WO2018129293A1 - Method for conducting early detection of colon cancer and/or of colon cancer precursor cells and for monitoring colon cancer recurrence - Google Patents

Abstract

The invention provides a kit for detecting the presence or absence of mutations in the selected regions of the target genes associated with colorectal cancer, comprising XNA clamps and primers; wherein the XNA clamps are capable of hybridizing with the selected regions having wild-type sequences in the target genes, and the primers are capable of amplifying the selected regions containing each of the mutations in the target genes. The invention also discloses a method of detecting a mutant gene associated with colorectal cancer, comprising: providing a sample containing DNA and a xeno nucleic acid clamp capable of hybridizing to a wild-type gene; and detecting a mutant of the gene in the sample with a xeno nucleic acid probe capable of hybridizing to the mutant gene.

Description

METHOD FOR CONDUCTING EARLY DETECTION OF COLON CANCER AND/OR OF COLON CANCER PRECURSOR CELLS AND FOR MONITORING COLON

CANCER RECURRENCE This application claims the priority benefit under 35 U.S.C. section 119 of U.S.

Provisional Patent Application No. 62/442,898 entitled "Method For Conducting Early Detection Of Colon Cancer And/Or Of Colon Cancer Precursor Cells And For Monitoring Colon Cancer Recurrence" filed January 5, 2017, which is in its entirety herein incorporated by reference.

FIELD OF THE INVENTION

The field of application of the present invention is the medical sector, in the field of Molecular Biology. More specifically, the invention addresses a method for the early diagnosis of colorectal cancer and the kit for performing the method. This invention further relates to methods for disease diagnosis, including the early detection of colon cancer in patients. More particularly the invention also to methods for preparing samples derived from tissue, stools, circulating DNA and circulating tumor cells for disease diagnosis, including the detection of colon cancer, so as to assure or increase the likelihood that the sample will contain the diagnostically relevant information if the patient has a disease, for example a cancerous or precancerous lesion, and to methods for sample analysis regardless of its source.

The invention further relates to a method of non-invasive early detection of colon cancer and/or of colon cancer precursor cells. It also relates to XNA clamps and primers allowing to perform mutational analyses in selected regions of the genes responsible for colon cancer in a combined fashion, to a kit comprising said XNA clamps primers, and, in addition, to the use of said primers and said kit in mutational analysis, particularly in early detection of colon cancer and/or colon cancer precursor cells.

BACKGROUND OF THE INVENTION

Polymerase chain reaction (PCR) is a widely used technique for the detection of pathogens. The technique uses a DNA polymerase used to amplify a piece of DNA by in vitro enzymatic replication. The PCR process generates DNA that is used as a template for replication. This results in a chain reaction that exponentially amplifies the DNA template. Technologies for genomic detection most commonly use DNA probes to hybridize to target sequences. To achieve required sensitivity, the use of PCR to amplify target sequences has remained standard practice in many labs. While PCR has been the principle method to identify genes associated with disease states, the method has remained confined to use within a laboratory environment. Most current diagnostic applications that can be used outside of the laboratory are based on antibody recognition of protein targets and use ELISA-based technologies to signal the presence of a disease. These methods are fast and fairly robust, but they can lack the specificity associated with nucleic acid detection.

With the advent of molecular diagnostics and the discovery of numerous nucleic acid biomarkers useful in the diagnosis and treatment of conditions and diseases, detection of nucleic acid sequences, and sequence variants, mutations and polymorphisms has become increasingly important. In many instances, it is desirable to detect sequence variants or mutations (which may in some instances, differ by one a single nucleotide) present in low copy numbers against a high background of wild-type sequences. For example, as more and more somatic mutations are shown to be biomarkers for cancer prognosis and prediction of therapeutic efficacy, the need for efficient and effective methods to detect rare mutations in a sample is becoming more and more critical. In the case in which one or more allelic variants is/are present in low copy number compared to wild-type sequences, the presence of excess wild-type target sequence creates challenges to the detection of the less abundant variant target sequence. Nucleic acid amplification/detection reactions almost always are performed using limiting amounts of reagents. A large excess of wild-type target sequences, thus competes for and consumes limiting reagents. As a result amplification and/or detection of rare mutant or variant alleles under these conditions is substantially suppressed, and the methods may not be sensitive enough to detect the rare variants or mutants. Various methods to overcome this problem have been attempted. These methods are not ideal, however, because they either require the use of a unique primer for each allele, or the performance of an intricate melt-curve analysis. Both of these shortcomings limit the ability and feasibility of multiplex detection of multiple variant alleles from a single sample.

Additionally, it is also known that colorectal cancer is a leading cause of death in Western society. However, if diagnosed early, it may be treated effectively by surgical removal of the cancerous tissue. Colorectal cancers originate in the colorectal epithelium and typically are not extensively vascularized (and therefore not invasive) during the early stages of development. Colorectal cancer is thought to result from the clonal expansion of a single mutant cell in the epithelial lining of the colon or rectum. The transition to a highly vascularized, invasive and ultimately metastatic cancer which spreads throughout the body commonly takes ten years or longer. If the cancer is detected prior to invasion, surgical removal of the cancerous tissue is an effective cure. However, colorectal cancer is often detected only upon manifestation of clinical symptoms, such as pain and black tarry stool. Generally, such symptoms are present only when the disease is well established, often after metastasis has occurred, and the prognosis for the patient is poor, even after surgical resection of the cancerous tissue. Early detection of colorectal cancer therefore is important in that detection may significantly reduce its morbidity.

Invasive diagnostic methods such as endoscopic examination allow for direct visual identification, removal, and biopsy of potentially cancerous growths such as polyps. Endoscopy is expensive, uncomfortable, inherently risky, and therefore not a practical tool for screening populations to identify those with colorectal cancer. Non-invasive analysis of stool samples for characteristics indicative of the presence of colorectal cancer or precancer is a preferred alternative for early diagnosis, but no known diagnostic method is available which reliably achieves this goal.

Gene Mutations and Colorectal Cancer (CRC)

Complex signal pathways are involved in the colorectal cancer pathogenesis such as the WNT and RAS /RAF/MAPK pathways. Genetic and epigenetic changes in the pathway components have been studied extensively in relation to their roles in the initiation and development of CRC. KRAS mutations are found in several cancers including colorectal, lung, thyroid, and pancreatic cancers and cholangiocarcinoma. More than 90% KRAS mutations are located within codons 12 and 13 of exon 2, which may lead to abnormal growth signaling by the p21- ras protein. These alterations in cell growth and division may trigger cancer development as signaling is excessive. KRAS mutations have also been detected in many colorectal cancer patients.

The B-type Raf Kinase (BRAF) protein is a serine/threonine kinase that has important roles in regulating the MAP kinase/ERK signaling pathways, affecting cellular proliferation, differentiation, and programmed cell death. A BRAF mutation is commonly found in many human cancers including melanoma, colorectal cancer, lung cancer, and papillary thyroid carcinoma. The most common mutations in BRAF occur in codon 600, where an amino acid substitution in the activation segment of the kinase domain creates a constitutively active form of the protein. The V600E and V600K mutations are found in high frequencies in human cancer V600E 70-90% and V600K 10-15%. BRAF mutations are generally found in tumors that are wild-type for KRAS.

The adenomatous polyposis coli (APC) gene is a key tumor suppressor gene and APC mutation has been found in most colon cancers. The gene encodes a multi-domain protein that binds to various proteins, including -catenin, axin, CtBP, Asefs, IQGAP1, EB1 and microtubules. Most (-60%) cancer-linked APC mutations occur in a region referred to as the mutation cluster region (MCR) and result in C-terminal truncation of the protein. Mutations in the tumor suppressor gene APC result in the accumulation of catenin which activates the Wnt signaling pathway, leading to tumorigenesis. APC also plays roles in other fundamental cellular processes including cell adhesion and migration, organization of the actin and microtubule networks, spindle formation and chromosome segregation. Mutations in APC cause deregulation of theses cellular process, leading to the initiation and expansion of colon cancer. APC has been used as a biomarker for early colon cancer detection.

The β-catenin gene (CTN B1) is also an important component of the Wnt pathway. Mutations in the serine or threonine phosphorylation sites in the regulatory domain (exon 3, codon 29-48) of the gene leads to accumulation of the gene product (β- catenin) which activates the Wnt pathway.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 illustrates the principle of the Mutation Detection Test of the invention.

Figure 2 shows qPCR amplification curves generated by the assay of the invention on FFPE tissue.

Figures 3-6 illustrate the performance examples of the assays with optimal primer, probe, XNA concentration and ACt between -wildtype (Wt) and mutant.

Figure 7 shows quantitative PCR with β-Actin for different amount of DNA input and demonstrate PCR efficiency in the assay of the invention.

Figure 8 illustrates Watson-Crick Base Pairing of DNA with cognate XNA.

Figure 9 shows how XNA Clamp Detects below 0.1% Mutated DNA. SUMMARY OF THE INVENTION

The invention provides a method for detecting the presence or absence of a known mutated gene contained in a biological sample, said method comprising the steps of: (1) allowing a mixture of a clamp primer consisting of XNA which hybridizes with all or part of a target site having a sequence of a wild-type gene or a sequence complementary to the wild-type gene, a primer capable of amplifying a region comprising a target site having a sequence of the mutated gene, and the biological sample to coexist in a reaction solution for gene amplification, and selectively amplifying the region comprising a target site of the mutated gene by a gene amplification method, and (2) selectively detecting a detection region comprising the target site of the mutated gene by a gene detection method, using an amplified product obtained in step (1) or part thereof as a template, to detect the presence or absence of the mutated gene.

The invention also relates to a method for screening for the presence of colorectal cancer in a patient, the method comprising the steps of: (a) obtaining a biological sample from said patient; and (b) performing an assay that screen for DNA mutations in said sample employing a Xenonucleic acid clamp to detect mutations indicative of the presence of colorectal cancer.

The invention further relates to a method of detecting a mutant gene associated with colorectal cancer, comprising: providing a sample containing DNA and a xeno -nucleic acid clamp capable of hybridizing to a wild-type gene; and detecting a mutant of the gene in the sample with a xeno- nucleic acid probe capable of hybridizing to the mutant gene.

The present invention additionally provides a method for screening and/or monitoring a patient for mutations associated with colorectal cancer, the method comprising: isolating DNA from a stool sample, fresh peripheral blood (PB), plasma, and formalin-fixed, paraffin-embedded (FFPE) tissues sample obtained from the patient suspected of having a condition associated with colorectal cancer mutations; performing PCR on the extracted DNA to produce amplified DNA while using a xenonucleic acid clamp for blocking amplification of wild-type DNA; sequencing the amplified DNA in an automated sequencer; analyzing an output of the automated sequencer to identify mutations in the sequence.

The invention also provides a kit for detecting the presence or absence of mutations in the selected regions of the target genes associated with colorectal cancer, comprising XNA clamps and primers; wherein the XNA clamps are capable of hybridizing with the selected regions having wild-type sequences in the target genes, and the primers are capable of amplifying selected regions containing each of the mutations in the target genes.

The invention further provides kits that include novel xenonucleic acid clamps. DESCRIPTION OF THE INVENTION

The invention is a real-time PCR based in vitro diagnostic assay for qualitative detection of colorectal cancer associated biomarkers including APC (codons 877, 1309, 1367, 1450, 1465, 1556), KRAS (codons 12 and 13), BRAF (codon 600), -CTNNB1 (codons 41 and 45) and TGFBR2 (codon 449). The detection kit identifies the presence or absence of mutations in the targeted regions but

does not specify the exact nature of the mutation. The detection kits are designed to detect any mutation at or near the stated codon site without specifying the exact nucleotide change.

The mutation detection assay of the invention is based on xenonucleic acid (XNA) mediated PCR clamping technology. Xeno-nucleic acids (XNAs) are synthetic genetic polymers containing non-natural components such as alternative nucleobases, sugars, or a connecting backbone with a different chemical structure. This introduction of a wider selection of functional building blocks could enable XNA sequences to participate in a wider selection of chemical reactions than their DNA or RNA equivalents. XNA is a synthetic DNA analog in which the phosphodiester backbone has been replaced by a repeat formed by units of (2-aminoethyl)- glycine. XNAs hybridize tightly to complementary DNA target sequences only if the sequence is a complete match. Binding of XNA to its target sequence blocks strand elongation by DNA polymerase. When there is a mutation in the target site, and therefore a mismatch, the XNA:DNA duplex is unstable, allowing strand elongation by DNA polymerase. Addition of an XNA, whose sequence with a complete match to wild-type DNA, to a PCR reaction, blocks amplification of wild-type DNA allowing selective amplification of mutant DNA. XNA oligomers are not recognized by DNA polymerases and cannot be utilized as primers in subsequent real-time PCR reactions.

The invention relates to a method for conducting the early detection of and/or monitoring recurrence of colon cancer and for the detection of colon cancer precursory cells, employing polymerase chain reaction (PCR) using primers and xenonucleic acid (XNA) clamp oligomers with which mutation analyses can be carried out in selected regions of genes APC, K-ras, β-catenin B-raf and Transforming Growth Factor Beta Receptor II. The invention also relates to a kit containing said primers and xenonucleic acid (XNA) clamp oligomers and the use of these primers and xenonucleic acid (XNA) clamp oligomers and of the kit for analyzing mutations, particularly for conducting the early detection of and/or monitoring recurrence of colon cancer and for the detection of colon cancer precursory cells.

The invention further discloses means and methods for analysis of mutations in tumor DNA derived from colorectal cancer tumor tissue biopsies, circulating free tumor DNA derived from patient plasma samples or tumor DNA derived from stool samples.

The invention uses nucleic acid molecular oligomers that hybridize by Watson-Crick base pairing to target DNA sequences yet have a modified chemical backbone. The xenonucleic acid oligomers (Fig. 8) are highly effective at hybridizing to target sequences and can be employed as molecular clamps in quantitative real-time polymerase chain reactions (PCR) or as highly specific molecular probes for detection of nucleic acid target sequences.

The invention allows for a new way to screen for somatic mutations that utilizes a sequence-specific XNA clamp that suppresses PCR amplification of wild-type template DNA. The clamp allows selective PCR amplification of only mutant templates, which allows the detection of mutant DNA in the presence of a large excess of wild-type templates from a variety of samples including FFPE, liquid biopsy, and traditionally challenging cytology samples.

The molecular clamps for qPCR are synthetic oligomers containing natural A,T,C,G or modified nucleosides (15 to 25 nt long) and have hydrophilic and neutral backbone (no phosphate group like PNA) and undergo hybridization by Watson-Crick pairing. The benefits of XNA include resistance to any known nucleases, much higher binding affinity as DNA binding is independent of salt concentration and large melting temperature differential (ATm = 15-20°C) in single-nucleotide (SNP's) and insertion/deletions (indels) (5-7°C for natural DNA).

The assay of the invention utilizes sequence-specific clamps (Xeno-Nucleic Acid XNA probe) that suppresses PCR amplification of wild-type DNA template and selectively amplifies only mutant template. The assay and kits of the invention represent a rapid, reproducible solution which employs a simple workflow and PCR machines that are commonly used in research and clinical labs.

The xenonucleic acids that can be used in the presnet invention include functionality selected from the group consisting of azide, oxaaza and aza. Many XNA's are dicslosed in Applicant's pending U.S. application No. 15/786,591 filed October 17, 2017; the entire contents of which are incorporated by refrence herewith.

The biological samples useful for conducting the assay of the invention include, but are not limited to, whole blood, lymphatic fluid, serum, plasma, buccal cells, sweat, tears, saliva, sputum, hair, skin, biopsy, cerebrospinal fluid (CSF), amniotic fluid, seminal fluid, vaginal excretions, serous fluid, synovial fluid, pericardial fluid, peritoneal fluid, pleural fluid, transudates, exudates, cystic fluid, bile, urine, gastric fluids, intestinal fluids, fecal samples, and swabs, aspirates (e.g., bone marrow, fine needle, etc.), washes (e.g., oral, nasopharyngeal, bronchial, bronchial alveolar, optic, rectal, intestinal, vaginal, epidermal, etc.), and/or other specimens.

Any tissue or body fluid specimen may be used as a source for nucleic acid for use in the technology, including forensic specimens, archived specimens, preserved specimens, and/or specimens stored for long periods of time, e.g., fresh-frozen, methanol/acetic acid fixed, or formalin-fixed paraffin embedded (FFPE) specimens and samples. Nucleic acid template molecules can also be isolated from cultured cells, such as a primary cell culture or a cell line. The cells or tissues from which template nucleic acids are obtained can be infected with a virus or other intracellular pathogen. A sample can also be total RNA extracted from a biological specimen, a cDNA library, viral, or genomic DNA. A sample may also be isolated DNA from a non- cellular origin, e.g. amplified/isolated DNA that has been stored in a freezer.

Nucleic acid molecules can be obtained, e.g., by extraction from a biological sample, e.g., by a variety of techniques such as those described by Maniatis, et al. (1982) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y. (see, e.g., pp. 280-281).

The XNA-PCR chemistry is also the most reliable tool and it is the only technology that provides detection sensitivity of 0.1% or lower, a level that cannot be achieved by droplet digital PCR and Sanger sequencing. The assays can be completed in two hours for a variety of specimens, including solid tumors (e.g. FFPE tissues) and liquid biopsies (e.g. circulating tumor DNA).

Mutations Interrogated by primers and XNAs:

KRAS codon 12 any non-synonymous other than wild-type GGT— > GXT, XGT etc. Gly— >Asp, Ser, Vol, Arg, Ala, Cys

KRAS codon 13 - GGC-> GAC Gly>Asp BRAF codon 600 GTG -> GAG, V600E (V600K, D, R orM)

CTNNB1

codon 33 TCT—> TAT, Ser -> Tyr,

codon 41 ACC > GCC Thr > Ala,, ACC > ATC Thr > lie

codon 45 TCT > CCT Ser > Pro, TCT > TTT Ser > Phe

APC codon 1309 delAAAAG

codon 1367 CAG > TAG Glu > Stop

codon 1450 CGA > TGA Arg > Stop, 7bpdel

codon 1465 del AG

codon 1556 insA, delA

codon 877

TGFBR2 c449 458delp.E150fs

Primers designed to amplify regions containing each of the target mutations in the target genes are used together with wild-type sequence specific PCR clamp oligomers: peptide nucleic acid (PNA) locked nucleic acids (LNA), bridged nucleic acid (BNA) or more preferably xenonucleic acid clamp oligomers as previously disclosed (Ref DiaCarta XNA patent filings). The PCR reaction is performed and the resulting amplicons generated are detected by real-time fluorescence based PCR using SYBR green intercalating dye or fluorescent 5'-exonuclease hydrolysis probes (taqman). Alternatively the amplicons can be detected employing sequence specific hybridization capture and detection and solid-phase separation techniques.

The gene mutation specific primers and PCR clamp reactions are performed together with primers that are designed to amplify a housekeeping gene such as β-Actin (ACTB). The housekeeping gene provides a means to monitor the quality and quantity of the input DNA that is obtained from colon cancer tissue biopsy samples, circulating free tumor DNA in patients plasma or tumor DNA extracted from patient stool samples.

EXAMPLE I

Reagents for the stool sample preparation.

QIAamp DNA Stool Mini Kit. Ca# 51504. Good for 50 x200mg stool samples.

Qiagen reagents for the large scale (whole stool) preparation: Buffer ASL. Ca# 1014755. Buffer AL, Ca# 1014600, Buffer AWl Ca# 1014792, Buffer AW2 Ca# 1014592, InhibitEx tablets, Ca# 19590, RNAseA Ca# 1007885, Proteinase K Ca#19131. Our storage buffer: lOmM NaCl, 500mM TrisHCl pH9.5, lOOmM EDTA. Neutralization buffer: 1M MES pH 5.76 (Teknova). Silica maxi spin columns. Epoch Biosciences ( Ca# 2040-050). Streptavidin coated Magnetic Dynabeads MyOne (Thermo Fisher Scientific, Ca# 00351575) are the best for DNA capturing. 20XSSC buffer. Beckman Coulter Sorvall centrifuge with JA25.50 rotor and 50ml centrifugation tubes with screw caps (Ca# 357003). BeckmanCoulter AllegraX- 15 bench top centrifuge with SX4750 rotor for maxi columns.

The procedure described below is for the whole stool covered with the storage buffer added by patient. If stool is in the frozen state we recommend to take about 10 x 2g pieces and add 10 volumes (20ml) of ASL buffer to each piece. Allow stool to thaw and continue as described.

Add the minimal volume of storage buffer to the fresh stool -just to cover stool surface (no more!) Mix suspension with glass rod for few minutes to make it more homogeneous. Close the container and incubate for 16-24h at room temperature.

Determination of stool concentration.

Mix stool and -transfer 2-3 spoons of stool suspension into the graduated 50ml conical tube to determine the volume of an aliquot.

Spin the aliquot at ~20000g for 5 min. Discard the supernatant and determine the weight of the pellet.

Example

Discard the tube with the pellet.

To start DNA purification from 2g of stool take 2g/0.55g/ml=3.6ml of the liquid stool. To start with 200mg use 360μ1 of stool.

Isolation of human DNA from 200mg of stool in the storage buffer. This procedure is modification of Qiagen's QIAamp protocol. It is -recommended for the training purposes. It is quick andv may be performed using DNA stool mini kit (Ca# 51504). Mix the liquid stool and transfer 360μ1 (200mg) into 15ml graduated conical tube. Add 3.6ml (10 volumes) of ASL buffer. Vortex. Incubate at room temperature for 5min. Add 360ul IM MES pH5.76 buffer. Vortex. Volume =4.32ml

Distribute 2ml x 2 into two 2ml centrifugation tubes. Spin at 10000-13000g -for 5min in the bench top centrifuge. Combine supernatants in 15ml conical tube. Add lul RNAseA (lOOmg/ml, Qiagen). Mix and incubate for 5 min. Add 1 InhibitEx tablet (Qiagen). Vortex for about lmin until tablet is completely dispersed. Transfer -the whole mix into two 2ml tubes. Spin at 13000g for 5min. Combine the supernatants in 15 ml conical tube. Add 25ul Proteinase K. Mix. Add the equal volume of AL buffer. Mix. Incubate at 70C for 20min in the water bath. Cool the mix to the room temperature. Add the volume of ethanol equal to that of AL buffer.

Mix. Load 0.7ml mix repeatedly onto one silica column. (It may take more than 10 loadings. See details in instruction to the kit).

Briefly:

a) . Perform each loading of sample at 6000g for lmin.

b) . Washings. 500μ1 of AW1 buffer at 6000g for lmin.

500μ1 of AW2 buffer at 10000 for lmin, twice.

c) . Spin dry column at 13000g for 2min.

d). Elution. Load 50-100μ1 AE buffer onto silica column. Incubate for lmin. Spin at 13000g for 2min.

Isolation of human DNA from 2g of stool in the storage buffer.

Mix the liquid stool and transfer 3.6ml (2g) into 50ml graduated conical tube. Add 36ml (10 volumes) of ASL buffer. Vortex. Incubate at room temperature for 5min. Add 3.6ml of IM MES pH5.76 buffer. Vortex. Volume =43.2ml. Transfer mix into 50ml centrifugation tube (Beckman Coulter, Ca# 357003). Spin at 20000g for lOmin. Collect supernatant in 50ml conical tube. Add 4μ1 RNAseA (lOOmg/ml, Qiagen). Mix and incubate for 5 min. Add 4 InhibitEx tablets (Qiagen). Vortex for about lmin until tablets are completely dispersed. Transfer -the whole mix into 50ml centrifugation tube. Spin at 20000g for lOmin. Collect the supernatant in 50 ml conical tube. Add 250μ1 Proteinase K. Mix. Add the equal volume of AL buffer. Mix. Incubate at 70° C for 20min in the water bath. Cool the mix to the room temperature. Add the volume of ethanol equal to that of AL buffer.

Option 1 :

1. Use the beads from the bead vial of the Promega Maxwell® RSC Whole Blood DNA Kit 1.1. Resuspend the Bead Mix in the 2nd well of the kit cartridge and

1.2. transfer the whole content of the bead mixture to the solution from step 3.7

1.3. Incubate for 0.5 hour at RT on an orbital shaker at moderate speed to bind NA to the NA Binding Beads.

1.4. Pull down the beads with the magnet (optional: Spin down and discard supernatant). Save about 500 ul supernatant with beads.

1.5. Transfer bead suspension into the bead compartment of the kit cartridge and proceed with the kit-specific program.

1.6. Use 150ul elution volume

The DNA is ready for qPCR.

Option 2:

Mix. Load ~20ml mix repeatedly onto one Maxi silica column inserted into 50ml conical tube. (It may take more than 5 loadings).

a) Perform each loading of sample at 1850g for 3min in "Allegra X-15R centrifuge, bucket rotor SX4750, Beckman Coulter)

b) Washings. 5ml of AW1 buffer at 4500g for lmin.

5ml of AW2 buffer at 4500g for 15min.

d) Elution. Load 1ml of AE buffer onto silica column. Incubate for 5min. Spin at 4500g for 2min.

Concentration of DNA isolated from 2g of stool before the sequence dependent capture.

The volume of DNA eluted from maxi column is about 700μ1. Denature DNA by heating at 95C for 5 min.

Precipitation of DNA.

Transfer DNA into 2ml centrifugation tube. Add 70ul of 5M NaCl + 70ul of 5N NH4Ac + 700μ1 isopropanol. Incubate for lh at room temperature. Precipitate DNA by centrifugation at 13000g for 15min in the bench top centrifuge. Wash pellet with 70% EtOH. Dry pellet at 55C for 5 min. Dissolve DNA in 35μ1 of lOmM Tris pH8.0. Enrichment of eluted DNA with the target specific capture 5'-BIOprobe on the magnetic beads.

Put 35μ1 of eluted DNA into 0.2ml tube and incubate at 95°C for 2 minutes in thermo cycler with the preheated lid. Chill the tube on ice for 2 minutes. Transfer denatured DNA into the new 0.2ml tube. Assemble hybridization mix as shown in the Table below.

Perform hybridization in thermo cycler at: 95° C 4min - 58C lh.

Prepare magnetic beads during hybridization.

Washing of magnetic beads.

Vortex beads in bottle for 20sec. Transfer ΙΟμΙ (10^A9 beads) to the bottom of 0.5ml tube. Place tube on the magnet for lmin. Remove the liquid covering the concentrated beads. Remove tube from the magnet. Add ΙΟΟμΙ of IX B&W buffer and suspend beads by gentle aspiration. Put the tube on the magnet. Repeat the washing step with 50ul of lx B&W. Cover beads with 50μ1 of lx B&W to prevent beads from drying.

Capture of hybridization product on the magnetic beads.

Put the tube with the washed beads covered with lx B&W on magnet and remove supernatant without disturbing beads. Remove tube from the magnet and immediately suspend beads in lOul of B&W buffer. Remove the post hybridization mix from the thermo cycler. Add 7μ1 of washed beads. Suspend beads by the gentle aspiration. Place tubes into shaker for 2 hours at 1 lOOrpm. The speed of the shaking should be high enough to don't allow beads to precipitate.

Washing of beads with captured DNA.

Collect beads on the magnet. Aspirate the supernatant. Suspend beads in ΙΟΟμΙ B&W.

Repeat this wash step with 50μ1 of B&W. Repeat the step with suspending beads in 50μ1 of lOmM NaCl+20mM TrisHCl pH7.5 (high stringency wash buffer).

Elution of DNA from the beads. Aspirate the low stringency wash buffer from beads. Suspend beads in 20μ1 of 20ng^l of polyA or other homopolymer carrier. Place tubes into thermo cycler and heat at 70C for 5min to elute DNA. Place tube on magnet and collect ~20μ1 of captured human DNA.

Sequences of biotinylated capture probes

KRAS 01S SEQ ID NO: 1

5' -/5Biosg/ GAT AC A GCT AAT TCA GAA TCA TTT TGT GGA CGA ATA TGA TCC AAC AAT AGA GGT AAA TCT TGT TTT AAT ATG CAT ATT ACT GGT GCA GGA CCA TT-3 ^'

BRAF 01S SEQ ID NO: 2

5 ^' -/5Biosg/ AAG TCA ATC ATC C AC AGA GAC CTC AAG AGT AAT AAT ATA TTT CTT CAT GAA GAC CTC ACA GTA AAA ATA GGT GAT TTT GGT CTA GCT AC A-3 ' ACTB 02 AS SEQ ID NO: 3

5^' -/5Biosg/ AGG AAG GAA GGC TGG AAG AGT GCC TCA GGG CAG CGG AAC CGC TCA TTG CCA ATG GTG ATG ACC-3 ^'

APC 01S SEQ ID NO: 4

5' -/5Biosg/ TTG TCA TCA GCT GAA GAT GAA ATA GGA TGT AAT CAG ACG ACA CAG GAA GCA GAT TCT GCT AAT ACC CTG CAA ATA GCA GA-3 '

CTNNB 02 AS SEQ ID NO: 5

5 -/5Biosg/ GTA AAG GCA ATC CTG AGG AAG AGG ATG TGG ATA CCT CCC AAG TCC TGT ATG AGT GGG AAC AGG GAT TTT CTC AGT-3 '

EXAMPLE II

55 blinded samples of DNA extracted from plasma and FFPE of patients with known clinical and mutational status were provided as 15ul aliquots in microcentrifuge tubes. Some samples were from tumor tissue of colon cancer patients. Samples were labeled from 1 to 55 with the ID# on the sides of tubes.

The goal of the test was for detection of mutations in plasma of colon cancer patients. Samples were accessioned according to accessioning and sample traceability SOPs.

The quantity and qPCR readiness of the DNA was checked by qPCR using the reference amplicon from the internal control of the assay. The samples then were diluted accordingly and tested using the assay. All positive calls for any of the target mutations were confirmed by Sanger sequencing of the amplicons. 1. Methodology

Technology for Mutation Detection

The Colorectal Cancer Mutation Detection Kit of the invention is based on xenonucleic acid (XNA) mediated PCR clamping technology. XNA is a synthetic DNA analog in which the phosphodiester backbone has been replaced by a repeat formed by units of (2-aminoethyl)- glycine. XNAs hybridize tightly to complementary DNA target sequences only if the sequence is a complete match. Binding of XNA to its target sequence blocks strand elongation by DNA polymerase. When there is a mutation in the target site, and therefore a mismatch, the XNA:DNA duplex is unstable, allowing strand elongation by DNA polymerase. Addition of an XNA, whose sequence with a complete match to wild-type DNA, to a PCR reaction, blocks amplification of wild-type DNA allowing selective amplification of mutant DNA. XNA oligomers are not recognized by DNA polymerases and cannot be utilized as primers in subsequent real-time PCR reactions. The qPCR detection is Taqman-based. qPCR Assay

The assay of the invention is a real-time PCR based in vitro diagnostic assay for qualitative detection of colorectal cancer - associated biomarkers including APC (codons 1309, 1367, 1450), KRAS (codons 12 and 13), BRAF (codon 600) and CTNNB1 (codons 41 and 45) . The detection kit identifies the presence or absence of mutations in the targeted regions but does not specify the exact nature of the mutation. The detection kits are designed to detect any mutation at or near the stated codon site without specifying the exact nucleotide change. Table 1. List of Mutations and Cosmic Identities Found in the targeted genes of the invention

KRAS

Exon Amino Acid Change Nucleotide change Cosmic No.

G12>A c.35G>C 522

G12>R c.34G>C 518

G12>D c.35G>A 521

G12>C c.34G>T 516

G12>S c.34G>A 517

2

G12>V c.35G>T 520 G13>D c.38G>A 532

G13>C c.37G>T 527

G13>R c.37G>C 529

APC

Exon Amino Acid Change Nucleotide change Cosmic No.

E1309fs* c.3921_3925delAAAAG COSM18764

15

Q1367* c.4099C>T COSM13121

R1450* C.4348C>T COSM13127

CTNNB1

Exon Amino Acid Change Nucleotide change Cosmic No.

p.T41A c. l21A>G COSM5664

P.T41I c. 122C>T

p.S45P c. l33T>C COSM5663

P.S45F c. l34C>T

BRA I

Exon Amino Acid Change Nucleotide change Cosmic No.

p.V600E C.1799T>A COSM476 p.V600K C.1798_1799GT>AA COSM473

15

p.V600R c. l798_1799GT>AG COSM474 p.V600D C.1799_1800TG>AT COSM477

Table 1 above shows a list of mutations commonly found in the targeted gene that can be detected by the kit. The assay and kit is to be used by trained laboratory professionals within a laboratory environment.

Table 2 Reagents and Instruments Used

Vial Name of Component Description Volume, 24-test kit Volume, 6-test kit No.

1 APC cl309 and 1367 APC cl309 and 1367 1 X 62 μΐ. 1 X 15 μΐ.

Primer/Probe Mix Primers and probe

2 APC cl309 and cl367 APC cl309 XNA 1 X 28 μΐ. 1 Χ 7 μΐ.

XNA

3 BCT c41 primer/probe BCT c41 Primers and 1 X 62 μΐ. 1 X 15 μΐ.

Mix probe

4 BCT c41 XNA BCT c41 XNA 1 X 28 μΐ. 1 Χ 7 μΐ.

5 APC cl450 Primer/Probe APC c 1450 Primer and 1 X 62 μΐ. 1 X 15 uL

Mix probe

6 APC C1450 XNA APC C1450 XNA 1 X 28 μΐ. 1 X 7 μΐ,

7 BCT c45 Primer/probe BCT c45 Primers and 1 X 62 μΐ. 1 X 15 uL

Mix probe

8 BCT c45 XNA BCT c45 XNA 1 X 28 μΐ. 1 Χ 7 μί 9 KRAS cl2 Primer/Probe KRAS cl2 Primer/probe 1 X 62 μΐ, 1 X 15 μΐ, mix

10 KRAS cl2 XNA XNA for KRAS c 12 1 X 28 μΐ, 1 Χ 7 μΐ,

11 KRAS cl3 KRAS cl3 1 X 62 μΐ, 1 X 15 μΐ,

Primer/Probe mix Primer/probe

12 KRAS cl3 XNA XNA for KRAS c 13 1 X 28 μΐ, 1 Χ 7 μΐ,

13 BRAF c600 Primer/Probe BRAF V600 Primers and 1 X 62 μΐ, 1 X 15 μΐ,

Mix probe

14 BRAF c600 XNA BRAF V600 XNA 1 X 28 μΐ, 1 Χ 7 μΐ,

15 2X Assay qPCR Master PCR Reaction Premix 1043 μΐ, 287 μΐ,

Mix

16 Negative Control Wild-type DNA 1 X 56 μΐ, 1 Χ 28 μΐ,

17 Positive Control APC cl309, cl367, 1 X 56 μΐ, 1 Χ 28 μΐ,

cl450, BCT c41, BCT

c45, KRAS c 12, KRAS

cl3 BRAF c600 mutant

templates Template

18 Non template control Nuclease-Free Water 1 X 76 μΐ, 1 Χ 56 μΐ,

Materials Required

Reagents for DNA Isolation

QIAamp DSP DNA FFPE Tissue Kit (QIAGEN, Cat. No. 60404) or equivalent

QIAamp Circulating Nucleic Acid Kit (QIAGEN, Cat. No. 55114) or equivalent

Consumables

0.2 ml DNase-free PCR tubes or plates, nuclease-free, low-binding micro centrifuge tubes and nuclease-free pipet tips with aerosol barriers.

Equipment

Permanent marker, real time PCR instrument, dedicated pipettes* (adjustable) for sample preparation, dedicated pipettes* (adjustable) for PCR master mix preparation, dedicated pipettes* (adjustable) for dispensing of template DNA, micro centrifuge, bench top centrifuge* with rotor for 1.5 ml tubes, vortexer, PCR rack, reagent reservoir, distilled water.

* Prior to use ensure that instruments have been maintained and calibrated according to the manufacturer's recommendations.

Instruments

The assays have been developed and validated on the instruments shown in the table below. Instrument platforms not listed in the table should be validated by the individual labs. Guidance for validation can be obtained from DiaCarta upon request. Table 3. List of Instruments Validated with This Kit.

The kits of the invention should be stored at -20 °C immediately upon receipt, in a constant-temperature freezer and protected from light. When stored under the specified storage conditions, the kit is stable until the stated expiration date. It is recommended to store the PCR reagents (Box land 2) in a pre-amplification area and the controls (Box 3) in a postamplification (DNA template-handling) area. The kit can undergo up to 6 freeze-thaw cycles without affecting performance.

DNA Isolation

Human genomic DNA must be extracted from fixed paraffin-embedded tissue, frozen tissue or plasma prior to use. Several methods exist for DNA isolation. For consistency, we recommend using a commercial kit, such as Qiagen DNA extraction kit ( QIAamp DNA FFPE Tissue Kit, cat No. 56404, for paraffin embedded specimens; DNeasy Blood & Tissue kit, cat. No. 69504 or 69506, for tissue and blood specimens, QIAamp Circulating Nucleic Acid Kit, cat. No. 55114 for plasma). Follow the genomic DNA isolation procedure according to manufacturer's protocol. Sufficient amounts of DNA can be isolated from FFPE blocks or fresh frozen sections as well as plasma (approx. 2-10 μg).

This -assay requires a total of 22.5 - 35 ng of DNA per sample (2.5-5 ng/reaction). After DNA isolation, measure the concentration using fluorometric analysis (i.e. Qubit) and dilute to 1.25-2.5 ng/μΐ. If using spectrophotometric analysis, make sure the A260/A230 value is greater than 2.0 and A260/A280 value between 1.8 and 2.0.

Preparation of Reagents

A 24-test kit contains enough control material for 3 runs. Thaw all primer and probe mixes, XNAs, Positive Control, WT Negative Control, Nuclease-Free Water and 2X PCR mastermix provided. Thaw all reaction mixes at room temperature for a minimum of 30 minutes. Vortex all components except the PCR Master Mix and Primer and probe Mix for 5 seconds and perform a quick spin. The PCR Master Mix and Primer/probe mix should be mixed gently by inverting the tube a few times. Prior to use, ensure that any precipitate in the PCR Master Mix is re-suspended by pipetting up and down multiple times. Do not leave kit components at room temperature for more than 2 hours. The PCR reactions are set up in a total volume of 10 μΐ/reaction.

Table 4 shows the component volumes for each 10 ul reaction.

For accuracy, 2χ PCR Mastermix, primers and XNA should be pre-mixed into assay mixes as described in Table 5 below.

Preparation of Assay Mixes

Assay mixes should be prepared just prior to use. Label a micro centrifuge tube (not provided) for each reaction mix, as shown in Table 5. For each control and mutation detection reaction, prepare sufficient working assay mixes for the DNA samples, one Positive Control, one Nuclease-Free Water for No-Template Control (NTC), and one WT Negative Control, according to the volumes in Table 5. Include reagents for 1 extra sample to allow sufficient overage for the PCR set up. The assay mixes contain all of the components needed for PCR except the sample.

Table 5. Preparation of Assay Mixes.

Note: n = number of reactions (DNA samples plus 3 controls). Prepare enough for 1 extra sampl (n +1) to allow for sufficient overage for the PCR set. You may want to consider increasing volume of mix to (n+2) when processing larger number of samples.

Negative Control, Positive Control and Non template control must be run with each reaction mix, every time the assay is run.

Negative Control:

· Uses commercially available wild-type human genomic DNA as the template at 2.5ng^l concentration.

• No target mutations, efficient binding by XNA clamps suppressing the target amplification.

Positive control:

· A mix of synthetic reference mutant templates for each target of the assay at 5% allelic frequency in 2.5ng^l WT human genomic DNA (hgDNA).

• XNA clamps will not bind, allowing amplification of the mutant template.

• Positive controls must show the appropriate values in both HEX and FAM channels for the run to be valid.

Non- template control (NTC):

• Nuclease free water is used in the place of template

• No amplification should be observed in both HEX and FAM channel, assuring the absence of contamination during assay set-up.

The Internal Control assay uses ACT-B housekeeping gene as a reference gene to assess the quality of amplifiable DNA and demonstrating if the reagents are working correctly. When assessed using the HEX channel, this control should make amplicons efficiently for all samples and controls except NTC, providing another way to monitor performance of the primers, probes, polymerase, and sample DNA quality/quantity.

Please always use white plates, strips, or tubes. In pre-amplification area, add 8 μΐ of the appropriate assay mix to the plate or tubes. In designated template area, add 2 μΐ of template to each well.

Table 6. Suggested Plate Layout.

1 2 3 4 5 6

A NTC PC CC SI S2 S3

APC1309, APC 1309, APC 1309, APC 1309, APC 1309, APC 1309,

1367 Mix 1367 Mix 1367 Mix 1367 Mix 1367 Mix 1367 Mix

B NTC PC CC SI SI S3

APC 1450 Mix APC 1450 Mix APC 1450 Mix APC 1450 Mix APC 1450 Mix APC 1450 Mix c NTC PC CC SI S2 S3

CTNNBl 41 CTNNBl CTNNBl 41 CTNNBl 41 CTNNBl 41 CTNNBl Mix 41Mix Mix Mix Mix 41Mix

D NTC PC CC SI S2 S3

CTNNBl 45 CTNNBl 45 CTNNBl 45 CTNNBl 45 CTNNBl 45 CTNNBl 45 Mix Mix Mix Mix Mix Mix

E NTC PC CC SI S2 S3

KRAS 12 Mix KRAS 12 Mix KRAS 12 Mix KRAS 12 Mix KRAS 12 Mix KRAS 12 Mix

F NTC PC CC SI S2 S3

KRAS 13 Mix KRAS 13Mix KRAS 13Mix KRAS 13 Mix KRAS 13 Mix KRAS 13 Mix

G NTC PC CC SI S2 S3

BRAF c600 Mix BRAF c600 BRAF c600 BRAF c600 BRAF c600 BRAF c600

Mix Mix Mix Mix Mix

PC: Positive Control, NTC: No-Template Control (water), CC: Negative Contra (Wild-type DNA), SI -3 : Samples 1-3

Table 6 is a suggested plate set-up for a single experiment analyzing 3 unknown samples. Please disregard any assay mixes listed below that are not part of your kit. When all reagents have been added to the plate, tightly seal the plate to prevent evaporation. Spin at lOOOrpm for 1 minute to collect all the reagents. Place in the real-time PCR instrument immediately.

Instrument Set-Up

Roche Light cycler 96 and Light cycler 480, Bio-Rad CFX 384 and ABI QuantStudio 5

1 ) S el ecti on of Detectors :

i. Use 'F AM/HEX' as the Detector on Roche light cycler

ii. Select 'All Channel' as detection format on Bio-Rad CFX384

iii. For ABI QuantStudio 5, assign individual mutation target as 'FAM', and select all Targets and assign to VIC

2) Setup the cycling parameters as shown in Table 7a or Table 7b

3) Start the run

Table 7a. Roche Light Cycler and Bio-Rad CFX 384 Platforms Cycling Parameters

Temperature Time Ramp Rate (°C/s) for Roche Data

Step Cycles

(°C) (Seconds) instruments * Collection

Preincubation 95 300 4.4 1 OFF

Denaturation 95 20 4.4 OFF

XNA Annealing 70 40 2.2 X50 OFF

Primer 64 30 1 OFF

Extension 72 30 1 FAM and *On Bio-Rad CFX 384, use the default ramp rate

Table 7b. ABI QuantStudio 5 Cycling Parameters

Assessment of Real-Time PCR Results

The real-time PCR instrument generates a cycle threshold (Cq, also called as Ct) value for each sample. Cq is the cycle number at which a signal is detected above the set threshold for fluorescence. The lower the cycle number at which signal rises above background, the stronger the PCR reaction it represents and the higher initial template concentration (**please see MIQE Guidelines under References for more information).

· Data Analysis for Light Cycler 480

For the Light Cycler 480, open the LightCycler480 SW 1.5.1.61 and select Abs Quant/2nd Derivative Max algorithm to analyze the run file data.

• Data Analysis for Bio-Rad CFX384

For the BioRad CFX384, open the qPCR run file using BioRad CFX manager. In the Log scale view, adjust the threshold to 100 ±20 for HEX and 300 ±60 for FAM. Export the Cq data to excel. Exact threshold setting may be different for individual instruments.

• Data Analysis for ABI QuantStudio 5

For the ABI Quant Studio 5 instrument, adjust the threshold according to Table 8. Exact threshold setting may be different for individual instruments.

Export the Cq data to excel. For each control or sample, calculate the difference in Cq value between the mutation assay and the Internal Control Assay as follows: Cq difference (ACq) = Mutation Assay Cq - Internal Control Assay Cq

Table 8. ABI QuantStudio 5 Recommended Threshold

Target Recommended threshold

ACT-B (internal control) 5900 ± 600

APC cl309/1367 100000 ± 10000

APC cl450 20000 ± 2000 CTN B 1 c41 20000 ± 2000

CTN B 1 c45 8000 ± 800

KRAS cl2 20000 ± 2000

KARS cl3 20000 ± 2000

BRAF c600 20000 ± 2000

Evaluation of Controls

Verify that no amplification is observed in the non-template controls (NTC) for each of the reaction mixes. Cq should be Undetermined. For each control or sample, calculate the difference in Cq value between the mutation assay and the External Control Assay as follows: Cq difference (ACq) = Mutation Assay Cq - Internal Control Assay Cq

Negative and Positive Controls: For the assay to be valid, the Negative Control and Positive Control must meet the criteria in Table 9a and Table 9b.

Table 9a. Acceptable values for positive controls and negative controls on Roche Light Cycler 480 and Bio-Rad CFX384

Table 9b. Acceptable values for positive controls and negative controls on ABI QuantStudio 5

Evaluating Validity of Sample Data Based on Internal Control Results

The Cq value of the Internal Control Mix serve as an indication of the purity and concentration of DNA in each well. Thus, the validity of the test can be decided by the Cq value of the Internal Control mix. Cq values of any sample with Internal Control Mix should be in the range of 25<Cq<31 (Roche Light cycler 480 and Bio-Rad CFX 384) or 25<Cq<30 (ABI

QuantStudio 5). If the Cq values fall outside this range, the test results should be considered invalid. The experiment should be repeated following the recommendations in Table 10.

Table 10. Acceptable internal control Cq ranges for samples

Scoring Mutational Status

If a Cq value is Undetermined, assign a Cq of 50 and proceed to analysis. The tables below should be used to determine mutational status based on ACq values.

Note: If the Cq value of FAM is 50, the mutational status will be scored as "Negative" regardless of the ACq values.

Table 11. Scoring mutational status for Roche Light Cycler 480

Table 12. Scoring mutational status for Bio-Rad CFX384

APC APC CTNNB CTNNB1 KRAS KRAS BRAF

Sample type Mutation

C1309/1367 C1450 lc41 c45 cl2 cl3 c600

FFPE Positive: <13.6 < 8.1 < 7.0 < 8.1 < 8.9 <7.0 < 8.5

Negative >13.6 > 8.1 > 7.0 > 8.1 > 8.9 >7.0 > 8.5

Plasma Positive: <18.9 < 9.3 < 7.9 < 10.2 < 11.5 <7.9 < 9.7 cfDNA Negative >18.9 > 9.3 > 7.9 > 10.2 > 11.5 >7.9 > 9.7 Table 13. Scoring mutational status for ABI QuantStudio 5

Differentiating KRAS cl2 KRAS cl3 Mutational Status

The KRAS cl2 reaction mix detects both KRAS cl2 and KRAS cl3 mutations, whereas the KRAS cl3 reaction mix detects only KRAS cl3 mutations. Therefore, in order to differentiate between KRAS cl2 and KRAS cl3 mutations a combination of results from the two mixes should be used as described in Table 14 below.

Table 14. Interpretation of G12/G13 mutational status

Assay Performance Characteristics

The performance characteristics of the assay were established on the Roche LightCycler 96, Roche LightCycler 480, Bio-Rad CFX 384 and ABI QuantStudio 5 real-time PCR instruments. The studies were performed using genetically defined reference standards ( genomic DNA and FFPE) from cell lines with defined mutations obtained from Horizon Discovery (Cambridge, England) and cfDNA reference standards from SeraCare (Massachusetts, US). These samples have been characterized genetically as containing heterozygous or homozygous mutations in the coding sequence of the respective target regions. These single nucleotide polymorphisms in the target regions have been confirmed by genomic DNA sequencing and/or ddPCR. Additional samples consisted of cancer patient tissue, plasma samples and normal healthy donor DNA from tissue and plasma.

Reproducibility

Reproducibility of the assay was determined with defined analytical levels of genomic DNA with known mutational status and allelic frequencies.

• To establish lot-to-lot variation, a reproducibility study was performed using three different lots of kit. Each lot was tested on one wild-type control and two reference samples containing each mutation at 5% and 1% allelic frequency in nine replicates on Roche LC480 and Bio-Rad CFX 384 instruments.

• Inter-assay %CV was established for same lot of reagents tested on the same instrument by the same user.

• Intra-assay %CV was established through performance of kit on reference samples run in replicates of nine.

• Operator variability was evaluated with one lot of reagents by two operators.

Reproducibility is demonstrated based on %CV of Cq values and rate of % correct mutation calls for all assays on two lots and operators for Roche and Bio-Rad instruments.

Table 15. Summary of reproducibility results

Table 16. Intra-assay reproducibility results on Roche LC480.

The intra-assay data demonstrated good reproducibility with low %CV (Table 16).

Analytic Sensitivity and Limit of Detection (LOD)

To determine the limit of detection (LOD) and analytical sensitivity of the kit, the studies were performed using serial dilutions of mutant DNA (reference FFPE and cfDNA) in wild-type background. The wild-type DNA used for dilution was obtained from mutant-free FFPE and normal human plasma respectively. Mutant allelic frequencies tested were 1%, 0.5% and 0.1% at 2.5, 5 and lOng/reaction DNA input levels. The mutant copy numbers present in genomic DNA with 1%), 0.5% and 0.1% allelic frequency at different DNA input levels are shown in Table 17a.

Table 17a. Mutant DNA copy numbers at different allelic frequencies

Table 17b. LOD summary determined using genomic DNA reference standards

Target mutation DNA Input, ng/well

10 5 2.5

APC 1309 % Correct Call % Correct Call % Correct Call

1% mutation 100% 100% 100%

0.5% mutation 100% 100% 90%

0.10% mutation 20% 0% 0%

APC 1367 1% mutation 100% 100% 90%

0.5% mutation 100% 100% 20%

0.10% mutation 50% 10% 5%

APC 1450 1% mutation 100% 100% 100%

0.5% mutation 100% 100% 95%

0.10% mutation 90% 60% 35%

CTNNB1 41 1% mutation 100% 100% 100%

0.5% mutation 100% 100% 100%

0.10% mutation 100% 100% 90%

CTNNB1 45 1% mutation 100% 100% 100%

0.5% mutation 100% 100% 95%

0.10% mutation 95% 40% 40%

KRAS 12 1% mutation 100% 100% 100%

0.5% mutation 100% 100% 67%

0.10% mutation 45% 32% 35%

KRAS 13 1% mutation 100% 100% 60%

0.5% mutation 95% 80% 50%

0.10% mutation 56% 56% 30%

BR A I V600 1% mutation 100% 100% 90%

0.5% mutation 100% 75% 70%

0.10% mutation 65% 15% 20% Table 17c. LOD summary determined using cfDNA reference standards

Conclusion:

• All targets can be detected at 1% allelic frequency at 5 ng DNA input per PCR reaction;

• For FFPE DNA samples, 0.5% mutation frequency in APC 1309, APC 1307, APC 1450, CTNNBl (c41,c45) and KRAS(cl2) can be detected at 5 ng DNA input;

• For plasma cfDNA samples, 0.5% mutation frequency in APC 1309, APC 1450 and CTNNBl 41 can be detected at 5 ng DNA input;

• The recommended DNA input is a minimum of 5ng/well.

Recommended input of FFPE should not be higher than 20 ng/well due to possible PCR inhibition. Optimal FFPE sample input is between 25 and 31 Cq of the Internal Control.

Analytic Specificity

Analytical specificity of the kit was determined as the correct calling of the samples with no mutation at different concentrations of WT template. There were no false positive calls for up to 320ng of gDNA per well and up to 20ng FFPE DNA. Cross-reactivity of the assays within the kit was tested with one or more mutations present in a mixed positive control at 50% allelic frequency.

Table 18. Analytic specificity: cross-reactivity

The data demonstrates that the present invention Kit can correctly identify several mutations within one template. There is cross reactivity between KRAS12 and KRAS13, due to the proximity of the mutations, which can be differentiated (Refer to Table 13).

Clinical performance of the assay

Clinical sensitivity and specificity was tested on the samples extracted from FFPE and plasma of patients with different stages of CRC from normal to advanced adenomas (AA), to colorectal cancer stages 1 through 4.

A sample was considered positive if at least one of the target mutations tested positive based on the cutoffs presented in Tables 10-12.

Table 19. Clinical sample testing

Clinical parameter

Types of Clinical Samples

specificity sensitivity

Clinical stage CRC, including plasma and FFPE N/A 100%

CRC, tissue N/A 90%

Advanced Adenomas N/A 60%

Non-malignant 95% N/A Non-malienant. FFPE onlv 90% N/A

FFPE 95% 91%

Sample Type Plasma 100% 100%

Excluding adenomas 95% 100%

CRC FFPE N/A 100%

Products used in this study

qPCR Colorectal cancer detection assay and Kit of the invention

QClamp® BRAF Genotyping Mutation Test (60 Samples), CatJ DC- 10-0066

Instrumentation used in this study

Roche LC480 qPCR instrument

SOPs used in this study

CL-OPS.0005 Sample accessioning and management

CL-OPS 0006 Clinical Lab Patient Test Management

CL-TF.0007 DiaCarta Clinical Lab Specimen Accessioning and Tracking Log

CL-OPS.0013- NA Measurements using the Qubit HS dsDNA Assay for QClamp assays

4 Reported results

Summary of the qPCR test results is presented in Table 20 below:

S51 29.24 8.085 Wp BCT WT BCT

APC 1367,BRAF:

Positive, APC, K601E:

S52 32.05 4.3/ 7.325 11/10.24 wp KRAS AAA>CAA

BCT c42

S53 29.09 8.4 Positive, BCT ACA>ATA

S54 29.73 10.01 Positive, BCT no Sanger data

S55 30.55 Negative

26 samples

Total confirmed positive,

13 3 7 3 11 6 2 29

positive no seq data for 2 samples

Total

weak 1 1 3 2 1 4 13 10

positive 2

13 ( 1 BRAF, 1

Total BCT and 1 APC

41 51 45 50 43 45 40 16

Neg. weak positive tested

Negative)

In the column listing the overall assay calls (second from the right) samples highlighted in green were positive by Light green- weak positive. Negative calls - orange. Since the samples were blinded and most of them were expected to be extracted from plasma, we have used positive, negative and weak positive calls due to un-validated cutoffs for the plasma sample type. The column also shows all the genes that were found positive/weak positive for target mutations. Overall there were 29 positive calls, 16 negative calls and 10 weak positive calls.

Samples s22, s24, s34, s36, s39, s44, s52 and s55 had insufficient DNA as evidenced by the Cq of the IC over 30. These samples were processed by present inventionassay, but results of these tests should be interpreted with caution, especially the negative calls on Samples s24, s34 and s55.

qPCR results of all positive and weak positive samples were further confirmed by Sanger sequencing of the qPCR amplicons. Some BRAF samples were also tested by alternative BRAF qPCR DiaCarta kit.

Results are presented in the last column to the right. Out of the 49 samples tested for all the relevant targets, Sanger sequencing produced no satisfactory data for 6 samples. 2 BRAF weak positive samples were found to be negative (either WT by Sanger sequencing or Negative by the alternative qPCR DiaCarta assay for BRAF c600). Several BRAF mutations outside of the V600E were shown to be present in the other weak positive cases that did not change the overall calls for the samples carrying these mutations. 100% of the Positive present invention calls were confirmed by Sanger sequencing with available data. 3 calls could not be confirmed due to poor Sanger data. 3 out of 10 weak positive calls were negative by Sanger, 5 did not produce sequencing or qPCR data and 2 BRAF WP calls tested positive for mutations other than V600E.

1 Conclusions:

The test results clearly demonstrate that the assay can be used to detect mutations in the CRC DNA samples extracted from patient plasma. As little as 30 ng of DNA is sufficient to provide test results as evidenced by concordance rate of 100% for positive calls with available Sanger data. Most of the samples with low quantity/quality of DNA are difficult to test, but these can be identified by using the internal control data.

The table above shows the assay performance from FFPE samples. Pre-cancer detection sensitivity is 60% (6 out of 10 samples).

The Table below compares the technical details and performance characteristics of assay of the invention with prior art assays.

EXAMPLE III This example describes the feasibility studies of the Assay for qualitative detection of mutations in targeted genes of APC (codons 1309, 1367, 1450), KRAS (codons 12 and 13), BRAF (codon 600) and CTN B1 (codons 41 and 45) genes associated with colorectal cancer initiating events.

The Assay is a real-time qPCR-based in vitro diagnostic test intended for use in the detection of mutations in the APC (codons 1309, 1367, 1450), KRAS (codons 12 and 13), BRAF (codon 600) and CTN B1 (codons 41 and 45) genes in DNA extracted from FFPE sections and human stool samples.

Since clinical samples from cancer patients frequently contain trace amounts of mutant allele in a large excess of wild-type DNA, DiaCarta's proprietary QClamp® XNA-PCR technology is employed in the present invention Taqman assays to suppress amplification of WT alleles to improve the sensitivity of mutation detection.

Target Gene and Mutation selection

A panel of target genes were selected based on their mutation frequency in early-stage colorectal cancer patients (UP patent 0, 172,823 Al licensed from Pottsdam University), preliminary clinical trials by Dr. Sholttka (publications). These early colorectal cancer related biomarkers include APC (codons 1309, 1367, 1450), KRAS (codons 12 and 13), BRAF (codon

600), CTNNBl (codons 41 and 45) genes and TGFp (to be included). A housekeeping gene, beta- actin (ACTP), was selected as internal control based on preliminary data from B. Sholttka and because competitor assay (ColoGuard from Exact Sciences) also uses that same gene for internal control. ACTP assay is used to monitor sample DNA extraction efficiency and presence of PCR inhibitors as well as to provide a way of quantitation of amplifiable template in each reaction well to prevent false positive/negative results.

3.2. Primer, Probe and XNA Design

3.2.1. Primers and probes were designed using PrimerQuest Tool following the qPCR primer and probe design rules. The primers were designed with a Tm of 62-64°C while the probes were designed with Tm of 66-68 °C.

3.2.2. The amplicon sizes were designed under 150 bp if possible.

3.2.3. Primers and probes were checked in-silico for specificity (BLAST), primer dimers/secondary structure (autoDimer) and amplicon secondary structure (M- fold). 3.2.4. The XNAs were designed to be between the forward and reverse primers or overlap a few bases with the forward primer.

3.2.5. The probes were designed to be parallel (on the same strand as) to XNAs and either overlap with the XNA (mutant-specific probes) or be distal to the XNA (locus specific probes). 3.3. Design Selection strategy

3.3.1. Primer, probe and XNA combinations and concentration optimization tests were performed to find the optimal conditions for differentiating mutant and WT alleles for each targeted somatic mutation.

3.3.2. Several qPCR master mixes are tested to find the best one that gives the lowest Ct and highest delta Ct for best performance in differentiating mutant and WT.

3.3.3. For efficient clamping by the XNA, a XNA annealing step at 70°C before the binding of primers and probes is included in the qPCR cycling program. Optimal annealing temperature for primers and probes will be tested by gradient analysis.

4. MATERIALS AND METHODS

4.1. Composition of the PCR reaction Mix

Table 21. PCR reaction mix

1.1. Reference templates:

CTNNBl CD 41 : IDT gBlock, custom

CTNNBl CD 45: ATCC CCL-247 Dl

BRAF C600: BRAF C600 Reference standard (Horizon Cat#: HD238)

KRAS cl3 : KRAS G13D Reference Standard (Horizon Cat#: HD290)

KRAS cl2: KRAS G12D Reference Standard (Horizon Cat#: HD272)

APC 1309: ATCC CRL-2158 Dl APC 1367: ATCC CRL-2101 D1

APC 1450: ATCC CCL-235 D1

1.2. Instalments

Roche LC96 DC2034, Cat. No. 05 815 916 001

Roche LC480II DC2035, Cat. No. 05015243001

BioRad CFX384 DC2044, Cat. No. 4329001

1.1. Reagents/Kits

Takara Bio Premix Ex Taq (Probe qPCR) 2X master mix, Clontech/TAKARA, Cat. # RR390A

SensiFAST Probe No-ROX mix (2x), Bioline, Cat. # BIO-86002

STAT-NAT-DNA -Mix (lyophilized), SENTINEL, Cat. # 1N001)

KAPA Probe Fast qPCR Master Mix (2x) Universal (Cat. #: KK4703)

SensiFAST Probe No-ROX mix (2x), Bioline, CatJ BIO-86002

1.2. Software

PrimerQuestTool/IDT

Autodimer

M-fold

CLC sequence viewer 7

1.3. Browser based tools

UCSC Genome Browser

NCBI

dbSNP

dbVar

COSMIC

1.1. Referenced DiaCarta Documents

DDC.0007_ present invention qPCR Project Plan

DDC.0006_Product Requirements for present invention multiplex qPCR Test CO.0001 Product development and Commercialization

2. DESIGN ASSESSMENT RESULTS 2.1. Master Mix selection

Based on previous tests on master mixes for Taqman based qPCR assays , KAPA Probe Fast qPCR Master Mix (2x) Universal was selected as the primary master mix for Taqman probe based qPCR reactions for mutation detection assay development. The following additional master mixes were compared with the KAPA master mix:

1) Takara Bio Premix Ex Taq (Probe qPCR) 2X master mix, Clontech/TAKARA, Cat.# RR390A

2) SensiFAST Probe No-ROX mix (2x), Bioline, CatJ BIO-86002

3) STAT-NAT-DNA -Mix (lyophilized), SENTINEL, Cat. # 1N001)

Table 22. Comparison of master mixes for detection of CTNNBl codon 45 mutation by QClamp Taqman real-time PCR

3.1.1. Lyophilized master mix can be conveniently stored and shipped at room temperature, so lyophilized Bioline master mix was also evaluated and compared with KAPA probe Fast qPCR Master Mix (2x) Universal (Table 23)

Table 23. Present invention mutation detection assay using Bioline SensiFAST Probe mix (lyophilized)

BIOLINE 1 2 3 AVE SD CV 1 2 3 AVE SD CV Delta Ct

TARGET

APC 1309 50 50 50 50 0 0.0% 30.2 30.36 30.07 30.21 0.15 0.5% 19.79

APC 1367 50 50 50 50 0 0.0% 32.6 32.5 32.55 0.07 0.2% 17.45

APC 1450 50 38.56 38.5 42.36 6.619 15.6% 33.53 33.52 33.28 33.44 0.14 0.4% 8.913

CTNNBl CD41 38.24 35.47 38.3 37.34 1.62 4.3% 32.01 31.88 31.76 31.88 0.13 0.4% 5.457

CTNNBl CD45 50 38.25 36.9 41.7 7.222 17.3% 31.18 31.43 31.12 31.24 0.16 0.5% 10.46

KRAS CD 12 41.56 41.87 45 42.81 1.903 4.4% 32.97 34.89 34.31 34.06 0.98 2.9% 8.753

KRAS CD 13 50 42.6 50 47.53 4.272 9.0% 32.55 34.98 34.15 33.89 1.24 3.6% 13.64 BRAF 36.98 40.83 43 40.28 3.067 7.6% 33.52 34.19 33.78 33.83 0.34 1.0% 6.453

KAPA FAST

PROBE 1 2 3 AVE SD CV 1 2 3 AVE SD CV Delta Ct

TARGET

APC 1309 50 50 50 50 0 0.0% 31.93 31.61 32.02 31.85 0.22 0.7% 18.15

APC 1367 50 50 50 50 0 0.0% 50 50 31.92 43.97 10.4 23.7% 6.027

APC 1450 41.52 31.38 29.5 34.15 6.451 18.9% 34.11 30.4 50 38.17 10.4 27.3% -4.023

CTNNB1 CD41 50 50 35.6 45.19 8.337 18.4% 32.48 31.07 30.93 31.49 0.86 2.7% 13.69

CTNNB1 CD45 50 50 50 50 0 0.0% 30.08 32.59 33.01 31.89 1.58 5.0% 18.11

KRAS CD 12 50 50 50 50 0 0.0% 50 50 50 50 0 0.0% 0

KRAS CD 13 50 50 50 50 0 0.0% 50 36.76 50 45.59 7.64 16.8% 4.413

BRAF 36.98 40.83 43 33.52 34.19 33.78 33.83 0.34 1.0% -33.83

Bioline master mix and KAPA Probe Fast qPCR master Mix (2x) were further compared using samples with different mutation frequency and on different qPCR machines (Roche LC 480 vs BioradCFX 384). The control is in FLEX channel while all the targeted mutations are in Fam. Delta Ct was calculated for each sample as follows: Ct difference (ACt) = Mutation Assay Ct - Control Assay Ct. The data were summarized in Table 24.

3.1.1. Table 24. Comparison of KAPA probe fast qPCR master master mix and Bioline master mix on present invention targets with different mutation frequency and on different qPCR machines (Roche LC 480 vs Biorad CFX 384).

5.1. Master Mix selection Conclusion

Bioline master mix and KAPA Probe Fast qPCR Master Mix (2x) Universal are comparable when the mutation frequency is 5% or higher while when mutation frequency is lower (0.5% or 0.1% or lower), KAPA Probe Fast qPCR Master Mix (2x) Universal performed better in regarding to differentiating mutant and WT alleles. Therefore, KAPA Probe Fast qPCR Master Mix (2x) Universal will be used in the present invention assay.

5.2. Optimization of the assay reagent composition and thermocycling conditions.

5.2.1. Primers for BRAF c600 and KRAS cl2, cl3 were designed and optimized previously in existing QClamp SYBR commercial products (DC-10-1066, DC-10- 0036, DC-10-0039, DC-10- 1039, DC-10-0197, DC-10-0169).

5.2.2. The APC, CTN B1, beta- ACT primers were designed to have annealing temperatures same as BRAF and KRAS primer pairs (64C for Roche and BioRad instruments).

5.2.3. Annealing temperature gradients (60-70C) were performed using the Roche LC96 with KAPA Probe Fast qPCR Master Mix (2x) Universal to find the optimal annealing temperature of each target primers and probes. The results of the gradient analysis were summarized in Table 25 and Table 26.

Table 25. Gradient analysis of annealing temperature for assay primers and probes (No XNA)

Table 26. Gradient analysis of annealing temperatures for assay primers and probes (With XNA)

Average Ct (mean ± SD) Average Ct (mean ± SD) Average Ct (mean ± SD)

Temperature (° C) 5% WT A Ct 5% WT A Ct 5% WT A Ct

60 31.39 40 8.61 31.69 34 2.31 33.16 35.07 1.91

60.5 31.26 40 8.74 31.71 34.53 2.82 33.66 36.18 2.52

61.5 31.1 40 8.9 31.75 35.21 3.46 33.41 36.37 2.96

5.2.1. PCR annealing temperature conclusion: 63-64 C annealing temperatures were demonstrated to be optimal for differentiation of mutant and WT alleles for all the invention assay targets.

5.2.2. Optimization of PCR cycling conditions

XNAs are employed in the invention Taqman mutation detection assays to suppress wt amplification in order to improve mutation detection sensitivity. For efficient clamping by the XNA, a XNA annealing step at 70°C before the binding of primers and probes is included in the qPCR cycling program. Based on gradient analysis of the primer and probe annealing temperature, the thermo cycling conditions for the invention Taqman mutation detection assays is optimized as follows:

5.2.3. 95 °C for 5 min followed by 50 cycles of 95 °C 20 seconds, 70 °C 40 seconds, 64 °C 30 seconds and 72 °C 30 seconds (data acquisition).

5.3. Optimization of Primer and Probe Concentrations

5.3.1. Primer and probe matrix dilution experiments were conducted to find the optimal concentrations for differentiating mutant and WT alleles of targeted genes.

Table 27. Primer concentrations and Ratio of Primer to probe tested:

5.3.1. The use of XNA combined with limited primer/probe concentration resulted in less or no WT background Amplification for selected locus specific probes. The results of optimization of primer, probe and XNA concentrations are summarized in Tables 28

Table 28. Primer, probe and XNA titration for CTNNB l c41 assay on Bio-Rad CFX 384

Table 29. XNA titration for CTNNB 1 c41 assay with primer/probe at 200 nM/100 nm on LC 96

Table 30. Primer, probe and XNA titration for CTNNBl c45 assay on LC 96

Table 31. XNA titration for BRAF c600 assay with primer/probe at 100 nM/50 nM on LC 96

Average Ct (mean ± SD)

XNA final cone, (um) 5% BRAF V600 WT A Ct

2 29.68 ± 0.36 40 ± 0 10.32

1 30.25 ± 0.7 38.78 ± 2.1 8.53

0.5 29.78 ± 0.49 38.77 ± 2.12 8.99

0 24.61 ± 0.11 24.73 ± 0.18 0.12 Table 32. Primer, probe and XNA titration for BRAF codon 600 assay on LC 480

Table 33. XNA titration for KRAS codon 12 assay with primer/probe 400 nM/200 nM on LC96

Table 34. Primer and probe titration for KRAS cl2 assay on LC480

3.1.2. Table 35. XNA titration for KRAS cl3 assay with primer/probe 400 nM/200 nM LC96

Average Ct (mean ± SD)

XNA final cone. (μΜ) 5% KRAS cl3 WT ACt

2 31.95 + 0.45 40 + 0 8.05

1 31.13 + 0.13 40 + 0 8.87

0.5 31.58 + 0.11 40 + 0 8.42

0 27.36 + 0.15 27.06 + 0.06 0.3 Table 36. KRAS cl3 XNA titration with primer/probe 200-100 nM/100-50 Nm on LC480

5.3. Optimized Primer and Probe Concentrations

5.3.1. Optimal concentrations are 0.1 uM primer and 0.05 uM probe for differentiating mutant and WT of CTNNBl c45, BRAF c600 on Roche LightCycler 96, Roche LightCycler480 and

BioRadCFX384.

5.3.2. For CTNNBl c41, 0.2 um primer and 0.1 um probe are optimal for differentiating mutant and WT alleles on Roche Light cycler 96, Roche Light Cycler 480.

5.3.1. For KRAS12 and 13, 0.4/0.2 um primer and probe are optimal for differentiating mutant and WT on LC 96, 0.2 um primer and 0.1 um probe are optimal for differentiating mutant and

WT on LC 480 and BioRadCFX384.

5.3.2. In general, using limited primers and locus specific probes concentration ((100 Nm to 200 Nm/50 to 100 nM) result in less or no WT background amplification with XNA. Primer/probe cone, above 0.4/0.2 um usually result in WT background amplification with XNA. The use of limited primer/probe cone, combined with XNA will result in less or no WT background amplification for selected locus specific probes.

5.4. Optimization of XNA concentration with primer-probes

5.4.1. Primers and probes were screened for differentiating mutant and WT alleles in presence of XNA. For optimization, XNA titration and limited primer and probe concentration (100 Nm to 200 nM/50 to 100 nM) were used.

5.4.2. The following primers were screened by SYBR assay to find the primer pairs that result in best ACt between mutant and WT alleles (Tables 37-39).

Table 37. Primers screened for APC 1309, APC 1367 and APC 1450

Target Forward Primer Sequence Forward Primer Sequence

APC APC001F GAATCAGCTCCATCCA APC001R CTGTGACACTGCTGGAACT 1309 SEQ ID NO:6 AGT SEQ ID NO:7 TCGC

APC APC002F AGCACCCTAGAACCAA APC002R TGGCATGGTTTGTCCAG 1367 SEQ ID NO:8 ATCCAGCAG SEQ ID NO:9 GGC

APC APC003F ACAAACCATGCCACCA APC003R GAGCACTCAGGCTGGATG 1450 SEQ ID NO: 10 AGCAGA SEQ ID NO: 11 AACAAG

APC APC SI F2 GGATGTAATCAGACGAC APC SI R2 CACAGGATCTTCATCTGAC 1309 SEQ ID NO: 12 ACAGGA SEQ ID NO: 13 CTAGTT

APC APC S2 F2 TCTCCCTCCAAAAGTG APC S2 R2 AAACTATCAAGTGAACTGA 1367 SEQ ID NO: 14 GTG SEQ ID NO: 15 CAGAAG

APC APC S3 1 F2 CCAGATAGCCCTGGA APC S3 1 R2 CTTTTCAGCAGTAGGTGCT 1450 SEQ ID NO: 16 CAAACC SEQ ID NO: 17 TTATTTTTA

Table 38. Optimization of XNA and primer concentration for APC 1309, 1367 and 1450.

Table 39. Primers screened for BCT 41 and BCT 45.

A Primer/XNA Matrix was run to find the optimal Primer/XNA concentrations which gave the best differential between WT and 5%MT of BCT c41. The primer/XNA matrix analysis was summarized in Table 40.

Table 40. Matrix analysis of XNA and primer concentration for BCT41.

5.3.1. For the other targeted mutations including BRAF V600 and KRAS cl2 and cl3, the primer pairs that were used in DiaCarta Qclamp SYBR Kits of BRAF and KRAS cl2 and KRAS cl3 assays were also used in the development of the Taqman probe based BRAF and KRAS cl2 and KRAS cl3 mutation detection assays.

5.3.2. Primer, probe and XNA combinations and concentrations that resulted in highest delta Ct (measured as the difference between Cts of the mutation detection assay for the WT and 5%Mut samples) were selected for each targeted mutation detection assay.

5.3.3. The following primers and probes and XNA showed the best performance in regarding to differentiating mutant and WT alleles. For more details in the screening of primers by SYBR assay, please see the attached file with this document.

Table 41. Names of Primers, probes and XNAs selected for final configuration of assays:

Table 42. Final Composition of assay of the invention

Final

Target Component Name Component Sequence Concentration

(nM)

APC 1309DEL APC 1309TAQ-F - ACGACACAGGAAGCAGATTCT 300

SEQ ID NO:22

APC 1309DEL APC 1309TAQ-R- TCACAGGATCTTCAGCTGACCT 300

SEQ ID NO:23

APC 1309DEL APC 1309Pr - TTCCAATCTTTTATTTCTGCTATT 250

SEQ ID NO:24

APC 1309DEL APCXNA001A- Lys-0-(CTGACCTAGTTCCAATCTTTTCTT)PNA

SEQ ID NO:25 250

APC 1367C>T EAPC 1367F001- TTCAGGAGCGAAATCTCCC 400

SEQ ID NO:26

APC 1367C>T EAPC 1367R001- TGAACATAGTGTTCAGGTG 400

SEQ ID NO:27

APC 1367C>T APC 1367 Zen 5V56- 200 probe-2 FAM/CAAAAGTGG/ZEN/TGCTTAGACACCCAAAAG

SEQ ID NO:28 T/31ABkFQ/-3' APC 13670T APCXNA002S Lys-0-(AGTGGTGCTCAGACA)PNA 250 SEQ ID NO:29

APCcl450 APC3 1F002 CCAGATAGCCCTGGACAAACC 400

SEQ ID NO:30

APCcl450 APC3 1R002 CTTTTCAGCAGTAGGTGCTTTATTTTTA 400

SEQIDNO:31

APCcl450 APC1450 01 AGGTACTTCTCACTTGGTTT 200

SEQ ID NO:32

APCcl450 CS03.1 TAGGTACTTCTCGCTTGGTTT 250

SEQ ID NO:33

CTN B1 c41 PB-CTN B1-F ACTCTGGAATCCATTCTGGTGC 200

SEQ ID NO:34

CTN B1 c41 PB-CTN B1-R AGAAAATCCCTGTTCCCACTCATA 200

SEQ ID NO:35

CTN B1 c41 CTN B1M02S AGGAAGAGGATGTGGATACCTCCCAAG 100

SEQ ID NO:36

CTN B1 c41 CS05SXNA 500

SEQ ID NO:37 Lys-0-(TGCCACTACCACAGCTC)PNA

CTN B1 c45 PB-CTN B2-F ACTCTGGAATCCATTCTGGTGC 100

SEQ ID NO:38

CTN B1 c45 PB-CTN B2-R AGAAAATCCCTGTTCCCACTCATA 100

SEQ ID NO:39

CTN B1 c45 CTN B2M02S AGGAAGAGGATGTGGATACCTCCCAAG 50

SEQ ID NO:40

CTN B1 c45 CS06SXNA Ac-CTCCTTCTCTGAGTG-NH2 500

SEQIDN0:41

KRAScl2 KRASBioFP002 AAGGCCTGCTGAAAATGACTG 200

SEQ ID NO:42

KRAScl2 KRASG12VBPR001 GTTGGATCATATTCGTCCAC 200

SEQ ID NO:43

KRAScl2 KRASCS02 TCTGAATTAGCTGTATCGTCAAGGCACTC 100

SEQ ID NO:44

KRAScl2 K001C2XNA CTACGCCACCAGCTCCAACTACCA-O-D-Lys 250

SEQ ID NO:45

KRAS cl3 C13F001 ACTTGTGGTAGTTGGAGCTGGT 200

SEQ ID NO:46

KRAS cl3 KRASG12VBPR002 GTTGGATCATATTCGTCCAC 200

SEQ ID NO:47

KRAS c 13 KRASCS03 TCTGAATTAGCTGTATCGTCAAGGCACTC 100

SEQ ID NO:48

KRAS c 13 K002BXNA D-LYS-PEG2-TCTTGCCTACGCCACCAGCTCCA-NH2 500

SEQ ID NO:49

BRAF c600 BRAFAZFPNEW02 ACAGTAAAAATAGGTGATTTTGGTCTAGCTA 100

SEQ ID NO:50 BRAF c600 BRAFAZRP001 CATCCACAAAATGGATCCAGACAA 100 SEQ ID NO:51

BRAF c600 BRAF600P01 CAAACTGATGGGACCCACTCCATCG 50

SEQ ID NO:52

BRAF C600 E BR001B ATCGAGATTTCACTGTAGCTAGAC 500

SEQ ID NO:53

ΑΟΤβ ACTBF CCTGGACTTCGAGCAAGAGA 100

SEQ ID NO:54

ΑΟΤβ ACTBR CCGTCAGGCAGCTCGTA 100

SEQ ID NO:55

ΑΟΤβ ActBPr CTTCCAGCTCCTCCCTGGAGAA 100

SEQ ID NO:56

5.3. Examples of amplification curves for final configuration of the invention assays

5.3.1. The following figures illustrate the performance examples present invention assays with optimal primer, probe, XNA concentration and ACt between Wt and mutant.

5.3. Preliminary Analytical Validation for present invention

Based on experiments on each of the invention target primers, probe and XNA combination and titration, optimal conditions were obtained for each targeted mutation detection assay as listed in Table 22 and illustrated in figures above. The finalized assays of the invention were assessed for test specificity, sensitivity and reproducibility.

5.3.1. Accuracy

A set of cell lines with known mutation status were tested to evaluate the assay of the invention accuracy. The invention assays were run on the Roche LC 96 instrument. Only expected mutations were detected in all tested cell lines. Table 43. CTNNBl c41, CTNNBl c45, KRAS cl2, KRAS cl3 and BRAF c600 tests on cell lines with known mutation status.

LIM1215 P.T41A CD41 (35.20 ± 1.08) Yes

CW2 APC1465 DELAG no mutations detected

HCT 116 Cd. 45 delTCT. KRAS Glv to Asp (13) CD45 (31.89 ± 0.04). G13D Yes

NC 14549 APC CD1556 INSA BRAF C600 (33.4 ± 0.5) Yes

COL0678 T1556fs*3, KRAS Glv to Asp (12) KRAS 12 (34.72 ± 0.23) Yes

HDC73 WT no mutations detected Yes

5.3.1. Analytical sensitivity

Analytical Sensitivity was determined by testing of DNA samples with a serial dilutions of DNA into wild type DNA. Mutation detection assays were performed on DNA samples with 5%, 1%, 0.5%, 0.1%, mutation DNA in wt background respectively. The lowest percentage of mutated DNA in wild type background that can be detected is determined. At least 0.5% of mutation DNA in wild type background can be detected by the invention Taqman assays (See Table 18) and Table 19. Table 44. Invention Mutation detection assays of mutation DNA diluted to wt DNA (5%, 1%, 0.5%) and 0.10%>) with PCR cycles of 40 and run file data analysis using the Abs Quant/Fit Points algorithm. The control is in HEX channel while all the targeted mutations are in Fam. Delta Ct was calculated for each sample as follows: Ct difference (ACt) = Mutation Assay Ct - Control Assay Ct.

Table 45. Sensitivity of the invention Mutation detection assays.

Mutant DNA diluted into WT DNA to 5%, 1% and 0.10%. 50 cycles PCR and run file data analysis using the Abs Quant/2¹¹^ derivative max algorithm. The control is in HEX channel while all the targeted mutations are in Fam. Delta Ct was calculated for each sample as follows: Ct difference (ACt) = Mutation Assay Ct - Control Assay Ct.

ACt = Ct Fam - ACt = Ct Fam -

Ct Hex Ct Fam Ct Hex Ct Hex

APC 1309 Runl Run2 Runl Run2 Runl Run2

5% 29.01 28.85 30.81 43.43 1.8 14.58

1% 28.63 28.55 32.81 46.39 4.18 17.84

0.10% 28.5 28.49 33.15 50 4.65 21.51

CC 29.01 28.69 50 50 20.99 21.31

APC 1367

5% 28.94 28.77 31.47 31.65 2.53 2.88

28.69 28.69

1% 28.71 28.63 33.78 34.2 5.09 5.57

0.10% 28.71 28.53 35.83 37.05 7.12 8.52

CC 28.94 28.76 50 50 21.06 21.24

APC 1450

5% 29.04 29.21 34.05 35.65 5.01 6.44

1% 28.98 29.25 36.49 38.16 7.51 8.91

0.10% 28.87 29.12 39.36 41.49 10.49 12.37

CC 29.04 29.01 47.37 45.64 18.33 16.63

CTNNBl

CD41

5% 28.85 29.63 31.96 33.04 3.11 3.41

1% 28.89 29.22 34.66 39.28 5.77 10.06

0.10% 28.5 29.15 39.99 37.25 11.49 8.1

CC 28.86 29.02 40.06 39.98 11.2 10.96

CTNNBl

CD45 5% 29 29.83 31.34 31.59 2.34 1.76

1% 28.98 29.07 34.1 34.57 5.12 5.5

0.10% 28.75 28.76 36.53 38.25 7.78 9.49

cc 29 28.95 41.13 41.47 12.13 12.52

KRAS CD12

5% 28.87 28.95 34.51 34.17 5.64 5.22

1% 28.77 28.66 37.17 37.87 8.4 9.21

0.10% 28.81 28.93 42.12 45 13.31 16.07

CC 28.87 28.92 43.54 43.28 14.67 14.36

KRAS CD13

5% 28.84 28.89 36.17 36.2 7.33 7.31

1% 28.88 28.95 39.95 40.23 11.07 11.28

0.10% 28.93 29.11 42.78 43.9 13.85 14.79

CC 28.84 29.19 43.99 46.67 15.15 17.48

BRAF

5% 28.97 29.18 32.61 32.75 3.64 3.57

1% 28.88 29.04 35.52 34.75 6.64 5.71

0.10% 28.71 29.05 38.05 37.13 9.34 8.08

CC 28.97 29.19 39.65 39.95 10.68 10.76

5.3.1. Assay Precision

Reproducibility (Precision) of the invention assays was demonstrated by comparing test results from mutation detection assays on 5% AF sample from multiple runs throughout the feasibility study period (See Table 46 and 47). %CV values were calculated within runs and between runs to test inter-assay and intra-assay precision (Table 47 and 48).

Data presented in tables 47 and 48 indicated that all the invention assays have good intra- and inter- assay precision with %CV <10.

Table 46. Assay Precision and instrument comparison: Inter-assay reproducibility: Invention Taqman assays run on different dates on LC96

Assay Run 1 Average Ct (mean ± SD) Run2 Average Ct (mean ± SD)

Targeted Targeted

mutation 5% PC WT A Cl mutation 5% PC WT A Ct

CTN B 1 c41 CTN B 1

(0.5%) 33.9 ± 0.73 (CV 2.15%) 40 ± 0 6.1 c41 30.61 ± 0.16 (CV 0.52%) 40 ± 0 9.39

Table 47. Assay Precision and instrument comparison: Inter-assay reproducibility: Invention Taqman assays run on different dates on LC480

Table 48. Assay precision (Intra-assay reproducibility)

Assay Average Ct (mean ± SD)

Targeted mutation 5% PC WT ACt

APC 1309 31.37 ±1.75 (CV 5.6%) 40 ±0 8.63

APC 1367 32.45 ±0.43 (CV 1.3%) 40 ±0 7.55

APC 1450 32.73 ±0.37 (CV 1.1%) 40 ±0 7.27

BCT c41 28.22 ±0.43 (CV 1.5%) 37.96 ± 1.76 9.74

BCT c45 30.08 ±0.57 (CV 1.9%) 40 ±0 9.92

KRAS cl2 29.1 ±1.47 (CV 5.1%) 40 ±0 10.9

KRAS cl3 32.1 ±0.26 (CV 0.8%) 40 ±0 7.9

BRAF V600 32.73 ± 0.26 (CV 0.8%) 40 ±0 7.27 Table 49. Table Assay precision (Inter-assay reproducibility)

5.3.1. Analytical specificity

Analytical specificity was tested by performing the assay on reference samples with known mutation negative status. All the test results were as expected (see Table 43).

5.7.1. Limit of blank was tested by performing the assay on the NTC samples.

All tested NTC samples were called negative.

1. Conclusions

1.1. The final design is presented in the Tables 41 and 42.

1.2. Final assay PCR cycling parameters are presented in section 5.2.3 :

95 °C for 5 min followed by 50 cycles of 95 °C 20 seconds, 70 °C 40

seconds, 64 °C 30 seconds and 72 °C 30 seconds (data acquisition).

1.3. The present invention design demonstrated that the performance parameters of the tested design met or exceeded specifications set in the product requirement document (DDC.0006) and the assay is ready for the development stage.

1.3.1. Product requirement 1 for the sample types tested will be tested in the Matrix interference test of the Verification study. Requirements 11-15 will be also tested in Verification and Stability studies of the Development stage.

1.3.2. Product requirement 2 is met: under 60 min for reaction setup and under 2.5h for the reaction PCR run on the three qPCR instruments tested.

1.3.3. Product requirement 3 will be addressed in a separate stool DNA preparation study

1.3.4. Product requirement 4 is met by having 7 reaction mixes where each gene is tested in a separate reaction mix, KRAS 12 and KRAS 13 are in two separate reactions; CTNNB 41 and 45 are also in 2 separate reactions. APC is tested in 2 tubes.

1.3.5. Product requirement 5 is met by testing the assay on all three listed qPCR instruments - Roce LC96 and LC480 and BioRad CFX

1.3.6. Product requirement 6 is met by including the internal control assay in each reaction tube that provides evidence of the sufficient quantity of amplifyable DNA in each reaction well.

1.3.7. Product requirement 7 is met, kit contains NTC, WT control and mixed positive control.

1.3.8. At least 0.5% of mutatnt DNA in wild type background can be detected by the present inventionTaqman assays (high sensitivity) with total DNA input of 2.5 ng/well. Exceeds Product requirement 8 set for detection of 1% mutant DNA.

1.3.9. The data presented in this report demonstrate the feasibility of the present invention design to detect intended mutations with no cross-reactivity observed. Product requirement 9 1.3.10. The design also showed good intra and inter- assay reproducibility (CV <10%).

Product requirement 10 is met.

1.4. The final design is presented in the Tables 41 and 42.

1.5. Final assay PCR cycling parameters are presented in section 5.2.3 :

95 °C for 5 min followed by 50 cycles of 95 °C 20 seconds, 70 °C 40

seconds, 64 °C 30 seconds and 72 °C 30 seconds (data acquisition

EXAMPLE IV

This example further describes the verification and validation studies of the assay of the invention for qualitative detection of mutations in targeted genes of APC (codons 1309, 1367, 1450), KRAS (codons 12 and 13), BRAF (codon 600) and CTNNB1 (codons 41 and 45) genes associated with colorectal cancer initiating events. The assay and -kit has been validated for precision, limit of detection (LOD), stability, specificity/cross-reactivity and matrix interference.

The verification and validation studies were performed on two development lots of the assays and kits. Mixed positive controls were used as test samples except that positive controls for APC 1309 and APC 1367 were prepared individually for the LOD studies. The mutation detection protocol is as described in the present invention for doing the test samples. The validation tests were run on LC 480 (for instrument comparison, the tests were also run on BioRad384).

The assay of the invention is a real-time qPCR-based in vitro diagnostic test intended for use in the detection of mutations in the APC (codons 1309, 1367, and 1450), KRAS (codons 12 and 13), BRAF (codon 600) and CTNNB1 (codons 41 and 45) genes in DNA extracted from FFPE sections and Human stool samples.

OUTLINE OF THE VALIDATION PLAN

Test analytic sensitivity of the assay (LOD) and allelic frequency

Test Limit of Blank of the assay

Test matrix interference (e.g. FFPE extraction, add ethanol) for the potential inhibitory effect of several substances that would most probably be encountered in the real patient samples

Test cross-reactivity (detection of each of the present invention target DNA).

Test reproducibility of the assay:

Intra-assay: replicate samples representative of all mutations near LOD

Inter-assay: 3x3 samples in 3 runs per instrument

Lot-to-lot variation tested by repeating 1.5.1 and 1.5.2 on second lot, on same run

Instrument comparison on Roche LC480, BioRad CFX384

Operator variability (2 operators test same lot on the same day on same instrument)

Test analytic specificity on both lots

Analytic Specificity test on high concentration of WT reference samples

Invention stability studies

Accelerated stability studies

Freeze-thaw stability studies

Real-time stability studies

Deviations from the planned V&V of the invention assay analytical performance

Sensifast lyophilized Bioline mastermix was reverted to KAPA Universal 2x liquid formulation for the two reasons: The timelines of the manufacturing on the Bioline side were too long and The assay sensitivity at 1% mutation was not as good as with KAPA

Manufacturing ·: Reagents for some primer-probe mixes were purchased separately for lot 2, others- same

The tubes used to aliquote the kits were from USA scientific, planned to be change to the stock of approved tubes from Fisher Scientific that are used for all the current product manufacturing. The run time for the BioRad CFX 384 instrument exceeds 2h limit set as Product Requirement #5. The requirement was not an essential one and 2.5h run time was considered acceptable. 1. MATERIALS AND METHODS

Composition of the PCR reaction Mix

Table 50. PCR reaction mix

Reference templates:

CTNNB1 CD 41 : IDT gBlock, custom

CTNNB1 CD 45: ATCC CCL-247 D1

BRAF C600: BRAF C600 Reference standard (Horizon Cat#: HD238)

KRAS cl3 : KRAS G13D Reference Standard (Horizon Cat#: HD290)

KRAS cl2: KRAS G12D Reference Standard (Horizon Cat#: HD272)

APC 1309: ATCC CRL-2158 D1

APC 1367: ATCC CRL-2102 D1

APC 1450: ATCC CCL-235 D1

Instruments

Roche LC480n DC2035, S/N 5536

BioRad CFX384 DC2044, S/N 786BR02318

Reagents/Kits

2 development lots (DL-1 and DL-2) of the Multiplexed Colorectal Cancer detection Kits including:

2XPCR master mix,

5x invention primer and probe mixes,

lOx present invention XNA mixes and

mixed positive controls as described in the reference templates and

- non-template control (NTC, nuclease free water.) The report on the development lots is in DDC.0041 VERIFICATION OF ASSAY PERFORMANCE PARAMETERS

Analytical sensitivity of the assay (LOD)

Analytical sensitivity of the assay was evaluated by testing 1%, 0.5% and 0.1% mutand DNA template at 2.5ng, 5ng and 10 ng input for all the present invention targets. For each target, 1%, 0.5% and 0.1 % mutation at each of the three DNA input level were tested in triplicates and on 3 separate runs on LC 480. No template control (NTC), wild type DNA (clamping control) and mixed positive controls (APC 1309 and APC 1367 positive controls were prepared individually) were included in each run. Average Ct values, standard deviation (SD) and coefficient of variation (%CV) were calculated for both FAM (target) and HEX (internal control). The ACt values (ACt = Ct Fam - Ct Hex) were calculated from the averaged Ct values (Table 51 to Table ). The average ACt values over all 3 DNA input levels for all three runs were calculated. The cutoff ACt is set to be the average ACt values - 1.5AQ SD (Table ). Correct call percentage were calculated for 1%, 0.5% and 0.1% mutation detection of all target at 2.5 ng, 5ng and lOng DNA input (Table 53 and Table 54-). Correct call percentage were also calculated for 1% mutation detection of all target at 5 ng DNA input with all runs during the V&V period and results were incorporated in Tables 53 and 54 .

Table 51. Average FAM CT values for WT, 1%, 0.5% and 0.1 % mutant DNA template of at 2.5 ng, 5 ng and 10 ng DNA input.

APC1450 36.17 0.69 1.90% 34.9 0.58 0.02 33.74 0.26 0.77%

BTC CD41 32.27 0.39 1.20% 30.51 0.14 0 29.31 0.11 0.37%

BTC CD45 33.99 0.34 0.99% 32.98 0.42 0.01 31.79 0.29 0.92%

KRAS CD 12 37.59 2.6 6.92% 35.55 0.76 0.02 34.11 0.37 1.09%

KRAS CD 13 38.42 1.02 2.65% 36.67 0.54 0.01 35.6 0.52 1.45%

BRAF V600 36.66 1.38 3.77% 34.65 0.6 0.02 33.57 0.39 1.18%

Control 29.88 0.16 0.55% 28.88 0.11 0.38% 28.11 0.13 0.48%

0.5% mutation

Target AVE SD cv AVE SD CV AVE SD CV

APC1309 44.71 7.52 16.83% 34.08 2.34 0.07 48.11 5.33 11.08%

APC1367 35.36 0.65 1.83% 35.71 0.86 0.02 32.53 0.17 0.53%

APC1450 38.5 4.09 10.63% 36.06 0.38 0.01 34.9 0.33 0.94%

BTC CD41 33.15 0.45 1.36% 31.5 0.18 0.01 30.82 0.25 0.80%

BTC CD45 35.35 0.64 1.80% 33.74 0.45 0.01 32.8 0.53 1.61%

KRAS CD 12 39.81 2.4 6.04% 36.72 0.96 0.03 35.18 0.69 1.96%

KRAS CD 13 39.86 2.19 5.48% 38.24 0.68 0.02 36.85 0.94 2.55%

BRAF V600 38.54 2.66 6.91% 35.52 0.68 0.02 34.59 0.84 2.43%

Control 29.91 0.2 0.66% 28.92 0.17 0.60% 28.12 0.19 0.68%

0.1% mutation

Target AVE SD CV AVE SD CV AVE SD CV

APC1309 50 0 0.00% 50 0 0 50 0 0.00%

APC1367 43.26 6.42 14.84% 39.13 4.88 0.12 35.05 0.75 2.13%

APC1450 40.13 3.63 9.05% 37.76 0.56 0.01 36.64 0.44 1.21%

BTC CD41 38.31 5.39 14.06% 33.24 1.12 0.03 32.92 0.23 0.70%

BTC CD45 41.09 3.03 7.38% 37.34 2.14 0.06 35.37 0.99 2.79%

KRAS CD 12 42.19 2.88 6.83% 40.42 2.37 0.06 37.34 1.58 4.24%

KRAS CD 13 41.33 1.72 4.17% 39.79 2.02 0.05 39.28 1.57 3.99%

BRAF V600 39.01 2.21 5.66% 37.61 1.44 0.04 36.71 1.46 3.98%

Control 29.9 0.22 0.72% 28.82 0.17 0.58% 28.08 0.1 0.35%

Table 52. Average Δ CT values for WT, 1%, 0.5% and 0.1 % mutant DNA template of at 2.5 ng, 5 ng and 10 ng DNA input.

Table 53. ACt cut-off values for Roche LC480

Table 54. Analytical sensitivity of the present invention assay based on the cut-off values from Table 3

Note: The data in table 54 were calculated based on the values from all the experiments that contained 1%, 5% and 0.1% mutant data for 5 ng input.

Table 55. Limit of detection summary for LC480

CONCLUSION:

0.5% mutation frequency in APC (cl367, cl450), BCT(c41,c 45), KRAS(cl2, cl3) can be reliably detected (100% correct call) at as low as 2.5 ng DNA input per PCR reaction. - at 5 ng DNA input 1% mutation in APC 1309 and BRAF V600 can be detected with

94% and 100% correct calls respectively. For APC (cl367, cl450), BCT(c41,c 45) and KRAS(cl2, cl3) analytic sensitivity is 0.5% at this input with 100% correct calls.

Limit of Blank of the assay

Non-template controls (nuclease free water) were run with each validation test to monitor for contamination in

the PCR. The data for NTC from 50 replicates from multiple runs were compiled (Table 56) and analyzed to estimate level of background noise of the present invention assays.

Table 56. Limit of Blank test result

CONCLUSION: For present invention targets including APC 1450, BCT 41, BCT 45, KRAS 12 and BRAF V600, there is no background amplification noise with no detected amplification for these targets when testing NTC. For APC 1309/1367 and KRAS13, there is minimal background noise with average Ct over 48 and 49 respectively.

Matrix Interference

To determine whether residual common substance in DNA isolated from FFPE has interfering inhibitory effect on the performance of the present invention assay, Ethanol (ETOH) was spiked in the DNA samples at 2%, 5% and 10% concentration and tested in 5 replicates on Roche LC 480. The average Ct values were calculated for each sample. The average Ct difference between each sample spiked with alcohol and the unspiked sample was calculated and summarized in Table 57.

Table 57. Matrix Interference

CONCLUSION:

The Ct difference between the unspiked and spiked test was used to determine if the tested ETOH amount caused inhibition of the present invention qPCR reactions. Data in Table showed that there is no EHOH interference on the present invention assays with up to 10% ETOH spiked in samples for most present invention targets including APC 1309/1367, APC 1450, BCT 41, BCT 45 and BRAF V600. KRAS 13 amplification was inhibited by as little as 2% ETOH (dCT over 2).

Cross-reactivity.

There are 8 target mutation detection reactions in the present invention assay. Each target assay was tested against all positive reference material to evaluate the cross-reactivity. Each assay mix was tested with three replicates of the eight individual 1% mutation standards. Some of the reference materials carry more than one target mutations (e.g. the BRAF reference standard from Horizon carries BRAF V600E, BCT 45 and KRAS 13 mutations at 50% frequency, the BCT 45 standard from ATCC also carries KRAS 13 mutation at 50% frequency). ACt (Ct Fam- CtHex) was calculated for each standard with all the mutation reactions and summarized in Table 58. Mutational status (Positive or Negative) of each test sample was determined on the basis of the cut-off dCT values (see Table 53).

Table 58. Cross-reactivity of the invention assays

CONCLUSION:

All target mutations including APC 1309, APC 1367, APC 1450, BCT 41, BCT 45, BRAF V600 were detected as expected by present invention assay, indicating there is no cross-reactivity of the different target detection. KRAS 12 is producing a signal in KRAS13 positive samples, but there is 6 Ct difference between the true KRAS 13 signal and the cross-talk signal from KRAS 12. This pattern can be used to differentiate between true KRAS 12 and KRAS 13 positive samples. Since the kit is to detect KRAS 12 and KRAS 13 mutations but not to differentiate them, the cross- talk will not have impact on the performance of the kit. Therefore, only intended target mutations can be detected by the present invention kit.

DNA input limits

Based on the analytical sensitivity studies (section 5.1), 2.5 ng or 5 ng was found to be the minimum

DNA input for the present invention kit to detect 1% mutations. To determine the maximum permissible DNA sample input for the present invention qPCR assays, high amounts of wild- type human genomic DNA were tested. Present invention qPCR assays (Fam and Hex) with different WT DNA inputs were performed for all targets in triplicates. The upper LOD was expected to be determined as the lowest DNA input levels producing false positive test results. qPCR with β-actin (Hex) was used to estimate the DNA amount and demonstrate PCR efficiency (Fig. 1). ACt (ACt = Ct Fam - Ct Hex) was calculated for each DNA input sample and compared to the ACt cut-off values to determine the mutation status of each DNA input sample (Table 53).

Table 59. Summary of the upper LOD test results ( ACt = Ct Fam - Ct Hex).

CONCLUSION:

The DNA input amount (control Ct value) between 31 <Ct <24, was shown to be acceptable for the present invention assay corresponding to 2.5ng to 320 ng per gDNA per well. ACt analysis of different DNA input amounts showed 100% correct calls. No false positive results were observed with up to 320 ng DNA input. Since the recommended DNA input for present invention mutation detection assays is only 5 ng/per reaction, it is unlikely that there will be false positive result due to sample overloading at this level of input.

Assay Precision Study results

Two development lots of present invention Kit reagents were used in the reproducibility experiments - DL1 and DL2. Two operators (Qing Sun and Larry Pastor) were testing the kits on two different instruments. The main instrument was LC480 from Roche, the second test instrument was BioRad CFX384. These tests were performed to assess that the product meets requirements set in DDC.0006.

Experiments were performed to evaluate the reproducibility of the present invention assays including intra-assay, inter- assay, lot-to- lot, instrument comparison and operator reproducibility. For intra-assay reproducibility and instrument comparison, 9 replicates of each sample including NTC, WT and PC were tested in one run of each lot on one plate. To assess inter-assay, lot-to- lot and operator reproducibility, 3 replicates of each sample including NTC, WT and PC were tested in one run of each lot for all present invention targets on one plate. The intra-assay and inter-assay reproducibility experiments were repeated on DL2. The mean, SD, %CV value were calculated for each marker or each lot and test sample. The data are summarized in Tables 50 to 66 below.

All target Ct values are FAM signals, Control- from the internal control measured on HEX channel. Control values were calculated as averages for all replicates for each run.

Table 60. Intra-assay reproducibility test results (LC 480), (DLl)

Table 61. Intra-assay reproducibility testing results (BioRad 384), DLl .

Table 62. Inter-assay reproducibility testing results. Average Ct values for each run are shown. Average (Ave) is a total average for three runs.

Table 63. Lot - to -lot variability (Roche LC 480), DLl and DL2.

Table 64. Lot - to -lot variability (BioRad CFX384), DLl and DL2.

Table 65. Operator variability test (DL2, QS and LP). Average Ct values for each operator are shown.

Operatorl Operator2 Ave SD CV%

Assay WT

APC1309/1367 50.00 50.00 50.00 0.00 0.00%

APC1450 42.28 42.54 42.41 0.19 0.44%

BTC CD41 39.77 39.96 39.86 0.13 0.33%

BTC CD45 39.58 40.35 39.97 0.55 1.37%

KRAS CD 12 42.17 43.39 42.78 0.87 2.02%

KRAS CD 13 42.14 41.59 41.87 0.39 0.93%

BRAF V600 39.08 38.25 38.67 0.59 1.53%

Assay 5%PC

APC1309/1367 30.05 30.29 30.17 0.17 0.57%

APC1450 31.43 31.95 31.69 0.37 1.16%

BTC CD41 27.88 28.24 28.06 0.26 0.92%

BTC CD45 30.36 30.58 30.47 0.16 0.52%

KRAS CD 12 32.24 33.02 32.63 0.55 1.69%

KRAS CD 13 33.29 33.89 33.59 0.43 1.28%

BRAF V600 31.91 32.63 32.27 0.51 1.58%

Assay 1%PC

APC1309/1367 32.63 32.92 32.77 0.20 0.62%

APC1450 34.55 34.47 34.51 0.06 0.17%

BTC CD41 30.39 30.60 30.50 0.15 0.48%

BTC CD45 32.94 33.02 32.98 0.06 0.18%

KRAS CD 12 35.57 36.26 35.91 0.49 1.36%

KRAS CD 13 36.61 37.30 36.96 0.48 1.31%

BRAF V600 34.95 34.90 34.92 0.04 0.10% Table 66. Instalment comparison on Roche LC 480 and BioRad 384.

Note: Correct calls on LC480 and BioRad384 were made based on different cutoffs set on LC 480 and BioRad384.

Assay Precision Summary:

The data on precision testing of present invention kit reagents summarized in Tables 10 to 16 demonstrated that all the present invention assays have good intra-assay, inter-assay, lot-to-lot and operator reproducibility with %CV <10 (Product requirement PR10 met).

All planned tests of the sources of variation that could affect the reproducibility of the present invention assay were tested and results show that the assay is robust and meets product requirements as set in DDC.0007.

7.7 Assay sensitivity and specificity with FFPE samples (Matrix interference).

DNA from positive reference FFPE (KRAS G12D, Horizon Diagnostics) and negative (WT) FFPE was extracted with the QIAamp DSP DNA FFPE Tissue Kit (Catalog, Qiagen, REF 60604. QIAGEN GmbH, Hilden, Germany) following manufacturer's instructions. To determine the upper FFPE DNA input limit for the present invention assay (the maximum amount of WT DNA that can be tested without producing false positive results), different amounts of WT FFPE DNA (10 and 20 ng/well based on Qubit data) were used in the present invention reactions and tested on LC 480 instrument. Data -are summarized in Table 67.

Table 67. Summary of the upper FFPE DNA input test results ( ACt = Ct Fam - Ct Hex)

To estimate the assay sensitivity using DNA from FFPE, DNA input was set at 5ng/well by Qubit data. DNA samples containing KRAS G12D mutation at 2% and 4% allelic frequency were tested and data were summarized in Table 68.

Table 68. Summary of FFPE DNA (2% and 4% KRAS G12D) test results, 5ng/well (( ACt Fam - Ct Hex). Positive calls are underlined, negative - not underlined

CONCLUSIONS:

Specificity assessment for FFPE samples: Test results of different FFPE DNA input indicated that FFPE DNA input up to 20 ng/per well produced no false positive results.

Sensitivity assessment for FFPE samples:

Initial testing on FFPE DNA with 2% and 4% KRAS G12D mutation suggested 2% of KRAS G12D can be detected with 100% accuracy at 5 ng input FFPE DNA level.

All patents, patent applications and publications cited in this application including all cited references in those patents, applications and publications, are hereby incorporated by reference in their entirety for all purposes to the same extent as if each individual patent, patent application or publication were so individually denoted.

Although the foregoing description (Angres) contains many specifics, these should not be construed as limiting the scope of the present invention, but merely as providing illustrations of some of the presently preferred embodiments. Similarly, other embodiments may be devised without departing from the spirit or scope of the present invention. Features from different embodiments may be employed in combination. The scope of the invention is, therefore, indicated and limited only by the appended claims and their legal equivalents rather than by the foregoing description. All additions, deletions and modifications to the invention as disclosed herein which fall within the meaning and scope of the claims are to be embraced thereby.

Claims

What is claimed is:

1. A method for detecting the presence or absence of a known mutated gene associated with colorectal cancer contained in a biological sample, said method comprising the steps of:

(1) allowing a mixture of a clamp primer consisting of XNA which hybridizes with all or part of a target site having a sequence of a wild-type gene or a sequence complementary to the wild-type gene, a primer capable of amplifying a region comprising a target site having a sequence of the mutated gene, and the biological sample to coexist in a reaction solution for gene amplification, and selectively amplifying the region comprising a target site of the mutated gene by a gene amplification method, and

(2) selectively detecting a detection region comprising the target site of the mutated gene by a gene detection method, using an amplified product obtained in step (1) or part thereof as a template, to detect the presence or absence of the mutated gene.

2. A method for screening for the presence of colorectal cancer in a patient, the method comprising the steps of:

(a) obtaining a biological sample from said patient; and

(b) performing an assay that screen for DNA mutations in said sample employing a Xenonucleic acid clamp to detect mutations indicative of the presence of colorectal cancer.

3. A method of detecting a mutant gene associated with colorectal cancer, comprising: providing a sample containing DNA and a xeno nucleic acid clamp capable of hybridizing to a wild-type gene; and detecting a mutant of the gene in the sample with a xeno nucleic acid probe capable of hybridizing to the mutant gene.

4. A method for screening and/or monitoring a patient for mutations associated with colorectal cancer, the method comprising: isolating DNA from a stool sample, fresh peripheral blood (PB), and formalin-fixed, paraffin-embedded (FFPE) tissues sample obtained from the patient suspected of having a condition associated with colorectal cancer mutations; performing PCR on the extracted DNA to produce amplified DNA while using a xenonucleic acid clamp for blocking amplification of wild-type DNA; sequencing the amplified DNA in an automated sequencer; analyzing an output of the automated sequencer to identify mutations in the sequence.

5. A kit for detecting the presence or absence of mutations in the selected regions of the target genes associated with colorectal cancer, comprising XNA clamps and primers;

wherein the XNA clamps are capable of hybridizing with the selected regions having wild-type sequences in the target genes, and the primers are capable of amplifying the selected regions containing each of the mutations in the target genes.

6. The kit of claim 5, wherein the mutations are selected from the group consisting of APC 1309, APC 1367, APC 1450, BCT 41, BCT 45, KRAS 12, KRAS 13 and BRAF V600.

7. The kit of claim 6, wherein the XNA clamps and primers have the sequences as shown Table 22.