WO2018154307A1 - Modulators of the interaction of cd248 with its ligand multimerin 2 - Google Patents
Modulators of the interaction of cd248 with its ligand multimerin 2 Download PDFInfo
- Publication number
- WO2018154307A1 WO2018154307A1 PCT/GB2018/050466 GB2018050466W WO2018154307A1 WO 2018154307 A1 WO2018154307 A1 WO 2018154307A1 GB 2018050466 W GB2018050466 W GB 2018050466W WO 2018154307 A1 WO2018154307 A1 WO 2018154307A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- mmrn2
- agent
- variant
- antibody
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2896—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against molecules with a "CD"-designation, not provided for elsewhere
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
- A61K39/3955—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/7056—Lectin superfamily, e.g. CD23, CD72
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
- C07K2319/21—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
Definitions
- the invention relates generally to endothelium and pericyte specific genes and polypeptides, modulators of these endothelium and pericyte specific genes/polypeptides, and the use of agents that bind to these polypeptides for imaging and targeting neovasculature.
- the present invention relates to portions of multimerin 2 (MMRN2) and CD248, and specifically to portions of MMRN2 and CD248 that modulate the interaction between MMRN2 and CD248.
- the invention also relates to antibodies that bind to said portions.
- Endothelial cells form a single cell layer that lines all blood vessels and regulates exchanges between the blood stream and the surrounding tissues. New blood vessels develop from the walls of existing small vessels by the outgrowth of endothelial cells in the process called angiogenesis. Endothelial cells even have the capacity to form hollow capillary tubes when isolated in culture. Once the vascular system is fully developed, endothelial cells of blood vessels normally remain quiescent with no new vessel formation, with the exception of the formation of new blood vessels in natural wound healing.
- Angiogenesis describes the formation of new blood vessels from existing vessels and is an integral part of reproduction, embryonic development and wound healing. Angiogenesis is mostly dormant in healthy adults but is a component of numerous pathologies including cancer, diabetic retinopathy and atherosclerosis (1). Angiogenesis plays a major role in the progression of solid tumours and is widely recognised as a rate- limiting process in the growth of solid tumours. Tumours that fail to attract a blood supply are severely limited in their growth. Thus, the ability to control angiogenesis would provide significant therapeutic value and understanding the underlying molecular events is critical in this pursuit.
- tumour angiogenesis involves the degradation of the basement membrane by activated tissue or circulating endothelial precursors, proliferation and migration of endothelial cells, interaction with the extracellular matrix, morphological differentiation, cell adherence and vascular tube formation.
- tumour angiogenesis is thus a target for anti-tumour therapies, employing either angiogenesis inhibitors alone or in combination with standard cancer treatments.
- targeting anti-tumour agents to the site of angiogenesis depends upon the identification of specific markers of tumour angiogenesis. It is now accepted that the growth of solid tumours is dependent on their capacity to acquire a blood supply, and much effort has been directed towards the development of anti-angiogenic agents that disrupt this process. It has also become apparent that targeted destruction of the established tumour vasculature is another avenue for exciting therapeutic opportunities, and the discovery of widely expressed tumour endothelial markers promises much clinical benefit (Neri & Bicknell (2005) "Tumour vascular targeting.” Nat Rev Cancer 5(6): 436-446).
- CLEC14A as a tumour endothelial marker (WO 201 1/027132). Available data on CLEC14A suggests that manipulation of CLEC14A levels or function blocking antibodies will regulate endothelial migration (WO201 1/027132).
- MMRN2 is an endothelial specific marker of the emilin family and a component of the extracellular matrix. MMRN2 is an extracellular interacting protein for CLEC14A and was found to be co- expressed with CLEC14A in the tumour vasculature.
- CD93 as well as CLEC14A can directly bind to MMRN2 (GB 1612860.5). Binding of CLEC14A and CD93 has been mapped to a non-glycosylated coiled-coil region of MMRN2, and a CLEC14A and CD93 binding portion of MMRN2 has been shown both to disrupt angiogenesis in an in vitro assay and increase adherence of HUVEC cells. Further, the portion of MMRN2 expressed by Lewis lung carcinoma cells inhibited their growth in vivo.
- CD248 can directly bind to MMRN2. Binding of CD248 to MMRN2 has been shown to involve a non-glycosylated coiled-coil region of MMRN2 and the C-type Lectin Domain (CTLD) of CD248 (see Example 1). Further, the inventors have shown that both CLEC14A and CD248 can bind MMRN2 simultaneously (see Example 1). CD248-MMRN2 interactions occur on a separate region from CLEC14A and CD93 binding, suggesting endothelial expressed CTLD group 14 members can bind to MMRN2 simultaneously with CD248 expressed by other cell types such as pericytes or fibroblasts.
- C-type Lectin Domain C-type Lectin Domain
- MMRN2 acts as an "extracellular glue” between both cell types in vessel formation and maturation. This adds to the list of ECM proteins along with collagen I and IV and fibronectin already described as potential CD248 ligands (33). Taken together, the inventors' findings propose previously unknown protein interactions, and new therapeutic avenues in inhibiting angiogenesis and combating cancer.
- a first aspect of the invention provides agents that modulate the interaction between CD248 and multimerin 2 (MMRN2).
- MMRN2 is a protein belonging to the member of elastin microfibril interface-located (EMI LIN) protein family with a signal peptide at residues 1-22.
- the mature human polypeptide is 927 amino acids in length (amino acid residues 23-949) and contains a 79 amino acid EMI domain (residues 54 - 132), a 688 amino acid coiled-coil domain (residues 133-820), and a C1q domain (residues 821-949).
- the gene MMRN2 is located at 10q23.2 and encodes a 949 amino acid residue polypeptide.
- MMRN2 polypeptide we include the meaning of a gene product of human MMRN2, including naturally occurring variants thereof.
- Human MMRN2 polypeptide includes the amino acid sequence found in Genbank Accession No NP_079032.2 and naturally occurring variants thereof.
- the MMRN2 polypeptide sequence from NP_079032.2 is shown in Figure 7 (SEQ ID No: 1).
- MMRN2 orthologues found in other species such a such as in horse, bull, chimp, chicken, zebrafish, dog, pig, cow, sheep, rat, mouse, guinea pig or a primate.
- CD248 is a type I transmembrane protein with a signal peptide at residues 1-17.
- the mature human polypeptide is 740 amino acids in length (amino acid residues 18-757 and contains a 670 residue extracellular region (residues 18-687), a transmembrane region (residues 688-708), and a cytoplasmic region (residues 709-757).
- the extracellular region contains a C-type lectin like domain (residues 30-156), a sushi domain (residues 162 - 232) and three EGF-like regions (residues 235-272, 273-313 and 314-354).
- the gene CD248 is located at 1 1q13.2 and encodes a 757 amino acid residue polypeptide with a predicted MW of 80.9 KDa.
- the CD248 polypeptide we include the meaning of a gene product of human CD248, including naturally occurring variants thereof.
- Human CD248 polypeptide includes the amino acid sequence found in Genbank Accession No NP_065137.1 , and naturally occurring variants thereof.
- CD248 polypeptide sequence from NP_065137.1 is shown in Figure 8 (SEQ ID No: 4). Also included are CD248 orthologues found in other species, such as in horse, dog, pig, cow, sheep, rat, mouse, guinea pig or a primate. A cDNA sequence corresponding to a human CD248 mRNA is found in Genbank Accession No NM_020404.2, and the coding region is also shown in Figure 8 (SEQ ID No: 3).
- MMRN2 and CD248 By “natural variants” of MMRN2 and CD248 we include, for example, allelic variants. Typically, these will vary from the given sequence by only one or two or three, and typically no more than 10 or 20 amino acid residues. Typically, the variants have conservative substitutions.
- agents that modulate the interaction between MMRN2 and CD248 in the context of the first aspect of the invention, we include the meaning of any synthetic or natural molecule, that modulates the interaction between MMRN2 and CD248.
- the agent may be one that modulates the level of binding between CD248 and MMRN2, as compared to the level of binding between CD248 and MMRN2 in the absence of the agent.
- Suitable methods for detecting and/or measuring (quantifying) the binding between CD248 and MMRN2 are well known to those skilled in the art.
- Examples of appropriate methods include pull-down assays, enzyme linked immunosorbent assays (ELISA), surface plasmon resonance assays, chip-based assays, immunocytofluorescence, yeast two- hybrid technology and phage display, which are common practice in the art and are described, for example, in Plant et al (1995) Analyt Biochem, 226(2), 342-348. and Sambrook et al (2001) Molecular Cloning A Laboratory Manual. Third Edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.
- Other methods of detecting binding between CD248 and MMRN2 include ultrafiltration with ion spray mass spectroscopy/HPLC methods or other physical and analytical methods.
- Fluorescence Energy Resonance Transfer methods, for example, well known to those skilled in the art, may be used, in which binding of two fluorescent labelled entities (i.e. CD248 and MMRN2 or portions or variants thereof) may be measured by measuring the interaction of the fluorescent labels when in close proximity to each other.
- fluorescent labelled entities i.e. CD248 and MMRN2 or portions or variants thereof
- the agent may be an inhibitor or an antagonist of the interaction between CD248 and MMRN2.
- the agent is one that reduces the level of binding between CD248 and MMRN2 by at least 10%, 20%, 30%, 40% or 50%, and more preferably the agent is one that reduces the level of binding between CD248 and MMRN2 by at least 70%, 80%, 90%, 95% or 99%.
- the agent is one that reduces the level of binding between CD248 and MMRN2 to an undetectable level, or eliminates binding between CD248 and MMRN2.
- modulate the interaction between CD248 and MMRN2
- the agent may be an activator of the interaction between CD248 and MMRN2.
- the agent is one that enhances the level of binding between CD248 and MMRN2 by at least 10%, 20%, 30%, 40% or 50%, and more preferably the agent is one that enhances the level of binding between CD248 and MMRN2 by at least 70%, 80%, 90%, 95% or 99%.
- the agent is one that enhances the level of binding between CD248 and MMRN2 by at least 10%, 20%, 30%, 40% or 50%, and more preferably the agent is one that enhances the level of binding between CD248 and MMRN2 by at least 70%, 80%, 90%, 95% or 99%.
- the agent is one that reduces the level of binding between CD248 and MMRN2, and so is an inhibitor of the interaction.
- the agent of the first aspect of the invention is one that selectively modulates the interaction between CD248 and MMRN2.
- an agent which selectively modulates the interaction we include the meaning that the agent modulates the interaction between CD248 and MMRN2 to a greater extent than it modulates the interaction between two irrelevant polypeptides, such as an interaction between human serum albumin and another peptide.
- the agent modulates the interaction between CD248 and MMRN2 at least 5, or at least 10, or at least 50 times more than it modulates the interaction between two irrelevant polypeptides. More preferably, the agent modulates the interaction between CD248 and MMRN2 at least 100, or at least 1 ,000, or at least 10,000 times more than it modulates the interaction between two irrelevant polypeptides.
- the agent may be one that selectively inhibits the interaction between CD248 and MMRN2.
- the agent may inhibit the interaction between CD248 and MMRN2 to a greater extent than it inhibits the interaction between two irrelevant polypeptides, such as an interaction between human serum albumin and another peptide.
- the agent inhibits the interaction between CD248 and MMRN2 at least 5, or at least 10, or at least 50 times more than it inhibits the interaction between two irrelevant polypeptides. More preferably, the agent inhibits the interaction between CD248 and MMRN2 at least 100, or at least 1 ,000, or at least 10,000 times more than it inhibits the interaction between two irrelevant polypeptides.
- the agent of the first aspect of the invention is one that inhibits the interaction between CD248 and MMRN2.
- the agent of the first aspect of the invention is one that selectively inhibits the interaction between CD248 and MMRN2.
- the agent may be one that selectively enhances the interaction between CD248 and MMRN2.
- the agent may enhance the interaction between CD248 and MMRN2 to a greater extent than it enhances the interaction between two irrelevant polypeptides, such as an interaction between human serum albumin and another peptide.
- the agent enhances the interaction between CD248 and MMRN2 at least 5, or at least 10, or at least 50 times more than it enhances the interaction between two irrelevant polypeptides.
- the agent enhances the interaction between CD248 and MMRN2 at least 100, or at least 1 ,000, or at least 10,000 times more than it enhances the interaction between two irrelevant polypeptides.
- the agent of the first aspect of the invention is one that enhances the interaction between CD248 and MMRN2. In a further embodiment, the agent of the first aspect of the invention is one that selectively enhances the interaction between CD248 and MMRN2
- the agent itself may modulate the interaction between CD248 and MMRN2 directly ⁇ eg by binding to CD248 or MMRN2).
- the agent itself may inhibit or enhance the interaction between CD248 and MMRN2 directly (eg by binding to CD248 or MMRN2).
- prodrugs for the avoidance of doubt, by an agent that modulates the interaction between CD248 and MMRN2, we also include the meaning of prodrugs thereof.
- the agent may be administered as a prodrug which is metabolised or otherwise converted into its active form once inside the body of a subject.
- prodrug refers to a precursor or derivative form of a pharmaceutically active substance that is less active compared to the parent drug and is capable of being enzymatically activated or converted into the more active parent form (see, for example, D. E. V. Wilman "Prodrugs in Cancer Chemotherapy” Biochemical Society Transactions 14, 375-382 (615th Meeting, Harbor 1986) and V. J. Stella et al. "Prodrugs: A Chemical Approach to Targeted Drug Delivery” Directed Drug Delivery R. Borchardt et al (ed.) pages 247-267 (Humana Press 1985)).
- the agent of the first aspect of the invention is one that binds to CD248, and more preferably is one that selectively binds to CD248.
- an agent that selectively binds to CD248 we include the meaning that the agent binds CD248 with a greater affinity than for an irrelevant polypeptide such as human serum albumin.
- the agent binds CD248 with at least 5, or at least 10 or at least 50 times greater affinity than for the irrelevant polypeptide.
- the agent binds the CD248 with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than for the irrelevant polypeptide. Such binding may be determined by methods well known in the art, such as one of the Biacore ® systems.
- the agent may be one that competes with MMNR2 for specific binding to the CD248 polypeptide. Whether or not a given agent selectively binds to the MMRN2 binding region or competes with MMRN2 for specific binding to the CD248 polypeptide can be determined using routine methods in the art such as competition binding studies. For example, binding of CD248 to the given agent can be assessed following pre-incubation with varying concentrations of MMRN2.
- the agent that binds to CD248 does not bind to thrombomodulin, or that the agent binds CD248 with a greater affinity than for thrombomodulin.
- the agent binds to CD248 with at least 5, or at least 10 or at least 50 times greater affinity than for thrombomodulin. More preferably, the agent binds to CD248 with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than for thrombomodulin.
- binding may be determined by methods well known in the art, such as one of the Biacore ® systems.
- the agent selectively binds to CD248, and binds to the mature polypeptide (residues 18-757), and not to the signal peptide (residues 1-17).
- the agent is one that binds to the extracellular domain of CD248.
- extracellular domain we include the meaning of the region corresponding to residues 18-687 of the human CD248 polypeptide.
- the extracellular domain in other CD248 orthologues or variants can be readily identified by alignment.
- region corresponding to the region spanning amino acid residues 18-687 of human CD248 we include the meaning of a region in a CD248 orthologue or variant that aligns to the region spanning amino acid residues 18-687 of human CD248 when the sequence of the CD248 orthologue or variant is compared to the human CD248 sequence by alignment.
- corresponding region as used herein we include the meaning of the region in a CD248 or MMRN2 orthologue or variant which aligns to the given region in human CD248 or human MMRN2 when the human CD248 and the CD248 orthologue or variant, or when the human MMRN2 and the MMRN2 orthologue or variant, are compared by alignment, such as with CLUSTALW.
- the agent is one that binds to the SUSHI domain of CD248.
- the SUSHI domain of CD248 corresponds to amino acid residues 162-232 of human CD248 and the SUSHI domain in other CD248 orthologues or variants can be readily identified by alignment.
- the agent is one that binds to one of the three EGF-like domains of CD248.
- the EGF-like domains of CD248 correspond to amino acid residues 235-272, 273-313 and 314-354 of human CD248 and the EGF-like domains in other CD248 orthologues or variants can be readily identified by alignment.
- the agent is one that binds to the C-type lectin Domain (CTLD) of CD248.
- the CTLD of CD248 corresponds to amino acid residues 30- 156 of human CD248, and the CTLD in other CD248 orthologues or variants can be readily identified by alignment.
- the agent binds to the long-loop region of CD248.
- the long-loop of human CD248 corresponds to amino acid residues Q88-C131 ( Figure 5), and the long- loop in other CD248 orthologues or variants can be readily identified by alignment.
- the agent is one that binds to the MMRN2 binding region of CD248.
- MMRN2 binding region we include the meaning of the region corresponding to residues 30-156 of the human CD248 polypeptide.
- the agent of the first aspect of the invention does not bind to a mutant CD248 polypeptide in which the cysteine corresponding to cysteine-94 of human CD248 is mutated and/or the cysteine corresponding to cysteine-126 of human CD248 is mutated.
- cysteine corresponding to cysteine-94 or cysteine-126 of human CD248 we include the meaning of cysteines in other CD248 orthologues or variants that align to cysteine-94 or cysteine-126 in human CD248 when the CD248 orthologue or variant and human CD248 are compared by alignment.
- the cysteines corresponding to cysteine-94 and cysteine-126 will be cysteine-94 and cysteine-126.
- the agent of the first aspect of the invention is one which binds to MMRN2, and more preferably is one that selectively binds to MMRN2.
- an agent that selectively binds to MMRN2 we include the meaning that the agent binds MMRN2 with a greater affinity than for an irrelevant polypeptide such as human serum albumin.
- the agent binds MMRN2 with at least 5, or at least 10 or at least 50 times greater affinity than for the irrelevant polypeptide. More preferably, the agent binds the MMRN2 with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than for the irrelevant polypeptide.
- binding may be determined by methods well known in the art, such as one of the Biacore ® systems.
- the agent may be one that competes with CD248 for specific binding to the MMRN2 polypeptide.
- Whether or not a given agent selectively binds to the MMRN2 binding region or competes with CD248 for specific binding to the MMRN2 polypeptide can be determined using routine methods in the art such as competition binding studies. For example, binding of MMRN2 to the given agent can be assessed following pre-incubation with varying concentrations of CD248.
- the agent selectively binds to MMRN2 and binds to the mature polypeptide (residues 23-949), and not to the signal peptide (residues 1-22).
- the agent binds to the CD248 binding region of the MMRN2 polypeptide.
- CD248 binding region we include the region corresponding to residues 133-486 of the human MMRN2 polypeptide.
- the agent binds to the coiled-coil domain of the MMRN2 polypeptide or part thereof, and more preferably the agent binds to a region spanning amino acids 133-486 of MMRN2.
- the agent does may not bind to a region spanning amino acids 487-820 of MMRN2.
- the agent of the first aspect of the invention is any one of a polypeptide, a peptide, an antibody a polynucleotide, a peptidomimetic, a natural product, a carbohydrate, an aptamer or a small molecule.
- the agent is a polypeptide, a peptide, an antibody or a peptidomimetic.
- polypeptide agents that modulate the interaction between CD248 and MMRN2 may be administered directly, or may be administered in the form of a polynucleotide that encodes the agent.
- an agent that modulates the interaction between CD248 and MMRN2 which agent is a polypeptide we include the meanings of administering the inhibitor directly, or administering a polynucleotide that encodes the inhibitor, typically in the form of a vector.
- a medicament or a composition comprising an agent that inhibits the interaction between CD248 and MMRN2 which is a polypeptide
- the medicament or composition comprises the agent itself, or comprises a polynucleotide that encodes the agent.
- the agent may be a peptidomimetic that modulates the interaction between CD248 and MMRN2.
- peptidomimetic refers to a compound that mimics the conformation and desirable features of a particular peptide as a therapeutic agent, but that avoids the undesirable features.
- morphine is a compound which can be orally administered, and which is a peptidomimetic of the peptide endorphin.
- the agent may be an antibody that modulates the interaction between CD248 and MMRN2.
- the antibody may be one that binds to either of CD248 or MMRN2 and preferably does so selectively.
- the antibody may bind specifically to regions of CD248 and/or MMRN2 that are involved either directly or indirectly in the interaction between CD248 and MMRN2.
- the antibody may bind to the MMRN2 binding site in CD248 and so directly block binding of MMRN2, or the antibody may bind to a region of CD248 outside the MMRN2 binding site that is nevertheless required for a stable interaction and so indirectly affects binding to MMRN2.
- the antibody may bind to the CD248 binding site in MMRN2 and so directly block binding of CD248, or the antibody may bind to a region of MMRN2 outside the CD248 binding site that is nevertheless required for a stable interaction and so indirectly affects binding to CD248. Further antibodies of the invention are discussed in more detail below.
- Suitable antibodies which bind to CD248 or MMRN2, or to specified portions thereof can be made by the skilled person using technology long-established in the art.
- Methods of preparation of monoclonal antibodies and antibody fragments are well known in the art and include hybridoma technology (Kohler & Milstein (1975) "Continuous cultures of fused cells secreting antibody of predefined specificity. Nature 256: 495-497); antibody phage display (Winter et al (1994) "Making antibodies by phage display technology.” Annu. Rev. Immunol. 12: 433-455); ribosome display (Schaffitzel et al (1999) "Ribosome display: an in vitro method for selection and evolution of antibodies from libraries.” J. Immunol.
- an antibody that selectively binds to CD248 or MMRN2 we include the meaning that the antibody molecule binds CD248 or MMRN2 with a greater affinity than for an irrelevant polypeptide, such as human serum albumin (HSA).
- HSA human serum albumin
- the antibody binds the CD248 or MMRN2 with at least 5, or at least 10 or at least 50 times greater affinity than for the irrelevant polypeptide.
- the antibody molecule binds the CD248 or MMRN2 with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than for the irrelevant polypeptide.
- Such binding may be determined by methods well known in the art, such as one of the Biacore ® systems.
- the antibody that selectively binds CD248 or MMRN2 does not bind a related polypeptide, such as thrombomodulin in the case of CD248 or multimerin 1 in the case of MMRN2, or that the antibody molecule binds CD248 or MMRN2 with a greater affinity than for the related polypeptide, such as thrombomodulin in the case of CD248 or multimerin 1 in the case of MMRN2.
- the antibody binds the CD248 or MMRN2 with at least 5, or at least 10 or at least 50 times greater affinity than for the related polypeptide.
- the antibody molecule binds the CD248 or MMRN2 with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than for the related polypeptide. Such binding may be determined by methods well known in the art, such as one of the Biacore ® systems.
- the antibodies have an affinity for CD248 or MMRN2 of at least 10 "5 M, 10 "6 M, or 10 "7 M and more preferably 10 "8 M, although antibodies with higher affinities, e.g. 10 "9 M, or higher, may be even more preferred.
- the antibody is one that selectively binds to the CD248 polypeptide.
- the antibody that selectively binds to CD248 binds to the mature peptide (residues 18-757) and not to the signal peptide (residues 1-17).
- the antibody that selectively binds CD248 binds to the extracellular region of CD248 (residues 18-687).
- the antibody may bind to one of the three EGF-like regions (residues 235-272, 273-313 and 314-354), or to the SUSHI domain (residues 162-232), but it is preferred if the antibody binds to the C-type lectin domain (residues 30-156) or the long-loop region of CD248 (residues Q88-C131).
- the antibody that selectively binds to the CD248 polypeptide selectively binds to the MMRN2 binding region of the CD248 polypeptide within the C-type lectin domain.
- the antibody may be one that competes with MMNR2 for specific binding to the CD248 polypeptide. Whether or not a given antibody selectively binds to the MMRN2 binding region or competes with MMRN2 for specific binding to the CD248 polypeptide can be determined using routine methods in the art such as epitope mapping, and competition binding studies. For example, binding of CD248 to the given antibody can be assessed following pre-incubation with varying concentrations of MMRN2.
- the antibody is one that selectively binds to the MMRN2 polypeptide.
- the antibody may be one that competes with CD248 for specific binding to the MMRN2 polypeptide.
- whether or not a given antibody binds to the CD248 binding region of the MMRN2 polypeptide or competes with CD248 for specific binding to the MMRN2 polypeptide can be determined using routine methods in the art such as epitope mapping and competition binding studies.
- CD248 binds to a separate region of MMRN2 from CLEC14A.
- the antibody that selectively binds to the MMRN2 polypeptide and that modulates the interaction between CD248 will not be an antibody that competes with CLEC14A for specific binding to the MMRN2 polypeptide.
- the antibody that selectively binds to the MMRN2 polypeptide may not modulate the interaction between CLEC14A and MMRN2.
- an antibody that selectively binds a specific portion of CD248 or MMRN2 we include the meaning that not only does the antibody selectively bind to the target as described above, the antibody molecule also binds the specified portion of the CD248 or MMRN2 with a greater affinity than for any other portion of it.
- the antibody binds the specified portion with at least 2, or at least 5, or at least 10 or at least 50 times greater affinity than for any other epitope on CD248 or MMRN2. More preferably, the antibody molecule binds the specified portion with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than for than for any other epitope on the CD248 or MMRN2.
- Such binding may be determined by methods well known in the art, such as one of the Biacore ® systems. It is preferred if the antibodies have an affinity for their target epitope on the CD248 or MMRN2 of at least 10 "7 M and more preferably 10 "8 M, although antibodies with higher affinities, e.g. 10 "9 M, or higher, may be even more preferred. Preferably, the antibody selectively binds the particular specified epitope within the CD248 or MMRN2 and does not bind any other epitopes within it.
- the antibody when the antibody is administered to an individual, the antibody binds to the target CD248 or MMRN2 or to the specified portion thereof with a greater affinity than for any other molecule in the individual.
- the antibody binds to (a specified portion of) the CD248 or MMRN2 with at least 2, or at least 5, or at least 10 or at least 50 times greater affinity than for any other molecule in the individual.
- the agent binds the CD248 or MMRN2 (at the specific domain) with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than any other molecule in the individual.
- the antibody molecule selectively binds the CD248 or MMRN2 without significantly binding other polypeptides in the body.
- the agent that modulates the interaction between CD248 and MMRN2 is a small molecule.
- small molecule includes small organic molecules. Suitable small molecules may be identified by methods such as screening large libraries of compounds (Beck- Sickinger & Weber (2001 ) Combinational Strategies in Biology and Chemistry (John Wiley & Sons, Chichester, Hampshire); by structure-activity relationship by nuclear magnetic resonance (Shuker et al (1996) "Discovering high-affinity ligands for proteins: SAR by NMR. Science 274: 1531-1534); encoded self-assembling chemical libraries Melkko et al (2004) “Encoded self-assembling chemical libraries.” Nature Biotechnol. 22: 568-574); DNA-templated chemistry (Gartner et al (2004) "DNA-templated organic synthesis and selection of a library of macrocycles.
- small organic molecules will have a dissociation constant for the polypeptide in the nanomolar range, particularly for antigens with cavities.
- the benefits of most small organic molecule binders include their ease of manufacture, lack of immunogenicity, tissue distribution properties, chemical modification strategies and oral bioavailability. Small molecules with molecular weights of less than 5000 daltons are preferred, for example less than 400, 3000, 2000, or 1000 daltons, or less than 500 daltons.
- the agent of the first aspect of the invention is a portion of MMRN2 or, a variant thereof. Such portions are expected to bind to CD248.
- portion or a variant thereof we include the meaning of any part of the full length native MMRN2 polypeptide or any portion of a variant of the full length native MMRN2 polypeptide provided that the portion modulates (eg inhibits) the interaction between CD248 and MMRN2.
- the portion of MMRN2 is one that reduces the level of binding between CD248 and MMRN2, as compared to the level of binding between CD248 and MMRN2 in the absence of the portion.
- the portion may be any portion of MMRN2 (or a variant thereof) that has less amino acids than the full length wild type polypeptide or a variant thereof.
- human MMRN2 is 949 amino acids in length, and so a portion of human MMRN2 would have 948 amino acids or less, and so on.
- the portion is one that reduces the level of binding between CD248 and MMRN2 by at least 10%, 20%, 30%, 40% or 50%, and more preferably the portion is one that reduces the level of binding between CD248 and MMRN2 by at least 70%, 80%, 90%, 95% or 99%. Most preferably, the portion is one that reduces the level of binding between CD248 and MMRN2 to an undetectable level, or eliminates binding between CD248 and MMRN2.
- a suitable portion is typically a contiguous portion of the MMRN2 polypeptide, or variant thereof, of at least 10 amino acids in length, such as at least, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300 or 350 amino acids in length.
- the portion is between 20 and 350 amino acids in length, such as between 25 and 300 amino acids in length, or 25 and 250 amino acids in length, or 25 and 200 amino acids in length.
- the contiguous portion of the MMRN2 may be larger, and so may be at least 350 amino acids in length, such as 400, 450, 500, 550, 600, 650, 700, 750, 800, 850 or 900 amino acids in length.
- the portion is no more than 900 amino acids in length, such as no more than 800, 700, 600, 500 or 400 amino acids.
- the portion is no more than 350 amino acids in length, such as no more than 300, 250, 240, 230, 220, 210, 200, 190, 180, 170, 160, 150, 140, 130, 120, 1 10, or 100 or 50 amino acids in length.
- the agent is a portion of MMRN2 of 400 amino acids in length or less, such as 300 amino acids or less, or 200 amino acids or less, or 100 amino acids or less, such as 90, 80, 70, 60, 50, 40, 30, 20 or 10 amino acids in length. It is appreciated that the portion is as small as possible, provided that the portion modulates (eg inhibits) the interaction between CD248 and MMRN2.
- the portions of MMRN2 have at least 30% sequence identity to the amino acid sequence of the corresponding portion of the native MMRN2, for example at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or 80% sequence identity, and preferably, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity, over the length of the portion.
- the portion of MMRN2 when the portion of MMRN2 is a portion of human MMRN2, the portion typically has at least 30% sequence identity to the amino acid sequence of the corresponding portion of the wild type human MMRN2, such as at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or 80% sequence identity, and preferably, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity, over the length of the portion.
- the portion of MMRN2 may be a portion of a variant of native MMRN2.
- a variant of native MMRN2 we include the meaning that the variant has at least 30% sequence identity to the wild type MMRN2 polypeptide [e.g.
- human MMRN2 over its entire length, for example at least 40%, 50%, 60%, 70% or 80% sequence identity. More preferably, the variant of MMRN2 has at least 85%, 90%, 95%, 96%, 97%, 98% or at least 99% sequence identity to the wild type MMRN2 polypeptide [e.g. human MMRN2) over its entire length. Generally, the variant of MMRN2 is one that retains one or more of the biological activities of the wild type MMRN2 polypeptide, such as binding to CD248.
- the percent sequence identity between two polypeptides may be determined using any suitable computer program, for example the GAP program of the University of Wisconsin Genetic Computing Group and it will be appreciated that percent identity is calculated in relation to polypeptides whose sequence has been aligned optimally.
- the alignment may alternatively be carried out using the Clustal W program Thompson et al., (1994) Nucleic Acids Res 22, 4673-80).
- the parameters used may be as follows: Fast pairwise alignment parameters: K-tuple(word) size; 1 , window size; 5, gap penalty; 3, number of top diagonals; 5. Scoring method: x percent. Multiple alignment parameters: gap open penalty; 10, gap extension penalty; 0.05. Scoring matrix: BLOSUM.
- the portion of MMRN2 of the first aspect of the invention is one that binds to CD248, and more preferably is one that selectively binds to CD248.
- a portion of MMRN2 that selectively binds to CD248 we include the meaning that the portion of MMRN2 binds CD248 with a greater affinity than for an irrelevant polypeptide such as human serum albumin.
- the portion of MMRN2 binds CD248 with at least 5, or at least 10 or at least 50 times greater affinity than for the irrelevant polypeptide. More preferably, the portion of MMRN2 binds the CD248 with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than for the irrelevant polypeptide.
- Suitable methods of assessing the binding between CD248 and MMRN2 are known in the art and include those described above, such as pull-down assays, enzyme linked immunosorbent assays (ELISA), surface plasmon resonance assays, chip-based assays, immunocytofluorescence, yeast two-hybrid technology and phage display. It is preferred that the portion does not bind to thrombomodulin, or that the portion binds CD248 with a greater affinity than for thrombomodulin. Preferably, the portion binds to CD248 with at least 5, or at least 10 or at least 50 times greater affinity than for thrombomodulin.
- the portion binds to CD248 with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than for thrombomodulin.
- binding may be determined by methods well known in the art, such as one of the Biacore ® systems.
- the portion of MMRN2 of the first aspect of the invention selectively binds to the CD248 mature polypeptide (residues 18-687) and not to the signal peptide (residues 1- 17).
- the inventors have identified a portion of MMRN2 that binds to the CTLD of CD248 (residues 30-156).
- the portion of MMRN2 selectively binds to a region of CD248 corresponding to the region spanning amino acid residues 30-156 of the human CD248 polypeptide.
- the portion binds to the long-loop region of CD248 (corresponding to residues Q88-C131 of the human CD248 polypeptide).
- region corresponding to the region spanning amino acid residues 30-156 of human CD248 we include the meaning of a region in a CD248 orthologue or variant that aligns to the region spanning amino acid residues 30-156 of human CD248 when the sequence of the CD248 orthologue or variant is compared to the human CD248 sequence by alignment.
- the portion of MMRN2 is one that binds to human CD248, the region corresponding to the region spanning amino acid residues 30-156 will be the region in the human CD248 itself.
- MMRN2 selectively binds to the CTLD of CD248, or the region spanning amino acids 30-156, can be determined using routine methods in the art such as ELISA, far-western blotting and chimera studies as described in Example 1.
- MMRN2 that selectively binds to a specific portion of CD248, we include the meaning that not only does the portion of MMRN2 selectively bind to the target as described above, the portion of MMRN2 also binds the specified region of the CD248 with a greater affinity than for any other region of it.
- the portion of MMRN2 binds the specified region with at least 2, or at least 5, or at least 10 or at least 50 times greater affinity than for any other region on CD248. More preferably, the portion of MMRN2 binds the specified region with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than for than for any other region on the CD248.
- the portion of MMRN2 has an affinity for CD248 of at least 10 "3 M, 10 "4 M, 10 "5 M, 10 "6 M or higher.
- the portion of MMRN2 selectively binds the particular specified region within the CD248 and does not bind any other regions within it.
- the portion of MMRN2 selectively binds to the region of CD248 corresponding to the region spanning amino acids residues 30-156 of human CD248, and does not bind to, or makes only weak interactions with, amino acids outside of this region.
- mutating amino acids residues other than residues 30-156 would not be expected to significantly affect binding of the portion of MMRN2 (e.g. reduce it to less than 90%, 80%, 70%, 60% or 50% of the original level of binding).
- mutations outside of the region spanning amino acids 30-156 may affect the overall structure and folding of the CD248 which may have an effect on binding of the portions of MMRN2.
- mutations outside of this region do not affect the global structure or folding of the protein, they are not expected to significantly affect binding of the portion of MMRN2 to CD248.
- the portion of MMRN2 does not bind to a mutant CD248 polypeptide in which the cysteine corresponding to cysteine-94 of human CD248 is mutated and/or the cysteine corresponding to cysteine- 126 of human CLEC14A is mutated.
- the portion of MMRN2 of the first aspect of the invention comprises or consists of the coiled-coil domain of MMRN2, or part thereof.
- the coiled-coil domain of human MMRN2 corresponds to amino acid residues 133-820, and the coiled-coil domain in other MMRN2 orthologues or variants can be readily identified by alignment.
- the portion of MMRN2 may comprise or consist of contiguous portion of at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600 or 650 amino acids of the coiled-coil domain of MMRN2.
- the portion of MMRN2 comprises or consists of a region of MMRN2 corresponding to the region spanning amino acid residues 133-486 of human MMRN2, or a part thereof. As shown in Example 1 , the inventors have identified this portion of MMRN2 binding to CD248.
- the part thereof is at least 10, 20, 30, 35, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140 or 150, 160, 170, 180, 190, 200, 250, 300 or 350 consecutive amino acids in length of the region corresponding to the region spanning amino acid residues 133-486 of human MMRN2. It will be appreciated that the part thereof must be less than 354 amino acids.
- corresponding region we include the meaning of a region which aligns to one of the specified regions of human MMRN2 when a MMRN2 orthologue or variant and human MMRN2 polypeptides are compared by alignment.
- the portion of MMRN2 is a portion of human MMRN2
- the portion of MMRN2 comprises or consists of a region of MMRN2 corresponding to the region spanning amino acid residues 215-478 of human MMRN2, or part thereof.
- the portion of MMRN2 may comprise or consist of a region of MMRN2 corresponding to the region spanning amino acid residues 215-344, or 295-478, or 344-478, or 215-280 or 295-344 or 375-478 of human MMRN2, or a part thereof.
- the part thereof is at least 10, 20, 30, 35, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140 or 150, 160, 170, 180, 190, 200 or 250 consecutive amino acids in length.
- corresponding region we include the meaning of a region which aligns to one of the specified regions of human MMRN2 when a MMRN2 orthologue or variant and human MMRN2 polypeptides are compared by alignment.
- portion of MMRN2 is a portion of human MMRN2, it is preferred if the portion comprises or consists of the region spanning amino acid residues 215-478, 215-344, or 344-478, or 215-280 or 295-344 or 375-478 of human MMRN2, or a part thereof.
- the agent according to the first aspect of the invention is a portion of MMRN2 which does not comprise or consist of a region of MMRN2 corresponding to the region spanning amino acids residues 487-820 of human MMRN2, or part thereof.
- the agent may be a portion of a variant of MMRN2, and so it will be appreciated that these particular portions (e.g. those that comprise or consist of a region corresponding to the region spanning amino acid residues 133-486, 215-478, 215-280, 295-344 or 375-478 of human MMRN2 or part thereof) may have at least 30%, 40%, 50%, 60%, or 70% sequence identity to the amino acid sequence of the corresponding portion of the wild type MMRN2 (e.g. human MMRN2), and preferably 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity.
- wild type MMRN2 e.g. human MMRN2
- the inventors have aligned human MMRN2 with orthologues from different species within the region spanning amino acid residues 133-486, as illustrated in Figure 6.
- the most conserved residues are E178, D187, H240, S242, L252, L255, N261 , L322, V333, Q344, I426, L443, L450, L471 and L478.
- the portion of MMRN2 may comprise one or more (for example at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, or all 16) of amino acids corresponding to any of the following amino acids according to the numbering of human MMRN2 in Figure 7: E178, D187, H240, S242, L252, L255, N261 , L322, V333, Q344, I426, L443, L450, L471 and L478.
- portion eg portion of the MMRN2 that comprises or consists of a region corresponding to the region spanning amino acid residues 133-486 of human MMRN2, or part thereof
- portion e.g portion of the MMRN2 that comprises or consists of a region corresponding to the region spanning amino acid residues 133-486 of human MMRN2, or part thereof
- particular residues listed i.e. E178, D187, H240, S242, L252, L255, N261 , L322, V333, Q344, I426, L443, L450, L471 and L478
- the portion of a variant of MMRN2 comprises all of the recited amino acids.
- the portion of MMRN2 comprises or consists of the amino acid sequence of any of the MMRN2 portions listed in Figure 6, or any part or variant of said portions.
- the portion of MMRN2 comprises or consists of the amino acid sequence of the human portion of MMRN2 listed in Figure 6, or any part or variant of said portion.
- part of said portion we include the meaning of a contiguous part of one of the MMRN2 portions listed in Figure 6 of at least 10 amino acids in length, such as at least, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300 or 350 amino acids in length.
- the part may be no more than 350, 300, 250, 200 or 150 amino acids in length.
- the part of said portion comprises the region of MMRN2 corresponding to the region spanning amino acid residues 133-486 of human MMRN2.
- variant of said portion we include the meaning of a variant having at least 30% sequence identity to one of the MMRN2 portions listed in Figure 6, such as at least 40%, 50%, 60% or 70% sequence identity, and more preferably, 75%, 80%, 85%, 90%, 95% or 99% sequence identity.
- the variant has at least 90% or 95% sequence identity.
- the agent of the first aspect of the invention does not modulate the interaction between MMRN2 and CD93 or the interaction between MMRN2 and CLEC14A.
- the agent is a portion of MMRN2 that does not bind to CD93 and/or CLEC14A.
- the agent according to the first aspect of invention is a portion of CD248, or a variant thereof. Such agents are expected to bind MMRN2.
- a suitable portion is typically a contiguous portion of the CD248 polypeptide, or variant thereof, of at least 10 amino acids in length, such as at least, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300 or 350 amino acids in length.
- the portion is between 10 and 150 amino acids in length, such as between 20 and 125 amino acids in length, or 25 and 100 amino acids in length, or 25 and 75 amino acids in length.
- the contiguous portion of the CD248 may be larger, and so may be at least 350 amino acids in length, such as 400, 450, 500, 550, 600, 650, 700 or 750 amino acids in length.
- the portion is no more than 700 amino acids in length, such as no more than 600, 500, 400 or 300 amino acids.
- the portion is no more than 200 amino acids in length, such as no more than 190, 180, 170, 160, 150, 140, 130, 120, 1 10, or 100, or 50 amino acids in length.
- the agent is a portion of CD248 of 150 amino acids in length or less, such as 127 amino acids or less, or 120 amino acids or less, or 100 amino acids or less, such as 90, 80, 70, 60, 50, 40, 30, 20 or 10 amino acids in length.
- the portions of CD248 have at least 30% sequence identity to the amino acid sequence of the corresponding portion of the native CD248, for example at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or 80% sequence identity, and preferably, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity, over the length of the portion.
- the portion of CD248 when the portion of CD248 is a portion of human CD248, the portion typically has at least 30% sequence identity to the amino acid sequence of the corresponding portion of the wild type human CD248, such as at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or 80% sequence identity, and preferably, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity, over the length of the portion.
- the percent sequence identity between two polypeptides may be determined using the methods described above.
- the portion of CD248 may be a portion of a variant of native CD248.
- a variant of native CD248 we include the meaning that the variant has at least 30% sequence identity to the wild type CD248 polypeptide (e.g. human CD248) over its entire length, for example at least 40%, 50%, 60%, 70% or 80% sequence identity. More preferably, the variant of CD248 has at least 85%, 90%, 95%, 96%, 97%, 98% or at least 99% sequence identity to the wild type CD248 polypeptide (e.g. human CD248) over its entire length.
- the variant of CD248 is one that retains one or more of the biological activities of the wild type CD248 polypeptide, such as binding to MMRN2.
- the portion of CD248 of the first aspect of the invention is one that binds to MMRN2, and more preferably is one that selectively binds to MMRN2.
- a portion of CD248 that selectively binds to MMRN2 we include the meaning that the portion of CD248 binds MMRN2 with a greater affinity than for an irrelevant polypeptide such as human serum albumin.
- the portion of CD248 binds MMRN2 with at least 5, or at least 10 or at least 50 times greater affinity than for the irrelevant polypeptide. More preferably, the portion of CD248 binds the MMRN2 with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than for the irrelevant polypeptide.
- Suitable methods of assessing the binding between CD248 and MMRN2 are known in the art and include those described above, such as pull-down assays, enzyme linked immunosorbent assays (ELISA), surface plasmon resonance assays, chip-based assays, immunocytofluorescence, yeast two-hybrid technology and phage display.
- ELISA enzyme linked immunosorbent assays
- the portion of CD248 of the first aspect of the invention selectively binds to the MMRN2 mature polypeptide (residues 23-949) and not to the signal peptide (residues 1- 22).
- Example 1 the inventors have identified a portion of MMRN2 comprising the coiled-coil domain (residues 133-486) that binds to the CTLD (residues 30-156) of human CD248. Hence, it is preferred if the portion of CD248 selectively binds to a region of MMRN2 corresponding to the region spanning amino acid residues 133-486 of the human MMRN2 polypeptide.
- region corresponding to the region spanning amino acid residues 133-486 of human MMRN2 we include the meaning of a region in a MMRN2 orthologue or variant that aligns to the region spanning amino acid residues 133-486 of human MMRN2 when the sequence of the MMRN2 orthologue or variant is compared to the human MMRN2 sequence by alignment.
- the portion of CD248 is one that binds to human MMRN2
- the region corresponding to the region spanning amino acid residues 133-486 will be the region in the human MMRN2 itself.
- Whether or not a given portion of CD248 selectively binds to the coiled-coil domain of MMRN2, or the region spanning amino acid residues 133-486 in human MMRN2, can be determined using routine methods in the art such as ELISA, far-western blotting and chimera studies as described in Example 1.
- a portion of CD248 that selectively binds to a specific portion of MMRN2 we include the meaning that not only does the portion of CD248 selectively bind to the target as described above, the portion of CD248 also binds the specified region of the MMRN2 with a greater affinity than for any other region of it.
- the portion of CD248 binds the specified region with at least 2, or at least 5, or at least 10 or at least 50 times greater affinity than for any other region on MMRN2. More preferably, the portion of CD248 binds the specified region with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than for than for any other region on the MMRN2. Such binding may be determined by methods well known in the art, such as those described above. It is preferred if the portion of CD248 has an affinity for MMRN2 of at least 10 "3 M, 10 "4 M, 10 "5 M, 10 "6 M or higher.
- the portion of CD248 selectively binds the particular specified region within the MMRN2 and does not bind any other regions within it.
- the portion of CD248 selectively binds to the region of MMRN2 corresponding to the region spanning amino acids residues 133-486 of human MMRN2, and does not bind to, or makes only weak interactions with, amino acids outside of this region.
- mutating amino acids residues other than residues 133-486 would not be expected to significantly affect binding of the portion of CD248 (e.g. reduce it to less than 90%, 80%, 70%, 60% or 50% of the original level of binding).
- mutations outside of the region spanning amino acids 133-486 may affect the overall structure and folding of the MMRN2 which may have an effect on binding of the portions of CD248. However, where the mutations outside of this region do not affect the global structure or folding of the protein, they are not expected to significantly affect binding of the portion of CD248 to MMRN2.
- the portion of CD248 of the first aspect of the invention comprises or consists of the CTLD of CD248, or part thereof, optionally wherein the CTLD of CD248 corresponds to amino acid residues 30-156 of human CD248.
- the CTLD in other CD248 orthologues or variants can be readily identified by alignment.
- the portion of CD248 may comprise or consist of a contiguous portion at least 10, 20, 30, 35, 40, 50, 60, 70, 80, 90, 100, 110, 120 or 127 amino acids of the CTLD of CD248.
- the portion of CD248 comprises or consists of the long-loop region of CD248 or part thereof.
- long-loop region of CD248 we include the meaning of the region corresponding to residues Q88-C131 of the human CD248 polypeptide. Generally, the part thereof, is at least 10, 15, 20, 25, 30, 35, 40 or 44 consecutive amino acids in length of the region corresponding to the region spanning amino acid residues 88- 131 of human CD248.
- corresponding region we include the meaning of a region which aligns to one of the specified regions of human CD248 when a CD248 orthologue or variant and human CD248 polypeptides are compared by alignment.
- the portion of CD248 is a portion of human CD248, it is preferred if the portion comprises or consists of the region spanning amino acid residues 30-156 of human CD248, or a part thereof.
- the portion of CD248 comprises or consists of a region of CD248 corresponding to the region spanning amino acid residues 29-117 or 29-156 of human CD248, or part thereof.
- the portion of CD248 may comprise or consist of a region of CD248 corresponding to the region spanning amino acid residues 83-1 17 of human CD248, or a part thereof.
- the portion of CD248 may comprise or consist of a region of CD248 corresponding to the region spanning amino acid residues 83-156 of human CD248, or a part thereof.
- the part thereof is at least 10, 20, 30, 35, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, or 130 consecutive amino acids in length.
- corresponding region we include the meaning of a region which aligns to one of the specified regions of human CD248 when a CD248 orthologue or variant and human CD248 polypeptides are compared by alignment.
- the agent according to the first aspect of the invention is a portion of CD248 which does not comprise or consist of a region of CD248 corresponding to the region spanning amino acids residues 157-757 of human CD248, or part thereof.
- the agent may be a portion of a variant of CD248, and so it will be appreciated that these particular portions (e.g. those that comprise or consist of a region corresponding to the region spanning amino acid residues 30-156 of human CD248, or part thereof) may have at least 30%, 40%, 50%, 60%, or 70% sequence identity to the amino acid sequence of the corresponding portion of the wild type CD248 (e.g. human CD248), and preferably 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity.
- the inventors have aligned human CD248 with orthologues from different species within the region spanning amino acid residues 18-158 of human CD248, as illustrated in Figure 9.
- the most conserved residues are C29, C34, Y35, L37, R41 , F44, L45, A47, W48, R49, C51 , E53, G56, L58, A59, T60, R62, A67, V70, L73, W84, I85, G86, L87, Q88, R89, Q90, R92, Q93, C94, R98, P99, L100, R101 , G102, F103, W105, T107, G108, D109, Q1 10, D1 1 1 , T1 12, F1 14, T1 15, N 1 16, W1 17, Q1 19, C126, R130, C131 , S137, W142, G145, C147, V151 , D152, G153, Y154, L155 and C156.
- the portion of CD248, or of a variant thereof may comprise one or more (for example at least 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, or all 61 ) of amino acids corresponding to any of the following amino acids according to the numbering of human CD248 in Figure 9: C29, C34, Y35, L37, R41 , F44, L45, A47, W48, R49, C51 , E53, G56, L58, A59, T60, R62, A67, V70, L73, W84, I85, G86, L87, Q88, R89, Q90, R92, Q93, C94, R98, P99, L100, R101 , G102, F103, W105, T107, G108, D109, Q1 10, D1 1 1 , T1 12, F1 14, T1 15, N 1 16, W1 17, Q1 19, C126, R130, C131 , S137, W142, G145, C147,
- the portion of CD248, or of a variant thereof may comprise one or more (for example at least 2, 3, 4, 5, 10, 1 1 , 12, 13, 14 , 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24 or all 25) of amino acids corresponding to any of the following amino acids according to the numbering of human CD248 in Figure 9: S33, F38, R40, R42, E46, A50, R52, E65, E66, S72, G75, A79, L83, Q95, T106, G124, A128, A133, L134, E139, R141 , E144, T148, L149 and A150.
- amino acids corresponding to any of the following amino acids according to the numbering of human CD248 in Figure 9: S33, F38, R40, R42, E46, A50, R52, E65, E66, S72, G75, A79, L83, Q95, T106, G124, A128, A133, L134, E139, R141 , E144, T148, L149 and
- the portion of CD248, or of a variant thereof may comprise one or more (for example at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 or all 86) of amino acids corresponding to any of the following amino acids according to the numbering of human CD248 in Figure 9: C29, C34, Y35, L37, R41 , F44, L45, A47, W48, R49, C51 , E53, G56, L58, A59, T60, R62, A67, V70, L73, W84, I85, G86, L87, Q88, R89, Q90, R92, Q93, C94, R98, P99, L100, R101 , G102, F103, W105, T107, G108, D109, Q1 10, D1 1 1 , T1 12, F1 14, T1 15, N 1 16, W1 17, Q1 19, C126, R130, C131 , S137, W142, G
- portion eg portion of the CD248 that comprises or consists of a region corresponding to the region spanning amino acid residues 30-156 of human CD248, or part thereof
- portion eg portion of the CD248 that comprises or consists of a region corresponding to the region spanning amino acid residues 30-156 of human CD248, or part thereof
- particular residues listed ie C34, Y35, L37, R41 , F44, L45, A47, W48, R49, C51 , E53, G56, L58, A59, T60, R62, A67, V70, L73, W84, I85, G86, L87, Q88, R89, Q90, R92, Q93, C94, R98, P99, L100, R101 , G102, F103, W105, T107, G108, D109, Q1 10, D1 1 1 , T1 12, F1 14, T1 15, N 1 16, W1 17, Q1 19, C126, R130, C131 , S137, W142
- portion eg portion of the CD248 that comprises or consists of a region corresponding to the region spanning amino acid residues 30-156 of human CD248, or part thereof
- portion eg portion of the CD248 that comprises or consists of a region corresponding to the region spanning amino acid residues 30-156 of human CD248, or part thereof
- particular residues listed ie S33, F38, R40, R42, E46, A50, R52, E65, E66, S72, G75, A79, L83, Q95, T106, G124, A128, A133, L134, E139, R141 , E144, T148, L149 and A150 corresponding to the amino acid sequence of human CD248 recited in Figure 8 are not substituted for another amino acid.
- the portion of a variant of CD248 comprises all of the recited amino acids.
- the portion eg portion of the CD248 that comprises or consists of a region corresponding to the region spanning amino acid residues 30-156 of human CD248, or part thereof
- the particular residues listed ie C34, Y35, L37, R41 , F44, L45, A47, W48, R49, C51 , E53, G56, L58, A59, T60, R62, A67, V70, L73, W84, I85, G86, L87, Q88, R89, Q90, R92, Q93, C94, R98, P99, L100, R101 , G102, F103, W105, T107, G108, D109, Q1 10, D1 1 1 , T1 12, F1 14, T1 15, N 1 16, W1 17, Q1 19, C126, R
- the portion of CD248 comprises or consists of the amino acid sequence of any if the CD248 portions listed in Figure 9, or any part or variant of said portions.
- the portion of CD248 comprises or consists of the amino acid sequence of the human portion of CD248 listed in Figure 9, or any part or variant of said portion.
- part of said portion we include the meaning of a contiguous part of one of the CD248 portions listed in Figure 9 of at least 10 amino acids in length, such as at least, 20, 30, 40, 50, 60, 70, 80, 90, 100, 1 10, 120 or 127 amino acids in length. The part may be no more than 120, 100, 80, 60 or 40 amino acids in length.
- the part of said portion comprises the region of CD248 corresponding to the region spanning amino acid residues 30-156 of human CD248.
- variant of said portion we include the meaning of a variant having at least 30% sequence identity to one of the CD248 portions listed in Figure 9, such as at least 40%, 50%, 60% or 70% sequence identity, and more preferably, 75%, 80%, 85%, 90%, 95% or 99% sequence identity.
- the variant has at least 90% or 95% sequence identity.
- a second aspect of the invention provides a portion of MMRN2 or a variant thereof, that binds to CD248.
- the portion of MMRN2 modulates the interaction between CD248 and MMRN2, and so it will be appreciated that all of the preferences and limitations described above in relation to the first aspect of the invention (including all structural and functional properties of the portion of MMRN2) may equally apply to the portion of MMRN2 according to the second aspect of the invention. It is especially preferred if the portion of MMRN2 inhibits the interaction between CD248 and MMRN2.
- a third aspect of the invention provides a portion of CD248 or a variant thereof, that binds to MMRN2.
- the portion of CD248 modulates the interaction between MMRN2 and CD248, and so it will be appreciated that all of the preferences and limitations described above in relation to the first aspect of the invention (including all structural and functional properties of the portion of CD248) may equally apply to the portion of CD248 according to the third aspect of the invention. It is especially preferred if the portion of CD248 inhibits the interaction between CD248 and MMRN2.
- the portion of MMRN2, or the portion of CD248, may be modified so that it can be more easily detected, for example by biotinylating it or by incorporating any detectable label known in the art such as affinity tags, radiolabels, fluorescent labels or enzymatic labels.
- any detectable label known in the art such as affinity tags, radiolabels, fluorescent labels or enzymatic labels.
- the portion of MMRN2, or portion of CD248, are typically made by recombinant DNA technology. Suitable techniques for cloning, manipulation, modification and expression of nucleic acids, and purification of expressed proteins, are well known in the art and are described for example in Sambrook et al (2001) "Molecular Cloning, a Laboratory Manual", 3 rd edition, Sambrook et al (eds), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA. Alternatively, the portion of MMRN2, or portion of CD248 may be made using protein chemistry techniques for example using partial proteolysis (either exolytically or endolytically), or by de novo synthesis.
- amino acid residues described herein may be in the "L” isomeric form. However, residues in the "D” isomeric form can be substituted for any L-amino acid residue, as long as the portion of MMRN2, or portion of CD248 can still inhibit the interaction between MMRN2 and CD248.
- This definition includes, unless otherwise specifically indicated, chemically-modified amino acids, including amino acid analogues (such as penicillamine, 3-mercapto-D-valine), naturally-occurring non-proteogenic amino acids (such as norleucine), and chemically-synthesised compounds that have properties known in the art to be characteristic of an amino acid.
- proteogenic indicates that the amino acid can be incorporated into a protein in a cell through well-known metabolic pathways.
- the portion of CD248, or the portion of MMRN2 can be a peptide "mimetic", i.e. peptidomimetics which mimic the structural features of the portion comprising or consisting of the amino acid sequence as described above.
- Retro-inverso peptides (known as all-D- retro or retro-enantio peptides) are also included, whereby all of the L-amino acids are replaced with D-amino acids and the peptide bonds are reversed.
- Peptidomimetics that are non-peptide in nature can be designed and synthesised by standard organic chemical methods. Peptidomimetics that are non-peptide in nature can be even more advantageous in therapeutic use, in the resistance to degradation, in permeability and in possible oral administration.
- Peptidomimetics are small molecules that can bind to proteins by mimicking certain structural aspects of peptides and proteins. They are used extensively in science and medicine as agonists and antagonists of protein and peptide ligands of cellular and other receptors, and as substrates and substrate analogues for enzymes. Some examples are morphine alkaloids (naturally-occurring endorphin analogues), penicillins (semi-synthetic), and HIV protease inhibitors (synthetic). Such compounds have structural features that mimic a peptide or a protein and as such are recognised and bound by other proteins. Binding the peptidomimetic either induces the binding protein to carry out the normal function caused by such binding (agonist) or disrupts such function (antagonist, inhibitor).
- the agent, portion of MMRN2, or portion of CD248 is one that modulates angiogenesis, for example as demonstrated in an angiogenesis assay, and/or is one that modulates tumour growth, for example as demonstrated in an animal model of cancer (e.g. a mouse with Lewis lung carcinoma).
- Suitable angiogenesis assays are well known in the art and include an aortic ring assay, a sponge angiogenesis assay, an assay of endothelial cell proliferation, an assay of endothelial cell migration and/or an assay of endothelial cell invasion.
- suitable animal models of cancer are well known in the art.
- MMRN2 or CD248 may be modified.
- a derivative of the portion of MMRN2 or CD248 described herein may be useful to inhibit angiogenesis and/or combat cancer in an individual as described in more detail below.
- derivative we include the meaning of the portion of MMRN2 or CD248 having one or more residues chemically derivatised by reaction of a functional side group.
- Such derivatised molecules include, for example, those molecules in which free amino groups have been derivatised to form amine hydrochlorides, p-toluene sulfonyl groups, carbobenzoxy groups, t-butyloxycarbonyl groups, chloroacetyl groups or formyl groups.
- Free carboxyl groups may be derivatised to form salts, methyl and ethyl esters or other types of esters or hydrazides.
- Free hydroxyl groups may be derivatised to form O-acyl or O-alkyl derivatives. Also included as derivatives are those peptide portions that contain one or more naturally occurring amino acid derivatives of the twenty standard amino acids.
- 4-hydroxyproline may be substituted for proline; 5-hydroxylysine may be substituted for lysine; 3-methylhistidine may be substituted for histidine; homoserine may be substituted for serine; and ornithine may be substituted for lysine.
- the derivatisation does not include changes in functional groups which change one amino acid to another.
- the portion of MMRN2 or CD248 may have a stabilising group at one or both termini.
- Typical stabilising groups include amido, acetyl, benzyl, phenyl, tosyl, alkoxycarbonyl, alkyl carbonyl, benzyloxycarbonyl and the like end group modifications.
- Additional modifications include using a "D" amino acid in place of a "L" amino acid at the termini, and amide rather than amino or carboxy termini to inhibit exopeptidase activity.
- the portion of MMRN2 or CD248 may have a capping moiety at one or both ends, preferably a moiety that is less than 100 Da in molecular weight such as an amide group.
- a fourth aspect of the invention provides a fusion protein comprising a polypeptide agent that modulates the interaction between CD248 and MMRN2 according to the first aspect of the invention (which itself may be a portion of MMRN2 or a portion of CD248), a portion of MMRN2 according to the second aspect of the invention, or a portion of CD248 according to the third aspect of the invention wherein the fusion protein does not comprise wild-type MMRN2 orwild-type CD248.
- the fusion protein does not comprise the full- length wild type MMRN2 or CD248 or any naturally occurring variant thereof.
- the fusion protein when the fusion protein comprises a portion of MMRN2, it does not comprise wild type MMRN2, and when the fusion protein comprises a portion of CD248, it does not comprise wild type CD248.
- Antibodies to portions of MMRN2 or CD248 when the fusion protein comprises a portion of MMRN2, it does not comprise wild type MMRN2, and when the fusion protein comprises a portion of CD248, it does not comprise wild type CD248.
- Antibodies to portions of MMRN2 or CD248 Antibodies to portions of MMRN2 or CD248
- a fifth aspect of the invention provides an antibody that selectively binds to a portion of MMRN2 according to the first or second aspect of the invention. Preferences for the portion of MMRN2 include those defined above in relation to the first and second aspects of the invention.
- the antibody binds to the portion of MMRN2 with a greater affinity than for an irrelevant polypeptide such as human serum albumin.
- the antibody binds to the portion of MMRN2 with at least 5, or at least 10 or at least 50 times greater affinity than for the irrelevant polypeptide. More preferably, the antibody binds to the portion of MMRN2 with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than for the irrelevant polypeptide.
- the antibody that selectively binds to the portion of MMRN2 binds to that portion of MMRN2 with a greater affinity than for any other region of the MMRN2 polypeptide (ie amino acid residues of MMRN2 outside of the portion of MMRN2).
- the antibody binds to the portion of MMRN2 with at least 2, or at least 5, or at least 10 or at least 50 times greater affinity than for any other region on MMRN2. More preferably, the antibody binds to the portion of MMRN2 with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than for than for any other region on the MMRN2. It is appreciated that the antibody may bind to amino acid residues outside of the portion of MMRN2. However, the interaction between the antibody and such amino acids is expected to be weaker than that between the antibody and the portion of MMRN2.
- the antibody selectively binds to the coiled-coil domain of MMRN2, or part thereof, optionally wherein the coiled-coil domain of MMRN2 corresponds to amino acid residues 133-820 of human MMRN2.
- the antibody may selectively bind to a region of MMRN2 corresponding to the region spanning amino acid residues 133-486 or 215-478, or 215-280, or 295-344, or 375-478 of human MMRN2, or a part thereof. It is particularly preferred if the antibody selectively binds to a region corresponding to the region spanning amino acid residues 133-486 of human MMRN2, or a part thereof.
- the antibody is one that does not interact with, or makes only weak interactions with, amino acids outside the region defined by amino acid residues 133-486 of human MMRN2.
- mutating amino acid residues other than residues 133- 486 would not be expected to significantly affect antibody binding (e.g. reduce it to less than 90%, 80%, 70%, 60% or 50% of the original level of binding). It will be appreciated therefore that the antibody would typically not interact with, or make only weak interaction with amino acids in the region defined by amino acids residues 487-820 (eg 588-620) of human MMRN2.
- the antibody is one that does not compete with an antibody known to bind elsewhere within MMRN2 for specific binding to an epitope located within amino acid residues 133-486 of MMRN2.
- the antibodies of the invention modulate the interaction between CD248 and MMRN2.
- the antibody may be one that competes with CD248 for specific binding to the MMRN2 polypeptide.
- the antibodies which selectively bind to MMRN2 do not modulate the interaction between CD93 and MMRN2 and/or do not modulate the interaction between CLECL14A and MMRN2.
- the antibodies may not compete with either of CD93 or CLEC14A for binding to MM RN2.
- the antibodies have an affinity for the portion of MMRN2 of at least 10 "5 M, 10 "6 M, or 10 "7 M and more preferably 10 "8 M, although antibodies with higher affinities, e.g. 10 "9 M, or higher, may be even more preferred.
- Antibodies that are especially active at inhibiting tumour angiogenesis are preferred to anti- cancer therapeutic agents, and they can be selected for this activity using methods well known in the art.
- the antibody when the antibody is administered to an individual, the antibody binds to the target portion of MMRN2 with a greater affinity than for any other molecule in the individual.
- the antibody binds to target portion of MMRN2 with at least 2, or at least 5, or at least 10 or at least 50 times greater affinity than for any other molecule in the individual. More preferably, the antibody binds to target portion of MMRN2 with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than any other molecule in the individual.
- the antibody molecule selectively binds the portion of MMRN2 without significantly binding other polypeptides in the body.
- a sixth aspect of the invention provides an antibody that selectively binds to a portion of CD248 according to the first or second aspect of the invention. Preferences for the portion of CD248 include those defined above in relation to the first and third aspects of the invention. It is preferred if the antibody that selectively binds to the portion of CD248 binds to that portion of CD248 with a greater affinity than for any other region of the CD248 polypeptide (ie amino acid residues of CD248 outside of the portion of CD248). Preferably, the antibody binds to the portion of CD248 with at least 2, or at least 5, or at least 10 or at least 50 times greater affinity than for any other region on CD248.
- the antibody binds to the portion of MMR CD248 N2 with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than for than for any other region on the CD248. It is appreciated that the antibody may bind to amino acid residues outside of the portion of CD248. However, the interaction between the antibody and such amino acids is expected to be weaker than that between the antibody and the portion of CD248.
- the antibody selectively binds to the CTLD of CD248, or part thereof, optionally wherein the CTLD of CD248 corresponds to amino acid residues 30-156 of human CD248.
- the antibody may selectively bind to the long-loop region of CD248, corresponding to the region spanning amino acid residues Q88-C131 of human CD248, or a part thereof.
- the antibody is one that does not interact with, or makes only weak interactions with, amino acids outside the region defined by amino acid residues 30-156 of human CD248.
- mutating amino acid residues other than residues 30- 156 would not be expected to significantly affect antibody binding (e.g. reduce it to less than 90%, 80%, 70%, 60% or 50% of the original level of binding).
- the antibody is one that does not compete with an antibody known to bind elsewhere within CD248 for specific binding to an epitope located within amino acid residues 30-156 of CD248. It is preferred if the antibodies have an affinity for the portion of CD248 of at least 10 "5 M, 10 "6 M, or 10 "7 M and more preferably 10 "8 M, although antibodies with higher affinities, e.g. 10 "9 M, or higher, may be even more preferred. Preferably, when the antibody is administered to an individual, the antibody binds to the target portion of CD248 with a greater affinity than for any other molecule in the individual.
- the antibody binds to target portion of CD248 with at least 2, or at least 5, or at least 10 or at least 50 times greater affinity than for any other molecule in the individual. More preferably, the antibody binds to target portion of CD248 with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than any other molecule in the individual. Preferably, the antibody molecule selectively binds the portion of CD248 without significantly binding other polypeptides in the body.
- antibody or "antibody molecule” as used herein throughout the specification includes but is not limited to polyclonal, monoclonal, chimeric, single chain, Fab fragments and fragments produced by a Fab expression library. Such fragments include fragments of whole antibodies which retain their binding activity for a target substance, Fv, F(ab') and F(ab')2 fragments, as well as single chain antibodies (scFv), fusion proteins and other synthetic proteins which comprise the antigen-binding site of the antibody.
- the term also includes antibody-like molecules which may be produced using phage-display techniques or other random selection techniques for molecules which bind to the specified polypeptide or to particular regions of it.
- the term antibody includes all molecules which contain a structure, preferably a peptide structure, which is part of the recognition site (i.e. the part of the antibody that binds or combines with the epitope or antigen) of a natural antibody.
- the antibodies and fragments thereof may be humanised antibodies, which are now well known in the art.
- ScFv molecules we mean molecules wherein the VH and VL partner domains are linked via a flexible oligopeptide.
- Engineered antibodies, such as ScFv antibodies can be made using the techniques and approaches long known in the art. The advantages of using antibody fragments, rather than whole antibodies, are several-fold. The smaller size of the fragments may lead to improved pharmacological properties, such as better penetration to the target site. Effector functions of whole antibodies, such as complement binding, are removed.
- Fab, Fv, ScFv and dAb antibody fragments can all be expressed in and secreted from E. coli, thus allowing the facile production of large amounts of the fragments.
- Whole antibodies, and F(ab')2 fragments are "bivalent". By “bivalent” we mean that the antibodies and F(ab')2 fragments have two antigen combining sites. In contrast, Fab, Fv, ScFv and dAb fragments are usually monovalent, having only one antigen combining site.
- the ScFv may be monovalent, divalent, trivalent or tetravalent.
- the ScFv may be a diabody, tribody, or a tetrabody.
- the two or more VH and VL partner domains in a divalent, trivalent or tetravalent or diabody, tribody, or a tetrabody may be different.
- an ScFv agent may comprise more than 2 or more than 3, for example 4 different VH and VL domains.
- Antibodies may be produced by standard techniques, for example by immunisation with the appropriate (glyco)polypeptide or portion(s) thereof, or by using a phage display library.
- a selected mammal e.g., mouse, rabbit, goat, horse, etc
- an immunogenic polypeptide bearing a desired epitope(s) optionally haptenised to another polypeptide.
- various adjuvants may be used to increase immunological response.
- adjuvants include, but are not limited to, Freund's, mineral gels such as aluminium hydroxide, and surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol. Serum from the immunised animal is collected and treated according to known procedures.
- the polyclonal antibodies can be purified by immunoaffinity chromatography. Techniques for producing and processing polyclonal antisera are well known in the art. Monoclonal antibodies directed against entire polypeptides or particular epitopes thereof can also be readily produced by one skilled in the art. The general methodology for making monoclonal antibodies by hybridomas is well known. Immortal antibody-producing cell lines can be created by cell fusion, and also by other techniques such as direct transformation of B lymphocytes with oncogenic DNA, or transfection with Epstein-Barr virus.
- Monoclonal antibodies may be prepared using any of the well-known techniques which provides for the production of antibody molecules by continuous cell lines in culture. It is preferred if the antibody is a monoclonal antibody. In some circumstances, particularly if the antibody is to be administered repeatedly to a human patient, it is preferred if the monoclonal antibody is a human monoclonal antibody or a humanised monoclonal antibody, which are suitable for administration to humans without engendering an immune response by the human against the administered immunoglobulin.
- non- human antibodies can be "humanised” in known ways, for example by inserting the CDR regions of mouse antibodies into the framework of human antibodies.
- Humanised antibodies can be made using the techniques and approaches described in Verhoeyen et al (1988) Science, 239, 1534-1536, and in Kettleborough et al, (1991) Protein Engineering, 14(7), 773-783.
- Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues.
- the humanised antibody will contain variable domains in which all or most of the CDR regions correspond to those of a non-human immunoglobulin, and framework regions which are substantially or completely those of a human immunoglobulin consensus sequence.
- Completely human antibodies may be produced using recombinant technologies. Typically large libraries comprising billions of different antibodies are used. In contrast to the previous technologies employing chimerisation or humanisation of e.g. murine antibodies this technology does not rely on immunisation of animals to generate the specific antibody. Instead the recombinant libraries comprise a huge number of pre-made antibody variants wherein it is likely that the library will have at least one antibody specific for any antigen. Thus, using such libraries, an existing antibody having the desired binding characteristics can be identified.
- the antibody when the antibody is for administration to a non-human individual, the antibody may have been specifically designed/produced for the intended recipient species.
- WO 98/32845 and Soderlind et al (2000) Nature BioTechnol. 18: 852-856 describe technology for the generation of variability in antibody libraries.
- Antibody fragments derived from this library all have the same framework regions and only differ in their CDRs. Since the framework regions are of germline sequence the immunogenicity of antibodies derived from the library, or similar libraries produced using the same technology, are expected to be particularly low (Soderlind et al, 2000). This property is of great value for therapeutic antibodies, reducing the risk that the patient forms antibodies to the administered antibody, thereby reducing risks for allergic reactions, the occurrence of blocking antibodies, and allowing a long plasma half-life of the antibody.
- antibodies we also include heavy-chain antibodies structurally derived from camelidae antibodies, such as Nanobodies ® (Ablynx). These are antibody-derived therapeutic proteins that contain the structural and functional properties of naturally-occurring heavy- chain antibodies.
- the Nanobody ® technology was developed following the discovery that camelidae (camels and llamas) possess fully functional antibodies that lack light chains. These heavy-chain antibodies contain a single variable domain (VHH) and two constant domains (CH2 and CH3).
- VHH domain is a perfectly stable polypeptide harbouring the full antigen-binding capacity of the original heavy-chain antibody.
- These VHH domains with their unique structural and functional properties form the basis of Nanobodies ® . They combine the advantages of conventional antibodies (high target specificity, high target affinity and low inherent toxicity) with important features of small molecule drugs (the ability to inhibit enzymes and access receptor clefts). Furthermore, they are stable, have the potential to be administered by means other than injection, are easier to manufacture, and can be humanised.
- a seventh aspect of the invention provides a nucleic acid molecule encoding a polypeptide agent that modulates the interaction between CD248 and MMRN2 according to the first aspect of the invention (which itself may be a portion of MMRN2 or portion of CD248), a portion of MMRN2 according to the second aspect of the invention, or a portion of CD248 according to the third aspect of the invention, the fusion protein according to the fourth aspect of the invention, the antibody according to the fifth aspect of the invention that selectively binds to a portion of MMRN2, or the antibody according to the sixth aspect of the invention that selectively binds to a portion of CD248.
- the nucleic acid molecule may be DNA or it may be RNA. Typically, it is comprised in a vector, such as a vector which can be used to express the said polypeptide agent, portion of MMRN2, portion of CD248, or antibody, or fusion protein.
- An eighth aspect of the invention provides a compound comprising an agent according to the first aspect of the invention, or a portion of MMRN2 according to the second aspect of the invention, or a portion of CD248 according to the third aspect of the invention; and a detectable moiety.
- Preferences for the agent, portion of MMRN2, and portion of CD248 include those described above in relation to the relevant aspects of this invention. It will be appreciated that in this aspect of the invention, the agent is one that binds to CD248 or MMRN2.
- Such a compound can be used, in combination with an appropriate detection method, to detect the location of the compound in the individual, and hence to identify the sites and extent of angiogenesis (e.g. tumour angiogenesis) in the individual, as well as inhibition of angiogenesis (e.g. tumour angiogenesis) in the individual.
- angiogenesis e.g. tumour angiogenesis
- angiogenesis e.g. tumour angiogenesis
- a “detectable moiety” we include the meaning that the moiety is one which, when located at the target site following administration of the compound of the invention into a patient, may be detected, typically non-invasively from outside the body, and the site of the target located.
- the compounds of this aspect of the invention are useful in imaging and diagnosis, especially in the imaging and diagnosis of neovasculature of solid tumours, as is described further below.
- the detectable moiety is or comprises a magnetic nano-particle, a radionuclide or a fluorophore.
- the detectable moiety may be a radioactive atom which is useful in imaging.
- Suitable radioactive atoms include technetium-99m or iodine-123 for scintigraphic studies. Others may be selected from the group consisting of: iodine-124; iodine-125; iodine-126; iodine-131 ; iodine-133; indium-1 1 1 ; indium-1 13m, fluorine-18; fluorine-19; carbon-1 1 ; carbon-13; copper-64; nitrogen-13; nitrogen-15; oxygen-15; oxygen-17; arsenic-72; gadolinium; manganese; iron; deuterium; tritium; yttrium-86; zirconium-89; bromine-77, gallium-67; gallium-68, ruthenium-95, ruthenium-97, ruthenium-103, ruthenium-105, mercury-107, rhenium-99m, rhenium-
- Suitable readily detectable moieties include, for example, spin labels for magnetic resonance imaging (MRI) such as iodine-123 again, iodine-131 , indium-1 1 1 , fluorine-19, carbon-13, nitrogen-15, oxygen-17, gadolinium, manganese or iron.
- MRI magnetic resonance imaging
- the compound of the invention must have sufficient of the appropriate atomic isotopes in order for the molecule to be detectable.
- the radio- or other label may be incorporated in the compound in known ways.
- the portion of MMRN2 may be biosynthesised or synthesised by chemical amino acid synthesis using suitable amino acid precursors involving, for example, fluorine-19 in place of hydrogen.
- Labels such as 99m Tc, 123 l, 186 Rh, 188 Rh and 111 ln can, for example, be attached via cysteine residues in the portion of MMRN2, or in the portion of CD248, or antibody thereto.
- Yttrium-90 can be attached via a lysine residue.
- the IODOGEN method (Fraker et al (1978) Biochem. Biophys. Res. Comm. 80, 49-57) can be used to incorporate iodine-123.
- the reference (“Monoclonal Antibodies in Immunoscintigraphy", J.F. Chatal, CRC Press, 1989) describes other methods in detail.
- MMRN2 or CD248 of the invention or their functional fragments can be prepared by methods known to the person skilled in the art.
- the detectable moiety may comprise a detectable enzyme such as peroxidase, alkaline phosphatase, beta-D-galactosidase, glucose oxidase, glucose amylase, carbonic anhydrase, acetylcholinesterase, lysozyme, malate dehydrogenase or glucose 6- phosphate dehydrogenase.
- a detectable enzyme such as peroxidase, alkaline phosphatase, beta-D-galactosidase, glucose oxidase, glucose amylase, carbonic anhydrase, acetylcholinesterase, lysozyme, malate dehydrogenase or glucose 6- phosphate dehydrogenase.
- the detectable moiety may comprise a molecule such as biotin, digoxygenin or 5- bromodeoxyuridine.
- the detectable moiety may comprise a chemiluminescent label such as luminol and the dioxetanes, or a bioluminescent label such as luciferase and luciferin.
- the detectable label may comprise an affinity tag (e.g. histidine tag, Fc tag, BirA tag, maltose-binding protein tag, GST tag, HA tag, FLAG tag); or a directly detectable label (such as a fluorophore, a radioisotope, a contrast agent, or a luminescent label); or an indirectly detectable label (such as an enzyme, an enzyme substrate, an antibody, an antibody fragment, an antigen, a hapten, a ligand, an affinity molecule, a chromogenic substrate, a protein, a peptide, a nucleic acid, a carbohydrate and a lipid).
- an affinity tag e.g. histidine tag, Fc tag, BirA tag, maltose-binding protein tag, GST tag, HA tag, FLAG tag
- a directly detectable label such as a fluorophore, a radioisotope, a contrast agent, or a luminescent label
- the compound comprises a portion of MMRN2 according to the second aspect of the invention and an Fc tag.
- the compound comprises a portion of CD248 according to the third aspect of the invention and an Fc tag.
- the detectable moiety may be one that is useful to detect the agent, or the portion of MMRN2, or the portion of CD248 during its manufacture and/or purification.
- the compound comprising agent, or the portion of MMRN2, or the portion of CD248 and detectable moiety may also comprise a cleavage site, for example to enable removal of a detectable moiety during purification. Any suitable cleavage site known in the art may be used. An example is the tobacco etch virus (TEV) cleavage site.
- TSV tobacco etch virus
- a ninth aspect of the invention provides a polynucleotide encoding a compound as defined above in the eighth aspect of the invention, wherein the agent according to the first aspect of the invention, a portion of MMRN2 according to the second aspect of the invention, or a portion of CD248; and the detectable moiety are fused. It will be appreciated that the ninth aspect of the invention also provides a vector comprising a polynucleotide encoding a compound as defined above in the seventh aspect of the invention, wherein the agent according to the first aspect of the invention, a portion of MMRN2 according to the second aspect of the invention, or a portion of CD248; and the detectable moiety are fused.
- a tenth aspect of the invention provides a compound comprising: an agent according to the first aspect of the invention, a portion of MM RN2 according to the second aspect of the invention, or a portion of CD248 according to the third aspect of the invention; and a cytotoxic moiety.
- Preferences for the agent, portion of MMRN2 and portion of CD248 include those described above in relation to the relevant aspects of the invention.
- the agent is one that binds to CD248 or MMRN2.
- the cytotoxic moiety may be directly or indirectly toxic to cells in neovasculature or cells which are in close proximity to and associated with neovasculature.
- directly cytotoxic we include the meaning that the moiety is one which on its own is cytotoxic.
- indirectly cytotoxic we include the meaning that the moiety is one which, although is not itself cytotoxic, can induce cytotoxicity, for example by its action on a further molecule or by further action on it.
- an indirect cytotoxic moiety may act to recruit an immune cell (e.g. a cytotoxic immune cell such as a cytotoxic T cell), and thereby indirectly induce a cytotoxic effect.
- the cytotoxic moiety is selected from a directly cytotoxic chemotherapeutic agent, a directly cytotoxic polypeptide, a moiety which is able to convert a prodrug into a cytotoxic drug, a radiosensitizer, a directly cytotoxic nucleic acid, a nucleic acid molecule that encodes a directly or indirectly cytotoxic polypeptide or a radioactive atom.
- cytotoxic moieties as well as methods of making the conjugates comprising the cytotoxic moiety, are provided in earlier publications WO 02/36771 , WO 2004/046191 , and WO 2011/027132 incorporated herein by reference.
- the compound may comprise a translocation domain capable of translocating the cytotoxic moiety into the cell, where the cytotoxic moiety is a directly cytotoxic moiety which exerts its cytotoxic effect inside the cell.
- the translocation domain is preferably capable of forming permeable pores in the cellular membrane.
- the domain may be a translocating domain of an enzyme, such as a bacterial toxin or viral protein.
- a cytotoxic moiety may still exert its cytotoxic function outside of the cell without the need to be internalised.
- the cytotoxic moiety may be joined to either of the portion of CD248, or portion of MMRN2, by a linker moiety that contains a cleavage site (eg protease cleavage site).
- the cleavage site When the compound is in the vicinity of a cell expressing either CD248 or MMRN2, the cleavage site may be cleaved, thereby enabling the cytotoxic moiety to be released and exert its cytotoxic function.
- cytotoxic moieties that may be used in this way include pyrrolobenzodiazepine and monomethyl auristatin E (MMAE).
- the cytotoxic moiety is a cytotoxic chemotherapeutic agent.
- Cytotoxic chemotherapeutic agents such as anticancer agents, are well known in the art, and include those described above.
- carbodiimide conjugation (Bauminger & Wilchek (1980) Methods Enzymol. 70, 151-159) may be used to conjugate a variety of agents, including doxorubicin, to proteins.
- Other methods for conjugating a cytotoxic moiety to a protein can also be used.
- cytotoxic moiety may be a cytotoxic peptide or polypeptide moiety by which we include any moiety which leads to cell death.
- Cytotoxic peptide and polypeptide moieties are well known in the art and include, for example, ricin, abrin, Pseudomonas exotoxin, tissue factor and the like. Methods for linking them to targeting moieties such as polypeptides are also known in the art, and include, for example, conventional ways of crosslinking polypeptides and production of the compound as a fusion polypeptide using recombinant DNA techniques. The use of ricin as a cytotoxic moiety is described in Burrows & Thorpe (1993) Proc. Natl. Acad. Sci.
- cytokines such as TNFa, INFy and IL-2, may also be useful as cytotoxic moieties.
- radioactive atoms may also be cytotoxic if delivered in sufficient doses.
- the cytotoxic moiety may comprise a radioactive atom which, in use, delivers a sufficient quantity of radioactivity to the target site so as to be cytotoxic.
- Suitable radioactive atoms include phosphorus-32, iodine-125, iodine-131 , indium-1 11 , rhenium-186, rhenium-188 or yttrium-90, or any other isotope which emits enough energy to destroy neighbouring cells, organelles or nucleic acid.
- the isotopes and density of radioactive atoms in the compound of the invention are such that a dose of more than 4000 cGy (preferably at least 6000, 8000 or 10000 cGy) is delivered to the target site and, preferably, to the cells at the target site and their organelles, particularly the nucleus.
- the radioactive atom may be attached to the agent, portion of MMRN2, or portion of CD248 in known ways.
- EDTA or another chelating agent may be attached to the portion and used to attach 111 In or 90 Y.
- Tyrosine residues may be labelled with 125 l or 3 l.
- the cytotoxic moiety may be a radiosensitizer.
- Radiosensitizers include fluoropyrimidines, thymidine analogues, hydroxyurea, gemcitabine, fludarabine, nicotinamide, halogenated pyrimidines, 3-aminobenzamide, 3-aminobenzodiamide, etanixadole, pimonidazole and misonidazole (see, for example, McGinn et a/ (1996) J. Natl. Cancer Inst. 88, 1193-11203; Shewach & Lawrence (1996) Invest. New Drugs 14, 257-263; Horsman (1995) Acta Oncol.
- the cytotoxic moiety may be a procoagulant factor, such as the extracellular domain of tissue factor (Rippmann et al (2000) "Fusion of the tissue factor extracellular domain to a tumour stroma specific single-chain fragment variable antibody results in an antigen- specific coagulation-promoting molecule.” Biochem J. 349: 805-12; Huang et al (1997) "Tumor infarction in mice by antibody-directed targeting of tissue factor to tumor vasculature.” Science. 275(5299): 547-550.
- tissue factor Rosmann et al (2000) "Fusion of the tissue factor extracellular domain to a tumour stroma specific single-chain fragment variable antibody results in an antigen- specific coagulation-promoting molecule.” Biochem J. 349: 805-12; Huang et al (1997) "Tumor infarction in mice by antibody-directed targeting of tissue factor to tumor vasculature.” Science. 275(5299): 547-550.
- the cytotoxic moiety may be an indirectly cytotoxic polypeptide.
- the indirectly cytotoxic polypeptide is a polypeptide which has enzymatic activity and can convert a relatively non-toxic prodrug into a cytotoxic drug.
- ADEPT Antibody-Directed Enzyme Prodrug Therapy
- the system requires that the targeting moiety locates the enzymatic portion to the desired site in the body of the patient (e.g.
- the object of the approach is to maximise the concentration of drug at the desired site and to minimise the concentration of drug in normal tissues (Senter et al (1988) "Anti-tumor effects of antibody- alkaline phosphatase conjugates in combination with etoposide phosphate" Proc. Natl. Acad. Sci. USA 85, 4842-4846; Bagshawe (1987) Br. J.
- the prodrug is relatively non-toxic compared to the cytotoxic drug. Typically, it has less than 10% of the toxicity, preferably less than 1 % of the toxicity as measured in a suitable in vitro cytotoxicity test.
- the cytotoxic moiety may be one which becomes cytotoxic, or releases a cytotoxic moiety, upon irradiation.
- the boron-10 isotope when appropriately irradiated, releases a particles which are cytotoxic (US 4,348,376; Primus et al (1996) Bioconjug. Chem. 7: 532-535).
- the cytotoxic moiety may be one which is useful in photodynamic therapy such as photofrin (see, for example, Dougherty et al (1998) J. Natl. Cancer Inst. 90, 889-905).
- the cytotoxic moiety is an antibody, such as one that specifically binds to an immune cell, such as a cytotoxic immune cell (e.g. T cell).
- an immune cell such as a cytotoxic immune cell (e.g. T cell).
- the compound of the invention may be useful in targeting an immune synapse, which is considered to be an interface between a target cell (e.g. a cell overexpressing CD248 or MMRN2) and a lymphocyte such as an effector T cell or Natural Killer cell.
- a target cell e.g. a cell overexpressing CD248 or MMRN2
- a lymphocyte such as an effector T cell or Natural Killer cell.
- the compounds of the invention are similar to bispecific T cell engagers (BiTEs), which are well known in the art.
- the cytotoxic moiety is a pyrrolobenzodiazepine dimer (PBD).
- PBDs are potent anticancer agents which have been shown to have broad spectrum anti- tumour activity in vivo. These drugs exert their activity by binding the minor groove of DNA and linking the two DNA strands together in a way that cells find difficult to recognise and repair.
- the compound of the invention may comprise a PBD. Further information on PBDs can be found in Hartley et al, 2012 ⁇ Invest New Drugs 30: 950-958).
- the cytotoxic moiety is monomethyl auristatin E (MMAE).
- An eleventh aspect of the invention provides a polynucleotide encoding a compound as defined above in the tenth aspect of the invention, wherein the agent, the portion of MMRN2, the portion of CD248 and the cytotoxic moiety are polypeptides which are fused.
- the aspect also includes a vector comprising such a polynucleotide.
- a twelfth aspect of the invention provides a chimeric antigen receptor (CAR) comprising (a) a portion of MMRN2 or a variant thereof that binds to CD248 (b) a transmembrane domain; and (c) an intracellular signalling domain.
- CAR chimeric antigen receptor
- CARs are recombinant receptors for antigen, which, in a single molecule, redirect the specificity and function of T lymphocytes and other immune cells (Sadelain et al 2013 Cancer Discov 3(4): 388).
- the general premise for their use in cancer immunotherapy is to rapidly generate tumour-targeted T cells, bypassing the barriers and incremental kinetics of active immunisation.
- CAR-modified T cells acquire supra-physiological properties and act as "living drugs” that may exert both immediate and long-term effects.
- the engineering of CARs into T cells requires that T cells be cultured to allow for transduction and expansion.
- the transduction may utilise a variety of methods, but stable gene transfer is required to enable sustained CAR expression in clonally expanding and persisting T cells.
- any cell surface molecule can be targeted through a CAR, thus overriding tolerance to self-antigens and the antigen recognition gaps in the physiological T cell repertoire that limit the scope of T cell reactivity.
- Various T cell subsets, as well as T cell progenitors and other immune cells such as natural killer cells can be targeted to any unwanted cell by modification with a CAR.
- MMRN2 By a portion of MMRN2 or a variant thereof that binds to CD248, we include the meaning of any portion of the full length native MMRN2 polypeptide or any portion of a variant of the full length native MMRN2 polypeptide, provided that that portion binds to CD248. Preferences for the variant of native MMRN2, for the length of the portion, and for the degree of sequence identity between the portion and corresponding portion of wild type MMRN2 include those described above in relation to the first and second aspects of the invention. It is preferred if the portion of MMRN2 selectively binds to CD248.
- the portion of MMRN2 contained within the CAR is the portion of MMRN2 of the first or second aspect of the invention.
- the portion of MMRN2 may correspond to the region spanning amino acid residues 133-486 of human MMRN2. It will be appreciated that the portion of MMRN2 may need to be attached to a linker or spacer moiety to allow it to bind to CD248.
- linker or spacer moieties are common in CARs that comprise scFv antibodies, and so are well known to the skilled person.
- the portion of MMRN2 is attached to a linker peptide that adopts a random coil conformation, such as peptides that contain alanine or proline or a mixture of alanine plus proline residues.
- linker peptide that adopts a random coil conformation
- Other possible linkers include glycine and/or serine residues.
- the linker peptide may be between 2 and 100 amino acids, such as 2 and 50 amino acids.
- transmembrane domain we include the meaning of any moiety that is capable of being embedded in a lipid membrane.
- transmembrane domain By being embedded in a lipid membrane we include the meaning of the transmembrane domain favourably interacting with the hydrophobic portions of the lipids that make up the lipid membrane. Insertion into lipid membranes may be assayed using any suitable method known in the art, including fluorescence labelling with fluorescence microscopy. Hence, it will be appreciated that the transmembrane domain is one that locates the CAR molecule within the lipid membrane.
- the transmembrane domain comprises the transmembrane domain of a protein (e.g. a transmembrane protein).
- the transmembrane domain can include one or more additional amino acids adjacent to the transmembrane region, such as one or more amino acids associated with the extracellular region of the protein from which the transmembrane domain was derived (e.g. 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 up to 15 amino acids of the extracellular region) and/or one or more additional amino acids associated with the intracellular region of the protein from which the transmembrane protein is derived (e.g. 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 up to 15 amino acids of the intracellular region).
- the transmembrane domain is one that is associated with one of the other domains of the CAR.
- the transmembrane domain comprises the transmembrane portion of an intracellular signalling protein that constitutes at least part of the intracellular signalling domain.
- the transmembrane domain can be selected or modified by amino acid substitution to avoid binding of such domains to the transmembrane domains of the same or different surface membrane proteins, e.g. to minimise interactions with other members of the receptor complex.
- the transmembrane domain is capable of homodimerisation with another CAR on the cell surface.
- the transmembrane domain may be derived either from a natural or from a recombinant source.
- the domain may be derived from any membrane-bound or transmembrane protein.
- the transmembrane domain is capable of signalling to the intracellular domain(s) whenever the CAR has bound to a target.
- a suitable transmembrane domain for use in the invention may include the transmembrane region(s) of the alpha, beta or zeta chain of the T cell receptor, CD28, CD3 epsilon, CD8, CD45 and CD4.
- the transmembrane domain can be attached to the portion of MMRN2 that binds to CD248, optionally via a hinge region.
- the hinge region may comprise one or more immunoglobulin domains. Particular examples include the Fc region of lgG1 and the immunoglobulin-like extracellular regions of CD4 and CD8.
- the hinge may be from a human protein such as human immunoglobulin.
- the transmembrane domain comprises predominantly hydrophobic amino acid residues such as leucine and valine.
- a short oligo- or polypeptide linker such as between 2 and 10 amino acids in length, may form the linkage between the transmembrane domain and the intracellular signalling domain of the CAR.
- the linker may comprise glycine and/or serine residues (eg a glycine-serine doublet).
- intracellular signalling domain we include the meaning of a domain that is capable of activating at least one of the normal functions of the cell in which the CAR is introduced, such as at least one of the normal effector functions of an immune cell (e.g. T cell).
- An effector function refers to a specialised function of a cell.
- the effector function of a T cell for example, may be cytolytic function or helper activity including the secretion of cytokines.
- the intracellular signalling domain may be a portion of a protein which transduces the effector function signal and directs the cell (e.g. T cell) to perform a specialised function.
- the whole intracellular signalling domain can be used; however, it is appreciated that it is not necessary to use the entire domain, provided that whatever part of the signalling domain that is used is still capable of transducing the effector function signal. It will also be appreciated that variants of such intracellular signalling domains with substantially the same or greater functional capability may also be used. By this we include the meaning that the variants should have substantially the same or greater transduction of the effector functional signal.
- substantially the same or greater signal transduction includes at least 80%, 85%, 90%, 95%, 100%, 105%, 1 10%, 1 15%, or 120%, or more of the signal transduction of the unmodified intracellular signalling domain, wherein signal transduction of the unmodified intracellular signalling domain corresponds to 100%.
- Methods for assessing transduction of effector function signal include, for example, assessing the amounts and/or activity of molecules (e.g. proteins such as cytokines) that are indicative of the transduced signal.
- molecules e.g. proteins such as cytokines
- the methods may involve measurement of one or more cytokines secreted by the T-cell, which cytokines are known to have a cytolytic activity (e.g. I FN gamma).
- Another means of assessing the cytolytic function is by a chromium release assay as is well known in the art.
- intracellular signalling domains for use in the CAR of the invention include the cytoplasmic sequences of the T cell receptor (TCR) and co-receptors that act in concert to initiate signal transduction following antigen receptor engagement, as well as any derivative or variant of these sequences and any recombinant sequence that has the same functional capability.
- TCR T cell receptor
- co-receptors that act in concert to initiate signal transduction following antigen receptor engagement
- T cell activation can be said to be mediated by two distinct classes of intracellular signaling sequences: those that initiate antigen-dependent primary activation through the TCR (primary intracellular signaling domains) and those that act in an antigen- independent manner to provide a secondary or costimulatory signal (secondary intracellular signalling domain, such as a costimulatory domain).
- Primary intracellular signaling domains those that initiate antigen-dependent primary activation through the TCR
- secondary intracellular signalling domain such as a costimulatory domain.
- Costimulatory domains promote activation of effector functions and may also promote persistence of the effector function and/or survival of the cell.
- a primary intracellular signaling domain regulates primary activation of the TCR complex either in a stimulatory way, or in an inhibitory way.
- Primary intracellular signaling domains that act in a stimulatory manner may contain signalling motifs which are known as immunoreceptor tyrosine-based activation motifs or ITAMs (e.g. 2, 3, 4, 5 or more ITAMs).
- ITAMs immunoreceptor tyrosine-based activation motifs
- the intracellular signalling domain may comprise one or more ITAMs.
- ITAM containing primary intracellular signaling domains that are of particular use in the invention include those of CD3 zeta, Fc receptor gamma, Fc receptor beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, and CD66d.
- a CAR of the invention comprises an intracellular signaling domain of CD3-zeta.
- one or more ITAMs of the intracellular signalling domain may be modified, for example by mutation.
- the modification may be used to increase or decrease the signalling function of the ITAM as compared to the native ITAM domain.
- the intracellular signalling domain may comprise a primary intracellular signalling domain by itself, or it may comprise a primary intracellular signalling domain in combination with one or more secondary intracellular signalling domains, such as one or more costimulatory signalling domains.
- the intracellular signalling domain of the CAR may comprise the CD3 zeta signalling domain by itself or in combination with one or more other intracellular signalling domains such as one or more costimulatory signalling domains.
- the costimulatory signaling domain refers to a portion of the CAR comprising the intracellular domain of a costimulatory molecule.
- a costimulatory molecule may be a cell surface molecule other than an antigen receptor or its ligands that is required for an efficient response of immune cells (eg lymphocytes) to an antigen. Examples of such molecules include CD28, 4-1 BB (CD137), OX40, ICOS, DAP10, CD27, CD30, CD40, ICOS, lymphocyte function-associated antigen- 1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7- H3, and a ligand that specifically binds with CD83, and the like.
- CD27 co- stimulation has been demonstrated to enhance expansion, effector function, and survival of human CART cells in vitro and augments human T cell persistence and anti-tumour activity in vivo (Song et al. Blood. 2012; 1 19(3):696-706).
- the intracellular signaling sequences within the intracellular portion of the CAR of the invention may be linked to each other in a random or specified order.
- a short oligo- or polypeptide linker for example, between 2 and 10 amino acids (eg 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids) in length may form the linkage between intracellular signaling sequences.
- a glycine- serine doublet can be used as a suitable linker.
- a single amino acid such as an alanine or a glycine, can be used as a suitable linker.
- the intracellular signaling domain is designed to comprise two or more, for example 3, 4, 5, or more, costimulatory signalling domains.
- the two or more, e.g., 2, 3, 4, 5, or more, costimulatory signaling domains are separated by a linker molecule, such as one described herein.
- the intracellular signaling domain comprises two costimulatory signaling domains.
- the linker molecule is a glycine residue. In some embodiments, the linker is an alanine residue.
- the intracellular portion of the CAR comprises the signalling domain of CD3 zeta and the signalling domain of CD28. In another embodiment, the intracellular portion of the CAR comprises the signaling domain of CD3-zeta and the signaling domain of 4-1 BB.
- the intracellular portion of the CAR comprises the signaling domain of CD3-zeta and the signaling domain of OX40.
- the intracellular portion of the CAR comprises the signaling domain of CD3-zeta and the signaling domain of ICOS.
- the intracellular portion of the CAR comprises the signaling domain of CD3-zeta and the signaling domain of DAP10.
- the intracellular portion of the CAR comprises the signalling domain of CD3-zeta, the signalling domain of 4-1 BB and the signalling domain of OX40. In another embodiment, the intracellular portion of the CAR comprises the signaling domain of 4-1 BB and the signaling domain of CD28.
- the intracellular portion of the CAR comprises the signaling domain of CD3-zeta, the signaling domain of 4-1 BB and the signalling domain of CD28.
- the CAR further comprises a leader sequence.
- a leader sequence we include the meaning of a peptide sequence that directs the CAR to the cell membrane.
- the CAR when it is a chimeric fusion protein, it may contain a leader sequence at the amino-terminus (N-ter) of the portion of MMRN2 that binds CD248.
- the leader sequence is cleaved from the portion of MMRN2 during cellular processing and localisation of the CAR to the cellular membrane.
- An exemplary leader sequence is the oncostatin M leader sequence MGVLLTQRTLLSLVLALLFPSMAS (SEQ ID No: 5) or a variant thereof (e.g. one having at least 70%, 75%, 80%, 85%, 90%, 95% or 99% sequence identity to said sequence); however, other leader sequences will also be known to a person skilled in the art, such as the leader sequence from CD8.
- the core of a leader sequence typically contains a stretch of hydrophobic amino acids that has a tendency to form a single alpha-helix.
- the CAR may comprise a suicide moiety.
- a suicide moiety we include the meaning of a molecule which possesses an inducible capacity to lead to the death of the cell in whose cellular membrane the CAR resides (eg T cell). In this way, the effect that the CARs have on a subject can be tightly controlled via selective deletion of the cells that comprise them.
- the suicide moiety comprises the epitope of an antibody that is either directly or indirectly cytotoxic.
- Antibodies that are directly cytotoxic include lytic antibodies such as Rituximab, which binds to CD20.
- the CAR may comprise a CD20 epitope.
- Antibodies may also be indirectly cytotoxic by being conjugated to one or more cytotoxic moieties.
- Suicide moieties are well known in the art and are reviewed in Jones et al (Front Pharmacol 2014, 5: 254).
- An example is inducible caspase-9.
- the CAR comprises a portion of MMRN2 of the first or second aspects of the invention, a transmembrane domain, and an intracellular signalling domain (e.g. an intracellular signalling domain comprising a primary signalling domain such as CD3 zeta, and optionally one or more costimulatory domains such as CD28, 4-1 BB, OX40, ICOS and DAP10).
- the CAR comprises a leader sequence (e.g. oncostatin M leader sequence), a portion of MMRN2 of the first or second aspects of the invention, a hinge region, a transmembrane domain, and an intracellular signalling domain (e.g. an intracellular signalling domain comprising a primary signalling domain such as CD3 zeta, and optionally one or more costimulatory domains such as CD28, 4-1 BB, OX40, ICOS and DAP10).
- a thirteenth aspect of the invention provides a polynucleotide encoding a CAR as defined above in relation to the twelfth aspect of the invention. It will be appreciated that the thirteenth aspect of the invention also provides a vector comprising a polynucleotide encoding a CAR defined above.
- the nucleic acid molecule of any of the fourth, seventh, ninth, eleventh and thirteenth aspects of the invention may be DNA or RNA, and is preferably DNA, in particular circumstances. In other circumstances, e.g. when employing cell therapy, RNA may be preferred. It may comprise deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and/or their analogues, or any substrate that can be incorporated into a polymer by DNA or RNA polymerase, or by a synthetic reaction.
- a polynucleotide may comprise modified nucleotides, such as methylated nucleotides and their analogues.
- a fourteenth aspect of the invention provides a vector comprising the polynucleotide of any of the fourth, seventh, ninth, eleventh and thirteenth aspects of the invention.
- a fifteenth aspect of the invention provides a host cell comprising a polynucleotide according to any of the fourth, seventh, ninth, eleventh and thirteenth aspects of the invention, and/or an agent according to the first aspect of the invention, or a MMRN2 portion according to second aspect of the invention, or a CD248 portion according to third aspect of the invention, or an antibody according to the fifth or sixth aspects of the invention, or a CAR according to the twelfth aspect of the invention, or a vector according to the fourteenth aspect of the invention.
- the vector can be of any type, and refers to a nucleic acid that comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell.
- Numerous vectors are known in the art including linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses.
- the term vector includes an autonomously replicating plasmid or a virus.
- the term should also be construed to further include non-plasmid and non-viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, a polylysine compound, liposome, and the like.
- the vector is an expression vector.
- Expression vectors contain elements (e.g., promoter, signals of initiation and termination of translation, as well as appropriate regions of regulation of transcription) which allow the expression and/or the secretion of products in a host cell.
- Expression vectors include all those known in the art, including cosmids, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate the recombinant polynucleotide.
- Typical cloning vectors contain transcription and translation terminators, initiation sequences, and promoters useful for regulation of the expression of the desired nucleic acid sequence.
- the vector can be suitable for replication and integration in eukaryotes, and/or it may be suitable for expression in prokaryotes, such as in bacterial species.
- the vector is capable of expressing the nucleic acids of the invention in mammalian cells (eg human cells), such as mammalian (eg human) immune cells (eg T cells), for example for the expression of CARs.
- mammalian cells eg human cells
- the nucleic acids of the invention can also be cloned into a number of types of vectors including a plasmid, a phagemid, a phage derivative, an animal virus, and a cosmid.
- Vectors of particular interest include expression vectors, replication vectors, probe generation vectors, and sequencing vectors.
- host cells can be used, such as a prokaryotic cell, for example, E. coli, or a eukaryotic cell, for example a mammalian cell such as Chinese Hamster Ovary (CHO) cell, or a yeast, insect or plant cell.
- a prokaryotic cell for example, E. coli
- a eukaryotic cell for example a mammalian cell such as Chinese Hamster Ovary (CHO) cell, or a yeast, insect or plant cell.
- CHO Chinese Hamster Ovary
- yeast yeast, insect or plant cell.
- the host cell is a stable cell line.
- the host cell may be a cell obtained from a patient, e.g. a T cell or other immune cell, as discussed further below.
- the invention also includes methods for making an agent, a portion of MMRN2, a portion of CD248, a fusion protein, an antibody that selectively binds to the MMRN2 portion, an antibody that selectively binds to the CD248 portion, or a CAR according to the invention.
- the invention comprises expressing in a suitable host cell a recombinant vector encoding the agent, a portion of MMRN2, a portion of CD248, a fusion protein, an antibody that selectively binds to the MMRN2 portion, an antibody that selectively binds to the CD248 portion, or a CAR, and recovering the product.
- Methods for expressing and purifying polypeptides are very well known in the art.
- the invention also provides a method of producing a cell comprising introducing a polynucleotide molecule according to the fourth, seventh, ninth, eleventh or thirteenth aspects of the invention, or a vector according to the fourteenth aspect of the invention.
- Suitable methods of introducing polynucleotide molecules and/or vectors include those described above, and are generally known in the art. Particularly, electroporation may be used.
- host cells can be used, such as a prokaryotic cell, for example, E. coli, or a eukaryotic cell, for example a mammalian cell such as Chinese Hamster Ovary (CHO) cell, or a yeast, insect or plant cell.
- a prokaryotic cell for example, E. coli
- a eukaryotic cell for example a mammalian cell such as Chinese Hamster Ovary (CHO) cell, or a yeast, insect or plant cell.
- a host cell being used in a method to produce an agent, a portion of MMRN2, a portion of CD248, a fusion protein, an antibody of the invention, or a CAR of the invention
- the host cell itself may be used directly in therapy, for example in cell mediated therapy.
- the invention provides a method of treatment, comprising administering a host cell according to the invention to the subject, for example for use in medicine or for combating cancer and/or for modulating angiogenesis.
- the invention also provides a host cell comprising a polynucleotide molecule according to fourth, seventh, ninth, eleventh and thirteenth aspects of the invention, eg an RNA molecule, or a vector according to the thirteenth aspect of the invention, eg a gamma retrovirus or a lentivirus, for use in medicine, for example for use in the treatment of cancer.
- the invention also provides for the use of said host cell in the preparation of a medicament for use in medicine, for example for use in the treatment of cancer.
- Preferences for the agent, portion of MMRN2, portion of CD248, antibodies, CAR, and fusion protein are as outlined above.
- the host cell is a mammalian cell (eg a human cell).
- the host cell is an immune cell, preferably a mammalian immune cell such as a human immune cell. This is particularly relevant when the host cell of the invention expresses a CAR of the invention.
- Immune cells include T cells and natural killer (NK) cells.
- the T cell may be any of an alpha-beta T cell, a gamma-delta T cell, a memory T cell (e.g. a memory T cell with stem cell-like properties).
- the NK cell may be an invariant NK cell.
- the immune cell is a memory T cell with stem cell like properties.
- the cell may be "autologous” or “allogeneic”, as described further below.
- Immune cells such as T cells can be obtained from a number of sources peripheral blood mononuclear cells, bone marrow, lymph node tissue, cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors. Any number of cell lines (eg immune cell lines such as T cell lines) available in the art, may also be used.
- immune cells are obtained from a unit of blood collected from a subject using any suitable techniques known in the art such as FicollTM separation.
- cells from the circulating blood of a subject are obtained by apheresis.
- the apheresis product typically contains lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and platelets.
- lymphocytes including T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and platelets.
- the cells collected by apheresis may be washed to remove the plasma fraction and to place the cells in an appropriate buffer or media for subsequent processing steps.
- the cells may be washed with phosphate buffered saline (PBS).
- PBS phosphate buffered saline
- the wash solution lacks calcium and may lack magnesium or may lack many if not all divalent cations. Initial activation steps in the absence of calcium can lead to magnified activation.
- a washing step may be accomplished by methods known to those in the art, such as by using a semi- automated "flow-through" centrifuge (for example, the Cobe 2991 cell processor, the Baxter CytoMate, or the Haemonetics Cell Saver 5) according to the manufacturer's instructions.
- the cells may be resuspended in a variety of biocompatible buffers, such as, for example, Ca-free, Mg-free PBS, PlasmaLyte A, or other saline solution with or without buffer.
- the undesirable components of the apheresis sample may be removed and the cells directly resuspended in culture media.
- T cells are isolated from peripheral blood lymphocytes by lysing the red blood cells and depleting the monocytes, for example, by centrifugation through a PERCOLLTM gradient or by counter-flow centrifugal elutriation.
- Specific subpopulations of T cells such as CD3+, CD28+, CD4+, CD8+, CD45RA+, and CD45RO+T cells, may be further isolated by positive or negative selection techniques known in the art.
- T cells may be isolated by incubation with anti-CD3/anti-CD28 (e.g., 3x28)-conjugated beads, such as DYNABEADS® M-450 CD3/CD28 T, for a time period sufficient for positive selection of the desired T cells.
- a population of T cells may be enriched by negative selection, for instance by a combination of antibodies directed to surface markers unique to the negatively selected cells. Cell sorting and/or selection via negative magnetic immunoadherence or flow cytometry may be used.
- cells derived from subjects that are to be modified to express the CAR of the invention may be stored for a period of time prior to their use (see, for example, therapeutic methods below).
- the cells may be frozen, optionally after they have been washed, or they may be incubated under suitable conditions for them to remain viable until needed (e.g. on a rotator at 2-10°C or at room temperature). In this way, the cells can be stored until such time as they might be needed. They may be stored in an unmodified state (i.e. wherein they do not express the CAR of the invention) or in a modified state (i.e. wherein they have been modified to express the CAR of the invention).
- the cells may be activated and expanded generally using methods known in the art.
- T cells may be expanded by contact with a surface having attached thereto an agent that stimulates a CD3/TCR complex associated signal and a ligand that stimulates a costimulatory molecule on the surface of the T cells.
- T cell populations may be stimulated as described herein, such as by contact with an anti-CD3 antibody, or antigen-binding fragment thereof, or an anti-CD2 antibody immobilized on a surface, or by contact with a protein kinase C activator (eg bryostatin) in conjunction with a calcium ionophore.
- a protein kinase C activator eg bryostatin
- a ligand that binds the accessory molecule is used for co-stimulation of an accessory molecule on the surface of the T cells.
- a population of T cells can be contacted with an anti-CD3 antibody and an anti-CD28 antibody, under conditions appropriate for stimulating proliferation of the T cells.
- an anti-CD28 antibody include 9.3, B-T3, XR-CD28 (Diaclone, Besancon, France) can be used as can other methods commonly known in the art (Berg et al. , Transplant Proc. 30(8):3975-3977, 1998; Haanen et al. , J. Exp. Med. 190(9): 13191328, 1999; Garland et al. , J. Immunol Meth. 227(1 - 2):53-63, 1999).
- T cells that have been exposed to varied stimulation times may exhibit different characteristics.
- typical blood or apherised peripheral blood mononuclear cell products have a helper T cell population (TH, CD4+) that is greater than the cytotoxic or suppressor T cell population (TC, CD8+).
- TH, CD4+ helper T cell population
- TC cytotoxic or suppressor T cell population
- TH, CD4+ helper T cell population
- TC cytotoxic or suppressor T cell population
- TC cytotoxic or suppressor T cell population
- T cells may be expanded prior to transduction with a polynucleotide or vector of the invention.
- the cell that expresses the agent, a portion of MMRN2, a portion of CD248 or antibodies of the invention or CAR of the invention is further modified to comprise or express one or more other agents that enhance the activity of the cell (e.g. T cell) expressing the agent, a portion of MMRN2, a portion of CD248 or antibodies of the invention or CAR of the invention.
- the other agent may be an agent that inhibits an inhibitory molecule that is known to decrease the ability of the CAR-expressing cell to mount an effective immune response.
- inhibitory molecules examples include PD1 , PD-L1 , CTLA4, TIM3, LAG3, VISTA, BTLA, TIGIT, LAI R1 , CD160, 2B4 and TGFR beta.
- the agent that inhibits the inhibitory molecule may comprise a first polypeptide, e.g. an inhibitory molecule, associated with a second polypeptide that provides a positive signal to the cell, e.g. an intracellular signalling domain described herein.
- the other agent may be a pro-inflammatory or pro-proliferative cytokine.
- the purpose of such cytokines may be to provide autocrine support to enhance the function, proliferation and/or persistence of antibody-expressing cells, and/or favourably alter the tumour microenvironment and recruit endogenous innate and cognate immune effects.
- an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MMRN2 portion according to the second aspect of the invention, a CD248 portion according to the third aspect of the invention, a fusion protein according to the fourth aspect of the invention, an antibody according to the fifth or sixth aspects of the invention, a polynucleotide according to any of fourth, seventh, ninth, eleventh and thirteenth aspects of the invention, a vector according to the fourteenth aspect of the invention, a cell according to the fifteenth aspect of the invention, a compound according to the eighth or tenth aspects of the invention, a CAR according to the twelfth aspect of the invention, have therapeutic potential.
- These molecules are collectively referred to herein as the agent of the invention.
- a sixteenth aspect of the invention provides the agent of the invention (ie an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MMRN2 portion according to the second aspect of the invention, a CD248 portion according to the third aspect of the invention, a fusion protein according to the fourth aspect of the invention, an antibody according to the fifth or sixth aspects of the invention, a polynucleotide according to any of fourth, seventh, ninth, eleventh and thirteenth aspects of the invention, a vector according to the fourteenth aspect of the invention, a cell according to the fifteenth aspect of the invention, a compound according to the eighth or tenth aspects of the invention, a CAR according to the twelfth aspect of the invention) for use in medicine.
- the agent of the invention ie an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MMRN2 portion according to the second aspect of the invention, a CD2
- a seventeenth aspect of the invention provides a method of modulating angiogenesis in an individual, the method comprising administering to the individual the agent of the invention (ie an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MMRN2 portion according to the second aspect of the invention, a CD248 portion according to the third aspect of the invention, a fusion protein according to the fourth aspect of the invention, an antibody according to the fifth or sixth aspects of the invention, a polynucleotide according to any of fourth, seventh, ninth, eleventh and thirteenth aspects of the invention, a vector according to the fourteenth aspect of the invention, a cell according to the fifteenth aspect of the invention, a compound according to the eighth or tenth aspects of the invention, a CAR according to the twelfth aspect of the invention).
- the agent of the invention ie an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MM
- This aspect of the invention includes the agent of the invention (ie an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MMRN2 portion according to the second aspect of the invention, a CD248 portion according to the third aspect of the invention, a fusion protein according to the fourth aspect of the invention, an antibody according to the fifth or sixth aspects of the invention, a polynucleotide according to any of fourth, seventh, ninth, eleventh and thirteenth aspects of the invention, a vector according to the fourteenth aspect of the invention, a cell according to the fifteenth aspect of the invention, a compound according to the eighth or tenth aspects of the invention, a CAR according to the twelfth aspect of the invention) for use in modulating angiogenesis in an individual.
- the agent of the invention ie an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MMRN2 portion according to the second aspect of the invention,
- the aspect of the invention also includes the use of the agent of the invention (i.e. an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MMRN2 portion according to the second aspect of the invention, a CD248 portion according to the third aspect of the invention, a fusion protein according to the fourth aspect of the invention, an antibody according to the fifth or sixth aspects of the invention, a polynucleotide according to any of fourth, seventh, ninth, eleventh and thirteenth aspects of the invention, a vector according to the fourteenth aspect of the invention, a cell according to the fifteenth aspect of the invention, a compound according to the eighth or tenth aspects of the invention, a CAR according to the twelfth aspect of the invention) in the preparation of a medicament for modulating angiogenesis in an individual.
- the agent of the invention i.e. an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a
- the agent, portion of MMRN2, or portion of CD248 are ones that inhibit the interaction between MMRN2 and CD248, and that angiogenesis is inhibited.
- the invention also includes an in vitro or ex vivo method of modulating angiogenesis (e.g. tumour angiogenesis) comprising administering to tissue or cells in vitro or ex vivo the agent of the invention (i.e.
- an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MMRN2 portion according to the second aspect of the invention, a CD248 portion according to the third aspect of the invention, a fusion protein according to the fourth aspect of the invention, an antibody according to the fifth or sixth aspects of the invention, a polynucleotide according to any of fourth, seventh, ninth, eleventh and thirteenth aspects of the invention, a vector according to the fourteenth aspect of the invention, a cell according to the fifteenth aspect of the invention, a compound according to the eighth or tenth aspects of the invention, a CAR according to the twelfth aspect of the invention).
- the agent is an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MMRN2 portion according to the second aspect of the invention, a CD248 portion according to the third aspect of the invention, an antibody according to the fifth or sixth aspects of the invention, preferences for which include those described above.
- the cells may be established cell lines, or cells that have been removed from an individual.
- the tissue or cells are preferably mammalian tissue or cells (e.g. endothelial tissue or cells), and most preferably are human tissue or cells.
- the agent may be administered to an angiogenesis model ex vivo. Suitable angiogenesis assays include assays for endothelial cell proliferation, migration and invasion, sponge assays and aortic ring assays. Further angiogenesis assays are described herein.
- modulating angiogenesis we include the meaning of reducing or enhancing the rate or level of angiogenesis.
- the enhancement can be a low level increase of about 10%, or about 20%, or about 30%, or about 40% of the rate or level of angiogenesis.
- the enhancement is a medium level increase of about 50%, or about 60%, or about 70%, or about 80% increase of the rate or level of angiogenesis.
- the reduction can be a low level reduction of about 10%, or about 20%, or about 30%, or about 40% of the rate or level of angiogenesis.
- the reduction is a medium level reduction of about 50%, or about 60%, or about 70%, or about 80% reduction of the rate or level of angiogenesis.
- the reduction is a high level reduction of about 90%, or about 95%, or about 99%, or about 99.9% of the rate or level of angiogenesis.
- inhibition can also include the elimination of angiogenesis or its reduction to an undetectable level.
- tumour angiogenesis typically, the angiogenesis that is inhibited is tumour angiogenesis.
- the individual may have a solid tumour, which can be treated by inhibiting tumour angiogenesis, ie the solid tumour is associated with new blood vessel production.
- tumour is to be understood as referring to all forms of neoplastic cell growth including, but not limited to, tumours of the breast, ovary, liver, bladder, prostate, kidney, pancreas, stomach, oesophagus, lung and thyroid.
- angiogenesis of a lung or pancreatic tumour may be inhibited.
- the tumour is associated with undesirable neovasculature formation and the agent reduces this to a useful extent.
- the reduction of undesirable neovasculature formation may halt the progression of the tumour and can lead to a clinically useful reduction of tumour size and growth, e.g. a reduction in tumour size or growth rate of at least 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80 or 90%.
- the inhibition of tumour angiogenesis can be used to treat the tumour, for example, to prevent the (further) growth of the tumour, to prevent the spread of the tumour (metastasis), or to reduce the size of the tumour.
- the size of a tumour can be measured by imaging the tumour e.g. using an appropriate antibody specific for the tumour being targeted.
- the growth rate of a tumour can be determined by measuring tumour size over a time period (e.g. before and after treatment, to determine whether treatment results in a reduction in the growth rate).
- the methods and medicaments of the invention are used to treat humans, in which case the agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), the MMRN2 portion, or the CD248 portion is a portion of human MMRN2 or CD248.
- the portion of MMRN2 or portion of CD248 is one that is a portion of MMRN2 or portion of CD248 from the other species. It is preferred if the agent is one that modulates the interaction between human MMRN2 and human CD248, when used to treat a human, and so on. Inhibition of angiogenesis may be useful in combating any disease or condition involving unwanted, undesirable or inappropriate angiogenesis.
- Such conditions include tumours/cancer, psoriasis, menorrhagia, endometriosis, arthritis (both inflammatory and rheumatoid), macular degeneration, Paget's disease, retinopathy and its vascular complications (including proliferative and of prematurity, and diabetic retinopathy), benign vascular proliferations, fibroses, obesity and inflammation.
- an eighteenth aspect of the invention provides a method of combating a disease or condition in an individual, selected from the group consisting of cancer, psoriasis, menorrhagia, endometriosis, arthritis (both inflammatory and rheumatoid), macular degeneration, Paget's disease, retinopathy and its vascular complications (including proliferative and of prematurity, and diabetic retinopathy), benign vascular proliferations, fibroses, obesity and inflammation, the method comprising administering to the individual an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MMRN2 portion according to the second aspect of the invention, a CD248 portion according to the third aspect of the invention, a fusion protein according to the fourth aspect of the invention, an antibody according to the fifth or sixth aspects of the invention, a polynucleotide according to any of fourth, seventh, ninth, eleventh and thirteenth aspects of the invention, a
- This aspect of the invention includes an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MMRN2 portion according to the second aspect of the invention, a CD248 portion according to the third aspect of the invention, a fusion protein according to the fourth aspect of the invention, an antibody according to the fifth or sixth aspects of the invention, a polynucleotide according to any of fourth, seventh, ninth, eleventh and thirteenth aspects of the invention, a vector according to the fourteenth aspect of the invention, a cell according to the fifteenth aspect of the invention, a compound according to the eighth or tenth aspects of the invention, a CAR according to the twelfth aspect of the invention, for use in combating a disease or condition in an individual, selected from the group consisting of cancer, psoriasis, menorrhagia, endometriosis, arthritis (both inflammatory and rheumatoid), macular degeneration, Paget's disease, retin
- the aspect of the invention also includes the use of an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MMRN2 portion according to the second aspect of the invention, a CD248 portion according to the third aspect of the invention, a fusion protein according to the fourth aspect of the invention, an antibody according to the fifth or sixth aspects of the invention, a polynucleotide according to any of fourth, seventh, ninth, eleventh and thirteenth aspects of the invention, a vector according to the fourteenth aspect of the invention, a cell according to the fifteenth aspect of the invention, a compound according to the eighth or tenth aspects of the invention, a CAR according to the twelfth aspect of the invention, in the preparation of a medicament for combating a disease or condition in an individual, selected from the group consisting of cancer, psoriasis, menorrhagia, endometriosis, arthritis (both inflammatory and rheumatoid), macular degeneration,
- the agent, portion of MMRN2, or portion of CD248 are ones that inhibit the interaction between MMRN2 and CD248, and that angiogenesis is inhibited.
- Preferences for the agent, MMRN2 portion, CD248 portion, fusion protein, antibody, polynucleotide, vector, cell, compound, and CAR in all medical use aspects of the invention include those described above in relation to the relevant aspect of the invention.
- the MMRN2 portion may comprise the region corresponding to amino acids 133-486 of human MMRN2.
- the CD248 portion may comprise the CTLD, corresponding to residues 30-156 of human CD248.
- the antibody may be an antibody that selectively binds such portions of MMRN2 or CD248.
- the invention provides a method of treating an individual who has a disease in which angiogenesis contributes to pathology, the method comprising the step of administering to the individual an agent of the invention (eg an agent, a portion of MMRN2, a portion of CD248, a fusion protein, an antibody that selectively binds to the MMRN2 portion, an antibody that selectively binds to the CD248 portion, or a CAR according to the invention).
- an agent of the invention eg an agent, a portion of MMRN2, a portion of CD248, a fusion protein, an antibody that selectively binds to the MMRN2 portion, an antibody that selectively binds to the CD248 portion, or a CAR according to the invention.
- the individual is preferably a human.
- the individual can be non-human, such as any non-human mammal, for example a horse, dog, pig, cow, sheep, rat, mouse, guinea pig or a primate.
- the individual has a solid tumour, such as a tumour of the colon, rectum, ovary, liver, bladder, prostate, breast, kidney, pancreas, stomach, oesophagus, lung or thyroid.
- a solid tumour such as a tumour of the colon, rectum, ovary, liver, bladder, prostate, breast, kidney, pancreas, stomach, oesophagus, lung or thyroid.
- angiogenesis inhibitor anti- VE.G.F monoclonal antibody bevacizumab improves the clinical outcome for a number of solid tumours when administered in combination with standard chemotherapy.
- Combinations that have been used include bevacizumab in combination with irinotecan, fluorouracil, and leucovorin; bevacizumab in combination with FOLFOX4 (a regimen of oxaliplatin, 5-fluorouracil and leucovorin); bevacizumab in combination with paclitaxel; and bevacizumab in combination with paclitaxel and carboplatin.
- FOLFOX4 a regimen of oxaliplatin, 5-fluorouracil and leucovorin
- bevacizumab in combination with paclitaxel and bevacizumab in combination with paclitaxel and carboplatin.
- the invention includes a composition
- a composition comprising an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MMRN2 portion according to the second aspect of the invention, a CD248 portion according to the third aspect of the invention, a fusion protein according to the fourth aspect of the invention, an antibody according to the fifth or sixth aspects of the invention, a polynucleotide according to any of fourth, seventh, ninth, eleventh and thirteenth aspects of the invention, a vector according to the fourteenth aspect of the invention, a cell according to the fifteenth aspect of the invention, a compound according to the eighth or tenth aspects of the invention, or a CAR according to the twelfth aspect of the invention, which composition further comprises at least one additional anti-cancer agent and/or at least one additional anti-angiogenic agent.
- the composition may be a pharmaceutical composition that also comprises a pharmaceutically acceptable diluent, carrier or excipient.
- the method may also comprise administering to the individual at least one further therapeutic agent (e.g. anticancer agent and/or ant- angiogenesis compound).
- the method may comprise administering to the individual a pharmaceutical composition containing the agent of the invention (e.g. agent, MMRN2 portion, CD248 portion, antibody or CAR), and the further therapeutic agent (e.g. anticancer agent and/or anti-angiogenesis compound).
- agent of the invention e.g. agent, MMRN2 portion, CD248 portion, antibody or CAR
- further therapeutic agent e.g. anticancer agent and/or anti-angiogenesis compound.
- the anticancer agent and/or anti-angiogenesis compound may be administered separately, for instance by separate routes of administration.
- the agent and the at least one further therapeutic agent can be administered sequentially or (substantially) simultaneously. They may be administered within the same pharmaceutical formulation or medicament or they may be formulated and administered separately.
- the medicament containing the agent of the invention may also comprise at least one further therapeutic agent (e.g. anticancer agent and/or anti-angiogenesis compound).
- the individual to be treated may be one who is administered at least one further therapeutic agent (e.g. anticancer agent and/or anti- angiogenesis compound). It is appreciated that the individual may be administered the further therapeutic agent (e.g.
- anticancer agent and/or anti-angiogenesis compound at the same time as the medicament containing the agent of the invention, although the individual may have been (or will be) administered the further therapeutic agent (e.g. anticancer agent and/or anti-angiogenesis compound) before (or after) receiving the medicament containing the agent of the invention.
- further therapeutic agent e.g. anticancer agent and/or anti-angiogenesis compound
- the invention also provides a method of treatment, wherein a further therapeutic agent (e.g. anticancer agent and/or anti-angiogenesis compound) is administered to an individual in need thereof, wherein the individual is one who is administered an agent of the invention.
- a further therapeutic agent e.g. anticancer agent and/or anti-angiogenesis compound
- the administration of the further therapeutic agent and agent of the invention may occur at the same time, although the individual may have been (or will be) administered the agent of the invention before (or after) receiving the medicament containing the further therapeutic agent (e.g. anticancer agent and/or anti- angiogenesis compound).
- the further therapeutic agent is an anti-cancer agent.
- the further anticancer agent may be selected from alkylating agents including nitrogen mustards such as mechlorethamine (HN2), cyclophosphamide, ifosfamide, melphalan (L-sarcolysin) and chlorambucil; ethylenimines and methylmelamines such as hexamethylmelamine, thiotepa; alkyl sulphonates such as busulphan; nitrosoureas such as carmustine (BCNU), lomustine (CCNU), semustine (methyl-CCNU) and streptozocin (streptozotocin); and triazenes such as decarbazine (DTIC; dimethyltriazenoimidazole-carboxamide); antimetabolites including folic acid analogues such as methotrexate (amethopterin); pyrimidine analogues such as fluorouracil (5-fluorouraci
- tyrosine kinase inhibitors such as Imatinib (Glivec ® ), COX-2 inhibitors, and hormone agonists/antagonists such as flutamide and tamoxifen. Particularly, tirapazamine may be utilised.
- the clinically used anticancer agents are typically grouped by mechanism of action: Alkylating agents, Topoisomerase I inhibitors, Topoisomerase II inhibitors, RNA/DNA antimetabolites, DNA antimetabolites and Antimitotic agents.
- Alkylating agents Topoisomerase I inhibitors
- Topoisomerase II inhibitors Topoisomerase II inhibitors
- RNA/DNA antimetabolites DNA antimetabolites
- Antimitotic agents The US NIH/National Cancer Institute website lists 122 compounds (http://dtp.nci.nih.gov/docs/cancer/ searches/standard_mechanism.html), all of which may be used in conjunction with an inhibitor of CLEC14A.
- Alkylating agents including Asaley, AZQ, BCNU, Busulfan, carboxyphthalatoplatinum, CBDCA, CCNU, CHIP, chlorambucil, chlorozotocin, c/ ' s-platinum, clomesone, cyanomorpholino-doxorubicin, cyclodisone, dianhydrogalactitol, fluorodopan, hepsulfam, hycanthone, melphalan, methyl CCNU, mitomycin C, mitozolamide, nitrogen mustard, PCNU, piperazine, piperazinedione, pipobroman, porfiromycin, spirohydantoin mustard, teroxirone, tetraplatin, picoplatin (SP-4-3) (cis- aminedichloro(2-methylpyridine)Pt(ll)), thio-tepa, triethylenemelamine, uracil nitrogen mustard, Yoshi-864; anitmitotic agents including
- the at least one further anticancer agent is selected from cisplatin; carboplatin; picoplatin; 5-fluro uracil; paclitaxel; mitomycin C; doxorubicin; gemcitabine; tomudex; pemetrexed; methotrexate; irinotecan, fluorouracil and leucovorin; oxaliplatin, 5-fluorouracil and leucovorin; and paclitaxel and carboplatin.
- the agent of the invention is used in combination with that further anticancer agent to treat that specific tumour type.
- Preferred anti-angiogenesis compounds include bevacizumab (Avastin®); itraconazole; carboxyamidotriazole; TNP-470 (an analog of fumagillin); CM101 ; IFN-a; IL-12; platelet factor-4; suramin; SU5416; thrombospondin; VE.G.FR antagonists; angiostatic steroids + heparin; Cartilage-Derived Angiogenesis Inhibitory Factor; matrix metalloproteinase inhibitors; angiostatin; endostatin; 2-methoxyestradiol; tecogalan; tetrathiomolybdate; thalidomide; prolactin; ⁇ / ⁇ 3 inhibitors; linomide; tasquinimod; ranibizumab; sorafenib; (Nexavar®); sunitinib (Sutent®); pazopanib (Votrient®); and everolimus (Afinit
- the invention also provides a kit of parts comprising: (i) an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MMRN2 portion according to the second aspect of the invention, a CD248 portion according to the third aspect of the invention, a fusion protein according to the fourth aspect of the invention, an antibody according to the fifth or sixth aspects of the invention, a polynucleotide according to any of fourth, seventh, ninth, eleventh and thirteenth aspects of the invention, a vector according to the fourteenth aspect of the invention, a cell according to the fifteenth aspect of the invention, a compound according to the eighth or tenth aspects of the invention, or a CAR according to the twelfth aspect of the invention; and (ii) at least one additional anti-cancer agent and/or at least one additional anti-angiogenic agent.
- an agent according to the first aspect of the invention which itself may be a portion of MMRN2 or CD248
- a nineteenth aspect of the invention provides a pharmaceutical composition
- a pharmaceutical composition comprising an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MMRN2 portion according to the second aspect of the invention, a CD248 portion according to the third aspect of the invention, a fusion protein according to the fourth aspect of the invention, an antibody according to the fifth or sixth aspects of the invention, a polynucleotide according to any of fourth, seventh, ninth, eleventh and thirteenth aspects of the invention, a vector according to the fourteenth aspect of the invention, a cell according to the fifteenth aspect of the invention, a compound according to the eighth or tenth aspects of the invention, or a CAR according to the twelfth aspect of the invention; and a pharmaceutically acceptable diluent, carrier or excipient.
- the formulation is sterile and pyrogen free.
- Suitable pharmaceutical carriers, diluents and excipients are well known in the art of pharmacy.
- the carrier(s) must be “acceptable” in the sense of being compatible with the inhibitor and not deleterious to the recipients thereof.
- the carriers will be water or saline which will be sterile and pyrogen free; however, other acceptable carriers may be used.
- the pharmaceutical compositions or formulations of the invention are for parenteral administration, more particularly for intravenous administration.
- the pharmaceutical composition is suitable for intravenous administration to a patient, for example by injection.
- Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents.
- the pharmaceutical composition is suitable for topical administration to a patient.
- the formulation is a unit dosage containing a daily dose or unit, daily sub-dose or an appropriate fraction thereof, of the active ingredient.
- the agent or active ingredient may be administered orally or by any parenteral route, in the form of a pharmaceutical formulation comprising the active ingredient, optionally in the form of a non-toxic organic, or inorganic, acid, or base, addition salt, in a pharmaceutically acceptable dosage form.
- a pharmaceutical formulation comprising the active ingredient, optionally in the form of a non-toxic organic, or inorganic, acid, or base, addition salt, in a pharmaceutically acceptable dosage form.
- the compositions may be administered at varying doses.
- the agent or active ingredient will generally be administered in admixture with a suitable pharmaceutical excipient, diluent or carrier selected with regard to the intended route of administration and standard pharmaceutical practice.
- the agent or active ingredient may be administered orally, buccally or sublingually in the form of tablets, capsules, ovules, elixirs, solutions or suspensions, which may contain flavouring or colouring agents, for immediate-, delayed- or controlled-release applications.
- the active ingredient may also be administered via intracavernosal injection.
- Suitable tablets may contain excipients such as microcrystalline cellulose, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate and glycine, disintegrants such as starch (preferably corn, potato or tapioca starch), sodium starch glycolate, croscarmellose sodium and certain complex silicates, and granulation binders such as polyvinylpyrrolidone, hydroxypropylmethylcellulose (HPMC), hydroxy-propylcellulose (HPC), sucrose, gelatin and acacia. Additionally, lubricating agents such as magnesium stearate, stearic acid, glyceryl behenate and talc may be included. Solid compositions of a similar type may also be employed as fillers in gelatin capsules.
- excipients such as microcrystalline cellulose, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate and glycine
- disintegrants such as starch (preferably corn, potato or tapioca starch), sodium star
- Preferred excipients in this regard include lactose, starch, a cellulose, milk sugar or high molecular weight polyethylene glycols.
- the compounds of the invention may be combined with various sweetening or flavouring agents, colouring matter or dyes, with emulsifying and/or suspending agents and with diluents such as water, ethanol, propylene glycol and glycerin, and combinations thereof.
- the agent or active ingredient can also be administered parenterally, for example, intravenously, intra-arterially, intraperitoneally, intrathecal ⁇ , intraventricularly, intrasternally, intracranially, intra-muscularly or subcutaneously, or they may be administered by infusion techniques. They are best used in the form of a sterile aqueous solution which may contain other substances, for example, enough salts or glucose to make the solution isotonic with blood.
- the aqueous solutions should be suitably buffered (preferably to a pH of from 3 to 9), if necessary.
- suitable parenteral formulations under sterile conditions is readily accomplished by standard pharmaceutical techniques well-known to those skilled in the art.
- the formulations may be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophilised) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use.
- sterile liquid carrier for example water for injections
- Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kind previously described.
- the daily dosage level of an agent, antibody or compound will usually be from 1 to 1 ,000 mg per adult (i.e. from about 0.015 to 15 mg/kg), administered in single or divided doses.
- the tablets or capsules of the agent or active ingredient may contain from 1 mg to 1 ,000 mg of agent or active agent for administration singly or two or more at a time, as appropriate.
- the physician in any event will determine the actual dosage which will be most suitable for any individual patient and it will vary with the age, weight and response of the particular patient.
- the above dosages are exemplary of the average case. There can, of course, be individual instances where higher or lower dosage ranges are merited and such are within the scope of this invention.
- the agent or active ingredient can also be administered intranasally or by inhalation and are conveniently delivered in the form of a dry powder inhaler or an aerosol spray presentation from a pressurised container, pump, spray or nebuliser with the use of a suitable propellant, e.g. dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoro-ethane, a hydrofluoroalkane such as 1 , 1 , 1 ,2-tetrafluoroethane (HFA 134A3 or 1 , 1 , 1 ,2,3,3,3-heptafluoropropane (HFA 227EA3), carbon dioxide or other suitable gas.
- a suitable propellant e.g. dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoro-ethane, a hydrofluoroalkane such as 1 , 1 , 1 ,2-
- the dosage unit may be determined by providing a valve to deliver a metered amount.
- the pressurised container, pump, spray or nebuliser may contain a solution or suspension of the active compound, e.g. using a mixture of ethanol and the propellant as the solvent, which may additionally contain a lubricant, e.g. sorbitan trioleate.
- a lubricant e.g. sorbitan trioleate.
- Capsules and cartridges (made, for example, from gelatin) for use in an inhaler or insufflator may be formulated to contain a powder mix of an active ingredient and a suitable powder base such as lactose or starch.
- Such formulations may be particularly useful for treating solid tumours of the lung, such as, for example, small cell lung carcinoma, non-small cell lung carcinoma, pleuropulmonary blastoma or carcinoid tumour.
- Aerosol or dry powder formulations are preferably arranged so that each metered dose or "puff" contains at least 1 mg of the inhibitor for delivery to the patient.
- the overall daily dose with an aerosol will vary from patient to patient, and may be administered in a single dose or, more usually, in divided doses throughout the day.
- the agent or active ingredient can be administered in the form of a suppository or pessary, particularly for treating or targeting colon, rectal or prostate tumours.
- the agent or active ingredient may also be administered by the ocular route.
- the inhibitor can be formulated as, e.g., micronised suspensions in isotonic, pH adjusted, sterile saline, or, preferably, as solutions in isotonic, pH adjusted, sterile saline, optionally in combination with a preservative such as a benzylalkonium chloride.
- a preservative such as a benzylalkonium chloride.
- they may be formulated in an ointment such as petrolatum.
- Such formulations may be particularly useful for treating solid tumours of the eye, such as retinoblastoma, medulloepithelioma, uveal melanoma, rhabdomyosarcoma, intraocular lymphoma, or orbital lymphoma.
- the agent or active ingredient may be applied topically in the form of a lotion, solution, cream, ointment or dusting powder, or may be transdermal ⁇ administered, for example, by the use of a skin patch.
- the active ingredient can be formulated as a suitable ointment containing the active compound suspended or dissolved in, for example, a mixture with one or more of the following: mineral oil, liquid petrolatum, white petrolatum, propylene glycol, polyoxyethylene polyoxypropylene compound, emulsifying wax and water.
- ком ⁇ онентs can be formulated as a suitable lotion or cream, suspended or dissolved in, for example, a mixture of one or more of the following: mineral oil, sorbitan monostearate, a polyethylene glycol, liquid paraffin, polysorbate 60, cetyl esters wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol and water.
- suitable lotion or cream suspended or dissolved in, for example, a mixture of one or more of the following: mineral oil, sorbitan monostearate, a polyethylene glycol, liquid paraffin, polysorbate 60, cetyl esters wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol and water.
- Such formulations may be particularly useful for treating solid tumours of the skin, such as, for example, basal cell cancer, squamous cell cancer or melanoma.
- the agent or active ingredient can also be delivered by electroincorporation (El).
- El occurs when small particles of up to 30 microns in diameter on the surface of the skin experience electrical pulses identical or similar to those used in electroporation. In El, these particles are driven through the stratum corneum and into deeper layers of the skin.
- the particles can be loaded or coated with inhibitor or can simply act as "bullets" that generate pores in the skin through which the active ingredient can enter.
- Formulations suitable for topical administration in the mouth include lozenges comprising the active ingredient in a flavoured basis, usually sucrose and acacia or tragacanth; pastilles comprising the agent or active ingredient in an inert basis such as gelatin and glycerin, or sucrose and acacia; and mouth-washes comprising the active ingredient in a suitable liquid carrier.
- Such formulations may be particularly useful for treating solid tumours of the mouth and throat.
- the agent or active ingredient may be delivered using an injectable sustained-release drug delivery system. These are designed specifically to reduce the frequency of injections.
- Nutropin Depot which encapsulates recombinant human growth hormone (rhGH) in biodegradable microspheres that, once injected, release rhGH slowly over a sustained period.
- the agent or active ingredient can be administered by a surgically implanted device that releases the drug directly to the required site, for example, into the eye to treat ocular tumours.
- a surgically implanted device that releases the drug directly to the required site, for example, into the eye to treat ocular tumours.
- Cannabis injectable system that is thermo-sensitive. Below body temperature, Regel is an injectable liquid while at body temperature it immediately forms a gel reservoir that slowly erodes and dissolves into known, safe, biodegradable polymers. The active drug is delivered over time as the biopolymers dissolve.
- Polypeptide pharmaceuticals can also be delivered orally.
- the process employs a natural process for oral uptake of vitamin B12 in the body to co-deliver proteins and peptides. By riding the vitamin B12 uptake system, the protein or peptide can move through the intestinal wall.
- Complexes are synthesised between vitamin B12 analogues and the drug that retain both significant affinity for intrinsic factor (IF) in the vitamin B12 portion of the complex and significant bioactivity of the drug portion of the complex.
- Polynucleotides may be administered as a suitable genetic construct as described below and delivered to the patient where it is expressed. Typically, the polynucleotide in the genetic construct is operatively linked to a promoter which can express the compound in the cell.
- the genetic constructs of the invention can be prepared using methods well known in the art, for example in Sambrook et al (2001).
- genetic constructs for delivery of polynucleotides can be DNA or RNA, it is preferred if they are DNA.
- the genetic construct is adapted for delivery to a human cell.
- Means and methods of introducing a genetic construct into a cell are known in the art, and include the use of immunoliposomes, liposomes, viral vectors (including vaccinia, modified vaccinia, lentivurus, parvovirus, retroviruses, adenovirus and adeno-associated viral (AAV) vectors), and by direct delivery of DNA, e.g. using a gene-gun and electroporation.
- methods of delivering polynucleotides to a target tissue of a patient for treatment are also well known in the art.
- a high-efficiency nucleic acid delivery system that uses receptor-mediated endocytosis to carry DNA macromolecules into cells is employed. This is accomplished by conjugating the iron-transport protein transferrin to polycations that bind nucleic acids.
- High-efficiency receptor-mediated delivery of the DNA constructs or other genetic constructs of the invention using the endosome-disruption activity of defective or chemically inactivated adenovirus particles produced by the methods of Cotten et al (1992) Proc. Natl. Acad. Sci. USA 89, 6094-6098 may also be used.
- tissue-specific promoters in the vectors encoding a polynucleotide inhibitor, this is not essential, as the risk of expression of the active ingredient in the body at locations other than the cancer/tumour would be expected to be tolerable in compared to the therapeutic benefit to a patient suffering from a cancer/tumour. It may be desirable to be able to temporally regulate expression of the polynucleotide inhibitor in the cell, although this is also not essential.
- agents or active ingredients of the invention may be lyophilised for storage and reconstituted in a suitable carrier prior to use.
- Any suitable lyophilisation method e.g. spray drying, cake drying
- reconstitution techniques can be employed. It will be appreciated by those skilled in the art that lyophilisation and reconstitution can lead to varying degrees of protein activity loss and that use levels may have to be adjusted upward to compensate.
- the lyophilised (freeze dried) active ingredient loses no more than about 20%, or no more than about 25%, or no more than about 30%, or no more than about 35%, or no more than about 40%, or no more than about 45%, or no more than about 50% of its activity (prior to lyophilisation) when re-hydrated.
- Targeted delivery of cytotoxic moieties loses no more than about 20%, or no more than about 25%, or no more than about 30%, or no more than about 35%, or no more than about 40%, or no more than about 45%, or no more than about 50% of its activity (prior to lyophilisation) when re-hydrated.
- a twentieth aspect of the invention provides a method of targeting a cytotoxic moiety to neovasculature in the body of an individual, the method comprising:
- a compound comprising a compound according to the tenth aspect of the invention i.e. (i) an agent according to the first aspect of invention, a MMRN2 portion according to the second aspect of the invention, or a CD248 portion according to the third aspect of the invention and (ii) a cytotoxic moiety.
- This aspect of the invention includes a compound according to the tenth aspect of the invention for use in targeting a cytotoxic moiety to neovasculature in the body of an individual.
- This aspect of the invention further includes the use of a compound according to the tenth aspect of the invention in the preparation of a medicament for targeting a cytotoxic moiety to neovasculature in the body of an individual.
- this aspect of the invention includes a method of inhibiting angiogenesis in an individual, the method comprising: administering to the individual a compound according to the tenth aspect of the invention.
- the neovasculature is tumour neovasculature and the angiogenesis is tumour angiogenesis.
- This aspect of the invention also includes a compound according to the tenth aspect of the invention for use in inhibiting angiogenesis in an individual.
- This aspect of the invention also includes the use of a compound according to the tenth aspect of the invention in the preparation of a medicament for inhibiting angiogenesis in an individual.
- the individual in the twentieth aspect of the invention has a solid tumour, preferably such as those described above in relation to the sixteenth, seventeenth and eighteenth aspects of the invention.
- the method may comprise administering to the individual a further anticancer agent.
- Preferences for the further anticancer agent to be administered include any of the cytotoxic agents described above.
- the anticancer agent may be any one or more of cisplatin; carboplatin; 5-fluro uracil; paclitaxel; mitomycin C; doxorubicin; gemcitabine; tomudex; pemetrexed; methotrexate; irinotecan, fluorouracil and leucovorin; oxaliplatin, 5- fluorouracil and leucovorin; and paclitaxel and carboplatin.
- the compound according to the tenth aspect of the invention and the further anticancer agent may be administered in the form of a pharmaceutical composition containing both of these components.
- the compound and the further anticancer agent may be administered separately, for instance by separate routes of administration.
- the compound and the at least one further anticancer agent can be administered sequentially or (substantially) simultaneously. They may be administered within the same pharmaceutical formulation or medicament or they may be formulated and administered separately.
- the method may comprise administering the compound according to the tenth aspect of the invention to the individual wherein the individual is one who is administered a further anticancer agent.
- the method may comprise administering a further anticancer to an individual wherein the individual is one who is administered the compound according to the tenth aspect of the invention.
- the invention also provides a kit of parts comprising: (i) an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MMRN2 portion according to the second aspect of the invention, a CD248 portion according to the third aspect of the invention, a fusion protein according to the fourth aspect of the invention, an antibody according to the fifth or sixth aspects of the invention, a polynucleotide according to any of fourth, seventh, ninth, eleventh and thirteenth aspects of the invention, a vector according to the fourteenth aspect of the invention, a cell according to the fifteenth aspect of the invention, a compound according to the eighth or tenth aspects of the invention, or a CAR according to the twelfth aspect of the invention; and (ii) a cytotoxic moiety.
- a twenty-first aspect of the invention provides a method of imaging neovasculature in the body of an individual the method comprising: administering to the individual a compound according to the eighth aspect of the invention (i.e. (i) an agent according to the first aspect of invention, a MMRN2 portion according to the second aspect of the invention, or a CD248 portion according to the third aspect of the invention, and (ii) a detectable moiety), and imaging the detectable moiety in the body.
- a compound according to the eighth aspect of the invention i.e. (i) an agent according to the first aspect of invention, a MMRN2 portion according to the second aspect of the invention, or a CD248 portion according to the third aspect of the invention, and (ii) a detectable moiety
- the individual has a solid tumour, preferably such as those described above, and the neovasculature of the tumour is imaged.
- the localisation of the portion of MMRN2 at a particular organ in the body indicates that the individual may have or may be developing a solid tumour at that organ.
- This method may be useful, for example, in determining the size of a previously diagnosed solid tumour, determining the effectiveness of a therapy against the solid tumour, or determining the extent of metastasis of the tumour.
- Methods for imaging the detectable moiety in the body are well known in the art, and include PET (positron emission tomography).
- this aspect of the invention provides a method of detecting, diagnosing and prognosing a solid tumour in an individual, the method comprising: administering to the individual a compound according to the eighth aspect of the invention, and detecting the presence and/or location of the detectable moiety in the body.
- the method further comprises the step of detecting the location of the compound in the individual.
- Preferences for the detectable moiety include those mentioned above, such as any of iodine-123, iodine-131 , indium-1 11 , fluorine-19, carbon-13, nitrogen-15, oxygen-17, technetium-99m, gadolinium, manganese or iron.
- the individual is a human.
- the individual has a solid tumour such as any of those described above.
- the invention also provides a kit of parts comprising (i) an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MMRN2 portion according to the second aspect of the invention, a CD248 portion according to the third aspect of the invention, a fusion protein according to the fourth aspect of the invention, an antibody according to the fifth or sixth aspects of the invention, a polynucleotide according to any of fourth, seventh, ninth, eleventh and thirteenth aspects of the invention, a vector according to the fourteenth aspect of the invention, a cell according to the fifteenth aspect of the invention, a compound according to the eighth or tenth aspects of the invention, or a CAR according to the twelfth aspect of the invention; and (ii) a detectable moiety.
- the inventors have characterised new molecular interactions between MMRN2 and CD248, and so it will be appreciated that complexes between the portion of MMRN2, or portion of CD248 of the invention will have utility in further elucidating the role of these molecules in angiogenesis.
- a twenty-second aspect of the invention provides a complex comprising: (i) MMRN2 or a portion or variant thereof, said portion or variant being capable of binding to CD248; and (ii) CD248 or a portion or variant thereof, said portion or variant being capable of binding to MMRN2.
- the complex further comprises CLEC14A or a portion or variant thereof, or CD93 or a portion or variant thereof, said portions or variants being capable of binding to MMRN2.
- Example 1 the inventors have conducted various experiments to investigate the interaction between MMRN2 and CD248 and CLEC14A. Specifically, they have shown that CLEC14A and CD248 can bind MMRN2 simultaneously and this occurs at the interface between endothelium and pericytes in human pancreatic cancer.
- a twenty-third aspect of the invention provides a kit of parts comprising: (i) a MMRN2 portion said portion or variant being capable of binding to CD248; and (ii) CD248 or a portion or variant thereof, said portion or variant being capable of binding to MMRN2.
- the kit may further comprise a test agent.
- the test agent may be a candidate modulator of the interaction between MMRN2 and CD248.
- the kit could be used in a screening method for identifying modulators of an interaction between CD248 and MMRN2. Therefore, the test agent could be such a candidate modulator. Such a method is described in more detail below.
- the kit further comprises CLEC14A or a portion or variant thereof, and/or CD93 or a portion or variant thereof, said portions or variants being capable of binding to MMRN2.
- a twenty-fourth aspect of the invention provides a nucleic acid molecule capable of encoding: (i) MMRN2 or a portion or variant thereof, said portion or variant being capable of binding to CD248; and (ii) CD248 or a portion or variant thereof, said portion or variant being capable of binding to MMRN2. It will be appreciated that a single nucleic acid molecule may be capable of encoding both (i) and (ii), or that two nucleic acid molecules may be capable of respectively encoding (i) and (ii).
- the nucleic acid molecule is capable of further encoding CLEC14A or a portion or variant thereof, and/or CD93 or a portion or variant thereof, said portions or variants being capable of binding to MMRN2. It will be appreciated that a single nucleic acid molecule may be capable of encoding both (i) and (ii) and CLEC14A, and/or CD93, or that two, three, or four nucleic acid molecules may be capable of respectively encoding (i), (ii), CLEC14A, and/or CD93.
- Preferences for the MMRN2 portion and for the CD248 portion include those described above in relation to the second and third aspects of the invention.
- the portion of CLEC14A or CD93 that is capable of binding to MMRN2 is at least 20 amino acid residues in length, and may be between 20 and 50 residues or between 50 and 100 residues or between 100 and 150 residues or between 150 and 200 residues in length, or more. In a particular embodiment, the portion of CLEC14A or CD93 that is capable of binding to MMRN2 is less than 400, 350, 300, 250, 150, 140, 130, 110, 100, 95, 90 or 85 amino acid residues in length.
- the portion of CLEC14A that is capable of binding to MMRN2 is a portion of, or that the portion contains, the extracellular region of CLEC14A (residues 22-396), or that the portion is a portion of, or that the portion contains the C-type lectin like domain (residues 32-173), or that the portion is a portion of, or that the portion contains the long- loop region of CLEC14A (residues E97-C143) or that the portion is a portion of, or that the portion contains, residues 97-108 of the C-type lectin like domain.
- the portion of CD93 that is capable of binding to MMRN2 is a portion of, or that the portion contains, the extracellular region of CD93 (residues A22-K580), or that the portion is a portion of, or that the portion contains the C-type lectin like domain (residues A22-N174), or that the portion is a portion of, or that the portion contains the long-loop region of CLEC14A (residues Q98-C142) or that the portion is a portion of, or that the portion contains, residues 97-108 of the C-type lectin like domain.
- variants of CLEC14A or CD93 that are capable of binding to MMRN2
- variants of CLEC14A that have at least 60% sequence identity to human CLEC14A or human CD93, for example variants with at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to human CLEC14A or human CD93. It is preferred if the variant polypeptide has a consecutive region of at least 20 amino acid residues, more preferably at least 50 residues, of the sequence of the human CLEC14A polypeptide.
- variants may be made, for example, using the methods of recombinant DNA technology, protein engineering and site-directed mutagenesis which are well known in the art.
- portions of CLEC14A or CD93 described above may also be portions of CLEC14A or CD93 variants.
- the portions of CLEC14A or CD93 have at least 60% sequence identity to human CLEC14A or CD93 respectively, for example at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity over the length of the portion.
- the complex of the twenty-second aspect of the invention is produced by expressing the portion of MMRN2, the portion of CD248, and optionally, either CLEC14A and/or CD93 (or portions or variants thereof) separately, and adding the proteins together after expression under conditions appropriate for complex formation.
- a cell may be engineered to overexpress the portion of MMRN2, the portion of CD248, and optionally either CLEC14A and/or CD93 (or portions or variants thereof) using standard molecular biology techniques, such that the complex can be recovered from the cell lysate.
- the complex is soluble.
- the proteins are manufactured in E. coli and purified by tagging them with histidine tags and using nickel beads to isolate the recombinant proteins.
- a twenty-fifth aspect of the invention provides a mutant MMRN2 polypeptide which has reduced or enhanced binding to CD248 relative to wild type MMRN2.
- wild type we include the meaning of the allele that encodes the phenotype most common in a particular natural population, for example, the naturally occurring sequence of a gene.
- a naturally occurring protein cannot be considered a mutant in the context of the present invention eg a naturally occurring mouse MMRN2 cannot be considered a mutant of a human MMRN2, and so on.
- the mutant MMRN2 binds to CD248 with less affinity than wild type MMRN2 binds to CD248.
- the mutant MMRN2 binds to CD248 with at least 2, or at least 5, or at least 10, or at least 50 times less affinity than the wild type MMRN2 binds to CD248.
- binding between CD248 and the mutant MMRN2 is reduced to an undetectable level.
- mutant binding to CD248 we include the meaning that the mutant MMRN2 binds to CD248 with a higher affinity than wild type MMRN2 binds to CD248.
- the mutant MMRN2 binds to CD248 with at least 2, or at least 5, or at least 10, or at least 50 times more affinity than the wild type MMRN2 binds to CD248.
- the mutant MMRN2 when compared to the corresponding wild type MMRN2, comprises one or more different amino acids in the region of MMRN2 corresponding to the region spanning amino acid residues 133-486 of human MMRN2, for example at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 75 or 100 different amino acids, such as at least 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300 or 350 different amino acids. Also included are mutant MMRN2 polypeptides wherein the region corresponding to the region spanning amino acid residues 133-486 of human MMRN2, or part thereof, is deleted.
- the mutant MMRN2 is a portion of MMRN2 which comprises or consists of a region of MMRN2 corresponding to the region spanning amino acid residues 215-478, or 215-344, or 295-478, or 344-478, or 215-280 or 295-344 or 375-478 of human MMRN2, or a part thereof.
- the part thereof is at least 10, 20, 30, 35, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140 or 150, consecutive amino acids in length.
- mutant MMRN2 is a mutant of a particular species of MMRN2 (eg human), and so, apart from the mutation that is causative for the reduction or enhancement in binding to CD248, the mutant MMRN2 and wild type MMRN2 will share the same characteristics (eg structural and functional characteristics) of MMRN2 of whichever species.
- a twenty-sixth aspect of the invention provides a mutant CD248 polypeptide which has reduced or enhanced binding to MMRN2 relative to wild type CD248,
- cysteine corresponding to cysteine-94 of human CD248 is mutated and/or the cysteine corresponding to cysteine-126 of human CD248 is mutated.
- the one or both cysteine residues are mutated to serine, although it is appreciated that any other amino acid may be used provided that binding to MMRN2 is still reduced compared to the wild type CD248.
- mutant binding to MMRN2 we include the meaning that the mutant CD248 binds to MMRN2 with less affinity than wild type CD248 binds to MMRN2.
- the mutant CD248 binds to MMRN2 with at least 2, or at least 5, or at least 10, or at least 50 times less affinity than does the wild type CD248 binds to MMRN2.
- binding between MMRN2 and the mutant CD248 is reduced to an undetectable level.
- mutant binding to MMRN2 we include the meaning that the mutant CD248 binds to MMRN2 with a higher affinity than wild type CD248 binds to MMRN2.
- mutant CD248 binds to MM RN2 with at least 2, or at least 5, or at least 10, or at least 50 times more affinity than the wild type CD248 binds to MMRN2.
- the mutant CD248 is a mutant of a particular species of CD248 (eg human), and so, apart from the mutation that is causative for the reduction or enhancement in binding to MMRN2, the mutant CD248 and wild type CD248 will share the same characteristics (eg structural and functional characteristics) of CD248 of whichever species.
- mutation we include insertions, deletions and substitutions, either conservative or 5 non-conservative.
- conservative substitutions is intended combinations such as Gly, Ala; Val, lie, Leu; Asp, Glu; Asn, Gin; Ser, Thr; Lys, Arg; and Phe, Tyr.
- mutants of the twenty-fifth and twenty-sixth aspects of the invention may be produced in any suitable way and provided in any suitable form.
- methods of proteini c) engineering or conventional site-directed mutagenesis may be employed, or polymerase chain reaction-based procedures well known in the art may be used.
- the proteins are manufactured in E. coli and purified by tagging them with histidine tags and using nickel beads to isolate the recombinant proteins.
- the proteins are detectably labelled. Examples of such labels are well known in the art and include peptide 15 labels, chemical labels, fluorescent labels, enzyme labels or radio labels.
- the invention does not include naturally occurring variants of the wild type MMRN2 polypeptide or the wild type CD248 polypeptide.
- the mutants are typically recombinantly produced.
- the invention includes a nucleic acid molecule encoding any of the mutant polypeptides of the twenty-fifth and twenty-sixth aspects of the invention.
- the nucleic acid molecule may be incorporated into a vector such as an expression vector. Further details of what the nucleic acid and vector may be include those described above. It will also be 25 appreciated that the invention provides a cell comprising the nucleic acid molecule or vector.
- a twenty-seventh aspect of the invention provides a method of identifying an agent that modulates the interaction between CD248 and MMRN2, the method comprising:
- MMRN2 or a portion or variant thereof, said portion or variant being capable of binding to CD248;
- CD248 or a portion of variant thereof, said portion or variant being 35 capable of biding to MM RN2;
- the invention includes a method of identifying an agent which modulates the interaction between CD248 and MMRN2, the method comprising determining whether a candidate agent modulates (eg reduces or enhances) the interaction between (i) MMRN2 or a portion or a variant thereof, said portion or variant thereof being capable of biding to CD248, and (ii) CD248 or a portion or variant thereof, said portion or variant thereof being capable of binding to MMRN2.
- the agent may be useful in modulating angiogenesis, or in combating cancer
- the method may be used to identify an agent that may be useful in modulating angiogenesis or in combating cancer.
- a method of identifying an agent that may be useful in modulating angiogenesis or in combating cancer, or a lead compound for the identification of an agent that may be useful in modulating angiogenesis or in combating cancer comprising:
- MMRN2 or a portion or variant thereof, said portion or variant being capable of binding to CD248;
- CD248 or a portion of variant thereof, said portion or variant being capable of biding to MM RN2;
- the candidate agent itself may be a portion of MMRN2 or variant thereof.
- the invention provides a method of identifying a portion of MMRN2 or a variant thereof, which portion may be useful in modulating angiogenesis or in combating cancer, or a lead compound for the identification of an agent that may be useful in modulating angiogenesis or in combating cancer, the method comprising:
- CD248 or a portion or variant thereof, said portion or variant being capable of binding to MMRN2;
- MMRN2 or a portion or variant thereof, said portion or variant being capable of binding to CD248;
- MMRN2 providing a candidate portion of MMRN2 or a variant thereof; and determining whether the candidate portion modulates binding of CD248 or the portion or variant thereof, to MMRN2, or the portion or variant thereof.
- the candidate agent itself may be a portion of CD248 or variant thereof.
- the invention provides a method of identifying a portion of CD248 or a variant thereof, which portion may be useful in modulating angiogenesis or in combating cancer, or a lead compound for the identification of an agent that may be useful in modulating angiogenesis or in combating cancer, the method comprising:
- MMRN2 or a portion or variant thereof, said portion or variant being capable of binding to CD248;
- CD248 or a portion of variant thereof, said portion or variant being capable of biding to MMRN2;
- MMRN2 polypeptide we include human MMRN2 having the sequence listed in Figure 7, or an orthologue or naturally occurring variant thereof.
- portion or variant of MMRN2 being capable of binding to CD248, we include any portion or variant of MMRN2 that is capable of binding to CD248.
- the portion of MMRN2 that is capable of binding to CD248 is at least 20 amino acid residues in length, and may be between 20 and 50 residues or between 50 and 100 residues or between 100 and 150 residues or between 150 and 200 residues in length, or more. In a particular embodiment, the portion of MMRN2 that is capable of binding to CD248 is less than 800, 700, 600, 500, 400, 350, 300, 250, 150, 140, 130, 110, 100, 95, 90 or 85 amino acid residues in length.
- variants of MMRN2 that are capable of binding to CD248, we include variants of MMRN2 that have at least 60% sequence identity to human MMRN2, the sequence of which is provided in Figure 7 (SEQ ID No: 1), for example variants with at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to human MMRN2. It is preferred if the variant polypeptide has a consecutive region of at least 20 amino acid residues, more preferably at least 50 residues, of the sequence of the MMRN2 polypeptide listed in Figure 7 (SEQ ID No: 1). Such variants may be made, for example, using the methods of recombinant DNA technology, protein engineering and site-directed mutagenesis which are well known in the art.
- the portions of MMRN2 described above may also be portions of MMRN2 variants.
- the portions of MMRN2 have at least 60% sequence identity to human MMRN2, the sequence of which is provided in Figure 7 (SEQ ID No: 1), for example at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity over the length of the portion.
- the portion of MMRN2 used in the method of the twenty- seventh aspect of the invention is the portion of MMRN2 of the second aspect of the invention, and the preferences mentioned above in relation to those aspects equally apply here.
- the candidate portion of MMRN2 may be any portion of wild type MMRN2 or any portion of a variant of wild type MMRN2.
- MMRN2 polypeptide we include human MMRN2 having the sequence listed in Figure 7 (SEQ ID No: 1), or an orthologue or naturally occurring variant thereof. Preferences for the portion or variant of MMRN2 include those described above in relation to the second aspect of the invention.
- MMRN2 it is particularly preferred if a portion of MMRN2 is used in the method of the twenty-seventh aspect of the invention, and still more preferred if the portion comprises or consists of the coiled-coil domain of MMRN2 (residues 133-820) or the region corresponding to the region spanning residues 133-486 of the coiled-coil domain of human MMRN2.
- CD248 polypeptide we include human CD248 having the sequence listed in Figure 8 (SEQ ID No: 4), or an orthologue or naturally occurring variant thereof.
- portion or variant of CD248 being capable of binding to MMRN2
- the portion of CD248 that is capable of binding to MMRN2 is at least 20 amino acid residues in length, and may be between 20 and 50 residues or between 50 and 100 residues or between 100 and 150 residues or between 150 and 200 residues in length, or more.
- the portion of CD248 that is capable of binding to MMRN2 is less than 800, 700, 600, 500, 400, 350, 300, 250, 150, 140, 130, 1 10, 100, 95, 90 or 85 amino acid residues in length.
- variants of CD248 that are capable of binding to MMRN2
- variants of CD248 that have at least 60% sequence identity to human CD248, the sequence of which is provided in Figure 8 (SEQ ID No: 4), for example variants with at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to human CD248. It is preferred if the variant polypeptide has a consecutive region of at least 20 amino acid residues, more preferably at least 50 residues, of the sequence of the CD248 polypeptide listed in Figure 8 (SEQ ID No: 4).
- the portions of CD248 described above may also be portions of CD248 variants.
- the portions of CD248 have at least 60% sequence identity to human CD248, the sequence of which is provided in Figure 8 (SEQ ID No: 4), for example at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity over the length of the portion.
- the portion of CD248 used in the method of the twenty-seventh aspect of the invention is the portion of CD248 of the third aspect of the invention, and the preferences mentioned above in relation to those aspects equally apply here.
- the candidate portion of CD248 may be any portion of wild type CD248 or any portion of a variant of wild type CD248.
- CD248 polypeptide we include human CD248 having the sequence listed in Figure 8 (SEQ ID No: 4), or an orthologue or naturally occurring variant thereof. Preferences for the portion or variant of CD248 include those described above in relation to the third aspect of the invention. It is particularly preferred if a portion of CD248 is used in the method of the twenty-seventh aspect of the invention, and still more preferred if the portion comprises or consists of the long-loop region of CD248 (residues Q88-C131) or the region corresponding to the region spanning residues 30-156 of the C-type lectin like domain of human CD248.
- the candidate agent may be any of an antibody, a peptide, a peptidomimetic, a natural product, a carbohydrate, an aptamer or a small molecule (eg small organic molecule).
- the candidate agent is an antibody that selectively binds the CD248 polypeptide, or a fragment thereof, or an antibody that selectively binds the MMRN2 polypeptide, or a fragment thereof, or a portion of either CD248 or MMRN2.
- the candidate agent may be a peptide.
- Suitable peptides may be identified by methods such as phage display of peptide libraries (Scott & Smith (1990) "Searching for peptide ligands with an epitope library.” Science 249: 386-390; Felici et al (1995) "Peptide and protein display on the surface of filamentous bacteriophage.” Biotechnol. Annu. Rev. 1 : 149-183); and Collins et al (2001) "Cosmix-plexing: a novel recombinatorial approach for evolutionary selection from combinatorial libraries.” J. Biotechnol.
- the dissociation constants of peptides are typically in the micromolar range, although avidity can be improved by multimerization (Terskikh et al (1997) "Peptabody”: a new type of high avidity binding protein. Proc. Natl Acad. Sci. USA 94, 1663-1668; and Wrighton et al (1997) "Increased potency of an erythropoietin peptide mimetic through covalent dimerization. Nature Biotechnol. 15, 1261-1265).
- the primary ligands of C-type lectins are carbohydrates, even though binding of other proteins, lipids or inorganic compounds has been shown.
- the candidate agent may be a carbohydrate, or a molecule containing carbohydrate moieties such as a glycoprotein or gycolipid. It is appreciated that carbohydrate recognition and binding by C-type lectins is calcium dependant. Thus, in this embodiment, the method is carried out in the presence of calcium ions.
- the candidate agent may be an aptamer, i.e. a single-stranded DNA molecule that folds into a specific ligand-binding structure.
- Suitable aptamers that bind to the CD248 polypeptide or to the MMRN2 polypeptide, or a fragment thereof, may be identified by methods such as in vitro selection and amplification (Ellington & Szostak (1992) "Selection in vitro of single stranded DNA molecules that fold into specific ligand binding structures.” Nature 355: 850-852; and Daniels et al (2003) "A tenascin-C aptamer identified by tumor cell SELEX: systematic evolution of ligands by exponential enrichment.” Proc.
- the aptamer may be a nuclease-stable 'Spiegelmer' (Helmling et al (2004) "Inhibition of ghrelin action in vitro and in vivo by an RNA-Spiegelmer.” Proc. Natl Acad. Sci. USA 101 : 13174-13179). Aptamers typically have dissociation constants in the micromolar to the subnanomolar range.
- the candidate agent may be a small organic molecule.
- Suitable small molecules may be identified by methods such as screening large libraries of compounds (Beck-Sickinger & Weber (2001) Combinational Strategies in Biology and Chemistry (John Wiley & Sons, Chichester, Hampshire); by structure-activity relationship by nuclear magnetic resonance (Shuker et al (1996) "Discovering high-affinity ligands for proteins: SAR by NMR. Science 274: 1531-1534); encoded self-assembling chemical libraries Melkko et al (2004) “Encoded self-assembling chemical libraries.” Nature Biotechnol. 22: 568-574); DNA-templated chemistry (Gartner et al (2004) "DNA-templated organic synthesis and selection of a library of macrocycles.
- small organic molecules will have a dissociation constant for the polypeptide in the nanomolar range, particularly for antigens with cavities.
- the benefits of most small organic molecule binders include their ease of manufacture, lack of immunogenicity, tissue distribution properties, chemical modification strategies and oral bioavailability. Small molecules with molecular weights of less than 5000 daltons are preferred, for example less than 400, 3000, 2000, or 1000 daltons, or less than 500 daltons.
- a candidate agent or a portion of MMRN2, or a portion of CD248, to modulate binding of the particular interactions may be assessed by any method of detecting/measuring a protein/protein interaction or other compound/protein interaction, as discussed further below. Suitable methods include methods such as, for example, yeast two-hybrid interactions, co-purification, ELISA, co-immunoprecipitation and surface plasmon resonance methods.
- the candidate agent may be considered capable of modulating binding between the particular proteins if the interaction between those proteins as determined by ELISA, co-immunoprecipitation or surface plasmon resonance methods or by a yeast two-hybrid interaction or a copurification method, is changed (e.g.
- the interaction can be detected using a surface plasmon resonance method.
- Surface plasmon resonance methods are well known to those skilled in the art. Techniques are described in, for example, O'Shannessy DJ (1994) "Determination of kinetic rate and equilibrium binding constants for macromolecular interactions: a critique of the surface plasmon resonance literature" Curr Opin Biotechnol. 5(1):65-71 ; Fivash et al (1998) "BIAcore for macromolecular interaction.” Curr Opin Biotechnol.
- FRET Fluorescence Energy Resonance Transfer
- candidate portion of MMRN2 or the candidate agent of the twenty-seventh aspect of the invention, or candidate portion of CD248 or candidate agent of the twenty-eighth aspect of the invention may be added to one or the other of the members of the protein pair whose interaction is monitored (e.g. CD248 and MMRN2) before addition to the other member, and vice versa, and its effect on binding assessed.
- members of the protein pair whose interaction is monitored e.g. CD248 and MMRN2
- At least one or other of members of the protein pair whose interaction is monitored are detectably labelled so as to facilitate detection of their binding and consequently the effect of the candidate agent.
- suitable labels include a peptide label, a nucleic acid label (Kerr et al (1993) JACS vol. 115, p. 2529-2531 ; and Brenner & Lerner (1992) Proc. Natl. Acad. Sci. USA vol. 89, p. 5381-5383), a chemical label (Ohlmeyer et al (1993) Proc. Natl. Acad. Sci. USA vol. 90, p.
- the candidate portion of MMRN2 or the candidate agent of the twenty- seventh aspect of the invention, or candidate portion of CD248 or candidate agent of the twenty-eighth aspect of the invention is one that reduces the level of binding between CD248, or the portion or variant thereof, to MMRN2, or the portion or variant thereof.
- the portion or agent may be useful in combating any disease or condition involving unwanted, undesirable or inappropriate angiogenesis, or may be a lead compound to the identification of an agent that is so useful
- the candidate portion of MMRN2 or the candidate agent of the twenty-seventh aspect of the invention, or candidate portion of CD248 or candidate agent of the twenty- eighth aspect of the invention reduces the level of binding between CD248 and MMRN2 (or portion(s) or variant(s) thereof) by at least 10%, 20%, 30%, 40% or 50%, and more preferably the candidate agent is one that reduces the level of binding between CD248 and MMRN2 (or portion(s) or variant(s) thereof by at least 70%, 80%, 90%, 95% or 99%, compared to the level of binding in the absence of the candidate agent.
- the agent is one that reduces the level of binding between CD248 and MMRN2 (or portion(s) or variant(s) thereof) to an undetectable level, or eliminates binding between CD248 and MMRN2 (or portion(s) or variant(s) thereof).
- the identification of a candidate portion of MMRN2 or candidate agent, or a candidate portion of CD248 or candidate agent, that modulates binding of CD248, or the portion or variant thereof, to MMRN2, or the portion or variant thereof may be an initial step in a drug screening pathway, and the identified agents may be further selected e.g. for the ability to inhibit angiogenesis and/or for the ability to inhibit tumour growth.
- the method may further comprise the step of testing the candidate portion or agent in an angiogenesis assay and/or testing the candidate agent for efficacy in an animal model of a solid tumour.
- Methods and assays for determining the rate or level of angiogenesis, and hence for determining whether and to what extent a candidate agent inhibits angiogenesis are known in the art.
- US 6,225, 1 18, incorporated herein by reference describes a multicellular ex vivo assay for modelling the combined stages of angiogenesis namely the proliferation, migration and differentiation stages of cell development.
- the AngioKit Catalogue No. ZHA-1000, by TCS CellWorks Ltd, Buckingham MK18 2LR, UK, is a suitable model of human angiogenesis for analysing the anti-angiogenic properties of compounds.
- the rate or level of angiogenesis can also be determined using the aortic ring assay and the sponge angiogenesis assay that are well known in the art.
- Assays for endothelial cell proliferation, migration and invasion are also useful as angiogenesis assays.
- Suitable assays for endothelial cell proliferation and migration are known to a person of skill in the art.
- Suitable assays for endothelial cell invasion are also known to a person of skill in the art and include the BD BioCoatTM Angiogenesis System for Endothelial Cell Invasion which is available as Catalogue Nos. 354141 and 354142 from BD Biosciences, Bedford, MA, USA, and the QCMTM Endothelial Cell Invasion Assay (EMD Millipore).
- these methods may be a drug screening methods, a term well known to those skilled in the art, and the candidate agent may be a drug-like compound or lead compound for the development of a drug-like compound.
- a drug-like compound is well known to those skilled in the art, and may include the meaning of a compound that has characteristics that may make it suitable for use in medicine, for example as the active ingredient in a medicament.
- a drug-like compound may be a molecule that may be synthesised by the techniques of organic chemistry, less preferably by techniques of molecular biology or biochemistry, and is preferably a small molecule, which may be of less than 5000 Daltons and which may be water-soluble.
- a drug-like compound may additionally exhibit features of selective interaction with a particular protein or proteins and be bioavailable and/or able to penetrate target cellular membranes or the blood:brain barrier, but it will be appreciated that these features are not essential.
- lead compound is similarly well known to those skilled in the art, and may include the meaning that the compound, whilst not itself suitable for use as a drug (for example because it is only weakly potent against its intended target, non-selective in its action, unstable, poorly soluble, difficult to synthesise or has poor bioavailability) may provide a starting-point for the design of other compounds that may have more desirable characteristics.
- the identified agent is modified, and the modified agent is tested for the ability to modulate binding between CD248 and MMRN2 (or portion(s) or variant(s) thereof).
- the screening methods can be used to identify agents that may be useful in combating any disease or condition involving unwanted, undesirable or inappropriate angiogenesis, such as solid tumours.
- the screening methods preferably also comprise the further step of testing the identified agent or the modified agent for efficacy in an animal model of cancer, particularly a solid tumour.
- Suitable models are known in the art and include Lewis lung carcinoma subcutaneous implants in mice (homograft in Black 57 mice) or HT29 xenografts subcutaneous implants in nude mice.
- the methods may comprise the further step of synthesising and/or purifying the identified agent or the modified agent.
- the methods may further comprise the step of formulating the agent into a pharmaceutically acceptable composition.
- Agents may also be subjected to other tests, for example toxicology or metabolism tests, as is well known to those skilled in the art.
- the invention includes a method for preparing an anti-angiogenic compound that may be useful in the treatment of any disease or condition involving unwanted, undesirable or inappropriate angiogenesis, the method comprising identifying an agent using the screening methods described above and synthesising, purifying and/or formulating the identified agent.
- the invention includes a method for preparing an anti-cancer compound that may be useful in the treatment of a solid tumour, the method comprising identifying an agent using the screening methods described above and synthesising, purifying and/or formulating the identified agent.
- the invention also includes a method of making a pharmaceutical composition comprising the step of mixing the agent identified using the methods described above with a pharmaceutically acceptable carrier. All of the documents referred to herein are incorporated herein, in their entirety, by reference. The invention will now be described by reference to the following Figures and Examples.
- CTLD group 14 family members CLEC14A and CD93 directly bind M MRN2.
- A Diagrams of GFP tagged CTLD group 14 family members showing domain architecture and relative size with number of amino acids (aa) without the GFP tag.
- C-type lectin domain C-type lectin domain (CTLD), sushi, epidermal growth factor (EGF) domain, transmembrane (TM), cytoplasmic tail (cyto) and green fluorescent protein (GFP) tag are displayed.
- B HEK293T were transfected with GFP tagged group 14 family members, lysates were separated by SDS-PAGE under non-reduced conditions and far western blotted with MMRN2 FL , showing MMRN2 FL binds CLEC14A and CD93 but not thrombomodulin or CD248, probing with anti-GFP confirmed expression of all proteins.
- C Immunoprecipitations of CD93 using monoclonal R139 antibody co-immunoprecipitates MMRN2 from HUVEC lysates.
- D Immunoprecipitations of MMRN2 using mouse polyclonal antibodies co-immunoprecipitates CD93 from HUVEC lysates. CD93 was detected using goat polyclonal antibodies in each immunoprecipitation experiment. IgG heavy chains included as loading control.
- FIG. 1 Diagram of MMRN2 truncation mutants. Diagrams of MMRN2 truncation mutants, showing the elastin microfibril interface (EMI) domain, coiled-coil (CC) domain and complement related C1q domain. The minimal CLEC14A binding fragment is highlighted in black.
- EMI elastin microfibril interface
- CC coiled-coil
- CD248 binds to MMRN2 in a distinct region from CLEC14A and CD93 binding.
- A HEK293T transfected with chimeras CLEC14A CD248 ⁇ sushi > and CLEC14A CD248 ⁇ CTLD > were lysed and far western blotted with MMRN2 FL and western blotted with anti-GFP.
- MMRN2 FL binds to CLEC14A and both chimeras CLEC14A CD248 ⁇ sushi > and CLEC14A CD248 ⁇ CTLD > but not CD248-GFP or GFP alone.
- B Immunoprecipitations of GFP tagged proteins after cell surface biotinylation.
- CLEC14A, THBD, CD93 and all four CLEC14A chimeras bind to streptavidin showing they are cell surface expressed. GFP alone was included to demonstrate intracellular proteins are not cell surface biotinylated.
- C MMRN2 truncation mutants were transfected into HEK293T and lysates under reducing conditions were far western blotted with mCD248-ECD-Fc, revealing binding to minimal fragment MMRN2 133"486 . His tag western blot confirmed expression of each MMRN2 protein fragment.
- D mCD248-ECD-Fc pull downs from HUVEC lysates resulted in enrichment of MMRN2 compared to hFc control.
- E Immunofluorescence analysis of HUVEC stained with MMRN2 mouse polyclonal antibodies, human Fc, mCD248-ECD-Fc or CLEC14A-ECD-FC. MMRN2 antibody staining partially co-localises with CD248-ECD- Fc and CLEC14A-ECD-Fc binding, scale bar 40 ⁇ .
- the C-type lectin domain of CLEC14A or CD93 expressed on endothelial cells bind to MMRN2 in the ECM (between residues 530-624) which in turn binds to the CTLD of CD248 expressed by pericytes or fibroblasts (between MMRN2 133-486).
- CLEC14A binding to MMRN2 is dependent upon the 97-108 region in the long loop domain.
- Figure 5. Amino acid sequence alignments of CTLD group 14 family members.
- FIG. 6 Amino acid sequence alignments of human MMRN2 133 486 and corresponding regions from different species.
- PRALINE (39) generated amino acid alignments of MMRN2 regions from human (Accession no. Q9H8L6), bull (E1 BJW3), chimp (H2Q273), rat (D4ABX6), mouse (A6H6E2), chicken (E1 BTB7) and two zebrafish proteins MMRN2a (zebrafish (a)) (F1 R6V5) and MMRN2b (zebrafish (b)) (E7FG77) (SEQ ID Nos: 10-17 respectively).
- FIG. 7 Sequences of human MMRN2.
- A Human MMRN2 polypeptide sequence (SEQ ID No: 1) and polynucleotide coding sequence (SEQ ID No: 2).
- B Human MMRN2 amino acid sequence (SEQ ID No: 60).
- Figure 8. Sequences of human CD248.
- A Human CD248 polynucleotide coding sequence (SEQ ID No: 3).
- B Human CD248 amino acid sequence (SEQ ID No: 4).
- Figure 9 Amino acid sequence alignments of human CD248 30 156 and corresponding regions from different species.
- PRALINE (39) generated amino acid alignments of CD248 regions from human (Accession no. NP_065137.1), bull (XP_003588093.1), chimp (XP_003313194.1), rat (NP_001099795.1), mouse (NP_473383.1), and zebrafish proteins CD248 zebrafish (NP_001092698.3) (SEQ ID Nos: 18-23).
- EXAMPLE 1 MULTIMERIN-2 IS A LIGAND FOR THE C-TYPE LECTIN CD248 SPANNING THE ENDOTHELIAL PERICYTE INTERFACE
- the C-type lectin domain containing group 14 family members CLEC14A and CD93 are proteins expressed by endothelium and implicated in tumour angiogenesis.
- CD248 (alternatively known as endosialin or tumour endothelial marker-1) is also a member of this family and is expressed by tumour associated fibroblasts and pericytes.
- Multimerin-2 (MMRN2) is a unique endothelial specific extracellular matrix protein that has been implicated in angiogenesis and tumour progression.
- Angiogenesis describes the formation of new blood vessels from existing vessels and is an integral part of reproduction, embryonic development and wound healing. Angiogenesis is mostly dormant in healthy adults but is a component of numerous pathologies including cancer, diabetic retinopathy and atherosclerosis (1). The ability to control angiogenesis would provide significant therapeutic value and understanding the underlying molecular events is critical in this pursuit.
- CD248 has also been shown to play roles in angiogenesis, particularly in vessel regression during vascular patterning (11).
- CD248 has been described as a marker of pericytes associated with tumour vasculature in glioma (12), and is elevated in the stroma of many other tumours including colorectal, melanoma and invasive glioblastoma (13-15).
- CD248 is actively being pursued as a cancer target with clinical trials underway (16).
- the endothelial specific cell surface glycoprotein CLEC14A has been identified as a tumour endothelial marker, due to its greater expression in the tumour vasculature than vessels in healthy tissue (2).
- CLEC14A is shed from the cell membrane and has roles in regulating sprouting angiogenesis (3-5).
- CD93 is also overexpressed in tumour endothelium and recent studies confirm a role in tumour angiogenesis (6-8).
- CD248 endosialin or TEM1 is not expressed by endothelium but is found on pericytes and tumour associated fibroblasts of multiple tumour types (9).
- CTLD group 14 family members CLEC14A and CD93 directly bind MMRN2
- MMRN2 we previously identified MMRN2 as a CLEC14A binding partner (3), to examine whether other CTLD group 14 members also bind MMRN2, we employed far western blotting using a MMRN2 protein probe to test for direct protein-protein interactions.
- the CTLD group 14 members CLEC14A, CD93, thrombomodulin and CD248 were constructed with C-terminal green fluorescent protein (GFP) tags ( Figure 1A), transfected into HEK293T cells and lysates were separated by SDS-PAGE under non-reducing conditions maintaining disulphide bonds.
- GFP green fluorescent protein
- HUVEC lysate was immunoprecipitated with polyclonal MMRN2 antibodies or the previously validated CD93 monoclonal antibody R139 (19;20). This resulted in MMRN2 enrichment in CD93 immunoprecipitations ( Figure 1 C) and CD93 enrichment in MMRN2 immunoprecipitations ( Figure 1 D).
- CD248 binds to a separate region of MMRN2 from CLEC14A and CD93 binding
- transfected HEK293T were cell surface biotinylated before anti-GFP immunoprecipitation. Probing with streptavidin-HRP confirmed CLEC14A, CD93, thrombomodulin and chimeras were expressed on the cell surface ( Figure 3B).
- MMRN2 constructs were generated, each lacking major domains ( Figure 2A). These included MMRN2 FL , EMI and coiled-coil (MMRN2 EMI"CC ), coiled-coil and C1 q (MMRN2 CC - C1 c ⁇ ), coiled-coil alone (MMRN2 CC ) and the coiled-coil halved (MMRN2 133-486 and MMRN2 487"820 ). Constructs were transfected into HEK293T and lysates subjected to far western blot analysis.
- MMRN2 staining revealed fibrous meshes in the ECM which partially co-localised with mCD248-ECD-Fc or CLEC14A-ECD-Fc binding but not hFc alone ( Figure 3E).
- Table 1 A summary of which CTLD group 14 family members bind to which regions of MMRN2.
- CLEC14A and CD248 bind MMRN2 simultaneously at the interface between endothelium and pericytes in human pancreatic cancer
- the CTLD group 14 family are important emerging molecules in tumour angiogenesis.
- CD248 has demonstrated CD248 as being able to bind the CLEC14A ECM ligand MMRN2.
- the CD248-MMRN2 interaction offers explanations to previous findings.
- the CD248-ECD has been used as a binding probe in immunofluorescence studies on mouse tissues and different cultured cell types (1 1), revealing characteristic ECM staining only occurring on endothelial cells, likely dependent on MMRN2.
- CD248-MMRN2 interactions occur on a separate region from CLEC14A and CD93 binding suggesting endothelial expressed CTLD group 14 members can bind to MMRN2 simultaneously with CD248 expressed by other cell types such as pericytes and fibroblasts.
- Antibodies mouse anti-His clone AD1.1 (R&D Systems, #MAB050), anti-GFP mouse clone 3E1 (Cancer Research UK), anti-MMRN2 mouse polyclonal (Abnova/Novus Biologicals, #H00079812-B01 P), anti-CD93 mouse clone R139 (eBioscience, #14-0939), anti-CD93 goat polyclonal (R&D Systems, #AF2379), anti-Tubulin mouse clone DM1A (Sigma-Aldrich, #T9026), anti-fibronectin sheep polyclonal (R&D Systems, #AF1918), mouse IgG isotype control (Thermo Scientific, #10400C), human IgG Fc (Bethyl Laboratories #P80-104) (sodium azide removed by dialysis against PBS), anti-human IgG Fc horse radish peroxidase (HRP) conjugated (Sigma-Aldrich #A01
- MMRN2 fragments were amplified using; (MMRN2 EMI"CC ; MMRN2 FL Forward CCGGACCGGTCAGGCTTCCAGTACTAGCC (SEQ ID No: 44) and MMRN2 820 Reverse CTACTAGGTACCCCAGAGCGCCGCGCCC (SEQ ID No: 45)). (MMRN2 CC - C1c ⁇ ; MMRN2 133 Forward CCGGACCGGTGATTCCATGGCAATCCCTGA (SEQ ID No: 46) and MMRN2 FL Reverse CGGGGTACCGGTCTTAAACATCAGGAAGC (SEQ ID No: 47)). (MMRN2 CC ; MMRN2 133 Forward and MMRN2 820 reverse).
- MMRN2 133"486 MMRN2 133 Forward and MMRN2 486 Reverse CTACTAGGTACCCTTGATGAGGTCGGCATGG (SEQ ID No: 48)).
- MMRN2 487"820 MMRN2 487 Forward
- PCR products digested with Agel and Kpnl were ligated into pHL-Avitag3 containing an N-terminal signal peptide (SP), C-terminal BirA and His tag (36).
- Lentiviral vectors were constructed by Gibson reaction between Pmel sites using primers. mCLEC14A-ECD; forward ACTAGCCTCGAGGTTTAAACATGAGGCCAGCGCTTGCC (SEQ ID No: 50) and reverse
- mFc alone fused to CLEC14A SP mCLEC14A SP forward AGACTAGCCTCGAGGTTTAAACATGAGGCCAGCGCTTGC (SEQ ID No: 54) and mCLEC14A SP reverse TGAGGATCCCTCCCCATTCCCTGGCCG (SEQ ID No: 55), and mFc fused to SP; forward AATGGGGAGGGATCCTCATCGAGTGTG (SEQ ID No: 56) and reverse TCCTGCAGCCCGTAGTTTTCATTTACCAGGAGAGTGG (SEQ ID No: 57).
- mMMRN2 495"678 inserted between engineered BamHI site separating the SP and mFc; forward CAGGGAATGGGGAGGGATCCCAAAGGGTCAACTCTGACG (SEQ ID No: 58) and reverse GGCACACTCGATGAGGATCCCAACTGTGGGTGCTGCTC (SEQ ID No: 59).
- CD93 amplified from pCDNA3 CD93, a gift from Suzanne Bohlson.
- CLEC14A domain deletions were generated previously in pCS2 plasmids (4).
- CLEC14A-ECD-Fc was expressed and purified as described (3).
- HUVEC Cell culture and plasmid transfections HUVEC were isolated from fresh umbilical cords collected at the Birmingham Women's Hospital with informed consent and cultured as described previously (2). HUVEC experiments used at least three distinct preparations from different cords. HEK293T were cultured as described (3). Transfections and lentiviral transductions were performed as previous (4).
- Transfected HEK293T were washed twice with PBS containing Mg 2+ and Ca 2+ and then EZ-Link Sulfo-NHS-Biotin (Thermo Scientific # 21217) was incubated at 1 mg/mL in PBS for 30 minutes. Biotinylation reaction was quenched using 100 mM glycine and cells were washed twice with PBS. Immunoprecipitations were performed as previously described with 2-5 ⁇ g of antibody or Fc tagged protein (3).
- HUVEC on gelatin coated coverslips were cultured for 6 days, media replaced every 2 days, fixed and blocked as described without permeabilisation (37). Incubated with anti- MMRN2 (Abnova, 4 g/mL) and hFc, mCD248-ECD-Fc or CLEC14A-ECD-Fc (all 20 g/mL) for 2 hours. Detection antibodies; anti-human alexafluor-555 and anti-mouse alexafluor-488 incubated for 1.5 hours.
- 96 well plates were coated with mCD248-ECD-Fc (400 ng) in PBS overnight (4°C), then blocked (PBS 3% (w/v) BSA).
- MMRN2 FL transfected HEK293T lysates (6x10 6 cells/mL) were added diluted in PBS (1 :50).
- CLEC14A-ECD-Fc 200 ng
- anti-His tag antibodies 200 ng
- Example 1 Carmeliet P. Angiogenesis in health and disease. Nat Med 2003 Jun;9(6):653-60. Mura M, Swain RK, Zhuang X, Vorschmitt H, Reynolds G, Durant S, et al. Identification and angiogenic role of the novel tumor endothelial marker CLEC14A. Oncogene 2012 Jan 19;31 (3):293-305.
- Rho SS Choi HJ, Min JK, Lee HW, Park H, Park H, et al.
- Clec14a is specifically expressed in endothelial cells and mediates cell to cell adhesion.
- a core human primary tumor angiogenesis signature identifies the endothelial orphan receptor ELTD1 as a key regulator of angiogenesis. Cancer Cell 2013 Aug 12;24(2):229-41.
- Endosialin is a marker of tumor-associated pericytes in high-grade glioma. Mod Pathol 2008 Mar;21 (3):308-15.
- the mesenchymal stem cell marker CD248 (endosialin) is a negative regulator of bone formation in mice. Arthritis Rheum 2012 Oct;64(10):3334-43.
- EndoGlyx-1 an EMILIN-like multisubunit glycoprotein of vascular endothelium. J Biol Chem 2001 Dec 21 ;276(51):48588- 95.
- Petrenko O Beavis A, Klaine M, Kittappa R, Godin I, Lemischka IR.
- MULTIMERIN2 binds VEGF-A primarily via the carbohydrate chains exerting an angiostatic function and impairing tumor growth. Oncotarget 2015 Dec 9.
- Nepomuceno RR Tenner AJ.
- C1qRP the C1 q receptor that enhances phagocytosis, is detected specifically in human cells of myeloid lineage, endothelial cells, and platelets. J Immunol 1998 Feb 15; 160(4): 1929-35.
- RhoJ interacts with the GIT-PIX complex and regulates focal adhesion disassembly. J Cell Sci 2014 Jul 15; 127(Pt 14):3039-51.
- RhoJ/TCL regulates endothelial motility and tube formation and modulates actomyosin contractility and focal adhesion numbers.
- Simossis VA Heringa J. PRALINE: a multiple sequence alignment toolbox that integrates homology-extended and secondary structure information. Nucleic Acids Res 2005 Jul 1 ;33(Web Server issue):W289-W294.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Biochemistry (AREA)
- Mycology (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Epidemiology (AREA)
- Cell Biology (AREA)
- Toxicology (AREA)
- Zoology (AREA)
- Gastroenterology & Hepatology (AREA)
- Endocrinology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention provides an agent that modulates the interaction between multimerin 2 (MMRN2) and CD248, a portion of MMRN2 or a variant thereof, a portion of CD248 or a variant thereof, that modulates the interaction between CD248 and MMRN2. The invention5 provides antibodies and compounds comprising said portions and either a cytotoxic moiety or a detectable moiety.
Description
MODULATORS OF THE INTERACTION OF CD248 WITH ITS LIGAND MULTIMERIN 2
The invention relates generally to endothelium and pericyte specific genes and polypeptides, modulators of these endothelium and pericyte specific genes/polypeptides, and the use of agents that bind to these polypeptides for imaging and targeting neovasculature. In particular, the present invention relates to portions of multimerin 2 (MMRN2) and CD248, and specifically to portions of MMRN2 and CD248 that modulate the interaction between MMRN2 and CD248. The invention also relates to antibodies that bind to said portions.
The listing or discussion of an apparently prior published document in this specification should not necessarily be taken as an acknowledgement that the document is part of the state of the art or is common general knowledge. Endothelial cells form a single cell layer that lines all blood vessels and regulates exchanges between the blood stream and the surrounding tissues. New blood vessels develop from the walls of existing small vessels by the outgrowth of endothelial cells in the process called angiogenesis. Endothelial cells even have the capacity to form hollow capillary tubes when isolated in culture. Once the vascular system is fully developed, endothelial cells of blood vessels normally remain quiescent with no new vessel formation, with the exception of the formation of new blood vessels in natural wound healing. However, some tumours attract a new blood supply by secreting factors that stimulate nearby endothelial cells to construct new capillary sprouts. Angiogenesis describes the formation of new blood vessels from existing vessels and is an integral part of reproduction, embryonic development and wound healing. Angiogenesis is mostly dormant in healthy adults but is a component of numerous pathologies including cancer, diabetic retinopathy and atherosclerosis (1). Angiogenesis plays a major role in the progression of solid tumours and is widely recognised as a rate- limiting process in the growth of solid tumours. Tumours that fail to attract a blood supply are severely limited in their growth. Thus, the ability to control angiogenesis would provide significant therapeutic value and understanding the underlying molecular events is critical in this pursuit. The development of new blood vessels is essential for both local tumour progression and the development of distant metastases. Indeed, the growth and survival of tumours is dependent on their ability to obtain a blood supply and damage inflicted on the tumour
endothelium has been shown to effectively eradicate tumours (Burrows et al (1993) "Eradication of large solid tumors in mice with an immunotoxin directed against tumor vasculature." Proc Natl Acad Sci USA, 90(19): 8996-9000). Tumour angiogenesis involves the degradation of the basement membrane by activated tissue or circulating endothelial precursors, proliferation and migration of endothelial cells, interaction with the extracellular matrix, morphological differentiation, cell adherence and vascular tube formation. Inhibition of tumour angiogenesis is thus a target for anti-tumour therapies, employing either angiogenesis inhibitors alone or in combination with standard cancer treatments. However, targeting anti-tumour agents to the site of angiogenesis depends upon the identification of specific markers of tumour angiogenesis. It is now accepted that the growth of solid tumours is dependent on their capacity to acquire a blood supply, and much effort has been directed towards the development of anti-angiogenic agents that disrupt this process. It has also become apparent that targeted destruction of the established tumour vasculature is another avenue for exciting therapeutic opportunities, and the discovery of widely expressed tumour endothelial markers promises much clinical benefit (Neri & Bicknell (2005) "Tumour vascular targeting." Nat Rev Cancer 5(6): 436-446).
The inventors have previously identified CLEC14A as a tumour endothelial marker (WO 201 1/027132). Available data on CLEC14A suggests that manipulation of CLEC14A levels or function blocking antibodies will regulate endothelial migration (WO201 1/027132).
The inventors previously demonstrated that the interaction between CLEC14A and MMRN2 plays an important role in angiogenesis (PCT/GB2016/050134). MMRN2 is an endothelial specific marker of the emilin family and a component of the extracellular matrix. MMRN2 is an extracellular interacting protein for CLEC14A and was found to be co- expressed with CLEC14A in the tumour vasculature.
The inventors have also previously demonstrated that CD93 as well as CLEC14A can directly bind to MMRN2 (GB 1612860.5). Binding of CLEC14A and CD93 has been mapped to a non-glycosylated coiled-coil region of MMRN2, and a CLEC14A and CD93 binding portion of MMRN2 has been shown both to disrupt angiogenesis in an in vitro assay and increase adherence of HUVEC cells. Further, the portion of MMRN2 expressed by Lewis lung carcinoma cells inhibited their growth in vivo.
The inventors have now shown that CD248 can directly bind to MMRN2. Binding of CD248 to MMRN2 has been shown to involve a non-glycosylated coiled-coil region of MMRN2
and the C-type Lectin Domain (CTLD) of CD248 (see Example 1). Further, the inventors have shown that both CLEC14A and CD248 can bind MMRN2 simultaneously (see Example 1). CD248-MMRN2 interactions occur on a separate region from CLEC14A and CD93 binding, suggesting endothelial expressed CTLD group 14 members can bind to MMRN2 simultaneously with CD248 expressed by other cell types such as pericytes or fibroblasts. This offers a scenario where MMRN2 acts as an "extracellular glue" between both cell types in vessel formation and maturation. This adds to the list of ECM proteins along with collagen I and IV and fibronectin already described as potential CD248 ligands (33). Taken together, the inventors' findings propose previously unknown protein interactions, and new therapeutic avenues in inhibiting angiogenesis and combating cancer.
Agents that modulate the interaction between MMRN2 and CD248 Accordingly, a first aspect of the invention provides agents that modulate the interaction between CD248 and multimerin 2 (MMRN2).
MMRN2 is a protein belonging to the member of elastin microfibril interface-located (EMI LIN) protein family with a signal peptide at residues 1-22. The mature human polypeptide is 927 amino acids in length (amino acid residues 23-949) and contains a 79 amino acid EMI domain (residues 54 - 132), a 688 amino acid coiled-coil domain (residues 133-820), and a C1q domain (residues 821-949).
The gene MMRN2 is located at 10q23.2 and encodes a 949 amino acid residue polypeptide. By the MMRN2 polypeptide we include the meaning of a gene product of human MMRN2, including naturally occurring variants thereof. Human MMRN2 polypeptide includes the amino acid sequence found in Genbank Accession No NP_079032.2 and naturally occurring variants thereof. The MMRN2 polypeptide sequence from NP_079032.2 is shown in Figure 7 (SEQ ID No: 1). Also included are MMRN2 orthologues found in other species, such a such as in horse, bull, chimp, chicken, zebrafish, dog, pig, cow, sheep, rat, mouse, guinea pig or a primate. A cDNA sequence corresponding to a human MMRN2 mRNA is found in Genbank Accession No NM_024756.2, and the coding region is also shown in Figure 7 (SEQ ID No: 2). CD248 is a type I transmembrane protein with a signal peptide at residues 1-17. The mature human polypeptide is 740 amino acids in length (amino acid residues 18-757 and contains a 670 residue extracellular region (residues 18-687), a transmembrane region
(residues 688-708), and a cytoplasmic region (residues 709-757). The extracellular region contains a C-type lectin like domain (residues 30-156), a sushi domain (residues 162 - 232) and three EGF-like regions (residues 235-272, 273-313 and 314-354). The gene CD248 is located at 1 1q13.2 and encodes a 757 amino acid residue polypeptide with a predicted MW of 80.9 KDa. By the CD248 polypeptide we include the meaning of a gene product of human CD248, including naturally occurring variants thereof. Human CD248 polypeptide includes the amino acid sequence found in Genbank Accession No NP_065137.1 , and naturally occurring variants thereof. The CD248 polypeptide sequence from NP_065137.1 is shown in Figure 8 (SEQ ID No: 4). Also included are CD248 orthologues found in other species, such as in horse, dog, pig, cow, sheep, rat, mouse, guinea pig or a primate. A cDNA sequence corresponding to a human CD248 mRNA is found in Genbank Accession No NM_020404.2, and the coding region is also shown in Figure 8 (SEQ ID No: 3).
By "natural variants" of MMRN2 and CD248 we include, for example, allelic variants. Typically, these will vary from the given sequence by only one or two or three, and typically no more than 10 or 20 amino acid residues. Typically, the variants have conservative substitutions.
By "agents that modulate the interaction between MMRN2 and CD248" in the context of the first aspect of the invention, we include the meaning of any synthetic or natural molecule, that modulates the interaction between MMRN2 and CD248. For example, the agent may be one that modulates the level of binding between CD248 and MMRN2, as compared to the level of binding between CD248 and MMRN2 in the absence of the agent. Suitable methods for detecting and/or measuring (quantifying) the binding between CD248 and MMRN2 are well known to those skilled in the art. Examples of appropriate methods include pull-down assays, enzyme linked immunosorbent assays (ELISA), surface plasmon resonance assays, chip-based assays, immunocytofluorescence, yeast two- hybrid technology and phage display, which are common practice in the art and are described, for example, in Plant et al (1995) Analyt Biochem, 226(2), 342-348. and Sambrook et al (2001) Molecular Cloning A Laboratory Manual. Third Edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. Other methods of detecting binding between CD248 and MMRN2 include ultrafiltration with ion spray mass spectroscopy/HPLC methods or other physical and analytical methods. Fluorescence Energy Resonance Transfer (FRET) methods, for example, well known to those skilled in the art, may be used, in which binding of two fluorescent labelled entities (i.e. CD248 and
MMRN2 or portions or variants thereof) may be measured by measuring the interaction of the fluorescent labels when in close proximity to each other.
By "modulate the interaction" between CD248 and MMRN2, we include the meaning of an agent that reduces the level of binding between CD248 and MMRN2, as compared to the level of binding between CD248 and MMRN2 in the absence of the agent. Thus, the agent may be an inhibitor or an antagonist of the interaction between CD248 and MMRN2. Preferably, the agent is one that reduces the level of binding between CD248 and MMRN2 by at least 10%, 20%, 30%, 40% or 50%, and more preferably the agent is one that reduces the level of binding between CD248 and MMRN2 by at least 70%, 80%, 90%, 95% or 99%. Most preferably, the agent is one that reduces the level of binding between CD248 and MMRN2 to an undetectable level, or eliminates binding between CD248 and MMRN2. By "modulate the interaction" between CD248 and MMRN2, we also include the meaning of an agent that enhances the level of binding between CD248 and MMRN2, as compared to the level of binding between CD248 and MMRN2 in the absence of the agent. Thus, the agent may be an activator of the interaction between CD248 and MMRN2. Preferably, the agent is one that enhances the level of binding between CD248 and MMRN2 by at least 10%, 20%, 30%, 40% or 50%, and more preferably the agent is one that enhances the level of binding between CD248 and MMRN2 by at least 70%, 80%, 90%, 95% or 99%.
In one embodiment, the agent is one that enhances the level of binding between CD248 and MMRN2 by at least 10%, 20%, 30%, 40% or 50%, and more preferably the agent is one that enhances the level of binding between CD248 and MMRN2 by at least 70%, 80%, 90%, 95% or 99%.
Preferably, the agent is one that reduces the level of binding between CD248 and MMRN2, and so is an inhibitor of the interaction.
In a preferred embodiment, the agent of the first aspect of the invention is one that selectively modulates the interaction between CD248 and MMRN2. By an agent which selectively modulates the interaction, we include the meaning that the agent modulates the interaction between CD248 and MMRN2 to a greater extent than it modulates the interaction between two irrelevant polypeptides, such as an interaction between human serum albumin and another peptide. Preferably, the agent modulates the interaction between CD248 and MMRN2 at least 5, or at least 10, or at least 50 times more than it
modulates the interaction between two irrelevant polypeptides. More preferably, the agent modulates the interaction between CD248 and MMRN2 at least 100, or at least 1 ,000, or at least 10,000 times more than it modulates the interaction between two irrelevant polypeptides.
Thus, the agent may be one that selectively inhibits the interaction between CD248 and MMRN2. For example, the agent may inhibit the interaction between CD248 and MMRN2 to a greater extent than it inhibits the interaction between two irrelevant polypeptides, such as an interaction between human serum albumin and another peptide. Preferably, the agent inhibits the interaction between CD248 and MMRN2 at least 5, or at least 10, or at least 50 times more than it inhibits the interaction between two irrelevant polypeptides. More preferably, the agent inhibits the interaction between CD248 and MMRN2 at least 100, or at least 1 ,000, or at least 10,000 times more than it inhibits the interaction between two irrelevant polypeptides.
Therefore, in a preferred embodiment, the agent of the first aspect of the invention is one that inhibits the interaction between CD248 and MMRN2. In a particularly preferred embodiment, the agent of the first aspect of the invention is one that selectively inhibits the interaction between CD248 and MMRN2.
The agent may be one that selectively enhances the interaction between CD248 and MMRN2. For example, the agent may enhance the interaction between CD248 and MMRN2 to a greater extent than it enhances the interaction between two irrelevant polypeptides, such as an interaction between human serum albumin and another peptide. Preferably, the agent enhances the interaction between CD248 and MMRN2 at least 5, or at least 10, or at least 50 times more than it enhances the interaction between two irrelevant polypeptides. More preferably, the agent enhances the interaction between CD248 and MMRN2 at least 100, or at least 1 ,000, or at least 10,000 times more than it enhances the interaction between two irrelevant polypeptides.
Accordingly, in an embodiment, the agent of the first aspect of the invention is one that enhances the interaction between CD248 and MMRN2. In a further embodiment, the agent of the first aspect of the invention is one that selectively enhances the interaction between CD248 and MMRN2
It is appreciated that the agent itself may modulate the interaction between CD248 and MMRN2 directly {eg by binding to CD248 or MMRN2). Thus, it is appreciated that the
agent itself may inhibit or enhance the interaction between CD248 and MMRN2 directly (eg by binding to CD248 or MMRN2).
For the avoidance of doubt, by an agent that modulates the interaction between CD248 and MMRN2, we also include the meaning of prodrugs thereof. For example, the agent may be administered as a prodrug which is metabolised or otherwise converted into its active form once inside the body of a subject. The term "prodrug" as used in this application refers to a precursor or derivative form of a pharmaceutically active substance that is less active compared to the parent drug and is capable of being enzymatically activated or converted into the more active parent form (see, for example, D. E. V. Wilman "Prodrugs in Cancer Chemotherapy" Biochemical Society Transactions 14, 375-382 (615th Meeting, Belfast 1986) and V. J. Stella et al. "Prodrugs: A Chemical Approach to Targeted Drug Delivery" Directed Drug Delivery R. Borchardt et al (ed.) pages 247-267 (Humana Press 1985)).
Agents that are especially active at modulating tumour angiogenesis are preferred for anticancer therapeutic agents, and they can be selected for this activity using methods well known in the art and as described below. In a preferred embodiment, the agent of the first aspect of the invention is one that binds to CD248, and more preferably is one that selectively binds to CD248. By an agent that selectively binds to CD248, we include the meaning that the agent binds CD248 with a greater affinity than for an irrelevant polypeptide such as human serum albumin. Preferably, the agent binds CD248 with at least 5, or at least 10 or at least 50 times greater affinity than for the irrelevant polypeptide. More preferably, the agent binds the CD248 with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than for the irrelevant polypeptide. Such binding may be determined by methods well known in the art, such as one of the Biacore® systems. Thus, the agent may be one that competes with MMNR2 for specific binding to the CD248 polypeptide. Whether or not a given agent selectively binds to the MMRN2 binding region or competes with MMRN2 for specific binding to the CD248 polypeptide can be determined using routine methods in the art such as competition binding studies. For example, binding of CD248 to the given agent can be assessed following pre-incubation with varying concentrations of MMRN2. It is preferred that the agent that binds to CD248 does not bind to thrombomodulin, or that the agent binds CD248 with a greater affinity than for thrombomodulin. Preferably, the agent binds to CD248 with at least 5, or at least 10 or at least 50 times greater affinity than
for thrombomodulin. More preferably, the agent binds to CD248 with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than for thrombomodulin. Such binding may be determined by methods well known in the art, such as one of the Biacore® systems. Typically, the agent selectively binds to CD248, and binds to the mature polypeptide (residues 18-757), and not to the signal peptide (residues 1-17).
In a preferred embodiment, the agent is one that binds to the extracellular domain of CD248. By "extracellular domain" we include the meaning of the region corresponding to residues 18-687 of the human CD248 polypeptide. The extracellular domain in other CD248 orthologues or variants can be readily identified by alignment.
By the region corresponding to the region spanning amino acid residues 18-687 of human CD248, we include the meaning of a region in a CD248 orthologue or variant that aligns to the region spanning amino acid residues 18-687 of human CD248 when the sequence of the CD248 orthologue or variant is compared to the human CD248 sequence by alignment.
By "corresponding region" as used herein we include the meaning of the region in a CD248 or MMRN2 orthologue or variant which aligns to the given region in human CD248 or human MMRN2 when the human CD248 and the CD248 orthologue or variant, or when the human MMRN2 and the MMRN2 orthologue or variant, are compared by alignment, such as with CLUSTALW. In an embodiment, the agent is one that binds to the SUSHI domain of CD248. The SUSHI domain of CD248 corresponds to amino acid residues 162-232 of human CD248 and the SUSHI domain in other CD248 orthologues or variants can be readily identified by alignment. In an embodiment, the agent is one that binds to one of the three EGF-like domains of CD248. The EGF-like domains of CD248 correspond to amino acid residues 235-272, 273-313 and 314-354 of human CD248 and the EGF-like domains in other CD248 orthologues or variants can be readily identified by alignment. In a particularly preferred embodiment, the agent is one that binds to the C-type lectin Domain (CTLD) of CD248. The CTLD of CD248 corresponds to amino acid residues 30-
156 of human CD248, and the CTLD in other CD248 orthologues or variants can be readily identified by alignment.
In one embodiment, the agent binds to the long-loop region of CD248. The long-loop of human CD248 corresponds to amino acid residues Q88-C131 (Figure 5), and the long- loop in other CD248 orthologues or variants can be readily identified by alignment.
In a preferred embodiment, the agent is one that binds to the MMRN2 binding region of CD248. By "MMRN2 binding region" we include the meaning of the region corresponding to residues 30-156 of the human CD248 polypeptide.
The inventors have previously shown that the interaction between MMRN2 and CLEC14A is dependent on cysteine residues 103 and 138 of human CLEC14A (GB 1612860.5). These cysteine residues are conserved in human CD248 (Example 1) and correspond to cysteine-94 and cysteine-126 of human CD248, and so in one embodiment, the agent of the first aspect of the invention, does not bind to a mutant CD248 polypeptide in which the cysteine corresponding to cysteine-94 of human CD248 is mutated and/or the cysteine corresponding to cysteine-126 of human CD248 is mutated. By cysteine corresponding to cysteine-94 or cysteine-126 of human CD248, we include the meaning of cysteines in other CD248 orthologues or variants that align to cysteine-94 or cysteine-126 in human CD248 when the CD248 orthologue or variant and human CD248 are compared by alignment. Of course, when the CD248 is human CD248, the cysteines corresponding to cysteine-94 and cysteine-126 will be cysteine-94 and cysteine-126. In another embodiment, the agent of the first aspect of the invention is one which binds to MMRN2, and more preferably is one that selectively binds to MMRN2. By an agent that selectively binds to MMRN2, we include the meaning that the agent binds MMRN2 with a greater affinity than for an irrelevant polypeptide such as human serum albumin. Preferably, the agent binds MMRN2 with at least 5, or at least 10 or at least 50 times greater affinity than for the irrelevant polypeptide. More preferably, the agent binds the MMRN2 with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than for the irrelevant polypeptide. Such binding may be determined by methods well known in the art, such as one of the Biacore® systems. Thus, the agent may be one that competes with CD248 for specific binding to the MMRN2 polypeptide. Whether or not a given agent selectively binds to the MMRN2 binding region or competes with CD248 for specific binding to the MMRN2 polypeptide can be determined using routine methods in the art
such as competition binding studies. For example, binding of MMRN2 to the given agent can be assessed following pre-incubation with varying concentrations of CD248.
Typically, the agent selectively binds to MMRN2 and binds to the mature polypeptide (residues 23-949), and not to the signal peptide (residues 1-22).
In a further embodiment, the agent binds to the CD248 binding region of the MMRN2 polypeptide. By "CD248 binding region" we include the region corresponding to residues 133-486 of the human MMRN2 polypeptide. Preferably, the agent binds to the coiled-coil domain of the MMRN2 polypeptide or part thereof, and more preferably the agent binds to a region spanning amino acids 133-486 of MMRN2. Thus, it will be appreciated that the agent does may not bind to a region spanning amino acids 487-820 of MMRN2.
In an embodiment, the agent of the first aspect of the invention is any one of a polypeptide, a peptide, an antibody a polynucleotide, a peptidomimetic, a natural product, a carbohydrate, an aptamer or a small molecule.
In a preferred embodiment, the agent is a polypeptide, a peptide, an antibody or a peptidomimetic.
Particular examples of what the agent may be are described below, and methods for identifying suitable agents feature in a subsequent aspect of the invention.
It will be appreciated that polypeptide agents that modulate the interaction between CD248 and MMRN2 may be administered directly, or may be administered in the form of a polynucleotide that encodes the agent. Thus, as used herein, unless the context demands otherwise, by administering to the individual an agent that modulates the interaction between CD248 and MMRN2 which agent is a polypeptide, we include the meanings of administering the inhibitor directly, or administering a polynucleotide that encodes the inhibitor, typically in the form of a vector. Similarly, as used herein, unless the context demands otherwise, by a medicament or a composition comprising an agent that inhibits the interaction between CD248 and MMRN2 which is a polypeptide, we include the meanings that the medicament or composition comprises the agent itself, or comprises a polynucleotide that encodes the agent.
It will be appreciated that the agent may be a peptidomimetic that modulates the interaction between CD248 and MMRN2. The term "peptidomimetic" refers to a compound that
mimics the conformation and desirable features of a particular peptide as a therapeutic agent, but that avoids the undesirable features. For example, morphine is a compound which can be orally administered, and which is a peptidomimetic of the peptide endorphin. Antibodies
It will be appreciated that the agent may be an antibody that modulates the interaction between CD248 and MMRN2. The antibody may be one that binds to either of CD248 or MMRN2 and preferably does so selectively. For instance, the antibody may bind specifically to regions of CD248 and/or MMRN2 that are involved either directly or indirectly in the interaction between CD248 and MMRN2. For example, the antibody may bind to the MMRN2 binding site in CD248 and so directly block binding of MMRN2, or the antibody may bind to a region of CD248 outside the MMRN2 binding site that is nevertheless required for a stable interaction and so indirectly affects binding to MMRN2. Similarly, the antibody may bind to the CD248 binding site in MMRN2 and so directly block binding of CD248, or the antibody may bind to a region of MMRN2 outside the CD248 binding site that is nevertheless required for a stable interaction and so indirectly affects binding to CD248. Further antibodies of the invention are discussed in more detail below.
Suitable antibodies which bind to CD248 or MMRN2, or to specified portions thereof, can be made by the skilled person using technology long-established in the art. Methods of preparation of monoclonal antibodies and antibody fragments are well known in the art and include hybridoma technology (Kohler & Milstein (1975) "Continuous cultures of fused cells secreting antibody of predefined specificity. Nature 256: 495-497); antibody phage display (Winter et al (1994) "Making antibodies by phage display technology." Annu. Rev. Immunol. 12: 433-455); ribosome display (Schaffitzel et al (1999) "Ribosome display: an in vitro method for selection and evolution of antibodies from libraries." J. Immunol. Methods 231 : 119-135); and iterative colony filter screening (Giovannoni et al (2001) "Isolation of anti-angiogenesis antibodies from a large combinatorial repertoire by colony filter screening." Nucleic Acids Res. 29: E27). Further, antibodies and antibody fragments suitable for use in the present invention are described, for example, in the following publications: "Monoclonal Hybridoma Antibodies: Techniques and Application", Hurrell (CRC Press, 1982); "Monoclonal Antibodies: A Manual of Techniques", H. Zola, CRC Press, 1987, ISBN: 0-84936-476-0; "Antibodies: A Laboratory Manual' 1st Edition, Harlow & Lane, Eds, Cold Spring Harbor Laboratory Press, New York, 1988. ISBN 0-87969-314-
2; "Using Antibodies: A Laboratory Manua 2nd Edition, Harlow & Lane, Eds, Cold Spring Harbor Laboratory Press, New York, 1999. ISBN 0-87969-543-9; and "Handbook of Therapeutic Antibodies" Stefan Dubel, Ed., 1st Edition, - Wiley-VCH, Weinheim, 2007. ISBN: 3-527-31453-9.
By an antibody that selectively binds to CD248 or MMRN2, we include the meaning that the antibody molecule binds CD248 or MMRN2 with a greater affinity than for an irrelevant polypeptide, such as human serum albumin (HSA). Preferably, the antibody binds the CD248 or MMRN2 with at least 5, or at least 10 or at least 50 times greater affinity than for the irrelevant polypeptide. More preferably, the antibody molecule binds the CD248 or MMRN2 with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than for the irrelevant polypeptide. Such binding may be determined by methods well known in the art, such as one of the Biacore® systems. It is preferred that the antibody that selectively binds CD248 or MMRN2 does not bind a related polypeptide, such as thrombomodulin in the case of CD248 or multimerin 1 in the case of MMRN2, or that the antibody molecule binds CD248 or MMRN2 with a greater affinity than for the related polypeptide, such as thrombomodulin in the case of CD248 or multimerin 1 in the case of MMRN2. Preferably, the antibody binds the CD248 or MMRN2 with at least 5, or at least 10 or at least 50 times greater affinity than for the related polypeptide. More preferably, the antibody molecule binds the CD248 or MMRN2 with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than for the related polypeptide. Such binding may be determined by methods well known in the art, such as one of the Biacore® systems.
It is preferred if the antibodies have an affinity for CD248 or MMRN2 of at least 10"5 M, 10"6 M, or 10"7 M and more preferably 10"8 M, although antibodies with higher affinities, e.g. 10"9 M, or higher, may be even more preferred. In a particularly preferred embodiment, the antibody is one that selectively binds to the CD248 polypeptide.
Typically, the antibody that selectively binds to CD248 binds to the mature peptide (residues 18-757) and not to the signal peptide (residues 1-17). Preferably, the antibody that selectively binds CD248 binds to the extracellular region of CD248 (residues 18-687). The antibody may bind to one of the three EGF-like regions (residues 235-272, 273-313 and 314-354), or to the SUSHI domain (residues 162-232), but it is preferred if the antibody
binds to the C-type lectin domain (residues 30-156) or the long-loop region of CD248 (residues Q88-C131).
It is especially preferred if the antibody that selectively binds to the CD248 polypeptide, selectively binds to the MMRN2 binding region of the CD248 polypeptide within the C-type lectin domain. Thus, the antibody may be one that competes with MMNR2 for specific binding to the CD248 polypeptide. Whether or not a given antibody selectively binds to the MMRN2 binding region or competes with MMRN2 for specific binding to the CD248 polypeptide can be determined using routine methods in the art such as epitope mapping, and competition binding studies. For example, binding of CD248 to the given antibody can be assessed following pre-incubation with varying concentrations of MMRN2.
In another embodiment, the antibody is one that selectively binds to the MMRN2 polypeptide. Thus, the antibody may be one that competes with CD248 for specific binding to the MMRN2 polypeptide. In this embodiment, it is preferred if the antibody selectively binds to the CD248 binding region of the MMRN2 polypeptide. Again, whether or not a given antibody binds to the CD248 binding region of the MMRN2 polypeptide or competes with CD248 for specific binding to the MMRN2 polypeptide can be determined using routine methods in the art such as epitope mapping and competition binding studies.
As described in more detail in Example 1 , the inventors have found that CD248 binds to a separate region of MMRN2 from CLEC14A. Thus, it will be appreciated that the antibody that selectively binds to the MMRN2 polypeptide and that modulates the interaction between CD248 will not be an antibody that competes with CLEC14A for specific binding to the MMRN2 polypeptide. Thus, the antibody that selectively binds to the MMRN2 polypeptide may not modulate the interaction between CLEC14A and MMRN2.
By an antibody that selectively binds a specific portion of CD248 or MMRN2 we include the meaning that not only does the antibody selectively bind to the target as described above, the antibody molecule also binds the specified portion of the CD248 or MMRN2 with a greater affinity than for any other portion of it. Preferably, the antibody binds the specified portion with at least 2, or at least 5, or at least 10 or at least 50 times greater affinity than for any other epitope on CD248 or MMRN2. More preferably, the antibody molecule binds the specified portion with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than for than for any other epitope on the CD248 or MMRN2. Such binding may be determined by methods well known in the art, such as one of the Biacore® systems. It is preferred if the antibodies have an affinity for their target epitope on the
CD248 or MMRN2 of at least 10"7 M and more preferably 10"8 M, although antibodies with higher affinities, e.g. 10"9 M, or higher, may be even more preferred. Preferably, the antibody selectively binds the particular specified epitope within the CD248 or MMRN2 and does not bind any other epitopes within it.
Preferably, when the antibody is administered to an individual, the antibody binds to the target CD248 or MMRN2 or to the specified portion thereof with a greater affinity than for any other molecule in the individual. Preferably, the antibody binds to (a specified portion of) the CD248 or MMRN2 with at least 2, or at least 5, or at least 10 or at least 50 times greater affinity than for any other molecule in the individual. More preferably, the agent binds the CD248 or MMRN2 (at the specific domain) with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than any other molecule in the individual. Preferably, the antibody molecule selectively binds the CD248 or MMRN2 without significantly binding other polypeptides in the body.
Small molecules
In another embodiment, the agent that modulates the interaction between CD248 and MMRN2 is a small molecule.
The term "small molecule" includes small organic molecules. Suitable small molecules may be identified by methods such as screening large libraries of compounds (Beck- Sickinger & Weber (2001 ) Combinational Strategies in Biology and Chemistry (John Wiley & Sons, Chichester, Sussex); by structure-activity relationship by nuclear magnetic resonance (Shuker et al (1996) "Discovering high-affinity ligands for proteins: SAR by NMR. Science 274: 1531-1534); encoded self-assembling chemical libraries Melkko et al (2004) "Encoded self-assembling chemical libraries." Nature Biotechnol. 22: 568-574); DNA-templated chemistry (Gartner et al (2004) "DNA-templated organic synthesis and selection of a library of macrocycles. Science 305: 1601-1605); dynamic combinatorial chemistry (Ramstrom & Lehn (2002) "Drug discovery by dynamic combinatorial libraries." Nature Rev. Drug Discov. 1 : 26-36); tethering (Arkin & Wells (2004) "Small-molecule inhibitors of protein-protein interactions: progressing towards the dream. Nature Rev. Drug Discov. 3: 301-317); and speed screen (Muckenschnabel et al (2004) "SpeedScreen: label-free liquid chromatography-mass spectrometry-based high-throughput screening for the discovery of orphan protein ligands." Anal. Biochem. 324: 241-249). Typically, small organic molecules will have a dissociation constant for the polypeptide in the nanomolar range, particularly for antigens with cavities. The benefits of most small organic molecule
binders include their ease of manufacture, lack of immunogenicity, tissue distribution properties, chemical modification strategies and oral bioavailability. Small molecules with molecular weights of less than 5000 daltons are preferred, for example less than 400, 3000, 2000, or 1000 daltons, or less than 500 daltons.
Portions of MMRN2 that modulate the interaction between MMRN2 and CD248
In a preferred embodiment, the agent of the first aspect of the invention is a portion of MMRN2 or, a variant thereof. Such portions are expected to bind to CD248.
By "portion or a variant thereof", we include the meaning of any part of the full length native MMRN2 polypeptide or any portion of a variant of the full length native MMRN2 polypeptide provided that the portion modulates (eg inhibits) the interaction between CD248 and MMRN2. In other words, the portion of MMRN2 is one that reduces the level of binding between CD248 and MMRN2, as compared to the level of binding between CD248 and MMRN2 in the absence of the portion. The portion may be any portion of MMRN2 (or a variant thereof) that has less amino acids than the full length wild type polypeptide or a variant thereof. For example, human MMRN2 is 949 amino acids in length, and so a portion of human MMRN2 would have 948 amino acids or less, and so on.
Preferably, the portion is one that reduces the level of binding between CD248 and MMRN2 by at least 10%, 20%, 30%, 40% or 50%, and more preferably the portion is one that reduces the level of binding between CD248 and MMRN2 by at least 70%, 80%, 90%, 95% or 99%. Most preferably, the portion is one that reduces the level of binding between CD248 and MMRN2 to an undetectable level, or eliminates binding between CD248 and MMRN2.
A suitable portion is typically a contiguous portion of the MMRN2 polypeptide, or variant thereof, of at least 10 amino acids in length, such as at least, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300 or 350 amino acids in length. Preferably, the portion is between 20 and 350 amino acids in length, such as between 25 and 300 amino acids in length, or 25 and 250 amino acids in length, or 25 and 200 amino acids in length. It will be appreciated that the contiguous portion of the MMRN2 may be larger, and so may be at least 350 amino acids in length, such as 400, 450, 500, 550, 600, 650, 700, 750, 800, 850 or 900 amino acids in length. Generally, the portion is no more than 900 amino acids in length, such as no more than 800, 700, 600, 500 or 400 amino acids. Preferably, the portion is no more than 350 amino acids in length, such as no more than 300, 250, 240,
230, 220, 210, 200, 190, 180, 170, 160, 150, 140, 130, 120, 1 10, or 100 or 50 amino acids in length.
In one embodiment, the agent is a portion of MMRN2 of 400 amino acids in length or less, such as 300 amino acids or less, or 200 amino acids or less, or 100 amino acids or less, such as 90, 80, 70, 60, 50, 40, 30, 20 or 10 amino acids in length. It is appreciated that the portion is as small as possible, provided that the portion modulates (eg inhibits) the interaction between CD248 and MMRN2. Generally, the portions of MMRN2 have at least 30% sequence identity to the amino acid sequence of the corresponding portion of the native MMRN2, for example at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or 80% sequence identity, and preferably, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity, over the length of the portion. Thus, when the portion of MMRN2 is a portion of human MMRN2, the portion typically has at least 30% sequence identity to the amino acid sequence of the corresponding portion of the wild type human MMRN2, such as at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or 80% sequence identity, and preferably, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity, over the length of the portion. It will be appreciated that the portion of MMRN2 may be a portion of a variant of native MMRN2. By a variant of native MMRN2, we include the meaning that the variant has at least 30% sequence identity to the wild type MMRN2 polypeptide [e.g. human MMRN2) over its entire length, for example at least 40%, 50%, 60%, 70% or 80% sequence identity. More preferably, the variant of MMRN2 has at least 85%, 90%, 95%, 96%, 97%, 98% or at least 99% sequence identity to the wild type MMRN2 polypeptide [e.g. human MMRN2) over its entire length. Generally, the variant of MMRN2 is one that retains one or more of the biological activities of the wild type MMRN2 polypeptide, such as binding to CD248.
The percent sequence identity between two polypeptides may be determined using any suitable computer program, for example the GAP program of the University of Wisconsin Genetic Computing Group and it will be appreciated that percent identity is calculated in relation to polypeptides whose sequence has been aligned optimally. The alignment may alternatively be carried out using the Clustal W program Thompson et al., (1994) Nucleic Acids Res 22, 4673-80). The parameters used may be as follows: Fast pairwise alignment parameters: K-tuple(word) size; 1 , window size; 5, gap penalty; 3, number of top diagonals; 5. Scoring method: x percent. Multiple alignment parameters: gap open penalty; 10, gap extension penalty; 0.05. Scoring matrix: BLOSUM.
In a preferred embodiment, the portion of MMRN2 of the first aspect of the invention is one that binds to CD248, and more preferably is one that selectively binds to CD248. By a portion of MMRN2 that selectively binds to CD248, we include the meaning that the portion of MMRN2 binds CD248 with a greater affinity than for an irrelevant polypeptide such as human serum albumin. Preferably, the portion of MMRN2 binds CD248 with at least 5, or at least 10 or at least 50 times greater affinity than for the irrelevant polypeptide. More preferably, the portion of MMRN2 binds the CD248 with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than for the irrelevant polypeptide. Suitable methods of assessing the binding between CD248 and MMRN2 are known in the art and include those described above, such as pull-down assays, enzyme linked immunosorbent assays (ELISA), surface plasmon resonance assays, chip-based assays, immunocytofluorescence, yeast two-hybrid technology and phage display. It is preferred that the portion does not bind to thrombomodulin, or that the portion binds CD248 with a greater affinity than for thrombomodulin. Preferably, the portion binds to CD248 with at least 5, or at least 10 or at least 50 times greater affinity than for thrombomodulin. More preferably, the portion binds to CD248 with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than for thrombomodulin. Such binding may be determined by methods well known in the art, such as one of the Biacore® systems.
Typically, the portion of MMRN2 of the first aspect of the invention selectively binds to the CD248 mature polypeptide (residues 18-687) and not to the signal peptide (residues 1- 17). As shown in Example 1 , the inventors have identified a portion of MMRN2 that binds to the CTLD of CD248 (residues 30-156). Hence, it is preferred if the portion of MMRN2 selectively binds to a region of CD248 corresponding to the region spanning amino acid residues 30-156 of the human CD248 polypeptide. In one embodiment, the portion binds to the long-loop region of CD248 (corresponding to residues Q88-C131 of the human CD248 polypeptide).
By the region corresponding to the region spanning amino acid residues 30-156 of human CD248, we include the meaning of a region in a CD248 orthologue or variant that aligns to the region spanning amino acid residues 30-156 of human CD248 when the sequence of the CD248 orthologue or variant is compared to the human CD248 sequence by alignment. Of course, when the portion of MMRN2 is one that binds to human CD248, the region corresponding to the region spanning amino acid residues 30-156 will be the region in the human CD248 itself.
Whether or not a given portion of MMRN2 selectively binds to the CTLD of CD248, or the region spanning amino acids 30-156, can be determined using routine methods in the art such as ELISA, far-western blotting and chimera studies as described in Example 1.
By a portion of MMRN2 that selectively binds to a specific portion of CD248, we include the meaning that not only does the portion of MMRN2 selectively bind to the target as described above, the portion of MMRN2 also binds the specified region of the CD248 with a greater affinity than for any other region of it. Preferably, the portion of MMRN2 binds the specified region with at least 2, or at least 5, or at least 10 or at least 50 times greater affinity than for any other region on CD248. More preferably, the portion of MMRN2 binds the specified region with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than for than for any other region on the CD248. Such binding may be determined by methods well known in the art, such as one of the Biacore® systems. It is preferred if the portion of MMRN2 has an affinity for CD248 of at least 10"3 M, 10"4 M, 10"5 M, 10"6 M or higher. Preferably, the portion of MMRN2 selectively binds the particular specified region within the CD248 and does not bind any other regions within it. Thus, in a particularly preferred embodiment, the portion of MMRN2 selectively binds to the region of CD248 corresponding to the region spanning amino acids residues 30-156 of human CD248, and does not bind to, or makes only weak interactions with, amino acids outside of this region. For example, mutating amino acids residues other than residues 30-156 would not be expected to significantly affect binding of the portion of MMRN2 (e.g. reduce it to less than 90%, 80%, 70%, 60% or 50% of the original level of binding). Of course, it will be appreciated that mutations outside of the region spanning amino acids 30-156 may affect the overall structure and folding of the CD248 which may have an effect on binding of the portions of MMRN2. However, where the mutations outside of this region do not affect the global structure or folding of the protein, they are not expected to significantly affect binding of the portion of MMRN2 to CD248. As described above for the agent generally, in one embodiment the portion of MMRN2 does not bind to a mutant CD248 polypeptide in which the cysteine corresponding to cysteine-94 of human CD248 is mutated and/or the cysteine corresponding to cysteine- 126 of human CLEC14A is mutated. In one embodiment, the portion of MMRN2 of the first aspect of the invention comprises or consists of the coiled-coil domain of MMRN2, or part thereof. The coiled-coil domain of human MMRN2 corresponds to amino acid residues 133-820, and the coiled-coil domain
in other MMRN2 orthologues or variants can be readily identified by alignment. Thus, the portion of MMRN2 may comprise or consist of contiguous portion of at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600 or 650 amino acids of the coiled-coil domain of MMRN2.
In a preferred embodiment, the portion of MMRN2 comprises or consists of a region of MMRN2 corresponding to the region spanning amino acid residues 133-486 of human MMRN2, or a part thereof. As shown in Example 1 , the inventors have identified this portion of MMRN2 binding to CD248.
Generally, the part thereof, is at least 10, 20, 30, 35, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140 or 150, 160, 170, 180, 190, 200, 250, 300 or 350 consecutive amino acids in length of the region corresponding to the region spanning amino acid residues 133-486 of human MMRN2. It will be appreciated that the part thereof must be less than 354 amino acids.
By corresponding region, we include the meaning of a region which aligns to one of the specified regions of human MMRN2 when a MMRN2 orthologue or variant and human MMRN2 polypeptides are compared by alignment. Of course, when the portion of MMRN2 is a portion of human MMRN2, it is preferred if the portion comprises or consists of the region spanning amino acid residues 133-486 of human MMRN2, or a part thereof.
The inventors have aligned human MMRN2 with orthologues from different species within the region spanning 133-486, as illustrated in Figure 6. As seen from Figure 6, the most conserved regions in MMRN2 orthologues include those corresponding to the regions spanning residues 215-280, 295-344 and 375-478 of human MMRN2. Thus, in one embodiment, the portion of MMRN2 comprises or consists of a region of MMRN2 corresponding to the region spanning amino acid residues 215-478 of human MMRN2, or part thereof. For example, the portion of MMRN2 may comprise or consist of a region of MMRN2 corresponding to the region spanning amino acid residues 215-344, or 295-478, or 344-478, or 215-280 or 295-344 or 375-478 of human MMRN2, or a part thereof. Generally, the part thereof, is at least 10, 20, 30, 35, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140 or 150, 160, 170, 180, 190, 200 or 250 consecutive amino acids in length. By corresponding region, we include the meaning of a region which aligns to one of the specified regions of human MMRN2 when a MMRN2 orthologue or variant and human MMRN2 polypeptides are compared by alignment. Of course, when the portion of MMRN2 is a portion of human MMRN2, it is preferred if the portion comprises or consists
of the region spanning amino acid residues 215-478, 215-344, or 344-478, or 215-280 or 295-344 or 375-478 of human MMRN2, or a part thereof.
In one embodiment the agent according to the first aspect of the invention is a portion of MMRN2 which does not comprise or consist of a region of MMRN2 corresponding to the region spanning amino acids residues 487-820 of human MMRN2, or part thereof.
As stated above, the agent may be a portion of a variant of MMRN2, and so it will be appreciated that these particular portions (e.g. those that comprise or consist of a region corresponding to the region spanning amino acid residues 133-486, 215-478, 215-280, 295-344 or 375-478 of human MMRN2 or part thereof) may have at least 30%, 40%, 50%, 60%, or 70% sequence identity to the amino acid sequence of the corresponding portion of the wild type MMRN2 (e.g. human MMRN2), and preferably 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity.
The inventors have aligned human MMRN2 with orthologues from different species within the region spanning amino acid residues 133-486, as illustrated in Figure 6. The most conserved residues are E178, D187, H240, S242, L252, L255, N261 , L322, V333, Q344, I426, L443, L450, L471 and L478. Thus, it is appreciated that the portion of MMRN2, or of a variant thereof, may comprise one or more (for example at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, or all 16) of amino acids corresponding to any of the following amino acids according to the numbering of human MMRN2 in Figure 7: E178, D187, H240, S242, L252, L255, N261 , L322, V333, Q344, I426, L443, L450, L471 and L478. It will be appreciated that when the portion (eg portion of the MMRN2 that comprises or consists of a region corresponding to the region spanning amino acid residues 133-486 of human MMRN2, or part thereof) is a portion of a variant of MMRN2, it is preferred if the particular residues listed (i.e. E178, D187, H240, S242, L252, L255, N261 , L322, V333, Q344, I426, L443, L450, L471 and L478) corresponding to the amino acid sequence of human MMRN2 recited in Figure 7 are not substituted for another amino acid. In other words, it is preferred if the portion of a variant of MMRN2 comprises all of the recited amino acids.
In a preferred embodiment, the portion of MMRN2 comprises or consists of the amino acid sequence of any of the MMRN2 portions listed in Figure 6, or any part or variant of said portions. Preferably, the portion of MMRN2 comprises or consists of the amino acid
sequence of the human portion of MMRN2 listed in Figure 6, or any part or variant of said portion.
By "part of said portion", we include the meaning of a contiguous part of one of the MMRN2 portions listed in Figure 6 of at least 10 amino acids in length, such as at least, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300 or 350 amino acids in length. The part may be no more than 350, 300, 250, 200 or 150 amino acids in length. Preferably, the part of said portion comprises the region of MMRN2 corresponding to the region spanning amino acid residues 133-486 of human MMRN2.
By a "variant of said portion", we include the meaning of a variant having at least 30% sequence identity to one of the MMRN2 portions listed in Figure 6, such as at least 40%, 50%, 60% or 70% sequence identity, and more preferably, 75%, 80%, 85%, 90%, 95% or 99% sequence identity. Preferably, the variant has at least 90% or 95% sequence identity.
Preferably, the agent of the first aspect of the invention does not modulate the interaction between MMRN2 and CD93 or the interaction between MMRN2 and CLEC14A. Thus, it is appreciated that in a further embodiment the agent is a portion of MMRN2 that does not bind to CD93 and/or CLEC14A.
Portions of CD248 that modulate the interaction between MMRN2 and CD248
In one embodiment, the agent according to the first aspect of invention is a portion of CD248, or a variant thereof. Such agents are expected to bind MMRN2.
A suitable portion is typically a contiguous portion of the CD248 polypeptide, or variant thereof, of at least 10 amino acids in length, such as at least, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300 or 350 amino acids in length. Preferably, the portion is between 10 and 150 amino acids in length, such as between 20 and 125 amino acids in length, or 25 and 100 amino acids in length, or 25 and 75 amino acids in length. It will be appreciated that the contiguous portion of the CD248 may be larger, and so may be at least 350 amino acids in length, such as 400, 450, 500, 550, 600, 650, 700 or 750 amino acids in length. Generally, the portion is no more than 700 amino acids in length, such as no more than 600, 500, 400 or 300 amino acids. Preferably, the portion is no more than 200 amino acids in length, such as no more than 190, 180, 170, 160, 150, 140, 130, 120, 1 10, or 100, or 50 amino acids in length.
In one embodiment, the agent is a portion of CD248 of 150 amino acids in length or less, such as 127 amino acids or less, or 120 amino acids or less, or 100 amino acids or less, such as 90, 80, 70, 60, 50, 40, 30, 20 or 10 amino acids in length. Generally, the portions of CD248 have at least 30% sequence identity to the amino acid sequence of the corresponding portion of the native CD248, for example at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or 80% sequence identity, and preferably, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity, over the length of the portion. Thus, when the portion of CD248 is a portion of human CD248, the portion typically has at least 30% sequence identity to the amino acid sequence of the corresponding portion of the wild type human CD248, such as at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or 80% sequence identity, and preferably, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity, over the length of the portion. The percent sequence identity between two polypeptides may be determined using the methods described above.
It will be appreciated that the portion of CD248 may be a portion of a variant of native CD248. By a variant of native CD248, we include the meaning that the variant has at least 30% sequence identity to the wild type CD248 polypeptide (e.g. human CD248) over its entire length, for example at least 40%, 50%, 60%, 70% or 80% sequence identity. More preferably, the variant of CD248 has at least 85%, 90%, 95%, 96%, 97%, 98% or at least 99% sequence identity to the wild type CD248 polypeptide (e.g. human CD248) over its entire length. Generally, the variant of CD248 is one that retains one or more of the biological activities of the wild type CD248 polypeptide, such as binding to MMRN2. In a preferred embodiment, the portion of CD248 of the first aspect of the invention is one that binds to MMRN2, and more preferably is one that selectively binds to MMRN2. By a portion of CD248 that selectively binds to MMRN2, we include the meaning that the portion of CD248 binds MMRN2 with a greater affinity than for an irrelevant polypeptide such as human serum albumin. Preferably, the portion of CD248 binds MMRN2 with at least 5, or at least 10 or at least 50 times greater affinity than for the irrelevant polypeptide. More preferably, the portion of CD248 binds the MMRN2 with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than for the irrelevant polypeptide. Suitable methods of assessing the binding between CD248 and MMRN2 are known in the art and include those described above, such as pull-down assays, enzyme linked immunosorbent assays (ELISA), surface plasmon resonance assays, chip-based assays, immunocytofluorescence, yeast two-hybrid technology and phage display.
Typically, the portion of CD248 of the first aspect of the invention selectively binds to the MMRN2 mature polypeptide (residues 23-949) and not to the signal peptide (residues 1- 22). As shown in Example 1 , the inventors have identified a portion of MMRN2 comprising the coiled-coil domain (residues 133-486) that binds to the CTLD (residues 30-156) of human CD248. Hence, it is preferred if the portion of CD248 selectively binds to a region of MMRN2 corresponding to the region spanning amino acid residues 133-486 of the human MMRN2 polypeptide. By the region corresponding to the region spanning amino acid residues 133-486 of human MMRN2, we include the meaning of a region in a MMRN2 orthologue or variant that aligns to the region spanning amino acid residues 133-486 of human MMRN2 when the sequence of the MMRN2 orthologue or variant is compared to the human MMRN2 sequence by alignment. Of course, when the portion of CD248 is one that binds to human MMRN2, the region corresponding to the region spanning amino acid residues 133-486 will be the region in the human MMRN2 itself. Whether or not a given portion of CD248 selectively binds to the coiled-coil domain of MMRN2, or the region spanning amino acid residues 133-486 in human MMRN2, can be determined using routine methods in the art such as ELISA, far-western blotting and chimera studies as described in Example 1. By a portion of CD248 that selectively binds to a specific portion of MMRN2, we include the meaning that not only does the portion of CD248 selectively bind to the target as described above, the portion of CD248 also binds the specified region of the MMRN2 with a greater affinity than for any other region of it. Preferably, the portion of CD248 binds the specified region with at least 2, or at least 5, or at least 10 or at least 50 times greater affinity than for any other region on MMRN2. More preferably, the portion of CD248 binds the specified region with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than for than for any other region on the MMRN2. Such binding may be determined by methods well known in the art, such as those described above. It is preferred if the portion of CD248 has an affinity for MMRN2 of at least 10"3 M, 10"4 M, 10"5 M, 10"6 M or higher. Preferably, the portion of CD248 selectively binds the particular specified region within the MMRN2 and does not bind any other regions within it. Thus, in a particularly preferred embodiment, the portion of CD248 selectively binds to the region of MMRN2 corresponding to the region spanning amino acids residues 133-486 of human MMRN2, and does not bind to, or makes only weak interactions with, amino acids outside of this region. For example, mutating amino acids residues other than residues 133-486 would not be expected to significantly affect binding of the portion of CD248 (e.g. reduce it to less than 90%, 80%, 70%, 60% or 50% of the original level of binding). Of course, it will be
appreciated that mutations outside of the region spanning amino acids 133-486 may affect the overall structure and folding of the MMRN2 which may have an effect on binding of the portions of CD248. However, where the mutations outside of this region do not affect the global structure or folding of the protein, they are not expected to significantly affect binding of the portion of CD248 to MMRN2.
In one embodiment, the portion of CD248 of the first aspect of the invention comprises or consists of the CTLD of CD248, or part thereof, optionally wherein the CTLD of CD248 corresponds to amino acid residues 30-156 of human CD248. The CTLD in other CD248 orthologues or variants can be readily identified by alignment. Thus, the portion of CD248 may comprise or consist of a contiguous portion at least 10, 20, 30, 35, 40, 50, 60, 70, 80, 90, 100, 110, 120 or 127 amino acids of the CTLD of CD248.
In a further embodiment, the portion of CD248 comprises or consists of the long-loop region of CD248 or part thereof. By "long-loop region of CD248" we include the meaning of the region corresponding to residues Q88-C131 of the human CD248 polypeptide. Generally, the part thereof, is at least 10, 15, 20, 25, 30, 35, 40 or 44 consecutive amino acids in length of the region corresponding to the region spanning amino acid residues 88- 131 of human CD248.
By corresponding region, we include the meaning of a region which aligns to one of the specified regions of human CD248 when a CD248 orthologue or variant and human CD248 polypeptides are compared by alignment. Of course, when the portion of CD248 is a portion of human CD248, it is preferred if the portion comprises or consists of the region spanning amino acid residues 30-156 of human CD248, or a part thereof.
The inventors have aligned human CD248 with orthologues from different species within the region spanning 18-158 of human CD248, as illustrated in Figure 9. As seen from Figure 9, the most conserved regions in CD248 orthologues include those corresponding to the regions spanning residues 29-117 or 29-156 of human CD248. Thus, in one embodiment, the portion of CD248 comprises or consists of a region of CD248 corresponding to the region spanning amino acid residues 29-117 or 29-156 of human CD248, or part thereof. For example, the portion of CD248 may comprise or consist of a region of CD248 corresponding to the region spanning amino acid residues 83-1 17 of human CD248, or a part thereof. In a further embodiment, the portion of CD248 may comprise or consist of a region of CD248 corresponding to the region spanning amino acid residues 83-156 of human CD248, or a part thereof. Generally, the part thereof, is at least
10, 20, 30, 35, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, or 130 consecutive amino acids in length. By corresponding region, we include the meaning of a region which aligns to one of the specified regions of human CD248 when a CD248 orthologue or variant and human CD248 polypeptides are compared by alignment.
In one embodiment the agent according to the first aspect of the invention is a portion of CD248 which does not comprise or consist of a region of CD248 corresponding to the region spanning amino acids residues 157-757 of human CD248, or part thereof. As stated above, the agent may be a portion of a variant of CD248, and so it will be appreciated that these particular portions (e.g. those that comprise or consist of a region corresponding to the region spanning amino acid residues 30-156 of human CD248, or part thereof) may have at least 30%, 40%, 50%, 60%, or 70% sequence identity to the amino acid sequence of the corresponding portion of the wild type CD248 (e.g. human CD248), and preferably 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity.
The inventors have aligned human CD248 with orthologues from different species within the region spanning amino acid residues 18-158 of human CD248, as illustrated in Figure 9. The most conserved residues are C29, C34, Y35, L37, R41 , F44, L45, A47, W48, R49, C51 , E53, G56, L58, A59, T60, R62, A67, V70, L73, W84, I85, G86, L87, Q88, R89, Q90, R92, Q93, C94, R98, P99, L100, R101 , G102, F103, W105, T107, G108, D109, Q1 10, D1 1 1 , T1 12, F1 14, T1 15, N 1 16, W1 17, Q1 19, C126, R130, C131 , S137, W142, G145, C147, V151 , D152, G153, Y154, L155 and C156. Thus, it is appreciated that the portion of CD248, or of a variant thereof, may comprise one or more (for example at least 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, or all 61 ) of amino acids corresponding to any of the following amino acids according to the numbering of human CD248 in Figure 9: C29, C34, Y35, L37, R41 , F44, L45, A47, W48, R49, C51 , E53, G56, L58, A59, T60, R62, A67, V70, L73, W84, I85, G86, L87, Q88, R89, Q90, R92, Q93, C94, R98, P99, L100, R101 , G102, F103, W105, T107, G108, D109, Q1 10, D1 1 1 , T1 12, F1 14, T1 15, N 1 16, W1 17, Q1 19, C126, R130, C131 , S137, W142, G145, C147, V151 , D152, G153, Y154, L155 and C156.
The next most conserved residues in human CD248 are residues S33, F38, R40, R42, E46, A50, R52, E65, E66, S72, G75, A79, L83, Q95, T106, G124, A128, A133, L134, E139, R141 , E144, T148, L149 and A150. Thus, it is appreciated that the portion of CD248, or of a variant thereof, may comprise one or more (for example at least 2, 3, 4, 5,
10, 1 1 , 12, 13, 14 , 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24 or all 25) of amino acids corresponding to any of the following amino acids according to the numbering of human CD248 in Figure 9: S33, F38, R40, R42, E46, A50, R52, E65, E66, S72, G75, A79, L83, Q95, T106, G124, A128, A133, L134, E139, R141 , E144, T148, L149 and A150.
Hence, it will be appreciated that the portion of CD248, or of a variant thereof, may comprise one or more (for example at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 or all 86) of amino acids corresponding to any of the following amino acids according to the numbering of human CD248 in Figure 9: C29, C34, Y35, L37, R41 , F44, L45, A47, W48, R49, C51 , E53, G56, L58, A59, T60, R62, A67, V70, L73, W84, I85, G86, L87, Q88, R89, Q90, R92, Q93, C94, R98, P99, L100, R101 , G102, F103, W105, T107, G108, D109, Q1 10, D1 1 1 , T1 12, F1 14, T1 15, N 1 16, W1 17, Q1 19, C126, R130, C131 , S137, W142, G145, C147, V151 , D152, G153, Y154, L155, C156, S33, F38, R40, R42, E46, A50, R52, E65, E66, S72, G75, A79, L83, Q95, T106, G124, A128, A133, L134, E139, R141 , E144, T148, L149 and A150.
It will be appreciated that when the portion (eg portion of the CD248 that comprises or consists of a region corresponding to the region spanning amino acid residues 30-156 of human CD248, or part thereof) is a portion of a variant of CD248, it is preferred if the particular residues listed (ie C34, Y35, L37, R41 , F44, L45, A47, W48, R49, C51 , E53, G56, L58, A59, T60, R62, A67, V70, L73, W84, I85, G86, L87, Q88, R89, Q90, R92, Q93, C94, R98, P99, L100, R101 , G102, F103, W105, T107, G108, D109, Q1 10, D1 1 1 , T1 12, F1 14, T1 15, N 1 16, W1 17, Q1 19, C126, R130, C131 , S137, W142, G145, C147, V151 , D152, G153, Y154, L155 and C156 corresponding to the amino acid sequence of human CD248 recited in Figure 8) are not substituted for another amino acid. In other words, it is preferred if the portion of a variant of CD248 comprises all of the recited amino acids.
It will be appreciated further that when the portion (eg portion of the CD248 that comprises or consists of a region corresponding to the region spanning amino acid residues 30-156 of human CD248, or part thereof) is a portion of a variant of CD248, it is preferred if the particular residues listed (ie S33, F38, R40, R42, E46, A50, R52, E65, E66, S72, G75, A79, L83, Q95, T106, G124, A128, A133, L134, E139, R141 , E144, T148, L149 and A150 corresponding to the amino acid sequence of human CD248 recited in Figure 8) are not substituted for another amino acid. In other words, it is preferred if the portion of a variant of CD248 comprises all of the recited amino acids.
Hence, in an embodiment when the portion (eg portion of the CD248 that comprises or consists of a region corresponding to the region spanning amino acid residues 30-156 of human CD248, or part thereof) is a portion of a variant of CD248, it is preferred if the particular residues listed (ie C34, Y35, L37, R41 , F44, L45, A47, W48, R49, C51 , E53, G56, L58, A59, T60, R62, A67, V70, L73, W84, I85, G86, L87, Q88, R89, Q90, R92, Q93, C94, R98, P99, L100, R101 , G102, F103, W105, T107, G108, D109, Q1 10, D1 1 1 , T1 12, F1 14, T1 15, N 1 16, W1 17, Q1 19, C126, R130, C131 , S137, W142, G145, C147, V151 , D152, G153, Y154, L155, C156, S33, F38, R40, R42, E46, A50, R52, E65, E66, S72, G75, A79, L83, Q95, T106, G124, A128, A133, L134, E139, R141 , E144, T148, L149 and A150 corresponding to the amino acid sequence of human CD248 recited in Figure 8) are not substituted for another amino acid. In other words, it is preferred if the portion of a variant of CD248 comprises all of the recited amino acids.
In a preferred embodiment, the portion of CD248 comprises or consists of the amino acid sequence of any if the CD248 portions listed in Figure 9, or any part or variant of said portions. Preferably, the portion of CD248 comprises or consists of the amino acid sequence of the human portion of CD248 listed in Figure 9, or any part or variant of said portion. By "part of said portion", we include the meaning of a contiguous part of one of the CD248 portions listed in Figure 9 of at least 10 amino acids in length, such as at least, 20, 30, 40, 50, 60, 70, 80, 90, 100, 1 10, 120 or 127 amino acids in length. The part may be no more than 120, 100, 80, 60 or 40 amino acids in length. Preferably, the part of said portion comprises the region of CD248 corresponding to the region spanning amino acid residues 30-156 of human CD248.
By a "variant of said portion", we include the meaning of a variant having at least 30% sequence identity to one of the CD248 portions listed in Figure 9, such as at least 40%, 50%, 60% or 70% sequence identity, and more preferably, 75%, 80%, 85%, 90%, 95% or 99% sequence identity. Preferably, the variant has at least 90% or 95% sequence identity.
Portions of MMRN2 and CD248
A second aspect of the invention provides a portion of MMRN2 or a variant thereof, that binds to CD248.
Preferably, the portion of MMRN2 modulates the interaction between CD248 and MMRN2, and so it will be appreciated that all of the preferences and limitations described above in relation to the first aspect of the invention (including all structural and functional properties of the portion of MMRN2) may equally apply to the portion of MMRN2 according to the second aspect of the invention. It is especially preferred if the portion of MMRN2 inhibits the interaction between CD248 and MMRN2.
A third aspect of the invention provides a portion of CD248 or a variant thereof, that binds to MMRN2.
Preferably, the portion of CD248 modulates the interaction between MMRN2 and CD248, and so it will be appreciated that all of the preferences and limitations described above in relation to the first aspect of the invention (including all structural and functional properties of the portion of CD248) may equally apply to the portion of CD248 according to the third aspect of the invention. It is especially preferred if the portion of CD248 inhibits the interaction between CD248 and MMRN2.
Conveniently, the portion of MMRN2, or the portion of CD248, may be modified so that it can be more easily detected, for example by biotinylating it or by incorporating any detectable label known in the art such as affinity tags, radiolabels, fluorescent labels or enzymatic labels. The incorporation of affinity tags into the portion of MMRN2 is discussed in more detail below.
The portion of MMRN2, or portion of CD248, are typically made by recombinant DNA technology. Suitable techniques for cloning, manipulation, modification and expression of nucleic acids, and purification of expressed proteins, are well known in the art and are described for example in Sambrook et al (2001) "Molecular Cloning, a Laboratory Manual", 3rd edition, Sambrook et al (eds), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA. Alternatively, the portion of MMRN2, or portion of CD248 may be made using protein chemistry techniques for example using partial proteolysis (either exolytically or endolytically), or by de novo synthesis.
The amino acid residues described herein may be in the "L" isomeric form. However, residues in the "D" isomeric form can be substituted for any L-amino acid residue, as long as the portion of MMRN2, or portion of CD248 can still inhibit the interaction between MMRN2 and CD248. This definition includes, unless otherwise specifically indicated, chemically-modified amino acids, including amino acid analogues (such as penicillamine,
3-mercapto-D-valine), naturally-occurring non-proteogenic amino acids (such as norleucine), and chemically-synthesised compounds that have properties known in the art to be characteristic of an amino acid. The term "proteogenic" indicates that the amino acid can be incorporated into a protein in a cell through well-known metabolic pathways.
The portion of CD248, or the portion of MMRN2 can be a peptide "mimetic", i.e. peptidomimetics which mimic the structural features of the portion comprising or consisting of the amino acid sequence as described above. Retro-inverso peptides (known as all-D- retro or retro-enantio peptides) are also included, whereby all of the L-amino acids are replaced with D-amino acids and the peptide bonds are reversed.
Peptidomimetics that are non-peptide in nature can be designed and synthesised by standard organic chemical methods. Peptidomimetics that are non-peptide in nature can be even more advantageous in therapeutic use, in the resistance to degradation, in permeability and in possible oral administration.
Peptidomimetics are small molecules that can bind to proteins by mimicking certain structural aspects of peptides and proteins. They are used extensively in science and medicine as agonists and antagonists of protein and peptide ligands of cellular and other receptors, and as substrates and substrate analogues for enzymes. Some examples are morphine alkaloids (naturally-occurring endorphin analogues), penicillins (semi-synthetic), and HIV protease inhibitors (synthetic). Such compounds have structural features that mimic a peptide or a protein and as such are recognised and bound by other proteins. Binding the peptidomimetic either induces the binding protein to carry out the normal function caused by such binding (agonist) or disrupts such function (antagonist, inhibitor).
In one preferred embodiment according to the first, second or third aspect of the invention, the agent, portion of MMRN2, or portion of CD248 is one that modulates angiogenesis, for example as demonstrated in an angiogenesis assay, and/or is one that modulates tumour growth, for example as demonstrated in an animal model of cancer (e.g. a mouse with Lewis lung carcinoma). Suitable angiogenesis assays are well known in the art and include an aortic ring assay, a sponge angiogenesis assay, an assay of endothelial cell proliferation, an assay of endothelial cell migration and/or an assay of endothelial cell invasion. Likewise, suitable animal models of cancer are well known in the art. It will be appreciated that assessment of anti-angiogenic properties and anti-cancer properties can be carried out in vitro or in vivo.
It is appreciated that the portion of MMRN2 or CD248 may be modified. For example, a derivative of the portion of MMRN2 or CD248 described herein may be useful to inhibit angiogenesis and/or combat cancer in an individual as described in more detail below. By "derivative", we include the meaning of the portion of MMRN2 or CD248 having one or more residues chemically derivatised by reaction of a functional side group. Such derivatised molecules include, for example, those molecules in which free amino groups have been derivatised to form amine hydrochlorides, p-toluene sulfonyl groups, carbobenzoxy groups, t-butyloxycarbonyl groups, chloroacetyl groups or formyl groups. Free carboxyl groups may be derivatised to form salts, methyl and ethyl esters or other types of esters or hydrazides. Free hydroxyl groups may be derivatised to form O-acyl or O-alkyl derivatives. Also included as derivatives are those peptide portions that contain one or more naturally occurring amino acid derivatives of the twenty standard amino acids. For example, 4-hydroxyproline may be substituted for proline; 5-hydroxylysine may be substituted for lysine; 3-methylhistidine may be substituted for histidine; homoserine may be substituted for serine; and ornithine may be substituted for lysine. The derivatisation does not include changes in functional groups which change one amino acid to another.
Some useful modifications are designed to increase the stability and, therefore, the half- life of polypeptides or peptides in solutions, particularly biological fluids, such as blood, plasma or serum, by blocking proteolytic activity in the blood. Thus, the portion of MMRN2 or CD248 may have a stabilising group at one or both termini. Typical stabilising groups include amido, acetyl, benzyl, phenyl, tosyl, alkoxycarbonyl, alkyl carbonyl, benzyloxycarbonyl and the like end group modifications. Additional modifications include using a "D" amino acid in place of a "L" amino acid at the termini, and amide rather than amino or carboxy termini to inhibit exopeptidase activity. Thus, it is appreciated that the portion of MMRN2 or CD248 may have a capping moiety at one or both ends, preferably a moiety that is less than 100 Da in molecular weight such as an amide group.
Fusion Proteins
A fourth aspect of the invention provides a fusion protein comprising a polypeptide agent that modulates the interaction between CD248 and MMRN2 according to the first aspect of the invention (which itself may be a portion of MMRN2 or a portion of CD248), a portion of MMRN2 according to the second aspect of the invention, or a portion of CD248 according to the third aspect of the invention wherein the fusion protein does not comprise wild-type MMRN2 orwild-type CD248. Thus, the fusion protein does not comprise the full- length wild type MMRN2 or CD248 or any naturally occurring variant thereof. For
example, when the fusion protein comprises a portion of MMRN2, it does not comprise wild type MMRN2, and when the fusion protein comprises a portion of CD248, it does not comprise wild type CD248. Antibodies to portions of MMRN2 or CD248
A fifth aspect of the invention provides an antibody that selectively binds to a portion of MMRN2 according to the first or second aspect of the invention. Preferences for the portion of MMRN2 include those defined above in relation to the first and second aspects of the invention.
By "selectively binds to a portion of MMRN2", we include the meaning that the antibody binds to the portion of MMRN2 with a greater affinity than for an irrelevant polypeptide such as human serum albumin. Preferably, the antibody binds to the portion of MMRN2 with at least 5, or at least 10 or at least 50 times greater affinity than for the irrelevant polypeptide. More preferably, the antibody binds to the portion of MMRN2 with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than for the irrelevant polypeptide. It is preferred if the antibody that selectively binds to the portion of MMRN2 binds to that portion of MMRN2 with a greater affinity than for any other region of the MMRN2 polypeptide (ie amino acid residues of MMRN2 outside of the portion of MMRN2). Preferably, the antibody binds to the portion of MMRN2 with at least 2, or at least 5, or at least 10 or at least 50 times greater affinity than for any other region on MMRN2. More preferably, the antibody binds to the portion of MMRN2 with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than for than for any other region on the MMRN2. It is appreciated that the antibody may bind to amino acid residues outside of the portion of MMRN2. However, the interaction between the antibody and such amino acids is expected to be weaker than that between the antibody and the portion of MMRN2.
In an embodiment, the antibody selectively binds to the coiled-coil domain of MMRN2, or part thereof, optionally wherein the coiled-coil domain of MMRN2 corresponds to amino acid residues 133-820 of human MMRN2. For example, the antibody may selectively bind to a region of MMRN2 corresponding to the region spanning amino acid residues 133-486 or 215-478, or 215-280, or 295-344, or 375-478 of human MMRN2, or a part thereof.
It is particularly preferred if the antibody selectively binds to a region corresponding to the region spanning amino acid residues 133-486 of human MMRN2, or a part thereof.
In an embodiment, the antibody is one that does not interact with, or makes only weak interactions with, amino acids outside the region defined by amino acid residues 133-486 of human MMRN2. For example, mutating amino acid residues other than residues 133- 486 would not be expected to significantly affect antibody binding (e.g. reduce it to less than 90%, 80%, 70%, 60% or 50% of the original level of binding). It will be appreciated therefore that the antibody would typically not interact with, or make only weak interaction with amino acids in the region defined by amino acids residues 487-820 (eg 588-620) of human MMRN2.
In an embodiment, the antibody is one that does not compete with an antibody known to bind elsewhere within MMRN2 for specific binding to an epitope located within amino acid residues 133-486 of MMRN2.
As with the agents and portions of MMRN2 of the invention, it is preferred if the antibodies of the invention modulate the interaction between CD248 and MMRN2. Thus, the antibody may be one that competes with CD248 for specific binding to the MMRN2 polypeptide. In an embodiment, the antibodies which selectively bind to MMRN2 do not modulate the interaction between CD93 and MMRN2 and/or do not modulate the interaction between CLECL14A and MMRN2. Thus, the antibodies may not compete with either of CD93 or CLEC14A for binding to MM RN2. It is preferred if the antibodies have an affinity for the portion of MMRN2 of at least 10"5 M, 10"6 M, or 10"7 M and more preferably 10"8 M, although antibodies with higher affinities, e.g. 10"9 M, or higher, may be even more preferred.
Antibodies that are especially active at inhibiting tumour angiogenesis are preferred to anti- cancer therapeutic agents, and they can be selected for this activity using methods well known in the art.
Preferably, when the antibody is administered to an individual, the antibody binds to the target portion of MMRN2 with a greater affinity than for any other molecule in the individual. Preferably, the antibody binds to target portion of MMRN2 with at least 2, or at least 5, or at least 10 or at least 50 times greater affinity than for any other molecule in the individual. More preferably, the antibody binds to target portion of MMRN2 with at least 100, or at
least 1 ,000, or at least 10,000 times greater affinity than any other molecule in the individual. Preferably, the antibody molecule selectively binds the portion of MMRN2 without significantly binding other polypeptides in the body. A sixth aspect of the invention provides an antibody that selectively binds to a portion of CD248 according to the first or second aspect of the invention. Preferences for the portion of CD248 include those defined above in relation to the first and third aspects of the invention. It is preferred if the antibody that selectively binds to the portion of CD248 binds to that portion of CD248 with a greater affinity than for any other region of the CD248 polypeptide (ie amino acid residues of CD248 outside of the portion of CD248). Preferably, the antibody binds to the portion of CD248 with at least 2, or at least 5, or at least 10 or at least 50 times greater affinity than for any other region on CD248. More preferably, the antibody binds to the portion of MMR CD248 N2 with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than for than for any other region on the CD248. It is appreciated that the antibody may bind to amino acid residues outside of the portion of CD248. However, the interaction between the antibody and such amino acids is expected to be weaker than that between the antibody and the portion of CD248.
In an embodiment, the antibody selectively binds to the CTLD of CD248, or part thereof, optionally wherein the CTLD of CD248 corresponds to amino acid residues 30-156 of human CD248. For example, the antibody may selectively bind to the long-loop region of CD248, corresponding to the region spanning amino acid residues Q88-C131 of human CD248, or a part thereof.
In an embodiment, the antibody is one that does not interact with, or makes only weak interactions with, amino acids outside the region defined by amino acid residues 30-156 of human CD248. For example, mutating amino acid residues other than residues 30- 156 would not be expected to significantly affect antibody binding (e.g. reduce it to less than 90%, 80%, 70%, 60% or 50% of the original level of binding).
In an embodiment, the antibody is one that does not compete with an antibody known to bind elsewhere within CD248 for specific binding to an epitope located within amino acid residues 30-156 of CD248.
It is preferred if the antibodies have an affinity for the portion of CD248 of at least 10"5 M, 10"6 M, or 10"7 M and more preferably 10"8 M, although antibodies with higher affinities, e.g. 10"9 M, or higher, may be even more preferred. Preferably, when the antibody is administered to an individual, the antibody binds to the target portion of CD248 with a greater affinity than for any other molecule in the individual. Preferably, the antibody binds to target portion of CD248 with at least 2, or at least 5, or at least 10 or at least 50 times greater affinity than for any other molecule in the individual. More preferably, the antibody binds to target portion of CD248 with at least 100, or at least 1 ,000, or at least 10,000 times greater affinity than any other molecule in the individual. Preferably, the antibody molecule selectively binds the portion of CD248 without significantly binding other polypeptides in the body.
The term "antibody" or "antibody molecule" as used herein throughout the specification includes but is not limited to polyclonal, monoclonal, chimeric, single chain, Fab fragments and fragments produced by a Fab expression library. Such fragments include fragments of whole antibodies which retain their binding activity for a target substance, Fv, F(ab') and F(ab')2 fragments, as well as single chain antibodies (scFv), fusion proteins and other synthetic proteins which comprise the antigen-binding site of the antibody. The term also includes antibody-like molecules which may be produced using phage-display techniques or other random selection techniques for molecules which bind to the specified polypeptide or to particular regions of it. Thus, the term antibody includes all molecules which contain a structure, preferably a peptide structure, which is part of the recognition site (i.e. the part of the antibody that binds or combines with the epitope or antigen) of a natural antibody. Furthermore, the antibodies and fragments thereof may be humanised antibodies, which are now well known in the art.
By "ScFv molecules" we mean molecules wherein the VH and VL partner domains are linked via a flexible oligopeptide. Engineered antibodies, such as ScFv antibodies, can be made using the techniques and approaches long known in the art. The advantages of using antibody fragments, rather than whole antibodies, are several-fold. The smaller size of the fragments may lead to improved pharmacological properties, such as better penetration to the target site. Effector functions of whole antibodies, such as complement binding, are removed. Fab, Fv, ScFv and dAb antibody fragments can all be expressed in and secreted from E. coli, thus allowing the facile production of large amounts of the fragments. Whole antibodies, and F(ab')2 fragments are "bivalent". By "bivalent" we mean that the antibodies
and F(ab')2 fragments have two antigen combining sites. In contrast, Fab, Fv, ScFv and dAb fragments are usually monovalent, having only one antigen combining site.
It is possible however that the ScFv may be monovalent, divalent, trivalent or tetravalent. The ScFv may be a diabody, tribody, or a tetrabody. The two or more VH and VL partner domains in a divalent, trivalent or tetravalent or diabody, tribody, or a tetrabody may be different. In such a situation, an ScFv agent may comprise more than 2 or more than 3, for example 4 different VH and VL domains. Antibodies may be produced by standard techniques, for example by immunisation with the appropriate (glyco)polypeptide or portion(s) thereof, or by using a phage display library.
If polyclonal antibodies are desired, a selected mammal (e.g., mouse, rabbit, goat, horse, etc) is immunised with an immunogenic polypeptide bearing a desired epitope(s), optionally haptenised to another polypeptide. Depending on the host species, various adjuvants may be used to increase immunological response. Such adjuvants include, but are not limited to, Freund's, mineral gels such as aluminium hydroxide, and surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol. Serum from the immunised animal is collected and treated according to known procedures. If serum containing polyclonal antibodies to the desired epitope contains antibodies to other antigens, the polyclonal antibodies can be purified by immunoaffinity chromatography. Techniques for producing and processing polyclonal antisera are well known in the art. Monoclonal antibodies directed against entire polypeptides or particular epitopes thereof can also be readily produced by one skilled in the art. The general methodology for making monoclonal antibodies by hybridomas is well known. Immortal antibody-producing cell lines can be created by cell fusion, and also by other techniques such as direct transformation of B lymphocytes with oncogenic DNA, or transfection with Epstein-Barr virus. Panels of monoclonal antibodies produced against the polypeptides listed above can be screened for various properties; i.e., for isotype and epitope affinity. Monoclonal antibodies may be prepared using any of the well-known techniques which provides for the production of antibody molecules by continuous cell lines in culture. It is preferred if the antibody is a monoclonal antibody. In some circumstances, particularly if the antibody is to be administered repeatedly to a human patient, it is preferred if the monoclonal antibody is a human monoclonal antibody or a humanised monoclonal
antibody, which are suitable for administration to humans without engendering an immune response by the human against the administered immunoglobulin. Suitably prepared non- human antibodies can be "humanised" in known ways, for example by inserting the CDR regions of mouse antibodies into the framework of human antibodies. Humanised antibodies can be made using the techniques and approaches described in Verhoeyen et al (1988) Science, 239, 1534-1536, and in Kettleborough et al, (1991) Protein Engineering, 14(7), 773-783. In some instances, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. In general, the humanised antibody will contain variable domains in which all or most of the CDR regions correspond to those of a non-human immunoglobulin, and framework regions which are substantially or completely those of a human immunoglobulin consensus sequence.
Completely human antibodies may be produced using recombinant technologies. Typically large libraries comprising billions of different antibodies are used. In contrast to the previous technologies employing chimerisation or humanisation of e.g. murine antibodies this technology does not rely on immunisation of animals to generate the specific antibody. Instead the recombinant libraries comprise a huge number of pre-made antibody variants wherein it is likely that the library will have at least one antibody specific for any antigen. Thus, using such libraries, an existing antibody having the desired binding characteristics can be identified.
It is appreciated that when the antibody is for administration to a non-human individual, the antibody may have been specifically designed/produced for the intended recipient species.
WO 98/32845 and Soderlind et al (2000) Nature BioTechnol. 18: 852-856 describe technology for the generation of variability in antibody libraries. Antibody fragments derived from this library all have the same framework regions and only differ in their CDRs. Since the framework regions are of germline sequence the immunogenicity of antibodies derived from the library, or similar libraries produced using the same technology, are expected to be particularly low (Soderlind et al, 2000). This property is of great value for therapeutic antibodies, reducing the risk that the patient forms antibodies to the administered antibody, thereby reducing risks for allergic reactions, the occurrence of blocking antibodies, and allowing a long plasma half-life of the antibody. Thus, when developing therapeutic antibodies to be used in humans, modern recombinant library technology (Soderlind et al, 2001 , Comb. Chem. & High Throughput Screen. 4: 409-416) is now used in preference to the earlier hybridoma technology.
By antibodies we also include heavy-chain antibodies structurally derived from camelidae antibodies, such as Nanobodies® (Ablynx). These are antibody-derived therapeutic proteins that contain the structural and functional properties of naturally-occurring heavy- chain antibodies. The Nanobody® technology was developed following the discovery that camelidae (camels and llamas) possess fully functional antibodies that lack light chains. These heavy-chain antibodies contain a single variable domain (VHH) and two constant domains (CH2 and CH3). The cloned and isolated VHH domain is a perfectly stable polypeptide harbouring the full antigen-binding capacity of the original heavy-chain antibody. These VHH domains with their unique structural and functional properties form the basis of Nanobodies®. They combine the advantages of conventional antibodies (high target specificity, high target affinity and low inherent toxicity) with important features of small molecule drugs (the ability to inhibit enzymes and access receptor clefts). Furthermore, they are stable, have the potential to be administered by means other than injection, are easier to manufacture, and can be humanised. (See, for example US 5,840,526; US 5,874,541 ; US 6,005,079, US 6.765,087; EP 1 589 107; WO 97/34103; WO97/49805; US 5,800,988; US 5,874, 541 and US 6,015,695).
A seventh aspect of the invention provides a nucleic acid molecule encoding a polypeptide agent that modulates the interaction between CD248 and MMRN2 according to the first aspect of the invention (which itself may be a portion of MMRN2 or portion of CD248), a portion of MMRN2 according to the second aspect of the invention, or a portion of CD248 according to the third aspect of the invention, the fusion protein according to the fourth aspect of the invention, the antibody according to the fifth aspect of the invention that selectively binds to a portion of MMRN2, or the antibody according to the sixth aspect of the invention that selectively binds to a portion of CD248. The nucleic acid molecule may be DNA or it may be RNA. Typically, it is comprised in a vector, such as a vector which can be used to express the said polypeptide agent, portion of MMRN2, portion of CD248, or antibody, or fusion protein.
Compounds comprising a detectable moiety
An eighth aspect of the invention provides a compound comprising an agent according to the first aspect of the invention, or a portion of MMRN2 according to the second aspect of the invention, or a portion of CD248 according to the third aspect of the invention; and a detectable moiety. Preferences for the agent, portion of MMRN2, and portion of CD248 include those described above in relation to the relevant aspects of this invention. It will
be appreciated that in this aspect of the invention, the agent is one that binds to CD248 or MMRN2.
Such a compound can be used, in combination with an appropriate detection method, to detect the location of the compound in the individual, and hence to identify the sites and extent of angiogenesis (e.g. tumour angiogenesis) in the individual, as well as inhibition of angiogenesis (e.g. tumour angiogenesis) in the individual.
By a "detectable moiety" we include the meaning that the moiety is one which, when located at the target site following administration of the compound of the invention into a patient, may be detected, typically non-invasively from outside the body, and the site of the target located. Thus, the compounds of this aspect of the invention are useful in imaging and diagnosis, especially in the imaging and diagnosis of neovasculature of solid tumours, as is described further below.
Typically, the detectable moiety is or comprises a magnetic nano-particle, a radionuclide or a fluorophore.
Thus, in an embodiment, the detectable moiety may be a radioactive atom which is useful in imaging. Suitable radioactive atoms include technetium-99m or iodine-123 for scintigraphic studies. Others may be selected from the group consisting of: iodine-124; iodine-125; iodine-126; iodine-131 ; iodine-133; indium-1 1 1 ; indium-1 13m, fluorine-18; fluorine-19; carbon-1 1 ; carbon-13; copper-64; nitrogen-13; nitrogen-15; oxygen-15; oxygen-17; arsenic-72; gadolinium; manganese; iron; deuterium; tritium; yttrium-86; zirconium-89; bromine-77, gallium-67; gallium-68, ruthenium-95, ruthenium-97, ruthenium-103, ruthenium-105, mercury-107, rhenium-99m, rhenium-101 , rhenium-105, scandium-47. Suitable methods for coupling such radioisotopes to the antibodies - either directly or via a chelating agent such as EDTA or DTPA -can be employed, as is known in the art.
Other readily detectable moieties include, for example, spin labels for magnetic resonance imaging (MRI) such as iodine-123 again, iodine-131 , indium-1 1 1 , fluorine-19, carbon-13, nitrogen-15, oxygen-17, gadolinium, manganese or iron. Clearly, the compound of the invention must have sufficient of the appropriate atomic isotopes in order for the molecule to be detectable.
The radio- or other label may be incorporated in the compound in known ways. For example, the portion of MMRN2 may be biosynthesised or synthesised by chemical amino acid synthesis using suitable amino acid precursors involving, for example, fluorine-19 in place of hydrogen. Labels such as 99mTc, 123l, 186Rh, 188Rh and 111 ln can, for example, be attached via cysteine residues in the portion of MMRN2, or in the portion of CD248, or antibody thereto. Yttrium-90 can be attached via a lysine residue. The IODOGEN method (Fraker et al (1978) Biochem. Biophys. Res. Comm. 80, 49-57) can be used to incorporate iodine-123. The reference ("Monoclonal Antibodies in Immunoscintigraphy", J.F. Chatal, CRC Press, 1989) describes other methods in detail.
Many suitable fluorophores and detection methods are well known in the art and are described, for example by Stefan Andersson-Engels et al (1997) "In vivo fluorescence imaging for tissue diagnostics. Phys. Med. Biol. 42: 815-824; Altinoglu et al (2008) "Near- Infrared Emitting Fluorophore-Doped Calcium Phosphate Nanoparticles for In Vivo Imaging of Human Breast Cancer" ACS Nano 2(10): 2075-84; and Chin et al (2009) "In- vivo optical detection of cancer using chlorin e6 - polyvinylpyrrolidone induced fluorescence imaging and spectroscopy" BMC Medical Imaging 9:1 (doi: 10.1186/1471- 2342-9-1). Examples include fluorescein and its derivatives, fluorochrome, rhodamine and its derivatives, Green Fluorescent Protein (GFP), dansyl, umbelliferone etc. In such conjugates, the portions of MMRN2 or CD248 of the invention or their functional fragments can be prepared by methods known to the person skilled in the art.
The detectable moiety may comprise a detectable enzyme such as peroxidase, alkaline phosphatase, beta-D-galactosidase, glucose oxidase, glucose amylase, carbonic anhydrase, acetylcholinesterase, lysozyme, malate dehydrogenase or glucose 6- phosphate dehydrogenase.
The detectable moiety may comprise a molecule such as biotin, digoxygenin or 5- bromodeoxyuridine.
The detectable moiety may comprise a chemiluminescent label such as luminol and the dioxetanes, or a bioluminescent label such as luciferase and luciferin.
The detectable label may comprise an affinity tag (e.g. histidine tag, Fc tag, BirA tag, maltose-binding protein tag, GST tag, HA tag, FLAG tag); or a directly detectable label (such as a fluorophore, a radioisotope, a contrast agent, or a luminescent label); or an indirectly detectable label (such as an enzyme, an enzyme substrate, an antibody, an
antibody fragment, an antigen, a hapten, a ligand, an affinity molecule, a chromogenic substrate, a protein, a peptide, a nucleic acid, a carbohydrate and a lipid).
In one embodiment of the eighth aspect of the invention, the compound comprises a portion of MMRN2 according to the second aspect of the invention and an Fc tag.
In an additional embodiment of the eighth aspect of the invention, the compound comprises a portion of CD248 according to the third aspect of the invention and an Fc tag. It will be appreciated that the detectable moiety may be one that is useful to detect the agent, or the portion of MMRN2, or the portion of CD248 during its manufacture and/or purification. Conveniently, the compound comprising agent, or the portion of MMRN2, or the portion of CD248 and detectable moiety may also comprise a cleavage site, for example to enable removal of a detectable moiety during purification. Any suitable cleavage site known in the art may be used. An example is the tobacco etch virus (TEV) cleavage site.
A ninth aspect of the invention provides a polynucleotide encoding a compound as defined above in the eighth aspect of the invention, wherein the agent according to the first aspect of the invention, a portion of MMRN2 according to the second aspect of the invention, or a portion of CD248; and the detectable moiety are fused. It will be appreciated that the ninth aspect of the invention also provides a vector comprising a polynucleotide encoding a compound as defined above in the seventh aspect of the invention, wherein the agent according to the first aspect of the invention, a portion of MMRN2 according to the second aspect of the invention, or a portion of CD248; and the detectable moiety are fused.
Compounds comprising a cytotoxic moiety
A tenth aspect of the invention provides a compound comprising: an agent according to the first aspect of the invention, a portion of MM RN2 according to the second aspect of the invention, or a portion of CD248 according to the third aspect of the invention; and a cytotoxic moiety. Preferences for the agent, portion of MMRN2 and portion of CD248 include those described above in relation to the relevant aspects of the invention. It will be appreciated that in this aspect of the invention, the agent is one that binds to CD248 or MMRN2.
The cytotoxic moiety may be directly or indirectly toxic to cells in neovasculature or cells which are in close proximity to and associated with neovasculature. By "directly cytotoxic" we include the meaning that the moiety is one which on its own is cytotoxic. By "indirectly cytotoxic" we include the meaning that the moiety is one which, although is not itself cytotoxic, can induce cytotoxicity, for example by its action on a further molecule or by further action on it. For example, an indirect cytotoxic moiety may act to recruit an immune cell (e.g. a cytotoxic immune cell such as a cytotoxic T cell), and thereby indirectly induce a cytotoxic effect. Typically, the cytotoxic moiety is selected from a directly cytotoxic chemotherapeutic agent, a directly cytotoxic polypeptide, a moiety which is able to convert a prodrug into a cytotoxic drug, a radiosensitizer, a directly cytotoxic nucleic acid, a nucleic acid molecule that encodes a directly or indirectly cytotoxic polypeptide or a radioactive atom. Examples of such cytotoxic moieties, as well as methods of making the conjugates comprising the cytotoxic moiety, are provided in earlier publications WO 02/36771 , WO 2004/046191 , and WO 2011/027132 incorporated herein by reference. It will be appreciated that it may be necessary for the compound to comprise a translocation domain capable of translocating the cytotoxic moiety into the cell, where the cytotoxic moiety is a directly cytotoxic moiety which exerts its cytotoxic effect inside the cell. For example, the translocation domain is preferably capable of forming permeable pores in the cellular membrane. The domain may be a translocating domain of an enzyme, such as a bacterial toxin or viral protein.
It will be appreciated, however, that a cytotoxic moiety may still exert its cytotoxic function outside of the cell without the need to be internalised. There are examples in the literature of targeting the tumour endothelial extracellular matrix with non-internalising antibody drug conjugates (Gebleux et al., 2017, Int J Cancer). Thus, the cytotoxic moiety may be joined to either of the portion of CD248, or portion of MMRN2, by a linker moiety that contains a cleavage site (eg protease cleavage site). When the compound is in the vicinity of a cell expressing either CD248 or MMRN2, the cleavage site may be cleaved, thereby enabling the cytotoxic moiety to be released and exert its cytotoxic function. Examples of cytotoxic moieties that may be used in this way include pyrrolobenzodiazepine and monomethyl auristatin E (MMAE).
In one embodiment the cytotoxic moiety is a cytotoxic chemotherapeutic agent. Cytotoxic chemotherapeutic agents, such as anticancer agents, are well known in the art, and include those described above.
Various of the cytotoxic moieties mentioned above, such as cytotoxic chemotherapeutic agents, have previously been attached to antibodies and other targeting agents, and so compounds of the invention comprising these agents may readily be made by the person skilled in the art. For example, carbodiimide conjugation (Bauminger & Wilchek (1980) Methods Enzymol. 70, 151-159) may be used to conjugate a variety of agents, including doxorubicin, to proteins. Other methods for conjugating a cytotoxic moiety to a protein can also be used. For example, sodium periodate oxidation followed by reductive alkylation of appropriate reactants can be used, as can glutaraldehyde cross-linking. Methods of cross- linking polypeptides are known in the art and described in WO 2004/046191. However, it is recognised that, regardless of which method of producing a compound of the invention is selected, a determination must be made that the agent or portion of MMRN2 or portion of CD248 maintains its targeting ability {e.g. the ability to bind to CD248 or MMRN2) and that the attached moiety maintains its relevant function. In a further embodiment of the invention, the cytotoxic moiety may be a cytotoxic peptide or polypeptide moiety by which we include any moiety which leads to cell death. Cytotoxic peptide and polypeptide moieties are well known in the art and include, for example, ricin, abrin, Pseudomonas exotoxin, tissue factor and the like. Methods for linking them to targeting moieties such as polypeptides are also known in the art, and include, for example, conventional ways of crosslinking polypeptides and production of the compound as a fusion polypeptide using recombinant DNA techniques. The use of ricin as a cytotoxic moiety is described in Burrows & Thorpe (1993) Proc. Natl. Acad. Sci. USA 90, 8996-9000, and the use of tissue factor, which leads to localised blood clotting and infarction of a tumour, has been described by Ran et al (1998) Cancer Res. 58, 4646-4653 and Huang et al (1997) Science 275, 547-550. Tsai et al (1995) Dis. Colon Rectum 38, 1067-1074 describes the abrin A chain conjugated to a monoclonal antibody. Other ribosome inactivating proteins are described as cytotoxic moieties in WO 96/06641. Pseudomonas exotoxin may also be used as the cytotoxic polypeptide moiety (Aiello et al (1995) Proc. Natl. Acad. Sci. USA 92, 10457-10461).
Certain cytokines, such as TNFa, INFy and IL-2, may also be useful as cytotoxic moieties.
Certain radioactive atoms may also be cytotoxic if delivered in sufficient doses. Thus, the cytotoxic moiety may comprise a radioactive atom which, in use, delivers a sufficient quantity of radioactivity to the target site so as to be cytotoxic. Suitable radioactive atoms include phosphorus-32, iodine-125, iodine-131 , indium-1 11 , rhenium-186, rhenium-188 or yttrium-90, or any other isotope which emits enough energy to destroy neighbouring cells,
organelles or nucleic acid. Preferably, the isotopes and density of radioactive atoms in the compound of the invention are such that a dose of more than 4000 cGy (preferably at least 6000, 8000 or 10000 cGy) is delivered to the target site and, preferably, to the cells at the target site and their organelles, particularly the nucleus.
The radioactive atom may be attached to the agent, portion of MMRN2, or portion of CD248 in known ways. For example, EDTA or another chelating agent may be attached to the portion and used to attach 111 In or 90Y. Tyrosine residues may be labelled with 125l or 3 l.
The cytotoxic moiety may be a radiosensitizer. Radiosensitizers include fluoropyrimidines, thymidine analogues, hydroxyurea, gemcitabine, fludarabine, nicotinamide, halogenated pyrimidines, 3-aminobenzamide, 3-aminobenzodiamide, etanixadole, pimonidazole and misonidazole (see, for example, McGinn et a/ (1996) J. Natl. Cancer Inst. 88, 1193-11203; Shewach & Lawrence (1996) Invest. New Drugs 14, 257-263; Horsman (1995) Acta Oncol. 34, 571-587; Shenoy & Singh (1992) Clin. Invest. 10, 533-551 ; Mitchell et al (1989) Int. J. Radiat. Biol. 56, 827-836; lliakis & Kurtzman (1989) Int. J. Radiat. Oncol. Biol. Phys. 16, 1235-1241 ; Brown (1989) Int. J. Radiat. Oncol. Biol. Phys. 16, 987-993; Brown (1985) Cancer 55, 2222-2228).
The cytotoxic moiety may be a procoagulant factor, such as the extracellular domain of tissue factor (Rippmann et al (2000) "Fusion of the tissue factor extracellular domain to a tumour stroma specific single-chain fragment variable antibody results in an antigen- specific coagulation-promoting molecule." Biochem J. 349: 805-12; Huang et al (1997) "Tumor infarction in mice by antibody-directed targeting of tissue factor to tumor vasculature." Science. 275(5299): 547-550.
The cytotoxic moiety may be an indirectly cytotoxic polypeptide. In a particularly preferred embodiment, the indirectly cytotoxic polypeptide is a polypeptide which has enzymatic activity and can convert a relatively non-toxic prodrug into a cytotoxic drug. When the targeting moiety is an antibody, this type of system is often referred to as ADEPT (Antibody-Directed Enzyme Prodrug Therapy). The system requires that the targeting moiety locates the enzymatic portion to the desired site in the body of the patient (e.g. the site of new vascular tissue associated with a tumour) and after allowing time for the enzyme to localise at the site, administering a prodrug which is a substrate for the enzyme, the end product of the catalysis being a cytotoxic compound. The object of the approach is to maximise the concentration of drug at the desired site and to minimise the
concentration of drug in normal tissues (Senter et al (1988) "Anti-tumor effects of antibody- alkaline phosphatase conjugates in combination with etoposide phosphate" Proc. Natl. Acad. Sci. USA 85, 4842-4846; Bagshawe (1987) Br. J. Cancer 56, 531-2; and Bagshawe, et al (1988) "A cytotoxic moiety can be generated selectively at cancer sites" Br. J. Cancer. 58, 700-703); Bagshawe (1995) Drug Dev. Res. 34, 220-230 and WO 2004/046191 , describe various enzyme/prodrug combinations which may be suitable in the context of this invention.
Typically, the prodrug is relatively non-toxic compared to the cytotoxic drug. Typically, it has less than 10% of the toxicity, preferably less than 1 % of the toxicity as measured in a suitable in vitro cytotoxicity test.
It is likely that the moiety which is able to convert a prodrug to a cytotoxic drug will be active in isolation from the rest of the compound but it is necessary only for it to be active when (a) it is in combination with the rest of the compound and (b) the compound is attached to, adjacent to or internalised in target cells.
The cytotoxic moiety may be one which becomes cytotoxic, or releases a cytotoxic moiety, upon irradiation. For example, the boron-10 isotope, when appropriately irradiated, releases a particles which are cytotoxic (US 4,348,376; Primus et al (1996) Bioconjug. Chem. 7: 532-535).
Similarly, the cytotoxic moiety may be one which is useful in photodynamic therapy such as photofrin (see, for example, Dougherty et al (1998) J. Natl. Cancer Inst. 90, 889-905).
In a particular embodiment, the cytotoxic moiety is an antibody, such as one that specifically binds to an immune cell, such as a cytotoxic immune cell (e.g. T cell). Thus, it will be appreciated that the compound of the invention may be useful in targeting an immune synapse, which is considered to be an interface between a target cell (e.g. a cell overexpressing CD248 or MMRN2) and a lymphocyte such as an effector T cell or Natural Killer cell. In this way, the compounds of the invention are similar to bispecific T cell engagers (BiTEs), which are well known in the art.
In another embodiment, the cytotoxic moiety is a pyrrolobenzodiazepine dimer (PBD). PBDs are potent anticancer agents which have been shown to have broad spectrum anti- tumour activity in vivo. These drugs exert their activity by binding the minor groove of DNA and linking the two DNA strands together in a way that cells find difficult to recognise and
repair. Thus the compound of the invention may comprise a PBD. Further information on PBDs can be found in Hartley et al, 2012 {Invest New Drugs 30: 950-958).
In another embodiment, the cytotoxic moiety is monomethyl auristatin E (MMAE).
An eleventh aspect of the invention provides a polynucleotide encoding a compound as defined above in the tenth aspect of the invention, wherein the agent, the portion of MMRN2, the portion of CD248 and the cytotoxic moiety are polypeptides which are fused. The aspect also includes a vector comprising such a polynucleotide.
Chimeric antigen receptors (CARs)
A twelfth aspect of the invention provides a chimeric antigen receptor (CAR) comprising (a) a portion of MMRN2 or a variant thereof that binds to CD248 (b) a transmembrane domain; and (c) an intracellular signalling domain.
CARs are recombinant receptors for antigen, which, in a single molecule, redirect the specificity and function of T lymphocytes and other immune cells (Sadelain et al 2013 Cancer Discov 3(4): 388). The general premise for their use in cancer immunotherapy is to rapidly generate tumour-targeted T cells, bypassing the barriers and incremental kinetics of active immunisation. Once expressed in T cells, CAR-modified T cells acquire supra-physiological properties and act as "living drugs" that may exert both immediate and long-term effects. The engineering of CARs into T cells requires that T cells be cultured to allow for transduction and expansion. The transduction may utilise a variety of methods, but stable gene transfer is required to enable sustained CAR expression in clonally expanding and persisting T cells. In principle, any cell surface molecule can be targeted through a CAR, thus overriding tolerance to self-antigens and the antigen recognition gaps in the physiological T cell repertoire that limit the scope of T cell reactivity. Various T cell subsets, as well as T cell progenitors and other immune cells such as natural killer cells, can be targeted to any unwanted cell by modification with a CAR.
By a portion of MMRN2 or a variant thereof that binds to CD248, we include the meaning of any portion of the full length native MMRN2 polypeptide or any portion of a variant of the full length native MMRN2 polypeptide, provided that that portion binds to CD248. Preferences for the variant of native MMRN2, for the length of the portion, and for the degree of sequence identity between the portion and corresponding portion of wild type
MMRN2 include those described above in relation to the first and second aspects of the invention. It is preferred if the portion of MMRN2 selectively binds to CD248.
In a particularly preferred embodiment, the portion of MMRN2 contained within the CAR is the portion of MMRN2 of the first or second aspect of the invention. Thus, the portion of MMRN2 may correspond to the region spanning amino acid residues 133-486 of human MMRN2. It will be appreciated that the portion of MMRN2 may need to be attached to a linker or spacer moiety to allow it to bind to CD248. Such linker or spacer moieties are common in CARs that comprise scFv antibodies, and so are well known to the skilled person. Typically, the portion of MMRN2 is attached to a linker peptide that adopts a random coil conformation, such as peptides that contain alanine or proline or a mixture of alanine plus proline residues. Other possible linkers include glycine and/or serine residues. The linker peptide may be between 2 and 100 amino acids, such as 2 and 50 amino acids.
By a transmembrane domain we include the meaning of any moiety that is capable of being embedded in a lipid membrane. By being embedded in a lipid membrane we include the meaning of the transmembrane domain favourably interacting with the hydrophobic portions of the lipids that make up the lipid membrane. Insertion into lipid membranes may be assayed using any suitable method known in the art, including fluorescence labelling with fluorescence microscopy. Hence, it will be appreciated that the transmembrane domain is one that locates the CAR molecule within the lipid membrane.
In an embodiment, the transmembrane domain comprises the transmembrane domain of a protein (e.g. a transmembrane protein). The transmembrane domain can include one or more additional amino acids adjacent to the transmembrane region, such as one or more amino acids associated with the extracellular region of the protein from which the transmembrane domain was derived (e.g. 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 up to 15 amino acids of the extracellular region) and/or one or more additional amino acids associated with the intracellular region of the protein from which the transmembrane protein is derived (e.g. 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 up to 15 amino acids of the intracellular region). In an embodiment, the transmembrane domain is one that is associated with one of the other domains of the CAR. In an embodiment, the transmembrane domain comprises the transmembrane portion of an intracellular signalling protein that constitutes at least part of the intracellular signalling domain. In some instances, the transmembrane domain can be selected or modified by amino acid substitution to avoid binding of such domains to the transmembrane domains of the same or different surface membrane proteins, e.g. to
minimise interactions with other members of the receptor complex. In some instances, the transmembrane domain is capable of homodimerisation with another CAR on the cell surface. The transmembrane domain may be derived either from a natural or from a recombinant source. The domain may be derived from any membrane-bound or transmembrane protein. In one embodiment, the transmembrane domain is capable of signalling to the intracellular domain(s) whenever the CAR has bound to a target. A suitable transmembrane domain for use in the invention may include the transmembrane region(s) of the alpha, beta or zeta chain of the T cell receptor, CD28, CD3 epsilon, CD8, CD45 and CD4.
In some instances, the transmembrane domain can be attached to the portion of MMRN2 that binds to CD248, optionally via a hinge region. The hinge region may comprise one or more immunoglobulin domains. Particular examples include the Fc region of lgG1 and the immunoglobulin-like extracellular regions of CD4 and CD8. The hinge may be from a human protein such as human immunoglobulin.
Typically, the transmembrane domain comprises predominantly hydrophobic amino acid residues such as leucine and valine.
In an embodiment, a short oligo- or polypeptide linker, such as between 2 and 10 amino acids in length, may form the linkage between the transmembrane domain and the intracellular signalling domain of the CAR. The linker may comprise glycine and/or serine residues (eg a glycine-serine doublet).
By intracellular signalling domain we include the meaning of a domain that is capable of activating at least one of the normal functions of the cell in which the CAR is introduced, such as at least one of the normal effector functions of an immune cell (e.g. T cell). An effector function refers to a specialised function of a cell. The effector function of a T cell, for example, may be cytolytic function or helper activity including the secretion of cytokines. Thus, the intracellular signalling domain may be a portion of a protein which transduces the effector function signal and directs the cell (e.g. T cell) to perform a specialised function.
Generally, the whole intracellular signalling domain can be used; however, it is appreciated that it is not necessary to use the entire domain, provided that whatever part of the
signalling domain that is used is still capable of transducing the effector function signal. It will also be appreciated that variants of such intracellular signalling domains with substantially the same or greater functional capability may also be used. By this we include the meaning that the variants should have substantially the same or greater transduction of the effector functional signal. Typically, substantially the same or greater signal transduction includes at least 80%, 85%, 90%, 95%, 100%, 105%, 1 10%, 1 15%, or 120%, or more of the signal transduction of the unmodified intracellular signalling domain, wherein signal transduction of the unmodified intracellular signalling domain corresponds to 100%. Methods for assessing transduction of effector function signal are well known to those skilled in the art and include, for example, assessing the amounts and/or activity of molecules (e.g. proteins such as cytokines) that are indicative of the transduced signal. Thus, when the signal is the cytolytic function of a T-cell, the methods may involve measurement of one or more cytokines secreted by the T-cell, which cytokines are known to have a cytolytic activity (e.g. I FN gamma). Another means of assessing the cytolytic function is by a chromium release assay as is well known in the art.
Examples of intracellular signalling domains for use in the CAR of the invention include the cytoplasmic sequences of the T cell receptor (TCR) and co-receptors that act in concert to initiate signal transduction following antigen receptor engagement, as well as any derivative or variant of these sequences and any recombinant sequence that has the same functional capability.
It is known that signals generated through the TCR alone are generally insufficient for full activation of a T cell and that a secondary and/or costimulatory signal may also be required. Thus, T cell activation can be said to be mediated by two distinct classes of intracellular signaling sequences: those that initiate antigen-dependent primary activation through the TCR (primary intracellular signaling domains) and those that act in an antigen- independent manner to provide a secondary or costimulatory signal (secondary intracellular signalling domain, such as a costimulatory domain). Costimulatory domains promote activation of effector functions and may also promote persistence of the effector function and/or survival of the cell.
A primary intracellular signaling domain regulates primary activation of the TCR complex either in a stimulatory way, or in an inhibitory way. Primary intracellular signaling domains that act in a stimulatory manner may contain signalling motifs which are known as immunoreceptor tyrosine-based activation motifs or ITAMs (e.g. 2, 3, 4, 5 or more ITAMs).
Thus, the intracellular signalling domain may comprise one or more ITAMs. Examples of ITAM containing primary intracellular signaling domains that are of particular use in the invention include those of CD3 zeta, Fc receptor gamma, Fc receptor beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, and CD66d.
In one embodiment, a CAR of the invention comprises an intracellular signaling domain of CD3-zeta.
It will be appreciated that one or more ITAMs of the intracellular signalling domain may be modified, for example by mutation. The modification may be used to increase or decrease the signalling function of the ITAM as compared to the native ITAM domain.
As mentioned above, the intracellular signalling domain may comprise a primary intracellular signalling domain by itself, or it may comprise a primary intracellular signalling domain in combination with one or more secondary intracellular signalling domains, such as one or more costimulatory signalling domains. Thus, the intracellular signalling domain of the CAR may comprise the CD3 zeta signalling domain by itself or in combination with one or more other intracellular signalling domains such as one or more costimulatory signalling domains.
The costimulatory signaling domain refers to a portion of the CAR comprising the intracellular domain of a costimulatory molecule. A costimulatory molecule may be a cell surface molecule other than an antigen receptor or its ligands that is required for an efficient response of immune cells (eg lymphocytes) to an antigen. Examples of such molecules include CD28, 4-1 BB (CD137), OX40, ICOS, DAP10, CD27, CD30, CD40, ICOS, lymphocyte function-associated antigen- 1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7- H3, and a ligand that specifically binds with CD83, and the like. For example, CD27 co- stimulation has been demonstrated to enhance expansion, effector function, and survival of human CART cells in vitro and augments human T cell persistence and anti-tumour activity in vivo (Song et al. Blood. 2012; 1 19(3):696-706).
The intracellular signaling sequences within the intracellular portion of the CAR of the invention may be linked to each other in a random or specified order. Optionally, a short oligo- or polypeptide linker, for example, between 2 and 10 amino acids (eg 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids) in length may form the linkage between intracellular signaling sequences. In one embodiment, a glycine- serine doublet can be used as a suitable linker.
In another embodiment, a single amino acid, such as an alanine or a glycine, can be used as a suitable linker.
In one embodiment, the intracellular signaling domain is designed to comprise two or more, for example 3, 4, 5, or more, costimulatory signalling domains. In an embodiment, the two or more, e.g., 2, 3, 4, 5, or more, costimulatory signaling domains, are separated by a linker molecule, such as one described herein. In one embodiment, the intracellular signaling domain comprises two costimulatory signaling domains. In some embodiments, the linker molecule is a glycine residue. In some embodiments, the linker is an alanine residue.
In a preferred embodiment, the intracellular portion of the CAR comprises the signalling domain of CD3 zeta and the signalling domain of CD28. In another embodiment, the intracellular portion of the CAR comprises the signaling domain of CD3-zeta and the signaling domain of 4-1 BB.
In another embodiment, the intracellular portion of the CAR comprises the signaling domain of CD3-zeta and the signaling domain of OX40.
In another embodiment, the intracellular portion of the CAR comprises the signaling domain of CD3-zeta and the signaling domain of ICOS.
In another embodiment, the intracellular portion of the CAR comprises the signaling domain of CD3-zeta and the signaling domain of DAP10.
In another embodiment, the intracellular portion of the CAR comprises the signalling domain of CD3-zeta, the signalling domain of 4-1 BB and the signalling domain of OX40. In another embodiment, the intracellular portion of the CAR comprises the signaling domain of 4-1 BB and the signaling domain of CD28.
In another embodiment, the intracellular portion of the CAR comprises the signaling domain of CD3-zeta, the signaling domain of 4-1 BB and the signalling domain of CD28.
In an embodiment, the CAR further comprises a leader sequence. By a "leader sequence" we include the meaning of a peptide sequence that directs the CAR to the cell membrane.
Thus, when the CAR is a chimeric fusion protein, it may contain a leader sequence at the amino-terminus (N-ter) of the portion of MMRN2 that binds CD248. Optionally, the leader sequence is cleaved from the portion of MMRN2 during cellular processing and localisation of the CAR to the cellular membrane.
An exemplary leader sequence is the oncostatin M leader sequence MGVLLTQRTLLSLVLALLFPSMAS (SEQ ID No: 5) or a variant thereof (e.g. one having at least 70%, 75%, 80%, 85%, 90%, 95% or 99% sequence identity to said sequence); however, other leader sequences will also be known to a person skilled in the art, such as the leader sequence from CD8. The core of a leader sequence typically contains a stretch of hydrophobic amino acids that has a tendency to form a single alpha-helix.
In a further embodiment, the CAR may comprise a suicide moiety. By a suicide moiety we include the meaning of a molecule which possesses an inducible capacity to lead to the death of the cell in whose cellular membrane the CAR resides (eg T cell). In this way, the effect that the CARs have on a subject can be tightly controlled via selective deletion of the cells that comprise them. Conveniently, the suicide moiety comprises the epitope of an antibody that is either directly or indirectly cytotoxic. Antibodies that are directly cytotoxic include lytic antibodies such as Rituximab, which binds to CD20. Thus, in one embodiment, the CAR may comprise a CD20 epitope. Antibodies may also be indirectly cytotoxic by being conjugated to one or more cytotoxic moieties. Suicide moieties are well known in the art and are reviewed in Jones et al (Front Pharmacol 2014, 5: 254). An example is inducible caspase-9. In an embodiment, the CAR comprises a portion of MMRN2 of the first or second aspects of the invention, a transmembrane domain, and an intracellular signalling domain (e.g. an intracellular signalling domain comprising a primary signalling domain such as CD3 zeta, and optionally one or more costimulatory domains such as CD28, 4-1 BB, OX40, ICOS and DAP10).
In an embodiment, the CAR comprises a leader sequence (e.g. oncostatin M leader sequence), a portion of MMRN2 of the first or second aspects of the invention, a hinge region, a transmembrane domain, and an intracellular signalling domain (e.g. an intracellular signalling domain comprising a primary signalling domain such as CD3 zeta, and optionally one or more costimulatory domains such as CD28, 4-1 BB, OX40, ICOS and DAP10).
A thirteenth aspect of the invention provides a polynucleotide encoding a CAR as defined above in relation to the twelfth aspect of the invention. It will be appreciated that the thirteenth aspect of the invention also provides a vector comprising a polynucleotide encoding a CAR defined above.
Polynucleotides, vectors, expression and cells
The nucleic acid molecule of any of the fourth, seventh, ninth, eleventh and thirteenth aspects of the invention may be DNA or RNA, and is preferably DNA, in particular circumstances. In other circumstances, e.g. when employing cell therapy, RNA may be preferred. It may comprise deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and/or their analogues, or any substrate that can be incorporated into a polymer by DNA or RNA polymerase, or by a synthetic reaction. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and their analogues. If present, modification to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. Suitable sequences can readily be determined based upon the knowledge of the genetic code. A fourteenth aspect of the invention provides a vector comprising the polynucleotide of any of the fourth, seventh, ninth, eleventh and thirteenth aspects of the invention.
A fifteenth aspect of the invention provides a host cell comprising a polynucleotide according to any of the fourth, seventh, ninth, eleventh and thirteenth aspects of the invention, and/or an agent according to the first aspect of the invention, or a MMRN2 portion according to second aspect of the invention, or a CD248 portion according to third aspect of the invention, or an antibody according to the fifth or sixth aspects of the invention, or a CAR according to the twelfth aspect of the invention, or a vector according to the fourteenth aspect of the invention.
The vector can be of any type, and refers to a nucleic acid that comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell. Numerous vectors are known in the art including linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term vector includes an autonomously replicating plasmid or a virus. The term should also be construed to further include non-plasmid and non-viral compounds which
facilitate transfer of nucleic acid into cells, such as, for example, a polylysine compound, liposome, and the like.
Conveniently, the vector is an expression vector. Expression vectors contain elements (e.g., promoter, signals of initiation and termination of translation, as well as appropriate regions of regulation of transcription) which allow the expression and/or the secretion of products in a host cell. Expression vectors include all those known in the art, including cosmids, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate the recombinant polynucleotide. Typical cloning vectors contain transcription and translation terminators, initiation sequences, and promoters useful for regulation of the expression of the desired nucleic acid sequence.
The vector can be suitable for replication and integration in eukaryotes, and/or it may be suitable for expression in prokaryotes, such as in bacterial species. Preferably, the vector is capable of expressing the nucleic acids of the invention in mammalian cells (eg human cells), such as mammalian (eg human) immune cells (eg T cells), for example for the expression of CARs. The nucleic acids of the invention can also be cloned into a number of types of vectors including a plasmid, a phagemid, a phage derivative, an animal virus, and a cosmid. Vectors of particular interest include expression vectors, replication vectors, probe generation vectors, and sequencing vectors. Any of a variety of host cells can be used, such as a prokaryotic cell, for example, E. coli, or a eukaryotic cell, for example a mammalian cell such as Chinese Hamster Ovary (CHO) cell, or a yeast, insect or plant cell. Many suitable vectors and host cells are very well known in the art. Preferably, the host cell is a stable cell line. Alternatively, the host cell may be a cell obtained from a patient, e.g. a T cell or other immune cell, as discussed further below.
The invention also includes methods for making an agent, a portion of MMRN2, a portion of CD248, a fusion protein, an antibody that selectively binds to the MMRN2 portion, an antibody that selectively binds to the CD248 portion, or a CAR according to the invention. For example, the invention comprises expressing in a suitable host cell a recombinant vector encoding the agent, a portion of MMRN2, a portion of CD248, a fusion protein, an antibody that selectively binds to the MMRN2 portion, an antibody that selectively binds to
the CD248 portion, or a CAR, and recovering the product. Methods for expressing and purifying polypeptides are very well known in the art.
The invention also provides a method of producing a cell comprising introducing a polynucleotide molecule according to the fourth, seventh, ninth, eleventh or thirteenth aspects of the invention, or a vector according to the fourteenth aspect of the invention. Suitable methods of introducing polynucleotide molecules and/or vectors include those described above, and are generally known in the art. Particularly, electroporation may be used.
Any of a variety of host cells can be used, such as a prokaryotic cell, for example, E. coli, or a eukaryotic cell, for example a mammalian cell such as Chinese Hamster Ovary (CHO) cell, or a yeast, insect or plant cell. In addition to a host cell being used in a method to produce an agent, a portion of MMRN2, a portion of CD248, a fusion protein, an antibody of the invention, or a CAR of the invention, the host cell itself may be used directly in therapy, for example in cell mediated therapy. Thus, the invention provides a method of treatment, comprising administering a host cell according to the invention to the subject, for example for use in medicine or for combating cancer and/or for modulating angiogenesis. Accordingly, the invention also provides a host cell comprising a polynucleotide molecule according to fourth, seventh, ninth, eleventh and thirteenth aspects of the invention, eg an RNA molecule, or a vector according to the thirteenth aspect of the invention, eg a gamma retrovirus or a lentivirus, for use in medicine, for example for use in the treatment of cancer. The invention also provides for the use of said host cell in the preparation of a medicament for use in medicine, for example for use in the treatment of cancer. Preferences for the agent, portion of MMRN2, portion of CD248, antibodies, CAR, and fusion protein are as outlined above.
In a preferred embodiment, the host cell is a mammalian cell (eg a human cell).
In a further preferred embodiment, the host cell is an immune cell, preferably a mammalian immune cell such as a human immune cell. This is particularly relevant when the host cell of the invention expresses a CAR of the invention. Immune cells include T cells and natural killer (NK) cells. The T cell may be any of an alpha-beta T cell, a gamma-delta T cell, a memory T cell (e.g. a memory T cell with stem cell-like properties). The NK cell may be an invariant NK cell.
In a particularly preferred embodiment, the immune cell is a memory T cell with stem cell like properties.
The cell may be "autologous" or "allogeneic", as described further below.
Immune cells such as T cells can be obtained from a number of sources peripheral blood mononuclear cells, bone marrow, lymph node tissue, cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors. Any number of cell lines (eg immune cell lines such as T cell lines) available in the art, may also be used.
In an embodiment, immune cells (eg T cells) are obtained from a unit of blood collected from a subject using any suitable techniques known in the art such as Ficoll™ separation. In another embodiment, cells from the circulating blood of a subject are obtained by apheresis. The apheresis product typically contains lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and platelets. It will be appreciated that the cells collected by apheresis may be washed to remove the plasma fraction and to place the cells in an appropriate buffer or media for subsequent processing steps. For example, the cells may be washed with phosphate buffered saline (PBS). Alternatively, the wash solution lacks calcium and may lack magnesium or may lack many if not all divalent cations. Initial activation steps in the absence of calcium can lead to magnified activation. A washing step may be accomplished by methods known to those in the art, such as by using a semi- automated "flow-through" centrifuge (for example, the Cobe 2991 cell processor, the Baxter CytoMate, or the Haemonetics Cell Saver 5) according to the manufacturer's instructions. After washing, the cells may be resuspended in a variety of biocompatible buffers, such as, for example, Ca-free, Mg-free PBS, PlasmaLyte A, or other saline solution with or without buffer. Alternatively, the undesirable components of the apheresis sample may be removed and the cells directly resuspended in culture media.
In an embodiment, T cells are isolated from peripheral blood lymphocytes by lysing the red blood cells and depleting the monocytes, for example, by centrifugation through a PERCOLLTM gradient or by counter-flow centrifugal elutriation. Specific subpopulations of T cells, such as CD3+, CD28+, CD4+, CD8+, CD45RA+, and CD45RO+T cells, may be further isolated by positive or negative selection techniques known in the art. For example, T cells may be isolated by incubation with anti-CD3/anti-CD28 (e.g., 3x28)-conjugated beads, such as DYNABEADS® M-450 CD3/CD28 T, for a time period sufficient for positive
selection of the desired T cells. Additionally or alternatively, a population of T cells may be enriched by negative selection, for instance by a combination of antibodies directed to surface markers unique to the negatively selected cells. Cell sorting and/or selection via negative magnetic immunoadherence or flow cytometry may be used.
It will be understood that cells derived from subjects that are to be modified to express the CAR of the invention may be stored for a period of time prior to their use (see, for example, therapeutic methods below). For example, the cells may be frozen, optionally after they have been washed, or they may be incubated under suitable conditions for them to remain viable until needed (e.g. on a rotator at 2-10°C or at room temperature). In this way, the cells can be stored until such time as they might be needed. They may be stored in an unmodified state (i.e. wherein they do not express the CAR of the invention) or in a modified state (i.e. wherein they have been modified to express the CAR of the invention). Prior to use in the therapeutic applications described further below, the cells may be activated and expanded generally using methods known in the art. For example, T cells may be expanded by contact with a surface having attached thereto an agent that stimulates a CD3/TCR complex associated signal and a ligand that stimulates a costimulatory molecule on the surface of the T cells. In particular, T cell populations may be stimulated as described herein, such as by contact with an anti-CD3 antibody, or antigen-binding fragment thereof, or an anti-CD2 antibody immobilized on a surface, or by contact with a protein kinase C activator (eg bryostatin) in conjunction with a calcium ionophore. For co-stimulation of an accessory molecule on the surface of the T cells, a ligand that binds the accessory molecule is used. For example, a population of T cells can be contacted with an anti-CD3 antibody and an anti-CD28 antibody, under conditions appropriate for stimulating proliferation of the T cells. Examples of an anti-CD28 antibody include 9.3, B-T3, XR-CD28 (Diaclone, Besancon, France) can be used as can other methods commonly known in the art (Berg et al. , Transplant Proc. 30(8):3975-3977, 1998; Haanen et al. , J. Exp. Med. 190(9): 13191328, 1999; Garland et al. , J. Immunol Meth. 227(1 - 2):53-63, 1999).
T cells that have been exposed to varied stimulation times may exhibit different characteristics. For example, typical blood or apherised peripheral blood mononuclear cell products have a helper T cell population (TH, CD4+) that is greater than the cytotoxic or suppressor T cell population (TC, CD8+). Ex vivo expansion of T cells by stimulating CD3 and CD28 receptors produces a population of T cells that prior to about days 8-9 consists predominately of TH cells, while after about days 8-9, the population of T cells comprises
an increasingly greater population of TC cells. Accordingly, depending on the purpose of treatment, infusing a subject with a T cell population comprising predominately of TH cells may be advantageous. Similarly, if an antigen-specific subset of TC cells has been isolated it may be beneficial to expand this subset to a greater degree.
Particularly, T cells may be expanded prior to transduction with a polynucleotide or vector of the invention.
In an embodiment, the cell that expresses the agent, a portion of MMRN2, a portion of CD248 or antibodies of the invention or CAR of the invention is further modified to comprise or express one or more other agents that enhance the activity of the cell (e.g. T cell) expressing the agent, a portion of MMRN2, a portion of CD248 or antibodies of the invention or CAR of the invention. For example, the other agent may be an agent that inhibits an inhibitory molecule that is known to decrease the ability of the CAR-expressing cell to mount an effective immune response. Examples of inhibitory molecules include PD1 , PD-L1 , CTLA4, TIM3, LAG3, VISTA, BTLA, TIGIT, LAI R1 , CD160, 2B4 and TGFR beta. The agent that inhibits the inhibitory molecule may comprise a first polypeptide, e.g. an inhibitory molecule, associated with a second polypeptide that provides a positive signal to the cell, e.g. an intracellular signalling domain described herein.
Additionally or alternatively, the other agent may be a pro-inflammatory or pro-proliferative cytokine. The purpose of such cytokines may be to provide autocrine support to enhance the function, proliferation and/or persistence of antibody-expressing cells, and/or favourably alter the tumour microenvironment and recruit endogenous innate and cognate immune effects.
Medical uses
The inventors have identified new molecular interactions that underline novel therapeutic approaches for modulating angiogenesis and/or combating cancer. In particular, an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MMRN2 portion according to the second aspect of the invention, a CD248 portion according to the third aspect of the invention, a fusion protein according to the fourth aspect of the invention, an antibody according to the fifth or sixth aspects of the invention, a polynucleotide according to any of fourth, seventh, ninth, eleventh and
thirteenth aspects of the invention, a vector according to the fourteenth aspect of the invention, a cell according to the fifteenth aspect of the invention, a compound according to the eighth or tenth aspects of the invention, a CAR according to the twelfth aspect of the invention, have therapeutic potential. These molecules are collectively referred to herein as the agent of the invention.
Accordingly, a sixteenth aspect of the invention provides the agent of the invention (ie an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MMRN2 portion according to the second aspect of the invention, a CD248 portion according to the third aspect of the invention, a fusion protein according to the fourth aspect of the invention, an antibody according to the fifth or sixth aspects of the invention, a polynucleotide according to any of fourth, seventh, ninth, eleventh and thirteenth aspects of the invention, a vector according to the fourteenth aspect of the invention, a cell according to the fifteenth aspect of the invention, a compound according to the eighth or tenth aspects of the invention, a CAR according to the twelfth aspect of the invention) for use in medicine.
A seventeenth aspect of the invention provides a method of modulating angiogenesis in an individual, the method comprising administering to the individual the agent of the invention (ie an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MMRN2 portion according to the second aspect of the invention, a CD248 portion according to the third aspect of the invention, a fusion protein according to the fourth aspect of the invention, an antibody according to the fifth or sixth aspects of the invention, a polynucleotide according to any of fourth, seventh, ninth, eleventh and thirteenth aspects of the invention, a vector according to the fourteenth aspect of the invention, a cell according to the fifteenth aspect of the invention, a compound according to the eighth or tenth aspects of the invention, a CAR according to the twelfth aspect of the invention). This aspect of the invention includes the agent of the invention (ie an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MMRN2 portion according to the second aspect of the invention, a CD248 portion according to the third aspect of the invention, a fusion protein according to the fourth aspect of the invention, an antibody according to the fifth or sixth aspects of the invention, a polynucleotide according to any of fourth, seventh, ninth, eleventh and thirteenth aspects of the invention, a vector according to the fourteenth aspect of the invention, a cell according to the fifteenth aspect of the invention, a compound according to the eighth or
tenth aspects of the invention, a CAR according to the twelfth aspect of the invention) for use in modulating angiogenesis in an individual.
The aspect of the invention also includes the use of the agent of the invention (i.e. an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MMRN2 portion according to the second aspect of the invention, a CD248 portion according to the third aspect of the invention, a fusion protein according to the fourth aspect of the invention, an antibody according to the fifth or sixth aspects of the invention, a polynucleotide according to any of fourth, seventh, ninth, eleventh and thirteenth aspects of the invention, a vector according to the fourteenth aspect of the invention, a cell according to the fifteenth aspect of the invention, a compound according to the eighth or tenth aspects of the invention, a CAR according to the twelfth aspect of the invention) in the preparation of a medicament for modulating angiogenesis in an individual.
In the seventeenth aspect of the invention, it is preferred if the agent, portion of MMRN2, or portion of CD248 are ones that inhibit the interaction between MMRN2 and CD248, and that angiogenesis is inhibited. For the avoidance of doubt, it will also be appreciated that the invention also includes an in vitro or ex vivo method of modulating angiogenesis (e.g. tumour angiogenesis) comprising administering to tissue or cells in vitro or ex vivo the agent of the invention (i.e. an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MMRN2 portion according to the second aspect of the invention, a CD248 portion according to the third aspect of the invention, a fusion protein according to the fourth aspect of the invention, an antibody according to the fifth or sixth aspects of the invention, a polynucleotide according to any of fourth, seventh, ninth, eleventh and thirteenth aspects of the invention, a vector according to the fourteenth aspect of the invention, a cell according to the fifteenth aspect of the invention, a compound according to the eighth or tenth aspects of the invention, a CAR according to the twelfth aspect of the invention). Preferably, the agent is an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MMRN2 portion according to the second aspect of the invention, a CD248 portion according to the third aspect of the invention, an antibody according to the fifth or sixth aspects of the invention, preferences for which include those described above. The cells may be established cell lines, or cells that have been removed from an individual. The tissue or cells are preferably mammalian tissue or cells (e.g. endothelial tissue or cells), and most preferably are human tissue or
cells. When the method is an ex vivo method, the agent may be administered to an angiogenesis model ex vivo. Suitable angiogenesis assays include assays for endothelial cell proliferation, migration and invasion, sponge assays and aortic ring assays. Further angiogenesis assays are described herein.
By "modulating angiogenesis" we include the meaning of reducing or enhancing the rate or level of angiogenesis. The enhancement can be a low level increase of about 10%, or about 20%, or about 30%, or about 40% of the rate or level of angiogenesis. The enhancement is a medium level increase of about 50%, or about 60%, or about 70%, or about 80% increase of the rate or level of angiogenesis. The reduction can be a low level reduction of about 10%, or about 20%, or about 30%, or about 40% of the rate or level of angiogenesis. Preferably, the reduction is a medium level reduction of about 50%, or about 60%, or about 70%, or about 80% reduction of the rate or level of angiogenesis. More preferably, the reduction is a high level reduction of about 90%, or about 95%, or about 99%, or about 99.9% of the rate or level of angiogenesis. Most preferably, inhibition can also include the elimination of angiogenesis or its reduction to an undetectable level. Methods and assays for determining the rate or level of angiogenesis, and hence for determining whether and to what extent an agent modulates angiogenesis, are known in the art and are described in further detail herein, including in the Examples.
Typically, the angiogenesis that is inhibited is tumour angiogenesis. Thus, the individual may have a solid tumour, which can be treated by inhibiting tumour angiogenesis, ie the solid tumour is associated with new blood vessel production. The term "tumour" is to be understood as referring to all forms of neoplastic cell growth including, but not limited to, tumours of the breast, ovary, liver, bladder, prostate, kidney, pancreas, stomach, oesophagus, lung and thyroid. Particularly, angiogenesis of a lung or pancreatic tumour may be inhibited.
Typically, the tumour is associated with undesirable neovasculature formation and the agent reduces this to a useful extent. The reduction of undesirable neovasculature formation may halt the progression of the tumour and can lead to a clinically useful reduction of tumour size and growth, e.g. a reduction in tumour size or growth rate of at least 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80 or 90%. Thus, the inhibition of tumour angiogenesis can be used to treat the tumour, for example, to prevent the (further) growth of the tumour, to prevent the spread of the tumour (metastasis), or to reduce the size of the tumour. The size of a tumour can be measured by imaging the tumour e.g. using an appropriate antibody specific for the tumour being targeted. Methods of tumour imaging
are well known in the art. The growth rate of a tumour can be determined by measuring tumour size over a time period (e.g. before and after treatment, to determine whether treatment results in a reduction in the growth rate). Preferably, the methods and medicaments of the invention are used to treat humans, in which case the agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), the MMRN2 portion, or the CD248 portion is a portion of human MMRN2 or CD248. It is appreciated, however, that when the methods and medicaments of the invention are for treatment of non-human mammals, it is preferred if the portion of MMRN2 or portion of CD248 is one that is a portion of MMRN2 or portion of CD248 from the other species. It is preferred if the agent is one that modulates the interaction between human MMRN2 and human CD248, when used to treat a human, and so on. Inhibition of angiogenesis may be useful in combating any disease or condition involving unwanted, undesirable or inappropriate angiogenesis. Such conditions include tumours/cancer, psoriasis, menorrhagia, endometriosis, arthritis (both inflammatory and rheumatoid), macular degeneration, Paget's disease, retinopathy and its vascular complications (including proliferative and of prematurity, and diabetic retinopathy), benign vascular proliferations, fibroses, obesity and inflammation.
Hence, an eighteenth aspect of the invention provides a method of combating a disease or condition in an individual, selected from the group consisting of cancer, psoriasis, menorrhagia, endometriosis, arthritis (both inflammatory and rheumatoid), macular degeneration, Paget's disease, retinopathy and its vascular complications (including proliferative and of prematurity, and diabetic retinopathy), benign vascular proliferations, fibroses, obesity and inflammation, the method comprising administering to the individual an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MMRN2 portion according to the second aspect of the invention, a CD248 portion according to the third aspect of the invention, a fusion protein according to the fourth aspect of the invention, an antibody according to the fifth or sixth aspects of the invention, a polynucleotide according to any of fourth, seventh, ninth, eleventh and thirteenth aspects of the invention, a vector according to the fourteenth aspect of the invention, a cell according to the fifteenth aspect of the invention, a compound according to the eighth or tenth aspects of the invention, a CAR according to the twelfth aspect of the invention.
This aspect of the invention includes an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MMRN2 portion according to the second aspect of the invention, a CD248 portion according to the third aspect of the invention, a fusion protein according to the fourth aspect of the invention, an antibody according to the fifth or sixth aspects of the invention, a polynucleotide according to any of fourth, seventh, ninth, eleventh and thirteenth aspects of the invention, a vector according to the fourteenth aspect of the invention, a cell according to the fifteenth aspect of the invention, a compound according to the eighth or tenth aspects of the invention, a CAR according to the twelfth aspect of the invention, for use in combating a disease or condition in an individual, selected from the group consisting of cancer, psoriasis, menorrhagia, endometriosis, arthritis (both inflammatory and rheumatoid), macular degeneration, Paget's disease, retinopathy and its vascular complications (including proliferative and of prematurity, and diabetic retinopathy), benign vascular proliferations, fibroses, obesity and inflammation.
The aspect of the invention also includes the use of an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MMRN2 portion according to the second aspect of the invention, a CD248 portion according to the third aspect of the invention, a fusion protein according to the fourth aspect of the invention, an antibody according to the fifth or sixth aspects of the invention, a polynucleotide according to any of fourth, seventh, ninth, eleventh and thirteenth aspects of the invention, a vector according to the fourteenth aspect of the invention, a cell according to the fifteenth aspect of the invention, a compound according to the eighth or tenth aspects of the invention, a CAR according to the twelfth aspect of the invention, in the preparation of a medicament for combating a disease or condition in an individual, selected from the group consisting of cancer, psoriasis, menorrhagia, endometriosis, arthritis (both inflammatory and rheumatoid), macular degeneration, Paget's disease, retinopathy and its vascular complications (including proliferative and of prematurity, and diabetic retinopathy), benign vascular proliferations, fibroses, obesity and inflammation.
It will be appreciated that in the eighteenth aspect of the invention, the agent, portion of MMRN2, or portion of CD248 are ones that inhibit the interaction between MMRN2 and CD248, and that angiogenesis is inhibited. Preferences for the agent, MMRN2 portion, CD248 portion, fusion protein, antibody, polynucleotide, vector, cell, compound, and CAR in all medical use aspects of the invention include those described above in relation to the relevant aspect of the invention. The
MMRN2 portion may comprise the region corresponding to amino acids 133-486 of human MMRN2. The CD248 portion may comprise the CTLD, corresponding to residues 30-156 of human CD248. Similarly, the antibody may be an antibody that selectively binds such portions of MMRN2 or CD248.
By "combating" we include the meaning that the method can be used to alleviate symptoms of the disorder (ie the method is used palliatively), or to treat the disorder, or to prevent the disorder (ie the method is used prophylactically). Thus, the invention provides a method of treating an individual who has a disease in which angiogenesis contributes to pathology, the method comprising the step of administering to the individual an agent of the invention (eg an agent, a portion of MMRN2, a portion of CD248, a fusion protein, an antibody that selectively binds to the MMRN2 portion, an antibody that selectively binds to the CD248 portion, or a CAR according to the invention).
In any of the methods or uses of the invention described in this document herein, the individual is preferably a human. However, it will also be understood that the individual can be non-human, such as any non-human mammal, for example a horse, dog, pig, cow, sheep, rat, mouse, guinea pig or a primate.
Typically, in any of the methods or uses of the invention described in this document herein, the individual has a solid tumour, such as a tumour of the colon, rectum, ovary, liver, bladder, prostate, breast, kidney, pancreas, stomach, oesophagus, lung or thyroid. Combination therapy
According to a National Cancer Institute Press Release dated 14 April 2005, updated 16 June 2005, ("Bevacizumab Combined With Chemotherapy Improves Progression-Free Survival for Patients With Advanced Breast Cancer"), the angiogenesis inhibitor anti- VE.G.F monoclonal antibody bevacizumab improves the clinical outcome for a number of solid tumours when administered in combination with standard chemotherapy. Combinations that have been used include bevacizumab in combination with irinotecan, fluorouracil, and leucovorin; bevacizumab in combination with FOLFOX4 (a regimen of oxaliplatin, 5-fluorouracil and leucovorin); bevacizumab in combination with paclitaxel; and bevacizumab in combination with paclitaxel and carboplatin.
It is therefore appreciated that although the agents of the invention described above may be clinically effective in the absence of any other therapeutic agent (e.g. anti-cancer compound and/or anti-angiogenesis compound), it may be advantageous to administer these agents in conjunction with a further therapeutic agent (e.g. anticancer agent and/or anti-angiogenesis compound).
Accordingly, the invention includes a composition comprising an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MMRN2 portion according to the second aspect of the invention, a CD248 portion according to the third aspect of the invention, a fusion protein according to the fourth aspect of the invention, an antibody according to the fifth or sixth aspects of the invention, a polynucleotide according to any of fourth, seventh, ninth, eleventh and thirteenth aspects of the invention, a vector according to the fourteenth aspect of the invention, a cell according to the fifteenth aspect of the invention, a compound according to the eighth or tenth aspects of the invention, or a CAR according to the twelfth aspect of the invention, which composition further comprises at least one additional anti-cancer agent and/or at least one additional anti-angiogenic agent. It will be appreciated that the composition may be a pharmaceutical composition that also comprises a pharmaceutically acceptable diluent, carrier or excipient.
In an embodiment of the medical methods of the invention (e.g. method of modulating angiogenesis and method of combating a disease or condition involving unwanted, undesirable or inappropriate angiogenesis), the method may also comprise administering to the individual at least one further therapeutic agent (e.g. anticancer agent and/or ant- angiogenesis compound). The method may comprise administering to the individual a pharmaceutical composition containing the agent of the invention (e.g. agent, MMRN2 portion, CD248 portion, antibody or CAR), and the further therapeutic agent (e.g. anticancer agent and/or anti-angiogenesis compound). However, it is appreciated that the agent of the invention (e.g. agent, MMRN2 portion, CD248 portion, antibody or CAR) and further therapeutic agent (e.g. anticancer agent and/or anti-angiogenesis compound) may be administered separately, for instance by separate routes of administration. Thus, it is appreciated that the agent and the at least one further therapeutic agent can be administered sequentially or (substantially) simultaneously. They may be administered within the same pharmaceutical formulation or medicament or they may be formulated and administered separately.
In an embodiment of the medical uses of the invention, the medicament containing the agent of the invention may also comprise at least one further therapeutic agent (e.g. anticancer agent and/or anti-angiogenesis compound). In another embodiment of the medical uses, the individual to be treated may be one who is administered at least one further therapeutic agent (e.g. anticancer agent and/or anti- angiogenesis compound). It is appreciated that the individual may be administered the further therapeutic agent (e.g. anticancer agent and/or anti-angiogenesis compound) at the same time as the medicament containing the agent of the invention, although the individual may have been (or will be) administered the further therapeutic agent (e.g. anticancer agent and/or anti-angiogenesis compound) before (or after) receiving the medicament containing the agent of the invention.
It will also be appreciated that the invention also provides a method of treatment, wherein a further therapeutic agent (e.g. anticancer agent and/or anti-angiogenesis compound) is administered to an individual in need thereof, wherein the individual is one who is administered an agent of the invention. The administration of the further therapeutic agent and agent of the invention may occur at the same time, although the individual may have been (or will be) administered the agent of the invention before (or after) receiving the medicament containing the further therapeutic agent (e.g. anticancer agent and/or anti- angiogenesis compound).
Preferably, the further therapeutic agent is an anti-cancer agent. The further anticancer agent may be selected from alkylating agents including nitrogen mustards such as mechlorethamine (HN2), cyclophosphamide, ifosfamide, melphalan (L-sarcolysin) and chlorambucil; ethylenimines and methylmelamines such as hexamethylmelamine, thiotepa; alkyl sulphonates such as busulphan; nitrosoureas such as carmustine (BCNU), lomustine (CCNU), semustine (methyl-CCNU) and streptozocin (streptozotocin); and triazenes such as decarbazine (DTIC; dimethyltriazenoimidazole-carboxamide); antimetabolites including folic acid analogues such as methotrexate (amethopterin); pyrimidine analogues such as fluorouracil (5-fluorouracil; 5-FU), floxuridine (fluorodeoxyuridine; FUdR) and cytarabine (cytosine arabinoside); and purine analogues and related inhibitors such as mercaptopurine (6-mercaptopurine; 6-MP), thioguanine (6-thioguanine; TG) and pentostatin (2 - deoxycoformycin); natural products including vinca alkaloids such as vinblastine (VLB) and vincristine; epipodophyllotoxins such as etoposide and teniposide; antibiotics such as dactinomycin (actinomycin D), daunorubicin (daunomycin; rubidomycin), doxorubicin, bleomycin, plicamycin (mithramycin) and mitomycin (mitomycin C); enzymes such as L-
asparaginase; and biological response modifiers such as interferon alphenomes; miscellaneous agents including platinum coordination complexes such as cisplatin (c/'s-DDP) and carboplatin; anthracenedione such as mitoxantrone and anthracydine; substituted urea such as hydroxyurea; methyl hydrazine derivative such as procarbazine (N-methylhydrazine, MIH); and adrenocortical suppressant such as mitotane (o,p'-DDD) and aminoglutethimide; taxol and analogues/derivatives; cell cycle inhibitors; proteosome inhibitors such as Bortezomib (Velcade®); signal transductase (e.g. tyrosine kinase) inhibitors such as Imatinib (Glivec®), COX-2 inhibitors, and hormone agonists/antagonists such as flutamide and tamoxifen. Particularly, tirapazamine may be utilised.
The clinically used anticancer agents are typically grouped by mechanism of action: Alkylating agents, Topoisomerase I inhibitors, Topoisomerase II inhibitors, RNA/DNA antimetabolites, DNA antimetabolites and Antimitotic agents. The US NIH/National Cancer Institute website lists 122 compounds (http://dtp.nci.nih.gov/docs/cancer/ searches/standard_mechanism.html), all of which may be used in conjunction with an inhibitor of CLEC14A. They include Alkylating agents including Asaley, AZQ, BCNU, Busulfan, carboxyphthalatoplatinum, CBDCA, CCNU, CHIP, chlorambucil, chlorozotocin, c/'s-platinum, clomesone, cyanomorpholino-doxorubicin, cyclodisone, dianhydrogalactitol, fluorodopan, hepsulfam, hycanthone, melphalan, methyl CCNU, mitomycin C, mitozolamide, nitrogen mustard, PCNU, piperazine, piperazinedione, pipobroman, porfiromycin, spirohydantoin mustard, teroxirone, tetraplatin, picoplatin (SP-4-3) (cis- aminedichloro(2-methylpyridine)Pt(ll)), thio-tepa, triethylenemelamine, uracil nitrogen mustard, Yoshi-864; anitmitotic agents including allocolchicine, Halichondrin B, colchicine, colchicine derivative, dolastatin 10, maytansine, rhizoxin, taxol, taxol derivative, thiocolchicine, trityl cysteine, vinblastine sulphate, vincristine sulphate; Topoisomerase I Inhibitors including camptothecin, camptothecin, Na salt, aminocamptothecin, 20 camptothecin derivatives, morpholinodoxorubicin; Topoisomerase II Inhibitors including doxorubicin, amonafide, m-AMSA, anthrapyrazole derivative, pyrazoloacridine, bisantrene HCL, daunorubicin, deoxydoxorubicin, mitoxantrone, menogaril, N,N-dibenzyl daunomycin, oxanthrazole, rubidazone, VM-26, VP-16; RNA/DNA antimetabolites including L-alanosine, 5-azacytidine, 5-fluorouracil, acivicin, 3 aminopterin derivatives, an antifol, Baker's soluble antifol, dichlorallyl lawsone, brequinar, ftorafur (pro-drug), 5,6- dihydro-5-azacytidine, methotrexate, methotrexate derivative, N-(phosphonoacetyl)-L- aspartate (PALA), pyrazofurin, trimetrexate; DNA antimetabolites including, 3-HP, 2'- deoxy-5-fluorouridine, 5-HP, alpha-TGDR, aphidicolin glycinate, ara-C, 5-aza-2'- deoxycytidine, beta-TGDR, cyclocytidine, guanazole, hydroxyurea, inosine glycodialdehyde, macbecin II, pyrazoloimidazole, thioguanine and thiopurine.
It is, however, preferred that the at least one further anticancer agent is selected from cisplatin; carboplatin; picoplatin; 5-fluro uracil; paclitaxel; mitomycin C; doxorubicin; gemcitabine; tomudex; pemetrexed; methotrexate; irinotecan, fluorouracil and leucovorin; oxaliplatin, 5-fluorouracil and leucovorin; and paclitaxel and carboplatin.
When the further anticancer agent has been shown to be particularly effective for a specific tumour type, it may be preferred that the agent of the invention is used in combination with that further anticancer agent to treat that specific tumour type.
Preferred anti-angiogenesis compounds include bevacizumab (Avastin®); itraconazole; carboxyamidotriazole; TNP-470 (an analog of fumagillin); CM101 ; IFN-a; IL-12; platelet factor-4; suramin; SU5416; thrombospondin; VE.G.FR antagonists; angiostatic steroids + heparin; Cartilage-Derived Angiogenesis Inhibitory Factor; matrix metalloproteinase inhibitors; angiostatin; endostatin; 2-methoxyestradiol; tecogalan; tetrathiomolybdate; thalidomide; prolactin; α\/β3 inhibitors; linomide; tasquinimod; ranibizumab; sorafenib; (Nexavar®); sunitinib (Sutent®); pazopanib (Votrient®); and everolimus (Afinitor®).
The invention also provides a kit of parts comprising: (i) an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MMRN2 portion according to the second aspect of the invention, a CD248 portion according to the third aspect of the invention, a fusion protein according to the fourth aspect of the invention, an antibody according to the fifth or sixth aspects of the invention, a polynucleotide according to any of fourth, seventh, ninth, eleventh and thirteenth aspects of the invention, a vector according to the fourteenth aspect of the invention, a cell according to the fifteenth aspect of the invention, a compound according to the eighth or tenth aspects of the invention, or a CAR according to the twelfth aspect of the invention; and (ii) at least one additional anti-cancer agent and/or at least one additional anti-angiogenic agent. Formulations and routes of administration
A nineteenth aspect of the invention provides a pharmaceutical composition comprising an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MMRN2 portion according to the second aspect of the invention, a CD248 portion according to the third aspect of the invention, a fusion protein according to the fourth aspect of the invention, an antibody according to the fifth or sixth aspects of the invention, a polynucleotide according to any of fourth, seventh, ninth, eleventh and
thirteenth aspects of the invention, a vector according to the fourteenth aspect of the invention, a cell according to the fifteenth aspect of the invention, a compound according to the eighth or tenth aspects of the invention, or a CAR according to the twelfth aspect of the invention; and a pharmaceutically acceptable diluent, carrier or excipient.
By "pharmaceutically acceptable" is included that the formulation is sterile and pyrogen free. Suitable pharmaceutical carriers, diluents and excipients are well known in the art of pharmacy. The carrier(s) must be "acceptable" in the sense of being compatible with the inhibitor and not deleterious to the recipients thereof. Typically, the carriers will be water or saline which will be sterile and pyrogen free; however, other acceptable carriers may be used.
In an embodiment, the pharmaceutical compositions or formulations of the invention are for parenteral administration, more particularly for intravenous administration. In a preferred embodiment, the pharmaceutical composition is suitable for intravenous administration to a patient, for example by injection.
Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents.
In an alternative preferred embodiment, the pharmaceutical composition is suitable for topical administration to a patient.
Preferably, the formulation is a unit dosage containing a daily dose or unit, daily sub-dose or an appropriate fraction thereof, of the active ingredient.
The agent or active ingredient may be administered orally or by any parenteral route, in the form of a pharmaceutical formulation comprising the active ingredient, optionally in the form of a non-toxic organic, or inorganic, acid, or base, addition salt, in a pharmaceutically acceptable dosage form. Depending upon the disorder and patient to be treated, as well as the route of administration, the compositions may be administered at varying doses. In human therapy, the agent or active ingredient will generally be administered in admixture with a suitable pharmaceutical excipient, diluent or carrier selected with regard to the intended route of administration and standard pharmaceutical practice.
For example, the agent or active ingredient may be administered orally, buccally or sublingually in the form of tablets, capsules, ovules, elixirs, solutions or suspensions, which may contain flavouring or colouring agents, for immediate-, delayed- or controlled-release applications. The active ingredient may also be administered via intracavernosal injection.
Suitable tablets may contain excipients such as microcrystalline cellulose, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate and glycine, disintegrants such as starch (preferably corn, potato or tapioca starch), sodium starch glycolate, croscarmellose sodium and certain complex silicates, and granulation binders such as polyvinylpyrrolidone, hydroxypropylmethylcellulose (HPMC), hydroxy-propylcellulose (HPC), sucrose, gelatin and acacia. Additionally, lubricating agents such as magnesium stearate, stearic acid, glyceryl behenate and talc may be included. Solid compositions of a similar type may also be employed as fillers in gelatin capsules. Preferred excipients in this regard include lactose, starch, a cellulose, milk sugar or high molecular weight polyethylene glycols. For aqueous suspensions and/or elixirs, the compounds of the invention may be combined with various sweetening or flavouring agents, colouring matter or dyes, with emulsifying and/or suspending agents and with diluents such as water, ethanol, propylene glycol and glycerin, and combinations thereof.
The agent or active ingredient can also be administered parenterally, for example, intravenously, intra-arterially, intraperitoneally, intrathecal^, intraventricularly, intrasternally, intracranially, intra-muscularly or subcutaneously, or they may be administered by infusion techniques. They are best used in the form of a sterile aqueous solution which may contain other substances, for example, enough salts or glucose to make the solution isotonic with blood. The aqueous solutions should be suitably buffered (preferably to a pH of from 3 to 9), if necessary. The preparation of suitable parenteral formulations under sterile conditions is readily accomplished by standard pharmaceutical techniques well-known to those skilled in the art.
The formulations may be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophilised) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kind previously described.
For oral and parenteral administration to human patients, the daily dosage level of an agent, antibody or compound will usually be from 1 to 1 ,000 mg per adult (i.e. from about 0.015 to 15 mg/kg), administered in single or divided doses. Thus, for example, the tablets or capsules of the agent or active ingredient may contain from 1 mg to 1 ,000 mg of agent or active agent for administration singly or two or more at a time, as appropriate. The physician in any event will determine the actual dosage which will be most suitable for any individual patient and it will vary with the age, weight and response of the particular patient. The above dosages are exemplary of the average case. There can, of course, be individual instances where higher or lower dosage ranges are merited and such are within the scope of this invention.
The agent or active ingredient can also be administered intranasally or by inhalation and are conveniently delivered in the form of a dry powder inhaler or an aerosol spray presentation from a pressurised container, pump, spray or nebuliser with the use of a suitable propellant, e.g. dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoro-ethane, a hydrofluoroalkane such as 1 , 1 , 1 ,2-tetrafluoroethane (HFA 134A3 or 1 , 1 , 1 ,2,3,3,3-heptafluoropropane (HFA 227EA3), carbon dioxide or other suitable gas. In the case of a pressurised aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. The pressurised container, pump, spray or nebuliser may contain a solution or suspension of the active compound, e.g. using a mixture of ethanol and the propellant as the solvent, which may additionally contain a lubricant, e.g. sorbitan trioleate. Capsules and cartridges (made, for example, from gelatin) for use in an inhaler or insufflator may be formulated to contain a powder mix of an active ingredient and a suitable powder base such as lactose or starch. Such formulations may be particularly useful for treating solid tumours of the lung, such as, for example, small cell lung carcinoma, non-small cell lung carcinoma, pleuropulmonary blastoma or carcinoid tumour. Aerosol or dry powder formulations are preferably arranged so that each metered dose or "puff" contains at least 1 mg of the inhibitor for delivery to the patient. It will be appreciated that the overall daily dose with an aerosol will vary from patient to patient, and may be administered in a single dose or, more usually, in divided doses throughout the day. Alternatively, the agent or active ingredient can be administered in the form of a suppository or pessary, particularly for treating or targeting colon, rectal or prostate tumours.
The agent or active ingredient may also be administered by the ocular route. For ophthalmic use, the inhibitor can be formulated as, e.g., micronised suspensions in isotonic, pH adjusted, sterile saline, or, preferably, as solutions in isotonic, pH adjusted, sterile saline, optionally in combination with a preservative such as a benzylalkonium chloride. Alternatively, they may be formulated in an ointment such as petrolatum. Such formulations may be particularly useful for treating solid tumours of the eye, such as retinoblastoma, medulloepithelioma, uveal melanoma, rhabdomyosarcoma, intraocular lymphoma, or orbital lymphoma. The agent or active ingredient may be applied topically in the form of a lotion, solution, cream, ointment or dusting powder, or may be transdermal^ administered, for example, by the use of a skin patch. For application topically to the skin, the active ingredient can be formulated as a suitable ointment containing the active compound suspended or dissolved in, for example, a mixture with one or more of the following: mineral oil, liquid petrolatum, white petrolatum, propylene glycol, polyoxyethylene polyoxypropylene compound, emulsifying wax and water. Alternatively, they can be formulated as a suitable lotion or cream, suspended or dissolved in, for example, a mixture of one or more of the following: mineral oil, sorbitan monostearate, a polyethylene glycol, liquid paraffin, polysorbate 60, cetyl esters wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol and water. Such formulations may be particularly useful for treating solid tumours of the skin, such as, for example, basal cell cancer, squamous cell cancer or melanoma.
For skin cancers, the agent or active ingredient can also be delivered by electroincorporation (El). El occurs when small particles of up to 30 microns in diameter on the surface of the skin experience electrical pulses identical or similar to those used in electroporation. In El, these particles are driven through the stratum corneum and into deeper layers of the skin. The particles can be loaded or coated with inhibitor or can simply act as "bullets" that generate pores in the skin through which the active ingredient can enter.
Formulations suitable for topical administration in the mouth include lozenges comprising the active ingredient in a flavoured basis, usually sucrose and acacia or tragacanth; pastilles comprising the agent or active ingredient in an inert basis such as gelatin and glycerin, or sucrose and acacia; and mouth-washes comprising the active ingredient in a suitable liquid carrier. Such formulations may be particularly useful for treating solid tumours of the mouth and throat.
In an embodiment, the agent or active ingredient may be delivered using an injectable sustained-release drug delivery system. These are designed specifically to reduce the frequency of injections. An example of such a system is Nutropin Depot which encapsulates recombinant human growth hormone (rhGH) in biodegradable microspheres that, once injected, release rhGH slowly over a sustained period.
The agent or active ingredient can be administered by a surgically implanted device that releases the drug directly to the required site, for example, into the eye to treat ocular tumours. Such direct application to the site of disease achieves effective therapy without significant systemic side-effects.
An alternative method for delivery of agents or active ingredients is the Regel injectable system that is thermo-sensitive. Below body temperature, Regel is an injectable liquid while at body temperature it immediately forms a gel reservoir that slowly erodes and dissolves into known, safe, biodegradable polymers. The active drug is delivered over time as the biopolymers dissolve.
Polypeptide pharmaceuticals can also be delivered orally. The process employs a natural process for oral uptake of vitamin B12 in the body to co-deliver proteins and peptides. By riding the vitamin B12 uptake system, the protein or peptide can move through the intestinal wall. Complexes are synthesised between vitamin B12 analogues and the drug that retain both significant affinity for intrinsic factor (IF) in the vitamin B12 portion of the complex and significant bioactivity of the drug portion of the complex. Polynucleotides may be administered as a suitable genetic construct as described below and delivered to the patient where it is expressed. Typically, the polynucleotide in the genetic construct is operatively linked to a promoter which can express the compound in the cell. The genetic constructs of the invention can be prepared using methods well known in the art, for example in Sambrook et al (2001).
Although genetic constructs for delivery of polynucleotides can be DNA or RNA, it is preferred if they are DNA.
Preferably, the genetic construct is adapted for delivery to a human cell. Means and methods of introducing a genetic construct into a cell are known in the art, and include the use of immunoliposomes, liposomes, viral vectors (including vaccinia, modified vaccinia, lentivurus, parvovirus, retroviruses, adenovirus and adeno-associated viral (AAV) vectors),
and by direct delivery of DNA, e.g. using a gene-gun and electroporation. Furthermore, methods of delivering polynucleotides to a target tissue of a patient for treatment are also well known in the art. In an alternative method, a high-efficiency nucleic acid delivery system that uses receptor-mediated endocytosis to carry DNA macromolecules into cells is employed. This is accomplished by conjugating the iron-transport protein transferrin to polycations that bind nucleic acids. High-efficiency receptor-mediated delivery of the DNA constructs or other genetic constructs of the invention using the endosome-disruption activity of defective or chemically inactivated adenovirus particles produced by the methods of Cotten et al (1992) Proc. Natl. Acad. Sci. USA 89, 6094-6098 may also be used. It will be appreciated that "naked DNA" and DNA complexed with cationic and neutral lipids may also be useful in introducing the DNA of the invention into cells of the individual to be treated. Non-viral approaches to gene therapy are described in Ledley (1995, Human Gene Therapy 6, 1 129-1144). Although for cancer/tumours of specific tissues it may be useful to use tissue-specific promoters in the vectors encoding a polynucleotide inhibitor, this is not essential, as the risk of expression of the active ingredient in the body at locations other than the cancer/tumour would be expected to be tolerable in compared to the therapeutic benefit to a patient suffering from a cancer/tumour. It may be desirable to be able to temporally regulate expression of the polynucleotide inhibitor in the cell, although this is also not essential.
The agents or active ingredients of the invention (i.e. an agent that inhibits the interaction between MMRN2 and CD248, portion of MMRN2, portion of CD248, antibody that selectively binds to a portion of MMRN2, antibody that selectively binds to a portion of CD248, fusion protein, CAR, compounds of invention and polynucleotides and vectors) may be lyophilised for storage and reconstituted in a suitable carrier prior to use. Any suitable lyophilisation method (e.g. spray drying, cake drying) and/or reconstitution techniques can be employed. It will be appreciated by those skilled in the art that lyophilisation and reconstitution can lead to varying degrees of protein activity loss and that use levels may have to be adjusted upward to compensate. In one embodiment, the lyophilised (freeze dried) active ingredient loses no more than about 20%, or no more than about 25%, or no more than about 30%, or no more than about 35%, or no more than about 40%, or no more than about 45%, or no more than about 50% of its activity (prior to lyophilisation) when re-hydrated.
Targeted delivery of cytotoxic moieties
A twentieth aspect of the invention provides a method of targeting a cytotoxic moiety to neovasculature in the body of an individual, the method comprising:
administering to the individual a compound comprising a compound according to the tenth aspect of the invention (i.e. (i) an agent according to the first aspect of invention, a MMRN2 portion according to the second aspect of the invention, or a CD248 portion according to the third aspect of the invention and (ii) a cytotoxic moiety). This aspect of the invention includes a compound according to the tenth aspect of the invention for use in targeting a cytotoxic moiety to neovasculature in the body of an individual. This aspect of the invention further includes the use of a compound according to the tenth aspect of the invention in the preparation of a medicament for targeting a cytotoxic moiety to neovasculature in the body of an individual.
It is appreciated that targeting a cytotoxic agent to neovasculature will act to inhibit angiogenesis. Hence, this aspect of the invention includes a method of inhibiting angiogenesis in an individual, the method comprising: administering to the individual a compound according to the tenth aspect of the invention. Preferably, the neovasculature is tumour neovasculature and the angiogenesis is tumour angiogenesis.
This aspect of the invention also includes a compound according to the tenth aspect of the invention for use in inhibiting angiogenesis in an individual. This aspect of the invention also includes the use of a compound according to the tenth aspect of the invention in the preparation of a medicament for inhibiting angiogenesis in an individual.
Typically, the individual in the twentieth aspect of the invention has a solid tumour, preferably such as those described above in relation to the sixteenth, seventeenth and eighteenth aspects of the invention.
It is appreciated that although targeting a cytotoxic moiety to tumour neovasculature to inhibit tumour neoangiogenesis may be clinically effective in the absence of any other anticancer compound, it may nevertheless be advantageous to administer the compounds in conjunction with a further anticancer agent. Accordingly, in an embodiment, the method may comprise administering to the individual a further anticancer agent.
Preferences for the further anticancer agent to be administered include any of the cytotoxic agents described above. For example, the anticancer agent may be any one or more of cisplatin; carboplatin; 5-fluro uracil; paclitaxel; mitomycin C; doxorubicin; gemcitabine; tomudex; pemetrexed; methotrexate; irinotecan, fluorouracil and leucovorin; oxaliplatin, 5- fluorouracil and leucovorin; and paclitaxel and carboplatin.
The compound according to the tenth aspect of the invention and the further anticancer agent may be administered in the form of a pharmaceutical composition containing both of these components. However, it is appreciated that the compound and the further anticancer agent, may be administered separately, for instance by separate routes of administration. Thus it is appreciated that the compound and the at least one further anticancer agent can be administered sequentially or (substantially) simultaneously. They may be administered within the same pharmaceutical formulation or medicament or they may be formulated and administered separately.
Thus, the method may comprise administering the compound according to the tenth aspect of the invention to the individual wherein the individual is one who is administered a further anticancer agent. Similarly, the method may comprise administering a further anticancer to an individual wherein the individual is one who is administered the compound according to the tenth aspect of the invention.
The invention also provides a kit of parts comprising: (i) an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MMRN2 portion according to the second aspect of the invention, a CD248 portion according to the third aspect of the invention, a fusion protein according to the fourth aspect of the invention, an antibody according to the fifth or sixth aspects of the invention, a polynucleotide according to any of fourth, seventh, ninth, eleventh and thirteenth aspects of the invention, a vector according to the fourteenth aspect of the invention, a cell according to the fifteenth aspect of the invention, a compound according to the eighth or tenth aspects of the invention, or a CAR according to the twelfth aspect of the invention; and (ii) a cytotoxic moiety.
Imaging, detection and diagnosis A twenty-first aspect of the invention provides a method of imaging neovasculature in the body of an individual the method comprising:
administering to the individual a compound according to the eighth aspect of the invention (i.e. (i) an agent according to the first aspect of invention, a MMRN2 portion according to the second aspect of the invention, or a CD248 portion according to the third aspect of the invention, and (ii) a detectable moiety), and imaging the detectable moiety in the body.
Typically, the individual has a solid tumour, preferably such as those described above, and the neovasculature of the tumour is imaged. Thus, the localisation of the portion of MMRN2 at a particular organ in the body indicates that the individual may have or may be developing a solid tumour at that organ. This method may be useful, for example, in determining the size of a previously diagnosed solid tumour, determining the effectiveness of a therapy against the solid tumour, or determining the extent of metastasis of the tumour. Methods for imaging the detectable moiety in the body are well known in the art, and include PET (positron emission tomography).
Accordingly, this aspect of the invention provides a method of detecting, diagnosing and prognosing a solid tumour in an individual, the method comprising: administering to the individual a compound according to the eighth aspect of the invention, and detecting the presence and/or location of the detectable moiety in the body.
In an embodiment, the method further comprises the step of detecting the location of the compound in the individual.
Preferences for the detectable moiety include those mentioned above, such as any of iodine-123, iodine-131 , indium-1 11 , fluorine-19, carbon-13, nitrogen-15, oxygen-17, technetium-99m, gadolinium, manganese or iron.
Preferably, the individual is a human. Preferably, the individual has a solid tumour such as any of those described above.
The invention also provides a kit of parts comprising (i) an agent according to the first aspect of the invention (which itself may be a portion of MMRN2 or CD248), a MMRN2 portion according to the second aspect of the invention, a CD248 portion according to the third aspect of the invention, a fusion protein according to the fourth aspect of the invention, an antibody according to the fifth or sixth aspects of the invention, a polynucleotide according to any of fourth, seventh, ninth, eleventh and thirteenth aspects of the invention,
a vector according to the fourteenth aspect of the invention, a cell according to the fifteenth aspect of the invention, a compound according to the eighth or tenth aspects of the invention, or a CAR according to the twelfth aspect of the invention; and (ii) a detectable moiety.
Further products
The inventors have characterised new molecular interactions between MMRN2 and CD248, and so it will be appreciated that complexes between the portion of MMRN2, or portion of CD248 of the invention will have utility in further elucidating the role of these molecules in angiogenesis.
Accordingly, a twenty-second aspect of the invention provides a complex comprising: (i) MMRN2 or a portion or variant thereof, said portion or variant being capable of binding to CD248; and (ii) CD248 or a portion or variant thereof, said portion or variant being capable of binding to MMRN2.
In one embodiment, the complex further comprises CLEC14A or a portion or variant thereof, or CD93 or a portion or variant thereof, said portions or variants being capable of binding to MMRN2.
As described in Example 1 , the inventors have conducted various experiments to investigate the interaction between MMRN2 and CD248 and CLEC14A. Specifically, they have shown that CLEC14A and CD248 can bind MMRN2 simultaneously and this occurs at the interface between endothelium and pericytes in human pancreatic cancer.
Similarly, a twenty-third aspect of the invention provides a kit of parts comprising: (i) a MMRN2 portion said portion or variant being capable of binding to CD248; and (ii) CD248 or a portion or variant thereof, said portion or variant being capable of binding to MMRN2.
Optionally, the kit may further comprise a test agent. The test agent may be a candidate modulator of the interaction between MMRN2 and CD248. Thus, the kit could be used in a screening method for identifying modulators of an interaction between CD248 and MMRN2. Therefore, the test agent could be such a candidate modulator. Such a method is described in more detail below.
In one embodiment, the kit further comprises CLEC14A or a portion or variant thereof, and/or CD93 or a portion or variant thereof, said portions or variants being capable of binding to MMRN2. Likewise, a twenty-fourth aspect of the invention provides a nucleic acid molecule capable of encoding: (i) MMRN2 or a portion or variant thereof, said portion or variant being capable of binding to CD248; and (ii) CD248 or a portion or variant thereof, said portion or variant being capable of binding to MMRN2. It will be appreciated that a single nucleic acid molecule may be capable of encoding both (i) and (ii), or that two nucleic acid molecules may be capable of respectively encoding (i) and (ii).
In one embodiment, the nucleic acid molecule is capable of further encoding CLEC14A or a portion or variant thereof, and/or CD93 or a portion or variant thereof, said portions or variants being capable of binding to MMRN2. It will be appreciated that a single nucleic acid molecule may be capable of encoding both (i) and (ii) and CLEC14A, and/or CD93, or that two, three, or four nucleic acid molecules may be capable of respectively encoding (i), (ii), CLEC14A, and/or CD93.
Preferences for the MMRN2 portion and for the CD248 portion include those described above in relation to the second and third aspects of the invention.
By a portion or variant of CLEC14A or CD93 being capable of binding to MMRN2, we include any portion or variant of CLEC14A or CD93 that is capable of binding to MMRN2. Assessing protein-protein interactions is standard practice in the art and any suitable method may be used, for example including those described herein.
Typically, the portion of CLEC14A or CD93 that is capable of binding to MMRN2 is at least 20 amino acid residues in length, and may be between 20 and 50 residues or between 50 and 100 residues or between 100 and 150 residues or between 150 and 200 residues in length, or more. In a particular embodiment, the portion of CLEC14A or CD93 that is capable of binding to MMRN2 is less than 400, 350, 300, 250, 150, 140, 130, 110, 100, 95, 90 or 85 amino acid residues in length.
It is preferred that the portion of CLEC14A that is capable of binding to MMRN2 is a portion of, or that the portion contains, the extracellular region of CLEC14A (residues 22-396), or that the portion is a portion of, or that the portion contains the C-type lectin like domain (residues 32-173), or that the portion is a portion of, or that the portion contains the long-
loop region of CLEC14A (residues E97-C143) or that the portion is a portion of, or that the portion contains, residues 97-108 of the C-type lectin like domain.
It is preferred that the portion of CD93 that is capable of binding to MMRN2 is a portion of, or that the portion contains, the extracellular region of CD93 (residues A22-K580), or that the portion is a portion of, or that the portion contains the C-type lectin like domain (residues A22-N174), or that the portion is a portion of, or that the portion contains the long-loop region of CLEC14A (residues Q98-C142) or that the portion is a portion of, or that the portion contains, residues 97-108 of the C-type lectin like domain.
By a variant of CLEC14A or CD93 that is capable of binding to MMRN2, we include variants of CLEC14A that have at least 60% sequence identity to human CLEC14A or human CD93, for example variants with at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to human CLEC14A or human CD93. It is preferred if the variant polypeptide has a consecutive region of at least 20 amino acid residues, more preferably at least 50 residues, of the sequence of the human CLEC14A polypeptide. Such variants may be made, for example, using the methods of recombinant DNA technology, protein engineering and site-directed mutagenesis which are well known in the art.
It will be appreciated that the portions of CLEC14A or CD93 described above may also be portions of CLEC14A or CD93 variants. Generally, the portions of CLEC14A or CD93 have at least 60% sequence identity to human CLEC14A or CD93 respectively, for example at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity over the length of the portion.
Conveniently, the complex of the twenty-second aspect of the invention is produced by expressing the portion of MMRN2, the portion of CD248, and optionally, either CLEC14A and/or CD93 (or portions or variants thereof) separately, and adding the proteins together after expression under conditions appropriate for complex formation. Alternatively, a cell may be engineered to overexpress the portion of MMRN2, the portion of CD248, and optionally either CLEC14A and/or CD93 (or portions or variants thereof) using standard molecular biology techniques, such that the complex can be recovered from the cell lysate. Preferably, the complex is soluble. Typically, the proteins are manufactured in E. coli and purified by tagging them with histidine tags and using nickel beads to isolate the recombinant proteins. Similarly, differently epitope tagged versions of the proteins can be expressed in and purified from cells.
It is appreciated that such complexes may be useful in the screening methods of the invention described below. Conveniently, either one or all parts of the complex are detectably labelled so that the presence of the complex in a sample or cell can readily be detected. Examples of labels include peptide labels, chemical labels, fluorescent labels or radio labels.
A twenty-fifth aspect of the invention provides a mutant MMRN2 polypeptide which has reduced or enhanced binding to CD248 relative to wild type MMRN2.
By "wild type" we include the meaning of the allele that encodes the phenotype most common in a particular natural population, for example, the naturally occurring sequence of a gene. For the avoidance of doubt, a naturally occurring protein cannot be considered a mutant in the context of the present invention eg a naturally occurring mouse MMRN2 cannot be considered a mutant of a human MMRN2, and so on.
By "reduced binding to CD248" we include the meaning that the mutant MMRN2 binds to CD248 with less affinity than wild type MMRN2 binds to CD248. Typically, the mutant MMRN2 binds to CD248 with at least 2, or at least 5, or at least 10, or at least 50 times less affinity than the wild type MMRN2 binds to CD248. Most preferably, binding between CD248 and the mutant MMRN2 is reduced to an undetectable level.
By "enhanced binding to CD248" we include the meaning that the mutant MMRN2 binds to CD248 with a higher affinity than wild type MMRN2 binds to CD248. Typically, the mutant MMRN2 binds to CD248 with at least 2, or at least 5, or at least 10, or at least 50 times more affinity than the wild type MMRN2 binds to CD248.
In an embodiment, the mutant MMRN2, when compared to the corresponding wild type MMRN2, comprises one or more different amino acids in the region of MMRN2 corresponding to the region spanning amino acid residues 133-486 of human MMRN2, for example at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 75 or 100 different amino acids, such as at least 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300 or 350 different amino acids. Also included are mutant MMRN2 polypeptides wherein the region corresponding to the region spanning amino acid residues 133-486 of human MMRN2, or part thereof, is deleted.
In another embodiment, the mutant MMRN2 is a portion of MMRN2 which comprises or consists of a region of MMRN2 corresponding to the region spanning amino acid residues 215-478, or 215-344, or 295-478, or 344-478, or 215-280 or 295-344 or 375-478 of human MMRN2, or a part thereof. Generally, the part thereof, is at least 10, 20, 30, 35, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140 or 150, consecutive amino acids in length.
It will be appreciated that the mutant MMRN2 is a mutant of a particular species of MMRN2 (eg human), and so, apart from the mutation that is causative for the reduction or enhancement in binding to CD248, the mutant MMRN2 and wild type MMRN2 will share the same characteristics (eg structural and functional characteristics) of MMRN2 of whichever species.
A twenty-sixth aspect of the invention provides a mutant CD248 polypeptide which has reduced or enhanced binding to MMRN2 relative to wild type CD248,
In one embodiment, the cysteine corresponding to cysteine-94 of human CD248 is mutated and/or the cysteine corresponding to cysteine-126 of human CD248 is mutated.
Preferably, the one or both cysteine residues are mutated to serine, although it is appreciated that any other amino acid may be used provided that binding to MMRN2 is still reduced compared to the wild type CD248.
By "reduced binding to MMRN2" we include the meaning that the mutant CD248 binds to MMRN2 with less affinity than wild type CD248 binds to MMRN2. Typically, the mutant CD248 binds to MMRN2 with at least 2, or at least 5, or at least 10, or at least 50 times less affinity than does the wild type CD248 binds to MMRN2. Most preferably, binding between MMRN2 and the mutant CD248 is reduced to an undetectable level.
By "enhanced binding to MMRN2" we include the meaning that the mutant CD248 binds to MMRN2 with a higher affinity than wild type CD248 binds to MMRN2. Typically, the mutant CD248 binds to MM RN2 with at least 2, or at least 5, or at least 10, or at least 50 times more affinity than the wild type CD248 binds to MMRN2.
It will be appreciated that the mutant CD248 is a mutant of a particular species of CD248 (eg human), and so, apart from the mutation that is causative for the reduction or enhancement in binding to MMRN2, the mutant CD248 and wild type CD248 will share the
same characteristics (eg structural and functional characteristics) of CD248 of whichever species.
By "mutation" we include insertions, deletions and substitutions, either conservative or 5 non-conservative. By "conservative substitutions" is intended combinations such as Gly, Ala; Val, lie, Leu; Asp, Glu; Asn, Gin; Ser, Thr; Lys, Arg; and Phe, Tyr.
The mutants of the twenty-fifth and twenty-sixth aspects of the invention may be produced in any suitable way and provided in any suitable form. For example, methods of proteini c) engineering or conventional site-directed mutagenesis may be employed, or polymerase chain reaction-based procedures well known in the art may be used. Typically, the proteins are manufactured in E. coli and purified by tagging them with histidine tags and using nickel beads to isolate the recombinant proteins. Conveniently, the proteins are detectably labelled. Examples of such labels are well known in the art and include peptide 15 labels, chemical labels, fluorescent labels, enzyme labels or radio labels.
For the avoidance of doubt, the invention does not include naturally occurring variants of the wild type MMRN2 polypeptide or the wild type CD248 polypeptide. The mutants are typically recombinantly produced.
20
The invention includes a nucleic acid molecule encoding any of the mutant polypeptides of the twenty-fifth and twenty-sixth aspects of the invention. The nucleic acid molecule may be incorporated into a vector such as an expression vector. Further details of what the nucleic acid and vector may be include those described above. It will also be 25 appreciated that the invention provides a cell comprising the nucleic acid molecule or vector.
Screening methods
30 A twenty-seventh aspect of the invention provides a method of identifying an agent that modulates the interaction between CD248 and MMRN2, the method comprising:
providing MMRN2 or a portion or variant thereof, said portion or variant being capable of binding to CD248;
providing CD248 or a portion of variant thereof, said portion or variant being 35 capable of biding to MM RN2;
providing a candidate agent; and
determining whether the candidate agent modulates binding of MMRN2 or the portion or variant thereof, to CD248, or the portion or variant thereof.
It will be appreciated that the invention includes a method of identifying an agent which modulates the interaction between CD248 and MMRN2, the method comprising determining whether a candidate agent modulates (eg reduces or enhances) the interaction between (i) MMRN2 or a portion or a variant thereof, said portion or variant thereof being capable of biding to CD248, and (ii) CD248 or a portion or variant thereof, said portion or variant thereof being capable of binding to MMRN2.
It will be appreciated that the agent may be useful in modulating angiogenesis, or in combating cancer, and so the method may be used to identify an agent that may be useful in modulating angiogenesis or in combating cancer. Also provided is a method of identifying an agent that may be useful in modulating angiogenesis or in combating cancer, or a lead compound for the identification of an agent that may be useful in modulating angiogenesis or in combating cancer, the method comprising:
providing MMRN2 or a portion or variant thereof, said portion or variant being capable of binding to CD248;
providing CD248 or a portion of variant thereof, said portion or variant being capable of biding to MM RN2;
providing a candidate agent; and
determining whether the candidate agent modulates binding of MMRN2 or the portion or variant thereof, to CD248, or the portion or variant thereof.
In one embodiment, the candidate agent itself may be a portion of MMRN2 or variant thereof. Thus, the invention provides a method of identifying a portion of MMRN2 or a variant thereof, which portion may be useful in modulating angiogenesis or in combating cancer, or a lead compound for the identification of an agent that may be useful in modulating angiogenesis or in combating cancer, the method comprising:
providing CD248 or a portion or variant thereof, said portion or variant being capable of binding to MMRN2;
providing MMRN2 or a portion or variant thereof, said portion or variant being capable of binding to CD248;
providing a candidate portion of MMRN2 or a variant thereof; and
determining whether the candidate portion modulates binding of CD248 or the portion or variant thereof, to MMRN2, or the portion or variant thereof.
In another embodiment, the candidate agent itself may be a portion of CD248 or variant thereof. Thus, the invention provides a method of identifying a portion of CD248 or a variant thereof, which portion may be useful in modulating angiogenesis or in combating cancer, or a lead compound for the identification of an agent that may be useful in modulating angiogenesis or in combating cancer, the method comprising:
providing MMRN2 or a portion or variant thereof, said portion or variant being capable of binding to CD248;
providing CD248 or a portion of variant thereof, said portion or variant being capable of biding to MMRN2;
providing a candidate portion of CD248 or a variant thereof; and
determining whether the candidate portion modulates binding of MMRN2 or the portion or variant thereof, to CD248, or the portion or variant thereof.
By "modulating angiogenesis", we include the meaning of inhibiting or enhancing angiogenesis. By MMRN2 polypeptide, we include human MMRN2 having the sequence listed in Figure 7, or an orthologue or naturally occurring variant thereof.
By portion or variant of MMRN2 being capable of binding to CD248, we include any portion or variant of MMRN2 that is capable of binding to CD248.
Typically, the portion of MMRN2 that is capable of binding to CD248 is at least 20 amino acid residues in length, and may be between 20 and 50 residues or between 50 and 100 residues or between 100 and 150 residues or between 150 and 200 residues in length, or more. In a particular embodiment, the portion of MMRN2 that is capable of binding to CD248 is less than 800, 700, 600, 500, 400, 350, 300, 250, 150, 140, 130, 110, 100, 95, 90 or 85 amino acid residues in length.
By a variant of MMRN2 that is capable of binding to CD248, we include variants of MMRN2 that have at least 60% sequence identity to human MMRN2, the sequence of which is provided in Figure 7 (SEQ ID No: 1), for example variants with at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to human MMRN2. It is preferred if the variant polypeptide has a consecutive region of at least 20 amino acid
residues, more preferably at least 50 residues, of the sequence of the MMRN2 polypeptide listed in Figure 7 (SEQ ID No: 1). Such variants may be made, for example, using the methods of recombinant DNA technology, protein engineering and site-directed mutagenesis which are well known in the art.
It will be appreciated that the portions of MMRN2 described above may also be portions of MMRN2 variants. Generally, the portions of MMRN2 have at least 60% sequence identity to human MMRN2, the sequence of which is provided in Figure 7 (SEQ ID No: 1), for example at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity over the length of the portion.
In a preferred embodiment, the portion of MMRN2 used in the method of the twenty- seventh aspect of the invention (ie not the candidate portion of MMRN2), is the portion of MMRN2 of the second aspect of the invention, and the preferences mentioned above in relation to those aspects equally apply here.
The candidate portion of MMRN2 may be any portion of wild type MMRN2 or any portion of a variant of wild type MMRN2. By MMRN2 polypeptide, we include human MMRN2 having the sequence listed in Figure 7 (SEQ ID No: 1), or an orthologue or naturally occurring variant thereof. Preferences for the portion or variant of MMRN2 include those described above in relation to the second aspect of the invention. It is particularly preferred if a portion of MMRN2 is used in the method of the twenty-seventh aspect of the invention, and still more preferred if the portion comprises or consists of the coiled-coil domain of MMRN2 (residues 133-820) or the region corresponding to the region spanning residues 133-486 of the coiled-coil domain of human MMRN2.
By CD248 polypeptide, we include human CD248 having the sequence listed in Figure 8 (SEQ ID No: 4), or an orthologue or naturally occurring variant thereof.
By portion or variant of CD248 being capable of binding to MMRN2, we include any portion or variant of CD248 that is capable of binding to MMRN2. Typically, the portion of CD248 that is capable of binding to MMRN2 is at least 20 amino acid residues in length, and may be between 20 and 50 residues or between 50 and 100 residues or between 100 and 150 residues or between 150 and 200 residues in length, or
more. In a particular embodiment, the portion of CD248 that is capable of binding to MMRN2 is less than 800, 700, 600, 500, 400, 350, 300, 250, 150, 140, 130, 1 10, 100, 95, 90 or 85 amino acid residues in length. By a variant of CD248 that is capable of binding to MMRN2, we include variants of CD248 that have at least 60% sequence identity to human CD248, the sequence of which is provided in Figure 8 (SEQ ID No: 4), for example variants with at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to human CD248. It is preferred if the variant polypeptide has a consecutive region of at least 20 amino acid residues, more preferably at least 50 residues, of the sequence of the CD248 polypeptide listed in Figure 8 (SEQ ID No: 4). Such variants may be made, for example, using the methods of recombinant DNA technology, protein engineering and site-directed mutagenesis which are well known in the art. It will be appreciated that the portions of CD248 described above may also be portions of CD248 variants. Generally, the portions of CD248 have at least 60% sequence identity to human CD248, the sequence of which is provided in Figure 8 (SEQ ID No: 4), for example at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity over the length of the portion.
In a preferred embodiment, the portion of CD248 used in the method of the twenty-seventh aspect of the invention (ie not the candidate portion of CD248), is the portion of CD248 of the third aspect of the invention, and the preferences mentioned above in relation to those aspects equally apply here.
The candidate portion of CD248 may be any portion of wild type CD248 or any portion of a variant of wild type CD248.
By CD248 polypeptide, we include human CD248 having the sequence listed in Figure 8 (SEQ ID No: 4), or an orthologue or naturally occurring variant thereof. Preferences for the portion or variant of CD248 include those described above in relation to the third aspect of the invention. It is particularly preferred if a portion of CD248 is used in the method of the twenty-seventh aspect of the invention, and still more preferred if the portion comprises or consists of the long-loop region of CD248 (residues Q88-C131) or the region corresponding to the region spanning residues 30-156 of the C-type lectin like domain of human CD248.
The candidate agent may be any of an antibody, a peptide, a peptidomimetic, a natural product, a carbohydrate, an aptamer or a small molecule (eg small organic molecule).
In an embodiment of the twenty-seventh aspect of the invention, the candidate agent is an antibody that selectively binds the CD248 polypeptide, or a fragment thereof, or an antibody that selectively binds the MMRN2 polypeptide, or a fragment thereof, or a portion of either CD248 or MMRN2.
In another embodiment, the candidate agent may be a peptide. Suitable peptides may be identified by methods such as phage display of peptide libraries (Scott & Smith (1990) "Searching for peptide ligands with an epitope library." Science 249: 386-390; Felici et al (1995) "Peptide and protein display on the surface of filamentous bacteriophage." Biotechnol. Annu. Rev. 1 : 149-183); and Collins et al (2001) "Cosmix-plexing: a novel recombinatorial approach for evolutionary selection from combinatorial libraries." J. Biotechnol. 74: 317-338); including in vivo panning (Pasqualini et al (1997) "av inte.g.rins as receptors for tumor targeting by circulating ligands. Nature Biotechnol. 15: 542-546), and solid-phase parallel synthesis (Frank (2002) "The SPOT-synthesis technique. Synthetic peptide arrays on membrane supports — principles and applications." J. Immunol. Methods 267: 13-26; and Pinilla et al (2003) "Advances in the use of synthetic combinatorial chemistry: mixture-based libraries." Nature Med. 9: 1 18-122). The dissociation constants of peptides are typically in the micromolar range, although avidity can be improved by multimerization (Terskikh et al (1997) "Peptabody": a new type of high avidity binding protein. Proc. Natl Acad. Sci. USA 94, 1663-1668; and Wrighton et al (1997) "Increased potency of an erythropoietin peptide mimetic through covalent dimerization. Nature Biotechnol. 15, 1261-1265).
The primary ligands of C-type lectins are carbohydrates, even though binding of other proteins, lipids or inorganic compounds has been shown. Thus, in another embodiment, the candidate agent may be a carbohydrate, or a molecule containing carbohydrate moieties such as a glycoprotein or gycolipid. It is appreciated that carbohydrate recognition and binding by C-type lectins is calcium dependant. Thus, in this embodiment, the method is carried out in the presence of calcium ions.
In still another embodiment, the candidate agent may be an aptamer, i.e. a single-stranded DNA molecule that folds into a specific ligand-binding structure. Suitable aptamers that bind to the CD248 polypeptide or to the MMRN2 polypeptide, or a fragment thereof, may be identified by methods such as in vitro selection and amplification (Ellington & Szostak
(1992) "Selection in vitro of single stranded DNA molecules that fold into specific ligand binding structures." Nature 355: 850-852; and Daniels et al (2003) "A tenascin-C aptamer identified by tumor cell SELEX: systematic evolution of ligands by exponential enrichment." Proc. Natl Acad. Sci. USA 100, 15416-15421). The aptamer may be a nuclease-stable 'Spiegelmer' (Helmling et al (2004) "Inhibition of ghrelin action in vitro and in vivo by an RNA-Spiegelmer." Proc. Natl Acad. Sci. USA 101 : 13174-13179). Aptamers typically have dissociation constants in the micromolar to the subnanomolar range.
In yet another embodiment, the candidate agent may be a small organic molecule. Suitable small molecules may be identified by methods such as screening large libraries of compounds (Beck-Sickinger & Weber (2001) Combinational Strategies in Biology and Chemistry (John Wiley & Sons, Chichester, Sussex); by structure-activity relationship by nuclear magnetic resonance (Shuker et al (1996) "Discovering high-affinity ligands for proteins: SAR by NMR. Science 274: 1531-1534); encoded self-assembling chemical libraries Melkko et al (2004) "Encoded self-assembling chemical libraries." Nature Biotechnol. 22: 568-574); DNA-templated chemistry (Gartner et al (2004) "DNA-templated organic synthesis and selection of a library of macrocycles. Science 305: 1601-1605); dynamic combinatorial chemistry (Ramstrom & Lehn (2002) "Drug discovery by dynamic combinatorial libraries." Nature Rev. Drug Discov. 1 : 26-36); tethering (Arkin & Wells (2004) "Small-molecule inhibitors of protein-protein interactions: progressing towards the dream. Nature Rev. Drug Discov. 3: 301-317); and speed screen (Muckenschnabel et al (2004) "SpeedScreen: label-free liquid chromatography-mass spectrometry-based high- throughput screening for the discovery of orphan protein ligands." Anal. Biochem. 324: 241-249). Typically, small organic molecules will have a dissociation constant for the polypeptide in the nanomolar range, particularly for antigens with cavities. The benefits of most small organic molecule binders include their ease of manufacture, lack of immunogenicity, tissue distribution properties, chemical modification strategies and oral bioavailability. Small molecules with molecular weights of less than 5000 daltons are preferred, for example less than 400, 3000, 2000, or 1000 daltons, or less than 500 daltons.
The capability of a candidate agent, or a portion of MMRN2, or a portion of CD248, to modulate binding of the particular interactions may be assessed by any method of detecting/measuring a protein/protein interaction or other compound/protein interaction, as discussed further below. Suitable methods include methods such as, for example, yeast two-hybrid interactions, co-purification, ELISA, co-immunoprecipitation and surface plasmon resonance methods. Thus, the candidate agent may be considered capable of
modulating binding between the particular proteins if the interaction between those proteins as determined by ELISA, co-immunoprecipitation or surface plasmon resonance methods or by a yeast two-hybrid interaction or a copurification method, is changed (e.g. increased or decreased) compared to the interaction between those proteins in the absence of the candidate portion of MMRN2 or the candidate agent. It is preferred that the interaction can be detected using a surface plasmon resonance method. Surface plasmon resonance methods are well known to those skilled in the art. Techniques are described in, for example, O'Shannessy DJ (1994) "Determination of kinetic rate and equilibrium binding constants for macromolecular interactions: a critique of the surface plasmon resonance literature" Curr Opin Biotechnol. 5(1):65-71 ; Fivash et al (1998) "BIAcore for macromolecular interaction." Curr Opin Biotechnol. 9(1):97-101 ; Malmqvist (1999) "BIACORE: an affinity biosensor system for characterization of biomolecular interactions." Biochem Soc Trans. 27(2):335-40. It is appreciated that screening assays which are capable of high throughput operation are particularly preferred. Examples may include cell based assays and protein-protein binding assays. An SPA-based (Scintillation Proximity Assay; Amersham International) system may be used. Other methods of detecting polypeptide/polypeptide interactions include ultrafiltration with ion spray mass spectroscopy/HPLC methods or other physical and analytical methods. Fluorescence Energy Resonance Transfer (FRET) methods, for example, well known to those skilled in the art, may be used, in which binding of two fluorescent labelled entities may be measured by measuring the interaction of the fluorescent labels when in close proximity to each other.
It will be appreciated that the candidate portion of MMRN2 or the candidate agent of the twenty-seventh aspect of the invention, or candidate portion of CD248 or candidate agent of the twenty-eighth aspect of the invention, may be added to one or the other of the members of the protein pair whose interaction is monitored (e.g. CD248 and MMRN2) before addition to the other member, and vice versa, and its effect on binding assessed.
Conveniently, at least one or other of members of the protein pair whose interaction is monitored (e.g. CD248 and MMRN2 (or portions or variants thereof)) are detectably labelled so as to facilitate detection of their binding and consequently the effect of the candidate agent. Examples of suitable labels include a peptide label, a nucleic acid label (Kerr et al (1993) JACS vol. 115, p. 2529-2531 ; and Brenner & Lerner (1992) Proc. Natl.
Acad. Sci. USA vol. 89, p. 5381-5383), a chemical label (Ohlmeyer et al (1993) Proc. Natl. Acad. Sci. USA vol. 90, p. 109222-10926; and Maclean et al (1997) Proc. Natl. Acad. Sci. USA vol. 94, p. 2805-2810); a fluorescent label (Yamashita & Weinstock (SmithKline Beecham Corporation), W095/32425 (1995); and Sebestyen et al (1993) Pept. Proc. Eur. Pept. Symp. 22nd 1992, p. 63-64), or a radio frequency tag (Nicolaou et al (1995) Angew. Chem. Int. Ed. Engl. vol. 34, p. 2289-2291 ; and Moran et al (1995) JACS vol. 117, p. 10787-10788).
In one embodiment, the candidate portion of MMRN2 or the candidate agent of the twenty- seventh aspect of the invention, or candidate portion of CD248 or candidate agent of the twenty-eighth aspect of the invention is one that reduces the level of binding between CD248, or the portion or variant thereof, to MMRN2, or the portion or variant thereof. Thus, the portion or agent may be useful in combating any disease or condition involving unwanted, undesirable or inappropriate angiogenesis, or may be a lead compound to the identification of an agent that is so useful
Preferably, the candidate portion of MMRN2 or the candidate agent of the twenty-seventh aspect of the invention, or candidate portion of CD248 or candidate agent of the twenty- eighth aspect of the invention reduces the level of binding between CD248 and MMRN2 (or portion(s) or variant(s) thereof) by at least 10%, 20%, 30%, 40% or 50%, and more preferably the candidate agent is one that reduces the level of binding between CD248 and MMRN2 (or portion(s) or variant(s) thereof by at least 70%, 80%, 90%, 95% or 99%, compared to the level of binding in the absence of the candidate agent. Most preferably, the agent is one that reduces the level of binding between CD248 and MMRN2 (or portion(s) or variant(s) thereof) to an undetectable level, or eliminates binding between CD248 and MMRN2 (or portion(s) or variant(s) thereof).
It is appreciated that the identification of a candidate portion of MMRN2 or candidate agent, or a candidate portion of CD248 or candidate agent, that modulates binding of CD248, or the portion or variant thereof, to MMRN2, or the portion or variant thereof, may be an initial step in a drug screening pathway, and the identified agents may be further selected e.g. for the ability to inhibit angiogenesis and/or for the ability to inhibit tumour growth. Thus, the method may further comprise the step of testing the candidate portion or agent in an angiogenesis assay and/or testing the candidate agent for efficacy in an animal model of a solid tumour.
Methods and assays for determining the rate or level of angiogenesis, and hence for determining whether and to what extent a candidate agent inhibits angiogenesis, are known in the art. For example, US 6,225, 1 18, incorporated herein by reference, describes a multicellular ex vivo assay for modelling the combined stages of angiogenesis namely the proliferation, migration and differentiation stages of cell development. The AngioKit, Catalogue No. ZHA-1000, by TCS CellWorks Ltd, Buckingham MK18 2LR, UK, is a suitable model of human angiogenesis for analysing the anti-angiogenic properties of compounds. The rate or level of angiogenesis can also be determined using the aortic ring assay and the sponge angiogenesis assay that are well known in the art.
Assays for endothelial cell proliferation, migration and invasion are also useful as angiogenesis assays. Suitable assays for endothelial cell proliferation and migration are known to a person of skill in the art. Suitable assays for endothelial cell invasion are also known to a person of skill in the art and include the BD BioCoat™ Angiogenesis System for Endothelial Cell Invasion which is available as Catalogue Nos. 354141 and 354142 from BD Biosciences, Bedford, MA, USA, and the QCM™ Endothelial Cell Invasion Assay (EMD Millipore).
It is appreciated that these methods may be a drug screening methods, a term well known to those skilled in the art, and the candidate agent may be a drug-like compound or lead compound for the development of a drug-like compound.
The term "drug-like compound" is well known to those skilled in the art, and may include the meaning of a compound that has characteristics that may make it suitable for use in medicine, for example as the active ingredient in a medicament. Thus, for example, a drug-like compound may be a molecule that may be synthesised by the techniques of organic chemistry, less preferably by techniques of molecular biology or biochemistry, and is preferably a small molecule, which may be of less than 5000 Daltons and which may be water-soluble. A drug-like compound may additionally exhibit features of selective interaction with a particular protein or proteins and be bioavailable and/or able to penetrate target cellular membranes or the blood:brain barrier, but it will be appreciated that these features are not essential.
The term "lead compound" is similarly well known to those skilled in the art, and may include the meaning that the compound, whilst not itself suitable for use as a drug (for example because it is only weakly potent against its intended target, non-selective in its action, unstable, poorly soluble, difficult to synthesise or has poor bioavailability) may
provide a starting-point for the design of other compounds that may have more desirable characteristics.
In an embodiment, the identified agent is modified, and the modified agent is tested for the ability to modulate binding between CD248 and MMRN2 (or portion(s) or variant(s) thereof).
It is appreciated that the screening methods can be used to identify agents that may be useful in combating any disease or condition involving unwanted, undesirable or inappropriate angiogenesis, such as solid tumours. Thus, the screening methods preferably also comprise the further step of testing the identified agent or the modified agent for efficacy in an animal model of cancer, particularly a solid tumour. Suitable models are known in the art and include Lewis lung carcinoma subcutaneous implants in mice (homograft in Black 57 mice) or HT29 xenografts subcutaneous implants in nude mice.
The methods may comprise the further step of synthesising and/or purifying the identified agent or the modified agent. The methods may further comprise the step of formulating the agent into a pharmaceutically acceptable composition.
Agents may also be subjected to other tests, for example toxicology or metabolism tests, as is well known to those skilled in the art.
The invention includes a method for preparing an anti-angiogenic compound that may be useful in the treatment of any disease or condition involving unwanted, undesirable or inappropriate angiogenesis, the method comprising identifying an agent using the screening methods described above and synthesising, purifying and/or formulating the identified agent. The invention includes a method for preparing an anti-cancer compound that may be useful in the treatment of a solid tumour, the method comprising identifying an agent using the screening methods described above and synthesising, purifying and/or formulating the identified agent. The invention also includes a method of making a pharmaceutical composition comprising the step of mixing the agent identified using the methods described above with a pharmaceutically acceptable carrier.
All of the documents referred to herein are incorporated herein, in their entirety, by reference. The invention will now be described by reference to the following Figures and Examples.
Figure 1. CTLD group 14 family members CLEC14A and CD93 directly bind M MRN2.
(A) Diagrams of GFP tagged CTLD group 14 family members showing domain architecture and relative size with number of amino acids (aa) without the GFP tag. C-type lectin domain (CTLD), sushi, epidermal growth factor (EGF) domain, transmembrane (TM), cytoplasmic tail (cyto) and green fluorescent protein (GFP) tag are displayed. (B) HEK293T were transfected with GFP tagged group 14 family members, lysates were separated by SDS-PAGE under non-reduced conditions and far western blotted with MMRN2FL, showing MMRN2FL binds CLEC14A and CD93 but not thrombomodulin or CD248, probing with anti-GFP confirmed expression of all proteins. (C) Immunoprecipitations of CD93 using monoclonal R139 antibody co-immunoprecipitates MMRN2 from HUVEC lysates. (D) Immunoprecipitations of MMRN2 using mouse polyclonal antibodies co-immunoprecipitates CD93 from HUVEC lysates. CD93 was detected using goat polyclonal antibodies in each immunoprecipitation experiment. IgG heavy chains included as loading control.
Figure 2. Diagram of MMRN2 truncation mutants. Diagrams of MMRN2 truncation mutants, showing the elastin microfibril interface (EMI) domain, coiled-coil (CC) domain and complement related C1q domain. The minimal CLEC14A binding fragment is highlighted in black.
Figure 3. CD248 binds to MMRN2 in a distinct region from CLEC14A and CD93 binding. (A) HEK293T transfected with chimeras CLEC14ACD248<sushi> and CLEC14ACD248<CTLD> were lysed and far western blotted with MMRN2FL and western blotted with anti-GFP. MMRN2FL binds to CLEC14A and both chimeras CLEC14ACD248<sushi> and CLEC14ACD248<CTLD> but not CD248-GFP or GFP alone. (B) Immunoprecipitations of GFP tagged proteins after cell surface biotinylation. CLEC14A, THBD, CD93 and all four CLEC14A chimeras bind to streptavidin showing they are cell surface expressed. GFP alone was included to demonstrate intracellular proteins are not cell surface biotinylated. (C) MMRN2 truncation mutants were transfected into HEK293T and lysates under reducing conditions were far western blotted with mCD248-ECD-Fc, revealing binding to minimal fragment MMRN2133"486. His tag western blot confirmed expression of each
MMRN2 protein fragment. (D) mCD248-ECD-Fc pull downs from HUVEC lysates resulted in enrichment of MMRN2 compared to hFc control. (E) Immunofluorescence analysis of HUVEC stained with MMRN2 mouse polyclonal antibodies, human Fc, mCD248-ECD-Fc or CLEC14A-ECD-FC. MMRN2 antibody staining partially co-localises with CD248-ECD- Fc and CLEC14A-ECD-Fc binding, scale bar 40 μηι. (F) ELISAs of mCD248-ECD-Fc bound to plate capturing MMRN2 FL His, (**p<0.01 Mann Whitney test n=5) error bars represent SEM. (G) ELISAs of mCD248-ECD-Fc capturing MMRN2 FL His and then binding by CLEC14A-ECD-Fc detected by anti-CLEC14A antibody C2. (**p<0.01 Mann Whitney test n=5) error bars SEM. (H) Diagram of CLEC14A or CD93 expressed by endothelial cells binding to MMRN2 in the ECM, which in turn is bound by CD248 expressed by fibroblasts or vasculature associated pericytes.
Figure 4. CLEC14A- MRiSS2-CD248 co-!oca!isation can be observed in human pancreatic cancer. (A) Human pancreatic cancer sections were stained with antibodies against CD248 (green), MMRN2 (blue), CLEC14A (red) and Hoeschtwas used to visualise nuclei (grey). This revealed partial co-localisation of CLEC14A and MMRN2 where they meet CD248 positive cells. Co-localisation of all three proteins is indicated in white. The merged image displays orthogonal views in xz and yz. Scale bars 10 μηι. (B) Human pancreatic cancer sections were stained with antibodies against CD248 (green), CLEC14A (red) and MMRN2 (blue), Hoeschtwas used to visualise nuclei (grey). CD248 positive cells (likely pericytes) are in close proximity to CLEC14A and MMRN2 positive endothelial cells. This revealed co-localisation of CLEC14A and MMRN2 in association with CD248 positive cells. Dotted lines highlight areas that have been enlarged (A and B). Scale bars 50 μηι. (C) Schematic diagram of CLEC14/CD93-MMRN2-CD248 interaction. The C-type lectin domain of CLEC14A or CD93 expressed on endothelial cells bind to MMRN2 in the ECM (between residues 530-624) which in turn binds to the CTLD of CD248 expressed by pericytes or fibroblasts (between MMRN2 133-486). CLEC14A binding to MMRN2 is dependent upon the 97-108 region in the long loop domain. Figure 5. Amino acid sequence alignments of CTLD group 14 family members.
Human CLEC14A (Accession no. Q86T13), CD93 (Q9NPY3), THBD (P07204) and CD248 (Q9HCU0) CTLD sequences (SEQ ID Nos: 6-9 respectively) were aligned using PRALINE without inclusion of signal peptides. The a-helices (yellow rectangle) and β-sheets (green arrow) are mapped onto the alignment corresponding to their position within the predicted CLEC14A-CTLD model. There are also four predicted loops L1-L4 mapped within the long-loop region (red) as described for tetranectin CTLD. The L1 loop contains the 97-108 region and the non-canonical cysteine 103. The L4 contains the other non-canonical
cysteine C138. Each cysteine residue within the long loop region is labelled with a black dot.
Figure 6. Amino acid sequence alignments of human MMRN2133 486 and corresponding regions from different species. PRALINE (39) generated amino acid alignments of MMRN2 regions from human (Accession no. Q9H8L6), bull (E1 BJW3), chimp (H2Q273), rat (D4ABX6), mouse (A6H6E2), chicken (E1 BTB7) and two zebrafish proteins MMRN2a (zebrafish (a)) (F1 R6V5) and MMRN2b (zebrafish (b)) (E7FG77) (SEQ ID Nos: 10-17 respectively).
Figure 7. Sequences of human MMRN2. (A) Human MMRN2 polypeptide sequence (SEQ ID No: 1) and polynucleotide coding sequence (SEQ ID No: 2). (B) Human MMRN2 amino acid sequence (SEQ ID No: 60). Figure 8. Sequences of human CD248. (A) Human CD248 polynucleotide coding sequence (SEQ ID No: 3). (B) Human CD248 amino acid sequence (SEQ ID No: 4).
Figure 9. Amino acid sequence alignments of human CD24830 156 and corresponding regions from different species.
PRALINE (39) generated amino acid alignments of CD248 regions from human (Accession no. NP_065137.1), bull (XP_003588093.1), chimp (XP_003313194.1), rat (NP_001099795.1), mouse (NP_473383.1), and zebrafish proteins CD248 zebrafish (NP_001092698.3) (SEQ ID Nos: 18-23). EXAMPLE 1 : MULTIMERIN-2 IS A LIGAND FOR THE C-TYPE LECTIN CD248 SPANNING THE ENDOTHELIAL PERICYTE INTERFACE
Summary The C-type lectin domain containing group 14 family members CLEC14A and CD93 are proteins expressed by endothelium and implicated in tumour angiogenesis. CD248 (alternatively known as endosialin or tumour endothelial marker-1) is also a member of this family and is expressed by tumour associated fibroblasts and pericytes. Multimerin-2 (MMRN2) is a unique endothelial specific extracellular matrix protein that has been implicated in angiogenesis and tumour progression. We have shown that the group 14 C- type lectins CLEC14A, CD93 and CD248 directly bind to MMRN2 and only
thrombomodulin of the family does not. These findings identify a novel protein interaction involving CD248 and MMRN2 as targetable components of vessel formation.
Introduction
Angiogenesis describes the formation of new blood vessels from existing vessels and is an integral part of reproduction, embryonic development and wound healing. Angiogenesis is mostly dormant in healthy adults but is a component of numerous pathologies including cancer, diabetic retinopathy and atherosclerosis (1). The ability to control angiogenesis would provide significant therapeutic value and understanding the underlying molecular events is critical in this pursuit.
CD248 has also been shown to play roles in angiogenesis, particularly in vessel regression during vascular patterning (11). CD248 has been described as a marker of pericytes associated with tumour vasculature in glioma (12), and is elevated in the stroma of many other tumours including colorectal, melanoma and invasive glioblastoma (13-15). CD248 is actively being pursued as a cancer target with clinical trials underway (16).
The endothelial specific cell surface glycoprotein CLEC14A has been identified as a tumour endothelial marker, due to its greater expression in the tumour vasculature than vessels in healthy tissue (2). CLEC14A is shed from the cell membrane and has roles in regulating sprouting angiogenesis (3-5). CD93 is also overexpressed in tumour endothelium and recent studies confirm a role in tumour angiogenesis (6-8). CD248 (endosialin or TEM1) is not expressed by endothelium but is found on pericytes and tumour associated fibroblasts of multiple tumour types (9).
In this study we investigate the interactions of the C-type lectin domain (CTLD) group 14 family with MMRN2 and show CD248, CLEC14A and CD93 all engage MMRN2 whereas thrombomodulin of the family does not. Our findings propose previously unknown protein- protein interactions that occur in endothelium and the surrounding stroma that could provide new targets in anti-angiogenic treatment.
Results
CTLD group 14 family members CLEC14A and CD93 directly bind MMRN2 We previously identified MMRN2 as a CLEC14A binding partner (3), to examine whether other CTLD group 14 members also bind MMRN2, we employed far western blotting using a MMRN2 protein probe to test for direct protein-protein interactions. The CTLD group 14 members CLEC14A, CD93, thrombomodulin and CD248 were constructed with C-terminal green fluorescent protein (GFP) tags (Figure 1A), transfected into HEK293T cells and lysates were separated by SDS-PAGE under non-reducing conditions maintaining disulphide bonds. Upon transfer, PVDF membranes were probed using HEK293T lysates overexpressing full-length MMRN2 (MMRN2FL) with a polyhistidine (His) tag. MMRN2FL bound to CLEC14A and CD93 detected by His tag antibodies (Figure 1 B). Anti-GFP western blot showed expression of each protein, however the CD248-GFP band migrated at a lower molecular weight (-120 kDa) than previously reported (-175 kDa), or than expected with a GFP tag (-205 kDa) (17), suggesting defects in glycosylation. Indeed, C-terminal tagging of CD248 has been shown previously to prevent cell surface expression (18). Therefore, CD248-GFP is most likely misfolded and we were unable to determine from this experiment whether CD248 binds MMRN2.
To validate the CD93-MMRN2 interaction in endothelial cells, HUVEC lysate was immunoprecipitated with polyclonal MMRN2 antibodies or the previously validated CD93 monoclonal antibody R139 (19;20). This resulted in MMRN2 enrichment in CD93 immunoprecipitations (Figure 1 C) and CD93 enrichment in MMRN2 immunoprecipitations (Figure 1 D).
CD248 binds to a separate region of MMRN2 from CLEC14A and CD93 binding
To determine whether the CTLD of CD248 binds MMRN2 in a correctly folded and cell surface expressed form, the domain was replaced in CLEC14A to create chimera CLEC14ACD248<CTLD>. This was expressed in HEK293T and lysates far western blotted under non-reducing conditions revealed binding by MMRN2FL (Figure 3A). To test whether the sushi domain of CD248 was sufficient to confer correct folding of CLEC14A-CTDL the chimera CLEC14ACD248<sushi> was generated, this also bound MMRN2FL.
To ensure GFP tagged wild-type (wt) and chimeric proteins were expressed at the cell surface, transfected HEK293T were cell surface biotinylated before anti-GFP
immunoprecipitation. Probing with streptavidin-HRP confirmed CLEC14A, CD93, thrombomodulin and chimeras were expressed on the cell surface (Figure 3B).
To determine where CD248 binds MMRN2, His tagged MMRN2 constructs were generated, each lacking major domains (Figure 2A). These included MMRN2FL, EMI and coiled-coil (MMRN2EMI"CC), coiled-coil and C1 q (MMRN2CC-C1 c<), coiled-coil alone (MMRN2CC) and the coiled-coil halved (MMRN2133-486 and MMRN2487"820). Constructs were transfected into HEK293T and lysates subjected to far western blot analysis. Mouse CD248-ECD-Fc which had been previously shown to bind human endothelial ECM was used as a probe (11). CD248-ECD-Fc bound to MMRN2133"486, a completely distinct region than required for CLEC14A or CD93 binding (Figure 3C). To test whether mCD248-ECD- Fc could bind MMRN2 from HUVEC, pull down assays were performed on lysates, revealing enrichment of MMRN2 compared with control human Fc (Figure 3D). To determine whether previous mCD248-ECD-Fc ECM staining experiments were due to binding to MMRN2, mCD248-ECD-Fc and polyclonal MMRN2 antibodies were used to stain cultured HUVEC. MMRN2 staining revealed fibrous meshes in the ECM which partially co-localised with mCD248-ECD-Fc or CLEC14A-ECD-Fc binding but not hFc alone (Figure 3E).
To determine whether both CLEC14A and CD248 can bind MMRN2 simultaneously, a sandwich ELISA approach was taken. This showed CD248 could capture MMRN2 detected by the His tag (Figure 3F). CD248 could also capture MMRN2 which subsequently bound CLEC14A, confirming these proteins do not compete for binding with MMRN2 (Figures 3G). This suggests CLEC14A or CD93 expressed by endothelial cells can bind MMRN2 at the same time as CD248 expressed by fibroblasts or pericytes (Figure 3H). Descriptions of each MMRN2 truncation and which CTLD group 14 members bind are summarised in Table 1.
MMRN2487"820 + Not tested -
MMRN2487"674 + Not tested -
MMRN2495"674 + + -
MMRN2495"603 - - -
MMRN2530"624 + Not tested -
MMRN2604"674 - Not tested -
Table 1. A summary of which CTLD group 14 family members bind to which regions of MMRN2.
CLEC14A and CD248 bind MMRN2 simultaneously at the interface between endothelium and pericytes in human pancreatic cancer
To determine whether the CLEC14A-MMRN2-CD248 interaction could be observed in human cancer, pancreatic tumours were stained with antibodies against each protein, revealing separate CLEC14A and MMRN2 expression from CD248. In some areas co- localisation of all three proteins can be seen at the interface between CLEC14A positive endothelial cells and CD248 positive cells, likely to be pericytes. (Figure 4A and 4B). This has been represented in a schematic diagram (Figure 4C).
Discussion
The CTLD group 14 family are important emerging molecules in tumour angiogenesis. Our present study has demonstrated CD248 as being able to bind the CLEC14A ECM ligand MMRN2. The CD248-MMRN2 interaction offers explanations to previous findings. The CD248-ECD has been used as a binding probe in immunofluorescence studies on mouse tissues and different cultured cell types (1 1), revealing characteristic ECM staining only occurring on endothelial cells, likely dependent on MMRN2. CD248-MMRN2 interactions occur on a separate region from CLEC14A and CD93 binding suggesting endothelial expressed CTLD group 14 members can bind to MMRN2 simultaneously with CD248 expressed by other cell types such as pericytes and fibroblasts. Indeed, this is the case for CLEC14A- MMRN2-CD248 interactions in pancreatic cancer. This offers a scenario where MMRN2
acts as an "extracellular glue" between both cell types in vessel formation and maturation. This adds to the list of ECM proteins along with collagen I and IV and fibronectin already described as potential CD248 ligands (33). Future studies will likely shed light on the roles of CD248, CLEC14A and CD93 and the signalling of these understudied molecules.
Materials and Methods Antibodies and reagents
Antibodies: mouse anti-His clone AD1.1 (R&D Systems, #MAB050), anti-GFP mouse clone 3E1 (Cancer Research UK), anti-MMRN2 mouse polyclonal (Abnova/Novus Biologicals, #H00079812-B01 P), anti-CD93 mouse clone R139 (eBioscience, #14-0939), anti-CD93 goat polyclonal (R&D Systems, #AF2379), anti-Tubulin mouse clone DM1A (Sigma-Aldrich, #T9026), anti-fibronectin sheep polyclonal (R&D Systems, #AF1918), mouse IgG isotype control (Thermo Scientific, #10400C), human IgG Fc (Bethyl Laboratories #P80-104) (sodium azide removed by dialysis against PBS), anti-human IgG Fc horse radish peroxidase (HRP) conjugated (Sigma-Aldrich #A0170), anti-mouse HRP (Dako, #P0447), anti-sheep HRP (R&D Systems #HAF016), anti-goat HRP (Dako, #P0449), streptavidin HRP (GE Healthcare #RPN1231) anti-mouse alexafluor 555 (Thermo Scientific, #A21425), anti-human IgG alexafluor-555 (Thermo Scientific, #A21433), anti-mouse alexafluor-488 (Thermo Scientific, #A1 1001), anti-human Fc FITC conjugated (Sigma-Aldrich, #F9512), streptavidin R-phycoerthrin (PE) conjugate (Thermo Scientific, #S-866), fibronectin (Sigma-Aldrich, #F2006). CD248-ECD-Fc as used in (1 1).
Plasmid construction
All CTLD 14 members, mutants and chimeras inserted between EcoRI in pEGFPNI , using Gibson assembly reaction according to manufacturer's instructions (New England Biolabs), using PCR products amplified with the following primers; CLEC14A forward GATCTCGAGCTCAAGCTTCGATGAGGCCGGCGTTCGCC (SEQ ID No: 24), CLEC14A reverse TACCGTCGACTGCAGTGCATCACTAGAGCCAAG (SEQ ID No: 25), CD93 forward CGAGCTCAAGCTTCGATGGCCACCTCCATGGGC (SEQ ID No: 26), CD93 reverse TACCGTCGACTGCAGGCAGTCTGTCCCAGGTGTCG (SEQ ID No: 27), THBD forward CGAGCTCAAGCTTCGATGCTTGGGGTCCTGGTC (SEQ ID No: 28), THBD reverse TACCGTCGACTGCAGGAGTCTCTGCGGCGTCCG (SEQ ID No: 29), CD248
forward CGAGCTCAAGCTTCGATGCTGCTGCGCCTGTTG (SEQ ID No: 30), CD248 reverse TACCGTCGACTGCAGTCACACGCTGGTTCTGCAG (SEQ ID No: 31). For chimeras, two PCR products or more were Gibson assembled together using; (CLEC14ATHBD<CTLD>; THBD forward and THBD-CTLD fused to CLEC14A-sushi reverse CTCAAACTGGAACTCGCAGAGGAAGCC (SEQ ID No: 32), THBD-CTLD fused to CLEC14A-sushi forward GCGAGTTCCAGTTTGAGGTCTTGTGTC (SEQ ID No: 33) and CLEC14A reverse). (CLEC14ATHBD<sushi>; CLEC14A forward and CLEC14A-CTLD fused to THBD-sushi reverse TACCGTCGACTGCAGTGCATCACTAGAGCCAAG (SEQ ID No: 34), CLEC14A-CTLD fused to THBD-sushi forward GTGCAAGTACCACTTCCCAGCCACCTGCAGGC (SEQ ID No: 35) and THBD-sushi fused to CLEC14A-EGF reverse TCCCGGGGCAAGCGCCCGGCGCCTCCCT (SEQ ID No: 36), THBD-sushi fused to CLEC14A-EGF forward GCCGGGCGCTTGCCCCGGGAGGTACCTC (SEQ ID No: 37) and CLEC14A wt reverse). (CLEC14ACD248<sushi>; CLEC14A Forward and CLEC14A-CTLD fused to CD248- sushi Reverse CCTCGAAGCCGTACTTGCACAGGTAGCCGTTGGC (SEQ ID No: 38), CLEC14A-CTLD fused to CD248-sushi Forward
GTGCAAGTACGGCTTCGAGGGCGCCTGC (SEQ ID No: 39) and CD248-sushi fused to CLEC14A-EGF Reverse TCCCGGGGCAGCCAGTCCCCAGGCACAGG (SEQ ID No: 40), CD248-sushi fused to CLEC14A-EGF Forward GGGGACTGGCTGCCCCGGGAGGTACCTC (SEQ ID No: 41) and CLEC14A Reverse). (CLEC14ACD248<CTLD>; CD248 Forward and CD248-CTLD fused to CLEC14A-sushi Reverse CTCAAACTGAAACTGGCACAGGTAGCCG (SEQ ID No: 42), CD248-CTLD fused to CLEC14A-sushi Forward GCCAGTTTCAGTTTGAGGTCTTGTGTC (SEQ ID No: 43) and CLEC14A Reverse).
MMRN2 fragments were amplified using; (MMRN2EMI"CC; MMRN2FL Forward CCGGACCGGTCAGGCTTCCAGTACTAGCC (SEQ ID No: 44) and MMRN2820 Reverse CTACTAGGTACCCCAGAGCGCCGCGCCC (SEQ ID No: 45)). (MMRN2CC-C1c<; MMRN2133 Forward CCGGACCGGTGATTCCATGGCAATCCCTGA (SEQ ID No: 46) and MMRN2FL Reverse CGGGGTACCGGTCTTAAACATCAGGAAGC (SEQ ID No: 47)). (MMRN2CC; MMRN2133 Forward and MMRN2820 reverse). (MMRN2133"486; MMRN2133 Forward and MMRN2486 Reverse CTACTAGGTACCCTTGATGAGGTCGGCATGG (SEQ ID No: 48)). (MMRN2487"820; MMRN2487 Forward
CCGGACCGGTTACGTGAAGGACTGCAATTG (SEQ ID No: 49) and MMRN2820 Reverse). PCR products digested with Agel and Kpnl were ligated into pHL-Avitag3 containing an N-terminal signal peptide (SP), C-terminal BirA and His tag (36).
Lentiviral vectors were constructed by Gibson reaction between Pmel sites using primers. mCLEC14A-ECD; forward ACTAGCCTCGAGGTTTAAACATGAGGCCAGCGCTTGCC (SEQ ID No: 50) and reverse
CACTCGATGAGGATCCGGAAGAGGTGTCGAAAGTCAGAGAAAC (SEQ ID No: 51), mouse Fc for fusion to mCLEC14A-ECD forward CCTCTTCCGGATCCTCATCGAGTGTGCCCAGGGATTGTGGT (SEQ ID No: 52) and reverse CTGCAGCCCGTAGTTTTCATTTACCAGGAGAGTGGG (SEQ ID No: 53). mFc alone fused to CLEC14A SP; mCLEC14A SP forward AGACTAGCCTCGAGGTTTAAACATGAGGCCAGCGCTTGC (SEQ ID No: 54) and mCLEC14A SP reverse TGAGGATCCCTCCCCATTCCCTGGCCG (SEQ ID No: 55), and mFc fused to SP; forward AATGGGGAGGGATCCTCATCGAGTGTG (SEQ ID No: 56) and reverse TCCTGCAGCCCGTAGTTTTCATTTACCAGGAGAGTGG (SEQ ID No: 57). mMMRN2495"678 inserted between engineered BamHI site separating the SP and mFc; forward CAGGGAATGGGGAGGGATCCCAAAGGGTCAACTCTGACG (SEQ ID No: 58) and reverse GGCACACTCGATGAGGATCCCAACTGTGGGTGCTGCTC (SEQ ID No: 59). Human and mouse MMRN2, human and mouse CLEC14A, CD248 and thrombomodulin amplified from IMAGE clones, mFc amplified from cDNA of C3 hybridomas. CD93 amplified from pCDNA3 CD93, a gift from Suzanne Bohlson. CLEC14A domain deletions were generated previously in pCS2 plasmids (4).
Protein expression and purification
CLEC14A-ECD-Fc was expressed and purified as described (3). Western blotting, far western blotting
Standard protocols for western blotting were used. Far westerns involved incubating PVDF membranes for 1 hour with either hCLEC14A-ECD-Fc (2 Mg/mL), CD248-ECD-Fc (2 Mg/mL), or MMRN2FL transfected lysates diluted 1 :50 (6x106 HEK293T cells/mL of lysis buffer) (diluted 1 :50). Epitope tags of each probed protein was detected with secondary antibodies as standard.
Cell culture and plasmid transfections HUVEC were isolated from fresh umbilical cords collected at the Birmingham Women's Hospital with informed consent and cultured as described previously (2). HUVEC experiments used at least three distinct preparations from different cords. HEK293T were
cultured as described (3). Transfections and lentiviral transductions were performed as previous (4).
Cell surface biotinylation and immunoprecipitation
Transfected HEK293T were washed twice with PBS containing Mg2+ and Ca2+ and then EZ-Link Sulfo-NHS-Biotin (Thermo Scientific # 21217) was incubated at 1 mg/mL in PBS for 30 minutes. Biotinylation reaction was quenched using 100 mM glycine and cells were washed twice with PBS. Immunoprecipitations were performed as previously described with 2-5 μg of antibody or Fc tagged protein (3).
Immunofluorescence staining
HUVEC on gelatin coated coverslips were cultured for 6 days, media replaced every 2 days, fixed and blocked as described without permeabilisation (37). Incubated with anti- MMRN2 (Abnova, 4 g/mL) and hFc, mCD248-ECD-Fc or CLEC14A-ECD-Fc (all 20 g/mL) for 2 hours. Detection antibodies; anti-human alexafluor-555 and anti-mouse alexafluor-488 incubated for 1.5 hours. Human pancreatic tumour sections were cleared of paraffin, rehydrated and antigen retrieved in Tris-EDTA pH9.0 for 1 hour (96°C), blocked in 2.5% horse serum PBS 30 minutes, anti-MMRN2 (Abeam, 0.45 Mg/mL), anti-CLEC14A (R&D, 50 Mg/mL), anti-CD248 B1.35 (1 :5 dilution) 1 hour. Imaged using confocal microscope Zeiss LSM-780 with Argon and He/Ne lasers, 40x or 63x/1.40 water immersion objectives. Images displayed as maximum intensity projections. ELISA
96 well plates were coated with mCD248-ECD-Fc (400 ng) in PBS overnight (4°C), then blocked (PBS 3% (w/v) BSA). MMRN2FL transfected HEK293T lysates (6x106 cells/mL) were added diluted in PBS (1 :50). CLEC14A-ECD-Fc (200 ng) or anti-His tag antibodies (200 ng), then for CLEC14A-ECD-Fc, C2 (400 ng) was incubated. Binding was detected with anti-mouse HRP (1 :5000), visualised using BM Blue POD substrate (Roche).
References of Example 1 (1) Carmeliet P. Angiogenesis in health and disease. Nat Med 2003 Jun;9(6):653-60.
Mura M, Swain RK, Zhuang X, Vorschmitt H, Reynolds G, Durant S, et al. Identification and angiogenic role of the novel tumor endothelial marker CLEC14A. Oncogene 2012 Jan 19;31 (3):293-305.
Noy PJ, Lodhia P, Khan K, Zhuang X, Ward DG, Verissimo AR, et al. Blocking CLEC14A-MMRN2 binding inhibits sprouting angiogenesis and tumour growth. Oncogene 2015 Nov 19;34(47):5821-31.
Noy PJ, Swain RK, Khan K, Lodhia P, Bicknell R. Sprouting angiogenesis is regulated by shedding of the C-type lectin family 14, member A (CLEC14A) ectodomain, catalyzed by rhomboid-like 2 protein (RHBDL2). FASEB J 2016 Jun;30(6):2311-23.
Rho SS, Choi HJ, Min JK, Lee HW, Park H, Park H, et al. Clec14a is specifically expressed in endothelial cells and mediates cell to cell adhesion. Biochem Biophys Res Commun 2011 Jan 7;404(1):103-8.
Masiero M, Simoes FC, Han HD, Snell C, Peterkin T, Bridges E, et al. A core human primary tumor angiogenesis signature identifies the endothelial orphan receptor ELTD1 as a key regulator of angiogenesis. Cancer Cell 2013 Aug 12;24(2):229-41.
Langenkamp E, Zhang L, Lugano R, Huang H, Elhassan TE, Georganaki M, et al. Elevated Expression of the C-Type Lectin CD93 in the Glioblastoma Vasculature Regulates Cytoskeletal Rearrangements That Enhance Vessel Function and Reduce Host Survival. Cancer Res 2015 Nov 1 ;75(21):4504-16.
Olsen RS, Lindh M, Vorkapic E, Andersson RE, Zar N, Lofgren S, et al. CD93 gene polymorphism is associated with disseminated colorectal cancer. Int J Colorectal Dis 2015 Jul;30(7):883-90.
Kontsekova S, Polcicova K, Takacova M, Pastorekova S. Endosialin: molecular and functional links to tumor angiogenesis. Neoplasma 2016 Jan 17.
Zanivan S, Maione F, Hein MY, Hernandez-Fernaud JR, Ostasiewicz P, Giraudo E, et al. SILAC-based proteomics of human primary endothelial cell morphogenesis unveils tumor angiogenic markers. Mol Cell Proteomics 2013 Dec;12(12):3599-611.
(1 1) Simonavicius N, Ashenden M, van WA, Lax S, Huso DL, Buckley CD, et al. Pericytes promote selective vessel regression to regulate vascular patterning. Blood 2012 Aug 16; 120(7): 1516-27.
(12) Simonavicius N, Robertson D, Bax DA, Jones C, Huijbers IJ, Isacke CM.
Endosialin (CD248) is a marker of tumor-associated pericytes in high-grade glioma. Mod Pathol 2008 Mar;21 (3):308-15.
(13) Rmali KA, Puntis MC, Jiang WG. Prognostic values of tumor endothelial markers in patients with colorectal cancer. World J Gastroenterol 2005 Mar 7; 11 (9): 1283- 6.
(14) Huber MA, Kraut N, Schweifer N, Dolznig H, Peter RU, Schubert RD, et al.
Expression of stromal cell markers in distinct compartments of human skin cancers. J Cutan Pathol 2006 Feb;33(2): 145-55.
(15) Brady J, Neal J, Sadakar N, Gasque P. Human endosialin (tumor endothelial marker 1) is abundantly expressed in highly malignant and invasive brain tumors. J Neuropathol Exp Neurol 2004 Dec;63(12): 1274-83.
(16) Diaz LA, Jr., Coughlin CM, Weil SC, Fishel J, Gounder MM, Lawrence S, et al. A first-in-human phase I study of MORAb-004, a monoclonal antibody to endosialin in patients with advanced solid tumors. Clin Cancer Res 2015 Mar 15;21 (6): 1281- 8.
(17) Naylor AJ, Azzam E, Smith S, Croft A, Poyser C, Duffield JS, et al. The mesenchymal stem cell marker CD248 (endosialin) is a negative regulator of bone formation in mice. Arthritis Rheum 2012 Oct;64(10):3334-43.
(18) Opavsky R, Haviernik P, Jurkovicova D, Garin MT, Copeland NG, Gilbert DJ, et al.
Molecular characterization of the mouse Tem1/endosialin gene regulated by cell density in vitro and expressed in normal tissues in vivo. J Biol Chem 2001 Oct 19;276(42):38795-807.
(19) Guan EN, Burgess WH, Robinson SL, Goodman EB, McTigue KJ, Tenner AJ.
Phagocytic cell molecules that bind the collagen-like region of C1q. Involvement in the C1 q-mediated enhancement of phagocytosis. J Biol Chem 1991 Oct 25;266(30):20345-55.
(20) Bohlson SS, Silva R, Fonseca Ml, Tenner AJ. CD93 is rapidly shed from the surface of human myeloid cells and the soluble form is detected in human plasma. J Immunol 2005 Jul 15;175(2): 1239-47.
(21) Christian S, Ahorn H, Novatchkova M, Garin-Chesa P, Park JE, Weber G, et al.
Molecular cloning and characterization of EndoGlyx-1 , an EMILIN-like multisubunit glycoprotein of vascular endothelium. J Biol Chem 2001 Dec 21 ;276(51):48588- 95.
(22) O'callaghan CA, Byford MF, Wyer JR, Willcox BE, Jakobsen BK, McMichael AJ, et al. BirA enzyme: production and application in the study of membrane receptor- ligand interactions by site-specific biotinylation. Anal Biochem 1999 Jan 1 ;266(1):9- 15.
(23) Yang J, Yan R, Roy A, Xu D, Poisson J, Zhang Y. The l-TASSER Suite: protein structure and function prediction. Nat Methods 2015 Jan; 12(1 ):7-8.
(24) Zelensky AN, Gready JE. The C-type lectin-like domain superfamily. FEBS J 2005 Dec;272(24):6179-217.
(25) Kastrup JS, Nielsen BB, Rasmussen H, Holtet TL, Graversen JH, Etzerodt M, et al. Structure of the C-type lectin carbohydrate recognition domain of human tetranectin. Acta Crystallogr D Biol Crystallogr 1998 Sep 1 ;54(Pt 5):757-66.
(26) Ki MK, Jeoung MH, Choi JR, Rho SS, Kwon YG, Shim H, et al. Human antibodies targeting the C-type lectin-like domain of the tumor endothelial cell marker clec14a regulate angiogenic properties in vitro. Oncogene 2013 Nov 28;32(48):5449-57.
(27) Lee S.M, Ki M.K, Jeoung MH, Choi J.R, inventors; Novel antibody specific for clec14a and uses thereof.WO2013187724 A1. 2013 Dec 19.
(28) Lorenzon E, Colladel R, Andreuzzi E, Marastoni S, Todaro F, Schiappacassi M, et al. MULTIMERIN2 impairs tumor angiogenesis and growth by interfering with VEGF-A/VEGFR2 pathway. Oncogene 2012 Jun 28;31 (26):3136-47.
(29) Donovan D, Brown NJ, Bishop ET, Lewis CE. Comparison of three in vitro human 'angiogenesis' assays with capillaries formed in vivo. Angiogenesis 2001 ;4(2): 113- 21.
McGreal EP, Ikewaki N, Akatsu H, Morgan BP, Gasque P. Human C1qRp is identical with CD93 and the mNI-1 1 antigen but does not bind C1q. J Immunol 2002 May 15; 168(10):5222-32.
Petrenko O, Beavis A, Klaine M, Kittappa R, Godin I, Lemischka IR. The molecular characterization of the fetal stem cell marker AA4. Immunity 1999 Jun; 10(6):691- 700.
Bao L, Tang M, Zhang Q, You B, Shan Y, Shi S, et al. Elevated expression of CD93 promotes angiogenesis and tumor growth in nasopharyngeal carcinoma. Biochem Biophys Res Commun 2016 Aug 5;476(4):467-74.
Tomkowicz B, Rybinski K, Foley B, Ebel W, Kline B, Routhier E, et al. Interaction of endosialin/TEM1 with extracellular matrix proteins mediates cell adhesion and migration. Proc Natl Acad Sci U S A 2007 Nov 13; 104(46): 17965-70.
Colladel R, Pellicani R, Andreuzzi E, Paulitti A, Tarticchio G, Todaro F, et al. MULTIMERIN2 binds VEGF-A primarily via the carbohydrate chains exerting an angiostatic function and impairing tumor growth. Oncotarget 2015 Dec 9.
Nepomuceno RR, Tenner AJ. C1qRP, the C1 q receptor that enhances phagocytosis, is detected specifically in human cells of myeloid lineage, endothelial cells, and platelets. J Immunol 1998 Feb 15; 160(4): 1929-35.
Aricescu AR, Lu W, Jones EY. A time- and cost-efficient system for high-level protein production in mammalian cells. Acta Crystallogr D Biol Crystallogr 2006 Oct;62(Pt 10): 1243-50.
Wilson E, Leszczynska K, Poulter NS, Edelmann F, Salisbury VA, Noy PJ, et al. RhoJ interacts with the GIT-PIX complex and regulates focal adhesion disassembly. J Cell Sci 2014 Jul 15; 127(Pt 14):3039-51.
Kaur S, Leszczynska K, Abraham S, Scarcia M, Hiltbrunner S, Marshall CJ, et al. RhoJ/TCL regulates endothelial motility and tube formation and modulates actomyosin contractility and focal adhesion numbers. Arterioscler Thromb Vase Biol 201 1 Mar;31 (3):657-64.
Simossis VA, Heringa J. PRALINE: a multiple sequence alignment toolbox that integrates homology-extended and secondary structure information. Nucleic Acids Res 2005 Jul 1 ;33(Web Server issue):W289-W294.
Claims
1. An agent that modulates the interaction between CD248 and multimerin 2 (MMRN2).
2. An agent according to Claim 1 wherein the agent inhibits or enhances the interaction between CD248 and MMRN2.
3. An agent according to Claim 2 wherein the agent inhibits the interaction between CD248 and MMRN2.
4. An agent according to any of Claims 1-3, wherein the agent is a polypeptide, a peptide, an antibody a polynucleotide, a peptidomimetic, a natural product, a carbohydrate, an aptamer or a small molecule.
5. An agent according to Claim 4, wherein the agent is a polypeptide, a peptide, an antibody or a peptidomimetic.
6. An agent according to any of Claims 1-5, wherein the agent is one which binds to CD248.
7. An agent according to Claim 6, wherein the agent is one that binds to the MMRN2 binding region of CD248.
8. An agent according to Claims 6 or 7, wherein the agent is one that binds to the extracellular domain of CD248.
9. An agent according to any of Claims 6-8, wherein the agent is one that binds to the C-type lectin Domain (CTLD) of CD248.
10. An agent according to Claim 9, wherein the CTLD of CD248 corresponds to the region spanning amino acid residues 30-156 of the human CD248 polypeptide.
1 1. An agent according to any of Claims 1-10, wherein the agent is a portion of MMRN2 or, a variant thereof.
12. An agent according to Claim 1 1 , wherein the portion of MMRN2 comprises or consists of the coiled-coil domain of MMRN2, or part thereof.
13. An agent according to Claim 12, wherein the coiled-coil domain of MMRN2 corresponds to the region spanning amino acid residues 133-820 of the human MMRN2 polypeptide.
14. An agent according to any of Claims 1 1-13, wherein the portion of MMRN2 comprises or consists of a region of MMRN2 corresponding to the region spanning amino acid residues 133-486 of human MMRN2, or a part thereof.
15. An agent according to any of Claims 11-14, wherein the portion of MMRN2 does not comprise or consist of a region of MMRN2 corresponding to the region spanning amino acids residues 487-820 of human MMRN2, or part thereof.
16. An agent according to any of Claims 11-15, wherein the portion is 400 amino acids in length or less, such as 350 amino acids or less, or 300 amino acids or less, or 250 amino acids or less, or 200 amino acids or less, or 150 amino acids or less, or 100 amino acids or less.
17. An agent according to any of Claims 1 1-16, wherein the portion has at least 30% sequence identity to the amino acid sequence of the corresponding portion of human MMRN2.
18. An agent according to any of Claims 1 1-17, wherein the portion comprises or consists of the amino acid sequence of any of the MMRN2 portions listed in Figure 6, or any part or variant of said portions.
19. An agent according to any of Claims 1 1-18, wherein the portion is a portion of a variant of MMRN2.
20. An agent according to Claim 19, wherein the variant of MMRN2 has at least 30% sequence identity to the amino acid sequence of human MMRN2.
21. An agent according to any of Claims 1-5, wherein the agent is one which binds to MMRN2.
22. An agent according to Claim 21 , wherein the agent is one that binds to the CD248 binding region of the MMRN2 polypeptide.
23. An agent according to any of Claims 21 or 22, wherein the agent is one that binds to the coiled-coil domain of the MMRN2 polypeptide or part thereof.
24. An agent according to any of Claims 21-23, wherein the agent is one that binds to a region spanning amino acids 133-486 of MMRN2.
25. An agent according to any of Claims 21-24, wherein the agent is one that does not bind to a region spanning amino acids 487-820 of MMRN2.
26. An agent according to any of Claims 1-5 and 21-25, wherein the agent is a portion of CD248.
27. An agent according to Claim 26, wherein the portion of CD248 comprises or consists of the CTLD of CD248, or part thereof, optionally wherein the CTLD of CD248 corresponds to amino acid residues 30-156 of human CD248.
28. An agent according to Claim 26 or 27, wherein the portion is 400 amino acids in length or less, such as 350 amino acids or less, or 300 amino acids or less, or 250 amino acids or less, or 200 amino acids or less, or 150 amino acids or less, or 100 amino acids or less.
29. An agent according to any of Claims 26-28, wherein the portion has at least 30% sequence identity to the amino acid sequence of the corresponding portion of human CD248.
30. An agent according to any of Claims 26-29, wherein the portion comprises or consists of the amino acid sequence of any of the CD248 portions listed in Figure 9, or any part or variant of said portions.
31. An agent according to any of Claims 26-30, wherein the portion is a portion of a variant of CD248.
32. An agent according to Claim 31 , wherein the variant of CD248 has at least 30% sequence identity to the amino acid sequence of human CD248.
33. An agent according to any of Claims 1-32, wherein the agent does not modulate the MMRN2/CD93 or MMRN2/CLEC14A interaction.
34. An agent according to any of Claims 11-20, wherein the portion of MMRN2 does not bind to CD93 and/or CLEC14A.
35. A portion of MMRN2 or a variant thereof, that binds to CD248.
36. A portion of MMRN2 or variant thereof according to Claim 35, wherein the portion has the property as defined in any of Claims 1-3 and 6-10.
37. A portion of MMRN2 or variant thereof according to Claim 35 or 36, wherein the portion is as defined in any of Claims 1 1-20.
38. A portion of CD248 or a variant thereof, that binds to MMRN2.
39. A portion of CD248 or variant thereof according to Claim 38, wherein the portion has the property as defined in any of Claims 1-3 and 21-25.
40. A portion of CD248 or variant thereof according to Claim 38 or 39, wherein the portion is as defined in any of Claims 26-32.
41. A portion of MMRN2 according to any of Claims 35-37, or a portion of CD248 according to any of Claims 38-40, wherein the portion comprises a stabilising moiety at one or both termini.
42. A portion of MMRN2 or CD248 according to Claim 41 , wherein the stabilising moiety is any of a amido, acetyl, benzyl, phenyl, tosyl, alkoxycarbonyl, alkyl carbonyl, or benzyloxycarbonyl moiety.
43. An agent according to any of Claims 1-34, or a portion of MMRN2 according to any of Claims 35-37 or 41-42, or a portion of CD248 according to any of Claims 38-42, wherein the agent or portion modulates angiogenesis in an angiogenesis assay, optionally wherein the angiogenesis assay is an aortic ring assay, a sponge angiogenesis assay, an assay of endothelial cell proliferation, an assay of endothelial cell migration and/or an assay of endothelial cell invasion.
44. An agent according to any of Claims 1-34, or a portion of MMRN2 according to any of Claims 35-37 or 41-42, or a portion of CD248 according to any of Claims 38-42, wherein the agent or portion modulates tumour growth in an assay of tumour growth.
45. A fusion protein comprising a portion of MMRN2 according to any of Claims 35-37 or 41-42, wherein the fusion protein does not comprise wild type MMRN2.
46. A fusion protein comprising a portion of CD248 according to any of Claims 38-42, wherein the fusion protein does not comprise wild type CD248.
47. An antibody that binds to a portion of MMRN2 according to any of Claims 35-37 or 41-42.
48. An antibody according to Claim 47, wherein the antibody binds to the coiled-coil domain of MMRN2, or part thereof, optionally wherein the coiled-coil domain of MMRN2 corresponds to amino acid residues 133-820 of human MMRN2.
49. An antibody according to Claim 48 wherein the antibody binds to a region of MMRN2 corresponding to the region spanning amino acid residues 133-486 of human
MMRN2, or a part thereof.
50. An antibody according to Claim 49 wherein the antibody does not bind to a region of MMRN2 corresponding to the region spanning amino acid residues 487-820 of human MMRN2, or a part thereof.
51. An antibody that binds to a portion of CD248 according to any of Claims 31-35.
52. An antibody according to Claim 51 , wherein the antibody binds to the CTLD of CD248, or part thereof, optionally wherein the CTLD of CD248 corresponds to amino acid residues 30-156 of human CD248.
53. An antibody according to Claim 52 wherein the antibody does not bind to a region of CD248 corresponding to the region spanning amino acid residues 157-757 of human CD248, or a part thereof.
54. A nucleic acid molecule encoding the agent of any of Claims 5-34, or a portion of MMRN2 according to any of Claims 35-37 or 41 -42, or a portion of CD248 according to any of Claims 38-42, or the fusion protein of Claim 45 or 46, or the antibody of any of any of Claims 47-53.
55. A vector, such as an expression vector, comprising the nucleic acid molecule of Claim 54.
56. A host cell comprising the nucleic acid molecule of Claim 54 or the vector of Claim 55.
57. A compound comprising (i) an agent of any of Claims 4-34, or a portion of MMRN2 according to any of Claims 35-37 or 41-42, or a portion of CD248 according to any of Claims 38-42 and (ii) a detectable moiety.
58. A compound according to Claim 57, wherein the detectable moiety comprises an enzyme, a radioactive atom, a fluorescent moiety, a chemiluminescent moiety or a bioluminescent moiety.
59. A compound according to Claim 58, wherein the detectable moiety comprises an affinity tag, such as a histidine tag or an Fc tag or a BirA tag.
60. A compound comprising (i) an agent of any of Claims 6-34, or a portion of MMRN2 according to any of Claims 35-37 or 41-42, or a portion of CD248 according to any of Claims 38-42 and (ii) a cytotoxic moiety.
61. A compound according to Claim 60 wherein the cytotoxic moiety is selected from a directly cytotoxic chemotherapeutic agent, a directly cytotoxic polypeptide, a moiety which is able to convert a prodrug into a cytotoxic drug, a radiosensitizer, a directly cytotoxic nucleic acid, an antibody (eg an antibody that binds to a cytotoxic immune cell such as a T cell) a nucleic acid molecule that encodes a directly or indirectly cytotoxic polypeptide, or a radioactive atom.
62. A compound according to Claim 61 wherein the radioactive atom is phosphorus- 32, iodine-125, iodine-131 , indium-1 1 1 , rhenium-186, rhenium-188 or yttrium-90.
63. A chimeric antigen receptor (CAR) comprising (a) a portion of MMRN2 according to any of Claims 35-37 or 41-42; (b) a transmembrane domain; and (c) an intracellular signalling domain.
64. A CAR according to Claim 63, wherein the portion of MMRN2 is as defined in any of Claims 23-33.
65. A CAR according to Claim 63 or 64, wherein the transmembrane domain comprises the transmembrane domain of a protein, optionally wherein the transmembrane domain of the protein is selected from the group consisting of the alpha, beta or zeta chain of the T- cell receptor, CD28, CD3 epsilon, CD8, CD45 and CD4.
66. A CAR according to any of Claims 63-65, wherein the portion of MMRN2 is connected to the transmembrane domain by a hinge region.
67. A CAR according to any of Claims 63-66, wherein the intracellular signalling domain comprises one or more immunoreceptor tyrosine-based activation motifs (ITAMs).
68. A CAR according to any of Claims 63-67, wherein the intracellular signalling domain comprises a signalling domain of CD3 zeta, Fc receptor gamma, Fc receptor beta,
CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b and CD66d.
69. A CAR according to any of Claims 63-68, wherein the CAR further comprises one or more costimulatory domains.
70. A CAR according to Claim 69, wherein the costimulatory domain is a functional signalling domain obtained from a protein selected from the group consisting of CD28, 41 BB, OX40, ICOS and DAP10.
71. A CAR according to any of Claim 63-70, wherein the intracellular portion of the CAR comprising the signalling domain of CD3 zeta and the signalling domain of CD28.
72. A CAR according to any of Claims 63-71 , wherein the CAR further comprises a leader sequence.
73. A CAR according to Claim 63-72, wherein the leader sequence comprises the oncostatin M leader sequence MGVLLTQRTLLSLVLALLFPSMAS.
74. A nucleic acid molecule encoding the CAR of any of Claims 63-73.
75. A vector comprising a nucleic acid molecule of Claim 74.
76. A cell comprising the nucleic acid molecule of Claim 74 or the vector of Claim 75.
77. A cell comprising a CAR according to any of Claims 63-73.
78. A method of producing a cell comprising introducing a nucleic acid molecule of Claim 74 or the vector of Claim 75 into a cell.
79. A cell according to Claim 76 or 77 or a method according to Claim 78, wherein the cell is a T cell or natural killer cell.
80. A pharmaceutical composition comprising an agent of any of Claims 1-34, or a portion of MMRN2 according to any of Claims 35-37 or 41-42, or a portion of CD248 according to any of Claims 38-42, a fusion protein according to Claim 45 or 46, an antibody according to any of Claims 47-53, a nucleic acid molecule according to Claim 54 or 74, a vector according to Claim 55 or 75, a cell according to any of Claims 56, 76, 77 or 79, a compound according to any of Claims 57-62, or a CAR according to any of Claims 63-73; and a pharmaceutically acceptable diluent, carrier or excipient.
81. A composition comprising an agent of any of Claims 1-34, or a portion of MMRN2 according to any of Claims 35-37 or 41-42, or a portion of CD248 according to any of
Claims 38-42, a fusion protein according to Claim 45 or 46, an antibody according to any of Claims 47-53, a nucleic acid molecule according to Claim 54 or 74, a vector according to Claim 55 or 75, a cell according to any of Claims 56, 76, 77 or 79, a compound according to any of Claims 57-62, or a CAR according to any of Claims 63-73; which composition further comprises at least one additional anti-cancer agent and/or at least one additional anti-angiogenic agent.
82. An agent of any of Claims 1-34, or a portion of MMRN2 according to any of Claims 35-37 or 41-42, or a portion of CD248 according to any of Claims 38-42, a fusion protein according to Claim 45 or 46, an antibody according to any of Claims 47-53, a nucleic acid molecule according to Claim 54 or 74, a vector according to Claim 55 or 75, a cell
according to any of Claims 56, 76, 77 or 79, a compound according to any of Claims 57- 62, or a CAR according to any of Claims 63-73; for use in medicine.
83. A method of modulating angiogenesis in an individual, the method comprising administering to the individual an agent of any of Claims 1-34, or a portion of MMRN2 according to any of Claims 35-37 or 41-42, or a portion of CD248 according to any of Claims 38-42, a fusion protein according to Claim 45 or 46, an antibody according to any of Claims 47-53, a nucleic acid molecule according to Claim 54 or 74, a vector according to Claim 55 or 75, a cell according to any of Claims 56, 76, 77 or 79, a compound according to any of Claims 57-62, or a CAR according to any of Claims 63-73.
84. An agent of any of Claims 1-34, or a portion of MMRN2 according to any of Claims 35-37 or 41-42, or a portion of CD248 according to any of Claims 38-42, a fusion protein according to Claim 45 or 46, an antibody according to any of Claims 47-53, a nucleic acid molecule according to Claim 54 or 74, a vector according to Claim 55 or 75, a cell according to any of Claims 56, 76, 77 or 79, a compound according to any of Claims 57- 62, or a CAR according to any of Claims 63-73; for use in modulating angiogenesis in an individual.
85. Use of an agent of any of Claims 1-34, or a portion of MMRN2 according to any of Claims 35-37 or 41-42, or a portion of CD248 according to any of Claims 38-42, a fusion protein according to Claim 45 or 46, an antibody according to any of Claims 47-53, a nucleic acid molecule according to Claim 54 or 74, a vector according to Claim 55 or 75, a cell according to any of Claims 56, 76, 77 or 79, a compound according to any of Claims 57-62, or a CAR according to any of Claims 63-73; in the preparation of a medicament for modulating angiogenesis in an individual.
86. A method of combating a disease or condition in an individual, selected from the group consisting of cancer, psoriasis, menorrhagia, endometriosis, arthritis (both inflammatory and rheumatoid), macular degeneration, Paget's disease, retinopathy and its vascular complications (including proliferative and of prematurity, and diabetic retinopathy), benign vascular proliferations, fibroses, obesity and inflammation, the method comprising administering to the individual an agent of any of Claims 1-34, or a portion of MMRN2 according to any of Claims 35-37 or 41-42, or a portion of CD248 according to any of Claims 38-42, a fusion protein according to Claim 45 or 46, an antibody according to any of Claims 47-53, a nucleic acid molecule according to Claim 54 or 74, a
vector according to Claim 55 or 75, a cell according to any of Claims 56, 76, 77 or 79, a compound according to any of Claims 57-62, or a CAR according to any of Claims 63-73.
87. Use of an agent of any of Claims 1-34, or a portion of MMRN2 according to any of Claims 35-37 or 41-42, or a portion of CD248 according to any of Claims 38-42, a fusion protein according to Claim 45 or 46, an antibody according to any of Claims 47-53, a nucleic acid molecule according to Claim 54 or 74, a vector according to Claim 55 or 75, a cell according to any of Claims 56, 76, 77 or 79, a compound according to any of Claims 57-62, or a CAR according to any of Claims 63-73, in the preparation of a medicament for combating a disease or condition in an individual selected from the group consisting of cancer, psoriasis, menorrhagia, endometriosis, arthritis (both inflammatory and rheumatoid), macular degeneration, Paget's disease, retinopathy and its vascular complications (including proliferative and of prematurity, and diabetic retinopathy), benign vascular proliferations, fibroses, obesity and inflammation.
88. An agent according to any of Claims an agent of any of Claims 1-34, or a portion of MMRN2 according to any of Claims 35-37 or 41-42, or a portion of CD248 according to any of Claims 38-42, a fusion protein according to Claim 45 or 46, an antibody according to any of Claims 47-53, a nucleic acid molecule according to Claim 54 or 74, a vector according to Claim 55 or 75, a cell according to any of Claims 56, 76, 77 or 79, a compound according to any of Claims 57-62, or a CAR according to any of Claims 63-73; for use in the preparation of a medicament for combating a disease or condition in an individual selected from the group consisting of cancer, psoriasis, menorrhagia, endometriosis, arthritis (both inflammatory and rheumatoid), macular degeneration, Paget's disease, retinopathy and its vascular complications (including proliferative and of prematurity, and diabetic retinopathy), benign vascular proliferations, fibroses, obesity and inflammation.
89. A method of targeting a cytotoxic moiety to neovasculature in the body of an individual, the method comprising:
administering to the individual a compound comprising (i) an agent of any of Claims
6-34, or a portion of MMRN2 according to any of Claims 35-37 or 41-42, or a portion of CD248 according to any of Claims 38-42; and (ii) a cytotoxic moiety.
90. A compound comprising (i) an agent of any of Claims 6-34, or a portion of MMRN2 according to any of Claims 35-37 or 41-42, or a portion of CD248 according to any of
Claims 38-42; and (ii) a cytotoxic moiety, for use in targeting a cytotoxic moiety to neovasculature in the body of an individual.
91. Use of a compound comprising (i) an agent of any of Claims 6-34, or a portion of MMRN2 according to any of Claims 35-37 or 41-42, or a portion of CD248 according to any of Claims 38-42; and (ii) a cytotoxic moiety, in the preparation of a medicament for targeting a cytotoxic moiety to neovasculature in the body of an individual.
92. A method according to any of Claims 83, 86 and 89 or a use according to any of Claims 82, 84, 85, 87, 88, 90 and 91 wherein at least one further anticancer agent and/or at least one further anti-angiogenesis agent is administered to the individual.
93. A method according to any of Claims 83, 86, 89 and 92, or a use according to any of Claims 82, 84, 85, 87, 88, 90 and 91 wherein the individual is one who is administered at least one further anticancer agent and/or at least one further anti-angiogenesis agent.
94. A method or use according to Claim 92 or 93, wherein the at least one further anticancer agent is selected from cisplatin; carboplatin; 5-flurouracil; paclitaxel; mitomycin C; doxorubicin; gemcitabine; tomudex; pemetrexed; methotrexate; irinotecan, fluorouracil and leucovorin; oxaliplatin, 5-fluorouracil and leucovorin; and paclitaxel and carboplatin and/or wherein the at least one further anti-angiogenesis agent is bevacizumab (Avastin®).
95. A method of imaging neovasculature in the body of an individual the method comprising:
administering to the individual a compound comprising (i) an agent of any of Claims 6-34, or a portion of MMRN2 according to any of Claims 35-37 or 41-42, or a portion of CD248 according to any of Claims 38-42; and (ii) a detectable moiety, and
imaging the detectable moiety in the body.
96. A method according to Claim 95 further comprising the step of detecting the location of the compound in the individual.
97. A method according to Claim 95 or 96 wherein the detectable moiety comprises iodine-123, iodine-131 , indium-1 11 , fluorine-19, carbon-13, nitrogen-15, oxygen-17, technetium-99m, gadolinium, manganese or iron.
98. A method or use according to any of the preceding claims wherein the individual is a human.
99. A method or a use according to any of the preceding claims wherein the individual has a solid tumour.
100. A method or a use according to Claim 99, wherein the solid tumour is a tumour of the colon, rectum, ovary, liver, bladder, prostate, breast, kidney, pancreas, stomach, oesophagus, lung or thyroid.
101. An ex vivo or in vitro method of modulating angiogenesis, the method comprising administering an agent of any of Claims 1-34, or a portion of MMRN2 according to any of Claims 35-37 or 41-42, or a portion of CD248 according to any of Claims 38-42, or an antibody according to any of Claims 47-53, to endothelial cells or to an angiogenesis model, ex vivo or in vitro.
102. A complex comprising:
(i) MMRN2 or a portion or variant thereof, said portion or variant being capable of binding to CD248; and
(ii) CD248 or a portion or variant thereof, said portion or variant being capable of binding to MMRN2.
103. A kit of parts comprising:
(i) MMRN2 or a portion or variant thereof, said portion or variant being capable of binding to CD248; and
(ii) CD248 or a portion or variant thereof, said portion or variant being capable of binding to MMRN2.
104. A complex according to Claim 102, or a kit according to Claim 103, further comprising CLEC14A and/or CD93.
105. A kit of parts according to Claim 103, further comprising a test agent.
106. A kit of parts according to Claim 105, wherein the test agent is a candidate modulator of the interaction between MMRN2 and CD248.
107. A nucleic acid molecule capable of expressing:
(i) MMRN2 or a portion or variant thereof, said portion or variant being capable of binding to CD248; and
(ii) CD248 or a portion or variant thereof, said portion or variant being capable of binding to MMRN2.
108. A nucleic acid molecule according to Claim 107, capable of further expressing CLEC14A or a portion or variant thereof, said portion or variant being capable of binding to MMRN2, and/or CD93 or a portion or variant thereof, said portion or variant being capable of binding to MMRN2.
109. A complex according to any of Claims 102 or 104, or a kit according to any of Claims 103 and 105-106, or a nucleic acid molecule according to any of Claims 107-108, wherein MMRN2 or a portion or variant thereof, is as defined in Claims 35-37 or 41-42 and/or wherein CD248 or a portion or variant thereof is as defined in any of Claims 38-42.
1 10. A mutant MMRN2 polypeptide which has reduced or enhanced binding to CD248 relative to wild type MMRN2.
1 11. A mutant MMRN2 polypeptide according to Claim 1 10, wherein the mutant MMRN2, when compared to the corresponding wild type MMRN2, comprises one or more different amino acids in the region of MMRN2 corresponding to the region spanning amino acid residues 133-486 of human MMRN2.
1 12. A mutant CD248 polypeptide which has reduced or enhanced binding to MMRN2 relative to wild type CD248.
1 13. A mutant CD248 polypeptide according to Claim 1 12, wherein the mutant CD248, when compared to the corresponding wild type CD248, comprises one or more different amino acids in the region of CD248 corresponding to the region spanning amino acid residues 30-156 of human CD248.
1 14. A nucleic acid molecule encoding the mutant MMRN2 polypeptide of Claim 110 or 1 11 or the mutant CD248 polypeptide of Claim 112 or 1 13.
1 15. A vector, such as an expression vector, comprising a nucleic acid molecule of Claim 1 14.
1 16. A cell comprising the nucleic acid molecule of Claim 114 or the vector of Claim 1 15.
1 17. A kit of parts comprising: (i) an agent of any of Claims 3-34, or a portion of MMRN2 according to any of Claims 35-37 or 41-42, or a portion of CD248 according to any of Claims 38-42, a fusion protein according to Claim 45 or 46, an antibody according to any of Claims 47-53, a nucleic acid molecule according to Claim 54 or 74, a vector according to Claim 55 or 75, a cell according to any of Claims 56, 76, 77 or 79, a compound according to any of Claims 57-62, or a CAR according to any of Claims 63-73, and (ii) at least one additional anti-cancer agent and/or at least one additional anti-angiogenic agent.
1 18. A kit of parts comprising: (i) an agent of any of Claims 3-34, or a portion of MMRN2 according to any of Claims 35-37 or 41-42, or a portion of CD248 according to any of
Claims 38-42, a fusion protein according to Claim 45 or 46, an antibody according to any of Claims 47-53, a nucleic acid molecule according to Claim 54 or 74, a vector according to Claim 55 or 75, a cell according to any of Claims 56, 76, 77 or 79, a compound according to any of Claims 57-62, or a CAR according to any of Claims 63-73; and (ii) a cytotoxic moiety, optionally wherein the cytotoxic moiety is as defined in Claim 45 or 46.
1 19. A kit of parts comprising (i) an agent of any of Claims 3-34, or a portion of MMRN2 according to any of Claims 35-37 or 41-42, or a portion of CD248 according to any of Claims 38-42, a fusion protein according to Claim 45 or 46, an antibody according to any of Claims 47-53, a nucleic acid molecule according to Claim 54 or 74, a vector according to Claim 55 or 75, a cell according to any of Claims 56, 76, 77 or 79, a compound according to any of Claims 57-62, or a CAR according to any of Claims 63-73; and (ii) a detectable moiety, optionally wherein the detectable moiety is as defined in Claim 42 or 43.
120. A method of identifying an agent that modulates the interaction between CD248 and MMRN2, the method comprising:
providing MMRN2 or a portion or variant thereof, said portion or variant being capable of binding to CD248;
providing CD248 or a portion or variant thereof, said portion or variant being capable of binding to MMRN2;
providing a candidate agent; and
determining whether the candidate agent modulates binding of MMRN2 or the portion or variant thereof, to CD248, or the portion or variant thereof.
121. A method according to Claim 120, wherein the candidate agent is an antibody, a peptide, a peptidomimetic, a natural product, a carbohydrate, an aptamer or a small molecule.
122. A method according to Claim 120 or 121 , wherein the method is used to identify an agent that may be useful in modulating angiogenesis or in combating cancer, or a lead compound for the identification of an agent that may be useful in modulating angiogenesis or in combating cancer.
123. A method according to any of Claim 120-122, wherein the agent is a portion of MMRN2 or a variant thereof.
124. A method according to any of Claim 120-122, wherein the agent is a portion of CD248 or a variant thereof.
125. A method according to any of Claims 120-124, further comprising the step of testing the candidate portion or agent in an angiogenesis assay.
126. A method for preparing an anticancer compound or anti-angiogenesis compound that may be useful in the treatment of a solid tumour, the method comprising identifying a compound using the method according to any of Claims 120 -124, and synthesising, purifying and/or formulating the identified compound.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GBGB1702926.5A GB201702926D0 (en) | 2017-02-23 | 2017-02-23 | Modulators |
| GB1702926.5 | 2017-02-23 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2018154307A1 true WO2018154307A1 (en) | 2018-08-30 |
Family
ID=58544189
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/GB2018/050466 Ceased WO2018154307A1 (en) | 2017-02-23 | 2018-02-22 | Modulators of the interaction of cd248 with its ligand multimerin 2 |
Country Status (2)
| Country | Link |
|---|---|
| GB (1) | GB201702926D0 (en) |
| WO (1) | WO2018154307A1 (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1995031482A1 (en) * | 1994-05-17 | 1995-11-23 | Ludwig Institute For Cancer Research | Monoclonal antibody specific for vascular endothelial cell antigen endoglyx-1, the antigen itself, and uses thereof |
| WO2006017759A2 (en) * | 2004-08-05 | 2006-02-16 | Kirin Brewery Co., Ltd. | Tumor endothelial marker-1 (tem1) binding antibodies and uses thereof |
| WO2008124570A1 (en) * | 2007-04-05 | 2008-10-16 | Morphotek, Inc. | Methods for inhibiting the binding of endosialin to ligands |
| US20130078242A1 (en) * | 2005-04-22 | 2013-03-28 | Morphotek, Inc. | Antibodies With Immune Effector Activity And That Internalize In Endosialin-Positive Cells |
-
2017
- 2017-02-23 GB GBGB1702926.5A patent/GB201702926D0/en not_active Ceased
-
2018
- 2018-02-22 WO PCT/GB2018/050466 patent/WO2018154307A1/en not_active Ceased
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1995031482A1 (en) * | 1994-05-17 | 1995-11-23 | Ludwig Institute For Cancer Research | Monoclonal antibody specific for vascular endothelial cell antigen endoglyx-1, the antigen itself, and uses thereof |
| WO2006017759A2 (en) * | 2004-08-05 | 2006-02-16 | Kirin Brewery Co., Ltd. | Tumor endothelial marker-1 (tem1) binding antibodies and uses thereof |
| US20130078242A1 (en) * | 2005-04-22 | 2013-03-28 | Morphotek, Inc. | Antibodies With Immune Effector Activity And That Internalize In Endosialin-Positive Cells |
| WO2008124570A1 (en) * | 2007-04-05 | 2008-10-16 | Morphotek, Inc. | Methods for inhibiting the binding of endosialin to ligands |
Non-Patent Citations (10)
| Title |
|---|
| DANIEL J O'SHANNESSY ET AL: "Novel antibody probes for the characterization of endosialin/TEM-1", ONCOTARGET, 7 November 2015 (2015-11-07), XP055464393, Retrieved from the Internet <URL:http://www.oncotarget.com/index.php?journal=oncotarget&page=article&op=download&path%5B%5D=11018&path%5B%5D=34887> DOI: 10.18632/oncotarget.11018 * |
| E LORENZON ET AL: "MULTIMERIN2 impairs tumor angiogenesis and growth by interfering with VEGF-A/VEGFR2 pathway", ONCOGENE, vol. 31, no. 26, 24 October 2011 (2011-10-24), pages 3136 - 3147, XP055087577, ISSN: 0950-9232, DOI: 10.1038/onc.2011.487 * |
| ELEANOR J. CHEADLE ET AL: "CAR T cells: driving the road from the laboratory to the clinic", IMMUNOLOGICAL REVIEWS, vol. 257, no. 1, 13 December 2013 (2013-12-13), pages 91 - 106, XP055177342, ISSN: 0105-2896, DOI: 10.1111/imr.12126 * |
| HOLZINGER ASTRID ET AL: "The growing world of CAR T cell trials: a systematic review", CANCER IMMUNOLOGY, IMMUNOTHERAPY, SPRINGER, BERLIN/HEIDELBERG, vol. 65, no. 12, 9 September 2016 (2016-09-09), pages 1433 - 1450, XP036093939, ISSN: 0340-7004, [retrieved on 20160909], DOI: 10.1007/S00262-016-1895-5 * |
| KATHERINE RYBINSKI ET AL: "Targeting endosialin/CD248 through antibody-mediated internalization results in impaired pericyte maturation and dysfunctional tumor microvasculature", ONCOTARGET, vol. 6, no. 28, 4 July 2015 (2015-07-04), United States, pages 25429 - 25440, XP055293248, ISSN: 1949-2553, DOI: 10.18632/oncotarget.4559 * |
| L. A. DIAZ ET AL: "A First-in-Human Phase I Study of MORAb-004, a Monoclonal Antibody to Endosialin in Patients with Advanced Solid Tumors", CLINICAL CANCER RESEARCH, vol. 21, no. 6, 14 November 2014 (2014-11-14), US, pages 1281 - 1288, XP055464394, ISSN: 1078-0432, DOI: 10.1158/1078-0432.CCR-14-1829 * |
| ROBERTA COLLADEL ET AL: "MULTIMERIN2 binds VEGF-A primarily via the carbohydrate chains exerting an angiostatic function and impairing tumor growth", ONCOTARGET, vol. 7, no. 2, 12 January 2016 (2016-01-12), XP055464398, DOI: 10.18632/oncotarget.6515 * |
| S. KONTSEKOVA ET AL: "Endosialin: molecular and functional links to tumor angiogenesis", NEOPLASMA, 11 January 2016 (2016-01-11), XP055464703, DOI: 10.4149/202_15090N474 * |
| SVEN CHRISTIAN ET AL: "Molecular Cloning and Characterization of EndoGlyx-1, an EMILIN-like Multisubunit Glycoprotein of Vascular Endothelium", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 276, no. 51, 21 December 2001 (2001-12-21), US, pages 48588 - 48595, XP055464705, ISSN: 0021-9258, DOI: 10.1074/jbc.M106152200 * |
| SVEN CHRISTIAN ET AL: "Molecular Cloning and Characterization of Endosialin, a C-type Lectin-like Cell Surface Receptor of Tumor Endothelium", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 276, no. 10, 17 November 2000 (2000-11-17), US, pages 7408 - 7414, XP055465338, ISSN: 0021-9258, DOI: 10.1074/jbc.M009604200 * |
Also Published As
| Publication number | Publication date |
|---|---|
| GB201702926D0 (en) | 2017-04-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11242388B2 (en) | ROR1 antibody compositions and related methods | |
| US20190185532A1 (en) | Inhibitors | |
| US11919959B2 (en) | Inhibitors of the interaction between CLEC14A and multimerin-2 for inhibition of angiogenesis | |
| CN108884168B (en) | Antibodies and related molecules and uses thereof | |
| CA2889055C (en) | M971 chimeric antigen receptors | |
| AU2011305817B2 (en) | Anti-SSX-2 T cell receptors and related materials and methods of use | |
| JP2023178323A (en) | Mesothelin and CD137 binding molecules | |
| JP7716623B2 (en) | Efflux pump-cancer antigen multispecific antibodies and compositions, reagents, kits and methods related thereto | |
| JP2026041756A (en) | Anti-MDR1 antibodies and uses thereof | |
| JP2026053316A (en) | Anti-ABCG2 antibodies and their use | |
| WO2018154307A1 (en) | Modulators of the interaction of cd248 with its ligand multimerin 2 | |
| US20230265185A1 (en) | Anti-cd22 single domain antibodies and therapeutic constructs | |
| CN116529267A (en) | ABCG2 efflux pump-cancer antigen multispecific antibodies and related compositions, reagents, kits and methods | |
| CN121511260A (en) | SLC4A4/NBCe1 inhibitors | |
| KR20230061429A (en) | Anti-ABCC1 Antibodies and Uses Thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18708461 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 18708461 Country of ref document: EP Kind code of ref document: A1 |
