WO2018204367A1 - Profiling of dna methylation using magnetoresistive biosensor array - Google Patents

Profiling of dna methylation using magnetoresistive biosensor array Download PDF

Info

Publication number
WO2018204367A1
WO2018204367A1 PCT/US2018/030457 US2018030457W WO2018204367A1 WO 2018204367 A1 WO2018204367 A1 WO 2018204367A1 US 2018030457 W US2018030457 W US 2018030457W WO 2018204367 A1 WO2018204367 A1 WO 2018204367A1
Authority
WO
WIPO (PCT)
Prior art keywords
dna strands
dna
methylated
unmethylated
temperature
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2018/030457
Other languages
French (fr)
Inventor
Jung-Rok Lee
Shan X. Wang
Mikkel F. HANSEN
Martin Dufva
Giovanni Rizzi
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Danmarks Tekniske Universitet
Leland Stanford Junior University
Original Assignee
Danmarks Tekniske Universitet
Leland Stanford Junior University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Danmarks Tekniske Universitet, Leland Stanford Junior University filed Critical Danmarks Tekniske Universitet
Priority to CN201880029325.9A priority Critical patent/CN110662845A/en
Publication of WO2018204367A1 publication Critical patent/WO2018204367A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6827Hybridisation assays for detection of mutation or polymorphism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6816Hybridisation assays characterised by the detection means
    • C12Q1/6825Nucleic acid detection involving sensors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/154Methylation markers

Definitions

  • the present invention relates generally to biosensing techniques and devices. More specifically, it relates to use of biosensor arrays for DNA methylation and mutation analysis.
  • Cancer is a cellular disease caused by the stepwise accumulation of genetic and epigenetic alterations. Extensive sequencing efforts have identified recurrent genetic mutations that are useful as genetic biomarkers for assessing risk of developing cancer, classifying disease subtypes, predicting response to treatment, and monitoring efficacy of treatment. DNA methylation causes epigenetic silencing of tumor suppressor genes and is studied for both its direct implication in oncogenesis and for its utility as cancer biomarker. In bladder and colon cancer, the combination of genetic and epigenetic analyses has been proven to have a higher diagnostic value than either of the two approaches applied separately.
  • methylation profiling is not a yes-no result, as Gene silencing mechanisms driven by methylation are generally sensitive to the overall density of methylated sites and typically multiple CpG dinucleotides (the most common methylation site) are present in gene promoters. Finally, the methylation density may vary between alleles and cells within a single tumor, resulting in a heterogeneous pattern.
  • a variety of techniques has been developed to detect single point mutations in DNA based on amplification, probe hybridization, enzymatic digestion, gel electrophoresis, or sequencing. DNA methylation information is lost during polymerase chain reaction (PCR) amplification, and DNA hybridization is insensitive to the methylation status of the target region.
  • a methylation sensitive pretreatment of the DNA has to be employed.
  • the two main DNA methylation analysis techniques are based on methylation sensitive enzymatic digestion, affinity enrichment using antibodies specific for methylated cytosine or bisulphite conversion of unmethylated cytosine into uracil.
  • Bisulphite conversion is most widely used since a methylation event is converted into a single base alteration (C/T) that can be detected with techniques derived from mutation detection including sequencing array hybridization, methylation sensitive PCR, and methylation sensitive melting curve analysis. Sequencing of bisulphite-converted DNA quantifies the methylation status and allows for comparison of data from different sequencing runs and batches, but it is costly and time consuming.
  • Amplification and melting-based techniques are not specific for single methylation sites and are not easily scalable to investigate a high number of methylation sites.
  • Array-based methods such as the Illumina BeadChip (Illumina Inc., San Diego, CA), offer a highly multiplexed site- specific assay.
  • DNA products comprise mostly three bases (guanine, adenine, and thymine plus residues of methylated cytosine). This reduced sequence complexity makes design of probes for end-point detection complicated and the decreased sequence variation reduces specificity.
  • the present invention aims to perform methylation (and, optionally, mutation) profiling simultaneously in a scalable chip platform that offers highly specific and quantitative DNA methylation and mutation data on a compact, easy-to-use, and potentially low-cost platform.
  • Our preferred approach is based on hybridization of magnetically labeled target DNA to DNA probes tethered to the surface of a GMR biosensor array.
  • melting curve measurements of the surface-tethered DNA hybrids. This avoids conventional assay condition optimization since the target-probe hybrids are exposed to continuously increasing stringency during melting curve measurement. Melting curves for surface-tethered DNA probes have been also measured using fluorescence and surface plasmon resonance.
  • the GMR biosensors offer high sensitivity, virtually no magnetic background signal from biological samples and no dependence on temperature.
  • the present invention provides a method to simultaneously profile DNA mutation and methylation events for an array of sites with single site specificity. It advantageously employs methylation detection with magnetoresi stive sensor arrays, and simultaneous profiling of methylation and mutation in DNA sequences. Genomic (mutation) or bisulphite-treated (methylation) DNA is amplified using non-discriminatory primers, and the amplicons are then hybridized to an array of magnetoresistive (MR) biosensor followed by real-time melting curve measurements.
  • MR biosensing technique offers scalable multiplexed detection of DNA hybridization, which has been shown to be insensitive to variations in temperature, pH value and biological fluid matrix. The melting curve approach further enhances the assay specificity and tolerance to variations in probe length.
  • the technique may use a method of applying methyltransferase on array to transfer methylation sites on the DNA sequences tethered to the sensor surface and directly target methylated sites for detection.
  • This method allows for simultaneously profiling mutation and methylation sites and provides quantitative assessment of methylation density equivalent to bisulphite pyrosequencing.
  • Embodiments of the invention advantageously provide epigenetic and mutational analysis that may be easily implemented in a magnetic DNAchip. Magnetic detection of hybridization offers high sensitivity and virtually no magnetic background from the sample and the sample matrix. A real-time melting curve measurement of the target- probe hybrids increases the specificity of the assay by challenging the hybrids with increasingly stringent conditions.
  • Methods to increase the stringency include, but are not limited to, raising the temperature of the MR biosensor array and decreasing the salt (Na+) concentration in the sample buffer.
  • the real-time melting curve measurement eliminates the need for probe optimization required for end point detection.
  • a method of methylation detection provides a quantitative description of the methylation density in DNA strands.
  • the method includes performing bisulphite conversion of the DNA strands containing methylated and unmethylated sites to create converted DNA strands with mismatch base pairs; performing PCR amplification of the converted DNA strands to produce PCR amplified converted DNA strands; hybridizing the PCR amplified converted DNA strands to complementary DNA strands immobilized onto a magnetoresi stive (MR) sensor array; magnetically labeling of the PCR amplified converted DNA strands preceding or following hybridization; increasing a stringency condition to cause the magnetically labeled single strand target DNA strands to be denatured from the complementary DNA strands immobilized onto a magnetoresi stive (MR) sensor array; reading out in real time during the increasing of the stringency condition a denaturation signal resulting from the denatured magnetically labeled single strand target DNA strands; and determining stringency conditions of methylated and unmethylated DNA strands from the denaturation signal.
  • MR magnetoresi stive
  • the method also includes reading out in real time a binding signal during hybridizing the magnetically labeled single strand target DNA strands with complementary DNA strands immobilized onto a magnetoresistive (MR) sensor array.
  • MR magnetoresistive
  • the stringency condition may be temperature, wherein increasing the stringency condition comprises increasing the temperature while salt concentration is held constant, and wherein determining the stringency conditions of the methylated and unmethylated DNA strands comprises determining melting temperatures of the methylated and unmethylated DNA strands.
  • the stringency condition may be salt concentration, wherein increasing the stringency condition comprises decreasing the salt concentration while temperature is held constant, and wherein determining the stringency conditions of the methylated and unmethylated DNA strands comprises determining melting salt concentrations of the methylated and unmethylated DNA strands.
  • the stringency condition may be a combination of temperature and salt, wherein increasing stringency comprises simultaneously increasing temperature and decreasing salt concentration.
  • the invention thus provides a method of methylation detection using a magnetoresi stive (MR) sensor array.
  • DNA strands with methylated sites are bisulphite-converted and PCR amplified. They are then hybridized to a temperature-controlled magnetoresi stive (e.g., GMR) biosensor array with immobilized complementary DNA strands and magnetically labeled.
  • GMR magnetoresi stive
  • Target DNA strands are denatured from the immobilized DNA strands by ramping up temperature. Real-time measurements of binding signal from target DNA are used to determine melting curve.
  • salt concentration rather than temperature is used for denaturing the target DNA strands.
  • the technique can be combined with measurements of genetic mutations on the same biosensor chip.
  • a method of methylation detection provides a quantitative description of the methylation density in DNA sequences.
  • the method includes performing bisulphite conversion of DNA strands with or without methylated sites; PCR amplification of converted DNA strands; hybridization of converted target DNA strands with a MR sensor array immobilized with (unmethylated) complementary DNA strands; adding methyltransferase to methylate the complementary DNA strands corresponding to the methylated sites of the target DNA strands; ramping up temperature until target DNA strands are denatured from the immobilized DNA strands, leaving behind the methylated single strand DNA if the target DNA is methylated, or leaving behind the unmethylated single strand DNA if the target DNA is unmethylated; adding magnetic nanoparticles conjugated with methyl-recognizing moieties, such as antimethylated lysine antibody, which will bind to methylated DNA strands immobilized on the sensor; reading out the binding signal in real time, and determining if the im
  • Fig. 1 shows an embodiment of the invention.
  • Fig. 2 provides a schematic overview of an exemplary protocol for the detection of magnetically labeled DNA using a GMR biosensor device.
  • Fig. 3A is a graph of the real-time monitoring of AMR signal from GMR biosensors.
  • Figs. 3B-C show melting curves from wild type WT and mutant type MT probes targeting BRAF c.1391 G>A mutation.
  • Figs. 4A-B are schematic illustrations of the bisulphite conversion process.
  • Figs. 4C-D show melting curves from methylated (M) and unmethylated (U) probes targeting /Tmethylation (site pi).
  • Fig. 5A shows mutation profiling of melanoma cell lines.
  • Figs. 5B-C are a heat map and a mutation map, respectively, corresponding to Fig. 5A.
  • Figs. 6A-C show results of mutation and methylation profiling of melanoma cell lines.
  • Fig. 7A is an exemplary schematic diagram of a differential magnetoresistive sensor bridge.
  • Fig. 7B is a schematic representation of temperature and salt concentration melting.
  • Fig. 7C is an exemplary schematic measurement setup.
  • Figs. 9A-B show salt concentration melting curves of WT DNA target hybridized to WT and MT DNA probes for the CD8/9 mutation.
  • Fig. 10 shows the values of melting temperature T m and salt concentration c m for the WT target and WT probes (filled symbols) and MT probes (open symbols) for the CD 8/9 locus of HBB.
  • Figs. 11C-D show the corresponding temperature and salt concentration melting profiles measured for the CD 17 locus.
  • Fig. 1 is a flow chart providing an overview of a method of methylation detection providing a quantitative description of the methylation density in DNA strands, according to an embodiment of the invention.
  • step 100 bisulphite conversion of the DNA strands containing methylated and unmethylated sites is performed to create converted DNA strands with mismatch base pairs.
  • step 102 PCR amplification of the converted DNA strands is performed.
  • step 104 single strand target DNA strands among the PCR amplified converted DNA strands are magnetically labeled.
  • the magnetically labeled single strand target DNA strands are hybridized with complementary DNA strands immobilized onto a magnetoresi stive (MR) sensor array.
  • MR magnetoresi stive
  • a stringency condition is increased to cause the magnetically labeled single strand target DNA strands to be denatured from the complementary DNA strands immobilized onto a magnetoresi stive (MR) sensor array.
  • MR magnetoresi stive
  • step 110 during the increasing of the stringency condition a denaturation signal resulting from the denatured magnetically labeled single strand target DNA strands is read out in real time.
  • step 112 stringency conditions of methylated and unmethylated DNA strands are determined from the denaturation signal.
  • the stringency condition may be temperature, in which case increasing the stringency condition comprises increasing the temperature while salt concentration is held constant. Determining the stringency conditions of the methylated and unmethylated DNA strands in this case comprises determining melting temperatures of the methylated and unmethylated DNA strands.
  • the stringency condition may be salt concentration, in which case increasing the stringency condition comprises decreasing the salt concentration while temperature is held constant. Determining the stringency conditions of the methylated and unmethylated DNA strands in this case comprises determining melting salt concentrations of the methylated and unmethylated DNA strands.
  • the method may be used to determine mutation sites simultaneously with methylation sites.
  • performing bisulphite conversion of the DNA strands containing methylated and unmethylated sites includes performing bisulphite conversion of the DNA strands containing methylated and unmethylated sites and wild type genes and mutated genes.
  • determining stringency conditions of methylated and unmethylated DNA strands from the denaturation signal in this case includes determining stringency conditions of methylated and unmethylated DNA strands and wild type genes and mutated type genes from the denaturation signal.
  • GMR Giant Magnetoresi stive
  • KIT Tyrosine Kinase
  • MNP Magnetic NanoParticle
  • MR MagnetoResistance
  • MT Mutant Type
  • PCR Polymerase Chain Reaction
  • RARB Retinoic Acid Receptor ⁇
  • SNP Single Nucleotide Polymorphism
  • WT Wild Type.
  • Fig. 2 provides a schematic overview of a protocol 202 for the detection of magnetically labeled DNA using a GMR biosensor device 200, according to an embodiment of the invention.
  • PCR products are injected into the reaction well over the chip 204.
  • DNA labeled with MNPs 206 hybridizes to complementary surface-tethered probes for 1 hour at 37 °C, resulting in hybridized DNA labeled with MNPs 208. Unbound sample is removed by washing.
  • melting step 214 the temperature is swept from 20 °C to 65 °C, causing denaturization of the DNA from the probes 210 to measure the melting temperature, T m .
  • MNP-ssDNA ssDNA conjugated to MNPs
  • a mutation To genotype a mutation, we employed a set of two probes complementary to the wild type (WT) and mutant type (MT) sequences of the sample (supplementary information Table 1). During hybridization at low stringency, amplicons hybridized to both WT and MT probes with similar affinity. To obtain single base specificity, stringent washing is typically used after hybridization in DNA microarray. To achieve a more flexible system for detection of single-base mutations, we challenged the hybrids by increasing the temperature and continuously measuring DNA melting simultaneously for all probes on the GMR biosensor array.
  • Fig. 3A is a graph of the real-time monitoring of AMR signal from GMR biosensors functionalized with positive and negative references, wild type (WT) and mutant type (MT) probes for the BRAF c.
  • a biotinylated DNA probe was used as positive reference and a DNA probe with an unspecific sequence was used as negative reference. After 1 hour of hybridization, the MT probe gave a slightly higher AMR signal than the WT probe, indicating that low- stringency hybridization was insufficient to genotype the WT sample.
  • Fig. 3B and Fig. 3C show melting curves from WT and mutant type MT probes targeting BRAF c. l391G>A mutation obtained for the indicated cell lines, where the EST045 and EST 164 cell lines were wild type and homozygous mutant, respectively.
  • the melting temperature T m is defined as the temperatures at which the normalized curves cross 0.5.
  • AT m is the difference in melting temperature between the MT and WT probes.
  • Fig. 3B shows the melting curve of WT BRAF amplicons hybridized to WT and MT probes for the c. l391G>A mutation.
  • T m the melting temperature at which the signal (AMR) dropped to the half of its initial signal (at 20 °C).
  • Each melting experiment was repeated with two identical GMR biosensor chips. Three sensors were functionalized with each probe, thus generating up to six identical melting curves for each probe. The obtained melting curves were found to be highly reproducible - both from sensor to sensor and from chip to chip.
  • Fig. 3C shows melting curves measured for a cell line heterozygous for the BRAF c. l391G>A mutation. 22
  • the resulting melting curves from WT and MT probes were both given by the contribution of low-Jm and high-J m DNA hybrids. Therefore, the melting curves overlapped and presented a lower slope.
  • Fig. 4A, Fig. 4B are schematic illustrations of the bisulphite conversion process.
  • Upon bisulphite treatment 402, 412 unmethylated cytosines in DNA 410 are converted to uracil in DNA 414 (Fig. 4B) whereas 5-methylcytosines in DNA 400 are retained in DNA 404 (Fig. 4A).
  • Fig. 4B unmethylated cytosines in DNA 410 are converted to uracil in DNA 414
  • Fig. 4A 5-methylcytosines in DNA 400 are retained in DNA 404
  • PCR 406 which produces products 408, 418
  • uracil in 414 is substituted by thymine.
  • the methylated cytosines are mapped to single base alterations (C>T) of the amplicons.
  • Fig. 4C and Fig. 4D show melting curves from methylated (M) and unmethylated (U) probes targeting KIT methylation (site pi).
  • the melting curves were measured for Fig. 4C the hypermethylated cell line EST045 and Fig. 4D the unmethylated cell line EST 164.
  • the melting curves are used to estimate methylation status of the KIT promoter (site pi) of hypermethylated (EST045) and wild-type (EST164) cell line.
  • the amplicons were hybridized to probes complementary to unmethylated (U) or methylated (M) target DNA. Melting curves were measured as described previously.
  • AT m T m (M) - T m (U).
  • a negative ⁇ ⁇ indicates a higher complementarity of the target to the U probe and a lower degree of methylation.
  • the -20 bp region of the KIT promoter investigated includes three CpG sites that can be methylated (sequences in supplementary information Table 1), and thus we expect higher AT m than for single base substitution. For the hypermethylated cell line in Fig.
  • the GMR biosensor array comprises of 64 individual sensors that can be individually functionalized with amino-modified DNA probes.
  • the GMR biosensor array comprises of 64 individual sensors that can be individually functionalized with amino-modified DNA probes.
  • the targeted regions of BRAF and of NRAS were amplified by non-discriminatory PCR.
  • the promoter regions of KIT and RARB were amplified by non-discriminatory PCR after bisulphite conversion.
  • Fig. 5B Heat map of AT m measured for the mutation and for the investigated EST cell lines.
  • Fig. 5C Heat map of measured AT m with applied threshold to genotype mutations.
  • Fig. 5A shows the AT m values measured for the BRAF c. l391G>A mutation for all cell lines.
  • the AT m values measured for all investigated mutations for each cell line are displayed in the heat map of Fig. 5B.
  • Classifying WT (AT m ⁇ -2 °C), heterozygous MT (-2 °C ⁇ AT m ⁇ 2 °C), and homozygous MT ( ⁇ ⁇ > 2 °C) resulted in the mutation map presented in Fig. 5C.
  • All mutations identified in the cell lines were consistent with previous genotyping data.
  • ⁇ ⁇ -0.2(4) °C, genotyping the cell line as heterozygous for this mutation; however, the cell line is known to be heterozygous for an A>G substitution in that location.
  • Methylation profiling differs substantially from genotyping since the methylation status of each CpG site in the promoter region varies between alleles and within a cell population. Therefore, it requires a different data analysis in terms of methylated fraction of the sample DNA.
  • Combining multiple investigated sites with the intrinsic variation of the methylation pattern we obtained a continuous variation of AT m for the analyzed cell lines.
  • Fig. 6A shows the measured AT m values for all cell lines.
  • higher AT m indicates higher affinity of the sample to the M probe, i.e., a hypermethylation event.
  • the complex AT m pattern is a direct consequence of the intrinsic methylation variation.
  • Fig. 6A-C show results of mutation and methylation profiling of melanoma cell lines.
  • Fig. 6A is a heat map of AT m measured for KIT and RARB methylation probes for the seven investigated EST cell lines. Calculation of AT m for EST007 KIT was not possible due to low binding signal.
  • Fig. 6B is a graph of AT m values measured for KIT pi (squares) and p2 (circles) methylation probe locations vs. methylation density measured by pyrosequencing.
  • methylation density was assessed independently by pyrosequencing of the bisulphite- converted DNA.
  • Fig. 6B, Fig. C show AT m measured using the GMR biosensor versus the methylation density obtained by pyrosequencing for the KIT pi and p2 probe locations and the RARB pi and p2 probe locations, respectively. In these plots, each point corresponds to one of the measured cell lines.
  • the probes can be tailored to sacrifice linearity to favor higher values of AT m .
  • the above examples have illustrated an approach for simultaneous DNA mutation and methylation profiling.
  • Our method combines the DNA microarray techniques for both mutation and methylation analysis in a single platform. Melting curves measurements are used to increase the specificity of mutation detection. For methylation detection, the melting curve quantifies the methylation state at a level equivalent to pyrosequencing. The same technique could potentially be employed on a variety of other platforms capable of real-time monitoring of the DNA hybridization vs. temperature.
  • the GMR biosensor platform has a low cross-sensitivity to temperature and provides a sensitive readout. Although it does not offer the extreme throughput as advanced bead microarray systems (e.g.
  • the GMR biosensor platform in its present format, can be used for the simultaneous triplicate investigation of about 20 mutation and methylation sites. This number is sufficient for many clinical applications where focus is limited to a small number of mutations and methylation sites of relevance for a specific cancer. Nevertheless, the GMR biosensor array has a modular design that can be scaled to include up to thousands of biosensors.
  • Melanoma cell lines for this study were obtained from The European Searchable Tumour Line Database (ESTDAB: http://www. ebi.ac.uk/ipd/estdab) and were maintained in RPMI-1640 medium containing 10% FBS and antibiotics at 37 °C and 5% C0 2 .
  • the PCR primers for this study have been modified from Dahl et al. and were obtained from DNA Technology A/S, Denmark. The sequences can be found in the supplementary material Table 2.
  • the amine modified DNA probes (sequences in supplementary material Table 1) were matched for melting temperature calculated with nearest-neighbor model. The probes were obtained from DNA Technology A/S.
  • the other reagents poly(ethylene-alt-maleic anhydride) (Sigma Aldrich), poly(allylamine hydrochloride) (Polyscience), distilled water (Invitrogen), l-Ethyl-3-(3- dimethylaminopropyl)-carbodiimide EDC (Sigma Aldrich), N-hydroxysuccinimide NHS (Sigma Aldrich) 1% bovine serum albumin BSA (Sigma Aldrich), phosphate buffered saline PBS (Gibco), Tween 20 (Sigma Aldrich), Urea (Fisher Scientific), 20 ⁇ saline sodium citrate SSC (Invitrogen), mineral oil (Sigma Aldrich), MNPs Streptavidin MicroBeads (Miltenyi), magnetic separation columns ⁇ Columns (Miltenyi).
  • Genomic DNA was isolated using the Qiagen AllPrep DNA/RNA/Protein Mini kit (Qiagen GmbH, Hilden, Germany) and quantified using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE). Bisulphite conversion of DNA (500 ng) was carried out using the EZ DNA Methylation-GoldTM Kit (Zymo Research, Irvine, CA) according to the manufacturer's protocol.
  • PCR amplification Prior to the GMR biosensor assay, PCR was performed using a VeritiTM 96-Well Thermal Cycler (Applied Biosystems) and TEMPase Hot Start Polymerase (VWR).
  • a magnetic separation column ( ⁇ column, Miltenyi Biotec Norden AB, Lund, Sweden) was prepared by washing with 1 mL of 1% Tween 20 and 1 mL of 0.1% BSA containing 0.05% Tween 20, sequentially. After the conjugation with magnetic particles, the five PCR products were mixed and added to the column under an applied magnetic field for separation. While the target DNA-bead complexes were trapped in the column, the reverse strands were denatured and removed by adding 2 mL of 6 M Urea solution at 75 °C. Then, the applied magnetic field was removed, and the conjugated complexes were eluted with 100 ⁇ of 2 SSC buffer.
  • the GMR biosensor chip with an array of 8 x 8 sensors was fabricated as previously described.
  • the chip surface was chemically activated following Kim et al. Briefly, the chip was sequentially washed with acetone, methanol, and isopropanol. After cleaned with oxygen plasma, the chip was treated with poly(ethylene- alt-maleic anhydride) for 5 min. Then, the chip was washed with distilled water, and baked at 1 10 °C for 1 hour using a hot plate. After treatment with poly(allylamine hydrochloride) for 5 min, the chip was washed with the distilled water, and activated with a mixture of NHS and EDC for 1 hour.
  • a robotic arrayer (sciFlexarrayer, Scienion) was used to print the amino-modified DNA probes on different sensors (Supplementary Table 2). Each DNA probe was dissolved in 3 x SSC buffer at 20 ⁇ , and was used for printing in triplicate.
  • Four sensors on the same chip were functionalized with biotinylated DNAs as positive references, and another set of four sensors was functionalized with DNA non-complementary to any of the PCR amplified regions as negative references. The chip was stored at room temperature until use.
  • the GMR biosensor assay The measurement setup described previously was employed to measure the response of GMR sensor to MNPs.
  • the temperature of the GMR chips was controlled by means of a Peltier element coupled to the chip.
  • the Peltier element was driven by a LFI3751 control unit (Wavelength Electronics, USA) with a PtlOOO therm oresistor.
  • the chip was washed with 3 mL of 0.1% bovine serum albumin (BSA, Sigma Aldrich) and 0.05% Tween20 (Sigma Aldrich). The chip was then blocked with 100 ⁇ ⁇ of 1% BSA for 1 h in a shaker.
  • BSA bovine serum albumin
  • Tween20 Sigma Aldrich
  • the chip was washed with 3 mL of 0.1% BSA and 0.05% Tween20, followed by washing with 3 mL of distilled water. Prior to sample injection, a base line signal measurement was performed for 2 min at 37 °C. After sample injection, the DNA hybridization signals from different sensors were measured for 1 h at 37 °C. Then, the temperature was lowered to 20 °C to inhibit further binding of the sample and stabilize DNA hybrids. The chip was washed five times with 100 ⁇ , of 0.05 * SSC to remove unbound sample. 150 ⁇ , of 0.05 * SSC were left in the reaction well and covered with 50 ⁇ ⁇ of mineral oil to prevent evaporation.
  • T m a first order polynomial was fitted to the melting curve in the region of interest.
  • Each mutation (methylation) site was genotyped using two probes.
  • AT m was defined as the difference between T m measured for the probe complementary to the mutated (methylated) sequence minus T m measured for the probe complementary to the Wild Type (un-methylated) sequence.
  • Pyrosequencing The methylation status of the RARB and KIT promoter regions was analyzed by pyrosequencing using the PyroMark Q24 platform (Qiagen) and subsequent data analysis using the PyroMark Q24 software. Primer sequences are listed in Supplementary Table 3.
  • Table 1 List of ssDNA probes used for mutation and methylation profiling.
  • T m Theoretical melting temperatures (T m ) were calculated with nearest neighbour (NN) model for 10 mM Na + ionic concentration. Probes were designed to have matched T m . **A11 probes are amino-labelled to bind to GMR sensor surfaces.
  • Table 2 PCR primers for amplification of EST cell line genomic DNA.
  • RARB promoter fw biotin- C6-5 ' - GGTTTATTTTTTGTTAAAGGGG -3 '
  • PHEB planar Hall effect bridge
  • the magnetoresi stive sensor bridges were fabricated as described previously. Briefly, anisotropic magnetoresi stive elements of nominal composition Ta(5 nm)/ NisoFe 2 o(30 nm)/ Mn 80 Ir 2 o(10 nm)/ Ta(5 nm) were sputter-deposited in a saturating magnetic field. Electrical contacts of Ti(10 nm)/ Pt(lOO nm)/ Au(lOO nm)/ Ti(lO nm) were deposited by electron beam evaporation. The sensors were spin coated with a 900 nm thick passivation layer (Ormocomp, Micro Resist Technology, GmbH, Germany). Fig.
  • FIG. 7A is a schematic diagram of the differential magnetoresi stive sensor bridge according to an embodiment of the invention.
  • the magnetic material are diagonal bars connecting electrical contacts.
  • V x is the sensor bias voltage and V y is the sensor bridge output voltage.
  • This sensor design (termed differential planar Hall effect bridge, dPHEB) measures the differential signal between the top two branches and the bottom two branches of the bridge as described by Rizzi et al.
  • Fig. 7B is a schematic representation of temperature and salt concentration melting. Increasing temperature (bottom) or decreasing salt concentration (top) increases the stringency causing denaturation of the target-probe hybrids. Following denaturation, MNP-labeled targets are released from the sensor surface, resulting in a reduced signal from the sensor bridge.
  • the measurement platform was previously described by 0sterberg et al. 17 and Rizzi et al. 15 and is depicted in the schematic measurement setup of Fig. 7C.
  • the chip is mounted in the microfluidic chamber below the circuit board that provides electrical connection to the chip via spring-loaded pins.
  • each sensor bridge was measured using an SR830 Lock-In amplifier 712 with an SR552 preamplifier (Stanford Research Systems, Inc., USA).
  • the MNPs were magnetized by the magnetic field due to the applied bias current through the sensor and the presence of MNPs on the sensor was detected in the imaginary part of the second harmonic lock-in signal.
  • Microscope 704 is provided for imaging the surface of the chip.
  • the sensor chip was mounted in an aluminum chip holder with good thermal contact.
  • the temperature of the chip mount was measured with a PtlOOO thermometer, and controlled via a LFI3751 control unit (Wavelength Electronics, USA) driving a Peltier element.
  • the other side of the Peltier element was cooled using a commercial CPU water cooling system 706.
  • Two syringe pumps 700, 702 (model 540060, TSE systems, Germany), connected to a chip inlet via a T-branch, provided the liquid flow in the chip during washing. They were controlled via a custom Lab View program such that any ratio of the two liquids could be injected while maintaining a constant total liquid flow rate.
  • the sensor elements on each of the five sensor bridges could be selectively functionalized with amino modified ssDNA probes as described by Rizzi et al.
  • the probes to genotype S Ps in the human beta globin (HBB) gene were adapted from Petersen et al. and were purchased from DNA Technology A/S, Denmark.
  • One of the sensor bridges on each chip was used as a positive reference and was functionalized on its top half with a biotinylated DNA probe.
  • Two sensor bridges were used for direct detection of the wild type (WT) or mutant type (MT) variants of the CD 8/9 locus of the HBB gene and were functionalized on their top halves with the corresponding respective probes.
  • the real-time data was corrected for the temperature dependence of the sensor output and normalized to the initial value at 20°C.
  • the two sensor bridges were functionalized as depicted in the inset.
  • the measurements below were performed with the WT and MT sensors for SNP detection of the CD 8/9 locus in HBB (see inset in Fig. 8B).
  • the signal due to MNPs was measured in the imaginary part of the 2 nd harmonic bridge voltage, here written as J 7 , in response to the AC bias of the bridge.
  • J 7 the imaginary part of the 2 nd harmonic bridge voltage
  • Fig. 9A, Fig. 9B show salt concentration melting curves of WT DNA target hybridized to WT and MT DNA probes for the CD8/9 mutation.
  • the signals for both WT and MT sensors were approximately constant at high salt concentrations, c(Na + ) > 20 mM, and the WT sensor signal was 25% higher than that from the MT sensor.
  • the three experiments were highly reproducible and therefore no normalization of the data was performed.
  • the signal from WT probe decreased at a lower salt concentration c(Na + ) ⁇ 3 mM.
  • T m and salt concentration c m obtained from error function fits to the temperature and salt melting, respectively, for the WT target and WT probes (filled symbols) and MT probes (open symbols) for the CD 8/9 locus of HBB.
  • the values of T m and c m obtained from the denaturation experiments are collected in Fig. 10.
  • the dashed lines represent the temperature or concentration profiles used.
  • the perfectly matched WT probe-WT target gave denaturation points at higher stringency compared to the mismatched MT probe-WT target hybrids. The separation between the two is not constant, but it is maximal in the central region of the plot.
  • a single sensor bridge can be used for genotyping when its top and bottom halves are functionalized with WT and MT probes, respectively.
  • the sensor output is proportional to the difference in the amount of MNPs bound to the top and bottom halves of the sensor bridge.
  • Fig. llC, Fig. 11D show the corresponding temperature and salt concentration melting profiles measured for the CD 17 locus.
  • the three targets showed a clear separation even at low temperature. The trend with temperature was the same as for the CD 8/9 locus except that the peaks appeared at lower temperatures and the peak levels were slightly lower. The maximum separation between the three targets was observed between 35°C and 40°C.
  • the salt concentration melting study (Fig. 11D) the three targets were initially separated at high c(Na + ) with A (WT) > A (WT:MT) > AV(MT) > 0. Upon increasing stringency (decreasing c(Na + )), AV for all three targets decreased and separated more from each other.
  • Fig. 11A-D Melting curves (Fig. 11 A, Fig. 11C) and salt concentration denaturation curves (Fig. 11B, Fig. 11D) measured on differential sensors for WT, MT, and a 1 : 1 WT:MT mixture of target DNA.
  • the sensors were functionalized with WT and MT probes for the CD 8/9 locus (Fig. ⁇ , ⁇ ) or the CD 17 locus (Fig. 11C, Fig. 11D) as indicated in the insets.
  • the variation in the absolute temperature may, for example, originate from differences in temperature of the washing buffer or the chip surroundings. Our results further indicate that salt concentration profiles are more easily reproduced. Moreover, the signal from the magnetoresistive sensors is only weakly sensitive to a change in the salt concentration. Further, the requirements for temperature control are less restrictive for salt concentration melting and the concentration can be varied using a simple two-pump setup. Therefore, concentration melting experiments are easier to implement.
  • the presented magnetoresi stive sensor detection scheme and setup allows for any profile in the ( ⁇ , c(Na + ))-plane, i.e., for a simultaneous change of T and c(Na + ).
  • Fig. 10 indicates that a potentially better separation between WT and MT could be obtained along the diagonal in the (T, c(Na + ))-plane by simultaneously ramping the temperature up and the salt concentration down. This will be topic for future investigation.
  • Magnetore si stive sensor arrays with up to thousand sensors have been presented in the literature.
  • 16 Real-time two-dimensional maps of the melting of a DNA target hybridized to an array of WT and MT detection probes enable a highly parallel screening of conditions for a range of sequences and probe lengths to target a number of loci and genes in a DNA target. This can be used for direct genotyping but also to identify regions on the ( ⁇ , c(Na + ))-plane that are optimal for end-point detection after a stringent washing. This could significantly ease the design and improve performance of microarrays, where the probe design may be challenging as a single stringent wash has to produce a large difference between matching and mismatching hybrids while still maintaining a significant signal from the matching hybrids.
  • the melting curves of Fig. 11 A, Fig. 11B showed different behaviors for the CD 8/9 and CD 17 loci.
  • the stability of the target-probes hybrids depends on the length of the probe, its C+G content and the type of mutation investigated.
  • the mutation at the CD 8/9 locus is a single base (C) insertion
  • that at the CD 17 locus is a single base (T>A) transversion.
  • the probes had lengths of 22 bases (C+G 54%) and 18 bases (C+G 66%) for the CD 8/9 and CD 17 loci, respectively.
  • the shorter probe length for CD 17 caused a separation of the three targets also at low stringency (Fig. 11C, Fig. 11D) and maximum separation between the targets was found at lower stringencies compared to CD 8/9. Moreover, the base insertion in CD 8/9 resulted in more unstable mismatched hybrids and caused a higher separation between the three targets (Fig. 11 A, Fig. 11B).
  • the initial negative signal from the 1 : 1 WT:MT mixed target at high c(Na + ) in Fig. 5b is likely caused by a higher affinity of the MT target-MT probe hybrids compared to that of the WT target-MT probe. This is supported by the observation that the signal from the MT target peaks at lower c(Na + ) (higher stringency) than the WT target in Fig. 11B.
  • the salt concentration melting for the CD 17 locus (Fig. 11D)
  • the initial signals from all three targets at high c(Na + ) were positive and were found to decrease with decreasing salt concentration. We speculate that this is caused by higher unspecific binding to the WT probe than the MT probe.
  • the different behavior of the WT and MT probes for the CD 8/9 and CD 17 loci would require optimization of the assay in end-point detection to determine the optimum washing stringency to perform a correct genotyping. Instead, using a denaturation curve method, the hybrids are subject to a continuously varying stringency and thus we could easily differentiate the three different target compositions.
  • the examples above demonstrated the use of a magnetoresistive sensor array integrated in a lab-on-a-chip system for studies of the denaturation of DNA hybrids as function of both temperature and salt concentration.
  • the magnetic readout was only weakly sensitive to the varying experimental conditions and could therefore be used to provide a sensitive real-time readout of the signal from the magnetic nanoparticle labeled DNA target hybridized to detection probes.
  • the differential sensor design enabled studies of the specific binding of a WT target to WT and MT detection probes for two loci of the human HBB gene. Melting experiments at different cuts in the temperature-salt concentration plane identified a region of optimal discrimination between the two. Further, it was found that salt concentration melting curves were more reproducible than temperature melting curves. These provide a hitherto not studied but interesting alternative to temperature melting curves in lab-on-a-chip systems.
  • the examples demonstrated the discrimination between WT, MT and 1 : 1 WT:MT targets using a single sensor bridge functionalized on its top and bottom parts with WT and MT probes, respectively. This was performed both for temperature melting and salt concentration melting.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

A method of methylation detection provides a quantitative description of the methylation density in DNA strands. Bisulphite conversion [100] of the DNA strands containing methylated and unmethylated sites creates converted DNA strands with mismatch base pairs. The converted DNA strands are PCR amplified [102], and single strand target DNA strands are magnetically labeled [104] and hybridized [106] with complementary DNA strands immobilized onto a magnetoresistive (MR) sensor array. During hybridization, a binding signal may be recorded. A stringency condition such as temperature or salt concentration is increased [108] to cause the magnetically labeled single strand target DNA strands to be denatured from the complementary DNA strands immobilized onto a magnetoresistive (MR) sensor array. During the increasing of the stringency condition a denaturation signal resulting from the denatured magnetically labeled single strand target DNA strands is recorded [110] in real time and used to determine [112] stringency conditions of methylated and unmethylated DNA strands. The DNA strands may also contain wild type genes and mutated genes, so that mutation sites may be determined simultaneously with methylation sites.

Description

Profiling of DNA methylation using magnetoresistive biosensor array
TITLE OF THE INVENTION
FIELD OF THE INVENTION
The present invention relates generally to biosensing techniques and devices. More specifically, it relates to use of biosensor arrays for DNA methylation and mutation analysis.
BACKGROUND OF THE INVENTION
Cancer is a cellular disease caused by the stepwise accumulation of genetic and epigenetic alterations. Extensive sequencing efforts have identified recurrent genetic mutations that are useful as genetic biomarkers for assessing risk of developing cancer, classifying disease subtypes, predicting response to treatment, and monitoring efficacy of treatment. DNA methylation causes epigenetic silencing of tumor suppressor genes and is studied for both its direct implication in oncogenesis and for its utility as cancer biomarker. In bladder and colon cancer, the combination of genetic and epigenetic analyses has been proven to have a higher diagnostic value than either of the two approaches applied separately. However, compared to mutation genotyping, methylation profiling is not a yes-no result, as Gene silencing mechanisms driven by methylation are generally sensitive to the overall density of methylated sites and typically multiple CpG dinucleotides (the most common methylation site) are present in gene promoters. Finally, the methylation density may vary between alleles and cells within a single tumor, resulting in a heterogeneous pattern. A variety of techniques has been developed to detect single point mutations in DNA based on amplification, probe hybridization, enzymatic digestion, gel electrophoresis, or sequencing. DNA methylation information is lost during polymerase chain reaction (PCR) amplification, and DNA hybridization is insensitive to the methylation status of the target region. Therefore, a methylation sensitive pretreatment of the DNA has to be employed. The two main DNA methylation analysis techniques are based on methylation sensitive enzymatic digestion, affinity enrichment using antibodies specific for methylated cytosine or bisulphite conversion of unmethylated cytosine into uracil. Bisulphite conversion is most widely used since a methylation event is converted into a single base alteration (C/T) that can be detected with techniques derived from mutation detection including sequencing array hybridization, methylation sensitive PCR, and methylation sensitive melting curve analysis. Sequencing of bisulphite-converted DNA quantifies the methylation status and allows for comparison of data from different sequencing runs and batches, but it is costly and time consuming. Amplification and melting-based techniques are not specific for single methylation sites and are not easily scalable to investigate a high number of methylation sites. Array-based methods, such as the Illumina BeadChip (Illumina Inc., San Diego, CA), offer a highly multiplexed site- specific assay. However, after bisulphite conversion and amplification of the template, DNA products comprise mostly three bases (guanine, adenine, and thymine plus residues of methylated cytosine). This reduced sequence complexity makes design of probes for end-point detection complicated and the decreased sequence variation reduces specificity.
BRIEF SUMMARY OF THE INVENTION
The present invention aims to perform methylation (and, optionally, mutation) profiling simultaneously in a scalable chip platform that offers highly specific and quantitative DNA methylation and mutation data on a compact, easy-to-use, and potentially low-cost platform. Our preferred approach is based on hybridization of magnetically labeled target DNA to DNA probes tethered to the surface of a GMR biosensor array. To increase the specificity of the DNA hybridization assay, we employed melting curve measurements of the surface-tethered DNA hybrids. This avoids conventional assay condition optimization since the target-probe hybrids are exposed to continuously increasing stringency during melting curve measurement. Melting curves for surface-tethered DNA probes have been also measured using fluorescence and surface plasmon resonance. Compared to these methods, the GMR biosensors offer high sensitivity, virtually no magnetic background signal from biological samples and no dependence on temperature.
In one aspect, the present invention provides a method to simultaneously profile DNA mutation and methylation events for an array of sites with single site specificity. It advantageously employs methylation detection with magnetoresi stive sensor arrays, and simultaneous profiling of methylation and mutation in DNA sequences. Genomic (mutation) or bisulphite-treated (methylation) DNA is amplified using non-discriminatory primers, and the amplicons are then hybridized to an array of magnetoresistive (MR) biosensor followed by real-time melting curve measurements. This MR biosensing technique offers scalable multiplexed detection of DNA hybridization, which has been shown to be insensitive to variations in temperature, pH value and biological fluid matrix. The melting curve approach further enhances the assay specificity and tolerance to variations in probe length. Alternatively, the technique may use a method of applying methyltransferase on array to transfer methylation sites on the DNA sequences tethered to the sensor surface and directly target methylated sites for detection. This method allows for simultaneously profiling mutation and methylation sites and provides quantitative assessment of methylation density equivalent to bisulphite pyrosequencing. Embodiments of the invention advantageously provide epigenetic and mutational analysis that may be easily implemented in a magnetic DNAchip. Magnetic detection of hybridization offers high sensitivity and virtually no magnetic background from the sample and the sample matrix. A real-time melting curve measurement of the target- probe hybrids increases the specificity of the assay by challenging the hybrids with increasingly stringent conditions. Methods to increase the stringency include, but are not limited to, raising the temperature of the MR biosensor array and decreasing the salt (Na+) concentration in the sample buffer. Importantly, the real-time melting curve measurement eliminates the need for probe optimization required for end point detection. In one aspect, a method of methylation detection provides a quantitative description of the methylation density in DNA strands. The method includes performing bisulphite conversion of the DNA strands containing methylated and unmethylated sites to create converted DNA strands with mismatch base pairs; performing PCR amplification of the converted DNA strands to produce PCR amplified converted DNA strands; hybridizing the PCR amplified converted DNA strands to complementary DNA strands immobilized onto a magnetoresi stive (MR) sensor array; magnetically labeling of the PCR amplified converted DNA strands preceding or following hybridization; increasing a stringency condition to cause the magnetically labeled single strand target DNA strands to be denatured from the complementary DNA strands immobilized onto a magnetoresi stive (MR) sensor array; reading out in real time during the increasing of the stringency condition a denaturation signal resulting from the denatured magnetically labeled single strand target DNA strands; and determining stringency conditions of methylated and unmethylated DNA strands from the denaturation signal.
In one implementation, the method also includes reading out in real time a binding signal during hybridizing the magnetically labeled single strand target DNA strands with complementary DNA strands immobilized onto a magnetoresistive (MR) sensor array.
The stringency condition may be temperature, wherein increasing the stringency condition comprises increasing the temperature while salt concentration is held constant, and wherein determining the stringency conditions of the methylated and unmethylated DNA strands comprises determining melting temperatures of the methylated and unmethylated DNA strands. Alternatively, the stringency condition may be salt concentration, wherein increasing the stringency condition comprises decreasing the salt concentration while temperature is held constant, and wherein determining the stringency conditions of the methylated and unmethylated DNA strands comprises determining melting salt concentrations of the methylated and unmethylated DNA strands. Moreover, the stringency condition may be a combination of temperature and salt, wherein increasing stringency comprises simultaneously increasing temperature and decreasing salt concentration.
In any of the methods to increase stringency condition, mutation sites in the DNA may be investigated simultaneously with methylation sites. Performing PCR amplification of the converted DNA strands may include performing PCR amplification on the DNA strands after bisulphite conversion and without conversion, where the input DNA strands may contain methylated and unmethylated sites and wild type genes and mutated genes; and determining stringency conditions of methylated and unmethylated DNA strands from the denaturation signal may include determining stringency conditions of methylated and unmethylated DNA strands and wild type genes and mutated type genes from the denaturation signal, whereby mutation sites may be determined simultaneously with methylation sites.
The invention thus provides a method of methylation detection using a magnetoresi stive (MR) sensor array. In preferred embodiments, DNA strands with methylated sites are bisulphite-converted and PCR amplified. They are then hybridized to a temperature- controlled magnetoresi stive (e.g., GMR) biosensor array with immobilized complementary DNA strands and magnetically labeled. Target DNA strands are denatured from the immobilized DNA strands by ramping up temperature. Real-time measurements of binding signal from target DNA are used to determine melting curve. In an alternative embodiment, salt concentration rather than temperature is used for denaturing the target DNA strands. The technique can be combined with measurements of genetic mutations on the same biosensor chip.
In another aspect, a method of methylation detection provides a quantitative description of the methylation density in DNA sequences. The method includes performing bisulphite conversion of DNA strands with or without methylated sites; PCR amplification of converted DNA strands; hybridization of converted target DNA strands with a MR sensor array immobilized with (unmethylated) complementary DNA strands; adding methyltransferase to methylate the complementary DNA strands corresponding to the methylated sites of the target DNA strands; ramping up temperature until target DNA strands are denatured from the immobilized DNA strands, leaving behind the methylated single strand DNA if the target DNA is methylated, or leaving behind the unmethylated single strand DNA if the target DNA is unmethylated; adding magnetic nanoparticles conjugated with methyl-recognizing moieties, such as antimethylated lysine antibody, which will bind to methylated DNA strands immobilized on the sensor; reading out the binding signal in real time, and determining if the immobilized DNA strand (and thus the corresponding target DNA strand) is methylated or not. Different MR technology can be used for the biosensing array. Those include, but are not limited to, giant magnetoresistive (GMR) sensors, magnetic tunnel junction (MTJ) sensors, planar Hall effect (PHE) sensors.
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS
Fig. 1 shows an embodiment of the invention.
Fig. 2 provides a schematic overview of an exemplary protocol for the detection of magnetically labeled DNA using a GMR biosensor device.
Fig. 3A is a graph of the real-time monitoring of AMR signal from GMR biosensors.
Figs. 3B-C show melting curves from wild type WT and mutant type MT probes targeting BRAF c.1391 G>A mutation.
Figs. 4A-B are schematic illustrations of the bisulphite conversion process.
Figs. 4C-D show melting curves from methylated (M) and unmethylated (U) probes targeting /Tmethylation (site pi).
Fig. 5A shows mutation profiling of melanoma cell lines.
Figs. 5B-C are a heat map and a mutation map, respectively, corresponding to Fig. 5A. Figs. 6A-C show results of mutation and methylation profiling of melanoma cell lines. Fig. 7A is an exemplary schematic diagram of a differential magnetoresistive sensor bridge.
Fig. 7B is a schematic representation of temperature and salt concentration melting.
Fig. 7C is an exemplary schematic measurement setup.
Figs. 8A-B show the WT target melting curves measured for c(Na+)=10 mM and 2 mM, respectively of MNP labeled WT DNA target hybridized to WT and MT DNA probes for the CD8/9 mutation.
Figs. 9A-B show salt concentration melting curves of WT DNA target hybridized to WT and MT DNA probes for the CD8/9 mutation.
Fig. 10 shows the values of melting temperature Tm and salt concentration cm for the WT target and WT probes (filled symbols) and MT probes (open symbols) for the CD 8/9 locus of HBB.
Fig. 11A shows the temperature melting curve measured at c(Na+)=10 mM for the CD 8/9 locus. Fig. 11B shows the salt concentration melting curve measured at J=37°C for the CD 8/9 locus.
Figs. 11C-D show the corresponding temperature and salt concentration melting profiles measured for the CD 17 locus.
DETAILED DESCRIPTION OF THE INVENTION
Fig. 1 is a flow chart providing an overview of a method of methylation detection providing a quantitative description of the methylation density in DNA strands, according to an embodiment of the invention. In step 100, bisulphite conversion of the DNA strands containing methylated and unmethylated sites is performed to create converted DNA strands with mismatch base pairs. In step 102, PCR amplification of the converted DNA strands is performed. In step 104, single strand target DNA strands among the PCR amplified converted DNA strands are magnetically labeled. In step 106, the magnetically labeled single strand target DNA strands are hybridized with complementary DNA strands immobilized onto a magnetoresi stive (MR) sensor array. In some implementations, during hybridizing a binding signal is read out in real time.
In step 108, a stringency condition is increased to cause the magnetically labeled single strand target DNA strands to be denatured from the complementary DNA strands immobilized onto a magnetoresi stive (MR) sensor array. In step 110, during the increasing of the stringency condition a denaturation signal resulting from the denatured magnetically labeled single strand target DNA strands is read out in real time. In step 112, stringency conditions of methylated and unmethylated DNA strands are determined from the denaturation signal.
The stringency condition may be temperature, in which case increasing the stringency condition comprises increasing the temperature while salt concentration is held constant. Determining the stringency conditions of the methylated and unmethylated DNA strands in this case comprises determining melting temperatures of the methylated and unmethylated DNA strands. Alternatively, the stringency condition may be salt concentration, in which case increasing the stringency condition comprises decreasing the salt concentration while temperature is held constant. Determining the stringency conditions of the methylated and unmethylated DNA strands in this case comprises determining melting salt concentrations of the methylated and unmethylated DNA strands. In some implementations, the method may be used to determine mutation sites simultaneously with methylation sites. In this case, performing bisulphite conversion of the DNA strands containing methylated and unmethylated sites includes performing bisulphite conversion of the DNA strands containing methylated and unmethylated sites and wild type genes and mutated genes. In addition, determining stringency conditions of methylated and unmethylated DNA strands from the denaturation signal in this case includes determining stringency conditions of methylated and unmethylated DNA strands and wild type genes and mutated type genes from the denaturation signal.
The method described above will now be illustrated by way of several examples. The following abbreviations will be used: GMR, Giant Magnetoresi stive; KIT, Tyrosine Kinase; MNP, Magnetic NanoParticle; MR, MagnetoResistance; MT, Mutant Type; PCR, Polymerase Chain Reaction; RARB, Retinoic Acid Receptor β; SNP, Single Nucleotide Polymorphism; WT, Wild Type. DNA Mutation analysis
Fig. 2 provides a schematic overview of a protocol 202 for the detection of magnetically labeled DNA using a GMR biosensor device 200, according to an embodiment of the invention. After denaturation of the reverse strand and labeling, PCR products are injected into the reaction well over the chip 204. In a hybridization step 212, DNA labeled with MNPs 206 hybridizes to complementary surface-tethered probes for 1 hour at 37 °C, resulting in hybridized DNA labeled with MNPs 208. Unbound sample is removed by washing. In melting step 214, the temperature is swept from 20 °C to 65 °C, causing denaturization of the DNA from the probes 210 to measure the melting temperature, Tm.
To detect DNA mutations, we PCR amplified the genomic regions of interest using nondiscriminatory primers. The PCR products were then magnetically labeled using biotinylated primers and streptavidin-coated magnetic nanoparticles (MNPs). After magnetic column separation and denaturation of the double-stranded PCR products, ssDNA conjugated to MNPs (MNP-ssDNA) was introduced to the GMR biosensor array where multiple DNA probes were separately tethered to the surface of each sensor. Upon hybridization of the injected MNP-ssDNA to surface-tethered complementary probes, GMR biosensors produced changes in sensor magnetoresi stive ratio (AMR) proportional to the bound MNPs. To genotype a mutation, we employed a set of two probes complementary to the wild type (WT) and mutant type (MT) sequences of the sample (supplementary information Table 1). During hybridization at low stringency, amplicons hybridized to both WT and MT probes with similar affinity. To obtain single base specificity, stringent washing is typically used after hybridization in DNA microarray. To achieve a more flexible system for detection of single-base mutations, we challenged the hybrids by increasing the temperature and continuously measuring DNA melting simultaneously for all probes on the GMR biosensor array. Fig. 3A is a graph of the real-time monitoring of AMR signal from GMR biosensors functionalized with positive and negative references, wild type (WT) and mutant type (MT) probes for the BRAF c. l391G>A mutation. The signal was measured during hybridization (1 hour at 37 °C) of a known WT sample to probes with a perfect match (WT) or a single-base mismatch (MT) for the BRAF c. l391G>A mutation. Each line corresponds to up to three sensors functionalized with the same probe. The measurement was performed with PCR products from EST045 cell line that is WT for the investigated mutation. The sample was injected at t = 2 min.
In addition, a biotinylated DNA probe was used as positive reference and a DNA probe with an unspecific sequence was used as negative reference. After 1 hour of hybridization, the MT probe gave a slightly higher AMR signal than the WT probe, indicating that low- stringency hybridization was insufficient to genotype the WT sample.
After 60 min hybridization at 37 °C, the unbound sample was removed by a low- temperature wash at low stringency. Then, the temperature was ramped from 20 °C to 65 °C at constant rate while measuring the melting curves until all DNA hybrids melted. The signal (AMR) from GMR biosensors was corrected for its temperature dependence during ramping using the sensor resistance (R), which is linearly related to the sensor temperature. Fig. 3B and Fig. 3C show melting curves from WT and mutant type MT probes targeting BRAF c. l391G>A mutation obtained for the indicated cell lines, where the EST045 and EST 164 cell lines were wild type and homozygous mutant, respectively. Signals were normalized by the initial signal at T=20 °C. The melting temperature Tm is defined as the temperatures at which the normalized curves cross 0.5. ATm is the difference in melting temperature between the MT and WT probes. The numbers in parentheses are standard deviations on the last significant digit (n = 4-6).
Fig. 3B shows the melting curve of WT BRAF amplicons hybridized to WT and MT probes for the c. l391G>A mutation. Here, the AMR signal was normalized by the initial signal at T=20 °C. We defined the melting temperature Tm as the temperature at which the signal (AMR) dropped to the half of its initial signal (at 20 °C). Each melting experiment was repeated with two identical GMR biosensor chips. Three sensors were functionalized with each probe, thus generating up to six identical melting curves for each probe. The obtained melting curves were found to be highly reproducible - both from sensor to sensor and from chip to chip. The hybrids of the target DNA with WT and MT probes in Fig. 3B showed melting temperatures of Jm(WT)=43.0(7) °C and 7m(MT)=38.9(7) °C, respectively, where the numbers in parentheses are standard deviations of Tm on the last digit (ri>4). We defined the melting temperature difference, ATm as the difference between the melting temperature from the MT probe and that from the WT probe, ATm= Jm(MT) - Jm(WT). Thus, ΔΓω<0 indicates a higher complementarity of the target to the WT probe than the MT probe, and hence that the target is WT. The obtained value ΔΓω=-4.0(3) °C is in agreement with the expectation for a single base mismatch between the WT target and MT probe using a nearest neighbor calculation.28 We also note that the lower standard deviation of ATm compared to rm indicates that differences in melting temperatures were more reproducible than their absolute values.
Fig. 3C shows melting curves measured for a cell line heterozygous for the BRAF c. l391G>A mutation.22 The melting curves from WT and MT probes were found to overlap each other, resulting in ΔΓω=-0.6(4) °C because the heterozygous sample contains both MT and WT targets, which hybridize to both WT and MT probes. The resulting melting curves from WT and MT probes were both given by the contribution of low-Jm and high-Jm DNA hybrids. Therefore, the melting curves overlapped and presented a lower slope.
DNA methylation analysis
We applied a similar detection scheme to analyze the methylation state of specific regions of the target. We employed bisulphite treatment of the genomic DNA to convert a methylation event into a single base substitution (C>T). After bisulphite conversion, we amplified the gene promoter region of interest by non-discriminatory PCR. Fig. 4A, Fig. 4B are schematic illustrations of the bisulphite conversion process. Upon bisulphite treatment 402, 412, unmethylated cytosines in DNA 410 are converted to uracil in DNA 414 (Fig. 4B) whereas 5-methylcytosines in DNA 400 are retained in DNA 404 (Fig. 4A). In the subsequent PCR 406, 416, which produces products 408, 418, uracil in 414 is substituted by thymine. Thus, the methylated cytosines are mapped to single base alterations (C>T) of the amplicons.
Fig. 4C and Fig. 4D show melting curves from methylated (M) and unmethylated (U) probes targeting KIT methylation (site pi). The melting curves were measured for Fig. 4C the hypermethylated cell line EST045 and Fig. 4D the unmethylated cell line EST 164. The melting curves are used to estimate methylation status of the KIT promoter (site pi) of hypermethylated (EST045) and wild-type (EST164) cell line. The amplicons were hybridized to probes complementary to unmethylated (U) or methylated (M) target DNA. Melting curves were measured as described previously. Here, AJm was defined as the melting temperature of the M probe minus that of the U probe, ATm= Tm(M) - Tm(U). Thus, a negative ΔΤω indicates a higher complementarity of the target to the U probe and a lower degree of methylation. The -20 bp region of the KIT promoter investigated includes three CpG sites that can be methylated (sequences in supplementary information Table 1), and thus we expect higher ATm than for single base substitution. For the hypermethylated cell line in Fig. 4C, we found ΔΓω=8.1(1) °C, confirming the hyper- methylation status of the KIT promoter, whereas we found ATm=-\ 1.7(7) °C for the WT cell line in Fig. 4D, indicating the unmethylated status.
Multiplex DNA profiling of melanoma cell lines The GMR biosensor array comprises of 64 individual sensors that can be individually functionalized with amino-modified DNA probes. Using the mutation and methylation detection techniques described above, we simultaneously probed three mutation sites in BRAF, two mutation sites in NRAS, two methylation sites in the KIT promoter, and two methylation sites in the RARB promoter in triplicate. We performed mutation and methylation profiling of seven melanoma cell lines. For each cell line, the targeted regions of BRAF and of NRAS were amplified by non-discriminatory PCR. Also, the promoter regions of KIT and RARB were amplified by non-discriminatory PCR after bisulphite conversion. After magnetic labeling, a mixture of all amplicons from a cell line was injected over the sensor surface. For each cell line, melting curve profiling was repeated with two nominally identical GMR biosensor arrays. The melting curves were analyzed in terms of melting temperatures, and we determined ATm for all investigated mutations and methylation.
Fig. 5A Mutation profiling of melanoma cell lines. ATm measured for BRAF c. l391G>A mutation for the seven investigated EST cell lines. Error bars are one standard deviation (n = 4-6). The horizontal lines are threshold values used for genotyping: ATm<-2 °C WT, 2 °C < ATm < 2 °C heterozygous MT, ATm > 2 °C homozygous MT. Fig. 5B Heat map of ATm measured for the mutation and for the investigated EST cell lines. Fig. 5C Heat map of measured ATm with applied threshold to genotype mutations.
Fig. 5A shows the ATm values measured for the BRAF c. l391G>A mutation for all cell lines. Six cell lines showed ATm values around ATm = -4 °C, indicating a homozygous WT sequence. EST164 is known to be the only cell line with a heterozygous mutation in this site, showing ATm = -0.5(4) °C, which is significantly different from the other cell lines.
The ATm values measured for all investigated mutations for each cell line are displayed in the heat map of Fig. 5B. Classifying WT (ATm < -2 °C), heterozygous MT (-2 °C < ATm < 2 °C), and homozygous MT (ΔΤω > 2 °C) resulted in the mutation map presented in Fig. 5C. All mutations identified in the cell lines were consistent with previous genotyping data. For the NRAS c.182 A>T mutation in the cell line EST045, we measured ΔΓω=-0.2(4) °C, genotyping the cell line as heterozygous for this mutation; however, the cell line is known to be heterozygous for an A>G substitution in that location. As an MT probe targeting an A>T mutation was employed, both the WT and MT probes were similarly mismatched to the target, resulting in ATm close to zero. The absolute values of Tm were comparable to the other investigated mismatched probes confirming the mismatch of the target to both the WT and MT probes. Therefore, an unknown mutation can be detected by a lower Tm from the WT probe, but probes targeting all possible mutations should be included in the assay to perform accurate genotyping. DNA methylation density
Methylation profiling differs substantially from genotyping since the methylation status of each CpG site in the promoter region varies between alleles and within a cell population. Therefore, it requires a different data analysis in terms of methylated fraction of the sample DNA. We measured melting curves using surface-tethered probes targeting two locations of the KIT promoter and two locations of the RARB promoter. The targeted sequences contain one to four CpG sites. Combining multiple investigated sites with the intrinsic variation of the methylation pattern, we obtained a continuous variation of ATm for the analyzed cell lines. Fig. 6A shows the measured ATm values for all cell lines. Here, higher ATm indicates higher affinity of the sample to the M probe, i.e., a hypermethylation event. The complex ATm pattern is a direct consequence of the intrinsic methylation variation.
Fig. 6A-C show results of mutation and methylation profiling of melanoma cell lines. Fig. 6A is a heat map of ATm measured for KIT and RARB methylation probes for the seven investigated EST cell lines. Calculation of ATm for EST007 KIT was not possible due to low binding signal. Fig. 6B is a graph of ATm values measured for KIT pi (squares) and p2 (circles) methylation probe locations vs. methylation density measured by pyrosequencing. Fig. 6C is a graph of ΔΤω measured for RARB pi (squares) and p2 (circles) methylation probe locations vs. methylation level measured by pyrosequencing. Error bars are one standard deviation (n = 4-6).
The methylation density was assessed independently by pyrosequencing of the bisulphite- converted DNA. To each target sequence corresponding to the probes, we calculated methylation density depending on both the fraction of methylated sample and the number (1 to 4) of methylated CpG sites in the region targeted by the probe. Fig. 6B, Fig. C show ATm measured using the GMR biosensor versus the methylation density obtained by pyrosequencing for the KIT pi and p2 probe locations and the RARB pi and p2 probe locations, respectively. In these plots, each point corresponds to one of the measured cell lines. There is an evident linear correlation between ATm and the methylation density (R2 > 0.94 for all probe locations, results of linear regression are given in supplementary Table 4). For the KIT pi and p2 probes, the slopes are comparable (-0.22 °C/%, Fig. 6B), whereas for the RARB probes, the slopes for the pi and p2 probes differ significantly (pi : 0.076(5) °C/%, p2: 0.22(2) °C/%). The slope for the p2 probe was three times that for the pi probe because the p2 probe covers three CpG sites whereas the pi probe only covers one CpG site. Nevertheless, three methylation sites allowed for a more complex pattern of methylation sites and thus the RARB p2 probe showed a broader spread of data around the best linear fit. The probes can be tailored to sacrifice linearity to favor higher values of ATm.
These results demonstrate the application of real-time temperature melting on a GMR biosensor as a novel and quantitative method for profiling methylation density. High- throughput profiling of genome wide methylation can be performed with single-base resolution using array-based methods like Illumina BeadChips but the specificity of such arrays is limited by lower sequence variability of bisulphite converted DNA. A quantification of the overall methylation density of a gene promoter can be obtained with methylation-specific melting curve analysis. Here, we combined the throughput and scalability of arrays with the specificity and flexibility of melting curve analysis. The obtained quantitative profiling was equivalent to the results of pyrosequencing.
The above examples have illustrated an approach for simultaneous DNA mutation and methylation profiling. Our method combines the DNA microarray techniques for both mutation and methylation analysis in a single platform. Melting curves measurements are used to increase the specificity of mutation detection. For methylation detection, the melting curve quantifies the methylation state at a level equivalent to pyrosequencing. The same technique could potentially be employed on a variety of other platforms capable of real-time monitoring of the DNA hybridization vs. temperature. The GMR biosensor platform has a low cross-sensitivity to temperature and provides a sensitive readout. Although it does not offer the extreme throughput as advanced bead microarray systems (e.g. : Illumina), in its present format, the GMR biosensor platform can be used for the simultaneous triplicate investigation of about 20 mutation and methylation sites. This number is sufficient for many clinical applications where focus is limited to a small number of mutations and methylation sites of relevance for a specific cancer. Nevertheless, the GMR biosensor array has a modular design that can be scaled to include up to thousands of biosensors.27
Methods
Cells and reagents. Melanoma cell lines for this study were obtained from The European Searchable Tumour Line Database (ESTDAB: http://www. ebi.ac.uk/ipd/estdab) and were maintained in RPMI-1640 medium containing 10% FBS and antibiotics at 37 °C and 5% C02. The PCR primers for this study have been modified from Dahl et al. and were obtained from DNA Technology A/S, Denmark. The sequences can be found in the supplementary material Table 2. The amine modified DNA probes (sequences in supplementary material Table 1) were matched for melting temperature calculated with nearest-neighbor model. The probes were obtained from DNA Technology A/S. The other reagents: poly(ethylene-alt-maleic anhydride) (Sigma Aldrich), poly(allylamine hydrochloride) (Polyscience), distilled water (Invitrogen), l-Ethyl-3-(3- dimethylaminopropyl)-carbodiimide EDC (Sigma Aldrich), N-hydroxysuccinimide NHS (Sigma Aldrich) 1% bovine serum albumin BSA (Sigma Aldrich), phosphate buffered saline PBS (Gibco), Tween 20 (Sigma Aldrich), Urea (Fisher Scientific), 20χ saline sodium citrate SSC (Invitrogen), mineral oil (Sigma Aldrich), MNPs Streptavidin MicroBeads (Miltenyi), magnetic separation columns μ Columns (Miltenyi).
DNA extraction and bisulphite treatment. Genomic DNA was isolated using the Qiagen AllPrep DNA/RNA/Protein Mini kit (Qiagen GmbH, Hilden, Germany) and quantified using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE). Bisulphite conversion of DNA (500 ng) was carried out using the EZ DNA Methylation-Gold™ Kit (Zymo Research, Irvine, CA) according to the manufacturer's protocol. PCR amplification. Prior to the GMR biosensor assay, PCR was performed using a Veriti™ 96-Well Thermal Cycler (Applied Biosystems) and TEMPase Hot Start Polymerase (VWR). All amplifications were initiated with enzyme activation and DNA denaturation at 95 °C for 15 minutes, 40 cycles of 95 °C for 30 seconds, 56 °C for 30 seconds and 72 °C for 30 seconds, followed by a final incubation at 72 °C for 10 minutes. All primer sequences used are listed in the supplementary material Table 2.
Magnetic labeling. Products from PCR amplification of each cell line were processed as described by Rizzi et al. to obtain ss-DNA target conjugated with MNPs. Briefly, for each amplified region, 10 μΐ. of PCR products were mixed with 10 μΐ. of stock solution of streptavi din-coated MNPs (MACS Streptavidin Microbeads, cat: 130-048-102, Miltenyi Biotec Norden AB, Lund, Sweden) and incubated for 30 min at 37 °C. A magnetic separation column (μ column, Miltenyi Biotec Norden AB, Lund, Sweden) was prepared by washing with 1 mL of 1% Tween 20 and 1 mL of 0.1% BSA containing 0.05% Tween 20, sequentially. After the conjugation with magnetic particles, the five PCR products were mixed and added to the column under an applied magnetic field for separation. While the target DNA-bead complexes were trapped in the column, the reverse strands were denatured and removed by adding 2 mL of 6 M Urea solution at 75 °C. Then, the applied magnetic field was removed, and the conjugated complexes were eluted with 100 μί of 2 SSC buffer.
Sensor preparation. The GMR biosensor chip with an array of 8 x 8 sensors was fabricated as previously described. The chip surface was chemically activated following Kim et al. Briefly, the chip was sequentially washed with acetone, methanol, and isopropanol. After cleaned with oxygen plasma, the chip was treated with poly(ethylene- alt-maleic anhydride) for 5 min. Then, the chip was washed with distilled water, and baked at 1 10 °C for 1 hour using a hot plate. After treatment with poly(allylamine hydrochloride) for 5 min, the chip was washed with the distilled water, and activated with a mixture of NHS and EDC for 1 hour. After the chip was washed again with distilled water, a robotic arrayer (sciFlexarrayer, Scienion) was used to print the amino-modified DNA probes on different sensors (Supplementary Table 2). Each DNA probe was dissolved in 3 x SSC buffer at 20 μΜ, and was used for printing in triplicate. Four sensors on the same chip were functionalized with biotinylated DNAs as positive references, and another set of four sensors was functionalized with DNA non-complementary to any of the PCR amplified regions as negative references. The chip was stored at room temperature until use.
Data acquisition for temperature calibration. Prior to the assay, the thermal resistivity of each GMR sensor was characterized for temperature calibration. The temperature coefficient for each chip was obtained by linear fitting to resistance measurements at 20, 30, 40, 50 and 60 °C. The temperature coefficient was then used to trace the instantaneous temperature of each sensor.
GMR biosensor assay. The measurement setup described previously was employed to measure the response of GMR sensor to MNPs. The temperature of the GMR chips was controlled by means of a Peltier element coupled to the chip. The Peltier element was driven by a LFI3751 control unit (Wavelength Electronics, USA) with a PtlOOO therm oresistor. First, the chip was washed with 3 mL of 0.1% bovine serum albumin (BSA, Sigma Aldrich) and 0.05% Tween20 (Sigma Aldrich). The chip was then blocked with 100 μΐ^ of 1% BSA for 1 h in a shaker. After blocking, the chip was washed with 3 mL of 0.1% BSA and 0.05% Tween20, followed by washing with 3 mL of distilled water. Prior to sample injection, a base line signal measurement was performed for 2 min at 37 °C. After sample injection, the DNA hybridization signals from different sensors were measured for 1 h at 37 °C. Then, the temperature was lowered to 20 °C to inhibit further binding of the sample and stabilize DNA hybrids. The chip was washed five times with 100 μΐ, of 0.05 * SSC to remove unbound sample. 150 μΐ, of 0.05 * SSC were left in the reaction well and covered with 50 μΐ^ of mineral oil to prevent evaporation. Melting curves for all the probes were measured while temperature was ramped from 20 °C to 65 °C at 0.05 °C/s. The temperature was then swept back to 20 °C to obtain temperature reference signals. Data processing. The MNPs are detected as a variation of the magnetoresistivity (AMR) of the GMR sensors. The temperature coefficients of AMR were calculated for each sensor as in Hall et al. using the temperature reference signals. A 5th order polynomial was used to account for non-linear temperature dependency at high temperature. After temperature correction, the melting curves measured between 20 °C to 65 °C were normalized by their initial value at 20 °C. The melting temperature Tm was defined as the temperature at which the normalized signal is 0.5. To calculate Tm, a first order polynomial was fitted to the melting curve in the region of interest. Each mutation (methylation) site was genotyped using two probes. ATm was defined as the difference between Tm measured for the probe complementary to the mutated (methylated) sequence minus Tm measured for the probe complementary to the Wild Type (un-methylated) sequence. Pyrosequencing. The methylation status of the RARB and KIT promoter regions was analyzed by pyrosequencing using the PyroMark Q24 platform (Qiagen) and subsequent data analysis using the PyroMark Q24 software. Primer sequences are listed in Supplementary Table 3. DNA enzymatically methylated in vitro (CpGenome Universal Methylated DNA; Millipore) and unmethylated DNA prepared by whole genome amplification (WGA; GenomePlex, Sigma-Aldrich) was used as methylation-positive and -negative controls, respectively.
Table 1: List of ssDNA probes used for mutation and methylation profiling.
GENE Site Jm Sequence
*
[°C]
BRAF Exon c. l391G>A 44.7 NH2-C6-5'-
11 WT 44.7 (9xT)AAATGATCCAGATCCAATTCTTTGTCC-3'
NM_004333.4 NH2-C6-5'-(9xT)
AATGATCCAGATTCAATTCTTTGTCCC-3 '
BRAF Exon c. l799T>A 46.3 NH2-C6-5'-(9xT)
15 C.1798GT>AA 46.6 CTCC ATCGAGATTTCTCTGTAGCTAGAC-3 '
NM_004333.4 WT 46.4 NH2-C6-5'-(9xT)
TCC ATCGAG ATTTCTTTGTAGCTAGACC-3 '
NH2-C6-5'-(9xT)
TCCATCGAGATTTCACTGTAGCTAGAC-3 '
NRAS Exon 2 C.1810A 45.3 NH2-C6-5'-(9xT) ACTGTACTCTTCTTTTCCAGCTGT-3 '
NM_002524.4 C.182A>T 45.5 NH2-C6-5'-(9xT) ACTGTACTCTTCTAGTCCAGCTGTA-3 '
WT 45.5 NH2-C6-5'-(9xT) CTGTACTCTTCTTGTCC AGCTGT-3 '
KIT Promoter PI Meth 46.5 NH2-C6-5'-(9xT) CCCAAAACCGCGAACGAC-3 '
PI uMeth 46.4 NH2-C6-5'-(9xT)CCCCCAAAACCACAAACAACAA-3 ' KIT Promoter P2 Meth 46.4 NH2-C6-5'-(9xT) GAACGCGACAAAACCGAACC-3 '
P2 uMeth 46.5 NH2-C6-5'-(9xT) ACAAACACAACAAAACCAAACCCC-3 '
RARB PI Meth 44.0 NH2-C6-5'-(9xT)
Promoter PI uMeth 43.8 ATCCTCAAACAACTCGCATAAAAAAATTC-3'
NH2-C6-5'-
(9xT)AATCCTCAAACAACTCACATAAAAAAATTCT-3 '
RARB P2 Meth 45.6 NH2-C6-5'-(9xT) GAATCCTACCCCGACGATACC -3 '
Promoter P2 uMeth 45.7 NH2-C6-5'-(9xT) AAATCCTACCCCAACAATACCCA -3 '
Reference Positive NH2-C6-5'-(9xT) TGC GAG CTT CGT ATT ATG GCG -3'
Negative TEG Biotin
NH2-C6-5'-(9xT) GTGGGGCTAGGTG -3 '
*Theoretical melting temperatures (Tm) were calculated with nearest neighbour (NN) model for 10 mM Na+ ionic concentration. Probes were designed to have matched Tm. **A11 probes are amino-labelled to bind to GMR sensor surfaces.
Table 2: PCR primers for amplification of EST cell line genomic DNA.
GENE Sequence Product length BRAF Exon 11 fw : biotin-C6-5 ' -TTGACTTTTTTACTGTTTTTATC-3 ' 167bp
NM_004333.4 bw : 5 ' -ATGTCACC AC ATTAC ATACTTAC-3 '
BRAF Exon 15 fw: biotin- C6-5'- TTTTCCTTTACTTACTACACCTC -3 ' 167bp
NM_004333.4 bw: 5'- GGAAAAATAGCCTCAATTCT -3'
NRAS Exon 2 fw: biotin- C6-5'- CAAGTGGTTATAGATGGTGA -3 ' l lObp
NM_002524.4 bw: 5'- AGGAAGCCTTCGCCTGTCCT -3 '
KIT Promoter fw: biotin- C6-5'- GGGAGGAGGGGTTGTTGTT -3 ' 82bp
bw: 5' - TTCCAACTCTCCCCCAAATACAAC -3 '
RARB Promoter* fw: biotin- C6-5'- GGTTTATTTTTTGTTAAAGGGG -3 ' 179bp
bw: 5'- AAAAATCCCAAATTCTCCTTC -3 '
* KIT and RARB primers were designed to amplify bisulphite converted promoter re;
Table 3: Primers for pyrosequencing KIT and RARB promoter regions of bisulphite converted DNA from EST cell lines.
Gene Sequence
KIT Promoter fw : 5 ' - GTGG A A AGGTGG AG AG AG A A A -3 '
bw: biotin-5'- TTCCAACTCTCCCCCAAATACAAC -3 '
SI : 5'- GAGGAGGGGTTGTTG -3 '
RARB promoter fw : biotin- C6-5 ' - GGTTTATTTTTTGTTAAAGGGG -3 '
bw: 5'- AAAAATCCCAAATTCTCCTTC -3 ' SI : 5'- ACATCCCAATCCTCA -3'
S2: 5'- ATACTTACAAAAAACCTTCC -3 '
Table 4: Parameters from linear fitting of ATm vs.
methylation density by pyrosequencing (Fig. 6A-C).
Numbers in parenthesis are standard errors on the last
digits from the fitting routine.
Location Slope Intercept R
[°C/%] [°C]
KIT pi 0.22(1) -9(1) 0.97
KIT p2 0.25(1) -8.8(7) 0.98
RARB pi 0.075(5) -5.1(2) 0.97
RARB p2 0.22(2) -9.3(7) 0.94
Above, we described the use of so-called planar Hall effect bridge (PHEB) sensors for real-time measurements of the temperature melting of DNA hybrids. We now describe examples of embodiments related to two-dimensional salt and temperature DNA denaturation analysis on a magnetoresi stive sensor. In particular, these examples illustrate the combined effect of temperature and salt concentration and demonstrate two- dimensional salt and temperature denaturing mapping of a target to WT and MT probes to investigate salt concentration melting and to identify optimum conditions for discrimination between matching and mismatching target-probe hybrids. We further investigate the use of a single sensor bridge to discriminate between WT, MT and a mixture of these targets. Sensor fabrication
The magnetoresi stive sensor bridges were fabricated as described previously. Briefly, anisotropic magnetoresi stive elements of nominal composition Ta(5 nm)/ NisoFe2o(30 nm)/ Mn80Ir2o(10 nm)/ Ta(5 nm) were sputter-deposited in a saturating magnetic field. Electrical contacts of Ti(10 nm)/ Pt(lOO nm)/ Au(lOO nm)/ Ti(lO nm) were deposited by electron beam evaporation. The sensors were spin coated with a 900 nm thick passivation layer (Ormocomp, Micro Resist Technology, GmbH, Germany). Fig. 7A is a schematic diagram of the differential magnetoresi stive sensor bridge according to an embodiment of the invention. The magnetic material are diagonal bars connecting electrical contacts. Vx is the sensor bias voltage and Vy is the sensor bridge output voltage. The chip has five differential magnetoresi stive sensor bridges, each having four sensor elements with length 7=250 μπι and width w=25 μπι. This sensor design (termed differential planar Hall effect bridge, dPHEB) measures the differential signal between the top two branches and the bottom two branches of the bridge as described by Rizzi et al. Fig. 7B is a schematic representation of temperature and salt concentration melting. Increasing temperature (bottom) or decreasing salt concentration (top) increases the stringency causing denaturation of the target-probe hybrids. Following denaturation, MNP-labeled targets are released from the sensor surface, resulting in a reduced signal from the sensor bridge.
Measurement platform
The measurement platform was previously described by 0sterberg et al.17 and Rizzi et al.15 and is depicted in the schematic measurement setup of Fig. 7C. The chip is mounted in the microfluidic chamber below the circuit board that provides electrical connection to the chip via spring-loaded pins. The chip was mounted in a click-on microfluidic system 710 defining a fluidic channel (width x height x length= 1 mm x 1 mm x 5 mm) over the sensor surface and providing electrical contact to the magnetoresi stive sensors using spring-loaded pins. A voltage of RMS^ I -6 V at frequency f=\61 Hz was applied to all sensor bridges connected in parallel using a commercial audio amplifier 708. The output voltage of each sensor bridge was measured using an SR830 Lock-In amplifier 712 with an SR552 preamplifier (Stanford Research Systems, Inc., USA). The MNPs were magnetized by the magnetic field due to the applied bias current through the sensor and the presence of MNPs on the sensor was detected in the imaginary part of the second harmonic lock-in signal. Microscope 704 is provided for imaging the surface of the chip. The sensor chip was mounted in an aluminum chip holder with good thermal contact. The temperature of the chip mount was measured with a PtlOOO thermometer, and controlled via a LFI3751 control unit (Wavelength Electronics, USA) driving a Peltier element. The other side of the Peltier element was cooled using a commercial CPU water cooling system 706.
Two syringe pumps 700, 702 (model 540060, TSE systems, Germany), connected to a chip inlet via a T-branch, provided the liquid flow in the chip during washing. They were controlled via a custom Lab View program such that any ratio of the two liquids could be injected while maintaining a constant total liquid flow rate.
Sensor functionalization
The sensor elements on each of the five sensor bridges could be selectively functionalized with amino modified ssDNA probes as described by Rizzi et al. The probes to genotype S Ps in the human beta globin (HBB) gene (sequences in Supplementary Information) were adapted from Petersen et al. and were purchased from DNA Technology A/S, Denmark. One of the sensor bridges on each chip was used as a positive reference and was functionalized on its top half with a biotinylated DNA probe. Two sensor bridges were used for direct detection of the wild type (WT) or mutant type (MT) variants of the CD 8/9 locus of the HBB gene and were functionalized on their top halves with the corresponding respective probes. We will refer to these as the MT and WT sensors, respectively. To perform WT-MT differential detection of the CD 8/9 and CD 17 loci of the HBB gene, two sensor bridges on a chip were functionalized on their top and bottom halves with probes matching the WT and MT variants, respectively.
Hybridization. The solution of target-labeled MNPs was prepared by mixing a solution of 10 nM biotinylated target DNA (sequences in supplementary information) in 4xSaline Sodium Citrate (SSC, Gibco, USA) buffer 1 : 1 v:v with the stock solution of Miltenyi Streptavidin Microbeads (Miltenyi Biotec Norden AM, Sweden) to a final target concentration of 5 nM (buffer salt concentration c(Na+)=400 mM). The target-MNP solution was injected over the sensors and incubated for 30 min at J=370C. Temperature melting. After hybridization of WT DNA target, the chip was washed with diluted SSC buffer to a final concentration c(Na+)=10 mM or 2 mM at J=20°C for 80 s at 30 Following washing, the temperature was ramped from J=20°C to 70°C at 0.1 °C/s. The melting data was corrected for the temperature dependence of the sensor sensitivity using a reference sweep from J=70°C to 20°C measured after complete dena- turation of the hybrids as described previously.
Salt concentration melting. After hybridization of WT DNA target, the chip was washed with 2xSSC (c(Na+)=400 mM) at J=30°C or 40°C at 30 uL/min for 80 s. After this initial washing, the washing buffer concentration was varied exponentially from c(Na+)=400 mM to 0.4 mM over 1200 s by mixing the flow of 2xSSC buffer from syringe pump one with milliQ water from syringe pump two. Concentration dependent sensor offsets determined from a reference concentration profile measurement with no MNPs were subtracted from the data.
WT-MT differential measurements. Three 5 nM target DNA solutions were analyzed on the sensor bridges functionalized for WT-MT differential detection: WT, MT and 1 : 1 WT:MT. After hybridization, melting curves were measured during both temperature and salt concentration melting. Temperature melting was performed as described above with c(Na+)=10 mM. Salt concentration melting was performed as described above at J=370C. The signal measured during temperature melting was corrected for the temperature dependence of the sensor sensitivity and normalized by the signal from the positive reference sensor functionalized with biotinylated DNA.
Temperature melting
Fig. 8A, Fig. 8B show the WT target melting curves measured for c(Na+)=10 mM and 2 mM, respectively of MNP labeled WT DNA target hybridized to WT and MT DNA probes for the CD8/9 mutation. The real-time data was corrected for the temperature dependence of the sensor output and normalized to the initial value at 20°C. The two sensor bridges were functionalized as depicted in the inset. The DNA hybrids were denatured by increasing the temperature from J=20°C to 70°C at 0.1°C/s for Fig. 8A c(Na+)=10 mM and Fig. 8B c(Na+)=2 mM. Results of triplicate experiments are shown. Biotinylated WT DNA target, labeled with streptavidin MNPs, at a DNA concentration of c=5 nM in 2xSSC buffer (c(Na+)=400 mM) was incubated over the sensors at J=37°C for 30 min. The measurements below were performed with the WT and MT sensors for SNP detection of the CD 8/9 locus in HBB (see inset in Fig. 8B). The signal due to MNPs was measured in the imaginary part of the 2nd harmonic bridge voltage, here written as J7, in response to the AC bias of the bridge. When the top and bottom halves of the bridge experience the same concentration and distribution of MNPs, the bridge is balanced and nominally zero signal is detected. Hybridization of MNP -labeled DNA to the top half of a sensor bridge increases the local MNP concentration at this half of the sensor bridge and causes an increase of V.
After hybridization, the chip temperature was decreased to J=20°C to stabilize hybrids and inhibit further binding. Unbound target-MNPs were removed by washing. Two buffers were tested, with c(Na+)=10 mM and 2 mM, respectively. Following washing, the buffer was left stagnant over the sensors and the temperature was ramped from J=20°C to 70°C at 0.1°C/s to measure the melting of the DNA hybrids in real time.
For c(Na+)=10 mM (Fig. 8A) the signals for both the WT and MT sensors were stable between 20°C and 30°C. At T > 30°C, the signal from the MT sensor decreased sharply indicating a temperature melting of the DNA hybrids. For the WT sensor, the melting was shifted to a higher temperature. Some variation in the absolute melting temperatures was observed between the three experiments. However, in each experiment, we found the temperature shift between the MT and WT sensors to be reproducible and with a value of about 8°C.
For c(Na+)=2 mM (Fig. 8B) the results followed a similar trend. The MT sensor signal showed a sharp decrease at a temperature, which was about 9°C lower than for the WT signal. Compared to Fig. 8A, the melting also took place at lower temperature. Salt concentration melting
Fig. 9A, Fig. 9B show salt concentration melting curves of WT DNA target hybridized to WT and MT DNA probes for the CD8/9 mutation. PHEB sensors were functionalized as depicted in the inset. The hybrids were denatured by decreasing the salt concentration from c(Na+)=400 mM to 0.4 mM over 1200 s at J=30°C (Fig. 9A) and J=40°C (Fig. 9B). Results of triplicate experiments are shown.
Melting measurements of the MNP-labeled WT DNA hybrids were performed at fixed temperature as function of decreasing salt concentration in the washing buffer. Following hybridization, the sensor temperature was set to 30°C or 40°C and unbound labels were washed off with 2x SSC buffer (c(Na+)=400 mM) at a flow rate of 30 μΐ,/πώι. Subsequently, the washing buffer salt concentration was exponentially decreased from c(Na+)=400 mM to 0.4 mM over 1200 s while maintaining a constant total flow rate of 30 μΐ,/πήη by varying the relative flow rate of the two syringe pumps loaded with 2x SSC and MilliQ water, respectively. Salt concentration melting curves were measured in realtime during the decreasing concentration profile. The results are shown in Fig. 9A, Fig. 9B obtained at J=30°C and 40°C; a logarithmic time scale is used because of the exponential time profile of the buffer concentration. The final value of the sensor signal at c(Na+)=0.4 mM was subtracted to obtain the signal variation AV(c).
At J=30°C (Fig. 9A), the signals for both WT and MT sensors were approximately constant at high salt concentrations, c(Na+) > 20 mM, and the WT sensor signal was 25% higher than that from the MT sensor. The three experiments were highly reproducible and therefore no normalization of the data was performed. The MT sensor signal decreased sharply between c(Na+)=20 mM and 2 mM indicating a melting of the DNA hybrids. The signal from WT probe decreased at a lower salt concentration c(Na+) < 3 mM.
At J=40°C (Fig. 9B), the same trend was observed, but the melting curves were shifted to higher salt concentrations, such that melting took place at higher c(Na+) compared to J=30°C.
Melting temperature Tm and concentration cm
Error function fits to the temperature melting curves in Fig. 8A, Fig. 8B were performed to extract the melting temperature Tm defined as the temperature at which the curve reached 50% of its initial value. For c(Na+)=10 mM we obtained rm(WT)=43±l°C and rm(MT)=35±l°C (uncertainties indicate standard error of the mean (SDOM), n=3) for the WT and MT sensors, respectively. The corresponding values for c(Na+)=2 mM were
Figure imgf000028_0001
Similarly, error function fits to the data in Fig. 9A, Fig. 9B vs. log(c) were performed to extract the melting concentration cm, defined as the point at which the error function reached 50% of the initial value. At J=30°C we obtained cm(WT)=1.4±0.1 mM and cm(MT)=6.3±0.3 mM and at J=40°C we obtained cm(WT)=5.7±0.2 mM and cm(MT)=15±l mM. Uncertainties indicate SDOM (n=3). Fig. 10 shows the values of melting temperature Tm and salt concentration cm obtained from error function fits to the temperature and salt melting, respectively, for the WT target and WT probes (filled symbols) and MT probes (open symbols) for the CD 8/9 locus of HBB. Dashed lines represent the temperature (horizontal) and concentration (vertical) profiles used. The arrow indicates direction of increasing stringency. Error bars are standard error of the mean (n=3). The values of Tm and cm obtained from the denaturation experiments are collected in Fig. 10. The dashed lines represent the temperature or concentration profiles used. The perfectly matched WT probe-WT target gave denaturation points at higher stringency compared to the mismatched MT probe-WT target hybrids. The separation between the two is not constant, but it is maximal in the central region of the plot.
Genotyping using WT-MT differential measurements
We have previously shown that a single sensor bridge can be used for genotyping when its top and bottom halves are functionalized with WT and MT probes, respectively. The sensor output is proportional to the difference in the amount of MNPs bound to the top and bottom halves of the sensor bridge. To genotype each of the CD 8/9 and CD 17 loci of the HBB gene with respect to the mutations given in Table 1, we functionalized a sensor bridge with WT and MT probes on its top and bottom halves, respectively (see insets in Fig. 11A-D). Three target combinations were measured: WT, MT and 1 : 1 WT:MT.
Fig. 11A shows the temperature melting curve measured at c(Na+)=10 mM for the CD 8/9 locus. Note that the curves show the signal relative to that obtained from the positive reference sensor. At low temperature, the relative signal was close to zero for all three targets, indicating identical hybridization of the targets to both WT and MT probes. At temperatures J=30°C to 50°C, the relative signal from the three target clearly differed from each other. For the WT target, the relative signal peaked at a positive value of 0.17 whereas for the MT target, the signal peaked at a negative value of -0.15. The signal from the 1 : 1 WT:MT target mixture maintained a value closer to zero and reached a minimum value of -0.06. Above J=50°C the relative signal for the three targets stabilized at zero. Fig. 11B shows the salt concentration melting curve measured at J=37°C for the CD 8/9 locus. At high salt concentration (c(Na+) > 50 nM) the WT and MT targets showed similar values in the range ΔΚ=-0.005 μν to 0 μν. The signal from the mixed WT:MT target showed a lower value (ΔΚ=-0.021μν) that increased towards zero for increasing c(Na+). For c(Na+)=40 nM to c(Na+)=4 nM, the three targets showed maximum separation, with the WT target reaching ΔΚ=+0.023 μν, the MT target reaching ΔΚ=-0.023 μν, and the mixed MT:WT target showing a stable signal near AV=0 μ\. At low salt concentration (c(Na+)<4nM) the signals from the three targets stabilized at zero.
Fig. llC, Fig. 11D show the corresponding temperature and salt concentration melting profiles measured for the CD 17 locus. In the temperature melting study (Fig. 11C), the three targets showed a clear separation even at low temperature. The trend with temperature was the same as for the CD 8/9 locus except that the peaks appeared at lower temperatures and the peak levels were slightly lower. The maximum separation between the three targets was observed between 35°C and 40°C. In the salt concentration melting study (Fig. 11D), the three targets were initially separated at high c(Na+) with A (WT) > A (WT:MT) > AV(MT) > 0. Upon increasing stringency (decreasing c(Na+)), AV for all three targets decreased and separated more from each other. The largest separation was observed for c(Na+)=29 mM and corresponded to ΔΚ(ΜΤ)=+0.015 μν, ΔΚ(ΜΤ)=-0.008 μν, and AF(WT:MT)= +0.002 μν. For c(Na+)<7 mM, the signal from all targets approached AV=0.
Melting curves discussion The differential design of the bridge sensors allowed for real-time measurement of the formation and melting of DNA hybrids. The integration of the sensor chip in a microfluidic system with temperature control allowed us to perform two-dimensional melting studies as function of temperature and/or salt concentration. Both of these two parameters affect the stability of DNA hybrids and can thus be used to discriminate between perfectly matched target-probe hybrids and mismatches down to a single nucleotide level. The magnetic sensor platform is compact and sufficiently robust to enable readout under conditions of varying temperature or salt concentration. Both temperature and salt concentration melting curves were measured to characterize the investigated loci of the HBB gene. In both investigations, the unmatched MT probe-WT target duplexes denatured at lower stringency (lower T, higher c(Na+)) compared to the perfectly matched counterparts. As expected from nearest neighbor models, decreasing buffer c(Na+) leads to lower Tm for both matched and mismatched hybrids. Similarly, increasing Jleads to higher cm.
Fig. 11A-D Melting curves (Fig. 11 A, Fig. 11C) and salt concentration denaturation curves (Fig. 11B, Fig. 11D) measured on differential sensors for WT, MT, and a 1 : 1 WT:MT mixture of target DNA. The sensors were functionalized with WT and MT probes for the CD 8/9 locus (Fig. ΙΙΑ,Β) or the CD 17 locus (Fig. 11C, Fig. 11D) as indicated in the insets.
The two methods showed clear differences in reproducibility. While salt concentration denaturation curves (Fig. 9A, Fig. 9B) were almost perfectly overlapping, the absolute melting temperatures measured for repeated measurements showed an uncertainty of about 2°C (SDOM, n=3). The differences in the simultaneously measured melting temperatures measured for the two sensors, Arm=rm(WT)-rm(MT), were found to AJm=7.7±0.2°C (c(Na+)= 10 mM) and 8.9±0.5°C (c(Na+)=2 mM), where the stated uncertainties are SDOM (n=3). Thus, the uncertainty on ATm was significantly lower than that on the absolute melting temperature. This indicates that it was difficult to accurately replicate identical temperature profiles. The variation in the absolute temperature may, for example, originate from differences in temperature of the washing buffer or the chip surroundings. Our results further indicate that salt concentration profiles are more easily reproduced. Moreover, the signal from the magnetoresistive sensors is only weakly sensitive to a change in the salt concentration. Further, the requirements for temperature control are less restrictive for salt concentration melting and the concentration can be varied using a simple two-pump setup. Therefore, concentration melting experiments are easier to implement.
Two-dimensional mapping of Tm and cm
The measurements of the melting curves as function of both temperature and salt concentration allowed us to map the point of denaturation over these two dimensions of experimental conditions. The resulting map of Fig. 10 presents the measured Tm and cm. These results offer a non-trivial insight into the stability of DNA hybrids over a wide range of stringencies in the (Γ, c(Na+))-plane.
Hybridization-based assays aim to discriminate between matched and mismatched probe- target hybrids. In an end-point detection scheme, this is done by selecting a stringency condition that, to the extent possible, denatures mismatched hybrids and maintains the matched hybrids. Similarly, a denaturation assay should maximize the gap between the melting points of the matched and mismatched hybrids. In Fig. 10 we can identify an optimal region between J=32-38°C and c(Na+)=3-7 mM where the distance between open and solid symbols is maximal.
As a perspective, the presented magnetoresi stive sensor detection scheme and setup allows for any profile in the (Γ, c(Na+))-plane, i.e., for a simultaneous change of T and c(Na+). Fig. 10 indicates that a potentially better separation between WT and MT could be obtained along the diagonal in the (T, c(Na+))-plane by simultaneously ramping the temperature up and the salt concentration down. This will be topic for future investigation.
Magnetore si stive sensor arrays with up to thousand sensors have been presented in the literature.16 Real-time two-dimensional maps of the melting of a DNA target hybridized to an array of WT and MT detection probes enable a highly parallel screening of conditions for a range of sequences and probe lengths to target a number of loci and genes in a DNA target. This can be used for direct genotyping but also to identify regions on the (Γ, c(Na+))-plane that are optimal for end-point detection after a stringent washing. This could significantly ease the design and improve performance of microarrays, where the probe design may be challenging as a single stringent wash has to produce a large difference between matching and mismatching hybrids while still maintaining a significant signal from the matching hybrids.
Genotyping using WT-MT differential measurements
By functionalizing the top and bottom halves of a single sensor bridge with WT and MT probes, it was possible to measure the differential binding of target to the two probes. For a given sensor array, this configuration allows for the investigation of a higher number of mutation sites, since only a single sensor is used for each mutation.
The melting curves of Fig. 11 A, Fig. 11B showed different behaviors for the CD 8/9 and CD 17 loci. The stability of the target-probes hybrids depends on the length of the probe, its C+G content and the type of mutation investigated. Here, the mutation at the CD 8/9 locus is a single base (C) insertion, whereas that at the CD 17 locus is a single base (T>A) transversion. The probes had lengths of 22 bases (C+G 54%) and 18 bases (C+G 66%) for the CD 8/9 and CD 17 loci, respectively.
The shorter probe length for CD 17 caused a separation of the three targets also at low stringency (Fig. 11C, Fig. 11D) and maximum separation between the targets was found at lower stringencies compared to CD 8/9. Moreover, the base insertion in CD 8/9 resulted in more unstable mismatched hybrids and caused a higher separation between the three targets (Fig. 11 A, Fig. 11B).
For the CD 8/9 locus, the initial negative signal from the 1 : 1 WT:MT mixed target at high c(Na+) in Fig. 5b is likely caused by a higher affinity of the MT target-MT probe hybrids compared to that of the WT target-MT probe. This is supported by the observation that the signal from the MT target peaks at lower c(Na+) (higher stringency) than the WT target in Fig. 11B. For the salt concentration melting for the CD 17 locus (Fig. 11D), the initial signals from all three targets at high c(Na+) were positive and were found to decrease with decreasing salt concentration. We speculate that this is caused by higher unspecific binding to the WT probe than the MT probe. The different behavior of the WT and MT probes for the CD 8/9 and CD 17 loci would require optimization of the assay in end-point detection to determine the optimum washing stringency to perform a correct genotyping. Instead, using a denaturation curve method, the hybrids are subject to a continuously varying stringency and thus we could easily differentiate the three different target compositions.
Conclusion
The examples above demonstrated the use of a magnetoresistive sensor array integrated in a lab-on-a-chip system for studies of the denaturation of DNA hybrids as function of both temperature and salt concentration. The magnetic readout was only weakly sensitive to the varying experimental conditions and could therefore be used to provide a sensitive real-time readout of the signal from the magnetic nanoparticle labeled DNA target hybridized to detection probes. The differential sensor design enabled studies of the specific binding of a WT target to WT and MT detection probes for two loci of the human HBB gene. Melting experiments at different cuts in the temperature-salt concentration plane identified a region of optimal discrimination between the two. Further, it was found that salt concentration melting curves were more reproducible than temperature melting curves. These provide a hitherto not studied but interesting alternative to temperature melting curves in lab-on-a-chip systems.
Further, the examples demonstrated the discrimination between WT, MT and 1 : 1 WT:MT targets using a single sensor bridge functionalized on its top and bottom parts with WT and MT probes, respectively. This was performed both for temperature melting and salt concentration melting.
This demonstrates the feasibility of using a lab-on-a-chip magnetoresistive sensor arrays for the characterization of the stability of DNA hybrids as function of both salt concentration and temperature. On a larger sensor array, this can be used for simultaneous mapping of a number of probe-target interactions in the temperature-salt concentration plane for real-time detection or to identify regions of optimal assay conditions.

Claims

1. A method of methylation detection that provides a quantitative description of the methylation density in DNA strands, the method comprising:
performing bisulphite conversion of the DNA strands containing methylated and
unmethylated sites to create converted DNA strands with mismatch base pairs; performing PCR amplification of the converted DNA strands to produce PCR amplified converted DNA strands;
magnetically labeling the PCR amplified converted DNA strands;
hybridizing PCR amplified converted DNA strands to complementary DNA strands immobilized onto a magnetoresi stive (MR) sensor array, wherein the hybridizing is performed before or after the magnetically labeling;
increasing a stringency condition to cause the magnetically labeled single strand target
DNA strands to be denatured from the complementary DNA strands immobilized onto a magnetoresistive (MR) sensor array;
reading out in real time during the increasing of the stringency condition a denaturation signal resulting from the denatured magnetically labeled single strand target DNA strands;
determining stringency conditions of methylated and unmethylated DNA strands from the denaturation signal.
2. The method of claim 1 further comprising reading out in real time a binding
signal during hybridizing the magnetically labeled single strand target DNA strands with complementary DNA strands immobilized onto a magnetoresistive (MR) sensor array.
3. The method of claim 2 wherein the stringency condition is temperature, wherein increasing the stringency condition comprises increasing the temperature while salt concentration is held constant, and wherein determining the stringency conditions of the methylated and unmethylated DNA strands comprises determining melting temperatures of the methylated and unmethylated DNA strands. The method of claim 2 wherein the stringency condition is salt concentration, wherein increasing the stringency condition comprises decreasing the salt concentration while temperature is held constant, and wherein determining the stringency conditions of the methylated and unmethylated DNA strands comprises determining melting salt concentrations of the methylated and unmethylated DNA strands.
The method of claim 3 or 4 wherein performing bisulphite conversion of the DNA strands containing methylated and unmethylated sites comprises performing bisulphite conversion of the DNA strands containing methylated and
unmethylated sites and wild type genes and mutated genes; and wherein determining stringency conditions of methylated and unmethylated DNA strands from the denaturation signal comprises determining stringency conditions of methylated and unmethylated DNA strands and wild type genes and mutated type genes from the denaturation signal, whereby mutation sites may be determined simultaneously with methylation sites.
A method of methylation detection that provides a quantitative description of the methylation density in DNA sequences, comprising: Bisulphite conversion of DNA strands with or without methylated sites; PCR amplification of converted DNA strands; Hybridization of converted target DNA strands with a MR sensor array immobilized with (unmethylated) complementary DNA strands; Adding methyltransferase to methylate the complementary DNA strands corresponding to the methylated sites of the target DNA strands; Ramping up temperature until target DNA strands are denatured from the immobilized DNA strands, leaving behind the methylated single strand DNA if the target DNA is methylated, or leaving behind the unmethylated single strand DNA if the target DNA is unmethylated; Adding magnetic nanoparticles conjugated with methyl- recognizing moieties, such as antimethylated lysine antibody, which will bind to methylated DNA strands immobilized on the sensor; Reading out the binding signal in real time, and determining if the immobilized DNA strand (and thus the corresponding target DNA strand) is methylated or not.
PCT/US2018/030457 2017-05-01 2018-05-01 Profiling of dna methylation using magnetoresistive biosensor array Ceased WO2018204367A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201880029325.9A CN110662845A (en) 2017-05-01 2018-05-01 Characterization of DNA methylation using magnetoresistive biosensor arrays

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201762492617P 2017-05-01 2017-05-01
US62/492,617 2017-05-01

Publications (1)

Publication Number Publication Date
WO2018204367A1 true WO2018204367A1 (en) 2018-11-08

Family

ID=63915550

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2018/030457 Ceased WO2018204367A1 (en) 2017-05-01 2018-05-01 Profiling of dna methylation using magnetoresistive biosensor array

Country Status (3)

Country Link
US (1) US20180312911A1 (en)
CN (1) CN110662845A (en)
WO (1) WO2018204367A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4172360A4 (en) * 2020-06-30 2024-01-17 The Board of Trustees of the Leland Stanford Junior University METHOD AND DEVICE FOR AUTOMATED AND POINT-OF-CARE NUCLEIC ACID AMPLIFICATION TESTING

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070114180A1 (en) * 2005-11-18 2007-05-24 Intel Corporation Device, method, and system for separation and detection of biomolecules and cells
US20110165565A1 (en) * 2008-01-03 2011-07-07 The Johns Hopkins University Compositions and methods for polynucleotide extraction and methylation detection
US20130309668A1 (en) * 2004-03-08 2013-11-21 Rubicon Genomics, Inc. Methods and compositions for generating and amplifying dna libraries for sensitive detection and analysis of dna methylation
US20150275304A1 (en) * 2008-09-16 2015-10-01 Sequenom, Inc. Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses
US20160083792A1 (en) * 2013-01-25 2016-03-24 Murdoch Childrens Research Institute An assay for quantitating the extent of methylation of a target site
WO2016097319A1 (en) * 2014-12-19 2016-06-23 Epigenomics Ag METHODS FOR DETECTING CpG METHYLATION AND FOR DIAGNOSING CANCER
US20170097337A1 (en) * 2015-10-02 2017-04-06 The Board Of Trustees Of The Leland Stanford Junior University Method for detecting small molecule analytes using magnetoresistant sensors

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130309668A1 (en) * 2004-03-08 2013-11-21 Rubicon Genomics, Inc. Methods and compositions for generating and amplifying dna libraries for sensitive detection and analysis of dna methylation
US20070114180A1 (en) * 2005-11-18 2007-05-24 Intel Corporation Device, method, and system for separation and detection of biomolecules and cells
US20110165565A1 (en) * 2008-01-03 2011-07-07 The Johns Hopkins University Compositions and methods for polynucleotide extraction and methylation detection
US20150275304A1 (en) * 2008-09-16 2015-10-01 Sequenom, Inc. Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses
US20160083792A1 (en) * 2013-01-25 2016-03-24 Murdoch Childrens Research Institute An assay for quantitating the extent of methylation of a target site
WO2016097319A1 (en) * 2014-12-19 2016-06-23 Epigenomics Ag METHODS FOR DETECTING CpG METHYLATION AND FOR DIAGNOSING CANCER
US20170097337A1 (en) * 2015-10-02 2017-04-06 The Board Of Trustees Of The Leland Stanford Junior University Method for detecting small molecule analytes using magnetoresistant sensors

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
RIZZI ET AL.: "Simultaneous Profiling of DNA Mutation and Methylation by Melting Analysis Using Magnetoresistive Biosensor Array", ACS NANO, vol. 11, no. 9, 13 September 2017 (2017-09-13), pages 8864 - 8870, XP055545085 *

Also Published As

Publication number Publication date
CN110662845A (en) 2020-01-07
US20180312911A1 (en) 2018-11-01

Similar Documents

Publication Publication Date Title
Liu et al. An integrated and sensitive detection platform for biosensing application based on Fe@ Au magnetic nanoparticles as bead array carries
CA2701380C (en) Detection of methylated dna and dna mutations
CA2505254A1 (en) Universal tag assay
US20050191636A1 (en) Detection of STRP, such as fragile X syndrome
WO1995002068A1 (en) Method of discriminating nucleic acid and testing set for discriminating nucleic acid
JP2006520206A (en) Probe, biochip and method of using them
US9745633B2 (en) Detection of PNA clamping
Nesvet et al. Highly sensitive detection of DNA hypermethylation in melanoma cancer cells
WO2004042057A1 (en) Method of detecting gene mutation
Park et al. Highly sensitive and selective detection of single-nucleotide polymorphisms using gold nanoparticle MutS enzymes and a micro cantilever resonator
HK1222881A1 (en) Improved ngs workflow
Zhang et al. A novel bisulfite-microfluidic temperature gradient capillary electrophoresis platform for highly sensitive detection of gene promotermethylation
JP2020519249A (en) Accurate temperature measurement method for giant magnetoresistive biosensor array
US8673563B2 (en) Amplification method of methylated or unmethylated nucleic acid
Jang et al. Multiplexed and streamlined DNA methylation detection of colorectal cancer-related genes using graphically encoded hydrogel microparticles and rolling circle amplification
US20180312911A1 (en) Profiling of DNA methylation using magnetoresistive biosensor array
Elenis et al. A nanoparticle-based sensor for visual detection of multiple mutations
Hansen et al. Visual, base-specific detection of nucleic acid hybridization using polymerization-based amplification
Dufva et al. Detection of mutations using microarrays of poly (C) 10–poly (T) 10 modified DNA probes immobilized on agarose films
EP3577233B1 (en) Genotyping of mutations by combination of in-tube hybridization and universal tag-microarray
JP4477936B2 (en) Nucleic acid detection method
US20050042608A1 (en) Detection of single nucleotide polymorphisms
WO2004099755A2 (en) Method of electrochemical detection of somatic cell mutations
JP4666525B2 (en) Electrochemical method for measuring DNA binding to electrode surfaces in the presence of molecular oxygen
EP1207209A3 (en) Methods using arrays for detection of single nucleotide polymorphisms

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18794454

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18794454

Country of ref document: EP

Kind code of ref document: A1