WO2018165186A1 - Assessment of chronic iron deficiency - Google Patents

Assessment of chronic iron deficiency Download PDF

Info

Publication number
WO2018165186A1
WO2018165186A1 PCT/US2018/021189 US2018021189W WO2018165186A1 WO 2018165186 A1 WO2018165186 A1 WO 2018165186A1 US 2018021189 W US2018021189 W US 2018021189W WO 2018165186 A1 WO2018165186 A1 WO 2018165186A1
Authority
WO
WIPO (PCT)
Prior art keywords
hepcidin
iron
antibody
level
subject
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2018/021189
Other languages
French (fr)
Inventor
Mark D. FLEMING
Mark Westerman
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Boston Childrens Hospital
Intrinsic LifeSciences LLC
Original Assignee
Boston Childrens Hospital
Intrinsic LifeSciences LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Boston Childrens Hospital, Intrinsic LifeSciences LLC filed Critical Boston Childrens Hospital
Publication of WO2018165186A1 publication Critical patent/WO2018165186A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K33/00Medicinal preparations containing inorganic active ingredients
    • A61K33/24Heavy metals; Compounds thereof
    • A61K33/26Iron; Compounds thereof
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/26Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against hormones ; against hormone releasing or inhibiting factors
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/84Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving inorganic compounds or pH
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/90Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving iron binding capacity of blood
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/02Nutritional disorders
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/52Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis

Definitions

  • Iron is an essential trace element required for growth and development of living organisms. In mammals, iron content is regulated by controlling iron absorption, iron recycling, and release of iron from the cells in which it is stored. Iron is predominantly absorbed in the duodenum and upper jejunum by enterocytes. Iron is recycled from degraded red cells by reticuloendothelial macrophages in bone marrow, hepatic Kupffer cells and spleen. Iron release is controlled by ferroportin, a major iron export protein located on the cell surface of enterocytes, macrophages and hepatocytes, the main cells capable of releasing iron into plasma. Hepcidin binds to ferroportin and decreases its functional activity by causing it to be internalized from the cell surface and degraded.
  • Iron-Refractory Iron Deficiency Anemia is characterized by congenital iron deficiency poorly responsive to oral iron treatment. Biallelic mutations in TMPRSS6 are found in most patients with IRIDA. TMPRSS6 negatively regulates synthesis of the iron regulatory hormone hepcidin and loss of TMPRSS6 causes increased plasma hepcidin and impaired iron absorption and recycling.
  • the inventors employ a new hepcidin immunoassay to measure plasma hepcidin in individuals with chronic iron deficiency and correlate the results with MPRSS6 genotypes.
  • the inventors confirm that chronically iron deficient patients without MPRSS6 mutations typically have low hepcidin levels, whereas those with biallelic TMPRSS6 mutations have higher levels, but patients in both groups are often within the reference range.
  • the inventors tested several indices derived from plasma iron markers and hepcidin.
  • a multivariable logistic regression model identified a 54% decrease (95% CI: 22%-73%) in the odds of having two MPRSS6 mutations for every unit increase in HGB; a 1.2-fold increase (95% CI: 1.1-1.4) in the odds of having two MPRSS6 mutations for every unit increase in iron; and a 36% decrease (95%CI: 21%-48%) in the odds of having two MPRSS6 mutations for every unit increase in Iron/logi 0 (Hepcidin). Similar relationships could be determined substituting ferritin for hepcidin.
  • a method for quantifying an amount of hepcidin in a fluid sample using an immunoassay comprising: a) providing a known amount of a tracer reagent consisting of: (1) a peptide having an amino acid sequence of at least a portion of any one of SEQ ID NOS: 1, 3 and 4; (2) at least one hydrophilic spacer consisting of one or more AEEAc residues(ni -6 ) covalently linked to the peptide of step (a)(1) at the amino terminus or a lysine residue in said peptide; and (3) a detector molecule covalently linked to the hydrophilic spacer of (a)(2); b) contacting a fluid sample from a patient with a known amount of said tracer reagent in the presence of an immobilized antibody that specifically binds to an epitope on hepcidin with a dissociation constant of less than about 50 picomolar; c) washing unbound tracer reagent;
  • the tracer reagent comprises biotin as the detector molecule covalently linked to the hydrophilic spacer at a single site on the peptide.
  • the tracer reagent comprises K18-biotin- biotin or K24-biotin and the antibody is 583 or an antibody that comprises complimentary determining regions (CDRs) of 583.
  • the antibody that comprises the CDRs of 583 comprises variable heavy chain CDRs encoded by SEQ ID NOS: 5, 7 and 9; and variable light chain CDRs encoded by SEQ ID NOS: 11, 13 and 15.
  • the tracer reagent comprises K18-biotin-biotin or K24-biotin and the antibody is 1B1 or an antibody that comprises the CDRs of 1B1.
  • the antibody that comprises the CDRs of 1B1 comprises variable heavy chain CDRs encoded by SEQ ID NOS: 6, 8 and 10; and variable light chain CDRs encoded by SEQ ID NOS: 12, 14 and 16.
  • the stop solution can be, for example, H 2 S0 4 or another conventionally known stop solution.
  • the known amount of a tracer reagent is an amount such as, for example, of from about 0.05 ng to about 50 ng.
  • the development solution comprises tetramethyl benzidine (TMB), 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) or another conventionally known development solution.
  • TMB tetramethyl benzidine
  • ABTS 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)
  • the tracer reagent comprises biotin as the detector molecule covalently linked to the hydrophilic spacer at a single site on the peptide.
  • the tracer reagent comprises K18-biotin-biotin or K24-biotin and the antibody is 583 or an antibody that comprises complimentary determining regions (CDRs) of 583.
  • the antibody that comprises the CDRs of 583 comprises variable heavy chain CDRs encoded by SEQ ID NOS: 5, 7 and 9; and variable light chain CDRs encoded by SEQ ID NOS: 11, 13 and 15.
  • the tracer reagent comprises K18-biotin-biotin or K24-biotin and the antibody is 1B 1 or an antibody that comprises the CDRs of 1B1.
  • the antibody that comprises the CDRs of 1B1 comprises variable heavy chain CDRs encoded by SEQ ID NOS: 6, 8 and 10; and variable light chain CDRs encoded by SEQ ID NOS: 12, 14 and 16.
  • the stop solution can be, for example, H 2 S0 4 or another conventionally known stop solution.
  • the known amount of a tracer reagent is an amount such as, for example, of from about 0.05 ng to about 50 ng.
  • the development solution comprises tetramethyl benzidine (TMB), 2,2'-azino-bis(3- ethylbenzothiazoline-6-sulphonic acid) (ABTS) or another conventionally known development solution.
  • TMB tetramethyl benzidine
  • ABTS 2,2'-azino-bis(3- ethylbenzothiazoline-6-sulphonic acid)
  • a method for quantifying an amount of hepcidin in a fluid sample using an immunoassay comprising: a) providing a known amount of a tracer reagent consisting of: (1) a peptide having an amino acid sequence of at least a portion of any one of SEQ ID NOS: 1, 3 and 4; (2) at least one hydrophilic spacer consisting of one or more AEEAc residues(ni -6 ) covalently linked to the peptide of step (a)(1) at the amino terminus or a lysine residue in said peptide; and (3) a detector molecule covalently linked to the hydrophilic spacer of (a)(2); b) contacting a fluid sample from a patient with a known amount of said tracer reagent in the presence of an immobilized antibody that specifically binds to an epitope on hepcidin with a dissociation constant of less than about 50 picomolar; c) washing unbound tracer reagent;
  • the secondary detection reagent to be used in such a method is, for example, streptavidin horseradish peroxidase (HRP) or another conventionally known detection reagent.
  • HRP streptavidin horseradish peroxidase
  • the tracer reagent comprises K24-HRP or K18-HRP and the antibody is 583 or an antibody that comprises CDRs of 583.
  • the antibody that comprises the CDRs of 583 comprises variable heavy chain CDRs encoded by SEQ ID NOS: 5, 7 and 9; and variable light chain CDRs encoded by SEQ ID NOS: 11, 13 and 15.
  • the tracer reagent comprises K24-HRP or K18-HRP and the antibody is 1B1 or an antibody that comprises CDRs of 1B1.
  • the antibody that comprises the CDRs of 1B1 comprises variable heavy chain CDRs encoded by SEQ ID NOS: 6, 8 and 10; and variable light chain CDRs encoded by SEQ ID NOS: 12, 14 and 16.
  • the secondary detection reagent comprises streptavidin HRP or another conventionally known detection reagent.
  • the stop solution is HC1, phosphoric acid, H 2 S0 4 or another conventionally known stop solution.
  • the known amount of a tracer reagent can be, for example, an amount of from about 0.05 ng to about 50 ng.
  • the development solution comprises tetramethyl benzidine (TMB), 2,2'-azino-bis(3-ethylbenzothiazoline-6- sulphonic acid) (ABTS) or another conventionally known development solution.
  • TMB tetramethyl benzidine
  • ABTS 2,2'-azino-bis(3-ethylbenzothiazoline-6- sulphonic acid)
  • the peptide of (a)(1) has an amino acid sequence set forth as SEQ ID NO 1.
  • the peptide of (a)(1) has an amino acid sequence set forth as SEQ ID NO 3.
  • the peptide of (a)(1) has an amino acid sequence set forth as SEQ ID NO 4.
  • the antibody that specifically binds to an epitope on hepcidin can specifically binds to hepcidin 20, hepcidin 22 and hepcidin 25.
  • the peptide of (a)(1) can be oxidatively-folded.
  • the secondary detection reagent is streptavidin horseradish peroxidase (HRP) or another conventionally known secondary detection reagent.
  • the tracer reagent comprises K24-HRP or K18-HRP and the antibody is 583 or an antibody that comprises CDRs of 583.
  • the antibody that comprises the CDRs of 583 comprises variable heavy chain CDRs encoded by SEQ ID NOS: 5, 7 and 9; and variable light chain CDRs encoded by SEQ ID NOS: 11, 13 and 15.
  • the tracer reagent comprises K24-HRP or K18-HRP and the antibody is IB l or an antibody that comprises CDRs of IBl .
  • the antibody that comprises the CDRs of IBl comprises variable heavy chain CDRs encoded by SEQ ID NOS: 6, 8 and 10; and variable light chain CDRs encoded by SEQ ID NOS: 12, 14 and 16.
  • the secondary detection reagent comprises streptavidin HRP or another conventionally known detection reagent.
  • the stop solution is HC1, phosphoric acid, H 2 SO 4 or another conventionally known stop solution.
  • the known amount of a tracer reagent can be, for example, an amount of from about 0.05 ng to about 50 ng.
  • the development solution comprises tetramethyl benzidine (TMB), 2,2'- azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) or another conventionally known development solution.
  • TMB tetramethyl benzidine
  • ABTS 2,2'- azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)
  • the peptide of (a)(1) has an amino acid sequence set forth as SEQ ID NO 1.
  • the peptide of (a)(1) has an amino acid sequence set forth as SEQ ID NO 3.
  • the peptide of (a)(1) has an amino acid sequence set forth as SEQ ID NO 4.
  • the antibody that specifically binds to an epitope on hepcidin can specifically binds to hepcidin 20, hepcidin 22 and hepcidin 25.
  • the peptide of (a)(1) can be oxidatively-folded.
  • kits for detecting a level of hepcidin in a fluid sample comprising a tracer reagent, as described herein, and an antibody that specifically binds to hepcidin.
  • the antibody is immobilized on a support.
  • the tracer reagent comprises K18-biotin, K24-biotin, K24-HRP, or K18-HRP.
  • the antibody that specifically binds to hepcidin is antibody 583 or an antibody that comprises CDRs of 583.
  • the antibody that comprises the CDRs of 583 comprises variable heavy chain CDRs encoded by SEQ ID NOS: 5, 7 and 9; and variable light chain CDRs encoded by SEQ ID NOS: 11, 13 and 15.
  • the antibody that specifically binds to hepcidin is antibody 1B1 or an antibody that comprises CDRs of IB 1.
  • the antibody that comprises the CDRs of 1B1 comprises variable heavy chain CDRs encoded by SEQ ID NOS: 6, 8 and 10; and variable light chain CDRs encoded by SEQ ID NOS: 12, 14 and 16.
  • the tracer reagent is K18-biotin, K24-biotin, K24-HRP, or K18-HRP and the antibody is 583 or an antibody that comprises CDRs of 583.
  • the tracer reagent is K18-biotin, K24- biotin, K24-HRP or K18-HRP and the antibody is 1B 1 or an antibody that comprises CDRs of 1B1.
  • the tracer reagent comprises an enzyme.
  • the tracer reagent comprises a binding molecule as a detector molecule.
  • the detector molecule is biotin and the kit further comprises a secondary detection reagent.
  • the secondary detection reagent comprises streptavidin-HRP or another conventionally known secondary detection reagent.
  • detector molecule is horseradish peroxidase and the kit further comprises peroxide.
  • a method of treating iron deficiency anemia in a subject in need thereof comprising: a) measuring a level of hepcidin in a biological sample obtained from the subject; and b) administering a pharmaceutical composition that comprises parenteral iron to the subject if the level of hepcidin is increased relative to a reference level.
  • the method further comprises administering a pharmaceutical composition that comprises oral iron to the subject if the level of hepcidin identified in the sample is not increased relative to a reference level.
  • the method may further comprise: c) measuring the level of hepcidin in a biological sample obtained from the subject after the administering of step b); d) administering a further dose of a pharmaceutical composition that comprises parenteral iron to the subject if the level of hepcidin measured in step c) is increased relative to a reference level.
  • the reference level to be used as a comparator in the subject methods is the hepcidin level of a normal, healthy subject without anemia. Where the reference level is the lower limit of normal (e.g., at the 5 th percentile) in a population of normal, healthy subjects without anemia. In some instances, the level of hepcidin is increased at least 1.5 fold relative to the reference level.
  • the level of hepcidin is increased at least 3.0 fold relative to the reference level.
  • the level of hepcidin is the level of plasma hepcidin.
  • the subject does not have an inflammatory condition; chronic inflammation; and/or abnormal levels of C-reactive protein (CRP).
  • CRP C-reactive protein
  • a step of measuring the level of hepcidin further comprises measuring the level of plasma iron and a step of administration further comprises: administering a pharmaceutical composition that comprises parenteral iron to the subject if the level of plasma Iron/logi 0 (Hepcidin) is decreased relative to the reference level; or administering a pharmaceutical composition that comprises oral iron to the subject if the level of plasma Iron/logio(Hepcidin) is not decreased relative to a reference level.
  • a level of plasma Iron/logi 0 (Hepcidin) which is decreased relative to a reference level indicates that the patient is unlikely to respond to oral iron therapy.
  • a step of measuring the level of hepcidin further comprises measuring the level of TfSat and a step of administration further comprises: administering a pharmaceutical composition that comprises parenteral iron to the subject if the level of Tfsat/logio(Hepcidin) is decreased relative to a reference level; or administering a pharmaceutical composition that comprises oral iron to the subject if the level of Tfsat/logio(Hepcidin) is not decreased relative to a reference level.
  • a level of Tfsat/logio(Hepcidin) which is decreased relative to a reference level indicates that the patient is unlikely to respond to oral iron therapy.
  • the reference level of TfSat/logio(hepcidin) is from about 3.0 to about 5.0, and in some instances, about 4.0.
  • the level of hepcidin is measured using any of the methods described herein.
  • the level of hepcidin is measured by contacting a biological sample with an antibody such as, for example, mAb583, an antibody that comprises the CDRs of mAb583, mAb lB l, or an antibody that comprises the CDRs of mAb lB l .
  • IRIDA Iron-Refractory Iron- Deficiency Anemia
  • Also provided herein is a method of treating anemia in a subject in need thereof, the method comprising:
  • IRIDA Iron-Refractory Iron- Deficiency Anemia
  • a method of treating iron overload in a subject in need thereof comprising: a) measuring the level of hepcidin and at least one of ferritin, iron, or TfSat in a subject diagnosed with primary or secondary iron overload at, at least, two time points; and b) administering or withholding a treatment selected from the group consisting of: transfusions, phlebotomy, hepcidin mimetics, or other any other therapy that modulates erythropoiesis, total body iron, iron available for erythropoiesis or excretion or chelation of iron if the level of: plasma Iron/logi 0 (Hepcidin) changes over time; plasma ferritin/logi 0 (Hepcidin) changes over time; or Tfsat/logi 0 (Hepcidin) changes over time.
  • the iron overload is hereditary hemochromatosis (HH); X-linked sideroblastic anemia (XLSA); or
  • FIG. 1 Diagram describing assignment of ID/A probands into the TMPRSS6 mut/mut and TMPRSS6* /+ cID groups.
  • 139 patients were referred for evaluation of chronic iron deficiency. Patients were included or excluded from the analysis on the basis of the availability of plasma for iron, TIBC, and hepcidin measurements and a TfSat ⁇ 15% at the time of referral. Patients were further subdivided based on the presence or absence of TMPRSS6 mutations. Patients with either two or no MPRSS6 mutations fulfilling the enrollment criteria of adequate samples for analysis of Iron, TIBC, TfSat and hepcidin, and a TfSat ⁇ 15% were analyzed. Those individuals with only a single molecular genetically detectable TMPRSS6 allele and fulfilling the enrollment criteria were subsequently analyzed as part of a validation set.
  • FIG. 2A-2D Plasma hepcidin and derivative indices in IRIDA.
  • FIG. 2A Hepcidin
  • FIG. 2B Iron/Logi 0 (Hepcidin)
  • FIG. 2C TfSat/Logi 0 (Hepcidin);
  • FIG. 2D Sensitivity%.
  • FIG. 3A-3F Plasma TIBC, TfSat, ferritin and derivative indices in iron deficiency.
  • FIG. 3A Iron
  • FIG. 3B TfSat(%)
  • FIG. 3C Ferritin
  • FIG. 3D Hepcidin/Ferritin
  • FIG. 3E Iron/logi 0 (Ferritin)
  • FIG. 3F TfSat/ logi 0 (Ferritin).
  • FIG. 5 Genotyping primers. Alternative primer set from: Guillem F, Lawson S, Kannengiesser C, Westerman M, Beaumont C, Grandchamp B. 2008. Two nonsense mutations in the TMPRSS6 gene in a patient with microcytic anemia and iron deficiency. Blood 112:2089- 2091. Sequence identifiers are noted for each sequence.
  • FIG. 6 Demographic and genetic characteristics of TMPRSS6-mutated and cID subjects. Variants are reported in relation to MPRSS6 reference transcript NM_153609.3 Individuals excluded from the analysis because of incomplete iron, TIBC, and hepcidin data are indicated in underlined text those excluded from the analysis for TfSat>15% are highlighted in bold type. *Patients previously reported in Nature Genetics 2008;40(5):569-571. # Patients previously reported in Human Mutation: Mutation in Brief 2010; 31 :E1390-E1405. ®Patients previously reported in Human Mutation 2014; 35(11): 1321-1329.
  • FIG. 7 Comparison of hematological and iron metabolism characteristics of subjects HGB, hemoglobin; MCV, mean red blood cell volume; TIBC, total iron binding capacity; TfSat, transferrin saturation; ZPP/Heme; zinc protoporphyrin/heme ratio; sTfR, serum transferrin receptor; CRP, C-reactive protein.
  • FIG. 8 Comparison of hepcidin and hepcidin derivative indices in subjects control groups.
  • FIG. 9 Application of ferritin, hepcidin and derivative metrics to the prediction of mutation status in IRIDA patients with one detectable MPRSS6 mutant allele. Cutoff values for each parameter were set at the 90% specificity level as in Table 4 or at 70% probability of having two MPRSS6 mutations in the multivariable models. Patients predicted to NOT have biallelic mutations by these criteria are highlighted in italics. Genotypically concordant sibling pairs are adjacent to one-another and are highlighted in bold or underlined text.
  • FIG. 10 Comparison of hematological and iron metabolism characteristics of HH and XLS A subjects.
  • HGB hemoglobin
  • MCV mean red blood cell volume
  • TIBC total iron binding capacity
  • TfSat transferrin saturation
  • ZPP/Heme zinc protoporphyrin/heme ratio.
  • references to “a method” include one or more methods, and/or steps of the type described herein and/or which will become apparent to those persons skilled in the art upon reading this disclosure.
  • the term “about” means ⁇ 10% of the indicated value.
  • “about” refers to ⁇ 0.05%, ⁇ 0.1%, ⁇ 0.2%, 0.25%, ⁇ 0.5%, ⁇ 1.0%, ⁇ 1.5%, ⁇ 2.0%, ⁇ 2.5%, ⁇ 3.0%, ⁇ 3.5%, ⁇ 4.0%, ⁇ 4.5%, ⁇ 5.0%, ⁇ 5.5%, ⁇ 6.0%, ⁇ 6.5%, ⁇ 7.0%, ⁇ 7.5%, ⁇ 8.0%, ⁇ 8.5%, ⁇ 9.0%, ⁇ 9.5%, or ⁇ 10.0%.
  • antibody refers to an immunoglobulin (Ig) whether natural or partly or wholly synthetically produced.
  • Ig immunoglobulin
  • the term also covers any polypeptide or protein having a binding domain which is, or is homologous to, an antigen-binding domain.
  • the term further includes “antigen-binding fragments” and other interchangeable terms for similar binding fragments such as described below.
  • Complementarity determining region (CDR) grafted antibodies and other humanized antibodies are also contemplated by this term.
  • Native antibodies and native immunoglobulins are usually heterotetrameric glycoproteins of about 150,000 Daltons, composed of two identical light (L) chains and two identical heavy (H) chains. Each light chain is typically linked to a heavy chain by one covalent disulfide bond, while the number of disulfide linkages varies among the heavy chains of different immunoglobulin isotypes. Each heavy and light chain also has regularly spaced intrachain disulfide bridges. Each heavy chain has at one end a variable domain ("VH”) followed by a number of constant domains ("CH").
  • VH variable domain
  • CH constant domains
  • Each light chain has a variable domain at one end (“VL”) and a constant domain (“CL”) at its other end; the constant domain of the light chain is aligned with the first constant domain of the heavy chain, and the light-chain variable domain is aligned with the variable domain of the heavy chain. Particular amino acid residues are believed to form an interface between the light- and heavy-chain variable domains.
  • synthetic polynucleotide means that the corresponding polynucleotide sequence or portion thereof, or amino acid sequence or portion thereof, is derived, from a sequence that has been designed, or synthesized de novo, or modified, compared to an equivalent naturally-occurring sequence.
  • Synthetic polynucleotides (antibodies or antigen binding fragments) or synthetic genes can be prepared by methods known in the art, including but not limited to, the chemical synthesis of nucleic acid or amino acid sequences.
  • Synthetic genes are typically different from naturally- occurring genes, either at the amino acid, or polynucleotide level, (or both) and are typically located within the context of synthetic expression control sequences.
  • synthetic gene sequences can include amino acid, or polynucleotide, sequences that have been changed, for example, by the replacement, deletion, or addition, of one or more, amino acids, or nucleotides, thereby providing an antibody amino acid sequence, or a polynucleotide coding sequence that is different from the source sequence.
  • Synthetic gene polynucleotide sequences may not necessarily encode proteins with different amino acids, compared to the natural gene; for example, they can also encompass synthetic polynucleotide sequences that incorporate different codons but which encode the same amino acid (i.e., the nucleotide changes represent silent mutations at the amino acid level).
  • variable domain refers to the variable domains of antibodies that are used in the binding and specificity of each particular antibody for its particular antigen.
  • variability is not evenly distributed throughout the variable domains of antibodies. Rather, it is concentrated in three segments called hypervariable regions (also known as CDRs) in both the light chain and the heavy chain variable domains. More highly conserved portions of variable domains are called the "framework regions" or "FRs.”
  • the variable domains of unmodified heavy and light chains each contain four FRs (FR1, FR2, FR3 and FR4), largely adopting a ⁇ -sheet configuration interspersed with three CDRs which form loops connecting and, in some cases, part of the ⁇ -sheet structure.
  • the CDRs in each chain are held together in close proximity by the FRs and, with the CDRs from the other chain, contribute to the formation of the antigen-binding site of antibodies (see Kabat et al, Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991), pages 647-669).
  • the CDRs comprise amino acid residues from three sequence regions which bind in a complementary manner to an antigen and are known as CDR1, CDR2, and CDR3 for each of the VH and VL chains.
  • the CDRs typically correspond to approximately residues 24-34 (CDRLl), 50- 56 (CDRL2) and 89-97 (CDRL3)
  • the CDRs typically correspond to approximately residues 31-35 (CDRH1), 50-65 (CDRH2) and 95-102 (CDRH3) according to Kabat et al., Id.
  • the CDRs of different antibodies may contain insertions, thus the amino acid numbering may differ.
  • the Kabat numbering system accounts for such insertions with a numbering scheme that utilizes letters attached to specific residues ⁇ e.g., 27A, 27B, 27C, 27D, 27E, and 27F of CDRLl in the light chain) to reflect any insertions in the numberings between different antibodies.
  • the CDRs typically correspond to approximately residues 26-32 (CDRLl), 50-52 (CDRL2) and 91- 96 (CDRL3)
  • the CDRs typically correspond to approximately residues 26-32 (CDRH1), 53-55 (CDRH2) and 96-101 (CDRH3) according to Chothia and Lesk, J Mol. Biol, 196: 901-917 (1987)).
  • framework region refers to framework amino acid residues that form a part of the antigen binding pocket or groove.
  • the framework residues form a loop that is a part of the antigen binding pocket or groove and the amino acids residues in the loop may or may not contact the antigen.
  • Framework regions generally comprise the regions between the CDRs.
  • the FRs typically correspond to approximately residues 0-23 (FRLl), 35-49 (FRL2), 57-88 (FRL3), and 98-109 and in the heavy chain variable domain the FRs typically correspond to approximately residues 0-30 (FRHl), 36-49 (FRH2), 66-94 (FRH3), and 103-133 according to Kabat et al, Id.
  • the heavy chain too accounts for insertions in a similar manner ⁇ e.g., 35 A, 35B of CDRHl in the heavy chain).
  • the FRs typically correspond to approximately residues 0-25 (FRLl), 33- 49 (FRL2) 53-90 (FRL3), and 97-109 (FRL4)
  • the FRs typically correspond to approximately residues 0-25 (FRHl), 33-52 (FRH2), 56-95 (FRH3), and 102-113 (FRH4) according to Chothia and Lesk, Id.
  • the loop amino acids of a FR can be assessed and determined by inspection of the three- dimensional structure of an antibody heavy chain and/or antibody light chain.
  • the three- dimensional structure can be analyzed for solvent accessible amino acid positions as such positions are likely to form a loop and/or provide antigen contact in an antibody variable domain. Some of the solvent accessible positions can tolerate amino acid sequence diversity and others (e.g., structural positions) are, generally, less diversified.
  • the three dimensional structure of the antibody variable domain can be derived from a crystal structure or protein modeling.
  • Constant domains (Fc) of antibodies are not involved directly in binding an antibody to an antigen but, rather, exhibit various effector functions, such as participation of the antibody in antibody-dependent cellular toxicity via interactions with, for example, Fc receptors (FcR). Fc domains can also increase bioavailability of an antibody in circulation following administration to a subject.
  • immunoglobulins can be assigned to different classes. There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, and several of these can be further divided into subclasses (isotypes), e.g., IgGl, IgG2, IgG3, IgG4, IgAl, and IgA2.
  • the heavy-chain constant domains (Fc) that correspond to the different classes of immunoglobulins are called ⁇ , ⁇ , ⁇ , ⁇ , and ⁇ , respectively.
  • the subunit structures and three-dimensional configurations of different classes of immunoglobulins are well known.
  • the "light chains" of antibodies (immunoglobulins) from any vertebrate species can be assigned to one of two clearly distinct types, called kappa or (" ⁇ ") and lambda or (" ⁇ "), based on the amino acid sequences of their constant domains.
  • antigen-binding portion of an antibody refers to one or more fragments of an antibody that retain the ability to specifically bind to an antigen.
  • Non-limiting examples of antibody fragments included within such terms include, but are not limited to, (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CHI domains; (ii) a F(ab')2 fragment, a bivalent fragment containing two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the VH and CHI domains; (iv) a Fv fragment containing the VL and VH domains of a single arm of an antibody, (v) a dAb fragment (Ward et al, (1989) Nature 341 :544 546), which containing a VH domain; and (vi) an isolated CDR. Additionally included in this definition are "one-half antibodies comprising a single heavy chain and a single light chain. Other forms of single chain antibodies, such as diabodies are also encompassed herein.
  • F(ab') 2 " and "Fab"' moieties can be produced by treating an Ig with a protease such as pepsin and papain, and include antibody fragments generated by digesting immunoglobulin near the disulfide bonds existing between the hinge regions in each of the two heavy chains.
  • a protease such as pepsin and papain
  • papain cleaves IgG upstream of the disulfide bonds existing between the hinge regions in each of the two heavy chains to generate two homologous antibody fragments in which an light chain composed of VL and CL (light chain constant region), and a heavy chain fragment composed of VH and CHyl ( ⁇ ) region in the constant region of the heavy chain) are connected at their C terminal regions through a disulfide bond.
  • Fab' Each of these two homologous antibody fragments is called Fab'.
  • Pepsin also cleaves IgG downstream of the disulfide bonds existing between the hinge regions in each of the two heavy chains to generate an antibody fragment slightly larger than the fragment in which the two above-mentioned Fab' are connected at the hinge region. This antibody fragment is called F(ab') 2 .
  • the Fab fragment also contains the constant domain of the light chain and the first constant domain (CHI) of the heavy chain.
  • Fab' fragments differ from Fab fragments by the addition of a few residues at the carboxyl terminus of the heavy chain CHI domain including one or more cysteine(s) from the antibody hinge region.
  • Fab'-SH is the designation herein for Fab' in which the cysteine residue(s) of the constant domains bear a free thiol group.
  • F(ab') 2 antibody fragments originally were produced as pairs of Fab' fragments which have hinge cysteines between them. Other chemical couplings of antibody fragments are also known.
  • Fv refers to an antibody fragment which contains a complete antigen-recognition and antigen-binding site. This region consists of a dimer of one heavy chain and one light chain variable domain in tight, non-covalent or covalent association (disulfide linked Fv's have been described in the art, Reiter et al., (1996) Nature Biotechnology 14: 1239-1245). It is in this configuration that the three CDRs of each variable domain interact to define an antigen-binding site on the surface of the VH-VL dimer.
  • a combination of one or more of the CDRs from each of the VH and VL chains confer antigen-binding specificity to the antibody.
  • the CDRH3 and CDRL3 could be sufficient to confer antigen-binding specificity to an antibody when transferred to VH and VL chains of a recipient antibody or antigen-binding fragment thereof and this combination of CDRs can be tested for binding, affinity, etc. using any of the techniques described herein.
  • Even a single variable domain (or half of an Fv comprising only three CDRs specific for an antigen) has the ability to recognize and bind antigen, although likely at a lower affinity than when combined with a second variable domain.
  • VL and VH the two domains of a Fv fragment
  • VL and VH are coded for by separate genes
  • they can be joined using recombinant methods by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv)).
  • scFvs are also intended to be encompassed within the term "antigen-binding portion" of an antibody.
  • Any VH and VL sequences of specific scFv can be linked to an Fc region cDNA or genomic sequences, in order to generate expression vectors encoding complete Ig (e.g., IgG) molecules or other isotypes.
  • VH and VL can also be used in the generation of Fab, Fv or other fragments of Igs using either protein chemistry or recombinant DNA technology.
  • Single-chain Fv or “sFv” antibody fragments comprise the VH and VL domains of an antibody, wherein these domains are present in a single polypeptide chain.
  • the Fv polypeptide further comprises a polypeptide linker between the VH and VL domains which enables the sFv to form the desired structure for antigen binding.
  • AVEVIER® refers to a class of therapeutic proteins of human origin, which are unrelated to antibodies and antibody fragments, and are composed of several modular and reusable binding domains, referred to as A-domains (also referred to as class A module, complement type repeat, or LDL-receptor class A domain). They were developed from human extracellular receptor domains by in vitro exon shuffling and phage display (Silverman et al., 2005, Nat. Biotechnol. 23 : 1493-1494; Silverman et al, 2006, Nat. Biotechnol. 24:220).
  • the resulting proteins can contain multiple independent binding domains that can exhibit improved affinity (in some cases, sub-nanomolar) and specificity compared with single-epitope binding proteins. See, for example, U.S. Patent Application Publ. Nos. 2005/0221384, 2005/0164301, 2005/0053973 and 2005/0089932, 2005/0048512, and 2004/0175756, each of which is hereby incorporated by reference herein in its entirety.
  • Each of the known 217 human A-domains comprises -35 amino acids ( ⁇ 4 kDa); and these domains are separated by linkers that average five amino acids in length.
  • Native A- domains fold quickly and efficiently to a uniform, stable structure mediated primarily by calcium binding and disulfide formation.
  • a conserved scaffold motif of only 12 amino acids is required for this common structure.
  • the end result is a single protein chain containing multiple domains, each of which represents a separate function.
  • Each domain of the proteins binds independently and the energetic contributions of each domain are additive. These proteins were called "AVEVIERs®" from avidity multimers.
  • diabodies refers to small antibody fragments with two antigen-binding sites, which fragments comprise a heavy chain variable domain (VH) connected to a light chain variable domain (VL) in the same polypeptide chain (VH-VL).
  • VH heavy chain variable domain
  • VL light chain variable domain
  • linker that is too short to allow pairing between the two domains on the same chain, the domains are forced to pair with the complementary domains of another chain and create two antigen-binding sites.
  • Antigen-binding polypeptides also include heavy chain dimers such as, for example, antibodies from camelids and sharks.
  • Camelid and shark antibodies comprise a homodimeric pair of two chains of V-like and C-like domains (neither has a light chain). Since the VH region of a heavy chain dimer IgG in a camelid does not have to make hydrophobic interactions with a light chain, the region in the heavy chain that normally contacts a light chain is changed to hydrophilic amino acid residues in a camelid. VH domains of heavy-chain dimer IgGs are called VHH domains.
  • Shark Ig-NARs comprise a homodimer of one variable domain (termed a V- NAR domain) and five C-like constant domains (C-NAR domains).
  • camelids the diversity of antibody repertoire is determined by the CDRs 1, 2, and 3 in the VH or VHH regions.
  • the CDR3 in the camel VHH region is characterized by its relatively long length, averaging 16 amino acids. This is in contrast to CDR3 regions of antibodies of many other species.
  • the CDR3 of mouse VH has an average of 9 amino acids.
  • Humanized forms of non-human ⁇ e.g., murine) antibodies include chimeric antibodies which contain minimal sequence derived from a non-human Ig.
  • humanized antibodies are human Igs (recipient antibody) in which one or more of the CDRs of the recipient are replaced by CDRs from a non-human species antibody (donor antibody) such as mouse, rat, rabbit or non-human primate having the desired specificity, affinity and binding function.
  • donor antibody such as mouse, rat, rabbit or non-human primate having the desired specificity, affinity and binding function.
  • one or more FR amino acid residues of the human Ig are replaced by corresponding non-human amino acid residues.
  • humanized antibodies can contain residues which are not found in the recipient antibody or in the donor antibody. These modifications can be made to refine antibody performance, if needed.
  • a humanized antibody can comprise substantially all of at least one and, in some cases two, variable domains, in which all or substantially all of the hypervariable regions correspond to those of a non-human immunoglobulin and all, or substantially all, of the FRs are those of a human immunoglobulin sequence.
  • the humanized antibody optionally can also include at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin.
  • Fc immunoglobulin constant region
  • a humanized antibody also includes antibodies in which part, or all of the CDRs of the heavy and light chain are derived from a non-human monoclonal antibody, substantially all the remaining portions of the variable regions are derived from human variable region (both heavy and light chain), and the constant regions are derived from a human constant region.
  • the CDR1, CDR2 and CDR3 regions of the heavy and light chains are derived from a non-human antibody.
  • at least one CDR ⁇ e.g., a CDR3) of the heavy and light chains is derived from a non-human antibody.
  • Various combinations of CDR1, CDR2, and CDR3 can be derived from a non-human antibody and are contemplated herein.
  • one or more of the CDR1, CDR2 and CDR3 regions of each of the heavy and light chains are derived from the sequences provided herein.
  • the term "monoclonal antibody” as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Furthermore, in contrast to conventional (polyclonal) antibody preparations, which can include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen.
  • monoclonal indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method.
  • monoclonal antibodies can be made by the hybridoma method first described by Kohler et al., Nature 256:495 (1975), or can be made by recombinant DNA methods (see, e.g., U.S. Pat. No. 4,816,567).
  • the monoclonal antibodies can be isolated from phage antibody libraries using the techniques described in Clackson et al., Nature 352:624-628 (1991) and Marks et al, J. Mol. Biol. 222:581-597 (1991), for example.
  • Antibodies can be isolated and purified from the culture supernatant or ascites mentioned above by saturated ammonium sulfate precipitation, euglobulin precipitation method, caproic acid method, caprylic acid method, ion exchange chromatography (DEAE or DE52), or affinity chromatography using anti-Ig column or a protein A, G or L column such as described in more detail below.
  • Exemplary antibodies for use in the compositions and methods described herein are intact immunoglobulin molecules, such as, for example, a humanized antibody or those portions of a humanized Ig molecule that contain the antigen binding site ⁇ i.e., paratope) or a single heavy chain and a single light chain, including those portions known in the art as Fab, Fab ' , F(ab) ' , F(ab ' )2, Fd, scFv, a variable heavy domain, a variable light domain, a variable NAR domain, bi-specific scFv, a bi-specific Fab 2 , a tri-specific Fab 3 and a single chain binding polypeptides and others also referred to as antigen-binding fragments.
  • variable regions or portions thereof may be fused to, connected to, or otherwise joined to one or more constant regions or portions thereof to produce any of the antibodies or fragments thereof described herein. This may be accomplished in a variety of ways known in the art, including but not limited to, molecular cloning techniques or direct synthesis of the nucleic acids encoding the molecules. Exemplary non-limiting methods of constructing these molecules can also be found in the examples described herein. [0057] Methods for making bispecific or other multispecific antibodies are known in the art and include chemical cross-linking, use of leucine zippers; diabody technology; scFv dimers, linear antibodies; and chelating recombinant antibodies.
  • Linear antibodies comprise a pair of tandem Fd segments (VH-CH1-VH-CH1) which form a pair of antigen binding regions. Linear antibodies can be bispecific or monospecific.
  • anti-hepcidin antibodies disclosed herein can also be constructed to fold into multivalent forms, which may improve binding affinity, specificity and/or increased half-life in blood.
  • Multivalent forms of anti-hepcidin antibodies can be prepared by techniques known in the art.
  • Bispecific or multispecific antibodies include cross-linked or "heteroconjugate" antibodies.
  • one of the antibodies in the heteroconjugate can be coupled to avidin, the other to biotin.
  • Heteroconjugate antibodies may be made using any convenient cross-linking methods. Suitable cross-linking agents are well known in the art, and are disclosed in U.S. Pat. No. 4,676,980, along with a number of cross-linking techniques. Another method is designed to make tetramers by adding a streptavidin-coding sequence at the C-terminus of the scFv. Streptavidin is composed of four subunits, so when the scFv-streptavidin is folded, four subunits associate to form a tetramer.
  • the interface between a pair of antibody molecules can be engineered to maximize the percentage of heterodimers which are recovered from recombinant cell culture.
  • One interface comprises at least a part of the CH3 domain of an antibody constant domain.
  • one or more small amino acid side chains from the interface of the first antibody molecule are replaced with larger side chains (e.g., tyrosine or tryptophan).
  • Compensatory "cavities" of identical or similar size to the large side chain(s) are created on the interface of the second antibody molecule by replacing large amino acid side chains with smaller ones (e.g., alanine or threonine). This provides a mechanism for increasing the yield of the heterodimer over other unwanted end-products such as homodimers.
  • bispecific or multispecific antibodies can be prepared using chemical linkage.
  • Brennan et al, Science 229:81 (1985) describe a procedure wherein intact antibodies are proteolytically cleaved to generate F(ab')2 fragments. These fragments are reduced in the presence of the dithiol complexing agent sodium arsenite to stabilize vicinal dithiols and prevent intermolecular disulfide formation.
  • the Fab' fragments generated are then converted to thionitrobenzoate (TNB) derivatives.
  • Fab'-TNB derivatives is then reconverted to the Fab'-thiol by reduction with mercaptoethylamine and is mixed with an equimolar amount of the other Fab'-TNB derivative to form the bispecific antibody.
  • the bispecific antibodies produced can be used as agents for the selective immobilization of enzymes. Better et al, Science 240: 1041-1043 (1988) disclose secretion of functional antibody fragments from bacteria. For example, Fab'-SH fragments can be directly recovered from E. coli and chemically coupled to form bispecific antibodies.
  • bispecific antibodies have been produced using leucine zippers, e.g., GCN4.
  • leucine zipper peptides from the Fos and Jun proteins were linked to the Fab' portions of two different antibodies by gene fusion.
  • the antibody homodimers were reduced at the hinge region to form monomers and then re-oxidized to form the antibody heterodimers. This method can also be utilized for the production of antibody homodimers.
  • minibody refers to a scFv fused to CH3 via a peptide linker (hingeless) or via an IgG hinge.
  • a “maxibody” refers to a bivalent scFv covalently attached to the Fc region of an immunoglobulin.
  • an "intrabody” refers to a single chain antibody which demonstrates intracellular expression and can manipulate intracellular protein function. Intrabodies, which comprise cell signal sequences which retain the antibody construct in intracellular regions, may be produced as described in Mhashilkar et al, (EMBO J, 14: 1542-51, 1995) and Wheeler et al, (FASEB J, 17: 1733-5. 2003). Transbodies are cell-permeable antibodies in which a protein transduction domain (PTD) is fused with single chain variable fragment (scFv) antibodies Heng et al, (Med Hypotheses, 64: 1105-8, 2005).
  • PTD protein transduction domain
  • scFv single chain variable fragment
  • antibodies that are SMTPs or binding domain immunoglobulin fusion proteins specific for target protein. These constructs are single-chain polypeptides comprising antigen binding domains fused to immunoglobulin domains necessary to carry out antibody effector functions. See e.g., WO03/041600, U.S. Patent publication 20030133939 and US Patent Publication 20030118592, which are hereby incorporated by reference.
  • the application contemplates a single chain binding polypeptide having a heavy chain variable region, and/or a light chain variable region which binds an epitope described herein and has, optionally, an immunoglobulin Fc region.
  • a single chain variable fragment scFv
  • Methods of preparing single chain binding polypeptides are known in the art (e.g., U. S. Patent Application No. 2005/0238646).
  • germline gene segments or “germline sequences” refer to the genes from the germline (the haploid gametes and those diploid cells from which they are formed).
  • the germline DNA contains multiple gene segments that encode a single Ig heavy or light chain. These gene segments are carried in the germ cells but cannot be transcribed and translated into heavy and light chains until they are arranged into functional genes. During B-cell differentiation in the bone marrow, these gene segments are randomly shuffled by a dynamic genetic system capable of generating more than 108 specificities. Most of these gene segments are published and collected by the germline database.
  • Binding affinity and/or avidity of antibodies or antigen-binding fragments thereof may be improved by modifying framework regions.
  • Methods for modifications of framework regions are known in the art and are contemplated herein.
  • Selection of one or more relevant framework amino acid positions to alter depends on a variety of criteria.
  • One criterion for selecting relevant framework amino acids to change can be the relative differences in amino acid framework residues between the donor and acceptor molecules. Selection of relevant framework positions to alter using this approach has the advantage of avoiding any subjective bias in residue determination or any bias in CDR binding affinity contribution by the residue.
  • immunosorbent refers to antibodies or antigen-binding fragments thereof that are specific to a sequence of amino acid residues ("binding site” or “epitope"), yet if are cross-reactive to other peptides/proteins, are not toxic at the levels at which they are formulated for administration to human use.
  • binding refers to a direct association between two molecules, due to, for example, covalent, electrostatic, hydrophobic, and ionic and/or hydrogen-bond interactions under physiological conditions, and including interactions such as salt bridges and water bridges and any other conventional binding means.
  • binding agent binds to the binding site with greater affinity than it binds unrelated amino acid sequences.
  • affinity is at least 1-fold greater, at least 2-fold greater, at least 3-fold greater, at least 4-fold greater, at least 5-fold greater, at least 6-fold greater, at least 7-fold greater, at least 8-fold greater, at least 9-fold greater, 10-fold greater, at least 20-fold greater, at least 30-fold greater, at least 40-fold greater, at least 50-fold greater, at least 60-fold greater, at least 70-fold greater, at least 80-fold greater, at least 90-fold greater, at least 100-fold greater, or at least 1000-fold greater than the affinity of the binding agent for unrelated amino acid sequences.
  • immunoreactive and “preferentially binds” are used interchangeably herein.
  • the term "affinity” refers to the equilibrium constant for the reversible binding of two agents and is expressed as K D .
  • the antibodies, or antigen- binding fragments thereof exhibit desirable characteristics such as binding affinity as measured by K D (equilibrium dissociation constant) for hepcidin in the range of l x lO "6 M or less, or ranging down to 10 "16 M or lower, (e.g., about 10 "7 , 10 "8 , 10 “9 , 10 "10 , 10 "11 , 10 "12 , 10 “13 , 10 “14 , 10 " 15 , 10 "16 M or less).
  • the equilibrium dissociation constant can be determined in solution equilibrium assay using BIAcore and/or KinExA.
  • the term "avidity” refers to the resistance of a complex of two or more agents to dissociation after dilution. Apparent affinities can be determined by methods such as an enzyme linked immunosorbent assay (ELISA) or any other technique familiar to one of skill in the art. Avidities can be determined by methods such as a Scatchard analysis or any other technique familiar to one of skill in the art.
  • Epitope refers to that portion of an antigen or other macromolecule capable of forming a binding interaction with the variable region binding pocket of an antibody. Such binding interactions can be manifested as an intermolecular contact with one or more amino acid residues of one or more CDRs.
  • Antigen binding can involve, for example, a CDR3 or a CDR3 pair or, in some cases, interactions of up to all six CDRs of the variable heavy (VH) and variable light (VL) chains.
  • An epitope can be a linear peptide sequence (i.e., “continuous") or can be composed of noncontiguous amino acid sequences (i.e., "conformational” or “discontinuous").
  • An antibody can recognize one or more amino acid sequences; therefore an epitope can define more than one distinct amino acid sequence.
  • Epitopes recognized by antibodies can be determined by peptide mapping and sequence analysis techniques well known to one of skill in the art. Binding interactions are manifested as intermolecular contacts with one or more amino acid residues of a CDR.
  • the term "specific” refers to a situation in which an antibody will not show any significant binding to molecules other than the antigen containing the epitope recognized by the antibody.
  • the term is also applicable where for example, an antigen binding domain is specific for a particular epitope which is carried by a number of antigens, in which case the antibody or antigen-binding fragment thereof carrying the antigen binding domain will be able to bind to the various antigens carrying the epitope.
  • preferentially binds or “specifically binds” mean that the antibodies or fragments thereof bind to an epitope with greater affinity than it binds unrelated amino acid sequences, and, if cross-reactive to other polypeptides containing the epitope, are not toxic at the levels at which they are formulated for administration to human use.
  • such affinity is at least 1-fold greater, at least 2-fold greater, at least 3-fold greater, at least 4-fold greater, at least 5-fold greater, at least 6-fold greater, at least 7-fold greater, at least 8-fold greater, at least 9-fold greater, 10-fold greater, at least 20-fold greater, at least 30- fold greater, at least 40-fold greater, at least 50-fold greater, at least 60-fold greater, at least 70- fold greater, at least 80-fold greater, at least 90-fold greater, at least 100-fold greater, or at least 1000-fold greater than the affinity of the antibody or fragment thereof for unrelated amino acid sequences.
  • immunoreactive binds
  • preferentially binds and “specifically binds” are used interchangeably herein.
  • binding refers to a direct association between two molecules, due to, for example, covalent, electrostatic, hydrophobic, and ionic and/or hydrogen-bond interactions under physiological conditions, and includes interactions such as salt bridges and water bridges, as well as any other conventional means of binding.
  • Antibodies may be screened for binding affinity by methods known in the art including, but not limited to, gel-shift assays, Western blots, radiolabeled competition assay, co- fractionation by chromatography, co-precipitation, cross linking, ELISA, and the like, which are described in, for example, Current Protocols in Molecular Biology (1999) John Wiley & Sons, NY, which is incorporated herein by reference in its entirety.
  • Antibodies which bind to the desired epitope on the target antigen may be screened in a routine cross-blocking assay such as described in Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory, Ed Harlow and David Lane (1988), can be performed. Routine competitive binding assays may also be used, in which an unknown antibody is characterized by its ability to inhibit binding of target to a target-specific antibody of the invention. Intact antigen, fragments thereof such as the extracellular domain, or linear epitopes can be used.
  • Antibodies that inhibit or neutralize human hepcidin activity may be identified by contacting hepcidin with an antibody, comparing hepcidin activity in the presence and absence of the test antibody, and determining whether the presence of the antibody decreases activity of the hepcidin.
  • the biological activity of a particular antibody, or combination of antibodies may be evaluated in vivo using a suitable animal model, including any of those described herein.
  • isolated when applied to polypeptides means a polypeptide or a portion thereof which, by virtue of its origin or manipulation: (i) is present in a host cell as the expression product of a portion of an expression vector; or (ii) is linked to a protein or other chemical moiety other than that to which it is linked in nature; or (iii) does not occur in nature, for example, a protein that is chemically manipulated by appending, or adding at least one hydrophobic moiety to the protein so that the protein is in a form not found in nature.
  • isolated it is further meant a protein that is: (i) synthesized chemically; or (ii) expressed in a host cell and purified away from associated and contaminating proteins.
  • the term generally means a polypeptide that has been separated from other proteins and nucleic acids with which it naturally occurs.
  • the polypeptide is also separated from substances such as antibodies or gel matrices (polyacrylamide) which are used to purify it.
  • An immunoglobulin heavy chain can be derived from any antibody isotype, e.g., IgG, IgA, IgE, IgD and IgM and any of the isotype sub-classes, including, for example, IgGl, IgG2b, IgG2a, IgG3 and IgG4.
  • An antibody provided herein may be modified (labeled) to include a tracer for detection of an antibody during an assay.
  • Methods for modifying an antibody are well known in the art and are contemplated herein.
  • Non-limiting examples of reporter molecules which have been conjugated to polypeptides include enzymes, radiolabels, haptens, fluorescent labels, phosphorescent molecules, chemiluminescent molecules, chromophores, luminescent molecules, photoaffinity molecules, colored particles or ligands, such as biotin.
  • Detectable labels include compounds and/or elements that can be detected due to their specific functional properties, and/or chemical characteristics, the use of which allows the polypeptide to which they are attached to be detected, and/or further quantified if desired.
  • detectable (imaging) agents are known in the art, as are methods for their attachment to polypeptides (see, for e.g., U.S. Pat. Nos. 5,021,236; 4,938,948; and 4,472,509, each of which is hereby incorporated by reference).
  • Methods of joining polypeptides such as antibodies with detectable moieties include, for example, recombinant DNA technology to form fusion proteins and conjugation (e.g., chemical conjugation). Methods for preparing fusion proteins by chemical conjugation or recombinant engineering are well-known in the art. Methods of covalently and non-covalently linking components are also known in the art. See, e.g., Williams (1995) Biochemistry 34: 1787 1797; Dobeli (1998) Protein Expr. Purif. 12:404-414; and Kroll (1993) DNA Cell. Biol. 12: 441-453.
  • Hepcidin is a 25 amino acid peptide hormone that regulates iron homeostasis. Genetic or acquired hepcidin deficiency or excess is the main or contributing cause of major diseases of iron regulation. In other diseases where iron homeostasis is disturbed, blood hepcidin concentrations reflect the physiologic response to the body's iron status.
  • Hepcidin is the master regulator of iron metabolism, intestinal iron absorption, recycling of senescent RBCs and iron via macrophages, and efflux to plasma from hepatocytes in humans. It regulates extracellular iron in response to changes in dietary and systemic iron, anemia, hypoxia, inflammation and erythropoiesis. Hepcidin is an acute phase protein increased in anemia of inflammation and IL-6 is a principal regulator of hepcidin during inflammation. Hepcidin inhibits cellular iron efflux by binding to and inducing internalization of the sole known iron exporter, ferroportin (FPN1), which mediates iron absorption from intestine and iron recycling by macrophages. Synthetic hepcidin injected into mice rapidly lowers serum iron levels, confirming its central role in regulating iron availability.
  • FPN1 ferroportin
  • hepcidin-related disorder refers to a condition caused by or associated with an abnormal level of hepcidin (e.g., hepcidin excess or hepcidin deficiency relative to the degree of anemia or iron stored) which disrupts iron homeostasis.
  • a disruption in iron homeostasis can in turn result in secondary diseases such as anemia.
  • Acute or chronic inflammatory conditions can result in up-regulation of hepcidin expression, which can result in decreased circulating iron levels, which can cause anemia or worsen existing anemia.
  • Exemplary hepcidin-related inflammatory diseases include anemia of cancer, anemia of chronic disease, anemia of inflammation, chemotherapy-induced anemia, chronic kidney disease (stage I, II, III, IV or V), end stage renal disease, chronic renal failure congestive heart failure, cancer, rheumatoid arthritis, systemic lupus erythematosus, Crohn's disease, H. pylori infection or other bacterial infections, hepatitis C, HIV, and other viral illnesses, arteriosclerosis, atherosclerosis, cirrhosis of the liver, pancreatitis, sepsis, vasculitis, iron-deficiency, hypochromic microcytic anemia and conditions with hepcidin excess.
  • the phrase "disease (or disorder) of iron homeostasis” refers to a condition in which a subject's iron levels require modulation. It includes hepcidin-related disorders; conditions not associated with elevated levels of hepcidin that nevertheless would benefit from inhibition of hepcidin activity, such as a disruption in iron homeostasis not caused by hepcidin; diseases where aberrant iron absorption, recycling, metabolism or excretion causes a disruption in normal iron blood levels or tissue distribution; diseases where iron dysregulation is a consequence of another disease or condition, such as inflammation, cancer or chemotherapy; diseases or disorders resulting from abnormal iron blood levels or tissue distribution; and diseases or disorders that can be treated by modulating iron levels or distribution.
  • Non-limiting examples of such diseases or disorders of iron homeostasis, hepcidin-related disorders and inflammatory conditions which can result in hepcidin excess include African iron overload, iron refractory iron deficiency anemia (IRIDA), alpha-thalassemia, beta-thalassemia intermedia or major, Alzheimer's disease, anemia, anemia of cancer, anemia of chronic disease, anemia of inflammation, arteriosclerosis or atherosclerosis (including coronary artery disease, cerebrovascular disease or peripheral occlusive arterial disease), ataxias, ataxias related to iron, atransferrinemia, cancer, ceruloplasmin deficiency, chemotherapy-induced anemia, chronic renal/kidney disease (stage I, II, III, IV or V), including end stage renal disease or chronic renal/kidney failure, acute kidney injury (AKI), cardiopulmonary bypass-associated AKI, drug or toxin-associated AKI, cirrhosis of liver, classic hemochromatosis, collagen-induced arthritis (CIA), conditions with
  • Hallervordan-Spatz Disease hereditary hemochromatosis, acquired hemochromatosis, hemochromatosis resulting from mutations in transferrin receptor 2, hemoglobinopathies, hepatitis, hepatitis (Brock), hepatitis C, hepatocellular carcinoma, HIV or other viral illnesses, Huntington's disease, hyperferritinemia, hypochromic microcytic anemia, hypoferremia, insulin resistance, iron deficiency anemia, iron deficiency disorders, iron overload disorders, iron-deficiency conditions with hepcidin excess, juvenile hemochromatosis (HFE2), multiple sclerosis, mutation in transferrin receptor 2, HFE, hemojuvelin, ferroportin or other genes of iron metabolism, neonatal hemochromatosis, neurodegenerative diseases related to iron, osteopenia, osteoporosis pancreatitis, Pantothenate kinase-associated neurodegeneration
  • Hallervordan-Spatz Disease hereditary hemochromatosis
  • Non-inflammatory conditions which are implicated in a disruption of iron regulation include, but are not limited to, vitamin B6 deficiency, vitamin B12 deficiency, folate deficiency, pellagra, funicular myelosis, pseudoencephalitis, Parkinson's Disease, Alzheimer's Disease, coronary heart disease, osteopenia and osteoporosis, hemoglobinopathies and disorders of red cell metabolism, and peripheral occlusive arterial disease.
  • HH Hereditary Hemochromatosis
  • HH Hereditary Hemochromatosis
  • Iron-induced tissue damage can result in organ failure and death.
  • Loss of hepcidin production due to loss-of-function mutations in the hepcidin gene itself causes juvenile hemochromatosis, the most severe form of hereditary hemochromatosis.
  • HH caused by mutations in genes other than hepcidin all manifest relative or absolute hepcidin deficiency. In sum, inappropriately low hepcidin levels in HH patients allow unrestrained absorption of iron and, eventually iron overload.
  • Hepcidin in thalasemmias and other "iron loading" anemias Thalasemmias are anemias caused by diverse genetic lesions that result in deficient hemoglobin a- or ⁇ -chain synthesis associated with ineffective erythropoiesis (IE)— a situation in which erythropoiesis is expanded, but mature erythrocytes are not produced due to premature death of precursors in the bone marrow.
  • Iron overload is the primary cause of morbidity-mortality and commonly attributed to excessive blood transfusions.
  • patients who are never or rarely transfused thalassemia intermedia
  • severe iron overload as a consequence of excessive iron absorption.
  • Inflammation promotes hepcidin excess and causes anemia due to iron-restricted erythropoiesis: Hepcidin production is greatly stimulated by inflammatory mediators, particularly IL-6. Indeed, highly elevated urinary hepcidin levels are observed in patients with infection and inflammatory disorders. When hepcidin is excessive, iron absorption is inhibited and iron is sequestered in macrophages, leading to iron-restricted erythropoiesis and anemia whose severity is proportional to the level and duration of hepcidin overexpression. This was experimentally confirmed by transgenic mice engineered to overexpress hepcidin and humans with rare hepatic adenomas that overexpress hepcidin.
  • Hepcidin IVDs may enable differentiation between ACD/AI from ID where hepcidin is responsive to iron.
  • TMPRSS6 iron refractory iron deficiency anemia
  • IRJDA iron refractory iron deficiency anemia
  • TMPRSS6 membrane protein matriptase 2
  • IRIDA iron-refractory iron-deficiency anemia
  • Our first generation validated RUO serum hepcidin assay was instrumental in showing that the IRIDA phenotype is caused by inappropriately elevated hepcidin in relation to plasma iron levels.
  • IRIDA is a primary disorder of excessive hepcidin synthesis and as we show in the preliminary data, can be diagnosed by measuring hepcidin levels, rather than by DNA sequencing. Consequently, diagnosis of IRIDA due to TMPRSS6 (mut/mut) mutations is the first clinical indication we will pursue for FDA approval for our MAb 583 hepcidin C-ELISA. [0092] Anemia in the U.S. and hepcidin diagnostics: Based on a national household interview survey, the National Center for Health Statistics estimated in 1996 that 3.4 million Americans were living with anemia.
  • anemia may be vague, and are often attributed to the diseases with which it is associated, including chronic kidney disease (CKD), cancer, diabetes, cardiovascular disease, HIV/AIDS, rheumatoid arthritis, and inflammatory bowel disease among others.
  • CKD chronic kidney disease
  • NTF-K/DOQI National Kidney Foundation's Kidney Disease Outcomes Quality Initiative
  • Anemia is a common and early complication of CKD and worsens as the disease progresses. Not only is anemia a consequence of many diseases, it may also result from treatment of the disease itself in patients with diseases such as cancer, HIV/AIDS, or hepatitis C.
  • Candidates for surgery may be anemic due to underlying disease or become so due to perioperative blood loss. Anemia also occurs more frequently among the elderly, and its prevalence is expected to increase significantly as Baby Boomers age. Although the comparative advantages of the hepcidin assay over other assays used in diagnosis of anemia are being defined, and will require larger studies, preliminary data suggest that hepcidin may be useful in detecting iron deficiency (ID) as a cause of anemia, and differentiating it from common causes of anemia of inflammation.
  • ID iron deficiency
  • ID Iron deficiency
  • IDA iron deficiency anemia
  • the prevalence rates of ID and IDA in US toddlers are 9% and 3%, respectively, and together they affect nearly 3 million children, particularly those of low-socioeconomic status and minorities.
  • the incidence of ID is 5% in early childhood (ages 3-5) and in adolescent girls (ages 12-19) the incidence of ID is 9-16%; 2% of adolescent girls have frank IDA.
  • IDA iron deficiency in older children and adolescents may affect cognitive function and academic performance.
  • the present application describes new methods for quantifying an amount of hepcidin in a fluid sample using an immunoassay.
  • the methods provide an advantage over prior assays in that the results are more sensitive and accurate.
  • Methods for quantifying hepcidin in a fluid are described in US Patent No. 7,745,162, by Lauth et al., are incorporated herein by reference.
  • a tracer reagent may have a detector molecule covalently linked to amino acid residues 18 or 24 of a hepcidin molecule.
  • the methods described herein represent an improvement over prior with respect to the location of where the detector molecule is linked to a peptide in that it was not previously considered that the detector molecule could be linked to an internal amino acid residue in the peptide rather than the C- or N-terminus.
  • Samples to be obtained for use in an assay described herein include tissues and bodily fluids which may be processed using conventional means in the art ⁇ e.g., homogenization, serum isolation, etc.). Accordingly, a sample obtained from a patient is transformed prior to use in an assay described herein. Hepcidin, if present in the sample, is further transformed in the methods described herein by virtue of binding to an antibody and a labeled tracer reagent.
  • a method for quantifying an amount of hepcidin in a fluid sample using an immunoassay comprising: (a) providing a known amount of a tracer reagent consisting of: (1) a peptide having an amino acid sequence of at least a portion of any one of SEQ ID NOS: 1, 3 and 4; (2) at least one hydrophilic spacer consisting of one or more AEEAc residues(nl-6) covalently linked to the peptide of step (a)(1) at the amino terminus or a lysine residue in said peptide; and (3) a detector molecule covalently linked to the hydrophilic spacer of (a)(2); (b) contacting a fluid sample from a patient with a known amount of said tracer reagent in the presence of an immobilized antibody that specifically binds to an epitope on hepcidin at less than about 50 picomolar and has acceptable non-specific binding characteristics; (c) washing unbound tracer reagent; (d
  • Also provided herein is a method for quantifying an amount of hepcidin in a fluid sample using an immunoassay, comprising: providing a known amount of a tracer reagent consisting of: a peptide having an amino acid sequence of at least a portion of any one of SEQ ID NOS: 1, 3 and 4; at least one hydrophilic spacer consisting of one or more AEEAc residues(ni -6 ) covalently linked to the peptide of step (a)(1) at the amino terminus or a lysine residue in said peptide; and a detector molecule covalently linked to the hydrophilic spacer of (a)(2); contacting a fluid sample from a patient with a known amount of said tracer reagent in the presence of an immobilized antibody that specifically binds to an epitope on hepcidin with a dissociation constant of less than about 50 picomolar; and determining the amount of hepcidin present in the fluid sample based on the amount of
  • an immobilized antibody that specifically binds to an epitope on hepcidin at less than about 20 picomolar, less than about 10 picomolar, less than about 7 picomolar, or less than about 5 picomolar, and has acceptable non-specific binding characteristics.
  • the tracer reagent comprises biotin as the detector molecule covalently linked to the hydrophilic spacer at a single site on the peptide.
  • the tracer reagent comprises biotin as the detector molecule covalently linked to the hydrophilic spacer at amino acid residue 18 or amino acid residue 24 of a hepcidin peptide.
  • the tracer reagent comprises K18-biotin or Bio-K24 and the antibody is 583 or an antibody that comprises the CDRs of antibody 583.
  • the tracer reagent comprises K18- biotin or Bio-K24 and the antibody is 1B1 or an antibody that comprises the CDRs of antibody 1B1.
  • an antibody described herein is a monoclonal antibody, a humanized antibody, a deimmunized antibody, a human antibody, or a ScFv.
  • the antibody that comprises antibody 583 comprises a variable heavy chain of SEQ ID NO: 17 and a variable light chain of SEQ ID NO: 18.
  • the antibody that comprises the CDRs of 583 comprises variable heavy chain CDRs encoded by SEQ ID NOS: 5, 7 and 9; and variable light chain CDRs encoded by SEQ ID NOS: 11, 13 and 15.
  • the antibody that comprises antibody 1B1 comprises a variable heavy chain of SEQ ID NO: 19 and a variable light chain of SEQ ID NO: 20.
  • the antibody that comprises the CDRs of 1B1 comprises variable heavy chain CDRs encoded by SEQ ID NOS: 6, 8 and 10; and variable light chain CDRs encoded by SEQ ID NOS: 12, 14 and 16.
  • the known amount of a tracer reagent may be empirically determined and may be, for example, an amount from about 0.05 ng to about 50 ng, from about 0.5 ng to about 40 ng, from about 1.0 ng to about 30 ng, from about 5 ng to about 25 ng, from about 10 ng to about 20 ng, from about 0.05 ng to about 25 ng, from about 0.5 ng to about 15 ng, or from about 0.5 ng to about 10 ng, or any integer between.
  • Any suitable conventional ELISA development solution may be used in any of the methods described herein including, but not limited to, Tetramethyl Benzidine (TMB) and 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS).
  • TMB Tetramethyl Benzidine
  • ABTS 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)
  • a stop solution may be added to stop the development of the substrate when a peptide is present. Any suitable conventional stop solution may be used in any of the methods described herein including, but not limited to, HC1, H 2 SO 4 , and phosphoric acid.
  • Hepcidin peptides to be used in any of the methods described herein include, but are not limited to, a peptide of any one of SEQ ID NOS: 1, 3 and 4.
  • a peptide to be used in the methods described herein has an amino acid sequence set forth as SEQ ID NO 1.
  • a peptide to be used in the methods described herein has an amino acid sequence set forth as SEQ ID NO 3.
  • a peptide to be used in the methods described herein has an amino acid sequence set forth as SEQ ID NO 4.
  • a peptide to be used in the methods described herein may be oxi datively-folded.
  • the optical density (e.g., 405 nm or 450 nm) of the wells may be measured after a stop solution is added.
  • a computer program such as, for example, GraphPad Prism, may be used to statistically interrogate the data and interpolate the hepcidin concentration of the sample from a standard curve.
  • Also provided herein is a method for quantifying an amount of hepcidin in a fluid sample using an immunoassay, comprising: (a) providing a known amount of a tracer reagent consisting of: (1) a peptide having an amino acid sequence of at least a portion of any one of SEQ ID NOS: 1, 3 and 4; (2) at least one hydrophilic spacer consisting of one or more AEEAc residues(nl -6) covalently linked to the peptide of step (a)(1) at the amino terminus or a lysine residue in said peptide; and (3) a detector molecule covalently linked to the hydrophilic spacer of (a)(2); (b) contacting a fluid sample from a patient with a known amount of said tracer reagent in the presence of an immobilized antibody that specifically binds to an epitope on hepcidin at less than about 50 picomolar and has acceptable non-specific binding characteristics; (c) washing unbound tracer reagent; (a) providing
  • Also provided herein is a method for quantifying an amount of hepcidin in a fluid sample using an immunoassay, comprising: providing a known amount of a tracer reagent consisting of: a peptide having an amino acid sequence of at least a portion of any one of SEQ ID NOS: 1, 3 and 4; at least one hydrophilic spacer consisting of one or more AEEAc residues(ni -6 ) covalently linked to the peptide of step (a)(1) at the amino terminus or a lysine residue in said peptide; and a detector molecule covalently linked to the hydrophilic spacer of (a)(2); contacting a fluid sample from a patient with a known amount of said tracer reagent in the presence of an immobilized antibody that specifically binds to an epitope on hepcidin with a dissociation constant of less than about 50 picomolar; and determining the amount of hepcidin in the fluid sample based upon the amount of secondary
  • an immobilized antibody that specifically binds to an epitope on hepcidin at less than about 20 picomolar, less than about 10 picomolar, less than about 7 picomolar, or less than about 5 picomolar, and has acceptable non-specific binding characteristics.
  • the method further comprises, after step (c), adding a secondary detection reagent.
  • a secondary detection reagent that may be added in such methods is streptavidin HRP.
  • a detector molecule may be added via a hydrophilic spacer to an internal amino acid residue of a hepcidin peptide.
  • the tracer reagent comprises HRP-K24 or HRP-K18 and the antibody is 583 or an antibody that comprises the CDRs of antibody 583.
  • the tracer reagent comprises HRP-K24 or HRP-K18 and the antibody is 1B1 or an antibody that comprises the CDRs of antibody 1B1.
  • an antibody described herein is a monoclonal antibody, a humanized antibody, a deimmunized antibody or a human antibody.
  • the antibody that comprises antibody 583 comprises a variable heavy chain of SEQ ID NO: 17 and a variable light chain of SEQ ID NO: 18.
  • the antibody that comprises the CDRs of 583 comprises variable heavy chain CDRs encoded by SEQ ID NOS: 5, 7 and 9; and variable light chain CDRs encoded by SEQ ID NOS: 11, 13 and 15.
  • the antibody that comprises antibody 1B1 comprises a variable heavy chain of SEQ ID NO: 19 and a variable light chain of SEQ ID NO: 20.
  • the antibody that comprises the CDRs of 1B1 comprises variable heavy chain CDRs encoded by SEQ ID NOS: 6, 8 and 10; and variable light chain CDRs encoded by SEQ ID NOS: 12, 14 and 16.
  • the secondary detection reagent comprises streptavidin
  • HRP or another conventionally known agent in the art.
  • the known amount of a tracer reagent may be empirically determined and may be, for example, an amount from about 0.05 ng to about 50 ng, from about 0.5 ng to about 40 ng, from about 1.0 ng to about 30 ng, from about 5 ng to about 25 ng, from about 10 ng to about 20 ng, from about 0.05 ng to about 25 ng, from about 0.5 ng to about 15 ng, or from about 0.5 ng to about 10 ng, or any integer between.
  • TMB Tetramethylbenzidine
  • ABTS 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)
  • a stop solution may be added to stop the development of the substrate when a peptide is present.
  • Any suitable conventional stop solution may be used in any of the methods described herein including, but not limited to, HC1, H 2 S0 4 , and phosphoric acid.
  • Hepcidin peptides to be used in any of the methods described herein include, but are not limited to, a peptide of any one of SEQ ID NOS: 1, 3 and 4.
  • a peptide to be used in the methods described herein has an amino acid sequence set forth as SEQ ID NO 1.
  • a peptide to be used in the methods described herein has an amino acid sequence set forth as SEQ ID NO 3.
  • a peptide to be used in the methods described herein has an amino acid sequence set forth as SEQ ID NO 4.
  • a peptide to be used in the methods described herein may be oxi datively-folded.
  • the optical density (e.g., 405 nm or 450 nm) of the wells may be measured after a stop solution is added.
  • a computer program such as, for example, GraphPad Prism, may be used to statistically interrogate the data and interpolate the hepcidin concentration of the sample from a standard curve.
  • an immobilized support may be an inert support that is commercially available in the art such as, for example, nitrocellulose, polyvinylidene difluoride (PVDF), nylon, polyethersulfone, a polystyrene plate or magnetic beads.
  • PVDF polyvinylidene difluoride
  • Such plates or beads are commercially available from, for example, THERMO FISHER SCIENTIFIC®, BIO- RAD®, ROCHE®, IN VITRO GEN® and other suppliers.
  • compounds may be attached to an inert support using conventionally known techniques including, but not limited to, passive attachment via hydrophobic bonding; covalent bonding; ionic bonding via a variety of chemical means; or a bioaffinity type of immobilization where the inert support is coated protein A or G and the antibody is immobilized via its Fc region.
  • Hepcidin is a highly informative diagnostic for differential diagnosis of genetic and acquired IDA: The measurement of hepcidin as a biomarker of iron status is theoretically and clinically compelling because it is the sole hormone regulating human systemic iron homeostasis and is at the intersection between dietary iron absorption, transport, and recycling for erythropoiesis and iron-sequestration due to inflammatory signaling, particularly via IL-6. Hepcidin may be used to refine diagnosis of IDA as it integrates and responds rapidly to iron requirements for blood and periodic iron sequestration or chronic pathogenic sequestration in many diseases.
  • ID Iron deficiency
  • IDA iron deficiency anemia
  • Hepcidin is a 25 amino acid peptide produced in the liver that is responsive to iron stores, erythropoiesis, hypoxia, and inflammation. Hepcidin negatively regulates the expression of the duodenal and macrophage iron exporter ferroportin 1 (FPN1) in response to high iron levels. Consequently, hepcidin suppresses systemic iron absorption as well as iron reutilization and plasma iron availability.
  • FPN1 duodenal and macrophage iron exporter ferroportin 1
  • HH hereditary hemochromatosis
  • IRIDA Iron Refractory Iron Deficiency Anemia
  • the anemia is unresponsive or very poorly responsive to oral iron supplementation and only partially or temporarily responsive to parenteral iron therapy.
  • IRIDA is due to mutations in transmembrane protease, serine 6 (TMPRSS6), a hepatocyte-specific protein that ordinarily negatively regulates iron-dependent hepcidin gene expression.
  • TMPRSS6 transmembrane protease, serine 6
  • IRIDA can be difficult to distinguish from clinically complicated cases of acquired iron deficiency that are unresponsive to oral or parenteral iron therapy in which there is no clear cause ⁇ e.g., ongoing blood loss and/or malabsorption). For these reasons, and because clinical genetic diagnostics may be unavailable, expensive or undesirable, we sought to develop a biochemical approach to the diagnosis of IRIDA. In particular, we wished to address, "What level of hepcidin is too high for a patient with acquired ID/A and would suggest a diagnosis of IRIDA?
  • hepcidin in a subject is correlated with responsiveness to oral iron treatments and accordingly, described herein are methods of treatment relating to this discovery.
  • described herein is a method of treating iron deficiency anemia in a subject in need thereof, the method comprising: a) measuring the level of hepcidin in a biological sample obtained from the subject; b) administering parenteral iron to the subject if the level of hepcidin is increased relative to a reference level. Levels of hepcidin which are increased relative to a reference level indicate that the patient is unlikely to respond to oral therapy.
  • the methods described herein can comprise administering oral iron to the subject if the level of hepcidin is not increased relative to a reference level.
  • the methods described herein can further relate to monitoring treatment efficacy and/or sustained methods of treatment, e.g., determining if parenteral iron administration has been sufficient and/or should be continued.
  • the methods described herein further comprise c) measuring the level of hepcidin in a biological sample obtained from the subject after the administering of step b); and d) administering a further dose of parenteral iron to the subject if the level of hepcidin measured in step c) is increased relative to a reference level.
  • a step comprising measuring the level of hepcidin further comprises measuring the level of plasma iron and a step comprising administration further comprises administering parenteral iron to the subject if the level of plasma Iron/logio(Hepcidin) is decreased relative to a reference level; or administering oral iron to the subject if the level of plasma Iron/1 ogio(Hepci din) is not decreased relative to a reference level.
  • a level of plasma Iron/logi 0 (Hepcidin) which is decreased relative to a reference level indicates that the patient is unlikely to respond to oral iron therapy.
  • a step comprising measuring the level of hepcidin further comprises measuring the level of TfSat and a step comprising administration further comprises administering parenteral iron to the subject if the level of Tfsat/logi 0 (Hepcidin) is decreased relative to a reference level; or administering oral iron to the subject if the level of Tfsat/logio(Hepcidin) is not decreased relative to a reference level.
  • a level of Tfsat/logio(Hepcidin) which is decreased relative to a reference level indicates that the patient is unlikely to respond to oral iron therapy.
  • the inventors have further determined the relative influence of hemoglobin, hepcidin, plasma iron, and ferritin levels to the foregoing discriminatory, diagnostic, and therapeutic methods. Therefore, provided herein are algorithms that allow a quantification of, e.g., the likelihood of a patient responding to oral iron, or the likelihood of a subject having TMPRSS6 mutations.
  • a method of treating anemia in a subject in need thereof comprising: a) measuring the level of hemoglobin, hepcidin and the level of plasma iron in a biological sample obtained from the subject; b) administering parenteral iron to the subject if the value of p according to equation 2
  • IRIDA Iron-Refractory Iron-Deficiency Anemia
  • a method of treating anemia in a subject in need thereof comprising: a) measuring the level of hemoglobin, hepcidin and the level of plasma iron in a biological sample obtained from the subject; b) administering parenteral iron to the subject if the value of p according to equation 2
  • IRIDA Iron-Refractory Iron-Deficiency Anemia
  • a method of treating anemia in a subj ect in need thereof comprising: a) administering parenteral iron to the subject if the value of p according to equation 2
  • IRIDA Iron-Refractory Iron-Deficiency Anemia
  • a method of determining the likelihood of a subject not responding to oral iron treatment for anemia comprising: a) measuring the level of hemoglobin, hepcidin and the level of plasma iron in a biological sample obtained from the subject; and b) calculating p according to equation 2
  • Equation 2 where the value of p the likelihood (as a fraction of 1) that the patient will not respond to oral iron (e.g., that the subject has Iron-Refractory Iron-Deficiency Anemia (IRIDA)).
  • IRIDA Iron-Refractory Iron-Deficiency Anemia
  • a method of treating anemia in a subj ect in need thereof comprising: a) measuring the level of hemoglobin, ferritin and the level of plasma iron in a biological sample obtained from the subject; b) administering parenteral iron to the subject if the value of p according to equation 1
  • IRIDA Iron-Refractory Iron-Deficiency Anemia
  • a method of treating anemia in a subject in need thereof comprising: a) measuring the level of hemoglobin, ferritin and the level of plasma iron in a biological sample obtained from the subject; b) administering parenteral iron to the subject the value of p according to equation 1
  • IRIDA Iron-Refractory Iron-Deficiency Anemia
  • a method of treating anemia in a subj ect in need thereof comprising: a) administering parenteral iron to the subject if the value of p according to equation 1 for a biological sample obtained from the subject
  • IRIDA Iron-Refractory Iron-Deficiency Anemia
  • a method of determining the likelihood of a subj ect not responding to oral iron treatment for anemia comprising: a) measuring the level of hemoglobin, ferritin and the level of plasma iron in a biological sample obtained from the subject; and b) calculating p according to equation 1
  • the value of p the likelihood (as a fraction of 1) that the patient will not respond to oral iron (e.g., that the subject has Iron-Refractory Iron-Deficiency Anemia (IRIDA)).
  • IRIDA Iron-Refractory Iron-Deficiency Anemia
  • the value of p obtained with an algorithm described herein can be used to determine if a genetic test should be ordered for a subject, e.g., to determine if they have TMPRSS6.
  • the value of p (the likelihood of TMPRSS6 mutations underlying the anemia of the subj ect) can be considered by a skilled practitioner in view of factors such as the subject's symptoms and family history in order to determine whether a genetic test is indicated by the value of P.
  • Methods for measuring levels of hepcidin, plasma iron, total iron binding concentration (TIBC), ferritin, and/or TfSat are known in the art and described elsewhere herein.
  • the level of hepcidin can be measured using the methods or kits described herein. In some embodiments, the level of hepcidin can be measured using mAB583, which is described in US Patent 9,657,098, which is incorporated by reference herein in its entirety. Plasma iron and TfSat can be measured, e.g., using commercially available assays from ROCHE®, HITACHI®, SYSMEX®, and others.
  • a subject treated according to the methods described herein is a subject who does not have, or is not diagnosed as having, an inflammatory condition; chronic inflammation; and/or abnormal levels of C-reactive protein (CRP).
  • CRP C-reactive protein
  • the assays and methods as described herein can relate to determining or measuring if a subject has a level which is increased or decreased relative to a reference level.
  • the reference level can be the level in a sample of similar cell type, sample type, sample processing, and/or obtained from a subject of similar age, sex and other demographic parameters as the sample/subject for which the level of, for example, hepcidin is to be determined.
  • the test sample and control reference sample are of the same type, that is, obtained from the same biological source, and comprising the same composition, e.g., the same number and type of cells and/or type of sample material.
  • a level which is increased or decreased can vary as demographic factors such as age, gender, genotype, environmental factors, and individual medical histories vary.
  • a reference level can be the level in a prior sample obtained from the subject. This permits a direct analysis of any change in levels in that individual.
  • the reference level of hepcidin can be the level of hepcidin in a healthy subject not having, or not diagnosed as having anemia. In some embodiments, the reference level of hepcidin can be the lower limit of normal (e.g., at the 5 th percentile) in a population of healthy subjects not having, or not diagnosed as having anemia. In some embodiments, an increased level of hepcidin is a level which is increased at least 1.5 fold relative to the reference level. In some embodiments, an increased level of hepcidin is a level which is increased at least 3.0 fold relative to the reference level. In some embodiments, the level of hepcidin is the level of plasma hepcidin.
  • the reference level of Tfsat/logio(Hepcidin) can be from about 3.0 to about 5.0.
  • the reference level of Tfsat/logi 0 (Hepcidin) about 4.0.
  • the reference level of plasma Iron/1 ogi 0 (Hepci din) can be from about 13 to about 15.
  • the reference level of plasma Iron/logio(Hepcidin) is about 14.3.
  • a level can be increased relative to a reference level if the level is at least about
  • a level can be increased relative to a reference level is the level is greater by a statistically significant amount.
  • Statistically significant amounts can be determined utilizing art recognized assessments including, but not limited to, a Student's t test.
  • a level can be decreased relative to a reference level if the level is about 90% or less, about 85% or less, about 80% or less, about 75% or less, about 60% or less, about 50% or less, about 25% or less, about 10% or less, about 5% or less, or about 2% less of the reference level.
  • a level can be decreased relative to a reference level is the level is less by a statistically significant amount. Statistically significant amounts can be determined utilizing art recognized assessments including, but not limited to, a Student's t test.
  • sample biological sample or test sample as used herein denotes a sample taken or isolated from an organism, e.g., a plasma sample from a subject.
  • Non-limiting exemplary biological samples include, but are not limited to, a biofluid sample; serum; plasma; urine; saliva; and/or tumor sample, etc.
  • the term also includes a mixture of the above-mentioned samples.
  • test sample also includes untreated or pretreated (or pre-processed) biological samples.
  • a test sample can comprise cells from a subject.
  • biologicalfluid refers to any fluid obtained from a biological source and includes, but is not limited to, blood, urine, and bodily secretions.
  • a test sample can be obtained by removing a sample from a subject, but can also be accomplished by using a previously isolated sample ⁇ e.g., isolated at a prior time point and isolated by the same or another person). In addition, a test sample can be freshly collected or a previously collected sample.
  • the test sample can be an untreated test sample.
  • untreated test sample refers to a test sample that has not had any prior sample pre-treatment except for dilution and/or suspension in a solution.
  • Exemplary methods for treating a test sample include, but are not limited to, centrifugation, filtration, sonication, homogenization, heating, freezing and thawing, and combinations thereof.
  • the test sample can be a frozen test sample, e.g., a frozen tissue. The frozen sample can be thawed before employing methods, assays and systems described herein.
  • a frozen sample can be centrifuged before being subjected to methods, assays and systems described herein.
  • the test sample is a clarified test sample, for example, prepared by centrifugation and collection of a supernatant comprising the clarified test sample.
  • a test sample can be a pre-processed test sample, for example, supernatant or filtrate resulting from a treatment selected from the group consisting of centrifugation, filtration, thawing, purification, and any combinations thereof.
  • the test sample can be treated with a chemical reagent and/or a biological reagent.
  • Chemical and/or biological reagents can be employed to protect and/or maintain the stability of the sample, including biomolecules (e.g., nucleic acid and protein) therein, during processing.
  • biomolecules e.g., nucleic acid and protein
  • the skilled artisan is well aware of methods and processes appropriate for pre-processing of biological samples required for determination of the level biomolecules as described herein.
  • the methods, assays, and systems described herein can further comprise a step of obtaining a test sample from a subject.
  • the subject can be a human subject.
  • the methods, assays, and systems described herein can comprise creating a report based on the levels as described herein.
  • the report denotes raw values the levels described herein in the test sample (plus, optionally, the level in a reference sample) or it indicates a percentage or fold increase or decrease as compared to a reference level, and/or provides a signal regarding the subject's risk of treatment responsiveness.
  • a method of treating iron overload in a subject in need thereof comprising a) measuring the level of hepcidin and at least one of ferritin, iron, or TfSat in a subject diagnosed with primary or secondary iron overload at, at least two time points; b) administering or withholding a treatment selected from the group consisting of: transfusions, phlebotomy, hepcidin mimetics, or other any other therapy that modulates erythropoiesis, total body iron, iron available for erythropoiesis or excretion or chelation of iron if the level of: i) plasma Iron/1 ogl0(Hepci din) changes over time ii) plasma ferritin/loglO(hepcidin) changes over time, or iii) Tfsat/loglO(Hepcidin) changes over time.
  • the subject has or is diagnosed as having hereditary hemochromatosis (HH);
  • Eligibility criteria for inclusion in this study were: a) a history of IDA, defined by clinical assessment and laboratory evaluation by the referring physician, and typically included patients with plasma ferritin ⁇ 15 ng/mL and a transferrin saturation (TfSat) ⁇ 15% with a hemoglobin (HGB) ⁇ 11.0g/dL at the time of initial diagnosis; b) a poor clinical response to at least one course of oral iron replacement therapy, and c) DNA samples available for MPRSS6 genotyping.
  • IMPRSS6 mut/mut and 59 cID patients with a TfSat ⁇ 15% at the time of referral one IMPRSS6 mut/mut and 10 cID patients were excluded for a TfSat >15% at the time of study.
  • Control groups included 66 TMPRSS6 mutation heterozygous relatives of Z RXS -mutated patients (TMPRSS6 muj+ ), and 35 TMPRSS6 wild type first- and second-degree relatives of the TMPRSS6-mutated patients or wild type family members of patients with other genetically defined hematological diseases (e.g., XLSA) collected in a similar manner (TMPRSS6" + ). These individuals were not selected on the basis of their TfSat.
  • Hepcidin measurement We employed a fully automated, second generation competitive ELISA (C-ELISA; Patent No. US 7,723,063 B2) that utilizes a proprietary monoclonal antibody (mAb583; US Patent No. 9,657,098) that binds the N-terminus of bioactive hepcidin-25 and a biotinylated, bioactive hepcidin-25 analog as a competitive tracer (US Patent No. 7,745, 162). The test was performed on a Beckman FX liquid-handling platform (Beckman, Inc., Brea, CA) equipped with an automated ELX405 plate washer (BioTek, Inc., Winooski, VT), a DTX-880 plate reader (Molecular Devices, Inc.
  • the Intrinsic Hepcidin IDxTM Test was validated and performed under Clinical Laboratory Institute Amendments (CLIA ID 05D2087906) and College of American Pathologist (CAP ID 8958850) guidelines as a laboratory developed test (LDT).
  • the performance characteristics of the Hepcidin IDx Test are excellent with a lower limit of detection (LLOD) of 1.5 ng/ml, a lower limit of quantification (LLOQ) of 4.0 ng/ml, and intra-assay and inter-day precision (CVs) across the normal range averaging 5% and 8% respectively.
  • Spike recoveries were excellent and averaged 3% across the normal range.
  • an antibody that comprises the CDRs of antibody 583 may also be utilized in such methods of hepcidin measurement. Additionally, it will be understood that antibody 1B1, or an antibody that comprises the CDRs of antibody 1B1 may also be utilized in such methods of hepcidin measurement.
  • ZPP/heme was performed on Li-Heparin RBC pellets using a Helena Laboratories, Protofluor-Z instrument. Complete blood count data were collected on a Bayer Advial20 instrument on EDTA anticoagulated samples ( ⁇ 3 days old).
  • CBCs were performed at Federico II University Medical School on an ADVIA 2120 analyzer and banked Li-Heparin plasma store at -80°C was shipped to BCH for clinical chemical analysis.
  • lithium-heparin plasma patient samples were diluted 1 :5 in binding buffer (TRIS-buffered saline (0.05M TRIS, 0.138M NaCl, 0.0027M KCl, pH 8.0, 0.05% Tween-20, TBST) containing 2% BSA, 5mM trehalose, 0.1% Triton X100, and the biotinylated tracer.
  • binding buffer 0.05M TRIS, 0.138M NaCl, 0.0027M KCl, pH 8.0, 0.05% Tween-20, TBST
  • BSA binding buffer
  • 5mM trehalose 0.1% Triton X100
  • biotinylated tracer 0.1% Triton X100
  • microtiter plate wells were washed four times with TBST and streptavi din-horseradish peroxidase (Thermo Fisher, Waltham, MA) diluted to 1 :5000, and added and allowed to bind for 30 minutes at 23°C.
  • the microtiter plate wells were washed with TBST and Tetramethylbenzidine substrate (TMB-US; (Moss, Inc., Pasadena, MD) added for 15 minutes, and the reaction stopped with 0.5M H 2 S0 4 and optical density (OD) measured at 450nm.
  • TMB-US Tetramethylbenzidine substrate
  • OD optical density
  • a cut-off value was determined such that a sensitivity of 80% for detecting biallelic MPRSS6 mutations was achieved, the receiver-operator curve (ROC) was generated, and the area under the curve (AUC) was calculated.
  • ROC receiver-operator curve
  • AUC area under the curve
  • a Fisher's exact test compared TMPRSS6 mut/mat versus cID by sex and age.
  • a univariate logistic regression model was used to compare TMPRSS6 mut/mut versus cID in terms of hematological and iron metabolism characteristics.
  • multivariable logistic regression models were generated using a backwards selection approach, starting from the factors that were significant in univariate logistic regression analysis.
  • the IMPRSS6 mut/mut and cID groups were anemic and hypoferremic compared to the TMPRSS6 mut/+ and TMPRSS6 +/+ controls.
  • heterozygosity for a MPRSS6 mutation was associated with significant decreases in mean cell volume (MCV) and plasma iron and an increase in serum ferritin, but no change in the total iron binding concentration (TIBC) and the transferrin saturation (TfSat); the hemoglobin (HGB) was nearly significantly lower in the TMPRSS6 mut/+ individuals.
  • the TMPRSS6 mut/mut patients were slightly more anemic and iron deficient, based upon the HGB and plasma iron and transferrin saturation (TfSat), than the cID group.
  • hepcidin is regulated by plasma and storage iron as well as erythropoiesis
  • the hepcidin/ferritin ratio has been employed to attempt to normalize hepcidin for iron stores, and thus distinguish an inappropriately increased or decreased hepcidin, even in cases where the plasma hepcidin concentration falls within the normal range.
  • the plasma hepcidin/ferritin ratio is a poor predictor of MPRSS6 mutation status in patients with cID, yielding an AUC of only 0.571 (FIG. 2D, FIG. 4D and FIG. 8).
  • Hepcidin and derivative indices in iron overload subjects may also be inappropriately decreased either primarily or secondarily in patients with iron overload.
  • chronic anemias associated with ineffective erythropoiesis include beta-thalassemia and sideroblastic anemias, which may mimic the clinical features, red cell indices and morphological features of IRIDA— a chronic hypochromic, microcytic anemia unresponsive to iron therapy.
  • HH hereditary hemochromatosis
  • TfSat uncovers the relative hepcidin insufficiency in each of these disorders (FIG. 2B FIG. 2C, FIG. 6 and FIG. 8).
  • hepcidin itself or the hepcidin normalized to ferritin normalization of hepcidin to plasma iron or the TfSat is notable because these indices distinguish conditions in which hepcidin is either inappropriately increased or decreased, suggesting that these hepcidin derivative indices are clinically useful for the diagnosis of hepcidin insufficiency and hepcidin excess states alike.
  • TMPRSS6 mut/mut patients were statistically significantly different from cID patients in terms of hemoglobin (HGB), plasma iron, TIBC, TfSat, and hepcidin, and the TfSat/logi 0 (hepcidin), plasma Iron/logi 0 (hepcidin), TfSat/logi 0 (Ferritin), and plasma Iron/logi 0 (Ferritin) (Table 2).
  • HGB hemoglobin
  • MCV mean red blood cell volume
  • TIBC total iron binding capacity
  • TfSat transferrin saturation
  • ZPP/Heme zinc protoporphyrin IX/heme
  • sTfR serum transferrin receptor
  • CRP C-reactive protein.
  • TMPRSS6 mut/mut 44 9.7 11.1 5.3 30.2 ⁇ 0.0001 cID 59 27.2 32.1 7.0 80.9
  • TMPRSS6 mut/mut 44 0.9 1.3 0.1 6.8 0.7 cID 59 0.8 1.2 0.1 10.8
  • TMPRSS6 mut/mut 44 9.1 11.3 6.5 31.3 ⁇ 0.0001 cID 59 28.5 31.2 6.4 122.9
  • Table 3A Multivariable logistic regression model to identify which
  • Model 1 utilizes HGB and plasma Iron/logio(Ferritin)
  • Model 2 utilizes
  • HGB plasma iron
  • plasma Iron/logio(hepcidin) Iron/logio(hepcidin).
  • transferrin is predominantly a product of the hepatocyte and regulated transcriptionally, it is possible that the iron contributing to the regulation of transferrin production by the hepatocyte is relatively high compared to the plasma iron in IRIDA patients. This could be a cell autonomous effect due to iron storage in the hepatocyte, or a paracrine effect due to relatively increased iron storage in sinusoidal macrophages or endothelial cells that are thought to produce BMP6 in response to iron. Again, because all patients were previously treated, we do not know if this finding is evident at presentation.
  • GWAS Genome-wide association studies
  • missense alleles may be functionally null due to trafficking or protease defects, that null alleles may be in trans with either the p. A736 or p. V736 variant, that the missense mutations are variably present in cis or trans of the p.V736 partial loss-of-function allele, or a combination of these and other factors.
  • a major goal of this study was to predict which patients in a group of individuals with chronic ID/A were most likely to have biallelic MPRSS6 mutations. This would aid in prioritizing genetic analysis in those patients with a high probability of having MPRSS6 mutations and for whom early initiation of parenteral iron therapy would be beneficial.
  • We found that the ratios normalizing the hepcidin to the plasma iron were the most sensitive and specific distinguishing features of the two groups and remained so after a multivariable analysis. This is likely related to the effect of hepcidin on plasma iron levels.
  • this group is highly pre-selected, having already proven to be clinically non- responsive to oral iron and having a TfSat ⁇ 15%—that is to say having a higher pre-test probability of having IRIDA due to MPRSS6 mutations than an unselected group of individuals with ID/A and TfSat ⁇ 15%. For this reason and the relative rarity of IRIDA compared to all patients with ID/ A, application of these tests in a broader iron deficient population would likely result in a lower specificity. Furthermore, although the study inclusion criteria did not include the absence of serologic evidence of inflammation, very few study subjects had a C-reactive protein (CRP) outside of the normal range.
  • CRP C-reactive protein
  • SEQ ID NO: 1 (25aa) DTHFPICIFCCGCCHRSKCGMCCKT
  • SEQ ID NO: 2 (25aa) DTNFPICIFCCKCCNNSQCGICCKT
  • SEQ ID NO: 3 (20aa) ICIFCCGCCHRSKCGMCCKT
  • SEQ ID NO: 4 (22aa) FPICIFCCGCCHRSKCGMCCKT
  • SEQ ID NO: 8 1B1 ATAAGCTACAGTAGTATCACT
  • SEQ ID NO: 9 583 ACAACGTACGCTACTAGCTGGTAC
  • SEQ ID NO: 10 1B1 GCTGGTCTTTACTATGTTATGGACCAC
  • SEQ ID NO: 15 583 CAGCAAAGTAATGAGGATCTGACG
  • SEQ ID NO: 16 1B1 CAGCAGTGGAGTAGTGACCCTTTCACG
  • SEQ ID NO: 20: 1B1 Variable Light Chain Amino Acid Sequence

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Hematology (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Analytical Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Pathology (AREA)
  • Inorganic Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Diabetes (AREA)
  • Obesity (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Endocrinology (AREA)
  • Epidemiology (AREA)
  • Peptides Or Proteins (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

The present application relates to methods of using humanized antibodies that specifically bind to hepcidin to quantify hepcidin in a fluid sample. Another aspect relates to discriminating, using quantified plasma hepcidin levels, between a subject with a condition due to biallelic TMPRSS6 mutation and other chronic iron deficiency/iron deficiency anemia. Another aspect relates to methods of treatment of a disease or condition related to hepcidin comprising use of humanized antibodies which bind hepcidin to determine hepcidin levels in the subject.

Description

ASSESSMENT OF CHRONIC IRON DEFICIENCY
CROSS-REFERENCE
[0001] This application claims the benefit of U.S. Provisional Application No. 62/468,281, filed March 7, 2017, and the benefit of U.S. Provisional Application No. 62/550,102, filed August 25, 2017, which applications are incorporated herein by reference in their entireties.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on February 28, 2018, is named 44546_704_601_SL.txt and is 22,233 bytes in size.
STATEMENT AS TO FEDERALLY SPONSORED RESEARCH
[0003] This invention was made with government support under NIH R44 DK083843 and K12 HL087164 awarded by the National Institutes of Health. The government has certain rights in the invention.
BACKGROUND OF THE INVENTION
[0004] Iron is an essential trace element required for growth and development of living organisms. In mammals, iron content is regulated by controlling iron absorption, iron recycling, and release of iron from the cells in which it is stored. Iron is predominantly absorbed in the duodenum and upper jejunum by enterocytes. Iron is recycled from degraded red cells by reticuloendothelial macrophages in bone marrow, hepatic Kupffer cells and spleen. Iron release is controlled by ferroportin, a major iron export protein located on the cell surface of enterocytes, macrophages and hepatocytes, the main cells capable of releasing iron into plasma. Hepcidin binds to ferroportin and decreases its functional activity by causing it to be internalized from the cell surface and degraded.
SUMMARY OF THE INVENTION
[0005] Iron-Refractory Iron Deficiency Anemia (IRIDA) is characterized by congenital iron deficiency poorly responsive to oral iron treatment. Biallelic mutations in TMPRSS6 are found in most patients with IRIDA. TMPRSS6 negatively regulates synthesis of the iron regulatory hormone hepcidin and loss of TMPRSS6 causes increased plasma hepcidin and impaired iron absorption and recycling.
[0006] In this application, the inventors employ a new hepcidin immunoassay to measure plasma hepcidin in individuals with chronic iron deficiency and correlate the results with MPRSS6 genotypes. The inventors confirm that chronically iron deficient patients without MPRSS6 mutations typically have low hepcidin levels, whereas those with biallelic TMPRSS6 mutations have higher levels, but patients in both groups are often within the reference range. To normalize hepcidin to physiological iron status, the inventors tested several indices derived from plasma iron markers and hepcidin. Fixing sensitivity at 80%, it was found that plasma iron/logio(hepcidin) and TfSat/logi0(hepcidin) have superior specificity (96% [95% CI=80- 100%]) compared to plasma hepcidin alone (73% [95% CI=52-88%]) to predict biallelic TMPRSS6 mutations.
[0007] A multivariable logistic regression model identified a 54% decrease (95% CI: 22%-73%) in the odds of having two MPRSS6 mutations for every unit increase in HGB; a 1.2-fold increase (95% CI: 1.1-1.4) in the odds of having two MPRSS6 mutations for every unit increase in iron; and a 36% decrease (95%CI: 21%-48%) in the odds of having two MPRSS6 mutations for every unit increase in Iron/logi0(Hepcidin). Similar relationships could be determined substituting ferritin for hepcidin. Thus, in addition to describing the largest series of patients with IRIDA due to TMPRSS6 mutations, we elaborate an approach to the diagnosis based on blood parameters alone.
[0008] Provided herein is a method for quantifying an amount of hepcidin in a fluid sample using an immunoassay, comprising: a) providing a known amount of a tracer reagent consisting of: (1) a peptide having an amino acid sequence of at least a portion of any one of SEQ ID NOS: 1, 3 and 4; (2) at least one hydrophilic spacer consisting of one or more AEEAc residues(ni-6) covalently linked to the peptide of step (a)(1) at the amino terminus or a lysine residue in said peptide; and (3) a detector molecule covalently linked to the hydrophilic spacer of (a)(2); b) contacting a fluid sample from a patient with a known amount of said tracer reagent in the presence of an immobilized antibody that specifically binds to an epitope on hepcidin with a dissociation constant of less than about 50 picomolar; c) washing unbound tracer reagent; d) adding a development solution; e) stopping the reaction with a stop solution; f) detecting the relative amount of tracer reagent of step (a) bound to the immobilized antibody with a substrate, optionally stopping the reaction with a stop solution; and g) calculating the amount of the hepcidin present in the sample based on the results of the detecting of step (f). In one aspect, the tracer reagent comprises biotin as the detector molecule covalently linked to the hydrophilic spacer at a single site on the peptide. In another aspect, the tracer reagent comprises K18-biotin- biotin or K24-biotin and the antibody is 583 or an antibody that comprises complimentary determining regions (CDRs) of 583. In another aspect, the antibody that comprises the CDRs of 583 comprises variable heavy chain CDRs encoded by SEQ ID NOS: 5, 7 and 9; and variable light chain CDRs encoded by SEQ ID NOS: 11, 13 and 15. In another aspect, the tracer reagent comprises K18-biotin-biotin or K24-biotin and the antibody is 1B1 or an antibody that comprises the CDRs of 1B1. In another aspect, the antibody that comprises the CDRs of 1B1 comprises variable heavy chain CDRs encoded by SEQ ID NOS: 6, 8 and 10; and variable light chain CDRs encoded by SEQ ID NOS: 12, 14 and 16. In such method as described herein, the stop solution can be, for example, H2S04 or another conventionally known stop solution. In another aspect, the known amount of a tracer reagent is an amount such as, for example, of from about 0.05 ng to about 50 ng. In some instances, the development solution comprises tetramethyl benzidine (TMB), 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) or another conventionally known development solution. The immobilized antibody that specifically binds to an epitope on hepcidin as described herein, in some instances, specifically binds to hepcidin 20, hepcidin 22 and hepcidin 25.
[0009] Provided herein is another method for quantifying an amount of hepcidin in a fluid sample using an immunoassay, comprising: a) providing a known amount of a tracer reagent consisting of: (1) a peptide having an amino acid sequence of at least a portion of any one of SEQ ID NOS: 1, 3 and 4; (2) at least one hydrophilic spacer consisting of one or more AEEAc residues(ni-6) covalently linked to the peptide of step (a)(1) at the amino terminus or a lysine residue in said peptide; and (3) a detector molecule covalently linked to the hydrophilic spacer of (a)(2); b) contacting a fluid sample from a patient with a known amount of said tracer reagent in the presence of an immobilized antibody that specifically binds to an epitope on hepcidin with a dissociation constant of less than about 50 picomolar; and c) determining the amount of hepcidin present in the fluid sample based on the amount of tracer reagent bound to the immobilized antibody. In one aspect, the tracer reagent comprises biotin as the detector molecule covalently linked to the hydrophilic spacer at a single site on the peptide. In another aspect, the tracer reagent comprises K18-biotin-biotin or K24-biotin and the antibody is 583 or an antibody that comprises complimentary determining regions (CDRs) of 583. In another aspect, the antibody that comprises the CDRs of 583 comprises variable heavy chain CDRs encoded by SEQ ID NOS: 5, 7 and 9; and variable light chain CDRs encoded by SEQ ID NOS: 11, 13 and 15. In another aspect, the tracer reagent comprises K18-biotin-biotin or K24-biotin and the antibody is 1B 1 or an antibody that comprises the CDRs of 1B1. In another aspect, the antibody that comprises the CDRs of 1B1 comprises variable heavy chain CDRs encoded by SEQ ID NOS: 6, 8 and 10; and variable light chain CDRs encoded by SEQ ID NOS: 12, 14 and 16. In such method as described herein, the stop solution can be, for example, H2S04 or another conventionally known stop solution. In another aspect, the known amount of a tracer reagent is an amount such as, for example, of from about 0.05 ng to about 50 ng. In some instances, the development solution comprises tetramethyl benzidine (TMB), 2,2'-azino-bis(3- ethylbenzothiazoline-6-sulphonic acid) (ABTS) or another conventionally known development solution. The immobilized antibody that specifically binds to an epitope on hepcidin as described herein, in some instances, specifically binds to hepcidin 20, hepcidin 22 and hepcidin 25.
[0010] Provided herein is a method for quantifying an amount of hepcidin in a fluid sample using an immunoassay, comprising: a) providing a known amount of a tracer reagent consisting of: (1) a peptide having an amino acid sequence of at least a portion of any one of SEQ ID NOS: 1, 3 and 4; (2) at least one hydrophilic spacer consisting of one or more AEEAc residues(ni-6) covalently linked to the peptide of step (a)(1) at the amino terminus or a lysine residue in said peptide; and (3) a detector molecule covalently linked to the hydrophilic spacer of (a)(2); b) contacting a fluid sample from a patient with a known amount of said tracer reagent in the presence of an immobilized antibody that specifically binds to an epitope on hepcidin with a dissociation constant of less than about 50 picomolar; c) washing unbound tracer reagent; d) adding a secondary detection reagent; d) washing unbound secondary detection reagent; e) adding a development solution; e) stopping the reaction with a stop solution; f) detecting the relative amount of tracer reagent of step (a) bound to the immobilized antibody with a substrate, optionally stopping the reaction with a stop solution; and g) calculating the amount of the hepcidin present in the sample based on the results of the detecting of step (d). The secondary detection reagent to be used in such a method is, for example, streptavidin horseradish peroxidase (HRP) or another conventionally known detection reagent. In another aspect, the tracer reagent comprises K24-HRP or K18-HRP and the antibody is 583 or an antibody that comprises CDRs of 583. In another aspect, the antibody that comprises the CDRs of 583 comprises variable heavy chain CDRs encoded by SEQ ID NOS: 5, 7 and 9; and variable light chain CDRs encoded by SEQ ID NOS: 11, 13 and 15. In another aspect, the tracer reagent comprises K24-HRP or K18-HRP and the antibody is 1B1 or an antibody that comprises CDRs of 1B1. Also provided herein is a method where the antibody that comprises the CDRs of 1B1 comprises variable heavy chain CDRs encoded by SEQ ID NOS: 6, 8 and 10; and variable light chain CDRs encoded by SEQ ID NOS: 12, 14 and 16. In another aspect, the secondary detection reagent comprises streptavidin HRP or another conventionally known detection reagent. In another aspect, the stop solution is HC1, phosphoric acid, H2S04 or another conventionally known stop solution. In another aspect, the known amount of a tracer reagent can be, for example, an amount of from about 0.05 ng to about 50 ng. In another aspect, the development solution comprises tetramethyl benzidine (TMB), 2,2'-azino-bis(3-ethylbenzothiazoline-6- sulphonic acid) (ABTS) or another conventionally known development solution. In another aspect, the peptide of (a)(1) has an amino acid sequence set forth as SEQ ID NO 1. In another aspect, the peptide of (a)(1) has an amino acid sequence set forth as SEQ ID NO 3. In another aspect, the peptide of (a)(1) has an amino acid sequence set forth as SEQ ID NO 4. In some instances, the antibody that specifically binds to an epitope on hepcidin can specifically binds to hepcidin 20, hepcidin 22 and hepcidin 25. In certain instances, the peptide of (a)(1) can be oxidatively-folded.
[0011] Provided herein is another method for quantifying an amount of hepcidin in a fluid sample using an immunoassay, comprising: a) providing a known amount of a tracer reagent consisting of: (1) a peptide having an amino acid sequence of at least a portion of any one of SEQ ID NOS: 1, 3 and 4; (2) at least one hydrophilic spacer consisting of one or more AEEAc residues(ni-6) covalently linked to the peptide of step (a)(1) at the amino terminus or a lysine residue in said peptide; and (3) a detector molecule covalently linked to the hydrophilic spacer of (a)(2); b) contacting a fluid sample from a patient with a known amount of said tracer reagent in the presence of an immobilized antibody that specifically binds to an epitope on hepcidin with a dissociation constant of less than about 50 picomolar; and c) determining the amount of hepcidin in the fluid sample based upon the amount of secondary detection reagent. In one aspect, the secondary detection reagent is streptavidin horseradish peroxidase (HRP) or another conventionally known secondary detection reagent. In another aspect, the tracer reagent comprises K24-HRP or K18-HRP and the antibody is 583 or an antibody that comprises CDRs of 583. In another aspect, the antibody that comprises the CDRs of 583 comprises variable heavy chain CDRs encoded by SEQ ID NOS: 5, 7 and 9; and variable light chain CDRs encoded by SEQ ID NOS: 11, 13 and 15. In another aspect, the tracer reagent comprises K24-HRP or K18-HRP and the antibody is IB l or an antibody that comprises CDRs of IBl . In another aspect, the antibody that comprises the CDRs of IBl comprises variable heavy chain CDRs encoded by SEQ ID NOS: 6, 8 and 10; and variable light chain CDRs encoded by SEQ ID NOS: 12, 14 and 16. In another aspect, the secondary detection reagent comprises streptavidin HRP or another conventionally known detection reagent. In another aspect, the stop solution is HC1, phosphoric acid, H2SO4 or another conventionally known stop solution. In another aspect, the known amount of a tracer reagent can be, for example, an amount of from about 0.05 ng to about 50 ng. In another aspect, the development solution comprises tetramethyl benzidine (TMB), 2,2'- azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) or another conventionally known development solution. In another aspect, the peptide of (a)(1) has an amino acid sequence set forth as SEQ ID NO 1. In another aspect, the peptide of (a)(1) has an amino acid sequence set forth as SEQ ID NO 3. In another aspect, the peptide of (a)(1) has an amino acid sequence set forth as SEQ ID NO 4. In some instances, the antibody that specifically binds to an epitope on hepcidin can specifically binds to hepcidin 20, hepcidin 22 and hepcidin 25. In certain instances, the peptide of (a)(1) can be oxidatively-folded.
[0012] Provided herein are kits for detecting a level of hepcidin in a fluid sample comprising a tracer reagent, as described herein, and an antibody that specifically binds to hepcidin. In one aspect, the antibody is immobilized on a support. In another aspect, the tracer reagent comprises K18-biotin, K24-biotin, K24-HRP, or K18-HRP. In another aspect, the antibody that specifically binds to hepcidin is antibody 583 or an antibody that comprises CDRs of 583. In a further aspect, the antibody that comprises the CDRs of 583 comprises variable heavy chain CDRs encoded by SEQ ID NOS: 5, 7 and 9; and variable light chain CDRs encoded by SEQ ID NOS: 11, 13 and 15. In another aspect, the antibody that specifically binds to hepcidin is antibody 1B1 or an antibody that comprises CDRs of IB 1. In a further aspect, the antibody that comprises the CDRs of 1B1 comprises variable heavy chain CDRs encoded by SEQ ID NOS: 6, 8 and 10; and variable light chain CDRs encoded by SEQ ID NOS: 12, 14 and 16. In another aspect, the tracer reagent is K18-biotin, K24-biotin, K24-HRP, or K18-HRP and the antibody is 583 or an antibody that comprises CDRs of 583. In another aspect, the tracer reagent is K18-biotin, K24- biotin, K24-HRP or K18-HRP and the antibody is 1B 1 or an antibody that comprises CDRs of 1B1. In another aspect, the tracer reagent comprises an enzyme. In another aspect, the tracer reagent comprises a binding molecule as a detector molecule. In a further aspect, the detector molecule is biotin and the kit further comprises a secondary detection reagent. In a further aspect, the secondary detection reagent comprises streptavidin-HRP or another conventionally known secondary detection reagent. In a further aspect, detector molecule is horseradish peroxidase and the kit further comprises peroxide.
[0013] Provided herein is a method of treating iron deficiency anemia in a subject in need thereof, the method comprising: a) measuring a level of hepcidin in a biological sample obtained from the subject; and b) administering a pharmaceutical composition that comprises parenteral iron to the subject if the level of hepcidin is increased relative to a reference level. In one aspect, wherein the level of hepcidin identified in the biological sample is increased relative to a reference level, the patient is unlikely to respond to oral iron therapy. In another aspect, the method further comprises administering a pharmaceutical composition that comprises oral iron to the subject if the level of hepcidin identified in the sample is not increased relative to a reference level. In another instance, the method may further comprise: c) measuring the level of hepcidin in a biological sample obtained from the subject after the administering of step b); d) administering a further dose of a pharmaceutical composition that comprises parenteral iron to the subject if the level of hepcidin measured in step c) is increased relative to a reference level. The reference level to be used as a comparator in the subject methods is the hepcidin level of a normal, healthy subject without anemia. Where the reference level is the lower limit of normal (e.g., at the 5th percentile) in a population of normal, healthy subjects without anemia. In some instances, the level of hepcidin is increased at least 1.5 fold relative to the reference level. In other instances the level of hepcidin is increased at least 3.0 fold relative to the reference level. In a further aspect, the level of hepcidin is the level of plasma hepcidin. In a further aspect, the subject does not have an inflammatory condition; chronic inflammation; and/or abnormal levels of C-reactive protein (CRP). In one instance, a step of measuring the level of hepcidin further comprises measuring the level of plasma iron and a step of administration further comprises: administering a pharmaceutical composition that comprises parenteral iron to the subject if the level of plasma Iron/logi0(Hepcidin) is decreased relative to the reference level; or administering a pharmaceutical composition that comprises oral iron to the subject if the level of plasma Iron/logio(Hepcidin) is not decreased relative to a reference level. In a further aspect, a level of plasma Iron/logi0(Hepcidin) which is decreased relative to a reference level indicates that the patient is unlikely to respond to oral iron therapy. In a further aspect, provided herein is a method as described herein, wherein the reference level of plasma Iron/logio(Hepcidin) is from about 13 to about 15; and in some instances, about 14.3. In a another aspect, a step of measuring the level of hepcidin further comprises measuring the level of TfSat and a step of administration further comprises: administering a pharmaceutical composition that comprises parenteral iron to the subject if the level of Tfsat/logio(Hepcidin) is decreased relative to a reference level; or administering a pharmaceutical composition that comprises oral iron to the subject if the level of Tfsat/logio(Hepcidin) is not decreased relative to a reference level. In another aspect, a level of Tfsat/logio(Hepcidin) which is decreased relative to a reference level indicates that the patient is unlikely to respond to oral iron therapy. In another aspect the reference level of TfSat/logio(hepcidin) is from about 3.0 to about 5.0, and in some instances, about 4.0. In another aspect, the level of hepcidin is measured using any of the methods described herein. In another aspect, the level of hepcidin is measured by contacting a biological sample with an antibody such as, for example, mAb583, an antibody that comprises the CDRs of mAb583, mAb lB l, or an antibody that comprises the CDRs of mAb lB l .
[0014] Provided herein is a method of treating anemia in a subject in need thereof, the method comprising:
(a) measuring a level of hemoglobin, a level of hepcidin and a level of plasma iron in a biological sample obtained from the subj ect; and
(b) administering to the subject:
(i) a composition that comprises parenteral iron if the value of P according to equation 2 P = e (9.7743-0.7826*HGB+0.2067*Iron-
0.4487*Iron/logl0(hepcidin))7+e(9.7743-0.7826*HGB+0.2067*Iron- 0.4487*Iron/loglO(hepcidin))
(equation 2)
is 0.7 or greater, thereby indicating the subject has Iron-Refractory Iron- Deficiency Anemia (IRIDA); or
(ii) a composition that comprises oral iron if the value of P according to equation 2 is less than 0.7.
[0015] Also provided herein is a method of treating anemia in a subject in need thereof, the method comprising:
(a) measuring a level of ferritin, a level of hemoglobin, and a level of plasma iron in a biological sample obtained from the subject; and
(b) administering to the subject:
(i) a composition that comprises parenteral iron if the value of P according to equation 1
P = e { 10.0744 - 0.6543*HGB - 0.2412*Iron/loglO(Ferritin)}7+e{ 10.0744 - 0.6543*HGB - 0.2412*Iron/loglO(Ferritin)}
(equation 1)
is 0.7 or greater, thereby indicating the subject has Iron-Refractory Iron- Deficiency Anemia (IRIDA); or
(ii) a composition that comprises oral iron if the value of P according to equation 1 is less than 0.7.
[0016] Provided herein is a method of treating iron overload in a subject in need thereof, the method comprising: a) measuring the level of hepcidin and at least one of ferritin, iron, or TfSat in a subject diagnosed with primary or secondary iron overload at, at least, two time points; and b) administering or withholding a treatment selected from the group consisting of: transfusions, phlebotomy, hepcidin mimetics, or other any other therapy that modulates erythropoiesis, total body iron, iron available for erythropoiesis or excretion or chelation of iron if the level of: plasma Iron/logi0(Hepcidin) changes over time; plasma ferritin/logi0(Hepcidin) changes over time; or Tfsat/logi0(Hepcidin) changes over time. In some instances, the iron overload is hereditary hemochromatosis (HH); X-linked sideroblastic anemia (XLSA); or other iron loading anemia. INCORPORATION BY REFERENCE
[0017] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.
BRIEF DISCLOSURE OF THE DRAWINGS
[0018] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure are utilized, and the accompanying drawings of which:
[0019] FIG. 1. Diagram describing assignment of ID/A probands into the TMPRSS6mut/mut and TMPRSS6*/+ cID groups. 139 patients were referred for evaluation of chronic iron deficiency. Patients were included or excluded from the analysis on the basis of the availability of plasma for iron, TIBC, and hepcidin measurements and a TfSat <15% at the time of referral. Patients were further subdivided based on the presence or absence of TMPRSS6 mutations. Patients with either two or no MPRSS6 mutations fulfilling the enrollment criteria of adequate samples for analysis of Iron, TIBC, TfSat and hepcidin, and a TfSat <15% were analyzed. Those individuals with only a single molecular genetically detectable TMPRSS6 allele and fulfilling the enrollment criteria were subsequently analyzed as part of a validation set.
[0020] FIG. 2A-2D. Plasma hepcidin and derivative indices in IRIDA. (A-C) Plasma hepcidin and derivative indices of IRIDA patients with biallelic MPRSS6 mutations (mut/mut, n=44), their heterozygous relatives (mut/+, n=59) wild type controls (+/+, n=35), TMPRSS6 mutation negative chronic ID/A patients (cID, n=66), patients with X-linked sideroblastic anemia (XLSA, n=l l), and FPNl-negative hereditary hemochromatosis (HH, n=9). Box and whisker plots present the quartiles (box), and the 10th and 90th percentiles (whiskers). (D) Receiver-operator curve analysis comparing hepcidin, ferritin and their derivative indices in the TMPRSS6mut/mut and cID groups. TfSat=Transferrin Saturation; AUC, Area Under the Receiver-Operator Curve. FIG. 2A: Hepcidin; FIG. 2B: Iron/Logi0(Hepcidin); FIG. 2C: TfSat/Logi0(Hepcidin); and FIG. 2D: Sensitivity%.
[0021] FIG. 3A-3F. Plasma TIBC, TfSat, ferritin and derivative indices in iron deficiency. (A- F) Plasma TIBC, ferritin and derivative indices of IRIDA patients with biallelic MPRSS6 mutations (mut/mut, n=44), their heterozygous relatives (+/mut, n=59) wild type controls (+/+, n=35), TMPRSS6 mutation negative chronic ID/A patients (cID, n=66). Box and whisker plots present the quartiles (box), and the 10th and 90th percentiles (whiskers). FIG. 3A. Iron; FIG. 3B. TfSat(%);FIG. 3C: Ferritin; FIG. 3D: Hepcidin/Ferritin; FIG. 3E: Iron/logi0(Ferritin); and FIG. 3F: TfSat/ logi0(Ferritin).
[0022] FIG. 4. Plasma hepcidin and derivative indices in TMPRSS6 mutation heterozygous individuals. Receiver-operator curve analysis comparing hepcidin, ferritin and their derivative indices in the TMPRSS6mut/mut and iron deficient 7 im%mut/+groups. TfSat=Transferrin Saturation; AUC, Area Under the Receiver-Operator Curve.
[0023] FIG. 5. Genotyping primers. Alternative primer set from: Guillem F, Lawson S, Kannengiesser C, Westerman M, Beaumont C, Grandchamp B. 2008. Two nonsense mutations in the TMPRSS6 gene in a patient with microcytic anemia and iron deficiency. Blood 112:2089- 2091. Sequence identifiers are noted for each sequence.
[0024] FIG. 6. Demographic and genetic characteristics of TMPRSS6-mutated and cID subjects. Variants are reported in relation to MPRSS6 reference transcript NM_153609.3 Individuals excluded from the analysis because of incomplete iron, TIBC, and hepcidin data are indicated in underlined text those excluded from the analysis for TfSat>15% are highlighted in bold type. *Patients previously reported in Nature Genetics 2008;40(5):569-571. #Patients previously reported in Human Mutation: Mutation in Brief 2010; 31 :E1390-E1405. ®Patients previously reported in Human Mutation 2014; 35(11): 1321-1329.
[0025] FIG. 7. Comparison of hematological and iron metabolism characteristics of subjects HGB, hemoglobin; MCV, mean red blood cell volume; TIBC, total iron binding capacity; TfSat, transferrin saturation; ZPP/Heme; zinc protoporphyrin/heme ratio; sTfR, serum transferrin receptor; CRP, C-reactive protein.
[0026] FIG. 8. Comparison of hepcidin and hepcidin derivative indices in subjects control groups.
[0027] FIG. 9. Application of ferritin, hepcidin and derivative metrics to the prediction of mutation status in IRIDA patients with one detectable MPRSS6 mutant allele. Cutoff values for each parameter were set at the 90% specificity level as in Table 4 or at 70% probability of having two MPRSS6 mutations in the multivariable models. Patients predicted to NOT have biallelic mutations by these criteria are highlighted in italics. Genotypically concordant sibling pairs are adjacent to one-another and are highlighted in bold or underlined text.
[0028] FIG. 10. Comparison of hematological and iron metabolism characteristics of HH and XLS A subjects. HGB, hemoglobin; MCV, mean red blood cell volume; TIBC, total iron binding capacity; TfSat, transferrin saturation; ZPP/Heme; zinc protoporphyrin/heme ratio. DETAILED DESCRIPTION OF THE INVENTION
[0029] In accordance with the present application, there may be employed conventional cellular biology, molecular biology, microbiology, and recombinant DNA techniques as explained fully in the art.
[0030] As used in this specification and the appended claims, the singular forms "a", "an", and "the" include plural references unless the context clearly dictates otherwise. Thus for example, references to "a method" include one or more methods, and/or steps of the type described herein and/or which will become apparent to those persons skilled in the art upon reading this disclosure.
[0031] As used herein, when referring to numerical values, the term "about" means ± 10% of the indicated value. For example, "about" refers to ± 0.05%, ±0.1%, ±0.2%, 0.25%, ±0.5%, ±1.0%, ±1.5%, ±2.0%, ±2.5%, ±3.0%, ±3.5%, ±4.0%, ±4.5%, ±5.0%, ±5.5%, ±6.0%, ±6.5%, ±7.0%, ±7.5%, ±8.0%, ±8.5%, ±9.0%, ±9.5%, or ±10.0%.
[0032] In accordance with the present application, there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook et al., "Molecular Cloning: A Laboratory Manual" (1989); "Current Protocols in Molecular Biology" Volumes I- III [Ausubel, R. M., ed. (1994)]; "Cell Biology: A Laboratory Handbook" Volumes I-III [J. E. Celis, ed. (1994))]; "Current Protocols in Immunology" Volumes I-III [Coligan, J. E., ed. (1994)]; "Oligonucleotide Synthesis" (M.J. Gait ed. 1984); "Nucleic Acid Hybridization" [B.D. Hames & S.J. Higgins eds. (1985)]; "Transcription And Translation" [B.D. Hames & S.J. Higgins, eds. (1984)]; "Animal Cell Culture" [R.I. Freshney, ed. (1986)]; "Immobilized Cells And Enzymes" [IRL Press, (1986)]; B. Perbal, "A Practical Guide To Molecular Cloning" (1984), each of which is specifically incorporated herein by reference in its entirety.
Antibody Terminology
[0033] As used herein, the term "antibody" refers to an immunoglobulin (Ig) whether natural or partly or wholly synthetically produced. The term also covers any polypeptide or protein having a binding domain which is, or is homologous to, an antigen-binding domain. The term further includes "antigen-binding fragments" and other interchangeable terms for similar binding fragments such as described below. Complementarity determining region (CDR) grafted antibodies and other humanized antibodies (including CDR modifications and framework region modifications) are also contemplated by this term.
[0034] Native antibodies and native immunoglobulins are usually heterotetrameric glycoproteins of about 150,000 Daltons, composed of two identical light (L) chains and two identical heavy (H) chains. Each light chain is typically linked to a heavy chain by one covalent disulfide bond, while the number of disulfide linkages varies among the heavy chains of different immunoglobulin isotypes. Each heavy and light chain also has regularly spaced intrachain disulfide bridges. Each heavy chain has at one end a variable domain ("VH") followed by a number of constant domains ("CH"). Each light chain has a variable domain at one end ("VL") and a constant domain ("CL") at its other end; the constant domain of the light chain is aligned with the first constant domain of the heavy chain, and the light-chain variable domain is aligned with the variable domain of the heavy chain. Particular amino acid residues are believed to form an interface between the light- and heavy-chain variable domains.
[0035] The terms "synthetic polynucleotide," "synthetic gene" or "synthetic polypeptide," as used herein, mean that the corresponding polynucleotide sequence or portion thereof, or amino acid sequence or portion thereof, is derived, from a sequence that has been designed, or synthesized de novo, or modified, compared to an equivalent naturally-occurring sequence. Synthetic polynucleotides (antibodies or antigen binding fragments) or synthetic genes can be prepared by methods known in the art, including but not limited to, the chemical synthesis of nucleic acid or amino acid sequences. Synthetic genes are typically different from naturally- occurring genes, either at the amino acid, or polynucleotide level, (or both) and are typically located within the context of synthetic expression control sequences. For example, synthetic gene sequences can include amino acid, or polynucleotide, sequences that have been changed, for example, by the replacement, deletion, or addition, of one or more, amino acids, or nucleotides, thereby providing an antibody amino acid sequence, or a polynucleotide coding sequence that is different from the source sequence. Synthetic gene polynucleotide sequences, may not necessarily encode proteins with different amino acids, compared to the natural gene; for example, they can also encompass synthetic polynucleotide sequences that incorporate different codons but which encode the same amino acid (i.e., the nucleotide changes represent silent mutations at the amino acid level).
[0036] With respect to antibodies, the term "variable domain" refers to the variable domains of antibodies that are used in the binding and specificity of each particular antibody for its particular antigen. However, the variability is not evenly distributed throughout the variable domains of antibodies. Rather, it is concentrated in three segments called hypervariable regions (also known as CDRs) in both the light chain and the heavy chain variable domains. More highly conserved portions of variable domains are called the "framework regions" or "FRs." The variable domains of unmodified heavy and light chains each contain four FRs (FR1, FR2, FR3 and FR4), largely adopting a β-sheet configuration interspersed with three CDRs which form loops connecting and, in some cases, part of the β-sheet structure. The CDRs in each chain are held together in close proximity by the FRs and, with the CDRs from the other chain, contribute to the formation of the antigen-binding site of antibodies (see Kabat et al, Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991), pages 647-669).
[0037] The terms "hypervariable region" and "CDR" when used herein, refer to the amino acid residues of an antibody which are responsible for antigen-binding. The CDRs comprise amino acid residues from three sequence regions which bind in a complementary manner to an antigen and are known as CDR1, CDR2, and CDR3 for each of the VH and VL chains. In the light chain variable domain, the CDRs typically correspond to approximately residues 24-34 (CDRLl), 50- 56 (CDRL2) and 89-97 (CDRL3), and in the heavy chain variable domain the CDRs typically correspond to approximately residues 31-35 (CDRH1), 50-65 (CDRH2) and 95-102 (CDRH3) according to Kabat et al., Id. It is understood that the CDRs of different antibodies may contain insertions, thus the amino acid numbering may differ. The Kabat numbering system accounts for such insertions with a numbering scheme that utilizes letters attached to specific residues {e.g., 27A, 27B, 27C, 27D, 27E, and 27F of CDRLl in the light chain) to reflect any insertions in the numberings between different antibodies. Alternatively, in the light chain variable domain, the CDRs typically correspond to approximately residues 26-32 (CDRLl), 50-52 (CDRL2) and 91- 96 (CDRL3), and in the heavy chain variable domain, the CDRs typically correspond to approximately residues 26-32 (CDRH1), 53-55 (CDRH2) and 96-101 (CDRH3) according to Chothia and Lesk, J Mol. Biol, 196: 901-917 (1987)).
[0038] As used herein, "framework region" or "FR" refers to framework amino acid residues that form a part of the antigen binding pocket or groove. In some embodiments, the framework residues form a loop that is a part of the antigen binding pocket or groove and the amino acids residues in the loop may or may not contact the antigen. Framework regions generally comprise the regions between the CDRs. In the light chain variable domain, the FRs typically correspond to approximately residues 0-23 (FRLl), 35-49 (FRL2), 57-88 (FRL3), and 98-109 and in the heavy chain variable domain the FRs typically correspond to approximately residues 0-30 (FRHl), 36-49 (FRH2), 66-94 (FRH3), and 103-133 according to Kabat et al, Id. As discussed above with the Kabat numbering for the light chain, the heavy chain too accounts for insertions in a similar manner {e.g., 35 A, 35B of CDRHl in the heavy chain). Alternatively, in the light chain variable domain, the FRs typically correspond to approximately residues 0-25 (FRLl), 33- 49 (FRL2) 53-90 (FRL3), and 97-109 (FRL4), and in the heavy chain variable domain, the FRs typically correspond to approximately residues 0-25 (FRHl), 33-52 (FRH2), 56-95 (FRH3), and 102-113 (FRH4) according to Chothia and Lesk, Id.
[0039] The loop amino acids of a FR can be assessed and determined by inspection of the three- dimensional structure of an antibody heavy chain and/or antibody light chain. The three- dimensional structure can be analyzed for solvent accessible amino acid positions as such positions are likely to form a loop and/or provide antigen contact in an antibody variable domain. Some of the solvent accessible positions can tolerate amino acid sequence diversity and others (e.g., structural positions) are, generally, less diversified. The three dimensional structure of the antibody variable domain can be derived from a crystal structure or protein modeling.
[0040] Constant domains (Fc) of antibodies are not involved directly in binding an antibody to an antigen but, rather, exhibit various effector functions, such as participation of the antibody in antibody-dependent cellular toxicity via interactions with, for example, Fc receptors (FcR). Fc domains can also increase bioavailability of an antibody in circulation following administration to a subject.
[0041] Depending on the amino acid sequence of the constant domain of their heavy chains, immunoglobulins can be assigned to different classes. There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, and several of these can be further divided into subclasses (isotypes), e.g., IgGl, IgG2, IgG3, IgG4, IgAl, and IgA2. The heavy-chain constant domains (Fc) that correspond to the different classes of immunoglobulins are called α, δ, ε, γ, and μ, respectively. The subunit structures and three-dimensional configurations of different classes of immunoglobulins are well known.
[0042] The "light chains" of antibodies (immunoglobulins) from any vertebrate species can be assigned to one of two clearly distinct types, called kappa or ("κ") and lambda or ("λ"), based on the amino acid sequences of their constant domains.
[0043] The terms "antigen-binding portion of an antibody," "antigen-binding fragment," "antigen-binding domain," "antibody fragment" or a "functional fragment of an antibody" are used interchangeably herein to refer to one or more fragments of an antibody that retain the ability to specifically bind to an antigen. Non-limiting examples of antibody fragments included within such terms include, but are not limited to, (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CHI domains; (ii) a F(ab')2 fragment, a bivalent fragment containing two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the VH and CHI domains; (iv) a Fv fragment containing the VL and VH domains of a single arm of an antibody, (v) a dAb fragment (Ward et al, (1989) Nature 341 :544 546), which containing a VH domain; and (vi) an isolated CDR. Additionally included in this definition are "one-half antibodies comprising a single heavy chain and a single light chain. Other forms of single chain antibodies, such as diabodies are also encompassed herein.
[0044] "F(ab')2" and "Fab"' moieties can be produced by treating an Ig with a protease such as pepsin and papain, and include antibody fragments generated by digesting immunoglobulin near the disulfide bonds existing between the hinge regions in each of the two heavy chains. For example, papain cleaves IgG upstream of the disulfide bonds existing between the hinge regions in each of the two heavy chains to generate two homologous antibody fragments in which an light chain composed of VL and CL (light chain constant region), and a heavy chain fragment composed of VH and CHyl (γΐ) region in the constant region of the heavy chain) are connected at their C terminal regions through a disulfide bond. Each of these two homologous antibody fragments is called Fab'. Pepsin also cleaves IgG downstream of the disulfide bonds existing between the hinge regions in each of the two heavy chains to generate an antibody fragment slightly larger than the fragment in which the two above-mentioned Fab' are connected at the hinge region. This antibody fragment is called F(ab')2.
[0045] The Fab fragment also contains the constant domain of the light chain and the first constant domain (CHI) of the heavy chain. Fab' fragments differ from Fab fragments by the addition of a few residues at the carboxyl terminus of the heavy chain CHI domain including one or more cysteine(s) from the antibody hinge region. Fab'-SH is the designation herein for Fab' in which the cysteine residue(s) of the constant domains bear a free thiol group. F(ab')2 antibody fragments originally were produced as pairs of Fab' fragments which have hinge cysteines between them. Other chemical couplings of antibody fragments are also known.
[0046] "Fv" refers to an antibody fragment which contains a complete antigen-recognition and antigen-binding site. This region consists of a dimer of one heavy chain and one light chain variable domain in tight, non-covalent or covalent association (disulfide linked Fv's have been described in the art, Reiter et al., (1996) Nature Biotechnology 14: 1239-1245). It is in this configuration that the three CDRs of each variable domain interact to define an antigen-binding site on the surface of the VH-VL dimer. Collectively, a combination of one or more of the CDRs from each of the VH and VL chains confer antigen-binding specificity to the antibody. For example, it would be understood that, for example, the CDRH3 and CDRL3 could be sufficient to confer antigen-binding specificity to an antibody when transferred to VH and VL chains of a recipient antibody or antigen-binding fragment thereof and this combination of CDRs can be tested for binding, affinity, etc. using any of the techniques described herein. Even a single variable domain (or half of an Fv comprising only three CDRs specific for an antigen) has the ability to recognize and bind antigen, although likely at a lower affinity than when combined with a second variable domain. Furthermore, although the two domains of a Fv fragment (VL and VH), are coded for by separate genes, they can be joined using recombinant methods by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv)). Such scFvs are also intended to be encompassed within the term "antigen-binding portion" of an antibody. Any VH and VL sequences of specific scFv can be linked to an Fc region cDNA or genomic sequences, in order to generate expression vectors encoding complete Ig (e.g., IgG) molecules or other isotypes. VH and VL can also be used in the generation of Fab, Fv or other fragments of Igs using either protein chemistry or recombinant DNA technology.
[0047] "Single-chain Fv" or "sFv" antibody fragments comprise the VH and VL domains of an antibody, wherein these domains are present in a single polypeptide chain. In some embodiments, the Fv polypeptide further comprises a polypeptide linker between the VH and VL domains which enables the sFv to form the desired structure for antigen binding.
[0048] The term "AVEVIER®" refers to a class of therapeutic proteins of human origin, which are unrelated to antibodies and antibody fragments, and are composed of several modular and reusable binding domains, referred to as A-domains (also referred to as class A module, complement type repeat, or LDL-receptor class A domain). They were developed from human extracellular receptor domains by in vitro exon shuffling and phage display (Silverman et al., 2005, Nat. Biotechnol. 23 : 1493-1494; Silverman et al, 2006, Nat. Biotechnol. 24:220). The resulting proteins can contain multiple independent binding domains that can exhibit improved affinity (in some cases, sub-nanomolar) and specificity compared with single-epitope binding proteins. See, for example, U.S. Patent Application Publ. Nos. 2005/0221384, 2005/0164301, 2005/0053973 and 2005/0089932, 2005/0048512, and 2004/0175756, each of which is hereby incorporated by reference herein in its entirety.
[0049] Each of the known 217 human A-domains comprises -35 amino acids (~4 kDa); and these domains are separated by linkers that average five amino acids in length. Native A- domains fold quickly and efficiently to a uniform, stable structure mediated primarily by calcium binding and disulfide formation. A conserved scaffold motif of only 12 amino acids is required for this common structure. The end result is a single protein chain containing multiple domains, each of which represents a separate function. Each domain of the proteins binds independently and the energetic contributions of each domain are additive. These proteins were called "AVEVIERs®" from avidity multimers.
[0050] The term "diabodies" refers to small antibody fragments with two antigen-binding sites, which fragments comprise a heavy chain variable domain (VH) connected to a light chain variable domain (VL) in the same polypeptide chain (VH-VL). By using a linker that is too short to allow pairing between the two domains on the same chain, the domains are forced to pair with the complementary domains of another chain and create two antigen-binding sites.
[0051] Antigen-binding polypeptides also include heavy chain dimers such as, for example, antibodies from camelids and sharks. Camelid and shark antibodies comprise a homodimeric pair of two chains of V-like and C-like domains (neither has a light chain). Since the VH region of a heavy chain dimer IgG in a camelid does not have to make hydrophobic interactions with a light chain, the region in the heavy chain that normally contacts a light chain is changed to hydrophilic amino acid residues in a camelid. VH domains of heavy-chain dimer IgGs are called VHH domains. Shark Ig-NARs comprise a homodimer of one variable domain (termed a V- NAR domain) and five C-like constant domains (C-NAR domains). In camelids, the diversity of antibody repertoire is determined by the CDRs 1, 2, and 3 in the VH or VHH regions. The CDR3 in the camel VHH region is characterized by its relatively long length, averaging 16 amino acids. This is in contrast to CDR3 regions of antibodies of many other species. For example, the CDR3 of mouse VH has an average of 9 amino acids. Libraries of camelid-derived antibody variable regions, which maintain the in vivo diversity of the variable regions of a camelid, can be made by, for example, the methods disclosed in U.S. Patent Application Ser. No. 20050037421.
[0052] "Humanized" forms of non-human {e.g., murine) antibodies include chimeric antibodies which contain minimal sequence derived from a non-human Ig. For the most part, humanized antibodies are human Igs (recipient antibody) in which one or more of the CDRs of the recipient are replaced by CDRs from a non-human species antibody (donor antibody) such as mouse, rat, rabbit or non-human primate having the desired specificity, affinity and binding function. In some instances, one or more FR amino acid residues of the human Ig are replaced by corresponding non-human amino acid residues. Furthermore, humanized antibodies can contain residues which are not found in the recipient antibody or in the donor antibody. These modifications can be made to refine antibody performance, if needed. A humanized antibody can comprise substantially all of at least one and, in some cases two, variable domains, in which all or substantially all of the hypervariable regions correspond to those of a non-human immunoglobulin and all, or substantially all, of the FRs are those of a human immunoglobulin sequence. The humanized antibody optionally can also include at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin.
[0053] A humanized antibody also includes antibodies in which part, or all of the CDRs of the heavy and light chain are derived from a non-human monoclonal antibody, substantially all the remaining portions of the variable regions are derived from human variable region (both heavy and light chain), and the constant regions are derived from a human constant region. In one embodiment, the CDR1, CDR2 and CDR3 regions of the heavy and light chains are derived from a non-human antibody. In yet another embodiment, at least one CDR {e.g., a CDR3) of the heavy and light chains is derived from a non-human antibody. Various combinations of CDR1, CDR2, and CDR3 can be derived from a non-human antibody and are contemplated herein. In one non-limiting example, one or more of the CDR1, CDR2 and CDR3 regions of each of the heavy and light chains are derived from the sequences provided herein. [0054] The term "monoclonal antibody" as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Furthermore, in contrast to conventional (polyclonal) antibody preparations, which can include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen. The modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method. For example, monoclonal antibodies can be made by the hybridoma method first described by Kohler et al., Nature 256:495 (1975), or can be made by recombinant DNA methods (see, e.g., U.S. Pat. No. 4,816,567). In certain embodiments, the monoclonal antibodies can be isolated from phage antibody libraries using the techniques described in Clackson et al., Nature 352:624-628 (1991) and Marks et al, J. Mol. Biol. 222:581-597 (1991), for example.
[0055] Antibodies can be isolated and purified from the culture supernatant or ascites mentioned above by saturated ammonium sulfate precipitation, euglobulin precipitation method, caproic acid method, caprylic acid method, ion exchange chromatography (DEAE or DE52), or affinity chromatography using anti-Ig column or a protein A, G or L column such as described in more detail below.
[0056] Exemplary antibodies for use in the compositions and methods described herein are intact immunoglobulin molecules, such as, for example, a humanized antibody or those portions of a humanized Ig molecule that contain the antigen binding site {i.e., paratope) or a single heavy chain and a single light chain, including those portions known in the art as Fab, Fab', F(ab)', F(ab')2, Fd, scFv, a variable heavy domain, a variable light domain, a variable NAR domain, bi-specific scFv, a bi-specific Fab2, a tri-specific Fab3 and a single chain binding polypeptides and others also referred to as antigen-binding fragments. When constructing an immunoglobulin molecule or fragments thereof, variable regions or portions thereof may be fused to, connected to, or otherwise joined to one or more constant regions or portions thereof to produce any of the antibodies or fragments thereof described herein. This may be accomplished in a variety of ways known in the art, including but not limited to, molecular cloning techniques or direct synthesis of the nucleic acids encoding the molecules. Exemplary non-limiting methods of constructing these molecules can also be found in the examples described herein. [0057] Methods for making bispecific or other multispecific antibodies are known in the art and include chemical cross-linking, use of leucine zippers; diabody technology; scFv dimers, linear antibodies; and chelating recombinant antibodies.
[0058] "Linear antibodies" comprise a pair of tandem Fd segments (VH-CH1-VH-CH1) which form a pair of antigen binding regions. Linear antibodies can be bispecific or monospecific.
[0059] Additionally, the anti-hepcidin antibodies disclosed herein can also be constructed to fold into multivalent forms, which may improve binding affinity, specificity and/or increased half-life in blood. Multivalent forms of anti-hepcidin antibodies can be prepared by techniques known in the art.
[0060] Bispecific or multispecific antibodies include cross-linked or "heteroconjugate" antibodies. For example, one of the antibodies in the heteroconjugate can be coupled to avidin, the other to biotin. Heteroconjugate antibodies may be made using any convenient cross-linking methods. Suitable cross-linking agents are well known in the art, and are disclosed in U.S. Pat. No. 4,676,980, along with a number of cross-linking techniques. Another method is designed to make tetramers by adding a streptavidin-coding sequence at the C-terminus of the scFv. Streptavidin is composed of four subunits, so when the scFv-streptavidin is folded, four subunits associate to form a tetramer.
[0061] According to another approach for making bispecific antibodies, the interface between a pair of antibody molecules can be engineered to maximize the percentage of heterodimers which are recovered from recombinant cell culture. One interface comprises at least a part of the CH3 domain of an antibody constant domain. In this method, one or more small amino acid side chains from the interface of the first antibody molecule are replaced with larger side chains (e.g., tyrosine or tryptophan). Compensatory "cavities" of identical or similar size to the large side chain(s) are created on the interface of the second antibody molecule by replacing large amino acid side chains with smaller ones (e.g., alanine or threonine). This provides a mechanism for increasing the yield of the heterodimer over other unwanted end-products such as homodimers.
[0062] Techniques for generating bispecific or multispecific antibodies from antibody fragments are conventionally known in the art. For example, bispecific or trispecific antibodies can be prepared using chemical linkage. Brennan et al, Science 229:81 (1985) describe a procedure wherein intact antibodies are proteolytically cleaved to generate F(ab')2 fragments. These fragments are reduced in the presence of the dithiol complexing agent sodium arsenite to stabilize vicinal dithiols and prevent intermolecular disulfide formation. The Fab' fragments generated are then converted to thionitrobenzoate (TNB) derivatives. One of the Fab'-TNB derivatives is then reconverted to the Fab'-thiol by reduction with mercaptoethylamine and is mixed with an equimolar amount of the other Fab'-TNB derivative to form the bispecific antibody. The bispecific antibodies produced can be used as agents for the selective immobilization of enzymes. Better et al, Science 240: 1041-1043 (1988) disclose secretion of functional antibody fragments from bacteria. For example, Fab'-SH fragments can be directly recovered from E. coli and chemically coupled to form bispecific antibodies.
[0063] Various techniques for making and isolating bispecific or multispecific antibody fragments directly from recombinant cell culture have are conventionally known in the art. For example, bispecific antibodies have been produced using leucine zippers, e.g., GCN4. (The leucine zipper peptides from the Fos and Jun proteins were linked to the Fab' portions of two different antibodies by gene fusion. The antibody homodimers were reduced at the hinge region to form monomers and then re-oxidized to form the antibody heterodimers. This method can also be utilized for the production of antibody homodimers.
[0064] As used herein, a "minibody" refers to a scFv fused to CH3 via a peptide linker (hingeless) or via an IgG hinge.
[0065] As used herein, a "maxibody" refers to a bivalent scFv covalently attached to the Fc region of an immunoglobulin.
[0066] As used herein, an "intrabody" refers to a single chain antibody which demonstrates intracellular expression and can manipulate intracellular protein function. Intrabodies, which comprise cell signal sequences which retain the antibody construct in intracellular regions, may be produced as described in Mhashilkar et al, (EMBO J, 14: 1542-51, 1995) and Wheeler et al, (FASEB J, 17: 1733-5. 2003). Transbodies are cell-permeable antibodies in which a protein transduction domain (PTD) is fused with single chain variable fragment (scFv) antibodies Heng et al, (Med Hypotheses, 64: 1105-8, 2005).
[0067] Additionally contemplated herein are antibodies that are SMTPs or binding domain immunoglobulin fusion proteins specific for target protein. These constructs are single-chain polypeptides comprising antigen binding domains fused to immunoglobulin domains necessary to carry out antibody effector functions. See e.g., WO03/041600, U.S. Patent publication 20030133939 and US Patent Publication 20030118592, which are hereby incorporated by reference.
[0068] Humanization of antibodies and antigen-binding fragments thereof, can be accomplished via a variety of methods known in the art and described herein. Similarly, production of humanized antibodies can also be accomplished via methods known in the art and described herein.
[0069] In one exemplary embodiment, the application contemplates a single chain binding polypeptide having a heavy chain variable region, and/or a light chain variable region which binds an epitope described herein and has, optionally, an immunoglobulin Fc region. Such a molecule is a single chain variable fragment (scFv) optionally having effector function or increased half-life through the presence of the immunoglobulin Fc region. Methods of preparing single chain binding polypeptides are known in the art (e.g., U. S. Patent Application No. 2005/0238646).
[0070] The terms "germline gene segments" or "germline sequences" refer to the genes from the germline (the haploid gametes and those diploid cells from which they are formed). The germline DNA contains multiple gene segments that encode a single Ig heavy or light chain. These gene segments are carried in the germ cells but cannot be transcribed and translated into heavy and light chains until they are arranged into functional genes. During B-cell differentiation in the bone marrow, these gene segments are randomly shuffled by a dynamic genetic system capable of generating more than 108 specificities. Most of these gene segments are published and collected by the germline database.
[0071] Binding affinity and/or avidity of antibodies or antigen-binding fragments thereof may be improved by modifying framework regions. Methods for modifications of framework regions are known in the art and are contemplated herein. Selection of one or more relevant framework amino acid positions to alter depends on a variety of criteria. One criterion for selecting relevant framework amino acids to change can be the relative differences in amino acid framework residues between the donor and acceptor molecules. Selection of relevant framework positions to alter using this approach has the advantage of avoiding any subjective bias in residue determination or any bias in CDR binding affinity contribution by the residue.
[0072] As used herein, "immunoreactive" refers to antibodies or antigen-binding fragments thereof that are specific to a sequence of amino acid residues ("binding site" or "epitope"), yet if are cross-reactive to other peptides/proteins, are not toxic at the levels at which they are formulated for administration to human use. The term "binding" refers to a direct association between two molecules, due to, for example, covalent, electrostatic, hydrophobic, and ionic and/or hydrogen-bond interactions under physiological conditions, and including interactions such as salt bridges and water bridges and any other conventional binding means. The term "preferentially binds" means that the binding agent binds to the binding site with greater affinity than it binds unrelated amino acid sequences. Preferably such affinity is at least 1-fold greater, at least 2-fold greater, at least 3-fold greater, at least 4-fold greater, at least 5-fold greater, at least 6-fold greater, at least 7-fold greater, at least 8-fold greater, at least 9-fold greater, 10-fold greater, at least 20-fold greater, at least 30-fold greater, at least 40-fold greater, at least 50-fold greater, at least 60-fold greater, at least 70-fold greater, at least 80-fold greater, at least 90-fold greater, at least 100-fold greater, or at least 1000-fold greater than the affinity of the binding agent for unrelated amino acid sequences. The terms "immunoreactive" and "preferentially binds" are used interchangeably herein.
[0073] As used herein, the term "affinity" refers to the equilibrium constant for the reversible binding of two agents and is expressed as KD. In one embodiment, the antibodies, or antigen- binding fragments thereof exhibit desirable characteristics such as binding affinity as measured by KD (equilibrium dissociation constant) for hepcidin in the range of l x lO"6 M or less, or ranging down to 10"16 M or lower, (e.g., about 10"7, 10"8, 10"9, 10"10, 10"11, 10"12, 10"13, 10"14, 10" 15, 10"16 M or less). The equilibrium dissociation constant can be determined in solution equilibrium assay using BIAcore and/or KinExA. As used herein, the term "avidity" refers to the resistance of a complex of two or more agents to dissociation after dilution. Apparent affinities can be determined by methods such as an enzyme linked immunosorbent assay (ELISA) or any other technique familiar to one of skill in the art. Avidities can be determined by methods such as a Scatchard analysis or any other technique familiar to one of skill in the art.
[0074] "Epitope" refers to that portion of an antigen or other macromolecule capable of forming a binding interaction with the variable region binding pocket of an antibody. Such binding interactions can be manifested as an intermolecular contact with one or more amino acid residues of one or more CDRs. Antigen binding can involve, for example, a CDR3 or a CDR3 pair or, in some cases, interactions of up to all six CDRs of the variable heavy (VH) and variable light (VL) chains. An epitope can be a linear peptide sequence (i.e., "continuous") or can be composed of noncontiguous amino acid sequences (i.e., "conformational" or "discontinuous"). An antibody can recognize one or more amino acid sequences; therefore an epitope can define more than one distinct amino acid sequence. Epitopes recognized by antibodies can be determined by peptide mapping and sequence analysis techniques well known to one of skill in the art. Binding interactions are manifested as intermolecular contacts with one or more amino acid residues of a CDR.
[0075] The term "specific" refers to a situation in which an antibody will not show any significant binding to molecules other than the antigen containing the epitope recognized by the antibody. The term is also applicable where for example, an antigen binding domain is specific for a particular epitope which is carried by a number of antigens, in which case the antibody or antigen-binding fragment thereof carrying the antigen binding domain will be able to bind to the various antigens carrying the epitope. The terms "preferentially binds" or "specifically binds" mean that the antibodies or fragments thereof bind to an epitope with greater affinity than it binds unrelated amino acid sequences, and, if cross-reactive to other polypeptides containing the epitope, are not toxic at the levels at which they are formulated for administration to human use. In one aspect, such affinity is at least 1-fold greater, at least 2-fold greater, at least 3-fold greater, at least 4-fold greater, at least 5-fold greater, at least 6-fold greater, at least 7-fold greater, at least 8-fold greater, at least 9-fold greater, 10-fold greater, at least 20-fold greater, at least 30- fold greater, at least 40-fold greater, at least 50-fold greater, at least 60-fold greater, at least 70- fold greater, at least 80-fold greater, at least 90-fold greater, at least 100-fold greater, or at least 1000-fold greater than the affinity of the antibody or fragment thereof for unrelated amino acid sequences. The terms "immunoreactive," "binds," "preferentially binds" and "specifically binds" are used interchangeably herein. The term "binding" refers to a direct association between two molecules, due to, for example, covalent, electrostatic, hydrophobic, and ionic and/or hydrogen-bond interactions under physiological conditions, and includes interactions such as salt bridges and water bridges, as well as any other conventional means of binding.
[0076] Antibodies may be screened for binding affinity by methods known in the art including, but not limited to, gel-shift assays, Western blots, radiolabeled competition assay, co- fractionation by chromatography, co-precipitation, cross linking, ELISA, and the like, which are described in, for example, Current Protocols in Molecular Biology (1999) John Wiley & Sons, NY, which is incorporated herein by reference in its entirety.
[0077] Antibodies which bind to the desired epitope on the target antigen may be screened in a routine cross-blocking assay such as described in Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory, Ed Harlow and David Lane (1988), can be performed. Routine competitive binding assays may also be used, in which an unknown antibody is characterized by its ability to inhibit binding of target to a target-specific antibody of the invention. Intact antigen, fragments thereof such as the extracellular domain, or linear epitopes can be used.
[0078] Antibodies that inhibit or neutralize human hepcidin activity may be identified by contacting hepcidin with an antibody, comparing hepcidin activity in the presence and absence of the test antibody, and determining whether the presence of the antibody decreases activity of the hepcidin. The biological activity of a particular antibody, or combination of antibodies, may be evaluated in vivo using a suitable animal model, including any of those described herein.
[0079] "Isolated" (used interchangeably with "substantially pure" or "purified") when applied to polypeptides means a polypeptide or a portion thereof which, by virtue of its origin or manipulation: (i) is present in a host cell as the expression product of a portion of an expression vector; or (ii) is linked to a protein or other chemical moiety other than that to which it is linked in nature; or (iii) does not occur in nature, for example, a protein that is chemically manipulated by appending, or adding at least one hydrophobic moiety to the protein so that the protein is in a form not found in nature. By "isolated" it is further meant a protein that is: (i) synthesized chemically; or (ii) expressed in a host cell and purified away from associated and contaminating proteins. The term generally means a polypeptide that has been separated from other proteins and nucleic acids with which it naturally occurs. Preferably, the polypeptide is also separated from substances such as antibodies or gel matrices (polyacrylamide) which are used to purify it.
[0080] An immunoglobulin heavy chain can be derived from any antibody isotype, e.g., IgG, IgA, IgE, IgD and IgM and any of the isotype sub-classes, including, for example, IgGl, IgG2b, IgG2a, IgG3 and IgG4.
[0081] An antibody provided herein may be modified (labeled) to include a tracer for detection of an antibody during an assay. Methods for modifying an antibody are well known in the art and are contemplated herein. Non-limiting examples of reporter molecules which have been conjugated to polypeptides include enzymes, radiolabels, haptens, fluorescent labels, phosphorescent molecules, chemiluminescent molecules, chromophores, luminescent molecules, photoaffinity molecules, colored particles or ligands, such as biotin. Detectable labels include compounds and/or elements that can be detected due to their specific functional properties, and/or chemical characteristics, the use of which allows the polypeptide to which they are attached to be detected, and/or further quantified if desired. Many appropriate detectable (imaging) agents are known in the art, as are methods for their attachment to polypeptides (see, for e.g., U.S. Pat. Nos. 5,021,236; 4,938,948; and 4,472,509, each of which is hereby incorporated by reference).
[0082] Methods of joining polypeptides such as antibodies with detectable moieties are known in the art and include, for example, recombinant DNA technology to form fusion proteins and conjugation (e.g., chemical conjugation). Methods for preparing fusion proteins by chemical conjugation or recombinant engineering are well-known in the art. Methods of covalently and non-covalently linking components are also known in the art. See, e.g., Williams (1995) Biochemistry 34: 1787 1797; Dobeli (1998) Protein Expr. Purif. 12:404-414; and Kroll (1993) DNA Cell. Biol. 12: 441-453.
Hepcidin
[0083] Hepcidin is a 25 amino acid peptide hormone that regulates iron homeostasis. Genetic or acquired hepcidin deficiency or excess is the main or contributing cause of major diseases of iron regulation. In other diseases where iron homeostasis is disturbed, blood hepcidin concentrations reflect the physiologic response to the body's iron status.
[0084] Hepcidin is the master regulator of iron metabolism, intestinal iron absorption, recycling of senescent RBCs and iron via macrophages, and efflux to plasma from hepatocytes in humans. It regulates extracellular iron in response to changes in dietary and systemic iron, anemia, hypoxia, inflammation and erythropoiesis. Hepcidin is an acute phase protein increased in anemia of inflammation and IL-6 is a principal regulator of hepcidin during inflammation. Hepcidin inhibits cellular iron efflux by binding to and inducing internalization of the sole known iron exporter, ferroportin (FPN1), which mediates iron absorption from intestine and iron recycling by macrophages. Synthetic hepcidin injected into mice rapidly lowers serum iron levels, confirming its central role in regulating iron availability.
Hepcidin-related disorders
[0085] As used herein, a "hepcidin-related disorder" refers to a condition caused by or associated with an abnormal level of hepcidin (e.g., hepcidin excess or hepcidin deficiency relative to the degree of anemia or iron stored) which disrupts iron homeostasis. A disruption in iron homeostasis can in turn result in secondary diseases such as anemia. Acute or chronic inflammatory conditions can result in up-regulation of hepcidin expression, which can result in decreased circulating iron levels, which can cause anemia or worsen existing anemia. Exemplary hepcidin-related inflammatory diseases include anemia of cancer, anemia of chronic disease, anemia of inflammation, chemotherapy-induced anemia, chronic kidney disease (stage I, II, III, IV or V), end stage renal disease, chronic renal failure congestive heart failure, cancer, rheumatoid arthritis, systemic lupus erythematosus, Crohn's disease, H. pylori infection or other bacterial infections, hepatitis C, HIV, and other viral illnesses, arteriosclerosis, atherosclerosis, cirrhosis of the liver, pancreatitis, sepsis, vasculitis, iron-deficiency, hypochromic microcytic anemia and conditions with hepcidin excess.
[0086] As used herein, the phrase "disease (or disorder) of iron homeostasis" refers to a condition in which a subject's iron levels require modulation. It includes hepcidin-related disorders; conditions not associated with elevated levels of hepcidin that nevertheless would benefit from inhibition of hepcidin activity, such as a disruption in iron homeostasis not caused by hepcidin; diseases where aberrant iron absorption, recycling, metabolism or excretion causes a disruption in normal iron blood levels or tissue distribution; diseases where iron dysregulation is a consequence of another disease or condition, such as inflammation, cancer or chemotherapy; diseases or disorders resulting from abnormal iron blood levels or tissue distribution; and diseases or disorders that can be treated by modulating iron levels or distribution. Non-limiting examples of such diseases or disorders of iron homeostasis, hepcidin-related disorders and inflammatory conditions which can result in hepcidin excess include African iron overload, iron refractory iron deficiency anemia (IRIDA), alpha-thalassemia, beta-thalassemia intermedia or major, Alzheimer's disease, anemia, anemia of cancer, anemia of chronic disease, anemia of inflammation, arteriosclerosis or atherosclerosis (including coronary artery disease, cerebrovascular disease or peripheral occlusive arterial disease), ataxias, ataxias related to iron, atransferrinemia, cancer, ceruloplasmin deficiency, chemotherapy-induced anemia, chronic renal/kidney disease (stage I, II, III, IV or V), including end stage renal disease or chronic renal/kidney failure, acute kidney injury (AKI), cardiopulmonary bypass-associated AKI, drug or toxin-associated AKI, cirrhosis of liver, classic hemochromatosis, collagen-induced arthritis (CIA), conditions with hepcidin excess (elevated hepcidin), congenital dyserythropoietic anemia, congestive heart failure, Crohn's disease, diabetes, disorders of iron biodistribution, disorders of iron homeostasis, disorders of iron metabolism, ferroportin disease, ferroportin mutation hemochromatosis, folate deficiency, Friedrich's ataxia, funicular myelosis, Gracile syndrome, H. pylori infection or other bacterial infections, neurodegeneration with iron accumulation (Hallervordan-Spatz Disease), hereditary hemochromatosis, acquired hemochromatosis, hemochromatosis resulting from mutations in transferrin receptor 2, hemoglobinopathies, hepatitis, hepatitis (Brock), hepatitis C, hepatocellular carcinoma, HIV or other viral illnesses, Huntington's disease, hyperferritinemia, hypochromic microcytic anemia, hypoferremia, insulin resistance, iron deficiency anemia, iron deficiency disorders, iron overload disorders, iron-deficiency conditions with hepcidin excess, juvenile hemochromatosis (HFE2), multiple sclerosis, mutation in transferrin receptor 2, HFE, hemojuvelin, ferroportin or other genes of iron metabolism, neonatal hemochromatosis, neurodegenerative diseases related to iron, osteopenia, osteoporosis pancreatitis, Pantothenate kinase-associated neurodegeneration, Parkinson's disease, pellagra, pica, porphyria, porphyria cutanea tarda, pseudoencephalitis, pulmonary hemosiderosis, red blood cell disorders, rheumatoid arthritis, sepsis, sideroblastic anemia, systemic lupus erythematosus, thalassemia, thalassemia intermedia, transfusional iron overload, tumors, vasculitis, vitamin B6 deficiency, vitamin B12 deficiency, and/or Wilson's disease.
[0087] Non-inflammatory conditions which are implicated in a disruption of iron regulation include, but are not limited to, vitamin B6 deficiency, vitamin B12 deficiency, folate deficiency, pellagra, funicular myelosis, pseudoencephalitis, Parkinson's Disease, Alzheimer's Disease, coronary heart disease, osteopenia and osteoporosis, hemoglobinopathies and disorders of red cell metabolism, and peripheral occlusive arterial disease.
[0088] Hepcidin deficiency and common iron overload disorders: Hereditary Hemochromatosis (HH) is a group of genetic disorders characterized by excessive iron absorption that leads to the accumulation of iron in the liver and other tissues. Iron-induced tissue damage can result in organ failure and death. Loss of hepcidin production due to loss-of-function mutations in the hepcidin gene itself causes juvenile hemochromatosis, the most severe form of hereditary hemochromatosis. HH caused by mutations in genes other than hepcidin all manifest relative or absolute hepcidin deficiency. In sum, inappropriately low hepcidin levels in HH patients allow unrestrained absorption of iron and, eventually iron overload. [0089] Hepcidin in thalasemmias and other "iron loading" anemias: Thalasemmias are anemias caused by diverse genetic lesions that result in deficient hemoglobin a- or β-chain synthesis associated with ineffective erythropoiesis (IE)— a situation in which erythropoiesis is expanded, but mature erythrocytes are not produced due to premature death of precursors in the bone marrow. Iron overload is the primary cause of morbidity-mortality and commonly attributed to excessive blood transfusions. However, patients who are never or rarely transfused (thalassemia intermedia) also suffer from severe iron overload as a consequence of excessive iron absorption. It is now evident that the fundamental pathophysiology of this iron overload is a relative hepcidin deficiency, similar to that seen in hereditary hemochromatosis, that is mediated by a substance produced by the bone marrow in the setting of IE, possibly, erythroferrone. Similarly, hepcidin suppression is observed in other anemias with IE, including sideroblastic anemias and myelodysplastic syndromes.
[0090] Inflammation promotes hepcidin excess and causes anemia due to iron-restricted erythropoiesis: Hepcidin production is greatly stimulated by inflammatory mediators, particularly IL-6. Indeed, highly elevated urinary hepcidin levels are observed in patients with infection and inflammatory disorders. When hepcidin is excessive, iron absorption is inhibited and iron is sequestered in macrophages, leading to iron-restricted erythropoiesis and anemia whose severity is proportional to the level and duration of hepcidin overexpression. This was experimentally confirmed by transgenic mice engineered to overexpress hepcidin and humans with rare hepatic adenomas that overexpress hepcidin. If sustained, as in chronic inflammatory diseases such as rheumatoid arthritis and infections, excessive inflammation-induced hepcidin can eventuate in so-called anemia of chronic disease or anemia of inflammation (ACD; AI), which is the most common anemia in hospitalized patients. Hepcidin IVDs may enable differentiation between ACD/AI from ID where hepcidin is responsive to iron.
[0091] Hepcidin excess due to mutations in TMPRSS6 causes iron refractory iron deficiency anemia (IRJDA): In humans, genetic deficiency of a negative regulator of hepcidin transcription, the membrane protein matriptase 2 (TMPRSS6), leads to overproduction of hepcidin and the iron-refractory iron-deficiency anemia (IRIDA) that is characteristic of this disease. Our first generation validated RUO serum hepcidin assay was instrumental in showing that the IRIDA phenotype is caused by inappropriately elevated hepcidin in relation to plasma iron levels. IRIDA is a primary disorder of excessive hepcidin synthesis and as we show in the preliminary data, can be diagnosed by measuring hepcidin levels, rather than by DNA sequencing. Consequently, diagnosis of IRIDA due to TMPRSS6 (mut/mut) mutations is the first clinical indication we will pursue for FDA approval for our MAb 583 hepcidin C-ELISA. [0092] Anemia in the U.S. and hepcidin diagnostics: Based on a national household interview survey, the National Center for Health Statistics estimated in 1996 that 3.4 million Americans were living with anemia. The signs and symptoms of anemia may be vague, and are often attributed to the diseases with which it is associated, including chronic kidney disease (CKD), cancer, diabetes, cardiovascular disease, HIV/AIDS, rheumatoid arthritis, and inflammatory bowel disease among others. The National Kidney Foundation's Kidney Disease Outcomes Quality Initiative (NKF-K/DOQI) new clinical practice guideline published in 2000 estimates that more than 19.5 million Americans have CKD. Anemia is a common and early complication of CKD and worsens as the disease progresses. Not only is anemia a consequence of many diseases, it may also result from treatment of the disease itself in patients with diseases such as cancer, HIV/AIDS, or hepatitis C. Candidates for surgery may be anemic due to underlying disease or become so due to perioperative blood loss. Anemia also occurs more frequently among the elderly, and its prevalence is expected to increase significantly as Baby Boomers age. Although the comparative advantages of the hepcidin assay over other assays used in diagnosis of anemia are being defined, and will require larger studies, preliminary data suggest that hepcidin may be useful in detecting iron deficiency (ID) as a cause of anemia, and differentiating it from common causes of anemia of inflammation.
[0093] Iron deficiency: (ID) is the most common global nutritional deficiency and iron deficiency anemia (IDA) is the leading cause of acquired anemia in children. The prevalence rates of ID and IDA in US toddlers are 9% and 3%, respectively, and together they affect nearly 3 million children, particularly those of low-socioeconomic status and minorities. The incidence of ID is 5% in early childhood (ages 3-5) and in adolescent girls (ages 12-19) the incidence of ID is 9-16%; 2% of adolescent girls have frank IDA. There is an association between IDA in early childhood and cognitive, motor and behavioral impairment (Pollitt 1993) and iron deficiency in older children and adolescents may affect cognitive function and academic performance. Once recognized, IDA can be reversed with iron supplementation, but the alteration in cognitive performance observed may not be fully correctable and persist past school age. The US Preventive Services Task Force 2006 report on screening for IDA suggests that detection and treatment of ID is highly recommended, since prevention of mental, motor, and behavior effects requires initiation of oral or IV iron therapy in the pre-anemic stages.
Methods for quantifying hepcidin in a sample
[0094] The present application describes new methods for quantifying an amount of hepcidin in a fluid sample using an immunoassay. The methods provide an advantage over prior assays in that the results are more sensitive and accurate. [0095] Methods for quantifying hepcidin in a fluid are described in US Patent No. 7,745,162, by Lauth et al., are incorporated herein by reference.
[0096] The inventors of the present application have identified for the first time that a tracer reagent may have a detector molecule covalently linked to amino acid residues 18 or 24 of a hepcidin molecule. The methods described herein represent an improvement over prior with respect to the location of where the detector molecule is linked to a peptide in that it was not previously considered that the detector molecule could be linked to an internal amino acid residue in the peptide rather than the C- or N-terminus.
[0097] Samples to be obtained for use in an assay described herein include tissues and bodily fluids which may be processed using conventional means in the art {e.g., homogenization, serum isolation, etc.). Accordingly, a sample obtained from a patient is transformed prior to use in an assay described herein. Hepcidin, if present in the sample, is further transformed in the methods described herein by virtue of binding to an antibody and a labeled tracer reagent.
[0098] Provided herein is a method for quantifying an amount of hepcidin in a fluid sample using an immunoassay, comprising: (a) providing a known amount of a tracer reagent consisting of: (1) a peptide having an amino acid sequence of at least a portion of any one of SEQ ID NOS: 1, 3 and 4; (2) at least one hydrophilic spacer consisting of one or more AEEAc residues(nl-6) covalently linked to the peptide of step (a)(1) at the amino terminus or a lysine residue in said peptide; and (3) a detector molecule covalently linked to the hydrophilic spacer of (a)(2); (b) contacting a fluid sample from a patient with a known amount of said tracer reagent in the presence of an immobilized antibody that specifically binds to an epitope on hepcidin at less than about 50 picomolar and has acceptable non-specific binding characteristics; (c) washing unbound tracer reagent; (d) adding a development solution; (e) stopping the reaction with a stop solution; (f) detecting the relative amount of tracer reagent of step (a) bound to the immobilized antibody with a substrate, optionally stopping the reaction with a stop solution; and (g) calculating the amount of the hepcidin present in the sample based on the results of the detecting of step (f).
[0099] Also provided herein is a method for quantifying an amount of hepcidin in a fluid sample using an immunoassay, comprising: providing a known amount of a tracer reagent consisting of: a peptide having an amino acid sequence of at least a portion of any one of SEQ ID NOS: 1, 3 and 4; at least one hydrophilic spacer consisting of one or more AEEAc residues(ni-6) covalently linked to the peptide of step (a)(1) at the amino terminus or a lysine residue in said peptide; and a detector molecule covalently linked to the hydrophilic spacer of (a)(2); contacting a fluid sample from a patient with a known amount of said tracer reagent in the presence of an immobilized antibody that specifically binds to an epitope on hepcidin with a dissociation constant of less than about 50 picomolar; and determining the amount of hepcidin present in the fluid sample based on the amount of tracer reagent bound to the immobilized antibody.
[00100] In some embodiments, an immobilized antibody that specifically binds to an epitope on hepcidin at less than about 20 picomolar, less than about 10 picomolar, less than about 7 picomolar, or less than about 5 picomolar, and has acceptable non-specific binding characteristics.
[00101] In one embodiment, the tracer reagent comprises biotin as the detector molecule covalently linked to the hydrophilic spacer at a single site on the peptide. For example, the tracer reagent comprises biotin as the detector molecule covalently linked to the hydrophilic spacer at amino acid residue 18 or amino acid residue 24 of a hepcidin peptide. In certain examples, the tracer reagent comprises K18-biotin or Bio-K24 and the antibody is 583 or an antibody that comprises the CDRs of antibody 583. In other examples, the tracer reagent comprises K18- biotin or Bio-K24 and the antibody is 1B1 or an antibody that comprises the CDRs of antibody 1B1. In some instances, an antibody described herein is a monoclonal antibody, a humanized antibody, a deimmunized antibody, a human antibody, or a ScFv.
[00102] In one non-limiting example, the antibody that comprises antibody 583 comprises a variable heavy chain of SEQ ID NO: 17 and a variable light chain of SEQ ID NO: 18. In one non-limiting example, the antibody that comprises the CDRs of 583 comprises variable heavy chain CDRs encoded by SEQ ID NOS: 5, 7 and 9; and variable light chain CDRs encoded by SEQ ID NOS: 11, 13 and 15. In one non-limiting example, the antibody that comprises antibody 1B1 comprises a variable heavy chain of SEQ ID NO: 19 and a variable light chain of SEQ ID NO: 20. In one non-limiting example, the antibody that comprises the CDRs of 1B1 comprises variable heavy chain CDRs encoded by SEQ ID NOS: 6, 8 and 10; and variable light chain CDRs encoded by SEQ ID NOS: 12, 14 and 16.
[00103] The known amount of a tracer reagent may be empirically determined and may be, for example, an amount from about 0.05 ng to about 50 ng, from about 0.5 ng to about 40 ng, from about 1.0 ng to about 30 ng, from about 5 ng to about 25 ng, from about 10 ng to about 20 ng, from about 0.05 ng to about 25 ng, from about 0.5 ng to about 15 ng, or from about 0.5 ng to about 10 ng, or any integer between.
[00104] Any suitable conventional ELISA development solution may be used in any of the methods described herein including, but not limited to, Tetramethyl Benzidine (TMB) and 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS).
[00105] A stop solution may be added to stop the development of the substrate when a peptide is present. Any suitable conventional stop solution may be used in any of the methods described herein including, but not limited to, HC1, H2SO4, and phosphoric acid. [00106] Hepcidin peptides to be used in any of the methods described herein include, but are not limited to, a peptide of any one of SEQ ID NOS: 1, 3 and 4. In one embodiment, a peptide to be used in the methods described herein has an amino acid sequence set forth as SEQ ID NO 1. In another embodiment, a peptide to be used in the methods described herein has an amino acid sequence set forth as SEQ ID NO 3. In another embodiment, a peptide to be used in the methods described herein has an amino acid sequence set forth as SEQ ID NO 4. A peptide to be used in the methods described herein may be oxi datively-folded.
[00107] In any of such methods, the optical density (e.g., 405 nm or 450 nm) of the wells may be measured after a stop solution is added. A computer program such as, for example, GraphPad Prism, may be used to statistically interrogate the data and interpolate the hepcidin concentration of the sample from a standard curve.
[00108] Also provided herein is a method for quantifying an amount of hepcidin in a fluid sample using an immunoassay, comprising: (a) providing a known amount of a tracer reagent consisting of: (1) a peptide having an amino acid sequence of at least a portion of any one of SEQ ID NOS: 1, 3 and 4; (2) at least one hydrophilic spacer consisting of one or more AEEAc residues(nl -6) covalently linked to the peptide of step (a)(1) at the amino terminus or a lysine residue in said peptide; and (3) a detector molecule covalently linked to the hydrophilic spacer of (a)(2); (b) contacting a fluid sample from a patient with a known amount of said tracer reagent in the presence of an immobilized antibody that specifically binds to an epitope on hepcidin at less than about 50 picomolar and has acceptable non-specific binding characteristics; (c) washing unbound tracer reagent; (d) adding a secondary detection reagent; (e) washing unbound secondary detection reagent, (f) adding a development solution (e.g., 10-20 min); (g) stopping the reaction with a stop solution; (h) detecting the relative amount of tracer reagent of step (a) bound to the immobilized antibody with a substrate, optionally stopping the reaction with a stop solution; measuring the optical density (OD) at 450 nm and (i) calculating the amount of the hepcidin present in the sample based on the results of the detecting of step (d).
[00109] Also provided herein is a method for quantifying an amount of hepcidin in a fluid sample using an immunoassay, comprising: providing a known amount of a tracer reagent consisting of: a peptide having an amino acid sequence of at least a portion of any one of SEQ ID NOS: 1, 3 and 4; at least one hydrophilic spacer consisting of one or more AEEAc residues(ni-6) covalently linked to the peptide of step (a)(1) at the amino terminus or a lysine residue in said peptide; and a detector molecule covalently linked to the hydrophilic spacer of (a)(2); contacting a fluid sample from a patient with a known amount of said tracer reagent in the presence of an immobilized antibody that specifically binds to an epitope on hepcidin with a dissociation constant of less than about 50 picomolar; and determining the amount of hepcidin in the fluid sample based upon the amount of secondary detection reagent.
[00110] In some embodiments, an immobilized antibody that specifically binds to an epitope on hepcidin at less than about 20 picomolar, less than about 10 picomolar, less than about 7 picomolar, or less than about 5 picomolar, and has acceptable non-specific binding characteristics.
[00111] In one embodiment, the method further comprises, after step (c), adding a secondary detection reagent. One non-limiting example of a secondary detection reagent that may be added in such methods is streptavidin HRP.
[00112] A detector molecule may be added via a hydrophilic spacer to an internal amino acid residue of a hepcidin peptide.
[00113] In one embodiment, the tracer reagent comprises HRP-K24 or HRP-K18 and the antibody is 583 or an antibody that comprises the CDRs of antibody 583. In another embodiment, the tracer reagent comprises HRP-K24 or HRP-K18 and the antibody is 1B1 or an antibody that comprises the CDRs of antibody 1B1. In some instances, an antibody described herein is a monoclonal antibody, a humanized antibody, a deimmunized antibody or a human antibody.
[00114] In one non-limiting example, the antibody that comprises antibody 583 comprises a variable heavy chain of SEQ ID NO: 17 and a variable light chain of SEQ ID NO: 18. In one non-limiting example, the antibody that comprises the CDRs of 583 comprises variable heavy chain CDRs encoded by SEQ ID NOS: 5, 7 and 9; and variable light chain CDRs encoded by SEQ ID NOS: 11, 13 and 15. In one non-limiting example, the antibody that comprises antibody 1B1 comprises a variable heavy chain of SEQ ID NO: 19 and a variable light chain of SEQ ID NO: 20. In one non-limiting example, the antibody that comprises the CDRs of 1B1 comprises variable heavy chain CDRs encoded by SEQ ID NOS: 6, 8 and 10; and variable light chain CDRs encoded by SEQ ID NOS: 12, 14 and 16.
[00115] In another embodiment, the secondary detection reagent comprises streptavidin
HRP, or another conventionally known agent in the art.
[00116] The known amount of a tracer reagent may be empirically determined and may be, for example, an amount from about 0.05 ng to about 50 ng, from about 0.5 ng to about 40 ng, from about 1.0 ng to about 30 ng, from about 5 ng to about 25 ng, from about 10 ng to about 20 ng, from about 0.05 ng to about 25 ng, from about 0.5 ng to about 15 ng, or from about 0.5 ng to about 10 ng, or any integer between. [00117] Any suitable conventional ELISA development solution may be used in any of the methods described herein including, but not limited to, Tetramethylbenzidine (TMB) and 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS).
[00118] A stop solution may be added to stop the development of the substrate when a peptide is present. Any suitable conventional stop solution may be used in any of the methods described herein including, but not limited to, HC1, H2S04, and phosphoric acid.
[00119] Hepcidin peptides to be used in any of the methods described herein include, but are not limited to, a peptide of any one of SEQ ID NOS: 1, 3 and 4. In one embodiment, a peptide to be used in the methods described herein has an amino acid sequence set forth as SEQ ID NO 1. In another embodiment, a peptide to be used in the methods described herein has an amino acid sequence set forth as SEQ ID NO 3. In another embodiment, a peptide to be used in the methods described herein has an amino acid sequence set forth as SEQ ID NO 4. A peptide to be used in the methods described herein may be oxi datively-folded.
[00120] In any of such methods, the optical density (e.g., 405 nm or 450 nm) of the wells may be measured after a stop solution is added. A computer program such as, for example, GraphPad Prism, may be used to statistically interrogate the data and interpolate the hepcidin concentration of the sample from a standard curve.
[00121] In any of such methods, an immobilized support may be an inert support that is commercially available in the art such as, for example, nitrocellulose, polyvinylidene difluoride (PVDF), nylon, polyethersulfone, a polystyrene plate or magnetic beads. Such plates or beads are commercially available from, for example, THERMO FISHER SCIENTIFIC®, BIO- RAD®, ROCHE®, IN VITRO GEN® and other suppliers. It will be understood that compounds may be attached to an inert support using conventionally known techniques including, but not limited to, passive attachment via hydrophobic bonding; covalent bonding; ionic bonding via a variety of chemical means; or a bioaffinity type of immobilization where the inert support is coated protein A or G and the antibody is immobilized via its Fc region.
Competitive Assays
[00122] Hepcidin is a highly informative diagnostic for differential diagnosis of genetic and acquired IDA: The measurement of hepcidin as a biomarker of iron status is theoretically and clinically compelling because it is the sole hormone regulating human systemic iron homeostasis and is at the intersection between dietary iron absorption, transport, and recycling for erythropoiesis and iron-sequestration due to inflammatory signaling, particularly via IL-6. Hepcidin may be used to refine diagnosis of IDA as it integrates and responds rapidly to iron requirements for blood and periodic iron sequestration or chronic pathogenic sequestration in many diseases. [00123] The development of a widely-distributable hepcidin immunoassay has been hampered by the great difficulty in producing anti-hepcidin antibodies. Alternative assays based on mass spectrometric techniques have been developed, but the required equipment is not widely available in clinical or research laboratories, and when the equipment is available, the assay costs are high.
[00124] Normalizing plasma hepcidin to plasma iron indices predicts MPRSS6 mutation status in patients with Chronic Iron Deficiency.
[00125] Iron deficiency (ID) and iron deficiency anemia (IDA) are common. In at risk populations, such as toddlers, adolescent girls, and women of childbearing age, screening studies in the United States, for example, demonstrate incidences of 9%-l l% and 2%-5% for ID and IDA, respectively. The most common cause of ID in young adults and adult patients is blood loss, whereas in children it is a relative nutritional deficiency owing to inadequate intake in the setting of rapid growth. Less commonly, malabsorption owing to gastrointestinal diseases or chronic inflammation may be the underlying basis of ID or IDA (ID/ A).
[00126] Hepcidin is a 25 amino acid peptide produced in the liver that is responsive to iron stores, erythropoiesis, hypoxia, and inflammation. Hepcidin negatively regulates the expression of the duodenal and macrophage iron exporter ferroportin 1 (FPN1) in response to high iron levels. Consequently, hepcidin suppresses systemic iron absorption as well as iron reutilization and plasma iron availability.
[00127] Many primary (inherited) disorders of iron metabolism involve the dysregulation of hepcidin or the ability of hepcidin to regulate FPN1 expression. Autosomal recessive forms of hereditary hemochromatosis (HH), for example, are due to defects in several genes that promote the expression of hepcidin in response to hepatocellular and/or macrophage iron stores and/or plasma levels of diferric-transferrin. Iron Refractory Iron Deficiency Anemia (IRIDA) is the phenotypic opposite of HH, insofar as hepcidin is inappropriately increased in relation to iron stores. Patients with IRIDA have congenital hypochromic, microcytic anemia associated with systemic iron deficiency. The anemia is unresponsive or very poorly responsive to oral iron supplementation and only partially or temporarily responsive to parenteral iron therapy. IRIDA is due to mutations in transmembrane protease, serine 6 (TMPRSS6), a hepatocyte-specific protein that ordinarily negatively regulates iron-dependent hepcidin gene expression.
[00128] IRIDA can be difficult to distinguish from clinically complicated cases of acquired iron deficiency that are unresponsive to oral or parenteral iron therapy in which there is no clear cause {e.g., ongoing blood loss and/or malabsorption). For these reasons, and because clinical genetic diagnostics may be unavailable, expensive or undesirable, we sought to develop a biochemical approach to the diagnosis of IRIDA. In particular, we wished to address, "What level of hepcidin is too high for a patient with acquired ID/A and would suggest a diagnosis of IRIDA? " We specifically aimed to develop an algorithm based on plasma hepcidin to distinguish patients with IRIDA due to MPRSS6 mutations from patients with chronic acquired ID/A in whom hepcidin levels should be appropriately low relative to iron stores. To do so, we analyzed the hematological, biochemical, and genetic features of a group of patients with chronic ID/A referred for research testing for TMPRSS6 mutations.
[00129] Certain subjects with anemia fail to respond to standard oral iron treatments. As described herein, the inventors have discovered the level of hepcidin in a subject is correlated with responsiveness to oral iron treatments and accordingly, described herein are methods of treatment relating to this discovery. In one aspect of any of the embodiments, described herein is a method of treating iron deficiency anemia in a subject in need thereof, the method comprising: a) measuring the level of hepcidin in a biological sample obtained from the subject; b) administering parenteral iron to the subject if the level of hepcidin is increased relative to a reference level. Levels of hepcidin which are increased relative to a reference level indicate that the patient is unlikely to respond to oral therapy. In some embodiments of any of the aspects, the methods described herein can comprise administering oral iron to the subject if the level of hepcidin is not increased relative to a reference level.
[00130] The methods described herein can further relate to monitoring treatment efficacy and/or sustained methods of treatment, e.g., determining if parenteral iron administration has been sufficient and/or should be continued. In some embodiments of any of the aspects, the methods described herein further comprise c) measuring the level of hepcidin in a biological sample obtained from the subject after the administering of step b); and d) administering a further dose of parenteral iron to the subject if the level of hepcidin measured in step c) is increased relative to a reference level.
[00131] As described elsewhere herein, the inventors have determined that measurements which take into account plasma iron and/or TfSat (Transferrin Saturation) provide improved discriminatory capabilities. Accordingly, in some embodiments, a step comprising measuring the level of hepcidin further comprises measuring the level of plasma iron and a step comprising administration further comprises administering parenteral iron to the subject if the level of plasma Iron/logio(Hepcidin) is decreased relative to a reference level; or administering oral iron to the subject if the level of plasma Iron/1 ogio(Hepci din) is not decreased relative to a reference level. A level of plasma Iron/logi0(Hepcidin) which is decreased relative to a reference level indicates that the patient is unlikely to respond to oral iron therapy. In some embodiments, a step comprising measuring the level of hepcidin further comprises measuring the level of TfSat and a step comprising administration further comprises administering parenteral iron to the subject if the level of Tfsat/logi0(Hepcidin) is decreased relative to a reference level; or administering oral iron to the subject if the level of Tfsat/logio(Hepcidin) is not decreased relative to a reference level. A level of Tfsat/logio(Hepcidin) which is decreased relative to a reference level indicates that the patient is unlikely to respond to oral iron therapy.
[00132] The inventors have further determined the relative influence of hemoglobin, hepcidin, plasma iron, and ferritin levels to the foregoing discriminatory, diagnostic, and therapeutic methods. Therefore, provided herein are algorithms that allow a quantification of, e.g., the likelihood of a patient responding to oral iron, or the likelihood of a subject having TMPRSS6 mutations.
[00133] In one aspect of any of the embodiments, provided herein is a method of treating anemia in a subject in need thereof, the method comprising: a) measuring the level of hemoglobin, hepcidin and the level of plasma iron in a biological sample obtained from the subject; b) administering parenteral iron to the subject if the value of p according to equation 2
P = e (9.7743-0.7826*HGB+0.2067*Iron- 0.4487*Iron/logl0(hepcidin))7+e(9.7743-
0.7826*HGB+0.2067*Iron-0.4487*Iron/logl0(hepcidin))
(equation 2)
is about 0.7 or greater (e.g., about 0.7, 0.75, 0.8, 0.85, 0.9 or greater), thereby indicating the subject has Iron-Refractory Iron-Deficiency Anemia (IRIDA); and c) administering oral iron to the subject if the value of p according to equation 2 is less than about 0.7 (e.g., less than about 0.7, less than about 0.65, less than about 0.6, less than about 0.55, or less than about 0.5). In one aspect of any of the embodiments, provided herein is a method of treating anemia in a subject in need thereof, the method comprising: a) measuring the level of hemoglobin, hepcidin and the level of plasma iron in a biological sample obtained from the subject; b) administering parenteral iron to the subject if the value of p according to equation 2
P = e (9.7743-0.7826*HGB+0.2067*Iron- 0.4487*Iron/logl0(hepcidin))7+e(9.7743-
0.7826*HGB+0.2067*Iron-0.4487*Iron/logl0(hepcidin))
(equation 2)
is about about 0.5 or greater, thereby indicating the subject has Iron-Refractory Iron-Deficiency Anemia (IRIDA); and c) administering oral iron to the subject if the value of p according to equation 2 is less than about 0.5. [00134] In one aspect of any of the embodiments, provided herein is a method of treating anemia in a subj ect in need thereof, the method comprising: a) administering parenteral iron to the subject if the value of p according to equation 2
P = e (9.7743-0.7826*HGB+0.2067*Iron- 0.4487*Iron/logl0(hepcidin))7+e(9.7743-
0.7826*HGB+0.2067*Iron-0.4487*Iron/logl0(hepcidin))
(equation 2)
for a biological sample obtained from the subject is about 0.7 or greater (e.g., about 0.7, 0.75, 0.8, 0.85, 0.9 or greater), thereby indicating the subject has Iron-Refractory Iron-Deficiency Anemia (IRIDA); and b) administering oral iron to the subject if the value of p according to equation 2 for a biological sample obtained from the subject is less than about 0.7 (e.g., less than about 0.7, less than about 0.65, less than about 0.6, less than about 0.55, or less than about 0.5). In one aspect of any of the embodiments, provided herein is a method of determining the likelihood of a subject not responding to oral iron treatment for anemia, the method comprising: a) measuring the level of hemoglobin, hepcidin and the level of plasma iron in a biological sample obtained from the subject; and b) calculating p according to equation 2
P = e (9.7743-0.7826*HGB+0.2067*Iron- 0.4487*Iron/logl0(hepcidin))7+e(9.7743-
0.7826*HGB+0.2067*Iron-0.4487*Iron/logl0(hepcidin))
(equation 2) where the value of p the likelihood (as a fraction of 1) that the patient will not respond to oral iron (e.g., that the subject has Iron-Refractory Iron-Deficiency Anemia (IRIDA)).
[00135] In one aspect of any of the embodiments, provided herein is a method of treating anemia in a subj ect in need thereof, the method comprising: a) measuring the level of hemoglobin, ferritin and the level of plasma iron in a biological sample obtained from the subject; b) administering parenteral iron to the subject if the value of p according to equation 1
P = e { 10.0744 - 0.6543 *HGB - 0.2412*Iron/loglO(Ferritin)} l+e{ 10.0744 -
0.6543 *HGB - 0.2412*Iron/loglO(Ferritin)}
(equation 1)
is about 0.7 or greater (e.g., about 0.7, 0.75, 0.8, 0.85, 0.9 or greater), thereby indicating the subject has Iron-Refractory Iron-Deficiency Anemia (IRIDA); and c) administering oral iron to the subject if the value of p according to equation 1 is less than about 0.7 (e.g., less than about 0.7, less than about 0.65, less than about 0.6, less than about 0.55, or less than about 0.5). In one aspect of any of the embodiments, provided herein is a method of treating anemia in a subject in need thereof, the method comprising: a) measuring the level of hemoglobin, ferritin and the level of plasma iron in a biological sample obtained from the subject; b) administering parenteral iron to the subject the value of p according to equation 1
P = e { 10.0744 - 0.6543 *HGB - 0.2412*Iron/loglO(Ferritin)} l+e{ 10.0744 -
0.6543 *HGB - 0.2412*Iron/loglO(Ferritin)}
(equation 1)
is about 0.5 or greater, thereby indicating the subject has Iron-Refractory Iron-Deficiency Anemia (IRIDA); and c) administering oral iron to the subject if the value of p according to equation 1 is less than about 0.5. In one aspect of any of the embodiments, provided herein is a method of treating anemia in a subj ect in need thereof, the method comprising: a) administering parenteral iron to the subject if the value of p according to equation 1 for a biological sample obtained from the subject
P = e { 10.0744 - 0.6543 *HGB - 0.2412*Iron/loglO(Ferritin)} l+e{ 10.0744 -
0.6543 *HGB - 0.2412*Iron/loglO(Ferritin)}
(equation 1)
is about 0.7 or greater (e.g., about 0.7, 0.75, 0.8, 0.85, 0.9 or greater), thereby indicating the subject has Iron-Refractory Iron-Deficiency Anemia (IRIDA); and b) administering oral iron to the subject if the value of p according to equation 1 for a biological sample obtained from the subject is less than about 0.7 (e.g., less than about 0.7, less than about 0.65, less than about 0.6, less than about 0.55, or less than about 0.5). In one aspect of any of the embodiments, provided herein is a method of determining the likelihood of a subj ect not responding to oral iron treatment for anemia, the method comprising: a) measuring the level of hemoglobin, ferritin and the level of plasma iron in a biological sample obtained from the subject; and b) calculating p according to equation 1
P = e { 10.0744 - 0.6543 *HGB - 0.2412*Iron/loglO(Ferritin)} l+e{ 10.0744 -
0.6543 *HGB - 0.2412*Iron/loglO(Ferritin)}
(equation 1)
where the value of p the likelihood (as a fraction of 1) that the patient will not respond to oral iron (e.g., that the subject has Iron-Refractory Iron-Deficiency Anemia (IRIDA)).
[00136] In some embodiments of any of the aspects, the value of p obtained with an algorithm described herein can be used to determine if a genetic test should be ordered for a subject, e.g., to determine if they have TMPRSS6. The value of p (the likelihood of TMPRSS6 mutations underlying the anemia of the subj ect) can be considered by a skilled practitioner in view of factors such as the subject's symptoms and family history in order to determine whether a genetic test is indicated by the value of P. [00137] Methods for measuring levels of hepcidin, plasma iron, total iron binding concentration (TIBC), ferritin, and/or TfSat are known in the art and described elsewhere herein. In some embodiments, the level of hepcidin can be measured using the methods or kits described herein. In some embodiments, the level of hepcidin can be measured using mAB583, which is described in US Patent 9,657,098, which is incorporated by reference herein in its entirety. Plasma iron and TfSat can be measured, e.g., using commercially available assays from ROCHE®, HITACHI®, SYSMEX®, and others.
[00138] In some embodiments, a subject treated according to the methods described herein is a subject who does not have, or is not diagnosed as having, an inflammatory condition; chronic inflammation; and/or abnormal levels of C-reactive protein (CRP).
[00139] The assays and methods as described herein can relate to determining or measuring if a subject has a level which is increased or decreased relative to a reference level. In some embodiments, the reference level can be the level in a sample of similar cell type, sample type, sample processing, and/or obtained from a subject of similar age, sex and other demographic parameters as the sample/subject for which the level of, for example, hepcidin is to be determined. In some embodiments, the test sample and control reference sample are of the same type, that is, obtained from the same biological source, and comprising the same composition, e.g., the same number and type of cells and/or type of sample material. Accordingly, in some embodiments, a level which is increased or decreased can vary as demographic factors such as age, gender, genotype, environmental factors, and individual medical histories vary. In some embodiments, a reference level can be the level in a prior sample obtained from the subject. This permits a direct analysis of any change in levels in that individual.
[00140] In some embodiments, the reference level of hepcidin can be the level of hepcidin in a healthy subject not having, or not diagnosed as having anemia. In some embodiments, the reference level of hepcidin can be the lower limit of normal (e.g., at the 5th percentile) in a population of healthy subjects not having, or not diagnosed as having anemia. In some embodiments, an increased level of hepcidin is a level which is increased at least 1.5 fold relative to the reference level. In some embodiments, an increased level of hepcidin is a level which is increased at least 3.0 fold relative to the reference level. In some embodiments, the level of hepcidin is the level of plasma hepcidin.
[00141] The reference level of Tfsat/logio(Hepcidin) can be from about 3.0 to about 5.0.
In some instances, the reference level of Tfsat/logi0(Hepcidin) about 4.0. In some embodiments, the reference level of plasma Iron/1 ogi0(Hepci din) can be from about 13 to about 15. In some instances, the reference level of plasma Iron/logio(Hepcidin) is about 14.3. [00142] A level can be increased relative to a reference level if the level is at least about
1.25x the reference level, e.g., at least about 1.25x, at least about 1.5x, at least about 2x, at least about 3x, at least about 4x, at least about 5x, at least about 6x, or greater of the reference level. In some embodiments, a level can be increased relative to a reference level is the level is greater by a statistically significant amount. Statistically significant amounts can be determined utilizing art recognized assessments including, but not limited to, a Student's t test.
[00143] A level can be decreased relative to a reference level if the level is about 90% or less, about 85% or less, about 80% or less, about 75% or less, about 60% or less, about 50% or less, about 25% or less, about 10% or less, about 5% or less, or about 2% less of the reference level. In some embodiments, a level can be decreased relative to a reference level is the level is less by a statistically significant amount. Statistically significant amounts can be determined utilizing art recognized assessments including, but not limited to, a Student's t test.
[00144] The term "sample" "biological sample" or "test sample" as used herein denotes a sample taken or isolated from an organism, e.g., a plasma sample from a subject. Non-limiting exemplary biological samples include, but are not limited to, a biofluid sample; serum; plasma; urine; saliva; and/or tumor sample, etc. The term also includes a mixture of the above-mentioned samples. The term "test sample" also includes untreated or pretreated (or pre-processed) biological samples. In some embodiments, a test sample can comprise cells from a subject. As used herein, the term "biofluid" refers to any fluid obtained from a biological source and includes, but is not limited to, blood, urine, and bodily secretions.
[00145] A test sample can be obtained by removing a sample from a subject, but can also be accomplished by using a previously isolated sample {e.g., isolated at a prior time point and isolated by the same or another person). In addition, a test sample can be freshly collected or a previously collected sample.
[00146] In some embodiments, the test sample can be an untreated test sample. As used herein, the phrase "untreated test sample" refers to a test sample that has not had any prior sample pre-treatment except for dilution and/or suspension in a solution. Exemplary methods for treating a test sample include, but are not limited to, centrifugation, filtration, sonication, homogenization, heating, freezing and thawing, and combinations thereof. In some embodiments, the test sample can be a frozen test sample, e.g., a frozen tissue. The frozen sample can be thawed before employing methods, assays and systems described herein. After thawing, a frozen sample can be centrifuged before being subjected to methods, assays and systems described herein. In some embodiments, the test sample is a clarified test sample, for example, prepared by centrifugation and collection of a supernatant comprising the clarified test sample. In some embodiments, a test sample can be a pre-processed test sample, for example, supernatant or filtrate resulting from a treatment selected from the group consisting of centrifugation, filtration, thawing, purification, and any combinations thereof. In some embodiments, the test sample can be treated with a chemical reagent and/or a biological reagent. Chemical and/or biological reagents can be employed to protect and/or maintain the stability of the sample, including biomolecules (e.g., nucleic acid and protein) therein, during processing. The skilled artisan is well aware of methods and processes appropriate for pre-processing of biological samples required for determination of the level biomolecules as described herein.
[00147] In some embodiments, the methods, assays, and systems described herein can further comprise a step of obtaining a test sample from a subject. In some embodiments, the subject can be a human subject.
[00148] In some embodiments, the methods, assays, and systems described herein can comprise creating a report based on the levels as described herein. In some embodiments, the report denotes raw values the levels described herein in the test sample (plus, optionally, the level in a reference sample) or it indicates a percentage or fold increase or decrease as compared to a reference level, and/or provides a signal regarding the subject's risk of treatment responsiveness.
[00149] In one aspect, described herein is a method of treating iron overload in a subject in need thereof, the method comprising a) measuring the level of hepcidin and at least one of ferritin, iron, or TfSat in a subject diagnosed with primary or secondary iron overload at, at least two time points; b) administering or withholding a treatment selected from the group consisting of: transfusions, phlebotomy, hepcidin mimetics, or other any other therapy that modulates erythropoiesis, total body iron, iron available for erythropoiesis or excretion or chelation of iron if the level of: i) plasma Iron/1 ogl0(Hepci din) changes over time ii) plasma ferritin/loglO(hepcidin) changes over time, or iii) Tfsat/loglO(Hepcidin) changes over time. In some embodiments, the subject has or is diagnosed as having hereditary hemochromatosis (HH); X-linked sideroblastic anemia (XLSA); or other iron loading anemia.
EXAMPLES
[00150] The application may be better understood by reference to the following non- limiting examples, which are provided as exemplary embodiments of the application. The following examples are presented in order to more fully illustrate embodiments and should in no way be construed, however, as limiting the broad scope of the application.
Methods
[00151] Study subjects. Study subjects with and without TMPRSS6 mutations {see, also,
Supplementary Methods) were identified in a group of sequential individuals referred to Boston Children's Hospital or Federico II University Medical School, Naples, Italy for research genetic evaluation of chronic ID/A (FIG. 1). Eligibility criteria for inclusion in this study were: a) a history of IDA, defined by clinical assessment and laboratory evaluation by the referring physician, and typically included patients with plasma ferritin <15 ng/mL and a transferrin saturation (TfSat) <15% with a hemoglobin (HGB) <11.0g/dL at the time of initial diagnosis; b) a poor clinical response to at least one course of oral iron replacement therapy, and c) DNA samples available for MPRSS6 genotyping. Of the 139 individuals referred for evaluation, 12, including 5 with, and 7 without at least one TMPRSS6 mutation, were excluded from the analysis due to insufficient plasma to perform an iron, TIBC, and hepcidin. The remaining 127 patients included 69 TMPRSS6 mutation-negative (chronic iron deficiency [cID] group) and 58 MPRSS6 mutation positive patients from 47 families (FIG. 1). The MPRSS6 mutation positive patients included 45 with biallelic mutations (IMPRSS6mut/mut) and 13 clinically affected individuals with a single identifiable TMPRSS6 pathogenic variant (IMPRSS6mut/?).
[00152] The comparison and multivariable analyses were performed on 44
IMPRSS6mut/mut and 59 cID patients with a TfSat <15% at the time of referral: one IMPRSS6mut/mut and 10 cID patients were excluded for a TfSat >15% at the time of study. Control groups included 66 TMPRSS6 mutation heterozygous relatives of Z RXS -mutated patients (TMPRSS6muj+), and 35 TMPRSS6 wild type first- and second-degree relatives of the TMPRSS6-mutated patients or wild type family members of patients with other genetically defined hematological diseases (e.g., XLSA) collected in a similar manner (TMPRSS6"+). These individuals were not selected on the basis of their TfSat. 11 iron-deficient (TfSat<15%) patients with one pathogenic variant (TMPRSS6mut/?) and the subset of the TMPRSS6mut/+ relatives of IRIDA patients with a TfSat<15% (n=27), each with adequate plasma for measurement of iron, TIBC, and hepcidin were used to test the metrics. Additional comparison groups include patients with X-linked sideroblastic anemia (XLSA, n=l 1) and patients with hereditary hemochromatosis not due to a mutation in ferroportin 1 (FPN1, n=9)
The Institutional Review Board at Boston Children's Hospital or Federico II University Medical School, Naples, Italy approved all human subject research.
[00153] Hepcidin measurement. We employed a fully automated, second generation competitive ELISA (C-ELISA; Patent No. US 7,723,063 B2) that utilizes a proprietary monoclonal antibody (mAb583; US Patent No. 9,657,098) that binds the N-terminus of bioactive hepcidin-25 and a biotinylated, bioactive hepcidin-25 analog as a competitive tracer (US Patent No. 7,745, 162). The test was performed on a Beckman FX liquid-handling platform (Beckman, Inc., Brea, CA) equipped with an automated ELX405 plate washer (BioTek, Inc., Winooski, VT), a DTX-880 plate reader (Molecular Devices, Inc. Sunnyvale, CA). The Intrinsic Hepcidin IDx™ Test was validated and performed under Clinical Laboratory Institute Amendments (CLIA ID 05D2087906) and College of American Pathologist (CAP ID 8958850) guidelines as a laboratory developed test (LDT). The performance characteristics of the Hepcidin IDx Test are excellent with a lower limit of detection (LLOD) of 1.5 ng/ml, a lower limit of quantification (LLOQ) of 4.0 ng/ml, and intra-assay and inter-day precision (CVs) across the normal range averaging 5% and 8% respectively. Spike recoveries were excellent and averaged 3% across the normal range. It will be understood that an antibody that comprises the CDRs of antibody 583 may also be utilized in such methods of hepcidin measurement. Additionally, it will be understood that antibody 1B1, or an antibody that comprises the CDRs of antibody 1B1 may also be utilized in such methods of hepcidin measurement.
[00154] Hepcidin assays, other biochemical analytical procedures and statistical analyses are described in more detail below.
Supplementary Methods
[00155] Genetic evaluation. To ascertain TMPRSS6 mutation status, we bi-directionally sequenced all exons and intron-exon boundaries for the MPRSS6 reference transcript M l 53609.3 (FIG. 5) and followed the segregation of each rare variant, defined as <1.0% allele frequency in the Exome Variant Server (ev5.gs.washington.edu/EVS/) database, in available family members. We assessed the potential functional significance of each variant using PolyPhen2 and the Human Splicing Finder suite of applications (www.umd.be/HSF/). Variants with PolyPhen2 scores >0.9 were considered functionally significant. Alleles that did not conform to these criteria, but have previously been reported in trans of an unambiguous {e.g., a nonsense, frameshift, deletion or splicing variant) disease-associated MPRSS6 allele in an IRIDA patient were ascribed pathogenicity. In this regard, the cID group within the Discovery Set included patients with three heterozygous rare missense variants, p.A80V, p.V289L, and p.R446W, the latter in two unrelated individuals, which we did not ascribe as pathogenic based upon bioinformatic criteria, genotype-phenotype correlations within families, and/or existing mutational data in the literature (FIG. 6).
[00156] In probands in whom no or only a single rare variant could be identified by exon sequencing, we re-sequenced the coding exons using a second primer set to exclude primer-specific allele dropout, sequenced an additional exon present in an alternative MPRSS6 transcript (NM_001289000.1, FIG. 5), and assessed copy number alterations by quantitative droplet digital PCR for targets located within each of the 18 exons encoding MPRSS6 M_153609.3 on Bio-Rad's QX200 Droplet Digital PCR System using TaqMan CNV assays from Life Technologies and/or by a custom tiled oligonucleotide array spanning the MPRSS6 gene and flanking regions (GRCh37/hgl9 chr22: 37,441,479-37,519,693) at an average probe density of 50 base pairs (Nimblegen). In those probands in which we could still identify only a single mutant allele, we analyzed the TMPRSS6 genomic locus (GRCh37/hgl9 chr22: 37,459,659-37,509,940) by Sanger sequencing tiled genomic PCR amplicons. In no case, however, did we identify a potential disease-associated intronic or regulatory variant (data not shown). In families with multiple affected or affected and unaffected siblings, in whom we could identify only one allele in the proband, we interpreted concordant or discordant MPRSS6 haplotypes in affected and unaffected siblings, respectively, as indicative of a second, inferred, but unidentified, pathogenic allele, indicated as TMPRSS6milt/~.
[00157] Clinical laboratory analyses. For the Discovery Set and comparator groups, except when transport was scheduled to take more than two days, samples were collected ad libitum at the referring center and shipped to BCH in containers cooled with ice packs. For shipments anticipated to be less timely, CBCs were obtained at the collection site and plasma was prepared locally and shipped frozen on dry ice. Li-heparin anticoagulated plasma iron, TIBC, ferritin, and soluble transferrin receptor (sTfR) were performed at BCH on fresh or frozen plasma stored at -80°C for up to seven years using Roche Diagnostics reagents on a Cobas 6000 analyzer. ZPP/heme was performed on Li-Heparin RBC pellets using a Helena Laboratories, Protofluor-Z instrument. Complete blood count data were collected on a Bayer Advial20 instrument on EDTA anticoagulated samples (<3 days old). For the Validation Set, CBCs were performed at Federico II University Medical School on an ADVIA 2120 analyzer and banked Li-Heparin plasma store at -80°C was shipped to BCH for clinical chemical analysis. For hepcidin measurements, briefly, lithium-heparin plasma patient samples were diluted 1 :5 in binding buffer (TRIS-buffered saline (0.05M TRIS, 0.138M NaCl, 0.0027M KCl, pH 8.0, 0.05% Tween-20, TBST) containing 2% BSA, 5mM trehalose, 0.1% Triton X100, and the biotinylated tracer. The sample solution was then added to the microtiter plate wells coated with mAb583 and incubated in a Heraeus Cytomat 2C15 incubator (Thermo Scientific, Waltham, MA) at 23°C, ±1 C for 1 hour. The microtiter plate wells were washed four times with TBST and streptavi din-horseradish peroxidase (Thermo Fisher, Waltham, MA) diluted to 1 :5000, and added and allowed to bind for 30 minutes at 23°C. The microtiter plate wells were washed with TBST and Tetramethylbenzidine substrate (TMB-US; (Moss, Inc., Pasadena, MD) added for 15 minutes, and the reaction stopped with 0.5M H2S04 and optical density (OD) measured at 450nm. The samples were compared to a standard curve of synthetic bioactive hepcidin-25 (Peptides International, Inc.; Louisville, KY).
[00158] Statistical analyses. Descriptive analysis was performed on the Discovery Set using a series of Wilcoxon rank-sum tests on the hematology and iron metabolism phenotypes, hepcidin, and hepcidin derivative indices for pairwise comparisons of Discovery subgroups {i.e., cID and TMPRSS6mut/mut) versus comparator groups (i.e., IMPRSS(f/mu\ TMPRSS<?' XLS A, and HH). Box and whisker plots present the quartiles (box), and the 10th and 90th percentiles (whiskers).
[00159] With the goal of distinguishing patients with IRTDA due to TMPRSS6 mutations from patients with chronic acquired ID/A, the following indices were tested for their diagnostic utility in predicting the existence of biallelic TMPRSS6 mutations in patients with chronic ID/A: ferritin, hepcidin, Tfsat/logio(Hepcidin), plasma Iron/logio(Hepcidin), TfSat/logio(Ferritin), and plasma iron/logio(Ferritin). For each index, within the Discovery Set, a cut-off value was determined such that a sensitivity of 80% for detecting biallelic MPRSS6 mutations was achieved, the receiver-operator curve (ROC) was generated, and the area under the curve (AUC) was calculated. Using the cut-off value obtained from the Discovery Set, sensitivity and specificity were calculated in the Validation Set to test the appropriateness of the cut-off.
[00160] A Fisher's exact test compared TMPRSS6mut/mat versus cID by sex and age. A univariate logistic regression model was used to compare TMPRSS6mut/mut versus cID in terms of hematological and iron metabolism characteristics. To identify the factor or combination of factors most highly predictive of biallelic MPRSS6 mutation status within the Discovery Set, multivariable logistic regression models were generated using a backwards selection approach, starting from the factors that were significant in univariate logistic regression analysis. The final models were run on the Validation Set to confirm that the factors identified as statistically significant in the Discovery Set remained so, to adjust for multiple comparisons, p-values <0.01 were considered statistically significant, except in the multivariable logistic regression model building, where a significance level of p<0.05 was applied. Statistical analysis was performed using SAS Version 9.4.
Results
Hematological and biochemical characteristics of the primary study and comparator groups
[00161] We evaluated hematological and biochemical tests relevant to the evaluation of
ID/A in each of the study groups (FIG. 7). As expected, the IMPRSS6mut/mut and cID groups were anemic and hypoferremic compared to the TMPRSS6mut/+ and TMPRSS6+/+ controls. Compared to wild type controls, heterozygosity for a MPRSS6 mutation was associated with significant decreases in mean cell volume (MCV) and plasma iron and an increase in serum ferritin, but no change in the total iron binding concentration (TIBC) and the transferrin saturation (TfSat); the hemoglobin (HGB) was nearly significantly lower in the TMPRSS6mut/+ individuals. As a group, the TMPRSS6mut/mut patients were slightly more anemic and iron deficient, based upon the HGB and plasma iron and transferrin saturation (TfSat), than the cID group.
Evaluation of hepcidin and ferritin derivative metrics to distinguish patients with chronic ID/A with or without biallelic TMPRSS6 mutations.
[00162] In order to evaluate the possibility that chronically iron deficient individuals with and without biallelic MPRSS6 mutations could be distinguished based upon biochemical parameters alone, we measured plasma hepcidin using the Intrinsic Hepcidin IDx Test. We found that in comparison to iron-replete TMPRSS6+/+ controls and the cID group, plasma hepcidin was significantly increased in TMPRSS6mat/mat patients ( O.0001 in both cases, (FIG. 2 and FIG. 8), even despite the fact that as a group they were less anemic and iron deficient. Hepcidin is characteristically decreased in iron deficiency, however, we found that the cID group had a slightly increased average hepcidin compared to controls. This discrepancy is likely due to the cID group being a highly selected population of iron deficient patients than have already failed iron therapy, and includes several individuals with very high C-reactive proteins levels (FIG. 5), indicative of ongoing inflammation. We also observed higher plasma hepcidin levels in the TMPRSS6mut/+ group compared to wild type controls, providing evidence of a heterozygous phenotype in these individuals.
[00163] Receiver-Operator Curve (ROC) analysis of plasma hepcidin levels showed an
AUC of 0.861 in the ability of hepcidin to distinguish the IMPRSS6mut/mut and cID groups (FIG. 2D), which was better than a similar analysis of ferritin (AUC=0.767, FIG. 2D and FIG. 4C). Thus, measurement of plasma hepcidin can facilitate the discrimination of a patient with IRIDA due to biallelic MPRSS6 mutations from one with chronic ID/A unrelated to MPRSS6. Nevertheless, because there was significant overlap in hepcidin levels between the TMPRSS6mut/mut and cID groups, TMPRSS6mut/+ individuals, and even normal controls (FIG. 2A), we sought to evaluate hepcidin derivative indices to aid in this clinical distinction.
[00164] Because hepcidin is regulated by plasma and storage iron as well as erythropoiesis, we explored the value of normalizing the hepcidin to other biochemical parameters indicative of iron status. For example, the hepcidin/ferritin ratio has been employed to attempt to normalize hepcidin for iron stores, and thus distinguish an inappropriately increased or decreased hepcidin, even in cases where the plasma hepcidin concentration falls within the normal range. We found that the plasma hepcidin/ferritin ratio is a poor predictor of MPRSS6 mutation status in patients with cID, yielding an AUC of only 0.571 (FIG. 2D, FIG. 4D and FIG. 8).
[00165] We reasoned that normalization of hepcidin to the plasma iron or TfSat might be more physiologically relevant, as it is thought that hepcidin is responsive to the concentration of diferric transferrin (holotransferrin) in the plasma. We found that the Iron/logi0(Hepcidin) and Tfsat/logio(Hepcidin) ratios were highly correlated with TMPRSS6 mutation status in iron deficient patients (FIG. 2B, FIG. 2C and FIG. 8). In ROC analyses performed to evaluate the ability to discriminate cID from IMPRSS6mut/mut patients, the AUCs for plasma Iron/logio(Hepcidin) and Tfsat/logi0(Hepcidin) were 0.930 and 0.886, respectively (FIG. 2D). Fixing the sensitivity at 80%, plasma Iron/logi0(Hepcidin) and Tfsat/logi0(Hepcidin) both have superior specificity (91% [95% CI=78-97% and 89% [95%CI 75-95%], respectively) than plasma hepcidin alone (77% [95% CI=62-99%]) (Table 1).
[00166] Table 1. Performance characteristics of hepcidin and ferritin and their derivative indices to distinguish subjects with chronic iron deficiency with and without biallelic TMPRSS6 mutations. (n=44 1MPRSS6mut/mut and 59 cID patients).
Figure imgf000049_0001
[00167] Hepcidin and derivative indices in iron overload subjects. Whereas hepcidin is inappropriately increased in patients with IRIDA due to TMPRSS6 mutations, it may also be inappropriately decreased either primarily or secondarily in patients with iron overload. Among those conditions, in which hepcidin is secondarily decreased, are chronic anemias associated with ineffective erythropoiesis. These include beta-thalassemia and sideroblastic anemias, which may mimic the clinical features, red cell indices and morphological features of IRIDA— a chronic hypochromic, microcytic anemia unresponsive to iron therapy. In contrast, patients with most forms of hereditary hemochromatosis (HH) are not anemic, but have inappropriately low hepcidin levels due to an intrinsic defect in hepatocellular iron sensing. Indeed, plasma hepcidin concentrations in the HH and XLSA group are not statistically different than wild type controls
(data not shown). However, normalization of plasma hepcidin to the plasma ferritin, iron, or
TfSat uncovers the relative hepcidin insufficiency in each of these disorders (FIG. 2B FIG. 2C, FIG. 6 and FIG. 8). Importantly, unlike hepcidin itself or the hepcidin normalized to ferritin, normalization of hepcidin to plasma iron or the TfSat is notable because these indices distinguish conditions in which hepcidin is either inappropriately increased or decreased, suggesting that these hepcidin derivative indices are clinically useful for the diagnosis of hepcidin insufficiency and hepcidin excess states alike.
[00168] Derivation of models predictive of TMPRSS6 mutations in individuals with chronic ID/A. In a univariate analysis TMPRSS6mut/mut patients were statistically significantly different from cID patients in terms of hemoglobin (HGB), plasma iron, TIBC, TfSat, and hepcidin, and the TfSat/logi0(hepcidin), plasma Iron/logi0(hepcidin), TfSat/logi0(Ferritin), and plasma Iron/logi0(Ferritin) (Table 2).
[00169] Table 2. Univariate analyses comparing hematological and iron metabolism characteristics of IMPRS S6-mutated (IMPRSS6mut/mut) versus unmutated chronic IDA (cID) patients (n=103). HGB, hemoglobin; MCV, mean red blood cell volume; TIBC, total iron binding capacity; TfSat, transferrin saturation, ZPP/Heme, zinc protoporphyrin IX/heme; sTfR, serum transferrin receptor, and CRP, C-reactive protein. T-value of univariate logistic regression model.
Figure imgf000050_0001
cID 59 10.2 51.8 1.3 636.0
sTfR (mg L) All 47 12.2 15.0 3.5 62.6
TMPRSS6mut/mut 19 15.2 14.5 5.2 28.8 0.8 cID 28 9.5 15.3 3.5 62.6
CRP (mg L) All 100 0.1 0.3 0.0 7.0
TMPRSS6mut/mut 42 0.1 0.2 0.0 2.1 0.2 cID 58 0.1 0.5 0.0 7.0
Hepcidin (ng/mL) All 103 28.4 42.1 2.8 219.3
TMPRSS6mut/mut 44 62.8 69.7 8.8 219.3 <0.0001 cID 59 7.0 21.5 2.8 105.1
TfSat /logio(Hepcidin) All 103 4.7 5.7 1.4 19.2
TMPRSS6mut/mut 44 2.5 3.2 1.4 8.9 <0.0001 cID 59 6.2 7.5 2.1 19.2
Iron /logio(Hepcidin) All 103 16.9 23.1 5.3 80.9
TMPRSS6mut/mut 44 9.7 11.1 5.3 30.2 <0.0001 cID 59 27.2 32.1 7.0 80.9
Hepcidin Ferritin) All 103 0.9 1.2 0.1 10.8
TMPRSS6mut/mut 44 0.9 1.3 0.1 6.8 0.7 cID 59 0.8 1.2 0.1 10.8
Fe/logio(Ferritin) All 103 18.4 22.7 6.4 122.9
TMPRSS6mut/mut 44 9.1 11.3 6.5 31.3 <0.0001 cID 59 28.5 31.2 6.4 122.9
TfSat/logio(Ferritin) All 103 4.7 5.4 1.7 23.9
TMPRSS6mut/mut 44 2.7 3.2 1.7 8.8 <0.0001 cID 59 6.5 7.0 2.0 23.9
[00170] To assess the relative performance of hepcidin compared to ferritin indices, we tested two models (Tables 3 A and 3B).
[00171] Table 3A: Multivariable logistic regression model to identify which
HEPCIDIN derivative indices are independently prognostic of the presence of biallelic TMPRSS6 mutations (n=103).
Figure imgf000051_0001
Iron 0.0352 0.0218 0.0167 0.0205 0.0116 0.0053
Iron/logio(hepcidin) 0.0178 0.0078 0.0062 0.0022 0.0003 <0.0001
TfSat/logio(hepcidin) 0.1199 0.1106 0.1060 0.0673 0.6476
TfSat 0.1136 0.1074 0.1068 0.1166
TIBC 0.5837 0.5751 0.5929
Ferritin 0.7043 0.6945
Plasma hepcidin 0.9071
[00172] Table 3B. Multivariable logistic regression models to identify which
FERRITIN derivative indices are independently prognostic of the presence of biallelic TMPRSS6 mutations (n=103).
Figure imgf000052_0001
[00173] Model 1 utilizes HGB and plasma Iron/logio(Ferritin), and Model 2 utilizes
HGB, plasma iron, and plasma Iron/logio(hepcidin).
[00174] Model 1 : Logit (p) = 10.0744 - 0.6543*HGB - 0.2412*Iron/logi0(Ferritin)
[00175] Model 2: Logit (p) = 9.7743 - 0.7826*HGB + 0.2067*Iron -
0.4487*Iron/logio(Hepcidin)
[00176] In Model 1, for every unit increase in HGB, the odds of having two TMPRSS6 mutations decreases 48% (95%CI: 21%-66%) and for every unit increase in Iron/log lO(Ferritin), the odds of having two MPRSS6 mutations decreases 21% (95%CI: 14%-29%). In Model 2, for every unit increase in HGB, the odds of having two TMPRRSS6 mutations decreases 54% (95%CI: 22%-73%); for every unit increase in iron, the odds of having two TMPRRSS6 mutations increases 1.2 times (95%CI: 1.1 -1.4); and, for every unit increase in Iron/1 ogio(hepci din), the odds of having two MPRSS6 mutations decreases by 36% (95%CI: 21%-48%). Taken together, these data suggest that measurements of hepcidin using the Intrinsic Hepcidin IDx Test or ferritin in combination with the plasma iron and HGB are predictive of biallelic TMPRSS6 mutations in individuals with chronic ID/A.
[00177] Application of derivative indices and the multivariate models to subjects with chronic ID/A and a single pathogenic TMPRSS6 allele. Despite employing exhaustive sequencing and copy number detection techniques we, and others have consistently identified only one pathogenic allele in a subset of patients presenting with IRIDA. For example, in this study, in 12 of 47 families we could identify only a single pathogenic variant; that is to say that if this is a uniquely recessive disease, 12.7% of potential alleles were undetermined. Some data, such as the high frequency of iron deficiency (27 of 66 [41%] of MPRSS6 heterozygous family members in this study with TfSat<15%) and high baseline plasma hepcidin concentrations (FIG. 7), would suggest that individuals heterozygous for a single pathogenic TMPRSS6 allele might be more susceptible to ID/A. Thus, it is unclear if those presenting with chronic ID/A and one MPRSS6 allele are heterozygotes expressing a phenotype or compound recessive mutants with one undetectable allele. In order to address this question, we determined the ability of the metrics described above to predict the genotype of iron- deficient (TfSat<15%) TMPRSS6mut/+ relatives of affected MPRSS6 patients with two mutant alleles (Table 4 and FIG. 4).
[00178] Table 4. Performance characteristics of hepcidin and ferritin and their derivative indices. The ability of each index to distinguish subjects with biallelic MPRSS6 mutations from iron deficient individuals with heterozygous MPRSS6 mutations was determined. (n=44 TMPRSS6mut/mut and n=27 TMPRSS6mut/+)
Figure imgf000053_0001
[00179] Of these, the Iron/logi0(Hepcidin) was the most sensitive metrics of discriminating iron deficient individuals with one from those with two MPRSS6 mutations, having a sensitivity of 93% (95% CI=76-99%) at a pre-determined specificity of 90% (95% CI=78-97%). We used these cutoff values to determine if 11 iron deficient patients, including 3 pairs of genotypically concordant siblings, with one discoverable MPRSS6 allele were more likely to be phenotypically affected heterozygotes, or compound heterozygotes {i.e., having one unambiguous allele and one undiscoverable allele, FIG. 9).
[00180] Using the Iron/logio(Hepcidin) measurement, two and three of the eleven patients were predicted to be clinically affected heterozygotes; the multivariable model predicted three patients to be affected heterozygotes. In all cases, as one might expect from the coinheritance of a mutant allele and the same TMPRSS6 haplotype on the other allele, the genotypically concordant siblings were all predicted to carry two mutant TMPRSS6 alleles. Thus, in most cases, it is highly likely that clinically affected individuals with one TMPRSS6 pathogenic variant possess a second, occult mutant allele.
Discussion
[00181] This is the largest study of the hematological, biochemical and genetic features of IRIDA due to TMPRSS6 mutations yet described. Of the 49 TMPRSS6- vAateA patients included in the combined Discovery and Validation Sets, 30 have not previously been reported, contributing not only to the phenotypic spectrum of disease, but also to the catalogue of proven pathogenic mutations. Furthermore, our analysis comprehensively describes for the first time the clinical and laboratory phenotypes of individuals heterozygous for pathogenic MPRSS6 mutations. Among the most important findings is the demonstration that the plasma Iron/logio(Hepcidin) and Tfsat/logio(Hepcidin) indexes and a model algorithms based on hemoglobin and plasma iron combined with ferritin or hepcidin and can predict with good to excellent sensitivity and specificity, patients harboring biallelic MPRSS6 mutations in a diagnostically challenging population of individuals with chronic ID/A. Thus, these biochemical indexes cannot only directly diagnose IRIDA patients but also provide therapeutic guidance {e.g., indicate parenteral iron therapy) to care for an individual patient prior to ordering expensive and time-consuming genetic analyses.
[00182] In addition to confirming the observation that IRIDA patients may have plasma hepcidin levels within the reference range, despite having chronic ID/ A, our data also indicate other subtle biochemical features that might lead one to suspect the diagnosis of IRIDA. First, as evidenced by the ratio of plasma iron/logio(Ferritin), after treatment, IRIDA patients tend to have a relatively high plasma ferritin relative to plasma iron. This indicates that ferritin is not a reliable measure of ID in IRIDA patients. It is unclear if this is the case in treatment naive patients that are truly and profoundly iron deficient, or if a relatively preserved ferritin is a marker of the IRIDA patient that has been partially treated with oral and/or parenteral iron or transfusion and whose capacity to recycle iron from stores is impaired by constitutionally excessive hepcidin production. Second, the typical response to ID is an increase in the plasma TIBC. Here, we observed that the TIBC was normal, if not slightly decreased in MPRSS6- mutated patients compared with chronic ID/A patients.
[00183] As transferrin is predominantly a product of the hepatocyte and regulated transcriptionally, it is possible that the iron contributing to the regulation of transferrin production by the hepatocyte is relatively high compared to the plasma iron in IRIDA patients. This could be a cell autonomous effect due to iron storage in the hepatocyte, or a paracrine effect due to relatively increased iron storage in sinusoidal macrophages or endothelial cells that are thought to produce BMP6 in response to iron. Again, because all patients were previously treated, we do not know if this finding is evident at presentation.
[00184] Genome-wide association studies (GWAS) have shown a small effect of the common TMPRSS6 missense variant allele p.A736V (rs855791) on several hematological and iron-related phenotypes, including plasma ferritin, iron, hepcidin, and TfSat as well as HGB, RDW and MCV. We found that compared to wild type controls, heterozygosity for a pathogenic MPRSS6 missense variant was associated with a trend toward a higher ferritin, but not other plasma markers of iron status (iron, TIBC, and TfSat); trends toward a lower HGB and MCV were also noted. The strongest association of the heterozygous MPRSS6 mutant phenotype was with the plasma hepcidin; heterozygotes had baseline hepcidin levels approximately two-times wild type individuals (P=0.0047). This provides further evidence that TMPRSS6 indirectly modifies hematological and iron traits through its direct effects on hepcidin. We were unable to distinguish a phenotypic difference between individuals heterozygous for a predicted null allele {i.e., those individuals with deletion, splicing, frameshift, and premature termination codons) and those with missense mutations (data not shown). It is unclear if this is due to the fact that many missense alleles may be functionally null due to trafficking or protease defects, that null alleles may be in trans with either the p. A736 or p. V736 variant, that the missense mutations are variably present in cis or trans of the p.V736 partial loss-of-function allele, or a combination of these and other factors. We did not discern a difference between patients harboring a null allele in trans of the p.A736 or p.V736 variant (data not shown).
[00185] In some patients who presented with clinical IRIDA, we could identify only a single pathogenic TMPRSS6 variant, despite comprehensive DNA-based mutation analyses. By and large, we found that clinically affected individuals with a single TMPRSS6 allele have hepcidin levels and hepcidin and ferritin derivative indices that are more like TMPRSS6 homozygotes than iron deficient TMPRSS6 heterozygotes. In contrast to reports that individuals with a single detectable allele had a milder biochemical phenotype than those with two mutated alleles, the work described herein suggests that most patients with a severe clinical phenotype do indeed have biallelic MPRSS6 mutations, and that in some cases the second allele is genetically occult.
[00186] A major goal of this study was to predict which patients in a group of individuals with chronic ID/A were most likely to have biallelic MPRSS6 mutations. This would aid in prioritizing genetic analysis in those patients with a high probability of having MPRSS6 mutations and for whom early initiation of parenteral iron therapy would be beneficial. We found that the ratios normalizing the hepcidin to the plasma iron were the most sensitive and specific distinguishing features of the two groups and remained so after a multivariable analysis. This is likely related to the effect of hepcidin on plasma iron levels. Importantly, this group is highly pre-selected, having already proven to be clinically non- responsive to oral iron and having a TfSat <15%— that is to say having a higher pre-test probability of having IRIDA due to MPRSS6 mutations than an unselected group of individuals with ID/A and TfSat <15%. For this reason and the relative rarity of IRIDA compared to all patients with ID/ A, application of these tests in a broader iron deficient population would likely result in a lower specificity. Furthermore, although the study inclusion criteria did not include the absence of serologic evidence of inflammation, very few study subjects had a C-reactive protein (CRP) outside of the normal range. Without wishing to be bound by theory, this may indicate that the influence of inflammation on these metrics could be further considered. Given that inflammation stimulates hepcidin expression, individuals with severe anemia of chronic inflammation and a TfSat <15% might be expected to test falsely positive. In some embodiments, individuals with severe anemia of chronic inflammation and a TfSat <10% might be expected to test false positive. Nonetheless, one might argue that, regardless of whether or not an individual with chronic ID/A has TMPRSS6 mutations, a positive result would likely indicate that they would benefit from parenteral iron therapy.
[00187] Apart from its application in iron deficient states, we tested the ability of plasma hepcidin and its derivative indices to characterize iron overload conditions in which hepcidin is inappropriately low for the extent of iron overload. Once again, we found that while many patients with HH and XLSA had hepcidin levels within the normal range, the relative abnormality of these levels could be quantified by the normalization of hepcidin to plasma iron to TfSat. (FIG. 10) Conclusion.
[00188] In conclusion, we discovered >30 previously undescribed mutations in MPRSS6 and validated clinical diagnostic utility of an index to normalize hepcidin to iron status, namely plasma Iron/logio(Hepcidin), as well as a multivariate model consisting of hemoglobin and plasma hepcidin and iron, that can identify iron deficient patients harboring MPRSS6 mutations with excellent sensitivity and specificity. Without wishing to be bound by theory, these results could indicate inflammation will need to be considered a confounding factor in diagnosis of IRIDA using these hepcidin indexes and that the rarity of TMPRSS6 mutations may ultimately affect the specificity of the test. However, the hepcidin indexes, when properly applied will help guide further confirmation of IRIDA by TMPRSS6 sequencing and also suggest therapeutic strategies to effectively treat both acquired and congenital iron deficiency.
SEQUENCES
[00189] Human hepcidin peptide (hepcidin-25, hep-25, Hep-25, hHepcidin-25)
[00190] SEQ ID NO: 1 (25aa) DTHFPICIFCCGCCHRSKCGMCCKT
[00191] Mouse hepcidin- 1 peptide (mhepcidin-1, mhep-1, mHep-1, mHepcidin-1)
[00192] SEQ ID NO: 2: (25aa) DTNFPICIFCCKCCNNSQCGICCKT
[00193] Human hepcidin -20 peptide (hepcidin-20, hep-20, Hep-25, hHepcidin-20)
[00194] SEQ ID NO: 3 : (20aa) ICIFCCGCCHRSKCGMCCKT
[00195] Human hepcidin 22 peptide (hepcidin-22, hep-22, Hep-22, hHepcidin-22)
[00196] SEQ ID NO: 4: (22aa) FPICIFCCGCCHRSKCGMCCKT
[00197] CDR-1, CDR-2, and CDR-3 Regions of Variable Heavy and Light Chains of
Hepcidin MAbs 583 and 1B1.
Variable Heavy Chain CDRs
[00198] CDR-1
[00199] SEQ ID NO: 5 583 GGGTATACCTTCACAAACTATGGA
[00200] SEQ ID NO: 6 1B1
GGCTACTCAATCACCAGTGATTATGCC
[00201] CDR-2
[00202] SEQ ID NO: 7 583 ATAAACACCTACACTGGAGAGCCA
[00203] SEQ ID NO: 8 1B1 ATAAGCTACAGTAGTATCACT
[00204] CDR-3
[00205] SEQ ID NO: 9 583 ACAACGTACGCTACTAGCTGGTAC [00206] SEQ ID NO: 10 1B1 GCTGGTCTTTACTATGTTATGGACCAC
Variable Light Chain CDRs
[00207] CDR-1
[00208] SEQ ID NO: 11 583 GAAAGTGTTGATAGTTATGGCAATAGTTTT
[00209] SEQ ID NO: 12 1B1 TCAAGTGTAAGTTAC
[00210] CDR-2
[00211] SEQ ID NO: 13 583 CGTGCATCC
[00212] SEQ ID NO: 14 1B1 CTCACATCC
[00213] CDR-3
[00214] SEQ ID NO: 15 583 CAGCAAAGTAATGAGGATCTGACG
[00215] SEQ ID NO: 16 1B1 CAGCAGTGGAGTAGTGACCCTTTCACG
[00216] SEQ ID NO: 17: 583 Variable Heavy Chain Amino Acid Sequence
[00217] Ala Ser Gly Tyr Thr Phe Thr Asn Tyr Gly Met Asn Gly Tip lie Asn Thr Tyr
Thr Gly Glu Pro Thr Tyr Phe Cys Thr Thr Tyr Ala Thr Ser Trp Tyr Tip Gly
[00218] SEQ ID NO: 18: 583 Variable Light Chain Amino Acid Sequence
[00219] Ala Ser Glu Ser Val Asp Ser Tyr Gly Asn Ser Phe Met His lie Tyr Arg Ala Ser
Asn Leu Tyr Cys Gin Gin Ser Asn Glu Asp Leu Thr Phe Gly
[00220] SEQ ID NO: 19: 1B1 Variable Heavy Chain Amino Acid Sequence
[00221] Val Thr Gly Tyr Ser lie Thr Ser Asp Tyr Ala Trp Asn Gly Tyr lie Ser Tyr Ser
Ser He Thr Asn Tyr Tyr Cys Ala Gly Leu Tyr Tyr Val Met Asp His Trp Gly
[00222] SEQ ID NO: 20: 1B1 Variable Light Chain Amino Acid Sequence
[00223] Ala Ser Ser Ser Val Ser Tyr Met Tyr lie Tyr Leu Thr Ser Asn Leu Tyr Cys Gin
Gin Tip Ser Ser Asp Pro Phe Thr Phe Gly
[00224] While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.

Claims

WHAT IS CLAIMED IS:
1. A method for quantifying an amount of hepcidin in a fluid sample using an immunoassay, comprising:
a) providing a known amount of a tracer reagent consisting of:
1) a peptide having an amino acid sequence of at least a portion of any one of SEQ ID NOS: 1, 3 and 4;
2) at least one hydrophilic spacer consisting of one or more AEEAc residues(ni-6) covalently linked to the peptide of step (a)(1) at the amino terminus or a lysine residue in said peptide; and
3) a detector molecule covalently linked to the hydrophilic spacer of (a)(2); b) contacting a fluid sample from a patient with a known amount of said tracer reagent in the presence of an immobilized antibody that specifically binds to an epitope on hepcidin with a dissociation constant of less than about 50 picomolar; c) washing unbound tracer reagent;
d) adding a development solution;
e) stopping the reaction with a stop solution;
f) detecting the relative amount of tracer reagent of step (a) bound to the immobilized antibody with a substrate, optionally stopping the reaction with a stop solution; and g) calculating the amount of the hepcidin present in the sample based on the results of the detecting of step (f).
2. A method for quantifying an amount of hepcidin in a fluid sample using an immunoassay, comprising:
a) providing a known amount of a tracer reagent consisting of:
1) a peptide having an amino acid sequence of at least a portion of any one of SEQ ID NOS: 1, 3 and 4;
2) at least one hydrophilic spacer consisting of one or more AEEAc residues(ni-6) covalently linked to the peptide of step (a)(1) at the amino terminus or a lysine residue in said peptide; and
3) a detector molecule covalently linked to the hydrophilic spacer of (a)(2); b) contacting a fluid sample from a patient with a known amount of said tracer reagent in the presence of an immobilized antibody that specifically binds to an epitope on hepcidin with a dissociation constant of less than about 50 picomolar; and c) determining the amount of hepcidin present in the fluid sample based on amount of tracer reagent bound to the immobilized antibody.
3. The method of claim 1 or 2, wherein the tracer reagent comprises biotin as the detector molecule covalently linked to the hydrophilic spacer at a single site on the peptide.
4. The method of claim 1 or 2, wherein the tracer reagent comprises K18-biotin- biotin or K24-biotin and the antibody is 583 or an antibody that comprises complimentary determining regions (CDRs) of 583.
5. The method of claim 4, wherein the antibody that comprises the CDRs of 583 comprises variable heavy chain CDRs encoded by SEQ ID NOS: 5, 7 and 9; and variable light chain CDRs encoded by SEQ ID NOS: 11, 13 and 15.
6. The method of claim 1 or 2, wherein the tracer reagent comprises K18-biotin- biotin or K24-biotin and the antibody is 1B1 or an antibody that comprises the CDRs of 1B1.
7. The method of claim 6, wherein the antibody that comprises the CDRs of 1B1 comprises variable heavy chain CDRs encoded by SEQ ID NOS: 6, 8 and 10; and variable light chain CDRs encoded by SEQ ID NOS: 12, 14 and 16.
8. The method of claim 1, wherein the stop solution is H2SO4.
9. The method of claim 1 or 2, wherein the known amount of a tracer reagent is an amount of from about 0.05 ng to about 50 ng.
10. The method of claim 1, wherein the development solution comprises tetramethyl benzidine (TMB) or 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS).
11. The method of claim 1 or 2, wherein the immobilized antibody that specifically binds to an epitope on hepcidin specifically binds to hepcidin 20, hepcidin 22 and hepcidin 25.
12. A method for quantifying an amount of hepcidin in a fluid sample using an immunoassay, comprising:
a) providing a known amount of a tracer reagent consisting of:
1. a peptide having an amino acid sequence of at least a portion of any one of SEQ ID NOS: 1, 3 and 4;
2. at least one hydrophilic spacer consisting of one or more AEEAc residues(ni-6) covalently linked to the peptide of step (a)(1) at the amino terminus or a lysine residue in said peptide; and
3. a detector molecule covalently linked to the hydrophilic spacer of (a)(2); b) contacting a fluid sample from a patient with a known amount of said tracer reagent in the presence of an immobilized antibody that specifically binds to an epitope on hepcidin with a dissociation constant of less than about 50 picomolar; c) washing unbound tracer reagent;
d) adding a secondary detection reagent;
e) washing unbound secondary detection reagent;
f) adding a development solution;
g) stopping the reaction with a stop solution;
h) detecting the relative amount of tracer reagent of step (a) bound to the immobilized antibody with a substrate, optionally stopping the reaction with a stop solution; and i) calculating the amount of the hepcidin present in the sample based on the results of the detecting of step (h).
13. A method for quantifying an amount of hepcidin in a fluid sample using an immunoassay, comprising:
a) providing a known amount of a tracer reagent consisting of:
1. a peptide having an amino acid sequence of at least a portion of any one of SEQ ID NOS: 1, 3 and 4;
2. at least one hydrophilic spacer consisting of one or more AEEAc residues(ni-6) covalently linked to the peptide of step (a)(1) at the amino terminus or a lysine residue in said peptide; and
3. a detector molecule covalently linked to the hydrophilic spacer of (a)(2); b) contacting a fluid sample from a patient with a known amount of said tracer reagent in the presence of an immobilized antibody that specifically binds to an epitope on hepcidin with a dissociation constant of less than about 50 picomolar; and c) determining the amount of hepcidin in the fluid sample based upon the amount of secondary detection reagent.
14. The method of claim 12 or 13, wherein the secondary detection reagent is streptavidin horseradish peroxidase (HRP).
15. The method of claim 12 or 13, wherein the tracer reagent comprises K24-HRP or K18-HRP and the antibody is 583 or an antibody that comprises CDRs of 583.
16. The method of claim 15, wherein the antibody that comprises the CDRs of 583 comprises variable heavy chain CDRs encoded by SEQ ID NOS: 5, 7 and 9; and variable light chain CDRs encoded by SEQ ID NOS: 11, 13 and 15.
17. The method of claim 12 or 13, wherein the tracer reagent comprises K24-HRP or K18-HRP and the antibody is 1B1 or an antibody that comprises CDRs of 1B1.
18. The method of claim 17, wherein the antibody that comprises the CDRs of 1B1 comprises variable heavy chain CDRs encoded by SEQ ID NOS: 6, 8 and 10; and variable light chain CDRs encoded by SEQ ID NOS: 12, 14 and 16.
19. The method of claim 12 or 13, wherein the secondary detection reagent comprises streptavidin HRP.
20. The method of claim 12, wherein the stop solution is HC1, phosphoric acid, or
H2S04.
21. The method of claim 12 or 13, wherein the known amount of a tracer reagent is an amount of from about 0.05 ng to about 50 ng.
22. The method of claim 12, wherein the development solution comprises tetramethyl benzidine (TMB) or 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS).
23. The method of claim 12 or 13, wherein the peptide of (a)(1) has an amino acid sequence set forth as SEQ ID NO 1.
24. The method of claim 12 or 13, wherein the peptide of (a)(1) has an amino acid sequence set forth as SEQ ID NO 3.
25. The method of claim 12 or 13, wherein the peptide of (a)(1) has an amino acid sequence set forth as SEQ ID NO 4.
26. The method of claim 12 or 13, wherein the antibody that specifically binds to an epitope on hepcidin specifically binds to hepcidin 20, hepcidin 22 and hepcidin 25.
27. The method of any one of claims 12-26, wherein the peptide of (a)(1) is oxidatively-folded.
28. A kit for detecting the level of Hepcidin in a fluid sample comprising a tracer reagent of any one of claims 1-27 and an antibody that specifically binds to hepcidin.
29. The kit of claim 28, wherein the antibody is immobilized on a support.
30. The kit of claim 28, wherein the tracer reagent comprises K18-biotin, K24-biotin, K24-HRP, or K18-HRP.
31. The kit of claim 28, wherein the antibody that specifically binds to hepcidin is antibody 583 or an antibody that comprises CDRs of 583.
32. The kit of claim 31, wherein the antibody that comprises the CDRs of 583 comprises variable heavy chain CDRs encoded by SEQ ID NOS: 5, 7 and 9; and variable light chain CDRs encoded by SEQ ID NOS: 11, 13 and 15.
33. The kit of claim 28, wherein the antibody that specifically binds to hepcidin is antibody IBl or an antibody that comprises CDRs of IBl .
34. The kit of claim 33, wherein the antibody that comprises the CDRs of IBl comprises variable heavy chain CDRs encoded by SEQ ID NOS: 6, 8 and 10; and variable light chain CDRs encoded by SEQ ID NOS: 12, 14 and 16.
35. The kit of claim 28, wherein the tracer reagent is K18-biotin, K24-biotin, K24- HRP, or K18-HRP and the antibody is 583 or an antibody that comprises CDRs of 583.
36. The kit of claim 28, wherein the tracer reagent is K18-biotin, K24-biotin, K24- HRP or K18-HRP and the antibody is IBl or an antibody that comprises CDRs of IBl .
37. The kit of claim 28, wherein the tracer reagent comprises an enzyme.
38. The kit of claim 28, wherein the tracer reagent comprises a binding molecule as a detector molecule.
39. The kit of claim 38, wherein the detector molecule is biotin and the kit further comprises a secondary detection reagent.
40. The kit of claim 39, wherein the secondary detection reagent comprises streptavidin-HRP.
41. The kit of claim 38, wherein the detector molecule is horseradish peroxidase and the kit further comprises peroxide.
42. A method of treating iron deficiency anemia in a subject in need thereof, the method comprising:
a. measuring the level of hepcidin in a biological sample obtained from the subject; b. administering to the subject a pharmaceutical composition that comprises parenteral iron to the subject if the level of hepcidin is increased relative to a reference level
43. The method of claim 42, wherein a level of hepcidin in the biological sample increased relative to a reference level indicates that the patient is unlikely to respond to oral iron therapy.
44. The method of any of claims 42-43, further comprising administering to the subject a pharmaceutical composition that comprises oral iron to the subject if the level of hepcidin measured in the biological sample is not increased relative to a reference level.
45. The method of any of claims 42-44, further comprising: c. measuring the level of hepcidin in a biological sample obtained from the subject after the administering of step b); and d. administering a further dose of the pharmaceutical composition that comprises parenteral iron to the subject if the level of hepcidin measured in step c) is increased relative to a reference level.
46. The method of any of claims 42-45, wherein the reference level is the hepcidin level of a normal, healthy subject without anemia.
47. The method of any of claims 42-45, wherein the reference level is the lower limit of normal (at the 5th percentile) in a population of normal, healthy subjects without anemia.
48. The method of any of claims 42-47, wherein the level of hepcidin is increased at least 1.5 fold relative to the reference level.
49. The method of any of claims 42-48, wherein the level of hepcidin is increased at least 3.0 fold relative to the reference level.
50. The method of any of claims 42-49, wherein the level of hepcidin is the level of plasma hepcidin.
51. The method of any of claims 42-50, wherein the subject does not have an inflammatory condition; chronic inflammation; and/or abnormal levels of C-reactive protein (CRP).
52. The method of any of claims 42-51, wherein a step comprising measuring the level of hepcidin further comprises measuring the level of plasma iron and a step comprising administration further comprises: administering parenteral iron to the subject if the level of plasma Iron/1 ogi0(Hepci din) is decreased relative to a reference level; or administering oral iron to the subject if the level of plasma Iron/1 ogio(Hepci din) is not decreased relative to a reference level.
53. The method of claim 52, wherein a level of plasma Iron/1 ogi0(Hepci din) which is decreased relative to a reference level indicates that the patient is unlikely to respond to oral iron therapy.
54. The method of any of claims 52-53, wherein the reference level of plasma Iron/logio(Hepcidin) is about 14.3.
55. The method of any of claims 42-54, wherein a step comprising measuring the level of hepcidin further comprises measuring the level of TfSat and a step comprising administration further comprises: administering parenteral iron to the subject if the level of Tfsat/logi0(Hepcidin) is decreased relative to a reference level; or administering oral iron to the subject if the level of Tfsat/logio(Hepcidin) is not decreased relative to a reference level.
56. The method of claim 55, wherein a level of Tfsat/logi0(Hepcidin) which is decreased relative to a reference level indicates that the patient is unlikely to respond to oral iron therapy.
57. The method of any of claims 55-56, wherein the reference level of TfSat/logio(hepcidin) is about 4.0.
58. The method of any of claims 42-57, wherein the level of hepcidin is measured using the method or kit of any of claims 1-41.
59. The method of any of claims 42-58, wherein the level of hepcidin is measured using mAb583.
A method of treating anemia in a subject in need thereof, the method comprising: measuring a level of hemoglobin, a level of hepcidin and a level of plasma iron in a biological sample obtained from the subj ect; and
administering to the subject:
i. a composition that comprises parenteral iron if the value of P according to equation 2
P = e (9.7743-0.7826*HGB+0.2067*Iron-0.4487*Iron/logl0(hepcidin))7 +e(9.7743- 0.7826*HGB+0.2067*Iron-0.4487*Iron/logl0(hepcidin))
(equation 2) is 0.7 or greater, thereby indicating the subject has Iron-Refractory Iron- Deficiency Anemia (TRIDA); or
ii. a composition that comprises oral iron if the value of P according to
equation 2 is less than 0.7.
A method of treating anemia in a subject in need thereof, the method comprising: measuring a level of ferritin, a level of hemoglobin, and a level of plasma iron in a biological sample obtained from the subj ect; and
administering to the subject:
i. a composition that comprises parenteral iron if the value of P according to equation 1
P = e { 10.0744 - 0.6543*HGB - 0.2412*Iron/logl0(Ferritin)}7 +e{ 10.0744 - 0.6543*HGB - 0.2412*Iron/loglO(Ferritin)}
(equation 1) is 0.7 or greater, thereby indicating the subject has Iron-Refractory Iron- Deficiency Anemia (IRIDA); or
ii. a composition that comprises oral iron if the value of P according to
equation 1 is less than 0.7.
62. A method of treating iron overload in a subject in need thereof, the method comprising:
a. measuring the level of hepcidin and at least one of ferritin, iron, or TfSat in a subject diagnosed with primary or secondary iron overload at, at least, two time points; and
b. administering or withholding a treatment selected from the group consisting of: transfusions, phlebotomy, hepcidin mimetics, or other any other therapy that modulates erythropoiesis, total body iron, iron available for erythropoiesis or excretion or chelation of iron if the level of:
i. plasma Iron/1 ogi0(Hepci din) changes over time;
ii. plasma ferri tin/1 ogio(Hepci din) changes over time; or iii. Tfsat/logio(Hepcidin) changes over time.
63. The method of claim 62, wherein the iron overload is hereditary hemochromatosis (HH); X-linked sideroblastic anemia (XLSA); or other iron loading anemia.
PCT/US2018/021189 2017-03-07 2018-03-06 Assessment of chronic iron deficiency Ceased WO2018165186A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201762468281P 2017-03-07 2017-03-07
US62/468,281 2017-03-07
US201762550102P 2017-08-25 2017-08-25
US62/550,102 2017-08-25

Publications (1)

Publication Number Publication Date
WO2018165186A1 true WO2018165186A1 (en) 2018-09-13

Family

ID=63448932

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2018/021189 Ceased WO2018165186A1 (en) 2017-03-07 2018-03-06 Assessment of chronic iron deficiency

Country Status (1)

Country Link
WO (1) WO2018165186A1 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10239941B2 (en) 2013-03-15 2019-03-26 Intrinsic Lifesciences Llc Anti-hepcidin antibodies and uses thereof
US10323088B2 (en) 2014-09-22 2019-06-18 Intrinsic Lifesciences Llc Humanized anti-hepcidin antibodies and uses thereof
EP4041241A1 (en) 2019-09-27 2022-08-17 Disc Medicine, Inc. Methods for treating myelofibrosis and related conditions
CN115247173A (en) * 2021-11-11 2022-10-28 南京启真基因工程有限公司 Construction and application of gene editing system for porcine nuclear transfer donor cells with TMPRSS6 gene mutation in iron deficiency anemia
US12365729B2 (en) 2020-05-13 2025-07-22 Disc Medicine, Inc. Anti-hemojuvelin (HJV) antibodies for treating myelofibrosis

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090215095A1 (en) * 2004-04-28 2009-08-27 Mark E. Westerman, Ph.D. Compositions and methods for measuring levels of bioactive human hepcidin
US20150202224A1 (en) * 2012-07-27 2015-07-23 Luitpold Pharmaceuticals, Inc. Method of treating iron deficiency anemia
US20160017032A1 (en) * 2013-03-15 2016-01-21 Intrinsic Lifesciences Llc Anti-hepcidin antibodies and uses thereof
WO2016049036A1 (en) * 2014-09-22 2016-03-31 Intrinsic Lifesciences Llc Humanized anti-hepcidin antibodies and uses thereof
US20160166649A1 (en) * 2001-05-25 2016-06-16 Institut National De La Sante Et De La Recherche Medicale Use of hepcidin as a regulator of iron homeostasis

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160166649A1 (en) * 2001-05-25 2016-06-16 Institut National De La Sante Et De La Recherche Medicale Use of hepcidin as a regulator of iron homeostasis
US20090215095A1 (en) * 2004-04-28 2009-08-27 Mark E. Westerman, Ph.D. Compositions and methods for measuring levels of bioactive human hepcidin
US20150202224A1 (en) * 2012-07-27 2015-07-23 Luitpold Pharmaceuticals, Inc. Method of treating iron deficiency anemia
US20160017032A1 (en) * 2013-03-15 2016-01-21 Intrinsic Lifesciences Llc Anti-hepcidin antibodies and uses thereof
WO2016049036A1 (en) * 2014-09-22 2016-03-31 Intrinsic Lifesciences Llc Humanized anti-hepcidin antibodies and uses thereof

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10239941B2 (en) 2013-03-15 2019-03-26 Intrinsic Lifesciences Llc Anti-hepcidin antibodies and uses thereof
US10323088B2 (en) 2014-09-22 2019-06-18 Intrinsic Lifesciences Llc Humanized anti-hepcidin antibodies and uses thereof
EP4041241A1 (en) 2019-09-27 2022-08-17 Disc Medicine, Inc. Methods for treating myelofibrosis and related conditions
US12365729B2 (en) 2020-05-13 2025-07-22 Disc Medicine, Inc. Anti-hemojuvelin (HJV) antibodies for treating myelofibrosis
US12497452B2 (en) 2020-05-13 2025-12-16 Disc Medicine, Inc. Anti-hemojuvelin (HJV) antibodies for treating myelofibrosis
CN115247173A (en) * 2021-11-11 2022-10-28 南京启真基因工程有限公司 Construction and application of gene editing system for porcine nuclear transfer donor cells with TMPRSS6 gene mutation in iron deficiency anemia

Similar Documents

Publication Publication Date Title
JP7837375B2 (en) Antibodies against pyroglutamate amyloid-beta and their use
JP7238042B2 (en) Compositions and methods for diagnosing and treating iron-related disorders
JP2025186346A (en) Assays for detecting neurodegeneration
AU2015322662B2 (en) Antibody capable of neutralizing substance having activity alternative to function of coagulation factor VIII (FVIII)
JP5819194B2 (en) Antibody to pyroglutamine oxidized monocyte chemotactic protein-1 (MCP-1N1pE)
CA2958995C (en) Method for measuring reactivity of fviii
JP2017522043A (en) FcRn-specific human antibody and autoimmune disease treatment composition containing the same
JP7252953B2 (en) H1.0K180ME2 Antibodies, Methods of Making and Using Them
JP2023524041A (en) KRAS-specific antibody and uses thereof
KR20180068952A (en) Novel anti-human GPVI antibodies and uses thereof
US20220073611A1 (en) Anti-nmda receptor antibodies and methods of use
US20250179196A1 (en) Materials and methods of making or using il-23r binding proteins
JP2023067832A (en) Compounds and methods targeting interleukin-34
RU2773819C2 (en) Protein bound with human glycoprotein, composition, pharmaceutical composition, expression vector
CN121666395A (en) Alkaline phosphatase antibody and use thereof
WO2020100779A1 (en) Monoclonal antibody specifically binding to pser46-marcks
EA045911B1 (en) ANTIBODIES TO PYROGLUTAMATE-β-AMYLOID AND THEIR APPLICATION
CA3055965A1 (en) Antibodies to human erythroferrone and uses thereof
HK1235415A1 (en) Antibody capable of neutralizing substance having activity alternative to function of coagulation factor viii (fviii)
NZ729317B2 (en) Method for measuring reactivity of fviii

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18764434

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18764434

Country of ref document: EP

Kind code of ref document: A1