WO2018167153A1 - Improved filamentous fungal host cell - Google Patents

Improved filamentous fungal host cell Download PDF

Info

Publication number
WO2018167153A1
WO2018167153A1 PCT/EP2018/056406 EP2018056406W WO2018167153A1 WO 2018167153 A1 WO2018167153 A1 WO 2018167153A1 EP 2018056406 W EP2018056406 W EP 2018056406W WO 2018167153 A1 WO2018167153 A1 WO 2018167153A1
Authority
WO
WIPO (PCT)
Prior art keywords
aspergillus
seq
polypeptide
host cell
sequence identity
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2018/056406
Other languages
French (fr)
Inventor
Jan Lehmbeck
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novozymes AS
Original Assignee
Novozymes AS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novozymes AS filed Critical Novozymes AS
Publication of WO2018167153A1 publication Critical patent/WO2018167153A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93Ligases (6)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1025Acyltransferases (2.3)
    • C12N9/1029Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00Preparation of peptides or proteins
    • C12P21/02Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y121/00Oxidoreductases acting on X-H and Y-H to form an X-Y bond (1.21)
    • C12Y121/03Oxidoreductases acting on X-H and Y-H to form an X-Y bond (1.21) with oxygen as acceptor (1.21.3)
    • C12Y121/03001Isopenicillin-N synthase (1.21.3.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y203/00Acyltransferases (2.3)
    • C12Y203/01Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C12Y203/01164Isopenicillin-N N-acyltransferase (2.3.1.164)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y603/00Ligases forming carbon-nitrogen bonds (6.3)
    • C12Y603/02Acid—amino-acid ligases (peptide synthases)(6.3.2)
    • C12Y603/02026N-(5-Amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase (6.3.2.26)

Definitions

  • the present invention relates to genetically modified improved filamentous fungal cells and to methods for producing such cells as well as methods of producing polypeptides of interest therein.
  • Filamentous fungal host cells are widely employed in the industrial manufacture of polypeptides of interest, such as, enzymes.
  • the host cells are constantly modified to improve an array of characteristics, including, product yield as well as overall production economy.
  • the present invention is directed to genetically modified improved filamentous fungal host cells in which one or more gene involved in synthesis of penicillin G has been inactivated.
  • Inactivation of the one or more gene involved in synthesis of penicillin G may be done by any suitable gene inactivation method known in the art.
  • An example of a convenient way to inactivate one or more gene involved in synthesis of penicillin G is based on the techniques of gene replacement or gene interruption.
  • the inactivation of one or more gene involved in synthesis of penicillin G in a filamentous fungal host cell has several potential benefits, such as, improved product yield of a polypeptide of interest, improved carbon-utilization, reduced fermentation broth viscosity, reduced allergenicity of the fermentation broth due to the absence of any trace amount of penicillin G etc.
  • the invention relates to filamentous fungal host cells comprising a polynucleotide encoding a polypeptide of interest and comprising at least one inactivated gene which in its active form encodes a delta-(L-alpha-aminoadipyl)-L-cysteinyl-D- valine synthetase having at least 80% amino acid sequence identity with SEQ ID NO:2, an isopenicillin-N synthase having at least 80% amino acid sequence identity with SEQ ID NO:4, and/or an isopenicillin N-acyltransferase having at least 80% amino acid sequence identity with SEQ ID NO:6, whereby the host cell is deficient in the production of penicillin.
  • the invention relates to methods of producing a polypeptide of interest, said methods comprising the steps of:
  • a) cultivating a filamentous fungal host cell comprising a polynucleotide encoding a polypeptide of interest and comprising at least one inactivated gene which in its active form encodes a delta-(L-alpha-aminoadipyl)-L-cysteinyl-D-valine synthetase having at least 80% amino acid sequence identity with SEQ ID NO:2, an isopenicillin-N synthase having at least 80% amino acid sequence identity with SEQ ID NO:4, and/or an isopenicillin N-acyltransferase having at least 80% amino acid sequence identity with SEQ ID NO:6, whereby the host cell is deficient in the production of penicillin and, optionally, b) recovering the polypeptide of interest.
  • the invention relates to methods of producing an improved filamentous fungal host cell producing a polypeptide of interest, said method comprising the following steps in no particular order:
  • Figure 1 shows a map of the Aspergillus oryzae penicillin G gene cluster.
  • the grey arrows indicate the three genes aatA (isopenicillin N-acyltransferase); ipnA (isopenicillin-N synthase) and acvA (delta-(L-alpha-aminoadipyl)-L-cysteinyl-D-valine synthetase).
  • the black arrowheads indicate primer locations.
  • ⁇ and ⁇ indicate the deletions tested with indication of the size of the deletion.
  • BglW indicates the location of restriction sites.
  • cDNA means a DNA molecule that can be prepared by reverse transcription from a mature, spliced, mRNA molecule obtained from a eukaryotic or prokaryotic cell. cDNA lacks intron sequences that may be present in the corresponding genomic DNA.
  • the initial, primary RNA transcript is a precursor to mRNA that is processed through a series of steps, including splicing, before appearing as mature spliced mRNA.
  • Coding sequence means a polynucleotide, which directly specifies the amino acid sequence of a polypeptide.
  • the boundaries of the coding sequence are generally determined by an open reading frame, which begins with a start codon such as ATG, GTG, or TTG and ends with a stop codon such as TAA, TAG, or TGA.
  • the coding sequence may be a genomic DNA, cDNA, synthetic DNA, or a combination thereof.
  • control sequences means nucleic acid sequences necessary for expression of a polynucleotide encoding a mature polypeptide of the present invention.
  • Each control sequence may be native (i.e., from the same gene) or foreign (i.e., from a different gene) to the polynucleotide encoding the polypeptide or native or foreign to each other.
  • control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator.
  • the control sequences include a promoter, and transcriptional and translational stop signals.
  • the control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the polynucleotide encoding a polypeptide.
  • expression includes any step involved in the production of a polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
  • Expression vector means a linear or circular DNA molecule that comprises a polynucleotide encoding a polypeptide and is operably linked to control sequences that provide for its expression.
  • host cell means any cell type that is susceptible to transformation, transfection, transduction, or the like with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention.
  • host cell encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication.
  • Isolated means a substance in a form or environment that does not occur in nature.
  • isolated substances include (1 ) any non-naturally occurring substance, (2) any substance including, but not limited to, any enzyme, variant, nucleic acid, protein, peptide or cofactor, that is at least partially removed from one or more or all of the naturally occurring constituents with which it is associated in nature; (3) any substance modified by the hand of man relative to that substance found in nature; or (4) any substance modified by increasing the amount of the substance relative to other components with which it is naturally associated (e.g., recombinant production in a host cell; multiple copies of a gene encoding the substance; and use of a stronger promoter than the promoter naturally associated with the gene encoding the substance).
  • Mature polypeptide means a polypeptide in its final form following translation and any post-translational modifications, such as N-terminal processing, C-terminal truncation, glycosylation, phosphorylation, etc. It is known in the art that a host cell may produce a mixture of two of more different mature polypeptides (i.e., with a different C-terminal and/or N-terminal amino acid) expressed by the same polynucleotide.
  • Mature polypeptide coding sequence means a polynucleotide that encodes a mature polypeptide
  • nucleic acid construct means a nucleic acid molecule, either single- or double-stranded, which is isolated from a naturally occurring gene or is modified to contain segments of nucleic acids in a manner that would not otherwise exist in nature or which is synthetic, which comprises one or more control sequences.
  • operably linked means a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of a polynucleotide such that the control sequence directs expression of the coding sequence.
  • Sequence identity The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter "sequence identity”.
  • sequence identity is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et ai, 2000, Trends Genet. 16: 276-277), preferably version 5.0.0 or later.
  • the parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix.
  • the output of Needle labeled "longest identity" is used as the percent identity and is calculated as follows:
  • sequence identity between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra), preferably version 5.0.0 or later.
  • the parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix.
  • the output of Needle labeled "longest identity" (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:
  • the present invention relates to recombinant host cells comprising a polynucleotide of the present invention operably linked to one or more control sequences that direct the production and secretion of a heterologous polypeptide of interest.
  • a construct or vector comprising a polynucleotide is introduced into a host cell so that the construct or vector is maintained as a chromosomal integrant or as a self-replicating extra- chromosomal vector as described earlier.
  • the term "host cell” encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication. The choice of a host cell will to a large extent depend upon the gene encoding the polypeptide and its source.
  • the host cell may be a fungal cell.
  • "Fungi” as used herein includes the phyla Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota as well as the Oomycota and all mitosporic fungi (as defined by Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK).
  • the fungal host cell of the invention is a filamentous fungal cell.
  • "Filamentous fungi” include all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et al., 1995, supra).
  • the filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic.
  • the filamentous fungal host cell may be an Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or Trichoderma cell.
  • the filamentous fungal host cell may be an Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium merdarium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium zona
  • Fungal cells may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se.
  • Suitable procedures for transformation of Aspergillus and Trichoderma host cells are described in EP 238023, Yelton et ai, 1984, Proc. Natl. Acad. Sci. USA 81 : 1470-1474, and Christensen et al., 1988, Bio/Technology 6: 1419-1422.
  • Suitable methods for transforming Fusarium species are described by Malardier et al., 1989, Gene 78: 147-156, and WO 96/00787.
  • the invention relates to methods of producing an improved filamentous fungal host cell producing a polypeptide of interest, said method comprising the following steps in no particular order:
  • the invention relates to the resulting host cells; filamentous fungal host cells comprising a polynucleotide encoding a polypeptide of interest and comprising at least one inactivated gene which in its active form encodes a delta-(L-alpha-aminoadipyl)-L-cysteinyl-D- valine synthetase having at least 80% amino acid sequence identity with SEQ ID NO:2, an isopenicillin-N synthase having at least 80% amino acid sequence identity with SEQ ID NO:4, and/or an isopenicillin N-acyltransferase having at least 80% amino acid sequence identity with SEQ ID NO:6, whereby the host cell is deficient in the production of penicillin.
  • the least one gene encodes a delta-(L-alpha-aminoadipyl)-L-cysteinyl-D- valine synthetase which has at least 85%, 90%, 95%, 97% or 98% amino acid sequence identity with SEQ ID NO:2, an isopenicillin-N synthase which has at least 85%, 90%, 95%, 97% or 98% amino acid sequence identity with SEQ ID NO:4, and/or an isopenicillin N-acyltransferase which has at least 85%, 90%, 95%, 97% or 98% amino acid sequence identity with SEQ ID NO:6.
  • a delta-(L-alpha-aminoadipyl)-L-cysteinyl-D- valine synthetase which has at least 85%, 90%, 95%, 97% or 98% amino acid sequence identity with SEQ ID NO:2
  • an isopenicillin-N synthase which has at least 85%, 90%, 95%, 97% or 98% amino acid sequence identity
  • the at least one inactivated gene in its active form comprises or consists of a polynucleotide encoding a delta-(L-alpha-aminoadipyl)-L-cysteinyl-D-valine synthetase and having at least 80%, 85%, 90%, 95%, 97% or 98% sequence identity with SEQ ID NO:1 , a polynucleotide encoding an isopenicillin-N synthase and having at least 80%, 85%, 90%, 95%, 97% or 98% sequence identity with SEQ ID NO:3, and/or a polynucleotide encoding an isopenicillin N-acyltransferase and having at least 80%, 85%, 90%, 95%, 97% or 98% sequence identity with SEQ ID NO:5.
  • At least two genes are inactivated which in their active form encodes a delta-(L-alpha-aminoadipyl)-L-cysteinyl-D-valine synthetase having at least 80% amino acid sequence identity with SEQ ID NO:2, an isopenicillin-N synthase having at least 80% amino acid sequence identity with SEQ ID NO:4, and/or an isopenicillin N- acyltransferase having at least 80% amino acid sequence identity with SEQ ID N0:6. Even more preferably all three genes are inactivated.
  • the filamentous fungal host cell is of a genus selected from the group consisting of Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes and Trichoderma; even more preferably the filamentous fungal host cell is an Aspergillus cell; preferably an Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, As
  • the polypeptide of interest is homologous or heterologous; more preferably the homologous or heterologous the polypeptide of interest is an enzyme; preferably the enzyme is a hydrolase, isomerase, ligase, lyase, oxidoreductase, or transferase, e.g., an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase, alpha- galactosidase, beta-galactosidase, glucoamylase, alpha-glucosidase, beta-glucosidase, invertase, laccase, lipase, mannosidase, mutanase,
  • the enzyme
  • polypeptide of interest is a secreted polypeptide.
  • the present invention also relates to nucleic acid constructs comprising a polynucleotide of the present invention operably linked to one or more control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences.
  • the polynucleotide may be manipulated in a variety of ways to provide for expression of the polypeptide. Manipulation of the polynucleotide prior to its insertion into a vector may be desirable or necessary depending on the expression vector. The techniques for modifying polynucleotides utilizing recombinant DNA methods are well known in the art.
  • the control sequence may be a promoter, a polynucleotide that is recognized by a host cell for expression of a polynucleotide encoding a polypeptide of the present invention.
  • the promoter contains transcriptional control sequences that mediate the expression of the polypeptide.
  • the promoter may be any polynucleotide that shows transcriptional activity in the host cell including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell.
  • promoters for directing transcription of the nucleic acid constructs of the present invention in a filamentous fungal host cell are promoters obtained from the genes for Aspergillus nidulans acetamidase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase ⁇ glaA), Aspergillus oryzae TAKA amylase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Fusarium oxysporum trypsin-like protease (WO 96/00787), Fusarium venenatum amyloglucosidase (WO 00/56900), Fusarium venenatum Daria (WO 00/56900), Fusarium venenatum Quinn
  • the control sequence may also be a transcription terminator, which is recognized by a host cell to terminate transcription.
  • the terminator is operably linked to the 3'-terminus of the polynucleotide encoding the polypeptide. Any terminator that is functional in the host cell may be used in the present invention.
  • Preferred terminators for filamentous fungal host cells are obtained from the genes for
  • control sequence may also be an mRNA stabilizer region downstream of a promoter and upstream of the coding sequence of a gene which increases expression of the gene.
  • the control sequence may also be a leader, a nontranslated region of an mRNA that is important for translation by the host cell.
  • the leader is operably linked to the 5'-terminus of the polynucleotide encoding the polypeptide. Any leader that is functional in the host cell may be used.
  • Preferred leaders for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.
  • the control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3'-terminus of the polynucleotide and, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence that is functional in the host cell may be used.
  • Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase Aspergillus oryzae TAKA amylase, and Fusarium oxysporum trypsin-like protease.
  • the control sequence may also be a signal peptide coding region that encodes a signal peptide linked to the N-terminus of a polypeptide and directs the polypeptide into the cell's secretory pathway.
  • the 5'-end of the coding sequence of the polynucleotide may inherently contain a signal peptide coding sequence naturally linked in translation reading frame with the segment of the coding sequence that encodes the polypeptide.
  • the 5'-end of the coding sequence may contain a signal peptide coding sequence that is foreign to the coding sequence.
  • a foreign signal peptide coding sequence may be required where the coding sequence does not naturally contain a signal peptide coding sequence.
  • a foreign signal peptide coding sequence may simply replace the natural signal peptide coding sequence in order to enhance secretion of the polypeptide.
  • any signal peptide coding sequence that directs the expressed polypeptide into the secretory pathway of a host cell may be used.
  • Effective signal peptide coding sequences for filamentous fungal host cells are the signal peptide coding sequences obtained from the genes for Aspergillus niger neutral amylase, Aspergillus niger glucoamylase, Aspergillus oryzae TAKA amylase, Humicola insolens cellulase, Humicola insolens endoglucanase V, Humicola lanuginosa lipase, and Rhizomucor miehei aspartic proteinase.
  • the control sequence may also be a propeptide coding sequence that encodes a propeptide positioned at the N-terminus of a polypeptide.
  • the resultant polypeptide is known as a proenzyme or propolypeptide (or a zymogen in some cases).
  • a propolypeptide is generally inactive and can be converted to an active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide.
  • the propeptide coding sequence may be obtained from the genes for Bacillus subtilis alkaline protease ⁇ aprE), Bacillus subtilis neutral protease ⁇ nprT), Myceliophthora thermophila laccase (WO 95/33836), Rhizomucor miehei aspartic proteinase, and Saccharomyces cerevisiae alpha-factor. Where both signal peptide and propeptide sequences are present, the propeptide sequence is positioned next to the N-terminus of a polypeptide and the signal peptide sequence is positioned next to the N-terminus of the propeptide sequence.
  • regulatory sequences that regulate expression of the polypeptide relative to the growth of the host cell.
  • regulatory sequences are those that cause expression of the gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound.
  • filamentous fungi the Aspergillus niger glucoamylase promoter, Aspergillus oryzae TAKA alpha-amylase promoter, and Aspergillus oryzae glucoamylase promoter, Trichoderma reesei cellobiohydrolase I promoter, and Trichoderma reesei cellobiohydrolase II promoter may be used.
  • Other examples of regulatory sequences are those that allow for gene amplification.
  • these regulatory sequences include the dihydrofolate reductase gene that is amplified in the presence of methotrexate, and the metallothionein genes that are amplified with heavy metals.
  • the polynucleotide encoding the polypeptide would be operably linked to the regulatory sequence.
  • the present invention also relates to recombinant expression vectors comprising a polynucleotide of the present invention, a promoter, and transcriptional and translational stop signals.
  • the various nucleotide and control sequences may be joined together to produce a recombinant expression vector that may include one or more convenient restriction sites to allow for insertion or substitution of the polynucleotide encoding the polypeptide at such sites.
  • the polynucleotide may be expressed by inserting the polynucleotide or a nucleic acid construct comprising the polynucleotide into an appropriate vector for expression.
  • the coding sequence is located in the vector so that the coding sequence is operably linked with the appropriate control sequences for expression.
  • the recombinant expression vector may be any vector (e.g., a plasmid or virus) that can be conveniently subjected to recombinant DNA procedures and can bring about expression of the polynucleotide.
  • the choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced.
  • the vector may be a linear or closed circular plasmid.
  • the vector may be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome.
  • the vector may contain any means for assuring self-replication.
  • the vector may be one that, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated.
  • a single vector or plasmid or two or more vectors or plasmids that together contain the total DNA to be introduced into the genome of the host cell, or a transposon may be used.
  • the vector preferably contains one or more selectable markers that permit easy selection of transformed, transfected, transduced, or the like cells.
  • a selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like.
  • Selectable markers for use in a filamentous fungal host cell include, but are not limited to, adeA (phosphoribosylaminoimidazole-succinocarboxamide synthase), adeB (phosphoribosyl- aminoimidazole synthase), amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (sulfate adenyltransferase), and trpC (anthranilate synthase), as well as equivalents thereof.
  • adeA phosphoribosylaminoimidazole-succinocarboxamide synthase
  • adeB phospho
  • Preferred for use in a Trichoderma cell are adeA, adeB, amdS, hph, and pyrG genes.
  • the selectable marker may be a dual selectable marker system as described in WO 2010/039889.
  • the dual selectable marker is an hph-tk dual selectable marker system.
  • the vector preferably contains an element(s) that permits integration of the vector into the host cell's genome or autonomous replication of the vector in the cell independent of the genome.
  • the vector may rely on the polynucleotide's sequence encoding the polypeptide or any other element of the vector for integration into the genome by homologous or non-homologous recombination.
  • the vector may contain additional polynucleotides for directing integration by homologous recombination into the genome of the host cell at a precise location(s) in the chromosome(s).
  • the integrational elements should contain a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, 400 to 10,000 base pairs, and 800 to 10,000 base pairs, which have a high degree of sequence identity to the corresponding target sequence to enhance the probability of homologous recombination.
  • the integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell. Furthermore, the integrational elements may be non-encoding or encoding polynucleotides. On the other hand, the vector may be integrated into the genome of the host cell by non-homologous recombination.
  • the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question.
  • the origin of replication may be any plasmid replicator mediating autonomous replication that functions in a cell.
  • the term "origin of replication" or "plasmid replicator” means a polynucleotide that enables a plasmid or vector to replicate in vivo.
  • AMA1 and ANSI examples of origins of replication useful in a filamentous fungal cell are AMA1 and ANSI (Gems et ai, 1991 , Gene 98: 61 -67; Cullen et ai, 1987, Nucleic Acids Res. 15: 9163-9175; WO 00/24883). Isolation of the AMA1 gene and construction of plasmids or vectors comprising the gene can be accomplished according to the methods disclosed in WO 00/24883.
  • More than one copy of a polynucleotide of the present invention may be inserted into a host cell to increase production of a polypeptide.
  • An increase in the copy number of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the polynucleotide where cells containing amplified copies of the selectable marker gene, and thereby additional copies of the polynucleotide, can be selected for by cultivating the cells in the presence of the appropriate selectable agent.
  • the present invention also relates to methods of producing a mutant of a parent cell, which comprises inactivating, disrupting or deleting a polynucleotide, or a portion thereof, which results in the mutant cell producing less of the encoded polypeptide than the parent cell when cultivated under the same conditions.
  • the mutant cell may be constructed by reducing or eliminating expression of the polynucleotide or a homologue thereof using methods well known in the art, for example, insertions, disruptions, replacements, or deletions.
  • the polynucleotide is inactivated.
  • the polynucleotide to be modified or inactivated may be, for example, the coding region or a part thereof essential for activity, or a regulatory element required for expression of the coding region.
  • An example of such a regulatory or control sequence may be a promoter sequence or a functional part thereof, i.e., a part that is sufficient for affecting expression of the polynucleotide.
  • Other control sequences for possible modification include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, signal peptide sequence, transcription terminator, and transcriptional activator.
  • Modification or inactivation of the polynucleotide may be performed by subjecting the parent cell to mutagenesis and selecting for mutant cells in which expression of the polynucleotide has been reduced or eliminated.
  • the mutagenesis which may be specific or random, may be performed, for example, by use of a suitable physical or chemical mutagenizing agent, by use of a suitable oligonucleotide, or by subjecting the DNA sequence to PCR generated mutagenesis. Furthermore, the mutagenesis may be performed by use of any combination of these mutagenizing agents.
  • Examples of a physical or chemical mutagenizing agent suitable for the present purpose include ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), O-methyl hydroxylamine, nitrous acid, ethyl methane sulphonate (EMS), sodium bisulphite, formic acid, and nucleotide analogues.
  • UV ultraviolet
  • MNNG N-methyl-N'-nitro-N-nitrosoguanidine
  • EMS ethyl methane sulphonate
  • sodium bisulphite formic acid
  • nucleotide analogues examples include ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), O-methyl hydroxylamine, nitrous acid, ethyl methane sulphonate (EMS), sodium bisulphite, formic acid, and nucleotide ana
  • the mutagenesis is typically performed by incubating the parent cell to be mutagenized in the presence of the mutagenizing agent of choice under suitable conditions, and screening and/or selecting for mutant cells exhibiting reduced or no expression of the gene.
  • Modification or inactivation of the polynucleotide or homologue thereof may be accomplished by insertion, substitution, or deletion of one or more nucleotides in the gene or a regulatory element required for transcription or translation thereof.
  • nucleotides may be inserted or removed so as to result in the introduction of a stop codon, the removal of the start codon, or a change in the open reading frame.
  • modification or inactivation may be accomplished by site-directed mutagenesis or PCR generated mutagenesis in accordance with methods known in the art.
  • the modification may be performed in vivo, i.e., directly on the cell expressing the polynucleotide to be modified, it is preferred that the modification be performed in vitro as exemplified below.
  • An example of a convenient way to eliminate or reduce expression of a polynucleotide is based on techniques of gene replacement, gene deletion, or gene disruption.
  • a nucleic acid sequence corresponding to the endogenous polynucleotide is mutagenized in vitro to produce a defective nucleic acid sequence that is then transformed into the parent cell to produce a defective gene.
  • the defective nucleic acid sequence replaces the endogenous polynucleotide.
  • the defective polynucleotide also encodes a marker that may be used for selection of transformants in which the polynucleotide has been modified or destroyed.
  • the polynucleotide is disrupted with a selectable marker such as those described herein.
  • the polypeptide-deficient mutant cells are particularly useful as host cells for expression of heterologous secreted polypeptides.
  • the methods used for cultivation and purification of the product of interest may be performed by methods known in the art. Methods of Production
  • the host cells are cultivated in a nutrient medium suitable for production of the polypeptide using methods known in the art.
  • the cells may be cultivated by shake flask cultivation, or small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors in a suitable medium and under conditions allowing the polypeptide to be expressed and/or isolated.
  • the cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American Type Culture Collection). If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted, it can be recovered from cell lysates.
  • the polypeptide may be detected using methods known in the art that are specific for the polypeptides. These detection methods include, but are not limited to, use of specific antibodies, formation of an enzyme product, or disappearance of an enzyme substrate. For example, an enzyme assay may be used to determine the activity of the polypeptide.
  • the polypeptide may be recovered using methods known in the art.
  • the polypeptide may be recovered from the nutrient medium by conventional procedures including, but not limited to, collection, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation.
  • a fermentation broth comprising the polypeptide is recovered.
  • the polypeptide may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein Purification, Janson and Ryden, editors, VCH Publishers, New York, 1989) to obtain substantially pure polypeptides.
  • chromatography e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion
  • electrophoretic procedures e.g., preparative isoelectric focusing
  • differential solubility e.g., ammonium sulfate precipitation
  • SDS-PAGE or extraction (see, e.g., Protein Purification, Janson and Ryden, editors, VCH Publishers, New York, 1989)
  • polypeptide is not recovered, but rather a host cell of the present invention expressing the polypeptide is used as a source of the polypeptide.
  • One aspect of the invention relates to methods of producing a polypeptide of interest, said methods comprising the steps of:
  • a) cultivating a filamentous fungal host cell comprising a polynucleotide encoding a polypeptide of interest and comprising at least one inactivated gene which in its active form encodes a delta-(L-alpha-aminoadipyl)-L-cysteinyl-D-valine synthetase having at least 80% amino acid sequence identity with SEQ ID NO:2, an isopenicillin-N synthase having at least 80% amino acid sequence identity with SEQ ID NO:4, and/or an isopenicillin N-acyltransferase having at least 80% amino acid sequence identity with SEQ ID NO:6, whereby the host cell is deficient in the production of penicillin and, optionally, b) recovering the polypeptide of interest.
  • the least one inactivated gene in its active form encodes a delta-(L-alpha- aminoadipyl)-L-cysteinyl-D-valine synthetase which has at least 85%, 90%, 95%, 97% or 98% amino acid sequence identity with SEQ ID NO:2, an isopenicillin-N synthase which has at least 85%, 90%, 95%, 97% or 98% amino acid sequence identity with SEQ ID NO:4, and/or an isopenicillin N-acyltransferase which has at least 85%, 90%, 95%, 97% or 98% amino acid sequence identity with SEQ ID NO:6.
  • a delta-(L-alpha- aminoadipyl)-L-cysteinyl-D-valine synthetase which has at least 85%, 90%, 95%, 97% or 98% amino acid sequence identity with SEQ ID NO:2
  • an isopenicillin-N synthase which has at least 85%, 90%, 95%, 97% or 98% amino
  • the at least one inactivated gene in its active form comprises or consists of a polynucleotide encoding a delta-(L-alpha-aminoadipyl)-L-cysteinyl-D-valine synthetase and having at least 80%, 85%, 90%, 95%, 97% or 98% sequence identity with SEQ ID NO:1 , a polynucleotide encoding an isopenicillin-N synthase and having at least 80%, 85%, 90%, 95%, 97% or 98% sequence identity with SEQ ID NO:3, and/or a polynucleotide encoding an isopenicillin N-acyltransferase and having at least 80%, 85%, 90%, 95%, 97% or 98% sequence identity with SEQ ID NO:5.
  • At least two genes are inactivated which in their active form encode a delta-(L-alpha-aminoadipyl)-L-cysteinyl-D-valine synthetase having at least 80% amino acid sequence identity with SEQ ID NO:2, an isopenicillin-N synthase having at least 80% amino acid sequence identity with SEQ ID NO:4, and/or an isopenicillin N-acyltransferase having at least 80% amino acid sequence identity with SEQ ID NO:6. Even more preferably all three genes are inactivated.
  • the filamentous fungal host cell is of a genus selected from the group consisting of Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes and Trichoderma; even more preferably the filamentous fungal host cell is an Aspergillus cell; preferably an Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus jap
  • the polypeptide of interest is homologous or heterologous; more preferably the homologous or heterologous polypeptide of interest is an enzyme; preferably the enzyme is a hydrolase, isomerase, ligase, lyase, oxidoreductase, or transferase, e.g., an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase, alpha- galactosidase, beta-galactosidase, glucoamylase, alpha-glucosidase, beta-glucosidase, invertase, laccase, lipase, mannosidase, mutanase, oxide,
  • the at least one inactivated gene in its active form comprises or consists of a polynucleotide encoding a delta-(L-alpha-aminoadipyl)-L-cysteinyl-D-valine synthetase and having at least 80% sequence identity with SEQ ID NO:1 , a polynucleotide encoding an isopenicillin-N synthase and having at least 80% sequence identity with SEQ ID NO:3, and/or a polynucleotide encoding an isopenicillin N-acyltransferase and having at least 80% sequence identity with SEQ ID NO:5.
  • PCR amplifications was performed in a volume of 100 microL containing 2.5 units Taq po-lymerase, 100 ng of pS02, 250 nM of each dNTP, and 10 pmol of each of the two primers described above in a reaction buffer of 50 mM KCI, 10 mM Tris-HCI pH 8.0, 1.5 mM MgCI2.
  • Amplification was carried out in a Perkin-Elmer Cetus DNA Termal 480, and consisted of one cycle of 3 minutes at 94°C, followed by 25 cycles of 1 minute at 94°C, 30 seconds at 55°C, and 1 minute at 72°C.
  • A.oryzae mycelia were grown in a rich nutrient broth. The mycelia were separated from the broth by filtration.
  • the enzyme preparation Glucanex ® (Novozymes) was added to the mycelia in osmotically stabilizing buffer such as 1.2 M MgS0 4 buffered to pH 5.0 with sodium phosphate. The suspension was incubated for 60 minutes at 37degrees C with agitation. The protoplast was filtered through mira-cloth to remove mycelial debris. The protoplast was harvested and washed twice with STC (1.2 M sorbitol, 10 mM CaCI 2 , 10 mM Tris-HCI pH 7.5). The protoplasts were finally re-suspended in 200-1000 microl STC.
  • acvA This gene codes for delta-(L-alpha-aminoadipyl)-L-cysteinyl-D-valine synthetase, an enzyme involved in the biosynthesis of penicillin G.
  • ipnA This gene codes for isopenicillin N synthetase, an enzyme involved in the biosynthesis of penicillin G.
  • aatA This gene codes for Isopenicillin N-acyltransferase, an enzyme involved in the biosynthesis of penicillin G.
  • pyrG This gene codes for orotidine-5'-phosphate decarboxylase, an enzyme involved in the biosynthesis of uridine.
  • amdS This gene codes for acetamidase, an enzyme involved in the metabolism of acetamide.
  • pCR-4 Blunt-TOPO is from Invitrogen.
  • Aspergillus oryzae NBRC4177 available from Institute for fermentation, Osaka; 17-25 Juso
  • COIs454 is described in patent WO2012160093, example 16
  • SEQ ID NO:1 DNA sequence of acvA
  • SEQ ID NO:2 Amino acid sequence of AcvA encoded by SEQ ID NO:1
  • SEQ ID NO:3 DNA sequence of ipnA
  • SEQ ID NO:4 Amino acid sequence of IpnA encoded by SEQ ID NO:3
  • SEQ ID NO:5 DNA sequence of aatA
  • SEQ ID NO 3 Amino acid sequence of AatA encoded by SEQ ID NO:5
  • SEQ ID NO 8 Primer oJal_1 14 5 - ccaacagccgactcaggag
  • ligD gene (AO090120000322) involved in non-homologous-end- joining plasmid pJal_1 123 was linearized with Spel and used to transform A. oryzae RUNG237 and transformants were selected on minimal medium supplemented 0.6 mM 5-fluoro-2'- deoxyuridine (FdU) as described in WO 0168864. A number of transformants were re-isolated twice and genomic DNA was prepared. The chromosomal DNA from each of the transformants was digested with Asp718 and analyzed by Southern blotting, using the 1 102 bp 32P-labelled DNA EcoRI - BamHI fragment from pJal_1 123 containing the 5' flanks of the A.
  • the A. oryzae strain Jal_1844 was screened for resistance to 5-flouro-orotic acid (FOA) to identify spontaneous pyrG mutants on minimal plates (Cove D.J. 1966. Biochem. Biophys. Acta. 1 13:51 -56) supplemented with 1 .0 M sucrose as carbon source, 10 mM sodiumnitrate as nitrogen source, and 0.5 mg/ml FOA.
  • FAA 5-flouro-orotic acid
  • One strain, Jal_1877 was identifying as being pyrG minus. JaL1877 is uridine dependent, therefore it can be transformed with the wild type pyrG gene and transformants selected by the ability to grow in the absence of uridine.
  • acvA (AO090038000543; SEQ ID NO:1 encoding SEQ ID NO:2) , ipnA (AO090038000544; SEQ ID NO:3 encoding SEQ ID NO:4) and aatA (AO090038000545; SEQ ID NO: 5 encoding SEQ ID NO:6) are involved in synthesis of penicillin G (penG) which is clustered on chromosome 6 in A. oryzae strains.
  • Fig. 1 shows the orientation of these three 3 genes and location of primers used for PCR amplification of flanks used for deletion of part of the penG gene cluster. First it was tried to deleted the entire penG gene cluster (all three genes, ⁇ in Fig.
  • the 4401 bp deletion includes the first 132 bp (encoding the first 44 amino acids) of the aatA gene, the entire ipnA gene, the first 1515 bp (encoding the first 505 amino acids) of the avcA gene and the promoters for all three genes as indicated in Fig. 1.
  • the strategy used for the deletion is as described in Nielsen M. L. et al. (2006), Efficient PCR-based gene targeting with a recyclable marker for Aspergillus nidulans, Fungal Genetics and Biology vol. 43: 54-64. It was done in the following way:
  • aatA flank and a partially N-terminal pyrG gene was fused by overlap extension PCR of two PCR generated fragments 1 ) an 1418 bp fragment (aatA flank) using primers oJal_565 (SEQ ID NO:9) and oJaL566 (SEQ ID NO:10) on genomic DNA from RUNG237 and 2) an 1 129 bp fragment (encoding part of the A. oryzae pyrG gene) using primers oJal_1 14 (SEQ ID NO:8) and X1 1 1 1 C07 (SEQ ID NO:13) on plasmid pJal_554.
  • the two fragments was mix and PCR amplification with primers oJal_565 and oJal_1 14 was done giving a fragment on 2527 bp, which was purified over a 1 % agarose gel.
  • acvA flank and a partially C-terminal pyrG gene was fused by overlap extension PCR of two PCR generated fragments 1 ) an 2003 bp fragment (acvA flank) using primers oJal_567 (SEQ ID NO:1 1 ) and oJal_568 (SEQ ID NO:12) on genomic DNA from RUNG237 and 2) an 1445 bp fragment (encoding part of the A. oryzae pyrG gene) using primers oJaL1 13 (SEQ ID NO:7) and X1 1 1 1 C08 (SEQ ID NO:14) on plasmid pJal_554.
  • the two fragments was mix and PCR amplification with primers oJal_568 and oJaL1 13 was done giving a fragment on 3428 bp, which was purified over a 1 % agarose gel.
  • the above two fragments (1 ⁇ g of each) was mix and transformed into RUNG237.
  • a number of transformants were re-isolated twice and genomic DNA was prepared.
  • the chromosomal DNA from each of the transformants was digested with Asp718 and analyzed by Southern blotting, using 32P-labelling of the above 1418 bp PCR product containing the aatA flank as the probe. Strains of interest were identified by the disappearance of an 8520 kb Bglll band and the appearance of a 6161 kb Bglll band.
  • One transformant having the above characteristics was named Jal_1898.
  • the A. oryzae strain Jal_1898 was screened for resistance to 5-flouro-orotic acid (FOA) to identify spontaneous pyrG mutants on minimal plates (Cove D.J. 1966. Biochem. Biophys. Acta. 1 13:51 -56) supplemented with 1 .0 M sucrose as carbon source, 10 mM sodiumnitrate as nitrogen source, and 0.5 mg/ml FOA.
  • FAA 5-flouro-orotic acid
  • One strain, Jal_1903 was identifying as being pyrG minus. JaL1903 is uridine dependent, therefore it can be transformed with the wild type pyrG gene and transformants selected by the ability to grow in the absence of uridine.
  • the loss of the pyrG gene was confirmed by Southern blotting analysis, using 32P-labelling of the above 1418 bp PCR product containing the aatA flank as the probe. Strains of interest were identified by the disappearance of a 6161 kb Bglll band and the appearance of a 4554 kb Bglll band. One transformant having the above characteristics was named Jal_1903. This strain can then be used for further gene deletions.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Mycology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to penicillin-inactivated filamentous fungal cells producing a polypeptide of interest and methods of producing a polypeptide of interest in said cells as well as methods of producing said cells.

Description

Improved Filamentous Fungal Host Cell
Reference to sequence listing
This application contains a Sequence Listing in computer readable form. The computer readable form is incorporated herein by reference.
FIELD OF THE INVENTION
The present invention relates to genetically modified improved filamentous fungal cells and to methods for producing such cells as well as methods of producing polypeptides of interest therein.
BACKGROUND OF THE INVENTION
Filamentous fungal host cells are widely employed in the industrial manufacture of polypeptides of interest, such as, enzymes. The host cells are constantly modified to improve an array of characteristics, including, product yield as well as overall production economy.
SUMMARY OF THE INVENTION
The present invention is directed to genetically modified improved filamentous fungal host cells in which one or more gene involved in synthesis of penicillin G has been inactivated. Inactivation of the one or more gene involved in synthesis of penicillin G may be done by any suitable gene inactivation method known in the art. An example of a convenient way to inactivate one or more gene involved in synthesis of penicillin G is based on the techniques of gene replacement or gene interruption.
The inactivation of one or more gene involved in synthesis of penicillin G in a filamentous fungal host cell has several potential benefits, such as, improved product yield of a polypeptide of interest, improved carbon-utilization, reduced fermentation broth viscosity, reduced allergenicity of the fermentation broth due to the absence of any trace amount of penicillin G etc.
Accordingly, in a first aspect, the invention relates to filamentous fungal host cells comprising a polynucleotide encoding a polypeptide of interest and comprising at least one inactivated gene which in its active form encodes a delta-(L-alpha-aminoadipyl)-L-cysteinyl-D- valine synthetase having at least 80% amino acid sequence identity with SEQ ID NO:2, an isopenicillin-N synthase having at least 80% amino acid sequence identity with SEQ ID NO:4, and/or an isopenicillin N-acyltransferase having at least 80% amino acid sequence identity with SEQ ID NO:6, whereby the host cell is deficient in the production of penicillin.
In a second aspect, the invention relates to methods of producing a polypeptide of interest, said methods comprising the steps of:
a) cultivating a filamentous fungal host cell comprising a polynucleotide encoding a polypeptide of interest and comprising at least one inactivated gene which in its active form encodes a delta-(L-alpha-aminoadipyl)-L-cysteinyl-D-valine synthetase having at least 80% amino acid sequence identity with SEQ ID NO:2, an isopenicillin-N synthase having at least 80% amino acid sequence identity with SEQ ID NO:4, and/or an isopenicillin N-acyltransferase having at least 80% amino acid sequence identity with SEQ ID NO:6, whereby the host cell is deficient in the production of penicillin and, optionally, b) recovering the polypeptide of interest.
In a final aspect, the invention relates to methods of producing an improved filamentous fungal host cell producing a polypeptide of interest, said method comprising the following steps in no particular order:
a) transforming a filamentous fungal host cell with a polynucleotide encoding the polypeptide of interest; and
b) inactivating at least one gene which in its active form encodes a delta-(L-alpha- aminoadipyl)-L-cysteinyl-D-valine synthetase having at least 80% amino acid sequence identity with SEQ ID NO:2, an isopenicillin-N synthase having at least 80% amino acid sequence identity with SEQ ID NO:4, and/or an isopenicillin N-acyltransferase having at least 80% amino acid sequence identity with SEQ ID NO:6, whereby the host cell becomes deficient in the production of penicillin.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 shows a map of the Aspergillus oryzae penicillin G gene cluster. The grey arrows indicate the three genes aatA (isopenicillin N-acyltransferase); ipnA (isopenicillin-N synthase) and acvA (delta-(L-alpha-aminoadipyl)-L-cysteinyl-D-valine synthetase). The black arrowheads indicate primer locations. ΔΑ and ΔΒ indicate the deletions tested with indication of the size of the deletion. BglW indicates the location of restriction sites.
DEFINITIONS
cDNA: The term "cDNA" means a DNA molecule that can be prepared by reverse transcription from a mature, spliced, mRNA molecule obtained from a eukaryotic or prokaryotic cell. cDNA lacks intron sequences that may be present in the corresponding genomic DNA. The initial, primary RNA transcript is a precursor to mRNA that is processed through a series of steps, including splicing, before appearing as mature spliced mRNA.
Coding sequence: The term "coding sequence" means a polynucleotide, which directly specifies the amino acid sequence of a polypeptide. The boundaries of the coding sequence are generally determined by an open reading frame, which begins with a start codon such as ATG, GTG, or TTG and ends with a stop codon such as TAA, TAG, or TGA. The coding sequence may be a genomic DNA, cDNA, synthetic DNA, or a combination thereof.
Control sequences: The term "control sequences" means nucleic acid sequences necessary for expression of a polynucleotide encoding a mature polypeptide of the present invention. Each control sequence may be native (i.e., from the same gene) or foreign (i.e., from a different gene) to the polynucleotide encoding the polypeptide or native or foreign to each other. Such control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator. At a minimum, the control sequences include a promoter, and transcriptional and translational stop signals. The control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the polynucleotide encoding a polypeptide.
Expression: The term "expression" includes any step involved in the production of a polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
Expression vector: The term "expression vector" means a linear or circular DNA molecule that comprises a polynucleotide encoding a polypeptide and is operably linked to control sequences that provide for its expression.
Host cell: The term "host cell" means any cell type that is susceptible to transformation, transfection, transduction, or the like with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention. The term "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication.
Isolated: The term "isolated" means a substance in a form or environment that does not occur in nature. Non-limiting examples of isolated substances include (1 ) any non-naturally occurring substance, (2) any substance including, but not limited to, any enzyme, variant, nucleic acid, protein, peptide or cofactor, that is at least partially removed from one or more or all of the naturally occurring constituents with which it is associated in nature; (3) any substance modified by the hand of man relative to that substance found in nature; or (4) any substance modified by increasing the amount of the substance relative to other components with which it is naturally associated (e.g., recombinant production in a host cell; multiple copies of a gene encoding the substance; and use of a stronger promoter than the promoter naturally associated with the gene encoding the substance).
Mature polypeptide: The term "mature polypeptide" means a polypeptide in its final form following translation and any post-translational modifications, such as N-terminal processing, C-terminal truncation, glycosylation, phosphorylation, etc. It is known in the art that a host cell may produce a mixture of two of more different mature polypeptides (i.e., with a different C-terminal and/or N-terminal amino acid) expressed by the same polynucleotide. It is also known in the art that different host cells process polypeptides differently, and thus, one host cell expressing a polynucleotide may produce a different mature polypeptide (e.g., having a different C-terminal and/or N-terminal amino acid) as compared to another host cell expressing the same polynucleotide. Mature polypeptide coding sequence: The term "mature polypeptide coding sequence" means a polynucleotide that encodes a mature polypeptide
Nucleic acid construct: The term "nucleic acid construct" means a nucleic acid molecule, either single- or double-stranded, which is isolated from a naturally occurring gene or is modified to contain segments of nucleic acids in a manner that would not otherwise exist in nature or which is synthetic, which comprises one or more control sequences.
Operably linked: The term "operably linked" means a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of a polynucleotide such that the control sequence directs expression of the coding sequence.
Sequence identity: The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter "sequence identity". For purposes of the present invention, the sequence identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et ai, 2000, Trends Genet. 16: 276-277), preferably version 5.0.0 or later. The parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. The output of Needle labeled "longest identity" (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:
(Identical Residues x 100)/(Length of Alignment - Total Number of Gaps in Alignment)
For purposes of the present invention, the sequence identity between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra), preferably version 5.0.0 or later. The parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix. The output of Needle labeled "longest identity" (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:
(Identical Deoxyribonucleotides x 100)/(Length of Alignment - Total Number of Gaps in Alignment)
DETAILED DESCRIPTION OF THE INVENTION
Host Cells
The present invention relates to recombinant host cells comprising a polynucleotide of the present invention operably linked to one or more control sequences that direct the production and secretion of a heterologous polypeptide of interest. A construct or vector comprising a polynucleotide is introduced into a host cell so that the construct or vector is maintained as a chromosomal integrant or as a self-replicating extra- chromosomal vector as described earlier. The term "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication. The choice of a host cell will to a large extent depend upon the gene encoding the polypeptide and its source.
The host cell may be a fungal cell. "Fungi" as used herein includes the phyla Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota as well as the Oomycota and all mitosporic fungi (as defined by Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK).
The fungal host cell of the invention is a filamentous fungal cell. "Filamentous fungi" include all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et al., 1995, supra). The filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic.
The filamentous fungal host cell may be an Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or Trichoderma cell.
For example, the filamentous fungal host cell may be an Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium merdarium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium zonatum, Coprinus cinereus, Coriolus hirsutus, Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucormiehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Thielavia terrestris, Trametes villosa, Trametes versicolor, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride cell.
Fungal cells may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se. Suitable procedures for transformation of Aspergillus and Trichoderma host cells are described in EP 238023, Yelton et ai, 1984, Proc. Natl. Acad. Sci. USA 81 : 1470-1474, and Christensen et al., 1988, Bio/Technology 6: 1419-1422. Suitable methods for transforming Fusarium species are described by Malardier et al., 1989, Gene 78: 147-156, and WO 96/00787.
In a first aspect, the invention relates to methods of producing an improved filamentous fungal host cell producing a polypeptide of interest, said method comprising the following steps in no particular order:
c) transforming a filamentous fungal host cell with a polynucleotide encoding the polypeptide of interest; and
d) inactivating at least one gene which in its active form encodes a delta-(L-alpha- aminoadipyl)-L-cysteinyl-D-valine synthetase having at least 80% amino acid sequence identity with SEQ ID NO:2, an isopenicillin-N synthase having at least 80% amino acid sequence identity with SEQ ID NO:4, and/or an isopenicillin N-acyltransferase having at least 80% amino acid sequence identity with SEQ ID NO:6, whereby the host cell becomes deficient in the production of penicillin.
In another aspect, the invention relates to the resulting host cells; filamentous fungal host cells comprising a polynucleotide encoding a polypeptide of interest and comprising at least one inactivated gene which in its active form encodes a delta-(L-alpha-aminoadipyl)-L-cysteinyl-D- valine synthetase having at least 80% amino acid sequence identity with SEQ ID NO:2, an isopenicillin-N synthase having at least 80% amino acid sequence identity with SEQ ID NO:4, and/or an isopenicillin N-acyltransferase having at least 80% amino acid sequence identity with SEQ ID NO:6, whereby the host cell is deficient in the production of penicillin.
Preferably, the least one gene encodes a delta-(L-alpha-aminoadipyl)-L-cysteinyl-D- valine synthetase which has at least 85%, 90%, 95%, 97% or 98% amino acid sequence identity with SEQ ID NO:2, an isopenicillin-N synthase which has at least 85%, 90%, 95%, 97% or 98% amino acid sequence identity with SEQ ID NO:4, and/or an isopenicillin N-acyltransferase which has at least 85%, 90%, 95%, 97% or 98% amino acid sequence identity with SEQ ID NO:6.
Preferably the at least one inactivated gene in its active form comprises or consists of a polynucleotide encoding a delta-(L-alpha-aminoadipyl)-L-cysteinyl-D-valine synthetase and having at least 80%, 85%, 90%, 95%, 97% or 98% sequence identity with SEQ ID NO:1 , a polynucleotide encoding an isopenicillin-N synthase and having at least 80%, 85%, 90%, 95%, 97% or 98% sequence identity with SEQ ID NO:3, and/or a polynucleotide encoding an isopenicillin N-acyltransferase and having at least 80%, 85%, 90%, 95%, 97% or 98% sequence identity with SEQ ID NO:5.
In a preferred aspect of the invention, at least two genes are inactivated which in their active form encodes a delta-(L-alpha-aminoadipyl)-L-cysteinyl-D-valine synthetase having at least 80% amino acid sequence identity with SEQ ID NO:2, an isopenicillin-N synthase having at least 80% amino acid sequence identity with SEQ ID NO:4, and/or an isopenicillin N- acyltransferase having at least 80% amino acid sequence identity with SEQ ID N0:6. Even more preferably all three genes are inactivated.
In a preferred embodiment of the aspects of the invention, the filamentous fungal host cell is of a genus selected from the group consisting of Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes and Trichoderma; even more preferably the filamentous fungal host cell is an Aspergillus cell; preferably an Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger or an Aspergillus oryzae cell.
Preferably, the polypeptide of interest is homologous or heterologous; more preferably the homologous or heterologous the polypeptide of interest is an enzyme; preferably the enzyme is a hydrolase, isomerase, ligase, lyase, oxidoreductase, or transferase, e.g., an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase, alpha- galactosidase, beta-galactosidase, glucoamylase, alpha-glucosidase, beta-glucosidase, invertase, laccase, lipase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phospholipase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transglutaminase, xylanase, or beta-xylosidase.
In a preferred embodiment the polypeptide of interest is a secreted polypeptide.
Nucleic Acid Constructs
The present invention also relates to nucleic acid constructs comprising a polynucleotide of the present invention operably linked to one or more control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences.
The polynucleotide may be manipulated in a variety of ways to provide for expression of the polypeptide. Manipulation of the polynucleotide prior to its insertion into a vector may be desirable or necessary depending on the expression vector. The techniques for modifying polynucleotides utilizing recombinant DNA methods are well known in the art.
The control sequence may be a promoter, a polynucleotide that is recognized by a host cell for expression of a polynucleotide encoding a polypeptide of the present invention. The promoter contains transcriptional control sequences that mediate the expression of the polypeptide. The promoter may be any polynucleotide that shows transcriptional activity in the host cell including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell. Examples of suitable promoters for directing transcription of the nucleic acid constructs of the present invention in a filamentous fungal host cell are promoters obtained from the genes for Aspergillus nidulans acetamidase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase {glaA), Aspergillus oryzae TAKA amylase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Fusarium oxysporum trypsin-like protease (WO 96/00787), Fusarium venenatum amyloglucosidase (WO 00/56900), Fusarium venenatum Daria (WO 00/56900), Fusarium venenatum Quinn (WO 00/56900), Rhizomucor miehei lipase, Rhizomucor miehei aspartic proteinase, Trichoderma reesei beta-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei xylanase III, Trichoderma reesei beta-xylosidase, and Trichoderma reesei translation elongation factor, as well as the NA2-tpi promoter (a modified promoter from an Aspergillus neutral alpha-amylase gene in which the untranslated leader has been replaced by an untranslated leader from an Aspergillus triose phosphate isomerase gene; non-limiting examples include modified promoters from an Aspergillus niger neutral alpha-amylase gene in which the untranslated leader has been replaced by an untranslated leader from an Aspergillus nidulans or Aspergillus oryzae triose phosphate isomerase gene); and mutant, truncated, and hybrid promoters thereof. Other promoters are described in U.S. Patent No. 6,01 1 ,147.
The control sequence may also be a transcription terminator, which is recognized by a host cell to terminate transcription. The terminator is operably linked to the 3'-terminus of the polynucleotide encoding the polypeptide. Any terminator that is functional in the host cell may be used in the present invention.
Preferred terminators for filamentous fungal host cells are obtained from the genes for
Aspergillus nidulans acetamidase, Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase, Aspergillus oryzae TAKA amylase, Fusarium oxysporum trypsin-like protease, Trichoderma reesei beta-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei xylanase III, Trichoderma reesei beta-xylosidase, and Trichoderma reesei translation elongation factor.
The control sequence may also be an mRNA stabilizer region downstream of a promoter and upstream of the coding sequence of a gene which increases expression of the gene.
The control sequence may also be a leader, a nontranslated region of an mRNA that is important for translation by the host cell. The leader is operably linked to the 5'-terminus of the polynucleotide encoding the polypeptide. Any leader that is functional in the host cell may be used.
Preferred leaders for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.
The control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3'-terminus of the polynucleotide and, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence that is functional in the host cell may be used.
Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase Aspergillus oryzae TAKA amylase, and Fusarium oxysporum trypsin-like protease.
The control sequence may also be a signal peptide coding region that encodes a signal peptide linked to the N-terminus of a polypeptide and directs the polypeptide into the cell's secretory pathway. The 5'-end of the coding sequence of the polynucleotide may inherently contain a signal peptide coding sequence naturally linked in translation reading frame with the segment of the coding sequence that encodes the polypeptide. Alternatively, the 5'-end of the coding sequence may contain a signal peptide coding sequence that is foreign to the coding sequence. A foreign signal peptide coding sequence may be required where the coding sequence does not naturally contain a signal peptide coding sequence. Alternatively, a foreign signal peptide coding sequence may simply replace the natural signal peptide coding sequence in order to enhance secretion of the polypeptide. However, any signal peptide coding sequence that directs the expressed polypeptide into the secretory pathway of a host cell may be used.
Effective signal peptide coding sequences for filamentous fungal host cells are the signal peptide coding sequences obtained from the genes for Aspergillus niger neutral amylase, Aspergillus niger glucoamylase, Aspergillus oryzae TAKA amylase, Humicola insolens cellulase, Humicola insolens endoglucanase V, Humicola lanuginosa lipase, and Rhizomucor miehei aspartic proteinase.
The control sequence may also be a propeptide coding sequence that encodes a propeptide positioned at the N-terminus of a polypeptide. The resultant polypeptide is known as a proenzyme or propolypeptide (or a zymogen in some cases). A propolypeptide is generally inactive and can be converted to an active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide. The propeptide coding sequence may be obtained from the genes for Bacillus subtilis alkaline protease {aprE), Bacillus subtilis neutral protease {nprT), Myceliophthora thermophila laccase (WO 95/33836), Rhizomucor miehei aspartic proteinase, and Saccharomyces cerevisiae alpha-factor. Where both signal peptide and propeptide sequences are present, the propeptide sequence is positioned next to the N-terminus of a polypeptide and the signal peptide sequence is positioned next to the N-terminus of the propeptide sequence.
It may also be desirable to add regulatory sequences that regulate expression of the polypeptide relative to the growth of the host cell. Examples of regulatory sequences are those that cause expression of the gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. In filamentous fungi, the Aspergillus niger glucoamylase promoter, Aspergillus oryzae TAKA alpha-amylase promoter, and Aspergillus oryzae glucoamylase promoter, Trichoderma reesei cellobiohydrolase I promoter, and Trichoderma reesei cellobiohydrolase II promoter may be used. Other examples of regulatory sequences are those that allow for gene amplification. In eukaryotic systems, these regulatory sequences include the dihydrofolate reductase gene that is amplified in the presence of methotrexate, and the metallothionein genes that are amplified with heavy metals. In these cases, the polynucleotide encoding the polypeptide would be operably linked to the regulatory sequence.
Expression Vectors
The present invention also relates to recombinant expression vectors comprising a polynucleotide of the present invention, a promoter, and transcriptional and translational stop signals. The various nucleotide and control sequences may be joined together to produce a recombinant expression vector that may include one or more convenient restriction sites to allow for insertion or substitution of the polynucleotide encoding the polypeptide at such sites. Alternatively, the polynucleotide may be expressed by inserting the polynucleotide or a nucleic acid construct comprising the polynucleotide into an appropriate vector for expression. In creating the expression vector, the coding sequence is located in the vector so that the coding sequence is operably linked with the appropriate control sequences for expression.
The recombinant expression vector may be any vector (e.g., a plasmid or virus) that can be conveniently subjected to recombinant DNA procedures and can bring about expression of the polynucleotide. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector may be a linear or closed circular plasmid.
The vector may be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may contain any means for assuring self-replication. Alternatively, the vector may be one that, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated. Furthermore, a single vector or plasmid or two or more vectors or plasmids that together contain the total DNA to be introduced into the genome of the host cell, or a transposon, may be used. The vector preferably contains one or more selectable markers that permit easy selection of transformed, transfected, transduced, or the like cells. A selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like.
Selectable markers for use in a filamentous fungal host cell include, but are not limited to, adeA (phosphoribosylaminoimidazole-succinocarboxamide synthase), adeB (phosphoribosyl- aminoimidazole synthase), amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (sulfate adenyltransferase), and trpC (anthranilate synthase), as well as equivalents thereof. Preferred for use in an Aspergillus cell are Aspergillus nidulans or Aspergillus oryzae amdS and pyrG genes and a Streptomyces hygroscopicus bar gene. Preferred for use in a Trichoderma cell are adeA, adeB, amdS, hph, and pyrG genes.
The selectable marker may be a dual selectable marker system as described in WO 2010/039889. In one aspect, the dual selectable marker is an hph-tk dual selectable marker system.
The vector preferably contains an element(s) that permits integration of the vector into the host cell's genome or autonomous replication of the vector in the cell independent of the genome.
For integration into the host cell genome, the vector may rely on the polynucleotide's sequence encoding the polypeptide or any other element of the vector for integration into the genome by homologous or non-homologous recombination. Alternatively, the vector may contain additional polynucleotides for directing integration by homologous recombination into the genome of the host cell at a precise location(s) in the chromosome(s). To increase the likelihood of integration at a precise location, the integrational elements should contain a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, 400 to 10,000 base pairs, and 800 to 10,000 base pairs, which have a high degree of sequence identity to the corresponding target sequence to enhance the probability of homologous recombination. The integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell. Furthermore, the integrational elements may be non-encoding or encoding polynucleotides. On the other hand, the vector may be integrated into the genome of the host cell by non-homologous recombination.
For autonomous replication, the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question. The origin of replication may be any plasmid replicator mediating autonomous replication that functions in a cell. The term "origin of replication" or "plasmid replicator" means a polynucleotide that enables a plasmid or vector to replicate in vivo.
Examples of origins of replication useful in a filamentous fungal cell are AMA1 and ANSI (Gems et ai, 1991 , Gene 98: 61 -67; Cullen et ai, 1987, Nucleic Acids Res. 15: 9163-9175; WO 00/24883). Isolation of the AMA1 gene and construction of plasmids or vectors comprising the gene can be accomplished according to the methods disclosed in WO 00/24883.
More than one copy of a polynucleotide of the present invention may be inserted into a host cell to increase production of a polypeptide. An increase in the copy number of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the polynucleotide where cells containing amplified copies of the selectable marker gene, and thereby additional copies of the polynucleotide, can be selected for by cultivating the cells in the presence of the appropriate selectable agent.
The procedures used to ligate the elements described above to construct the recombinant expression vectors of the present invention are well known to one skilled in the art (see, e.g., Sambrook et al., 1989, supra).
Inactivation of one or more gene
The present invention also relates to methods of producing a mutant of a parent cell, which comprises inactivating, disrupting or deleting a polynucleotide, or a portion thereof, which results in the mutant cell producing less of the encoded polypeptide than the parent cell when cultivated under the same conditions.
The mutant cell may be constructed by reducing or eliminating expression of the polynucleotide or a homologue thereof using methods well known in the art, for example, insertions, disruptions, replacements, or deletions. In a preferred aspect, the polynucleotide is inactivated. The polynucleotide to be modified or inactivated may be, for example, the coding region or a part thereof essential for activity, or a regulatory element required for expression of the coding region. An example of such a regulatory or control sequence may be a promoter sequence or a functional part thereof, i.e., a part that is sufficient for affecting expression of the polynucleotide. Other control sequences for possible modification include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, signal peptide sequence, transcription terminator, and transcriptional activator.
Modification or inactivation of the polynucleotide may be performed by subjecting the parent cell to mutagenesis and selecting for mutant cells in which expression of the polynucleotide has been reduced or eliminated. The mutagenesis, which may be specific or random, may be performed, for example, by use of a suitable physical or chemical mutagenizing agent, by use of a suitable oligonucleotide, or by subjecting the DNA sequence to PCR generated mutagenesis. Furthermore, the mutagenesis may be performed by use of any combination of these mutagenizing agents.
Examples of a physical or chemical mutagenizing agent suitable for the present purpose include ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), O-methyl hydroxylamine, nitrous acid, ethyl methane sulphonate (EMS), sodium bisulphite, formic acid, and nucleotide analogues.
When such agents are used, the mutagenesis is typically performed by incubating the parent cell to be mutagenized in the presence of the mutagenizing agent of choice under suitable conditions, and screening and/or selecting for mutant cells exhibiting reduced or no expression of the gene.
Modification or inactivation of the polynucleotide or homologue thereof may be accomplished by insertion, substitution, or deletion of one or more nucleotides in the gene or a regulatory element required for transcription or translation thereof. For example, nucleotides may be inserted or removed so as to result in the introduction of a stop codon, the removal of the start codon, or a change in the open reading frame. Such modification or inactivation may be accomplished by site-directed mutagenesis or PCR generated mutagenesis in accordance with methods known in the art. Although, in principle, the modification may be performed in vivo, i.e., directly on the cell expressing the polynucleotide to be modified, it is preferred that the modification be performed in vitro as exemplified below.
Methods for deleting or disrupting a targeted gene are described, for example, by Miller, et al (1985. Mol. Cell. Biol. 5:1714-1721 ); WO 90/00192; May, G. (1992. Applied Molecular Genetics of Filamentous Fungi. J. R. Kinghorn and G. Turner, eds., Blackie Academic and Professional, pp. 1 -25); and Turner, G. (1994. Vectors for Genetic Manipulation. S. D. Martinelli and J. R. Kinghorn, eds., Elsevier, pp. 641 -665).
An example of a convenient way to eliminate or reduce expression of a polynucleotide is based on techniques of gene replacement, gene deletion, or gene disruption. For example, in the gene disruption method, a nucleic acid sequence corresponding to the endogenous polynucleotide is mutagenized in vitro to produce a defective nucleic acid sequence that is then transformed into the parent cell to produce a defective gene. By homologous recombination, the defective nucleic acid sequence replaces the endogenous polynucleotide. It may be desirable that the defective polynucleotide also encodes a marker that may be used for selection of transformants in which the polynucleotide has been modified or destroyed. In an aspect, the polynucleotide is disrupted with a selectable marker such as those described herein.
The polypeptide-deficient mutant cells are particularly useful as host cells for expression of heterologous secreted polypeptides.
The methods used for cultivation and purification of the product of interest may be performed by methods known in the art. Methods of Production
The host cells are cultivated in a nutrient medium suitable for production of the polypeptide using methods known in the art. For example, the cells may be cultivated by shake flask cultivation, or small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors in a suitable medium and under conditions allowing the polypeptide to be expressed and/or isolated. The cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American Type Culture Collection). If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted, it can be recovered from cell lysates.
The polypeptide may be detected using methods known in the art that are specific for the polypeptides. These detection methods include, but are not limited to, use of specific antibodies, formation of an enzyme product, or disappearance of an enzyme substrate. For example, an enzyme assay may be used to determine the activity of the polypeptide.
The polypeptide may be recovered using methods known in the art. For example, the polypeptide may be recovered from the nutrient medium by conventional procedures including, but not limited to, collection, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation. In one aspect, a fermentation broth comprising the polypeptide is recovered.
The polypeptide may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein Purification, Janson and Ryden, editors, VCH Publishers, New York, 1989) to obtain substantially pure polypeptides.
In an alternative aspect, the polypeptide is not recovered, but rather a host cell of the present invention expressing the polypeptide is used as a source of the polypeptide.
One aspect of the invention relates to methods of producing a polypeptide of interest, said methods comprising the steps of:
a) cultivating a filamentous fungal host cell comprising a polynucleotide encoding a polypeptide of interest and comprising at least one inactivated gene which in its active form encodes a delta-(L-alpha-aminoadipyl)-L-cysteinyl-D-valine synthetase having at least 80% amino acid sequence identity with SEQ ID NO:2, an isopenicillin-N synthase having at least 80% amino acid sequence identity with SEQ ID NO:4, and/or an isopenicillin N-acyltransferase having at least 80% amino acid sequence identity with SEQ ID NO:6, whereby the host cell is deficient in the production of penicillin and, optionally, b) recovering the polypeptide of interest.
Preferably, the least one inactivated gene in its active form encodes a delta-(L-alpha- aminoadipyl)-L-cysteinyl-D-valine synthetase which has at least 85%, 90%, 95%, 97% or 98% amino acid sequence identity with SEQ ID NO:2, an isopenicillin-N synthase which has at least 85%, 90%, 95%, 97% or 98% amino acid sequence identity with SEQ ID NO:4, and/or an isopenicillin N-acyltransferase which has at least 85%, 90%, 95%, 97% or 98% amino acid sequence identity with SEQ ID NO:6.
Preferably the at least one inactivated gene in its active form comprises or consists of a polynucleotide encoding a delta-(L-alpha-aminoadipyl)-L-cysteinyl-D-valine synthetase and having at least 80%, 85%, 90%, 95%, 97% or 98% sequence identity with SEQ ID NO:1 , a polynucleotide encoding an isopenicillin-N synthase and having at least 80%, 85%, 90%, 95%, 97% or 98% sequence identity with SEQ ID NO:3, and/or a polynucleotide encoding an isopenicillin N-acyltransferase and having at least 80%, 85%, 90%, 95%, 97% or 98% sequence identity with SEQ ID NO:5.
In a preferred aspect of the invention, at least two genes are inactivated which in their active form encode a delta-(L-alpha-aminoadipyl)-L-cysteinyl-D-valine synthetase having at least 80% amino acid sequence identity with SEQ ID NO:2, an isopenicillin-N synthase having at least 80% amino acid sequence identity with SEQ ID NO:4, and/or an isopenicillin N-acyltransferase having at least 80% amino acid sequence identity with SEQ ID NO:6. Even more preferably all three genes are inactivated.
In a preferred embodiment, the filamentous fungal host cell is of a genus selected from the group consisting of Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes and Trichoderma; even more preferably the filamentous fungal host cell is an Aspergillus cell; preferably an Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger or an Aspergillus oryzae cell.
Preferably, the polypeptide of interest is homologous or heterologous; more preferably the homologous or heterologous polypeptide of interest is an enzyme; preferably the enzyme is a hydrolase, isomerase, ligase, lyase, oxidoreductase, or transferase, e.g., an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase, alpha- galactosidase, beta-galactosidase, glucoamylase, alpha-glucosidase, beta-glucosidase, invertase, laccase, lipase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transglutaminase, xylanase, or beta-xylosidase. Even more preferably, the polypeptide of interest is secreted.
In a preferred embodiment, the at least one inactivated gene in its active form comprises or consists of a polynucleotide encoding a delta-(L-alpha-aminoadipyl)-L-cysteinyl-D-valine synthetase and having at least 80% sequence identity with SEQ ID NO:1 , a polynucleotide encoding an isopenicillin-N synthase and having at least 80% sequence identity with SEQ ID NO:3, and/or a polynucleotide encoding an isopenicillin N-acyltransferase and having at least 80% sequence identity with SEQ ID NO:5.
EXAMPLES Methods
General methods of PCR, cloning, ligation nucleotides etc. are well-known to a person skilled in the art and may for example be found in in "Molecular cloning: A laboratory manual", Sambrook et al. (1989), Cold Spring Harbor lab., Cold Spring Harbor, NY; Ausubel, F. M. et al. (eds.); "Current protocols in Molecular Biology", John Wiley and Sons, (1995); Harwood, C. R., and Cutting, S. M. (eds.); "DNA Cloning: A Practical Approach, Volumes I and II", D.N. Glover ed. (1985); Oligonucleotide Synthesis", M.J. Gait ed. (1984); "Nucleic Acid Hybridization", B.D. Hames & S.J. Higgins eds (1985); "A Practical Guide To Molecular Cloning", B. Perbal, (1984).
PCR amplification
All PCR amplifications was performed in a volume of 100 microL containing 2.5 units Taq po-lymerase, 100 ng of pS02, 250 nM of each dNTP, and 10 pmol of each of the two primers described above in a reaction buffer of 50 mM KCI, 10 mM Tris-HCI pH 8.0, 1.5 mM MgCI2.
Amplification was carried out in a Perkin-Elmer Cetus DNA Termal 480, and consisted of one cycle of 3 minutes at 94°C, followed by 25 cycles of 1 minute at 94°C, 30 seconds at 55°C, and 1 minute at 72°C.
Aspergillus transformation
Aspergillus transformation was done as described by Christensen et al.; Biotechnology
1988 6 1419-1422. In short, A.oryzae mycelia were grown in a rich nutrient broth. The mycelia were separated from the broth by filtration. The enzyme preparation Glucanex® (Novozymes) was added to the mycelia in osmotically stabilizing buffer such as 1.2 M MgS04 buffered to pH 5.0 with sodium phosphate. The suspension was incubated for 60 minutes at 37degrees C with agitation. The protoplast was filtered through mira-cloth to remove mycelial debris. The protoplast was harvested and washed twice with STC (1.2 M sorbitol, 10 mM CaCI2, 10 mM Tris-HCI pH 7.5). The protoplasts were finally re-suspended in 200-1000 microl STC.
For transformation, 5 microg DNA was added to 100 microl protoplast suspension and then 200 microl PEG solution (60% PEG 4000, 10 mM CaC , 10 mM Tris-HCI pH 7.5) was added and the mixture is incubated for 20 minutes at room temperature. The protoplast were harvested and washed twice with 1 .2 M sorbitol. The protoplast was finally re-suspended 200 microl 1 .2 M sorbitol. Transformants containing the amdS gene were selected for its ability to used acetamide as the sole source for nitrogen on minimal plates (Cove D.J. 1966. Biochem. Biophys. Acta. 1 13:51 -56) containing 1 .0 M sucrose as carbon source, 10 mM acetamide as nitrogen source. After 5-7 days of growth at 37 degrees C, stable transformants appeared as vigorously growing and sporulating colonies. Transformants were purified twice through conidiospores. Shake flask fermentation
Shake flask containing 10 ml YPM medium (2 g/l yeast extract, 2 g/l peptone, and 2% maltose) were inoculated with spores from a transformant/heterokaryon or diploid strain and incubated at 30 degrees C, 200 rpm for 4 days. Genes
acvA: This gene codes for delta-(L-alpha-aminoadipyl)-L-cysteinyl-D-valine synthetase, an enzyme involved in the biosynthesis of penicillin G.
ipnA: This gene codes for isopenicillin N synthetase, an enzyme involved in the biosynthesis of penicillin G.
aatA: This gene codes for Isopenicillin N-acyltransferase, an enzyme involved in the biosynthesis of penicillin G.
pyrG: This gene codes for orotidine-5'-phosphate decarboxylase, an enzyme involved in the biosynthesis of uridine.
amdS: This gene codes for acetamidase, an enzyme involved in the metabolism of acetamide.
Plasmids
pCR-4 Blunt-TOPO is from Invitrogen.
pHUda797 is described in patent US2013095525, example 1
pJaL554 is described in patent WO07045248, example 9
pJaL1 123 is described in patent WO2012160093, example 10
Strains
Aspergillus oryzae NBRC4177: available from Institute for fermentation, Osaka; 17-25 Juso
Hammachi 2-Chome Yodogawa-Ku, Osaka, Japan.
COIs454 is described in patent WO2012160093, example 16
RUNG237 is described in patent WO20150226, example 1
JaL1844 is described in example 1
JaL1877 is described in example 2
JaL1898 is described in example 3
JaL1903 is described in example 4
Sequences
SEQ ID NO:1 : DNA sequence of acvA SEQ ID NO:2: Amino acid sequence of AcvA encoded by SEQ ID NO:1
SEQ ID NO:3: DNA sequence of ipnA
SEQ ID NO:4: Amino acid sequence of IpnA encoded by SEQ ID NO:3
SEQ ID NO:5 DNA sequence of aatA
SEQ ID NO 3: Amino acid sequence of AatA encoded by SEQ ID NO:5
SEQ ID NO 7: Primer oJaL1 13 5 - gagctgctggatttggctg
SEQ ID NO 8: Primer oJal_1 14 5 - ccaacagccgactcaggag
SEQ ID NO 9: Primer oJal_565 5 - cggttctacagtccgccc
SEQ ID NO 10 Primer oJal_566 5 - cgtccacgcggggattatgctgatcgccaaatctattaac
SEQ ID NO 1 1 Primer oJal_567 5 - cgataagctccttgacggggtgactgggcaacaccacgaag
SEQ ID NO 12 Primer oJal_568 5 - ggtcatagtccgccagttg
SEQ ID NO 13 Primer X1 1 1 1 C07 5 - gcataatccccgcgtggacg
SEQ ID NO 14 Primer X1 1 1 1 C08 5 - ccccgtcaaggagcttatcg Example 1. Construction of a ligD minus A. oryzae strain, Jal_1844.
For deletion of the ligD gene (AO090120000322) involved in non-homologous-end- joining plasmid pJal_1 123 was linearized with Spel and used to transform A. oryzae RUNG237 and transformants were selected on minimal medium supplemented 0.6 mM 5-fluoro-2'- deoxyuridine (FdU) as described in WO 0168864. A number of transformants were re-isolated twice and genomic DNA was prepared. The chromosomal DNA from each of the transformants was digested with Asp718 and analyzed by Southern blotting, using the 1 102 bp 32P-labelled DNA EcoRI - BamHI fragment from pJal_1 123 containing the 5' flanks of the A. oryzae ligD gene as the probe. Strains of interest were identified by the disappearance of a 3828 kb Asp718 band and the appearance of a 2899 kb Asp718 band. One transformant having the above characteristics was named Jal_1844.
Example 2. Isolation of a pyrG minus A. oryzae strain, JaL1877
The A. oryzae strain Jal_1844 was screened for resistance to 5-flouro-orotic acid (FOA) to identify spontaneous pyrG mutants on minimal plates (Cove D.J. 1966. Biochem. Biophys. Acta. 1 13:51 -56) supplemented with 1 .0 M sucrose as carbon source, 10 mM sodiumnitrate as nitrogen source, and 0.5 mg/ml FOA. One strain, Jal_1877, was identifying as being pyrG minus. JaL1877 is uridine dependent, therefore it can be transformed with the wild type pyrG gene and transformants selected by the ability to grow in the absence of uridine. Example 3. Construction of a penG minus A. oryzae strain, Jal_1898.
The three genes acvA (AO090038000543; SEQ ID NO:1 encoding SEQ ID NO:2) , ipnA (AO090038000544; SEQ ID NO:3 encoding SEQ ID NO:4) and aatA (AO090038000545; SEQ ID NO: 5 encoding SEQ ID NO:6) are involved in synthesis of penicillin G (penG) which is clustered on chromosome 6 in A. oryzae strains. Fig. 1 shows the orientation of these three 3 genes and location of primers used for PCR amplification of flanks used for deletion of part of the penG gene cluster. First it was tried to deleted the entire penG gene cluster (all three genes, ΔΑ in Fig. 1 ), but was not able to obtained any Aspergillus oryzae clones having this entire penG gene cluster deletion, so therefore only part of the penG gene cluster was tried deleted with success. The 4401 bp deletion includes the first 132 bp (encoding the first 44 amino acids) of the aatA gene, the entire ipnA gene, the first 1515 bp (encoding the first 505 amino acids) of the avcA gene and the promoters for all three genes as indicated in Fig. 1. The strategy used for the deletion is as described in Nielsen M. L. et al. (2006), Efficient PCR-based gene targeting with a recyclable marker for Aspergillus nidulans, Fungal Genetics and Biology vol. 43: 54-64. It was done in the following way:
First the aatA flank and a partially N-terminal pyrG gene was fused by overlap extension PCR of two PCR generated fragments 1 ) an 1418 bp fragment (aatA flank) using primers oJal_565 (SEQ ID NO:9) and oJaL566 (SEQ ID NO:10) on genomic DNA from RUNG237 and 2) an 1 129 bp fragment (encoding part of the A. oryzae pyrG gene) using primers oJal_1 14 (SEQ ID NO:8) and X1 1 1 1 C07 (SEQ ID NO:13) on plasmid pJal_554. The two fragments was mix and PCR amplification with primers oJal_565 and oJal_1 14 was done giving a fragment on 2527 bp, which was purified over a 1 % agarose gel.
Second the acvA flank and a partially C-terminal pyrG gene was fused by overlap extension PCR of two PCR generated fragments 1 ) an 2003 bp fragment (acvA flank) using primers oJal_567 (SEQ ID NO:1 1 ) and oJal_568 (SEQ ID NO:12) on genomic DNA from RUNG237 and 2) an 1445 bp fragment (encoding part of the A. oryzae pyrG gene) using primers oJaL1 13 (SEQ ID NO:7) and X1 1 1 1 C08 (SEQ ID NO:14) on plasmid pJal_554. The two fragments was mix and PCR amplification with primers oJal_568 and oJaL1 13 was done giving a fragment on 3428 bp, which was purified over a 1 % agarose gel.
The above two fragments (1 μg of each) was mix and transformed into RUNG237. A number of transformants were re-isolated twice and genomic DNA was prepared. The chromosomal DNA from each of the transformants was digested with Asp718 and analyzed by Southern blotting, using 32P-labelling of the above 1418 bp PCR product containing the aatA flank as the probe. Strains of interest were identified by the disappearance of an 8520 kb Bglll band and the appearance of a 6161 kb Bglll band. One transformant having the above characteristics was named Jal_1898.
Example 4. Isolation of a pyrG minus A. oryzae strain, Jal_1903
The A. oryzae strain Jal_1898 was screened for resistance to 5-flouro-orotic acid (FOA) to identify spontaneous pyrG mutants on minimal plates (Cove D.J. 1966. Biochem. Biophys. Acta. 1 13:51 -56) supplemented with 1 .0 M sucrose as carbon source, 10 mM sodiumnitrate as nitrogen source, and 0.5 mg/ml FOA. One strain, Jal_1903, was identifying as being pyrG minus. JaL1903 is uridine dependent, therefore it can be transformed with the wild type pyrG gene and transformants selected by the ability to grow in the absence of uridine. The loss of the pyrG gene was confirmed by Southern blotting analysis, using 32P-labelling of the above 1418 bp PCR product containing the aatA flank as the probe. Strains of interest were identified by the disappearance of a 6161 kb Bglll band and the appearance of a 4554 kb Bglll band. One transformant having the above characteristics was named Jal_1903. This strain can then be used for further gene deletions.

Claims

1 . A filamentous fungal host cell comprising a polynucleotide encoding a polypeptide of interest and comprising at least one inactivated gene which in its active form encodes a delta-(L- alpha-aminoadipyl)-L-cysteinyl-D-valine synthetase having at least 80% amino acid sequence identity with SEQ ID NO:2, an isopenicillin-N synthase having at least 80% amino acid sequence identity with SEQ ID NO:4, and/or an isopenicillin N-acyltransferase having at least 80% amino acid sequence identity with SEQ ID NO:6, whereby the host cell is deficient in the production of penicillin.
2. The host cell of claim 1 which is of a genus selected from the group consisting of Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes and Trichoderma.
3. The host cell of claim 2 which is an Aspergillus cell; preferably an Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger or an Aspergillus oryzae cell.
4. The host cell of any preceding claim, wherein the polypeptide of interest is homologous or heterologous; preferably the homologous or heterologous polypeptide of interest is an enzyme; preferably the enzyme is a hydrolase, isomerase, ligase, lyase, oxidoreductase, or transferase, e.g., an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase, alpha-galactosidase, beta-galactosidase, glucoamylase, alpha- glucosidase, beta-glucosidase, invertase, laccase, lipase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transglutaminase, xylanase, or beta-xylosidase.
5. The host cell of claim 4, wherein the polypeptide of interest is a secreted polypeptide.
6. The host cell of any preceding claim, wherein the at least one inactivated gene in its active form comprises or consists of a polynucleotide encoding a delta-(L-alpha-aminoadipyl)-L- cysteinyl-D-valine synthetase and having at least 80% sequence identity with SEQ ID NO:1 , a polynucleotide encoding an isopenicillin-N synthase and having at least 80% sequence identity with SEQ ID NO:3, and/or a polynucleotide encoding an isopenicillin N-acyltransferase and having at least 80% sequence identity with SEQ ID NO:5.
7. A method of producing a polypeptide of interest, said method comprising the steps of: a) cultivating a filamentous fungal host cell comprising a polynucleotide encoding a polypeptide of interest and comprising at least one inactivated gene which in its active form encodes a delta-(L-alpha-aminoadipyl)-L-cysteinyl-D-valine synthetase having at least 80% amino acid sequence identity with SEQ ID NO:2, an isopenicillin-N synthase having at least 80% amino acid sequence identity with SEQ ID NO:4, and/or an isopenicillin N-acyltransferase having at least 80% amino acid sequence identity with SEQ ID NO:6, whereby the host cell is deficient in the production of penicillin and, optionally, b) recovering the polypeptide of interest.
8. The method of claim 7, wherein the filamentous fungal host cell is of a genus selected from the group consisting of Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes and Trichoderma.
9. The method cell of claim 8, wherein the filamentous fungal host cell is an Aspergillus cell; preferably an Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger or an Aspergillus oryzae cell.
10. The method of any of claims 7-9, wherein the polypeptide of interest is homologous or heterologous; preferably the homologous or heterologous polypeptide of interest is an enzyme; more preferably the enzyme is a hydrolase, isomerase, ligase, lyase, oxidoreductase, or transferase, e.g., an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase, alpha-galactosidase, beta-galactosidase, glucoamylase, alpha-glucosidase, beta-glucosidase, invertase, laccase, lipase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transglutaminase, xylanase or beta-xylosidase.
1 1 . The method of claim 10, wherein the polypeptide of interest is a secreted polypeptide.
12. The method of any of claims 7-1 1 , wherein the at least one inactivated gene in its active form comprises or consists of a polynucleotide encoding a delta-(L-alpha-aminoadipyl)-L- cysteinyl-D-valine synthetase and having at least 80% sequence identity with SEQ ID N0:1 , a polynucleotide encoding an isopenicillin-N synthase and having at least 80% sequence identity with SEQ ID NO:3, and/or a polynucleotide encoding an isopenicillin N-acyltransferase and having at least 80% sequence identity with SEQ ID NO:5.
13. A method of producing an improved filamentous fungal host cell producing a polypeptide of interest, said method comprising the following steps in no particular order:
e) transforming a filamentous fungal host cell with a polynucleotide encoding the polypeptide of interest; and
f) inactivating at least one gene which in its active form encodes a delta-(L-alpha- aminoadipyl)-L-cysteinyl-D-valine synthetase having at least 80% amino acid sequence identity with SEQ ID NO:2, an isopenicillin-N synthase having at least 80% amino acid sequence identity with SEQ ID NO:4, and/or an isopenicillin N-acyltransferase having at least 80% amino acid sequence identity with SEQ ID NO:6, whereby the host cell becomes deficient in the production of penicillin.
14. The method of claim 13, wherein the filamentous fungal host cell is of a genus selected from the group consisting of Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes and Trichoderma.
15. The method cell of claim 14, wherein the filamentous fungal host cell is an Aspergillus cell; preferably an Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger or an Aspergillus oryzae cell.
16. The method of any of claims 13-15, wherein the polypeptide of interest is homologous or heterologous; preferably the homologous or heterologous polypeptide of interest is an enzyme; more preferably the enzyme is a hydrolase, isomerase, ligase, lyase, oxidoreductase, or transferase, e.g., an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase, alpha-galactosidase, beta-galactosidase, glucoamylase, alpha-glucosidase, beta-glucosidase, invertase, laccase, lipase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phospholipase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transglutaminase, xylanase or beta- xylosidase.
17. The method of claim 16, wherein the polypeptide of interest is a secreted polypeptide.
18. The method of any of claims 13-17, wherein the at least one inactivated gene in its active form comprises or consists of a polynucleotide encoding a delta-(L-alpha-aminoadipyl)-L- cysteinyl-D-valine synthetase and having at least 80% sequence identity with SEQ ID NO:1 , a polynucleotide encoding an isopenicillin-N synthase and having at least 80% sequence identity with SEQ ID NO:3, and/or a polynucleotide encoding an isopenicillin N-acyltransferase and having at least 80% sequence identity with SEQ ID NO:5.
PCT/EP2018/056406 2017-03-17 2018-03-14 Improved filamentous fungal host cell Ceased WO2018167153A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP17161588 2017-03-17
EP17161588.3 2017-03-17

Publications (1)

Publication Number Publication Date
WO2018167153A1 true WO2018167153A1 (en) 2018-09-20

Family

ID=58387690

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2018/056406 Ceased WO2018167153A1 (en) 2017-03-17 2018-03-14 Improved filamentous fungal host cell

Country Status (1)

Country Link
WO (1) WO2018167153A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020092608A1 (en) 2018-10-31 2020-05-07 Novozymes A/S Genome editing by guided endonuclease and single-stranded oligonucleotide
WO2020112881A1 (en) 2018-11-28 2020-06-04 Novozymes A/S Modified filamentous fungal host cells

Citations (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0238023A2 (en) 1986-03-17 1987-09-23 Novo Nordisk A/S Process for the production of protein products in Aspergillus oryzae and a promoter for use in Aspergillus
WO1990000192A1 (en) 1988-07-01 1990-01-11 Genencor, Inc. Aspartic proteinase deficient filamentous fungi
WO1995033836A1 (en) 1994-06-03 1995-12-14 Novo Nordisk Biotech, Inc. Phosphonyldipeptides useful in the treatment of cardiovascular diseases
WO1996000787A1 (en) 1994-06-30 1996-01-11 Novo Nordisk Biotech, Inc. Non-toxic, non-toxigenic, non-pathogenic fusarium expression system and promoters and terminators for use therein
US6011147A (en) 1986-04-30 2000-01-04 Rohm Enzyme Finland Oy Fungal promoters active in the presence of glucose
WO2000024883A1 (en) 1998-10-26 2000-05-04 Novozymes A/S Constructing and screening a dna library of interest in filamentous fungal cells
WO2000056900A2 (en) 1999-03-22 2000-09-28 Novo Nordisk Biotech, Inc. Promoter sequences derived from fusarium venenatum and uses thereof
WO2001068864A1 (en) 2000-03-14 2001-09-20 Novozymes A/S Fungal transcriptional activator useful in methods for producing polypeptides
WO2007045248A1 (en) 2005-10-17 2007-04-26 Novozymes A/S Use of fungal mutants for expression of antibodies
WO2007122249A1 (en) * 2006-04-25 2007-11-01 Dsm Ip Assets B.V. Production of compounds in a recombinant host
WO2010039889A2 (en) 2008-09-30 2010-04-08 Novozymes, Inc. Methods for using positively and negatively selectable genes in a filamentous fungal cell
WO2012160093A1 (en) 2011-05-23 2012-11-29 Novozymes A/S Simultaneous site-specific integrations of multiple gene-copies in filamentous fungi
US20130095525A1 (en) 2010-06-25 2013-04-18 Novozymes A/S Polynucleotides having leader sequence function
WO2015080226A1 (en) 2013-11-27 2015-06-04 ジェノダイブファーマ株式会社 Simple method and kit for dna profiling of hla genes by high-throughput massively parallel sequencer

Patent Citations (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0238023A2 (en) 1986-03-17 1987-09-23 Novo Nordisk A/S Process for the production of protein products in Aspergillus oryzae and a promoter for use in Aspergillus
US6011147A (en) 1986-04-30 2000-01-04 Rohm Enzyme Finland Oy Fungal promoters active in the presence of glucose
WO1990000192A1 (en) 1988-07-01 1990-01-11 Genencor, Inc. Aspartic proteinase deficient filamentous fungi
WO1995033836A1 (en) 1994-06-03 1995-12-14 Novo Nordisk Biotech, Inc. Phosphonyldipeptides useful in the treatment of cardiovascular diseases
WO1996000787A1 (en) 1994-06-30 1996-01-11 Novo Nordisk Biotech, Inc. Non-toxic, non-toxigenic, non-pathogenic fusarium expression system and promoters and terminators for use therein
WO2000024883A1 (en) 1998-10-26 2000-05-04 Novozymes A/S Constructing and screening a dna library of interest in filamentous fungal cells
WO2000056900A2 (en) 1999-03-22 2000-09-28 Novo Nordisk Biotech, Inc. Promoter sequences derived from fusarium venenatum and uses thereof
WO2001068864A1 (en) 2000-03-14 2001-09-20 Novozymes A/S Fungal transcriptional activator useful in methods for producing polypeptides
WO2007045248A1 (en) 2005-10-17 2007-04-26 Novozymes A/S Use of fungal mutants for expression of antibodies
WO2007122249A1 (en) * 2006-04-25 2007-11-01 Dsm Ip Assets B.V. Production of compounds in a recombinant host
WO2010039889A2 (en) 2008-09-30 2010-04-08 Novozymes, Inc. Methods for using positively and negatively selectable genes in a filamentous fungal cell
US20130095525A1 (en) 2010-06-25 2013-04-18 Novozymes A/S Polynucleotides having leader sequence function
WO2012160093A1 (en) 2011-05-23 2012-11-29 Novozymes A/S Simultaneous site-specific integrations of multiple gene-copies in filamentous fungi
WO2015080226A1 (en) 2013-11-27 2015-06-04 ジェノダイブファーマ株式会社 Simple method and kit for dna profiling of hla genes by high-throughput massively parallel sequencer

Non-Patent Citations (25)

* Cited by examiner, † Cited by third party
Title
"Protein Purification, Janson and Ryden", 1989, VCH PUBLISHERS
AUSUBEL, F. M. ET AL.: "Current protocols in Molecular Biology", 1995, JOHN WILEY AND SONS
B. PERBAL, A PRACTICAL GUIDE TO MOLECULAR CLONING, 1984
B.D. HAMES & S.J. HIGGINS: "Nucleic Acid Hybridization", 1985
CANTORAL J M ET AL: "Biochemical characterization and molecular genetics of nine mutants of Penicillium chrysogenum impaired in penicillin biosynthesis", JOURNAL OF BIOLOGICAL CHEMISTRY, AMERICAN SOCIETY FOR BIOCHEMISTRY AND MOLECULAR BIOLOGY, US, vol. 268, no. 1, 5 January 1993 (1993-01-05), pages 737 - 744, XP002400770, ISSN: 0021-9258 *
CHRISTENSEN ET AL., BIOLTECHNOLOGY, vol. 6, 1988, pages 1419 - 1422
CHRISTENSEN ET AL., BIOTECHNOLOGY, vol. 6, 1988, pages 1419 - 1422
COVE D.J., BIOCHEM. BIOPHYS. ACTA., vol. 113, 1966, pages 51 - 56
CULLEN, NUCLEIC ACIDS RES., vol. 15, 1987, pages 9163 - 9175
FIERRO F ET AL: "Mutants blocked in penicillin biosynthesis show a deletion of the entire penicillin gene cluster at a specific site within a conserved hexanucleotide sequence", APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, SPRINGER, DE, vol. 44, no. 5, 1 January 1996 (1996-01-01), pages 597 - 604, XP009072972, ISSN: 0175-7598, DOI: 10.1007/S002530050605 *
GEMS, GENE, vol. 98, 1991, pages 61 - 67
HARWOOD, C. R., AND CUTTING, S. M.: "DNA Cloning: A Practical Approach", vol. I and II, 1985
HAWKSWORTH ET AL.: "Ainsworth and Bisby's Dictionary of The Fungi, 8th edition,", 1995, CAB INTERNATIONAL, UNIVERSITY PRESS
M.J. GAIT: "Oligonucleotide Synthesis", 1984
MALARDIER ET AL., GENE, vol. 78, 1989, pages 147 - 156
MAY, G.: "Applied Molecular Genetics of Filamentous Fungi", 1992, BLACKIE ACADEMIC AND PROFESSIONAL, pages: 1 - 25
MILLER ET AL., MOL. CELL. BIOL., vol. 5, 1985, pages 1714 - 1721
NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 - 453
NIELSEN M. L. ET AL.: "Efficient PCR-based gene targeting with a recyclable marker for Aspergillus nidulans", FUNGAL GENETICS AND BIOLOGY, vol. 43, 2006, pages 54 - 64, XP024918908, DOI: doi:10.1016/j.fgb.2005.09.005
PETRA SPRÖTE ET AL: "Identification of the novel penicillin biosynthesis gene aatB of Aspergillus nidulans and its putative evolutionary relationship to this fungal secondary metabolism gene cluster", MOLECULAR MICROBIOLOGY., vol. 70, no. 2, 15 September 2008 (2008-09-15), GB, pages 445 - 461, XP055467474, ISSN: 0950-382X, DOI: 10.1111/j.1365-2958.2008.06422.x *
RICE ET AL., EMBOSS: THE EUROPEAN MOLECULAR BIOLOGY OPEN SOFTWARE SUITE, 2000
RICE ET AL.: "EMBOSS: The European Molecular Biology Open Software Suite", TRENDS GENET, vol. 16, 2000, pages 276 - 277, XP004200114, DOI: doi:10.1016/S0168-9525(00)02024-2
SAMBROOK ET AL.: "Molecular cloning: A laboratory manual", 1989, COLD SPRING HARBOR LAB.
TURNER, G.: "Vectors for Genetic Manipulation", 1994, ELSEVIER, pages: 641 - 665
YELTON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 81, 1984, pages 1470 - 1474

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020092608A1 (en) 2018-10-31 2020-05-07 Novozymes A/S Genome editing by guided endonuclease and single-stranded oligonucleotide
WO2020112881A1 (en) 2018-11-28 2020-06-04 Novozymes A/S Modified filamentous fungal host cells

Similar Documents

Publication Publication Date Title
CN104395454B (en) Improved fungal selection
US20160304905A1 (en) Fungal Gene Library By Double Split-Marker Integration
US20190225988A1 (en) Genomic integration of DNA fragments in fungal host cells
CN105492604B (en) Modulated PEPC expression
US11046736B2 (en) Filamentous fungal host
JP7609774B2 (en) Modified filamentous fungal host cells
US20140113304A1 (en) Bi-Directional Cytosine Deaminase-Encoding Selection Marker
EP2652138B1 (en) Promoters for expressing genes in a fungal cell
WO2018172155A1 (en) Improved filamentous fungal host cells
US10550398B2 (en) RlmA-inactivated filamentous fungal host cell
WO2018167153A1 (en) Improved filamentous fungal host cell
US11434475B2 (en) Modified filamentous fungal host cell for encoding a secreted polypetide of interest
US20220267783A1 (en) Filamentous fungal expression system
US20230407273A1 (en) Glycosyltransferase variants for improved protein production
US20220251581A1 (en) Modified filamentous fungal host cell

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18710060

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18710060

Country of ref document: EP

Kind code of ref document: A1