WO2018115083A1 - Method of treatment of gut diseases such as irritable bowel syndrome (ibs) - Google Patents
Method of treatment of gut diseases such as irritable bowel syndrome (ibs) Download PDFInfo
- Publication number
- WO2018115083A1 WO2018115083A1 PCT/EP2017/083743 EP2017083743W WO2018115083A1 WO 2018115083 A1 WO2018115083 A1 WO 2018115083A1 EP 2017083743 W EP2017083743 W EP 2017083743W WO 2018115083 A1 WO2018115083 A1 WO 2018115083A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- trypsin
- ibs
- inhibitor
- activity
- bowel syndrome
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
- C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
- C12N9/6424—Serine endopeptidases (3.4.21)
- C12N9/6427—Chymotrypsins (3.4.21.1; 3.4.21.2); Trypsin (3.4.21.4)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
- C12Y304/21—Serine endopeptidases (3.4.21)
- C12Y304/21004—Trypsin (3.4.21.4)
Definitions
- Trypsin-3 was the only form of trypsin up-regulated in stimulated intestinal epithelial cells and in IBS patient tissues. Trypsin-3 was able to signal to human submucosal enteric neurons and mouse sensory neurons, and to induce visceral hypersensitivity in vivo, all by a Protease-Activated Receptor- 2-dependent mechanism. Trypsin-3 inhibitor
- Trypsin-3 inhibitor (inhibitor of expression or of activity) may be used to treat gut diseases associated with intestinal permeability and visceral hypersensitivity.
- the term “selectively blocks or inactivates” refers to a compound that preferentially binds to and blocks or inactivates Trypsin-3 with a greater affinity and potency, respectively, than its interaction with the other sub-types of the Trypsin family (Trypsin- 1 or Trypsin-2 for example).
- Trypsin-3 inhibitor also refers to a compound that inhibits Trypsin-3 expression.
- inhibitor of the TRYPSIN-3 activity is selected from the group consisting of antibodies, aptamers, polypeptides.
- Figure 3 Intestinal epithelial cells up-regulate Trypsin-3 secretion in inflammatory condition and in IBS Mean fluorescence intensity for Trypsin-3- immunoreactivity quantified specifically in epithelial (Epcam-positive) cells in tissues from healthy controls or IBS patients. Data are expressed as mean ⁇ SEM and were analyzed by Student's t-test in A and C, and a one-way ANOVA followed by a Bonferroni post-test in B.
- Caco-2 cells were grown to confluence as monolayers in Transwell plates (2x105 cells per well) (Corning)[15]. After 21 days in culture (transepithelial electrical resistance of 350 ⁇ cm2)[15], culture medium was replaced by OptiMEM (Life technologies) and cells incubated for 24 hours (h) before stimulation on apical and baso-lateral sides by LPS (50 ⁇ g/mL, Sigma), or by epinephrine (5nM, Sigma) on the basolateral side [16] for 2, 4, 6, 18 and 24h to mimic a stress condition in vitro. In a third set of experiments, Caco-2 monolayers were exposed for 24h to Trypsin-3 (0.5-10nM) on the baso-lateral side. Paracellular permeability was measured by the passage of dextran FITC (3000kDa, Sigma) from the apical to the basal medium, as previously described[ 17].
- mice were submitted to intraco Ionic administration of Trypsin-3 (10 U/mouse), followed by colorectal distensions at 0, 1, 3, 6 and 9-hours time points, as previously described[3].
- mice were intracolonically administered with increasing doses of Trypsin-3 (0.1, 1 or 10 U/mouse), followed by colorectal distension 3 hours later.
- Mice from the control group were administered intracolonically with vehicle (10% v/v absolute ethanol and 10% v/v Tween- 80)[19]. Similar experiments were repeated in PAR2-deficient mice and wild-type littermates[3].
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Epidemiology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biochemistry (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention is in the field of therapy of gut diseases associated with intestinal permeability such as, Irritable Bowel Syndrome (IBS), Inflammatory Bowel Diseases (IBD), celiac disease or pouchitis. In particular, the invention relates to inhibitors of Trypsin-3, for use in the treatment of Irritable Bowel Syndrome (IBS) including gluten hypersensitivity. The inventors demonstrate that, stimulated intestinal epithelial cells released trypsin-like activity specifically from the basolateral side. This activity was able to activate sensory neurons. In IBS patient colons, increased trypsin-like activity was associated with the epithelium. Inventors identified that Trypsin-3 was the only form of trypsin up-regulated in stimulated intestinal epithelial cells and in IBS patient tissues. Trypsin-3 was able to signal to human submucosal enteric neurons and mouse sensory neurons, and to induce visceral hypersensitivity in vivo, all by a Protease-Activated Receptor-2-dependent mechanism.
Description
METHOD OF TREATMENT OF GUT DISEASES SUCH AS IRRITABLE BOWEL
SYNDROME (IBS)
FIELD OF THE INVENTION:
The invention is in the field of therapy of gut diseases associated with intestinal permeability such as, Irritable Bowel Syndrome (IBS), Inflammatory Bowel Diseases (IBD), celiac disease or pouchitis. In particular, the invention relates to inhibitors of Trypsin-3, for use in the treatment of Irritable Bowel Syndrome (IBS) including gluten hypersensitivity.
BACKGROUND OF THE INVENTION:
Irritable Bowel Syndrome (IBS) is the most common functional gastrointestinal disorder[l]. Patients are suffering from abdominal pain, cramping, and altered bowel habit. While the pathophysiology remains poorly understood, there is growing evidence that neurons innervating the intestine in IBS patients are hyperexcitable, including both enteric neurons and extrinsic primary sensory afferents. Numerous studies suggest that a number of mediators that are present within tissues of IBS patients underlie these neuronal changes, and among them, proteases seem to be particularly important [2, 3, 4].
Studies reported that protease inhibitors completely inhibited neuronal activation induced by IBS tissue supematants [3, 4]. However, the origin and the nature of proteases that could be responsible for neuronal hyperactivity in tissues from IBS patients are still unclear. Identification of the origin and nature of such proteases would be an important step for potential therapeutic approach and drug development in the field of IBS.
Based on this knowledge, the inventors propose identification of a new protease associated with increase intestinal permeability into the gut of IBS patient, which could be used as a new target for the treatment of IBS but also with pathologies associated with intestinal permeability such as IBD celiac disease or pouchitis. SUMMARY OF THE INVENTION:
The invention is based on the discovery that the Trypsin-3 (also called mesotrypsin) is implicated in pathophysiological pathways of IBS. Indeed, inventors made the hypothesis that the intestinal epithelium could be an important source of proteases that are inducing neuronal signaling, and potentially hypersensitivity symptoms associated with IBS. Therefore, they
have investigated proteolytic activity released by human cultured intestinal epithelial cells and tested their effect on sensory neuron activation. In humans, three serine protease (PRSS) genes encode trypsinogens: PRSS1 encodes Trypsinogen-1 (cationic trypsin), PRSS2 encodes Trypsinogen-2 (anionic trypsin) and PRSS3 encodes Trypsinogen-3, wherein at least two isoforms with overlapping mature peptide sequences, formerly designated as mesotrypsinogen and trypsinogen IV, have been functionally characterized. The mature protein of PRSS3 gene uses the nomenclature of Trypsin-3 protein, common to all transcripts of this gene. Herein, inventors have determined that a stimulated (by LPS or Epinephrine) intestinal epithelium released specifically on the basolateral side Trypsin-3, which is able to signal to human enteric neurons and sensory neurons through a Protease-Activated Receptor-2 (PAR2)- dependent mechanism. In addition, Trypsin-3 was able to induce increased epithelial permeability in vitro and visceral hypersensitivity in vivo, when delivered into the colon. Finally, in tissues from IBS patients, we determined that the vast majority of trypsin-like proteolytic activity was associated with the epithelium, where Trypsin-3 was up-regulated compared to the levels of healthy controls. Inventors data demonstrated in IBS, that the intestinal epithelium produces and releases active proteases: i.e. Trypsin-3 that is able to signal to submucosal neurons, primary afferents and to induce visceral hypersensitivity.
Furthermore inventors demonstrate in a gut model, that Trypsin-3 increases cellular permeability in PAR2-dependent manner. Furthermore they show that trypsin-3 is overexpressed in colonic biopsies of IBD patients when compared with biopsies of control.
Thus, the invention relates to an inhibitor of Trypsin-3 for the treatment of gut diseases associated with intestinal permeability or Irritable Bowel Syndrome (IBS) and gluten hypersensitivity. The invention also relates to an inhibitor of Trypsin-3 for the treatment of Inflammatory Bowel Diseases (IBD), such as Crohn's Disease, Ulcerative Colitis, Celiac disease, and pouchitis.
A further object of the invention relates to a therapeutic composition comprising inhibitor of Trypsin-3 as defined above.
DETAILED DESCRIPTION OF THE INVENTION:
As previously mentioned the inventors demonstrate that, stimulated intestinal epithelial cells released trypsin-like activity specifically from the basolateral side. This activity was able to activate sensory neurons. In IBS patient colons, increased trypsin-like activity was associated with the epithelium. Inventors identified that Trypsin-3 was the only form of trypsin up-regulated in stimulated intestinal epithelial cells and in IBS patient tissues.
Trypsin-3 was able to signal to human submucosal enteric neurons and mouse sensory neurons, and to induce visceral hypersensitivity in vivo, all by a Protease-Activated Receptor- 2-dependent mechanism. Trypsin-3 inhibitor
Increased proteolytic activity, and in particular trypsin activity is released by colonic tissues of IBS patients. It is considered to be involved in hyperexcitability of both extrinsic and intrinsic enteric neurons, and in visceral hypersensitivity [2, 3, 4]. Reducing the protease activity associated with visceral hypersensitivity is known to completely inhibit neuronal activation induced by IBS tissue supernatants [3, 4]. Increased intestinal permeability is also a factor in several gut diseases such as irritable bowel syndrome, and inflammatory bowel disease, (Arrieta MC et al Gut. 2006 Oct; 55(10): 1512-1520).
Accordingly, use of Trypsin-3 inhibitor (inhibitor of expression or of activity) may be used to treat gut diseases associated with intestinal permeability and visceral hypersensitivity.
Accordingly Trypsin-3 inhibitor (inhibitor of expression or of activity) may be used to treat Irritable Bowel Syndrome (IBS) or Inflammatory Bowel Diseases (IBD).
In particular embodiment the gut disease is selected from the group consisting of Irritable Bowel Syndrome (IBS), Gluten hypersensitivity.
The term "Trypsin-3" also known as "Mesotrypsin" or "TRY3" means Trypsin3 (EC
3.4.21.4) which is a serine protease that in humans is encoded by the PRSS3 gene. In humans, three serine protease (PRSS) genes encode trypsinogens: PRSS1 encodes Trypsinogen-1 (cationic trypsin), PRSS2 encodes Trypsinogen-2 (anionic trypsin) and PRSS3 encodes Trypsinogen-3, wherein at least two iso forms with overlapping mature peptide sequences, formerly designated as mesotrypsinogen and trypsinogen IV, have been functionally characterized. The mature protein of PRSS3 gene uses the nomenclature of Trypsin-3 protein, common to all transcripts of this gene. Trypsin-3 is expressed in the brain and pancreas and is resistant to common trypsin inhibitors. It is active on peptide linkages involving the carboxyl group of lysine or arginine. Four transcript variants encoding different iso forms have been described for this gene. The whole sequence of human PRSS3 gene (gene TRYPSINS) is referenced as Gene ID: 5646
The protein sequence of said human Trypsin-3, and its isoforms, may be found in NCBI database with the following access numbers:
Trypsin-3 Variant 1 mRNA: NM 007343, and protein id: NP 031369 (isoform 1),
(Trypsinogen 4)
Trypsin-3 Variant 2 mR A: NM_002771 and protein_id: NP_002762 (isoform 2) (Trypsinogen 3; Mesotrypsinogen)
Trypsin-3 Variant 3 mRNA: NM 001197097, and protein id: NP 001184026 (isoform 3),
Trypsin-3 Variant 4 mRNA NM 001197098, and protein id: NP 001184027 (isoform 4) (Trypsinogen 5).
Inventors determined that PRSS3 variant 1 (Trypsin3 isoform 1) is the major transcript expressed in intestinal epithelial cells and in colonic tissue samples.
Accordingly in a particular embodiment Trypsin-3 inhibitor is specific of the isoform
1.
The term "Trypsin-3 inhibitor" has its general meaning in the art and refers to a compound that selectively blocks or inactivates the serine protease Trypsin-3. The term "Trypsin-3 inhibitor" also refers to a compound that selectively blocks or inactivates the trypsin activity of the enzyme that is to say to cleave peptide chains mainly at the carboxyl side of the amino acids lysine or arginine, except when either is followed by proline. As used herein, the term "selectively blocks or inactivates" refers to a compound that preferentially binds to and blocks or inactivates Trypsin-3 with a greater affinity and potency, respectively, than its interaction with the other sub-types of the Trypsin family (Trypsin- 1 or Trypsin-2 for example). Compounds that block or inactivate Trypsin-3, but that may also block or inactivate other Trypsin sub-types, as partial inhibitors, are contemplated. The term "Trypsin-3 inhibitor" also refers to a compound that inhibits Trypsin-3 expression.
Typically, a Trypsin-3 inhibitor is, a polypeptide, an aptamer, an antibody, an oligonucleotide or a ribozyme.
Accordingly in the present invention, a functional assay may also be envisaged to determine a Trypsin-3 inhibitor. Such inhibition of trypsin activity assay (see Example "Trypsin activity"and Figure 1A) could also be used to evaluate the ability of Trypsin-3 inhibitors to block specific intestinal permeability, visceral hypersensitivity in the gut, neuronal signalling (see Example "Epithelial proteolytic activity signals to sensory neurons ").
This functional assay may be: Recombinant Trypsin-3 is incubated in medium with N- p-Tosyl-GPR-amino-4-methylcoumarin hydrochloride and a time course dependent assay is performed to quantify fluorescence released after proteolytic cleavage by Trypsin-3. Substrate
degradation is calculated by the change in fluorescence. Presence of Trypsin- 3 inhibitor in the reaction milieu will decrease the fluorescence quantity due to decrease of Trypsin-3 activity. Specificity for Trypsin-3 inhibition will be determined by using the same assay, but with other pancreatic Trypsins (PRSS1, PRSS2) and Tryptases for substrate degradation.
Commercial kits to test trypsin activity are also available such as Trypsin Activity
Assay Kit (Colorimetric) (ab 102531) or Procedure for Enzymatic Assay of Trypsin (EC 3.4.21.4) by sigma Aldrich.
Accordingly a first object of the present invention is a Trypsin-3 inhibitor for use in treating gut diseases associated with intestinal permeability and visceral hypersensitivity in a patient.
In a specific embodiment gut diseases is selected from the group consisting of Inflammatory Bowel Diseases (IBD) or Irritable Bowel Syndrome (IBS).
As used herein, the term "Irritable Bowel Syndrome (IBS)" is a term for a variety of pathological conditions causing discomfort in the gastro-intestinal tract. It is a functional bowel disorder characterized by chronic abdominal pain, discomfort, bloating, and alteration of bowel habits in the absence of any organic cause. It also includes some forms of food- related visceral hypersensitivity, such as Gluten hypersensitivity.
As used herein, the term "inflammatory bowel diseases (IBD)" is a group of inflammatory diseases of the colon and small intestine. The major types of IBD are Crohn's disease, ulcerative colitis Celiac disease, and pouchitis.
Inhibitors of the TRYPSIN-3 expression
A further object of the present invention relates to a Trypsin-3 inhibitor, which is an inhibitor of the TRYPSIN-3 expression for use in the treatment of Irritable Bowel Syndrome (IBS), including Gluten hypersensitivity or Inflammatory Bowel Diseases (IBD).
In preferred embodiment the disease is Irritable Bowel Syndrome (IBS) including Gluten hypersensitivity
In particular embodiment Inflammatory Bowel Diseases (IBD), is selected between the group consisting of Crohn's Disease, Ulcerative Colitis, Celiac disease, and Pouchitis.
Small inhibitory RNAs (siRNAs) can also function as inhibitors of Trypsin-3 gene (PRSS3) expression for use in the present invention. Trypsin-3 gene expression can be reduced by contacting a subject or cell with a small double stranded RNA (dsRNA), or a
vector or construct causing the production of a small double stranded RNA, such that TRYPSIN-3 gene expression is specifically inhibited (i.e. RNA interference or RNAi). Methods for selecting an appropriate dsRNA or dsRNA-encoding vector are well known in the art for genes whose sequence is known (e.g. see for example Tuschl, T. et al. (1999); Elbashir, S. M. et al. (2001); Hannon, GJ. (2002); McManus, MT. et al. (2002); Brummelkamp, TR. et al. (2002); U.S. Pat. Nos. 6,573,099 and 6,506,559; and International Patent Publication Nos. WO 01/36646, WO 99/32619, and WO 01/68836).
Examples of oligonucleotide antisense (shRNA) targeting Trypsin-3 gene are:
- 5 ' - C AAACTCTCCTC ACCTGCCGTCATC AATG -3 ' : SEQ ID NO : 1 - 5'- ATGAGCAGTTCATCAATGCGGCCAAGATC -3' : SEQ ID NO: 2
- 5 ' - AC ACC AAGGTCTAC AACT ATGTGGACTGG -3 ' : SEQ ID NO : 3
- 5 ' - TGGTCTGCAACGGAC AGCTCC AAGGAGTT -3 ' : SEQ ID NO : 4
Ribozymes can also function as inhibitors of Trypsin-3 gene expression for use in the present invention. Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. The mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Engineered hairpin or hammerhead motif ribozyme molecules that specifically and efficiently catalyze endonucleolytic cleavage of Trypsin-3 mRNA sequences are thereby useful within the scope of the present invention. Specific ribozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites, which typically include the following sequences, GUA, GUU, and GUC. Once identified, short RNA sequences of between about 15 and 20 ribonucleotides corresponding to the region of the target gene containing the cleavage site can be evaluated for predicted structural features, such as secondary structure, that can render the oligonucleotide sequence unsuitable. The suitability of candidate targets can also be evaluated by testing their accessibility to hybridization with complementary oligonucleotides, using, e.g., ribonuclease protection assays.
Both antisense oligonucleotides and ribozymes useful as inhibitors of Trypsin-3 gene expression can be prepared by known methods. These include techniques for chemical synthesis such as, e.g., by solid phase phosphoramadite chemical synthesis. Alternatively, anti-sense RNA molecules can be generated by in vitro or in vivo transcription of DNA sequences encoding the RNA molecule. Such DNA sequences can be incorporated into a wide variety of vectors that incorporate suitable RNA polymerase promoters such as the T7 or SP6
polymerase promoters. Various modifications to the oligonucleotides of the invention can be introduced as a means of increasing intracellular stability and half-life. Possible modifications include but are not limited to the addition of flanking sequences of ribonucleotides or deoxyribonucleotides to the 5' and/or 3' ends of the molecule, or the use of phosphorothioate or 2'-0-methyl rather than phosphodiesterase linkages within the oligonucleotide backbone.
Antisense oligonucleotides siRNAs and ribozymes of the invention may be delivered in vivo alone or in association with a vector. In its broadest sense, a "vector" is any vehicle capable of facilitating the transfer of the antisense oligonucleotide siRNA or ribozyme nucleic acid to the cells and preferably cells expressing Trypsin-3. Preferably, the vector transports the nucleic acid to cells with reduced degradation relative to the extent of degradation that would result in the absence of the vector. In general, the vectors useful in the invention include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of the antisense oligonucleotide siRNA or ribozyme nucleic acid sequences. Viral vectors are a preferred type of vector and include, but are not limited to nucleic acid sequences from the following viruses: retrovirus, such as moloney murine leukemia virus, harvey murine sarcoma virus, murine mammary tumor virus, and rouse sarcoma virus; adenovirus, adeno-associated virus; SV40-type viruses; polyoma viruses; Epstein-Barr viruses; papilloma viruses; herpes virus; vaccinia virus; polio virus; and RNA virus such as a retrovirus. One can readily employ other vectors not named but known to the art.
Preferred viral vectors are based on non-cytopathic eukaryotic viruses in which nonessential genes have been replaced with the gene of interest. Non-cytopathic viruses include retroviruses (e.g., lentivirus), the life cycle of which involves reverse transcription of genomic viral RNA into DNA with subsequent proviral integration into host cellular DNA. Retroviruses have been approved for human gene therapy trials. Most useful are those retroviruses that are replication-deficient (i.e., capable of directing synthesis of the desired proteins, but incapable of manufacturing an infectious particle). Such genetically altered retroviral expression vectors have general utility for the high-efficiency transduction of genes in vivo. Standard protocols for producing replication-deficient retroviruses (including the steps of incorporation of exogenous genetic material into a plasmid, trans fection of a packaging cell lined with plasmid, production of recombinant retroviruses by the packaging cell line, collection of viral particles from tissue culture media, and infection of the target cells with viral particles) are provided in Kriegler, 1990 and in Murry, 1991.
Preferred viruses for certain applications are the adeno-viruses and adeno-associated viruses, which are double-stranded DNA viruses that have already been approved for human use in gene therapy. The adeno-associated virus can be engineered to be replication deficient and is capable of infecting a wide range of cell types and species. It further has advantages such as, heat and lipid solvent stability; high transduction frequencies in cells of diverse lineages, including hemopoietic cells; and lack of superinfection inhibition thus allowing multiple series of transductions. Reportedly, the adeno-associated virus can integrate into human cellular DNA in a site-specific manner, thereby minimizing the possibility of insertional mutagenesis and variability of inserted gene expression characteristic of retroviral infection. In addition, wild-type adeno-associated virus infections have been followed in tissue culture for greater than 100 passages in the absence of selective pressure, implying that the adeno-associated virus genomic integration is a relatively stable event. The adeno- associated virus can also function in an extrachromosomal fashion.
Other vectors include plasmid vectors. Plasmid vectors have been extensively described in the art and are well known to those of skill in the art. See e.g. Sambrook et al., 1989. In the last few years, plasmid vectors have been used as DNA vaccines for delivering antigen-encoding genes to cells in vivo. They are particularly advantageous for this because they do not have the same safety concerns as with many of the viral vectors. These plasmids, however, having a promoter compatible with the host cell, can express a peptide from a gene operatively encoded within the plasmid. Some commonly used plasmids include pBR322, pUC18, pUC19, pRC/CMV, SV40, and pBlueScript. Other plasmids are well known to those of ordinary skill in the art. Additionally, plasmids may be custom designed using restriction enzymes and ligation reactions to remove and add specific fragments of DNA. Plasmids may be delivered by a variety of parenteral, mucosal and topical routes. For example, the DNA plasmid can be injected by intramuscular, eye, intradermal, subcutaneous, or other routes. It may also be administered by intranasal sprays or drops, rectal suppository and orally. It may also be administered into the epidermis or a mucosal surface using a gene-gun. The plasmids may be given in an aqueous solution, dried onto gold particles or in association with another DNA delivery system including but not limited to liposomes, dendrimers, cochleate and microencapsulation.
In a preferred embodiment, the antisense oligonucleotide, siRNA, shRNA or ribozyme nucleic acid sequence is under the control of a heterologous regulatory region, e.g., a heterologous promoter.
Inhibitors of the Trypsin-3 activity
A further aspect of the present invention relates to a Trypsin-3 inhibitor which is an inhibitor of the Trypsin-3 activity for use in the treatment of Inflammatory Bowel Diseases (IBD) or Irritable Bowel Syndrome (IBS) including Gluten hypersensitivity.
In preferred embodiment the disease is Irritable Bowel Syndrome (IBS) including Gluten hypersensitivity
In particular embodiment Inflammatory Bowel Diseases (IBD), is selected between the group consisting of Crohn's Disease, Ulcerative Colitis, Celiac disease, and Pouchitis.
According to the invention inhibitor of the TRYPSIN-3 activity is selected from the group consisting of antibodies, aptamers, polypeptides.
In a particular embodiment, the present invention relates to compound which is an inhibitor of the Trypsin-3 activity for use in the treatment of Irritable Bowel Syndrome (IBS), wherein said compound is an anti-Trypsin-3 antibody which neutralizes Trypsin-3 or an anti- Trypsin-3 antibody fragment which neutralizes Trypsin-3.
Antibodies directed against Trypsin-3 can be raised according to known methods by administering the appropriate antigen or epitope to a host animal selected, e.g., from pigs, cows, horses, rabbits, goats, sheep, and mice, among others. Various adjuvants known in the art can be used to enhance antibody production. Although antibodies useful in practicing the invention can be polyclonal, monoclonal antibodies are preferred. Monoclonal antibodies against Trypsin-3 can be prepared and isolated using any technique that provides for the production of antibody molecules by continuous cell lines in culture. Techniques for production and isolation include but are not limited to the hybridoma technique originally described by Kohler and Milstein (1975); the human B-cell hybridoma technique (Cote et al., 1983); and the EBV-hybridoma technique (Cole et al. 1985). Alternatively, techniques described for the production of single chain antibodies (see e.g., U.S. Pat. No. 4,946,778) can be adapted to produce anti-Trypsin-3 single chain antibodies. Trypsin-3 activity inhibitors useful in practicing the present invention also include anti-Trypsin-3 antibody fragments including but not limited to F(ab')2 fragments, which can be generated by pepsin digestion of an intact antibody molecule, and Fab fragments, which can be generated by reducing the disulfide bridges of the F(ab')2 fragments. Alternatively, Fab and/or scFv expression libraries can be constructed to allow rapid identification of fragments having the desired specificity to Trypsin-3.
Humanized anti-Trypsin-3 antibodies and antibody fragments therefrom can also be prepared according to known techniques. "Humanized antibodies" are forms of non-human (e.g., rodent) chimeric antibodies that contain minimal sequence derived from non-human
immunoglobulin. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a hypervariable region (CDRs) of the recipient are replaced by residues from a hypervariable region of a non-human species (donor antibody) such as mouse, rat, rabbit or nonhuman primate having the desired specificity, affinity and capacity. In some instances, framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. Furthermore, humanized antibodies may comprise residues that are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the hypervariable loops correspond to those of a non-human immunoglobulin and all or substantially all of the FRs are those of a human immunoglobulin sequence. The humanized antibody optionally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. Methods for making humanized antibodies are described, for example, by Winter (U.S. Pat. No. 5,225,539) and Boss (Celltech, U.S. Pat. No. 4,816,397).
Then, for this invention, neutralizing antibodies of Trypsin- 3 are selected.
In still another embodiment, Trypsin-3 inhibitors may be selected from aptamers. Aptamers are a class of molecule that represents an alternative to antibodies in term of molecular recognition. Aptamers are oligonucleotide or oligopeptide sequences with the capacity to recognize virtually any class of target molecules with high affinity and specificity. Such ligands may be isolated through Systematic Evolution of Ligands by Exponential enrichment (SELEX) of a random sequence library, as described in Tuerk C. and Gold L., 1990. The random sequence library is obtainable by combinatorial chemical synthesis of DNA. In this library, each member is a linear oligomer, eventually chemically modified, of a unique sequence. Possible modifications, uses and advantages of this class of molecules have been reviewed in Jayasena S.D., 1999. Peptide aptamers consists of a conformationally constrained antibody variable region displayed by a platform protein, such as E. coli Thioredoxin A that are selected from combinatorial libraries by two hybrid methods (Colas et al, 1996).
Then, for this invention, neutralizing aptamers of Trypsin-3 are selected.
In still another embodiment, Trypsin-3 inhibitors may be selected from polypeptides. In one embodiment, the compound according to the invention is a polypeptide.
The polypeptides of the invention may be produced by any suitable means, as will be apparent to those of skill in the art. In order to produce sufficient amounts of a polypeptide for use in accordance with the present invention, expression may conveniently be achieved by culturing under appropriate conditions recombinant host cells containing the polypeptide of the invention. Preferably, the polypeptide is produced by recombinant means, by expression from an encoding nucleic acid molecule. Systems for cloning and expression of a polypeptide in a variety of different host cells are well known.
When expressed in recombinant form, the polypeptide is preferably generated by expression from an encoding nucleic acid in a host cell. Any host cell may be used, depending upon the individual requirements of a particular system. Suitable host cells include bacteria mammalian cells, plant cells, yeast and baculovirus systems. Mammalian cell lines available in the art for expression of a heterologous polypeptide include Chinese hamster ovary cells. HeLa cells, baby hamster kidney cells and many others. Bacteria are also preferred hosts for the production of recombinant protein, due to the ease with which bacteria may be manipulated and grown. A common, preferred bacterial host is E coli.
In specific embodiments, it is contemplated that polypeptides used in the therapeutic methods of the present invention may be modified in order to improve their therapeutic efficacy. Such modification of therapeutic compounds may be used to decrease toxicity, increase circulatory time, or modify biodistribution. For example, the toxicity of potentially important therapeutic compounds can be decreased significantly by combination with a variety of drug carrier vehicles that modify biodistribution. In example adding dipeptides can improve the penetration of a circulating agent in the eye through the blood retinal barrier by using endogenous transporters.
A strategy for improving drug viability is the utilization of water-soluble polymers. Various water-soluble polymers have been shown to modify biodistribution, improve the mode of cellular uptake, change the permeability through physiological barriers; and modify the rate of clearance from the body. To achieve either a targeting or sustained-release effect, water-soluble polymers have been synthesized that contain drug moieties as terminal groups, as part of the backbone, or as pendent groups on the polymer chain.
Polyethylene glycol (PEG) has been widely used as a drug carrier, given its high degree of biocompatibility and ease of modification. Attachment to various drugs, proteins, and liposomes has been shown to improve residence time and decrease toxicity. PEG can be coupled to active agents through the hydroxyl groups at the ends of the chain and via other chemical methods; however, PEG itself is limited to at most two active agents per molecule.
In a different approach, copolymers of PEG and amino acids were explored as novel biomaterials which would retain the biocompatibility properties of PEG, but which would have the added advantage of numerous attachment points per molecule (providing greater drug loading), and which could be synthetically designed to suit a variety of applications.
Those of skill in the art are aware of PEGylation techniques for the effective modification of drugs. For example, drug delivery polymers that consist of alternating polymers of PEG and tri- functional monomers such as lysine have been used by VectraMed (Plainsboro, N.J.). The PEG chains (typically 2000 daltons or less) are linked to the a- and e- amino groups of lysine through stable urethane linkages. Such copolymers retain the desirable properties of PEG, while providing reactive pendent groups (the carboxylic acid groups of lysine) at strictly controlled and predetermined intervals along the polymer chain. The reactive pendent groups can be used for derivatization, cross-linking, or conjugation with other molecules. These polymers are useful in producing stable, long-circulating pro-drugs by varying the molecular weight of the polymer, the molecular weight of the PEG segments, and the cleavable linkage between the drug and the polymer. The molecular weight of the PEG segments affects the spacing of the drug/linking group complex and the amount of drug per molecular weight of conjugate (smaller PEG segments provides greater drug loading). In general, increasing the overall molecular weight of the block co-polymer conjugate will increase the circulatory half-life of the conjugate. Nevertheless, the conjugate must either be readily degradable or have a molecular weight below the threshold-limiting glomular filtration (e.g., less than 60 kDa).
In addition, to the polymer backbone being important in maintaining circulatory half- life, and bio distribution, linkers may be used to maintain the therapeutic agent in a pro-drug form until released from the backbone polymer by a specific trigger, typically enzyme activity in the targeted tissue. For example, this type of tissue activated drug delivery is particularly useful where delivery to a specific site of biodistribution is required and the therapeutic agent is released at or near the site of pathology. Linking group libraries for use in activated drug delivery are known to those of skill in the art and may be based on enzyme kinetics, prevalence of active enzyme, and cleavage specificity of the selected disease-specific enzymes. Such linkers may be used in modifying the protein or fragment of the protein described herein for therapeutic delivery.
Examples of such polypeptide which is specific inhibitors of Trypsin-3 is disclosed in Wu P. et al Identification of novel peptide inhibitors for human trypsins Biol. Chem., Vol. 391, pp. 283-293, February/March 2010.
In one embodiment, the Trypsin-3 inhibitor according to the invention is the poly peptides compound as described in Wu P. et al, 2010.
Method of screening for treating gut disease and pain
A further object of the invention relates a method for screening a Trypsin-3 inhibitor (or antagonist) for use in the treatment or prevention of Irritable Bowel Syndrome (IBS) including Gluten hypersensitivity or Inflammatory Bowel Diseases (IBD).
For example, the screening method may measure the binding of a candidate compound to Trypsin-3, or to cells tissue sample or organism expressing Trypsin-3, or a fusion protein thereof by means of a label directly or indirectly associated with the candidate compound. Furthermore, the screening method may involve measuring or, qualitatively or quantitatively, detecting ability of said candidate compound to inactivate Trypsin-3 activity.
In a particular embodiment, the screening method of the invention comprises the step consisting of:
(i) providing purified Trypsin-3 protein, providing a cell, tissue sample or organism expressing the Trypsin-3,
(ii) providing a candidate compound such as small organic molecule, nucleic acids, antibodies, peptide or polypeptide,
(iii) measuring the activity of the Trypsin-3,
(iv) and selecting positively candidate compounds that, blocks the action of Trypsin-3 or inhibits Trypsin-3 expression. .
In a particular embodiment, the screening method of the invention may further comprising a step consisting of administering the candidate compound selected at step d) to an animal model of Irritable Bowel Syndrome (IBS) to validate the protective effects of said candidate compound.
In general, such screening methods involve providing appropriate cells which express Trypsin-3. In particular, a nucleic acid encoding Trypsin-3 may be employed to transfect cells to thereby express the enzyme of the invention. Such a transfection may be accomplished by methods well known in the art. In a particular embodiment, said cells may be selected from the group consisting of the mammal cells reported yet to express Trypsin-3 (e.g. epithelial cells).
The screening method of the invention may be employed for determining a Trypsin-3 inhibitor by contacting such cells with compounds to be screened and determining whether such compound inactivates Trypsin-3.
According to a one embodiment of the invention, the candidate compounds may be selected from a library of compounds previously synthesized, or a library of compounds for which the structure is determined in a database, or from a library of compounds that have been synthesized de novo or natural compounds. The candidate compound may be selected from the group of (a) proteins or peptides, (b) nucleic acids and (c) organic or chemical compounds (natural or not). Illustratively, libraries of pre-selected candidate nucleic acids may be obtained by performing the SELEX method as described in documents US 5,475,096 and US 5,270,163. Further illustratively, the candidate compound may be selected from the group of antibodies directed against Trypsin-3.
Trypsin-3 inhibition with the candidate compound can be tested by various known methods. For example Trypsin3 activity assay (see Examples and Figure la see above) may be used for performing the screening method of the invention, or in situ zymography assays in pathological or healthy tissues (see example 1 figure 1 and example 3 figure 6).
Method of preventing or treating intestinal inflammation and pain Another object of the invention is a method for treating an Inflammatory Bowel
Diseases (IBD) or Irritable Bowel Syndrome (IBS) including Gluten hypersensitivity comprising administering to a subject in need thereof a therapeutically effective amount of a Trypsin-3 inhibitor as disclosed above.
By a "therapeutically effective amount" is meant a sufficient amount of compound to treat and/or to prevent the Inflammatory Bowel Diseases or Irritable Bowel Syndrome (IBS).
It will be understood that the total daily usage of the compounds and compositions of the present invention will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular patient will depend upon a variety of factors including the disorder being treated and the severity of the disorder; activity of the specific compound employed; the specific composition employed, the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific polypeptide employed; and like factors well known in the medical arts. For example, it is well
within the skill of the art to start doses of the compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved.
The inhibitor of the Trypsin-3 expression or Trypsin-3 activity according to the invention can be administered by any suitable route of administration. For example, the inhibitor according to the invention can be administered by oral (including buccal and sublingual), rectal, nasal, topical, pulmonary, vaginal, or parenteral (including intramuscular, intra-arterial, intrathecal, subcutaneous and intravenous).
In a preferred embodiment of the invention, the therapeutic composition containing the Trypsin-3 inhibitor is administered intrarectally or orally. A rectal administration preferably takes place in the form of a suppository, enema or foam. Intrarectal administration is particularly suitable for chronic inflammatory intestinal diseases which affect the lower intestinal sections, for example the colon.
Pharmaceutical composition
The inhibitors of the present invention, together with one or more conventional adjuvants, carriers, or diluents may be placed into the form of pharmaceutical compositions and unit dosages.
"Pharmaceutically" or "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to a mammal, especially a human, as appropriate. A pharmaceutically acceptable carrier or excipient refers to a non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.
The pharmaceutical compositions and unit dosage forms may comprise conventional ingredients in conventional proportions, with or without additional active compounds or principles, and the unit dosage forms may contain any suitable effective amount of the active ingredients commensurate with the intended daily dosage range to be employed. The pharmaceutical compositions may be employed as solids, such as tablets or filled capsules, semisolids, powders, sustained release formulations, or liquids such as solutions, suspensions, emulsions, elixirs, or filled capsules for oral use; or in the form of suppositories for rectal administration; or in the form of sterile injectable solutions for parenteral uses. Formulations containing about one (1) milligram of active ingredient or, more broadly, about 0.01 to about one hundred (100) milligrams, per tablet, are accordingly suitable representative unit dosage forms.
The inhibitors of the present invention may be formulated in a wide variety of oral administration dosage forms. The pharmaceutical compositions and dosage forms may comprise compounds of the present invention or pharmaceutically acceptable salts thereof as the active component. The pharmaceutically acceptable carriers may be either solid or liquid. Solid form preparations include powders, tablets, pulls, capsules, cachets, suppositories, and dispersible granules. A solid carrier may be one or more substances which may also act as diluents, flavouring agents, solubilizers, lubricants, suspending agents, binders, preservatives, tablet disintegrating agents, or an encapsulating material. In powders, the carrier generally is a finely divided solid, which is a mixture with the finely divided active component. In tablets, the active component generally is mixed with the carrier having the necessary binding capacity in suitable proportions and compacted in the shape and size desired. The powders and tablets preferably contain from about one (1) to about seventy (70) percent of the active compound. Suitable carriers include but are not limited to magnesium carbonate, magnesium stearate, talc, sugar, lactose, pectin, dextrin, starch gelatin, tragacanth, methylcellulose sodium carboxymethylcellulose, a low melting wax, cocoa butter, and the like.
The term "preparation" is intended to include the formulation of the active compound with an encapsulating material as carrier, providing a capsule in which the active component, with or without carriers, is surrounded by a carrier, which is in association with it. Similarly, cachets and lozenges are included. Tablets, powders, capsules, pulls, cachets, and lozenges may be as solid forms suitable for oral administration.
Other forms suitable for oral administration include liquid form preparations including emulsions, syrups, elixirs, aqueous solutions, aqueous suspensions, or solid form preparations which are intended to be converted shortly before use to liquid form preparations. Emulsions may be prepared in solutions, for example, in aqueous propylene glycol solutions or may contain emulsifying agents, for example, such as lecithin, sorbitan monooleate, or acacia. Aqueous solutions can be prepared by dissolving the active component in water and adding suitable colorants, flavours, stabilizers, and thickening agents. Aqueous suspensions can be prepared by dispersing the finely divided active component in water with viscous material, such as natural or synthetic gums, resins, methylcellulose, sodium carboxymethylcellulose, and other well known suspending agents. Solid form preparations include solutions, suspensions, and emulsions, and may contain, in addition to the active component, colorants, flavours, stabilizers, buffers, artificial and natural sweeteners, dispersants, thickeners, solubilising agents, and the like.
The inhibitors of the present invention may be formulated for parenteral administration (e.g., by injection, for example bolus injection or continuous infusion) and may be presented in unit dose form in ampoules, pre-filled syringes small volume infusion or in multi-dose containers with an added preservative. The compositions may take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, for example solutions in aqueous polyethylene glycol. Examples of oily or non-aqueous carriers, diluents solvents or vehicles include propylene glycol, polyethylene glycol, vegetable oils (e.g., olive oil, and injectable organic esters (e.g., ethyl oleate), and may contain formulatory agents such as preserving, wetting, emulsifying or suspending, stabilizing and/or dispersing agents. Alternatively, the active ingredient may be in powder form, obtained by aseptic isolation of sterile solid or by lyophilization from solution for constitution before use with a suitable vehicle, e.g., sterile, pyrogen-free water.
The invention will be further illustrated by the following figures and examples. However, these examples and figures should not be interpreted in any way as limiting the scope of the present invention.
FIGURES:
Figure 1. Intestinal epithelial cells released trypsin-like activity A. Trypsin-like activity measured in apical and basal supernatants recovered from control or LPS-treated Caco-2 cells. Assembled data from 7 independent experiments with 4-6 wells per test. (B) Graph representation of mean fluorescence intensity quantified from 6-12 patients per group. Data are expressed as mean±SEM and were compared using Student's t-test. *p<0.05, **p<0.01, ***p<0.005.
Figure 2. Gene expression of trypsinogens Relative mRNA expression of PRSS3 within colonic biopsies from healthy control and different IBS subtypes: IBS-C (constipated), IBS-D (diarrhea), IBS-M (mix). Data are expressed as mean ± SEM and were compared using student's t test. **p<0.01 vs. Ctrl.
Figure 3. Intestinal epithelial cells up-regulate Trypsin-3 secretion in inflammatory condition and in IBS Mean fluorescence intensity for Trypsin-3- immunoreactivity quantified specifically in epithelial (Epcam-positive) cells in tissues from healthy controls or IBS patients. Data are expressed as mean ± SEM and were analyzed by Student's t-test in A and C, and a one-way ANOVA followed by a Bonferroni post-test in B.
Figure 4. Trypsin-3 evokes PAR2 dependent hyperexcitability of nociceptive dorsal root ganglia neurons and calcium signals in human submucosal neurons. A.
Representative data showing the effect of trypsin and thrombin on the rheobase and action potential discharge is similar in magnitude to that observed with Trypsin-3, shown in B. The PAR2 antagonist blocks the trypsin but not the thrombin effect on neuronal excitability. *P<0.05 compared to control, #P<0.05 compared to Trypsin-1. One-way ANOVA with Bonferroni post-hoc test. B. Average amplitude of Trypsin-3 (0.5-10 nM)-induced [Ca2+]i rises in submucosal neurons in the presence or absence of the PAR2 antagonist GB83. Data are expressed as mean ± SEM and were analyzed by One-Way ANOVA followed by Bonferroni's post-test, (n=6 subjects per group), *p<0.05, **p<0.01, oop<0.01.
Figure 5. Colorectal administration of Trypsin-3 induces visceral hypersensitivity A. Kinetic viscero-motor response to intraco Ionic administration of Trypsin-3 (10 U/mouse) 1, 3, 6 and 9 hours after its administration. B. Viscero-motor response to intraco Ionic administration of Trypsin-3 (0.1, 1 or 10 U/mouse) or vehicle, 3 hours after intracolonic administration in wild-types, or PAR2-/- mice (C). Data are expressed as mean±SEM and were analyzed by Two-Ways ANOVA followed by Bonferroni's post-test (n=10 per group). *p<0.05, **p<0.01 and ***p<0.001.
Figure 6 In situ Zymography of trypsin activity in colonic biopsies of control and IBD patients Graph representation of mean fluorescence intensity of in situ zymography assays performed in colonic tissue slices from healthy controls and IBD patients (scale bar: 50 μιη), including Crohn's Disease (CD) and Ulcerative Colitis (UC).
EXAMPLE 1: Epithelial Expression and Function of Trypsin-3 in Irritable Bowel Syndrome
Material & Methods
Patients
Colon tissues were obtained from IBS patients and healthy controls at the Kingston
General Hospital (Ontario, Canada) (ethic approval 6004988, collected between 2013 and 2016), Nantes (ethic approval DC-2008-402 collected between 2012 and 2016) and Toulouse (ethic approval DC-2015-2443 for the COLIC project collected in 2015 and 2016) Hospitals (France) (Table 1). IBS patients were defined by the Rome III criteria. Descending colonic biopsies collected during colonoscopy procedures were used for immunohistochemistry and mRNA expression randomly. For immunohistochemistry, fresh biopsies were coated in optimal cutting temperature compound (OCT, Dako) and stored at -80°C. For mRNA expression, cDNA samples generated from RNA extracts were used. For submucosal neuron
imaging, samples of large bowel were harvested from non-pathologic zones of resections from 6 patients undergoing colectomy for colon cancer.
B
Table 1 : A. Characteristics and outcomes of patients from which biopsies were collected. Values are number of patients with characteristic unless otherwise indicated. N, number ; F, female ; M, male. Abdominal pain intensity was scored according to: 0: absent 1 : no impact on daily life 2: reducing some daily activities 3: greatly reducing daily activities 4: patient confined to bed. Pain frequency was classified as: 0: absent 1 : rare (1 day/week) 2: occasional (2-3 days/week) 3: frequent (4-6 days/week) 4: very frequent (7days/week). B. Characteristics of control patients sampled during resection of colon cancer, tissue samples were taken from non-pathological margins and were used to assess enteric neuron activity.
Mice
Male C57BL/6 mice (6-10 weeks, Charles River Laboratories, Wilmington, MI, USA, or Janvier St Quentin-Fallavier, France), and male PAR2 -deficient mice or wild-type littermates were used[5]. Mice had free access to food and water and were subjected to 12 hours light/dark cycles. Animal protocols followed the Canadian Council of Animal Care Guidelines and were approved by animal care committee's at Queen's University (protocol
2016-1644), University of Calgary (protocol M08068-70), and Toulouse (protocol PI-U1220- NV19).
Rat models of visceral hypersensitivity
Adult Wistar rats (8-9 weeks old, Harlan Laboratory, Indianapolis, IN, USA), males (240-300g) and females (175-220g) exposed to limited bedding stress as neonates[6] or na'ive Sprague-Dawley rats (7-8 weeks old, 250-275 g) with free access to food and water and in 12 hours light/dark cycles were acclimated for 1 week before starting experiments. Experiments followed NIH guidelines according to protocol #09026-11 and #9906-020 approved by the Institutional Animal Care and Use Committee of the Veteran Affairs Greater Los Angeles Healthcare System under the auspice of the Office of Laboratory Animal Welfare - Assurance of Compliance (A3002-01).
Two methods were used to induce visceral hypersensitivity: repeated water avoidance stress (WAS, 10 days, lh/day)[7] and the cortagine administration via intraperitoneal injection [8]. Visceral sensitivity was assessed as previously described[7, 8].
Imaging
Section and live imaging were performed on Zeiss confocal LSM710 and ApoTome.2 microscopes, respectively.
Culture of sensory neurons from dorsal root ganglia
Dorsal root ganglia neurons were isolated from mice[3]. Cells were washed and incubated with Hank's Balanced Salt Solution (HBSS)+Ca2+, Fluo-4-AM (Invitrogen) and 20% pluronic F-127 (Invitrogen) during 30 minutes at 37°C followed by 30 minutes at room temperature before imaging[9]. Supernatants from apical or basal compartments of Caco-2 cells culture, stimulated or not by lipopolysaccharide (LPS) (Escherichia coli serotype K235, ATCC 13027), were pre-incubated with the serine protease inhibitor FUT-175 (50 μg/mL) or the trypsin inhibitor leupeptin (100 μΜ) (all from Calbiochem) for 15 minutes. Additional recordings were made from DRG neurons after addition of Trypsin-3 (10 nM, R&D) or its vehicle (HBSS+0.025 % Brij35) in the presence or absence of specific PARI (SCH79797, Tocris Bio-Techne, UK) or PAR4 (ML-354, Tocris Bio-Techne) antagonists (all at 10 μΜ for 5-min). Neurons were identified by addition of High-K+ (50 mM) solution at the end of the recording. Fluo-4 was excited at 475 nm, and fluorescence emission was collected at 490/515nm. Changes in [Ca2+]i are reflected by Fluo-4 fluorescence intensity.
Human submucosal neuron imaging
To isolate submucosal ganglia from descending colon, we used previously described methods[10, 11]. The colon was placed in a cold oxygenated sterile HBSS (Sigma), cut along
the mesenteric border and pinned flat with the mucosa facing upwards. Ice-cold HBSS was changed every 5-minutes. The submucosal plexus was dissected from the mucosal and underlying circular muscle, cut in small pieces (~1.5xl .5mm) and digested at 37°C in an enzymatic solution (1 mg/mL; Sigma) and collagenase (1.25 mg/mL; Sigma) for 45 minutes. The suspension was centrifuged, the ganglia were plated onto 96-well plates (Greiner), topped-up with Neurobasal medium (Invitrogen) supplemented with 10% heat-inactivated FBS, 1% antibiotic-antimycotic solution (Sigma) and Nerve Growth Factor 25ng/mL, and kept in an incubator at 37°C continuously gassed with 95% 02-5% C02[l l]. Ganglia were cultured for 3 days before performing Ca2+ imaging experiments [12]. Tissues were loaded with 10 μΜ Fluo-4 AM (Molecular Probes, Invitrogen) for 30 minutes at 37°C, then rinsed with HBSS and transferred on the microscope stage. Recordings were made at room temperature to monitor Ca2+ flux after addition of Trypsin- 3 (0.5-1-10 nM) to the wells, in the presence or absence of specific PARI (SCH79797), PAR2 (GB83, Axon Medchem, The Netherlands) or PAR4 (ML-354) antagonists (all at 10 μΜ for 15-min). Neurons were identified by addition of High-K+ (75 mM) solution at the end of the recording. Fluo-4 was excited at 475 nm, and fluorescence emission was collected at 525/50 nm. Changes in [Ca2+]i are reflected by Fluo-4 fluorescence intensity.
PAR2 receptor internalization in human submucosal neurons
Trypsin-3 (10 nM) was added to the submucosal tissue that was isolated from colonic biopsies and cultured in Neurobasal medium (Invitrogen) supplemented with 10% heat- inactivated FBS, 1% antibiotic-antimycotic solution (Sigma) for 2 hours. The plexus was then washed in PBS, fixed in paraformaldehyde (PFA) 4% and processed for immunostaining, using chicken anti-neurofilament 200 kD (NF200, 1 :500, Abcam-ab 134306), to identify neurons and nerve fibers, and mouse anti-PAR2 antibody (1 :200, SAM-11-LifeSpan Biosciences, Seattle, USA)[13]. Primary antibody incubation (overnight at 4°C) was followed by incubation with appropriate fluorescently labeled secondary antibodies (2-hours room temperature). The tissue was mounted on a microscope slide in Citifluor (Citifluor Ltd., Leicester, UK). PAR2 involvement specificity was investigated in the presence of the PAR2 antagonist GB83 (10 μΜ),[14], added 30 minutes before Trypsin-3.
Intestinal epithelial cell cultures
Caco-2 cells were grown to confluence as monolayers in Transwell plates (2x105 cells per well) (Corning)[15]. After 21 days in culture (transepithelial electrical resistance of 350 Ω cm2)[15], culture medium was replaced by OptiMEM (Life technologies) and cells incubated for 24 hours (h) before stimulation on apical and baso-lateral sides by LPS (50μg/mL, Sigma),
or by epinephrine (5nM, Sigma) on the basolateral side [16] for 2, 4, 6, 18 and 24h to mimic a stress condition in vitro. In a third set of experiments, Caco-2 monolayers were exposed for 24h to Trypsin-3 (0.5-10nM) on the baso-lateral side. Paracellular permeability was measured by the passage of dextran FITC (3000kDa, Sigma) from the apical to the basal medium, as previously described[ 17].
Trypsin activity
Basal media were concentrated 3 times using Vivaspin 500 (Dutcher). Trypsin activity was measured in basal and apical medium with the substrate N-p-Tosyl-GPR-amino-4- methylcoumarin hydrochloride (0.1 mM) in 50 mM Tris, 10 mM CaC12. Substrate degradation was calculated by the change in fluorescence (excitation: 355 nm, emission: 460 nm), measured over 30 min at 37°C on a microplate reader NOVOstar (BMG Labtech). OCT- included biopsies of control and IBS patients were cryostat sectioned (8-um thickness) and washed with PBS, 2% Tween-20. All samples were incubated overnight at 37°C with the substrate N-p-Tosyl-GPR-amino-4-methylcoumarin hydrochloride (50μg/mL, Sigma) in 0.3% low melting agarose. Nuclei were stained with Topro3 (Invitrogen). Images were analysed with ImageJ software.
Reverse transcription, conventionnel and quantitative PCR
Total RNA was extracted with the Nucleospin RNA/Protein Kit (Macherey-Nagel, GmbH). DNAse-treated RNA was reverse transcribed using the Maxima First Strand cDNA Synthesis Kit for RT-qPCR (Thermo Scientific). Resulting cDNA samples were amplified by conventional PCR with Taq DNA polymerase (Invitrogen, USA) and sequence-specific primer pairs (Table 2)[18]. For quantitative PCR, cDNA was amplified with the SYBR Green Master I Kit (Roche) and sequence-specific primer pairs (Table 2) in a LightCycler 480 Instrument (Roche). The analysis of stability of three standard housekeeping genes (HPRT1, GAPDH and TBP) by using RefFinder ranked HPRT1 as the overall most stable housekeeping gene in our experimental conditions. Thus, the relative level of mRNA expression for target genes was calculated with the method 2-DDCt[18] by using hHPRTl as reference gene. For conventional and quantitative PCR, negative controls consisted of samples from reverse transcription, wherein the enzyme was not added to reactions. The identity of amplicons from PRSS1, 2 and 3 was confirmed by automated DNA sequencing (Eurofms MWG Operon, GmbH).
Western Blot
Proteins from Caco-2 cells were extracted with the Nucleospin RNA/Protein Kit (Macherey-Nagel, GmbH) as per manufacturer's instructions. Supernatant's proteins were
precipitated by trichloroacetic acid/acetone, separated by SDS-polyacrylamide gel electrophoresis (12%) and transferred onto a nitrocellulose membrane (Life science). Membranes were incubated with anti-Trypsin-3 antibody (1/100, ab 107430- Abeam) overnight at 4°C and secondary antibody conjugated with HRP (1/3000, w4018-Promega,) and then visualized by chemiluminescence (Chemidoc XRS BIO-RAD).
Immunofluorescence in cell cultures and biopsies
Cell cultures were fixed using formaldehyde (4%) during 10 min followed by washes in 0.1 M glycine (2 x 10 min). Immunostaining was performed with anti-Trypsin-3 (1/500 abl07430-Abcam), anti-Occludin (1/100 711500 Life technologies), anti-Zonula Occludens-1 (1/100, 617300 Invitrogen) and 670 phalloidin (PHDNl-Cytoskeleton), to label actin network. Human colonic biopsies were included in OCT and tissue cryosections (5 μιη thickness) were cut with cryostat (Leica Microsystems, GmbH). Tissue slices were co-stained with antibodies against Trypsin-3 and the epithelial cell maker EpCAM/CD326 (1/500 VU1D9-Cell Signaling). Cells and tissue slices were then incubated with appropriate secondary antibodies conjugated to AlexaFluor 488 or 555 (Molecular Probes). Slides were mounted with Prolong Gold Anti-fading Reagent with DAPI (Molecular Probes), to counterstain cell nuclei. The mean fluorescence intensity corresponding to Trypsin-3- immunoreactivity in epithelial cells, as delimited by EpCAM co-staining, was quantified with Image J software [17].
Electrophysiological recordings from nociceptive DRG neurons
Mouse DRG were dissected from T9 to LI and were enzymatically dissociated, plated onto coverslips, and cultured overnight, as described[4]. Neurons were incubated with active Trypsin-3 (10 nM) 20 min prior electrophysiological studies, the PAR2 antagonist GB83 (10 μΜ)[14] was added 30 min before Trypsin-3. Whole-cell perforated patch current-clamp recordings were made using Amphotericin B (240 g/ml, Sigma) on small diameter neurons (<40 pF capacitance). Changes in excitability were quantified by measuring rheobase and numbers of action potentials discharged at twice rheobase. Recordings were performed using Multiclamp 700B, digitized by Digidata 1440A, were stored and processed using pClamp 10.2 software (all by Molecular Devices, Sunnyvale, CA). The recording chamber was continuously perfused with external solution (~2 ml/min) at room temperature (23°C). Standard solutions used was (in mmol/1); pipette solution: K-gluconate 110, KC1 30, HEPES 10, MgC12 1, and CaC12 2; pH adjusted to 7.25 with 1 M KOH; external solution: NaCl 140, KC1 5 HEPES 10, glucose 10, MgC12 1, and CaC12 2; pH adjusted to 7.3 to 7.4 with 3 M NaOH.
Colorectal distension
Recombinant human Trypsinogen-IV was purchased and activated into Trypsin-3 by enteropeptidase following commercial recommendations. Then, mice were submitted to intraco Ionic administration of Trypsin-3 (10 U/mouse), followed by colorectal distensions at 0, 1, 3, 6 and 9-hours time points, as previously described[3]. In another set of experiments, mice were intracolonically administered with increasing doses of Trypsin-3 (0.1, 1 or 10 U/mouse), followed by colorectal distension 3 hours later. Mice from the control group were administered intracolonically with vehicle (10% v/v absolute ethanol and 10% v/v Tween- 80)[19]. Similar experiments were repeated in PAR2-deficient mice and wild-type littermates[3].
Statistical analysis
Data were expressed as mean±SEM, except for RT-qPCR, immunostaining and in situ zymography quantification of patient biopsies, where each dot represents one patient. Statistical analysis was performed using parametric t tests, two-ways or one-way ANOVA and Bonferroni's post-test (see figure legends). GraphPad Prism 5.0 software was used for analysis. Statistical significance was accepted at p<0.05.
Results
-Epithelial proteolytic activity signals to sensory neurons- Culture media from the apical compartment of Caco-2 cells stimulated or not with
LPS, induced very small amplitude Ca2+ response in a limited number of mouse sensory neurons (data not shown). Similarly, culture media from the basal compartment of unstimulated Caco-2 cells had little effect on the Ca2+ signal in DRG neurons (data not shown). However, culture media from basal compartment of LPS -stimulated Caco-2 cells induced a significant increase in the number of responding neurons (data not shown), and in the amplitude of their response (data not shown). This increase was completely suppressed by pre-incubation with the non-selective trypsin inhibitors (FUT or leupeptin) (data not shown), and the effect of the LPS-stimulated supernatant was not observed using DRG neurons from PAR2-/- mice (data not shown). These experiments demonstrated that LPS stimulation of intestinal epithelial cells releases proteolytic activity specifically on the basal compartment, and that this activity can signal to sensory neurons, through the activation of PAR2.
-Trypsin activity originates from intestinal epithelial cells in human colons- Residual trypsin activity was released in culture supernatants of intestinal epithelial Caco-2 cells, both in basal and apical compartments. This trypsin activity was significantly
increased in the basal, but not the apical compartment after stimulation of Caco-2 cells by LPS (Figure 1A). Thus, epithelial trypsin activity follows the same pattern as the epithelial proteolytic mediators activating primary afferents described above.
Using in situ zymography, we next investigated where trypsin activity was located in human colonic tissues. Very low trypsin activity was detected in colonic tissues from healthy controls, while in IBS patients, increased activity was detected (Figure IB middle panel), and this was observed predominantly in the epithelium, with similar activity at the base and the tip of the crypts. The epithelial Trypsin activity was significantly increased in tissues from all IBS subgroups (-C, -D and -M) (Figure IB). Hypersentivity was induced in rats by submitting them to water avoidance stress. Colonic tissues from rats with demonstrated hypersensitivity (not shown) were used for in situ zymography. Trypsin activity was also increased in the colon epithelium of hypersensitive rats compared to naive controls.
-Trypsin-3 is the predominant form of epithelial trypsin and is overexpressed in IBS- We then examined the forms of trypsin present in human intestinal epithelium and/or tissues from IBS patients. We found that all three human trypsin genes: PRSSl, PRSS2 and PRSS3 forms were present in intestinal epithelial cells (data not shown), and in human colonic tissues (data not shown ). However, only PRSS3 mRNA (codes for the Trypsin-3 protein) expression was up-regulated in epithelial cells after LPS exposure, or after addition of epinephrine to the baso-lateral side (data not shown). In human colon, PRSS3 was the predominant form of trypsin detected (data not shown) and no difference was observed for PRSSl and PRSS2 expression in IBS tissues versus healthy controls. However, PRSS3 expression was significantly up-regulated in tissues from IBS-C, compared to healthy controls, while changes in PRSS3 expression was not significant in IBS-D or IBS-M, compared healthy controls (Figure 2). We further investigated the splice variants of PRSS3 that would be expressed in colonic tissues, and we determined that PRSS3 variant 1 was the major transcript expressed in intestinal epithelial cells and in colonic tissue samples. Tryptase mRNA expression (amplicons from the TPSAB1, TPSB2 and TPSD1, the 3 Tryptase genes) was not detected in Caco-2 cells stimulated or not with LPS.
We confirmed the presence of the 33-kDa Trypsin-3 protein in intestinal epithelial cells and its LPS-induced up-regulation in those cells (data not shown) as well as the epinephrine -induced up-regulation (data not shown). In Caco-2 cells, Trypsin-3 was associated with the plasma membrane co-localizing with actin. We confirmed the secretion of Trypsin-3 in culture supernatants of Caco-2 cells, at low-level in apical supernatants (basal or
LPS stimulated), but at significantly higher level in the basal compartment of Caco-2 cells after their stimulation with LPS (data not shown).
In human and rat tissues, epithelial Trypsin-3 was just above detection level in healthy controls but was significantly up-regulated in tissues from IBS patients and from hypersensitive rats (cortagine-treated). All IBS subgroups (IBS-D, IBS-C and IBS-M) expressed significantly larger amounts of Trypsin-3 compared to healthy controls (Figure 3). We also found that Trypsin-3 epithelial expression was polarized towards the basolateral membrane in these tissues. This suggests that Trypsin-3 would be released from the basolateral membrane of intestinal epithelial cells in vivo, as found in the in vitro studies. Taken together, we confirmed at a protein level that Trypsin-3 matched the trypsin activity detected in intestinal epithelial cells and tissues from IBS patients.
-Trypsin-3 increases epithelial permeability, signals to human and mouse neurons, and causes visceral hvpersensitivity- The addition of Trypsin-3 (1 and 10 nM) to the basal compartment of Caco-2 monolayers caused an increased passage of Dextran-FITC (data not shown). It also caused a decreased staining and disorganization of the epithelial tight junction protein ZO-1 and occludin, compared to control (Trypsin-3 vehicle) conditions. Trypsin-3 increased excitability of mouse DRG neurons compared to controls (data not shown). The mean rheobase of neurons was decreased by 30 % and the mean action potential number at twice rheobase increased by 39 % (n = 23, p < 0.05), compared to control neurons. Trypsin-1 (10 nM) and thrombin (50 nM) also increased neuronal excitability (Fig. 4A) to a similar level to that seen with Trypsin-3 (10 nM).
Trypsin-3 was able to induce Ca2+ transients in human submucosal neurons in a dose-dependent manner (Figure 4B).
Trypsin-3 administered intracolonically, in a tween-based saline solution (in order to allow the passage of Trypsin-3 through the intestinal barrier) caused visceral hyperalgesia in response to colorectal distension, compared to baseline measures (Figure 5A-C). This was evident by lh and persisted for 6-hrs. (Figure 5A). No effect was seen with vehicle alone and the Trypsin-3 effect was dose-dependent (Figure 5B).
-Mechanisms of trypsin-3 -induced enteric effects-
The effects of Trypsin-3 in mouse sensory neurons were blocked by the PAR2 antagonist GB83, which also blocked the effect of Trypsin-1 but had no effect on thrombin, a
PAR1/PAR4 agonist (Figure 4A). PARI or PAR4 antagonists had no significant effect on Trypsin-3 -induced rise in [Ca2+]i. In human colonic submucosal neurons, the Trypsin-3- induced rise in [Ca2+]i was completely abolished by pre -incubation with the PAR2 antagonist GB83 (Figure 4B), but was not modified by pre-incubation with PARI (SCH79797) or PAR4 (ML-354) antagonists. In PAR2-deficient mice, Trypsin-3-induced visceral hypersensitivity was also significantly inhibited at the 30 mmHg pressure (Figure 5C). The whole area under the curve of Trypsin-3 -induced viscero-motor response as a function of increasing pressures of distension was significantly lower in PAR2-deficient mice compared to wild-type (p<0.05, not shown), thereby confirming the notion that Trypsin-3 's enteric effects, including in vivo visceral hypersensitivity, are mediated by PAR2 activation.
We further investigated in human colonic submucosal neurons, Trypsin-3 -induced potential changes in PAR2 expression, as a marker of PAR2 activation. In basal (unstimulated) conditions PAR2 staining was clustered seemingly at the plasma membrane of submucosal neurons. After Trypsin-3 stimulation, PAR2 expression radically changed, becoming either diffuse or in intracellular clusters (. This suggested that PAR2 had been activated by Trypsin-3 and had been internalized into submucosal neurons. Exposure to the PAR2 antagonist GB83 inhibited Trypsin-3 -induced changes in PAR2 staining.
Discussion
Increased proteolytic activity, and in particular trypsin activity is released by colonic tissues of IBS patients. It is considered to be involved in hyperexcitability of both extrinsic and intrinsic enteric neurons, and in visceral hypersensitivity [2, 3, 4]. However, the lack of knowledge on the origin and the nature of the protease(s) responsible for this trypsin activity has hampered further research on proteases as potential molecular targets for the treatment of IBS. The current study provides the first description of the expression and function of an epithelial form of trypsin: Trypsin-3 and its potential importance in IBS. Trypsin-3 is presented as a valuable target for new therapeutic development, further highlighting the importance of epithelial biology in IBS.
Trypsin proteolytic activity is increased both in IBS patient tissues (Figure IB) and biopsy supernatants[3]. Several potential sources could account for this increase. First, the microbiota could be a major source of trypsin activity, and indeed, such activity has been found in the feces of IBS patients[20]. However, when the nature of the proteases present in human feces has been investigated, only host proteases were identified[20]. Secondly, pancreatic enzymes and in particular trypsins could explain the luminal presence of trypsin
activity. But for both sources (microbiota or pancreas), it seems implausible that luminal proteases could penetrate the mucus layer, cross the epithelial barrier, and reach the vicinity of enteric neurons, remaining active to potentially induce hyperactivity in those neurons. Therefore, we sought to investigate mucosal tissue sources for trypsin activity in this study, by using in situ zymography. We observed very low trypsin activity in colonic tissues from healthy controls, but this activity was markedly increased in tissues from IBS patients, and was strongly associated with intestinal epithelial cells (Figure IB). We therefore considered the intestinal epithelium as a potential important source of trypsin activity. We demonstrated that LPS -stimulated intestinal epithelial cells release trypsin activity, specifically on the basolateral side, and that this activity was able to signal to sensory neurons by a PAR2- dependent mechanism. The polarized secretion of trypsin activity in LPS-treated intestinal epithelial cells constitutes a major breakthrough in our comprehension of the role of epithelial mediators in enteric neuron signaling. Firstly, it demonstrates that stressed intestinal epithelial cells (LPS- or epinephrine-induced stress) can overexpress and release active trypsin-like enzymes. Secondly, it demonstrates that this release is oriented towards mucosa-submucosa, where enteric neurons and primary afferent nerve terminals are found. Our results further suggest that polarized expression of trypsin proteins also occurs in vivo in patient's tissues, as observed by the presence of Trypsin-3 protein on the basolateral side of epithelial layers in tissues from IBS patients.
When investigating the forms of trypsin that could be expressed by intestinal epithelial cells, we demonstrated the presence of transcripts from the three trypsin genes: PRSS1, PRSS2 and PRSS3. However, only PRSS3 mRNA was up-regulated in LPS- or epinephrine- stimulated intestinal epithelial cells (data not shown), and in tissues from IBS patients. Interestingly, PRSS3 mRNA was significantly up-regulated in IBS patients (in agreement with the results of a previous study[21]), but in our study, this overexpression was significant only in the IBS-C subgroup (Figure 2), suggesting that only this condition is associated with transcriptional regulation of Trypsin-3. The protein product of PRSS3, Trypsin-3, matched the same pattern of overexpression in intestinal epithelial cells and in tissues from IBS patients (Figure 3), and is up-regulated in all IBS subgroups: IBS-C, IBS-D and IBS-M subgroups. Taken together, our results clearly point to an increased presence of Trypsin-3 in tissues from IBS patients. However, differential regulatory mechanisms might be involved in IBS patient subgroups, with some (IBS-C) being submitted to transcriptional regulation and others (IBS- D, IBS-M), being submitted to post-transcriptional regulation. Further, we showed here that of the 4 different known alternative splice variants derived from PRSS3 transcription (1 to 4),
PRSS3 variant 1 was the major transcript expressed in colonic tissues or in intestinal epithelial cells. Interestingly, we found that the protein product of PRSS3, Trypsin-3 was expressed all along the colonic crypt (Figure 3), indicating that potentially most epithelial cell types express the protein. Low constitutive expression of Trypsin-3 was detected in tissues from healthy controls (Figure 3). However, it might not be active there since very low trypsin- like activity was detected in tissues from healthy controls (Figure IB).
Very little is known about the physiological or pathophysiological functions of Trypsin-3. Work by the group of E. Radisky reported that Trypsin-3 targets multiple endogenous human canonical inhibitors, therefore presenting Trypsin-3 as a gatekeeper in the protease web[22, 23]. We demonstrated that active Trypsin-3 was able to signal both to primary afferent nerves and to submucosal enteric neurons. In both cases, our data shows that Trypsin-3 signals to PAR2 in neurons. This finding is consistent with previous studies reporting that PAR2 can be activated by Trypsin-3 [24]. Although our findings are in keeping with previous evidence that proteases in IBS tissues signal to neurons by activating PAR2[3, 4, 25], specific evidence for the role of Trypsin-3 in IBS supernatants cannot be directly tested as specific Trypsin-3 inhibitors (small molecules) are not yet available. However we did show that PAR2 was present on human submucosal neurons and was internalized following exposure to Trypsin-3. This clearly suggests that PAR2 can be activated in human submucosal neurons, and that Trypsin-3 is a potential endogenous agonist of PAR2 on this cell type in humans. Previous reports have demonstrated that PAR2-activating peptides induced low Ca2+ signals in human submucosal neurons, leading the authors to conclude that PAR2 was minimally activated in human submucosal neurons[26]. However, recent studies have highlighted the complex pharmacology of PARs and in particular the fact that these receptors can be cleaved at multiple sites, triggering different intracellular signaling pathways[13, 14, 27]. Canonical PAR2 activation leading to β-arrestin-dependent receptor internalization has been well documented[14]. In the present study, we provide evidence that such signaling occurs in human submucosal neurons in response to Trypsin-3 exposure. We also report that other PARs (PARI and PAR4) are not implicated in Trypsin-3 -induced signaling to mouse sensory neurons or human submucosal neurons.
Our data also demonstrate increased expression of Trypsin-3 in rats with cortagine- induced visceral hypersensitivity and show that intracolonic administration of Trypsin-3 recapitulates visceral hypersensitivity (Figure 5). In these studies we used a barrier breaker to allow Trypsin-3 access to the lamina propria, recreating the postulated in vivo conditions where Trypsin-3 signals from the basolateral aspect of epithelial cells. This hyperalgesic
effect of Trypsin-3 was observed at concentrations as low as lU/mouse. This activity is comparable to that detected in supernatants of IBS patients[3], and in supernatants of LPS- treated intestinal epithelial cells. Together, these data suggest that epithelial Trypsin-3 basolateral release could well be sufficient to activate neurons, and participates to visceral hypersensitivity symptoms. Another possible pathway for Trypsin-3 to participate to visceral hypersensitivity is by affecting barrier function. Indeed, our results demonstrated that Trypsin-3 basolateral exposure to intestinal epithelial cells leads to an increase permeability and a decreased expression and organization or tight junction proteins. At this point, it is impossible to determine the relative contribution of Trypsin-3 -induced increased permeability ant its action on neuron signaling in the genesis of hypersensitivity symptoms. It might well be that both participate to generate visceral hypersensitivity, which could highlight Trypsin-3 as a relevant target for the treatment of IBS.
In summary, these results point to colonocytes as a novel source of proteases that activate nociceptive and enteric nerves in IBS patients and that participate to barrier dysfunction. We reveal that epithelial protease regulation might have profound implications in IBS, particularly when considering signaling from the lumen. Conceptually, most models in IBS have focused on capacity of the epithelium to release serotonin and on its role in barrier function. Here we demonstrate that proteolytic homeostasis in intestinal epithelium is also a major signaling pathway in IBS and that luminal stimuli may be one important trigger leading to mucosal proteolytic changes. Thus, epithelial Trypsin-3 may be a potential new target for IBS therapeutic intervention.
EXAMPLE 2 : Trypsin 3 increase epithelial permeability in a PAR2-dependent manner
Caco-2 cells were grown to confluence as monolayers in Transwell plates (2xl05 cells per well) (Corning). After 21 days in culture (transepithelial electrical resistance of 350 Ω cm2)[15], culture medium was replaced by OptiMEM (Life technologies) and cells incubated for 24 hours (h) before stimulation on apical and baso-lateral sides by LPS (50μg/mL, Sigma), or by epinephrine (5nM, Sigma) on the basolateral side [16] for 2, 4, 6, 18 and 24h to mimic a stress condition in vitro. In a third set of experiments, Caco-2 monolayers were exposed for 24h to Trypsin-3 (0.5-10nM) on the baso-lateral side. Paracellular permeability was measured by the passage of dextran FITC (3000kDa, Sigma) from the apical to the basal medium, as previously described[17].
Results (data not shown) demonstrated that basolateral exposure of human intestinal epithelial cells lead to an increase in paracellular permeability, in a dose-dependent manner. This effect of Trypsin-3 was mediated by the activation of PAR2, as a PAR2 antagonist was able to completely inhibit Trypsin-3 -induced permeability.
EXAMPLE 3 : Expression of Trypsin 3 in colonic biopsies of control and IBD patients
Human colonic biopsies from IBD patients (Crohn's Disease: CD, or Ulcerative Colitis: UC) or healthy controls were included in OCT and tissue cryosections (5 μιη thickness) were cut with cryostat (Leica Microsystems, GmbH). Tissue slices were co-stained with antibodies against Trypsin-3 and the epithelial cell maker EpCAM/CD326 (1/500 VU1D9-Cell Signaling). Cells and tissue slices were then incubated with appropriate secondary antibodies conjugated to AlexaFluor 488 or 555 (Molecular Probes). Slides were mounted with Prolong Gold Anti-fading Reagent with DAPI (Molecular Probes), to counterstain cell nuclei. The mean fluorescence intensity corresponding to Trypsin-3- immunoreactivity in epithelial cells, as delimited by EpCAM co-staining, was quantified with Image J software [17].
The results showed that Trypsin-3 is detected in human colonic tissues (Figure 6). This expression did not seem to be significantly up-regulated in Crohn's Disease patients, as confirmed by quantification of tissue immuno staining. However, in Ulcerative Colitis patient tissues, Trypsin-3 immunostaining was clearly and significantly up-regulated compared to healthy controls (data not shown).
REFERENCES:
Throughout this application, various references describe the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure.
1 Sperber AD, Dumitrascu D, Fukudo S, Gerson C, Ghoshal UC, Gwee KA, et al. The global prevalence of IBS in adults remains elusive due to the heterogeneity of studies: a Rome Foundation working team literature review. Gut 2016.
2 Buhner S, Li Q, Vignali S, Barbara G, De Giorgio R, Stanghellini V, et al. Activation of human enteric neurons by supematants of colonic biopsy specimens from patients with irritable bowel syndrome. Gastroenterology 2009;137: 1425-34.
3 Cenac N, Bautzova T, Le Faouder P, Veldhuis NA, Poole DP, Rolland C, et al. Quantification and Potential Functions of Endogenous Agonists of Transient Receptor Potential Channels in Patients With Irritable Bowel Syndrome. Gastroenterology 2015;149:433-44 e7.
4 Valdez-Morales EE, Overington J, Guerrero-Alba R, Ochoa-Cortes F,
Ibeakanma CO, Spreadbury I, et al. Sensitization of peripheral sensory nerves by mediators from colonic biopsies of diarrhea-predominant irritable bowel syndrome patients: a role for PAR2. Am J Gastroenterol 2013;108: 1634-43.
5 Hyun E, Andrade-Gordon P, Steinhoff M, Vergnolle N. Protease-activated receptor-2 activation: a major actor in intestinal inflammation. Gut 2008;57: 1222-9.
6 Moussaoui N, Larauche M, Biraud M, Molet J, Million M, Mayer E, et al. Limited Nesting Stress Alters Maternal Behavior and In Vivo Intestinal Permeability in Male Wistar Pup Rats. PLoS One 2016;l l :e0155037.
7 Larauche M, Mulak A, Kim YS, Labus J, Million M, Tache Y. Visceral analgesia induced by acute and repeated water avoidance stress in rats: sex difference in opioid involvement. Neurogastroenterol Motil 2012;24: 1031-e547.
8 Larauche M, Gourcerol G, Wang L, Pambukchian K, Brunnhuber S, Adelson DW, et al. Cortagine, a CRFl agonist, induces stresslike alterations of colonic function and visceral hypersensitivity in rodents primarily through peripheral pathways. Am J Physiol Gastrointest Liver Physiol 2009;297:G215-27.
9 Cenac N, Altier C, Motta JP, dAldebert E, Galeano S, Zamponi GW, et al. Potentiation of TRPV4 signalling by histamine and serotonin: an important mechanism for visceral hypersensitivity. Gut 2010;59:481-8.
10 Cirillo C, Sarnelli G, Turco F, Mango A, Grosso M, Aprea G, et al. Proinflammatory stimuli activates human-derived enteroglial cells and induces autocrine nitric oxide production. Neurogastroenterol Motil 201 l;23:e372-82.
11 Grundmann D, Klotz M, Rabe H, Glanemann M, Schafer KH. Isolation of high-purity myenteric plexus from adult human and mouse gastrointestinal tract. Sci Rep 2015;5:9226.
12 Sarnelli G, Vanden Berghe P, Raeymaekers P, Janssens J, Tack J. Inhibitory effects of galanin on evoked [Ca2+]i responses in cultured myenteric neurons. Am J Physiol Gastrointest Liver Physiol 2004;286:G1009-14.
13 Oikonomopoulou K, Hansen K , Saifeddine M, Vergnolle N, Tea I, Diamandis EP, et al. Proteinase-mediated cell signalling: targeting proteinase-activated receptors (PARs) by kallikreins and more. Biol Chem 2006;387:677-85.
14 Ramachandran R, Noorbakhsh F, Defea K, Hollenberg MD. Targeting proteinase-activated receptors: therapeutic potential and challenges. Nat Rev Drug Discov
2012;11 :69-86.
15 Chin AC, Lee WY, Nusrat A, Vergnolle N, Parkos CA. Neutrophil-mediated activation of epithelial protease-activated receptors- 1 and -2 regulates barrier function and transepithelial migration. J Immunol 2008;181 :5702-10.
16 Ochoa-Cortes F, Guerrero-Alba R, Valdez -Morales EE, Spreadbury I, Barajas-
Lopez C, Castro M, et al. Chronic stress mediators act synergistically on colonic nociceptive mouse dorsal root ganglia neurons to increase excitability. Neurogastroenterology and motility : the official journal of the European Gastrointestinal Motility Society 2014;26:334- 45.
17 Motta JP, Bermudez-Humaran LG, Deraison C, Martin L, Rolland C, Rousset
P, et al. Food-grade bacteria expressing elafin protect against inflammation and restore colon homeostasis. Sci Transl Med 2012;4:158ra44.
18 Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001;25:402-8.
19 Hyun E, Ramachandran R, Cenac N, Houle S, Rousset P, Saxena A, et al.
Insulin modulates protease-activated receptor 2 signaling: implications for the innate immune response. J Immunol 2010;184:2702-9.
20 Tooth D, Garsed K, Singh G, Marciani L, Lam C, Fordham I, et al. Characterisation of faecal protease activity in irritable bowel syndrome with diarrhoea: origin and effect of gut transit. Gut 2014;63:753-60.
21 Kerckhoffs AP, Ter Linde JJ, Akkermans LM, Samsom M. Trypsinogen IV, serotonin transporter transcript levels and serotonin content are increased in small intestine of irritable bowel syndrome patients. NeurogastroenterolMotil 2008;20:900-7.
22 Alloy AP, Kayode O, Wang R, Hockla A, Soares AS, Radisky ES. Mesotrypsin Has Evolved Four Unique Residues to Cleave Trypsin Inhibitors as Substrates. J
Biol Chem 2015;290:21523-35.
23 Pendlebury D, Wang R, Henin RD, Hockla A, Soares AS, Madden BJ, et al. Sequence and conformational specificity in substrate recognition: several human Kunitz
protease inhibitor domains are specific substrates of mesotrypsin. J Biol Chem 2014;289:32783-97.
24 Knecht W, Cottrell GS, Amadesi S, Mohlin J, Skaregarde A, Gedda K, et al. Trypsin IV or mesotrypsin and p23 cleave protease-activated receptors 1 and 2 to induce inflammation and hyperalgesia. JBiolChem 2007;282:26089-100.
25 Ibeakanma C, Ochoa-Cortes F, Miranda-Morales M, McDonald T, Spreadbury I, Cenac N, et al. Brain-gut interactions increase peripheral nociceptive signaling in mice with postinfectious irritable bowel syndrome. Gastroenterology 2011 ; 141 :2098-108 e5.
26 Mueller K, Michel K, Krueger D, Demir IE, Ceyhan GO, Zeller F, et al. Activity of protease-activated receptors in the human submucous plexus. Gastroenterology
2011;141 :2088-97 el .
27 Vergnolle N. Clinical relevance of proteinase activated receptors (pars) in the gut. Gut 2005;54:867-74.
Claims
CLAIMS:
A Trypsin-3 inhibitor for use in treating a gut disease associated with intestinal permeability and visceral hypersensitivity in a patient.
The Trypsin -3 inhibitor for use according to claim 1, wherein the gut disease is selected from the group consisting of Irritable Bowel Syndrome (IBS) Gluten hypersensitivity or Inflammatory Bowel Diseases (IBD).
The Trypsin -3 inhibitor for use according to claim 1 or 2, wherein the gut disease is Irritable Bowel Syndrome (IBS).
The Trypsin -3 inhibitor for use according to any one claims 1 to 3, wherein the Trypsin -3 inhibitor is an anti- Trypsin -3 neutralizing antibody, polypeptides or aptamer.
The Trypsin -3 inhibitor for use according to any one claims 1 to 3, wherein said inhibitor is an inhibitor of Trypsin -3 gene expression, wherein said inhibitor of Trypsin -3 gene expression is a small inhibitory R A (siR A), a nuclease, a ribozyme, or an antisense oligonucleotide.
The Trypsin -3 inhibitor for use according to claim 5, the wherein antisense oligonucleotide is selected from the group consisting of :
- 5'- CAAACTCTCCTCACCTGCCGTCATCAATG -3'(SEQ ID NO: 1)
- 5'- ATGAGCAGTTCATCAATGCGGCCAAGATC -3'(SEQ ID NO: 2)
- 5'- ACACCAAGGTCTACAACTATGTGGACTGG -3'(SEQ ID NO: 3)
5'- TGGTCTGCAACGGACAGCTCCAAGGAGTT -3'(SEQ ID NO: 4)
7. A pharmaceutical composition comprising a Trypsin-3 inhibitor according to any one claims 1 to 6 and a pharmaceutically acceptable carrier.
8. A pharmaceutical composition comprising a Trypsin-3 inhibitor according to any one claims 1 to 6 for use in treating a disease associated with intestinal permeability and visceral hypersensitivity in a patient
9. A pharmaceutical composition for use according to claim 8, wherein the gut disease is selected from the group consisting of Irritable Bowel Syndrome (IBS) or Gluten hypersensitivity or Inflammatory Bowel Diseases (IBD) in a patient.
10. The pharmaceutical composition for use according to claim 9, wherein the gut disease is Irritable Bowel Syndrome (IBS).
11. A method for screening an Trypsin-3 inhibitor or Trypsin-3 antagonist for use in the treatment or prevention of Inflammatory Bowel Diseases (IBD), Irritable Bowel Syndrome (IBS) or Gluten hypersensitivity.
12. The method for screening an Trypsin-3 inhibitor or Trypsin-3 antagonist according to claim 11 which comprises the step consisting of:
(i) providing a purified Trypsin-3 protein, providing a cell, tissue sample or organism expressing the Trypsin-3,
(ii) providing a candidate compound such as small organic molecule, nucleic acids, antibodies, peptide or polypeptide,
(iii) measuring the activity of the Trypsin-3,
(iv) and selecting positively candidate compounds that, blocks the action of Trypsin-3 or inhibits TRYPSIN-3 expression.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP16306760 | 2016-12-21 | ||
| EP16306760.6 | 2016-12-21 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2018115083A1 true WO2018115083A1 (en) | 2018-06-28 |
Family
ID=57755131
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2017/083743 Ceased WO2018115083A1 (en) | 2016-12-21 | 2017-12-20 | Method of treatment of gut diseases such as irritable bowel syndrome (ibs) |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2018115083A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2025132833A1 (en) * | 2023-12-20 | 2025-06-26 | Institut National de la Santé et de la Recherche Médicale | Anti trypsin-3 single domain antibody |
Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4816397A (en) | 1983-03-25 | 1989-03-28 | Celltech, Limited | Multichain polypeptides or proteins and processes for their production |
| US4946778A (en) | 1987-09-21 | 1990-08-07 | Genex Corporation | Single polypeptide chain binding molecules |
| US5225539A (en) | 1986-03-27 | 1993-07-06 | Medical Research Council | Recombinant altered antibodies and methods of making altered antibodies |
| US5270163A (en) | 1990-06-11 | 1993-12-14 | University Research Corporation | Methods for identifying nucleic acid ligands |
| US5475096A (en) | 1990-06-11 | 1995-12-12 | University Research Corporation | Nucleic acid ligands |
| WO1999032619A1 (en) | 1997-12-23 | 1999-07-01 | The Carnegie Institution Of Washington | Genetic inhibition by double-stranded rna |
| WO2001036646A1 (en) | 1999-11-19 | 2001-05-25 | Cancer Research Ventures Limited | Inhibiting gene expression with dsrna |
| WO2001068836A2 (en) | 2000-03-16 | 2001-09-20 | Genetica, Inc. | Methods and compositions for rna interference |
| US6573099B2 (en) | 1998-03-20 | 2003-06-03 | Benitec Australia, Ltd. | Genetic constructs for delaying or repressing the expression of a target gene |
-
2017
- 2017-12-20 WO PCT/EP2017/083743 patent/WO2018115083A1/en not_active Ceased
Patent Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4816397A (en) | 1983-03-25 | 1989-03-28 | Celltech, Limited | Multichain polypeptides or proteins and processes for their production |
| US5225539A (en) | 1986-03-27 | 1993-07-06 | Medical Research Council | Recombinant altered antibodies and methods of making altered antibodies |
| US4946778A (en) | 1987-09-21 | 1990-08-07 | Genex Corporation | Single polypeptide chain binding molecules |
| US5270163A (en) | 1990-06-11 | 1993-12-14 | University Research Corporation | Methods for identifying nucleic acid ligands |
| US5475096A (en) | 1990-06-11 | 1995-12-12 | University Research Corporation | Nucleic acid ligands |
| WO1999032619A1 (en) | 1997-12-23 | 1999-07-01 | The Carnegie Institution Of Washington | Genetic inhibition by double-stranded rna |
| US6506559B1 (en) | 1997-12-23 | 2003-01-14 | Carnegie Institute Of Washington | Genetic inhibition by double-stranded RNA |
| US6573099B2 (en) | 1998-03-20 | 2003-06-03 | Benitec Australia, Ltd. | Genetic constructs for delaying or repressing the expression of a target gene |
| WO2001036646A1 (en) | 1999-11-19 | 2001-05-25 | Cancer Research Ventures Limited | Inhibiting gene expression with dsrna |
| WO2001068836A2 (en) | 2000-03-16 | 2001-09-20 | Genetica, Inc. | Methods and compositions for rna interference |
Non-Patent Citations (42)
| Title |
|---|
| A. P. M. KERCKHOFFS ET AL: "Trypsinogen IV, serotonin transporter transcript levels and serotonin content are increased in small intestine of irritable bowel syndrome patients", NEUROGASTROENTEROLOGY AND MOTILITY, vol. 20, no. 8, 1 August 2008 (2008-08-01), GB, pages 900 - 907, XP055363747, ISSN: 1350-1925, DOI: 10.1111/j.1365-2982.2008.01100.x * |
| ALLOY AP; KAYODE O; WANG R; HOCKLA A; SOARES AS; RADISKY ES: "Mesotrypsin Has Evolved Four Unique Residues to Cleave Trypsin Inhibitors as Substrates", J BIOL CHEM, vol. 290, 2015, pages 21523 - 35 |
| ARRIETA MC ET AL., GUT., vol. 55, no. 10, October 2006 (2006-10-01), pages 1512 - 1520 |
| BUENO L: "Protease activated receptor 2: a new target for IBS treatment", RIVISTA EUROPEA PERLE SCIENZE MEDICHE E FARMACOLOGICHE // EUROPEAN REVIEW FOR MEDICAL AND PHARMACOLOGICAL SCIENCES // REVUE EUROPEENNE POUR LES SCIENCES MEDICALES ETPHARMACOLOGIQUES, ROME, IT, vol. 12, no. suppl. 1, 1 August 2008 (2008-08-01), pages 95 - 102, XP008107526, ISSN: 0392-291X * |
| BUHNER S; LI Q; VIGNALI S; BARBARA G; DE GIORGIO R; STANGHELLINI V ET AL.: "Activation of human enteric neurons by supernatants of colonic biopsy specimens from patients with irritable bowel syndrome", GASTROENTEROLOGY, vol. 137, 2009, pages 1425 - 34, XP026661279, DOI: doi:10.1053/j.gastro.2009.07.005 |
| CENAC N; ALTIER C; MOTTA JP; D'ALDEBERT E; GALEANO S; ZAMPONI GW ET AL.: "Potentiation of TRPV4 signalling by histamine and serotonin: an important mechanism for visceral hypersensitivity", GUT, vol. 59, 2010, pages 481 - 8 |
| CENAC N; BAUTZOVA T; LE FAOUDER P; VELDHUIS NA; POOLE DP; ROLLAND C ET AL.: "Quantification and Potential Functions of Endogenous Agonists of Transient Receptor Potential Channels in Patients With Irritable Bowel Syndrome", GASTROENTEROLOGY, vol. 149, 2015, pages 433 - 44 e7 |
| CENAC NICOLAS ET AL: "Role for protease activity in visceral pain in irritable bowel syndrome", JOURNAL OF CLINICAL INVESTIGATION, vol. 117, no. 3, 1 March 2007 (2007-03-01), AMERICAN SOCIETY FOR CLINICAL INVESTIGATION, US, pages 636 - 647, XP002534418, ISSN: 0021-9738, DOI: 10.1172/JCI29255 * |
| CHIN AC; LEE WY; NUSRAT A; VERGNOLLE N; PARKOS CA: "Neutrophil-mediated activation of epithelial protease-activated receptors-1 and -2 regulates barrier function and transepithelial migration", J IMMUNOL, vol. 181, 2008, pages 5702 - 10 |
| CIRILLO C; SARNELLI G; TURCO F; MANGO A; GROSSO M; APREA G ET AL.: "Proinflammatory stimuli activates human-derived enteroglial cells and induces autocrine nitric oxide production", NEUROGASTROENTEROL MOTIL, vol. 23, 2011, pages e372 - 82 |
| CLAIRE ROLLAND-FOURCADE ET AL: "Epithelial expression and function of trypsin-3 in irritable bowel syndrome", GUT, 17 January 2017 (2017-01-17), UK, XP055363723, ISSN: 0017-5749, DOI: 10.1136/gutjnl-2016-312094 * |
| DATABASE BIOSIS [online] BIOSCIENCES INFORMATION SERVICE, PHILADELPHIA, PA, US; April 2007 (2007-04-01), CENAC NICOLAS ET AL: "Trypsin IV implication in irritable bowel syndrome (IBS) and visceral hypersensitivity", XP002770809, Database accession no. PREV200700605297 * |
| DATABASE BIOSIS [online] BIOSCIENCES INFORMATION SERVICE, PHILADELPHIA, PA, US; April 2015 (2015-04-01), FOURCADE CLAIRE ROLLAND ET AL: "Epithelial Mesotrypsin in IBS: Expression and Function", XP002770810, Database accession no. PREV201500718134 * |
| DATABASE BIOSIS [online] BIOSCIENCES INFORMATION SERVICE, PHILADELPHIA, PA, US; April 2016 (2016-04-01), LOPEZ CINTYA D LOPEZ ET AL: "Mesotrypsin Evokes PAR2 Dependent Excitabilty of Nociceptive Dorsal Root Ganglia (DRG) Neurons", XP002770811, Database accession no. PREV201700234848 * |
| GASTROENTEROLOGY, vol. 132, no. 4, Suppl. 2, April 2007 (2007-04-01), DIGESTIVE DISEASE WEEK MEETING/108TH ANNUAL MEETING OF THE AMERICAN-GASTROENTEROLOGICAL-ASSOCIATION; WASHINGTON, DC, USA; MAY 19 -24, 2007, pages A602, ISSN: 0016-5085 * |
| GASTROENTEROLOGY, vol. 148, no. 4, Suppl. 1, April 2015 (2015-04-01), 46TH ANNUAL DIGESTIVE DISEASE WEEK (DDW); WASHINGTON, DC, USA; MAY 16 -19, 2015, pages S120, ISSN: 0016-5085 * |
| GASTROENTEROLOGY, vol. 150, no. 4, Suppl. 1, April 2016 (2016-04-01), pages S596, ISSN: 0016-5085 * |
| GRUNDMANN D; KLOTZ M; RABE H; GLANEMANN M; SCHAFER KH: "Isolation of high-purity myenteric plexus from adult human and mouse gastrointestinal tract", SCI REP, vol. 5, 2015, pages 9226 |
| HYUN E ET AL: "Protease-activated receptor-2 activation: a major actor in intestinal inflammation", GUT, vol. 57, no. 9, 1 September 2008 (2008-09-01), BRITISH MEDICAL ASSOCIATION, LONDON, UK, pages 1222 - 1229, XP009134514, ISSN: 0017-5749, DOI: 10.1136/GUT.2008.150722 * |
| HYUN E; ANDRADE-GORDON P; STEINHOFF M; VERGNOLLE N: "Protease-activated receptor-2 activation: a major actor in intestinal inflammation", GUT, vol. 57, 2008, pages 1222 - 9, XP009134514, DOI: doi:10.1136/gut.2008.150722 |
| HYUN E; RAMACHANDRAN R; CENAC N; HOULE S; ROUSSET P; SAXENA A ET AL.: "Insulin modulates protease-activated receptor 2 signaling: implications for the innate immune response", J IMMUNOL, vol. 184, 2010, pages 2702 - 9 |
| IBEAKANMA C; OCHOA-CORTES F; MIRANDA-MORALES M; MCDONALD T; SPREADBURY I; CENAC N ET AL.: "Brain-gut interactions increase peripheral nociceptive signaling in mice with postinfectious irritable bowel syndrome", GASTROENTEROLOGY, vol. 141, 2011, pages 2098 - 108 |
| KERCKHOFFS AP; TER LINDE JJ; AKKERMANS LM; SAMSOM M: "Trypsinogen IV, serotonin transporter transcript levels and serotonin content are increased in small intestine of irritable bowel syndrome patients", NEUROGASTROENTEROLMOTIL, vol. 20, 2008, pages 900 - 7, XP055363747, DOI: doi:10.1111/j.1365-2982.2008.01100.x |
| KNECHT W; COTTRELL GS; AMADESI S; MOHLIN J; SKAREGARDE A; GEDDA K ET AL.: "Trypsin IV or mesotrypsin and p23 cleave protease-activated receptors 1 and 2 to induce inflammation and hyperalgesia", JBIOLCHEM, vol. 282, 2007, pages 26089 - 100, XP055364354, DOI: doi:10.1074/jbc.M703840200 |
| LARAUCHE M; GOURCEROL G; WANG L; PAMBUKCHIAN K; BRUNNHUBER S; ADELSON DW ET AL.: "Cortagine, a CRF1 agonist, induces stresslike alterations of colonic function and visceral hypersensitivity in rodents primarily through peripheral pathways", AM J PHYSIOL GASTROINTEST LIVER PHYSIOL, vol. 297, 2009, pages G215 - 27, XP055126789, DOI: doi:10.1152/ajpgi.00072.2009 |
| LARAUCHE M; MULAK A; KIM YS; LABUS J; MILLION M; TACHE Y: "Visceral analgesia induced by acute and repeated water avoidance stress in rats: sex difference in opioid involvement", NEUROGASTROENTEROL MOTIL, vol. 24, 2012, pages 1031 - e547 |
| LIVAK KJ; SCHMITTGEN TD: "Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method", METHODS, vol. 25, 2001, pages 402 - 8 |
| MOTTA JP; BERMUDEZ-HUMARAN LG; DERAISON C; MARTIN L; ROLLAND C; ROUSSET P ET AL.: "Food-grade bacteria expressing elafin protect against inflammation and restore colon homeostasis", SCI TRANSL MED, vol. 4, 2012, pages 158ra44, XP002761849 |
| MOUSSAOUI N; LARAUCHE M; BIRAUD M; MOLET J; MILLION M; MAYER E ET AL.: "Limited Nesting Stress Alters Maternal Behavior and In Vivo Intestinal Permeability in Male Wistar Pup Rats", PLOS ONE, vol. ll, 2016, pages e0155037 |
| MUELLER K; MICHEL K; KRUEGER D; DEMIR IE; CEYHAN GO; ZELLER F ET AL.: "Activity of protease-activated receptors in the human submucous plexus", GASTROENTEROLOGY, vol. 141, 2011, pages 2088 - 97 el |
| OCHOA-CORTES F; GUERRERO-ALBA R; VALDEZ-MORALES EE; SPREADBURY I; BARAJAS-LOPEZ C; CASTRO M ET AL.: "Chronic stress mediators act synergistically on colonic nociceptive mouse dorsal root ganglia neurons to increase excitability", NEUROGASTROENTEROLOGY AND MOTILITY : THE OFFICIAL JOURNAL OF THE EUROPEAN GASTROINTESTINAL MOTILITY SOCIETY, vol. 26, 2014, pages 334 - 45 |
| OIKONOMOPOULOU K; HANSEN KK; SAIFEDDINE M; VERGNOLLE N; TEA I; DIAMANDIS EP ET AL.: "Proteinase-mediated cell signalling: targeting proteinase-activated receptors (PARs) by kallikreins and more", BIOL CHEM, vol. 387, 2006, pages 677 - 85 |
| PENDLEBURY D; WANG R; HENIN RD; HOCKLA A; SOARES AS; MADDEN BJ ET AL.: "Sequence and conformational specificity in substrate recognition: several human Kunitz protease inhibitor domains are specific substrates of mesotrypsin", J BIOL CHEM, vol. 289, 2014, pages 32783 - 97 |
| RAMACHANDRAN R; NOORBAKHSH F; DEFEA K; HOLLENBERG MD: "Targeting proteinase-activated receptors: therapeutic potential and challenges", NAT REV DRUG DISCOV, vol. 11, 2012, pages 69 - 86, XP055065758, DOI: doi:10.1038/nrd3615 |
| SARNELLI G; VANDEN BERGHE P; RAEYMAEKERS P; JANSSENS J; TACK J: "Inhibitory effects of galanin on evoked [Ca2+]i responses in cultured myenteric neurons", AM J PHYSIOL GASTROINTEST LIVER PHYSIOL, vol. 286, 2004, pages G1009 - 14 |
| SPERBER AD; DUMITRASCU D; FUKUDO S; GERSON C; GHOSHAL UC; GWEE KA ET AL.: "The global prevalence of IBS in adults remains elusive due to the heterogeneity of studies: a Rome Foundation working team literature review", GUT, 2016 |
| TOOTH D; GARSED K; SINGH G; MARCIANI L; LAM C; FORDHAM I ET AL.: "Characterisation of faecal protease activity in irritable bowel syndrome with diarrhoea: origin and effect of gut transit", GUT, vol. 63, 2014, pages 753 - 60 |
| VALDEZ-MORALES EE; OVERINGTON J; GUERRERO-ALBA R; OCHOA-CORTES F; IBEAKANMA CO; SPREADBURY I ET AL.: "Sensitization of peripheral sensory nerves by mediators from colonic biopsies of diarrhea-predominant irritable bowel syndrome patients: a role for PAR2", AM J GASTROENTEROL, vol. 108, 2013, pages 1634 - 43 |
| VERGNOLLE N: "Clinical relevance of proteinase activated receptors (pars) in the gut", GUT, vol. 54, 2005, pages 867 - 74, XP009134513, DOI: doi:10.1136/gut.2004.048876 |
| W. KNECHT ET AL: "Trypsin IV or Mesotrypsin and p23 Cleave Protease-activated Receptors 1 and 2 to Induce Inflammation and Hyperalgesia", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 282, no. 36, 5 July 2007 (2007-07-05), US, pages 26089 - 26100, XP055364354, ISSN: 0021-9258, DOI: 10.1074/jbc.M703840200 * |
| WU P. ET AL.: "Identification of novel peptide inhibitors for human trypsins", BIOL. CHEM., vol. 391, February 2010 (2010-02-01), pages 283 - 293, XP008184258, DOI: doi:10.1515/BC.2010.030 |
| WU PING ET AL: "Identification of novel peptide inhibitors for human trypsins", BIOLOGICAL CHEMISTRY, vol. 391, no. 2-3, 1 January 2010 (2010-01-01), WALTER DE GRUYTER GMBH & CO, BERLIN, DE, pages 283 - 293, XP008184258, ISSN: 1431-6730, [retrieved on 20100203], DOI: 10.1515/BC.2010.030 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2025132833A1 (en) * | 2023-12-20 | 2025-06-26 | Institut National de la Santé et de la Recherche Médicale | Anti trypsin-3 single domain antibody |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12031137B2 (en) | Compositions comprising SASP modulators and senescence attenuators and uses thereof for modulating cellular senescence | |
| AU2020268619B2 (en) | Treatment and prevention of metabolic diseases | |
| EP2846793A1 (en) | Methods and pharmaceutical compositions for prevention or treatment of chronic obstructive pulmonary disease | |
| US20130108645A1 (en) | Methods for enhancing axonal regeneration | |
| EP2566967A1 (en) | Detection and treatment of fibrosis | |
| EP3268027B1 (en) | Hepcidin antagonists for use in the treatment of inflammation | |
| US11692045B2 (en) | Method of treating inflammatory bowel disease (IBD), irritable bowel syndrome (IBS) or gluten hypersensitivity by administering an elastase 2A (ELA2A) inhibitor | |
| US20140093494A1 (en) | Alpha synuclein toxicity | |
| EP3253777B1 (en) | Rvg derived peptides | |
| WO2018231025A9 (en) | Therapeutic agent for immune cell migration-caused disease and method for screening same | |
| US20240076671A1 (en) | P21 mrna targeting dnazymes | |
| US20230190887A1 (en) | Targeting g3bp aggregation to prevent neurodegeneration | |
| JP7580739B2 (en) | Prevention and treatment of urinary stones by controlling oncostatin M receptor signaling | |
| WO2011151395A2 (en) | Transglutaminase 2 inhibitors for use in the prevention or treatment of rapidly progressive glomerulonephritis | |
| KR20190122532A (en) | Composition comprising Carbonyl reductase 1 inhibitor for treating head and neck cancer and enhancing radiation sensitivity | |
| WO2024028476A1 (en) | Methods for the treatment of th2-mediated diseases | |
| KR20200028982A (en) | Targeting HDAC2-SP3 complex to enhance synaptic function | |
| WO2025021839A1 (en) | Method to treat metabolic disorders | |
| EA047713B1 (en) | TREATMENT OF HEPATOTOXICITY | |
| EP4210722A1 (en) | Methods of treatment of inflammatory bowel diseases | |
| WO2020016160A1 (en) | Method to treat neurological diseases | |
| Lai et al. | Blockade of Cysteine-rich Protein 61 Attenuates Renal Inflammation 2 | |
| WO2017212021A1 (en) | Methods and pharmaceutical compositions for the treatment of cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17837880 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 17837880 Country of ref document: EP Kind code of ref document: A1 |

