WO2018200889A1 - Oncogene chd4 and uses thereof in the diagnosis and treatment of cancer - Google Patents
Oncogene chd4 and uses thereof in the diagnosis and treatment of cancer Download PDFInfo
- Publication number
- WO2018200889A1 WO2018200889A1 PCT/US2018/029682 US2018029682W WO2018200889A1 WO 2018200889 A1 WO2018200889 A1 WO 2018200889A1 US 2018029682 W US2018029682 W US 2018029682W WO 2018200889 A1 WO2018200889 A1 WO 2018200889A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- chd4
- expression
- level
- cells
- genes
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57535—Immunoassay; Biospecific binding assay; Materials therefor for cancer of the large intestine, e.g. colon, rectum or anus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/573—Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6875—Nucleoproteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/90—Enzymes; Proenzymes
- G01N2333/914—Hydrolases (3)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
- G01N2500/10—Screening for compounds of potential therapeutic value involving cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/54—Determining the risk of relapse
Definitions
- CHD4 chromodomain helicase DNA-binding protein 4
- NuRD histone deacetylation
- DDR DNA damage repair
- Loss of CHD4 function can sensitize tumor cells to oxidative damage and the protein promotes genome stability by helping to regulate p53 dependent cell cycle checkpoints (Polo et al, 2010).
- CHD4 can also protect replication forks in a poly(ADP-ribose) polymerase (PARP) dependent manner helping BRCA1 and BRCA2 deficient cells survive, perform DDR and acquire drug resistance (Guillemette et al., 2015; Ray Chaudhuri et al., 2016).
- PARP poly(ADP-ribose) polymerase
- One defined role of CHD4 in double strand break (DSB) repair is to recruit repressive chromatin to open chromatin regions in active gene promoters (Chou et al, 2010; Larsen et al, 2010; Polo et al., 2010) serving to protect transcribed regions during repair (Chou et al, 2010; Larsen et al., 2010; Polo et al., 2010).
- CHD4 has previously associated a key core subunit of NuRD, CHD4 with potentially maintaining TSG silencing mediated by abnormal promoter CpG island DNA methylation in cancer cells (Cai et al., 2014). Furthermore, recent studies reported that CHD4 is rapidly recruited to DNA damage sites where it facilitates DNA damage repair (Chou et al, 2010; Polo et al, 2010).
- the present invention shows how a key component of the NuRD complex, CHD4 plays a vital oncogenic role during DNA damage inherent to tumor initiation and progression.
- damage is inherent to the severe cellular stress and chronic inflammation which are leading risk factors for many human cancer types (Grivennikov et al, 2010) and arise secondary to toxicities from increases in reactive oxygen species (ROS) (Reuter et al, 2010).
- ROS reactive oxygen species
- the survival of such cells depends upon addiction to repair pathways which can support viability of pre-malignant and/or cancer cells and thus may contribute to emergence of cell transformation in the involved risk state (Federico et al, 2007; Scott et al, 2014).
- the present invention now defines CHD4 as playing a central role in tying together all of the above events for DNA damage linking chromatin repression of transcription, and abnormal DNA methylation.
- CHD4 is critical in DNA damage-induced de novo DNA methylation and epigenetic gene silencing.
- the inventors have demonstrated an essential role of CHD4 in the recruitment of epigenetic modifier proteins to DNA damage sites within promoter CpG islands of multiple documented, and importantly candidate TSGs and these recruitment associate with appearance of de novo DNA methylation, repressive histone modifications and suppression of nascent gene transcription. This role appears operative for maintaining proliferation, invasion, and metastases of cultured human colorectal cancer (CRC) cells.
- CRC human colorectal cancer
- the present invention provides a method of screening an agent which inhibits mRNA expression of CHD4 in a cancer cell or population of cells, the method comprising: (a) contacting a first cell or population of cells expressing CHD4 with a test agent; (b) contacting a second cell or population of cells expressing CHD4 with a control agent; (c) detecting the level of CHD4 mRNA expression in the first cell or population of cells; (d) detecting the level of CHD4 mRNA expression in the second cell or population of cells; (e) comparing the levels of mRNA expression of CHD4 from (c) and (d); and (f) identifying the agent as an inhibitor of CHD4 when the mRNA expression in (c) is less than the mRNA expression in (d).
- the present invention provides a method of screening an agent which inhibits expression of CHD4 protein in a cancer cell or population of cells, the method comprising: a) contacting a first cell or population of cells expressing CHD4 with a test agent; (b) contacting a second cell or population of cells expressing CHD4 with a control agent; (c) detecting the level of CHD4 protein expression in the first cell or population of cells; (d) detecting the level of CHD4 protein expression in the second cell or population of cells; (e) comparing the levels of protein expression of CHD4 from (c) and (d); and (f) identifying the agent as an inhibitor of CHD4 when the protein expression in (c) is less than the protein expression in (d).
- the present invention provides a method for treating colorectal cancer in a subject comprising: (a) obtaining a biological sample from a tumor of the subject; (b) detecting the level of CHD4, CDH1, WIF1, TIMP2, TIMP3, MLH1, CDK 2A, SFRP4, and SFRP5 expression in the sample; (c) detecting the amount of 8-OHdG in the sample; (d) comparing the level of expression of CHD4, CDH1, WIF1, TIMP2, TIMP3, MLH1, CDK 2A, SFRP4, and SFRP5 and the amount of 8-OHdG in the subject to the level of expression in one or more control samples, (e) identifying the tumor of the subject as having a high probability of disease recurrence and decreased overall survival level when the level of expression of CHD4 is higher in the subject than the control levels, the amount of 8-OHdG in the subject sample is greater in the subject than the control amount, and the level of expression
- the present invention provides a method for treating colorectal cancer in a subject comprising: (a) obtaining a biological sample from a tumor of the subject; (b) detecting the level of CHD4 expression in the sample; (c) detecting the level of methylation of the promoter regions of one or more of the genes selected from the group consisting of CDH1, WIF1, TIMP2, TIMP3, MLH1, CDK 2A, SFRP4, and SFRP5; (d) detecting the amount of 8-OHdG in the sample; (e) comparing the level of expression of CHD4, the level of methylation of the promoter regions of one or more of the genes selected from the group consisting of CDH1, WIF1, TIMP2, TIMP3, MLH1, CDKN2A, SFRP4, and SFRP5, and the amount of 8-OHdG in the subject, to the level of expression CHD4, the amount of 8-OHdG, and the level of methylation of the promoter
- the present invention provides a method for treating a subject having colorectal cancer comprising administering to the subject a pharmaceutical composition comprising an effective amount of an agent which inhibits expression of CHD4 in a cell or population of cells and a pharmaceutically acceptable carrier.
- FIG. 1 A-1C The recruitment of DNMT1, DNMT3A, and DNMT3B to laser- induced DNA damage sites is dependent on CHD4.
- A, B The indicated cells were micro- irradiated with a 455 nm laser and fixed at the indicated time points.
- the indicated cells were micro-irradiated with a 455 nm laser and fixed at the indicated time points.
- the accumulation of endogenous 5mc at DNA damage sites and the co-localization with ⁇ 2 ⁇ was examined by immunofluorescence staining.
- the graph represents the percentages of cells with co- localization of ⁇ 2 ⁇ and accumulation of 5mc at micro-irradiation tracks. Data are represented as mean ⁇ SEM for triplicate experiments.
- the scale bar represents 10 ⁇ . *p value ⁇ 0.05.
- FIGS. 2A-2F The recruitment of EZH2 and G9a to DNA damage sites is dependent on CHD4.
- SW480 cells were not treated (Un) or treated with 2 mM H2O2 for 30 min. Immunoprecipitations and immunoblottings were performed using the indicated antibodies.
- B The indicated cells were not treated (Un) or treated with 2 mM H2O2 for 30 min. Whole cell extracts and the tight chromatin fractions were analyzed by immunoblotting.
- C-E The indicated cells were micro-irradiated with a 455 nm laser and fixed at the indicated time points.
- FIGS 3A-3B The ATPase activity of CHD4 is required for the recruitment of DNMTs and EZH2 and G9a to DNA damage sites.
- A Cells were infected with Lenti- shCHD4 and lentivirus expressing shRNA-resistant CHD4-WT or ATPase-dead CHD4 (CHD4-DN). After 96 hr, cells were micro-irradiated with a 455 nm laser and fixed at the indicated time points. The recruitment of endogenous proteins to DNA damage sites and their co-localization with ⁇ 2 ⁇ were examined by immunofluorescence staining.
- the graph represents the percentages of cells with co-localization of ⁇ 2 ⁇ with the indicated proteins at micro-irradiation tracks. Data are represented as mean ⁇ SEM for triplicate experiments. The scale bar represents 10 ⁇ . *p value ⁇ 0.05.
- FIGS 4A-4D Induction of DSBs at the promoter CpG islands of endogenous TSGs results in CHD4-dependent local epigenetic changes and gene silencing.
- the pCW-dCas9/FokI construct expresses a dCas9/FokI fusion protein containing the Fokl restriction endonuclease cleavage domain fused with a catalytically dead Cas9 (Top), a working model of the doxycycline-inducible DSB system at the promoter CpG islands of endogenous TSGs (Middle), and the time course for doxycycline treatment (Bottom).
- D Summary of the CHD4-mediated recruitment of epigenetic silencing proteins and epigenetic changes in the vicinity of DSB site at the endogenous promoters of eight representative TSGs.
- FIGS 5A-5J The recruitment of CHD4 to oxidative DNA damage sites depends on OGG1.
- A CoIPs of ly sates from SW480 cells untreated or treated with 2 mM H2O2 for 30 min were performed with the indicated antibodies.
- B Purified OGG1 and Flag-CHD4 were incubated with antibodies against Flag or OGG1 in IP buffer. The immunoprecipitated samples were detected by Western blot analyses using the antibodies indicated.
- C After SW480 OGG1 KO cells were transfected with pCMV-Taq or pCMV-OGGl for 48 hr, the cells were untreated or treated with 2 mM H2O2 for 30 min.
- Bound proteins were eluted and analyzed by immunoblotting with the indicated antibodies.
- G SW480 OGG1 KO cells were untreated or treated with 2 mM H2O2 for 30 min followed by ChIP for control IgG, 8-OHdG, and CHD4 at the promoter CpG islands of eight representative genes and analyzed by real-time RT-PCR. Data are represented as mean ⁇ SEM for triplicate experiments.
- H Cells were untreated or treated with 2 mM H2O2 for 30 min. Sequential ChIP analyses were performed to test the co-occupancy of CHD4 and 8- OHdG at the promoter CpG islands of eight TSGs. Data are represented as mean ⁇ SEM for triplicate experiments.
- FIGS 6A-6D 8-OHdG is positively correlated with the methylation but inversely correlated with the expression of TSGs in human CRC tissues (A-D)
- the top two rows show representative images of immunohistochemistry of 8-OHdG and E-cadherin (A), WIF1 (B), TIMP2 (C), or TIMP3 (D) in human CRC tissues. Scale bars represent 200 ⁇ (low magnification) and 50 ⁇ (high magnification).
- the middle row shows the association between 8-OHdG levels and the methylation or expression of the TSG in human CRC tissues.
- the lower two rows show Kaplan-Meier analyses of the correlation of the TSG expression, TSG methylation, 8-OHdG/TSG co-expression or 8-OHdG/TSG methylation status with recurrence and overall survival in patients with CRC.
- FIGS 7A-7D Over-expression of CHD4 is positively correlated with the methylation and inversely correlated with expression of eight TSGs in human CRC tissues.
- FIGS 8A-8M CHD4-mediated silencing of E-cadherin, WIF1, TIMP2, and TIMP3 promotes colon cancer metastases.
- A Transwell assay analyses of the migration and invasion abilities of the indicated CRC cells.
- B-G SW620 cells infected with the indicated shRNA lenti viruses for the indicated genes were injected into the tail vein of immune- incompetent mice, followed by noninvasive bioluminescence imaging for 9 weeks.
- bioluminescent imaging B
- bioluminescence signals C
- overall survival D
- incidence of lung colonization E
- the number of lung colonization foci F
- representative H&E staining of lung tissues G
- Scale bars represent 1 mm (low magnification) and 100 ⁇ (high magnification).
- H-M A mouse model of liver metastases was established by intrasplenic injection of the indicated colon cancer cells.
- Representative bioluminescent imaging 9 weeks after injection (H),
- nucleic acid includes “polynucleotide,” “oligonucleotide,” and “nucleic acid molecule,” and generally means a polymer of DNA or RNA, which can be single-stranded or double-stranded, synthesized or obtained (e.g., isolated and/or purified) from natural sources, which can contain natural, non-natural or altered nucleotides, and which can contain a natural, non-natural or altered internucleotide linkage, such as a phosphoroamidate linkage or a phosphorothioate linkage, instead of the phosphodiester found between the nucleotides of an unmodified oligonucleotide.
- the nucleic acid does not comprise any insertions, deletions, inversions, and/or substitutions. However, it may be suitable in some instances, as discussed herein, for the nucleic acid to comprise one or more insertions, deletions, inversions, and/or substitutions.
- the nucleic acids of the invention are recombinant.
- the term “recombinant” refers to (i) molecules that are constructed outside living cells by joining natural or synthetic nucleic acid segments to nucleic acid molecules that can replicate in a living cell, or (ii) molecules that result from the replication of those described in (i) above.
- the replication can be in vitro replication or in vivo replication.
- nucleic acids used as primers in embodiments of the present invention can be constructed based on chemical synthesis and/or enzymatic ligation reactions using procedures known in the art. See, for example, Sambrook et al. (eds.), Molecular Cloning, A Laboratory Manual, 3 rd Edition, Cold Spring Harbor Laboratory Press, New York (2001) and Ausubel et al, Current Protocols in Molecular Biology, Greene Publishing Associates and John Wiley & Sons, NY (1994).
- a nucleic acid can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed upon hybridization (e.g., phosphorothioate derivatives and acridine substituted nucleotides).
- modified nucleotides that can be used to generate the nucleic acids include, but are not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl) uracil, 5-carboxymethylaminomethyl- 2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N 6 -isopentenyladenine, 1 -methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2- methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N 6 -substituted adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannos
- the nucleotide sequences used herein are those which hybridize under stringent conditions preferably hybridizes under high stringency conditions.
- high stringency conditions is meant that the nucleotide sequence specifically hybridizes to a target sequence (the nucleotide sequence of any of the nucleic acids described herein) in an amount that is detectably stronger than non-specific hybridization.
- High stringency conditions include conditions which would distinguish a polynucleotide with an exact complementary sequence, or one containing only a few scattered mismatches from a random sequence that happened to have a few small regions (e.g., 3-10 bases) that matched the nucleotide sequence.
- Relatively high stringency conditions would include, for example, low salt and/or high temperature conditions, such as provided by about 0.02-0.1 M NaCl or the equivalent, at temperatures of about 50-70 °C.
- isolated and purified means a protein that is essentially free of association with other proteins or polypeptides, e.g., as a naturally occurring protein that has been separated from cellular and other contaminants by the use of antibodies or other methods or as a purification product of a recombinant host cell culture.
- biologically active means an enzyme or protein having structural, regulatory, or biochemical functions of a naturally occurring molecule.
- the term "subject” refers to any mammal, including, but not limited to, mammals of the order Rodentia, such as mice and hamsters, and mammals of the order Logomorpha, such as rabbits. It is preferred that the mammals are from the order Carnivora, including Felines (cats) and Canines (dogs). It is more preferred that the mammals are from the order Artiodactyla, including Bovines (cows) and Swines (pigs) or of the order Perssodactyla, including Equines (horses). It is most preferred that the mammals are of the order Primates, Ceboids, or Simoids (monkeys) or of the order Anthropoids (humans and apes). An especially preferred mammal is the human.
- mammals of the order Rodentia such as mice and hamsters
- mammals of the order Logomorpha such as rabbits. It is preferred that the mammals are from the order Carnivora, including Felines (cats) and Canines (dogs). It is
- cancer can be any cancer.
- cancer is meant any malignant growth or tumor caused by abnormal and uncontrolled cell division that may spread to other parts of the body through the lymphatic system or the blood stream.
- the cancer can be a metastatic cancer or a non-metastatic (e.g., localized) cancer.
- metastatic cancer refers to a cancer in which cells of the cancer have metastasized, e.g., the cancer is characterized by metastasis of a cancer cells.
- the metastasis can be regional metastasis or distant metastasis, as described herein.
- inventive methods can provide any amount of any level of diagnosis, staging, screening, or other patient management, including treatment or prevention of cancer in a mammal.
- treatment or prevention provided by the inventive method can include treatment or prevention of one or more conditions or symptoms of the disease, e.g., cancer, being treated or prevented.
- prevention can encompass delaying the onset of the disease, or a symptom or condition thereof.
- “Complement” or “complementary” as used herein to refer to a nucleic acid may mean Watson-Crick (e.g., A-T/U and C-G) or Hoogsteen base pairing between nucleotides or nucleotide analogs of nucleic acid molecules.
- differential expression may mean qualitative or quantitative differences in the temporal and/or cellular gene expression patterns within and among cells and tissue.
- a differentially expressed gene may qualitatively have its expression altered, including an activation or inactivation, in, e.g., normal versus disease tissue. Genes may be turned on or turned off in a particular state, relative to another state thus permitting comparison of two or more states.
- a qualitatively regulated gene may exhibit an expression pattem within a state or cell type which may be detectable by standard techniques. Some genes may be expressed in one state or cell type, but not in both.
- the difference in expression may be quantitative, e.g., in that expression is modulated, either up-regulated, resulting in an increased amount of transcript, or down-regulated, resulting in a decreased amount of transcript.
- the degree to which expression differs need only be large enough to quantify via standard characterization techniques such as expression arrays, quantitative reverse transcriptase PCR, northern analysis, and RNase protection.
- nucleic acids or polypeptide sequences may mean that the sequences have a specified percentage of residues that are the same over a specified region. The percentage may be calculated by optimally aligning the two sequences, comparing the two sequences over the specified region, determining the number of positions at which the identical residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the specified region, and multiplying the result by 100 to yield the percentage of sequence identity.
- the residues of single sequence are included in the denominator but not the numerator of the calculation.
- thymine (T) and uracil (U) may be considered equivalent.
- Identity may be performed manually or by using a computer sequence algorithm such as BLAST or BLAST 2.0.
- Probe as used herein may mean an oligonucleotide capable of binding to a target nucleic acid of complementary sequence through one or more types of chemical bonds, usually through complementary base pairing, usually through hydrogen bond formation. Probes may bind target sequences lacking complete complementarity with the probe sequence depending upon the stringency of the hybridization conditions. There may be any number of base pair mismatches which will interfere with hybridization between the target sequence and the single stranded nucleic acids described herein. However, if the number of mutations is so great that no hybridization can occur under even the least stringent of hybridization conditions, the sequence is not a complementary target sequence.
- a probe may be single stranded or partially single and partially double stranded. The strandedness of the probe is dictated by the structure, composition, and properties of the target sequence. Probes may be directly labeled or indirectly labeled such as with biotin to which a streptavidin complex may later bind.
- substantially complementary used herein may mean that a first sequence is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identical to the complement of a second sequence over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
- substantially identical used herein may mean that a first and second sequence are at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identical over a region of 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more nucleotides or amino acids, or with respect to nucleic acids, if the first sequence is substantially complementary to the complement of the second sequence.
- a probe is also provided comprising a nucleic acid described herein. Probes may be used for screening and diagnostic methods, as outlined below. The probes may be attached or immobilized to a solid substrate or apparatus, such as a biochip.
- Probe as used herein may mean an oligonucleotide capable of binding to a target nucleic acid of complementary sequence through one or more types of chemical bonds, usually through complementary base pairing, usually through hydrogen bond formation. Probes may bind target sequences lacking complete complementarity with the probe sequence depending upon the stringency of the hybridization conditions. There may be any number of base pair mismatches which will interfere with hybridization between the target sequence and the single stranded nucleic acids described herein. However, if the number of mutations is so great that no hybridization can occur under even the least stringent of hybridization conditions, the sequence is not a complementary target sequence.
- a probe may be single stranded or partially single and partially double stranded. The strandedness of the probe is dictated by the structure, composition, and properties of the target sequence. Probes may be directly labeled or indirectly labeled such as with biotin to which a streptavidin complex may later bind.
- the term "probe” also means an oligonucleotide which is capable of specifically binding to a CpG locus which can be methylated.
- the DNA gene target or probes of the present invention are used to determine the methylation status of at least one CpG dinucleotide sequence of at least one target gene as described herein.
- the probe may have a length of from 8 to 500, 10 to 100 or 20 to 60 nucleotides.
- the probe may also have a length of at least 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20,
- the probe may further comprise a linker sequence of from 10-60 nucleotides.
- a method of identifying the level of nucleic acid expression associated with a disease or a pathological condition comprises measuring a level of the nucleic acid in a sample that is different than the level of a control.
- the nucleic acid is a mRNA and the detection may be performed by contacting the sample with a probe or biochip described herein and detecting the amount of hybridization.
- PCR including RT-PCR, may be used to amplify nucleic acids in the sample, which may provide higher sensitivity.
- the level of the nucleic acid in the sample may also be compared to a control cell (e.g., a normal cell) to determine whether the nucleic acid is differentially expressed (e.g., overexpressed or underexpressed).
- a control cell e.g., a normal cell
- the ability to identify mRNAs that are differentially expressed in pathological cells compared to a control can provide high-resolution, high- sensitivity datasets which may be used in the areas of diagnostics, prognostics, therapeutics, drug development, pharmacogenetics, biosensor development, and other related areas.
- the expression level of a disease-associated nucleic acid or mRNA provides information in a number of ways. For example, a differential expression of a disease-associated nucleic acid compared to a control may be used as a diagnostic that a patient suffers from the disease. Expression levels of a disease-associated nucleic acid may also be used to monitor the treatment and disease state of a patient. Furthermore, expression levels of a disease- associated mRNA may allow the screening of drug candidates for altering a particular expression profile or suppressing an expression profile associated with disease.
- the detection of the target nucleic acid, or portions or fragments thereof can be through direct hybridization assays or can comprise sandwich assays, which include the use of multiple probes, as is generally known in the art.
- hybridization conditions may be used, including high, moderate and low stringency conditions as outlined above.
- the assays may be performed under stringency conditions which allow hybridization of the probe only to the target.
- Stringency can be controlled by altering a step parameter that is a thermodynamic variable, including, but not limited to, temperature, formamide concentration, salt concentration, chaotropic salt concentration pH, or organic solvent concentration.
- Hybridization reactions may be accomplished in a variety of ways. Components of the reaction may be added simultaneously, or sequentially, in different orders.
- the reaction may include a variety of other reagents. These include salts, buffers, neutral proteins, e.g., albumin, detergents, etc. which may be used to facilitate optimal hybridization and detection, and/or reduce non-specific or background interactions. Reagents that otherwise improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors and antimicrobial agents may also be used as appropriate, depending on the sample preparation methods and purity of the target.
- kits comprising an array of oligonucleotides as described herein, or portions or fragments thereof, as well as a biochip as described herein, along with any or all of the following: assay reagents, buffers, probes and/or primers, and sterile saline or another pharmaceutically acceptable emulsion and suspension base.
- the kits may include instructional materials containing directions (e.g., protocols) for the practice of the methods described herein.
- biological sample or “biological fluid” includes, but is not limited to, any quantity of a substance from a living or formerly living patient or mammal.
- substances include, but are not limited to, blood, serum, plasma, urine, cells, organs, tissues, bone, bone marrow, lymph, lymph nodes, synovial tissue, chondrocytes, synovial macrophages, endothelial cells, and skin.
- the sample is tissue or cells from a tumor of a subject.
- contacting means that the one or more agents which can inhibit CHD4 expression are introduced into a sample having at least one cancer cell expressing CHD4, and appropriate enzymes or reagents, in a test tube, flask, tissue culture, chip, array, plate, microplate, capillary, or the like, and incubated at a temperature and time sufficient to inhibit expression of CHD4 in the cancer cell.
- Methods for contacting the samples with the compounds, and other specific binding components are known to those skilled in the art, and may be selected depending on the type of assay protocol to be run. Incubation methods are also standard and are known to those skilled in the art.
- the term "contacting" means that the at least one identified CHD4 inhibiting agent using the methods of the present invention is introduced into a subject, preferably a subject receiving treatment for a CHD4 related disorder, such as colorectal cancer, and the at least one agent is allowed to come in contact with the cancer cells in vivo.
- a pharmaceutically acceptable carrier can be used, including those conventionally used, and is limited only by physico-chemical considerations, such as solubility and lack of reactivity with the active compound(s), and by the route of administration.
- the pharmaceutically acceptable carriers described herein for example, vehicles, adjuvants, excipients, and diluents, are well-known to those skilled in the art and are readily available to the public.
- the pharmaceutically acceptable carriers include soluble carriers such as known buffers which can be physiologically acceptable (e.g., phosphate buffer) as well as solid compositions such as solid-state carriers or latex beads. It is preferred that the soluble carriers such as known buffers which can be physiologically acceptable (e.g., phosphate buffer) as well as solid compositions such as solid-state carriers or latex beads. It is preferred that the
- pharmaceutically acceptable carrier be one which is chemically inert to the active agent(s), and one which has little or no detrimental side effects or toxicity under the conditions of use.
- the carriers or diluents used herein may be solid carriers or diluents for solid formulations, liquid carriers or diluents for liquid formulations, or mixtures thereof.
- Solid carriers or diluents include, but are not limited to, gums, starches (e.g., corn starch, pregelatinized starch), sugars (e.g., lactose, mannitol, sucrose, dextrose), cellulosic materials (e.g., microcrystalline cellulose), acrylates (e.g., polymethylacrylate), calcium carbonate, magnesium oxide, talc, or mixtures thereof.
- pharmaceutically acceptable carriers may be, for example, aqueous or non-aqueous solutions, suspensions, emulsions or oils.
- non-aqueous solvents are propylene glycol, polyethylene glycol, and injectable organic esters such as ethyl oleate.
- Aqueous carriers include, for example, water, alcoholic/aqueous solutions, cyclodextrins, emulsions or suspensions, including saline and buffered media.
- oils are those of petroleum, animal, vegetable, or synthetic origin, for example, peanut oil, soybean oil, mineral oil, olive oil, sunflower oil, fish-liver oil, sesame oil, cottonseed oil, corn oil, olive, petrolatum, and mineral.
- Suitable fatty acids for use in parenteral formulations include, for example, oleic acid, stearic acid, and isostearic acid. Ethyl oleate and isopropyl myristate are examples of suitable fatty acid esters.
- Parenteral vehicles for subcutaneous, intravenous, intraarterial, or intramuscular injection
- parenteral vehicles include, for example, sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's and fixed oils.
- Formulations suitable for parenteral administration include, for example, aqueous and non-aqueous, isotonic sterile injection solutions, which can contain anti-oxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives.
- Intravenous vehicles include, for example, fluid and nutrient replenishers, electrolyte replenishers such as those based on Ringer's dextrose, and the like.
- sterile liquids such as water and oils, with or without the addition of a surfactant and other pharmaceutically acceptable adjuvants.
- water, saline, aqueous dextrose and related sugar solutions, and glycols such as propylene glycols or polyethylene glycol are preferred liquid carriers, particularly for injectable solutions.
- any CHD4 inhibiting agents identified using the methods of the present invention may further comprise, for example, binders (e.g., acacia, cornstarch, gelatin, carbomer, ethyl cellulose, guar gum, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, povidone), disintegrating agents (e.g., cornstarch, potato starch, alginic acid, silicon dioxide, croscarmelose sodium, crospovidone, guar gum, sodium starch glycolate), buffers (e.g., Tris-HCl, acetate, phosphate) of various pH and ionic strength, additives such as albumin or gelatin to prevent absorption to surfaces, detergents (e.g., Tween 20, Tween 80, Pluronic F68, bile acid salts), protease inhibitors, surfactants (e.g.
- binders e.g., acacia, cornstarch, gelatin, carbomer, e
- sodium lauryl sulfate permeation enhancers
- solubilizing agents e.g., cremophor, glycerol, polyethylene glycerol, benzlkonium chloride, benzyl benzoate, cyclodextrins, sorbitan esters, stearic acids
- anti-oxidants e.g., ascorbic acid, sodium metabisulfite, butylated
- hydroxyanisole hydroxyanisole
- stabilizers e.g., hydroxypropyl cellulose, hyroxypropylmethyl cellulose
- viscosity increasing agents e.g., carbomer, colloidal silicon dioxide, ethyl cellulose, guar gum
- sweetners e.g., aspartame, citric acid
- preservatives e.g., thimerosal, benzyl alcohol, parabens
- lubricants e.g., stearic acid, magnesium stearate, polyethylene glycol, sodium lauryl sulfate
- flow-aids e.g., colloidal silicon dioxide
- plasticizers e.g., diethyl phthalate, tri ethyl citrate
- emulsifiers e.g., carbomer, hydroxypropyl cellulose, sodium lauryl sulfate
- polymer coatings e.g., poloxamers or po
- the choice of carrier will be determined, in part, by the particular compound, as well as by the particular method used to administer the compound. Accordingly, there are a variety of suitable formulations of the pharmaceutical composition of the invention.
- the following formulations for parenteral, subcutaneous, intravenous, intramuscular, intraarterial, intrathecal and interperitoneal administration are exemplary, and are in no way limiting. More than one route can be used to administer any identified compounds, and in certain instances, a particular route can provide a more immediate and more effective response than another route.
- Suitable soaps for use in parenteral formulations include, for example, fatty alkali metal, ammonium, and triethanolamine salts
- suitable detergents include, for example, (a) cationic detergents such as, for example, dimethyl dialkyl ammonium halides, and alkyl pyridinium halides, (b) anionic detergents such as, for example, alkyl, aryl, and olefin sulfonates, alkyl, olefin, ether, and monoglyceride sulfates, and sulfosuccinates, (c) nonionic detergents such as, for example, fatty amine oxides, fatty acid alkanolamides, and polyoxyethylenepolypropylene copolymers, (d) amphoteric detergents such as, for example, alkyl-P-aminopropionates, and 2-alkyl-imidazoline quaternary ammonium salts, and (e)
- the parenteral formulations will typically contain from about 0.5% to about 25% by weight of the compounds in solution. Preservatives and buffers may be used. In order to minimize or eliminate irritation at the site of injection, such compositions may contain one or more nonionic surfactants, for example, having a hydrophile-lipophile balance (HLB) of from about 12 to about 17. The quantity of surfactant in such formulations will typically range from about 5% to about 15% by weight. Suitable surfactants include, for example, polyethylene glycol sorbitan fatty acid esters, such as sorbitan monooleate and the high molecular weight adducts of ethylene oxide with a hydrophobic base, formed by the condensation of propylene oxide with propylene glycol.
- HLB hydrophile-lipophile balance
- parenteral formulations can be presented in unit-dose or multi-dose sealed containers, such as ampoules and vials, and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid excipient, for example, water, for injections, immediately prior to use.
- sterile liquid excipient for example, water
- Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules, and tablets.
- injectable formulations are in accordance with the invention.
- the requirements for effective pharmaceutical carriers for injectable compositions are well-known to those of ordinary skill in the art (see, e.g., Pharmaceutics and Pharmacy Practice, J.B. Lippincott Company, Philadelphia, PA, Banker and Chalmers, eds., pages 238-250 (1982), md ASHP Handbook on Injectable Drugs, Trissel, 15th ed., pages 622-630 (2009)).
- the amount or dose of the compounds, salts, solvates, or stereoisomers of any one the CHD4 inhibiting agents identified using the screening methods disclosed herein, administered should be sufficient to effect, e.g., a therapeutic or prophylactic response, in the subject over a reasonable time frame.
- the dose will be determined by the efficacy of the particular compound and the condition of a human, as well as the body weight of a human to be treated.
- Embodiments of the invention also include a process for preparing pharmaceutical products comprising the agents identified using the screening methods.
- pharmaceutical product means a composition suitable for pharmaceutical use
- composition as defined herein.
- Pharmaceutical compositions formulated for particular applications comprising the compounds of the present invention are also part of this invention, and are to be considered an embodiment thereof.
- the term “treat,” as well as words stemming therefrom, includes preventative as well as disorder remitative treatment.
- the terms “reduce,” “suppress,” “prevent,” and “inhibit,” as well as words stemming therefrom, have their commonly understood meaning of lessening or decreasing. These words do not necessarily imply 100% or complete treatment, reduction, suppression, or inhibition.
- administering means that the agents identified using the screening methods of the present invention are introduced into a subject, preferably a subject receiving treatment for a disease, and the compounds are allowed to come in contact with the one or more disease related cells or population of cells in vivo.
- the host cell or population of cells in the host can be any cell or population of cells that can be selectively bound by the antigens bound to the agents so identified.
- the host cells can be cancer cells.
- an active agent and a biologically active agent are used interchangeably herein to refer to a chemical or biological compound that induces a desired pharmacological and/or physiological effect, wherein the effect may be prophylactic or therapeutic.
- the terms also encompass pharmaceutically acceptable, pharmacologically active derivatives of those active agents specifically mentioned herein, including, but not limited to, salts, esters, amides, prodrugs, active metabolites, analogs and the like.
- pharmacologically active agent and "drug” are used, then, it is to be understood that the invention includes the active agent per se, as well as pharmaceutically acceptable, pharmacologically active salts, esters, amides, prodrugs, metabolites, analogs etc.
- the agents identified using the screening methods of the present invention can be used in combination with one or more additional therapeutically active agents which are known to be capable of treating conditions or diseases discussed above.
- the identified agents could be used in combination with one or more known therapeutically active agents, to treat a proliferative disease such as a tumor or cancer.
- therapeutically active agents that can be readily combined in a pharmaceutical composition with the compositions and methods of the present invention are enzymatic nucleic acid molecules, allosteric nucleic acid molecules, antisense, decoy, or aptamer nucleic acid molecules, antibodies such as monoclonal antibodies, small molecules, and other organic and/or inorganic compounds including metals, salts and ions.
- the dose of the identified agents of the present invention also will be determined by the existence, nature and extent of any adverse side effects that might accompany the administration of a particular composition. Typically, an attending physician will decide the dosage of the pharmaceutical composition with which to treat each individual subject, taking into consideration a variety of factors, such as age, body weight, general health, diet, sex, compound to be administered, route of administration, and the severity of the condition being treated.
- the methods of treatment disclosed herein are useful against many mammalian tumors, including, for example, colon cancer, as well as others such as breast cancer, prostate cancer, pancreatic cancer, hepatoma, glioblastoma, ovarian cancer, leukemia, Hodgkin's lymphoma and multiple myeloma.
- tumor means a neoplastic growth which may, or may not be malignant.
- compositions and methods provided herein are not only useful in the treatment of tumors, but in their micrometastses and their macrometastses.
- micrometastasis is a form of metastasis (the spread of a cancer from its original location to other sites in the body) in which the newly formed tumors are identified only by histologic examination;
- micrometastases are detectable by neither physical exam nor imaging techniques. In contrast, macrometastses are usually large secondary tumors.
- the present invention provides methods of screening agents which inhibit CHD4 and methods for the prevention and/or treatment of tumors, and their micrometastses and their macrometastses using said agents.
- target compound encompasses antibodies, antibody fragments, proteins, peptides, siRNAs, antagonists, agonists, compounds, or nucleotide constructs which modulate the expression of CHD4 in a cell or population of cells.
- the cells are mammalian cells.
- the cells are cancer cells, for example, colorectal cancer cells.
- the agents which modulate expression of CHD4 in a cell or population of cells are agents which downregulate or inhibit expression of CHD4 in the cell.
- the present invention provides a method of screening an agent which inhibits mRNA expression of CHD4 in a cancer cell or population of cells, the method comprising: (a) contacting a first cell or population of cells expressing CHD4 with a test agent; (b) contacting a second cell or population of cells expressing CHD4 with a control agent; (c) detecting the level of CHD4 mRNA expression in the first cell or population of cells; (d) detecting the level of CHD4 mRNA expression in the second cell or population of cells; (e) comparing the levels of mRNA expression of CHD4 from (c) and (d); and (f) identifying the agent as an inhibitor of CHD4 when the mRNA expression in (c) is less than the mRNA expression in (d).
- the method for detecting mRNA expression is RT-PCR using the following exemplary primers and probes: E-cadherin sense: 5'- GAACGCATTGCCACATAC-3' (SEQ ID NO: 1); E-cadherin antisense: 5'- ACCTTCCATGACAGACCC-3' (SEQ ID NO: 2); WIF1 sense: 5'- ATGCCAATGTCAAGAAGG-3' (SEQ ID NO: 3); WIF1 antisense: 5'- ATGTC GGAGTTC AC C AGA-3 ' (SEQ ID NO: 4); TIMP2 sense: 5'- GC AC C ACC C AGAAGAAGAG-3 ' (SEQ ID NO: 5); TIMP2 antisense: 5'- ACCCAGTCCATCCAGAGGC-3' (SEQ ID NO: 6); TIMP3 sense: 5'- GCTGACAGGTCGCGTCTA-3' (SEQ ID NO: 7); TIMP3 antisense: 5'- CACAA
- the cancer cells include, but are not limited to Adenomas such as: Tubular, Villous, Tubulovillous, and Serrated; Intraepithelial neoplasia (dysplasia); Carcinomas, including Adenocarcinoma, Mucinous adenocarcinoma, Signet-ring cell carcinoma, Small cell carcinoma, Squamous cell carcinoma, Adenosquamous carcinoma, Medullary carcinoma, and Undifferentiated carcinoma; Carcinoids (well differentiated endocrine neoplasm) including, EC-cell, serotonin-producing neoplasm, L-cell, glucagon-like peptide and PP/PYY producing tumors.
- Adenomas such as: Tubular, Villous, Tubulovillous, and Serrated
- Intraepithelial neoplasia displasia
- Carcinomas including Adenocarcinoma, Mucinous adenocarcinoma, Sign
- the cancer cells used in the context of the present invention also include cells from tumors of subjects, and cell lines, including, but not limited to RKO, RKO-AS45-1 ; SW1417; SW948; DLD-1; SW480; SW1116; LS174T; WIDr;
- the present invention provides a method of screening an agent which inhibits expression of CHD4 protein in a cancer cell or population of cells, the method comprising: a) contacting a first cell or population of cells expressing CHD4 with a test agent; (b) contacting a second cell or population of cells expressing CHD4 with a control agent; (c) detecting the level of CHD4 protein expression in the first cell or population of cells; (d) detecting the level of CHD4 protein expression in the second cell or population of cells; (e) comparing the levels of protein expression of CHD4 from (c) and (d); and (f) identifying the agent as an inhibitor of CHD4 when the protein expression in (c) is less than the protein expression in (d).
- the method for detecting CHD4 protein expression can be known immunological based assays, such as, but not limited to, ELISA, Western blots, immunoprecipitation, antibody coated beads with antibodies specific for an antigen of CHD4, proteomic screens, HPLC, mass spectrometry-based techniques, such as matrix-assisted laser desorption/ionization (MALDI) and electrospray ionization (ESI).
- immunological based assays such as, but not limited to, ELISA, Western blots, immunoprecipitation, antibody coated beads with antibodies specific for an antigen of CHD4, proteomic screens, HPLC, mass spectrometry-based techniques, such as matrix-assisted laser desorption/ionization (MALDI) and electrospray ionization (ESI).
- MALDI matrix-assisted laser desorption/ionization
- ESI electrospray ionization
- the present invention provides a method for treating colorectal cancer in a subject comprising: (a) obtaining a biological sample from a tumor of the subject; (b) detecting the level of CHD4 expression in the sample; (c) comparing the level of expression of CHD4 in one or more control samples; (d) identifying the tumor of the subject as having a high probability of disease recurrence and decreased overall survival level when the level of expression of CHD4 is higher in the subject sample compared to controls; and (e) providing the subject with an appropriate treatment regimen.
- the present invention provides a method for treating colorectal cancer in a subject comprising: (a) obtaining a biological sample from a tumor of the subject; (b) detecting the level of CHD4 expression in the sample; (c) detecting the amount of 8-OHdG in the sample; (c) comparing the level of expression of CHD4 and the amount of 8-OHdG in the subject sample to the level of expression of CHD4 and the amount of 8-OHdG in one or more control samples; (d) identifying the tumor of the subject as having a high probability of disease recurrence and decreased overall survival level when the level of expression of CHD4 is higher in the subject sample compared to controls and the amount of 8-OHdG in the subject sample is greater compared to controls; and (e) providing the subject with an appropriate treatment regimen.
- the present invention provides a method for treating colorectal cancer in a subject comprising: (a) obtaining a biological sample from a tumor of the subject; (b) detecting the level of CHD4, CDH1, WIF1, TIMP2, TIMP3, MLH1, CDK 2A, SFRP4, and SFRP5 expression in the sample; (c) comparing the level of expression of CHD4, CDHl, WIFl, TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, and SFRP5 in the subject sample to the level of expression in one or more control samples, (d) identifying the tumor of the subject as having a high probability of disease recurrence and decreased overall survival level when the level of expression of CHD4 is higher in the subject sample compared to controls, and the level of expression of one or more of the following genes CDHl, WIFl, TIMP2, TIMP3, MLHl, CDKN2A, SFRP4, and SFRP5 is lower in
- the present invention provides a method for treating colorectal cancer in a subject comprising: (a) obtaining a biological sample from a tumor of the subject; (b) detecting the level of CHD4, CDHl, WIFl, TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, and SFRP5 expression in the sample; (c) detecting the amount of 8-OHdG in the sample; (d) comparing the level of expression of CHD4, CDHl, WIFl, TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, and SFRP5 and the amount of 8-OHdG in the subject sample to the level of expression of CHD4, CDHl, WIFl, TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, and SFRP5 and the amount of 8-OHdG in one or more control samples, (e) identifying the tumor of the subject as having a high probability of disease recurrence
- the present invention provides a method for treating colorectal cancer in a subject comprising: (a) obtaining a biological sample from a tumor of the subject; (b) detecting the level of CHD4 expression in the subject sample; (c) detecting the level of methylation of the promoter regions of one or more of the genes selected from the group consisting of CDHl, WIFl, TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, and SFRP5; (d) comparing the level of expression of CHD4, and the level of methylation of the promoter regions of one or more of the genes selected from the group consisting of CDHl, WIFl, TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, and SFRP5, to the level of expression CHD4, and the level of methylation of the promoter regions of one or more of the genes selected from the group consisting of CDHl, WIFl, TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, and
- the present invention provides a method for treating colorectal cancer in a subject comprising: (a) obtaining a biological sample from a tumor of the subject; (b) detecting the level of CHD4 expression in the subject sample; (c) detecting the level of methylation of the promoter regions of one or more of the genes selected from the group consisting of CDHl, WIFl, TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, and SFRP5 in the subject sample; (d) detecting the amount of 8-OHdG in the subject sample; (e) comparing the level of expression of CHD4, the level of methylation of the promoter regions of one or more of the genes selected from the group consisting of CDHl, WIFl, TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, and SFRP5, and the amount of 8-OHdG in the subject sample, to the level of expression CHD4, the amount of 8-OHdG
- the present invention provides the use of chromodomain helicase DNA-binding protein 4 (CHD4) and 8-hydroxy-2' -deoxyguanosine (8-OHdG) as a marker for a tumor of colorectal origin of a subject as having a high probability of disease recurrence and decreased overall survival level, when the expression of the CHD4 marker and the amount of 8-OHdG in a sample from the tumor of the subject in a sample from the subject is increased compared to one or more control colorectal samples.
- CHD4 chromodomain helicase DNA-binding protein 4
- 8-OHdG 8-hydroxy-2' -deoxyguanosine
- the above use further comprises measuring the expression level of one or more of CDHl, WIFl, TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, and SFRP5 genes in the sample from the subject and comparing the levels to the levels of one or more of CDHl, WIFl, TIMP2, TIMP3, MLHl, CDKN2A, SFRP4, and SFRP5 genes in one or more control colorectal samples; and diagnosing, monitoring, or prognosing a tumor of colorectal origin of a subject as having a high probability of disease recurrence and decreased overall survival level, when the expression of the CHD4 marker and the amount of 8-OHdG in a sample from the tumor of the subject in a sample from the subject is increased compared to one or more control colorectal samples, and the expression levels of more of CDHl, WIFl, TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, and SFRP5
- the present invention provides the use of CHD4, 8-OHdG, and one or more of CDHl, WIFl, TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, and SFRP5 genes as a marker for a tumor of colorectal origin of a subject as having a high probability of disease recurrence and decreased overall survival level, when the expression of the CHD4 marker and the amount of 8-OHdG in a sample from the tumor of the subject in a sample from the subject is increased compared to one or more control colorectal samples, and the methylation levels of the promoters of more of CDHl, WIFl, TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, and SFRP5 genes in the sample from the subject are increased compared to the methylation levels of the promoters of those genes in one or more control colorectal samples.
- the present invention provides a composition for diagnosing, detecting, monitoring or prognosticating high probability of disease recurrence and decreased overall survival level of colorectal cancer or the progression towards disease recurrence and decreased overall survival level colorectal cancer, comprising a nucleic acid affinity ligand and/or a peptide affinity ligand for the CHD4 expression product or protein and a 8-OHdG peptide affinity ligand.
- the nucleic acid affinity ligand or peptide affinity ligand is modified to function as a contrast agent.
- the affinity ligand is a set of oligonucleotides specific for the CHD4 expression product, a probe specific for the CHD4 expression product, an aptamer specific for the CHD4 expression product or for the CHD4 protein, an antibody specific for the CHD4 protein and/or an antibody variant specific for the CHD4 protein.
- the 8-OHdG peptide affinity ligand is an antibody.
- the method for detecting mRNA expression is RT-PCR using the following primers and probes described above
- 8-OHdG is measured with immunohistochemical methods known in the art, such as ELISA.
- Other methods of detection include HPLC, MS and combinations thereof.
- methylation state means the detection of one or more methyl groups on a cytidine in a target site of the DNA in the sample.
- Quantitative Real-Time PCR is known in the art. Reactions are characterized by the point in time during cycling when amplification of a PCR product is first detected (over assay noise) rather than the amount of PCR product accumulated after a fixed number of cycles. The higher the starting copy number of the nucleic acid target, the sooner a significant increase in fluorescence is observed.
- the number of target gene copies can be extrapolated from a standard curve equation using the absolute quantitation method.
- cDNA from a positive control is first generated from RNA by the reverse transcription reaction. Using about 1 ⁇ of this cDNA, the gene under investigation is amplified using the primers by means of a standard PCR reaction.
- the amount of amplicon obtained is then quantified by spectrophotometry and the number of copies calculated on the basis of the molecular weight of each individual gene amplicon.
- Serial dilutions of this amplicon are tested with the Q-PCR assay to generate the gene specific standard curve.
- Optimal standard curves are based on PCR amplification efficiency from 90 to 100% (100% meaning that the amount of template is doubled after each cycle), as demonstrated by the slope of the standard curve equation. Linear regression analysis of all standard curves should show a high correlation (R 2 coefficients.98). Genomic DNA can be similarly quantified.
- Standard curves can also be generated by other means, for example, by using recombinant genes (which can be incorporated into plasmid vectors) or amplicons generated by pre-amplification PCR.
- control sample or "reference sample” means a sample from a subject known not to have a colorectal disease or cancer.
- comparing encompasses comparing the level of the peptide or polypeptide, or mRNA or methylation level of a promoter of a gene of interest, comprised by the sample to be analyzed with a level of a suitable reference level specified elsewhere in this description. It is to be understood that comparing as used herein refers to a comparison of corresponding parameters or values, e.g., an absolute amount is compared to an absolute reference amount while a concentration is compared to a reference concentration or an intensity signal obtained from a test sample is compared to the same type of intensity signal of a reference sample or a ratio of amounts is compared to a reference ratio of amounts.
- the comparison referred to in the methods of the present invention may be carried out manually or computer assisted.
- the value of the determined amount may be compared to values corresponding to suitable references which are stored in a database by a computer program.
- the computer program may further evaluate the result of the comparison, i.e. automatically provide the desired assessment in a suitable output format.
- CHD4 and 8-OHdG are elevated and one or more of the following gene promoters: CDH1, WIFl , TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, SFRP5 are methylated.
- adjuvant therapy such as chemotherapy, radiation therapy, and targeted therapy.
- Chemotherapeutic agents to be administered include, but are not limited to, irinotecan, cisplatin and 5-fluorouracil.
- patients considered as having a high probability of disease recurrence and decreased overall survival level can be treated with chemotherapy including, for example, either the FOLFOX (5-FU, leucovorin, and oxaliplatin) or CapeOx
- chemotherapy including, for example, either the FOLFOX (5-FU, leucovorin, and oxaliplatin) or CapeOx
- capecitabine and oxaliplatin regimens, but some patients may get 5-FU with leucovorin or capecitabine alone based on their age and health needs.
- patients considered as having a high probability of disease recurrence and decreased overall survival level can be treated with targeted therapies, including, for example, drugs which block vascular endothelial growth factor (VEGF) is a protein that helps tumors form new blood vessels (a process known as angiogenesis) to get nutrients they need to grow.
- VEGF vascular endothelial growth factor
- Drugs that stop VEGF from working can be used to treat colon or rectal cancers, including Bevacizumab (Avastin), Ramucirumab (Cyramza), Ziv- aflibercept (Zaltrap). These drugs are given as (IV) infusions every 2 or 3 weeks, in most cases along with chemotherapy.
- Other targeted therapy includes drugs that target EGFR for treating high risk colon or rectal cancers. These include: Cetuximab (Erbitux), and Panitumumab (Vectibix). Both of these drugs are given by IV infusion, either once a week or every other week, however these therapies are not indicated in colorectal cancers that have mutations (defects) in the KRAS, NRAS or BRAF gene.
- Immunotherapies that can be indicated in patients considered as having a high probability of disease recurrence and decreased overall survival level include Pembrolizumab (Keytruda) and Nivolumab (Opdivo) are drugs that target PD-1. These treatments can be used for subjects whose colorectal cancer cells have tested positive for specific gene changes, such as a high level of microsatellite instability (MSI-H), or changes in one of the mismatch repair (MMR) genes. The treatments can also be used for subjects whose cancer is still growing after treatment with the above adjuvant chemotherapy. They can also be used to treat subjects whose cancer can't be removed with surgery, has come back (recurred) after treatment, or has spread to other parts of the body (metastasized).
- MSI-H microsatellite instability
- MMR mismatch repair
- Pembrolizumab (Keytruda) is administered to the subject as an IV infusion.
- Nivolumab (Opdivo) is given as an IV infusion that takes 1 hour. Typically administered to the subject every 2 weeks.
- the present invention provides a method for treating a subject having colorectal cancer comprising administering to the subject a pharmaceutical composition comprising an effective amount of an agent which inhibits expression of CHD4 in a cell or population of cells and a pharmaceutically acceptable carrier.
- a kit is also provided comprising an array of oligonucleotides as described herein, or portions or fragments thereof, as well as a biochip as described herein, along with any or all of the following: assay reagents, buffers, probes and/or primers, and sterile saline or another pharmaceutically acceptable emulsion and suspension base.
- the kits may include instructional materials containing directions (e.g., protocols) for the practice of the methods described herein.
- SW480, HCT116, NCCIT, SW620, LoVo cells were obtained from American Tissue Type Culture Collection and maintained at 37 °C and 5% CC in McCoy's5A, McCoy's5A, RPMI-1640, McCoy's5A, and DMEM (Dulbecco's Modified Eagle Medium), respectively.
- 30% H2O2 (Sigma) was diluted in PBS immediately before adding it to the media and cells were collected 30 min later.
- DR-GFP U20S cells with one copy of the DR-GFP gene stably integrated into its genome were gifts from Dr. Maria Jasin (Memorial Sloan Kettering Cancer Center).
- mice were housed under standard conditions and cared for according to the institutional guidelines for animal care. All animal experiments were approved by the Committee on the Use of Live Animals in Teaching and Research (CULATR), Fourth Military Medical University.
- CULATR Committee on the Use of Live Animals in Teaching and Research
- Xenogen phosphate-buffered saline
- mice were sacrificed and examined for lung metastases using standard histological examination.
- a mouse model of liver metastases was established by intrasplenic injection of luciferase tagged SW620 and LoVo cells. Briefly, the spleens were exposed by an incision on the left upper abdomen of mice. For each mouse, 1 x l O 6 cells in 100 ⁇ of PBS were injected into the spleen, by which the injected cells were delivered to the liver through the portal circulation. Ten minutes after injection, the spleen was removed and the abdominal cavity was closed. Metastases were monitored by weekly noninvasive IVIS imaging of luciferase activity. The survival of the mice was recorded daily. After 9 weeks post implantation, all mice were sacrificed, and the number of tumor foci on liver surface was calculated. Liver tissues were fixed and stained with H&E to detect the liver metastases.
- xenograft tumor growth assay 5 * 10 4 cells were injected subcutaneously into the right flank of 5-week-old male BALB/C nude mice. Each group consisted of 10 mice. Tumor formation in nude mice was monitored over a 30-day period, and the tumor volume was measured every 5 days and calculated as: 1/2 (largest diameter) ⁇ (smallest diameter) 2 .
- Wild-type and ATP-domain mutant CHD4 were kindly provided by Wenbing Xie (Xie et al, 2012) and subcloned into pLenti-Flag.
- shRNA-resistant form of CHD4 was generated using Q5® Site-Directed Mutagenesis Kit (NEB) with the oligonucleotides (forward) 5'-AATGGCGTGAATTTAGTACCAATAACCCCTTC-3' (SEQ ID NO: 35) and (reverse) 5'- TTGCACCCAAAACCATCATCATCTTGGAG-3' (SEQ ID NO: 36). The construct was confirmed by DNA sequencing.
- DNMT3A CCGGCCACCAGAAGAAGAGAAGAATCTCGAGATTCTTCTCTTCTTCTGGTGGT
- DNMT3B CCGGGACGATGGCTATCAGTCTTACCTCGAGGTAAGACTGATAGCCATCGTCT
- TIMP2 CCGGCAAGTTCTTCGCCTGCATCAACTCGAGTTGATGCAGGCGAAGAACTTGT
- TIMP3 CCGGCGAGAGTCTCTGTGGCCTTAACTCGAGTTAAGGCCACAGAGACTCTCGT
- pl6 CCGGGCTCTGAGAAACCTCGGGAAACTCGAGTTTCCCGAGGTTTCTCAGAGCT
- DNMT3A sense 5'-caccgCGATGACGAGCCAGAGTACG-3' (SEQ ID NO: 53)
- DNMT3B sense 5'-caccgATCCGCACCCCGGAGATCAG-3' (SEQ ID NO: 55)
- antisense 5'-aaacCTGATCTCCGGGGTGCGGATc-3' (SEQ ID NO: 56)
- lentivirus and cell infection were performed according to the pLKO.1 lentiviral vector protocol recommended by Addgene. Briefly, the lentiviral plasmid and packaging plasmids pMD2.G and psPAX2 (Addgene plasmid #12259 and #12260) were transfected into HEK-293T cells with transfection reagent (Lipofectamine®3000, Thermo Fisher Scientific) and OPTI-MEM media (Invitrogen, Waltham, MA, USA). The lentiviruses were harvested twice at day 4 and day 5. Virus were filtered with 0.45 ⁇ filter and stored at -80 °C.
- the lentiviral infection of target cells was performed in cell culture media with 8 ⁇ g/ml polybrene (Sigma H9268). Sevent -two hours after infection, cells were selected for 2 weeks using 2.5 ⁇ g/ml puromycin (OriGene). Selected pools of shRNA knockdown cells were used for the following experiments. For CRISPR knockout, subsequently single clones were selected through serial dilution. Clones were verified by western blot and sequencing.
- CEBN buffer 10 mM HEPES pH 7.8, 10 mM KC1, 1.5 mM MgCh, 0.34 M sucrose, 10% glycerol, 0.2% NP-40, l protease inhibitor cocktail (Thermo Scientific), l x phosphatase Inhibitor cocktail (Sigma), N- ethylmaleimide (Sigma)], CEB buffer (CEBN buffer without NP-40), soluble nuclear buffer (3 mM EDTA, 0.2 mM EGTA, inhibitors), and 0.45 M NaCl buffer (50 mM Tris pH 8.0, 0.05% NP40, 0.45 M NaCl, inhibitors).
- CEBN buffer 10 mM HEPES pH 7.8, 10 mM KC1, 1.5 mM MgCh, 0.34 M sucrose, 10% glycerol, 0.2% NP-40, l protease inhibitor cocktail (Thermo Scientific), l x phosphatase Inhibitor cocktail (Sigma), N- eth
- the remaining pellet was lysed in 4% SDS buffer using a Qiashredder (Qiagen) and referred to as tight chromatin.
- Band densitometry data for western blots were collected using ImageJ software.
- Whole cell extracts were prepared from 1/10 of the pellet collected after treatment before beginning the tight chromatin isolation.
- GAPDH and LaminB immunoblotting serve as cytoplasmic and nuclear controls, respectively, for the designated extractions.
- the total nuclear pellet was resuspended in modified RIPA buffer (50 mM Tris PH 7.5, 100 mM NaCl, 3 mM EDTA, 0.5% NP-40, 50 mM NaF), sonicated for three cycles of 30 s using a BioruptorPicosonicator (Diagenode), rotated at 4 °C for 1 hr with 60 mM spermine and 20 mM spermidine to release chromatin bound proteins, sonicated for two cycles of 30 s, and cleared by high-speed centrifugation. Lysates were rotated with antibody for 4 hr at 4 °C.
- anti-CHD4 Sigma, WH0001108M1
- anti-DNMTl Sigma, D4692
- anti-DNMT3A Novusbio, NB120-13888
- anti-DNMT3B A rabbit polyclonal antibody (QCB/BioSource International) was raised against a fusion protein containing residues 376-390 (ENKTRRRTADDSATS) (SEQ ID NO: 59)), anti-EZH2 (Active Motif, 39875), and anti-G9a (Perseus Proteomics Inc, PP-A8620A-00).
- Protein A/G- magnetic beads Pierce
- the beads were washed six times with TNE buffer for 10 min at 4 °C. Complexes were eluted off the beads in loading buffer at 65 °C for 15 min.
- hCHD4 human CHD4
- IP buffer 50 mM Tris-HCl pH 8.0, 100 mM NaCl, 5 mM MgCh, 1% NP-40
- 8-OHdG oligonucleotides double strand
- the beads were washed five times using an IP buffer and the immunoprecipitated proteins were analysed by Western blotting. Normal rabbit IgG (sc-2027, Santa Cruz) or normal mouse IgG (sc-2025, Santa Cruz) was used as a negative control. Antibodies were used in the amount of 3 ⁇ g per IP.
- Oligonucleotides for the co-immunoprecipitation are listed in Table 2.
- Proteins from lysed cells were fractionated by SDS-PAGE and transferred to nitrocellulose membranes. Nonspecific binding sites were blocked with 5% milk in TBST (120 mM Tris-HCl (pH 7.4), 150 mM NaCl, and 0.05% Tween 20) for 1 hr at room temperature. Blots were incubated with a specific antibody overnight at 4 °C. Western blotting of ⁇ -actin on the same membrane was used as a loading control.
- the membranes were incubated with primary antibodies anti-CHD4 (Sigma, WH0001108M1), anti-DNMTl (Sigma, D4692), anti-DNMT3A (Novusbio, NB120-13888), anti-DNMT3B (A rabbit polyclonal antibody (QCB/BioSource International) was raised against a fusion protein containing residues 376-390 (ENKTRRRTADDSATS) (SEQ ID NO: 59)), anti-EZH2 (Cell Signaling, #3147), anti-G9a (Perseus Proteomics Inc, PP-A8620A-00), anti-E-cadherin (Cell Signaling, #3195), anti-WIFl (Abeam, abl55101), anti-TIMP2 (Abeam, abl828), anti- TIMP3 (Abeam, ab39184), anti-MLHl (Abeam, ab92312), anti-pl6 (Abeam, ab51243), anti- SFRP4 (Abeam
- QIAGEN Advantage RT-for-PCR Kit
- aliquots of double-stranded cDNA were amplified using a SYBR Green PCR Kit (QIAGEN).
- the cycling parameters were as follows: 95 °C for 15 s, 55-60 °C for 15 s, and 72 °C for 15 s for 45 cycles.
- a melting curve analyses was then performed. The Ct was measured during the exponential amplification phase, and the amplification plots were analyzed using SDS 1.9.1 software (Applied Biosystems).
- the primer sequences are SEQ ID NOS: 1-34 and described above.
- Nascent transcription assays were performed using the Click-iT Nascent RNA Capture Kit (Thermo Fisher). Cells were labeled with ethynyluridine for 30 min concurrently with the 2 mM H2O2 treatment or Dox treatment if indicated. cDNA was analyzed by qPCR using primers indicated herein.
- Chromatin immunoprecipitation Assay (ChIP).
- anti-80HdG (Millipore, MAB3560), anti-yH2AX (Millipore, 05-636) anti-CHD4 (Sigma, WH0001108M1), anti-DNMTl (Sigma, D4692), anti-DNMT3A (Novusbio, NB120-13888), anti-DNMT3B (A rabbit polyclonal antibody was raised against a fusion protein containing residues 376-390 (ENKTRRRTADDSATS) (SEQ ID NO: 59)), anti-EZH2 (Active Motif, 39875), anti-G9a (Perseus Proteomics Inc, PP-A8620A-00), anti-5mc (Diagenode,
- CDH1 Fl GCAACTCCAGGCTAGAGG (SEQ ID NO: 1
- SFRP5 R5 CCTCTCCAGGTGCGCGCC (SEQ ID NO: 1
- the first immunoprecipitation was performed as described above except for the elution step, which was performed with SDS lysis buffer (1% SDS, 10 mmol/L EDTA, 50 mmol/L Tris-HCl, pH 8.1, 1 xcOmplete Protease Inhibitor Cocktail;
- Beads were washed once with low-salt immune complex wash buffer (0.1% SDS, 1% Triton X-100, 2 mmol/L EDTA, 20 mmol/L Tris-HCl, pH 8.1, 150 mmol/L NaCl,
- a Nikon Eclipse 2000E spinning-disk confocal microscope with five laser imaging modules and a charge-coupled device (CCD) camera (Hamamatsu) was employed.
- the setup integrated a Stanford Research Systems (SRS) NL100 nitrogen laser with a Micropoint ablation system (Photonics Instruments). Site-specific DNA damage was induced using the SRS NL100 nitrogen laser adjusted to emit at 455 nm. Positions internal to the nuclei of the indicated cells were targeted using a 60 ⁇ oil objective lens. Cells were targeted at 5.5% laser intensity to induce DSBs, and images were captured at various time points and analyzed using Volocity, version 5.0, build 6 (Improvision).
- the forward and reverse primers are: 5'-
- a doxycycline-inducible DSB system at the promoter CpG islands of endogenous TSGs was constructed.
- the Fokl restriction endonuclease cleavage domain was fused to a catalytically dead Cas9, which was cloned into a pCW-Cas9 plasmid ( Figure 4A).
- SW480 cells were transfected with the plasmid, and a single clone was selected that had a high level of doxycycline-induced dead Cas9/FokI fusion protein expression.
- these cells were infected with lentivirus expressing gRNAs.
- this system was used to produce DSB at the promoter CpG islands of eight representative tumor suppressor genes.
- Four pairs of primers were designed to detect the local epigenetic changes near the DSB sites, including DSB sites upstream 0.2 kb, 0.4 kb, and 0.6 kb, and DSB sites downstream 0.2 kb ( Figure 4B, C).
- the dead Cas9/FokI induced cutting was monitored by real-time PCR using a primer pair (Fl, Rl) flanking the cutting site ( Figure 4B, C). Using this PCR, only uncut or repaired DNA will result in a PCR product.
- the PCR product was slightly decreased at the 8 hr time point, followed by a dramatic decrease at the 8+8 hr time point.
- the PCR product level increased at the 8+24 hr time point suggesting that a significant portion of the cells repair the DSB during this time frame (data not shown).
- tissue microarrays and immunohistochemistry were used to construct a tissue microarray (Shanghai Biochip Co., Ltd. Shanghai, China).
- the tissue microarray was stained for 8-OHdG (Abeam, abl0802), CHD4 (Abeam, ab72418), E-cadherin (Cell signaling, #3195), WIF1 (Abeam, ab33281), TIMP2 (Thermo Fisher, MA1-774), TIMP3 (Thermo Fisher, PA1-21146), MLH1 (Abeam, ab92312), pl6 (Thermo Fisher, MA5-17093), SFRP4 (Abeam, abl54167), and SFRP5 (Novus Biologicals, NBP2-20331) expression.
- the array was scored independently by two pathologists for both the staining intensity and the extent of the protein expression across the section.
- the sections were incubated in a moist chamber at 4 °C overnight with the primary antibody diluted in PBS containing 1% (wt/vol) bovine serum albumin. Negative controls were performed by replacing the primary antibody with preimmune mouse serum. After three 5 min washes with PBS, the sections were treated with a peroxidase-conjugated second antibody (Santa Cruz) for 30 min at room temperature, followed by additional three 5 min washes with PBS.
- PBS pH 7.4, 0.01 mol/L
- Reaction product was visualized with diaminobenzidine for 2 min. Images were obtained under a light microscope (Olympus, Japan) equipped with a DP70 digital camera.
- Genomic DNA was isolated from cells using Genomic DNA Purification kit following the manufacturer's instructions (Promega). Bisulfite modification of genomic DNA was carried out using the EZDNA methylation Kit (Zymo Research). Briefly, 1 ⁇ g of genomic DNA was denatured by NaOH (final concentration, 0.2 mol/L) for 10 min at 37 °C. Hydroquinone (10 mmol/L, 30 ⁇ ) and 520 ⁇ of 3 mol/L sodium hydroxide (pH 5) were added, and samples were incubated at 50 °C for 16 hr. Modified DNA was purified using Wizard DNA Clean-Up System following the manufacturer's instructions (Promega) and eluted into 50 ⁇ water.
- DNA was treated with NaOH (final concentration, 0.3 mol/L) for 5 min at room temperature, ethanol precipitated, and resuspended in 20 ⁇ water. Modified DNA was used immediately or stored at -20 °C. Primer sequences specific to unmethylated and methylated promoter sequences are listed in Table 5.
- E-cadherin M-R CGAATACGATCGAATCGAACCG (SEQ ID NO:
- E-cadherin U-R ACACCAAATACAATCAAATCAAACCAAA (SEQ ID NO:
- WIF1 M-F ATTTAGGTCGGGAGGCGACGC (SEQ ID NO: 65 C
- WIF1 U-F TGGTATTTAGGTTGGGAGGTGATGT (SEQ ID 56 C
- WIF1 U-R AACCTCCACCCACAATACCAA (SEQ ID NO: 171)
- TIMP2 M-F TTTGGTGTTTTGGAAGAACGGGCG (SEQ ID NO: 60 C
- TIMP2 U-F TTTGGTGTTTTGGAAGAATGGGTG (SEQ ID NO: 60 C
- TIMP2 U-R CCAACCCCAATCCCCACTACA (SEQ ID NO: 175)
- TIMP3 M-R CCGAAAACCCCGCCTCG (SEQ ID NO: 177)
- TIMP3 U-F TTTTGTTTTGTT ATTTTTTGTTTTTGGTTTT ( SEQ 59 C
- TIMP3 U-R CCCCCAAAAACCCCACCTCA (SEQ ID NO: 179)
- MLH1 M-F ACGTAGACGTTTTATTAGGGTCGC (SEQ ID NO: 60 C
- MLH1 M-R CCTCATCGTAACTACCCGCG (SEQ ID NO: 181)
- MLH1 U-F TTTTGATGTAGATGTTTTATTAGGGTTGT (SEQ 60 C
- MLH1 U-R ACCACCTCATCATAACTACCCACA (SEQ ID NO:
- pl6 M-F TTATTAGAGGGTGGGGCGGATCGC (SEQ ID NO: 65 C
- pl6 M-R GACCCCGAACCGCGACCGTAA (SEQ ID NO:
- pl6 U-F TTATTAGAGGGTGGGGTGGATTGT (SEQ ID NO: 60 C
- pl6 U-R CAACCCCAAACCACAACCATAA (SEQ ID NO:
- SFRP4 M-F GGGTGATGTTATCGTTTTTGTATCGAC (SEQ ID 60 C
- SFRP5 M-F AAGATTTGGCGTTGGGCGGGACGTTC (SEQ ID 60 C
- SFRP5 U-F GTAAGATTTGGTGTTGGGTGGGATGTTT (SEQ 60 C
- Each methylation-specific PCR reaction incorporated 100 ng of bisulfite-treated DNA as template, 10 pmol/L of each primer, 100 pmol/L deoxynucleoside triphosphate, 10 PCR buffer, and 1 unit of JumpStart Red Taq Polymerase (Sigma-Aldrich, St. Louis, MO) in a final reaction volume of 25 ⁇ . Cycle conditions were as follows: 95 °C 5 min; 35 cycles (95 °C 30 s, 60 °C 30 s, and 72 °C 30 s); and 72 °C 5 min. Methylation-specific PCR products were analyzed with nondenaturing 6% polyacrylamide gel electrophoresis and stained with ethidium bromide.
- a 24-well transwell plate (8- ⁇ pore size, Corning, USA) was used to measure the migratory and invasion capacity of each tested cell line.
- transwell migration assays 5x 10 4 cells were plated in the top chamber lined with a non-coated membrane.
- invasion assays chamber inserts were coated with 200 mg/ml of Matrigel and dried overnight under sterile conditions. Then, 1 ⁇ 10 5 cells were plated in the top chamber. The mean of triplicate assays for each experimental condition was used. The average number of cells in five fields per membrane was counted in triplicate inserts. The relative invasion/migration was expressed as the number of treated cells to control cells.
- the proliferation of colon cancer cells in vitro was measured using the MTT assay. 5000 stably infected cells were seeded into each well of 96 well plates. Six wells of each group were detected every day. 100 ⁇ fresh medium containing MTT 0.5 mg/ml was put into each cell and incubated at 37 °C for 4 hr, then the medium was replaced by 100 ⁇ of DMSO and shaken at room temperature for 10 min. The absorbance was measured at 490 nm.
- CHD4 is essential for the recruitment of DNMT1 , DNMT3A, and DNMT3B to DNA damage sites.
- CHD4 interacts with DNMT1 and DNMT3B in human CRC cell line HCTl 16 (Cai et al, 2014).
- the inventors have also tied recruitment of these DNMT's to chromatin and sites of ROS induced DNA damage (O'Hagan et al, 2011) and to DSBs (O'Hagan et al, 2008).
- the inventors now identify an upstream role for CHD4 in guiding these latter interactions.
- CHD4 interacts with DNMT1, DNMT3A, and DNMT3B.
- a key consequence of the above recruitment to DNA damage sites can be imposition of DNA methylation at the involved lesions.
- the inventors saw this begin within a 30 min period at the promoters of vulnerable genes (O'Hagan et al, 2011).
- clones of cells with an induced DSB in an exogenous, CpG island containing construct accumulated DNA methylation, mediated by DNMT3B at the damage site (O'Hagan et al, 2008).
- the inventors now find a key role for CHD4 in guiding this process.
- CHD4 is critical for the recruitment of EZH2 and G9a to DNA damage sites.
- H3K27me3 and H3K9me2 enrichment mediated by EZH2 and G9a near DSBs depends on CHD4.
- a DSB is induced in a stably introduced DNA recognition site for the endonuclease I-Scel.
- the enzyme activity is introduced via infection with Lentivirus Lenti-I-Scel (Pierce et al, 1999) (data not shown). Twenty-four hours after I-Scel infection, there is enrichment of CHD4, DNMT1, DNMT3A, DNMT3B, EZH2, and G9a near the DSB site correlating with ⁇ 2 ⁇ enrichment (data not shown).
- the ATPase activity of CHD4 is required for the recruitment of DNMTs and EZH2 and G9a to DNA damage sites.
- CHD4 mediates gene silencing associated with DNA damage.
- CDH1, WIF1, TIMP2, TIMP3, MLH1, CDK 2A, SFRP4, and SFRP5 were constructed in SW480 CRC cells, a Dox-inducible DSB system driving a Fokl restriction endonuclease coupled to catalytically dead Cas9 (Figure 5A-C). ChIP assays were used to detect chromatin events around the DSB sites ( Figure 5D, H). A significant portion of the cells appear to repair the DSB over 24 hours (data not shown).
- CHD4 also has an upstream role for those investigated in this section ( Figure 5L).
- CHD4 knockdown decreases DSB-induced recruitment of epigenetic silencing proteins (DNMT1, DNMT3A, DNMT3B, EZH2 and G9a), reduces accumulation of 5mc and the repressive marks H3K27me3 and H3K9me2 ( Figures 5G, K), and negates the DSB-induced reduction in nascent RNA transcription of the eight examined TSGs ( Figure 5M).
- CHD4 is involved upstream in the recruitment of epigenetic silencing proteins to promoter CpG islands following oxidative DNA damage.
- H3K27me3 and H3K9me2 are also differentially increased, whereas the active marks H3K4me3 and H4K16ac are decreased in these same regions.
- knockdown of CHD4 reduces the H202-induced enrichment of the epigenetic silencing proteins as well as blunting enrichment of 5mc and the repressive marks, H3K27me3 and H3K9me2 (data not shown). This knockdown also relieves the H202-induced reduction in nascent RNA transcription of the eight TSGs (data not shown).
- H2O2 treatment significantly decreased the nascent RNA transcription of promoter CpG island-containing genes with high expression (MYC, ACTB, RPL13, and RPL10A), and knockdown of CHD4 also relieve the H202-induced reduction in nascent RNA transcription of these genes.
- H2O2 treatment did not affect the nascent RNA transcription of non-CpG island- containing genes (IL-8, HBD, MYH1, and LAMB4) (data not shown).
- 8-OHdG was added to the pull down assay buffer and did not affect the OGGl and CHD4 interaction, suggesting that this interaction is not DNA-dependent (data not shown).
- the 8-OHdG oligonucleotide could pull down CHD4 protein in the presence of OGGl, whereas the 8-OHdG
- ChIP assays showed that knockout of OGGl reduced the H202-induced enrichment of CHD4 at the promoter CpG islands of eight TSGs, indicating that OGGl is important for CHD4 recruitment (data not shown).
- Sequential ChIP assays using antibody against CHD4 in the first immunoprecipitation followed by another pulldown with the antibody against 8-OHdG, demonstrated the co-occupancy of CHD4 and 8-OHdG at the promoter CpG islands of eight TSGs after H202-induced oxidative damage (data not shown).
- knockout of OGGl also relieves the H202-induced reduction in nascent RNA transcription of the eight TSGs (data not shown).
- CDHl sense GTCTATGCGAGGCCGGGT (SEQ ID NO: 196)
- CDH1 antisense AGTTCCGACGCCACTGAG (SEQ ID NO: 197)
- WIF1 sense CTGCCATCGGCACCATCG (SEQ ID NO: 198)
- WIF1 antisense GATGATGATGATGAGGTG (SEQ ID NO: 199)
- TIMP2 sense TCGCCTGGTGTCCTGGAA (SEQ ID NO: 200)
- TIMP2 antisense TTGTGCCCGGCCTGGCAC (SEQ ID NO: 201)
- TIMP3 sense GAGCTCTGTCAGCCATGG (SEQ ID NO: 202)
- TIMP3 antisense ATCCTCGCTGAGAAGTGG (SEQ ID NO: 203)
- MLH1 sense CTCGTCGACTTCCATCTT (SEQ ID NO: 204)
- CDKN2A sense AGGACTCGGTGCTTGTCC (SEQ ID NO: 206)
- CDKN2A antisense CCGCTCCTCTTCTAGATT (SEQ ID NO: 207)
- SFRP4 sense ACAACTGCCAGAGGTTCT (SEQ ID NO: 208)
- SFRP4 antisense CCTTGGCAGCTGCAGCCG (SEQ ID NO: 209)
- SFRP5 sense TGCGGCAGGGGAGCCGAG (SEQ ID NO: 210)
- SFRP5 antisense GACTGATCCTGGCGCCTC (SEQ ID NO: 211)
- ChIP assays performed in a series of fresh frozen CRC samples, for promoter regions of the above examined eight genes, there is a distinct enrichment of epigenetic silencing proteins (CHD4, DNMT1, DNMT3A, DNMT3B, EZH2, and G9a) and the oxidative damage marker, 8-OHdG as compared to normal colon epithelial tissues (data not shown). Furthermore, this enrichment is greater for the repressive proteins in CRC tissues with positive versus negative 8-OHdG in the above regions (data not shown).
- CHD4 enrichment is positively associated with the enrichment of other epigenetic silencing proteins (DNMT1, DNMT3A, DNMT3B, EZH2, and G9a) at the promoter CpG islands of the eight genes in human CRC tissues (data not shown).
- DNMT1, DNMT3A, DNMT3B, EZH2, and G9a epigenetic silencing proteins
- SW620 and LoVo CRC served for the studies as they have, as analyzed by Realtime PCR, westem blot analyses, and ELISA assays very low levels of all eight of the genes being examined. Knockdown of CHD4 increases the expression of all eight genes in both cell lines (data not shown). Among the genes, CDH1, WIF1, TIMP2, and TIMP3 are important in invasion and metastases and they were found to be drivers in mediating a role for CHD4 in this key aspect of tumor biology. Both SW620 and LoVo cells are known to have high invasion and metastatic capabilities (Drewinko et al, 1976; McNutt et al, 1981).
- CHD4 may account for their findings in a large subset of patients with CRC.
- these results are important for considering biomarker strategies to monitor the clinical behavior of CRC.
- CHD4 plays a role in ongoing silencing and blocking induction of these genes. Possibly this reflects ongoing damage repair at these loci in cancer cells but this must be further determined.
- the present data suggest that developing inhibitors for this function of CHD4 might be an excellent strategy to consider for cancer management. Important for any such drug development is our finding for the key role of the helicase domain of CHD4 for its mediation of abnormal epigenetic events as this presents a potentially target for drug intervention.
- a bivalent chromatin structure marks key developmental genes in embryonic stem cells. Cell 125, 315-326.
- the Mi-2/NuRD complex associates with pericentromeric heterochromatin during S phase in rapidly proliferating lymphoid cells. Chromosoma 118, 445-457.
- Double strand breaks can initiate gene silencing and SIRTl -dependent onset of DNA methylation in an exogenous promoter CpG island.
- Oxidative damage targets complexes containing DNA methyltransferases, SIRTl, and poly comb members to promoter CpG Islands. Cancer cell 20, 606-619.
- a stem cell-like chromatin pattern may predispose tumor suppressor genes to DNA hypermethylation and heritable silencing. Nat Genet 39, 237-242.
- Chromodomain helicase DNA-binding protein 4 regulates homologous recombination DNA repair, and its deficiency sensitizes cells to poly(ADP-ribose) polymerase (PARP) inhibitor treatment.
- PARP poly(ADP-ribose) polymerase
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- General Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Physics & Mathematics (AREA)
- Organic Chemistry (AREA)
- Cell Biology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides CHD4, as a potent oncogene which initiates and maintains tumor suppressor gene (TSG) silencing in human colorectal cancer (CRC). CHD4 is required to recruit repressive histone modifiers and DNA methyltransferases (DNMT) and impose de novo DNA methylation at sites of oxidative damage and double strand breaks (DSB's). CHD4 knockdown reactivates expression of silenced TSG's with abnormal, promoter DNA methylation and blunts CRC cell proliferation, invasion and metastases. Simultaneous prevention of re-expression of TSG's rescues these effects. In CRC patients, high tumor levels of CHD4 and the damage marker, 8-OHdG plus negative expression of the TSGs strongly correlates with early disease recurrence and decreased overall survival. CHD4 is then an appealing therapeutic target for CRC management. Methods of diagnosis and prognosis of CRC as well as methods of screening for inhibitors of CHD4 expression are also provided.
Description
ONCOGENE CHD4 AND USES THEREOF IN THE DIAGNOSIS AND TREATMENT OF
CANCER
REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional Patent Application No. 62/490,887, filed on April 27, 2017, which is hereby incorporated by reference for all purposes as if fully set forth herein.
STATEMENT OF GOVERNMENTAL INTEREST
[0002] This invention was made with government support under grant nos. ES011858 and CA170550, awarded by the National Institutes of Health. The government has certain rights in the invention.
BACKGROUND OF THE INVENTION
[0003] Although significant advancements have been made in the prevention and treatment of colorectal cancer, this disease still ranks third on the list of causes of cancer related deaths in the United States, which underlines the need for development of new targeted therapies in this field.
[0004] The chromodomain helicase DNA-binding protein 4 (CHD4), a key component of the nucleosome remodeling and histone deacetylation (NuRD) complex, is essential in DNA damage repair (DDR) and has been linked to oncogenic effects including inducing abnormal stem cell renewal, blunting differentiation, and altering cell cycle control (Lai and Wade, 2011). Loss of CHD4 function can sensitize tumor cells to oxidative damage and the protein promotes genome stability by helping to regulate p53 dependent cell cycle checkpoints (Polo et al, 2010). CHD4 can also protect replication forks in a poly(ADP-ribose) polymerase (PARP) dependent manner helping BRCA1 and BRCA2 deficient cells survive, perform DDR and acquire drug resistance (Guillemette et al., 2015; Ray Chaudhuri et al., 2016). One defined role of CHD4 in double strand break (DSB) repair is to recruit repressive chromatin to open chromatin regions in active gene promoters (Chou et al, 2010; Larsen et al, 2010; Polo et al., 2010) serving to protect transcribed regions during repair (Chou et al, 2010; Larsen et al., 2010; Polo et al., 2010).
[0005] Epigenetic events, involving chromatin modifier recruitment to DNA damage sites, play a key role in proper DNA damage repair (Sulli et al, 2012). However, the
inventors' recent studies have stressed such chromatin modifier recruitment facilitates the generation of epigenetic abnormalities which are hallmarks of cancer. Thus, in cancer cells, within minutes of inducing DNA double strand breaks and with exposure to ROS induced damage, key components of transcriptional repression, including interactions between DNA methyltransferases (DNMT's), histone deacetylases (HDAC's), and components of the long term gene silencing poly comb group proteins (PcG) are recruited to damage sites (O'Hagan et al, 2008; O'Hagan et al, 2011). This recruitment is associated with consequent silencing of nascent transcription for involved gene promoter regions (O'Hagan et al, 2011). Moreover, gene promoters biased to abnormal, de novo DNA methylation in cancer cells, those developmental genes controlled by PcG in embryonic and adult stem cells (Ohm et al, 2007; Schlesinger et al, 2007; Widschwendter et al, 2007), can begin to exhibit the above methylation during the induction of the DNA damage (O'Hagan et al., 2008; O'Hagan et al., 2011).
[0006] The inventors have previously associated a key core subunit of NuRD, CHD4 with potentially maintaining TSG silencing mediated by abnormal promoter CpG island DNA methylation in cancer cells (Cai et al., 2014). Furthermore, recent studies reported that CHD4 is rapidly recruited to DNA damage sites where it facilitates DNA damage repair (Chou et al, 2010; Polo et al, 2010).
[0007] Thus, identifying druggable targets in this pathway would be beneficial for optimizing colorectal cancer treatment.
SUMMARY OF THE INVENTION
[0008] In accordance with some embodiments, the present invention shows how a key component of the NuRD complex, CHD4 plays a vital oncogenic role during DNA damage inherent to tumor initiation and progression. Such damage is inherent to the severe cellular stress and chronic inflammation which are leading risk factors for many human cancer types (Grivennikov et al, 2010) and arise secondary to toxicities from increases in reactive oxygen species (ROS) (Reuter et al, 2010). Cells which re-populate such "wounded" cell systems must then adopt mechanisms to survive this toxic scenario and repair the ongoing DNA damage insults. In turn, the survival of such cells depends upon addiction to repair pathways which can support viability of pre-malignant and/or cancer cells and thus may contribute to
emergence of cell transformation in the involved risk state (Federico et al, 2007; Scott et al, 2014).
[0009] In accordance with some embodiments, the present invention now defines CHD4 as playing a central role in tying together all of the above events for DNA damage linking chromatin repression of transcription, and abnormal DNA methylation.
[0010] Following clues from the above observations, the inventors' now directly establish that CHD4 is critical in DNA damage-induced de novo DNA methylation and epigenetic gene silencing. The inventors have demonstrated an essential role of CHD4 in the recruitment of epigenetic modifier proteins to DNA damage sites within promoter CpG islands of multiple documented, and importantly candidate TSGs and these recruitment associate with appearance of de novo DNA methylation, repressive histone modifications and suppression of nascent gene transcription. This role appears operative for maintaining proliferation, invasion, and metastases of cultured human colorectal cancer (CRC) cells. Moreover the inventive data tie to these key tumorigenesis properties, a driver role for multiple, epigenetically silenced, candidate TSG's and have significant prognostic implications in a large cohort of patients with CRC.
[0011] In accordance with an embodiment, the present invention provides a method of screening an agent which inhibits mRNA expression of CHD4 in a cancer cell or population of cells, the method comprising: (a) contacting a first cell or population of cells expressing CHD4 with a test agent; (b) contacting a second cell or population of cells expressing CHD4 with a control agent; (c) detecting the level of CHD4 mRNA expression in the first cell or population of cells; (d) detecting the level of CHD4 mRNA expression in the second cell or population of cells; (e) comparing the levels of mRNA expression of CHD4 from (c) and (d); and (f) identifying the agent as an inhibitor of CHD4 when the mRNA expression in (c) is less than the mRNA expression in (d).
[0012] In accordance with another embodiment, the present invention provides a method of screening an agent which inhibits expression of CHD4 protein in a cancer cell or population of cells, the method comprising: a) contacting a first cell or population of cells expressing CHD4 with a test agent; (b) contacting a second cell or population of cells expressing CHD4 with a control agent; (c) detecting the level of CHD4 protein expression in the first cell or population of cells; (d) detecting the level of CHD4 protein expression in the second cell or population of cells; (e) comparing the levels of protein expression of CHD4
from (c) and (d); and (f) identifying the agent as an inhibitor of CHD4 when the protein expression in (c) is less than the protein expression in (d).
[0013] In accordance with a further embodiment, the present invention provides a method for treating colorectal cancer in a subject comprising: (a) obtaining a biological sample from a tumor of the subject; (b) detecting the level of CHD4, CDH1, WIF1, TIMP2, TIMP3, MLH1, CDK 2A, SFRP4, and SFRP5 expression in the sample; (c) detecting the amount of 8-OHdG in the sample; (d) comparing the level of expression of CHD4, CDH1, WIF1, TIMP2, TIMP3, MLH1, CDK 2A, SFRP4, and SFRP5 and the amount of 8-OHdG in the subject to the level of expression in one or more control samples, (e) identifying the tumor of the subject as having a high probability of disease recurrence and decreased overall survival level when the level of expression of CHD4 is higher in the subject than the control levels, the amount of 8-OHdG in the subject sample is greater in the subject than the control amount, and the level of expression of one or more of the following genes CDH1, WIF1, TIMP2, TIMP3, MLH1, CDK 2A, SFRP4, and SFRP5 is lower in the subject than the control levels; and (f) providing the subject with an appropriate treatment regimen.
[0014] In accordance with a further embodiment, the present invention provides a method for treating colorectal cancer in a subject comprising: (a) obtaining a biological sample from a tumor of the subject; (b) detecting the level of CHD4 expression in the sample; (c) detecting the level of methylation of the promoter regions of one or more of the genes selected from the group consisting of CDH1, WIF1, TIMP2, TIMP3, MLH1, CDK 2A, SFRP4, and SFRP5; (d) detecting the amount of 8-OHdG in the sample; (e) comparing the level of expression of CHD4, the level of methylation of the promoter regions of one or more of the genes selected from the group consisting of CDH1, WIF1, TIMP2, TIMP3, MLH1, CDKN2A, SFRP4, and SFRP5, and the amount of 8-OHdG in the subject, to the level of expression CHD4, the amount of 8-OHdG, and the level of methylation of the promoter regions of one or more of the genes selected from the group consisting of CDH1, WIF1, TIMP2, TIMP3, MLH1, CDK 2A, SFRP4, and SFRP5,in one or more control samples, (f) identifying the tumor of the subject as having a high probability of disease recurrence and decreased overall survival level when the level of expression of CHD4 is higher in the subject than the control levels, the amount of 8-OHdG in the subject sample is greater in the subject than the control amount, and the level of methylation of the promoter regions of one or more of the following genes CDH1, WIF1, TIMP2, TIMP3, MLH1, CDK 2A, SFRP4, and SFRP5 is higher in the
subject than the control levels; and (g) providing the subject with an appropriate treatment regimen.
[0015] In accordance with still another embodiment, the present invention provides a method for treating a subject having colorectal cancer comprising administering to the subject a pharmaceutical composition comprising an effective amount of an agent which inhibits expression of CHD4 in a cell or population of cells and a pharmaceutically acceptable carrier.
BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Figures 1 A-1C. The recruitment of DNMT1, DNMT3A, and DNMT3B to laser- induced DNA damage sites is dependent on CHD4. (A, B) The indicated cells were micro- irradiated with a 455 nm laser and fixed at the indicated time points. The recruitment of endogenous DNMTs (A) and CHD4 (B) to DNA damage sites and their co-localization with γΗ2ΑΧ was examined by immunofluorescence staining. Representative images at the indicated time points are shown. The graphs below corresponding images represent the percentages of cells with γΗ2ΑΧ micro-irradiation tracks observed that have visible accumulation of DNMTs or CHD4 co-localizing with γΗ2ΑΧ. (C) The indicated cells were micro-irradiated with a 455 nm laser and fixed at the indicated time points. The accumulation of endogenous 5mc at DNA damage sites and the co-localization with γΗ2ΑΧ was examined by immunofluorescence staining. The graph represents the percentages of cells with co- localization of γΗ2ΑΧ and accumulation of 5mc at micro-irradiation tracks. Data are represented as mean ± SEM for triplicate experiments. The scale bar represents 10 μιτι. *p value < 0.05.
[0017] Figures 2A-2F. The recruitment of EZH2 and G9a to DNA damage sites is dependent on CHD4. (A) SW480 cells were not treated (Un) or treated with 2 mM H2O2 for 30 min. Immunoprecipitations and immunoblottings were performed using the indicated antibodies. (B) The indicated cells were not treated (Un) or treated with 2 mM H2O2 for 30 min. Whole cell extracts and the tight chromatin fractions were analyzed by immunoblotting. (C-E) The indicated cells were micro-irradiated with a 455 nm laser and fixed at the indicated time points. The recruitment of endogenous EZH2 (C), G9a (D) and CHD4 (E) to DNA damage sites and their co-localization with γΗ2ΑΧ were examined by immunofluorescence staining. The graph represents the percentages of cells with co-localization of γΗ2ΑΧ with
EZH2, G9a, or CHD4 at micro-irradiation tracks. The scale bar represents 10 μηι. (F) ChIP analyses of the indicated histone modifications at I-Scel-induced DSBs in SW480 DR-GFP cells infected with the indicated lentivirus. The y-axis represents the relative enrichment of the indicated histone modifications compared to the IgG control. Data are represented as mean ± SEM for triplicate experiments. *p value < 0.05.
[0018] Figures 3A-3B. The ATPase activity of CHD4 is required for the recruitment of DNMTs and EZH2 and G9a to DNA damage sites. (A) Cells were infected with Lenti- shCHD4 and lentivirus expressing shRNA-resistant CHD4-WT or ATPase-dead CHD4 (CHD4-DN). After 96 hr, cells were micro-irradiated with a 455 nm laser and fixed at the indicated time points. The recruitment of endogenous proteins to DNA damage sites and their co-localization with γΗ2ΑΧ were examined by immunofluorescence staining. The graph represents the percentages of cells with co-localization of γΗ2ΑΧ with the indicated proteins at micro-irradiation tracks. Data are represented as mean ± SEM for triplicate experiments. The scale bar represents 10 μιτι. *p value < 0.05. (B) Western blot analyses of the endogenous CHD4 and Flag-tagged CHD4 levels in the indicated cells.
[0019] Figures 4A-4D. Induction of DSBs at the promoter CpG islands of endogenous TSGs results in CHD4-dependent local epigenetic changes and gene silencing. (A)
Introduction of doxycycline-inducible DSB system at the promoter CpG islands of endogenous TSGs. The pCW-dCas9/FokI construct expresses a dCas9/FokI fusion protein containing the Fokl restriction endonuclease cleavage domain fused with a catalytically dead Cas9 (Top), a working model of the doxycycline-inducible DSB system at the promoter CpG islands of endogenous TSGs (Middle), and the time course for doxycycline treatment (Bottom). (B, C) Map of the doxycycline-inducible DSB sites at the endogenous promoter CpG islands of CDH1 (B) and WIF1 (C). Doxycycline-induced DSBs were monitored by a PCR assay with Fl, Rl primers spanning the cut site. Four pairs of primers (F2, R2— F5, R5) were used for ChIP assays at indicated distances from the DSB site (Upper panels). ChIP analyses of the indicated protein enrichment, 5mc enrichment and histone modifications near DSB sites at the indicated time points (Lower panels). Data are represented as mean ± SEM for triplicate experiments. *p value < 0.05. (D) Summary of the CHD4-mediated recruitment of epigenetic silencing proteins and epigenetic changes in the vicinity of DSB site at the endogenous promoters of eight representative TSGs.
[0020] Figures 5A-5J. The recruitment of CHD4 to oxidative DNA damage sites depends on OGG1. (A) CoIPs of ly sates from SW480 cells untreated or treated with 2 mM H2O2 for
30 min were performed with the indicated antibodies. (B) Purified OGG1 and Flag-CHD4 were incubated with antibodies against Flag or OGG1 in IP buffer. The immunoprecipitated samples were detected by Western blot analyses using the antibodies indicated. (C) After SW480 OGG1 KO cells were transfected with pCMV-Taq or pCMV-OGGl for 48 hr, the cells were untreated or treated with 2 mM H2O2 for 30 min. Whole cell extracts and the tight chromatin fractions were analyzed by immunoblotting with the indicated antibodies. (D) Whole cell extracts and the tight chromatin fractions from SW480 CHD4 KD cells untreated (Un) or treated with 2 mM H2O2 for 30 min were analyzed by immunoblotting as in (C). (E) Purified OGG1 and Flag-CHD4 were incubated with antibodies against Flag or OGG1 in IP buffer with or without 8-OHdG oligonucleotide. The immunoprecipitated samples were detected by Western blot analyses using the antibodies indicated. (F) Biotin labeled 8-OHdG oligonucleotide incubated with OGG1 and Flag-CHD4 was pulled down using streptavidin beads. Bound proteins were eluted and analyzed by immunoblotting with the indicated antibodies. (G) SW480 OGG1 KO cells were untreated or treated with 2 mM H2O2 for 30 min followed by ChIP for control IgG, 8-OHdG, and CHD4 at the promoter CpG islands of eight representative genes and analyzed by real-time RT-PCR. Data are represented as mean ± SEM for triplicate experiments. (H) Cells were untreated or treated with 2 mM H2O2 for 30 min. Sequential ChIP analyses were performed to test the co-occupancy of CHD4 and 8- OHdG at the promoter CpG islands of eight TSGs. Data are represented as mean ± SEM for triplicate experiments. (I) Cells were untreated or treated with 2 mM H2O2 for 30 min, and nascent RNA was labeled concurrently. Real-time RT-PCR data are presented as mean ± SEM of the treated over untreated values for triplicate experiments. (J) Sequential ChIP analyses were performed to test the co-occupancy of CHD4 and 8-OHdG or epigenetic silencing proteins at the promoter CpG islands of eight representative TSGs in fresh frozen human CRC tissues (n = 20) and normal colon epithelial tissues (n = 6). Data are represented as mean ± SEM.
[0021] Figures 6A-6D. 8-OHdG is positively correlated with the methylation but inversely correlated with the expression of TSGs in human CRC tissues (A-D) The top two rows show representative images of immunohistochemistry of 8-OHdG and E-cadherin (A), WIF1 (B), TIMP2 (C), or TIMP3 (D) in human CRC tissues. Scale bars represent 200 μιη (low magnification) and 50 μιτι (high magnification). The middle row shows the association between 8-OHdG levels and the methylation or expression of the TSG in human CRC tissues. The lower two rows show Kaplan-Meier analyses of the correlation of the TSG expression,
TSG methylation, 8-OHdG/TSG co-expression or 8-OHdG/TSG methylation status with recurrence and overall survival in patients with CRC.
[0022] Figures 7A-7D. Over-expression of CHD4 is positively correlated with the methylation and inversely correlated with expression of eight TSGs in human CRC tissues. (A) Real-time RT-PCR analyses of CHD4 mRNA expression in normal colon epithelial tissues (n=20) and 120 paired, adjacent non-tumor and CRC tissues, in CRC samples from patients with recurrence (n = 69) or without recurrence (n = 51), in CRC samples from patients with metastases (n = 50) or without metastases (n = 50), and in primary colon cancer tissues and paired metastatic colon cancer tissues (n = 20). Data are represented as mean ± SEM. *p value <0.05. (B) Representative immunohistochemistry staining of CHD4 in adjacent non-tumor tissues and CRC tissues. Scale bars represent 200 μηι (low magnification) and 50 μιτι (high magnification). (C) Kaplan-Meier analyses of the correlation between CHD4 expression and the recurrence or overall survival of patients with CRC. (D) The association between CHD4 expression and the expression or methylation of TSGs in CRC tissues (Upper panels) and Kaplan-Meier analysis of the correlation of CHD4/TSGs co- expression or CHD4/TSGs methylation status with recurrence and overall survival in patients with CRC (lower panels).
[0023] Figures 8A-8M. CHD4-mediated silencing of E-cadherin, WIF1, TIMP2, and TIMP3 promotes colon cancer metastases. (A) Transwell assay analyses of the migration and invasion abilities of the indicated CRC cells. (B-G) SW620 cells infected with the indicated shRNA lenti viruses for the indicated genes were injected into the tail vein of immune- incompetent mice, followed by noninvasive bioluminescence imaging for 9 weeks.
Representative bioluminescent imaging (B), bioluminescence signals (C), overall survival (D), incidence of lung colonization (E), the number of lung colonization foci (F), and representative H&E staining of lung tissues (G) from the different groups is shown. Scale bars represent 1 mm (low magnification) and 100 μιτι (high magnification). (H-M) A mouse model of liver metastases was established by intrasplenic injection of the indicated colon cancer cells. Representative bioluminescent imaging 9 weeks after injection (H),
bioluminescence signals recorded at the indicated time points (I), overall survival (J), incidence of liver metastases (K), number of tumor foci on the liver surface (L), and representative HE staining of liver tissues (M) from the different groups is shown. The scale bar represents 200 μιτι. Data are represented as mean ± SEM. *p value < 0.05.
DETAILED DESCRIPTION OF THE INVENTION
[0024] By "nucleic acid" as used herein includes "polynucleotide," "oligonucleotide," and "nucleic acid molecule," and generally means a polymer of DNA or RNA, which can be single-stranded or double-stranded, synthesized or obtained (e.g., isolated and/or purified) from natural sources, which can contain natural, non-natural or altered nucleotides, and which can contain a natural, non-natural or altered internucleotide linkage, such as a phosphoroamidate linkage or a phosphorothioate linkage, instead of the phosphodiester found between the nucleotides of an unmodified oligonucleotide. It is generally preferred that the nucleic acid does not comprise any insertions, deletions, inversions, and/or substitutions. However, it may be suitable in some instances, as discussed herein, for the nucleic acid to comprise one or more insertions, deletions, inversions, and/or substitutions.
[0025] In an embodiment, the nucleic acids of the invention are recombinant. As used herein, the term "recombinant" refers to (i) molecules that are constructed outside living cells by joining natural or synthetic nucleic acid segments to nucleic acid molecules that can replicate in a living cell, or (ii) molecules that result from the replication of those described in (i) above. For purposes herein, the replication can be in vitro replication or in vivo replication.
[0026] The nucleic acids used as primers in embodiments of the present invention can be constructed based on chemical synthesis and/or enzymatic ligation reactions using procedures known in the art. See, for example, Sambrook et al. (eds.), Molecular Cloning, A Laboratory Manual, 3rd Edition, Cold Spring Harbor Laboratory Press, New York (2001) and Ausubel et al, Current Protocols in Molecular Biology, Greene Publishing Associates and John Wiley & Sons, NY (1994). For example, a nucleic acid can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed upon hybridization (e.g., phosphorothioate derivatives and acridine substituted nucleotides).
Examples of modified nucleotides that can be used to generate the nucleic acids include, but are not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl) uracil, 5-carboxymethylaminomethyl- 2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1 -methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2- methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-substituted
adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5 -methoxy uracil, 2-methylthio- N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2- thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5- oxyacetic acid methylester, 3-(3-amino-3-N-2-carboxypropyl) uracil, and 2,6-diaminopurine. Alternatively, one or more of the nucleic acids of the invention can be purchased from companies, such as Macromolecular Resources (Fort Collins, CO) and Synthegen (Houston, TX).
[0027] The nucleotide sequences used herein are those which hybridize under stringent conditions preferably hybridizes under high stringency conditions. By "high stringency conditions" is meant that the nucleotide sequence specifically hybridizes to a target sequence (the nucleotide sequence of any of the nucleic acids described herein) in an amount that is detectably stronger than non-specific hybridization. High stringency conditions include conditions which would distinguish a polynucleotide with an exact complementary sequence, or one containing only a few scattered mismatches from a random sequence that happened to have a few small regions (e.g., 3-10 bases) that matched the nucleotide sequence. Such small regions of complementarity are more easily melted than a full-length complement of 14-17 or more bases, and high stringency hybridization makes them easily distinguishable. Relatively high stringency conditions would include, for example, low salt and/or high temperature conditions, such as provided by about 0.02-0.1 M NaCl or the equivalent, at temperatures of about 50-70 °C.
[0028] The term "isolated and purified" as used herein means a protein that is essentially free of association with other proteins or polypeptides, e.g., as a naturally occurring protein that has been separated from cellular and other contaminants by the use of antibodies or other methods or as a purification product of a recombinant host cell culture.
[0029] The term "biologically active" as used herein means an enzyme or protein having structural, regulatory, or biochemical functions of a naturally occurring molecule.
[0030] As used herein, the term "subject" refers to any mammal, including, but not limited to, mammals of the order Rodentia, such as mice and hamsters, and mammals of the order Logomorpha, such as rabbits. It is preferred that the mammals are from the order Carnivora, including Felines (cats) and Canines (dogs). It is more preferred that the mammals are from the order Artiodactyla, including Bovines (cows) and Swines (pigs) or of the order Perssodactyla, including Equines (horses). It is most preferred that the mammals
are of the order Primates, Ceboids, or Simoids (monkeys) or of the order Anthropoids (humans and apes). An especially preferred mammal is the human.
[0031] In accordance with one or more embodiments of the present invention, it will be understood that the types of cancer diagnosis which may be made, using the methods provided herein, is not necessarily limited. For purposes herein, the cancer can be any cancer. As used herein, the term "cancer" is meant any malignant growth or tumor caused by abnormal and uncontrolled cell division that may spread to other parts of the body through the lymphatic system or the blood stream.
[0032] The cancer can be a metastatic cancer or a non-metastatic (e.g., localized) cancer. As used herein, the term "metastatic cancer" refers to a cancer in which cells of the cancer have metastasized, e.g., the cancer is characterized by metastasis of a cancer cells. The metastasis can be regional metastasis or distant metastasis, as described herein.
[0033] The terms "treat," and "prevent" as well as words stemming therefrom, as used herein, do not necessarily imply 100% or complete treatment or prevention. Rather, there are varying degrees of treatment or prevention of which one of ordinary skill in the art recognizes as having a potential benefit or therapeutic effect. In this respect, the inventive methods can provide any amount of any level of diagnosis, staging, screening, or other patient management, including treatment or prevention of cancer in a mammal. Furthermore, the treatment or prevention provided by the inventive method can include treatment or prevention of one or more conditions or symptoms of the disease, e.g., cancer, being treated or prevented. Also, for purposes herein, "prevention" can encompass delaying the onset of the disease, or a symptom or condition thereof.
[0034] "Complement" or "complementary" as used herein to refer to a nucleic acid may mean Watson-Crick (e.g., A-T/U and C-G) or Hoogsteen base pairing between nucleotides or nucleotide analogs of nucleic acid molecules.
[0035] "Differential expression" may mean qualitative or quantitative differences in the temporal and/or cellular gene expression patterns within and among cells and tissue. Thus, a differentially expressed gene may qualitatively have its expression altered, including an activation or inactivation, in, e.g., normal versus disease tissue. Genes may be turned on or turned off in a particular state, relative to another state thus permitting comparison of two or more states. A qualitatively regulated gene may exhibit an expression pattem within a state or cell type which may be detectable by standard techniques. Some genes may be expressed in one state or cell type, but not in both. Alternatively, the difference in expression may be
quantitative, e.g., in that expression is modulated, either up-regulated, resulting in an increased amount of transcript, or down-regulated, resulting in a decreased amount of transcript. The degree to which expression differs need only be large enough to quantify via standard characterization techniques such as expression arrays, quantitative reverse transcriptase PCR, northern analysis, and RNase protection.
[0036] "Identical" or "identity" as used herein in the context of two or more nucleic acids or polypeptide sequences may mean that the sequences have a specified percentage of residues that are the same over a specified region. The percentage may be calculated by optimally aligning the two sequences, comparing the two sequences over the specified region, determining the number of positions at which the identical residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the specified region, and multiplying the result by 100 to yield the percentage of sequence identity. In cases where the two sequences are of different lengths or the alignment produces one or more staggered ends and the specified region of comparison includes only a single sequence, the residues of single sequence are included in the denominator but not the numerator of the calculation. When comparing DNA and RNA, thymine (T) and uracil (U) may be considered equivalent. Identity may be performed manually or by using a computer sequence algorithm such as BLAST or BLAST 2.0.
[0037] "Probe" as used herein may mean an oligonucleotide capable of binding to a target nucleic acid of complementary sequence through one or more types of chemical bonds, usually through complementary base pairing, usually through hydrogen bond formation. Probes may bind target sequences lacking complete complementarity with the probe sequence depending upon the stringency of the hybridization conditions. There may be any number of base pair mismatches which will interfere with hybridization between the target sequence and the single stranded nucleic acids described herein. However, if the number of mutations is so great that no hybridization can occur under even the least stringent of hybridization conditions, the sequence is not a complementary target sequence. A probe may be single stranded or partially single and partially double stranded. The strandedness of the probe is dictated by the structure, composition, and properties of the target sequence. Probes may be directly labeled or indirectly labeled such as with biotin to which a streptavidin complex may later bind.
[0038] "Substantially complementary" used herein may mean that a first sequence is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identical to the
complement of a second sequence over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21 , 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more nucleotides, or that the two sequences hybridize under stringent hybridization conditions.
[0039] "Substantially identical" used herein may mean that a first and second sequence are at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identical over a region of 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more nucleotides or amino acids, or with respect to nucleic acids, if the first sequence is substantially complementary to the complement of the second sequence.
[0040] A probe is also provided comprising a nucleic acid described herein. Probes may be used for screening and diagnostic methods, as outlined below. The probes may be attached or immobilized to a solid substrate or apparatus, such as a biochip.
[0041] "Probe" as used herein may mean an oligonucleotide capable of binding to a target nucleic acid of complementary sequence through one or more types of chemical bonds, usually through complementary base pairing, usually through hydrogen bond formation. Probes may bind target sequences lacking complete complementarity with the probe sequence depending upon the stringency of the hybridization conditions. There may be any number of base pair mismatches which will interfere with hybridization between the target sequence and the single stranded nucleic acids described herein. However, if the number of mutations is so great that no hybridization can occur under even the least stringent of hybridization conditions, the sequence is not a complementary target sequence. A probe may be single stranded or partially single and partially double stranded. The strandedness of the probe is dictated by the structure, composition, and properties of the target sequence. Probes may be directly labeled or indirectly labeled such as with biotin to which a streptavidin complex may later bind.
[0042] In accordance with one or more embodiments, the term "probe" also means an oligonucleotide which is capable of specifically binding to a CpG locus which can be methylated. The DNA gene target or probes of the present invention are used to determine the methylation status of at least one CpG dinucleotide sequence of at least one target gene as described herein.
[0043] The probe may have a length of from 8 to 500, 10 to 100 or 20 to 60 nucleotides. The probe may also have a length of at least 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180,
200, 220, 240, 260, 280 or 300 nucleotides. The probe may further comprise a linker sequence of from 10-60 nucleotides.
[0044] A method of identifying the level of nucleic acid expression associated with a disease or a pathological condition is also provided. The method comprises measuring a level of the nucleic acid in a sample that is different than the level of a control. In accordance with an embodiment, the nucleic acid is a mRNA and the detection may be performed by contacting the sample with a probe or biochip described herein and detecting the amount of hybridization. PCR, including RT-PCR, may be used to amplify nucleic acids in the sample, which may provide higher sensitivity.
[0045] The level of the nucleic acid in the sample may also be compared to a control cell (e.g., a normal cell) to determine whether the nucleic acid is differentially expressed (e.g., overexpressed or underexpressed). The ability to identify mRNAs that are differentially expressed in pathological cells compared to a control can provide high-resolution, high- sensitivity datasets which may be used in the areas of diagnostics, prognostics, therapeutics, drug development, pharmacogenetics, biosensor development, and other related areas.
The expression level of a disease-associated nucleic acid or mRNA provides information in a number of ways. For example, a differential expression of a disease-associated nucleic acid compared to a control may be used as a diagnostic that a patient suffers from the disease. Expression levels of a disease-associated nucleic acid may also be used to monitor the treatment and disease state of a patient. Furthermore, expression levels of a disease- associated mRNA may allow the screening of drug candidates for altering a particular expression profile or suppressing an expression profile associated with disease.
[0046] The detection of the target nucleic acid, or portions or fragments thereof, can be through direct hybridization assays or can comprise sandwich assays, which include the use of multiple probes, as is generally known in the art.
[0047] A variety of hybridization conditions may be used, including high, moderate and low stringency conditions as outlined above. The assays may be performed under stringency conditions which allow hybridization of the probe only to the target. Stringency can be controlled by altering a step parameter that is a thermodynamic variable, including, but not limited to, temperature, formamide concentration, salt concentration, chaotropic salt concentration pH, or organic solvent concentration.
[0048] Hybridization reactions may be accomplished in a variety of ways. Components of the reaction may be added simultaneously, or sequentially, in different orders. In addition, the
reaction may include a variety of other reagents. These include salts, buffers, neutral proteins, e.g., albumin, detergents, etc. which may be used to facilitate optimal hybridization and detection, and/or reduce non-specific or background interactions. Reagents that otherwise improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors and antimicrobial agents may also be used as appropriate, depending on the sample preparation methods and purity of the target.
[0049] A kit is also provided comprising an array of oligonucleotides as described herein, or portions or fragments thereof, as well as a biochip as described herein, along with any or all of the following: assay reagents, buffers, probes and/or primers, and sterile saline or another pharmaceutically acceptable emulsion and suspension base. In addition, the kits may include instructional materials containing directions (e.g., protocols) for the practice of the methods described herein.
[0050] In accordance with another embodiment of the present invention, it will be understood that the term "biological sample" or "biological fluid" includes, but is not limited to, any quantity of a substance from a living or formerly living patient or mammal. Such substances include, but are not limited to, blood, serum, plasma, urine, cells, organs, tissues, bone, bone marrow, lymph, lymph nodes, synovial tissue, chondrocytes, synovial macrophages, endothelial cells, and skin. In a preferred embodiment, the sample is tissue or cells from a tumor of a subject.
[0051] As defined herein, in one or more embodiments, "contacting" means that the one or more agents which can inhibit CHD4 expression are introduced into a sample having at least one cancer cell expressing CHD4, and appropriate enzymes or reagents, in a test tube, flask, tissue culture, chip, array, plate, microplate, capillary, or the like, and incubated at a temperature and time sufficient to inhibit expression of CHD4 in the cancer cell. Methods for contacting the samples with the compounds, and other specific binding components are known to those skilled in the art, and may be selected depending on the type of assay protocol to be run. Incubation methods are also standard and are known to those skilled in the art.
[0052] In another embodiment, the term "contacting" means that the at least one identified CHD4 inhibiting agent using the methods of the present invention is introduced into a subject, preferably a subject receiving treatment for a CHD4 related disorder, such as colorectal cancer, and the at least one agent is allowed to come in contact with the cancer cells in vivo.
[0053] With respect to any identified pharmaceutical compositions comprising agents which inhibit expression of CHD4 using the screening methods described herein, a pharmaceutically acceptable carrier can be used, including those conventionally used, and is limited only by physico-chemical considerations, such as solubility and lack of reactivity with the active compound(s), and by the route of administration. The pharmaceutically acceptable carriers described herein, for example, vehicles, adjuvants, excipients, and diluents, are well-known to those skilled in the art and are readily available to the public. Examples of the pharmaceutically acceptable carriers include soluble carriers such as known buffers which can be physiologically acceptable (e.g., phosphate buffer) as well as solid compositions such as solid-state carriers or latex beads. It is preferred that the
pharmaceutically acceptable carrier be one which is chemically inert to the active agent(s), and one which has little or no detrimental side effects or toxicity under the conditions of use.
[0054] The carriers or diluents used herein may be solid carriers or diluents for solid formulations, liquid carriers or diluents for liquid formulations, or mixtures thereof.
[0055] Solid carriers or diluents include, but are not limited to, gums, starches (e.g., corn starch, pregelatinized starch), sugars (e.g., lactose, mannitol, sucrose, dextrose), cellulosic materials (e.g., microcrystalline cellulose), acrylates (e.g., polymethylacrylate), calcium carbonate, magnesium oxide, talc, or mixtures thereof.
[0056] For liquid formulations, pharmaceutically acceptable carriers may be, for example, aqueous or non-aqueous solutions, suspensions, emulsions or oils. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, and injectable organic esters such as ethyl oleate. Aqueous carriers include, for example, water, alcoholic/aqueous solutions, cyclodextrins, emulsions or suspensions, including saline and buffered media.
[0057] Examples of oils are those of petroleum, animal, vegetable, or synthetic origin, for example, peanut oil, soybean oil, mineral oil, olive oil, sunflower oil, fish-liver oil, sesame oil, cottonseed oil, corn oil, olive, petrolatum, and mineral. Suitable fatty acids for use in parenteral formulations include, for example, oleic acid, stearic acid, and isostearic acid. Ethyl oleate and isopropyl myristate are examples of suitable fatty acid esters.
[0058] Parenteral vehicles (for subcutaneous, intravenous, intraarterial, or intramuscular injection) include, for example, sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's and fixed oils. Formulations suitable for parenteral administration include, for example, aqueous and non-aqueous, isotonic sterile injection solutions, which can contain anti-oxidants, buffers, bacteriostats, and solutes that render the
formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives.
[0059] Intravenous vehicles include, for example, fluid and nutrient replenishers, electrolyte replenishers such as those based on Ringer's dextrose, and the like. Examples are sterile liquids such as water and oils, with or without the addition of a surfactant and other pharmaceutically acceptable adjuvants. In general, water, saline, aqueous dextrose and related sugar solutions, and glycols such as propylene glycols or polyethylene glycol are preferred liquid carriers, particularly for injectable solutions.
[0060] In addition, in an embodiment, any CHD4 inhibiting agents identified using the methods of the present invention may further comprise, for example, binders (e.g., acacia, cornstarch, gelatin, carbomer, ethyl cellulose, guar gum, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, povidone), disintegrating agents (e.g., cornstarch, potato starch, alginic acid, silicon dioxide, croscarmelose sodium, crospovidone, guar gum, sodium starch glycolate), buffers (e.g., Tris-HCl, acetate, phosphate) of various pH and ionic strength, additives such as albumin or gelatin to prevent absorption to surfaces, detergents (e.g., Tween 20, Tween 80, Pluronic F68, bile acid salts), protease inhibitors, surfactants (e.g. sodium lauryl sulfate), permeation enhancers, solubilizing agents (e.g., cremophor, glycerol, polyethylene glycerol, benzlkonium chloride, benzyl benzoate, cyclodextrins, sorbitan esters, stearic acids), anti-oxidants (e.g., ascorbic acid, sodium metabisulfite, butylated
hydroxyanisole), stabilizers (e.g., hydroxypropyl cellulose, hyroxypropylmethyl cellulose), viscosity increasing agents (e.g., carbomer, colloidal silicon dioxide, ethyl cellulose, guar gum), sweetners (e.g., aspartame, citric acid), preservatives (e.g., thimerosal, benzyl alcohol, parabens), lubricants (e.g., stearic acid, magnesium stearate, polyethylene glycol, sodium lauryl sulfate), flow-aids (e.g., colloidal silicon dioxide), plasticizers (e.g., diethyl phthalate, tri ethyl citrate), emulsifiers (e.g., carbomer, hydroxypropyl cellulose, sodium lauryl sulfate), polymer coatings (e.g., poloxamers or poloxamines), coating and film forming agents (e.g., ethyl cellulose, acrylates, polymethacrylates), and/or adjuvants.
[0061] The choice of carrier will be determined, in part, by the particular compound, as well as by the particular method used to administer the compound. Accordingly, there are a variety of suitable formulations of the pharmaceutical composition of the invention. The following formulations for parenteral, subcutaneous, intravenous, intramuscular, intraarterial, intrathecal and interperitoneal administration are exemplary, and are in no way limiting.
More than one route can be used to administer any identified compounds, and in certain instances, a particular route can provide a more immediate and more effective response than another route.
[0062] Suitable soaps for use in parenteral formulations include, for example, fatty alkali metal, ammonium, and triethanolamine salts, and suitable detergents include, for example, (a) cationic detergents such as, for example, dimethyl dialkyl ammonium halides, and alkyl pyridinium halides, (b) anionic detergents such as, for example, alkyl, aryl, and olefin sulfonates, alkyl, olefin, ether, and monoglyceride sulfates, and sulfosuccinates, (c) nonionic detergents such as, for example, fatty amine oxides, fatty acid alkanolamides, and polyoxyethylenepolypropylene copolymers, (d) amphoteric detergents such as, for example, alkyl-P-aminopropionates, and 2-alkyl-imidazoline quaternary ammonium salts, and (e) mixtures thereof.
[0063] The parenteral formulations will typically contain from about 0.5% to about 25% by weight of the compounds in solution. Preservatives and buffers may be used. In order to minimize or eliminate irritation at the site of injection, such compositions may contain one or more nonionic surfactants, for example, having a hydrophile-lipophile balance (HLB) of from about 12 to about 17. The quantity of surfactant in such formulations will typically range from about 5% to about 15% by weight. Suitable surfactants include, for example, polyethylene glycol sorbitan fatty acid esters, such as sorbitan monooleate and the high molecular weight adducts of ethylene oxide with a hydrophobic base, formed by the condensation of propylene oxide with propylene glycol.
[0064] The parenteral formulations can be presented in unit-dose or multi-dose sealed containers, such as ampoules and vials, and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid excipient, for example, water, for injections, immediately prior to use. Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules, and tablets.
[0065] Injectable formulations are in accordance with the invention. The requirements for effective pharmaceutical carriers for injectable compositions are well-known to those of ordinary skill in the art (see, e.g., Pharmaceutics and Pharmacy Practice, J.B. Lippincott Company, Philadelphia, PA, Banker and Chalmers, eds., pages 238-250 (1982), md ASHP Handbook on Injectable Drugs, Trissel, 15th ed., pages 622-630 (2009)).
[0066] For purposes of the invention, the amount or dose of the compounds, salts, solvates, or stereoisomers of any one the CHD4 inhibiting agents identified using the
screening methods disclosed herein, administered should be sufficient to effect, e.g., a therapeutic or prophylactic response, in the subject over a reasonable time frame. The dose will be determined by the efficacy of the particular compound and the condition of a human, as well as the body weight of a human to be treated.
[0067] Embodiments of the invention also include a process for preparing pharmaceutical products comprising the agents identified using the screening methods. The term
"pharmaceutical product" means a composition suitable for pharmaceutical use
(pharmaceutical composition), as defined herein. Pharmaceutical compositions formulated for particular applications comprising the compounds of the present invention are also part of this invention, and are to be considered an embodiment thereof.
[0068] As used herein, the term "treat," as well as words stemming therefrom, includes preventative as well as disorder remitative treatment. The terms "reduce," "suppress," "prevent," and "inhibit," as well as words stemming therefrom, have their commonly understood meaning of lessening or decreasing. These words do not necessarily imply 100% or complete treatment, reduction, suppression, or inhibition.
[0069] In an embodiment, the term "administering" means that the agents identified using the screening methods of the present invention are introduced into a subject, preferably a subject receiving treatment for a disease, and the compounds are allowed to come in contact with the one or more disease related cells or population of cells in vivo. In some
embodiments the host cell or population of cells in the host can be any cell or population of cells that can be selectively bound by the antigens bound to the agents so identified. One of ordinary skill in the art would understand the host cells can be cancer cells.
[0070] An active agent and a biologically active agent are used interchangeably herein to refer to a chemical or biological compound that induces a desired pharmacological and/or physiological effect, wherein the effect may be prophylactic or therapeutic. The terms also encompass pharmaceutically acceptable, pharmacologically active derivatives of those active agents specifically mentioned herein, including, but not limited to, salts, esters, amides, prodrugs, active metabolites, analogs and the like. When the terms "active agent,"
"pharmacologically active agent" and "drug" are used, then, it is to be understood that the invention includes the active agent per se, as well as pharmaceutically acceptable, pharmacologically active salts, esters, amides, prodrugs, metabolites, analogs etc.
[0071] In a further embodiment, the agents identified using the screening methods of the present invention can be used in combination with one or more additional therapeutically
active agents which are known to be capable of treating conditions or diseases discussed above. For example, the identified agents could be used in combination with one or more known therapeutically active agents, to treat a proliferative disease such as a tumor or cancer. Non-limiting examples of other therapeutically active agents that can be readily combined in a pharmaceutical composition with the compositions and methods of the present invention are enzymatic nucleic acid molecules, allosteric nucleic acid molecules, antisense, decoy, or aptamer nucleic acid molecules, antibodies such as monoclonal antibodies, small molecules, and other organic and/or inorganic compounds including metals, salts and ions.
[0072] The dose of the identified agents of the present invention also will be determined by the existence, nature and extent of any adverse side effects that might accompany the administration of a particular composition. Typically, an attending physician will decide the dosage of the pharmaceutical composition with which to treat each individual subject, taking into consideration a variety of factors, such as age, body weight, general health, diet, sex, compound to be administered, route of administration, and the severity of the condition being treated.
[0073] It is also contemplated that in an embodiment of the present invention, the methods of treatment disclosed herein are useful against many mammalian tumors, including, for example, colon cancer, as well as others such as breast cancer, prostate cancer, pancreatic cancer, hepatoma, glioblastoma, ovarian cancer, leukemia, Hodgkin's lymphoma and multiple myeloma.
[0074] It will be understood by those of ordinary skill in the art that the term "tumor" as used herein means a neoplastic growth which may, or may not be malignant. Additionally, the compositions and methods provided herein are not only useful in the treatment of tumors, but in their micrometastses and their macrometastses. Typically, micrometastasis is a form of metastasis (the spread of a cancer from its original location to other sites in the body) in which the newly formed tumors are identified only by histologic examination;
micrometastases are detectable by neither physical exam nor imaging techniques. In contrast, macrometastses are usually large secondary tumors.
[0075] In accordance with an embodiment, the present invention provides methods of screening agents which inhibit CHD4 and methods for the prevention and/or treatment of tumors, and their micrometastses and their macrometastses using said agents.
[0076] As used herein, the term "target compound" encompasses antibodies, antibody fragments, proteins, peptides, siRNAs, antagonists, agonists, compounds, or nucleotide
constructs which modulate the expression of CHD4 in a cell or population of cells. In some embodiments, the cells are mammalian cells. In some embodiments, the cells are cancer cells, for example, colorectal cancer cells.
[0077] In some embodiments, the agents which modulate expression of CHD4 in a cell or population of cells, are agents which downregulate or inhibit expression of CHD4 in the cell.
[0078] In accordance with an embodiment, the present invention provides a method of screening an agent which inhibits mRNA expression of CHD4 in a cancer cell or population of cells, the method comprising: (a) contacting a first cell or population of cells expressing CHD4 with a test agent; (b) contacting a second cell or population of cells expressing CHD4 with a control agent; (c) detecting the level of CHD4 mRNA expression in the first cell or population of cells; (d) detecting the level of CHD4 mRNA expression in the second cell or population of cells; (e) comparing the levels of mRNA expression of CHD4 from (c) and (d); and (f) identifying the agent as an inhibitor of CHD4 when the mRNA expression in (c) is less than the mRNA expression in (d).
[0079] In some embodiments, the method for detecting mRNA expression is RT-PCR using the following exemplary primers and probes: E-cadherin sense: 5'- GAACGCATTGCCACATAC-3' (SEQ ID NO: 1); E-cadherin antisense: 5'- ACCTTCCATGACAGACCC-3' (SEQ ID NO: 2); WIF1 sense: 5'- ATGCCAATGTCAAGAAGG-3' (SEQ ID NO: 3); WIF1 antisense: 5'- ATGTC GGAGTTC AC C AGA-3 ' (SEQ ID NO: 4); TIMP2 sense: 5'- GC AC C ACC C AGAAGAAGAG-3 ' (SEQ ID NO: 5); TIMP2 antisense: 5'- ACCCAGTCCATCCAGAGGC-3' (SEQ ID NO: 6); TIMP3 sense: 5'- GCTGACAGGTCGCGTCTA-3' (SEQ ID NO: 7); TIMP3 antisense: 5'- CACAAAGCAAGGCAGGTAG-3' (SEQ ID NO: 8); MLH1 sense: 5'- AAGTTGTTGGCAGGTATT-3' (SEQ ID NO: 9); MLH1 antisense: 5'- GGTTGAGGCATTGGGTAG-3' (SEQ ID NO: 10); pl6 sense: 5'- TTCCTGGACACGCTGGTGGT-3' (SEQ ID NO: 11); pl6 antisense: 5'- CTATGCGGGCATGGTTACTGC-3' (SEQ ID NO: 12); SFRP4 sense: 5'- GATGTTGACTGTAAACGCCTAA-3 (SEQ ID NO: 13); SFRP4 antisense: 5'- AGGGATGGGTGATGAGGA-3 '(SEQ ID NO: 14) ; SFRP5 sense: 5'- TTGACATCCCTGCCGACCTG-3' (SEQ ID NO: 15); SFRP5 antisense: 5'- GAAGACCTGCGTATCCGAGTG-3' (SEQ ID NO: 16); β-actin sense: 5'- CGGGAAATCGTGCGTGAC-3' (SEQ ID NO: 17); β-actin antisense: 5'-
CAGGAAGC AAGGCTGGAA-3 ' (SEQ ID NO: 18); MYC sense: 5'- CTGCGACGAGGAGGAGAA-3'(SEQ ID NO: 19); MYC anti-sense: 5'- CCGAAGGGAGAAGGGTGT-3' (SEQ ID NO: 20); ACTB sense: 5'- CGGGAAATCGTGCGTGAC-3'(SEQ ID NO: 21); ACTB antisense: 5'- CAGGAAGGAAGGCTGGAAG-3' (SEQ ID NO: 22); RPL13 sense: 5'- ACCGCTCCAAACTCATCCTC-3' (SEQ ID NO: 23); RPL13 antisense: 5'- TTTGCCCGTATGCCGAAG-3' (SEQ ID NO: 24); RPL10A sense: 5'- TTCCCTTCCCTGCTCACA-3' (SEQ ID NO: 25); RPL10A antisense: 5'- CAGCCAGACATAACACCTTC-3' (SEQ ID NO: 26); IL-8 sense: 5'- AGCCTTCCTGATTTCTGC-3' (SEQ ID NO: 27); IL-8 antisense: 5'- AACCCTCTGCACCCAGTT-3' (SEQ ID NO: 28); HBD sense: 5'- GATGCAGTTGGTGGTGAG-3' (SEQ ID NO: 29); HBD antisense: 5'- AAGTGCCCTTGAGGTTGT-3' (SEQ ID NO: 30); MYH1 sense: 5'- CACCACCAACCCATACGA-3' (SEQ ID NO: 31); MYH1 antisense: 5'- CTGCCTTGTCAGCAACTTCA-3' (SEQ ID NO: 32); LAMB4 sense: 5'- CCAACCACTACGGACTAAG-3' (SEQ ID NO: 33); LAMB4 antisense: 5'- AGCACCTCCAATATCACA-3' (SEQ ID NO: 34); CHD4 Sense: 5'- GCGGGACTTACCTTAC-3' (SEQ ID NO: 212), and CHD4 Antisense: 5'- CTGTCGCTC ATACTTC AC-3 ' (SEQ ID NO: 213).
[0080] In some embodiments the cancer cells include, but are not limited to Adenomas such as: Tubular, Villous, Tubulovillous, and Serrated; Intraepithelial neoplasia (dysplasia); Carcinomas, including Adenocarcinoma, Mucinous adenocarcinoma, Signet-ring cell carcinoma, Small cell carcinoma, Squamous cell carcinoma, Adenosquamous carcinoma, Medullary carcinoma, and Undifferentiated carcinoma; Carcinoids (well differentiated endocrine neoplasm) including, EC-cell, serotonin-producing neoplasm, L-cell, glucagon-like peptide and PP/PYY producing tumors. The cancer cells used in the context of the present invention also include cells from tumors of subjects, and cell lines, including, but not limited to RKO, RKO-AS45-1 ; SW1417; SW948; DLD-1; SW480; SW1116; LS174T; WIDr;
COLO 3200; HCT-15; SW403; SW48; HCT-8; HCT 116; LS123; LS 180; HX; HP; CCD- 18Co; CCD-33Co; CCD-112Co; CCD-841 CoN; CaCo-2; LoVo; TB4; SW620; SNU-C1; HT-29 and the like.
[0081] In accordance with another embodiment, the present invention provides a method of screening an agent which inhibits expression of CHD4 protein in a cancer cell or
population of cells, the method comprising: a) contacting a first cell or population of cells expressing CHD4 with a test agent; (b) contacting a second cell or population of cells expressing CHD4 with a control agent; (c) detecting the level of CHD4 protein expression in the first cell or population of cells; (d) detecting the level of CHD4 protein expression in the second cell or population of cells; (e) comparing the levels of protein expression of CHD4 from (c) and (d); and (f) identifying the agent as an inhibitor of CHD4 when the protein expression in (c) is less than the protein expression in (d).
[0082] In some embodiments, the method for detecting CHD4 protein expression can be known immunological based assays, such as, but not limited to, ELISA, Western blots, immunoprecipitation, antibody coated beads with antibodies specific for an antigen of CHD4, proteomic screens, HPLC, mass spectrometry-based techniques, such as matrix-assisted laser desorption/ionization (MALDI) and electrospray ionization (ESI).
[0083] In accordance with an embodiment, the present invention provides a method for treating colorectal cancer in a subject comprising: (a) obtaining a biological sample from a tumor of the subject; (b) detecting the level of CHD4 expression in the sample; (c) comparing the level of expression of CHD4 in one or more control samples; (d) identifying the tumor of the subject as having a high probability of disease recurrence and decreased overall survival level when the level of expression of CHD4 is higher in the subject sample compared to controls; and (e) providing the subject with an appropriate treatment regimen.
[0084] In accordance with another embodiment, the present invention provides a method for treating colorectal cancer in a subject comprising: (a) obtaining a biological sample from a tumor of the subject; (b) detecting the level of CHD4 expression in the sample; (c) detecting the amount of 8-OHdG in the sample; (c) comparing the level of expression of CHD4 and the amount of 8-OHdG in the subject sample to the level of expression of CHD4 and the amount of 8-OHdG in one or more control samples; (d) identifying the tumor of the subject as having a high probability of disease recurrence and decreased overall survival level when the level of expression of CHD4 is higher in the subject sample compared to controls and the amount of 8-OHdG in the subject sample is greater compared to controls; and (e) providing the subject with an appropriate treatment regimen.
[0085] In accordance with another embodiment, the present invention provides a method for treating colorectal cancer in a subject comprising: (a) obtaining a biological sample from a tumor of the subject; (b) detecting the level of CHD4, CDH1, WIF1, TIMP2, TIMP3, MLH1, CDK 2A, SFRP4, and SFRP5 expression in the sample; (c) comparing the level of
expression of CHD4, CDHl, WIFl, TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, and SFRP5 in the subject sample to the level of expression in one or more control samples, (d) identifying the tumor of the subject as having a high probability of disease recurrence and decreased overall survival level when the level of expression of CHD4 is higher in the subject sample compared to controls, and the level of expression of one or more of the following genes CDHl, WIFl, TIMP2, TIMP3, MLHl, CDKN2A, SFRP4, and SFRP5 is lower in the subject sample compared to controls; and (f) providing the subject with an appropriate treatment regimen.
[0086] In accordance with another embodiment, the present invention provides a method for treating colorectal cancer in a subject comprising: (a) obtaining a biological sample from a tumor of the subject; (b) detecting the level of CHD4, CDHl, WIFl, TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, and SFRP5 expression in the sample; (c) detecting the amount of 8-OHdG in the sample; (d) comparing the level of expression of CHD4, CDHl, WIFl, TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, and SFRP5 and the amount of 8-OHdG in the subject sample to the level of expression of CHD4, CDHl, WIFl, TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, and SFRP5 and the amount of 8-OHdG in one or more control samples, (e) identifying the tumor of the subject as having a high probability of disease recurrence and decreased overall survival level when the level of expression of CHD4 is higher in the subject sample compared to controls, the amount of 8-OHdG in the subject sample is greater compared to controls, and the level of expression of one or more of the following genes CDHl, WIFl, TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, and SFRP5 is lower in the subject sample compared to controls; and (f) providing the subject with an appropriate treatment regimen.
[0087] In accordance with a further embodiment, the present invention provides a method for treating colorectal cancer in a subject comprising: (a) obtaining a biological sample from a tumor of the subject; (b) detecting the level of CHD4 expression in the subject sample; (c) detecting the level of methylation of the promoter regions of one or more of the genes selected from the group consisting of CDHl, WIFl, TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, and SFRP5; (d) comparing the level of expression of CHD4, and the level of methylation of the promoter regions of one or more of the genes selected from the group consisting of CDHl, WIFl, TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, and SFRP5, to the level of expression CHD4, and the level of methylation of the promoter regions of one or more of the genes selected from the group consisting of CDHl, WIFl, TIMP2, TIMP3,
MLHl, CDK 2A, SFRP4, and SFRP5, in one or more control samples, (e) identifying the tumor of the subject as having a high probability of disease recurrence and decreased overall survival level when the level of expression of CHD4 is higher in the subject sample compared to controls and the level of methylation of the promoter regions of one or more of the following genes CDHl, WIFl, TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, and SFRP5 is higher in the subject sample compared to controls; and (f) providing the subject with an appropriate treatment regimen.
[0088] In accordance with a further embodiment, the present invention provides a method for treating colorectal cancer in a subject comprising: (a) obtaining a biological sample from a tumor of the subject; (b) detecting the level of CHD4 expression in the subject sample; (c) detecting the level of methylation of the promoter regions of one or more of the genes selected from the group consisting of CDHl, WIFl, TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, and SFRP5 in the subject sample; (d) detecting the amount of 8-OHdG in the subject sample; (e) comparing the level of expression of CHD4, the level of methylation of the promoter regions of one or more of the genes selected from the group consisting of CDHl, WIFl, TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, and SFRP5, and the amount of 8-OHdG in the subject sample, to the level of expression CHD4, the amount of 8-OHdG, and the level of methylation of the promoter regions of one or more of the genes selected from the group consisting of CDHl, WIFl, TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, and SFRP5,in one or more control samples, (f) identifying the tumor of the subject as having a high probability of disease recurrence and decreased overall survival level when the level of expression of CHD4 is higher in the subject sample compared to controls, the amount of 8-OHdG in the subject sample is greater compared to controls, and the level of methylation of the promoter regions of one or more of the following genes CDHl, WIFl, TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, and SFRP5 is higher in the subject sample compared to controls; and (g) providing the subject with an appropriate treatment regimen.
[0089] In accordance with an embodiment, the present invention provides the use of chromodomain helicase DNA-binding protein 4 (CHD4) and 8-hydroxy-2' -deoxyguanosine (8-OHdG) as a marker for a tumor of colorectal origin of a subject as having a high probability of disease recurrence and decreased overall survival level, when the expression of the CHD4 marker and the amount of 8-OHdG in a sample from the tumor of the subject in a sample from the subject is increased compared to one or more control colorectal samples.
[0090] In some alternative embodiments, the above use further comprises measuring the expression level of one or more of CDHl, WIFl, TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, and SFRP5 genes in the sample from the subject and comparing the levels to the levels of one or more of CDHl, WIFl, TIMP2, TIMP3, MLHl, CDKN2A, SFRP4, and SFRP5 genes in one or more control colorectal samples; and diagnosing, monitoring, or prognosing a tumor of colorectal origin of a subject as having a high probability of disease recurrence and decreased overall survival level, when the expression of the CHD4 marker and the amount of 8-OHdG in a sample from the tumor of the subject in a sample from the subject is increased compared to one or more control colorectal samples, and the expression levels of more of CDHl, WIFl, TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, and SFRP5 genes in the sample from the subject are decreased compared to the expression levels of those genes in one or more control colorectal samples.
[0091] In accordance with an embodiment, the present invention provides the use of CHD4, 8-OHdG, and one or more of CDHl, WIFl, TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, and SFRP5 genes as a marker for a tumor of colorectal origin of a subject as having a high probability of disease recurrence and decreased overall survival level, when the expression of the CHD4 marker and the amount of 8-OHdG in a sample from the tumor of the subject in a sample from the subject is increased compared to one or more control colorectal samples, and the methylation levels of the promoters of more of CDHl, WIFl, TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, and SFRP5 genes in the sample from the subject are increased compared to the methylation levels of the promoters of those genes in one or more control colorectal samples.
[0092] In accordance with an embodiment, the present invention provides a composition for diagnosing, detecting, monitoring or prognosticating high probability of disease recurrence and decreased overall survival level of colorectal cancer or the progression towards disease recurrence and decreased overall survival level colorectal cancer, comprising a nucleic acid affinity ligand and/or a peptide affinity ligand for the CHD4 expression product or protein and a 8-OHdG peptide affinity ligand. In some embodiments, the nucleic acid affinity ligand or peptide affinity ligand is modified to function as a contrast agent.
[0093] In some embodiments, the affinity ligand is a set of oligonucleotides specific for the CHD4 expression product, a probe specific for the CHD4 expression product, an aptamer specific for the CHD4 expression product or for the CHD4 protein, an antibody specific for the CHD4 protein and/or an antibody variant specific for the CHD4 protein.
[0094] In some embodiments, the 8-OHdG peptide affinity ligand is an antibody.
[0095] In some embodiments, the method for detecting mRNA expression is RT-PCR using the following primers and probes described above
[0096] In some embodiments, 8-OHdG is measured with immunohistochemical methods known in the art, such as ELISA. Other methods of detection include HPLC, MS and combinations thereof.
[0097] It will be understood by those of ordinary skill, that there are a number of ways to detect DNA methylation, and these are known in the art. Examples of preferred methods of detection of methylation of DNA in a sample include the use of QMSP, oligonucleotide methylation tiling arrays, paramagnetic beads linked to MBD2, i.e., BeadChip assays and HPLC/MS methods. Other methods include methylation-specific multiplex ligation- dependent probe amplification (MS-MPLA), bisulfate sequencing, and assays using antibodies to DNA methylation, i.e., ELISA assays.
[0098] As used herein, the term "methylation state" means the detection of one or more methyl groups on a cytidine in a target site of the DNA in the sample.
[0099] Quantitative Real-Time PCR (Q-PCR) is known in the art. Reactions are characterized by the point in time during cycling when amplification of a PCR product is first detected (over assay noise) rather than the amount of PCR product accumulated after a fixed number of cycles. The higher the starting copy number of the nucleic acid target, the sooner a significant increase in fluorescence is observed. Briefly, in the Q-PCR method the number of target gene copies can be extrapolated from a standard curve equation using the absolute quantitation method. For each gene, cDNA from a positive control is first generated from RNA by the reverse transcription reaction. Using about 1 μΐ of this cDNA, the gene under investigation is amplified using the primers by means of a standard PCR reaction. The amount of amplicon obtained is then quantified by spectrophotometry and the number of copies calculated on the basis of the molecular weight of each individual gene amplicon. Serial dilutions of this amplicon are tested with the Q-PCR assay to generate the gene specific standard curve. Optimal standard curves are based on PCR amplification efficiency from 90 to 100% (100% meaning that the amount of template is doubled after each cycle), as demonstrated by the slope of the standard curve equation. Linear regression analysis of all standard curves should show a high correlation (R2 coefficients.98). Genomic DNA can be similarly quantified. Standard curves can also be generated by other means, for example, by
using recombinant genes (which can be incorporated into plasmid vectors) or amplicons generated by pre-amplification PCR.
[0100] As used herein, the term "control sample" or "reference sample" means a sample from a subject known not to have a colorectal disease or cancer.
[0101] The term "comparing" as used herein encompasses comparing the level of the peptide or polypeptide, or mRNA or methylation level of a promoter of a gene of interest, comprised by the sample to be analyzed with a level of a suitable reference level specified elsewhere in this description. It is to be understood that comparing as used herein refers to a comparison of corresponding parameters or values, e.g., an absolute amount is compared to an absolute reference amount while a concentration is compared to a reference concentration or an intensity signal obtained from a test sample is compared to the same type of intensity signal of a reference sample or a ratio of amounts is compared to a reference ratio of amounts. The comparison referred to in the methods of the present invention may be carried out manually or computer assisted. For a computer assisted comparison, the value of the determined amount may be compared to values corresponding to suitable references which are stored in a database by a computer program. The computer program may further evaluate the result of the comparison, i.e. automatically provide the desired assessment in a suitable output format.
[0102] There are different types of treatment for patients with colon cancer. Six types of standard treatment are used: surgery, radiofrequency ablation, cryosurgery, chemotherapy, radiation therapy, and targeted therapy. In accordance with the inventive methods, subjects which do not have increased levels of CHD4 and/or 8-OHdG are not likely to have a high probability of disease recurrence and decreased overall survival level. As such, their treatment is typically surgery alone. In subjects where CHD4 in elevated with/or without increased 8-OHdG, those subjects would be considered as having a high probability of disease recurrence and decreased overall survival level. Even more so when those levels of CHD4 and 8-OHdG are elevated and one or more of the following gene promoters: CDH1, WIFl , TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, SFRP5 are methylated. In these subjects, surgery would be followed with adjuvant therapy, such as chemotherapy, radiation therapy, and targeted therapy. Chemotherapeutic agents to be administered include, but are not limited to, irinotecan, cisplatin and 5-fluorouracil.
[0103] In some embodiments, patients considered as having a high probability of disease recurrence and decreased overall survival level can be treated with chemotherapy including,
for example, either the FOLFOX (5-FU, leucovorin, and oxaliplatin) or CapeOx
(capecitabine and oxaliplatin) regimens, but some patients may get 5-FU with leucovorin or capecitabine alone based on their age and health needs.
[0104] In other embodiments, patients considered as having a high probability of disease recurrence and decreased overall survival level can be treated with targeted therapies, including, for example, drugs which block vascular endothelial growth factor (VEGF) is a protein that helps tumors form new blood vessels (a process known as angiogenesis) to get nutrients they need to grow. Drugs that stop VEGF from working can be used to treat colon or rectal cancers, including Bevacizumab (Avastin), Ramucirumab (Cyramza), Ziv- aflibercept (Zaltrap). These drugs are given as (IV) infusions every 2 or 3 weeks, in most cases along with chemotherapy.
[0105] Other targeted therapy includes drugs that target EGFR for treating high risk colon or rectal cancers. These include: Cetuximab (Erbitux), and Panitumumab (Vectibix). Both of these drugs are given by IV infusion, either once a week or every other week, however these therapies are not indicated in colorectal cancers that have mutations (defects) in the KRAS, NRAS or BRAF gene.
[0106] Immunotherapies that can be indicated in patients considered as having a high probability of disease recurrence and decreased overall survival level include Pembrolizumab (Keytruda) and Nivolumab (Opdivo) are drugs that target PD-1. These treatments can be used for subjects whose colorectal cancer cells have tested positive for specific gene changes, such as a high level of microsatellite instability (MSI-H), or changes in one of the mismatch repair (MMR) genes. The treatments can also be used for subjects whose cancer is still growing after treatment with the above adjuvant chemotherapy. They can also be used to treat subjects whose cancer can't be removed with surgery, has come back (recurred) after treatment, or has spread to other parts of the body (metastasized).
[0107] Pembrolizumab (Keytruda) is administered to the subject as an IV infusion.
Treatment takes about 30 minutes and is given every 3 weeks. Nivolumab (Opdivo) is given as an IV infusion that takes 1 hour. Typically administered to the subject every 2 weeks.
[0108] In accordance with still another embodiment, the present invention provides a method for treating a subject having colorectal cancer comprising administering to the subject a pharmaceutical composition comprising an effective amount of an agent which inhibits expression of CHD4 in a cell or population of cells and a pharmaceutically acceptable carrier.
[0109] A kit is also provided comprising an array of oligonucleotides as described herein, or portions or fragments thereof, as well as a biochip as described herein, along with any or all of the following: assay reagents, buffers, probes and/or primers, and sterile saline or another pharmaceutically acceptable emulsion and suspension base. In addition, the kits may include instructional materials containing directions (e.g., protocols) for the practice of the methods described herein.
EXAMPLES
[0110] The following examples have been included to provide guidance to one of ordinary skill in the art for practicing representative embodiments of the presently disclosed subject matter. In light of the present disclosure and the general level of skill in the art, those of skill can appreciate that the following examples are intended to be exemplary only and that numerous changes, modifications, and alterations can be employed without departing from the scope of the presently disclosed subject matter. The synthetic descriptions and specific examples that follow are only intended for the purposes of illustration, and are not to be construed as limiting in any manner to make compounds of the disclosure by other methods. All primer sequences disclosed herein are presented in their 5 '-3' orientation.
[0111] Cell culture and treatments
[0112] SW480, HCT116, NCCIT, SW620, LoVo cells were obtained from American Tissue Type Culture Collection and maintained at 37 °C and 5% CC in McCoy's5A, McCoy's5A, RPMI-1640, McCoy's5A, and DMEM (Dulbecco's Modified Eagle Medium), respectively. For H2O2 exposure 30% H2O2 (Sigma) was diluted in PBS immediately before adding it to the media and cells were collected 30 min later. DR-GFP U20S cells with one copy of the DR-GFP gene stably integrated into its genome were gifts from Dr. Maria Jasin (Memorial Sloan Kettering Cancer Center).
[0113] Mice
[0114] BALB/C nude mice (5 weeks old) were housed under standard conditions and cared for according to the institutional guidelines for animal care. All animal experiments were approved by the Committee on the Use of Live Animals in Teaching and Research (CULATR), Fourth Military Medical University. For the tail vein injection assays, Luciferase tagged SW620 and LoVo (2 l06) cells in 200 μΐ of phosphate-buffered saline (PBS) were injected into the lateral tail vein of nude mice using 25-gauge needles. In weekly intervals,
anesthetized mice were injected i.p. with D-luciferin (150 mg/kg) and imaged 10 min after injection using an IVIS 100 Imaging System (Xenogen). The acquisition time was 2 min. The survival of the mice was recorded daily. Nine weeks after tail vein injection, mice were sacrificed and examined for lung metastases using standard histological examination.
[0115] A mouse model of liver metastases was established by intrasplenic injection of luciferase tagged SW620 and LoVo cells. Briefly, the spleens were exposed by an incision on the left upper abdomen of mice. For each mouse, 1 x l O6 cells in 100 μΐ of PBS were injected into the spleen, by which the injected cells were delivered to the liver through the portal circulation. Ten minutes after injection, the spleen was removed and the abdominal cavity was closed. Metastases were monitored by weekly noninvasive IVIS imaging of luciferase activity. The survival of the mice was recorded daily. After 9 weeks post implantation, all mice were sacrificed, and the number of tumor foci on liver surface was calculated. Liver tissues were fixed and stained with H&E to detect the liver metastases.
[0116] For the xenograft tumor growth assay, 5 * 104 cells were injected subcutaneously into the right flank of 5-week-old male BALB/C nude mice. Each group consisted of 10 mice. Tumor formation in nude mice was monitored over a 30-day period, and the tumor volume was measured every 5 days and calculated as: 1/2 (largest diameter) χ (smallest diameter)2.
[0117] Human specimens.
[0118] This study was approved by the ethics committee of the Fourth Military Medical University. All patients provided full consent for the study. Fresh colorectal cancer specimens and matched adj acent tissues were obtained from 363 adult patients who underwent surgery at Xijing Hospital, Fourth Military Medical University (Xi'an, China), between January 2005 and December 2007. None of the patients had received preoperative chemotherapy or radiotherapy. Pathological staging was performed according to the American Joint
Committee on Cancer/International Union against Cancer. Patients with stage II, III, and IV disease were treated after surgery with adjuvant chemotherapy, and none of the patients had received postoperative radiotherapy. Histomorphology of all primary tumor specimens and regional lymph nodes was confirmed by hematoxylin-eosin staining by the Department of Pathology, Xijing Hospital. In addition, 20 normal colon epithelial tissues, 120 pairs of frozen fresh colon cancer tissues and peripheral nontumor tissues were collected after surgical resection and stored in liquid nitrogen. These tissue pairs were used to detect the
mRNA expression of CHD4. Six normal colon epithelial tissues and 20 fresh frozen colon cancer tissues were collected after surgical resection, and were used to perform ChIP assays.
[0119] Complete follow-up was available for at least 8 years. During the follow-up period, diagnosis of recurrence and distant metastases was based on imaging methods such as endoscopy, ultrasonography, computed tomography, magnetic resonance imaging, position emission tomography, and, if possible, cytologic analyses and biopsy. Disease-free survival was defined as the time elapsed from surgery to the first occurrence of any of the following events: recurrence of colorectal cancer, colorectal cancer distant metastases, development of second noncolorectal malignancy excluding basal cell carcinoma of the skin and carcinoma- in-situ of the cervix, or death from any cause without documentation of a cancer-related event. Overall survival was defined as the time elapsed from surgery to death of patients with colorectal cancer. Follow-up information of all participants was updated every 3 months by telephone enquiry and questionnaire letters. Deaths of patients were ascertained by reporting from the family and verified by review of public records.
[0120] Construction of lentivirus shRNA knockdown and CRISPR knockout, and stable cell lines.
[0121] Lentivirus shRNA knockdown and CRISPR knockout.
[0122] Wild-type and ATP-domain mutant CHD4 were kindly provided by Wenbing Xie (Xie et al, 2012) and subcloned into pLenti-Flag. shRNA-resistant form of CHD4 was generated using Q5® Site-Directed Mutagenesis Kit (NEB) with the oligonucleotides (forward) 5'-AATGGCGTGAATTTAGTACCAATAACCCCTTC-3' (SEQ ID NO: 35) and (reverse) 5'- TTGCACCCAAAACCATCATCATCTTGGAG-3' (SEQ ID NO: 36). The construct was confirmed by DNA sequencing.
[0123] All lentiviral shRNA clones were ordered from Sigma. For CRISPR genome- editing, gRNAs were cloned into the lentiCRIPSR v2 vector (Addgene plasmid #52961) through the BsmBI site based on the protocol recommended by Addgene (Cambridge, MA, USA). The complete lists of shRNA and gRNA sequences are shown in Table 1.
TABLE 1 : Sequence for shRNA and CRISPR guide RNA
Gene Name Sequence
shRNA
CHD4 CCGGGCGGGAGTTCAGTACCAATAACTCGAGTTATTGGTACTGAACTCCCGCT
TTTT (SEQ ID NO: 37)
DNMT1 CCGGCGATGAGGAAGTCGATGATAACTCGAGTTATCATCGACTTCCTCATCGT TTTTG (SEQ ID NO: 38)
DNMT3A CCGGCCACCAGAAGAAGAGAAGAATCTCGAGATTCTTCTCTTCTTCTGGTGGT
TTTTG (SEQ ID NO: 39)
DNMT3B CCGGGACGATGGCTATCAGTCTTACCTCGAGGTAAGACTGATAGCCATCGTCT
TTTTTG (SEQ ID NO: 40)
EZH2 CCGGTATGATGGTTAACGGTGATCACTCGAGTGATCACCGTTAACCATCATAT
TTTTG (SEQ ID NO: 41)
G9a CCGGCGAGAGAGTTCATGGCTCTTTCTCGAGAAAGAGCCATGAACTCTCTCGT
TTTTG (SEQ ID NO: 42)
E-cadherin CCGGGAACGAGGCTAACGTCGTAATCTCGAGATTACGACGTTAGCCTCGTTCT
TTTTG (SEQ ID NO: 43)
WIF1 CCGGGCAAGAGTACTCATAGGATTTCTCGAGAAATCCTATGAGTACTCTTGCT
TTTTG (SEQ ID NO: 44)
TIMP2 CCGGCAAGTTCTTCGCCTGCATCAACTCGAGTTGATGCAGGCGAAGAACTTGT
TTTTG (SEQ ID NO: 45)
TIMP3 CCGGCGAGAGTCTCTGTGGCCTTAACTCGAGTTAAGGCCACAGAGACTCTCGT
TTTTG (SEQ ID NO: 46)
MLH1 CCGGCCAAGTGAAGAATATGGGAAACTCGAGTTTCCCATATTCTTCACTTGGT
TTTTG (SEQ ID NO: 47)
pl6 CCGGGCTCTGAGAAACCTCGGGAAACTCGAGTTTCCCGAGGTTTCTCAGAGCT
TTTTG (SEQ ID NO: 48)
SFRP4 CCGGGAACTCAAGTCCCGCTCATTACTCGAGTAATGAGCGGGACTTGAGTTCT
TTTTG (SEQ ID NO: 49)
SFRP5 CCGGCCACTCGGATACGCAGGTCTTCTCGAGAAGACCTGCGTATCCGAGTGGT
TTTT (SEQ ID NO: 50)
OGG1 CCGGCGGATCAAGTATGGACACTGACTCGAGTCAGTGTCCATACTTGATCCGT
TTTT (SEQ ID NO: 51)
ZMYND8 CCGGCCCTGACTATGCGGAATACATCTCGAGATGTATTCCGCATAGTCAGGGT
TTTTG (SEQ ID NO: 52)
CRISPR guide
RNA
DNMT3A sense: 5'-caccgCGATGACGAGCCAGAGTACG-3' (SEQ ID NO: 53)
antisense: 5'-aaacCGTACTCTGGCTCGTCATCGc-3 ' (SEQ ID NO: 54)
DNMT3B sense: 5'-caccgATCCGCACCCCGGAGATCAG-3' (SEQ ID NO: 55)
antisense: 5'-aaacCTGATCTCCGGGGTGCGGATc-3' (SEQ ID NO: 56)
OGG1 sense: 5'-caccgTAGCCTCCACTCCTGCCCTG-3 ' (SEQ ID NO: 57)
antisense: 5 ' -aaacCAGGGCAGGAGTGGAGGCTAc-3 ' (SEQ ID NO: 58)
[0124] The production of lentivirus and cell infection were performed according to the pLKO.1 lentiviral vector protocol recommended by Addgene. Briefly, the lentiviral plasmid and packaging plasmids pMD2.G and psPAX2 (Addgene plasmid #12259 and #12260) were transfected into HEK-293T cells with transfection reagent (Lipofectamine®3000, Thermo Fisher Scientific) and OPTI-MEM media (Invitrogen, Waltham, MA, USA). The lentiviruses were harvested twice at day 4 and day 5. Virus were filtered with 0.45 μιτι filter and stored at -80 °C. The lentiviral infection of target cells was performed in cell culture media with 8 μg/ml polybrene (Sigma H9268). Sevent -two hours after infection, cells were selected for 2 weeks using 2.5 μg/ml puromycin (OriGene). Selected pools of shRNA knockdown cells were used for the following experiments. For CRISPR knockout, subsequently single clones were selected through serial dilution. Clones were verified by western blot and sequencing.
[0125] Tight chromatin and whole cell isolation.
[0126] Indicated cell pellets were sequentially washed in CEBN buffer [10 mM HEPES pH 7.8, 10 mM KC1, 1.5 mM MgCh, 0.34 M sucrose, 10% glycerol, 0.2% NP-40, l protease inhibitor cocktail (Thermo Scientific), l x phosphatase Inhibitor cocktail (Sigma), N- ethylmaleimide (Sigma)], CEB buffer (CEBN buffer without NP-40), soluble nuclear buffer (3 mM EDTA, 0.2 mM EGTA, inhibitors), and 0.45 M NaCl buffer (50 mM Tris pH 8.0, 0.05% NP40, 0.45 M NaCl, inhibitors). The remaining pellet was lysed in 4% SDS buffer using a Qiashredder (Qiagen) and referred to as tight chromatin. Band densitometry data for western blots were collected using ImageJ software. Whole cell extracts were prepared from 1/10 of the pellet collected after treatment before beginning the tight chromatin isolation. GAPDH and LaminB immunoblotting serve as cytoplasmic and nuclear controls, respectively, for the designated extractions.
[0127] Co-immunoprecipitation
[0128] The total nuclear pellet was resuspended in modified RIPA buffer (50 mM Tris PH 7.5, 100 mM NaCl, 3 mM EDTA, 0.5% NP-40, 50 mM NaF), sonicated for three cycles of 30 s using a BioruptorPicosonicator (Diagenode), rotated at 4 °C for 1 hr with 60 mM spermine and 20 mM spermidine to release chromatin bound proteins, sonicated for two cycles of 30 s, and cleared by high-speed centrifugation. Lysates were rotated with antibody
for 4 hr at 4 °C. These antibodies are anti-CHD4 (Sigma, WH0001108M1), anti-DNMTl (Sigma, D4692), anti-DNMT3A (Novusbio, NB120-13888), anti-DNMT3B (A rabbit polyclonal antibody (QCB/BioSource International) was raised against a fusion protein containing residues 376-390 (ENKTRRRTADDSATS) (SEQ ID NO: 59)), anti-EZH2 (Active Motif, 39875), and anti-G9a (Perseus Proteomics Inc, PP-A8620A-00). Protein A/G- magnetic beads (Pierce) were added and the samples were rotated for 3 hr at 4 °C. The beads were washed six times with TNE buffer for 10 min at 4 °C. Complexes were eluted off the beads in loading buffer at 65 °C for 15 min.
[0129] Recombinant Flag-tagged human CHD4 (hCHD4) protein was purified from HEK293 cells transfected with (full-length) Flag-hCHD4 plasmid. Purified recombinant hCHD4 and hOGGl (M0241, NEB) proteins were incubated in IP buffer (50 mM Tris-HCl pH 8.0, 100 mM NaCl, 5 mM MgCh, 1% NP-40) with or without 8-OHdG oligonucleotides (double strand) at 4 °C for overnight, followed by co-precipitation using anti-flag M2 beads (M8823, Sigma) or protein A/G agarose (sc-2003, Santa Cruz) using antibodies against Flag (ab49763, Abeam) or OGG1 (sc-376935, Santa Cruz). The beads were washed five times using an IP buffer and the immunoprecipitated proteins were analysed by Western blotting. Normal rabbit IgG (sc-2027, Santa Cruz) or normal mouse IgG (sc-2025, Santa Cruz) was used as a negative control. Antibodies were used in the amount of 3 μg per IP.
Oligonucleotides for the co-immunoprecipitation are listed in Table 2.
[0130] TABLE 2: Sequences of DNA oligonucleotides.
Name Sequence
Control oligo GGAACTAGTGGCTCCCCCGGGCTGC (SEQ
ID NO: 60)
8-OHdG oligo GGAACTAGTGG (8-OHd) CTCCCCCGGGCTGC
(SEQ ID NO: 61)
8-OHdG oligo GGAACTAGTGG (8-OHd) CTCCCCCGGGCTGC
(SEQ ID NO: 62)
(double strand) GCAGCCCGGGGGAGCCACTAGTTCC (SEQ
ID NO: 63)
Biotin-8-OHdG oligo GGAACTAGTGG (8-OHd) CTCCCCCGGGCTGC
(SEQ ID NO: 64)
(double strand) GCAGCCCGGGGGAGCCACTAGTTCC(Biotin)
(SEQ ID NO: 65)
[0131] Western blot analyses.
[0132] Proteins from lysed cells were fractionated by SDS-PAGE and transferred to nitrocellulose membranes. Nonspecific binding sites were blocked with 5% milk in TBST (120 mM Tris-HCl (pH 7.4), 150 mM NaCl, and 0.05% Tween 20) for 1 hr at room temperature. Blots were incubated with a specific antibody overnight at 4 °C. Western blotting of β-actin on the same membrane was used as a loading control. The membranes were incubated with primary antibodies anti-CHD4 (Sigma, WH0001108M1), anti-DNMTl (Sigma, D4692), anti-DNMT3A (Novusbio, NB120-13888), anti-DNMT3B (A rabbit polyclonal antibody (QCB/BioSource International) was raised against a fusion protein containing residues 376-390 (ENKTRRRTADDSATS) (SEQ ID NO: 59)), anti-EZH2 (Cell Signaling, #3147), anti-G9a (Perseus Proteomics Inc, PP-A8620A-00), anti-E-cadherin (Cell Signaling, #3195), anti-WIFl (Abeam, abl55101), anti-TIMP2 (Abeam, abl828), anti- TIMP3 (Abeam, ab39184), anti-MLHl (Abeam, ab92312), anti-pl6 (Abeam, ab51243), anti- SFRP4 (Abeam, abl54167), anti-SFRP5 (Novus Biologicals, NBP2-20331), anti-yH2AX (Millipore, 05-636), anti-LaminB (Santa Cruz, sc-6216), anti-GAPDH (Sigma,
WH0002597M1) and anti- -actin (Santa Cruz, sc-47778) overnight at 4 °C. The membranes were then washed with PBS 3 times and incubated with an HRP-conjugated secondary antibody. Proteins were visualized using a Dura SuperSignal Substrate (Pierce, USA).
[0133] Real-time PCR.
[0134] Total RNA was extracted using TRIzol Reagent (Invitrogen), and reverse transcription was performed using the Advantage RT-for-PCR Kit (QIAGEN) according to the manufacturer's instructions. For the real-time PCR analyses, aliquots of double-stranded cDNA were amplified using a SYBR Green PCR Kit (QIAGEN). The cycling parameters were as follows: 95 °C for 15 s, 55-60 °C for 15 s, and 72 °C for 15 s for 45 cycles. A melting curve analyses was then performed. The Ct was measured during the exponential amplification phase, and the amplification plots were analyzed using SDS 1.9.1 software (Applied Biosystems). For the cell lines, the relative expression levels (defined as the fold change) of the target genes were determined by the following equation: 2~ΔΔα (ACt= ACttar et - ACtGAPDH; AACt = ACtexPressing vector - ACtcontrol vector). The expression level was normalized to the fold change that was detected in the corresponding control cells, which was defined as
1.0. For the clinical tissue samples, the fold change of the target gene was determined by the following equation: 2 ΔΔα (AACt= ACt1"™* - ACtnontumor). This value was normalized to the average fold change in the normal colon epithelial tissues, which was defined as 1.0. All reactions were performed in duplicate. The primer sequences are SEQ ID NOS: 1-34 and described above.
[0135] Nascent RNA transcription.
[0136] Nascent transcription assays were performed using the Click-iT Nascent RNA Capture Kit (Thermo Fisher). Cells were labeled with ethynyluridine for 30 min concurrently with the 2 mM H2O2 treatment or Dox treatment if indicated. cDNA was analyzed by qPCR using primers indicated herein.
[0137] Chromatin immunoprecipitation Assay (ChIP).
[0138] Cells were cross-linked in 1% formaldehyde at 37 °C for 10 min. After washing with PBS, the cells were resuspended in 300 μΐ of lysis buffer. The DNA was sheared to small fragments by sonication. Sonicated chromatin was diluted to a final SDS concentration of 0.1% and aliquots were rotated with antibody O/N at 4 °C. The recovered supernatants were incubated with specific antibodies or an isotype control IgG for 2 hr in the presence of herring sperm DNA and Protein A/G Magnetic beads (Thermo Fisher). These antibodies are anti-80HdG (Millipore, MAB3560), anti-yH2AX (Millipore, 05-636) anti-CHD4 (Sigma, WH0001108M1), anti-DNMTl (Sigma, D4692), anti-DNMT3A (Novusbio, NB120-13888), anti-DNMT3B (A rabbit polyclonal antibody was raised against a fusion protein containing residues 376-390 (ENKTRRRTADDSATS) (SEQ ID NO: 59)), anti-EZH2 (Active Motif, 39875), anti-G9a (Perseus Proteomics Inc, PP-A8620A-00), anti-5mc (Diagenode,
CI 5200081), anti-H3 (Millipore, 17-10046), anti-H3K27me3 (Millipore, 17-622), anti- H3K9me2 (Millipore, 05-1249), anti-H3K4me3 (Millipore, 17-614), and anti-H4K16ac (Millipore, 17-10101). The immunoprecipitated DNA was retrieved from the beads with 1% SDS and a 1.1 M NaHCC solution at 65 °C for 6 hr. The DNA was then purified using a PCR Purification Kit (QIAGEN, USA). The primers are shown in Table 3.
[0139] TABLE 3 : Primers for ChIP and PCR of cutting site in Dox-inducible DSB system.
CDH1 Fl : GCAACTCCAGGCTAGAGG (SEQ ID
NO: 66)
NO: 145)
All primers listed in 5 '-3' orientation
[0140] For sequential ChIP, the first immunoprecipitation was performed as described above except for the elution step, which was performed with SDS lysis buffer (1% SDS, 10 mmol/L EDTA, 50 mmol/L Tris-HCl, pH 8.1, 1 xcOmplete Protease Inhibitor Cocktail;
Roche Applied Science) for 10 min at 68 °C on a shaker at 1,000 rpm. After removal of beads, the samples were diluted with 1 : 10 ChIP dilution buffer (0.01% SDS, 1.1% Triton X- 100, 1.2 mmol/L EDTA, 16.7 mmol/L Tris-HCl, pH 8.1, 167 mmol/L NaCl, 22 μg/mL BSA, 1 xcOmplete Protease Inhibitor Cocktail) and incubated with beads, pre-blocked with BSA and herring sperm DNA, for 30 min at 4 °C. After removal of beads, chromatin was incubated with the indicated antibodies overnight at 4 °C followed by further incubation with beads. Beads were washed once with low-salt immune complex wash buffer (0.1% SDS, 1% Triton X-100, 2 mmol/L EDTA, 20 mmol/L Tris-HCl, pH 8.1, 150 mmol/L NaCl,
1 xcOmplete Protease Inhibitor Cocktail) and twice with high salt immune complex wash buffer (0.1% SDS, 1% Triton X-100, 2 mmol/L EDTA, 20 mmol/L Tris-HCl, pH 8.1, 500 mmol/L NaCl, 1 xcOmplete Protease Inhibitor Cocktail). Chromatin was eluted with SDS lysis buffer for 10 min at 68 °C on a shaker at 1,000 rpm and crosslinks were reversed in presence of 300 mmol/L NaCl at 65 °C overnight.
[0141] Laser irradiation and confocal microscopy.
[0142] Briefly, a Nikon Eclipse 2000E spinning-disk confocal microscope with five laser imaging modules and a charge-coupled device (CCD) camera (Hamamatsu) was employed. The setup integrated a Stanford Research Systems (SRS) NL100 nitrogen laser with a Micropoint ablation system (Photonics Instruments). Site-specific DNA damage was induced using the SRS NL100 nitrogen laser adjusted to emit at 455 nm. Positions internal to the nuclei of the indicated cells were targeted using a 60 χ oil objective lens. Cells were targeted at 5.5% laser intensity to induce DSBs, and images were captured at various time points and analyzed using Volocity, version 5.0, build 6 (Improvision). Experiments were performed using an environmental chamber attached to the microscope to maintain experimental conditions (37 °C, 5% CO2, and 80% humidity). After laser treatment, the cells were incubated at 37 °C for different time points and fixed immediately in freshly prepared 4%
formaldehyde (in PBS) for 10 minutes at room temperature. Fixed cells were permeabilized with a PBS solution containing 0.5% Triton X-100 on ice for 10 min. For
immunofluorescence staining, cells were incubated at 37 °C for 1 hr with anti-YH2AX (Millipore, 05-636; Santa cruz, sc-101696), anti-DNMTl (Santa cruz, sc-20701), anti- DNMT3A (Novusbio, NB120-13888), anti-DNMT3B (A rabbit polyclonal antibody (QCB/BioSource International) was raised against a fusion protein containing residues 376- 390 (ENKTRRRTADDSATS) (SEQ ID NO: 59)), anti-EZH2 (Cell Signaling, #3147), anti- G9a (Perseus Proteomics Inc, PP-A8620A-00), and anti-5mc (Diagenode, C15200081). Cells were incubated with corresponding secondary antibodies (Alexa Fluor goat anti-mouse or Alexa Fluor goat anti-rabbit, Invitrogen). After washing, they were mounted using ProLong Gold antifade reagent with DAPI (Invitrogen). The immunostained cells were visualized and imaged using a Hamamatsu EM-CCD digital camera attached to the Nikon Eclipse TE2000 confocal microscope. Cells (n = 30) were examined for each experimental point. In each experiment, images of cells at various time points were acquired using the same exposure, gain, sensitivity, and contrast settings.
[0143] Doxycycline -inducible DSB system at the promoter TSGs
[0144] Construction of pCW-dCas9-FokI: The pCW-Cas9 (Addgene: #50661) was digested with BamHl, and blunted by DNA polymerase and Klenow fragment. Then, the linearized vector was digested with Nhel and the bigger fragment (7.6 kb) was purified. The dCas9-FokI sequence was amplified from the pSQT-dCas9-FokI plasmids (Addgene:
#53369). The forward and reverse primers are: 5'-
TCTGTCTAGAATGCCTAAGAAGAAGCGGAAG-3' (SEQ ID NO: 146) and 5'- TTGTGGATCCGCTTCACTTGTCATCGTCAT-3' (SEQ ID NO: 147). The PCR products were digested with Xbal and ligated with the 7.6 kb vector fragment. The construct was confirmed by DNA sequencing.
[0145] A doxycycline-inducible DSB system at the promoter CpG islands of endogenous TSGs was constructed. First, the Fokl restriction endonuclease cleavage domain was fused to a catalytically dead Cas9, which was cloned into a pCW-Cas9 plasmid (Figure 4A). Then SW480 cells were transfected with the plasmid, and a single clone was selected that had a high level of doxycycline-induced dead Cas9/FokI fusion protein expression. Second, these cells were infected with lentivirus expressing gRNAs. After doxycycline induction, a double strand break at the specific site of a gene promoter was generated (Figure 4A). Doxycycline was added to medium for 8 hr followed by washing out the doxycycline and collecting cells
at indicated time points (Figure 4A). By western blot analyses, dCas9/FokI fusion protein was induced after 8 hr of doxycycline treatment, and this expression was maintained after an eight hour wash (data not shown). By immunofluorescence staining, each cell was shown to express high levels of nuclear flag tagged dCas9/FokI fusion protein at the 8+8 hr time point (data not shown). Next, this system was used to produce DSB at the promoter CpG islands of eight representative tumor suppressor genes. Four pairs of primers were designed to detect the local epigenetic changes near the DSB sites, including DSB sites upstream 0.2 kb, 0.4 kb, and 0.6 kb, and DSB sites downstream 0.2 kb (Figure 4B, C). To determine the timing of the DSB formation and repair, the dead Cas9/FokI induced cutting was monitored by real-time PCR using a primer pair (Fl, Rl) flanking the cutting site (Figure 4B, C). Using this PCR, only uncut or repaired DNA will result in a PCR product. The PCR product was slightly decreased at the 8 hr time point, followed by a dramatic decrease at the 8+8 hr time point. The PCR product level increased at the 8+24 hr time point suggesting that a significant portion of the cells repair the DSB during this time frame (data not shown).
[0146] TABLE 4 Sequence for CRISPR guide RNA in the Dox-inducible DSB system
Construction of tissue microarrays and immunohistochemistry.
[0148] Colorectal cancer specimens and matched adjacent tissues were used to construct a tissue microarray (Shanghai Biochip Co., Ltd. Shanghai, China). The tissue microarray was stained for 8-OHdG (Abeam, abl0802), CHD4 (Abeam, ab72418), E-cadherin (Cell signaling, #3195), WIF1 (Abeam, ab33281), TIMP2 (Thermo Fisher, MA1-774), TIMP3 (Thermo Fisher, PA1-21146), MLH1 (Abeam, ab92312), pl6 (Thermo Fisher, MA5-17093), SFRP4 (Abeam, abl54167), and SFRP5 (Novus Biologicals, NBP2-20331) expression. The array was scored independently by two pathologists for both the staining intensity and the extent of the protein expression across the section.
[0149] Immunohistochemistry was performed on 4^m-thick, routinely processed paraffin-embedded sections. Briefly, after baking on a panel at 60 °C for an hour, the tissue sections were deparaffinized with xylene and rehydrated through gradient ethanol immersion. Endogenous peroxidase activity was quenched by 3% (vol/vol) hydrogen peroxide in methanol for 12 min, followed by three 3-min washes with phosphate-buffered saline (PBS). Then the slides were immersed in 0.01 mol/L citrate buffer solution (pH 6.0) and placed in a microwave oven for 30 min. After washing in PBS (pH 7.4, 0.01 mol/L), the sections were incubated in a moist chamber at 4 °C overnight with the primary antibody diluted in PBS containing 1% (wt/vol) bovine serum albumin. Negative controls were performed by replacing the primary antibody with preimmune mouse serum. After three 5 min washes with PBS, the sections were treated with a peroxidase-conjugated second antibody (Santa Cruz) for 30 min at room temperature, followed by additional three 5 min washes with PBS.
Reaction product was visualized with diaminobenzidine for 2 min. Images were obtained under a light microscope (Olympus, Japan) equipped with a DP70 digital camera.
[0150] Analyses were performed by two independent observers who were blinded to the clinical outcome. The immunostaining intensity was scored on a scale of 0 to 3: 0 (negative), 1 (weak), 2 (medium) or 3 (strong). The percentage of positive cells was evaluated on a scale of 0 to 4: 0 (negative), 1 (l%-25%), 2 (26%-50%), 3 (51%-75%), or 4 (76%-100%). The final immuno-activity scores were calculated by multiplying the above two scores, resulting an overall scores which range from 0-12. Each case was ultimately considered "negative" if the final score ranges from 0-3, and "positive" if the final score ranges from 4-12.
[0151] DNA Methylation Analyses.
[0152] Genomic DNA was isolated from cells using Genomic DNA Purification kit following the manufacturer's instructions (Promega). Bisulfite modification of genomic DNA was carried out using the EZDNA methylation Kit (Zymo Research). Briefly, 1 μg of
genomic DNA was denatured by NaOH (final concentration, 0.2 mol/L) for 10 min at 37 °C. Hydroquinone (10 mmol/L, 30 μΐ) and 520 μΐ of 3 mol/L sodium hydroxide (pH 5) were added, and samples were incubated at 50 °C for 16 hr. Modified DNA was purified using Wizard DNA Clean-Up System following the manufacturer's instructions (Promega) and eluted into 50 μΐ water. DNA was treated with NaOH (final concentration, 0.3 mol/L) for 5 min at room temperature, ethanol precipitated, and resuspended in 20 μΐ water. Modified DNA was used immediately or stored at -20 °C. Primer sequences specific to unmethylated and methylated promoter sequences are listed in Table 5.
[0153] TABLE 5 : Primers for Methylation specific PCR
Primer Name Sequence Annealing Temp
E-cadherin methylated 60 C
(M) F ID NO: 164)
E-cadherin M-R: CGAATACGATCGAATCGAACCG (SEQ ID NO:
165)
E-cadherin 60 C
unmethylated F (SEQ ID NO: 166)
E-cadherin U-R: ACACCAAATACAATCAAATCAAACCAAA (SEQ
ID NO: 167)
WIF1 M-F: ATTTAGGTCGGGAGGCGACGC (SEQ ID NO: 65 C
168)
WIF1 M-R GACCTCCGCCCGCAATACCAA (SEQ ID NO: 169)
WIF1 U-F: TGGTATTTAGGTTGGGAGGTGATGT (SEQ ID 56 C
NO: 170)
WIF1 U-R: AACCTCCACCCACAATACCAA (SEQ ID NO: 171)
TIMP2 M-F: TTTGGTGTTTTGGAAGAACGGGCG (SEQ ID NO: 60 C
172)
TIMP2 M-R CGACCCCGATCCCCGCTACG (SEQ ID NO: 173)
TIMP2 U-F: TTTGGTGTTTTGGAAGAATGGGTG (SEQ ID NO: 60 C
174)
TIMP2 U-R: CCAACCCCAATCCCCACTACA (SEQ ID NO: 175)
TIMP3 M-F: 59 C
NO: 176)
TIMP3 M-R: CCGAAAACCCCGCCTCG (SEQ ID NO: 177)
TIMP3 U-F: TTTTGTTTTGTT ATTTTTTGTTTTTGGTTTT ( SEQ 59 C
ID NO: 178)
TIMP3 U-R: CCCCCAAAAACCCCACCTCA (SEQ ID NO: 179)
MLH1 M-F: ACGTAGACGTTTTATTAGGGTCGC (SEQ ID NO: 60 C
180)
MLH1 M-R: CCTCATCGTAACTACCCGCG (SEQ ID NO: 181)
MLH1 U-F: TTTTGATGTAGATGTTTTATTAGGGTTGT (SEQ 60 C
ID NO: 182)
MLH1 U-R: ACCACCTCATCATAACTACCCACA (SEQ ID NO:
183)
pl6 M-F: TTATTAGAGGGTGGGGCGGATCGC (SEQ ID NO: 65 C
184)
pl6 M-R: GACCCCGAACCGCGACCGTAA (SEQ ID NO:
185)
pl6 U-F: TTATTAGAGGGTGGGGTGGATTGT (SEQ ID NO: 60 C
186)
pl6 U-R: CAACCCCAAACCACAACCATAA (SEQ ID NO:
187)
SFRP4 M-F: GGGTGATGTTATCGTTTTTGTATCGAC (SEQ ID 60 C
NO: 188)
SFRP4 M-R: CCTCCCCTAACGTAAACTCGAAACG (SEQ ID
NO: 189)
SFRP4 U-F: 60 C
ID NO: 190)
SFRP4 U-R: CACCTCCCCTAACATAAACTCAAAACA (SEQ ID
NO: 191)
SFRP5 M-F: AAGATTTGGCGTTGGGCGGGACGTTC (SEQ ID 60 C
NO: 192)
SFRP5 M-R: ACTCCAACCCGAACCTCGCCGTACG (SEQ ID
NO: 193)
SFRP5 U-F: GTAAGATTTGGTGTTGGGTGGGATGTTT (SEQ 60 C
ID NO: 194)
SFRP5 U-R: AAAACTCCAACCCAAACCTCACCATACA (SEQ
ID NO: 195)
[0154] Each methylation-specific PCR reaction incorporated 100 ng of bisulfite-treated DNA as template, 10 pmol/L of each primer, 100 pmol/L deoxynucleoside triphosphate, 10 PCR buffer, and 1 unit of JumpStart Red Taq Polymerase (Sigma-Aldrich, St. Louis, MO) in
a final reaction volume of 25 μΐ. Cycle conditions were as follows: 95 °C 5 min; 35 cycles (95 °C 30 s, 60 °C 30 s, and 72 °C 30 s); and 72 °C 5 min. Methylation-specific PCR products were analyzed with nondenaturing 6% polyacrylamide gel electrophoresis and stained with ethidium bromide.
[0155] In vitro migration and invasion assays
[0156] A 24-well transwell plate (8-μηι pore size, Corning, USA) was used to measure the migratory and invasion capacity of each tested cell line. For transwell migration assays, 5x 104 cells were plated in the top chamber lined with a non-coated membrane. For invasion assays, chamber inserts were coated with 200 mg/ml of Matrigel and dried overnight under sterile conditions. Then, 1 χ 105 cells were plated in the top chamber. The mean of triplicate assays for each experimental condition was used. The average number of cells in five fields per membrane was counted in triplicate inserts. The relative invasion/migration was expressed as the number of treated cells to control cells.
[0157] MTT, Colony formation assay, and Soft agar colony formation assay.
[0158] The proliferation of colon cancer cells in vitro was measured using the MTT assay. 5000 stably infected cells were seeded into each well of 96 well plates. Six wells of each group were detected every day. 100 μΐ fresh medium containing MTT 0.5 mg/ml was put into each cell and incubated at 37 °C for 4 hr, then the medium was replaced by 100 μΐ of DMSO and shaken at room temperature for 10 min. The absorbance was measured at 490 nm.
[0159] For colony formation assays, 500 cells were seeded into 35 mm dishes and shaken. Then the cells were incubated at 37 °C in a humidified atmosphere containing 5% CO2 in air for 2 weeks. Subsequently, the medium was removed and the cells stained with crystal violet, and the dishes were imaged with a light microscope (Olympus, Japan) equipped with a DP70 digital camera. Only positive colonies (diameter > 40 um) in the dishes were counted and compared.
[0160] For soft agar colony formation assay, 1 χ 104 cells were suspended in 1 ml of soft agar mixture (2xcell culture medium, 20% FBS and 0.7% agarose) and were subsequently overlaid on the agar base. After 2-3 weeks, colonies (> 10 cells) were counted under the microscope in 10 fields per well. Three independent experiments were performed in duplicate.
[0161] Quantification and Statistical Analysis.
[0162] The quantitative data were compared between groups using the Student's t-test. Categorical data were analyzed using the Fisher's exact test. The cumulative recurrence and survival rates were determined using the Kaplan-Meier method and log-rank test. The Cox proportional hazards model was used to determine the independent factors that influence survival and recurrence based on the variables that had been selected from the univariate analyses. A value of p < 0.05 was considered to be significant. All the analyses were performed using the SPSS software (version 16.0).
EXAMPLE 1
[0163] CHD4 is essential for the recruitment of DNMT1 , DNMT3A, and DNMT3B to DNA damage sites.
[0164] Previously, the inventors demonstrated that CHD4 interacts with DNMT1 and DNMT3B in human CRC cell line HCTl 16 (Cai et al, 2014). The inventors have also tied recruitment of these DNMT's to chromatin and sites of ROS induced DNA damage (O'Hagan et al, 2011) and to DSBs (O'Hagan et al, 2008). The inventors now identify an upstream role for CHD4 in guiding these latter interactions. In reciprocal endogenous co- immunoprecipitations using human CRC and embryonic carcinoma (EC) cells, CHD4 interacts with DNMT1, DNMT3A, and DNMT3B. Hydrogen peroxide (H202)-induced oxidative damage dramatically increases these interactions (Figure 1A). In addition, this damage increases the tightness of binding of CHD4, DNMT1, DNMT3A, and DNMT3B to chromatin, whereas the total cellular levels of these proteins did not change (Figure 1B-D). Knockdown of CHD4 in CRC and EC cells significantly decreased the tightness of binding of DNMT1, DNMT3A, and DNMT3B to chromatin after H2O2 treatment (Figure 1B-D). In contrast, such knockout of DNMT3A, and DNMT3B, and also a severe genetic disruption of DNMT1 in CRC cells (DNMT1 hypomorph), does not diminish chromatin tightening of CHD4 (Figure 1B-D). These studies show that the oxidative damage-induced increase in affinity of DNMT1, DNMT3A, and DNMT3B for chromatin is dependent on CHD4.
[0165] The above interactions and role(s) for CHD4 and DNMT's are dynamically ongoing directly at sites of DNA damage. In HCTl 16 cells, when visualized at laser-induced DNA damage sites, endogenous DNMT3A and DNMT3B can be detected as early as 1 min after break induction. There is gradual accumulation of these proteins at the DNA damage sites during the first 5 min, retention for at least 3 hours and decrease in the levels thereafter
(Figures 2A, B). Similarly, endogenous DNMT1 is recruited to the DNA damage site with very similar dynamics but with earlier decreases beginning after 2 hours followed by complete disappearance (Figure 2C). However, CHD4 knockdown leads to a dramatic reduction of endogenous DNMT3A, DNMT3B, and DNMT1 recruitment to laser-induced DNA damage sites (Figures 2A-C). In contrast to the above, either knockout of DNMT3A and DNMT3B, or a severe genetic disruption of DNMT1 (DNMT1 hypomorph) have no effect on the recruitment of endogenous CHD4 to the laser-induced DNA damage sites (Figure 2D). Taken together, these studies show that CHD4 plays a critical role in recruiting DNMT1, DNMT3A, and DNMT3B to DNA damage sites.
EXAMPLE 2
[0166] De novo DNA methylation at DNA damage sites, mediated by DNMT3A and DNMT3B, is dependent on CHD4.
[0167] A key consequence of the above recruitment to DNA damage sites can be imposition of DNA methylation at the involved lesions. In previous studies of ROS induced damage, the inventors saw this begin within a 30 min period at the promoters of vulnerable genes (O'Hagan et al, 2011). Also, clones of cells with an induced DSB in an exogenous, CpG island containing construct accumulated DNA methylation, mediated by DNMT3B at the damage site (O'Hagan et al, 2008). The inventors now find a key role for CHD4 in guiding this process. In CRC cells, as determined by immunofluorescence staining with an antibody specific for 5-methylcytosine (5mc), while this modification is not detected at the DNA damage site 30 min after laser induction, it appears at one hour and accumulates for at least 6 hours (Figure 2E). CHD4 knockdown dramatically decreases this 5mc accumulation at laser-induced DNA damage sites (Figures 2F, G). Without being limited by any particular theory, the above CHD4 recruitment of the de novo DNMT's, DNMT3A and especially DNMT3B, appears responsible for the above DNA methylation. Knockout of the former reduces the 5mC accumulation somewhat while knockout of the DNMT3B dramatically reduces this as severely as CHD4 knockdown (Figures 2F, G). In contrast, a severe genetic disruption of the DNA methylation maintenance enzyme, DNMT1 has no significant effect on 5mC accumulation at the laser-induced DNA damage sites (Figures 2F, G). Taken together, these studies show that de novo DNA methylation mediated by DNMT3A and DNMT3B at the DNA damage site depends on CHD4.
EXAMPLE 3
[0168] CHD4 is critical for the recruitment of EZH2 and G9a to DNA damage sites.
[0169] In previous studies of both DSBs and ROS induced DNA damage, the inventors observed that the complexes triggered to the damage sites involves not only DNMT's but other key proteins for assembling repressive chromatin including PcG proteins such as EZH2 (O'Hagan et al, 2008; O'Hagan et al., 2011). The role of CHD4 in these processes needed to be determined. The inventors searched for this scenario by first examining by mass spectrometry, in SW480 CRC pre- and post H2O2 treatment cells, CHD4 interacting proteins (data not shown). Several NuRD components as well as the above and known CHD4 interacting proteins were identified among those co-immunoprecipitated with CHD4 including DNMT1, PCNA, histone deacetylases and PARP1 (data not shown). In addition, several previously unknown CHD4 interacting proteins, which can also interact with DNMT's were also identified including chromatin modifiers as outlined below and DNA damage repair proteins (data not shown). For the present studies, the inventors selected to focus their research on the transcription repressive histone modifiers, EZH2 and G9a. The former catalyzes the modification, H3K27me3 and the latter a key repressive mark associated with DNA methylated gene promoters, H3K9me2 (Shinkai and Tachibana, 2011).
[0170] Reciprocal endogenous co-immunoprecipitation experiments show that CHD4 interacts with EZH2 and G9a. Oxidative damage dramatically increases the interaction between CHD4 and EZH2 and G9a (Figure 3A). In addition, oxidative damage increases the tightness of binding of EZH2 and G9a to chromatin. Even though CHD4 knockdown does not affect the total protein levels of EZH2 and G9a, CHD4 knockdown dramatically decreases this tightening. However, neither EZH2 nor G9a knockdown affects the oxidative damage-induced increase in affinity of CHD4 for chromatin (Figure 3B). These studies suggest that the oxidative damage-induced increase in affinity of EZH2 and G9a for chromatin is dependent on CHD4.
[0171] Next, it was determined that, with respect to the above tightening to chromatin, endogenous EZH2 and G9a are specifically recruited to DNA damage sites. Again using the inventors' laser induced DNA damage approach, recruitment of both endogenous EZH2 and G9a to DSB damage sites occur as early as 2 min after microirradiation and accumulates at the DNA damage sites for at least 30 min. However, CHD4 knockdown leads to a dramatic
reduction of this recruitment (Figure 3C, D). On the contrary, neither G9a nor EZH2 knockdown affects recruitment of endogenous CHD4 to the laser-induced DNA damage sites (Figure 3E). These studies suggest that CHD4 is, as for all of the proteins studied earlier above, critical for the recruitment of EZH2 and G9a to DNA damage sites.
EXAMPLE 4
[0172] H3K27me3 and H3K9me2 enrichment mediated by EZH2 and G9a near DSBs depends on CHD4.
[0173] The recruitment of histone modifying proteins to chromatin and directly to DNA damage sites begs the question of how the histone marks they catalyze change at these sites. Previously, it was seen that with DSBs and ROS induced damage at gene promoter sites, active histone modifications are quickly reduced and repressive marks associated with proteins like EZH2 are increased (O'Hagan et al, 2008)(O'Hagan et al., 2011). To extend these findings to the present studies of CHD4, and to simultaneously look at the full range of the proteins we are studying and histone modifications, the inventors turned to a cell-based system (SW480 DR-GFP) for creating a DSB in an exogenous construct. In this assay, a DSB is induced in a stably introduced DNA recognition site for the endonuclease I-Scel. The enzyme activity is introduced via infection with Lentivirus Lenti-I-Scel (Pierce et al, 1999) (data not shown). Twenty-four hours after I-Scel infection, there is enrichment of CHD4, DNMT1, DNMT3A, DNMT3B, EZH2, and G9a near the DSB site correlating with γΗ2ΑΧ enrichment (data not shown). The levels of repressive markers H3K27me3 and H3K9me2 are significantly increased, whereas the levels of active markers H3K4me3 and H4K16ac are markedly decreased near the DSB sites (Figure 3F). Again, knockdown of CHD4 decreases the enrichment of each of the proteins at the induced DSB without affecting γΗ2ΑΧ enrichment (data not shown). In addition, CHD4 knockdown increases enrichment of the active marks H3K4me3 and H4K16ac, but significantly decreases the repressive marks H3K27me3 and H3K9me2 consistent with decreased enrichment of EZH2 and G9a (Figure 3F). These studies suggest that H3K27me3 and H3K9me2 enrichment mediated by EZH2 and G9a respectively near DSBs depends on presence of CHD4.
[0174] To determine whether the recruitment of these epigenetic factors to DSB sites are dependent on each other, these factors were knocked down individually, and their enrichment near DSB sites were analyzed, respectively. Consistent with the previous laser-induced DNA
damage results, knockdown of DNMT1, DNMT3A, DNMT3B, EZH2, or G9a have no significant effect on the enrichment of CHD4 near the DSB sites (data not shown). In addition, the recruitment of DNMT1, DNMT3A, DNMT3B, EZH2, and G9a to DSB sites do not dependent on each other (data not shown). Similar results were also found in U20S DR- GFP, osteosarcoma cells (data not shown).
EXAMPLE 5
[0175] The ATPase activity of CHD4 is required for the recruitment of DNMTs and EZH2 and G9a to DNA damage sites.
[0176] To determine whether the recruitment of DNMTs and EZH2 and G9a to DNA damage sites requires the ATPase activity of CHD4, endogenous CHD4 was depleted by shRNA interference (Lenti-shCHD4) and complemented the cells with shRNA-resistant wild type CHD4 or ATPase-dead CHD4. Western blot analyses confirmed that endogenous CHD4 was depleted and replaced with Flag-tagged CHD4 (Figure 4B). Ectopic expression of wild type CHD4 in cells depleted for endogenous CHD4 rescued the decreased recruitment of DNMTs and EZH2 and G9a to DNA damage sites. However, ectopic expression of ATPase-dead CHD4 failed to rescue the decreased recruitment of these proteins, suggesting that the ATPase activity of CHD4 is critical for the recruitment of these proteins to DNA damage sites (Figure 4A).
EXAMPLE 6
[0177] CHD4 mediates gene silencing associated with DNA damage.
[0178] The inventors previously linked CHD4 to silencing of genes with cancer-specific abnormal promoter, CpG island DNA methylation (Cai et al, 2014). The inventors have now linked this phenomenon to the upstream role of this NuRD component for assembly of repressive chromatin during DNA damage. To identify CHD4 target genes in human CRC, local ChIP assays were performed to analyze CHD4 enrichment at the promoter CpG islands of twenty representative genes which are frequently hypermethylated and silenced in human CRC tissues (data not shown) (van Engeland et al, 2011). In addition, real-time PCR was performed to analyze whether CHD4 knockdown reactivates the expression of these genes in two CRC cell lines (data not shown). Among the twenty genes, eight genes were identified
as target genes that could be reactivated by the CHD4 knock down alone (data not shown). Abnormal silencing of these genes play important roles in cancer for escape from senescence, inhibiting proliferation, anti-WNT activity, and inhibiting invasion and metastases (Baylin and Jones, 2011 ; Shen and Laird, 2013; Suzuki et al., 2004; van Engeland et al., 2011).
[0179] To induce DSBs at sites in the promoter CpG islands of the above eight proven and/or candidate TSG's, CDH1, WIF1, TIMP2, TIMP3, MLH1, CDK 2A, SFRP4, and SFRP5, were constructed in SW480 CRC cells, a Dox-inducible DSB system driving a Fokl restriction endonuclease coupled to catalytically dead Cas9 (Figure 5A-C). ChIP assays were used to detect chromatin events around the DSB sites (Figure 5D, H). A significant portion of the cells appear to repair the DSB over 24 hours (data not shown). Enrichment of γΗ2ΑΧ, CHD4, DNMT1, DNMT3A, DNMT3B, EZH2 and G9a are increased in the vicinity of the induced DSB site (Figures 5E, I). Also, 5mc is significantly increased near the DSB site at the endogenous promoters of all TSGs and there is enrichment of the repressive marks H3K27me3 and H3K9me2 and decreases in the active marks H3K4me3 and H4K16ac in the vicinity of DSB's in the promoters of the eight genes (Figures 5F, J), and this is accompanied by reduction of nascent RNA transcription in each gene (Figure 5M).
[0180] As for all of the chromatin events associated in the previous sections, it was found that CHD4 also has an upstream role for those investigated in this section (Figure 5L). Thus, in the vicinity of the induced promoter DSB sites, CHD4 knockdown decreases DSB-induced recruitment of epigenetic silencing proteins (DNMT1, DNMT3A, DNMT3B, EZH2 and G9a), reduces accumulation of 5mc and the repressive marks H3K27me3 and H3K9me2 (Figures 5G, K), and negates the DSB-induced reduction in nascent RNA transcription of the eight examined TSGs (Figure 5M). Taken together, these studies suggest that CHD4- mediated recruitment of epigenetic silencing proteins plays a critical role in DSB damage- induced TSG silencing.
[0181] Next, it was determined whether the NuRD components HDAC1 and 2 are involved in the epigenetic silencing mediated by CHD4 at damage sites and at TSGs.
Recruitment of both endogenous HDAC1 and HDAC2 to DNA damage sites occur as early as 1 min after microirradiation and accumulates at the DNA damage sites for at least 15 min. However, CHD4 knockdown leads to a dramatic reduction of this recruitment (data not shown). In the Dox-inducible DSB system, the enrichment of both HDAC1 and 2 are significantly increased near the DSB sites at the endogenous promoters of eight TSGs, whereas CHD4 knockdown decreases DSB-induced recruitment of HDAC1 and 2 (data not
shown). Furthermore, double knockdown of HDACl and 2 reactivates the expression of these TSGs in two CRC cell lines (data not shown). These studies suggest that HDACl and 2 are involved in the epigenetic silencing mediated by CHD4 at damage sites and at TSGs.
[0182] It was also found that CHD4 is involved upstream in the recruitment of epigenetic silencing proteins to promoter CpG islands following oxidative DNA damage. After H2O2 treatment, ChIP for epigenetic silencing proteins at the promoter CpG islands of the above eight TSGs (data not shown), but not in non-CpG island-containing gene promoters (IL-8 and Nanog) (data not shown), identified enrichment of the ROS damage product, 8-OHdG, along with CHD4, DNMT1, DNMT3A, DNMT3B, EZH2, and G9a. The enrichment of 5mc and repressive markers H3K27me3 and H3K9me2 are also differentially increased, whereas the active marks H3K4me3 and H4K16ac are decreased in these same regions. Again, knockdown of CHD4 reduces the H202-induced enrichment of the epigenetic silencing proteins as well as blunting enrichment of 5mc and the repressive marks, H3K27me3 and H3K9me2 (data not shown). This knockdown also relieves the H202-induced reduction in nascent RNA transcription of the eight TSGs (data not shown). In addition, H2O2 treatment significantly decreased the nascent RNA transcription of promoter CpG island-containing genes with high expression (MYC, ACTB, RPL13, and RPL10A), and knockdown of CHD4 also relieve the H202-induced reduction in nascent RNA transcription of these genes.
However, H2O2 treatment did not affect the nascent RNA transcription of non-CpG island- containing genes (IL-8, HBD, MYH1, and LAMB4) (data not shown).
EXAMPLE 7
[0183] The recruitment of CHD4 to oxidative DNA damage sites depends on OGG1.
[0184] Reciprocal endogenous co-immunoprecipitations showed that CHD4 interacts with OGG1. H202-induced oxidative damage dramatically increases their interaction.
Knockout of OGG1 significantly decreased the tightness of binding of CHD4 to chromatin after H2O2 treatment, whereas over-expression of OGG1 rescued the decreased binding of CHD4 to chromatin induced by OGG1 knockout (data not shown). These studies suggested that oxidative damage-induced increase in affinity of CHD4 for chromatin is dependent on OGG1. In contrast, knockdown of CHD4 had no significant effect on the oxidative damage- induced increase in affinity of OGG1 for chromatin (data not shown).
[0185] To further confirm that OGGl and CHD4 interact physically, we performed pull down assays using purified OGGl and CHD4 proteins. The pull down assays showed that OGGl directly interacts with CHD4 (data not shown). 8-OHdG was added to the pull down assay buffer and did not affect the OGGl and CHD4 interaction, suggesting that this interaction is not DNA-dependent (data not shown). In addition, the 8-OHdG oligonucleotide could pull down CHD4 protein in the presence of OGGl, whereas the 8-OHdG
oligonucleotide could not pull down CHD4 in the absence of OGGl, suggesting that CHD4 binds 8-OHdG oligonucleotide by interacting with OGGl (data not shown).
[0186] ChIP assays showed that knockout of OGGl reduced the H202-induced enrichment of CHD4 at the promoter CpG islands of eight TSGs, indicating that OGGl is important for CHD4 recruitment (data not shown). Sequential ChIP assays, using antibody against CHD4 in the first immunoprecipitation followed by another pulldown with the antibody against 8-OHdG, demonstrated the co-occupancy of CHD4 and 8-OHdG at the promoter CpG islands of eight TSGs after H202-induced oxidative damage (data not shown). Furthermore, knockout of OGGl also relieves the H202-induced reduction in nascent RNA transcription of the eight TSGs (data not shown). Taken together, these studies suggested that the recruitment of CHD4 to the promoter CpG islands of eight TSGs after oxidative damage is dependent on OGGl .
[0187] TABLE 6: Primers for ChIP in H2O2 treatment induced oxidative DNA Damage
Gene Name Sequence
CDHl sense: GTCTATGCGAGGCCGGGT (SEQ ID NO: 196)
CDH1 antisense: AGTTCCGACGCCACTGAG (SEQ ID NO: 197)
WIF1 sense: CTGCCATCGGCACCATCG (SEQ ID NO: 198)
WIF1 antisense: GATGATGATGATGAGGTG (SEQ ID NO: 199)
TIMP2 sense: TCGCCTGGTGTCCTGGAA (SEQ ID NO: 200)
TIMP2 antisense: TTGTGCCCGGCCTGGCAC (SEQ ID NO: 201)
TIMP3 sense: GAGCTCTGTCAGCCATGG (SEQ ID NO: 202)
TIMP3 antisense: ATCCTCGCTGAGAAGTGG (SEQ ID NO: 203)
MLH1 sense: CTCGTCGACTTCCATCTT (SEQ ID NO: 204)
MLH1 antisense CTCTGCTGAGGTGATCTG (SEQ ID NO: 205)
CDKN2A sense: AGGACTCGGTGCTTGTCC (SEQ ID NO: 206)
CDKN2A antisense: CCGCTCCTCTTCTAGATT (SEQ ID NO: 207)
SFRP4 sense: ACAACTGCCAGAGGTTCT (SEQ ID NO: 208)
SFRP4 antisense: CCTTGGCAGCTGCAGCCG (SEQ ID NO: 209)
SFRP5 sense: TGCGGCAGGGGAGCCGAG (SEQ ID NO: 210)
SFRP5 antisense: GACTGATCCTGGCGCCTC (SEQ ID NO: 211)
[0188] To further test our proposition that CHD4 and 8-OHdG or epigenetic silencing proteins function in the same protein complex at the promoter CpG islands of TSGs, sequential ChIP experiments were performed in a series of fresh frozen CRC samples. In these experiments, soluble chromatins were first immunoprecipitated with antibody against CHD4. The immunoprecipitates were subsequently re-immunoprecipitated with antibodies against 8-OHdG or epigenetic silencing proteins. The results showed that, in precipitates, the eight TSGs promoters that were immunoprecipitated with antibody against CHD4 could be individually re-immunoprecipitated with antibodies against 8-OHdG, DNMT1, DNMT3A, DNMT3B, EZH2, or G9a (data not shown). These results suggested that CHD4 and 8-OHdG or epigenetic silencing proteins co-occupy the promoter CpG islands of eight TSGs in human CRC.
EXAMPLE 8
[0189] Correlations of 8-OHdG levels, recruitment of repressive chromatin and DNA methylation at the promoters of TSG's in primary CRC.
[0190] The inventors' previous cell culture studies for ROS exposure on recruitment of 8- OHdG to gene promoter CpG islands, silencing of transcription, and recruitment of DNMT1 and EZH2 (O'Hagan et al, 2011), and the present findings, when examined in a large, well characterized cohort of patients with CRC (data not shown) can be translated in clinically important ways. In ChIP assays, performed in a series of fresh frozen CRC samples, for promoter regions of the above examined eight genes, there is a distinct enrichment of epigenetic silencing proteins (CHD4, DNMT1, DNMT3A, DNMT3B, EZH2, and G9a) and the oxidative damage marker, 8-OHdG as compared to normal colon epithelial tissues (data not shown). Furthermore, this enrichment is greater for the repressive proteins in CRC tissues with positive versus negative 8-OHdG in the above regions (data not shown). In addition, CHD4 enrichment is positively associated with the enrichment of other epigenetic silencing proteins (DNMT1, DNMT3A, DNMT3B, EZH2, and G9a) at the promoter CpG islands of the eight genes in human CRC tissues (data not shown). These studies then suggest that the correlations we are seeing in cell culture studies between ROS induced damage and recruitment of repressive chromatin to gene promoter CpG islands are not limited to in vitro studies but appear in primary CRC.
[0191] Importantly, the immediately above findings have important prognostic implications for patients with CRC. In CRC samples from over 300 patients, levels of 8- OHdG, as determined by immunohistochemistry are positively correlated with aggressive tumor behavior and poor prognosis (data not shown). Moreover, both negative expression of the above eight genes and accompanying increased DNA methylation in their promoter regions, are also associated with these more aggressive-associated, poor prognosis parameters (Figures 6C, F, I). Finally, high expression of 8-OHdG is significantly correlated with the negative expression of the eight TSGs and the methylation of their gene promoters, as assessed by the MSP PCR assay (Figures 6A, B, D, E, G, H, J and K), and these relationships correlate with poorer prognosis (Figures 6C, F, I, and L). With regards to the methylation of the eight genes being inversely correlated with the expression of these genes (data not shown), patients with positive tumor 8-OHdG expression, and hypermethylation and silencing of the TSG's have the highest recurrence rates and shortest overall survival times (Figures 6C, F, I, and L).
[0192] Several additional relationships of translational importance for CHD4 emerge in parallel with the changes in the above large cohort. First, in 120 paired CRC tissues, the mRNA levels of CHD4 are significantly up-regulated in CRC tissues as compared to adjacent non-tumor tissues and normal colon epithelial tissues (Figure 7A). Second, patients with recurrence of CRC (69 of 120) have higher CHD4 mRNA expression than patients without recurrence (51 of 120) (Figure 7A). Third, CHD4 mRNA expression is much higher in primary CRC tissues from patients who developed metastases than in primary CRC tissues from patients who did not (Figure 7A). In primary and metastatic CRC for 20 pairs of specimens, CHD4 mRNA expression is much higher in the metastatic versus primary CRC tissues (Figure 7A).
[0193] The inventive findings are extended when the immunohistochemistry studies of CHD4 protein expression are examined by tissue microarrays from 363 CRC patients.
Nuclear levels of the protein are distinctly up-regulated in tumor tissues than in adjacent non- tumor tissues (Figure 7B). This protein over-expression significantly correlates with poorer tumor differentiation, higher tumor-nodule-metastases (TNM) stage and AJCC stage (data not shown), shorter overall survival times and higher recurrence rates (Figure 7C). CHD4 protein expression, in multi-variant analyses is an independent and significant risk factor for recurrence and reduced survival (Table 7). Taken together, these studies suggest that a
history of high DNA damage with involvement of the events for CHD4 of the present study, is associated with increased aggressiveness of CRC.
[0194] TABLE 7: Multivariate analysis of factors associated with survival and recurrence of 363 human CRCs.
[0195] Finally, a particularly compelling clinical prognosis profile emerges when many of the parameters above are fully linked together. The CHD4 over-expression is positively correlated with the promoter hypermethylation of the eight selected TSGs and inversely correlated with their expression in CRC tissues (Figures 7D-K). When CRC tumors are divided into four groups based on these parameters, those with positive CHD4 expression and promoter hypermethylation and low expression of the eight genes have the highest recurrence rates and shortest overall survival times (Figures 7D-K).
EXAMPLE 9
[0196] In a series of final studies, key roles in the biology of CRC for CHD4 and the interactions we have outlined for selected genes are defined in all the work in the current studies. Further, these roles explain why the relationships between CHD4, ROS damage and gene silencing have the prognostic implications seen in the preceding section. Overall, it was found that CHD4 is involved in the ability of CRC cells to proliferate, invade, and colonize the lung and metastasize to the liver and this is partially dependent on the role of CHD4 in silencing of the above eight candidate TSG's studied in previous sections.
[0197] SW620 and LoVo CRC served for the studies as they have, as analyzed by Realtime PCR, westem blot analyses, and ELISA assays very low levels of all eight of the genes being examined. Knockdown of CHD4 increases the expression of all eight genes in both cell lines (data not shown). Among the genes, CDH1, WIF1, TIMP2, and TIMP3 are important in invasion and metastases and they were found to be drivers in mediating a role for CHD4 in this key aspect of tumor biology. Both SW620 and LoVo cells are known to have high invasion and metastatic capabilities (Drewinko et al, 1976; McNutt et al, 1981). Knockdown of CHD4 robustly decreases the migration and invasion of SW620 and LoVo cells in in vitro assays (Figure 8A). Simultaneous, highly efficient knockdown of the above eight genes, as shown by westem blot or ELISA assays (data not shown), can significantly rescue these CHD4 knockdown effects. Particularly, decreases in E-cadherin and WIF1 decrease migration and invasion abilities induced by CHD4 knockdown. Knockdown of TIMP2 and TIMP3 have no significant effect on the decreased migration abilities induced by CHD4 knockdown, but this rescues the decreased invasion abilities induced by CHD4 knockdown (Figure 8A).
[0198] Most important, in tail vein injection assays of the CRC cells, which lead to colonization of the cells in the lung (Figures 8B-G), and assays of the metastatic capacity to liver of cells implanted in the spleen (Figures 8H-M), knockdown of CHD4 significantly decreases the incidence of both activities while increasing the overall survival time of the mice versus in SW620-shcontrol and LoVo-shcontrol cells. Knockdown of E-cadherin, WIF1, TIMP2, and TIMP3 individually each partially rescues the decreased incidence of metastatic lung nodules and of metastatic liver lesions while decreasing the overall survival time of the SW620-CHD4 KD and LoVo-CHD4 KD groups (Figure 8B-M). These studies strongly suggest an important role of CHD4 in mediating lung colonization and metastatic capacity of CRC cells in these studies and which are facilitated by its role in mediating the silencing of E-cadherin, WIF1, TIMP2, and TIMP3.
[0199] Next, it was found that MLHl, pl6, SFRP4, and SFRP5 are involved in proliferation, viability, ability to clone in soft agar, and tumorigenic potential of the CRC cells studied above. Knockdown of CHD4 decreases proliferation and anchorage- independent growth of SW620 and LoVo cells as seen in MTT, colony formation, and soft agar colony formation assays. Simultaneous knockdown of MLHl, pl6, SFRP4, and SFRP5 each individually partially rescues these above decreased proliferation and anchorage- independent growth effects induced by CHD4 knockdown (data not shown). In vivo
tumorigenicity assays show that knockdown of CHD4 significantly decreases tumor growth of SW620 and LoVo cells, whereas simultaneous knockdown to prevent up-regulation of MLHl, pl6, SFRP4, and SFRP5 individually rescues the decreased tumor growth induced by CHD4 knockdown (data not shown). These studies suggest that CHD4-mediated silencing of the above genes promotes colon cancer proliferation and tumorigenic properties. The studies also define, for the CRC cells studies, a driver, TSG role for the DNA hyper-methylated and epigenetically silenced genes studied.
[0200] The inventors' findings for CHD4 may account for their findings in a large subset of patients with CRC. There is surprisingly strong correlation for levels of CHD4, 8-OHdG, and silencing of target TSGs to the recurrence rate of tumors after initial surgery, for reduction in overall patient survival and for presence of metastases. In turn, these results are important for considering biomarker strategies to monitor the clinical behavior of CRC. It is clear that CHD4 plays a role in ongoing silencing and blocking induction of these genes. Possibly this reflects ongoing damage repair at these loci in cancer cells but this must be further determined. The present data suggest that developing inhibitors for this function of CHD4 might be an excellent strategy to consider for cancer management. Important for any such drug development is our finding for the key role of the helicase domain of CHD4 for its mediation of abnormal epigenetic events as this presents a potentially target for drug intervention.
[0201] All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.
[0202] The use of the terms "a" and "an" and "the" and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms "comprising," "having," "including," and "containing" are to be construed as open-ended terms (i.e., meaning "including, but not limited to,") unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or
otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as") provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.
[0203] Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.
[0204] References
Baker, D. J., Childs, B. G., Durik, M., Wijers, M. E., Sieben, C. I, Zhong, J., Saltness, R. A.,
Jeganathan, K. B., Verzosa, G. C, Pezeshki, A., et al. (2016). Naturally occurring pl6
(Ink4a)-positive cells shorten healthy lifespan. Nature 530, 184-189.
Baylin, S. B., and Jones, P. A. (2016). Epigenetic Determinants of Cancer. Cold
Spring Harbor perspectives in biology 8.
Becker, P. B., and Horz, W. (2002). ATP-dependent nucleosome remodeling. Annual review of biochemistry 71, 247-273.
Bernstein, B. E., Mikkelsen, T. S., Xie, X., Kamal, M., Huebert, D. I, Cuff, I, Fry, B.,
Meissner, A., Wemig, M., Plath, K., et al. (2006). A bivalent chromatin structure marks key developmental genes in embryonic stem cells. Cell 125, 315-326.
Cai, Y., Geutjes, E. J., de Lint, K., Roepman, P., Bruurs, L., Yu, L. R., Wang, W., van
Blijswijk, J., Mohammad, H., de Rink, I., et al. (2014). The NuRD complex cooperates with
DNMTs to maintain silencing of key colorectal tumor suppressor genes. Oncogene 33, 2157-
2168.
Chou, D. M., Adamson, B., Dephoure, N. E., Tan, X., Nottke, A. C, Hurov, K. E.,
Gygi, S. P., Colaiacovo, M. P., and Elledge, S. J. (2010). A chromatin localization screen reveals poly (ADP ribose)-regulated recruitment of the repressive poly comb and NuRD
complexes to sites of DNA damage. Proceedings of the National Academy of Sciences of the United States of America 107, 18475-18480.
de Dieuleveult, M., Yen, K., Hmitou, I., Depaux, A., Boussouar, F., Bou Dargham, D., Jounier, S., Humbertclaude, H., Ribierre, F., Baulard, C, et al. (2016). Genome-wide nucleosome specificity and function of chromatin remodellers in ES cells. Nature 530, 113- 116.
Ding, N., Bonham, E. M., Hannon, B. E., Amick, T. R., Baylin, S. B., and O'Hagan, H. M. (2016). Mismatch repair proteins recruit DNA methyltransferase 1 to sites of oxidative DNA damage. Journal of molecular cell biology 8, 244-254.
Baker, D. J., Childs, B. G., Durik, M., Wijers, M. E., Sieben, C. I, Zhong, I, Saltness, R. A., Jeganathan, K. B., Verzosa, G. C, Pezeshki, A., et al. (2016). Naturally occurring pl6(Ink4a)- positive cells shorten healthy lifespan. Nature 530, 184-189.
Baylin, S. B., and Jones, P. A. (2016). Epigenetic Determinants of Cancer. Cold Spring Harbor perspectives in biology 8.
Becker, P. B., and Horz, W. (2002). ATP-dependent nucleosome remodeling. Annual review of biochemistry 71, 247-273.
Bernstein, B. E., Mikkelsen, T. S., Xie, X., Kamal, M., Huebert, D. J., Cuff, J., Fry, B., Meissner, A., Wernig, M., Plath, K., et al. (2006). A bivalent chromatin structure marks key developmental genes in embryonic stem cells. Cell 125, 315-326.
Cai, Y, Geutjes, E. J., de Lint, K., Roepman, P., Bruurs, L., Yu, L. R., Wang, W., van Blijswijk, J., Mohammad, H., de Rink, I., et al. (2014). The NuRD complex cooperates with DNMTs to maintain silencing of key colorectal tumor suppressor genes. Oncogene 33, 2157-2168. Chou, D. M., Adamson, B., Dephoure, N. E., Tan, X., Nottke, A. C, Hurov, K. E., Gygi, S. P., Colaiacovo, M. P., and Elledge, S. J. (2010). A chromatin localization screen reveals poly (ADP ribose)-regulated recruitment of the repressive polycomb and NuRD complexes to sites of DNA damage. Proceedings of the National Academy of Sciences of the United States of America 107, 18475-18480.
de Dieuleveult, M., Yen, K., Hmitou, I., Depaux, A., Boussouar, F., Bou Dargham, D., Jounier, S., Humbertclaude, H., Ribierre, F., Baulard, C, et al. (2016). Genome-wide nucleosome specificity and function of chromatin remodellers in ES cells. Nature 530, 113-116.
Ding, N., Bonham, E. M., Hannon, B. E., Amick, T. R., Baylin, S. B., and O'Hagan, H. M. (2016). Mismatch repair proteins recruit DNA methyltransferase 1 to sites of oxidative DNA damage. Journal of molecular cell biology 8, 244-254.
Easwaran, H., Johnstone, S. E., Van Neste, L., Ohm, J., Mosbruger, T., Wang, Q., Aryee, M. J., Joyce, P, Ahuja, N., Weisenberger, D., et al. (2012). A DNA hypermethylation module for the stem/progenitor cell signature of cancer. Genome research 22, 837-849.
Fu, J., Qin, L., He, T., Qin, J., Hong, J., Wong, J., Liao, L., and Xu, J. (2011). The TWIST/Mi2/NuRD protein complex and its essential role in cancer metastasis. Cell research 27, 275-289.
Gong, F., Chiu, L. Y, Cox, B., Aymard, F., Clouaire, T, Leung, J. W, Cammarata, M., Perez, M., Agarwal, P., Brodbelt, J. S., et al. (2015). Screen identifies bromodomain protein ZMYND8 in chromatin recognition of transcription-associated DNA damage that promotes homologous recombination. Genes & development 29, 197-211.
Grivennikov, S. I., Greten, F. R., and Karin, M. (2010). Immunity, inflammation, and cancer. Cell 140, 883-899.
Guillemette, S., Serra, R. W, Peng, M., Hayes, J. A., Konstantinopoulos, P. A., Green, M. R., and Cantor, S. B. (2015). Resistance to therapy in BRCA2 mutant cells due to loss of the nucleosome remodeling factor CHD4. Genes & development 29, 489-494.
Hansen, K. H., Bracken, A. P., Pasini, D., Dietrich, N., Gehani, S. S., Monrad, A., Rappsilber, J., Lerdrup, M., and Helin, K. (2008). A model for transmission of the H3K27me3 epigenetic mark. Nature cell biology 10, 1291-1300.
Helbling Chadwick, L., Chadwick, B. P., Jaye, D. L., and Wade, P. A. (2009). The Mi-2/NuRD
complex associates with pericentromeric heterochromatin during S phase in rapidly proliferating lymphoid cells. Chromosoma 118, 445-457.
Janzen, V., Forkert, R., Fleming, H. E., Saito, Y, Waring, M. T., Dombkowski, D. M., Cheng, T., DePinho, R. A., Sharpless, N. E., and Scadden, D. T. (2006). Stem-cell ageing modified by the cyclin-dependent kinase inhibitor pl6INK4a. Nature 443, 421-426.
Lai, A. Y, and Wade, P. A. (2011). Cancer biology and NuRD: a multifaceted chromatin remodelling complex. Nat Rev Cancer 11, 588-596.
Larsen, D. H., Poinsignon, C, Gudjonsson, T., Dinant, C, Payne, M. R., Hari, F. J., Rendtlew Danielsen, J. M., Menard, P., Sand, J. C, Stucki, M., et al. (2010). The chromatin-remodeling factor CHD4 coordinates signaling and repair after DNA damage. The Journal of cell biology 190, 731-740.
Nio, K., Yamashita, T, Okada, H., Kondo, M., Hayashi, T, Hara, Y, Nomura, Y, Zeng, S. S., Yoshida, M., Sunagozaka, H., et al. (2015). Defeating EpCAM(+) liver cancer stem cells by targeting chromatin remodeling enzyme CHD4 in human hepatocellular carcinoma. J Hepatol 63, 1164-1172.
O'Hagan, H. M., Mohammad, H. P., and Baylin, S. B. (2008). Double strand breaks can initiate gene silencing and SIRTl -dependent onset of DNA methylation in an exogenous promoter CpG island. PLoS genetics 4, el000155.
O'Hagan, H. M., Wang, W, Sen, S., Destefano Shields, C, Lee, S. S., Zhang, Y. W., Clements, E. G., Cai, Y, Van Neste, L., Easwaran, H., et al. (2011). Oxidative damage targets complexes containing DNA methyltransferases, SIRTl, and poly comb members to promoter CpG Islands. Cancer cell 20, 606-619.
Ohm, J. E., McGarvey, K. M., Yu, X., Cheng, L., Schuebel, K. E., Cope, L., Mohammad, H. P., Chen, W., Daniel, V. C, Yu, W, et al. (2007). A stem cell-like chromatin pattern may predispose tumor suppressor genes to DNA hypermethylation and heritable silencing. Nat
Genet 39, 237-242.
Pan, M. R, Hsieh, H. I, Dai, H., Hung, W. C, Li, K., Peng, G., and Lin, S. Y. (2012). Chromodomain helicase DNA-binding protein 4 (CHD4) regulates homologous recombination DNA repair, and its deficiency sensitizes cells to poly(ADP-ribose) polymerase (PARP) inhibitor treatment. The Journal of biological chemistry 287, 6764-6772.
Pierce, A. J., Johnson, R. D., Thompson, L. H., and Jasin, M. (1999). XRCC3 promotes homology-directed repair of DNA damage in mammalian cells. Genes Dev 13, 2633-2638. Polo, S. E., Kaidi, A., Baskcomb, L., Galanty, Y, and Jackson, S. P. (2010). Regulation of DNA-damage responses and cell-cycle progression by the chromatin remodelling factor CHD4. EMBO J 29, 3130-3139.
Radicella, J. P., Dherin, C, Desmaze, C, Fox, M. S., and Boiteux, S. (1997). Cloning and characterization of hOGGl , a human homolog of the OGG1 gene of Saccharomy ces cerevisiae. Proceedings of the National Academy of Sciences of the United States of America 94, 8010- 8015.
Ray Chaudhuri, A., Callen, E., Ding, X., Gogola, E., Duarte, A. A, Lee, J. E., Wong, N., Lafarga, V., Calvo, J. A., Panzarino, N. J., et al. (2016). Replication fork stability confers chemoresistance in BRCA-deficient cells. Nature 535, 382-387.
Reuter, S., Gupta, S. C, Chaturvedi, M. M., and Aggarwal, B. B. (2010). Oxidative stress, inflammation, and cancer: how are they linked? Free Radic Biol Med 49, 1603-1616.
Schuebel, K. E., Chen, W, Cope, L., Glockner, S. C, Suzuki, H., Yi, J. M., Chan, T. A., Van Neste, L., Van Criekinge, W, van den Bosch, S., et al. (2007). Comparing the DNA hypermethylome with gene mutations in human colorectal cancer. PLoS genetics 3, 1709-1723. Scott, T. L., Rangaswamy, S., Wicker, C. A., and Izumi, T. (2014). Repair of oxidative DNA damage and cancer: recent progress in DNA base excision repair. Antioxid Redox Signal 20, 708-726.
Shanbhag, N. M., Rafalska-Metcalf, I. U., Balane-Bolivar, C, Janicki, S. M., and Greenberg, R. A. (2010). ATM-dependent chromatin changes silence transcription in cis to DNA double- strand breaks. Cell 141, 970-981.
Shen, H., and Laird, R W. (2013). Interplay between the cancer genome and epigenome. Cell 153, 38-55.
Shinkai, Y, and Tachibana, M. (2011). H3K9 methyltransferase G9a and the related molecule GLP. Genes & development 25, 781-788.
Sperlazza, J., Rahmani, M., Beckta, J., Aust, M., Hawkins, E., Wang, S. Z., Zu Zhu, S., Podder, S., Dumur, C, Archer, K., etal. (2015). Depletion of the chromatin remodeler CHD4 sensitizes AML blasts to genotoxic agents and reduces tumor formation. Blood 126, 1462-1472.
Sulli, G, Di Micco, R., and d'Adda di Fagagna, F. (2012). Crosstalk between chromatin state and DNA damage response in cellular senescence and cancer. Nat Rev Cancer 12, 709-720. Suzuki, H., Watkins, D. N., Jair, K. W., Schuebel, K. E., Markowitz, S. D., Chen, W. D., Pretlow, T. P., Yang, B., Akiyama, Y, Van Engeland, M., et al. (2004). Epigenetic inactivation of SFRP genes allows constitutive WNT signaling in colorectal cancer. Nature genetics 36, 417-422.
Tong, J. K., Hassig, C. A., Schnitzler, G. R, Kingston, R. E., and Schreiber, S. L. (1998). Chromatin deacetylation by an ATP-dependent nucleosome remodelling complex. Nature 395, 917-921.
van Engeland, M., Derks, S., Smits, K. M., Meijer, G. A., and Herman, J. G. (2011). Colorectal cancer epigenetics: complex simplicity. J Clin Oncol 29, 1382-1391.
Xie, W., Ling, T., Zhou, Y, Feng, W., Zhu, Q., Stunnenberg, H. G, Grummt, I., and Tao, W. (2012). The chromatin remodeling complex NuRD establishes the poised state of rRNA genes characterized by bivalent histone modifications and altered nucleosome positions. Proceedings of the National Academy of Sciences of the United States of America 109, 8161-8166.
Yu, D. H., Waterland, R. A., Zhang, P., Schady, D., Chen, M. H., Guan, Y, Gadkari, M., and Shen, L. (2014). Targeted pl6(Ink4a) epimutation causes tumorigenesis and reduces survival in mice. The Journal of clinical investigation 124, 3708-3712.
Zhang, Y. W, Wang, Z., Xie, W, Cai, Y, Xia, L., Easwaran, H., Luo, J., Yen, R. C, Li, Y, and Baylin, S. B. (2017). Acetylation Enhances TET2 Function in Protecting against Abnormal DNA Methylation during Oxidative Stress. Molecular cell 65, 323-335.
Claims
1. Use of chromodomain helicase DNA-binding protein 4 (CHD4) and 8-hydroxy-2' - deoxyguanosine (8-OHdG) as a marker for a tumor of colorectal origin of a subject as having a high probability of disease recurrence and decreased overall survival level, when the expression of the CHD4 marker and the amount of 8-OHdG in a sample from the tumor of the subject in a sample from the subject is increased compared to one or more control colorectal samples.
2. A composition for diagnosing, detecting, monitoring or prognosticating high probability of disease recurrence and decreased overall survival level of colorectal cancer or the progression towards disease recurrence and decreased overall survival level colorectal cancer, comprising a nucleic acid affinity ligand and/or a peptide affinity ligand for the CHD4 expression product or protein and a 8-OHdG peptide affinity ligand.
3. The composition of 2, wherein said nucleic acid affinity ligand or peptide affinity ligand is modified to function as a contrast agent.
4. The composition of claim 2, wherein said affinity ligand is a set of oligonucleotides specific for the CHD4 expression product, a probe specific for the CHD4 expression product, an aptamer specific for the CHD4 expression product or for the CHD4 protein, an antibody specific for the CHD4 protein and/or an antibody variant specific for the CHD4 protein.
5. The composition of claim 2, wherein said 8-OHdG peptide affinity ligand is an antibody.
6. The use of claim 1, further comprising measuring the expression level of one or more of CDH1, WIF1, TIMP2, TIMP3, MLH1, CDK 2A, SFRP4, and SFRP5 genes in the sample from the subject and comparing the levels to the levels of one or more of CDH1, WIF1, TIMP2, TIMP3, MLH1, CDK 2A, SFRP4, and SFRP5 genes in one or more control colorectal samples; and diagnosing, monitoring, or prognosing a tumor of colorectal origin of a subject as having a high probability of disease recurrence and decreased overall survival level, when the expression of the CHD4 marker and the amount of 8-OHdG in a sample from the tumor of the subject in a sample from the subject is increased compared to one or more control colorectal samples, and the expression levels of more of CDH1, WIF1, TIMP2,
TIMP3, MLHl, CDK 2A, SFRP4, and SFRP5 genes in the sample from the subject are decreased compared to the expression levels of those genes in one or more control colorectal samples.
7. Use of CHD4, 8-OHdG, and one or more of CDH1, WIF1, TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, and SFRP5 genes as a marker for a tumor of colorectal origin of a subject as having a high probability of disease recurrence and decreased overall survival level, when the expression of the CHD4 marker and the amount of 8-OHdG in a sample from the tumor of the subject in a sample from the subject is increased compared to one or more control colorectal samples, and the methylation levels of the promoters of more of CDH1, WIF1, TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, and SFRP5 genes in the sample from the subject are increased compared to the methylation levels of the promoters of those genes in one or more control colorectal samples.
8. A method of screening an agent which inhibits mRNA expression of CHD4 in a cancer cell or population of cells, the method comprising:
(a) contacting a first cell or population of cells expressing CHD4 with a test agent;
(b) contacting a second cell or population of cells expressing CHD4 with a control agent;
(c) detecting the level of CHD4 mRNA expression in the first cell or
population of cells;
(d) detecting the level of CHD4 mRNA expression in the second cell or
population of cells;
(e) comparing the levels of mRNA expression of CHD4 from (c) and (d); and
(f) identifying the agent as an inhibitor of CHD4 when the mRNA expression in (c) is less than the mRNA expression in (d).
9. The method of claim 8, wherein the method for detecting mRNA expression is RT- PCR using the following primers and probes (SEQ ID NOS: 1-34, 212-213).
10. A method of screening an agent which inhibits expression of CHD4 protein in a cancer cell or population of cells, the method comprising:
a) contacting a first cell or population of cells expressing CHD4 with a test agent;
(b) contacting a second cell or population of cells expressing CHD4 with a control agent;
(c) detecting the level of CHD4 protein expression in the first cell or
population of cells;
(d) detecting the level of CHD4 protein expression in the second cell or
population of cells;
(e) comparing the levels of protein expression of CHD4 from (c) and (d); and
(f) identifying the agent as an inhibitor of CHD4 when the protein expression in (c) is less than the protein expression in (d).
11. The method of claim 10, wherein the method of detection is by Western blot of cell lysates of (c) and (d) using antibodies specific for CHD4 protein antigens.
12. The method of any of claims 8 to 11, wherein the level of expression of CHD4, and/or the level of expression of one or more of the following genes CDH1, WIF1, TIMP2, TIMP3, MLHl, CDK 2A, SFRP4, and SFRP5 is made using RT-PCR with the following primers and probes (SEQ ID NOS: 1-34, 212-213).
13. The method of any of claims 8 to 11, wherein the level of expression of CHD4, and/or the level of expression of one or more of the following genes CDH1, WIF1, TIMP2, TIMP3, MLHl, CDKN2A, SFRP4, and SFRP5 is made using Western blot of cell lysates with antibodies specific for the expressed proteins of the genes.
14. The method of any of claims 8 to 11, wherein the level of expression of CHD4, and the level of expression of one or more of the following genes CDH1, WIF1, TIMP2, TIMP3, MLHl, CDKN2A, SFRP4, and SFRP5 is made using an ELISA assay of cell lysates with antibodies specific for the expressed proteins of the genes.
15. The method of any of claims 12 to 13, wherein the level of expression of CHD4, is made using RT-PCR with the following primers and probes (SEQ ID NOS: 1-34, 212-213) and/or the level of methylation of one or more of the following genes CDH1, WIF1, TIMP2, TIMP3, MLHl, CDKN2A, SFRP4, and SFRP5 is made using methylation specific PCR with the following primers and probes (SEQ ID NOS: 168-195).
16. A method for treating a subject having colorectal cancer comprising administering to the subject a pharmaceutical composition comprising an effective amount of an agent which inhibits expression of CHD4 in a cell or population of cells and a pharmaceutically acceptable carrier.
17. The use of either of claims 1, 6, or 7, wherein the method for detecting mRNA expression is RT-PCR using the following primers and probes (SEQ ID NOS: 1-34, 212- 213).
18. The use of either of claims 1, 6, or 7, wherein the method of detection is by Western blot of cell lysates of (c) and (d) using antibodies specific for CHD4 protein antigens.
19. The use of either of claims 1, 6, or 7, wherein the level of expression of CHD4, and/or the level of expression of one or more of the following genes CDHl, WIFl, TIMP2, TIMP3, MLHl, CDKN2A, SFRP4, and SFRP5 is made using RT-PCR with the following primers and probes (SEQ ID NOS: 1-34, 212-213).
20. The use of either of claims 1, 6, or 7, wherein the level of expression of CHD4, and/or the level of expression of one or more of the following genes CDHl, WIFl, TIMP2, TIMP3, MLHl, CDKN2A, SFRP4, and SFRP5 is made using Western blot of cell lysates with antibodies specific for the expressed proteins of the genes.
21. The use of either of claims 1, 6, or 7, wherein the level of expression of CHD4, and the level of expression of one or more of the following genes CDHl, WIFl, TIMP2, TIMP3, MLHl, CDKN2A, SFRP4, and SFRP5 is made using an ELISA assay of cell lysates with antibodies specific for the expressed proteins of the genes.
22. The use of claim 7, wherein the level of expression of CHD4, is made using RT- PCR with the following primers and probes (SEQ ID NOS: 1-34, 212-213) and/or the level of methylation of one or more of the following genes CDHl, WIFl, TIMP2, TIMP3, MLHl, CDKN2A, SFRP4, and SFRP5 is made using methylation specific PCR with the following primers and probes (SEQ ID NOS: 168-195).
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201762490887P | 2017-04-27 | 2017-04-27 | |
| US62/490,887 | 2017-04-27 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2018200889A1 true WO2018200889A1 (en) | 2018-11-01 |
Family
ID=63920122
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2018/029682 Ceased WO2018200889A1 (en) | 2017-04-27 | 2018-04-27 | Oncogene chd4 and uses thereof in the diagnosis and treatment of cancer |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2018200889A1 (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110279704A (en) * | 2019-07-30 | 2019-09-27 | 南京师范大学 | Adriamycin drug and its application |
| US20220304990A1 (en) * | 2021-03-16 | 2022-09-29 | Bioventures, Llc | Mi-2beta Inhibitor as an Immunotherapy Agent |
| WO2023215235A3 (en) * | 2022-05-03 | 2024-01-25 | The Regents Of The University Of California | Peptide inhibitors for chromodomain helicase dna binding protein 4 (chd4) |
| WO2024259431A3 (en) * | 2023-06-16 | 2025-01-16 | The Regents Of The University Of California | Small peptide (vgn73) derived from kshv lana protein inhibits leukemic cell growth |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030108926A1 (en) * | 2000-03-15 | 2003-06-12 | Eos Biotechnology, Inc. | Novel methods of diagnosing colorectal cancer, compositions, and methods of screening for colorectal cancer modulators |
| US20160160213A1 (en) * | 2013-03-14 | 2016-06-09 | Genentech, Inc. | Methods of treating cancer and preventing cancer drug resistance |
-
2018
- 2018-04-27 WO PCT/US2018/029682 patent/WO2018200889A1/en not_active Ceased
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030108926A1 (en) * | 2000-03-15 | 2003-06-12 | Eos Biotechnology, Inc. | Novel methods of diagnosing colorectal cancer, compositions, and methods of screening for colorectal cancer modulators |
| US20160160213A1 (en) * | 2013-03-14 | 2016-06-09 | Genentech, Inc. | Methods of treating cancer and preventing cancer drug resistance |
Non-Patent Citations (9)
| Title |
|---|
| AMIOT A. ET AL.: "The Detection of the Methylated Wif-1 Gene Is More Accurate than a Fecal Occult Blood Test for Colorectal Cancer Screening", PLOS ONE, vol. 9, no. 7, 2014, XP055536049 * |
| CAI Y. ET AL.: "The NuRD complex cooperates with DNMTs to maintain silencing of key colorectal tumor suppressor genes", ONCOGENE, vol. 33, no. 17, April 2014 (2014-04-01), pages 2157 - 2168, XP055536016 * |
| HONG YU ET AL.: "The mRNA level of MLH1 in peripheral blood is a biomarker for the diagnosis of hereditary nonpolyposis colorectal cancer", AM J CANCER RES, vol. 6, no. 5, May 2016 (2016-05-01), pages 1135 - 1140, XP055536035 * |
| HUANG D. ET AL.: "SFRP4 was overexpressed in colorectal carcinoma", J CANCER RES CLIN ONCOL., vol. 136, no. 3, March 2010 (2010-03-01), pages 395 - 401, XP055536037 * |
| KAZUYA MAEDA ET AL.: "Hypermethylation of the CDKN2A gene in colorectal cancer is associated with shorter survival", ONCOLOGY REPORTS, vol. 10, no. 4, August 2003 (2003-08-01), pages 935 - 938, XP055536044 * |
| MIN SUNG KIM ET AL.: "Genetic and expressional alterations of CHD genes in gastric and colorectal cancers", HISTOPATHOLOGY, vol. 58, no. 5, April 2011 (2011-04-01), pages 660 - 668, XP055419302 * |
| OFFENBERG H. ET AL.: "TIMP-1 expression in human colorectal cancer is associated with TGF-B 1, LOXL2, INHBA1, TNF-AIP6 and TIMP-2 transcript profiles", MOLECULAR ONCOLOGY, vol. 2, no. 3, October 2008 (2008-10-01), pages 233 - 240, XP025475230 * |
| OLIVA M. R. ET AL.: "Genetic alterations and oxidative metabolism in sporadic colorec-tal tumors from a Spanish community", MOLECULAR CARCINOGENESIS, vol. 18, no. 4, April 1997 (1997-04-01), pages 232 - 243, XP055536010 * |
| SOVA H. ET AL.: "8-Hydroxydeoxyguanosine: a new potential independent prognostic factor in breast cancer", BRITISH JOURNAL OF CANCER, vol. 102, no. 6, March 2010 (2010-03-01), pages 1018 - 1023, XP055536020 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110279704A (en) * | 2019-07-30 | 2019-09-27 | 南京师范大学 | Adriamycin drug and its application |
| CN110279704B (en) * | 2019-07-30 | 2022-08-26 | 南京师范大学 | Adriamycin combined medicine and application thereof |
| US20220304990A1 (en) * | 2021-03-16 | 2022-09-29 | Bioventures, Llc | Mi-2beta Inhibitor as an Immunotherapy Agent |
| US12268674B2 (en) * | 2021-03-16 | 2025-04-08 | Bioventures, Llc | Mi-2β inhibitor as an immunotherapy agent |
| WO2023215235A3 (en) * | 2022-05-03 | 2024-01-25 | The Regents Of The University Of California | Peptide inhibitors for chromodomain helicase dna binding protein 4 (chd4) |
| WO2024259431A3 (en) * | 2023-06-16 | 2025-01-16 | The Regents Of The University Of California | Small peptide (vgn73) derived from kshv lana protein inhibits leukemic cell growth |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Xia et al. | CHD4 has oncogenic functions in initiating and maintaining epigenetic suppression of multiple tumor suppressor genes | |
| Yu et al. | CD73 on cancer-associated fibroblasts enhanced by the A2B-mediated feedforward circuit enforces an immune checkpoint | |
| Lappin et al. | Cancer-associated SF3B1 mutations confer a BRCA-like cellular phenotype and synthetic lethality to PARP inhibitors | |
| Tang et al. | miR-185 suppresses tumor proliferation by directly targeting E2F6 and DNMT1 and indirectly upregulating BRCA1 in triple-negative breast cancer | |
| Lai et al. | HDAC inhibition induces microRNA-182, which targets RAD51 and impairs HR repair to sensitize cells to sapacitabine in acute myelogenous leukemia | |
| JP2022050493A (en) | Inhibitor of Mutant Rad3-Related Protein Kinase (ATR) in Ataxia-telangiectasia for use in methods of treating cancer | |
| EP3004396B1 (en) | Compositions for the treatment of cancer | |
| Zhang et al. | Selective inhibition of the second bromodomain of BET family proteins results in robust antitumor activity in preclinical models of acute myeloid leukemia | |
| Yang et al. | DNMT3B overexpression by deregulation of FOXO3a-mediated transcription repression and MDM2 overexpression in lung cancer | |
| EP3020828A1 (en) | Method of predicting response of cancer to treatment | |
| WO2024189299A1 (en) | Inhibitors for treating solid tumours | |
| WO2018200889A1 (en) | Oncogene chd4 and uses thereof in the diagnosis and treatment of cancer | |
| Huang et al. | AKT1 interacts with DHX9 to mitigate R loop–induced replication stress in ovarian cancer | |
| CN117042767A (en) | Approaches to Treating Cancer Using STING Agonists | |
| JP2015529665A (en) | Aminoheteroaryl compounds as MTH1 inhibitors | |
| EP3959230A1 (en) | Cancer therapy by modifying neoantigen expression | |
| EP3436601A1 (en) | Cytidine deaminase expression level in cancer as a new therapeutic target | |
| CN115554405B (en) | Medicine containing endonuclease inhibiting function and anti-tumor application thereof | |
| US20200216906A1 (en) | Methods and compositions relating to the diagnosis and treatment of cancer | |
| Sui et al. | Protein Phosphatase 2A–dependent Mitotic hnRNPA1 Dephosphorylation and TERRA Formation Facilitate Telomere Capping | |
| US20210277395A1 (en) | Methods and compositions for modulating lncrnas and methods of treatment based on lncrna expression | |
| Duan et al. | Protein arginine methyltransferase 6 enhances immune checkpoint blockade efficacy via the STING pathway in MMR-proficient colorectal cancer | |
| Zhu et al. | Inhibition of AKT sensitizes Cancer cells to antineoplastic drugs by Downregulating flap endonuclease 1 | |
| US20190147975A1 (en) | Sf3b1 suppression as a therapy for tumors harboring sf3b1 copy loss | |
| Wang et al. | PARP inhibitor augments anti-tumor efficacy of DNMT inhibitor by inducing senescence in cholangiocarcinoma |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18792277 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 18792277 Country of ref document: EP Kind code of ref document: A1 |






