WO2018231322A1 - B cell disorder classification and susceptibity to inhibitors - Google Patents
B cell disorder classification and susceptibity to inhibitors Download PDFInfo
- Publication number
- WO2018231322A1 WO2018231322A1 PCT/US2018/025377 US2018025377W WO2018231322A1 WO 2018231322 A1 WO2018231322 A1 WO 2018231322A1 US 2018025377 W US2018025377 W US 2018025377W WO 2018231322 A1 WO2018231322 A1 WO 2018231322A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- complex
- protein
- inhibitor
- bcr
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57557—Immunoassay; Biospecific binding assay; Materials therefor for cancer of other specific parts of the body, e.g. brain
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6854—Immunoglobulins
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
Definitions
- the invention provides a method of detecting an association of a first protein and a second protein, the method comprising: (A) obtaining a sample comprising one or more B cells; (B) contacting the sample with a first antibody and a second antibody, wherein the first antibody binds the first protein and does not bind the second protein and the second antibody binds the second protein and does not bind the first protein, wherein the first antibody is of a species different than the first protein and the second antibody is of a species different than the second protein, and wherein the first antibody is of a species different than the second antibody; (C) performing a proximity ligation assay using the first antibody and the second antibody and a detectable probe to produce a PLA signal of one or more detectable puncta; (D) contacting the sample with a third antibody, wherein the third antibody binds to a protein on the B cell surface, and wherein the third antibody is labeled with a detectable label; and (E) detecting the proximity ligation
- the invention provides a method of identifying a B cell disorder having a greater probability of responding to treatment using an inhibitor, the method comprising: (a) obtaining a B cell disorder sample; (b) analyzing the sample for the presence of a protein complex, wherein the protein complex comprises two proteins, wherein each protein is a protein component of at least one of the following complexes: the BCR complex, the MYD88 complex, and the mTORCl complex, wherein the two proteins are different from one another and are components of different complexes; (b') detecting in the sample the presence of the protein complex of (b); and (c) identifying the sample having the presence of the protein complex of (b) as a B cell disorder having a greater probability of responding to treatment using an inhibitor of the BCR complex, an inhibitor of the MYD88 complex, or an inhibitor of the mTORCl complex, as compared to a sample having an absence of the protein complex of (b).
- the invention provides a method of identifying an activated B-cell-like diffuse large B cell lymphoma (ABC DLBCL) tumor having a greater probability of responding to treatment using an inhibitor of the B cell receptor (BCR) signaling pathway, the method comprising obtaining an ABC DLBCL tumor sample;
- analyzing the sample for the presence of an activated component of the BCR signaling pathway detecting in the sample the presence of an activated component of the BCR signaling pathway; and identifying the sample having the presence of an activated component of the BCR signaling pathway as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway compared to a sample having an absence of an activated component of the BCR signaling pathway.
- the invention provides a method of identifying germinal center B-cell-like diffuse large B cell lymphoma (GCB DLBCL) or Burkitt lymphoma tumor having a greater probability of responding to treatment using an inhibitor of the B cell receptor (BCR) signaling pathway proximal component LYN, SYK, or CD 19, the method comprising obtaining a GCB DLBCL tumor sample; analyzing the sample for survival dependence on LYN, SYK, or CD 19; detecting in the sample survival dependence on LYN, SYK, or CD 19; and identifying the sample having survival dependence on LYN, SYK, or CD 19 as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway proximal component LYN, SYK, or CD 19 compared to a tumor sample not detected to have a survival dependence on LYN, SYK, or CD 19.
- BCR B cell receptor
- the invention provides a method of identifying a tumor having a greater probability of responding to treatment using an inhibitor of the B cell receptor (BCR), CD45, PI3 kinase pathway, or mTOR, the method comprising obtaining a tumor sample; analyzing the sample for the presence of a complex of BCR, MYD88, and Toll-like receptor 9 (TLR9) proteins; detecting in the sample the presence of a complex of BCR, MYD88, and TLR9 proteins; and identifying the sample having the presence of a complex of BCR, MYD88, and TLR9 proteins as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR, CD45, PI3 kinase pathway, or mTOR compared to a sample having an absence of a complex of BCR, MYD88, and TLR9 proteins.
- BCR B cell receptor
- CD45 Toll-like receptor 9
- the invention provides a method of identifying a tumor having a greater probability of responding to treatment using an inhibitor of the NF- ⁇ pathway, the method comprising obtaining a tumor sample; analyzing the sample for the presence of a complex of BCR, MYD88, and Toll-like receptor 9 (TLR9) proteins; detecting in the sample the presence of a complex of BCR, MYD88, and TLR9 proteins; and identifying the sample having the presence of a complex of BCR, MYD88, and TLR9 proteins as a tumor having a greater probability of responding to treatment using an inhibitor of the NF-KB pathway compared to a sample having an absence of a complex of BCR, MYD88, and TLR9 proteins.
- TLR9 Toll-like receptor 9
- the invention provides a method of classifying a lymphoma tumor, the method comprising obtaining a lymphoma tumor sample; analyzing the sample for survival dependence on LYN, SYK, or CD19; detecting in the sample the presence of survival dependence on LYN, SYK, or CD 19; and classifying the sample as germinal center B-cell-like diffuse large ⁇ cell lymphoma (GCB DLBCL) or Burkitt lymphoma.
- GCB DLBCL germinal center B-cell-like diffuse large ⁇ cell lymphoma
- Burkitt lymphoma Burkitt lymphoma
- the invention provides a method of treating or preventing an activated B-cell-like diffuse large B cell lymphoma (ABC DLBCL) in a human subject, the method comprising administering to the subject an effective amount of an inhibitor of CD45.
- the inhibitor of CD 45 is 2-(4-acetylanilino)-3- chloronaphthoquinone.
- the inhibitor is an inhibitor of mTOR and is selected from the group of OSI-027, AZD-8055, AZD2014, SIROLIMUS, BEZ-235, and everolimus.
- the inhibitor is an inhibitor of PI3 kinase pathway and is selected from the group of IPI-145, BYL-719, BKM-120, Idelalisib, GDC-0980, and Copanlisib.
- the invention provides a method of treating or preventing a germinal center B-cell-like diffuse large B cell lymphoma (GCB DLBCL) or Burkitt lymphoma in a human subject, the method comprising administering to the subject an effective amount of an inhibitor of LY , SYK, or CD19.
- GCB DLBCL germinal center B-cell-like diffuse large B cell lymphoma
- CD19 Burkitt lymphoma
- Figure 1A presents a schematic of CRISPR-Cas9 screens in lymphoma cell lines.
- Figure IB presents graphs showing negative control (top) or positive control (bottom) sgRNAs displayed for each cell line with indicated metrics.
- Figure 1C presents graphs showing cumulative CRISPR screen scores (CSS) of selected transcription factors.
- Figures ID and IE present graphs showing cumulative CSS of significantly different genes between BCR-dependent ABC or GCB lines compared to all others.
- Figure IF is a schematic wiring diagram of pathways important to survival of DLBCL subtypes.
- Figure 2A presents graphs showing toxicity of sgRNA mediated depletion of BCR signaling genes or control RPL6. DLBCL lines were transduced and percentages of sgRNA- expressing green fluorescent (“GFP”) (GFP+) cells were monitored by FACS. GFP was normalized to day 0 and followed for two weeks. Average and SEM of replicates is displayed, n>3 [0022]
- Figure 2B presents graphs showing correlation of sgRNA toxicity 14 days post sgRNA induction with GRmax of SYK inhibitor PRT062607 or BTK inhibitor, ibrutinib four days after treatment.
- Figure 2C is a bar graph showing calculated GRmax from dose response of PRT062607 in 44 DLBCL cell lines.
- Figure 3A is graph showing DLBCL lines transduced and percentages of sgRNA- expressing (GFP+) cells monitored by FACS. GFP was normalized to day 0 and followed for two weeks; average and SEM of replicates is displayed, n>3.
- Figure 3B shows overlap and frequency of copy number gains or amplifications in 290 ABC DLBCL patients for indicated genes (top). Amplification of the UNC93B1 and CNPY3 loci in ABC DLBCL biopsies (black lines, below chromosome ideogram). Minimal shared regions are bracketed and genes displayed below (bottom).
- FIG. 3C is a dot plot showing the essential TLR9 interactome in HBL1.
- TLR9- BioID2 interactome determined by SILAC-based mass spectrometry (y-axis) plotted by the CRISPR screen score (CSS, x-axis).
- Bait (TLR9) is labeled using a square.
- Essential interactors are labeled using a labeled dot, with those interactors shared with TMD8 labeled using a circle (see Fig. 11A-C).
- Figure 3D shows gels. Lysates of indicated DLBCL cell lines were
- Figure 3E is a confocal image of PLA reaction between TLR9 and IgM counterstained with DAPI and wheat germ agglutinin (left), and normalized quantification (PLA Score) of IgM:TLR9 proximal spots, data from five independent experiments in HBL1 cells.
- White scale bar is 10 um.
- Figure 3F is a PLA image of TLR9 and MYD88 counterstained with DAPI. PLA score of IgM and TLR9 after shRNA knockdown of indicated genes, data from four experiments. White scale bar is 10 um. Statistical analysis performed using one-way ANOVA with Tukey's post test, *p ⁇ 0.05, **p ⁇ 0.01,***p ⁇ 0.001.
- Figure 5 presents a summary model of My-T-BCR signaling (left) and constitutive GC BCR signaling (right).
- Figure 6 presents a bar graph showing cumulative CRISPR screen scores (CSS) of indicated lymphoma cell lines for MCL1, BCL2, and BCL-XL (BCL2L1).
- CRISPR screen scores SCS
- Figures 7A-7G present dot plots showing correlation of genome-wide and replication CRISPR screens.
- a subset of lymphoma cell lines were rescreened with replication libraries containing approximately 10 sgRNAs targeting each of the displayed genes.
- Depletion scores of the genome-wide screen are shown on the x-axis while the z-score of the average log 2 fold change of all sgRNAs targeting a given gene is shown on the y-axis for the replication screen.
- Pearson correlations and linear regressions are displayed for each of the overlapping datasets. Genes displayed are the same as in Fig. IF.
- Figure 8 presents a bar graph showing cumulative CRISPR screen scores (CSS) displayed for indicated lymphoma cell lines from a replication screen containing
- Figures 9A-9F show toxicity profiles of lymphoma cell lines treated with
- Figure 10 presents a bar graph.
- a panel of 67 lymphoma cell lines was transduced with an shRNA targeting CD 19. Shown is the percent of live, shRNA-containing (GFP+) cells at the last time point (10-12 days) after shRNA induction normalized to the level GFP before induction (day 0). Average and SEM are displayed, n>3.
- FIG 11A shows the essential TLR9 interactome in TMD8.
- TLR9-BioID2 interactome determined by SILAC-based mass spectrometry (y-axis) plotted by the CRISPR screen score (CSS, x-axis).
- Bait (TLR9) is labeled using a square.
- Essential interactors are labeled using a labeled dot, those shared with HBL1 (see Fig. 3C) are labeled using a circle.
- Figure 1 IB is a Venn diagram of the overlap of SILAC mass spectrometry TLR9-BioID2 interactors in experiments performed in TMD8 and HBL1 ABC lines. The 47 overlapping proteins are listed.
- Figure 11C is a bar graph showing the enrichment of 47 overlapping TLR9- bioID2 proximal proteins is shown (upper) relative to their CRISPR screen score (lower). Gene names labeled in red are enriched and toxic to both HBLl and TMD8.
- Figure 12B presents gels showing ABC DLBCL cell lines HBLl and TMD8 incubated on ice with IgM or isotype control antibodies and lysed. Lysates were
- Figure 12C presents confocal images of PLA reaction between IgM and TLR9 in HBLl and TMD8 cells transduced with control SC4, CD79A or TLR9 shRNAs.
- Cells were puromycin selected and shRNAs induced with dox for two days before being fixed and imaged (left); quantification right, data from 3 separate experiments.
- One-way ANOVA and Tukey's post test **p ⁇ 0.01 ***p ⁇ 0.001 (left)
- Figure 12D presents images.
- Figure 12E shows the number of puncta per cell of IgM:TLR9 PLA quantitated. Box and whisker plots display mean and interquartile data, outliers represent 10% of total dataset, n>3.
- Figure 12F shows she data from Fig. 12E plotted as a box and whisker plot segregated by ABC (left) and GCL (right) lines. Mann- Whitney unpaired t-test **p ⁇ 0.01.
- Figure 12G shows images. To define the cytoplasmic location of the
- Figure 12H is a dot plot showing Pearson's correlation coefficients. To quantify the association between PLA signals and LAMP1 staining, the Pearson's correlation coefficients was calculated across all pixels in each imaged cell. The highest
- Figure 121 shows quantitation of IgM:TLR9 PLA signal following
- FIG. 13A is a graph showing TLR9 shRNA is rescued by overexpression of TLR9.
- HBLl cells were transduced with empty vector (EV) or wild type TLR9 expressing dsRedExpress2 vectors and then with shRNA vectors marked by GFP targeting a control (SC4), MYD88 or TLR9. The percent of double positive cells was monitored by FACS and normalized to day 0.
- Figure 13B is a heatmap of gene expression values showing the global phenocopy of MYD88-dependent genes after shRNA-mediated knockdown of TLR9 or MYD88 in HBLl at indicated time points.
- Figure 13C is a bar graph showing gene signatures enriched in downregulated genes from HBLl or TMD8 after shRNA-mediated knockdown of TLR9.
- Figure 14A shows the essential MYD88 interactome in TMD8.
- BioID interactome determined by SILAC-based mass spectrometry (y-axis) plotted by the
- CRISPR screen score (CSS, x-axis).
- Bait (MYD88) is labeled in a square.
- Essential interactors are labeled using a labeled dot, with those shared between at least two ABC lines
- Figure 14B is a bar graph showing the common MYD88 interactome. Abundance of proteins detected in two or more MYD88L265P-BIOID interactome experiments in the indicated ABC lines (upper) with their corresponding CRISPR screen scores (lower).
- Figures 14C-14F are confocal images (left) of a PLA of (C) MALT1 with MYD88 (D) CARD11 with BCL10 (E) IgM with phospho- ⁇ (F) TLR9 with phospho- ⁇ . Quantitation (right) of a normalized PLA score is shown for all cells collected in at least 3 independent experiments in HBLl ABC cells. White scale bar is 10 um. Statistical analysis performed using one-way ANOVA with Tukey's post test,*** p O.0001.
- Figure 14G shows MYD88 1 265P -BioID2 selected cells imaged with indicated antibodies, white scale bar is lOum.
- Figure 14H shows MYD88 L265P -BioID2 selected cells transduced with indicated shRNAs and BioID2 signal was measured by streptavidin binding via FACS.
- Figure 15A shows the essential MYD88 L265P interactome in HBL1. MYD88L265P -
- Figure 15B is a Venn diagram of the overlap of MYD88 L265P
- FIG. 15C shows gels. Lysates of TMD8, HBL1 and U2932 cells transduced with empty vector or MYD88 L265P -BioID2, selected and treated with 50 uM biotin for 24 hours. Lysates were prepared and immunoprecipitated with streptavidin before being immunoblotted with CARDl 1 and MYD88 antibodies.
- Figure 15E shows a confocal image (left) of a PLA of BCL 10 with MYD88. Quantitation (right) of a normalized PLA score is shown for all cells collected in at least 3 independent experiments in HBL1 ABC cells. White scale bar is 10 um. *** p ⁇ 0.0001.
- Figure 15F shows a bar graph of BCL10:MYD88 and MALTl :MYD88 PLA in ABC (left) and GCB (right) lines, Mann- Whitney unpaired t-test, **p ⁇ 0.01.
- Figure 16B is a graph showing SILAC-based mass spectrometry comparison of MYD88 L265P -BioID2 interactome in TMD8 cells treated with DMSO (x-axis) vs. 10 nM ibrutinib (y-axis). Proteins reduced upon ibrutinib treatment are shown in circles, those similarly decreased in two separate cell lines (see Fig. 17A) are labeled in circles. Bait
- FIG. 17A Venn diagraph showing overlap of proteins decreased by >30% in OCI-LylO cells (Fig. 17A) is shown as an inset.
- Figure 16C shows a graph showing synergistic killing.
- Figure 17A shows SILAC mass spectrometry comparison of MYD88 L265P -BioID2 interactome in DMSO (x-axis) vs. lOnM ibrutinib (y-axis). Proteins reduced upon ibrutinib treatment in two separate experiments (Fig. S9) are labeled in circles, while bait (MYD88) is labeled in a square.
- Figure 17B presents confocal images of mTOR, LAMP1 and MYD88 I 265P -BioID2 in the HBL1 and TMD8 ABC lines.
- Figure 17D shows ABC lines expressing MYD88i.,265P-BioID2 treated with DMSO, 10 nM ibrutinib, 200 nM AZD2014 or both for 24 hours. Intensity of the biotin signal was quantified from confocal images; n>2.
- Figure 17E shows immunoblot analysis of phospho-Serl76/180-IKK ⁇ / ⁇ , phospho-Ser371-p70S6K, phospho-Thr37/46-4E-BPl and total
- Figure 17F shows a matrix drug screen.
- Left Representative matrix viability data from a 10-fold dose titration of ibrutinib vs. the mTORCl/2 inhibitor AZD2014 in the TMD8 ABC line.
- Middle ABliss score, with negative values indicating synergy.
- Right ABliss negative sum (synergism metric) for TMD8 cells treated for the indicated times with combinations of the BTK inhibitors ibrutinib or acalabrutinib with the indicated mTOR, PI3 kinase, or chemotherapy drugs.
- Figure 17G is a graph showing TMD8 cells established as s.c. tumors in NSG mice and treated daily by i.p. injection with vehicle or BTK inhibitor ibrutinib (5 mg/kg), orally with AZD2014 (15mg/kg) twice per day or with a combination of ibrutinib and AZD2014. Mice were treated for 12 days and tumor growth was measured as a function of tumor volume (1/2 x length x width 2 ). Error bars represent SEM,
- mice per group for vehicle ibrutinib, combination
- n 9 mice per group AZD2014. ***p ⁇ 0.001, Day 12, two-way ANOVA, Tukey's post test.
- FIG 18A is a graph showing IgM:TLR9 PLA performed on an FFPE fixed tissue microarray of lymphoma cell lines. PLA puncta were quantified and plotted as the absolute number of spots per cell from at least 2 images. Cell lines are divided by putative lymphoma subtype for presentation.
- PMBL Primary Mediastinal B cell lymphoma
- HL Hodgkin lymphoma
- BPDC Blastic Plasmacytoid Dendritic Cell neoplasm
- BL Burkitt lymphoma
- MZL Marginal Zone lymphoma
- GCB Germinal Center DLBCL
- WM Waldenstrom's macroglobulinemia
- ABC Activated B cell-like DLBCL.
- Figure 18B shows representative confocal fluorescent image of a germinal center from a reactive lymph node.
- Figure 19A shows IgM:TLR9 PLA puncta per cell in ABC and GCB FFPE patient biopsies. All data were normalized to an FFPE TMD8 sample stained concurrently.
- Figure 19B shows IgM:TLR9 PLA measured in FFPE primary patient material from the indicated lymphoma types. All data were normalized to an FFPE TMD8 sample stained concurrently.
- Figure 19C shows PLA performed between IgM and TLR9 on DLBCL patient biopsy samples, shown in bright field (top) or fluorescence (bottom).
- White scale bar is 10 um.
- Figure 19D shows quantification of IgM:TLR9 PLA puncta per cell
- Figure 20A shows shRNA-mediated toxicity of indicated genes in two WM cell lines. Control (SC4), CD79A, TLR9 or MYD88 shRNAs were expressed in tandem with GFP and the relative level of GFP was followed over time by FACS. Data from 3 independent experiments.
- Figures 20B and 20C show (B) confocal images of PLA reaction between IgM and TLR9 counterstained with DAPI and wheat germ agglutinin, and (C) normalized quantification (PLA Score) of IgM:TLR9. Data from 3 independent experiments.
- White scale bar is 10 um.
- the invention provides a method of identifying an activated B-cell-like diffuse large B cell lymphoma (ABC DLBCL) tumor having a greater probability of responding to treatment using an inhibitor of the B cell receptor (BCR) signaling pathway, the method comprising obtaining an ABC DLBCL tumor sample;
- analyzing the sample for the presence of an activated component of the BCR signaling pathway detecting in the sample the presence of an activated component of the BCR signaling pathway; and identifying the sample having the presence of an activated component of the BCR signaling pathway as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway compared to a sample having an absence of an activated component of the BCR signaling pathway.
- the activated component of the BCR signaling pathway is (i) a complex of BCR, MYD88, and Toll-like receptor 9 (TLR9) proteins, (ii) CARD1 1, (iii) BCL10, (iv) MALT1, (v) IkappaB kinase (IKK) alpha, beta, or gamma subunits, (vi) phosphorylated IKK beta, (vii) IkappaB alpha, or (viii) phosphorylated IkappaB alpha, or any combination of (i) - (viii).
- TLR9 Toll-like receptor 9
- the inhibitor of the BCR signaling pathway is ibrutinib, acalabrutinib, or ONO/GS-4059. In certain embodiments, the inhibitor of the BCR signaling pathway is ibrutinib.
- an inhibitor is a substance that decreases the function or expression of a protein or the signaling of a protein in a pathway.
- An inhibitor may be a small molecule, an siRNA, an shRNA, CRISPR, an antibody, etc.
- the activated component of the BCR signaling pathway is a complex of BCR, MYD88, and Toll-like receptor 9 (TLR9) proteins. In certain embodiments, none of these proteins are mutated.
- the MYD88 protein in the complex has an L265P mutation and the CD79A or CD79B subunit of the BCR protein in the complex has an activating mutation.
- the tumor sample is a formalin-fixed and paraffin- embedded (FFPE) sample, which may be any suitable sample, e.g., derived from any type of tissue, liquid (e.g., blood, plasma, urine, etc.).
- analyzing the sample comprises performing a proximity ligation assay on the sample.
- the tumor sample is from a human.
- Proximity ligation assay signal is dependent upon the distance between two species-specific secondary antibodies that each bind to a target-specific primary antibody, where the primary antibodies are each bound to a target protein/antigen.
- the primary antibody target proteins/antigens are within tens of nanometers of one another, i.e., when the two target proteins are associated with one another (e.g., within 10 nm of each other, within 20 nm of each other, within 30 nm of each other, within 40 nm of each other, within a distance that will permit a detectable PLA signal)
- a double-stranded PCR template is formed from complementary oligos bound to the species-specific secondary antibodies.
- This double- stranded PCR template is then ligated, amplified, and detected by a probe.
- Any suitable detectable signal may be used, including, for example, an oligonucleotide probe conjugated to a detectable tag, wherein the detectable tag is a FLAG tag, a poly-histidine tag (e.g.
- a SNAP tag a Halo tag, a cMyc tag, a glutathione-S-transferase tag, an avidin tag, a biotin tag, an enzyme, a fluorescent protein, a luminescent protein, a chemiluminescent protein, a bioluminescent protein, a phosphorescent protein, use of horseradish peroxidase, etc.
- the signal is dependent upon the specificity of the primary antibodies, the distance between the two target proteins, and importantly, the absence of additional antibodies that might be bound by the oligo-bound secondary PLA antibody.
- a positive PLA signal is indicated by an increase of at least 5%, at least 10%, at least 15%, at least 20% or more in the number, size, and/or intensity of the detectable puncta compared to a PLA signal obtained from a negative control sample.
- the PLA signal can be normalized to a positive control.
- One embodiment of the invention provides co-staining with B cell-specific, fluorescently-tagged antibodies (e.g., mouse anti-CD20 labeled with Alexa488) while staining with, e.g., anti-IgM (e.g., goat) and, e.g., anti-TLR9 (e.g., rabbit).
- B cell-specific, fluorescently-tagged antibodies e.g., mouse anti-CD20 labeled with Alexa488
- anti-IgM e.g., goat
- anti-TLR9 e.g., rabbit
- the invention provides a method of treating an ABC DLBCL tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway, the method comprising identifying the tumor as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway according to a method as described herein; and administering to the tumor an effective amount of an inhibitor of the BCR signaling pathway.
- the inhibitor of the BCR signaling pathway is ibrutinib, acalabrutinib, or ONO/GS-4059.
- the inhibitor of the BCR signaling pathway is ibrutinib.
- the tumor is in a human.
- the invention provides a method of treating a human subject having an ABC DLBCL tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway, the method comprising identifying the tumor as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway according to a method as described herein; and administering to the human subject an effective amount of an inhibitor of the BCR signaling pathway.
- the inhibitor of the BCR signaling pathway is ibrutinib, acalabrutinib, or ONO/GS-4059. In certain embodiments, the inhibitor of the BCR signaling pathway is ibrutinib.
- the invention provides a method of identifying germinal center B-cell-like diffuse large B cell lymphoma (GCB DLBCL) or Burkitt lymphoma tumor having a greater probability of responding to treatment using an inhibitor of the B cell receptor (BCR) signaling pathway proximal component LYN, SYK, or CD 19, the method comprising obtaining a GCB DLBCL tumor sample; analyzing the sample for survival dependence on LYN, SYK, or CD 19; detecting in the sample survival dependence on LYN, SYK, or CD 19; and identifying the sample having survival dependence on LYN, SYK, or CD 19 as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway proximal component LYN, SYK, or CD 19 compared to a tumor sample not detected to have a survival dependence on LYN, SYK, or CD 19.
- BCR B cell receptor
- the lymphoma is a GCB DLBCL.
- the lymphoma is a Burkitt lymphoma.
- the tumor sample is a formalin-fixed and paraffin-embedded (FFPE) sample, which may be any suitable sample, e.g., derived from any type of tissue, liquid (e.g., blood, plasma, urine, etc.).
- FFPE formalin-fixed and paraffin-embedded
- the tumor sample is from a human.
- the inhibitor of the BCR signaling pathway proximal component is an inhibitor of LYN and is dasatinib or ponatinib. In certain embodiments, the inhibitor of the BCR signaling pathway proximal component is an inhibitor of SYK and is entospletinib or PRT-060318 or PRT-062607.
- the invention provides a method of treating a GCB DLBCL tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway proximal component LYN, SYK, or CD 19, the method comprising identifying the tumor as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway proximal component LYN, SYK, or CD 19 according to a method described herein; and administering to the tumor an effective amount of an inhibitor of the BCR signaling pathway proximal component LYN, SYK, or CD 19.
- the inhibitor of the BCR signaling pathway proximal component is an inhibitor of LYN and is dasatinib or ponatinib. In certain embodiments, the inhibitor of the BCR signaling pathway proximal component is an inhibitor of SYK and is entospletinib, PRT-062607, or PRT-060318. In certain embodiments, the tumor is in a human.
- the invention provides a method of treating a human subject having a GCB DLBCL tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway proximal component LYN, SYK, or CD 19, the method comprising identifying the tumor as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway proximal component LYN, SYK, or CD 19 according to a method described herein; and administering to the human subject an effective amount of an inhibitor of the BCR signaling pathway proximal component LYN, SYK, or CD19.
- the inhibitor of the BCR signaling pathway proximal component is an inhibitor of LYN and is dasatinib or ponatinib. In certain embodiments, the inhibitor of the BCR signaling pathway proximal component is an inhibitor of SYK and is entospletinib, PRT-062607, or PRT-060318.
- the invention provides a method of identifying a tumor having a greater probability of responding to treatment using an inhibitor of the B cell receptor (BCR), CD45, PI3 kinase pathway, or mTOR, the method comprising obtaining a tumor sample; analyzing the sample for the presence of a complex of BCR, MYD88, and Toll-like receptor 9 (TLR9) proteins; detecting in the sample the presence of a complex of BCR, MYD88, and TLR9 proteins; and identifying the sample having the presence of a complex of BCR, MYD88, and TLR9 proteins as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR, CD45, PI3 kinase pathway, or mTOR compared to a sample having an absence of a complex of BCR, MYD88, and TLR9 proteins.
- BCR B cell receptor
- CD45 Toll-like receptor 9
- the tumor is a lymphoma.
- the lymphoma is a diffuse large B cell lymphoma (DLBCL), a primary central nervous system lymphoma (PCNSL), or a Waldenstrom macroglobulinemia/ lympoplasmacytic lymphoma (WM/LPL).
- the DLBCL is an activated B-cell-like (ABC) DLBCL.
- the MYD88 protein in the complex has an L265P mutation and the CD79A or CD79B subunit of the BCR protein in the complex has an activating mutation.
- the tumor sample is a formalin-fixed and paraffin- embedded (FFPE) sample, which may be any suitable sample, e.g., derived from any type of tissue, liquid (e.g., blood, plasma, urine, etc.).
- analyzing the sample comprises performing a proximity ligation assay on the sample.
- the inhibitor is an inhibitor of CD45 and is 2-(4- acetylanilino)-3-chloronaphthoquinone (Perron et al., Mol. Pharm., 85: 553-63 (2014), incorporated by reference herein).
- the inhibitor is an inhibitor of mTOR and is selected from the group of OSI-027, AZD-8055, AZD2014, SIROLIMUS, BEZ-235, and everolimus.
- the inhibitor is an inhibitor of PI3 kinase pathway and is selected from the group of IPI-145, BYL-719, BKM-120, Idelalisib, GDC- 0980, and Copanlisib.
- the tumor sample is from a human.
- the invention provides a method of treating a tumor having a greater probability of responding to treatment using an inhibitor of the BCR, CD45, PI3 kinase pathway, or mTOR, the method comprising identifying the tumor as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR, CD45, PI3 kinase pathway, or mTOR according to a method described herein; and administering to the tumor an effective amount of an inhibitor of the BCR, CD45, PI3 kinase pathway, or mTOR.
- the inhibitor is an inhibitor of CD45 and is 2-(4- acetylanilino)-3-chloronaphthoquinone.
- the inhibitor is an inhibitor of mTOR and is selected from the group of OSI-027, AZD-8055, AZD2014, SIROLIMUS, BEZ-235, and everolimus.
- the inhibitor is an inhibitor of PI3 kinase pathway and is selected from the group of IPI-145, BYL-719, BKM-120, Idelalisib, GDC- 0980, and Copanlisib.
- the tumor is in a human.
- the invention provides a method of treating a human subject having a tumor having a greater probability of responding to treatment using an inhibitor of the BCR, CD45, PI3 kinase pathway, or mTOR, the method comprising identifying the tumor as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR, CD45, PI3 kinase pathway, or mTOR according to a method described herein; and administering to the human subject an effective amount of an inhibitor of the BCR, CD45, PI3 kinase pathway, or mTOR.
- the inhibitor is an inhibitor of CD45 and is 2-(4-acetylanilino)-3-chloronaphthoquinone.
- the inhibitor is an inhibitor of mTOR and is selected from the group of OSI- 027, AZD-8055, AZD2014, SIROLIMUS, BEZ-235, and everolimus.
- the inhibitor is an inhibitor of PI3 kinase pathway and is selected from the group of IPI-145, BYL-719, BKM-120, Idelalisib, GDC-0980, and Copanlisib.
- the invention provides a method of identifying a tumor having a greater probability of responding to treatment using an inhibitor of the NF-KB pathway, the method comprising obtaining a tumor sample; analyzing the sample for the presence of a complex of BCR, MYD88, and Toll-like receptor 9 (TLR9) proteins; detecting in the sample the presence of a complex of BCR, MYD88, and TLR9 proteins; and identifying the sample having the presence of a complex of BCR, MYD88, and TLR9 proteins as a tumor having a greater probability of responding to treatment using an inhibitor of the NF-KB pathway compared to a sample having an absence of a complex of BCR, MYD88, and TLR9 proteins.
- TLR9 Toll-like receptor 9
- the tumor is a lymphoma.
- the lymphoma is a diffuse large B cell lymphoma (DLBCL), a primary central nervous system lymphoma (PCNSL), or a Waldenstrom macroglobulinemia/ lympoplasmacytic lymphoma (WM/LPL).
- the DLBCL is an activated B-cell-like (ABC) DLBCL.
- ABSC activated B-cell-like DLBCL.
- none of these proteins are mutated.
- the MYD88 protein in the complex has an L265P mutation and the CD79A or CD79B subunit of the BCR protein in the complex has an activating mutation.
- the tumor sample is a formalin-fixed and paraffin- embedded (FFPE) sample, which may be any suitable sample, e.g., derived from any type of tissue, liquid (e.g., blood, plasma, urine, etc.).
- analyzing the sample comprises performing a proximity ligation assay on the sample.
- the inhibitor of the NF- ⁇ pathway is ibrutinib, acalabrutinib, or ONO/GS-4059. In certain embodiments, the inhibitor of the NF-KB pathway is ibrutinib. In certain embodiments, the tumor sample is from a human. [0108] In certain embodiments, the invention provides a method of treating a tumor having a greater probability of responding to treatment using an inhibitor of the NF-KB pathway, the method comprising identifying the tumor as a tumor having a greater probability of responding to treatment using an inhibitor of the NF- ⁇ pathway according to a method described herein; and administering to the tumor an effective amount of an inhibitor of the NF-KB pathway.
- the inhibitor of the NF- ⁇ pathway is ibrutinib, acalabrutinib, or ONO/GS-4059. In certain embodiments, the inhibitor of the NF-KB pathway is ibrutinib. In certain embodiments, the tumor is in a human.
- the invention provides a method of treating a human subject having a tumor having a greater probability of responding to treatment using an inhibitor of the NF- ⁇ pathway, the method comprising identifying the tumor as a tumor having a greater probability of responding to treatment using an inhibitor of the NF-KB pathway according to a method described herein; and administering to the human subject an effective amount of an inhibitor of the NF- ⁇ pathway.
- the inhibitor of the NF-KB pathway is ibrutinib, acalabrutinib, or ONO/GS-4059.
- the inhibitor of the NF- ⁇ pathway is ibrutinib.
- the invention provides a method of classifying a lymphoma tumor, the method comprising obtaining a lymphoma tumor sample; analyzing the sample for survival dependence on LYN, SYK, or CD 19; detecting in the sample the presence of survival dependence on LYN, SYK, or CD 19; and classifying the sample as germinal center B-cell-like diffuse large B cell lymphoma (GCB DLBCL) or Burkitt lymphoma.
- GCB DLBCL germinal center B-cell-like diffuse large B cell lymphoma
- Burkitt lymphoma Burkitt lymphoma
- the tumor sample is a formalin-fixed and paraffin- embedded (FFPE) sample, which may be any suitable sample, e.g., derived from any type of tissue, liquid (e.g., blood, plasma, urine, etc.).
- analyzing the sample comprises performing a proximity ligation assay on the sample.
- the tumor sample is from a human.
- the invention provides a method of treating or preventing an activated B-cell-like diffuse large B cell lymphoma (ABC DLBCL) in a human subject, the method comprising administering to the subject an effective amount of an inhibitor of CD45.
- the inhibitor of CD 45 is 2-(4-acetylanilino)-3- chloronaphthoquinone.
- the inhibitor is an inhibitor of mTOR and is selected from the group of OSI-027, AZD-8055, AZD2014, SIROLIMUS, BEZ-235, and everolimus.
- the inhibitor is an inhibitor of PI3 kinase pathway and is selected from the group of IPI-145, BYL-719, BKM-120, Idelalisib, GDC-0980, and Copanlisib.
- the invention provides a method of treating or preventing a germinal center B-cell-like diffuse large B cell lymphoma (GCB DLBCL) or Burkitt lymphoma in a human subject, the method comprising administering to the subject an effective amount of an inhibitor of LYN, SYK, or CD 19.
- the inhibitor of the BCR signaling pathway proximal component is an inhibitor of LYN and is dasatinib or ponatinib.
- the inhibitor of the BCR signaling pathway proximal component is an inhibitor of SYK and is entospletinib, PRT-062607, or PRT- 060318.
- the present invention provides a method of determining a CRISPR score of a gene, which method comprises
- i is an index indicating sgRNA
- j is an index indicating cell line
- Rj is the number of replicates for cell line j
- d is an index indicating time point
- Xirjd indicates the raw sequencing counts for sgRNA i, in replicate r of cell line j at time d.
- the terms "lymphoma” and "lymphoid malignancy” as used herein refer to malignant tumors derived from lymphocytes and lymphoblasts. In some embodiments, when required, the lymphoma will have My-T-BCR involvement.
- the phrase may refer to a broad lymphoma class (e.g., DLBCL, FL, MCL, etc.) or to a subtype or subgroup falling within a broad lymphoma class (e.g., GCB DLBCL, ABC DLBCL).
- lymphomas include, but are not limited to, follicular lymphoma (FL), Burkitt lymphoma (BL), mantle cell lymphoma (MCL), follicular hyperplasia (FH), small cell lymphocytic lymphoma (SLL), mucosa-associated lymphoid tissue lymphoma (MALT), splenic lymphoma, multiple myeloma, lymphoplasmacytic lymphoma, post-transplant lymphoproliferative disorder (PTLD), lymphoblastic lymphoma, nodal marginal zone lymphoma (NMZ), germinal center B cell-like diffuse large B cell lymphoma (GCB), activated B cell-like diffuse large B cell lymphoma (ABC) and primary mediastinal B cell lymphoma (PMBL), primary central nervous system lymphoma (PCNSL) and Waldenstrom's macroglobulinemia (WM).
- FL follicular lymphoma
- BL Burkitt lympho
- the inventive method can comprise analyzing a sample from a subject, such as from fresh tissue, a snap-frozen sample from a subject, or a formalin-fixed and paraffin- embedded (FFPE) sample from a subject.
- the sample may be any suitable sample, e.g., derived from any type of tissue, liquid (e.g., blood, plasma, urine, etc.).
- a snap-frozen sample from a subject means that a sample is first taken from a subject and afterwards snap-frozen
- the phrase “obtaining or providing a formalin-fixed and paraffin-embedded (FFPE) sample from the subject” means that a sample is first taken from a subject and afterwards fixed with formalin and embedded in paraffin.
- the sample may be a biopsy sample.
- lymphoma samples for example, since the tumor can be in any anatomic location, from any tissue, including, but not limited to needle cores of lymph nodes, whole lymph nodes, skin and liver.
- biopsy samples may be obtained from a patient that has been diagnosed as having a tumor, and the biopsy samples can be formalin-fixed and paraffin- embedded using protocols that are known in the art or are commercially available (see, e.g., Keirnan, J. (ed.), Histological and Histochemical Methods: Theory and Practice, 4th edition, Cold Spring Harbor Laboratory Press (2008), incorporated herein by reference.
- the invention provides an inhibitor of the NF- ⁇ pathway for use in treating a tumor having a greater probability of responding to treatment using an inhibitor of the NF- ⁇ pathway, wherein the tumor is identified as a tumor having a greater probability of responding to treatment using an inhibitor of the NF- ⁇ pathway according to methods described herein.
- the invention provides an inhibitor of the BCR, CD45, PI3 kinase pathway, or mTOR for use in treating a tumor having a greater probability of responding to treatment using an inhibitor of the BCR, CD45, PI3 kinase pathway, or mTOR, wherein the tumor is identified as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR, CD45, PI3 kinase pathway, or mTOR according to methods described herein.
- inventive methods can provide any amount of any level of treatment, inhibition, or inhibition of a protein, protein complex, or condition in a mammal.
- the treatment or prevention provided by the inventive method can include treatment or prevention of one or more conditions or symptoms of the condition, e.g., cancer, being treated or prevented.
- treatment or prevention can include promoting the regression of a tumor.
- prevention can encompass delaying the onset of the condition, or a symptom or condition thereof.
- an “effective amount” or “an amount effective to treat” refers to a dose that is adequate to prevent or treat cancer in an individual. Amounts effective for a therapeutic or prophylactic use will depend on, for example, the stage and severity of the disease or disorder being treated, the age, weight, and general state of health of the patient, and the judgment of the prescribing physician. The size of the dose will also be determined by the active selected, method of administration, timing and frequency of administration, the existence, nature, and extent of any adverse side-effects that might accompany the administration of a particular active, and the desired physiological effect. It will be appreciated by one of skill in the art that various diseases or disorders could require prolonged treatment involving multiple administrations, perhaps using the inhibitors in each or various rounds of administration.
- the subject referred to herein may be any mammal.
- the term "mammal” refers to any mammal, including, but not limited to, mammals of the order Rodentia, such as mice and hamsters, and mammals of the order Logomorpha, such as rabbits.
- the mammals may be from the order Carnivora, including Felines (cats) and Canines (dogs).
- the mammals may be from the order Artiodactyla, including Bovines (cows) and Swines (pigs) or of the order Perssodactyla, including Equines (horses).
- the mammals may be of the order Primates, Ceboids, or Simoids (monkeys) or of the order Anthropoids (humans and apes).
- the mammal is a human.
- the invention provides a method of detecting an association of a first protein and a second protein, the method comprising: (A) obtaining a sample comprising one or more B cells; (B) contacting the sample with a first antibody and a second antibody, wherein the first antibody binds the first protein and does not bind the second protein and the second antibody binds the second protein and does not bind the first protein, wherein the first antibody is of a species different than the first protein and the second antibody is of a species different than the second protein, and wherein the first antibody is of a species different than the second antibody; (C) performing a proximity ligation assay using the first antibody and the second antibody and a detectable probe to produce a PLA signal of one or more detectable puncta; (D) contacting the sample with a third antibody, wherein the third antibody binds to a protein on the B cell surface, and wherein the third antibody is labeled with a detectable label; and (E) detecting the proximity ligation
- the B cell surface protein is IgM, IgD, IgA, IgE, IgG, IgK@, IgL@, CD79A, CD79B, CD20, CD10, CD19, CD81, CR2, CD38, CD138, CD21, CD22, CD23, CD24, CD27, CD40, CD43, CD5, CD72, CD95, CD180, CD45/B220, TACI/TNFRSF 13 B , IL10RA, or IL10RB.
- a proximity ligation assay signal is utilized.
- a proximity ligation assay signal of fluorescent puncta formed from detection of two secondary antibodies, conjugated to unique complementary oligonucleotides, with specificity for different species-specific primary antibodies, such that when in proximity of less than 40 nM of one another, the conjungated oligos hybridize allowing a rolling circle DNA amplification to proceed, which can be detected by a fluorescently-labeled probe oligo
- the third antibody is fluorescently labeled.
- the first antibody and the second antibody each bind to a protein component of at least one of the following complexes: the BCR complex, the MYD88 complex, and the mTORCl complex.
- the invetion provides a method of identifying a B cell disorder having a greater probability of responding to treatment using an inhibitor, the method comprising: (a) obtaining a B cell disorder sample; (b) analyzing the sample for the presence of a protein complex, wherein the protein complex comprises two proteins, wherein each protein is a protein component of at least one of the following complexes: the BCR complex, the MYD88 complex, and the mTORCl complex, wherein the two proteins are different from one another and are components of different complexes, and wherein the analysis comprises detecting an association of the two proteins according to any suitable method described herein; and (c) identifying the sample having the presence of the protein complex of (b) as a B cell disorder having a greater probability of responding to treatment using an inhibitor of the B
- the invetion provides a method of identifying a B cell disorder having a greater probability of responding to treatment using an inhibitor, the method comprising: (a) obtaining a B cell disorder sample; (b) analyzing the sample for the presence of a protein complex, wherein the protein complex comprises two proteins, wherein each protein is a protein component of at least one of the following complexes: the BCR complex, the MYD88 complex, and the mTORCl complex, wherein the two proteins are different from one another and are components of different complexes; (b') detecting in the sample the presence of the protein complex of (b); and (c) identifying the sample having the presence of the protein complex of (b) as a B cell disorder having a greater probability of responding to treatment using an inhibitor of the BCR complex, an inhibitor of the MYD88 complex, or an inhibitor of the mTORCl complex, as compared to a sample having an absence of the protein complex of (b).
- the sample is identified as a B cell disorder having a greater probability of responding to treatment (i) using an inhibitor of the BCR complex, when the protein complex of (b) includes a protein component of the BCR complex, (ii) using an inhibitor of the MYD88 complex, when the protein complex of (b) includes a protein component of the MYD88 complex, or (iii) using an inhibitor of the mTORCl complex, when the protein complex of (b) includes a protein component of the mTORCl complex, as compared to a sample having an absence of the protein complex of (b).
- the sample is identified as a B cell disorder having a greater probability of responding to treatment (i) using an inhibitor of the BCR complex, when the protein complex of (b) includes a protein component of the BCR complex, (ii) using an inhibitor of the MYD88 complex, when the protein complex of (b) includes a protein component of the MYD88 complex, and (iii) using an inhibitor of the mTORCl complex, when the protein complex of (b) includes a protein component of the mTORCl complex, as compared to a sample having an absence of the protein complex of (b).
- B cell disorder refers to a disease or disorder characterized by aberrant or abnormal proliferation and/or function of B cells.
- B cell disorders can include autoimmune diseases, autoinflammatory diseases, cancers, immunodeficiency disorders, infectious diseases, and the like.
- the B cell disorder is diffuse large B-cell lymphoma (DLBCL); follicular lymphoma; marginal zone B-cell lymphoma (MZL) or Mucosa-Associated Lymphatic Tissue lymphoma (MALT); small lymphocytic lymphoma (also known as chronic lymphocytic leukemia, CLL); mantle cell lymphoma (MCL); DLBCL variants or sub-types of primary mediastinal (thymic) large B cell lymphoma, TDLBCL
- follicular lymphoma follicular lymphoma
- MZL marginal zone B-cell lymphoma
- MALT Mucosa-Associated Lymphatic Tissue lymphoma
- small lymphocytic lymphoma also known as chronic lymphocytic leukemia, CLL
- MCL mantle cell lymphoma
- lymphoplasmacytic lymphoma which may manifest as Waldenstrom's macroglobulinemia; nodal marginal zone B cell lymphoma (NMZL); splenic marginal zone lymphoma (SMZL); intravascular large B-cell lymphoma; primary effusion lymphoma; lymphomatoid granulomatosis; primary central nervous system lymphoma; ALK-positive large B-cell lymphoma; plasmablastic lymphoma; large B-cell lymphoma arising in HHV8- associated multicentric Castleman's disease; B-cell lymphoma, unclassifiable with features intermediate between diffuse large B-cell lymphoma and Burkitt
- the B cell disorder is a lymphoma.
- the lymphoma is a diffuse large B cell lymphoma (DLBCL), a primary central nervous system lymphoma (PCNSL), or a Waldenstrom macroglobulinemia/
- DLBCL diffuse large B cell lymphoma
- PCNSL primary central nervous system lymphoma
- the lymphoma is a DLBCL and is an activated B-cell-like (ABC) DLBCL.
- the protein complex comprises the proteins of BCR, MYD88, and mTOR.
- the B cell disorder sample is a formalin-fixed and paraffin-embedded (FFPE) sample, which may be any suitable sample, e.g., derived from any type of tissue, liquid (e.g., blood, plasma, urine, etc.).
- the inhibitor is OSI-027, AZD-8055, AZD2014, SIROLIMUS, BEZ-235, everolimus, or ibrutinib. In certain embodiments, the inhibitor is ibrutinib.
- the invention provides an inhibitor of the BCR complex, MYD88 complex, or mTORCl complex for use in treating a B cell disorder having a greater probability of responding to treatment using an inhibitor, wherein the B cell disorder is identified as a B cell disorder having a greater probability of responding to treatment using an inhibitor according to any method described herein.
- the invention provides a method of identifying a patient suffering from a B cell disorder that is responsive to treatment with one or more inhibitors comprising: (a) obtaining a sample comprising one or more B cells from the patient;
- the protein complex comprises at least two proteins, wherein each protein is a protein component of at least one of the following complexes: the BCR complex, the MYD88 complex, and the mTORCl complex, wherein each of the two proteins are different from one another and are components of different complexes, and wherein the analysis comprises detecting an association of the two proteins according to any suitable method described herein; and (c) identifying the sample having the presence of the protein complex of (b), wherein detection of the protein complex in the patient sample identifies the patient as having a greater likelihood of responsiveness to treatment with one or more inhibitors of the BCR complex, the MYD88 complex, and/or the mTORCl complex as compared to a patient in which the presence of the protein complex was not detected.
- the invention provides a method of identifying a patient suffering from a B cell disorder that is responsive to treatment with one or more inhibitors comprising: (a) obtaining a sample comprising one or more B cells from the patient;
- the protein complex comprises at least two proteins, wherein each protein is a protein component of at least one of the following complexes: the BCR complex, the MYD88 complex, and the mTORCl complex, wherein the two proteins are different from one another and are components of different complexes; (b') detecting in the sample the presence of the protein complex of (b), wherein detection of the protein complex in the patient sample identifies the patient as having a greater likelihood of responsiveness to treatment with one or more inhibitors of the BCR complex, the MYD88 complex, and/or the mTORCl complex as compared to a patient in which the presence of the protein complex was not detected.
- the My-T-BCR complex is a complex of proteins.
- the My-T-BCR complex comprises at least two different proteins, where each of these two different proteins are of at least one of the following complexes: the BCR complex, the MYD88 complex, and the mTORCl complex.
- the two proteins are of different complexes.
- a "protein A” may be from the BCR complex and a "protein B” may be from the MYD88 complex
- a protein A may be from the nTORCl complex and a protein B may be from the MYD88 complex;
- the My-T-BCR complex may comprise more than two different proteins from the BCR complex, the MYD88 complex, or the mTORCl complex.
- the My-T-BCR complex may comprise several proteins, where at least two are different such that there are several of a protein A and one of a protein B; equal numbers of a protein A and a protein B; one or more of a protein A and one or more of a protein B and one or more of a protein C, etc.
- Genes known to be involved in the BCR signaling pathway, which comprises the BCR complex include, but are not limited to, IgM, CD79A, CD79B, SYK, BTK, BLNK, PLCG2, BANK1, CARD11, BCL10, MALT1, CD22, LYN, MS4A1, PTPN1.
- Additional genes involved in the BCR signaling pathway and may be suitable for use in the methods described herein include BLK, CBL, CBLB, CD19, CD72, CD81, CR2, CSK, FYN, GRB2, HCK, LAPTM5, LASP1, LAT2, LCK, LRMP, MAP4K1, MAPK1, PRKCB, PRKCD, PTPN22, PTPN6, PTPRC, RAB3GAP2, SIGLEC10, SLA, TEC, VAV1, VAV2, VAV3.
- Genes known to be involved in the MyD88 signaling pathway include, but are not limited to, TLR9, MYD88, IRAKI, IRAK4, CNPY3, UNC93B 1, STAT3, plkBa, NFKB2.
- Additional genes involved in the MyD88 signaling pathway and may be suitable for use in the methods described herein include CHUK, cREL, 1KB KB, IKBKG, IRAK2, IRAK3, IRF3, IRF4, IRF5, IRF7, MAP3K7, NFKB 1, NFKBIA, NFKBIE, NLRP2, RELA, RELB, TAB 1, TAB2, TBK1, TIRAP, TOLLIP, TRAM, TRAF3, TRAF6, TRIF, UBE2M.
- Genes known to be involved in the mTOR signaling pathway include, but are not limited to, mTOR, LAMTOR1, LAMTOR3, FKBP4, RUVBLl, RUVBL2, MAP4K4, PIK3C3.
- Additional genes involved in the mTOR signaling pathway and may be suitable for use in the methods described herein include AKT1, AKT2, AKT3, AKT1 S1, ATP6V0A1, ATP6V0D1, ATP6V0D2, ATP6V1A, ATP6V1B2, ATP6V1E1 , ATP6V1H, FKBP1A, FKBP1B, LAMTOR2, LAMTOR4, LAMTOR5, MIOS, MLST8, NPRL2, NPRL3, PDPK1, PIK3CA, PIK3CB, PIK3CD, PIK3CG, PTEN, TSC1, TSC2, TBC1D7, RHEB, RPS6KB 1, RPS6KB2, RPTOR, RRAGA, RRAGB, RRAGC, RRAGD.
- Preferred proteins of the BCR complex include: IgM, CD79A, CD79B, SYK, BTK, BLNK, PLCG2, BANK1, CARDl l, BCL10, MALT1, CD22, LY , MS4A1, PTPN1.
- Preferred proteins of the MYD88 complex include: TLR9, MYD88, IRAKI, IRAK4, CNPY3, U C93B 1, STAT3, plkBa, NFKB2.
- Preferred proteins of the mTORCl complex include: mTOR, LAMTORl, LAMTOR3, FKBP4, RUVBLl , RUVBL2, MAP4K4, PIK3C3.
- a greater probability means an increased likelihood of an event.
- the increase may be any level of increase that is statistically significant. Mehtods of determining an increased likelihood and statistical significance are known in the art and are described herein.
- a method of identifying an activated B-cell-like diffuse large B cell lymphoma (ABC DLBCL) tumor having a greater probability of responding to treatment using an inhibitor of the B cell receptor (BCR) signaling pathway comprising:
- the activated component of the BCR signaling pathway is (i) a complex of BCR, MYD88, and Toll-like receptor 9 (TLR9) proteins, (ii) CARDl l, (iii) BCL10, (iv) MALT1, (v) IkappaB kinase (IKK) alpha, beta, or gamma subunits, (vi) phosphorpylated IKK beta, (vii) IkappaB alpha, or (viii) phosphorylated IkappaB alpha, or any combination of (i) - (viii).
- TLR9 Toll-like receptor 9
- tumor sample is a formalin-fixed and paraffin-embedded (FFPE) sample.
- FFPE formalin-fixed and paraffin-embedded
- a method of treating an ABC DLBCL tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway comprising:
- [0150] 1 The method of aspect 10, wherein the inhibitor of the BCR signaling pathway is ibrutinib, acalabrutinib, or ONO/GS-4059.
- a method of treating a human subject having an ABC DLBCL tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway comprising:
- lymphoma is a GCB DLBCL.
- lymphoma is a Burkitt lymphoma.
- tumor sample is a formalin-fixed and paraffin-embedded (FFPE) sample.
- FFPE formalin-fixed and paraffin-embedded
- inhibitor of the BCR signaling pathway proximal component is an inhibitor of SYK and is entospletinib, PRT- 062607, or PRT-060318.
- a method of identifying a tumor having a greater probability of responding to treatment using an inhibitor of the B cell receptor (BCR) or CD45 comprising:
- lymphoma is a diffuse large B cell lymphoma (DLBCL).
- DLBCL diffuse large B cell lymphoma
- DLBCL is an activated B-cell-like (ABC) DLBCL.
- a method of treating a tumor having a greater probability of responding to treatment using an inhibitor of the BCR or CD45 comprising:
- a method of treating a human subject having a tumor having a greater probability of responding to treatment using an inhibitor of the BCR or CD45 comprising: (1) identifying the tumor as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR or CD45 according to the method of any one of aspects 31-39; and
- a method of identifying a tumor having a greater probability of responding to treatment using an inhibitor of the NF- ⁇ pathway comprising:
- lymphoma is a diffuse large B cell lymphoma (DLBCL).
- DLBCL diffuse large B cell lymphoma
- tumor sample is a formalin-fixed and paraffin-embedded (FFPE) sample.
- FFPE formalin-fixed and paraffin-embedded
- a method of treating a tumor having a greater probability of responding to treatment using an inhibitor of the NF- ⁇ pathway comprising:
- a method of treating a human subject having a tumor having a greater probability of responding to treatment using an inhibitor of the NF- ⁇ pathway comprising:
- a method of classifying a lymphoma tumor comprising:
- BCR B cell receptor
- MYD88 MYD88
- TLR9 Toll-like receptor 9
- a method of classifying a lymphoma tumor comprising:
- GCB DLBCL germinal center B-cell-like diffuse large B cell lymphoma
- Burkitt lymphoma Burkitt lymphoma
- tumor sample is a formalin-fixed and paraffin-embedded (FFPE) sample.
- FFPE formalin-fixed and paraffin-embedded
- a method of treating or preventing an activated B-cell-like diffuse large B cell lymphoma (ABC DLBCL) in a human subject comprising administering to the subject an effective amount of an inhibitor of CD45.
- ABSC DLBCL activated B-cell-like diffuse large B cell lymphoma
- a method of treating or preventing a germinal center B-cell-like diffuse large B cell lymphoma (GCB DLBCL) or Burkitt lymphoma in a human subject comprising administering to the subject an effective amount of an inhibitor of LYN, SYK, or CD19.
- GCB DLBCL germinal center B-cell-like diffuse large B cell lymphoma
- CD19 Burkitt lymphoma
- a method of detecting an association of a first protein and a second protein comprising:
- A obtaining a sample comprising one or more B cells;
- B contacting the sample with a first antibody and a second antibody, wherein the first antibody binds the first protein and does not bind the second protein and the second antibody binds the second protein and does not bind the first protein, wherein the first antibody is of a species different than the first protein and the second antibody is of a species different than the second protein, and wherein the first antibody is of a species different than the second antibody;
- a method of identifying a B cell disorder having a greater probability of responding to treatment using an inhibitor comprising:
- the protein complex comprises two proteins, wherein each protein is a protein component of at least one of the following complexes: the BCR complex, the MYD88 complex, and the mTORCl complex,
- the analysis comprises detecting an association of the two proteins according to any one of aspects 72-75; and (c) identifying the sample having the presence of the protein complex of (b) as a B cell disorder having a greater probability of responding to treatment using an inhibitor of the BCR complex, an inhibitor of the MYD88 complex, or an inhibitor of the mTORCl complex, as compared to a sample having an absence of the protein complex of (b).
- a method of identifying a B cell disorder having a greater probability of responding to treatment using an inhibitor comprising:
- the protein complex comprises two proteins, wherein each protein is a protein component of at least one of the following complexes: the BCR complex, the MYD88 complex, and the mTORCl complex,
- the two proteins are different from one another and are components of different complexes
- lymphoma is a diffuse large B cell lymphoma (DLBCL), a primary central nervous system lymphoma (PCNSL), or a
- W/LPL Waldenstrom macroglobulinemia/ lympoplasmacytic lymphoma
- lymphoma is a DLBCL and is an activated B-cell-like (ABC) DLBCL.
- B cell disorder sample is a formalin-fixed and paraffin-embedded (FFPE) sample.
- FFPE formalin-fixed and paraffin-embedded
- An inhibitor of the BCR complex, MYD88 complex, or mTORCl complex for use in treating, in a subject in need thereof, a B cell disorder having a greater probability of responding to treatment using an inhibitor, wherein the B cell disorder is identified as a B cell disorder having a greater probability of responding to treatment using an inhibitor according to the method of any one of aspects 76-86.
- pRetroCMV/TO-Cas9-Hygro was created by ligating the tetracycline-inducible CMV promoter from pcDNA4/TO (Invitrogen) with Mfel/Xbal and blunt cloned into the XhoI/EcoRI digested pRetrosuper vector (Brummelkamp et al., Cancer Cell, 2: 243-247 (2002), incorporated by reference herein).
- pRetroCMV/TO was removed with Stul/Clal and replaced with PGK-hygromycin which was isolated from pMSCV Hygro (Clontech, Mountain View, CA, USA) with Agel/Hindlll and similarly cloned into pRetroCMV/TO.
- Cas9 was isolated from the LentiCrispr v2 (Addgene #52961) and blunt cloned into pRetroCMV/TO-hygro digested with Agel/BamHI.
- pCW- Cas9-Blasticidin was generated from pCW-Cas9-puro which was purchased from Addgene, Cambridge, MA, USA (#50661) and digested with BamHI and Xbal to remove the puromycin resistance gene.
- a g-block (IDT) containing the blasticidin resistance gene was Gibson cloned into the cut vector with 12 basepair overlaps.
- Cell lines were transduced multiple times with either pTO-Cas9-hygro or pCW- Cas9, selected and dilution cloned. Single cell clones were picked and tested for functional Cas9 cutting after transduction with sgRNAs targeting surface markers including CD20 or ICAMl . Clones were selected based upon loss of surface expression within the transduced population as measured by FACS 8-14 days after addition of doxycyline. sgRNA vector and cloning
- the pLKO-based sgRNA vector was purchased from Addgene (#52628).
- the puromycin gene was removed and replaced with a puro-GFP fusion protein previously described (Ngo et al., Nature, 441 : 106-110 (2006), incorporated by reference herein) using Gibson assembly.
- the resulting plasmid was digested with BfuAI and incubated with shrimp alkaline phosphatase before isolating the backbone.
- sgRNA sequences flanked by ACCG (SEQ ID NO: 1) on the 5' end, and CTTT (SEQ ID NO: 2) on the 3' of the reverse strand were annealed, diluted, and ligated into the cut vector with T4 ligase according to the manufacturer's instructions. All transformations were performed in Stbl3 bacteria and grown at 30° C.
- the library (CustomArray Inc., Bothell, WA, USA) of 74-mer of the sgRNA sequence prepended with the oligo sequence GGAAAGGACGAAACACCG (SEQ ID NO: 3) and followed by GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC (SEQ ID NO: 4).
- the oligo library was PCR amplified with Herculase II Fusion DNA polymerase (Agilent, Santa Clara, CA, USA) using ArrayF and ArrayR (Shalem et al., Science, 343: 84-87 (2014), incorporated by reference herein).
- the subsequent PCR product was gel extracted using an eGel from Invitrogen and 20ng of library was Gibson cloned into BfuAI-cut sgRNA vector following the manufacturer's instructions. Transformations were grown at 30°C overnight on 24.5cm 2 bioassay plates maintaining at least 100X coverage. Colonies were scrapped, spun and DNA was isolated with Blood and Cell Culture DNA Maxi kits (Qiagen, Hilden, Germany).
- Lentiviruses were produced in 293FT cells by cotransfecting sgRNA vectors with packaging vectors pPAX2 (Addgene #12260) and pMD2.g (Addgene #12259) in a 4:3:1 ratio in serum-free Opti-MEM.
- Trans-IT 293T (Mirus, Madison, WI, USA) was added and incubated for 15 minutes before adding dropwise to cells.
- Supernatants were harvested 24, 48, and 72 hours later, spun at lOOOg to pellet any virus producing cells and then incubated with Lenti-X concentrator (ClonTech). Virus was concentrated according to manufacturer's instructions, aliquoted and frozen.
- Virus titration was performed on target cell populations and GFP was measured 3-4 days later. When GFP was not present in the backbone of the sgRNA plasmids, transduced cells were split and incubated with or without puromycin until untransduced control cells were dead. The percentage of viable cells was then measured by FACS and percent transduction was calculated as the ratio of viable cells in treated versus untreated wells.
- sgRNA sequences were amplified using a nested PCR to first isolate the sgRNA sequence from genomic DNA and then to add nextgen sequencing adapters compatible with NextSeq500 from Illumina (San Diego, CA, USA). Products were amplified using ExTaq (Takara, Shiga, Japan) for 18 cycles in both rounds of amplification. Products were size selected using an eGel (Invitrogen) and libraries were quantitated using an Illumina specific Kapa quantification kit according to the manufacturer's instructions or by Qubit (Thermo Fisher Scientific, Waltham, MA, USA). All libraries were sequenced using a high output single-read 75 cycle read flow cell.
- Rj Number of replicates for cell line j
- Xirjd Indicates the raw sequencing counts for sgRNA i, in replicate r of cell line j at time d [0238] Step 1 : Normalize raw counts by total read counts
- Step 2 Eliminate sgRNAs with low counts across all experimental conditions by calculating
- Step 4 Z transform log-ratios
- Step 5a Average across replicates
- Step 5b Calculate signal variance for each sgRNA
- Step 6 For each gene g, let G g be the set of sgRNAs that represent it, and calculate the maximal pair wise correlation between any two sgRNAs in this set.
- i g be the index of the sgRNA representing that gene that has the highest signal variance and use that as the sole representative of gene j
- Step 7 Average the two sgRNAs which were most correlated within gene g.
- Step 8 For each calculate
- knockout was validated by flow cytometry by spinning cells down, washing in FACS buffer (PBS plus 2% (vol/vol) FBS, ImM EDTA), and stained at 4°C for 30 minutes in FACS buffer with fluorescently labeled antibodies from Biolegend, San Diego, CA, USA: mouse anti-human CD19-APC (Biolegend SJ25C1, 1 :500), mouse anti-human CD81-PE (Biolegend 5A6, 1 :500), mouse anti-human IgM-APC (MHM- 88), 1 :400); or from Southern Biotech, Birmingham, AL, USA: goat anti-human IgG-PE (1 :200).
- FACS buffer PBS plus 2% (vol/vol) FBS, ImM EDTA
- DLBCL cell lines were enumerated and 10,000 cells were seeded in triplicate in a 96-well plate in fresh media.
- Ibrutinib Selleck Chem, Houston, TX, USA
- AZD2014 AstraZeneca, Cambridge, UK
- Cells were cultured with drugs, which were replenished after 48 hours.
- Metabolic activity was measured at day 4 by adding 10 ul of MTS reagent (Promega, Madison, WI, USA) and incubating at 37°C for 4 hours. Absorbance was measured at 490 nm using a 96-well Tecan Infinite 200 Pro plate reader.
- Array elements were filtered for spot quality using Agilent Feature Extraction software, specific genes were determined to be downregulated if the log 2 fold change (comparing control shSC4 to shRNA for TLR9) was less than -0.3 for at least 3 of the 4 time points (shTLR9) per cell line.
- Gene expression data have been deposited in Gene Expression Omnibus (GEO) under accession GSE99276. Signature enrichment was performed as previously described (Ceribelli et al., Proc. Natl. Acad. Sci. USA, 1 1 1 : 1 1365-1 1370 (2014), incorporated by reference herein). Briefly, downregulated genes were tested for overlap with published gene signatures in a 2x2 contingency table using a Fisher's exact test.
- TMD8-IKBCC cell line was transduced with indicated shRNAs, puro-selected and induced with doxycycline. Cells were harvested at the indicated time points and luciferase was measured with the Dual Luciferase Reporter Assay System (Promega) on a Tecan Infinite 200 Pro plate reader.
- HBL1, TMD8, OCI-LylO and OCI-Lyl9 cells were lysed at 10 7 cells per ml in a modified RIPA buffer (0.5% Triton X-100, 0.25% deoxycholate, 0.025% SDS, 10 mM Tris, pH 8.0, 100 mM NaCl, 10 mM EDTA, 1 mM Na 3 V0 4 , 30 mM pyrophosphate, 10 mM glycerophosphate, 1 mM AEBSF, 0.02 U ml -1 aprotinin and 0.01% NaN 3 ) for 10 min. on ice. Lysates were cleared by centrifugation at 14,000xg for 20 min. at 4°C. IgM was
- DLBCL cell lines were either left untreated, treated with ⁇ ibrutinib or equivalent volumes of DMSO, or transduced with either control shRNA (SC4) or shRNAs targeting CD79A, TLR9, MYD88, CARD11, BCL10 or MALT1, followed by puromycin (Invitrogen) selection as previously described (Ngo et al., Nature, 470: 1 15-119 (201 1), incorporated by reference herein).
- Cells were plated onto a 15 well ⁇ -Slide Angiogenesis ibiTreat chamber slide (Ibidi, Martinsried, Germany) and allowed to adhere to the surface for 30 min at 37°C.
- Cells were then fixed with 4% paraformaldehyde (Electron Microscopy Sciences, Hatfield, PA, USA) for 20 min at room temperature and then washed in PBS (Invitrogen).
- Cellular membranes were labeled with 5 ⁇ g/ml wheat germ agglutinin conjugated to Alexa Fluor 488 (Thermo Fisher Scientific) for 10 min at room temperature.
- Cells were permeabilized in cold methanol for 10 min, washed in PBS and then blocked in Duolink Blocking buffer (Sigma, St. Louis, MO, USA) for 30 min at room temperature.
- Primary antibodies were diluted in Duolink Antibody Diluent (Sigma) and incubated overnight at 4°C (See Table 2).
- cells were counterstained with mouse anti-Lampl conjugated to Alexa Fluor 488 (Santa Cruz Biotechnology) with the primary antibodies. The following morning, cells were washed for 20 min in a large volume of PBS with 1% BSA, followed by addition of the appropriate Duolink secondary antibodies (Sigma), diluted and mixed according to the manufacturer's instructions. Cells were incubated for 1 hour at 37°C, after which cells were washed in TBST with 0.5% tween-20 for 10 min. Ligation and amplification steps of the PLA were performed using the Duolink in situ Detection Reagents Orange kit (Sigma) according to the manufacturer's instructions.
- FFPE formalin-fixed, paraffin-embedded
- Tissue microarrays were prepared by fixing cells in neutral buffer formalin for 24 hours, pelleting, and resuspending in an equal volume of low-melt agarose in a 10 ml conical tube. The resulting pellet was paraffin embedded by standard protocol (Hewitt, Methods in Enzymology, 410: 400-415 (2006), incorporated by reference herein). The resultant blocks were used to construct a cell line array (CMA) using the same approach used for construction of a tissue microarray, with 1.00 mm needles, using a Beecher MTA-1 instrument (Beecher Instruments, Silver Spring, MD, USA). Sample identifiers were removed and blinded before pathology review for PLA signal. Samples were called positive if the presence of >2 fluorescent puncta/cell in >25% of the malignant cells was observed. After all data were collected, sample identifiers were revealed and samples were grouped by response to ibrutinib.
- CMA cell line array
- BioID2 (Addgene #80899) was appended to the c-terminus of TLR9 and
- MYD88 L265P using Gibson cloning techniques.
- MYD88 L265P -13X-BioID2 was cloned by removing GFP from the previously described pBMN-MYD88 L265P -VD-GFP 9 by restriction digest with Stul and Notl.
- BioID2 was PCR amplified with a 13X N-terminal linker and Gibson cloned as above from Addgene #80899 with the following primers:
- BioID2 was also appended to the c-terminus of both wild type and m utant isoforms of MYD88 with a two-amino acid linker (VD).
- VD two-amino acid linker
- TLR9 was cloned into a modified version of pBMN that expresses a 10X linker followed by BioID2 with the following oligos.
- PCR products were separated on a 1% agarose gel and column purified (Qiagen). Purified PCR products were mixed and added to pBMN-LYT2 vector that was linearized with StuI (New England Biolabs, Ipswich, MA, USA) and subjected to a Gibson reaction (New England Biolabs) following the manufacturer's protocol.
- StuI New England Biolabs, Ipswich, MA, USA
- MYD88 L265P - 13X-BioID2 was retrovirally transduced into TMD8 cells, and then purified with anti-LYT2 beads as described above.
- Cells were first cultured for 16 hr in 50 ⁇ biotin. Next, cells were incubated with ⁇ g/ml goat anti-human IgM FAB conjugated to Alexa Fluor 488 (Jackson Immunoresearch) for 90 min at 37°C. During this incubation period, cells were plated onto a 15 ⁇ -Slide 8 well IbiTreat chamber slides (Ibidi) for 30 min and allowed to stick to the slides.
- TMD8 OCI-LylO and/or HBL1 cells expressing
- MYD88 L265P -13X-BioID2 were additionally transduced with either control shRNA (SC4) or shRNAs targeting CD79A, TLR9 or MYD88, as described above.
- SC4 control shRNA
- shRNAs targeting CD79A, TLR9 or MYD88 were additionally transduced with either control shRNA (SC4) or shRNAs targeting CD79A, TLR9 or MYD88, as described above.
- TLR9-10X-BioID2 pBMN-LYT2 and MYD88-13X-BioID2 pBMN-LYT2 constructs were retrovirally transduced into DLBCL cell lines, as described above. Infected cells were enriched by positive selection with LYT2 magnetic beads (Invitrogen). Cells were then grown in SILAC media, containing amino acids labeled with stable isotopes or arginine and lysine, for 2 weeks prior to expansion to lOOxlO 6 cells. 16 hours prior to lysis, biotin (Sigma) was added to a final concentration of 50 ⁇ to transduced cells.
- Lysates were then subjected to western blot analysis as described above.
- Western blots were probed with rabbit anti-CARDl 1 and rabbit anti-MALTl (Cell Signaling Technologies) and mouse anti-MYD88 (Santa Cruz Biotechnology).
- a fraction of lysates were also subjected to western blot analysis as described above.
- Western blots were probed with rabbit anti- CARDl 1 and rabbit anti-MALTl (Cell Signaling Technologies) and mouse anti-MYD88 (Santa Cruz Biotechnology).
- peptides were resuspended in sample loading buffer (2% acetonitrile and 0.05% trifluoroacetic acid) and were separated by an UltiMate 3000 RSLCnano HPLC system (Thermo Fisher Scientific) coupled online to a Q Exactive HF mass spectrometer (Thermo Fisher Scientific).
- sample loading buffer 2% acetonitrile and 0.05% trifluoroacetic acid
- UltiMate 3000 RSLCnano HPLC system Thermo Fisher Scientific
- Q Exactive HF mass spectrometer Thermo Fisher Scientific
- the precolumn was switched online to the analytical column (30cm length, 75 mm inner diameter) prepared in- house using ReproSil-Pur C 18 AQ 1.9 mm reversed phase resin (Dr. Maisch GmbH, Ammerbuch, Germany).
- Buffer A consisted of 0.1 % formic acid in H 2
- buffer B consisted of 80% acetonitrile and 0.1 % formic acid in H 2 0.
- the peptides eluted from buffer B (5 to 42 % gradient) at a flow rate of 300 nl/min over 76 min.
- the temperature of the precolumn and the analytical column was set to 50°C during the chromatography.
- the mass spectrometer was operated in a TopN data-dependent mode, where the 30 most intense precursors from survey MSI scans were selected with an isolation window of 1.6 Th for MS2 fragmentation under a normalized collision energy of 28. Only precursor ions with a charge state between 2 and 5 were selected.
- MSI scans were acquired with a mass range from 350 to 1600 m/z at a resolution of 60,000 at 200 m/z.
- MS2 scans were acquired with a starting mass of 1 10 Th at a resolution of 15,000 at 200 m/z with maximum IT of 54ms.
- AGC targets for MSI and MS2 scans were set to 1E6 and 1E5, respectively. Dynamic exclusion was set to 20 seconds.
- MS data analysis was performed using the software MaxQuant (version 1.6.0.1, Max Planck Institute of Biochemistry, Germany) linked to the UniProtKB/Swiss-Prot human database containing 155990 protein entries and supplemented with 245 frequently observed contaminants via the Andromeda search engine (Cox et al., J. Proteome Res., 10: 1794-1805 (201 1)). Precursor and fragment ion mass tolerances were set to 6 and 20 ppm after initial recalibration, respectively. Protein biotinylation, N-terminal acetylation and methionine oxidation were allowed as variable modifications. Cysteine carbamidomethylation was defined as a fixed modification.
- FDR false discovery rate
- mice were obtained from NCI Fredrick Biological Testing Branch and used for the xenograft experiments between 6-8 weeks of age.
- TMD8 tumors were established by subcutaneous injection of 10 x 10 6 cells in a 1 : 1
- Matrigel/PBS suspension Treatments were initiated when tumor volume reached a mean of 200mm 3 .
- Ibrutinib was prepared in PBS with 50% (v/v) DMSO and administered i.p. once per day (6mg/kg/day).
- AZD2014 was prepared in deionized water with 1% (v/v) Tween 80 and administered p.o. twice per day on days 0, 1, 7 and 8 (lOmg/kg/day).
- CRISPR-Cas9 screens were performed for essential genes in ABC and GCB DLBCL cell lines. These screens employed libraries of lentiviral vectors to express short guide RNAs (sgRNAs) that direct Cas9 to distinct genes, leading to their inactivation by repeated cycles of cleavage and error-prone repair.
- sgRNAs short guide RNAs
- a library of 77,441 lentiviral vectors that express sgRNAs targeting unique loci in most (19,114) protein-coding genes in the human genome was used, with approximately four sgRNAs per gene (Doench et al., Nat. Biotechnol., 34: 184-191 (2016), incorporated by reference herein).
- Cell lines were engineered to express Cas9 in a doxycycline-inducible fashion, and selected clones of each line with optimal sgRNA- mediated deletion (see above).
- ABC DLBCL three BCR-dependent and ibrutinib- sensitive lines were studied, two of which harbor both CD79B and MYD88 L265P mutations (TMD8, HBL1), and one (U2932) that lacks both mutations (Davis et al., Nature, 463: 88-92 (2010), incorporated by reference herein; and Kelly et al., J. Exp. Med., 212: 2189-2201 (2015), incorporated by reference herein).
- HLY1 BCR-independent, ibrutinib- resistant line
- GCB DLBCL four ibrutinib-resistant lines with an unknown dependence on BCR signaling (DOHH2, SUDHL4, SUDHL5, WSU-DLCL2) were studied.
- parallel screens were performed in two multiple myeloma lines (ARP1C, KMS1 1) and one T cell lymphoma line (DEL).
- CRISPR screen score For each gene in each sample, a "CRISPR screen score" (CSS) was defined that measures the effect of its CRISPR-mediated inactivation as the number of standard deviations away from the average effect of inactivating any gene (see above). Little evidence of non-specific toxicity among control, non-gene targeting sgRNAs was observed, whereas sgRNAs targeting essential genes (Hart et al., Cell, 163: 1515-1526 (2015), incorporated by reference herein) were depleted in all lines (Fig. IB). As expected from previous work (Wang et al., Science, 350: 1096-1101 (2015), incorporated by reference herein), sgRNAs targeting genomic regions with high-level amplifications were non- specifically toxic and were removed from functional analyses.
- sgRNAs depleted in the final cultures frequently targeted essential genes previously identified in CRISPR loss-of-function screens in non-lymphoma cancer cell lines (Fig. IB) (Hart et al., Cell, 163: 1515-1526 (2015), incorporated by reference herein).
- NF-KB subunits p50 NFKB 1
- REL c-Rel
- CD19 is a BCR co-receptor that participates in PI3K activation (reviewed in Fearon et al., Annu. Rev. Immunol., 13: 127-149 (1995), incorporated by reference herein). CD19 was essential in all GCB lines but behaved as a tumor suppressor in ABC lines. Given the essentiality of LYN and CD 19 in GCB DLBCL, the function of other proximal BCR components in these lines was investigated.
- Figure IF depicts the average CSS scores from the whole-genome CRISPR screens of three BCR-dependent ABC and four GCB lines in the proximal BCR, PI3K, NF- ⁇ , TLR and JAK/STAT signaling pathways.
- a validation screen using ⁇ 10 sgRNAs per gene demonstrated strong correlations between screens of overlapping cell lines (Pearson's correlation coefficients averaging 0.79; 0.68-0.84, pO.0001; Figs. 7A-7G).
- CD45 positively regulates BCR signaling during B cell development but has less effect on antigen-induced active BCR signaling (Cyster et al., Nature, 381 : 325-328 (1996), incorporated by reference herein).
- CSK another regulator of SFKs, was essential in both BCR-dependent ABC and GCB lines. While this was unexpected, given the fact that CSK inhibits SFK function in T cells
- SYK proximal BCR tyrosine kinase SYK was essential in both ABC and GCB lines, which is notable given that small molecule SYK inhibitors are in clinical trials (see below). Nonetheless, the consequences of SYK activity appear to differ between the DLBCL subtypes. SYK mediates PI3K signaling in normal B cells by several mechanisms, including direct interaction with the PI3K p85 subunit as well as phosphorylation of CD 19 and BCAP (PIK3AP1), enabling them to also recruit p85 (reviewed in Kulathu et al., Immunological Reviews, 232: 286-299 (2009), incorporated by reference herein).
- CD 19 was selectively essential in GCB lines, as was CD81, which facilitates CD 19 localization to the plasma membrane (Maecker et al., J. Exp. Med., 185: 1505-1510 (1997), incorporated by reference herein).
- PIK3AP1 was required only in BCR-dependent ABC DLBCL lines.
- CD 19 and BCAP are functionally redundant in normal mouse B cells (Aiba et al., Blood, 1 1 1 : 1497-1503 (2008), incorporated by reference herein), these results indicate that that is not the case in DLBCL and suggest that each DLBCL subtype uses a distinct mechanism to engage PI3K (Id.).
- PTEN a negative regulator of PI3K signaling, functioned as a tumor suppressor in GCB but not ABC lines, in keeping with the fact that inactivation of PTEN is a recurrent genetic event in GCB but not ABC DLBCL tumors (Lenz et al., Proc. Natl. Acad. Sci. USA, 105: 13520-13525 (2008), incorporated by reference herein; and Pfeifer et al., Proc. Natl. Acad. Sci. USA, 110: 12420-12425 (2013), incorporated by reference herein).
- BLNK is a signaling adapter that is phosphorylated by SYK and partners with BTK to form a plasma membrane-associated complex that activates NF- ⁇ .
- BLNK was selectively essential in ABC lines, in keeping with their chronic active form of BCR signaling.
- TNFAIP3 Two negative regulators of NF-KB - A20 (TNFAIP3) and its associated protein TNIP1 - behaved as tumor suppressors in ABC but not GCB lines, in keeping with the frequent inactivation of A20 by a variety of genetic and epigenetic means in ABC DLBCL tumors (Compagno et al., Nature, 459: 717-721 (2009), incorporated by reference herein).
- TNFAIP3 Two negative regulators of NF-KB - A20
- TNIP1 Two negative regulators of NF-KB - A20 (TNFAIP3) and its associated protein TNIP1 - behaved as tumor suppressors in ABC but not GCB lines, in keeping with the frequent inactivation of A20 by a variety of genetic and epigenetic means in ABC DLBCL tumors (Compagno et al., Nature, 459: 717-721 (2009), incorporated by reference herein).
- NFKBIA NFKBIA functioned as a tumor suppressor only in GCB lines, presumably because the chronic active BCR signaling in ABC DLBCL triggers ⁇ phosphorylation of ⁇ , leading to its degradation.
- a parallel means to activate NF- ⁇ in ABC DLBCL involves MYD88 and its associated kinases IRAKI and IRAK4 (Ngo et al., Nature, 470: 115-119 (2011), incorporated by reference herein), which were selectively essential in the ABC lines with MYD88 mutations (TMD8, HBL1, HLY1).
- MYD88-dependent lines further required the Toll-like receptor TLR9, and its associated chaperone proteins UNC93Bland CNPY3 (reviewed in Saitoh et al., Immunological reviews 227, 32-43 (2009), incorporated by reference herein), uncovering a new facet of MYD88-dependent NF- ⁇ activation in these lines that were examined in detail below.
- TLR9 Toll-like receptor 9
- UNC93Bland CNPY3 a new facet of MYD88-dependent NF- ⁇ activation in these lines that were examined in detail below.
- none of the other nine TLRs were found to be essential in ABC DLBCL lines (Fig. 8).
- NF- ⁇ activation by oncogenic MYD88 isoforms directs the expression of the cytokines IL-10 and IL-6 (Ngo et al., Nature, 470: 115-119 (2011), incorporated by reference herein).
- the alpha and beta subunits of the IL-10 receptor were selectively essential in ABC lines, while the components of the IL-6 receptor were not.
- the role of JAK1 and its target STAT3 in MYD88-mutant ABC DLBCL has been described recently (Rui et al., Proc. Natl. Acad. Sci. USA, 113: E7260-E7267 (2016), incorporated by reference herein), and both genes were essential in the MYD88-mutant ABC lines (Fig. IF).
- a larger set of Cas9-expressing GCB and ABC lines was transduced with vectors expressing individual sgRNAs targeting BCR pathway components along with GFP, which allowed use of GFP to track sgRNA toxicity over a two-week period by FACS.
- transduction of an sgRNA targeting the ribosomal protein RPL6 caused a time-dependent decrease in GFP+ cells in all lines (Fig. 2A).
- Genetic depletion of CD79A or SYK was toxic to five of seven ABC lines and four of six GCB lines (Fig. 2A).
- BCR-dependent ABC lines uniquely required BTK, PLCG2, CARD11 and PIK3AP1, whereas the BCR-dependent GCB lines uniquely required CD 19.
- TLR9 which coordinates MYD88 signaling in innate immune cells
- CNPY3 CNPY3 and U C93B1.
- TLR9 was the only essential TLR, and its essentiality was confined to MYD88 L265P -mutant ABC lines (Fig. 8).
- ABC tumors had recurrent single copy gains or amplifications involving MYD88 (31.0%), TLR9 (26.9%), CNPY3 (17.9%), and UNC93B1 (15.9%), and these occurred more frequently in ABC than in GCB tumors. All four genes were more highly expressed in ABC tumors, and expression correlated with copy number (Fig. 3B, Fig. 4). MYD88 and TLR9 are located -15 Mb from each other on chromosome 3, which is notable since trisomy or amplification of chromosome 3 is present in more than 25% of ABC cases.
- TLR9 To elucidate the function of TLR9 in ABC DLBCL, a fusion protein was expressed, linking TLR9 to BioID2, a promiscuous biotin ligase that biotinylates proteins within -10 nm. Biotinylated proteins in transduced HBLl and TMD8 ABC cells were purified using streptavidin and compared to proteins from control cells expressing empty vector by a SILAC -based quantitative mass spectrometry (MS) approach. To define the subset of the TLR9 interactome that is essential in ABC DLBCL, the TLR9- BioID2 enrichment of each protein was compared with its respective CRISPR CSS metric (Fig. 3C, Fig. 11A).
- TLR9-essential interactome shared by both HBLl and TMD8 cells confirmed association of TLR9 with MYD88 and CNPY3, but also revealed interactions with the BCR subunits CD79A and CD79B (Fig. 3C, Fig. 11 A-C). It was confirmed that
- IgM:TLR9 PLA signal was present across a panel of BCR-dependent ABC lines, with higher signals in double-mutant lines, whereas BCR-independent ABC and GCB lines had substantially lower signals (Fig. 12D-F).
- the IgM:TLR9 PLA signal co-localized with the endolysosomal marker LAMP1 (Fig. 12G- H), consistent with the dependence of these ABC lines on UNC93B1 and CNPY3, which facilitate entry of TLR9 into LAMPl+ endolysosomes.i 9
- Ectopic expression of TLR9, MYD88 WT or MYD88 L265P markedly increased the IgM:TLR9 PLA signal (Fig. 121), suggesting that TLR9/MYD88 copy number gains in ABC tumors may augment this signaling complex (Fig. 3B).
- MYD88 mediates TLR9-dependent NF- ⁇ activation, and accordingly, knockdown of MYD88 or TLR9 with small hairpin RNAs (shRNAs) produced similar changes in gene expression and ⁇ levels in two ABC lines with MYD88 L265P (Fig. 13A- D).
- shRNAs small hairpin RNAs
- a TLR9:MYD88 PLA produced a strong signal in the cytoplasm of ABC lines, which was diminished by knockdown of TLR9 or MYD88.
- Knockdown of CD79A also decreased the TLR9:MYD88 PLA signal, suggesting that the BCR facilitates recruitment of MYD88 to TLR9 (Fig. 3F).
- MYD88-TLR9-BCR My-T-BCR
- My-T-BCR My-T-BCR
- MYD88 L265P -BioID2 fusion protein was expressed in TMD8, HBL1 and OCI-LylO ABC cells and performed SILAC-MS analysis of MYD88-proximal biotinylated proteins.
- Proteins were identified as biotinylated in all 3 MYD88 L265P -BioID2 lines and used their corresponding CRISPR CSS scores to define the essential MYD88 interactome, which included the BCR (CD79B), mTOR, ⁇ 2, and the CBM complex (CARDl 1, MALT1) (Fig. 14A-B, Fig. 15A-B). It was confirmed that both CARDl 1 and MALT1 are biotinylated by MYD88 L265P -BioID2 in ABC cells using streptavidin pulldown and immunoblot analysis (Fig. 15C,D). Finding the CBM complex in close proximity to MYD88 was unexpected since these adaptors are thought to independently promote NF- ⁇ activation.
- MALT1 :MYD88 and BCL10:MYD88 PLAs yielded robust cytoplasmic puncta in ABC cells, confirming the association of endogenous MYD88 with the CBM complex (Fig. 14C, Fig. 15E-F).
- MYD88:MALT1 and MYD88:BCL10 puncta were reduced by knockdown of CD79A, TLR9, and CARDl 1, suggesting that BCR and TLR9 signaling cooperate to assemble MYD88 and the CBM into a supercomplex. It was further hypothesized that CBM assembly might depend not only on BCR signaling, but also, on TLR9 and MYD88. Indeed, the puncta observed using a CARDl 1 :BCL10 PLA were reduced by knockdown of TLR9 or MYD88, as well as by knockdown of CARDl 1, BCL10, and CD79A (Fig. 14D).
- NF-KB activation is closely associated with the My-T-BCR complex.
- BioID2 reduced My-T-BCR-dependent biotinylated puncta (Fig. 16A). To globally assess the influence of ibrutinib on the MYD88 interactome, SILAC-MS
- MYD88 L265P -BioID2 MYD88 L265P -BioID2
- mTOR was localized to LAMP 1 + vesicles, often in proximity to the My-T-BCR (Fig. 17B).
- PLA in three ABC lines confirmed that ibrutinib decreased the association of endogenous MYD88 with mTOR, MALT1, and BCL10 (Fig. 17C).
- Ibrutinib also decreased the association of IgM and phospho- ⁇ but had mixed effects on IgM association with TLR9.
- BioID2 the My-T-BCR was reduced following ibrutinib treatment, but was further attenuated by the addition of AZD2014, an mTORCl/2 inhibitor (Fig. 17D). Dual mTOR and BTK inhibition also cooperatively decreased MYD88 protein levels and blocked mTOR activity, as assessed by phospho-4E-BPl and phospho-S6 kinase, as well as NF-KB
- mTOR inhibitors OSI-027, AZD-8055, AZD2014, SIROLIMUS, BEZ-235, and everolimus
- PI3 kinase pathway inhibitors IPI-145, BYL-719, BKM-120, Idelalisib, GDC-
- the PLA was optimized for use in formalin-fixed and paraffin-embedded (FFPE) samples using a tissue microarray prepared from FFPE pellets of 81 lymphoma cell lines.
- FFPE formalin-fixed and paraffin-embedded
- WM macroglobulinemia
- LPL lymphoplasmacytic lymphoma
- IgM:TLR9 PLA methodology was adapted to allow the malignant lymphoma cells to be identified by anti-CD20 immunohistochemical staining (Fig. 19C).
- IgM:TLR9 PLA-positive malignant cells was significantly higher in tumors that
- CR Complete Responder
- PR Partial Responder
- SD Stable disease
- PD Progressive Disease
- the CRISPR-Cas9 genetic screens revealed two distinct modes of BCR signaling in lymphomas, which will help guide the development of therapies targeting components of the BCR pathway (Fig. 5).
- One BCR signaling mode termed herein as “constitutive GC BCR signaling,” is shared by GCB DLBCL and Burkitt lymphoma lines. This mode of signaling utilizes the BCR, CD19, and SYK to engage PI3K as its principle downstream survival pathway (including AKT and mTOR).
- the BCR- dependent GCB lines were not dependent on BTK or the NF- ⁇ pathway, thus distinguishing BCR signaling in GCB DLBCL from chronic active BCR signaling in ABC DLBCL and explaining why ibrutinib yielded only a 5% response rate among GCB DLBCL cases in a phase II clinical trial (Wilson et al., Nat. Med., 21 : 922-926 (2015), incorporated by reference herein).
- BCR signaling in GCB DLBCL resembles "tonic" BCR signaling, which sustains the survival of naive mature mouse B cells, since PI3K is the principle downstream survival mechanism engaged by the BCR in both cases (Lam et al., Cell, 90: 1073-1083 (1997), incorporated by reference herein; Kraus et al., J. Exp. Med., 194: 455-469 (2001), incorporated by reference herein; and Srinivasan et al., Cell, 139: 573-586 (2009), incorporated by reference herein).
- BCR signaling in Burkitt lymphoma was previously characterized as "tonic” based on similar considerations (Schmitz et al., Nature, 490: 116-120 (2012), incorporated by reference herein).
- certain mechanistic aspects of BCR signaling in GCB DLBCL and Burkitt lymphoma appear to be distinct from tonic BCR signaling in naive mature mouse B cells.
- the CRISPR screens revealed that GCB lines rely on the BCR co-receptor CD 19 and its associated membrane protein CD81 for survival, and similarly, knockdown of CD19 in BCR-dependent Burkitt lymphoma lines is toxic.
- CD19 _/_ mice have only a modest decrease in naive mature B cell numbers, largely due to loss of the marginal zone and B l-B subpopulations, in contrast to the dramatic loss of all mature B cells following conditional deletion of the BCR (Rickert et al, Nature, 376: 352- 355 (1995), incorporated by reference herein; and Engel et al., Immunity, 3: 39-50 (1995), incorporated by reference herein). Both CD19 _ ⁇ and CD81 -/- mice are severely impaired in their antibody responses to T cell-dependent antigens, which require a germinal center response, but responses to T cell-independent antigens are intact (Maecker et al., J. Exp.
- CD19 -/- mice do not form germinal centers upon immunization with T cell-dependent antigens (Rickert et al., Nature, 376: 352- 355 (1995), incorporated by reference herein).
- Knock-in mice lacking the CD19 tyrosine residues necessary for PI3K recruitment can support early steps in germinal center B cell formation, but the proliferation of these cells and the expansion of the germinal center are dramatically attenuated (Wang et al., Immunity, 17: 501-514 (2002), incorporated by reference herein).
- a second aspect of BCR signaling in GCB DLBCL lines that is distinct from tonic BCR signaling is the dependence of GCB lines on the kinase LYN.
- Mature B cells from LYN -/- mice are in fact increased in number and are hyperresponsive to BCR crosslinking, ultimately leading to autoimmune glomerulonephritis (Wang et al., J. Exp. Med., 184: 831- 838 (1996), incorporated by reference herein; and Hibbs et al., Cell, 83: 301-31 1 (1995), incorporated by reference herein).
- LYN -/- mice like CD19 -/- mice, fail to form germinal centers in response to T cell-dependent antigens (Kato et al., J. Immunol., 160: 4788-4795 (1998), incorporated by reference herein). It thus seems likely that the dependence of GCB lines on CD 19 and LYN reflects their required role in normal GC B cell function.
- PI3K-dependent AKT activation is a feature of normal GC B cells residing in the GC "light zone", where the B cells engage antigen on the surface of follicular dendritic cells (Sander et al., Immunity, 43: 1075-1086 (2015), incorporated by reference herein).
- BCR-dependent NF- ⁇ activation is impaired in normal GC B cells, apparently because PKC ⁇ cannot be efficiently recruited to the immune synapse on the cell surface in response to antigen engagement of the BCR (Nowosad, Nat. Immunol., 17: 870-877 (2016), incorporated by reference herein).
- the antibody response to virus-like particles containing TLR9 ligands depends on MYD88 in GC B cells (Hou et al., Immunity, 34: 375-384 (201 1), incorporated by reference herein).
- pathological B cell proliferation depends on endosomal TLR7 and/or TLR9 engaging ligands in complex self-antigens that are internalized by the BCR (Leadbetter et al., Nature, 416: 603-607 (2002), incorporated by reference herein).
- MYD88 L265P augments self-antigen-driven proliferation of mouse B cells in a TLR9-dependent fashion, especially in the presence of a Bcl2 transgene (Wang et al., J. Exp. Med., 21 1 : 413-426 (2014), incorporated by reference herein).
- a mechanistic basis is provided for cooperation between TLR9 and the BCR in the pathological survival of ABC DLBCL cells.
- the ABC lines that depend on the BCR and TLR9 form a multi-protein, My-T-BCR complex on endolysomal membranes that includes all components known to activate NF- ⁇ in ABC DLBCL.
- the My-T-BCR complex provides an unexpected nexus between distinct biochemical mechanisms that activate IKK and trigger classical NF- ⁇ signaling in lymphoma.
- BCR signaling has long been known to promote formation of the CBM complex, a large signaling assembly that recruits and activates IKK (Thome et al., Cold Spring Harbor Perspectives in Biology, 2: a003004 (2010), incorporated by reference herein; and Qiao et al., Mol. Cell, 51 : 766-779 (2013), incorporated by reference herein).
- a variety of innate immune receptors recruit MYD88, allowing it to coordinate a signalosome with IRAKI and IRAK4 that activates IKK (Lin et al., Nature, 465: 885-890 (2010), incorporated by reference herein).
- the double mutant genotype is observed in 10% of cases (Ngo et al. Nature, 470: 115-119 (201 1), incorporated by reference herein).
- the prevalence of this genotype is much higher in extranodal tumors with an ABC-like gene expression profile, such as primary central nervous system lymphoma (PCNSL), in which 37% of tumors are double mutant (Kraan et al. Leukemia, 28: 719-720 (2014), incorporated by reference herein; Chapuy et al. Blood, 127: 869-881 (2016), incorporated by reference herein; and Taniguchi et al.
- PCNSL primary central nervous system lymphoma
- the phosphatase CD45 emerges as a therapeutic target in ABC but not GCB DLBCL.
- agents targeting BCR- dependent NF- ⁇ activity - including inhibitors of BTK, PKC ⁇ , PLCy2, TAK1 (MAP3K7), and ⁇ - could be developed and evaluated in ABC but not GCB DLBCL.
- a pro-survival signaling hub termed the My-T-BCR supercomplex - that coordinates NF- ⁇ activation in DLBCL and identifies tumors that respond to therapeutic inhibition of NF- ⁇ by ibrutinib.
- This supercomplex is present in a subset of ABC DLBCL lines and tumors, but is generally absent from GCB DLBCL. Instead, GCB lines are sustained by an alternative "constitutive GC" BCR signaling mode that engages PI3K but not NF-KB (Fig. 5).
- the My-T-BCR supercomplex integrates signals from the BCR-dependent CBM complex and MYD88, which were previously thought to be parallel mechanisms to activate NF- ⁇ in ABC DLBCL.
- BCR signaling controls CBM complex formation in normal B cells, but these studies demonstrate that TLR9 and MYD88 also influence CBM assembly in ABC DLBCL. Further, it has been proposed that MYD88 mutant
- the proteogenomic study revealed a new form of molecular heterogeneity among ABC DLBCL tumors that has implications for precision medicine approaches to these often recalcitrant cancers.
- the My-T-BCR supercomplex was a feature of some, but not all, ABC DLBCL tumors. To some extent, this heterogeneity tracks with genetic
- This double-mutant genotype was previously linked to frequent responses to ibrutinib in a trial of relapsed/refractory DLBCL.
- these results suggest that analysis of the My-T-BCR could provide information regarding oncogenic pathway dependence that is complementary to tumor genetics.
- the My-T-BCR was detected in ibrutinib- responsive cases that lacked the double-mutant genotype, including one case that was wild type for MYD88, CD79B and CD79A.
- the prevalence of My-T-BCR supercomplexes in PCNSL (82% of cases) fits with their high response rate to ibrutinib (80- 90%), which can not be explained by the prevalence of the double-mutant genotype
- My-T-BCR supercomplex formation could be used to assess the mechanism of action of drug combinations in ABC DLBCL, which could help in prioritizing certain combinations for clinical evaluation.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Hematology (AREA)
- Molecular Biology (AREA)
- Urology & Nephrology (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Food Science & Technology (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
In embodiments of the invention, the invention provides methods of classifying lymphomas with respect to treatment sensitivity in order to provide better prognosis and treatment.
Description
B CELL DISORDER CLASSIFICATION AND SUSCEPTIBILITY TO INHIBITORS
CROSS-REFERENCE TO A RELATED APPLICATION
[0001] This patent application claims the benefit of U.S. Provisional Patent Application No. 62/518,994, filed June 13, 2017, which is incorporated by reference herein in its entirety.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] This invention was made with Government support under project number Z01 ZIA BC 011010 by the National Institutes of Health, National Cancer Institute. The
Government has certain rights in the invention.
INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED
ELECTRONICALLY
[0003] Incorporated by reference in its entirety herein is a computer-readable nucleotide/amino acid sequence listing submitted concurrently herewith and identified as follows: One 7,994 Byte ASCII (Text) file named "737957_ST25.txt" created on March 30, 2018.
BACKGROUND OF THE INVENTION
[0004] There is an unmet need in the art for better methods of classifying lymphomas with respect to treatment sensitivity in order to provide better prognosis and treatment. The present invention provides such methods.
BRIEF SUMMARY OF THE INVENTION
[0005] In certain embodiments, the invention provides a method of detecting an association of a first protein and a second protein, the method comprising: (A) obtaining a sample comprising one or more B cells; (B) contacting the sample with a first antibody and a second antibody, wherein the first antibody binds the first protein and does not bind the second protein and the second antibody binds the second protein and does not bind the first protein, wherein the first antibody is of a species different than the first protein and the second antibody is of a species different than the second protein, and wherein the first
antibody is of a species different than the second antibody; (C) performing a proximity ligation assay using the first antibody and the second antibody and a detectable probe to produce a PLA signal of one or more detectable puncta; (D) contacting the sample with a third antibody, wherein the third antibody binds to a protein on the B cell surface, and wherein the third antibody is labeled with a detectable label; and (E) detecting the proximity ligation assay signal of (C) wherein a positive PLA signal indicates association of the first and second proteins in one or more of the B cells comprised in the sample. The items (C) and (D) may be performed in any order or simultaneously.
[0006] In certain embodiments, the invention provides a method of identifying a B cell disorder having a greater probability of responding to treatment using an inhibitor, the method comprising: (a) obtaining a B cell disorder sample; (b) analyzing the sample for the presence of a protein complex, wherein the protein complex comprises two proteins, wherein each protein is a protein component of at least one of the following complexes: the BCR complex, the MYD88 complex, and the mTORCl complex, wherein the two proteins are different from one another and are components of different complexes; (b') detecting in the sample the presence of the protein complex of (b); and (c) identifying the sample having the presence of the protein complex of (b) as a B cell disorder having a greater probability of responding to treatment using an inhibitor of the BCR complex, an inhibitor of the MYD88 complex, or an inhibitor of the mTORCl complex, as compared to a sample having an absence of the protein complex of (b).
[0007] In certain embodiments, the invention provides a method of identifying an activated B-cell-like diffuse large B cell lymphoma (ABC DLBCL) tumor having a greater probability of responding to treatment using an inhibitor of the B cell receptor (BCR) signaling pathway, the method comprising obtaining an ABC DLBCL tumor sample;
analyzing the sample for the presence of an activated component of the BCR signaling pathway; detecting in the sample the presence of an activated component of the BCR signaling pathway; and identifying the sample having the presence of an activated component of the BCR signaling pathway as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway compared to a sample having an absence of an activated component of the BCR signaling pathway.
[0008] In certain embodiments, the invention provides a method of identifying germinal center B-cell-like diffuse large B cell lymphoma (GCB DLBCL) or Burkitt lymphoma tumor having a greater probability of responding to treatment using an inhibitor of the B cell
receptor (BCR) signaling pathway proximal component LYN, SYK, or CD 19, the method comprising obtaining a GCB DLBCL tumor sample; analyzing the sample for survival dependence on LYN, SYK, or CD 19; detecting in the sample survival dependence on LYN, SYK, or CD 19; and identifying the sample having survival dependence on LYN, SYK, or CD 19 as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway proximal component LYN, SYK, or CD 19 compared to a tumor sample not detected to have a survival dependence on LYN, SYK, or CD 19.
[0009] In certain embodiments, the invention provides a method of identifying a tumor having a greater probability of responding to treatment using an inhibitor of the B cell receptor (BCR), CD45, PI3 kinase pathway, or mTOR, the method comprising obtaining a tumor sample; analyzing the sample for the presence of a complex of BCR, MYD88, and Toll-like receptor 9 (TLR9) proteins; detecting in the sample the presence of a complex of BCR, MYD88, and TLR9 proteins; and identifying the sample having the presence of a complex of BCR, MYD88, and TLR9 proteins as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR, CD45, PI3 kinase pathway, or mTOR compared to a sample having an absence of a complex of BCR, MYD88, and TLR9 proteins.
[0010] In certain embodiments, the invention provides a method of identifying a tumor having a greater probability of responding to treatment using an inhibitor of the NF-κΒ pathway, the method comprising obtaining a tumor sample; analyzing the sample for the presence of a complex of BCR, MYD88, and Toll-like receptor 9 (TLR9) proteins; detecting in the sample the presence of a complex of BCR, MYD88, and TLR9 proteins; and identifying the sample having the presence of a complex of BCR, MYD88, and TLR9 proteins as a tumor having a greater probability of responding to treatment using an inhibitor of the NF-KB pathway compared to a sample having an absence of a complex of BCR, MYD88, and TLR9 proteins.
[0011] In certain embodiments, the invention provides a method of classifying a lymphoma tumor, the method comprising obtaining a lymphoma tumor sample; analyzing the sample for survival dependence on LYN, SYK, or CD19; detecting in the sample the presence of survival dependence on LYN, SYK, or CD 19; and classifying the sample as germinal center B-cell-like diffuse large Β cell lymphoma (GCB DLBCL) or Burkitt lymphoma.
[0012] In certain embodiments, the invention provides a method of treating or preventing an activated B-cell-like diffuse large B cell lymphoma (ABC DLBCL) in a human subject,
the method comprising administering to the subject an effective amount of an inhibitor of CD45. In certain embodiments, the inhibitor of CD 45 is 2-(4-acetylanilino)-3- chloronaphthoquinone. In certain embodiments, the inhibitor is an inhibitor of mTOR and is selected from the group of OSI-027, AZD-8055, AZD2014, SIROLIMUS, BEZ-235, and everolimus. In certain embodiments, the inhibitor is an inhibitor of PI3 kinase pathway and is selected from the group of IPI-145, BYL-719, BKM-120, Idelalisib, GDC-0980, and Copanlisib.
[0013] In certain embodiments, the invention provides a method of treating or preventing a germinal center B-cell-like diffuse large B cell lymphoma (GCB DLBCL) or Burkitt lymphoma in a human subject, the method comprising administering to the subject an effective amount of an inhibitor of LY , SYK, or CD19.
[0014] Additional embodiments are described herein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0015] The accompanying drawings, which are incorporated into and form a part of the specification, illustrate several embodiments of the present invention and, together with the description, serve to explain the principles of the invention. The drawings are only for the purpose of illustrating (an) embodiment(s) of the invention and are not to be construed as limiting the invention.
[0016] Figure 1A presents a schematic of CRISPR-Cas9 screens in lymphoma cell lines.
[0017] Figure IB presents graphs showing negative control (top) or positive control (bottom) sgRNAs displayed for each cell line with indicated metrics.
[0018] Figure 1C presents graphs showing cumulative CRISPR screen scores (CSS) of selected transcription factors.
[0019] Figures ID and IE present graphs showing cumulative CSS of significantly different genes between BCR-dependent ABC or GCB lines compared to all others.
[0020] Figure IF is a schematic wiring diagram of pathways important to survival of DLBCL subtypes.
[0021] Figure 2A presents graphs showing toxicity of sgRNA mediated depletion of BCR signaling genes or control RPL6. DLBCL lines were transduced and percentages of sgRNA- expressing green fluorescent ("GFP") (GFP+) cells were monitored by FACS. GFP was normalized to day 0 and followed for two weeks. Average and SEM of replicates is displayed, n>3
[0022] Figure 2B presents graphs showing correlation of sgRNA toxicity 14 days post sgRNA induction with GRmax of SYK inhibitor PRT062607 or BTK inhibitor, ibrutinib four days after treatment.
[0023] Figure 2C is a bar graph showing calculated GRmax from dose response of PRT062607 in 44 DLBCL cell lines.
[0024] Figure 3A is graph showing DLBCL lines transduced and percentages of sgRNA- expressing (GFP+) cells monitored by FACS. GFP was normalized to day 0 and followed for two weeks; average and SEM of replicates is displayed, n>3.
[0025] Figure 3B shows overlap and frequency of copy number gains or amplifications in 290 ABC DLBCL patients for indicated genes (top). Amplification of the UNC93B1 and CNPY3 loci in ABC DLBCL biopsies (black lines, below chromosome ideogram). Minimal shared regions are bracketed and genes displayed below (bottom).
[0026] Figure 3C is a dot plot showing the essential TLR9 interactome in HBL1. TLR9- BioID2 interactome determined by SILAC-based mass spectrometry (y-axis) plotted by the CRISPR screen score (CSS, x-axis). Bait (TLR9) is labeled using a square. Essential interactors are labeled using a labeled dot, with those interactors shared with TMD8 labeled using a circle (see Fig. 11A-C).
[0027] Figure 3D shows gels. Lysates of indicated DLBCL cell lines were
immunoprecipitated with anti-IgM or isotype control antibodies before being immunoblotted with TLR9 or IgM antibodies, representative blot; n=3.
[0028] Figure 3E is a confocal image of PLA reaction between TLR9 and IgM counterstained with DAPI and wheat germ agglutinin (left), and normalized quantification (PLA Score) of IgM:TLR9 proximal spots, data from five independent experiments in HBL1 cells. White scale bar is 10 um. Statistical analysis performed using one-way ANOVA with Tukey's post test, *p<0.05, **p<0.01,***p<0.001.
[0029] Figure 3F is a PLA image of TLR9 and MYD88 counterstained with DAPI. PLA score of IgM and TLR9 after shRNA knockdown of indicated genes, data from four experiments. White scale bar is 10 um. Statistical analysis performed using one-way ANOVA with Tukey's post test, *p<0.05, **p<0.01,***p<0.001.
[0030] Figure 4 presents dot plots showing gene expression values (Log2 FPKM) values of MYD88 are shown by DLBCL subtype, ABC (n=294), GCB (n=164)
and unclassified (Unc) (n=l 15). Gene expression data were correlated with DNA
copy number and linear regression calculated for ABC samples (right). One-way
ANOVA and Tukey's post test *p< 0.05 ***p< 0.001 (left), linear regression *p< 0.05, ***p<0.0001 (right).
[0031] Figure 5 presents a summary model of My-T-BCR signaling (left) and constitutive GC BCR signaling (right).
[0032] Figure 6 presents a bar graph showing cumulative CRISPR screen scores (CSS) of indicated lymphoma cell lines for MCL1, BCL2, and BCL-XL (BCL2L1).
[0033] Figures 7A-7G present dot plots showing correlation of genome-wide and replication CRISPR screens. A subset of lymphoma cell lines were rescreened with replication libraries containing approximately 10 sgRNAs targeting each of the displayed genes. Depletion scores of the genome-wide screen are shown on the x-axis while the z-score of the average log2 fold change of all sgRNAs targeting a given gene is shown on the y-axis for the replication screen. Pearson correlations and linear regressions are displayed for each of the overlapping datasets. Genes displayed are the same as in Fig. IF.
[0034] Figure 8 presents a bar graph showing cumulative CRISPR screen scores (CSS) displayed for indicated lymphoma cell lines from a replication screen containing
approximately 10 sgRNAs targeting each of the indicated TLR family genes.
[0035] Figures 9A-9F show toxicity profiles of lymphoma cell lines treated with
PRT062607. ABC and GCB cell lines were counted, plated and treated with various doses of the SYK inhibitor, PRT062607, or DMSO control. MTS assays were performed after plating and again four days later to monitor growth inhibition. Normalized MTS readings were used to calculate the GRmetrics (see methods) and GR value was plotted against PRT062607 dose. Results are grouped by DLBCL subtype and GRmax values.
[0036] Figure 10 presents a bar graph. A panel of 67 lymphoma cell lines was transduced with an shRNA targeting CD 19. Shown is the percent of live, shRNA-containing (GFP+) cells at the last time point (10-12 days) after shRNA induction normalized to the level GFP before induction (day 0). Average and SEM are displayed, n>3.
[0037] Figure 11A shows the essential TLR9 interactome in TMD8. TLR9-BioID2 interactome determined by SILAC-based mass spectrometry (y-axis) plotted by the CRISPR screen score (CSS, x-axis). Bait (TLR9) is labeled using a square. Essential interactors are labeled using a labeled dot, those shared with HBL1 (see Fig. 3C) are labeled using a circle.
[0038] Figure 1 IB is a Venn diagram of the overlap of SILAC mass spectrometry TLR9-BioID2 interactors in experiments performed in TMD8 and HBL1 ABC lines. The 47 overlapping proteins are listed.
[0039] Figure 11C is a bar graph showing the enrichment of 47 overlapping TLR9- bioID2 proximal proteins is shown (upper) relative to their CRISPR screen score (lower). Gene names labeled in red are enriched and toxic to both HBLl and TMD8.
[0040] Figure 12 A presents gels showing whole cell lysates of indicated DLBCL cell lines immunoprecipitated with anti-IgM or isotype control antibodies before being immunoblotted with IgM or indicated TLR antibodies, representative blots, n=3.
[0041] Figure 12B presents gels showing ABC DLBCL cell lines HBLl and TMD8 incubated on ice with IgM or isotype control antibodies and lysed. Lysates were
immunoprecipitated (plasma membrane) with IgM or isotype control. Unbound lysates (cytosolic) were then immunoprecipitated with IgM or isotype control antibodies before all IP lysates were immunoblotted with indicated antibodies, representative blots, n=2.
[0042] Figure 12C presents confocal images of PLA reaction between IgM and TLR9 in HBLl and TMD8 cells transduced with control SC4, CD79A or TLR9 shRNAs. Cells were puromycin selected and shRNAs induced with dox for two days before being fixed and imaged (left); quantification right, data from 3 separate experiments. One-way ANOVA and Tukey's post test **p< 0.01 ***p< 0.001 (left)
[0043] Figure 12D presents images. An IgM:TLR9 PLA was performed in a panel of ABC and GCB DLBCL cell lines and the presence of chronic active BCR signaling (+ = present), MYD88 mutational status and IgH isotype (μ=¾Μ, y=IgG).
[0044] Figure 12E shows the number of puncta per cell of IgM:TLR9 PLA quantitated. Box and whisker plots display mean and interquartile data, outliers represent 10% of total dataset, n>3.
[0045] Figure 12F shows she data from Fig. 12E plotted as a box and whisker plot segregated by ABC (left) and GCL (right) lines. Mann- Whitney unpaired t-test **p< 0.01.
[0046] Figure 12G shows images. To define the cytoplasmic location of the
BCR-TLR9 interaction, ABC cells were counterstained for LAMP1, a marker of late endolysosomes, where TLR9 resides, and PLA was performed between IgM:TLR9, IgM : LAMP 1 and IgM:SYK.
[0047] Figure 12H is a dot plot showing Pearson's correlation coefficients. To quantify the association between PLA signals and LAMP1 staining, the Pearson's correlation coefficients was calculated across all pixels in each imaged cell. The highest
correlation was between an IgM:LAMPl PLA and LAMP1 staining (R=0.471), whereas the correlation between an IgM:SYK PLA signal and LAMP1 was much lower
(R=0.153). The correlation between the IgM:TLR9 PLA signal and LAMP1 staining was intermediate (R=0.310), indicating that a significant component of the IgM:TLR9 interaction is in LAMP 1+ vesicles.
[0048] Figure 121 shows quantitation of IgM:TLR9 PLA signal following
ectopic expression of either empty vector, TLR9, wild type MYD88 or MYD88L265P.
[0049] Figure 13A is a graph showing TLR9 shRNA is rescued by overexpression of TLR9. HBLl cells were transduced with empty vector (EV) or wild type TLR9 expressing dsRedExpress2 vectors and then with shRNA vectors marked by GFP targeting a control (SC4), MYD88 or TLR9. The percent of double positive cells was monitored by FACS and normalized to day 0.
[0050] Figure 13B is a heatmap of gene expression values showing the global phenocopy of MYD88-dependent genes after shRNA-mediated knockdown of TLR9 or MYD88 in HBLl at indicated time points.
[0051] Figure 13C is a bar graph showing gene signatures enriched in downregulated genes from HBLl or TMD8 after shRNA-mediated knockdown of TLR9.
[0052] Figure 13D is a bar graph showing normalized ΙκΒα-luciferase reporter levels at indicated time points after knockdown of TLR9 with indicated shRNAs; n=3.
[0053] Figure 14A shows the essential MYD88 interactome in TMD8. MYD88L265P-
BioID interactome determined by SILAC-based mass spectrometry (y-axis) plotted by the
CRISPR screen score (CSS, x-axis). Bait (MYD88) is labeled in a square. Essential interactors are labeled using a labeled dot, with those shared between at least two ABC lines
(see Fig. 15) are labeled in a circle.
[0054] Figure 14B is a bar graph showing the common MYD88 interactome. Abundance of proteins detected in two or more MYD88L265P-BIOID interactome experiments in the indicated ABC lines (upper) with their corresponding CRISPR screen scores (lower).
[0055] Figures 14C-14F are confocal images (left) of a PLA of (C) MALT1 with MYD88 (D) CARD11 with BCL10 (E) IgM with phospho-ΙκΒα (F) TLR9 with phospho- ΙκΒα. Quantitation (right) of a normalized PLA score is shown for all cells collected in at least 3 independent experiments in HBLl ABC cells. White scale bar is 10 um. Statistical analysis performed using one-way ANOVA with Tukey's post test,*** p O.0001.
[0056] Figure 14G shows MYD881 265P-BioID2 selected cells imaged with indicated antibodies, white scale bar is lOum.
[0057] Figure 14H shows MYD88L265P-BioID2 selected cells transduced with indicated shRNAs and BioID2 signal was measured by streptavidin binding via FACS.
[0058] Figure 15A shows the essential MYD88L265P interactome in HBL1. MYD88L265P -
BioID2 interactome from SILAC-based mass spectrometry (y-axis) plotted by the CRISPR screen score (CSS, x-axis). Bait (MYD88) is labeled in a square. Essential interactors are a labeled dot, with those shared with either TMD8 or OCI-Lyl O labeled in a circle.
[0059] Figure 15B is a Venn diagram of the overlap of MYD88L265P
-BioID2 interactors in TMD8, OCI-LylO and HBL1 ABC lines. Proteins found in two or more experiments are listed.
[0060] Figure 15C shows gels. Lysates of TMD8, HBL1 and U2932 cells transduced with empty vector or MYD88L265P -BioID2, selected and treated with 50 uM biotin for 24 hours. Lysates were prepared and immunoprecipitated with streptavidin before being immunoblotted with CARDl 1 and MYD88 antibodies.
[0061] Figure 15D shows gels. Lysates of TMD8 cells transduced with empty vector, MYD88L265P or wild type (WT) BioID2-fusion proteins, selected and treated with 50 uM biotin for 24 hours. Lysates were prepared and immunoprecipitated with streptavidin before being immunoblotted with CARDl 1, MALT 1 or MYD88 antibodies; representative blot; n=3.
[0062] Figure 15E shows a confocal image (left) of a PLA of BCL 10 with MYD88. Quantitation (right) of a normalized PLA score is shown for all cells collected in at least 3 independent experiments in HBL1 ABC cells. White scale bar is 10 um. *** p <0.0001.
[0063] Figure 15F shows a bar graph of BCL10:MYD88 and MALTl :MYD88 PLA in ABC (left) and GCB (right) lines, Mann- Whitney unpaired t-test, **p< 0.01.
[0064] Figure 16A is a bar graph showing ABC lines expressing MYD881 265P-BioID2 treated with DMSO or 10 nM ibrutinib for 24 hours, and the numbers of biotin puncta were quantified from confocal images (representative experiment, n=3).
[0065] Figure 16B is a graph showing SILAC-based mass spectrometry comparison of MYD88L265P -BioID2 interactome in TMD8 cells treated with DMSO (x-axis) vs. 10 nM ibrutinib (y-axis). Proteins reduced upon ibrutinib treatment are shown in circles, those similarly decreased in two separate cell lines (see Fig. 17A) are labeled in circles. Bait
(MYD88L265P) is labeled in a square. Venn diagraph showing overlap of proteins decreased by >30% in OCI-LylO cells (Fig. 17A) is shown as an inset.
[0066] Figure 16C shows a graph showing synergistic killing.
[0067] Figure 17A shows SILAC mass spectrometry comparison of MYD88L265P-BioID2 interactome in DMSO (x-axis) vs. lOnM ibrutinib (y-axis). Proteins reduced upon ibrutinib treatment in two separate experiments (Fig. S9) are labeled in circles, while bait (MYD88) is labeled in a square.
[0068] Figure 17B presents confocal images of mTOR, LAMP1 and MYD88I 265P-BioID2 in the HBL1 and TMD8 ABC lines.
[0069] Figure 17C shows quantitation of normalized PLA score for the indicated PLA pairs shown for ABC lines treated with DMSO or 10 nM ibrutinib, n=3
independent experiments.
[0070] Figure 17D shows ABC lines expressing MYD88i.,265P-BioID2 treated with DMSO, 10 nM ibrutinib, 200 nM AZD2014 or both for 24 hours. Intensity of the biotin signal was quantified from confocal images; n>2.
[0071] Figure 17E shows immunoblot analysis of phospho-Serl76/180-IKKα/β, phospho-Ser371-p70S6K, phospho-Thr37/46-4E-BPl and total
MYD88 in HBL1 and TMD8 cells treated with either ibrutinib (10 nM), AZD2014 (200 nM) or both drugs in combination for 24 hours.
[0072] Figure 17F shows a matrix drug screen. Left: Representative matrix viability data from a 10-fold dose titration of ibrutinib vs. the mTORCl/2 inhibitor AZD2014 in the TMD8 ABC line. Middle: ABliss score, with negative values indicating synergy. Right: ABliss negative sum (synergism metric) for TMD8 cells treated for the indicated times with combinations of the BTK inhibitors ibrutinib or acalabrutinib with the indicated mTOR, PI3 kinase, or chemotherapy drugs.
[0073] Figure 17G is a graph showing TMD8 cells established as s.c. tumors in NSG mice and treated daily by i.p. injection with vehicle or BTK inhibitor ibrutinib (5 mg/kg), orally with AZD2014 (15mg/kg) twice per day or with a combination of ibrutinib and AZD2014. Mice were treated for 12 days and tumor growth was measured as a function of tumor volume (1/2 x length x width2). Error bars represent SEM,
n=10 mice per group for vehicle, ibrutinib, combination, n=9 mice per group AZD2014. ***p<0.001, Day 12, two-way ANOVA, Tukey's post test.
[0074] Figure 18A is a graph showing IgM:TLR9 PLA performed on an FFPE fixed tissue microarray of lymphoma cell lines. PLA puncta were quantified and plotted as the absolute number of spots per cell from at least 2 images. Cell lines are divided by putative lymphoma subtype for presentation. PMBL = Primary Mediastinal B cell
lymphoma, HL = Hodgkin lymphoma, BPDC = Blastic Plasmacytoid Dendritic Cell neoplasm, BL = Burkitt lymphoma, MZL = Marginal Zone lymphoma, GCB = Germinal Center DLBCL, WM = Waldenstrom's macroglobulinemia, ABC = Activated B cell-like DLBCL.
[0075] Figure 18B shows representative confocal fluorescent image of a germinal center from a reactive lymph node.
[0076] Figure 19A shows IgM:TLR9 PLA puncta per cell in ABC and GCB FFPE patient biopsies. All data were normalized to an FFPE TMD8 sample stained concurrently.
[0077] Figure 19B shows IgM:TLR9 PLA measured in FFPE primary patient material from the indicated lymphoma types. All data were normalized to an FFPE TMD8 sample stained concurrently.
[0078] Figure 19C shows PLA performed between IgM and TLR9 on DLBCL patient biopsy samples, shown in bright field (top) or fluorescence (bottom). White scale bar is 10 um.
[0079] Figure 19D shows quantification of IgM:TLR9 PLA puncta per cell
from confocal images of DLBCL FFPE patient biopsy samples. Patients were grouped by ibrutinib response: Responders (left, CR, PR, SD) included 3 ABC and 1 unclassified patient, Non-Responders (right, PD,) included 3 ABC, and 1 GCB patient.
[0080] Figure 20A shows shRNA-mediated toxicity of indicated genes in two WM cell lines. Control (SC4), CD79A, TLR9 or MYD88 shRNAs were expressed in tandem with GFP and the relative level of GFP was followed over time by FACS. Data from 3 independent experiments.
[0081] Figures 20B and 20C show (B) confocal images of PLA reaction between IgM and TLR9 counterstained with DAPI and wheat germ agglutinin, and (C) normalized quantification (PLA Score) of IgM:TLR9. Data from 3 independent experiments. White scale bar is 10 um.
DETAILED DESCRIPTION OF THE INVENTION
[0082] In certain embodiments, the invention provides a method of identifying an activated B-cell-like diffuse large B cell lymphoma (ABC DLBCL) tumor having a greater probability of responding to treatment using an inhibitor of the B cell receptor (BCR) signaling pathway, the method comprising obtaining an ABC DLBCL tumor sample;
analyzing the sample for the presence of an activated component of the BCR signaling
pathway; detecting in the sample the presence of an activated component of the BCR signaling pathway; and identifying the sample having the presence of an activated component of the BCR signaling pathway as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway compared to a sample having an absence of an activated component of the BCR signaling pathway.
[0083] In certain embodiments, the activated component of the BCR signaling pathway is (i) a complex of BCR, MYD88, and Toll-like receptor 9 (TLR9) proteins, (ii) CARD1 1, (iii) BCL10, (iv) MALT1, (v) IkappaB kinase (IKK) alpha, beta, or gamma subunits, (vi) phosphorylated IKK beta, (vii) IkappaB alpha, or (viii) phosphorylated IkappaB alpha, or any combination of (i) - (viii).
[0084] In certain embodiments, the inhibitor of the BCR signaling pathway is ibrutinib, acalabrutinib, or ONO/GS-4059. In certain embodiments, the inhibitor of the BCR signaling pathway is ibrutinib.
[0085] As defined herein, an inhibitor is a substance that decreases the function or expression of a protein or the signaling of a protein in a pathway. An inhibitor may be a small molecule, an siRNA, an shRNA, CRISPR, an antibody, etc.
[0086] In certain embodiments, the activated component of the BCR signaling pathway is a complex of BCR, MYD88, and Toll-like receptor 9 (TLR9) proteins. In certain embodiments, none of these proteins are mutated. In certain embodiments, the MYD88 protein in the complex has an L265P mutation and the CD79A or CD79B subunit of the BCR protein in the complex has an activating mutation.
[0087] In certain embodiments, the tumor sample is a formalin-fixed and paraffin- embedded (FFPE) sample, which may be any suitable sample, e.g., derived from any type of tissue, liquid (e.g., blood, plasma, urine, etc.). In certain embodiments, analyzing the sample comprises performing a proximity ligation assay on the sample. In certain embodiments, the tumor sample is from a human.
[0088] Proximity ligation assay signal is dependent upon the distance between two species-specific secondary antibodies that each bind to a target-specific primary antibody, where the primary antibodies are each bound to a target protein/antigen. When the primary antibody target proteins/antigens are within tens of nanometers of one another, i.e., when the two target proteins are associated with one another (e.g., within 10 nm of each other, within 20 nm of each other, within 30 nm of each other, within 40 nm of each other, within a distance that will permit a detectable PLA signal), a double-stranded PCR template is formed
from complementary oligos bound to the species-specific secondary antibodies. This double- stranded PCR template is then ligated, amplified, and detected by a probe. Any suitable detectable signal may be used, including, for example, an oligonucleotide probe conjugated to a detectable tag, wherein the detectable tag is a FLAG tag, a poly-histidine tag (e.g.
6xHis), a SNAP tag, a Halo tag, a cMyc tag, a glutathione-S-transferase tag, an avidin tag, a biotin tag, an enzyme, a fluorescent protein, a luminescent protein, a chemiluminescent protein, a bioluminescent protein, a phosphorescent protein, use of horseradish peroxidase, etc. The signal is dependent upon the specificity of the primary antibodies, the distance between the two target proteins, and importantly, the absence of additional antibodies that might be bound by the oligo-bound secondary PLA antibody. A positive PLA signal is indicated by an increase of at least 5%, at least 10%, at least 15%, at least 20% or more in the number, size, and/or intensity of the detectable puncta compared to a PLA signal obtained from a negative control sample. The PLA signal can be normalized to a positive control.
[0089] The ability to co-stain patient samples when performing PLA is an aspect of the invention. Using antibodies against surface antigens on tumor enriched populations
1) identifies the cells of interest and 2) filters out cells from complex tissue samples which can have high levels of non-specific background PLA signal. This is the case in FFPE tissue samples from lymph node biopsies. Previous methods for co-staining have been for chemical dyes and other non-antibody stains such as phalloidin, but these methods are inadequate for tumor samples. Previous methods were to perform the complete PLA protocol, wash the samples, e.g., back into TBS with 0.5% tween-20, and stain with antibodies against surface antigens. However, this destroys antibody binding, which is perhaps due to degradation of epitopes. One embodiment of the invention provides co-staining with B cell-specific, fluorescently-tagged antibodies (e.g., mouse anti-CD20 labeled with Alexa488) while staining with, e.g., anti-IgM (e.g., goat) and, e.g., anti-TLR9 (e.g., rabbit). A PLA between these antibodies, e.g., goat and rabbit antibodies, can then be performed. As shown in the Example, by selecting anti-B-cell specific antibodies from a third species (e.g., mouse anti- human CD20), the PLA signal between IgM and TLR9 was unaffected and the surface epitopes were detected before their degradation.
[0090] In certain embodiments, the invention provides a method of treating an ABC DLBCL tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway, the method comprising identifying the tumor as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling
pathway according to a method as described herein; and administering to the tumor an effective amount of an inhibitor of the BCR signaling pathway. In certain embodiments, the inhibitor of the BCR signaling pathway is ibrutinib, acalabrutinib, or ONO/GS-4059. In certain embodiments, the inhibitor of the BCR signaling pathway is ibrutinib. In certain embodiments, the tumor is in a human.
[0091] In certain embodiments, the invention provides a method of treating a human subject having an ABC DLBCL tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway, the method comprising identifying the tumor as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway according to a method as described herein; and administering to the human subject an effective amount of an inhibitor of the BCR signaling pathway. In certain embodiments, the inhibitor of the BCR signaling pathway is ibrutinib, acalabrutinib, or ONO/GS-4059. In certain embodiments, the inhibitor of the BCR signaling pathway is ibrutinib.
[0092] In certain embodiments, the invention provides a method of identifying germinal center B-cell-like diffuse large B cell lymphoma (GCB DLBCL) or Burkitt lymphoma tumor having a greater probability of responding to treatment using an inhibitor of the B cell receptor (BCR) signaling pathway proximal component LYN, SYK, or CD 19, the method comprising obtaining a GCB DLBCL tumor sample; analyzing the sample for survival dependence on LYN, SYK, or CD 19; detecting in the sample survival dependence on LYN, SYK, or CD 19; and identifying the sample having survival dependence on LYN, SYK, or CD 19 as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway proximal component LYN, SYK, or CD 19 compared to a tumor sample not detected to have a survival dependence on LYN, SYK, or CD 19.
[0093] In certain embodiments, the lymphoma is a GCB DLBCL. In certain
embodiments, the lymphoma is a Burkitt lymphoma. In certain embodiments, the tumor sample is a formalin-fixed and paraffin-embedded (FFPE) sample, which may be any suitable sample, e.g., derived from any type of tissue, liquid (e.g., blood, plasma, urine, etc.). In certain embodiments, the tumor sample is from a human.
[0094] In certain embodiments, the inhibitor of the BCR signaling pathway proximal component is an inhibitor of LYN and is dasatinib or ponatinib. In certain embodiments, the inhibitor of the BCR signaling pathway proximal component is an inhibitor of SYK and is entospletinib or PRT-060318 or PRT-062607.
[0095] In certain embodiments, the invention provides a method of treating a GCB DLBCL tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway proximal component LYN, SYK, or CD 19, the method comprising identifying the tumor as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway proximal component LYN, SYK, or CD 19 according to a method described herein; and administering to the tumor an effective amount of an inhibitor of the BCR signaling pathway proximal component LYN, SYK, or CD 19. In certain embodiments, the inhibitor of the BCR signaling pathway proximal component is an inhibitor of LYN and is dasatinib or ponatinib. In certain embodiments, the inhibitor of the BCR signaling pathway proximal component is an inhibitor of SYK and is entospletinib, PRT-062607, or PRT-060318. In certain embodiments, the tumor is in a human.
[0096] In certain embodiments, the invention provides a method of treating a human subject having a GCB DLBCL tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway proximal component LYN, SYK, or CD 19, the method comprising identifying the tumor as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway proximal component LYN, SYK, or CD 19 according to a method described herein; and administering to the human subject an effective amount of an inhibitor of the BCR signaling pathway proximal component LYN, SYK, or CD19. In certain embodiments, the inhibitor of the BCR signaling pathway proximal component is an inhibitor of LYN and is dasatinib or ponatinib. In certain embodiments, the inhibitor of the BCR signaling pathway proximal component is an inhibitor of SYK and is entospletinib, PRT-062607, or PRT-060318.
[0097] In certain embodiments, the invention provides a method of identifying a tumor having a greater probability of responding to treatment using an inhibitor of the B cell receptor (BCR), CD45, PI3 kinase pathway, or mTOR, the method comprising obtaining a tumor sample; analyzing the sample for the presence of a complex of BCR, MYD88, and Toll-like receptor 9 (TLR9) proteins; detecting in the sample the presence of a complex of BCR, MYD88, and TLR9 proteins; and identifying the sample having the presence of a complex of BCR, MYD88, and TLR9 proteins as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR, CD45, PI3 kinase pathway, or mTOR compared to a sample having an absence of a complex of BCR, MYD88, and TLR9 proteins.
[0098] In certain embodiments, the tumor is a lymphoma. In certain embodiments, the lymphoma is a diffuse large B cell lymphoma (DLBCL), a primary central nervous system lymphoma (PCNSL), or a Waldenstrom macroglobulinemia/ lympoplasmacytic lymphoma (WM/LPL). In certain embodiments, the DLBCL is an activated B-cell-like (ABC) DLBCL.
[0099] In certain embodiments, none of these proteins are mutated. In certain embodiments, the MYD88 protein in the complex has an L265P mutation and the CD79A or CD79B subunit of the BCR protein in the complex has an activating mutation.
[0100] In certain embodiments, the tumor sample is a formalin-fixed and paraffin- embedded (FFPE) sample, which may be any suitable sample, e.g., derived from any type of tissue, liquid (e.g., blood, plasma, urine, etc.). In certain embodiments, analyzing the sample comprises performing a proximity ligation assay on the sample.
[0101] In certain embodiments, the inhibitor is an inhibitor of CD45 and is 2-(4- acetylanilino)-3-chloronaphthoquinone (Perron et al., Mol. Pharm., 85: 553-63 (2014), incorporated by reference herein). In certain embodiments, the inhibitor is an inhibitor of mTOR and is selected from the group of OSI-027, AZD-8055, AZD2014, SIROLIMUS, BEZ-235, and everolimus. In certain embodiments, the inhibitor is an inhibitor of PI3 kinase pathway and is selected from the group of IPI-145, BYL-719, BKM-120, Idelalisib, GDC- 0980, and Copanlisib. In certain embodiments, the tumor sample is from a human.
[0102] In certain embodiments, the invention provides a method of treating a tumor having a greater probability of responding to treatment using an inhibitor of the BCR, CD45, PI3 kinase pathway, or mTOR, the method comprising identifying the tumor as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR, CD45, PI3 kinase pathway, or mTOR according to a method described herein; and administering to the tumor an effective amount of an inhibitor of the BCR, CD45, PI3 kinase pathway, or mTOR. In certain embodiments, the inhibitor is an inhibitor of CD45 and is 2-(4- acetylanilino)-3-chloronaphthoquinone. In certain embodiments, the inhibitor is an inhibitor of mTOR and is selected from the group of OSI-027, AZD-8055, AZD2014, SIROLIMUS, BEZ-235, and everolimus. In certain embodiments, the inhibitor is an inhibitor of PI3 kinase pathway and is selected from the group of IPI-145, BYL-719, BKM-120, Idelalisib, GDC- 0980, and Copanlisib. In certain embodiments, the tumor is in a human.
[0103] In certain embodiments, the invention provides a method of treating a human subject having a tumor having a greater probability of responding to treatment using an inhibitor of the BCR, CD45, PI3 kinase pathway, or mTOR, the method comprising
identifying the tumor as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR, CD45, PI3 kinase pathway, or mTOR according to a method described herein; and administering to the human subject an effective amount of an inhibitor of the BCR, CD45, PI3 kinase pathway, or mTOR. In certain embodiments, the inhibitor is an inhibitor of CD45 and is 2-(4-acetylanilino)-3-chloronaphthoquinone. In certain embodiments, the inhibitor is an inhibitor of mTOR and is selected from the group of OSI- 027, AZD-8055, AZD2014, SIROLIMUS, BEZ-235, and everolimus. In certain
embodiments, the inhibitor is an inhibitor of PI3 kinase pathway and is selected from the group of IPI-145, BYL-719, BKM-120, Idelalisib, GDC-0980, and Copanlisib.
[0104] In certain embodiments, the invention provides a method of identifying a tumor having a greater probability of responding to treatment using an inhibitor of the NF-KB pathway, the method comprising obtaining a tumor sample; analyzing the sample for the presence of a complex of BCR, MYD88, and Toll-like receptor 9 (TLR9) proteins; detecting in the sample the presence of a complex of BCR, MYD88, and TLR9 proteins; and identifying the sample having the presence of a complex of BCR, MYD88, and TLR9 proteins as a tumor having a greater probability of responding to treatment using an inhibitor of the NF-KB pathway compared to a sample having an absence of a complex of BCR, MYD88, and TLR9 proteins.
[0105] In certain embodiments, the tumor is a lymphoma. In certain embodiments, the lymphoma is a diffuse large B cell lymphoma (DLBCL), a primary central nervous system lymphoma (PCNSL), or a Waldenstrom macroglobulinemia/ lympoplasmacytic lymphoma (WM/LPL). In certain embodiments, the DLBCL is an activated B-cell-like (ABC) DLBCL. In certain embodiments, none of these proteins are mutated. In certain embodiments, the MYD88 protein in the complex has an L265P mutation and the CD79A or CD79B subunit of the BCR protein in the complex has an activating mutation.
[0106] In certain embodiments, the tumor sample is a formalin-fixed and paraffin- embedded (FFPE) sample, which may be any suitable sample, e.g., derived from any type of tissue, liquid (e.g., blood, plasma, urine, etc.). In certain embodiments, analyzing the sample comprises performing a proximity ligation assay on the sample.
[0107] In certain embodiments, the inhibitor of the NF-κΒ pathway is ibrutinib, acalabrutinib, or ONO/GS-4059. In certain embodiments, the inhibitor of the NF-KB pathway is ibrutinib. In certain embodiments, the tumor sample is from a human.
[0108] In certain embodiments, the invention provides a method of treating a tumor having a greater probability of responding to treatment using an inhibitor of the NF-KB pathway, the method comprising identifying the tumor as a tumor having a greater probability of responding to treatment using an inhibitor of the NF-κΒ pathway according to a method described herein; and administering to the tumor an effective amount of an inhibitor of the NF-KB pathway. In certain embodiments, the inhibitor of the NF-κΒ pathway is ibrutinib, acalabrutinib, or ONO/GS-4059. In certain embodiments, the inhibitor of the NF-KB pathway is ibrutinib. In certain embodiments, the tumor is in a human.
[0109] In certain embodiments, the invention provides a method of treating a human subject having a tumor having a greater probability of responding to treatment using an inhibitor of the NF-κΒ pathway, the method comprising identifying the tumor as a tumor having a greater probability of responding to treatment using an inhibitor of the NF-KB pathway according to a method described herein; and administering to the human subject an effective amount of an inhibitor of the NF-κΒ pathway. In certain embodiments, the inhibitor of the NF-KB pathway is ibrutinib, acalabrutinib, or ONO/GS-4059. In certain embodiments, the inhibitor of the NF-κΒ pathway is ibrutinib.
[0110] In certain embodiments, the invention provides a method of classifying a lymphoma tumor, the method comprising obtaining a lymphoma tumor sample; analyzing the sample for survival dependence on LYN, SYK, or CD 19; detecting in the sample the presence of survival dependence on LYN, SYK, or CD 19; and classifying the sample as germinal center B-cell-like diffuse large B cell lymphoma (GCB DLBCL) or Burkitt lymphoma.
[0111] In certain embodiments, the tumor sample is a formalin-fixed and paraffin- embedded (FFPE) sample, which may be any suitable sample, e.g., derived from any type of tissue, liquid (e.g., blood, plasma, urine, etc.). In certain embodiments, analyzing the sample comprises performing a proximity ligation assay on the sample. In certain embodiments, the tumor sample is from a human.
[0112] In certain embodiments, the invention provides a method of treating or preventing an activated B-cell-like diffuse large B cell lymphoma (ABC DLBCL) in a human subject, the method comprising administering to the subject an effective amount of an inhibitor of CD45. In certain embodiments, the inhibitor of CD 45 is 2-(4-acetylanilino)-3- chloronaphthoquinone. In certain embodiments, the inhibitor is an inhibitor of mTOR and is
selected from the group of OSI-027, AZD-8055, AZD2014, SIROLIMUS, BEZ-235, and everolimus. In certain embodiments, the inhibitor is an inhibitor of PI3 kinase pathway and is selected from the group of IPI-145, BYL-719, BKM-120, Idelalisib, GDC-0980, and Copanlisib.
[0113] In certain embodiments, the invention provides a method of treating or preventing a germinal center B-cell-like diffuse large B cell lymphoma (GCB DLBCL) or Burkitt lymphoma in a human subject, the method comprising administering to the subject an effective amount of an inhibitor of LYN, SYK, or CD 19. In certain embodiments, the inhibitor of the BCR signaling pathway proximal component is an inhibitor of LYN and is dasatinib or ponatinib. In certain embodiments, the inhibitor of the BCR signaling pathway proximal component is an inhibitor of SYK and is entospletinib, PRT-062607, or PRT- 060318.
[0114] In certain embodiments, the present invention provides a method of determining a CRISPR score of a gene, which method comprises
and eliminating those sgRNAs for which
(f) calculating signal variance for each sgRNA using the equations:
Total Variance:
Error Variance:
Signal Variance:
(g) calculating the maximal pair wise correlation between any two sgRNAs in this set by, for each gene g, letting Gg be the set of sgRNAs that represent it, and using the equation
where, if for a given gene Cg < 0.45, then letting ig be the index of the sgRNA representing that gene that has the highest signal variance and using that as the sole representative of gene j using the equation
where, if Cg > 0.45, then proceeding;
to calculate for each , and averaging together those sgRNAs for which Vi > 0.85;
wherein
i is an index indicating sgRNA,
j is an index indicating cell line,
Rj is the number of replicates for cell line j,
r is { 1 - Rj} amd is and index indicating replicate,
d is an index indicating time point, and
Xirjd indicates the raw sequencing counts for sgRNA i, in replicate r of cell line j at time d.
[0115] The terms "lymphoma" and "lymphoid malignancy" as used herein refer to malignant tumors derived from lymphocytes and lymphoblasts. In some embodiments, when required, the lymphoma will have My-T-BCR involvement. The phrase may refer to a broad lymphoma class (e.g., DLBCL, FL, MCL, etc.) or to a subtype or subgroup falling within a broad lymphoma class (e.g., GCB DLBCL, ABC DLBCL). Examples of lymphomas include, but are not limited to, follicular lymphoma (FL), Burkitt lymphoma (BL), mantle cell lymphoma (MCL), follicular hyperplasia (FH), small cell lymphocytic lymphoma (SLL), mucosa-associated lymphoid tissue lymphoma (MALT), splenic lymphoma, multiple myeloma, lymphoplasmacytic lymphoma, post-transplant lymphoproliferative disorder (PTLD), lymphoblastic lymphoma, nodal marginal zone lymphoma (NMZ), germinal center B cell-like diffuse large B cell lymphoma (GCB), activated B cell-like diffuse large B cell lymphoma (ABC) and primary mediastinal B cell lymphoma (PMBL), primary central nervous system lymphoma (PCNSL) and Waldenstrom's macroglobulinemia (WM).
[0116] The inventive method can comprise analyzing a sample from a subject, such as from fresh tissue, a snap-frozen sample from a subject, or a formalin-fixed and paraffin- embedded (FFPE) sample from a subject. The sample may be any suitable sample, e.g., derived from any type of tissue, liquid (e.g., blood, plasma, urine, etc.). As understood by one of ordinary skill in the art, the phrase "a snap-frozen sample from a subject" means that a sample is first taken from a subject and afterwards snap-frozen, and the phrase "obtaining or providing a formalin-fixed and paraffin-embedded (FFPE) sample from the subject" means that a sample is first taken from a subject and afterwards fixed with formalin and embedded in paraffin. The sample may be a biopsy sample. For lymphoma samples, for example, since the tumor can be in any anatomic location, from any tissue, including, but not limited to needle cores of lymph nodes, whole lymph nodes, skin and liver.
[0117] One or more biopsy samples may be obtained from a patient that has been diagnosed as having a tumor, and the biopsy samples can be formalin-fixed and paraffin- embedded using protocols that are known in the art or are commercially available (see, e.g., Keirnan, J. (ed.), Histological and Histochemical Methods: Theory and Practice, 4th edition, Cold Spring Harbor Laboratory Press (2008), incorporated herein by reference.
[0118] In certain embodiments, the invention provides an inhibitor of the NF-κΒ pathway for use in treating a tumor having a greater probability of responding to treatment using an inhibitor of the NF-κΒ pathway, wherein the tumor is identified as a tumor having a greater
probability of responding to treatment using an inhibitor of the NF-κΒ pathway according to methods described herein.
[0119] In certain embodiments, the invention provides an inhibitor of the BCR, CD45, PI3 kinase pathway, or mTOR for use in treating a tumor having a greater probability of responding to treatment using an inhibitor of the BCR, CD45, PI3 kinase pathway, or mTOR, wherein the tumor is identified as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR, CD45, PI3 kinase pathway, or mTOR according to methods described herein.
[0120] The terms "treat," "inhibit," and "prevent" as well as words stemming therefrom, as used herein, do not necessarily imply 100% or complete treatment, inhibition, or prevention. Rather, there are varying degrees of treatment, inhibition, or prevention of which one of ordinary skill in the art recognizes as having a potential benefit or therapeutic effect. In this respect, the inventive methods can provide any amount of any level of treatment, inhibition, or inhibition of a protein, protein complex, or condition in a mammal.
Furthermore, the treatment or prevention provided by the inventive method can include treatment or prevention of one or more conditions or symptoms of the condition, e.g., cancer, being treated or prevented. For example, treatment or prevention can include promoting the regression of a tumor. Also, for purposes herein, "prevention" can encompass delaying the onset of the condition, or a symptom or condition thereof.
[0121] An "effective amount" or "an amount effective to treat" refers to a dose that is adequate to prevent or treat cancer in an individual. Amounts effective for a therapeutic or prophylactic use will depend on, for example, the stage and severity of the disease or disorder being treated, the age, weight, and general state of health of the patient, and the judgment of the prescribing physician. The size of the dose will also be determined by the active selected, method of administration, timing and frequency of administration, the existence, nature, and extent of any adverse side-effects that might accompany the administration of a particular active, and the desired physiological effect. It will be appreciated by one of skill in the art that various diseases or disorders could require prolonged treatment involving multiple administrations, perhaps using the inhibitors in each or various rounds of administration.
[0122] The subject referred to herein may be any mammal. As used herein, the term "mammal" refers to any mammal, including, but not limited to, mammals of the order Rodentia, such as mice and hamsters, and mammals of the order Logomorpha, such as rabbits. The mammals may be from the order Carnivora, including Felines (cats) and
Canines (dogs). The mammals may be from the order Artiodactyla, including Bovines (cows) and Swines (pigs) or of the order Perssodactyla, including Equines (horses). The mammals may be of the order Primates, Ceboids, or Simoids (monkeys) or of the order Anthropoids (humans and apes). Preferably, the mammal is a human.
[0123] In certain embodiments, the invention provides a method of detecting an association of a first protein and a second protein, the method comprising: (A) obtaining a sample comprising one or more B cells; (B) contacting the sample with a first antibody and a second antibody, wherein the first antibody binds the first protein and does not bind the second protein and the second antibody binds the second protein and does not bind the first protein, wherein the first antibody is of a species different than the first protein and the second antibody is of a species different than the second protein, and wherein the first antibody is of a species different than the second antibody; (C) performing a proximity ligation assay using the first antibody and the second antibody and a detectable probe to produce a PLA signal of one or more detectable puncta; (D) contacting the sample with a third antibody, wherein the third antibody binds to a protein on the B cell surface, and wherein the third antibody is labeled with a detectable label; and (E) detecting the proximity ligation assay signal of (C) wherein a positive PLA signal indicates association of the first and second proteins in one or more of the B cells comprised in the sample. The items (C) and (D) may be performed in any order or simultaneously.
[0124] In certain embodiments, the B cell surface protein is IgM, IgD, IgA, IgE, IgG, IgK@, IgL@, CD79A, CD79B, CD20, CD10, CD19, CD81, CR2, CD38, CD138, CD21, CD22, CD23, CD24, CD27, CD40, CD43, CD5, CD72, CD95, CD180, CD45/B220, TACI/TNFRSF 13 B , IL10RA, or IL10RB.
[0125] In certain embodiments, a proximity ligation assay signal is utilized. In certain embodiments, a proximity ligation assay signal of fluorescent puncta (formed from detection of two secondary antibodies, conjugated to unique complementary oligonucleotides, with specificity for different species-specific primary antibodies, such that when in proximity of less than 40 nM of one another, the conjungated oligos hybridize allowing a rolling circle DNA amplification to proceed, which can be detected by a fluorescently-labeled probe oligo) indicates association of the first and second proteins. In certain embodiments, the third antibody is fluorescently labeled. In certain embodiments, the first antibody and the second antibody each bind to a protein component of at least one of the following complexes: the BCR complex, the MYD88 complex, and the mTORCl complex.
[0126] In certain embodiments, the invetion provides a method of identifying a B cell disorder having a greater probability of responding to treatment using an inhibitor, the method comprising: (a) obtaining a B cell disorder sample; (b) analyzing the sample for the presence of a protein complex, wherein the protein complex comprises two proteins, wherein each protein is a protein component of at least one of the following complexes: the BCR complex, the MYD88 complex, and the mTORCl complex, wherein the two proteins are different from one another and are components of different complexes, and wherein the analysis comprises detecting an association of the two proteins according to any suitable method described herein; and (c) identifying the sample having the presence of the protein complex of (b) as a B cell disorder having a greater probability of responding to treatment using an inhibitor of the BCR complex, an inhibitor of the MYD88 complex, or an inhibitor of the mTORCl complex, as compared to a sample having an absence of the protein complex of (b).
[0127] In certain embodiments, the invetion provides a method of identifying a B cell disorder having a greater probability of responding to treatment using an inhibitor, the method comprising: (a) obtaining a B cell disorder sample; (b) analyzing the sample for the presence of a protein complex, wherein the protein complex comprises two proteins, wherein each protein is a protein component of at least one of the following complexes: the BCR complex, the MYD88 complex, and the mTORCl complex, wherein the two proteins are different from one another and are components of different complexes; (b') detecting in the sample the presence of the protein complex of (b); and (c) identifying the sample having the presence of the protein complex of (b) as a B cell disorder having a greater probability of responding to treatment using an inhibitor of the BCR complex, an inhibitor of the MYD88 complex, or an inhibitor of the mTORCl complex, as compared to a sample having an absence of the protein complex of (b).
[0128] In certain embodiments, the sample is identified as a B cell disorder having a greater probability of responding to treatment (i) using an inhibitor of the BCR complex, when the protein complex of (b) includes a protein component of the BCR complex, (ii) using an inhibitor of the MYD88 complex, when the protein complex of (b) includes a protein component of the MYD88 complex, or (iii) using an inhibitor of the mTORCl complex, when the protein complex of (b) includes a protein component of the mTORCl complex, as compared to a sample having an absence of the protein complex of (b).
[0129] In certain embodiments, the sample is identified as a B cell disorder having a greater probability of responding to treatment (i) using an inhibitor of the BCR complex, when the protein complex of (b) includes a protein component of the BCR complex, (ii) using an inhibitor of the MYD88 complex, when the protein complex of (b) includes a protein component of the MYD88 complex, and (iii) using an inhibitor of the mTORCl complex, when the protein complex of (b) includes a protein component of the mTORCl complex, as compared to a sample having an absence of the protein complex of (b).
[0130] Herein, the term "B cell disorder" refers to a disease or disorder characterized by aberrant or abnormal proliferation and/or function of B cells. B cell disorders can include autoimmune diseases, autoinflammatory diseases, cancers, immunodeficiency disorders, infectious diseases, and the like. In certain embodiments, the B cell disorder is diffuse large B-cell lymphoma (DLBCL); follicular lymphoma; marginal zone B-cell lymphoma (MZL) or Mucosa-Associated Lymphatic Tissue lymphoma (MALT); small lymphocytic lymphoma (also known as chronic lymphocytic leukemia, CLL); mantle cell lymphoma (MCL); DLBCL variants or sub-types of primary mediastinal (thymic) large B cell lymphoma, T
cell/histiocyte-rich large B-cell lymphoma, primary cutaneous diffuse large B-cell lymphoma, leg type (Primary cutaneous DLBCL, leg type), EBV positive diffuse large B-cell lymphoma of the elderly, diffuse large B-cell lymphoma associated with inflammation; Burkitt's lymphoma; lymphoplasmacytic lymphoma, which may manifest as Waldenstrom's macroglobulinemia; nodal marginal zone B cell lymphoma (NMZL); splenic marginal zone lymphoma (SMZL); intravascular large B-cell lymphoma; primary effusion lymphoma; lymphomatoid granulomatosis; primary central nervous system lymphoma; ALK-positive large B-cell lymphoma; plasmablastic lymphoma; large B-cell lymphoma arising in HHV8- associated multicentric Castleman's disease; B-cell lymphoma, unclassifiable with features intermediate between diffuse large B-cell lymphoma and Burkitt lymphoma; B-cell lymphoma, unclassifiable with features intermediate between diffuse large B-cell lymphoma and classical Hodgkin lymphoma.
[0131] In certain embodiments, the B cell disorder is a lymphoma. In certain
embodiments, the lymphoma is a diffuse large B cell lymphoma (DLBCL), a primary central nervous system lymphoma (PCNSL), or a Waldenstrom macroglobulinemia/
lympoplasmacytic lymphoma (WM/LPL). In certain embodiments, the lymphoma is a DLBCL and is an activated B-cell-like (ABC) DLBCL. In certain embodiments, the protein
complex comprises the proteins of BCR, MYD88, and mTOR. In certain embodiments, the B cell disorder sample is a formalin-fixed and paraffin-embedded (FFPE) sample, which may be any suitable sample, e.g., derived from any type of tissue, liquid (e.g., blood, plasma, urine, etc.). In certain embodiments, the inhibitor is OSI-027, AZD-8055, AZD2014, SIROLIMUS, BEZ-235, everolimus, or ibrutinib. In certain embodiments, the inhibitor is ibrutinib.
[0132] In certain embodiments, the invention provides an inhibitor of the BCR complex, MYD88 complex, or mTORCl complex for use in treating a B cell disorder having a greater probability of responding to treatment using an inhibitor, wherein the B cell disorder is identified as a B cell disorder having a greater probability of responding to treatment using an inhibitor according to any method described herein.
[0133] In an embodiment, the invention provides a method of identifying a patient suffering from a B cell disorder that is responsive to treatment with one or more inhibitors comprising: (a) obtaining a sample comprising one or more B cells from the patient;
(b) analyzing the sample for the presence of a protein complex, wherein the protein complex comprises at least two proteins, wherein each protein is a protein component of at least one of the following complexes: the BCR complex, the MYD88 complex, and the mTORCl complex, wherein each of the two proteins are different from one another and are components of different complexes, and wherein the analysis comprises detecting an association of the two proteins according to any suitable method described herein; and (c) identifying the sample having the presence of the protein complex of (b), wherein detection of the protein complex in the patient sample identifies the patient as having a greater likelihood of responsiveness to treatment with one or more inhibitors of the BCR complex, the MYD88 complex, and/or the mTORCl complex as compared to a patient in which the presence of the protein complex was not detected.
[0134] In an embodiment, the invention provides a method of identifying a patient suffering from a B cell disorder that is responsive to treatment with one or more inhibitors comprising: (a) obtaining a sample comprising one or more B cells from the patient;
(b) analyzing the sample for the presence of a protein complex, wherein the protein complex comprises at least two proteins, wherein each protein is a protein component of at least one of the following complexes: the BCR complex, the MYD88 complex, and the mTORCl complex, wherein the two proteins are different from one another and are components of different complexes; (b') detecting in the sample the presence of the protein complex of (b),
wherein detection of the protein complex in the patient sample identifies the patient as having a greater likelihood of responsiveness to treatment with one or more inhibitors of the BCR complex, the MYD88 complex, and/or the mTORCl complex as compared to a patient in which the presence of the protein complex was not detected.
[0135] The My-T-BCR complex is a complex of proteins. The My-T-BCR complex comprises at least two different proteins, where each of these two different proteins are of at least one of the following complexes: the BCR complex, the MYD88 complex, and the mTORCl complex. The two proteins are of different complexes. As an example, a "protein A" may be from the BCR complex and a "protein B" may be from the MYD88 complex; a protein A from the BCR complex and a protein B from the mTORCl complex; a protein A may be from the nTORCl complex and a protein B may be from the MYD88 complex;). The My-T-BCR complex may comprise more than two different proteins from the BCR complex, the MYD88 complex, or the mTORCl complex. As an example, the My-T-BCR complex may comprise several proteins, where at least two are different such that there are several of a protein A and one of a protein B; equal numbers of a protein A and a protein B; one or more of a protein A and one or more of a protein B and one or more of a protein C, etc.
[0136] Genes known to be involved in the BCR signaling pathway, which comprises the BCR complex, include, but are not limited to, IgM, CD79A, CD79B, SYK, BTK, BLNK, PLCG2, BANK1, CARD11, BCL10, MALT1, CD22, LYN, MS4A1, PTPN1. Additional genes involved in the BCR signaling pathway and may be suitable for use in the methods described herein include BLK, CBL, CBLB, CD19, CD72, CD81, CR2, CSK, FYN, GRB2, HCK, LAPTM5, LASP1, LAT2, LCK, LRMP, MAP4K1, MAPK1, PRKCB, PRKCD, PTPN22, PTPN6, PTPRC, RAB3GAP2, SIGLEC10, SLA, TEC, VAV1, VAV2, VAV3. Genes known to be involved in the MyD88 signaling pathway include, but are not limited to, TLR9, MYD88, IRAKI, IRAK4, CNPY3, UNC93B 1, STAT3, plkBa, NFKB2. Additional genes involved in the MyD88 signaling pathway and may be suitable for use in the methods described herein include CHUK, cREL, 1KB KB, IKBKG, IRAK2, IRAK3, IRF3, IRF4, IRF5, IRF7, MAP3K7, NFKB 1, NFKBIA, NFKBIE, NLRP2, RELA, RELB, TAB 1, TAB2, TBK1, TIRAP, TOLLIP, TRAM, TRAF3, TRAF6, TRIF, UBE2M. Genes known to be involved in the mTOR signaling pathway include, but are not limited to, mTOR, LAMTOR1, LAMTOR3, FKBP4, RUVBLl, RUVBL2, MAP4K4, PIK3C3. Additional genes involved in the mTOR signaling pathway and may be suitable for use in the methods described herein include AKT1, AKT2, AKT3, AKT1 S1, ATP6V0A1, ATP6V0D1, ATP6V0D2, ATP6V1A,
ATP6V1B2, ATP6V1E1 , ATP6V1H, FKBP1A, FKBP1B, LAMTOR2, LAMTOR4, LAMTOR5, MIOS, MLST8, NPRL2, NPRL3, PDPK1, PIK3CA, PIK3CB, PIK3CD, PIK3CG, PTEN, TSC1, TSC2, TBC1D7, RHEB, RPS6KB 1, RPS6KB2, RPTOR, RRAGA, RRAGB, RRAGC, RRAGD.
[0137] Preferred proteins of the BCR complex include: IgM, CD79A, CD79B, SYK, BTK, BLNK, PLCG2, BANK1, CARDl l, BCL10, MALT1, CD22, LY , MS4A1, PTPN1. Preferred proteins of the MYD88 complex include: TLR9, MYD88, IRAKI, IRAK4, CNPY3, U C93B 1, STAT3, plkBa, NFKB2. Preferred proteins of the mTORCl complex include: mTOR, LAMTORl, LAMTOR3, FKBP4, RUVBLl , RUVBL2, MAP4K4, PIK3C3.
[0138] As used herein, "a greater probability" means an increased likelihood of an event. The increase may be any level of increase that is statistically significant. Mehtods of determining an increased likelihood and statistical significance are known in the art and are described herein.
[0139] The following includes certain aspects of the invention.
[0140] 1. A method of identifying an activated B-cell-like diffuse large B cell lymphoma (ABC DLBCL) tumor having a greater probability of responding to treatment using an inhibitor of the B cell receptor (BCR) signaling pathway, the method comprising:
(a) obtaining an ABC DLBCL tumor sample;
(b) analyzing the sample for the presence of an activated component of the BCR signaling pathway;
(c) detecting in the sample the presence of an activated component of the BCR signaling pathway; and
(d) identifying the sample having the presence of an activated component of the BCR signaling pathway as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway compared to a sample having an absence of an activated component of the BCR signaling pathway.
[0141] 2. The method of aspect 1, wherein the activated component of the BCR signaling pathway is (i) a complex of BCR, MYD88, and Toll-like receptor 9 (TLR9) proteins, (ii) CARDl l, (iii) BCL10, (iv) MALT1, (v) IkappaB kinase (IKK) alpha, beta, or gamma subunits, (vi) phosphorpylated IKK beta, (vii) IkappaB alpha, or (viii) phosphorylated IkappaB alpha, or any combination of (i) - (viii).
[0142] 3. The method of aspect 1 or 2, wherein the inhibitor of the BCR signaling pathway is ibrutinib, acalabrutinib, or ONO/GS-4059.
[0143] 4. The method of any one of aspects 1-3, wherein the inhibitor of the BCR signaling pathway is ibrutinib.
[0144] 5. The method of aspect 2, wherein the activated component of the BCR signaling pathway is a complex of BCR, MYD88, and Toll-like receptor 9 (TLR9) proteins.
[0145] 6. The method of aspect 5, wherein (i) the MYD88 protein in the complex has an L265P mutation and (ii) the CD79A or CD79B subunit of the BCR protein in the complex has an activating mutation.
[0146] 7. The method of any one of aspects 1-6, wherein the tumor sample is a formalin-fixed and paraffin-embedded (FFPE) sample.
[0147] 8. The method of any one of aspects 1-7, wherein analyzing the sample comprises performing a proximity ligation assay on the sample.
[0148] 9. The method of any one of aspects 1-8, wherein the tumor sample is from a human.
[0149] 10. A method of treating an ABC DLBCL tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway, the method comprising:
(1) identifying the tumor as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway according to the method of any one of aspects 1-9; and
(2) administering to the tumor an effective amount of an inhibitor of the BCR signaling pathway.
[0150] 1 1. The method of aspect 10, wherein the inhibitor of the BCR signaling pathway is ibrutinib, acalabrutinib, or ONO/GS-4059.
[0151] 12. The method of aspect 10 or 11, wherein the inhibitor of the BCR signaling pathway is ibrutinib.
[0152] 13. The method of any one of aspects 10-12, wherein the tumor is in a human.
[0153] 14. A method of treating a human subject having an ABC DLBCL tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway, the method comprising:
(1) identifying the tumor as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway according to the method of any one of aspects 1-9; and
(2) administering to the human subject an effective amount of an inhibitor of the BCR signaling pathway.
[0154] 15. The method of aspect 14, wherein the inhibitor of the BCR signaling pathway is ibrutinib, acalabrutinib, or ONO/GS-4059.
[0155] 16. The method of aspect 14 or 15, wherein the inhibitor of the BCR signaling pathway is ibrutinib.
[0156] 17. A method of identifying germinal center B-cell-like diffuse large B cell lymphoma (GCB DLBCL) or Burkitt lymphoma tumor having a greater probability of responding to treatment using an inhibitor of the B cell receptor (BCR) signaling pathway proximal component LYN, SYK, or CD 19, the method comprising:
(a) obtaining a GCB DLBCL tumor sample;
(b) analyzing the sample for survival dependence on LYN, SYK, or CD19;
(c) detecting in the sample survival dependence on LYN, SYK, or CD 19; and
(d) identifying the sample having survival dependence on LYN, SYK, or CD 19 as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway proximal component LYN, SYK, or CD 19 compared to a tumor sample not detected to have a survival dependence on LYN, SYK, or CD 19.
[0157] 18. The method of aspect 17, wherein the lymphoma is a GCB DLBCL.
[0158] 19. The method of aspect 17, wherein the lymphoma is a Burkitt lymphoma.
[0159] 20. The method of any one of aspects 17-19, wherein the tumor sample is a formalin-fixed and paraffin-embedded (FFPE) sample.
[0160] 21. The method of any one of aspects 17-20, wherein the inhibitor of the BCR signaling pathway proximal component is an inhibitor of LYN and is dasatinib or ponatinib.
[0161] 22. The method of any one of aspects 17-20, wherein the inhibitor of the BCR signaling pathway proximal component is an inhibitor of SYK and is entospletinib, PRT- 062607, or PRT-060318.
[0162] 23. The method of any one of aspects 17-22, wherein the tumor sample is from a human.
[0163] 24. A method of treating a GCB DLBCL tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway proximal component LYN, SYK, or CD 19, the method comprising:
(1) identifying the tumor as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway proximal component LYN, SYK, or CD 19 according to the method of any one of aspects 17-23; and
(2) administering to the tumor an effective amount of an inhibitor of the BCR signaling pathway proximal component LYN, SYK, or CD 19.
[0164] 25. The method of aspect 24, wherein the inhibitor of the BCR signaling pathway proximal component is an inhibitor of LYN and is dasatinib or ponatinib.
[0165] 26. The method of aspect 24, wherein the inhibitor of the BCR signaling pathway proximal component is an inhibitor of SYK and is entospletinib, PRT-062607, or PRT-
060318.
[0166] 27. The method of any one of aspects 24-26, wherein the tumor is in a human.
[0167] 28. A method of treating a human subject having a GCB DLBCL tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway proximal component LYN, SYK, or CD 19, the method comprising:
(1) identifying the tumor as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR signaling pathway proximal component LYN, SYK, or CD 19 according to the method of any one of aspects 17-23; and
(2) administering to the human subject an effective amount of an inhibitor of the BCR signaling pathway proximal component LYN, SYK, or CD 19.
[0168] 29. The method of aspect 28, wherein the inhibitor of the BCR signaling pathway proximal component is an inhibitor of LYN and is dasatinib or ponatinib.
[0169] 30. The method of aspect 28, wherein the inhibitor of the BCR signaling pathway proximal component is an inhibitor of SYK and is entospletinib, PRT-062607, or PRT-
060318.
[0170] 31. A method of identifying a tumor having a greater probability of responding to treatment using an inhibitor of the B cell receptor (BCR) or CD45, the method comprising:
(a) obtaining a tumor sample;
(b) analyzing the sample for the presence of a complex of BCR, MYD88, and Toll-like receptor 9 (TLR9) proteins;
(c) detecting in the sample the presence of a complex of BCR, MYD88, and TLR9 proteins; and
(d) identifying the sample having the presence of a complex of BCR, MYD88, and TLR9 proteins as a tumor having a greater probability of responding to treatment using
an inhibitor of the BCR or CD45 compared to a sample having an absence of a complex of BCR, MYD88, and TLR9 proteins.
[0171] 32. The method of aspect 31, wherein the tumor is a lymphoma.
[0172] 33. The method of aspect 32, wherein the lymphoma is a diffuse large B cell lymphoma (DLBCL).
[0173] 34. The method of aspect 33, wherein the DLBCL is an activated B-cell-like (ABC) DLBCL.
[0174] 35. The method of any one of aspects 31-34, wherein (i) the MYD88 protein in the complex has an L265P mutation and (ii) the CD79A or CD79B subunit of the BCR protein in the complex has an activating mutation.
[0175] 36. The method of any one of aspects 31 -35, wherein the tumor sample is a formalin-fixed and paraffin-embedded (FFPE) sample.
[0176] 37. The method of any one of aspects 31-36, wherein analyzing the sample comprises performing a proximity ligation assay on the sample.
[0177] 38. The method of any one of aspects 31-37, wherein the inhibitor is an inhibitor of CD45 and is 2-(4-acetylanilino)-3-chloronaphthoquinone.
[0178] 39. The method of any one of aspects 31-38, wherein the tumor sample is from a human.
[0179] 40. A method of treating a tumor having a greater probability of responding to treatment using an inhibitor of the BCR or CD45, the method comprising:
(1) identifying the tumor as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR or CD45 according to the method of any one of aspects 31-39; and
(2) administering to the tumor an effective amount of an inhibitor of the BCR or
CD45.
[00100] 41. The method of aspect 40, wherein the inhibitor is an inhibitor of CD45 and is 2-(4-acetylanilino)-3-chloronaphthoquinone.
[0180] 42. The method of aspect 40 or 41, wherein the tumor is in a human.
[0181] 43. A method of treating a human subject having a tumor having a greater probability of responding to treatment using an inhibitor of the BCR or CD45, the method comprising:
(1) identifying the tumor as a tumor having a greater probability of responding to treatment using an inhibitor of the BCR or CD45 according to the method of any one of aspects 31-39; and
(2) administering to the human subject an effective amount of an inhibitor of the BCR or CD45.
[0182] 44. The method of aspect 43, wherein the inhibitor is an inhibitor of CD45 and is 2-(4-acetylanilino)-3-chloronaphthoquinone.
[0183] 45. A method of identifying a tumor having a greater probability of responding to treatment using an inhibitor of the NF-κΒ pathway, the method comprising:
(a) obtaining a tumor sample;
(b) analyzing the sample for the presence of a complex of BCR, MYD88, and Toll-like receptor 9 (TLR9) proteins;
(c) detecting in the sample the presence of a complex of BCR, MYD88, and TLR9 proteins; and
(d) identifying the sample having the presence of a complex of BCR, MYD88, and TLR9 proteins as a tumor having a greater probability of responding to treatment using an inhibitor of the NF-κΒ pathway compared to a sample having an absence of a complex of BCR, MYD88, and TLR9 proteins.
[0184] 46. The method of aspect 45, wherein the tumor is a lymphoma.
[0185] 47. The method of aspect 46, wherein the lymphoma is a diffuse large B cell lymphoma (DLBCL).
[0186] 48. The method of aspect 47, wherein the DLBCL is an activated B-cell-like (ABC) DLBCL.
[0187] 49. The method of any one of aspects 45-48, wherein (i) the MYD88 protein in the complex has an L265P mutation and (ii) the CD79A or CD79B subunit of the BCR protein in the complex has an activating mutation.
[0188] 50. The method of any one of aspects 45-49, wherein the tumor sample is a formalin-fixed and paraffin-embedded (FFPE) sample.
[0189] 51. The method of any one of aspects 45-50, wherein analyzing the sample comprises performing a proximity ligation assay on the sample.
[0190] 52. The method of any one of aspects 45-51, wherein the inhibitor of the NF-κΒ pathway is ibrutinib, acalabrutinib, or ONO/GS-4059.
[0191] 53. The method of any one of aspects 45-52, wherein the inhibitor of the NF-KB pathway is ibrutinib.
[0192] 54. The method of any one of aspects 45-53, wherein the tumor sample is from a human.
[0193] 55. A method of treating a tumor having a greater probability of responding to treatment using an inhibitor of the NF-κΒ pathway, the method comprising:
(1) identifying the tumor as a tumor having a greater probability of responding to treatment using an inhibitor of the NF-κΒ pathway according to the method of any one of aspects 45-54; and
(2) administering to the tumor an effective amount of an inhibitor of the NF-KB pathway.
[0194] 56. The method of aspect 55, wherein the inhibitor of the NF-κΒ pathway is ibrutinib, acalabrutinib, or ONO/GS-4059.
[0195] 57. The method of aspect 55 or 56, wherein the inhibitor of the NF-κΒ pathway is ibrutinib.
[0196] 58. The method of any one of aspects 55-57, wherein the tumor is in a human.
[0197] 59. A method of treating a human subject having a tumor having a greater probability of responding to treatment using an inhibitor of the NF-κΒ pathway, the method comprising:
(1) identifying the tumor as a tumor having a greater probability of responding to treatment using an inhibitor of the NF-κΒ pathway according to the method of any one of aspects 45-54; and
(2) administering to the human subject an effective amount of an inhibitor of the NF-KB pathway.
[0198] 60. The method of aspect 59, wherein the inhibitor of the NF-κΒ pathway is ibrutinib, acalabrutinib, or ONO/GS-4059.
[0199] 61. The method of aspect 59 or 60, wherein the inhibitor of the NF-κΒ pathway is ibrutinib.
[0200] 62. A method of classifying a lymphoma tumor, the method comprising:
(a) obtaining a lymphoma tumor sample;
(b) analyzing the sample for the presence of a complex of B cell receptor (BCR), MYD88, and Toll-like receptor 9 (TLR9) proteins;
(c) detecting in the sample the presence of a complex of BCR, MYD88, and TLR9 proteins; and
(d) classifying the sample as activated B-cell-like diffuse large B cell lymphoma (ABC DLBCL).
[0201] 63. A method of classifying a lymphoma tumor, the method comprising:
(a) obtaining a lymphoma tumor sample;
(b) analyzing the sample for survival dependence on LYN, SYK, or CD19;
(c) detecting in the sample the presence of survival dependence on LYN, SYK, or CD 19; and
(d) classifying the sample as germinal center B-cell-like diffuse large B cell lymphoma (GCB DLBCL) or Burkitt lymphoma.
[0202] 64. The method of aspect 62 or 63, wherein the tumor sample is a formalin-fixed and paraffin-embedded (FFPE) sample.
[0203] 65. The method of any one of aspects 62-64, wherein analyzing the sample comprises performing a proximity ligation assay on the sample.
[0204] 66. The method of any one of aspects 62-65, wherein the tumor sample is from a human.
[0205] 67. A method of treating or preventing an activated B-cell-like diffuse large B cell lymphoma (ABC DLBCL) in a human subject, the method comprising administering to the subject an effective amount of an inhibitor of CD45.
[0206] 68. The method of aspect 67, wherein the inhibitor of CD 45 is 2-(4- acetylanilino)-3-chloronaphthoquinone.
[0207] 69. A method of treating or preventing a germinal center B-cell-like diffuse large B cell lymphoma (GCB DLBCL) or Burkitt lymphoma in a human subject, the method comprising administering to the subject an effective amount of an inhibitor of LYN, SYK, or CD19.
[0208] 70. The method of aspect 69, wherein the inhibitor is dasatinib or ponatinib.
[0209] 71. The method of aspect 69, wherein the inhibitor is entospletinib, PRT-062607, or PRT-060318.
[0210] 72. A method of detecting an association of a first protein and a second protein, the method comprising:
(A) obtaining a sample comprising one or more B cells;
(B) contacting the sample with a first antibody and a second antibody, wherein the first antibody binds the first protein and does not bind the second protein and the second antibody binds the second protein and does not bind the first protein, wherein the first antibody is of a species different than the first protein and the second antibody is of a species different than the second protein, and wherein the first antibody is of a species different than the second antibody;
(C) performing a proximity ligation assay using the first antibody and the second antibody and a detectable probe to produce a PLA signal of one or more detectable puncta;
(D) contacting the sample with a third antibody, wherein the third antibody binds to a protein on the B cell surface, and wherein the third antibody is labeled with a detectable label; and
(E) detecting the proximity ligation assay signal of (C) wherein a positive PLA signal indicates association of the first and second proteins in one or more of the B cells comprised in the sample.
[0211] 73. The method of aspect 72, wherein a proximity ligation assay signal of fluorescent puncta indicates association of the first and second proteins.
[0212] 74. The method of aspect 72 or 73, wherein the third antibody is fluorescently labeled.
[0213] 75. The method of any one of aspects 72-74, wherein the first antibody and the second antibody each bind to a protein component of at least one of the following complexes: the BCR complex, the MYD88 complex, and the mTORC l complex.
[0214] 76. A method of identifying a B cell disorder having a greater probability of responding to treatment using an inhibitor, the method comprising:
(a) obtaining a B cell disorder sample;
(b) analyzing the sample for the presence of a protein complex, wherein the protein complex comprises two proteins, wherein each protein is a protein component of at least one of the following complexes: the BCR complex, the MYD88 complex, and the mTORCl complex,
wherein the two proteins are different from one another and are components of different complexes,
and wherein the analysis comprises detecting an association of the two proteins according to any one of aspects 72-75; and
(c) identifying the sample having the presence of the protein complex of (b) as a B cell disorder having a greater probability of responding to treatment using an inhibitor of the BCR complex, an inhibitor of the MYD88 complex, or an inhibitor of the mTORCl complex, as compared to a sample having an absence of the protein complex of (b).
[0215] 77. A method of identifying a B cell disorder having a greater probability of responding to treatment using an inhibitor, the method comprising:
(a) obtaining a B cell disorder sample;
(b) analyzing the sample for the presence of a protein complex, wherein the protein complex comprises two proteins, wherein each protein is a protein component of at least one of the following complexes: the BCR complex, the MYD88 complex, and the mTORCl complex,
wherein the two proteins are different from one another and are components of different complexes;
(b') detecting in the sample the presence of the protein complex of (b); and
(c) identifying the sample having the presence of the protein complex of (b) as a B cell disorder having a greater probability of responding to treatment using an inhibitor of the BCR complex, an inhibitor of the MYD88 complex, or an inhibitor of the mTORCl complex, as compared to a sample having an absence of the protein complex of (b).
[0216] 78. The method of aspect 76 or 77, wherein the sample is identified as a B cell disorder having a greater probability of responding to treatment
(i) using an inhibitor of the BCR complex, when the protein complex of (b) includes a protein component of the BCR complex,
(ii) using an inhibitor of the MYD88 complex, when the protein complex of (b) includes a protein component of the MYD88 complex, or
(iii) using an inhibitor of the mTORCl complex, when the protein complex of (b) includes a protein component of the mTORCl complex,
as compared to a sample having an absence of the protein complex of (b).
[0217] 79. The method of any one of aspects 76-78, wherein the sample is identified as a B cell disorder having a greater probability of responding to treatment
(i) using an inhibitor of the BCR complex, when the protein complex of (b) includes a protein component of the BCR complex,
(ii) using an inhibitor of the MYD88 complex, when the protein complex of (b) includes a protein component of the MYD88 complex, and
(iii) using an inhibitor of the niTORCl complex, when the protein complex of (b) includes a protein component of the mTORCl complex,
as compared to a sample having an absence of the protein complex of (b).
[0218] 80. The method of any one of aspects 76-79, wherein the B cell disorder is a lymphoma.
[0219] 81. The method of aspect 80, wherein the lymphoma is a diffuse large B cell lymphoma (DLBCL), a primary central nervous system lymphoma (PCNSL), or a
Waldenstrom macroglobulinemia/ lympoplasmacytic lymphoma (WM/LPL).
[0220] 82. The method of aspect 81, wherein the lymphoma is a DLBCL and is an activated B-cell-like (ABC) DLBCL.
[0221] 83. The method of any one of aspects 76-82, wherein the protein complex comprises the proteins of BCR, MYD88, and mTOR.
[0222] 84. The method of any one of aspects 76-83, wherein the B cell disorder sample is a formalin-fixed and paraffin-embedded (FFPE) sample.
[0223] 85. The method of any one of aspects 76-84, wherein the inhibitor is OSI-027, AZD-8055, AZD,2014, SIROLIMUS, BEZ-235, everolimus, or ibrutinib.
[0224] 86. The method of any one of aspects 76-85, wherein the inhibitor is ibrutinib.
[0225] 87. An inhibitor of the BCR complex, MYD88 complex, or mTORCl complex for use in treating, in a subject in need thereof, a B cell disorder having a greater probability of responding to treatment using an inhibitor, wherein the B cell disorder is identified as a B cell disorder having a greater probability of responding to treatment using an inhibitor according to the method of any one of aspects 76-86.
[0226] It shall be noted that the preceding are merely examples of embodiments. Other exemplary embodiments are apparent from the entirety of the description herein. It will also be understood by one of ordinary skill in the art that each of these embodiments may be used in various combinations with the other embodiments provided herein.
[0227] The following example further illustrates the invention, including embodiments of the invention, but, of course, should not be construed as in any way limiting its scope.
EXAMPLE
[0228] This example demonstrates embodiments of the invention.
Cell culture
[0229] Cell lines were grown at 37°C in the presence of 5% CO2 and maintained in RPMI supplemented with fetal bovine serum (Tet tested, Atlanta Biologies, Atlanta, GA, USA) and 1% pen/strep and 1% L-glutamine (Invitrogen, Carlsbad, CA, USA), except for OCI-LylO and OCI-Ly3 which were grown in IMDM supplemented with 20% heparinized human plasma, 1% pen/strep and 55uM β-mercaptoethanol. All cell lines were regularly tested for mycoplasma using the MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland) and DNA fingerprinted by examining 16 regions of copy number variants.
Cas9 vector construction
[0230] pRetroCMV/TO-Cas9-Hygro was created by ligating the tetracycline-inducible CMV promoter from pcDNA4/TO (Invitrogen) with Mfel/Xbal and blunt cloned into the XhoI/EcoRI digested pRetrosuper vector (Brummelkamp et al., Cancer Cell, 2: 243-247 (2002), incorporated by reference herein). The puromycin resistance gene from
pRetroCMV/TO was removed with Stul/Clal and replaced with PGK-hygromycin which was isolated from pMSCV Hygro (Clontech, Mountain View, CA, USA) with Agel/Hindlll and similarly cloned into pRetroCMV/TO. Cas9 was isolated from the LentiCrispr v2 (Addgene #52961) and blunt cloned into pRetroCMV/TO-hygro digested with Agel/BamHI. pCW- Cas9-Blasticidin was generated from pCW-Cas9-puro which was purchased from Addgene, Cambridge, MA, USA (#50661) and digested with BamHI and Xbal to remove the puromycin resistance gene. A g-block (IDT) containing the blasticidin resistance gene was Gibson cloned into the cut vector with 12 basepair overlaps.
Cas9-clone generation
[0231] Cell lines were transduced multiple times with either pTO-Cas9-hygro or pCW- Cas9, selected and dilution cloned. Single cell clones were picked and tested for functional Cas9 cutting after transduction with sgRNAs targeting surface markers including CD20 or ICAMl . Clones were selected based upon loss of surface expression within the transduced population as measured by FACS 8-14 days after addition of doxycyline. sgRNA vector and cloning
[0232] The pLKO-based sgRNA vector was purchased from Addgene (#52628). The puromycin gene was removed and replaced with a puro-GFP fusion protein previously
described (Ngo et al., Nature, 441 : 106-110 (2006), incorporated by reference herein) using Gibson assembly. The resulting plasmid was digested with BfuAI and incubated with shrimp alkaline phosphatase before isolating the backbone. Complementary sgRNA sequences flanked by ACCG (SEQ ID NO: 1) on the 5' end, and CTTT (SEQ ID NO: 2) on the 3' of the reverse strand, were annealed, diluted, and ligated into the cut vector with T4 ligase according to the manufacturer's instructions. All transformations were performed in Stbl3 bacteria and grown at 30° C. sgRNA Library Construction
[0233] The genome-wide Brunello sgRNA library (Doench et al., Nat. Biotechnol., 34: 184-191 (2016), incorporated by reference herein) was purchased from Addgene and transformed in Stbl4 bacteria from Invitrogen. Sequences for the follow up library of 12,472 sgRNAs were chosen from published sgRNA libraries (Wang et al., Science, 350: 1096-1101 (2015), incorporated by reference herein; and Shalem et al., Science, 343: 84-87 (2014), incorporated by reference herein) or were designed using the online tool at http:// crispr. mit. edu. The library (CustomArray Inc., Bothell, WA, USA) of 74-mer of the sgRNA sequence prepended with the oligo sequence GGAAAGGACGAAACACCG (SEQ ID NO: 3) and followed by GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC (SEQ ID NO: 4). The oligo library was PCR amplified with Herculase II Fusion DNA polymerase (Agilent, Santa Clara, CA, USA) using ArrayF and ArrayR (Shalem et al., Science, 343: 84-87 (2014), incorporated by reference herein). The subsequent PCR product was gel extracted using an eGel from Invitrogen and 20ng of library was Gibson cloned into BfuAI-cut sgRNA vector following the manufacturer's instructions. Transformations were grown at 30°C overnight on 24.5cm2 bioassay plates maintaining at least 100X coverage. Colonies were scrapped, spun and DNA was isolated with Blood and Cell Culture DNA Maxi kits (Qiagen, Hilden, Germany).
Virus production and transduction
[0234] Lentiviruses were produced in 293FT cells by cotransfecting sgRNA vectors with packaging vectors pPAX2 (Addgene #12260) and pMD2.g (Addgene #12259) in a 4:3:1 ratio in serum-free Opti-MEM. Trans-IT 293T (Mirus, Madison, WI, USA) was added and incubated for 15 minutes before adding dropwise to cells. Supernatants were harvested 24, 48, and 72 hours later, spun at lOOOg to pellet any virus producing cells and then incubated
with Lenti-X concentrator (ClonTech). Virus was concentrated according to manufacturer's instructions, aliquoted and frozen. Virus titration was performed on target cell populations and GFP was measured 3-4 days later. When GFP was not present in the backbone of the sgRNA plasmids, transduced cells were split and incubated with or without puromycin until untransduced control cells were dead. The percentage of viable cells was then measured by FACS and percent transduction was calculated as the ratio of viable cells in treated versus untreated wells.
Pooled sgRNA screening
[0235] For both genome-wide and targeted follow-up screens, individual replicates were transduced such that an average of 500 copies of each sgRNA were present after selection. Cultures were carried for the duration of the 21-day screen maintaining 500X coverage. Antibiotic selection was started 3-4 days after transduction and carried out until untransduced control cells were dead, approximately 4-5 days later. Cells were then harvested for a day 0 time point and doxycycline was added to the culture media at 200ng/mL final concentration. Transduced cells were counted and passaged every two days with fresh media containing dox until day 21 when cells were again harvested for DNA extraction. DNA was isolated from frozen cell pellets using Qiagen QIAmp DNA Blood Midi and Maxi kits.
Library amplification, sequence extraction and PCR primers
[0236] For both screens, sgRNA sequences were amplified using a nested PCR to first isolate the sgRNA sequence from genomic DNA and then to add nextgen sequencing adapters compatible with NextSeq500 from Illumina (San Diego, CA, USA). Products were amplified using ExTaq (Takara, Shiga, Japan) for 18 cycles in both rounds of amplification. Products were size selected using an eGel (Invitrogen) and libraries were quantitated using an Illumina specific Kapa quantification kit according to the manufacturer's instructions or by Qubit (Thermo Fisher Scientific, Waltham, MA, USA). All libraries were sequenced using a high output single-read 75 cycle read flow cell. An average of 400X (200-700X) sequencing depth was achieved. Libraries were multiplexed using indexes compatible with the Illumina TrueSeq HT kit with the primers below where x denotes an eight basepair index and y represents a variable length adapter inserted to prevent monotemplate. Eight forward primers and 12 reverse primers were used following this format such that 96 samples could be multiplexed. Basespace.com was used to evaluate sequencing quality measures and to
demultiplex sequencing reads. Sequences were aligned to the sgRNAs library allowing for a one basepair mismatch using custom scripts and Bowtie 2 version 2.2.9.
CRISPR Screen primers
First PCR forward primer:
AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG (SEQ ID NO: 5) First PCR reverse primer:
GTAATTCTTTAGTTTGTATGTCTGTTGCTATTATG (SEQ ID NO: 6)
Second PCR forward primer:
AATGATACGGCGACCACCGAGATCTACACxACACTCTTTCCCTACACGACGCTCT TCCGATCTyTCTTGTGGAAAGGACGAAACACCG (SEQ ID NO: 7)
Second PCR reverse primer:
CAAGCAGAAGACGGCATACGAGATxGTGACTGGAGTTCAGACGTGTGCTCTTCCG ATCTCTACTATTCTTTCCCCTGCACTGT (SEQ ID NO: 8)
PCR amplification for sgRNA library construction
ARRAY-F:
TAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAA
CACCG (SEQ ID NO: 9)
ARRAY-R:
ACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTA AAAC (SEQ ID NO: 10)
Pooled sgRNA screen analysis
[0237] Crispr screen scores (CSS) were calculated using the following formulas:
Notation:
i = { 1 - 77,441} Index indicating sgRNA
j = { 1 - 11 } Index indicating cell line
Rj = Number of replicates for cell line j
r = { 1 - Rj} Index indicating replicate
d = {0 ,21} index indicating time point
Xirjd = Indicates the raw sequencing counts for sgRNA i, in replicate r of cell line j at time d
[0238] Step 1 : Normalize raw counts by total read counts
and eliminating those sgRNAs for whic
Step 3: Calculate log ratios
Step 5b: Calculate signal variance for each sgRNA
Step 6: For each gene g, let Gg be the set of sgRNAs that represent it, and calculate the maximal pair wise correlation between any two sgRNAs in this set.
If for a given gene
, then let ig be the index of the sgRNA representing that gene that has the highest signal variance and use that as the sole representative of gene j
Step 7: Average the two sgRNAs which were most correlated within gene g.
where are such that
Step 8: For each calculate
[0239] For the replication sgRNA library, in which most genes had 9-10 sgRNAs per gene, it was found this could be simplified by using the z-scores of the averaged log2 fold change of all sgRNAs per gene. As described above, using the best correlated sgRNAs per gene excluded many poor performing sgRNAs, it also excluded many high performing sgRNAs that shared expected subtype-specific toxicities.
Statistical significance
[0240] The statistical significance in Figure 1 of the CSS of ABC BCR-dependent, or GCB DLBCL, compared to all other cell lines, was calculated with a Random Variance T-test (Wright et al., Bioinformatics, 19: 2448-2455 (2003), incorporated by reference herein) for individual genes. Genes in Figures ID and IE were filtered as follows: p-value of <0.01, a subtype-specific CSS of < -1.5, a CSS of > -0.6 in control lymphoid lines, were not present in the ABC-specific Chrl9 amplicon, and were not previously reported as essential (Hart et al., Cell 163: 1515-1526 (2015), incorporated by reference herein).
FACS analysis
[0241] Cell lines were transduced with sgRNA vectors marked by GFP. Three to four days after transduction, GFP levels were measured by flow cytometry on a BD FACS Calibur. Cells were split every other day into doxycycline containing media and GFP levels were followed for 14 days and normalized to the day 0 measurement. All sgRNA and shRNA sequences used in the Example are listed below in Table 1.
Table 1 : shR A and sgRNA sequences used in functional assays
[0242] When surface proteins were targeted, knockout was validated by flow cytometry by spinning cells down, washing in FACS buffer (PBS plus 2% (vol/vol) FBS, ImM EDTA), and stained at 4°C for 30 minutes in FACS buffer with fluorescently labeled antibodies from Biolegend, San Diego, CA, USA: mouse anti-human CD19-APC (Biolegend SJ25C1, 1 :500), mouse anti-human CD81-PE (Biolegend 5A6, 1 :500), mouse anti-human IgM-APC (MHM- 88), 1 :400); or from Southern Biotech, Birmingham, AL, USA: goat anti-human IgG-PE (1 :200).
MTS Growth Assays
[0243] DLBCL cell lines were enumerated and 10,000 cells were seeded in triplicate in a 96-well plate in fresh media. Ibrutinib (Selleck Chem, Houston, TX, USA) and AZD2014
(AstraZeneca, Cambridge, UK) were dissolved in DMSO and equal volumes of diluted drug were added to cells to reach the indicated final concentration. Cells were cultured with drugs, which were replenished after 48 hours. Metabolic activity was measured at day 4 by adding 10 ul of MTS reagent (Promega, Madison, WI, USA) and incubating at 37°C for 4 hours. Absorbance was measured at 490 nm using a 96-well Tecan Infinite 200 Pro plate reader. Absorbance from media-only wells were subtracted and data were normalized to DMSO control unless otherwise stated. Absorbance from media-only wells were subtracted and data were normalized to DMSO control unless otherwise stated. GR50 was calculated using the online tool GRcalculator (http:// www. grcalculator. org/) (Hafner et al., Nat. Methods, 13: 521-527 (2016), incorporated by reference herein). Drug matrix screens and Abliss calculations were performed as previously described (Mathews Griner, et al., Proc. Natl. Acad. Sci. U. S. A., 1 1 1 : 2349-2354 (2014), incorporated by reference herein).
Gene Expression Profiling and Signature Enrichment
[0244] Cells were transduced with shRNAs, puro-selected and harvested at indicated times after shRNA induction. RNA was isolated using RNEasy mini kits (Qiagen). Gene expression was assessed using two-color human Agilent 4 χ 44K gene expression arrays following the manufacturers protocol. Briefly, control shSC4 (control, Cy3-labelled) RNA was compared to RNA from cells with shRNAs targeting TLR9 (C4), TLR9 (D7), MyD88 (A7), MyD88 (B3) (Cy5 -labelled) at each of the indicated time points. Array elements were filtered for spot quality using Agilent Feature Extraction software, specific genes were determined to be downregulated if the log2 fold change (comparing control shSC4 to shRNA for TLR9) was less than -0.3 for at least 3 of the 4 time points (shTLR9) per cell line. Gene expression data have been deposited in Gene Expression Omnibus (GEO) under accession GSE99276. Signature enrichment was performed as previously described (Ceribelli et al., Proc. Natl. Acad. Sci. USA, 1 1 1 : 1 1365-1 1370 (2014), incorporated by reference herein). Briefly, downregulated genes were tested for overlap with published gene signatures in a 2x2 contingency table using a Fisher's exact test.
DNA Copy Number analysis
[0245] DLBCL DNA samples were analyzed with the Affymetrix SNP6.0 array
(Affymetrix, Santa Clara, CA, USA). Probe log ratios were calculated using Affymetrix Genotyping Console, and were collected into segments of similar value using circular binary
segmentation (https: //www. bioconductor. org/packages/ devel/bioc/ manuals/.../ man/ DNAcopy. pdf). These segments were assigned copy number values as previously described (G. Lenz et al, Proc. Natl. Acad. Sci. USA, 105: 13520-13525 (2008), incorporated by reference herein). DNA copy number was correlated to sample gene expression using linear regressions calculated with Prism 7. Overlapping DNA segments of amplified regions were identified and bedgraph files generated using bedtools2.19.1 before being visualized on the UCSC genome browser, Hgl9.
NF-KB reporters
[0246] The generation of the ΙκΒ luciferase reporter cell line has been previously described (Lam et al., Clin. Cancer Res, 11 : 28-40 (2005), incorporated by reference herein). Briefly, TMD8-IKBCC cell line was transduced with indicated shRNAs, puro-selected and induced with doxycycline. Cells were harvested at the indicated time points and luciferase was measured with the Dual Luciferase Reporter Assay System (Promega) on a Tecan Infinite 200 Pro plate reader.
IgM co-immunoprecipitation
[0247] HBL1, TMD8, OCI-LylO and OCI-Lyl9 cells were lysed at 107 cells per ml in a modified RIPA buffer (0.5% Triton X-100, 0.25% deoxycholate, 0.025% SDS, 10 mM Tris, pH 8.0, 100 mM NaCl, 10 mM EDTA, 1 mM Na3V04, 30 mM pyrophosphate, 10 mM glycerophosphate, 1 mM AEBSF, 0.02 U ml-1 aprotinin and 0.01% NaN3) for 10 min. on ice. Lysates were cleared by centrifugation at 14,000xg for 20 min. at 4°C. IgM was
immunoprecipitated by incubating lysates on ice for 1 hour with 10μg of biotin-labeled goat anti-human IgM (Jackson Immunoresearch, West Grove, PA, USA), followed by the addition of 35 μΐ of pre-washed streptavidin-agarose beads (Invitrogen) and rotated for 30 min. at 4°C. Beads were washed 3X with cold IX RIPA buffer, then solubilized by adding 2X LDS sample buffer (Invitrogen) with 1% β-mercaptoethanol and boiled for 5 min. Samples were separated on a 10% polyacrylamide gel and transferred to Immobilon-p PVDF membrane (Millipore, Billerica, MA, USA) for western blot analysis. Membranes were probed with rabbit anti-TLR9 monoclonal XP, rabbit anti-TLR7 (Cell Signaling Technologies, Danvers, MA, USA), rabbit anti-TLR4 (Santa Cruz Biotechnology, Dallas, TX, USA) and goat anti- IgM-HRP (Bethyl, Montgomery, TX, USA).
Proximity Ligation Assay
[0248] DLBCL cell lines were either left untreated, treated with ΙΟηΜ ibrutinib or equivalent volumes of DMSO, or transduced with either control shRNA (SC4) or shRNAs targeting CD79A, TLR9, MYD88, CARD11, BCL10 or MALT1, followed by puromycin (Invitrogen) selection as previously described (Ngo et al., Nature, 470: 1 15-119 (201 1), incorporated by reference herein). Cells were plated onto a 15 well μ-Slide Angiogenesis ibiTreat chamber slide (Ibidi, Martinsried, Germany) and allowed to adhere to the surface for 30 min at 37°C. Cells were then fixed with 4% paraformaldehyde (Electron Microscopy Sciences, Hatfield, PA, USA) for 20 min at room temperature and then washed in PBS (Invitrogen). Cellular membranes were labeled with 5μg/ml wheat germ agglutinin conjugated to Alexa Fluor 488 (Thermo Fisher Scientific) for 10 min at room temperature. Cells were permeabilized in cold methanol for 10 min, washed in PBS and then blocked in Duolink Blocking buffer (Sigma, St. Louis, MO, USA) for 30 min at room temperature. Primary antibodies were diluted in Duolink Antibody Diluent (Sigma) and incubated overnight at 4°C (See Table 2).
Table 2
[0249] Where appropriate, cells were counterstained with mouse anti-Lampl conjugated to Alexa Fluor 488 (Santa Cruz Biotechnology) with the primary antibodies. The following morning, cells were washed for 20 min in a large volume of PBS with 1% BSA, followed by addition of the appropriate Duolink secondary antibodies (Sigma), diluted and mixed according to the manufacturer's instructions. Cells were incubated for 1 hour at 37°C, after which cells were washed in TBST with 0.5% tween-20 for 10 min. Ligation and amplification steps of the PLA were performed using the Duolink in situ Detection Reagents Orange kit (Sigma) according to the manufacturer's instructions. Following the PLA, cells were mounted in Prolong Gold mounting media with DAPI (Invitrogen). Images were
acquired on a Zeiss LSM 880 Confocal microscope. Images for display and Pearson's correlation coefficients values were calculated with NIH ImageJ/FIJI software (Schindelin et al., Nat. Methods, 9: 676-682 (2012), incorporated by reference herein). PLA spots were counted in cell lines using Blobfinder (Allalou et al., Comput. Methods Programs Biomed., 94: 58-65 (2009), incorporated by reference herein).
[0250] The PLA was performed on formalin-fixed, paraffin-embedded (FFPE) tissue microarrays or biopsy samples in a similar manner. FFPE microarrays (7 μm) and patient tissue sections (4 μm) were deparaffinized in xylene and rehydrated in graded alcohol and distilled water. Heat induced antigen retrieval was performed on TMAs and tissue sections at pH 6.0 for 30 minutes. Slides were then placed in tris-buffered solution and prepared for proximity ligation assay, as described above, samples were costained with mouse anti-human CD20-eFluor660 (L26, eBioscience/Thermo Fisher Scientific). Tissue microarrays were prepared by fixing cells in neutral buffer formalin for 24 hours, pelleting, and resuspending in an equal volume of low-melt agarose in a 10 ml conical tube. The resulting pellet was paraffin embedded by standard protocol (Hewitt, Methods in Enzymology, 410: 400-415 (2006), incorporated by reference herein). The resultant blocks were used to construct a cell line array (CMA) using the same approach used for construction of a tissue microarray, with 1.00 mm needles, using a Beecher MTA-1 instrument (Beecher Instruments, Silver Spring, MD, USA). Sample identifiers were removed and blinded before pathology review for PLA signal. Samples were called positive if the presence of >2 fluorescent puncta/cell in >25% of the malignant cells was observed. After all data were collected, sample identifiers were revealed and samples were grouped by response to ibrutinib.
BioID2 contracts
[0251] BioID2 (Addgene #80899) was appended to the c-terminus of TLR9 and
MYD88L265P using Gibson cloning techniques. MYD88L265P-13X-BioID2 was cloned by removing GFP from the previously described pBMN-MYD88L265P-VD-GFP 9 by restriction digest with Stul and Notl. BioID2 was PCR amplified with a 13X N-terminal linker and Gibson cloned as above from Addgene #80899 with the following primers:
CCTCTAGTGCGGCCGCTTATGCGTAATCCGGTACATC (SEQ ID NO: 16)
BioID2 was also appended to the c-terminus of both wild type and m utant isoforms of MYD88 with a two-amino acid linker (VD). First, BioID2 and MYD88 were PCR amplified with Primestar (Takara) using the following primers:
BioID FWD
TTGTCCCTGCCCGTCGACTTCAAGAACCTGATCTGGCTG (SEQ ID NO: 11) BioID REV
CGCCGGCCCTCGAGGCTATGCGTAATCCGGTACATCG (SEQ ID NO: 12)
MYD88 FWD
AATTCGAATTCCTGAAGGGCCACCATGCGACCCGACCGCGC (SEQ ID NO: 13) MYD88 REV
AGATCAGGTTCTTGAAGTCGACGGGCAGGGACAAGGC (SEQ ID NO: 14)
[0252] TLR9 was cloned into a modified version of pBMN that expresses a 10X linker followed by BioID2 with the following oligos.
TLR9 C-BioID FWD
CTGCCGGATCCGAATTCTA GCC ACA atgggtttctgccgcagcg (SEQ ID NO: 39) TLR9 C-BioID REV
CCCGACCCGCCTCCACCTAC ttcggccgtgggtccctggc (SEQ ID NO: 40)
[0253] The PCR products were separated on a 1% agarose gel and column purified (Qiagen). Purified PCR products were mixed and added to pBMN-LYT2 vector that was linearized with StuI (New England Biolabs, Ipswich, MA, USA) and subjected to a Gibson reaction (New England Biolabs) following the manufacturer's protocol.
Imaging MYD88-13X-BioID2
[0254] MYD88L265P- 13X-BioID2 was retrovirally transduced into TMD8 cells, and then purified with anti-LYT2 beads as described above. Cells were first cultured for 16 hr in 50μΜ biotin. Next, cells were incubated with ^g/ml goat anti-human IgM FAB conjugated
to Alexa Fluor 488 (Jackson Immunoresearch) for 90 min at 37°C. During this incubation period, cells were plated onto a 15 μ-Slide 8 well IbiTreat chamber slides (Ibidi) for 30 min and allowed to stick to the slides. Cells were washed 2X with PBS and then fixed with 4% paraformaldehyde (Electron Microscopy Sciences) for 20 min and then permeabilized with cold methanol for 10 min at -20°C. Fixed and permeabilized cells were blocked with Duolink blocking buffer (Sigma) for 30 min at room temperature. Cells were then incubated with rabbit mAb anti-phospho-ΙΚΚα/β (Serl76/180) (Cell Signaling Technology) diluted 1 :200 in PBS with 1% BSA for 2 hour at room temperature, followed by 2X washes with PBS:BSA. Cells were then incubated with anti-rabbit F(ab')2 conjugated to Alexa Fluor 555 (Cell Signaling Technology) at 1 :1000, mouse anti-Lamp 1 conjugated to Alexa Fluor 405 (Santa Cruz Biotechnology) at 1:50 and streptavidin conjugated to Alexa Fluor 647
(Biolegend) at 1 :1000, all diluted into PBS:BSA and allowed to incubate for 1 hour at room temperature. Cells were then washed for 15 min in a large volume of PBS:BSA and mounted with Prolong Diamond mounting media (Invitrogen). Images were acquired on a Zeiss LSM 880 Confocal microscope. Images for display were prepared with NIH ImageJ/FIJI (75) and animations were prepared using the Imaris 3D rendering software (Bitplane, Belfast, Northern Ireland).
[0255] In certain instances, TMD8, OCI-LylO and/or HBL1 cells expressing
MYD88L265P-13X-BioID2 were additionally transduced with either control shRNA (SC4) or shRNAs targeting CD79A, TLR9 or MYD88, as described above. Following puromycin (Invitrogen) selection, cells stained with streptavidin conjugated to Alexa Fluor 555 (Thermo Fisher Scientific) and anti-LYT2 conjugated to Alexa Fluor 647 (Biolegend). Cells were either subjected to FACS analysis, as described above, or were imaged as described above. Biotin spots or blobs were counted using Blobfinder, as for the PLA above. Likewise, these cell lines were either left untreated, treated with ΙΟηΜ ibrutinib or equivalent volumes of DMSO, then stained and analyzed in the same manner.
Mass spectrometry and western blot analysis of BioID2 constructs
[0256] TLR9-10X-BioID2 pBMN-LYT2 and MYD88-13X-BioID2 pBMN-LYT2 constructs were retrovirally transduced into DLBCL cell lines, as described above. Infected cells were enriched by positive selection with LYT2 magnetic beads (Invitrogen). Cells were then grown in SILAC media, containing amino acids labeled with stable isotopes or arginine and lysine, for 2 weeks prior to expansion to lOOxlO6 cells. 16 hours prior to lysis, biotin
(Sigma) was added to a final concentration of 50μΜ to transduced cells. Cells were then lysed at 2.5 x 107 cells per ml in RIPA buffer modified for MS analysis (1% NP-40, 0.5% deoxycholate, 50 mM Tris, pH 7.5, 150 mM NaCl, 1 mM Na3V04, 5mM NaF, 1 mM AEBSF) for 10 min. on ice. Lysates were cleared by centrifugation at 14,000xg for 20 min. at 4°C. 35μ1 of Pre-washed streptavidin agarose beads were added to each sample; samples were then rotated at 4°C for 2 hours, then washed four times in IX RIPA buffer, then solubilized with 4X LDS sample buffer (Invitrogen) with 1% β-mercaptoethanol, and boiled for 5 min.
Lysates were then subjected to western blot analysis as described above. Western blots were probed with rabbit anti-CARDl 1 and rabbit anti-MALTl (Cell Signaling Technologies) and mouse anti-MYD88 (Santa Cruz Biotechnology). A fraction of lysates were also subjected to western blot analysis as described above. Western blots were probed with rabbit anti- CARDl 1 and rabbit anti-MALTl (Cell Signaling Technologies) and mouse anti-MYD88 (Santa Cruz Biotechnology).
[0257] For MS analysis, proteins were separated by one-dimensional gel electrophoresis (4-12% NuPAGE Bis-Tris Gel, Invitrogen) and the entire lane of a Coomassie blue-stained gel was cut into 23 slices. All slices were processed as described previously (Oellerich et al., Blood, 121: 3889-3899, S3881-3866 (2013)). After tryptic digestion of the proteins the resulting peptides were resuspended in sample loading buffer (2% acetonitrile and 0.05% trifluoroacetic acid) and were separated by an UltiMate 3000 RSLCnano HPLC system (Thermo Fisher Scientific) coupled online to a Q Exactive HF mass spectrometer (Thermo Fisher Scientific). First, peptides were desalted on a reverse phase CI 8 precolumn (Dionex 5 mm length, 0.3 mm inner diameter) for 3 minutes. After 3 minutes the precolumn was switched online to the analytical column (30cm length, 75 mm inner diameter) prepared in- house using ReproSil-Pur C 18 AQ 1.9 mm reversed phase resin (Dr. Maisch GmbH, Ammerbuch, Germany). Buffer A consisted of 0.1 % formic acid in H20, and buffer B consisted of 80% acetonitrile and 0.1 % formic acid in H20. The peptides eluted from buffer B (5 to 42 % gradient) at a flow rate of 300 nl/min over 76 min. The temperature of the precolumn and the analytical column was set to 50°C during the chromatography. The mass spectrometer was operated in a TopN data-dependent mode, where the 30 most intense precursors from survey MSI scans were selected with an isolation window of 1.6 Th for MS2 fragmentation under a normalized collision energy of 28. Only precursor ions with a charge state between 2 and 5 were selected. MSI scans were acquired with a mass range from 350 to 1600 m/z at a resolution of 60,000 at 200 m/z. MS2 scans were acquired with a starting mass
of 1 10 Th at a resolution of 15,000 at 200 m/z with maximum IT of 54ms. AGC targets for MSI and MS2 scans were set to 1E6 and 1E5, respectively. Dynamic exclusion was set to 20 seconds.
MS data analysis
[0258] MS data analysis was performed using the software MaxQuant (version 1.6.0.1, Max Planck Institute of Biochemistry, Germany) linked to the UniProtKB/Swiss-Prot human database containing 155990 protein entries and supplemented with 245 frequently observed contaminants via the Andromeda search engine (Cox et al., J. Proteome Res., 10: 1794-1805 (201 1)). Precursor and fragment ion mass tolerances were set to 6 and 20 ppm after initial recalibration, respectively. Protein biotinylation, N-terminal acetylation and methionine oxidation were allowed as variable modifications. Cysteine carbamidomethylation was defined as a fixed modification. Minimal peptide length was set to 7 amino acids, with a maximum of two missed cleavages. The false discovery rate (FDR) was set to 1% on both the peptide and the protein level using a forward-and-reverse concatenated decoy database approach. For SILAC quantification, multiplicity was set to two or three for double
(Lys+O/Arg+0, Lys+8/Arg+10) or triple (Lys+O/Arg+0, Lys+4/Arg+6, Lys+8/Arg+10) labeling, respectively. At least two ratio counts were required for peptide quantification. The "re-quantify" option of MaxQuant was enabled..
Xenograft
[0259] All mouse experiments were approved by the National Cancer Institute Animal Care and Use Committee (NCI-ACUC) and were performed in accordance with NCI-ACUC guidelines and under approved protocols. Female NSG (non-obese diabetic/severe combined immunodeficient/common gamma chain deficient) mice were obtained from NCI Fredrick Biological Testing Branch and used for the xenograft experiments between 6-8 weeks of age. TMD8 tumors were established by subcutaneous injection of 10 x 106 cells in a 1 : 1
Matrigel/PBS suspension. Treatments were initiated when tumor volume reached a mean of 200mm3. Ibrutinib was prepared in PBS with 50% (v/v) DMSO and administered i.p. once per day (6mg/kg/day). AZD2014 was prepared in deionized water with 1% (v/v) Tween 80 and administered p.o. twice per day on days 0, 1, 7 and 8 (lOmg/kg/day). For
ADZ2014/ibrutinib combination, drugs were given at the same concentration and schedule as single agents. Tumor growth was monitored every other day by measuring tumor size in two
orthogonal dimensions and tumor volume was calculated by the following equation: tumor volume = (length x width2)/2.
CRISPR screens reveal essential pathways that distinguish DLBCL subtypes
[0260] To gain new insights into the pathogenesis of DLBCL, pooled, loss-of-function CRISPR-Cas9 screens were performed for essential genes in ABC and GCB DLBCL cell lines. These screens employed libraries of lentiviral vectors to express short guide RNAs (sgRNAs) that direct Cas9 to distinct genes, leading to their inactivation by repeated cycles of cleavage and error-prone repair. A library of 77,441 lentiviral vectors that express sgRNAs targeting unique loci in most (19,114) protein-coding genes in the human genome was used, with approximately four sgRNAs per gene (Doench et al., Nat. Biotechnol., 34: 184-191 (2016), incorporated by reference herein). Cell lines were engineered to express Cas9 in a doxycycline-inducible fashion, and selected clones of each line with optimal sgRNA- mediated deletion (see above). For ABC DLBCL, three BCR-dependent and ibrutinib- sensitive lines were studied, two of which harbor both CD79B and MYD88 L265P mutations (TMD8, HBL1), and one (U2932) that lacks both mutations (Davis et al., Nature, 463: 88-92 (2010), incorporated by reference herein; and Kelly et al., J. Exp. Med., 212: 2189-2201 (2015), incorporated by reference herein). For comparison, one BCR-independent, ibrutinib- resistant line (HLY1) was included, that line being MYD88-dependent and having a less prevalent MYD88 S219C mutation (Ngo et al., Nature, 470: 115-1 19 (2011), incorporated by reference herein). For GCB DLBCL, four ibrutinib-resistant lines with an unknown dependence on BCR signaling (DOHH2, SUDHL4, SUDHL5, WSU-DLCL2) were studied. As controls, parallel screens were performed in two multiple myeloma lines (ARP1C, KMS1 1) and one T cell lymphoma line (DEL).
[0261] After lentiviral transduction, duplicate cultures for each line were passed for three weeks before measuring the abundance of each sgRNA in the initial and final cultures by next-generation sequencing (Fig. 1A). For each gene, the two sgRNAs that displayed the most correlated toxicity across the 11 cell lines were identified, and averaged their effect to derive a gene-level depletion/enrichment value (see above). For the minority of genes without correlated sgRNAs, the sgRNA with the greatest variance across the cell lines as the gene exemplar were chosen. For each gene in each sample, a "CRISPR screen score" (CSS) was defined that measures the effect of its CRISPR-mediated inactivation as the number of standard deviations away from the average effect of inactivating any gene (see above). Little
evidence of non-specific toxicity among control, non-gene targeting sgRNAs was observed, whereas sgRNAs targeting essential genes (Hart et al., Cell, 163: 1515-1526 (2015), incorporated by reference herein) were depleted in all lines (Fig. IB). As expected from previous work (Wang et al., Science, 350: 1096-1101 (2015), incorporated by reference herein), sgRNAs targeting genomic regions with high-level amplifications were non- specifically toxic and were removed from functional analyses.
[0262] sgRNAs depleted in the final cultures frequently targeted essential genes previously identified in CRISPR loss-of-function screens in non-lymphoma cancer cell lines (Fig. IB) (Hart et al., Cell, 163: 1515-1526 (2015), incorporated by reference herein).
Dependence of both GCB and ABC lines on the anti-apoptotic BCL2 family members BCL2, BCL-XL (BCL2L1) and MCLl was also observed, with each member contributing variably to the survival of individual cell lines (Fig. 6). In keeping with the derivation of the DLBCL subtypes from distinct stages of normal B cell differentiation (Shaffer et al., Annu. Rev. Immunol., 30: 565-610 (2012), incorporated by reference herein), several B cell-restricted transcription factors were selectively essential in ABC DLBCL (IRF4, SPIB, BATF) or GCB DLBCL (MEF2B, TCF3, IRF8, SPI1), along with others (BCL6, PAX5, EBF, POU2F2, POU2AF1) that were required in the majority of DLBCL lines but were variably essential in the myeloma and T cell lymphoma lines (Fig. 1C).
Distinct modes of BCR signaling
[0263] Next, identity of genes that were specifically essential in the three BCR-dependent ABC DLBCL lines were sought. Twenty-eight genes were identified whose inactivation produced a significantly greater depletion (p<0.01, CSS< -1.5) in BCR-dependent ABC lines than in all others, and that were not reported to be essential in previous CRISPR-Cas9 screens (Hart et al., Cell, 163: 1515-1526 (2015), incorporated by reference herein) (Figs. ID and IE). In keeping with the known pro-survival role of NF-κΒ in these cell lines, NF-KB subunits p50 (NFKB 1) and c-Rel (REL) were essential, as was the IKK catalytic β subunit (1KB KB), the defining kinase of the classical NF-κΒ pathway. Also essential were components of the BCR-dependent signaling cascade known to activate IKK in these ABC DLBCL cells (Davis et al., Nature, 463: 88-92 (2010), incorporated by reference herein; Yang et al., Cancer Discov., 4: 480-493 (2014), incorporated by reference herein; and Ngo et al., Nature, 441 : 106-110 (2006), incorporated by reference herein), including the kinase BTK and its substrate phospholipase Cy2 (PLCG2), protein kinase CP (PRKCB), components
of the CBM signaling adapter complex (CARD11, BCL10, MALT1), and the RBCK1 subunit of the linear ubiquitin chain assembly complex (LUBAC) that facilitates recruitment of IKK to the CBM complex (Yang et al, Cancer Discov., 4: 480-493 (2014), incorporated by reference herein). Additional NF-κΒ regulators that were essential in ABC lines include TRAF6, TAK1 (MAP3K7) and NFKBIZ.
[0264] Analogous selection criteria were used to identify genes that were selectively essential in the GCB DLBCL lines versus all others (Figs. ID and IE). Surprisingly, two of the 12 genes identified encode proteins involved in proximal BCR signaling, LYN and CD 19. LYN, one of several SRC-family kinases (SFKs) that can initiate BCR signaling (Gross et al., J. Immunol., 182: 5382-5392 (2009), incorporated by reference herein), was essential in all GCB lines. Among ABC lines, LYN was only moderately essential in HBL1 and behaved as a tumor suppressor in TMD8 cells (i.e. LYN sgRNAs were enriched at day 21). CD19 is a BCR co-receptor that participates in PI3K activation (reviewed in Fearon et al., Annu. Rev. Immunol., 13: 127-149 (1995), incorporated by reference herein). CD19 was essential in all GCB lines but behaved as a tumor suppressor in ABC lines. Given the essentiality of LYN and CD 19 in GCB DLBCL, the function of other proximal BCR components in these lines was investigated. Surprisingly, the BCR subunits CD79A and CD79B were not only essential in ABC lines, but also in GCB lines, a finding that was not appreciated in previous studies (Davis et al., Nature, 463: 88-92 (2010), incorporated by reference herein), most likely due to incomplete knockdown of these highly expressed genes by RNA interference.
[0265] These observations prompted an investigation into whether oncogenic signaling pathways were differentially engaged in ABC and GCB DLBCL. Figure IF depicts the average CSS scores from the whole-genome CRISPR screens of three BCR-dependent ABC and four GCB lines in the proximal BCR, PI3K, NF-κΒ, TLR and JAK/STAT signaling pathways. A validation screen using ~10 sgRNAs per gene demonstrated strong correlations between screens of overlapping cell lines (Pearson's correlation coefficients averaging 0.79; 0.68-0.84, pO.0001; Figs. 7A-7G).
[0266] Proximal BCR signaling in developing B cells is initiated by the redundant SFKs LYN, BLK and FYN (Saijo et al., Nat. Immunol. 4: 274-279 (2003), incorporated by reference herein). In addition to the already mentioned requirement for LYN in all GCB lines, two lines depended on the SFK BLK (DOHH2, SUDHL4) and one depended on LCK (DOHH2). By contrast, no single SFK was essential in ABC lines, possibly due to functional redundancy. The phosphatase CD45, a regulator of SFKs, was essential in GCB lines but had
the opposite effect in ABC lines. In this regard, it is notable that CD45 positively regulates BCR signaling during B cell development but has less effect on antigen-induced active BCR signaling (Cyster et al., Nature, 381 : 325-328 (1996), incorporated by reference herein). CSK, another regulator of SFKs, was essential in both BCR-dependent ABC and GCB lines. While this was unexpected, given the fact that CSK inhibits SFK function in T cells
(Zikherman et al., Immunity, 32: 342-354 (2010), incorporated by reference herein), this finding may fit with the observation that a CSK polymorphism that increases its expression predisposes to systemic lupus erythematosus and is associated with increased BCR signaling (Manjarrez-Orduno et al., Nat. Genet., 44: 1227-1230 (2012), incorporated by reference herein).
[0267] The proximal BCR tyrosine kinase SYK was essential in both ABC and GCB lines, which is notable given that small molecule SYK inhibitors are in clinical trials (see below). Nonetheless, the consequences of SYK activity appear to differ between the DLBCL subtypes. SYK mediates PI3K signaling in normal B cells by several mechanisms, including direct interaction with the PI3K p85 subunit as well as phosphorylation of CD 19 and BCAP (PIK3AP1), enabling them to also recruit p85 (reviewed in Kulathu et al., Immunological Reviews, 232: 286-299 (2009), incorporated by reference herein). As mentioned, CD 19 was selectively essential in GCB lines, as was CD81, which facilitates CD 19 localization to the plasma membrane (Maecker et al., J. Exp. Med., 185: 1505-1510 (1997), incorporated by reference herein). By contrast, PIK3AP1, was required only in BCR-dependent ABC DLBCL lines. Although CD 19 and BCAP are functionally redundant in normal mouse B cells (Aiba et al., Blood, 1 1 1 : 1497-1503 (2008), incorporated by reference herein), these results indicate that that is not the case in DLBCL and suggest that each DLBCL subtype uses a distinct mechanism to engage PI3K (Id.). ABC and GCB lines shared a dependence on the delta catalytic subunit of PI3K (PIK3CD) and the downstream kinases PDPK1, mTOR and RPS6KB 1. However, PTEN, a negative regulator of PI3K signaling, functioned as a tumor suppressor in GCB but not ABC lines, in keeping with the fact that inactivation of PTEN is a recurrent genetic event in GCB but not ABC DLBCL tumors (Lenz et al., Proc. Natl. Acad. Sci. USA, 105: 13520-13525 (2008), incorporated by reference herein; and Pfeifer et al., Proc. Natl. Acad. Sci. USA, 110: 12420-12425 (2013), incorporated by reference herein).
[0268] As already discussed, multiple components of the NF-κΒ pathway downstream of BTK were essential in ABC but not GCB lines (Fig. IF). BLNK is a signaling adapter that is phosphorylated by SYK and partners with BTK to form a plasma membrane-associated
complex that activates NF-κΒ. BLNK was selectively essential in ABC lines, in keeping with their chronic active form of BCR signaling. Two negative regulators of NF-KB - A20 (TNFAIP3) and its associated protein TNIP1 - behaved as tumor suppressors in ABC but not GCB lines, in keeping with the frequent inactivation of A20 by a variety of genetic and epigenetic means in ABC DLBCL tumors (Compagno et al., Nature, 459: 717-721 (2009), incorporated by reference herein). Conversely, the NF-κΒ negative regulator ΙκΒα
(NFKBIA) functioned as a tumor suppressor only in GCB lines, presumably because the chronic active BCR signaling in ABC DLBCL triggers ΙΚΚβ phosphorylation of ΙκΒα, leading to its degradation.
[0269] A parallel means to activate NF-κΒ in ABC DLBCL involves MYD88 and its associated kinases IRAKI and IRAK4 (Ngo et al., Nature, 470: 115-119 (2011), incorporated by reference herein), which were selectively essential in the ABC lines with MYD88 mutations (TMD8, HBL1, HLY1). Unexpectedly, the MYD88-dependent lines further required the Toll-like receptor TLR9, and its associated chaperone proteins UNC93Bland CNPY3 (reviewed in Saitoh et al., Immunological reviews 227, 32-43 (2009), incorporated by reference herein), uncovering a new facet of MYD88-dependent NF-κΒ activation in these lines that were examined in detail below. Of note, none of the other nine TLRs were found to be essential in ABC DLBCL lines (Fig. 8). NF-κΒ activation by oncogenic MYD88 isoforms directs the expression of the cytokines IL-10 and IL-6 (Ngo et al., Nature, 470: 115-119 (2011), incorporated by reference herein). The alpha and beta subunits of the IL-10 receptor were selectively essential in ABC lines, while the components of the IL-6 receptor were not. The role of JAK1 and its target STAT3 in MYD88-mutant ABC DLBCL has been described recently (Rui et al., Proc. Natl. Acad. Sci. USA, 113: E7260-E7267 (2016), incorporated by reference herein), and both genes were essential in the MYD88-mutant ABC lines (Fig. IF).
BCR signaling in germinal center-derived lymphomas
[0270] Although previous studies have not identified a role for the BCR in the pathogenesis of GCB DLBCL (Davis et al., Nature, 463: 88-92 (2010), incorporated by reference herein; Young et al., Proc. Natl. Acad. Sci. USA, 112: 13447-13454 (2015), incorporated by reference herein; and Schmitz et al., Nature, 490: 1 16-120 (2012), incorporated by reference herein), the CRISPR screens suggested that a subset of GCB DLBCL lines require BCR signaling for survival, but in a fashion that is mechanistically
distinct from chronic active BCR signaling in ABC DLBCL. To validate these results, a larger set of Cas9-expressing GCB and ABC lines was transduced with vectors expressing individual sgRNAs targeting BCR pathway components along with GFP, which allowed use of GFP to track sgRNA toxicity over a two-week period by FACS. As a positive control, transduction of an sgRNA targeting the ribosomal protein RPL6 caused a time-dependent decrease in GFP+ cells in all lines (Fig. 2A). Genetic depletion of CD79A or SYK was toxic to five of seven ABC lines and four of six GCB lines (Fig. 2A). BCR-dependent ABC lines uniquely required BTK, PLCG2, CARD11 and PIK3AP1, whereas the BCR-dependent GCB lines uniquely required CD 19.
[0271] These genetic data suggested that the toxicity of small molecule inhibitors of BCR signaling would depend on the mode of BCR signaling in each DLBCL line. To examine this issue, MTS viability assays were performed using a large panel of DLBCL lines treated with small molecule inhibitors of SYK (PRT062607 (Coffey et al., J. Pharmacol. Exp. Ther., 340: 350-359 (2012), incorporated by reference herein)) or BTK (ibrutinib), and used the GRmax calculation to measure toxicity since it is less susceptible to changes in cell density than the IC50 metric (Hafner et al., Nat. Methods, 13: 521-527 (2016), incorporated by reference herein). Most ABC lines were sensitive to ibrutinib, while GCB lines were insensitive, and GRmax values for ibrutinib correlated with the degree of depletion of a BTK sgRNA after 14 days (R2=0.602). In contrast, a subset of both GCB and ABC lines were sensitive to the SYK inhibitor, again with a good correlation between the GRmax and the genetic toxicity of SYK deletion (R2=0.849; Fig. 2B). Across 44 DLBCL lines, a spectrum of sensitivity to the SYK inhibitor was observed: 16 lines had a GRmax below 0, signifying a cytotoxic effect, 17 had a GRmax between 0 and 0.75, suggesting a cytostatic effect, and 11 lines were insensitive to SYK inhibition (Fig. 2C, Figs. 9A-9F).
[0272] The dependence of GCB DLBCL lines on SYK and the PI3K pathway is shared by Burkitt lymphoma, another GC-derived malignancy (Schmitz et al., Leukemia, 19: 1452- 1458 (2005), incorporated by reference herein). Interestingly, the CD19-dependence of GCB DBLCL lines was also shared by Burkitt lymphoma lines, as judged by the toxicity of a CD 19 shRNA (Fig. 10). "Constitutive GC BCR signaling" is a term that can be used to characterize the shared mode of BCR signaling in these two GC-derived lymphoma subtypes (see below).
TLR9 is essential for BCR signaling in ABC DLBCL
[0273] The survival of BCR-dependent ABC lines relied on TLR9, which coordinates MYD88 signaling in innate immune cells, and on two chaperones that regulate the subcellular localization of TLR9, CNPY3 and U C93B1. TLR9 was the only essential TLR, and its essentiality was confined to MYD88L265P-mutant ABC lines (Fig. 8). These findings were validated using time-dependent toxicity assays in 12 DLBCL lines transduced with vectors co-expressing sgRNAs and GFP (Fig. 3A). ABC lines expressing mutant isoforms of MYD88 were sensitive to MYD88 deletion. In contrast, TLR9, UNC93B1 and CNPY3 were only essential in ABC lines with MYD88L265? and either a CD79B or CD79A mutation. These double-mutant lines were also particularly sensitive to BTK depletion.
[0274] ABC tumors had recurrent single copy gains or amplifications involving MYD88 (31.0%), TLR9 (26.9%), CNPY3 (17.9%), and UNC93B1 (15.9%), and these occurred more frequently in ABC than in GCB tumors. All four genes were more highly expressed in ABC tumors, and expression correlated with copy number (Fig. 3B, Fig. 4). MYD88 and TLR9 are located -15 Mb from each other on chromosome 3, which is notable since trisomy or amplification of chromosome 3 is present in more than 25% of ABC cases. Amplification of CNPY3 was observed in 14 ABC biopsies (4.8%) as well as the ABC line HBLl, with a minimal common amplified region of 1.1 Mb containing 24 protein coding genes (Fig. 3B). UNC93B1 was amplified in 9 ABC biopsies (3.1%), with a 277 kb minimal common amplified region containing only 3 genes (Fig. 3B). Altogether, 49.7% of ABC DLBCL tumors had increased copy number of one or more of these TLR9 module genes (Fig. 3B), providing genetic evidence that this pathway contributes to the ABC DLBCL phenotype.
The My-T-BCR supercomplex
[0275] To elucidate the function of TLR9 in ABC DLBCL, a fusion protein was expressed, linking TLR9 to BioID2, a promiscuous biotin ligase that biotinylates proteins within -10 nm. Biotinylated proteins in transduced HBLl and TMD8 ABC cells were purified using streptavidin and compared to proteins from control cells expressing empty vector by a SILAC -based quantitative mass spectrometry (MS) approach. To define the subset of the TLR9 interactome that is essential in ABC DLBCL, the TLR9- BioID2 enrichment of each protein was compared with its respective CRISPR CSS metric (Fig. 3C, Fig. 11A). The TLR9-essential interactome shared by both HBLl and TMD8 cells confirmed
association of TLR9 with MYD88 and CNPY3, but also revealed interactions with the BCR subunits CD79A and CD79B (Fig. 3C, Fig. 11 A-C). It was confirmed that
immunoprecipitated IgM was associated with TLR9 in three ABC lines, but to a much lesser extent in the GCB line OCI-Lyl9 (Fig. 3D). By contrast, neither TLR4 nor TLR7 co- immunoprecipitated with IgM (Fig. 12A). Sub-cellular fractionation revealed that TLR9 was associated with IgM in an intracellular fraction rather than a plasma membrane fraction (Fig. 12B), suggesting that the BCR may cooperate with TLR9 in signaling at an intracellular location.
[0276] To visualize where TLR9 and the BCR interact, the proximity ligation assay (PLA) was employed (Soderberg et al., Methods, 45: 227-232 (2008), incorporated by reference herein), which identifies interactions between proteins within tens of nanometers of each other. An IgM:TLR9 PLA produced fluorescent puncta in the cytoplasm of ABC cells (Fig. 3E). Depletion of the BCR component CD79A or TLR9 substantially reduced the PLA signal, demonstrating its specificity (Fig. 3E, Fig. 12C). IgM:TLR9 PLA signal was present across a panel of BCR-dependent ABC lines, with higher signals in double-mutant lines, whereas BCR-independent ABC and GCB lines had substantially lower signals (Fig. 12D-F). The IgM:TLR9 PLA signal co-localized with the endolysosomal marker LAMP1 (Fig. 12G- H), consistent with the dependence of these ABC lines on UNC93B1 and CNPY3, which facilitate entry of TLR9 into LAMPl+ endolysosomes.i 9 Ectopic expression of TLR9, MYD88WT or MYD88L265P markedly increased the IgM:TLR9 PLA signal (Fig. 121), suggesting that TLR9/MYD88 copy number gains in ABC tumors may augment this signaling complex (Fig. 3B).
[0277] MYD88 mediates TLR9-dependent NF-κΒ activation, and accordingly, knockdown of MYD88 or TLR9 with small hairpin RNAs (shRNAs) produced similar changes in gene expression and ΙκΒα levels in two ABC lines with MYD88L265P (Fig. 13A- D). A TLR9:MYD88 PLA produced a strong signal in the cytoplasm of ABC lines, which was diminished by knockdown of TLR9 or MYD88. Knockdown of CD79A also decreased the TLR9:MYD88 PLA signal, suggesting that the BCR facilitates recruitment of MYD88 to TLR9 (Fig. 3F). These results suggest that TLR9 coordinates signaling between the BCR and MYD88. It was hypothesized that the BCR, TLR9 and MYD88 nucleate a signalosome that activates NF-κΒ, which we will term the MyD88-TLR9-BCR (My-T-BCR) supercomplex. To identify additional My-T-BCR components, a MYD88L265P-BioID2 fusion protein was expressed in TMD8, HBL1 and OCI-LylO ABC cells and performed SILAC-MS analysis of
MYD88-proximal biotinylated proteins. Proteins were identified as biotinylated in all 3 MYD88L265P-BioID2 lines and used their corresponding CRISPR CSS scores to define the essential MYD88 interactome, which included the BCR (CD79B), mTOR, ΡΙΧγ2, and the CBM complex (CARDl 1, MALT1) (Fig. 14A-B, Fig. 15A-B). It was confirmed that both CARDl 1 and MALT1 are biotinylated by MYD88L265P-BioID2 in ABC cells using streptavidin pulldown and immunoblot analysis (Fig. 15C,D). Finding the CBM complex in close proximity to MYD88 was unexpected since these adaptors are thought to independently promote NF-κΒ activation. Both MALT1 :MYD88 and BCL10:MYD88 PLAs yielded robust cytoplasmic puncta in ABC cells, confirming the association of endogenous MYD88 with the CBM complex (Fig. 14C, Fig. 15E-F). MYD88:MALT1 and MYD88:BCL10 puncta were reduced by knockdown of CD79A, TLR9, and CARDl 1, suggesting that BCR and TLR9 signaling cooperate to assemble MYD88 and the CBM into a supercomplex. It was further hypothesized that CBM assembly might depend not only on BCR signaling, but also, on TLR9 and MYD88. Indeed, the puncta observed using a CARDl 1 :BCL10 PLA were reduced by knockdown of TLR9 or MYD88, as well as by knockdown of CARDl 1, BCL10, and CD79A (Fig. 14D).
[0278] The classical NF-κΒ pathway is activated by IKK-dependent phosphorylation of ΙκΒα, making phospho-ΙκΒ a marker of NF-κΒ activation. By PLA, we observed association of IgM and phospho-ΙκΒα in the cytoplasm of ABC cells, which was reduced by knockdown of CD79A, TLR9 or MYD88 (Fig. 14E). Phospho-ΙκΒ was also associated with TLR9, and knockdown of CD79A, TLR9 or MYD88 reduced this signal (Fig. 14F). Thus, NF-KB activation is closely associated with the My-T-BCR complex.
[0279] The subcellular location of the My-T-BCR complex was visualized by staining ABC cells bearing MYD88L265P-BioID2 with fluorescently-labeled streptavidin. The MYD88-BioID2 signal defined large cytoplasmic structures that colocalized with phospho- IKK, consistent with active NF-κΒ signaling at these sites (Fig. 14G). These complexes extended into the cytoplasmic space from the surface of LAMP 1+ vesicles. BCR
internalization was visualized by cell surface labelling of IgM with a fluorescent Fab on ice, followed by brief warming of the cells to allow BCR internalization. The LAMP 1+ vesicles with MYD88-BioID2 signals also contained IgM, suggesting a dynamic shuttling of the BCR from the plasma membrane to the intracellular site of My-T-BCR complex formation.
Knockdown of CD79A or TLR9 decreased the MYD88-BioID2 signal (Fig. 14H),
demonstrating that these complexes were similar to those detected by the PLA method in their dependence on TLR9 and the BCR. Taken together, these data provide evidence that IKK-dependent activation of classical NF-κΒ signaling is coordinated in ABC cells by the My-T-BCR supercomplex.
My-T-BCR and ibrutinib responses
[0280] Given that the My-T-BCR complex coordinates pro-survival signaling in ABC DLBCL, it was hypothesized that inhibition of BTK activity by ibrutinib might disrupt this signaling complex. Indeed, ibrutinib treatment of ABC lines bearing MYD88L265P
BioID2 reduced My-T-BCR-dependent biotinylated puncta (Fig. 16A). To globally assess the influence of ibrutinib on the MYD88 interactome, SILAC-MS
analysis of biotinylated proteins was performed in OCI-LylO and TMD8 ABC lines bearing MYD88L265P-BioID2, in the presence or absence of ibrutinib. This analysis revealed that interactions of MYD88 with the CBM complex (CARD11), PLCy2, and mTOR were disrupted by ibrutinib treatment in both ABC lines (Fig. 17A, Fig. 16B).
[0281] The ibrutinib-sensitive association of mTOR with MYD88 was surprising and raised the possibility that signaling by the My-T-BCR complex might affect essential downstream pathways controlled by mTOR. Of note, components of the Ragulator complex (LAMTOR1, LAMTOR3, LAMTOR4, RRAGA), which regulates mTORCl activity at the lysosomal membrane, were biotinylated by TLR9-BioID2, as were components of the lysosomal V-ATPase (ATP6V1B2, ATP6V0D1), which regulates the mTORCl response to amino acids (Fig. 3C, Fig. 11C). In ABC lines expressing
MYD88L265P-BioID2, mTOR was localized to LAMP 1+ vesicles, often in proximity to the My-T-BCR (Fig. 17B). PLA in three ABC lines confirmed that ibrutinib decreased the association of endogenous MYD88 with mTOR, MALT1, and BCL10 (Fig. 17C).
Ibrutinib also decreased the association of IgM and phospho-ΙκΒα but had mixed effects on IgM association with TLR9. These findings suggest that IgM trafficking to TLR9- containing endolysosomes is constitutive in these lines, but interaction of the My-T-BCR complex with mTOR, the CBM complex, and NF-κΒ is controlled by BCR signaling in an ibrutinib-sensitive manner.
[0282] Given the proximity of MYD88 and mTOR, the effect of mTOR
inhibition on the My-T-BCR was investigated. In three ABC cells bearing MYD88L265P-
BioID2, the My-T-BCR was reduced following ibrutinib treatment, but was further
attenuated by the addition of AZD2014, an mTORCl/2 inhibitor (Fig. 17D). Dual mTOR and BTK inhibition also cooperatively decreased MYD88 protein levels and blocked mTOR activity, as assessed by phospho-4E-BPl and phospho-S6 kinase, as well as NF-KB
activation, as assessed by phospho-IKK (Fig. 17E). These data provide mechanistic insights into the synergistic toxicity of combinations of BTK inhibitors and drugs targeting mTOR or PI3 kinase in ABC models growing in vitro (Fig. 17F) and in vivo (Fig. 17G) (Mathews Griner et al., PNAS, 11 :, 2349-2354 (2014) and Ezell et al., Oncotarget, 5: 4990-5001 (2014), both incorporated by reference herein). mTOR inhibitors: OSI-027, AZD-8055, AZD2014, SIROLIMUS, BEZ-235, and everolimus
PI3 kinase pathway inhibitors: IPI-145, BYL-719, BKM-120, Idelalisib, GDC-
0980, andCopanlisib
Figure 17F has the following tables:
Table 3: Viability (48 hrs)
Ibrutinib (nM)
Table 4: ABliss (48 hrs)
500 250 125 62 31 16 8 4 2 0
Ibrutinib (nM)
[0283] It was examined whether the My-T-BCR complex is detectable in primary lymphoma patient biopsy samples, and if its presence might predict response to ibrutinib. The PLA was optimized for use in formalin-fixed and paraffin-embedded (FFPE) samples using a tissue microarray prepared from FFPE pellets of 81 lymphoma cell lines. The highest IgM:TLR9 PLA signals were in ABC lines with chronic active BCR signaling, whereas little if any PLA signal was observed in GCB lines, Burkitt lymphoma lines, or in normal B cells present in tonsils or reactive lymph nodes (Fig. 18A-B). Among
DLBCL FFPE biopsy samples, ABC cases had significantly more IgM:TLR9 puncta than GCB cases (Fig. 19A). High IgM:TLR9 PLA signals were also observed in FFPE biopsies of primary central nervous system lymphoma (PCNSL), Waldenstrom
macroglobulinemia (WM), and its relative lymphoplasmacytic lymphoma (LPL) (Fig. 19B). These malignancies commonly have MYD88L265P and/or CD79A or CD79B
mutations, and respond frequently to ibrutinib. Of two WM lines tested, one had My- T-BCR complexes, and knockdown of either the BCR (CD79A) or TLR9 was selectively toxic for this line (Fig. 20A-C). My-T-BCR complexes were not evident in mantle cell lymphoma (MCL) or chronic lymphocytic leukemia (CLL) samples (Fig. 19B), suggesting that these malignancies rely on a qualitatively distinct form of BCR signaling.
[0284] Eight available biopsies were examined from patients with relapsed or refractory DLBCL enrolled on a clinical trial of ibrutinib monotherapy. The
IgM:TLR9 PLA methodology was adapted to allow the malignant lymphoma cells to be identified by anti-CD20 immunohistochemical staining (Fig. 19C). Three ABC cases and one unclassified DLBCL case scored positive in the IgM:TLR9 PLA while three other ABC cases and one GCB case were negative. The percentage of
IgM:TLR9 PLA-positive malignant cells was significantly higher in tumors that
responded to ibrutinib than in those that progressed on treatment (Fig. 19D, p<0.0286). In this series, two responding cases with IgM:TLR9 puncta had CD79B or CD79A
mutations, respectively, but lacked MYD88L265P, while two other responders were wild type for these genes (Table 5). These findings demonstrate that the My-T-BCR exists in ABC DLBCL tumors that respond to ibrutinib, even in those lacking the
MYD88L265P/CD79B double-mutant genotype.
Table 5
CR = Complete Responder, PR = Partial Responder, SD = Stable disease; PD = Progressive Disease
Response to ibrutinib = "+", Non-response = "-"
[0285] The CRISPR-Cas9 genetic screens revealed two distinct modes of BCR signaling in lymphomas, which will help guide the development of therapies targeting components of the BCR pathway (Fig. 5). One BCR signaling mode, termed herein as "constitutive GC BCR signaling," is shared by GCB DLBCL and Burkitt lymphoma lines. This mode of signaling utilizes the BCR, CD19, and SYK to engage PI3K as its principle downstream survival pathway (including AKT and mTOR). By contrast, a subset of ABC DLBCLs with mutations targeting both the BCR and MYD88 are sustained by a form of chronic active BCR signaling in which the My-T-BCR complex in endolysosomes engages NF-κΒ to promote pathological survival.
[0286] The first unexpected insight from the CRISPR-Cas9 screens was the strong dependence of some GCB DLBCL lines on the BCR, which was likely missed in previous
studies because RNA interference cannot fully eliminate expression of the BCR subunits (Davis et al., Nature, 463: 88-92 (2010), incorporated by reference herein). Previous studies used RNA interference to show that SYK is essential in some GCB lines (Cheng et al., Blood, 1 18: 6342-6352 (2011), incorporated by reference herein; and Chen et al., Cancer Cell, 23: 826-838 (2013), incorporated by reference herein), but these studies did not directly assess the role of the BCR, leaving considerable uncertainty since SYK can be activated by a wide variety of receptors and signaling pathways (Mocsai et al., Nat. Rev. Immunol., 10: 387-402 (2010), incorporated by reference herein). In the CRISPR-Cas9 screens, the BCR- dependent GCB lines were not dependent on BTK or the NF-κΒ pathway, thus distinguishing BCR signaling in GCB DLBCL from chronic active BCR signaling in ABC DLBCL and explaining why ibrutinib yielded only a 5% response rate among GCB DLBCL cases in a phase II clinical trial (Wilson et al., Nat. Med., 21 : 922-926 (2015), incorporated by reference herein).
[0287] Superficially, BCR signaling in GCB DLBCL resembles "tonic" BCR signaling, which sustains the survival of naive mature mouse B cells, since PI3K is the principle downstream survival mechanism engaged by the BCR in both cases (Lam et al., Cell, 90: 1073-1083 (1997), incorporated by reference herein; Kraus et al., J. Exp. Med., 194: 455-469 (2001), incorporated by reference herein; and Srinivasan et al., Cell, 139: 573-586 (2009), incorporated by reference herein). Indeed, BCR signaling in Burkitt lymphoma was previously characterized as "tonic" based on similar considerations (Schmitz et al., Nature, 490: 116-120 (2012), incorporated by reference herein). However, certain mechanistic aspects of BCR signaling in GCB DLBCL and Burkitt lymphoma appear to be distinct from tonic BCR signaling in naive mature mouse B cells. First, the CRISPR screens revealed that GCB lines rely on the BCR co-receptor CD 19 and its associated membrane protein CD81 for survival, and similarly, knockdown of CD19 in BCR-dependent Burkitt lymphoma lines is toxic. CD19_/_ mice have only a modest decrease in naive mature B cell numbers, largely due to loss of the marginal zone and B l-B subpopulations, in contrast to the dramatic loss of all mature B cells following conditional deletion of the BCR (Rickert et al, Nature, 376: 352- 355 (1995), incorporated by reference herein; and Engel et al., Immunity, 3: 39-50 (1995), incorporated by reference herein). Both CD19_ ~ and CD81-/- mice are severely impaired in their antibody responses to T cell-dependent antigens, which require a germinal center response, but responses to T cell-independent antigens are intact (Maecker et al., J. Exp. Med., 185: 1505-1510 (1997), incorporated by reference herein; Rickert et al., Nature, 376:
352-355 (1995), incorporated by reference herein; and Engel et al., Immunity, 3: 39-50 (1995), incorporated by reference herein). Indeed, CD19-/- mice do not form germinal centers upon immunization with T cell-dependent antigens (Rickert et al., Nature, 376: 352- 355 (1995), incorporated by reference herein). Knock-in mice lacking the CD19 tyrosine residues necessary for PI3K recruitment can support early steps in germinal center B cell formation, but the proliferation of these cells and the expansion of the germinal center are dramatically attenuated (Wang et al., Immunity, 17: 501-514 (2002), incorporated by reference herein).
[0288] A second aspect of BCR signaling in GCB DLBCL lines that is distinct from tonic BCR signaling is the dependence of GCB lines on the kinase LYN. Mature B cells from LYN-/- mice are in fact increased in number and are hyperresponsive to BCR crosslinking, ultimately leading to autoimmune glomerulonephritis (Wang et al., J. Exp. Med., 184: 831- 838 (1996), incorporated by reference herein; and Hibbs et al., Cell, 83: 301-31 1 (1995), incorporated by reference herein). LYN-/- mice, like CD19-/- mice, fail to form germinal centers in response to T cell-dependent antigens (Kato et al., J. Immunol., 160: 4788-4795 (1998), incorporated by reference herein). It thus seems likely that the dependence of GCB lines on CD 19 and LYN reflects their required role in normal GC B cell function.
[0289] For these reasons, "constitutive GC BCR signaling" is a term used herein to characterize the mode of BCR signaling in GCB DLBCL and Burkitt lymphoma, which engages PI3K, but not NF-κΒ, to promote malignant cell survival. In this regard, it is notable that PI3K-dependent AKT activation is a feature of normal GC B cells residing in the GC "light zone", where the B cells engage antigen on the surface of follicular dendritic cells (Sander et al., Immunity, 43: 1075-1086 (2015), incorporated by reference herein). By contrast, BCR-dependent NF-κΒ activation is impaired in normal GC B cells, apparently because PKCβ cannot be efficiently recruited to the immune synapse on the cell surface in response to antigen engagement of the BCR (Nowosad, Nat. Immunol., 17: 870-877 (2016), incorporated by reference herein).
[0290] The second insight from the CRISPR-Cas9 screens is that chronic active BCR signaling in ABC DLBCL is mechanistically heterogeneous, with a subset of these lymphomas utilizing a novel TLR9-dependent mechanism to promote strong addiction to BCR signaling. Among ABC lines with chronic active BCR signaling, some depend only on the BCR (U2932 and RIVA) while others depend on the BCR and TLR9 (TMD8, HBL1, OCI-Ly10). Cooperative signaling between the BCR and TLRs has been reported previously
in the context of normal and pathological immune responses in the mouse. BCR ablation in mouse B cells impairs their proliferative response to TLR9 stimulation (Otipoby et al., Proc. Natl. Acad. Sci. USA, 1 12: 12145-12150 (2015), incorporated by reference herein). The antibody response to virus-like particles containing TLR9 ligands depends on MYD88 in GC B cells (Hou et al., Immunity, 34: 375-384 (201 1), incorporated by reference herein). In a murine model of systemic lupus erythematosis, pathological B cell proliferation depends on endosomal TLR7 and/or TLR9 engaging ligands in complex self-antigens that are internalized by the BCR (Leadbetter et al., Nature, 416: 603-607 (2002), incorporated by reference herein). Finally, MYD88 L265P augments self-antigen-driven proliferation of mouse B cells in a TLR9-dependent fashion, especially in the presence of a Bcl2 transgene (Wang et al., J. Exp. Med., 21 1 : 413-426 (2014), incorporated by reference herein).
[0291] Here, a mechanistic basis is provided for cooperation between TLR9 and the BCR in the pathological survival of ABC DLBCL cells. The ABC lines that depend on the BCR and TLR9 form a multi-protein, My-T-BCR complex on endolysomal membranes that includes all components known to activate NF-κΒ in ABC DLBCL. The My-T-BCR complex provides an unexpected nexus between distinct biochemical mechanisms that activate IKK and trigger classical NF-κΒ signaling in lymphoma. BCR signaling has long been known to promote formation of the CBM complex, a large signaling assembly that recruits and activates IKK (Thome et al., Cold Spring Harbor Perspectives in Biology, 2: a003004 (2010), incorporated by reference herein; and Qiao et al., Mol. Cell, 51 : 766-779 (2013), incorporated by reference herein). Separately, a variety of innate immune receptors recruit MYD88, allowing it to coordinate a signalosome with IRAKI and IRAK4 that activates IKK (Lin et al., Nature, 465: 885-890 (2010), incorporated by reference herein). This work shows that these seemingly separate molecular machines coalesce into a signaling complex on the surface of endolysomal membranes in ABC DLBCL cells. The formation of the My-T-BCR complex depended on both the BCR and TLR9, and was the site of active NF-KB signaling, as judged by the phosphorylation of IKK and its substrate Ι Βα in this complex. Importantly, ibrutinib treatment decreased the recruitment of the CBM
components, MYD88 and ρ-ΙκΒα into this complex. Interestingly, ibrutinib did not disrupt the IgM-TLR9 interaction, which is shown as a hallmark of a subset of ABC DLBCL cell lines and patient samples. It is speculated that the IgM-TLR9 interaction in endolysosomes may be related to the cell of origin of ABC DLBCL rather than the product of oncogenic signaling.
[0292] In survival assays, ABC lines with My-T-BCR complexes were particularly sensitive to ibrutinib, consistent with ibrutinib-induced reduction in My-T-BCR complexes. All ABC lines with this phenotype had a "double mutant" genotype consisting of the MYD88 L265P mutation in conjunction with an activating mutation targeting CD79B or CD79A. In a recent clinical trial, such double mutant tumors had an 80% response rate to ibrutinib compared to only 30% in other ABC DLBCL tumors (Wilson et al., Nat. Med, 21 : 922-926 (2015), incorporated by reference herein). Analysis of biopsies from patients on this trial revealed that tumors that responded to ibrutinib had significantly more My-T-BCR complexes than tumors that progressed on treatment. Among nodal, systemic ABC DLBCL tumors, the double mutant genotype is observed in 10% of cases (Ngo et al. Nature, 470: 115-119 (201 1), incorporated by reference herein). The prevalence of this genotype is much higher in extranodal tumors with an ABC-like gene expression profile, such as primary central nervous system lymphoma (PCNSL), in which 37% of tumors are double mutant (Kraan et al. Leukemia, 28: 719-720 (2014), incorporated by reference herein; Chapuy et al. Blood, 127: 869-881 (2016), incorporated by reference herein; and Taniguchi et al. The American Journal of Surgical Pathology, 40: 324-334 (2016), incorporated by reference herein). Notably, a recent clinical trial in PCNSL reported that ibrutinib induced objective responses in 94% of cases, consistent with an extreme and uniform dependence on BCR signaling. Thus, we examined PCNSL samples for the presence of the MY-T-BCR and found relatively high expression in contrast to CLL and MCL patient biopsies.
[0293] The distinct modes of BCR signaling revealed by the CRISPR-Cas9 screens - constitutive GC BCR signaling and My-T-BCR-dependent chronic active BCR signaling - will inform the development of therapeutic agents targeting components of the BCR pathway and will help shape the design of precision medicine trials in aggressive lymphomas. Both types of BCR-dependent DLBCLs are sensitive to inhibition of the proximal BCR kinase SYK and the downstream PI3K pathway, but other aspects of proximal BCR signaling differ between these two BCR signaling modes. GCB DLBCLs with constitutive GC BCR signaling are uniquely dependent on LYN, supporting the development of LYN-selective SRC-family kinase inhibitors. Conversely, the phosphatase CD45 emerges as a therapeutic target in ABC but not GCB DLBCL. This work suggests that agents targeting BCR- dependent NF-κΒ activity - including inhibitors of BTK, PKCβ, PLCy2, TAK1 (MAP3K7), and ΙΚΚβ - could be developed and evaluated in ABC but not GCB DLBCL. These findings suggest that these agents would have their best opportunity to produce therapeutic responses
in tumors with the CD79A/B-MYD88 double mutant genotype because of hyperaddiction to NF-KB fostered by My-T-BCR complexes.
[0294] In further summary, herein is provied genetic, proteomic and cell biological evidence for a pro-survival signaling hub - termed the My-T-BCR supercomplex - that coordinates NF-κΒ activation in DLBCL and identifies tumors that respond to therapeutic inhibition of NF-κΒ by ibrutinib. This supercomplex is present in a subset of ABC DLBCL lines and tumors, but is generally absent from GCB DLBCL. Instead, GCB lines are sustained by an alternative "constitutive GC" BCR signaling mode that engages PI3K but not NF-KB (Fig. 5). The My-T-BCR supercomplex integrates signals from the BCR-dependent CBM complex and MYD88, which were previously thought to be parallel mechanisms to activate NF-κΒ in ABC DLBCL. BCR signaling controls CBM complex formation in normal B cells, but these studies demonstrate that TLR9 and MYD88 also influence CBM assembly in ABC DLBCL. Further, it has been proposed that MYD88 mutant
isoforms activate NF-κΒ by dimerizing spontaneously, but these studies show that TLR9 is required for NF-κΒ activation by MYD88 and the BCR. The dependence of ABC
DLBCL cells on TLR9 revealed that NF-κΒ activation by the My-T-BCR supercomplex occurs on the surface of endolysosomal vesicles. Consequently, the My-T-BCR
supercomplex is co-localized with the mTORCl complex, allowing the proposal that pro-survival, signaling cross-talk between mTOR and NF-κΒ takes place at this
intracellular location (Fig. 5).
[0295] While the My-T-BCR supercomplex was readily detected in a variety of malignant B cell types, it was not apparent in normal B cells in tonsils or reactive lymph nodes. Nonetheless, this signaling mechanism may play a role in non-transformed B- cells since the BCR is necessary for proliferative responses of normal B cells to TLR ligands. Moreover, in a murine model of systemic lupus erythematosis, B cell
proliferation depends on endosomal TLR7 and/or TLR9 recognition of ligands present in complex self-antigens that are internalized by the BCR. Although self-antigens also drive BCR signaling in ABC DLBCL, they have no known role in activating TLR9.
Thus, it is not clear whether ligand recognition by TLR9 is required for oncogenic signaling in ABC DLBCL.
[0296] The proteogenomic study revealed a new form of molecular heterogeneity among ABC DLBCL tumors that has implications for precision medicine approaches to these
often recalcitrant cancers. The My-T-BCR supercomplex was a feature of some, but not all, ABC DLBCL tumors. To some extent, this heterogeneity tracks with genetic
aberrations. Among ABC cell lines, those with MYD88L265P and a CD79B or CD79A mutation had My-T-BCR supercomplexes and were particularly sensitive to ibrutinib.
This double-mutant genotype was previously linked to frequent responses to ibrutinib in a trial of relapsed/refractory DLBCL. However, these results suggest that analysis of the My-T-BCR could provide information regarding oncogenic pathway dependence that is complementary to tumor genetics. Specifically, the My-T-BCR was detected in ibrutinib- responsive cases that lacked the double-mutant genotype, including one case that was wild type for MYD88, CD79B and CD79A. Similarly, the prevalence of My-T-BCR supercomplexes in PCNSL (82% of cases) fits with their high response rate to ibrutinib (80- 90%), which can not be explained by the prevalence of the double-mutant genotype
(37%). These considerations suggest that the My-T-BCR supercomplex could serve as a biomarker to identify ibrutinib-responsive ABC tumors.
[0297] It was observed that small molecule inhibitors of BTK and mTOR
cooperated in decreasing My-T-BCR supercomplex formation, which tracked with the synergism of these drugs in suppressing NF-κΒ activation and the growth of ABC lines in vitro and in vivo. Thus, My-T-BCR supercomplex formation could be used to assess the mechanism of action of drug combinations in ABC DLBCL, which could help in prioritizing certain combinations for clinical evaluation.
[0298] All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.
[0299] The use of the terms "a" and "an" and "the" and "at least one" and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The use of the term "at least one" followed by a list of one or more items (for example, "at least one of A and B") is to be construed to mean one item selected from the listed items (A or B) or any combination of two or more of the listed items (A and B), unless otherwise indicated herein or clearly contradicted by context. The terms "comprising," "having," "including," and "containing"
are to be construed as open-ended terms (i.e., meaning "including, but not limited to,") unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as") provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.
[0300] Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.
Claims
1. A method of detecting an association of a first protein and a second protein, the method comprising:
(A) obtaining a sample comprising one or more B cells;
(B) contacting the sample with a first antibody and a second antibody, wherein the first antibody binds the first protein and does not bind the second protein and the second antibody binds the second protein and does not bind the first protein, wherein the first antibody is of a species different than the first protein and the second antibody is of a species different than the second protein, and wherein the first antibody is of a species different than the second antibody;
(C) performing a proximity ligation assay using the first antibody and the second antibody and a detectable probe to produce a PLA signal of one or more detectable puncta;
(D) contacting the sample with a third antibody, wherein the third antibody binds to a protein on the B cell surface, and wherein the third antibody is labeled with a detectable label; and
(E) detecting the proximity ligation assay signal of (C) wherein a positive PLA signal indicates association of the first and second proteins in one or more of the B cells comprised in the sample.
2. The method of claim 1, wherein a proximity ligation assay signal of fluorescent puncta indicates association of the first and second proteins.
3. The method of claim 1 or 2, wherein the third antibody is fluorescently labeled.
4. The method of any one of claims 1-3, wherein the first antibody and the second antibody each bind to a protein component of at least one of the following complexes: the BCR complex, the MYD88 complex, and the mTORC l complex.
5. A method of identifying a B cell disorder having a greater probability of responding to treatment using an inhibitor, the method comprising:
(a) obtaining a B cell disorder sample;
(b) analyzing the sample for the presence of a protein complex, wherein the protein complex comprises two proteins, wherein each protein is a protein component of at least one of the following complexes: the BCR complex, the MYD88 complex, and the mTORCl complex,
wherein the two proteins are different from one another and are components of different complexes,
and wherein the analysis comprises detecting an association of the two proteins according to any one of claims 1-4; and
(c) identifying the sample having the presence of the protein complex of (b) as a B cell disorder having a greater probability of responding to treatment using an inhibitor of the BCR complex, an inhibitor of the MYD88 complex, or an inhibitor of the mTORCl complex, as compared to a sample having an absence of the protein complex of (b).
6. A method of identifying a B cell disorder having a greater probability of responding to treatment using an inhibitor, the method comprising:
(a) obtaining a B cell disorder sample;
(b) analyzing the sample for the presence of a protein complex, wherein the protein complex comprises two proteins, wherein each protein is a protein component of at least one of the following complexes: the BCR complex, the MYD88 complex, and the mTORCl complex,
wherein the two proteins are different from one another and are components of different complexes;
(b') detecting in the sample the presence of the protein complex of (b); and
(c) identifying the sample having the presence of the protein complex of (b) as a B cell disorder having a greater probability of responding to treatment using an inhibitor of the BCR complex, an inhibitor of the MYD88 complex, or an inhibitor of the mTORCl complex, as compared to a sample having an absence of the protein complex of (b).
7. The method of claim 5 or 6, wherein the sample is identified as a B cell disorder having a greater probability of responding to treatment
(i) using an inhibitor of the BCR complex, when the protein complex of (b) includes a protein component of the BCR complex,
(ii) using an inhibitor of the MYD88 complex, when the protein complex of (b) includes a protein component of the MYD88 complex, or
(iii) using an inhibitor of the mTORCl complex, when the protein complex of (b) includes a protein component of the mTORCl complex,
as compared to a sample having an absence of the protein complex of (b).
8. The method of any one of claims 5-7, wherein the sample is identified as a B cell disorder having a greater probability of responding to treatment
(i) using an inhibitor of the BCR complex, when the protein complex of (b) includes a protein component of the BCR complex,
(ii) using an inhibitor of the MYD88 complex, when the protein complex of (b) includes a protein component of the MYD88 complex, and
(iii) using an inhibitor of the mTORCl complex, when the protein complex of (b) includes a protein component of the mTORCl complex,
as compared to a sample having an absence of the protein complex of (b).
9. The method of any one of claims 5-8, wherein the B cell disorder is a lymphoma.
10. The method of claim 9, wherein the lymphoma is a diffuse large B cell lymphoma (DLBCL), a primary central nervous system lymphoma (PCNSL), or a
Waldenstrom macroglobulinemia/ lympoplasmacytic lymphoma (WM/LPL).
11. The method of claim 10, wherein the lymphoma is a DLBCL and is an activated B-cell-like (ABC) DLBCL.
12. The method of any one of claims 5-11, wherein the protein complex comprises the proteins of BCR, MYD88, and mTOR.
13. The method of any one of claims 5-12, wherein the B cell disorder sample is a formalin-fixed and paraffin-embedded (FFPE) sample.
14. The method of any one of claims 5-13, wherein the inhibitor is OSI-027, AZD-8055, AZD,2014, SIROLIMUS, BEZ-235, everolimus, or ibrutinib.
15. The method of any one of claims 5-14, wherein the inhibitor is ibrutinib.
16. An inhibitor of the BCR complex, MYD88 complex, or mTORCl complex for use in treating, in a subject in need thereof, a B cell disorder having a greater probability of responding to treatment using an inhibitor, wherein the B cell disorder is identified as a B cell disorder having a greater probability of responding to treatment using an inhibitor according to the method of any one of claims 5-15.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201762518994P | 2017-06-13 | 2017-06-13 | |
| US62/518,994 | 2017-06-13 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2018231322A1 true WO2018231322A1 (en) | 2018-12-20 |
Family
ID=62044985
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2018/025377 Ceased WO2018231322A1 (en) | 2017-06-13 | 2018-03-30 | B cell disorder classification and susceptibity to inhibitors |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2018231322A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11879000B2 (en) | 2019-11-15 | 2024-01-23 | National Guard Health Affairs | Purification and identification of a protein complex containing b-cell lymphoma protein (BCL10) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014016401A1 (en) * | 2012-07-27 | 2014-01-30 | Centre Leon Berard | DETECTION OF THE ERα/SRC/PI3K COMPLEX AS PREDICTIVE MARKER IN BREAST CANCER |
| WO2014122275A1 (en) * | 2013-02-08 | 2014-08-14 | Fundación Pública Andaluza Progreso Y Salud | Method for the diagnosis and monitoring of autoinmune diseases |
-
2018
- 2018-03-30 WO PCT/US2018/025377 patent/WO2018231322A1/en not_active Ceased
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014016401A1 (en) * | 2012-07-27 | 2014-01-30 | Centre Leon Berard | DETECTION OF THE ERα/SRC/PI3K COMPLEX AS PREDICTIVE MARKER IN BREAST CANCER |
| WO2014122275A1 (en) * | 2013-02-08 | 2014-08-14 | Fundación Pública Andaluza Progreso Y Salud | Method for the diagnosis and monitoring of autoinmune diseases |
Non-Patent Citations (72)
| Title |
|---|
| "Histological and Histochemical Methods: Theory and Practice", 2008, COLD SPRING HARBOR LABORATORY PRESS |
| AIBA ET AL., BLOOD, vol. 111, 2008, pages 1497 - 1503 |
| ALLALOU ET AL., COMPUT. METHODS PROGRAMS BIOMED., vol. 94, 2009, pages 58 - 65 |
| BRUMMELKAMP ET AL., CANCER CELL, vol. 2, 2002, pages 243 - 247 |
| CERIBELLI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 111, 2014, pages 11365 - 11370 |
| CHAPUY ET AL., BLOOD, vol. 127, 2016, pages 869 - 881 |
| CHEN ET AL., CANCER CELL, vol. 23, 2013, pages 826 - 838 |
| CHENG ET AL., BLOOD, vol. 118, 2011, pages 6342 - 6352 |
| COFFEY ET AL., J. PHARMACOL. EXP. THER., vol. 340, 2012, pages 350 - 359 |
| COMPAGNO ET AL., NATURE, vol. 459, 2009, pages 717 - 721 |
| COX ET AL., J. PROTEOME RES., vol. 10, 2011, pages 1794 - 1805 |
| CYSTER ET AL., NATURE, vol. 381, 1996, pages 325 - 328 |
| DAVIS ET AL., NATURE, vol. 463, 2010, pages 88 - 92 |
| DOENCH ET AL., NAT. BIOTECHNOL., vol. 34, 2016, pages 184 - 191 |
| ENGEL ET AL., IMMUNITY, vol. 3, 1995, pages 39 - 50 |
| EZELL ET AL., ONCOTARGET, vol. 5, 2014, pages 4990 - 5001 |
| FEARON ET AL., ANNU. REV. IMMUNOL., vol. 13, 1995, pages 127 - 149 |
| G. LENZ ET AL., PROC. NATL. ACAD. SCI. USA, vol. 105, 2008, pages 13520 - 13525 |
| GROSS ET AL., J. IMMUNOL., vol. 182, 2009, pages 5382 - 5392 |
| HAFNER ET AL., NAT. METHODS, vol. 13, 2016, pages 521 - 527 |
| HART ET AL., CELL, vol. 163, 2015, pages 1515 - 1526 |
| HEWITT, METHODS IN ENZYMOLOGY, vol. 410, 2006, pages 400 - 415 |
| HIBBS ET AL., CELL, vol. 83, 1995, pages 301 - 311 |
| HOU ET AL., IMMUNITY, vol. 34, 2011, pages 375 - 384 |
| KATHRIN KLÄSENER; PALASH C MAITY; ELIAS HOBEIKA; JIANYING YANG; MICHAEL RETH: "B cell activation involves nanoscale receptor reorganizations and inside-out signaling by Syk", ELIFE, vol. 3, 24 June 2014 (2014-06-24), pages 1 - 17, XP055184372 * |
| KATO ET AL., J. IMMUNOL., vol. 160, 1998, pages 4788 - 4795 |
| KELLY ET AL., J. EXP. MED., vol. 212, 2015, pages 2189 - 2201 |
| KRAAN ET AL., LEUKEMIA, vol. 28, 2014, pages 719 - 720 |
| KRAUS ET AL., J. EXP. MED., vol. 194, 2001, pages 455 - 469 |
| KULATHU ET AL., IMMUNOLOGICAL REVIEWS, vol. 232, 2009, pages 286 - 299 |
| LAM ET AL., CELL, vol. 90, 1997, pages 1073 - 1083 |
| LAM ET AL., CLIN. CANCER RES, vol. 11, 2005, pages 28 - 40 |
| LEADBETTER ET AL., NATURE, vol. 416, 2002, pages 603 - 607 |
| LENZ ET AL., PROC. NATL. ACAD. SCI. USA, vol. 105, 2008, pages 13520 - 13525 |
| LIN ET AL., NATURE, vol. 465, 2010, pages 885 - 890 |
| LM STAUDT: "NIH Wednesday afternoon lecture - Therapy of lymphoma inspired by functional and structural genomics", 1 February 2017 (2017-02-01), XP054978411, Retrieved from the Internet <URL:https://videocast.nih.gov/Summary.asp?Live=21795&bhcp=1> [retrieved on 20180611] * |
| MAECKER ET AL., J. EXP. MED., vol. 185, 1997, pages 1505 - 1510 |
| MANJARREZ-ORDUNO ET AL., NAT. GENET., vol. 44, 2012, pages 1227 - 1230 |
| MATHEWS GRINER ET AL., PNAS, vol. 11, 2014, pages 2349 - 2354 |
| MATHEWS GRINER ET AL., PROC. NATL. ACAD. SCI. U. S. A., vol. 111, 2014, pages 2349 - 2354 |
| MOCSAI ET AL., NAT. REV. IMMUNOL., vol. 10, 2010, pages 387 - 402 |
| NGO ET AL., NATURE, vol. 441, 2006, pages 106 - 110 |
| NGO ET AL., NATURE, vol. 470, 2011, pages 115 - 119 |
| NOWOSAD, NAT. IMMUNOL., vol. 17, 2016, pages 870 - 877 |
| OELLERICH ET AL., BLOOD, vol. 121, 2013, pages 3889 - 3899,S3881-3866 |
| OTIPOBY ET AL., PROC. NATL. ACAD. SCI. USA, vol. 112, 2015, pages 12145 - 12150 |
| PERRON ET AL., MOL. PHARM., vol. 85, 2014, pages 553 - 63 |
| PFEIFER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 110, 2013, pages 12420 - 12425 |
| QIAO ET AL., MOL. CELL, vol. 51, 2013, pages 766 - 779 |
| RICKERT ET AL., NATURE, vol. 376, 1995, pages 352 - 355 |
| RUI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 113, 2016, pages E7260 - E7267 |
| SAIJO ET AL., NAT. IMMUNOL., vol. 4, 2003, pages 274 - 279 |
| SAITOH ET AL., IMMUNOLOGICAL REVIEWS, vol. 227, 2009, pages 32 - 43 |
| SANDER ET AL., IMMUNITY, vol. 43, 2015, pages 1075 - 1086 |
| SCHINDELIN ET AL., NAT. METHODS, vol. 9, 2012, pages 676 - 682 |
| SCHMITZ ET AL., LEUKEMIA, vol. 19, 2005, pages 1452 - 1458 |
| SCHMITZ ET AL., NATURE, vol. 490, 2012, pages 116 - 120 |
| SHAFFER ET AL., ANNU. REV. IMMUNOL., vol. 30, 2012, pages 565 - 610 |
| SHALEM ET AL., SCIENCE, vol. 343, 2014, pages 84 - 87 |
| SODERBERG ET AL., METHODS, vol. 45, 2008, pages 227 - 232 |
| SRINIVASAN ET AL., CELL, vol. 139, 2009, pages 573 - 586 |
| TANIGUCHI ET AL., THE AMERICAN JOURNAL OF SURGICAL PATHOLOGY, vol. 40, 2016, pages 324 - 334 |
| THOME ET AL., COLD SPRING HARBOR PERSPECTIVES IN BIOLOGY, vol. 2, 2010, pages a003004 |
| WANG ET AL., IMMUNITY, vol. 17, 2002, pages 501 - 514 |
| WANG ET AL., J. EXP. MED., vol. 184, 1996, pages 831 - . 838 |
| WANG ET AL., J. EXP. MED., vol. 211, 2014, pages 413 - 426 |
| WANG ET AL., SCIENCE, vol. 350, 2015, pages 1096 - 1101 |
| WILSON ET AL., NAT. MED., vol. 21, 2015, pages 922 - 926 |
| WRIGHT ET AL., BIOINFORMATICS, vol. 19, 2003, pages 2448 - 2455 |
| YANG ET AL., CANCER DISCOV., vol. 4, 2014, pages 480 - 493 |
| YOUNG ET AL., PROC. NATL. ACAD. SCI. USA, vol. 112, 2015, pages 13447 - 13454 |
| ZIKHERMAN ET AL., IMMUNITY, vol. 32, 2010, pages 342 - 354 |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11879000B2 (en) | 2019-11-15 | 2024-01-23 | National Guard Health Affairs | Purification and identification of a protein complex containing b-cell lymphoma protein (BCL10) |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Phelan et al. | A multiprotein supercomplex controlling oncogenic signalling in lymphoma | |
| Yu et al. | B cell-specific XIST complex enforces X-inactivation and restrains atypical B cells | |
| Yamagishi et al. | Targeting excessive EZH1 and EZH2 activities for abnormal histone methylation and transcription network in malignant lymphomas | |
| Gilan et al. | Functional interdependence of BRD4 and DOT1L in MLL leukemia | |
| Delmore et al. | BET bromodomain inhibition as a therapeutic strategy to target c-Myc | |
| Zeng et al. | Genome-wide CRISPR screening reveals genetic modifiers of mutant EGFR dependence in human NSCLC | |
| Schick et al. | Genetic alterations of the SUMO isopeptidase SENP6 drive lymphomagenesis and genetic instability in diffuse large B-cell lymphoma | |
| JP2023514441A (en) | Method for identifying functional disease-specific regulatory T cells | |
| Wang et al. | Proteotoxic stress response drives T cell exhaustion and immune evasion | |
| Ghram et al. | The eukaryotic translation initiation factor eIF4E reprograms alternative splicing | |
| Suzuki et al. | TUG1-mediated R-loop resolution at microsatellite loci as a prerequisite for cancer cell proliferation | |
| EP3016512A2 (en) | Soluble cd33 for treating myelodysplastic syndromes (mds) | |
| Mahat et al. | Mutant p53 exploits enhancers to elevate immunosuppressive chemokine expression and impair immune checkpoint inhibitors in pancreatic cancer | |
| Andreou | DDX41: a multifunctional DEAD-box protein involved in pre-mRNA splicing and innate immunity | |
| Lachapelle et al. | Proteome-wide identification of WRN-interacting proteins in untreated and nuclease-treated samples | |
| Gimple et al. | Sorting nexin 10 sustains PDGF receptor signaling in glioblastoma stem cells via endosomal protein sorting | |
| Zhou et al. | An oncohistone-driven H3. 3K27M/CREB5/ID1 axis maintains the stemness and malignancy of diffuse intrinsic pontine glioma | |
| Gray et al. | Engineering a synthetic cell panel to identify signalling components reprogrammed by the cell growth regulator anterior gradient-2 | |
| Walker et al. | Rapid P-TEFb-dependent transcriptional reorganization underpins the glioma adaptive response to radiotherapy | |
| Zhu et al. | Molecular glue degrader function of SPOP inhibitors enhances STING-dependent immunotherapy efficacy in melanoma models | |
| WO2018231322A1 (en) | B cell disorder classification and susceptibity to inhibitors | |
| KR102049090B1 (en) | An anticancer agent for treating cancers resistant to EGFR inhibitor | |
| Gabele et al. | Unveiling IRF4-steered regulation of context-dependent effector programs in CD4+ T cells under Th17-and Treg-skewing conditions | |
| EP2536741A2 (en) | Gene fusion targeted therapy | |
| US20220218708A1 (en) | Methods for treating smarcb1 deficient cancer or pazopanib resistant cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18719725 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 18719725 Country of ref document: EP Kind code of ref document: A1 |
















