WO2018115202A1 - Conferring resistance to geminiviruses in plants in alternative manner to gene drive, using crispr/cas systems - Google Patents
Conferring resistance to geminiviruses in plants in alternative manner to gene drive, using crispr/cas systems Download PDFInfo
- Publication number
- WO2018115202A1 WO2018115202A1 PCT/EP2017/083952 EP2017083952W WO2018115202A1 WO 2018115202 A1 WO2018115202 A1 WO 2018115202A1 EP 2017083952 W EP2017083952 W EP 2017083952W WO 2018115202 A1 WO2018115202 A1 WO 2018115202A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sequence
- nucleic acid
- geminivirus
- protein
- homology arm
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8213—Targeted insertion of genes into the plant genome by homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8283—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for virus resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
Definitions
- SDN site-specific nuclease
- Geminiviruses are a major plant pathogen, responsible for significant crop losses worldwide (Mansoor et al. Trends Plant Sci. 8: 128-134, 2003). Geminiviruses are small, single-stranded, circular DNA plant viruses in a particle composed of two partially assembled icosahedra joined together. The size of the geminivirus genome is between 2.5 and 3.0 kb.
- geminiviruses are capable of causing disease in a widevariety of plants, including species from both monocotyledonous (e.g., maize and wheat) and dicotyledonous (e.g., tomato and cassava) groups.
- Examples of geminiviruses include the cabbage leaf curl virus, tomato golden mosaic virus, bean yellow dwarf virus, African cassava mosaic virus, wheat dwarf virus, miscanthus streak mastrevirus, tobacco yellow dwarf virus, tomato yellow leaf curl virus, bean golden mosaic virus, beet curly top virus, maize streak virus, and tomato pseudo-curly top virus.
- the present disclosure is based in part on the discovery of effective genome- engineering methods for increasing plant resistance to geminiviruses.
- the methods provided herein utilize the prokaryotic adaptive immune system known as the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated (Cas) system, which includes a nuclease known as Cas9.
- CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
- Cas CRISPR-associated
- Cpfl and NgAgo can be used instead of Cas9.
- a method for generating a plant cell having an increased resistance to a geminivirus infection comprises introducing into the genome of the plant cell:
- a first nucleic acid comprising a sequence encoding a site-specific nuclease protein , where the protein may be a CRISPR (system)-associated site-specific nuclease (SDN) protein, preferably a Cas protein for instance Cas9 or Cas 10, or the Cpfl protein, and where the protein is capable of introducing a double stranded break in the genome of the geminivirus at a target site, and where the first nucleic acid further comprises a promoter directing expression of the protein in the plant cell, or the expression of the protein is directed by the promoter of (ii) or (iii),
- SDN system-associated site-specific nuclease
- a second nucleic acid comprising a sequence encoding one or more CRISPR RNA (crRNA), where each of the one or more crRNA comprises a sequence complementary to one or more target sequences within the geminivirus genome, and where the second nucleic acid further comprises one or more promoters directing expression of the one or more crRNA in the plant cell, or the expression of the one or more crRNA is directed by the promoter of (i) or (iii) and
- a third nucleic acid comprising a sequence encoding one or more trans- activating crRNA (tracrRNA), where the third nucleic acid further comprises one or more promoters directing expression of the one or more tracrRNA in the plant cell, or the expression of the one or more tracrRNA is directed by the promoter of (i) or (ii).
- tracrRNA trans- activating crRNA
- the second and third nucleic acids can be optionally replaced by a single fourth nucleic acid encoding one or more single guide RNA (sgRNA).
- sgRNA single guide RNA
- Each of the one or more sgRNA comprises a sequence complementary to one or more target sequences within the geminivirus genome.
- the fourth nucleic acid further comprises one or more promoters directing expression of the one or more sgRNA in the plant cell, or the expression of the one or more sgRNA are directed by the promoter of (i).
- the site-specific nuclease protein is NgAgo the second and third nucleic acids can be replaced by a single fourth nucleic acid encoding one or more DNA molecules.
- Each of the one or more DNA molecules comprises a sequence complementary to one or more target sequences within the geminivirus genome and one or more DNA molecules are able to guide the NgAgo to the one or more target sequences within the geminivirus genome.
- the fourth nucleic acid further comprises one or more promoters directing expression of the one or more DNA molecules in the plant cell, or the expression of the one or more DNA molecules is directed by the promoter of (i).
- the first and/or second and/or third nucleic acid or said first and/or fourth nucleic acid further comprises a left homology arm sequence and/or a right homology arm sequence.
- Each homology arm sequence comprises a nucleotide sequence from the geminivirus genome that is adjacent to the target site of the double stranded break introduced by the site-specific nuclease protein within a geminivirus target sequence.
- the left homology arm sequence and the right homology arm sequence are effective to introduce the nucleic acid sequences contained between them into the geminivirus genome at a geminivirus target sequence by homologous recombination.
- the first, second and third nucleic acid or said first and fourth nucleic acid become stably integrated into the genome of the plant cell.
- a method for generating a plant cell having an increased resistance to a geminivirus infection comprises introducing into the genome of the plant cell:
- a first nucleic acid sequence encoding a site-specific nuclease protein where the protein may be a CRISPR (systemj-associated site-specific nuclease protein, preferably a Cas protein, for instance Cas9 or CaslO, or the Cpfl protein, where the protein is capable of introducing a double stranded break in the genome of the geminivirus at a target site, and where the first nucleic acid sequence is operably linked to a promoter directing expression of the protein in the plant cell, or where the first nucleic acid sequence is operably linked to the promoter of (ii) or (iii),
- a third nucleic acid sequence encoding a trans-activating crRNA tracrRNA
- the third nucleic acid sequence is operably linked to a promoter directing expression of the tracrRNA in the plant cell, or the third nucleic acid sequence is operably linked to the promoter of (i) or (ii).
- the second and third nucleic acid sequences can be optionally replaced by a single fourth nucleic acid sequence encoding a hybrid crRNA tracrRNA as a guide RNA (gRNA).
- the gRNA comprises a sequence complementary to a target sequence within the geminivirus genome, where the fourth nucleic acid sequence is operably linked to a promoter directing expression of the gRNA in the plant cell, or the fourth nucleic acid sequence is operably linked to the promoter of (i).
- the site-specific nuclease protein is NgAgo the second and third nucleic acids can be replaced by a single fourth nucleic acid encoding one or more DNA molecules.
- Each of the one or more DNA molecules comprises a sequence complementary to one or more target sequences within the geminivirus genome and one or more DNA molecules are able to guide the NgAgo to the one or more target sequences within the geminivirus genome.
- the fourth nucleic acid further comprises one or more promoters directing expression of the one or more DNA molecules in the plant cell, or the expression of the one or more DNA molecules is directed by the promoter of (i).
- the first and/or second and/or third nucleic acid or the first and/or fourth nucleic acid further comprises a left homology arm sequence and a right homology arm sequence, each homology arm sequence comprising a nucleotide sequence from the geminivirus genome that is adjacent to the site of the double stranded break introduced by the protein within a geminivirus target sequence.
- the left homology arm sequence and the right homology arm sequence are effective to introduce the nucleic acid sequences contained between them into the geminivirus genome at or near a geminivirus target sequence by homologous recombination.
- the first, second and third nucleic acid or the first and fourth nucleic acid become stably integrated into the genome of the plant cell.
- a method for generating a plant cell having an increased resistance to a geminivirus infection comprises introducing into the genome of the plant cell one nucleic acid molecule comprising:
- a first nucleic acid sequence encoding a site-specific nuclease protein where the protein may be a CRISPR (systemj-associated site-specific nuclease protein, preferably a Cas protein, for instance Cas9 or CaslO, or the Cpfl protein, where the protein is capable of introducing a double stranded break in the genome of the geminivirus at a target site, and where the first nucleic acid sequence is operably linked to a promoter directing expression of the protein in the plant cell, or where the first nucleic acid sequence is operably linked to the promoter of (ii) or (iii),
- a second nucleic acid sequence encoding a CRISPR R A (crR A), where the crRNA comprises a sequence complementary to one or more target sequences within the geminivirus genome, and where the second nucleic acid sequence is operably linked to a promoter directing expression of the crRNA in the plant cell, or the second nucleic acid sequence is operably linked to the promoter of (i) or (iii), and
- a third nucleic acid sequence encoding a trans-activating crRNA tracrRNA
- the third nucleic acid sequence is operably linked to a promoter directing expression of the tracrRNA in the plant cell, or the third nucleic acid sequence is operably linked to the promoter of (i) or (ii).
- the second and third nucleic acid sequences can be optionally replaced by a single fourth nucleic acid sequence encoding a hybrid crRNA tracrRNA as a guide RNA (gRNA).
- the gRNA comprises a sequence complementary to a target sequence within the geminivirus genome, where the fourth nucleic acid sequence is operably linked to a promoter directing expression of the gR A in the plant cell, or the fourth nucleic acid sequence is operably linked to the promoter of (i).
- the site-specific nuclease protein is NgAgo the second and third nucleic acids can be replaced by a single fourth nucleic acid encoding one or more DNA molecules.
- Each of the one or more DNA molecules comprises a sequence complementary to one or more target sequences within the geminivirus genome and one or more DNA molecules are able to guide the NgAgo to the one or more target sequences within the geminivirus genome.
- the fourth nucleic acid further comprises one or more promoters directing expression of the one or more DNA molecules in the plant cell, or the expression of the one or more DNA molecules is directed by the promoter of (i).
- the one nucleic acid molecule further comprises a left homology arm sequence and a right homology arm sequence, each homology arm sequence comprising a nucleotide sequence from the geminivirus genome that is adjacent to the site of the double stranded break introduced by the protein within a geminivirus target sequence.
- the left homology arm sequence and the right homology arm sequence are effective to introduce the nucleic acid sequences contained between them into the geminivirus genome at or near a geminivirus target sequence by homologous recombination.
- the one nucleic acid molecule becomes stably integrated into the genome of the plant cell.
- the size of the nucleic acid sequence between the left homology arm sequence and the right homology arm sequence may be such that upon homologous recombination into the geminivirus genome it prevents such genome e.g. from being packaged into viral particles and/or the geminivirus target sequence is a sequence of the geminivirus genome essential for the infection of a plant cell.
- the first and second nucleic acid, the first and third nucleic acid, the second and third nucleic acids, the first, second and third nucleic acid or the first and fourth nucleic acid are placed on a single nucleic acid molecule for introducing into the genome of the plant cell.
- the plant cells generated by above described method(s) Upon exposure of the plant cells generated by above described method(s) to a genminivirus,
- the site-specific nuclease protein can mediate a double stranded break in the geminivirus genome at or near the geminivirus target site
- one or more of the first and/or second and/or third or one or more of the first and/or fourth nucleic acids can be inserted into the geminivirus genome at the double stranded break by homologous recombination to form a modified geminivirus;
- modified geminivirus is unable to undergo one or more of replication, packaging, transport from the plant cell, or infection of a plant cell.
- the one or more crR A or the one or more sgRNA may comprise a sequence complementary to one or more target sequences within the genomes of more than one geminivirus species or more than one strain of the same geminivirus species.
- Each homology arm sequence may comprise a nucleotide sequence that is adjacent to the target site of the double stranded break introduced by the protein within target sequence, and the left homology arm sequence and the right homology arm sequence may be effective to introduce the nucleic acid sequences contained between them into the genomes of more than one geminivirus species or more than one strain of the same geminivirus species by homologous recombination.
- a plant cell generated by one of the above described methods for generating a plant cell having an increased resistance to a geminivirus infection, or a plant or plant part generated by the above described method for generating a plant having an increased resistance to a geminivirus infection.
- a vector comprising:
- a first nucleic acid comprising a sequence encoding a site-specific nuclease protein, where the protein may be a CRISPR (system)-associated site-specific nuclease protein, preferably a Cas protein, for instance Cas9 or CaslO, or the Cpfl protein, and where the protein is capable of introducing a double stranded break in the genome of a geminivirus, and where the first nucleic acid further comprises a promoter directing expression of the protein in a plant cell, or the expression of the protein is directed by the promoter of (ii) or (iii),
- a second nucleic acid comprising a sequence encoding one or more Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) RNA (crRNA), where each of the one or more crRNA comprises a sequence complementary to one or more target sequences within the geminivirus genome and where the second nucleic acid further comprises one or more promoters directing expression of the one or more crRNA in a plant cell, or the expression of the one or more crRNA is directed by the promoter of (i) or (iii), and
- CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
- a third nucleic acid comprising a sequence encoding one or more trans- activating crRNA (tracrRNA), where the third nucleic acid further comprises one or more promoters directing expression of the one or more tracrRNA in a plant cell, or the expression of the one or more tracrRNA is directed by the promoter of (i) or (ii), and
- each homology arm sequence comprising a nucleotide sequence from the geminivirus genome that is adjacent to the target site of the double stranded break introduced by the protein within a geminivirus target sequence, and where the left homology arm sequence and the right homology arm sequence are effective to introduce the nucleic acid sequences contained between them into a geminivirus genome at a geminivirus target sequence by homologous recombination.
- a first nucleic acid comprising a sequence encoding a site-specific nuclease protein, where the protein may be a CRISPR (system)-associated site-specific nuclease protein, preferably a Cas protein, for instance Cas9 or CaslO, or the Cpfl protein, and where the protein is capable of introducing a double stranded break in the genome of a geminivirus, and where the first nucleic acid further comprises a promoter directing expression of the protein in a plant cell, or the expression of the protein is directed by the promoter of (ii) or (iii),
- a second nucleic acid encoding one or more single guide RNA (sgR A), where each of the one or more sgRNA comprises a sequence complementary to one or more target sequences within the geminivirus genome and where the second nucleic acid further comprises one or more promoters directing expression of the one or more sgRNA in a plant cell, or the expression of the one or more sgRNA is directed by the promoter of (i), and
- sgR A single guide RNA
- each homology arm sequence comprising a nucleotide sequence from the geminivirus genome that is adjacent to the target site of the double stranded break introduced by the protein within a geminivirus target sequence, and where the left homology arm sequence and the right homology arm sequence are effective to introduce the nucleic acid sequences contained between them into a geminivirus genome at a geminivirus target sequence by homologous recombination.
- a first nucleic acid comprising a sequence encoding a site-specific nuclease protein, where the protein may be a CRISPR (system)-associated site-specific nuclease protein, preferably a Cas protein, for instance Cas9 or CaslO, or the Cpfl protein, and where the protein is capable of introducing a double stranded break in the genome of a geminivirus, and where the first nucleic acid sequence is operably linked to a promoter directing expression of the protein in a plant cell, or the first nucleic acid sequence is operably linked to the promoter of (ii) or (iii),
- a second nucleic acid comprising a sequence encoding a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) RNA (crRNA), where the crRNA comprises a sequence complementary to one or more target sequences within the geminivirus genome and where the second nucleic acid sequence is operably linked to a promoter directing expression of the crR A in a plant cell, or the second nucleic acid sequence is operably linked to the promoter of (i) or (iii),
- CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
- a third nucleic acid encoding a trans-activating crRNA tracrRNA
- the third nucleic acid sequence is operably linked to a promoter directing expression of the tracrRNA in a plant cell, or the second nucleic acid sequence is operably linked to the promoter of (i) or (ii)
- each homology arm sequence comprising a nucleotide sequence from the geminivirus genome that is adjacent to the target site of the double stranded break introduced by the protein within a geminivirus target sequence, and where the left homology arm sequence and the right homology arm sequence are effective to introduce the nucleic acid sequences contained between them into a geminivirus genome at a geminivirus target sequence by homologous recombination.
- a first nucleic acid comprising a sequence encoding a site-specific nuclease protein, where the protein may be a CRISPR (system)-associated site-specific nuclease protein, preferably a Cas protein, for instance Cas9 or CaslO, or the Cpfl protein, and where the protein is capable of introducing a double stranded break in the genome of a geminivirus, and where the first nucleic acid sequence is operably linked to a promoter directing expression of the protein in a plant cell, or the first nucleic acid sequence is operably linked to the promoter of (ii),
- a second nucleic acid sequence encoding a hybrid crRNA tracrRNA gRNA
- the gRNA comprises a sequence complementary to a target sequence within the geminivirus genome and where the second nucleic acid sequence is operably linked to a promoter directing expression of the gRNA in a plant cell, or the second nucleic acid sequence is operably linked to the promoter of (i)
- each homology arm sequence comprising a nucleotide sequence from the geminivirus genome that is adjacent to the target site of the double stranded break introduced by the protein within a geminivirus target sequence, and where the left homology arm sequence and the right homology arm sequence are effective to introduce the nucleic acid sequences contained between them into a geminivirus genome at a geminivirus target sequence by homologous recombination.
- the size of the nucleic acid sequence between the left homology arm sequence and the right homology arm sequence may be such that upon homologous recombination into the geminivirus genome it prevents such genome e.g. from being packaged into viral particles and/or the geminivirus target sequence is a sequence of the geminivirus genome essential for the infection of a plant cell.
- the first and second nucleic acid, the first and third nucleic acid, the second and third nucleic acids, the first, second and third nucleic acid or the first and fourth nucleic acid are placed on a single nucleic acid molecule for introducing into the genome of the plant cell.
- the one or more crR A or the one or more sgRNA may comprise a sequence complementary to one or more target sequences within the genomes of more than one geminivirus species or more than one strain of the same geminivirus species.
- Each homology arm sequence may comprise a nucleotide sequence that is adjacent to the target site of the double stranded break introduced by the protein within target sequence, and the left homology arm sequence and the right homology arm sequence may be effective to introduce the nucleic acid sequences contained between them into the genomes of more than one geminivirus species or more than one strain of the same geminivirus species by homologous recombination.
- [0028] in another aspect is a plant, plant part, or plant cell that has increased resistance to geminivirus infection, comprising one of the above described vectors.
- a plant, plant part, or plant cell that has increased resistance to geminivirus infection, comprising stably integrated into the genome: (i) a first nucleic acid comprising a sequence encoding a site-specific nuclease protein, where the protein may be a CRISPR (system)-associated site-specific nuclease protein, preferably a Cas protein, for instance Cas9 or CaslO, or the Cpfl protein, and where the protein is capable of introducing a double stranded break in the genome of a geminivirus, and where the first nucleic acid further comprises a promoter directing expression of the protein in a plant cell, or the expression of the protein is directed by the promoter of (ii) or (iii),
- a second nucleic acid comprising a sequence encoding one or more Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) RNA (crRNA), where each of the one or more crRNA comprises a sequence complementary to one or more target sequences within the geminivirus genome and where the second nucleic acid further comprises one or more promoters directing expression of the one or more crRNA in at least one plant cell, or the expression of the one or more crRNA is directed by the promoter of (i) or (iii), and
- CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
- a third nucleic acid comprising a sequence encoding one or more trans- activating crRNA (tracrRNA), where the third nucleic acid further comprises one or more promoters directing expression of the one or more tracrRNA in at least one plant cell, or the expression of the one or more tracrRNA is directed by the promoter of (i) or (ii).
- tracrRNA trans- activating crRNA
- the second and third nucleic acids can be optionally replaced by a single fourth nucleic acid encoding one or more single guide RNA (sgRNA).
- sgRNA single guide RNA
- Each of the one or more sgRNA comprises a sequence complementary to one or more target sequences within the geminivirus genome.
- the fourth nucleic acid further comprises one or more promoters directing expression of the one or more sgRNA in at least one plant cell, or the expression of the one or more sgRNA is directed by the promoter of (i).
- the first and/or second and/or third nucleic acid or the first and/or fourth nucleic acid further comprises a left homology arm sequence and/or a right homology arm sequence.
- Each homology arm sequence comprises a nucleotide sequence from the geminivirus genome that is adjacent to the site of the double stranded break introduced by the protein within a geminivirus target sequence.
- the left homology arm sequence and the right homology arm sequence are effective to introduce the nucleic acid sequences contained between them into the geminivirus genome at a geminivirus target sequence by homologous recombination.
- a plant, plant part, or plant cell that has increased resistance to geminivirus infection comprising stably integrated into the genome:
- a first nucleic acid comprising a sequence encoding a site-specific nuclease protein, where the protein may be a CRISPR (system)-associated site-specific nuclease protein, preferably a Cas protein, for instance Cas9 or CaslO, or the Cpfl protein, and where the protein is capable of introducing a double stranded break in the genome of a geminivirus, and, where the first nucleic acid sequence is operably linked to a promoter directing expression of the protein in at least one plant cell, or the first nucleic acid sequence is operably linked to the promoter of (ii) or (iii),
- a second nucleic acid comprising a sequence encoding a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) RNA (crRNA), where the crRNA comprises a sequence complementary to one or more target sequences within the geminivirus genome, and where the second nucleic acid sequence is operably linked to a promoter directing expression of the crRNA in at least one plant cell, or the second nucleic acid sequence is operably linked to the promoter of (i) or (iii), and
- CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
- a third nucleic acid encoding a trans- activating crRNA tracrRNA
- the third nucleic acid sequence is operably linked to a promoter directing expression of the tracrRNA in at least one plant cell, or the second nucleic acid sequence is operably linked to the promoter of (i) or (ii).
- the second and third nucleic acid sequences can be optionally replaced by a single fourth nucleic acid sequence encoding a hybrid crRNA tracrRNA (gRNA).
- the gRNA comprises a sequence complementary to a target sequence within the geminivirus genome.
- the fourth nucleic acid sequence is operably linked to a promoter directing expression of the gR A in at least one plant cell, or the fourth nucleic acid sequence is operably linked to the promoter of (i).
- the first and/or second and/or third nucleic acid or the first and/or fourth nucleic acid further comprises a left homology arm sequence and a right homology arm sequence.
- Each homology arm sequence comprises a nucleotide sequence from the geminivirus genome that is adjacent to the site of the double stranded break introduced by the protein within a geminivirus target sequence.
- the left homology arm sequence and the right homology arm sequence are effective to introduce the nucleic acid sequences contained between them into the geminivirus genome at or near a geminivirus target sequence by homologous recombination.
- a plant, plant part, or plant cell that has increased resistance to geminivirus infection, comprising stably integrated into the genome one nucleic acid molecule comprising:
- a first nucleic acid comprising a sequence encoding a site-specific nuclease protein, where the protein may be a CRISPR (system)-associated site-specific nuclease protein, preferably a Cas protein, for instance Cas9 or Casl O, or the Cpfl protein, and where the protein is capable of introducing a double stranded break in the genome of a geminivirus, and, where the first nucleic acid sequence is operably linked to a promoter directing expression of the protein in at least one plant cell, or the first nucleic acid sequence is operably linked to the promoter of (ii) or (iii),
- a second nucleic acid comprising a sequence encoding a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) RNA (crRNA), where the crRNA comprises a sequence complementary to one or more target sequences within the geminivirus genome, and where the second nucleic acid sequence is operably linked to a promoter directing expression of the crRNA in at least one plant cell, or the second nucleic acid sequence is operably linked to the promoter of (i) or (iii), and
- CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
- a third nucleic acid encoding a trans-activating crRNA tracrRNA
- the third nucleic acid sequence is operably linked to a promoter directing expression of the tracrRNA in at least one plant cell, or the second nucleic acid sequence is operably linked to the promoter of (i) or (ii).
- the second and third nucleic acid sequences can be optionally replaced by a single fourth nucleic acid sequence encoding a hybrid crRNA tracrRNA (gRNA).
- the gRNA comprises a sequence complementary to a target sequence within the geminivirus genome.
- the fourth nucleic acid sequence is operably linked to a promoter directing expression of the gRNA in at least one plant cell, or the fourth nucleic acid sequence is operably linked to the promoter of (i).
- the one nucleic acid molecule further comprises a left homology arm sequence and a right homology arm sequence.
- Each homology arm sequence comprises a nucleotide sequence from the geminivirus genome that is adjacent to the site of the double stranded break introduced by the protein within a geminivirus target sequence.
- the left homology arm sequence and the right homology arm sequence are effective to introduce the nucleic acid sequences contained between them into the geminivirus genome at or near a geminivirus target sequence by homologous recombination.
- the size of the nucleic acid sequence between the left homology arm sequence and the right homology arm sequence may be such that upon homologous recombination into the geminivirus genome it prevents such genome e.g. from being packaged into viral particles and/or the geminivirus target sequence is a sequence of the geminivirus genome essential for the infection of a plant cell.
- the first and second nucleic acid, the first and third nucleic acid, the second and third nucleic acids, the first, second and third nucleic acid or the first and fourth nucleic acid are placed on a single nucleic acid molecule for introducing into the genome of the plant cell.
- the site-specific nuclease protein can mediate a double stranded break in the geminivirus genome at or near the geminivirus target site, and
- one or more of the first and/or second and/or third or one or more of the first and/or fourth nucleic acids can be inserted into the geminivirus genome at the double stranded break by homologous recombination to form a modified geminivirus;
- modified geminivirus is unable to undergo one or more of replication, packaging, transport from the plant cell, or infection of a plant cell.
- the one or more crR A or the one or more sgRNA may comprise a sequence complementary to one or more target sequences within the genomes of more than one geminivirus species or more than one strain of the same geminivirus species.
- Each homology arm sequence may comprise a nucleotide sequence that is adjacent to the target site of the double stranded break introduced by the protein within target sequence, and the left homology arm sequence and the right homology arm sequence may be effective to introduce the nucleic acid sequences contained between them into the genomes of more than one geminivirus species or more than one strain of the same geminivirus species by homologous recombination.
- Fig. 1 illustrates three nucleic acids to be integrated into a plant genome for instance by plant transformation: a Cas9 coding sequence flanked by a left and right homology arms to effect homologous recombination into a geminivirus genome, a crRNA, and a tracrR A.
- Fig. 2 illustrates a double stranded break in geminivirus genome from Cas9 protein, followed by insertion of Cas9 coding sequence into the geminivirus genome by way of homologous recombination.
- Fig. 3A illustrates packaging of a geminivirus genome into a capsid.
- Fig. 3B illustrates failure to package a geminivirus genome with Cas9 inserted due to excess size of the modified geminivirus genome.
- Fig. 4 illustrates two nucleic acids to be integrated into a plant genome by plant transformation: a single nucleic acid with Cas9 coding sequence, a crR A and tracrRNA flanked by left and right homology arms to effect homologous recombination into a geminivirus genome.
- Fig. 5 illustrates a single nucleic acid with Cas9 coding sequence, crRNA and tracrRNA flanked by left and right homology arms to effect homologous recombination.
- Fig. 6 illustrates two nucleic acids to be integrated into a plant genome by plant transformation: a single nucleic acid with Cas9 coding sequence flanked by left and right homology arms to effect homologous recombination into a geminivirus genome, and a crRNA and tracrRNA flanked by left and right homology arms to effect homologous recombination into a geminivirus genome.
- the methods described herein can be used for engineering plants with preprogrammed systems for gene editing like CRISPR/Cas or CRISPR Cpfl that target and disrupt geminivirus DNA sequences, and add additional sequence to the geminivirus genome, so as to inhibit packaging, movement or transport of the modified geminivirus from an infected cell, or infection of additional plant cells. It has the added benefit of amplifying the copy number of the gene that is recombined into the geminivirus genome, thereby increasing the expression potential for this component of the nuclease during the infection.
- CRISPR systems are used to generate double strand breaks (DSBs) in the target region. Disruption of the geminivirus with a DSB on its own can lead to increased plant resistance to geminivirus.
- CRISPR systems in the native context provide bacteria and archaea with immunity to invading foreign nucleic acids and relies on RNA base pairing to direct an enzyme, such as Cas9 or Cpf 1 , to cleave DNA or RNA.
- an enzyme such as Cas9 or Cpf 1
- Beside of CRISPR systems the NGAgo-based system relies on DNA base pairing to direct an Argonaute enzyme to cleave DNA or RNA.
- CRISPR systems are based on (a) small RNAs that base-pair with sequences carried by invading nucleic acid, and (b) a specialized class of endonucleases that cleave nucleic acids complementary to the small RNA.
- the CRISPR system can be reprogrammed to create targeted DSBs in DNA of higher-eukaryotic genomes, including animal and plant cells (Mali et al., Science 339:823-826, 2013; and Li et al., Nature Biotechnology 31 (8): 688-691 , 2013). Double stranded DNA virus genomes can be targeted by CRISPR system.
- CRISPR system can be further used for gene editing by triggering DNA repair pathways effective to introduce DNA at the site of the double stranded break.
- DNA can be added by homology-directed repair (HDR), involving homologous recombination between (1) the geminivirus genome and (2) sequence substantially identical to the genome near the DSB.
- HDR homology-directed repair
- the substantially identical sequence is both 5' and 3' to sequence desired to be inserted, and is collectively referred to as left and right homology arms.
- a DNA segment comprising a left homology arm, DNA to be inserted, and a right homology arm undergoes a crossover event in each of the left and right arms with geminivirus genomic DNA
- the sequence between the homology arms can be inserted into the genome.
- Fig. 1 shows exemplary constructs with three CRISPR/site-directed nuclease (SDN) reagents that can target a virus genome: Cas9, crRNA, and tracrRNA.
- LH refers to the left homology arm and RH refers to the right homology arm.
- SDN can be inserted into the genomic DNA by homologous recombination, which involves a double crossing over illustrated in Fig. 2.
- Cas9 can be replaced by any other site-directed nuclease, e.g. Cpfl .
- a "plant” may be any species of dicotyledon, monocotyledon or gymnosperm plant.
- the plants may be monocotyledon and of interest in agriculture or horticulture or for the production of bioenergy (bioethanol, biogas, etc).
- Examples are barley ⁇ Hordeum vulgare), sorghum ⁇ Sorghum bicolor), rye ⁇ Secale cereale), Triticale, sugar cane ⁇ Saccharum officinarium), maize ⁇ Zea mays), foxtail millet ⁇ Setaria italic), rice ⁇ Oryza sativa), Oryza minuta, Oryza australiensis, Oryza alta, wheat (Triticum aestivum), Triticum durum, Hordeum bulbosum, purple false brome (Brachypodium distachyon), sea barley (Hordeum marinum), goat grass ⁇ Aegilops tauschii), apple ⁇ Malus domestica), Beta vulgaris, sunflower (Helianthus annuus), Australian carrot ⁇ Daucus glochidiatus), American wild carrot ⁇ Daucus pusillus), Daucus muricatus, carrot ⁇ Daucus carota), eucalyptus ⁇ Euca
- Plant “parts” are in particular plant cells, plant tissue, in particular plant propagation material, preferably leaves, stems, roots, emerged radicles, flowers or flower parts, petals, fruits, pollen, pollen tubes, anther filaments, ovules, embryo sacs, egg cells, ovaries, zygotes, embryos, zygotic embryos per se, somatic embryos, hypocotyl sections, apical meristems, vascular bundles, pericycles, seeds, roots, cuttings, cell or tissue cultures, or any other part or product of a plant.
- plant cell should be understood to refer to isolated plant cells with a cell wall or aggregates thereof or protoplasts, for example.
- the plant cell can be from a plant selected from the group consisting of barley (Hordeum vulgare), sorghum (Sorghum bicolor), rye (Secale cereale), Triticale, sugar cane (Saccharum ojficinarium), maize (Zea mays), foxtail millet (Setaria italic), rice (Oryza sativa), Oryza minuta, Oryza australiensis, Oryza alta, wheat (Triticum aestivum), Triticum durum, Hordeum bulbosum, purple false brome (Brachypodium distachyon), sea barley (Hordeum marinum), goat grass (Aegilops tauschii), apple (Malus domestica), Beta vulgaris, sunflower (Helianthus annuus), Australian carrot (Daucus glochidiatus), American wild carrot (Daucus pusillus), Daucus muricatus, carrot (Daucus carota), euca
- resistance or “resistant” as regards a pathogen should be understood to mean the ability of a plant or plant cell to resist the damaging effects of the pathogen and extends from a delay in the development of disease to complete suppression of the development of the disease.
- the term "increased resistance,” as used herein, means that a plant, plant part, or plant cell is less severely affected by geminivirus infection than a corresponding plant, plant part, or plant cell that does not contain any of the gene editing components like CRISPR/Cas or CRISPR/Cpfl or nucleic acids as described herein.
- a plant with increased resistance to geminivirus will display fewer or milder symptoms, e.g., leaf curling, chlorotic lesions, yellowing and stunting, when exposed to geminivirus, as compared to a corresponding plant that does not have increased geminivirus resistance.
- symptoms of geminivirus infection can be scored by using a scale with no observable symptoms at one end and severe symptoms at the other. In such cases, the difference between the score for a plant with increased geminivirus resistance and the score for no observable symptoms will be less than the difference between the score for a corresponding plant without increased geminivirus resistance and the score for no observable symptoms.
- “Operatively linked” means linked in a common nucleic acid molecule in a manner such that the linked elements are positioned and orientated with respect to each other such that transcription of the nucleic acid molecule can take place.
- a DNA which is operatively linked with a promoter is under the transcriptional control of this promoter.
- a "vector” is a replicon, such as a plasmid, phage, or cosmid, into which one or multiple DNA segments may be inserted so as to bring about the replication of the inserted segment.
- the first and/or second and/or third and/or fourth nucleic acid further comprises a left homology arm sequence and/or a right homology arm sequence. Any one or more of the first, second, third and fourth nucleic acid sequences may be preceded by a promoter directing expression in the plant cell.
- repair of a DSB occurs generally through non-homologous end joining (NHEJ) or homo logy-directed repair (HDR).
- NHEJ non-homologous end joining
- HDR homo logy-directed repair
- HDR can introduce sequence at the site of the DSB through homologous recombination.
- HDR allows for nucleic acids such as Cas9 or Cpfl, crRNA and tracrRNA, to be introduced at the DSB. Adding these nucleic acid sequences into the geminivirus genome can have multiple beneficial effects.
- the geminivirus genome can be disrupted in a manner sufficient to block replication, packaging or transport of the virus. Infection of neighboring cells can be controlled or stopped, which may lead to overall increased resistance of a plant to geminivirus.
- insertion of sequence into the geminivirus genome results in enlargement of the geminivirus genome such that it cannot be packaged or otherwise be transported from one plant cell to another.
- the wildtype geminivirus genome generally has one or two components, each between 2.5 to 3.2 kb in size. The genome size can be increased by 200 bp to 9 kb, or any value in between, so as to block replication. Increasing the size of the genome can prevent packaging of geminivirus into capsids, transport of the geminivirus genome from one cell to another, or both. It can therefore be beneficial to have plant cells capable of both blocking geminivirus transmission and spreading modified geminivirus into the wild.
- CRISPR/Cas nucleic acids after insertion of CRISPR/Cas nucleic acids into the geminivirus genome, transcription and expression of such nucleic acids greatly increases.
- the replication machinery, promoters and gene expression drivers that are used to replicate and package geminivirus can provide for high levels of transcription and expression of CRISPR/Cas nucleic acids and proteins, particularly in a positive-feedback manner. Such increased expression can be helpful to control high copy number geminivirus that start replicating after infecting a cell.
- Use of such positive-feedback mechanisms can be less burdensome to plant cells than expressing similarly high levels of CRISPR/SDN components in the absence of geminivirus.
- the first, second, third and optionally fourth nucleic acids may be part of a vector, a single nucleic acid construct, or in separate constructs.
- Fig. 5 shows an exemplary single construct having Cas9, crRNA and tracrRNA between left and right homology arms.
- the crRNA and tracrRNA sequences can be present in separate nucleic acid constructs, e.g., separate vectors (see Figs 4 and 6).
- nucleic acid constructs could be used for integration into the plant cell genome.
- a first nucleic acid encodes the SDN protein
- a second nucleic acid encodes the tracrRNA
- third through seventh nucleic acids encode the crRNAs.
- the left and right homology arm sequences may be added into any of these vectors to allow particular sequences between the homology arms to be integrated into the geminivirus genome.
- introducing of nucleic acids into the genome of a plant can be undertaken by various ways, including Agrobacterium-mediated transformation, electroporation, polyethylene glycol (PEG), insect vectors, grafting, DNA abrasion, viral vectors, insertion by CRISPR systems followed by homologous recombination, and biolistic transformation.
- Agrobacterium-mediated transformation electroporation, polyethylene glycol (PEG), insect vectors, grafting, DNA abrasion, viral vectors, insertion by CRISPR systems followed by homologous recombination, and biolistic transformation.
- Exemplary viral vectors are from a DNA virus such as geminiviruses, nanoviruses (e.g., fava bean necrotic yellow virus), an RNA virus such as, a tobravirus (e.g., tobacco rattle virus or tobacco mosaic virus), a potexvirus (e.g., potato virus X), and a hordeivirus (e.g., barley stripe mosaic virus).
- a DNA virus such as geminiviruses, nanoviruses (e.g., fava bean necrotic yellow virus), an RNA virus such as, a tobravirus (e.g., tobacco rattle virus or tobacco mosaic virus), a potexvirus (e.g., potato virus X), and a hordeivirus (e.g., barley stripe mosaic virus).
- the SDN protein is a Cas, preferably a Cas9 protein with nuclease activity.
- Other proteins with similar targeted nuclease activity can be used instead of Cas9, such as Cpfl , CaslO and NgAgo.
- Cpfl protein is capable of modifying DNA by introducing a double stranded break with 5' overhangs, and may be used.
- NgAgo may also be used.
- the nuclease-active version of SDN can induce targeted double-strand breaks (DSBs) in the geminivirus double- stranded DNA replication intermediate.
- wildtype SDN protein may be used to introduce such DSBs via its nuclease activity. Any mutants of SDN may be used that are capable of introducing DSBs, such as those that retain nuclease activity.
- the crRNA and tracrRNA sequences can be engineered as a single crRNA tracrRNA hybrid, also referred to herein as a "guide RNA" (gRNA).
- the SDN protein can contain one or more mutations, e.g., substitutions, deletions, or additions, within its amino acid sequence as compared to the amino acid sequence of a corresponding wild type SDN protein, in which the mutant SDN retains nuclease activity.
- additional amino acids may be added to the N- and/or C-termini.
- Cas9 protein can be modified by adding a VP64 activation domain or a green fluorescent protein to the C- terminus, or by the adding nuclear-localization signals to both the N- and C-termini (see, e.g., Mali et al., Nature Biotechnology 31 :833-838, 2013; and Cong et al., Science 339:819-823).
- the geminivirus homology regions within each crRNA sequence can be between about 10 and about 40 (e.g., 10, 11, 12, 13,14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40) nucleotides in length.
- the tracrRNA hybridizing region within each crRNA sequence can be between about 8 and about 20 (e.g., 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20) nucleotides in length.
- the overall length of a crRNA sequence can be, for example, between about 20 and about 80 (e.g., 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, or 80) nucleotides, while the overall length of a tracrRNA can be, for example, between about 10 and about 30 (e.g., 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, or 30) nucleotides.
- multiple (e.g., one, two, three, four, five, or more than five) crRNA sequences, and multiple (e.g., one, two, three, four, five, or more than five) tracrRNA sequences can be included to allow crRNA sequences to be targeted to one or more (e.g., one, two, three, four, five, or more than five) geminivirus sequences.
- each of the one or more crRNA sequences can contain a region that is homologous to a geminivirus sequence, such that the one or more crRNA sequences are targeted to different geminivirus sequences.
- the tracrRNA hybridizes with the crRNA, and together they guide the SDN protein to the target sequence.
- each crRNA sequence can contain a different geminivirus homology region but the same tracrRNA hybridizing region.
- multiple crR A sequences can also be targeted to different molecules of the geminivirus DNA (e.g., to primary and satellite genomes).
- a gR A is used instead of separate crRNA and tracrR A sequences, with the gRNA sequence including a geminivirus homology region and a stem loop region that contains a crRNA tracrRNA hybridizing region and a linker- loop sequence.
- the length of the gRNA can be between about 30 and about 130 (e.g., 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, or 130) nucleotides.
- the crRNA sequence is targeted to a sequence contained within a geminivirus genome. Suitable target sequences typically are followed by a protospacer adjacent motif (PAM) sequence that is required for cleavage.
- the PAM sequence can be immediately downstream of the target sequence.
- An NGG PAM sequence downstream of the target sequence can be required for cleavage by a Cas9 nuclease (e.g., by a S. pyogenes Cas9).
- a NNNNGMTT PAM sequence can be required for cleavage by a Neisseria meningitides Cas9 protein.
- Cpfl requires for instance a 5' TTN or TTTN PAM.
- the target sequence is within a Rep protein ORF, a movement protein ORF, a coat protein ORF, a hairpin region that mediates replication origin, the origin of replication, the nuclear shuttling protein coding sequence, or a satellite DNA.
- the target sequence may be the TAATATTAC sequence present in the apex of the geminivirus stem-loop structure.
- a target sequence is found within one, or even more than one, of the following: tomato golden mosaic virus (TGMV), bean yellow dwarf virus (BeYDV), tomato yellow leaf curl virus (TYLCV), cabbage leaf curl virus, wheat dwarf virus, tomato leaf curl virus, maize streak virus, tobacco leaf curl virus, beet curly top virus, spinach severe curly top virus, bean golden mosaic virus, tomato pseudo-curly top virus, and turnip curly top virus.
- TGMV tomato golden mosaic virus
- BeYDV bean yellow dwarf virus
- TYLCV tomato yellow leaf curl virus
- cabbage leaf curl virus wheat dwarf virus
- tomato leaf curl virus maize streak virus
- tobacco leaf curl virus beet curly top virus
- spinach severe curly top virus spinach severe curly top virus
- bean golden mosaic virus tomato pseudo-curly top virus
- turnip curly top virus turnip curly top virus.
- each of the one or more crRNA sequences can be fused to a tracrR A sequence to form a guide RNA (gRNA).
- gRNA guide RNA
- the tracrR A sequence and the one or more crRNA sequences or the SDN sequence can be operably linked to a constitutive promoter (e.g., an RNA polymerase III promoter or an RNA polymerase II promoter), an inducible promoter (e.g. a promoter inducible in response to a geminivirus infection), or a plant tissue specific promoter.
- a constitutive promoter e.g., an RNA polymerase III promoter or an RNA polymerase II promoter
- an inducible promoter e.g. a promoter inducible in response to a geminivirus infection
- a plant tissue specific promoter e.g., a plant tissue specific promoter.
- the target sequence may comprise sequence from any of the following target sites:
- the geminivirus target sequence can be present on the plus or minus strand of the double stranded DNA intermediate form of the geminivirus genome.
- target sequence present on the plus strand include:
- target sequence present on the plus strand examples include:
- the plant cell to be transformed by introducing one or more nucleic acids can be in a plant or in vitro.
- the individual nucleic acid sequences i.e. the first nucleic acid, the second nucleic acid, the third nucleic acid, and the optional fourth nucleic acid, are in a single vector or in separate vectors.
- the fourth nucleic acid can encode a polycistronic message containing a tracrRNA sequence and one or more crRNA sequences, or containing a crRNA tracrRNA hybrid (gRNA) sequence.
- the introduction of the nucleic acid into the plant cell may allow the plant cell to express sufficient SDN protein, crRNA and tracrRNA such that when the plant cell is exposed to a geminivirus, the SDN protein, crRNA and tracrRNA work in concert to introduce a DSB at the target region in the geminivirus.
- the DSB can disrupt the replication, packaging, movement, transport of that geminivirus and reinfection of other plant cells.
- the plant cell may contain sufficient amounts of the nucleic acid sequence comprising the first, second and third nucleic acids such that sequences of the first, second and third nucleic acids are introduced at the DSB by homologous recombination. Introduction of such nucleic acid may further block packaging and transport due to inability to further package the enlarged genome into the capsid. See, Fig. 5.
- the left and right homology arms of nucleic acid sequence (iv) comprise nucleic acid sequence from the geminivirus genome that is adjacent to the geminivirus target site.
- the left homology arm comprises nucleic acid sequence 5' to the geminivirus target site and the right homology arm comprises nucleic acid sequence 3' to the geminivirus target site.
- the left homology arm comprises nucleic acid sequence 3' to the geminivirus target site
- the right homology arm may comprise nucleic acid sequence 5 ' to the geminivirus target site.
- the left homology arm and the right homology arm can comprise sequence that is within 10, 20, 30, 40, 50 bp or more of the geminivirus target site.
- HDR homology-directed repair
- the total length of the left homology arm nucleic acid sequence is from 30 bp to 800 bp or more, and may be any integer between 30 and 800 bp.
- the total length of the right homology arm nucleic acid sequence may be from 30 bp to 800 bp, and may be any integer between 30 and 800 bp.
- the length of the left homology arm can be from 30 bp to 400 bp, 40 bp to 300 bp, 50 bp to 250 bp, 60 bp to 200 bp, 70 bp to 170 bp, 80 bp to 150 bp, 90 bp to 140 bp, 100 bp to 120 bp.
- the length of the right homology arm can be from 30 bp to 400 bp, 40 bp to 300 bp, 50 bp to 250 bp, 60 bp to 200 bp, 70 bp to 170 bp, 80 bp to 150 bp, 90 bp to 140 bp, 100 bp to 120 bp. If the left homology arm and the right homology arm flank the first, second, third and optional fourth nucleic acid sequences, the nucleic acid comprising the first, second and third nucleic acid sequences can be introduced into a geminivirus genome at or near the geminivirus target site by homologous recombination.
- the first, second, third and fourth nucleic acid sequences are operably linked to a constitutive promoter, an inducible promoter, or a plant tissue specific promoter.
- exemplary plant tissue specific promoters include egg apparatus- specific enhancer (EASE), cruciferin, nap in, or rubisco small subunit promoter, and promoters that are activated by alternative splicing of a suicide exon.
- Exemplary constitutive promoters include constitutive RNA pol II promoters such as the 35S, Nos-P, and ubiquitin promoters, and constitutive RNA pol III promoters such as the U6 promoter.
- inducible promoters include the virion-sense promoter from geminivirus, and the XVE promoter.
- a Cas coding sequence can be operably linked to an inducible XVE promoter, which can be activated by estradiol. Expression of the first, second, third and fourth nucleic acids in a plant can be activated by treating the plant with estradiol, and the expressed protein then can cleave geminivirus DNA at the target sequence.
- each of the first, second, third and fourth nucleic acid sequences can have its own promoter.
- a polycistronic approach can be used to express multiple nucleic acid sequences from one promoter.
- multiple crRNAs can be expressed from a single promoter, along the lines of the bacterial pre-crRNA molecule, while the tracrRNA can be expressed from a separate promoter.
- a polycistronic message can include one or more crRNA sequences and one or more tracrRNA sequences, or two or gRNA sequences.
- the SDN protein is Cpfl , a polycistronic message containing two or more crRNA sequences can be expressed that will be processed by Cpfl into mature crRNA molecules that function as guides for the Cpfl protein (see Zetsche et al., 2016).
- portions of the geminivirus genome that include symptom- modulating DNA satellites associated with geminiviruses are targeted for DSB.
- An example of a DNA beta molecule is the cotton leaf curl virus beta (ACCGTGGGCGAGCGGTGTCTTTGGCGTTCCATGTGGGTCCCACAATATCCA AAAGAAGAATAATGGACTGGGTCAATGCAATTGGGCCTTAAATGAAATGGG CTTGGACCAGTAGATTCGAGACTGGGCCAATAGAATAAAACAACAAATGG ACTCATAATCAAAACAAAGTGTTTATTCATGTCAAATACATTACACACTCAC ACACACACAGTCGTACACACATCATATTCATCCCCTATACGTATATCAACTAA TGGGGCCTCATGCATCATCATTATATCAATAGCCTCTACCATGTCCTCCTGGC GAAAGTCCCGAACATGACAATCCCTATACATGATCTTTAATATATTATGTATC CCTTCCTCCAAATTGTTGAAGTCGAAAGGCGGTATGATCCCATGGCCGT A
- CRISPR/SDN technology can be multiplexed, enabling the targeting of multiple different regions on the same geminivirus, or on multiple geminivirus species or strains. Targeting multiple regions of the same virus has the benefit of potentially increasing the durability of resistance. Targeting regions on multiple virus species has the benefit of increasing the broadness of resistance.
- the geminivirus target site is within a critical region of the genome required for virus biology.
- the critical region may be the Rep protein open reading frame (ORF), the movement protein ORF, the coat protein ORF, or the hairpin region that mediates the origin of replication. Any portion of these critical regions can serve as the target site.
- the one or more crR A sequences and the tracrR A sequence are stably integrated into the genome of the plant cell. Integration can occur by using Agrobacterium-mediated transfer of nucleic acids sequences into the plant.
- the Agrobacterium is transformed with the first, second, third and fourth nucleic acids. The transformed Agrobacterium can effectively integrate the first, second, third and fourth nucleic acids into the plant genome by treating plants with the Agrobacterium.
- any suitable method can be used to determine whether the first, second, third and optionally fourth nucleic acid sequences have integrated into the genome of the plant or plant cell.
- thermal asymmetric interlaced polymerase chain reaction (PCR) or Southern blotting of genomic DNA from a potentially transgenic plant, plant part, or plant cell, or from progeny thereof can be used to assess whether integration has occurred.
- Western blotting of cellular extracts can be used to determine whether the SDN protein is present, and Northern blotting of cellular RNA can be used to determine whether the crRNA and tracrRNA are expressed.
- any suitable method(s) can be used to propagate the plant, plant part, or plant cell to generate a population of transgenic plants that express the these nucleic acids and thus have increased geminivirus resistance.
- plants, plant parts, and plant cells prepared by any of the methods and embodiments thereof described herein. Such plants, plant parts, and plant cells have increased geminivirus resistance when the CRISPR/Cas components are expressed.
- Embodiment 1 is a method for generating a plant cell having the potential for increased resistance to geminivirus infection.
- the method comprises transforming the plant cell with a nucleic acid comprising:
- CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
- crRNA Clustered Regularly Interspaced Short Palindromic Repeats
- a left homology arm nucleic acid sequence and a right homology arm nucleic acid sequence each comprising a nucleotide sequence from the geminivirus genome that is adjacent to the geminivirus target site, and where the left homology arm nucleic acid sequence and the right homology arm nucleic acid sequence are effective to introduce nucleic acid sequences (i), (ii), and/or (iii) into a geminivirus genome at or near the geminivirus target site by homologous recombination.
- the nucleic acid is stably integrated into the genome of the plant cell.
- Cas protein, the (ii) one or more crRNA nucleic acid sequences, and the (iii) tracrRNA nucleic acid sequence are flanked by the left homology arm nucleic acid sequence and the right homology arm nucleic acid sequence.
- the Cas protein upon exposure of the plant cell to a geminivirus, mediates a double stranded break in the geminivirus genome at or near the geminivirus target site, and the nucleic acid sequences (i), (ii), and (iii) are inserted into the geminivirus genome at the double stranded break by homologous recombination between the nucleic acid and the geminivirus genome to form a modified geminivirus.
- the modified geminivirus is unable to undergo one or more of replication, packaging, transport from the plant cell, or infection of a plant cell.
- the left homology arm is at least 30 bp, optionally at least 400 bp
- the right homology arm is at least 30 bp, optionally at least 400 bp.
- the sequence contained within the geminivirus genome required for geminivirus replication or packaging is a Rep protein ORF, a movement protein ORF, a coat protein protein ORF, a hairpin region that mediates replication origin, or a satellite DNA.
- each of the (ii) one or more crR A sequences is fused to the (iii) tracrR A sequence.
- the nucleic acid is operably linked to a constitutive promoter, an inducible promoter or a plant tissue specific promoter.
- the plant cell is in a plant.
- the transforming comprises Agrobacterium- mediated transformation, electroporation transformation, polyethylene glycol (PEG) transformation, or biolistic transformation.
- Embodiment 2 is a method for generating a plant cell having the potential for increased resistance to geminivirus infection.
- the method comprises transforming the plant cell with a nucleic acid comprising: (i) a nucleic acid sequence that encodes a Clustered Regularly Interspaced Short Palindromic Repeats-associated (system) Cas protein capable of modifying DNA by introducing a double stranded break,
- CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
- crRNA Clustered Regularly Interspaced Short Palindromic Repeats
- a left homology arm nucleic acid sequence and a right homology arm nucleic acid sequence each comprising a nucleotide sequence from the geminivirus genome that is adjacent to the geminivirus target site, and where the left homology arm nucleic acid sequence and the right homology arm nucleic acid sequence are effective to introduce nucleic acid sequence (i), (ii), or (iii) into a geminivirus genome at or near the geminivirus target site by homologous recombination.
- the nucleic acid is stably integrated into the genome of the plant cell.
- Cas protein is flanked by the left homology arm nucleic acid sequence and the right homology arm nucleic acid sequence.
- the (ii) one or more crRNA nucleic acid sequences is flanked by the left homology arm nucleic acid sequence and the right homology arm nucleic acid sequence.
- the (iii) tracrRNA nucleic acid sequence is flanked by the left homology arm nucleic acid sequence and the right homology arm nucleic acid sequence.
- the Cas protein upon exposure of the plant cell to a geminivirus, mediates a double stranded break in the geminivirus genome at or near the geminivirus target site, and at least one of the nucleic acid sequences (i), (ii), and (iii) are inserted into the geminivirus genome at the double stranded break by homologous recombination between the nucleic acid and the geminivirus genome to form a modified geminivirus.
- the modified geminivirus is unable to undergo one or more of replication, packaging transport from the plant cell, or infection of new plant cells.
- the left homology arm is at least 30 bp, optionally at least 400 bp
- the right homology arm is at least 30 bp, optionally at least 400 bp.
- the sequence contained within the geminivirus genome required for geminivirus replication or packaging is a Rep protein ORF, a movement protein ORF, a coat protein protein ORF, a hairpin region that mediates replication origin, or a satellite DNA.
- the insert sequence comprises one or more of a sequence that encodes a Clustered Regularly Interspaced Short Palindromic Repeats- associated Cas protein, a crR A sequence, and a tracrRNA sequence targeted to one or more geminivirus sequences.
- each of the (ii) one or more crRNA sequences is fused to the (iii) tracrRNA sequence.
- the nucleic acid is operably linked to a constitutive promoter, an inducible promoter or a plant tissue specific promoter.
- the plant cell is in a plant, and where the transforming comprises Agrobacterium-mediated transformation, electroporation transformation, polyethylene glycol (PEG) transformation, or biolistic transformation.
- Agrobacterium-mediated transformation comprises Agrobacterium-mediated transformation, electroporation transformation, polyethylene glycol (PEG) transformation, or biolistic transformation.
- Embodiment 3 is a method for generating a plant cell having the potential for increased resistance to geminivirus infection.
- the method comprises transforming the plant cell with a nucleic acid comprising: (i) a nucleic acid sequence that encodes a Clustered Regularly Interspaced Short Palindromic Repeats-associated Cas protein capable of modifying DNA by introducing a double stranded break,
- CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
- crRNA Clustered Regularly Interspaced Short Palindromic Repeats
- a left homology arm nucleic acid sequence and a right homology arm nucleic acid sequence each comprising a nucleotide sequence from the geminivirus genome that is adjacent to the geminivirus target site, and where the left homology arm nucleic acid sequence and the right homology arm nucleic acid sequence flank the (iv) insert nucleic acid sequence and are effective to insert the (iv) insert nucleic acid sequence into a geminivirus genome at or near the geminivirus target site by homologous recombination.
- the nucleic acid is stably integrated into the genome of the plant cell.
- the (iv) insert nucleic acid sequence comprises one or more of the (i) nucleic acid sequence that encodes the Cas protein, the (ii) one or more crRNA nucleic acid sequences, and the (iii) tracrRNA nucleic acid sequence.
- the (iv) insert nucleic acid sequence comprises the (i) nucleic acid sequence that encodes the Cas protein, the (ii) one or more crRNA nucleic acid sequences, and the (iii) tracrRNA nucleic acid sequence.
- the insert sequence is at least 200 bp, optionally from 200 bp to 9 kb.
- the Cas protein upon exposure of the plant cell to a geminivirus, mediates a double stranded break in the geminivirus genome at or near the geminivirus target site, and the (iv) insert nucleic acid sequence is inserted into the geminivirus genome at the double stranded break by homologous recombination.
- the modified geminivirus is unable to undergo one or more of replication, packaging or transport from the plant cell.
- the left homology arm is at least 30 bp, optionally at least 400 bp
- the right homology arm is at least 30 bp, optionally at least 400 bp.
- the sequence contained within the geminivirus genome required for geminivirus replication or packaging may be a Rep protein ORF, a movement protein ORF, a coat protein ORF, a hairpin region that mediates replication origin, or a satellite DNA.
- the insert sequence may comprise one or more of a sequence that encodes a Clustered Regularly Interspaced Short Palindromic Repeats-associated Cas protein, a crRNA sequence, and a tracrRNA sequence targeted to one or more geminivirus sequences.
- each of the (ii) one or more crRNA sequences is fused to the (iii) tracrRNA sequence.
- the nucleic acid is operably linked to a constitutive promoter, an inducible promoter or a plant tissue specific promoter.
- the plant cell is in a plant.
- Transforming can occur by any of Agrobacterium-mediated transformation, electroporation transformation, polyethylene glycol (PEG) transformation, or biolistic transformation.
- Embodiment 4 is a plant, plant part, or plant cell that has increased resistance to geminivirus infection, where the genome of the plant, plant part, or plant cell comprises a nucleic acid comprising:
- CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
- crRNA Clustered Regularly Interspaced Short Palindromic Repeats
- a left homology arm nucleic acid sequence and a right homology arm nucleic acid sequence each comprising a nucleotide sequence from the geminivirus genome that is adjacent to the geminivirus target site, and where the left homology arm nucleic acid sequence and the right homology arm nucleic acid sequence are effective to introduce nucleic acid sequences (i), (ii), and/or (iii) into a geminivirus genome at or near the geminivirus target site by homologous recombination.
- the nucleic acid is stably integrated into the genome of the plant cell.
- Cas protein, the (ii) one or more crRNA nucleic acid sequences, and the (iii) tracrRNA nucleic acid sequence are flanked by the left homology arm nucleic acid sequence and the right homology arm nucleic acid sequence.
- nucleic acid sequences (i), (ii), and/or (iii) are inserted into the geminivirus genome at the double stranded break by homologous recombination between the nucleic acid and the geminivirus genome to form a modified geminivirus.
- the modified geminivirus is unable to undergo one or more of replication, packaging or transport from the plant cell.
- the plant, plant part, or plant cell of claim 31 where the left homology arm is at least 30 bp, optionally at least 400 bp, and the right homology arm is at least 30 bp, optionally at least 400 bp.
- the sequence contained within the geminiviras genome required for geminiviras replication or packaging is a Rep protein ORF, a movement protein ORF, a coat protein protein ORF, a hairpin region that mediates replication origin, or a satellite DNA.
- each of the (ii) one or more crR A sequences is fused to the (iii) tracrR A sequence.
- the nucleic acid is operably linked to a constitutive promoter, an inducible promoter or a plant tissue specific promoter.
- the plant cell is in a plant.
- Transforming occurs by any of Agrobacterium-mediated transformation, electroporation transformation, polyethylene glycol (PEG) transformation, and biolistic transformation.
- Embodiment 5 is a plant, plant part, or plant cell that has increased resistance to geminiviras infection.
- the genome of the plant, plant part, or plant cell comprises a nucleic acid comprising:
- CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
- crRNA Clustered Regularly Interspaced Short Palindromic Repeats
- a left homology arm nucleic acid sequence and a right homology arm nucleic acid sequence each comprising a nucleotide sequence from the geminiviras genome that is adjacent to the geminiviras target site, and where the left homology arm nucleic acid sequence and the right homology arm nucleic acid sequence are effective to introduce nucleic acid sequence (i), (ii), or (iii) into a geminivirus genome at or near the geminivirus target site by homologous recombination.
- the nucleic acid is stably integrated into the genome of the plant cell.
- Cas protein is flanked by the left homology arm nucleic acid sequence and the right homology arm nucleic acid sequence.
- the (ii) one or more crRNA nucleic acid sequences is flanked by the left homology arm nucleic acid sequence and the right homology arm nucleic acid sequence.
- the (iii) tracrR A nucleic acid sequence is flanked by the left homology arm nucleic acid sequence and the right homology arm nucleic acid sequence.
- the Cas protein upon exposure of the plant cell to a geminivirus, mediates a double stranded break in the geminivirus genome at or near the geminivirus target site, and at least one of the nucleic acid sequences (i), (ii), and (iii) are inserted into the geminivirus genome at the double stranded break by homologous recombination between the nucleic acid and the geminivirus genome to form a modified geminivirus.
- the modified geminivirus is unable to undergo one or more of replication, packaging or transport from the plant cell.
- the left homology arm is at least 30 bp, optionally at least 400 bp
- the right homology arm is at least 30 bp, optionally at least 400 bp.
- the sequence contained within the geminivirus genome required for geminivirus replication or packaging is a Rep protein ORF, a movement protein ORF, a coat protein protein ORF, a hairpin region that mediates replication origin, or a satellite DNA.
- the insert sequence comprises one or more of a sequence that encodes a Clustered Regularly Interspaced Short Palindromic Repeats- associated Cas protein, a crRNA sequence, and a tracrRNA sequence targeted to one or more geminivirus sequences.
- each of the (ii) one or more crRNA sequences is fused to the (iii) tracrRNA sequence.
- the nucleic acid is operably linked to a constitutive promoter, an inducible promoter or a plant tissue specific promoter.
- the plant cell is in a plant, and where the transforming comprises Agrobacterium-mediated transformation, electroporation transformation, polyethylene glycol (PEG) transformation, or biolistic transformation.
- Agrobacterium-mediated transformation comprises Agrobacterium-mediated transformation, electroporation transformation, polyethylene glycol (PEG) transformation, or biolistic transformation.
- Embodiment 6 is a plant, plant part, or plant cell that has increased resistance to geminivirus infection.
- the genome of the plant, plant part, or plant cell comprises a nucleic acid comprising:
- CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
- crRNA Clustered Regularly Interspaced Short Palindromic Repeats
- a left homology arm nucleic acid sequence and a right homology arm nucleic acid sequence each comprising a nucleotide sequence from the geminivirus genome that is adjacent to the geminiviras target site, and where the left homology arm nucleic acid sequence and the right homology arm nucleic acid sequence flank the (iv) insert nucleic acid sequence and are effective to insert the (iv) insert nucleic acid sequence into a geminiviras genome at or near the geminiviras target site by homologous recombination.
- the nucleic acid is stably integrated into the genome of the plant cell.
- the (iv) insert nucleic acid sequence comprises one or more of the (i) nucleic acid sequence that encodes the Cas protein, the (ii) one or more crRNA nucleic acid sequences, and the (iii) tracrRNA nucleic acid sequence.
- the (iv) insert nucleic acid sequence comprises the (i) nucleic acid sequence that encodes the Cas protein, the (ii) one or more crRNA nucleic acid sequences, and the (iii) tracrRNA nucleic acid sequence.
- the (iv) insert sequence is at least 200 bp, optionally from 200 bp to 9 kb.
- the Cas protein upon exposure of the plant cell to a geminiviras, mediates a double stranded break in the geminiviras genome at or near the geminiviras target site, and the (iv) insert nucleic acid sequence is inserted into the geminiviras genome at the double stranded break by homologous recombination.
- the modified geminiviras is unable to undergo one or more of replication, packaging or transport from the plant cell.
- the left homology arm is at least 30 bp, optionally at least 400 bp
- the right homology arm is at least 30 bp, optionally at least 400 bp.
- the sequence contained within the geminiviras genome required for geminiviras replication or packaging is a Rep protein ORF, a movement protein ORF, a coat protein protein ORF, a hairpin region that mediates replication origin, or a satellite DNA.
- the insert sequence comprises one or more of a sequence that encodes a Clustered Regularly Interspaced Short Palindromic Repeats- associated Cas protein, a crRNA sequence, and a tracrRNA sequence targeted to one or more geminivirus sequences.
- each of the (ii) one or more crRNA sequences is fused to the (iii) tracrRNA sequence.
- the nucleic acid is operably linked to a constitutive promoter, an inducible promoter or a plant tissue specific promoter.
- the plant cell is in a plant, and the transforming comprises Agrobacterium-mediated transformation, electroporation transformation, polyethylene glycol (PEG) transformation, or biolistic transformation.
- Embodiment 7 is a method for generating a plant cell having the potential for increased resistance to geminivirus infection.
- the method comprises transforming the plant cell with a nucleic acid comprising:
- gRNA guide RNA
- a left homology arm nucleic acid sequence and a right homology arm nucleic acid sequence each comprising a nucleotide sequence from the geminivirus genome that is adjacent to the geminivirus target site, and where the left homology arm nucleic acid sequence and the right homology arm nucleic acid sequence are effective to introduce one or more of nucleic acid sequences (i) and (ii) into a geminivirus genome at or near the geminivirus target site by homologous recombination.
- the nucleic acid is stably integrated into the genome of the plant cell.
- Plasmid DNA is modified to encode a nucleic acid comprising a Cas9 protein.
- the plasmid DNA contains a nuclease-active, plant codon-optimized Cas9 sequence that includes at least one translationally fused nuclear-localization signal peptide , downstream of and expressed by a constitutive RNA pol II promoter.
- the plasmid also contains selectable markers effective to provide Agrobacterum tumefaciens resistance to both kanamycin and gentamicin, and T-DNA borders suitable for causing transfer of the included sequence between the borders into the plant cell.
- the resulting plasmid is called pCas9.
- An Agrobacterium tumefaciens strain is transformed with pCas9 using a freeze-thaw method and plated onto LB agar containing 50 ⁇ g/mL kanamyscin and 50 ⁇ g/mL gentamicin.
- 5 mL starter cultures with LB broth with 50 ⁇ g/mL kanamyscin and 50 ⁇ g/mL gentamicin are inoculated with colonies that grow on the LB agar plates.
- the starter culture is used to inoculate 500 mL of LB broth with 50 ⁇ g/mL kanamyscin and 50 ⁇ g/mL gentamicin are inoculated with colonies that grow on the LB agar plates.
- An infiltration suspension is formed by pelleting the Agrobacterium cells, resuspending them in 10 mM MES, 150 ⁇ acetosyringone and 10 mM MgCk, and incubating at room temperature for four hours.
- Example 2 Selection of a target sequence, left homology arm, and right homology arm
- a target sequence is selected for such that if a double stranded break in the geminivirus genome occurs within the target sequence, geminivirus replication, packaging and/or transport is disrupted.
- the preferred target sequence is within a region of the geminivirus genome that is critical for geminivirus biology.
- the selected target sequence will then be used to design a crR A or gR A that is effective to target Cas9, in the following examples, or even another reagent such as Cpfl .
- CTGGAGAAGAGCATGATAGTG (SEQ ID NO: 15) is selected as a target sequence from Motif II within the Rep coding sequence of bean yellow dwarf virus (BeYDV-m).
- the left and right homology arms comprise about 100 bases of sequence from BeYDV-m immediately adjacent to CTGGAGAAGAGCATGATAGTG (SEQ ID NO: 15) in the 5' and 3' directions, respectively.
- the left homology arm has the sequence:
- the right homology arm has the sequence:
- Example 3 Preparing a construct with Cas9 between the left homology arm and the right homology arm
- a construct is prepared that includes the Cas9 coding sequence flanked by both the left and right homology arms, operatively linked to the RNA polymerase II promoter.
- An exemplary construct comprises the following sequence:
- CATCTCTTTGAGAT (SEQ ID NO: 34).
- Example 4 Preparing a construct comprising crRNA and tracrRNA
- the nucleic acid encoding a crRNA comprises the sequence AATTTCTACTCTTGTAGATCTGGAGAAGAGCATGATAGTG (SEQ ID NO: 35).
- the nucleic acid encoding a tracrRNA from Streptococcus pyogenes is GTTGGAACCATTCAAAACAGCATAGCAAGTTAAAATAAGGCTAGTCCGTTAT CAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTT (SEQ ID NO: 36).
- a construct is prepared with each of the crRNA and tracrRNA sequences operatively linked to the RNA polymerase III promoter.
- Example 5 Testing plants resistant to geminivirus.
- N. benthamiana plant as described in Example 1.
- leaves of the N. benthamiana are infiltrated with Agrobacterium strain expressing each of the constructs.
- Plants are bred and those having constructs integrated into the genome are identified.
- geminivirus infection symptoms Following infection, visual observation of geminivirus infection symptoms is undertaken, with scoring of leaf curling, chlorotic lesions, mosaic, malformation, size reduction and stunting. A scale of zero to four, with zero representing no observable symptoms and four representing severe symptoms, can be used.
- an uninfected plant is placed in proximity to the individual plant.
- the degree of geminivirus migration from the challenged plant to the uninfected plant can be ascertained by visual observation of geminivirus infection symptoms in the uninfected plant, as described above.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Virology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
Description
Claims
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201780086842.5A CN110325644A (en) | 2016-12-20 | 2017-12-20 | It carries out gene driving in an alternate manner using CRISPR/CAS system and assigns resistance to geminivirus infection in plant |
| CA3047829A CA3047829A1 (en) | 2016-12-20 | 2017-12-20 | Conferring resistance to geminiviruses in plants in alternative manner to gene drive, using crispr/cas systems |
| US16/471,465 US20190352653A1 (en) | 2016-12-20 | 2017-12-20 | Conferring resistance to geminiviruses in plants in alternative manner to gene drive, using crispr/cas systems |
| BR112019012839A BR112019012839A2 (en) | 2016-12-20 | 2017-12-20 | resistance conferring resistance to geminiviruses in plants as an alternative to the gene unit using wror / cas systems |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201662436792P | 2016-12-20 | 2016-12-20 | |
| US62/436,792 | 2016-12-20 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2018115202A1 true WO2018115202A1 (en) | 2018-06-28 |
Family
ID=60937734
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2017/083952 Ceased WO2018115202A1 (en) | 2016-12-20 | 2017-12-20 | Conferring resistance to geminiviruses in plants in alternative manner to gene drive, using crispr/cas systems |
Country Status (5)
| Country | Link |
|---|---|
| US (1) | US20190352653A1 (en) |
| CN (1) | CN110325644A (en) |
| BR (1) | BR112019012839A2 (en) |
| CA (1) | CA3047829A1 (en) |
| WO (1) | WO2018115202A1 (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020089448A1 (en) * | 2018-11-01 | 2020-05-07 | Keygene N.V. | Dual guide rna for crispr/cas genome editing in plants cells |
| CN111118061A (en) * | 2019-12-31 | 2020-05-08 | 中国农业科学院植物保护研究所 | A vector for editing Chinese tomato yellow leaf curl virus based on CRISPR/Cas9 system and its construction method and application |
| WO2020176389A1 (en) * | 2019-02-25 | 2020-09-03 | Caribou Biosciences, Inc. | Plasmids for gene editing |
| WO2021188526A1 (en) * | 2020-03-16 | 2021-09-23 | Pairwise Plants Services, Inc. | Natural guide architectures and methods of making and using the same |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111088277B (en) * | 2019-12-31 | 2022-01-18 | 中国农业科学院植物保护研究所 | Vector for inhibiting geminivirus infection based on CRISPR/Cas9 SunTag system and construction and application thereof |
| CN111041043B (en) * | 2019-12-31 | 2026-04-07 | 中国农业科学院植物保护研究所 | Vectors for editing the Nicotiana benthamiana gene based on CRISPR/Cas9, their construction methods and applications |
| CN116083432B (en) * | 2023-03-17 | 2023-07-04 | 西南大学 | Mulberry U6 promoter and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015048707A2 (en) * | 2013-09-30 | 2015-04-02 | Regents Of The University Of Minnesota | Conferring resistance to geminiviruses in plants using crispr/cas systems |
| WO2016185411A1 (en) * | 2015-05-18 | 2016-11-24 | King Abdullah University Of Science And Technology | Method of inhibiting plant virus pathogen infections by crispr/cas9-mediated interference |
-
2017
- 2017-12-20 BR BR112019012839A patent/BR112019012839A2/en not_active IP Right Cessation
- 2017-12-20 CN CN201780086842.5A patent/CN110325644A/en active Pending
- 2017-12-20 US US16/471,465 patent/US20190352653A1/en not_active Abandoned
- 2017-12-20 WO PCT/EP2017/083952 patent/WO2018115202A1/en not_active Ceased
- 2017-12-20 CA CA3047829A patent/CA3047829A1/en not_active Abandoned
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015048707A2 (en) * | 2013-09-30 | 2015-04-02 | Regents Of The University Of Minnesota | Conferring resistance to geminiviruses in plants using crispr/cas systems |
| WO2016185411A1 (en) * | 2015-05-18 | 2016-11-24 | King Abdullah University Of Science And Technology | Method of inhibiting plant virus pathogen infections by crispr/cas9-mediated interference |
Non-Patent Citations (11)
| Title |
|---|
| CONG ET AL., SCIENCE, vol. 339, pages 819 - 823 |
| LI ET AL., NATURE BIOTECHNOLOGY, vol. 31, no. 8, 2013, pages 688 - 691 |
| MALI ET AL., NATURE BIOTECHNOLOGY, vol. 31, 2013, pages 833 - 838 |
| MALI ET AL., SCIENCE, vol. 339, 2013, pages 823 - 826 |
| MANSOOR ET AL., TRENDS PLANT SCI., vol. 8, 2003, pages 128 - 134 |
| NICHOLAS J. BALTES ET AL: "Conferring resistance to geminiviruses with the CRISPR-Cas prokaryotic immune system", NATURE PLANTS, vol. 1, no. 10, 15145, 28 September 2015 (2015-09-28), pages 1 - 4, XP055287295, ISSN: 2055-026X, DOI: 10.1038/nplants.2015.145 * |
| SURENDER KHATODIA ET AL: "The CRISPR/Cas Genome-Editing Tool: Application in Improvement of Crops", FRONTIERS IN PLANT SCIENCE, vol. 7, 506, 19 April 2016 (2016-04-19), pages 1 - 13, XP055420620, DOI: 10.3389/fpls.2016.00506 * |
| XIANG JI ET AL: "Establishing a CRISPR-Cas-like immune system conferring DNA virus resistance in plants - Supplementary Information", NATURE PLANTS, vol. 1, no. 10, 15144, 28 September 2015 (2015-09-28), pages 1 - 4, XP055457719, ISSN: 2055-026X, DOI: 10.1038/nplants.2015.144 * |
| XIANG JI ET AL: "Establishing a CRISPR-Cas-like immune system conferring DNA virus resistance in plants", NATURE PLANTS, vol. 1, no. 10, 15144, 28 September 2015 (2015-09-28), pages 1 - 4, XP055457718, ISSN: 2055-026X, DOI: 10.1038/nplants.2015.144 * |
| ZAHIR ALI ET AL: "CRISPR/Cas9-mediated viral interference in plants", GENOME BIOLOGY, vol. 16, no. 1, 11 November 2015 (2015-11-11), XP055458062, DOI: 10.1186/s13059-015-0799-6 * |
| ZAIDI SYED SHAN-E-ALI ET AL: "Engineering Plants for Geminivirus Resistance with CRISPR/Cas9 System", TRENDS IN PLANT SCIENCE, ELSEVIER SCIENCE, OXFORD, GB, vol. 21, no. 4, 12 February 2016 (2016-02-12), pages 279 - 281, XP029486912, ISSN: 1360-1385, DOI: 10.1016/J.TPLANTS.2016.01.023 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020089448A1 (en) * | 2018-11-01 | 2020-05-07 | Keygene N.V. | Dual guide rna for crispr/cas genome editing in plants cells |
| US20220010321A1 (en) * | 2018-11-01 | 2022-01-13 | Keygene N.V. | Dual guide rna for crispr/cas genome editing in plants cells |
| JP2022505440A (en) * | 2018-11-01 | 2022-01-14 | キージーン ナムローゼ フェンノートシャップ | Dual guide RNA for CRISPR / Cas genome editing in plant cells |
| WO2020176389A1 (en) * | 2019-02-25 | 2020-09-03 | Caribou Biosciences, Inc. | Plasmids for gene editing |
| CN111118061A (en) * | 2019-12-31 | 2020-05-08 | 中国农业科学院植物保护研究所 | A vector for editing Chinese tomato yellow leaf curl virus based on CRISPR/Cas9 system and its construction method and application |
| WO2021188526A1 (en) * | 2020-03-16 | 2021-09-23 | Pairwise Plants Services, Inc. | Natural guide architectures and methods of making and using the same |
| US20210292754A1 (en) * | 2020-03-16 | 2021-09-23 | Pairwise Plants Services, Inc. | Natural guide architectures and methods of making and using the same |
Also Published As
| Publication number | Publication date |
|---|---|
| BR112019012839A2 (en) | 2019-12-17 |
| CN110325644A (en) | 2019-10-11 |
| CA3047829A1 (en) | 2018-06-28 |
| US20190352653A1 (en) | 2019-11-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20240409949A1 (en) | Optimized plant crispr/cpf1 systems | |
| US20190352653A1 (en) | Conferring resistance to geminiviruses in plants in alternative manner to gene drive, using crispr/cas systems | |
| US20160237451A1 (en) | Conferring resistance to geminiviruses in plants using crispr/cas systems | |
| US11492630B2 (en) | Methods and hybrids for targeted nucleic acid editing in plants using CRISPR/Cas systems | |
| JP3256952B2 (en) | Vector for gene transfer into plant, method for producing transgenic plant using the same, and method for multiple gene transfer into plant | |
| WO2018103686A1 (en) | Chloroplast genome editing method | |
| JP7774959B2 (en) | Regeneration of genetically modified plants | |
| WO2015189693A1 (en) | Targeted viral-mediated plant genome editing using crispr/cas9 | |
| IL84381A (en) | Process for the genetic modification of monocotyledonous plants of the family gramineae using agrobacterium | |
| Mestiri et al. | Multiple host‐cell recombination pathways act in A grobacterium‐mediated transformation of plant cells | |
| AU2017248614A1 (en) | Method for changing the intercellular mobility of an mRNA | |
| US10941412B2 (en) | Citrus varieties resistant to Xanthomonas citri infection | |
| JP2019528757A (en) | Targeted genome optimization in plants | |
| JP3412134B2 (en) | Specific site integration method of DNA into plant genome | |
| US10000766B2 (en) | Recombinant construct, recombinant microorganism, recombinant plant cell and method of providing plant with resistance against DNA virus and RNA virus | |
| AU2010211450B2 (en) | Plant transformation using DNA minicircles | |
| US20160222395A1 (en) | Agrobacterium-mediated genome modification without t-dna integration | |
| Meynard et al. | Thirty years of genome engineering in rice: From gene addition to gene editing | |
| Anandan | Viral Vector Mediated CRISPR/Cas9 Genome Editing in Common Bean (Phaseolus vulgaris): Evaluation of BeYDV and TRV Delivery Systems | |
| CN112867794A (en) | DNA constructs for genome editing in plants | |
| Ellison | Development of RNA Viral Vectors for Plant Genome Engineering | |
| KR20260030188A (en) | NML1 gene controlling virus resistance of plant and method for producing tomato plant having edited NML1 gene using CRISPR/Cas system | |
| Illing | The optimisation of CRISPR-Cas9 transformation in brassica species using the eIEF4E resistance gene as a model target | |
| KR20260053128A (en) | nCBP gene controlling virus resistance of plant and method for producing tomato plant having edited nCBP gene using CRISPR/Cas system | |
| WO2021078934A1 (en) | (be-)curtovirus replicon-mediated genome editing in plants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17825841 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3047829 Country of ref document: CA |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112019012839 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112019012839 Country of ref document: BR Kind code of ref document: A2 Effective date: 20190619 |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 17825841 Country of ref document: EP Kind code of ref document: A1 |