WO2018106932A2 - Compositions and methods for electronic control of gene expression - Google Patents
Compositions and methods for electronic control of gene expression Download PDFInfo
- Publication number
- WO2018106932A2 WO2018106932A2 PCT/US2017/065138 US2017065138W WO2018106932A2 WO 2018106932 A2 WO2018106932 A2 WO 2018106932A2 US 2017065138 W US2017065138 W US 2017065138W WO 2018106932 A2 WO2018106932 A2 WO 2018106932A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cells
- electrical stimulation
- protein
- cell
- dna segment
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/001—Enzyme electrodes
- C12Q1/005—Enzyme electrodes involving specific analytes or enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/001—Enzyme electrodes
- C12Q1/005—Enzyme electrodes involving specific analytes or enzymes
- C12Q1/006—Enzyme electrodes involving specific analytes or enzymes for glucose
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters
Definitions
- This disclosure generally relates to compositions, methods, devices and systems for reversible redox control of gene expression.
- molecular connectivity with electronics can benefit from the fact that electrochemical detection is sensitive, selective, cost-efficient, and label-free in small volumes 1"3 .
- Such connectivity presents a unique opportunity to apply knowledge of and control over electronic-device form and function to study biological systems 4 , improve biosensors 2 5 , and create wearable and implantable bio-hybrid devices 6"8 .
- Redox biomolecules play significant roles in a wide array of cellular functions, and present a tool for electronically interceding with both native cell pathways and redox- sensitive engineered constructs 9"11 .
- Bioelectrochemical technologies such as microbial fuel cells (MFC) and bioelectrosynthesis systems (BES) use electrochemical techniques to interact with cellular redox processes and electron transport mechanisms to change or measure cellular behaviors.
- MFC microbial fuel cells
- BES bioelectrosynthesis systems
- Literature exists on MFCs, where microbial communities metabolize organic compounds, resulting in production of electricity .
- BESs aim to electrochemically intercede with microbial metabolism for the production of various compounds of interest 15 16 .
- bioelectrochemical methods will continue to have impactful applications in fields such as bioenergy, biotechnology, biosensing, and biocomputing 30 .
- the present disclosure provides in certain embodiments electrogenetic methods, devices and systems that use redox biomolecules to carry electronic information to engineered bacterial cells in order to control transcription from a synthetic gene circuit.
- the disclosure provides a method comprising providing electrical stimulation to one or more living cells, the cells comprising a promoter operably linked to a DNA segment, wherein the promoter is controllable by reversible redox dependent activation. At least in part as a consequence of the electrical stimulation, redox dependent activation and transcription of the DNA segment occurs.
- the promoter, the DNA segment, or both are heterologous to the cell.
- the cells are single cell organisms, and can be prokaryotic or eukaryotic organisms.
- the DNA segment that is transcribed encodes a biologically active RNA polynucleotide that does not encode a protein.
- the DNA segment encodes a protein, which may be heterologous to the cell.
- the protein is secreted, and may exert a biological effect on other cells, which can include cells that are not exposed to the electrical stimulation.
- a method comprises modulating the electrical stimulation such that the redox dependent activation and transcription of the DNA transcription is altered.
- Altering the electrical stimulation can comprise increasing or decreasing the intensity, frequency, etc., of the electrical stimulation, and can comprise stopping the electrical stimulation such that the transcription is reduced or stopped.
- the disclosure includes supplying the cells with an electron acceptor. Supplying the electron acceptor to the cells results in a change in transcription, such as an increase in transcription. In certain implementations supplying an electron acceptor to the cells results in a change of transcription relative to a control value for transcription in the absence of the electron acceptor, and can comprise an increase in transcription relative to a control value.
- the electrical stimulation is configured to change in response to a signal, such as the presence and/or amount of a biological molecule.
- the disclosure includes a device or other apparatus that comprises an electrical stimulation component that changes the electrical stimulation in response to a signal.
- the device is a wearable or implantable device.
- the disclosure includes a biologic-based sensor comprising living cells as described above, wherein the cells are maintained in a housing capable of sustaining the cells.
- the housing includes at least one port through which liquids and biological molecules can pass, and also includes an electrical stimulation component that can provide electrical stimulation to the cells.
- the sensor can further include a power source for operating the electrical stimulation component.
- the device can be in communication with a sensing component that can sense the presence, absence and/or amount of a biological indicator, which can be any biological indicator, non-limiting examples of which include a protein, a peptide, a carbohydrate, a lipid, a cytokine, a drug, a toxin, an indicator of a pathogen, ionizing radiation, or a combination thereof.
- a biologic-based sensor includes a sensing component that is configured to sense for example glucose or insulin, and may also be configured to adjust the electrical stimulation based on communication with the sensing component.
- a device of this disclosure includes a reservoir component that contains an electron acceptor that is in fluid communication with the cells in the device, such that the electron acceptor can be provided to the cells.
- the disclosure includes a system comprising a biologic-based sensor as further described herein, further comprising a processor running software configured to adjust the electrical stimulation based on communication with a sensing component.
- Electrogenetic device scheme (a) Device-mediated electronic input consists of applied potential (step functions) for controlling the oxidation state of redox- mediators (transduced input). Redox mediators intersect with cells to actuate transcription and, depending on actuated gene-of-interest, control biological output, (b) The electrogenetic device consists of the region encompassing the gene coding for the SoxR protein and the divergent overlapping VsoxRfPsoxS promoters. A gene of interest is placed downstream of the T > soxS promoter. Pyo (O) initiates gene induction and Fcn(R/0), through interactions with respiratory machinery, allows electronic control of induction level. Fen (R/O),
- Figure 2 Electronic control of cell fluorescence, (a) Schematic of electrogenetic device induction of the phiLOV fluorescent protein. soxR and T*soxR omitted from schematic, but present, (b) Charge and average cell fluorescence resulting from applying the indicated potentials with Fen (R) and Pyo. Grey cyclic voltammogram shows reduction (R) and oxidation (O) peaks of Fen (R/O). Arrows indicate oxidizing (+0.5 V) and reducing (-0.3 V) potentials, (c) Cell fluorescence resulting from applied potential in the presence of indicated mediators.
- each bar corresponds to no potential, +0.5 V, and -0.3 V, respectively.
- Figure 3 Electronic control of On/Off of fluorescence, (a) Schematic of dynamic experiments with electronic signals to increase ('ON') or decrease ('OFF') fluorescence, (b) Fluorescence of cells from an extended culture cycled 'ON' and 'OFF' by potential applied in upper panel (signal; light grey— 'ON' and dark grey— 'OFF'). Charge is indicated in middle panel, with axis ranges: 'ON' is 0 to -2 C; 'OFF' is -2 to 0 C. (c) Cell fluorescence after 'ON'/'OFF' cycles with the indicated durations. 'ON' potential applied at start and 'OFF' after 1 ⁇ 2 cycle measurement is taken.
- each bar corresponds to 0, 15, 30, 45, 60, and 90, respectively, (d) Linearity between protein synthesis and charge.
- the value 'Integrated protein synthesis' represents the calculated accumulation of phiLOV fluorescence in the absence of degradation using the Matlab model. Error bars indicate s.d. of biological triplicates.
- Figure 4 Electronic induction of cell motility, (a) Schematic of CheZ induction, which stimulates swimming. soxR and T*soxR omitted from schematic, but present, (b) CheZ levels in response to added mediators or electronic induction with Pyo and Fen (R). NT, no treatment. Samples were processed in parallel. Uncropped blots in Figure 18. (c) Two- dimensional recapitulation of 3 s cell trajectories in treated samples as indicated. Samples electronically induced were provided +0.5 V with Pyo and Fen (R) until indicated charge was obtained, (d) Cell swimming velocities. Error bars indicate s.e.m.
- WT are W31 10 cells
- CheZ KO are isogenic W31 10 cheZ ⁇
- inducible cells are W31 10 cheZ ⁇ cells transformed with pHWOl .
- O.OOOl as analyzed by Student' s t-test against the Pyo+Fcn (R) control (two-tailed).
- the -0.009 C sample indicates 15 min +0.5 V
- FIG. 5 Electronic control of cell-to-cell communication
- Electronic signals modulating Pyo and Fen (R) to Fen (O) result in Luxl-laa and AHL production from relay cells.
- soxR and T*soxR omitted from schematic, but present in relay cells.
- the receiver cells produce LuxR.
- LuxR detects AHL phiLOV is induced from the luxl promoter
- Redox mediator structures a. The chemical structure of pyocyanin.
- Figure 7 Response of cells with intact soxRS : (a) phiLOV fluorescence of GC4468 or DJ901 (GC4468 AsoxRS) cells induced anaerobically with the indicated pyocyanin concentrations for 1 hour. From left to right in each group of two bars, each bar corresponds to DJ901 and GC4468, respectively, (b) Miller Units resulting from pyocyanin (2.5 ⁇ ) and femcyanide (concentrations indicated) treatment of ZK126 cells with the pTGl plasmid anaerobically for 1 hour. Pyocyanin-only control was 153 MU. Error bars indicate s.d. of biological duplicates.
- Plasmid maps Maps of the pBR322-based plasmids that were used in this disclosure. ssRA tag denotes either the LAA or DAS tag.
- FIG. 9 Mediator effects on induction from PsoxS promoter: (a) Fluorescent protein induction due to pyocyanin with or without the addition of ferricyanide. From left to right in each group of two bars, each bar is Pyo ( ⁇ ) + 5 mM Fen (O) and Pyo only, respectively, (b) Fluorescent protein induction due to varying concentrations of ferricyanide or ferrocyanide added with or without 5 ⁇ pyocyanin. The first ten bars are Pyo + ferricyanide, the second three are Pyo + ferrocyanide, the next four bars are ferricyanide only, and the remaining bars are ferrocyanide.
- Figure 10 Induction of fluorescence in aerobic conditions: Cell fluorescence measured after induction with different concentrations of pyocyanin with or without 5 mM ferricyanide (Fen (O)) in aerobic conditions. Cultures were either aerated (250 rpm) or non- aerated (stationary). Error bars represent s.d. of biological duplicates. From left to right in each group of four bars, each bar corresponds to aerated Pyo, Aerated Pyo + 5 mM Fen (O), non-aerated Pyo, and non-aerated Pyo + 5 mM Fen, respectively.
- Fen (O) ferricyanide
- each bar corresponds to no treatment, 5 ⁇ Pyo, 50 ⁇ Pyo, 5 mM Fen (R), 50 mM Fen (R), 5 mM Fen (O), 50 mM Fen (O), 5 ⁇ Pyo 5 mM Fen (R), 5 ⁇ Pyo 5 mM Fen (O), 5 ⁇ Pyo 50 mM Fen (R), 5 ⁇ Pyo 50 mM Fen (O), and heat killed, respectively.
- FIG. 12 Cell reduction of ferricyanide: (a) Scheme of spectrophotometric and electrochemical methods for measuring ferricyanide reduction by cells, (b) Absorbance at 420 nm correlates with ferricyanide concentration, (c) Reduction of different ferricyanide concentrations by cells results in absorbance decrease (measured at 420 nm, starting cell OD600 of 2.0) over time, (d) Oxidation of ferrocyanide shows more negative current (measuring ferrocyanide) when ferricyanide is reduced by cells, (e) Reduction of
- ferricyanide as measured by absorbance, is higher with higher cell amounts.
- Figure 13 Effect of alternate redox mediators on cell response: (a) Schematic of potential mechanism of ferricyanide-based pyocyanin-driven gene induction amplification from the T > soxS promoter, (b) Fluorescence of cells after 1.5 hours, producing the phiLOV protein in response to 5 ⁇ added pyocyanin and the indicated concentrations of either nitrate or nitrite. 5 ⁇ Na Myolobdate was added to all samples. From left to right in each group of two bars, each bar corresponds to nitrite and nitrate, respectively, (c) Cell fluorescence over time in response to addition of PMS with or without Fen (O).
- each bar corresponds to no treatment, 5 ⁇ PMS, 5 ⁇ PMS + 1 mM Fen (O), and 5 ⁇ PMS + 5 mM Fen (O), respectively,
- Electrochemical bulk electrolysis setup (a) An electrochemical analyzer is connected to a computer and three electrodes - gold (Au) working and counter electrodes and an Ag/ AgCl reference electrode. The working and counter electrodes are separated by two agar salt bridges, (b) Photographs of setup used for bulk electrolysis and in situ electrochemical cell induction. Liquid level indicates 3 mL of solution.
- FIG. 1 Ferricyanide and ferrocyanide control of protein levels: (a) Schematic of experiments in (c) and (d) where cells are first induced with pyocyanin and Fen (O) for a 1 ⁇ 2 cycle duration ("ON"), then spun down and re-suspended in pyocyanin with Fen (R) ("OFF"), (b) Cell fluorescence degradation of phiLOV with the DAS tag or phiLOV without a tag. Time is after re-suspension in fresh media, (c) Repeated "ON"/" OFF" cycles show that cells continue to respond overtime.
- each bar From left to right in each group of two bars, each bar corresponds to OFF and On/Off cycles, respectively, (d) A single "ON"/" OFF" cycle of various half-cycle lengths shows cell response time to changing Fcn(O) to Fcn(R). Error bars indicate standard deviation of biological triplicates. From left to right in each group of six bars, each bar corresponds to 15 min, 30 min, 45 min, 60 min, 90 min, and 0 min, respectively.
- Cell velocities Cell velocities of various cells treated with the mediators in the indicated concentrations. Error bars represent standard error of 50 - 800 separate cell trajectories per sample.
- FIG. 21 AHL solution-based induction: (a) Fluorescence of either the reporter cells only or co-culture of reporter and relay cells in response to the indicated mediators. From left to right in each group of two bars, each bar corresponds biosensor cells only and co-culture relay + biosensor cells, respectively, (b) Fluorescence over time of reporter cells in co-cultures induced with the indicated charges, (c) Fluorescence of the reporter cells when treated with supernatants of the relay cells induced with the indicated charges. Error bars indicate s.d. of biological triplicates.
- Figure 22 qPCR analysis of electrochemically-induced cells, (a) Fold change of c eZ upon treatment with indicated inducers and electronic induction, (b) Fold change of luxl upon treatment with indicated inducers and electronic induction, (c) Fold change of phiLOV-DAS upon treatment with indicated inducers and electronic induction - both ON and OFF. (d) Fold change of soxR upon same treatments (and from the same samples) as in c. Calibrator samples are the "no treatment" samples for each gene of interest. In (a) and (b), three technical replicates were done for one biological sample; in (c) and (d) three technical replicates were done for each of two biological replicates. Error bars plotted in (a) and (b) illustrate the range of fold change in expression based upon one standard deviation above and below the average AACt. In (c) and (d), error bars represent standard deviation of the two biological replicates.
- the disclosure includes each and every polynucleotide sequence disclosed herein, the RNA equivalent of every DNA polynucleotide (i.e., where uracil replaces thymine) and every DNA equivalent of every RNA, and the complementary sequence and the reverse
- the disclosure includes every amino acid sequence, and all polynucleotide sequences encoding the amino acid sequences. Contiguous segments of polynucleotides and polypeptides sequences are also included.
- the present disclosure provides new compositions of matter, methods, systems, and devices that link electronic signals, through redox molecules, to control gene expression. It is contemplated that the methods, devices and systems described herein can be tailored to produce a variety of responses, guide various behaviors, and further the use of other electronic 28 31 and redox-based systems to access and affect biomolecular information transfer.
- Embodiments of the disclosure may include MFC and/or BES systems for gene expression based on potential, current, or electron acceptor availability.
- embodiments of the disclosure may be used for spatio-temporal control of cells immobilized at or near electrode surfaces, for metabolic engineering applications, gut-on-a-chip systems, and other bio-hybrid devices where precise cellular spatio-temporal control is desirable. Additionally, embodiments of this disclosure offer additional modes (in addition to light, magnetic, and radio) of relaying electronic signals to cells. Such cells can be programmed to respond to an unprecedentedly wide array of biological and non-biological information. Embodiments of the disclosure additionally provide for electronic interrogation of SoxRS- (or other) specific targets and electron-flow-dependent processes. Thus, and without intending to be constrained by any theory, it is considered that the present description of translating electronic signals to gene expression represents a new way of using redox molecules and electron flow for guiding biological function.
- Non-limiting embodiments of the disclosure are illustrated using Escherichia coli, a widely used synthetic biology chassis, and show circuit versatility and quick response times. These demonstrations are distinct from previous approaches 31 , at least insofar as the redox- dependent control of gene expression demonstrated herein is reversible, tunable, and utilizes redox substrates that are not irreversibly converted to compounds that are terminally committed to a single variant with a confined effect on gene expression.
- the disclosure provides a method that comprises providing electrical stimulation to one or more living cells.
- the cells comprise a promoter operably linked to a DNA segment capable of being transcribed, wherein the promoter is controllable by reversible redox dependent activation.
- the promoter, the DNA segment, or both are heterologous to the cell.
- heterologous it is meant that the DNA segment and/or the promoter are not ordinarily encoded by the cell, apart from having been engineered to do so.
- the DNA segment and/or the promoter can be from a distinct organism, and/or can comprise modifications of endogenous sequences.
- the electrical stimulation is such that a redox change is caused with the cells, which can include change in the redox status of one or more proteins that can directly or indirectly influence transcription.
- a redox change is caused with the cells, which can include change in the redox status of one or more proteins that can directly or indirectly influence transcription.
- RNA transcription from the promoter is induced, and the degree and/or duration of the transcription can be affected by moderating the electrical stimulation.
- RNA encoded by the DNA segment under redox-controlled transcription as described herein can encode any polynucleotide.
- the RNA is an mRNA, a tRNA, an RNA aptamer, shRNA, snRNA, an siRNA, a guide or tracr RNA for use in CRISPR based gene editing, or a piRNA.
- the tRNA is a modified tRNA. Accordingly, in embodiments the RNA can code for protein, or it may not code for protein, or it may have segments that code for protein and other that do not code for protein.
- the RNA is a spliced or unspliced mRNA.
- the RNA is any RNA that is involved in RNAi-mediated targeting of a target RNA.
- a microRNA miRNA
- a ribozyme can be encoded.
- small interfering RNA siRNA
- an shRNA is encoded.
- an RNA produced according to the electrogenetically controllable approaches described herein comprises a CRISPR RNA (crRNA) or a guide RNA, such as sgRNA, and thus embodiments of the disclosure provide companion technologies to currently emerging or established gene editing techniques.
- the RNA can be designed to adopt any particular secondary structure, if desired.
- the RNA can be any RNA that can form a component of a ribonucleoprotein.
- the RNA produced according to this invention can have any desired features, including polyadenylation signals, translation initiation sites, transcription and translation termination sites, and can encode amino acid sequences that impart to the encoded protein any useful or otherwise desirable function, including but not limited to cell trafficking signals, degradation signals, secretion signals, nuclear localization signals, and the like.
- an RNA produced according to this method may be polycistronic, and therefore may include such features as an internal ribosome entry site (IRES) to facilitate the discontinuous translation of more than one polypeptide sequence.
- IRS internal ribosome entry site
- IRES sequences are known in the art and may be used, so long as they are capable of recruiting translation initiation factors to the downstream open reading frame(s) of the mRNA.
- IRES sequences are normally identical to or are derived from viral sequences.
- other suitable IRES sequences may be obtained from other organisms, including but not limited to mammal, insect, and yeast.
- the RNA produced according to this invention can include more than one open reading frame, which may or may not be overlapping. In the case of overlapping reading framed the RNA may contain, for example, signals that facilitate ribosomal frameshifting, including but not necessarily limited to ribosomal slippery sites and the ability to adopt secondary structures, such as pseudoknots.
- the RNA is under reversible redox-based control as described herein encodes any desired amino acid sequence, such as any peptide or polypeptide/protein.
- any desired amino acid sequence such as any peptide or polypeptide/protein.
- the RNA encodes a peptide or protein that has biological activity.
- the protein is any of a peptide or protein hormone, a chemokine, a growth factor, a quorum sensing peptide or protein, a protein or peptide that can interfere with quorum sensing, a toxin, an antimicrobial peptide, a protein or peptide that affects cell motility, or cell differentiation, a protein or peptide that has anti-cancer activity, or other therapeutic and/or prophylactic benefits.
- the cells that are modified according to the present disclosure can be, for example, resistant to a toxin or other protein or peptide or RNA that the expression of which is reversibly controlled according to the electrogenetic modifications described herein, and thus, the cells may secrete such peptides or proteins to kill other cells within their vicinity, or otherwise in communication with the modified cells, whereas the engineered cells of this disclosure will be resistant to the secreted toxin or other antimicrobial agent.
- the protein is an antagonist or an agonist of a receptor.
- the protein is capable of binding an antigen, and thus may comprise an antibody or antigen binding fragment thereof. Sets of proteins can be encoded to produce conventional antibodies, or single chain antibodies or antigen binding fragments thereof can be produced.
- the antibodies can be of any Ig subtype, and can comprise any combination of complementary determining regions.
- the protein or peptide can function as a checkpoint inhibitor for tunable immunotherapy purposes.
- the protein is a neuropeptide.
- the protein is a clotting factor, or has an anti-clotting function, or has a vasoconstriction function, i.e., angiotensin or a derivative thereof.
- the protein or peptide comprises antidiuretic hormone, calcitonin, enkephalin, erythropoietin, ghrelin, growth hormone, insulin, insulin-like growth factor, leptin, luteinizing hormone, prolactin, renin, somatostatin, or any other peptide hormone.
- the protein comprises an antigen for use in stimulating an immune response.
- the disclosure can be adapted for microbiological biocontainment purposes.
- the RNA encodes a protein or peptide that can disrupt a biofilm.
- the protein or peptide or RNA can kill bacterial persister cells, and/or cells that are in a vegetative growth state.
- the protein or peptide can kill antibiotic resistant bacteria.
- the RNA encodes a peptide or protein that is a prodrug, which may be converted into its active form by, for example, enzymes that are endogenous to the modified organisms, or via other modifications to the cells such that the prodrug can be converted to its active form once it has been expressed.
- the protein is a radioprotectant protein, such as flagellin and/or fragments thereof, and/or protects cells from ionizing radiation and/or apoptosis, such as those described in U.S. Patent 8,007,812 and 9, 139,623, the disclosures of which are incorporated herein by reference.
- RNA and/or proteins produced under the electrogenetic control scheme of this disclosure can be for virtually any purpose, and in some examples, a method, device and/or system of this disclosure is suitable for prophylaxis and/or therapy of any disease, disorder or other condition.
- the protein is insulin. Accordingly, in embodiments a method, device and/or system of this disclosure is suitable for use with diabetic patients.
- the encoded protein is a detectable protein.
- the detectable protein can be secreted, or non-secreted.
- the disclosure comprises detecting a signal from one or more cells that have been engineered according to this disclosure to express a detectable protein.
- the detectable protein can be visually detected by eye, and/or via machine-based detection.
- the detectable protein comprises fluorescent proteins, such as any of green fluorescent protein (GFP), mCherry, etc., and non- fluorescent proteins such as luciferase and beta-galactosidase which produce detectable signals via enzymatic action, and can include but are not limited to other enzymes that produce molecules that have biological activity, such as tyrosinase, Luxl, and LuxS, or pyocyin, microcin S.
- the RNA encodes a secreted placental alkaline phosphatase (SEAP).
- SEAP secreted placental alkaline phosphatase
- the disclosure includes imaging cells that express a detectable protein, including in vitro and in vivo imaging approaches.
- a method, device and/or system of this disclosure is associated with an inanimate object or surface, and can thus be used in a wide variety of settings, including but not limited to medical devices, including but not necessarily limited to implantable medical devices, or any other surface wherein influencing the function and/or viability of cells is desirable.
- the cells are proximal to or are in physical association with a conduit or any other surface that is susceptible to biofilm formation or comprises a biofilm.
- the cells are single cell organisms.
- the cells are prokaryotes, including but not necessarily limited to bacteria.
- the bacteria are Gram positive or Gram negative bacteria. The disclosure includes mixtures of all cell types described herein.
- Mixtures of different cell types can be designed such that they express different RNA that are controlled by distinct promoters. Further, any cell described herein can be designed to express distinct RNAs from distinct promoters.
- the cells are single celled eukaryotic cells, and thus can comprise any type of yeasts, plant cells, insect cells, and mammalian cells.
- the cells are present in a tissue or organ, which may be in an organism, or may be maintained ex vivo.
- the cells are mammalian cells that are totipotent, multipotent, or pluripotent, and thus the RNA, the expression of which is controllable according to this disclosure, may influence differentiation of the cells, or may help preserve the cells in a fully or partially differentiated state.
- the disclosure includes culturing cells modified according to this disclosure, inducing expression of a peptide or protein, and separating the protein from the cells and/or the culture medium.
- the disclosure includes systems and devices that can house the cells, such as a housing. Any suitable cell housing that can sustain the cells can be adapted for use in embodiments of this disclosure.
- the housing will be suitable for supplying the cells with a nutrient source and/or removal of waste products.
- the housing comprises a chip.
- a housing/device/system of this disclosure is adapted from known devices, including for example, those described in U.S. Patent Publication nos.
- the housing comprises a three-dimensional article having at least one port for allowing fluid communication with its environment.
- a housing component can be adapted or visualizing the cells and/or for detecting a signal produced by the cells.
- the device may comprise a translucent component, which may be adapted to function with, for example, a waveguide, and a signal detector, and may further be integrated with other devices, including for example, cameras and microscope devices.
- the device comprises a housing in communication with any suitable component for providing electrical stimulation to the cells.
- the electrical stimulation component comprises a working electrode and a counter electrode, and may include a reference electrode, or other electrodes.
- the device comprises a potentiostatic component.
- the electrical component may comprise an anode and a cathode.
- the electrodes may be coupled to any suitable leads, and to a power source.
- the power source is not particularly limited, and may comprise a battery that is integrated into the device/housing, or the power source may be connected remotely to the device via, for example, any suitable wiring, leads, etc.
- a non-limiting embodiment of components for use in providing electrical stimulation is presented in the figures of this disclosure, including for example Figure 14.
- cells that are subjected to electrical stimulation as described herein are maintained in anaerobic conditions, or hypoxic conditions, or aerobic conditions.
- the oxygen content in which the cells are maintained is thus controllable, and may include modulating an oxygen gradient.
- the electrical stimulation component can be configured to provide alternating current or direct-current and to vary the voltage, frequency, duration, current, initiation or cessation of the electrical stimulation, such as on a predetermined schedule, or in response to any suitable signal, including but not necessarily limited to biological, electrochemical, electrical, electromagnetic, magnetic, chemical, and mechanical signals.
- the electrical stimulation is of a form and character such that it can affect the redox state of the cells and/or the protein(s) described herein that can reversibly induce expression of the RNA and/or enhance such expression, but is not lethal to the cells. However, inducing lethality of the cells may be desirable under certain circumstances, and thus the electrical stimulation component can be configured accordingly.
- the voltage applied to the cells is from -1.0 to +1.0 Volts, inclusive, and including all numbers to the first decimal point there between.
- the current is generally in a milliamp range.
- the current does not exceed 1.0 Amp.
- the duration of the electrical stimulation is variable, and can range from milliseconds to hours, and may extend over a period of days.
- the electrical stimulation is provided at a minimum of 0.01 V/s.
- the electrical stimulation may be provided at approximately 1.0-10.0 MHz, inclusive, and including all numbers to the first decimal point there between.
- the disclosure includes interrupting periods of electrical stimulation for any suitable period.
- the signal interpreted by a sensor that is a component of a system or device of this disclosure is a biological signal.
- the device may comprise any suitable sensor for detecting any signaling moiety such that the electrical stimulation can be initiated, stopped, or altered in response to the presence, absence or amount of the signal.
- the sensor comprises a biological sensor, such as a cell surface molecule that can produce a detectable signal when bound by a ligand.
- the sensor comprise an electronic sensor.
- a sensor comprises a transducer or detector element that may function in a physicochemical way, which can include but is not limited to optical, piezoelectric, and electrochemical functions.
- the sensor comprises a biochip.
- the electrical stimulation component and/or the signaling component and/or the sensing component can be connected to a computer and/or microprocessor such that the electrical stimulation is altered in response to the signal, such as by running software which may be customized for any particular use and to cause any desirable change in the electrical stimulation provided to the cells.
- Systems comprising such computers and/or microprocessors in communication with a device and/or the modified cells of this disclosure are included within its scope.
- a device and/or system of this disclosure is configured to be capable of WiFi or Bluetooth communication with another component that can, for example, control the electrical stimulation, and/or interpret signals that signify a need to change the electrical stimulation.
- information obtained by the device can be monitored in real-time by a computer, and/or by a human operator.
- the disclosure provides as an embodiment or component of the system a non-transitory computer readable storage media for use in performing an algorithm to control electrical stimulation, and/or for monitoring and/or recording electrical stimulation events.
- a device of this disclosure comprises microprocessor wherein the
- a device and/or system of this disclosure comprises a continuous glucose monitor.
- a device of this disclosure is provided as an implantable device, or is integrated into a wearable garment or a wearable device, including but not necessarily limited to WiFi and/or Bluetooth enabled watches or other wrist-worn devices.
- the disclosure includes ingestible devices such as pill-based devices which may or may not include camera components, and drug delivery devices which may include pumps, such as a glucose or insulin pump, and thus may further comprise tubing as part of an infusion set that also includes a catheter and an insulin reservoir.
- the promoters that are operably linked to the DNA sequence encoding any RNA of this disclosure can comprise any promoter that is responsive to the redox state of any cellular component, particularly proteins that can participate in initiating, modulating, or inhibiting transcription. Certain and non-limiting embodiments of the sequences of such promoters are provided in Table 5. In non-limiting examples, the promoter comprises a SoxS promoter, or an OxyS promoter.
- a method, device and/or system of this disclosure involves supplementing the modified cells with an electron acceptor.
- an electron acceptor can enhance expression of the RNA that is in communication with the promoter. It is expected that any electron acceptor can be used, non-limiting examples of which include Ferricyanide/ferrocyanide (FCN) and Nitrate/ni trite. Non-limiting embodiments of nucleotide sequences encoding examples of electron acceptors are provided in Table 5. In certain embodiments, fumarate, oxygen, and/or Dimethyl sulfoxide (DMSO) can be used. In embodiments, any moiety that improves electron transfer can be used, including but not necessarily limited to flavins and CymA.
- FCN Ferricyanide/ferrocyanide
- DMSO Dimethyl sulfoxide
- any moiety that improves electron transfer can be used, including but not necessarily limited to flavins and CymA.
- a device of this disclosure can include a reservoir component or any other component that can hold and/or retain a supply of the electron transfer moiety, such as a membrane, or a surface to which the electron transfer moiety is reversibly attached, or a gel, or a capsule, or other components that will be apparent to those skilled in the art given the benefit of the present disclosure.
- a component to supply the cells with a suitable electron acceptor and such supply can be regulated using any suitable mechanism, the control of which can be integrated into computer/microprocessor controls.
- the disclosure utilizes pyocyanin (Pyo) for gene induction and ferricyanide (Fen) for response-amplification and electronic control to guide production of proteins that act as reporters or that otherwise direct cell function.
- Pyocyanin is secreted by Pseudomonas aeruginosa and is implicated in community organization, pathogenicity, and interspecies behavior 32"34 .
- SoxRS regulon 32,35"37 which functions to sense and respond to oxidative stress.
- SoxR protein contains an iron-sulfur cluster (2Fe-2S) that is maintained in a reduced form by NADPH-dependent enzymes 38 .
- SoxR activates transcription of the SoxS protein from the T > soxS promoter.
- SoxS protein in turn, regulates dozens of other genes, mainly with the aim of detoxifying the cell 40 .
- Ferricyanide oxidized, Fcn(O)
- ferrocyanide reduced, Fcn(R)
- E° a standard potential
- Figure la provides a schematic representation of our approach.
- Fcn(O), and Fcn(R) on gene expression and their interactions with cells we first carried out studies using chemical systems (e.g., without electrodes; chemical structures are presented in Figure 6). These results set the stage for electrode-based studies.
- plasmid pTTOl from the pBR322 vector, that includes the soxR gene and the overlapping divergent T > soxR and T > soxS promoters.
- the gene coding for the fluorescent reporter protein phiLOV 43 was placed downstream of T > soxS ( Figure lb).
- pyocyanin and ferricyanide were both necessary for the amplified protein production (beyond pyocyanin at 5 ⁇ ) from the PsoxS promoter, with pyocyanin initiating the protein production, and ferricyanide amplifying it.
- Non-limiting embodiments of this disclosure are concentration-dependent on both pyocyanin and ferricyanide ( Figures 7 & 9) anaerobically. However, when oxygen is present, the effect of ferricyanide (increase of fluorescence) is either negated (in aerated conditions) or decreased (non-aerated) in the conditions tested ( Figure 10). Fluorescence was measured after 1.5 hours of aerobic culture at 37 °C with or without 250 rpm shaking. When any pyocyanin is present, aeration allows oxygen to amplify the response to a maximum value, and the concentration of ferricyanide does not affect fluorescence at the tested conditions. Non-aerated conditions allow for some cells to not be exposed to high oxygen over the course of the experiment.
- PMS phenazine metho-sulfate
- Fen (O) amount defines whether protein production increases (high Pyo- and
- Fen (O/R) redox form we could similarly specify increases or decreases in protein levels.
- the AHL receiver cell interprets the AHL cue by binding the LuxR protein and expressing phiLOV from the Vluxl promoter in the plasmid pTT06.
- adding various Fen (O) concentrations with Pyo in solution resulted in amplified gene expression in co-cultures of the relay and receiver cells (Figure 21a).
- Figure 21b shows electronic induction of cell fluorescence of co-cultures over time, the average of which correlates with the charge (Figure 5b).
- the bioelectronic relay cells (DJ901 with the plasmid pTT05) and the biosensor cells (DJ901 with the plasmid pTT06 ) were co-cultured as described in the Methods and induced with the indicated mediators in solution to test initial effects on production of fluorescent protein by the biosensor cells.
- a trend similar to when DJ901 with pTT03 cells were used is seen. That is, increasing amounts of fluorescence were measured from cells induced with Fen (O). Pyocyanin is also needed for an amplified response.
- relay and biosensor cells were not co- cultured. Both cells were grown as before and placed in the anaerobic chamber. The relay cells alone were electrochemically induced by oxidation of pyocyanin and
- the disclosure further comprises separating the electronic signaling and the output response while still maintaining a good correlation, thereby using bio-electronic relay cells as translators between electronics and other cells that do not have to be under anaerobic conditions or be exposed to any of the mediators.
- E.coli DJ901 (AlacU169 rpsL AsoxRS901) 6 .
- E.coli with CheZ genomic deletion were constructed (CheZ KO).
- Plasmid vectors include pBR322 (for phiLOV and Luxl expression) and pFZYl (for CheZ expression). Briefly, the complete DNA region encompassing the soxR (Gene ID: 948566),and the T > soxR and T > soxS promoters (entire region between soxR and soxS) was PCR-amplified from the genome of E.coli MG1655.
- a SpectraMax M2 plate reader (Molecular Devices, Sunnyvale, CA) was used to read absorbance of ferricyanide (420 nm) and cell amounts (600 nm).
- Flow cytometry was performed using a BD Biosciences (Franklin Lakes, NJ) FACS Canto with the BD FACSDiva software. 50,000 cells were collected for each sample and consistently gated by forward scatter (FSC) and side scatter (SSC). The mean green fluorescence levels of phiLOV (488 nm laser and 530/30 green filter) are based on the means of 40,000-50,000 cells from the number of indicated samples. Analysis was done in
- Agar salt bridges consisted of 6 in -long 1.2 mm OD, 0.9 mm ID glass capillary tubes bent into a U shape after brief heating under a Bunsen burner. A 3 % agar solution with 1 M
- KC1 was heated and added into the bent capillary tube. Tubes were cooled by immersion in a
- Typical electrochemical setup for Fcn(0/R) interconversion and in situ experiments were performed as follows: the working and reference electrodes were placed in one glass vial with 3 mL of solution and/or cells; in a separate similar vial the counter electrode was placed with another 3 mL of solution or cells. Mediators were added to the counter chamber as follows: if Fen (O) was added to the working, then Fen (R) was added to the counter chamber, and vice versa. If pyocyanin was added to the working chamber, then it was also added to the counter chamber. If neither pyocyanin nor Fen (O/R) were added to the working chamber, then these were also omitted from the counter chamber.
- mediators were added, and the working electrode was biased at the indicated voltage for the indicated amount of time.
- For fluorescent cell sampling about 100 ⁇ of cells were removed from the solution and fixed as above. If multiple time points were to be taken without further electrochemical signaling, a volume equivalent to 100 ⁇ x number of samples + 100 ⁇ was removed from the glass vial and put in an Eppendorf tube in the mini-incubator, from which samples were collected. If further electronic signals were to be applied, 100 ⁇ of media + mediators were added back into the culture after sampling. Charge was recorded by the CHI software and the end-point total was used in the figures.
- CB chemotaxis buffer
- Cells in CB were removed from the anaerobic chamber, placed on a microscope slide, and a video was recorded using Cell Sens software and DX60 microscope equipped with a DP72 camera (Olympus, Waltham, MA). Approximately 100 frames are recorded for each video, using a 20 x objective lens with a GFP filter.
- Motility video analysis was done using Matlab based on methods in literature 54 .
- Otsu's method 55 each frame of the motility video was segmented into a binary image.
- the built-in function regionprops provided the location and shape of each cell.
- the tracking algorithm uses a nearest-neighbor approach that links cells in subsequent frames based on closeness, size similarity, and pixel intensity.
- the velocity was determined from centroid data.
- the program accounts for cells that are stuck for part or the entire duration of the video and cells that are under the influence of background flow.
- the trajectory diagrams in Figure 4c the first 3 seconds of each cell trajectory in the video are shown, translated and plotted at the origin (0,0). Induction of Cell-to-cell Communication
- the bioelectronic relay cells (DJ901 with the plasmid pTT05) and the receiver cells (DJ901 with the plasmid pTT06) were inoculated from overnight cultures at 1.5% in LB and grown in 37 °C with 250 rpm shaking until reaching OD 6 oo 0. 2- 0.5 aerobically.
- the cells were re-suspended in the M9 media at an OD 6 oo of 0.25 and mixed at a 1 : 1 relay to receiver cell ratio before induction.
- Solution-based induction was done as for cells with induced motility above.
- Electrochemical induction was done as above with application of + 0.5 V for various times.
- the DNA region containing the soxR gene and the region between soxR and soxS was amplified from the E.coli MG1655 genome and ligated into the PCR-Blunt II-TOPO plasmid. The fragment was then digested out with the BamHI and Hindlll enzymes and ligated into a similarly-digested pBR322 vector.
- the gene coding for the phiLOV2.1 protein was produced as a gBlock by IDT, with E.coli codons optimized using GenScript from amino acid sequence from Christie et al 43 .
- the pTTOl (phiLOV) and pTT02 (phiLOV-LAA) plasmids were assembled using the Gibson Assembly method 56 (NEB Gibson Assembly Master Mix) by PCR amplifying both the phiLOV sequence (with or without the
- AANDENYALAA (LAA) degradation tag; SEQ ID NO:41)
- AANDENYALAA (LAA) degradation tag; SEQ ID NO:41)
- the A ANDEN Y AD A S (DAS) (SEQ ID NO:42) tag was added to phiLOVby PCR amplifying pTT02, treating the PCR with T4 polynucleotide kinase and ligating with T4 ligase to create plasmid pTT03.
- the plasmid pTT04 was created by PCR- amplifying pTT03 without the soxR coding sequence, treating the PCR with T4
- polynucleotide kinase and ligating with T4 ligase The relevant primers can be found in Table 2.
- the relevant genetic element sequences, including the tags, can be found in Table 3. Construction of pTT05 and pTT06
- the plasmid pTT05 was created from pTTOl by PCR amplification without phiLOV.
- the luxl gene with the LAA tag was amplified from the plasmid pLuxRI2 57 .
- Gibson Assembly Master Mix from NEB was used to assemble the final construct.
- Plasmid pTT06 was created by amplifying pTTOl plasmid without the soxR through PsoxS region, and luxR through luxl (including promoters) out of plasmid pTD103Aiia 58 .
- the Gibson assembly method was used as above.
- the relevant primers can be found in Table 2.
- the relevant genetic element sequences, including the tags, can be found in Table 3. Construction of Motility Plasmid pHWOl
- E. coli W3110 cells were used as the template for amplifying the cheZ and soxR-PsoxS fragments via PCR.
- the primer set BamHI-SoxR-F & SoxS-cheZ-R was used for the amplification of the soxR- PsoxS fragment, while the primer set SoxS-cheZ-F & CheZ- Hindlll-R was utilized for the cheZ fragment.
- the primer SoxS-cheZ- R by our design, was a reverse complementary strand to SoxS-cheZ-F and therefore, both resulting PCR products shared an overlapping fragment.
- the plasmid pT5G was derived from a plasmid previously used for constitutive expression of DSRedExpress2 60,61 First, a redundant Hindlll restriction endonuclease site (AAGCTT) was deleted from plasmid pT5RT7G through plasmid PCR using primers Hindllldel-F and Hindllldel-R. The product was phosphorylated with T4 PNK and re-ligated with T4 ligase. Next, the reporter gene eGFP was amplified using the t5EGFP-F and t5EGFP-R primers.
- AAGCTT Hindlll restriction endonuclease site
- the dsRedExpress2 was excited from the pT5RT7G derivative via EcoRI and Hindlll digestion and eGFP was inserted. Transformation and recovery of the ligation product yielded Top 10 + pT5G cells that constitutively expressed EGFP and thereby fluoresced green.
- the plasmid was transformed into cheZ KO cells (below) with the motility plasmid pHWOl to allow for fluorescent video recording. Construction of Plasmid pTGl
- the E.coli K-12 genomic region that constitutes the soxR protein and the divergent overlapping T*soxR and T*soxS promoters was inserted into a pCR-Bluntll-TOPO plasmid (Thermo Fisher Scientific). This construct and the plasmid pFZYl were digested with BamHI and Hindlll and ligated such that the lacZ gene in pFZYl was downstream of the PsoxS promoter. pTGl allowed for SoxR-mediated expression of ⁇ -galactosidase.
- the transformed cells were grown and selected on LB-agar plates which contained 50 ⁇ g ml A -l ampicillin at 30 °C. A positive colony was picked and inoculated into in 50 ml LB medium which contained 50 ⁇ g ml A -l ampicillin and 1 mM L- arabinose . The cells were cultivated at 30 °C 250 rpm shaking to an OD 6 oo -0.3 and electro- competent cells were freshly prepared and kept on ice until the next transformation of a kan resistance cassette.
- kanamycin resistance cassette To synthesize the kanamycin resistance cassette, we conducted a PCR using the primer set (cheZ-KO-PlF & cheZ-KO-P2R) and the plasmid pKD4 (GenBank Accession: AY048743.1) as the template.
- the resulting PCR product of the kanamycin cassette flanked by FLP recognition target sites was produced and gel-purified for subsequent transformation into pKD46 carrying W3110 electro-competent cells abovementioned.
- 300-500 ng of the kanamycin cassette product was introduced into 50 ⁇ of competent cells by electroporation followed by the incubation with 500 ⁇ SOC medium and 1 mM L-arabinose at 37 °C 250 rpm shaking for 2 hrs. Cells were grown overnight on an LB-agar plate containing 30 ⁇ g ml A -l
- Kanamycin for screening the recombinants We further isolated colonies from the kanamycin plate and conducted PCR verification for cheZ deletion (cheZ seq-PlF & cheZ_seq-P2R) and kanamycin cassette insertion (primer set l :cheZ-upstream & Kt; primer set 2: k2 & cheZ- downstream). Isolated cells were also inoculated in LB medium supplemented with 50 ⁇ g ml A -l ampicillin for checking the curing of pKD46 plasmid.
- the removal of the kanamycin resistance cassette from the isolated clones was also implemented by the electro- transformation and temperature upshift induction of the 707-FLPe plasmid.
- temperature shifting 30 °C to 37 °C
- cheZ mutant cells carrying 707-FLPe plasmid expressed FLPe recombinase and then triggered FLP-mediated excision of the FRT -flanked kanamycin resistance cassette.
- the cells were plated and grown on LB-agar plates.
- DNA was extracted from cells using either a Qiagen (Hilden, Germany) or a Zymo Research (Irvine, CA) Miniprep kit according to manufacturer' s instructions. Polymerase chain reaction (PCR) was used to amplify genes or DNA of interest using Q5 DNA
- NEB Polymerase
- NEB restriction enzymes such as BamHI and Hindlll were used to generate restriction digests of desired PCR products or plasmids.
- Agarose gel electrophoresis was used to separate DNA fragments based on size and the gel bands (as visualized with SYBR Safe, Invitrogen) as well as DNA sequencing by Genewiz was used to verify the constructs.
- Digested fragments were ligated using either NEB Quick Ligase or NEB T4 Ligase. Gibson Assembly was performed with NEB' s Gibson Master Mix according to manufacturer' s instructions.
- Electro- or chemically- competent cells (either from NEB, Invitrogen (Carlsbad, CA), electrocompetent, or made with Zymo Research' s Z- Competent E. coli Transformation Kit) were used fortransformation.
- the Miller Assay was performed on ZK126 cells with the pTGl plasmid expressing ⁇ - galactosidase according to standard protocols. Miller assay was performed according to standard protocols 63 . Briefly, cells were lysed with chloroform and sodium dodecyl sulfate (SDS) to release ?-gal. The substrate ONPG was added and cleaved by ?-gal into a yellow molecule, o- nitrophenol. Absorbance at 600 nm, 550nm, and 420 nm was quantified by a SpectraMax M2 plate reader. The OD at 600nm was measured from 250 ⁇ of cells and the ODs at 420 nm and 550 nm were measured from 200 ⁇ of cells.
- PI Propidium Iodide
- Glucose was determined by the YSI 2700 SELECT Biochemistry Analyzer (YSI Life Sciences, Yellow Springs, Ohio). Acetate was determined by HPLC, Hewlett Packard 1100 Series using an Aminex ® resin-based HPX-87H column (Bio-Rad, Hercules, CA). The analysis conditions were as follows: wavelength 210 nm, mobile phase 0.008 N H2SO4, flow rate 0.6 mL per min, temp 35 °C, calibration was done using organic acid analysis standard (Bio-Rad, Hercules, CA). qPCR Analysis
- RNAlater RNAlater
- BSA bovine serum albumin
- W3110 cheZ ' lysate is prepared by growing a volume (50 mL) of the cells overnight, pelleting the next day, re-suspending in 40 % the volume (20 mL) of TBST with 100 ⁇ Triton X-100 (Bio-Rad, Hercules, CA), sonicating for 30 min or until lysate is colored and remaining pellet is small. After rinsing the membrane in TBST, the blot is incubated with the primary antibody mixture for 90 min. The membrane is thoroughly rinsed again, and incubated for 60 min with an HRP-conjugated secondary antibody (Sigma, St. Louis, MO) diluted 1 :4000 in TBST with 3 % BSA.
- HRP-conjugated secondary antibody Sigma, St. Louis, MO
- the blot was imaged using a chemiluminescence detection system (ECL; Pierce, Rockford, IL) according to manufacturer's instructions, and developed using Hyperfilm (GE Healthcare, Waukesha, WI).
- Figure 19 shows molecular size markers and un-cropped blots.
- Escherichia coli Escherichia coli, Klebsiella pneumoniae, and Zymomonas mobilis. Bioresour.
- the DNA region containing the soxR gene and the PsoxS promoter was amplified from the E.coli MG1655 genome and ligated into the PCR-Blunt II-TOPO plasmid. The fragment was then digested out with the BamHI and Hindlll enzymes and ligated into a similarly-digested pBR322 vector.
- the gene coding for the phiLOV2.1 protein was produced as a gBlock by IDT, with E.coli codons optimized using GenScript from amino acid sequence from Christie et al
- the pTTOl (phiLOV) and pTT02 (phiLOV-LAA) plasmids were assembled using the Gibson Assembly method ⁇ (with NEB Gibson Assembly Master Mix) by PCR amplifying both the phiLO V sequence (with or without the AANDENYALAA (LAA) degradation tag) (SEQ ID NO:41) and the pBR322-soxR-PsoxS constructs with overlaps.
- the AANDENYADAS (DAS) tag (SEQ ID NO:42) was added to phiLOVby PCR amplifying pTT02, treating the PCR with T4 polynucleotide kinase and ligating with T4 ligase to create plasmid pTT03.
- the plasmid pTT04 was created by PCR- amplifying pTT03 without the soxR coding sequence, treating the PCR with T4 polynucleotide kinase and ligating with T4 ligase.
- the relevant primers can be found in Table 2.
- the relevant genetic element sequences, including the tags, can be found in Table 3.
- the plasmid pTT05 was created from pTTOl by PCR amplification without phiLOV.
- the luxl gene with the LAA tag was amplified from the plasmid pLuxRLzA Gibson Assembly Master Mix from NEB was used to assemble the final construct.
- Plasmid pTT06 was created by amplifying pTTOl plasmid without the soxR-PsoxS region, and luxR-luxI (including promoters) out of plasmid pTD103 Aiia ⁇ .
- the Gibson assembly method was used as above.
- the relevant primers can be found in Table 2.
- the relevant genetic element sequences, including the tags, can be found in Table 3.
- E. coli W3110 cells were used as the template for amplifying the cheZ and soxR- PsoxS fragments via PCR.
- the primer set BamHI-SoxR-F & SoxS-cheZ-R was used for the amplification of the soxR- PsoxS fragment, while the primer set SoxS-cheZ-F & CheZ- Hindlll-R was utilized for the cheZ fragment.
- the primer SoxS-cheZ- R by our design, was a reverse complementary strand to SoxS-cheZ-F and therefore, both resulting PCR products shared an overlapping fragment.
- the plasmid pT5G was derived from a plasmid previously used for constitutive expression of DSRedExpress2 First, a redundant Hindlll restriction endonuclease site (AAGCTT) was deleted from plasmid pT5RT7G through plasmid PCR using primers Hindllldel-F and Hindllldel-R. The product was phosphorylated with T4 PNK and re-ligated with T4 ligase. Next, the reporter gene eGFP was amplified using the t5EGFP-F and t5EGFP-R primers.
- AAGCTT Hindlll restriction endonuclease site
- the dsRedExpress2 was excited from the pT5RT7G derivative via EcoRI and Hindlll digestion and eGFP was inserted. Transformation and recovery of the ligation product yielded Top 10 + pT5G cells that constitutively expressed EGFP and thereby fluoresced green.
- the plasmid was transformed into cheZ KO cells (below) with the motility plasmid pHWOl to allow for fluorescent video recording.
- the E.coli K-12 genomic region that constitutes the soxR protein and the divergent overlapping soxR/PsoxS promoters was inserted into a pCR-Bluntll-TOPO plasmid (Thermo Fisher Scientific). This construct and the plasmid pFZYl were digested with BamHI and Hindlll and ligated such that the lacZ gene in pFZYl was downstream of the PsoxS promoter. pTGl allowed for SoxR-mediated expression of ⁇ -galactosidase.
- the transformed cells were grown and selected on LB-agar plates which contained 50 ⁇ g/ml ampicillin at 30 °C. A positive colony was picked and inoculated into in 50 ml LB medium which contained 50 ⁇ g/ml ampicillin and 1 mM L- arabinose ⁇ . The cells were cultivated at 30 °C 250 rpm shaking to an OD600 -0.3 and electro- competent cells were freshly prepared and kept on ice until the next
- the resulting PCR product of the kanamycin cassette flanked by FLP recognition target sites was produced and gel-purified for subsequent transformation into pKD46 carrying W3110 electro-competent cells abovementioned.
- 300-500 ng of the kanamycin cassette product was introduced into 50 ⁇ of competent cells by electroporation followed by the incubation with 500 ⁇ SOC medium and 1 mM L-arabinose at 37 °C 250 rpm shaking for 2 hrs. Cells were grown overnight on an LB-agar plate containing 30 ⁇ g/ml Kanamycin for screening the recombinants.
- DNA was extracted from cells using either a Qiagen (Hilden, Germany) or a Zymo Research (Irvine, CA) Miniprep kit according to manufacturer's instructions. Polymerase chain reaction (PCR) was used to amplify genes or DNA of interest using Q5 DNA
- NEB Polymerase
- NEB restriction enzymes such as BamHI and Hindlll were used to generate restriction digests of desired PCR products or plasmids.
- Agarose gel electrophoresis was used to separate DNA fragments based on size and the gel bands (as visualized with SYBR Safe, Invitrogen) as well as DNA sequencing by Genewiz was used to verify the constructs.
- Digested fragments were ligated using either NEB Quick Ligase or NEB T4 Ligase. Gibson Assembly was performed with NEB's Gibson Master Mix according to manufacturer's instructions.
- Electro- or chemically- competent cells either from NEB, Invitrogen (Carlsbad, CA), electrocompetent, or made with Zymo Research's Z- Competent E. coli Transformation Kit) were used fortransformation.
- the Miller Assay was performed on ZK126 cells with the pTGl plasmid expressing ⁇ - galactosidase according to standard protocols. Miller assay was performed according to
- PI Propidium Iodide
- Glucose was determined by the YSI 2700 SELECT Biochemistry Analyzer (YSI Life).
- RNAlater (Ambion, Austin, TX) at 4 °C overnight. Before RNA isolation, cells were pelleted to remove RNAlater. RNA was isolated using the TRIzol Max Bacterial RNA Isolation Kit (Ambion, Austin, TX) according to manufacturer's protocol, followed by treatment of 50 ng of total RNA with DNase I (Sigma, St. Louis, MO). qPCR was performed using SensiFAST SYBR Hi-ROX One-Step Kit (Bioline, Taunton, MA) with approximately 5 ng of total RNA per reaction using the primers in Table 4. Each sample was performed in triplicate (technical replicate). Outlying data was removed. 16s rRNA was used as the endogenous housekeeping gene. Data was analyzed using the ⁇ method, with the Ct threshold set automatically by the Applied Biosy stems 7300 Real-Time PCR System for all samples.
- BSA bovine serum albumin
- W3110 cheZ- lysate is prepared by growing a volume (50 mL) of the cells overnight, pelleting the next day, re-suspending in 40 % the volume (20 mL) of TBST with 100 ⁇ Triton X-100 (Bio-Rad, Hercules, CA), sonicating for 30 min or until lysate is colored and remaining pellet is small. After rinsing the membrane in TBST, the blot is incubated with the primary antibody mixture for 90 min. The membrane is thoroughly rinsed again, and incubated for 60 min with an HRP-conjugated secondary antibody (Sigma, St. Louis, MO) diluted 1 :4000 in TBST with 3 % BSA. The blot was imaged using a chemiluminescence detection system (ECL; Pierce, Rockford, IL) according to manufacturer's instructions, and developed using Hyperfilm (GE Healthcare, Waukesha, WI).
- ECL chemiluminescence detection system
- Hindllldel-R TAATGCGGTAGTTTATCACAGTTAAATTGCTAACGCAG TCAGG (SEQ ID NO: 38)
- t5EGFP-F TACACAAGAATTCATTAAAGAGGAGAAATTAACCATGGTG
- embodiments are based on coupling Pyo-driven SoxR activation 31,35 with electronic control of Fcn(0/R) redox form 18 ' 41 42 .
- This integration allows opening a new communication pathway and development of a novel framework to connect electronic signals to gene expression.
- the disclosure thus includes robust evidence and characterization of a
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Emergency Medicine (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Provided are electrogenetic methods, devices and systems that use redox biomolecules to carry electronic information to engineered bacterial cells in order to control transcription from a synthetic gene circuit. A method includes providing electrical stimulation to one or more living cells, the cells comprising a promoter operably linked to a DNA segment, wherein the promoter is controllable by reversible redox dependent activation, whereby redox dependent activation and transcription of the DNA segment occurs. The promoter, the DNA segment, or both may be heterologous to the cell. The methods, devices and systems use single cell organisms, and can be prokaryotic or eukaryotic organisms. The DNA segment that is transcribed can encode a biologically active RNA polynucleotide that does not encode a protein, or it can encode a protein, which may or may not be secreted. Methods include modulating the electrical stimulation such that the redox dependent activation and transcription of the DNA transcription is altered. Methods and devices include supplying an electron acceptor to the cells, which results in a change in transcription, such as an increase in transcription. The electrical stimulation can change in response to a signal, such as the presence and/or amount of a biological molecule. Devices can be biologic-based sensors that contain living cells that are maintained in a housing capable of sustaining the cells. The devices are configured to provide electrical stimulation to the cells, and to change the electrical stimulation in response to signals. The devices can be implantable or wearable. Also provided is a system that contains a biologic-based sensor that includes a processor running software configured to adjust the electrical stimulation based on communication with a sensing component.
Description
COMPOSITIONS AND METHODS FOR ELECTRONIC CONTROL OF GENE
EXPRESSION
CROSS REFERENCE TO RELATED APPLICATIONS
This application claims priority to US provisional 62/431,291 filed December 7, 2016, the disclosure of which is incorporated herein by reference.
GOVERNMENT FUNDING
This invention was made with government support under HDTRA11310037 awarded by the Defense Threat Reduction Agency and CBET1160005 awarded by the National Science Foundation. The government has certain rights in the invention.
FIELD
This disclosure generally relates to compositions, methods, devices and systems for reversible redox control of gene expression.
BACKGROUND
The exchange of information between electrons and ions has been a mainstay in a variety of biochemical applications for decades. Small molecules, however, represent a much wider repertoire for biological information transfer, or molecular communication. Gaining the ability to measure, disrupt, or enhance these biomolecular signals would allow for
development of advanced technologies to study and manipulate the biological environment. Specifically, molecular connectivity with electronics can benefit from the fact that electrochemical detection is sensitive, selective, cost-efficient, and label-free in small volumes1"3. Such connectivity presents a unique opportunity to apply knowledge of and control over electronic-device form and function to study biological systems4, improve biosensors2 5, and create wearable and implantable bio-hybrid devices6"8.
Redox biomolecules play significant roles in a wide array of cellular functions, and present a tool for electronically interceding with both native cell pathways and redox- sensitive engineered constructs9"11. Bioelectrochemical technologies such as microbial fuel cells (MFC) and bioelectrosynthesis systems (BES) use electrochemical techniques to interact with cellular redox processes and electron transport mechanisms to change or measure cellular behaviors. Literature exists on MFCs, where microbial communities metabolize
organic compounds, resulting in production of electricity . Conversely, BESs aim to electrochemically intercede with microbial metabolism for the production of various compounds of interest15 16. Electronic interrogation of biological systems with redox molecules has allowed for detection of changes in cell metabolic activity17"19, redox state20"22, toxicity23, and other parameters4 . Cells have been engineered for enhanced electron flow24'25 and to allow for electronic detection of engineered cell activity26'27. Electronic signals translated through redox molecules also show controlled glucose consumption28 and regulation of enzymatic activity29. The use of the abovementioned and other
bioelectrochemical methods will continue to have impactful applications in fields such as bioenergy, biotechnology, biosensing, and biocomputing30.
However, while the accomplishments above are notable, they are limited in their cellular effects to those that are naturally responsive to changes in electron transfer or redox status. There is accordingly an ongoing and unmet need for improved methods for engineered cells that are responsive to engineered controllable and reversible changes in redox status. The present disclosure is pertinent to this need.
SUMMARY
The present disclosure provides in certain embodiments electrogenetic methods, devices and systems that use redox biomolecules to carry electronic information to engineered bacterial cells in order to control transcription from a synthetic gene circuit.
In a non-limiting implementation of the approach, electronic actuation of the native transcriptional regulator SoxR and transcription from the T>soxS promoter allows cell response that is quick, reversible, and dependent on the amplitude and frequency of the imposed electronic signals. Further, induction of bacterial motility and population based cell- to-cell communication demonstrates the versatility of the approach and capacity to drive intricate biological behaviors.
In certain embodiments, the disclosure provides a method comprising providing electrical stimulation to one or more living cells, the cells comprising a promoter operably linked to a DNA segment, wherein the promoter is controllable by reversible redox dependent activation. At least in part as a consequence of the electrical stimulation, redox dependent activation and transcription of the DNA segment occurs. In certain embodiments the promoter, the DNA segment, or both are heterologous to the cell. In embodiments, the cells are single cell organisms, and can be prokaryotic or eukaryotic organisms.
In certain embodiments, the DNA segment that is transcribed encodes a biologically active RNA polynucleotide that does not encode a protein. In another embodiment the DNA segment encodes a protein, which may be heterologous to the cell. In embodiments the protein is secreted, and may exert a biological effect on other cells, which can include cells that are not exposed to the electrical stimulation.
In embodiments, a method comprises modulating the electrical stimulation such that the redox dependent activation and transcription of the DNA transcription is altered. Altering the electrical stimulation can comprise increasing or decreasing the intensity, frequency, etc., of the electrical stimulation, and can comprise stopping the electrical stimulation such that the transcription is reduced or stopped. In embodiments, the disclosure includes supplying the cells with an electron acceptor. Supplying the electron acceptor to the cells results in a change in transcription, such as an increase in transcription. In certain implementations supplying an electron acceptor to the cells results in a change of transcription relative to a control value for transcription in the absence of the electron acceptor, and can comprise an increase in transcription relative to a control value.
In embodiments, the electrical stimulation is configured to change in response to a signal, such as the presence and/or amount of a biological molecule. In certain aspects, the disclosure includes a device or other apparatus that comprises an electrical stimulation component that changes the electrical stimulation in response to a signal. In embodiments, the device is a wearable or implantable device.
In an aspect, the disclosure includes a biologic-based sensor comprising living cells as described above, wherein the cells are maintained in a housing capable of sustaining the cells. The housing includes at least one port through which liquids and biological molecules can pass, and also includes an electrical stimulation component that can provide electrical stimulation to the cells. The sensor can further include a power source for operating the electrical stimulation component. The device can be in communication with a sensing component that can sense the presence, absence and/or amount of a biological indicator, which can be any biological indicator, non-limiting examples of which include a protein, a peptide, a carbohydrate, a lipid, a cytokine, a drug, a toxin, an indicator of a pathogen, ionizing radiation, or a combination thereof. In an embodiment, a biologic-based sensor includes a sensing component that is configured to sense for example glucose or insulin, and may also be configured to adjust the electrical stimulation based on communication with the sensing component. In certain examples, a device of this disclosure includes a reservoir
component that contains an electron acceptor that is in fluid communication with the cells in the device, such that the electron acceptor can be provided to the cells.
In another aspect, the disclosure includes a system comprising a biologic-based sensor as further described herein, further comprising a processor running software configured to adjust the electrical stimulation based on communication with a sensing component.
BRIEF DESCRIPTION OF FIGURES
Figure 1: Electrogenetic device scheme, (a) Device-mediated electronic input consists of applied potential (step functions) for controlling the oxidation state of redox- mediators (transduced input). Redox mediators intersect with cells to actuate transcription and, depending on actuated gene-of-interest, control biological output, (b) The electrogenetic device consists of the region encompassing the gene coding for the SoxR protein and the divergent overlapping VsoxRfPsoxS promoters. A gene of interest is placed downstream of the T>soxS promoter. Pyo (O) initiates gene induction and Fcn(R/0), through interactions with respiratory machinery, allows electronic control of induction level. Fen (R/O),
ferro/ferri cyanide; Pyo, pyocyanin. The oxidation state of both redox mediators is
colorimetrically indicated (Fen (O) is light grey pentagon; Fen (R) is white pentagon; Pyo (O) is dark grey hexagon; Pyo (R) is medium grey hexagon). Encircled 'e~' and arrows indicate electron movement.
Figure 2: Electronic control of cell fluorescence, (a) Schematic of electrogenetic device induction of the phiLOV fluorescent protein. soxR and T*soxR omitted from schematic, but present, (b) Charge and average cell fluorescence resulting from applying the indicated potentials with Fen (R) and Pyo. Grey cyclic voltammogram shows reduction (R) and oxidation (O) peaks of Fen (R/O). Arrows indicate oxidizing (+0.5 V) and reducing (-0.3 V) potentials, (c) Cell fluorescence resulting from applied potential in the presence of indicated mediators. From left to right in each group of three bars, each bar corresponds to no potential, +0.5 V, and -0.3 V, respectively, (d) Heat map showing cell fluorescence over time of samples induced with the indicated charges. Left panel indicates graphic representation of charge (area of shaded grey) increasing with application length of time of oxidizing potential (+0.5 V). (e) Overlay of cell fluorescence (averages over 4 h) from b,d and Figure 15 plotted against the applied charge. Error bars in c indicate s.d. of biological triplicates. Fen (R/O), ferro/ferricyanide; Pyo, pyocyanin; V, Volts; C, Coulombs.
Figure 3: Electronic control of On/Off of fluorescence, (a) Schematic of dynamic experiments with electronic signals to increase ('ON') or decrease ('OFF') fluorescence, (b)
Fluorescence of cells from an extended culture cycled 'ON' and 'OFF' by potential applied in upper panel (signal; light grey— 'ON' and dark grey— 'OFF'). Charge is indicated in middle panel, with axis ranges: 'ON' is 0 to -2 C; 'OFF' is -2 to 0 C. (c) Cell fluorescence after 'ON'/'OFF' cycles with the indicated durations. 'ON' potential applied at start and 'OFF' after ½ cycle measurement is taken. From left to right in each group of six bars, each bar corresponds to 0, 15, 30, 45, 60, and 90, respectively, (d) Linearity between protein synthesis and charge. The value 'Integrated protein synthesis' represents the calculated accumulation of phiLOV fluorescence in the absence of degradation using the Matlab model. Error bars indicate s.d. of biological triplicates.
Figure 4: Electronic induction of cell motility, (a) Schematic of CheZ induction, which stimulates swimming. soxR and T*soxR omitted from schematic, but present, (b) CheZ levels in response to added mediators or electronic induction with Pyo and Fen (R). NT, no treatment. Samples were processed in parallel. Uncropped blots in Figure 18. (c) Two- dimensional recapitulation of 3 s cell trajectories in treated samples as indicated. Samples electronically induced were provided +0.5 V with Pyo and Fen (R) until indicated charge was obtained, (d) Cell swimming velocities. Error bars indicate s.e.m. WT are W31 10 cells, CheZ KO are isogenic W31 10 cheZ~, inducible cells are W31 10 cheZ~ cells transformed with pHWOl . indicates O.OOOl as analyzed by Student' s t-test against the Pyo+Fcn (R) control (two-tailed). Sample numbers for velocities, starting with WT: 79, 1 17, 157, 100, 87, 200, 264, 903, 509, 786, 712. In b,c and d the -0.009 C sample indicates 15 min +0.5 V
application with no mediators.
Figure 5: Electronic control of cell-to-cell communication, (a) Schematic of electronic control of cell-to-cell communication. Electronic signals modulating Pyo and Fen (R) to Fen (O) result in Luxl-laa and AHL production from relay cells. soxR and T*soxR omitted from schematic, but present in relay cells. The receiver cells produce LuxR. When LuxR detects AHL, phiLOV is induced from the luxl promoter, (b) Average fluorescence of biosensor cells within co-cultures in which relay cells are electronically induced with the indicated charges, (c) Flow cytometry histograms showing the emergence of a fluorescent receiver-cell population at the indicated time points after induction.
Figure 6. Redox mediator structures: a. The chemical structure of pyocyanin.
b.The chemical structure of ferricyanide
Figure 7. Response of cells with intact soxRS : (a) phiLOV fluorescence of GC4468 or DJ901 (GC4468 AsoxRS) cells induced anaerobically with the indicated pyocyanin concentrations for 1 hour. From left to right in each group of two bars, each bar corresponds
to DJ901 and GC4468, respectively, (b) Miller Units resulting from pyocyanin (2.5 μΜ) and femcyanide (concentrations indicated) treatment of ZK126 cells with the pTGl plasmid anaerobically for 1 hour. Pyocyanin-only control was 153 MU. Error bars indicate s.d. of biological duplicates.
Figure 8. Plasmid maps: Maps of the pBR322-based plasmids that were used in this disclosure. ssRA tag denotes either the LAA or DAS tag.
Figure 9. Mediator effects on induction from PsoxS promoter: (a) Fluorescent protein induction due to pyocyanin with or without the addition of ferricyanide. From left to right in each group of two bars, each bar is Pyo (μΜ) + 5 mM Fen (O) and Pyo only, respectively, (b) Fluorescent protein induction due to varying concentrations of ferricyanide or ferrocyanide added with or without 5 μΜ pyocyanin. The first ten bars are Pyo + ferricyanide, the second three are Pyo + ferrocyanide, the next four bars are ferricyanide only, and the remaining bars are ferrocyanide. (c) Fluorescent protein induction time profile with the same pyocyanin but different ferricyanide amounts. Error bars indicate s.d. of biological triplicates. From left to right in each group of five bars, each bar corresponds to 0, 0.5, 2, 4, and 10, respectively.
Figure 10. Induction of fluorescence in aerobic conditions: Cell fluorescence measured after induction with different concentrations of pyocyanin with or without 5 mM ferricyanide (Fen (O)) in aerobic conditions. Cultures were either aerated (250 rpm) or non- aerated (stationary). Error bars represent s.d. of biological duplicates. From left to right in each group of four bars, each bar corresponds to aerated Pyo, Aerated Pyo + 5 mM Fen (O), non-aerated Pyo, and non-aerated Pyo + 5 mM Fen, respectively.
Figure 11. Metabolic effects and propidium iodide analysis: (a) Glucose consumed (normalized to initial measurement) plotted vs. the acetate produced for DJ901 cells with or without the pTT03 plasmid treated with the indicated mediators. Lighter and darker shaded regions represent 95% confidence intervals for related trendlines, respectively, (b) The percent of DJ901 pTT03 cells stained with propidium iodide, indicating dead cells. Error bars show s.d. of biological triplicates. From left to right in each group of twelve bars, each bar corresponds to no treatment, 5 μΜ Pyo, 50 μΜ Pyo, 5 mM Fen (R), 50 mM Fen (R), 5 mM Fen (O), 50 mM Fen (O), 5 μΜ Pyo 5 mM Fen (R), 5 μΜ Pyo 5 mM Fen (O), 5 μΜ Pyo 50 mM Fen (R), 5 μΜ Pyo 50 mM Fen (O), and heat killed, respectively.
Figure 12. Cell reduction of ferricyanide: (a) Scheme of spectrophotometric and electrochemical methods for measuring ferricyanide reduction by cells, (b) Absorbance at 420 nm correlates with ferricyanide concentration, (c) Reduction of different ferricyanide
concentrations by cells results in absorbance decrease (measured at 420 nm, starting cell OD600 of 2.0) over time, (d) Oxidation of ferrocyanide shows more negative current (measuring ferrocyanide) when ferricyanide is reduced by cells, (e) Reduction of
ferricyanide, as measured by absorbance, is higher with higher cell amounts.
Figure 13. Effect of alternate redox mediators on cell response: (a) Schematic of potential mechanism of ferricyanide-based pyocyanin-driven gene induction amplification from the T>soxS promoter, (b) Fluorescence of cells after 1.5 hours, producing the phiLOV protein in response to 5 μΜ added pyocyanin and the indicated concentrations of either nitrate or nitrite. 5 μΜ Na Myolobdate was added to all samples. From left to right in each group of two bars, each bar corresponds to nitrite and nitrate, respectively, (c) Cell fluorescence over time in response to addition of PMS with or without Fen (O). From left to right in each group of four bars, each bar corresponds to no treatment, 5 μΜ PMS, 5 μΜ PMS + 1 mM Fen (O), and 5 μΜ PMS + 5 mM Fen (O), respectively, (d) Electronic control of cell fluorescence with charge with 5 mM Fen (R) and 5 μΜ PMS. (e) Fluorescence of DJ901 cells with or without the soxR gene on the plasmid in addition to the T>soxS promoter and phiLOV gene induced with the indicated mediators. Error bars indicate standard deviation of biological duplicates in c and triplicates in e. From left to right in each group of two bars, each bar corresponds to SoxR + and SoxR -, respectively. R^ indicates Spearman correlation coefficient for monotonic correlation.
Figure 14. Electrochemical bulk electrolysis setup: (a) An electrochemical analyzer is connected to a computer and three electrodes - gold (Au) working and counter electrodes and an Ag/ AgCl reference electrode. The working and counter electrodes are separated by two agar salt bridges, (b) Photographs of setup used for bulk electrolysis and in situ electrochemical cell induction. Liquid level indicates 3 mL of solution.
Figure 15. Electrochemical ferro/ferricyanide redox-state interconversion: (a)
Sample cyclic voltammograms of 0.5 mM ferri/ferrocyanide indicating the reduction (R) and oxidation (O) peaks. Biotic sample included cells at OD600 at 0.25. (b) Current and charge over time of bulk oxidation of 5 mM Fen (R). (c) Current and charge over time of bulk reduction of 5 mM Fen (O). (d) Absorbance change with charge as Fen (R) is oxidized (+0.5 V) or Fen (O) is reduced (-0.3 V). (e) Multiple cycles of oxidation/reduction on the same solution and corresponding changes in absorbance over time.
Figure 16. Cell fluorescence due to varying voltages: Heatmap depicting cell fluorescence over time in response to application of various voltages (from Figure 2 b) for 15 minutes, then continued ceil response and sampling.
Figure 17. Ferricyanide and ferrocyanide control of protein levels: (a) Schematic of experiments in (c) and (d) where cells are first induced with pyocyanin and Fen (O) for a ½ cycle duration ("ON"), then spun down and re-suspended in pyocyanin with Fen (R) ("OFF"), (b) Cell fluorescence degradation of phiLOV with the DAS tag or phiLOV without a tag. Time is after re-suspension in fresh media, (c) Repeated "ON"/" OFF" cycles show that cells continue to respond overtime. From left to right in each group of two bars, each bar corresponds to OFF and On/Off cycles, respectively, (d) A single "ON"/" OFF" cycle of various half-cycle lengths shows cell response time to changing Fcn(O) to Fcn(R). Error bars indicate standard deviation of biological triplicates. From left to right in each group of six bars, each bar corresponds to 15 min, 30 min, 45 min, 60 min, 90 min, and 0 min, respectively.
Figure 18. Model results. Line indicates integrated rate (from model). Circles with line represents experimental data.
Figure 19. CheZ controls Western blots: (a) Western blots of the CheZ protein of WT and CheZ KO cells treated with the indicated mediators. Pyocyanin was 5 μΜ and Fen (O) was 5 mM. (b) Ladder used for CheZ size determination, which is about 24 kDa. (c) Western blot as seen in Figure 4 b, uncropped. Fen (O), when not indicated, was at 5 mM. Pyocyanin was 5 μΜ. Charges applied as indicated in Methods. NT indicates no treatment.
Figure 20. Cell velocities: Cell velocities of various cells treated with the mediators in the indicated concentrations. Error bars represent standard error of 50 - 800 separate cell trajectories per sample.
Figure 21. AHL solution-based induction: (a) Fluorescence of either the reporter cells only or co-culture of reporter and relay cells in response to the indicated mediators. From left to right in each group of two bars, each bar corresponds biosensor cells only and co-culture relay + biosensor cells, respectively, (b) Fluorescence over time of reporter cells in co-cultures induced with the indicated charges, (c) Fluorescence of the reporter cells when treated with supernatants of the relay cells induced with the indicated charges. Error bars indicate s.d. of biological triplicates.
Figure 22. qPCR analysis of electrochemically-induced cells, (a) Fold change of c eZ upon treatment with indicated inducers and electronic induction, (b) Fold change of luxl upon treatment with indicated inducers and electronic induction, (c) Fold change of phiLOV-DAS upon treatment with indicated inducers and electronic induction - both ON
and OFF. (d) Fold change of soxR upon same treatments (and from the same samples) as in c. Calibrator samples are the "no treatment" samples for each gene of interest. In (a) and (b), three technical replicates were done for one biological sample; in (c) and (d) three technical replicates were done for each of two biological replicates. Error bars plotted in (a) and (b) illustrate the range of fold change in expression based upon one standard deviation above and below the average AACt. In (c) and (d), error bars represent standard deviation of the two biological replicates.
DETAILED DESCRIPTION
Unless defined otherwise herein, all technical and scientific terms used in this disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains.
Every numerical range given throughout this specification includes its upper and lower values, as well as every narrower numerical range that falls within it, as if such narrower numerical ranges were all expressly written herein.
The disclosure includes each and every polynucleotide sequence disclosed herein, the RNA equivalent of every DNA polynucleotide (i.e., where uracil replaces thymine) and every DNA equivalent of every RNA, and the complementary sequence and the reverse
complement of every polynucleotide sequence. The disclosure includes every amino acid sequence, and all polynucleotide sequences encoding the amino acid sequences. Contiguous segments of polynucleotides and polypeptides sequences are also included.
The present disclosure provides new compositions of matter, methods, systems, and devices that link electronic signals, through redox molecules, to control gene expression. It is contemplated that the methods, devices and systems described herein can be tailored to produce a variety of responses, guide various behaviors, and further the use of other electronic28 31 and redox-based systems to access and affect biomolecular information transfer. Embodiments of the disclosure may include MFC and/or BES systems for gene expression based on potential, current, or electron acceptor availability. Further,
embodiments of the disclosure may be used for spatio-temporal control of cells immobilized at or near electrode surfaces, for metabolic engineering applications, gut-on-a-chip systems, and other bio-hybrid devices where precise cellular spatio-temporal control is desirable. Additionally, embodiments of this disclosure offer additional modes (in addition to light, magnetic, and radio) of relaying electronic signals to cells. Such cells can be programmed to respond to an unprecedentedly wide array of biological and non-biological information.
Embodiments of the disclosure additionally provide for electronic interrogation of SoxRS- (or other) specific targets and electron-flow-dependent processes. Thus, and without intending to be constrained by any theory, it is considered that the present description of translating electronic signals to gene expression represents a new way of using redox molecules and electron flow for guiding biological function.
Non-limiting embodiments of the disclosure are illustrated using Escherichia coli, a widely used synthetic biology chassis, and show circuit versatility and quick response times. These demonstrations are distinct from previous approaches31, at least insofar as the redox- dependent control of gene expression demonstrated herein is reversible, tunable, and utilizes redox substrates that are not irreversibly converted to compounds that are terminally committed to a single variant with a confined effect on gene expression.
In one approach, the disclosure provides a method that comprises providing electrical stimulation to one or more living cells. The cells comprise a promoter operably linked to a DNA segment capable of being transcribed, wherein the promoter is controllable by reversible redox dependent activation. In embodiments, the promoter, the DNA segment, or both are heterologous to the cell. By "heterologous" it is meant that the DNA segment and/or the promoter are not ordinarily encoded by the cell, apart from having been engineered to do so. Thus, the DNA segment and/or the promoter can be from a distinct organism, and/or can comprise modifications of endogenous sequences. The electrical stimulation is such that a redox change is caused with the cells, which can include change in the redox status of one or more proteins that can directly or indirectly influence transcription. Thus, upon electrical stimulation and an ensuing change in redox status of the cells, RNA transcription from the promoter is induced, and the degree and/or duration of the transcription can be affected by moderating the electrical stimulation.
The type of RNA that is transcribed is not particularly limited. Thus, an RNA encoded by the DNA segment under redox-controlled transcription as described herein can encode any polynucleotide. In embodiments, the RNA is an mRNA, a tRNA, an RNA aptamer, shRNA, snRNA, an siRNA, a guide or tracr RNA for use in CRISPR based gene editing, or a piRNA. In embodiments, the tRNA is a modified tRNA. Accordingly, in embodiments the RNA can code for protein, or it may not code for protein, or it may have segments that code for protein and other that do not code for protein. In embodiments, the RNA is a spliced or unspliced mRNA. In embodiments, the RNA is any RNA that is involved in RNAi-mediated targeting of a target RNA. Thus, in certain non-limiting embodiments, a microRNA (miRNA) is encoded. In another embodiment, a ribozyme can be encoded. In yet another embodiment,
small interfering RNA (siRNA) can be encoded. In embodiments, an shRNA is encoded. In embodiments, an RNA produced according to the electrogenetically controllable approaches described herein comprises a CRISPR RNA (crRNA) or a guide RNA, such as sgRNA, and thus embodiments of the disclosure provide companion technologies to currently emerging or established gene editing techniques. The RNA can be designed to adopt any particular secondary structure, if desired. In embodiments, the RNA can be any RNA that can form a component of a ribonucleoprotein. The RNA produced according to this invention can have any desired features, including polyadenylation signals, translation initiation sites, transcription and translation termination sites, and can encode amino acid sequences that impart to the encoded protein any useful or otherwise desirable function, including but not limited to cell trafficking signals, degradation signals, secretion signals, nuclear localization signals, and the like. In embodiments, an RNA produced according to this method may be polycistronic, and therefore may include such features as an internal ribosome entry site (IRES) to facilitate the discontinuous translation of more than one polypeptide sequence. A variety of suitable IRES sequences are known in the art and may be used, so long as they are capable of recruiting translation initiation factors to the downstream open reading frame(s) of the mRNA. IRES sequences are normally identical to or are derived from viral sequences. However, other suitable IRES sequences may be obtained from other organisms, including but not limited to mammal, insect, and yeast. Thus, in embodiments, the RNA produced according to this invention can include more than one open reading frame, which may or may not be overlapping. In the case of overlapping reading framed the RNA may contain, for example, signals that facilitate ribosomal frameshifting, including but not necessarily limited to ribosomal slippery sites and the ability to adopt secondary structures, such as pseudoknots.
In embodiments, the RNA is under reversible redox-based control as described herein encodes any desired amino acid sequence, such as any peptide or polypeptide/protein. Those skilled in the art will understand, given the benefit of this disclosure, that there is no particular limit to the length or amino acid constitution of the encoded peptide or
polypeptide/protein.
In certain embodiments, the RNA encodes a peptide or protein that has biological activity. In embodiments, the protein is any of a peptide or protein hormone, a chemokine, a growth factor, a quorum sensing peptide or protein, a protein or peptide that can interfere with quorum sensing, a toxin, an antimicrobial peptide, a protein or peptide that affects cell motility, or cell differentiation, a protein or peptide that has anti-cancer activity, or other therapeutic and/or prophylactic benefits. In embodiments, the cells that are modified
according to the present disclosure can be, for example, resistant to a toxin or other protein or peptide or RNA that the expression of which is reversibly controlled according to the electrogenetic modifications described herein, and thus, the cells may secrete such peptides or proteins to kill other cells within their vicinity, or otherwise in communication with the modified cells, whereas the engineered cells of this disclosure will be resistant to the secreted toxin or other antimicrobial agent. In embodiments, the protein is an antagonist or an agonist of a receptor. In embodiments, the protein is capable of binding an antigen, and thus may comprise an antibody or antigen binding fragment thereof. Sets of proteins can be encoded to produce conventional antibodies, or single chain antibodies or antigen binding fragments thereof can be produced. The antibodies can be of any Ig subtype, and can comprise any combination of complementary determining regions. In embodiments, the protein or peptide can function as a checkpoint inhibitor for tunable immunotherapy purposes. In embodiments, the protein is a neuropeptide. In certain examples, the protein is a clotting factor, or has an anti-clotting function, or has a vasoconstriction function, i.e., angiotensin or a derivative thereof. In embodiments, the protein or peptide comprises antidiuretic hormone, calcitonin, enkephalin, erythropoietin, ghrelin, growth hormone, insulin, insulin-like growth factor, leptin, luteinizing hormone, prolactin, renin, somatostatin, or any other peptide hormone. In embodiments, the protein comprises an antigen for use in stimulating an immune response. In certain implementations the disclosure can be adapted for microbiological biocontainment purposes. In embodiments, the RNA encodes a protein or peptide that can disrupt a biofilm. In embodiments, the protein or peptide or RNA can kill bacterial persister cells, and/or cells that are in a vegetative growth state. In embodiments, the protein or peptide can kill antibiotic resistant bacteria. In embodiments, the RNA encodes a peptide or protein that is a prodrug, which may be converted into its active form by, for example, enzymes that are endogenous to the modified organisms, or via other modifications to the cells such that the prodrug can be converted to its active form once it has been expressed. In embodiments, the protein is a radioprotectant protein, such as flagellin and/or fragments thereof, and/or protects cells from ionizing radiation and/or apoptosis, such as those described in U.S. Patent 8,007,812 and 9, 139,623, the disclosures of which are incorporated herein by reference. Thus, it will be apparent from the present description that the RNA and/or proteins produced under the electrogenetic control scheme of this disclosure can be for virtually any purpose, and in some examples, a method, device and/or system of this disclosure is suitable for prophylaxis and/or therapy of any disease, disorder or other condition. In embodiments, the protein is insulin.
Accordingly, in embodiments a method, device and/or system of this disclosure is suitable for use with diabetic patients.
In embodiments, the encoded protein is a detectable protein. The detectable protein can be secreted, or non-secreted. In embodiments, the disclosure comprises detecting a signal from one or more cells that have been engineered according to this disclosure to express a detectable protein. In embodiments, the detectable protein can be visually detected by eye, and/or via machine-based detection. In embodiments, the detectable protein comprises fluorescent proteins, such as any of green fluorescent protein (GFP), mCherry, etc., and non- fluorescent proteins such as luciferase and beta-galactosidase which produce detectable signals via enzymatic action, and can include but are not limited to other enzymes that produce molecules that have biological activity, such as tyrosinase, Luxl, and LuxS, or pyocyin, microcin S. In embodiments, the RNA encodes a secreted placental alkaline phosphatase (SEAP). The disclosure includes imaging cells that express a detectable protein, including in vitro and in vivo imaging approaches.
In embodiments, a method, device and/or system of this disclosure is associated with an inanimate object or surface, and can thus be used in a wide variety of settings, including but not limited to medical devices, including but not necessarily limited to implantable medical devices, or any other surface wherein influencing the function and/or viability of cells is desirable. In embodiments, the cells are proximal to or are in physical association with a conduit or any other surface that is susceptible to biofilm formation or comprises a biofilm.
The type of cells that are modified according to this disclosure so as to be
electrogenetically controllable are not particularly limited. In embodiments, the cells are single cell organisms. In embodiments, the cells are prokaryotes, including but not necessarily limited to bacteria. In embodiments, the bacteria are Gram positive or Gram negative bacteria. The disclosure includes mixtures of all cell types described herein.
Mixtures of different cell types can be designed such that they express different RNA that are controlled by distinct promoters. Further, any cell described herein can be designed to express distinct RNAs from distinct promoters.
In embodiments, the cells are single celled eukaryotic cells, and thus can comprise any type of yeasts, plant cells, insect cells, and mammalian cells. In embodiments, the cells are present in a tissue or organ, which may be in an organism, or may be maintained ex vivo. In embodiments, the cells are mammalian cells that are totipotent, multipotent, or pluripotent, and thus the RNA, the expression of which is controllable according to this disclosure, may
influence differentiation of the cells, or may help preserve the cells in a fully or partially differentiated state.
The disclosure includes culturing cells modified according to this disclosure, inducing expression of a peptide or protein, and separating the protein from the cells and/or the culture medium.
The disclosure includes systems and devices that can house the cells, such as a housing. Any suitable cell housing that can sustain the cells can be adapted for use in embodiments of this disclosure. In general, the housing will be suitable for supplying the cells with a nutrient source and/or removal of waste products. In embodiments, the housing comprises a chip. In embodiments, a housing/device/system of this disclosure is adapted from known devices, including for example, those described in U.S. Patent Publication nos.
20130045521, 20120041289, the disclosures of which are incorporated herein by reference. In embodiments, the housing comprises a three-dimensional article having at least one port for allowing fluid communication with its environment. In embodiments, a housing component can be adapted or visualizing the cells and/or for detecting a signal produced by the cells. Thus, the device may comprise a translucent component, which may be adapted to function with, for example, a waveguide, and a signal detector, and may further be integrated with other devices, including for example, cameras and microscope devices.
In embodiments, the device comprises a housing in communication with any suitable component for providing electrical stimulation to the cells. In general, the electrical stimulation component comprises a working electrode and a counter electrode, and may include a reference electrode, or other electrodes. In embodiments, the device comprises a potentiostatic component. The electrical component may comprise an anode and a cathode. The electrodes may be coupled to any suitable leads, and to a power source. The power source is not particularly limited, and may comprise a battery that is integrated into the device/housing, or the power source may be connected remotely to the device via, for example, any suitable wiring, leads, etc. A non-limiting embodiment of components for use in providing electrical stimulation is presented in the figures of this disclosure, including for example Figure 14. In embodiments, cells that are subjected to electrical stimulation as described herein are maintained in anaerobic conditions, or hypoxic conditions, or aerobic conditions. The oxygen content in which the cells are maintained is thus controllable, and may include modulating an oxygen gradient.
The electrical stimulation component can be configured to provide alternating current or direct-current and to vary the voltage, frequency, duration, current, initiation or cessation
of the electrical stimulation, such as on a predetermined schedule, or in response to any suitable signal, including but not necessarily limited to biological, electrochemical, electrical, electromagnetic, magnetic, chemical, and mechanical signals. The electrical stimulation is of a form and character such that it can affect the redox state of the cells and/or the protein(s) described herein that can reversibly induce expression of the RNA and/or enhance such expression, but is not lethal to the cells. However, inducing lethality of the cells may be desirable under certain circumstances, and thus the electrical stimulation component can be configured accordingly. In certain embodiments, the voltage applied to the cells is from -1.0 to +1.0 Volts, inclusive, and including all numbers to the first decimal point there between. In embodiments, the current is generally in a milliamp range. Thus, in embodiments, the current does not exceed 1.0 Amp. The duration of the electrical stimulation is variable, and can range from milliseconds to hours, and may extend over a period of days. In embodiments, the electrical stimulation is provided at a minimum of 0.01 V/s. In embodiments, the electrical stimulation may be provided at approximately 1.0-10.0 MHz, inclusive, and including all numbers to the first decimal point there between. The disclosure includes interrupting periods of electrical stimulation for any suitable period.
In embodiments, the signal interpreted by a sensor that is a component of a system or device of this disclosure is a biological signal. Thus, the device may comprise any suitable sensor for detecting any signaling moiety such that the electrical stimulation can be initiated, stopped, or altered in response to the presence, absence or amount of the signal. In embodiments, the sensor comprises a biological sensor, such as a cell surface molecule that can produce a detectable signal when bound by a ligand. In embodiments, the sensor comprise an electronic sensor. In embodiments, a sensor comprises a transducer or detector element that may function in a physicochemical way, which can include but is not limited to optical, piezoelectric, and electrochemical functions. In embodiments, the sensor comprises a biochip.
The electrical stimulation component and/or the signaling component and/or the sensing component can be connected to a computer and/or microprocessor such that the electrical stimulation is altered in response to the signal, such as by running software which may be customized for any particular use and to cause any desirable change in the electrical stimulation provided to the cells. Systems comprising such computers and/or microprocessors in communication with a device and/or the modified cells of this disclosure are included within its scope. In embodiments, a device and/or system of this disclosure is configured to be capable of WiFi or Bluetooth communication with another component that can, for
example, control the electrical stimulation, and/or interpret signals that signify a need to change the electrical stimulation. In embodiments, information obtained by the device can be monitored in real-time by a computer, and/or by a human operator. In certain embodiments, the disclosure provides as an embodiment or component of the system a non-transitory computer readable storage media for use in performing an algorithm to control electrical stimulation, and/or for monitoring and/or recording electrical stimulation events. In certain embodiments, a device of this disclosure comprises microprocessor wherein the
microprocessor is a component of an Arduino board, and wherein the device further comprises a suitable Arduino WiFi shield. In embodiments, a device and/or system of this disclosure comprises a continuous glucose monitor. In embodiments, a device of this disclosure is provided as an implantable device, or is integrated into a wearable garment or a wearable device, including but not necessarily limited to WiFi and/or Bluetooth enabled watches or other wrist-worn devices. In embodiments, the disclosure includes ingestible devices such as pill-based devices which may or may not include camera components, and drug delivery devices which may include pumps, such as a glucose or insulin pump, and thus may further comprise tubing as part of an infusion set that also includes a catheter and an insulin reservoir.
The promoters that are operably linked to the DNA sequence encoding any RNA of this disclosure can comprise any promoter that is responsive to the redox state of any cellular component, particularly proteins that can participate in initiating, modulating, or inhibiting transcription. Certain and non-limiting embodiments of the sequences of such promoters are provided in Table 5. In non-limiting examples, the promoter comprises a SoxS promoter, or an OxyS promoter.
In embodiments, a method, device and/or system of this disclosure involves supplementing the modified cells with an electron acceptor. As will be apparent from the
Examples provided herein, the presence of an electron acceptor can enhance expression of the RNA that is in communication with the promoter. It is expected that any electron acceptor can be used, non-limiting examples of which include Ferricyanide/ferrocyanide (FCN) and Nitrate/ni trite. Non-limiting embodiments of nucleotide sequences encoding examples of electron acceptors are provided in Table 5. In certain embodiments, fumarate, oxygen, and/or Dimethyl sulfoxide (DMSO) can be used. In embodiments, any moiety that improves electron transfer can be used, including but not necessarily limited to flavins and CymA. In embodiments, a device of this disclosure can include a reservoir component or any other component that can hold and/or retain a supply of the electron transfer moiety, such as a
membrane, or a surface to which the electron transfer moiety is reversibly attached, or a gel, or a capsule, or other components that will be apparent to those skilled in the art given the benefit of the present disclosure. Thus, embodiments comprise a component to supply the cells with a suitable electron acceptor, and such supply can be regulated using any suitable mechanism, the control of which can be integrated into computer/microprocessor controls.
In non-limiting embodiments which demonstrate proof of principle, the disclosure utilizes pyocyanin (Pyo) for gene induction and ferricyanide (Fen) for response-amplification and electronic control to guide production of proteins that act as reporters or that otherwise direct cell function.
Pyocyanin is secreted by Pseudomonas aeruginosa and is implicated in community organization, pathogenicity, and interspecies behavior32"34. To use pyocyanin as an inducer and demonstrate distinct utilities for embodiments of the disclosure, we employed one of the best-characterized redox-responsive regulons in E.coli, the SoxRS regulon32,35"37, which functions to sense and respond to oxidative stress. In E. coli, the SoxR protein contains an iron-sulfur cluster (2Fe-2S) that is maintained in a reduced form by NADPH-dependent enzymes38. When oxidized (e.g. by redox-cycling drugs 32>38>39)3 SoxR activates transcription of the SoxS protein from the T>soxS promoter. The SoxS protein, in turn, regulates dozens of other genes, mainly with the aim of detoxifying the cell40.
Studies of the mechanisms of redox-drug activation of SoxR show that conditions that promote cellular respiration increase expression from the T>soxS promoter32. They suggest that this is due to increased electron flow through the respiratory machinery, which could allow increased re-oxidation of the redox drugs and SoxR activation. Based in part on these observations, the present disclosure demonstrates that using a redox molecule that acts as an electron acceptor and whose form we could electronically regulate allows amplification of the intracellular Pyo redox cycling that leads to SoxR-mediated transcription. We chose ferricyanide as a representative alternative electron acceptor. Ferricyanide (oxidized, Fcn(O)) and ferrocyanide (reduced, Fcn(R))(with a standard potential, E° , of ~ +0.2 V vs. Ag/AgCl - silver/silver chloride) have been used previously in studies of electron transport processes, where Fcn(O) reduction rates correlate with microbial respiratory activities 18>41>42.
The specific and non-limiting examples described below demonstrate electronic control of a native redox process to actuate gene expression. Given the benefit of this disclosure, the method, device and/or systems of this disclosure are adaptable, specific, and versatile. The illustrative examples take advantage of the well-characterized native redox- response of the SoxRS regulon and proposed electron transport mechanisms so that minimal
genetic "rewiring" is required. Induction levels are controlled by varying either the applied electronic potential or its duration, and correlate to the measured charge through Fcn(0/R) redox form interconversion. We show that gene expression is functionally reversible on relatively short time scales (30 - 45 min) and that this allows for response "ON'V'OFF" cycling. Additionally, we expand on this genetic circuit by demonstrating electronic induction of cell motility and by connecting electronically-actuated cells to non-actuated cells via generation of the native signaling molecules associated with bacterial quorum sensing. Thus, electrons are converted to biological signaling molecules that, in turn, influence phenotype in otherwise unaffected cell populations. The "controlled" behaviors that the presently described electrogenetic device use are typically not responsive to such redox changes. Thus, the effects may be contained to specific, deliberately selected proteins and/or other cellular components.
The following Examples are intended to illustrate but not limit the disclosure.
Example 1
Redox mediator effects on cells and gene expression
Figure la provides a schematic representation of our approach. To test the effect of pyocyanin, Fcn(O), and Fcn(R), on gene expression and their interactions with cells we first carried out studies using chemical systems (e.g., without electrodes; chemical structures are presented in Figure 6). These results set the stage for electrode-based studies. We constructed plasmid pTTOl, from the pBR322 vector, that includes the soxR gene and the overlapping divergent T>soxR and T>soxS promoters. The gene coding for the fluorescent reporter protein phiLOV43, which can fluoresce in anaerobic conditions, was placed downstream of T>soxS (Figure lb). We incorporated an ssRA44 degradation tag -AA DENYADAS (DAS) on the C-terminus of phiLOV in plasmid pTTOl (forming plasmid pTT03), which significantly increases protein degradation and thus results in an overall lower steady-state protein level, but also a more rapid return to baseline levels upon cessation of induction (denoted "OFF"). All constructs, unless otherwise stated, were tested in the strain DJ901 {AsoxRS) 6. This strain allowed for higher reporter levels, but cells with intact soxRS were still responsive (see "Electronic actuation of bacterial motility" section and Figure 72). See materials and methods described below, and Figure 8, and Tables 1-3 for all plasmid and cell engineering information and sequences.
The addition of pyocyanin alone (0 - 10 μΜ) resulted in modest phiLOV
expression (fluorescence increase from 200 to 500 au). The addition of 5 mM of Fcn(O)
amplified this pyocyanin-induced fluorescence ~17-fold. Control cultures showed no increase in fluorescence (e.g., Fen (R) + Pyo or Fcn(O) only). See and Figure 9. Increasing concentrations of pyocyanin added to the culture resulted in higher phiLOV fluorescence as measured by flow cytometry (Figure 9 a insert) from samples induced for 1.5 hours before fixing. The addition of 5 mM of ferricyanide increased fluorescence to a much higher degree than just pyocyanin (up to ~17-fold in the case of 5 μΜ of pyocyanin) (Figure 9 a). Increasing ferricyanide concentration also increased the fluorescence when pyocyanin was 5 μΜ (Figure 9 b). When phiLOV-DAS fluorescence was measured over time, increasing ferricyanide sustained a higher fluorescence over a longer period of time (Figure 9c). Negative controls of ferrocyanide or ferricyanide alone were also tested, and as can be seen from Figure 9 b, did not result in an increase of fluorescence. Therefore, pyocyanin and ferricyanide were both necessary for the amplified protein production (beyond pyocyanin at 5 μΜ) from the PsoxS promoter, with pyocyanin initiating the protein production, and ferricyanide amplifying it.
Additionally, phiLOV fluorescence increased with ferricyanide (0 - 25 mM) while pyocyanin was kept at 5 μΜ, in an apparent dose-dependent response (Figure 9). The results indicated the importance of the redox status of Fcn(0/R) since Fcn(O) but not Fcn(R) amplified pyocyanin-induced gene expression. Since this is the first study of this
electrogenetic device, we performed the above and all following experiments anaerobically to exclude oxygen's interference with pyocyanin redox state and for better control of redox conditions. However, the system could be adapted for conditions that span a variety of oxygen gradients through further optimization. Data supporting this is shown in Figure 10.
Non-limiting embodiments of this disclosure are concentration-dependent on both pyocyanin and ferricyanide (Figures 7 & 9) anaerobically. However, when oxygen is present, the effect of ferricyanide (increase of fluorescence) is either negated (in aerated conditions) or decreased (non-aerated) in the conditions tested (Figure 10). Fluorescence was measured after 1.5 hours of aerobic culture at 37 °C with or without 250 rpm shaking. When any pyocyanin is present, aeration allows oxygen to amplify the response to a maximum value, and the concentration of ferricyanide does not affect fluorescence at the tested conditions. Non-aerated conditions allow for some cells to not be exposed to high oxygen over the course of the experiment. This drops the Pyo and SoxR-induced fluorescence response. Ferricyanide addition recovers a maximum response due to its high concentration throughout the sample. More optimization and studies would have to be conducted in conditions with various oxygen amounts to find those in which the
electrogenetic device would function non-anaerotically, but here we present preliminary studies.
Based on the above, we worked with 5 μΜ pyocyanin and 5 mM Fen (O/R) for the remaining studies. At these levels, neither mediator significantly altered cell viability, though the combination did alter acetate production per glucose consumed (Figure 11). In more detail, since ferricyanide acts as an electron acceptor in anaerobic conditions, and pyocyanin can be toxic to cells, we wanted to check the metabolic and toxicity effects of our treatments. This included the measurement of glucose consumption, acetate production, and propidium iodide staining of treated cells. To tease apart metabolic effects of our treatments vs. those due to protein production, we used both the DJ901 cells with the pTT03 plasmid and those without. Propidium iodide staining over 9 hours of growth with the indicated mediators shows that 5 μΜ pyocyanin and 5 mM ferricyanide, which are the concentrations used in embodiments of this disclosure, do not induce cell death at the levels used (Figure 6b). But concentrations of - 50 mM were toxic. Those skilled in the art will understand, given the benefit of the present disclosure, how to determine whether or not any given amount of an electron acceptor is toxic, and can furthermore optimize levels of any particular electron acceptor to provide a desired level of gene expression.
We measured the anaerobic consumption of glucose and production of acetate due to various treatments of both DJ901 cells with and without the pTT03 plasmid. Cells were inoculated at OD6oo of 0.25 with the mediators in the anaerobic chamber. As can be seen from data in Figure 11 a, whether the plasmid is present or not, adding both pyocyanin and ferricyanide to the cultures results in significantly lower production of acetate per glucose consumed. This was not the case for either ferricyanide or pyocyanin alone. Specifically, while the with-plasmid cases resulted in a slightly lower specific acetate yield on glucose than those cases without plasmid, there was no apparent influence of either redox mediator. Thus, the apparent amplification of pyocyanin-induced gene expression coincided with suppressed acetate production, but was not the cause of the suppressed acetate production (because the no- plasmid case also had low acetate production). Thus, and without intending to be bound by any particular theory, it is possible that the apparent amplification in gene expression may have been assisted by reduced metabolic byproducts.
We found that Fcn(O) reduction by cells depended on both the amount of cells and starting Fcn(O) concentration (Figure 12), consistent with above-mentioned literature regarding Fcn(O) use for respiratory activity measurement. As mentioned previously, others
have proposed that redox-cycling drugs which oxidize SoxR and drive expression from the T>soxS promoter interact with the electron transport machinery32. We propose that in our system, after oxidation of SoxR, the now-reduced drugs are re-oxidized intracellularly when an electron acceptor is present. We provide corroborating evidence in Figure 13. In more detail, Figure 13 a shows a non-limiting embodiment of proposed intracellular interactions. Pyocyanin oxidizes SoxR and results in phiLOV protein production. Ferricyanide interacts with the cell by acting as an electron acceptor for one or more parts of the electron transport machinery. While a well-known microbial electron acceptor, ferricyanide' s exact interactions within the electron chain remain unclear 9-11.
To test whether ferricyanide specifically, by acting as a terminal electron acceptor, amplifies the production of pyocyanin-induced protein, we used an alternative electron acceptor in a similar experiment with pyocyanin. As can be seen in Figure λ2, nitrate, a common anaerobic electron acceptor, also results in an increase in phiLOV fluorescence when pyocyanin is added to cells with pTT03. Correspondingly, nitrite, a reduced form of nitrate and a less efficient electron acceptor, does not result in as high an increase in protein production. We next used phenazine metho-sulfate (PMS) instead of pyocyanin, in similar concentrations, to induce a fluorescent response with ferricyanide addition to cells with pTT03. Figure 13 c shows that PMS behaves similarly to pyocyanin and induces fluorescence over time in a ferricyanide-dependent manner. Importantly, PMS behaves similarly to pyocyanin when cells are electronically induced with various charges
(oxidizing potential, various times, as further described below). We see an average cell fluorescence that correlates well with the applied charge (Figure 13d).. These results demonstrate the principle that Pyo-induced gene expression may be augmented due to Fcn(0)'s role as an electron acceptor and/or the involvement of electron transport mechanisms.
Thus, chemical studies described in this Example demonstrated that Pyo induces phiLO V expression from the T>soxS promoter and Fen (O) but not Fen (R) amplifies this expression in a dose-dependent manner.
Example 2
Electronic control of gene expression - dose-response
The above results suggested the possibility for genetic induction in situ by applying electronic signals that provide negative charge (oxidation) to ensure both that PYO is oxidized and to increase Fcn(O) from Fcn(R), and positive charges (reduction) for
subsequently halting gene induction through Fcn(O) reduction to Fcn(R) (Fig 2a). We interconverted bulk Fen (O/R) redox state electrochemically in a three-electrode setup (Figure 14). In an embodiment used in this disclosure, the E° of the Fen (O/R) couple was about -0.2 V (gray cyclic voltammogram in Fig 2b, Figure 15a). For complete and quick bulk oxidation and reduction (< 20 min, Figures 15b & c), we biased electrodes significantly more positively than the oxidation peak (+0.5V for ~ +0.25 V peak) or more negatively than the reduction peak (-0.3V for ~ +0.1V peak). We could use potentials closer to the peak potentials, but conversion efficiency would suffer; conversely, higher voltages can generate unwanted reactive species. The measured charge (integrated current over time) correlated well with Fcn(O) absorbance (Figure 15d) and repeated oxidation and reduction of the same solution did not degrade Fen (O/R) (Figure 15e).
Correspondingly, in Figure 2b, we show that varied electrode potential modulates Fcn(R) oxidation (charge) and cell (phiLOV) fluorescence. In these experiments, we applied different voltages to Pyo + Fcn(R) solutions with cells for 15 min, followed by incubation to allow for phiLOV accumulation, and flow cytometry measurements. Figure 2b shows the resulting total charge and average cell fluorescence levels at specific potentials. Three response ranges were observed based on the potential used. When we applied potentials more negative than the reduction peak, which did not promote significant Fcn(R) -> Fcn(O) conversion, charge and fluorescence outputs were negligible. Applied potentials between the reduction and oxidation peaks (~ + 0.1 & + 0.25 V) resulted in proportionally more negative charge (partial Fcn(R) to Fcn(O) conversion) and increasing fluorescence. Potentials more positive than that of the oxidation peak resulted in a leveling off of charge and maximally induced cells. Based on these results, we confirmed +0.5 V as our oxidizing potential (for Fen (R) to Fen (O) conversion) and -0.3 V as our reducing potential (for Fen (O) to Fen (R) conversion) for future experiments. Control experiments confirmed that cells with both Pyo and Fcn(O) (either added or oxidized from Fcn(R)) were required for fluorescence amplification above pyocyanin-only levels, similarly to chemically-induced experiments (Figure 2c).
We tested whether Fcn(R) oxidized in situ by a constant oxidizing potential could amplify gene expression and whether increasingly negative charge, mediated by increasing duration (10 - 900 s), could elicit a dose-dependent response. A heat map depicts the cell fluorescence due to varied durations of applied +0.5 V (Figure 2d). Low charge (closer to zero) resulted in low cell fluorescence. For charges between zero and ~ -0.27 C, initial increases in fluorescence were followed by decreases. In these situations, the Fcn(R) amount
converted to Fcn(O) was not sufficient to enable continued expression over the timeframe tested and ssRA-mediated phiLOV degradation brought the reporter quantity down. More negative charges than -0.27 C resulted in higher Fcn(O) levels and continued increase in fluorescence for the length of the experiment (despite the ssRA-mediated degradation). A heat map with the corresponding cell fluorescence of induction with varied potentials is shown in Figure 16, and results are comparable.
In Figure 2e, we show that the average fluorescence (via moving-window time average) increased with applied charge whether +0.5 V was applied for varied lengths of time or potentials were varied but applied for 15 minutes. We found no significant differences between the two methods - highlighting that it was the applied electronic charge, not the voltage or its duration, which correlated with fluorescence. The response appeared linear until ~ -0.5 C. These experiments demonstrate a direct relationship between applied potential (electronic signal), resulting charge (Fcn(R) to Fcn(O) interconversion at the electrode), and average cell fluorescence, confirming electronic control of gene expression and defining the redox-based communication pathway.
Example 3
Dynamic control of gene expression
We wanted to take advantage of the dynamic electrochemical control of the redox state of Fcn(0/R) to drive overall reporter response "ON" or "OFF", characterized by increased protein production ("ON") or decreased protein production and quantity via the ssRA tag ("OFF"). We thus first tested the effects chemically by centrifuging and re- suspending cells in fresh media with different mediators to evaluate the genetic response from an "ON" (Pyo + Fcn(O)) to "OFF" (Pyo + Fen (R)) transition (Figure 17a). In this situation phiLO V induction is reduced, the remaining protein (with ssRA tag, see Figure 17b) degrades, and the total fluorescence decreases. Repeated cycling of "ON" to "OFF" induction conditions at 1 hour intervals showed corresponding fluorescence increases and decreases, with cells fluorescing similarly after each "ON" cycle (Figure 17c). Cells showed significant fluorescence degradation upon switching of Fcn(O) to Fcn(R) in less than 45 minutes of exposure (Figure 17d).
Thus, Fen (O) amount defines whether protein production increases (high Pyo- and
SoxR-mediated induction from T>soxS promoter, and total protein increase despite ssRA- mediated protein degradation) or decreases (low induction from T>soxS promoter, and total
protein decrease due to degradation). We predicted that by electronically controlling the Fen (O/R) redox form we could similarly specify increases or decreases in protein levels.
We thus introduce the "OFF" component of the electronic control scheme, where we stop amplifying gene expression and rely on the biological system (ssRA tag) to drop the output signal in a similar manner as in the chemical experiments. Cells are turned "ON" with electronic oxidation of Fcn(R) to Fcn(O) (+0.5 V) and off with electronic reduction of Fcn(O) to Fcn(R) (-0.3 V)(Figure 3 a). In Figure 3b, we show dynamic control of cell fluorescence with repeated "ON'V'OFF" electronic signals in a continuous culture. We show that the cells remain responsive and the cycling process is reproducible.
In Figure 3c we evaluated the "ON'V'OFF" profile by varying the cycle time. We found that the fluorescence measured at the half cycle time (after an "ON" signal) increased monotonically with cycle time. After the half cycle measurement, an "OFF" signal was passed to the cells. The fluorescence then decreased significantly by the termination of the cycle for half-cycle times above ~ 45 min. One aspect to keep in mind is that the full electrochemical interconversion between Fen (O) and Fcn(R) takes about 15 min using our current setup. Therefore, for the shorter cycle time (e.g. 15 min), cells remain exposed to Fcn(O) for the majority of the time. This results in continual gene expression. For a 30 min cycle time, the cells are not in the presence of Fcn(O) for at least half the duration, and we see more pronounced effects of degradation. Longer "ON" states result in greater
fluorescence and longer "OFF" states result in greater degradation. Fully developed
"ON'V'OFF" switching occurs for cycle times near 30-45 minutes.
We constructed a mathematical model (see below) to delineate phiLOV synthesis from its degradation (Figure 18). In Figure 3d, we show the calculated accumulation of phiLOV in the absence of degradation over time, and found a positive linear relationship between charge and synthesis of phiLOV protein, consistent with data in Figure 2. This analysis allows for the prediction of outcomes from the electrogenetic circuit. In more detail, in order to separate synthesis (from promoter activity) from protein degradation, the following model was applied to the changing fluorescence levels with respect to charge: dF/dt = r(t) - kdF, where F = fluorescence, r(t) = rate of synthesis, and kd= first order degradation constant. All calculations were performed using Matlab.The degradation rate of the fluorescence was measured using degradation tags in separate experiments (Figure 17 b). A first-order model for degradation was assumed and the exponential was fitted to the data using the Levenberg-Marquardt nonlinear least squares method. The resulting best-fit
degradation constant was found (kd= 0.0362/min). The fluorescence data was shifted to an initial value of 0 and interpolated using piecewise cubic hermite interpolation. Combining these data with the calculated first derivatives of the interpolation, r() was extracted. The integral of r() was then calculated to observe the dynamics of accumulated rate with respect to charge using adaptive quadrature (ie integral function in Matlab). This accumulated rate (from left to right, top to bottom; increasing in positive charge) is shown as lines in Figure 18, along with the interpolation (line) of the original data (circle). The integral is calculated up to its maximum value, which we denote "integrated protein synthesis". This terminal integrated rate is plotted with respect to the corresponding charge in Figure 3 d. The resulting relationship between the terminal integrated rate and charges produced the following fitted YmQy(t) = (-1.543 * 105)tt + 3.814, meaning that as the charge increases, the terminal integrated rate increases linearly.
Example 4
Electronic actuation of bacterial motility
To show that the redox-driven control scheme can actuate behavior more complex than fluorescent reporter production, we first electrically induced bacterial swimming. We placed the E. coli motility effector gene, cheZ, under the VsoxS promoter, creating pHWOl (details in Methods). CheZ stimulates dephosphorylation of CheY, which drives flagellar motor function and swimming vs. tumbling behavior (Figure 4a)45. CheZ null mutants were transformed with pHWOl and first chemically induced with pyocyanin +/- Fcn(0/R). CheZ expression (via Western blot) showed similar trends to previously-shown fluorescence induction results (Figure 14a). Further, cells stimulated with +0.5 V with Pyo and Fcn(R) showed that higher charges correlated with increased CheZ production, almost to the level of wild-type cells (Figure 4b, Figure 14c shows expanded Western blot).
Solution-based induction of the control WT cells (W3110), CheZ KO cells (W3110 cheZ') without plasmid pHWOl, and CheZ KO cells with the pHWOl plasmid were performed before measurement of CheZ protein and cell velocities. Western blots performed on WT and CheZ KO cells without pHWOl (Figure 19 a) show that all WT cells have CheZ and all KO cells without pHWOl show absence of CheZ regardless of the inducers used. These results demonstrate that changes in CheZ protein in the CheZ KO cells with pHWOl are due to the addition of the genetically engineered elements.
Additionally, the treatments do not affect the presence (WT) or absence (CheZ KO) of
CheZ. Figure 19 c shows expanded blots of the same results as in Figure 4 b. Since we pre- incubated polyclonal antibody, additional uncharacterized bands were present. The results in Figure 20 show that the WT cells retain a higher relative velocity that is not affected by the mediator treatments. The CheZ KO cells that do not have pHWOl show an expected lower velocity that is not affected by mediator addition. The CheZ KO cells with pHWOl show a low velocity, similar to that of the CheZ KO cells without the plasmid when no mediators are present. Pyocyanin does not affect the velocity, but ferricyanide alone did show a slight increase. Both mediators together show a concentration-dependent increase in velocity. These solution-based controls indicate that electronic induction as described in the paper enables CheZ induction and increased velocity relative to the non-motile knockouts.
To characterize swimming, we developed a video-analysis algorithm that calculates per-cell swimming velocities (see Methods and Data and Code Availability) . CheZ amplification from its background level in the null mutant should correspond to higher velocities as its presence induces more straight swimming and less tumbling. Cell trajectories, showing individual cell paths starting at the origin and spanning 3 s, are smoother and longer with Pyo + Fen (O) and at higher charges (Figure 4c). Figure 4 d shows that velocity of tracked cells significantly increased with charge. Importantly, we observed no interference on cell motility or CheZ production from non-inducing controls (Figure 20). These results indicate that our redox-mediated approach can electronically stimulate a complex cell behavior- bacterial swimming - through gene induction, and do so without apparent interference with motility mechanisms.
Example 5
Electronic actuation of bacterial communication
We aimed to create a bio-electronic cellular information relay: electronically induced cells produce a signaling molecule that is interpreted by a second set of cells that, in turn, responds with altered behavior specifically encoded by the molecular signal. In this way, we can separate the redox-based electronic-actuation components (relay cell) from the resultant behavioral changes (receiver cell). This could be useful in cases where interactions between Pyo, Fcn(OZR), and the engineered electrogenetic circuit are of background importance. As seen in Figure 5a, in our relay cell, SoxR induces Vibrio fischerii Luxl (instead of phiLOV) expression from the plasmid pTT05. Luxl produces an acylated homoserine lactone (AHL), a bacterial signaling molecule that can diffuse through the membrane to guide quorum sensing
(QS) behavior. The V. fischerii Luxl QS system has been widely used to engineer
communication networks between non-communicating bacteria 46. The AHL receiver cell interprets the AHL cue by binding the LuxR protein and expressing phiLOV from the Vluxl promoter in the plasmid pTT06. As before, adding various Fen (O) concentrations with Pyo in solution resulted in amplified gene expression in co-cultures of the relay and receiver cells (Figure 21a). Figure 21b shows electronic induction of cell fluorescence of co-cultures over time, the average of which correlates with the charge (Figure 5b).
In electronically induced co-cultures, the AHL receiver cells exhibited an increase in fluorescence and emerged as a distinct fluorescent population, as can be seen from the flow cytometry histograms in Figure 5c. Figure 21c shows results of electronic induction between non-co-cultured cells, also with a charge-dependent response. In addition, quantitative PCR analysis corroborates gene expression results for all electronically induced proteins presented (Figure 22), demonstrating mRNA decay following the "OFF" transition in dynamic studies.
The bioelectronic relay cells (DJ901 with the plasmid pTT05) and the biosensor cells (DJ901 with the plasmid pTT06 ) were co-cultured as described in the Methods and induced with the indicated mediators in solution to test initial effects on production of fluorescent protein by the biosensor cells. As can be seen in Figure 21, a trend similar to when DJ901 with pTT03 cells were used is seen. That is, increasing amounts of fluorescence were measured from cells induced with Fen (O). Pyocyanin is also needed for an amplified response. We can see that fluorescence is higher in cells that are co-cultured and induced with more negative charges (Figure 21 b) but that these charges are relatively closer to zero than those needed to similarly induce DJ901 cells with pTT03. This is due to Luxl & AHL's amplification of the initial Pyo and Fcn(O) signal induction, and allows for a method to tweak the sensitivity and response of the electrogenetic device.
Additionally, we performed experiments in which the relay and biosensor cells were not co- cultured. Both cells were grown as before and placed in the anaerobic chamber. The relay cells alone were electrochemically induced by oxidation of pyocyanin and
ferrocyanide for various times, which resulted in the charges indicated in Figure 21 c. After a half hour of total induction + culture time, the cells were spun down, and the supernatant filtered through a 0.22 μπι filter. The supernatant was then added to the biosensor cells at OD6oo of 0.25. These cells were then grown for 2 hours, spun down and fixed, and then fluorescence was measured with flow cytometry. As can be seen from Figure 21 c, there is a linear correlation between the induction charge applied to the relay cells and the fluorescent
response of the biosensor cells. These results indicate that an electronic induction can be translated through cell-communication molecules (AHL) into a correlated response by a second set of cells. In embodiments, the disclosure further comprises separating the electronic signaling and the output response while still maintaining a good correlation, thereby using bio-electronic relay cells as translators between electronics and other cells that do not have to be under anaerobic conditions or be exposed to any of the mediators.
These results demonstrate successful biomolecular information transfer through redox-mediated electronic signals to native quorum sensing signaling molecules.
Example 6
Methods
Cell Strains and Plasmids
The majority of the experiments used E.coli DJ901 (AlacU169 rpsL AsoxRS901) 6. For experiments with CheZ induction W3110 E.coli with CheZ genomic deletion were constructed (CheZ KO). Plasmid vectors include pBR322 (for phiLOV and Luxl expression) and pFZYl (for CheZ expression). Briefly, the complete DNA region encompassing the soxR (Gene ID: 948566),and the T>soxR and T>soxS promoters (entire region between soxR and soxS) was PCR-amplified from the genome of E.coli MG1655. The genes coding for the proteins phiLOV (fluorescence), Luxl (autoinducer production), or CheZ (motility), with and without ssRA degradation tags, were placed downstream of the T*soxS promoter. Standard restriction cloning techniques and Gibson assembly were used. NEB5a (New England
Biolabs, Ipswich, MA) and Top 10 Chemically Competent (ThermoFisher Scientific) cells were used for construct assembly. Details of plasmid construction and all sequences are below and Tables 1-3.
Cell Culture
Cells were grown overnight in LB at 30 °C aerobically with 250 rpm shaking, were inoculated from the overnight cultures at 1.5 % in LB, and grown in 37 °C with 250 rpm shaking until OD6oo 0.2 - 0.5. The cells were re-suspended in M9 media (1 x M9 salts, 0.4 % glucose, 0.2 % casamino acids, 2 mM MgSC , 0.1 mM CaCk, and 100 mM MOPS) and then grown at 37 °C in a mini-incubator inside the Coy chamber for anaerobic experiments or in a shaking incubator (250 rpm) aerobically.
Establishment of Anaerobic Conditions
A Coy Laboratory Products (Grass Lake, MI) anaerobic chamber maintained anaerobic conditions - set up as per manufacturer's instructions, with nitrogen and CO2/H2/N2 mix. Spectrophotometric Readings
A SpectraMax M2 plate reader (Molecular Devices, Sunnyvale, CA) was used to read absorbance of ferricyanide (420 nm) and cell amounts (600 nm).
Cell Fixing
Typically, 100 μΐ of cells were taken per sample for fluorescence measurements. Cells were washed in PBS, re-suspended in 2 % paraformaldehyde in PBS, and incubated for at least 30 min at room temperature before flow cytometry measurements.
Flow Cytometry
Flow cytometry was performed using a BD Biosciences (Franklin Lakes, NJ) FACS Canto with the BD FACSDiva software. 50,000 cells were collected for each sample and consistently gated by forward scatter (FSC) and side scatter (SSC). The mean green fluorescence levels of phiLOV (488 nm laser and 530/30 green filter) are based on the means of 40,000-50,000 cells from the number of indicated samples. Analysis was done in
FACSDiva, FlowJo and Excel.
Electrochemical Setup
For bulk electrolysis, 50 cm-long gold electrodes (0.5 mm diameter, 99.95 % metal basis) were wound and used for both working and counter electrodes. An Ag/AgCl reference electrode was used. A CH Instruments, Inc. (Austin, TX) 600-series potentiostat was used for all electrochemical experiments.
Agar salt bridges consisted of 6 in -long 1.2 mm OD, 0.9 mm ID glass capillary tubes bent into a U shape after brief heating under a Bunsen burner. A 3 % agar solution with 1 M
KC1 was heated and added into the bent capillary tube. Tubes were cooled by immersion in a
3 M KC1 solution and stored in 3 M KC1 at 4 °C.
Typical electrochemical setup for Fcn(0/R) interconversion and in situ experiments were performed as follows: the working and reference electrodes were placed in one glass vial with 3 mL of solution and/or cells; in a separate similar vial the counter electrode was placed with another 3 mL of solution or cells. Mediators were added to the counter chamber
as follows: if Fen (O) was added to the working, then Fen (R) was added to the counter chamber, and vice versa. If pyocyanin was added to the working chamber, then it was also added to the counter chamber. If neither pyocyanin nor Fen (O/R) were added to the working chamber, then these were also omitted from the counter chamber. Holes to fit the electrodes and salt bridges were punched out in the plastic vial stoppers. Two salt bridges linked the two chambers. A mini magnetic stirrer with a 7 mm stir bar was used to facilitate mixing and accelerate electrochemical conversion in both vials. Unless otherwise stated, oxidation indicates a constant application of +0.5 V and reduction -0.3 V. For details and picture of the setup, see Figure 14.
For cyclic voltammograms, scan rates of 0.05 V sA-l were used.
In situ Electronic Cell Induction
Cells were cultured as above and placed in the anaerobic chamber. An
electrochemical setup as described above was used - with two chambers, three electrodes, and agar salt bridges. Cells at OD6oo 0.2 (unless otherwise stated) were added to the working electrode vial and placed in the 37 °C mini incubator for ~ 5 min in order to warm before the addition of mediators.
To initiate the electrochemical signaling, mediators were added, and the working electrode was biased at the indicated voltage for the indicated amount of time. For fluorescent cell sampling, about 100 μΐ of cells were removed from the solution and fixed as above. If multiple time points were to be taken without further electrochemical signaling, a volume equivalent to 100 μΐ x number of samples + 100 μΐ was removed from the glass vial and put in an Eppendorf tube in the mini-incubator, from which samples were collected. If further electronic signals were to be applied, 100 μΐ of media + mediators were added back into the culture after sampling. Charge was recorded by the CHI software and the end-point total was used in the figures.
For induction by varying potential, the indicated potentials (Figure 2 b) were applied for 15 minutes, after which the cells were removed as mentioned above, and sampled every 30 minutes for 3 hours. For induction by varying time, +0.5 V was applied for between 10 and 900 s.
Turning cells "ON" and then "OFF" involved first cell induction with pyocyanin and Fen (R) with +0.5 V for 15 minutes. Afterwards, cells were left in the glass vials for the indicated amount of time to produce fluorescence (Figure 2d indicates total time of induction + culture), and were sampled for fluorescence. To subsequently turn cells "OFF", an -0.3 V
reducing potential was applied for 15 minutes, reduced the Fen (O), and cells were placed in a separate tube for the remaining time for sampling. Multiple cycles of ON and OFF as in Figure 3b repeated the above process while cells stayed in the vials with electrodes throughout and fresh media was added when samples were removed.
Induction of Motility
Overnight cultures were grown as above. Following re-inoculation in LB, cells were grown to an OD6oo of 0.45 at 37 °C shaking at 250 rpm aerobically. Cells were spun at 400 g for 5 min and re-suspended in an equal volume of M9 media. Cells were placed in the anaerobic chamber where mediators were added as indicated. Non-electrically stimulated samples were induced in the anaerobic chamber at 37 °C for 90 minutes. Electrically stimulated cells were induced with various charges (constant potential, varying time, as above), after which cells were placed into Eppendorf tubes and cultured for a total of 90 min before analysis. Western Blot analysis is described in Methods and was done using standard techniques. For video analysis, cells were spun down at 400 g for 5 min and re-suspended in chemotaxis buffer (CB: 1 χ PBS, 0.1 mM EDTA, 0.01 mM L-methionine, 10 mM D,L- lactate) while still in the anaerobic chamber.
Motility Video Analysis
Cells in CB were removed from the anaerobic chamber, placed on a microscope slide, and a video was recorded using Cell Sens software and DX60 microscope equipped with a DP72 camera (Olympus, Waltham, MA). Approximately 100 frames are recorded for each video, using a 20 x objective lens with a GFP filter.
Motility video analysis was done using Matlab based on methods in literature54. Using Otsu's method55, each frame of the motility video was segmented into a binary image. The built-in function regionprops provided the location and shape of each cell. The tracking algorithm uses a nearest-neighbor approach that links cells in subsequent frames based on closeness, size similarity, and pixel intensity. The velocity was determined from centroid data. The program accounts for cells that are stuck for part or the entire duration of the video and cells that are under the influence of background flow. In order to create the trajectory diagrams in Figure 4c, the first 3 seconds of each cell trajectory in the video are shown, translated and plotted at the origin (0,0).
Induction of Cell-to-cell Communication
The bioelectronic relay cells (DJ901 with the plasmid pTT05) and the receiver cells (DJ901 with the plasmid pTT06) were inoculated from overnight cultures at 1.5% in LB and grown in 37 °C with 250 rpm shaking until reaching OD6oo 0. 2- 0.5 aerobically. The cells were re-suspended in the M9 media at an OD6oo of 0.25 and mixed at a 1 : 1 relay to receiver cell ratio before induction. Solution-based induction was done as for cells with induced motility above. Electrochemical induction was done as above with application of + 0.5 V for various times.
Construction of pTT01-pTT04 Plasmids
The DNA region containing the soxR gene and the region between soxR and soxS was amplified from the E.coli MG1655 genome and ligated into the PCR-Blunt II-TOPO plasmid. The fragment was then digested out with the BamHI and Hindlll enzymes and ligated into a similarly-digested pBR322 vector. The gene coding for the phiLOV2.1 protein was produced as a gBlock by IDT, with E.coli codons optimized using GenScript from amino acid sequence from Christie et al 43. The pTTOl (phiLOV) and pTT02 (phiLOV-LAA) plasmids were assembled using the Gibson Assembly method 56 (NEB Gibson Assembly Master Mix) by PCR amplifying both the phiLOV sequence (with or without the
AANDENYALAA (LAA) degradation tag; SEQ ID NO:41)) and the pBR322-soxR-PsoxS constructs with overlaps. The A ANDEN Y AD A S (DAS) (SEQ ID NO:42) tag was added to phiLOVby PCR amplifying pTT02, treating the PCR with T4 polynucleotide kinase and ligating with T4 ligase to create plasmid pTT03. The plasmid pTT04 was created by PCR- amplifying pTT03 without the soxR coding sequence, treating the PCR with T4
polynucleotide kinase and ligating with T4 ligase. The relevant primers can be found in Table 2. The relevant genetic element sequences, including the tags, can be found in Table 3. Construction of pTT05 and pTT06
The plasmid pTT05 was created from pTTOl by PCR amplification without phiLOV. The luxl gene with the LAA tag was amplified from the plasmid pLuxRI2 57. Gibson Assembly Master Mix from NEB was used to assemble the final construct. Plasmid pTT06 was created by amplifying pTTOl plasmid without the soxR through PsoxS region, and luxR through luxl (including promoters) out of plasmid pTD103Aiia 58. The Gibson assembly method was used as above. The relevant primers can be found in Table 2. The relevant genetic element sequences, including the tags, can be found in Table 3.
Construction of Motility Plasmid pHWOl
To create the plasmid pHWOl with the cheZ gene under control of the PsoxS promoter,
E. coli W3110 cells were used as the template for amplifying the cheZ and soxR-PsoxS fragments via PCR. The primer set BamHI-SoxR-F & SoxS-cheZ-R was used for the amplification of the soxR- PsoxS fragment, while the primer set SoxS-cheZ-F & CheZ- Hindlll-R was utilized for the cheZ fragment. In between both PCRs, the primer SoxS-cheZ- R, by our design, was a reverse complementary strand to SoxS-cheZ-F and therefore, both resulting PCR products shared an overlapping fragment. After gel -extraction of PCR products, both were mixed together at equimolar ratio and an extra PCR was performed with the primers BamHI- SoxR-F & CheZ- Hindlll-R for ligating soxR-PsoxS-cheZ. The resulting product was inserted into pFZYl 59 vector through BamHI and Hindlll restriction enzyme cloning.
Construction of Constitutive Fluorescent Plasmid pT5G
The plasmid pT5G was derived from a plasmid previously used for constitutive expression of DSRedExpress2 60,61 First, a redundant Hindlll restriction endonuclease site (AAGCTT) was deleted from plasmid pT5RT7G through plasmid PCR using primers Hindllldel-F and Hindllldel-R. The product was phosphorylated with T4 PNK and re-ligated with T4 ligase. Next, the reporter gene eGFP was amplified using the t5EGFP-F and t5EGFP-R primers. The dsRedExpress2 was excited from the pT5RT7G derivative via EcoRI and Hindlll digestion and eGFP was inserted. Transformation and recovery of the ligation product yielded Top 10 + pT5G cells that constitutively expressed EGFP and thereby fluoresced green. The plasmid was transformed into cheZ KO cells (below) with the motility plasmid pHWOl to allow for fluorescent video recording. Construction of Plasmid pTGl
The E.coli K-12 genomic region that constitutes the soxR protein and the divergent overlapping T*soxR and T*soxS promoters was inserted into a pCR-Bluntll-TOPO plasmid (Thermo Fisher Scientific). This construct and the plasmid pFZYl were digested with BamHI and Hindlll and ligated such that the lacZ gene in pFZYl was downstream of the PsoxS promoter. pTGl allowed for SoxR-mediated expression of β-galactosidase.
Genomic cheZ Deletion
Chromosomal deletion of cheZ in E. coli W3110 was carried out using the one-step
inactivation method described by Datsenko and Wanner In this method, a phage λ Red recombination system was introduced to facilitate the homologous replacement of W3110 cheZ gene with kanamycin resistance gene cassette followed by the excision of the resistance cassette for creating cheZ knockout of W3110 (W3110 cheZ-). Specifically, the Red helper plasmid, pKD46 (GenBank Accession: AY048746.1), was first transformed into W3110 electro- competent cells by electroporation. The transformed cells were grown and selected on LB-agar plates which contained 50 μg mlA-l ampicillin at 30 °C. A positive colony was picked and inoculated into in 50 ml LB medium which contained 50 μg mlA-l ampicillin and 1 mM L- arabinose . The cells were cultivated at 30 °C 250 rpm shaking to an OD6oo -0.3 and electro- competent cells were freshly prepared and kept on ice until the next transformation of a kan resistance cassette. To synthesize the kanamycin resistance cassette, we conducted a PCR using the primer set (cheZ-KO-PlF & cheZ-KO-P2R) and the plasmid pKD4 (GenBank Accession: AY048743.1) as the template.
The resulting PCR product of the kanamycin cassette flanked by FLP recognition target sites was produced and gel-purified for subsequent transformation into pKD46 carrying W3110 electro-competent cells abovementioned. 300-500 ng of the kanamycin cassette product was introduced into 50 μΐ of competent cells by electroporation followed by the incubation with 500 μΐ SOC medium and 1 mM L-arabinose at 37 °C 250 rpm shaking for 2 hrs. Cells were grown overnight on an LB-agar plate containing 30 μg mlA-l
Kanamycin for screening the recombinants. We further isolated colonies from the kanamycin plate and conducted PCR verification for cheZ deletion (cheZ seq-PlF & cheZ_seq-P2R) and kanamycin cassette insertion (primer set l :cheZ-upstream & Kt; primer set 2: k2 & cheZ- downstream). Isolated cells were also inoculated in LB medium supplemented with 50 μg mlA-l ampicillin for checking the curing of pKD46 plasmid. Subsequently, the removal of the kanamycin resistance cassette from the isolated clones was also implemented by the electro- transformation and temperature upshift induction of the 707-FLPe plasmid. Upon temperature shifting, 30 °C to 37 °C, cheZ mutant cells carrying 707-FLPe plasmid expressed FLPe recombinase and then triggered FLP-mediated excision of the FRT -flanked kanamycin resistance cassette. After incubating at 37 °C for 3-5 hours, the cells were plated and grown on LB-agar plates. We then picked single clones from the plates and inoculated into LB only, LB with 30 μg mlA-l kanamycin, and LB with 3 μg mlA-l tetracycline for the screening of kanamycin removal and 707-FLPe plasmid curing. PCR verification of kanamycin cassette removal was further performed with the primer set kl & kt.
General Cloning Procedures
DNA was extracted from cells using either a Qiagen (Hilden, Germany) or a Zymo Research (Irvine, CA) Miniprep kit according to manufacturer' s instructions. Polymerase chain reaction (PCR) was used to amplify genes or DNA of interest using Q5 DNA
Polymerase (NEB). Primers were ordered from Integrated DNA Technologies (IDT,
Coralville, IA). NEB restriction enzymes such as BamHI and Hindlll were used to generate restriction digests of desired PCR products or plasmids. Agarose gel electrophoresis was used to separate DNA fragments based on size and the gel bands (as visualized with SYBR Safe, Invitrogen) as well as DNA sequencing by Genewiz was used to verify the constructs. Digested fragments were ligated using either NEB Quick Ligase or NEB T4 Ligase. Gibson Assembly was performed with NEB' s Gibson Master Mix according to manufacturer' s instructions. Electro- or chemically- competent cells (either from NEB, Invitrogen (Carlsbad, CA), electrocompetent, or made with Zymo Research' s Z- Competent E. coli Transformation Kit) were used fortransformation. β-galactosidase (Miller) Assay
The Miller Assay was performed on ZK126 cells with the pTGl plasmid expressing β- galactosidase according to standard protocols. Miller assay was performed according to standard protocols63. Briefly, cells were lysed with chloroform and sodium dodecyl sulfate (SDS) to release ?-gal. The substrate ONPG was added and cleaved by ?-gal into a yellow molecule, o- nitrophenol. Absorbance at 600 nm, 550nm, and 420 nm was quantified by a SpectraMax M2 plate reader. The OD at 600nm was measured from 250 μΐ of cells and the ODs at 420 nm and 550 nm were measured from 200 μΐ of cells.
Electrochemical Ferricyanide Reduction Measurement
To measure ferricyanide reduction by cells, a three electrode setup was used: an Au working electrode (2 mm diameter, CH Instruments, Inc., Austin, TX), a 4 cm-long platinum wire counter electrode (Alfa Aesar, Haverhill, MA), and Ag/AgCl reference electrode (B ASi, West Lafayette, IN). We used about 1.5 mL of cells at OD6oo of 1.5, with a mini magnetic stir bar (see bulk electrolysis setup in Methods). The cells were grown as above and incubated inside the anaerobic chamber at 37 °C during measurements. An oxidation potential of +0.5 V was applied over time to measure ferrocyanide.
Propidium Iodide Staining
Propidium Iodide (PI) was used to stain dead bacteria. Cells were washed in 10 mM
MgS04 (pH 6.5), then PBS, and finally re-suspended in PBS with 5 μg mlA-l of PI added. The cells were incubated at room temperature while covered with foil for 30 min. Afterwards cells were spun down and re-suspended in PBS. Fluorescence of cells was measured with flow cytometry as described in Methods, with the excitation and emission set for DsRed detection.
Glucose and Acetate Measurement
Glucose was determined by the YSI 2700 SELECT Biochemistry Analyzer (YSI Life Sciences, Yellow Springs, Ohio). Acetate was determined by HPLC, Hewlett Packard 1100 Series using an Aminex® resin-based HPX-87H column (Bio-Rad, Hercules, CA). The analysis conditions were as follows: wavelength 210 nm, mobile phase 0.008 N H2SO4, flow rate 0.6 mL per min, temp 35 °C, calibration was done using organic acid analysis standard (Bio-Rad, Hercules, CA). qPCR Analysis
To study the mRNA levels in response to mediator treatments qPCR was performed. Cells were grown as stated in the Methods, taken to the anaerobic chamber, and let sit for 15 minutes before treatments. Cells were induced with the indicated mediators for 30 minutes (if in solution). Electrochemical induction was performed as in the Methods - in all cases +0.5 V was applied for 15 minutes, resulting in the indicated charges, after which the cells were cultured a further 15 minutes before addition of RNAlater. Cells were treated as indicated and approximately 2 x 108 total cells were washed in equal volume of PBS and then re- suspended and stored in RNAlater (Ambion, Austin, TX) at 4 °C overnight. Before RNA isolation, cells were pelleted to remove RNAlater. RNA was isolated using the TRIzol Max Bacterial RNA Isolation Kit (Ambion, Austin, TX) according to manufacturer's protocol, followed by treatment of 50 ng of total RNA with DNase I (Sigma, St. Louis, MO). qPCR was performed using SensiFAST SYBR Hi-ROX One-Step Kit (Bioline, Taunton, MA) with approximately 5 ng of total RNA per reaction using the primers in Table 4. Each sample was performed in triplicate (technical replicate). Outlying data was removed. 16s rRNA was used as the endogenous housekeeping gene. Data was analyzed using the ΔΔΟΐ method, with the Ct threshold set automatically by the Applied Biosy stems 7300 Real-Time PCR System for all samples.
Cell Preparation for Western Blotting
Cells were grown and induced or treated as indicated. For cell lysate preparation, 3 ml
of culture were spun down at designated time-points at 6,000 rpm for 5 min. The supernatant was discarded, and the remaining pellets were frozen at -80 °C. Upon thawing, samples were lysed in 250 μΐ BugBuster HT (Novagen, Madison, WI) according to the manufacturer's protocol. Lysate concentrations were assessed via BCA assay (Pierce, Rockford, IL) according to manufacturer's protocol. Lysates were normalized to 500 ng μ1Α-1 with water and boiled with SDS loading dye.
SDS-PAGE and Western Blotting
Approximately 12 μg total protein per sample was loaded in a 12.5 % SDS-PAGE gel and run at 120 V in running buffer (25 mM Tris, 192 mM glycine, 0.1% SDS, pH8.3). The proteins were then transferred to a nitrocellulose membrane in transfer buffer (48 mM Tris, 39 mM glycine, 20% methanol, pH 9.2) using the semi-dry Trans-Blot SD cell (Bio-Rad, Hercules, CA). Blots were blocked overnight at 4 °C with Tris-buffered saline (20 mM Tris, 500 mM NaCl, pH 7.5) with 0.1 % Tween-20 (TBST) and 10 % nonfat milk. TBST with 3 % bovine serum albumin (BSA) and 1 : 10,000 dilution of anti-CheZ rabbit antiserum is incubated for at least 30 min, shaking at RT, with 25 % total volume of cell lysate from W3110 cheZ- cells.
W3110 cheZ' lysate is prepared by growing a volume (50 mL) of the cells overnight, pelleting the next day, re-suspending in 40 % the volume (20 mL) of TBST with 100 μΐ Triton X-100 (Bio-Rad, Hercules, CA), sonicating for 30 min or until lysate is colored and remaining pellet is small. After rinsing the membrane in TBST, the blot is incubated with the primary antibody mixture for 90 min. The membrane is thoroughly rinsed again, and incubated for 60 min with an HRP-conjugated secondary antibody (Sigma, St. Louis, MO) diluted 1 :4000 in TBST with 3 % BSA. The blot was imaged using a chemiluminescence detection system (ECL; Pierce, Rockford, IL) according to manufacturer's instructions, and developed using Hyperfilm (GE Healthcare, Waukesha, WI). Figure 19 shows molecular size markers and un-cropped blots.
The following reference numbering is as designated in the foregoing description.
1 Grieshaber, D., MacKenzie, R., Voros, J. & Reimhult, E. Electrochemical Biosensors - Sensor Principles and Architectures. Sensors (Basel, Switzerland) 8, 1400-1458, (2008).
2 Rackus, D. G., Shamsi, M. H. & Wheeler, A. R. Electrochemistry, biosensors and microfluidics: a convergence of fields. Chem. Soc. Rev. 44, 5320-5340, (2015).
3 Ronkainen, N. J., Halsall, H. B. & Heineman, W. R. Electrochemical biosensors. Chem. Soc. Rev. 39, 1747-1763, (2010).
4 Wang, J. et al. Microfabricated Electrochemical Cell-Based Biosensors for Analysis of Living Cells In Vitro. Biosensors 2, (2012).
5 Sadik, O. A., Aluoch, A. O. & Zhou, A. Status of biomolecular recognition using electrochemical techniques. Biosensors and Bioelectronics 24, 2749-2765, (2009).
6 Gao, W. et al. Fully integrated wearable sensor arrays for multiplexed in situ
perspiration analysis. Nature 529, 509-514, (2016).
7 Bandodkar, A. J. & Wang, J. Non-invasive wearable electrochemical sensors: a
review. Trends in biotechnology 32, 363-371, (2014).
8 Kim, D.-H., Ghaffari, R., Lu, N. & Rogers, J. A. Flexible and Stretchable Electronics for Biointegrated Devices. Annual review of biomedical engineering 14, 113-128,
(2012) .
9 Green, J. & Paget, M. S. Bacterial redox sensors. Nature reviews. Microbiology 2,
954-966, (2004).
10 Oktyabrsky, O. N. & Smirnova, G. V. Redox regulation of cellular functions.
Biochemistry. Biokhimiia 72, 132-145, (2007).
11 Buettner, G. R., Wagner, B. A. & Rodgers, V. G. J. Quantitative Redox Biology: An approach to understanding the role of reactive species in defining the cellular redox environment. Cell Biochem. Biophys. 67, 10.1007/s 12013-12011-19320-12013,
(2013) .
12 Franks, A. E. & Nevin, K. P. Microbial Fuel Cells, A Current Review. Energies 3,
899, (2010).
13 Logan, B. E. Exoelectrogenic bacteria that power microbial fuel cells. Nature reviews.
Microbiology 7, 375-381, (2009).
14 Lovley, D. R. Bug juice: harvesting electricity with microorganisms. Nat Rev Micro
4, 497-508, (2006).
15 Rosenbaum, M. A. & Franks, A. E. Microbial catalysis in bioelectrochemical
technologies: status quo, challenges and perspectives. Appl Microbiol Biotechnol 98, 509-518, (2014).
16 Rabaey, K. & Rozendal, R. A. Microbial electrosynthesis— revisiting the electrical route for microbial production. Nat Rev Micro 8, 706-716, (2010).
17 Morris, K., Catterall, K., Zhao, H., Pasco, N. & John, R. Ferricyanide mediated
biochemical oxygen demand - development of a rapid biochemical oxygen demand assay. Anal. Chim. Acta 442, 129-139, (2001).
18 Pasco, N., Baronian, K., Jeffries, C. & Hay, J. Biochemical mediator demand - a novel rapid alternative for measuring biochemical oxygen demand. Appl Microbiol Biotechnol 53, 613-618, (2000).
19 Harrington, T. D. et al. Neutral red-mediated microbial electrosynthesis by
Escherichia coli, Klebsiella pneumoniae, and Zymomonas mobilis. Bioresour.
Technol. 195, 57-65, (2015).
20 Rawson, F. J., Downard, A. J. & Baronian, K. H. Electrochemical detection of
intracellular and cell membrane redox systems in Saccharomyces cerevisiae. Scientific Reports 4, 5216, (2014).
21 Rabinowitz, J. D., Vacchino, J. F., Beeson, C. & McConnell, H. M. Potentiometric Measurement of Intracellular Redox Activity. J. Am. Chem. Soc. 120, 2464-2473, (1998).
22 Kim, E. et al. Redox-capacitor to connect electrochemistry to redox-biology. Analyst,
(2014) .
23 Liu, C, Yong, D., Yu, D. & Dong, S. Cell-based biosensor for measurement of phenol and nitrophenols toxicity. Talanta 84, 766-770, (2011).
24 Jensen, H. M. et al. Engineering of a synthetic electron conduit in living cells.
Proceedings of the National Academy of Sciences 107, 19213-19218, (2010).
25 Alferov, S. et al. Electrical communication of cytochrome enriched Escherichia coli JM109 cells with graphite electrodes. Electrochimica Acta 54, 4979-4984, (2009). 26 Tschirhart, T. et al. Electrochemical Measurement of the β-Galactosidase Reporter from Live Cells: A Comparison to the Miller Assay. ACS Synthetic Biology 5, 28-35, (2016).
27 Collier, J. H. & Mrksich, M. Engineering a biospecific communication pathway
between cells and electrodes. Proceedings of the National Academy of Sciences of the
United States of America 103, 2021-2025, (2006).
28 Song, Y., Wang, J. & Yau, S.-T. Controlled glucose consumption in yeast using a transistor-like device. Scientific Reports 4, 5429, (2014).
29 Gordonov, T. et al. Electronic modulation of biochemical signal generation. Nature nanotechnology 9, 605-610, (2014).
30 TerAvest, M. A. & Ajo-Franklin, C. M. Transforming exoelectrogens for
biotechnology using synthetic biology. Biotechnol. Bioeng. 113, 687-697, (2016).
31 Weber, W. et al. A synthetic mammalian electro-genetic transcription circuit. Nucleic Acids Res. 37, e33, (2009).
32 Gu, M. & Imlay, J. A. The SoxRS response of Escherichia coli is directly activated by redox-cycling drugs rather than by superoxide. Mol Microbiol 79, 1136-1150, (2011).
33 Price-Whelan, A., Dietrich, L. E. & Newman, D. K. Pyocyanin alters redox
homeostasis and carbon flux through central metabolic pathways in Pseudomonas aeruginosa PA14. J Bacteriol 189, 6372-6381, (2007).
34 Gamby, S. et al. Altering the communication networks of multispecies microbial systems using a diverse toolbox of AI-2 analogues. ACS chemical biology 7, 1023- 1030, (2012).
35 Demple, B., Ding, H. & Jorgensen, M. Escherichia coli SoxR protein:
sensor/transducer of oxidative stress and nitric oxide. Methods in enzymology 348,
355-364, (2002).
36 Greenberg, J. T., Monach, P., Chou, J. H., Josephy, P. D. & Demple, B. Positive control of a global antioxidant defense regulon activated by superoxide-generating agents in Escherichia coli. Proc Natl Acad Sci USA 87, 6181-6185, (1990).
37 Tsaneva, I. R. & Weiss, B. soxR, a locus governing a superoxide response regulon in Escherichia coli K-12. J Bacteriol 172, 4197-4205, (1990).
38 Koo, M. S. et al. A reducing system of the superoxide sensor SoxR in Escherichia coli. EMBO J 22, 2614-2622, (2003).
39 Singh, A. K., Shin, J. H., Lee, K. L., Imlay, J. A. & Roe, J. H. Comparative study of SoxR activation by redox-active compounds. Mol Microbiol 90, 983-996, (2013).
40 Wu, J. & Weiss, B. Two divergently transcribed genes, soxR and soxS, control a superoxide response regulon of Escherichia coli. J Bacteriol 173, 2864-2871, (1991).
41 Morris, K., Zhao, H. & John, R. Ferricyanide-Mediated Microbial Reactions for
Environmental Monitoring. Australian Journal of Chemistry 58, 237-245, (2005). 42 Catterall, K., Robertson, D., Teasdale, P. R., Welsh, D. T. & John, R. Evaluating use of ferricyanide-mediated respiration bioassays to quantify stimulatory and inhibitory effects on Escherichia coli populations. Talanta 80, 1980-1985, (2010).
43 Christie, J. M. et al. Structural Tuning of the Fluorescent Protein iLOV for Improved Photostability. The Journal of biological chemistry 287 ', 22295-22304, (2012).
44 McGinness, K. E., Baker, T. A. & Sauer, R. T. Engineering Controllable Protein Degradation. Molecular Cell 22, 701-707, (2006).
45 Zhao, R., Collins, E. J., Bourret, R. B. & Silversmith, R. E. Structure and catalytic mechanism of the E. coli chemotaxis phosphatase CheZ. Nature structural biology 9, 570-575, (2002).
46 Danino, T., Mondragon-Palomino, O., Tsimring, L. & Hasty, J. A synchronized
quorum of genetic clocks. Nature 463, 326-330, (2010).
47 Olson, E. J., Hartsough, L. A., Landry, B. P., Shroff, R. & Tabor, J. J. Characterizing bacterial gene circuit dynamics with optically programmed gene expression signals. NatMeth 11, 449-455, (2014).
48 Wang, X., Chen, X. & Yang, Y. Spatiotemporal control of gene expression by a light- switchable transgene system. NatMeth 9, 266-269, (2012).
49 Levskaya, A. et al. Synthetic biology: engineering Escherichia coli to see light.
Nature 438, 441-442, (2005).
50 Schmidl, S. R., Sheth, R. U., Wu, A. & Tabor, J. J. Refactoring and optimization of light-switchable escherichia coli two-component systems. ACS Synth Biol 3, 820-831, (2014).
51 Ortner, V. et al. Magnetic field-controlled gene expression in encapsulated cells.
Journal of controlled release : official journal of the Controlled Release Society 158, 424-432, (2012).
52 Stanley, S. A. et al. Radio-Wave Heating of Iron Oxide Nanoparticles Can Regulate Plasma Glucose in Mice. Science 336, 604-608, (2012).
53 Stanley, S. A., Sauer, J., Kane, R. S., Dordick, J. S. & Friedman, J. M. Remote
regulation of glucose homeostasis in mice using genetically encoded nanoparticles. Nat Med 21, 92-98, (2015).
54 Meijering, E., Dzyubachyk, O. & Smal, I. Methods for cell and particle tracking.
Methods in enzymology 504, 183-200, (2012).
55 Otsu, N. A Threshold Selection Method from Gray-Level Histograms. Systems, Man and Cybernetics, IEEE Transactions on 9, 62-66, (1979).
56 Gibson, D. G. et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature methods 6, 343-345, (2009).
57 You, L., Cox, R. S., 3rd, Weiss, R. & Arnold, F. H. Programmed population control by cell-cell communication and regulated killing. Nature 428, 868-871, (2004).
58 Danino, T., Mondragon-Palomino, O., Tsimring, L. & Hasty, J. A synchronized
quorum of genetic clocks. Nature 463, 326-330, (2010).
59 Koop, A. H., Hartley, M. E. & Bourgeois, S. A low-copy-number vector utilizing beta-galactosidase for the analysis of gene control elements. Gene 52, 245-256, (1987).
60 Servinsky, M. D. et al. Directed assembly of a bacterial quorum. The ISME journal
10, 158-169, (2016).
61 Wu, H. C. et al. Autonomous bacterial localization and gene expression based on nearby cell receptor density. Molecular systems biology 9, 636, (2013).
62 Datsenko, K. A. & Wanner, B. L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA 97, 6640-6645, (2000).
63 Miller, J. H. Experiments in molecular genetics. (Cold Spring Harbor Laboratory, 1972).
64 Pottash, A. E., McKay, R., Virgile, C. R., Ueda, H. & Bentley, W. E. TumbleScore: run and tumble analysis for low frame-rate motility videos. BioTechniques, In press, (2016).
Example 7
The following materials and methods were used to obtain the results presented in Figure 6-16. Construction of pTT01-pTT04 plasmids
The DNA region containing the soxR gene and the PsoxS promoter was amplified from the E.coli MG1655 genome and ligated into the PCR-Blunt II-TOPO plasmid. The fragment was then digested out with the BamHI and Hindlll enzymes and ligated into a similarly-digested pBR322 vector. The gene coding for the phiLOV2.1 protein was produced as a gBlock by IDT, with E.coli codons optimized using GenScript from amino acid sequence from Christie et al The pTTOl (phiLOV) and pTT02 (phiLOV-LAA) plasmids were assembled using the Gibson Assembly method ^ (with NEB Gibson Assembly Master Mix) by PCR amplifying both the phiLO V sequence (with or without the AANDENYALAA (LAA) degradation tag) (SEQ ID NO:41) and the pBR322-soxR-PsoxS constructs with overlaps. The AANDENYADAS (DAS) tag (SEQ ID NO:42) was added to phiLOVby PCR amplifying pTT02, treating the PCR with T4 polynucleotide kinase and ligating with T4 ligase to create plasmid pTT03. The plasmid pTT04 was created by PCR- amplifying pTT03 without the soxR coding sequence, treating the PCR with T4 polynucleotide kinase and ligating with T4 ligase. The relevant primers can be found in Table 2. The relevant genetic element sequences, including the tags, can be found in Table 3.
Construction of pTT05 and pTT06
The plasmid pTT05 was created from pTTOl by PCR amplification without phiLOV.
The luxl gene with the LAA tag was amplified from the plasmid pLuxRLzA Gibson Assembly Master Mix from NEB was used to assemble the final construct. Plasmid pTT06 was created by amplifying pTTOl plasmid without the soxR-PsoxS region, and luxR-luxI (including promoters) out of plasmid pTD103 Aiia^. The Gibson assembly method was used as above. The relevant primers can be found in Table 2. The relevant genetic element sequences, including the tags, can be found in Table 3.
Construction of motility plasmid pHWOl
To create the plasmid pHWOl with the cheZ gene under control of the PsoxS
promoter, E. coli W3110 cells were used as the template for amplifying the cheZ and soxR- PsoxS fragments via PCR. The primer set BamHI-SoxR-F & SoxS-cheZ-R was used for the amplification of the soxR- PsoxS fragment, while the primer set SoxS-cheZ-F & CheZ- Hindlll-R was utilized for the cheZ fragment. In between both PCRs, the primer SoxS-cheZ- R, by our design, was a reverse complementary strand to SoxS-cheZ-F and therefore, both resulting PCR products shared an overlapping fragment. After gel -extraction of PCR products, both were mixed together at equimolar ratio and an extra PCR was performed with the primers BamHI- SoxR-F & CheZ- Hindlll-R for ligating soxR-PsoxS-cheZ. The resulting
n
product was inserted into pFZYl vector through BamHI and Hindlll restriction enzyme cloning.
Construction of constitutive fluorescent plasmid pT5G
The plasmid pT5G was derived from a plasmid previously used for constitutive expression of DSRedExpress2 First, a redundant Hindlll restriction endonuclease site (AAGCTT) was deleted from plasmid pT5RT7G through plasmid PCR using primers Hindllldel-F and Hindllldel-R. The product was phosphorylated with T4 PNK and re-ligated with T4 ligase. Next, the reporter gene eGFP was amplified using the t5EGFP-F and t5EGFP-R primers. The dsRedExpress2 was excited from the pT5RT7G derivative via EcoRI and Hindlll digestion and eGFP was inserted. Transformation and recovery of the ligation product yielded Top 10 + pT5G cells that constitutively expressed EGFP and thereby fluoresced green. The plasmid was transformed into cheZ KO cells (below) with the motility plasmid pHWOl to allow for fluorescent video recording.
Construction of plasmid pTGl
The E.coli K-12 genomic region that constitutes the soxR protein and the divergent overlapping soxR/PsoxS promoters was inserted into a pCR-Bluntll-TOPO plasmid (Thermo Fisher Scientific). This construct and the plasmid pFZYl were digested with BamHI and Hindlll and ligated such that the lacZ gene in pFZYl was downstream of the PsoxS promoter. pTGl allowed for SoxR-mediated expression of β-galactosidase.
Genomic cheZ deletion
Chromosomal deletion of cheZ in E. coli W3110 was carried out using the one-step inactivation method described by Datsenko and Wanner . In this method, a phage λ Red recombination system was introduced to facilitate the homologous replacement of W3110
cheZ gene with kanamycin resistance gene cassette followed by the excision of the resistance cassette for creating cheZ knockout of W3110 (W3110 cheZ'). Specifically, the Red helper plasmid, pKD46 (GenBank Accession: AY048746.1), was first transformed into W3110 electro- competent cells by electroporation. The transformed cells were grown and selected on LB-agar plates which contained 50 μg/ml ampicillin at 30 °C. A positive colony was picked and inoculated into in 50 ml LB medium which contained 50 μg/ml ampicillin and 1 mM L- arabinose^. The cells were cultivated at 30 °C 250 rpm shaking to an OD600 -0.3 and electro- competent cells were freshly prepared and kept on ice until the next
transformation of a kan resistance cassette. To synthesize the kanamycin resistance cassette, we conducted a PCR using the primer set (cheZ-KO-PlF & cheZ-KO-P2R) and the plasmid pKD4 (GenBank Accession: AY048743.1) as the template.
The resulting PCR product of the kanamycin cassette flanked by FLP recognition target sites was produced and gel-purified for subsequent transformation into pKD46 carrying W3110 electro-competent cells abovementioned. 300-500 ng of the kanamycin cassette product was introduced into 50 μΐ of competent cells by electroporation followed by the incubation with 500 μΐ SOC medium and 1 mM L-arabinose at 37 °C 250 rpm shaking for 2 hrs. Cells were grown overnight on an LB-agar plate containing 30 μg/ml Kanamycin for screening the recombinants. We further isolated colonies from the kanamycin plate and conducted PCR verification for cheZ deletion (cheZ seq-PlF & cheZ_seq-P2R) and kanamycin cassette insertion (primer set 1 :cheZ -up stream & Kt; primer set 2: k2 & cheZ- downstream). Isolated cells were also inoculated in LB medium supplemented with 50 μg/ml ampicillin for checking the curing of pKD46 plasmid. Subsequently, the removal of the kanamycin resistance cassette from the isolated clones was also implemented by the electro- transformation and temperature upshift induction of the 707-FLPe plasmid. Upon
temperature shifting, 30 °C to 37 °C, cheZ mutant cells carrying 707-FLPe plasmid expressed FLPe recombinase and then triggered FLP-mediated excision of the FRT-flanked kanamycin resistance cassette. After incubating at 37 °C for 3-5 hours, the cells were plated and grown on LB-agar plates. We then picked single clones from the plates and inoculated into LB only, LB with 30 μg/ml kanamycin, and LB with 3 μg/ml tetracycline for the screening of kanamycin removal and 707-FLPe plasmid curing. PCR verification of kanamycin cassette removal was further performed with the primer set kl & kt.
General cloning procedures
DNA was extracted from cells using either a Qiagen (Hilden, Germany) or a Zymo Research (Irvine, CA) Miniprep kit according to manufacturer's instructions. Polymerase chain reaction (PCR) was used to amplify genes or DNA of interest using Q5 DNA
Polymerase (NEB). Primers were ordered from Integrated DNA Technologies (IDT,
Coralville, IA). NEB restriction enzymes such as BamHI and Hindlll were used to generate restriction digests of desired PCR products or plasmids. Agarose gel electrophoresis was used to separate DNA fragments based on size and the gel bands (as visualized with SYBR Safe, Invitrogen) as well as DNA sequencing by Genewiz was used to verify the constructs. Digested fragments were ligated using either NEB Quick Ligase or NEB T4 Ligase. Gibson Assembly was performed with NEB's Gibson Master Mix according to manufacturer's instructions. Electro- or chemically- competent cells (either from NEB, Invitrogen (Carlsbad, CA), electrocompetent, or made with Zymo Research's Z- Competent E. coli Transformation Kit) were used fortransformation.
Miller Assay
The Miller Assay was performed on ZK126 cells with the pTGl plasmid expressing β- galactosidase according to standard protocols. Miller assay was performed according to
13
standard protocols. Briefly, cells were lysed with chloroform and sodium dodecyl sulfate (SDS) to release ?-gal. The substrate ONPG was added and cleaved by ?-gal into a yellow molecule, o- nitrophenol. Absorbance at 600 nm, 550nm, and 420 nm was quantified by a SpectraMax M2 plate reader. The OD at 600nm was measured from 250 μΐ of cells and the ODs at 420 nm and 550 nm were measured from 200 μΐ of cells. Electrochemical Ferricyanide Reduction Measurement
To measure ferricyanide reduction by cells, a three electrode setup was used: an Au working electrode (2 mm diameter, CH Instruments, Inc., Austin, TX), a 4 cm-long platinum wire counter electrode (Alfa Aesar, Haverhill, MA), and Ag/AgCl reference electrode (B ASi, West Lafayette, IN). We used about 1.5 mL of cells at OD600 of 1.5, with a mini magnetic stir bar (see bulk electrolysis setup in Methods). The cells were grown as above and incubated inside the anaerobic chamber at 37 °C during measurements. An oxidation potential of +0.5 V was applied over time to measure ferrocyanide.
Propidium Iodide Staining
Propidium Iodide (PI) was used to stain dead bacteria. Cells were washed in 10 mM MgS04 (pH 6.5), then PBS, and finally re-suspended in PBS with 5 μg/ml of PI added. The cells were incubated at room temperature while covered with foil for 30 min. Afterwards cells were spun down and re-suspended in PBS. Fluorescence of cells was measured with flow cytometry as described in Methods, with the excitation and emission set for DsRed detection.
Glucose and Acetate Measurement
Glucose was determined by the YSI 2700 SELECT Biochemistry Analyzer (YSI Life
Sciences, Yellow Springs, Ohio). Acetate was determined by HPLC, Hewlett Packard 1100
(R)
Series using an Aminex resin-based HPX-87H column (Bio-Rad, Hercules, CA). The analysis conditions were as follows: wavelength 210 nm, mobile phase 0.008 N H2S04, flow rate 0.6 mL/ min, temp 35 °C, calibration was done using organic acid analysis standard (Bio-Rad, Hercules, CA). qPCR analysis
To study the mRNA levels in response to mediator treatments qPCR was performed. Cells were grown as stated in the Methods, taken to the anaerobic chamber, and let sit for 15 minutes before treatments. Cells were induced with the indicated mediators for 30 minutes (if in solution). Electrochemical induction was performed as in the Methods - in all cases +0.5 V was applied for 15 minutes, resulting in the indicated charges, after which the cells were cultured a further 15 minutes before addition of RNAlater. Cells were treated as indicated
Q
and approximately 2 x 10 total cells were washed in equal volume of PBS and then re- suspended and stored in RNAlater (Ambion, Austin, TX) at 4 °C overnight. Before RNA isolation, cells were pelleted to remove RNAlater. RNA was isolated using the TRIzol Max Bacterial RNA Isolation Kit (Ambion, Austin, TX) according to manufacturer's protocol, followed by treatment of 50 ng of total RNA with DNase I (Sigma, St. Louis, MO). qPCR was performed using SensiFAST SYBR Hi-ROX One-Step Kit (Bioline, Taunton, MA) with approximately 5 ng of total RNA per reaction using the primers in Table 4. Each sample was performed in triplicate (technical replicate). Outlying data was removed. 16s rRNA was used as the endogenous housekeeping gene. Data was analyzed using the ΔΔΟΐ method, with the Ct threshold set automatically by the Applied Biosy stems 7300 Real-Time PCR System for
all samples.
Cell Preparation for Western Blotting
Cells were grown and induced or treated as indicated. For cell lysate preparation, 3 ml of culture were spun down at designated time-points at 6,000 rpm for 5 min. The supernatant was discarded, and the remaining pellets were frozen at -80 °C. Upon thawing, samples were lysed in 250 μΐ BugBuster HT (Novagen, Madison, WI) according to the manufacturer's protocol. Lysate concentrations were assessed via BCA assay (Pierce, Rockford, IL) according to manufacturer's protocol. Lysates were normalized to 500 ng/μΐ with water and boiled with SDS loading dye.
SDS-PAGE and Western Blotting
Approximately 12 μg total protein per sample was loaded in a 12.5 % SDS-PAGE gel and run at 120 V in running buffer (25 mM Tris, 192 mM glycine, 0.1% SDS, pH8.3). The proteins were then transferred to a nitrocellulose membrane in transfer buffer (48 mM Tris, 39 mM glycine, 20% methanol, pH 9.2) using the semi-dry Trans-Blot SD cell (Bio-Rad, Hercules, CA). Blots were blocked overnight at 4 °C with Tris-buffered saline (20 mM Tris, 500 mM NaCl, pH 7.5) with 0.1 % Tween-20 (TBST) and 10 % nonfat milk. TBST with 3 % bovine serum albumin (BSA) and 1 : 10,000 dilution of anti-CheZ rabbit antiserum is incubated for at least 30 min, shaking at RT, with 25 % total volume of cell lysate from W3110 c/zeZ- cells.
W3110 cheZ- lysate is prepared by growing a volume (50 mL) of the cells overnight, pelleting the next day, re-suspending in 40 % the volume (20 mL) of TBST with 100 μΐ Triton X-100 (Bio-Rad, Hercules, CA), sonicating for 30 min or until lysate is colored and remaining pellet is small. After rinsing the membrane in TBST, the blot is incubated with the primary antibody mixture for 90 min. The membrane is thoroughly rinsed again, and incubated for 60 min with an HRP-conjugated secondary antibody (Sigma, St. Louis, MO) diluted 1 :4000 in TBST with 3 % BSA. The blot was imaged using a chemiluminescence detection system (ECL; Pierce, Rockford, IL) according to manufacturer's instructions, and developed using Hyperfilm (GE Healthcare, Waukesha, WI).
The following references are for the materials and methods described above in connection with Figures 6-16, and for the Tables.
1 Greenberg, J. T., Monach, P., Chou, J. H., Josephy, P. D. & Demple, B. Positive control of a global antioxidant defense regulon activated by superoxide- generating agents in Escherichia coli. Proc Natl Acad Sci U S A 87, 6181-6185, (1990).
2 You, L., Cox, R. S., 3rd, Weiss, R. & Arnold, F. H. Programmed population
control by cell-cell communication and regulated killing. Nature 428, 868-871, (2004).
3 Datsenko, K. A. & Wanner, B. L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA 97,
6640-6645, (2000).
4 Servinsky, M. D. et al. Directed assembly of a bacterial quorum. The ISME
journal Id, 158-169, (2016).
5 Wu, H. C. et al. Autonomous bacterial localization and gene expression based on nearby cell receptor density. Molecular systems biology 9, 636, (2013).
6 Danino, T., Mondragon-Palomino, O., Tsimring, L. & Hasty, J. A synchronized quorum of genetic clocks. Nature 463, 326-330, (2010).
7 Koop, A. H., Hartley, M. E. & Bourgeois, S. A low-copy-number vector utilizing beta- galactosidase for the analysis of gene control elements. Gene 52, 245-256, (1987).
8 Christie, J. M. et al. Structural Tuning of the Fluorescent Protein iLOV for
Improved Photostability. The Journal of biological chemistry 287, 22295- 22304, (2012).
9 Boonstra, J., Sips, H. J. & Konings, W. N. Active transport by membrane vesicles from anaerobically grown Escherichia coli energized by electron transfer to ferri cyanide and chlorate. European journal of biochemistry / FEBS 69, 35-44,
(1976).
10 Oktyabrsky, O. N., Smirnova, G. V. & Kuznetsova, E. V. Ferricyanide
reduction by Escherichia coli cells: Probable contribution of low molecular weight thiols. Bioelectrochemistry and Bioenergetics 32, 267-275, (1993).
11 Hadjipetrou, L. P., Gray-Young, T. & Lilly, M. D. Effect of Ferricyanide on
Energy Production by Escherichia coli. Journal of General Microbiology 45, 479-488, (1966).
12 Baba, T. et al. Construction of Escherichia coli K-12 in-frame, single-gene
knockout mutants: the Keio collection. Molecular systems biology 2, 2006 0008, (2006).
13 Miller, J. H. Experiments in molecular genetics. (Cold Spring Harbor Laboratory, 1972).
Table 1. Strains and plasmids used in this study.
Table 2
cassette deletion
Hindllldel-F: ATCGATGATAAGCTGTCAAACATGAGAATTAATTCTTGA AGACGAAAGGG (SEQ ID NO: 37)
Hindllldel-R: TAATGCGGTAGTTTATCACAGTTAAATTGCTAACGCAG TCAGG (SEQ ID NO: 38)
pT5G construction t5EGFP-F: TACACAAGAATTCATTAAAGAGGAGAAATTAACCATGGTG
AGCAAGGGCGAGGAGC (SEQ ID NO: 39)
t5EGFP-R:
TTATGTAGAAGCTTGCGGCCGTTACTTGTACAGCTCGTCCAT GCCGAGAGTGATC (SEQ ID NO: 40)
Table 3
CGCAAGTTTTGCGTGTTATATATCATTAAAACGGTAATGGATTGACATTTGATTC TAATAAATTGGATTTTTGTCACACTATTGTATCGCTGGGAATACAATTACTTAAC ATAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCG AATGAATTCATTAAAGAGGAGAAAGGTACC (SEQ ID NO: 47)
ATGATGCAACCATCAATCAAACCTGCTGACGAGCATTCAGCTGGCGATATCAT
TGCGCGCATCGGCAGCCTGACGCGTATGCTGCGCGACAGTTTGCGGGAACTGG
GGCTGGATCAGGCCATTGCCGAAGCGGCGGAAGCCATCCCCGATGCGCGCGATCG
TTTGTACTATGTTGTGCAGATGACCGCCCAGGCTGCGGAGCGGGCGCTGAACA
GTGTTGAGGCGTCACAACCGCATCAGGATCAAATGGAGAAATCAGCAAAAGC
GTTAACCCAACGTTGGGATGACTGGTTTGCCGATCCGATTGACCTTGCCGACGCCC
cheZ GTGAACTGGTAACAGATACACGACAATTTCTGGCAGATGTACCCGCGCATACC
AGCTTTACTAACGCGCAACTGCTGGAAATCATGATGGCGCAGGATTTTCAGGA
TCTCACCGGGCAGGTCATTAAGCGGATGATGGATGTCATTCAGGAGATCGAAC
GCCAGTTGCTGATGGTGCTGTTGGAAAACATCCCGGAACAGGAGTCGCGTCCA
AAACGTGAAAACCAGAGTTTGCTTAATGGACCTCAGGTCGATACCAGCAAAG
CCGGTGTGGTAGCCAGTCAGGATCAGGTGGACGATTTGTTGGATAGTCTTGGA
TTTTGA (SEQ ID NO: 48)
Table 4 Primer sequences for quantitative PCR analysis.
Table 5. Representative genetic elements for use in embodiments of this.
TCGGCGTGCGGCAGATTCCTGCCACGTTAGCCAGCCGACGCTTAGCGGGCAA
ATTCGTAAGCTGGAAGATGAGCTGGGCGTGATGTTGCTGGAGCGGACCAGCC
GTAAAGTGTTGTTCACCCAGGCGGGAATGCTGCTGGTGGATCAGGCGCGTAC
CGTGCTGCGTGAGGTGAAAGTCCTTAAAGAGATGGCAAGCCAGCAGGGCGAG
ACGATGTCCGGACCGCTGCACATTGGTTTGATTCCCACAGTTGGACCGTACCT
OxyR protein - GCTACCGCATATTATCCCTATGCTGCACCAGACCTTTCCAAAGCTGGAAATGT oxidative and ATCTGCATGAAGCACAGACCCACCAGTTACTGGCGCAACTGGACAGCGGCAA nitrosative stress ACTCGATTGCGTGATCCTCGCGCTGGTGAAAGAGAGCGAAGCATTCATTGAA transcriptional GTGCCGTTGTTTGATGAGCCAATGTTGCTGGCTATCTATGAAGATCACCCGTG regulator (Gene GGCGAACCGCGAATGCGTACCGATGGCCGATCTGGCAGGGGAAAAACTGCTG ID: 948462) ATGCTGGAAGATGGTCACTGTTTGCGCGATCAGGCAATGGGTTTCTGTTTTGA
AGCCGGGGCGGATGAAGATACACACTTCCGCGCGACCAGCCTGGAAACTCTG
CGCAACATGGTGGCGGCAGGTAGCGGGATCACTTTACTGCCAGCGCTGGCTG
TGCCGCCGGAGCGCAAACGCGATGGGGTTGTTTATCTGCCGTGCATTAAGCCG
GAACCACGCCGCACTATTGGCCTGGTTTATCGTCCTGGCTCACCGCTGCGCAG
CCGCTATGAGCAGCTGGCAGAGGCCATCCGCGCAAGAATGGATGGCCATTTC
GATAAAGTTTTAAAACAGGCGGTTTAA (SEQ ID NO: 59)
OxyS promoter - Region upstream of
TATCCATCCTCCATCGCCACGATAGTTCATGGCGATAGGTAGAATAGCAATGA
the OxyS sRNA
ACGATTATCCCTATCAAGCATTCTGACTGATAATTGCTCACA (SEQ ID NO: 60) coding sequence and
the oxyR CDS
It will be apparent from the foregoing description that this disclosure demonstrates, for the first time, the utility of using biologically relevant redox molecules in translating electronic signals to changes in engineered bacterial gene expression. Non-limiting
embodiments are based on coupling Pyo-driven SoxR activation31,35 with electronic control of Fcn(0/R) redox form18'41 42. This integration allows opening a new communication pathway and development of a novel framework to connect electronic signals to gene expression. The disclosure thus includes robust evidence and characterization of a
functioning bacterial electrogenetic device. It is believed this disclosure is first in
demonstrating and characterizing an electrode-based system for reversible and specific redox- driven genetic control in bacteria.
The applications of this system to genetically induce bacterial motility and cell-to-cell communication highlight its versatility in that it builds upon advances in using electronic control of behaviors that are naturally redox-dependent. Additionally, although the disclosure highlights dynamic gene-actuation capabilities, it is distinct from those of other synthetic biology efforts that enlist non-native components to recognize alternative input signals for precise genetic control using light47"50 or magnetic and radio waves 51"53. Instead, the present
disclosure in certain implementations entails minimally rewiring the cells to take advantage of native redox interactions.
While the invention has been described through specific embodiments, routine modifications will be apparent to those skilled in the art and such modifications are intended to be within the scope of the present invention.
Claims
1. A method comprising providing electrical stimulation to one or more living cells, the cells comprising a promoter operably linked to a DNA segment, wherein the promoter is controllable by reversible redox dependent activation, such that the redox dependent activation and transcription of the DNA segment occurs, wherein optionally the promoter, the DNA segment, or both are heterologous to the cell.
2. The method of claim 1, wherein the DNA segment is heterologous to the cell.
3. The method of claim 1, wherein the DNA segment encodes a biologically active RNA polynucleotide that does not encode a protein.
4. The method of claim 1, wherein the DNA segment encodes a protein that is heterologous to the cell.
5. The method of claim 1, wherein the DNA segment encodes a protein that is secreted, and wherein the secreted protein exerts a biological effect on cells that are not exposed to the electrical stimulation.
6. The method of claim 1, further comprising modulating the electrical stimulation such that the redox dependent activation and transcription of the DNA transcription is altered, wherein the modulating optionally comprises stopping the electrical stimulation such that the transcription is reduced or stopped.
7. The method any one of claims 1-6 wherein the cells are prokaryotic cells.
8. The method of claim 7, further comprising supplying the cells with an electron acceptor such that the transcription is altered relative to a control value for transcription in the absence of the electron acceptor.
9. The method of claim 7, wherein the electrical stimulation is configured to change in response to a signal, wherein the signal comprises the presence and/or amount of a biological molecule.
10. The method of claim 9, wherein the one or more cells are present in an apparatus that comprises an electrical stimulation component that changes the electrical stimulation in response to the signal.
11. The method of claim 10, wherein the apparatus comprises a wearable or implantable device.
12. A biologic-based sensor comprising living cells, the cells comprising a promoter operably linked to a DNA segment, wherein the promoter is controllable by reversible redox dependent activation, such that the redox dependent activation and transcription of the DNA segment occurs, wherein optionally the promoter, the DNA segment, or both are heterologous to the cell, the sensor comprising a housing capable of sustaining the cells, the housing including at least one port through which liquids and biological molecules can pass; an electrical stimulation component that can provide electrical stimulation to the cells; and a power source for operating the electrical stimulation component.
13. The biologic-based sensor of claim 12, wherein the housing further comprises or is in communication with a sensing component that can sense the presence, absence and/or amount of a biological indicator.
14. The biologic-based sensor of claim 12, wherein the sensing component is configured to sense a protein, a peptide, a carbohydrate, a lipid, a cytokine, a drug, a toxin, an indicator of a pathogen, ionizing radiation, or a combination thereof.
15. The biologic-based sensor of claim 13, wherein the sensing component is configured to sense glucose or insulin.
16. The biologic-based sensor of claim 13, wherein the electrical stimulation component is configured to adjust the electrical stimulation based on communication with the sensing component.
17. The biologic-based sensor of claim 13, wherein the DNA segment is heterologous to the cell.
18. The biologic-based sensor of claim 13, wherein the DNA segment encodes a biologically active RNA polynucleotide that does not encode a protein.
19. The biologic-based sensor of claim 13, wherein the DNA segment encodes a protein that is heterologous to the cell.
20. The biologic-based sensor of claim 12, further comprising a reservoir component comprising an electron acceptor that is in fluid communication with the cells such that the electron acceptor can be provided to the cells.
21. The biologic-based sensor of any one of claims 12-20, wherein the cells are prokaryotic cells.
22. A system comprising a biologic-based sensor of any of claims 12-20, further comprising a processor running software configured to adjust the electrical stimulation based on communication with the sensing component.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201662431291P | 2016-12-07 | 2016-12-07 | |
| US62/431,291 | 2016-12-07 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2018106932A2 true WO2018106932A2 (en) | 2018-06-14 |
| WO2018106932A3 WO2018106932A3 (en) | 2018-07-12 |
Family
ID=62491380
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2017/065138 Ceased WO2018106932A2 (en) | 2016-12-07 | 2017-12-07 | Compositions and methods for electronic control of gene expression |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2018106932A2 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20230038480A1 (en) * | 2021-07-08 | 2023-02-09 | University Of Maryland, College Park | System for produciton of high yield of recombinant proteins |
| CN116457435A (en) * | 2020-09-09 | 2023-07-18 | 上海科技大学 | Programmed living body gel system for autonomous mechanical repair |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE102012017026A1 (en) * | 2012-08-28 | 2014-03-06 | Forschungszentrum Jülich GmbH | Sensor for NADP (H) and development of alcohol dehydrogenases |
-
2017
- 2017-12-07 WO PCT/US2017/065138 patent/WO2018106932A2/en not_active Ceased
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116457435A (en) * | 2020-09-09 | 2023-07-18 | 上海科技大学 | Programmed living body gel system for autonomous mechanical repair |
| US20230038480A1 (en) * | 2021-07-08 | 2023-02-09 | University Of Maryland, College Park | System for produciton of high yield of recombinant proteins |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2018106932A3 (en) | 2018-07-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Tschirhart et al. | Electronic control of gene expression and cell behaviour in Escherichia coli through redox signalling | |
| Bird et al. | Engineering wired life: synthetic biology for electroactive bacteria | |
| Reguera | Microbial nanowires and electroactive biofilms | |
| Tahernia et al. | Characterization of electrogenic gut bacteria | |
| Wang et al. | Enhancing electrical outputs of the fuel cells with Geobacter sulferreducens by overexpressing nanowire proteins | |
| Mouhib et al. | Extracellular electron transfer pathways to enhance the electroactivity of modified Escherichia coli | |
| Richter et al. | Cyclic voltammetry of biofilms of wild type and mutant Geobacter sulfurreducens on fuel cell anodes indicates possible roles of OmcB, OmcZ, type IV pili, and protons in extracellular electron transfer | |
| Chan et al. | Genome scale mutational analysis of Geobacter sulfurreducens reveals distinct molecular mechanisms for respiration and sensing of poised electrodes versus Fe (III) oxides | |
| Adamo et al. | Amplification of the CUP1 gene is associated with evolution of copper tolerance in Saccharomyces cerevisiae | |
| Schmitz et al. | Boosting mediated electron transfer in bioelectrochemical systems with tailored defined microbial cocultures | |
| Choi et al. | A paper-based microbial fuel cell array for rapid and high-throughput screening of electricity-producing bacteria | |
| Zacharoff et al. | Redox conduction in biofilms: From respiration to living electronics | |
| Kundu et al. | Extracellular respiration is a latent energy metabolism in Escherichia coli | |
| Han et al. | Design of growth‐dependent biosensors based on destabilized GFP for the detection of physiological behavior of Escherichia coli in heterogeneous bioreactors | |
| Moscoviz et al. | Novel outlook in microbial ecology: nonmutualistic interspecies electron transfer | |
| Hernández-Eligio et al. | GSU1771 regulates extracellular electron transfer and electroactive biofilm formation in Geobacter sulfurreducens: Genetic and electrochemical characterization | |
| Yu et al. | Engineering outer membrane vesicles to increase extracellular electron transfer of Shewanella oneidensis | |
| Schmitz et al. | Controlling the production of Pseudomonas phenazines by modulating the genetic repertoire | |
| Baruch et al. | Electronic control of redox reactions inside Escherichia coli using a genetic module | |
| Chen et al. | CRISPR/dCas9-RpoD-mediated simultaneous transcriptional activation and repression in Shewanella oneidensis MR-1 | |
| Bruscella et al. | The HiPIP from the acidophilic Acidithiobacillus ferrooxidans is correctly processed and translocated in Escherichia coli, in spite of the periplasm pH difference between these two micro-organisms | |
| Stephens et al. | Electronic signals are electrogenetically relayed to control cell growth and co-culture composition | |
| Hu et al. | All roads lead to Rome: Cyclic di-GMP differentially regulates extracellular electron transfer in Geobacter biofilms | |
| Tan et al. | Tailoring genetic elements of the plasmid-driven T7 system for stable and robust one-step cloning and protein expression in broad Escherichia coli | |
| Jaramillo-Rodríguez et al. | Global transcriptional analysis of Geobacter sulfurreducens gsu1771 mutant biofilm grown on two different support structures |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17878373 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 17878373 Country of ref document: EP Kind code of ref document: A2 |






