WO2018170234A1 - Methods and compositions for treating cancer - Google Patents
Methods and compositions for treating cancer Download PDFInfo
- Publication number
- WO2018170234A1 WO2018170234A1 PCT/US2018/022593 US2018022593W WO2018170234A1 WO 2018170234 A1 WO2018170234 A1 WO 2018170234A1 US 2018022593 W US2018022593 W US 2018022593W WO 2018170234 A1 WO2018170234 A1 WO 2018170234A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- tumor
- agent
- ammonia
- subject
- composition
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/075—Ethers or acetals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
Definitions
- compositions and methods of treating or preventing cancer in a subject by administering to the subject a composition comprising an agent (e.g., a small molecule, an ammonia scavenger, a kinase inhibitor, an ammonium protonator, or a synthetic biotic) that decreases the amount of ammonia in the subject (e.g. systemically in the subject in the tumor microenvironment, and/or in a tumor in the subject).
- an agent e.g., a small molecule, an ammonia scavenger, a kinase inhibitor, an ammonium protonator, or a synthetic biotic
- determining the progression of cancer e.g., breast cancer
- a tumor e.g., a breast tumor
- measuring the amount of ammonia e.g., systemic ammonia, ammonia in the tumor microenvironment, and/or ammonia in a tumor
- measuring the amount of ammonia in the subject thereby determining a second measurement of systemic ammonia, wherein the cancer and/or tumor has progressed if the second measurement is higher than the first measurement.
- compositions and methods for treating cancer e.g., breast cancer
- a tumor e.g., a breast tumor
- the first agent may be a polypeptide, small molecule, or a polynucleotide (e.g., an inhibitory polynucleotide, such as an shRNA).
- the second agent may be a polypeptide, small molecule, or a polynucleotide (e.g., an inhibitory polynucleotide, such as an shRNA).
- the first agent and the second agent are administered at different times (e.g., sequentially). In some embodiments, the first agent and the second agent are administered at the same time.
- an agent e.g., a small molecule, an ammonium scavenger, a kinase inhibitor, an ammonium protonator, or a synthetic biotic
- an agent e.g., a small molecule, an ammonia scavenger, a kinase inhibitor, an ammonium protonator, or a synthetic biotic
- the methods described herein further comprise administering an additional agent (i.e., an immune checkpoint inhibitor or a chemotherapeutic inhibitor).
- an additional agent i.e., an immune checkpoint inhibitor or a chemotherapeutic inhibitor.
- chemotherapeutic drug resistance in a subject, comprising administering to the subject (e.g., to the subject systemically or locally to a tumor present in the subject) an agent that reduces the amount of ammonia in the subject and a chemotherapeutic agent.
- kits for preventing or treating immunotherapeutic drug resistance in a subject comprising administering to the subject (e.g., to the subject systemically, or locally to a tumor present in the subject) an agent that reduces the amount of ammonia in the subject (e.g., systemic ammonia and/or the local level of ammonia in the tumor) and an immunotherapeutic agent.
- Figure 1 has eight parts, A-H, and shows glutamine-derived ammonia is recycled.
- Part A shows a schematic of underlying question on ammonia in cancer metabolism.
- Part B shows RNA levels from The Cancer Genome Atlas of ammonia assimilating enzymes in a panel of cancer subtypes run on the "Normal versus Cancer" analytical tool on Oncomine.org. Fold-change (cancer/normal) for GS (Glutamine Synthetase), GDH
- RNA levels were assessed.
- A- Ovarian Serous Cystadenocarcinoma B- Colon Adenocarcinoma, C- Rectal Adenocarcinoma, D- Lobular & Ductal Breast Carcinoma, E- Lung Adenocarcinoma, F- Squamous Lung Cell Carcinoma, G- Endometrial Adenocarcinoma, H- Bladder Urothelial Carcinoma, I- Gastric Adenocarcinoma, J- Glioblastoma, K- Pancreatic Adenocarcinoma, L- Hepatocellular Carcinoma, M- Cutaneous Melanoma.
- Part C shows heat map of % isotope abundance of metabolites with 15 N-mass shifts in MCF7 and T47D cells after 8 hour treatment with 15 N-(amide)glutamine. 211 metabolites were screened for 15 N-isomeric mass shift using mass spectrometry.
- Part D shows a schematic of expected and unexpected (in gray) 15 N-isomers after treatment with 15 N-(amide)glutamine.
- Part E shows isotope abundance of novel 15 N-(amide)glutamine derivatives +/- lwM BPTES in MCF7 and T47D cell lines.
- Part F shows steady-state metabolite abundance of MCF7 cells treated with luM BPTES in the presence or absence of 0.75mM NH4CI.
- Glu Glutamate M+l
- Pro Proline M+l
- Asp Aspartate M+l
- Cit Citrulline M+l
- Asa Arginosuccinate M+l .
- Part H shows a schematic of ammonia recycling through reductive amination catalyzed by GDH. *P ⁇ 0.05, **P ⁇ 0.01, ***P ⁇ 0.001, and ****P ⁇ 0.0001 by paired Student t test. Error bars represent the SEM.
- Figure 2 has six parts, A-F, and shows free ammonia is primarily assimilated via GDH to generate glutamate and other amino acids.
- Part A shows propidium iodide staining of cells treated with a dose of NH 4 C1 for 48 hours.
- Part B shows heat map of fold-change in steady-state abundance of keto- and amino acids involved in transaminase reactions in T47D cells treated with 0.75mM NH 4 C1.
- Part C shows a schematic of a transaminase reaction.
- Part D shows isotope abundance of 15 N-isomers in MCF7 cells after 8 hours of treatment with 0.75mM 15 NH4C1.
- Part F shows isotope abundance of glutamate (M+l) in MCF7 and T47D cells treated for 8 hours with 0.75mM 15 NH4C1 in control and GDH knockdown cells.
- Part F shows isotope abundance of 15 N-isomers of metabolites downstream of glutamate treated for 8 hours with 0.75mM 15 NH 4 C1 in control and GDH knockdown cells*P ⁇ 0.05, **P ⁇ 0.01, ***P ⁇ 0.001, and ****P ⁇ 0.0001 by paired Student t test. Error bars represent the SEM.
- Figure 3 has seven parts, A-G, and shows ammonia stimulates breast cancer growth and proliferation.
- Part A shows a representative images of 3D culture models of MCF7 and T47D cells treated with 0.5mM NH 4 C1 compared to control conditions.
- Part D shows representative images of MCF7 and T47D cells in control conditions (daily media change) and conditioned media (media changed every 72 hours). Cells were treated for 8 days.
- Part E shows ammonia measurement in conditioned media compared to control after 8 days.
- Part G shows nmoles ammonia secreted per cell in conditioned media of cells harboring stable shRNA-mediated knockdown of GDH or control hairpin. *P ⁇ 0.05, **P ⁇ 0.01, ***P ⁇ 0.001, and ****P ⁇ 0.0001 by paired Student t test. Error bars represent the SEM.
- Figure 4 has five parts, A-E, and shows systemic and tumor autonomous ammonia metabolism contribute to amino acid synthesis.
- Part A shows measurement of ammonia in the interstitial fluids of the tumor microenvironment compared to plasma isolated from
- Part E shows schematic of systemic and tumor autonomous ammonia metabolism. *P ⁇ 0.05, **P ⁇ 0.01, ***P ⁇ 0.001, and ****P ⁇ 0.0001 by paired Student t test. Error bars represent the SEM.
- Figure 5 has two parts, A-B, and shows ammonia assimilating enzymes in cancer. Part A shows enzymatic reactions of the ammonia assimilating enzymes. Carbamoyl Phosphate Synthetase 1 (CPS1), Glutamate Dehydrogenase (GDH), and Glutamine
- Figure 6 shows a heatmap of Metabolic Derivatives of 15 N-(amide)-glutamine.
- Figure 7 has two parts, A-B, and shows metabolic Derivatives of 15 N-(amide)- glutamine in MCF7 and T47D.
- Part A shows isotope abundance of expected 15 N-isomers after treatment with 15 N-(amide)-glutamine. These metabolites are made in direct, enzymatically catalyzed reactions of glutamine with other metabolites.
- Part B shows isotope abundance of novel 15 N-isomers after treatment with 15 N-(amide)-glutamine. These metabolites are unexpected because the labeled nitrogen on glutamine is liberated as ammonia prior to their synthesis.
- Figure 8 has four parts, A-D, and shows characterization of the glutaminase inhibitor BPTES in ER(+) breast cancer cell lines.
- Part A shows cytotoxicity assay by Propidium Iodide staining of cells treated with a dose of BPTES for 48 hours.
- Part B shows
- Part C shows steady-state abundance of glutamate, analyzed by mass spectrometry, in MCF7 and T47D cells treated with 1 uM BPTES.
- Part D shows isotope abundance of expected 15 N-isomers after treatment with 15 N-(amide)-glutamine and 1 uM BPTES.
- Figure 9 has three parts, A-C, and shows stoichiometric analysis of ammonia recycling.
- Part A shows schematic of experiment. MCF7 cells were incubated with 15 N2 13 Cs- glutamine (glutamine (M+7)) for 8 hours. Glutaminolysis was measured by the ion counts of glutamate (M+6), in which five carbons and one nitrogen are labeled. Ammonia recycling was measured by glutamate (M+l), in which a single nitrogen atom on glutamate is labeled. Purple circles indicate 13 C isotopes and yellow circles indicate 15 N isotopes.
- Part B shows the equation for quantification of total glutamates generated in glutaminolysis.
- Part C shows the ratio of glutamates generated by glutaminolysis in MCF7 cells.
- Figure 10 has five parts, A-E, and shows the effect of NH 4 C1 on basal metabolic phenotypes.
- Part D shows pH measurement of media treated with a dose of NH4C1 (0-50 mM)
- Figure 11 has four parts, A-D, and shows steady-state profile of ammonia treated cells.
- Part A shows metabolites that were significantly altered (p ⁇ 0.05) in cells treated with 0.75 mM NH4CI compared to control were analyzed using Metaboanalyst 3.0 pathway analysis.
- Part C shows relative abundance of nucleotides in cells treated with 0.75 mM NH4CI compared to control
- N 4
- Figure 12 shows a heatmap of metabolic derivatives of 15 NH4C1. Percent isotope abundance of 15 N-isomers in the nitrogen scan of T47D and MCF7 cells treated with 0.75 mM 15 NH 4 C1.
- Figure 13 has six parts, A-F, and shows 15 NH4C1 Tracing in MCF7 and T47D cell lines.
- Part A shows isotope abundance of 15 N-isomers in T47D cells after 8 hours of treatment with 0.75 mM 15 NH4C1.
- Part B shows schematic of metabolic pathways by which 15 N-isomers acquire labeling from 15 NH4C1.
- Figure 14 has two parts, A-B, shows GDH knockdown does not affect 15 N-isomers that derive from GS.
- Part A shows isotope abundance of 15 N-isomers in T47D and MCF7 cells after 8 hours of treatment with 0.75 mM 15 NH4C1 +/- GDH.
- Part B shows schematic of GS-derived 15 N-isomers.
- Figure 15 has three parts, A-C, and shows ammonia accelerates proliferation in 2D and 3D culture.
- Figure 16 has three parts, A-C, and shows ammonia metabolism and biology in fibroblasts.
- Part B shows isotope abundance of 15 N-isomers in primary human fibroblasts after 8 hours of treatment with 0.75 mM 15 H4C1.
- ND 15 N- isomer not detected.
- Part C shows isotope abundance of 15 N-isomers in primary human fibroblasts after 8 hours of treatment with 2.0 mM 15 N-(amide)-glutamine.
- ND 15 N-isomer not detected.
- Figure 17 has three parts, A-C, and shows GDH knockdown does not alter basal growth and proliferation in 3D culture.
- Part A shows a western blot depicting shRNA- mediated knockdown of glutamate dehydrogenase (GDH) compared to control hairpin in MCF7 cells.
- Figure 18 has two parts, A-B, shows plasma ammonia measurements in T47D xenograft model.
- Part B shows ammonia measurement in plasma isolated from mice harboring a subcutaneous tumor >100mm 3 on a time course of a bolus intraperitoneal injection of 9.0mmoles/kg 15 NH4C1.
- Figure 19 shows heat maps of 15 N-isomers in the tumor, plasma, and liver after 15 NH4C1 Tracing in vivo.
- Figure 20 shows N-isomers in the tumor, plasma and liver after NH l Tracing in vivo.
- Figure 21 has two parts, A-B, shows ex vivo tracing in T47D xenograft model.
- Part A shows isotope abundance of 15 N-isomers isolated from the tumors treated with 0.75 mM 15 H4C1.
- Part B shows isotope abundance of 15 N-isomers isolated from the tumors treated with 2.0 mM 15 N-(amide)-glutamine.
- Figure 22 has three parts A-C, and shows inhibition of ammonia assimilation in vivo represses tumor growth.
- Part A shows a western blot of GDH knockdown in T47D xenograft tumors.
- Figure 23 has two parts, A -B, and shows ammonia metabolism in primary breast cancer patients.
- Part A shows measurement of ammonia in the microenvironment of tumor and healthy tissue from estrogen receptor positive breast cancer patients. Concentrations are relative to healthy tissue.
- Figure 24 has four parts, A-D, and shows synergy between ammonia assimilation and glutaminase inhibition in breast cancer.
- Part A shows schematic depicting the potential synthetic lethality of glutaminase (GLS) inhibition with ammonia assimilation through GDH. Both pathways converge on glutamate synthesis.
- Part B shows steady-state metabolite levels of glutamate and downstream metabolites in MCF7 cells with DMSO control, 1 uM BPTES alone, and 1 uM BPTES with 1 mM NH4CI.
- Part C shows representative images of 3D culture growth of breast cancer cells treated with 1 uM BPTES +/- shRNA-mediated GDH depletion.
- compositions and methods for treating or preventing cancer in a subject by administering to the subject a composition comprising an agent that decreases the amount of systemic ammonia in the subject and/or decreases the amount of ammonia in a tumor present in the subject.
- methods for determining the progression of cancer and/or a tumor in a subject comprising measuring the amount of ammonia (e.g., systemic ammonia, ammonia in the tumor microenvironment, and/or ammonia in a tumor) in the subject at different times and comparing the ammonia measurements.
- ammonia e.g., systemic ammonia, ammonia in the tumor microenvironment, and/or ammonia in a tumor
- compositions and methods for treating cancer or a tumor in a subject by administering to the subject a first agent that inhibits the expression or activity of glutaminase and a second agent that inhibits the expression or activity of glutamate dehydrogenase.
- drug resistance e.g., chemotherapeutic and/or immunotherapeutic drug resistance
- an agent e.g., a small molecule or an ammonium scavenger
- administering means providing a pharmaceutical agent or composition to a subject, and includes, but is not limited to, administering by a medical professional and self-administering.
- agenf is used herein to denote a chemical compound, a small molecule, a mixture of chemical compounds and/or a biological macromolecule (such as a nucleic acid, a protein, or a peptide).
- Agents may be identified as having a particular activity by screening assays described herein below. The activity of such agents may render them suitable as a "therapeutic agent” which is a biologically, physiologically, or pharmacologically active substance (or substances) that acts locally or systemically in a subject.
- amino acid is intended to embrace all molecules, whether natural or synthetic, which include both an amino functionality and an acid functionality and capable of being included in a polymer of naturally-occurring amino acids.
- exemplary amino acids include naturally-occurring amino acids; analogs, derivatives and congeners thereof; amino acid analogs having variant side chains; and all stereoisomers of any of any of the foregoing.
- ammonia and “ammonium” are used interchangeably.
- ammonia is H3.
- ammonium is H4+.
- ammonia and/or ammonium is a mixture of NH3 and H4+.
- ammonia and/or ammonium is a salt.
- polynucleotide and “nucleic acid” are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or
- Polynucleotides may have any three-dimensional structure, and may perform any function, known or unknown.
- the following are non- limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA
- a polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present,
- nucleotide structure may be imparted before or after assembly of the polymer.
- sequence of nucleotides may be interrupted by non-nucleotide components.
- a polynucleotide may be further modified, such as by conjugation with a labeling component.
- recombinant polynucleotide means a polynucleotide of genomic, cDNA, semisynthetic, or synthetic origin which either does not occur in nature or is linked to another polynucleotide in a non-natural arrangement.
- pharmaceutically-acceptable carrier means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body.
- a therapeutic that "prevents" a disorder or condition refers to a compound that, when administered to a statistical sample prior to the onset of the disorder or condition, reduces the occurrence of the disorder or condition in the treated sample relative to an untreated control sample, or delays the onset or reduces the severity of one or more symptoms of the disorder or condition relative to the untreated control sample.
- small molecule is a term of the art and includes molecules that are less than about 1000 molecular weight or less than about 500 molecular weight. In one embodiment, small molecules do not exclusively comprise peptide bonds. In another embodiment, small molecules are not oligomeric.
- Exemplary small molecule compounds which can be screened for activity include, but are not limited to, peptides, peptidomimetics, nucleic acids, carbohydrates, small organic molecules ⁇ e.g., polyketides) (Cane et al. (1998) Science 282:63), and natural product extract libraries.
- the compounds are small, organic non-peptidic compounds.
- a small molecule is not biosynthetic.
- the term "subject' means a human or non-human animal selected for treatment or therapy.
- tumor microenvironmenf is an art-recognized term and refers to the cellular environment in which the tumor exists, and includes, for example, interstitial fluids surrounding the tumor, surrounding blood vessels, immune cells, other cells, fibroblasts, signaling molecules, and the extracellular matrix.
- therapeutically-effective amount and “effective amount' as used herein means the amount of an agent which is effective for producing the desired therapeutic effect in at least a sub-population of cells in a subject at a reasonable benefit/risk ratio applicable to any medical treatment.
- Treating" a disease in a subject or “treating” a subject having a disease refers to subjecting the subject to a pharmaceutical treatment, e.g., the administration of a drug, such that at least one symptom of the disease is decreased or prevented from worsening.
- the methods described herein relate, in part, to the novel discovery that cancer cells use the ammonium by-product of glutaminolysis in the production of glutamine and other downstream amino acids, thus promoting cancer cell proliferation.
- provided herein are methods and compositions to treat or prevent cancer in a subject by administering to the subject a composition comprising at least one agent that decreases the amount of ammonia in the subject.
- the agent may decrease the amount of ammonia in the subject systemically or locally (e.g., within the tumor or in the tumor microenvironment).
- methods for treating a tumor in a subject by administering a composition comprising at least one agent that decreases the amount of ammonia in the subject (e.g., decreasing systemic ammonia in the subject and/or decreasing the amount of ammonia in the tumor).
- compositions disclosed herein may decrease the amount of systemic ammonia in the subject by at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%>, at least 65%>, at least 70%, at least 75 %, at least 80%, at least 85%), at least 90%, at least 95%, or at least 99%.
- the composition may decrease the amount of ammonia in a tumor present in the subject (e.g., a subject with cancer) by at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75 %, at least 80%, at least 85%, at least 90%, at least 95%), at least 99%, or by 100%.
- a composition may comprise two or more, three or more, four or more, or five or more agents disclosed herein.
- the composition may decrease the amount of ammonia in a tumor microenvironment (e.g., in the interstitial fluids in the tumor microenvironment) by at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75 %, at least 80%, at least 85%., at least 90%, at least 95%, at least 99%, or by 100%.
- a composition may comprise two or more, three or more, four or more, or five or more agents disclosed herein.
- a composition and/or agent disclosed herein may decrease systemic or local ammonia (e.g., local ammonia in a tumor present in a subject) by, for example, inhibiting ammonia production, inhibiting ammonia recycling in glutaminolysis, or facilitating the removal of ammonia from a subject.
- the agent may be, for example, a small molecule, a glutamine scavenger, an ammonium scavenger, a kinase inhibitor (e.g., sodium
- ammonium scavenger may refer to any compound that facilitates the removal of ammonia from a subject (e.g., a subject in need thereof).
- Ammonium scavengers may be found in U.S. Patent 4,650,587, U.S. Patent No. 4,460,555, and U.S. Patent No. 8,642,012, each of which is hereby incorporated in its entirety.
- the agent may be a synthetic biotic (e.g., a modified bacteria capable of assimilating ammonia, such as SYNB1020).
- Exemplary agents include, but are not limited to, sodium phenyl acetate, phenylbutyrate,
- the agent may be a polypeptide or an inhibitory polynucleotide disclosed herein. Agents disclosed herein may be used alone or in combination.
- determining the progression of cancer in a subject by measuring the amount of systemic ammonia in the subject, thereby determining a first measurement of ammonia; and, after a period of time, measuring the amount of ammonia in the subject, thereby determining a second measurement of ammonia.
- the cancer has progressed if the second measurement is higher than the first measurement.
- the method further comprises measuring the amount of ammonia in the subject to determine a third measurement of ammonia, and cancer is considered to have progressed if the third measurement is higher than the second measurement.
- measurement of ammonia may be systemic ammonia or local levels of ammonia (e.g., ammonia in the tumor, and/or ammonia in the tumor microenvironment). Also disclosed herein are methods of determining the progression of a tumor (e.g., a tumor present in a subject) by measuring the an amount of ammonia, thereby determining a first measurement of ammonia; and, after a period of time, measuring the amount of ammonia, thereby determining a second measurement of ammonia, wherein the tumor has progressed if the second measurement is higher than the first measurement.
- a tumor e.g., a tumor present in a subject
- the method further comprising measuring the amount of ammonia to determine a third measurement of ammonia, wherein the tumor has progressed if the third measurement is higher than the second measurement. In some embodiments, the method further comprising measuring the amount of ammonia to determine a third measurement of ammonia, wherein the tumor has progressed if the third measurement is higher than the second measurement.
- the measurement of ammonia may be systemic ammonia or local levels of ammonia (e.g., ammonia in the tumor, and/or ammonia in the tumor microenvironment).
- systemic or local ammonia measurements of systemic or local ammonia. Measurements of systemic ammonia or local ammonia may be taken at regular or sporadic intervals. Systemic or local ammonia in a subject may be measured by any means known in the art. For example, systemic ammonia may be measured by a blood test, wherein blood samples are collected from the subject, mixed, and centrifuged. The plasma is then separated, collected, and, optionally, frozen for later testing.
- Local ammonia may be measured, for example, by direct sampling of the tumor (e.g., sampling of the interstitial fluids of the tumor microenvironment).
- the period of time between ammonia measurements may be any period of time, and may depend on the type of cancer or tumor.
- the period of time may be, for example, 1 day, 3 days, 5 days, one week, two weeks, three weeks, one month, two months, three months, four months, five months, six months, seven months, eight months, nine months, ten months, eleven months, one year, two years, or five years.
- methods of determining the progression of cancer or a tumor further comprises administering an agent disclosed herein (i.e., an agent that decreases the amount of systemic ammonia, the amount of ammonia in a tumor present in a subject, and/or ammonia in the tumor
- Glutaminase is an amidohydrolase enzyme that generates glutamate from glutamine.
- Glutamate dehydrogenase is an enzyme responsible for converting a- ketoglutarate to glutamate.
- glutamate dehydrogenase recycles ammonia to replenish depleted glutamate pools during glutaminase inhibition.
- glutaminase and glutamate dehydrogenase generate ammonia and, therefore, inhibition of glutaminase and glutamate dehydrogenase in a subject would lead to a decrease of ammonia in the subject.
- the glutaminase inhibitor is a small molecule. In some embodiments, the glutaminase inhibitor depletes glutamine pools. In some embodiments, the glutaminase inhibitor is a thiourea derivative product.
- Exemplary glutaminase inhibitors include, but are not limited to, THDP-17, CB-839, and bis-2-(5-phenylacetamido-l,3,4-thiadiazol-2-yl)ethyl sulfide (BPTES).
- the glutamate dehydrogenase inhibitor is a small molecule.
- An exemplary glutamate dehydrogenase inhibitor is epigallocatechin-monogallate (EGCG).
- the first agent may inhibit the expression and/or activity of glutaminase by at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75 %, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or by 100%.
- the second agent may inhibit the expression and/or activity of glutamate dehydrogenase by at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75 %, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or by 100%.
- the methods described herein further comprise administering an additional agent (i.e., an immune checkpoint inhibitor or a chemotherapeutic inhibitor).
- an additional agent i.e., an immune checkpoint inhibitor or a chemotherapeutic inhibitor.
- kits for preventing or treating chemotherapeutic drug resistance in a subject comprising administering to the subject (e.g., to the subject systemically or locally to a tumor present in the subject) an agent disclosed herein (e.g., an agent that reduces the amount of ammonia in the subject) in combination with a tumor present in the subject.
- an agent disclosed herein e.g., an agent that reduces the amount of ammonia in the subject
- chemotherapeutic agent The agent disclosed herein and the chemotherapeutic agent may be administered at the same time or at different times.
- an agent disclosed herein e.g., an agent that reduces the amount of ammonia in the subject
- the agent disclosed herein and the immunotherapeutic agent may be administered at the same time or at different times.
- the agents and/or compositions described herein may be administered systemically, intravenously, intramuscularly, orally, or locally (e.g., delivered locally to a tumor).
- the compositions and/or agents disclosed herein may be delivered by any suitable route of administration, including orally, nasally, as by, for example, a spray, rectally, intravaginal, parenterally, intracisternally and topically, as by powders, ointments or drops, including buccally and sublingually.
- the agents and/or compositions are delivered generally (e.g., via oral or parenteral administration). In certain other
- the compositions and/or agents are delivered locally through injection.
- the therapeutics described herein may be administered through conjunctive therapy.
- Conjunctive therapy includes sequential, simultaneous and separate, and/or co-administration of the compositions and/or agents in such a way that the therapeutic effects of the first agent administered have not entirely disappeared when the subsequent agent is administered.
- the additional agent may be co-formulated with the first and/or second agent or be formulated in a separate pharmaceutical composition.
- the compositions and additional agents are administered at the same time or at different times (e.g., the compositions and additional agents are administered sequentially).
- agent may refer to any compound that inhibits the expression and/or activity of glutaminase, any compound that inhibits the expression and/or activity of glutamate dehydrogenase, or a compound that otherwise decreases the amount of ammonia in a subject and/or a tumor present in the subject.
- An agent may be a small molecule, an ammonium scavenger, a kinase inhibitor, an ammonium protonator, a synthetic biotic, a polypeptide, or an inhibitory nucleic acid.
- agents that decrease the amount of ammonia in a subject or in the tumor of the subject include, but are not limited to, sodium phenylacetate, sodium benzoate, sodium phenylbutyrate, glycerol phenylbutyrate, SY B1020, VS-01, and lactulose.
- Certain embodiments of the methods and compositions disclosed herein relate to the use of small molecule agents e.g., small molecule agents that inhibit the expression or activity of ammonia, glutaminase, or glutamate dehydrogenase.
- the small molecule decreases the amount of ammonia in the subject by inhibiting its activity (e.g., by binding to ammonia, inhibiting the production of ammonia, or increasing the elimination of ammonia from a subject.
- an agent disclosed herein is a polypeptide.
- the polypeptides can be isolated from cells or tissue sources by an appropriate purification scheme using standard protein purification techniques.
- polypeptides are produced by recombinant DNA techniques.
- polypeptides can be chemically synthesized using standard peptide synthesis techniques.
- polypeptide is a chimeric or fusion polypeptide.
- a fusion or chimeric polypeptide can be produced by standard recombinant DNA techniques. For example, DNA fragments coding for the different polypeptide sequences are ligated together in-frame in accordance with conventional techniques, for example by employing blunt-ended or stagger- ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation.
- the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers.
- PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and re-amplified to generate a chimeric gene sequence (see, for example, Current Protocols in Molecular Biology, Ausubel et al., eds., John Wiley & Sons: 1992).
- anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and re-amplified to generate a chimeric gene sequence.
- polypeptides described herein can be produced in prokaryotic or eukaryotic host cells by expression of polynucleotides encoding a polypeptide(s). Alternatively, such peptides can be synthesized by chemical methods. Methods for expression of heterologous polypeptides in recombinant hosts, chemical synthesis of polypeptides, and in vitro translation are well known in the art and are described further in Maniatis et al., Molecular Cloning: A Laboratory Manual (1989), 2nd Ed., Cold Spring Harbor, N. Y.; Berger and Kimmel, Methods in Enzymology, Volume 152, Guide to Molecular Cloning Techniques (1987), Academic Press, Inc., San Diego, Calif ; Merrifield, J.
- an agent disclosed herein is an inhibitory polynucleotide.
- the inhibitory RNA molecules is administered to the subject. Alternatively, constructs encoding these may be contacted with or introduced into the subject.
- Antisense constructs, antisense oligonucleotides, RNA interference constructs or siRNA duplex RNA molecules can be used to interfere with activity or expression of a target of interest, e.g., glutaminase or glutamate dehydrogenase.
- Antisense or RNA interference molecules can be delivered in vivo, e.g., injected into tissues of a subject. Typical delivery means known in the art can be used.
- an interfering RNA can be delivered systemically using, for example, the methods and compositions described in PCT Application No:
- PCT/US09/036223 PCT/US09/061381 PCT/US09/063927, PCT/US09/063931 and
- the siRNA is delivered locally.
- local delivery to the tumor may be accomplished by injection.
- the interfering RNA described herein when used to cancer, the interfering RNA can be delivered intravenously or parenterally.
- Actual dosage levels of the agents to be administered may be varied so as to obtain an amount of the active ingredient (e.g., an agent described herein) which is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient.
- the selected dosage level will depend upon a variety of factors including the activity of the particular agent employed, the route of administration, the time of administration, the rate of excretion or metabolism of the particular compound being employed, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compound employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts.
- a physician or veterinarian having ordinary skill in the art can readily determine and prescribe the effective amount of the pharmaceutical composition required.
- the physician or veterinarian could prescribe and/or administer doses of the compounds employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.
- compositions e.g., pharmaceutical compositions, containing at least one agent (e.g., an agent that inhibits the expression and/or activity of glutaminase, an agent that inhibits the expression and/or activity of glutamate dehydrogenase, or a compound that otherwise decreases the amount of ammonia in a subject and/or a tumor) described herein together with a pharmaceutically acceptable carrier.
- the composition includes a combination of multiple (e.g., two or more) agents described herein.
- compositions that comprise an agent (e.g., a small molecule or an ammonium scavenger) that decreases the amount of ammonia in the subject.
- agent e.g., a small molecule or an ammonium scavenger
- the agent may decrease ammonia in the subject by decreasing ammonia production, decreasing ammonia recycling, or increasing ammonia excretion.
- compositions comprising at a first agent (e.g., a small molecule, a polypeptide, an inhibitory nucleic acid) that inhibits the expression or activity of glutaminase and a second agent (e.g., a small molecule, a polypeptide, or an inhibitory nucleic acid) that inhibits the expression or activity of glutamate dehydrogenase described herein together with a pharmaceutically acceptable carrier.
- a first agent e.g., a small molecule, a polypeptide, an inhibitory nucleic acid
- a second agent e.g., a small molecule, a polypeptide, or an inhibitory nucleic acid
- the compositions include a combination of multiple (e.g., three or more) agents described herein.
- the first agent may be a polypeptide, small molecule, or an inhibitory polynucleotide.
- the second agent may be a polypeptide, small molecule, or an inhibitory polynucleotide.
- the agents and/or compositions are delivered locally.
- the agents and/or compositions e.g., pharmaceutical compositions
- the agent or pharmaceutical composition is administered with an additional therapeutic agent.
- the additional therapeutic agent is a chemotherapeutic agent.
- chemotherapeutic agents include alkylating agents such as thiotepa and cyclophosphamide (CytoxanTM); alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; emylerumines and memylamelamines including alfretamine, triemylenemelamine, triethylenephosphoramide, triethylenethiophosphoramide, and trimemylolomelamine; acetogenins (especially bullatacin and bullatacinone); a camptothecin (including synthetic analogue topotecan); bryostatin; cally statin; CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic analogues); cryptophycins (articularly cryptophycin 1 and cryptophycin 8); dolastatin;
- spongistatin nitrogen mustards such as chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard;
- nitrogen mustards such as chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard;
- nitrosoureas such as carmustine, chlorozotocin, foremustine, lomustine, nimustine, ranimustine; antibiotics such as the enediyne antibiotics (e.g., calicheamicin, especially calicheamicin gammall and calicheamicin phili); dynemicin, including dynemicin A;
- bisphosphonates such as clodronate; an esperamicin; as well as neocarzinostatin
- aclacinomysins actinomycin, authramycin, azaserine, bleomycins, cactinomycin, carabicin, carrninomycin, carzinophilin, chromomycins, dactinomycin, daunorubicin, detorubicin, 6- diazo-5-oxo-L-norleucine, doxorubicin (AdramycinTM) (including morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenolic acid, nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex
- aminolevulinic acid aminolevulinic acid
- eniluracil amsacrine; hestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elformthine; elliptinium acetate; an epothilone; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidamine; maytansinoids such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidamol; nitracrine; pentostatin; phenamet; pirarubicin; losoxantrone; podophyllinic acid; 2-ethylhydrazide; procarbazine; PSKTM;
- razoxane rhizoxin; sizofiran; spirogermanium; tenuazonic acid; triaziquone; 2,2',2"- tricUorotriemylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethane; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol;
- paclitaxel TexolTM, Bristol Meyers Squibb Oncology, Princeton, N.J.
- docetaxel TaxoteretTM, Rhone-Poulenc Rorer, Antony, France
- chlorambucil gemcitabine
- mitroxantrone vancristine; vinorelbine (NavelbineTM); novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeoloda; ibandronate; CPT-11; topoisomerase inhibitor RFS 2000; difluoromethylornithine (DMFO); retinoids such as retinoic acid; capecitabine; and pharmaceutically acceptable salts, acids or derivatives of any of the above.
- DMFO difluoromethylornithine
- chemotherapeutic agent anti-hormonal agents that act to regulate or inhibit hormone action on tumors
- anti-estrogens and selective estrogen receptor modulators SERMs
- SERMs selective estrogen receptor modulators
- tamoxifen including NolvadexTM
- raloxifene including NolvadexTM
- droloxifene 4-hydroxytamoxifen
- trioxifene keoxifene
- LY117018 4-hydroxytamoxifen
- toremifene FarestonTM
- inhibitors of the enzyme aromatase which regulates estrogen production in the adrenal glands, such as, for example, 4(5)-imidazoles, aminoglutethimide, megestrol acetate (MegaceTM), exemestane, formestane, fadrozole, vorozole (RivisorTM), letrozole (FemaraTM), and anastrozole (ArimidexTM)
- anti-androgens such as flutamide
- the additional therapeutic agent is an immune checkpoint inhibitor.
- Immune Checkpoint inhibition broadly refers to inhibiting the checkpoints that cancer cells can produce to prevent or downregulate an immune response.
- immune checkpoint proteins are CTLA-4, PD-1, VISTA, B7-H2, B7-H3, PD-L1, B7-H4, B7-H6, ICOS, HVEM, PD-L2, CD160, gp49B, PIR-B, KIR family receptors, TIM-1, TIM-3, TIM-4, LAG-3, BTLA, SIRPalpha (CD47), CD48, 2B4 (CD244), B7.1, B7.2, ILT-2, ILT-4, TIGIT, HHLA2, butyrophilins, A2aR, and combinations thereof.
- compositions and/or agents disclosed herein may be specially formulated for administration in solid or liquid form, including those adapted for the following: (1) oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; or (2) parenteral administration, for example, by subcutaneous, intramuscular, intravenous, intrathecal, intracerebral or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation.
- oral administration for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue
- parenteral administration for example, by subcutaneous, intramuscular, intravenous, intrathecal, intracer
- Methods of preparing pharmaceutical formulations or compositions include the step of bringing into association an agent described herein with the carrier and, optionally, one or more accessory ingredients.
- the formulations are prepared by uniformly and intimately bringing into association an agent described herein with liquid carriers, or finely divided solid carriers, or both, and then, if necessary, shaping the product.
- compositions suitable for parenteral administration comprise one or more agents described herein in combination with one or more pharmaceutically-acceptable sterile isotonic aqueous or non-aqueous solutions, dispersions, suspensions or emulsions, or sterile powders which may be reconstituted into sterile injectable solutions or dispersions just prior to use, which may contain sugars, alcohols, antioxidants, buffers, bacteriostats, solutes which render the formulation isotonic with the blood of the intended recipient or suspending or thickening agents.
- aqueous and non-aqueous carriers examples include water, ethanol, dimethyl sulfoxide (DMSO), polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate.
- DMSO dimethyl sulfoxide
- polyols such as glycerol, propylene glycol, polyethylene glycol, and the like
- vegetable oils such as olive oil
- injectable organic esters such as ethyl oleate.
- Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
- kits for treating a cancer by administering to a subject (e.g., to a tumor present in a subject) a composition comprising an agent described herein.
- the methods described herein may be used to treat any cancerous or pre-cancerous tumor.
- the cancer includes a solid tumor.
- Cancers that may be treated by methods and compositions provided herein include, but are not limited to, cancer cells from the bladder, blood, bone, bone marrow, brain, breast (e.g., estrogen receptor (ER)-positive breast cancer, triple negative breast cancer, or HER2 positive breast cancer), colon, esophagus, gastrointestine, gum, head, kidney, liver, lung,
- ER estrogen receptor
- the cancer may specifically be of the following histological type, though it is not limited to these: neoplasm, malignant; carcinoma; carcinoma, undifferentiated; giant and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma;
- lymphoepithelial carcinoma basal cell carcinoma; pilomatrix carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma, malignant; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in adenomatous polyp; adenocarcinoma, familial polyposis coli; solid carcinoma; carcinoid tumor, malignant; branchiolo-alveolar adenocarcinoma; papillary adenocarcinoma;
- chromophobe carcinoma acidophil carcinoma; oxyphilic adenocarcinoma; basophil carcinoma; clear cell adenocarcinoma; granular cell carcinoma; follicular adenocarcinoma; papillary and follicular adenocarcinoma; nonencapsulating sclerosing carcinoma; adrenal cortical carcinoma; endometrioid carcinoma; skin appendage carcinoma; apocrine adenocarcinoma; sebaceous adenocarcinoma; ceruminous adenocarcinoma; mucoepidermoid carcinoma; cystadenocarcinoma; papillary cystadenocarcinoma; papillary serous
- cystadenocarcinoma mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; infiltrating duct carcinoma; medullary carcinoma; lobular carcinoma;
- inflammatory carcinoma mammary paget's disease; acinar cell carcinoma; adenosquamous carcinoma; adenocarcinoma w/squamous metaplasia; malignant thymoma; malignant ovarian stromal tumor; malignant thecoma; malignant granulosa cell tumor; and malignant roblastoma; Sertoli cell carcinoma; malignant leydig cell tumor; malignant lipid cell tumor; malignant paraganglioma; malignant extra-mammary paraganglioma; pheochromocytoma; glomangiosarcoma; malignant melanoma; amelanotic melanoma; superficial spreading melanoma; malignant melanoma in giant pigmented nevus; epithelioid cell melanoma;
- myxosarcoma liposarcoma; leiomyosarcoma; rhabdomyosarcoma; embryonal
- rhabdomyosarcoma alveolar rhabdomyosarcoma; stromal sarcoma; malignant mixed tumor; mullerian mixed tumor; nephroblastoma; hepatoblastoma; carcinosarcoma; malignant mesenchymoma; malignant brenner tumor; malignant phyllodes tumor; synovial sarcoma; malignant mesothelioma; dysgerminoma; embryonal carcinoma; malignant teratoma;
- lymphangiosarcoma osteosarcoma; juxtacortical osteosarcoma; chondrosarcoma; malignant chondroblastoma; mesenchymal chondrosarcoma; giant cell tumor of bone; ewing's sarcoma; malignant odontogenic tumor; ameloblastic odontosarcoma; malignant ameloblastoma;
- ameloblastic fibrosarcoma malignant pinealoma; chordoma; malignant glioma;
- ependymoma ependymoma; astrocytoma; protoplasmic astrocytoma; fibrillary astrocytoma; astroblastoma; glioblastoma; oligodendroglioma; oligodendroblastoma; primitive neuroectodermal;
- cerebellar sarcoma cerebellar sarcoma; ganglion euroblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumor; malignant meningioma; neurofibrosarcoma; malignant neurilemmoma; malignant granular cell tumor; malignant lymphoma; Hodgkin's disease; Hodgkin's lymphoma; paragranuloma; small lymphocytic malignant lymphoma; diffuse large cell malignant lymphoma; follicular malignant lymphoma; mycosis fungoides; other specified non-Hodgkin's lymphomas; malignant histiocytosis; multiple myeloma; mast cell sarcoma; immunoproliferative small intestinal disease; leukemia; lymphoid leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophil
- the subject has cancer (e.g., breast cancer, such as ER-positive breast cancer).
- the cancer comprises a solid tumor.
- the tumor is an adenocarcinoma, an adrenal tumor, an anal tumor, a bile duct tumor, a bladder tumor, a bone tumor, a blood born tumor, a brain/CNS tumor, a breast tumor, a cervical tumor, a colorectal tumor, an endometrial tumor, an esophageal tumor, an Ewing tumor, an eye tumor, a gallbladder tumor, a gastrointestinal, a kidney tumor, a laryngeal or hypopharyngreal tumor, a liver tumor, a lung tumor, a mesothelioma tumor, a multiple myeloma tumor, a muscle tumor, a nasopharyngeal tumor, a neuroblastoma, an oral tumor, an osteosarcoma, an ovarian tumor, a pan
- Ammonia is a ubiquitous byproduct of cancer metabolism, however its fate has remained elusive. Here it is identified that ammonia is not merely a toxic waste product of cancers, but is recycled into central amino acid metabolism to maximize nitrogen utilization. Cancer cells primarily assimilate ammonia via reductive amination catalyzed by glutamate dehydrogenase (GDH), and secondary reactions enable other amino acids, such as proline and aspartate, to directly acquire this nitrogen. It was discovered that metabolic recycling of ammonia fosters accelerated breast cancer proliferation in 2D and 3D breast cancer culture models. In vivo, ammonia accumulates in the tumor microenvironment, and can be directly utilized to generate amino acids. Taken together, these data reorient the dogma that ammonia is a secreted waste product and for the first time highlights its role as a
- Glutamine is considered the "nitrogen reservoir" for cancer cells due to its anabolic role in nucleotide production.
- the role of glutamine as a nitrogen reservoir is contradicted in catabolic glutamine metabolism, since nitrogen is liberated as the by-product ammonia.
- the fate of ammonia in tumor metabolism has never been determined. It was hypothesized that this ammonia may be re-assimilated into central metabolism to maximize the efficiency of nitrogen utilization. In this study, it was sought to elucidate the fate of ammonia in cancer as 1) a toxic waste product or 2) a biosynthetic metabolite ( Figure 1, Part A).
- CPS1 carbamoyl phosphate synthetase I
- GDH glutamate dehydrogenase
- GS glutamine synthetase
- FIG. 5 Part A Bioinformatic analysis of patient data from The Cancer Genome Atlas of RNA levels for the ammonia assimilating enzymes in healthy compared to cancerous tissues revealed that GS and GDH expression were significantly increased across multiple cancer subtypes ( Figure 2, Part B & Figure 5, Part B). Moreover, CPS1, which is normally expressed in the liver, was not induced in many cancer subtypes. Of note, breast cancers displayed increased expression of both GS and GDH compared to healthy breast tissue. Specifically, ER positive breast cancers induced GS and GDH compared to other subtypes. Therefore, ER positive breast cancer was used as a representative model to probe for ammonia assimilation.
- a metabolic tracing analysis was performed using a targeted hydrophilic interaction liquid chromatography coupled to mass spectrometry (HILIC-MS) method and assessed the fate of 15 N(amide)-glutamine, which liberates 15 H 3 via glutaminase activity.
- HILIC-MS hydrophilic interaction liquid chromatography coupled to mass spectrometry
- M+l indicates a single 15 N-mass shift
- M+2 indicates two 15 N-mass shifts
- M+3 indicates three 15 N-mass shifts
- M+4 indicates four 15 N-mass shifts
- M+5 indicates five 15 N-mass shifts
- M+6 indicates six 15 N-mass shifts
- M+7 indicates seven 15 N-mass shifts.
- GDH-catalyzed reductive amination is prevalent in the liver, where there is a sufficient concentration of ammonia to enable this direction of catalytic activity. It was postulated that elevated levels of ammonia in the tumor microenvironment may likewise be permissive of GDH-catalyzed reductive amination.
- NH l ammonium chloride
- Physiological concentrations of ammonia range between 0-50 ⁇ in healthy adults, 50-150 ⁇ in newborns, and up to l .OmM in patients with hyperammonemia.
- Supraphysiological levels of ammonia are toxic to neurons, fueling the dogma that ammonia may also be toxic to tumor cells.
- NH 4 C1 was not cytotoxic to tumor cells even at a concentration of 50 mM, contrasting the toxicity of ammonia reported for neurons ( Figure 2, Part A). Moreover, ammonia concentrations of 0- 10 mM did not alter glucose and glutamine uptake, or basal respiration ( Figure 10, Parts A- C). In addition, ammonia did not alter pH of media ( Figure 10, Part D).
- ammonium NH4 +
- NH3 ammonia
- Ammonia assimilation in yeast has a fundamental role in supporting growth and proliferation. As ammonia was not toxic to tumor cells, it was tested whether ammonia facilitates breast cancer growth and proliferation (Figure 2, Part A). As in yeast, addition of physiological levels of ammonia supported increased proliferation in a panel of breast cancer cell lines ( Figure 15, Parts A-B). Moreover, in 3D culture, ammonia stimulates sphere growth and cell proliferation ( Figure 3, Parts A-B & Figure 14, Part C). Contrary to breast cancer cells, proliferation in primary human fibroblasts was not changed by ammonia (Figure 16, Part A). Using 15 NH 4 C1 tracing, it was found that fibroblasts centrally assimilated ammonia to generate glutamine (Figure 16, Part B).
- glutamine and glutamate labeling in the tumor. Since labeled glutamine and glutamate are also found in the liver and plasma, it is indistinguishable whether these 15 N-isomers can be generated in a tumor autonomous manner. Furthermore, the kinetics of glutamine labeling in the tumor implies that a subset of the labeled glutamine pool in the tumor may be taken up from the plasma.
- ammonia is not simply a metabolic waste product, and is recycled to support the high demand for amino acid synthesis in rapidly proliferating cells.
- ammonia is often considered a toxin, herein it is shown that it stimulates growth and proliferation in breast cancer. This stimulatory effect is directly mediated by GDH-catalyzed ammonia assimilation.
- ammonia accumulates in the tumor microenvironment, and is utilized by cancer cells for amino acid synthesis in vivo. These biosynthetic pathways are supported in both systemic and tumor autonomous metabolism.
- 2D cell culture All breast cancer cell lines were cultured in Glutamine-Free RPMI (Life Technologies) supplemented with 5% FBS (Life Technologies) and 1% Penicillin and Streptomycin (Invitrogen). 2 mM L-Glutamine (Sigma) was added to the media on the day of the experiment to minimize glutamine degradation and subsequent ammonium
- 3D cell culture MCF7 and T47D cells that have been adapted to culture conditions for four days were incubated in 8-well glass chamber culture slides (BD Falcon) on a bed of LDEV-free MatriGel (Corning) in RPMI supplemented with 5% FBS, 1%
- Penicillin/Streptomycin and 2% MatriGel Two days after seeding cells, media was replaced in all conditions. For control and ammonium-treated conditions media was changed daily for the duration of the experiment. For studies on conditioned media, media was changed every three days. Images were taken on a Nikon Eclipse TE2000-U Microscope after 8 days or 11 days for MCF7 and T47D cells, respectively. Sphere area was quantified using ImageJ on 200-300 colonies per replicate. Cells were harvested after incubation in Cell Recovery Solution (Corning: 354253) for one hour at 4°C and counted with a Beckman Coulter Counter.
- Proliferation Assays Cell lines were adapted to medium conditions containing 0.0 mM, 0.1 mM, or 0.5 mM NFLCl for four days prior to experimentation. 25,000 cells were seeded in triplicate in 6-well dishes and counted daily for approximately one week on a
- Oncomine Database Analysis Patient data from The Cancer Genome Atlas (TCGA) was analyzed using the 'Cancer Versus Normal' analytical tool on the public database Oncomine. Datasets were filtered for a threshold P-value ⁇ 0.0001 and assessed for both Over-expression Fold-Change and Under-expression Fold-Change in mRNA levels relative to healthy tissue as measured with a Human Genome U133A Array.
- Antibody (1 :5000, Cell Signaling), Anti-mouse IgG FIRP-linked Antibody (1 :5000, Cell
- Blots were developed using Pierce ECL Western Blotting Substrate (Thermo).
- shRNAs against GDH1/2 were subcloned into the pLKO. l puro vector (Addgene Plasmid #8453) at EcoRI and Agel sites: shControl:
- Subcloned plasmids were transfected into HEK293T cells. MCF7 and T47D cells were subsequently infected with the lentivirus, generating stable GDH knockdown cell lines.
- Glutamine and Ammonia Tracing Prior to experimentation, cells were adapted to respective media conditions for four days. Following adaptation, cells were seeded in 6-cm plates as previously described. After 24 hours media was replaced with RPMI supplemented with 2 mM L-Glutamine (amide- 15 N) (Sigma, 98% isotopic purity), or 2 mM L-Glutamine ( 13 Cs, 15 N2) (Sigma, 98% isotopic purity), or 0.75 mM 15 H4C1 (Sigma, 98% isotopic purity). Cells were incubated with metabolic isotopes for on a time course (0-12 hours) or for 8 hours and polar metabolites were extracted as previously described.
- Mass Spectrometry Metabolites were isolated in 80% MeOH and analyzed on two distinct methods of hydrophilic interaction liquid chromatography coupled to mass spectrometry (HILIC-MS). In one method, electrospray ionization was tailored to negative- ion mode, and in the second method to positive-ion mode. For negative-ion mode, analytes were eluted in Buffer A (20 mM Ammonium Acetate, 20 mM Ammonium Hydroxide) and Buffer B (10 mM Ammonium Hydroxide in 75:25 Acetonitrile:Methanol).
- Buffer A (20 mM Ammonium Acetate, 20 mM Ammonium Hydroxide
- Buffer B 10 mM Ammonium Hydroxide in 75:25 Acetonitrile:Methanol.
- Samples were run on a HILIC silica (3um, 2.1 x 150mm) column (Waters) with a binary flow rate of 0.4mL/min for 10 minutes on linear gradient (95% Buffer B to 0% Buffer B) followed by 2 minutes with (0% Buffer B) and ending with a 2 minute linear gradient (0% Buffer B to 95% Buffer B) and holding (95% Buffer B) for 13 minutes.
- samples were dried down and reconstituted in a 20:70: 10: acetonitrile: MeOH: water mixture.
- the buffers were: Buffer A (10 mM Ammonium Formate, 0.1% formic acid in water) and Buffer B (Acetonitrile, 0.1% formic acid).
- a master mix of reference standards for metabolites in the targeted method were run immediately prior to each set of samples, such that their retention times were associated with peaks in the unknown samples run over that same column. Peaks were integrated in Tracefinder 3.3.
- masses for 15 N-isomers were assessed on every targeted metabolite containing nitrogen atom(s).
- mass spectrum from control samples (not treated with metabolite isotopes) were scanned for the same 15 N-isotopes.
- Metaboanalyst Pathway Analysis Metabolites were sorted based on their statistical significance (students two-tailed T-Test) on fold-change of relative abundance (normalized peak area) in ammonium-treated cells compared to control. Metabolites altered with the statistical cutoff p ⁇ 0.05 were submitted to MetaboAnalyst 3.0 Pathway Enrichment Analysis Software.
- Respiration was assessed using the Seahorse XFe-96 Analyzer
- MCF7 and T47D cells were pre-treated for 1 hour in normal media conditions with a dose of ammonium chloride (0 mM-50 mM). Following this incubation, media was changed to a non-buffered, serum-free Seahorse Media (Seahorse Bioscience, Catalog #102353) supplemented with 5 mM glucose, 2 mM L-glutamine, 1 mM sodium pyruvate, and the appropriate ammonium concentration.
- Oxygen consumption rate (OCR) was measured over a period of 30 minutes, and values were normalized to cell number.
- Metabolite Uptake/Secretion Analysis Glucose and glutamine uptake and lactate and ammonium secretion were assessed using the NOVA BioProfile Flex Analyzer (NOVA Biomedical). Control media (no cells) and cells treated with a dose of ammonium chloride (0 mM-50 mM) were incubated for 24 hours and run on the Bioanalyzer. Values for glucose, glutamine, lactate and ammonium in the experimental conditions were subtracted from the values in the respective control media and normalized to cell number.
- mice All mouse protocols were approved by the Institutional Animal Care and Use Committee (IACUC) at Harvard University. Female athymic nude mice
- mice harboring subcutaneous tumors that are > 100mm 3 were injected intraperitoneal with a bolus of NH 4 C1 (9.0 mmoles/kg) in two 50 iiL injections.
- a bolus of NH 4 C1 (9.0 mmoles/kg) in two 50 iiL injections.
- twelve mice were injected with 15 ⁇ 4 0 in Hanks' Balanced Salt solution (Sigma H6648) and sacrificed 1 hour, 2 hours, and 4 hours post-injection.
- a control mouse was injected with an equivalent amount of NH4CI and sacrificed two hours after injection, a time determined to be the peak of ammonium levels in plasma after ammonium injection. Livers and tumors were excised, flash-frozen and powderized.
- Polar metabolites were extracted from 8mg tissue in 80%MeOH and profiled on LC/MS as previously described. Blood was collected from each mouse via heart puncture into heparin tubes and centrifuged at 1500 x g to separate plasma. Metabolites were extracted from plasma in 1 : 10 (v:v) plasma: 80% MeOH and centrifuged at 10,000 x g for 10 minutes at 4°C. Supernatant was run on LC/MS to profile metabolites as previously described.
- Interstitial fluid from the tumor microenvironment was isolated using a validated protocol (39). Briefly, tumors >100mm 3 were excised, washed with lmL PBS, and blotted dry with a kim wipe. Tumors were cut in half and centrifuged at 400 x g on a Nylon Mesh filter with 20wm pores (EMB catalog #NY2004700). 2-5wL of fluid was isolated from each tumor. Ammonium was immediately measured using a colorimetric assay (Abeam #ab83360).
- Cytotoxicity Assay Cell viability was assessed using a standard Propidium Iodide and Flow Cytometry protocol (40). Briefly, cells were trypsinized, washed, re-suspended in PBS and treated with lwg/mL Propidium Iodide (Sigma). Samples were run on an LSR II Flow Cytometer (BD Biosciences) and cell populations were gated dependent on fluorescence with a 488nm laser.
- NFb Ammonia
- NFb in cancer has never been investigated. It was discovered NFb generated in breast cancer metabolism is efficiently recycled as a re-purposed nitrogen source for amino acid synthesis (Spinelli et al., Science, 2017, hereby incorporated by reference in its entirety). NFb recycling stimulated breast cancer proliferation, and inhibition of assimilation repressed breast cancer proliferation in vitro.
- NFb was a dominant nitrogen source in vitro, these findings were tested in ER positive breast cancer xenograft mouse models. Tracking the fate of NFb in tumors was enabled by subcutaneous injection of 15 NFb. It was found that NFb was a nitrogen donor to amino acids via GDH in vivo ( Figure 22, Parts A-C), which is consistent with previously discussed in vitro studies.
- Ammonia is Assimilated in Primary Breast Cancer Patients
Landscapes
- Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Life Sciences & Earth Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Epidemiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Provided herein are methods and compositions for treating cancer or a tumor in a subject, comprising administering to the subject a composition comprising an agent that decreases the amount of ammonia in the subject.
Description
METHODS AND COMPOSITIONS FOR TREATING CANCER
RELATED APPLICATIONS
This application claims the benefit of priority to U.S. Provisional Patent Application serial number 62/471612, filed March 15, 2017, which is hereby incorporated by reference in its entirety.
BACKGROUND
Over the last century, studies have revealed that increased nutrient consumption supplies a critical pool of carbon, nitrogen, oxygen, and sulfur to satiate the bioenergetic, biosynthetic, and pro-survival requirements of a transformed cell. As a consequence of this metabolic gluttony, cancer cells generate an excess of waste products, such as lactate and ammonia. While lactate secretion and metabolism are well studied in cancer, little is known about the mechanisms by which cancer cells manage elevated ammonia ( H3), generated by glutamine and asparagine catabolism, and salvage nucleotide metabolism. In fact, a prevalent view has been that ammonia is a toxic by-product and must be exported from cells via Rh glycoproteins.
SUMMARY
Generally, provided herein are methods of treating cancer in a subject (e.g., a subject in need thereof) by decreasing the amount of systemic ammonia in the subject or by decreasing the amount of ammonia in a tumor present in the subject (e.g., a subject with cancer). Provided herein are compositions and methods of treating or preventing cancer (e.g., breast cancer) in a subject by administering to the subject a composition comprising an agent (e.g., a small molecule, an ammonia scavenger, a kinase inhibitor, an ammonium protonator, or a synthetic biotic) that decreases the amount of ammonia in the subject (e.g. systemically in the subject in the tumor microenvironment, and/or in a tumor in the subject).
Disclosed herein are methods for determining the progression of cancer (e.g., breast cancer) and/or a tumor (e.g., a breast tumor) in a subject comprising measuring the amount of ammonia (e.g., systemic ammonia, ammonia in the tumor microenvironment, and/or ammonia in a tumor) in the subject, thereby determining a first measurement of ammonia; and after a period of time, measuring the amount of ammonia in the subject, thereby determining a second measurement of systemic ammonia, wherein the cancer and/or tumor has progressed if the second measurement is higher than the first measurement.
Provided herein are compositions and methods for treating cancer (e.g., breast cancer) or a tumor (e.g., a breast tumor) in a subject by administering to the subject a first agent that inhibits the expression or activity of glutaminase and a second agent that inhibits the expression or activity of glutamate dehydrogenase. The first agent may be a polypeptide, small molecule, or a polynucleotide (e.g., an inhibitory polynucleotide, such as an shRNA). The second agent may be a polypeptide, small molecule, or a polynucleotide (e.g., an inhibitory polynucleotide, such as an shRNA). In some embodiments, the first agent and the second agent are administered at different times (e.g., sequentially). In some embodiments, the first agent and the second agent are administered at the same time.
Disclosed herein are methods of preventing or treating chemotherapeutic drug resistance in a subject by administering to the subject an agent (e.g., a small molecule, an ammonium scavenger, a kinase inhibitor, an ammonium protonator, or a synthetic biotic) that reduces the amount of ammonia in the subject (e.g., systemic ammonia and/or the local level of ammonia in the tumor) and a chemotherapeutic agent. Also disclosed herein are methods of preventing or treating immunotherapy resistance in a subject by administering to the subject an agent (e.g., a small molecule, an ammonia scavenger, a kinase inhibitor, an ammonium protonator, or a synthetic biotic) that reduces the amount of ammonia in the subject and an immunotherapeutic agent.
In some embodiments, the methods described herein further comprise administering an additional agent (i.e., an immune checkpoint inhibitor or a chemotherapeutic inhibitor).
Provided herein are methods of preventing or treating chemotherapeutic drug resistance in a subject, comprising administering to the subject (e.g., to the subject systemically or locally to a tumor present in the subject) an agent that reduces the amount of ammonia in the subject and a chemotherapeutic agent.
Provided herein are methods of preventing or treating immunotherapeutic drug resistance in a subject, comprising administering to the subject (e.g., to the subject systemically, or locally to a tumor present in the subject) an agent that reduces the amount of ammonia in the subject (e.g., systemic ammonia and/or the local level of ammonia in the tumor) and an immunotherapeutic agent.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 has eight parts, A-H, and shows glutamine-derived ammonia is recycled. Part A shows a schematic of underlying question on ammonia in cancer metabolism. Part B shows RNA levels from The Cancer Genome Atlas of ammonia assimilating enzymes in a
panel of cancer subtypes run on the "Normal versus Cancer" analytical tool on Oncomine.org. Fold-change (cancer/normal) for GS (Glutamine Synthetase), GDH
(Glutamate Dehydrogenase), and CPS1 (Carbamoyl Phosphate Synthetase 1) RNA levels were assessed. A- Ovarian Serous Cystadenocarcinoma, B- Colon Adenocarcinoma, C- Rectal Adenocarcinoma, D- Lobular & Ductal Breast Carcinoma, E- Lung Adenocarcinoma, F- Squamous Lung Cell Carcinoma, G- Endometrial Adenocarcinoma, H- Bladder Urothelial Carcinoma, I- Gastric Adenocarcinoma, J- Glioblastoma, K- Pancreatic Adenocarcinoma, L- Hepatocellular Carcinoma, M- Cutaneous Melanoma. Part C shows heat map of % isotope abundance of metabolites with 15N-mass shifts in MCF7 and T47D cells after 8 hour treatment with 15N-(amide)glutamine. 211 metabolites were screened for 15N-isomeric mass shift using mass spectrometry. Part D shows a schematic of expected and unexpected (in gray) 15N-isomers after treatment with 15N-(amide)glutamine. Part E shows isotope abundance of novel 15N-(amide)glutamine derivatives +/- lwM BPTES in MCF7 and T47D cell lines. Part F shows steady-state metabolite abundance of MCF7 cells treated with luM BPTES in the presence or absence of 0.75mM NH4CI. Part G shows isotope abundance of 15N-(amide)glutamine-derived metabolites with stable knockdowns of GDH: shGDH#l, shGHD#2 and shControl. ND= 15N-Isomer not detected. Glu = Glutamate M+l, Pro = Proline M+l, Asp = Aspartate M+l, Cit = Citrulline M+l, Asa = Arginosuccinate M+l . Part H shows a schematic of ammonia recycling through reductive amination catalyzed by GDH. *P < 0.05, **P < 0.01, ***P<0.001, and ****P<0.0001 by paired Student t test. Error bars represent the SEM.
Figure 2 has six parts, A-F, and shows free ammonia is primarily assimilated via GDH to generate glutamate and other amino acids. Part A shows propidium iodide staining of cells treated with a dose of NH4C1 for 48 hours. Part B shows heat map of fold-change in steady-state abundance of keto- and amino acids involved in transaminase reactions in T47D cells treated with 0.75mM NH4C1. Part C shows a schematic of a transaminase reaction. Part D shows isotope abundance of 15N-isomers in MCF7 cells after 8 hours of treatment with 0.75mM 15NH4C1. (M+l) indicates a single 15N-isotope and (M+2) indicates two 15N- isotopes. Part F shows isotope abundance of glutamate (M+l) in MCF7 and T47D cells treated for 8 hours with 0.75mM 15NH4C1 in control and GDH knockdown cells. Part F shows isotope abundance of 15N-isomers of metabolites downstream of glutamate treated for 8 hours with 0.75mM 15NH4C1 in control and GDH knockdown cells*P < 0.05, **P < 0.01, ***P<0.001, and ****P<0.0001 by paired Student t test. Error bars represent the SEM.
Figure 3 has seven parts, A-G, and shows ammonia stimulates breast cancer growth and proliferation. Part A shows a representative images of 3D culture models of MCF7 and T47D cells treated with 0.5mM NH4C1 compared to control conditions. Part B shows quantification of average sphere area of 100-200 spheres per well, N=4, in 3D culture models of MCF7 and T47D cells treated with ammonia and control conditions for 7 days. Part C shows quantification of average sphere area of 200-250 spheres per well, N=3, in 3D culture models of MCF7 cells harboring stable shRNA-mediated knockdown of GDH or control hairpin. Cells were treated for 8 days. Part D shows representative images of MCF7 and T47D cells in control conditions (daily media change) and conditioned media (media changed every 72 hours). Cells were treated for 8 days. Part E shows ammonia measurement in conditioned media compared to control after 8 days. Part F shows quantification of average sphere area of 200-250 spheres per well, N=3, in 3D culture models of MCF7 cells harboring stable shRNA-mediated knockdown of GDH or control hairpin. Cells were treated in control or conditioned media conditions for 8 days. Part G shows nmoles ammonia secreted per cell in conditioned media of cells harboring stable shRNA-mediated knockdown of GDH or control hairpin. *P < 0.05, **P < 0.01, ***P<0.001, and ****P<0.0001 by paired Student t test. Error bars represent the SEM.
Figure 4 has five parts, A-E, and shows systemic and tumor autonomous ammonia metabolism contribute to amino acid synthesis. Part A shows measurement of ammonia in the interstitial fluids of the tumor microenvironment compared to plasma isolated from
ER(+) breast cancer xenograft models. Part B shows quantification of average sphere area of 200-250 spheres per well, N=3, in 3D culture models of MCF7 cells treated in control conditions or with 3.0mM NH4CI. Part C shows isotope abundance of 15N-isomers isolated from the liver, plasma and tumor of mice IP injected with a bolus (9.0mmol/kg) of 15NH4C1. Tissues were harvested 1, 2, or 4 hours after injection, N=4 mice per time point. 15N-isomers were corrected for natural abundance of tissues harvested from a control mouse treated with 9.0mmol/kg NH4CI for 4 hours. Part D shows isotope abundance of 15N-isomers isolated in ex vivo tracing samples. Tumors were harvested and incubated in 0.75mM 15NH4C1 for 4, 8, or 16 hours, N=4 each time point. 15N-isomers were corrected for natural abundance in control samples treated with NH4CI. Part E shows schematic of systemic and tumor autonomous ammonia metabolism. *P < 0.05, **P < 0.01, ***P<0.001, and ****P<0.0001 by paired Student t test. Error bars represent the SEM.
Figure 5 has two parts, A-B, and shows ammonia assimilating enzymes in cancer. Part A shows enzymatic reactions of the ammonia assimilating enzymes. Carbamoyl Phosphate Synthetase 1 (CPS1), Glutamate Dehydrogenase (GDH), and Glutamine
Synthetase (GS). Part B shows protein Atlas expression score for ammonia assimilating enzymes in healthy tissue.
Figure 6 shows a heatmap of Metabolic Derivatives of 15N-(amide)-glutamine.
Percent isotope abundance of 15N-isomers in MCF7 and T47D cell lines treated for 8 hours with 2.0 mM 15N-(amide)-glutamine.
Figure 7 has two parts, A-B, and shows metabolic Derivatives of 15N-(amide)- glutamine in MCF7 and T47D. Part A shows isotope abundance of expected 15N-isomers after treatment with 15N-(amide)-glutamine. These metabolites are made in direct, enzymatically catalyzed reactions of glutamine with other metabolites. Part B shows isotope abundance of novel 15N-isomers after treatment with 15N-(amide)-glutamine. These metabolites are unexpected because the labeled nitrogen on glutamine is liberated as ammonia prior to their synthesis.
Figure 8 has four parts, A-D, and shows characterization of the glutaminase inhibitor BPTES in ER(+) breast cancer cell lines. Part A shows cytotoxicity assay by Propidium Iodide staining of cells treated with a dose of BPTES for 48 hours. Part B shows
proliferation of cells treated with a dose of BPTES for 48 hours. Part C shows steady-state abundance of glutamate, analyzed by mass spectrometry, in MCF7 and T47D cells treated with 1 uM BPTES. Part D shows isotope abundance of expected 15N-isomers after treatment with 15N-(amide)-glutamine and 1 uM BPTES.
Figure 9 has three parts, A-C, and shows stoichiometric analysis of ammonia recycling. Part A shows schematic of experiment. MCF7 cells were incubated with 15N213Cs- glutamine (glutamine (M+7)) for 8 hours. Glutaminolysis was measured by the ion counts of glutamate (M+6), in which five carbons and one nitrogen are labeled. Ammonia recycling was measured by glutamate (M+l), in which a single nitrogen atom on glutamate is labeled. Purple circles indicate 13C isotopes and yellow circles indicate 15N isotopes. Part B shows the equation for quantification of total glutamates generated in glutaminolysis. This calculation assesses the stoichiometric ratio of glutamate (by nitrogen) generated from glutamine catabolism. Part C shows the ratio of glutamates generated by glutaminolysis in MCF7 cells. The error is SEM, N=4.
Figure 10 has five parts, A-E, and shows the effect of NH4C1 on basal metabolic phenotypes. Part A shows glucose consumed from media after 24 hours in T47D and MCF7 on a dose of NH4CI (0-50 mM). Normalized to cell number, N=3. Part B shows glutamine consumed from media after 24 hours in T47D and MCF7 on a dose of NH4CI (0-50 mM). Normalized to cell number, N=3. Part C shows basal oxygen consumption rate (OCR) in T47D and MCF7 on a dose of NH4C1 (0-50 mM). Normalized to cell number, N=3. Part D shows pH measurement of media treated with a dose of NH4C1 (0-50 mM) Part E shows ammonia uptake/output from media after 24 hours in T47D and MCF7 cell treated with a dose of NH4CI (0-50 mM). Normalized to cell number, N=3. Blue bars represent net ammonia output and red bars represent net ammonia uptake.
Figure 11 has four parts, A-D, and shows steady-state profile of ammonia treated cells. Part A shows metabolites that were significantly altered (p<0.05) in cells treated with 0.75 mM NH4CI compared to control were analyzed using Metaboanalyst 3.0 pathway analysis. Part B shows relative abundance of essential amino acids in cells treated with 0.75 mM NH4CI compared to control, N=4 Part C shows relative abundance of nucleotides in cells treated with 0.75 mM NH4CI compared to control, N=4 Part D shows relative abundance of urea cycle intermediates in cells treated with 0.75 mM NH4CI compared to control, N=4.
Figure 12 shows a heatmap of metabolic derivatives of 15NH4C1. Percent isotope abundance of 15N-isomers in the nitrogen scan of T47D and MCF7 cells treated with 0.75 mM 15NH4C1.
Figure 13 has six parts, A-F, and shows 15NH4C1 Tracing in MCF7 and T47D cell lines. Part A shows isotope abundance of 15N-isomers in T47D cells after 8 hours of treatment with 0.75 mM 15NH4C1. (M+1) indicates a single 15N-isotope and (M+2) indicates two 15N-isotopes. * indicates no isotope detected, N=4. Part B shows schematic of metabolic pathways by which 15N-isomers acquire labeling from 15NH4C1. Parts C-F show isotope abundance of metabolites labeled after treatment with 0.75 mM 15NH4C1 in T47D on a time course, N=4.
Figure 14 has two parts, A-B, shows GDH knockdown does not affect 15N-isomers that derive from GS. Part A shows isotope abundance of 15N-isomers in T47D and MCF7 cells after 8 hours of treatment with 0.75 mM 15NH4C1 +/- GDH. Part B shows schematic of GS-derived 15N-isomers.
Figure 15 has three parts, A-C, and shows ammonia accelerates proliferation in 2D and 3D culture. Part A shows representative growth curves of T47D and HCC1937 cells
treated with control or NH4C1, N=3. Part B shows calculated doubling times for growth curves in ER(+) breast cancer cell lines, MCF7 and T47D, and triple negative breast cancer cell lines, HCC1937 and SUM149, treated with a dose (0.0 mM, 0.1 mM, and 0.5 mM) H4CI, N=3. Part C shows proliferation in 3D culture, measured by cell number of MCF7 cells in control (O.OmM H4CI) or ammonia treated (0.5 mM H4CI) conditions for 8 days of treatment, N=3.
Figure 16 has three parts, A-C, and shows ammonia metabolism and biology in fibroblasts. Part A shows representative growth curve of primary human fibroblasts treated with control or 0.5 mM H4CI, N=3. Part B shows isotope abundance of 15N-isomers in primary human fibroblasts after 8 hours of treatment with 0.75 mM 15 H4C1. ND = 15N- isomer not detected. Part C shows isotope abundance of 15N-isomers in primary human fibroblasts after 8 hours of treatment with 2.0 mM 15N-(amide)-glutamine. ND = 15N-isomer not detected.
Figure 17 has three parts, A-C, and shows GDH knockdown does not alter basal growth and proliferation in 3D culture. Part A shows a western blot depicting shRNA- mediated knockdown of glutamate dehydrogenase (GDH) compared to control hairpin in MCF7 cells. Part B shows average sphere area of MCF7 cells harboring control hairpin, or GDH knockdown (GDH#1 or GDH#2). Cells were treated in control conditions, with daily media change for 8 days, N=3. Part C shows cell count of MCF7 cells harboring control hairpin, or GDH knockdown (GDH#1 or GDH#2). Cells were treated in control conditions, with daily media change for 8 days, N=3.
Figure 18 has two parts, A-B, shows plasma ammonia measurements in T47D xenograft model. Part A shows ammonia measurement in plasma isolated from control mice, without tumors and mice harboring a subcutaneous tumor >100mm3, N=6. Part B shows ammonia measurement in plasma isolated from mice harboring a subcutaneous tumor >100mm3 on a time course of a bolus intraperitoneal injection of 9.0mmoles/kg 15NH4C1.
Figure 19 shows heat maps of 15N-isomers in the tumor, plasma, and liver after 15NH4C1 Tracing in vivo. Mice harboring a subcutaneous tumor > 100mm3 were given a bolus IP injection (9.0mmoles/kg) of 15NH4C1, and metabolites isolated from the tumor, plasma and liver were scanned for 15N-isomers. Percent isotope abundance of 15N-isomers was determined for tumor, plasma and liver tissue harvested 1, 2, and 4 hours after IP injection, N=4.
Figure 20 shows N-isomers in the tumor, plasma and liver after NH l Tracing in vivo. Isotope abundance of 15N-isomers isolated from the liver, plasma and tumor of mice IP injected with a bolus (9.0mmol/kg) of 15 H4C1. Tissues were harvested 1, 2, or 4 hours after injection. 15N-isomers were corrected for natural abundance of tissues harvested from a control mouse treated with 9.0mmol/kg H4CI for 4 hours.
Figure 21 has two parts, A-B, shows ex vivo tracing in T47D xenograft model. Part A shows isotope abundance of 15N-isomers isolated from the tumors treated with 0.75 mM 15 H4C1. Part B shows isotope abundance of 15N-isomers isolated from the tumors treated with 2.0 mM 15N-(amide)-glutamine.
Figure 22 has three parts A-C, and shows inhibition of ammonia assimilation in vivo represses tumor growth. Part A shows a western blot of GDH knockdown in T47D xenograft tumors. Part B shows m vivo tumor growth of T47D control and GDH-depleted mouse xenograft models (n = 15 mice per group). Values represent mean tumor volume +/- SEM.*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. Part C shows in vivo metabolic tracing of 15 H4C1 in T47D control and GDH-depleted xenograft mouse models. Values represent mean isotopologue abundance +/- SEM, n = 4.*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.
Figure 23 has two parts, A -B, and shows ammonia metabolism in primary breast cancer patients. Part A shows measurement of ammonia in the microenvironment of tumor and healthy tissue from estrogen receptor positive breast cancer patients. Concentrations are relative to healthy tissue. Each line is an individual patient, n=3. Part B shows ex vivo metabolic tracing of ammonia in patient breast tumors. 15N-Isotopologues detected in primary breast cancer patient tumors after treatment with 15NH4C1. Values represent mean +/- SEM, n=3.
Figure 24 has four parts, A-D, and shows synergy between ammonia assimilation and glutaminase inhibition in breast cancer. Part A shows schematic depicting the potential synthetic lethality of glutaminase (GLS) inhibition with ammonia assimilation through GDH. Both pathways converge on glutamate synthesis. Part B shows steady-state metabolite levels of glutamate and downstream metabolites in MCF7 cells with DMSO control, 1 uM BPTES alone, and 1 uM BPTES with 1 mM NH4CI. Part C shows representative images of 3D culture growth of breast cancer cells treated with 1 uM BPTES +/- shRNA-mediated GDH depletion. Part D shows quantification of sphere area in 3D culture experiment (>200 spheres quantified per replicate). Values represent mean +/- SEM, n=3.
DETAILED DESCRIPTION
Provided herein are compositions and methods for treating or preventing cancer in a subject by administering to the subject a composition comprising an agent that decreases the amount of systemic ammonia in the subject and/or decreases the amount of ammonia in a tumor present in the subject. Also provided herein are methods for determining the progression of cancer and/or a tumor in a subject comprising measuring the amount of ammonia (e.g., systemic ammonia, ammonia in the tumor microenvironment, and/or ammonia in a tumor) in the subject at different times and comparing the ammonia measurements.
Provided herein are compositions and methods for treating cancer or a tumor in a subject by administering to the subject a first agent that inhibits the expression or activity of glutaminase and a second agent that inhibits the expression or activity of glutamate dehydrogenase.
Disclosed herein are methods of preventing or treating drug resistance (e.g., chemotherapeutic and/or immunotherapeutic drug resistance) in a subject by administering to the subject (e.g., administering systemically or locally to a tumor present in the subject) an agent (e.g., a small molecule or an ammonium scavenger) disclosed herein that reduces the amount of ammonia in the subject and a chemotherapeutic or immunotherapeutic agent.
Definitions
For convenience, certain terms employed in the specification, examples, and appended claims are collected here.
As used herein, the term "administering" means providing a pharmaceutical agent or composition to a subject, and includes, but is not limited to, administering by a medical professional and self-administering.
The term agenf is used herein to denote a chemical compound, a small molecule, a mixture of chemical compounds and/or a biological macromolecule (such as a nucleic acid, a protein, or a peptide). Agents may be identified as having a particular activity by screening assays described herein below. The activity of such agents may render them suitable as a "therapeutic agent" which is a biologically, physiologically, or pharmacologically active substance (or substances) that acts locally or systemically in a subject.
The term "amino acid" is intended to embrace all molecules, whether natural or synthetic, which include both an amino functionality and an acid functionality and capable of being included in a polymer of naturally-occurring amino acids. Exemplary amino acids
include naturally-occurring amino acids; analogs, derivatives and congeners thereof; amino acid analogs having variant side chains; and all stereoisomers of any of any of the foregoing.
As used herein, "ammonia" and "ammonium" are used interchangeably. In some embodiments, ammonia is H3. In some embodiments, ammonium is H4+. As used herein, in some embodiments, ammonia and/or ammonium is a mixture of NH3 and H4+. In some embodiments, ammonia and/or ammonium is a salt.
The terms "polynucleotide", and "nucleic acid" are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or
ribonucleotides, or analogs thereof. Polynucleotides may have any three-dimensional structure, and may perform any function, known or unknown. The following are non- limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA
(mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present,
modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified, such as by conjugation with a labeling component. The term "recombinant" polynucleotide means a polynucleotide of genomic, cDNA, semisynthetic, or synthetic origin which either does not occur in nature or is linked to another polynucleotide in a non-natural arrangement.
The phrase "pharmaceutically-acceptable carrier" as used herein means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body.
As used herein, a therapeutic that "prevents" a disorder or condition refers to a compound that, when administered to a statistical sample prior to the onset of the disorder or condition, reduces the occurrence of the disorder or condition in the treated sample relative to an untreated control sample, or delays the onset or reduces the severity of one or more symptoms of the disorder or condition relative to the untreated control sample.
The term "small molecule" is a term of the art and includes molecules that are less than about 1000 molecular weight or less than about 500 molecular weight. In one embodiment, small molecules do not exclusively comprise peptide bonds. In another embodiment, small molecules are not oligomeric. Exemplary small molecule compounds which can be screened for activity include, but are not limited to, peptides, peptidomimetics, nucleic acids, carbohydrates, small organic molecules {e.g., polyketides) (Cane et al. (1998) Science 282:63), and natural product extract libraries. In another embodiment, the compounds are small, organic non-peptidic compounds. In a further embodiment, a small molecule is not biosynthetic.
As used herein, the term "subject' means a human or non-human animal selected for treatment or therapy.
The "tumor microenvironmenf is an art-recognized term and refers to the cellular environment in which the tumor exists, and includes, for example, interstitial fluids surrounding the tumor, surrounding blood vessels, immune cells, other cells, fibroblasts, signaling molecules, and the extracellular matrix.
The phrases "therapeutically-effective amount" and "effective amount' as used herein means the amount of an agent which is effective for producing the desired therapeutic effect in at least a sub-population of cells in a subject at a reasonable benefit/risk ratio applicable to any medical treatment.
"Treating" a disease in a subject or "treating" a subject having a disease refers to subjecting the subject to a pharmaceutical treatment, e.g., the administration of a drug, such that at least one symptom of the disease is decreased or prevented from worsening.
Therapeutic Methods
The methods described herein, relate, in part, to the novel discovery that cancer cells use the ammonium by-product of glutaminolysis in the production of glutamine and other downstream amino acids, thus promoting cancer cell proliferation.
In some aspects, provided herein are methods and compositions to treat or prevent cancer in a subject by administering to the subject a composition comprising at least one agent that decreases the amount of ammonia in the subject. The agent may decrease the amount of ammonia in the subject systemically or locally (e.g., within the tumor or in the tumor microenvironment). Also provided herein are methods for treating a tumor in a subject by administering a composition comprising at least one agent that decreases the amount of
ammonia in the subject (e.g., decreasing systemic ammonia in the subject and/or decreasing the amount of ammonia in the tumor).
In some embodiments, the compositions disclosed herein may decrease the amount of systemic ammonia in the subject by at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%>, at least 65%>, at least 70%, at least 75 %, at least 80%, at least 85%), at least 90%, at least 95%, or at least 99%. In some embodiments, the composition may decrease the amount of ammonia in a tumor present in the subject (e.g., a subject with cancer) by at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75 %, at least 80%, at least 85%, at least 90%, at least 95%), at least 99%, or by 100%. A composition may comprise two or more, three or more, four or more, or five or more agents disclosed herein. In some embodiments, the composition may decrease the amount of ammonia in a tumor microenvironment (e.g., in the interstitial fluids in the tumor microenvironment) by at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75 %, at least 80%, at least 85%., at least 90%, at least 95%, at least 99%, or by 100%.. A composition may comprise two or more, three or more, four or more, or five or more agents disclosed herein.
A composition and/or agent disclosed herein may decrease systemic or local ammonia (e.g., local ammonia in a tumor present in a subject) by, for example, inhibiting ammonia production, inhibiting ammonia recycling in glutaminolysis, or facilitating the removal of ammonia from a subject. The agent may be, for example, a small molecule, a glutamine scavenger, an ammonium scavenger, a kinase inhibitor (e.g., sodium
phenylbutyrate), or an ammonium protonator (e.g., an ammonia reducer, such as lactulose). An ammonium scavenger may refer to any compound that facilitates the removal of ammonia from a subject (e.g., a subject in need thereof). Ammonium scavengers may be found in U.S. Patent 4,650,587, U.S. Patent No. 4,460,555, and U.S. Patent No. 8,642,012, each of which is hereby incorporated in its entirety. The agent may be a synthetic biotic (e.g., a modified bacteria capable of assimilating ammonia, such as SYNB1020). Exemplary agents include, but are not limited to, sodium phenyl acetate, phenylbutyrate,
butyroyloxymethyl-4-phenylbutyrate, glyceryl tri-4-phenylbutyrate, sodium benzoate, sodium phenylbutyrate, glycerol phenylbutyrate, SYNB1020, VS-01, or lactulose. The agent
may be a polypeptide or an inhibitory polynucleotide disclosed herein. Agents disclosed herein may be used alone or in combination.
Provided herein are methods for determining the progression of cancer in a subject by measuring the amount of systemic ammonia in the subject, thereby determining a first measurement of ammonia; and, after a period of time, measuring the amount of ammonia in the subject, thereby determining a second measurement of ammonia. In some embodiments, the cancer has progressed if the second measurement is higher than the first measurement. In some embodiments, the method further comprises measuring the amount of ammonia in the subject to determine a third measurement of ammonia, and cancer is considered to have progressed if the third measurement is higher than the second measurement. The
measurement of ammonia may be systemic ammonia or local levels of ammonia (e.g., ammonia in the tumor, and/or ammonia in the tumor microenvironment). Also disclosed herein are methods of determining the progression of a tumor (e.g., a tumor present in a subject) by measuring the an amount of ammonia, thereby determining a first measurement of ammonia; and, after a period of time, measuring the amount of ammonia, thereby determining a second measurement of ammonia, wherein the tumor has progressed if the second measurement is higher than the first measurement. In some embodiments, the method further comprising measuring the amount of ammonia to determine a third measurement of ammonia, wherein the tumor has progressed if the third measurement is higher than the second measurement. In some embodiments, the method further comprising measuring the amount of ammonia to determine a third measurement of ammonia, wherein the tumor has progressed if the third measurement is higher than the second measurement. The measurement of ammonia may be systemic ammonia or local levels of ammonia (e.g., ammonia in the tumor, and/or ammonia in the tumor microenvironment). In some embodiments, four or more, five or more, six or more, seven or more, ten or more, twenty or more, thirty or more, fifty or more, or one hundred or more measurements of systemic or local ammonia are taken. Measurements of systemic ammonia or local ammonia may be taken at regular or sporadic intervals. Systemic or local ammonia in a subject may be measured by any means known in the art. For example, systemic ammonia may be measured by a blood test, wherein blood samples are collected from the subject, mixed, and centrifuged. The plasma is then separated, collected, and, optionally, frozen for later testing. Local ammonia may be measured, for example, by direct sampling of the tumor (e.g., sampling of the interstitial fluids of the tumor microenvironment).
The period of time between ammonia measurements may be any period of time, and may depend on the type of cancer or tumor. The period of time may be, for example, 1 day, 3 days, 5 days, one week, two weeks, three weeks, one month, two months, three months, four months, five months, six months, seven months, eight months, nine months, ten months, eleven months, one year, two years, or five years.
In some embodiments, methods of determining the progression of cancer or a tumor (e.g., a tumor present in a subject with cancer), further comprises administering an agent disclosed herein (i.e., an agent that decreases the amount of systemic ammonia, the amount of ammonia in a tumor present in a subject, and/or ammonia in the tumor
microenvironment).
Disclosed herein are methods of treating cancer and/or a tumor in a subject by administering to the subject a first agent that inhibits the expression and/or activity of glutaminase and a second agent that inhibits the expression and/or activity of glutamate dehydrogenase. Glutaminase is an amidohydrolase enzyme that generates glutamate from glutamine. Glutamate dehydrogenase is an enzyme responsible for converting a- ketoglutarate to glutamate. In addition, glutamate dehydrogenase recycles ammonia to replenish depleted glutamate pools during glutaminase inhibition. Both glutaminase and glutamate dehydrogenase generate ammonia and, therefore, inhibition of glutaminase and glutamate dehydrogenase in a subject would lead to a decrease of ammonia in the subject. In some embodiments, the glutaminase inhibitor is a small molecule. In some embodiments, the glutaminase inhibitor depletes glutamine pools. In some embodiments, the glutaminase inhibitor is a thiourea derivative product. Exemplary glutaminase inhibitors include, but are not limited to, THDP-17, CB-839, and bis-2-(5-phenylacetamido-l,3,4-thiadiazol-2-yl)ethyl sulfide (BPTES). In some embodiments, the glutamate dehydrogenase inhibitor is a small molecule. An exemplary glutamate dehydrogenase inhibitor is epigallocatechin-monogallate (EGCG). In some embodiments, the first agent may inhibit the expression and/or activity of glutaminase by at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75 %, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or by 100%. In some embodiments, the second agent may inhibit the expression and/or activity of glutamate dehydrogenase by at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%,
at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75 %, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or by 100%.
In some embodiments, the methods described herein further comprise administering an additional agent (i.e., an immune checkpoint inhibitor or a chemotherapeutic inhibitor).
Provided herein are methods of preventing or treating chemotherapeutic drug resistance in a subject, comprising administering to the subject (e.g., to the subject systemically or locally to a tumor present in the subject) an agent disclosed herein (e.g., an agent that reduces the amount of ammonia in the subject) in combination with a
chemotherapeutic agent. The agent disclosed herein and the chemotherapeutic agent may be administered at the same time or at different times. Provided herein are methods of preventing or treating immunotherapeutic drug resistance in a subject, comprising administering to the subject (e.g., to the subject systemically or locally to a tumor present in the subject) an agent disclosed herein (e.g., an agent that reduces the amount of ammonia in the subject) in combination with an immunotherapeutic agent. The agent disclosed herein and the immunotherapeutic agent may be administered at the same time or at different times.
The agents and/or compositions described herein may be administered systemically, intravenously, intramuscularly, orally, or locally (e.g., delivered locally to a tumor). The compositions and/or agents disclosed herein may be delivered by any suitable route of administration, including orally, nasally, as by, for example, a spray, rectally, intravaginal, parenterally, intracisternally and topically, as by powders, ointments or drops, including buccally and sublingually. In certain embodiments, the agents and/or compositions are delivered generally (e.g., via oral or parenteral administration). In certain other
embodiments, the compositions and/or agents are delivered locally through injection. The therapeutics described herein may be administered through conjunctive therapy. Conjunctive therapy includes sequential, simultaneous and separate, and/or co-administration of the compositions and/or agents in such a way that the therapeutic effects of the first agent administered have not entirely disappeared when the subsequent agent is administered. In certain embodiments, the additional agent may be co-formulated with the first and/or second agent or be formulated in a separate pharmaceutical composition. In some embodiments, the compositions and additional agents are administered at the same time or at different times (e.g., the compositions and additional agents are administered sequentially).
Agents
As used herein, the term "agent" may refer to any compound that inhibits the expression and/or activity of glutaminase, any compound that inhibits the expression and/or activity of glutamate dehydrogenase, or a compound that otherwise decreases the amount of ammonia in a subject and/or a tumor present in the subject. An agent may be a small molecule, an ammonium scavenger, a kinase inhibitor, an ammonium protonator, a synthetic biotic, a polypeptide, or an inhibitory nucleic acid. Exemplary agents that decrease the amount of ammonia in a subject or in the tumor of the subject include, but are not limited to, sodium phenylacetate, sodium benzoate, sodium phenylbutyrate, glycerol phenylbutyrate, SY B1020, VS-01, and lactulose.
Certain embodiments of the methods and compositions disclosed herein relate to the use of small molecule agents e.g., small molecule agents that inhibit the expression or activity of ammonia, glutaminase, or glutamate dehydrogenase. In some embodiments, the small molecule decreases the amount of ammonia in the subject by inhibiting its activity (e.g., by binding to ammonia, inhibiting the production of ammonia, or increasing the elimination of ammonia from a subject.
In some embodiments, an agent disclosed herein is a polypeptide. In some embodiments, the polypeptides can be isolated from cells or tissue sources by an appropriate purification scheme using standard protein purification techniques. In another embodiment, polypeptides are produced by recombinant DNA techniques. Alternatively, polypeptides can be chemically synthesized using standard peptide synthesis techniques. In some
embodiments, polypeptide is a chimeric or fusion polypeptide. A fusion or chimeric polypeptide can be produced by standard recombinant DNA techniques. For example, DNA fragments coding for the different polypeptide sequences are ligated together in-frame in accordance with conventional techniques, for example by employing blunt-ended or stagger- ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation. In another embodiment, the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers.
Alternatively, PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and re-amplified to generate a chimeric gene sequence (see, for example, Current Protocols in Molecular Biology, Ausubel et al., eds., John Wiley & Sons: 1992). Moreover, many expression vectors are commercially available that already
encode a fusion moiety.
The polypeptides described herein can be produced in prokaryotic or eukaryotic host cells by expression of polynucleotides encoding a polypeptide(s). Alternatively, such peptides can be synthesized by chemical methods. Methods for expression of heterologous polypeptides in recombinant hosts, chemical synthesis of polypeptides, and in vitro translation are well known in the art and are described further in Maniatis et al., Molecular Cloning: A Laboratory Manual (1989), 2nd Ed., Cold Spring Harbor, N. Y.; Berger and Kimmel, Methods in Enzymology, Volume 152, Guide to Molecular Cloning Techniques (1987), Academic Press, Inc., San Diego, Calif ; Merrifield, J. (1969) J. Am. Chem. Soc. 91 :501; Chaiken I. M. (1981) CRC Crit. Rev. Biochem. 11 :255; Kaiser et al. (1989) Science 243 : 187; Merrifield, B. (1986) Science 232:342; Kent, S. B. H. (1988) Annu. Rev. Biochem. 57:957; and Offord, R. E. (1980) Semisynthetic Proteins, Wiley Publishing, which are incorporated herein by reference.
In some embodiments, an agent disclosed herein is an inhibitory polynucleotide. In some embodiments, the inhibitory polynucleotides an inhibitory RNA molecule. In some embodiments, the inhibitory RNA molecules is administered to the subject. Alternatively, constructs encoding these may be contacted with or introduced into the subject. Antisense constructs, antisense oligonucleotides, RNA interference constructs or siRNA duplex RNA molecules can be used to interfere with activity or expression of a target of interest, e.g., glutaminase or glutamate dehydrogenase. Antisense or RNA interference molecules can be delivered in vivo, e.g., injected into tissues of a subject. Typical delivery means known in the art can be used. For example, an interfering RNA can be delivered systemically using, for example, the methods and compositions described in PCT Application No:
PCT/US09/036223, PCT/US09/061381 PCT/US09/063927, PCT/US09/063931 and
PCT/US09/063933, each of which is hereby incorporated by reference in its entirety. In certain embodiments, the siRNA is delivered locally. For example, when the siRNA described herein is used to treat a tumor, local delivery to the tumor may be accomplished by injection. Alternatively, when the interfering RNA described herein is used to cancer, the interfering RNA can be delivered intravenously or parenterally.
Actual dosage levels of the agents to be administered may be varied so as to obtain an amount of the active ingredient (e.g., an agent described herein) which is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient.
The selected dosage level will depend upon a variety of factors including the activity of the particular agent employed, the route of administration, the time of administration, the rate of excretion or metabolism of the particular compound being employed, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compound employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts.
A physician or veterinarian having ordinary skill in the art can readily determine and prescribe the effective amount of the pharmaceutical composition required. For example, the physician or veterinarian could prescribe and/or administer doses of the compounds employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.
Compositions
In certain embodiments, provided herein are compositions, e.g., pharmaceutical compositions, containing at least one agent (e.g., an agent that inhibits the expression and/or activity of glutaminase, an agent that inhibits the expression and/or activity of glutamate dehydrogenase, or a compound that otherwise decreases the amount of ammonia in a subject and/or a tumor) described herein together with a pharmaceutically acceptable carrier. In some embodiments, the composition includes a combination of multiple (e.g., two or more) agents described herein.
In some embodiments, provide herein are compositions that comprise an agent (e.g., a small molecule or an ammonium scavenger) that decreases the amount of ammonia in the subject. The agent may decrease ammonia in the subject by decreasing ammonia production, decreasing ammonia recycling, or increasing ammonia excretion. In other embodiments, provided herein are compositions comprising at a first agent (e.g., a small molecule, a polypeptide, an inhibitory nucleic acid) that inhibits the expression or activity of glutaminase and a second agent (e.g., a small molecule, a polypeptide, or an inhibitory nucleic acid) that inhibits the expression or activity of glutamate dehydrogenase described herein together with a pharmaceutically acceptable carrier. In some embodiments, the compositions include a combination of multiple (e.g., three or more) agents described herein. The first agent may be a polypeptide, small molecule, or an inhibitory polynucleotide. The second agent may be a polypeptide, small molecule, or an inhibitory polynucleotide.
In some embodiments, the agents and/or compositions are delivered locally. The agents and/or compositions (e.g., pharmaceutical compositions) may be administered to a tumor present in the subject. In some embodiments, the agent or pharmaceutical composition is administered with an additional therapeutic agent. In some embodiments, the additional therapeutic agent is a chemotherapeutic agent. Exemplary chemotherapeutic agents include alkylating agents such as thiotepa and cyclophosphamide (Cytoxan™); alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; emylerumines and memylamelamines including alfretamine, triemylenemelamine, triethylenephosphoramide, triethylenethiophosphoramide, and trimemylolomelamine; acetogenins (especially bullatacin and bullatacinone); a camptothecin (including synthetic analogue topotecan); bryostatin; cally statin; CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic analogues); cryptophycins (articularly cryptophycin 1 and cryptophycin 8); dolastatin; duocarmycin (including the synthetic analogues, KW-2189 and CBI-TMI); eleutherobin; pancrati statin; a sarcodictyin;
spongistatin; nitrogen mustards such as chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard;
nitrosoureas such as carmustine, chlorozotocin, foremustine, lomustine, nimustine, ranimustine; antibiotics such as the enediyne antibiotics (e.g., calicheamicin, especially calicheamicin gammall and calicheamicin phili); dynemicin, including dynemicin A;
bisphosphonates, such as clodronate; an esperamicin; as well as neocarzinostatin
chromophore and related chromoprotein enediyne antibiotic chromomophores),
aclacinomysins, actinomycin, authramycin, azaserine, bleomycins, cactinomycin, carabicin, carrninomycin, carzinophilin, chromomycins, dactinomycin, daunorubicin, detorubicin, 6- diazo-5-oxo-L-norleucine, doxorubicin (Adramycin™) (including morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenolic acid, nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti- metabolites such as methotrexate and 5-fluorouracil (5-FU); folic acid analogues such as demopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6- mercaptopurine, thiamiprine, thioguanine; pyrimidine analogues such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine,
floxuridine; androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone; anti-adrenals such as aminoglutethimide, mitotane, trilostane; folic acid replinisher such as frolinic acid; aceglatone; aldophosphamide glycoside;
aminolevulinic acid; eniluracil; amsacrine; hestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elformthine; elliptinium acetate; an epothilone; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidamine; maytansinoids such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidamol; nitracrine; pentostatin; phenamet; pirarubicin; losoxantrone; podophyllinic acid; 2-ethylhydrazide; procarbazine; PSK™;
razoxane; rhizoxin; sizofiran; spirogermanium; tenuazonic acid; triaziquone; 2,2',2"- tricUorotriemylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethane; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol;
pipobroman; gacytosine; arabinoside ("Ara-C"); cyclophosphamide; thiopeta; taxoids, e.g., paclitaxel (Taxol™, Bristol Meyers Squibb Oncology, Princeton, N.J.) and docetaxel (Taxoteret™, Rhone-Poulenc Rorer, Antony, France); chlorambucil; gemcitabine
(Gemzar™); 6-thioguanine; mercaptopurine; methotrexate; platinum analogs such as cisplatin and carboplatin; vinblastine; platinum; etoposide (VP- 16); ifosfamide;
mitroxantrone; vancristine; vinorelbine (Navelbine™); novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeoloda; ibandronate; CPT-11; topoisomerase inhibitor RFS 2000; difluoromethylornithine (DMFO); retinoids such as retinoic acid; capecitabine; and pharmaceutically acceptable salts, acids or derivatives of any of the above. Also included in the definition of "chemotherapeutic agent" are anti -hormonal agents that act to regulate or inhibit hormone action on tumors such as anti-estrogens and selective estrogen receptor modulators (SERMs), including, for example, tamoxifen (including Nolvadex™), raloxifene, droloxifene, 4-hydroxytamoxifen, trioxifene, keoxifene, LY117018, onapristone, and toremifene (Fareston™); inhibitors of the enzyme aromatase, which regulates estrogen production in the adrenal glands, such as, for example, 4(5)-imidazoles, aminoglutethimide, megestrol acetate (Megace™), exemestane, formestane, fadrozole, vorozole (Rivisor™), letrozole (Femara™), and anastrozole (Arimidex™); and anti-androgens such as flutamide, nilutamide, bicalutamide, leuprohde, and goserelin; and pharmaceutically acceptable salts, acids or derivatives of any of the above. In some embodiments, the additional therapeutic agent is an immune checkpoint inhibitor. Immune Checkpoint inhibition broadly refers to inhibiting the checkpoints that cancer cells can produce to prevent or downregulate an immune response. Examples of immune checkpoint proteins are CTLA-4, PD-1, VISTA,
B7-H2, B7-H3, PD-L1, B7-H4, B7-H6, ICOS, HVEM, PD-L2, CD160, gp49B, PIR-B, KIR family receptors, TIM-1, TIM-3, TIM-4, LAG-3, BTLA, SIRPalpha (CD47), CD48, 2B4 (CD244), B7.1, B7.2, ILT-2, ILT-4, TIGIT, HHLA2, butyrophilins, A2aR, and combinations thereof.
As described in detail below, the pharmaceutical compositions and/or agents disclosed herein may be specially formulated for administration in solid or liquid form, including those adapted for the following: (1) oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; or (2) parenteral administration, for example, by subcutaneous, intramuscular, intravenous, intrathecal, intracerebral or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation. Methods of preparing pharmaceutical formulations or compositions include the step of bringing into association an agent described herein with the carrier and, optionally, one or more accessory ingredients. In general, the formulations are prepared by uniformly and intimately bringing into association an agent described herein with liquid carriers, or finely divided solid carriers, or both, and then, if necessary, shaping the product.
Pharmaceutical compositions suitable for parenteral administration comprise one or more agents described herein in combination with one or more pharmaceutically-acceptable sterile isotonic aqueous or non-aqueous solutions, dispersions, suspensions or emulsions, or sterile powders which may be reconstituted into sterile injectable solutions or dispersions just prior to use, which may contain sugars, alcohols, antioxidants, buffers, bacteriostats, solutes which render the formulation isotonic with the blood of the intended recipient or suspending or thickening agents.
Examples of suitable aqueous and non-aqueous carriers which may be employed in the pharmaceutical compositions include water, ethanol, dimethyl sulfoxide (DMSO), polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
Indications
In some aspects, provided herein are methods of treating a cancer by administering to a subject (e.g., to a tumor present in a subject) a composition comprising an agent described herein.
In some embodiments, the methods described herein may be used to treat any cancerous or pre-cancerous tumor. In some embodiments, the cancer includes a solid tumor. Cancers that may be treated by methods and compositions provided herein include, but are not limited to, cancer cells from the bladder, blood, bone, bone marrow, brain, breast (e.g., estrogen receptor (ER)-positive breast cancer, triple negative breast cancer, or HER2 positive breast cancer), colon, esophagus, gastrointestine, gum, head, kidney, liver, lung,
nasopharynx, neck, ovary, prostate, skin, stomach, testis, tongue, or uterus. In addition, the cancer may specifically be of the following histological type, though it is not limited to these: neoplasm, malignant; carcinoma; carcinoma, undifferentiated; giant and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma;
lymphoepithelial carcinoma; basal cell carcinoma; pilomatrix carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma, malignant; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in adenomatous polyp; adenocarcinoma, familial polyposis coli; solid carcinoma; carcinoid tumor, malignant; branchiolo-alveolar adenocarcinoma; papillary adenocarcinoma;
chromophobe carcinoma; acidophil carcinoma; oxyphilic adenocarcinoma; basophil carcinoma; clear cell adenocarcinoma; granular cell carcinoma; follicular adenocarcinoma; papillary and follicular adenocarcinoma; nonencapsulating sclerosing carcinoma; adrenal cortical carcinoma; endometrioid carcinoma; skin appendage carcinoma; apocrine adenocarcinoma; sebaceous adenocarcinoma; ceruminous adenocarcinoma; mucoepidermoid carcinoma; cystadenocarcinoma; papillary cystadenocarcinoma; papillary serous
cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; infiltrating duct carcinoma; medullary carcinoma; lobular carcinoma;
inflammatory carcinoma; mammary paget's disease; acinar cell carcinoma; adenosquamous carcinoma; adenocarcinoma w/squamous metaplasia; malignant thymoma; malignant ovarian stromal tumor; malignant thecoma; malignant granulosa cell tumor; and malignant roblastoma; Sertoli cell carcinoma; malignant leydig cell tumor; malignant lipid cell tumor; malignant paraganglioma; malignant extra-mammary paraganglioma; pheochromocytoma; glomangiosarcoma; malignant melanoma; amelanotic melanoma; superficial spreading
melanoma; malignant melanoma in giant pigmented nevus; epithelioid cell melanoma;
malignant blue nevus; sarcoma; fibrosarcoma; malignant fibrous histiocytoma;
myxosarcoma; liposarcoma; leiomyosarcoma; rhabdomyosarcoma; embryonal
rhabdomyosarcoma; alveolar rhabdomyosarcoma; stromal sarcoma; malignant mixed tumor; mullerian mixed tumor; nephroblastoma; hepatoblastoma; carcinosarcoma; malignant mesenchymoma; malignant brenner tumor; malignant phyllodes tumor; synovial sarcoma; malignant mesothelioma; dysgerminoma; embryonal carcinoma; malignant teratoma;
malignant struma ovarii; choriocarcinoma; malignant mesonephroma; hemangiosarcoma; malignant hemangioendothelioma; kaposi's sarcoma; malignant hemangiopericytoma;
lymphangiosarcoma; osteosarcoma; juxtacortical osteosarcoma; chondrosarcoma; malignant chondroblastoma; mesenchymal chondrosarcoma; giant cell tumor of bone; ewing's sarcoma; malignant odontogenic tumor; ameloblastic odontosarcoma; malignant ameloblastoma;
ameloblastic fibrosarcoma; malignant pinealoma; chordoma; malignant glioma;
ependymoma; astrocytoma; protoplasmic astrocytoma; fibrillary astrocytoma; astroblastoma; glioblastoma; oligodendroglioma; oligodendroblastoma; primitive neuroectodermal;
cerebellar sarcoma; ganglion euroblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumor; malignant meningioma; neurofibrosarcoma; malignant neurilemmoma; malignant granular cell tumor; malignant lymphoma; Hodgkin's disease; Hodgkin's lymphoma; paragranuloma; small lymphocytic malignant lymphoma; diffuse large cell malignant lymphoma; follicular malignant lymphoma; mycosis fungoides; other specified non-Hodgkin's lymphomas; malignant histiocytosis; multiple myeloma; mast cell sarcoma; immunoproliferative small intestinal disease; leukemia; lymphoid leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia; myeloid sarcoma; and hairy cell leukemia.
In some embodiments, the subject has cancer (e.g., breast cancer, such as ER-positive breast cancer). In some embodiments, the cancer comprises a solid tumor. In some embodiments, the tumor is an adenocarcinoma, an adrenal tumor, an anal tumor, a bile duct tumor, a bladder tumor, a bone tumor, a blood born tumor, a brain/CNS tumor, a breast tumor, a cervical tumor, a colorectal tumor, an endometrial tumor, an esophageal tumor, an Ewing tumor, an eye tumor, a gallbladder tumor, a gastrointestinal, a kidney tumor, a laryngeal or hypopharyngreal tumor, a liver tumor, a lung tumor, a mesothelioma tumor, a multiple myeloma tumor, a muscle tumor, a nasopharyngeal tumor, a neuroblastoma, an oral
tumor, an osteosarcoma, an ovarian tumor, a pancreatic tumor, a penile tumor, a pituitary tumor, a primary tumor, a prostate tumor, a retinoblastoma, a Rhabdomyosarcoma, a salivary gland tumor, a soft tissue sarcoma, a melanoma, a metastatic tumor, a basal cell carcinoma, a Merkel cell tumor, a testicular tumor, a thymus tumor, a thyroid tumor, a uterine tumor, a vaginal tumor, a vulvar tumor, or a Wilms tumor.
EXEMPLIFICATION
Ammonia is a ubiquitous byproduct of cancer metabolism, however its fate has remained elusive. Here it is identified that ammonia is not merely a toxic waste product of cancers, but is recycled into central amino acid metabolism to maximize nitrogen utilization. Cancer cells primarily assimilate ammonia via reductive amination catalyzed by glutamate dehydrogenase (GDH), and secondary reactions enable other amino acids, such as proline and aspartate, to directly acquire this nitrogen. It was discovered that metabolic recycling of ammonia fosters accelerated breast cancer proliferation in 2D and 3D breast cancer culture models. In vivo, ammonia accumulates in the tumor microenvironment, and can be directly utilized to generate amino acids. Taken together, these data reorient the dogma that ammonia is a secreted waste product and for the first time highlights its role as a
fundamental nitrogen source that can support tumor biomass.
Glutamine is considered the "nitrogen reservoir" for cancer cells due to its anabolic role in nucleotide production. However, the role of glutamine as a nitrogen reservoir is contradicted in catabolic glutamine metabolism, since nitrogen is liberated as the by-product ammonia. Importantly, the fate of ammonia in tumor metabolism has never been determined. It was hypothesized that this ammonia may be re-assimilated into central metabolism to maximize the efficiency of nitrogen utilization. In this study, it was sought to elucidate the fate of ammonia in cancer as 1) a toxic waste product or 2) a biosynthetic metabolite (Figure 1, Part A).
Mammals possess three enzymes capable of overcoming the thermodynamic hurdles of ammonia assimilation: carbamoyl phosphate synthetase I (CPS1), the ATP-dependent, rate- limiting step of the urea cycle, glutamate dehydrogenase (GDH), a NAD(P)H-dependent enzyme that catalyzes reductive amination of a-ketoglutarate, and glutamine synthetase (GS), which catalyzes the ATP-dependent amination of glutamate to generate glutamine
(Figure 5, Part A). Bioinformatic analysis of patient data from The Cancer Genome Atlas of RNA levels for the ammonia assimilating enzymes in healthy compared to cancerous tissues revealed that GS and GDH expression were significantly increased across multiple cancer
subtypes (Figure 2, Part B & Figure 5, Part B). Moreover, CPS1, which is normally expressed in the liver, was not induced in many cancer subtypes. Of note, breast cancers displayed increased expression of both GS and GDH compared to healthy breast tissue. Specifically, ER positive breast cancers induced GS and GDH compared to other subtypes. Therefore, ER positive breast cancer was used as a representative model to probe for ammonia assimilation.
To investigate the fate of glutamine-derived ammonia, a metabolic tracing analysis was performed using a targeted hydrophilic interaction liquid chromatography coupled to mass spectrometry (HILIC-MS) method and assessed the fate of 15N(amide)-glutamine, which liberates 15 H3 via glutaminase activity. To identify the metabolic derivatives of
15N(amide)-glutamine in an unbiased manner, a method was developed to screen the nitrogen metabolome, which contained 211 15N-isomers (Table 1, see below).
Table 1: Comprehensive List of 15N-isomers in "Nitrogen Scanning" Method.
15N-Isotopes
2-aminoadipate M+l
2-aminoisobutyric acid M+l
Acetyl-glycine M+l
Acetylcholine M+l
Adenine M+l
Adenine M+2
Adenine M+3
Adenine M+4
Adenine M+5
adenylosuccinate M+l
adenylosuccinate M+2
adenylosuccinate M+3
adenylosuccinate M+4
adenylosuccinate M+5
ADM A M+l
ADMA M+2
ADMA M+3
ADMA M+4
Alanine M+l
alpha-glycerophosphocholine M+l
Aminocaproic acid M+l
AMP M+l
AMP M+2
AMP M+3
AMP M+4
AMP M+5
Arginine M+1
Arginine M+2
Arginine M+3
Arginine M+4
Arginosuccinate M+1
Arginosuccinate M+2
Arginosuccinate M+3
Arginosuccinate M+4
Asparagine M+1
Asparagine M+2
Aspartate M+1 betaine M+1
Cadaverdine M+1
Cadaverdine M+2 carnitine M+1
Carnosine M+1
Carnosine M+2
Carnosine M+3
Carnosine M+4
Choline M+1
Citrulline M+1
Citrulline M+2 cmp M+1
cmp M+2
cmp M+3
Creatine M+1
Creatine M+2
Creatine M+3
Creatinine M+1
Creatinine M+2
Creatinine M+3 cystathionine M+1 cystathionine M+2
Cysteine M+1
Cytidine M+1
Cytidine M+2
Cytidine M+3 dihydroorotate M+1 dihydroorotate M+2 dimethylglycine M+1
Folate M+1
Folate M+2
Folate M+3
Folate M+4
Folate M+5
Folate M+6
Folate M+7
Glucosamine M+1 glutamate M+1
Glutamine M+1 Glutamine M+2 glutathione red M+1 glutathione red M+2 glutathione red M+3 glycholate M+1 Glycine M+1
GMP M+1
GMP M+2
GMP M+3
GMP M+4
GMP M+5
Guanidoacetic acid M+1 Guanidoacetic acid M+2 Guanidoacetic acid M+3 Guanine M+1
Guanine M+2
Guanine M+3
Guanine M+4
Guanine M+5
Guanosine M+1 Guanosine M+2 Guanosine M+3 Guanosine M+4 Guanosine M+5 hippurate M+1
Histamine M+1 Histamine M+2
Histamine M+3
Histidine M+1
Histidine M+2
Histidine M+3
Homocysteine M+1 homocystine M+1 homocystine M+2 Homoserine m+1 IMP M+1
IMP M+2
IMP M+3
IMP M+4
Indoleacetic Acid M+1 Inosine M+1
Inosine M+2
Inosine M+3
Inosine M+4
Isoleucine M+1 kynurenic acid M+1 Leucine M+1
Lysine M+1
Lysine M+2
Methionine M+2
Methionine Sulfoxide M+1 N-acetylglutamine M+1 N-acetylglutamine M+2 N-acetylleucine M+1 N-acetylputrescine M+1 N-acetylputrescine M+2 N-acetyl tryptophan M+1 N-acetyltryptophan M+2 N6-acetyllysine M+1 N6-acetyllysine M+2 NAD M+1
NAD M+2
NAD M+3
NAD M+4
NAD M+5
NAD M+6
NAD M+7
Niacinamide M+1
Niacinamide M+2 nicotinate M+1
NMMA M+1
NMMA M+2
NMMA M+3
NMMA M+4
Ornithine M+1
Ornithine M+2
p-methylhippuric acid M+1 pantothenate M+1 phenylacetylglycine M+1 phenylalanine M+1 Phosphocholine m+1
phosphocreatine M+1 phosphocreatine M+2 phosphocreatine M+3 phosphoethanolamine M+1 Proline M+1
Putrescine M+1
Putrescine M+2
Pyridoxine M+1
pyroglutamic acid M+1 quinolinate M+1
Sarcosine M+1
SDMA M+1
SDMA M+2
SDMA M+3
SDMA M+4
Serine M+1
Spermidine M+1
Spermidine M+2
Spermidine M+3
Spermine M+1
Spermine M+2
Spermine M+3
Spermine M+4
Taurine M+1
Theronine M+1
Thymine M+1
Thymine M+2
Tryptophan M+1
Tryptophan M+2
UDP-galactose/glucose M+1 UDP-galactose/glucose M+2 ump m+1
UMP M+2
Uracil M+1
Uracil M+2
Urate M+1
Urate M+2
Urate M+3
Urate M+4
Uric Acid M+2
Uric Acid M+3
Urica Acid M+1
Urica Acid M+4
Uridine M+1
Uridine M+2
Valine M+l
xanthine M+l
xanthine M+2
xanthine M+3
xanthine M+4
XMP M+1
XMP M+2
XMP M+3
XMP M+4
Nitrogen abundant metabolites screened for in nitrogen scanning. M+l indicates a single 15N-mass shift, M+2 indicates two 15N-mass shifts, M+3 indicates three 15N-mass shifts, M+4 indicates four 15N-mass shifts, M+5 indicates five 15N-mass shifts, M+6 indicates six 15N-mass shifts, M+7 indicates seven 15N-mass shifts.
The majority of the nitrogen metabolome did not acquire 15N-labeling; of 211 15N- isomers, only 33 metabolites were labeled (Figure 1, Part C & Figure 6). Consistent with previous studies, 15N-(amide)-glutamine was incorporated into asparagine and nucleotides (Figure 1, Part D & fig. Figure 7, Part A). Unexpectedly, 15N-isomers of proline, aspartate were identified, branched chain amino acids and glutamate, which have no previous biosynthetic connection to the amide-nitrogen on glutamine (Figure 1, Part D & Figure 7, Part B). The labeled nitrogen is liberated as ammonia prior to the production of these metabolites, suggesting that an ammonia recycling pathway may be critical for synthesis of these novel glutamine derivatives.
To test whether ammonia released during glutaminolysis was necessary for production of these unanticipated amide-nitrogen glutamine derivatives, cells were treated with the glutaminase inhibitor BPTES (Figure 8, Parts A-C). BPTES treatment significantly decreased 15N-isomers of glutamate, proline and aspartate, while metabolites involved in direct glutamine metabolism such as nucleotides and asparagine remained labeled (Figure 1, Part E & Figure 8, Part D). Importantly, addition of ammonia to BPTES-treated cells rescued steady-state levels of metabolites depleted by glutaminase inhibition, demonstrating the specific contribution of ammonia (Figure 1, Part F).
Next, the potential mechanisms underlying assimilation of ammonia liberated during glutaminolysis were examined. As 15N-(amide)-glutamine did not elicit any isotopes of the urea cycle intermediates ornithine, citrulline, arginosuccinate and arginine, CPS1 was ruled out as a mechanism for ammonia assimilation (Figure 6). These data suggested that GDH
was the primary point of ammonia assimilation because glutamate is upstream of proline, aspartate, glutamine and branched chain amino acid synthesis. However, the Km of ammonia in GDH is high (sub-mM) and GDH was reported to chiefly favor oxidative deamination over reductive amination in cancer cells. By contrast, GDH-catalyzed reductive amination is prevalent in the liver, where there is a sufficient concentration of ammonia to enable this direction of catalytic activity. It was postulated that elevated levels of ammonia in the tumor microenvironment may likewise be permissive of GDH-catalyzed reductive amination.
To determine if GDH assimilates ammonia generated by glutamine catabolism, stable shRNA-mediated GDH knockdown cells were cultured with 15N-(amide)-glutamine and subjected to nitrogen metabolome scanning. 15N-isomers of glutamate and downstream metabolites (proline, aspartate) were significantly decreased in GDH knockdown cells compared to controls (Figure 1, Part G). Importantly, urea cycle intermediates (citrulline, arginosuccinate) remained unlabeled in GDH knockdown cells, underscoring the specificity and lack of CPS 1 -mediated ammonia assimilation in breast cancer cells (Figure 1, Part G).
Next, the efficiency of ammonia recycling from glutamine catabolism by incubating
MCF7 cells with 15N2-13Cs glutamine. A reaction of glutaminolysis generated 15N-13Cs- glutamate (glutamate M+6), and a reaction of ammonia recycling was measured by 15N- glutamate (glutamate M+l) (Figure 9, Part A). The ratio of total glutamate (glutamate M+6 + glutamate M+l) to reactions of glutaminolysis (glutamate M+6) (Figure 9, Part B) was calculated. In total, 1.57 molecules of glutamate were generated from a single reaction of glutaminolysis, suggesting a 57% efficiency of ammonia recycling (Figure 9, Part C). Since both processes are mitochondrial, the localization may play a significant role in this high efficiency. In sum, these data support the model that ammonia derived from glutaminolysis is recycled via reductive amination
As numerous reactions generate ammonia beyond glutaminolysis, it was investigated whether free ammonia could be assimilated into metabolic pathways. To optimize NH l for tracing studies, it was investigated whether increasing levels of ammonium chloride (NH l) induced cytotoxicity in tumor cells. Physiological concentrations of ammonia range between 0-50μΜ in healthy adults, 50-150μΜ in newborns, and up to l .OmM in patients with hyperammonemia. Supraphysiological levels of ammonia are toxic to neurons, fueling the dogma that ammonia may also be toxic to tumor cells. Surprisingly, NH4C1 was not cytotoxic to tumor cells even at a concentration of 50 mM, contrasting the toxicity of ammonia reported for neurons (Figure 2, Part A). Moreover, ammonia concentrations of 0-
10 mM did not alter glucose and glutamine uptake, or basal respiration (Figure 10, Parts A- C). In addition, ammonia did not alter pH of media (Figure 10, Part D).
Taken together, these data suggest that supra-physiological ammonia did not induce toxicity or metabolic stress on breast cancer cells.
Next, ammonia uptake by cells was examined. Notably, when cells were cultured in low concentrations of ammonia (0-1.0 mM) a net output of ammonia was observed, which reverted to net uptake as the culture concentration of NH4CI increased above 1 mM (Figure 10, Part E). At approximately 1.0 mM NH4CI, ammonia was taken up from the media, suggesting that ammonia entry may be regulated by diffusion. In agreement, the
characterized mechanism of ammonium (NH4+) import and export is via facilitated diffusion through RhC and RhG proteins. Also, ammonia (NH3) can freely diffuse across the plasma membrane.
Based on the above characterization, a steady-state and tracing experiments was performed in the presence of 0.75 mM NH4CI. An unbiased pathway analysis was performed on the steady-state metabolites with or without ammonia using MetaboAnalyst 3.0 (Figure. 11, Part A). The most significantly altered pathways were glutamate, aspartate and alanine metabolism. In addition, NH4CI elicited a signature of increased transaminase activity, whereby ketoacids decrease and subsequent amino acids increase (Figure 2, Parts B- C). Although non-essential amino acids increased, the abundance of other amino acids remain unchanged by ammonia, suggesting ammonia did not universally affect amino acid metabolism (Figure 11, Part B). In addition, ammonia did not alter the abundance of metabolites from the urea cycle and nucleotides, suggesting it may not affect synthesis or turnover of these metabolites (Figure 11, Parts C-D).
To evaluate the metabolic fate of ammonia, cell lines were treated with 15NH4C1 and scanned for 15N-isomers (Figure 12). Consistent with glutamine-derived ammonia, 15N- labeling was found on glutamate and downstream metabolites, such as proline and aspartate (Figure 2, Part D & Figure 13, Part A). A striking 8% of the glutamate pool was labeled, implying an important role for ammonia assimilation in glutamate metabolism in cancer, as glutamate exists near sub-millimolar levels.
Consistent with steady-state data, all of the amino acids labeled were generated through glutamate-dependent transaminase reactions, except proline and glutathione, which are made in direct synthetic pathways from glutamate (Figure 13, Part B). Other nitrogen- abundant metabolites, particularly urea cycle intermediates, and essential amino acids were
not labeled by ammonia (Figure 12). Furthermore, in spite of ammonia generating N- isomers of glutamine, there were no isomers identified on any nucleotides.
A time course of 15NH4C1 tracing revealed that ammonia was rapidly converted into glutamate and was the first metabolite to reach steady-state (Figure 13, Parts C-F). This suggests that ammonia is primarily assimilated to generate glutamate and other labeled metabolites are produced in secondary reactions. Therefore, it was investigated which metabolic derivatives of ammonia are GDH-dependent. Indeed, 15ΝΗ40 labeling of glutamate in GDH knockdown cells was substantially depleted, as were 15N-isomers of metabolites downstream of glutamate (Figure 2, Parts E-F). Adaptation via ammonia assimilating enzymes GS or CPSl when GDH was reduced was not observed. In both T47D and MCF7 cells, glutamine and asparagine labeling did not consistently change with GDH knockdown, suggesting that GS may also contribute to ammonia assimilation (Figure 14). Metabolites of the urea cycle were unlabeled in GDH knockdown cells, suggesting adaptive reprogramming of ammonia assimilation into the urea cycle is not important in breast cancer cells (Figure 12). These data suggest a general mechanism by which free ammonia in the tumor microenvironment can be harnessed for biosynthetic pathways.
Ammonia assimilation in yeast has a fundamental role in supporting growth and proliferation. As ammonia was not toxic to tumor cells, it was tested whether ammonia facilitates breast cancer growth and proliferation (Figure 2, Part A). As in yeast, addition of physiological levels of ammonia supported increased proliferation in a panel of breast cancer cell lines (Figure 15, Parts A-B). Moreover, in 3D culture, ammonia stimulates sphere growth and cell proliferation (Figure 3, Parts A-B & Figure 14, Part C). Contrary to breast cancer cells, proliferation in primary human fibroblasts was not changed by ammonia (Figure 16, Part A). Using 15NH4C1 tracing, it was found that fibroblasts centrally assimilated ammonia to generate glutamine (Figure 16, Part B). This observation was in line with their high expression of glutamine synthetase. Moreover, 15N-amide-glutamine tracing revealed that fibroblasts did not recycle glutamine-derived ammonia to generate glutamate, aspartate and proline (Figure 16, Part C). Therefore, it was hypothesized that ammonia assimilation to generate glutamate via GDH was important for its role in increased proliferation observed in breast cancer cells. In agreement, GDH knockdown prevented the accelerated growth when treated with ammonia, consistent with the idea that derivatives of glutamate, such as proline, aspartate and glutathione benefit proliferation and tumorigenesis (Figure 3, Part C).
To assess the effect of tumor-generated ammonia on growth and proliferation, the ability of cancer cells to grow in 3D culture was compared with daily media change or in conditioned media, in which media was changed every 3 days allowing ammonia to accumulate (Figure 3, Parts D-E). It was observed that conditioned media provided a robust growth advantage for breast cancer cells. Moreover, ammonia accumulated in conditioned media 3 -fold compared to daily media change (Figure 3, Part E). Therefore, it was tested whether ammonia recycling via GDH is a critical aspect of the conditioned media benefit. Of note, GDH knockdown cells had no growth defect in conditions of daily media change, while the growth advantage of conditioned media was abrogated by GDH knockdown (Figure 17, Part A-C & Figure 3, Part F). Furthermore, GDH knockdown cells secreted more ammonia into the media, consistent with the idea that ammonia recycling was impaired (Figure 3, Part G).
To examine the physiological relevance of ammonia in the tumor microenvironment in vivo, the levels of ammonia that accumulated were measured in the interstitial fluids of ER(+) xenograft tumors (Figure 4A). Consistent with a previous report finding elevated ammonia in cancer, ER(+) xenografts accumulated ~2 mM ammonia in the interstitial fluids of the tumor microenvironment, compared with plasma ammonia levels of 300 mM (Figure 4, Part A). Plasma ammonia levels of mice harboring tumors was not different than control mice (Figure 18, Part A). Intriguingly, 3 mM ammonia was observed to be sufficient to stimulate proliferation in vitro in 3D cultures (Figure 4, Part B).
Next, it was assessed if the accumulating ammonia in the tumor microenvironment was assimilated into metabolic pathways in vivo. Mice harboring subcutanenous T47D breast tumors were IP injected with 15NH4C1 and the tumor, liver, and plasma were assessed for 15N-isomers on a time course of 1-4 hours (Figure 18, Part B). It was observed that the liver and tumor accessed distinct metabolic pathways for ammonia assimilation (Figure 4, Part C, Figure 19, and Figure 20, Part A). The liver rapidly sequestered the ammonia into the urea cycle, leading to labeled ornithine, citrulline, arginosuccinate, and arginine.
Although these labeled intermediates of the urea cycle were identified in the plasma, they were undetectable in the tumor, validating that these tumors did not engage the urea cycle for ammonia assimilation in vivo. Proline, which was identified in vitro as a metabolic derivative of ammonia, was also labeled in the tumor in vivo. The metabolic pathway enabling proline labeling is likely a tumor autonomous pathway, as proline was not labeled
in the liver or detected in the blood. Similarly, aspartate synthesis from ammonia in vivo appeared tumor autonomous (Figure 4, Part C).
It was observed that glutamine and glutamate labeling in the tumor. Since labeled glutamine and glutamate are also found in the liver and plasma, it is indistinguishable whether these 15N-isomers can be generated in a tumor autonomous manner. Furthermore, the kinetics of glutamine labeling in the tumor implies that a subset of the labeled glutamine pool in the tumor may be taken up from the plasma.
To distinguish systemic contributions of ammonia metabolism from tumor autonomous metabolic pathways were traced 15 H4C1 and 15N-(amide)-glutamine ex vivo (Figure 4, Part D & Figure 21, Part A and B). With 15 H4C1, labeling on glutamate, aspartate, proline and glutamine were recapitulated. Consistent with in vivo studies, the urea cycle intermediates, nucleotides, and other nitrogen-abundant metabolites were not labeled (Figure 4, Part D). These data underscore the fundamental role of ammonia for amino acid synthesis, particularly aspartate and proline in vivo (Figure 4, Part E).
Consistent with in vitro experiments, treatment with 15N-(amide)-glutamine generated glutamate and the downstream metabolites proline and aspartate, suggesting that glutamine-derived ammonia may be recycled in solid tumors (Figure 21, Part B). In contrast to free 15 H4C1 tracing which did not label the urea cycle in cells, in vivo or in solid tumors ex vivo, 15N-(amide)-glutamine treatment ex vivo elicited labeling on the urea cycle intermediate citrulline (Figure 21, Part B). As this finding appears distinct from ammonia metabolism, an alternative-ammonia independent pathway may exist that connects the amide nitrogen on glutamine to citrulline production ex vivo.
Here, it was identified that a fundamental role of ammonia as a nitrogen source in breast cancer metabolism. These findings demonstrate that ammonia is not simply a metabolic waste product, and is recycled to support the high demand for amino acid synthesis in rapidly proliferating cells. Although ammonia is often considered a toxin, herein it is shown that it stimulates growth and proliferation in breast cancer. This stimulatory effect is directly mediated by GDH-catalyzed ammonia assimilation. Furthermore, ammonia accumulates in the tumor microenvironment, and is utilized by cancer cells for amino acid synthesis in vivo. These biosynthetic pathways are supported in both systemic and tumor autonomous metabolism. These findings define ammonia recycling as a critical pathway for sustaining intracellular glutamate pools, which may provide insight into adaptive nodes of tumor metabolism important in the efficacy of therapy.
Materials and Methods
Cell Culture
2D cell culture : All breast cancer cell lines were cultured in Glutamine-Free RPMI (Life Technologies) supplemented with 5% FBS (Life Technologies) and 1% Penicillin and Streptomycin (Invitrogen). 2 mM L-Glutamine (Sigma) was added to the media on the day of the experiment to minimize glutamine degradation and subsequent ammonium
accumulation in stored media. Primary human fibroblasts were cultured in Fibroblast Basal Medium (ATCC) supplemented with Fibroblast Growth Kit-Low serum (ATCC) and 2.0 mM glutamine. Media was changed every 24 hours to minimize ammonium accumulation. Inhibitors and other supplements: 0-50 mM ammonium chloride (Sigma), 1 uM BPTES (Sigma).
3D cell culture: MCF7 and T47D cells that have been adapted to culture conditions for four days were incubated in 8-well glass chamber culture slides (BD Falcon) on a bed of LDEV-free MatriGel (Corning) in RPMI supplemented with 5% FBS, 1%
Penicillin/Streptomycin and 2% MatriGel. Two days after seeding cells, media was replaced in all conditions. For control and ammonium-treated conditions media was changed daily for the duration of the experiment. For studies on conditioned media, media was changed every three days. Images were taken on a Nikon Eclipse TE2000-U Microscope after 8 days or 11 days for MCF7 and T47D cells, respectively. Sphere area was quantified using ImageJ on 200-300 colonies per replicate. Cells were harvested after incubation in Cell Recovery Solution (Corning: 354253) for one hour at 4°C and counted with a Beckman Coulter Counter.
Proliferation Assays: Cell lines were adapted to medium conditions containing 0.0 mM, 0.1 mM, or 0.5 mM NFLCl for four days prior to experimentation. 25,000 cells were seeded in triplicate in 6-well dishes and counted daily for approximately one week on a
Beckman Coulter Counter. Points were fitted to the exponential growth equation Y=Yoe(kX) to obtain the rate constant (k). Then, the equation DT = ln(2)/k was used to calculate doubling time (DT). All growth curves were repeated at least once.
Bioinformatics
Oncomine Database Analysis: Patient data from The Cancer Genome Atlas (TCGA) was analyzed using the 'Cancer Versus Normal' analytical tool on the public database Oncomine. Datasets were filtered for a threshold P-value < 0.0001 and assessed for both
Over-expression Fold-Change and Under-expression Fold-Change in mRNA levels relative to healthy tissue as measured with a Human Genome U133A Array.
Stable shRNA-mediated Knockdowns
Western Blots: Adherent cells were lysed directly on the cell culture dish with lysis buffer (1% NP40, 1 mM DTT, 0.2% phosphatase inhibitor cocktail 2 & 3(Sigma), 1
Complete protease inhibitor tablet (Sigma). Protein content was quantified using a BCA
Assay (Thermo Scientific) and equal amounts of protein were run on a 10-20% Tris-HCl Gel
(BioRad). Protein was transferred overnight (4°C) to a Nitrocellulose membrane (BioRad).
Primary antibodies were used at the following dilutions: GLUD1/2 (Proteintech; 1 : 1000), a-Tubulin (Santa Cruz, 1 : 1000). Secondary antibodies: Anti-rabbit IgG FIRP-linked
Antibody (1 :5000, Cell Signaling), Anti-mouse IgG FIRP-linked Antibody (1 :5000, Cell
Signaling). Blots were developed using Pierce ECL Western Blotting Substrate (Thermo
Scientific) and were exposed using autoradiography film.
Plasmids and Stable Cell Lines: shRNAs against GDH1/2 were subcloned into the pLKO. l puro vector (Addgene Plasmid #8453) at EcoRI and Agel sites: shControl:
sh #l GDH: 5'-
CCGGGCCATTGAGAAAGTCTTCAAACTCGAGTTTGAAGACTTTCTCAATGGCTTT TTG-3 '
sh #2 GDH: 5'-
CCGGCCCAAGAACTATACTGATAATCTCGAGATTATCAGTATAGTTCTTGGGTTT TTG-3'
Subcloned plasmids were transfected into HEK293T cells. MCF7 and T47D cells were subsequently infected with the lentivirus, generating stable GDH knockdown cell lines.
Metabolite Profiling and Tracing Studies
Steady-State Metabolite Extraction: Prior to experimentation, cells were adapted to 0.0 mM NH4CI or 0.75 mM NH4CI for 4 days. MCF7 and T47D were seeded in 6-cm plates at densities that would reach 70% confluence after 24 hours based on their calculated doubling times in each condition. Samples were plated in quadruplicate for metabolite extraction and in quadruplicate for cell count normalization. After 24 hours, cells were
washed once with ice-cold PBS and polar metabolites were extracted directly on the dish using lmL ice-cold 80% methanol.
Glutamine and Ammonia Tracing: Prior to experimentation, cells were adapted to respective media conditions for four days. Following adaptation, cells were seeded in 6-cm plates as previously described. After 24 hours media was replaced with RPMI supplemented with 2 mM L-Glutamine (amide-15N) (Sigma, 98% isotopic purity), or 2 mM L-Glutamine (13Cs, 15N2) (Sigma, 98% isotopic purity), or 0.75 mM 15 H4C1 (Sigma, 98% isotopic purity). Cells were incubated with metabolic isotopes for on a time course (0-12 hours) or for 8 hours and polar metabolites were extracted as previously described.
Mass Spectrometry : Metabolites were isolated in 80% MeOH and analyzed on two distinct methods of hydrophilic interaction liquid chromatography coupled to mass spectrometry (HILIC-MS). In one method, electrospray ionization was tailored to negative- ion mode, and in the second method to positive-ion mode. For negative-ion mode, analytes were eluted in Buffer A (20 mM Ammonium Acetate, 20 mM Ammonium Hydroxide) and Buffer B (10 mM Ammonium Hydroxide in 75:25 Acetonitrile:Methanol). Samples were run on a HILIC silica (3um, 2.1 x 150mm) column (Waters) with a binary flow rate of 0.4mL/min for 10 minutes on linear gradient (95% Buffer B to 0% Buffer B) followed by 2 minutes with (0% Buffer B) and ending with a 2 minute linear gradient (0% Buffer B to 95% Buffer B) and holding (95% Buffer B) for 13 minutes. For positive-ion mode, samples were dried down and reconstituted in a 20:70: 10: acetonitrile: MeOH: water mixture. The buffers were: Buffer A (10 mM Ammonium Formate, 0.1% formic acid in water) and Buffer B (Acetonitrile, 0.1% formic acid). Samples were run on a HILIC silica (3um, 2.1 x 150mm) column (Waters) with a binary flow rate of 0.25mL/min for 10 minutes on linear gradient (95% Buffer B to 40% Buffer B) followed by 4.5 minutes with (40% Buffer B) and ending with a 2 minute linear gradient (40% Buffer B to 95% Buffer B) and holding (95% Buffer B) for 13 minutes. For both ion-modes, a Q Exactive hybrid quadrupole orbitrap mass spectrometer (Thermo Fisher Scientific) with a full-scan analysis over 70-800 m/z and high resolution (70,000) was used for mass detection. A targeted-method developed for 176 compounds (118 on positive and 58 on negative) was used to identify metabolites. A master mix of reference standards for metabolites in the targeted method were run immediately prior to each set of samples, such that their retention times were associated with peaks in the unknown samples run over that same column. Peaks were integrated in Tracefinder 3.3. For tracing studies, masses for 15N-isomers were assessed on every targeted metabolite
containing nitrogen atom(s). To confirm isotope peaks, mass spectrum from control samples (not treated with metabolite isotopes) were scanned for the same 15N-isotopes.
Calculation of Percent Isotope Abundance: All metabolic tracing experiments were performed as previously described. Four replicates were treated with the 15N-isotope of either glutamine or ammonia and four replicates were not treated with the 15N-isotope but kept in biologically equivalent conditions. This untreated control was used to subtract out the natural isotope abundance of 15N-metabolites. Control (untreated) samples were averaged and subtracted out of each treated sample to quantify the abundance of metabolic isotopes above natural abundance after treatment:
Untreated Control
Isotope Treated Sample
Average of four replicates
Ion Count ( +1 ) Ion Count ( +1)
X 100
Ion Cou nt (M+1) + Ion Count Ion Count (M+1) + Ion Count
Metaboanalyst Pathway Analysis: Metabolites were sorted based on their statistical significance (students two-tailed T-Test) on fold-change of relative abundance (normalized peak area) in ammonium-treated cells compared to control. Metabolites altered with the statistical cutoff p<0.05 were submitted to MetaboAnalyst 3.0 Pathway Enrichment Analysis Software.
Metabolic Assays
Respiration: Respiration was assessed using the Seahorse XFe-96 Analyzer
(Seahorse Bioscience). MCF7 and T47D cells were pre-treated for 1 hour in normal media conditions with a dose of ammonium chloride (0 mM-50 mM). Following this incubation, media was changed to a non-buffered, serum-free Seahorse Media (Seahorse Bioscience, Catalog #102353) supplemented with 5 mM glucose, 2 mM L-glutamine, 1 mM sodium pyruvate, and the appropriate ammonium concentration. Oxygen consumption rate (OCR) was measured over a period of 30 minutes, and values were normalized to cell number.
Metabolite Uptake/Secretion Analysis: Glucose and glutamine uptake and lactate and ammonium secretion were assessed using the NOVA BioProfile Flex Analyzer (NOVA Biomedical). Control media (no cells) and cells treated with a dose of ammonium chloride (0 mM-50 mM) were incubated for 24 hours and run on the Bioanalyzer. Values for
glucose, glutamine, lactate and ammonium in the experimental conditions were subtracted from the values in the respective control media and normalized to cell number.
In Vivo Experiments
Xenograft Model: All mouse protocols were approved by the Institutional Animal Care and Use Committee (IACUC) at Harvard University. Female athymic nude mice
(Foxnlnu Nu/J strain # 002019) were obtained from The Jackson Laboratory and housed in the New Research Building Animal Facility at Harvard Medical School. 10 week old mice were injected subcutaneously with six million T47D cells in 50% Hanks' Balanced Salt solution (Sigma H6648) and 50% LDEV-free MatriGel (Corning). To sustain tumor growth, USP approved 17P-estradiol (Sigma El 024) was administered daily using a peroral method. Briefly, mice were fed 56wg/kg/day 17P-estradiol mixed into 60mg of the hazelnut cream Nutella. Tumor growth was measured every 2 days and tumor volume was quantified using the equation: Volume = ( /6)(S2)(L) where S represents the shorter length, and L represents longer length. All experiments were performed on mice with tumors > 100mm3.
In vivo Ammonia Tracing: Mice harboring subcutaneous tumors that are > 100mm3 were injected intraperitoneal with a bolus of NH4C1 (9.0 mmoles/kg) in two 50 iiL injections. For tracing studies, twelve mice were injected with 15ΝΗ40 in Hanks' Balanced Salt solution (Sigma H6648) and sacrificed 1 hour, 2 hours, and 4 hours post-injection. A control mouse was injected with an equivalent amount of NH4CI and sacrificed two hours after injection, a time determined to be the peak of ammonium levels in plasma after ammonium injection. Livers and tumors were excised, flash-frozen and powderized. Polar metabolites were extracted from 8mg tissue in 80%MeOH and profiled on LC/MS as previously described. Blood was collected from each mouse via heart puncture into heparin tubes and centrifuged at 1500 x g to separate plasma. Metabolites were extracted from plasma in 1 : 10 (v:v) plasma: 80% MeOH and centrifuged at 10,000 x g for 10 minutes at 4°C. Supernatant was run on LC/MS to profile metabolites as previously described.
Ex vivo Metabolic Tracing: Tumors > 100mm3 were excised and washed with lmL PBS. Tumors were cut in half and incubated in RPMI supplemented with 5% FBS, 1% Pen/Strep and one of the following conditions: 2 mM glutamine only, 2 mM glutamine and 0.75 mM NH4CI, 2 mM 15N-(amide)-glutamine only, or 2 mM glutamine and 0.75 mM 15NH4C1 (38). Incubations took place in a 37°C incubator with ambient 5% CO2 and constant stirring. After incubation, tumors were powderized and metabolites were extracted as previously described.
Isolation of Interstitial Fluids: Interstitial fluid from the tumor microenvironment was isolated using a validated protocol (39). Briefly, tumors >100mm3 were excised, washed with lmL PBS, and blotted dry with a kim wipe. Tumors were cut in half and centrifuged at 400 x g on a Nylon Mesh filter with 20wm pores (EMB catalog #NY2004700). 2-5wL of fluid was isolated from each tumor. Ammonium was immediately measured using a colorimetric assay (Abeam #ab83360).
Ammonia Measurement in Plasma: Plasma was isolated as previously described. Ammonia levels were measured in two distinct assays run in parallel: a colorimetric assay (Abeam #ab83360) and a NADH-dependent spectrophotometric assay (Sigma #AA0100).
Cytotoxicity
Cytotoxicity Assay : Cell viability was assessed using a standard Propidium Iodide and Flow Cytometry protocol (40). Briefly, cells were trypsinized, washed, re-suspended in PBS and treated with lwg/mL Propidium Iodide (Sigma). Samples were run on an LSR II Flow Cytometer (BD Biosciences) and cell populations were gated dependent on fluorescence with a 488nm laser.
Statistical Analysis: Two-tailed student's t-test was used to compare the means among experimental subgroups. All statistical tests had an alpha of 0.05 as the significance threshold. * = P<0.05, ** = P<0.01, *** = P<0.005, **** = PO.001, ***** = PO.0001. Inhibition of Ammonia Assimilation Represses Tumor Growth In Mice
Ammonia (NFb) is a ubiquitous by-product of tumor metabolism, however the fate of
NFb in cancer has never been investigated. It was discovered NFb generated in breast cancer metabolism is efficiently recycled as a re-purposed nitrogen source for amino acid synthesis (Spinelli et al., Science, 2017, hereby incorporated by reference in its entirety). NFb recycling stimulated breast cancer proliferation, and inhibition of assimilation repressed breast cancer proliferation in vitro.
Since NFb was a dominant nitrogen source in vitro, these findings were tested in ER positive breast cancer xenograft mouse models. Tracking the fate of NFb in tumors was enabled by subcutaneous injection of 15NFb. It was found that NFb was a nitrogen donor to amino acids via GDH in vivo (Figure 22, Parts A-C), which is consistent with previously discussed in vitro studies.
Additionally, the effect of NFb was tested on tumor growth and survival in vivo. It was found that, consistent with in vitro previously discussed data demonstrating that ammonia stimulates proliferation through GDH, depletion of GDH in tumors significantly
repressed tumor growth (Figure 22, Part C). Therefore, inhibition of ammonia assimilation is a promising therapeutic target for breast cancer.
Ammonia is Assimilated in Primary Breast Cancer Patients
The relevance of ammonia metabolism in breast cancer patients was investigated by utilizing samples of healthy breast tissue and breast tumors were removed from estrogen receptor positive (ER+) patients and assessed for ammonia metabolism. It was found NH3 accumulated in the tumor microenvironment ~8-fold higher than levels detected in healthy tissue from the same patients (Figure 23, Part A). This demonstrates that ammonia is a critical component of the TME in patients. Next, ex vivo metabolic tracing of 15NH3 was performed on the tumors and identified that ammonia is assimilated to generate glutamate and downstream amino acids (Figure 23, Part B). Together, these data demonstrate that NH3 assimilation is an active source of amino acids in breast cancer patients.
Inhibition of GDH Synergizes with the Glutaminase Inhibitor to Repress Breast Cancer Proliferation
Breast cancer cells rely on glutaminolysis for growth and proliferation.
Pharmacological inhibitors of glutaminase (GLS) are being tested in breast cancer, however, cancer cells are often resistant to the GLS inhibitor, especially in vivo. Since GLS and NH3 assimilation both converge on production of glutamate, it was hypothesized that GDH- mediated NH3 assimilation may be an adaptive mechanism to support glutamate pools in cancer cells with GLS inhibition (Figure 24, Part A). To test this, cells were treated with the GLS inhibitor in the presence or absence of NH3 and measured glutamate levels. NH3 supplementation rescued the levels of glutamate and downstream metabolites compared to GLS inhibition alone (Figure 24, Part B). The synthetic lethality of GDH and GLS inhibition was tested on breast cancer proliferation (Figure 24, Part C). GLS inhibition had no effect on breast cancer growth alone, but in the absence of GDH substantially decreased proliferation (Figure 24, Part D). Therefore, this data demonstrate that ammonia assimilation may be an adaptive mechanism that promotes resistance to GLS inhibition through replenishing glutamate pools.
Incorporation by Reference
All publications, patents, and patent applications mentioned herein are hereby incorporated by reference in their entirety as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference. In case of conflict, the present application, including any definitions herein, will control.
Equivalents
Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments are described herein. Such equivalents are intended to be encompassed by the following claims.
Claims
1. A method of treating or preventing cancer in a subject, comprising administering to the subject a composition comprising an agent that decreases the amount of ammonia in the subject.
2. The method of claim 1, wherein the composition decreases the amount of ammonia in the subject by at least 10%.
3. The method of claim 1 or claim 2, wherein the composition decreases the amount of ammonia in the subject by at least 30%.
4. The method of any one of claims 1 to 3, wherein the composition decreases the amount of ammonia in the subject by at least 50%.
5. The method of any one of claims 1 to 4, wherein the composition decreases the amount of ammonia in the subject by at least 70%.
6. The method of any one of claims 1 to 5, wherein the composition decreases the amount of ammonia in the subject by at least 80%.
7. The method of any one of claims 1 to 6, wherein the composition decreases the amount of ammonia in the subject by at least 90%.
8. A method of treating a tumor in a subject, comprising administering to the subject a composition comprising an agent that decreases the amount of ammonia in the tumor.
9. The method of claim 8, wherein the composition decreases the amount of ammonia in the tumor by at least 20%.
10. The method of claim 8 or claim 9, wherein the composition decreases the amount of ammonia in the tumor by at least 30%.
11. The method of any one of claims 8 to 10, wherein the composition decreases the amount of ammonia in the tumor by at least 50%.
12. The method of any one of claims 8 to 11, wherein the composition decreases the amount of ammonia in the tumor by at least 60%.
13. The method of any one of claims 8 to 12, wherein the composition decreases the amount of ammonia in the tumor by at least 80%.
14. The method of any one of claims 8 to 13, wherein the composition decreases the amount of ammonia in the tumor by at least 90%.
15. The method of any one of claims 8 to 14, wherein the composition decreases the amount of ammonia in the tumor by at least 99%.
16. The method of any one of claims 1 to 15, wherein the agent is a small molecule.
17. The method of any one of claims 1 to 15, wherein the agent is an ammonium scavenger.
18. The method of any one of claims 1 to 15, wherein the agent is a kinase inhibitor.
19. The method of any one of claims 1 to 15, wherein the agent is an ammonium protonator.
20. The method of any one of claims 1 to 15, wherein the agent is a synthetic biotic.
21. The method of any one of claims 1 to 15, wherein the agent is sodium phenyl acetate, sodium benzoate, sodium phenylbutyrate, glycerol phenylbutyrate, SY B1020, VS-01, lactulose, or any combination thereof.
22. The method of any one of the previous claims, wherein the composition is administered to the subject systemically.
23. The method of any one of claims 1 to 22, wherein the composition is administered orally.
24. The method of any one of claims 1 to 22, wherein the composition is administered parenterally.
25. The method of claim 24, wherein the composition is administered intravenously.
26. The method of claim 24, wherein the composition is administered intramuscularly.
27. The method of any one of claims 1 to 21, wherein the composition is administered locally.
28. The method of any one of claims 1 to 27, wherein the composition is administered with an additional agent.
29. The method of claim 28, wherein the additional agent is a chemotherapeutic agent.
30. The method of claim 28, wherein the additional agent is an immune checkpoint inhibitor.
31. The method of any one of claims 28 to 30, wherein the composition and additional agent are administered at the same time.
32. The method of any one of claims 28 to 30, wherein the composition and additional agent are administered sequentially.
33. The method of claim 1, wherein the cancer is breast cancer.
34. The method of claim 33, wherein the breast cancer is ER positive breast cancer.
35. The method of claim 2, wherein the tumor is an adenocarcinoma, an adrenal tumor, an anal tumor, a bile duct tumor, a bladder tumor, a bone tumor, a brain/CNS tumor, a breast tumor, a cervical tumor, a colorectal tumor, an endometrial tumor, an esophageal tumor, an
Ewing tumor, an eye tumor, a gallbladder tumor, a gastrointestinal, a kidney tumor, a laryngeal or hypopharyngreal tumor, a liver tumor, a lung tumor, a mesothelioma tumor, a multiple myeloma tumor, a muscle tumor, a nasopharyngeal tumor, a nueroblastoma, an oral tumor, an osteosarcoma, an ovarian tumor, a pancreatic tumor, a penile tumor, a pituitary tumor, a primary tumor, a prostate tumor, a retinoblastoma, a Rhabdomyosarcoma, a salivary gland tumor, a soft tissue sarcoma, a melanoma, a metastatic tumor, a basal cell carcinoma, a Merkel cell tumor, a testicular tumor, a thymus tumor, a thyroid tumor, a uterine tumor, a vaginal tumor, a vulvar tumor, or a Wilms tumor.
36. The method of claim 35, wherein the tumor is a breast tumor.
37. A method of determining the progression of cancer in a subject comprising:
a) measuring the amount of systemic ammonia in the subject, thereby determining a first measurement of systemic ammonia; and
b) after a period of time, measuring the amount of systemic ammonia in the subject, thereby determining a second measurement of systemic ammonia,
wherein the cancer has progressed if the second measurement is higher than the first measurement.
38. The method of claim 37, the method further comprising measuring the amount of systemic ammonia in the subject to determine a third measurement of systemic ammonia, wherein the cancer has progressed if the third measurement is higher than the second measurement.
39. The method of claim 37 or claim 38, further comprising administering a composition comprising an agent that decreases the amount of systemic ammonia in the subject.
40. The method of claim 39, wherein the agent is a small molecule.
41. The method of claim 39, wherein the agent is an ammonium scavenger.
42. The method of claim 39, wherein the agent is a kinase inhibitor.
43. The method of claim 39, wherein the agent is an ammonium protonator.
44. The method of claim 39, wherein the agent is a synthetic biotic.
45. The method of claim 39, wherein the agent is sodium phenyl acetate, sodium benzoate, sodium phenylbutyrate, glycerol phenylbutyrate, SY B 1020, VS-01, lactulose, or any combination thereof.
46. The method of any one of claims 39 to 45, wherein the composition is administered intravenously, intramuscularly, orally, or locally.
47. The method of any one of claims 39 to 45, wherein the composition is administered with an additional agent.
48. The method of claim 47, wherein the additional agent is a chemotherapeutic agent.
49. The method of claim 47, wherein the additional agent is an immune checkpoint inhibitor.
50. A method of determining the progression of a tumor in a subject comprising:
a) measuring the amount of ammonia in the tumor or tumor microenvironment, thereby determining a first measurement of ammonia; and
b) after a period of time, measuring the amount of ammonia in the tumor or tumor microenvironment, thereby determining a second measurement of ammonia,
wherein the tumor has progressed if the second measurement is higher than the first measurement.
51. The method of claim 50, the method further comprising measuring the amount of ammonia in the tumor or tumor microenvironment to determine a third measurement of ammonia, wherein the tumor has progressed if the third measurement is higher than the second measurement.
52. The method of claim 50 or claim 51, further comprising administering a composition comprising an agent that decreases the amount of ammonia in the tumor.
53. The method of claim 52, wherein the agent is a small molecule.
54. The method of claim 52, wherein the agent is an ammonium scavenger.
55. The method of claim 52, wherein the agent is a kinase inhibitor.
56. The method of claim 52, wherein the agent is an ammonium protonator.
57. The method of claim 52, wherein the agent is a synthetic biotic.
58. The method of claim 52, wherein the agent is sodium phenyl acetate, sodium benzoate, sodium phenylbutyrate, glycerol phenylbutyrate, SY B 1020, VS-01, lactulose, or any combination thereof.
59. The method of any one of claims 52 to 58, wherein the composition is administered intravenously, intramuscularly, orally, or locally.
60. The method of any one of claims 52 to 59, wherein the composition is administered with an additional agent.
61. The method of claim 60, wherein the additional agent is a chemotherapeutic agent.
62. The method of claim 60, wherein the additional agent is an immune checkpoint inhibitor.
63. The method of any one of claims 37 to 62, wherein the period of time is 1 week.
64. The method of any one of claims 37 to 62, wherein the period of time is 3 weeks.
65. The method of any one of claims 37 to 62, wherein the period of time is 1 month.
66. The method of any one of claims 37 to 62, wherein the period of time is 3 months.
67. The method of any one of claims 37 to 62, wherein the period of time is 6 months.
68. The method of claim 37, wherein the cancer is breast cancer.
69. The method of claim 68, wherein the cancer is ER positive breast cancer.
70. The method of claim 50, wherein the tumor is an adenocarcinoma, an adrenal tumor, an anal tumor, a bile duct tumor, a bladder tumor, a bone tumor, a brain/CNS tumor, a breast tumor, a cervical tumor, a colorectal tumor, an endometrial tumor, an esophageal tumor, an Ewing tumor, an eye tumor, a gallbladder tumor, a gastrointestinal, a kidney tumor, a laryngeal or hypopharyngreal tumor, a liver tumor, a lung tumor, a mesothelioma tumor, a multiple myeloma tumor, a muscle tumor, a nasopharyngeal tumor, a nueroblastoma, an oral tumor, an osteosarcoma, an ovarian tumor, a pancreatic tumor, a penile tumor, a pituitary tumor, a primary tumor, a prostate tumor, a retinoblastoma, a Rhabdomyosarcoma, a salivary gland tumor, a soft tissue sarcoma, a melanoma, a metastatic tumor, a basal cell carcinoma, a Merkel cell tumor, a testicular tumor, a thymus tumor, a thyroid tumor, a uterine tumor, a vaginal tumor, a vulvar tumor, or a Wilms tumor.
71. The method of claim 70, wherein the tumor is a breast tumor.
72. A method of treating cancer in a subject, comprising administering to the subject a first agent that inhibits the expression or activity of glutaminase and a second agent that inhibits the expression or activity of glutamate dehydrogenase.
73. A method of treating a tumor in a subject, comprising administering to the subject a first agent that inhibits the expression or activity of glutaminase and a second agent that inhibits the expression or activity of glutamate dehydrogenase.
74. The method of claim 72 or claim 73, wherein the first agent is a polypeptide.
75. The method of claim 72 or claim 73, wherein the second agent is a polypeptide.
76. The method of claim 72 or claim 73, wherein the first agent is a small molecule.
77. The method of claim 72 or claim 73, wherein the second agent is a small molecule.
78. The method of claim 72 or claim 73, wherein the first agent is an inhibitory polynucleotide.
79. The method of claim 72 or claim 73, wherein the second agent is an inhibitory polynucleotide.
80. The method of claim 78 or claim 79, wherein the inhibitory polynucleotide is selected from the group consisting of siRNA, shRNA, and an antisense RNA molecule, or a polynucleotide that encodes a molecule selected from the group consisting of siRNA, shRNA, and/or an antisense RNA molecule.
81. The method of any one of claims 72 to 80, wherein the first agent is administered to the subject systemically.
82. The method of any one of claims 72 to 80, wherein the second agent is administered to the subject systemically.
83. The method of any one of claims 72 to 80, wherein the first agent is administered intravenously.
84. The method of any one of claims 72 to 80, wherein the second agent is administered intravenously.
85. The method of any one of claims 72 to 80, wherein the first agent is administered subcutaneously.
86. The method of any one of claims 72 to 80, wherein the second agent is administered subcutaneously.
87. The method of any one of claims 72 to 80, wherein the first agent is administered intramuscularly.
88. The method of any one of claims 72 to 80, wherein the second agent is administered intramuscularly.
89. The method of any one of claims 72 to 80, wherein the first agent is administered orally.
90. The method of any one of claims 72 to 80, wherein the second agent is administered orally.
91. The method of any one of claims 72 to 80, wherein the first agent is administered locally.
92. The method of any one of claims 72 to 80, wherein the second agent is administered locally.
93. The method of any one of claims 72 to 80, wherein the first and second agent are administered at the same time.
94. The method of any one of claims 72 to 80, wherein the first agent and the second agent are administered sequentially.
95. The method of any one of claims 72 to 94, wherein the method further comprises administering an additional agent.
96. The method of claim 95, wherein the additional agent is a chemotherapeutic agent.
97. The method of claim 95, wherein the additional agent is an immune checkpoint inhibitor.
98. The method of claim 72, wherein the cancer is breast cancer.
99. The method of claim 98, wherein the cancer is ER positive breast cancer.
100. The method of claim 73, wherein the tumor is an adenocarcinoma, an adrenal tumor, an anal tumor, a bile duct tumor, a bladder tumor, a bone tumor, a brain/CNS tumor, a breast tumor, a cervical tumor, a colorectal tumor, an endometrial tumor, an esophageal tumor, an Ewing tumor, an eye tumor, a gallbladder tumor, a gastrointestinal, a kidney tumor, a laryngeal or hypopharyngreal tumor, a liver tumor, a lung tumor, a mesothelioma tumor, a multiple myeloma tumor, a muscle tumor, a nasopharyngeal tumor, a nueroblastoma, an oral tumor, an osteosarcoma, an ovarian tumor, a pancreatic tumor, a penile tumor, a pituitary tumor, a primary tumor, a prostate tumor, a retinoblastoma, a Rhabdomyosarcoma, a salivary gland tumor, a soft tissue sarcoma, a melanoma, a metastatic tumor, a basal cell carcinoma, a Merkel cell tumor, a testicular tumor, a thymus tumor, a thyroid tumor, a uterine tumor, a vaginal tumor, a vulvar tumor, or a Wilms tumor.
101. A composition comprising a first agent that inhibits the expression or activity of glutaminase and a second agent that inhibits the expression or activity of glutamate dehydrogenase.
102. The composition of claim 101, wherein the first agent is a polypeptide.
103. The composition of claim 101, wherein the second agent is a polypeptide.
104. The composition of claim 101, wherein the first agent is a small molecule.
105. The composition of claim 101, wherein the second agent is a small molecule.
106. The composition of claim 101, wherein the first agent is an inhibitory polynucleotide.
107. The composition of claim 101, wherein the second agent is an inhibitory
polynucleotide.
108. The composition of claim 106 or 107, wherein the inhibitory polynucleotide is selected from the group consisting of siRNA, shRNA, and an antisense RNA molecule, or a polynucleotide that encodes a molecule selected from the group consisting of siRNA, shRNA, and/or an antisense RNA molecule.
109. A method of treating cancer in a subject comprising administering to the subject a composition of any one of claims 101 to 108.
110. A method of treating a tumor in a subject comprising administering to the subject a composition of any one of claims 101 to 108.
111. The method of claim 109 or 110, wherein the composition is administered to the subject systemically, intravenously, intramuscularly, orally, or locally.
112. The method of any one of claim 109 to 111, further comprising administering an additional agent.
113. The method of claim 112, wherein the additional agent is a chemotherapeutic agent.
114. The method of claim 112, wherein the additional agent is an immune checkpoint inhibitor.
115. The method of claim 109, wherein the cancer is breast cancer.
116. The method of claim 115, wherein the breast cancer is ER positive breast cancer.
117. The method of claim 110, wherein the tumor is an adenocarcinoma, an adrenal tumor, an anal tumor, a bile duct tumor, a bladder tumor, a bone tumor, a brain/CNS tumor, a breast tumor, a cervical tumor, a colorectal tumor, an endometrial tumor, an esophageal tumor, an Ewing tumor, an eye tumor, a gallbladder tumor, a gastrointestinal, a kidney tumor, a laryngeal or hypopharyngreal tumor, a liver tumor, a lung tumor, a mesothelioma tumor, a multiple myeloma tumor, a muscle tumor, a nasopharyngeal tumor, a
nueroblastoma, an oral tumor, an osteosarcoma, an ovarian tumor, a pancreatic tumor, a penile tumor, a pituitary tumor, a primary tumor, a prostate tumor, a retinoblastoma, a Rhabdomyosarcoma, a salivary gland tumor, a soft tissue sarcoma, a melanoma, a metastatic tumor, a basal cell carcinoma, a Merkel cell tumor, a testicular tumor, a thymus tumor, a thyroid tumor, a uterine tumor, a vaginal tumor, a vulvar tumor, or a Wilms tumor.
118. The method of claim 117, wherein the tumor is a breast tumor.
119. A method of preventing or treating chemotherapeutic drug resistance in a subject, comprising administering to the subject an agent that reduces the amount of ammonia in the subject and a chemotherapeutic agent.
120. A method of preventing or treating immunotherapy resistance in a subject, comprising administering to the subject an agent that reduces the amount of ammonia in the subject and an immunotherapeutic agent.
121. A method of preventing or treating chemotherapeutic drug resistance in a subject, comprising administering to a tumor in the subject an agent that reduces the amount of ammonia in the subject and a chemotherapeutic agent.
122. A method of preventing or treating immunotherapy resistance in a subject, comprising administering to a tumor in the subject an agent that reduces the amount of ammonia in the subject and an immunotherapeutic agent.
123. The method of claim 120 or claim 122, wherein the immunotherapeutic agent is an immune checkpoint inhibitor.
124. The method of anyone of claims 119 to 123, wherein the subject has cancer.
125. The method of claim 124, wherein the subject has breast cancer.
126. The method of claim 125, wherein the subject has ER positive breast cancer.
127. The method of any one of claims 119 to 126, wherein the agent is a small molecule.
128. The method of any one of claims 119 to 126, wherein the agent is an ammonium scavenger.
129. The method of any one of claims 119 to 126, wherein the agent is a kinase inhibitor.
130. The method of any one of claims 119 to 126, wherein the agent is an ammonium protonator.
131. The method of any one of claims 119 to 126, wherein the agent is a synthetic biotic.
132. The method of any one of claims 119 to 126, wherein the agent is sodium
phenylacetate, sodium benzoate, sodium phenylbutyrate, glycerol phenylbutyrate,
SY B1020, VS-01, lactulose, or any combination thereof.
133. The method of any one of claims 119 to 132, wherein the agent is administered to the subject systemically, orally, parenterally, intravenously, intramuscularly, or locally.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201762471612P | 2017-03-15 | 2017-03-15 | |
| US62/471,612 | 2017-03-15 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2018170234A1 true WO2018170234A1 (en) | 2018-09-20 |
Family
ID=61873997
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2018/022593 Ceased WO2018170234A1 (en) | 2017-03-15 | 2018-03-15 | Methods and compositions for treating cancer |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2018170234A1 (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4460555A (en) | 1983-08-25 | 1984-07-17 | Organon Teknika Corporation | Ammonia scavenger |
| US4650587A (en) | 1982-09-09 | 1987-03-17 | Akzona Incorporated | Ammonia scavenger |
| US8642012B2 (en) | 2008-04-29 | 2014-02-04 | Hyperion Therapeutics, Inc. | Methods of treatment using ammonia-scavenging drugs |
| WO2016085887A1 (en) * | 2014-11-24 | 2016-06-02 | Ucl Business Plc | Treatment of diseases associated with hepatic stellate cell activation using ammonia-lowering therapies |
-
2018
- 2018-03-15 WO PCT/US2018/022593 patent/WO2018170234A1/en not_active Ceased
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4650587A (en) | 1982-09-09 | 1987-03-17 | Akzona Incorporated | Ammonia scavenger |
| US4460555A (en) | 1983-08-25 | 1984-07-17 | Organon Teknika Corporation | Ammonia scavenger |
| US8642012B2 (en) | 2008-04-29 | 2014-02-04 | Hyperion Therapeutics, Inc. | Methods of treatment using ammonia-scavenging drugs |
| WO2016085887A1 (en) * | 2014-11-24 | 2016-06-02 | Ucl Business Plc | Treatment of diseases associated with hepatic stellate cell activation using ammonia-lowering therapies |
Non-Patent Citations (17)
| Title |
|---|
| "Current Protocols in Molecular Biology", 1992, JOHN WILEY & SONS |
| "Guide to Molecular Cloning Techniques", 1987, ACADEMIC PRESS, INC. |
| BERGER; KIMMEL, METHODS IN ENZYMOLOGY, vol. 152 |
| BRIAN J. ALTMAN ET AL: "From Krebs to clinic: glutamine metabolism to cancer therapy", NATURE REVIEWS. CANCER, vol. 16, no. 10, 29 July 2016 (2016-07-29), GB, pages 619 - 634, XP055438168, ISSN: 1474-175X, DOI: 10.1038/nrc.2016.71 * |
| CANE ET AL., SCIENCE, vol. 282, 1998, pages 63 |
| CHAIKEN I. M., CRC CRIT. REV. BIOCHEM., vol. 11, 1981, pages 255 |
| CSIBI ALFREDO ET AL: "The mTORC1/S6K1 Pathway Regulates Glutamine Metabolism through the eIF4B-Dependent Control ofc-MycTranslation", CURRENT BIOLOGY, CURRENT SCIENCE, GB, vol. 24, no. 19, 11 September 2014 (2014-09-11), pages 2274 - 2280, XP029048800, ISSN: 0960-9822, DOI: 10.1016/J.CUB.2014.08.007 * |
| KAISER ET AL., SCIENCE, vol. 243, 1989, pages 187 |
| KAPPLER MATTHIAS ET AL: "Normoxic accumulation of HIF1[alpha] is associated with glutaminolysis", CLINICAL ORAL INVESTIGATIONS, SPRINGER, BERLIN, DE, vol. 21, no. 1, 9 March 2016 (2016-03-09), pages 211 - 224, XP036123254, ISSN: 1432-6981, [retrieved on 20160309], DOI: 10.1007/S00784-016-1780-9 * |
| KENT, S. B. H., ANNU. REV. BIOCHEM., vol. 57, 1988, pages 957 |
| MANIATIS ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR |
| MERRIFIELD, B., SCIENCE, vol. 232, 1986, pages 342 |
| MERRIFIELD, J., J. AM. CHEM. SOC., vol. 91, 1969, pages 501 |
| MIN ET AL: "Biomolecular Interaction Assays Identified Dual Inhibitors of Glutaminase and Glutamate Dehydrogenase That Disrupt Mitochondrial Function and Prevent Growth of Cancer Cells", ANALYTICAL CHEMISTRY, vol. 89, no. 3, 16 January 2017 (2017-01-16), pages 1689 - 1696, XP002782107, DOI: 10.1021/acs.analchem.6b03849 * |
| OFFORD, R. E.: "Semisynthetic Proteins", 1980, WILEY PUBLISHING |
| SPINELLI ET AL., SCIENCE, 2017 |
| YUAN L ET AL: "Abstract 14: Glutamine supports ovarian cancer cell proliferation through modulation of the mTOR/S6 pathway", GYNECOLOGIC ONCOLOGY, vol. 137, no. 3, 28 March 2015 (2015-03-28), pages 596, XP029240786, ISSN: 0090-8258, DOI: 10.1016/J.YGYNO.2015.03.031 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hu et al. | IFNα potentiates anti–PD-1 efficacy by remodeling glucose metabolism in the hepatocellular carcinoma microenvironment | |
| Huang et al. | Guanosine triphosphate links MYC-dependent metabolic and ribosome programs in small-cell lung cancer | |
| Wahl et al. | Glioblastoma therapy can be augmented by targeting IDH1-mediated NADPH biosynthesis | |
| Zhao et al. | Drosha-independent miR-6778–5p strengthens gastric cancer stem cell stemness via regulation of cytosolic one-carbon folate metabolism | |
| EP3500307B1 (en) | Use of vcp inhibitor and oncolytic virus in the preparation of an anti-tumor drug | |
| EP3603678A2 (en) | Collateral gene inactivation biomarkers and targets for cancer therapy | |
| EP4034084B1 (en) | Compositions and methods for treating metastatic gastrointestinal cancer | |
| US20190231761A1 (en) | Compositions and methods for targeting fructose enzymes and transporters for the treatment of cancer | |
| WO2016111991A1 (en) | The protein kinase activity of phosphoglycerate kinase 1 as a target for cancer treatment and diagnosis | |
| WO2017156362A1 (en) | Modulating t cell survival by targeting the one-carbon metabolic pathway | |
| EP3917538B1 (en) | Deoxy- cytidine derivatives for use in cancer therapies | |
| Chen et al. | Blocking M2-like macrophage polarization using decoy oligodeoxynucleotide-based gene therapy prevents immune evasion for pancreatic cancer treatment | |
| US20230000896A1 (en) | Aldh3a2 inhibition and ferroptosis induction for cancer therapy | |
| US20200299783A1 (en) | Molecular signature for selecting lymphoma patients for treatment with ibrutinib | |
| US20210169992A1 (en) | Compositions and methods for inhibiting the production or activity of d-2hydroxyglutarate in subjects afflicted with cancer | |
| Ward et al. | Nutrient profiling reveals extracellular uridine as a fuel for pancreatic cancer through uridine phosphorylase 1 | |
| Qi et al. | Tripartite motif containing 33 demonstrated anticancer effect by degrading c‑Myc: Limitation of glutamine metabolism and proliferation in endometrial carcinoma cells | |
| WO2013083813A2 (en) | Modulators of spermine/spermidine n'-acetyltransferase (ssat) and ssat associated proteins for use in prevention or treatment of rheumatoid arthritis | |
| US20220016205A1 (en) | Methods of overcoming resistance to immune checkpoint inhibitors | |
| US20240374575A1 (en) | Methods and compositions for treating cancer | |
| US11191816B2 (en) | Mutant glyceraldehyde-3-phosphate dehydrogenase (GAPDH) compositions and methods of treating cancer | |
| WO2025219395A1 (en) | Treatment of cancers | |
| US20260022380A1 (en) | Genetic modulators of kras protein expression and their uses | |
| US20240401012A1 (en) | Sgf29 as a target for hox/myc driven cancers | |
| HK40091434B (en) | Deoxy- cytidine derivatives for use in cancer therapies |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18715399 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 18715399 Country of ref document: EP Kind code of ref document: A1 |