WO2018170299A1 - Inhibitors of prokaryotic gene transcription and uses thereof - Google Patents
Inhibitors of prokaryotic gene transcription and uses thereof Download PDFInfo
- Publication number
- WO2018170299A1 WO2018170299A1 PCT/US2018/022703 US2018022703W WO2018170299A1 WO 2018170299 A1 WO2018170299 A1 WO 2018170299A1 US 2018022703 W US2018022703 W US 2018022703W WO 2018170299 A1 WO2018170299 A1 WO 2018170299A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- seq
- xaa
- nle
- polypeptides
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
- 0 *C(*CN*1=C)(C1=O)N*(*)=C Chemical compound *C(*CN*1=C)(C1=O)N*(*)=C 0.000 description 2
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/04—Linear peptides containing only normal peptide links
- C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N37/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom having three bonds to hetero atoms with at the most two bonds to halogen, e.g. carboxylic acids
- A01N37/44—Biocides, pest repellants or attractants, or plant growth regulators containing organic compounds containing a carbon atom having three bonds to hetero atoms with at the most two bonds to halogen, e.g. carboxylic acids containing at least one carboxylic group or a thio analogue, or a derivative thereof, and a nitrogen atom attached to the same carbon skeleton by a single or double bond, this nitrogen atom not being a member of a derivative or of a thio analogue of a carboxylic group, e.g. amino-carboxylic acids
- A01N37/46—N-acyl derivatives
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N43/00—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds
- A01N43/90—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having two or more relevant hetero rings, condensed among themselves or with a common carbocyclic ring system
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23B—PRESERVATION OF FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES; CHEMICAL RIPENING OF FRUIT OR VEGETABLES
- A23B2/00—Preservation of foods or foodstuffs, in general
- A23B2/70—Preservation of foods or foodstuffs, in general by treatment with chemicals
- A23B2/725—Preservation of foods or foodstuffs, in general by treatment with chemicals in the form of liquids or solids
- A23B2/729—Organic compounds; Microorganisms; Enzymes
- A23B2/762—Organic compounds containing nitrogen
Definitions
- nucleotide/amino acid sequence listing submitted concurrently herewith and identified as follows: One 52,309 Byte ASCII (Text) file named "737956_ST25.txt” dated March 15, 2018.
- ⁇ 54 Bacteria are the cause of numerous pathologies in animals (including humans) and plants.
- ⁇ 54 is a bacterial transcription factor that is widely distributed and highly conserved across most bacterial phyla and is present in many serious Gram negative pathogens such as Enterococcus faecium, Campylobacter jejuni, Acinetobacter baumannii, Klebsiella pneumonia, Pseudomonas aeruginosa, Borrelia burgdorferi, and Enterobacter spp.
- a number of structural studies have confirmed the binding of ⁇ 54 to RNAP and DNA.
- ⁇ 54 binds DNA -24 and -12 base pairs from the transcription start site to initiate DNA melting, an essential step in transcription.
- HTH long helix- turn-helix
- RpoN box a single a-helix at residues 377 to 386
- the present disclosure relates to the surprising and unexpected discovery of proteins and processes involved in the inhibition of microbial transcription and/or treating microbial infections.
- polypeptides and compositions which alone or in combination with other components, can modulate microbial transcription (e.g., bacterial transcription).
- microbial transcription e.g., bacterial transcription
- polypeptides including cytoplasmic, nuclear, membrane bound, and secreted polypeptides
- recombinant proteins e.g., pseudopeptides, and fusion proteins.
- the present disclosure also relates to polypeptides and compositions useful as therapeutics for treating and/or preventing microbial infections (e.g., prokaryotic infections, bacterial infections, etc.).
- microbial infections e.g., prokaryotic infections, bacterial infections, etc.
- a polypeptide of the present disclosure can comprise a polypeptide derived from a bacterial RNA polymerase cofactor (e.g., alternative sigma factor ⁇ 54,) comprising at least two non-natural amino acids.
- the polypeptide is derived from the amino acid sequence FKVARRTVAKYREML (SEQ ID NO: 3).
- the polypeptide is derived from the amino acid sequence F VARRTVAKYREMLGI (SEQ ID NO: 35).
- the polypeptide is derived from the amino acid sequence (PAla)FKVARRTVAKYRE(M/Nle)L (SEQ ID NO: 20), wherein Ala is ⁇ -alanine. Nle is norleaucine.
- the present disclosure provides a polypeptide comprising the structure of at least one of: (i) aKVARRTyAKYRE (SEQ ID NO: 4); (ii)
- aKVARRTyAKYRE(M/Q/S/N L )5 (SEQ ID NO: 5); (iii) aFKVpRRTVAKYRE (SEQ ID NO: 6); (iv) aKVApRRTVAKYRE (SEQ ID NO: 7) or aKVApRTVAKYRE (SEQ ID NO: 8);
- aKVpRRTyA YRE (SEQ ID NO: 9); (vi) aKVA RTVAKYRE(M/Q/S/N L )LGIPSSRERRI (SEQ ID NO: 36); or (vii) a ⁇ RRTyAKYRE(M/Q/S/NL)6GIPSSRERRI (SEQ ID NO: 37).
- the , ⁇ , ⁇ , and ⁇ are non-natural amino acids.
- at least two of the ⁇ , ⁇ , ⁇ , and ⁇ are non-natural amino acids.
- at least two of the at least two non-natural amino acids form a hydrocarbon staple or disulfide bond.
- the present disclosure provides a polypeptide having the structure: [d]i(a)KV(P)RRT(Y)AKYRE(M/Q/S/N L )(6) (SEQ ID NO: 38);
- [d]i(a)KVA( )RTVAKYRE(M/Q/S/N L )LGIPSSRERRI (SEQ ID NO: 41), wherein: d is independently a capping group, a linker, a tryptophan, or a combination thereof; i can be 0 or 1.
- a is F, x, z or a combination thereof; ⁇ is A or x or both; ⁇ is V, z or x; ⁇ is L, M or x; and "z" and "x" correspond to a non-natural amino acid, wherein at least two of ⁇ , ⁇ , ⁇ , and ⁇ are non- natural amino acids.
- the capping group is at least one of Ac (acetyl), FITC
- the linker is at least one of beta-alanine or other linking entity (e.g., PEG).
- a polypeptide as described herein can be from about 14 to about 27 amino acids in length.
- the location of the at least two non-natural amino acids forming a hydrocarbon staple or disulfide bond are located at positions i and i+7 or i and i+4 of an amino acid sequence of the polypeptide.
- the polypeptide comprises at least one of an amino terminal capping group, a linker or a combination thereof.
- the present disclosure provides a polypeptide having the structure of a member selected from the group consisting of: Bi-linkeri-Tryptopharii- FKVARRTzAKYRE(Nle)x-NH 2 (Sa 54 -1) (SEQ ID NO: 42); Bi-linkeri-Tryptophani- FKVxRRTxAKYRE(Nle)L-NH 2 (So 54 -2) (SEQ ID NO: 43); Bi-linkerj-Tryptophani- zKVARRTxAKYRE(Nle)L-NH 2 (Sa 54 -3) (SEQ ID NO: 44); Bi-linkeri-Tryptophani- xFKVxRTVAKYRE(Nle)L-NH 2 (Sa 54 -4A) (SEQ ID NO: 45); Bi-linken-Tryptophanr x VAxRTVAKYRE(Nle)L-NH 2 (Sa 54 -4B) (SEQ ID NO: 42; Bi-
- B is any of the capping groups Ac (acetyl), FITC (fluorescein, thiourea), Bt (biotinyl) or any other fluorophore or affinity agent
- linker is beta-alanine or other linking entity (e.g., PEG)
- i is independently 0 or 1
- z and "x” correspond to a non-natural amino acid.
- the present disclosure provides a polypeptide comprising
- each Ri and R 2 are independently H, alkyl, alkenyl, alkynyl, arylalkyl, cycloalkylalkyl, heteroarylalkyl, or heterocyclylalkyl;
- each R 3 is independently alkylene, alkenylene, alkynylene; [R 4 — K— R 4 '] n ; each of which is substituted with 0-6 R 5 ;
- R 4 and R4' are independently alkylene, alkenylene or alkynylene
- each R5 is independently is halo, alkyl, ORe;, N(R 6 ) 2 , SR 6 , SOR 6 , SO2R6, C0 2 R 6 , R 6 , a fluorescent moiety, or a radioisotope;
- K is independently O, S, SO, S0 2 , CO, C0 2 , CONR 6 or
- each R 6 is independently H, alkyl, or a therapeutic agent
- Rz and R w are independently H, hydroxyl, amide (NH2), tryptophan, a linker, B, a B linker— , a linker-tryptophan— , a B-tryptophan— , or B-linker-tryptophan— ;
- B is any of the capping groups Ac (acetyl), FITC (fluorescein thiourea), Bt (biotinyl) or any other fluorophore or affinity agent;
- linker is beta-alanine or other linking entity (e.g., PEG);
- n is an integer from 1-4;
- x is 2, 3, 4 or 6;
- y and w are independently integers from 0-100;
- each Xaa is independently an amino acid
- polypeptide comprises at least 8 contiguous amino acids of a bacterial RNA polymerase cofactor or a variant thereof or a homologue of a bacterial RNA polymerase cofactor or a variant thereof except that: (a) within the 8 contiguous amino acids the side chains of at least one pair of amino acids separated by 3, 4 or 6 amino acids is replaced by the linking group R 3 which connects the alpha carbons of the pair of amino acids as depicted in Formula I and (b) the alpha carbon of the first amino acid of the pair of amino acids is substituted with R ⁇ as depicted in formula I and the alpha carbon of the second amino acid of the pair of amino acids is substituted with R 2 as depicted in Formula I.
- the bacterial RNA polymerase cofactor is alternative sigma factor ⁇ 54 (RpoN).
- the polypeptide is derived from the amino acid sequence: FKVARRTVAKYRE(M/Q/S/N L ) (SEQ ID NO: 55), optionally with L after the last amino acid.
- x is 2, 3, or 6;
- R 3 is an alkenyl containing a single double bond; and/or both Ri and R 2 are H.
- the [Xaa] x is selected from the group consisting of: (i) AKYRE(M/S/ Q NL) (SEQ ID NO: 56); (ii) RRT; (iii) KVARRT (SEQ ID NO:
- [Xaa]* is (i) AKYREM (SEQ ID NO: 64), [Xaa] w is FKVARRT (SEQ ID NO: 58) and/or [Xaa] ⁇ is GIPSSRERRI (SEQ ID NO: 65); [Xaa]* is (ii) RRT, [Xaa] w is FKV and/or [Xaa] y AKYRE(M/S/Q/N L )LGIPSSRERRI (SEQ ID NO: 66); [Xaa] x is (iii) KVARRT (SEQ ID NO: 57), [Xaa] w is H and/or [Xaa] ⁇ is AKYRE(M/S/Q/N L )LGIPSSRERRI (SEQ ID NO: 66); [Xaa] x is (v) KVA, [Xaa] w is H and/or [Xaa] . is
- polypeptide comprising: or a pharmaceutically acceptable salt thereof, wherein:
- q is an integer from 0-100.
- Ri, R 2 , and R 3 are independently selected; and [Xaa]*, [Xaa] ⁇ , and [Xaa] v are selected from the group consisting of: (i) KVARRT (SEQ ID NO: 57), AKYRE(M/S/Q/N L )LGIPSS (SEQ ID NO: 68), and ERR; (ii) KVARRT (SEQ ID NO: 57), AKYRESLSIPPS (SEQ ID NO: 69), and QRK; (iii) KVARRT (SEQ ID NO: 57), AKYREQ(M/S/Q N L )NIPSS (SEQ ID NO: 70), and ARK; and (iv) KVARRT (SEQ ID NO: 57), AKYRE(M/S/Q/NL)LGIAPSS (SEQ ID NO: 63), and RKR.
- KVARRT SEQ ID NO: 57
- the invention provides a polypeptide comprising Formula (II):
- Ri and R 2 are independently H, alkyl, alkenyl, alkynyl, arylalkyl, cycloalkylalkyl, heteroarylalkyl, or heterocyclylalkyl;
- R 31 and R 32 are independently alkenyl, alkynyl, azido, amino, carboxylic acid, or sulfide or (ii) are taken together to form alkylene, alkenylene, alkynylene, or
- R4 and *' are independently alkylene, alkenylene or alkynylene
- each R 5 is independently halo, alkyl, OR 6 , N(R 6 )2, SR 6 , SOR 6 , S0 2 R 6 , C0 2 R 6 , R 6 , a fluorescent moiety, or a radioisotope;
- each K is O, S, SO, S0 2 , CO, C0 2 , CONR 6 or
- each R 6 is H, alkyl, or a therapeutic agent
- Rz and R w are independently H, hydroxyl, NH 2 , tryptophan, a linker, B, a B-linker— , a linker-tryptophan— , a B-tryptophan— , or B-linker-tryptophan— ;
- B is any of the capping groups Ac (acetyl), FITC (fluorescein thiourea), Bt (biotinyl) or any other fluorophore or affinity agent;
- linker is beta-alanine or other linking entity
- n is an integer from 1-4;
- x is an integer from 2-6;
- FKVARRTVAKYRE(M/Q/S/N L ) (SEQ ID NO: 55), wherein two of the amino acids within the sequence are replaced with the residues A and B.
- the present disclosure relates to therapeutic or pharmaceutical compositions, and methods related to the treatment and/or prevention of microbial infections (e.g. prokaryotic infections or bacterial infections).
- the pharmaceutical composition for treating or preventing a microbial infection can comprise a therapeutically effective amount of a polypeptide of the present disclosure and a pharmaceutically acceptable excipient.
- the method treating or preventing a microbial infection comprises administering an effective amount of a composition of the present disclosure or a polypeptide of the present disclosure to a subject in need thereof, wherein the composition or polypeptide is effective in treating or ameliorating a symptom of the microbial infection.
- compositions of the present disclosure further include an additional therapeutic agent.
- the therapeutic agent is at least one of an antimicrobial agent (e.g., antibiotic) and an ameliorative agent.
- the present disclosure provides a method of inhibiting transcription in a prokaryote (e.g. bacteria) comprising administering an effective amount of a composition of the present disclosure or a polypeptide of the present disclosure, wherein the composition or polypeptide is effective in inhibiting transcription in a prokaryote.
- a prokaryote e.g. bacteria
- FIG. 2 Circular dichroism spectra of acetylated stapled a-helical polypeptide analogs. Polypeptide concentrations ranged from 60 to 77 ⁇ in water.
- FIG. 3 Flow cytometry analysis of cell penetration of FITC-tagged stapled a- helical polypeptide analogs with a Beckman Coulter Gallios flow cytometer. Bacteria were incubated with polypeptide for 90 minutes at 37°C followed by 30 minutes at 4°C.
- FIG. 4 Confocal microscopy of BW251 13 cells under FITC-tagged polypeptide treatment for 30 minutes at 37°C. Cells were treated with FM4-64 (1 jig/mL) and DAPI (2 ⁇ g/ L) prior to slide mounting. Three samples are shown in the rows above: A) Vehicle, B)
- FIG. 5 Fluorescence polarization of the stapled polypeptides and ⁇ Y ⁇ C-glnAp2.
- FIG. 6 Fluorescence excitation (filled) and emission (open) spectra of a FITC tagged ⁇ 54 stapled polypeptide and the Cy5 tagged dsDNA strand.
- FIGS. 7 A and 7B Fluorescence lifetime imaging microscopy of double stranded
- FIG. 8 Relative GlnA activity in treated BW25113 cells.
- FIGS. 9A, 9B, 9C, 9D, 9E, 9F, 9G, 9H, 91, 93, 9K, and 9L Motility assay conducted with soft LB agar with polypeptide concentrations of 4 ⁇ ). E. coli cells were incubated with media mixed with polypeptide for 18 hours at 37°C. A-F) MC4100 cells display the knockout phenotype and BW25113 cells are used to determine motility in G) Vehicle H) WT-a54 I) ⁇ 54-1 J) ⁇ 54-2 K) ⁇ 54-3 L) ⁇ 54-4. [0033] FIG. 10. Absorbance of retained crystal violet in PA01 biofilms grown 6 hour post-inoculation in 0.4% arginine supplemented M63 media with 4 ⁇ polypeptide.
- FIG. 11 Percent of cells fluorescently labeled in PA01 biofilms treated with FITC labeled ⁇ -54 polypeptides, FITC labeled wildtype ⁇ 54 polypeptides (control), and DMSO
- FIG. 12 Prokaryotic cell viability when treated with stapled polypeptides.
- MG1655 E. coli were grown in Gutnick Minimal Media (33.8 mM KH 2 P0 4 , 77.5 mM K 2 HPO 4 , 5.74 mM K 2 S0 4 , 0.41 mM MgS0 4 ) supplemented with Ho-LE trace elements, 0.4% glucose (w/v), and 3 mM NH4CI.
- Gutnick Minimal Media 33.8 mM KH 2 P0 4 , 77.5 mM K 2 HPO 4 , 5.74 mM K 2 S0 4 , 0.41 mM MgS0 4
- Ho-LE trace elements 0.4% glucose (w/v)
- 3 mM NH4CI 3 mM NH4CI.
- cells were treated with 10 ⁇ stapled polypeptide, DMSO vehicle control, or wildtype control for 4 hours, then plated on LB agar at various dilutions and incubated at 37 °C overnight. The following day, colonies were counted and used to back-calculate colon
- FIG. 13 presents a dot plot showing regulation of genes by the ⁇ 54 polypeptides.
- FIG. 14 presents bar graphs showing relative normalized expression of ⁇ 54- controlled genes after treatment with So54. Data are represented as mean ⁇ SEM. N+ denotes nitrogen-rich media while N- indicates nitrogen-deficient media. The bars are from left to right: N+, N- (DMSO), ⁇ 54 WT, Sa54-1, Sa54-2, Sa54-3, Sa54-4B.
- FIG. 15 presents a bar graph showing glutamine synthetase transferase assay with
- compositions or polypeptides of the present disclosure can provide a significant inhibition of transcription in prokaryotes, treat and/or prevent a prokaryotic infection, ameliorate the systems of a prokaryotic infection, or any combination thereof, and therefore, the compositions and/or polypeptides of the present disclosure represent a novel therapeutic intervention for the treatment and/or prevention of, for example, bacterial infections and tissue damage/injury caused therefrom.
- the present disclosure is related, in part, to the surprising and unexpected discovery that the polypeptides and compositions of the present disclosure are capable of inhibiting prokaryotic transcription and therefore, are effective in the treatment and/or prevention of prokaryotic infection, or ameliorating and/or preventing the symptoms of a prokaryotic infection.
- a reference to "A and/or B", when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.
- the phrase "at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from anyone or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements.
- This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase "at least one" refers, whether related or unrelated to those elements specifically identified.
- At least one of A and B can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.
- phrases "pharmaceutically or pharmacologically acceptable” refer to molecular entities and compositions that do not produce an adverse, allergic or other undesirable reaction when administered to an animal, or a human, as appropriate.
- co -administration and “co-administering” or “combination therapy” refer to both concurrent administration (administration of two or more therapeutic agents at the same time) and time varied administration (administration of one or more therapeutic agents at a time different from that of the administration of an additional therapeutic agent or agents), as long as the therapeutic agents are present in the patient to some extent, preferably at effective amounts, at the same time.
- one or more of the present polypeptides described herein are co-administered in combination with at least one additional bioactive agent, especially including an anticancer agent.
- the co-administration results in synergistic activity and/or therapy, including anticancer activity.
- polypeptide encompasses two or more naturally occurring or synthetic amino acids linked by a covalent bond (e.g., an amide bond). Polypeptides as described herein include full length proteins (e.g., fully processed proteins) as well as shorter amino acids sequences (e.g., fragments of naturally occurring proteins or synthetic polypeptide fragments).
- amino acid side chain refers to a moiety attached to the a-carbon in an amino acid.
- amino acid side chain for alanine is methyl
- amino acid side chain for phenylalanine is phenylmethyl
- amino acid side chain for cysteine is thiomethyl
- amino acid side chain for tyrosine is 4-hydroxyphenylmethyl
- Other non-naturally occurring amino acid side chains are also included for example, those that occur in nature (e.g., an amino acid metabolite) or those that are made synthetically (e.g., an alpha di-substituted amino acid).
- Non-natural amino acid as used herein means any amino acid that may form a polypeptide, excluding the “natural amino acids” that form polypeptides in mammals.
- the "natural amino acids” are alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine.
- a "non-essential" amino acid residue is a residue that can be altered from the wild-type sequence of a polypeptide without abolishing or substantially altering its activity.
- An "essential” amino acid residue is a residue that, when altered from the wild-type sequence of the polypeptide, results in abolishing or substantially abolishing the polypeptides activity.
- a "conservative amino acid substitution” is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain.
- Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
- halo refers to any radical or fluorine, chlorine, bromine, or iodine.
- alkyl refers to a hydrocarbon chain that may be a straight chain or branched chain, containing the indicated number of carbon atoms.
- Ci-Cio indicates that the group may have from 1 to 10 (inclusive) carbon atoms in it.
- alkyl is a chain (straight or branched) having 1 to 20 (inclusive) carbon atoms in it (i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 carbon atoms).
- alkylene refers to a divalent alkyl (i.e.,— R— ).
- alkenyl refers to a hydrocarbon chain that may be a straight chain or branched chain having one or more carbon-carbon double bonds in either Z or E geometric configurations.
- the alkenyl moiety contains the indicated number of carbon atoms.
- C2-C10 indicates that the group may have from 2 to 10 (inclusive) carbon atoms in it.
- lower alkenyl refers to a C 2 -C 8 alkenyl chain. In the absence of any numerical designation, "alkenyl” is a chain (straight or branched) having 2 to 20 (inclusive) carbon atoms in it.
- alkynyl refers to a hydrocarbon chain that may be a straight chain or branched chain having one or more carbon-carbon triple bonds.
- the alkynyl moiety contains the indicated number of carbon atoms. For example C 2 -C 10 indicates that the group may have from 2 to 10 (inclusive) carbon atoms in it.
- lower alkynyl refers to a C 2 -C 8 alkynyl chain. In the absence of any numerical designation, “alkynyl” is a chain (straight or branched) having 2 to 20 (inclusive) carbon atoms in it.
- aryl refers to a 6-carbon monocyclic or 10-carbon bicyclic aromatic ring system wherein 0, 1 , 2, 3, or 4 atoms of each right may be substituted by a substituent. Examples of aryl groups include phenyl, naphthyl and the like.
- arylalkyl or the term “aralkyl” refers to alkyl substituted with an aryl.
- arylalkoxy refers to an alkoxy substituted with aryl.
- cycloalkyl as employed herein includes saturated and partially unsaturated cyclic hydrocarbon groups having 3 to 12 carbons, preferably 3 to 8 carbons, and more preferably 3 to 6 carbons, wherein the cycloalkyl group additionally may be optionally substitute.
- Preferred cycloalkyl groups include, without limitation, cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexenyl, cycloheptyl, and cyclooctyl.
- heteroaryl refers to an aromatic 5-8 membered monocyclic, 8-12 membered bicyclic, or 1 1-14 membered tricyclic right system having 1-3 heteroatoms if monocyclic, 1-6 heteroatoms if bicyclic, or 109 heteroatoms if tricyclic, said heteroatoms selected from O, N, or S (e.g., carbon atoms and 1-3, 1-6, or 1-9 heteroatoms of N, O, or S if monocyclic, bicyclic, or tricyclic, respectively), wherein 0, 1, 2, 3, or 4 atoms of each ring may be substituted by a substituent.
- heteroaryl groups examples include pyridyl, furyl, or furanyl, imidazolyl, 1, 2, 3-triazolyl, 1, 2, 4-triazolyl, benzimidazolyl, pyrimidinyl, thiophenyl or thienyl, quinolinyl, indolyl, thiazolyl, and the like.
- heteroarylalkyl or the term
- heteroarylkyl refers to an alkyl substituted with a heteroaryl.
- heteroarylalkoxy refers to an alkoxy substituted with heteroaryl.
- heterocyclyl refers to a nonaromatic 5-8 membered monocyclic, 8012 membered bicyclic, or 11-14 membered tricyclic ring system having 1-3 heteroatoms if monocyclic, 1-6 heteroatoms if bicyclic, or 1-9 heteroatoms if tricyclic, said heteroatoms selected from O, N, or S (e.g., carbon atoms and 1-3, 1-6, or 1-9 heteroatoms of N, O, or S if monocyclic, bicyclic, or tricyclic, respectively), wherein 0, 1, 2, or 3 atoms of each ring may be substituted by a substituent.
- heterocyclyl groups include piperazinyl, pyrrolidinyl, dioxanyl, aziridinzyl, oxiryl, thiiryl, morpholinyl, tetrahydrofuranyl, and the like.
- substituted refers to a group “substituted” on an alkyl, cycloalkyl, aryl, heterocyclyl, or heteroaryl group at any atom of that group.
- Suitable substituents include, without limitations, halo, hydroxyl, mercapto, oxo, nitro, haloalkyl, alkyl, alkaryl, aryl, aralkyl, alkoxy, thioalkoxy, aryloxy, amino, alkoxycarbonyl, amido, carboxy, alkanesulfonyl, alkylcarbonyl, azido, and cyano groups.
- patient or “subject” is used throughout the specification to describe an animal, preferably a human or a domesticated animal, to whom treatment, including prophylactic treatment, with the polypeptides and compositions according to the present disclosure is provided.
- patient refers to that specific animal, including a domesticated animal such as a dog or cat or a farm animal such as a horse, cow, sheep, etc.
- patient refers to a human patient unless otherwise stated or implied from the context of the use of the term.
- the term "effective" is used to describe an amount of a polypeptide, compound, composition or component which, when used within the context of its intended use, effects an intended result.
- the term effective subsumes all other effective amount or effective concentration terms, which are otherwise described or used in the present application.
- aspects of the present disclosure provide for internally cross-linked alpha helical domain polypeptides related to a bacterial R A polymerase cofactor (e.g., RpoN).
- the polypeptides include a tether (also referred to as a cross-link) between two non-natural amino acids that significantly enhance the alpha helical secondary structure of the polypeptide.
- the tether or cross-link (also referred to as a staple) extends across the length of one or two helical turns (i.e., about 3.4 or about 7 amino acids). Accordingly, amino acids positioned at i and i+3, i and i+4, or i and i+7 are ideal candidates for chemical modification and cross-linking.
- cross-links between Xaai and Xaa 8 are useful as are cross-links between Xaa 2 and Xaa 5 , or between Xaa 2 and Xaa 6 , or between Xaa 2 and Xaa 9 , etc.
- polypeptides can include more than one cross-link within the polypeptide sequence to either further stabilize the sequence or facilitate the stabilization of longer polypeptide stretches. If the polypeptides are too long to be readily synthesized in one part, independently synthesized, cross-linked polypeptides can be conjoined by a technique called native chemical ligation (Bang, et al, J Am. Chem. Soc. 126: 1377-83 (2004), incorporated by reference herein in its entirety).
- stapled a-helical polypeptides can bind over extended surfaces and are thus more likely to be able to inhibit ⁇ 54 binding to either RNAP or DNA. As the interaction of ⁇ 54 with DNA is predominantly mediated by a single a-helix, a stapled polypeptide should act as an effective competitive inhibitor of this binding event.
- the present disclosure is the first instance of stapled a-helical polypeptides being used in bacterial models as both a tool to study ⁇ 54 and as a novel method to targeting Gram negative bacteria through a route that bypasses innate multidrug resistances.
- the present disclosure shows that the staples enable polypeptides to adopt an a-helical confirmation without inducing cell death mechanisms in either bacteria or mammalian cell cultures.
- the present disclosure further shows that stapled polypeptides are able to enter bacteria and through a mechanism different to that of other mammalian stapled polypeptides currently under study.
- the binding of the polypeptides appears to be quite strong and is detectable at the nanomolar range. While the polypeptide appears to bind well to DNA, in vivo studies below confirm that the polypeptide inhibits ⁇ 54 function.
- the present disclosure relates to compositions and/or polypeptides useful as therapeutics for treating and/or preventing microbial infections (e.g., prokaryotic infections, bacterial infections, etc.).
- the polypeptide of the present disclosure can comprise a polypeptide derived from a bacterial RNA polymerase cofactor (e.g., alternative sigma factor ⁇ 54, SEQ ID NO: 1 , or SEQ ID NO: 2) comprising at least two non-natural amino acids. At least two of the at least two non-natural amino acids can be cross-linked. The cross- linked amino acids may be in an i and i+4, or an i and i+7 configuration.
- the polypeptide is derived from the amino acid sequence FKVARRTVAKYREML (SEQ ID NO: 3).
- the polypeptide is derived from the amino acid sequence
- polypeptide is derived from the amino acid sequence BFKVARRTVAKYRE(M Nle)L (SEQ ID NO: 15).
- the non-natural amino acids can be selected from (S)-pentenylalanine and (R)- octenylalanine, e.g. (S)-2-(4'pentenyl)-alanine and (R)-2-(7'-octenyl)-alanine.
- the polypeptide has an amino acid sequence selected from the group consisting of: SEQ ID NOS: 4-14, 16-19, and 21-33.
- the present disclosure provides a polypeptide comprising the structure of at least one of: (i) ocKVARRTyAKYRE (SEQ ID NO: 4); (ii)
- aKV ARRTyAK YRE(M/Q/ S/NL)5 (SEQ ID NO: 5); (iii) ccFKVpRRTVAKYRE (SEQ ID NO: 6); (iv) aKVApRRTVAKYRE (SEQ ID NO: 7) or aKVApRTVAKYRE (SEQ ID NO: 8); (v) aKVpRRTyAKYRE (SEQ ID NO: 9); vi) aKVAPRTVAKYRE(M/Q/S/NL)LGIPSSRERRI (SEQ ID NO: 36); or vii) aKV RRTyAKYRE(M/Q/S/N L )6GIPSSRERRI (SEQ ID NO: 37).
- At least two of the ⁇ , ⁇ , ⁇ , and ⁇ are non-natural amino acids.
- at least two of the at least two non-natural amino acids form a hydrocarbon staple or disulfide bond (i.e., are cross-linked).
- the hydrocarbon staple crosslinks the alpha carbons of the stapled non-natural amino acids (i.e. non-natural amino acids).
- the non-natural amino acids for the i/i+4 configuration are (S)- pentenylalanine.
- the non-natural amino acids for the i/i+7 configuration are (S)-pentenylalanine and (R)-octenylalanine, e.g., (S)-2-(4'pentenyl)-alanine and (R)-2-(7'-octenyl)-alanine.
- the present disclosure provides a polypeptide having the structure: [d]i(a)KV( )RRT(y)AKYRE(M/Q/S N L )(5) (SEQ ID NO: 38);
- d is independently a capping group, a linker, a tryptophan, or a combination thereof; i can be 0 or 1.
- a is F, x, z or a combination thereof; ⁇ is A or x or both; ⁇ is V, z or x; ⁇ is L, M or x; and "z" and "x" correspond to a non-natural amino acid, wherein at least two of ⁇ , ⁇ , ⁇ , and ⁇ are non- natural amino acids.
- x is (S)-pentenylalanine.
- z is (R)-octenylalanine.
- the capping group is at least one of Ac (acetyl), FITC
- the linker is at least one of beta-alanine or other linking entity (e.g., PEG).
- the polypeptide can be from about 14 to about 27 amino acids in length.
- the location of the at least two non-natural amino acids forming a hydrocarbon staple or disulfide bond are located at positions i and i+7 or i and i+4 of an amino acid sequence of the polypeptide.
- the polypeptide comprises at least one of an amino terminal capping group, a linker or a combination thereof.
- the present disclosure provides a polypeptide having the structure of a member selected from the group consisting of: Bi-linkeri-Tryptophani- FKVARRTzAKYRE(Nle)x-NH 2 (Sa 54 -1 ) (SEQ ID NO: 42); Bj-linkerj-Tryptophani- FKVxRRTxAKYRE(Nle)L-NH 2 (Sa 54 -2) (SEQ ID NO: 43); Bi-linkerj-Tryptophani- zKVARRTxAKYRE(Nle)L-NH 2 (Sa 54 -3) (SEQ ID NO: 44); Bi-linkeri-Tryptophan,- xFKVxRRTVAKYRE(Nle)L-NH 2 (Sa 54 -4A) (SEQ ID NO: 45); Bi-linkeri-Tryptophani- xKVAxRTVAKYRE(Nle)L-NH 2 (Sa 54 -1 ) (SEQ ID
- B is any of the capping groups Ac (acetyl), FITC (fluorescein thiourea), Bt (biotinyl) or any other fiuorophore or affinity agent
- linker is beta-alanine or other linking entity (e.g., PEG)
- i is 0 or 1
- z and "x” correspond to a non-natural amino acid.
- the present disclosure provides a polypeptide comprising
- each Ri and R 2 are independently H, alkyl, alkenyl, alkynyl, arylalkyl, cycloalkylalkyl, heteroarylalkyl, or heterocyclylalkyl; [0080] each R3 is independently alkylene, alkenylene, alkynylene; [R 4 — K— R Jn; each of which is substituted with 0-6 R 5 ;
- R 4 and R4' are independently alkylene, alkenylene or alkynylene;
- each R 5 is independently is halo, alkyl, ORe, N(R 6 ) 2 , SR 6 , SORe, S0 2 R 6 , C0 2 R 6 ,
- R 6 a fluorescent moiety, or a radioisotope
- K is independently O, S, SO, S0 2 , CO, C0 2 , CONR 6 or
- each R 6 is independently H, alkyl, or a therapeutic agent
- Rz and R w are independently H, hydroxy!, amide (NH2), tryptophan, a linker, B, a
- B-linker— , a linker-tryptophan— , a B-tryptophan— , or B-linker-tryptophan— ;
- B is any of the capping groups Ac (acetyl), FITC (fluorescein thiourea), Bt
- linker is beta-alanine or other linking entity (e.g., PEG);
- n is an integer from 1-4;
- x is 2, 3, 4 or 6;
- y and w are independently integers from 0-100;
- each Xaa is independently an amino acid
- polypeptide comprises at least 8 contiguous amino acids of a bacterial
- RNA polymerase cofactor or a variant thereof or a homologue of a bacterial RNA polymerase cofactor or a variant thereof except that: (a) within the 8 contiguous amino acids the side chains of at least one pair of amino acids separated by 3, 4 or 6 amino acids is replaced by the linking group R 3 which connects the alpha carbons of the pair of amino acids as depicted in Formula I and (b) the alpha carbon of the first amino acid of the pair of amino acids is substituted with Ri as depicted in formula I and the alpha carbon of the second amino acid of the pair of amino acids is substituted with R 2 as depicted in Formula I.
- the bacterial RNA polymerase cofactor is alternative sigma factor ⁇ 54 (RpoN).
- the polypeptide is derived from the amino acid sequence: FKVARRTVAKYRE(M/Q/S/N L ) (SEQ ID NO: 55).
- x is 2, 3, or 6;
- R 3 is an alkenyl containing a single double bond; and/or both Ri and R 2 are H.
- the [Xaa] x is selected from the group consisting of: (i) AKYRE(M/S/Q/NL) (SEQ ID NO: 56); (ii) RRT; (iii) VARRT (SEQ ID NO: 57); (iv) FKV; (v) KVA; (vi) KVARRT (SEQ ID NO: 57); (vii) QRK; (viii) ARK; and (ix) RKR.
- [Xaa]* is (i) AKYRE(M/S/Q/N L ) (SEQ ID NO: 56), at least one of [Xaa] w is FKVARRT (SEQ ID NO: 58), [Xaajy is H, or a combination thereof;
- [Xaa] is (ii) RRT, at least one of [Xaa] w is FKV, [Xaa] y is AKYRE(M/S/Q/N L )L (SEQ ID NO: 59), or a combination thereof;
- [Xaa]x is (iii) KVARRT (SEQ ID NO: 57), at least one of [Xaa] w is H, [XaaJ ⁇ is
- RRTVAKYRE(M/S/Q/NL) (SEQ ID NO: 60), or a combination thereof; when [Xaa]* is (vi) KVARRT (SEQ ID NO: 57), at least one of [Xaa] w is H, [Xaa] y is AKYRE(M/S/Q/N L ) (SEQ ID NO: 56), or a combination thereof; when [Xaa] x is (vii) QRK, at least one of [Xaa] w is
- AKYRESLSIPSS SEQ ID NO: 61
- [Xaa] y is LV, or a combination thereof
- [Xaa]* is (viii) ARK
- at least one of [Xaa] w is AKYREQL(M/S/Q/N L )NIPSS (SEQ ID NO: 62).
- [Xaa] y is YK, or a combination thereof; when [Xaa] x is (ix) RKR, at least one of [Xaa] w is
- [Xaa] y is V, or a combination thereof; when [Xaa]* is (i) AKYREM (SEQ ID NO: 64), at least one of [Xaa] w is FKVARRT (SEQ ID NO: 58), [Xaa]y is GIPSSRERRI (SEQ ID NO: 65), or a combination thereof; [Xaa]* is (ii) RRT, at least one of [Xaa] w is FKV, [Xaa] y AKYRE(M/S/ Q/NL)LGIPS SRERRI (SEQ ID NO: 66), or a combination thereof; [Xaa]* is (iii) KVARRT (SEQ ID NO: 57), at least one of [Xaa] w is H, [Xaa] y is AKYRE(M/S/Q/N L )LGIPSSRERRI
- RTVAKYRE(M/S/Q/NL)LGIPSSRERRI (SEQ ID NO: 67), or a combination thereof.
- polypeptide comprising: or a pharmaceutically acceptable salt thereof, wherein:
- q is an integer from 0-100.
- R 1; R 2 , and R 3 are independently selected; and [Xaa] x , [XaaL, and [Xaa] v are selected from the group consisting of: (i) KVARRT (SEQ ID NO: 57), AKYREMLGIPSS (SEQ ID NO: 71), and ERR; (ii) KVARRT (SEQ ID NO: 57), AKYRESLSIPPS (SEQ ID NO: 69), and QRK; (iii) KVARRT (SEQ ID NO: 57), AKYREQMNIPSS (SEQ ID NO: 72), and ARK; and (iv) KVARRT (SEQ ID NO: 57), AKYREMLGIAPSS (SEQ ID NO: 73), and RKR.
- [Xaa] 9 can be LV.
- [Xaa] ? can be YK.
- [Xaa] ? can be V.
- the invention provides a polypeptide comprising Formula (II):
- Ri and R 2 are independently H, alkyl, alkenyl, alkynyl, arylalkyl, cycloalkylalkyl, heteroarylalkyl, or heterocyclylalkyl;
- R31 and R32 are independently alkenyl, alkynyl, azido, amino, carboxylic acid, or sulfide or (ii) are taken together to form alkylene, alkenylene, alkynylene, or [R 4 — K— R 4 '] n , each of which is substituted with 0-6 R 5 ;
- R4 and R4' are independently alkylene, alkenylene or alkynylene
- each Rs is independently halo, alkyl, OR 6 , N(R 6 ) 2 , SR 6 , SOR 6 , SO2R6, C0 2 R 6 , e, a fluorescent moiety, or a radioisotope;
- each R 6 is H, alkyl, or a therapeutic agent
- z and R w are independently H, hydroxyl, NH2, tryptophan, a linker, B, a B-linker— , a linker-tryptophan— , a B-tryptophan— , or B-linker-tryptophan— ;
- B is any of the capping groups Ac (acetyl), FITC (fluorescein thiourea), Bt (biotinyl) or any other fluorophore or affinity agent;
- linker is beta-alanine or other linking entity
- n is an integer from 1-4;
- x is an integer from 2-6;
- FKVARRTVAKYRE(M/Q/S/N L ) (SEQ ID NO: 55), wherein two of the amino acids within the sequence are replaced with the residues A and B.
- R31 and R32 are taken together to form alkylene, alkenylene, alkynylene, or [R 4 — K— R 4 '] n , each of which is substituted with 0-6 R5.
- polypeptide is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl
- i of Bi is 1, i of linken and Tryptophan! is 0 or 1 ;
- z and x each are a non-natural amino acid
- the non-natural amino acid that is z or x that is closest to Bi within the sequence is residue A and the other non-natural amino acid that is z or x within the sequence is residue B.
- z is (R)-octenylalanine.
- x is (S)-pentenylalanine.
- polypeptide is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl
- B is acetyl
- x is (S)-2-(4'pentenyl)-alanine
- z is (R)-2-(7'-octenyl)-alanine.
- compositions including therapeutic or pharmaceutical compositions, and methods related to the treatment and/or prevention of microbial infections (e.g. prokaryotic infections or bacterial infections).
- a pharmaceutical composition for treating or preventing a microbial infection can comprise a therapeutically effective amount of a polypeptide of the present disclosure and a
- the method treating or preventing a microbial infection comprises administering an effective amount of a composition of the present disclosure or a polypeptide of the present disclosure to a subject in need thereof, wherein the composition or polypeptide is effective in treating or ameliorating a symptom of the microbial infection.
- the present disclosure relates to methods of using the polypeptides described herein as a food additive/preservative to prevent or inhibit food spoilage, for example caused by prokaryotes or bacteria.
- the present disclosure relates to therapeutic or pharmaceutical compositions, and methods related to the use of the polypeptides described herein to prevent or treat diseases of plants (e.g., due to infection oiXylella fastidiosa,
- the present disclosure provides a method of preventing contamination of and/or disinfecting a contaminated device, wherein the device may be, e.g., a medical device. Such a method could prevent biofilm formation on the medical device.
- compositions of the present disclosure further include an additional (or therapeutic) agent.
- the therapeutic agent is at least one of an antimicrobial agent (e.g., antibiotic or antibacterial agent) and an ameliorative agent.
- the antibiotic may be selected from the following groups aminoglycosides (e.g., amikacin, gentamicin, kanamycin, neomycin, netilmicin, tobramycin, paromomycin, streptomycin, and/or spectinomycin), ansamycins (e.g., geldanamycin, herbimycin, and/or rifaximin), carbacephem (e.g., loracarbef), carbapenems (e.g., ertapenem, doripenem,
- aminoglycosides e.g., amikacin, gentamicin, kanamycin, neomycin, netilmicin, tobramycin, paromomycin, streptomycin, and/or spectino
- cephalosporins first, second, third, fourth, and/or fifth generation; e.g., cefadroxil, cefazolin, cefalotin, cefalothin, cephalexin, cefavlor, cefamandole, cefoxitin, cefprozil, cefuroxime, cefixime, cefdinir, cefditoren, cefoperazone, cefotaxime, cefpodoxime, ceftazidime, ceftibuten, ceftizoxime, ceftriaxone, cefepime, ceftaroline fosamil, and/or ceftobiprole), glycopeptides (e.g., teicoplanin, vancomycin, telavancin, dalbavancin, and/or oritavancin), lincosamides (e.g.,
- the ameliorative agent can be any agent to one skilled in the art as long as it is effective at alleviating, improving, and/or reduce a sign or symptom of a microbial infection.
- the present disclosure provides a method of inhibiting transcription in a prokaryote (e.g. bacteria) comprising administering an effective amount of a composition of the present disclosure or a polypeptide of the present disclosure, wherein the composition or polypeptide is effective in inhibiting transcription in a prokaryote.
- a prokaryote e.g. bacteria
- the present disclosure comprises the use of a therapeutic composition comprising an effective amount of a composition or a polypeptide of the present disclosure for the manufacture of a medicament for the treatment and/or prevention of microbial infection (e.g., prokaryotic or bacterial infections).
- microbial infection e.g., prokaryotic or bacterial infections.
- the use of the therapeutic composition can comprise an effective amount of from 0.1 mg/kg and 1000 mg/kg body weight/day.
- the therapeutic composition of the disclosure can be in any pharmaceutically acceptable form and administered by any
- the therapeutic composition can be administered as an oral dosage, either single daily dose or unitary dosage form, for the treatment and/or protection of microbial infection and/or, ameliorating and/or preventing the symptoms of the microbial infection, or any combination thereof.
- Such pharmaceutically acceptable carriers and excipients and methods of administration will be readily apparent to those of skill in the art, and include compositions and methods as described in the USP-NF 2008 (United States
- hydrocarbon tethers can be further manipulated, e.g., a double bond of a hydrocarbon alkenyl tether (e.g., as synthesized using ruthenium-catalyzed ring closing metathesis (RCM)) can be oxidized (e.g., via epoxidation of dihydroxylation) to provide one of the following:
- RCM ruthenium-catalyzed ring closing metathesis
- hydrocarbon alkenyl tether e.g., as synthesized using ruthenium-catalyzed ring closing metathesis (RCM)
- RCM ruthenium-catalyzed ring closing metathesis
- Either the epoxide moiety or one of the free hydroxyl moieties can be further functionalized.
- the epoxide can be treated with a nucleophile, which provides additional functionality that can be used, for example, to attach a tag (e.g., a radioisotope or fluorescent tag).
- the tag can be used to help direct the polypeptide to a desired location in the body or track the location in the body.
- an additional therapeutic agent can be chemically attached to the functionalized tether (e.g., an anti-bacterial agent).
- Such derivitization can alternatively be achieved by synthetic manipulation of the amino or carboxy terminus of the polypeptide or via the amino acid side chain.
- Other agents can be attached to the functionalized tether, e.g., an agent that facilitates entry of the polypeptide into cells.
- the tether can include at least one of an ether, thioether, ester, amine, or amide moiety.
- a naturally occurring amino acid side chain is incorporated into the tether.
- a tether can be coupled with a functional group, such as the hydroxyl in serine, the thiol in cysteine, the primary amine in lysine, the acid in aspartate or glutamate, or the amide in asparagine or glutamine. Therefore, it is possible to create a tether using naturally occurring amino acids rather than using a tether that is made by coupling two non-naturally occurring amino acids.
- the tether is created between a single non- naturally occurring amino acid and a naturally occurring amino acid.
- a shorter length tether can be utilized when it is desirable to provide a relatively high degree of constraint on the secondary alpha-helical structure.
- a longer tether can be utilized when it is desirable to provide less constraint on the secondary alpha-helical structure.
- tethers spanning from amino acids i to i+3, i to i+4; and i to i+7 have been described in order to provide a tether that is primarily on a single face of the alpha helix, the tethers can be synthesized to span any combinations of numbers of amino acids.
- alpha di-substituted amino acids are used in the polypeptide to improve the stability of the alpha helical secondary structure.
- alpha mono-substituted amino acids e.g., in the tethered amino acids are used in the polypeptide.
- polypeptides of this disclosure can be made by chemical synthesis methods, which are well known to the ordinarily skilled artisan. See, for example, Fields et al., Chapter 3 in Synthetic Peptides: A User's Guide, ed. Grant, W.H. Freeman & Co., New York, N.Y., 1992, p. 77.
- polypeptides can be synthesized using the automated Merrifield techniques of solid phase synthesis with the a-NH 2 protected by either t-Boc or Fmoc chemistry using side chain protected amino acids on, for example, an Applied Biosystems Peptide Synthesizer Model 43 OA or 431 or a Creosalus TETRAS Asynchronous Peptide Synthesizer.
- polypeptides described herein are using solid phase peptide synthesis (SPPS).
- SPPS solid phase peptide synthesis
- the C-terminal amino acid is attached to a cross-linked polystyrene resin via an acid labile bond with a linker molecule.
- This resin is insoluble in the solvents used for synthesis, making it relatively simple and fast to wash away excess reagents and by-products.
- the N-terminus is protected with the Fmoc group, which is stable in acid, but removable by base (e.g., piperidine or l,8-diazabicycloundec-7-ene). Any side chain functional groups are protected with base stable, acid labile groups.
- polypeptides could be made by conjoining individual synthetic polypeptides using native chemical ligation. Alternatively, the longer synthetic polypeptides can be synthesized by well-known recombinant DNA techniques. Such techniques are provided in well-known standard manuals with detailed protocols.
- a gene encoding a polypeptide of this disclosure the amino acid sequence is reverse translated to obtain a nucleic acid sequence encoding the amino acid sequence, preferably with codons that are optimum for the organism in which the gene is to be expressed.
- a synthetic gene is made, typically by synthesizing oligonucleotides which encode the polypeptide and any regulatory elements, if necessary.
- the synthetic gene is inserted in a suitable cloning vector and transfected into a host cell.
- the polypeptide is then expressed under suitable conditions appropriate for the selected expression system and host.
- the polypeptide is purified and characterized by standard methods.
- polypeptides can be made in a high-throughput, combinatorial fashion, e.g., using a high-throughput multiple channel combinatorial synthesizer available from Advanced Chemtech or Creosalus/Thuramed.
- the present disclosure provides for the polypeptides wherein at least one conventional peptide bonds replaced by a different bond that may increase the stability of the polypeptide in the subject.
- the polypeptides of the disclosure are modified by at least one of: acetylation, amidation, biotinylation, cinnamoylation, farnesylation, fluoresceination, formylation, myristoylation, palmitoylation, phosphorylation. (Ser, Tyr or Thr), stearoylation, succinylation and sulfurylation.
- the polypeptide of the present disclosure is conjugated to, for example, polyethylene glycol (PEG); alkyl groups (e.g., C1-C20 straight or branched alkyl groups); fatty acid radicals; or combinations thereof.
- the stapled polypeptides further includes at least one of a drug, a toxin, a derivative of polyethylene glycol, a second polypeptide, a carbohydrate, etc.
- a polymer or other agent is linked to the stapled polypeptide.
- PEG pharmacokinetic and pharmacodynamic properties of the polypeptide.
- PEGylation can reduce renal clearance and can result in a more stable plasma concentration.
- PEG is a water soluble polymer and can be represented as linked to the polypeptide as formula: T m O—
- n 2 to 10,000
- T m is H or a terminal modification (e.g., a Ci-4 alkyl) and Y is an amide, carbamate or urea linkage to an amine group (including but not limited to, the epsilon amine of lysine or the N-terminus) of the polypeptide.
- Y can be a maleimide linkage to a thiol group (including but not limited to, the thiol group of cysteine).
- Other methods for linking PEG to a polypeptide, directly or indirectly, are known to those of ordinary skill in the art.
- the PEG can be linear or branched.
- the PEG has at least one degradable linkage.
- PEG can be prepared with ester linkages that are subject to hydrolysis. Conjugates having degradable PEG linkages are described in WO 99/34833, WO 99/14259, and U.S. Patent No. 6,348,558.
- macromolecular polymer e.g., PEG
- the linker includes 1 to 20 amino acids linked by peptide bonds, wherein the amino acids are selected from the 20 naturally occurring amino acids.
- at least one of the amino acids of the linker is glycosylated.
- the 1 to 20 amino acids are selected from the group consisting of glycine, alanine, proline, asparagine, glutamine, and lysine.
- the linker is a non-peptide linker.
- the non-peptide linker can be an alkyl linkers, such as— NH(CH 2 ) n C(0)— , wherein n is an integer from 2 to 20.
- the alkyl linker can be substituted by at least one of any non-sterically hindering group (e.g., lower alkyl (e.g., d-C 6 ), lower acyl, halogen (e.g., CI, Br), CN, NH 2 , phenyl, etc.).
- a bifunctional PEG linker and its use in forming conjugates having a polypeptide at each of the PEG linker termini has been described, e.g., U.S. Patent No. 5,446,090.
- compositions comprising combinations of an effective amount of at least one polypeptide as described herein, and one or more of the polypeptides otherwise described herein, all in effective amounts, in combination with a pharmaceutically effective amount of a carrier, additive or excipient, represents a further aspect of the present disclosure.
- compositions comprising the pharmaceutically acceptable salts, in particular, acid or base addition salts of polypeptides as described herein.
- the acids which are used to prepare the pharmaceutically acceptable acid addition salts are those which form non-toxic acid addition salts, i.e., salts containing
- pharmacologically acceptable anions such as the hydrochloride, hydrobromide, hydroiodide, nitrate, sulfate, bisulfate, phosphate, acid phosphate, acetate, lactate, citrate, acid citrate, tartrate, bitartrate, succinate, maleate, fumarate, gluconate, saccharate, benzoate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate and pamoate [i.e., l,l'-methylene-bis-(2- hydroxy-3 naphthoate)] salts, among numerous others.
- anions such as the hydrochloride, hydrobromide, hydroiodide, nitrate, sulfate, bisulfate, phosphate, acid phosphate, acetate, lactate, citrate, acid citrate, tartrate, bitartrate, succinate, maleate,
- compositions may also be used to produce pharmaceutically acceptable salt forms of the polypeptides or derivatives according to the present disclosure.
- the chemical bases that may be used as reagents to prepare pharmaceutically acceptable base salts of the present polypeptides that are acidic in nature are those that form nontoxic base salts with such polypeptides.
- Such non-toxic base salts include, but are not limited to those derived from such pharmacologically acceptable cations such as alkali metal cations (e.g., potassium and sodium) and alkaline earth metal cations (e.g., calcium, zinc and magnesium), ammonium or water-soluble amine addition salts such as N-methylglucamine-(meglumine), and the lower alkanolammonium and other base salts of pharmaceutically acceptable organic amines, among others.
- alkali metal cations e.g., potassium and sodium
- alkaline earth metal cations e.g., calcium, zinc and magnesium
- ammonium or water-soluble amine addition salts such as N-methylglucamine-(meglumine)
- the lower alkanolammonium and other base salts of pharmaceutically acceptable organic amines among others.
- the polypeptides as described herein may, in accordance with the disclosure, be administered in single or divided doses by the oral, parenteral or topical routes.
- Administration of the active may range from continuous (intravenous drip) to several oral administrations per day (for example, Q.I.D.) and may include oral, topical, parenteral, intramuscular, intravenous, sub-cutaneous, transdermal (which may include a penetration enhancement agent), buccal, sublingual and suppository administration, among other routes of administration.
- Enteric coated oral tablets may also be used to enhance bioavailability of the polypeptides from an oral route of administration. The most effective dosage form will depend upon the pharmacokinetics of the particular agent chosen as well as the severity of disease in the patient.
- polypeptides according to the present disclosure as sprays, mists, or aerosols for intra-nasal, intra-tracheal or pulmonary administration may also be used.
- the present disclosure therefore also is directed to pharmaceutical compositions comprising an effective amount of polypeptide as described herein, optionally in combination with a pharmaceutically acceptable carrier, additive or excipient.
- Polypeptides according to the present disclosure may be administered in immediate release, intermediate release or sustained or controlled release forms. Sustained or controlled release forms are preferably administered orally, but also in suppository and transdermal or other topical forms. Intramuscular injections in liposomal form may also be used to control or sustain the release of polypeptide at an injection site.
- compositions as described herein may be formulated in a conventional manner using one or more pharmaceutically acceptable carriers and may also be administered in controlled-release formulations.
- Pharmaceutically acceptable carriers that may be used in these pharmaceutical compositions include, but are not limited to, ion exchangers, alumina, aluminum stearate, lecithin, serum proteins, such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes, such as prolamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, polyethylene glycol and wool fat.
- compositions as described herein may be administered orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally or via an implanted reservoir.
- parenteral as used herein includes subcutaneous, intravenous, intramuscular, intraarticular, intra-synovial, intrasternal, intrathecal, intrahepatic, intralesional and intracranial injection or infusion techniques.
- the compositions are administered orally, intraperitoneally or intravenously.
- Sterile injectable forms of the compositions as described herein may be aqueous or oleaginous suspension. These suspensions may be formulated according to techniques known in the art using suitable dispersing or wetting agents and suspending agents.
- the sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally- acceptable diluent or solvent, for example as a solution in 1, 3-butanediol.
- the acceptable vehicles and solvents that may be employed are water, Ringer's solution and isotonic sodium chloride solution.
- sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed including synthetic mono- or di-glycerides.
- Fatty acids such as oleic acid and its glyceride derivatives are useful in the preparation of injectables, as are natural pharmaceutically-acceptable oils, such as olive oil or castor oil, especially in their polyoxyethylated versions.
- oils such as olive oil or castor oil, especially in their polyoxyethylated versions.
- These oil solutions or suspensions may also contain a long-chain alcohol diluent or dispersant, such as Ph. Helv or similar alcohol.
- compositions as described herein may be orally administered in any orally acceptable dosage form including, but not limited to, capsules, tablets, aqueous suspensions or solutions.
- carriers which are commonly used include lactose and corn starch.
- Lubricating agents such as magnesium stearate, are also typically added.
- useful diluents include lactose and dried corn starch.
- aqueous suspensions are required for oral use, the active ingredient is combined with emulsifying and suspending agents. If desired, certain sweetening, flavoring or coloring agents may also be added.
- compositions as described herein may be administered in the form of suppositories for rectal administration.
- suppositories for rectal administration.
- a suitable non-irritating excipient which is solid at room temperature but liquid at rectal temperature and therefore will melt in the rectum to release the drug.
- suitable non-irritating excipient include cocoa butter, beeswax and polyethylene glycols.
- compositions as described herein may also be administered topically. Suitable topical formulations are readily prepared for each of these areas or organs. Topical application for the lower intestinal tract can be effected in a rectal suppository formulation (see above) or in a suitable enema formulation. Topically-acceptable transdermal patches may also be used.
- the pharmaceutical compositions may be formulated in a suitable ointment containing the active component suspended or dissolved in one or more carriers.
- Carriers for topical administration of the polypeptides of this disclosure include, but are not limited to, mineral oil, liquid petrolatum, white petrolatum, propylene glycol,
- polypeptides may be coated onto a stent which is to be surgically implanted into a patient in order to inhibit or reduce the likelihood of occlusion occurring in the stent in the patient.
- the pharmaceutical compositions may be formulated in a suitable lotion or cream containing the active components suspended or dissolved in one or more pharmaceutically acceptable carriers.
- suitable carriers include, but are not limited to, mineral oil, sorbitan monostearate, polysorbate 60, cetyl esters wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol and water.
- the pharmaceutical compositions may be formulated as micronized suspensions in isotonic, pH adjusted sterile saline, or, preferably, as solutions in isotonic, pH adjusted sterile saline, either with or without a preservative such as benzylalkonium chloride.
- the pharmaceutical compositions may be formulated in an ointment such as petrolatum.
- compositions as described herein may also be administered by nasal aerosol or inhalation.
- Such compositions are prepared according to techniques well- known in the art of pharmaceutical formulation and may be prepared as solutions in saline, employing benzyl alcohol or other suitable preservatives, absorption promoters to enhance bioavailability, fluorocarbons, and/or other conventional solubilizing or dispersing agents.
- compositions should be formulated to contain between about 0.05 milligram to about 750 milligrams or more, more preferably about 1 milligram to about 600 milligrams, and even more preferably about 10 milligrams to about 500 milligrams of active ingredient, alone or in combination with at least one other polypeptide according to the present dislcosure.
- a specific dosage and treatment regimen for any particular patient will depend upon a variety of factors, including the activity of the specific polypeptide employed, the age, body weight, general health, sex, diet, time of administration, rate of excretion, drug combination, and the judgment of the treating physician and the severity of the particular disease or condition being treated.
- a patient or subject in need of therapy using polypeptides according to the methods described herein can be treated by administering to the patient (subject) an effective amount of the polypeptide according to the present disclosure including pharmaceutically acceptable salts, solvates or polymorphs, thereof optionally in a pharmaceutically acceptable carrier or diluent, either alone, or in combination with other known erythopoiesis stimulating agents as otherwise identified herein.
- polypeptides can be administered by any appropriate route, for example, orally, parenterally, intravenously, intradermally, subcutaneously, or topically, including transdermally, in liquid, cream, gel, or solid form, or by aerosol form.
- the active polypeptide is included in the pharmaceutically acceptable carrier or diluent in an amount sufficient to deliver to a patient a therapeutically effective amount for the desired indication, without causing serious toxic effects in the patient treated.
- a preferred dose of the active polypeptide for all of the herein-mentioned conditions is in the range from about 10 ng/kg to 300 mg/kg, preferably 0.1 to 100 mg/kg per day, more generally 0.5 to about 25 mg per kilogram body weight of the recipient/patient per day.
- a typical topical dosage will range from 0.01-5% wt/wt in a suitable carrier.
- the polypeptide is conveniently administered in any suitable unit dosage form, including but not limited to one containing less than 1 mg, 1 mg to 3000 mg, preferably 5 to 500 mg of active ingredient per unit dosage form.
- An oral dosage of about 25-250 mg is often convenient.
- the active ingredient is preferably administered to achieve peak plasma concentrations of the active polypeptide of about 0.00001-30 mM, preferably about 0.1-30 ⁇ . This may be achieved, for example, by the intravenous injection of a solution or formulation of the active ingredient, optionally in saline, or an aqueous medium or administered as a bolus of the active ingredient. Oral administration is also appropriate to generate effective plasma concentrations of active agent.
- the concentration of active polypeptide in the drug composition will depend on absorption, distribution, inactivation, and excretion rates of the drug as well as other factors known to those of skill in the art. It is to be noted that dosage values will also vary with the severity of the condition to be alleviated. It is to be further understood that for any particular subject, specific dosage regimens should be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions, and that the concentration ranges set forth herein are exemplary only and are not intended to limit the scope or practice of the claimed composition.
- the active ingredient may be administered at once, or may be divided into a number of smaller doses to be administered at varying intervals of time.
- Oral compositions will generally include an inert diluent or an edible carrier.
- the active polypeptide or its prodrug derivative can be incorporated with excipients and used in the form of tablets, troches, or capsules.
- Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition.
- the tablets, pills, capsules, troches and the like can contain any of the following ingredients, or polypeptides of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a dispersing agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
- a binder such as microcrystalline cellulose, gum tragacanth or gelatin
- an excipient such as starch or lactose, a dispersing agent such as alginic acid, Primogel, or corn starch
- a lubricant such as magnesium stearate or Sterotes
- a glidant such as colloidal silicon dioxide
- dosage unit form When the dosage unit form is a capsule, it can contain, in addition to material of the above type, a liquid carrier such as a fatty oil.
- dosage unit forms can contain various other materials which modify the physical form of the dosage unit, for example, coatings of sugar, shellac, or enteric agents.
- the active polypeptide or pharmaceutically acceptable salt thereof can be administered as a component of an elixir, suspension, syrup, wafer, chewing gum or the like.
- a syrup may contain, in addition to the active polypeptides, sucrose as a sweetening agent and certain preservatives, dyes and colorings and flavors.
- the active polypeptide or pharmaceutically acceptable salts thereof can also be mixed with other active materials that do not impair the desired action, or with materials that supplement the desired action, such as an antimicrobial agent including an antibacterial agent.
- one or more polypeptides according to the present disclosure are coadministered with another bioactive agent, such as an antibacterial agent or a wound healing agent as otherwise described herein.
- Solutions or suspensions used for parenteral, intradermal, subcutaneous, or topical application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerin, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid;
- a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerin, propylene glycol or other synthetic solvents
- antibacterial agents such as benzyl alcohol or methyl parabens
- antioxidants such as ascorbic acid or sodium bisulfite
- chelating agents such as ethylenediaminetetraacetic acid
- buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose.
- the parental preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
- preferred carriers are physiological saline or phosphate buffered saline (PBS).
- the active polypeptides are prepared with carriers that will protect the polypeptide against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
- a controlled release formulation including implants and microencapsulated delivery systems.
- Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art.
- Liposomal suspensions may also be pharmaceutically acceptable carriers. These may be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811 (which is incorporated herein by reference in its entirety).
- liposome formulations may be prepared by dissolving appropriate lipid(s) (such as stearoyl phosphatidyl ethanolamine, stearoyl phosphatidyl choline, arachadoyl phosphatidyl choline, and cholesterol) in an inorganic solvent that is then evaporated, leaving behind a thin film of dried lipid on the surface of the container. An aqueous solution of the active polypeptide is then introduced into the container. The container is then swirled by hand to free lipid material from the sides of the container and to disperse lipid aggregates, thereby forming the liposomal suspension.
- appropriate lipid(s) such as stearoyl phosphatidyl ethanolamine, stearoyl
- the present disclosure also includes pharmaceutically acceptable formulations of the polypeptides described.
- formulations include salts of the above polypeptides, e.g., acid addition salts, for example, salts of hydrochloric, hydrobromic, acetic acid, and benzene sulfonic acid.
- a pharmacological composition or formulation refers to a composition or formulation in a form suitable for administration, e.g., systemic administration, into a cell or subject, preferably a human.
- systemic administration is meant in vivo systemic absorption or accumulation of drugs in the blood stream followed by distribution throughout the entire body. Suitable forms, in part, depend upon the use or the route of entry, for example oral, transdermal, or by injection. Such forms should not prevent the composition or formulation from reaching a target cell (i.e., a cell to which the negatively charged polymer is desired to be delivered to).
- pharmacological compositions injected into the blood stream should be soluble. Other factors are known in the art, and include considerations such as toxicity and forms which prevent the composition or formulation from exerting its effect.
- Administration routes which lead to systemic absorption include, without limitations: intravenous, subcutaneous, intraperitoneal, inhalation, oral, intrapulmonary and intramuscular.
- the rate of entry of a drug into the circulation has been shown to be a function of molecular weight or size.
- polypeptides of the present disclosure can potentially localize the drug, for example, in certain tissue types, such as the tissues of the reticular endothelial system (RES).
- tissue types such as the tissues of the reticular endothelial system (RES).
- RES reticular endothelial system
- formulation which can facilitate the association of drug with the surface of cells, such as, lymphocytes and macrophages is also useful.
- the present disclosure also features the use of the composition comprising surface-modified liposomes containing poly (ethylene glycol) lipids (PEG-modified, or long- circulating liposomes or stealth liposomes).
- PEG-modified, or long- circulating liposomes or stealth liposomes poly (ethylene glycol) lipids
- Polypeptides and compositions of the present disclosure can also comprise covalently attached PEG molecules of various molecular weights.
- These formulations offer a method for increasing the accumulation of drugs in target tissues.
- This class of drug carriers resists opsonization and elimination by the mononuclear phagocytic system (MPS or RES), thereby enabling longer blood circulation times and enhanced tissue exposure for the encapsulated drug (Lasic et al. Chem. Rev.
- compositions prepared for storage or administration which include a pharmaceutically effective amount of the desired polypeptides in a pharmaceutically acceptable carrier or diluent.
- Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R. Gennaro edit. 1985) hereby incorporated by reference herein.
- preservatives, stabilizers, dyes and flavoring agents can be provided. These include sodium benzoate, sorbic acid and esters of p-hydroxybenzoic acid.
- antioxidants and suspending agents can be used.
- an effective amount, pharmaceutically effective dose, therapeutically effective amount, or pharmaceutically effective amount is that dose required to prevent, inhibit the occurrence, or treat (alleviate a symptom to some extent, preferably all of the symptoms) of a disease state or pathological condition.
- the effective amount depends on the type of disease, the composition used, the route of administration, the type of mammal being treated, the physical characteristics of the specific mammal under consideration, concurrent medication, and other factors which those skilled in the medical arts will recognize. Generally, an amount between 0.1 mg/kg and 1000 mg/kg body weight/day of active ingredients is administered dependent upon potency of the negatively charged polymer.
- effective amounts of the compositions of the disclosure encompass those amounts utilized in the examples to facilitate the intended or desired biological effect.
- Toxicity and therapeutic efficacy of such polypeptides can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for
- LD50 the dose lethal to 50% of the population
- ED50 the dose therapeutically effective in 50% of the population.
- the dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50.
- Polypeptides that exhibit large therapeutic indices are preferred. While polypeptides that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such polypeptides to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.
- the data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans.
- the dosage of such polypeptides lies preferably within a range of circulating concentrations that include the ED 50 with little or no toxicity.
- the dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
- the therapeutically effective dose can be estimated initially from cell culture assays.
- a dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test polypeptide which achieves a half- maximal inhibition of symptoms) as determined in cell culture.
- IC50 i.e., the concentration of the test polypeptide which achieves a half- maximal inhibition of symptoms
- levels in plasma may be measured, for example, by high performance liquid chromatography.
- formulations can be administered orally, topically, parenterally, by inhalation or spray or rectally in dosage unit formulations containing conventional non-toxic
- parenteral includes percutaneous, subcutaneous, intravascular (e.g., intravenous), intramuscular, or intrathecal injection or infusion techniques and the like.
- a pharmaceutical formulation comprising a polypeptide of the disclosure and a pharmaceutically acceptable carrier.
- One or more polypeptides of the disclosure can be present in association with one or more non-toxic pharmaceutically acceptable carriers and/or diluents and/or adjuvants, and if desired other active ingredients.
- compositions of the present disclosure can be in a form suitable for oral use, for example, as tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsion, hard or soft capsules, or syrups or elixirs.
- compositions intended for oral use can be prepared according to any method known to the art for the manufacture of pharmaceutical compositions and such compositions can contain one or more such sweetening agents, flavoring agents, coloring agents or preservative agents in order to provide pharmaceutically elegant and palatable preparations.
- Tablets contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients that are suitable for the manufacture of tablets.
- excipients can be for example, inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, corn starch, or alginic acid; binding agents, for example starch, gelatin or acacia, and lubricating agents, for example magnesium stearate, stearic acid or talc.
- the tablets can be uncoated or they can be coated by known techniques. In some cases such coatings can be prepared by known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period.
- a time delay material such as glyceryl monosterate or glyceryl distearate can be employed.
- Formulations for oral use can also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium, for example peanut oil, liquid paraffin or olive oil.
- Aqueous suspensions contain the active materials in admixture with excipients suitable for the manufacture of aqueous suspensions.
- excipients are suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydropropyl-methylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents can be a naturally-occurring phosphatide, for example, lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, or condensation products of ethylene oxide with long chain aliphatic alcohols, for example heptadecaethyleneoxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyethylene sorbitan mono
- the aqueous suspensions can also contain one or more preservatives, for example ethyl, or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose or saccharin.
- preservatives for example ethyl, or n-propyl p-hydroxybenzoate
- coloring agents for example ethyl, or n-propyl p-hydroxybenzoate
- flavoring agents for example ethyl, or n-propyl p-hydroxybenzoate
- sweetening agents such as sucrose or saccharin.
- Oily suspensions can be formulated by suspending the active ingredients in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin.
- the oily suspensions can contain a thickening agent, for example beeswax, hard paraffin or cetyl alcohol.
- Sweetening agents and flavoring agents can be added to provide palatable oral preparations. These compositions can be preserved by the addition of an antioxidant such as ascorbic acid.
- Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives. Suitable dispersing or wetting agents or suspending agents are exemplified by those already mentioned above. Additional excipients, for example sweetening, flavoring and coloring agents, can also be present.
- Pharmaceutical compositions of the present disclosure can also be in the form of oil-in-water emulsions.
- the oily phase can be a vegetable oil or a mineral oil or mixtures of these.
- Suitable emulsifying agents can be naturally-occurring gums, for example gum acacia or gum tragacanth, naturally-occurring phosphatides, for example soy bean, lecithin, and esters or partial esters derived from fatty acids and hexitol, anhydrides, for example sorbitan monooleate, and condensation products of the said partial esters with ethylene oxide, for example
- polyoxyethylene sorbitan monooleate polyoxyethylene sorbitan monooleate.
- the emulsions can also contain sweetening and flavoring agents.
- Syrups and elixirs can be formulated with sweetening agents, for example glycerol, propylene glycol, sorbitol, glucose or sucrose. Such formulations can also contain a demulcent, a preservative and flavoring and coloring agents.
- the pharmaceutical compositions can be in the form of a sterile injectable aqueous or oleaginous suspension. This suspension can be formulated according to the known art using those suitable dispersing or wetting agents and suspending agents that have been mentioned above.
- the sterile injectable preparation can also be a sterile injectable solution or suspension in a non-toxic parentally acceptable diluent or solvent, for example as a solution in 1,3-butanediol.
- Suitable vehicles and solvents that can be employed are water, Ringer's solution and isotonic sodium chloride solution.
- sterile, fixed oils are conventionally employed as a solvent or suspending medium.
- any bland fixed oil can be employed including synthetic mono-or diglycerides.
- fatty acids such as oleic acid find use in the preparation of injectables.
- the composition can also be added to the animal feed or drinking water. It can be convenient to formulate the animal feed and drinking water compositions so that the animal takes in a therapeutically appropriate quantity of the composition along with its diet. It can also be convenient to present the composition as a premix for addition to the feed or drinking water.
- the composition can also be administered to a subject in combination with other therapeutic compounds to increase the overall therapeutic effect.
- the use of multiple polypeptides to treat an indication can increase the beneficial effects while reducing the presence of side effects.
- a further object of the present disclosure is to provide a kit comprising a suitable container, the therapeutic of the present disclosure in a pharmaceutically acceptable form disposed therein, and instructions for its use.
- Preparations for administration of the therapeutic of the present disclosure include sterile aqueous or non-aqueous solutions, suspensions, and emulsions.
- non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
- Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
- Vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's intravenous vehicles including fluid and nutrient replenishers, electrolyte replenishers, and the like.
- Preservatives and other additives may be added such as, for example, antimicrobial agents, anti-oxidants, chelating agents and inert gases and the like.
- compositions suitable for administration can be incorporated into pharmaceutical compositions suitable for administration.
- Such compositions typically comprise the polypeptide and a pharmaceutically acceptable carrier.
- pharmaceutically acceptable carrier is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Suitable carriers are described in the most recent edition of Remington's Pharmaceutical Sciences, a standard reference text in the field, which is incorporated herein by reference.
- Such carriers or diluents include, but are not limited to, water, saline, finger's solutions, dextrose solution, and 5% human serum albumin. Liposomes and non-aqueous vehicles such as fixed oils may also be used.
- the use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active polypeptide, use thereof in the compositions is contemplated. Supplementary active polypeptides can also be incorporated into the compositions.
- a pharmaceutical composition of the present disclosure is formulated to be compatible with its intended route of administration.
- routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (i.e., topical), transmucosal, intraperitoneal, and rectal administration.
- Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid (EDTA); buffers such as acetates, citrates or phosphates, and agents for the adjustment of tonicity such as sodium chloride or dextrose.
- the pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide.
- the parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
- compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
- suitable carriers include physiological saline, bacteriostatic water, CremophorTM. (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS).
- the composition must be sterile and should be fluid to the extent that easy syringeability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of
- the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof
- the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
- Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable
- compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
- an agent which delays absorption for example, aluminum monostearate and gelatin.
- the pharmaceutical compositions may take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinised maize starch,
- polyvinylpyrrolidone or hydroxypropyl methylcellulose fillers (e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc or silica); disintegrants (e.g., potato starch or sodium starch glycolate); or wetting agents (e.g., sodium lauryl sulphate).
- fillers e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate
- lubricants e.g., magnesium stearate, talc or silica
- disintegrants e.g., potato starch or sodium starch glycolate
- wetting agents e.g., sodium lauryl sulphate
- preparations for oral administration may take the form of, for example, solutions, syrups, or suspensions, or they may be presented as a dry product for constitution with water or other suitable vehicle before use.
- Such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol or fractionated vegetable oils); and preservatives (e.g., methyl or propyl-p-hydroxybenzoates or sorbic acid).
- the preparations may also contain buffer salts, flavoring, coloring, and sweetening agents as appropriate.
- Preparations for oral administration may be suitably formulated to give controlled release of the active polypeptide.
- the compositions may take the form of tablets or lozenges formulated in conventional manner.
- the polypeptides for use according to the present disclosure are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebuliser, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethan- e, carbon dioxide or other suitable gas.
- a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethan- e, carbon dioxide or other suitable gas.
- the dosage unit may be determined by providing a valve to deliver a metered amount.
- Capsules and cartridges of e.g. gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the polypeptide and a suitable powder base such as lactose or starch.
- the polypeptides may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion.
- Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative.
- the compositions may take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing, and/or dispersing agents.
- the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen- free water, before use.
- a suitable vehicle e.g., sterile pyrogen- free water
- the polypeptides may also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
- the polypeptides may also be formulated as a depot preparation. Such long acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by
- polypeptides may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
- the active polypeptides are prepared with carriers that will protect the polypeptide against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
- a controlled release formulation including implants and microencapsulated delivery systems.
- Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc.
- Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.
- Dosage unit form refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active polypeptide calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
- the specification for the dosage unit forms of the disclosure are dictated by and directly dependent on the unique characteristics of the active polypeptide and the particular therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active polypeptide for the treatment of individuals.
- This example demonstrates stapled peptides in accordance with embodiments of the invention.
- the data demonstrates the stapled peptides effectively target a protein-DNA interaction, which has not been observed previously.
- the synthesis protocol consists of removal of the Fmoc protective group with 25% piperidine in NMP, washing with NMP, and subsequent amino acid coupling using 10 equiv. amino acid (1 mL, 0.3 M), HCTU (0.99 mL, 0.3 M) and DIPEA (2.0 mL, 0.3 M) in NMP for 60 minutes before draining and washing. All polypeptide sequences include an N-terminal ⁇ -alanine spacing residue.
- the acetylation reaction consisted of deprotection of the Fmoc group as outlined above, followed by reaction with neat acetic anhydride (1 mL) and DIPEA (2 mL, 0.3 M in NMP) for 1 hour.
- Other experiments made use of N-terminal fluoresceinated peptides.
- Fmoc-deprotected peptides were exposed to fluorescein isothiocyanate (2.8 mL, 25 mM) and DIPEA (0.2 mL, 0.3 M) in DMF for 12 hours.
- spectrophotometer ThermoScientific, Wilmington, DE. Spectra were obtained on an Aviv Circular Dichroism Spectrometer, Model 420 (Aviv Biomedical, Inc, Lakewood, New Jersey) at 25°C. The spectra were collected using a 0.1 cm path length quartz cuvette (Hellma Analytics, Germany) with the following measurement parameters: wavelength, 240-190 nm; step resolution, 0.50 nm; averaging time, 5.0 sec per step.
- Spectra were processed using Aviv CDS Program software and converted to mean residue molar ellipticity using the cuvette path length (0.1 cm), the measured concentration, and the number of amino acids in the polypeptide (cross- linking amino acids and ⁇ -alanine cap were included as amino acids in this count).
- Klebsiella pneumoniae was cloned into the pET28b expression vector by PCR (Q5 Site-directed Mutagenesis Kit; New England Biolabs) and confirmed through Sanger sequencing. The plasmid was then transformed into E. coli Rosetta 2 (DE3) cells. The cells were grown at 37°C in 500 mL of LB medium and induced with 1 mM IPTG at ODeoo: -0.6. Four hours after induction cells were harvested via centrifugation and resuspended in IX PBS supplemented with IX Protease and Phosphatase Inhibitor Cocktail (ThermoScientific). Cells were lysed through sonication and the CTD was purified through Ni-affinity chromatography (Qiagen) and size exclusion chromatography (Superdex 75 10/300 GL; GE Healthcare).
- Electrophoretic Mobility Shift Assays (EMSA). FITC-g/rcAP2 DNA (5.625 nM) was initially incubated with the library of stapled peptides (20 ⁇ ) for 20 minutes at room temperature in the dark for 20 minutes, with DMSO as the negative control. The complexes were formed in 25 mM HEPES, 500 mM NaCl, 10% glycerol, pH 6.9. Next, the CTD protein (32 ⁇ ) was added to the mixture and further incubated at room temperature for 20 minutes. 12% polyacrylamide gels (29: 1 acrylamide:bisacrylamide) were pre-run for 40 minutes at 4°C at 70 V.
- Nitrogen starvation was induced in one of two ways: MG1655 E. coli were grown in LB broth, then switched to M9 minimal media (IX M9 salts, MgSC>4, CaCl 2 and 20% (w/v) glycerol) containing either 40 mM (nitrogen rich) or 100 ⁇ (nitrogen deficient) NH 4 C1.
- M9 minimal media IX M9 salts, MgSC>4, CaCl 2 and 20% (w/v) glycerol
- LB media LB media to an OD 6 oo of 0.4-0.6.
- 1.0 x 10 6 cells were washed twice with PBS and treated with the FITC-labeled stapled-a-helical polypeptide (4 ⁇ ) and incubated at 37°C for 90 min Samples were washed once with PBS and incubated at 4°C as pellets for 30 min Trypan Blue (0.04% w/v) was added to all samples and removed and washed with PBS. The measurements were performed using a Beckman-Coulter Gallios Flow Cytometer in which a 488 nm laser was used to excite FITC and fluorescence was detected using the FL1 channel.
- OD6oo 0.5-0.7 in LB media.
- the culture was split into separate 1 mL aliquots, centrifuged and resuspended in PBS.
- FITC-labeled compounds were added to a final concentration of 4 ⁇ .
- Samples were incubated at 37°C in the dark for 90 minutes and then centrifuged to pellet the cells. The supernatant was discarded and washed twice with PBS. After centrifugation, the samples were incubated on ice as pellets in the dark for 30 minutes.
- FM 4-64 was added to a concentration of 2 ⁇ g mL "1 and incubated for 5 min at 37°C in the dark.
- Fluorescence Polarization Binding Assays were performed as described. Briefly, to determine dissociation constants for polypeptide-DNA interactions, FITC- labeled oligonucleotides (5.625 nM) were incubated with different concentrations of stapled polypeptide (40 ⁇ - 9.8 nM) at 25°C for 10 min in FPA buffer (50 mM Tris-HCl pH 7.5, 1 mM DTT, 0.1 mg mL "1 BSA) in a black, opaque 96-well plate, and fluorescence polarization measured at equilibrium on a SpectraMax M5 microplate reader (Molecular Devices).
- FPA buffer 50 mM Tris-HCl pH 7.5, 1 mM DTT, 0.1 mg mL "1 BSA
- OD6oo OD6oo of 1.0 and seeded onto a white, opaque 96-well plate in LB broth. The cells were incubated with compounds at the indicated doses for 1 h. Cell viability was assayed by addition of BacTiter-GloTM bioluminescence reagent according to the manufacturer's protocol (Promega) and luminescence measured using a Spectramax M5 microplate reader (Molecular Devices). Data are normalized to vehicle-treated controls. [0192] Cell Viability Assays. Human Cells: WS1 normal fibroblasts (1.5 x 10 4 cells) were seeded onto a white, opaque 96-well plate. The cells were incubated with compounds at the indicated doses for 24 h.
- Opti-MEM Opti-MEM (Gibco).
- Cell viability was assayed by addition of CellTiter-GloTM bioluminescence reagent according to the manufacturer's protocol (Promega) and luminescence measured using a Spectramax M5 microplate reader (Molecular Devices). Data are normalized to vehicle-treated controls.
- qPCR reactions were as follows: 1 cDNA, 5 ⁇ , SYBR-Select Master Mix (Applied Biosystems) and 250 nM forward and reverse primer in a final volume of 10 ⁇ ,. Table 1 shows the sequences of all oligos and primers used.
- SEQ ID NOS: 81-84 have a /5fluorT/ at the 5' end.
- SEQ ID NOS: 85 and 86 have /56-FAM/ at the 5' end.
- Threshold-cycle (C t ) values were automatically calculated for each replicate and used to determine the relative expression of the gene of interest relative to cysG for both treated and untreated samples by the 2 " ⁇ method (Livak and Schmittgen, Methods, 25: 402-408, 2001, incorporated herein by reference). P-values were calculated using one-way ANOVA analysis.
- RNA-Seq RNA for the RNA-Seq experiment was obtained exactly as described previously for the quantitative RT-PCR experiment. RNA libraries were prepared for sequencing using standard Illumina protocols. Sequenced reads were trimmed for adaptor sequence, and masked for low-complexity or low-quality sequence, then mapped to E. coli K-12 genome using bowtie2 with default parameters. Reads were counted by feature count and then reads-per- megabase of library size (CPM) were generated and normalized by the limmaVoom pipeline. All data are publicly available through GEO (accession # GSE1 11317).
- Gene Set Enrichment Analysis Gene set enrichment analysis was performed using GSEAPreranked version 6 module from GenePattern (Reich et al., Nature Genetics 38: 500 (2006), incorporated by reference herein). The ranked list of genes based on fold change data from RNA-seq was used as the ranked list input for GSEAPreranked. A database containing 155 E. coli gene sets with fewer than 500 gene members each was obtained from gene2go (Powell, BMC Bioinformatics, 15:146 (2014), incorporated by reference herein). The gene set for rpoN regulon was generated by selecting all the genes with an intergenic sense rpoN consensus sequenced that were identified by ChlP-seq.
- the gene set for the rpoH regulon was obtained from genes dev 2006 20 1776.
- the rpoN and rpoH gene sets were combined to generate an alternative sigma factor gene set database. 1000 permutations of the gene set were used to assess the significance of the enrichment score for each gene set.
- Hierarchical clustering analysis Hierarchical clustering was performed using
- Heatmapper (doi: 10.1093/nar/gkw419).
- the distance measurement method used was Euclidean and clustering methods used was average linkage.
- WS1 fibroblasts cells were exposed to serial dilutions of each polypeptide (i.e., stapled polypeptide analog). As can be seen from FIG. 1, the polypeptides are not toxic to normal eukaryotic cells over a concentration range peaking at 10 ⁇ .
- E. coli cells were exposed to 10 ⁇ of each polypeptide (i.e., stapled polypeptide, vehicle control (DMSO) or wildtype polypeptide). As can be seen from FIG. 12, most of the stapled polypeptides have either low levels of cytotoxicity or no cytotoxicity at a concentration of 10 ⁇ .
- DMSO vehicle control
- polypeptides 1-4 all possess the hallmark spectrum of an alpha-helical secondary structure (FIG. 2).
- polypeptides is through active or passive transport. Furthermore, with passive transport, the entry of the polypeptide should be faster than active due to the lack of metabolic means necessary to promote cell entry.
- the majority of polypeptide analogs increase in penetration upon NaN 3 (i.e., sodium azide) treatment. This may be an indicator that the polypeptide is able to be pumped out by bacteria to as small degree. This data demonstrates that stapled polypeptides are capable of penetrating cells better than their unstapled counterpart in a charge independent manner.
- FIG. 5 The data is shown in FIG. 5 in which the stapled polypeptide at a concentration of 40 ⁇ to 39 nM were incubated with ⁇ YTC-glnAp2 (5.625 nM) for 10 minutes at 4 °C. Fluorescence polarization was read on a Spectramax M5 plate reader (Molecular Devices) and are shown in FIG. 5. Each individual points represents the mean value of 5 independent experiments, and the error bars are S.E.M.
- the scramble sequence was RVL * EFK* (Nle)T ARYK (SEQ ID NO: 75) with each asterisk being (S)-pentenylalanine.
- Each of the above had an acetyl N-terminal cap and were amidated at the C-terminus.
- FRET fluorescence lifetime imaging microscope
- FITC was selected as the polypeptide donor due to its excitation at 488 nm and Cy5 as the acceptor due to its lack of 488 nm excitation, its absorption within FITC's emission range, and its emission outside the FITC emission range. See FIG. 6.
- a Cy5 tagged DNA was immobilized on to a thin film of gold nanoparticles (AuNP), where the latter' s purpose is to enhance single molecular fluorescence events (Simoncelli, S. et al. Thermoplasmonic ssDNA Dynamic Release from Gold Nanoparticles Examined with Advanced Fluorescence Microscopy. J. Phys. Chem. Lett. 6, 1499-1503 (2015), incorporated by reference herein in its entirety). By using single molecular events, it is possible to visualize the direct interaction between DNA and polypeptide. FITC tagged polypeptide (donor) was then added to the AuNP-glnA conjugates, with FRET only to be observed upon the specific binding of the DNA and the stapled
- GlnA expression in the DMSO vehicle control is higher than when ⁇ 54-3 polypeptide treatment is applied to a sample of BW25113 cells.
- ⁇ 54-3 polypeptide treatment is applied to a sample of BW25113 cells.
- DMSO has surfactant properties that enable it to inhibit the natural surface tension of water.
- the crystal violet staining of the vehicle control varies among trials.
- PA01 was grown overnight.
- the culture was diluted so that the bacteria enter log phase.
- the diluted culture was plated into M63 media with or without polypeptides at 4 ⁇ in solution.
- the plate was angles at about 35° to allow for biofilm growth at the air-liquid interface.
- the plates were incubated for 6 hours and biofilm formation was observed. Crystal violet staining is proportional to the amount of biofilm present so a lower absorbance was indicative of less stain retention and thus, biofilm formation. As shown in FIG.
- the biofilm was homogenized and subjected to flow cytometry.
- the method is similar to that described above with regard to FIG. 10, but without the polypeptide treatment in the initial mixture.
- the biofilms were grown for 48 hours to reach maturity.
- the mature biofilms were then treated with the fluorescently labeled polypeptides for 90 minutes at 37°C.
- the treated biofilms were washed repeatedly with phosphate buffered saline (PBS) and the cells scraped from the plate.
- PBS phosphate buffered saline
- the removed cells were suspended in 1.5 mL tubes and placed on ice for 30 minutes and flow cytometry performed.
- the stapled polypeptides ⁇ 54-1 , ⁇ 54-2, ⁇ 54-3, and ⁇ 54-4 demonstrated substantially greater biofilm penetration, as compared to the wild type ⁇ 54 control polypeptide.
- FIG. 13 for a dot plot showing regulation of genes by the ⁇ 54 polypeptides.
- ⁇ 54 is primarily responsible for triggering transcription in response to nitrogen starvation. It was hypothesized that exposing E. coli cells to growth media deficient in nitrogen would initiate ⁇ 54 - mediated transcription of nitrogen metabolism genes, and subsequent treatment with SG 54 peptides would reverse or inhibit that transcriptional activation. To examine this, MG1655 E. coli cells were cultured in Gutnick minimal media to induce nitrogen starvation. Cells were then treated with polypeptide, and RNA was later isolated and processed for RT-PCR analysis (FIG. 14).
- pspA a ⁇ 54 - dependent gene that responds to cell membrane disruptions and is not responsive to nitrogen levels
- cysG was used as a control. Exposure to nitrogen deficient conditions activates transcription of glnA by a factor of 10, yeaG 100-fold, and nac close to 500-fold while pspA was unaffected by nitrogen depletion.
- RNA-Seq experiment was executed to analyze the transcriptome of E. coli.
- MG1655 E. coli cells were grown in Gutnick media to induce nitrogen starvation, were treated with either WT ⁇ 54 , SG 54 -1, or Sa 54 -2, and RNA isolated and processed for RNA-Seq.
- Comparison of the data set for Sa 54 -2 treatment versus DMSO control showed differential expression of 2,191 of the 4,273 genes detected, 1047 of which were positively regulated and 1140 were negatively regulated by a factor of 2 or greater.
- GSEA Gene set enrichment analysis
- Swarming activity of this pathogen is controlled directly by the transcriptional activity of ⁇ 54. Whereas unstapled polypeptide did not control swarming, stapled polypeptide ( ⁇ 54-2) did (the phenotype was consistent with inhibition of ⁇ 54 transcriptional activity).
- the present disclosure provides a polypeptide comprising: a polypeptide derived from a bacterial RNA polymerase cofactor comprising at least two non- natural amino acids.
- polypeptide is derived from the amino acid sequence: FKVARRTVAKYREML (SEQ ID NO: 3).
- polypeptide is a polypeptide comprising the structure of at least one of:
- aKV ARRTyAKYRE SEQ ID NO : 4
- KV ARRTy A YRE(M/ Q/ S/NL)6 SEQ ID NO: 5
- aKVApRRTVAKYRE SEQ ID NO: 7
- aKVApRTVA YRE SEQ ID NO: 8
- aKVApRTVAKYRE(M/Q/S/N L )LGIPSSRERRI SEQ ID NO: 36
- a VpRRTyA YRE(M/Q/S/N L )5GIPSSRERRI SEQ ID NO: 37
- At least two of the at least two non- natural amino acids form a hydrocarbon staple or disulfide bond.
- the polypeptide is from about 14 to about 27 amino acids in length.
- the polypeptide comprises at least one of an amino terminal capping group, a linker or a combination thereof.
- the location of the at least two non- natural amino acids forming a hydrocarbon staple or disulfide bond are located at positions i and i+7 or i and i+4 of an amino acid sequence of the polypeptide.
- d is independently a capping group, a linker, a tryptophan, or a combination thereof;
- i 0 or 1 ;
- a is F, x, z or a combination thereof
- ⁇ is A or x or both; ⁇ is V, z or x;
- ⁇ is L, M or x
- z and "x” correspond to a non-natural amino acid, wherein at least two of ⁇ , ⁇ , ⁇ , and 6 are non-natural amino acids.
- the location of the at least two non- natural amino acids forming a hydrocarbon staple or disulfide bond are located at positions i and i+7 or i and i+4 of an amino acid sequence of the polypeptide.
- the capping group is at least one of Ac (acetyl), FITC (fluorescein thiourea), Bt (biotinyl) or any other fluorophore or affinity agent.
- the linker is at least one of beta- alanine or other linking entity (e.g., PEG).
- x is (S)-pentenylalanine.
- z is (R)-octenylalanine.
- z is (R)-octenylalanine and x is (S)- pentenylalanine.
- B is any of the capping groups Ac (acetyl), FITC (fluorescein thiourea), Bt (biotinyl) or any other fluorophore or affinity agent,
- linker is beta-alanine or other linking entity (e.g., PEG),
- i is independently 0 or 1 .
- z corresponds to the non-natural amino acid (R)-octenylalanine.
- x corresponds to the non-natural amino acid (S)-pentenylalanine.
- B is any of the capping groups Ac (acetyl), FITC (fluorescein thiourea), Bt (biotinyl) or any other fluorophore or affinity agent,
- linker is beta-alanine or other linking entity (e.g., PEG),
- i is independently 0 or 1
- z corresponds to the non-natural amino acid (R)-octenylalanine.
- x corresponds to the non-natural amino acid (S)-pentenylalanine.
- polypeptide comprising Formula (I):
- each Ri and R 2 are independently H, alkyl, alkenyl, alkynyl, arylalkyl, cycloalkylalkyl, heteroaryl alkyl, or heterocyclylalkyl;
- each R 3 is independently alkylene, alkenylene, alkynylene; [R 4 — — R4']r>; each of which is substituted with 0-6 R 5 ;
- R4 and R4' are independently alkylene, alkenylene or alkynylene
- each R5 is independently is halo, alkyl, OR 6 , N(R 6 ) 2 , SR 6 , SOR 6 , SO2R6, CO2R6, R(usually a fluorescent moiety, or a radioisotope;
- K is independently O, S, SO, S0 2 , CO, C0 2 , CONR 6 or each R.6 is independently H, alkyl, or a therapeutic agent;
- R z and R w are independently H, hydroxyl, amide (NH2), tryptophan, a linker, D, a B- linker— , a linker-tryptophan— , a B-tryptophan— , or B-linker-tryptophan— ;
- B is any of the capping groups Ac (acetyl), FITC (fluorescein thiourea), Bt (biotinyl) or any other fluorophore or affinity agent;
- linker is beta-alanine or other linking entity (e.g., PEG);
- n is an integer from 1 -4;
- x is 2, 3, 4 or 6;
- y and w are independently integers from 0-100;
- each Xaa is independently an amino acid
- polypeptide comprises at least 8 contiguous amino acids of a bacterial RNA polymerase cofactor or a variant thereof or a homologue of a bacterial RNA polymerase cofactor or a variant thereof except that: (a) within the 8 contiguous amino acids the side chains of at least one pair of amino acids separated by 3, 4 or 6 amino acids is replaced by the linking group R 3 which connects the alpha carbons of the pair of amino acids as depicted in Formula I and (b) the alpha carbon of the first amino acid of the pair of amino acids is substituted with Ri as depicted in formula I and the alpha carbon of the second amino acid of the pair of amino acids is substituted with R 2 as depicted in Formula I.
- the bacterial RNA polymerase is alternative sigma factor ⁇ 54 (RpoN).
- polypeptide is derived from the amino acid sequence: FKVARRTVAKYRE(M/Q/S/N L )L (SEQ ID NO: 74), wherein N L is norleucine.
- x is 3 or 6.
- x is 2, 3, or 6; R 3 is an alkenyl containing a single double bond; and both Ri and R 2 are H.
- the [Xaa]* is selected from the group consisting of:
- NL is norleucine
- [Xaa]* is (i) AKYREM (SEQ ID NO: 64), [Xaa] w is FKVARRT (SEQ ID NO: 58) and/or
- [Xaa]* is (ii) RRT, [Xaa] w is FKV and/or [XaaL is AKYRE(M/S/Q/N L )L (SEQ ID NO: 59);
- [Xaa]* is (iii) KVARRT (SEQ ID NO: 57), [Xaa] w is H and/or [XaaL is
- AKYRE(M/S/Q/N L )L (SEQ ID NO: 59);
- [Xaa]* is (iv) FKV, [Xaa] w is H and/or [XaaL is RRTVAKYRE(M/S/Q/NL) (SEQ ID NO:
- [Xaa]x is (v) KVA, [Xaa] w is H and/or [Xaa] y is RRTVAKYRE(M/S/Q/N L ) (SEQ ID NO:
- [Xaa]* is (vi) KVARRT (SEQ ID NO: 57), [Xaa] w is H and/or [XaaL is
- [Xaa]* is (vii) QRK, [Xaa] w is AKYRESLSIPSS (SEQ ID NO: 61) and/or [XaaL is LV;
- [Xaa]* is (viii) ARK, [Xaa] w is AKYREQL(M/S/Q/N L )NIPSS (SEQ ID NO: 62) and/or [XaaL is YK; and
- [Xaa]* is (ix) RKR, [Xaa] w is AKYRE(M/S/Q/N L )LGIAPSS (SEQ ID NO: 63) and/or [Xaa] ⁇ is V.
- [Xaa] 3 ⁇ 4 is (i) AKYREM (SEQ ID NO: 64), [Xaa] w is FKVARRT (SEQ ID NO: 58) and/or [Xaa] ⁇ is GIPSSRERRI (SEQ ID NO: 65); [Xaa]* is (ii) RRT, [Xaa] w is FKV and/or [Xaa] y AK YRE(M/S/Q/N L)LGIP S S RERRI (SEQ ID NO: 66);
- [Xaa] is (iii) KVARRT (SEQ ID NO: 57), [Xaa] w is H and/or [XaaJ ⁇ is
- [Xaa]* is (v) KVA, [Xaa] w is H and/or [XaaL is RT V AK YRE(M/S/Q/NL)LGIP S S RERRI (SEQ ID NO: 67).
- q is an integer from 0-100.
- Ri, R 2 , and R 3 are independently selected; and [Xaa]*-, [Xaa] y , and [Xaa] v are selected from the group consisting of:
- KVARRT (SEQ ID NO: 57), AKYRE(M/S/Q/N L )LGIPSS (SEQ ID NO: 68), and ERR;
- KVARRT SEQ ID NO: 57
- AKYRESLSIPPS SEQ ID NO: 69
- QRK QRK
- KVARRT (SEQ ID NO: 57), AKYRE(M/S/Q/N L )LGIAPSS (SEQ ID NO: 63), and RKR;
- NL is nor leucine
- the present disclosure provides a pharmaceutical composition for treating or preventing a bacterial infection, the pharmaceutical composition comprising a therapeutically effective amount of a polypeptide of the present disclosure and a
- the present disclosure provides a method treating and/or preventing a bacterial infection, the method comprising: administering an effective amount of a composition of the present disclosure or a polypeptide of the present disclosure to a subject in need thereof, wherein the composition or polypeptide is effective in treating or preventing a symptom of the bacterial infection.
- the present disclosure provides a method of inhibiting
- the method comprising administrating an effective amount of a composition of the present disclosure or a polypeptide of the present disclosure.
- the invention provides a polypeptide comprising Formula (II):
- Ri and R 2 are independently H, alkyl, alkenyl, alkynyl, arylalkyl, cycloalkylalkyl, heteroarylalkyl, or heterocyclylalkyl;
- R31 and R32 are independently alkenyl, alkynyl, azido, amino, carboxylic acid, or sulfide or (ii) are taken together to form alkylene, alkenylene, alkynylene, or [R 4 — K— R 4 '] n , each of which is substituted with 0-6 R5;
- R 4 and Rt' are independently alkylene, alkenylene or alkynylene
- each R 5 is independently halo, alkyl, OR 6 , N(R&)2, SR 6 , SOR 6 , SO2R6, CO2R6, R&, a fluorescent moiety, or a radioisotope;
- each Re is H, alkyl, or a therapeutic agent
- Rz and R w are independently H, hydroxy!, NH 2 , tryptophan, a linker, B, a B-linker— , linker-tryptophan— , a B-tryptophan— , or B-linker-tryptophan— ;
- B is any of the capping groups Ac (acetyl), F1TC (fluorescein thiourea), Bt (biotinyl) any other fluorophore or affinity agent;
- linker is beta-alanine or other linking entity
- FKVARRTVAKYRE(M/Q/S N L ) (SEQ ID NO: 55), wherein two of the amino acids within the sequence are replaced with the residues A and B.
- R 3 1 and R 32 are taken together to form alkylene, alkenylene, alkynylene, or [R 4 — K— R4'] n , each of which is substituted with 0-6 Rs.
- polypeptide is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl
- i of Bi is 1, i of linkeri and Tryptophan! is 0 or 1 ;
- z and x each are a non-natural amino acid
- the non-natural amino acid that is z or x that is closest to Bi within the sequence is residue A and the other non-natural amino acid that is z or x within the sequence is residue B.
- z is (R)-octenylalanine.
- x is (S)-pentenylalanine.
- polypeptide is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl
- B is acetyl
- x is (S)-2-(4'pentenyl)-alanine
- z is (R)-2-(7'-octenyl)-alanine.
- the invention provides a pharmaceutical composition, the pharmaceutical composition comprising a therapeutically effective amount of a polypeptide of any polypeptide described herein and a pharmaceutically acceptable excipient.
- the pharmaceutical composition further comprises an additional agent.
- the invention provides any polypeptide described herein or a pharmaceutical composition described herein for use in treating and/or preventing a bacterial infection.
- the invention provides any polypeptide described herein or a pharmaceutical composition described herein for use in inhibiting transcription in a prokaryote.
- the invention provides a method of preventing or inhibiting food spoilage, the method comprising adding to food an effective amount of a polypeptide as described herein.
- the invention provides a method of preventing or treating a disease in a plant, the method comprising administering to the plant an effective amount of a polypeptide as described herein.
- the invention provides a method of preventing contamination of or disinfecting a medical device, the method comprising contacting the medical device with an effective amount of a polypeptide as described herein.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Pest Control & Pesticides (AREA)
- Plant Pathology (AREA)
- Agronomy & Crop Science (AREA)
- Dentistry (AREA)
- Environmental Sciences (AREA)
- Food Science & Technology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Polymers & Plastics (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Abstract
Disclosed herein are polypeptides, compositions, and methods for the treatment and/or prevention of microbial infections. In certain aspects, the disclosure provides a polypeptide derived from a bacterial RNA polymerase cofactor (e.g., alternative sigma factor σ54,) comprising at least two non-natural amino acids.
Description
INHIBITORS OF PROKARYOTIC GENE TRANSCRIPTION AND USES THEREOF
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This patent application claims the benefit of U.S. Provisional Patent Application
No. 62/471 ,681, filed March 15, 2017, which is incorporated herein by reference in its entirety.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT
[0002] This invention was made with Government support under project number Z01
ZIA BC 01151 1 by the National Institutes of Health, National Cancer Institute. The Government has certain rights in the invention.
INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED
ELECTRONICALLY
[0003] Incorporated by reference in its entirety herein is a computer-readable
nucleotide/amino acid sequence listing submitted concurrently herewith and identified as follows: One 52,309 Byte ASCII (Text) file named "737956_ST25.txt" dated March 15, 2018.
BACKGROUND OF THE INVENTION
[0004] Bacteria are the cause of numerous pathologies in animals (including humans) and plants. σ54 is a bacterial transcription factor that is widely distributed and highly conserved across most bacterial phyla and is present in many serious Gram negative pathogens such as Enterococcus faecium, Campylobacter jejuni, Acinetobacter baumannii, Klebsiella pneumonia, Pseudomonas aeruginosa, Borrelia burgdorferi, and Enterobacter spp. A number of structural studies have confirmed the binding of σ54 to RNAP and DNA. σ54 binds DNA -24 and -12 base pairs from the transcription start site to initiate DNA melting, an essential step in transcription. σ54 binds specifically and tightly to the major groove of DNA. The 66 amino acid long helix- turn-helix (HTH) motif from in Aquifex aeolicus binds DNA. Within this C-terminal HTH motif, a single a-helix at residues 377 to 386 (ARRTVAKYRE (SEQ ID NO: 34)), termed the
RpoN box, is responsible for binding to the major groove of DNA (PBD: 208K). It is known that replacement of Arg378, Arg379, Tyr384 and Arg385 with Ala decreased DNA binding substantially. The protein NMR structure shows that this helix interacts selectively with the -24 region (5'-TGGCACG-3') of the promoter. In particular, Arg378 and Arg379 are localized to the -24 element of the interaction and make multiple hydrogen bond and ionic interactions with Gua-25 and Gua-26 on the non-coding strand of DNA based on significant line-broadening of a 15N-HSQC spectrum. This leads to a high affinity interaction between the 66-mer HTH motif and the promoter region (Kd = 114 ± 10 nM).
[0005] With the ever increasing rates of multidrug resistant bacterial infections, there is an existing need for new therapeutic options, and in particular, to treat Gram negative infections.
BRIEF SUMMARY OF THE INVENTION
[0006] The present disclosure relates to the surprising and unexpected discovery of proteins and processes involved in the inhibition of microbial transcription and/or treating microbial infections.
[0007] In particular, presently described are polypeptides and compositions, which alone or in combination with other components, can modulate microbial transcription (e.g., bacterial transcription). Also described are, for example, polypeptides (including cytoplasmic, nuclear, membrane bound, and secreted polypeptides) as well as recombinant proteins, pseudopeptides, and fusion proteins.
[0008] In certain aspects, the present disclosure also relates to polypeptides and compositions useful as therapeutics for treating and/or preventing microbial infections (e.g., prokaryotic infections, bacterial infections, etc.).
[0009] A polypeptide of the present disclosure can comprise a polypeptide derived from a bacterial RNA polymerase cofactor (e.g., alternative sigma factor σ54,) comprising at least two non-natural amino acids. In an embodiment, the polypeptide is derived from the amino acid sequence FKVARRTVAKYREML (SEQ ID NO: 3). In another embodiment, the polypeptide is derived from the amino acid sequence F VARRTVAKYREMLGI (SEQ ID NO: 35). In additional embodiments, the polypeptide is derived from the amino acid sequence
(PAla)FKVARRTVAKYRE(M/Nle)L (SEQ ID NO: 20), wherein Ala is β-alanine. Nle is norleaucine.
[0010] In another aspect, the present disclosure provides a polypeptide comprising the structure of at least one of: (i) aKVARRTyAKYRE (SEQ ID NO: 4); (ii)
aKVARRTyAKYRE(M/Q/S/NL)5 (SEQ ID NO: 5); (iii) aFKVpRRTVAKYRE (SEQ ID NO: 6); (iv) aKVApRRTVAKYRE (SEQ ID NO: 7) or aKVApRTVAKYRE (SEQ ID NO: 8);
(v) aKVpRRTyA YRE (SEQ ID NO: 9); (vi) aKVA RTVAKYRE(M/Q/S/NL)LGIPSSRERRI (SEQ ID NO: 36); or (vii) a^RRTyAKYRE(M/Q/S/NL)6GIPSSRERRI (SEQ ID NO: 37). In an embodiment, the , β, γ, and δ are non-natural amino acids. In another embodiment, at least two of the α, β, γ, and δ are non-natural amino acids. In a certain embodiments, at least two of the at least two non-natural amino acids form a hydrocarbon staple or disulfide bond.
[0011] In further aspects, the present disclosure provides a polypeptide having the structure: [d]i(a)KV(P)RRT(Y)AKYRE(M/Q/S/NL)(6) (SEQ ID NO: 38);
[d] i(a)KV A(P)RTV AKYRE(6) (SEQ ID NO: 39);
[d]i(a)KV( )RRT(Y)AKYRE(M/Q/S/NL)(5)GIPSSRERRI (SEQ ID NO: 40); or
[d]i(a)KVA( )RTVAKYRE(M/Q/S/NL)LGIPSSRERRI (SEQ ID NO: 41), wherein: d is independently a capping group, a linker, a tryptophan, or a combination thereof; i can be 0 or 1. a is F, x, z or a combination thereof; β is A or x or both; γ is V, z or x; δ is L, M or x; and "z" and "x" correspond to a non-natural amino acid, wherein at least two of α, β, γ, and δ are non- natural amino acids.
[0012] In certain embodiments, the capping group is at least one of Ac (acetyl), FITC
(fluorescein thiourea), Bt (biotinyl) or any other fluorophore or affinity agent, and tryptophan. In another embodiment, the linker is at least one of beta-alanine or other linking entity (e.g., PEG).
[0013] In still additional embodiments, a polypeptide as described herein can be from about 14 to about 27 amino acids in length. In a particular embodiment, the location of the at least two non-natural amino acids forming a hydrocarbon staple or disulfide bond are located at positions i and i+7 or i and i+4 of an amino acid sequence of the polypeptide. In other
embodiments, the polypeptide comprises at least one of an amino terminal capping group, a linker or a combination thereof.
[0014] In another aspects, the present disclosure provides a polypeptide having the structure of a member selected from the group consisting of: Bi-linkeri-Tryptopharii- FKVARRTzAKYRE(Nle)x-NH2 (Sa54-1) (SEQ ID NO: 42); Bi-linkeri-Tryptophani- FKVxRRTxAKYRE(Nle)L-NH2 (So54-2) (SEQ ID NO: 43); Bi-linkerj-Tryptophani- zKVARRTxAKYRE(Nle)L-NH2 (Sa54-3) (SEQ ID NO: 44); Bi-linkeri-Tryptophani- xFKVxRTVAKYRE(Nle)L-NH2 (Sa54-4A) (SEQ ID NO: 45); Bi-linken-Tryptophanr x VAxRTVAKYRE(Nle)L-NH2 (Sa54-4B) (SEQ ID NO: 46); Bj-linkeri-Tryptophani- zKVARRTxAKYRE(Nle)LGIPSSxERRx-NH2 (AA So54) (SEQ ID NO: 47); Bi-linker,- Tryptophanj-zKVARRTxAKYRESLSIPSSxQRKxLV-NH2 (EC Sa54) (SEQ ID NO: 48); Β,- linkerj-Tryptophani-zKVARRTxAKYREQ(Nle)NIPSSxAPvKxYK-NH2 (BS So54) (SEQ ID NO: 49); Bi-linkeri-Tryptophani-zKVARRTxAKYRE(Nle)LGIAPSSxR RxV-NH2 (PA Sa54) (SEQ ID NO: 50); So54-l Long Bi-linkeri-Tryptophani-FKVARRTzAKYRE(Nle)xGIPSSRERRI-NH2 (SEQ ID NO: 51); Bi-linkeri-Tryptophani-FKVxRRTxAKYRE(Nle)LGIPSSRERRI-NH2 (So54-2 Long) (SEQ ID NO: 52); Bi-linkeri-Tryptophani-zKVARRTxA YRE(Nle)LGIPSSRERRI-NH2 (Sa54-3 Long) (SEQ ID NO: 53); and B pinker i-Tryptophani- xKVAxRTVAKYRE(Nle)LGIPSSRERRI-NH2 (So54-4 Long) (SEQ ID NO: 54). "B" is any of the capping groups Ac (acetyl), FITC (fluorescein, thiourea), Bt (biotinyl) or any other fluorophore or affinity agent, "linker" is beta-alanine or other linking entity (e.g., PEG), "i" is independently 0 or 1, and "z" and "x" correspond to a non-natural amino acid.
[0015] In further aspects, the present disclosure provides a polypeptide comprising
Formul
wherein:
each Ri and R2 are independently H, alkyl, alkenyl, alkynyl, arylalkyl, cycloalkylalkyl, heteroarylalkyl, or heterocyclylalkyl;
each R3 is independently alkylene, alkenylene, alkynylene; [R4— K— R4']n; each of which is substituted with 0-6 R5;
R4 and R4' are independently alkylene, alkenylene or alkynylene;
each R5 is independently is halo, alkyl, ORe;, N(R6)2, SR6, SOR6, SO2R6, C02R6, R6, a fluorescent moiety, or a radioisotope;
each R6 is independently H, alkyl, or a therapeutic agent;
Rz and Rw are independently H, hydroxyl, amide (NH2), tryptophan, a linker, B, a B linker— , a linker-tryptophan— , a B-tryptophan— , or B-linker-tryptophan— ;
"B" is any of the capping groups Ac (acetyl), FITC (fluorescein thiourea), Bt (biotinyl) or any other fluorophore or affinity agent;
"linker" is beta-alanine or other linking entity (e.g., PEG);
n is an integer from 1-4;
x is 2, 3, 4 or 6;
y and w are independently integers from 0-100; and
each Xaa is independently an amino acid;
wherein the polypeptide comprises at least 8 contiguous amino acids of a bacterial RNA polymerase cofactor or a variant thereof or a homologue of a bacterial RNA polymerase cofactor or a variant thereof except that: (a) within the 8 contiguous amino acids the side chains of at least one pair of amino acids separated by 3, 4 or 6 amino acids is replaced by the linking group R3 which connects the alpha carbons of the pair of amino acids as depicted in Formula I and (b) the alpha carbon of the first amino acid of the pair of amino acids is substituted with R\ as depicted
in formula I and the alpha carbon of the second amino acid of the pair of amino acids is substituted with R2 as depicted in Formula I.
[0016] In particular embodiments, the bacterial RNA polymerase cofactor is alternative sigma factor σ54 (RpoN). In another embodiment, the polypeptide is derived from the amino acid sequence: FKVARRTVAKYRE(M/Q/S/NL) (SEQ ID NO: 55), optionally with L after the last amino acid. In other embodiments, x is 2, 3, or 6; R3 is an alkenyl containing a single double bond; and/or both Ri and R2 are H. In an embodiment, the [Xaa]x is selected from the group consisting of: (i) AKYRE(M/S/ Q NL) (SEQ ID NO: 56); (ii) RRT; (iii) KVARRT (SEQ ID NO:
57) ; (iv) FKV; (v) KVA; (vi) QRK; (vii) ARK; and (vii) RKR. In an additional embodiment, when [Xaa]x is (i) AKYRE(M/S/ Q/NL) (SEQ ID NO: 56), [Xaa]w is FKVARRT (SEQ ID NO:
58) and/or [Xaa]y is H; when [Xaa]¾ is (ii) RRT, [Xaa]w is FKV and/or [Xaa]^ is
AKYRE(M/S/Q/NL)L (SEQ ID NO: 59); when [Xaa]* is (iii) KVARRT (SEQ ID NO: 57), [Xaa]w is H and/or [Xaa]^ is AKYRE(M/S/Q/NL)L (SEQ ID NO: 59); when [Xaa]* is (iv) FKV, [Xaa]„ is H and/or [Xaa]y is RRTVAKYRE(M/S/Q NL) (SEQ ID NO: 60); when [Xaa]x is (v) KVA, [Xaa)w is H and/or [Xaa^ is RRTVAKYRE(M/S/Q/NL) (SEQ ID NO: 60); when [Xaa] is (vi) KVARRT (SEQ ID NO: 57), [Xaa]w is H and/or [Xaa],v is AKYRE(M/S/Q NL) (SEQ ID NO: 56), wherein NL is norleucine; when [Xaa]x is (vii) QRK, [Xaa]w is AKYRESLSIPSS (SEQ ID NO: 61) and/or [Xaa]y is LV; when [Xaa]* is (viii) ARK, [Xaa]w is
AKYREQL(M/S/Q/NL)NIPSS (SEQ ID NO: 62) and/or [Xaa^ is YK; and/or when [Xaa]* is (ix) RKR, [Xaa]„ is AKYRE(M/S/Q/NL)LGIAPSS (SEQ ID NO: 63) and/or [Xaa]y is V. In another embodiment, when: [Xaa]* is (i) AKYREM (SEQ ID NO: 64), [Xaa]w is FKVARRT (SEQ ID NO: 58) and/or [Xaa]^ is GIPSSRERRI (SEQ ID NO: 65); [Xaa]* is (ii) RRT, [Xaa]w is FKV and/or [Xaa]y AKYRE(M/S/Q/NL)LGIPSSRERRI (SEQ ID NO: 66); [Xaa]x is (iii) KVARRT (SEQ ID NO: 57), [Xaa]w is H and/or [Xaa]^ is AKYRE(M/S/Q/NL)LGIPSSRERRI (SEQ ID NO: 66); [Xaa]x is (v) KVA, [Xaa]w is H and/or [Xaa] . is
RTVAKYRE(M/S/Q/NL)LGIPSSRERRI (SEQ ID NO: 67).
[0017] In certain aspects, the present disclosure provides for a polypeptide comprising:
or a pharmaceutically acceptable salt thereof, wherein:
q is an integer from 0-100; and
Ri, R2, and R3 are independently selected; and [Xaa]*, [Xaa]^, and [Xaa]v are selected from the group consisting of: (i) KVARRT (SEQ ID NO: 57), AKYRE(M/S/Q/NL)LGIPSS (SEQ ID NO: 68), and ERR; (ii) KVARRT (SEQ ID NO: 57), AKYRESLSIPPS (SEQ ID NO: 69), and QRK; (iii) KVARRT (SEQ ID NO: 57), AKYREQ(M/S/Q NL)NIPSS (SEQ ID NO: 70), and ARK; and (iv) KVARRT (SEQ ID NO: 57), AKYRE(M/S/Q/NL)LGIAPSS (SEQ ID NO: 63), and RKR. In a particular embodiment, when [Xaa]*, [Xaa]y, and [Xaa]v is (ii), [Xaa]9 is LV; when [Xaa]*, [Xaa]y, and [Xaa]v is (iii), [Xaa]? is YK; and when [Xaa]*, [Xaa]y, and [Xaa]v is (iv), [Xaa]? is V.
[0018] In another aspect, the invention provides a polypeptide comprising Formula (II):
B
or a pharmaceutically acceptable salt thereof,
wherein:
Ri and R2 are independently H, alkyl, alkenyl, alkynyl, arylalkyl, cycloalkylalkyl, heteroarylalkyl, or heterocyclylalkyl;
R31 and R32 (i) are independently alkenyl, alkynyl, azido, amino, carboxylic acid, or sulfide or (ii) are taken together to form alkylene, alkenylene, alkynylene, or
each of which is substituted with 0-6 R5;
R4 and *' are independently alkylene, alkenylene or alkynylene;
each R5 is independently halo, alkyl, OR6, N(R6)2, SR6, SOR6, S02R6, C02R6, R6, a fluorescent moiety, or a radioisotope;
each R6 is H, alkyl, or a therapeutic agent;
Rz and Rw are independently H, hydroxyl, NH2, tryptophan, a linker, B, a B-linker— , a linker-tryptophan— , a B-tryptophan— , or B-linker-tryptophan— ;
B is any of the capping groups Ac (acetyl), FITC (fluorescein thiourea), Bt (biotinyl) or any other fluorophore or affinity agent;
linker is beta-alanine or other linking entity;
n is an integer from 1-4;
x is an integer from 2-6; and
[Xaa]w, [Xaa]x, and [Xaa]y taken together have the amino acid sequence of
FKVARRTVAKYRE(M/Q/S/NL) (SEQ ID NO: 55), wherein two of the amino acids within the sequence are replaced with the residues A and B.
[0019] In certain additional aspects, the present disclosure relates to therapeutic or pharmaceutical compositions, and methods related to the treatment and/or prevention of microbial infections (e.g. prokaryotic infections or bacterial infections). The pharmaceutical composition for treating or preventing a microbial infection can comprise a therapeutically effective amount of a polypeptide of the present disclosure and a pharmaceutically acceptable excipient. In some embodiments, the method treating or preventing a microbial infection (e.g., a prokaryotic or bacterial infection) comprises administering an effective amount of a composition of the present disclosure or a polypeptide of the present disclosure to a subject in need thereof,
wherein the composition or polypeptide is effective in treating or ameliorating a symptom of the microbial infection.
[0020] In additional embodiments, the compositions of the present disclosure further include an additional therapeutic agent. In particular embodiments, the therapeutic agent is at least one of an antimicrobial agent (e.g., antibiotic) and an ameliorative agent.
[0021] In still another aspect, the present disclosure provides a method of inhibiting transcription in a prokaryote (e.g. bacteria) comprising administering an effective amount of a composition of the present disclosure or a polypeptide of the present disclosure, wherein the composition or polypeptide is effective in inhibiting transcription in a prokaryote.
[0022] The preceding general areas of utility are given by way of example only and are not intended to be limiting on the scope of the present disclosure and appended claims.
Additional objects and advantages of the present invention will be appreciated by one of ordinary skill in the art in light of the instant claims, description, and examples. For example, the various aspects and embodiments of the invention may be utilized in numerous combinations, all of which are expressly contemplated by the present description. These additional objects and advantages are expressly included within the scope of the present invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0023] The accompanying drawings, which are incorporated into and form a part of the specification, illustrate several embodiments of the present invention and, together with the description, serve to explain the principles of the invention. The drawings are only for the purpose of illustrating (an) embodiment(s) of the invention and are not to be construed as limiting the invention.
[0024] FIG. 1. Eukaryotic cell viability when treated with stapled polypeptides. Each stapled polypeptide (50 μΜ - 97 nM) was incubated with WS1 fibroblast cells (1.5E4 viable cells/well) for 24 hours at 37 °C. Viability was determined with the CellTiter-Glo viability assay (Promega) using a Spectramax M5 plate reader (Molecular Devices, San Jose, CA, USA). Error bars = S.E.M, Points = Mean values of 3 independent experiments. The circle represents the wild-type unstapled polypeptide, the square represents σ54-1, the upward pointing triangle
represents σ54-2, the diamond represents σ54-3, and the downward pointing triangle represents σ54-4.
[0025] FIG. 2. Circular dichroism spectra of acetylated stapled a-helical polypeptide analogs. Polypeptide concentrations ranged from 60 to 77 μΜ in water.
[0026] FIG. 3. Flow cytometry analysis of cell penetration of FITC-tagged stapled a- helical polypeptide analogs with a Beckman Coulter Gallios flow cytometer. Bacteria were incubated with polypeptide for 90 minutes at 37°C followed by 30 minutes at 4°C.
[0027] FIG. 4. Confocal microscopy of BW251 13 cells under FITC-tagged polypeptide treatment for 30 minutes at 37°C. Cells were treated with FM4-64 (1 jig/mL) and DAPI (2 μg/ L) prior to slide mounting. Three samples are shown in the rows above: A) Vehicle, B)
WT-o54, C) σ54 -2.
[0028] FIG. 5. Fluorescence polarization of the stapled polypeptides and ¥Y∑C-glnAp2.
Each stapled polypeptide (40 μΜ - 39 nM) was incubated with FlTC-glnAp2 (5.625 nM) for 10 minutes at 4 °C. Fluorescence polarization was read on a Spectramax M5 plate reader (Molecular Devices). Scramble sequence was used as a control. Error bars = S.E.M, Points = Mean values of 5 independent experiments.
[0029] FIG. 6. Fluorescence excitation (filled) and emission (open) spectra of a FITC tagged σ54 stapled polypeptide and the Cy5 tagged dsDNA strand.
[0030] FIGS. 7 A and 7B. Fluorescence lifetime imaging microscopy of double stranded
DNA immobilized on gold nanoparticles. Polypeptides were incubated for 3 hours at 4°C in a humidity chamber. The plots represent Cy5-tagged DNA bound with acetylated σ54-2 and excited at 620 nm and Cy5-tagged DNA interaction with FITC-tagged σ54-2 and excited at 488 nm.
[0031] FIG. 8. Relative GlnA activity in treated BW25113 cells.
[0032] FIGS. 9A, 9B, 9C, 9D, 9E, 9F, 9G, 9H, 91, 93, 9K, and 9L. Motility assay conducted with soft LB agar with polypeptide concentrations of 4 μΜ). E. coli cells were incubated with media mixed with polypeptide for 18 hours at 37°C. A-F) MC4100 cells display the knockout phenotype and BW25113 cells are used to determine motility in G) Vehicle H) WT-a54 I) σ54-1 J) σ54-2 K) σ54-3 L) σ54-4.
[0033] FIG. 10. Absorbance of retained crystal violet in PA01 biofilms grown 6 hour post-inoculation in 0.4% arginine supplemented M63 media with 4 μΜ polypeptide.
[0034] FIG. 11. Percent of cells fluorescently labeled in PA01 biofilms treated with FITC labeled σ-54 polypeptides, FITC labeled wildtype σ54 polypeptides (control), and DMSO
(control)
[0035] FIG. 12. Prokaryotic cell viability when treated with stapled polypeptides.
MG1655 E. coli were grown in Gutnick Minimal Media (33.8 mM KH2P04, 77.5 mM K2HPO4, 5.74 mM K2S04, 0.41 mM MgS04) supplemented with Ho-LE trace elements, 0.4% glucose (w/v), and 3 mM NH4CI. At ~O.D. 0.5, cells were treated with 10 μΜ stapled polypeptide, DMSO vehicle control, or wildtype control for 4 hours, then plated on LB agar at various dilutions and incubated at 37 °C overnight. The following day, colonies were counted and used to back-calculate colony forming units per mL of culture. Error bars = S.E.M. of 3 independent experiments, bars = mean values.
[0036] FIG. 13 presents a dot plot showing regulation of genes by the σ54 polypeptides.
[0037] FIG. 14 presents bar graphs showing relative normalized expression of σ54- controlled genes after treatment with So54. Data are represented as mean ± SEM. N+ denotes nitrogen-rich media while N- indicates nitrogen-deficient media. The bars are from left to right: N+, N- (DMSO), σ54 WT, Sa54-1, Sa54-2, Sa54-3, Sa54-4B.
[0038] FIG. 15 presents a bar graph showing glutamine synthetase transferase assay with
A540 values normalized to OD600. Data are represented as mean ± SEM.
DETAILED DESCRIPTION OF THE INVENTION
[0039] As described herein, the compositions or polypeptides of the present disclosure can provide a significant inhibition of transcription in prokaryotes, treat and/or prevent a prokaryotic infection, ameliorate the systems of a prokaryotic infection, or any combination thereof, and therefore, the compositions and/or polypeptides of the present disclosure represent a novel therapeutic intervention for the treatment and/or prevention of, for example, bacterial infections and tissue damage/injury caused therefrom.
[0040] The present disclosure is related, in part, to the surprising and unexpected discovery that the polypeptides and compositions of the present disclosure are capable of inhibiting prokaryotic transcription and therefore, are effective in the treatment and/or prevention of prokaryotic infection, or ameliorating and/or preventing the symptoms of a prokaryotic infection.
[0041] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entireties. In the case of conflict, the present specification, including definitions, will control. In addition, the examples are illustrative only and not intended to be limiting.
[0042] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise (such as in the case of a group containing a number of amino acids in which case each amino acid number falling within the range is provided), between the upper and lower limit of that range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges is also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either both of those included limits are also included in the invention.
[0043] The following terms are used to describe the present invention. In instances where a term is not specifically defined herein, that term is given an art-recognized meaning by those of ordinary skill applying that term in context to its use in describing the present invention.
[0044] The articles "a" and "an" as used herein and in the appended claims are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article unless the context clearly indicates otherwise. By way of example, "an element" means one element or more than one element.
[0045] The phrase "and/or," as used herein in the specification and in the claims, should be understood to mean "either or both" of the elements so conjoined, i.e., elements that are
conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with "and/or" should be construed in the same fashion. Other elements may optionally be present other than the elements specifically identified by the "and/or" clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to "A and/or B", when used in conjunction with open-ended language such as "comprising" can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.
[0046] As used herein in the specification and in the claims, "or" should be understood to have the same meaning as "and/or" as defined above. For example, when separating items in a list, "or" or "and/or" shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as "only one of or "exactly one of," or, when used in the claims, "consisting of," will refer to the inclusion of exactly one element of a number or list of elements. In general, the term "or" as used herein shall only be interpreted as indicating exclusive alternatives (i.e., "one or the other but not both") when preceded by terms of exclusivity, such as "either," "one of," "only one of," or "exactly one of."
[0047] In the claims, as well as in the specification above, all transitional phrases such as
"comprising," "including," "carrying," "having," "containing," "involving," "holding,"
"composed of," and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases "consisting of and "consisting essentially of shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03 (Ninth Edition, Revision 08.2017, Last Revised January 2018).
[0048] As used herein in the specification and in the claims, the phrase "at least one," in reference to a list of one or more elements, should be understood to mean at least one element selected from anyone or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows
that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase "at least one" refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, "at least one of A and B" (or, equivalently, "at least one of A or B," or, equivalently "at least one of A and/or B") can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.
[0049] It should also be understood that, in certain methods described herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited unless the context indicates otherwise.
[0050] The phrases "pharmaceutically or pharmacologically acceptable" refer to molecular entities and compositions that do not produce an adverse, allergic or other undesirable reaction when administered to an animal, or a human, as appropriate.
[0051] The terms "co -administration" and "co-administering" or "combination therapy" refer to both concurrent administration (administration of two or more therapeutic agents at the same time) and time varied administration (administration of one or more therapeutic agents at a time different from that of the administration of an additional therapeutic agent or agents), as long as the therapeutic agents are present in the patient to some extent, preferably at effective amounts, at the same time. In certain preferred aspects, one or more of the present polypeptides described herein, are co-administered in combination with at least one additional bioactive agent, especially including an anticancer agent. In particularly preferred aspects, the co-administration results in synergistic activity and/or therapy, including anticancer activity.
[0052] The term "polypeptide" encompasses two or more naturally occurring or synthetic amino acids linked by a covalent bond (e.g., an amide bond). Polypeptides as described herein include full length proteins (e.g., fully processed proteins) as well as shorter amino acids sequences (e.g., fragments of naturally occurring proteins or synthetic polypeptide fragments).
[0053] The term "amino acid side chain" refers to a moiety attached to the a-carbon in an amino acid. For example, the amino acid side chain for alanine is methyl, the amino acid side chain for phenylalanine is phenylmethyl, the amino acid side chain for cysteine is thiomethyl, the amino acid side chain for tyrosine is 4-hydroxyphenylmethyl, etc. Other non-naturally occurring amino acid side chains are also included for example, those that occur in nature (e.g., an amino acid metabolite) or those that are made synthetically (e.g., an alpha di-substituted amino acid).
[0054] "Non-natural amino acid" as used herein means any amino acid that may form a polypeptide, excluding the "natural amino acids" that form polypeptides in mammals. The "natural amino acids" are alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine.
[0055] A "non-essential" amino acid residue is a residue that can be altered from the wild-type sequence of a polypeptide without abolishing or substantially altering its activity. An "essential" amino acid residue is a residue that, when altered from the wild-type sequence of the polypeptide, results in abolishing or substantially abolishing the polypeptides activity.
[0056] A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
[0057] The term "halo" refers to any radical or fluorine, chlorine, bromine, or iodine.
The term "alkyl" refers to a hydrocarbon chain that may be a straight chain or branched chain, containing the indicated number of carbon atoms. For example, Ci-Cio indicates that the group may have from 1 to 10 (inclusive) carbon atoms in it. In the absence of any numerical designation, "alkyl" is a chain (straight or branched) having 1 to 20 (inclusive) carbon atoms in it
(i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 carbon atoms). The term "alkylene" refers to a divalent alkyl (i.e.,— R— ).
[0058] The term "alkenyl" refers to a hydrocarbon chain that may be a straight chain or branched chain having one or more carbon-carbon double bonds in either Z or E geometric configurations. The alkenyl moiety contains the indicated number of carbon atoms. For example, C2-C10 indicates that the group may have from 2 to 10 (inclusive) carbon atoms in it. The term "lower alkenyl" refers to a C2-C8 alkenyl chain. In the absence of any numerical designation, "alkenyl" is a chain (straight or branched) having 2 to 20 (inclusive) carbon atoms in it.
[0059] The term "alkynyl" refers to a hydrocarbon chain that may be a straight chain or branched chain having one or more carbon-carbon triple bonds. The alkynyl moiety contains the indicated number of carbon atoms. For example C2-C10 indicates that the group may have from 2 to 10 (inclusive) carbon atoms in it. The term "lower alkynyl" refers to a C2-C8 alkynyl chain. In the absence of any numerical designation, "alkynyl" is a chain (straight or branched) having 2 to 20 (inclusive) carbon atoms in it.
[0060] The term "aryl" refers to a 6-carbon monocyclic or 10-carbon bicyclic aromatic ring system wherein 0, 1 , 2, 3, or 4 atoms of each right may be substituted by a substituent. Examples of aryl groups include phenyl, naphthyl and the like. The term "arylalkyl" or the term "aralkyl" refers to alkyl substituted with an aryl. The term "arylalkoxy" refers to an alkoxy substituted with aryl.
[0061] The term "cycloalkyl" as employed herein includes saturated and partially unsaturated cyclic hydrocarbon groups having 3 to 12 carbons, preferably 3 to 8 carbons, and more preferably 3 to 6 carbons, wherein the cycloalkyl group additionally may be optionally substitute. Preferred cycloalkyl groups include, without limitation, cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexenyl, cycloheptyl, and cyclooctyl.
[0062] The term "heteroaryl" refers to an aromatic 5-8 membered monocyclic, 8-12 membered bicyclic, or 1 1-14 membered tricyclic right system having 1-3 heteroatoms if monocyclic, 1-6 heteroatoms if bicyclic, or 109 heteroatoms if tricyclic, said heteroatoms selected from O, N, or S (e.g., carbon atoms and 1-3, 1-6, or 1-9 heteroatoms of N, O, or S if
monocyclic, bicyclic, or tricyclic, respectively), wherein 0, 1, 2, 3, or 4 atoms of each ring may be substituted by a substituent. Examples of heteraryl groups include pyridyl, furyl, or furanyl, imidazolyl, 1, 2, 3-triazolyl, 1, 2, 4-triazolyl, benzimidazolyl, pyrimidinyl, thiophenyl or thienyl, quinolinyl, indolyl, thiazolyl, and the like. The term "heteroarylalkyl" or the term
"heteroaralkyl" refers to an alkyl substituted with a heteroaryl. The term "heteroarylalkoxy" refers to an alkoxy substituted with heteroaryl.
[0063] The term "heterocyclyl" refers to a nonaromatic 5-8 membered monocyclic, 8012 membered bicyclic, or 11-14 membered tricyclic ring system having 1-3 heteroatoms if monocyclic, 1-6 heteroatoms if bicyclic, or 1-9 heteroatoms if tricyclic, said heteroatoms selected from O, N, or S (e.g., carbon atoms and 1-3, 1-6, or 1-9 heteroatoms of N, O, or S if monocyclic, bicyclic, or tricyclic, respectively), wherein 0, 1, 2, or 3 atoms of each ring may be substituted by a substituent. Examples of heterocyclyl groups include piperazinyl, pyrrolidinyl, dioxanyl, aziridinzyl, oxiryl, thiiryl, morpholinyl, tetrahydrofuranyl, and the like.
[0064] The term "substituents" refers to a group "substituted" on an alkyl, cycloalkyl, aryl, heterocyclyl, or heteroaryl group at any atom of that group. Suitable substituents include, without limitations, halo, hydroxyl, mercapto, oxo, nitro, haloalkyl, alkyl, alkaryl, aryl, aralkyl, alkoxy, thioalkoxy, aryloxy, amino, alkoxycarbonyl, amido, carboxy, alkanesulfonyl, alkylcarbonyl, azido, and cyano groups.
[0065] The term "patient" or "subject" is used throughout the specification to describe an animal, preferably a human or a domesticated animal, to whom treatment, including prophylactic treatment, with the polypeptides and compositions according to the present disclosure is provided. For treatment of those infections, conditions or disease states which are specific for a specific animal such as a human patient, the term patient refers to that specific animal, including a domesticated animal such as a dog or cat or a farm animal such as a horse, cow, sheep, etc. In general, in the present disclosure, the term patient refers to a human patient unless otherwise stated or implied from the context of the use of the term.
[0066] The term "effective" is used to describe an amount of a polypeptide, compound, composition or component which, when used within the context of its intended use, effects an
intended result. The term effective subsumes all other effective amount or effective concentration terms, which are otherwise described or used in the present application.
[0067] Aspects of the present disclosure provide for internally cross-linked alpha helical domain polypeptides related to a bacterial R A polymerase cofactor (e.g., RpoN). The polypeptides include a tether (also referred to as a cross-link) between two non-natural amino acids that significantly enhance the alpha helical secondary structure of the polypeptide.
Generally, the tether or cross-link (also referred to as a staple) extends across the length of one or two helical turns (i.e., about 3.4 or about 7 amino acids). Accordingly, amino acids positioned at i and i+3, i and i+4, or i and i+7 are ideal candidates for chemical modification and cross-linking. Thus, for example, where a polypeptide has the sequence...Xaai, Xaa2, Xaa3, Xaa^, Xaa5, Xaa6, Xaa7, Xaa8, Xaa9,...(wherein "..." indicates the optional presence of additional amino acids), cross-links between Xaai and Xaa8 are useful as are cross-links between Xaa2 and Xaa5, or between Xaa2 and Xaa6, or between Xaa2 and Xaa9, etc. The polypeptides can include more than one cross-link within the polypeptide sequence to either further stabilize the sequence or facilitate the stabilization of longer polypeptide stretches. If the polypeptides are too long to be readily synthesized in one part, independently synthesized, cross-linked polypeptides can be conjoined by a technique called native chemical ligation (Bang, et al, J Am. Chem. Soc. 126: 1377-83 (2004), incorporated by reference herein in its entirety).
[0068] Unlike traditional small molecules, stapled a-helical polypeptides can bind over extended surfaces and are thus more likely to be able to inhibit σ54 binding to either RNAP or DNA. As the interaction of σ54 with DNA is predominantly mediated by a single a-helix, a stapled polypeptide should act as an effective competitive inhibitor of this binding event.
Inhibition of σ54 binding to DNA will lead to a decrease in the transcription of genes required for pathogenicity. Without wishing to be bound by theory, stapled polypeptides, due to their amphipathic nature, have the ability to permeate the bacterial cell membrane allowing for the successful targeting of intracellular interactions.
[0069] The present disclosure is the first instance of stapled a-helical polypeptides being used in bacterial models as both a tool to study σ54 and as a novel method to targeting Gram negative bacteria through a route that bypasses innate multidrug resistances. The present
disclosure shows that the staples enable polypeptides to adopt an a-helical confirmation without inducing cell death mechanisms in either bacteria or mammalian cell cultures. The present disclosure further shows that stapled polypeptides are able to enter bacteria and through a mechanism different to that of other mammalian stapled polypeptides currently under study. The binding of the polypeptides appears to be quite strong and is detectable at the nanomolar range. While the polypeptide appears to bind well to DNA, in vivo studies below confirm that the polypeptide inhibits σ54 function.
[0070] In certain aspects, the present disclosure relates to compositions and/or polypeptides useful as therapeutics for treating and/or preventing microbial infections (e.g., prokaryotic infections, bacterial infections, etc.). The polypeptide of the present disclosure can comprise a polypeptide derived from a bacterial RNA polymerase cofactor (e.g., alternative sigma factor σ54, SEQ ID NO: 1 , or SEQ ID NO: 2) comprising at least two non-natural amino acids. At least two of the at least two non-natural amino acids can be cross-linked. The cross- linked amino acids may be in an i and i+4, or an i and i+7 configuration. In an embodiment, the polypeptide is derived from the amino acid sequence FKVARRTVAKYREML (SEQ ID NO: 3). In another embodiment, the polypeptide is derived from the amino acid sequence
FKV ARRT V AK YREMLGIP S SRERRI (SEQ ID NO: 15). In additional embodiments, the polypeptide is derived from the amino acid sequence BFKVARRTVAKYRE(M Nle)L (SEQ ID
NO: 20). The non-natural amino acids can be selected from (S)-pentenylalanine and (R)- octenylalanine, e.g. (S)-2-(4'pentenyl)-alanine and (R)-2-(7'-octenyl)-alanine. In a particular embodiment, the polypeptide has an amino acid sequence selected from the group consisting of: SEQ ID NOS: 4-14, 16-19, and 21-33.
[0071] In another aspect, the present disclosure provides a polypeptide comprising the structure of at least one of: (i) ocKVARRTyAKYRE (SEQ ID NO: 4); (ii)
aKV ARRTyAK YRE(M/Q/ S/NL)5 (SEQ ID NO: 5); (iii) ccFKVpRRTVAKYRE (SEQ ID NO: 6); (iv) aKVApRRTVAKYRE (SEQ ID NO: 7) or aKVApRTVAKYRE (SEQ ID NO: 8); (v) aKVpRRTyAKYRE (SEQ ID NO: 9); vi) aKVAPRTVAKYRE(M/Q/S/NL)LGIPSSRERRI (SEQ ID NO: 36); or vii) aKV RRTyAKYRE(M/Q/S/NL)6GIPSSRERRI (SEQ ID NO: 37). In
an embodiment, at least two of the α, β, γ, and δ are non-natural amino acids. In other embodiments, at least two of the at least two non-natural amino acids form a hydrocarbon staple or disulfide bond (i.e., are cross-linked). In certain embodiments, the hydrocarbon staple crosslinks the alpha carbons of the stapled non-natural amino acids (i.e. non-natural amino acids). In certain embodiments, the non-natural amino acids for the i/i+4 configuration are (S)- pentenylalanine. In certain other embodiments, the non-natural amino acids for the i/i+7 configuration are (S)-pentenylalanine and (R)-octenylalanine, e.g., (S)-2-(4'pentenyl)-alanine and (R)-2-(7'-octenyl)-alanine.
[0072] In further aspects, the present disclosure provides a polypeptide having the structure: [d]i(a)KV( )RRT(y)AKYRE(M/Q/S NL)(5) (SEQ ID NO: 38);
[d] i(a)KV A(P)RT V AK YRE(5) (SEQ ID NO: 39);
[d]i(a)KV(p)RRT(y)AKYRE(M/Q/S/NL)(6)GIPSSRERRI (SEQ ID NO: 40); or
[d] i(a)KV A(p)RTV AK YRE(M/ Q/S L)LGIP S SRERRI (SEQ ID NO: 41 ), wherein: d is independently a capping group, a linker, a tryptophan, or a combination thereof; i can be 0 or 1. a is F, x, z or a combination thereof; β is A or x or both; γ is V, z or x; δ is L, M or x; and "z" and "x" correspond to a non-natural amino acid, wherein at least two of α, β, γ, and δ are non- natural amino acids. In an embodiment, x is (S)-pentenylalanine. In another embodiment, z is (R)-octenylalanine.
[0073] In certain embodiments, the capping group is at least one of Ac (acetyl), FITC
(fluorescein thiourea), Bt (biotinyl) or any other fluorophore or affinity agent. In another embodiment, the linker is at least one of beta-alanine or other linking entity (e.g., PEG).
[0074] The polypeptide can be from about 14 to about 27 amino acids in length. In a particular embodiment, the location of the at least two non-natural amino acids forming a hydrocarbon staple or disulfide bond are located at positions i and i+7 or i and i+4 of an amino acid sequence of the polypeptide. In other embodiments, the polypeptide comprises at least one of an amino terminal capping group, a linker or a combination thereof.
[0075] In another aspects, the present disclosure provides a polypeptide having the structure of a member selected from the group consisting of: Bi-linkeri-Tryptophani- FKVARRTzAKYRE(Nle)x-NH2 (Sa54-1 ) (SEQ ID NO: 42); Bj-linkerj-Tryptophani-
FKVxRRTxAKYRE(Nle)L-NH2 (Sa54-2) (SEQ ID NO: 43); Bi-linkerj-Tryptophani- zKVARRTxAKYRE(Nle)L-NH2 (Sa54-3) (SEQ ID NO: 44); Bi-linkeri-Tryptophan,- xFKVxRRTVAKYRE(Nle)L-NH2 (Sa54-4A) (SEQ ID NO: 45); Bi-linkeri-Tryptophani- xKVAxRTVAKYRE(Nle)L-NH2 (Sa54-4B) (SEQ ID NO: 46); Bi-linken-Tryptophani- zK V ARRTx AK YRE(Nle)LGIP S SxERRx-NH2 (AA So54) (SEQ ID NO: 47); Bi-linken- Tryptophani-zKVARRTxAKYRESLSIPSSxQRKxLV-NH2 (EC Sa54) (SEQ ID NO: 48); B;- linkeri-Tryptophani-zKVARRTxAKYREQ(Nle)NIPSSxARKxYK-NH2 (BS Sa54) (SEQ ID NO: 49); Bi-linkeri-Tryptophani-zKVARRTxAKYRE(Nle)LGIAPSSxRKRxV-NH2 (PA Sa54) (SEQ ID NO: 50); Bi-linkeri-Tryptophani-FKVARRTzAKYRE(Nle)xGIPSSRERRJ-NH2 (Sa54-1 Long) (SEQ ID NO: 51); Bi-linkeri-Tryptophani-FKVxRRTxAKYRE(Nle)LGIPSSRERRI-NH2 (Sa54-2 Long) (SEQ ID NO: 52); Bi-linken-Tryptophani- zKVARRTxAKYRE(Nle)LGIPSSRERRI-NH2 (Sa54-3 Long) (SEQ ID NO: 53); and Bi-linkeri- Tryptophani-xKVAxRTVA YRE(Nle)LGIPSSRERRI-NH2 (Sa54-4 Long) (SEQ ID NO: 54). "B" is any of the capping groups Ac (acetyl), FITC (fluorescein thiourea), Bt (biotinyl) or any other fiuorophore or affinity agent, "linker" is beta-alanine or other linking entity (e.g., PEG), "i" is 0 or 1, and "z" and "x" correspond to a non-natural amino acid.
[0076] In further aspects, the present disclosure provides a polypeptide comprising
Formul
[0077] or a pharmaceutically acceptable salt thereof,
[0078] wherein:
[0079] each Ri and R2 are independently H, alkyl, alkenyl, alkynyl, arylalkyl, cycloalkylalkyl, heteroarylalkyl, or heterocyclylalkyl;
[0080] each R3 is independently alkylene, alkenylene, alkynylene; [R4— K— R Jn; each of which is substituted with 0-6 R5;
[0081] R4 and R4' are independently alkylene, alkenylene or alkynylene;
[0082] each R5 is independently is halo, alkyl, ORe, N(R6)2, SR6, SORe, S02R6, C02R6,
R6, a fluorescent moiety, or a radioisotope;
[0084] each R6 is independently H, alkyl, or a therapeutic agent;
[0085] Rz and Rw are independently H, hydroxy!, amide (NH2), tryptophan, a linker, B, a
B-linker— , a linker-tryptophan— , a B-tryptophan— , or B-linker-tryptophan— ;
[0086] "B" is any of the capping groups Ac (acetyl), FITC (fluorescein thiourea), Bt
(biotinyl) or any other fluorophore or affinity agent;
[0087] "linker" is beta-alanine or other linking entity (e.g., PEG);
[0088] n is an integer from 1-4;
[0089] x is 2, 3, 4 or 6;
[0090] y and w are independently integers from 0-100; and
[0091] each Xaa is independently an amino acid;
[0092] wherein the polypeptide comprises at least 8 contiguous amino acids of a bacterial
RNA polymerase cofactor or a variant thereof or a homologue of a bacterial RNA polymerase cofactor or a variant thereof except that: (a) within the 8 contiguous amino acids the side chains of at least one pair of amino acids separated by 3, 4 or 6 amino acids is replaced by the linking group R3 which connects the alpha carbons of the pair of amino acids as depicted in Formula I and (b) the alpha carbon of the first amino acid of the pair of amino acids is substituted with Ri as depicted in formula I and the alpha carbon of the second amino acid of the pair of amino acids is substituted with R2 as depicted in Formula I.
[0093] In particular embodiments, the bacterial RNA polymerase cofactor is alternative sigma factor σ54 (RpoN). In another embodiment, the polypeptide is derived from the amino acid sequence: FKVARRTVAKYRE(M/Q/S/NL) (SEQ ID NO: 55). In other embodiments, x is
2, 3, or 6; R3 is an alkenyl containing a single double bond; and/or both Ri and R2 are H. In an embodiment, the [Xaa]x is selected from the group consisting of: (i) AKYRE(M/S/Q/NL) (SEQ ID NO: 56); (ii) RRT; (iii) VARRT (SEQ ID NO: 57); (iv) FKV; (v) KVA; (vi) KVARRT (SEQ ID NO: 57); (vii) QRK; (viii) ARK; and (ix) RKR. In an additional embodiment, when [Xaa]* is (i) AKYRE(M/S/Q/NL) (SEQ ID NO: 56), at least one of [Xaa]w is FKVARRT (SEQ ID NO: 58), [Xaajy is H, or a combination thereof; when [Xaa] is (ii) RRT, at least one of [Xaa]w is FKV, [Xaa]y is AKYRE(M/S/Q/NL)L (SEQ ID NO: 59), or a combination thereof; when [Xaa]x is (iii) KVARRT (SEQ ID NO: 57), at least one of [Xaa]w is H, [XaaJ^ is
AKYRE(M/S/Q/NL)L (SEQ ID NO: 59), or a combination thereof; when [Xaa]* is (iv) FKV, at least one of [Xaa]w is H, \Xaa]y is RRTVAKYRE(M/S/Q/NL) (SEQ ID NO: 60), or a combination thereof; when [Xaa]* is (v) KVA, at least one of [Xaa]w is H, [Xaa]^ is
RRTVAKYRE(M/S/Q/NL) (SEQ ID NO: 60), or a combination thereof; when [Xaa]* is (vi) KVARRT (SEQ ID NO: 57), at least one of [Xaa]w is H, [Xaa]y is AKYRE(M/S/Q/NL) (SEQ ID NO: 56), or a combination thereof; when [Xaa]x is (vii) QRK, at least one of [Xaa]w is
AKYRESLSIPSS (SEQ ID NO: 61), [Xaa]y is LV, or a combination thereof; when [Xaa]* is (viii) ARK, at least one of [Xaa]w is AKYREQL(M/S/Q/NL)NIPSS (SEQ ID NO: 62). [Xaa]y is YK, or a combination thereof; when [Xaa]x is (ix) RKR, at least one of [Xaa]w is
AKYRE(M/S/Q/NL)LGIAPSS (SEQ ID NO: 63). [Xaa]y is V, or a combination thereof; when [Xaa]* is (i) AKYREM (SEQ ID NO: 64), at least one of [Xaa]w is FKVARRT (SEQ ID NO: 58), [Xaa]y is GIPSSRERRI (SEQ ID NO: 65), or a combination thereof; [Xaa]* is (ii) RRT, at least one of [Xaa]w is FKV, [Xaa]y AKYRE(M/S/ Q/NL)LGIPS SRERRI (SEQ ID NO: 66), or a combination thereof; [Xaa]* is (iii) KVARRT (SEQ ID NO: 57), at least one of [Xaa]w is H, [Xaa]y is AKYRE(M/S/Q/NL)LGIPSSRERRI (SEQ ID NO: 66), or a combination thereof; and/or [Xaa]x is (v) KVA, at least one of [Xaa]w is H, [Xaa]^ is
RTVAKYRE(M/S/Q/NL)LGIPSSRERRI (SEQ ID NO: 67), or a combination thereof.
[0094] In certain aspects, the present disclosure provides for a polypeptide comprising:
or a pharmaceutically acceptable salt thereof, wherein:
[0095] q is an integer from 0-100; and
[0096] R1; R2, and R3 are independently selected; and [Xaa]x, [XaaL, and [Xaa]v are selected from the group consisting of: (i) KVARRT (SEQ ID NO: 57), AKYREMLGIPSS (SEQ ID NO: 71), and ERR; (ii) KVARRT (SEQ ID NO: 57), AKYRESLSIPPS (SEQ ID NO: 69), and QRK; (iii) KVARRT (SEQ ID NO: 57), AKYREQMNIPSS (SEQ ID NO: 72), and ARK; and (iv) KVARRT (SEQ ID NO: 57), AKYREMLGIAPSS (SEQ ID NO: 73), and RKR. When [Xaa]*, [Xaa] , and [Xaa]v is (ii), [Xaa]9 can be LV. When [Xaa]*, [XaaL, and [Xaa]v is (iii), [Xaa]? can be YK. When [Xaa]x, [XaaL, and [Xaa]v is (iv), [Xaa]? can be V.
[0097] In another aspect, the invention provides a polypeptide comprising Formula (II):
B
or a pharmaceutically acceptable salt thereof,
wherein:
Ri and R2 are independently H, alkyl, alkenyl, alkynyl, arylalkyl, cycloalkylalkyl, heteroarylalkyl, or heterocyclylalkyl;
R31 and R32 (i) are independently alkenyl, alkynyl, azido, amino, carboxylic acid, or sulfide or (ii) are taken together to form alkylene, alkenylene, alkynylene, or [R4— K— R4']n, each of which is substituted with 0-6 R5;
R4 and R4' are independently alkylene, alkenylene or alkynylene;
each Rs is independently halo, alkyl, OR6, N(R6)2, SR6, SOR6, SO2R6, C02R6, e, a fluorescent moiety, or a radioisotope;
each R6 is H, alkyl, or a therapeutic agent;
z and Rw are independently H, hydroxyl, NH2, tryptophan, a linker, B, a B-linker— , a linker-tryptophan— , a B-tryptophan— , or B-linker-tryptophan— ;
B is any of the capping groups Ac (acetyl), FITC (fluorescein thiourea), Bt (biotinyl) or any other fluorophore or affinity agent;
linker is beta-alanine or other linking entity;
n is an integer from 1-4;
x is an integer from 2-6; and
[Xaa]w, [Xaa]x, and [Xaa]y taken together have the amino acid sequence of
FKVARRTVAKYRE(M/Q/S/NL) (SEQ ID NO: 55), wherein two of the amino acids within the sequence are replaced with the residues A and B.
[0098] In any aspect or embodiment described herein, R31 and R32 are taken together to form alkylene, alkenylene, alkynylene, or [R4— K— R4']n, each of which is substituted with 0-6 R5.
[0099] In any aspect or embodiment described herein, the polypeptide is
Bi-linkeri-Tryptophani-FKVARRTzAKYRE(Nle)x-NH2 (SEQ ID NO: 42);
Bi-linkeri-Tryptophani-FKVxRRTxAKYRE(Nle)L-NH2 (SEQ ID NO: 43);
Bi-linkeri-Tryptophani-zKVARRTxAKYRE(Nle)L-NH2 (SEQ ID NO: 44);
Bi-linkeri-Tryptophani-xFKVxRTVAKYRE(Nle)L-NH2 (SEQ ID NO: 45);
Bi-linkeri-Tryptophani-xKVAxRTVA YRE(Nle)L-NH2 (SEQ ID NO: 46); or
wherein:
i of Bi is 1, i of linken and Tryptophan! is 0 or 1 ;
z and x each are a non-natural amino acid; and
the non-natural amino acid that is z or x that is closest to Bi within the sequence is residue A and the other non-natural amino acid that is z or x within the sequence is residue B.
[0100] In any aspect or embodiment described herein, z is (R)-octenylalanine.
[0101] In any aspect or embodiment described herein, x is (S)-pentenylalanine.
[0102] In any aspect or embodiment described herein, the polypeptide is
BFKVARRTzAKYRE(Nle)x (SEQ ID NO: 77);
BFKVxRRTxAKYRE(Nle)L (SEQ ID NO: 78);
BzKVARRTxAKYRE(Nle)L (SEQ ID NO: 79); or
BxKVAxRTVAKYRE(Nle)L (SEQ ID NO: 80);
wherein B is acetyl, x is (S)-2-(4'pentenyl)-alanine, and z is (R)-2-(7'-octenyl)-alanine.
[0103] In certain additional aspects, the present disclosure relates to compositions, including therapeutic or pharmaceutical compositions, and methods related to the treatment and/or prevention of microbial infections (e.g. prokaryotic infections or bacterial infections). A pharmaceutical composition for treating or preventing a microbial infection can comprise a therapeutically effective amount of a polypeptide of the present disclosure and a
pharmaceutically acceptable excipient. In some embodiments, the method treating or preventing a microbial infection (e.g., a prokaryotic or bacterial infection) comprises administering an effective amount of a composition of the present disclosure or a polypeptide of the present disclosure to a subject in need thereof, wherein the composition or polypeptide is effective in treating or ameliorating a symptom of the microbial infection. In certain additional aspects, the present disclosure relates to methods of using the polypeptides described herein as a food additive/preservative to prevent or inhibit food spoilage, for example caused by prokaryotes or bacteria. In certain additional aspects, the present disclosure relates to therapeutic or pharmaceutical compositions, and methods related to the use of the polypeptides described herein to prevent or treat diseases of plants (e.g., due to infection oiXylella fastidiosa,
Pseudomonas syringae, or Erwinia amylovora). Xylella fastidiosa causes gelation of the plant
xylem, which is specifically regulated by σ54. In another embodiment, the present disclosure provides a method of preventing contamination of and/or disinfecting a contaminated device, wherein the device may be, e.g., a medical device. Such a method could prevent biofilm formation on the medical device.
[0104] In additional embodiments, the compositions of the present disclosure further include an additional (or therapeutic) agent. In particular embodiments, the therapeutic agent is at least one of an antimicrobial agent (e.g., antibiotic or antibacterial agent) and an ameliorative agent. For example, the antibiotic may be selected from the following groups aminoglycosides (e.g., amikacin, gentamicin, kanamycin, neomycin, netilmicin, tobramycin, paromomycin, streptomycin, and/or spectinomycin), ansamycins (e.g., geldanamycin, herbimycin, and/or rifaximin), carbacephem (e.g., loracarbef), carbapenems (e.g., ertapenem, doripenem,
iminpenem/cilastatin, and/or meropenem), cephalosporins (first, second, third, fourth, and/or fifth generation; e.g., cefadroxil, cefazolin, cefalotin, cefalothin, cephalexin, cefavlor, cefamandole, cefoxitin, cefprozil, cefuroxime, cefixime, cefdinir, cefditoren, cefoperazone, cefotaxime, cefpodoxime, ceftazidime, ceftibuten, ceftizoxime, ceftriaxone, cefepime, ceftaroline fosamil, and/or ceftobiprole), glycopeptides (e.g., teicoplanin, vancomycin, telavancin, dalbavancin, and/or oritavancin), lincosamides (e.g., clindamycin and/or lincomycin), lipopeptide (e.g., daptomycin), macrolides (e.g., azithromycin, clarithromycin, dirithromycin, ertythtromycin, roxithromycin, troleandomycin, telithromycin, and/or spiramycin), monobactams (e.g., aztreonam), nitrofurans (e.g., furazolidone and/or nitrofurantoin), oxazolidinones (e.g., linezolid, posizolid, radezolid, and/or torezolid), penicillins (amoxicillin, ampicillin, azlocillin, carbenicillin, cloxacillin, dicloxacillin, flucloxacillin, mezlocillin, methicillin, nafcillin, oxacillin, penicillin G, temocillin, and/or ticarcillin), penicillin combinations (e.g., amoxicillin/clavulanate, ampicillin/sulbactam, piperacillin/taxobactam, and/or ticarcillin/clavulanate), polypeptides (e.g., bacitracin, colistin, and/or polymyxin B), quinolones/fluoroquinolones (ciprofloxacin, enoxacin, gatifloxacin, gemifloxacin, levofloxacin, lomefloxacin, moxifloxacin, nalidixic acid, norfloxacin, ofloxacin, trovafloxacin, grepafloxacin, sparfloxacin, and/or temafloxacin), sulfonamides (e.g., mafenide, sulfacetamide, sulfadiazine, silver sulfadiazine, sulfadimethoxine, sulfamethizole, sulfanilamide, sulfasalazine, sulfisoxazole, trimethoprim-sulfamethoxazole, and/or
sulfonamidochrysoidine), tetracyclines (demeclocycline, doxycycline, minocycline, oxytetracycline, and/or tetracycline), and agents effective against mycobacteria (e.g.,
clofazimine, dapsone, capreomycin, cycloserine, ethambutol, ethionamide, isoniazid,
pyrazinamide, rifampicin, rifabutin, and/or rifapentine).
[0105] The ameliorative agent can be any agent to one skilled in the art as long as it is effective at alleviating, improving, and/or reduce a sign or symptom of a microbial infection.
[0106] In still another aspect, the present disclosure provides a method of inhibiting transcription in a prokaryote (e.g. bacteria) comprising administering an effective amount of a composition of the present disclosure or a polypeptide of the present disclosure, wherein the composition or polypeptide is effective in inhibiting transcription in a prokaryote.
[0107] In addition, the present disclosure comprises the use of a therapeutic composition comprising an effective amount of a composition or a polypeptide of the present disclosure for the manufacture of a medicament for the treatment and/or prevention of microbial infection (e.g., prokaryotic or bacterial infections). The use of the therapeutic composition can comprise an effective amount of from 0.1 mg/kg and 1000 mg/kg body weight/day.
[0108] In any aspect of the present disclosure, the therapeutic composition of the disclosure can be in any pharmaceutically acceptable form and administered by any
pharmaceutically acceptable route, for example, the therapeutic composition can be administered as an oral dosage, either single daily dose or unitary dosage form, for the treatment and/or protection of microbial infection and/or, ameliorating and/or preventing the symptoms of the microbial infection, or any combination thereof. Such pharmaceutically acceptable carriers and excipients and methods of administration will be readily apparent to those of skill in the art, and include compositions and methods as described in the USP-NF 2008 (United States
Pharmacopeia/ ational Formulary), which is incorporated herein by reference in its entirety.
[0109] In additional aspects, the hydrocarbon tethers can be further manipulated, e.g., a double bond of a hydrocarbon alkenyl tether (e.g., as synthesized using ruthenium-catalyzed ring closing metathesis (RCM)) can be oxidized (e.g., via epoxidation of dihydroxylation) to provide one of the following:
[0110] The hydrocarbon alkenyl tether (e.g., as synthesized using ruthenium-catalyzed ring closing metathesis (RCM)) can be reduced to produce a polypeptide without a double bond.
[0111] Either the epoxide moiety or one of the free hydroxyl moieties can be further functionalized. For example, the epoxide can be treated with a nucleophile, which provides additional functionality that can be used, for example, to attach a tag (e.g., a radioisotope or fluorescent tag). The tag can be used to help direct the polypeptide to a desired location in the body or track the location in the body. Alternatively, an additional therapeutic agent can be chemically attached to the functionalized tether (e.g., an anti-bacterial agent). Such derivitization can alternatively be achieved by synthetic manipulation of the amino or carboxy terminus of the polypeptide or via the amino acid side chain. Other agents can be attached to the functionalized tether, e.g., an agent that facilitates entry of the polypeptide into cells.
[0112] While hydrocarbon tethers have been described, other tethers are also envisioned.
For example, the tether can include at least one of an ether, thioether, ester, amine, or amide moiety. In some embodiments, a naturally occurring amino acid side chain is incorporated into the tether. For example, a tether can be coupled with a functional group, such as the hydroxyl in
serine, the thiol in cysteine, the primary amine in lysine, the acid in aspartate or glutamate, or the amide in asparagine or glutamine. Therefore, it is possible to create a tether using naturally occurring amino acids rather than using a tether that is made by coupling two non-naturally occurring amino acids. In another embodiment, the tether is created between a single non- naturally occurring amino acid and a naturally occurring amino acid.
[0113] A shorter length tether can be utilized when it is desirable to provide a relatively high degree of constraint on the secondary alpha-helical structure. Alternatively, a longer tether can be utilized when it is desirable to provide less constraint on the secondary alpha-helical structure.
[0114] While examples of tethers spanning from amino acids i to i+3, i to i+4; and i to i+7 have been described in order to provide a tether that is primarily on a single face of the alpha helix, the tethers can be synthesized to span any combinations of numbers of amino acids.
[0115] In certain embodiments, alpha di-substituted amino acids are used in the polypeptide to improve the stability of the alpha helical secondary structure. In a particular embodiment, alpha mono-substituted amino acids (e.g., in the tethered amino acids) are used in the polypeptide.
[0116] Methods of synthesizing the polypeptides of the present invention will be evident to those of ordinary skill in the art. Additionally, the various synthetic steps may be performed in an alternate sequence or order to give the desired polypeptides. Synthetic chemistry transformations and protecting group methodologies (protection and deprotection) useful in synthesizing the polypeptides described herein are known in the art and include, for example, those such as described in R. Larock, Comprehensive Organic Transformations, VCH Publishers (1989); T. W. Greene and P. G. M. Wuts, Protective Groups in Organic Synthesis, 3d. Ed., John Wiley and Sons (1999); L. Fieser and M. Fieser, Fieser and Fieser's Reagents for Organic Synthesis, John Wiley and Sons (1994); and L. Paquette, ed., Encyclopedia of Reagents for Organic Synthesis, John Wiley and Sons (1995), and subsequent editions thereof.
[0117] The polypeptides of this disclosure can be made by chemical synthesis methods, which are well known to the ordinarily skilled artisan. See, for example, Fields et al., Chapter 3 in Synthetic Peptides: A User's Guide, ed. Grant, W.H. Freeman & Co., New York, N.Y., 1992,
p. 77. Hence, polypeptides can be synthesized using the automated Merrifield techniques of solid phase synthesis with the a-NH2 protected by either t-Boc or Fmoc chemistry using side chain protected amino acids on, for example, an Applied Biosystems Peptide Synthesizer Model 43 OA or 431 or a Creosalus TETRAS Asynchronous Peptide Synthesizer.
[0118] One manner of making of the polypeptides described herein is using solid phase peptide synthesis (SPPS). The C-terminal amino acid is attached to a cross-linked polystyrene resin via an acid labile bond with a linker molecule. This resin is insoluble in the solvents used for synthesis, making it relatively simple and fast to wash away excess reagents and by-products. The N-terminus is protected with the Fmoc group, which is stable in acid, but removable by base (e.g., piperidine or l,8-diazabicycloundec-7-ene). Any side chain functional groups are protected with base stable, acid labile groups. Longer polypeptides could be made by conjoining individual synthetic polypeptides using native chemical ligation. Alternatively, the longer synthetic polypeptides can be synthesized by well-known recombinant DNA techniques. Such techniques are provided in well-known standard manuals with detailed protocols. To construct a gene encoding a polypeptide of this disclosure, the amino acid sequence is reverse translated to obtain a nucleic acid sequence encoding the amino acid sequence, preferably with codons that are optimum for the organism in which the gene is to be expressed. Next, a synthetic gene is made, typically by synthesizing oligonucleotides which encode the polypeptide and any regulatory elements, if necessary. The synthetic gene is inserted in a suitable cloning vector and transfected into a host cell. The polypeptide is then expressed under suitable conditions appropriate for the selected expression system and host. The polypeptide is purified and characterized by standard methods.
[0119] The polypeptides can be made in a high-throughput, combinatorial fashion, e.g., using a high-throughput multiple channel combinatorial synthesizer available from Advanced Chemtech or Creosalus/Thuramed.
[0120] In additional embodiments, the present disclosure provides for the polypeptides wherein at least one conventional peptide bonds replaced by a different bond that may increase the stability of the polypeptide in the subject. Peptide bonds can be replaced by: a retro-inverso bonds (C(O)— NH); a reduced amide bond (NH— CH2); a thiomethylene bond (S— CH2 or
CH2— S); an oxomethylene bond (O— CH2 or CH2— O); an ethylene bond (CH2— CH2); a thioamide bond (C(S)— NH); a trans-olefin bond (CH=CH); a fluoro substituted trans-olefm bond (CF=CH); a ketomethylene bond (C(O)— CH ) or CHR— C(0) wherein R is H or CH3; and a fluoro-ketomethylene bond (C(O)— CFR or CFR— C(O) wherein R is H, F or CH3.
[0121] In other embodiments, the polypeptides of the disclosure are modified by at least one of: acetylation, amidation, biotinylation, cinnamoylation, farnesylation, fluoresceination, formylation, myristoylation, palmitoylation, phosphorylation. (Ser, Tyr or Thr), stearoylation, succinylation and sulfurylation. In certain embodiments, the polypeptide of the present disclosure is conjugated to, for example, polyethylene glycol (PEG); alkyl groups (e.g., C1-C20 straight or branched alkyl groups); fatty acid radicals; or combinations thereof.
[0122] In another aspect, the stapled polypeptides further includes at least one of a drug, a toxin, a derivative of polyethylene glycol, a second polypeptide, a carbohydrate, etc. In an embodiment, a polymer or other agent is linked to the stapled polypeptide.
[0123] The addition of polyethelene glycol (PEG) molecules can improve the
pharmacokinetic and pharmacodynamic properties of the polypeptide. For example, PEGylation can reduce renal clearance and can result in a more stable plasma concentration. PEG is a water soluble polymer and can be represented as linked to the polypeptide as formula: TmO—
(CH2CH20)n— CH2CH2— Y, wherein n is 2 to 10,000, Tm is H or a terminal modification (e.g., a Ci-4 alkyl) and Y is an amide, carbamate or urea linkage to an amine group (including but not limited to, the epsilon amine of lysine or the N-terminus) of the polypeptide. Alternatively, Y can be a maleimide linkage to a thiol group (including but not limited to, the thiol group of cysteine). Other methods for linking PEG to a polypeptide, directly or indirectly, are known to those of ordinary skill in the art. The PEG can be linear or branched. Various forms of PEG including various functionalized derivatives are commercially available. In a particular embodiment, the PEG has at least one degradable linkage. For example, PEG can be prepared with ester linkages that are subject to hydrolysis. Conjugates having degradable PEG linkages are described in WO 99/34833, WO 99/14259, and U.S. Patent No. 6,348,558.
[0124] In certain embodiments, macromolecular polymer (e.g., PEG) is attached to a polypeptide of the present disclosure through an intermediate linker and/or tryptophan. In
certain embodiments, the linker includes 1 to 20 amino acids linked by peptide bonds, wherein the amino acids are selected from the 20 naturally occurring amino acids. In an embodiment, at least one of the amino acids of the linker is glycosylated. In other embodiments, the 1 to 20 amino acids are selected from the group consisting of glycine, alanine, proline, asparagine, glutamine, and lysine. In further embodiments, a majority of the amino acids of the linker are sterically unhindered amino acids (e.g., glycine and alanine). In another embodiment, the linker is a non-peptide linker. For example, the non-peptide linker can be an alkyl linkers, such as— NH(CH2)nC(0)— , wherein n is an integer from 2 to 20. The alkyl linker can be substituted by at least one of any non-sterically hindering group (e.g., lower alkyl (e.g., d-C6), lower acyl, halogen (e.g., CI, Br), CN, NH2, phenyl, etc.). A bifunctional PEG linker and its use in forming conjugates having a polypeptide at each of the PEG linker termini has been described, e.g., U.S. Patent No. 5,446,090.
[0125] Therapeutic Compositions
[0126] Pharmaceutical compositions comprising combinations of an effective amount of at least one polypeptide as described herein, and one or more of the polypeptides otherwise described herein, all in effective amounts, in combination with a pharmaceutically effective amount of a carrier, additive or excipient, represents a further aspect of the present disclosure.
[0127] The present disclosure includes, where applicable, the compositions comprising the pharmaceutically acceptable salts, in particular, acid or base addition salts of polypeptides as described herein. The acids which are used to prepare the pharmaceutically acceptable acid addition salts are those which form non-toxic acid addition salts, i.e., salts containing
pharmacologically acceptable anions, such as the hydrochloride, hydrobromide, hydroiodide, nitrate, sulfate, bisulfate, phosphate, acid phosphate, acetate, lactate, citrate, acid citrate, tartrate, bitartrate, succinate, maleate, fumarate, gluconate, saccharate, benzoate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate and pamoate [i.e., l,l'-methylene-bis-(2- hydroxy-3 naphthoate)] salts, among numerous others.
[0128] Pharmaceutically acceptable base addition salts may also be used to produce pharmaceutically acceptable salt forms of the polypeptides or derivatives according to the present disclosure. The chemical bases that may be used as reagents to prepare pharmaceutically
acceptable base salts of the present polypeptides that are acidic in nature are those that form nontoxic base salts with such polypeptides. Such non-toxic base salts include, but are not limited to those derived from such pharmacologically acceptable cations such as alkali metal cations (e.g., potassium and sodium) and alkaline earth metal cations (e.g., calcium, zinc and magnesium), ammonium or water-soluble amine addition salts such as N-methylglucamine-(meglumine), and the lower alkanolammonium and other base salts of pharmaceutically acceptable organic amines, among others.
[0129] The polypeptides as described herein may, in accordance with the disclosure, be administered in single or divided doses by the oral, parenteral or topical routes. Administration of the active may range from continuous (intravenous drip) to several oral administrations per day (for example, Q.I.D.) and may include oral, topical, parenteral, intramuscular, intravenous, sub-cutaneous, transdermal (which may include a penetration enhancement agent), buccal, sublingual and suppository administration, among other routes of administration. Enteric coated oral tablets may also be used to enhance bioavailability of the polypeptides from an oral route of administration. The most effective dosage form will depend upon the pharmacokinetics of the particular agent chosen as well as the severity of disease in the patient. Administration of polypeptides according to the present disclosure as sprays, mists, or aerosols for intra-nasal, intra-tracheal or pulmonary administration may also be used. The present disclosure therefore also is directed to pharmaceutical compositions comprising an effective amount of polypeptide as described herein, optionally in combination with a pharmaceutically acceptable carrier, additive or excipient. Polypeptides according to the present disclosure may be administered in immediate release, intermediate release or sustained or controlled release forms. Sustained or controlled release forms are preferably administered orally, but also in suppository and transdermal or other topical forms. Intramuscular injections in liposomal form may also be used to control or sustain the release of polypeptide at an injection site.
[0130] The compositions as described herein may be formulated in a conventional manner using one or more pharmaceutically acceptable carriers and may also be administered in controlled-release formulations. Pharmaceutically acceptable carriers that may be used in these pharmaceutical compositions include, but are not limited to, ion exchangers, alumina, aluminum
stearate, lecithin, serum proteins, such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes, such as prolamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, polyethylene glycol and wool fat.
[0131] The compositions as described herein may be administered orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally or via an implanted reservoir. The term "parenteral" as used herein includes subcutaneous, intravenous, intramuscular, intraarticular, intra-synovial, intrasternal, intrathecal, intrahepatic, intralesional and intracranial injection or infusion techniques. Preferably, the compositions are administered orally, intraperitoneally or intravenously.
[0132] Sterile injectable forms of the compositions as described herein may be aqueous or oleaginous suspension. These suspensions may be formulated according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally- acceptable diluent or solvent, for example as a solution in 1, 3-butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed including synthetic mono- or di-glycerides. Fatty acids, such as oleic acid and its glyceride derivatives are useful in the preparation of injectables, as are natural pharmaceutically-acceptable oils, such as olive oil or castor oil, especially in their polyoxyethylated versions. These oil solutions or suspensions may also contain a long-chain alcohol diluent or dispersant, such as Ph. Helv or similar alcohol.
[0133] The pharmaceutical compositions as described herein may be orally administered in any orally acceptable dosage form including, but not limited to, capsules, tablets, aqueous suspensions or solutions. In the case of tablets for oral use, carriers which are commonly used include lactose and corn starch. Lubricating agents, such as magnesium stearate, are also
typically added. For oral administration in a capsule form, useful diluents include lactose and dried corn starch. When aqueous suspensions are required for oral use, the active ingredient is combined with emulsifying and suspending agents. If desired, certain sweetening, flavoring or coloring agents may also be added.
[0134] Alternatively, the pharmaceutical compositions as described herein may be administered in the form of suppositories for rectal administration. These can be prepared by mixing the agent with a suitable non-irritating excipient, which is solid at room temperature but liquid at rectal temperature and therefore will melt in the rectum to release the drug. Such materials include cocoa butter, beeswax and polyethylene glycols.
[0135] The pharmaceutical compositions as described herein may also be administered topically. Suitable topical formulations are readily prepared for each of these areas or organs. Topical application for the lower intestinal tract can be effected in a rectal suppository formulation (see above) or in a suitable enema formulation. Topically-acceptable transdermal patches may also be used.
[0136] For topical applications, the pharmaceutical compositions may be formulated in a suitable ointment containing the active component suspended or dissolved in one or more carriers. Carriers for topical administration of the polypeptides of this disclosure include, but are not limited to, mineral oil, liquid petrolatum, white petrolatum, propylene glycol,
polyoxyethylene, polyoxypropylene compound, emulsifying wax and water. In certain preferred aspects of the disclosure, the polypeptides may be coated onto a stent which is to be surgically implanted into a patient in order to inhibit or reduce the likelihood of occlusion occurring in the stent in the patient.
[0137] Alternatively, the pharmaceutical compositions may be formulated in a suitable lotion or cream containing the active components suspended or dissolved in one or more pharmaceutically acceptable carriers. Suitable carriers include, but are not limited to, mineral oil, sorbitan monostearate, polysorbate 60, cetyl esters wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol and water.
[0138] For ophthalmic use, the pharmaceutical compositions may be formulated as micronized suspensions in isotonic, pH adjusted sterile saline, or, preferably, as solutions in
isotonic, pH adjusted sterile saline, either with or without a preservative such as benzylalkonium chloride. Alternatively, for ophthalmic uses, the pharmaceutical compositions may be formulated in an ointment such as petrolatum.
[0139] The pharmaceutical compositions as described herein may also be administered by nasal aerosol or inhalation. Such compositions are prepared according to techniques well- known in the art of pharmaceutical formulation and may be prepared as solutions in saline, employing benzyl alcohol or other suitable preservatives, absorption promoters to enhance bioavailability, fluorocarbons, and/or other conventional solubilizing or dispersing agents.
[0140] The amount of polypeptide in a pharmaceutical composition as described herein that may be combined with the carrier materials to produce a single dosage form will vary depending upon the host and disease treated, the particular mode of administration. Preferably, the compositions should be formulated to contain between about 0.05 milligram to about 750 milligrams or more, more preferably about 1 milligram to about 600 milligrams, and even more preferably about 10 milligrams to about 500 milligrams of active ingredient, alone or in combination with at least one other polypeptide according to the present dislcosure.
[0141] It should also be understood that a specific dosage and treatment regimen for any particular patient will depend upon a variety of factors, including the activity of the specific polypeptide employed, the age, body weight, general health, sex, diet, time of administration, rate of excretion, drug combination, and the judgment of the treating physician and the severity of the particular disease or condition being treated.
[0142] A patient or subject in need of therapy using polypeptides according to the methods described herein can be treated by administering to the patient (subject) an effective amount of the polypeptide according to the present disclosure including pharmaceutically acceptable salts, solvates or polymorphs, thereof optionally in a pharmaceutically acceptable carrier or diluent, either alone, or in combination with other known erythopoiesis stimulating agents as otherwise identified herein.
[0143] These polypeptides can be administered by any appropriate route, for example, orally, parenterally, intravenously, intradermally, subcutaneously, or topically, including transdermally, in liquid, cream, gel, or solid form, or by aerosol form.
[0144] The active polypeptide is included in the pharmaceutically acceptable carrier or diluent in an amount sufficient to deliver to a patient a therapeutically effective amount for the desired indication, without causing serious toxic effects in the patient treated. A preferred dose of the active polypeptide for all of the herein-mentioned conditions is in the range from about 10 ng/kg to 300 mg/kg, preferably 0.1 to 100 mg/kg per day, more generally 0.5 to about 25 mg per kilogram body weight of the recipient/patient per day. A typical topical dosage will range from 0.01-5% wt/wt in a suitable carrier.
[0145] The polypeptide is conveniently administered in any suitable unit dosage form, including but not limited to one containing less than 1 mg, 1 mg to 3000 mg, preferably 5 to 500 mg of active ingredient per unit dosage form. An oral dosage of about 25-250 mg is often convenient.
[0146] The active ingredient is preferably administered to achieve peak plasma concentrations of the active polypeptide of about 0.00001-30 mM, preferably about 0.1-30 μΜ. This may be achieved, for example, by the intravenous injection of a solution or formulation of the active ingredient, optionally in saline, or an aqueous medium or administered as a bolus of the active ingredient. Oral administration is also appropriate to generate effective plasma concentrations of active agent.
[0147] The concentration of active polypeptide in the drug composition will depend on absorption, distribution, inactivation, and excretion rates of the drug as well as other factors known to those of skill in the art. It is to be noted that dosage values will also vary with the severity of the condition to be alleviated. It is to be further understood that for any particular subject, specific dosage regimens should be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions, and that the concentration ranges set forth herein are exemplary only and are not intended to limit the scope or practice of the claimed composition. The active ingredient may be administered at once, or may be divided into a number of smaller doses to be administered at varying intervals of time.
[0148] Oral compositions will generally include an inert diluent or an edible carrier.
They may be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral
therapeutic administration, the active polypeptide or its prodrug derivative can be incorporated with excipients and used in the form of tablets, troches, or capsules. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition.
[0149] The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or polypeptides of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a dispersing agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring. When the dosage unit form is a capsule, it can contain, in addition to material of the above type, a liquid carrier such as a fatty oil. In addition, dosage unit forms can contain various other materials which modify the physical form of the dosage unit, for example, coatings of sugar, shellac, or enteric agents.
[0150] The active polypeptide or pharmaceutically acceptable salt thereof can be administered as a component of an elixir, suspension, syrup, wafer, chewing gum or the like. A syrup may contain, in addition to the active polypeptides, sucrose as a sweetening agent and certain preservatives, dyes and colorings and flavors.
[0151] The active polypeptide or pharmaceutically acceptable salts thereof can also be mixed with other active materials that do not impair the desired action, or with materials that supplement the desired action, such as an antimicrobial agent including an antibacterial agent. In certain preferred aspects of the disclosure, one or more polypeptides according to the present disclosure are coadministered with another bioactive agent, such as an antibacterial agent or a wound healing agent as otherwise described herein.
[0152] Solutions or suspensions used for parenteral, intradermal, subcutaneous, or topical application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerin, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid;
buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as
sodium chloride or dextrose. The parental preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
[0153] If administered intravenously, preferred carriers are physiological saline or phosphate buffered saline (PBS).
[0154] In one embodiment, the active polypeptides are prepared with carriers that will protect the polypeptide against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art.
[0155] Liposomal suspensions may also be pharmaceutically acceptable carriers. These may be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811 (which is incorporated herein by reference in its entirety). For example, liposome formulations may be prepared by dissolving appropriate lipid(s) (such as stearoyl phosphatidyl ethanolamine, stearoyl phosphatidyl choline, arachadoyl phosphatidyl choline, and cholesterol) in an inorganic solvent that is then evaporated, leaving behind a thin film of dried lipid on the surface of the container. An aqueous solution of the active polypeptide is then introduced into the container. The container is then swirled by hand to free lipid material from the sides of the container and to disperse lipid aggregates, thereby forming the liposomal suspension.
[0156] The present disclosure also includes pharmaceutically acceptable formulations of the polypeptides described. These formulations include salts of the above polypeptides, e.g., acid addition salts, for example, salts of hydrochloric, hydrobromic, acetic acid, and benzene sulfonic acid.
[0157] A pharmacological composition or formulation refers to a composition or formulation in a form suitable for administration, e.g., systemic administration, into a cell or subject, preferably a human. By "systemic administration" is meant in vivo systemic absorption or accumulation of drugs in the blood stream followed by distribution throughout the entire body. Suitable forms, in part, depend upon the use or the route of entry, for example oral,
transdermal, or by injection. Such forms should not prevent the composition or formulation from reaching a target cell (i.e., a cell to which the negatively charged polymer is desired to be delivered to). For example, pharmacological compositions injected into the blood stream should be soluble. Other factors are known in the art, and include considerations such as toxicity and forms which prevent the composition or formulation from exerting its effect.
[0158] Administration routes which lead to systemic absorption include, without limitations: intravenous, subcutaneous, intraperitoneal, inhalation, oral, intrapulmonary and intramuscular. The rate of entry of a drug into the circulation has been shown to be a function of molecular weight or size. The use of a liposome or other drug carrier comprising the
polypeptides of the present disclosure can potentially localize the drug, for example, in certain tissue types, such as the tissues of the reticular endothelial system (RES). A liposome
formulation which can facilitate the association of drug with the surface of cells, such as, lymphocytes and macrophages is also useful.
[0159] The present disclosure also features the use of the composition comprising surface-modified liposomes containing poly (ethylene glycol) lipids (PEG-modified, or long- circulating liposomes or stealth liposomes). Polypeptides and compositions of the present disclosure can also comprise covalently attached PEG molecules of various molecular weights. These formulations offer a method for increasing the accumulation of drugs in target tissues. This class of drug carriers resists opsonization and elimination by the mononuclear phagocytic system (MPS or RES), thereby enabling longer blood circulation times and enhanced tissue exposure for the encapsulated drug (Lasic et al. Chem. Rev. 1995, 95, 2601-2627; Ishiwata et al., Chem. Pharm. Bull. 1995, 43, 1005-101 1). Long-circulating liposomes are also likely to protect drugs from nuclease degradation to a greater extent compared to cationic liposomes, based on their ability to avoid accumulation in metabolically aggressive MPS tissues such as the liver and spleen. All of these references are incorporated by reference herein.
[0160] The present disclosure also includes compositions prepared for storage or administration which include a pharmaceutically effective amount of the desired polypeptides in a pharmaceutically acceptable carrier or diluent. Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington's
Pharmaceutical Sciences, Mack Publishing Co. (A. R. Gennaro edit. 1985) hereby incorporated by reference herein. For example, preservatives, stabilizers, dyes and flavoring agents can be provided. These include sodium benzoate, sorbic acid and esters of p-hydroxybenzoic acid. In addition, antioxidants and suspending agents can be used.
[0161] An effective amount, pharmaceutically effective dose, therapeutically effective amount, or pharmaceutically effective amount is that dose required to prevent, inhibit the occurrence, or treat (alleviate a symptom to some extent, preferably all of the symptoms) of a disease state or pathological condition. The effective amount depends on the type of disease, the composition used, the route of administration, the type of mammal being treated, the physical characteristics of the specific mammal under consideration, concurrent medication, and other factors which those skilled in the medical arts will recognize. Generally, an amount between 0.1 mg/kg and 1000 mg/kg body weight/day of active ingredients is administered dependent upon potency of the negatively charged polymer. In addition, effective amounts of the compositions of the disclosure encompass those amounts utilized in the examples to facilitate the intended or desired biological effect.
[0162] Toxicity and therapeutic efficacy of such polypeptides can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for
determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Polypeptides that exhibit large therapeutic indices are preferred. While polypeptides that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such polypeptides to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects. The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such polypeptides lies preferably within a range of circulating concentrations that include the ED 50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any polypeptide used in the method of the present disclosure, the therapeutically effective dose can be estimated initially from cell culture assays.
A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test polypeptide which achieves a half- maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.
[0163] The formulations can be administered orally, topically, parenterally, by inhalation or spray or rectally in dosage unit formulations containing conventional non-toxic
pharmaceutically acceptable carriers, adjuvants and vehicles. The term parenteral as used herein includes percutaneous, subcutaneous, intravascular (e.g., intravenous), intramuscular, or intrathecal injection or infusion techniques and the like. In addition, there is provided a pharmaceutical formulation comprising a polypeptide of the disclosure and a pharmaceutically acceptable carrier. One or more polypeptides of the disclosure can be present in association with one or more non-toxic pharmaceutically acceptable carriers and/or diluents and/or adjuvants, and if desired other active ingredients. The pharmaceutical compositions of the present disclosure can be in a form suitable for oral use, for example, as tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsion, hard or soft capsules, or syrups or elixirs.
[0164] Compositions intended for oral use can be prepared according to any method known to the art for the manufacture of pharmaceutical compositions and such compositions can contain one or more such sweetening agents, flavoring agents, coloring agents or preservative agents in order to provide pharmaceutically elegant and palatable preparations. Tablets contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients that are suitable for the manufacture of tablets. These excipients can be for example, inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, corn starch, or alginic acid; binding agents, for example starch, gelatin or acacia, and lubricating agents, for example magnesium stearate, stearic acid or talc. The tablets can be uncoated or they can be coated by known techniques. In some cases such coatings can be prepared by known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer
period. For example, a time delay material such as glyceryl monosterate or glyceryl distearate can be employed. Formulations for oral use can also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium, for example peanut oil, liquid paraffin or olive oil.
[0165] Aqueous suspensions contain the active materials in admixture with excipients suitable for the manufacture of aqueous suspensions. Such excipients are suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydropropyl-methylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents can be a naturally-occurring phosphatide, for example, lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, or condensation products of ethylene oxide with long chain aliphatic alcohols, for example heptadecaethyleneoxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyethylene sorbitan monooleate. The aqueous suspensions can also contain one or more preservatives, for example ethyl, or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose or saccharin.
[0166] Oily suspensions can be formulated by suspending the active ingredients in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin. The oily suspensions can contain a thickening agent, for example beeswax, hard paraffin or cetyl alcohol. Sweetening agents and flavoring agents can be added to provide palatable oral preparations. These compositions can be preserved by the addition of an antioxidant such as ascorbic acid.
[0167] Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives. Suitable dispersing or wetting agents or suspending agents are exemplified by those already mentioned above. Additional excipients, for example sweetening, flavoring and coloring agents, can also be present.
Pharmaceutical compositions of the present disclosure can also be in the form of oil-in-water emulsions. The oily phase can be a vegetable oil or a mineral oil or mixtures of these. Suitable emulsifying agents can be naturally-occurring gums, for example gum acacia or gum tragacanth, naturally-occurring phosphatides, for example soy bean, lecithin, and esters or partial esters derived from fatty acids and hexitol, anhydrides, for example sorbitan monooleate, and condensation products of the said partial esters with ethylene oxide, for example
polyoxyethylene sorbitan monooleate. The emulsions can also contain sweetening and flavoring agents.
[0168] Syrups and elixirs can be formulated with sweetening agents, for example glycerol, propylene glycol, sorbitol, glucose or sucrose. Such formulations can also contain a demulcent, a preservative and flavoring and coloring agents. The pharmaceutical compositions can be in the form of a sterile injectable aqueous or oleaginous suspension. This suspension can be formulated according to the known art using those suitable dispersing or wetting agents and suspending agents that have been mentioned above. The sterile injectable preparation can also be a sterile injectable solution or suspension in a non-toxic parentally acceptable diluent or solvent, for example as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that can be employed are water, Ringer's solution and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil can be employed including synthetic mono-or diglycerides. In addition, fatty acids such as oleic acid find use in the preparation of injectables.
[0169] For administration to non-human animals, the composition can also be added to the animal feed or drinking water. It can be convenient to formulate the animal feed and drinking water compositions so that the animal takes in a therapeutically appropriate quantity of the composition along with its diet. It can also be convenient to present the composition as a premix for addition to the feed or drinking water. The composition can also be administered to a subject in combination with other therapeutic compounds to increase the overall therapeutic effect. The use of multiple polypeptides to treat an indication can increase the beneficial effects while reducing the presence of side effects.
[0170] A further object of the present disclosure is to provide a kit comprising a suitable container, the therapeutic of the present disclosure in a pharmaceutically acceptable form disposed therein, and instructions for its use.
[0171] Preparations for administration of the therapeutic of the present disclosure include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's intravenous vehicles including fluid and nutrient replenishers, electrolyte replenishers, and the like. Preservatives and other additives may be added such as, for example, antimicrobial agents, anti-oxidants, chelating agents and inert gases and the like.
[0172] The polypeptides (also referred to herein as "active polypeptides") of the disclosure, and derivatives, fragments, analogs and homologs thereof, can be incorporated into pharmaceutical compositions suitable for administration. Such compositions typically comprise the polypeptide and a pharmaceutically acceptable carrier. As used herein, "pharmaceutically acceptable carrier" is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Suitable carriers are described in the most recent edition of Remington's Pharmaceutical Sciences, a standard reference text in the field, which is incorporated herein by reference. Preferred examples of such carriers or diluents include, but are not limited to, water, saline, finger's solutions, dextrose solution, and 5% human serum albumin. Liposomes and non-aqueous vehicles such as fixed oils may also be used. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active polypeptide, use thereof in the compositions is contemplated. Supplementary active polypeptides can also be incorporated into the compositions.
[0173] A pharmaceutical composition of the present disclosure is formulated to be compatible with its intended route of administration. Examples of routes of administration
include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (i.e., topical), transmucosal, intraperitoneal, and rectal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid (EDTA); buffers such as acetates, citrates or phosphates, and agents for the adjustment of tonicity such as sodium chloride or dextrose. The pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
[0174] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor™. (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringeability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of
microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable
compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
[0175] For oral administration, the pharmaceutical compositions may take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinised maize starch,
polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc or silica); disintegrants (e.g., potato starch or sodium starch glycolate); or wetting agents (e.g., sodium lauryl sulphate). The tablets may be coated by methods well known in the art. Liquid
preparations for oral administration may take the form of, for example, solutions, syrups, or suspensions, or they may be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol or fractionated vegetable oils); and preservatives (e.g., methyl or propyl-p-hydroxybenzoates or sorbic acid). The preparations may also contain buffer salts, flavoring, coloring, and sweetening agents as appropriate.
Preparations for oral administration may be suitably formulated to give controlled release of the active polypeptide. For buccal administration the compositions may take the form of tablets or lozenges formulated in conventional manner. For administration by inhalation, the polypeptides for use according to the present disclosure are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebuliser, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethan- e, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of e.g. gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the polypeptide and a suitable powder base such as lactose or starch. The polypeptides may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulatory
agents such as suspending, stabilizing, and/or dispersing agents. Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen- free water, before use. The polypeptides may also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides. In addition to the formulations described previously, the polypeptides may also be formulated as a depot preparation. Such long acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by
intramuscular injection. Thus, for example, the polypeptides may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
[0176] In one embodiment, the active polypeptides are prepared with carriers that will protect the polypeptide against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.
[0177] It is especially advantageous to formulate oral or parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active polypeptide calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the disclosure are dictated by and directly dependent on the unique characteristics of the active polypeptide and the particular therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active polypeptide for the treatment of individuals.
[0178] Additional objects and advantages of the present disclosure will be appreciated by one of ordinary skill in the art in light of the current description and examples of the preferred embodiments, and are expressly included within the scope of the present disclosure.
[0179] EXAMPLE
[0180] This example demonstrates stapled peptides in accordance with embodiments of the invention. The data demonstrates the stapled peptides effectively target a protein-DNA interaction, which has not been observed previously.
[0181] Polypeptide Synthesis. Polypeptides were synthesized on a Tetras Peptide
Synthesizer (Advanced ChemTech, Louisville, KY) using Fmoc-based solid phase peptide chemistry on Rink amide resin (30 μιηοΐ polypeptide per reaction). In brief, the synthesis protocol consists of removal of the Fmoc protective group with 25% piperidine in NMP, washing with NMP, and subsequent amino acid coupling using 10 equiv. amino acid (1 mL, 0.3 M), HCTU (0.99 mL, 0.3 M) and DIPEA (2.0 mL, 0.3 M) in NMP for 60 minutes before draining and washing. All polypeptide sequences include an N-terminal β-alanine spacing residue.
Stapled peptides underwent a further ring-closing metathesis reaction on the resin-bound N- terminal Fmoc-protected polypeptide. After washing with NMP and 1 ,2-dichloroethane, the resin was exposed to three 6-hour cycles of bis(tricyclohexylphosphine)benzylidine ruthenium (IV) dichloride (Grubbs' I catalyst, 3 mL, 1 mM) at room temperature in 1,2-dichloroethane. Peptides were primarily N-terminal acetylated for use in biochemical and cell-based assays. The acetylation reaction consisted of deprotection of the Fmoc group as outlined above, followed by reaction with neat acetic anhydride (1 mL) and DIPEA (2 mL, 0.3 M in NMP) for 1 hour. Other experiments made use of N-terminal fluoresceinated peptides. To this end, Fmoc-deprotected peptides were exposed to fluorescein isothiocyanate (2.8 mL, 25 mM) and DIPEA (0.2 mL, 0.3 M) in DMF for 12 hours. Final peptides were cleaved from the resin and fully deprotected by exposure to a solution containing 95% TFA, 2.5% water, and 2.5% triisopropyl silane for 2.5-3 hours. The cleaved peptides were precipitated into ice-cold 1 :1 methyl-tert-butyl ether (MTBE), re-suspended in water and lyophilized as crude peptides overnight. The lyophilized peptides were purified by C-l 8 reverse phase HPLC on an Agilent 1200 HPLC system (Santa Clara, CA). See Table 2 for the sequences of the polypeptides that were used throughout this Example.
[0182] Circular Dichroism (CD) Spectroscopy. Acetylated compounds were dissolved in water to concentrations ranging from 60 to 75 μΜ. Final compound concentrations were determined by measuring sample absorbance at 205 nm using a NanoDrop2000
spectrophotometer (ThermoScientific, Wilmington, DE). Spectra were obtained on an Aviv Circular Dichroism Spectrometer, Model 420 (Aviv Biomedical, Inc, Lakewood, New Jersey) at 25°C. The spectra were collected using a 0.1 cm path length quartz cuvette (Hellma Analytics, Germany) with the following measurement parameters: wavelength, 240-190 nm; step resolution, 0.50 nm; averaging time, 5.0 sec per step. Spectra were processed using Aviv CDS Program software and converted to mean residue molar ellipticity using the cuvette path length (0.1 cm), the measured concentration, and the number of amino acids in the polypeptide (cross- linking amino acids and β-alanine cap were included as amino acids in this count).
[0183] Protein Purification. The C-terminal RpoN domain (CTD) of σ54 (residues 338—
398) from Klebsiella pneumoniae was cloned into the pET28b expression vector by PCR (Q5 Site-directed Mutagenesis Kit; New England Biolabs) and confirmed through Sanger sequencing. The plasmid was then transformed into E. coli Rosetta 2 (DE3) cells. The cells were grown at 37°C in 500 mL of LB medium and induced with 1 mM IPTG at ODeoo: -0.6. Four hours after induction cells were harvested via centrifugation and resuspended in IX PBS supplemented with IX Protease and Phosphatase Inhibitor Cocktail (ThermoScientific). Cells were lysed through sonication and the CTD was purified through Ni-affinity chromatography (Qiagen) and size exclusion chromatography (Superdex 75 10/300 GL; GE Healthcare).
[0184] Electrophoretic Mobility Shift Assays (EMSA). FITC-g/rcAP2 DNA (5.625 nM) was initially incubated with the library of stapled peptides (20 μΜ) for 20 minutes at room temperature in the dark for 20 minutes, with DMSO as the negative control. The complexes were formed in 25 mM HEPES, 500 mM NaCl, 10% glycerol, pH 6.9. Next, the CTD protein (32 μΜ) was added to the mixture and further incubated at room temperature for 20 minutes. 12% polyacrylamide gels (29: 1 acrylamide:bisacrylamide) were pre-run for 40 minutes at 4°C at 70 V. Samples were then electrophoresed through the gels for approximately two hours at 10 V using IX Tris-borate buffer. DNA was detected by fluorescence imaging on a Typhoon FLA 7000 (GE Healthcare).
[0185] The experiment was performed in the presence of the C-terminal fragment of σ
(residues 338-398) which contains the RpoN box, and it was observed that σ54(338-398) binds to the probe, and So54-2 disrupts this binding interaction effectively in a dose-dependent fashion. Performing the experiment using a scrambled DN A probe shows that none of the stapled peptides can interact with the probe, corroborating the fluorescence polarization results.
[0186] Induction of Nitrogen Starvation. The genotypes and origins of all bacterial strains can be found in the key resources table. Nitrogen starvation was induced in one of two ways: MG1655 E. coli were grown in LB broth, then switched to M9 minimal media (IX M9 salts, MgSC>4, CaCl2 and 20% (w/v) glycerol) containing either 40 mM (nitrogen rich) or 100 μΜ (nitrogen deficient) NH4C1. Conversely, overnight cultures were also grown in Gutnick minimal media (33.8 mM KH2P04, 77.5 mM K2HP04, 5.74 mM K2S0 , 0.41 mM MgS04) containing Ho-LE trace elements, 0.4% (w/v) glycerol and 10 mM NH4C1. The following day, cultures were prepared using Gutnick media with 3 mM NH4C1, a concentration that allows for complete depletion of nitrogen during 4 hours of growth. In Gutnick media, "nitrogen rich" is the point when ODeoo - 0.3, and "nitrogen deficient" being approximately 30 minutes after cultures have reached stationary phase.
[0187] Flow Cytometry. BW251 13 E. coli or PA01 P. aeruginosa cells were grown in
LB media to an OD6oo of 0.4-0.6. 1.0 x 106 cells were washed twice with PBS and treated with the FITC-labeled stapled-a-helical polypeptide (4 μΜ) and incubated at 37°C for 90 min Samples were washed once with PBS and incubated at 4°C as pellets for 30 min Trypan Blue (0.04% w/v) was added to all samples and removed and washed with PBS. The measurements were performed using a Beckman-Coulter Gallios Flow Cytometer in which a 488 nm laser was used to excite FITC and fluorescence was detected using the FL1 channel.
[0188] Confocal Fluorescence Microscopy. MG1655 E. coli cells were grown to an
OD6oo of 0.5-0.7 in LB media. The culture was split into separate 1 mL aliquots, centrifuged and resuspended in PBS. FITC-labeled compounds were added to a final concentration of 4 μΜ. Samples were incubated at 37°C in the dark for 90 minutes and then centrifuged to pellet the cells. The supernatant was discarded and washed twice with PBS. After centrifugation, the samples were incubated on ice as pellets in the dark for 30 minutes. FM 4-64 was added to a
concentration of 2 μg mL"1 and incubated for 5 min at 37°C in the dark. After centrifugation and resuspension in PBS, 4 μΐ, of each sample was pipetted onto the center of a square, 1% (w/v) agarose pad. Using a scalpel, the pad was placed directly atop a glass-bottom culture dish (35 mM, poly-lysine coated, MatTek Corporation). The cells were then visualized and images acquired on a Zeiss LSM780 confocal scanning microscope (Zeiss).
[0189] Fluorescence Polarization Binding Assays. FP assays were performed as described. Briefly, to determine dissociation constants for polypeptide-DNA interactions, FITC- labeled oligonucleotides (5.625 nM) were incubated with different concentrations of stapled polypeptide (40 μΜ - 9.8 nM) at 25°C for 10 min in FPA buffer (50 mM Tris-HCl pH 7.5, 1 mM DTT, 0.1 mg mL"1 BSA) in a black, opaque 96-well plate, and fluorescence polarization measured at equilibrium on a SpectraMax M5 microplate reader (Molecular Devices).
[0190] DNase I Digestion. A 216 bp oligonucleotide containing the glnA σ54 promoter
(glnAp2) was PCR amplified from pure, genomic DNA isolated from MG1655 E. coli. The resulting product was used as template in a subsequent PCR containing one 5' 6-FAM labeled primer and one unlabeled primer. The fluorescent PCR product was run on a 1% (w/v) agarose gel and gel purified. Reactions were performed as follows: 5 μΐ, stapled polypeptide (Cfinai = 20 μΜ) and 35 ΐ 6-FAM DNA (250 ng) were incubated for 15 min at 37°C. 5 μΐ, of DNase I (150 mU μΐ 1) was added and reactions incubated for 5 min at 37°C. Reactions were terminated with 5 EDTA (500 mM) and vortexed immediately. The digestion products were purified via PCR Purification (Qiagen) according to the manufacturer's protocol. The total, purified digestion products were run on a 12% polyacrylamide-TBE gel and imaged on a Typhoon Imager (GE Life Sciences). FIJI was used to quantitate remaining starting material relative to DMSO-treated samples.
[0191] Ceil Viability Assays. Bacterial Cells: MG1655 E. coli cells were grown to an
OD6oo of 1.0 and seeded onto a white, opaque 96-well plate in LB broth. The cells were incubated with compounds at the indicated doses for 1 h. Cell viability was assayed by addition of BacTiter-Glo™ bioluminescence reagent according to the manufacturer's protocol (Promega) and luminescence measured using a Spectramax M5 microplate reader (Molecular Devices). Data are normalized to vehicle-treated controls.
[0192] Cell Viability Assays. Human Cells: WS1 normal fibroblasts (1.5 x 104 cells) were seeded onto a white, opaque 96-well plate. The cells were incubated with compounds at the indicated doses for 24 h. in Opti-MEM (Gibco). Cell viability was assayed by addition of CellTiter-Glo™ bioluminescence reagent according to the manufacturer's protocol (Promega) and luminescence measured using a Spectramax M5 microplate reader (Molecular Devices). Data are normalized to vehicle-treated controls.
[0193] Quantitative RT-PCR. MG1655 E. coli were grown in Gutnick minimal media to induce nitrogen starvation. At OD6oo 0.5, cells were treated with 10 μΜ stapled polypeptide. RNA was stabilized after 80 minutes after treatment using the RNAprotect Bacteria Reagent (Qiagen), and purified using the RNeasy Mini Kit and RNase-free DNase (Qiagen). Purified RNA was stored at -80°C in nuclease-free water. 0.5 μg of total RNA was used for cDNA synthesis, following manufacturer protocols (Superscript III First-strand cDNA Synthesis System, Invitrogen). qPCR reactions were as follows: 1 cDNA, 5 μΐ, SYBR-Select Master Mix (Applied Biosystems) and 250 nM forward and reverse primer in a final volume of 10 μΐ,. Table 1 shows the sequences of all oligos and primers used.
Table 1
Nac 3 Forward CTGGATACACCAGCCACAGG 95
Nac 3 Reverse GGCATTATCGGGGCAAGTCT 96 glriA 4 Forward TACGGATAGACGCAGAACGG 97 glnA 4 Reverse AAACGTGAGTTCTGGGGGTG 98
SEQ ID NOS: 81-84 have a /5fluorT/ at the 5' end. SEQ ID NOS: 85 and 86 have /56-FAM/ at the 5' end.
Plates were briefly centrifuged (1 min, 1 ,000 RPM, RT) before target amplification was performed on a CI 000 Touch Real-Time PCR System (Bio-Rad) using the following conditions: 50°C (2 min), followed by 95°C (2 min), followed by 40 cycles of 95°C (15 s) and 60°C (1 min). A melt curve was performed at the end of each experiment with the following conditions: 65°C (5 sec), followed by 60, 5 second cycles with increases of 0.5°C per cycle. All experiments were performed in triplicate and cysG was used as a reference gene. Threshold-cycle (Ct) values were automatically calculated for each replicate and used to determine the relative expression of the gene of interest relative to cysG for both treated and untreated samples by the 2"ΔΔα method (Livak and Schmittgen, Methods, 25: 402-408, 2001, incorporated herein by reference). P-values were calculated using one-way ANOVA analysis.
[0194] Quantification of Glutaminc Synthetase Activity. MG1655 E. coli cells grown to an optical density (OD60o) of approximately 0.15 were suspended in 40 mL of M9 minimal media containing either 40 mM NH4C1 (nitrogen-rich conditions) or 100 μΜ NH4C1 (nitrogen- deficient conditions). Compounds were added to the cultures to a concentration of 10 μΜ and the cells were incubated in a shaker at 37°C for 4 hours. The samples were then removed from the incubator and cetyltrimethylammonium bromide (CTAB) was added to a concentration of 1.5 mg mL"1. Samples were incubated at 37°C for 2 minutes and subsequently centrifuged (3,500 RPM, 4°C) for 15 minutes. The supernatant was discarded, and the samples were washed with KC1 (1% w/v) and centrifuged a second time. After discarding the supernatant, pellets were resuspended in 150 xL of KC1 (1% w/v). An assay mixture (40 mM L-glutamine, 40 mM
NH2OH HCl, 800 μΜ Na-ADP, 40 mM postassium arsenate, 100 mM mixed imidazole buffer (0.33 M each of imidazole, 2-methylimidazole, and 2,4-dimethylimidazole, pH 7.15), 600 μΜ MnCh, and 0.2 mg mL"1 CTAB, pH 7.15) was added, and samples were incubated at 37°C for 30 minutes. After incubation with termination buffer (3.33% FeCl3, 2% trichloroacetic acid, and 250
niM HC1) for 15 min, particulate matter was pelleted by centrifugation (3.500 RPM, RT) for 15 minutes. The absorbance at a wavelength of 540 nm was quantified using a Spectramax M5 plate-reader (Molecular Devices) to determine the amount of gamma glutamyl hydroxamate, indicative of active enzyme.
[0195] RNA-Seq. RNA for the RNA-Seq experiment was obtained exactly as described previously for the quantitative RT-PCR experiment. RNA libraries were prepared for sequencing using standard Illumina protocols. Sequenced reads were trimmed for adaptor sequence, and masked for low-complexity or low-quality sequence, then mapped to E. coli K-12 genome using bowtie2 with default parameters. Reads were counted by feature count and then reads-per- megabase of library size (CPM) were generated and normalized by the limmaVoom pipeline. All data are publicly available through GEO (accession # GSE1 11317).
[0196] Gene Set Enrichment Analysis. Gene set enrichment analysis was performed using GSEAPreranked version 6 module from GenePattern (Reich et al., Nature Genetics 38: 500 (2006), incorporated by reference herein). The ranked list of genes based on fold change data from RNA-seq was used as the ranked list input for GSEAPreranked. A database containing 155 E. coli gene sets with fewer than 500 gene members each was obtained from gene2go (Powell, BMC Bioinformatics, 15:146 (2014), incorporated by reference herein). The gene set for rpoN regulon was generated by selecting all the genes with an intergenic sense rpoN consensus sequenced that were identified by ChlP-seq. The gene set for the rpoH regulon was obtained from genes dev 2006 20 1776. The rpoN and rpoH gene sets were combined to generate an alternative sigma factor gene set database. 1000 permutations of the gene set were used to assess the significance of the enrichment score for each gene set.
[0197] Hierarchical clustering analysis. Hierarchical clustering was performed using
Heatmapper (doi: 10.1093/nar/gkw419). The distance measurement method used was Euclidean and clustering methods used was average linkage.
[0198] Quantification and Statistical Analysis. Unless otherwise specified, data are represented as the means of three, independent experiments (n=3) with error bars reflecting the standard error of the mean (SEM). P-values were determined with a 1-way ANOVA test
compared to vehicle treatment (DMSO): (* = < 0.05; ** = < 0.005; *** = < 0.0005; **** = < 0.00005). All statistical analyses were performed with GraphPad Prism 7.01.
[0199] Examination of Stapled Polypeptides Effect on Cell Viability. As discussed above, the polypeptides of the present disclosure are modeled to inhibit transcription. Cell viability was assessed to ensure that downstream anti-virulence effects are observable. By using a standard broth microdilution method as described in Cockerill et al. (F. R. Cockerill, M. A. Wiker, J. Alder, M. N. Dudley, G. M. Eliopoulos, M. J. Ferraro, D. J. Hardy, D. W. Hecht, J. A. Hindler, J. B. Patel, M. Powell, J. M. Swenson, R. B. Thomson, M. M. Traczewski, J. D.
Turnidge, M. P. Weinstein, B. L. Z. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically ; Approved Standard— Ninth Edition. Methods Dilution Antimicrob. Susceptibility Tests Bact. That Grow Aerob. Approv. Standar- Ninth Ed. 32, (2012) , incorporated by reference herein in its entirety), the antimicrobial activity of stapled polypeptide analogs were assessed. As seen in Table 2, the minimum inhibitory concentration (MIC) value of all polypeptides is 32 Mg/mL or higher. As this value is high compared to many conventional antibiotics (Cockerill et al. 2012), the polypeptide can be assessed at low concentrations to study its effects on virulence properties of Gram negative bacteria.
[0200] Table 2. Minimum inhibitory concentration values associated with acetylated stapled a-helical polypeptide analogs. BW25113 E. coli cells were incubated with varying concentrations of polypeptide for 18 hours at 37°C according to CLSI standards.
Cells. WS1 fibroblasts cells were exposed to serial dilutions of each polypeptide (i.e., stapled polypeptide analog). As can be seen from FIG. 1, the polypeptides are not toxic to normal eukaryotic cells over a concentration range peaking at 10 μΜ.
[0202] Examination of the Cytotoxicity the Stapled Polypeptides to Prokaryotic
Cells. MG1655 E. coli cells were exposed to 10 μΜ of each polypeptide (i.e., stapled polypeptide, vehicle control (DMSO) or wildtype polypeptide). As can be seen from FIG. 12, most of the stapled polypeptides have either low levels of cytotoxicity or no cytotoxicity at a concentration of 10 μΜ.
[0203] Examination of the Helical Structure of the Stapled Polypeptides. Circular dichroism spectroscopy was carried out by dissolving the stapled polypeptides (i.e., the polypeptides) in water. While the wild type σ54 polypeptide is unstructured, stapled
polypeptides 1-4 all possess the hallmark spectrum of an alpha-helical secondary structure (FIG. 2).
[0204] Sa54 Peptides Enter Gram-Negative Bacteria by Diffusion. Flow cytometry was used to gain a high-throughput perspective on the effectiveness of each stapled polypeptide in a large population of bacteria. By making use of its individual event detection, the percentage of cellular uptake of the polypeptides was determined. As shown in FIG. 3, in both E. coli and P. aeruginosa species of Gram negative bacteria, all four polypeptide analogs are capable of penetration. Compared to the vehicle control, the wild type polypeptide, the sequence in which no staple is present, shows minor penetration in PA01 P. aeruginosa (p-value < 0.05) and insignificant levels of penetration in BW25113 E. coli (p-value > 0.05). With each polypeptide, there is a penetration of at least 50% of cells in each polypeptide sample (p-value < 0.001). In particular, σ54-2 appears to have the highest penetrance whereas σ54-4 has the least. To determine the mode of transport within the cell, sodium azide (NaN3) was used to inactivate ATPases used in hydrogen ion transport in accordance with Noumi et al (Noumi, T., Maeda, M. & Futai, M. Mode of inhibition of sodium azide on H+-ATPase of Escherichia coli. FEBS Lett. 213, 381-384 (1987), incorporated by reference herein in its entirety). All interior transport will
be conducted through a non-active method such as passive or facilitated diffusion. With both types of treatments, it's possible to determine whether the mode of uptake of stapled
polypeptides is through active or passive transport. Furthermore, with passive transport, the entry of the polypeptide should be faster than active due to the lack of metabolic means necessary to promote cell entry. The majority of polypeptide analogs increase in penetration upon NaN3 (i.e., sodium azide) treatment. This may be an indicator that the polypeptide is able to be pumped out by bacteria to as small degree. This data demonstrates that stapled polypeptides are capable of penetrating cells better than their unstapled counterpart in a charge independent manner.
[0205] Examination of Cell Penetration via Confocal Microscopy. Confocal microscopy was used as a low throughput visual method of assessing cell penetrance. As shown in the cells displayed in FIG. 4, the confocal microscopy data of cell penetration of the polypeptides correlate with the flow cytometry data, i.e., some cells display strong fluorescence intensity and others display less with high cell penetration observed with stapled polypeptides. By using an image-based detection method for permeability, it was observed that the double-stranded DNA of E. coli appears to aggregate in the center, away from the membrane. In many of the cells observed, a number of the cells were undergoing cell division but still had significant uptake of the stapled polypeptides. With the cell membranes, it is seen that the polypeptide does not integrate itself into the membrane due to a lack of masking of the membrane stain. These polypeptides must cross both the cell wall and cell membrane to remain in the cytoplasm of bacteria.
[0206] Sa54 Peptides Bind to the σ54 Promoter Element. The binding of σ54 RpoN with the -24 site of glnA was thoroughly examined through the use of fluorescence polarization. Fluorescence polarization is a powerful tool in determining biomolecular affinities, where the emission polarization and the molecular rotational diffusion are dependent upon the molecular binding. In this study, the change in polarization of FITC tagged double stranded -24 g/«Ap2 sequence at vary concentrations of σ54 stapled a-helical polypeptides was studied thoroughly to determine the level of polarization (millipolarization or MP), which is directly proportional to the level of binding between the polypeptide and the DNA. That is, a higher MP correlates with an
increased binding affinity to the specific stretch of DNA being studied, which is the double stranded -24 glnA sequence. The data is shown in FIG. 5 in which the stapled polypeptide at a concentration of 40 μΜ to 39 nM were incubated with ¥YTC-glnAp2 (5.625 nM) for 10 minutes at 4 °C. Fluorescence polarization was read on a Spectramax M5 plate reader (Molecular Devices) and are shown in FIG. 5. Each individual points represents the mean value of 5 independent experiments, and the error bars are S.E.M.
[0207] The table below shows the dissociation constants determined from the graph. The "scramble" sequence is a negative control.
Table 3
The scramble sequence was RVL * EFK* (Nle)T ARYK (SEQ ID NO: 75) with each asterisk being (S)-pentenylalanine. Each of the above had an acetyl N-terminal cap and were amidated at the C-terminus.
[0208] To further confirm the ability of So54 peptides to bind to DNA, a DNase digestion assay was performed by combining a 6-FAM-labeled dsDNA oligo containing E, coli glnAp2 with polypeptide and exposing the mixture to DNase I. The reaction mixtures were separated by polyacrylamide gel electrophoresis and analyzed by fluorescence scanning. Treatment with the wild type σ54 polypeptide showed a significant amount of DNA degradation as observed in vehicle-treated DNA, confirming the fluorescence polarization results showing a lack of binding by this polypeptide. On the other hand, Sa54 peptides were far more effective at protecting DNA
from enzymatic degradation. There were differences in the ability of each Sa polypeptide to shield DNA from cleavage, with Sa54-1 and -2 being the most effective. Notably, the binding affinities correlate with the ability of the peptides to protect DNA from degradation by an endonuclease. The differential binding of the peptides suggests that each of these compounds may result in varying degrees of activity in a biological setting.
[0209] Examination of the Specific Binding Between the Polypeptide Analogs
(stapled polypeptides) and the Double Stranded glnA DNA Sequence. A fluorescence lifetime imaging microscope (FLIM) setup was utilized to evaluate the specific binding between the polypeptide analogs and the double-stranded glnA DNA sequence of 30 base pairs in length bound to a solid phase. Foster resonance energy transfer (FRET) is a widely used technique in determining biomolecular binding (Cremazy, F. G. E. et al. Imaging in situ protein-DNA interactions in the cell nucleus using FRET-FLIM. Exp. Cell Res. 309, 390-396 (2005) and Wouters, F. S., Verveer, P. J. & Bastiaens, P. I. H. Imaging biochemistry inside cells. Trends Cell Biol. 11, 203-211 (2001), incorporated by reference herein in its entirety), along with the quantitative analysis of biomolecular conformational and structural changes (Jares-Erijman, E. a & Jovin, T. M. FRET imaging. Nat. Biotechnol. 21, 1387-1395 (2003), Selvin, P. R. The renaissance of fluorescence resonance energy transfer. Nat. Struct. Biol. 7, 730-734 (2000), and Schuler, B., Lipman, E. a & Eaton, W. a. Probing the free-energy surface for protein folding with single-molecule fluorescence spectroscopy. October 743-748 (2002).
doi: 10.1038/nature01062.1, each incorporated by reference herein in its entirety), where FRET is observed upon the close proximity of the donor and acceptor fluorophores (1-10 nm) (Edelhoch, H., Brand, L. & Wilchek, M. Fluorescence studies with tryptophyl peptides. Biochemistry 6, 547-559 (1967), incorporated by reference herein in its entirety). FITC was selected as the polypeptide donor due to its excitation at 488 nm and Cy5 as the acceptor due to its lack of 488 nm excitation, its absorption within FITC's emission range, and its emission outside the FITC emission range. See FIG. 6. In this experimental setup, a Cy5 tagged DNA (acceptor) was immobilized on to a thin film of gold nanoparticles (AuNP), where the latter' s purpose is to enhance single molecular fluorescence events (Simoncelli, S. et al. Thermoplasmonic ssDNA Dynamic Release from Gold Nanoparticles Examined with Advanced Fluorescence Microscopy.
J. Phys. Chem. Lett. 6, 1499-1503 (2015), incorporated by reference herein in its entirety). By using single molecular events, it is possible to visualize the direct interaction between DNA and polypeptide. FITC tagged polypeptide (donor) was then added to the AuNP-glnA conjugates, with FRET only to be observed upon the specific binding of the DNA and the stapled
polypeptide. As the maxima of both tagged and non-tagged FITC are aligned, the interaction between DNA and polypeptide displays the profile shown in FIGS. 7A and 7B, and FRET occurs due to the presence of a Cy5 signal from an excitation at 488 nm.
[0210] Examination of Ability of Stapled Polypeptides to Inhibit Pathogenic
Functions that Relate to σ54 Expression in vivo. To further understand the functioning of the σ54 RpoN peptidomimetics, the polypeptide's ability to inhibit known pathogenic functions of bacteria related to σ54 expression in vivo was assessed. By performing phenotypic assessments of known o54-regulated functions, the down-regulatory effects of the stapled a-helical polypeptide analogs were monitored.
[0211] The involvement of σ54 in nitrogen assimilation is due to its regulation of the glnA gene; this gene encodes a subunit for glutamine synthetase (Da Salva Neto et al. 2010, Reitzer, L. J. & Magasanik, B. Transcription of glnA in E. coli is stimulated by activator bound to sites far from the promoter. Cell 45, 785-792 (1986), and Reitzer, L. J. et al. Mutations that create new promoters suppress the sigma 54 dependence of glnA transcription in Escherichia coli. J. Bacterial. 169, 4279-4284 (1987), each incorporated by reference herein in its entirety). By monitoring this gene in nitrogen-poor conditions, GlnA expression was assessed. As seen in FIG. 8, GlnA expression in the DMSO vehicle control is higher than when σ54-3 polypeptide treatment is applied to a sample of BW25113 cells. With the application of a RpoN-modeled stapled a-helical polypeptide, transcription is inhibited approximately three fold.
[0212] Examination of Bacterial Motility when Treated with Stapled Polypeptides.
A modified classic motility assay was used to determine the bacteria's ability to travel through soft media (Lane, M. C. et al. Role of Motility in the Colonization of Uropathogenic Escherichia coli in the Urinary Tract Role of Motility in the Colonization of Uropathogenic Escherichia coli in the Urinary Tract. 73, 7644-7656 (2005), incorporated by reference herein in its entirety). As shown in FIG. 9, knockout MC4100 strain displays (9 A through 9F) a phenotype in which the
bacteria do not grow/move significantly away from the point of inoculation. In BW25113 cells, all polypeptides show a degree of inhibition of growth/movement away from the point of inoculation relative to the vehicle and wild-type polypeptide. As demonstrated from the change in diameter of bacterial growth, the polypeptides do not possess the same motility inhibition in the knocked out cell line (9C-9F) as compared to the non-knock out cell line (9I-9L). As the polypeptide decreases the expression of motility-related genes, the overall ability of the polypeptides does demonstrate a decrease in flagellar mobility of the bacteria.
[0213] Examination of Biofilm Growth/Formation. An adapted biofilm growth experiment was utilized to observe and quantify biofilms growth through the use of crystal violet (O'Toole, G. a. Microtiter dish biofilm formation assay. J. Vis. Exp. 3-5 (2011).
doi:10.3791/2437, Merritt, J. H., Kadouri, D. E. & O'Toole, G. a. Growing and analyzing static biofilms. Curr. Protoc. Microbiol. 1-18 (2011). doi:10.1002/9780471729259.mc01b01s22, and Cady, N. C. et al. Inhibition of biofilm formation, quorum sensing and infection in Pseudomonas aeruginosa by natural products-inspired organosulfur compounds. PloS One 7, (2012), each incorporated by reference herein in its entirety). This allows for the determination of a delay in biofilm formation relative to a vehicle control. DMSO has surfactant properties that enable it to inhibit the natural surface tension of water. As a result, the crystal violet staining of the vehicle control varies among trials. PA01 was grown overnight. The culture was diluted so that the bacteria enter log phase. The diluted culture was plated into M63 media with or without polypeptides at 4 μΜ in solution. The plate was angles at about 35° to allow for biofilm growth at the air-liquid interface. The plates were incubated for 6 hours and biofilm formation was observed. Crystal violet staining is proportional to the amount of biofilm present so a lower absorbance was indicative of less stain retention and thus, biofilm formation. As shown in FIG. 10, σ54-1, σ54-2, σ54-3, and σ54-4 polypeptides each demonstrated a modest decrease in biofilm formation with σ54-2 showing the biggest decrease in biofilm formation. This result is directly in line with the motility experiment as both demonstrate that the polypeptides, regardless of the staple's positioning, are able to inhibit phenotypic functions of a54-regulated virulence factors.
[0214] Biofilm penetration was also examined using FITC labeled σ-54 polypeptides.
After treatment with the fluorescently labeled σ54 polypeptides, the biofilm was homogenized and subjected to flow cytometry. In particular, the method is similar to that described above with regard to FIG. 10, but without the polypeptide treatment in the initial mixture. The biofilms were grown for 48 hours to reach maturity. The mature biofilms were then treated with the fluorescently labeled polypeptides for 90 minutes at 37°C. The treated biofilms were washed repeatedly with phosphate buffered saline (PBS) and the cells scraped from the plate. The removed cells were suspended in 1.5 mL tubes and placed on ice for 30 minutes and flow cytometry performed. As shown in FIG. 11 , the stapled polypeptides σ54-1 , σ54-2, σ54-3, and σ54-4 demonstrated substantially greater biofilm penetration, as compared to the wild type σ54 control polypeptide.
[0215] Stapled σ54 Peptides Block the Upregulation of a54-dependent Genes. See
FIG. 13 for a dot plot showing regulation of genes by the σ54 polypeptides. In E. coli, σ54 is primarily responsible for triggering transcription in response to nitrogen starvation. It was hypothesized that exposing E. coli cells to growth media deficient in nitrogen would initiate σ54- mediated transcription of nitrogen metabolism genes, and subsequent treatment with SG54 peptides would reverse or inhibit that transcriptional activation. To examine this, MG1655 E. coli cells were cultured in Gutnick minimal media to induce nitrogen starvation. Cells were then treated with polypeptide, and RNA was later isolated and processed for RT-PCR analysis (FIG. 14). RNA was quantified for the a54-dependent nitrogen starvation response genes glnA, yeaG and nac, which are involved in nitrogen fixation, metabolism and assimilation. pspA, a σ54- dependent gene that responds to cell membrane disruptions and is not responsive to nitrogen levels, was looked into, and the housekeeping gene cysG was used as a control. Exposure to nitrogen deficient conditions activates transcription of glnA by a factor of 10, yeaG 100-fold, and nac close to 500-fold while pspA was unaffected by nitrogen depletion. Treatment with the wild type σ54 polypeptide showed no difference in mRNA levels when compared to the untreated control; however, exposure to Sa54 peptides, particularly Sa54-2 and SG54-3, restricted the mRNA levels of the nitrogen response genes to the basal levels found in cells at the nitrogen-rich
state (N+, FIG. 14). Some Sa peptides also increased the levels of pspA transcripts, which is not surprising given the involvement of this gene in responding to changes in the integrity of the bacterial envelope and membranes. Because nitrogen depletion with a concomitant blockade in the transcription of nitrogen metabolism genes is likely to be toxic to bacterial cells, it was verified that E. coli cells are alive at the dose used in the RT-qPCR experiment via cell viability demonstrating that the low levels of nitrogen metabolism gene transcripts detected in SG54- treated cells are not due to cell death. It was evaluated whether the compounds were toxic to human cells, and the data show that, at these doses, Sa54 peptides are not toxic to human cells despite the ability of the peptides to penetrate human cells.
[0216] Experiments were performed to confirm that inhibition of a54-dependent gene transcription led to a decrease in the nitrogen sensitivity response. The intracellular activity of glutamine synthetase, the gene product of glnA, was measured in a colorimetric assay (Rothstein et al, PNAS, 77: 7372-7376 (1980), incorporated by reference herein), and found no appreciable enzymatic activity in cells treated with Sa54-2 and Sa54-3 (FIG. 15), which is consistent with the observations from the RT-qPCR experiment.
[0217] To understand more broadly the full-scale effects of stapled σ54 peptides on the transcription of activated a54-dependent genes, an RNA-Seq experiment was executed to analyze the transcriptome of E. coli. MG1655 E. coli cells were grown in Gutnick media to induce nitrogen starvation, were treated with either WT σ54, SG54-1, or Sa54-2, and RNA isolated and processed for RNA-Seq. Comparison of the data set for Sa54-2 treatment versus DMSO control showed differential expression of 2,191 of the 4,273 genes detected, 1047 of which were positively regulated and 1140 were negatively regulated by a factor of 2 or greater. Gene set enrichment analysis (GSEA) (Subramanian et al., PNAS, 102: 15545-15550 (2005), incorporated by reference herein) with all 155 E. coli gene sets with fewer than 500 genes per set from gene2go (Powell, BMC Bioinformatics 15: 146 (2014), incorporated by reference herein) showed that 6 gene sets were positively regulated with a false discovery rate of less 5%. These included carbohydrate and polysaccharide biosynthesis, amide biosynthesis and catabolism, and metal ion transport. 6 out of 155 gene sets were negatively regulated with a false discovery rate
of less than 5%, including amino acid, organic acid, and organonitrogen catabolism. These results are consistent with the SG54 having minimal impact on gene sets that describe a common function.
[0218] When GSEA was performed using gene sets for the RpoN (σ54) and RpoH regulons, the RpoN regulon was shown to be negatively regulated with a false discovery rate of less 0.1 %. This result is consistent with SG54-2 binding to the σ54 promoter preventing transcription of genes under σ54 control. In contrast, the RpoH regulon, which is regulated by σ32 alternative sigma factor as part of the heat shock response, was neither positively nor negatively regulated by Sa54-2. Similarly, GSEA of Sa54- 1 versus DMSO showed the RpoN regulon was negatively regulated and the RpoH was not significantly impacted. Hierarchical clustering of the transcriptome data for genes under σ54 (RpoN) and σ32 (RpoH) control clearly showed that genes from the RpoN regulon cluster together and were negatively regulated in the positive control (i.e., growth in nitrogen rich media) and Sa54-2 and Sa54- 1 treatment, but not with WT σ54 treatment. These data are consistent with and strongly support the selective, negative regulation of the RpoN regulon by Sa54.
[0219] σ54 Polypeptide Inhibits σ54 Function of Pseudomonas aeruginosa.
Swarming activity of this pathogen is controlled directly by the transcriptional activity of σ54. Whereas unstapled polypeptide did not control swarming, stapled polypeptide (σ54-2) did (the phenotype was consistent with inhibition of σ54 transcriptional activity).
[0220] Specific Embodiments
[0221] In an aspect, the present disclosure provides a polypeptide comprising: a polypeptide derived from a bacterial RNA polymerase cofactor comprising at least two non- natural amino acids.
[0222] In any aspect or embodiment described herein, the polypeptide is derived from the amino acid sequence: FKVARRTVAKYREML (SEQ ID NO: 3).
[0223] In any aspect or embodiment described herein, the polypeptide is a polypeptide comprising the structure of at least one of:
i) aKV ARRTyAKYRE (SEQ ID NO : 4);
ii) KV ARRTy A YRE(M/ Q/ S/NL)6 (SEQ ID NO: 5);
iii) FKVpRRTVAKYRE (SEQ ID NO: 6), with an optional δ after E;
iv) aKVApRRTVAKYRE (SEQ ID NO: 7), with an optional δ after E, or aKVApRTVA YRE (SEQ ID NO: 8), with an optional 6 after E;
v) cxKVpRRTyAKYRE (SEQ ID NO : 9);
vi) aKVApRTVAKYRE(M/Q/S/NL)LGIPSSRERRI (SEQ ID NO: 36); or vii) a VpRRTyA YRE(M/Q/S/NL)5GIPSSRERRI (SEQ ID NO: 37), wherein at least two of α, β, γ and δ are non-natural amino acids.
[0224] In any aspect or embodiment described herein, at least two of the at least two non- natural amino acids form a hydrocarbon staple or disulfide bond.
[0225] In any aspect or embodiment described herein, the polypeptide is from about 14 to about 27 amino acids in length.
[0226] In any aspect or embodiment described herein, the polypeptide comprises at least one of an amino terminal capping group, a linker or a combination thereof.
[0227] In any aspect or embodiment described herein, the location of the at least two non- natural amino acids forming a hydrocarbon staple or disulfide bond are located at positions i and i+7 or i and i+4 of an amino acid sequence of the polypeptide.
[0228] In an additional aspect, the present disclosure provides a polypeptide having the structure:
[d]i(a)KV(p)RRT(y)AKYRE(M/Q/S/NL)(6) (SEQ ID NO: 38),
[d]i(a) VA(p)RTVAKYRE(5) (SEQ ID NO: 39);
[d]i(a)KV(P)RRT(Y)AKYRE(M/Q/S/NL)(6)GIPSSRERRI (SEQ ID NO: 40); or
[d]i(a)KVA(P)RTVA YRE(M/Q/S/NL)LGIPSSRERRI (SEQ ID NO: 41),
wherein:
d is independently a capping group, a linker, a tryptophan, or a combination thereof;
i is 0 or 1 ;
a is F, x, z or a combination thereof;
β is A or x or both;
γ is V, z or x;
δ is L, M or x; and
"z" and "x" correspond to a non-natural amino acid, wherein at least two of α, β, γ, and 6 are non-natural amino acids.
[0229] In any aspect or embodiment described herein, the location of the at least two non- natural amino acids forming a hydrocarbon staple or disulfide bond are located at positions i and i+7 or i and i+4 of an amino acid sequence of the polypeptide.
[0230] In any aspect or embodiment described herein, the capping group is at least one of Ac (acetyl), FITC (fluorescein thiourea), Bt (biotinyl) or any other fluorophore or affinity agent.
[0231] In any aspect or embodiment described herein, the linker is at least one of beta- alanine or other linking entity (e.g., PEG).
[0232] In any aspect or embodiment described herein, x is (S)-pentenylalanine.
[0233] In any aspect or embodiment described herein, z is (R)-octenylalanine.
[0234] In any aspect or embodiment described herein, z is (R)-octenylalanine and x is (S)- pentenylalanine.
[0235] In a further aspect, the present disclosure provides a polypeptide having the structure of a member selected from the group consisting of:
SG54-1 Bi-linkeri-Tryptophani-FKVARRTzAKYRE(Nle)x-NH2 (SEQ ID
NO: 42);
Sa54-2 Bi-linkeri-Tryptophani-FKVxRRTxAKYRE(Nle)L-NH2 (SEQ ID
NO: 43);
Sa54-3 Bi-linkeri-Tryptophani-z VARRTxAKYRE(Nle)L-NH2 (SEQ ID
NO: 44);
Sa54-4A Bi-linkeri-Tryptophani-xFKVxRTVAKYRE(Nle)L-NH2 (SEQ ID
NO: 45);
So54-4B Bi-linkeri-Tryptophani-xKVAxRTVAKYRE(Nle)L-NH2 (SEQ ID
NO: 46);
wherein:
"B" is any of the capping groups Ac (acetyl), FITC (fluorescein thiourea), Bt (biotinyl) or any other fluorophore or affinity agent,
"linker" is beta-alanine or other linking entity (e.g., PEG),
"i" is independently 0 or 1 , and
"z" and "x" correspond to a non-natural amino acid.
[0236] In any aspect or embodiment described herein, "z" corresponds to the non-natural amino acid (R)-octenylalanine.
[0237] In any aspect or embodiment described herein, "x" corresponds to the non-natural amino acid (S)-pentenylalanine.
[0238] In another aspect, the present disclosure provides a polypeptide having the structure of a member selected from the group consisting of:
AA SG54 Bi-linkeri-Tryptophani-zKVARRTxAKYRE(Nle)LGIPSSxERRx-NH2 (SEQ ID NO: 47);
EC So54 Bi-linkeri-Tryptophani-zKVARRTxAKYRESLSIPSSxQRKxLV-NH2 (SEQ ID NO: 48);
BS Sa54 Bi-linkeri-Tryptophani-zKVARRTxA YREQ(Nle)NIPSSxARKxYK-NH2
(SEQ ID NO: 49); and
PA So54 Bi-linkeri-Tryptophani-zKVARRTxAKYRE(Nle)LGIAPSSxRKRxV-NH2
(SEQ ID NO: 50);
So54-l Long Bi-linkeri-Tryptophani-FKVARRTzA YRE(Nle)xGIPSSRERRI-NH2 (SEQ ID NO: 51);
Sa54-2 Long Bi-linkeri-Tryptophani-FKVxRRTxAKYRE(Nle)LGIPSSRERRI-NH2 (SEQ ID NO: 52);
Sa54-3 Long Bi-linkeri-Tryptophani-zKVARRTxAKYRE(Nle)LGIPSSRERRI-NH2
(SEQ ID NO: 53); and
So54-4 Long Bi-linkeri-Tryptophani-xKVAxRTVAKYRE(Nle)LGIPSSRERRI-NH2
(SEQ ID NO: 54),
wherein:
"B" is any of the capping groups Ac (acetyl), FITC (fluorescein thiourea), Bt (biotinyl) or any other fluorophore or affinity agent,
"linker" is beta-alanine or other linking entity (e.g., PEG),
"i" is independently 0 or 1, and
"z" and "x" correspond to a non-natural amino acid.
[0239] In any aspect or embodiment described herein, "z" corresponds to the non-natural amino acid (R)-octenylalanine.
[0240] In any aspect or embodiment described herein, "x" corresponds to the non-natural amino acid (S)-pentenylalanine.
[0241] In another aspect, the present disclosure provides a polypeptide comprising Formula (I):
or a pharmaceutically acceptable salt thereof,
wherein:
each Ri and R2 are independently H, alkyl, alkenyl, alkynyl, arylalkyl, cycloalkylalkyl, heteroaryl alkyl, or heterocyclylalkyl;
each R3 is independently alkylene, alkenylene, alkynylene; [R4— — R4']r>; each of which is substituted with 0-6 R5;
R4 and R4' are independently alkylene, alkenylene or alkynylene;
each R5 is independently is halo, alkyl, OR6, N(R6)2, SR6, SOR6, SO2R6, CO2R6, R(„ a fluorescent moiety, or a radioisotope;
K is independently O, S, SO, S02, CO, C02, CONR6 or
each R.6 is independently H, alkyl, or a therapeutic agent;
Rz and Rw are independently H, hydroxyl, amide (NH2), tryptophan, a linker, D, a B- linker— , a linker-tryptophan— , a B-tryptophan— , or B-linker-tryptophan— ;
"B" is any of the capping groups Ac (acetyl), FITC (fluorescein thiourea), Bt (biotinyl) or any other fluorophore or affinity agent;
"linker" is beta-alanine or other linking entity (e.g., PEG);
n is an integer from 1 -4;
x is 2, 3, 4 or 6;
y and w are independently integers from 0-100; and
each Xaa is independently an amino acid;
wherein the polypeptide comprises at least 8 contiguous amino acids of a bacterial RNA polymerase cofactor or a variant thereof or a homologue of a bacterial RNA polymerase cofactor or a variant thereof except that: (a) within the 8 contiguous amino acids the side chains of at least one pair of amino acids separated by 3, 4 or 6 amino acids is replaced by the linking group R3 which connects the alpha carbons of the pair of amino acids as depicted in Formula I and (b) the alpha carbon of the first amino acid of the pair of amino acids is substituted with Ri as depicted in formula I and the alpha carbon of the second amino acid of the pair of amino acids is substituted with R2 as depicted in Formula I.
[0242] In any aspect or embodiment described herein, the bacterial RNA polymerase is alternative sigma factor σ54 (RpoN).
[0243] In any aspect or embodiment described herein, the polypeptide is derived from the amino acid sequence: FKVARRTVAKYRE(M/Q/S/NL)L (SEQ ID NO: 74), wherein NL is norleucine.
[0244] In any aspect or embodiment described herein, x is 3 or 6.
[0245] In any aspect or embodiment described herein, x is 2, 3, or 6; R3 is an alkenyl containing a single double bond; and both Ri and R2 are H.
[0246] In any aspect or embodiment described herein, the [Xaa]* is selected from the group consisting of:
(i) AKYRE(M/S/Q/NL) (SEQ ID NO: 56);
(ii) RRT;
(iii) KVARRT (SEQ ID NO: 57);
(iv) FKV;
(v) KVA;
(vi) KVARRT (SEQ ID NO: 57);
(vii) QRK;
(viii) ARK; and
(ix) RKR,
wherein NL is norleucine.
[0247] In any aspect or embodiment described herein, when:
[Xaa]* is (ii) RRT, [Xaa]w is FKV and/or [XaaL is AKYRE(M/S/Q/NL)L (SEQ ID NO: 59);
[Xaa]* is (iii) KVARRT (SEQ ID NO: 57), [Xaa]w is H and/or [XaaL is
AKYRE(M/S/Q/NL)L (SEQ ID NO: 59);
[Xaa]* is (iv) FKV, [Xaa]w is H and/or [XaaL is RRTVAKYRE(M/S/Q/NL) (SEQ ID NO:
60);
[Xaa]x is (v) KVA, [Xaa]w is H and/or [Xaa]y is RRTVAKYRE(M/S/Q/NL) (SEQ ID NO:
60);
[Xaa]* is (vi) KVARRT (SEQ ID NO: 57), [Xaa]w is H and/or [XaaL is
AKYRE(M/S/Q/NL) (SEQ ID NO: 56);
[Xaa]* is (vii) QRK, [Xaa]w is AKYRESLSIPSS (SEQ ID NO: 61) and/or [XaaL is LV;
[Xaa]* is (viii) ARK, [Xaa]w is AKYREQL(M/S/Q/NL)NIPSS (SEQ ID NO: 62) and/or [XaaL is YK; and
[Xaa]* is (ix) RKR, [Xaa]w is AKYRE(M/S/Q/NL)LGIAPSS (SEQ ID NO: 63) and/or [Xaa]} is V.
[0248] In any aspect or embodiment described herein, when:
[Xaa]¾ is (i) AKYREM (SEQ ID NO: 64), [Xaa]w is FKVARRT (SEQ ID NO: 58) and/or [Xaa]^ is GIPSSRERRI (SEQ ID NO: 65);
[Xaa]* is (ii) RRT, [Xaa]w is FKV and/or [Xaa]y AK YRE(M/S/Q/N L)LGIP S S RERRI (SEQ ID NO: 66);
[Xaa] is (iii) KVARRT (SEQ ID NO: 57), [Xaa]w is H and/or [XaaJ^ is
AKYRE(M/S/Q/NL)LGIPSSRERRI (SEQ ID NO: 66); and
[Xaa]* is (v) KVA, [Xaa]w is H and/or [XaaL is RT V AK YRE(M/S/Q/NL)LGIP S S RERRI (SEQ ID NO: 67).
wherein:
q is an integer from 0-100; and
Ri, R2, and R3 are independently selected; and [Xaa]*-, [Xaa]y, and [Xaa]v are selected from the group consisting of:
(i) KVARRT (SEQ ID NO: 57), AKYRE(M/S/Q/NL)LGIPSS (SEQ ID NO: 68), and ERR;
(ii) KVARRT (SEQ ID NO: 57), AKYRESLSIPPS (SEQ ID NO: 69), and QRK;
(iii) KVARRT (SEQ ID NO: 57), AKYREQ(M/S/Q/NL)NIPSS (SEQ ID NO: 70), and ARK;
(iv) KVARRT (SEQ ID NO: 57), AKYRE(M/S/Q/NL)LGIAPSS (SEQ ID NO: 63), and RKR; and
NL is nor leucine.
[0250] In any aspect or embodiment described herein, when:
[Xaa]x, [Xaa]y, and [Xaa]v is (ii), [Xaa]? is LV;
[Xaa]*, [Xaa]j,, and [Xaa]v is (iii), [Xaa]? is YK; and
[Xaajx, [XaaL, and [Xaa]v is (iv), [Xaa]? is V.
[0251] In an additional aspect, the present disclosure provides a pharmaceutical composition for treating or preventing a bacterial infection, the pharmaceutical composition comprising a therapeutically effective amount of a polypeptide of the present disclosure and a
pharmaceutically acceptable excipient.
[0252] In yet another aspect, the present disclosure provides a method treating and/or preventing a bacterial infection, the method comprising: administering an effective amount of a composition of the present disclosure or a polypeptide of the present disclosure to a subject in need thereof, wherein the composition or polypeptide is effective in treating or preventing a symptom of the bacterial infection.
[0253] In a further aspect, the present disclosure provides a method of inhibiting
transcription in a prokaryote, the method comprising administrating an effective amount of a composition of the present disclosure or a polypeptide of the present disclosure.
[0254] It is understood that the detailed examples and embodiments described herein are given by way of example for illustrative purposes only, and are in no way considered to be limiting to the invention. Various modifications or changes in light thereof will be suggested to persons skilled in the art and are included within the spirit and purview of this application and are considered within the scope of the appended claims. For example, the relative quantities of the ingredients may be varied to optimize the desired effects, additional ingredients may be added, and/or similar ingredients may be substituted for one or more of the ingredients described. Additional advantageous features and functionalities associated with the systems, methods, and processes of the present invention will be apparent from the appended claims.
[0255] In another aspect, the invention provides a polypeptide comprising Formula (II):
or a pharmaceutically acceptable salt thereof,
wherein:
Ri and R2 are independently H, alkyl, alkenyl, alkynyl, arylalkyl, cycloalkylalkyl, heteroarylalkyl, or heterocyclylalkyl;
R31 and R32 (i) are independently alkenyl, alkynyl, azido, amino, carboxylic acid, or sulfide or (ii) are taken together to form alkylene, alkenylene, alkynylene, or [R4— K— R4']n, each of which is substituted with 0-6 R5;
R4 and Rt' are independently alkylene, alkenylene or alkynylene;
each R5 is independently halo, alkyl, OR6, N(R&)2, SR6, SOR6, SO2R6, CO2R6, R&, a fluorescent moiety, or a radioisotope;
each Re is H, alkyl, or a therapeutic agent;
Rz and Rw are independently H, hydroxy!, NH2, tryptophan, a linker, B, a B-linker— , linker-tryptophan— , a B-tryptophan— , or B-linker-tryptophan— ;
B is any of the capping groups Ac (acetyl), F1TC (fluorescein thiourea), Bt (biotinyl) any other fluorophore or affinity agent;
linker is beta-alanine or other linking entity;
n is an integer from 1-4;
x is an integer from 2-6; and
[Xaa]w, [Xaa]x, and [Xaa]y taken together have the amino acid sequence of
FKVARRTVAKYRE(M/Q/S NL) (SEQ ID NO: 55), wherein two of the amino acids within the sequence are replaced with the residues A and B.
[0256] In any aspect or embodiment described herein, R31 and R32 are taken together to form alkylene, alkenylene, alkynylene, or [R4— K— R4']n, each of which is substituted with 0-6 Rs.
[0257] In any aspect or embodiment described herein, the polypeptide is
Bi-linkeri-Tryptophani-FKVARRTzAKYRE(Nle)x-NH2 (SEQ ID NO: 42);
Bi-linkeri-Tryptophani-FKVxRRTxAKYRE(Nle)L-NH2 (SEQ ID NO: 43);
Bi-linkeri-Tryptophani-zKVARRTxAKYRE(Nle)L-NH2 (SEQ ID NO: 44);
Bi-linkeri-TryptophanrxFKVxRTVAKYRE(Nle)L-NH2 (SEQ ID NO: 45);
Bi-linkeri-Tryptophani-xKVAxRTVA YRE(Nle)L-NH2 (SEQ ID NO: 46); or wherein:
i of Bi is 1, i of linkeri and Tryptophan! is 0 or 1 ;
z and x each are a non-natural amino acid; and
the non-natural amino acid that is z or x that is closest to Bi within the sequence is residue A and the other non-natural amino acid that is z or x within the sequence is residue B.
[0258] In any aspect or embodiment described herein, z is (R)-octenylalanine.
[0259] In any aspect or embodiment described herein, x is (S)-pentenylalanine.
[0260] In any aspect or embodiment described herein, the polypeptide is
BF VARRTzAKYRE(Nle)x (SEQ ID NO: 77);
BF VxRRTxAKYRE(Nle)L (SEQ ID NO: 78);
BzKVARRTxAKYRE(Nle)L (SEQ ID NO: 79); or
BxKVAxRTVAKYRE(Nle)L (SEQ ID NO: 80);
wherein B is acetyl, x is (S)-2-(4'pentenyl)-alanine, and z is (R)-2-(7'-octenyl)-alanine.
[0261] In another aspect, the invention provides a pharmaceutical composition, the pharmaceutical composition comprising a therapeutically effective amount of a polypeptide of any polypeptide described herein and a pharmaceutically acceptable excipient.
[0262] In any aspect or embodiment described herein, the pharmaceutical composition further comprises an additional agent.
[0263] In another aspect, the invention provides any polypeptide described herein or a pharmaceutical composition described herein for use in treating and/or preventing a bacterial infection.
[0264] In another aspect, the invention provides any polypeptide described herein or a pharmaceutical composition described herein for use in inhibiting transcription in a prokaryote.
[0265] In another aspect, the invention provides a method of preventing or inhibiting food spoilage, the method comprising adding to food an effective amount of a polypeptide as described herein.
[0266] In another aspect, the invention provides a method of preventing or treating a disease in a plant, the method comprising administering to the plant an effective amount of a polypeptide as described herein.
[0267] In another aspect, the invention provides a method of preventing contamination of or disinfecting a medical device, the method comprising contacting the medical device with an effective amount of a polypeptide as described herein.
Claims
CLAIMS:
or a pharmaceutically acceptable salt thereof
wherein:
Ri and R2 are independently H, alkyl, alkenyl, alkynyl, arylalkyl, cycloalkylalkyl, heteroarylalkyl, or heterocyclylalkyl;
R3i and R32 (i) are independently alkenyl, alkynyl, azido, amino, carboxylic acid, or sulfide or (ii) are taken together to form alkylene, alkenylene, alkynylene, or [R4— K— Ri'ln, each of which is substituted with 0-6 R5;
R4 and R4' are independently alkylene, alkenylene or alkynylene;
each R5 is independently halo, alkyl, OR6, N(R6)2, SR6, SOR6, S02R6, C02R6, R6, a fluorescent moiety, or a radioisotope;
each Rfi is H, alkyl, or a therapeutic agent;
Rz and Rw are independently H, hydroxyl, NH2, tryptophan, a linker, B, a B-linker— , a linker-tryptophan— , a B-tryptophan— , or B-linker-tryptophan— ;
B is any of the capping groups Ac (acetyl), FITC (fluorescein thiourea), Bt (biotinyl) or any other fluorophore or affinity agent;
linker is beta-alanine or other linking entity;
n is an integer from 1-4;
x is an integer from 2-6; and
[Xaa]w, [Xaa]x, and [Xaa]y taken together have the amino acid sequence of
F VARRTVAKYRE(M/Q/S/NL) (SEQ ID NO: 55), wherein two of the amino acids within the sequence are replaced with the residues A and B.
2. The polypeptide of claim 1 , wherein R31 and R32 are taken together to form alkylene, alkenylene, alkynylene, or [R4— — R.4']n, each of which is substituted with 0-6 R5.
3. The polypeptide of claim 1 or 2, wherein the polypeptide is
Bi-linkeri-Tryptophani-FKVARRTzAKYRE(Nle)x-NH2 (SEQ ID NO: 42);
Bi-linkeri-Tryptophani-FKVxRRTxAKYRE(Nle)L-NH2 (SEQ ID NO: 43);
B1-linker1-Tryptophani-zKVARRTxAKYRE(Nle)L-NH2 (SEQ ID NO: 44);
Bi-linkeri-Tryptophanj-xFKVxRTVAKYRE(Nle)L-NH2 (SEQ ID NO: 45);
Bi-linkeri-Tryptophani-xKVAxRTVAKYRE(Nle)L-NH2 (SEQ ID NO: 46); or wherein:
i of Bi is 1, i of linken and Tryptophan; is 0 or 1 ;
z and x each are a non-natural amino acid; and
the non-natural amino acid that is z or x that is closest to Bi within the sequence is residue A and the other non-natural amino acid that is z or x within the sequence is residue B.
4. The polypeptide of claim 3, wherein z is (R)-octenylalanine.
5. The polypeptide of claim 3 or 4, wherein x is (S)-pentenylalanine.
6. The polypeptide of any one of claims 3-5, wherein the polypeptide is
BFKVARRTzAKYRE(Nle)x (SEQ ID NO: 77);
BFKVxRRTxA YRE(Nle)L (SEQ ID NO: 78);
BzKVARRTxAKYRE(Nle)L (SEQ ID NO: 79); or
BxKVAxRTVAKYRE(Nle)L (SEQ ID NO: 80);
wherein B is acetyl, x is (S)-2-(4'pentenyl)-alanine, and z is (R)-2-(7'-octenyl)-alanine.
7. A pharmaceutical composition, the pharmaceutical composition comprising a therapeutically effective amount of a polypeptide of any one of claims 1-6 and a pharmaceutically acceptable excipient.
8. The pharmaceutical composition of claim 7, wherein the composition further comprises an additional agent.
9. A polypeptide of any one of claims 1-6 or a pharmaceutical composition of claim 7 or 8 for use in treating and/or preventing a bacterial infection.
10. A polypeptide of any one of claims 1-6 or a pharmaceutical composition of claim 7 or 8 for use in inhibiting transcription in a prokaryote.
11. A method of preventing or inhibiting food spoilage, the method comprising adding to food an effective amount of a polypeptide of any one of claims 1-6.
12. A method of preventing or treating a disease in a plant, the method comprising administering to the plant an effective amount of a polypeptide of any one of claims 1-6.
13. A method of preventing contamination of or disinfecting a medical device, the method comprising contacting the medical device with an effective amount of a polypeptide of any one of claims 1-6.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201762471681P | 2017-03-15 | 2017-03-15 | |
| US62/471,681 | 2017-03-15 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2018170299A1 true WO2018170299A1 (en) | 2018-09-20 |
Family
ID=61899382
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2018/022703 Ceased WO2018170299A1 (en) | 2017-03-15 | 2018-03-15 | Inhibitors of prokaryotic gene transcription and uses thereof |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2018170299A1 (en) |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4522811A (en) | 1982-07-08 | 1985-06-11 | Syntex (U.S.A.) Inc. | Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides |
| US5446090A (en) | 1993-11-12 | 1995-08-29 | Shearwater Polymers, Inc. | Isolatable, water soluble, and hydrolytically stable active sulfones of poly(ethylene glycol) and related polymers for modification of surfaces and molecules |
| WO1999014259A1 (en) | 1997-09-12 | 1999-03-25 | Shearwater Polymers | Degradable poly(ethylene glycol) hydrogels with controlled half-life and precursors therefor |
| WO1999034833A1 (en) | 1998-01-07 | 1999-07-15 | Shearwater Polymers, Incorporated | Degradable heterobifunctional poly(ethylene glycol) acrylates and gels and conjugates derived therefrom |
| US6348558B1 (en) | 1999-12-10 | 2002-02-19 | Shearwater Corporation | Hydrolytically degradable polymers and hydrogels made therefrom |
| WO2011121357A2 (en) * | 2010-04-01 | 2011-10-06 | Procarta Biosystems Limited | Transcription factor decoys |
| WO2012154651A2 (en) * | 2011-05-06 | 2012-11-15 | The Research Foundation Of State University Of New York | Molecular roadblocks for rpon binding sites |
| US20140370042A1 (en) * | 2011-12-29 | 2014-12-18 | Dana-Farber Cancer Institute, Inc. | Stabilized Antiviral Fusion Helices |
-
2018
- 2018-03-15 WO PCT/US2018/022703 patent/WO2018170299A1/en not_active Ceased
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4522811A (en) | 1982-07-08 | 1985-06-11 | Syntex (U.S.A.) Inc. | Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides |
| US5446090A (en) | 1993-11-12 | 1995-08-29 | Shearwater Polymers, Inc. | Isolatable, water soluble, and hydrolytically stable active sulfones of poly(ethylene glycol) and related polymers for modification of surfaces and molecules |
| WO1999014259A1 (en) | 1997-09-12 | 1999-03-25 | Shearwater Polymers | Degradable poly(ethylene glycol) hydrogels with controlled half-life and precursors therefor |
| WO1999034833A1 (en) | 1998-01-07 | 1999-07-15 | Shearwater Polymers, Incorporated | Degradable heterobifunctional poly(ethylene glycol) acrylates and gels and conjugates derived therefrom |
| US6348558B1 (en) | 1999-12-10 | 2002-02-19 | Shearwater Corporation | Hydrolytically degradable polymers and hydrogels made therefrom |
| WO2011121357A2 (en) * | 2010-04-01 | 2011-10-06 | Procarta Biosystems Limited | Transcription factor decoys |
| WO2012154651A2 (en) * | 2011-05-06 | 2012-11-15 | The Research Foundation Of State University Of New York | Molecular roadblocks for rpon binding sites |
| US20140370042A1 (en) * | 2011-12-29 | 2014-12-18 | Dana-Farber Cancer Institute, Inc. | Stabilized Antiviral Fusion Helices |
Non-Patent Citations (32)
| Title |
|---|
| "MSc Thesis", 4 March 2016, DANIEL IAN PAU / UNIV. OTTAWA, Canada, ISSN: 1754-2189, article DANIEL PAU: "Investigation of hydrocarbon stapled alpha-helical peptides as a novel method to interrupt protein-target interactions in bacteria", pages: 1 - 123, XP055472755, DOI: 10.1038/nprot.2011.324 * |
| "Remington's Pharmaceutical Sciences", 1985, MACK PUBLISHING CO |
| "United States Patent Office Manual of Patent Examining Procedures", January 2018 |
| BANG ET AL., J. AM. CHEM. SOC., vol. 126, 2004, pages 1377 - 83 |
| CADY, N. C. ET AL.: "Inhibition of biofilm formation, quorum sensing and infection in Pseudomonas aeruginosa by natural products-inspired organosulfur compounds", PLOS ONE, vol. 7, 2012 |
| CREMAZY, F. G. E. ET AL.: "Imaging in situ protein-DNA interactions in the cell nucleus using FRET-FLIM", EXP. CELL RES., vol. 309, 2005, pages 390 - 396, XP005074656, DOI: doi:10.1016/j.yexcr.2005.06.007 |
| EDELHOCH, H.; BRAND, L.; WILCHEK, M.: "Fluorescence studies with tryptophyl peptides", BIOCHEMISTRY, vol. 6, 1967, pages 547 - 559 |
| F. R. COCKERILL; M. A. WIKER; J. ALDER; M. N. DUDLEY; G. M. ELIOPOULOS; M. J. FERRARO; D. J. HARDY; D. W. HECHT; J. A. HINDLER; J.: "Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically; Approved Standard", vol. 32, 2012 |
| FIELDS ET AL.: "Synthetic Peptides: A User's Guide", 1992, W.H. FREEMAN & CO. |
| ISHIWATA ET AL., CHEM. PHARM. BULL., vol. 43, 1995, pages 1005 - 1011 |
| JARES-ERIJMAN, E.; JOVIN, T. M. FRET, NAT. BIOTECHNOL., vol. 21, 2003, pages 1387 - 1395 |
| L. FIESER; M. FIESER: "Fieser and Fieser's Reagents for Organic Synthesis", 1994, JOHN WILEY AND SONS |
| L. PAQUETTE: "Encyclopedia of Reagents for Organic Synthesis", 1995, JOHN WILEY AND SONS |
| LANE, M. C. ET AL., ROLE OF MOTILITY IN THE COLONIZATION OF UROPATHOGENIC ESCHERICHIA COLI IN THE URINARY TRACT ROLE OF MOTILITY IN THE COLONIZATION OF UROPATHOGENIC ESCHERICHIA COLI IN THE URINARY TRACT, vol. 73, 2005, pages 7644 - 7656 |
| LASIC ET AL., CHEM. REV., vol. 95, 1995, pages 2601 - 2627 |
| LIVAK; SCHMITTGEN, METHODS, vol. 25, 2001, pages 402 - 408 |
| MEGAN G. LLOYD ET AL: "Targeting the alternative sigma factor RpoN to combat virulence in Pseudomonas aeruginosa", SCIENTIFIC REPORTS, vol. 7, no. 1, 3 October 2017 (2017-10-03), XP055472662, DOI: 10.1038/s41598-017-12667-y * |
| MERRITT, J. H.; KADOURI, D. E.; O'TOOLE, G. A.: "Growing and analyzing static biofilms", CURR. PROTOC. MICROBIOL., 2011, pages 1 - 18 |
| NOUMI, T.; MAEDA, M.; FUTAI, M.: "Mode of inhibition of sodium azide on H+-ATPase of Escherichia coli", FEBS LETT., vol. 213, 1987, pages 381 - 384, XP025598496, DOI: doi:10.1016/0014-5793(87)81526-0 |
| O'TOOLE, G. A.: "Microtiter dish biofilm formation assay", J. VIS. EXP., 2011, pages 3 - 5 |
| POWELL, BMC BIOINFORMATICS, vol. 15, 2014, pages 146 |
| R. LAROCK: "Comprehensive Organic Transformations", 1989, VCH PUBLISHERS |
| REICH ET AL., NATURE GENETICS, vol. 38, 2006, pages 500 |
| REITZER, L. J. ET AL.: "Mutations that create new promoters suppress the sigma 54 dependence of glnA transcription in Escherichia coli.", J. BACTERIOL., vol. 169, 1987, pages 4279 - 4284 |
| REITZER, L. J.; MAGASANIK, B.: "Transcription of glnA in E. coli is stimulated by activator bound to sites far from the promoter", CELL, vol. 45, 1986, pages 785 - 792, XP023883422, DOI: doi:10.1016/0092-8674(86)90553-2 |
| ROTHSTEIN ET AL., PNAS, vol. 77, 1980, pages 7372 - 7376 |
| SCHULER, B.; LIPMAN, E.; EATON, W., A. PROBING THE FREE-ENERGY SURFACE FOR PROTEIN FOLDING WITH SINGLE-MOLECULE FLUORESCENCE SPECTROSCOPY, 2002, pages 743 - 748 |
| SELVIN, P. R.: "The renaissance of fluorescence resonance energy transfer", NAT. STRUCT. BIOL., vol. 7, 2000, pages 730 - 734, XP002475861, DOI: doi:10.1038/78948 |
| SIMONCELLI, S. ET AL.: "Thermoplasmonic ssDNA Dynamic Release from Gold Nanoparticles Examined with Advanced Fluorescence Microscopy", J. PHYS. CHEM. LETT., vol. 6, 2015, pages 1499 - 1503 |
| SUBRAMANIAN ET AL., PNAS, vol. 102, 2005, pages 15545 - 15550 |
| T. W. GREENE; P. G. M. WUTS: "Protective Groups in Organic Synthesis", 1999, JOHN WILEY AND SONS |
| WOUTERS, F. S.; VERVEER, P. J.; BASTIAENS, P. I. H.: "Imaging biochemistry inside cells", TRENDS CELL BIOL., vol. 11, 2001, pages 203 - 211, XP009098796 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2116603A2 (en) | Antimicrobial peptides | |
| US20100028334A1 (en) | Compositions and methods to potentiate colistin activity | |
| Lee et al. | De novo generation of short antimicrobial peptides with simple amino acid composition | |
| CN101065131A (en) | Antimicrobial agents | |
| EP3038638A1 (en) | Small cationic anti-biofilm and idr peptides | |
| US11479587B2 (en) | Cationic intrinsically disordered antimicrobial peptides | |
| US20180282374A1 (en) | Antimicrobial polymyxin derivative compounds | |
| JP6471236B2 (en) | Polymyxin derivatives and uses thereof | |
| US7169756B2 (en) | Streptogramin antibiotics | |
| US12215129B2 (en) | Antibacterial cyclopeptides targeting acinetobacter and other gram-negative pathogens | |
| WO2014102782A1 (en) | Compositions and methods of killing bacteria | |
| Scioli et al. | New teixobactin analogues with a total lactam ring | |
| US12116424B2 (en) | Compounds and compositions for modulating Listeria virulence | |
| WO2018170299A1 (en) | Inhibitors of prokaryotic gene transcription and uses thereof | |
| EP1996217A2 (en) | Novel antibiotic compositions | |
| CN113490682A (en) | Antimicrobial peptides and methods of use thereof | |
| WO2023230547A2 (en) | Cilagicin compounds and methods of use thereof | |
| WO2008104777A2 (en) | Peptide | |
| US20220112251A1 (en) | Engineered lysin-human defensin protein | |
| US20250346633A1 (en) | Macolacins and methods of use thereof | |
| US20260001910A1 (en) | Peptides and uses thereof | |
| EP3755360A1 (en) | Composition and method for new antimicrobial agents with secondary mode of action | |
| US11339189B2 (en) | DNA primase and gyrase inhibitors | |
| AU2017214761A1 (en) | Proteinaceous compounds and uses therefor | |
| WO2019227173A1 (en) | Stable protein ligands as anti-infective agents |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18715870 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 18715870 Country of ref document: EP Kind code of ref document: A1 |



















