WO2018148186A1 - Eimeria tenella elongation factor-1 alpha recombinant immunogenic compositions which induce active protective immunity against avian coccidiosis - Google Patents

Eimeria tenella elongation factor-1 alpha recombinant immunogenic compositions which induce active protective immunity against avian coccidiosis Download PDF

Info

Publication number
WO2018148186A1
WO2018148186A1 PCT/US2018/017006 US2018017006W WO2018148186A1 WO 2018148186 A1 WO2018148186 A1 WO 2018148186A1 US 2018017006 W US2018017006 W US 2018017006W WO 2018148186 A1 WO2018148186 A1 WO 2018148186A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
immunogenic composition
seq
recombinant
vaccine
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2018/017006
Other languages
French (fr)
Inventor
Hyun S. Lillehoj
Sungtaek OH
Alfredo PANEBRA
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
US Department of Agriculture USDA
Original Assignee
US Department of Agriculture USDA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by US Department of Agriculture USDA filed Critical US Department of Agriculture USDA
Publication of WO2018148186A1 publication Critical patent/WO2018148186A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70Vectors or expression systems specially adapted for E. coli
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00Antiparasitic agents
    • A61P33/02Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/002Protozoa antigens
    • A61K39/012Coccidia antigens
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/44Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from protozoa
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/44Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from protozoa
    • C07K14/455Eimeria
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/52Bacterial cells; Fungal cells; Protozoal cells
    • A61K2039/522Bacterial cells; Fungal cells; Protozoal cells avirulent or attenuated
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/55Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
    • A61K2039/552Veterinary vaccine

Definitions

  • the subject matter disclosed herein provides immunogenic compositions containing recombinant proteins capable of presenting all, or antigenic portions of, the Eimeria tenella Elongation Factor 1 alpha, or EF-la, protein to a recipient, such as poultry.
  • the immunogenic compositions are capable of inducing active immunity to, and control of, coccidiosis.
  • methodologies of using the immunogenic compositions for administration to poultry and other animals in the control of coccidiosis are also provided.
  • the EF-la protein utilized in the immunogenic compositions presented herein is molecularly manipulated or combined with adjuvants to increase effectiveness.
  • live vaccines are not widely used, most likely due to the risk of unintended infection, and inconsistent immunity development causes by many different clinical factors such as climate and management (Wu et al., supra). Additionally, live coccidiosis vaccines consist of multiple different species of Eimeria, even different strains in some species of Eimeria spp. to account for the varied immunogenicity (Smith et al., Infect. Immun. (2002) 70:2472-9; Allen et al., Parasitol. Res.
  • the phylum Apicomplexa which includes species of the genus Eimeria, comprises obligate intracellular parasites that infect vertebrates. All invasive forms of Apicomplexans (referred as zoites) including Cryptosporidium spp., possess a unique complex of organelles located at the anterior end of the organism (the apical complex).
  • the apical complex comprises rhoptries, micronemes, dense granules, and an apical assembly of cytoskeleton-associated structures such as the conoid, polar/apical rings, and microtubular protrusions.
  • the apical complex of zoites of Cryptosporidium spp. (Lumb et al., Parasitol. Res. (1988) 74:531-6; Hamer et al., Infect. Immun. (1994) 62:2208-13; Riggs et al., Infect. Immun. (1999) 67: 1317-22;
  • Elongation Factor-la (“EF-la”) is highly conserved and ubiquitously expressed in all eukaryotic cells (Riis et al., Trends Biochem. Sci. (1990) 15:420-4). Previous studies have revealed that EF-la regulates protein synthesis and plays an important role in the progress of invasion of host- cells by Apicomplexan parasites (Abrahamsen et al., Mol. Biochem. Parasitol. (1993) 57: 1-14; Amiruddin et al., BMC Genomics (2012) 13:21; Matsubayashi et al., J. Biol. Chem. (2013) 288:34111-20).
  • avian coccidiosis is caused by multiple different species of the genus Eimeria, which are antigenically distinct and have complex life cycles, thus the identification and application of more and highly conserved protective epitopes will be helpful for the control of different Eimeria species.
  • the present disclosure provides an immunogenic composition, comprising an isolated Eimeria tenella EF-la protein (SEQ ID NO: 2), an isolated protein having at least 95% homology to Eimeria tenella EF-la (SEQ ID NO: 2), or an isolated protein comprising an antigenic portion of Eimeria tenella EF-la (SEQ ID NO: 2), and a pharmaceutically or veterinarily acceptable carrier wherein the immunogenic composition is capable of inducing an immune response to said isolated protein in a recipient.
  • the immunogenic compositions disclosed herein comprise an adjuvant, such as ISA 71.
  • the isolated Eimeria tenella EF-la protein is expressed by a recombinant host cell comprising an exogenous nucleic acid encoding the isolated protein, such as a recombinant Escherichia coli cell.
  • the carrier is a liquid carrier. Immunogenic compositions of the present invention can be formulated for parenteral, intramuscular, or oral delivery.
  • Also provided herein is a method of protecting a recipient against coccidiosis, comprising administering to the recipient an immunogenic composition comprising an isolated Eimeria tenella EF-la protein (SEQ ID NO: 2), an isolated protein having at least 95% homology to Eimeria tenella EF-la (SEQ ID NO: 2), or an isolated protein comprising an antigenic portion of Eimeria tenella EF-la (SEQ ID NO: 2) in an amount effective to induce a protective immune response to an Eimeria species.
  • an adjuvant can also be administered to the recipient.
  • the protective immune response is to E. tenella, E. maxima, or E. acervulina.
  • the recipient is a poultry species, such as chickens or turkeys.
  • the immunogenic composition is administered to the recipient at a dose of at least 50 ⁇ g of recombinant Eimeria tenella EF-la.
  • immunogenic compositions of the present invention are administered parenterally, intramuscularly or orally.
  • immunogenic compositions produced by the steps of: 1) culturing a recombinant host cell transformed with a gene encoding Eimeria tenella EF-la (e.g., SEQ ID NO: 1), a DNA sequence encoding a protein having at least 95% homology to Eimeria tenella EF-la (as compared to SEQ ID NO: 2), or a DNA sequence encoding a protein comprising an antigenic portion of Eimeria tenella EF-la (SEQ ID NO:2); 2) expressing the protein encoded by the recombinant DNA; 3) purifying the protein produced; and 4)
  • the purified protein in or on a pharmacologically or veterinarily acceptable carrier.
  • an adjuvant such as ISA 71 is also incorporated.
  • the host cell expressing the protein is a bacterial cell, such as an Escherichia coli cell.
  • Figure 1 provides a schematic outline of experimental designs detailed herein.
  • Figure 2 provides an image of agarose gel electrophoresis of a PCR product of the EF-la coding sequence from E. tenella.
  • Figure 3 provides an image of Western blot analysis of recombinant EF-la protein.
  • the lanes are as follows: M - Marker; Lane 1 - supernatant of cell lysate with overnight induction at 15°C; Lane 2 - supernatant of cell lysate with 4 hour induction at 37°C.
  • Figures 4A and 4B provide graphs showing the effects of vaccination with recombinant EF-la protein on body weight gain from Trial 1 and Trial 2.
  • Figure 4A shows results from experimental infection with E. tenella.
  • Figure 4B shows results from experimental infection with E. maxima.
  • Figures 5A and 5B provide graphs showing the effects of vaccination with recombinant EFla protein on fecal oocyst shedding from Trial 1.
  • Figure 5A shows results from experimental infection with E. tenella.
  • Figure 5B shows results from experimental infection with E. maxima.
  • Figures 6A and 6B provide graphs showing the effects of vaccination with recombinant EF-la on serum IgG antibody levels during experimental avian coccidiosis.
  • Figure 6A shows results from experimental infection with E. tenella.
  • Figure 6B shows results from experimental infection with E. maxima.
  • the EF-la genomic sequence was amplified from E. tenella DNA, and found to contain one intron. After removing the intron, the E. tenella EF-la coding sequence was cloned into the pET32a(+) plasmid vector and confirmed by sequencing. The recombinant EF-la protein was detected by SDS-PAGE and Western blot as expected. Then the immune protection it induced in chicken was evaluated and 1 x 10 4 sporulated oocysts of E. tenella, E. acervulina or E. maxima were used for challenging infections.
  • Standard reference literature teaching general methodologies and principles of fungal genetics useful for selected aspects of the invention include: Sherman et al. "Laboratory Course Manual Methods in Yeast Genetics", Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1986 and Guthrie et al., "Guide to Yeast Genetics and Molecular Biology", Academic, New York, 1991. [0025] Any suitable materials and/or methods known to those of skill can be utilized in carrying out the instant invention. Materials and/or methods for practicing the instant invention are described. Materials, reagents and the like to which reference is made in the following description and examples are obtainable from commercial sources, unless otherwise noted.
  • nucleic acid or protein consisting essentially of, and grammatical variations thereof, means: 1) nucleic acids that differ from a reference sequence by 20 or fewer nucleic acid residues and also perform the function of the reference nucleic acid sequence, and 2) proteins that differ from a reference sequence by 10 or fewer nucleic acids and also perform the function of the reference protein sequence.
  • variants include sequences which are shorter or longer than the reference sequence, have different residues or amino acids at particular positions, or a combination thereof.
  • Elongation Factor 1 alpha are synonyms and refer to the protein defined herein as SEQ ID NO: 2 and encoded by the DNA of SEQ ID NO: 1 (or any version of SEQ ID NO: 1 with base substitutions that result in a protein with a sequence identical to SEQ ID NO: 2). These terms also refer to modified versions of these SEQ ID NOs, such as those comprising regulatory nucleic acids, or proteins (and the nucleic acids encoding them) containing additional moieties allowing for purification or immunogenicity-enhancement.
  • these terms can also include antigenic sub-portions of the provided protein sequence(s).
  • poultry refers to one bird, or a group of birds, of any type of domesticated birds typically kept for egg and/or meat production.
  • poultry includes chickens, ducks, turkeys, geese, bantams, quail, pheasant, pigeons, or the like, preferably commercially important poultry such as chickens, ducks, geese and turkeys.
  • isolated refers to material that is substantially, or essentially, free from components that normally accompany the referenced material in its native state.
  • An isolated nucleic acid is a nucleic acid the structure of which is not identical to that of any naturally occurring nucleic acid.
  • the term therefore covers, for example, (a) a DNA which has the sequence of part of a naturally occurring genomic DNA molecule but is not flanked by both of the coding or noncoding sequences that flank that part of the molecule in the genome of the organism in which it naturally occurs; (b) a nucleic acid incorporated into a vector or into the genomic DNA of a prokaryote or eukaryote in a manner such that the resulting molecule is not identical to any naturally occurring vector or genomic DNA; (c) a separate molecule such as a cDNA, a genomic fragment, a fragment produced by polymerase chain reaction (PCR), or a restriction fragment; and (d) a recombinant nucleotide sequence that is part of a hybrid gene, i.e., a gene encoding a fusion protein.
  • PCR polymerase chain reaction
  • nucleic acids present in mixtures of (i) DNA molecules, (ii) transformed or transfected cells, and (iii) cell clones, e.g., as these occur in a DNA library such as a cDNA or genomic DNA library.
  • recombinant nucleic acids refers to polynucleotides which are made by the combination of two otherwise separated segments of sequence accomplished by the artificial manipulation of isolated segments of polynucleotides by genetic engineering techniques or by chemical synthesis. In so doing one may join together polynucleotide segments of desired functions to generate a desired combination of functions.
  • a host cell producing the immunogenic protein of the immunogenic compositions (e.g., EF-la protein).
  • a host cell is E. coli.
  • Such modification can involve deletion of all or a portion of a target gene, including but not limited to the open reading frame of a target locus, transcriptional regulators such as promoters of a target locus, and any other regulatory nucleic acid sequences positioned 5' or 3' from the open reading frame.
  • Such deletional mutations can be achieved using any technique known to those of skill in the art.
  • Mutational, insertional, and deletional variants of the disclosed nucleotide sequences and genes can be readily prepared by methods which are well known to those skilled in the art. It is well within the skill of a person trained in this art to make mutational, insertional, and deletional mutations which are equivalent in function to the specific ones disclosed herein.
  • DNA constructs prepared for introduction into a prokaryotic or eukaryotic host will typically comprise a replication system (i.e. vector) recognized by the host, including the intended DNA fragment encoding a desired polypeptide, and can also include transcription and translational initiation regulatory sequences operably linked to the polypeptide-encoding segment.
  • a replication system i.e. vector
  • Expression systems can include, for example, an origin of replication or autonomously replicating sequence (ARS) and expression control sequences, a promoter, an enhancer and necessary processing information sites, such as ribo some-binding sites, RNA splice sites, polyadenylation sites, transcriptional terminator sequences, and mRNA stabilizing sequences.
  • Signal peptides can also be included where appropriate from secreted polypeptides of the same or related species, which allow the protein to cross and/or lodge in cell membranes, cell wall, or be secreted from the cell.
  • Selectable markers useful in practicing the methodologies of the invention disclosed herein can be positive selectable markers.
  • positive selection refers to the case in which a genetically altered cell can survive in the presence of a toxic substance only if the recombinant polynucleotide of interest is present within the cell.
  • Negative selectable markers and screenable markers are also well known in the art and are contemplated by the present invention. One of skill in the art will recognize that any relevant markers available can be utilized in practicing the inventions disclosed herein.
  • Screening and molecular analysis of recombinant strains of the present invention can be performed utilizing nucleic acid hybridization techniques.
  • Hybridization procedures are useful for identifying polynucleotides, such as those modified using the techniques described herein, with sufficient homology to the subject regulatory sequences to be useful as taught herein.
  • the particular hybridization techniques are not essential to the subject invention. As improvements are made in hybridization techniques, they can be readily applied by one of skill in the art.
  • Hybridization probes can be labeled with any appropriate label known to those of skill in the art.
  • Hybridization conditions and washing conditions for example temperature and salt
  • concentration can be altered to change the stringency of the detection threshold. See, e.g., Sambrook et al. (1989) vide infra or Ausubel et al. (1995) Current Protocols in Molecular Biology, John Wiley & Sons, NY, N.Y., for further guidance on hybridization conditions.
  • PCR Polymerase Chain Reaction
  • PCR is a repetitive, enzymatic, primed synthesis of a nucleic acid sequence. This procedure is well known and commonly used by those skilled in this art (see Mullis, U.S. Pat. Nos. 4,683,195, 4,683,202, and 4,800,159; Saiki et al. (1985) Science 230: 1350-1354). PCR is based on the enzymatic amplification of a DNA fragment of interest that is flanked by two oligonucleotide primers that hybridize to opposite strands of the target sequence.
  • the primers are oriented with the 3 ' ends pointing towards each other. Repeated cycles of heat denaturation of the template, annealing of the primers to their complementary sequences, and extension of the annealed primers with a DNA polymerase result in the amplification of the segment defined by the 5' ends of the PCR primers. Since the extension product of each primer can serve as a template for the other primer, each cycle essentially doubles the amount of DNA template produced in the previous cycle. This results in the exponential accumulation of the specific target fragment, up to several million-fold in a few hours.
  • a thermostable DNA polymerase such as the Taq polymerase, which is isolated from the thermophilic bacterium Thermus aquaticus, the amplification process can be completely automated. Other enzymes which can be used are known to those skilled in the art.
  • Nucleic acids and proteins of the present invention can also encompass homologues of the specifically disclosed sequences. Homology can be 50%-100%. In some instances, such homology is greater than 80%, greater than 85%, greater than 90%, or greater than 95%. The degree of homology or identity needed for any intended use of the sequence(s) is readily identified by one of skill in the art. As used herein percent sequence identity of two nucleic acids is determined using an algorithm known in the art, such as that disclosed by Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264-2268, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877.
  • Preferred host cells are members of the genus Escherichia, especially E. coli.
  • any suitable bacterial, protist, animal or fungal host capable of expressing the described proteins can be utilized.
  • Even more preferably, non-pathogenic and non-toxigenic strains of such host cells are utilized in practicing embodiments of the disclosed inventions. Examples of workable combinations of cell lines and expression vectors are described in Sambrook et al. (1989);
  • Recombinant host cells in the present context, are those which have been genetically modified to contain an isolated nucleic molecule, or produce a recombinant protein, of the instant invention.
  • the nucleic acid(s) encoding the protein(s) of the present invention can be introduced by any means known to the art which is appropriate for the particular type of cell, including without limitation, transformation, lipofection, electroporation or any other methodology known by those skilled in the art.
  • An immunogenic composition is defined herein as a biological agent which is capable of providing a protective response in an animal to which the immunogenic composition has been delivered and is incapable of causing severe disease.
  • Administration of the immunogenic compositions result in increased immunity to a disease; the immunogenic compositions stimulate antibody production, cellular immunity, or both against the pathogen causing the disease.
  • Immunity is defined herein as the induction of a significantly higher level of protection in a population of recipients, such as poultry, against mortality and clinical symptoms after receipt of an immunogenic composition compared to an untreated group.
  • the immunogenic composition(s) according to the invention can: (a) protect a large proportion of treated animals against the occurrence of clinical symptoms of the disease and mortality, or; (b) result in a significant decrease in clinical symptoms of the disease and mortality.
  • the immunogenic composition(s) of the invention herein comprise a recombinant EF- la protein from E. tenella.
  • EF- la proteins of the present invention can comprise the entirety of SEQ ID NO: 2, or antigenic portions thereof.
  • EF-la proteins of the present invention can also include those with 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher homology to the protein of SEQ ID NO: 2.
  • immunogenic ally effective amounts of immunogenic compositions disclosed herein can vary based upon multiple parameters. In general, however, effective amounts per dosage unit can be about 10-200 ⁇ g recombinant EF-la protein, about 20-150 ⁇ g recombinant EF-la protein, or about 50-100 ⁇ g recombinant EF-la protein.
  • An individual dose can contain 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250 or more ⁇ g of recombinant EF- la protein per dose. These amounts can also include antigenic portions of the full length EF- la protein.
  • One, two, or more dosage units can be utilized in practicing the methodologies of the present invention. If two dosage units are selected, then vaccination at about day 1 post-hatch and again at about one week to two weeks of age is preferred. A dosage unit can readily be modified to fit a desired volume or mass by one of skill in the art. Regardless of the dosage unit parameters, immunogenic compositions disclosed herein can be administered in an amount effective to produce an immune response to the presented antigen (e.g., EF- la protein).
  • the presented antigen e.g., EF- la protein
  • an “immunogenic ally effective amount” or “effective amount” of an immunogenic composition as used herein is an amount of the composition that provides sufficient levels of antigenic protein to produce a desired result, such as induction of, or increase in, production of antibody specific to the antigen, protection against coccidiosis, as evidenced by a reduction in gastrointestinal lesions, increased weight gain, and decreased oocyst shedding and other indicators of reduction in pathogenesis. Amounts of immunogenic compositions capable of inducing such effects are referred to as an effective amount, or immunogenically effective amount, of the immunogenic compositions.
  • Dosage levels of active ingredients (e.g., EF- la protein) in immunogenic compositions disclosed herein, can be varied by one of skill in the art to achieve a desired result in a subject or per application. As such, a selected dosage level can depend upon a variety of factors including, but not limited to, formulation, combination with other treatments, severity of a pre-existing condition, and the presence or absence of adjuvants.
  • a minimal dose of an immunogenic composition is administered.
  • minimal dose or “minimal effective dose” refers to a dose that demonstrates the absence of, or minimal presence of, toxicity to the recipient, but still results in producing a desired result (e.g., protective immunity).
  • Minimal effective doses, or minimum immunizing doses, of the recombinant immunogenic compositions provided herein can include about 10-200 ⁇ g recombinant EF-la protein, about 20-150 ⁇ g recombinant EF-la protein, or about 50-100 ⁇ g recombinant EF-la protein.
  • the minimal effective doses can also be any dose within the range of 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250 or more ⁇ g of recombinant EF-la protein per dose. These amounts can also include antigenic portions of the full length EF-la protein. Determination of a minimal dose is well within the capabilities of one skilled in the art.
  • immunogenic compositions of the present invention also contain or comprise one or more adjuvants, which includes any material included in the immunogenic composition formulation that enhances an immune response in the recipient that is induced by the immunogenic composition.
  • adjuvants can include proteins other components included with the antigenic protein (e.g., EF-la protein).
  • Non-limiting examples of such adjuvants can include engineered proteins in which the (e.g., EF-la protein) is expressed as a fusion protein operably linked with immunity-enhancing moieties.
  • adjuvants can be included as an extra component of the immunogenic compositions, and include such categories as aluminum salts (alum), oil emulsions, saponins, immune-stimulating complexes (ISCOMs), liposomes, microparticles, nonionic block copolymers, derivatized polysaccharides, cytokines, and a wide variety of bacterial derivatives.
  • adjuvants can include, for example, ISA 71, IMS 1313, immuno stimulating complex, AB5 toxins (e.g., cholera toxin), E.
  • coli heat labile toxin monophosphoryl lipid A, flagellin, c-di-GMP, inflammatory cytokines, chemokines, definsins, chitosan, phytochemicals, and combinations of these.
  • Any relevant adjuvant known in the art can be utilized in practicing the inventions disclosed herein. Factors influencing the selection of an adjuvant include animal species, specific pathogen, antigen, route of
  • Immunogenic compositions of the present invention can also comprise pharmaceutically or veterinarily acceptable carriers in addition to the recombinant protein component.
  • Carriers utilized in practicing the immunogenic compositions provided herein can be any known in the art and can be liquid, solid, semi-solid, or gel. The type of formulation can be modified depending on the route of administration of the antigen. For example, if the immunogenic compositions of the present invention are applied parenterally (intramuscularly, intravascularly, or
  • a liquid formulation - such as an emulsion, suspension, or solution - is preferred.
  • the vaccines of the present invention can be applied to carriers such as pellets, tablets, kibbles, chewables, powders and beads, as well as specific materials such as microcrystalline cellulose (MCC), plant-based products and soil-based products (e.g., clays).
  • carriers are non-toxic to the recipient.
  • the immunogenic compositions of the present invention, with or without carriers can be presented to a recipient for ingestion via suspension in drinking water.
  • a recipient animals such as poultry.
  • targets e.g., poultry
  • the compositions provided herein can be utilized to induce immunity to Eimeria species (e.g., E. tenella) and more generally, the disease coccidiosis in targets to which the antigen is provided.
  • An immunogenic composition of the present invention can be administered
  • an immunogenic composition to a subject can result in the development of immunity to the EF-la protein, preferably development of an effective immune response that results in the decrease or removal of clinical symptoms.
  • Application of the immunogenic compositions of the present invention can be provided at multiple times or in a single dosage.
  • Application of the immunogenic compositions provided herein to poultry can occur for the first time about day 1 post-hatch or any time thereafter. Application can be performed before, during or after the development of Eimeria-caused coccidiosis, including coccidiosis caused by E. tenella, E. maxima, E.
  • Chickens were immunized twice with PBS (Control), rEF-la protein alone or with rEF-la protein/ISA 71 at 1 and 7 days post-hatch subcutaneously, and infected with Eimeria sp. (E. tenella or E. maxima) at 7 days post-secondary immunization.
  • the EFla sequence (containing an intron) amplified by PCR from E. tenella DNA was ⁇ 1800 bp in length and consists of 450 amino acids (49,101.54 daltons) (data not shown).
  • the PCR product representing the coding sequence of EFla (Fig.2, ⁇ 1400 bp) was cloned into T vector (Invitrogen, USA), and then subcloned into pET32a(+) expression vector and sequenced.
  • the nucleotide sequence (SEQ ID NO: 1) was identical to the published E. tenella EF-la sequence (GenBank accession no. JN987661).
  • the expression of recombinant proteins containing an His6 epitope tag (615 amino acids) with estimated molecular weight of 66,804.1 was detected by SDS-acrylamide gel and showed mainly in the inclusion body form.
  • the protein expression was further confirmed by Western blotting using a monoclonal antibody (anti-His monoclonal- antibody (Genscript, Cat.No. A00186)) against the His epitope tag (Fig. 3).
  • E. tenella The purified oocysts of E. tenella were washed in phosphate buffered saline (PBS), disrupted in glass beads, and the total genomic DNA was extracted using the sodium dodecyl sulphate/proteinase K, followed by phenol/chloroform method. The purity of E. tenella was confirmed by specific PCR as previously described (Fernandez et al., Parasitol. (2003) 127:317- 25). The sequence of E. tenella EF-la gene (containing an intron) was amplified by PCR from genomic DNA of E.
  • PBS phosphate buffered saline
  • tenella with a pair of oligonucleotide primers (EF-laF: 5'- TGCTGGATCCATGGGGAAGGAAAAG -3' (SEQ ID NO: 3), and EF-laR: 5'- CACAAAGCTTGTCACTTCTTGGCG -3' (SEQ ID NO: 4)), and BamH I and Hindlll recognition sites were introduced (underlined sequences).
  • the PCR product was cloned into T plasmid vector (TOPO® TA Cloning® Kit, Invitrogen, USA) and sequenced in both directions.
  • TCTCCAAGGAAGGGCAGACGCGGGAAC /EFlaR (SEQ ID NO: 6)) using PfuUltra II fusion HS DNA Polymerase (Agilent Technologies Inc., USA).
  • the EF-la PCR product (without intron) was cloned and sequenced to ensure fidelity. Then the coding sequence of EF- la was cleaved using BamH I / Hindlll from recombinant T ET-EF- la plasmid expression vector and cloned into the pET32a(+) plasmid vector (Novagen/EMD Chemicals, Gibbstown, NJ) downstream from an NH2-teminal His6 epitope tag. The recombinant plasmid clones of pET-EFla were verified by sequence analysis.
  • the recombinant plasmid pET-EF-la was used to transform E. coli BL21(DE3), induced for 4 h with 1 mM J TG at 37°C and 15°C, and the cells harvested by centrifugation and sonication. The lysate was applied to Ni- NTA resin and Filter Column (HITrap ® , GE
  • Fecal samples were collected from infected birds between 6 and 9 days (for E. tenella; Figure 5A), or between 6 and 8 (for E. maxima; Figure 5B) post-infection and oocysts were enumerated using a McMaster counting chamber as described (Ding et al., Infect. Immun. (2004) 72:6939-44). Two independent people counted oocysts.
  • Trial 1 chickens were subcutaneously immunized twice with 50 or 100 ug of EFla. At 7 days post-secondary immunization, the animals were uninfected or infected with 1.0 x 10 4 E. tenella parasites.
  • Trial 2 chickens were subcutaneously immunized twice with 100 ug of rEF-la. At 7 days post- secondary immunization, the animals were uninfected or infected with 1.0 x 10 4 E. maxima parasites. Serum IgG antibody levels were measured by ELISA at 9 days post-infection for Trial 1 and 8 days post-infection for Trial 2.
  • Serum IgG antibody levels against rEF-la protein were measured by an indirect enzyme- linked immunosorbent assay (ELISA) as described (Lee et al., Res. Vet. Sci. (2013) 95: 110-14).
  • ELISA enzyme- linked immunosorbent assay
  • PBS-T PBS containing 0.05% Tween 20
  • Serum samples were diluted 1:50, lOOul was added to each well, incubated with agitation for 1 h at room temperature, and washed with PBS-T. Bound antibodies were detected with peroxidase-conjugated rabbit anti-chicken IgG secondary antibody and
  • tetramethylbenzidine substrate (Sigma, St. Louis, MO).
  • Optical densities (OD) were measured using a microplate spectrophotometer (ELx800TM, BioTek, Winooski, VT).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Engineering & Computer Science (AREA)
  • Public Health (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Provided herein are immunogenic compositions containing recombinant proteins capable of presenting all, or antigenic portions of, the Eimeria tenella Elongation Factor 1 alpha, or EF-1α, protein in the development of active immunity to, and control of, coccidiosis. Also provided are methodologies of using the immunogenic compositions for administration to poultry and other animals in the control of coccidiosis. In some instances, the EF-1α protein utilized in the immunogenic composition presented herein is molecularly manipulated or combined with adjuvants to increase effectiveness.

Description

EIMERIA TENELLA ELONGATION FACTOR- 1 ALPHA RECOMBINANT IMMUNOGENIC COMPOSITIONS WHICH INDUCE ACTIVE PROTECTIVE IMMUNITY AGAINST AVIAN COCCIDIOSIS
BACKGROUND OF THE INVENTION
[0001] Field of Invention
[0002] The subject matter disclosed herein provides immunogenic compositions containing recombinant proteins capable of presenting all, or antigenic portions of, the Eimeria tenella Elongation Factor 1 alpha, or EF-la, protein to a recipient, such as poultry. The immunogenic compositions are capable of inducing active immunity to, and control of, coccidiosis. Also provided are methodologies of using the immunogenic compositions for administration to poultry and other animals in the control of coccidiosis. In some instances, the EF-la protein utilized in the immunogenic compositions presented herein is molecularly manipulated or combined with adjuvants to increase effectiveness. [0003] Background
[0004] Avian coccidiosis is caused by multiple species of the genus Eimeria and imposes a great economic impact on poultry industry worldwide (Yin et al., Int. J. Parasitol. (2011) 41:813-6; Shirley et al., Avian Pathol. (2012) 41: 111-21; Wu et al., Avian Dis. (2014)58:367-72; Lillehoj et al., in "Intestinal Health: Key to Maximize Growth Performance in Livestock", ed. T. Niewold, (2015) pp. 71-116). Although traditionally, coccidiosis control was successful using prophylactic chemotherapy, increasing concerns with drug resistance, drug residue and the restricted governmental regulation on the use of drugs in agricultural animals hinder its application (Jeffers, J.K., in "Coccidia and Intestinal Coccidiomorphs", ed. P. Yvore (1989) pp 295-308; Lillehoj et al., Poultry Sci. (2007) 86: 1491-1500; Lin et al., Gene (2011) 480:28-33). Immunization is an effective and cost-effective method of preventing infection and a live coccidiosis vaccine has been used for more than 50 years. However, the live vaccine is not widely used, most likely due to the risk of unintended infection, and inconsistent immunity development causes by many different clinical factors such as climate and management (Wu et al., supra). Additionally, live coccidiosis vaccines consist of multiple different species of Eimeria, even different strains in some species of Eimeria spp. to account for the varied immunogenicity (Smith et al., Infect. Immun. (2002) 70:2472-9; Allen et al., Parasitol. Res.
(2005) 97: 179-85).
[0005] In recent years, induction of protective immunity using peptide vaccines has gained much interest with increasing technological advances in genetic engineering and protein expression (Shirley et al., supra; Lillehoj et al., supra). Immunogenic proteins from various stages of Eimeria have been tried with various levels of success and when combined with mucosal delivery adjuvants, or components that enhance cell-mediated immunity, significant protective immune responses that decrease negative consequences of coccidiosis were reported (Lillehoj et al., supra). However, there remains an inability to elicit optimal levels of protective response against multiple coccidia species due to their weak immunogenicity and poor/undetermined cross-protection against different species. Thus, many challenges still remain before peptide antigens can be applied in commercial poultry production (Jang et al., Vaccine (2010) 28:2980-5; Shirley et al., supra; Liu et al., Parasit. Vectors (2014) 7:27; Xu et al., Korean J. Parasitol. (2013) 51: 147-54).
[0006] The phylum Apicomplexa, which includes species of the genus Eimeria, comprises obligate intracellular parasites that infect vertebrates. All invasive forms of Apicomplexans (referred as zoites) including Cryptosporidium spp., possess a unique complex of organelles located at the anterior end of the organism (the apical complex). The apical complex comprises rhoptries, micronemes, dense granules, and an apical assembly of cytoskeleton-associated structures such as the conoid, polar/apical rings, and microtubular protrusions. The apical complex of zoites of Cryptosporidium spp. (Lumb et al., Parasitol. Res. (1988) 74:531-6; Hamer et al., Infect. Immun. (1994) 62:2208-13; Riggs et al., Infect. Immun. (1999) 67: 1317-22;
Schaefer et al., Infect. Immun. (2000) 68:2608-16) and other closely related Apicomplexans (Tomley et al., Mol. Biochem. Parasitol. (1996) 79: 195-206; Brown and Palmer, Parasitol.
Today (1999) 15:275-81; Carruthers et al., Cell. Microbiol. (1999) 1:225-35; Lovett et al., Mol. Biochem. Parasitol. (2000) 107:33-43; Hu et al., J. Cell Biol. (2002) 156: 1039-50) are involved in parasite attachment, invasion, and intracellular development. Thus, these organelles and their molecular constituents are thought to provide rational targets for immunological therapy or drug treatment to control infections by these parasites.
[0007] In Eimeria, very limited information on conserved proteins that elicit protective immune response against multiple species of Eimeria has been reported (Lillehoj et al., supra).
Elongation Factor-la ("EF-la") is highly conserved and ubiquitously expressed in all eukaryotic cells (Riis et al., Trends Biochem. Sci. (1990) 15:420-4). Previous studies have revealed that EF-la regulates protein synthesis and plays an important role in the progress of invasion of host- cells by Apicomplexan parasites (Abrahamsen et al., Mol. Biochem. Parasitol. (1993) 57: 1-14; Amiruddin et al., BMC Genomics (2012) 13:21; Matsubayashi et al., J. Biol. Chem. (2013) 288:34111-20).
[0008] Although immunogenic Eimeria proteins have yet to be proven in commercial applications against coccidiosis, recent studies on expressed recombinant proteins have shown various levels of protective immune response against Eimeria challenge with some examined parameters, which promoted the development of recombinant vaccines against coccidiosis (Jang et al., supra; Ding et al., Parasitol. Res. (2012) 110:2297-306; Liu et al., Parasitol. Res. (2013) 112:251-7; Zhao et al., Parasitol. Res. (2014) 113:3007-14). Usually, avian coccidiosis is caused by multiple different species of the genus Eimeria, which are antigenically distinct and have complex life cycles, thus the identification and application of more and highly conserved protective epitopes will be helpful for the control of different Eimeria species.
[0009] As described herein, we carried out experiments to clone the EF-la gene from E. tenella, express EF-la recombinant protein, and evaluate its immunogenicity and protective efficacy against E. tenella challenge infection in commercial broiler chickens. To do this, we constructed a prokaryotic plasmid pET-EFla, expressed and purified the rET-EFla and evaluated its efficacy against E. tenella or E. maxima. The results show that rEF-la from E. tenella can elicit cross protective immunity against other species of Eimeria.
SUMMARY OF THE INVENTION
[0010] Provided herein are multiple embodiments encompassing the inventions claimed. In one embodiment, the present disclosure provides an immunogenic composition, comprising an isolated Eimeria tenella EF-la protein (SEQ ID NO: 2), an isolated protein having at least 95% homology to Eimeria tenella EF-la (SEQ ID NO: 2), or an isolated protein comprising an antigenic portion of Eimeria tenella EF-la (SEQ ID NO: 2), and a pharmaceutically or veterinarily acceptable carrier wherein the immunogenic composition is capable of inducing an immune response to said isolated protein in a recipient. In some embodiments, the immunogenic compositions disclosed herein comprise an adjuvant, such as ISA 71. In other embodiments, the isolated Eimeria tenella EF-la protein is expressed by a recombinant host cell comprising an exogenous nucleic acid encoding the isolated protein, such as a recombinant Escherichia coli cell. In some embodiments, the carrier is a liquid carrier. Immunogenic compositions of the present invention can be formulated for parenteral, intramuscular, or oral delivery.
[0011] Also provided herein is a method of protecting a recipient against coccidiosis, comprising administering to the recipient an immunogenic composition comprising an isolated Eimeria tenella EF-la protein (SEQ ID NO: 2), an isolated protein having at least 95% homology to Eimeria tenella EF-la (SEQ ID NO: 2), or an isolated protein comprising an antigenic portion of Eimeria tenella EF-la (SEQ ID NO: 2) in an amount effective to induce a protective immune response to an Eimeria species. In practicing such methodologies, an adjuvant can also be administered to the recipient. In some embodiments, the protective immune response is to E. tenella, E. maxima, or E. acervulina. In particular embodiments, the recipient is a poultry species, such as chickens or turkeys. In other embodiments, the immunogenic composition is administered to the recipient at a dose of at least 50 μg of recombinant Eimeria tenella EF-la. In still other embodiments, immunogenic compositions of the present invention are administered parenterally, intramuscularly or orally.
[0012] Further provided herein are immunogenic compositions produced by the steps of: 1) culturing a recombinant host cell transformed with a gene encoding Eimeria tenella EF-la (e.g., SEQ ID NO: 1), a DNA sequence encoding a protein having at least 95% homology to Eimeria tenella EF-la (as compared to SEQ ID NO: 2), or a DNA sequence encoding a protein comprising an antigenic portion of Eimeria tenella EF-la (SEQ ID NO:2); 2) expressing the protein encoded by the recombinant DNA; 3) purifying the protein produced; and 4)
incorporating the purified protein in or on a pharmacologically or veterinarily acceptable carrier. In some embodiments, an adjuvant such as ISA 71 is also incorporated. In still other embodiments, the host cell expressing the protein is a bacterial cell, such as an Escherichia coli cell.
INCORPORATION BY REFERENCE
[0013] All publications, patents and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference.
BRIEF DESCRIPTION OF THE DRAWINGS
[0014] The novel features of the invention are set forth with particularity in the claims. Features and advantages of the present invention are referred to in the following detailed description, and the accompanying drawings of which:
[0015] Figure 1 provides a schematic outline of experimental designs detailed herein.
[0016] Figure 2 provides an image of agarose gel electrophoresis of a PCR product of the EF-la coding sequence from E. tenella.
[0017] Figure 3 provides an image of Western blot analysis of recombinant EF-la protein. The lanes are as follows: M - Marker; Lane 1 - supernatant of cell lysate with overnight induction at 15°C; Lane 2 - supernatant of cell lysate with 4 hour induction at 37°C.
[0018] Figures 4A and 4B provide graphs showing the effects of vaccination with recombinant EF-la protein on body weight gain from Trial 1 and Trial 2. Figure 4A shows results from experimental infection with E. tenella. Figure 4B shows results from experimental infection with E. maxima. [0019] Figures 5A and 5B provide graphs showing the effects of vaccination with recombinant EFla protein on fecal oocyst shedding from Trial 1. Figure 5A shows results from experimental infection with E. tenella. Figure 5B shows results from experimental infection with E. maxima.
[0020] Figures 6A and 6B provide graphs showing the effects of vaccination with recombinant EF-la on serum IgG antibody levels during experimental avian coccidiosis. Figure 6A shows results from experimental infection with E. tenella. Figure 6B shows results from experimental infection with E. maxima.
DETAILED DESCRIPTION OF THE INVENTION
[0021] As described herein, the EF-la genomic sequence was amplified from E. tenella DNA, and found to contain one intron. After removing the intron, the E. tenella EF-la coding sequence was cloned into the pET32a(+) plasmid vector and confirmed by sequencing. The recombinant EF-la protein was detected by SDS-PAGE and Western blot as expected. Then the immune protection it induced in chicken was evaluated and 1 x 104 sporulated oocysts of E. tenella, E. acervulina or E. maxima were used for challenging infections. In general, chickens immunized with rEF-la showed increased weight gains and reduced fecal oocyst shedding compared with non-vaccinated controls. When vaccinated only with EF-la, antigen- specific humoral antibodies were not found to be increased, however, the results showed ISA 71 adjuvant could significantly increase the IgG level against EF-la. The effect of ISA 71 adjuvant on enhancing immunization has also been demonstrated in other similar reports (Jang et al., supra; Jang et al., PLoS One (2013) 8:e59786).
[0022] Presented herein are evaluations of the immunization effects of rEF-la against E. tenella, or E. maxima challenge by measuring body weight gain, fecal oocyst shedding and antibody response. These result revealed rEF-la can induce a protective effect against different Eimeria
1 species, suggesting that EF-la should provide a promising immunogenic composition candidate against Eimeria infection.
[0023] Preferred embodiments of the present invention are shown and described herein. It will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will occur to those skilled in the art without departing from the invention. Various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the included claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents are covered thereby.
[0024] Technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art to which the instant invention pertains, unless otherwise defined. Reference is made herein to various materials and methodologies known to those of skill in the art. Standard reference works setting forth the general principles of recombinant DNA technology include Sambrook et al., "Molecular Cloning: A Laboratory Manual", 2d ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y., 1989; Kaufman et al., eds., "Handbook of Molecular and Cellular Methods in Biology and Medicine", CRC Press, Boca Raton, 1995; and McPherson, ed., "Directed Mutagenesis: A Practical Approach", IRL Press, Oxford, 1991. Standard reference literature teaching general methodologies and principles of fungal genetics useful for selected aspects of the invention include: Sherman et al. "Laboratory Course Manual Methods in Yeast Genetics", Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1986 and Guthrie et al., "Guide to Yeast Genetics and Molecular Biology", Academic, New York, 1991. [0025] Any suitable materials and/or methods known to those of skill can be utilized in carrying out the instant invention. Materials and/or methods for practicing the instant invention are described. Materials, reagents and the like to which reference is made in the following description and examples are obtainable from commercial sources, unless otherwise noted.
[0026] As used in the specification and claims, use of the singular "a", "an", and "the" include plural references unless the context clearly dictates otherwise.
[0027] The term "about" is defined as plus or minus ten percent of a recited value. For example, about l.Og means 0.9g to l.lg and all values within that range, whether specifically stated or not.
[0028] The term a nucleic acid or protein "consisting essentially of, and grammatical variations thereof, means: 1) nucleic acids that differ from a reference sequence by 20 or fewer nucleic acid residues and also perform the function of the reference nucleic acid sequence, and 2) proteins that differ from a reference sequence by 10 or fewer nucleic acids and also perform the function of the reference protein sequence. Such variants include sequences which are shorter or longer than the reference sequence, have different residues or amino acids at particular positions, or a combination thereof.
[0029] The term "comprising" as used herein will be understood to mean that the list following is non-exhaustive and may or may not include any other additional suitable items, for example one or more further feature(s), component(s) and/or ingredient(s) as appropriate.
[0030] The terms "EF-la" and "Elongation Factor 1 alpha" are synonyms and refer to the protein defined herein as SEQ ID NO: 2 and encoded by the DNA of SEQ ID NO: 1 (or any version of SEQ ID NO: 1 with base substitutions that result in a protein with a sequence identical to SEQ ID NO: 2). These terms also refer to modified versions of these SEQ ID NOs, such as those comprising regulatory nucleic acids, or proteins (and the nucleic acids encoding them) containing additional moieties allowing for purification or immunogenicity-enhancement.
Where indicated, these terms can also include antigenic sub-portions of the provided protein sequence(s).
[0031] As used herein, the term "poultry" refers to one bird, or a group of birds, of any type of domesticated birds typically kept for egg and/or meat production. For example, poultry includes chickens, ducks, turkeys, geese, bantams, quail, pheasant, pigeons, or the like, preferably commercially important poultry such as chickens, ducks, geese and turkeys.
[0032] The terms "isolated", "purified", or "biologically pure" as used herein, refer to material that is substantially, or essentially, free from components that normally accompany the referenced material in its native state.
Molecular Biological Methods
[0033] An isolated nucleic acid is a nucleic acid the structure of which is not identical to that of any naturally occurring nucleic acid. The term therefore covers, for example, (a) a DNA which has the sequence of part of a naturally occurring genomic DNA molecule but is not flanked by both of the coding or noncoding sequences that flank that part of the molecule in the genome of the organism in which it naturally occurs; (b) a nucleic acid incorporated into a vector or into the genomic DNA of a prokaryote or eukaryote in a manner such that the resulting molecule is not identical to any naturally occurring vector or genomic DNA; (c) a separate molecule such as a cDNA, a genomic fragment, a fragment produced by polymerase chain reaction (PCR), or a restriction fragment; and (d) a recombinant nucleotide sequence that is part of a hybrid gene, i.e., a gene encoding a fusion protein. Specifically excluded from this definition are nucleic acids present in mixtures of (i) DNA molecules, (ii) transformed or transfected cells, and (iii) cell clones, e.g., as these occur in a DNA library such as a cDNA or genomic DNA library. [0034] The term recombinant nucleic acids refers to polynucleotides which are made by the combination of two otherwise separated segments of sequence accomplished by the artificial manipulation of isolated segments of polynucleotides by genetic engineering techniques or by chemical synthesis. In so doing one may join together polynucleotide segments of desired functions to generate a desired combination of functions.
[0035] In practicing some embodiments of the invention disclosed herein, it can be useful to modify the genomic DNA of a recombinant strain of a host cell producing the immunogenic protein of the immunogenic compositions (e.g., EF-la protein). In preferred embodiments, such a host cell is E. coli. Such modification can involve deletion of all or a portion of a target gene, including but not limited to the open reading frame of a target locus, transcriptional regulators such as promoters of a target locus, and any other regulatory nucleic acid sequences positioned 5' or 3' from the open reading frame. Such deletional mutations can be achieved using any technique known to those of skill in the art. Mutational, insertional, and deletional variants of the disclosed nucleotide sequences and genes can be readily prepared by methods which are well known to those skilled in the art. It is well within the skill of a person trained in this art to make mutational, insertional, and deletional mutations which are equivalent in function to the specific ones disclosed herein.
[0036] Where a recombinant nucleic acid is intended for expression, cloning, or replication of a particular sequence, DNA constructs prepared for introduction into a prokaryotic or eukaryotic host will typically comprise a replication system (i.e. vector) recognized by the host, including the intended DNA fragment encoding a desired polypeptide, and can also include transcription and translational initiation regulatory sequences operably linked to the polypeptide-encoding segment. Expression systems (expression vectors) can include, for example, an origin of replication or autonomously replicating sequence (ARS) and expression control sequences, a promoter, an enhancer and necessary processing information sites, such as ribo some-binding sites, RNA splice sites, polyadenylation sites, transcriptional terminator sequences, and mRNA stabilizing sequences. Signal peptides can also be included where appropriate from secreted polypeptides of the same or related species, which allow the protein to cross and/or lodge in cell membranes, cell wall, or be secreted from the cell.
[0037] Selectable markers useful in practicing the methodologies of the invention disclosed herein can be positive selectable markers. Typically, positive selection refers to the case in which a genetically altered cell can survive in the presence of a toxic substance only if the recombinant polynucleotide of interest is present within the cell. Negative selectable markers and screenable markers are also well known in the art and are contemplated by the present invention. One of skill in the art will recognize that any relevant markers available can be utilized in practicing the inventions disclosed herein.
[0038] Screening and molecular analysis of recombinant strains of the present invention can be performed utilizing nucleic acid hybridization techniques. Hybridization procedures are useful for identifying polynucleotides, such as those modified using the techniques described herein, with sufficient homology to the subject regulatory sequences to be useful as taught herein. The particular hybridization techniques are not essential to the subject invention. As improvements are made in hybridization techniques, they can be readily applied by one of skill in the art.
Hybridization probes can be labeled with any appropriate label known to those of skill in the art. Hybridization conditions and washing conditions, for example temperature and salt
concentration, can be altered to change the stringency of the detection threshold. See, e.g., Sambrook et al. (1989) vide infra or Ausubel et al. (1995) Current Protocols in Molecular Biology, John Wiley & Sons, NY, N.Y., for further guidance on hybridization conditions.
[0039] Additionally, screening and molecular analysis of genetically altered strains, as well as creation of desired isolated nucleic acids can be performed using Polymerase Chain Reaction (PCR). PCR is a repetitive, enzymatic, primed synthesis of a nucleic acid sequence. This procedure is well known and commonly used by those skilled in this art (see Mullis, U.S. Pat. Nos. 4,683,195, 4,683,202, and 4,800,159; Saiki et al. (1985) Science 230: 1350-1354). PCR is based on the enzymatic amplification of a DNA fragment of interest that is flanked by two oligonucleotide primers that hybridize to opposite strands of the target sequence. The primers are oriented with the 3 ' ends pointing towards each other. Repeated cycles of heat denaturation of the template, annealing of the primers to their complementary sequences, and extension of the annealed primers with a DNA polymerase result in the amplification of the segment defined by the 5' ends of the PCR primers. Since the extension product of each primer can serve as a template for the other primer, each cycle essentially doubles the amount of DNA template produced in the previous cycle. This results in the exponential accumulation of the specific target fragment, up to several million-fold in a few hours. By using a thermostable DNA polymerase such as the Taq polymerase, which is isolated from the thermophilic bacterium Thermus aquaticus, the amplification process can be completely automated. Other enzymes which can be used are known to those skilled in the art.
[0040] Nucleic acids and proteins of the present invention can also encompass homologues of the specifically disclosed sequences. Homology can be 50%-100%. In some instances, such homology is greater than 80%, greater than 85%, greater than 90%, or greater than 95%. The degree of homology or identity needed for any intended use of the sequence(s) is readily identified by one of skill in the art. As used herein percent sequence identity of two nucleic acids is determined using an algorithm known in the art, such as that disclosed by Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264-2268, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877. Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul et al. (1990) J. Mol. Biol. 215:402-410. BLAST nucleotide searches are performed with the NBLAST program, score=100, wordlength=12, to obtain nucleotide sequences with the desired percent sequence identity. To obtain gapped alignments for comparison purposes, Gapped BLAST is used as described in Altschul et al. (1997) Nucl. Acids. Res. 25:3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (NBLAST and XBLAST) are used. See w w w .ncbi . nih . go v .
[0041] Preferred host cells are members of the genus Escherichia, especially E. coli. However, any suitable bacterial, protist, animal or fungal host capable of expressing the described proteins can be utilized. Even more preferably, non-pathogenic and non-toxigenic strains of such host cells are utilized in practicing embodiments of the disclosed inventions. Examples of workable combinations of cell lines and expression vectors are described in Sambrook et al. (1989);
Ausubel et al. (Eds.) (1995) Current Protocols in Molecular Biology, Greene Publishing and Wiley Interscience, New York; and Metzger et al. (1988) Nature, 334: 31-36. Recombinant host cells, in the present context, are those which have been genetically modified to contain an isolated nucleic molecule, or produce a recombinant protein, of the instant invention. The nucleic acid(s) encoding the protein(s) of the present invention can be introduced by any means known to the art which is appropriate for the particular type of cell, including without limitation, transformation, lipofection, electroporation or any other methodology known by those skilled in the art.
[0042] Immunogenic Compositions
[0043] An immunogenic composition is defined herein as a biological agent which is capable of providing a protective response in an animal to which the immunogenic composition has been delivered and is incapable of causing severe disease. Administration of the immunogenic compositions result in increased immunity to a disease; the immunogenic compositions stimulate antibody production, cellular immunity, or both against the pathogen causing the disease.
Immunity is defined herein as the induction of a significantly higher level of protection in a population of recipients, such as poultry, against mortality and clinical symptoms after receipt of an immunogenic composition compared to an untreated group. In particular, the immunogenic composition(s) according to the invention can: (a) protect a large proportion of treated animals against the occurrence of clinical symptoms of the disease and mortality, or; (b) result in a significant decrease in clinical symptoms of the disease and mortality.
[0044] The immunogenic composition(s) of the invention herein, regardless of other components included, comprise a recombinant EF- la protein from E. tenella. EF- la proteins of the present invention can comprise the entirety of SEQ ID NO: 2, or antigenic portions thereof. EF-la proteins of the present invention can also include those with 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher homology to the protein of SEQ ID NO: 2.
[0045] The immunogenic ally effective amounts of immunogenic compositions disclosed herein can vary based upon multiple parameters. In general, however, effective amounts per dosage unit can be about 10-200 μg recombinant EF-la protein, about 20-150 μg recombinant EF-la protein, or about 50-100 μg recombinant EF-la protein. An individual dose can contain 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250 or more μg of recombinant EF- la protein per dose. These amounts can also include antigenic portions of the full length EF- la protein.
[0046] One, two, or more dosage units can be utilized in practicing the methodologies of the present invention. If two dosage units are selected, then vaccination at about day 1 post-hatch and again at about one week to two weeks of age is preferred. A dosage unit can readily be modified to fit a desired volume or mass by one of skill in the art. Regardless of the dosage unit parameters, immunogenic compositions disclosed herein can be administered in an amount effective to produce an immune response to the presented antigen (e.g., EF- la protein). An "immunogenic ally effective amount" or "effective amount" of an immunogenic composition as used herein, is an amount of the composition that provides sufficient levels of antigenic protein to produce a desired result, such as induction of, or increase in, production of antibody specific to the antigen, protection against coccidiosis, as evidenced by a reduction in gastrointestinal lesions, increased weight gain, and decreased oocyst shedding and other indicators of reduction in pathogenesis. Amounts of immunogenic compositions capable of inducing such effects are referred to as an effective amount, or immunogenically effective amount, of the immunogenic compositions.
[0047] Dosage levels of active ingredients (e.g., EF- la protein) in immunogenic compositions disclosed herein, can be varied by one of skill in the art to achieve a desired result in a subject or per application. As such, a selected dosage level can depend upon a variety of factors including, but not limited to, formulation, combination with other treatments, severity of a pre-existing condition, and the presence or absence of adjuvants. In preferred embodiments, a minimal dose of an immunogenic composition is administered. As used herein, the term "minimal dose" or "minimal effective dose" refers to a dose that demonstrates the absence of, or minimal presence of, toxicity to the recipient, but still results in producing a desired result (e.g., protective immunity). Minimal effective doses, or minimum immunizing doses, of the recombinant immunogenic compositions provided herein can include about 10-200 μg recombinant EF-la protein, about 20-150 μg recombinant EF-la protein, or about 50-100 μg recombinant EF-la protein. The minimal effective doses can also be any dose within the range of 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250 or more μg of recombinant EF-la protein per dose. These amounts can also include antigenic portions of the full length EF-la protein. Determination of a minimal dose is well within the capabilities of one skilled in the art.
[0048] Formulations
[0049] In some instances, immunogenic compositions of the present invention also contain or comprise one or more adjuvants, which includes any material included in the immunogenic composition formulation that enhances an immune response in the recipient that is induced by the immunogenic composition. In some instances, such adjuvants can include proteins other components included with the antigenic protein (e.g., EF-la protein). Non-limiting examples of such adjuvants can include engineered proteins in which the (e.g., EF-la protein) is expressed as a fusion protein operably linked with immunity-enhancing moieties. Other adjuvants can be included as an extra component of the immunogenic compositions, and include such categories as aluminum salts (alum), oil emulsions, saponins, immune-stimulating complexes (ISCOMs), liposomes, microparticles, nonionic block copolymers, derivatized polysaccharides, cytokines, and a wide variety of bacterial derivatives. Such adjuvants can include, for example, ISA 71, IMS 1313, immuno stimulating complex, AB5 toxins (e.g., cholera toxin), E. coli heat labile toxin, monophosphoryl lipid A, flagellin, c-di-GMP, inflammatory cytokines, chemokines, definsins, chitosan, phytochemicals, and combinations of these. Any relevant adjuvant known in the art can be utilized in practicing the inventions disclosed herein. Factors influencing the selection of an adjuvant include animal species, specific pathogen, antigen, route of
immunization, and type of immunity needed and can be readily determined by one of skill in the art.
[0050] Immunogenic compositions of the present invention can also comprise pharmaceutically or veterinarily acceptable carriers in addition to the recombinant protein component. Carriers utilized in practicing the immunogenic compositions provided herein can be any known in the art and can be liquid, solid, semi-solid, or gel. The type of formulation can be modified depending on the route of administration of the antigen. For example, if the immunogenic compositions of the present invention are applied parenterally (intramuscularly, intravascularly, or
subcutaneously), a liquid formulation - such as an emulsion, suspension, or solution - is preferred. For oral administration, the vaccines of the present invention can be applied to carriers such as pellets, tablets, kibbles, chewables, powders and beads, as well as specific materials such as microcrystalline cellulose (MCC), plant-based products and soil-based products (e.g., clays). Preferably, carriers are non-toxic to the recipient. In some instances the immunogenic compositions of the present invention, with or without carriers, can be presented to a recipient for ingestion via suspension in drinking water. One of skill in the art is readily able to choose such carriers for application to recipient animals such as poultry.
[0051] Administration methodologies [0052] The present disclosure provides compositions for introducing a recombinant immunogenic composition containing, at a minimum, a recombinant E. tenella EF- la protein, or antigenic fragments thereof, into targets (e.g., poultry). Thus, the compositions provided herein can be utilized to induce immunity to Eimeria species (e.g., E. tenella) and more generally, the disease coccidiosis in targets to which the antigen is provided.
[0053] An immunogenic composition of the present invention can be administered
intramuscularly, intradermally, subcutaneously, intranasally, by injection, or via ingestion in an amount which is effective to protect the recipient (e.g., poultry). Application of an immunogenic composition to a subject can result in the development of immunity to the EF-la protein, preferably development of an effective immune response that results in the decrease or removal of clinical symptoms. Application of the immunogenic compositions of the present invention can be provided at multiple times or in a single dosage. Application of the immunogenic compositions provided herein to poultry can occur for the first time about day 1 post-hatch or any time thereafter. Application can be performed before, during or after the development of Eimeria-caused coccidiosis, including coccidiosis caused by E. tenella, E. maxima, E.
acervulina, and other Eimeria species.
[0054] Having generally described this invention, the same will be better understood by reference to certain specific examples, which are included herein to further illustrate the invention and are not intended to limit the scope of the invention as defined by the claims.
EXAMPLES
[0055] Example 1
[0056] Experimental design. [0057] Two separate animal trials were carried out to evaluate the immunogenic composition efficacy of the EF la protein against avian coccidiosis. The experimental design is illustrated in Table 1 and Figure 1. At Id of age, commercial broiler chickens (15 or 20/group) were subcutaneously immunized with 50 or 100 ug of rEF-la. Control animals received PBS alone. At 1 week post-immunization, animals were given a booster injection with the same immunogenic compositions. At 7 d post- secondary immunization, chickens were given PBS or l.OxlO4 Eimeria sp. sporulated oocysts by oral gavage using an 18-gauge needle. Chickens were immunized twice with PBS (Control), rEF-la protein alone or with rEF-la protein/ISA 71 at 1 and 7 days post-hatch subcutaneously, and infected with Eimeria sp. (E. tenella or E. maxima) at 7 days post-secondary immunization.
Table 1. Experimental groups vaccinated with rEF-la protein
Trial . .. Number
number Group Immunogen Adiuvant . Infection
of Birds
1-1 PBS(100 ul/bird) 20 -
E. tenella (1 x
1-2 PBS(100 ul/bird) 20
io4/mi)
Trial #1
E. tenella (1 x
1-3 EFla (50 ug/bird) 20
io4/mi)
E. tenella (1 x
1-4 EFla (100 ug/bird) 20 io4/mi)
1-1 PBS(100 ul/bird) 15 -
Trial #2 E. maxima (1 x
1-2 PBS(100 ul/bird) 15
io4/mi)
E. maxima (1 x
1-3 EFla (100 ug/bird) 15
io4/mi)
[0058] Experimental animals [0059] One day-old male broiler chickens (Ross strain, Longenecker' s Hatchery, Elizabethtown, PA) were reared in floor pan cages and provided with feed and water ad libitum. At 14 days post-hatch, the chickens were transferred to hanging cages with two birds per cage. All procedures were approved by the Beltsville Area Institutional Animal Care and Use Committee.
[0060] Parasites
[0061] The strains of E. tenella, E. maxima and E. acervulina used in this study were originally developed and maintained at the Animal Biosciences and Biotechnology Laboratory of the Beltsville Agricultural Research Center (Beltsville, MD). Oocysts were cleaned by flotation on 2.5% sodium hypochlorite, washed three times with PBS, and enumerated using a
hemocytometer prior to experimental infections as described (Jang et al., 2010, supra).
[0062] Statistical analysis
[0063] All data are expressed as means +S.D. values and subjected to one-way analysis of variance using SPSS software (SPSS 15.0 for windows, Chicago, IL). Duncan's multiple range test was used to analyze differences between the mean values. Differences were considered statistically significant at <0.05.
[0064] Example 2
[0065] Cloning and expression of recombinant EF-la protein from E. tenella.
[0066] The EFla sequence (containing an intron) amplified by PCR from E. tenella DNA was ~ 1800 bp in length and consists of 450 amino acids (49,101.54 daltons) (data not shown). After removing the intron, the PCR product representing the coding sequence of EFla (Fig.2, ~ 1400 bp) was cloned into T vector (Invitrogen, USA), and then subcloned into pET32a(+) expression vector and sequenced. The nucleotide sequence (SEQ ID NO: 1) was identical to the published E. tenella EF-la sequence (GenBank accession no. JN987661). The expression of recombinant proteins containing an His6 epitope tag (615 amino acids) with estimated molecular weight of 66,804.1 was detected by SDS-acrylamide gel and showed mainly in the inclusion body form. The protein expression was further confirmed by Western blotting using a monoclonal antibody (anti-His monoclonal- antibody (Genscript, Cat.No. A00186)) against the His epitope tag (Fig. 3).
[0067] Construction of the prokaryotic expression plasmid pET -EF-la
[0068] The purified oocysts of E. tenella were washed in phosphate buffered saline (PBS), disrupted in glass beads, and the total genomic DNA was extracted using the sodium dodecyl sulphate/proteinase K, followed by phenol/chloroform method. The purity of E. tenella was confirmed by specific PCR as previously described (Fernandez et al., Parasitol. (2003) 127:317- 25). The sequence of E. tenella EF-la gene (containing an intron) was amplified by PCR from genomic DNA of E. tenella with a pair of oligonucleotide primers (EF-laF: 5'- TGCTGGATCCATGGGGAAGGAAAAG -3' (SEQ ID NO: 3), and EF-laR: 5'- CACAAAGCTTGTCACTTCTTGGCG -3' (SEQ ID NO: 4)), and BamH I and Hindlll recognition sites were introduced (underlined sequences). The PCR product was cloned into T plasmid vector (TOPO® TA Cloning® Kit, Invitrogen, USA) and sequenced in both directions.
[0069] Subsequently, the intron was removed by amplifying and connecting two segments of EF-la coding sequence with two pairs of primers respectively ((EFlaF/EFlaR2:
GTTCCCGCGTCTGCCCTTCCTTGGAGA (SEQ ID NO: 5); EFlaF2:
TCTCCAAGGAAGGGCAGACGCGGGAAC /EFlaR (SEQ ID NO: 6)) using PfuUltra II fusion HS DNA Polymerase (Agilent Technologies Inc., USA). The EF-la PCR product (without intron) was cloned and sequenced to ensure fidelity. Then the coding sequence of EF- la was cleaved using BamH I / Hindlll from recombinant T ET-EF- la plasmid expression vector and cloned into the pET32a(+) plasmid vector (Novagen/EMD Chemicals, Gibbstown, NJ) downstream from an NH2-teminal His6 epitope tag. The recombinant plasmid clones of pET-EFla were verified by sequence analysis.
[0070] Bacterial expression and purification of EF-la recombinant protein
[0071] The recombinant plasmid pET-EF-la was used to transform E. coli BL21(DE3), induced for 4 h with 1 mM J TG at 37°C and 15°C, and the cells harvested by centrifugation and sonication. The lysate was applied to Ni- NTA resin and Filter Column (HITrap®, GE
Healthcare, Piscataway, NJ), washed with PBS, Tris pH 7.4 and Tris pH 8.0 to remove unbound proteins, and bound proteins were eluted stepwise with PBS, pH 7.0 containing 0.25 M imidazole(Sigma). The eluted protein fractions were visualized on 12% sodium dodecyl sulfate polyacrylamide gel (SDS-PAGE)SDS-acrylamide gels stained with Coomassie brilliant blue and on Western blots probed with horseradish peroxidase-conjugated anti-His monoclonal antibody (Giagen), and stored at -20°C.
[0072] Example 3
[0073] Effect of EF-la vaccination on body weight gain and fecal oocyst shedding
[0074] Body weight gain and fecal oocyst shedding were used to evaluate the effect of EFla immunization against E. tenella, or E. maxima challenge infection. Following challenge infection with E. tenella or E. maxima, the average body weight (Figures 4A and 4B) of chickens was higher and the fecal oocyst output (Figures 5A and 5B) were significantly decreased in all the vaccinated and challenged groups compared with non- vaccinated and challenged groups, indicating immunization with rEF-la induced an effective, protective response.
[0075] Body weight gain [0076] Uninfected and Eimer ζΏ-infected birds (8-12/group) were assessed for body weight changes between dO to d6 for E. tenella, and dO to d8 for E. maxima infection (23 day-old for E. tenella infection) post- infection. For Trial 1, chickens were infected with 1.0 x 104 sporulated E. tenella oocysts and body weight gains between 0 to 6 (Figure 4A) days post-infection were determined. For Trial 2, chickens were infected with 1.0 x 104 sporulated E. maxima oocysts and body weight gains between 0 to 8 days (Figure 4B) days post-infection were determined. In Figures 4A and 4B, each bar represents the mean + S.D. value (n=8-12) and within each graph, bars with different letters are significantly different according to the Duncan's multiple range test (P < 0.05).
[0077] Oocyst shedding
[0078] Fecal samples were collected from infected birds between 6 and 9 days (for E. tenella; Figure 5A), or between 6 and 8 (for E. maxima; Figure 5B) post-infection and oocysts were enumerated using a McMaster counting chamber as described (Ding et al., Infect. Immun. (2004) 72:6939-44). Two independent people counted oocysts.
[0079] For Trial 1, chickens were immunized with PBS (control), or rEF- la protein. At 7 days post- immunization, the chickens were uninfected or infected with 1.0 x 104 sporulated E. tenella (Figure 5A) oocysts and shedding between 6 to 9 days post-infection were determined. For Trial 2, chickens were immunized with PBS (control), or EFla protein. At 7 days post- immunization, the chickens were uninfected or infected with 1.0 x 104 sporulated E. maxima (Figure 5B) oocysts and shedding between 6 to 8 days post-infection was determined. In
Figures 5A and 5B, each bar represents the mean + S.D. value (n=8) and within each graph, bars with different letters are significantly different according to the Duncan's multiple range test (P < 0.05). Uninfected control animals did not exhibit any oocyst shedding (data not shown). [0080] Example 4
[0081] Effect of EF-la vaccination on humoral antibody response
[0082] In Trial 1 (Figure 6A), chickens were subcutaneously immunized twice with 50 or 100 ug of EFla. At 7 days post-secondary immunization, the animals were uninfected or infected with 1.0 x 104 E. tenella parasites. For Trial 2 (Figure 6B), chickens were subcutaneously immunized twice with 100 ug of rEF-la. At 7 days post- secondary immunization, the animals were uninfected or infected with 1.0 x 104 E. maxima parasites. Serum IgG antibody levels were measured by ELISA at 9 days post-infection for Trial 1 and 8 days post-infection for Trial 2.
[0083] Serum IgG antibody levels against rEF-la protein were measured by an indirect enzyme- linked immunosorbent assay (ELISA) as described (Lee et al., Res. Vet. Sci. (2013) 95: 110-14). Ninety- six well microtiter plates were coated overnight with 1.0 ug/well of purified recombinant EF-la proteins which were expressed in Escherichia coli. The plates were washed with PBS containing 0.05% Tween 20 (PBS-T) and blocked with PBS containing 1% bovine serum albumin. Serum samples were diluted 1:50, lOOul was added to each well, incubated with agitation for 1 h at room temperature, and washed with PBS-T. Bound antibodies were detected with peroxidase-conjugated rabbit anti-chicken IgG secondary antibody and
tetramethylbenzidine substrate (Sigma, St. Louis, MO). Optical densities (OD) were measured using a microplate spectrophotometer (ELx800TM, BioTek, Winooski, VT).
[0084] Results are shown in Figures 6A and 6B. Antibody levels are expressed as AOD values (OD450 vaccinated and infected group -OD450 non-vaccinated, uninfected controls). Each sample was analyzed in triplicate and each bar represents the mean + S.D. value (n = 5). Bars with different letters are significantly different according to the Duncan's multiple range test (P < 0.05). [0085] The data shows that compared with uninfected control and infected control, no higher antibody titers were detected at 9 days post-infection (for E. tenella infection; Figure 6A) or at 8 days post-infection (for E. maxima infection; Figure 6B) days post-vaccinated only with rEF-la.
[0086] While the invention has been described with reference to details of the illustrated embodiments, these details are not intended to limit the scope of the invention as defined in the appended claims. The embodiment of the invention in which exclusive property or privilege is claimed is defined as follows:

Claims

CLAIMS WHAT IS CLAIMED IS:
1. An immunogenic composition, comprising a recombinant protein of SEQ ID NO: 2, a recombinant protein having at least 95% homology to SEQ ID NO: 2, or a recombinant protein comprising an antigenic portion of SEQ ID NO: 2, and a pharmaceutically or veterinarily acceptable carrier, wherein said immunogenic composition is capable of inducing an immune response to said isolated protein in a recipient.
2. The immunogenic composition of claim 1, further comprising an adjuvant.
3. The immunogenic composition of claim 1, wherein the protein is expressed by a
recombinant host cell comprising an exogenous nucleic acid encoding the protein.
4. The immunogenic composition of claim 3, wherein the host cell is an Escherichia coli cell.
5. The immunogenic composition of claim 1, wherein the carrier is a liquid carrier.
6. The immunogenic composition of claim 1, wherein the vaccine is formulated for
parenteral delivery.
7. The immunogenic composition of claim 1, wherein the vaccine is formulated for oral delivery.
8. The immunogenic composition of any of claims 1-7, wherein the protein is an isolated protein.
9. A method of protecting a recipient against coccidiosis, comprising administering to the recipient an immunogenic composition according to claim 1 or claim 2 in an amount effective to induce a protective immune response to an Eimeria species.
10. The method of claim 9, wherein the Eimeria species is E. tenella, E. maxima, or E.
acervulina.
11. The method of claim 9, wherein the recipient is a chicken or turkey.
12. The method of claim 9, wherein the immunogenic composition is administered to the recipient at a live whole-cell formulation at a dose of at least 50 μg.
13. The method of claim 9, wherein the vaccine is administered parenterally.
14. The method of claim 13, wherein the vaccine is administered intramuscularly.
15. The method of claim 9, wherein the vaccine is administered orally.
16. An immunogenic composition produced according to the process comprising the steps of: a. culturing a recombinant host cell transformed with SEQ ID NO: 1, a DNA sequence encoding a protein having at least 95% homology to SEQ ID NO: 2, or a DNA sequence encoding a protein comprising an antigenic portion of SEQ ID NO:2;
b. expressing the protein encoded by SEQ ID NO: 1, a DNA sequence encoding a protein having at least 95% homology to SEQ ID NO:2, or a DNA sequence encoding a protein comprising an antigenic portion of SEQ ID NO:2; c. purifying the protein produced in the expressing step; and
d. incorporating the purified protein in or on a pharmacologically or veterinarily acceptable carrier.
17. The vaccine of claim 16, further comprising the step of incorporating an adjuvant.
18. The vaccine of claim 16, wherein the host cell is an Escherichia coli cell.
PCT/US2018/017006 2017-02-13 2018-02-06 Eimeria tenella elongation factor-1 alpha recombinant immunogenic compositions which induce active protective immunity against avian coccidiosis Ceased WO2018148186A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201762458101P 2017-02-13 2017-02-13
US62/458,101 2017-02-13
US15/887,130 US10294483B2 (en) 2017-02-13 2018-02-02 Eimeria tenella elongation factor-1 alpha recombinant immunogenic compositions which induce active protective immunity against avian coccidiosis
US15/887,130 2018-02-02

Publications (1)

Publication Number Publication Date
WO2018148186A1 true WO2018148186A1 (en) 2018-08-16

Family

ID=63106160

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2018/017006 Ceased WO2018148186A1 (en) 2017-02-13 2018-02-06 Eimeria tenella elongation factor-1 alpha recombinant immunogenic compositions which induce active protective immunity against avian coccidiosis

Country Status (2)

Country Link
US (1) US10294483B2 (en)
WO (1) WO2018148186A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA3244651A1 (en) * 2021-12-29 2023-07-06 Mazen Animal Health Inc. Expression of eimeria sequences in plants and plant produced vaccine for same

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20050076419A (en) * 2004-01-20 2005-07-26 재단법인서울대학교산학협력재단 Recombinant scfv antibodies specific to surface antigen from sporozoite of eimeria spp. responsible for coccidiosis
US20160256544A1 (en) * 2013-11-12 2016-09-08 Societe D'exploitation De Produits Pour Les Industries Chimiques Seppic Adjuvanted vaccines for in ovo avian vaccination

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20050076419A (en) * 2004-01-20 2005-07-26 재단법인서울대학교산학협력재단 Recombinant scfv antibodies specific to surface antigen from sporozoite of eimeria spp. responsible for coccidiosis
US20160256544A1 (en) * 2013-11-12 2016-09-08 Societe D'exploitation De Produits Pour Les Industries Chimiques Seppic Adjuvanted vaccines for in ovo avian vaccination

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE Protein [O] 20 October 2016 (2016-10-20), XP055537470, retrieved from NCBI Database accession no. XP013234784 *
LIN, RUI-QING ET AL.: "Vaccination with Eimeria tenella elongation factor-l a recombinant protein induces protective immunity against E. tenella and E. maxima infections", VETERINARY PARASITOLOGY, vol. 243, August 2017 (2017-08-01), pages 79 - 84, XP085181745 *
MATSUBAYASHI, MAKOTO ET AL.: "Elongation factor-1 a is a novel protein associated with host cell invasion and a potential protective antigen of Cryptosporidium parvum", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 288, no. 47, 2013, pages 34111 - 34120, XP055537471 *
REID, ADAM J. ET AL.: "Genomic analysis of the causative agents of coccidiosis in domestic chickens", GENOME RESEARCH, vol. 24, no. 10, 2014, pages 1676 - 1685, XP055537474 *

Also Published As

Publication number Publication date
US20180230475A1 (en) 2018-08-16
US10294483B2 (en) 2019-05-21

Similar Documents

Publication Publication Date Title
Lin et al. Vaccination with Eimeria tenella elongation factor-1α recombinant protein induces protective immunity against E. tenella and E. maxima infections
US7968695B2 (en) Nucleic acids encoding recombinant 56 and 82 kDa antigens from gametocytes of Eimeria maxima and their uses
Wang et al. Immune response induced by recombinant Mycobacterium bovis BCG expressing ROP2 gene of Toxoplasma gondii
Jang et al. Eimeria maxima recombinant Gam82 gametocyte antigen vaccine protects against coccidiosis and augments humoral and cell-mediated immunity
Fereig et al. Immunization with Toxoplasma gondii peroxiredoxin 1 induces protective immunity against toxoplasmosis in mice
Rafiqi et al. Immune response and protective efficacy of Eimeria tenella recombinant refractile body protein, EtSO7, in chickens
Subramanian et al. Cloning, expression and evaluation of the efficacy of a recombinant Eimeria tenella sporozoite antigen in birds
Rafiqi et al. Immunoprophylactic evaluation of recombinant gametocyte 22 antigen of Eimeria tenella in broiler chickens
Huang et al. Eimeria maxima microneme protein 2 delivered as DNA vaccine and recombinant protein induces immunity against experimental homogenous challenge
Fereig et al. Peroxiredoxin 3 promotes IL-12 production from macrophages and partially protects mice against infection with Toxoplasma gondii
Ewaisha et al. Combination of the two schistosomal antigens Sm14 and Sm29 elicits significant protection against experimental Schistosoma mansoni infection
AU2002316558A1 (en) Nucleic acids encoding recombinant 56 and 82 kDa antigens from gametocytes of Eimeria maxima and their uses
Lalsiamthara et al. Effect of immunization routes and protective efficacy of Brucella antigens delivered via Salmonella vector vaccine
Du et al. A novel lumazine synthase molecule from Brucella significantly promotes the immune-stimulation effects of antigenic protein
Hoan et al. Identification and immunogenicity of microneme protein 2 (EbMIC2) of Eimeria brunetti
US10294483B2 (en) Eimeria tenella elongation factor-1 alpha recombinant immunogenic compositions which induce active protective immunity against avian coccidiosis
Phonvisay et al. Evaluation of long-term antibody response and cross-serotype reaction in ducks immunised with recombinant Riemerella anatipestifer outer membrane protein A and CpG ODN
Zhang et al. Vaccination with formulations targeting Eimeria maxima and Clostridium perfringens conferred comprehensive protection using a dual-infection challenge model of necrotic enteritis
Wei et al. Fusion with CTB enhances the immunogenicity and protective efficacy of MIC2 subunit vaccine against Eimeria tenella
EP2601211B1 (en) Vaccine
Zhu et al. Identification and characterization of a cDNA clone-encoding antigen of Eimeria acervulina
US20180153945A1 (en) Oral e. coli vector-based vaccine for prevention of coccidiosis in poultry
US20250340601A1 (en) Recombinant flavobacterium covae protein vaccines
US11000579B2 (en) Recombinant Eimeria maxima protein delivered as nanoparticles
JP2007527707A (en) Piroplasmid vaccine

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18752013

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18752013

Country of ref document: EP

Kind code of ref document: A1