WO2018150029A1 - Generation of monoclonal antibodies targeting respiratory syncytial virus (rsv) using regulatory b cells from newborns (nbregs) - Google Patents

Generation of monoclonal antibodies targeting respiratory syncytial virus (rsv) using regulatory b cells from newborns (nbregs) Download PDF

Info

Publication number
WO2018150029A1
WO2018150029A1 PCT/EP2018/054048 EP2018054048W WO2018150029A1 WO 2018150029 A1 WO2018150029 A1 WO 2018150029A1 EP 2018054048 W EP2018054048 W EP 2018054048W WO 2018150029 A1 WO2018150029 A1 WO 2018150029A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
rsv
nbregs
nbreg
fragments
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2018/054048
Other languages
French (fr)
Inventor
Richard Lo-Man
Xiaoming Zhang
Dania ZHIVAKI
Marie-Anne Rameix-Welti
Pierre TISSIERES
Jean-François ELEOUËT
Sabine Riffault
Hugo MOUQUET
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Assistance Publique Hopitaux de Paris APHP
Institut National de la Recherche Agronomique INRA
Institut National de la Sante et de la Recherche Medicale INSERM
Universite de Versailles Saint Quentin en Yvelines
Universite Paris Sud
Institut Pasteur
Original Assignee
Assistance Publique Hopitaux de Paris APHP
Institut National de la Recherche Agronomique INRA
Institut National de la Sante et de la Recherche Medicale INSERM
Universite de Versailles Saint Quentin en Yvelines
Universite Paris Sud
Institut Pasteur
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Assistance Publique Hopitaux de Paris APHP, Institut National de la Recherche Agronomique INRA, Institut National de la Sante et de la Recherche Medicale INSERM, Universite de Versailles Saint Quentin en Yvelines, Universite Paris Sud, Institut Pasteur filed Critical Assistance Publique Hopitaux de Paris APHP
Publication of WO2018150029A1 publication Critical patent/WO2018150029A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/08Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10RNA viruses
    • C07K16/11Paramyxoviridae (F); Pneumoviridae (F), e.g. respiratory syncytial virus [RSV]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man

Definitions

  • RSV Human respiratory syncytial virus
  • RSV infection holds a heavy clinical and economic burden in industrialized countries. Although most of RSV infections in infants are managed in ambulatory settings, 10% will require hospitalization and, with 1% requiring intensive care. Severe RSV infection is the first cause of epidemic lower respiratory tract infection among infants and represents 2-6% of all admissions to pediatric intensive care unit in developed countries (Deshpande and Northern, 2003). It is estimated that each hospitalization in pediatric intensive care for severe RSV infection cost between 28,000 and 92,000 US dollars (Howard et al., 2000; Katz et al., 2003). The most severe manifestations of RSV infection (pneumonia and bronchiolitis) occur in infants aged 2 to 6 months and will require mechanical ventilation and prolonged hospitalization in pediatric intensive care units.
  • RSV infection Since the 70' s, RSV infection has been suspected to be an important cause of illness in community-dwelling elderly people. Over the past 10 years, RSV infection was demonstrated to represent a major cause of respiratory illness in the elderly population (Falsey et al., 2005) as much as influenza infection for which this population is proposed for vaccination. RSV infection resulted in similar lengths of stay, rates of use of intensive care and death rate than influenza A following hospitalization (Falsey et al., 2005). No vaccine is available against RSV.
  • the invention pertains to methods for the production of antibodies specifics of an antigen of interest, which rely on the use of nBreg cells.
  • the invention further pertains to the monoclonal antibodies susceptible to be obtained with the method of the invention, as well as compositions comprising thereof, and their use as medicine.
  • the invention preferably encompasses compositions and methods for treating and preventing RSV infection of humans.
  • the invention encompasses methods for preparing a monoclonal antibody or fragments thereof that specifically bind to the RSV-F protein comprising isolating nBreg cells from a subject; selecting a nBreg cell that produces an IgM that specifically binds to the RSV-F protein; generating copies of the gene encoding the IgM or a fragment of the gene; producing monoclonal antibodies or fragments thereof by expression of the protein encoded by the copies; and isolating the monoclonal antibodies or fragments thereof that specifically bind to the RSV-F protein.
  • the copies are generated by the polymerase chain reaction.
  • the invention further encompasses the isolated monoclonal antibodies and fragments thereof produced by these methods.
  • the invention further encompasses a pharmaceutical composition
  • a pharmaceutical composition comprising a pharmaceutically acceptable carrier and an isolated monoclonal Ig or a fragment thereof that specifically binds to the RSV-F protein and an isolated monoclonal Ig or a fragment thereof that specifically binds to the RSV-F protein for treating or preventing infection of an RSV infection in a human.
  • the invention further encompasses the use of an isolated monoclonal Ig or a fragment thereof that specifically binds to the RSV-F protein to treat or prevent infection of an RSV infection in a human.
  • the invention further encompasses methods for treating or preventing infection of an RSV infection in a human comprising administering an isolated monoclonal Ig or a fragment thereof that specifically binds to the RSV-F protein to a human.
  • the isolated monoclonal Ig or a fragment thereof is produced by isolating nBreg cells from a subject; selecting a nBreg cell that produces an IgM that specifically binds to the RSV-F protein; generating copies of the gene encoding the IgM or a fragment of the gene; producing monoclonal antibodies or fragments thereof by expression of the protein encoded by the copies; and isolating the monoclonal antibodies or fragments thereof that specifically bind to the RSV-F protein.
  • Figure 1 A-E depicts Identification of phenotypic of new population of regulatory B cells in the human neonate (nBregs).
  • A-B CyTOF analysis of cord blood CD19 + B cells within CMBCs for lineage and B cell markers.
  • A Data analysis using viSNE based on 19 markers delineating phenotype CD10 CD5 " (1), CD10 + CD5 + (2) and CD10 " CD5 + (3).
  • B Heatmap analysis for data corresponding to the fold change expression of indicated markers for each subset as compared to the whole CD19 + CD20 + B cell population
  • C Cord blood B cell subsets were FACS sorted as, CD10 CD5 " (MN; blue), CD10 + CD5 + (EVIT; green) and CD10 " CD5 + (nBreg; red).
  • Neonatal naive CD4+ T cells were activated by anti-CD3 + anti-CD28 and cultured with 10 ng/ml IL-12 (Thl) or without (ThO), alone or in co-culture with HRSV- activated nBregs for 6 days.
  • A FACS plots and
  • B mean frequencies of TNF-a, IL-2, IFN- ⁇ , IL-13, IL-17 or IL-22 secreting cells, as determined by intracellular staining for 5 donors (Anova test).
  • Neonatal pDCs were stimulated with HRSV-A either alone or in co-culture with nBregs in the presence of neutralizing anti-IL-10 or control antibody (Ctrl) for 48 h. pDCs were FACS purified again before being used in TH differentiation assay.
  • D-E Intracellular IFN- ⁇ , IL-4, IL-17 and IL- 22 expression was analyzed by FACS and (F) secreted IFN- ⁇ analyzed in the supernatants by ELISA.
  • D-F Results are representatives of 3 experiments. Results are expressed as the means ⁇ SD. *p ⁇ 0.05, **p ⁇ 0.01, ** p ⁇ 0.001 and NS for non significant.
  • Figure 3 A-H depicts nBregs are preferentially infected by RSV.
  • A Representative plot of IL10 gene expression, as measured by qRT-PCR at Oh, 6h and 24h.
  • B 10 5 B cell subsets were FACS sorted as nBreg, MN or IMT and stimulated with rHRSV-Ch. mCherry expression was assessed by fluorescent microscopy at 48h post-infection (left panel) or by monitoring the red object count (R.O.C) through live imaging (right panel). Results are representative of 3-5 independent experiments.
  • C Representative FACS plot for intra-cellular IL-10 expression at 48h post-infection as compared to untreated cells (No stimulus).
  • H nBregs were stimulated or not with HRSV-A for 24h. IL10 + nBregs were then enriched using IL-10 enrichment beads, then FACS sorted IL10 + nBregs were used for fluorescent IgM ELISPOT. Left panel is a representative FACS plot following IL-10 enrichment and sorting purity. Right panel indicate the frequency of IgM cells. Results are expressed as the means ⁇ SD of triplicates. *p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001.
  • FIG. 4 A-E depicts RSV activates the BCR pathway.
  • nBregs were FACS-sorted as CD19 + CD5 + CD10 " B cells, and stimulated for 6h with algM, R848, HRSV-A, IAV or left unstimulated. Gene expression profiles were compared by microarray analysis for 3 independent donors.
  • C The list of differentially expressed genes (p ⁇ 0.05) was processed using the Ingenuity pathway analysis software. The list was then manually curated to remove pathways irrelevant to B cell biology. Canonical pathways were considered significant for p ⁇ 0.05 (red line).
  • D-E nBregs were activated for 30 min.
  • Figure 5 A-F depicts Ig from nBregs recognize RSV and display a biased repertoire.
  • D The mean CDR3 lengths was analyzed for the different IGHV, and a profile comparison is shown for IGHV3.
  • E The frequencies of different IGHJ usage among V3a (V3-15, 49, 72, 73) subfamily were determined.
  • Figure 6A-H depicts HRSV infects nBreg cells via CX3CR1-G protein interaction.
  • A-C FACS analysis of CX3CR1 expression in nBregs.
  • A Representative FACS plot of freshly isolated nBregs (MFI: 193 for Ab Ctrl, and 237 for CX3CR1 Ab) as compared to CD14 + monocytes (MFI: 9971).
  • D IL-10 production was measured by ELISA. Results are expressed as means ⁇ SD of 4 independent experiments.
  • E Phopshorylation of CD79a was assessed intracellularly by FACS in nBregs after 30 min. of exposure to AG RSV or WT RSV. Results are expressed means ⁇ SD of triplicates, and are representative of 3 experiments.
  • FIG. 1 Representative FACS plot (left panel) of nBregs infection with AG RSV or WT RSV, as compared to non-infected cells (none). Histogram plot shows the percentage of infected nBregs, as measured by FACS as % of mCherry+ cells (right panel) and is representative of 3 independent experiments.
  • G Viral replication measured through the detection of the mCherry fluorescence for 48h with AG as compared to WT counterpart. Results are expressed as means ⁇ SD of triplicates and are represent 3 independent experiments.
  • results are expressed as means +/- SD and represent three independent experiments. Unpaired t-test were used for comparison. Results are expressed as the means +/- SD. **p ⁇ 0.01, ***p ⁇ 0.001, ****p ⁇ 0.0001.
  • Figure 7 A-H depicts nBregs are infected by RSV in patients and predict the severity of acute bronchiolitis.
  • nBregs and MN B cell subsets based on CD5 and CD 10 expression were analyzed and purified by FACS as nBregs and MN B cell subsets based on CD5 and CD 10 expression.
  • Heatmap shows sorted cell subsets analyzed for RSV nucleoprotein gene (RSV N) expression by qRT-PCR. Correlation plots (right panel) of nBreg cells frequency in the NPA with the duration of oxygen supply.
  • H Representative FACS analysis plot of blood CXCR3+ and CCR6+ Tern cells in patients whose nBreg cells were found infected or not in the NPA of panel (A).
  • Figure 8 depicts a strategy.
  • Figure 9 A-D depicts (related to Fig. 1) viSNE analysis of CBMC.
  • FIG. 1A Cord blood cells were analyzed as in Fig. 1A using viSNE which defines based on indicated lineage markers :
  • A monocytes
  • B T cells
  • C NK cells
  • D B cells.
  • B cell phenotypes 1, 2 and 3 can be clearly visualized independently of other blood cell types with (2) as CD10 pos CD5 lo (green arrow) and (3) as CD5 hi CD10 neg (red arrow).
  • B Gating strategy for FACS sorting of neonatal B cells MN , IMT and nBreg, purity check and subsets IgM/IgD expression.
  • C 10 5 cord blood nBregs were stimulated with the indicated stimuli.
  • IgG and IgA detection on nBregs activated or not with RSV in comparison to adult Memory B cells. In parenthesis, frequencies of Ig isotype is indicated (IgA%; IgG%).
  • Figure 10 A-B depicts (related to Fig. 1) IL-10 response of B cells to viruses.
  • Figure 11 A- C depicts (related to Fig. 2) cell sorting.
  • A Left panel represents pDC infection as compared to nBreg cells cultured alone measured by live microscopy.
  • Right panel FACS plot shows the frequency of RSV infected pDC when cultured alone. Results are means of triplicates and are representative of three experiments.
  • FIG. 1 Histograms show the expression of HLA-DR, CD80 or intracellular IFN-a after 48h of stimulation with HRSV-A. Iso corresponds to isotype control staining, and Ctrl Ig to anti-ILlO isotype control.
  • C CD4 naive T cells were culture in TH17 conditions, and serve as positive control of Fig. 2 for intracellular staining of cytokines indicated on the X and Y axes.
  • Figure 12 A-B depicts (relate to Fig. 3) sorting.
  • (A) 10 5 B cell subsets were FACS sorted as nBreg, MN or IMT and stimulated by rHRSV-Ch, HRSV-A or CpG for 48 h. Live/dead cells were analyzed by FACS following DAPI staining. Live cells were negative for DAPI, and results are mean +/-SD of 3 experiments.
  • Figure 13 A-D depicts (related to Fig. 4) Pathway analysis of RSV stimulated nBregs.
  • A-C Cord blood nBregs were FACS-sorted as CD19+CD5+CD10- B cells, and they were either left unstimulated (-) or stimulated for 6 h with HRSV-A, IAV or anti-IgM. Gene expression profiles were compared by microarray analysis for 3 independent donors.
  • A Venn diagram for the number of common and specific genes activated in nBregs for algM (BCR) and RSV.
  • B-C GSEA analysis.
  • B Description of GSEA analysis plot.
  • C GSEA comparison of IAV and RSV activated nBregs for BCR receptor, signaling and molecular pathways.
  • D nBregs were activated as indicated for 30 min. and ERK phosphorylation was assessed by FACS. FACS plots and mean of triplicates+/-SD are shown.
  • Figure 14 A-H depicts (related to Fig. 5) B cell reactivity and repertoire analysis
  • C CDR3 length profiles (in AA) of one neonatal sample nBreg subset (red) for the various IGVH are compared by overlay with MN (blue) and IMT (green) B cell subsets.
  • D the IgM V usage
  • F-H nBregs were sorted as CD27-positive and negative cell fractions and subjected to repertoire analysis as in Fig. 5 and to RSV infection and IL-10 response.
  • CDR3 length spectra are shown for major IGHV gene family (VI , V3a, V3b and V4).
  • V major IGHV gene family
  • G nBregs subsets were exposed to HRSV-A and IL-10 was detected by ELISA at 48 h.
  • H nBregs subsets were exposed to rHRSV-Ch and infection was monitored by following mCherry expression by fluorescent live microscopy for 48h.
  • Figure 15 A-E depicts (related to Fig. 7) RSV-positive patient cohort analysis.
  • Figure 16 A-H Immunoglobulin gene repertoire of human cord-blood B-cell subsets.
  • Single nBreg, imB and mnB cells were FACS sorted from the cord blood of 4 healthy donors and their heavy- and light-chain variable domains (IgH and IgL) amplified and sequenced. All immunoglobulin gene characteristics were determined by analyzing IgH and IgL sequences using IgBLAST; (http://www.ncbi.nlm.nih.gov/igblast) and IMGT® (http://www.imgt.org) online tools.
  • IgBLAST http://www.ncbi.nlm.nih.gov/igblast
  • IMGT® http://www.imgt.org
  • nBregs cord blood B lymphocytes
  • This specific subpopulation of B cells is able to produce antibodies reactive to antigens of interest, in particular RSV.
  • This population has a biased repertoire with particularities at the CDR3 level, the antigen binding site.
  • nBregs are also biased with regards to VK gene segements usage, and the Inventors have demonstrated that nBregs have an increased usage of VK4 gene segments, particularly VK4-1 gene (IGKV4-1).
  • the inventors have observed that, in the population of nBregs, the frequency of V H 3(D H )J H 4 rearrangements is much higher than the frequency of V H 3(D H )J H 3 rearrangements, and further, than the ratio of V H 3(D H )J H 4 rearrangements over V H 3(D H )J H 3 rearrangements is higher in this population than it is in mature na ' ive B cells or immature B cells populations.
  • Palivizumab which is the IgGl humanized monoclonal antibody that binds to F protein outcompeted in a dose dependent manner for nBregs derived IgM binding to RSV.
  • Polyclonal IgM inhibit RSV infection in vitro.
  • the produced antibodies are of human origin and do not need to be further developed/optimized for human administration.
  • the invention encompasses isolation, amplification, purification, and fragments of these antibodies, as well as uses thereof.
  • nBregs neonatal B lymphocytes with immunosuppressive activity
  • nBregs which are a target for RSV
  • CX3CR1 interacted with RSV G glycoprotein and promoted infection of nBregs to induce IL-10 production.
  • nBregs which are an age-dependent factor associated with the severity of RSV-induced acute bronchiolitis.
  • RSV infects nBregs, through IgM recognition and induced CX3CR1 allowing viral interaction with the G glycoprotein.
  • B cell interactions with pathogens without antigen specificity usually leads to B cell death and an impaired antibody responses (Nothelfer et al., 2015).
  • Salmonella spp. Induces and/or activates Bregs in a TLR-dependent manner (Neves et al., 2010).
  • nBregs developed in utero cells and waned with age, likely reflecting a fetal- specific wave of B-cell ontogeny and selection.
  • the polyreactive nature of the Ig repertoire of nBregs suggests that other pathogens may target nBregs.
  • the BCR was not sufficient to activate nBregs as a second receptor was required in the context of RSV.
  • the mechanism we propose involves the combined role of RSV G and F glycoproteins in hijacking the newborn immune system to impair viral clearance.
  • the pre-fusion form of the F protein appears to be the critical target for virus neutralization (McLellan et al., 2013; McLellan et al., 2011).
  • TLR4 was reported to interact with the F fusion protein of RSV in a CD14-dependent manner (Kurt- Jones et al., 2000).
  • human B cells do not express TLR4.
  • the F fusion protein-BCR interaction that initiates nBreg activation enables G-CX3CR1 -mediated infection, and the nBreg-IgM outcompeted and decreased the initial viral interaction and further infection.
  • the IL-10 production by nBregs was mainly associated with the infection of the cell, although additional mechanisms such as TLR activation might contribute to the amplification of the anti-inflammatory response.
  • CTLs cytotoxic T lymphocytes
  • Primary HRSV infection in newborn mice, during the critical neonatal window led to the generation of a type-II response, an enhanced airway inflammation, lymphocyte infiltration and eosinophilia upon re-infection at adulthood, whereas delayed age priming led to enhanced IFN- ⁇ production and less severe symptoms during reinfection (Culley et al., 2002).
  • Th2 pathology occurs upon secondary RSV infection, and is poorly associated with the primary infection.
  • nBregs can reach the lymph nodes (LNs) and whether they directly influence directly Thl priming.
  • Human nBregs are related to neonatal B la cells in terms of their regulatory properties (Sun et al., 2005; Zhang et al., 2007).
  • Mouse B la cells have been recently shown to be trans-infected by blood-borne retroviruses via LN macrophages (Sewald et al., 2015). In such a scenario, RSV might reach nBregs in the lung draining LN via myeloid cells.
  • Such innate B cells produce natural antibodies with polyreactive properties.
  • the hallmark of the human innate B cells is the expression of CD27, a marker corresponding to memory cells.
  • IgM memory cells in the blood as cells that are IgM + IgD + CD22 + CD27 + (Kruetzmann et al., 2003), splenic MZBs are defined as IgM hi IgD low CD23 " CD21 + CDlc + CD27 + (Weller et al., 2008) and B l cell candidate are IgM + IgD + CD43 + CD27 + B cells (Griffin et al., 2011).
  • This IgM memory/MZB compartment develops following birth, possibly in response to the gut microbiota.
  • the human B l cells would represent a minority in neonatal blood but could account for 40 % of all CD27 + memory B cells.
  • nBreg quickly wanes with age whereas human B l cell population would develop. This age dependency of nBreg might explain their contribution to RSV disease which becomes asymptomatic later in age.
  • canonical adult memory B cells can be slightly infected by the RSV. Therefore it remains to be determined whether they correspond to a small fraction of RSV specific B cells and whether their infection could play a role in the susceptibility to the infection later in life, in the elderly population.
  • nBregs represent a newly described target cell for RSV and a biomarker for the severity of acute bronchiolitis.
  • the increased number of nBregs observed in the blood emphasizes how carefully B cell signatures need to be interpreted. Therefore, the appropriate complex signal deconvolution of whole blood signatures needs to take into account age-specific immune characteristics.
  • the "RSV-nBreg" signature that we defined may serve as a molecular biomarker of disease severity. Future work will determine whether the high frequency of nBregs is a consequence or a cause of the disease. In future investigations, large cohorts are needed to determine whether nBreg is a host risk factor that might predispose individuals to RSV-induced bronchiolitis. nBreg activity may constitute an early-life host response that favors microbial pathogenesis and may represent a target for the treatment of low respiratory tract viral infections and their pathological consequences later in life.
  • the invention encompasses methods for preparing nBreg cell populations, isolated nBreg cell populations, methods for preparing monoclonal antibodies against RSV, monoclonal antibodies against RSV, pharmaceutical compositions comprising mAbs, and uses thereof to treat and prevent RSV infections.
  • the invention pertains to a method for preparing a monoclonal antibody or fragments thereof that binds, preferably specifically, to an antigen of interest comprising:
  • nBreg cell refers to a B cell having the phenotype CD5 hi CD 10 " .
  • the population of nBreg cells can be isolated from blood samples, as described in the examples, or using similar techniques.
  • the population of nBreg cells can be isolated from cord blood mononuclear cells (CBMCs) or peripheral blood mononuclear cells (PBMCs) from child patients, preferably from human child under the age of 3 months, for example, using Lymphoprep (Axis-Shield).
  • B cells are positively enriched from CBMCs or PBMCs by using anti-CD19 magnetic beads with AutoMACS (Miltenyi Biotec), and nBregs cells can be isolated based on surface CD 10 and CD5 markers to obtain CD 10 " CD5 hi cells. Expression of a protein on the surface of a cell can easily be assessed using established techniques known in the art, such as disclosed for instance in the experimental part.
  • the population of nBreg cells is a population of B cells which is homogenous for the phenotype CD5 hi CD10 " .
  • a population of cells is considered as "homogenous for the phenotype CD5 hi CD10 " when said population of cells consists essentially of cells having the phenotype CD5 hi CD10 " .
  • a population of cells "consisting essentially of cells having the phenotype CD5 hi CD10 " refers to a population of cells wherein, in addition to those cells which are mandatory i.e. the cells having the phenotype CD5 hi CD10 " , other cells may also be present in the population, provided that they have a phenotype CD5 hi .
  • the population of nBreg cells is a population of B cells which is homogenous for the phenotype CD5 hi CD10 "
  • CDlc lo CD21 int CD45RA int CD23 hi CD24 lo CD38 lo IgD lo IgM lo a population of cells is considered has "homogenous for the phenotype CD5 hi CD10 " CDlc lo CD21 int CD45RA int CD23 hi CD24 lo CD38 lo IgD lo IgM lo " when said population of cells consists essentially of cells having the phenotype CD5 hi CD10 " CDlc lo CD21 int CD45RA int CD23 hi CD24 lo CD38 lo IgD lo IgM lo .
  • a population of cells consisting essentially of cells having the phenotype CD5 hi CD10 " CDlc lo CD21 int CD45RA int CD23 hi CD24 lo CD38 lo IgD lo IgM lo refers to a population of cells wherein, in addition to those cells which are mandatory i.e. the cells having the phenotype CD5 hi CD10 " CDlc lo CD21 int CD45RA int CD23 hi CD24 lo CD38 lo IgD lo IgM lo , other cells may also be present in the population, provided that they have a phenotype CD5 hi .
  • the population of nBreg cells homogenous for the phenotype CD5 hi CD10 " CDlc lo CD21 int CD45RA int CD23 hi CD24 lo CD38 lo IgD lo IgM lo is characterized in that: - at least 90%, preferably at least 95%, yet preferably at least 99% of the cells within the population have the phenotype CD5 hi
  • the cells within the population have the phenotype IgM 10 .
  • the population of cells of the invention is characterized in that at least 90%, preferably at least 95%, yet preferably at least 99% of the cells within the population have the phenotype CD5 hi CD10 " CDlc lo CD21 int CD45RA int CD23 hi CD24 lo CD38 lo IgD lo IgM lo .
  • the population of nBreg cells is characterized in that at least 15%, preferably at least 20% of the cells of the population have a genome which comprises at least part of the sequence of the IGKV4-1 gene of sequence SEQ ID NO. l.
  • the population of nBreg cells is characterized in that, in said population, the frequency of V H 3(D H )J H 4 rearrangements is higher thanthe frequency of V H 3(D H )J H 3 rearrangements.
  • the population of nBreg cells is preferably characterized in that, in said population, the ratio of V H 3(D H )J H 4 rearrangements over V H 3(D H )J H 3 rearrangements is superior to 1: 1.
  • the population of nBreg cells is characterized in that, in said population, the ratio of V H 3(D H )J H 4 rearrangements over V H 3(D H )J H 3 rearrangements is superior to 3: 1, preferably superior to 4: 1, yet preferably equal or superior to 5: 1.
  • V H 3(D H )J H 4 rearrangement and "V H 3(D H )J H 3 rearrangement” should be construed as generally understood in the field, that is to say as refereing to a rearranged heavy chain DNA wherein the VDJ segment comprises respectively a gene of the V H 3 family and the J H 4 gene, or a gene of theVn3 family and the J H 3 gene.
  • the antigen of interest may be any antigen for which an antibody is desired.
  • the antigen of interest refers to an (foreign) antigen derived from a microorganism or a cell (e.g., tumor cell) different from a the cells of the subject, against which one intends to elicit an immune response.
  • the microorganism can be a bacterium, virus or fungus organism.
  • antigens of interest include antigens derived from bacteria such as Chlamydia, Gonococcus, Mycoplasma, Tuberculosis and group B Streptococcus, antigens derived from HIV, Hepatitis virus, Variola (Smallpox) virus, Parvovirus and Cytomegalovirus, or antigens derived from Candida.
  • antigen is RSv, yet preferably the RSV-F protein.
  • the biological sample is a blood sample.
  • the subject is a human, preferably an infant, yet preferably an infant of 3 months old or of under 3 months old.
  • infant should be construed as generally in the field, that is to say as referring to human children from two months to one year old.
  • the subject from whom the biological sample is obtained has been in contact with the antigen of interest prior to collection of the biological sample.
  • the subject from whom the biological sample is obtained has been infected by the antigen of interest, or a micro-organism comprising thereof, prior to collection of the biological sample.
  • the person skilled in the art may add a step of culturing the population of nBreg cells in vitro, in the presence of the antigen of interest. This step may increase the chances that the population of nBreg cells of interest comprises at least one nBreg cell that produces an immunoglobulin of a primordial class that specifically binds to said antigen of interest.
  • This additional step may be of interest when it is uncertain whether the subject from whom the biological sample is obtained has been in contact with the antigen of interest prior to collection of the biological sample.
  • the terms "immunoglobulin of a primordial class” should be construed as generally understood in the art, that is to say as either IgM or IgD.
  • a nBreg cell that produces an immunoglobulin of a primordial class that binds to said antigen of interest using usual technics known in the art.
  • such a nBreg cell may be selected on its hability to produce, advatatgesouly after in vitro stimulation with the antigen of interest, either IgM or IgD, using the ELISPOT technique.
  • the person skilled in the art may then easily verify that the IgM or IgD produced by the nBreg cell binds to the antigen of interest, and determine the affinity of the binding, thereby the specificity of the antibody.
  • Antibodies are defined to be specifically binding if they bind to the antigen of interest with a Ka of greater than or equal to about 10 7 M - " 1. Affinities of binding partners or antibodies can be readily determined using conventional techniques, for example those described by Scatchard et al., Ann. N.Y. Acad. Sci., 51:660 (1949).
  • the further steps of generating copies of the genes encoding the immunoglobulin of a primordial class or a fragment of these genes; producing monoclonal antibodies or fragments thereof by expression of the protein encoded by the copies; and isolating the monoclonal antibodies or fragments thereof that specifically bind to the antigen of interest, can be performed according to the usual techniques known in the art and detailed hereunder with respect to the specific RSV embodiment.
  • cDNA library can be generated from the selected nBreg cell that produces an immunoglobulin of a primordial class that specifically binds to said antigen, by amplification of the mRNA corresponding to the genes encoding the immunoglobulin of a primordial class or a fragment of these genes, or possibly only the variable genes of heavy chains and light chains, by reverse transcriptase-PCR.
  • the PCR products can then be used to construct recombinant monoclonal antibodies and fragments, said PCR products being cloned in appropriate expression vector.
  • vector is to be construed as generally understood in the field, that is to say as autonomously replicating DNA molecules that can be used to carry foreign DNA fragments.
  • Vectors have been extensively used in gene cloning and in protein expression, and the person skilled in the art can easily select an appropriate expression vector when implementing the method of the invention.
  • the vector may be derived from a virus Aprpopriate vectors may be vectors derived from Simian Viruses 40 (SV40), polyomavirus, herpesvirus and papovirus.
  • SV40 Simian Viruses 40
  • polyomavirus polyomavirus
  • herpesvirus herpesvirus
  • the person skilled in the art may take into consideration the host which will be used for the antibody production.
  • the host which will be used for the antibody production.
  • vectors derived from mammalian viruses are used for expressing genes in mammalian cells.
  • the PCR products are cloned into antibody gene expression cassettes which can be stably integrated into the host cell genome, and will provide long term production stability.
  • the expression vector comprises comprises a promoter such as cytomegalovirus (CMV) or the cellular elongation factor (EF) 1 -alpha promoter.
  • the expression vector comprises polyadenylation sites from the simian virus (SV) 40 or the bovine growth hormone (BGH)
  • the expression vector may further comprise the genes encoding constant regions of the ligh chains, as well as the genes encoding the constant regions of the heavy chains of interest.
  • the expression vector may comprise any of the genes encoding the constant heavy chains, which comprises the heavy-chain constant genes C ⁇ (Cmu), C5 (delta), Cy3 (Cgama3), Cyl (Cgamal), Cy2a (Cgama2alpha), Cy2p (Cgama2beta),C8 (Cepsilon) and Ca (Calpha), which are deemed necessary for the production of a heavy chain of the class or subclass of interest.
  • the person skilled in the art may thus easily produce IgM, IgD, IgA, IgG (any of the four subclasses, IgGl, IgG2, IgG3, and IgG4), or IgE monoclonal antibodies.
  • the monoclonal antibodies produced by the method of the invention are IgM, or IgG.
  • These expression vectors may then be transfected into appropriate antibody production hosts.
  • Known hosts typically used in the art and appropriate for use in the context of the invention are for instance mammalian cells, yeast, filamentous fungi, protozoa, insect cells, plant cells.
  • Usual mammalian cells appropriate in the context of the invention are for instance Chinese hamster ovary (CHO) cells, in particular the K1-, DukX B 11-, DG44-cell lines derived therefrom, the human embryonic retinal cell line Per.C6, mouse myeloma NSO cells, baby hamster kidney (BHK) cells, the African green monkey COS cells, the African green monkey Vero cells, the human HeLa cells, the mouse myeloma NSO cells, and the human embryonic kidney cell line HEK293.
  • CHO Chinese hamster ovary
  • K1-, DukX B 11-, DG44-cell lines derived therefrom the human embryonic retinal cell line Per.C6, mouse myeloma NSO cells, baby hamster kidney (BHK) cells, the African green monkey COS cells, the African green monkey Vero cells, the human HeLa cells, the mouse myeloma NSO cells, and the human embryonic kidney cell line HEK293.
  • Usual yeast hosts appropriate in the context of the invention are for instance Pichia pastoris Saccharomyces cerevisiae, Hansenula polymorpha, Schizosaccharomyces pombe, Schwanniomyces occidentalis, Kluyveromyces lactis, and Yarrowia lipolytica.
  • genetically modified glyco-engineered P. pastoris strains have been generated which produce humanized glycosylation patterns.
  • Filamentous fungi appropriate in the context of the invention are for instance Trichoderma, in particular Trichoderma reesei, Aspergillus, in particular A. niger (subgenus A.
  • awamori and Aspergillus oryzae, as well as cell lines derivide therefrom and modified to improve glycosylation patterns.
  • the protozoa appropriate in the context of the invention one may cite for instance the eukaryotic parasite Leishmania tarentolae wich possesses a mammalian-like glycosylation pattern and is able to perform O-glycosylation as well as N- glycosylation.
  • Insect cells appropriate in the context of the invention are for instance Spodoptera frugiperda, Drosophila melanogaster, or Trichopulsia ni, as well as cell lines derivide therefrom and modified to improve glycosylation patterns.
  • Plant cells appropriate in the context of the invention are for instance Agrobacterium tumefaciens, Nicotiana tabacum, Nicotiana benthamiana, as well as cell lines derivide therefrom and modified to improve glycosylation patterns.
  • the monoclonal antibodies fragments produced by the method of the invention are antigen-binding fragments.
  • an "antigen-binding fragment of an antibody” means a part of an antibody, i.e. a molecule corresponding to a portion of the structure of the antibody of the invention, that exhibits antigen-binding capacity for the antigen of interest possibly in its native form; such fragment especially exhibits the same or substantially the same antigen-binding specificity for said antigen compared to the antigen- binding specificity of the corresponding four-chain antibody.
  • the antigen- binding fragments have a similar binding affinity as the corresponding monoclonal antibodies.
  • antigen-binding fragment that have a reduced antigen-binding affinity with respect to corresponding 4-chain antibodies are also encompassed within the invention.
  • the antigen- binding capacity can be determined by measuring the affinity between the antibody and the target fragment.
  • These antigen-binding fragments may also be designated as "functional fragments" of antibodies.
  • antigen binding fragments of an antibody encompass Fv, dsFv, scFv, Fab, Fab', F(ab')2 fragments.
  • Fv fragments consist of the VL and VH domains of an antibody associated together by hydrophobic interactions; in dsFv fragments, the VH:VL heterodimer is stabilised by a disulphide bond; in scFv fragments, the VL and VH domains are connected to one another via a flexible peptide linker thus forming a single-chain protein.
  • Fab fragments are monomeric fragments obtainable by papain digestion of an antibody; they comprise the entire L chain, and a VH-CH1 fragment of the H chain, bound together through a disulfide bond.
  • the F(ab')2 fragment can be produced by pepsin digestion of an antibody below the hinge disulfide; it comprises two Fab' fragments, and additionally a portion of the hinge region of the immunoglobulin molecule.
  • the Fab' fragments are obtainable from F(ab')2 fragments by cutting a disulfide bond in the hinge region.
  • F(ab')2 fragments are divalent, i.e.
  • Fv a VHVL dimmer constituting the variable part of Fab
  • dsFv a VHVL dimmer constituting the variable part of Fab
  • dsFv a VHVL dimmer constituting the variable part of Fab
  • dsFv a VHVL dimmer constituting the variable part of Fab
  • dsFv a VHVL dimmer constituting the variable part of Fab
  • dsFv a VHVL dimmer constituting the variable part of Fab
  • dsFv a VHVL dimmer constituting the variable part of Fab
  • dsFv a VHVL dimmer constituting the variable part of Fab
  • dsFv a VHVL dimmer constituting the variable part of Fab
  • dsFv a VHVL dimmer constituting the variable part of Fab
  • dsFv a VHVL dimmer constituting the
  • the monoclonal antibodies and the corresponding antigen-binding fragments can be purified from the culture supernatants by affinity chromatography.
  • Antibody libraries as well as libraries of antibody fragments, in particular the scFv or Fab antibody fragments, are well known in the art. They typically consist in a plurality of replicable genetic constructs, wherein each genetic construct comprises in its genome a sequence coding for a specific antibody or antibody fragment, and is capable of expressing the peptidic product of said sequence and to display it on its surface.
  • antibody libraries rely on phage-display technology, which uses genetically modified phages, and have been widely used to produce and screen libraries of polypeptides for binding to a selected target.
  • the phage is modified to integrate a nucleotide sequence of interest.
  • the modified phase then displays the polypeptide product of the nucleotide sequence of interest, as part of a capsid enclosing the phage genome.
  • Other display technologies have been developed, which rely on various genetic construct, such as yeast-display.
  • the invention further pertains to a method for preparing a library of antibodies or fragments thereof, comprising:
  • the genetic construct is capable of expressing the peptidic product of said copies and to display it on its surface.
  • the steps of isolating a population of nBreg cells from a biological sample of a subject; selecting the nBreg cells that produces immunoglobulins of a primordial class; generating copies of the genes encoding said immunoglobulins, can easily be performed by the person skilled in the art, using as developed above.
  • the step of integrating said copies in a genetic construct can be performed based on well known techniques of genetic engeneering and molecular cloning.
  • said genetic construct is a phage or a yeast, yet preferably a phage or a yeast adapted to display technology.
  • the peptidic product displayed by the genetic construct will possess features of the original primordial class antibodies, or fragment thereof, and can thus be refered to as a "primordial antibody library".
  • the invention pertains to a library of antibodies or fragments thereof, susceptible to be obtained by the method of the invention detailled above.
  • the library of antibodies or fragments thereof is a primordial antibody library.
  • the method for preparing a primordial antibody library relies on the use of a population of nBregs, wherein preferably, as indicated above, the frequency of V H 3(D H )J H 4 rearrangements is much higher than the frequency of V H 3(D H )J H 3 rearrangements, and further, than the ratio of V H 3(D H )J H 4 rearrangements over V H 3(D H )J H 3 rearrangements is higher in this population than it is in mature na ' ive B cells or immature B cells populations.
  • the frequency of VH3(DH)JH4 rearrangements is higher than the frequency of VH3(DH)JH3 rearrangements.
  • the ratio of V H 3(D H )J H 4 rearrangements over V H 3(D H )J H 3 rearrangements is superior to 1: 1.
  • the ratio of V H 3(D H )J H 4 rearrangements over V H 3(D H )J H 3 rearrangements is superior to 3: 1, preferably superior to 4: 1, yet preferably equal or superior to 5: 1.
  • the antibody library may then further be used to prepare monoclonal antibodies of interest.
  • an antibodyor antibody fragment may be selected from the library based on its hability to bind an antigen of interest, preferably in a specific binding.
  • the nucleotidique sequences encoding the selected antibody or antibody fragment may then easily be retrieved from the genetic construct expressing said antibody or antibody fragment, and be cloned in expression vectors as detailed above.
  • the person skilled in the art may thus easily produce IgM, IgD, IgA, IgG (any of the four subclasses, IgGl, IgG2, IgG3, and IgG4), or IgE monoclonal antibodies.
  • the invention further pertains to a monoclonal antibody derived from the library as defined above, wherein said antibody comprises V H 3(D H )J H 4 rearrangements.
  • said antibody is an IgM or IgG antibody.
  • the invention further pertains to a monoclonal antibody or fragments thereof, susceptible to be obtained by the method of the invention.
  • variable regions (Fab) in the corresponding light and heavy chains of an antibody, in particular derived from a human origin, are each composed of seven amino acid regions, four of which are framework regions and three of which are hypervariable regions (also called CDR).
  • the framework and CDR regions are herein refered to as defined by IMGT unique numbering.
  • the IMGT unique numbering has been defined to compare the variable domains whatever the antigen receptor, the chain type, or the species.
  • the IMGT unique numbering provides a standardized delimitation of the framework regions (FR1- IMGT: positions 1 to 26, FR2-IMGT: 39 to 55, FR3-IMGT: 66 to 104 and FR4-IMGT: 118 to 128) and of the complementarity determining regions: CDR1-IMGT: 27 to 38, CDR2-IMGT: 56 to 65 and CDR3-IMGT: 105 to 117.
  • the 3 framework regions of the light chains will be referred to as FR-L1; FR-L2, FR-L3, respectively, while the 3 framework regions of the heavy chains will be referred to as FR-H1; FR-H2, FR-H3, respectively.
  • the method preferably uses a population of nBreg cells wherein at least 15%, preferably at least 20% of the cells of the population have a genome which comprises at least part of the sequence of the IGKV4-1 gene of sequence SEQ ID NO. l.
  • Monoclonal antibodies and fragments thereof, produced by the method of the invention using nBreg cells having at least part of the sequence of the IGKV4-lgene of sequence SEQ ID NO.l in their genome, will possess a specific peptidic sequence in their variable heavy chain corresponding to the framework sequences encoded by this gene.
  • the monoclonal antibody of the invention comprises in its light chain domain, preferably in one of the FR-L1; FR-L2, FR-L3 regions as defined above, a sequence having at least 80% identity with at least one of the sequence SEQ ID NO. 2, 3 or 4 or a fragment thereof.
  • the "percentage identity” or “% identity” between two sequences of nucleic acids or amino acids means the percentage of identical nucleotides or amino acid residues between the two sequences to be compared, obtained after optimal alignment, this percentage being purely statistical and the differences between the two sequences being distributed randomly along their length.
  • the comparison of two nucleic acid or amino acid sequences is traditionally carried out by comparing the sequences after having optimally aligned them, said comparison being able to be conducted by segment or by using an "alignment window".
  • Optimal alignment of the sequences for comparison can be carried out, in addition to comparison by hand, by means of the local homology algorithm of Smith and Waterman, by means of the similarity search method of Pearson and Lipman (1988) or by means of computer software using these algorithms (GAP, BESTFIT, FASTA and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI, or by the comparison software BLAST NR or BLAST P).
  • the percentage identity between two nucleic acid or amino acid sequences is determined by comparing the two optimally-aligned sequences in which the nucleic acid or amino acid sequence to compare can have additions or deletions compared to the reference sequence for optimal alignment between the two sequences.
  • Percentage identity is calculated by determining the number of positions at which the amino acid, nucleotide or residue is identical between the two sequences, preferably between the two complete sequences, dividing the number of identical positions by the total number of positions in the alignment window and multiplying the result by 100 to obtain the percentage identity between the two sequences.
  • the monoclonal antibody of the invention comprises a light chain comprising at least one, preferably two, and most preferably three, framework regions chosen from FR-L1; FR-L2 and FR-L3, wherein:
  • FR-L1 comprises at least a portion of the amino acid sequence SEQ ID NO. 2
  • FR-L2 comprises at least a portion of the amino acid sequence SEQ ID NO. 3
  • FR-L3 comprises at least a portion of the amino acid sequence SEQ ID NO. 4.
  • the monoclonal antibody or fragments thereof, susceptible to be obtained by the method of the invention is an immunoglobulin of a primordial class, i.e. IgD or IgM, preferably IgM.
  • the monoclonal antibody or fragments thereof, susceptible to be obtained by the method of the invention binds specifically to the antigen of interest.
  • nBreg cells can be isolated as described in the Examples, or using similar techniques.
  • B cells can be isolated based on surface CD 10 and CD5 markers to obtain CD10 " CD5 hi cells.
  • the nBregs are isolated using the CD20 marker to obtain CD20+ cells.
  • distinct sets of B cell markers are used to isolate the nBregs.
  • the nBregs are isolated based on their characterization as CD5 hi CD10 " CDlc lo CD21 int CD45RA int CD23 hi CD24 lo CD38 lo IgD lo IgM lo CD43 + CD9 " CD62L " CD40 int DRintCD25 + / " CD27 + / " CD70 " .
  • FACS purification is used to isolate CD20+CD10negCD5hi cells from cord blood. Any of the markers and reagents set forth herein can be used in the isolation of nBregs.
  • nBreg cells are isolated from cord blood mononuclear cells (CBMCs) or peripheral blood mononuclear cells (PBMCs) from child patients, for example, using Lymphoprep (Axis-Shield).
  • B cells are positively enriched from CBMCs or PBMCs by using anti-CD19 magnetic beads with AutoMACS (Miltenyi Biotec).
  • the nBregs are infected with Human respiratory syncytial virus (RSV).
  • the nBregs express CX3CR1.
  • nBregs can be isolated using a biotinylated recombinant form of the RSV-F protein using affinity selection techniques (McLellan et al., 2013; McLellan et al., 2011).
  • the invention encompasses isolated populations of nBreg cells. In one embodiment, a single nBreg is isolated.
  • the nBregs are infected with Human respiratory syncytial virus (RSV).
  • the nBregs express CX3CR1.
  • the nBregs are specific for the RSV-F proteins. In one embodiment, the invention encompasses a single isolated nBregs specific for the RSV-F protein protein.
  • the invention encompasses the development of monoclonal antibodies (mAbs) specific for respiratory syncytial virus (RSV) for prophylactic and therapeutic purposes.
  • mAbs monoclonal antibodies
  • RSV respiratory syncytial virus
  • the process can be based on the characterization of a subset of cord blood derived B cells with known or unknown RSV specificity that can be used to generate mAbs.
  • isolated nBregs specific for RSV preferably the RSV-F protein
  • RSV-F protein can be used to generate monoclonal antibodies (mAbs) by conventional techniques. See, e.g., Fraussen et al., J Autoimmun. 35(2): 130-4 (2010); Bruggemann et al., Arch Immunol Ther Exp (Warsz) 63(2): 101-8 (2015).
  • the monoclonal antibodies of the invention can be produced using techniques such as those described by Alting-Mees et al., "Monoclonal Antibody Expression Libraries: A Rapid Alternative to Hybridomas", Strategies in Molecular Biology 3: 1-9 (1990), which is incorporated herein by reference.
  • binding partners can be constructed using recombinant DNA techniques to incorporate the variable regions of a gene that encodes a specific binding antibody. Such a technique is described in Larrick et al., Biotechnology, 7:394 (1989).
  • mAbs are prepared using the techniques described in U.S. Patent 9,555,112; Kozbor, et al., Immunol Today 4: 72 (1983); Cote, et al., Proc Natl Acad Sci USA 80: 2026-2030 (1983); or Cole, et al., In: Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96 (1985).
  • monoclonal antibodies refers to an antibody arising from a population of substantially homogeneous antibodies. More particularly, the individual antibodies of a population are identical except for a few possible naturally- occurring mutations, which may be found in minimal amounts.
  • the monoclonal antibodies are directed against a single epitope of an antigen, preferably an RSV-F antigen.
  • single cells from individual antigen- specific B cells are isolated by FACS and a cDNA library is generated.
  • IgH and corresponding Igk or Igl light chain gene transcripts can be amplified by 2 successive rounds of RT-PCR. Restriction sites can be introduced by the nested primers used in the second PCR.
  • IgH and Igk or Igl light chain PCR products can then be directly cloned into human immunoglobulin gene expression vectors.
  • Cells, preferably 293F cells can be co-transfected with plasmids encoding the IgH and IgL chains originally amplified from the same cell to produce recombinant IgM, IgG or IgA mAbs.
  • the mAbs can be purified from supernatants by affinity chromatography.
  • the invention encompasses methods for preparing a monoclonal antibody or fragments thereof that specifically bind to the RSV-F protein comprising isolating nBreg cells from a subject; selecting a nBreg cell that produces an IgM that specifically binds to the RSV-F protein; generating copies of the gene encoding the IgM or a fragment of the gene; producing monoclonal antibodies or fragments thereof by expression of the protein encoded by the copies; and isolating the monoclonal antibodies or fragments thereof that specifically bind to the RSV-F protein.
  • nBreg cells can be isolated from a subject by the methods disclosed herein or by other similar methods that will be evident to the skilled artisan.
  • Selecting a nBreg cell that produces an IgM that specifically binds to the RSV-F protein can be performed by the methods disclosed herein or by other similar methods that will be evident to the skilled artisan.
  • Generating copies of the gene encoding the IgM or a fragment of the gene can be performed by the methods disclosed herein or by other similar methods that will be evident to the skilled artisan.
  • the copies are made by transforming the nBreg cell.
  • the copies can be made by in vitro replication of DNA with an isolated polymerase. In one embodiment, the copies are generated by the polymerase chain reaction.
  • the copies can be made by inserting the gene encoding the IgM or a fragment of the gene into a vector and allowing a host replicate the gene or fragment thereof.
  • the fragment of the gene should encode a fragment of the IgM sufficient to confer specific binding to the target antigen, preferably the RSV-F protein.
  • the cloning of a fragment of the IgM and its insertion into a vector can provide a mAb of any class or subclass (e.g., IgG, IgM, IgA).
  • the invention encompasses isolated mAbs that bind specifically to RSV proteins.
  • the mAbs block infection of a human cell by RSV.
  • the mAbs bind specifically to the RSV-F protein.
  • the mAbs are fully human antibodies, that is, derived fully from human sequences.
  • the mAbs of the invention are preferably not humanized mAbs.
  • the mAbs are IgM, IgG (e.g., IgGl), or IgA antibodies.
  • the invention further encompasses the isolated monoclonal antibodies and fragments thereof produced by any of the methods disclosed herein.
  • Antibodies are defined to be specifically binding if they bind to the target protein (e.g.,
  • RSV-F protein with a Ka of greater than or equal to about 10 7 M - " 1.
  • Affinities of binding partners or antibodies can be readily determined using conventional techniques, for example those described by Scatchard et al., Ann. N.Y. Acad. Sci., 51:660 (1949).
  • Antigen-binding fragments of such antibodies which can be produced by conventional techniques, are also encompassed by the present invention.
  • Antibody fragments and derivatives produced by genetic engineering techniques are also provided.
  • antibody fragment(s) refers to functional portions of antibodies (as opposed to the whole antibodies), that is, portions of the antibodies able to bind to an antigen (antigen binding fragment). It is to be understood that the antibody fragments retain the ability to bind to the target (also generally referred to as antigen) of the antibody of reference.
  • antibody fragments include the following fragments: Fv (composed of the variable regions of the heavy and light chains of an antibody), ScFv (divalent single-chain variable fragment), Fab (composed of the entire light chain and part of the heavy chain), F(ab')2 (composed of two Fab fragments linked by the hinge region).
  • compositions comprising mAbs and Uses thereof
  • the invention encompasses the mAbs or antibody fragments of the invention, together with a pharmaceutically acceptable carrier in a pharmaceutical composition and uses thereof.
  • the pharmaceutical compositions may be sterilized and/or may comprise excipients, e.g., preservatives, stabilizers, wetting agents and/or emulsifiers, solubilizers, salts for regulating osmotic pressure and/or buffers and are prepared in a manner known per se, for example by means of conventional dispersing and suspending processes.
  • the dispersions or suspensions may comprise viscosity-regulating agents.
  • the suspensions or dispersions may be kept at temperatures around 2-4°C, or for longer storage may be frozen and then thawed shortly before use.
  • the dosage of the mAb or antibody fragment depends upon the subject, and their age, weight, individual condition, the individual pharmacokinetic data, and the mode of administration.
  • the invention further pertains to a monoclonal antibody or a fragment thereof, that bind, preferably specifically, to an antigen of interest, or a pharmaceutical composition comprising thereof, for its use as a medicine, preferably for the treatment of an infection by said antigen of interest.
  • compositions of the invention can be used to treat a patient, preferably a newborn or infant, with an RSV infection.
  • the pharmaceutical compositions of the invention comprise at least 25, 50, 100, 150, or 200 mg of the mAb or antibody fragment.
  • the pharmaceutical composition comprises a dose of at least 1, 2, 5, 10, 15, 20, 25, or 50 mg/kg of the mAb or antibody fragment.
  • the dosage is between 1- lOOmg/kg, 5-20 mg/kg, or 10-50mg/kg.
  • the pharmaceutical composition is administered at least 1, 2, 3, 4, 5, 6, or 7 times. In some embodiments, the pharmaceutical composition is administered every 7 or less, 14 or less, 30 or less, or 60 or less days. Preferably, the pharmaceutical composition is administered every 30 days for a total of 5 doses.
  • the pharmaceutical composition may be formulated in aqueous solutions, such as in physiologically compatible buffers such as Hanks' s solution, Ringer's solution, or physiological saline buffer.
  • physiologically compatible buffers such as Hanks' s solution, Ringer's solution, or physiological saline buffer.
  • the solution may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • compositions described herein additionally comprise a preservative, e.g., the mercury derivative thimerosal.
  • a preservative e.g., the mercury derivative thimerosal.
  • the pharmaceutical compositions described herein comprises 0.001% to 0.01% thimerosal. In other embodiments, the pharmaceutical compositions described herein do not comprise a preservative.
  • a pharmaceutical composition of the invention is administered to a subject by, including but not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, and percutaneous routes. Most preferably, the pharmaceutical composition is administered intramuscularly.
  • the pharmaceutical compositions of the invention are used to treat an RSV infection in humans, preferably in a neonate, most preferably in a neonate with an acute RSV infection.
  • the neonate has an increased number of nBregs or an increased level of IL-10 relative to an uninfected neonate.
  • the invention encompasses a pharmaceutical composition
  • a pharmaceutical composition comprising a pharmaceutically acceptable carrier and an isolated monoclonal Ig, particularly IgM, or a fragment thereof that specifically binds to the RSV-F protein protein.
  • the invention also encompasses an isolated monoclonal Ig, particularly IgM, or a fragment thereof that specifically binds to the RSV-F protein protein for treating or preventing infection of an RSV infection in a human.
  • the invention further encompasses the use of an isolated monoclonal Ig, particularly IgM, or a fragment thereof that specifically binds to the RSV-F protein protein to treat or prevent infection of an RSV infection in a human.
  • the invention encompasses methods for treating or preventing an infection by an antigen of interest in a human in need thereof, which comprises administering a monoclonal antibody or a fragment thereof, that bind, preferably specifically, to an antigen of interest, or a pharmaceutical composition comprising thereof, according to the invention, to said human.
  • the invention encompasses methods for treating or preventing infection of an RSV infection in a human.
  • the method comprises administering an isolated monoclonal IgM or a fragment thereof that specifically binds to the RSV-F protein protein to a human.
  • the isolated monoclonal Ig, particularly IgM, or a fragment thereof is produced by isolating nBreg cells from a subject; selecting a nBreg cell that produces an IgM that specifically binds to the RSV-F protein; generating copies of the gene encoding the IgM or a fragment of the gene; producing monoclonal antibodies or fragments thereof by expression of the protein encoded by the copies; and isolating the monoclonal antibodies or fragments thereof that specifically bind to the RSV-F protein protein.
  • Buffy coats were obtained from adult donors by the Etablatoriums Francais du Sang (France). Heparinized cord blood samples from healthy neonates collected by the Therapie Cellulaire of Hopital Saint-Louis (France). Written consent was obtained from the mothers. This study was conducted with the approval of the Ethics Committee of Institut Pasteur in agreement with the principles of the Declaration of Helsinki. For FACS analysis of infant B cells, we used blood samples from children from birth to 5 years of age that were admitted to the Hopital Erasme laboratory (Brussels, Belgium) for routine analysis of the common hematological parameters between March 2012 and June 2012. The final protocol of this study was approved by the Ethics Committee of Erasme Hospital, allowing us to test residual blood samples.
  • Example 2 Cohort of patients with acute bronchiolitis.
  • RPMI-1640 supplemented with 10% fetal calf serum (ICN Biomedicals), 5xl0 "5 M of 2-ME (Sigma), and antibiotics (Gibco BRL).
  • R848 was purchased from InvivoGen.
  • Human Influenza Virus A/PR/8/34 (IAV) was purchased from Charles River. Measles virus (MV, strain Schwarz) were amplified and titrated using Vero cells.
  • Human coronavirus (HCoV-229E), Herpes simplex virus 1 (HSV, strain KOS), Human immunodeficiency virus (HIV) were used.
  • Human T-lymphotropic virus (HTLV-1) was produced with Mt2 cell supernatants (kindly provided by MA Thoulouze).
  • Epstein-Barr virus (EBV) was generated using B95.8 cell line.
  • Recombinant human BAFF, IL-2 and IL-12 were purchased from Peprotech.
  • CX3CL1 was from R&D Systems.
  • HRSV-A Long Human respiratory syncytial virus A
  • rHRSV-Ch Human respiratory syncytial virus A
  • rHRSV-Ch Human respiratory syncytial virus A
  • the antibodies were labeled 100 ⁇ g at a time according to the manufacturer's instruction with heavy metal-preloaded maleimide-coupled MAXPAR chelating polymers.
  • Purified antibodies were purchased from Miltenyi. CBMC were stained with these reagents, DNA content stained by an iridium- 191/193 interchelator was used to identify individual cells, and by exclusion of a live-dead viability stain. Data were acquired using a CyTOF2 instrument (Fluidigm) and analyzed using vISNE algorithm on Cytobank (Fluidigm). Antibody clones used are detailed in the supplementary experimental procedures.
  • CBMCs or PBMCs from child patients or adults were isolated using Lymphoprep (Axis-Shield).
  • B cells were positively enriched from CBMCs or PBMCs by using anti-CD19 magnetic beads with AutoMACS (Miltenyi Biotec).
  • AutoMACS Miltenyi Biotec
  • the cells were sorted based on surface CD 10 and CD5 markers to obtain CD10 + CD5 + (EVIT), CD10 " CD5 hi (nBreg) and CD10 CD5 " (MN) B cell subsets using a FACS Aria 3 (BD). Cells sorted by AutoMACS and FACS were routinely >95% and 97-99% pure, respectively.
  • mycoplasma-free HEp-2 cells were incubated for 2h at 37°C with rHRSV-Ch, supernatants were then discarded. 24 h later, cells were washed twice with PBS (lx), and purified nBregs, MN, or IMT B cells were added to the infected HEp2 cells for 48 h. Alternatively, cells were cultured with human BAFF (200 ng/ml), CpGB 1826 (5 ⁇ g/ml), and IL-2 (10 ng/ml). The supernatants were measured for IL10 by ELISA (eBioscience).
  • mCherry fluorescence was detected either by LSR Fortes sa FACS (BD) or IncucyteZoom (Essen Bioscience) for live cell imaging.
  • Antibodies used for FACS are described in the supplementary experimental procedures.
  • Example 8 Nasopharyngeal aspirate cells isolation.
  • Nasopharyngeal aspirates were maintained on ice and processed within 24 h. The samples were repeatedly washed with PBS with 5% FCS and centrifuged until no visible mucus clumps remained in the solution. The samples were then filtered using a Falcon 100- ⁇ filter (Miltenyi Biotech). For nasal wash cell staining and isolation, filtered NPA cells were incubated with antibodies for 20 min.
  • Example 10 Microarray analysis.
  • the gene expression profiles were measured by Miltenyi Biotec using an Agilent DNA chip. We used the Agilent 60-mer Whole Human Genome Oligo Microarray containing approximately 44 K genes and gene candidates.
  • Output data files were further analyzed using the Rosetta Resolver gene expression data analysis system.
  • Microarrays Agilent files were processed, background corrected, and normalized using the quantile method with R and package Limma. Genes were averaged using ProbelD, and GeneName and transcripts were filtered using the refseq mRNA database. Principal component analyses on most differentially expressed genes, heatmaps and hierarchical clustering were performed using Qlucore Omics Explorer 3.1.
  • EBB CCCTTCCCAGAGATCTTCTCAC ; CAGCCCTGAGGATGAAGGAC
  • IL10 CGTGGAGCAGGTGAAGAA
  • GTCAAACTCACTC ATGGCTTTGTA IL12A
  • CACAGTGGAGGCCTGTTTA TCTGGAATTTAGGCAACTCTCA RNAj on a Biomark System (Fluidigm).
  • Example 12 Intracellular staining assay.
  • CD19 B cell fraction was stained with surface markers (CD20, CD 10, CD5 and CD3) and live/dead-Blue to identify viable B cell subsets.
  • Cells were then directly fixed and permeabilized using BD Cytofix/CytopermTM solution by following the manufacturer's instructions (eBioscience) and then subjected to intracellular phospho-CD79a detection.
  • purified cord blood pDCs were stimulated with HRSV-A in the presence of nBregs for 48 h.
  • Activated pDCs were sorted again by gating on CD123hiCD20- cells on FACSAria II.
  • T cells Five-six days later, differentiated T cells were restimulated with 50 ng/ml PMA, 1 ⁇ g/ml Ionomycin and GolgiPlug (BD) to detect intracellular cytokines (IL-2, IFN- ⁇ , IL-13, IL-17, IL-22 and TNF- a), Alternatively, secreted IFN- ⁇ , IL-13 and IL-17 were detected by ELISA with a specific kit (eBiosciences).
  • cytokines IL-2, IFN- ⁇ , IL-13, IL-17, IL-22 and TNF- a
  • secreted IFN- ⁇ , IL-13 and IL-17 were detected by ELISA with a specific kit (eBiosciences).
  • nBregs were stimulated or not with HRSV-A for 24h.
  • IL10 secreting nBregs were enriched using IL-10 cytokine secretion assay according to the manufacturer's protocol (Milteny Biotec). Enriched cells were then FACS sorted for IL-10-positive cells and used for human fluoroSpot IgM according to the manufacturer's protocol (Mabtech). Alternatively, IgM secreting cells were also analysed with an HRP-based ELISPOT assay (Mabtech).
  • Example 16 RSV infection activates neonatal Bregs resulting in IL-10 production
  • Immature transitional B cells (IMT, N°2), basically corresponding to CD24 hi CD38 hi B cells, were phenotypically defined as being CD5 lo CD10 + CDlc " CD21 " CD45RA int CD23 " CD24 hi CD38 hi IgD int IgM hi .
  • CD5 hi B cells phenotypically defined as being CD5 hi CD10 " CDlc lo CD21 int CD45RA klt CD23 hi CD24 lo CD38 lo IgD lo IgM lo (N°3) (Fig. 1A).
  • CD5 hi CD10 CDlc lo CD21 int CD45RA klt CD23 hi CD24 lo CD38 lo IgD lo IgM lo (N°3)
  • Fig. 1A We compared the cytometry profiles for additional CD markers of MN B cells, IMT B cells, and the newly defined CD5 hi population to bulk CD19 + CD20 + B cells and further defined the CD5 hi B cell phenotype as CD43 + CD9 " CD62L " CD40 int DR int CD25 +/” CD27 +/” CD70 " (Fig. IB).
  • IMT B cells have been shown to produce IL-10 in response to CD40 (Blair et al., 2010) or CpG and/or TLR9 activation (Menon et al., 2016). Therefore the abundance of IMT B cells in cord blood suggested that these cells could be a major source of IL-10 in newborns. IMT B cells could be distinguished by CD10 expression with an intermediate cell surface expression of CD5 (Fig. 9A), which accurately matched the high expression of CD24 and CD38 (Fig. IB). To analyze the functions of newborns B cells, the three cord blood B cell populations were sorted by fluorescence activated cell sorting (FACS) based on cell surface CD5 and CD10 expression (Fig. 9B).
  • FACS fluorescence activated cell sorting
  • FISH Fluorescence In Situ Hybridization
  • FISH detected X and Y chromosomes in all of the nBregs isolated from the cord blood of male babies, indicating that the nBregs were derived from the babies rather than the mothers (Fig. IE).
  • Thl-Th2 balance is critical at the time of the primary RSV infection, as impaired Thl priming or a Th2 immunopathology have been shown to determine the outcome of secondary infection (Culley et al., 2002).
  • Coculture of RSV-activated nBregs with activated CD4 + Thl cells inhibited IFN- ⁇ and IL-22, but not TNF-a, cytokine production from the CD4 + T cells (Fig. 2A-C).
  • IAV-activated neonatal plasmacytoid DCs we recently showed that type I IFN dependent neonatal Thl differentiation is induced by the allogeneic immune response (Zhang et al., 2014a). Similarly, RSV-activated neonatal pDCs induced a predominantly IFN- ⁇ Thl response that was associated with a mild IL-4 Th2 responses (Fig. 2D-F). To investigate whether nBregs could regulate Thl response indirectly via pDCs, pDC were cultured alone or with RSV-activated nBregs for 2 days, then these cells were co-culture with na ' ive T cells for six days post.
  • nBregs we observed few pDCs infected by RSV when cultured alone or after coculture with nBregs (Fig. 11 A). RSV- activated nBregs were able to inhibit the ability of pDCs to prime a IFN- ⁇ T-cell response in an IL-10-dependent manner (Fig. 2D-F). This was associated with decreased the APC functions of pDCs (HLA-DR and CD80), but not the IFN- ⁇ response (Fig. 11B). Altogether, these data demonstrate that the nBregs can be specifically activated by RSV and may control the Thl responses in an IL-10 dependent manner.
  • nBregs were preferentially infected by the virus (Fig. 3B) compared to MN or IMT B cells isolated from cord blood. RSV infection did not affect the viability of nBregs (Fig. 12A).
  • nBregs harboring RSV produced more IL-10 compared to their RSV-negative counterparts (Fig. 3C and D) and only live but not UV- treated RSV induced IL-10 production (Fig. 3E), indicative of a role for viral infection in nBreg activation.
  • Epithelial cells of the respiratory tract are the major targets of HRSV replication in vivo.
  • nBregs but not MN and IMT B cells, produced IL-10 and were preferentially infected when cocultured with a RSV-infected human epithelial HEp-2 cell line (Fig. 3F and G). Altogether, these data show that nBregs are specifically permissive to RSV infection and that IL-10 production by nBregs requires their viral infection.
  • Example 18 RSV is recognized by IgM and can engage the BCR pathway in nBregs
  • nBregs stimulated with anti-IgM (BCR) and RSV were closer than with TLR agonist closely related, indicating that BCR activation could be involved in RSV infection.
  • TLR7 or 8 activation by the R848 agonist did not recapitulate the transcriptional pattern of viral activation. Therefore, RSV RNA sensing by TLR7 or 8 may not be essential for the activation of nBregs and may explain why other RNA viruses did not induced IL-10.
  • pathway analysis showed that RSV activated nBregs significantly upregulated BCR-related pathways but not TLR-, RIG-I- or CD40-related pathways (Fig. 4C).
  • nBregs produced 5-fold higher concentrations of IgM than MN cells, and 50-fold higher concentrations than IMT cells (Fig. 14A). This finding was confirmed using ELISPOT in which over 80% were secreting IgM nBregs as compared to 10-15% of MN B cells as assessed (Fig. 14A). IgM produced by nBregs, but not MN or IMT B cells, showed specific binding to RSV particles (Fig. 5A and S6B).
  • the mature HRSV envelope consists of glycoprotein (G), fusion (F) protein and small hydrophobic (SH) protein.
  • IgM from nBregs recognized the F fusion protein of HRSV but barely recognized the HIV-1 envelope glycoprotein gpl40 (Fig. 5A). These IgM still bound the rHRSV-ASH and the rHRSV-AG mutants showing that F, but not G or SH, were recognized by the Ig (Fig. 14B).
  • Palivizumab which is an IgGl humanized monoclonal antibody that binds to F protein outcompeted the binding of nBreg-derived IgM to RSV in a dose- dependent manner (Fig. 5B).
  • IgM produced by nBregs but not by MN or IMT B cells, competitively inhibited RSV infection of nBregs (Fig. 5C).
  • F fusion protein, but not SH and G proteins on the virion contributes to IgM-mediated recognition of RSV by nBregs. This further reinforced the results from transcriptomics and signaling analyses that indicated the engagement of the BCR in nBregs infection by RSV.
  • nBreg Ig recognized RSV in the absence of any previous exposure to the virus.
  • One possible explanation of such a property may rely on polyreactivity of the nBreg-IgM that may have developed in utero upon exposure to self- antigens.
  • nBreg-IgM displayed canonical features of polyreactive B cells, including self-antigen recognition (Fig. 14A).
  • IGHV Ig heavy chain V genes
  • nBreg IgM exhibited a shorter complementarity determining region 3 (CDR3) for most of the IGHV genes, representing more than 90% of the BCR repertoire (Fig. 5D and Fig. 14C and D).
  • CDR3 complementarity determining region 3
  • MZB cells Weller et al., 2008
  • CD23 and CD5 Weill et al., 2009
  • CD27 + "B l-like cells” were described to have a 14 bp CDR3 (Griffin et al., 2011), whereas the CDR3 of nBregs was a 12.9 bp+/-0.2 in length (Fig. 5D).
  • nBregs We identified preferential usage of the IGHJ4 segment associated with IGHD6 in nBregs by analyzing the IGHV3 gene PCR products (Fig. 5E-F and Fig. 14E). Both CD27 + and CD27 " nBregs showed similar repertoire characteristics and functional properties, such as eqivelent susceptibility to RSV infection and similar concentrations of IL10 production upon stimulation with RSV (Fig. 14F-G). Therefore, the Ig repertoire analysis of nBregs showed that this population constituted a B cell subset with unique characteristics, presumably resulting from specific selection and/or maintenance processes. In summary, the repertoire traits, together with the viral particle recognition by nBreg IgM, provide the molecular basis for the activation of the BCR pathway following exposure to RSV.
  • Example 19 The RSV G glycoprotein interaction with CX3CR1 is critical to infect nBregs
  • nBreg-IgM Because ultraviolet (UV) inactivation of RSV impaired IL-10 production, the polyreactive nature of nBreg-IgM was not sufficient to explain the triggering of nBreg activity by RSV.
  • the G glycoprotein harbors a CX3C chemokine motif capable of chemokine mimicry when interacting with chemokine receptor CX3CR1 (Tripp et al., 2001). This interaction is reported as an important mechanism for RSV binding and infection in human lung epithelial cells (Jeong et al. 2015; Chirkova et al. 2015). Because nBreg exposure to RSV activated chemokine receptor pathways (Fig. 4C), we analyzed CX3CR1 expression on cord blood B cells.
  • CX3CR1 was expressed by monocytes, but not by B cells, including nBregs (Fig. 6A). However, after 48 h of RSV exposure, CX3CR1 was induced on nBregs (Fig. 6B), an effect that was mimicked by BCR activation, but not by TLR activation (Fig. 6C). Using rHRSV-Ch, we observed that viral infection of nBregs was associated with the highest frequencies of nBregs expression cell surface CX3CR1 relative to other stimuli. We found that an RSV AG mutant poorly infected nBregs (Fig. 6F-G) and was unable to induce IL-10 production (Fig.
  • Example 20 RSV infects infant nBregs and nBregs are predictive of disease severity Infants under 3 months of age who develop acute severe bronchiolitis because of RSV infection may require ventilator support and are at a much higher risk to develop recurrent wheezing up through their teenage years (Stein, 2009). This is often thought to be associated with Th2 responses. However, post-mortem analysis in fatal cases reveals heavy pulmonary infiltration of B cells, but not T cells, in the lung upon RSV infection (Reed et al., 2009). RSV remains in the respiratory tract and does not spread to the blood.
  • IL-10 can be detected in the nasopharyngeal aspirates (NPA) of RSV-infected children (Bont et al., 2001) and is associated with post-bronchiolitis wheeze (Schuurhof et al., 2011).
  • NPA nasopharyngeal aspirates
  • NPA nasopharyngeal aspirates
  • nBregs The frequency of nBregs correlated with the severity of the disease, as assessed by the duration of oxygen support and hospitalization in the ICU (Fig. 7A and Fig. 15).
  • Fig. 7A and Fig. 15 We also found a higher frequency of nBregs in the blood of RSV-infected patients suffering from acute bronchiolitis compared to non-infected children, and a positive correlation between the percentage of nBregs with the disease severity and the viral load, but not with the age of the patient or the pregnancy term (Fig. 7B-D and Fig. 15).
  • nBregs purified from the blood of RSV-positive patients expressed IL10 mRNA upon RSV exposure, but not IL35, IL12A and EBI3, subunits (Fig. 7E), indicating the capacity of nBreg activity to be activated following their recruitment at the site of infection.
  • Example 21 B cell repertoire analysis.
  • V3 was divided in two subgroups: V3a (V3- 15,49,72,73) and V3b (V3-d,07,09,l 1,13,20,21,23,30,30.3,33, 43, 48,53,64,66,74).
  • PCR products were subjected to run-off reactions with a nested fluorescent primer specific for the constant region gene.
  • the fluorescent products were separated and analyzed on an ABI-PRISM 3730 DNA analyzer to determine CDR3 lengths.
  • the IGHV3a/C amplification prod ucts were cloned, sequenced, and analyzed according to the procedure described previously (Lim et al., 2008).
  • a more detailed analysis of ⁇ H- chain transcripts was performed to examine the usage of IGHD families and the IGHJ gene as well as the of the IGHV-D and IGHJ-IGHD junction regions.
  • IGVH CDR3 length was analyzed in nBregs, and NM B cells. Each profile represents the CDR3 length distribution for a given IGVH family.
  • One-way ANOVA was used for group comparisons; P values ⁇ 0.05 were considered statistically significant. List of primers is detailed below.
  • the first ATG of the G gene was substituted by ACA by site-directed mutagenesis using the QuickChange II site-directed mutagenesis kit (Stratagene). Mutagenesis was performed using the pJET2.1 vector in which the HRSV G gene was cloned at Xhol-Stul sites, with the following primers: forward primer: CGTTGGGGCAAATGCAAACACATCCAAAAA CAAGGACCAACGC; reverse primer: GCGTTGGTCCTTGTTTTTGGATGTGTTTGCATTTGCC CCAACG (sequence changes were boxed).
  • the modified sequence was then sub-cloned in the pACNR-rHRSV-Cherry vector (Genbank accession N° KF713492.1) to engineer the pACNR-rHRSV-AG-Cherry vector. Sequence analysis was carried out to control the integrity of this vector.
  • the recombinant rHRSV-AG-Cherry virus was recovered by co-transfecting the pACNR-rHRSV- AG-Cherry vector together with plasmids expressing the RSV N, P, M2-1 and L proteins in BSRT7/5 cells (Buchholz et al., 1999) as previously described (Rameix -Welti, 2014).
  • rHRSV-ASH SH gene together with corresponding Gene Start and Gene End signals was deleted from the full-length cDNA clone of HRSV subgroup A previously described (Rameix- Welti et al., 2014) using standard cloning procedures. Resulting sequence is available in the Genbank nucleotide database with accession code KU707921. rHRSV-ASH was rescued and amplified as previously described. Viral genome sequence was verified at passage 3. Viruses were titrated on Vero cells at 37°C using a plaque assay procedure derived from the one previously described (Rameix -Welti et al., 2014).
  • Example 23 RSV detection in nasal washes.
  • RSV expression B cell subsets were directly sorted from the nasal washes in a Lysis Solution (Lysis Enhancer and Resuspension Buffer at a ratio 1: 10) (CellsDirectTM One- Step qRT-PCR Kit, Invitrogen). Sequence-specific pre-amplification was performed using TaqMan PreAmp Master Mix (Invitrogen). Unincorporated primers were inactivated by Exonuclease I treatment (New England Biolabs). RSV nucleoprotein gene N analysed by qPCR with 2x Sso Fast EvaGreen Supermix With Low ROX (Bio-Rad Laboratories) using primers in 48:48 Dynamic Arrays on a Biomark System (Fluidigm).
  • Quantitative data for the viral N was normalized to house keeping genes mRNA content ( ⁇ -actin and GAPDH).
  • RSV N forward primer AGATCAACTTCTGTCATCCAGCAA and reverse primer TTCTGCACATCATAATTAGGAG TATCAAT were used.
  • IgM (3-4ug/ml) from nBregs or MN were tested for polyreactivity using high-binding 96-well ELISA plates (Costar) coated with 10 ⁇ g/ml of LPS from E. coli (Sigma, L2637), Keyhole Limpet Hemocyanin (KLH) (Sigma, H8283), ssDNA from dsDNA (heated at 95°C for 30 min), 5 ⁇ g/ml Human insulin (Sigma, 19278), HEp-2 whole cell lysates (Prigent et al., 2016) and purified HIV-1 (YU-2) gpl40 trimers gpl40 (Mouquet et al, 2011). (2 ⁇ g/ml). ELISA done as previously described. HRSV-F protein (4 ⁇ g/ml) was described (McLellan et al., 2011 ; McLellan et al., 2013)
  • the first one is based on FACS purification of cord blood derived nBregs (CD20+CD10negCD5hi cells) and the 2nd approach selects a few highly specific for the RSV-F protein using the biotinylated recombinant prefusion form of the protein (McLellan et al., 2013; McLellan et al., 2011).
  • single cells from individual antigen-specific B cells are isolated by FACS and a cDNA library is generated.
  • IgH and corresponding Igk or Igl light chain gene transcripts are amplified by 2 successive rounds of RT-PCR. All PCR products are sequenced to perform detailed Ig gene sequence analyses. Restriction sites are introduced by the nested primers used in the second PCR.
  • IgH and Igk or Igl light chain PCR products are directly cloned into human immunoglobulin gene expression vectors. Plasmid inserts are sequenced to confirm identity with the original PCR product.
  • 293F cells are co-transfected with plasmids encoding the IgH and IgL chains originally amplified from the same cell to produce recombinant IgG or IgA mAbs that are purified from supernatants by affinity chromatograhy.
  • Antibodies can be produced at microgram scale and tested by ELISA for RSV reactivity. ASH and AG mutant can be used to assess recognition of SH, G and F proteins. Specificity for pre-F and post F form of the fusion protein can also be evaluated by ELISA Example 27. Neutralizing activity
  • a recombinant HRSV-A virus expressing mCherry reporter protein (Rameix -Welti et al., 2014) can be used. Upon infection, Hep 2 cells express mCherry and infection can be assessed along a large time-frame in a very sensitive way. This allows an automation of the process by fluorescent microscopy using Incucyte technology available at the CIH platform.
  • the mAbs having neutralization activity can be characterized by defining the neutralization site and the Ag/Ab interaction by X-Ray crystallography and the validation of the anti-RSV activity in cotton rats.
  • Example 28 Immunoglobulin gene features of nBreg antibodies
  • nBregs showed increased frequency of V H 3(D H )J H 4 rearrangements and conversely, a lower number of V H 1(D H )J H 3 recombined fragments (Figure 16D).
  • nBreg, imB and mnB cells did not differ in terms of k/1 light chain usage (Figure 16E), Igl V and J gene distributions and CDR L 3 characteristics ( Figure 17).
  • nBregs had increased usage of Vk4 gene segments especially, Vk4-1 gene (22.5% vs 4.34% for imB and 9.3% for mnB) ( Figures 16F and 16G).
  • nBregs displayed a singular immunoglobulin gene repertoire with unique IgH and IgL characteristics, which differentiate them from both imB and mnB cells.
  • viSNE enables visualization of high dimensional single-cell data and reveals phenotypic heterogeneity of leukemia. Nature Biotech 31, 545-552.
  • Antigen- specific B-cell receptor sensitizes B cells to infection by influenza virus. Nature 503, 406-409.
  • Ly-1 B (B-l) cells are the main source of B cell-derived interleukin 10. Eur J Immunol 22, 711-717.
  • Retroviruses use CD169-mediated trans-infection of permissive lymphocytes to establish infection. Science 350, 563-7.
  • IL-35-producing B cells are critical regulators of immunity during autoimmune and infectious diseases. Nature 507, 366-370. Siegrist, C.A. (2001). Neonatal and early life vaccinology. Vaccine 19, 3331-3346.
  • CD5(+) B cells control the IL-12-dependent Thl-priming capacity of neonatal DCs. Immunity 22, 467- 477.
  • CD4 T cells with effector memory phenotype and function develop in the sterile environment of the fetus. Sci Transl Med 6, 238ra272.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Virology (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pulmonology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

The invention pertains to methods for preparing libraraies of antibodies or fragments thereof, and methods for preparing a monoclonal antibody or fragments thereof that bind, preferably specifically, to an antigen of interest, based on the use of nBreg cells. The invention further pertains to the antibody library susceptible to be produced by the methods of the invention. The invention further pertains to the monoclonal antibodies and fragments thereof susceptible to be produced by the methods of the invention, as well as the monoclonal antibodies derived from the antibody library, the pharmaceutical compositions comprisising thereof, and their use as a medicine. The invention more particularly pertains to monoclonal antibodies derived from nBregs can be used for prophylactic and therapeutic purposes for RSV infections.

Description

Generation of monoclonal antibodies targeting respiratory syncytial virus (RSV) using regulatory B cells from newborns (nBregs).
Introduction
Human respiratory syncytial virus (RSV) is the major cause of lower respiratory tract infections in young infants leading to hospitalization and an increased risk factor for asthma development (Smyth and Openshaw, 2006). The immune system plays a critical role in the pathogenesis of RSV disease, and RSV is associated with the exacerbation of airway inflammation (Castro et al., 2008). In infants, fatal outcomes of primary RSV infection are associated with the pulmonary infiltration of B cells (Reed et al., 2009; Welliver et al., 2007), yet the role of these cells remains to be assessed.
RSV infection holds a heavy clinical and economic burden in industrialized countries. Although most of RSV infections in infants are managed in ambulatory settings, 10% will require hospitalization and, with 1% requiring intensive care. Severe RSV infection is the first cause of epidemic lower respiratory tract infection among infants and represents 2-6% of all admissions to pediatric intensive care unit in developed countries (Deshpande and Northern, 2003). It is estimated that each hospitalization in pediatric intensive care for severe RSV infection cost between 28,000 and 92,000 US dollars (Howard et al., 2000; Katz et al., 2003). The most severe manifestations of RSV infection (pneumonia and bronchiolitis) occur in infants aged 2 to 6 months and will require mechanical ventilation and prolonged hospitalization in pediatric intensive care units. Children with underlying cardiac or pulmonary disease or infants with an immunodeficiency are at the highest risk of complications, which include apnea and respiratory failure. In most infants, the illness lasts 7 to 21 days, and hospitalization, if required, averages 4 to 7 days. Mortality among those with heart and lung disease who are hospitalized is of the order of 3%. Mortality is below 1% in children without underlying illness.
A growing concern is that severe RSV infection may adversely affect pulmonary development and lead to long-term respiratory problems. Indeed infants exposed to severe bronchiolitis or even mild RSV-disease are at much higher risk to develop recurrent wheeze up to teenage years (Stein, 2009).
Since the 70' s, RSV infection has been suspected to be an important cause of illness in community-dwelling elderly people. Over the past 10 years, RSV infection was demonstrated to represent a major cause of respiratory illness in the elderly population (Falsey et al., 2005) as much as influenza infection for which this population is proposed for vaccination. RSV infection resulted in similar lengths of stay, rates of use of intensive care and death rate than influenza A following hospitalization (Falsey et al., 2005). No vaccine is available against RSV.
The significant morbidity and mortality associated with RSV disease underscores the urgent need for the development of prophylactic or therapeutic treatments. However there are currently nor adequate treatment nor vaccine available. Ribavirin is sometimes used in dire circumstances but is not recommended in most cases.
Passively administered humanized monoclonal antibodies (Synagis (Palivizumab), Medlmmune/AstraZeneca) are provided only for neonates at highest risk of severe RSV disease (e.g. prematurity, chronic lung disease, congenital heart disease) but are only effective in prophylaxis, and the cost of this treatment is very high (1000 euros/dose, five doses required). Unfortunately, these treatments are only partially effective, reducing the frequency of the most severe bronchiolitis forms. Thus, overall, there continues to be a need for methods to increase the repertoire of possible antibody molecules from which to manipulate useful binding functions, including heavy chain and light chain immunoglobulin polypeptides. New methods for obtaining monoclonal antibodies with improved properties, and in particular an improved anti-RSV treatment are urgently needed. The invention fulfills this need.
BRIEF SUMMARY OF THE INVENTION
The invention pertains to methods for the production of antibodies specifics of an antigen of interest, which rely on the use of nBreg cells. The invention further pertains to the monoclonal antibodies susceptible to be obtained with the method of the invention, as well as compositions comprising thereof, and their use as medicine.
The invention preferably encompasses compositions and methods for treating and preventing RSV infection of humans.
In one embodiment, the invention encompasses methods for preparing a monoclonal antibody or fragments thereof that specifically bind to the RSV-F protein comprising isolating nBreg cells from a subject; selecting a nBreg cell that produces an IgM that specifically binds to the RSV-F protein; generating copies of the gene encoding the IgM or a fragment of the gene; producing monoclonal antibodies or fragments thereof by expression of the protein encoded by the copies; and isolating the monoclonal antibodies or fragments thereof that specifically bind to the RSV-F protein. In one embodiment, the copies are generated by the polymerase chain reaction. The invention further encompasses the isolated monoclonal antibodies and fragments thereof produced by these methods. The invention further encompasses a pharmaceutical composition comprising a pharmaceutically acceptable carrier and an isolated monoclonal Ig or a fragment thereof that specifically binds to the RSV-F protein and an isolated monoclonal Ig or a fragment thereof that specifically binds to the RSV-F protein for treating or preventing infection of an RSV infection in a human.
The invention further encompasses the use of an isolated monoclonal Ig or a fragment thereof that specifically binds to the RSV-F protein to treat or prevent infection of an RSV infection in a human.
The invention further encompasses methods for treating or preventing infection of an RSV infection in a human comprising administering an isolated monoclonal Ig or a fragment thereof that specifically binds to the RSV-F protein to a human. Preferably, the isolated monoclonal Ig or a fragment thereof is produced by isolating nBreg cells from a subject; selecting a nBreg cell that produces an IgM that specifically binds to the RSV-F protein; generating copies of the gene encoding the IgM or a fragment of the gene; producing monoclonal antibodies or fragments thereof by expression of the protein encoded by the copies; and isolating the monoclonal antibodies or fragments thereof that specifically bind to the RSV-F protein.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 A-E depicts Identification of phenotypic of new population of regulatory B cells in the human neonate (nBregs).
(A-B) CyTOF analysis of cord blood CD19+ B cells within CMBCs for lineage and B cell markers. (A) Data analysis using viSNE based on 19 markers delineating phenotype CD10 CD5" (1), CD10+CD5+ (2) and CD10"CD5+ (3). (B) Heatmap analysis for data corresponding to the fold change expression of indicated markers for each subset as compared to the whole CD19+CD20+ B cell population (C) Cord blood B cell subsets were FACS sorted as, CD10 CD5" (MN; blue), CD10+CD5+ (EVIT; green) and CD10"CD5+ (nBreg; red). 105 cord blood B cell subsets were stimulated with HRSV-A (MOI=2.5) and IL-10 production was measured at 48h by ELISA (n=3). Results are expressed as the means +/- SD. (D) Percentage of the nBreg subset among the total B cells circulating in the blood during different developmental stages and ages. *p<0.05, **p<0.01. (E) X and Y chromosome FISH staining of nBreg cells isolated from cord blood of a male baby. Bar chart indicates the number of nuclei associated with XY or XX staining. Figure 2 A-F depicts nBregs regulate TH cell polarization directly or indirectly via pDCs.
(A-C) Neonatal naive CD4+ T cells were activated by anti-CD3+ anti-CD28 and cultured with 10 ng/ml IL-12 (Thl) or without (ThO), alone or in co-culture with HRSV- activated nBregs for 6 days. (A) FACS plots and (B) mean frequencies of TNF-a, IL-2, IFN- γ, IL-13, IL-17 or IL-22 secreting cells, as determined by intracellular staining for 5 donors (Anova test). (C) Quantification of IFN-γ in the supernatants of the same co-cultures, as determined (n=4 donors; paired t-test was used for comparison). (D-F) Neonatal pDCs were stimulated with HRSV-A either alone or in co-culture with nBregs in the presence of neutralizing anti-IL-10 or control antibody (Ctrl) for 48 h. pDCs were FACS purified again before being used in TH differentiation assay. (D-E) Intracellular IFN-γ, IL-4, IL-17 and IL- 22 expression was analyzed by FACS and (F) secreted IFN-γ analyzed in the supernatants by ELISA. (D-F) Results are representatives of 3 experiments. Results are expressed as the means ± SD. *p<0.05, **p<0.01, ** p<0.001 and NS for non significant.
Figure 3 A-H depicts nBregs are preferentially infected by RSV.
(A-C) 105 cord blood nBregs were FACS sorted and left untreated (0 h) or exposed to HRSV-A or to rHRSV-Ch (MOI=2.5). (A) Representative plot of IL10 gene expression, as measured by qRT-PCR at Oh, 6h and 24h. (B) 105 B cell subsets were FACS sorted as nBreg, MN or IMT and stimulated with rHRSV-Ch. mCherry expression was assessed by fluorescent microscopy at 48h post-infection (left panel) or by monitoring the red object count (R.O.C) through live imaging (right panel). Results are representative of 3-5 independent experiments. (C) Representative FACS plot for intra-cellular IL-10 expression at 48h post-infection as compared to untreated cells (No stimulus). (D) The frequency of IL10+ nBreg cells among rHRSV-Ch-positive or -negative nBregs(n=3). Unpaired t-test was used for comparison. (E) IL-10 production following nBreg exposure to live or UV-treated HRSV-mCherry was measured at 48h by ELISA (n=5). Paired t test was also used to compare the three conditions. (F-G) HEp-2 cells were infected with rHRSV-Ch (MOI=0.1) then cocultured with B cell subsets (F) The percentage of rHRSV-Ch+ B cells in co-culture with HEp-2 cells is shown by FACS at 48 h post coculture (n=3). ANOVA test was used to compare the three groups. (G) IL-10 production was measured by ELISA (n=3) and unpaired t-test was used for comparison. (H) nBregs were stimulated or not with HRSV-A for 24h. IL10+ nBregs were then enriched using IL-10 enrichment beads, then FACS sorted IL10+ nBregs were used for fluorescent IgM ELISPOT. Left panel is a representative FACS plot following IL-10 enrichment and sorting purity. Right panel indicate the frequency of IgM cells. Results are expressed as the means ± SD of triplicates. *p<0.05, **p<0.01, ***p<0.001.
Figure 4 A-E depicts RSV activates the BCR pathway.
5xl03 cord blood nBregs were FACS-sorted as CD19+CD5+CD10" B cells, and stimulated for 6h with algM, R848, HRSV-A, IAV or left unstimulated. Gene expression profiles were compared by microarray analysis for 3 independent donors. (A) PCA and (B) heatmap of hierarchical clustering corresponding to the indicated stimulus (p=0.0049 and q=0.067; 745 genes). (C) The list of differentially expressed genes (p<0.05) was processed using the Ingenuity pathway analysis software. The list was then manually curated to remove pathways irrelevant to B cell biology. Canonical pathways were considered significant for p<0.05 (red line). (D-E) nBregs were activated for 30 min. with algM, R848, HRSV-A, IAV or left unstimulated. Phosphorylation of CD79a was assessed intracellularly by FACS. (D) Representative FACS plots and (E) means ± SD of 3 experiments are shown *p<0.05, **p<0.01, ***p<0.001.
Figure 5 A-F depicts Ig from nBregs recognize RSV and display a biased repertoire.
(A-C) IgM from three donors (d#l, d#2 and d#3) were produced by nBregs and MN neonatal B cell subsets following their stimulation with CpG B (1826) for 4 days and then were tested by ELISA for recognition of WT HRSV-A (left panel, IgM 4μg/ml), HRSV-F protein or HIV-1 gpl40 protein (right panel; serial dilutions of IgM). Results are expressed as optical density measured at 450 nm (O.D. 450 nm). (B) IgM (100 ng/ml) from nBregs were tested by ELISA for HRSV-A recognition in the presence of various doses of anti-F Palivizumab IgG Ab. (C) rHRSV-Ch was pre-incubated with nBreg-, MN- or IMT-derived IgM (50 ng/ml) for lh prior infection. RSV infection was assessed by monitoring mCherry expression by fluorescent live microscopy. Histogram plot shows the frequency of inhibition at 48h post-infection with rHRSV-Ch/IgM mixes as compared to free rHRSV-Ch. Results are expressed as means ± SD of triplicates, and are representative of 2 experiments. (D-F) B cell subsets were subjected to Ig repertoire analysis of the IgM heavy chain (n=5-6 donors). (D) The mean CDR3 lengths was analyzed for the different IGHV, and a profile comparison is shown for IGHV3. (E) The frequencies of different IGHJ usage among V3a (V3-15, 49, 72, 73) subfamily were determined. (F) For IGH3 subfamily 3a family, 165 clones from MN and 185 clones from nBregs were sequenced to determine IGHJ/IGHD junctions. Among IGHJ4, the number for the different D gene usage is indicated (n=74 for MN, and n=84 for nBregs). Figure 6A-H depicts HRSV infects nBreg cells via CX3CR1-G protein interaction. (A-C) FACS analysis of CX3CR1 expression in nBregs. (A) Representative FACS plot of freshly isolated nBregs (MFI: 193 for Ab Ctrl, and 237 for CX3CR1 Ab) as compared to CD14+ monocytes (MFI: 9971). (B) nBreg cells were infected with HRSV-A (MOI=2.5) for 48h. MFI are shown for CX3CR1 Ab as compared to isotype control. Results are expressed means ± SD of duplicates from 3 donors. (C) nBreg cells were stimulated with R848, agM or HRSV-A (MOI=2.5) for 48h and their CX3CR1 expression was assessed by FACS. Results are expressed as means ± SD of duplicates from 2 independent experiments. nBregs were infected for 48h with WT or AG strains of rHRSV-Ch (MOI=2.5). (D) IL-10 production was measured by ELISA. Results are expressed as means ± SD of 4 independent experiments. (E) Phopshorylation of CD79a was assessed intracellularly by FACS in nBregs after 30 min. of exposure to AG RSV or WT RSV. Results are expressed means ± SD of triplicates, and are representative of 3 experiments. (F) Representative FACS plot (left panel) of nBregs infection with AG RSV or WT RSV, as compared to non-infected cells (none). Histogram plot shows the percentage of infected nBregs, as measured by FACS as % of mCherry+ cells (right panel) and is representative of 3 independent experiments. (G) Viral replication measured through the detection of the mCherry fluorescence for 48h with AG as compared to WT counterpart. Results are expressed as means ± SD of triplicates and are represent 3 independent experiments. (H) nBreg cells were cultured on CX3CLl-coated plates and infected with rHRSV-Ch (MOI=2.5). The percentage of infected nBregs and IL-10 secretion were measured at 48h. Results are expressed as means +/- SD and represent three independent experiments. Unpaired t-test were used for comparison. Results are expressed as the means +/- SD. **p<0.01, ***p<0.001, ****p<0.0001.
Figure 7 A-H depicts nBregs are infected by RSV in patients and predict the severity of acute bronchiolitis.
(A) CD20+ B cells in nasopharyngeal aspirates (NPA) collected from RSV-positive patients (n=13) at the first day of hospital admission were analyzed and purified by FACS as nBregs and MN B cell subsets based on CD5 and CD 10 expression. Heatmap shows sorted cell subsets analyzed for RSV nucleoprotein gene (RSV N) expression by qRT-PCR. Correlation plots (right panel) of nBreg cells frequency in the NPA with the duration of oxygen supply. (B) Frequency of B cells subsets in the blood of RSV-positive (RSVpos ; n= 18) and negative (RSVneg ; n=10) patients. (C) Correlation plot of B cell subsets % in the blood of RSVpos patients (n=18) with the duration of oxygen supply. (D) Correlation plot of blood nBreg cells frequency with RSV load in the corresponding NPA of RSVpos patients (n=13). (E) nBreg, MN and EVIT B cells were sorted from the blood of RSVpos patients (n=7) and stimulated or not with HRSV for 24h. IL10, EBI3 and IL12 gene expression for was analyzed by qRT-PCR and normalized to housekeeping genes. (F) CD4+ T cells were analyzed by FACS for Tregs and Terns, as shown in the blood of RSV-positive and (RSVpos ; n= 13) and negative (RSVneg ; n=7) patients. (G) Correlation plots of blood Tern and CXCR3+ Tern frequencies with the duration of oxygen supplementation (n=13). (H) Representative FACS analysis plot of blood CXCR3+ and CCR6+ Tern cells in patients whose nBreg cells were found infected or not in the NPA of panel (A). Histograms represent the frequency of CXCR3+ Tern cells in the blood (left histogram) and nBregs IL-10 gene expression in the NPA (right histogram) from patients corresponding to infected nBreg (RSVpos ; n=3) or non infected nBreg (RSVneg ; n=3) Results are expressed as the means +/- SD. *p<0.05, **p<0.01, ***p<0.001. ns for non significant.
Figure 8 depicts a strategy.
A strategy to clone and produce recombinant antibodies from single human antigen- specific B cells.
Figure 9 A-D depicts (related to Fig. 1) viSNE analysis of CBMC.
(A) Cord blood cells were analyzed as in Fig. 1A using viSNE which defines based on indicated lineage markers : (A) monocytes, (B) T cells, (C) NK cells, (D) B cells. B cell phenotypes 1, 2 and 3 can be clearly visualized independently of other blood cell types with (2) as CD10posCD5lo (green arrow) and (3) as CD5hiCD10neg (red arrow). (B) Gating strategy for FACS sorting of neonatal B cells MN , IMT and nBreg, purity check and subsets IgM/IgD expression. (C) 105 cord blood nBregs were stimulated with the indicated stimuli. IL-10 was detected in the supernatants at 48 h (means of three donors +/-SD). (D) IgG and IgA detection on nBregs activated or not with RSV in comparison to adult Memory B cells. In parenthesis, frequencies of Ig isotype is indicated (IgA%; IgG%).
Figure 10 A-B depicts (related to Fig. 1) IL-10 response of B cells to viruses.
(A) CyTOF of adult B cell subsets for the expression of the indicated markers, data were normalized to the the total population of B cells. (B) 105 adult blood B subsets were purified by FACS with indicated gating strategy. Mature Na'ive (MN), memory B cells (MEM), marginal zone B cells (MZB) were pre-gated on CD241oCD38+/lo mature B cells, and (IMT) Immature transitional correspond to CD24hiCD24hi B cells. Sorted B cells were then stimulated or not with HRSV-A or R848 and IL-10 was detected at 48h by ELISA. Results are expressed as the means of triplicates+/-SD and are representative of two experiments.
Figure 11 A- C depicts (related to Fig. 2) cell sorting. (A-B) pDC and nBreg cells were sorted from cord blood and cultured with rRSV-Ch (MOI=2.5) alone or in co-culture for 30h-48h in the presence of anti-ILlO (a-ILlO) or an isotype control Ig. (A) Left panel represents pDC infection as compared to nBreg cells cultured alone measured by live microscopy. Right panel FACS plot shows the frequency of RSV infected pDC when cultured alone. Results are means of triplicates and are representative of three experiments. (B) Histograms show the expression of HLA-DR, CD80 or intracellular IFN-a after 48h of stimulation with HRSV-A. Iso corresponds to isotype control staining, and Ctrl Ig to anti-ILlO isotype control. (C) CD4 naive T cells were culture in TH17 conditions, and serve as positive control of Fig. 2 for intracellular staining of cytokines indicated on the X and Y axes.
Figure 12 A-B depicts (relate to Fig. 3) sorting.
(A) 105 B cell subsets were FACS sorted as nBreg, MN or IMT and stimulated by rHRSV-Ch, HRSV-A or CpG for 48 h. Live/dead cells were analyzed by FACS following DAPI staining. Live cells were negative for DAPI, and results are mean +/-SD of 3 experiments. (B) 105 nBregs and adult B cells were sorted as indicated in FigS2B and exposed to rHRSV-Ch (MOI=2.5). Viral infection was assessed mCherry expression using fluorescent live microscopy.
Figure 13 A-D depicts (related to Fig. 4) Pathway analysis of RSV stimulated nBregs.
(A-C) Cord blood nBregs were FACS-sorted as CD19+CD5+CD10- B cells, and they were either left unstimulated (-) or stimulated for 6 h with HRSV-A, IAV or anti-IgM. Gene expression profiles were compared by microarray analysis for 3 independent donors. (A) Venn diagram for the number of common and specific genes activated in nBregs for algM (BCR) and RSV. (B-C) GSEA analysis. (B) Description of GSEA analysis plot. (C) GSEA comparison of IAV and RSV activated nBregs for BCR receptor, signaling and molecular pathways. (D) nBregs were activated as indicated for 30 min. and ERK phosphorylation was assessed by FACS. FACS plots and mean of triplicates+/-SD are shown.
Figure 14 A-H depicts (related to Fig. 5) B cell reactivity and repertoire analysis,
(A) Indicated B cell subset (3X106/ml) was stimulated for 6 days with CpG, and concentration of IgM was determined. IgM produced by nBregs and MN were tested at 4-0.4 and 0.04 μg/ml for polyreactivity against the indicated Ag by ELISA and results are plotted as CAUC. Alternatively, B subsets, was analyzed using an enzymatic ELISPOT assay to evaluate the frequency IgM secreting cells after 48 h. (B) IgM (100 ng/ml) produced by nBregs, IMT and MN neonatal B cell were tested by ELISA for recognition of WT HRSV-A vs. (B) ASH and (C) AG mutants. (C) CDR3 length profiles (in AA) of one neonatal sample nBreg subset (red) for the various IGVH are compared by overlay with MN (blue) and IMT (green) B cell subsets. For the three neonatal B cell subsets, (D) the IgM V usage and (E) the J usage repertoire was analyzed for IgM V3b (IGHV3b) (*P<0.05). Each dot represents one donor (n=5). (F-H) nBregs were sorted as CD27-positive and negative cell fractions and subjected to repertoire analysis as in Fig. 5 and to RSV infection and IL-10 response. CDR3 length spectra are shown for major IGHV gene family (VI , V3a, V3b and V4). (G) nBregs subsets were exposed to HRSV-A and IL-10 was detected by ELISA at 48 h. (H) nBregs subsets were exposed to rHRSV-Ch and infection was monitored by following mCherry expression by fluorescent live microscopy for 48h.
Figure 15 A-E depicts (related to Fig. 7) RSV-positive patient cohort analysis.
Correlation analysis of blood cell parameters of patients suffering of acute bronchiolitis with duration of ICU hospitalization, age of patients and pregnancy term. Immunological parameters correspond to those presented in Figure 7.
Figure 16 A-H : Immunoglobulin gene repertoire of human cord-blood B-cell subsets.
Single nBreg, imB and mnB cells were FACS sorted from the cord blood of 4 healthy donors and their heavy- and light-chain variable domains (IgH and IgL) amplified and sequenced. All immunoglobulin gene characteristics were determined by analyzing IgH and IgL sequences using IgBLAST; (http://www.ncbi.nlm.nih.gov/igblast) and IMGT® (http://www.imgt.org) online tools. (A) Pie charts showing the distribution of VH, Dn and ½ genes in between cord blood B-cell subsets. The number of antibody sequences analyzed is indicated in the center of each pie chart. Groups were compared using 2x5 Fisher's Exact test. (B) Bar graphs comparing the CDRH3 aminoacid length and number of positive charges in the CDRH3 between cord blood B-cell subsets (red, nBreg; green, imB; blue, mnB). Groups were compared using 2x5 Fisher's Exact test. A dot plot shows the CDRH3 aminoacid length according to the Vn gene usage. Groups were compared using Student's t-test with Welch's correction, ns, not significant. (C) Bar graph comparing the distribution of individual VH genes between cord blood B-cell subsets. Groups were compared using 2x5 Fisher's Exact test. (D) Circos plots generated from the immunoglobulin gene analysis using "circlize" (vO.3.1) R package compare the frequency of VH(DH)JH rearrangements between cord blood B-cell subsets. Groups were compared using 2x5 Fisher's Exact test. (E) Pie charts comparing the frequency of IgK and/or Igl expressing antibodies between the different cord blood B-cell subsets (nBreg, imB and mnB cells). Groups were compared using 2x5 Fisher's Exact test. (F) Same as in (A) and (B) but for VK and JK gene usages. (G) Same as in (C) but for individual VK genes. (H) Same as in (D) but for VH-VK combinaisons. Figure 17 A-C : Igk Gene features of human cord-blood B-cell subsets
(A) Pie charts showing the distribution of νλ, and Ιλ genes in cord blood B-cell subsets. The number of antibody sequences analyzed is indicated in the center of each pie chart. Groups were compared using 2x5 Fisher's Exact test. (B) Bar graphs comparing the CDR 3 aminoacid length and number of positive charges in the CDR 3 between cord blood B-cell subsets (red, nBreg; green, imB; blue, mnB). Groups were compared using 2x5 Fisher's Exact test. (C) Bar graph comparing the distribution of individual νλ genes between cord blood B-cell subsets. Groups were compared using 2x5 Fisher's Exact test.
DETAILED DESCRIPTION OF THE INVENTION
A subpopulation of cord blood B lymphocytes, namely nBregs, has been characterized by the inventors. This specific subpopulation of B cells is able to produce antibodies reactive to antigens of interest, in particular RSV. This population has a biased repertoire with particularities at the CDR3 level, the antigen binding site. Furthermore, nBregs are also biased with regards to VK gene segements usage, and the Inventors have demonstrated that nBregs have an increased usage of VK4 gene segments, particularly VK4-1 gene (IGKV4-1). In addition, the inventors have observed that, in the population of nBregs, the frequency of VH3(DH)JH4 rearrangements is much higher than the frequency of VH3(DH)JH3 rearrangements, and further, than the ratio of VH3(DH)JH4 rearrangements over VH3(DH)JH3 rearrangements is higher in this population than it is in mature na'ive B cells or immature B cells populations.
Palivizumab, which is the IgGl humanized monoclonal antibody that binds to F protein outcompeted in a dose dependent manner for nBregs derived IgM binding to RSV. Polyclonal IgM inhibit RSV infection in vitro. The produced antibodies are of human origin and do not need to be further developed/optimized for human administration. The invention encompasses isolation, amplification, purification, and fragments of these antibodies, as well as uses thereof.
The B-cell compartment in human newborns were analyzed using high-content mass cytometry, transcriptomics and functional studies. We identified a population of neonatal B lymphocytes with immunosuppressive activity (nBregs) through the production of IL-10. We showed that nBregs, which are a target for RSV, are highly permissive to infection because of BCR recognition of RSV F that drove nBreg activation and expression of the chemokine receptor CX3CR1. CX3CR1 interacted with RSV G glycoprotein and promoted infection of nBregs to induce IL-10 production. Analysis of clinical samples indicated that nBregs were associated with poor control of RSV infection in neonates. We propose the use of the frequency of nBregs as a prognostic tool to determine bronchiolitis severity and the use of both RSV F and G glycoprotein as targets for the development of interventions in the context of acute infection.
Using mass cytometry we identified nBregs, which are an age-dependent factor associated with the severity of RSV-induced acute bronchiolitis. RSV infects nBregs, through IgM recognition and induced CX3CR1 allowing viral interaction with the G glycoprotein. B cell interactions with pathogens without antigen specificity usually leads to B cell death and an impaired antibody responses (Nothelfer et al., 2015). The possibility of virus-mediated B- cell subversion in an antigen-specific manner has been proposed recently in the context of influenza specific-B cells (Dougan et al., 2013). Salmonella spp. Induces and/or activates Bregs in a TLR-dependent manner (Neves et al., 2010). In inflammatory situations, the CD40- and TLR- mediated pathways are central in Breg activation (Mauri and Bosma, 2012). nBregs developed in utero cells and waned with age, likely reflecting a fetal- specific wave of B-cell ontogeny and selection. The polyreactive nature of the Ig repertoire of nBregs suggests that other pathogens may target nBregs. However, the BCR was not sufficient to activate nBregs as a second receptor was required in the context of RSV. The mechanism we propose involves the combined role of RSV G and F glycoproteins in hijacking the newborn immune system to impair viral clearance. The pre-fusion form of the F protein appears to be the critical target for virus neutralization (McLellan et al., 2013; McLellan et al., 2011). Of note, TLR4 was reported to interact with the F fusion protein of RSV in a CD14-dependent manner (Kurt- Jones et al., 2000). However human B cells do not express TLR4. The F fusion protein-BCR interaction that initiates nBreg activation enables G-CX3CR1 -mediated infection, and the nBreg-IgM outcompeted and decreased the initial viral interaction and further infection. The IL-10 production by nBregs was mainly associated with the infection of the cell, although additional mechanisms such as TLR activation might contribute to the amplification of the anti-inflammatory response.
In primary RSV infection in humans and mice, a type-I immune response including NK cells, Thl cells, and cytotoxic T lymphocytes (CTLs) which act as important sources of IFN-γ, is essential for viral clearance (Openshaw and Chiu, 2013). An unbalanced and dysregulated T-cell response to HRSV limits viral clearance and is reported to cause immunopathology in the respiratory tract. Primary HRSV infection in newborn mice, during the critical neonatal window led to the generation of a type-II response, an enhanced airway inflammation, lymphocyte infiltration and eosinophilia upon re-infection at adulthood, whereas delayed age priming led to enhanced IFN-γ production and less severe symptoms during reinfection (Culley et al., 2002). Th2 pathology occurs upon secondary RSV infection, and is poorly associated with the primary infection. We found very few T cells in the NPA or effector memory Thl cells in the blood and no detectable Th2 signature in the patients. Therefore, our in vivo and in vitro data support the role of RSV-activated nBregs in the control of IFN-γ Thl cells and associated viral clearance.
It is unclear yet whether infected nBregs can reach the lymph nodes (LNs) and whether they directly influence directly Thl priming. Human nBregs are related to neonatal B la cells in terms of their regulatory properties (Sun et al., 2005; Zhang et al., 2007). Mouse B la cells have been recently shown to be trans-infected by blood-borne retroviruses via LN macrophages (Sewald et al., 2015). In such a scenario, RSV might reach nBregs in the lung draining LN via myeloid cells. Such innate B cells produce natural antibodies with polyreactive properties. The hallmark of the human innate B cells is the expression of CD27, a marker corresponding to memory cells. Carsetti and colleagues defined "IgM memory cells" in the blood as cells that are IgM+IgD+CD22+CD27+ (Kruetzmann et al., 2003), splenic MZBs are defined as IgMhiIgDlowCD23"CD21+CDlc+CD27+ (Weller et al., 2008) and B l cell candidate are IgM+IgD+CD43+CD27+ B cells (Griffin et al., 2011). This IgM memory/MZB compartment develops following birth, possibly in response to the gut microbiota. The human B l cells would represent a minority in neonatal blood but could account for 40 % of all CD27+ memory B cells. This latter point raised some controversies about the phenotype of these cells, that would include T cell or monocyte contaminants (Descatoire et al. 2011 ; Perez-Andres, 2011). A small fraction of human B l cell express CD5, which is the hallmark of nBreg, and do not have any repertoire bias in contrast to nBreg. The cyTOF approach had clearly eliminated the possibility of other cell lineage contamination to CD5 and CD27 expression. The "human B l cells" have been proposed to be pre-plasmablasts because they produce IgM, IgG and IgA, and we showed nBregs to be free of any IgG or IgA positive cells. In addition, nBreg quickly wanes with age whereas human B l cell population would develop. This age dependency of nBreg might explain their contribution to RSV disease which becomes asymptomatic later in age. We also showed that canonical adult memory B cells can be slightly infected by the RSV. Therefore it remains to be determined whether they correspond to a small fraction of RSV specific B cells and whether their infection could play a role in the susceptibility to the infection later in life, in the elderly population.
In addition to lung epithelial cells, nBregs represent a newly described target cell for RSV and a biomarker for the severity of acute bronchiolitis. A recent study that defined biomarkers in bronchiolitis using whole blood RNA profiling, highlighted an overexpression of neutrophil and interferon genes as well as suppression of B- and T-cell genes in children of less than 6 months (Mejias et al., 2013). The increased number of nBregs observed in the blood emphasizes how carefully B cell signatures need to be interpreted. Therefore, the appropriate complex signal deconvolution of whole blood signatures needs to take into account age-specific immune characteristics. If confirmed in the NPA, the "RSV-nBreg" signature that we defined may serve as a molecular biomarker of disease severity. Future work will determine whether the high frequency of nBregs is a consequence or a cause of the disease. In future investigations, large cohorts are needed to determine whether nBreg is a host risk factor that might predispose individuals to RSV-induced bronchiolitis. nBreg activity may constitute an early-life host response that favors microbial pathogenesis and may represent a target for the treatment of low respiratory tract viral infections and their pathological consequences later in life.
The discovery of that nBregs produce antibodies reactive to RSV, and that the polyclonal IgM inhibit RSV infection in vitro, allows many applications. The invention encompasses methods for preparing nBreg cell populations, isolated nBreg cell populations, methods for preparing monoclonal antibodies against RSV, monoclonal antibodies against RSV, pharmaceutical compositions comprising mAbs, and uses thereof to treat and prevent RSV infections.
Methods for Preparing nBreg Cell Populations
The invention pertains to a method for preparing a monoclonal antibody or fragments thereof that binds, preferably specifically, to an antigen of interest comprising:
- isolating a population of nBreg cells from a biological sample of a subject;
- selecting a nBreg cell that produces an immunoglobulin of a primordial class,
optionally that binds to said antigen of interest; preferably specifically,
- generating copies of the genes encoding said immunoglobulin, preferably the variable genes of heavy chain and light chain, or a fragment thereof,
- producing monoclonal antibodies or fragments thereof by expression of the protein encoded by the copies; and
- isolating the monoclonal antibody or fragments thereof that binds, preferably
specifically, to the antigen of interest. In the context of the invention, the terms "nBreg cell" refer to a B cell having the phenotype CD5hiCD 10".
The population of nBreg cells can be isolated from blood samples, as described in the examples, or using similar techniques. For instance, the population of nBreg cells can be isolated from cord blood mononuclear cells (CBMCs) or peripheral blood mononuclear cells (PBMCs) from child patients, preferably from human child under the age of 3 months, for example, using Lymphoprep (Axis-Shield). Preferably, B cells are positively enriched from CBMCs or PBMCs by using anti-CD19 magnetic beads with AutoMACS (Miltenyi Biotec), and nBregs cells can be isolated based on surface CD 10 and CD5 markers to obtain CD 10" CD5hi cells. Expression of a protein on the surface of a cell can easily be assessed using established techniques known in the art, such as disclosed for instance in the experimental part.
Advantageously, the population of nBreg cells is a population of B cells which is homogenous for the phenotype CD5hiCD10". In the context of the invention, a population of cells is considered as "homogenous for the phenotype CD5hiCD10 " when said population of cells consists essentially of cells having the phenotype CD5hiCD10". In the context of the invention, a population of cells "consisting essentially of cells having the phenotype CD5hiCD10 " refers to a population of cells wherein, in addition to those cells which are mandatory i.e. the cells having the phenotype CD5hiCD10", other cells may also be present in the population, provided that they have a phenotype CD5hi.
Preferably, the population of nBreg cells is a population of B cells which is homogenous for the phenotype CD5hiCD10"
CDlcloCD21intCD45RAintCD23hiCD24loCD38loIgDloIgMlo. In the context of the invention, a population of cells is considered has "homogenous for the phenotype CD5hiCD10" CDlcloCD21intCD45RAintCD23hiCD24lo CD38loIgDloIgMlo" when said population of cells consists essentially of cells having the phenotype CD5hiCD10" CDlcloCD21intCD45RAintCD23hiCD24lo CD38loIgDloIgMlo. In the context of the invention, a population of cells consisting essentially of cells having the phenotype CD5hiCD10" CDlcloCD21intCD45RAintCD23hiCD24lo CD38loIgDloIgMlo refers to a population of cells wherein, in addition to those cells which are mandatory i.e. the cells having the phenotype CD5hiCD10"CDlcloCD21intCD45RAintCD23hiCD24loCD38loIgDloIgMlo, other cells may also be present in the population, provided that they have a phenotype CD5hi.
Preferably, the population of nBreg cells homogenous for the phenotype CD5hiCD10" CDlcloCD21intCD45RAintCD23hiCD24loCD38loIgDloIgMlo is characterized in that: - at least 90%, preferably at least 95%, yet preferably at least 99% of the cells within the population have the phenotype CD5hi
- at least 90%, preferably at least 95%, yet preferably at least 99% of the cells within the population have the phenotype CD 10"
- at least 90%, preferably at least 95%, yet preferably at least 99% of the cells within the population have the phenotype CDlclQ
- at least 90%, preferably at least 95%, yet preferably at least 99% of the cells within the population have the phenotype CD21int,
- at least 90%, preferably at least 95%, yet preferably at least 99% of the cells within the population have the phenotype CD45RAint
- at least 90%, preferably at least 95%, yet preferably at least 99% of the cells within the population have the phenotype CD23hi
- at least 90%, preferably at least 95%, yet preferably at least 99% of the cells within the population have the phenotype CD24lQ
- at least 90%, preferably at least 95%, yet preferably at least 99% of the cells within the population have the phenotype CD38lQ
- at least 90%, preferably at least 95%, yet preferably at least 99% of the cells within the population have the phenotype IgDlQ and
- at least 90%, preferably at least 95%, yet preferably at least 99% of the cells within the population have the phenotype IgM10.
More preferably, the population of cells of the invention is characterized in that at least 90%, preferably at least 95%, yet preferably at least 99% of the cells within the population have the phenotype CD5hiCD10"CDlcloCD21intCD45RAintCD23hiCD24loCD38loIgDloIgMlo.
Preferably, the population of nBreg cells is characterized in that at least 15%, preferably at least 20% of the cells of the population have a genome which comprises at least part of the sequence of the IGKV4-1 gene of sequence SEQ ID NO. l.
Preferably, the population of nBreg cells is characterized in that, in said population, the frequency of VH3(DH)JH4 rearrangements is higher thanthe frequency of VH3(DH)JH3 rearrangements. In other terms, the population of nBreg cells is preferably characterized in that, in said population, the ratio of VH3(DH)JH4 rearrangements over VH3(DH)JH3 rearrangements is superior to 1: 1. Yet preferably, the population of nBreg cells is characterized in that, in said population, the ratio of VH3(DH)JH4 rearrangements over VH3(DH)JH3 rearrangements is superior to 3: 1, preferably superior to 4: 1, yet preferably equal or superior to 5: 1. The terms "VH3(DH)JH4 rearrangement" and "VH3(DH)JH3 rearrangement" should be construed as generally understood in the field, that is to say as refereing to a rearranged heavy chain DNA wherein the VDJ segment comprises respectively a gene of the VH3 family and the JH4 gene, or a gene of theVn3 family and the JH3 gene.
In the context of the invention, the antigen of interest may be any antigen for which an antibody is desired. Preferably, the antigen of interest refers to an (foreign) antigen derived from a microorganism or a cell (e.g., tumor cell) different from a the cells of the subject, against which one intends to elicit an immune response. The microorganism can be a bacterium, virus or fungus organism. For instance, antigens of interest include antigens derived from bacteria such as Chlamydia, Gonococcus, Mycoplasma, Tuberculosis and group B Streptococcus, antigens derived from HIV, Hepatitis virus, Variola (Smallpox) virus, Parvovirus and Cytomegalovirus, or antigens derived from Candida. Preferably the antigen is RSv, yet preferably the RSV-F protein.
Preferably, the biological sample is a blood sample.
Preferably, the subject is a human, preferably an infant, yet preferably an infant of 3 months old or of under 3 months old. In the context of the invention, the term "infant" should be construed as generally in the field, that is to say as referring to human children from two months to one year old.
Preferably, the subject from whom the biological sample is obtained has been in contact with the antigen of interest prior to collection of the biological sample. Advantageously, the subject from whom the biological sample is obtained has been infected by the antigen of interest, or a micro-organism comprising thereof, prior to collection of the biological sample.
Optionally, in the method of the invention, after the step of isolating a population of nBreg cells from a biological sample of a subject; and before the step of selecting a nBreg cell that produces an IgM that specifically binds to said antigen of interest; the person skilled in the art may add a step of culturing the population of nBreg cells in vitro, in the presence of the antigen of interest. This step may increase the chances that the population of nBreg cells of interest comprises at least one nBreg cell that produces an immunoglobulin of a primordial class that specifically binds to said antigen of interest. This additional step may be of interest when it is uncertain whether the subject from whom the biological sample is obtained has been in contact with the antigen of interest prior to collection of the biological sample.
In the context of the invention, the terms "immunoglobulin of a primordial class" should be construed as generally understood in the art, that is to say as either IgM or IgD. From the isolated population of nBreg cells, the person skilled in the art may easily select a nBreg cell that produces an immunoglobulin of a primordial class that binds to said antigen of interest using usual technics known in the art. For instance, as disclosed in details in the experimental part, such a nBreg cell may be selected on its hability to produce, advatatgesouly after in vitro stimulation with the antigen of interest, either IgM or IgD, using the ELISPOT technique. The person skilled in the art may then easily verify that the IgM or IgD produced by the nBreg cell binds to the antigen of interest, and determine the affinity of the binding, thereby the specificity of the antibody.
Antibodies are defined to be specifically binding if they bind to the antigen of interest with a Ka of greater than or equal to about 10 7 M -" 1. Affinities of binding partners or antibodies can be readily determined using conventional techniques, for example those described by Scatchard et al., Ann. N.Y. Acad. Sci., 51:660 (1949).
The further steps of generating copies of the genes encoding the immunoglobulin of a primordial class or a fragment of these genes; producing monoclonal antibodies or fragments thereof by expression of the protein encoded by the copies; and isolating the monoclonal antibodies or fragments thereof that specifically bind to the antigen of interest, can be performed according to the usual techniques known in the art and detailed hereunder with respect to the specific RSV embodiment.
For instance, cDNA library can be generated from the selected nBreg cell that produces an immunoglobulin of a primordial class that specifically binds to said antigen, by amplification of the mRNA corresponding to the genes encoding the immunoglobulin of a primordial class or a fragment of these genes, or possibly only the variable genes of heavy chains and light chains, by reverse transcriptase-PCR. The PCR products can then be used to construct recombinant monoclonal antibodies and fragments, said PCR products being cloned in appropriate expression vector.
In the context of the invention the term "vector" is to be construed as generally understood in the field, that is to say as autonomously replicating DNA molecules that can be used to carry foreign DNA fragments. Vectors have been extensively used in gene cloning and in protein expression, and the person skilled in the art can easily select an appropriate expression vector when implementing the method of the invention.
The vector may be derived from a virus Aprpopriate vectors may be vectors derived from Simian Viruses 40 (SV40), polyomavirus, herpesvirus and papovirus.
In choosing a expression vector, the person skilled in the art may take into consideration the host which will be used for the antibody production. Typically, for expressing genes in mammalian cells, usually vectors derived from mammalian viruses are used. Preferably, the PCR products are cloned into antibody gene expression cassettes which can be stably integrated into the host cell genome, and will provide long term production stability. Preferably the expression vector comprises comprises a promoter such as cytomegalovirus (CMV) or the cellular elongation factor (EF) 1 -alpha promoter. Preferably the expression vector comprises polyadenylation sites from the simian virus (SV) 40 or the bovine growth hormone (BGH)
When only the variable genes of heavy chains and light chains are amplified by RT- PCR, the expression vector may further comprise the genes encoding constant regions of the ligh chains, as well as the genes encoding the constant regions of the heavy chains of interest. In order to produce full monoclonal antibodies, the expression vector may comprise any of the genes encoding the constant heavy chains, which comprises the heavy-chain constant genes Cμ (Cmu), C5 (delta), Cy3 (Cgama3), Cyl (Cgamal), Cy2a (Cgama2alpha), Cy2p (Cgama2beta),C8 (Cepsilon) and Ca (Calpha), which are deemed necessary for the production of a heavy chain of the class or subclass of interest. The person skilled in the art may thus easily produce IgM, IgD, IgA, IgG (any of the four subclasses, IgGl, IgG2, IgG3, and IgG4), or IgE monoclonal antibodies. Preferably, the monoclonal antibodies produced by the method of the invention are IgM, or IgG.
These expression vectors may then be transfected into appropriate antibody production hosts. Known hosts typically used in the art and appropriate for use in the context of the invention are for instance mammalian cells, yeast, filamentous fungi, protozoa, insect cells, plant cells.
Usual mammalian cells appropriate in the context of the invention are for instance Chinese hamster ovary (CHO) cells, in particular the K1-, DukX B 11-, DG44-cell lines derived therefrom, the human embryonic retinal cell line Per.C6, mouse myeloma NSO cells, baby hamster kidney (BHK) cells, the African green monkey COS cells, the African green monkey Vero cells, the human HeLa cells, the mouse myeloma NSO cells, and the human embryonic kidney cell line HEK293. Usual yeast hosts appropriate in the context of the invention are for instance Pichia pastoris Saccharomyces cerevisiae, Hansenula polymorpha, Schizosaccharomyces pombe, Schwanniomyces occidentalis, Kluyveromyces lactis, and Yarrowia lipolytica. In particular, genetically modified glyco-engineered P. pastoris strains have been generated which produce humanized glycosylation patterns. Filamentous fungi appropriate in the context of the invention are for instance Trichoderma, in particular Trichoderma reesei, Aspergillus, in particular A. niger (subgenus A. awamori) and Aspergillus oryzae, as well as cell lines derivide therefrom and modified to improve glycosylation patterns. Among the protozoa appropriate in the context of the invention, one may cite for instance the eukaryotic parasite Leishmania tarentolae wich possesses a mammalian-like glycosylation pattern and is able to perform O-glycosylation as well as N- glycosylation. Insect cells appropriate in the context of the invention are for instance Spodoptera frugiperda, Drosophila melanogaster, or Trichopulsia ni, as well as cell lines derivide therefrom and modified to improve glycosylation patterns. Plant cells appropriate in the context of the invention are for instance Agrobacterium tumefaciens, Nicotiana tabacum, Nicotiana benthamiana, as well as cell lines derivide therefrom and modified to improve glycosylation patterns.
Preferably, the monoclonal antibodies fragments produced by the method of the invention are antigen-binding fragments. As used herein, an "antigen-binding fragment of an antibody" means a part of an antibody, i.e. a molecule corresponding to a portion of the structure of the antibody of the invention, that exhibits antigen-binding capacity for the antigen of interest possibly in its native form; such fragment especially exhibits the same or substantially the same antigen-binding specificity for said antigen compared to the antigen- binding specificity of the corresponding four-chain antibody. Advantageously, the antigen- binding fragments have a similar binding affinity as the corresponding monoclonal antibodies. However, antigen-binding fragment that have a reduced antigen-binding affinity with respect to corresponding 4-chain antibodies are also encompassed within the invention. The antigen- binding capacity can be determined by measuring the affinity between the antibody and the target fragment. These antigen-binding fragments may also be designated as "functional fragments" of antibodies.
In the context of the invention, antigen binding fragments of an antibody encompass Fv, dsFv, scFv, Fab, Fab', F(ab')2 fragments. Fv fragments consist of the VL and VH domains of an antibody associated together by hydrophobic interactions; in dsFv fragments, the VH:VL heterodimer is stabilised by a disulphide bond; in scFv fragments, the VL and VH domains are connected to one another via a flexible peptide linker thus forming a single-chain protein. Fab fragments are monomeric fragments obtainable by papain digestion of an antibody; they comprise the entire L chain, and a VH-CH1 fragment of the H chain, bound together through a disulfide bond. The F(ab')2 fragment can be produced by pepsin digestion of an antibody below the hinge disulfide; it comprises two Fab' fragments, and additionally a portion of the hinge region of the immunoglobulin molecule. The Fab' fragments are obtainable from F(ab')2 fragments by cutting a disulfide bond in the hinge region. F(ab')2 fragments are divalent, i.e. they comprise two antigen binding sites, like the native immunoglobulin molecule; on the other hand, Fv (a VHVL dimmer constituting the variable part of Fab), dsFv, scFv, Fab, and Fab' fragments are monovalent, i.e. they comprise a single antigen-binding site.
The monoclonal antibodies and the corresponding antigen-binding fragments can be purified from the culture supernatants by affinity chromatography.
The core principles and feautres of the invention can be used for preparing libraries of antibodies or of antibody fragments. Antibody libraries, as well as libraries of antibody fragments, in particular the scFv or Fab antibody fragments, are well known in the art. They typically consist in a plurality of replicable genetic constructs, wherein each genetic construct comprises in its genome a sequence coding for a specific antibody or antibody fragment, and is capable of expressing the peptidic product of said sequence and to display it on its surface. Typically, antibody libraries rely on phage-display technology, which uses genetically modified phages, and have been widely used to produce and screen libraries of polypeptides for binding to a selected target. In phage-display technology, the phage is modified to integrate a nucleotide sequence of interest. The modified phase then displays the polypeptide product of the nucleotide sequence of interest, as part of a capsid enclosing the phage genome. Other display technologies have been developed, which rely on various genetic construct, such as yeast-display.
The invention further pertains to a method for preparing a library of antibodies or fragments thereof, comprising:
- isolating a population of nBreg cells from a biological sample of a subject;
- selecting the nBreg cells that produces immunoglobulins of a primordial class;
- generating copies of the genes encoding said immunoglobulins, preferably the variable genes of heavy chain and light chain, or a fragment thereof,
- integrating said copies in a genetic construct, wherein the genetic construct is capable of expressing the peptidic product of said copies and to display it on its surface.
The steps of isolating a population of nBreg cells from a biological sample of a subject; selecting the nBreg cells that produces immunoglobulins of a primordial class; generating copies of the genes encoding said immunoglobulins, can easily be performed by the person skilled in the art, using as developed above. The step of integrating said copies in a genetic construct can be performed based on well known techniques of genetic engeneering and molecular cloning. Preferably, said genetic construct is a phage or a yeast, yet preferably a phage or a yeast adapted to display technology. When the library of antibodes is prepared using copies of the genes encoding the heavy chains, or fragments thereof, such as copies of the genes encoding the antigen -binding fragments of the four-chain antibodies, the peptidic product displayed by the genetic construct will possess features of the original primordial class antibodies, or fragment thereof, and can thus be refered to as a "primordial antibody library".
The invention pertains to a library of antibodies or fragments thereof, susceptible to be obtained by the method of the invention detailled above. Preferably, the library of antibodies or fragments thereof is a primordial antibody library.
As indicated, the method for preparing a primordial antibody library relies on the use of a population of nBregs, wherein preferably, as indicated above, the frequency of VH3(DH)JH4 rearrangements is much higher than the frequency of VH3(DH)JH3 rearrangements, and further, than the ratio of VH3(DH)JH4 rearrangements over VH3(DH)JH3 rearrangements is higher in this population than it is in mature na'ive B cells or immature B cells populations.
Preferably, in the library of antibodies of fragments thereof, the frequency of VH3(DH)JH4 rearrangements is higher than the frequency of VH3(DH)JH3 rearrangements. Yet preferably, in the library of antibodies of fragments thereof, the ratio of VH3(DH)JH4 rearrangements over VH3(DH)JH3 rearrangements is superior to 1: 1. Yet preferably, in the library of antibodies of fragments thereof, the ratio of VH3(DH)JH4 rearrangements over VH3(DH)JH3 rearrangements is superior to 3: 1, preferably superior to 4: 1, yet preferably equal or superior to 5: 1.
The antibody library may then further be used to prepare monoclonal antibodies of interest. For instance, an antibodyor antibody fragment may be selected from the library based on its hability to bind an antigen of interest, preferably in a specific binding. The nucleotidique sequences encoding the selected antibody or antibody fragment may then easily be retrieved from the genetic construct expressing said antibody or antibody fragment, and be cloned in expression vectors as detailed above. The person skilled in the art may thus easily produce IgM, IgD, IgA, IgG (any of the four subclasses, IgGl, IgG2, IgG3, and IgG4), or IgE monoclonal antibodies.
The invention further pertains to a monoclonal antibody derived from the library as defined above, wherein said antibody comprises VH3(DH)JH4 rearrangements. Preferably said antibody is an IgM or IgG antibody. The invention further pertains to a monoclonal antibody or fragments thereof, susceptible to be obtained by the method of the invention.
The variable regions (Fab) (in the corresponding light and heavy chains) of an antibody, in particular derived from a human origin, are each composed of seven amino acid regions, four of which are framework regions and three of which are hypervariable regions (also called CDR). The framework and CDR regions are herein refered to as defined by IMGT unique numbering. The IMGT unique numbering has been defined to compare the variable domains whatever the antigen receptor, the chain type, or the species. The IMGT unique numbering provides a standardized delimitation of the framework regions (FR1- IMGT: positions 1 to 26, FR2-IMGT: 39 to 55, FR3-IMGT: 66 to 104 and FR4-IMGT: 118 to 128) and of the complementarity determining regions: CDR1-IMGT: 27 to 38, CDR2-IMGT: 56 to 65 and CDR3-IMGT: 105 to 117.
In the context of the invention, the 3 framework regions of the light chains will be referred to as FR-L1; FR-L2, FR-L3, respectively, while the 3 framework regions of the heavy chains will be referred to as FR-H1; FR-H2, FR-H3, respectively.
As indicated above, the method preferably uses a population of nBreg cells wherein at least 15%, preferably at least 20% of the cells of the population have a genome which comprises at least part of the sequence of the IGKV4-1 gene of sequence SEQ ID NO. l. Monoclonal antibodies and fragments thereof, produced by the method of the invention using nBreg cells having at least part of the sequence of the IGKV4-lgene of sequence SEQ ID NO.l in their genome, will possess a specific peptidic sequence in their variable heavy chain corresponding to the framework sequences encoded by this gene.
Thus preferably, the monoclonal antibody of the invention comprises in its light chain domain, preferably in one of the FR-L1; FR-L2, FR-L3 regions as defined above, a sequence having at least 80% identity with at least one of the sequence SEQ ID NO. 2, 3 or 4 or a fragment thereof.
In the sense of the present invention, the "percentage identity" or "% identity" between two sequences of nucleic acids or amino acids means the percentage of identical nucleotides or amino acid residues between the two sequences to be compared, obtained after optimal alignment, this percentage being purely statistical and the differences between the two sequences being distributed randomly along their length. The comparison of two nucleic acid or amino acid sequences is traditionally carried out by comparing the sequences after having optimally aligned them, said comparison being able to be conducted by segment or by using an "alignment window". Optimal alignment of the sequences for comparison can be carried out, in addition to comparison by hand, by means of the local homology algorithm of Smith and Waterman, by means of the similarity search method of Pearson and Lipman (1988) or by means of computer software using these algorithms (GAP, BESTFIT, FASTA and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI, or by the comparison software BLAST NR or BLAST P). The percentage identity between two nucleic acid or amino acid sequences is determined by comparing the two optimally-aligned sequences in which the nucleic acid or amino acid sequence to compare can have additions or deletions compared to the reference sequence for optimal alignment between the two sequences. Percentage identity is calculated by determining the number of positions at which the amino acid, nucleotide or residue is identical between the two sequences, preferably between the two complete sequences, dividing the number of identical positions by the total number of positions in the alignment window and multiplying the result by 100 to obtain the percentage identity between the two sequences.
Yet preferably, the monoclonal antibody of the invention comprises a light chain comprising at least one, preferably two, and most preferably three, framework regions chosen from FR-L1; FR-L2 and FR-L3, wherein:
FR-L1 comprises at least a portion of the amino acid sequence SEQ ID NO. 2, FR-L2 comprises at least a portion of the amino acid sequence SEQ ID NO. 3, or FR-L3 comprises at least a portion of the amino acid sequence SEQ ID NO. 4.
Preferably, the monoclonal antibody or fragments thereof, susceptible to be obtained by the method of the invention, is an immunoglobulin of a primordial class, i.e. IgD or IgM, preferably IgM.
Preferably, the monoclonal antibody or fragments thereof, susceptible to be obtained by the method of the invention, binds specifically to the antigen of interest.
The invention encompasses methods for the preparation of nBreg cells. nBreg cells can be isolated as described in the Examples, or using similar techniques. For examples, B cells can be isolated based on surface CD 10 and CD5 markers to obtain CD10"CD5hi cells. Preferably, the nBregs are isolated using the CD20 marker to obtain CD20+ cells.
In various embodiments, distinct sets of B cell markers are used to isolate the nBregs. Preferably, the nBregs are isolated based on their characterization as CD5hiCD10" CDlcloCD21int CD45RAint CD23hiCD24lo CD38loIgDloIgMloCD43+CD9"CD62L" CD40intDRintCD25+/"CD27+/"CD70". In one embodiment, FACS purification is used to isolate CD20+CD10negCD5hi cells from cord blood. Any of the markers and reagents set forth herein can be used in the isolation of nBregs. In one embodiment, nBreg cells are isolated from cord blood mononuclear cells (CBMCs) or peripheral blood mononuclear cells (PBMCs) from child patients, for example, using Lymphoprep (Axis-Shield). In one embodiment, B cells are positively enriched from CBMCs or PBMCs by using anti-CD19 magnetic beads with AutoMACS (Miltenyi Biotec).
Preferably, the isolated nBregs produce IL-10 upon 48 h of stimulation with a strain of human RSV (HRSV-A)(MOI=2.5). In some embodiments, the nBregs are infected with Human respiratory syncytial virus (RSV). In some embodiments, the nBregs express CX3CR1.
In one embodiment, nBregs can be isolated using a biotinylated recombinant form of the RSV-F protein using affinity selection techniques (McLellan et al., 2013; McLellan et al., 2011).
Isolated nBreg Cell Populations
The invention encompasses isolated populations of nBreg cells. In one embodiment, a single nBreg is isolated.
Preferably, the isolated nBregs produce IL-10 upon 48 h of stimulation with A strain of human RSV (HRSV-A)(MOI=2.5). In some embodiments, the nBregs are infected with Human respiratory syncytial virus (RSV). In some embodiments, the nBregs express CX3CR1.
In various embodiments, the nBregs are specific for the RSV-F proteins. In one embodiment, the invention encompasses a single isolated nBregs specific for the RSV-F protein protein.
Methods for Preparing Monoclonal Antibodies against RSV
The invention encompasses the development of monoclonal antibodies (mAbs) specific for respiratory syncytial virus (RSV) for prophylactic and therapeutic purposes. The process can be based on the characterization of a subset of cord blood derived B cells with known or unknown RSV specificity that can be used to generate mAbs.
In various embodiments, isolated nBregs specific for RSV, preferably the RSV-F protein, can be used to generate monoclonal antibodies (mAbs) by conventional techniques. See, e.g., Fraussen et al., J Autoimmun. 35(2): 130-4 (2010); Bruggemann et al., Arch Immunol Ther Exp (Warsz) 63(2): 101-8 (2015).
The monoclonal antibodies of the invention can be produced using techniques such as those described by Alting-Mees et al., "Monoclonal Antibody Expression Libraries: A Rapid Alternative to Hybridomas", Strategies in Molecular Biology 3: 1-9 (1990), which is incorporated herein by reference. Similarly, binding partners can be constructed using recombinant DNA techniques to incorporate the variable regions of a gene that encodes a specific binding antibody. Such a technique is described in Larrick et al., Biotechnology, 7:394 (1989).
In some embodiments, mAbs are prepared using the techniques described in U.S. Patent 9,555,112; Kozbor, et al., Immunol Today 4: 72 (1983); Cote, et al., Proc Natl Acad Sci USA 80: 2026-2030 (1983); or Cole, et al., In: Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96 (1985).
The expression "monoclonal antibodies" as used herein refers to an antibody arising from a population of substantially homogeneous antibodies. More particularly, the individual antibodies of a population are identical except for a few possible naturally- occurring mutations, which may be found in minimal amounts. The monoclonal antibodies are directed against a single epitope of an antigen, preferably an RSV-F antigen.
In one embodiment, single cells from individual antigen- specific B cells are isolated by FACS and a cDNA library is generated. IgH and corresponding Igk or Igl light chain gene transcripts can be amplified by 2 successive rounds of RT-PCR. Restriction sites can be introduced by the nested primers used in the second PCR. IgH and Igk or Igl light chain PCR products can then be directly cloned into human immunoglobulin gene expression vectors. Cells, preferably 293F cells, can be co-transfected with plasmids encoding the IgH and IgL chains originally amplified from the same cell to produce recombinant IgM, IgG or IgA mAbs. The mAbs can be purified from supernatants by affinity chromatography.
In one embodiment, the invention encompasses methods for preparing a monoclonal antibody or fragments thereof that specifically bind to the RSV-F protein comprising isolating nBreg cells from a subject; selecting a nBreg cell that produces an IgM that specifically binds to the RSV-F protein; generating copies of the gene encoding the IgM or a fragment of the gene; producing monoclonal antibodies or fragments thereof by expression of the protein encoded by the copies; and isolating the monoclonal antibodies or fragments thereof that specifically bind to the RSV-F protein.
The nBreg cells can be isolated from a subject by the methods disclosed herein or by other similar methods that will be evident to the skilled artisan.
Selecting a nBreg cell that produces an IgM that specifically binds to the RSV-F protein can be performed by the methods disclosed herein or by other similar methods that will be evident to the skilled artisan. Generating copies of the gene encoding the IgM or a fragment of the gene can be performed by the methods disclosed herein or by other similar methods that will be evident to the skilled artisan.
In one embodiment, the copies are made by transforming the nBreg cell.
In various embodiments, the copies can be made by in vitro replication of DNA with an isolated polymerase. In one embodiment, the copies are generated by the polymerase chain reaction.
In one embodiment, the copies can be made by inserting the gene encoding the IgM or a fragment of the gene into a vector and allowing a host replicate the gene or fragment thereof. The fragment of the gene should encode a fragment of the IgM sufficient to confer specific binding to the target antigen, preferably the RSV-F protein. The cloning of a fragment of the IgM and its insertion into a vector can provide a mAb of any class or subclass (e.g., IgG, IgM, IgA).
Monoclonal Antibodies against RSV
The invention encompasses isolated mAbs that bind specifically to RSV proteins. Preferably, the mAbs block infection of a human cell by RSV. Most preferably, the mAbs bind specifically to the RSV-F protein.
Preferably, the mAbs are fully human antibodies, that is, derived fully from human sequences. Thus, the mAbs of the invention are preferably not humanized mAbs.
Preferably, the mAbs are IgM, IgG (e.g., IgGl), or IgA antibodies.
The invention further encompasses the isolated monoclonal antibodies and fragments thereof produced by any of the methods disclosed herein.
Antibodies are defined to be specifically binding if they bind to the target protein (e.g.,
RSV-F protein) with a Ka of greater than or equal to about 10 7 M -" 1. Affinities of binding partners or antibodies can be readily determined using conventional techniques, for example those described by Scatchard et al., Ann. N.Y. Acad. Sci., 51:660 (1949).
Antigen-binding fragments of such antibodies, which can be produced by conventional techniques, are also encompassed by the present invention. Antibody fragments and derivatives produced by genetic engineering techniques are also provided.
The expression "antibody fragment(s)" as used herein refers to functional portions of antibodies (as opposed to the whole antibodies), that is, portions of the antibodies able to bind to an antigen (antigen binding fragment). It is to be understood that the antibody fragments retain the ability to bind to the target (also generally referred to as antigen) of the antibody of reference. Examples of antibody fragments include the following fragments: Fv (composed of the variable regions of the heavy and light chains of an antibody), ScFv (divalent single-chain variable fragment), Fab (composed of the entire light chain and part of the heavy chain), F(ab')2 (composed of two Fab fragments linked by the hinge region).
Pharmaceutical Compositions Comprising mAbs and Uses thereof
The invention encompasses the mAbs or antibody fragments of the invention, together with a pharmaceutically acceptable carrier in a pharmaceutical composition and uses thereof. The pharmaceutical compositions may be sterilized and/or may comprise excipients, e.g., preservatives, stabilizers, wetting agents and/or emulsifiers, solubilizers, salts for regulating osmotic pressure and/or buffers and are prepared in a manner known per se, for example by means of conventional dispersing and suspending processes. The dispersions or suspensions may comprise viscosity-regulating agents. The suspensions or dispersions may be kept at temperatures around 2-4°C, or for longer storage may be frozen and then thawed shortly before use.
As skilled artisans will appreciate, the dosage of the mAb or antibody fragment depends upon the subject, and their age, weight, individual condition, the individual pharmacokinetic data, and the mode of administration.
The invention further pertains to a monoclonal antibody or a fragment thereof, that bind, preferably specifically, to an antigen of interest, or a pharmaceutical composition comprising thereof, for its use as a medicine, preferably for the treatment of an infection by said antigen of interest.
The pharmaceutical compositions of the invention can be used to treat a patient, preferably a newborn or infant, with an RSV infection.
Preferably, the pharmaceutical compositions of the invention comprise at least 25, 50, 100, 150, or 200 mg of the mAb or antibody fragment.
Preferably, the pharmaceutical composition comprises a dose of at least 1, 2, 5, 10, 15, 20, 25, or 50 mg/kg of the mAb or antibody fragment. Preferably, the dosage is between 1- lOOmg/kg, 5-20 mg/kg, or 10-50mg/kg.
In some embodiments, the pharmaceutical composition is administered at least 1, 2, 3, 4, 5, 6, or 7 times. In some embodiments, the pharmaceutical composition is administered every 7 or less, 14 or less, 30 or less, or 60 or less days. Preferably, the pharmaceutical composition is administered every 30 days for a total of 5 doses.
For injection, the pharmaceutical composition may be formulated in aqueous solutions, such as in physiologically compatible buffers such as Hanks' s solution, Ringer's solution, or physiological saline buffer. The solution may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
In certain embodiments, the compositions described herein additionally comprise a preservative, e.g., the mercury derivative thimerosal. In some embodiments, the pharmaceutical compositions described herein comprises 0.001% to 0.01% thimerosal. In other embodiments, the pharmaceutical compositions described herein do not comprise a preservative.
In various embodiments a pharmaceutical composition of the invention is administered to a subject by, including but not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, and percutaneous routes. Most preferably, the pharmaceutical composition is administered intramuscularly.
Preferably, the pharmaceutical compositions of the invention are used to treat an RSV infection in humans, preferably in a neonate, most preferably in a neonate with an acute RSV infection.
In some embodiments, the neonate has an increased number of nBregs or an increased level of IL-10 relative to an uninfected neonate.
The invention encompasses a pharmaceutical composition comprising a pharmaceutically acceptable carrier and an isolated monoclonal Ig, particularly IgM, or a fragment thereof that specifically binds to the RSV-F protein protein.
The invention also encompasses an isolated monoclonal Ig, particularly IgM, or a fragment thereof that specifically binds to the RSV-F protein protein for treating or preventing infection of an RSV infection in a human.
The invention further encompasses the use of an isolated monoclonal Ig, particularly IgM, or a fragment thereof that specifically binds to the RSV-F protein protein to treat or prevent infection of an RSV infection in a human.
The invention encompasses methods for treating or preventing an infection by an antigen of interest in a human in need thereof, which comprises administering a monoclonal antibody or a fragment thereof, that bind, preferably specifically, to an antigen of interest, or a pharmaceutical composition comprising thereof, according to the invention, to said human. The invention encompasses methods for treating or preventing infection of an RSV infection in a human. In one embodiment, the method comprises administering an isolated monoclonal IgM or a fragment thereof that specifically binds to the RSV-F protein protein to a human. Preferably, the isolated monoclonal Ig, particularly IgM, or a fragment thereof is produced by isolating nBreg cells from a subject; selecting a nBreg cell that produces an IgM that specifically binds to the RSV-F protein; generating copies of the gene encoding the IgM or a fragment of the gene; producing monoclonal antibodies or fragments thereof by expression of the protein encoded by the copies; and isolating the monoclonal antibodies or fragments thereof that specifically bind to the RSV-F protein protein.
EXAMPLES
Example 1. Blood.
Buffy coats were obtained from adult donors by the Etablissements Francais du Sang (France). Heparinized cord blood samples from healthy neonates collected by the Therapie Cellulaire of Hopital Saint-Louis (France). Written consent was obtained from the mothers. This study was conducted with the approval of the Ethics Committee of Institut Pasteur in agreement with the principles of the Declaration of Helsinki. For FACS analysis of infant B cells, we used blood samples from children from birth to 5 years of age that were admitted to the Hopital Erasme laboratory (Brussels, Belgium) for routine analysis of the common hematological parameters between March 2012 and June 2012. The final protocol of this study was approved by the Ethics Committee of Erasme Hospital, allowing us to test residual blood samples.
Example 2. Cohort of patients with acute bronchiolitis.
46 infants admitted to the NICU of the Bicetre Hospital for severe bronchiolitis were recruited. Infants being prophylactically treated with Palivizumab were excluded. After signed informed consent from the legal representatives of the children, 1 mL of blood in EDTA tubes (Sarstedt) and nasopharyngeal aspirates were obtained and stored at 4°C and at - 80°C. Samples were processed within 12 h. Diagnosis of viral bronchiolitis was confirmed using immunochromatography for RSV (Alere BinaxNow RSV, Alere) and respiratory virus Q-PCR techniques (either Simplexa Flu A/B & RSV Direct, Focus Diagnostics; or Argene Respiratory Multi Well System MWS r-gene range, Biomerieux). The study was approved by the local IRB (Pasteur Institute CoRC, no 2013-14) and the French Ministry of Research (no. 13.644). Details of the demographic and diagnostic data are detailed in the supplementary experimental procedures.
Example 3. Culture Medium and Reagents.
Complete medium consisted of RPMI-1640 supplemented with 10% fetal calf serum (ICN Biomedicals), 5xl0"5 M of 2-ME (Sigma), and antibiotics (Gibco BRL). R848 was purchased from InvivoGen. Human Influenza Virus A/PR/8/34 (IAV) was purchased from Charles River. Measles virus (MV, strain Schwarz) were amplified and titrated using Vero cells. Human coronavirus (HCoV-229E), Herpes simplex virus 1 (HSV, strain KOS), Human immunodeficiency virus (HIV) were used. Human T-lymphotropic virus (HTLV-1) was produced with Mt2 cell supernatants (kindly provided by MA Thoulouze). Epstein-Barr virus (EBV) was generated using B95.8 cell line. Recombinant human BAFF, IL-2 and IL-12 were purchased from Peprotech. CX3CL1 was from R&D Systems.
Example 4. HRSV strains and mutants
Human respiratory syncytial virus A (HRSV-A Long, kindly provided by F. Freymuth) was amplified and titrated on HEp-2 cells. Recombinant Human RSV (rHRSV-A) and recombinant Human RSV-Cherry (rHRSV-Ch) were previously described (Rameix- Welti et al., 2014). The procedures to generate the rHRSV-AG-Cherry and rHRSV-ASH are described in the supplementary info.
Example 5. RSV specific ELISA.
Maxisorp plates (NUNC) were coated with HRSV-A, or ASH and AG mutants or their WT counterparts described above at 4 °C overnight. Following blocking of the plates with 1% BSA in PBS at 37 °C for 1 h, IgM from CpG-stimulated cord blood B cell subsets were added to the plates for 1 h at room temperature. After washing, horseradish peroxidase (HRP) conjugated to goat anti-human IgM (Southern Biotech) with a TMB substrate was used. Optical densities (OD) were measured at 450 nm.
Example 6. Mass cytometry.
The antibodies were labeled 100 μg at a time according to the manufacturer's instruction with heavy metal-preloaded maleimide-coupled MAXPAR chelating polymers. Purified antibodies were purchased from Miltenyi. CBMC were stained with these reagents, DNA content stained by an iridium- 191/193 interchelator was used to identify individual cells, and by exclusion of a live-dead viability stain. Data were acquired using a CyTOF2 instrument (Fluidigm) and analyzed using vISNE algorithm on Cytobank (Fluidigm). Antibody clones used are detailed in the supplementary experimental procedures.
Example 7. Cell purification and culture
CBMCs or PBMCs from child patients or adults were isolated using Lymphoprep (Axis-Shield). B cells were positively enriched from CBMCs or PBMCs by using anti-CD19 magnetic beads with AutoMACS (Miltenyi Biotec). To recover the blood B cell subsets, the cells were sorted based on surface CD 10 and CD5 markers to obtain CD10+CD5+ (EVIT), CD10"CD5hi (nBreg) and CD10 CD5" (MN) B cell subsets using a FACS Aria 3 (BD). Cells sorted by AutoMACS and FACS were routinely >95% and 97-99% pure, respectively. B cells were stimulated with indicated compounds or viruses for 48 hours (MOI=2.5). For co-culture assay, mycoplasma-free HEp-2 cells were incubated for 2h at 37°C with rHRSV-Ch, supernatants were then discarded. 24 h later, cells were washed twice with PBS (lx), and purified nBregs, MN, or IMT B cells were added to the infected HEp2 cells for 48 h. Alternatively, cells were cultured with human BAFF (200 ng/ml), CpGB 1826 (5 μg/ml), and IL-2 (10 ng/ml). The supernatants were measured for IL10 by ELISA (eBioscience). To monitor infection of cells, mCherry fluorescence was detected either by LSR Fortes sa FACS (BD) or IncucyteZoom (Essen Bioscience) for live cell imaging. Antibodies used for FACS are described in the supplementary experimental procedures.
Example 8. Nasopharyngeal aspirate cells isolation.
Nasopharyngeal aspirates (NPA) were maintained on ice and processed within 24 h. The samples were repeatedly washed with PBS with 5% FCS and centrifuged until no visible mucus clumps remained in the solution. The samples were then filtered using a Falcon 100- μιη filter (Miltenyi Biotech). For nasal wash cell staining and isolation, filtered NPA cells were incubated with antibodies for 20 min.
Example 9. B cell repertoire analysis.
We characterized the IgM repertoire at the molecular level in various B-cell subsets from cord blood and the details can be found in the supplementary information.
Example 10. Microarray analysis.
5x10 negatively- enriched cord blood B cells were FACS-sorted as nBregs (CD19+CD5+CD10~CD3~), and stimulated for 6 h with 10 μ^πύ F(ab')2 goat anti-human IgM, R848 (^g/ml), HRSV-A (MOI=5) or IAV (MOI=4000HA/ml). The gene expression profiles were measured by Miltenyi Biotec using an Agilent DNA chip. We used the Agilent 60-mer Whole Human Genome Oligo Microarray containing approximately 44 K genes and gene candidates. Raw expression files and details can be accessed at the following link: http://www.ncbi.nlm.nih.gov/geo/ query/acc.cgi?token=orifscmydxsxvav&acc=GSE78847. Output data files were further analyzed using the Rosetta Resolver gene expression data analysis system. Microarrays Agilent files were processed, background corrected, and normalized using the quantile method with R and package Limma. Genes were averaged using ProbelD, and GeneName and transcripts were filtered using the refseq mRNA database. Principal component analyses on most differentially expressed genes, heatmaps and hierarchical clustering were performed using Qlucore Omics Explorer 3.1.
Example 11. Gene expression.
10 blood B cells stimulated or not with HRSV for 24h, were then analysed using appropriate primers for expression of EBB (CCCTTCCCAGAGATCTTCTCAC ; CAGCCCTGAGGATGAAGGAC ), IL10 (CCGTGGAGCAGGTGAAGAA ; GTCAAACTCACTC ATGGCTTTGTA ), and IL12A (CACAGTGGAGGCCTGTTTA ; TCTGGAATTTAGGCAACTCTCA RNAj on a Biomark System (Fluidigm).
Example 12. Intracellular staining assay.
CD19 B cell fraction was stained with surface markers (CD20, CD 10, CD5 and CD3) and live/dead-Blue to identify viable B cell subsets. Cells were stimulated for 30 min with 10 μ^πύ F(ab')2 goat anti-human IgM, R848 (^g/ml), HRSV-A (MOI=1/10) or IAV (MOI=4000HA/ml). Cells were then directly fixed and permeabilized using BD Cytofix/Cytoperm™ solution by following the manufacturer's instructions (eBioscience) and then subjected to intracellular phospho-CD79a detection.
Example 13. T cell differentiation in vitro.
5xl04 purified cord blood na'ive CD4+ T cells activated with anti-CD3/CD28 beads in ThO (no cytokine added) or Thl (with 10 ng/ml of IL-12) conditions were co-cultured with 5xl04 syngeneic B activated with HRSV. Alternatively, purified cord blood pDCs were stimulated with HRSV-A in the presence of nBregs for 48 h. Activated pDCs were sorted again by gating on CD123hiCD20- cells on FACSAria II. 104 activated pDCs were co- cultured with 5xl04 purified allogeneic cord blood na'ive CD4+ T cells. Five-six days later, differentiated T cells were restimulated with 50 ng/ml PMA, 1 μg/ml Ionomycin and GolgiPlug (BD) to detect intracellular cytokines (IL-2, IFN-γ, IL-13, IL-17, IL-22 and TNF- a), Alternatively, secreted IFN-γ, IL-13 and IL-17 were detected by ELISA with a specific kit (eBiosciences).
Example 14. ELISPOT
nBregs were stimulated or not with HRSV-A for 24h. IL10 secreting nBregs were enriched using IL-10 cytokine secretion assay according to the manufacturer's protocol (Milteny Biotec). Enriched cells were then FACS sorted for IL-10-positive cells and used for human fluoroSpot IgM according to the manufacturer's protocol (Mabtech). Alternatively, IgM secreting cells were also analysed with an HRP-based ELISPOT assay (Mabtech).
Example 15. Statistical analysis.
Unpaired t tests were done in comparison of two groups (data are presented as the mean value ± SD). Paired t tests were also used to take into account donor to donor variation. ANOVA tests were used when comparing three groups or more. Spearman tests were used for correlations. P values <0.05 were considered statistically significant.
Example 16. RSV infection activates neonatal Bregs resulting in IL-10 production
To analyze the activity of putative Breg cell activity in healthy human newborns, we first examined neonatal B cells within the cord blood mononuclear cell (CBMC) population using a 35-parameter mass cytometric approach (CyTOF). Within the B cell population, unsupervised analysis using the viSNE algorythm that allows dimensionality reduction (Amir el et al., 2013), we revealed different B subsets with different phenotypes that clustered according to their high expression of CD5 or CD 10 and that were associated with distinct sets of B cell markers (Fig. 1A-B and Fig. 9). Mature naive (MN) CD19+ B cells were phenotypically defined as being CD5 CD10"
CDlchiCD21hiCD45RAhiCD23loCD24intCD38intIgDhiIgMlo/hi, although there was some heterogeneity for some markers. Immature transitional B cells (IMT, N°2), basically corresponding to CD24hiCD38hi B cells, were phenotypically defined as being CD5loCD10+CDlc"CD21"CD45RAintCD23"CD24hiCD38hiIgDintIgMhi. We also found an additional, previously undescribed population of CD5hi B cells, phenotypically defined as being CD5hiCD10"CDlcloCD21int CD45RAklt CD23hiCD24lo CD38loIgDloIgMlo (N°3) (Fig. 1A). We compared the cytometry profiles for additional CD markers of MN B cells, IMT B cells, and the newly defined CD5hi population to bulk CD19+CD20+ B cells and further defined the CD5hi B cell phenotype as CD43+CD9"CD62L"CD40intDRintCD25+/"CD27+/"CD70" (Fig. IB). Adult blood IMT CD24hiCD38hi B cells have been shown to produce IL-10 in response to CD40 (Blair et al., 2010) or CpG and/or TLR9 activation (Menon et al., 2016). Therefore the abundance of IMT B cells in cord blood suggested that these cells could be a major source of IL-10 in newborns. IMT B cells could be distinguished by CD10 expression with an intermediate cell surface expression of CD5 (Fig. 9A), which accurately matched the high expression of CD24 and CD38 (Fig. IB). To analyze the functions of newborns B cells, the three cord blood B cell populations were sorted by fluorescence activated cell sorting (FACS) based on cell surface CD5 and CD10 expression (Fig. 9B). Among these cord blood- derived cells, CD5hiB cells, but not IMT and MN B cells, produced IL-10 upon 48 h of stimulation with A strain of human RSV (HRSV-A)(MOI=2.5) (Fig. 1C). Based on their IL- 10 production, we thus named CD5hiB cells neonatal Bregs (nBreg). nBregs were abundant in neonatal blood from preterm and full-term babies and their frequency among total B cells quickly waned with age (Fig. ID). To determine whether these cells originated from the mothers of the babies or the babies themselves, we performed Fluorescence In Situ Hybridization (FISH) on nBregs from male babies. FISH detected X and Y chromosomes in all of the nBregs isolated from the cord blood of male babies, indicating that the nBregs were derived from the babies rather than the mothers (Fig. IE). We then sought to determine the stimuli that can lead to IL-10 production from nBregs. While nBregs made IL-10 in response to HRSV (Figure 1C), the nBregs failed to produce IL-10 following infection with a large panel of RNA or DNA viruses, including influenza A virus (IAV), coronavirus 229E, HIV, HSV-1, HTLV and MV (Fig. 9C). To determine whether the induction of the IL-10 response by HRSV was specific to neonatal B cells, we tested the various adult blood B cell subsets and tested their responsiveness to HRSV.
We first peformed CyTOF on adult IMT B cells, memory B cells, marginal zone B (MZB) cells, and na'ive B cells. Adult IMT cells displayed a phenotype similar to newborn IMT cells, whereas MZBs cells and memory B cells were phenotypically distinct from nBregs (Fig. 10A). FACS sorted adult memory B cells, MZB cells and IMT cells produced IL-10 in response to R848, a TLR7 agonist, but not in response to HRSV (MOI=2.5) (Fig. 10B). These data indicate that HRSV-activated nBregs may possess unique anti-inflammatory properties. The Thl-Th2 balance is critical at the time of the primary RSV infection, as impaired Thl priming or a Th2 immunopathology have been shown to determine the outcome of secondary infection (Culley et al., 2002). We thus performed an inflammatory T cell suppression assay, which remains the gold standard for assessing Breg activity. Coculture of RSV-activated nBregs with activated CD4+ Thl cells inhibited IFN-γ and IL-22, but not TNF-a, cytokine production from the CD4+ T cells (Fig. 2A-C). Using IAV-activated neonatal plasmacytoid DCs (pDCs), we recently showed that type I IFN dependent neonatal Thl differentiation is induced by the allogeneic immune response (Zhang et al., 2014a). Similarly, RSV-activated neonatal pDCs induced a predominantly IFN-γ Thl response that was associated with a mild IL-4 Th2 responses (Fig. 2D-F). To investigate whether nBregs could regulate Thl response indirectly via pDCs, pDC were cultured alone or with RSV-activated nBregs for 2 days, then these cells were co-culture with na'ive T cells for six days post. We observed few pDCs infected by RSV when cultured alone or after coculture with nBregs (Fig. 11 A). RSV- activated nBregs were able to inhibit the ability of pDCs to prime a IFN-γ T-cell response in an IL-10-dependent manner (Fig. 2D-F). This was associated with decreased the APC functions of pDCs (HLA-DR and CD80), but not the IFN-γ response (Fig. 11B). Altogether, these data demonstrate that the nBregs can be specifically activated by RSV and may control the Thl responses in an IL-10 dependent manner.
Example 17. Neonatal Bregs are highly permissive to RSV infection
We further investigated the capacity of RSV to directly activate the immunosuppressive properties of nBregs. RSV induced IL-10 transcription in sorted cord blood nBregs as soon as 6 h after exposure (Fig. 3A). We used a rHRSV-expressing mCherry (rHRSV-Ch) construct (Rameix- Welti et al., 2014), to visualize the virus replication in cells by quantifying the red emitted fluorescence. We found that nBregs were preferentially infected by the virus (Fig. 3B) compared to MN or IMT B cells isolated from cord blood. RSV infection did not affect the viability of nBregs (Fig. 12A). Among adult B-cell subsets, only memory B cells were able to be infected with RSV, but they showed much lower viral replication compared with nBregs. (Fig. 12B). nBregs harboring RSV produced more IL-10 compared to their RSV-negative counterparts (Fig. 3C and D) and only live but not UV- treated RSV induced IL-10 production (Fig. 3E), indicative of a role for viral infection in nBreg activation. Epithelial cells of the respiratory tract are the major targets of HRSV replication in vivo. We found that nBregs, but not MN and IMT B cells, produced IL-10 and were preferentially infected when cocultured with a RSV-infected human epithelial HEp-2 cell line (Fig. 3F and G). Altogether, these data show that nBregs are specifically permissive to RSV infection and that IL-10 production by nBregs requires their viral infection.
Example 18. RSV is recognized by IgM and can engage the BCR pathway in nBregs
During steady state or upon RSV-mediated activation, nBregs expressed immunoglobulin M (IgM) and IgD, but not IgA or IgG (Fig. 9B and D). In addition, RSV- nBreg cell specific interactions led to IgM secretion by the majority of IL-10-producing cells (Fig. 3H), suggesting a role for the BCR. To investigate this hypothesis, we used a transcriptomic approach to compare nBregs following TLR (R848), BCR (anti-IgM) or viral (RSV or IAV) activation. Principal component analysis (PCA) and hierarchical clustering showed the similarities and distinctness of the Breg response to different activators (Fig. 4A and B). The transcriptional profiles of nBregs stimulated with anti-IgM (BCR) and RSV were closer than with TLR agonist closely related, indicating that BCR activation could be involved in RSV infection. TLR7 or 8 activation by the R848 agonist did not recapitulate the transcriptional pattern of viral activation. Therefore, RSV RNA sensing by TLR7 or 8 may not be essential for the activation of nBregs and may explain why other RNA viruses did not induced IL-10. In addition, pathway analysis showed that RSV activated nBregs significantly upregulated BCR-related pathways but not TLR-, RIG-I- or CD40-related pathways (Fig. 4C). RSV and BCR activation induced expression of common 534 genes in nBregs, as shown on the Venn diagram in Fig. 13 A. Gene set enrichment analysis (GSEA) analysis of the transcriptome also indicated that BCR pathways were induced in nBregs by RSV compared whereas IAV infection did not specifically induce BCR pathways (Fig. 13C). To confirm that RSV-infected nBregs were triggered through their BCRs, we performed an Iga (CD79a) phospho flow assay. Iga phosphorylation was detected in nBregs 30 min. following treatment with anti-IgM or RSV, but not with R848 or IAV treatment (Fig. 4D and E). All the stimuli activated nBregs, as shown by Erk phosphorylation (Fig. 13D). In conclusion, the above experiments strongly indicate that RSV activation of nBregs is mediated in part by Ig recognition.
To further address the role of the BCR at the level of Ig recognition, we analyzed the IgM secreted by nBreg. nBregs produced 5-fold higher concentrations of IgM than MN cells, and 50-fold higher concentrations than IMT cells (Fig. 14A). This finding was confirmed using ELISPOT in which over 80% were secreting IgM nBregs as compared to 10-15% of MN B cells as assessed (Fig. 14A). IgM produced by nBregs, but not MN or IMT B cells, showed specific binding to RSV particles (Fig. 5A and S6B). The mature HRSV envelope consists of glycoprotein (G), fusion (F) protein and small hydrophobic (SH) protein. We found by ELISA that IgM from nBregs recognized the F fusion protein of HRSV but barely recognized the HIV-1 envelope glycoprotein gpl40 (Fig. 5A). These IgM still bound the rHRSV-ASH and the rHRSV-AG mutants showing that F, but not G or SH, were recognized by the Ig (Fig. 14B). Palivizumab, which is an IgGl humanized monoclonal antibody that binds to F protein outcompeted the binding of nBreg-derived IgM to RSV in a dose- dependent manner (Fig. 5B). In addition, IgM produced by nBregs, but not by MN or IMT B cells, competitively inhibited RSV infection of nBregs (Fig. 5C). We concluded that the F fusion protein, but not SH and G proteins on the virion contributes to IgM-mediated recognition of RSV by nBregs. This further reinforced the results from transcriptomics and signaling analyses that indicated the engagement of the BCR in nBregs infection by RSV.
Our results indicated that nBreg Ig recognized RSV in the absence of any previous exposure to the virus. One possible explanation of such a property may rely on polyreactivity of the nBreg-IgM that may have developed in utero upon exposure to self- antigens. Compared to neonatal MN-IgM, nBreg-IgM displayed canonical features of polyreactive B cells, including self-antigen recognition (Fig. 14A). To explore the molecular basis of this phenomenon, we compared the different neonatal B cell subsets at the level of their Ig repertoire. There was no bias in the usage of specific Ig heavy chain V genes (IGHV) in the IgM derived from nBregs. However, nBreg IgM exhibited a shorter complementarity determining region 3 (CDR3) for most of the IGHV genes, representing more than 90% of the BCR repertoire (Fig. 5D and Fig. 14C and D). A short CDR3 has been reported for MZB cells (Weller et al., 2008) that do not express CD23 and CD5 (Weill et al., 2009). CD27+ "B l-like cells" were described to have a 14 bp CDR3 (Griffin et al., 2011), whereas the CDR3 of nBregs was a 12.9 bp+/-0.2 in length (Fig. 5D). We identified preferential usage of the IGHJ4 segment associated with IGHD6 in nBregs by analyzing the IGHV3 gene PCR products (Fig. 5E-F and Fig. 14E). Both CD27+ and CD27"nBregs showed similar repertoire characteristics and functional properties, such as eqivelent susceptibility to RSV infection and similar concentrations of IL10 production upon stimulation with RSV (Fig. 14F-G). Therefore, the Ig repertoire analysis of nBregs showed that this population constituted a B cell subset with unique characteristics, presumably resulting from specific selection and/or maintenance processes. In summary, the repertoire traits, together with the viral particle recognition by nBreg IgM, provide the molecular basis for the activation of the BCR pathway following exposure to RSV.
Example 19. The RSV G glycoprotein interaction with CX3CR1 is critical to infect nBregs
Because ultraviolet (UV) inactivation of RSV impaired IL-10 production, the polyreactive nature of nBreg-IgM was not sufficient to explain the triggering of nBreg activity by RSV. The G glycoprotein harbors a CX3C chemokine motif capable of chemokine mimicry when interacting with chemokine receptor CX3CR1 (Tripp et al., 2001). This interaction is reported as an important mechanism for RSV binding and infection in human lung epithelial cells (Jeong et al. 2015; Chirkova et al. 2015). Because nBreg exposure to RSV activated chemokine receptor pathways (Fig. 4C), we analyzed CX3CR1 expression on cord blood B cells. CX3CR1 was expressed by monocytes, but not by B cells, including nBregs (Fig. 6A). However, after 48 h of RSV exposure, CX3CR1 was induced on nBregs (Fig. 6B), an effect that was mimicked by BCR activation, but not by TLR activation (Fig. 6C). Using rHRSV-Ch, we observed that viral infection of nBregs was associated with the highest frequencies of nBregs expression cell surface CX3CR1 relative to other stimuli. We found that an RSV AG mutant poorly infected nBregs (Fig. 6F-G) and was unable to induce IL-10 production (Fig. 6D), despite its ability to trigger BCR Ig phosphorylation (Fig. 6E). This indicates that G protein binding to CX3CR1 was necessary to induce IL-10 production. In the presence of the CX3CR1 ligand CX3CL1, RSV infection was strongly decreased, concomitant with the inhibition of the IL-10 secretion (Fig. 6H), indicating that CX3CL1 is blocking the interaction of the RSV G protein with CX3CR1, which is therefore essential for the induction of nBreg activity. Our results show that RSV, upon binding of surface Ig on nBregs, induces the upregulation of CX3CR1 which, in turn, interacts with the G glycoprotein and favors viral entry and replication in Bregs. This two-step mechanism can explain the permissiveness of nBregs to RSV infection and the specific induction of IL-10 which does not occur with the other viruses tested.
Example 20. RSV infects infant nBregs and nBregs are predictive of disease severity Infants under 3 months of age who develop acute severe bronchiolitis because of RSV infection may require ventilator support and are at a much higher risk to develop recurrent wheezing up through their teenage years (Stein, 2009). This is often thought to be associated with Th2 responses. However, post-mortem analysis in fatal cases reveals heavy pulmonary infiltration of B cells, but not T cells, in the lung upon RSV infection (Reed et al., 2009). RSV remains in the respiratory tract and does not spread to the blood. IL-10 can be detected in the nasopharyngeal aspirates (NPA) of RSV-infected children (Bont et al., 2001) and is associated with post-bronchiolitis wheeze (Schuurhof et al., 2011). We therefore looked for the presence of nBregs in the NPA of hospitalized RSV-infected children who required respiratory assistance. In 6 out of the 13 patients, RSV-infected nBregs were found in NPA swabs, whereas 2 patients showed RSV-infected MN B cells, highlighting the preferential infection of nBregs in vivo. The frequency of nBregs correlated with the severity of the disease, as assessed by the duration of oxygen support and hospitalization in the ICU (Fig. 7A and Fig. 15). We also found a higher frequency of nBregs in the blood of RSV-infected patients suffering from acute bronchiolitis compared to non-infected children, and a positive correlation between the percentage of nBregs with the disease severity and the viral load, but not with the age of the patient or the pregnancy term (Fig. 7B-D and Fig. 15). In contrast to MN and IMT B cells, nBregs purified from the blood of RSV-positive patients expressed IL10 mRNA upon RSV exposure, but not IL35, IL12A and EBI3, subunits (Fig. 7E), indicating the capacity of nBreg activity to be activated following their recruitment at the site of infection.
In the neonatal blood, we identified emerging CD4+ T cell effector memory (Tern) including CXCR3+ IFN-γ producing Thl cells (Zhang et al., 2014b). RSV-activated nBregs limited the development of neonatal Thl responses in vitro (Fig. 2). We found a higher frequency of Tern cells, but not Treg cells, in the blood of RSV-infected children compared to RSV un-infected children. The percentage of Tern cells and CXCR3+Tem cells negatively correlated with bronchiolitis severity, but not with the age of the patient or the pregnancy term (Fig. 7F-G and Fig. 15). Among the RSV-infected patients, the frequency of CXCR3+ Tern cells was significantly lower when nBregs were infected with RSV, as measured in the NPA (Fig. 7H). These findings indicate that RSV infection of nBregs may inhibit CXCR3+ Tern responses in patients to reduce viral clearance and to drive more severe lung disease.
Example 21. B cell repertoire analysis.
We characterized the IgM repertoire at the molecular level in various B-cell subsets from cord blood. IGHV gene usage and CDR3 analysis were performed using the Immuno scope method coupled with real-time PCR to provide quantitative information on the IGHV and IGHJ gene usage. Briefly, PCR reactions were performed by combining a primer and a specific fluorophore-labeled probe for the constant region C^ with one of eight primers covering the different IGHV1-7 genes. V3 was divided in two subgroups: V3a (V3- 15,49,72,73) and V3b (V3-d,07,09,l 1,13,20,21,23,30,30.3,33, 43, 48,53,64,66,74). Reactions were performed using Taqman 7300. PCR products were subjected to run-off reactions with a nested fluorescent primer specific for the constant region gene. The fluorescent products were separated and analyzed on an ABI-PRISM 3730 DNA analyzer to determine CDR3 lengths. The IGHV3a/C amplification prod ucts were cloned, sequenced, and analyzed according to the procedure described previously (Lim et al., 2008). A more detailed analysis of ν^μ H- chain transcripts was performed to examine the usage of IGHD families and the IGHJ gene as well as the of the IGHV-D and IGHJ-IGHD junction regions. IMGT/junction analysis was used to accurately identify the different regions of the junctions: 3'V-region, D-region(s), and 5'J-region. IGVH CDR3 length was analyzed in nBregs, and NM B cells. Each profile represents the CDR3 length distribution for a given IGVH family. One-way ANOVA was used for group comparisons; P values <0.05 were considered statistically significant. List of primers is detailed below.
Example 22. HRSV mutants
To generate the rHRSV-AG-Cherry virus, the first ATG of the G gene was substituted by ACA by site-directed mutagenesis using the QuickChange II site-directed mutagenesis kit (Stratagene). Mutagenesis was performed using the pJET2.1 vector in which the HRSV G gene was cloned at Xhol-Stul sites, with the following primers: forward primer: CGTTGGGGCAAATGCAAACACATCCAAAAA CAAGGACCAACGC; reverse primer: GCGTTGGTCCTTGTTTTTGGATGTGTTTGCATTTGCC CCAACG (sequence changes were boxed). The modified sequence was then sub-cloned in the pACNR-rHRSV-Cherry vector (Genbank accession N° KF713492.1) to engineer the pACNR-rHRSV-AG-Cherry vector. Sequence analysis was carried out to control the integrity of this vector. The recombinant rHRSV-AG-Cherry virus was recovered by co-transfecting the pACNR-rHRSV- AG-Cherry vector together with plasmids expressing the RSV N, P, M2-1 and L proteins in BSRT7/5 cells (Buchholz et al., 1999) as previously described (Rameix -Welti, 2014). Rescued viruses were passaged and amplified on Vero cells grown at 37°C with 5% C02 in EMEM (Gibco) supplemented with 2% foetal calf serum (FCS). To control that rHRSV-AG- Cherry no longer express G, immunofluorescence was carried out after virus titration on Vero cells (described below). Briefly, 6 days postinfection cells were wash with PBS IX, fixed with PBS- PFA 4% and labelled with either a polyclonal anti-N serum (Castagne et al., 2004) or anti-G monoclonal antibodies (AbD Serotec). Fluorescent plaques were observed using an inverted fluorescence microscope. For rHRSV-ASH, SH gene together with corresponding Gene Start and Gene End signals was deleted from the full-length cDNA clone of HRSV subgroup A previously described (Rameix- Welti et al., 2014) using standard cloning procedures. Resulting sequence is available in the Genbank nucleotide database with accession code KU707921. rHRSV-ASH was rescued and amplified as previously described. Viral genome sequence was verified at passage 3. Viruses were titrated on Vero cells at 37°C using a plaque assay procedure derived from the one previously described (Rameix -Welti et al., 2014).
Example 23. RSV detection in nasal washes.
For RSV expression, B cell subsets were directly sorted from the nasal washes in a Lysis Solution (Lysis Enhancer and Resuspension Buffer at a ratio 1: 10) (CellsDirect™ One- Step qRT-PCR Kit, Invitrogen). Sequence-specific pre-amplification was performed using TaqMan PreAmp Master Mix (Invitrogen). Unincorporated primers were inactivated by Exonuclease I treatment (New England Biolabs). RSV nucleoprotein gene N analysed by qPCR with 2x Sso Fast EvaGreen Supermix With Low ROX (Bio-Rad Laboratories) using primers in 48:48 Dynamic Arrays on a Biomark System (Fluidigm). Quantitative data for the viral N was normalized to house keeping genes mRNA content (β-actin and GAPDH). RSV N forward primer AGATCAACTTCTGTCATCCAGCAA and reverse primer TTCTGCACATCATAATTAGGAG TATCAAT were used.
Example 24. Polyreactivity ELISA
IgM (3-4ug/ml) from nBregs or MN were tested for polyreactivity using high-binding 96-well ELISA plates (Costar) coated with 10 μg/ml of LPS from E. coli (Sigma, L2637), Keyhole Limpet Hemocyanin (KLH) (Sigma, H8283), ssDNA from dsDNA (heated at 95°C for 30 min), 5 μg/ml Human insulin (Sigma, 19278), HEp-2 whole cell lysates (Prigent et al., 2016) and purified HIV-1 (YU-2) gpl40 trimers gpl40 (Mouquet et al, 2011). (2^g/ml). ELISA done as previously described. HRSV-F protein (4μg/ml) was described (McLellan et al., 2011 ; McLellan et al., 2013)
Figure imgf000042_0001
Figure imgf000043_0001
Figure imgf000044_0001
Figure imgf000045_0001
Example 25. Isolation, Cloning, and Expression of Monoclonal Antibodies
Two different strategies can be conducted. The first one is based on FACS purification of cord blood derived nBregs (CD20+CD10negCD5hi cells) and the 2nd approach selects a few highly specific for the RSV-F protein using the biotinylated recombinant prefusion form of the protein (McLellan et al., 2013; McLellan et al., 2011).
The group led by Hugo Mouquet is using a very efficient method for cloning antibody genes from individual B cells from different compartments, thereby permitting the analysis of the human immunoglobulin gene repertoire and B-cell receptor reactivity (Julie Prigent, Valerie Lorin, Ayrin Kok, Thierry Hieu, Salome Bourgeau, and Hugo Mouquet, Scarcity of autoreactive human blood IgA+ memory B cells, Eur J Immunol. 2016 Oct; 46(10): 2340- 2351; Tiller, T., Meffre, E., Yurasov, S., Tsuiji, M., Nussenzweig, M. C. and Wardemann, H., Efficient generation of monoclonal antibodies from single human B cells by single cell RT- PCR and expression vector cloning, J. Immunol. Methods 2008. 329: 112-124.)
In summary, single cells from individual antigen-specific B cells are isolated by FACS and a cDNA library is generated. IgH and corresponding Igk or Igl light chain gene transcripts are amplified by 2 successive rounds of RT-PCR. All PCR products are sequenced to perform detailed Ig gene sequence analyses. Restriction sites are introduced by the nested primers used in the second PCR. IgH and Igk or Igl light chain PCR products are directly cloned into human immunoglobulin gene expression vectors. Plasmid inserts are sequenced to confirm identity with the original PCR product. 293F cells are co-transfected with plasmids encoding the IgH and IgL chains originally amplified from the same cell to produce recombinant IgG or IgA mAbs that are purified from supernatants by affinity chromatograhy.
Example 26. Reactivity Screening and specificity evaluation
Antibodies can be produced at microgram scale and tested by ELISA for RSV reactivity. ASH and AG mutant can be used to assess recognition of SH, G and F proteins. Specificity for pre-F and post F form of the fusion protein can also be evaluated by ELISA Example 27. Neutralizing activity
To assess the neutralizing activity of the mAbs a recombinant HRSV-A virus expressing mCherry reporter protein (Rameix -Welti et al., 2014) can be used. Upon infection, Hep 2 cells express mCherry and infection can be assessed along a large time-frame in a very sensitive way. This allows an automation of the process by fluorescent microscopy using Incucyte technology available at the CIH platform. The mAbs having neutralization activity can be characterized by defining the neutralization site and the Ag/Ab interaction by X-Ray crystallography and the validation of the anti-RSV activity in cotton rats.
Example 28. Immunoglobulin gene features of nBreg antibodies
To characterize the IgM antibody repertoire of nBregs, we FACS-isolated single CD19+CD10~CD5+IgM+ B lymphocytes from the cord blood of four healthy donors, and amplified their heavy- and light-chain variable domain (IgH and IgL, respectively) genes as previously described 1 ' 2. IgH and IgL gene features of 268 nBregs were compared to those of single immature (imB, CD19+CD10+CD5+IgM+, n=263) and mature na'ive (mnB, CD19+CD10~CD5TgM+, n=274) B cells sorted from the same samples. Comparative analyses of IgH variable (V), diversity (D) and joining (J) genes, and characteristics of the complementary determining region 3 (CDRH3) confirmed previously identified bias in the global nBreg population1, which showed increased JH4 gene usage at the expanse of JH3 genes (Figure 16 A), and shorter CDRH3S particularly, in VH3 -encoded antibodies (Figure 16B). The analysis also revealed an increased YRI-2 gene expression (10.8% vs 3.5% for imB and 5% for mnB) and decreased frequency of VH3(DH)JH3 rearrangements in the nBreg subset compared to imB and mnB cells (Figures 16C and 16D). In comparison to mnB alone, nBregs showed increased frequency of VH3(DH)JH4 rearrangements and conversely, a lower number of VH1(DH)JH3 recombined fragments (Figure 16D). nBreg, imB and mnB cells did not differ in terms of k/1 light chain usage (Figure 16E), Igl V and J gene distributions and CDRL3 characteristics (Figure 17). However, nBregs had increased usage of Vk4 gene segments especially, Vk4-1 gene (22.5% vs 4.34% for imB and 9.3% for mnB) (Figures 16F and 16G). Moreover, nBregs more frequently combined Vk4-expressing IgL with VH3- and VHI- expressing IgH (Figures 16F and 16G), and had a distinct pattern of positive charges in CDRk3s when compared the other cord blood B-cell subsets (Figure 16F).
Together, these data showed that nBregs displayed a singular immunoglobulin gene repertoire with unique IgH and IgL characteristics, which differentiate them from both imB and mnB cells. References
Amir el, A.D., Davis, K.L., Tadmor, M.D., Simonds, E.F., Levine, J.H., Bendall, S.C., Shenfeld, D.K., Krishnaswamy, S., Nolan, G.P., and Pe'er, D. (2013). viSNE enables visualization of high dimensional single-cell data and reveals phenotypic heterogeneity of leukemia. Nature Biotech 31, 545-552.
Blair, P.A., Norena, L.Y., Flores-Borja, F., Rawlings, D.J., Isenberg, D.A., Ehrenstein, M.R., and Mauri, C. (2010). CD19(+)CD24(hi)CD38(hi) B Cells Exhibit Regulatory Capacity in Healthy Individuals but Are Functionally Impaired in Systemic Lupus Erythematosus Patients. Immunity 32, 129-140.
Bont, L., Heijnen, C.J., Kavelaars, A., van Aalderen, W.M., Brus, F., Draaisma, J.M., Pekelharing-Berghuis, M., van Diemen-Steenvoorde, R.A., and Kimpen, J.L. (2001). Local interferon-gamma levels during respiratory syncytial virus lower respiratory tract infection are associated with disease severity. J Infect Dis 184, 355-358.
Castro, M., Schweiger, T., Yin-Declue, H., Ramkumar, T.P., Christie, C, Zheng, J., Cohen, R., Schechtman, K.B., Strunk, R., and Bacharier, L.B. (2008). Cytokine response after severe respiratory syncytial virus bronchiolitis in early life. J Allergy Clin Immunol 122, 726-733 e723.
CuUey, F.J., Pollott, J., and Openshaw, P.J. (2002). Age at first viral infection determines the pattern of T cell-mediated disease during reinfection in adulthood. J Exp Med 196, 1381- 1386.
Descatoire, M., Weill, J.C., Reynaud, C.A., and Weller, S. (2011). A human equivalent of mouse B-l cells? J Exp Med 208, 2563-2564; author reply 2566-2569.
Dougan, S.K., Ashour, J., Karssemeijer, R.A., Popp, M.W., Avalos, A.M., Barisa, M., Altenburg, A.F., Ingram, J.R., Cragnolini, J.J., Guo, C, et al. (2013). Antigen- specific B-cell receptor sensitizes B cells to infection by influenza virus. Nature 503, 406-409.
Fillatreau, S., Sweenie, C.H., McGeachy, M.J., Gray, D., and Anderton, S.M. (2002). B cells regulate autoimmunity by provision of IL-10. Nat Immunol 3, 944-950.
Griffin, D.O., Holodick, N.E., and Rothstein, T.L. (2011). Human B l cells in umbilical cord and adult peripheral blood express the novel phenotype CD20+CD27+CD43+CD70-. J Exp Med 208, 67-80. Kruetzmann, S., Rosado, M.M., Weber, H., Germing, U., Tournilhac, O., Peter, H.H., Berner, R., Peters, A., Boehm, T., Plebani, A., et al. (2003). Human immunoglobulin M memory B cells controlling Streptococcus pneumoniae infections are generated in the spleen. J Exp Med 197, 939-945.
Kurt- Jones, E.A., Popova, L., Kwinn, L., Haynes, L.M., Jones, L.P., Tripp, R.A., Walsh, E.E., Freeman, M.W., Golenbock, D.T., Anderson, L.J., et al. (2000). Pattern recognition receptors TLR4 and CD14 mediate response to respiratory syncytial virus. Nat Immunol 1, 398-401.
Lemoine, S., Morva, A., Youinou, P., and Jamin, C. (2011). Human T cells induce their own regulation through activation of B cells. J Autoimmun 36, 228-238.
Matsushita, T., Yanaba, K., Bouaziz, J.-D., Fujimoto, M., and Tedder, T.F. (2008). Regulatory B cells inhibit EAE initiation in mice while other B cells promote disease progression. J Clin Invest 118, 3420-3430.
Mauri, C, and Bosma, A. (2012). Immune regulatory function of B cells. Ann Rev Immunol 30, 221-241.
Mauri, C, Gray, D., Mushtaq, N., and Londei, M. (2003). Prevention of arthritis by interleukin 10-producing B cells. J Exp Med 197, 489-501.
McLellan, J.S., Chen, M., Leung, S., Graepel, K.W., Du, X., Yang, Y., Zhou, T., Baxa, U., Yasuda, E., Beaumont, T., et al. (2013). Structure of RSV fusion glycoprotein trimer bound to a prefusion-specific neutralizing antibody. Science 340, 1113-1117.
McLellan, J.S., Yang, Y., Graham, B.S., and Kwong, P.D. (2011). Structure of respiratory syncytial virus fusion glycoprotein in the postfusion conformation reveals preservation of neutralizing epitopes. J Virol 85, 7788-7796.
Mejias, A., Dimo, B., Suarez, N.M., Garcia, C, Suarez-Arrabal, M.C., Jartti, T., Blankenship, D., Jordan- Villegas, A., Ardura, M.I., Xu, Z., et al. (2013). Whole blood gene expression profiles to assess pathogenesis and disease severity in infants with respiratory syncytial virus infection. PLoS Med 10, el001549.
Menon, M., Blair, P. A., Isenberg, D.A., and Mauri, C. (2016). A Regulatory Feedback between Plasmacytoid Dendritic Cells and Regulatory B Cells Is Aberrant in Systemic Lupus Erythematosus. Immunity 44, 683-697.
Neves, P., Lampropoulou, V., Calderon-Gomez, E., Roch, T., Stervbo, U., Shen, P., Kiihl, A.A., Loddenkemper, C, Haury, M., Nedospasov, S.A., et al. (2010). Signaling via the MyD88 Adaptor Protein in B Cells Suppresses Protective Immunity during Salmonella typhimurium Infection. Immunity 33, 777-790.
Nothelfer, K., Sansonetti, P. J., and Phalipon, A. (2015). Pathogen manipulation of B cells: the best defence is a good offence. Nature Rev Microbiol 13, 173-184.
Perez-Andres, M., Grosserichter-Wagener, C, Teodosio, C, van Dongen, J.J., Orfao, A., and van Zelm, M.C. (2011). The nature of circulating CD27+CD43+ B cells. J Exp Med 208, 2565-2566; author reply 2566-2569.
O'Garra, A., Chang, R., Go, N., Hastings, R., Haughton, G., and Howard, M. (1992). Ly-1 B (B-l) cells are the main source of B cell-derived interleukin 10. Eur J Immunol 22, 711-717.
Openshaw, P.J., and Chiu, C. (2013). Protective and dysregulated T cell immunity in RSV infection. Curr Opin Vvirol 3, 468-474.
Prabhudas, M., Adkins, B., Gans, H., King, C, Levy, O., Ramilo, O., and Siegrist, C.-A. (2011). Challenges in infant immunity: implications for responses to infection and vaccines. Nat Immunol 12, 189-194.
Rameix-Welti, M.A., Le Goffic, R., Herve, P.L., Sourimant, J., Remot, A., Riffault, S., Yu, Q., Galloux, M., Gault, E., and Eleouet, J.F. (2014). Visualizing the replication of respiratory syncytial virus in cells and in living mice. Nat Comm 5, 5104.
Reed, J.L., Welliver, T.P., Sims, G.P., Mckinney, L., Velozo, L., Avendano, L., Hintz, K., Luma, J., Coyle, A. J., and Welliver, R.C. (2009). Innate immune signals modulate antiviral and polyreactive antibody responses during severe respiratory syncytial virus infection. J Infect Dis 199, 1128-1138.
Schuurhof, A., Janssen, R., de Groot, H., Hodemaekers, H.M., de Klerk, A., Kimpen, J.L., and Bont, L. (2011). Local interleukin- 10 production during respiratory syncytial virus bronchiolitis is associated with post-bronchiolitis wheeze. Respir Res 12, 121.
Sewald, X., Ladinsky, M.S., Uchil, P.D., Beloor, J., Pi, R., Herrmann, C, Motamedi, N., Murooka, T.T., Brehm, M.A., Greiner, D.L., et al. (2015). Retroviruses use CD169-mediated trans-infection of permissive lymphocytes to establish infection. Science 350, 563-7.
Shen, P., Roch, T., Lampropoulou, V., O'Connor, R.A., Stervbo, U., Hilgenberg, E., Ries, S., Dang, V.D., Jaimes, Y., Daridon, C, et al. (2014). IL-35-producing B cells are critical regulators of immunity during autoimmune and infectious diseases. Nature 507, 366-370. Siegrist, C.A. (2001). Neonatal and early life vaccinology. Vaccine 19, 3331-3346.
Smyth, R.L., and Openshaw, P.J. (2006). Bronchiolitis. Lancet 368, 312-322.
Stein, R.T. (2009). Long-term airway morbidity following viral LRTI in early infancy: recurrent wheezing or asthma? Paediatr Respir Rev 10, 29-31.
Sun, C, Deriaud, E., Leclerc, C, and Lo-Man, R. (2005). Upon TLR9 signaling, CD5(+) B cells control the IL-12-dependent Thl-priming capacity of neonatal DCs. Immunity 22, 467- 477.
Tayyari, F., Marchant, D., Moraes, T.J., Duan, W., Mastrangelo, P., and Hegele, R.G. (2011). Identification of nucleolin as a cellular receptor for human respiratory syncytial virus. Nat Med i7, 1132.
Teng, M.N., Whitehead, S.S., and Collins, P.L. (2001). Contribution of the respiratory syncytial virus G glycoprotein and its secreted and membrane-bound forms to virus replication in vitro and in vivo. Virology 289, 283-296.
Tripp, R.A., Jones, L.P., Haynes, L.M., Zheng, H., Murphy, P.M., and Anderson, L.J. (2001). CX3C chemokine mimicry by respiratory syncytial virus G glycoprotein. Nat Immunol 2, 732-738.
Weill, J.-C, Weller, S., and Reynaud, C.-A. (2009). Human marginal zone B cells. Annu Rev Immunol 27, 267-285.
Weller, S., Mamani-Matsuda, M., Picard, C, Cordier, C, Lecoeuche, D., Gauthier, F., Weill, J.-C, and Reynaud, C.-A. (2008). Somatic diversification in the absence of antigen-driven responses is the hallmark of the IgM+ IgD+ CD27+ B cell repertoire in infants. J Exp Med 205, 1331-1342.
Welliver, T.P., Garofalo, R.P., Hosakote, Y., Hintz, K.H., Avendano, L., Sanchez, K., Velozo, L., Jafri, H., Chavez-Bueno, S., Ogra, P.L., et al. (2007). Severe human lower respiratory tract illness caused by respiratory syncytial virus and influenza virus is characterized by the absence of pulmonary cytotoxic lymphocyte responses. J Infect Dis 195, 1126-1136.
Zhang, X., Casartelli, N., Lemoine, S., Mozeleski, B., Azria, E., Le Ray, C, Schwartz, O., Launay, O., Leclerc, C, and Lo-Man, R. (2014a). Plasmacytoid dendritic cells engagement by influenza vaccine as a surrogate strategy for driving T-helper type 1 responses in human neonatal settings. J Infect Dis 210, 424-434. Zhang, X., Deriaud, E., Jiao, X., Braun, D., Leclerc, C, and Lo-Man, R. (2007). Type I interferons protect neonates from acute inflammation through interleukin 10-producing B cells. J Exp Med 204, 1107-1118.
Zhang, X., Mozeleski, B., Lemoine, S., Deriaud, E., Lim, A., Zhivaki, D., Azria, E., Le Ray, C, Roguet, G., Launay, O., et al. (2014b). CD4 T cells with effector memory phenotype and function develop in the sterile environment of the fetus. Sci Transl Med 6, 238ra272.
Zhivaki D, Lemoine S, Lim A, Morva A, Vidalain PO, Schandene L, Casartelli N, Rameix- Welti MA, Herve PL, Deriaud E, Beitz B, Ripaux-Lefevre M, Miatello J, Lemercier B, Lorin V, Descamps D, Fix J, Eleouet JF, Riffault S, Schwartz O, Porcheray F, Mascart F, Mouquet H, Zhang X, Tissieres P, Lo-Man R. Respiratory Syncytial Virus Infects Regulatory B Cells in Human Neonates via Chemokine Receptor CX3CR1 and Promotes Lung Disease Severity. Immunity 2017 Feb 21;46(2):301-314.
Buchholz, et al. J Virol 73, 251-259.
Castagne, N.,et al. The Journal of general virology 85, 1643-1653. Lim, A. et al. Int Immunol 20, 105-116.
McLellan, et al. Science 340 (6136): 1113-17. doi: 10.1126/science.l234914. McLellan et al. Journal of Virology 85 (15): 7788-96. doi: 10.1128/JVI.00555-l l. Rameix -Welti, M.A. et al. Nature communications 5, 5104.
Prigent J, Lorin V, Kok A, Hieu T, Bourgeau S, Mouquet HI. Scarcity of autoreactive human blood IgA+ memory B cells. Eur J Immunol 2016;46:2340-2351.
Mouquet, H. et al. PloS one 6, e24078. 1.

Claims

1. A method for preparing a monoclonal antibody or fragments thereof that bind, preferably specifically, to an antigen of interest comprising:
- isolating a population of nBreg cells from a biological sample of a subject;
- selecting a nBreg cell that produces an immunoglobulin of a primordial class, optionally that binds to said antigen of interest; preferably specifically,
- generating copies of the genes encoding said immunoglobulin, preferably the variable genes of heavy chain and light chain, or a fragment thereof,
- producing monoclonal antibodies or fragments thereof by expression of the protein encoded by the copies; and
- isolating the monoclonal antibody or fragments thereof that bind, preferably specifically, to the antigen of interest.
2. A method for preparing a monoclonal antibody or fragments thereof that specifically bind to the RSV-F protein comprising:
- isolating nBreg cells from a subject;
- selecting a nBreg cell that produces an IgM that specifically binds to the RSV-F protein;
- generating copies of the gene encoding the IgM or a fragment of the gene;
- producing monoclonal antibodies or fragments thereof by expression of the protein encoded by the copies; and
- isolating the monoclonal antibodies or fragments thereof that specifically bind to the RSV-F protein.
3. The method of claim 1 or 2, wherein the copies are generated by the polymerase chain reaction.
4. The isolated monoclonal antibodies or fragments thereof produced by the method of claim 1 or 2.
5. The isolated monoclonal antibodie according to claim 4, wherein it comprises in its light chain domain, preferably in one of the FR-Ll; FR-L2, FR-L3 regions, a sequence having at least 80% identity with at least one of the sequence SEQ ID NO. 2, 3 or 4 or a fragment thereof.
6. The isolated monoclonal antibodie according to claim 4 or 5, wherein it comprises a light chain comprising at least one, preferably two, and most preferably three, framework regions chosen from FR-L1 ; FR-L2 and FR-L3, wherein:
FR-L1 comprises at least a portion of the amino acid sequence SEQ ID NO. 2, FR-L2 comprises at least a portion of the amino acid sequence SEQ ID NO. 3, or FR-L3 comprises at least a portion of the amino acid sequence SEQ ID NO. 4.
7. The isolated monoclonal antibodie according to any of claims 4 to 6, wherein it is an immunoglobulin of a primordial class, preferably IgM.
8. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and an isolated monoclonal antibody or a fragment thereof as defined in any of claims 4 to 7.
9. The isolated monoclonal antibodies or fragments thereof as defined in any of claims 4 to 7, or pharmaceutical composition as defined in claim 8, for use as a medicine.
10. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and an isolated monoclonal IgM or a fragment thereof that specifically binds to the RSV-F protein.
1 1. An isolated monoclonal Ig or a fragment thereof that specifically binds to the RSV-F protein for treating or preventing infection of an RSV infection in a human.
12. A primordial antibody library wherein the frequency of VH3 (DH)JH4 rearrangements is higher than the frequency of VH3(DH)JH3 rearrangements.
13. A monoclonal antibody derived from the library as defined in claim 12, comprising VH3 (DH)JH4 rearrangements.
PCT/EP2018/054048 2017-02-17 2018-02-19 Generation of monoclonal antibodies targeting respiratory syncytial virus (rsv) using regulatory b cells from newborns (nbregs) Ceased WO2018150029A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201762460258P 2017-02-17 2017-02-17
US62/460,258 2017-02-17

Publications (1)

Publication Number Publication Date
WO2018150029A1 true WO2018150029A1 (en) 2018-08-23

Family

ID=61628290

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2018/054048 Ceased WO2018150029A1 (en) 2017-02-17 2018-02-19 Generation of monoclonal antibodies targeting respiratory syncytial virus (rsv) using regulatory b cells from newborns (nbregs)

Country Status (1)

Country Link
WO (1) WO2018150029A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11434282B2 (en) 2018-05-18 2022-09-06 Chan Zuckerberg Biohub, Inc. Allergen-specific antibodies

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009030237A2 (en) * 2007-09-07 2009-03-12 Symphogen A/S Methods for recombinant manufacturing of anti-rsv antibodies
US20140044719A1 (en) * 2009-08-13 2014-02-13 Crucell Holland B.V. Antibodies against human respiratory syncytial virus (rsv) and methods of use
WO2016131125A1 (en) * 2015-02-19 2016-08-25 Cangene Corporation Humanized filovirus antibodies and uses thereof
US9555112B2 (en) 2014-06-18 2017-01-31 Mersana Therapeutics, Inc. Monoclonal antibodies against HER2 epitope and methods of use thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009030237A2 (en) * 2007-09-07 2009-03-12 Symphogen A/S Methods for recombinant manufacturing of anti-rsv antibodies
US20140044719A1 (en) * 2009-08-13 2014-02-13 Crucell Holland B.V. Antibodies against human respiratory syncytial virus (rsv) and methods of use
US9555112B2 (en) 2014-06-18 2017-01-31 Mersana Therapeutics, Inc. Monoclonal antibodies against HER2 epitope and methods of use thereof
WO2016131125A1 (en) * 2015-02-19 2016-08-25 Cangene Corporation Humanized filovirus antibodies and uses thereof

Non-Patent Citations (67)

* Cited by examiner, † Cited by third party
Title
ALTING-MEES ET AL.: "Monoclonal Antibody Expression Libraries: A Rapid Alternative to Hybridomas", STRATEGIES IN MOLECULAR BIOLOGY, vol. 3, 1990, pages 1 - 9, XP001538956
AMIR EL, A.D.; DAVIS, K.L.; TADMOR, M.D.; SIMONDS, E.F.; LEVINE, J.H.; BENDALL, S.C.; SHENFELD, D.K.; KRISHNASWAMY, S.; NOLAN, G.P: "viSNE enables visualization of high dimensional single-cell data and reveals phenotypic heterogeneity of leukemia", NATURE BIOTECH, vol. 31, 2013, pages 545 - 552
BLAIR, P.A.; NOREFIA, L.Y.; FLORES-BORJA, F.; RAWLINGS, D.J.; ISENBERG, D.A.; EHRENSTEIN, M.R.; MAURI, C.: "CD19(+)CD24(hi)CD38(hi) B Cells Exhibit Regulatory Capacity in Healthy Individuals but Are Functionally Impaired in Systemic Lupus Erythematosus Patients", IMMUNITY, vol. 32, 2010, pages 129 - 140, XP009173143, DOI: doi:10.1016/j.immuni.2009.11.009
BONT, L.; HEIJNEN, C.J.; KAVELAARS, A.; VAN AALDEREN, W.M.; BRUS, F.; DRAAISMA, J.M.; PEKELHARING-BERGHUIS, M.; VAN DIEMEN-STEENVO: "Local interferon-gamma levels during respiratory syncytial virus lower respiratory tract infection are associated with disease severity", J INFECT DIS, vol. 184, 2001, pages 355 - 358
BRUGGEMANN ET AL., ARCH IMMUNOL THER EXP (WARSZ, vol. 63, no. 2, 2015, pages 101 - 108
BUCHHOLZ ET AL., J VIROL, vol. 73, pages 251 - 259
CASTAGNE, N., THE JOURNAL OF GENERAL VIROLOGY, vol. 85, pages 1643 - 1653
CASTRO, M.; SCHWEIGER, T.; YIN-DECLUE, H.; RAMKUMAR, T.P.; CHRISTIE, C.; ZHENG, J.; COHEN, R.; SCHECHTMAN, K.B.; STRUNK, R.; BACHA: "Cytokine response after severe respiratory syncytial virus bronchiolitis in early life", J ALLERGY CLIN IMMUNOL, vol. 122, 2008, pages 726 - 733
COLE ET AL.: "Monoclonal Antibodies and Cancer Therapy", 1985, ALAN R. LISS, INC., pages: 77 - 96
COTE ET AL., PROC NATL ACAD SCI USA, vol. 80, 1983, pages 2026 - 2030
CULLEY, F.J.; POLLOTT, J.; OPENSHAW, P.J.: "Age at first viral infection determines the pattern of T cell-mediated disease during reinfection in adulthood", J EXP MED, vol. 196, 2002, pages 1381 - 1386
D. MASEDA ET AL: "Regulatory B10 Cells Differentiate into Antibody-Secreting Cells After Transient IL-10 Production In Vivo", THE JOURNAL OF IMMUNOLOGY, vol. 188, no. 3, 1 February 2012 (2012-02-01), US, pages 1036 - 1048, XP055468943, ISSN: 0022-1767, DOI: 10.4049/jimmunol.1102500 *
DATABASE Genbank [O] retrieved from ncbi Database accession no. KF713492.1
DESCATOIRE, M.; WEILL, J.C.; REYNAUD, C.A.; WELLER, S.: "A human equivalent of mouse B-l cells?", J EXP MED, vol. 208, 2011, pages 2563 - 2564
DONGMEI SU ET AL: "A Preliminary Study on the Preparation of Monoclonal Antibody with Umbilical Cord Blood Cell", JOURNAL OF BIOSCIENCES AND MEDICINES, vol. 03, no. 03, 1 January 2015 (2015-01-01), pages 73 - 77, XP055468941, ISSN: 2327-5081, DOI: 10.4236/jbm.2015.33011 *
DOUGAN, S.K.; ASHOUR, J.; KARSSEMEIJER, R.A.; POPP, M.W.; AVALOS, A.M.; BARISA, M.; ALTENBURG, A.F.; INGRAM, J.R.; CRAGNOLINI, J.J: "Antigen-specific B-cell receptor sensitizes B cells to infection by influenza virus", NATURE, vol. 503, 2013, pages 406 - 409
FILLATREAU, S.; SWEENIE, C.H.; MCGEACHY, M.J.; GRAY, D.; ANDERTON, S.M.: "B cells regulate autoimmunity by provision of IL-10", NAT IMMUNOL, vol. 3, 2002, pages 944 - 950
FRAUSSEN ET AL., J AUTOIMMUN., vol. 35, no. 2, 2010, pages 130 - 134
GRIFFIN, D.O.; HOLODICK, N.E.; ROTHSTEIN, T.L.: "Human B1 cells in umbilical cord and adult peripheral blood express the novel phenotype CD20+CD27+CD43+CD70", J EXP MED, vol. 208, 2011, pages 67 - 80
JULIE PRIGENT; VALERIE LORIN; AYRIN KOK; THIERRY HIEU; SALOME BOURGEAU; HUGO MOUQUET: "Scarcity of autoreactive human blood IgA+ memory B cells", EUR J IMMUNOL., vol. 46, no. 10, October 2016 (2016-10-01), pages 2340 - 2351
KOZBOR ET AL., IMMUNOL TODAY, vol. 4, 1983, pages 72
KRUETZMANN, S.; ROSADO, M.M.; WEBER, H.; GERMING, U.; TOURNILHAC, O.; PETER, H.H.; BERNER, R.; PETERS, A.; BOEHM, T.; PLEBANI, A.: "Human immunoglobulin M memory B cells controlling Streptococcus pneumoniae infections are generated in the spleen", J EXP MED, vol. 197, 2003, pages 939 - 945, XP055087220, DOI: doi:10.1084/jem.20022020
KURT-JONES, E.A.; POPOVA, L.; KWINN, L.; HAYNES, L.M.; JONES, L.P.; TRIPP, R.A.; WALSH, E.E.; FREEMAN, M.W.; GOLENBOCK, D.T.; ANDE: "Pattern recognition receptors TLR4 and CD14 mediate response to respiratory syncytial virus", NAT IMMUNOL, vol. 1, 2000, pages 398 - 401, XP001120614, DOI: doi:10.1038/80833
LARRICK ET AL., BIOTECHNOLOGY, vol. 7, 1989, pages 394
LEMOINE, S.; MORVA, A.; YOUINOU, P.; JAMIN, C.: "Human T cells induce their own regulation through activation of B cells", J AUTOIMMUN, vol. 36, 2011, pages 228 - 238, XP028226360, DOI: doi:10.1016/j.jaut.2011.01.005
LIM, A. ET AL., INT IMMUNOL, vol. 20, pages 105 - 116
MARK J KWAKKENBOS ET AL: "Generation of stable monoclonal antibody-producing B cell receptor-positive human memory B cells by genetic programming", NATURE MEDICINE, vol. 16, no. 1, 1 January 2010 (2010-01-01), pages 123 - 128, XP055019451, ISSN: 1078-8956, DOI: 10.1038/nm.2071 *
MATSUSHITA, T.; YANABA, K.; BOUAZIZ, J.-D.; FUJIMOTO, M.; TEDDER, T.F.: "Regulatory B cells inhibit EAE initiation in mice while other B cells promote disease progression", J CLIN INVEST, vol. 118, 2008, pages 3420 - 3430, XP002590589
MAURI, C.; BOSMA, A.: "Immune regulatory function of B cells", ANN REV IMMUNOL, vol. 30, 2012, pages 221 - 241, XP055034359, DOI: doi:10.1146/annurev-immunol-020711-074934
MAURI, C.; GRAY, D.; MUSHTAQ, N.; LONDEI, M.: "Prevention of arthritis by interleukin 10-producing B cells", J EXP MED, vol. 197, 2003, pages 489 - 501, XP002590583
MCLELLAN ET AL., JOURNAL OF VIROLOGY, vol. 85, no. 15, pages 7788 - 7796
MCLELLAN ET AL., SCIENCE, vol. 340, no. 6136, pages 1113 - 1117
MCLELLAN, J.S.; CHEN, M.; LEUNG, S.; GRAEPEL, K.W.; DU, X.; YANG, Y.; ZHOU, T.; BAXA, U.; YASUDA, E.; BEAUMONT, T. ET AL.: "Structure of RSV fusion glycoprotein trimer bound to a prefusion-specific neutralizing antibody", SCIENCE, vol. 340, 2013, pages 1113 - 1117, XP055132644, DOI: doi:10.1126/science.1234914
MCLELLAN, J.S.; YANG, Y.; GRAHAM, B.S.; KWONG, P.D.: "Structure of respiratory syncytial virus fusion glycoprotein in the postfusion conformation reveals preservation of neutralizing epitopes", J VIROL, vol. 85, 2011, pages 7788 - 7796, XP002710047, DOI: doi:10.1128/JVI.00555-11
MEJIAS, A.; DIMO, B.; SUAREZ, N.M.; GARCIA, C.; SUAREZ-ARRABAL, M.C.; JARTTI, T.; BLANKENSHIP, D.; JORDAN-VILLEGAS, A.; ARDURA, M.: "Whole blood gene expression profiles to assess pathogenesis and disease severity in infants with respiratory syncytial virus infection", PLOS MED, vol. 10, 2013, pages el001549
MENON, M.; BLAIR, P.A.; ISENBERG, D.A.; MAURI, C.: "A Regulatory Feedback between Plasmacytoid Dendritic Cells and Regulatory B Cells Is Aberrant in Systemic Lupus Erythematosus", IMMUNITY, vol. 44, 2016, pages 683 - 697, XP029448986, DOI: doi:10.1016/j.immuni.2016.02.012
MOUQUET, H. ET AL., PLOS ONE, vol. 6, pages e24078
NEVES, P.; LAMPROPOULOU, V.; CALDERON-GOMEZ, E.; ROCH, T.; STERVBO, U.; SHEN, P.; KIIHL, A.A.; LODDENKEMPER, C.; HAURY, M.; NEDOSP: "Signaling via the MyD88 Adaptor Protein in B Cells Suppresses Protective Immunity during Salmonella typhimurium Infection", IMMUNITY, vol. 33, 2010, pages 777 - 790
NGUYEN H ET AL: "Efficient generation of respiratory syncytial virus (RSV)-neutralizing human MoAbs via human peripheral blood lymphocyte (hu-PBL)-SCID mice and scFv phage display libraries", CLINICAL AND EXPERIMENTAL IMMUNOLOGY, WILEY-BLACKWELL PUBLISHING LTD, GB, vol. 122, no. 1, 1 October 2000 (2000-10-01), pages 85 - 93, XP002340945, ISSN: 0009-9104, DOI: 10.1046/J.1365-2249.2000.01345.X *
NOTHELFER, K.; SANSONETTI, P.J.; PHALIPON, A.: "Pathogen manipulation of B cells: the best defence is a good offence", NATURE REV MICROBIOL, vol. 13, 2015, pages 173 - 184
O'GARRA, A.; CHANG, R.; GO, N.; HASTINGS, R.; HAUGHTON, G.; HOWARD, M.: "Ly-1 B (B-l) cells are the main source of B cell-derived interleukin 10", EUR J IMMUNOL, vol. 22, 1992, pages 711 - 717
OPENSHAW, P.J.; CHIU, C.: "Protective and dysregulated T cell immunity in RSV infection", CURR OPIN VVIROL, vol. 3, 2013, pages 468 - 474
PEREZ-ANDRES, M.; GROSSERICHTER-WAGENER, C.; TEODOSIO, C.; VAN DONGEN, J.J.; ORFAO, A.; VAN ZELM, M.C.: "The nature of circulating CD27+CD43+ B cells", J EXP MED, vol. 208, 2011, pages 2565 - 2566
PRABHUDAS, M.; ADKINS, B.; GANS, H.; KING, C.; LEVY, O.; RAMILO, O.; SIEGRIST, C.-A.: "Challenges in infant immunity: implications for responses to infection and vaccines", NAT IMMUNOL, vol. 12, 2011, pages 189 - 194
PRIGENT J; LORIN V; KOK A; HIEU T; BOURGEAU S; MOUQUET HI: "Scarcity of autoreactive human blood IgA+ memory B cells", EUR J IMMUNOL, vol. 46, 2016, pages 2340 - 2351
RAMEIX-WELTI, M.A. ET AL., NATURE COMMUNICATIONS, vol. 5, pages 5104
RAMEIX-WELTI, M.A.; LE GOFFIC, R.; HERVE, P.L.; SOURIMANT, J.; REMOT, A.; RIFFAULT, S.; YU, Q.; GALLOUX, M.; GAULT, E.; ELEOUET, J: "Visualizing the replication of respiratory syncytial virus in cells and in living mice", NAT COMM, vol. 5, 2014, pages 5104
REED, J.L.; WELLIVER, T.P.; SIMS, G.P.; MCKINNEY, L.; VELOZO, L.; AVENDANO, L.; HINTZ, K.; LUMA, J.; COYLE, A.J.; WELLIVER, R.C.: "Innate immune signals modulate antiviral and polyreactive antibody responses during severe respiratory syncytial virus infection", J INFECT DIS, vol. 199, 2009, pages 1128 - 1138
SCATCHARD ET AL., ANN. N.Y. ACAD. SCI., vol. 51, 1949, pages 660
SCHUURHOF, A.; JANSSEN, R.; DE GROOT, H.; HODEMAEKERS, H.M.; DE KLERK, A.; KIMPEN, J.L.; BONT, L.: "Local interleukin-10 production during respiratory syncytial virus bronchiolitis is associated with post-bronchiolitis wheeze", RESPIR RES, vol. 12, 2011, pages 121, XP021108639, DOI: doi:10.1186/1465-9921-12-121
SEWALD, X.; LADINSKY, M.S.; UCHIL, P.D.; BELOOR, J.; PI, R.; HERRMANN, C.; MOTAMEDI, N.; MUROOKA, T.T.; BREHM, M.A.; GREINER, D.L.: "Retroviruses use CD169-mediated trans-infection of permissive lymphocytes to establish infection", SCIENCE, vol. 350, 2015, pages 563 - 7
SHEN, P.; ROCH, T.; LAMPROPOULOU, V.; O'CONNOR, R.A.; STERVBO, U.; HILGENBERG, E.; RIES, S.; DANG, V.D.; JAIMES, Y.; DARIDON, C. E: "IL-35-producing B cells are critical regulators of immunity during autoimmune and infectious diseases", NATURE, vol. 507, 2014, pages 366 - 370
SIEGRIST, C.A.: "Neonatal and early life vaccinology", VACCINE, vol. 19, 2001, pages 3331 - 3346, XP004238927, DOI: doi:10.1016/S0264-410X(01)00028-7
SMYTH, R.L.; OPENSHAW, P.J.: "Bronchiolitis", LANCET, vol. 368, 2006, pages 312 - 322, XP025092912, DOI: doi:10.1016/S0140-6736(06)69077-6
STEIN, R.T.: "Long-term airway morbidity following viral LRTI in early infancy: recurrent wheezing or asthma?", PAEDIATR RESPIR REV, vol. 10, 2009, pages 29 - 31, XP026418528
SUN, C.; DERIAUD, E.; LECLERC, C.; LO-MAN, R.: "Upon TLR9 signaling, CD5(+) B cells control the IL-12-dependent Thl-priming capacity of neonatal DCs", IMMUNITY, vol. 22, 2005, pages 467 - 477
TAYYARI, F.; MARCHANT, D.; MORAES, T.J.; DUAN, W.; MASTRANGELO, P.; HEGELE, R.G.: "Identification of nucleolin as a cellular receptor for human respiratory syncytial virus", NAT MED, vol. 17, 2011, pages 1132, XP055161385, DOI: doi:10.1038/nm.2444
TENG, M.N.; WHITEHEAD, S.S.; COLLINS, P.L.: "Contribution of the respiratory syncytial virus G glycoprotein and its secreted and membrane-bound forms to virus replication in vitro and in vivo", VIROLOGY, vol. 289, 2001, pages 283 - 296, XP002301784, DOI: doi:10.1006/viro.2001.1138
TILLER, T.; MEFFRE, E.; YURASOV, S.; TSUIJI, M.; NUSSENZWEIG, M. C.; WARDEMANN, H.: "Efficient generation of monoclonal antibodies from single human B cells by single cell RT-PCR and expression vector cloning", J.IMMUNOL. METHODS, vol. 329, 2008, pages 112 - 124, XP022389335
TRIPP, R.A.; JONES, L.P.; HAYNES, L.M.; ZHENG, H.; MURPHY, P.M.; ANDERSON, L.J.: "CX3C chemokine mimicry by respiratory syncytial virus G glycoprotein", NAT IMMUNOL, vol. 2, 2001, pages 732 - 738, XP008016202, DOI: doi:10.1038/90675
WEILL, J.-C.; WELLER, S.; REYNAUD, C.-A.: "Human marginal zone B cells", ANNU REV IMMUNOL, vol. 27, 2009, pages 267 - 285
WELLER, S.; MAMANI-MATSUDA, M.; PICARD, C.; CORDIER, C.; LECOEUCHE, D.; GAUTHIER, F.; WEILL, J.-C.; REYNAUD, C.-A.: "Somatic diversification in the absence of antigen-driven responses is the hallmark of the IgM+ IgD+ CD27+ B cell repertoire in infants", J EXP MED, vol. 205, 2008, pages 1331 - 1342
WELLIVER, T.P.; GAROFALO, R.P.; HOSAKOTE, Y.; HINTZ, K.H.; AVENDANO, L.; SANCHEZ, K.; VELOZO, L.; JAFRI, H.; CHAVEZ-BUENO, S.; OGR: "Severe human lower respiratory tract illness caused by respiratory syncytial virus and influenza virus is characterized by the absence of pulmonary cytotoxic lymphocyte responses", J INFECT DIS, vol. 195, 2007, pages 1126 - 1136
ZHANG, X.; CASARTELLI, N.; LEMOINE, S.; MOZELESKI, B.; AZRIA, E.; LE RAY, C.; SCHWARTZ, O.; LAUNAY, O.; LECLERC, C.; LO-MAN, R.: "Plasmacytoid dendritic cells engagement by influenza vaccine as a surrogate strategy for driving T-helper type 1 responses in human neonatal settings", J INFECT DIS, vol. 210, 2014, pages 424 - 434, XP055416206, DOI: doi:10.1093/infdis/jiu103
ZHANG, X.; DERIAUD, E.; JIAO, X.; BRAUN, D.; LECLERC, C.; LO-MAN, R.: "Type I interferons protect neonates from acute inflammation through interleukin 10-producing B cells", J EXP MED, vol. 204, 2007, pages 1107 - 1118
ZHANG, X.; MOZELESKI, B.; LEMOINE, S.; DERIAUD, E.; LIM, A.; ZHIVAKI, D.; AZRIA, E.; LE RAY, C.; ROGUET, G.; LAUNAY, O. ET AL.: "CD4 T cells with effector memory phenotype and function develop in the sterile environment of the fetus", SCI TRANSL MED, vol. 6, 2014, pages 238ra272
ZHIVAKI D; LEMOINE S; LIM A; MORVA A; VIDALAIN PO; SCHANDENE L; CASARTELLI N; RAMEIX-WELTI MA; HERVE PL; DERIAUD E: "Respiratory Syncytial Virus Infects Regulatory B Cells in Human Neonates via Chemokine Receptor CX3CR1 and Promotes Lung Disease Severity", IMMUNITY, vol. 46, no. 2, 21 February 2017 (2017-02-21), pages 301 - 314, XP029929850, DOI: doi:10.1016/j.immuni.2017.01.010

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11434282B2 (en) 2018-05-18 2022-09-06 Chan Zuckerberg Biohub, Inc. Allergen-specific antibodies
US11613569B2 (en) * 2018-05-18 2023-03-28 CZ Biohub SF, LLC. Identifying human B cells expressing anti-allergen antibodies
US12103964B2 (en) 2018-05-18 2024-10-01 Cz Biohub Sf, Llc Methods of isolating allergen-specific antibodies from humans and uses thereof

Similar Documents

Publication Publication Date Title
Li et al. In vitro and in vivo functions of SARS-CoV-2 infection-enhancing and neutralizing antibodies
Zhivaki et al. Respiratory syncytial virus infects regulatory B cells in human neonates via chemokine receptor CX3CR1 and promotes lung disease severity
Gilman et al. Rapid profiling of RSV antibody repertoires from the memory B cells of naturally infected adult donors
Richardson et al. IgG3 enhances neutralization potency and Fc effector function of an HIV V2-specific broadly neutralizing antibody
Cortjens et al. Broadly reactive anti-respiratory syncytial virus G antibodies from exposed individuals effectively inhibit infection of primary airway epithelial cells
CN106432484B (en) Neutralizing antibodies to human immunodeficiency virus and methods of use thereof
Fallet et al. Chronic viral infection promotes efficient germinal center B cell responses
CN110621338B (en) Broadly neutralizing anti-HIV-1 antibodies and methods of use thereof
CN108137676A (en) gp120 neutralizing antibody and use thereof
WO2022159685A2 (en) Sars-cov-2 coronavirus antibodies and uses thereof
Woolsey et al. Immune correlates of postexposure vaccine protection against Marburg virus
Fonseka et al. Dengue virus co-opts innate type 2 pathways to escape early control of viral replication
JPWO2007094423A1 (en) Human monoclonal antibody binding to human cytomegalovirus and antigen-binding portion thereof
Zehner et al. Single-cell analysis of memory B cells from top neutralizers reveals multiple sites of vulnerability within HCMV Trimer and Pentamer
Powell et al. Human monoclonal antibodies against Ross River virus target epitopes within the E2 protein and protect against disease
Ivanova et al. SARS-CoV-2 mRNA vaccine elicits a potent adaptive immune response in the absence of IFN-mediated inflammation observed in COVID-19
US20250296985A1 (en) Potently neutralizing novel human monoclonal antibodies against sars-cov-2 (covid-19)
US20230295274A1 (en) Anti-sars coronavirus-2 spike protein antibodies
JP2025503669A (en) Systems and methods for incorporating modified T cells
WO2018150029A1 (en) Generation of monoclonal antibodies targeting respiratory syncytial virus (rsv) using regulatory b cells from newborns (nbregs)
Harris et al. Development of a potent monoclonal antibody for treatment of human metapneumovirus infections
Boonyaratanakornkit et al. Protective Antibodies Against Human Parainfluenza Virus Type 3 (HPIV3) Infection
Paciello et al. B cell maturation restored ancestral germlines to control Omicron BA. 2.86
WO2024163949A2 (en) Pediatric sars-cov-2 antibodies and uses thereof
HK40103005A (en) Human immunodeficiency virus neutralizing antibodies and methods of use thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18711013

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18711013

Country of ref document: EP

Kind code of ref document: A1