WO2018148449A1 - Modulation of kallikrein b1 (klkb1) for treatment of headache - Google Patents

Modulation of kallikrein b1 (klkb1) for treatment of headache Download PDF

Info

Publication number
WO2018148449A1
WO2018148449A1 PCT/US2018/017478 US2018017478W WO2018148449A1 WO 2018148449 A1 WO2018148449 A1 WO 2018148449A1 US 2018017478 W US2018017478 W US 2018017478W WO 2018148449 A1 WO2018148449 A1 WO 2018148449A1
Authority
WO
WIPO (PCT)
Prior art keywords
oligomeric compound
headache
individual
modified
certain embodiments
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2018/017478
Other languages
French (fr)
Inventor
Frederick Joseph DEROSIER
Jason D. FERRONE
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ionis Pharmaceuticals Inc
Original Assignee
Ionis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ionis Pharmaceuticals Inc filed Critical Ionis Pharmaceuticals Inc
Publication of WO2018148449A1 publication Critical patent/WO2018148449A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7115Nucleic acids or oligonucleotides having modified bases, i.e. other than adenine, guanine, cytosine, uracil or thymine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/712Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/06Antimigraine agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/341Gapmers, i.e. of the type ===---===
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate

Definitions

  • KLKB1 KALLIKREIN Bl
  • Sequence Listing is provided as a file entitled BIOL0314WOSEQ_ST25.txt created February 8, 2018 which is 52 Kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.
  • compositions for modulating the kallikrein-kinin pathway in an individual in order to treat, prevent, delay, or ameliorate headache are provided herein.
  • Migraine is a highly prevalent neurovascular disorder that affects a significant proportion of the adult population worldwide: up to 12% of males and 24% of females, with the highest prevalence occurring between 25 and 55 years of age. Migraine represents an enormous socio-economic burden to the individual as well as to society and affects quality of life. Migraine is also a leading cause of suicide (Fuller-Thomson et al. Depress. Res. Treat. 2013: 401487).
  • a migraine attack is characterized by recurrent, severe, debilitating headache that may be associated with nausea, vomiting, photophobia, phonophobia, and/or osmophobia, and fatigue, along with other disturbances in autonomic, mental, sensory and motor functions.
  • Migraine attacks typically last 4 to 72 hours and may be precipitated by endogenous factors (i.e., hormonal changes, sleep deficit or surplus, hunger), or by exogenous factors (i.e., certain kinds of food, psychosocial stress, stimulation of different sensory modalities).
  • Migraine attacks can be preceded or accompanied by abnormal visual, sensory, motor and/or speech functions (migraine with aura) or start with no warning signs (migraine without aura).
  • Chronic migraine is a disabling neurological condition with an estimated global prevalence of up to 4-5%, and represents approximately half of all cases of chronic primary headache (Stovner et al. Eur. J. Neurol. 13: 333-345, 2006; Stovner et al. Cephalagia. 27: 193-210, 2007; Diener et al. Nat. Rev. Neurol. 8: 162-171, 2012; Paemeleire et al. Acta Neurol. Belg. 115: 1-17, 2015).
  • Chronic migraine patients are most commonly females in their 40s and have longer attacks, experience greater pain severity, are more disabled, and more likely to have a lower quality of life than patients with episodic migraine (Paemeleire et al. Acta Neurol. Belg. 115: 1-17, 2015).
  • Kallikrein-Kinin Pathway Kallikrein-Kinin Pathway
  • the kallikrein-kinin pathway comprises several proteins that play a role in inflammation, blood pressure control, coagulation, and pain.
  • the product of the KLKB 1 gene is plasma pre-kallikrein, which is cleaved by Factor Xlla to produce plasma kallikrein, which in turn generates kinins from kininogens and also generates plasmin from plasminogen.
  • plasma kallikrein cleaves high molecular weight kininogen (HMWK) to generate bradykinin.
  • HMWK high molecular weight kininogen
  • the kinins, especially bradykinin go on to induce downstream effects including vasodilation and edema (See, e.g., Schmaier. J. Thromb. Haemost 14: 28-39, 2016).
  • the headache is migraine.
  • the compound or composition is a modulator of the kallikrein-kinin pathway.
  • kallikrein Bl expression or activity is inhibited or reduced by the compound or composition.
  • plasma kallikrein activity is inhibited by a compound specifically designed to bind to plasma kallikrein.
  • the compound is an oligomeric compound comprising a modified oligonucleotide complementary to KLKB 1.
  • a method of treating, preventing, or ameliorating headache in an individual having, or at risk of having, a headache comprising
  • an oligomeric compound comprising a modified oligonucleotide complementary to a KLKB 1 nucleic acid, thereby treating, preventing, or ameliorating the headache in the individual.
  • a method comprising identifying an individual having, or at risk of having, a headache;
  • an oligomeric compound comprising a modified oligonucleotide complementary to a
  • KLKB 1 nucleic acid to the individual for treating, preventing, or ameliorating headache, thereby treating, preventing, or ameliorating the headache in the individual.
  • a method of treating, preventing, or ameliorating headache in an individual having, or at risk of having, a headache comprising administering to the individual an oligomeric compound comprising a modified oligonucleotide complementary to a KLKB1 nucleic acid, thereby treating, preventing, or ameliorating the headache in the individual.
  • a method comprising administering an oligomeric compound comprising a modified oligonucleotide complementary to a KLKB1 nucleic acid to an individual having, or at risk of having, a headache, for treating, preventing, or ameliorating headache, thereby treating, preventing, or ameliorating the headache in the individual.
  • a method of inhibiting expression or activity of kallikrein B l in a cell in an individual identified as having, or at risk of having, a headache comprising contacting the cell with an oligomeric compound comprising a modified oligonucleotide complementary to a KLKB 1 nucleic acid, thereby inhibiting expression or activity of kallikrein Bl in the cell.
  • a method of inhibiting expression or activity of kallikrein B l in a cell in an individual having, or at risk of having, a headache comprising contacting the cell with an oligomeric compound comprising a modified oligonucleotide complementary to a KLKB 1 nucleic acid, thereby inhibiting expression or activity of kallikrein B l in the cell.
  • a method of preventing or ameliorating nausea, vomiting, photophobia, phonophobia, osmophobia, pain intensity, blurry vision, loss of vision, cloudy vision, visual aura, vertigo, tingling sensations, numbness, head pain severity, head pain duration, the number of days of headache per month, or a combination thereof, in an individual having, or at risk of having, a headache comprising
  • oligonucleotide complementary to a KLKB 1 nucleic acid thereby preventing or ameliorating nausea, vomiting, photophobia, phonophobia, osmophobia, pain intensity, blurry vision, loss of vision, cloudy vision, visual aura, vertigo, tingling sensations, numbness, head pain severity, head pain duration, the number of days of headache per month, or a combination thereof, in the individual.
  • a method of preventing or ameliorating nausea, vomiting, photophobia, phonophobia, osmophobia, pain intensity, blurry vision, loss of vision, cloudy vision, visual aura, vertigo, tingling sensations, numbness, head pain severity, head pain duration, the number of days of headache per month, or a combination thereof, in an individual having, or at risk of having, a headache comprising
  • an oligomeric compound comprising a modified oligonucleotide complementary to a KLKB 1 nucleic acid, thereby preventing or ameliorating nausea, vomiting, photophobia, phonophobia, osmophobia, pain intensity, blurry vision, loss of vision, cloudy vision, visual aura, vertigo, tingling sensations, numbness, head pain severity, head pain duration, the number of days of headache per month, or a combination thereof, in the individual.
  • the headache is cluster headaches, migrainous neuralgia, chronic tension-type headache, chronic paroxysmal hemicrania, cranial neuralgia, or sinus headache.
  • migraine migraine, menopausal migraine, or menstrual migraine.
  • migraine is chronic migraine or episodic migraine.
  • migraine is chronic migraine.
  • oligomeric compound ameliorates nausea, vomiting, photophobia, phonophobia, osmophobia, pain intensity, blurry vision, loss of vision, cloudy vision, visual aura, vertigo, tingling sensations, or numbness.
  • nucleobase sequence of the modified oligonucleotide is at least 80% complementary to the KLKB1 transcript.
  • nucleobase sequence of the modified oligonucleotide is at least 85% complementary to the KLKBl transcript.
  • nucleobase sequence of the modified oligonucleotide is at least 90% complementary to the KLKB 1 transcript.
  • nucleobase sequence of the modified oligonucleotide is at least 95% complementary to the KLKBl transcript.
  • oligonucleotide comprises SEQ ID NO: 3
  • modified oligonucleotide comprises at least one modified internucleoside linkage, at least one modified sugar moiety, or at least one modified nucleobase.
  • a 3' wing segment consisting of linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, and wherein the 3' most nucleoside of the 5' wing and the 5' most nucleoside of the 3' wing each comprises a modified sugar moiety.
  • each nucleoside of the 5' wing segment and each nucleoside of the 3 ' wing segment comprises a modified sugar.
  • nucleosides in length are nucleosides in length.
  • nucleosides in length are nucleosides in length.
  • modified oligonucleotide comprises at least one modified intemucleoside linkage.
  • each intemucleoside linkage of the modified oligonucleotide is a modified intemucleoside linkage.
  • each intemucleoside linkage comprises the same modification.
  • each intemucleoside linkage is a phosphorothioate
  • At least one additional therapy is a beta blocker, an anticonvulsant, a calcium antagonist, a tricyclic antidepressant, an analgesic agent, an opioid, atriptan, or an ergotamine.
  • At least one additional therapy is invasive or noninvasive peripheral nerve stimulation, central neurostimulation, transcranial magnetic stimulation, cranial osteopathic manipulative treatment, or cognitive-behavioral therapy.
  • an oligomeric compound comprising a modified oligonucleotide complementary to a KLKB 1 nucleic acid for the manufacture or preparation of a medicament for treating headache.
  • oligomeric compound comprising a modified oligonucleotide complementary to a KLKB 1 nucleic acid for the treatment of headache.
  • embodiment 95 or 96 wherein the headache is cluster headaches, migrainous neuralgia, chronic tension-type headache, chronic paroxysmal hemicrania, cranial neuralgia, or sinus headache.
  • embodiment 95 or 96 wherein the headache is chronic tension-type headache.
  • embodiment 95 or 96 wherein the headache is migraine preceded or accompanied by aura.
  • migraine is chronic migraine, episodic migraine, menopausal migraine, or menstrual migraine.
  • embodiment 101 wherein the migraine is chronic migraine or episodic migraine.
  • embodiment 101 wherein the migraine is chronic migraine.
  • the oligomeric compound is capable of reducing or improving nausea, vomiting, photophobia, phonophobia, osmophobia, pain intensity, blurry vision, loss of vision, cloudy vision, visual aura, vertigo, tingling sensations, or numbness.
  • embodiment 104 wherein the oligomeric compound is capable of reducing or improving nausea or vomiting.
  • any of embodiments 104-105, wherein the oligomeric compound is capable of reducing or improving photophobia, phonohobia, or osmophobia.
  • oligomeric compound is capable of reducing or improving blurry vision, loss of vision, cloudy vision, or visual aura.
  • any of embodiments 95-111 wherein the headache occurs fewer average days per month over the course of at least three months than the average number of days per month the headache occurred over the course of the one to three months prior to use of the oligomeric compound.
  • embodiment 113 wherein the headache occurs fewer than 9 days per month following use of the oligomeric compound.
  • embodiment 113 wherein the headache occurs fewer than 8 days per month following use of the oligomeric compound.
  • modified oligonucleotide comprises at least one modified intemucleoside linkage, at least one modified sugar moiety, or at least one modified nucleobase.
  • the at least one modified intemucleoside linkage is a phosphorothioate intemucleoside linkage
  • the at least one modified sugar is a bicyclic sugar or 2'-0- methyoxyethyl
  • the at least one modified nucleobase is a 5-methylcytosine
  • each modified intemucleoside is a phosphorothioate linkage.
  • each cytosine is a 5-methylcytosine.
  • modified oligonucleotide comprises:
  • a 5' wing segment consisting of linked nucleosides
  • a 3' wing segment consisting linked nucleosides; wherein the gap segment is positioned immediately adjacent to and between the 5' wing segment and the 3'
  • oligomeric compound is an RNAi antisense compound.
  • any of embodiments 1-163 comprising administering to the individual a chirally enriched population of the oligomeric compound, wherein the population is enriched for oligomeric compounds comprising at least one particular phorphorothioate internucleoside linkage having a particular stereochemical configuration.
  • sequence set forth in each sequence ID number (SEQ ID NO.) herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • oligonucleotides defined by a SEQ ID NO. may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • 2'-deoxynucleoside means a nucleoside comprising 2'-H(H) furanosyl sugar moiety, as found in naturally occurring deoxyribonucleic acids (DNA).
  • a 2'- deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).
  • 2 '-substituted nucleoside or “2 -modified nucleoside” means a nucleoside comprising a 2 '-substituted or 2 '-modified sugar moiety.
  • “2 '-substituted” or “2 -modified” in reference to a sugar moiety means a sugar moiety comprising at least one 2'-substituent group other than H or OH.
  • administered concomitantly means co-administration of at least two agents to an individual in any manner in which the pharmacological effects of the agents overlap in time. Concomitant administration does not require that the agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of the agents need only be overlapping for a period of time and need not be coextensive.
  • administered consecutively means co-administration of at least two agents to an individual in a manner in which the pharmacological effects of the agents do not overlap in time.
  • administering means providing a compound to an individual, and includes, but is not limited to administering by a medical professional and self-administering.
  • the compound may be provided in a pharmaceutical composition.
  • “amelioration” refers to an improvement or reduction of at least one symptom of an associated disease, disorder, or condition.
  • amelioration includes a delay or slowing in the progression or severity of one or more symptoms of a condition or disease. The progression or severity of symptoms may be determined by subjective or objective measures, which are known to those skilled in the art.
  • amelioration is the reduction in the severity or frequency of a symptom.
  • antisense activity means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid.
  • antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.
  • antisense compound means a compound comprising an antisense oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.
  • antisense oligonucleotide means an oligonucleotide having a nucleobase sequence that is at least partially complementary to a target nucleic acid.
  • bicyclic nucleoside or “BNA” means a nucleoside comprising a bicyclic sugar moiety.
  • bicyclic sugar or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure.
  • the first ring of the bicyclic sugar moiety is a furanosyl moiety.
  • the bicyclic sugar moiety does not comprise a furanosyl moiety.
  • branching group means a group of atoms having at least 3 positions that are capable of forming covalent linkages to at least 3 groups.
  • a branching group provides a plurality of reactive sites for connecting tethered ligands to an oligonucleotide via a conjugate linker and/or a cleavable moiety.
  • cell-targeting moiety means a conjugate group or portion of a conjugate group that is capable of binding to a particular cell type or particular cell types.
  • cEt means a bicyclic sugar moiety comprising a bridge connecting the 4 '-carbon and the 2'-carbon, wherein the bridge has the formula: 4'-CH(CH3)-0-2' and the chiral carbon is in the S configuration.
  • chirally enriched population means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more sterorandom chiral centers.
  • the molecules are modified oligonucleotides.
  • the molecules are oligomeric compounds comprising modified oligonucleotides.
  • cleavable moiety means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human.
  • co-administration means administration of two or more compounds to an individual.
  • the two or more compounds may be in a single composition, or may be separate.
  • Each of the two or more compounds may be administered through the same or different routes of administration.
  • Coadministration encompasses concomitant and consecutive administration.
  • oligonucleotide in reference to an oligonucleotide means that at least 70% of the nucleobases of such oligonucleotide or one or more regions thereof and the nucleobases of another nucleic acid or one or more regions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions.
  • Complementary nucleobases means nucleobases that are capable of forming hydrogen bonds with one another.
  • Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5 -methyl cytosine ( m C) and guanine (G).
  • Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated.
  • oligonucleotides are complementary to another oligonucleotide or nucleic acid at each nucleoside of the oligonucleotide.
  • conjugate group means a group of atoms that is directly or indirectly attached to an oligonucleotide.
  • Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.
  • conjugate linker means a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.
  • conjugate moiety means a group of atoms that is attached to an oligonucleotide via a conjugate linker.
  • oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other.
  • contiguous nucleobases means nucleobases that are immediately adjacent to each other in a sequence.
  • dose means a specified quantity of a compound provided in a single administration, or in a specified time period.
  • a dose may be administered in one, two, or more boluses, tablets, or injections.
  • the desired dose requires a volume not easily accommodated by a single injection, therefore, two or more injections may be used to achieve the desired dose.
  • Doses may be stated as the amount of compound administered per hour, day, week, or month.
  • double-stranded antisense compound means an antisense compound comprising two oligomeric compounds that are complementary to each other and form a duplex, and wherein one of the two said oligomeric compounds comprises an antisense oligonucleotide.
  • effective amount means the amount of a compound sufficient to effectuate a desired physiological outcome in an individual.
  • the effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individual to be treated, the formulation of the composition, assessment of the individual's medical condition, and other relevant factors.
  • gapmer means an antisense oligonucleotide comprising an internal region having a plurality of nucleosides that support R ase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions.
  • the internal region may be referred to as the “gap” and the external regions may be referred to as the "wings.”
  • headache means pain in any region in the head and/or migraine.
  • a headache is a migraine that includes pain in any region in the head.
  • a headache is a migraine with aura but without pain in any region of the head.
  • cluster headaches or “migrainous neuralgia” means recurrent, severely painful headaches that occur for weeks or months at a time, an average of less than five times per day.
  • the pain of a cluster headache occurs primarily on one side of the head.
  • chronic headache means headache that occurs an average of at least 15 days per month over the course of three consecutive months.
  • a headache for example, a migraine, occurs on a given day if any one of the symptoms associated with the headache occur at any time during the given day.
  • tension-type headache means a headache with bilateral pain that has a pressing but not throbbing quality, and it is not associated with vomiting or made worse by routine physical activity.
  • sinus headache means inflammation of the sinuses and pain in the cheekbones, forehead, or bridge of the nose.
  • chronic paroxysmal hemicrania means headache that occurs an average of at least five times per day in which the pain is felt on one side of the head at a time.
  • cranial neuralgia is headache caused by inflammation of a cranial nerve.
  • Diagnosis of headache in an individual is accomplished by evaluation of an individual's medical history, physical examination, evaluation of symptoms as reported by the individual, or other standard clinical tests or assessments.
  • hybridization means the pairing or annealing of complementary oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
  • identifying an individual having, or at risk of having a given condition means identifying an individual having been diagnosed with the condition or identifying an individual predisposed to develop the condition. Individuals predisposed to develop a condition include those having one or more risk factors for the condition, including, having a personal or family history of the condition.
  • individual means a human or a non-human animal.
  • inhibiting in reference to expression, amount, or activity means a reduction or blockade of the expression, amount, or activity relative to the expression, amount, or activity in an untreated individual or individual receiving placebo, and does not necessarily indicate a total elimination of expression, amount, or activity.
  • internucleoside linkage means a group or bond that forms a covalent linkage between adjacent nucleosides in an oligonucleotide.
  • modified internucleoside linkage means any internucleoside linkage other than a naturally occurring, phosphate internucleoside linkage. Non-phosphate linkages are referred to herein as modified internucleoside linkages.
  • Phosphorothioate linkage means a modified phosphate linkage in which one of the non-bridging oxygen atoms is replaced with a sulfur atom.
  • a phosphorothioate internucleoside linkage is a modified
  • internucleoside linkage Modified internucleoside linkages include linkages that comprise abasic nucleosides.
  • abasic nucleoside means a sugar moiety in an oligonucleotide or oligomeric compound that is not directly connected to a nucleobase.
  • an abasic nucleoside is adjacent to one or two nucleosides in an oligonucleotide.
  • KLKBl nucleic acids include a KLKBl gene and an RNA sequence transcribed from a KLKBl gene (e.g., a KLKBl transcript).
  • a KLKB l transcript is an RNA that is transcribed from a KLKBl gene.
  • a KLKB l transcript is a KLKB 1 pre-mRNA.
  • a KLKB 1 transcript is a KLKB 1 mRNA.
  • KLKB l expression or “KLKB l expression” means the amount of a downstream product of a KLKBl nucleic acid. Downstream products of KLKBl nucleic acids include the products of transcription and translation of a KLKB 1 gene, e.g. , KLKB 1 transcripts and plasma prekallikrein and plasma kallikrein proteins.
  • kallikrein Bl activity or "KLKBl activity” means the enzymatic activity of a downstream protein product of a KLKB l nucleic acid.
  • Downstream protein products of KLKB l nucleic acids include the products of translation of a KLKB 1 gene, e.g. , plasma prekallikrein and plasma kallikrein proteins.
  • linker-nucleoside means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.
  • LNA means a bicyclic sugar moiety comprising a bridge connecting the 4 '-carbon and the 2'-carbon, wherein the bridge has the formula: 4'- ⁇ 3 ⁇ 4-0-2' .
  • non-bicyclic modified sugar or “non-bicyclic modified sugar moiety” means a modified sugar moiety that comprises a modification, such as a substitutent, that does not form a bridge between two atoms of the sugar to form a second ring.
  • linked nucleosides are nucleosides that are connected in a continuous sequence (i.e. no additional nucleosides are present between those that are linked).
  • migraine is headache with severe or debilitating head pain and/or one or more aura symptoms.
  • a migraine can be preceded or accompanied by nausea, vomiting, photophobia, phonophobia, osmophobia, fatigue, and/or other disturbances in autonomic, mental, sensory and motor functions.
  • chronic migraine means migraine that occurs an average of at least 15 days per month over the course of three consecutive months.
  • episodic migraine means migraine that does not occur frequently enough to be classified as chronic migraine.
  • migraine without aura means a migraine that is not preceded or accompanied by one or more aura symptoms.
  • migraine with aura means a migraine that is preceded or accompanied by one or more "aura symptoms”.
  • aura symptoms are fully reversible sensory disturbances that include but are not limited to vision change, speech or language disturbance, tingling sensation, and motor function disturbance. As used herein,
  • menstrual migraine or “menopausal migraine” means migraine that is associated with changing hormone levels throughout the menstrual cycle or associated with the onset of menopause, respectively.
  • mismatch or “non-complementary” means a nucleobase of a first oligonucleotide that is not complementary with the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligomeric compound are aligned.
  • modulating refers to changing or adjusting a feature in a cell, tissue, organ, or organism.
  • modulating KLKBl can mean to increase or decrease the level of KLKB l expression in a cell, tissue, organ or organism.
  • MOE means methoxyethyl.
  • 2'-MOE means a -OCH 2 CH 2 OCH 3 group at the 2' position of a furanosyl ring.
  • motif means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages, in an oligonucleotide.
  • nucleobase means a naturally occurring nucleobase or a modified nucleobase.
  • a "naturally occurring nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G).
  • a modified nucleobase is a group of atoms capable of pairing with at least one naturally occurring nucleobase.
  • a universal base is a nucleobase that can pair with any one of the five unmodified nucleobases.
  • nucleobase sequence means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage modification.
  • nucleoside means a compound comprising a nucleobase and a sugar moiety.
  • the nucleobase and sugar moiety are each, independently, unmodified or modified.
  • modified nucleoside means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety.
  • oligomeric compound means a compound consisting of an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.
  • oligonucleotide means a strand of linked nucleosides connected via internucleoside linkages, wherein each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides.
  • modified oligonucleotide means an oligonucleotide, wherein at least one nucleoside or internucleoside linkage is modified.
  • unmodified oligonucleotide means an oligonucleotide that does not comprise any nucleoside modifications or internucleoside modifications.
  • pharmaceutically acceptable carrier or diluent means any substance suitable for use in administering to an animal. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject.
  • a pharmaceutically acceptable carrier or diluent is sterile water; sterile saline; or sterile buffer solution.
  • pharmaceutically acceptable salts means physiologically and pharmaceutically acceptable salts of compounds, such as oligomeric compounds, i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
  • a pharmaceutical composition means a mixture of substances suitable for administering to a subject.
  • a pharmaceutical composition may comprise an antisense compound and a sterile aqueous solution.
  • a pharmaceutical composition shows activity in free uptake assay in certain cell lines.
  • phosphorus moiety means a group of atoms comprising a phosphorus atom.
  • a phosphorus moiety comprises a mono-, di-, or tri-phosphate, or phosphorothioate.
  • plasma prekallikrein or "prekallikrein” means a protein encoded by a KLKB 1 nucleic acid that is a precursor of plasma kallikrein.
  • plasma kallikrein means the active form of a protein encoded by a KLKB 1 nucleic acid.
  • prodrug means a therapeutic agent in a form outside the body that is converted to a differentform within the body or cells thereof. Typically conversion of a prodrug within the body is facilitated by the action of an enzymes (e.g., endogenous or viral enzyme) or chemicals present in cells or tissues and/or by physiologic conditions.
  • an enzymes e.g., endogenous or viral enzyme
  • chemicals present in cells or tissues and/or by physiologic conditions.
  • prevent refers to delaying or forestalling the onset or development of a disease, disorder, or condition for a period of time from minutes to indefinitely. Prevent also means reducing risk of developing a disease, disorder, or condition.
  • R Ai compound means an antisense compound that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid.
  • RNAi compounds include, but are not limited to double-stranded siRNA, single -stranded RNA (ssRNA), and microRNA, including microRNA mimics.
  • ssRNA single -stranded RNA
  • microRNA including microRNA mimics.
  • the term RNAi compound excludes antisense oligonucleotides that act through RNase H.
  • single-stranded in reference to a compound means such a compound consisting of one oligomeric compound that is not paired with a second oligomeric compound to form a duplex.
  • Self-complementary in reference to an oligonucleotide means an oligonucleotide that at least partially hybridizes to itself. A compound consisting of one oligomeric compound, wherein the
  • oligonucleotide of the oligomeric compound is self-complementary, is a single-stranded compound.
  • a single- stranded antisense or oligomeric compound may be capable of binding to a complementary oligomeric compound to form a duplex.
  • stereorandom chiral center in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration.
  • the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center.
  • the stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration.
  • a stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.
  • sugar moiety means an unmodified sugar moiety or a modified sugar moiety.
  • unmodified sugar moiety means a 2'-OH(H) furanosyl moiety, as found in RNA (an).
  • modified RNA sugar moiety or a 2'-H(H) moiety, as found in DNA (an “unmodified DNA sugar moiety”).
  • Unmodified sugar moieties have one hydrogen at each of the , 3', and 4' positions, an oxygen at the 3 ' position, and two hydrogens at the 5 ' position.
  • modified sugar moiety or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate.
  • modified furanosyl sugar moiety means a furanosyl sugar comprising a non-hydrogen substituent in place of at least one hydrogen of an unmodified sugar moiety.
  • a modified furanosyl sugar moiety is a 2'- substituted sugar moiety.
  • modified furanosyl sugar moieties include bicyclic sugars and non4)icyclic sugars.
  • sugar surrogate means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide.
  • Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or nucleic acids.
  • target nucleic acid means a nucleic acid that a compound (e.g. , an antisense compound) is designed to affect.
  • target region means a portion of a target nucleic acid to which an antisense compound is designed to hybridize.
  • terminal group means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.
  • treat or “treating” refers to administering a compound or pharmaceutical composition to a human or non-human animal in order to effect an alteration or improvement of a disease, disorder, or condition in the animal.
  • Certain embodiments provide methods, compounds, and compositions for modulating headache, or a symptom thereof, in an individual identified as having or at risk of having headache by administering a compound or composition to the individual, wherein the compound or composition comprises a KLKB l modulator or other modulator of the kallikrein-kinin pathway.
  • Modulation of KLKB l can lead to a decrease of KLKB 1 expression in order to treat, prevent, ameliorate or delay a disease or disorder associated with KLKB 1, such as headache.
  • the KLKBl modulator is an inhibitor of KLKB l expression.
  • inhibitors of KLKB 1 expression directly or indirectly reduce the amount or activity of plasma kallikrein.
  • modulators of the kallikrein-kinin pathway are antisense compounds, oligomeric compounds, peptides, antibodies, or small molecules.
  • an inhibitor of KLKB l expression is an oligomeric compound targeting a KLKB l nucleic acid.
  • the oligomeric compound comprises an oligonucleotide targeting a KLKB l nucleic acid.
  • the oligonucleotide is a modified oligonucleotide.
  • the individual is human. In certain embodiments, the individual is identified as at risk of having headache due to the individual having a history of headache.
  • the individual has a history of chronic migraine. In certain embodiments, the individual has experienced head pain on more than 15 days per month over the course of at least one to three months. In certain embodiments, the individual has experienced head pain and/or one or more aura symptoms on more than 15 days per month over the course of at least one to three months. In certain embodiments, the individual has experienced head pain on more than 15 days per month over the course of at least three months. In certain embodiments, the individual has experienced head pain and/or one or more aura symptoms on more than 15 days per month over the course of at least three months.
  • modulators of the kallikrein-kinin pathway for use in treatment of headache include lympho -epithelial Kazal -type-related inhibitor (LEKTI) as described in JProteome Res 9: 4389- 4394, 2010; ecotin-Pkal as described in Biol Chem 391 : 425-433, 2010; aprotinin as described in JHypertens 5: 581-586, 1987; PK15 as described in Nat Chem Biol 5: 502-507, 2009; kallistatin as described in Biol Chem 382: 15-21, 2001 and J Biol Chem 267: 25873-25880, 1992; Cl-inhibitor as described in Thromb Haemost 92: 1277-1283, 2004 and Adv Biosci 17: 93-101, 1978; CeKI as described in Biol Chem 385: 1083- 1086, 2004; AdKi as described in Toxicon 43: 219-223, 2004; FE999024 as described in Am
  • a method of preventing or ameliorating nausea, vomiting, photophobia, phonophobia, osmophobia, pain intensity, blurry vision, loss of vision, cloudy vision, visual aura, vertigo, tingling sensations, numbness, head pain severity, head pain duration, the number of days of headache per month, or a combination thereof, in an individual comprises administering to the individual a compound or composition comprising a modulator of the kallikrein-kinin pathway, such as an inhibitor of KLKB 1 expression.
  • the individual has or is at risk of having a headache.
  • the individual has or is at risk of having a migraine.
  • the individual has or is at risk of having chronic migraine.
  • the modulator of the kallikrein-kinin pathway such as an inhibitor of KLKB 1 expression, inhibits the conversion of HMWK to bradykinin. In certain such embodiments, bradykinin activity is reduced.
  • compounds and compositions described herein that modulate the kallikrein- kinin pathway can be used in methods of treating, preventing, delaying or ameliorating headache including, but not limited to cluster headaches, migrainous neuralgia, chronic headache, chronic paroxysmal hemicrania, cranial neuralgia, sinus headache, migraine with aura, migraine without aura, chronic migraine, episodic migraine, menopausal migraine, or menstrual migraine.
  • the methods described herein comprise administering an oligomeric compound comprising a modified oligonucleotide complementary to a KLKB 1 nucleic acid to an individual having, or at risk of having, headache.
  • the individual also has, or is at risk of having hereditary angioedema.
  • the individual neither has, nor is at risk of having, hereditary angioedema.
  • Hereditary angioedema is a rare inflammatory disease characterized by recurrent episodes of swelling around the head and extremities (Zuraw, B.L. N Engl. J. Med. 359: 1027-36, 2008).
  • Angioedema attacks occur with unpredictable frequency and are typically focused on the skin and gastric, oropharyngeal, and laryngeal mucosas. Asphyxiation due to laryngeal swelling can result in mortality. Hereditary angioedema is caused by deficiency or malfunction of the serine protease inhibitor C 1 - ⁇ (Kaplan, A.P. et al. J. Allergy Clin. Immunol. 109: 195-209, 2002).
  • the methods described herein comprise administering an oligomeric compound comprising a modified oligonucleotide complementary to a KLKB 1 nucleic acid to an individual having chronic migraine and hereditary angioedema, thereby ameliorating at least one symptom of chronic migraine and at least one symptom of hereditary angioedema.
  • the methods described herein comprise administering an oligomeric compound comprising a modified oligonucleotide complementary to a KLKB 1 nucleic acid to an individual having chronic migraine, wherein the individual does not have hereditary angioedema.
  • Certain embodiments are drawn to compounds and compositions described herein for use in therapy. Certain embodiments are drawn to a compound or composition comprising an inhibitor of KLKB 1 expression for use in treating, preventing, delaying the onset, slowing the progression, or ameliorating headache. Certain embodiments are drawn to a compound or composition for use in treating, preventing, delaying the onset, slowing the progression, or ameliorating a headache condition or disorder, or a symptom or physiological marker thereof.
  • the headache condition or disorder is cluster headaches, migrainous neuralgia, chronic headache, chronic paroxysmal hemicrania, cranial neuralgia, sinus headache, migraine with aura, migraine without aura, chronic migraine, episodic migraine, menopausal migraine, or menstrual migraine.
  • the headache condition or disorder is episodic migraine or chronic migraine.
  • the inhibitor of KLKB 1 expression is a nucleic acid, peptide, antibody, or small molecule.
  • the inhibitor of KLKB 1 expression is an antisense compound or an oligomeric compound comprising an oligonucleotide complementary to a KLKB 1 nucleic acid.
  • the compound or composition comprises a modified oligonucleotide 12 to 30 linked nucleosides in length.
  • the compound or composition comprises a modified oligonucleotide 20 linked nucleosides in length.
  • the compound comprising a modified oligonucleotide can be single-stranded.
  • the compound comprising a modified oligonucleotide can be double- stranded.
  • Certain embodiments are drawn to a compound or composition comprising an inhibitor of KLKB 1 expression for use in reducing, improving, or regulating nausea, vomiting, photophobia, phonophobia, osmophobia, pain intensity, blurry vision, loss of vision, cloudy vision, visual aura, vertigo, tingling sensations, numbness, head pain severity, head pain duration, the number of days of headache per month, or a combination thereof, in an individual.
  • the individual is identified as having, or at risk of having a disease, disorder, condition, symptom, or physiological marker associated with a headache condition or disorder.
  • the headache condition or disorder is episodic migraine, chronic migraine, or chronic tension-type headache. In certain embodiments, the headache condition or disorder is chronic migraine. In certain embodiments, the individual is human.
  • the inhibitor of KLKB 1 expression is a nucleic acid, peptide, antibody, or small molecule. In certain embodiments, the inhibitor of KLKB1 expression is an antisense compound or an oligomeric compound comprising an oligonucleotide complementary to a KLKB1 nucleic acid. In certain embodiments, the compound or composition comprises a modified oligonucleotide 12 to 30 linked nucleosides in length.
  • the compound or composition comprises a modified oligonucleotide 20 linked nucleosides in length.
  • the compound comprising a modified oligonucleotide can be single-stranded. In certain embodiments, the compound comprising a modified oligonucleotide can be double-stranded.
  • Certain embodiments are drawn to use of compounds or compositions described herein for the manufacture or preparation of a medicament for therapy. Certain embodiments are drawn to the use of a compound or composition as described herein in the manufacture or preparation of a medicament for treating, preventing, delaying the onset, slowing the progression, or ameliorating one or more diseases, disorders, conditions, symptoms or physiological markers associated with KLKB1 expression.
  • the compound or composition as described herein is used in the manufacture or preparation of a medicament for treating, ameliorating, delaying or preventing a headache condition or disorder, or a symptom or physiological marker thereof.
  • the headache condition or disorder is episodic migraine, chronic migraine, or chronic tension-type headache. In certain embodiments, the headache condition or disorder is chronic migraine.
  • the compound or composition comprises a nucleic acid, peptide, antibody, small molecule or other agent capable of inhibiting the expression or activity of a KLKB 1 nucleic acid.
  • the compound or composition is an antisense compound or an oligomeric compound comprising an oligonucleotide complementary to a KLKB1 nucleic acid.
  • the compound or composition comprises a modified oligonucleotide 12 to 30 linked nucleosides in length.
  • the compound or composition comprises a modified oligonucleotide 20 linked nucleosides in length.
  • the compound comprising a modified oligonucleotide can be single-stranded.
  • the compound comprising a modified oligonucleotide can be double- stranded.
  • Certain embodiments are drawn to the use of a compound or composition for the manufacture or preparation of a medicament for reducing, improving, or regulating nausea, vomiting, photophobia, phonophobia, osmophobia, pain intensity, blurry vision, loss of vision, cloudy vision, visual aura, vertigo, tingling sensations, numbness, head pain severity, head pain duration, the number of days of headache per month, or a combination thereof, in an individual having or at risk of having a headache condition or disorder.
  • the compound or composition comprises a nucleic acid, peptide, antibody, small molecule or other agent capable of inhibiting the expression or activity of a KLKBl nucleic acid.
  • the compound or composition is an antisense compound or an oligomeric compound comprising an oligonucleotide complementary to a KLKB l nucleic acid.
  • the compound or composition comprises a modified oligonucleotide 12 to 30 linked nucleosides in length.
  • the compound or composition comprises a modified oligonucleotide 20 linked nucleosides in length.
  • the compound comprising a modified oligonucleotide can be single-stranded.
  • the compound comprising a modified oligonucleotide can be double -stranded.
  • the compound or composition can be administered parenterally.
  • the compound or composition can be administered through injection or infusion.
  • Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration.
  • the parenteral administration is subcutaneous administration.
  • the compound or composition is co-administered with a second agent.
  • the compound or composition and the second agent are administered concomitantly.
  • the invention provides oligonucleotides, which consist of linked nucleosides.
  • Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides.
  • Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA (i.e., comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified internucleoside linkage).
  • Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modifed sugar moiety and a modified nucleobase.
  • modified sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain
  • modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.
  • modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more acyclic substituent, including but not limited to substituents at the 2', 4', and/or 5 ' positions.
  • one or more acyclic substituent of non-bicyclic modified sugar moieties is branched.
  • 2 '-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2'-F, 2'-OCH 3 ("OMe” or "O-methyl"), and 2'-0(CH 2 ) 2 OCH 3 (“MOE").
  • 2 '-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF 3 , OCF 3 , O-Ci-Cio alkoxy, O-Ci-Cio substituted alkoxy, O-Ci-Cio alkyl, O-Ci-Cio substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )- alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, 0(CH2)2SCH 3 ,
  • each R m and R n is, independently, H, an amino protecting group, or substituted or unsubstituted Ci-Cio alkyl, and the 2 '-substituent groups described in Cook et al., U.S. 6,531,584; Cook et al., U.S. 5,859,221 ; and Cook et al, U.S. 6,005,087.
  • 2'-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (N0 2 ), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl.
  • substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (N0 2 ), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl.
  • 4' -substituent groups suitable for non- bicyclic modified sugar moieties include but are not limited to alkoxy (e.g. , methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128.
  • non-bicyclic modified sugar moieties examples include but are not limited to: 5 '-methyl (R or S), 5'-vinyl, and 5'-methoxy.
  • non-bicyclic modified sugars comprise more than one non-bridging sugar substituent, for example, 2'-F-5 '-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008/101 157 and Rajeev et al., US2013/0203836.).
  • a non-bridging 2 '-substituent group selected from: F, OCF 3j OCH 3 , OCH 2 CH 2 OCH 3 , 0(CH 2 ) 2 SCH 3 , 0(CH 2 ) 2 ON(CH 3 ) 2 , 0(CH 2 ) 2 0(CH 2 ) 2 N(CH 3 ) 2 , and OCH 2
  • a 2'-substituted nucleoside or 2'- non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2 '-substituent group selected from: F, OCH 3 , and OCH 2 CH 2 OCH 3 .
  • Nucleosides comprising modified sugar moieties may be referred to by the position(s) of the substitution(s) on the sugar moiety of the nucleoside.
  • nucleosides comprising 2 '-substituted or 2-modified sugar moieties are referred to as 2 '-substituted nucleosides or 2-modified nucleosides.
  • Certain modifed sugar moieties comprise a bridging sugar substituent that forms a second ring resulting in a bicyclic sugar moiety.
  • the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms.
  • 4' to 2' bridging sugar substituents include but are not limited to: 4'-CH 2 -2', 4'-(CH 2 ) 2 -2', 4'-(CH 2 ) 3 -2', 4'-CH 2 -0-2' ("LNA"), 4'-CH 2 -S-2', 4'- (CH 2 ) 2 -0-2' ("ENA”), 4'-CH(CH 3 )-0-2' (referred to as "constrained ethyl" or "cEt" when in the S
  • x 0, 1, or 2;
  • n 1, 2, 3, or 4;
  • bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration.
  • an LNA nucleoside (described herein) may be in the a-L configu
  • bicyclic nucleosides include both isomeric configurations.
  • positions of specific bicyclic nucleosides e.g., LNA or cEt
  • they are in the ⁇ -D configuration, unless otherwise specified.
  • modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5 '-substituted and 4'-2' bridged sugars).
  • modified sugar moieties are sugar surrogates.
  • the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom.
  • such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein.
  • certain sugar surrogates comprise a 4'-sulfur atom and a substitution at the 2'- position (see, e.g., Bhat et al., U.S. 7,875,733 and Bhat et al., U.S. 7,939,677) and/or the 5' position.
  • sugar surrogates comprise rings having other than 5 atoms.
  • a sugar surrogate comprises a six-membered tetrahydropyran ("THP").
  • THP tetrahydropyran
  • Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified
  • tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MNA”) (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro
  • F-HNA see e.g. Swayze et al., U.S. 8,088,904; Swayze et al., U.S. 8,440,803; Swayze et al., U.S.
  • F-HNA can also be referred to as a F-THP or 3'-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula:
  • Bx is a nucleobase moiety
  • T3 and T4 are each, independently, an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T3 and T4 is an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group;
  • qi, q2, q3, q4, qs, qe and q7 are each, independently, H, Ci-Ce alkyl, substituted Ci-Ce alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; and
  • modified THP nucleosides are provided wherein qi, q2, q3, q4, qs, qe and q7 are each H. In certain embodiments, at least one of qi, q2, q3, q4, qs, qe and q7 is other than H. In certain embodiments, at least one of qi, q2, q3, q4, qs, qe and q7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of Ri and R2 is F. In certain embodiments, Ri is F and R2 is H, in certain embodiments, Ri is methoxy and R2 is H, and in certain embodiments, Ri is methoxyethoxy and R2 is
  • sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom.
  • nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. 5,698,685; Summerton et al., U.S. 5,166,315; Summerton et al., U.S. 5,185,444; and Summerton et al., U.S. 5,034,5 the term "morpholino" means a sugar surrogate having the following structure:
  • morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure.
  • sugar surrogates are refered to herein as "modifed morpholinos.”
  • sugar surrogates comprise acyclic moieites.
  • nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem. , 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011/133876.
  • modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase.
  • modified nucleobases are selected from: 5-substituted pyrimidines, 6- azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines.
  • modified nucleobases are selected from: 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N- methyladenine, 2-propyladenine , 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-C ⁇ C-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4- thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyl
  • nucleobases include tricyclic pyrimidines, such as l,3-diazaphenoxazine-2-one, l,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-l,3-diazaphenoxazine-2- one (G-clamp).
  • Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2- pyridone.
  • Further nucleobases include those disclosed in Merigan et al., U.S.
  • nucleosides of modified oligonucleotides may be linked together using any internucleoside linkage.
  • the two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom.
  • Modified internucleoside linkages compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide.
  • internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers.
  • Representative chiral internucleoside linkages include but are not limited to alkylphosphonates and phosphorothioates. Methods of preparation of phosphorous-containing and non- phosphorous-containing internucleoside linkages are well known to those skilled in the art.
  • Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates.
  • Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations.
  • populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom.
  • Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage.
  • each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration.
  • populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkages in a particular, independently selected stereochemical configuration.
  • the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population.
  • the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population.
  • Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555.
  • a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the ( ⁇ Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, modified oligonucleotides comprising (Rp) and/or ( ⁇ Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein "B" indicates a nucleobase:
  • chiral intemucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.
  • Further neutral intemucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral intemucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2 component parts.
  • modified oligonucleotides comprise one or more modified nucleoside comprising a modified sugar. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified intemucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or intemucleoside linkages of a modified
  • oligonucleotide define a pattern or motif.
  • the patterns of sugar moieties, nucleobases, and intemucleoside linkages are each independent of one another.
  • a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or intemucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).
  • oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif.
  • sugar motifs include but are not limited to any of the sugar modifications discussed herein.
  • modified oligonucleotides comprise or consist of a region having a gapmer motif, which comprises two external regions or "wings" and a central or internal region or "gap."
  • the three regions of a gapmer motif (the 5 '-wing, the gap, and the 3 '-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap.
  • the wings of a gapmer comprise 1-5 nucleosides. In certain embodiments, the wings of a gapmer comprise 2-5 nucleosides. In certain embodiments, the wings of a gapmer comprise 3- 5 nucleosides. In certain embodiments, the nucleosides of a gapmer are all modified nucleosides.
  • the gap of a gapmer comprises 7-12 nucleosides. In certain embodiments, the gap of a gapmer comprises 7-10 nucleosides. In certain embodiments, the gap of a gapmer comprises 8-10 nucleosides. In certain embodiments, the gap of a gapmer comprises 10 nucleosides. In certain embodiment, each nucleoside of the gap of a gapmer is an unmodified 2'-deoxy nucleoside.
  • the gapmer is a deoxy gapmer.
  • the nucleosides on the gap side of each wing/gap junction are unmodified 2'-deoxynucleosides and the nucleosides on the wing sides of each wing/gap junction are modified nucleosides.
  • each nucleoside of the gap is an unmodified 2'-deoxynucleoside.
  • each nucleoside of each wing is a modified nucleoside.
  • oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif.
  • each nucleobase is modified. In certain embodiments, none of the nucleobases are modified.
  • each purine or each pyrimidine is modified.
  • each adenine is modified.
  • each guanine is modified.
  • each thymine is modified.
  • each uracil is modified.
  • each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methylcytosines.
  • modified oligonucleotides comprise a block of modified nucleobases.
  • the block is at the 3 '-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3'-end of the oligonucleotide. In certain embodiments, the block is at the 5'-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5 '-end of the oligonucleotide.
  • oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase.
  • one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif.
  • the sugar moiety of said nucleoside is a 2'-deoxyribosyl moiety.
  • the modified nucleobase is selected from: a 2-thiopyrimidine and a 5-propynepyrimidine.
  • oligonucleotides comprise modified and/or unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif.
  • each intemucleoside linking group of a modified oligonucleotide is independently selected from a phosphorothioate and phosphate intemucleoside linkage.
  • the sugar motif of a modified oligonucleotide is a gapmer and the intemucleoside linkages within the gap are all modified.
  • some or all of the intemucleoside linkages in the wings are unmodified phosphate linkages.
  • the terminal intemucleoside linkages are modified.
  • oligonucleotides can have any of a variety of ranges of lengths.
  • oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range.
  • X and Y are each independently selected from 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X ⁇ Y.
  • oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to
  • modified oligonucleotides are characterized by their modification motifs and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each intemucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications.
  • the intemucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the intemucleoside linkages of the gap region of the sugar motif.
  • sugar gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications.
  • an oligonucleotide is described by an overall length or range and by lengths or length ranges of two or more regions (e.g., a regions of nucleosides having specified sugar modifications), in such circumstances it may be possible to select numbers for each range that result in an oligonucleotide having an overall length falling outside the specified range.
  • a modified oligonucleotide consists if of 15-20 linked nucleosides and has a sugar motif consisting of three regions, A, B, and C, wherein region A consists of 2-6 linked nucleosides having a specified sugar motif, region B consists of 6-10 linked nucleosides having a specified sugar motif, and region C consists of 2-6 linked nucleosides having a specified sugar motif.
  • oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid.
  • the invention provides oligomeric compounds, which consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups.
  • Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide.
  • Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position.
  • conjugate groups are attached to the 2'-position of a nucleoside of a modified oligonucleotide.
  • conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups.
  • conjugate groups or terminal groups are attached at the 3' and/or 5 '-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3'-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3 '-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5 '-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5 '-end of oligonucleotides.
  • terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, abasic nucleosides, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.
  • terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, abasic nucleosides, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.
  • oligonucleotides are covalently attached to one or more conjugate groups.
  • conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance.
  • conjugate groups impart a new property on the attached oligonucleotide, e.g. , fluorophores or reporter groups that enable detection of the oligonucleotide.
  • conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci.
  • Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.
  • intercalators include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, bio
  • a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, ( ⁇ S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a
  • an active drug substance for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, ( ⁇ S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a
  • benzothiadiazide chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.
  • Conjugate moieties are attached to oligonucleotides through conjugate linkers.
  • the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond).
  • the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.
  • a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.
  • conjugate linkers are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein.
  • a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a parent compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups.
  • bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.
  • conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-l-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA).
  • ADO 8-amino-3,6-dioxaoctanoic acid
  • SMCC succinimidyl 4-(N-maleimidomethyl) cyclohexane-l-carboxylate
  • AHEX or AHA 6-aminohexanoic acid
  • conjugate linkers include but are not limited to substituted or unsubstituted Ci- Cio alkyl, substituted or unsubstituted C2-C10 alkenyl or substituted or unsubstituted C2-C10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.
  • conjugate linkers comprise 1-10 linker-nucleosidesln certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments,
  • linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine.
  • a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5- methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue.
  • linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds.
  • cleavable bonds are phosphodiester bonds.
  • linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid.
  • an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide.
  • the total number of contiguous linked nucleosides in such an oligomeric compound is more than 30.
  • an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such an oligomeric compound is no more than 30.
  • conjugate linkers comprise no more than 10 linker-nucleosides.
  • conjugate linkers comprise no more than 5 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker- nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.
  • a conjugate group it is desirable for a conjugate group to be cleaved from the oligonucleotide.
  • oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide.
  • certain conjugate linkers may comprise one or more cleavable moieties.
  • a cleavable moiety is a cleavable bond.
  • a cleavable moiety is a group of atoms comprising at least one cleavable bond.
  • a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds.
  • a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome.
  • a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.
  • a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group.
  • a cleavable moiety comprises or consists of one or more linker-nucleosides.
  • the one or more linker-nucleosides are linked to one another and/or to the remainder of the oligomeric compound through cleavable bonds.
  • such cleavable bonds are unmodified phosphodiester bonds.
  • a cleavable moiety is 2'- deoxynucleoside that is attached to either the 3' or 5 '-terminal nucleoside of an oligonucleotide by a phosphate internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage.
  • the cleavable moiety is 2'-deoxyadenosine.
  • a conjugate group comprises a cell-targeting moiety.
  • a cell-targeting moiety has the general formula:
  • n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater.
  • conjugate groups comprise cell -targeting moieties that have at least one tethered ligand.
  • cell-targeting moieties comprise two tethered ligands covalently attached to a branching group.
  • cell -targeting moieties comprise three tethered ligands covalently attached to a branching group.
  • the cell-targeting moiety comprises a branching group comprising one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether and hydroxylamino groups.
  • the branching group comprises a branched aliphatic group comprising groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether and hydroxylamino groups.
  • the branched aliphatic group comprises groups selected from alkyl, amino, oxo, amide and ether groups.
  • the branched aliphatic group comprises groups selected from alkyl, amino and ether groups.
  • the branched aliphatic group comprises groups selected from alkyl and ether groups.
  • the branching group comprises a mono or polycyclic ring system.
  • each tether of a cell-targeting moiety comprises one or more groups selected from alkyl, substituted alkyl, ether, thioether, disulfide, amino, oxo, amide, phosphodiester, and polyethylene glycol, in any combination.
  • each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether, thioether, disulfide, amino, oxo, amide, and polyethylene glycol, in any combination.
  • each tether is a linear aliphatic group comprising one or more groups selected from alkyl, phosphodiester, ether, amino, oxo, and amide, in any combination.
  • each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether, amino, oxo, and amid, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, amino, and oxo, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl and oxo, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl and phosphodiester, in any combination. In certain embodiments, each tether comprises at least one phosphorus linking group or neutral linking group.
  • each tether comprises a chain from about 6 to about 20 atoms in length. In certain embodiments, each tether comprises a chain from about 10 to about 18 atoms in length. In certain embodiments, each tether comprises about 10 atoms in chain length.
  • each ligand of a cell-targeting moiety has an affinity for at least one type of receptor on a target cell. In certain embodiments, each ligand has an affinity for at least one type of receptor on the surface of a mammalian liver cell. In certain embodiments, each ligand has an affinity for the hepatic asialoglycoprotein receptor (ASGP-R). In certain embodiments, each ligand is a carbohydrate. In certain embodiments, each ligand is, independently selected from galactose, N-acetyl galactoseamine (GalNAc), mannose, glucose, glucoseamine and fucose. In certain embodiments, each ligand is N-acetyl galactoseamine (GalNAc).
  • the cell-targeting moiety comprises 3 GalNAc ligands. In certain embodiments, the cell -targeting moiety comprises 2 GalNAc ligands. In certain embodiments, the cell- targeting moiety comprises 1 GalNAc ligand. In certain embodiments, each ligand of a cell-targeting moiety is a carbohydrate, carbohydrate derivative, modified carbohydrate, polysaccharide, modified polysaccharide, or polysaccharide derivative.
  • the conjugate group comprises a carbohydrate cluster (see, e.g., Maier et al., "Synthesis of Antisense Oligonucleotides Conjugated to a Multivalent Carbohydrate Cluster for Cellular Targeting," Bioconjugate Chemistry, 2003, 14, 18-29 or Rensen et al., “Design and Synthesis of Novel N- Acetylgalactosamine-Terminated Glycolipids for Targeting of Lipoproteins to the Hepatic Asiaglycoprotein Receptor," J. Med. Chem. 2004, 47, 5798-5808).
  • each ligand is an amino sugar or a thio sugar.
  • amino sugars may be selected from any number of compounds known in the art, such as sialic acid, a-D-galactosamine, ⁇ -muramic acid, 2-deoxy-2-methylamino-L-glucopyranose, 4,6- dideoxy-4-formamido-2,3-di-0-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose and N- sulfo-D-glucosamine, and N-glycoloyl-a-neuraminic acid.
  • thio sugars may be selected from 5- Thio- -D-glucopyranose, methyl 2,3,4-tri-0-acetyl-l-thio-6-0-trityl-a-D-glucopyranoside, 4- ⁇ 1 ⁇ - ⁇ -0- galactopyranose, and ethyl 3,4,6,7-tetra-0-acetyl-2-deoxy-l,5-dithio-a-D-g/Mco-heptopyranoside.
  • conjugate groups comprise a cell-targeting moiety having the formula:
  • conjugate groups comprise a cell-targeting moiety having the formula:
  • conjugate groups comprise a cell-tar eting moiety having the formula-
  • oligomeric compounds comprise a conjugate group described herein as "LICA-1".
  • LICA-1 has the formula:
  • oligomeric compounds comprising LICA-1 have the formula:
  • oligo is an oligonucleotide
  • oligomeric compounds comprise modified oligonucleotides comprising a gapmer and a conjugate group comprising at least one, two, or three GalNAc ligands.
  • antisense compounds and oligomeric compounds comprise a conjugate group found in any of the following references: Lee, Carbohydr Res, 1978, 67, 509-514; Connolly et al., J Biol Chem, 1982, 257, 939-945; Pavia et al., IntJPep Protein Res, 1983, 22, 539-548; Lee et al., Biochem, 1984, 23, 4255-4261; Lee et al., Glycoconjugate J, 1987, 4, 317-328; Toyokuni et al., Tetrahedron Lett, 1990, 31, 2673-2676; Biessen et al., J
  • compounds of the invention are single -stranded.
  • oligomeric compounds are paired with a second oligonucleotide or oligomeric compound to form a duplex, which is double-stranded.
  • the present invention provides compounds, which comprise or consist of an oligomeric compound comprising an antisense oligonucleotide, having a nucleobase sequences
  • antisense compounds are antisense compounds.
  • antisense compounds are single-stranded.
  • Such single -stranded antisense compounds typically comprise or consist of an oligomeric compound that comprises or consists of a modified oligonucleotide and optionally a conjugate group.
  • antisense compounds are double-stranded.
  • Such double -stranded antisense compounds comprise a first oligomeric compound having a region complementary to a target nucleic acid and a second oligomeric compound having a region complementary to the first oligomeric compound.
  • the first oligomeric compound of such double stranded antisense compounds typically comprises or consists of a modified oligonucleotide and optionally a conjugate group.
  • the oligonucleotide of the second oligomeric compound of such double -stranded antisense compound may be modified or unmodified.
  • Either or both oligomeric compounds of a double-stranded antisense compound may comprise a conjugate group.
  • the oligomeric compounds of double-stranded antisense compounds may include non-complementary overhanging nucleosides.
  • oligomeric compounds of antisense compounds are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity.
  • antisense compounds selectively affect one or more target nucleic acid.
  • Such selective antisense compounds comprises a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity.
  • hybridization of an antisense compound to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid.
  • certain antisense compounds result in R ase H mediated cleavage of the target nucleic acid.
  • R ase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex.
  • the DNA in such an R A:DNA duplex need not be unmodified DNA.
  • the invention provides antisense compounds that are sufficiently "DNA-like" to elicit RNase H activity. Further, in certain embodiments, one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.
  • an antisense compound or a portion of an antisense compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid.
  • RISC RNA-induced silencing complex
  • certain antisense compounds result in cleavage of the target nucleic acid by Argonaute.
  • Antisense compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double- stranded (siRNA) or single -stranded (ssRNA).
  • Antisense activities may be observed directly or indirectly.
  • observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, and/or a phenotypic change in a cell or animal.
  • antisense compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid.
  • the target nucleic acid is a KLKB1 nucleic acid.
  • the target nucleic acid is an endogenous RNA molecule.
  • the target nucleic acid encodes a protein.
  • the target nucleic acid is selected from: an mRNA and a pre-mRNA, including intronic, exonic and untranslated regions.
  • the target RNA is an mRNA.
  • the target nucleic acid is a pre-mRNA.
  • the target region is entirely within an intron.
  • the target region spans an intron/exon junction.
  • the target region is at least 50% within an intron.
  • the target nucleic acid is a non-coding RNA.
  • the target non-coding RNA is selected from: a long-non-coding RNA, a short non-coding RNA, an intronic RNA molecule, a snoRNA, a scaRNA, a microRNA (including pre -microRNA and mature microRNA), a ribosomal RNA, and promoter directed RNA.
  • the target nucleic acid is a nucleic acid other than a mature mRNA. In certain embodiments, the target nucleic acid is a nucleic acid other than a mature mRNA or a microRNA.
  • the target nucleic acid is a non-coding RNA other than a microRNA. In certain embodiments, the target nucleic acid is a non-coding RNA other than a microRNA or an intronic region of a pre-mRNA. In certain embodiments, the target nucleic acid is a long non-coding RNA. In certain embodiments, the target nucleic acid is a nuclear-retained non-coding RNA.
  • antisense compounds described herein are complementary to a target nucleic acid comprising a single-nucleotide polymorphism (SNP).
  • the antisense compound is capable of modulating expression of one allele of the SNP -containing target nucleic acid to a greater or lesser extent than it modulates another allele.
  • an antisense compound hybridizes to a (SNP)-containing target nucleic acid at the single-nucleotide polymorphism site.
  • antisense compounds are at least partially complementary to more than one target nucleic acid.
  • antisense compounds of the present invention may mimic microRNAs, which typically bind to multiple targets.
  • antisense compounds comprise antisense oligonucleotides that are complementary to the target nucleic acid over the entire length of the oligonucleotide.
  • such oligonucleotides are 99% complementary to the target nucleic acid. In certain embodiments, such oligonucleotides are 95% complementary to the target nucleic acid. In certain embodiments, such oligonucleotides are 90% complementary to the target nucleic acid. In certain embodiments, such oligonucleotides are 85% complementary to the target nucleic acid. In certain embodiments, such oligonucleotides are 80% complementary to the target nucleic acid. In certain embodiments, antisense oligonucleotides are at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and comprise a region that is 100% or fully complementary to a target nucleic acid.
  • the region of full complementarity is from 6 to 20 nucleobases in length. In certain such embodiments, the region of full complementarity is from 10 to 18 nucleobases in length. In certain such embodiments, the region of full complementarity is from 18 to 20 nucleobases in length.
  • the oligomeric compounds of antisense compounds comprise one or more mismatched nucleobases relative to the target nucleic acid.
  • antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount.
  • selectivity of the antisense compound is improved.
  • the mismatch is specifically positioned within an oligonucleotide having a gapmer motif.
  • the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5'-end of the gap region.
  • the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3 '-end of the gap region.
  • the mismatch is at position 1, 2, 3, or 4 from the 5'-end of the wing region.
  • the mismatch is at position 4, 3, 2, or 1 from the 3'-end of the wing region.
  • antisense compounds and oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is a KLKBl nucleic acid.
  • antisense compounds and oligomeric compounds comprise or consist of an oligonucleotide that is fully complementary to a target nucleic acid, wherein the target nucleic acid is a KLKBl nucleic acid.
  • a KLKB l nucleic acid has the sequence set forth in GENBANK Accession No. NM_000892.3 (incorporated herein as SEQ ID NO: 1).
  • a KLKBl nucleic acid has the sequence set forth in GENBANK Accession No. NT_016354.19 truncated from nucleotides 111693001 to 111730000 (incorporated herein as SEQ ID NO: 2).
  • the antisense compound or oligomeric compound comprises or consists of Compound 546254 or a salt thereof.
  • the structure of Compound 546254 is
  • the antisense compound or oligomeric compound comprises or consists of Compound 721744 or a salt thereof.
  • the structure of Compound 721744 is
  • the antisense compound or oligomeric compound comprises or consists of a an embodiments described in WO 2013/003808, WO 2012/170945, WO 2015/031679, or WO 2015/168532, which are hereby incorporated by reference.
  • contacting a cell with an antisense compound or oligomeric compound complementary to KLKBl reduces the amount of KLKBl expression in the cell. In certain embodiments, contacting a cell with an antisense compound or oligomeric compound complementary to KLKB 1 reduces the amount of KLKBl expression in the cell and ameliorates one or more symptoms of headache.
  • antisense compounds or oligomeric compounds comprise or consist of an oligonucleotide that is complementary to a target nucleic acid, wherein the target nucleic acid is expressed in liver cells.
  • modulation of expression of KLKBl in liver cells results in a reduction in plasma prekallikrein.
  • plasma kallikrein is also reduced.
  • modulation of expression of KLKB 1 ameliorates one or more symptoms of a headache disorder such as migraine.
  • the present invention provides pharmaceutical compositions comprising one or more oligomeric compound or a salt thereof.
  • the pharmaceutical composition comprises a suitable pharmaceutically acceptable diluent or carrier.
  • a pharmaceutical composition comprises a sterile saline solution and one or more antisense compound.
  • such pharmaceutical composition consists of a sterile saline solution and one or more antisense compound.
  • the sterile saline is pharmaceutical grade saline.
  • a pharmaceutical composition comprises one or more antisense compound and sterile water.
  • a pharmaceutical composition consists of one antisense compound and sterile water.
  • the sterile water is pharmaceutical grade water.
  • a pharmaceutical composition comprises one or more antisense compound and phosphate-buffered saline (PBS).
  • PBS phosphate-buffered saline
  • a pharmaceutical composition consists of one or more antisense compound and sterile PBS.
  • the sterile PBS is pharmaceutical grade PBS.
  • compositions comprise one or more or oligomeric compound and one or more excipients.
  • excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.
  • oligomeric compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations.
  • compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
  • compositions comprising an oligomeric compound encompass any pharmaceutically acceptable salts of the antisense compound, esters of the antisense compound, or salts of such esters.
  • pharmaceutical compositions comprising antisense compounds comprising one or more antisense oligonucleotide upon administration to an animal, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof.
  • the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
  • Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
  • prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved by endogenous nucleases within the body.
  • Lipid moieties have been used in nucleic acid therapies in a variety of methods.
  • the nucleic acid such as an oligomeric compound, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids.
  • DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid.
  • a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue.
  • a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue.
  • a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.
  • compositions comprise a delivery system.
  • delivery systems include, but are not limited to, liposomes and emulsions.
  • Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds.
  • certain organic solvents such as dimethylsulfoxide are used.
  • compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types.
  • pharmaceutical compositions include liposomes coated with a tissue-specific antibody.
  • compositions comprise a co-solvent system.
  • co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase.
  • co-solvent systems are used for hydrophobic compounds.
  • VPD co-solvent system is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant
  • Polysorbate 80TM and 65% w/v polyethylene glycol 300 The proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80TM; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
  • compositions are prepared for oral administration.
  • pharmaceutical compositions are prepared for buccal administration.
  • a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, etc.).
  • a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer.
  • other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives).
  • injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like.
  • compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers.
  • Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.
  • Aqueous injection suspensions may contain. VII. Certain Combination Therapies
  • pharmaceutical agents that may be co-administered with a compound or composition described herein include anticoagulant or antiplatelet agents, beta blockers, anticonvulsants, calcium antagonists, tricyclic antidepressants, analgesic agents, opioids, triptans, and ergotamines.
  • therapies that may be co-administered with a compound or composition described herein include invasive or non-invasive peripheral nerve stimulation, central neurostimulation, transcranial magnetic stimulation, cranial osteopathic manipulative treatment, and cognitive-behavioral therapy.
  • pharmaceutical agents that may be co-administered with a compound or composition described herein include, but are not limited to, an additional inhibitor of KLKB l expression.
  • the co-adminstered pharmaceutical agent is administered prior to administration of a compound or composition described herein.
  • the co-administered pharmaceutical agent is administered following administration of a compound or composition described herein.
  • the co-administered pharmaceutical agent is administered at the same time as a compound or composition described herein.
  • the dose of a co-administered pharmaceutical agent is the same as the dose that would be administered if the co-administered pharmaceutical agent was administered alone.
  • the dose of a co-administered pharmaceutical agent is lower than the dose that would be administered if the co-administered pharmaceutical agent was administered alone. In certain embodiments the dose of a co-administered pharmaceutical agent is greater than the dose that would be administered if the co-administered pharmaceutical agent was administered alone.
  • the co-administration of a second compound enhances the effect of a first compound, such that co-administration of the compounds results in an effect that is greater than the effect of administering the first compound alone.
  • the co-administration results in effects that are additive of the effects of the compounds when administered alone.
  • the coadministration results in effects that are supra-additive of the effects of the compounds when administered alone.
  • the first compound is an antisense compound.
  • the second compound is an antisense compound.
  • RNA nucleoside comprising a 2' -OH sugar moiety and a thymine base
  • RNA having a modified sugar 2' -OH in place of one 2'-H of DNA
  • RNA having a modified base thymine (methylated uracil) in place of a uracil of RNA
  • nucleic acid sequences provided herein are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases.
  • an oligomeric compound having the nucleobase sequence "ATCGATCG” encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence "AUCGAUCG” and those having some DNA bases and some RNA bases such as "AUCGATCG” and oligomeric compounds having other modified
  • nucleobases such as "AT m CGAUCG,” wherein ""C indicates a cytosine base comprising a methyl group at the 5-position.
  • Certain compounds described herein e.g., modified oligonucleotides
  • R absolute stereochemistry
  • D diastereomers
  • L organic solvent
  • Included in the compounds provided herein are all such possible isomers, including their racemic and optically pure forms, unless specified otherwise.
  • all cis- and trans-isomers and tautomeric forms are also included unless otherwise indicated.
  • the compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element.
  • compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the 3 ⁇ 4 hydrogen atoms.
  • Isotopic substitutions encompassed by the compounds herein include but are not limited to: 2 H or H in place of 3 ⁇ 4, 13 C or 14 C in place of 12 C, 15 N in place of 14 N, 17 0 or 18 0 in place of 16 0, and 33 S, 4 S, 5 S, or 6 S in place of 2 S.
  • non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool.
  • radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging.
  • Example 1 Plasma kallikrein-kinin pathway activity following inhibition of KLKB1 expression in individuals
  • An oligomeric compound comprising a modified oligonucleotide complementary to a KLKB 1 nucleic acid was tested for its effects on activity of the kallikrein-kinin pathway in human individuals.
  • Compound 546254 is a modified oligonucleotide that is 20 linked nucleosides in length and has the nucleobase sequence TGCAAGTCTCTTGGCAAACA (incorporated herein as SEQ ID NO: 3).
  • the nucleobase sequence is 100% complementary to KLKB1 transcripts SEQ ID NO: 1, at positions 1019 to 1038, and SEQ ID NO: 2, at positions 27441 to 27460.
  • Compound 546254 is a gapmer wherein the central gap segment is ten 2'-deoxynucleosides in length and is flanked by wings of five nucleosides each.
  • Each nucleoside in the 5 '-wing segment and each nucleoside in the 3 '-wing segment is a 2'-MOE modified nucleoside.
  • the intemucleoside linkages throughout the oligonucleotide are phosphorothioate linkages.
  • All cytosine nucleobases throughout the oligonucleotide are 5-methylcytosines.
  • KLKB1 expression in the individuals was assessed by measuring their plasma prekallikrein (PKK) protein levels using an ELISA assay according to the manufacturer's directions (cat. # ab 171015, Abeam, Cambridge, MA). The results, shown in the the table below as the average percent change in plasma prekallikrein protein levels for each treatment group relative to the average level on day 1, show that KLKB l expression was inhibited in a dose dependent manner in the individuals.
  • PKI plasma prekallikrein
  • Serine protease activity of the individuals' plasma kallikrein-kinin pathway was assessed by measuring in vitro cleavage of a chromogenic substrate that comprises a portion of the peptide sequence of high molecular weight kininogen (HMWK).
  • HMWK high molecular weight kininogen
  • the individuals' plasma samples were centrifuged to remove platelets, then cooled to 0 °C, and incubated with 12.5 mg/mL dextran sulfate.
  • the chromogenic plasma kallikrein peptide substrate, H-D-Pro-Phe-Arg-pNA was then added at 30 °C and absorbance at 405 nm was monitored in order to measure cleavage of the substrate and release of /j>-nitroanaline.
  • the results shown in the table below as the average percent change in protease activity for each treatment group relative to the average activity on day 1, show that plasma kallikrein-kinin pathway activity was reduced in a dose dependent manner
  • Example 2 Effects on headache following administration of an oligomeric compound targeted to KLKBl
  • An oligomeric compound comprising a modified oligonucleotide complementary to a KLKB 1 nucleic acid is tested for its effects on headache in human individuals.
  • Human individuals are identified as having chronic migraine. Approximately thirty individuals identified as having chronic migraine are divided into groups. Individuals in the placebo group receive 1.00 mL 0.9% sterile saline. Individuals in the treatment group receive a dose of 200 mg of Compound 546254. Each dose of placebo or Compound 546254 is administered subcutaneously, once per week, for 16 weeks. Blood and/or plasma samples are taken from all individuals, and KLKB 1 expression, kallikrein-kinin pathway activity, pharmacokinetics and/or pharmacodynamics of the oligomeric compound, and/or other biomarkers are measured.
  • the number of days migraine occurs, the number of days head pain occurs, head pain severity, migraine headache frequency, use of medication other than the oligomeric compound, migraine specific quality of life (MSQ) questionnaire score, physician global impress of change (PGIC) score, subject global impress of change (SGIC) score, and/or other symptoms of migraine are assessed in the individuals using standardized subjective and/or objective measures.
  • Example 3 Effects on headache following administration of an oligomeric compound targeted to KLKB1
  • An oligomeric compound comprising a modified oligonucleotide complementary to a KLKB 1 nucleic acid is tested for its effects on headache in human individuals.
  • Compound 721744 is an oligomeric compound consisting of the modified oligonucleotide of Compound 546254 and a LICA-1 conjugate group.
  • Compound 546254 is described in Example 1.
  • the LICA- 1 conjugate group is attached at the 5 '-end of the modified oligonucleotide via a phosphate group.
  • Human individuals are identified as having, or at risk of having, one or more certain type(s) of headache. A certain number of the identified individuals are divided into groups. Individuals in the placebo group(s) receive placebo. Individuals in the treatment group(s) receive a dose of Compound 721744. The doses of placebo and the oligomeric compound are administered to the individuals subcutaneously. Blood and/or plasma samples are taken from all individuals, and KLKB 1 expression, kallikrein-kinin pathway activity, pharmacokinetics and/or pharmacodynamics of the oligomeric compound, and/or other biomarkers are measured.
  • the number of days headache occurs the number of days head pain occurs, head pain severity, headache frequency, use of medication other than the oligomeric compound, physician global impression of change (PGIC) score, subject global impression of change (SGIC) score, and/or other symptoms of headache are assessed in the individuals using standardized subjective and/or objective measures.
  • PGIC physician global impression of change
  • SGIC subject global impression of change
  • Example 4 Effects on headache following administration of an oligomeric compound targeted to KLKB1
  • Oligomeric compound 546254 comprising a modified oligonucleotide complementary to a KLKB1 nucleic acid, or placebo was administered to human individuals having chronic migraine, according to the protocol described in Example 2.
  • the individuals were asked to record all headaches or lack thereof once every day (24 hour period) in an electronic diary.
  • Information requested for inclusion in the diary included headache severity, symptoms, and use of other medications. Severity was recorded as "no pain”, “mild pain”, or "severe pain”.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Organic Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biochemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Epidemiology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Neurosurgery (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Neurology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pain & Pain Management (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Disclosed herein are methods for treating, preventing, or ameliorating headache using a compound targeted to a KLKBl nucleic acid. Examples of headache conditions that can be treated, prevented, or ameliorated with the administration of a compound targeted to KLKB 1 include migraine.

Description

MODULATION OF KALLIKREIN Bl (KLKB1) FOR TREATMENT OF HEADACHE
Sequence Listing
The present application is being filed along with a Sequence Listing in electronic format. The
Sequence Listing is provided as a file entitled BIOL0314WOSEQ_ST25.txt created February 8, 2018 which is 52 Kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety. Field
Provided herein are methods, compounds, and compositions for modulating the kallikrein-kinin pathway in an individual in order to treat, prevent, delay, or ameliorate headache.
Background
Migraine
Migraine is a highly prevalent neurovascular disorder that affects a significant proportion of the adult population worldwide: up to 12% of males and 24% of females, with the highest prevalence occurring between 25 and 55 years of age. Migraine represents an enormous socio-economic burden to the individual as well as to society and affects quality of life. Migraine is also a leading cause of suicide (Fuller-Thomson et al. Depress. Res. Treat. 2013: 401487). A migraine attack is characterized by recurrent, severe, debilitating headache that may be associated with nausea, vomiting, photophobia, phonophobia, and/or osmophobia, and fatigue, along with other disturbances in autonomic, mental, sensory and motor functions. Migraine attacks typically last 4 to 72 hours and may be precipitated by endogenous factors (i.e., hormonal changes, sleep deficit or surplus, hunger), or by exogenous factors (i.e., certain kinds of food, psychosocial stress, stimulation of different sensory modalities). Migraine attacks can be preceded or accompanied by abnormal visual, sensory, motor and/or speech functions (migraine with aura) or start with no warning signs (migraine without aura).
Chronic migraine is a disabling neurological condition with an estimated global prevalence of up to 4-5%, and represents approximately half of all cases of chronic primary headache (Stovner et al. Eur. J. Neurol. 13: 333-345, 2006; Stovner et al. Cephalagia. 27: 193-210, 2007; Diener et al. Nat. Rev. Neurol. 8: 162-171, 2012; Paemeleire et al. Acta Neurol. Belg. 115: 1-17, 2015). Chronic migraine patients are most commonly females in their 40s and have longer attacks, experience greater pain severity, are more disabled, and more likely to have a lower quality of life than patients with episodic migraine (Paemeleire et al. Acta Neurol. Belg. 115: 1-17, 2015). Kallikrein-Kinin Pathway
The kallikrein-kinin pathway comprises several proteins that play a role in inflammation, blood pressure control, coagulation, and pain. The product of the KLKB 1 gene is plasma pre-kallikrein, which is cleaved by Factor Xlla to produce plasma kallikrein, which in turn generates kinins from kininogens and also generates plasmin from plasminogen. For example, plasma kallikrein cleaves high molecular weight kininogen (HMWK) to generate bradykinin. The kinins, especially bradykinin, go on to induce downstream effects including vasodilation and edema (See, e.g., Schmaier. J. Thromb. Haemost 14: 28-39, 2016).
Summary
Provided herein are compounds, compositions, and methods for treating, preventing, delaying, or ameliorating symptoms associated with headache. In certain embodiments, the headache is migraine. In certain embodiments, the compound or composition is a modulator of the kallikrein-kinin pathway. In certain embodiments, kallikrein Bl expression or activity is inhibited or reduced by the compound or composition. In certain embodiments, plasma kallikrein activity is inhibited by a compound specifically designed to bind to plasma kallikrein. In certain embodiments, the compound is an oligomeric compound comprising a modified oligonucleotide complementary to KLKB 1.
Provided herein are certain numbered embodiments:
1. A method of treating, preventing, or ameliorating headache in an individual having, or at risk of having, a headache comprising
identifying an individual having, or at risk of having, a headache; and
administering to the individual an oligomeric compound comprising a modified oligonucleotide complementary to a KLKB 1 nucleic acid, thereby treating, preventing, or ameliorating the headache in the individual.
2. A method comprising identifying an individual having, or at risk of having, a headache; and
administering an oligomeric compound comprising a modified oligonucleotide complementary to a
KLKB 1 nucleic acid to the individual for treating, preventing, or ameliorating headache, thereby treating, preventing, or ameliorating the headache in the individual.
3. A method of treating, preventing, or ameliorating headache in an individual having, or at risk of having, a headache comprising administering to the individual an oligomeric compound comprising a modified oligonucleotide complementary to a KLKB1 nucleic acid, thereby treating, preventing, or ameliorating the headache in the individual.
4. A method comprising administering an oligomeric compound comprising a modified oligonucleotide complementary to a KLKB1 nucleic acid to an individual having, or at risk of having, a headache, for treating, preventing, or ameliorating headache, thereby treating, preventing, or ameliorating the headache in the individual. A method of inhibiting expression or activity of kallikrein B l in a cell in an individual identified as having, or at risk of having, a headache comprising contacting the cell with an oligomeric compound comprising a modified oligonucleotide complementary to a KLKB 1 nucleic acid, thereby inhibiting expression or activity of kallikrein Bl in the cell.
A method of inhibiting expression or activity of kallikrein B l in a cell in an individual having, or at risk of having, a headache comprising contacting the cell with an oligomeric compound comprising a modified oligonucleotide complementary to a KLKB 1 nucleic acid, thereby inhibiting expression or activity of kallikrein B l in the cell.
The method of embodiment 5 or 6, wherein the cell is a liver cell.
A method of preventing or ameliorating nausea, vomiting, photophobia, phonophobia, osmophobia, pain intensity, blurry vision, loss of vision, cloudy vision, visual aura, vertigo, tingling sensations, numbness, head pain severity, head pain duration, the number of days of headache per month, or a combination thereof, in an individual having, or at risk of having, a headache comprising
identifying an individual having, or at risk of having, a headache; and
administering to the individual an oligomeric compound comprising a modified
oligonucleotide complementary to a KLKB 1 nucleic acid, thereby preventing or ameliorating nausea, vomiting, photophobia, phonophobia, osmophobia, pain intensity, blurry vision, loss of vision, cloudy vision, visual aura, vertigo, tingling sensations, numbness, head pain severity, head pain duration, the number of days of headache per month, or a combination thereof, in the individual. A method of preventing or ameliorating nausea, vomiting, photophobia, phonophobia, osmophobia, pain intensity, blurry vision, loss of vision, cloudy vision, visual aura, vertigo, tingling sensations, numbness, head pain severity, head pain duration, the number of days of headache per month, or a combination thereof, in an individual having, or at risk of having, a headache comprising
administering to the individual an oligomeric compound comprising a modified oligonucleotide complementary to a KLKB 1 nucleic acid, thereby preventing or ameliorating nausea, vomiting, photophobia, phonophobia, osmophobia, pain intensity, blurry vision, loss of vision, cloudy vision, visual aura, vertigo, tingling sensations, numbness, head pain severity, head pain duration, the number of days of headache per month, or a combination thereof, in the individual.
The method of any of embodiments 1-9, wherein the individual is human.
The method of any of embodiments 1-10, wherein the headache is cluster headaches, migrainous neuralgia, chronic tension-type headache, chronic paroxysmal hemicrania, cranial neuralgia, or sinus headache.
The method of any of embodiments 1-10, wherein the headache is chronic tension-type headache. The method of any of embodiments 1-10, wherein the headache is migraine preceded or accompanied by aura. 14. The method of any of embodiments 1-10, wherein the headache is migraine without aura.
15. The method of any of embodiments 13-14, wherein the migraine is chronic migraine, episodic
migraine, menopausal migraine, or menstrual migraine.
16. The method of embodiment 15, wherein the migraine is chronic migraine or episodic migraine. 17. The method of embodiment 15, wherein the migraine is chronic migraine.
18. The method of any of embodiments 1-17, wherein the oligomeric compound ameliorates nausea, vomiting, photophobia, phonophobia, osmophobia, pain intensity, blurry vision, loss of vision, cloudy vision, visual aura, vertigo, tingling sensations, or numbness.
19. The method of embodiment 18, wherein the oligomeric compound ameliroates nausea or vomiting. 20. The method of any of embodiments 18-19, wherein the oligomeric compound ameliorates
photophobia, phonohobia, or osmophobia.
21. The method of any of embodiments 18-20, wherein the oligomeric compound ameliorates pain
intensity.
22. The method of any of embodiments 18-21, wherein the oligomeric compound ameliorates blurry vision, loss of vision, cloudy vision, or visual aura.
23. The method of any of embodiments 18-22, wherein the oligomeric compound ameliorates vertigo.
24. The method of any of embodiments 18-23, wherein the oligomeric compound ameliorates tingling sensations or numbness.
25. The method of any of embodiments 1-24, wherein the oligomeric compound reduces the frequency of headache in the individual.
26. The method of any of embodiments 1-25, wherein the headache occurs fewer average days per month over the course of at least three months than the average number of days per month the headache occurred over the course of the one to three months prior to administering or contacting the cell with the oligomeric compound.
27. The method of any of embodiments 25-26, wherein the headache occurs fewer than 15 days per month following administering or contacting the cell with the oligomeric compound.
28. The method of embodiment 27, wherein the headache occurs fewer than 14 days per month following administering or contacting the cell with the oligomeric compound.
29. The method of embodiment 27, wherein the headache occurs fewer than 13 days per month following administering or contacting the cell with the oligomeric compound.
30. The method of embodiment 27, wherein the headache occurs fewer than 12 days per month following administering or contacting the cell with the oligomeric compound.
31. The method of embodiment 27, wherein the headache occurs fewer than 11 days per month following administering or contacting the cell with the oligomeric compound. The method of embodiment 27, wherein the headache occurs fewer than 10 days per month following administering or contacting the cell with the oligomeric compound.
The method of embodiment 27, wherein the headache occurs fewer than 9 days per month following administering or contacting the cell with the oligomeric compound.
The method of embodiment 27, wherein the headache occurs fewer than 8 days per month following administering or contacting the cell with the oligomeric compound.
The method of embodiment 27, wherein the headache occurs fewer than 7 days per month following administering or contacting the cell with the oligomeric compound.
The method of embodiment 27, wherein the headache occurs fewer than 6 days per month following administering or contacting the cell with the oligomeric compound.
The method of embodiment 27, wherein the headache occurs fewer than 5 days per month following administering or contacting the cell with the oligomeric compound.
The method of embodiment 27, wherein the headache occurs fewer than 4 days per month following administering or contacting the cell with the oligomeric compound.
The method of embodiment 27, wherein the headache occurs fewer than 3 days per month following administering or contacting the cell with the oligomeric compound.
The method of embodiment 27, wherein the headache occurs fewer than 2 days per month following administering or contacting the cell with the oligomeric compound.
The method of embodiment 27, wherein the headache occurs fewer than 1 day per month following administering or contacting the cell with the oligomeric compound.
The method of any of embodiments 1-41, wherein the amount of KLKB 1 mR A is reduced in the individual.
The method of any of embodiments 1-42, wherein the amount of plasma prekallikrein is reduced in the individual.
The method of any of embodiments 1-43, wherein the amount of plasma kallikrein is reduced in the individual.
The method of any of embodiments 1-44, wherein the activity of plasma kallikrein is reduced in the individual.
The method of any of embodiments 1-45, wherein the amount of bradykinin is reduced in the individual.
The method of any of embodiments 1-46, wherein the KLKB 1 nucleic acid to which the modified oligonucleotide is complementary is a KLKB 1 transcript.
The method of embodiment 47, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to the KLKB1 transcript. 49. The method of embodiment 47, wherein the nucleobase sequence of the modified oligonucleotide is at least 85% complementary to the KLKBl transcript.
50. The method of embodiment 47, wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to the KLKB 1 transcript.
51. The method of embodiment 47, wherein the nucleobase sequence of the modified oligonucleotide is at least 95% complementary to the KLKBl transcript.
52. The method of embodiment 47, wherein the nucleobase sequence of the modified oligonucleotide is 100% complementary to the KLKBl transcript.
53. The method of any of embodiments 47-52, wherein the KLKB l transcript is a KLKBl pre-mRNA. 54. The method of any of embodiments 47-52, wherein the KLKB 1 transcript is a KLKB 1 mR A.
55. The method of any of embodiments 47-52, wherein the sequence of the KLKBl transcript is SEQ ID NO: 1 or SEQ ID NO: 2.
56. The method of any of embodiments 1-55, wherein the nucleobase sequence of the modified
oligonucleotide comprises SEQ ID NO: 3
57. The method of any of embodiments 1-56, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage, at least one modified sugar moiety, or at least one modified nucleobase.
58. The method of embodiment 57, wherein the modified oligonucleotide comprises at least one
modified sugar moiety.
59. The method of embodiment 58, wherein the at least one modified sugar moiety is a non-bicyclic, 2'- substituted sugar moiety.
60. The method of embodiment 59, wherein the non-bicyclic, 2 '-substituted sugar moiety is selected from among: 2'-OMe, 2'-F, and 2'-MOE.
61. The method of embodiment 60, wherein the non-bicyclic, 2 '-substituted sugar moiety is 2'-MOE. 62. The method of embodiment 58, wherein at least one modified sugar moiety is a bicyclic sugar moiety.
63. The method of embodiment 62, wherein at least one bicyclic sugar moiety is LNA or cEt.
64. The method of embodiment 58, wherein at least one modified sugar moiety is a sugar surrogate.
65. The method of embodiment 64, wherein at least one sugar surrogate is a morpholino.
66. The method of embodiment 65, wherein at least one sugar surrogate is a modified morpholino. 67. The method of any of embodiments 1-66, wherein the modified oligonucleotide comprises:
a gap segment consisting of linked 2'-deoxynucleosides;
a 5' wing segment consisting of linked nucleosides; and
a 3' wing segment consisting of linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, and wherein the 3' most nucleoside of the 5' wing and the 5' most nucleoside of the 3' wing each comprises a modified sugar moiety.
68. The method of embodiment 67, wherein each nucleoside of the 5' wing segment and each nucleoside of the 3 ' wing segment comprises a modified sugar.
69. The method of any of embodiments 58-68, wherein all of the modified sugar moieties are the same as each other.
70. The method of any of embodiments 1-69, wherein the modified oligonucleotide is 12-30 linked
nucleosides in length.
71. The method of any of embodiments 1-69, wherein the modified oligonucleotide is 16-20 linked
nucleosides in length.
72. The method of any of embodiments 1-69, wherein the modified oligonucleotide consists of 20 linked nucleosides.
73. The method of any of embodiments 57-72, wherein the modified oligonucleotide comprises at least one modified intemucleoside linkage.
74. The method of embodiment 73, wherein each intemucleoside linkage of the modified oligonucleotide is a modified intemucleoside linkage.
75. The method of any of embodiments 73-74, wherein at least one modified intemucleoside linkage is a phosphorothioate intemucleoside linkage.
76. The method of any of embodiments 73-75, wherein each intemucleoside linkage is a modified
intemucleoside linkage and wherein each intemucleoside linkage comprises the same modification.
77. The method of embodiment 76, wherein each intemucleoside linkage is a phosphorothioate
intemucleoside linkage.
78. The method of any of embodiments 1-77, wherein the strucuture of the modified oligonucleotide is
Figure imgf000009_0001
(SEQ ID NO: 3) or a salt thereof.
79. The method of any of embodiments 1-78, wherein the oligomeric compound comprises a conjugate group.
80. The method of embodiment 79, wherein the conjugate group comprises GalNAc.
Figure imgf000010_0001
(SEQ ID NO: 3) or a salt thereof.
82. The method of any of embodiments 1-81, wherein the oligomeric compound is an RNase H based antisense compound.
83. The method of any of embodiments 1-66, 69-77, or 79-80, wherein the oligomeric compound is an RNAi antisense compound.
84. The method of any of embodiments 1-83, wherein the oligomeric compound is single-stranded.
85. The method of any of embodiments 1-83, wherein the oligomeric compound is paired with a second oligomeric compound to form a duplex. The method of embodiment 85, wherein the second oligomeric compound comprises an
oligonucleotide and a conjugate group.
The method of any of embodiments 1-86, wherein the oligomeric compound is administered parenterally to the individual.
The method of embodiment 87, wherein the oligomeric compound is administered parenterally by subcutaneous or intravenous administration to the individual.
The method of embodiment 88, wherein the oligomeric compound is administered by subcutaneous administration to the individual.
The method of any of embodiments 1-89, comprising co-administering the oligomeric compound and at least one additional therapy.
The method of embodiment 90, wherein the compound and at least one additional therapy are administered concomitantly.
The method of embodiment 90, wherein the compound and at least one additional therapy are administered consecutively.
The method of any of embodiments 90-92, wherein at least one additional therapy is a beta blocker, an anticonvulsant, a calcium antagonist, a tricyclic antidepressant, an analgesic agent, an opioid, atriptan, or an ergotamine.
The method of any of embodiments 90-93, wherein at least one additional therapy is invasive or noninvasive peripheral nerve stimulation, central neurostimulation, transcranial magnetic stimulation, cranial osteopathic manipulative treatment, or cognitive-behavioral therapy.
Use of an oligomeric compound comprising a modified oligonucleotide complementary to a KLKB 1 nucleic acid for the manufacture or preparation of a medicament for treating headache.
Use of an oligomeric compound comprising a modified oligonucleotide complementary to a KLKB 1 nucleic acid for the treatment of headache.
The use of embodiment 95 or 96, wherein the headache is cluster headaches, migrainous neuralgia, chronic tension-type headache, chronic paroxysmal hemicrania, cranial neuralgia, or sinus headache.
The use of embodiment 95 or 96, wherein the headache is chronic tension-type headache.
The use of embodiment 95 or 96, wherein the headache is migraine preceded or accompanied by aura.
The use of embodiment 95 or 96, wherein the headache is migraine without aura.
The use of any of embodiments 99-100, wherein the migraine is chronic migraine, episodic migraine, menopausal migraine, or menstrual migraine.
The use of embodiment 101, wherein the migraine is chronic migraine or episodic migraine.
The use of embodiment 101, wherein the migraine is chronic migraine. The use of any of embodiments 95-103, wherein the oligomeric compound is capable of reducing or improving nausea, vomiting, photophobia, phonophobia, osmophobia, pain intensity, blurry vision, loss of vision, cloudy vision, visual aura, vertigo, tingling sensations, or numbness.
The use of embodiment 104, wherein the oligomeric compound is capable of reducing or improving nausea or vomiting.
The use of any of embodiments 104-105, wherein the oligomeric compound is capable of reducing or improving photophobia, phonohobia, or osmophobia.
The use of any of embodiments 104-106, wherein the oligomeric compound is capable of reducing or improving pain intensity.
The use of any of embodiments 104-107, wherein the oligomeric compound is capable of reducing or improving blurry vision, loss of vision, cloudy vision, or visual aura.
The use of any of embodiments 104-108, wherein the oligomeric compound is capable of reducing or improving vertigo.
The use of any of embodiments 104-109, wherein the oligomeric compound is capable of reducing or improving tingling sensations or numbness.
The use of any of embodiments 95-110, wherein the oligomeric compound is capable of reducing the frequency of headache.
The use of any of embodiments 95-111, wherein the headache occurs fewer average days per month over the course of at least three months than the average number of days per month the headache occurred over the course of the one to three months prior to use of the oligomeric compound.
The use of any of embodiments 111-112, wherein the headache occurs fewer than 15 days per month following use of the oligomeric compound.
The use of embodiment 113, wherein the headache occurs fewer than 14 days per month following use of the oligomeric compound.
The use of embodiment 113, wherein the headache occurs fewer than 13 days per month following use of the oligomeric compound.
The use of embodiment 113, wherein the headache occurs fewer than 12 days per month following use of the oligomeric compound.
The use of embodiment 113, wherein the headache occurs fewer than 11 days per month following use of the oligomeric compound.
The use of embodiment 113, wherein the headache occurs fewer than 10 days per month following use of the oligomeric compound.
The use of embodiment 113, wherein the headache occurs fewer than 9 days per month following use of the oligomeric compound. The use of embodiment 113, wherein the headache occurs fewer than 8 days per month following use of the oligomeric compound.
The use of embodiment 113, wherein the headache occurs fewer than 7 days per month following use of the oligomeric compound.
The use of embodiment 113, wherein the headache occurs fewer than 6 days per month following use of the oligomeric compound.
The use of embodiment 113, wherein the headache occurs fewer than 5 days per month following use of the oligomeric compound.
The use of embodiment 113, wherein the headache occurs fewer than 4 days per month following use of the oligomeric compound.
The use of embodiment 113, wherein the headache occurs fewer than 3 days per month following use of the oligomeric compound.
The use of embodiment 113, wherein the headache occurs fewer than 2 days per month following use of the oligomeric compound.
The use of embodiment 113, wherein the headache occurs fewer than 1 day per month following use of the oligomeric compound.
The use of any of embodiments 95-127, wherein the oligomeric compound is capable of reducing bradykinin.
The use of any of embodiments 95-128, wherein the modified oligonucleotide is 12 to 30 linked nucleosides in length.
The use of any of embodiments 95-129, wherein the modified oligonucleotide comprises at least one modified intemucleoside linkage, at least one modified sugar moiety, or at least one modified nucleobase.
The use of embodiment 130, wherein the at least one modified intemucleoside linkage is a phosphorothioate intemucleoside linkage, the at least one modified sugar is a bicyclic sugar or 2'-0- methyoxyethyl, and the at least one modified nucleobase is a 5-methylcytosine.
The use of embodiment 130 or 131, wherein at least one modified sugar is LNA or cEt.
The use of any of embodiments 130-132, wherein each modified intemucleoside is a phosphorothioate linkage.
The use of any of embodiments 130-133, wherein each cytosine is a 5-methylcytosine.
The use of any one of embodiments 130-134, wherein the modified oligonucleotide comprises:
a gap segment consisting of linked deoxynucleosides;
a 5' wing segment consisting of linked nucleosides;
a 3' wing segment consisting linked nucleosides; wherein the gap segment is positioned immediately adjacent to and between the 5' wing segment and the 3'
Figure imgf000014_0001
(SEQ ID NO: 3) or a salt thereof.
137. The use of any of embodiments 95-136, wherein the oligomeric compound comprises a conjugate group.
138. The use of embodiment 137, wherein the conjugate group comprises GalNAc.
Figure imgf000015_0001
(SEQ ID NO: 3) or a salt thereof.
140. The use of any of embodiments 95-139, wherein the oligomeric compound is an RNase H based antisense compound.
141. The use of any of embodiments 95-134 or 137-138, wherein the oligomeric compound is an RNAi antisense compound.
142. The use of any of embodiments 95-141, wherein the oligomeric compound is single-stranded.
143. The use of any of embodiments 95-141, wherein the oligomeric compound is paired with a second oligomeric compound to form a duplex. 144. The use of embodiment 143, wherein the second oligomeric compound comprises an oligonucleotide and a conjugate group.
145. The method of any of embodiments 1-94, wherein the individual has at least fifty percent fewer average headaches per month, over the course of at least three months, than the average number of headaches the individual had over the course of the one to three months prior to administering or contacting the cell with the oligomeric compound.
146. The use of any of embodiments 95-144, wherein the average number of headaches per month is reduced by at least fifty percent over the course of at least three months compared to the average number of headaches over the course of the one to three months prior to use of the oligomeric compound.
147. The method of any of embodiments 13-94 or 145, wherein the individual is identified as having migraine.
148. The method of any of embodiments 13-94 or 145, wherein the individual has migraine.
149. The method of any of embodiments 13-94 or 145, wherein the individual is identified as at risk of having migraine .
150. The method of any of embodiments 13-94 or 145, wherein the individual is at risk of having
migraine.
151. The method of any of embodiments 147-150, wherein the migraine is chronic migraine.
152. The method of any of embodiments 1-94, 145, or 147-151, wherein the individual has, or is at risk of having, hereditary angioedema.
153. The method of embodiments 1-94, 145, or 147-151, wherein the individual is identified as having, or at risk of having, hereditary angioedema.
154. The method of any of embodiments 1-94, 145, or 147-151, wherein the individual has hereditary angioedema.
155. The method of any of embodiments 1-94, 145, or 147-151, wherein the individual is identified as having hereditary angioedema.
156. The method of any of embodiments 1-94, 145, or 147-151, wherein the individual is at risk of having hereditary angioedema.
157. The method of any of embodiments 1-94, 145, or 147-151, wherein the individual is identified as at risk of having hereditary angioedema.
158. The method of any of embodiments 1-94, 145, or 147-151, wherein the individual does not have, and is not at risk of having, hereditary angioedema.
159. The method of any of embodiments 1-94, 145, or 147-151, wherein the individual is not identified as having, nor at risk of having, hereditary angioedema. The method of any of embodiments 1-94, 145, or 147-151, wherein the individual does not have hereditary angioedema.
The method of any of embodiments 1-94, 145, or 147-151, wherein the individual is not identified as having hereditary angioedema.
The method of any of embodiments 1-94, 145, or 147-151, wherein the individual is not at risk of having hereditary angioedema.
The method of any of embodiments 1-94, 145, or 147-151, wherein the individual is not identified as at risk of having hereditary angioedema.
The method or use of any of embodiments 1-163 comprising administering to the individual a chirally enriched population of the oligomeric compound, wherein the population is enriched for oligomeric compounds comprising at least one particular phorphorothioate internucleoside linkage having a particular stereochemical configuration.
The method or use of embodiment 164, wherein the population is enriched for oligomeric compounds comprising at least one particular phorphorothioate internucleoside linkage having the (<Sp) configuration.
The method or use of embodiment 164, wherein the population is enriched for oligomeric compounds comprising at least one particular phorphorothioate internucleoside linkage having the (Rp) configuration.
The method or use of embodiment 164, wherein the population is enriched for oligomeric compounds having a particular, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage
The method or use of embodiment 167, wherein the population is enriched for oligomeric compounds having the (<Sp) configuration at each phosphorothioate internucleoside linkage.
The method or use of embodiment 167, wherein the population is enriched for oligomeric compounds having the (Rp) configuration at each phosphorothioate internucleoside linkage.
The method or use of embodiment 167, wherein the population is enriched for oligomeric compounds having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.
The method or use of embodiment 164 or embodiment 167, wherein the population is enriched for oligomeric compounds having at least 3 contiguous phosphorothioate internucleoside linkages in the
Sp, Sp, and Rp configurations, in the 5 ' to 3' direction.
The method or use of any one of embodiments 1-163, wherein all of the internucleoside linkages of the oligomeric compound are stereorandom. Detailed Description
It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of "or" means "and/or" unless stated otherwise. Furthermore, the use of the term "including" as well as other forms, such as "includes" and "included", is not limiting.
The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this disclosure, including, but not limited to, patents, patent applications, published patent applications, articles, books, treatises, and GENBANK Accession Numbers and associated sequence information obtainable through databases such as National Center for Biotechnology Information (NCBI) and other data referred to throughout in the disclosure herein are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety.
It is understood that the sequence set forth in each sequence ID number (SEQ ID NO.) herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, oligonucleotides defined by a SEQ ID NO. may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
As used herein, "2'-deoxynucleoside" means a nucleoside comprising 2'-H(H) furanosyl sugar moiety, as found in naturally occurring deoxyribonucleic acids (DNA). In certain embodiments, a 2'- deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).
As used herein, "2 '-substituted nucleoside" or "2 -modified nucleoside" means a nucleoside comprising a 2 '-substituted or 2 '-modified sugar moiety. As used herein, "2 '-substituted" or "2 -modified" in reference to a sugar moiety means a sugar moiety comprising at least one 2'-substituent group other than H or OH.
As used herein, "administered concomitantly" means co-administration of at least two agents to an individual in any manner in which the pharmacological effects of the agents overlap in time. Concomitant administration does not require that the agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of the agents need only be overlapping for a period of time and need not be coextensive.
As used herein, "administered consecutively" means co-administration of at least two agents to an individual in a manner in which the pharmacological effects of the agents do not overlap in time.
As used herein, "administering" means providing a compound to an individual, and includes, but is not limited to administering by a medical professional and self-administering. The compound may be provided in a pharmaceutical composition. As used herein, "amelioration" refers to an improvement or reduction of at least one symptom of an associated disease, disorder, or condition. In certain embodiments, amelioration includes a delay or slowing in the progression or severity of one or more symptoms of a condition or disease. The progression or severity of symptoms may be determined by subjective or objective measures, which are known to those skilled in the art. In certain embodiments, amelioration is the reduction in the severity or frequency of a symptom.
As used herein, "antisense activity" means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.
As used herein, "antisense compound" means a compound comprising an antisense oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.
As used herein, "antisense oligonucleotide" means an oligonucleotide having a nucleobase sequence that is at least partially complementary to a target nucleic acid.
As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside comprising a bicyclic sugar moiety. As used herein, "bicyclic sugar" or "bicyclic sugar moiety" means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.
As used herein, "branching group" means a group of atoms having at least 3 positions that are capable of forming covalent linkages to at least 3 groups. In certain embodiments, a branching group provides a plurality of reactive sites for connecting tethered ligands to an oligonucleotide via a conjugate linker and/or a cleavable moiety.
As used herein, "cell-targeting moiety" means a conjugate group or portion of a conjugate group that is capable of binding to a particular cell type or particular cell types.
As used herein, "cEt" means a bicyclic sugar moiety comprising a bridge connecting the 4 '-carbon and the 2'-carbon, wherein the bridge has the formula: 4'-CH(CH3)-0-2' and the chiral carbon is in the S configuration.
As used herein, "chirally enriched population" means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more sterorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are oligomeric compounds comprising modified oligonucleotides.
As used herein, "cleavable moiety" means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human.
As used herein, "co-administration" means administration of two or more compounds to an individual. The two or more compounds may be in a single composition, or may be separate. Each of the two or more compounds may be administered through the same or different routes of administration. Coadministration encompasses concomitant and consecutive administration.
As used herein, "complementary" in reference to an oligonucleotide means that at least 70% of the nucleobases of such oligonucleotide or one or more regions thereof and the nucleobases of another nucleic acid or one or more regions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions. Complementary nucleobases means nucleobases that are capable of forming hydrogen bonds with one another.
Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5 -methyl cytosine (mC) and guanine (G). Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. As used herein, "fully complementary" or "100% complementary" in reference to oligonucleotides means that such oligonucleotides are complementary to another oligonucleotide or nucleic acid at each nucleoside of the oligonucleotide.
As used herein, "conjugate group" means a group of atoms that is directly or indirectly attached to an oligonucleotide. Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.
As used herein, "conjugate linker" means a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.
As used herein, "conjugate moiety" means a group of atoms that is attached to an oligonucleotide via a conjugate linker.
As used herein, "contiguous" in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, "contiguous nucleobases" means nucleobases that are immediately adjacent to each other in a sequence.
As used herein, "dose" means a specified quantity of a compound provided in a single administration, or in a specified time period. In certain embodiments, a dose may be administered in one, two, or more boluses, tablets, or injections. For example, in certain embodiments where subcutaneous administration is desired, the desired dose requires a volume not easily accommodated by a single injection, therefore, two or more injections may be used to achieve the desired dose. Doses may be stated as the amount of compound administered per hour, day, week, or month. As used herein, "double-stranded antisense compound" means an antisense compound comprising two oligomeric compounds that are complementary to each other and form a duplex, and wherein one of the two said oligomeric compounds comprises an antisense oligonucleotide.
As used herein, "effective amount" means the amount of a compound sufficient to effectuate a desired physiological outcome in an individual. The effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individual to be treated, the formulation of the composition, assessment of the individual's medical condition, and other relevant factors.
As used herein, "gapmer" means an antisense oligonucleotide comprising an internal region having a plurality of nucleosides that support R ase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as the "gap" and the external regions may be referred to as the "wings."
As used herein, "headache" means pain in any region in the head and/or migraine. In certain embodiments, a headache is a migraine that includes pain in any region in the head. In certain embodiments, a headache is a migraine with aura but without pain in any region of the head. As used herein, "cluster headaches" or "migrainous neuralgia" means recurrent, severely painful headaches that occur for weeks or months at a time, an average of less than five times per day. In certain embodiments, the pain of a cluster headache occurs primarily on one side of the head. As used here, "chronic headache" means headache that occurs an average of at least 15 days per month over the course of three consecutive months. A headache, for example, a migraine, occurs on a given day if any one of the symptoms associated with the headache occur at any time during the given day. As used herein, "tension-type headache" means a headache with bilateral pain that has a pressing but not throbbing quality, and it is not associated with vomiting or made worse by routine physical activity. As used herein, "sinus headache" means inflammation of the sinuses and pain in the cheekbones, forehead, or bridge of the nose. As used herein, "chronic paroxysmal hemicrania" means headache that occurs an average of at least five times per day in which the pain is felt on one side of the head at a time. As used herein, "cranial neuralgia" is headache caused by inflammation of a cranial nerve.
Diagnosis of headache in an individual is accomplished by evaluation of an individual's medical history, physical examination, evaluation of symptoms as reported by the individual, or other standard clinical tests or assessments.
As used herein, "hybridization" means the pairing or annealing of complementary oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. As used herein, "identifying an individual having, or at risk of having" a given condition means identifying an individual having been diagnosed with the condition or identifying an individual predisposed to develop the condition. Individuals predisposed to develop a condition include those having one or more risk factors for the condition, including, having a personal or family history of the condition.
As used herein, "increase" means raise to a larger extent, size, amount, or number.
As used herein, "individual" means a human or a non-human animal.
As used herein, "inhibiting" in reference to expression, amount, or activity means a reduction or blockade of the expression, amount, or activity relative to the expression, amount, or activity in an untreated individual or individual receiving placebo, and does not necessarily indicate a total elimination of expression, amount, or activity.
As used herein, the terms "internucleoside linkage" means a group or bond that forms a covalent linkage between adjacent nucleosides in an oligonucleotide. As used herein "modified internucleoside linkage" means any internucleoside linkage other than a naturally occurring, phosphate internucleoside linkage. Non-phosphate linkages are referred to herein as modified internucleoside linkages.
"Phosphorothioate linkage" means a modified phosphate linkage in which one of the non-bridging oxygen atoms is replaced with a sulfur atom. A phosphorothioate internucleoside linkage is a modified
internucleoside linkage. Modified internucleoside linkages include linkages that comprise abasic nucleosides. As used herein, "abasic nucleoside" means a sugar moiety in an oligonucleotide or oligomeric compound that is not directly connected to a nucleobase. In certain embodiments, an abasic nucleoside is adjacent to one or two nucleosides in an oligonucleotide.
As used herein, "kallikrein B 1 nucleic acid" or "KLKB 1 nucleic acid" means a nucleic acid that encodes plasma prekallikrein and/or plasma kallikrein. For example, KLKBl nucleic acids include a KLKBl gene and an RNA sequence transcribed from a KLKBl gene (e.g., a KLKBl transcript). As used herein, a "KLKB l transcript" is an RNA that is transcribed from a KLKBl gene. In certain embodiments, a KLKB l transcript is a KLKB 1 pre-mRNA. In certain embodiments, a KLKB 1 transcript is a KLKB 1 mRNA.
As used herein, "kallikrein Bl expression" or "KLKB l expression" means the amount of a downstream product of a KLKBl nucleic acid. Downstream products of KLKBl nucleic acids include the products of transcription and translation of a KLKB 1 gene, e.g. , KLKB 1 transcripts and plasma prekallikrein and plasma kallikrein proteins.
As used herein, "kallikrein Bl activity" or "KLKBl activity" means the enzymatic activity of a downstream protein product of a KLKB l nucleic acid. Downstream protein products of KLKB l nucleic acids include the products of translation of a KLKB 1 gene, e.g. , plasma prekallikrein and plasma kallikrein proteins.
As used herein, "linker-nucleoside" means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.
As used herein, "LNA" means a bicyclic sugar moiety comprising a bridge connecting the 4 '-carbon and the 2'-carbon, wherein the bridge has the formula: 4'-Ο¾-0-2' .
As used herein, "non-bicyclic modified sugar" or "non-bicyclic modified sugar moiety" means a modified sugar moiety that comprises a modification, such as a substitutent, that does not form a bridge between two atoms of the sugar to form a second ring.
As used herein, "linked nucleosides" are nucleosides that are connected in a continuous sequence (i.e. no additional nucleosides are present between those that are linked).
As used herein, "migraine" is headache with severe or debilitating head pain and/or one or more aura symptoms. A migraine can be preceded or accompanied by nausea, vomiting, photophobia, phonophobia, osmophobia, fatigue, and/or other disturbances in autonomic, mental, sensory and motor functions. As used herein, "chronic migraine" means migraine that occurs an average of at least 15 days per month over the course of three consecutive months. As used herein, "episodic migraine" means migraine that does not occur frequently enough to be classified as chronic migraine. As used herein, "migraine without aura" means a migraine that is not preceded or accompanied by one or more aura symptoms. As used herein, "migraine with aura" means a migraine that is preceded or accompanied by one or more "aura symptoms". As used herein,
"aura symptoms" are fully reversible sensory disturbances that include but are not limited to vision change, speech or language disturbance, tingling sensation, and motor function disturbance. As used herein,
"menstrual migraine" or "menopausal migraine" means migraine that is associated with changing hormone levels throughout the menstrual cycle or associated with the onset of menopause, respectively.
As used herein, "mismatch" or "non-complementary" means a nucleobase of a first oligonucleotide that is not complementary with the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligomeric compound are aligned.
As used herein, "modulating" refers to changing or adjusting a feature in a cell, tissue, organ, or organism. For example, modulating KLKBl can mean to increase or decrease the level of KLKB l expression in a cell, tissue, organ or organism.
As used herein, "MOE" means methoxyethyl. "2'-MOE" means a -OCH2CH2OCH3 group at the 2' position of a furanosyl ring.
As used herein, "motif means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages, in an oligonucleotide.
As used herein, "naturally occurring" means found in nature.
As used herein, "nucleobase" means a naturally occurring nucleobase or a modified nucleobase. As used herein a "naturally occurring nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G). As used herein, a modified nucleobase is a group of atoms capable of pairing with at least one naturally occurring nucleobase. A universal base is a nucleobase that can pair with any one of the five unmodified nucleobases. As used herein, "nucleobase sequence" means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage modification.
As used herein, "nucleoside" means a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified. As used herein, "modified nucleoside" means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety.
As used herein, "oligomeric compound" means a compound consisting of an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.
As used herein, "oligonucleotide" means a strand of linked nucleosides connected via internucleoside linkages, wherein each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides. As used herein, "modified oligonucleotide" means an oligonucleotide, wherein at least one nucleoside or internucleoside linkage is modified. As used herein, "unmodified oligonucleotide" means an oligonucleotide that does not comprise any nucleoside modifications or internucleoside modifications.
As used herein, "pharmaceutically acceptable carrier or diluent" means any substance suitable for use in administering to an animal. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject. In certain embodiments, a pharmaceutically acceptable carrier or diluent is sterile water; sterile saline; or sterile buffer solution.
As used herein "pharmaceutically acceptable salts" means physiologically and pharmaceutically acceptable salts of compounds, such as oligomeric compounds, i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
As used herein "pharmaceutical composition" means a mixture of substances suitable for administering to a subject. For example, a pharmaceutical composition may comprise an antisense compound and a sterile aqueous solution. In certain embodiments, a pharmaceutical composition shows activity in free uptake assay in certain cell lines.
As used herein, "phosphorus moiety" means a group of atoms comprising a phosphorus atom. In certain embodiments, a phosphorus moiety comprises a mono-, di-, or tri-phosphate, or phosphorothioate.
As used herein, "plasma prekallikrein" or "prekallikrein" means a protein encoded by a KLKB 1 nucleic acid that is a precursor of plasma kallikrein.
As used herein, "plasma kallikrein" means the active form of a protein encoded by a KLKB 1 nucleic acid.
As used herein "prodrug" means a therapeutic agent in a form outside the body that is converted to a differentform within the body or cells thereof. Typically conversion of a prodrug within the body is facilitated by the action of an enzymes (e.g., endogenous or viral enzyme) or chemicals present in cells or tissues and/or by physiologic conditions.
As used herein, "prevent" or "preventing" refers to delaying or forestalling the onset or development of a disease, disorder, or condition for a period of time from minutes to indefinitely. Prevent also means reducing risk of developing a disease, disorder, or condition.
As used herein, "reduce" means lower to a smaller extent, size, amount, or number.
As used herein, "R Ai compound" means an antisense compound that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. RNAi compounds include, but are not limited to double-stranded siRNA, single -stranded RNA (ssRNA), and microRNA, including microRNA mimics. The term RNAi compound excludes antisense oligonucleotides that act through RNase H.
As used herein, the term "single-stranded" in reference to a compound means such a compound consisting of one oligomeric compound that is not paired with a second oligomeric compound to form a duplex. "Self-complementary" in reference to an oligonucleotide means an oligonucleotide that at least partially hybridizes to itself. A compound consisting of one oligomeric compound, wherein the
oligonucleotide of the oligomeric compound is self-complementary, is a single-stranded compound. A single- stranded antisense or oligomeric compound may be capable of binding to a complementary oligomeric compound to form a duplex.
As used herein, "stereorandom chiral center" in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, a stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.
As used herein, "sugar moiety" means an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" means a 2'-OH(H) furanosyl moiety, as found in RNA (an
"unmodified RNA sugar moiety"), or a 2'-H(H) moiety, as found in DNA (an "unmodified DNA sugar moiety"). Unmodified sugar moieties have one hydrogen at each of the , 3', and 4' positions, an oxygen at the 3 ' position, and two hydrogens at the 5 ' position. As used herein, "modified sugar moiety" or "modified sugar" means a modified furanosyl sugar moiety or a sugar surrogate. As used herein, modified furanosyl sugar moiety means a furanosyl sugar comprising a non-hydrogen substituent in place of at least one hydrogen of an unmodified sugar moiety. In certain embodiments, a modified furanosyl sugar moiety is a 2'- substituted sugar moiety. Such modified furanosyl sugar moieties include bicyclic sugars and non4)icyclic sugars. As used herein, "sugar surrogate" means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide. Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or nucleic acids.
As used herein, "target nucleic acid," "target R A," "target R A transcript" and "nucleic acid target" mean a nucleic acid that a compound (e.g. , an antisense compound) is designed to affect.
As used herein, "target region" means a portion of a target nucleic acid to which an antisense compound is designed to hybridize.
As used herein, "terminal group" means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.
As used herein, "treat" or "treating" refers to administering a compound or pharmaceutical composition to a human or non-human animal in order to effect an alteration or improvement of a disease, disorder, or condition in the animal.
I. Certain Compounds, Compositions, Methods, and Uses
Certain embodiments provide methods, compounds, and compositions for modulating headache, or a symptom thereof, in an individual identified as having or at risk of having headache by administering a compound or composition to the individual, wherein the compound or composition comprises a KLKB l modulator or other modulator of the kallikrein-kinin pathway. Modulation of KLKB l can lead to a decrease of KLKB 1 expression in order to treat, prevent, ameliorate or delay a disease or disorder associated with KLKB 1, such as headache. In certain embodiments, the KLKBl modulator is an inhibitor of KLKB l expression. In certain embodiments, inhibitors of KLKB 1 expression directly or indirectly reduce the amount or activity of plasma kallikrein. In certain embodiments, modulators of the kallikrein-kinin pathway, including inhibitors of KLKB l expression, are antisense compounds, oligomeric compounds, peptides, antibodies, or small molecules. In certain embodiments, an inhibitor of KLKB l expression is an oligomeric compound targeting a KLKB l nucleic acid. In certain such embodiments, the oligomeric compound comprises an oligonucleotide targeting a KLKB l nucleic acid. In certain embodiments, the oligonucleotide is a modified oligonucleotide. In certain embodiments, the individual is human. In certain embodiments, the individual is identified as at risk of having headache due to the individual having a history of headache. In certain embodiments, the individual has a history of chronic migraine. In certain embodiments, the individual has experienced head pain on more than 15 days per month over the course of at least one to three months. In certain embodiments, the individual has experienced head pain and/or one or more aura symptoms on more than 15 days per month over the course of at least one to three months. In certain embodiments, the individual has experienced head pain on more than 15 days per month over the course of at least three months. In certain embodiments, the individual has experienced head pain and/or one or more aura symptoms on more than 15 days per month over the course of at least three months.
In certain embodiments, modulators of the kallikrein-kinin pathway for use in treatment of headache include lympho -epithelial Kazal -type-related inhibitor (LEKTI) as described in JProteome Res 9: 4389- 4394, 2010; ecotin-Pkal as described in Biol Chem 391 : 425-433, 2010; aprotinin as described in JHypertens 5: 581-586, 1987; PK15 as described in Nat Chem Biol 5: 502-507, 2009; kallistatin as described in Biol Chem 382: 15-21, 2001 and J Biol Chem 267: 25873-25880, 1992; Cl-inhibitor as described in Thromb Haemost 92: 1277-1283, 2004 and Adv Biosci 17: 93-101, 1978; CeKI as described in Biol Chem 385: 1083- 1086, 2004; AdKi as described in Toxicon 43: 219-223, 2004; FE999024 as described in Am J Pathol 159: 1797-1805, 2001; Arginine- 15 -aprotinin as described in Adv Exp Med Biol 247B: 15-21, 1989; alpha-1- antitrypsin-Pittsburgh as described in J Clin Invest 77: 631-634, 1986; antibodies such as DX-2300 as described in Biochem J 422: 383-392, 2009; small molecules such as Ecallantide (DX-88 by Dyax Corp) as described in Ann Allergy Asthma Immunol 105: 430-436, 2010 and Drugs Today 46: 547-555, 2010;
Nafamostat mesilate as described in JAnesth 24: 549-552, 2010 and Br JAneaesth 81 : 963-964, 1998; CU- 2010 as described in Anesthesiology 110: 123-130, 2009; VA999024 and VA999026 as described in
Immunopharmacology 32: 115-118, 1996; PKSI-527 as described in Thromb Res 116: 403-408, 2005; and those described in US Patent No. 7,235,530, USPPN 2006/0069020, USPPN 2008/0188409, USPPN
2008/0221031, USPPN 2009/0221480, USPPN 2009/0227494, USPPN 2009/0227495, USPPN
2009/0233852, USPPN 2009/0234009, USPPN 2009/0247453, USPPN 2009/0264350, USPPN
2009/0075887; USPPN 2009/0105142, USPPN 2010/0183625, US Patent No. 4,153,687, and US Patent No. 4,973,668.
In certain embodiments, a method of preventing or ameliorating nausea, vomiting, photophobia, phonophobia, osmophobia, pain intensity, blurry vision, loss of vision, cloudy vision, visual aura, vertigo, tingling sensations, numbness, head pain severity, head pain duration, the number of days of headache per month, or a combination thereof, in an individual comprises administering to the individual a compound or composition comprising a modulator of the kallikrein-kinin pathway, such as an inhibitor of KLKB 1 expression. In certain such embodiments, the individual has or is at risk of having a headache. In certain such embodiments, the individual has or is at risk of having a migraine. In certain such embodiments, the individual has or is at risk of having chronic migraine. In certain such embodiments, the modulator of the kallikrein-kinin pathway, such as an inhibitor of KLKB 1 expression, inhibits the conversion of HMWK to bradykinin. In certain such embodiments, bradykinin activity is reduced.
In certain embodiments, compounds and compositions described herein that modulate the kallikrein- kinin pathway, including inhibitors of KLKB 1 expression, can be used in methods of treating, preventing, delaying or ameliorating headache including, but not limited to cluster headaches, migrainous neuralgia, chronic headache, chronic paroxysmal hemicrania, cranial neuralgia, sinus headache, migraine with aura, migraine without aura, chronic migraine, episodic migraine, menopausal migraine, or menstrual migraine.
In certain embodiments, the methods described herein comprise administering an oligomeric compound comprising a modified oligonucleotide complementary to a KLKB 1 nucleic acid to an individual having, or at risk of having, headache. In certain such embodiments, the individual also has, or is at risk of having hereditary angioedema. In certain other such embodiments, the individual neither has, nor is at risk of having, hereditary angioedema. Hereditary angioedema is a rare inflammatory disease characterized by recurrent episodes of swelling around the head and extremities (Zuraw, B.L. N Engl. J. Med. 359: 1027-36, 2008). Angioedema attacks occur with unpredictable frequency and are typically focused on the skin and gastric, oropharyngeal, and laryngeal mucosas. Asphyxiation due to laryngeal swelling can result in mortality. Hereditary angioedema is caused by deficiency or malfunction of the serine protease inhibitor C 1 -ΙΝΗ (Kaplan, A.P. et al. J. Allergy Clin. Immunol. 109: 195-209, 2002). In certain embodiments, the methods described herein comprise administering an oligomeric compound comprising a modified oligonucleotide complementary to a KLKB 1 nucleic acid to an individual having chronic migraine and hereditary angioedema, thereby ameliorating at least one symptom of chronic migraine and at least one symptom of hereditary angioedema. In certain embodiments, the methods described herein comprise administering an oligomeric compound comprising a modified oligonucleotide complementary to a KLKB 1 nucleic acid to an individual having chronic migraine, wherein the individual does not have hereditary angioedema.
Certain embodiments are drawn to compounds and compositions described herein for use in therapy. Certain embodiments are drawn to a compound or composition comprising an inhibitor of KLKB 1 expression for use in treating, preventing, delaying the onset, slowing the progression, or ameliorating headache. Certain embodiments are drawn to a compound or composition for use in treating, preventing, delaying the onset, slowing the progression, or ameliorating a headache condition or disorder, or a symptom or physiological marker thereof. In certain embodiments, the headache condition or disorder is cluster headaches, migrainous neuralgia, chronic headache, chronic paroxysmal hemicrania, cranial neuralgia, sinus headache, migraine with aura, migraine without aura, chronic migraine, episodic migraine, menopausal migraine, or menstrual migraine. In certain embodiments, the headache condition or disorder is episodic migraine or chronic migraine. In certain embodiments, the inhibitor of KLKB 1 expression is a nucleic acid, peptide, antibody, or small molecule. In certain embodiments, the inhibitor of KLKB 1 expression is an antisense compound or an oligomeric compound comprising an oligonucleotide complementary to a KLKB 1 nucleic acid. In certain embodiments, the compound or composition comprises a modified oligonucleotide 12 to 30 linked nucleosides in length. In certain embodiments, the compound or composition comprises a modified oligonucleotide 20 linked nucleosides in length. In certain embodiments, the compound comprising a modified oligonucleotide can be single-stranded. In certain embodiments, the compound comprising a modified oligonucleotide can be double- stranded. Certain embodiments are drawn to a compound or composition comprising an inhibitor of KLKB 1 expression for use in reducing, improving, or regulating nausea, vomiting, photophobia, phonophobia, osmophobia, pain intensity, blurry vision, loss of vision, cloudy vision, visual aura, vertigo, tingling sensations, numbness, head pain severity, head pain duration, the number of days of headache per month, or a combination thereof, in an individual. In certain embodiments, the individual is identified as having, or at risk of having a disease, disorder, condition, symptom, or physiological marker associated with a headache condition or disorder. In certain embodiments, the headache condition or disorder is episodic migraine, chronic migraine, or chronic tension-type headache. In certain embodiments, the headache condition or disorder is chronic migraine. In certain embodiments, the individual is human. In certain embodiments, the inhibitor of KLKB 1 expression is a nucleic acid, peptide, antibody, or small molecule. In certain embodiments, the inhibitor of KLKB1 expression is an antisense compound or an oligomeric compound comprising an oligonucleotide complementary to a KLKB1 nucleic acid. In certain embodiments, the compound or composition comprises a modified oligonucleotide 12 to 30 linked nucleosides in length. In certain embodiments, the compound or composition comprises a modified oligonucleotide 20 linked nucleosides in length. In certain embodiments, the compound comprising a modified oligonucleotide can be single-stranded. In certain embodiments, the compound comprising a modified oligonucleotide can be double-stranded.
Certain embodiments are drawn to use of compounds or compositions described herein for the manufacture or preparation of a medicament for therapy. Certain embodiments are drawn to the use of a compound or composition as described herein in the manufacture or preparation of a medicament for treating, preventing, delaying the onset, slowing the progression, or ameliorating one or more diseases, disorders, conditions, symptoms or physiological markers associated with KLKB1 expression. In certain embodiments, the compound or composition as described herein is used in the manufacture or preparation of a medicament for treating, ameliorating, delaying or preventing a headache condition or disorder, or a symptom or physiological marker thereof. In certain embodiments, the headache condition or disorder is episodic migraine, chronic migraine, or chronic tension-type headache. In certain embodiments, the headache condition or disorder is chronic migraine. In certain embodiments, the compound or composition comprises a nucleic acid, peptide, antibody, small molecule or other agent capable of inhibiting the expression or activity of a KLKB 1 nucleic acid. In certain embodiments, the compound or composition is an antisense compound or an oligomeric compound comprising an oligonucleotide complementary to a KLKB1 nucleic acid. In certain embodiments, the compound or composition comprises a modified oligonucleotide 12 to 30 linked nucleosides in length. In certain embodiments, the compound or composition comprises a modified oligonucleotide 20 linked nucleosides in length. In certain embodiments, the compound comprising a modified oligonucleotide can be single-stranded. In certain embodiments, the compound comprising a modified oligonucleotide can be double- stranded. Certain embodiments are drawn to the use of a compound or composition for the manufacture or preparation of a medicament for reducing, improving, or regulating nausea, vomiting, photophobia, phonophobia, osmophobia, pain intensity, blurry vision, loss of vision, cloudy vision, visual aura, vertigo, tingling sensations, numbness, head pain severity, head pain duration, the number of days of headache per month, or a combination thereof, in an individual having or at risk of having a headache condition or disorder. In certain embodiments, the compound or composition comprises a nucleic acid, peptide, antibody, small molecule or other agent capable of inhibiting the expression or activity of a KLKBl nucleic acid. In certain embodiments, the compound or composition is an antisense compound or an oligomeric compound comprising an oligonucleotide complementary to a KLKB l nucleic acid. In certain embodiments, the compound or composition comprises a modified oligonucleotide 12 to 30 linked nucleosides in length. In certain embodiments, the compound or composition comprises a modified oligonucleotide 20 linked nucleosides in length. In certain embodiments, the compound comprising a modified oligonucleotide can be single-stranded. In certain embodiments, the compound comprising a modified oligonucleotide can be double -stranded.
In any of the foregoing methods or uses, the compound or composition can be administered parenterally. For example, in certain embodiments the compound or composition can be administered through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration. In certain embodiments, the parenteral administration is subcutaneous administration. In certain embodiments, the compound or composition is co-administered with a second agent. In certain embodiments, the compound or composition and the second agent are administered concomitantly. II. Certain Oligonucleotides
In certain embodiments, the invention provides oligonucleotides, which consist of linked nucleosides. Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides. Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA (i.e., comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified internucleoside linkage).
A. Certain Modified Nucleosides
Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modifed sugar moiety and a modified nucleobase.
1. Certain Sugar Moieties
In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain
embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties. In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more acyclic substituent, including but not limited to substituents at the 2', 4', and/or 5 ' positions. In certain embodiments one or more acyclic substituent of non-bicyclic modified sugar moieties is branched. Examples of 2 '-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2'-F, 2'-OCH3 ("OMe" or "O-methyl"), and 2'-0(CH2)2OCH3 ("MOE"). In certain embodiments, 2 '-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-Ci-Cio alkoxy, O-Ci-Cio substituted alkoxy, O-Ci-Cio alkyl, O-Ci-Cio substituted alkyl, S-alkyl, N(Rm)-alkyl, O-alkenyl, S-alkenyl, N(Rm)-alkenyl, O-alkynyl, S-alkynyl, N(Rm)- alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, 0(CH2)2SCH3,
0(CH2)2ON(Rm)(Rn) or OCH2C(=0)-N(Rm)(Rn), where each Rm and Rn is, independently, H, an amino protecting group, or substituted or unsubstituted Ci-Cio alkyl, and the 2 '-substituent groups described in Cook et al., U.S. 6,531,584; Cook et al., U.S. 5,859,221 ; and Cook et al, U.S. 6,005,087. Certain embodiments of these 2'-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (N02), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl. Examples of 4' -substituent groups suitable for non- bicyclic modified sugar moieties include but are not limited to alkoxy (e.g. , methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128. Examples of 5 '-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 5 '-methyl (R or S), 5'-vinyl, and 5'-methoxy. In certain embodiments, non-bicyclic modified sugars comprise more than one non-bridging sugar substituent, for example, 2'-F-5 '-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008/101 157 and Rajeev et al., US2013/0203836.).
In certain embodiments, a 2'-substituted nucleoside or 2'- non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2 '-substituent group selected from: F, NH2, N3, OCF3j OCH3, 0(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, 0(CH2)2SCH3, 0(CH2)2ON(Rm)(R„), 0(CH2)20(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(=0)-N(Rm)(R„)), where each Rm and R„ is, independently, H, an amino protecting group, or substituted or unsubstituted Ci-Cio alkyl.
In certain embodiments, a 2'-substituted nucleoside or 2'- non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2 '-substituent group selected from: F, OCF3j OCH3, OCH2CH2OCH3, 0(CH2)2SCH3, 0(CH2)2ON(CH3)2, 0(CH2)20(CH2)2N(CH3)2, and OCH2C(=0)-N(H)CH3 ("NMA").
In certain embodiments, a 2'-substituted nucleoside or 2'- non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2 '-substituent group selected from: F, OCH3, and OCH2CH2OCH3.
Nucleosides comprising modified sugar moieties, such as non-bicyclic modified sugar moieties, may be referred to by the position(s) of the substitution(s) on the sugar moiety of the nucleoside. For example, nucleosides comprising 2 '-substituted or 2-modified sugar moieties are referred to as 2 '-substituted nucleosides or 2-modified nucleosides.
Certain modifed sugar moieties comprise a bridging sugar substituent that forms a second ring resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms. Examples of such 4' to 2' bridging sugar substituents include but are not limited to: 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-0-2' ("LNA"), 4'-CH2-S-2', 4'- (CH2)2-0-2' ("ENA"), 4'-CH(CH3)-0-2' (referred to as "constrained ethyl" or "cEt" when in the S
configuration), 4'-CH2-0-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CH2OCH3)-0-2' ("constrained MOE" or "cMOE") and analogs thereof (see, e.g., Seth et al., U.S. 7,399,845, Bhat et al., U.S. 7,569,686, Swayze et al., U.S. 7,741,457, and Swayze et al., U.S. 8,022, 193), 4'-C(CH3)(CH3)-0-2' and analogs thereof (see, e.g., Seth et al., U.S. 8,278,283), 4'-CH2-N(OCH3)-2' and analogs thereof (see, e.g., Prakash et al., U.S. 8,278,425), 4'-CH2-0- N(CH3)-2' (see, e.g., Allerson et al., U.S. 7,696,345 and Allerson et al., U.S. 8, 124,745), 4'-CH2-C(H)(CH3)-2' (see, e.g., Zhou, et al, J. Org. Chem.,2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and analogs thereof (see e.g. , Seth et al., U.S. 8,278,426), 4'-C(RaRb)-N(R)-0-2', 4'-C(RaRb)-0-N(R)-2', 4'-CH2-0-N(R)-2', and 4'-CH2- N(R)-0-2', wherein each R, Ra, and Rb is, independently, H, a protecting group, or Ci-Ci2 alkyl (see, e.g. Imanishi et al., U.S. 7,427,672).
In certain embodiments, such 4' to 2' bridges independently comprise from 1 to 4 linked groups independently selected from: -[C(Ra)(Rb)]„-, -[C(Ra)(Rb)]„-0-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -C(=NRa)-, - C(=0)-, -C(=S)-, -0-, -Si(Ra)2-, -S(=0)x-, and -N(Ra)-;
wherein:
x is 0, 1, or 2;
n is 1, 2, 3, or 4;
each Ra and R¾ is, independently, H, a protecting group, hydroxyl, Ci-Ci2 alkyl, substituted Ci-Ci2 alkyl, C2-Ci2 alkenyl, substituted C2-Ci2 alkenyl, C2-Ci2 alkynyl, substituted C2-Ci2 alkynyl, C5-C2o aryl, substituted C5-C2o aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJi, NJJ2, SJi, N3, COOJi, acyl (C(=0)- H), substituted acyl, CN, sulfonyl (S(=0)2-Ji), or sulfoxyl (S(=0)-Ji); and
each Ji and J2 is, independently, H, Ci-Ci2 alkyl, substituted Ci-Ci2 alkyl, C2-Ci2 alkenyl, substituted C2-Ci2 alkenyl, C2-Ci2 alkynyl, substituted C2-Ci2 alkynyl, C5-C2o aryl, substituted C5-C2o aryl, acyl (C(=0)- H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, Ci-Ci2 aminoalkyl, substituted Ci-Ci2 aminoalkyl, or a protecting group.
Additional bicyclic sugar moieties are known in the art, see, for example: Freier et al, Nucleic Acids Research, 1997, 25(22), 4429-4443, Albaek et al, J. Org. Chem., 2006, 71, 7731-7740, Singh et al., Chem. Commun. , 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Kumar et al, Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc, 20017, 129, 8362-8379; Wengel et a., U.S. 7,053,207; Imanishi et al., U.S. 6,268,490; Imanishi et al. U.S. 6,770,748; Imanishi et al., U.S. RE44,779; Wengel et al., U.S. 6,794,499; Wengel et al., U.S. 6,670,461; Wengel et al., U.S. 7,034, 133; Wengel et al., U.S. 8,080,644; Wengel et al., U.S. 8,034,909; Wengel et al., U.S. 8,153,365; Wengel et al., U.S. 7,572,582; and Ramasamy et al., U.S. 6,525,191;; Torsten et al., WO 2004/106356;Wengel et al., WO 1999/014226; Seth et al., WO 2007/134181; Seth et al., U.S.
7,547,684; Seth et al., U.S. 7,666,854; Seth et al., U.S. 8,088,746; Seth et al., U.S. 7,750,131; Seth et al., U.S. 8,030,467; Seth et al., U.S. 8,268,980; Seth et al., U.S. 8,546,556; Seth et al., U.S. 8,530,640; Migawa et al., U.S. 9,012,421; Seth et al., U.S. 8,501,805; and U.S. Patent Publication Nos. Allerson et al,
US2008/0039618 and Migawa et al., US2015/0191727..
In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, an LNA nucleoside (described herein) may be in the a-L configu
Figure imgf000033_0001
LNA (β-D-configuration) a- -LNA (a- -configuration) bridge = 4'-CH2-0-2' bridge = 4'-CH2-0-2'
a-L-methyleneoxy (4'-CH2-0-2') or a-L-LNA bicyclic nucleosides have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21 , 6365-
6372). Herein, general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in exemplified embodiments herein, they are in the β-D configuration, unless otherwise specified.
In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5 '-substituted and 4'-2' bridged sugars).
In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein. For example, certain sugar surrogates comprise a 4'-sulfur atom and a substitution at the 2'- position (see, e.g., Bhat et al., U.S. 7,875,733 and Bhat et al., U.S. 7,939,677) and/or the 5' position.
In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran ("THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified
tetrahydropyrans include but are not limited to hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), manitol nucleic acid ("MNA") (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro
Figure imgf000034_0001
F-HNA
("F-HNA", see e.g. Swayze et al., U.S. 8,088,904; Swayze et al., U.S. 8,440,803; Swayze et al., U.S.
8,796,437; and Swayze et al., U.S. 9,005,906; F-HNA can also be referred to as a F-THP or 3'-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula:
Figure imgf000034_0002
wherein, independently, for each of said modified THP nucleoside:
Bx is a nucleobase moiety;
T3 and T4 are each, independently, an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T3 and T4 is an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group;
qi, q2, q3, q4, qs, qe and q7 are each, independently, H, Ci-Ce alkyl, substituted Ci-Ce alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; and
each of Ri and R2 is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJJ2, SJi, N3, OC(=X)Ji, OC(=X)NJiJ2, NJ3C(=X)NJiJ2, and CN, wherein X is O, S or NJi, and each Ji, J2, and J3 is, independently, H or Ci-Ce alkyl.
In certain embodiments, modified THP nucleosides are provided wherein qi, q2, q3, q4, qs, qe and q7 are each H. In certain embodiments, at least one of qi, q2, q3, q4, qs, qe and q7 is other than H. In certain embodiments, at least one of qi, q2, q3, q4, qs, qe and q7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of Ri and R2 is F. In certain embodiments, Ri is F and R2 is H, in certain embodiments, Ri is methoxy and R2 is H, and in certain embodiments, Ri is methoxyethoxy and R2 is
H. In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. 5,698,685; Summerton et al., U.S. 5,166,315; Summerton et al., U.S. 5,185,444; and Summerton et al., U.S. 5,034,5 the term "morpholino" means a sugar surrogate having the following structure:
Figure imgf000035_0001
In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are refered to herein as "modifed morpholinos."
In certain embodiments, sugar surrogates comprise acyclic moieites. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid ("PNA"), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem. , 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011/133876.
Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used in modified nucleosides.
2. Certain Modified Nucleobases
In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase.
In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6- azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N- methyladenine, 2-propyladenine , 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-C≡C-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4- thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N- benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N- benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size- expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as l,3-diazaphenoxazine-2-one, l,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-l,3-diazaphenoxazine-2- one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2- pyridone. Further nucleobases include those disclosed in Merigan et al., U.S. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J.I., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al. , Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y.S., Chapter 15, Antisense Research and Applications , Crooke, S.T. and Lebleu, B., Eds., CRC Press, 1993, 273- 288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S.T., Ed., CRC Press, 2008, 163-166 and 442-443.
Publications that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, Manohara et al., US2003/0158403; Manoharan et al., US2003/0175906;; Dinh et al, U.S. 4,845,205; Spielvogel et al., U.S. 5,130,302; Rogers et al., U.S.
5, 134,066; Bischofberger et al., U.S. 5,175,273; Urdea et al., U.S. 5,367,066; Benner et al., U.S. 5,432,272; Matteucci et al., U.S. 5,434,257; Gmeiner et al., U.S. 5,457,187; Cook et al., U.S. 5,459,255; Froehler et al., U.S. 5,484,908; Matteucci et al., U.S. 5,502, 177; Hawkins et al., U.S. 5,525,711; Haralambidis et al., U.S. 5,552,540; Cook et al., U.S. 5,587,469; Froehler et al., U.S. 5,594, 121; Switzer et al., U.S. 5,596,091; Cook et al., U.S. 5,614,617; Froehler et al., U.S. 5,645,985; Cook et al., U.S. 5,681,941; Cook et al., U.S. 5,811,534; Cook et al., U.S. 5,750,692; Cook et al., U.S. 5,948,903; Cook et al., U.S. 5,587,470; Cook et al., U.S.
5,457,191; Matteucci et al., U.S. 5,763,588; Froehler et al., U.S. 5,830,653; Cook et al., U.S. 5,808,027; Cook et al., 6,166,199; and Matteucci et al., U.S. 6,005,096.
B. Certain Modified Internucleoside Linkages
In certain embodiments, nucleosides of modified oligonucleotides may be linked together using any internucleoside linkage. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include but are not limited to phosphates, which contain a phosphodiester bond ("P=0") (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, and
phosphorothioates ("P=S"), and phosphorodithioates ("HS-P=S"). Representative non-phosphorus containing internucleoside linking groups include but are not limited to methylenemethylimino (-CH2-N(CH3)-0-CH2-), thiodiester , thionocarbamate (-0-C(=0)(NH)-S-); siloxane (-O-S1H2-O-); and N,N'-dimethylhydrazine (- CH2-N(CH3)-N(CH3)-). Modified internucleoside linkages, compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Representative chiral internucleoside linkages include but are not limited to alkylphosphonates and phosphorothioates. Methods of preparation of phosphorous-containing and non- phosphorous-containing internucleoside linkages are well known to those skilled in the art. Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nonetheless, as is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkages in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (<Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, modified oligonucleotides comprising (Rp) and/or (<Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein "B" indicates a nucleobase:
Figure imgf000037_0001
(Rp) (Sp) Unless otherwise indicated, chiral intemucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.
Neutral intemucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3'-CH2-N(CH3)-0-5'), amide-3 (3'-CH2-C(=0)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=0)-5'), formacetal (3'-0-CH2-0-5'), methoxypropyl, and thioformacetal (3'-S-CH2-0-5'). Further neutral intemucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral intemucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2 component parts.
C. Certain Motifs
In certain embodiments, modified oligonucleotides comprise one or more modified nucleoside comprising a modified sugar. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified intemucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or intemucleoside linkages of a modified
oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and intemucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or intemucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).
1. Certain Sugar Motifs
In certain embodiments, oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include but are not limited to any of the sugar modifications discussed herein.
In certain embodiments, modified oligonucleotides comprise or consist of a region having a gapmer motif, which comprises two external regions or "wings" and a central or internal region or "gap." The three regions of a gapmer motif (the 5 '-wing, the gap, and the 3 '-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3 '-most nucleoside of the 5 '-wing and the 5 '-most nucleoside of the 3 '-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction). In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the sugar motif of the 5 '-wing differs from the sugar motif of the 3 '-wing (asymmetric gapmer).
In certain embodiments, the wings of a gapmer comprise 1-5 nucleosides. In certain embodiments, the wings of a gapmer comprise 2-5 nucleosides. In certain embodiments, the wings of a gapmer comprise 3- 5 nucleosides. In certain embodiments, the nucleosides of a gapmer are all modified nucleosides.
In certain embodiments, the gap of a gapmer comprises 7-12 nucleosides. In certain embodiments, the gap of a gapmer comprises 7-10 nucleosides. In certain embodiments, the gap of a gapmer comprises 8-10 nucleosides. In certain embodiments, the gap of a gapmer comprises 10 nucleosides. In certain embodiment, each nucleoside of the gap of a gapmer is an unmodified 2'-deoxy nucleoside.
In certain embodiments, the gapmer is a deoxy gapmer. In such embodiments, the nucleosides on the gap side of each wing/gap junction are unmodified 2'-deoxynucleosides and the nucleosides on the wing sides of each wing/gap junction are modified nucleosides. In certain such embodiments, each nucleoside of the gap is an unmodified 2'-deoxynucleoside. In certain such embodiments, each nucleoside of each wing is a modified nucleoside.
2. Certain Nucleobase Motifs
In certain embodiments, oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methylcytosines.
In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3 '-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3'-end of the oligonucleotide. In certain embodiments, the block is at the 5'-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5 '-end of the oligonucleotide.
In certain embodiments, oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of said nucleoside is a 2'-deoxyribosyl moiety. In certain embodiments, the modified nucleobase is selected from: a 2-thiopyrimidine and a 5-propynepyrimidine.
3. Certain Internucleoside Linkage Motifs
In certain embodiments, oligonucleotides comprise modified and/or unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, essentially each intemucleoside linking group is a phosphate intemucleoside linkage (P=0). In certain embodiments, each intemucleoside linking group of a modified oligonucleotide is a phosphorothioate (P=S). In certain embodiments, each intemucleoside linking group of a modified oligonucleotide is independently selected from a phosphorothioate and phosphate intemucleoside linkage. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer and the intemucleoside linkages within the gap are all modified. In certain such embodiments, some or all of the intemucleoside linkages in the wings are unmodified phosphate linkages. In certain embodiments, the terminal intemucleoside linkages are modified.
D. Certain Lengths
In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of ranges of lengths. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X<Y. For example, in certain embodiments, oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to
27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to
19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30,
16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to
28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26,
17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26,
19 to 29, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides
E. Certain Modified Oligonucleotides
In certain embodiments, the above modifications (sugar, nucleobase, intemucleoside linkage) are incorporated into a modified oligonucleotide. In certain embodiments, modified oligonucleotides are characterized by their modification motifs and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each intemucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. For example, the intemucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the intemucleoside linkages of the gap region of the sugar motif. Likewise, such sugar gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Furthermore, in certain instances, an oligonucleotide is described by an overall length or range and by lengths or length ranges of two or more regions (e.g., a regions of nucleosides having specified sugar modifications), in such circumstances it may be possible to select numbers for each range that result in an oligonucleotide having an overall length falling outside the specified range. In such circumstances, both elements must be satisfied. For example, in certain embodiments, a modified oligonucleotide consists if of 15-20 linked nucleosides and has a sugar motif consisting of three regions, A, B, and C, wherein region A consists of 2-6 linked nucleosides having a specified sugar motif, region B consists of 6-10 linked nucleosides having a specified sugar motif, and region C consists of 2-6 linked nucleosides having a specified sugar motif. Such embodiments do not include modified oligonucleotides where A and C each consist of 6 linked nucleosides and B consists of 10 linked nucleosides (even though those numbers of nucleosides are permitted within the requirements for A, B, and C) because the overall length of such oligonucleotide is 22, which exceeds the upper limit of the overall length of the modified oligonucleotide (20). Herein, if a description of an oligonucleotide is silent with respect to one or more parameter, such parameter is not limited. Thus, a modified oligonucleotide described only as having a gapmer sugar motif without further description may have any length, intemucleoside linkage motif, and nucleobase motif. Unless otherwise indicated, all modifications are independent of nucleobase sequence.
F. Nucleobase Sequence
In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequence. In certain embodiments oligonucleotides have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain such embodiments, a region of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain embodiments, the nucleobase sequence of a region or entire length of an
oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid.
III. Certain Oligomeric Compounds
In certain embodiments, the invention provides oligomeric compounds, which consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups. Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3' and/or 5 '-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3'-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3 '-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5 '-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5 '-end of oligonucleotides.
Examples of terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, abasic nucleosides, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified. A. Certain Conjugate Groups
In certain embodiments, oligonucleotides are covalently attached to one or more conjugate groups. In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance. In certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, e.g. , fluorophores or reporter groups that enable detection of the oligonucleotide. Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533- 538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBSLett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993 , 75, 49- 54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium l,2-di-0-hexadecyl-rac-glycero-3- H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides &
Nucleotides, 1995, 14, 969-973), or adamantane acetic acid, a palmityl moiety (Mishra et al., Biochim.
Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or a GalNAc cluster {e.g., WO2014/ 179620). 1. Conj ugate Moieties
Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.
In certain embodiments, a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (<S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a
benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.
2. Conjugate linkers
Conjugate moieties are attached to oligonucleotides through conjugate linkers. In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond). In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.
In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.
In certain embodiments, conjugate linkers, including the conjugate linkers described above, are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a parent compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.
Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-l-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted Ci- Cio alkyl, substituted or unsubstituted C2-C10 alkenyl or substituted or unsubstituted C2-C10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.
In certain embodiments, conjugate linkers comprise 1-10 linker-nucleosidesln certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain
embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5- methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue.
Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds. In certain embodimements, such cleavable bonds are phosphodiester bonds.
Herein, linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric compound is more than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such an oligomeric compound is no more than 30. Unless otherwise indicated conjugate linkers comprise no more than 10 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 5 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker- nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.
In certain embodiments, it is desirable for a conjugate group to be cleaved from the oligonucleotide. For example, in certain circumstances oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide. Thus, certain conjugate linkers may comprise one or more cleavable moieties. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.
In certain embodiments, a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group.
In certain embodiments, a cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, the one or more linker-nucleosides are linked to one another and/or to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is 2'- deoxynucleoside that is attached to either the 3' or 5 '-terminal nucleoside of an oligonucleotide by a phosphate internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.
1. Certain Cell-Targeting Conjugate Moietiess
In certain embodiments, a conjugate group comprises a cell-targeting moiety. In certain
embodiments, a cell-targeting moiety has the general formula:
[Ligand— ether]— [Branching g
V ^ J
V
Cell-targeting
moiety wherein n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater.
In certain embodiments, conjugate groups comprise cell -targeting moieties that have at least one tethered ligand. In certain embodiments, cell-targeting moieties comprise two tethered ligands covalently attached to a branching group. In certain embodiments, cell -targeting moieties comprise three tethered ligands covalently attached to a branching group. In certain embodiments, the cell-targeting moiety comprises a branching group comprising one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether and hydroxylamino groups. In certain embodiments, the branching group comprises a branched aliphatic group comprising groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether and hydroxylamino groups. In certain such embodiments, the branched aliphatic group comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain such embodiments, the branched aliphatic group comprises groups selected from alkyl, amino and ether groups. In certain such embodiments, the branched aliphatic group comprises groups selected from alkyl and ether groups. In certain embodiments, the branching group comprises a mono or polycyclic ring system.
In certain embodiments, each tether of a cell-targeting moiety comprises one or more groups selected from alkyl, substituted alkyl, ether, thioether, disulfide, amino, oxo, amide, phosphodiester, and polyethylene glycol, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether, thioether, disulfide, amino, oxo, amide, and polyethylene glycol, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, phosphodiester, ether, amino, oxo, and amide, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether, amino, oxo, and amid, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, amino, and oxo, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl and oxo, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl and phosphodiester, in any combination. In certain embodiments, each tether comprises at least one phosphorus linking group or neutral linking group. In certain embodiments, each tether comprises a chain from about 6 to about 20 atoms in length. In certain embodiments, each tether comprises a chain from about 10 to about 18 atoms in length. In certain embodiments, each tether comprises about 10 atoms in chain length.
In certain embodiments, each ligand of a cell-targeting moiety has an affinity for at least one type of receptor on a target cell. In certain embodiments, each ligand has an affinity for at least one type of receptor on the surface of a mammalian liver cell. In certain embodiments, each ligand has an affinity for the hepatic asialoglycoprotein receptor (ASGP-R). In certain embodiments, each ligand is a carbohydrate. In certain embodiments, each ligand is, independently selected from galactose, N-acetyl galactoseamine (GalNAc), mannose, glucose, glucoseamine and fucose. In certain embodiments, each ligand is N-acetyl galactoseamine (GalNAc). In certain embodiments, the cell-targeting moiety comprises 3 GalNAc ligands. In certain embodiments, the cell -targeting moiety comprises 2 GalNAc ligands. In certain embodiments, the cell- targeting moiety comprises 1 GalNAc ligand. In certain embodiments, each ligand of a cell-targeting moiety is a carbohydrate, carbohydrate derivative, modified carbohydrate, polysaccharide, modified polysaccharide, or polysaccharide derivative. In certain such embodiments, the conjugate group comprises a carbohydrate cluster (see, e.g., Maier et al., "Synthesis of Antisense Oligonucleotides Conjugated to a Multivalent Carbohydrate Cluster for Cellular Targeting," Bioconjugate Chemistry, 2003, 14, 18-29 or Rensen et al., "Design and Synthesis of Novel N- Acetylgalactosamine-Terminated Glycolipids for Targeting of Lipoproteins to the Hepatic Asiaglycoprotein Receptor," J. Med. Chem. 2004, 47, 5798-5808). In certain such embodiments, each ligand is an amino sugar or a thio sugar. For example, amino sugars may be selected from any number of compounds known in the art, such as sialic acid, a-D-galactosamine, β-muramic acid, 2-deoxy-2-methylamino-L-glucopyranose, 4,6- dideoxy-4-formamido-2,3-di-0-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose and N- sulfo-D-glucosamine, and N-glycoloyl-a-neuraminic acid. For example, thio sugars may be selected from 5- Thio- -D-glucopyranose, methyl 2,3,4-tri-0-acetyl-l-thio-6-0-trityl-a-D-glucopyranoside, 4-ΐ1ήο-β-0- galactopyranose, and ethyl 3,4,6,7-tetra-0-acetyl-2-deoxy-l,5-dithio-a-D-g/Mco-heptopyranoside.
In certain embodiments, conjugate groups comprise a cell-targeting moiety having the formula:
Figure imgf000047_0001
In certain embodiments, conjugate groups comprise a cell-targeting moiety having the formula:
Figure imgf000048_0001
In certain embodiments, conjugate groups comprise a cell-tar eting moiety having the formula-
Figure imgf000048_0002
In certain embodiments, oligomeric compounds comprise a conjugate group described herein as "LICA-1". LICA-1 has the formula:
Figure imgf000048_0003
In certain embodiments, oligomeric compounds comprising LICA-1 have the formula:
Oligo
Figure imgf000049_0001
Branching group
Cell targeting conjugate moiety
wherein oligo is an oligonucleotide.
Representative United States patents, United States patent application publications, international patent application publications, and other publications that teach the preparation of certain of the above noted conjugate groups, oligomeric compounds comprising conjugate groups, tethers, conjugate linkers, branching groups, ligands, cleavable moieties as well as other modifications include without limitation, US 5,994,517, US 6,300,319, US 6,660,720, US 6,906, 182, US 7,262,177, US 7,491,805, US 8,106,022, US 7,723,509, US 2006/0148740, US 2011/0123520, WO 2013/033230 and WO 2012/037254, Biessen et al., J. Med. Chem. 1995, 38, 1846-1852, Lee et al, Bioorganic & Medicinal Chemistry 2011,79, 2494-2500, Rensen et al., J. Biol. Chem. 2001, 276, 37577-37584, Rensen et al., J. Med. Chem. 2004, 47, 5798-5808, Sliedregt et al., J. Med. Chem. 1999, 42, 609-618, and Valentijn et al., Tetrahedron, 1997, 53, 759-770.
In certain embodiments, oligomeric compounds comprise modified oligonucleotides comprising a gapmer and a conjugate group comprising at least one, two, or three GalNAc ligands. In certain embodiments antisense compounds and oligomeric compounds comprise a conjugate group found in any of the following references: Lee, Carbohydr Res, 1978, 67, 509-514; Connolly et al., J Biol Chem, 1982, 257, 939-945; Pavia et al., IntJPep Protein Res, 1983, 22, 539-548; Lee et al., Biochem, 1984, 23, 4255-4261; Lee et al., Glycoconjugate J, 1987, 4, 317-328; Toyokuni et al., Tetrahedron Lett, 1990, 31, 2673-2676; Biessen et al., J
Med Chem, 1995, 38, 1538-1546; Valentijn et al., Tetrahedron, 1997, 53, 759-770; Kim et al., Tetrahedron
Lett, 1997, 38, 3487-3490; Lee et al, Bioconjug Chem, 1997, 8, 762-765; Kato et al., Glycobiol, 2001, 11,
821-829; Rensen et al., J Biol Chem, 2001, 276, 37577-37584; Lee et al., Methods Enzymol, 2003, 362, 38- 43; Westerlind et al., Glycoconj J, 2004, 21, 227-241; Lee et al., BioorgMed Chem Lett, 2006, 16(19), 5132-
5135; Maierhofer et al., BioorgMed Chem, 2007, 15, 7661-7676; Khorev et al., BioorgMed Chem, 2008, 16,
5216-5231; Lee et al., BioorgMed Chem, 2011, 19, 2494-2500; Kornilova et al., Analyt Biochem, 2012, 425,
43-46; Pujol et al., Angew Chemie Int EdEngl, 2012, 51, 7445-7448; Biessen et al., J Med Chem, 1995, 38,
1846-1852; Sliedregt et al., J Med Chem, 1999, 42, 609-618; Rensen et al., J Med Chem, 2004, 47, 5798- 5808; Rensen et al., Arterioscler Thromb Vase Biol, 2006, 26, 169-175; van Rossenberg et al., Gene Ther,
2004, 11, 457-464; Sato et al., J Am Chem Soc, 2004, 126, 14013-14022; Lee et al., J Org Chem, 2012, 77,
7564-7571; Biessen et al., FASEB J, 2000, 14, 1784-1792; Rajur et al., Bioconjug Chem, 1997, 8, 935-940;
Duff et al., Methods Enzymol, 2000, 313, 297-321; Maier et al., Bioconjug Chem, 2003, 14, 18-29;
Jayaprakash et al., Org Lett, 2010, 12, 5410-5413; Manoharan, Antisense Nucleic Acid Drug Dev, 2002, 12, 103-128; Merwin et al., Bioconjug Chem, 1994, 5, 612-620; Tomiya et al., Bioorg Med Chem, 2013, 21,
5275-5281; International applications WO1998/013381; WO2011/038356; WO1997/046098;
WO2008/098788; WO2004/101619; WO2012/037254; WO2011/120053; WO2011/100131;
WO2011/163121; WO2012/177947; WO2013/033230; WO2013/075035; WO2012/083185;
WO2012/083046; WO2009/082607; WO2009/134487; WO2010/144740; WO2010/148013;
WO1997/020563; WO2010/088537; WO2002/043771; WO2010/129709; WO2012/068187;
WO2009/126933; WO2004/024757; WO2010/054406; WO2012/089352; WO2012/089602;
WO2013/166121; WO2013/165816; U.S. Patents 4,751,219; 8,552, 163; 6,908,903; 7,262,177; 5,994,517;
6,300,319; 8, 106,022; 7,491,805; 7,491,805; 7,582,744; 8,137,695; 6,383,812; 6,525,031; 6,660,720;
7,723,509; 8,541,548; 8,344,125; 8,313,772; 8,349,308; 8,450,467; 8,501,930; 8,158,601; 7,262,177;
6,906,182; 6,620,916; 8,435,491; 8,404,862; 7,851,615; Published U.S. Patent Application Publications
US2011/0097264; US2011/0097265; US2013/0004427; US2005/0164235; US2006/0148740;
US2008/0281044; US2010/0240730; US2003/0119724; US2006/0183886; US2008/0206869;
US2011/0269814; US2009/0286973; US2011/0207799; US2012/0136042; US2012/0165393;
US2008/0281041; US2009/0203135; US2012/0035115; US2012/0095075; US2012/0101148;
US2012/0128760; US2012/0157509; US2012/0230938; US2013/0109817; US2013/0121954;
US2013/0178512; US2013/0236968; US2011/0123520; US2003/0077829; US2008/0108801; and
US2009/0203132.
In certain embodiments, compounds of the invention are single -stranded. In certain embodiments, oligomeric compounds are paired with a second oligonucleotide or oligomeric compound to form a duplex, which is double-stranded. IV. Certain Antisense Compounds
In certain embodiments, the present invention provides compounds, which comprise or consist of an oligomeric compound comprising an antisense oligonucleotide, having a nucleobase sequences
complementary to that of a target nucleic acid. Certain such compounds are antisense compounds. In certain embodiments, antisense compounds are single-stranded. Such single -stranded antisense compounds typically comprise or consist of an oligomeric compound that comprises or consists of a modified oligonucleotide and optionally a conjugate group. In certain embodiments, antisense compounds are double-stranded. Such double -stranded antisense compounds comprise a first oligomeric compound having a region complementary to a target nucleic acid and a second oligomeric compound having a region complementary to the first oligomeric compound. The first oligomeric compound of such double stranded antisense compounds typically comprises or consists of a modified oligonucleotide and optionally a conjugate group. The oligonucleotide of the second oligomeric compound of such double -stranded antisense compound may be modified or unmodified. Either or both oligomeric compounds of a double-stranded antisense compound may comprise a conjugate group. The oligomeric compounds of double-stranded antisense compounds may include non-complementary overhanging nucleosides.
In certain embodiments, oligomeric compounds of antisense compounds are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity. In certain embodiments, antisense compounds selectively affect one or more target nucleic acid. Such selective antisense compounds comprises a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity.
In certain antisense activities, hybridization of an antisense compound to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in R ase H mediated cleavage of the target nucleic acid. R ase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an R A:DNA duplex need not be unmodified DNA. In certain embodiments, the invention provides antisense compounds that are sufficiently "DNA-like" to elicit RNase H activity. Further, in certain embodiments, one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.
In certain antisense activities, an antisense compound or a portion of an antisense compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain antisense compounds result in cleavage of the target nucleic acid by Argonaute. Antisense compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double- stranded (siRNA) or single -stranded (ssRNA).
Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, and/or a phenotypic change in a cell or animal. V. Certain Target Nucleic Acids
In certain embodiments, antisense compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is a KLKB1 nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: an mRNA and a pre-mRNA, including intronic, exonic and untranslated regions. In certain embodiments, the target RNA is an mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron/exon junction. In certain embodiments, the target region is at least 50% within an intron.
In certain embodiments, the target nucleic acid is a non-coding RNA. In certain such embodiments, the target non-coding RNA is selected from: a long-non-coding RNA, a short non-coding RNA, an intronic RNA molecule, a snoRNA, a scaRNA, a microRNA (including pre -microRNA and mature microRNA), a ribosomal RNA, and promoter directed RNA. In certain embodiments, the target nucleic acid is a nucleic acid other than a mature mRNA. In certain embodiments, the target nucleic acid is a nucleic acid other than a mature mRNA or a microRNA. In certain embodiments, the target nucleic acid is a non-coding RNA other than a microRNA. In certain embodiments, the target nucleic acid is a non-coding RNA other than a microRNA or an intronic region of a pre-mRNA. In certain embodiments, the target nucleic acid is a long non-coding RNA. In certain embodiments, the target nucleic acid is a nuclear-retained non-coding RNA.
In certain embodiments, antisense compounds described herein are complementary to a target nucleic acid comprising a single-nucleotide polymorphism (SNP). In certain such embodiments, the antisense compound is capable of modulating expression of one allele of the SNP -containing target nucleic acid to a greater or lesser extent than it modulates another allele. In certain embodiments, an antisense compound hybridizes to a (SNP)-containing target nucleic acid at the single-nucleotide polymorphism site.
In certain embodiments, antisense compounds are at least partially complementary to more than one target nucleic acid. For example, antisense compounds of the present invention may mimic microRNAs, which typically bind to multiple targets.
A. Complementarity/Mismatches to the Target Nucleic Acid
In certain embodiments, antisense compounds comprise antisense oligonucleotides that are complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain
embodiments, such oligonucleotides are 99% complementary to the target nucleic acid. In certain embodiments, such oligonucleotides are 95% complementary to the target nucleic acid. In certain embodiments, such oligonucleotides are 90% complementary to the target nucleic acid. In certain embodiments, such oligonucleotides are 85% complementary to the target nucleic acid. In certain embodiments, such oligonucleotides are 80% complementary to the target nucleic acid. In certain embodiments, antisense oligonucleotides are at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and comprise a region that is 100% or fully complementary to a target nucleic acid. In certain such embodiments, the region of full complementarity is from 6 to 20 nucleobases in length. In certain such embodiments, the region of full complementarity is from 10 to 18 nucleobases in length. In certain such embodiments, the region of full complementarity is from 18 to 20 nucleobases in length.
In certain embodiments, the oligomeric compounds of antisense compounds comprise one or more mismatched nucleobases relative to the target nucleic acid. In certain such embodiments, antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount. Thus, in certain such embodiments selectivity of the antisense compound is improved. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide having a gapmer motif. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5'-end of the gap region. In certain such embodiments, the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3 '-end of the gap region. In certain such embodiments, the mismatch is at position 1, 2, 3, or 4 from the 5'-end of the wing region. In certain such embodiments, the mismatch is at position 4, 3, 2, or 1 from the 3'-end of the wing region.
B. KLKBl
In certain embodiments, antisense compounds and oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is a KLKBl nucleic acid. In certain embodiments, antisense compounds and oligomeric compounds comprise or consist of an oligonucleotide that is fully complementary to a target nucleic acid, wherein the target nucleic acid is a KLKBl nucleic acid. In certain embodiments, a KLKB l nucleic acid has the sequence set forth in GENBANK Accession No. NM_000892.3 (incorporated herein as SEQ ID NO: 1). In certain embodiments, a KLKBl nucleic acid has the sequence set forth in GENBANK Accession No. NT_016354.19 truncated from nucleotides 111693001 to 111730000 (incorporated herein as SEQ ID NO: 2). In certain embodiments, the antisense compound or oligomeric compound comprises or consists of Compound 546254 or a salt thereof. The structure of Compound 546254 is
Figure imgf000054_0001
(SEQ ID NO: 3)
In certain embodiments, the antisense compound or oligomeric compound comprises or consists of Compound 721744 or a salt thereof. The structure of Compound 721744 is
Figure imgf000055_0001
(SEQ ID NO: 3)
In certain embodiments, the antisense compound or oligomeric compound comprises or consists of a an embodiments described in WO 2013/003808, WO 2012/170945, WO 2015/031679, or WO 2015/168532, which are hereby incorporated by reference.
In certain embodiments, contacting a cell with an antisense compound or oligomeric compound complementary to KLKBl reduces the amount of KLKBl expression in the cell. In certain embodiments, contacting a cell with an antisense compound or oligomeric compound complementary to KLKB 1 reduces the amount of KLKBl expression in the cell and ameliorates one or more symptoms of headache.
Certain Target Nucleic Acids in Certain Tissues In certain embodiments, antisense compounds or oligomeric compounds comprise or consist of an oligonucleotide that is complementary to a target nucleic acid, wherein the target nucleic acid is expressed in liver cells. In certain embodiments, modulation of expression of KLKBl in liver cells results in a reduction in plasma prekallikrein. In certain such embodiments, plasma kallikrein is also reduced. In certain embodiments, modulation of expression of KLKB 1 ameliorates one or more symptoms of a headache disorder such as migraine.
VI. Certain Pharmaceutical Compositions
In certain embodiments, the present invention provides pharmaceutical compositions comprising one or more oligomeric compound or a salt thereof. In certain such embodiments, the pharmaceutical composition comprises a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises a sterile saline solution and one or more antisense compound. In certain
embodiments, such pharmaceutical composition consists of a sterile saline solution and one or more antisense compound. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises one or more antisense compound and sterile water. In certain embodiments, a pharmaceutical composition consists of one antisense compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises one or more antisense compound and phosphate-buffered saline (PBS). In certain embodiments, a pharmaceutical composition consists of one or more antisense compound and sterile PBS. In certain embodiments, the sterile PBS is pharmaceutical grade PBS.
In certain embodiments, pharmaceutical compositions comprise one or more or oligomeric compound and one or more excipients. In certain such embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.
In certain embodiments, oligomeric compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations.
Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
In certain embodiments, pharmaceutical compositions comprising an oligomeric compound encompass any pharmaceutically acceptable salts of the antisense compound, esters of the antisense compound, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising antisense compounds comprising one or more antisense oligonucleotide, upon administration to an animal, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved by endogenous nucleases within the body.
Lipid moieties have been used in nucleic acid therapies in a variety of methods. In certain such methods, the nucleic acid, such as an oligomeric compound, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.
In certain embodiments, pharmaceutical compositions comprise a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used.
In certain embodiments, pharmaceutical compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types. For example, in certain embodiments, pharmaceutical compositions include liposomes coated with a tissue-specific antibody.
In certain embodiments, pharmaceutical compositions comprise a co-solvent system. Certain of such co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant
Polysorbate 80™ and 65% w/v polyethylene glycol 300. The proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80™; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
In certain embodiments, pharmaceutical compositions are prepared for oral administration. In certain embodiments, pharmaceutical compositions are prepared for buccal administration. In certain embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, etc.). In certain of such embodiments, a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes. Aqueous injection suspensions may contain. VII. Certain Combination Therapies
In certain embodiments, pharmaceutical agents that may be co-administered with a compound or composition described herein include anticoagulant or antiplatelet agents, beta blockers, anticonvulsants, calcium antagonists, tricyclic antidepressants, analgesic agents, opioids, triptans, and ergotamines. In certain embodiments, therapies that may be co-administered with a compound or composition described herein include invasive or non-invasive peripheral nerve stimulation, central neurostimulation, transcranial magnetic stimulation, cranial osteopathic manipulative treatment, and cognitive-behavioral therapy.
In certain embodiments, pharmaceutical agents that may be co-administered with a compound or composition described herein include, but are not limited to, an additional inhibitor of KLKB l expression. In certain embodiments, the co-adminstered pharmaceutical agent is administered prior to administration of a compound or composition described herein. In certain embodiments, the co-administered pharmaceutical agent is administered following administration of a compound or composition described herein. In certain embodiments the co-administered pharmaceutical agent is administered at the same time as a compound or composition described herein. In certain embodiments the dose of a co-administered pharmaceutical agent is the same as the dose that would be administered if the co-administered pharmaceutical agent was administered alone. In certain embodiments the dose of a co-administered pharmaceutical agent is lower than the dose that would be administered if the co-administered pharmaceutical agent was administered alone. In certain embodiments the dose of a co-administered pharmaceutical agent is greater than the dose that would be administered if the co-administered pharmaceutical agent was administered alone.
In certain embodiments, the co-administration of a second compound enhances the effect of a first compound, such that co-administration of the compounds results in an effect that is greater than the effect of administering the first compound alone. In other embodiments, the co-administration results in effects that are additive of the effects of the compounds when administered alone. In certain embodiments, the coadministration results in effects that are supra-additive of the effects of the compounds when administered alone. In certain embodiments, the first compound is an antisense compound. In certain embodiments, the second compound is an antisense compound. Nonlimiting disclosure
While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate examples of the compounds, compositions, and methods described herein and are not intended to limit the same. Each of the references, GenBank accession numbers, and the like recited in the present application is incorporated herein by reference in its entirety.
Although the sequence listing accompanying this filing identifies each sequence as either "RNA" or "DNA" as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as "RNA" or "DNA" to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2' -OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2' -OH in place of one 2'-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) in place of a uracil of RNA). Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligomeric compound having the nucleobase sequence "ATCGATCG" encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence "AUCGAUCG" and those having some DNA bases and some RNA bases such as "AUCGATCG" and oligomeric compounds having other modified
nucleobases, such as "ATmCGAUCG," wherein ""C indicates a cytosine base comprising a methyl group at the 5-position.
Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), or as (D) or (L), such as for amino acids, etc. Included in the compounds provided herein are all such possible isomers, including their racemic and optically pure forms, unless specified otherwise. Likewise, all cis- and trans-isomers and tautomeric forms are also included unless otherwise indicated.
The compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the ¾ hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to: 2H or H in place of ¾, 13C or 14C in place of 12C, 15N in place of 14N, 170 or 180 in place of 160, and 33S, 4S, 5S, or 6S in place of 2S. In certain embodiments, non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging.
EXAMPLES
The Examples described in WO 2013/003808, WO 2012/170945, WO 2015/031679, and WO 2015/168532 are hereby incorporated by reference.
Example 1: Plasma kallikrein-kinin pathway activity following inhibition of KLKB1 expression in individuals
An oligomeric compound comprising a modified oligonucleotide complementary to a KLKB 1 nucleic acid was tested for its effects on activity of the kallikrein-kinin pathway in human individuals.
Oligomeric compound
Compound 546254 is a modified oligonucleotide that is 20 linked nucleosides in length and has the nucleobase sequence TGCAAGTCTCTTGGCAAACA (incorporated herein as SEQ ID NO: 3). The nucleobase sequence is 100% complementary to KLKB1 transcripts SEQ ID NO: 1, at positions 1019 to 1038, and SEQ ID NO: 2, at positions 27441 to 27460. Compound 546254 is a gapmer wherein the central gap segment is ten 2'-deoxynucleosides in length and is flanked by wings of five nucleosides each. Each nucleoside in the 5 '-wing segment and each nucleoside in the 3 '-wing segment is a 2'-MOE modified nucleoside. The intemucleoside linkages throughout the oligonucleotide are phosphorothioate linkages. All cytosine nucleobases throughout the oligonucleotide are 5-methylcytosines.
Treatment
Thirty-three human individuals were divided into 4 treatment groups. One of four individuals (25%) received placebo across all treatment groups. The remaining individuals received a dose of Compound 546254 (100 mg, 200 mg, 300 mg, or 400 mg) according to their treatment group. The doses of placebo and Compound 546254 were administered to the individuals subcutaneously on days 1, 3, 5, 8, 15, and 22 of the study. Plasma samples were taken from all individuals on days 1, 29, and 71 of the study.
KLKB1 expression
KLKB1 expression in the individuals was assessed by measuring their plasma prekallikrein (PKK) protein levels using an ELISA assay according to the manufacturer's directions (cat. # ab 171015, Abeam, Cambridge, MA). The results, shown in the the table below as the average percent change in plasma prekallikrein protein levels for each treatment group relative to the average level on day 1, show that KLKB l expression was inhibited in a dose dependent manner in the individuals.
Plasma kallikren-kinin pathway activity assay
Serine protease activity of the individuals' plasma kallikrein-kinin pathway was assessed by measuring in vitro cleavage of a chromogenic substrate that comprises a portion of the peptide sequence of high molecular weight kininogen (HMWK). The individuals' plasma samples were centrifuged to remove platelets, then cooled to 0 °C, and incubated with 12.5 mg/mL dextran sulfate. The chromogenic plasma kallikrein peptide substrate, H-D-Pro-Phe-Arg-pNA, was then added at 30 °C and absorbance at 405 nm was monitored in order to measure cleavage of the substrate and release of /j>-nitroanaline. The results, shown in the table below as the average percent change in protease activity for each treatment group relative to the average activity on day 1, show that plasma kallikrein-kinin pathway activity was reduced in a dose dependent manner in the individuals.
Table 1
Dose dependent inhibition of KLKBl expression and plasma kallikrein-kinin pathway activity
Figure imgf000061_0001
Example 2: Effects on headache following administration of an oligomeric compound targeted to KLKBl
An oligomeric compound comprising a modified oligonucleotide complementary to a KLKB 1 nucleic acid is tested for its effects on headache in human individuals.
Oligomeric compound
Compound 546254 is described in Example 1.
Treatment and assessment
Human individuals are identified as having chronic migraine. Approximately thirty individuals identified as having chronic migraine are divided into groups. Individuals in the placebo group receive 1.00 mL 0.9% sterile saline. Individuals in the treatment group receive a dose of 200 mg of Compound 546254. Each dose of placebo or Compound 546254 is administered subcutaneously, once per week, for 16 weeks. Blood and/or plasma samples are taken from all individuals, and KLKB 1 expression, kallikrein-kinin pathway activity, pharmacokinetics and/or pharmacodynamics of the oligomeric compound, and/or other biomarkers are measured. The number of days migraine occurs, the number of days head pain occurs, head pain severity, migraine headache frequency, use of medication other than the oligomeric compound, migraine specific quality of life (MSQ) questionnaire score, physician global impress of change (PGIC) score, subject global impress of change (SGIC) score, and/or other symptoms of migraine are assessed in the individuals using standardized subjective and/or objective measures.
Example 3: Effects on headache following administration of an oligomeric compound targeted to KLKB1
An oligomeric compound comprising a modified oligonucleotide complementary to a KLKB 1 nucleic acid is tested for its effects on headache in human individuals.
Oligomeric compound
Compound 721744 is an oligomeric compound consisting of the modified oligonucleotide of Compound 546254 and a LICA-1 conjugate group. Compound 546254 is described in Example 1. The LICA- 1 conjugate group is attached at the 5 '-end of the modified oligonucleotide via a phosphate group.
Treatment and assessment
Human individuals are identified as having, or at risk of having, one or more certain type(s) of headache. A certain number of the identified individuals are divided into groups. Individuals in the placebo group(s) receive placebo. Individuals in the treatment group(s) receive a dose of Compound 721744. The doses of placebo and the oligomeric compound are administered to the individuals subcutaneously. Blood and/or plasma samples are taken from all individuals, and KLKB 1 expression, kallikrein-kinin pathway activity, pharmacokinetics and/or pharmacodynamics of the oligomeric compound, and/or other biomarkers are measured. The number of days headache occurs, the number of days head pain occurs, head pain severity, headache frequency, use of medication other than the oligomeric compound, physician global impression of change (PGIC) score, subject global impression of change (SGIC) score, and/or other symptoms of headache are assessed in the individuals using standardized subjective and/or objective measures.
Example 4: Effects on headache following administration of an oligomeric compound targeted to KLKB1
Oligomeric compound 546254, comprising a modified oligonucleotide complementary to a KLKB1 nucleic acid, or placebo was administered to human individuals having chronic migraine, according to the protocol described in Example 2. During the 28 days prior to start of treatment (baseline) and throughout the duration of treatment, the individuals were asked to record all headaches or lack thereof once every day (24 hour period) in an electronic diary. Information requested for inclusion in the diary included headache severity, symptoms, and use of other medications. Severity was recorded as "no pain", "mild pain", or "severe pain".

Claims

CLAIMS What is claimed is:
1. A method of treating, preventing, or ameliorating headache in an individual having, or at risk of having, a headache comprising
identifying an individual having, or at risk of having, a headache; and
administering to the individual an oligomeric compound comprising a modified oligonucleotide complementary to a KLKB 1 nucleic acid, thereby treating, preventing, or ameliorating the headache in the individual.
2. A method comprising identifying an individual having, or at risk of having, a headache; and
administering an oligomeric compound comprising a modified oligonucleotide complementary to a KLKB 1 nucleic acid to the individual for treating, preventing, or ameliorating headache, thereby treating, preventing, or ameliorating the headache in the individual.
3. A method of treating, preventing, or ameliorating headache in an individual having, or at risk of having, a headache comprising administering to the individual an oligomeric compound comprising a modified oligonucleotide complementary to a KLKB 1 nucleic acid, thereby treating, preventing, or ameliorating the headache in the individual.
4. A method comprising administering an oligomeric compound comprising a modified oligonucleotide complementary to a KLKB l nucleic acid to an individual having, or at risk of having, a headache, for treating, preventing, or ameliorating headache, thereby treating, preventing, or ameliorating the headache in the individual.
5. A method of inhibiting expression or activity of kallikrein B 1 in a cell in an individual identified as having, or at risk of having, a headache comprising contacting the cell with an oligomeric compound comprising a modified oligonucleotide complementary to a KLKB 1 nucleic acid, thereby inhibiting expression or activity of kallikrein B l in the cell.
6. A method of inhibiting expression or activity of kallikrein B 1 in a cell in an individual having, or at risk of having, a headache comprising contacting the cell with an oligomeric compound comprising a modified oligonucleotide complementary to a KLKB 1 nucleic acid, thereby inhibiting expression or activity of kallikrein B l in the cell.
7. The method of claim 5 or 6, wherein the cell is a liver cell.
8. A method of preventing or ameliorating nausea, vomiting, photophobia, phonophobia, osmophobia, pain intensity, blurry vision, loss of vision, cloudy vision, visual aura, vertigo, tingling sensations, numbness, head pain severity, head pain duration, the number of days of headache per month, or a combination thereof, in an individual having, or at risk of having, a headache comprising identifying an individual having, or at risk of having, a headache; and
administering to the individual an oligomeric compound comprising a modified oligonucleotide complementary to a KLKB 1 nucleic acid, thereby preventing or ameliorating nausea, vomiting, photophobia, phonophobia, osmophobia, pain intensity, blurry vision, loss of vision, cloudy vision, visual aura, vertigo, tingling sensations, numbness, head pain severity, head pain duration, the number of days of headache per month, or a combination thereof, in the individual.
9. A method of preventing or ameliorating nausea, vomiting, photophobia, phonophobia, osmophobia, pain intensity, blurry vision, loss of vision, cloudy vision, visual aura, vertigo, tingling sensations, numbness, head pain severity, head pain duration, the number of days of headache per month, or a combination thereof, in an individual having, or at risk of having, a headache comprising
administering to the individual an oligomeric compound comprising a modified oligonucleotide complementary to a KLKB 1 nucleic acid, thereby preventing or ameliorating nausea, vomiting, photophobia, phonophobia, osmophobia, pain intensity, blurry vision, loss of vision, cloudy vision, visual aura, vertigo, tingling sensations, numbness, head pain severity, head pain duration, the number of days of headache per month, or a combination thereof, in the individual.
10. The method of any of claims 1-9, wherein the individual is human.
11. The method of any of claims 1-10, wherein the headache is cluster headaches, migrainous neuralgia, chronic tension-type headache, chronic paroxysmal hemicrania, cranial neuralgia, or sinus headache.
12. The method of any of claims 1-10, wherein the headache is chronic tension-type headache.
13. The method of any of claims 1-10, wherein the headache is migraine preceded or accompanied by aura.
14. The method of any of claims 1-10, wherein the headache is migraine without aura.
15. The method of any of claims 13-14, wherein the migraine is chronic migraine, episodic migraine, menopausal migraine, or menstrual migraine.
16. The method of claim 15, wherein the migraine is chronic migraine or episodic migraine.
17. The method of claim 15, wherein the migraine is chronic migraine.
18. The method of any of claims 1-17, wherein the oligomeric compound ameliorates nausea, vomiting, photophobia, phonophobia, osmophobia, pain intensity, blurry vision, loss of vision, cloudy vision, visual aura, vertigo, tingling sensations, or numbness.
19. The method of claim 18, wherein the oligomeric compound ameliroates nausea or vomiting.
20. The method of any of claims 18-19, wherein the oligomeric compound ameliorates photophobia, phonohobia, or osmophobia.
21. The method of any of claims 18-20, wherein the oligomeric compound ameliorates pain intensity.
22. The method of any of claims 18-21, wherein the oligomeric compound ameliorates blurry vision, loss of vision, cloudy vision, or visual aura.
23. The method of any of claims 18-22, wherein the oligomeric compound ameliorates vertigo.
24. The method of any of claims 18-23, wherein the oligomeric compound ameliorates tingling
sensations or numbness.
25. The method of any of claims 1-24, wherein the oligomeric compound reduces the frequency of headache in the individual.
26. The method of any of claims 1-25, wherein the headache occurs fewer average days per month over the course of at least three months than the average number of days per month the headache occurred over the course of the one to three months prior to administering or contacting the cell with the oligomeric compound.
27. The method of any of claims 25-26, wherein the headache occurs fewer than 15 days per month following administering or contacting the cell with the oligomeric compound.
28. The method of claim 27, wherein the headache occurs fewer than 14 days per month following administering or contacting the cell with the oligomeric compound.
29. The method of claim 27, wherein the headache occurs fewer than 13 days per month following administering or contacting the cell with the oligomeric compound.
30. The method of claim 27, wherein the headache occurs fewer than 12 days per month following administering or contacting the cell with the oligomeric compound.
31. The method of claim 27, wherein the headache occurs fewer than 11 days per month following administering or contacting the cell with the oligomeric compound.
32. The method of claim 27, wherein the headache occurs fewer than 10 days per month following administering or contacting the cell with the oligomeric compound.
33. The method of claim 27, wherein the headache occurs fewer than 9 days per month following
administering or contacting the cell with the oligomeric compound.
34. The method of claim 27, wherein the headache occurs fewer than 8 days per month following
administering or contacting the cell with the oligomeric compound.
35. The method of claim 27, wherein the headache occurs fewer than 7 days per month following
administering or contacting the cell with the oligomeric compound.
36. The method of claim 27, wherein the headache occurs fewer than 6 days per month following
administering or contacting the cell with the oligomeric compound.
37. The method of claim 27, wherein the headache occurs fewer than 5 days per month following
administering or contacting the cell with the oligomeric compound.
38. The method of claim 27, wherein the headache occurs fewer than 4 days per month following
administering or contacting the cell with the oligomeric compound.
39. The method of claim 27, wherein the headache occurs fewer than 3 days per month following
administering or contacting the cell with the oligomeric compound.
40. The method of claim 27, wherein the headache occurs fewer than 2 days per month following administering or contacting the cell with the oligomeric compound.
41. The method of claim 27, wherein the headache occurs fewer than 1 day per month following
administering or contacting the cell with the oligomeric compound.
42. The method of any of claims 1-41, wherein the amount of KLKB1 mRNA is reduced in the
individual.
43. The method of any of claims 1-42, wherein the amount of plasma prekallikrein is reduced in the individual.
44. The method of any of claims 1-43, wherein the amount of plasma kallikrein is reduced in the
individual.
45. The method of any of claims 1-44, wherein the activity of plasma kallikrein is reduced in the
individual.
46. The method of any of claims 1-45, wherein the amount of bradykinin is reduced in the individual.
47. The method of any of claims 1-46, wherein the KLKB1 nucleic acid to which the modified
oligonucleotide is complementary is a KLKB 1 transcript.
48. The method of claim 47, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to the KLKB 1 transcript.
49. The method of claim 47, wherein the nucleobase sequence of the modified oligonucleotide is at least 85% complementary to the KLKB1 transcript.
50. The method of claim 47, wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to the KLKB 1 transcript.
51. The method of claim 47, wherein the nucleobase sequence of the modified oligonucleotide is at least 95% complementary to the KLKB1 transcript.
52. The method of claim 47, wherein the nucleobase sequence of the modified oligonucleotide is 100% complementary to the KLKB 1 transcript.
53. The method of any of claims 47-52, wherein the KLKB1 transcript is a KLKB1 pre-mRNA.
54. The method of any of claims 47-52, wherein the KLKB1 transcript is a KLKB1 mRNA.
55. The method of any of claims 47-52, wherein the sequence of the KLKB1 transcript is SEQ ID NO: 1 or SEQ ID NO: 2.
56. The method of any of claims 1-55, wherein the nucleobase sequence of the modified oligonucleotide comprises SEQ ID NO: 3
57. The method of any of claims 1-56, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage, at least one modified sugar moiety, or at least one modified nucleobase.
58. The method of claim 57, wherein the modified oligonucleotide comprises at least one modified sugar moiety.
59. The method of claim 58, wherein the at least one modified sugar moiety is a non-bicyclic, 2'- substituted sugar moiety.
60. The method of claim 59, wherein the non-bicyclic, 2 '-substituted sugar moiety is selected from
among: 2'-OMe, 2'-F, and 2'-MOE.
61. The method of claim 60, wherein the non-bicyclic, 2 '-substituted sugar moiety is 2'-MOE.
62. The method of claim 58, wherein at least one modified sugar moiety is a bicyclic sugar moiety.
63. The method of claim 62, wherein at least one bicyclic sugar moiety is LNA or cEt.
64. The method of claim 58, wherein at least one modified sugar moiety is a sugar surrogate.
65. The method of claim 64, wherein at least one sugar surrogate is a morpholino.
66. The method of claim 65, wherein at least one sugar surrogate is a modified morpholino.
67. The method of any of claims 1-66, wherein the modified oligonucleotide comprises:
a gap segment consisting of linked 2'-deoxynucleosides;
a 5' wing segment consisting of linked nucleosides; and
a 3' wing segment consisting of linked nucleosides;
wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, and wherein the 3' most nucleoside of the 5' wing and the 5' most nucleoside of the 3' wing each comprises a modified sugar moiety.
68. The method of claim 67, wherein each nucleoside of the 5' wing segment and each nucleoside of the 3' wing segment comprises a modified sugar.
69. The method of any of claims 58-68, wherein all of the modified sugar moieties are the same as each other.
70. The method of any of claims 1-69, wherein the modified oligonucleotide is 12-30 linked nucleosides in length.
71. The method of any of claims 1-69, wherein the modified oligonucleotide is 16-20 linked nucleosides in length.
72. The method of any of claims 1-69, wherein the modified oligonucleotide consists of 20 linked
nucleosides.
73. The method of any of claims 57-72, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.
74. The method of claim 73, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.
75. The method of any of claims 73-74, wherein at least one modified internucleoside linkage is a
phosphorothioate internucleoside linkage.
76. The method of any of claims 73-75, wherein each intemucleoside linkage is a modified intemucleoside linkage and wherein each intemucleoside linkage comprises the same modification.
77. The method of claim 76, wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage.
78. The method of any of claims 1-77, wherein the strucuture of the modified oligonucleotide is
Figure imgf000069_0001
(SEQ ID NO: 3) or a salt thereof.
79. The method of any of claims 1-78, wherein the oligomeric compound comprises a conjugate group.
80. The method of claim 79, wherein the conjugate group comprises GalNAc.
81. The method of claim 80, wherein the structure of the oligomeric compound is
Figure imgf000070_0001
(SEQ ID NO: 3) or a salt thereof.
82. The method of any of claims 1-81, wherein the oligomeric compound is an RNase H based antisense compound.
83. The method of any of claims 1-66, 69-77, or 79-80, wherein the oligomeric compound is an RNAi antisense compound.
84. The method of any of claims 1-83, wherein the oligomeric compound is single-stranded.
85. The method of any of claims 1-83, wherein the oligomeric compound is paired with a second
oligomeric compound to form a duplex.
86. The method of claim 85, wherein the second oligomeric compound comprises an oligonucleotide and a conjugate group.
87. The method of any of claims 1-86, wherein the oligomeric compound is administered parenterally to the individual.
88. The method of claim 87, wherein the oligomeric compound is administered parenterally by subcutaneous or intravenous administration to the individual.
89. The method of claim 88, wherein the oligomeric compound is administered by subcutaneous administration to the individual.
90. The method of any of claims 1-89, comprising co-administering the oligomeric compound and at least one additional therapy.
91. The method of claim 90, wherein the compound and at least one additional therapy are administered concomitantly.
92. The method of claim 90, wherein the compound and at least one additional therapy are administered consecutively.
93. The method of any of claims 90-92, wherein at least one additional therapy is a beta blocker, an anticonvulsant, a calcium antagonist, a tricyclic antidepressant, an analgesic agent, an opioid, atriptan, or an ergotamine.
94. The method of any of claims 90-93, wherein at least one additional therapy is invasive or non-invasive peripheral nerve stimulation, central neurostimulation, transcranial magnetic stimulation, cranial osteopathic manipulative treatment, or cognitive-behavioral therapy.
95. Use of an oligomeric compound comprising a modified oligonucleotide complementary to a KLKB 1 nucleic acid for the manufacture or preparation of a medicament for treating headache.
96. Use of an oligomeric compound comprising a modified oligonucleotide complementary to a KLKB1 nucleic acid for the treatment of headache.
97. The use of claim 95 or 96, wherein the headache is cluster headaches, migrainous neuralgia, chronic tension-type headache, chronic paroxysmal hemicrania, cranial neuralgia, or sinus headache.
98. The use of claim 95 or 96, wherein the headache is chronic tension-type headache.
99. The use of claim 95 or 96, wherein the headache is migraine preceded or accompanied by aura.
100. The use of claim 95 or 96, wherein the headache is migraine without aura.
101. The use of any of claims 99-100, wherein the migraine is chronic migraine, episodic migraine,
menopausal migraine, or menstrual migraine.
102. The use of claim 101, wherein the migraine is chronic migraine or episodic migraine.
103. The use of claim 101, wherein the migraine is chronic migraine.
104. The use of any of claims 95-103, wherein the oligomeric compound is capable of reducing or
improving nausea, vomiting, photophobia, phonophobia, osmophobia, pain intensity, blurry vision, loss of vision, cloudy vision, visual aura, vertigo, tingling sensations, or numbness.
105. The use of claim 104, wherein the oligomeric compound is capable of reducing or improving nausea or vomiting.
106. The use of any of claims 104-105, wherein the oligomeric compound is capable of reducing or
improving photophobia, phonohobia, or osmophobia.
107. The use of any of claims 104-106, wherein the oligomeric compound is capable of reducing or
improving pain intensity.
108. The use of any of claims 104-107, wherein the oligomeric compound is capable of reducing or
improving blurry vision, loss of vision, cloudy vision, or visual aura.
109. The use of any of claims 104-108, wherein the oligomeric compound is capable of reducing or
improving vertigo.
110. The use of any of claims 104-109, wherein the oligomeric compound is capable of reducing or
improving tingling sensations or numbness.
111. The use of any of claims 95-110, wherein the oligomeric compound is capable of reducing the
frequency of headache.
112. The use of any of claims 95-111, wherein the headache occurs fewer average days per month over the course of at least three months than the average number of days per month the headache occurred over the course of the one to three months prior to use of the oligomeric compound.
113. The use of any of claims 111-112, wherein the headache occurs fewer than 15 days per month
following use of the oligomeric compound.
114. The use of claim 113, wherein the headache occurs fewer than 14 days per month following use of the oligomeric compound.
115. The use of claim 113, wherein the headache occurs fewer than 13 days per month following use of the oligomeric compound.
116. The use of claim 113, wherein the headache occurs fewer than 12 days per month following use of the oligomeric compound.
117. The use of claim 113, wherein the headache occurs fewer than 11 days per month following use of the oligomeric compound.
118. The use of claim 113, wherein the headache occurs fewer than 10 days per month following use of the oligomeric compound.
119. The use of claim 113, wherein the headache occurs fewer than 9 days per month following use of the oligomeric compound.
120. The use of claim 113, wherein the headache occurs fewer than 8 days per month following use of the oligomeric compound.
121. The use of claim 113, wherein the headache occurs fewer than 7 days per month following use of the oligomeric compound.
122. The use of claim 1 13, wherein the headache occurs fewer than 6 days per month following use of the oligomeric compound.
123. The use of claim 1 13, wherein the headache occurs fewer than 5 days per month following use of the oligomeric compound.
124. The use of claim 1 13, wherein the headache occurs fewer than 4 days per month following use of the oligomeric compound.
125. The use of claim 1 13, wherein the headache occurs fewer than 3 days per month following use of the oligomeric compound.
126. The use of claim 1 13, wherein the headache occurs fewer than 2 days per month following use of the oligomeric compound.
127. The use of claim 1 13, wherein the headache occurs fewer than 1 day per month following use of the oligomeric compound.
128. The use of any of claims 95-127, wherein the oligomeric compound is capable of reducing
bradykinin.
129. The use of any of claims 95-128, wherein the modified oligonucleotide is 12 to 30 linked nucleosides in length.
130. The use of any of claims 95-129, wherein the modified oligonucleotide comprises at least one modified intemucleoside linkage, at least one modified sugar moiety, or at least one modified nucleobase.
131. The use of claim 130, wherein the at least one modified intemucleoside linkage is a phosphorothioate intemucleoside linkage, the at least one modified sugar is a bicyclic sugar or 2 '-O-methyoxyethyl, and the at least one modified nucleobase is a 5-methylcytosine.
132. The use of claim 130 or 131, wherein at least one modified sugar is LNA or cEt.
133. The use of any of claims 130-132, wherein each modified intemucleoside is a phosphorothioate linkage.
134. The use of any of claims 130-133, wherein each cytosine is a 5-methylcytosine.
135. The use of any one of claims 130-134, wherein the modified oligonucleotide comprises:
a gap segment consisting of linked deoxynucleosides;
a 5 ' wing segment consisting of linked nucleosides;
a 3 ' wing segment consisting linked nucleosides;
wherein the gap segment is positioned immediately adjacent to and between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
136. The use of any of claims 95-131 or 133-135, wherein the structure of the modified oligonucleotide is
Figure imgf000074_0001
(SEQ ID NO: 3) or a salt thereof.
137. The use of any of claims 95-136, wherein the oligomeric compound comprises a conjugate group.
138. The use of claim 137, wherein the conjugate group comprises GalNAc.
139. The use of claim 138, wherein the structure of the oligomeric compound is
Figure imgf000075_0001
(SEQ ID NO: 3) or a salt thereof.
140. The use of any of claims 95-139, wherein the oligomeric compound is an RNase H based antisense compound.
141. The use of any of claims 95-134 or 137-138, wherein the oligomeric compound is an RNAi antisense compound.
142. The use of any of claims 95-141, wherein the oligomeric compound is single -stranded.
143. The use of any of claims 95-141, wherein the oligomeric compound is paired with a second
oligomeric compound to form a duplex.
144. The use of claim 143, wherein the second oligomeric compound comprises an oligonucleotide and a conjugate group.
145. The method of any of claims 1-94, wherein the individual has at least fifty percent fewer average headaches per month, over the course of at least three months, than the average number of headaches the individual had over the course of the one to three months prior to administering or contacting the cell with the oligomeric compound.
146. The use of any of claims 95-144, wherein the average number of headaches per month is reduced by at least fifty percent over the course of at least three months compared to the average number of headaches over the course of the one to three months prior to use of the oligomeric compound.
147. The method of any of claims 13-94 or 145, wherein the individual is identified as having migraine.
148. The method of any of claims 13-94 or 145, wherein the individual has migraine.
149. The method of any of claims 13-94 or 145, wherein the individual is identified as at risk of having migraine.
150. The method of any of claims 13-94 or 145, wherein the individual is at risk of having migraine.
151. The method of any of claims 147-150, wherein the migraine is chronic migraine.
152. The method of any of claims 1-94, 145, or 147-151, wherein the individual has, or is at risk of
having, hereditary angioedema.
153. The method of claims 1-94, 145, or 147-151, wherein the individual is identified as having, or at risk of having, hereditary angioedema.
154. The method of any of claims 1-94, 145, or 147-151, wherein the individual has hereditary
angioedema.
155. The method of any of claims 1-94, 145, or 147-151, wherein the individual is identified as having hereditary angioedema.
156. The method of any of claims 1-94, 145, or 147-151, wherein the individual is at risk of having
hereditary angioedema.
157. The method of any of claims 1-94, 145, or 147-151, wherein the individual is identified as at risk of having hereditary angioedema.
158. The method of any of claims 1-94, 145, or 147-151, wherein the individual does not have, and is not at risk of having, hereditary angioedema.
159. The method of any of claims 1-94, 145, or 147-151, wherein the individual is not identified as
having, nor at risk of having, hereditary angioedema.
160. The method of any of claims 1-94, 145, or 147-151, wherein the individual does not have hereditary angioedema.
161. The method of any of claims 1-94, 145, or 147-151, wherein the individual is not identified as having hereditary angioedema.
162. The method of any of claims 1-94, 145, or 147-151, wherein the individual is not at risk of having hereditary angioedema.
163. The method of any of claims 1-94, 145, or 147-151, wherein the individual is not identified as at risk of having hereditary angioedema.
164. The method or use of any of claims 1-163 comprising administering to the individual a chirally enriched population of the oligomeric compound, wherein the population is enriched for oligomeric compounds comprising at least one particular phorphorothioate intemucleoside linkage having a particular stereochemical configuration.
165. The method or use of claim 164, wherein the population is enriched for oligomeric compounds comprising at least one particular phorphorothioate intemucleoside linkage having the (<Sp) configuration.
166. The method or use of claim 164, wherein the population is enriched for oligomeric compounds comprising at least one particular phorphorothioate intemucleoside linkage having the (Rp) configuration.
167. The method or use of claim 164, wherein the population is enriched for oligomeric compounds having a particular, independently selected stereochemical configuration at each phosphorothioate intemucleoside linkage
168. The method or use of claim 167, wherein the population is enriched for oligomeric compounds having the (<Sp) configuration at each phosphorothioate intemucleoside linkage.
169. The method or use of claim 167, wherein the population is enriched for oligomeric compounds having the (Rp) configuration at each phosphorothioate intemucleoside linkage.
170. The method or use of claim 167, wherein the population is enriched for oligomeric compounds having the (Rp) configuration at one particular phosphorothioate intemucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate intemucleoside linkages.
171. The method or use of claim 164 or claim 167, wherein the population is enriched for oligomeric compounds having at least 3 contiguous phosphorothioate intemucleoside linkages in the Sp, Sp, and Rp configurations, in the 5 ' to 3 ' direction.
172. The method or use of any one of claims 1-163, wherein all of the intemucleoside linkages of the oligomeric compound are stereorandom.
PCT/US2018/017478 2017-02-08 2018-02-08 Modulation of kallikrein b1 (klkb1) for treatment of headache Ceased WO2018148449A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201762456520P 2017-02-08 2017-02-08
US62/456,520 2017-02-08

Publications (1)

Publication Number Publication Date
WO2018148449A1 true WO2018148449A1 (en) 2018-08-16

Family

ID=63107817

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2018/017478 Ceased WO2018148449A1 (en) 2017-02-08 2018-02-08 Modulation of kallikrein b1 (klkb1) for treatment of headache

Country Status (2)

Country Link
TW (1) TW201828952A (en)
WO (1) WO2018148449A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021183857A1 (en) * 2020-03-13 2021-09-16 Ionis Pharmaceuticals, Inc. Compositions and methods for treating and preventing prekallikrein-associated conditions

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070253949A1 (en) * 2004-02-03 2007-11-01 Stefan Golz Diagnostics and Therapeutics for Diseases Associated with Plasma Kallikrein (KLKB1)
US20110154517A1 (en) * 2007-10-22 2011-06-23 Georg Dewald Disorders of vasoregulation and methods of diagnosing them
US20140206745A1 (en) * 2011-06-29 2014-07-24 Isis Pharmaceuticals, Inc. Methods for modulating kallikrein (klkb1) expression

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070253949A1 (en) * 2004-02-03 2007-11-01 Stefan Golz Diagnostics and Therapeutics for Diseases Associated with Plasma Kallikrein (KLKB1)
US20110154517A1 (en) * 2007-10-22 2011-06-23 Georg Dewald Disorders of vasoregulation and methods of diagnosing them
US20140206745A1 (en) * 2011-06-29 2014-07-24 Isis Pharmaceuticals, Inc. Methods for modulating kallikrein (klkb1) expression

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021183857A1 (en) * 2020-03-13 2021-09-16 Ionis Pharmaceuticals, Inc. Compositions and methods for treating and preventing prekallikrein-associated conditions

Also Published As

Publication number Publication date
TW201828952A (en) 2018-08-16

Similar Documents

Publication Publication Date Title
CA3038891C (en) Compounds and methods for reducing tau expression
US11434488B2 (en) Compounds and methods for reducing ATXN3 expression
US20220081689A1 (en) Compounds and Methods for Use in Dystrophin Transcript
US20260115222A1 (en) Compounds and Methods for Reducing ATXN3 Expression
WO2020023737A1 (en) Compounds and methods for reducing atxn2 expression
WO2022246251A2 (en) Compounds for modulating unc13a expression
WO2020172559A1 (en) Compounds and methods for reducing atxn3 expression
EP3397288A1 (en) Methods for reducing ataxin-2 expression
EP3938514A1 (en) Compounds and methods for reducing kcnt1 expression
CA3006599A1 (en) Methods for reducing lrrk2 expression
US12180479B2 (en) Compounds and methods for modulating ATXN1
WO2022246204A2 (en) Compounds for reducing ptbp1 expression
EP3956450B1 (en) Compounds and methods for modulating gfap
WO2018148449A1 (en) Modulation of kallikrein b1 (klkb1) for treatment of headache
CA3205040A1 (en) Compounds and methods for modulating factor xii
EP4222261A1 (en) Compounds for modulating chmp7
WO2021178769A1 (en) Compounds and methods for modulating kcnq2
HK40120557A (en) Compounds and methods for modulating angiotensinogen expression
WO2023073661A2 (en) Compounds and methods for reducing psd3 expression
US20250340874A1 (en) Compounds and methods for reducing pcdh19 expression
HK40116398A (en) Compounds and methods for reducing snca expression

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18750715

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18750715

Country of ref document: EP

Kind code of ref document: A1