complete maternal transmission and substantially normal cytoplasmic incompatibility (CI) to enable rapid spread into a wild mosquito population, whilst inducing minimal fitness cost to the mosquito host.
  • CI cytoplasmic incompatibility
  • release of the wMelCS-infected mosquitoes into the environment modifies one or more other biological properties of said mosquito population.
  • the one or more biological properties may include fecundity, tolerance of eggs to desiccation, pathogen susceptibility, viability of offspring and/or average lifespan of a mosquito or mosquito population.
  • the Wolbachia strain For a Wo3 ⁇ 4ac/zz ' (2-transinfected Ae. aegypti line to be considered for future release, the Wolbachia strain must provide strong protection against virus replication, demonstrate near-complete maternal transmission, induce CI to enable rapid spread into the wild mosquito population, whilst inducing minimal fitness cost to the mosquito host.
  • Ae. aegypti mosquitoes do not naturally carry Wolbachia
  • a number of mosquito species have natural infections including the closely related species Aedes albopictus (wAlbA and wAlbB) and Aedes notoscriptus (wNoto) as well as more distantly related species such as Culex quinquefasciatus (wPip).
  • wAlbB has previously been transinfected into Ae. aegypti and shown to provide strong protection against DENV while having limited effects on host fitness (11, 23-25), suggesting that Wolbachia strains from more-closely related species could be better adapted for an Ae. aegypti host.
  • vvPip has been reported to provide protection against West Nile virus (WNV) in its natural host, identifying this strain as a possible candidate for transinfection in Ae. aegypti (26).
  • Wolbachia transinfection The Wolbachia uninfected and inbred PGYPl .Tet line was used as the recipient line for transinfection. Embryonic microinjection, isofemale line establishment and selection for stably-infected lines were done as previously described (14, 15) with a few modifications.
  • the wMelCS, wRi and wPip strains were purified from the donor wMelCS-infected Drosophila melanogaster, wRi-infected Drosophila simulans and wPip-infected Culex quinquefasciatus, respectively, and microinjected into the posterior-pole of pre-blastoderm embryos of the recipient PGYPl .tet using methodology previously described (14, 15).
  • Surviving GO adult females from microinjection were mated to PGYPl .tet males, blood fed and setup for oviposition as isofemales.
  • GO females that laid fertile eggs were screened using quantitative PCR (qPCR) as described below. Once the newly introduced Wolbachia strain was at 100% frequency in the population and maintained itself for at least 2 consecutive generations the line was considered stable.
  • the wMelCS and wRi lines were stable at G3 and wPip at G5.
  • CI Wolbachia-induced cytoplasmic incompatibility
  • Each cross consisted of a group of 70 virgin males and 70 virgin females and each group was allowed to mate for 5 d after emergence. On day five all females were blood fed by one human volunteer. Gravid females were aspirated into individual tubes three-days post blood feeding and allowed to oviposit on wet filter paper (24). Three-days post oviposition female mosquitoes were removed and tested for the presence of Wolbachia by qPCR using strain-specific primers as described in the PCR section.
  • Egg diapause viability To assess the viability of eggs stored over time, age- controlled adults (emergence within 24 h; 100 males and 100 females) were placed in quadruplet in 30x20x20cm cages. One cage of each line was blood-fed by the same human volunteer at 5 days post emergence. To control for the potential variation caused by blood-meal quality and composition. This was repeated 4 times with 4 different volunteers. Three-days post blood meal, 12 oviposition cups were placed in each cage for three days. Approximately 72 h post oviposition, egg cups were removed, dried slowly over 3-5 days then stored in Whirlpak bags (Sigma) in an airtight container with saturated KC1 solution to maintain humidity (15).
  • Mosquitoes were provided fresh 10% sucrose twice/week and maintained at 26°C, 65% RH and a 12: 12 h light: dark cycle in a climate-controlled room. The number of dead males and/or females was recorded and removed daily until all mosquitoes in the cages were dead (15, 24).
  • wPip was detected by amplifying an IS2 transposon, with 49 identical copies of this sequence in the wPip genome (forward primer (SEQ ID NO: l): 5'- GC ACTTACCCT AACC AAAGGT AAC-3 ' , reverse primer (SEQ ID NO:2): 5' CTAACTTTAGGCCTCTATCGAAGAG-3 '), wRi was detected by amplifying a part of the gene WRi_009390, which encodes a hypothetical protein (forward primer (SEQ ID NO:3): 5'CATGCCAATAACGAAATAGC -3 ', reverse primer (SEQ ID NO:4): 5'-TAGCAACTTTTCTTGCGAAC-3 ').
  • a combination of two primer sets was used to differentiate wMelCS from wMel and wMelPop-CLA strains.
  • One of the primers sets binds to wMel and wMelCS in the WD0513 region of the genome (30, 31) (forward primer (SEQ ID NO:5): 5 ' C AAATTGCTCTTGTCCTGTGG-3 ' , reverse primer (SEQ ID NO:6): 5'- GGGTGTT AAGC AGAGTT ACGG-3 ' ), Probe Cy5 (SEQ ID NO:7): TGAAATGGAAAAATTGGCGAGGTGTAGG- BHQ3.
  • the second primer set binds to the polymorphic insertion sites of wMelPop-CLA and wMelCS at loci IS5-WD1310 (forward primer (SEQ ID NO: 8): 5'- CTC ATCTTTACCCCGTACTAAAATTTC-3 ' , reverse primer (SEQ ID NO: 9): 5'-TCTTCCTCATTAAGAACCTCTATCTTG-3 '), Probe HEX (SEQ ID NO: 10): TAGCCTTTT ACTTGTTTCCGGAC AACCT-BHQ 1.
  • DENV-3 Cairns 08/09 strain stocks (Genbank accession number: JN406515.1) were prepared by inoculation of C6/36 cells with a multiplicity of infection (MOI) of 1 and collection of culture supernatant 6-7 days later. Virus concentrations were determined by TCID50 as previously described (32) using monoclonal antibody 4G2 (33).
  • Injected mosquitoes were incubated for 7 days (10 mosquitoes/cup) at 26°C with 65% RH and a 12 h light/dark cycle.
  • total RNA was isolated from DENV-3 mosquitoes (entire mosquitoes for injection experiments, or head and bodies separately for blood fed mosquitoes) using the RNeasy 96 QIAcube HT kit (Qiagen).
  • DENV-3 copies were quantified using one step qRT-PCR (LightCycler® Multiplex RNA Virus Master, Roche), using primers to the conserved 3'UTR: Forward (SEQ ID NO: 17): 5 ' - AAGGACTAGAGGTT AGAGGAGACCC; Reverse (SEQ ID NO: 18): 5'- CGTTCTGTGCCTGGAATGATG; Probe (SEQ ID NO: 19): 5'- HEX- AAC AGC AT ATTGACGCTGGGAGAGACC AGA-BHQ 1 -3 ' .
  • Mosquito extracts with >1000 copies of DENV per well were scored positive, based on the LOD95 (limit of detection 95%) for DENV-3 with this primer set.
  • CI occurs when an uninfected female mated with a Wolbachia-mfected male cannot produce viable offspring. This phenomenon ensures all offspring will be Wolbachia-posihve, enabling effective spread of Wolbachia throughout a wild population.
  • Maternal transmission was assayed by crossing Wolbachia- ' fected females with males from their respective tetracycline (Tet)-treated line (minimum generation 5). The crosses revealed near-complete maternal transmission for wMelCS (99.4%) and wPip (98.9%) while wRi sustained some breakdown of maternal transmission at 88% (Table 1). Cytoplasmic incompatibility (CI) was determined for each line by measuring the hatch rate from crosses between Tet-treated females and infected males from each respective Wo/ ⁇ ac/zz ' a-infected line.
  • CI Cytoplasmic incompatibility
  • Fecundity was measured as the number of eggs collected/female following mating between Wolbachia-miected males and females, and Wolbachia-miected females and Tet-treated males, compared to the control cross of Tet-treated males and females.
  • wRi and wMelCS the number of eggs/female did not significantly decrease irrespective of these matings indicative of high fecundity (Fig. IB).
  • vvPip relative to control crosses, the mean number of eggs/female decreased for crosses between infected females and males, and infected females crossed with uninfected males, suggesting wPip reduces fecundity for this line.
  • wMel females had the longest mean survival time (80 days), followed by wMelCS (56 days), then wPip (53 days) and finally wRi (51 days). Similar relative survival rates were observed for males, although all males had a shorter lifespan than their female counterparts as previously reported (24).
  • wMel, wMelCS and wRi Wolbachia- ' fected lines tracked closely with their Tet-treated controls suggesting the infection had minimal influence on longevity, with the genetics of the generated line being a more important contributor.
  • wRi females p ⁇ 0.0001
  • wMel p ⁇ 0.05
  • wMelCS p ⁇ 0.05
  • wPip was the only line that showed substantially shorter lifespan for both males and females compared to the Tet-control (p ⁇ 0.0001).
  • No line showed impaired longevity that would be of relevance in a field setting where ⁇ 1% of female Ae. aegypti are expected to live beyond 3 weeks (34).
  • Total Wolbachia density was measured in 5-day old adult females of each line (minimum generation 9) and compared to benchmark line wMel, using qPCR for primers specific to the highly conserved Wolbachia ribosomal RNA gene, 16S, and Ae. aegypti rpsl7 gene to normalize for DNA input.
  • Total Wolbachia density in wMelCS and wPip lines was comparable to wMel (no significant difference), while the mean wRi density was approximately half that of wMel (p ⁇ 0.0001; Fig. 3A).
  • mosquitoes were fed an infectious blood meal containing 2.0 x 10 6 TCID ml (DENV-3), then incubated for 14 days at 26°C. Due to the reduced fitness of vvPip mosquitoes we elected to exclude this line, and vector competence analysis was performed on wRi and wMelCS lines, and compared to wMel. Mosquitoes were collected, the head separated from each mosquito body, then total RNA extracted to measure rates of infection (as determined by bodies positive for DENV RNA) and dissemination (heads positive for DENV RNA).
  • wMel reduced the mean DENV RNA levels by 31ogio in mosquito bodies (3 x 10 4 copies/body compared to 3 x 10 7 copies/body in the relevant Tet control line), as well as reducing the infection rate, with just 9% of wMel mosquito bodies scoring positive for DENV infection compared to 94% in the matched Tet control line (where positive was defined as >1000 copies/body, see Materials & Methods; Fig. 4 and Table 2).
  • wRi caused only a slight, although significant (p ⁇ 0.01, Mann- Whitney test) reduction in viral copies (7.6 x 10 7 copies/body compared to 1.3 x 10 8 copies/body for the matched Tet control line) with no reduction in infection rate (96% compared to 98%, respectively).
  • wMelCS gave a phenotype intermediate of wMel and wRi, whereby a wide spread in the number of DENV copies/body was observed, with a mean of 1.5 x 10 7 RNA copies compared to 4.7 x 10 7 RNA copies for its matched Tet control line.
  • DENV-3 dissemination key for viral transmission, was similarly restricted between wMel and wMelCS lines, with ⁇ 41ogio reduction in viral RNA copies determined in the head of each line relative to the matched Tet control, and just 2 and 9% infection rates, respectively, compared to 83 and 96% for the Tet controls. While the mean DENV RNA copies/head of wRi-infected mosquitoes was significantly reduced (2 x 10 6 copies compared to 9.5 x 10 6 copies for the Tet control line), the dissemination rates were not reduced (94% compared to 95%, respectively).
  • wMelCS When mosquitoes were injected with 2.5 x 10 5 TCIDWml, wMelCS reduced DENV RNA copies by ⁇ 21ogio compared to ⁇ llogio for wMel, indicating that wMelCS may be more effective at restricting replication DENV-3 when mosquitoes are challenged with a highly infectious virus, compared to mosquitoes modified by another Wolbachia strain such as wMel. This trend continued as the virus was diluted further, with substantially lower viral RNA levels measured in wMelCS mosquitoes when injected with 2.5 x 10 4 TCIDWml and 2.5 x 10 3 TCIDWml. Importantly, lower rates of infection were also observed in wMelCS compared to wMel for the three lowest injected virus concentrations ("number of DENV-positive mosquitoes/total blood-fed mosquitoes" are indicated above each bar).
  • the injection challenge model does provide information regarding the robustness of Wolbachia-mediated blocking and perhaps suggests that the wMelCS strain is better able to cope with high viral loads. This may be a critical feature in a clinical setting where viral loads in patients, and subsequent infection rates in mosquitoes occur at far greater levels than in artificial blood feeding systems (38).
  • Min KT Benzer S. Wolbachia, normally a symbiont of Drosophila, can be virulent, causing degeneration and early death. Proc Natl Acad Sci U S A. 1997;94(20): 10792-6.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Virology (AREA)
  • Microbiology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Agronomy & Crop Science (AREA)
  • Pest Control & Pesticides (AREA)
  • Plant Pathology (AREA)
  • Dentistry (AREA)
  • Environmental Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

A mosquito-adapted Wolbachia pipientis var wMelCS bacterium is provided which is particularly efficacious for infecting mosquitoes that can harbour highly infectious viruses. Mosquitoes infected with the wMelCS bacterium may be released into the environment thereby preventing, reducing or eliminating a disease caused by, or associated with, the highly infectious mosquito-borne virus.

Description

TITLE
MOSQUITO-ADAPTED BACTERIUM AGAINST HIGHLY INFECTIOUS
MOSQUITO-BORNE VIRUSES
FIELD OF THE INVENTION THIS INVENTION relates to environmental control of mosquito-transmitted diseases. More particularly, this invention relates to a Wolbachia strain that is particularly useful in modifying mosquitoes that harbour highly infectious, disease causing viruses.
BACKGROUND OF THE INVENTION
Arboviruses transmitted by the Aedes aegypti mosquito, including dengue (DENV), Zika (ZIKV) and chikungunya (CHIKV) are emerging threats that impose an increasing health burden on tropical and subtropical regions of the world. While these viruses usually cause self-limiting febrile disease, severe manifestations such as hemorrhagic shock can lead to death. In the absence of specific antiviral therapeutics and suboptimal vaccines (1-4), treatment is supportive only and limiting virus transmission has been largely dependent on vector control. The increasing global incidence of these diseases demonstrates the lack of effectiveness of current control programs and the need for novel, efficacious and cost-effective alternatives (5).
In 2011, the first releases of Ae. aegypti mosquitoes carrying the endosymbiotic bacterium Wolbachia pipientis began in field trials in Northern Australia as part of the Eliminate Dengue Program. Wolbachia is a gram negative, obligate endosymbiont that is maternally transmitted and can impart antiviral properties to arthropod hosts. It is estimated that at least 40% of all terrestrial arthropod species are infected with Wolbachia (6) which can also manipulate host biology to induce feminization, parthenogenesis, cytoplasmic incompatibility (CI) and male-killing (7, 8). Of these traits, CI is probably the most common, driven by many Wolbachia strains, and enables the spread of Wolbachia into a host population by providing females with Wolbachia an indirect reproductive advantage. In crosses between uninfected females and Wolbachia-' fected males, CI results in the embryonic lethality of offspring. However, Wolbachia-' fected females can mate with both infected and uninfected males successfully. CI, coupled with the maternal transmission of Wolbachia leads to the rapid invasion of the host population (7, 8).
The antiviral activity Wolbachia can provide to its host is a more recently described phenomenon. The mechanism that drives this protection is not well understood but may involve priming of the insect innate immune response pathways in new Wolbachia infections, and competition for resources such as cholesterol (9-11). Field trials to date have utilized Ae. aegypti transinfected with the Drosophila melanogaster native Wolbachia strain, wMel, and a more pathogenic form, wMelPop-CLA, isolated from a mutant lab strain of D. melanogaster (12-14). While these strains have been shown to restrict replication and dissemination of several virus genera including flaviviruses and alphaviruses in Ae. aegypti, due to the technical difficulties of introducing Wolbachia into a new species, the full potential of using alternative Wolbachia strains has remained largely unexplored.
SUMMARY OF THE INVENTION
The present invention relates to the use of a mosquito-adapted Wolbachia strain wMelCS bacterium to modify mosquitoes for release into areas where high titre, disease-causing viruses are endemic, to thereby at least partly prevent or inhibit viral disease transmission by mosquitoes.
In a broad form, the invention relates to a mosquito-adapted wMelCS bacterium for use in modifying mosquitoes capable of transmitting highly infectious viruses.
In an embodiment, the wMelCS bacterium is Wolbachia pipientis var wMelCS deposited at the National Measurement Institute, 1/153 Bertie St. Port Melbourne, Victoria, 3207, Australia under accession number V17/025608 on 14 November 2017.
In a first aspect, the invention provides a mosquito infected with a mosquito-adapted wMelCS bacterium and optionally infected with a highly infectious virus. In a second aspect, the invention provides a population of mosquitoes that include one or more mosquitoes infected with a highly infectious virus and one or more mosquitoes that comprise wMelCS bacteria.
In a third aspect, the invention provides a method of modifying an environment that comprises mosquitoes harbouring a highly infectious virus capable of being transmitted by one or more of the mosquitoes in the environment, including the step of introducing one or more mosquitoes that comprise wMelCS bacteria into the environment to thereby modify the environment.
In a fourth aspect, the invention provides a method of modifying a mosquito population, including the step of introducing one or more mosquitoes that comprise wMelCS bacteria into the mosquito population to thereby modify the mosquito population, wherein the mosquito population comprises mosquitoes that harbour a highly infectious virus capable of being transmitted by one or more mosquitoes.
In a fifth aspect, the invention provides a method of at least partly suppressing or inhibiting transmission of a highly infectious virus within a vertebrate host population having one or more vertebrate host individuals harbouring the highly infectious virus, including the step of introducing one or more mosquitoes that comprise wMelCS bacteria into an environment comprising the vertebrate host population to thereby at least partly suppress or inhibit transmission of the highly infectious virus within the vertebrate host population.
In a sixth aspect the invention provides of at least partly preventing, reducing or eliminating a disease caused by, or associated with, a highly infectious mosquito-borne virus, said method including the step of introducing one or more mosquitoes that comprise wMelCS bacteria into an environment where the highly infectious mosquito-borne virus is, or may become, present to thereby at least partly prevent, reduce or eliminate the incidence of the disease in said environment.
In a seventh aspect, the invention provides a mosquito-adapted bacterium which is Wolbachia pipientis var wMelCS deposited at the National Measurement Institute, Port Melbourne, Victoria, Australia under accession number V17/025608 on 14 November 2017.
In one embodiment of the aforementioned aspects, said mosquito is of the genus Aedes.
In a preferred embodiment, said mosquito is of the species Aedes aegypti.
Non-limiting examples of viruses include dengue virus, Zika virus and chikungunya virus, inclusive of all strains and serotypes of these viruses.
Suitably, the wMelCS-infected mosquitoes display substantially repressed or inhibited virus replication, substantially normal maternal transmission and/or substantially normal cytoplasmic incompatibility (CI), preferably at minimal fitness cost to the mosquito.
Throughout this specification, unless otherwise indicated, "comprise", "comprises" and "comprising" are used inclusively rather than exclusively, so that a stated integer or group of integers may include one or more other non-stated integers or groups of integers.
It will also be appreciated that the indefinite articles "a" and "an" are not to be read as singular indefinite articles or as otherwise excluding more than one or more than a single subject to which the indefinite article refers. For example, "a" mosquito includes one mosquito, one or more mosquitoes or a plurality of mosquitoes.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1. CI, fecundity and egg diapause viability in wMelCS, w>Ri, and wPip transinfected Ae. aegypti. (A) Hatch rates for crosses between infected and uninfected mosquitoes show CI and successful hatching. Bars are the mean percentage of eggs hatched +/- SEM from >40 females (individual data points are superimposed). Symbols for tetracycline-treated mosquitoes (uninfected) are in black, Wolbachia-m' fected are in red. Asterisks indicate significance compared to Tet x Tet controls (Kruskal-Wallis, Dunn's, * for <0.05, *** for <0.001, **** for <0.0001). (B) Fecundity was determined as a measure of eggs laid per female. Symbol codes and statistics are as per (A). Data are the mean +/- SEM from >40 females (individual data points are superimposed). (C) Eggs from gravid females were collected over 72 h, from 3-days post blood meal. Eggs were dried slowly over 3-5 days then stored in a humid, airtight container. Batches of 100-500 eggs were hatched after 1, 2, 3, 4, 6, 8, 10 and 12 weeks. Hatched larvae were counted at 2nd instar stage until no hatch was observed for a week then, the percent hatch calculated. Statistical analysis was performed using 2way ANOVA Sikdak's multiple comparisons test. wPip hatch rate was significantly reduced at all weeks compared to wPip.Tet (p<0.0001). wMel hatch rate was significantly reduced at weeks 4, 8, 10, (p<0.05) and 12 (pO.0001) compared to wMel.Tet. wMelCS had a significantly reduced hatch rate at weeks 10 and 12 compared to wMelCS.Tet (p<0.01 and p<0.0001, respectively). wRi had a significantly reduced hatch rate at week 12 only, compared to wRi.Tet (pO.0001).
Figure 2. Longevity in transinfected Ae. aegypti lines
Age-controlled (emergence within 24 h) adults (-150 males and -150 females) were maintained at 26°C, 65% relative humidity and a 12: 12 h ligh dark cycle in a climate controlled room. The number of dead males and/or females was recorded and carcasses removed daily until all mosquitoes in the cages were dead. Significant differences were observed for wRi females (p<0.0001), wMel (p<0.05) and wMelCS (p<0.05) males, relative to their respective Tet control line. wPip had a significantly shorter lifespan for both males and females compared its matched Tet-control (p<0.0001). Statistical analysis was performed using a Log- rank (Mantel-Cox) test.
Figure 3. Wolbachia density and distribution in transinfected Ae. aegypti lines
(A) Density of Wolbachia within 5-day old whole female mosquitoes was determined by qPCR using primers directed to the conserved 16S rRNA gene. Data are the mean and SEM of 24 mosquitoes (individual data points are superimposed). Asterisks indicate significance compared to wMel (Mann- Whitney test, **** p 0.0001). (B) The distribution of wMelCS, wRi and wPip Wolbachia strains in mosquitoes was determined in sections of paraffin- embedded female mosquitoes (5 to 7 day old) using fluorescence in situ hybridisation (FISH). The fluorescently labelled 16S probe detects the 16S rRNA gene from all four Wolbachia strains. Total DNA was stained in blue using DAPI and a green filter was included to increase contrast with surrounding tissues. Sg indicates salivary gland tissue, m indicates muscle, and c indicates cardia. White arrows identify select regions of Wolbachia staining.
Figure 4. wMelCS and w>Ri Wolbachia strains inhibit DENV-3 replication and dissemination following an infectious blood meal. Seven-day old female mosquitoes were fed a blood meal of fresh DENV-3 (2.0 x 106 TCID ml) mixed 1 : 1 with sheep blood (n = 500 per Wolbachia-mfected line, n = 200 per respective Tet control line). Mosquitoes were sorted immediately to identify those that took a blood meal, and incubated for 14 days. Mosquito heads were then separated from the thorax and total RNA was extracted from each head and remaining mosquito body. DENY genome copies were determined by qRT-PCR. for each body as a measure of infection, and for each head as a measure of viral dissemination. Data are the mean genome copies per mosquito body (top) or head (bottom) +/'- SEM, and are representative of 3 independent experiments. Statistical analyses were performed using a Mann-Whitney test where ** p < 0.01, ****p<0.0001.
Figure 5. wMelCS provides superior blocking of DENV-3 genome replication in a mosquito injection challenge model. (A) DENV-3 was injected into the thorax of 6 or 7-day old female mosquitoes at 2.5 l.06 TQDso/ml (undiluted) or 10, 100 or 1000-fold dilutions thereof. RNA was extracted from whole mosquito bodies 7-days post infection and virus replication was quantified by qRT-PCR Data are the mean number of genome copies per mosquito +/- SEM. Number of DENV-3 positive mosquitoes/total n are indicated above each bar. ** p < 0.01, ** * *p<0.0001 , Mann-Whitney test. (B) The mean DENY genome copies and SE : from (A) are repiotted as a function of virus concentration injected. Significant differences in the mean RNA copies of w el and wMelCS lines are indicated by ** (p<0.01). Significant differences in the mean RNA copies of wMel.Tet and wMelCS.Tet lines are indicated by $ (p<0.05), Mann-Whitney test.
DETAILED DESCRIPTION
The present invention is predicated on the surprising discovery that mosquito adaptation of the Drosophila melanogaster-m' fect g bacterium wMel CS results in a mosquito-adapted bacterium that is particularly useful for infecting mosquitoes to at least partly reduce or eliminate transmission of highly infectious viruses carried by mosquitoes. This occurs with no substantial fitness cost or loss of cytoplasmic incompatibility (CI). Thus, it is expected that the mosquito- adapted wMelCS strain may prove to have higher viral blocking characteristics in the field than other commonly used strains, such as wMel and wMelPop-CLA, without the fitness costs and loss of CI that prevent field establishment of some strains.
In an embodiment, the mosquito-adapted wMelCS strain bacterium is Wolbachia pipientis var wMelCS deposited at the National Measurement Institute, Port Melbourne, Victoria, Australia under accession number V17/025608 on 14 November 2017.
For the purposes of this invention, by "isolated" is meant material that has been removed from its natural state or otherwise been subjected to human manipulation. Isolated material may be substantially or essentially free from components that normally accompany it in its natural state, or may be manipulated so as to be in an artificial state together with components that normally accompany it in its natural state.
As used herein "mosquito " and "mosquitoes" include insects of the family Culicidae. Preferably, mosquitoes are of the sub-families Anophelinae and Culicinae. Even more preferably, mosquitoes are capable of transmitting disease- causing pathogens, including viruses, protozoa, worms {e.g. nematodes) and bacteria to a mammalian host. Non-limiting examples include species of the genus Anopheles which transmit malaria pathogens, species of the genus Culex, and species of the genus Aedes (e.g. Aedes aegypti, Aedes albopictus and Aedes polynesiensis) which transmit nematode worm pathogens, arbovirus pathogens such as Alphaviruses (e.g. Eastern Equine encephalitis, Western Equine encephalitis, Venezuelan equine encephalitis and Chikungunya virus), Flavivirus pathogens that cause diseases such as Japanese encephalitis, Murray Valley Encephalitis, West Nile fever, Yellow fever, Dengue fever and Zika virus- associated conditions such as Zika fever, microencephaly and Guillain-Barre syndrome, and Bunyavirus pathogens that cause diseases such as LaCrosse encephalitis, Rift Valley Fever, and Colorado tick fever, although without limitation thereto.
Non-limiting examples of pathogens that may be transmitted by Aedes aegypti are dengue virus, Zika virus, yellow fever virus, chikungunya virus and heartworm (Dirofilaria immitis).
Examples of pathogens that may be transmitted by Aedes albopictus include West Nile Virus, yellow fever virus, St Louis Encephalitis virus, dengue virus, Zika virus and chikungunya virus although without limitation thereto.
In one embodiment, said mosquito is of the genus Aedes.
In a preferred embodiment, said mosquito is of the species Aedes aegypti.
Non-limiting examples of virus pathogens include dengue virus, Zika virus and chikungunya virus, inclusive of all strains and serotypes of these viruses.
In certain aspects, the invention relates to a mosquito-adapted wMelCS strain bacterium and/or its use to infect mosquitoes that are capable of harbouring and/or transmitting highly infectious viruses. By "mosquito-adapted" bacterium is meant a bacterium that has been taken out of its native host environment and adapted to a mosquito host, in which environment said bacterium does not naturally reside. Accordingly, wMelCS is a mosquito-adapted Wolbachia pipientis bacterium that has been isolated from its native host {i.e. Drosophila melanogaster) and adapted to infect, colonize or reside in a mosquito.
Particular aspects of the invention provide methods whereby wMelCS- infected mosquitoes are introduced into an environment that has, or could have, a population of wild mosquitoes that are infected with a highly infectious virus such as hereinbefore described. The wMelCS-infected mosquitoes may be particularly efficient with regard to reducing or eliminating virus transmission by the mosquitoes to a vertebrate host population in that environment. This may result in at least partial reduction or elimination of the incidence of the viral disease in the host population. A "vertebrate hosf may be any vertebrate animal upon which a mosquito feeds and/or to which a mosquito is capable of transmitting a disease-causing pathogen. Non-limiting examples of vertebrate hosts are mammals such as humans, domesticated pets {e.g. dogs and cats), wild animals {e.g. monkeys, rodents and wild cats) livestock animals {e.g. sheep, pigs, cattle, and horses) and avians such as poultry {e.g. chickens, turkeys and ducks), although without limitation thereto.
Suitably, the disease is caused by, or associated with, a virus pathogen which is a "highly infectious" virus. By "highly infectious" is meant a virus which is present at, or is capable of being present at, a load, titre, concentration or amount in a vertebrate host {e.g following infection and/or replication) to the extent that the transmission rate of virus to wild-type {i.e not modified wMelCS) mosquitoes feeding on the vertebrate host is at least 30%, 40%, 50%, 60%, 70% or more. The viral titre or load that relates to an at least 30% transmission rate to mosquitoes may vary between different viruses and/or between different isolates or serotypes of the same virus. By way of example in relation to dengue virus, viral loads or titres in human plasma for DENV-1 and DENV-2 that can result in a 50%) transmission rate are typically 6.29-6.51 logio viral RNA copies/mL, whereas for DENV-3 and DENV-4 the load or titre is 7.49-7.52 logio viral RNA copies/mL (Carrington & Simmons, 2014, Front. Immunol. doi.org/10.3389/fimmu.2014.00290).
Although not wishing to be bound by theory, it is proposed that a dose- response relationship exists such that increasing viral load or titre in a vertebrate host correlates with an increased likelihood of a mosquito becoming infected following feeding on the vertebrate host, up to the point of saturation. Thus, wMelCS-modified mosquitoes feeding on a vertebrate host infected with a highly infectious virus will inhibit or suppress viral replication more so than a wild-type mosquito {i.e not modified by wMelCS), thereby inhibiting or suppressing viral transmission to other vertebrate hosts.
Suitably, the wMelCS bacteria do not produce or elicit a substantial fitness cost to wMelCS-infected mosquitoes. Examples of fitness costs include impaired egg viability and larval development, although without limitation thereto.
Suitably, the wMelCS-infected mosquitoes display substantially repressed or inhibited virus replication, near-complete maternal transmission and substantially normal cytoplasmic incompatibility (CI) to enable rapid spread into a wild mosquito population, whilst inducing minimal fitness cost to the mosquito host.
Suitably, release of the wMelCS-infected mosquitoes into the environment modifies one or more other biological properties of said mosquito population. The one or more biological properties may include fecundity, tolerance of eggs to desiccation, pathogen susceptibility, viability of offspring and/or average lifespan of a mosquito or mosquito population. A more detailed discussion of these biological properties in the context of Wolbachia-' fected mosquitoes may be found in United States Patent 9090911, for example.
So that the invention may be fully understood and put into practical effect, the skilled reader is directed to the following non-limiting detailed Examples.
EXAMPLES INTRODUCTION
This study set out to examine whether we could improve on the pathogenic protection afforded to Ae. aegypti by wMel, whilst avoiding fitness costs to the mosquito such as impaired egg viability and larval development as described for wMelPop-CLA infections (15-18).
For a Wo¾ac/zz'(2-transinfected Ae. aegypti line to be considered for future release, the Wolbachia strain must provide strong protection against virus replication, demonstrate near-complete maternal transmission, induce CI to enable rapid spread into the wild mosquito population, whilst inducing minimal fitness cost to the mosquito host.
To predict which Wolbachia strains may provide these traits we looked to past studies, most of which have been performed using natively Wolbachia- infected, artificially transinfected, or introgressed Drosophila lines, with the RNA viruses Drosophila C virus (DCV) or Flock House virus (FHV) as models. From these studies, we identified wMelCS (from D. melanogaster) and wRi (from D. simulans) as key candidates (19-22).
Although Ae. aegypti mosquitoes do not naturally carry Wolbachia, a number of mosquito species have natural infections including the closely related species Aedes albopictus (wAlbA and wAlbB) and Aedes notoscriptus (wNoto) as well as more distantly related species such as Culex quinquefasciatus (wPip). wAlbB has previously been transinfected into Ae. aegypti and shown to provide strong protection against DENV while having limited effects on host fitness (11, 23-25), suggesting that Wolbachia strains from more-closely related species could be better adapted for an Ae. aegypti host. vvPip has been reported to provide protection against West Nile virus (WNV) in its natural host, identifying this strain as a possible candidate for transinfection in Ae. aegypti (26).
MATERIALS AND METHODS
Mosquito rearing
All Ae. aegypti mosquitoes were reared and maintained as described earlier (15, 24). Adult mosquitoes were maintained at 26°C, 65% relative humidity (RH) and a 12: 12 h ligh dark cycle in a climate-controlled room. Mosquitoes were blood fed on the arms of human volunteers (Monash University human ethics permit CF11/0766-2011000387). The Wolbachia-miected wMe\ line included in our experiments has been described previously (14, 15, 27). We generated uninfected lines for each strain by treatment of the infected lines with the antibiotic tetracycline (Tet) as described earlier (15, 28).
To exclude any influence of age and quality of eggs used in experiments, 5-day old females from all lines were fed by the same volunteer in one sitting. The eggs collected from these females were then dried and used as experimental material within 2-3 weeks. For experiments using the wPip line, freshly laid eggs were used due to poor hatch rates following egg storage.
To exclude any influence of mosquito age on our experiments, age- controlled adults emerging within a 24 h window were used (29).
Wolbachia transinfection The Wolbachia uninfected and inbred PGYPl .Tet line was used as the recipient line for transinfection. Embryonic microinjection, isofemale line establishment and selection for stably-infected lines were done as previously described (14, 15) with a few modifications. In brief, the wMelCS, wRi and wPip strains were purified from the donor wMelCS-infected Drosophila melanogaster, wRi-infected Drosophila simulans and wPip-infected Culex quinquefasciatus, respectively, and microinjected into the posterior-pole of pre-blastoderm embryos of the recipient PGYPl .tet using methodology previously described (14, 15). Surviving GO adult females from microinjection were mated to PGYPl .tet males, blood fed and setup for oviposition as isofemales. GO females that laid fertile eggs were screened using quantitative PCR (qPCR) as described below. Once the newly introduced Wolbachia strain was at 100% frequency in the population and maintained itself for at least 2 consecutive generations the line was considered stable. The wMelCS and wRi lines were stable at G3 and wPip at G5.
Cytoplasmic incompatibility and maternal transmission
To investigate the level of Wolbachia-induced cytoplasmic incompatibility (CI) we set up paired crosses between Wolbachia-' fected and tetracycline-treated (Tet) Ae. aegypti. For each Wolbachia strain four crosses were set up: (1) a CI cross (Tet females x infected males), (2) a maternal transmission (MT) cross (infected females x Tet males), (3) an uninfected control cross (Tet females x Tet males) and (4) an infected control cross (infected females x infected males). Each cross consisted of a group of 70 virgin males and 70 virgin females and each group was allowed to mate for 5 d after emergence. On day five all females were blood fed by one human volunteer. Gravid females were aspirated into individual tubes three-days post blood feeding and allowed to oviposit on wet filter paper (24). Three-days post oviposition female mosquitoes were removed and tested for the presence of Wolbachia by qPCR using strain-specific primers as described in the PCR section.
Any paper containing less than 15 eggs was discarded. The egg papers from the remaining females were photographed and eggs were counted manually. The papers were then submerged in hatching water. Two days later the number of hatched larvae (2nd instar) was counted. Newly hatched larvae were counted daily until no hatching was recorded for three consecutive days. Any unhatched eggs were dried briefly for 48-72 h, hatched and counted again to get the maximum hatch.
To quantify the success of MT of Wolbachia to the next generation, hatched larvae from the MT cross (infected females x Tet males) were reared to 5-day old adults and screened by qPCR for the presence of Wolbachia. Fitness determinants
Egg diapause viability. To assess the viability of eggs stored over time, age- controlled adults (emergence within 24 h; 100 males and 100 females) were placed in quadruplet in 30x20x20cm cages. One cage of each line was blood-fed by the same human volunteer at 5 days post emergence. To control for the potential variation caused by blood-meal quality and composition. This was repeated 4 times with 4 different volunteers. Three-days post blood meal, 12 oviposition cups were placed in each cage for three days. Approximately 72 h post oviposition, egg cups were removed, dried slowly over 3-5 days then stored in Whirlpak bags (Sigma) in an airtight container with saturated KC1 solution to maintain humidity (15). Batches of 100-500 eggs were photographed and counted, then hatched after 1, 2, 3, 4, 6, 8, 10 and 12 weeks from each cage. Hatched larvae were counted at 2nd instar stage until no hatch was observed for a week then the percent hatch calculated. Fecundity and hatch rate. Performed using the parameters described for cytoplasmic incompatibility and maternal transmission above. Fecundity was calculated as the average number of eggs laid/female, and hatch rate determined as the number of 2nd instar larvae per 100 eggs hatched. Adult longevity. Age-controlled adults (approximately 150 males and 150 females) were placed in triplicate 30x30x30cm cages. Mosquitoes were provided fresh 10% sucrose twice/week and maintained at 26°C, 65% RH and a 12: 12 h light: dark cycle in a climate-controlled room. The number of dead males and/or females was recorded and removed daily until all mosquitoes in the cages were dead (15, 24).
Wolbachia detection by PCR
The presence or absence of Wolbachia in transinfected mosquitoes was confirmed by qPCR using strain-specific primers. wPip was detected by amplifying an IS2 transposon, with 49 identical copies of this sequence in the wPip genome (forward primer (SEQ ID NO: l): 5'- GC ACTTACCCT AACC AAAGGT AAC-3 ' , reverse primer (SEQ ID NO:2): 5' CTAACTTTAGGCCTCTATCGAAGAG-3 '), wRi was detected by amplifying a part of the gene WRi_009390, which encodes a hypothetical protein (forward primer (SEQ ID NO:3): 5'CATGCCAATAACGAAATAGC -3 ', reverse primer (SEQ ID NO:4): 5'-TAGCAACTTTTCTTGCGAAC-3 '). A combination of two primer sets was used to differentiate wMelCS from wMel and wMelPop-CLA strains. One of the primers sets binds to wMel and wMelCS in the WD0513 region of the genome (30, 31) (forward primer (SEQ ID NO:5): 5 ' C AAATTGCTCTTGTCCTGTGG-3 ' , reverse primer (SEQ ID NO:6): 5'- GGGTGTT AAGC AGAGTT ACGG-3 ' ), Probe Cy5 (SEQ ID NO:7): TGAAATGGAAAAATTGGCGAGGTGTAGG- BHQ3. The second primer set binds to the polymorphic insertion sites of wMelPop-CLA and wMelCS at loci IS5-WD1310 (forward primer (SEQ ID NO: 8): 5'- CTC ATCTTTACCCCGTACTAAAATTTC-3 ' , reverse primer (SEQ ID NO: 9): 5'-TCTTCCTCATTAAGAACCTCTATCTTG-3 '), Probe HEX (SEQ ID NO: 10): TAGCCTTTT ACTTGTTTCCGGAC AACCT-BHQ 1. For each sample, quantitative PCR amplification of DNA was performed using a LightCycler 480 II Instrument (Roche) using LightCycler 480 SYBR Green I Master (Roche) for wPip and wRi amplification and Taqman Probes Master for amplifying wMelCS according to the manufacturer' s protocol . Wolbachia density and distribution
The density of Wolbachia in the three newly introduced strains, wMelCS, wRi and vvPip was compared to the density in the long established wMelF strain (14, 15). Total relative Wolbachia densities for the four lines were determined in whole, female mosquitoes using qPCR using primers to amplify a fragment of the gene coding 16S rRNA (16S) (forward primer (SEQ ID NO: 11): 5'- GAGTGAAGAAGGCCTTTGGG-3 ' , reverse primer (SEQ ID NO: 12): 5'- C ACGGAGTT AGCC AGGACTTC-3 ' , probe (SEQ ID NO: 13): 5' LC640- CTGTGAGTACCGTCATTATCTTCCTCACT-IowaBlackRQ-3') and the reference Ae. aegypti rpsl7 gene (forward primer (SEQ ID NO: 14): 5'- TCCGTGGT ATCTCC ATC AAGCT-3 ' , reverse primer (SEQ ID NO: 15): 5'- C ACTTCCGGC ACGT AGTTGTC-3 ' , probe (SEQ ID NO: 16): 5'FAM- C AGGAGGAGGAACGTGAGCGC AG-BHQ 1 -3 ' )· Vector competence
DENV-3 Cairns 08/09 strain stocks (Genbank accession number: JN406515.1) were prepared by inoculation of C6/36 cells with a multiplicity of infection (MOI) of 1 and collection of culture supernatant 6-7 days later. Virus concentrations were determined by TCID50 as previously described (32) using monoclonal antibody 4G2 (33).
For feeding experiments with DENV-3 (Cairns 08/09) infected blood, 100 seven-day old age-controlled female mosquitoes were placed in 500 mL plastic containers (five containers per Wolbachia line, two containers per Tet line), starved for up to 24 h and allowed to feed on a 50:50 mixture of defibrinated sheep blood and tissue culture supernatant containing freshly harvested 2.0 x 106 TCID mL of DENV-3. Feeding was done through a piece of desalted porcine intestine stretched over a water-jacketed membrane feeding apparatus preheated to 37°C. Mosquitoes were left to feed in the dark for approximately 80 min. Fully engorged mosquitoes were placed in 500 mL containers at a density of < 20/container, and incubated for 14 d at 26°C with 65% RH and a 12 h light/dark cycle. For adult microinjections, 60 six or seven-day old age-controlled female mosquitoes were anesthetized by CO2. The mosquitoes were injected intrathoracically with 69 nL of DENV-3 Cairns 08/09 strain, 2.5 xl O6 TCIDso/ml (or 10, 100 or 1000-fold dilutions thereof) in RPMI media (Life Technologies) using a pulled-glass capillary and a handheld microinjector (Nanoject II, Drummond Scientific). Injected mosquitoes were incubated for 7 days (10 mosquitoes/cup) at 26°C with 65% RH and a 12 h light/dark cycle. To quantify DENV-3 genomic copies, total RNA was isolated from DENV-3 mosquitoes (entire mosquitoes for injection experiments, or head and bodies separately for blood fed mosquitoes) using the RNeasy 96 QIAcube HT kit (Qiagen). DENV-3 copies were quantified using one step qRT-PCR (LightCycler® Multiplex RNA Virus Master, Roche), using primers to the conserved 3'UTR: Forward (SEQ ID NO: 17): 5 ' - AAGGACTAGAGGTT AGAGGAGACCC; Reverse (SEQ ID NO: 18): 5'- CGTTCTGTGCCTGGAATGATG; Probe (SEQ ID NO: 19): 5'- HEX- AAC AGC AT ATTGACGCTGGGAGAGACC AGA-BHQ 1 -3 ' . Mosquito extracts with >1000 copies of DENV per well were scored positive, based on the LOD95 (limit of detection 95%) for DENV-3 with this primer set.
RESULTS
Maternal transmission and cytoplasmic incompatibility
Maternal transmission of a Wolbachia strain and its ability to induce CI are key features that must be conserved when considering new Wolbachia- infected Ae. aegypti lines for field releases. CI occurs when an uninfected female mated with a Wolbachia-mfected male cannot produce viable offspring. This phenomenon ensures all offspring will be Wolbachia-posihve, enabling effective spread of Wolbachia throughout a wild population.
Maternal transmission was assayed by crossing Wolbachia-' fected females with males from their respective tetracycline (Tet)-treated line (minimum generation 5). The crosses revealed near-complete maternal transmission for wMelCS (99.4%) and wPip (98.9%) while wRi sustained some breakdown of maternal transmission at 88% (Table 1). Cytoplasmic incompatibility (CI) was determined for each line by measuring the hatch rate from crosses between Tet-treated females and infected males from each respective Wo/^ac/zz'a-infected line. Control crosses where Tet- treated males and females were mated or Wo/^ac/zz'a-infected males and females were mated showed high hatch rates. In CI crosses, near-complete sterility was observed in all three lines, comparable to previous reports for wMel (Fig. 1 A) (14, 24).
Mosquito fitness costs induced by each Wolbachia strain
Fecundity, hatch rate and egg diapause viability
Fecundity was measured as the number of eggs collected/female following mating between Wolbachia-miected males and females, and Wolbachia-miected females and Tet-treated males, compared to the control cross of Tet-treated males and females. For wRi and wMelCS, the number of eggs/female did not significantly decrease irrespective of these matings indicative of high fecundity (Fig. IB). For vvPip, relative to control crosses, the mean number of eggs/female decreased for crosses between infected females and males, and infected females crossed with uninfected males, suggesting wPip reduces fecundity for this line.
We next examined the egg hatch rates of each cross. No significant reduction in hatch rate was observed for wRi crosses between Wolbachia-' fected females and males, when compared to Tet-treated male and female crosses. wMelCS showed a slight although significant reduction in the hatch rate between Wolbachia-' fected females and uninfected males, compared to the Tet-treated control cross (79% and 90%; p<0.05) (Fig. 1 A), similar to that reported for wMel (14, 24). Hatch rate was more dramatically impaired for wPip, with rates dropping from 82%) for the Tet-treated control cross, to 58%> for Wo Ibachia -infected male and female crosses (pO.0001).
To determine the effect of Wolbachia on egg viability and storage, eggs were collected and stored for 1-12 weeks before determining hatch rates. The benchmark transinfected line, wMel had a slight, but significant reduction in hatch rate following 4, 8, and 10 weeks storage (p<0.05) compared to its Tet control line, with a slightly larger reduction after 12 weeks (p<0.0001) (Fig. 1C). wRi and wMelCS lines displayed similar hatch rates (>60%) across all ages until week 10 (no significant different in hatch rates compared to the respective Tet control lines until week 8). By contrast, wPip eggs appeared to deteriorate rapidly, with < 20% hatch rate observed after 3 weeks of aging (significant reductions at all weeks tested, p<0.0001, compared to wPip.Tet). Together, these data indicate a substantial fitness cost in the wPip line.
Longevity
Effects on the survival of mosquitoes from each line were next examined over time (Fig. 2). wMel females had the longest mean survival time (80 days), followed by wMelCS (56 days), then wPip (53 days) and finally wRi (51 days). Similar relative survival rates were observed for males, although all males had a shorter lifespan than their female counterparts as previously reported (24). Interestingly, wMel, wMelCS and wRi Wolbachia-' fected lines tracked closely with their Tet-treated controls suggesting the infection had minimal influence on longevity, with the genetics of the generated line being a more important contributor. Minor, but significant differences were observed for wRi females (p<0.0001) and wMel (p<0.05) and wMelCS (p<0.05) males, relative to their respective Tet control lines. wPip was the only line that showed substantially shorter lifespan for both males and females compared to the Tet-control (p<0.0001). No line showed impaired longevity that would be of relevance in a field setting where <1% of female Ae. aegypti are expected to live beyond 3 weeks (34).
Wolbachia density and distribution
Total Wolbachia density was measured in 5-day old adult females of each line (minimum generation 9) and compared to benchmark line wMel, using qPCR for primers specific to the highly conserved Wolbachia ribosomal RNA gene, 16S, and Ae. aegypti rpsl7 gene to normalize for DNA input. Total Wolbachia density in wMelCS and wPip lines was comparable to wMel (no significant difference), while the mean wRi density was approximately half that of wMel (p<0.0001; Fig. 3A).
The localization of Wolbachia within ovary and salivary gland tissues was next examined within adult female mosquitoes using fluorescence in situ hybridisation (FISH). Mosquitoes were formaldehyde-fixed, and paraffin- embedded tissue sections stained using a probe specific for Wolbachia 16S gene (red, Fig. 3B). Total DNA was stained with DAPI (blue). Consistent with the strong maternal transmission shown in Table 1 for all lines, each strain was abundant in ovarian tissues, with distribution comparable with wMel (Fig. 3B). Similar distribution of Wolbachia was also observed for all lines in the salivary glands, key for restricting viral transmission.
Restriction of DENV-3 replication by wRi and wMelCS in Ae. aegypti
To compare the viral-blocking capacity of these lines, mosquitoes were fed an infectious blood meal containing 2.0 x 106 TCID ml (DENV-3), then incubated for 14 days at 26°C. Due to the reduced fitness of vvPip mosquitoes we elected to exclude this line, and vector competence analysis was performed on wRi and wMelCS lines, and compared to wMel. Mosquitoes were collected, the head separated from each mosquito body, then total RNA extracted to measure rates of infection (as determined by bodies positive for DENV RNA) and dissemination (heads positive for DENV RNA). Consistent with previous findings, wMel reduced the mean DENV RNA levels by 31ogio in mosquito bodies (3 x 104 copies/body compared to 3 x 107 copies/body in the relevant Tet control line), as well as reducing the infection rate, with just 9% of wMel mosquito bodies scoring positive for DENV infection compared to 94% in the matched Tet control line (where positive was defined as >1000 copies/body, see Materials & Methods; Fig. 4 and Table 2).
By contrast, wRi caused only a slight, although significant (p<0.01, Mann- Whitney test) reduction in viral copies (7.6 x 107 copies/body compared to 1.3 x 108 copies/body for the matched Tet control line) with no reduction in infection rate (96% compared to 98%, respectively). wMelCS gave a phenotype intermediate of wMel and wRi, whereby a wide spread in the number of DENV copies/body was observed, with a mean of 1.5 x 107 RNA copies compared to 4.7 x 107 RNA copies for its matched Tet control line. Interestingly, DENV-3 dissemination, key for viral transmission, was similarly restricted between wMel and wMelCS lines, with ~41ogio reduction in viral RNA copies determined in the head of each line relative to the matched Tet control, and just 2 and 9% infection rates, respectively, compared to 83 and 96% for the Tet controls. While the mean DENV RNA copies/head of wRi-infected mosquitoes was significantly reduced (2 x 106 copies compared to 9.5 x 106 copies for the Tet control line), the dissemination rates were not reduced (94% compared to 95%, respectively).
Together, these results indicate that wRi demonstrates reduced DENV- blocking capacity while the ability of wMelCS to restrict viral dissemination appears to be similar to that of wMel.
In order to more closely examine the blocking capacity of wMelCS we next used an injection challenge model to directly compare viral restriction in wMel and wMelCS lines. Female mosquitoes were injected with 2.5 x 106 TCID ml of DENV-3, or 10-fold dilutions thereof. Mosquitoes were incubated for 7 days before total RNA extraction from entire mosquitoes. When mosquitoes were injected with undiluted virus, both Wolbachia lines struggled to restrict viral replication with the number of DENV copies reduced by < llogio relative to each matched Tet control line (Fig 5 A and B). When mosquitoes were injected with 2.5 x 105 TCIDWml, wMelCS reduced DENV RNA copies by ~21ogio compared to < llogio for wMel, indicating that wMelCS may be more effective at restricting replication DENV-3 when mosquitoes are challenged with a highly infectious virus, compared to mosquitoes modified by another Wolbachia strain such as wMel. This trend continued as the virus was diluted further, with substantially lower viral RNA levels measured in wMelCS mosquitoes when injected with 2.5 x 104 TCIDWml and 2.5 x 103 TCIDWml. Importantly, lower rates of infection were also observed in wMelCS compared to wMel for the three lowest injected virus concentrations ("number of DENV-positive mosquitoes/total blood-fed mosquitoes" are indicated above each bar).
Overall, these data suggest that wMelCS could restrict a direct challenge by DENV-3 more effectively than wMel.
DISCUSSION
Field releases of wMel-transinfected Ae. aegypti in order to establish Wolbachia in wild populations have been expanding over the past 6 years in 4 countries endemic to DENV. This technology is now recommended by the World Health Organisation for operational pilot deployments considering the ongoing global Zika virus emergency (35). While cluster randomized trials measuring the impact of this intervention on disease transmission are still underway, observational studies suggest this is a highly promising approach and justifies further investment to optimize Wolbachia strain selection.
Here we report for the first time the transinfection of Ae. aegypti with Wolbachia strains wRi, wMelCS and wPip. wRi and wMelCS-infected mosquitoes displayed similar fitness to wMel-infected mosquitoes. However, the introduction of wPip lead to poor egg viability after short storage times, and weaker fecundity and hatch rates compared to wMel, wMelCS and wRi; traits that would be likely to compromise effective release strategies when performed on a large scale. Interestingly, in Ae. albopictus transinfected with wPip, similar reductions in female fecundity and egg hatch rate were observed (36), suggesting that wPip may broadly induce this fitness cost when introduced into a non-native host. Although this may be context dependent, as work from Zhang et al. (2015) determined no fitness cost to Ae. albopictus when wPip was introduced into mosquitoes that also contained the native wAlbA and wAlbB strains (37).
When tested for their ability to block DENV, wMelCS and wRi restricted replication and dissemination following an infectious blood meal, although wRi blocking was substantially reduced compared to wMelCS, with wMelCS restricting DENV dissemination to the mosquito head to a similar extent as wMel. A virus injection challenge model where mosquitoes are essentially overloaded with virus, was used to separate the ability of wMel and wMelCS to inhibit DENV in a more infectious setting, with wMelCS demonstrating superior blocking under all concentrations of virus tested. While viral infection of mosquitoes by blood feeding may be considered a more physiologically relevant model in which to examine virus blocking, the injection challenge model does provide information regarding the robustness of Wolbachia-mediated blocking and perhaps suggests that the wMelCS strain is better able to cope with high viral loads. This may be a critical feature in a clinical setting where viral loads in patients, and subsequent infection rates in mosquitoes occur at far greater levels than in artificial blood feeding systems (38).
It has been inferred that the degree of blocking correlates with density of the Wolbachia strain in key tissues (39-41). We show here that overall Wolbachia densities are nearly identical in wMelCS-transinfected mosquitoes compared to wMel, despite wMelCS appearing to have a stronger virus-blocking phenotype. Although analysis of ovarian and salivary gland tissues by FISH indicated similar amounts of Wolbachia for each line, tissue-specific quantitative analysis of wMelCS may identify differential densities and localization of Wolbachia in other tissues that contribute to virus blocking, e.g. nervous tissue (42).
In wRi-containing mosquitoes, Wolbachia was found to be present at approximately half the overall density of wMel, and was significantly worse at blocking DENV-3 replication and dissemination. Interestingly, when Osborne et al. (2009) examined blocking of DCV by wRi and transinfected-wMel in D. simulans they observed almost identical densities of wRi and wMel, similar protection against virus-induced mortality to flies infected with DCV, yet wRi did not reduce the viral load (19). While this supports a role for utilising Wolbachia densities to predict viral protection in mosquitoes, it highlights the complex nature of this tripartite interaction.
It should be noted that the apparent increase in DENV protection provided to wMelCS-infected mosquitoes, compared to wMel, is in line with work performed in D. melanogaster and D. simulans using DCV and FHV (21, 22), indicating that Wolbachia-m' fected Drosophila lines may be useful indicators for pathogen blocking in Wolbachia-mfected mosquitoes.
With no substantial fitness cost identified in wMelCS infections, this strain may prove to have higher DENV blocking characteristics in the field than wMel without the fitness costs that prevent field establishment of wMelPop-CLA (18). To test this prediction these mosquitoes now need to be examined in more realistic challenge settings, such as blood feeding on viremic patients.
Throughout this specification, the aim has been to describe the preferred embodiments of the invention without limiting the invention to any one embodiment or specific collection of features. Various changes and modifications may be made to the embodiments described and illustrated herein without departing from the broad spirit and scope of the invention.
All computer programs, algorithms, patent and scientific literature referred to herein is incorporated herein by reference in their entirety.
Table 1. Wolbachia presence in the progeny from crosses between infected females and uninfected males.
Figure imgf000025_0001
Table 2. Restriction of DENV-3 infection and dissemination by Wolbachia strains wRi and wMelCS.
Line Body Head
Number DENV % DENV + Number DENV % DENV +*
+ + wMel 22 (250) 9 5 (250) 2 wMel.Tet 78 (83) 94 69 (83) 83 wMelCS 135 (240) 56 21 (240) 9 wMelCS.Tet 74 (76) 97 73 (76) 96 wRi 166 (169) 98 159 (169) 94 wRi.Tet 103 (107) 96 102 (107) 95
# Calculated as a percentage of tota engorged mosquitoes REFERENCES
1. Capeding MR, Tran NH, Hadinegoro SR, Ismail HI, Chotpitayasunondh T, Chua MN, et al. Clinical efficacy and safety of a novel tetravalent dengue vaccine in healthy children in Asia: a phase 3, randomised, observer-masked, placebo-controlled trial. Lancet. 2014;384(9951): 1358-65.
2. Hadinegoro SR, Arredondo-Garcia JL, Capeding MR, Deseda C, Chotpitayasunondh T, Dietze R, et al. Efficacy and Long-Term Safety of a Dengue Vaccine in Regions of Endemic Disease. N Engl J Med. 2015;373(13): 1195-206.
3. Simmons CP. A Candidate Dengue Vaccine Walks a Tightrope. N Engl J Med. 2015;373(13): 1263-4.
4. Pang EL, Loh HS. Towards development of a universal dengue vaccine - How close are we? Asian Pac J Trop Med. 2017; 10(3):220-8.
5. Bhatt S, Gething PW, Brady OJ, Messina JP, Farlow AW, Moyes CL, et al. The global distribution and burden of dengue. Nature. 2013;496(7446):504-7. 6. Zug R, Hammerstein P. Still a host of hosts for Wolbachia: analysis of recent data suggests that 40% of terrestrial arthropod species are infected. PLoS One. 2012;7(6):e38544.
7. Serbus LR, Casper-Lindley C, Landmann F, Sullivan W. The genetics and cell biology of Wolbachia-host interactions. Annu Rev Genet. 2008;42:683-707.
8. Werren JH, Baldo L, Clark ME. Wolbachia: master manipulators of invertebrate biology. Nat Rev Microbiol. 2008;6(10):741-51.
9. Ranees E, Johnson TK, Popovici J, Iturbe-Ormaetxe I, Zakir T, Warr CG, et al. The toll and Imd pathways are not required for wolbachia-mediated dengue virus interference. J Virol. 2013;87(21): 11945-9.
10. Caragata EP, Ranees E, Hedges LM, Gofton AW, Johnson KN, O'Neill SL, et al. Dietary cholesterol modulates pathogen blocking by Wolbachia. PLoS Pathog. 2013;9(6):el003459.
11. Bian G, Xu Y, Lu P, Xie Y, Xi Z. The endosymbiotic bacterium Wolbachia induces resistance to dengue virus in Aedes aegypti. PLoS Pathog. 2010;6(4):el000833.
12. Min KT, Benzer S. Wolbachia, normally a symbiont of Drosophila, can be virulent, causing degeneration and early death. Proc Natl Acad Sci U S A. 1997;94(20): 10792-6.
13. Hoffmann AA, Montgomery BL, Popovici J, Iturbe-Ormaetxe I, Johnson PH, Muzzi F, et al. Successful establishment of Wolbachia in Aedes populations to suppress dengue transmission. Nature. 2011;476(7361):454-7.
14. Walker T, Johnson PH, Moreira LA, Iturbe-Ormaetxe I, Frentiu FD, McMeniman CJ, et al. The wMel Wolbachia strain blocks dengue and invades caged Aedes aegypti populations. Nature. 2011;476(7361):450-3.
15. McMeniman CJ, Lane RV, Cass BN, Fong AW, Sidhu M, Wang YF, et al. Stable introduction of a life-shortening Wolbachia infection into the mosquito Aedes aegypti. Science. 2009;323(5910): 141-4. 16. McMeniman CJ, O'Neill SL. A virulent Wolbachia infection decreases the viability of the dengue vector Aedes aegypti during periods of embryonic quiescence. PLoS Negl Trop Dis. 2010;4(7):e748.
17. Moreira LA, Iturbe-Ormaetxe I, Jeffery JA, Lu G, Pyke AT, Hedges LM, et al. A Wolbachia symbiont in Aedes aegypti limits infection with dengue,
Chikungunya, and Plasmodium. Cell. 2009;139(7): 1268-78.
18. Nguyen TH, Nguyen HL, Nguyen TY, Vu SN, Tran ND, Le TN, et al. Field evaluation of the establishment potential of wmelpop Wolbachia in Australia and Vietnam for dengue control. Parasit Vectors. 2015;8:563.
19. Osborne SE, Leong YS, O'Neill SL, Johnson KN. Variation in antiviral protection mediated by different Wolbachia strains in Drosophila simulans. PLoS Pathog. 2009;5(l l):el000656.
20. Martinez J, Duplouy A, Woolfit M, Vavre F, O'Neill SL, Varaldi J. Influence of the virus LbFV and of Wolbachia in a host-parasitoid interaction. PLoS One. 2012;7(4):e35081.
21. Chrostek E, Marialva MS, Esteves SS, Weinert LA, Martinez J, Jiggins FM, et al. Wolbachia variants induce differential protection to viruses in Drosophila melanogaster: a phenotypic and phylogenomic analysis. PLoS Genet. 2013;9(12):el003896.
22. Martinez J, Longdon B, Bauer S, Chan YS, Miller WJ, Bourtzis K, et al. Symbionts commonly provide broad spectrum resistance to viruses in insects: a comparative analysis of Wolbachia strains. PLoS Pathog. 2014; 10(9):el004369. 23. Xi Z, Khoo CC, Dobson SL. Wolbachia establishment and invasion in an Aedes aegypti laboratory population. Science. 2005;310(5746):326-8.
24. Joubert DA, Walker T, Carrington LB, De Bruyne JT, Kien DH, Hoang Nle T, et al. Establishment of a Wolbachia Superinfection in Aedes aegypti Mosquitoes as a Potential Approach for Future Resistance Management. PLoS Pathog. 2016; 12(2):el005434.
25. Axford JK, Ross PA, Yeap HL, Callahan AG, Hoffmann AA. Fitness of wAlbB Wolbachia Infection in Aedes aegypti: Parameter Estimates in an
Outcrossed Background and Potential for Population Invasion. Am J Trop Med Hyg. 2016;94(3):507-16.
26. Glaser RL, Meola MA. The native Wolbachia endosymbionts of Drosophila melanogaster and Culex quinquefasciatus increase host resistance to West Nile virus infection. PLoS One. 2010;5(8):el 1977.
27. Ye YH, Carrasco AM, Frentiu FD, Chenoweth SF, Beebe NW, van den Hurk AF, et al. Wolbachia Reduces the Transmission Potential of Dengue- Infected Aedes aegypti. PLoS Negl Trop Dis. 2015;9(6):e0003894.
28. Dobson SL, Rattanadechakul W. A novel technique for removing Wolbachia infections from Aedes albopictus (Diptera: Culicidae). J Med
Entomol. 2001;38(6):844-9.
29. Yamada R, Floate KD, Riegler M, O'Neill SL. Male development time influences the strength of Wolbachia-induced cytoplasmic incompatibility expression in Drosophila melanogaster. Genetics. 2007; 177(2):801-8. 30. Woolfit M, Iturbe-Ormaetxe I, Brownlie JC, Walker T, Riegler M, Seleznev A, et al. Genomic evolution of the pathogenic Wolbachia strain, wMelPop. Genome Biol Evol. 2013;5(l l):2189-204.
31. Ferguson M, Kien DT, Clapham H, Aguas R, Trung VT, Chau TN, et al. Modeling the impact on virus transmission of Wolbachia-mediated blocking of dengue virus infection of Aedes aegypti. Sci Transl Med. 2015;7(279):279ra37.
32. O'Brien CA, Hobson-Peters J, Yam AW, Colmant AM, McLean BJ, Prow NA, et al. Viral RNA intermediates as targets for detection and discovery of novel and emerging mosquito-borne viruses. PLoS Negl Trop Dis. 2015;9(3):e0003629. 33. Gentry MK, Henchal EA, McCown JM, Brandt WE, Dalrymple JM. Identification of distinct antigenic determinants on dengue-2 virus using monoclonal antibodies. Am J Trop Med Hyg. 1982;31(3 Pt l):548-55.
34. Brady OJ, Johansson MA, Guerra CA, Bhatt S, Golding N, Pigott DM, et al. Modelling adult Aedes aegypti and Aedes albopictus survival at different temperatures in laboratory and field settings. Parasit Vectors. 2013;6:351.
35. [Available from: http://vvww.vvho. int/negleGted diseases/news/mosquito vector control res ponse/en/.
36. Calvitti M, Moretti R, Lampazzi E, Bellini R, Dobson SL. Characterization of a new Aedes albopictus (Diptera: Culicidae)-Wolbachia pipientis (Rickettsiales: Rickettsiaceae) symbiotic association generated by artificial transfer of the wPip strain from Culex pipiens (Diptera: Culicidae). J Med Entomol. 2010;47(2): 179-87.
37. Zhang D, Zheng X, Xi Z, Bourtzis K, Gilles JR. Combining the sterile insect technique with the incompatible insect technique: I-impact of wolbachia infection on the fitness of triple- and double-infected strains of Aedes albopictus. PLoS One. 2015; 10(4):e0121126.
38. Nguyet MN, Duong TH, Trung VT, Nguyen TH, Tran CN, Long VT, et al. Host and viral features of human dengue cases shape the population of infected and infectious Aedes aegypti mosquitoes. Proc Natl Acad Sci U S A. 2013;110(22):9072-7.
39. Lu P, Bian G, Pan X, Xi Z. Wolbachia induces density-dependent inhibition to dengue virus in mosquito cells. PLoS Negl Trop Dis. 2012;6(7):el754.
40. Osborne SE, Iturbe-Ormaetxe I, Brownlie JC, O'Neill SL, Johnson KN. Antiviral protection and the importance of Wolbachia density and tissue tropism in Drosophila simulans. Appl Environ Microbiol. 2012;78(19):6922-9.
41. Frentiu FD, Robinson J, Young PR, McGraw EA, O'Neill SL. Wolbachia- mediated resistance to dengue virus infection and death at the cellular level. PLoS One. 2010;5(10):el3398.
42. Linthicum KJ, Piatt K, Myint KS, Lerdthusnee K, Innis BL, Vaughn DW. Dengue 3 virus distribution in the mosquito Aedes aegypti: an immunocytochemical study. Med Vet Entomol. 1996; 10(l):87-92.

Claims

1. A mosquito infected with a mosquito-adapted wMelCS bacterium and optionally infected with a highly infectious virus.
2. A population of mosquitoes that includes one or more mosquitoes infected with a highly infectious virus and one or more mosquitoes that comprise mosquito-adapted wMelCS bacteria.
3. A method of modifying an environment that comprises mosquitoes comprising a highly infectious virus capable of being transmitted by one or more of the mosquitoes in the environment, including the step of introducing one or more mosquitoes that comprise mosquito-adapted wMelCS bacteria into the environment to thereby modify the environment.
4. A method of modifying a mosquito population including the step of introducing one or more mosquitoes that comprise mosquito-adapted wMelCS bacteria into the mosquito population to thereby modify the mosquito population, wherein the mosquito population comprises mosquitoes that harbour a highly infectious virus capable of being transmitted by one or more mosquitoes to a vertebrate host.
5. A method of at least partly suppressing or inhibiting transmission of a highly infectious virus within a vertebrate host population having one or more individuals harbouring the highly infectious virus, including the step of introducing one or more mosquitoes that comprise mosquito-adapted wMelCS bacteria into an environment comprising the vertebrate host population to thereby at least partly suppress or inhibit transmission of the highly infectious virus within the vertebrate host population.
6. A method of at least partly preventing, reducing or eliminating a disease caused by, or associated with, a highly infectious mosquito-borne virus, said method including the step of introducing one or more mosquitoes that comprise mosquito-adapted wMelCS bacteria into an environment where the highly infectious mosquito-borne virus is, or may become, present to thereby at least partly prevent, reduce or eliminate the incidence of the disease in said environment.
7. The method of Claim 6, wherein the environment comprises a vertebrate host or host population.
8. The mosquito of Claim 1, the population of Claim 2 or the method of any one of Claim 3-8, wherein the mosquito-adapted wMelCS bacteria do not produce or elicit a substantial fitness cost to wMelCS-infected mosquitoes.
9. The mosquito, population or method of Claim 8, wherein the fitness cost includes impaired egg viability and larval development, although without limitation thereto.
10. The mosquito of Claim 1 or Claim 8, the population of Claim 2 or Claim 8 or method of any one of Claims 3-9, wherein the mosquito-adapted wMelCS-infected mosquitoes display substantially repressed or inhibited virus replication, substantially normal maternal transmission and substantially normal cytoplasmic incompatibility (CI).
11. The mosquito of any one of Claims 1 or 8-10, the population of any one of Claims 2 or 8-10 or the method of any one of Claims 3-10, wherein the mosquito is Aedes aegyptii.
12. The mosquito of any one of Claims 1 or 8-11, the population of any one of Claims 2 or 8-11 or the method of any one of Claims 3-11, wherein the virus is dengue virus, Zika virus or chikungunya virus.
13. The mosquito of any one of Claims 1 or 8-12, the population of any one of Claims 2 or 8-12 or the method of any one of Claims 3-12, wherein the highly infectious virus corresponds to, or is equivalent to, a viral load or titre in a vertebrate host that can result in a virus transmission rate to a mosquito that feeds on the vertebrate host of at least 30%.
14. The mosquito of any one of Claims 1 or 8-13, the population of any one of Claims 2 or 8-13 or the method of any one of Claims 3-13, wherein the mosquito-adapted wMelCS bacterium is Wolbachia pipientis var wMelCS deposited at the National Measurement Institute, Port Melbourne, Victoria, Australia under accession number V17/025608 on 14 November 2017.
15. A mosquito-adapted bacterium which is Wolbachia pipientis var wMelCS deposited at the National Measurement Institute, Port Melbourne, Victoria, Australia under accession number V17/025608 on 14 November 2017.
PCT/AU2018/050643 2017-06-28 2018-06-26 Mosquito-adapted bacterium against highly infectious mosquito-borne viruses Ceased WO2019000028A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
AU2017902499A AU2017902499A0 (en) 2017-06-28 Mosquito-adapted bacterium against highly infectious mosquito-borne viruses
AU2017902499 2017-06-28
AU2017904646A AU2017904646A0 (en) 2017-11-16 Mosquito-adapted bacterium against highly infectious mosquito-borne viruses
AU2017904646 2017-11-16

Publications (1)

Publication Number Publication Date
WO2019000028A1 true WO2019000028A1 (en) 2019-01-03

Family

ID=64740250

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2018/050643 Ceased WO2019000028A1 (en) 2017-06-28 2018-06-26 Mosquito-adapted bacterium against highly infectious mosquito-borne viruses

Country Status (1)

Country Link
WO (1) WO2019000028A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN118415141A (en) * 2024-05-08 2024-08-02 四川农业大学 Establishment and application of insect model of Culex pipiens infected with Tembusu virus

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110145939A1 (en) * 2009-06-17 2011-06-16 The University Of Queensland Modified arthropod and method of use
WO2013026994A1 (en) * 2011-08-24 2013-02-28 Isis Innovation Limited Mosquitoes with enhanced pathogen resistance

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110145939A1 (en) * 2009-06-17 2011-06-16 The University Of Queensland Modified arthropod and method of use
WO2013026994A1 (en) * 2011-08-24 2013-02-28 Isis Innovation Limited Mosquitoes with enhanced pathogen resistance

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
CHROSTEK, E. ET AL.: "Wolbachia Variants Induce Differential Protection to Viruses in Drosophila melanogaster: A Phenotypic and Phylogenomic Analysis", PLOS GENETICS, vol. 9, no. 12, 2013, pages el003896, XP055566364 *
FRASER J. E. ET AL.: "Novel Wolbachia-transinfected Aedes aegypti mosquitoes possess diverse fitness and vector competence phenotypes", PLOS PATHOGENS, vol. 13, no. 12, 7 December 2017 (2017-12-07), pages e1006751, XP055566373 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN118415141A (en) * 2024-05-08 2024-08-02 四川农业大学 Establishment and application of insect model of Culex pipiens infected with Tembusu virus

Similar Documents

Publication Publication Date Title
Fraser et al. Novel Wolbachia-transinfected Aedes aegypti mosquitoes possess diverse fitness and vector competence phenotypes
Van der Meulen et al. West Nile virus in the vertebrate world
Joubert et al. Establishment of a Wolbachia superinfection in Aedes aegypti mosquitoes as a potential approach for future resistance management
Bourtzis Wolbachia-based technologies for insect pest population control
Zabalou et al. Incompatible insect technique: incompatible males from a Ceratitis capitata genetic sexing strain
Mousson et al. Wolbachia modulates Chikungunya replication in Aedes albopictus
Nanthini et al. In vitro propagation of tilapia lake virus in cell lines developed from Oreochromis mossambicus
Dubey et al. Transplacental toxoplasmosis in naturally-infected white-tailed deer: Isolation and genetic characterisation of Toxoplasma gondii from foetuses of different gestational ages
Chomel et al. Bat-related zoonoses
Glover et al. Major histocompatibility complex (MHC) variation and susceptibility to the sea louse Lepeophtheirus salmonis in Atlantic salmon Salmo salar
Xi et al. Genetic control of malaria and dengue using Wolbachia
Songsangjinda et al. Current status and impact of early mortality syndrome (EMS)/acute hepatopancreatic necrosis disease (AHPND) and hepatopancreatic microsporidiosis (HPM) outbreaks on Thailand’s shrimp farming
Pocquet et al. Assessment of fitness and vector competence of a New Caledonia w Mel Aedes aegypti strain before field-release
Parvizi et al. Detection of Wolbachia pipientis, including a new strain containing the wsp gene, in two sister species of Paraphlebotomus sandflies, potential vectors of zoonotic cutaneous leishmaniasis
Degremont et al. Mortality associated with OsHV-1 in spat Crassostrea gigas: role of wild-caught spat in the horizontal transmission of the disease
WO2019000028A1 (en) Mosquito-adapted bacterium against highly infectious mosquito-borne viruses
Collet et al. A method to measure an indicator of viraemia in Atlantic salmon using a reporter cell line
Wiwatanaratanabutr et al. Impacts of temperature and crowding on sex ratio, fecundity and Wolbachia infection intensity in the copepod, Mesocyclops thermocyclopoides
Worwa et al. Comparing competitive fitness of West Nile virus strains in avian and mosquito hosts
Borzym et al. Experimental infection with epizootic haematopoietic necrosis virus (EHNV) of rainbow trout (Oncorhynchus mykiss Walbaum) and European perch (Perca fluviatilis L.)
Bourtzis Wolbachia-induced cytoplasmic incompatibility to control insect pests?
WO2020047284A1 (en) Compositions and methods for use in controlling mosquito-borne viruses
da Moura Wolbachia in medically important mosquitoes from Cape Verde: prevalence, genetic diversity and role in vector competence
Long 19 Mosquito-Borne Infections Affecting
Patil Chapter-6 Wolbachia pipientis: A Prospective Solution to Mosquito Borne Diseases

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18823775

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18823775

Country of ref document: EP

Kind code of ref document: A1