WO2018106918A1 - Neuronal survival and axonal regeneration through increasing mitochondrial motility - Google Patents

Neuronal survival and axonal regeneration through increasing mitochondrial motility Download PDF

Info

Publication number
WO2018106918A1
WO2018106918A1 PCT/US2017/065113 US2017065113W WO2018106918A1 WO 2018106918 A1 WO2018106918 A1 WO 2018106918A1 US 2017065113 W US2017065113 W US 2017065113W WO 2018106918 A1 WO2018106918 A1 WO 2018106918A1
Authority
WO
WIPO (PCT)
Prior art keywords
armcxl
polypeptide
neuron
injury
injured
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2017/065113
Other languages
French (fr)
Inventor
Zhigang He
Thomas L. Schwarz
Cartoni ROMAIN
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Boston Childrens Hospital
Original Assignee
Boston Childrens Hospital
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Boston Childrens Hospital filed Critical Boston Childrens Hospital
Priority to US16/467,750 priority Critical patent/US11413325B2/en
Publication of WO2018106918A1 publication Critical patent/WO2018106918A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • G01N33/5029Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects on cell motility
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5058Neurological cells
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • G01N33/6896Neurological disorders, e.g. Alzheimer's disease
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/66Phosphorus compounds
    • A61K31/665Phosphorus compounds having oxygen as a ring hetero atom, e.g. fosfomycin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7052Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
    • A61K31/706Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
    • A61K31/7064Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
    • A61K31/7076Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines containing purines, e.g. adenosine, adenylic acid
    • A61K31/708Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines containing purines, e.g. adenosine, adenylic acid having oxo groups directly attached to the purine ring system, e.g. guanosine, guanylic acid

Definitions

  • the present invention relates to field of neuronal survival and regeneration.
  • axonal mitochondria move bi-directionally along microtubule tracks. Their movement can be continuous or interrupted by pauses (for review see (Schwarz, 2013)).
  • Armcxl correlates with high axonal regeneration, modulates the transport of the axonal mitochondria and promotes neuronal survival and axonal regeneration. Described herein are compositions and methods to promote survival of neurons and/or axons regeneration of neurons. Provided herein are methods and compositions useful for neuronal injury or a disease or disorder causing neuronal injury or resulting from neuronal injury.
  • a method for promoting survival of, or axon regeneration in an injured mature central nervous system (CNS) neuron comprising: contacting the neuron with an effective amount of an agent capable of increasing mitochondrial motility in the injured neuron, thereby promoting survival of, or axon regeneration in the injured neuron.
  • CNS central nervous system
  • the method of the foregoing aspect further comprises detecting the resultant promotion of the survival of, or axon regeneration in the injured neuron in the subject.
  • the injured neuron results from traumatic injury, traumatic brain injury, optic nerve injury, acute spinal cord injury, stroke, restorative CNS surgery or CNS degeneration.
  • the injured neuron is a sensory neuron.
  • the injured neuron is in the spinal cord or the optic nerve.
  • the agent is administered intravenously, intracortically, intracerebrally, intrathecally, intranasally, ocularly or locally at the injured neuron.
  • the agent is Armcxl polypeptide. In some embodiments, the agent is Armcxl polypeptide.
  • the Armcxl polypeptide is recombinant.
  • the Armxcl polypeptide comprises a carrier peptide or lipophilic molecular group and/or is encapsulated in a liposome or a nanoparticle.
  • the agent is a vector comprising a nucleic acid sequence that encodes an Armcxl polypeptide.
  • the vector is a viral vector or non-viral vector.
  • the viral vector is selected from the group consisting of retrovirus, lentivirus, adenovirus, herpesvirus, poxvirus, alpha virus, vaccinia virus, and adeno-associated viruses.
  • the non-viral vector is selected from the group consisting of a nanoparticle, a cationic lipid, a cationic polymer, a metallic nanoparticle, a nanorod, a liposome, microbubbles, a cell penetrating peptide and a liposphere.
  • the Armcxl polypeptide is of human origin. In some embodiments, the Armcxl polypeptide comprises the sequence of SEQ ID NO: l . In some embodiments the Armcxl polypeptide has at least 95% amino acid sequence identity to SEQ ID NO: 1 and retains at least 80% of the biological activity of human Armcxl of SEQ ID NO: l .
  • the detecting step is effected by an indirect assay of axon regeneration.
  • the detecting step is effected by a direct assay of axon regeneration.
  • the method of the foregoing aspect further comprises an antecedent step of determining that the neuron is injured, and has axotomy-induced stress.
  • the method of the foregoing aspect further comprises contacting the injured neuron with a PTEN inhibitor, inhibitor of suppressor of cytokine signaling 3 (SOCS3), inosine, oncomodulin, BNDF, NGF, CNTF, or combinations thereof.
  • a PTEN inhibitor inhibitor of suppressor of cytokine signaling 3 (SOCS3), inosine, oncomodulin, BNDF, NGF, CNTF, or combinations thereof.
  • SOCS3 suppressor of cytokine signaling 3
  • the inhibitor of SOCS3 comprises a SOCS3 specific hpRNA or siRNA.
  • the PTEN inhibitor is, (a) potassium
  • the neuron is human.
  • technology herein relates to a method of treating a subject for neuronal injury, comprising: administering to the subject an agent that increases mitochondrial motility in injured neurons, wherein the administering results in contacting the injured neurons of the subject with the agent in an amount sufficient to promote survival of, or axon regeneration in the injured neurons, such that the subject is treated.
  • the agent is administered intravenously, intracortically, intracerebrally, intrathecally, intranasally, ocularly or locally at the site of neuronal injury.
  • the neuronal injury results from a traumatic injury, traumatic brain injury, optic nerve injury, acute spinal cord injury, stroke, restorative CNS surgery or CNS degeneration.
  • the neuronal injury results from restorative CNS injusry and wherein the agent is administered prior to, during or following restorative CNS surgery.
  • the agent is Armcxl polypeptide.
  • the Armcxl polypeptide is recombinant.
  • the Armxcl polypeptide comprises a carrier peptide or lipophilic molecular group and/or is encapsulated in a liposome or a nanoparticle.
  • the agent is a vector comprising a nucleic acid sequence that encodes a Armcxl polypeptide.
  • the vector is a viral vector or non-viral vector.
  • the viral vector is selected from the group consisting of retrovirus, lentivirus, adenovirus, herpesvirus, poxvirus, alpha virus, vaccinia virus, and adeno-associated viruses.
  • the non-viral vector is selected from the group consisting of a nanoparticle, a cationic lipid, a cationic polymer, a metallic nanoparticle, a nanorod, a liposome, microbubbles, a cell penetrating peptide and a liposphere.
  • the Armcxl polypeptide is of human origin.
  • the Armcxl polypeptide comprises the sequence of
  • the Armcxl polypeptide has at least 95% amino acid sequence identity to SEQ ID NO: 1 and retains at least 80% of the biological activity of human Armcxl of SEQ ID NO: 1.
  • technology herein relates to a method of treating a subject for a disease or disorder characterized by neuronal death or diminished potential for axonal growth, comprising administering to the subject an agent that increases mitochondrial motility, in an amount sufficient to promote survival of, or axonal growth in neurons, such that the subject is treated.
  • the disorder is selected from group comprising of glaucoma, stroke, head trauma, spinal injury, optic injury, ischemia, hypoxia,
  • neurodegenerative disease multiple sclerosis, infectious disease, cancer, and autoimmune disease.
  • the agent is Armcxl polypeptide or a vector comprising a nucleic acid sequence encoding an Armcxl polypeptide.
  • a method for promoting survival of, or axon regeneration in an injured mature central nervous system neuron in a subject determined to have a neuronal injury comprising, administering to the subject Armcxl polypeptide or an analog thereof in an amount sufficient to promote survival of, or axon regeneration of the injured neuron.
  • technology herein relates to a device for promoting survival of, or axon regeneration in an injured mature central nervous system (CNS) neuron in situ, comprising a therapeutically effective amount of an agent that increases mitochondrial motility in the neuron, and wherein the device locally releases the agent into the CNS for promoting survival of, or axon regeneration in an injured mature central system (CNS) neuron.
  • CNS central nervous system
  • the device of the foregoing aspect comprises a CNS- implantable solid or semi-solid device selected from a biodegradable matrix, fiber, pump, stent, adsorbable gelatin osmotic pump or indwelling catheter.
  • a pharmaceutical composition comprising an effective amount of Armcxl polypeptide or a vector comprising a nucleic acid sequence encoding the Armcxl polypeptide and a pharmaceutically acceptable carrier, for use in promoting survival of, or regeneration of axon in injured neurons.
  • the Armcxl polypeptide is of human origin. [0045] In some embodiments, the Armcxl polypeptide comprises the sequence of
  • the Armcxl polypeptide has at least 95% amino acid sequence identity to SEQ ID NO: 1 and retains at least 80% of the biological activity of human Armcxl of SEQ ID NO: 1.
  • the Armcxl polypeptide is fused to a carrier polypeptide.
  • the vector is a viral or non-viral vector.
  • the viral vector is selected from the group consisting of retrovirus, lentivirus, adenovirus, herpesvirus, poxvirus, alpha virus, vaccinia virus, and adeno-associated viruses.
  • the non-viral vector is selected from the group consisting of a nanoparticle, a cationic lipid, a cationic polymer, a metallic nanoparticle, a nanorod, a liposome, microbubbles, a cell penetrating peptide and a liposphere.
  • the Armcxl polypeptide or the vector comprising a nucleic acid sequence encoding the Armcxl polypeptide is formulated with a lipophilic molecular group and/or encapsulated in a liposome or a nanoparticle.
  • compositions of the foregoing aspects are formulated for administration to the brain, spinal cord, or optical nerve.
  • the composition is formulated for administration via intracerebroventricular, intranasal, intracranial, intracelial, intracerebellar, or intrathecal administration route.
  • the pharmaceutical composition is contained in a delivery device selected from the group consisting of a syringe, a blunt tip syringe, a catheter, an inhaler, a nebulizer, a nasal spray pump, a nasal irrigation pump or nasal lavage pump, and an implantable pump.
  • a delivery device selected from the group consisting of a syringe, a blunt tip syringe, a catheter, an inhaler, a nebulizer, a nasal spray pump, a nasal irrigation pump or nasal lavage pump, and an implantable pump.
  • the technology herein relates to a pharmaceutical composition
  • a pharmaceutical composition comprising an agent that increases mitochondrial motility in injured neuron and a pharmaceutically acceptable carrier, for use in promoting survival of, or regeneration of axon in injured neurons.
  • the agent is Armcxl polypeptide or a vector comprising a nucleic acid sequence encoding the Armcxl polypeptide.
  • the technology herein relates to a method for identifying an agent effective in promoting survival of, or axon regeneration in neurons after injury, the method comprising: (a) contacting a neuron with a candidate agent; (b) determining expression level of Armcxl in the neurons from step (a); and (c) identifying the candidate agent as effective if the expression level of Armcxl is increased relative to a reference level upon the contact of the neuron with the candidate agent; or identifying the candidate agent as ineffective if the expression level of Armcxl is not changed relative to a reference level upon the contact of the neuron with the candidate agent.
  • the reference level is expression level of Armcxl in neurons prior to contact with the candidate agent.
  • the contacting is in vitro or in vivo.
  • the term "consisting essentially of” refers to those elements required for a given embodiment. The term permits the presence of elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment of the invention.
  • compositions, methods, and respective components thereof as described herein which are exclusive of any element not recited in that description of the embodiment.
  • disease refers to any alternation in state of the body or of some of the organs, interrupting or disturbing the performance of the functions and/or causing symptoms such as discomfort, dysfunction, distress, or even death to the person afflicted or those in contact with a person.
  • a disease or disorder can also be related to a distemper, ailing, ailment, malady, disorder, sickness, illness, complaint, or affectation.
  • in need thereof when used in the context of a therapeutic or prophylactic treatment, means having a disease, being diagnosed with a disease, or being in need of preventing a disease, e.g., for one at risk of developing the disease.
  • a subject in need thereof can be a subject in need of treating or preventing a disease.
  • mitochondrial motility refers to mitochondrial movement within a cell. Motility of mitochondria is another aspect of mitochondrial dynamics beyond fusion and fission. This aspect is critically important in highly polarized cells, such as neurons.
  • increase in mitochondrial motility refers to the fraction of time mitochondria is in motion rather than paused.
  • increase in mitochondrial motility refers to increase in the motile mitochondrial pool.
  • the term "pharmaceutically acceptable” refers to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
  • the term "pharmaceutically acceptable carrier” means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid or solvent encapsulating material necessary or used in formulating an active ingredient or agent for delivery to a subject.
  • a pharmaceutically-acceptable material, composition or vehicle such as a liquid or solid filler, diluent, excipient, manufacturing aid or solvent encapsulating material necessary or used in formulating an active ingredient or agent for delivery to a subject.
  • Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient.
  • Armcxl polypeptide or vector comprising a nucleic acid sequence encoding an Armcxl polypeptide or compositions provided herein can be formulated in liposomes to promote delivery across membranes.
  • liposome refers to a vesicular structure having lipid-containing membranes enclosing an aqueous interior. In cell biology, a vesicular structure is a hollow, lamellar, spherical structure, and provides a small and enclosed compartment, separated from the cytosol by at least one lipid bilayer. Liposomes can have one or more lipid membranes.
  • Oligolamellar large vesicles and multilamellar vesicles have multiple, usually concentric, membrane layers and are typically larger than lOOnm. Liposomes with several nonconcentric membranes, i.e., several smaller vesicles contained within a larger vesicle, are termed multivesicular vesicles.
  • Liposomes can further comprise one or more additional lipids and/or other components such as sterols, e.g.,, cholesterol. Additional lipids can be included in the liposome compositions for a variety of purposes, such as to prevent lipid oxidation, to stabilize the bilayer, to reduce aggregation during formation or to attach ligands onto the liposome surface. Any of a number of additional lipids and/or other components can be present, including amphipathic, neutral, cationic, anionic lipids, and programmable fusion lipids. Such lipids and/or components can be used alone or in combination. One or more components of the liposome can comprise a ligand, e.g.,, a targeting ligand.
  • a ligand e.g., a targeting ligand.
  • Liposome compositions can be prepared by a variety of methods that are known in the art. See e.g., patents cited as reference, (25, 26, 27, 28, 29, 30). Niosomes are non-phospholipid based synthetic vesicles that have properties and function like liposomes.
  • nanoparticle refers to a particle having a size between 1 and 1000 nm which can be manufactured from artificial or natural macromolecular substances.
  • drugs or other biologically active materials can be bound drugs or other biologically active materials by covalent, ionic or adsorptive linkage, or the latter can be incorporated into the material of the nanoparticles.
  • Nanoparticles may or may not exhibit size-related properties that differ significantly from those observed in fine particles or bulk materials. Nanoparticles provide improved bioavailability by enhancing aqueous solubility, increasing resistance time in the body (increasing half-life for clearance/increasing specificity for its cognate receptors and targeting drug to specific location in the body (its site of action).
  • Nanoparticles include solid lipid nanoparticles (comprise lipids that are in solid phase at room temperature and surfactants for emulsification, the mean diameters of which range from 50 nm to 1000 nm for colloid drug delivery applications), liposomes, nanoemulsions (oil-in-water emulsions done on a nano-scale), albumin nanoparticles, and polymeric nanoparticles.
  • Nanoparticles can be surface coated to modulate their stability, solubility, and targeting.
  • a coating that is multivalent or polymeric confers high stability (34).
  • a non- limiting example includes coating with hydrophilic polymer such as polyethylene glycol or ploysorbate-80.
  • lipophilic molecular group refers to a lipid moiety, such as a fatty acid, glyceride or phospholipid which when coupled to a therapeutic molecule to be a targeted to the brain, increases its lipophilicity and hence movement across blood brain barrier.
  • the lipophilic molecular group can be attached to the therapeutic molecule through an ester bond.
  • a lipophilic molecular group can enable uptake of the agents or compositions herein into the mitochondria of the neurons.
  • carrier polypeptide refers to a peptide which exhibits substantially no bioactivity. In some embodiments, the carrier peptide is a
  • mitochondria targeting peptide and which is capable of targeting the agent to the
  • the carrier peptide capable of passing the blood-brain barrier.
  • the carrier peptide can be an endogenous peptide whose receptor is present on the cerebral capillary endothelial cell, such as insulin, insulin-like growth factor (IGF), leptin and transferrin or fragments thereof (see, e.g.,, reference 35).
  • the carrier peptide can be, for example, a short cell penetrating peptide of less than 30 amino acids that are amphipathic in nature and are able to interact with lipidic membranes.
  • Non-limiting examples of carrier peptides include SynB3, TAT ( HIV-1 trans- activating transcriptor).
  • the term "in combination” refers to the use of more than one prophylactic and/or therapeutic agent simultaneously or sequentially and in a manner such that their respective effects are additive or synergistic.
  • the term "effective amount” can be used interchangbly with “therapeutically effective amount” as used herein, refers to an amount sufficient to affect a beneficial or desired clinical result upon treatment.
  • the term “effective amount” means an amount of an agent e.g., Armcxl polypeptide, sufficient to measurably increase at least one of; mitochondrial motility in injured neurons, ii. survival of injured neurons , or iii) axon regeneration in injured neurons by at least 3 fold, at least 2.5 fold, at least 2 fold, at least 1.5 fold upon contacting with injured neurons, ex vivo or in vivo with effective amount relative to absence of contacting.
  • the increase in at least one of the desired biological activity can result in a measurable effect in terms of neuronal repair in a treated subject against for e.g., neurodegenerative disease, brain trauma, stroke.
  • the effective amounts may vary, as recognized by those skilled in the art, depending on the number of neurons to be contacted, the duration of contact, the specific underlying disease resulting in neuronal injury, intensity of prior therapy such as chemotherapy or radiotherapy.
  • the effective amount of an active therapeutic agent used to practice the present disclosure for the treatment of a CNS disease or neuronal injury varies depending upon the manner of administration, the age, body weight, and general health of the subject. Ultimately, the attending clinician will decide the appropriate amount and dosage regimen. Such amount is referred to as an "effective" amount.
  • An effective amount can therefore result in a clinical outcome of at least one selected from; increased survival of injured neurons or increased axon regeneration in injured neurons and cause treatment, reverse, alleviate, ameliorate, inhibit, slow down or stop the progression or severity of the disease characterized by, resulting in, or due to neuronal injury.
  • promoting regeneration of axon is meant increasing the number of axons or the distance of extension of axons relative to a control condition (e.g., in non-injured neurons). Preferably the increase is by at least 2-fold, 2.5-fold, 3-fold or more.
  • fragment is meant a portion of a polypeptide that has at least 50% of the biological activity of the polypeptide from which it is derived. This portion contains, preferably, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the entire length of the reference nucleic acid molecule or polypeptide.
  • a fragment of a polypeptide or nucleic acid molecule may contain 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 nucleotides or amino acids.
  • nerve any nerve cell derived from the nervous system of a mammal (e.g., mature neuron of the central nervous system).
  • restorative CNS surgery is meant any procedure carried out on the central nervous system to enhance neurological function.
  • An exemplary restorative CNS surgery is a peripheral nerve graft or a reinsertion of avulsed nerve roots.
  • the terms “treat,” “treatment,” “treating,” or “amelioration” refer to therapeutic treatments, wherein the object is to reverse, alleviate, ameliorate, inhibit, slow down or stop the progression or severity of a disorder or syndrome, (e.g.,, neuronal injury, glaucoma, stroke, head trauma, spinal injury, optic injury, ischemia, hypoxia, neurodegenerative disease, multiple sclerosis, infectious disease, cancer, and autoimmune disease) characterized by or making a patient susceptible to neuronal death and or inhibition of axon generation.
  • a disorder or syndrome e.g., neuronal injury, glaucoma, stroke, head trauma, spinal injury, optic injury, ischemia, hypoxia, neurodegenerative disease, multiple sclerosis, infectious disease, cancer, and autoimmune disease
  • treating includes reducing or alleviating at least one adverse effect or symptom of a syndrome. Treatment is generally "effective” if one or more symptoms or clinical markers are reduced.
  • “effective treatment” refers to a treatment that increases the number of surviving neurons and/or increases the number of axons in the neurons) and maintains normal function of the neurons.
  • treatment is “effective” if the progression of a disease is reduced or halted. That is, “treatment” includes not just the improvement of symptoms or markers, but also a cessation of, or at least slowing of, progress or worsening of symptoms compared to what would be expected in the absence of treatment.
  • Beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptom(s), diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, remission (whether partial or total), and/or decreased mortality.
  • treatment is considered effective if the condition is stabilized.
  • treatment also includes providing relief from the symptoms or side-effects of the disease (including palliative treatment).
  • the term “gene expression” includes both gene transcription, whereby DNA (or RNA in the case of some RNA-containing viruses) corresponding to a gene is transcribed to generate an RNA molecule and RNA translation, whereby an RNA molecule is translated to generate a protein encoded by the gene.
  • protein expression is used to refer both to gene expression comprising transcription of DNA (or RNA) to form an RNA molecule and subsequent processing and translation of the RNA molecule to form protein and to gene expression comprising translation of mRNA to form protein.
  • a DNA molecule can encode an RNA molecule (e.g., by the process of transcription incorporating a DNA-dependent RNA polymerase enzyme).
  • an RNA molecule can encode a polypeptide, as in the process of translation.
  • the term “encode” also extends to the triplet codon that encodes an amino acid.
  • an RNA molecule can encode a DNA molecule, e.g., by the process of reverse transcription incorporating an RNA-dependent DNA polymerase.
  • a DNA molecule can encode a polypeptide, where it is understood that "encode” as used in that case incorporates both the processes of transcription and translation.
  • a "subject”, “patient”, “individual” and like terms are used interchangeably and refers to a vertebrate, preferably a mammal, e.g., a primate, e.g., a human. Mammals include, without limitation, humans, primates, rodents, wild or
  • domesticated animals including feral animals, farm animals, sport animals, and pets.
  • Primates include, for example, chimpanzees, cynomologous monkeys, spider monkeys, and macaques, e.g., Rhesus.
  • Rodents include, for example, mice, rats, woodchucks, ferrets, rabbits and hamsters.
  • Domestic and game animals include, for example, cows, horses, pigs, deer, bison, buffalo, feline species, e.g., domestic cat, and canine species, e.g., dog, fox, wolf, avian species, e.g., chicken, emu, ostrich, and fish, e.g., trout, catfish and salmon.
  • the terms, "individual,” “patient” and “subject” are used interchangeably herein.
  • the subject is a human.
  • a subject can be male or female.
  • a “pharmaceutical composition” refers to a chemical or biological
  • compositions suitable for administration to a mammalian subject may be specifically formulated for administration via one or more of a number of routes, including but not limited to, oral, parenteral, intravenous, intraarterial, subcutaneous, intranasal, sublingual, intraspinal, intracerebroventricular, ocular and the like.
  • Mammals other than humans can be advantageously used as subjects that represent animal models of conditions or disorders disclosed herein.
  • the subject is a non-human primate animal in a model for neurodegeneration or nervous system (CNS or PNS) injury.
  • Neurons derived from said subjects are also suitable for performance of the methods described herein.
  • a subject can be one who has been previously diagnosed with or identified as suffering from or under medical supervision for a disorder characterized by neuronal injury.
  • a subject can be one who has undergone or will be undergoing a CNS restorative surgery or axotomy.
  • a subject can be one who is diagnosed and currently being treated for, or seeking treatment, monitoring, adjustment or modification of an existing therapeutic treatment, or is at a risk of developing such a disorder.
  • administering refers to the placement of an agent
  • Armcxl polypeptide or a vector comprising a nucleic acid sequence encoding the Armcxl polypeptide as disclosed herein into a subject by a method or route that results in at least partial delivery of the agent at a desired site (e.g., at or near the site of neuronal injury) such that the administering results in contact of the injured neurons with the agent.
  • compositions comprising the agent or cell preparation disclosed herein can be administered by any appropriate route which results in an effective treatment in the subject, e.g., intracerebroventricular ("icv") administration, intranasal administration, intracranial administration, intracelial administration, intracerebellar administration, or intrathecal administration. Administration can be continuous or intermittent.
  • a preparation or an agent can be administered therapeutically; that is, administered to treat an existing disease or condition.
  • a preparation can be administered prophylactically; that is, administered for prevention of a disease or condition (e.g., neuronal injury).
  • the term "contacting" as used herein, refers to bringing a disclosed agent (e.g.
  • mitochondria mitochondria, neuronal cell, axon etc.
  • axon a molecule, co-factor, factor, or protein on which the activity of the target is dependent.
  • protein As used herein, the terms “protein”, “peptide” and “polypeptide” are used interchangeably to designate a series of amino acid residues connected to each other by peptide bonds between the alpha-amino and carboxy groups of adjacent residues.
  • the terms “protein”, “peptide” and “polypeptide” refer to a polymer of amino acids, including modified amino acids (e.g.,phosphorylated, glycated, glycosylated, etc.) and amino acid analogs, regardless of its size or function.
  • modified amino acids e.g.,phosphorylated, glycated, glycosylated, etc.
  • amino acid analogs regardless of its size or function.
  • Protein and “polypeptide” are often used in reference to relatively large polypeptides, whereas the term “peptide” is often used in reference to small polypeptides, but usage of these terms in the art overlaps.
  • the terms “protein”, “peptide” and “polypeptide” are used interchangeably herein when
  • neurodegeneration refers to a physiological state caused by neuronal injury associated with neuronal loss and/or damage, or loss of axon regeneration. In specific aspects, neurodegeneration refers to neuronal injury resulting in impaired cognitive function.
  • neuronal injury refers to any damage or dysfunction exhibited by neurons, including but not limited to loss of myelin, dendrite retraction, dendritic spine density reduction, axonal damage, loss of axon regeneration and neuronal death.
  • small molecule refers to a molecule of a size comparable to those organic molecules generally used in pharmaceuticals.
  • Preferred small organic molecules range in size up to about 5000 Da, more preferably up to 2000 Da, and most preferably up to about 1000 Da.
  • neutral nervous system includes the process by which axons or dendrites extend from a neuron.
  • the outgrowth can result in a new neuritic projection or in the extension of a previously existing cellular process.
  • Neurite outgrowth may include linear extension of an axonal process by five cell-diameters or more.
  • "Central nervous system (CNS) neurons” include the neurons of the brain, the cranial nerves and the spinal cord. The invention relates not only to CNS neurons but also to peripheral neurons that make projections (axons) in CNS, for instance dorsal root ganglion neurons.
  • brain injury is the destruction or degeneration of brain cells is in the brain of a living organism. Brain injuries can result from direct impacts to the head. Such injuries are for example traumatic brain injury and spinal cord injury.
  • the present invention may also be used in treating other neuronal disorders, which include disease, disorder, or condition directly or indirectly affecting the normal functioning or anatomy of a subject's nervous system.
  • the disorder may be a neuronal injury, which can be acute or chronic. Examples of acute injury are those that results from surgery, trauma, compression, contusion, transection or other physical injury, vascular pharmacologic or other insults including hemorrhagic or ischemic damage.
  • Chronic neuronal injury may result from repetitive stress, inflammation/oxidative stress within a neural tissue caused by disease, neurodegenerative or other neurological diseases.
  • the method and compositions provided herein can be beneficial in all diseases where the CSPG matrix is inhibitory for regeneration or maintenance of axons, such as TBI, SCI, multiple sclerosis (MS disease) and amyotrophic lateral sclerosis (ALS).
  • TBI Traumatic brain injury, TBI as used herein includes the condition in which a traumatic blow to the head causes damage to the brain or connecting spinal cord, with or without penetrating the skull. It relates more specifically to the actual mechanical damage that occurs at the type of trauma, such as shearing, tearing and stretching of axons, neurons and blood vessels. Usually, the initial trauma can result in expanding hematoma,
  • a spinal cord injury, SCI as used herein is damage to any part of the spinal cord or nerves at the end of the spinal canal. It often causes permanent changes in strength, sensation and other body functions below the site of the injury.
  • the spinal cord injury may be a complete severing of the spinal cord, a partial severing of the spinal cord, or a crushing or compression injury of the spinal cord.
  • Spinal cord injury SCI proceeds over minutes, hours, days and even months after the initial traumatic insult and can lead to significant expansion of the original damage. These secondary events are a consequence of delayed biochemical, metabolic and cellular changes, which are initiated by the primary injury, and includes inflammation, free radical induced cell death and glutamate excitotoxicity.
  • Axonal sprouting, from surviving neurons, is associated with spontaneous motor and sensory recovery following TBI and SCI. Although the CNS has a limited capacity to regenerate, spontaneous pericontusional axon sprouting does take place approximately 1-2 weeks after trauma.
  • CSPGs chon- rioting sulphate proteoglycans
  • ChABC chondroitinase ABC
  • the terms “increased” 'increase”, “increasing” or “enhance” are all used herein to generally mean an increase by a statically significant amount; for the avoidance of doubt, the terms “increased”, “increase”, or “enhance”, mean an increase of at least 10% as compared to a reference level, for example an increase of at least about 10%, at least about 20%), or at least about 30%>, or at least about 40%>, or at least about 50%>, or at least about 60%), or at least about 70%>, or at least about 80%>, or at least about 90%> or up to and including a 100%> increase or any increase between 10-100%) as compared to a reference level, or at least about a 2-fold, or at least about a 3 -fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater as compared to a reference level.
  • the increase can be, for example, at least 10%>
  • control level refers to a level of expression of Armcxl in a "control sample”.
  • a control sample can be one that has not been contacted with an agent of the present disclosure.
  • a control sample is obtained prior to administration of the inhibitor.
  • a reference standard is used as a surrogate for a control sample.
  • the term "vector” is used in reference to a vehicle used to introduce a nucleic acid sequence into a cell.
  • a viral vector is virus that has been modified to allow recombinant DNA sequences to be introduced into host cells or cell organelles.
  • a non- viral vector delivers an amplified amount of agent or nucleic acid to a target tissue, cell or subcellular area, and comprise a lipid based or solid platform suitable for binding a number of substances (e.g., nanoparticle, liposomes etc.).
  • Nucleic acid sequence refers to a polymer of nucleotides in which the 3' position of one nucleotide sugar is linked to the 5' position of the next by a phosphodiester bridge. In a linear nucleic acid strand, one end typically has a free 5' phosphate group, the other a free 3' hydroxyl group. Nucleic acid sequences may be used herein to refer to oligonucleotides, or polynucleotides, and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin that may be single- or double-stranded, and represent the sense or antisense strand.
  • “decrease”, “reduce”, “reduction”, “lower” or “lowering,” or “inhibit” are all used herein generally to mean a decrease by a statistically significant amount.
  • “decrease”, “reduce”, “reduction”, or “inhibit” means a decrease by at least 10% as compared to a reference level, for example a decrease by at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%), or at least about 80%, or at least about 90% or up to and including a 100% decrease (e.g., absent level or non-detectable level as compared to a reference level), or any decrease between 10-100%) as compared to a reference level.
  • a marker or symptom by these terms is meant a statistically significant decrease in such level.
  • the decrease can be, for example, at least 10%, at least 20%, at least 30%, at least 40% or more, and is preferably down to a level accepted as within the range of normal for an individual without a given disease.
  • FIGs. 1A-1H show Armcxl is up-regulated in high regeneration conditions in vivo and localizes to mitochondria.
  • FIG. 1A In situ hybridization showing Armcxl mRNA levels in mouse retina cross-sections of wild type and high regeneration mutant PTEN, SOCS3 double KO +CNTF (dKO) and PTEN single KO (PTEN "/_ ) in intact conditions or 3 days post optic nerve crush. Arrow head indicates the retinal ganglion cells layer (GCL). Scale bar: 50 ⁇ .
  • FIG. IB Immunohistochemistry showing the level of endogenous Armcxl protein in intact retina or 3 days post optic nerve crush in wild type and high regeneration mutant dKO. Tuj l antibody is used as a RGC marker.
  • FIG. 1C Quantification of the percentage of Armcxl positive RGCs from matched sections of 2-3 animals per condition. One-way ANOVA with Tuckey's multiple comparison test.
  • FIG. ID Scheme of Armcxl constructs full length and mutant.
  • FIG. IE Immunoblot using anti-HA antibody on HEK cell extract transfected either with Armcxl-HA full length or Armcxl-HA lacking the trans membrane domain (ArmcxlATM-HA). Lower panel shows unspecific bands of lower molecular weights used as loading control.
  • FIG. 1F-1G Quantification of the percentage of Armcxl positive RGCs from matched sections of 2-3 animals per condition. One-way ANOVA with Tuckey's multiple comparison test.
  • FIG. ID Scheme of Armcxl constructs full length and mutant.
  • FIG. IE Immunoblot using anti-HA antibody on HEK cell extract transfected either with Armcxl-HA full length or Armcxl-HA lacking the trans membrane domain (ArmcxlATM
  • FIG. IF Immunohistochemistry using anti-HA antibody of mouse cortical neurons co-transfected with MitoDsRed2 and Armcxl-HA
  • FIG. 1G Low magnification picture of transfected neurons can be seen in FIG. 7B, discussed below. Lower panel shows signal intensity measured by line scan. Scale bar: 25 ⁇ .
  • FIGs. 2A-2G show Armcxl increases mitochondrial transport and axonal outgrowth of adult RGCs.
  • FIG. 2A Representative kymographs from live imaging of TMRM labeled mitochondria in RGC axons of adult retina explant from PTEN ⁇ mice co- injected with AAV-Cre and either AAV-PLAP, AAV- Armcxl or AAV- Arm cx 1 ⁇ .
  • FIG. 2A Representative kymographs from live imaging of TMRM labeled mitochondria in RGC axons of adult retina explant from PTEN ⁇ mice co- injected with AAV-PLAP, AAV- Armcxl or AAV- Arm cx 1 ⁇ .
  • FIGs. 3A-3D show Effect of Armcxl overexpression in E18 cortical neurons.
  • FIG. 3A Representative kymographs from live imaging of mitochondria in El 8 cortical neurons co-transfected with MitoDsRed and either GFP or Armcxl -F2A-GFP. Traces from motile mitochondria were isolated and represented by the bellow kymographs.
  • FIG. 3A Representative kymographs from live imaging of mitochondria in El 8 cortical neurons co-transfected with MitoDsRed and either GFP or Armcxl -F2A-GFP. Traces from motile mitochondria were isolated and represented by the bellow kymographs.
  • FIG. 3B Percentage of
  • FIG. 3D Representative images of El 8 cortical neurons transfected with GFP or Armcxl -F2A-GFP. Scale bar: ⁇ .
  • FIG. 3E Box plots showing the
  • FIGs. 4A-4E shows Armcxl promotes axonal regeneration and neuronal survival.
  • FIG. 4A Optical sections (approximately 14 ⁇ ) from whole mount cleared optic nerve from wild type mice injected with AAV -PLAP, AAV-Armcxl or AAV-ArmcxlATM, 15 days post optic nerve crush (dashed line). Axons were labeled with CTB injection. Scale bar: ⁇ .
  • FIG. 4B Full nerve thickness z projections of the cleared optic nerves shown in FIG. 4A.
  • FIG. 4C Bar plot showing the average total number of axons growing past the injury site based on the z projection of the whole mount cleared optic nerve.
  • FIGs. 5A-5F show Armcxl potentiates axonal regeneration of PTEN deleted RGCs.
  • FIG. 5A Optic nerve sections of PTEN ⁇ mice co-injected with AAV-Cre and the indicated AAVs, 15 days post optic nerve crush (dashed line). Axons were labeled with intraocular CTB injection. Scale bar: ⁇ . Pictures of the full nerve can be seen in FIG. l 1, discussed below.
  • FIG.5C Tuj 1 immunohistochemistry of whole mount retina from PTEN ⁇ mice shown in FIG. 5A.
  • FIG.5E Optic nerve longitudinal sections 15 days post crush of Kcng4-YFP mice injected with CTB and the indicated AAVs.
  • the YFP channel (was visualized as green) shows the axons projecting from the aRGCs (Kcng4-YFP) and the RFP channel (was visualized as red) shows the CTB labeled axons from all RGCs.
  • FIGs. 6A-6F show Armcxl is necessary for axonal regeneration. (FIG. 6A)
  • FIGs. 7A-7B show expression of Armcxl homologues in high regeneration capacities RGCs and Armcxl co-localization with mitochondria.
  • FIGs. 8A-8C shows characterization of AAV infected adult retina explants.
  • FIG. 8A Representative images of whole mount retinas from Wt mice injected with the indicated AAVs. 15 days post viral injections, mice were euthanized and
  • FIGs. 9A-9C shows Armcxl overexpression does not affect mitochondrial density and transport of BDNF positive vesicles.
  • FIG. 9B Representative kymographs from live imaging experiments of BDNF positive vesicles in El 8 cortical neurons co-transfected with BDNF- RFP and either GFP or Armcx 1-F2A-GFP.
  • FIGs. 10A-10D show Armcxl improve axonal regeneration independently of its survival effect.
  • FIG. IOC Optical sections
  • FIGs. 11A-11C shows Armcxl overexpression in PTEN _/" potentiates regeneration phenotype and partially recapitulates axonal regeneration phenotype of dKO.
  • FIG. 11B Side by side comparison of optic nerve sections of PTEN _/" mice injected with the indicated AAVs and dKO, 15 days post optic nerve crush (dashed red line). All AAVs were injected and incubated in parallel in all conditions.
  • FIGs. 12A-12K Armcxl is necessary for dKO high regeneration phenotype.
  • FIG. 12J Optic nerve sections of dKO mice injected with the indicated AAVs, 15 days post optic nerve crush. Axons were labeled with CTB injection. Images with tissues were stitched and black tiles were added to complete the rectangular shape. Scale bar 500 ⁇ .
  • Armcxl correlates with high axonal regeneration, modulates the transport of the axonal mitochondria and promotes neuronal survival and axonal regeneration. Described herein are compositions and methods to promote survival of neurons and/or axons regeneration of neurons. Provided herein are methods and compositions useful for neuronal injury or a disease or disorder causing neuronal injury or resulting from neuronal injury.
  • the methods and compositions provided herein encompasses contacting neurons with an agent for promoting their survival or axon regeneration.
  • the agent is a one that is capable of increasing mitochondrial motility in the neurons.
  • the agent is an Armcxl polypeptide.
  • the agent is a vector comprising a nucleic acid sequence encoding an Armcxl polypeptide.
  • Armadillo Repeat Containing, X-Linked protein 1 (Armcxl) [00125] Armcxl is a protein that is inserted in the mitochondria.
  • Armcxl or “Armcxl protein” or “Armcxl polypeptide” generally refers to an Armcxl polypeptide that is similar or identical in sequence to a wild-type Armcxl .
  • Armcxl polypeptide refers to a polypeptide having an amino acid sequence that is at least 80%, at least 85%>, at least 90%>, at least 95%>, at least 97%>, at least 99%), or 100%), identical to that of a wild-type Armcxl and that retains the ability, at a minimum, to increase mitochondrial motility in injured neurons and/or promote survival of injured neurons and/or promote axon regeneration of injured neurons in vivo. Accordingly in some embodiments, "Armcxl polypeptide" can be full length Armcxl . In some embodiments, “Armcxl polypeptide" can be full length Armcxl .
  • Armcxl can be a functional fragment of a full length Armcxl, a species homologue and/or functional fragments thereof, an ortholog of Armcxl and/or functional fragments thereof.
  • the Armcxl polypeptide can be a mammalian Armcxl protein.
  • the Armcxl polypeptide can also be a functional isoform of the full length Armcxl or functional fragment thereof.
  • Armcxl is a wild-type Armcxl of human origin, having the following amino acid sequence, or a functional fragment thereof:
  • a “functional fragment” refers to fragment of the full length Armcxl (e.g., corresponding to SEQ ID NO: 1) of at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140 consecutive amino acids of full length wild-type Armcxl, that has at least about 70%, 80%, 90%, 100% or more than 100% of the function of wild-type Armcxl (e.g., of SEQ ID NO: 1) at neuronal survival and/or axon regeneration of injured axons in vivo or in vitro.
  • the functional activity can be tested by one of ordinary skill in the art by the assays described in the examples.
  • the Armcxl polypeptide can be a mammalian homolog of human Armcxl or a functional fragment thereof.
  • Armcxl polypeptide has an amino acid sequence at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identical to the amino acid sequence of SEQ ID NO: 1 and increases at least one of i. mitochondrial motility in neurons,ii. survival of injured neurons and iii. axon regeneration of injured neurons.
  • Armcxl polypeptide has an amino acid sequence that has at least 85%, at least 90%, at least 95%, at least 97% or at least 99% amino acid sequence homology to amino acid sequence of SEQ ID NO: 1 and increases at least one of i. mitochondrial motility in neurons,ii. survival of injured neurons and iii. axon regeneration of injured neurons.
  • Armcxl is a functional fragment of SEQ ID NO: 1 of at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140 consecutive amino acids of SEQ ID NO: l, that has at least about 50%,60%, 70%, 80%, 90%, 100% or more than 100% of the function of wild type Armcxl (e.g., human Armcxl of SEQ ID NO: 1) of increasing at least one of i. mitochondrial motility in neurons, ii. survival of injured neurons and iii. axon regeneration of injured neurons, in vivo or in vitro.
  • the functional activity can be tested by one of ordinary skill in the art by the assays described in the examples.
  • Percent (%) amino acid sequence identity for a given polypeptide sequence relative to a reference sequence is defined as the percentage of identical amino acid residues identified after aligning the two sequences and introducing gaps if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity.
  • Percent (%) amino acid sequence homology for a given polypeptide sequence relative to a reference sequence is defined as the percentage of identical or strongly similar amino acid residues identified after aligning the two sequences and introducing gaps if necessary, to achieve the maximum percent homology.
  • Non identities of amino acid sequences include conservative substitutions, deletions or additions that do not affect the biological activity of Armcxl . Strongly similar amino acids can include, for example, conservative substitutions known in the art.
  • Percent identity and/or homology can be calculated using alignment methods known in the art, for instance alignment of the sequences can be conducted using publicly available software software such as BLAST, Align, ClustalW2. Those skilled in the art can determine the appropriate parameters for alignment, but the default parameters for BLAST are specifically contemplated.
  • Armcxl polypeptide useful in the methods and compositions described herein consists of, consists essentially of, or comprises an amino acid sequence, or is a fragment thereof derived from SEQ ID NO: 1, provided that the polypeptide retains at least one biological activity of full length Armcxl of SEQ ID NO: 1, the biological activity being selected from at a minimum, increasing i. mitochondrial motility in neurons, ii. survival of injured neurons and iii. axon regeneration of injured neurons, in vivo or in vitro.
  • polypeptides described herein can comprise conservative amino acid substitutions at one or more amino acid residues, e.g., at essential or non-essential amino acid residues but will retain a therapeutically or physiologically relevant activity of an inhibitory peptide as that term is described herein.
  • conservative amino acid substitution is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain.
  • Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
  • basic side chains e.g., lysine, arginine, histidine
  • acidic side chains e.g., aspartic acid
  • Armcxl can be a variant of wild type Armcxl .
  • variant refers to a polypeptide or nucleic acid that is "substantially similar” to a wild-type Armcxl .
  • a molecule is said to be “substantially similar” to another molecule if both molecules have substantially similar structures (i.e., they are at least 50% similar in amino acid sequence as determined by BLASTp alignment set at default parameters) and are substantially similar in at least one therapeutically or physiologically relevant biological activity.
  • a variant differs from the naturally occurring polypeptide or nucleic acid by one or more amino acid or nucleic acid deletions, additions, substitutions or side-chain modifications, yet retains one or more therapeutically relevant, specific functions or desired biological activities of the naturally occurring molecule, (e.g., at least one of i. mitochondrial motility in neurons, ii. survival of injured neurons and iii. axon regeneration of injured neurons, in vivo or in vitro.).
  • Amino acid substitutions include alterations in which an amino acid is replaced with a different naturally-occurring or a non-conventional amino acid residue. Some substitutions can be classified as "conservative,” in which case an amino acid residue contained in a polypeptide is replaced with another naturally occurring amino acid of similar character either in relation to polarity, side chain functionality or size.
  • substitutions encompassed by variants as described herein can also be "non-conservative," in which an amino acid residue which is present in a peptide is substituted with an amino acid having different properties (e.g., substituting a charged or hydrophobic amino acid with an uncharged or hydrophilic amino acid), or alternatively, in which a naturally-occurring amino acid is substituted with a non-conventional amino acid.
  • variants when used with reference to a polynucleotide or polypeptide, are variations in primary, secondary, or tertiary structure, as compared to a reference polynucleotide or polypeptide, respectively (e.g., as compared to a wild- type polynucleotide or polypeptide).
  • Polynucleotide changes can result in amino acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the reference sequence.
  • Variants can also include insertions, deletions or substitutions of amino acids in the peptide sequence. To be therapeutically useful, such variants will retain a therapeutically or physiologically relevant activity as that term is used herein.
  • the Armcxl polypeptide can be recombinant, purified, isolated, naturally occurring or synthetically produced.
  • the term "recombinant" when used in reference to a nucleic acid, protein, cell or a vector indicates that the nucleic acid, protein, vector or cell containing them have been modified by introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or a protein, or that the cell is derived from a cell so modified.
  • heterologous (meaning 'derived from a different organism') refers to the fact that often the transferred protein was initially derived from a different cell type or a different species from the recipient.
  • the protein itself is not transferred, but instead the genetic material coding for the protein (often the complementary DNA or cDNA) is added to the recipient cell.
  • Methods of generating and isolating recombinant polypeptides are known to those skilled in the art and can be performed using routine techniques in the field of recombinant genetics and protein expression. For standard recombinant methods, see
  • Armcxl can be an agonist of wild-type Armcxl, an analog or a derivative thereof.
  • Armcxl agonist as defined herein can be a compound that enhances or stimulates the normal biological activity of Armcxl by increasing transcription or translation of Armcxl -encoding nucleic acid, and/or by inhibiting or blocking activity of a molecule that inhibits Armcxl expression or Armcxl activity, and/or by enhancing normal Armcxl biological activity (including, but not limited to enhancing the stability of Armcxl or enhancing binding of Armcxl to a receptor and/or directly binding to and activating a potential Armcxl receptor.
  • the "biological activity” can be defined herein as including at least one of the activity selected from e.g., increasing i. mitochondrial motility in neurons, ii. survival of injured neurons and iii. axon regeneration of injured neurons, in vivo or in vitro.
  • the activity of the agonist can be for example, at least 80%, at least 85%>, at least 90%), at least 95%, at least 97% or at least 99% of the biological activity of human Armcxl of SEQ ID NO: l .
  • Armcxl analogs or Armcxl derivatives.
  • Armcxl analog it is meant a peptide whose sequence is derived from that of Armcxl including insertions, substitutions, extensions, and/or deletions, having at least some amino acid identity to Armcxl or region of an Armcxl polypeptide.
  • Analogs may have at least 50 or 55% amino acid sequence identity with a native Armcxl (e.g., human Armcxl, SEQ ID NO: 1) or at least 70%, 80%, 90%, or 95% amino acid sequence identity with a native Armcxl .
  • such analogs may comprise conservative or non-conservative amino acid substitutions (including non-natural amino acids and L and D forms).
  • Armcxl agonist analogs are analogs as herein described and function as an Armcxl agonist.
  • An "Armcxl derivative” is defined as a molecule having the amino acid sequence of a wild-type Armcxl (e.g., human Armcxl, SEQ ID NO: 1) or analog thereof, but additionally having a chemical modification of one or more of its amino acid side groups, alpha. -carbon atoms, terminal amino group, or terminal carboxylic acid group for example by ubiquitination, labeling, pegylation (derivatization with polyethylene glycol) or addition of other molecules.
  • a chemical modification includes, but is not limited to, adding chemical moieties, creating new bonds, and removing chemical moieties. Such modifications can improve the molecule's solubility, absorption, biological half-life, etc.
  • substantially similar in this context is meant that at least 50% of the relevant or desired biological activity of a corresponding wild-type peptide is retained.
  • the derivative retains at least 60%>, at least 70%, at least 80%>, at least 90%, at least 95%, or more, including 100% or even more (i.e., the derivative or variant has improved activity relative to wild-type) of the Armcxl .
  • the agonist of wild-type Armcxl, an analog or a derivative thereof retains at least one biological activity of full length ANG of SEQ ID NO: 1, the biological activity being selected from at a minimum, at least one of i. mitochondrial motility in neurons, ii. survival of injured neurons and iii. axon regeneration of injured neurons, in vivo or in vitro.
  • the agonist of wild-type Armcxl, an analog or a derivative thereof retains at least 50%, at least 60%, at least 70%, at least 80%, at least 90%), at least 100% or more than 100% of the biological activity of full length Armcxl of SEQ ID NO: 1.
  • an agent of the methods and compositions herein is a vector comprising a nucleic acid sequence encoding for an Armcxl polypeptide.
  • the vector is a viral vector.
  • the vector is non-viral vector.
  • the vector is an expression vector comprising a nucleic acid sequence encoding an Armcxl polypeptide.
  • Viral and non-viral -based gene transfer methods can be used to introduce nucleic acids encoding Armcxl polypeptides to cells or target tissues of the subject. Such methods can be used to administer nucleic acids encoding Armcxl polypeptides to cells in vitro.
  • Non-viral vector delivery systems include DNA plasmids, naked nucleic acid, and nucleic acid complexed with, for example, a liposome or other delivery vehicle.
  • Viral vector delivery systems include both DNA and RNA viruses, and can have either episomal or integrated genomes after delivery to the cell.
  • Methods of non-viral delivery of nucleic acids encoding engineered polypeptides of the invention include lipofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipid:nucleic acid conjugates, naked DNA, artificial virions, and agent-enhanced uptake of DNA.
  • Lipofection is described, e.g.,, in U.S. Pat. No. 5,049,386, U.S. Pat. No. 4,946,787; and U.S. Pat. No. 4,897,355, and lipofection reagents are sold commercially (e.g.,, TransfectamTM and LipofectinTM).
  • Cationic and neutral lipids that are suitable for efficient receptor-recognition lipofection of polynucleotides include those of Feigner, WO 91/17424, WO 91/16024. Delivery can be to cells (ex vivo administration) or target tissues (in vivo administration).
  • the preparation of lipid:nucleic acid complexes, including targeted liposomes such as immunolipid complexes, is well known to one of skill in the art (see, e.g., Crystal, Science270:404-410 (1995); Blaese et al., Cancer Gene Ther. 2:291-297 (1995); Behr et al., Bioconjugate Chem.
  • RNA or DNA viral based systems can be used to target the delivery of polynucleotides carried by the virus to specific cells in the body and deliver the
  • Viral vectors can be administered directly to patients (in vivo) or they can be used to transfect cells in vitro. In some cases, the transfected cells are administered to patients (ex vivo).
  • Conventional viral based systems for the delivery of polypeptides of the invention could include retroviral, lentivirus, adenoviral, adeno- associated and herpes simplex virus vectors for gene transfer.
  • Viral vectors are currently the most efficient and versatile method of gene transfer in target cells and tissues. Integration in the host genome is possible with the retrovirus, lentivirus, and adeno-associated virus gene transfer methods, often resulting in long term expression of the inserted transgene, and high transduction efficiencies.
  • the technology herein is partly based on the discovery that protein Armcxl increases mitochondrial motility, survival of injured neurons and regeneration of axon post injury. Accordingly the minimum set of biological activity of an agent (e.g., Armcxl) is at least one or combination of; i. increasing mitochondrial motility, ii. promoting survival of neurons (e.g. injured neurons) or iii. promoting regeneration of axons in the neurons (e.g., injured neurons).
  • an agent e.g., Armcxl
  • the minimum set of biological activity of an agent is at least one or combination of; i. increasing mitochondrial motility, ii. promoting survival of neurons (e.g. injured neurons) or iii. promoting regeneration of axons in the neurons (e.g., injured neurons).
  • Increased mitochondrial motility can be e.g., increase in the total pool of motile mitochondria or increase in the fraction of time mitochondria is in motion in neurons contacted by the agents, compared to that in absence of contact with the agent.
  • the increase can be e.g., at least 10%, 20%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75% or more relative to in neurons not contacted with the agent.
  • Increased survival of neurons is indicated by the number of neurons surviving from a specific injury or condition upon contact with an agent disclosed herein (e.g., Armcxl polypeptide), as compared to the number of neurons surviving in absence of said contact, and also by the length of time the survival persists upon contact with an agent disclosed herein (e.g., Armcxl polypeptide), as compared to that in absence of contact. Survival is considered to be sustained if it persists for an extended period of time post-injury (e.g., greater than 2 weeks post -injury, greater than 3 weeks, and greater than 4 weeks postinjury).
  • an agent disclosed herein e.g., Armcxl polypeptide
  • greater than 10% of neurons e.g., 15%, 20%, 25%, 30%, 35%, 0%, 45%, 50%, 55%), 60%), 65%), 70%) and 75%), survive upon contact with one or more agents disclosed herein.
  • greater than 20% of neurons e.g., 25%, 30%, 35%, 0%, 45%, 50%), 55%), 60%), 65%), 70% and 75%), survive for an extended period of time post-injury.
  • the regenerated axons extend at least 0.5 mm distal to the lesion epicenter. In one embodiment, greater than 10% or greater than 20% (e.g., 15%, 20%, 25%, 30%, 35%, 0%, 45%, 50%, 55%, 60%, 65%, 70% and 75%) of neurons regenerate injured axons or generate axons over 1 mm distal to the lesion site. In one embodiment, greater than 10% (e.g., 15%, 20%, 25%, 30%, 35%, 0%, 45%, 50%, 55%, 60%, 65%, 70% and 75%)) or greater than 20% of neurons regenerate or generate new axons that extend at least 2 mm distal from the lesion site.
  • An activator of protein translation e.g., a mTOR pathway activator; a PTEN inhibitor; a TSCl/2 inhibitor; an Akt activator; a Ras/MEK pathway activator; or a PRAS40 inhibitor can promote the survival of, or axon regeneration in the neuron. See for e,g, US 20090305333 Al, the contents of which are incorporated herein in its entirety.
  • PTEN inhibitors e.g., in US 20090305333 Al, US 8367352 B2, US 20140213609 Al (the contents of which are incorporated herein by reference in their entireties) can be useful in the methods and compositions herein, in combination with the agents disclosed herein (e.g., agents increasing mitochondrial motility, Armcxl polypeptide). Inhibition of SOCS3 was reported to promote neuron regeneration (US20110124706 Al, the contents of which are incorporated by reference herein in its entirety).
  • the methods described herein further comprises contacting injured neurons with other agents that can promote at least one of; i. mitochondrial motility, ii. survival of injured axons, or iii. axon regeneration in injured neurons in combination with the agents disclosed herein (e.g., agents that increase mitochondrial motility, Armcxl).
  • the agents of the present disclosure e.g., agents that increase mitochondrial motility, Armcxl polypeptide, or vector comprising a nucleic acid sequence encoding Armcxl polypeptide.
  • the methods and compositions of the present disclosure can comprise contacting the injured neurons or administering to the subject, an effective amount of one or more other agents selected from activator of protein translation, PTEN inhibitor, inhibitor of suppressor of cytokine signaling 3 (SOCS3) in combination with the agents disclosed herein (e.g., e.g., agents increasing mitochondrial motility, Armcxl polypeptide, vector comprising a nucleic acid sequence encoding an Armcxl polypeptide).
  • agents disclosed herein e.g., e.g., agents increasing mitochondrial motility, Armcxl polypeptide, vector comprising a nucleic acid sequence encoding an Armcxl polypeptide.
  • the methods and compositions herein comprises of contacting neurons with effective amounts of combination of Armcxl polypeptide, inhibitor of PTEN and inhibitor of SOCS3.
  • the neurons can also be contacted with nerve growth factor, trophic factor, or hormone that promotes neural cell survival, growth, and/or differentiation, such as brain-derived neurotrophic factor (BDNF), ciliary neurotrophic factor (CNTF), nerve growth factor (NGF), inosine, oncomodulin, NT-3, etc, in addition to the agents disclosed herein (e.g., Armcxl polypeptide), and/ or one of the other agents disclosed above (e.g., activator of protein translation, PTEN inhibitor, inhibitor of SOCS3).
  • BDNF brain-derived neurotrophic factor
  • CNTF ciliary neurotrophic factor
  • NGF nerve growth factor
  • inosine e.g., oncomodulin, NT-3, etc
  • the injury results from acute spinal cord injury and the method additionally comprises contacting the neuron with methylprednisolone sufficient to reduce inflammation of the spinal cord.
  • the agents are administered in combination with trophic and/or growth factors (e.g., denervation-induced cytokines) known in the art to promote or enhance neuronal survival/regeneration, growth and/or
  • BDNF brain-derived neurotrophic factor
  • CNTF ciliary neurotrophic factor
  • FGF fibroblast growth factor
  • NEF nerve growth factor
  • NT-3 fibroblast growth factor
  • inosine Choen et al, Proc Natl Acad Sci USA. (2002) 99:9031-6; U.S. Pat. No. 6,551,612 to Benowitz; U.S. Pat. No. 6,440,455 to Benowitz; and US Pat Publ 20050277614 to Benowitz
  • oncomodulin Yin et al, Nat Neurosci.
  • Another such agent is an agent to remove extracellular matrix molecules (e.g., chondroitin sulphate proteoglycans) that are inhibitory to neuronal outgrowth, such as chondroitenase ABC (ChABC), which breaks up chondroitin sulphate proteoglycans.
  • extracellular matrix molecules e.g., chondroitin sulphate proteoglycans
  • ChABC chondroitenase ABC
  • the agents are administered in combination with one or more factors that facilitate neuronal synapse formation.
  • factors include, without limitation, activators of Rab3A, NMDA-I, synapsin-1, tetanus toxin receptor, BDNF- receptor and a GAB A receptor.
  • MEF2A transcriptional factor myocyte enhancer factor 2
  • MEF2C transcriptional factor C
  • MEF2D tetanus toxin receptor
  • BDNF- receptor tetanus toxin receptor
  • GAB A receptor GAB A receptor
  • Neuronal synapse formation can be modulated, for example, by modulating the activity of the transcriptional factor myocyte enhancer factor 2 (MEF2) (e.g., MEF2A), MEF2C, MEF2D, dMEF2, CeMEF2, Activating transcription factor 6 beta
  • ATF6 Estrogen related receptor alpha (ERR1), Estrogen related receptor beta (ERR2), Estrogen related receptor gamma (ERR3), Erythroblastosis virus E26 oncogene homolog 1 (ETS1), Forkhead box protein C2 (FOXC2), Gata binding factor 1 (GATA-1), Heat shock factor 1 (HSF1), HSF4, MLL3, Myeloblastosis oncogene homolog (MYB), Nuclear receptor coactivator 2 (NCOA2), Nuclear receptor corepressor 1 (NCOR1),
  • Peroxisome proliferative activated receptor gamma PPARg
  • SNIP1 SMAD nuclear interacting protein 1
  • SOX3 SRY-box containing protein 3
  • SOX8 SOX9
  • SREBP2 Sterol regulatory element-binding transcription factor 2
  • THRB1 Thyroid hormone receptor beta-1
  • agent(s) can be administered to the same site or to a different site as the agents of the present disclosure (e.g., agents that increase mitochondrial motility, Armcxl polypeptide or a vector comprising a nucleic acid sequence encoding an Armcxl
  • the agents of the present disclosure e.g., agents that increase mitochondrial motility, Armcxl polypeptide or a vector comprising a nucleic acid sequence encoding an Armcxl polypeptide
  • the neuron(s) at the neuron's region of origin in the brain e.g., by administration to cortical neurons at the cerebral ventricle
  • the other agent is contacted to the neuron at the site of injury (e.g., the lesioned axon such as a cortical spinal tract axon).
  • the site of injury e.g., the lesioned axon such as a cortical spinal tract axon.
  • Other combinations of site of contact and routes of administration discussed herein are also envisioned.
  • the contacting with one or more of the other agents can occur prior to, with or after the contacting with the agents disclosed herein (e.g., Armcxl polypeptide).
  • An effective amount of the inhibitors are contacted with the neuron using a suitable method sufficient to promote sustained survival of the neuron and/or regeneration and/or sustained compensatory outgrowth of the neuronal axon.
  • An effective amount is the amount required to produce statistically significant and reproducible sustained survival, sustained regeneration, or a combination of both, as compared to an appropriate control.
  • the inhibitors are, for example, added to the culture medium, usually at nanomolar or micromolar concentrations.
  • the respective inhibitors can be added in the same formulation, or in different formulations.
  • one or more other agents can be administered to the subject by any method that results in contacting both a therapeutically effective amount of each to the neuron at relatively the same time, or in some embodiments, separately at different times.
  • the respective other agents can be administered at the same time or at different times, depending upon various factors associated with each inhibitor (e.g., half-life, administration route, etc.).
  • the respective other agents can be administered by the same route of administration or through different routes of administration e.g., orally, by intravenous (i.v.) bolus, by i.v. infusion, subcutaneously, intramuscularly, ocularly (intraocularly, periocularly, retrobulbarly, intravitreally, subconjunctivally, topically, by subtenon administration, etc., intracranially, intraperitoneally, intraventricularly, intrathecally, by epidural, etc.
  • the administration of the respective other agents can be for differing prolonged periods, or for the same length of period such that their activities on the contacted neurons completely or substantially overlap.
  • the respective other agents can be administered in a formulation which contains one or more of other agents (a pharmaceutical composition, as described herein), or they can be in separate formulations (separate pharmaceutical compositions) for separate administration.
  • Increased survival of neurons is indicated by the number of neurons surviving from a specific injury or condition, as compared to the number of neurons surviving as a result of the effects of the individual agent (either Armcxl, PTEN or SOCS3), and also by the length of time the survival persists, as compared to the length of time survival persists as a result of the effects of the individual agent (either Armcxl, PTEN or SOCS3). Survival is considered to be sustained if it persists for an extended period of time post-injury (e.g., greater than 2 weeks post -injury, greater than 3 weeks, and greater than 4 weeks postinjury).
  • an extended period of time post-injury e.g., greater than 2 weeks post -injury, greater than 3 weeks, and greater than 4 weeks postinjury.
  • greater than 10% of neurons e.g., 15%, 20%, 25%, 30%, 35%, 0%, 45%), 50%
  • 55%) 60%
  • greater than 20% of neurons e.g., 25%, 30%, 35%, 0%, 45%, 50%, 55%, 60%, 65%, 70% and 75%), survive for an extended period of time post- injury.
  • Increased regeneration or outgrowth is indicated by the number of neurons
  • Increased regeneration and axonal outgrowth occurs if greater than 10% or greater than 20% (e.g., 15%, 20%, 25%, 30%, 35%, 0%, 45%, 50%, 55%, 60%, 65%), 70%) and 75%) of the neurons regenerate injured axons or generate new axons.
  • the regenerated axons extend at least 0.5 mm distal to the lesion epicenter.
  • greater than 10% or greater than 20% e.g., 15%, 20%, 25%, 30%, 35%, 0%, 45%, 50%, 55%, 60%, 65%, 70% and 75%) of neurons regenerate injured axons or generate axons over 1 mm distal to the lesion site.
  • greater than 10%> e.g., 15%, 20%, 25%, 30%, 35%, 0%, 45%, 50%, 55%, 60%, 65%, 70% and 75%) or greater than 20%
  • Sustained regeneration and axonal outgrowth can be indicated by a significant amount of outgrowth occurs on or after 2 weeks post-injury. For example significant outgrowth occurs for up to 3 weeks or 4 weeks post-injury.
  • CNS neurons central nervous system neurons
  • PNS neurons peripheral nervous system neurons
  • CNS neurons include, without limitation, a cerebellar granule neuron, or an ocular neuron.
  • the neuron is the optic nerve.
  • the neuron is a sensory neuron (e.g., dorsal root ganglion (DRG) sensory neuron).
  • DRG dorsal root ganglion
  • peripheral nerve damage peripheral neuropathy
  • Peripheral nerves such as dorsal root ganglia, otherwise known as spinal ganglia, are known to extend down the spinal column. These nerves can be injured as a result of spinal injury. Such peripheral nerve damage associated with spinal cord injury can also benefit from neuron axonal outgrowth produced by the methods described herein.
  • the neurons are in the spinal cord. In some embodiments, the neurons are in the optic nerve.
  • the neurons are axotomized neurons (for example during surgery).
  • the neuron is human.
  • the neuron is a terminally differentiated neuron.
  • the neuron is an adult neuron (e.g., in a subject that has reached maturity, such as in humans older than 18 years).
  • the neuron is non-embryonic.
  • the neuron is in an immature organism (e.g., embryo, infant, child). All mammals are suitable subjects for performance of the methods described herein.
  • the mammal is a human, non-human primate, companion animal (e.g., dog, cat), livestock animal (e.g., horse, cow, pig, sheep), or rodent (mouse, rat, rabbit).
  • the subject is a non-human primate animal in a model for neurodegeneration or nervous system (CNS or PNS) injury. Neurons derived from said subjects are also suitable for performance of the methods described herein. In some embodiments, the neurons are injured neurons.
  • injury refers to damage (e.g., to a system or a cell).
  • Damage to a system is evidenced by aberrant function, reduction of function, loss of function of the system, or loss of essential components (e.g., specialized cells such as neurons).
  • Damage or injury to a specific neuron is also evidenced by aberrant function, loss of function, reduced function, and/or cell death.
  • Some forms of injury to a neuron can be directly detected (e.g., by visualization as with a severed or crushed neuronal axon).
  • the methods disclosed herein comprises an antecedent step of determining that the neuron is injured and/or has axotomy-induced stress.
  • Neuronal injury can result from a variety of insults, including, but not limited to physicial injury (e.g., severing, crushing), toxic effects, atrophy (e.g., due to lack of trophic factors).
  • neuronal injury refers to any damage or dysfunction exhibited by neurons, including but not limited to loss of myelin, dendrite retraction, dendritic spine density reduction, axonal damage, loss of axon regeneration and neuronal death.
  • Neuronal injury may be complete loss of a neuron, or loss of a part of the neuron (e.g., an axon).
  • Such damage may results from acute or traumatic injury to the neuron (e.g., crush, severing) such as the result of external physical trauma to the subject (e.g., contusion, laceration, acute spinal cord injury, traumatic brain injury, cortical impact, etc.).
  • Acute or traumatic injury to a neuron can also result from an acute condition, such as stroke, that results in acute ischemia to the neuron resulting in acute injury.
  • the specific location of neuronal injury will vary with the specific cause of the injury, and the specific individual.
  • the injured CNS neuron is located in CNS white matter, particularly white matter that has been subjected to traumatic injury.
  • the specific location of a lesion to a specific neuron will vary with respect to the injury.
  • the injury is in the axon or dendrite of a neuron.
  • the injured neuron is in the spinal cord.
  • the injured neuron is in the optic nerve.
  • Trauma neuron may also be incurred from a chronic injury (e.g., repetitive stress injury) or condition (e.g., chronic inflammation or disease).
  • Chronic injury leads to neurodegeneration such as caused by neurotoxicity or a neurological disease or disorder (e.g. Huntington's disease, Parkinson's disease, Alzheimer's disease, multiple system atrophy (MSA), etc.).
  • a neurological disease or disorder e.g. Huntington's disease, Parkinson's disease, Alzheimer's disease, multiple system atrophy (MSA), etc.
  • injured neurons results from an ocular injury or disorder (e.g. toxic amblyopia, optic atrophy, higher visual pathway lesions, disorders of ocular motility, third cranial nerve palsies, fourth cranial nerve palsies, sixth cranial nerve palsies, internuclear ophthalmoplegia, gaze palsies, eye damage from free radicals, etc.), or an optic neuropathy (e.g., ocular injury or disorder (e.g. toxic amblyopia, optic atrophy, higher visual pathway lesions, disorders of ocular motility, third cranial nerve palsies, fourth cranial nerve palsies, sixth cranial nerve palsies, internuclear ophthalmoplegia, gaze palsies, eye damage from free radicals, etc.), or an optic neuropathy (e.g.
  • an optic neuropathy e.g.
  • ischemic optic neuropathies toxic optic neuropathies, ocular ischemic syndrome, optic nerve inflammation, infection of the optic nerve, optic neuritis, optic neuropathy, papilledema, papillitis, retrobulbar neuritis, commotio retinae, glaucoma, macular degeneration, retinitis pigmentosa, retinal detachment, retinal tears or holes, diabetic retinopathy, iatrogenic retinopathy, optic nerve drusen, etc.).
  • Injury to a neuron can be detected by the skilled practitioner through a variety of assays known in the art. Loss of function assays can be used to determine neuronal injury. Physical damage to the neuron (e.g., axonal crushing or severing) can sometimes be observed diagnostically through routine methods.
  • One way to detect a lesion is through detection of axotomy-induced stress.
  • the methods and compositions disclosed herein are useful for the treatment of neuronal injury.
  • the methods and compositions of the invention are useful for treatment of diseases or disorders resulting from or leading to the neuronal injury described herein.
  • the disorder is selected from the group consisting of glaucoma, stroke, head trauma, spinal injury, optic injury, ischemia, hypoxia, neurodegenerative disease, multiple sclerosis, infectious disease, cancer, and autoimmune disease.
  • the methods and compositions described herein can be used specifically to treat damage associated with peripheral neuropathies including, but not limited to, the following: diabetic neuropathies, virus-associated neuropathies, including acquired immunodeficiency syndrome (AIDS) related neuropathy, infectious mononucleosis with polyneuritis, viral hepatitis with polyneuritis; Guillian-Barre syndrome; botulism-related neuropathy; toxic polyneuropathies including lead and alcohol-related neuropathies;
  • AIDS acquired immunodeficiency syndrome
  • nutritional neuropathies including subacute combined degeneration; angiopathic neuropathies including neuropathies associated with systemic lupus erythematosis; sarcoid-associated neuropathy; carcinomatous neuropathy; compression neuropathy (e.g. carpal tunnel syndrome) and hereditary neuropathies, such as Charcot-Marie-Tooth disease, peripheral nerve damage associated with spinal cord injury can also be treated with the present method.
  • the subject is treated in accordance with the present method for CNS or peripheral nerve damage as the result injury, including those listed above. Subjects at risk for developing such CNS or damage are also so treated.
  • Agent of the present disclosure is contacted with the neuron using a suitable drug delivery method and treatment protocol sufficient to promote regeneration of the axon.
  • the agent is added to the culture medium, usually at nanomolar or micromolar concentrations.
  • the agent can be administered orally, by intravenous (i.v.) bolus, by i.v. infusion, subcutaneously, intramuscularly, ocularly
  • intracranially intraperitoneally, intraventricularly,
  • the agent or compositions comprising the agent may be administered in one or more dosage form(s) (e.g. liquid, ointment, solution, suspension, emulsion, tablet, capsule, caplet, lozenge, powder, granules, cachets, douche, suppository, cream, mist, eye drops, gel, inhalant, patch, implant, injectable, infusion, etc.).
  • dosage forms may include a variety of other ingredients, including binders, solvents, bulking agents, plasticizers etc.
  • the agent is contacted with the neuron using an implantable device that contains the activator and that is specifically adapted for delivery to a CNS axon of neuron.
  • implantable devices include solid or semi-solid devices such as controlled release biodegradable matrices, fibers, pumps, stents, adsorbable gelatin (e.g. Gelfoam), etc.
  • the device may be loaded with premeasured, discrete and contained amounts of the activator sufficient to promote regeneration of the axon.
  • the device provides continuous contact of the neuron with the activator at nanomolar or micromolar concentrations, preferably for at least 2, 5, or 10 days.
  • Administration is to a subject by a route that results in contacting an effective amount of the agents disclosed herein (e.g., agent that increases mitochondrial mobility, Armcxl polypeptide or a vector comprising a nucleic acid sequence encoding an Armcxl polypeptide) to the target neuron(s).
  • the target neuron is the neuron which is intentionally contacted by the administered agent.
  • a target neuron can be an injured neuron or a non-injured neuron (e.g., for compensatory axonal outgrowth to a region of denervation, or used as a control in the methods herein).
  • the target neuron may be contacted at one or more specific target sites of the neuron.
  • the target site of the neuron is the region of the neuron to which the agent is intentionally contacted. Regions of the neuron include the dendrites, cell body, and the axon. In some embodiments, the target site of the neuron is the mitochondria of the neuron. Methods for targeting the agents to mitochondria of a cell are known in the art. See for e.g., AAPS J. 2006 Jun; 8(2): E277-E283., Antioxid Redox Signal. 2011 Dec 15; 15(12):3021-38, Biochim Biophys Acta. 2008 Jul-Aug; 1777(7-8): 1028-31, the contents of which are incorporated herein by reference in their entireties.
  • Non-limiting exemplary methods for targeting the agents and compositions disclosed herein to the mitochondria of a neuron can include for e.g., conjugation of an agent with a lipohilic molecular group, encapsulation of agents in a liposome or nanoparticle.
  • Suitable target neurons are actual damaged neurons, and also neurons that are in the immediate area of an injury site or an area of dennervation.
  • the specific location and extent of an injury site can be determined by the skilled practioner.
  • Examples of injury sites are the site of physical damage or disruption of neuronal activity.
  • the immediate area of an injury site will vary with respect to the specific injury, the nature of the injury, and the nature of the injured neurons (e.g., axonal length, specific function, etc.) and can be determined by the skilled practitioner.
  • a lesion is in the axon of the injured neuron.
  • the immediate area of the injury site is within about 1-10 mm of identified damaged neurons (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mm).
  • the administration is localized so as to be highly targeted to a specific site.
  • the administration is systemic, and results in delivery of the appropriate concentration to the specific site.
  • compositions may be administered in one or more dosage form(s) (e.g. liquid, ointment, solution, suspension, emulsion, tablet, capsule, caplet, lozenge, powder, granules, cachets, douche, suppository, cream, mist, eye drops, gel, inhalant, patch, implant, injectable, infusion, etc.).
  • dosage forms may include a variety of other ingredients, including binders, solvents, bulking agents, plasticizers etc.
  • the inhibitors are contacted with the neuron using an implantable device that contains the inhibitors and that is specifically adapted for delivery to a neuron.
  • implantable devices include solid or semi-solid devices such as controlled release biodegradable matrices, fibers, pumps, stents, adsorbable gelatin (e.g. Gelfoam), etc.
  • the device may be loaded with premeasured, discrete and contained amounts of the inhibitors sufficient to promote sustained regeneration or sustained survival of the neuron.
  • the device provides continuous contact of the neuron with the inhibitors at nanomolar or micromolar concentrations, (e.g., for at least 2, 5, or 10 days, or for at least 2, 3, or 4 weeks, or for greater than 4 weeks, e.g., 5, 6, 7, or 8 weeks).
  • administration of an agent disclosed herein to a subject results in the inhibitors directly contacting an injured neuron in need of regeneration.
  • administration results in contacting neurons proximal to a site of neuronal injury.
  • Neurons can be contacted at any point along their length (e.g., at the axon, dendrite and/or the cell body).
  • Administration to the subject can be by any one or combination of a variety of methods (e.g., intravenously, intracortically, intracerebrally, intrathecally, intranasally, ocularly, parenterally, enterally and/or topically or locally at the injured neuron.).
  • the appropriate method(s) will depend upon the circumstances of the individual (e.g. the location of the target neuron(s), the condition of the individual, the desired duration of the contact, whether local or systemic treatment is desired).
  • the administration can be by any methods described herein that will result in contact of sufficient agent(s) to the target neuron to promote survival of neuron, axon regeneration, or a combination of both.
  • parenteral, enteral and topical administration can be used.
  • parenteral, enteral and topical administration can be used.
  • parenteral, enteral and topical administration can be used.
  • parenteral, enteral and topical administration can be used.
  • parenteral, enteral and topical administration can be used
  • administering and "administered parenterally” as used herein means modes of
  • administration other than enteral and topical administration usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, intracortical, intracerebral, intranasal, ocular, sub capsular, subarachnoid, intraspinal, intracerebro spinal, and intrastemal injection and infusion.
  • Enteral administration involves the esophagus, stomach, and small and large intestines (i.e., the gastrointestinal tract).
  • systemic administration The phrases "systemic administration,"
  • administered systemically means the administration of a compound other than directly into the central nervous system, such that it enters the animal's system and, thus, is subject to metabolism and other like processes, for example, subcutaneous administration.
  • Administration may be topical (including ophthalmic, vaginal, rectal, intranasal, epidermal, and transdermal), oral or pulmonary administration, e.g. , by inhalation or insufflation, or intracranial, e.g., intrathecal or intraventricular, administration, topically to the eye, or by intraocular injection.
  • the method involves administering to a subject an agent that increases mitochondrial motility (e.g., Armcxl polypeptide or a vector comprising a nucleic acid sequence encoding Armcxl polypeptide to thereby contact the site of injury.
  • an agent that increases mitochondrial motility e.g., Armcxl polypeptide or a vector comprising a nucleic acid sequence encoding Armcxl polypeptide to thereby contact the site of injury.
  • administering includes dispensing, delivering or applying an active compound in a pharmaceutical formulation to a subject by any suitable route for delivery of the active compound to the desired location in the subject to thereby contact the desired portion(s) of the neuron(s), (e.g., the injury, the injured neuron, or the site of desired outgrowth of the neuron).
  • This includes, without limitation, delivery by either the parenteral or oral route, intramuscular injection, subcutaneous/intradermal injection, intravenous injection, buccal administration, transdermal delivery and administration by the rectal, colonic, vaginal, intranasal or respiratory tract route, intraocular, ocular.
  • the agent(s) is contacted in vivo by introduction into the central nervous system of a subject, e.g., into the cerebrospinal fluid of the subject.
  • the agent(s) is introduced intrathecally, e.g., into a cerebral ventricle, the lumbar area, or the cisterna magna.
  • the agent(s) is introduced intraocullarly, to thereby contact retinal ganglion cells or the optic nerve. Modes of administration are described in US 7,238,529.
  • administration occurs following neuronal injury in the subject, not prior to or at the time of neuronal injury.
  • the agent(s) formulation is administered into a subject intrathecally.
  • intrathecal administration is intended to include delivering an inhibitor(s) formulation directly into the cerebrospinal fluid of a subject, by techniques including lateral
  • cerebroventricular injection through a burrhole or cisternal or lumbar puncture or the like (described in Lazorthes et al. Advances in Drug Delivery Systems and Applications in Neurosurgery, 143-192 and Omaya et al., Cancer Drug Delivery, 1 : 169-179, the contents of which are incorporated herein by reference).
  • the term "lumbar region” is intended to include the area between the third and fourth lumbar (lower back) vertebrae.
  • cisterna magna is intended to include the area where the skull ends and the spinal cord begins at the back of the head.
  • Cerebral ventricle is intended to include the cavities in the brain that are continuous with the central canal of the spinal cord.
  • an agent(s) to any of the above mentioned sites can be achieved by direct injection of the agent(s) formulation or by the use of infusion pumps.
  • the agent(s) formulation of the invention can be formulated in liquid solutions, preferably in physiologically compatible buffers such as Hank's solution or Ringer's solution.
  • the inhibitor(s) formulation may be formulated in solid form and re-dissolved or suspended immediately prior to use. Lyophilized forms are also included.
  • the injection can be, for example, in the form of a bolus injection or continuous infusion (e.g., using infusion pumps) of the agent(s) formulation.
  • said agent(s) formulation is administered by lateral cerebroventricular injection into the brain of a subject in the inclusive period from the time of the injury to a time determined by the skilled practitioner (e.g., 100 hours).
  • the injection can be made, for example, through a burr hole made in the subject's skull.
  • said encapsulated therapeutic agent is administered through a surgically inserted shunt into the cerebral ventricle of a subject in the inclusive period from the time of the injury to a time determined by the skilled practitioner (e.g., 100 hours thereafter).
  • the injection can be made into the lateral ventricles, which are larger, even though injection into the third and fourth smaller ventricles can also be made.
  • said agent(s) formulation is administered by injection into the cisterna magna, or lumbar area of a subject in the inclusive period from the time of the injury to a time determined by the skilled practitioner (e.g., 100 hours thereafter). Administration can be continuous, or can be by repeated doses. In one embodiment, the repeated doses are formulated so that an effective amount of the inhibitors is continually present at the injury site.
  • Viral and non-viral-based gene transfer methods can be used to introduce nucleic acids encoding Armcxl polypeptides to cells or target tissues of the subject. Such methods can be used to administer nucleic acids encoding Armcxl polypeptides to cells in vitro. Alternatively, or in addition, such polynucleotides can be administered for in vivo or ex vivo gene therapy uses.
  • Non-viral vector delivery systems include DNA plasmids, naked nucleic acid, and nucleic acid complexed with, for example, a liposome or other delivery vehicle.
  • Viral vector delivery systems include both DNA and RNA viruses, and can have either episomal or integrated genomes after delivery to the cell.
  • Methods of non-viral delivery of nucleic acids encoding engineered polypeptides of the invention include lipofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipid:nucleic acid conjugates, naked DNA, artificial virions, and agent-enhanced uptake of DNA.
  • Lipofection is described, e.g.,, in U.S. Pat. No. 5,049,386, U.S. Pat. No. 4,946,787; and U.S. Pat. No. 4,897,355, and lipofection reagents are sold commercially (e.g.,, TransfectamTM and LipofectinTM).
  • Cationic and neutral lipids that are suitable for efficient receptor-recognition lipofection of polynucleotides include those of Feigner, WO 91/17424, WO 91/16024. Delivery can be to cells (ex vivo administration) or target tissues (in vivo administration).
  • the preparation of lipid:nucleic acid complexes, including targeted liposomes such as immunolipid complexes, is well known to one of skill in the art (see, e.g., Crystal, Science270:404-410 (1995); Blaese et al., Cancer Gene Ther. 2:291-297 (1995); Behr et al., Bioconjugate Chem.
  • RNA or DNA viral based systems can be used to target the delivery of polynucleotides carried by the virus to specific cells in the body and deliver the
  • Viral vectors can be administered directly to patients (in vivo) or they can be used to transfect cells in vitro. In some cases, the transfected cells are administered to patients (ex vivo).
  • Conventional viral based systems for the delivery of polypeptides of the invention could include retroviral, lentivirus, adenoviral, adeno- associated and herpes simplex virus vectors for gene transfer.
  • Viral vectors are currently the most efficient and versatile method of gene transfer in target cells and tissues. Integration in the host genome is possible with the retrovirus, lentivirus, and adeno-associated virus gene transfer methods, often resulting in long term expression of the inserted transgene, and high transduction efficiencies.
  • the present invention relates to the herein described
  • compositions, methods, and respective component(s) thereof as essential to the invention, yet open to the inclusion of unspecified elements, essential or not ("comprising).
  • other elements to be included in the description of the composition, method or respective component thereof are limited to those that do not materially affect the basic and novel characteristic(s) of the invention ("consisting essentially of). This applies equally to steps within a described method as well as compositions and components therein.
  • the inventions, compositions, methods, and respective components thereof, described herein are intended to be exclusive of any element not deemed an essential element to the component, composition or method ("consisting of).
  • the present invention may be as defined in any of the following numbered paragraphs: 1.
  • a method for promoting survival of, or axon regeneration in an injured mature central nervous system (CNS) neuron comprising contacting the neuron with an effective amount of an agent capable of increasing mitochondrial motility in the injured neuron, thereby promoting survival of, or axon regeneration in the injured neuron.
  • CNS central nervous system
  • the vector is a viral vector or non-viral vector.
  • the viral vector is selected from the group consisting of retrovirus, lentivirus, adenovirus, herpesvirus, poxvirus, alpha virus, vaccinia virus, and adeno-associated viruses.
  • non-viral vector is selected from the group consisting of a nanoparticle, a cationic lipid, a cationic polymer, a metallic nanoparticle, a nanorod, a liposome, microbubbles, a cell penetrating peptide and a liposphere.
  • the inhibitor of SOCS3 comprises a SOCS3 specific hpRNA or siRNA.
  • the PTEN inhibitor is,
  • a method of treating a subject for neuronal injury comprising:
  • administering results in contacting the injured neurons of the subject with the agent in an amount sufficient to promote survival of, or axon regeneration in the injured neurons, such that the subject is treated.
  • the viral vector is selected from the group consisting of retrovirus, lentivirus, adenovirus, herpesvirus, poxvirus, alpha virus, vaccinia virus, and adeno-associated viruses.
  • non-viral vector is selected from the group consisting of a nanoparticle, a cationic lipid, a cationic polymer, a metallic nanoparticle, a nanorod, a liposome, microbubbles, a cell penetrating peptide and a liposphere.
  • a method of treating a subject for a disease or disorder characterized by neuronal death or diminished potential for axonal growth comprising administering to the subject an agent that increases mitochondrial motility, in an amount sufficient to promote survival of, or axonal growth in neurons, such that the subject is treated.
  • the disorder is selected from group comprising of glaucoma, stroke, head trauma, spinal injury, optic injury, ischemia, hypoxia, neurodegenerative disease, multiple sclerosis, infectious disease, cancer, and autoimmune disease.
  • a method for promoting survival of, or axon regeneration in an injured mature central nervous system neuron in a subject determined to have a neuronal injury comprising, administering to the subject Armcxl polypeptide or an analog thereof in an amount sufficient to promote survival of, or axon regeneration of the injured neuron.
  • a device for promoting survival of, or axon regeneration in an injured mature central nervous system (CNS) neuron comprising a therapeutically effective amount of an agent that increases mitochondrial motility in the neuron, and wherein the device locally releases the agent into the CNS for promoting survival of, or axon regeneration in an injured mature central system (CNS) neuron.
  • CNS central nervous system
  • the device of paragraph 43 comprising a CNS-implantable solid or semi-solid device selected from a biodegradable matrix, fiber, pump, stent, adsorbable gelatin osmotic pump or indwelling catheter.
  • a pharmaceutical composition comprising an effective amount of Armcxl polypeptide or a vector comprising a nucleic acid sequence encoding the Armcxl polypeptide and a pharmaceutically acceptable carrier, for use in promoting survival of, or regeneration of axon in injured neurons.
  • the viral vector is selected from the group consisting of retrovirus, lentivirus, adenovirus, herpesvirus, poxvirus, alpha virus, vaccinia virus, and adeno-associated viruses.
  • non-viral vector is selected from the group consisting of a nanoparticle, a cationic lipid, a cationic polymer, a metallic nanoparticle, a nanorod, a liposome, microbubbles, a cell penetrating peptide and a liposphere.
  • composition of any one of paragraphs 45-53 formulated for administration to the brain, spinal cord, or optical nerve.
  • composition is formulated for administration via intracerebroventricular, intranasal, intracranial, intracelial, intracerebellar, or intrathecal administration route.
  • composition is contained in a delivery device selected from the group consisting of a syringe, a blunt tip syringe, a catheter, an inhaler, a nebulizer, a nasal spray pump, a nasal irrigation pump or nasal lavage pump, and an implantable pump.
  • a delivery device selected from the group consisting of a syringe, a blunt tip syringe, a catheter, an inhaler, a nebulizer, a nasal spray pump, a nasal irrigation pump or nasal lavage pump, and an implantable pump.
  • a pharmaceutical composition comprising an agent that increases mitochondrial motility in injured neuron and a pharmaceutically acceptable carrier, for use in promoting survival of, or regeneration of axon in injured neurons.
  • ArmcxlF2AGFP vectors were generated from the pAAV-MCS constructs (Stratagene). For shRNA Armcxl constructs, two targeting sequences against
  • TCAGTCAAGTGTGTGACGATACC were cloned into p AAV- Armcx 1 -2in-shRNA- mCherry vector from ViGene Biosciences. The construct was generated by ViGene Sciences, Inc. Control shRNA Scramble construct was generated from the pAAV-U6-GFP
  • Retina Explant culture P21 PTEISF mice were injected with AAV2-Cre and AAV2-PLAP (placental phosphatase alkaline) as control, AAV2-ArmcxlHA or AAV2-ArmcxlHAATM. 2 weeks after, retinas were dissected out in Hibernate- A (Brain Bits). Retina explants were then plated onto Poly-L-Lysin (Sigma) and Laminin (Sigma) coated glass bottom dishes (MatTek) in Neurobasal-A (Life Technology) supplemented with B-27 (Life Technology), L-Glutamine (Life Technology) and Penicillin/Streptomycin (Life Technology).
  • explants were fixed in PFA 4%/Sucrose 1,5% in PBS after 2 weeks and labeled with primary antibody anti-Tuj 1 (Covance Research Products Inc Cat# MMS-435P, RRID: AB 2313773 or Covance Research Products Inc Cat# MRB-435P-100, RRID:AB_10175616), secondary antibody Alexa-488 (1/400- Life Technology).
  • primary antibody anti-Tuj 1 Covance Research Products Inc Cat# MMS-435P, RRID: AB 2313773 or Covance Research Products Inc Cat# MRB-435P-100, RRID:AB_10175616
  • secondary antibody Alexa-488 (1/400- Life Technology
  • TMRM tetramethylrhodamine methyl ester
  • Antibodies against HA (Roche Cat #11867431001, RRID:AB_390919) and Tuj 1 (Covance Research Products Inc Cat# MRB-435P-100, RRID:AB_10175616) were apply on retina in blocking buffer and apply on retina overnight at 4°C. After PBS wash, retinas were incubated for a minimum of 2 hours at room temperature with Alexa secondary antibodies, washed with PBS and mount with fluoromount (SouthernBiotech). Retinas cross sections for
  • Cortical neurons culture and transfection were isolated from El 8 mouse embryo (Charles River). Briefly, cortices were chemically dissociated in papain solution (Worthington Biochemicals) for lOmn at 37°C followed by two wash in trypsin inhibition solution (Sigma T9253) and mechanical dissociation using PI 000 plastic tip in plain Neurobasal medium (Life Technology). Dissection, dissociation and wash were done in HBSS (Gibco 1470-112) with 45% glucose and kynurenic acid (Sigma K3375) solution (HBSS, kyuneric acid lOmM, lOOmM Hepes, lOOmM MgC12).
  • DIV7 To study mitochondrial and BDNF positive vesicles transport neurons were transfected at DIV 5. At DIV7 the culture medium was replaced by Hibernate E low fluorescence (BrainBites) to maintain cell viability in C02- free conditions during live imaging. For neurites outgrowth experiments, neurons were transfected at DIV1.
  • lysis buffer Tris-HCl pH: 7.5, NaCl 150mM, MgC12 1.5mM, EDTA 5mM Triton 1%, Glycerol 10% and protease inhibitor cocktail.
  • Immunoprecipitation was performed using Dynabeads Protein G (Novex 10003D) and following manufacturer protocol including mixing beads with 20 ⁇ g of antibody (Roche Cat# 11867431001, RRID:AB_390919) for lOmn on wheels at room temperature and a 1 hour incubation at room temperature with the cell homogenate.
  • a wash buffer was used (TrisHCl pH: 8, NaCl 500mM, EDTA ImM, EGTA ImM, Triton 1%, P-40 0.5%).
  • PerkinElmer Spinning Disc confocal microscope equipped with a temperature-controlled chamber at 37°C and with a 20 x oil objective. Each frame was captured every 2s. and 60 frames were acquired in total for each recording with laser power set to 30% for each channel to minimize damage. A portion of 80-120 ⁇ of axon located 150 ⁇ from the tip was selected for analysis. Volocity software (PerkinElmer) was used for live recording. For both the retina explant and the cortical neuron images, a custom-made Image J macro was used for kymograph based motility analysis as described in (Pekkurnaz et al., 2014).
  • Image J raw data were extracted as excel spreadsheets (Microsoft Excel) and statistical analysis was performed with GraphPad Prism version 6.0 for Mac OS X (GraphPad Software, Inc., La Jolla, CA, USA). E18 cortical neurons. Neurons were transferred into pre-warmed Hibernate medium without phenol red, which buffers C02 (Brain Bits). Transfected axons were detected using the GFP channel. Single axons were imaged on an inverted Nikon Eclipse Ti-U microscope and 1 frame was captured every 2s. 60 frames were acquired in total for each recording.
  • Mitochondrial transport analysis From the kymograph generated by the live imaging files, mitochondrial transport was analyzed as in (Pekkurnaz et al., 2014).
  • mitochondria were defined as motile when the average of the instantaneous velocity was higher than 0.05 ⁇ /8 (Wang and Schwarz, 2009). Mitochondria whose velocity was equal or lower than this threshold were considered as stationary.
  • the moving frequency was defined as the percentage of time each mitochondrion spent in motion during the time of the recording and was calculated by dividing the time spent in motion by the total recording time.
  • the motile pool of mitochondria were the mitochondria with a moving frequency higher than 0.
  • the moving frequency of the motile mitochondria was calculated by excluding the stationary mitochondria.
  • the moving frequency of individual mitochondria was used for statistical analysis. For the percentage of mitochondria in motion per axons, statistics were done on the number of axons. The density of mitochondria in axons was calculated by counting the number of mitochondria on the first frame of the recording used for
  • viruses were mixed and injected at the same time.
  • the following viruses were used: AAV2-Cre, AAV2-PLAP, AAV2- Armcx 1 HA, AAV2- Armcx 1 ⁇ , AAV2-CNTF, AAV2-shRNA Scramble and AAV2-shRNA Armcxl .
  • the titers of the viruses were comprised between 10 12 -10 13 gc/mL. Viruses were produced at the Boston Children's Hospital viral core.
  • Optic nerve injury Four weeks following AAV2 injection (5 weeks for AAV-shRNAs), the right optic nerve was exposed intraorbitally and crushed with forceps (Dumont #5 FST) for 5 seconds approximately 1mm behind the eye ball.
  • RGC anterograde labeling 2-3 days before animals were euthanized, 1.5ul of cholera toxin ⁇ subunit (CTB-2ug/ul, in sterile PBS-Life Technologies) coupled with Alexa-555 (CTB-Alexa-555) was injected into the vitreous with Hamilton syringe (Hamilton) to label axons in optic nerve.
  • CTB-2ug/ul cholera toxin ⁇ subunit
  • Alexa-555 CB-Alexa-555
  • optic nerves from perfused mice were post-fixed overnight washed three times lOmn in PBS and incubated at room temperature for 20 min in increasing concentration of ethanol (50%, 80%, 95%, 100%). Nerves were kept at 4°C overnight in ethanol 100% with constant agitation. Nerves were then put in Hexan (Sigma) for 3 hours at room temperature on a shaker. The clearing was completed by replacing Hexan by a solution of Benzyl alcohol/Benzyl Benzoate (1 : 2). Nerves were stored in the dark at room temperature in this final solution.
  • PerkinElmer Spinning Disc confocal microscope equipped with 20x objective and a motorized stage and Volocity software (Perkin Elmer). The whole nerve was acquired using optical sections of 2 ⁇ and stitched images of the Z stacks projections to maximum intensity.
  • RRID:AB_10175616 Because of the layering pattern of the retina with the RGCs layer sitting on the top of a whole mount preparation, Tuj 1 staining efficiently labeled RGCs (Belin et al., 2015; Nawabi et al., 2015; Park et al., 2008; Smith et al., 2009). Pictures from 10 regions per retina were taken under an epifluorescence microscope (Nikon 80i- 20X objective). Tuj 1 positive RGCs were counted in intact and injured eye for each animal. The number of Tuj 1 positive RGCs in intact eye of each animal was considered as 100% for this particular animal and was compared to its injured eye to quantify the survival.
  • Armcxl expression is up-regulated in RGCs with high regenerative capacity
  • Armcxl a member of a cluster of genes in which a family member, Armcx3, had been implicated in regulating mitochondrial transport (Lopez- Domenech et al., 2012), appeared to be highly expressed in injured RGCs with induced regenerative ability (Sun et al., 2012).
  • Armcxl localizes to mitochondria and interacts with mitochondrial transport machinery
  • Armcxl has a putative mitochondrial outer membrane-targeting sequence flanking the trans-membrane (TM) domain (FIG. ID) (Mou et al., 2009).
  • TM trans-membrane
  • a mutant of Armcxl was designed that lacks its transmembrane domain, ArmcxlATM (FIGs. ID and IE) and assessed the localization of Armcxl and Armcx 1 ⁇ by co-transfecting HA-tagged Armcxl or Armcx 1 ⁇ with the mitochondrial marker MitoDsRed in mouse cortical neurons.
  • the vast majority of Armcxl protein was shown to be was targeted to mitochondria (FIG. IF and FIG. 7B), while the absence of the TM domain of Armcxl prevented its mitochondrial localization (FIG. 1G and FIG. 7B).
  • Armcx3 was recently shown to regulate mitochondrial transport by interacting with the mitochondria trafficking regulatory complex that connects mitochondria to the motor proteins (Lopez-Domenech et al., 2012), but the role of Armcxl is unknown.
  • Co- immunoprecipitation using Armcxl-HA and Mirol-Myc showed that Armcxl interacted with Mirol (FIG. 1H), the protein linking mitochondria to the Trakl-Kinesin motor complex.
  • FIG. 1H the mitochondria-localized Armcxl protein is up- regulated in RGCs with induced regenerative ability and suggest that Armcxl might be a candidate in regulating mitochondrial trafficking.
  • Armcxl overexpression enhances mitochondrial transport in adult RGC axons
  • Axonal mitochondria are distributed in two pools: the motile pool, which can move bi-directionally and may pause before resuming movement, and the stationary pool, which is fixed in position typically for the observable duration of an experiment.
  • the proportion of these two pools has been suggested as an important indicator of mitochondrial trafficking in axons (Schwarz, 2013).
  • a first step to assess the role of Armcxl in the injury responses of adult RGCs we examined whether enhancing the expression of Armcxl would increase mitochondrial transport in adult RGC axons using retina explant cultures coupled with live imaging microscopy.
  • AAV expressing placental alkaline phosphatase (PLAP), a well- established non-fluorescent and inert control for viral injection was used .
  • Immunohistochemistry on whole mount retina confirmed the efficient infection of RGCs by AAVs encoding Armcxl full length and mutant (FIG. 8 A and 8B).
  • AAV expressing a mitochondrial protein was used to confirm that multiple viral co-injections allowed efficient targeting of RGCs in explant culture.
  • AAV2-FLEX-MitoDsRed was co-injected with AAV-Cre to the vitreous body of
  • mitochondrial membrane potential was used as a marker of axonal health by labeling mitochondria with tetramethylrhodamine methyl ester (TMRM), a membrane potential dependent fluorescent dye (Trushina et al., 2012; Verburg and
  • Armcxl overexpression increased the moving frequency of the total pool of mitochondria, i.e. the fraction of time mitochondria in motion rather than paused (FIG. 2C).
  • the overexpression of Armcxl increased the transport of mitochondria from the motile pool, we specifically analyzed the moving frequency of this pool and did not observe any difference between control and Armcxl overexpression (FIG. 8D). Since Armcxl overexpression increased the proportion of motile mitochondria with no accompanying changes of mitochondrial density (FIG. 2D), Armcxl was concluded to likely increase mitochondrial transport by recruiting stationary mitochondria into the motile pool.
  • Similar analyses were performed as described above in cultured El 8 cortical neurons, a well-established system for investigating mitochondrial trafficking (Pekkurnaz et al., 2014; Wang and Schwarz, 2009; Wang et al., 2011). Whether Armcxl overexpression could alter the proportion of motile versus stationary mitochondria in these neurons was first addressed.
  • the mitochondrial marker MitoDsRed was co-transfected with either Armcxl or GFP as a control.
  • Armcxl expression was coupled with a GFP reporter linked by an F2A sequence allowing the identification of transfected neurons.
  • Armcxl overexpression significantly increased the percentage of motile mitochondria up to 80% (FIGs. 3A and 3B).
  • Armcxl overexpression also significantly increased the moving frequency of mitochondria (FIGs. 3C) with no effect on mitochondrial density (FIG. 9A).
  • overexpressing Armcxl did not affect the transport of BD F positive vesicles (FIG. 9B and 9C), consistent with a specific localization of Armcxl to mitochondria.
  • Armcxl overexpression significantly increased the average length of the longest neurites of embryonic cortical neurons (FIG. 3D and 3E). These results together suggest that Armcxl overexpression leads to similar effects on enhancing mitochondria movement and neurite growth in both adult RGC axons and embryonic cortical neurons.
  • Armcxl promotes neuronal survival and axon regeneration after optic nerve injury
  • Armcxl overexpression induced a significantly higher number of regenerating axons in comparison to PLAP control (FIGs. 4A-4C). Consistent with in vitro data, this effect was dependent on Armcxl mitochondrial localization since the overexpression of Armcxl ⁇ failed to recapitulate the enhanced regeneration (FIGs. 4A-4C). The effect of Armcxl overexpression on the survival of RGCs (FIGs. 4D and 4E) was also analyzed. Consistent with previous studies (Belin et al., 2015; Nawabi et al., 2015; Park et al., 2008; Smith et al., 2009), about 25% of RGCs survived in the control group (FIGs. 4D and 4E).
  • Armcxl has a positive effect on axon regeneration in wild type mice, the limited numbers of regenerating axons might reflect compromised regenerative ability associated with injured RGCs.
  • PTEN deletion in adult RGCs is able to increase neuronal survival and axon regeneration by elevating mTOR activity in injured RGCs (Park et al., 2008)
  • we tested the effect of Armcxl in this regeneration-permissive background AAVs expressing Cre together with AAVs expressing Armcxl, Armcxl ⁇ or PLAP as a control, were co-injected to the vitreous body of adult PTENf/f mice and optic nerve crush was performed 4 weeks after viral injection.
  • Armcxl overexpression also further increased RGC survival induced by PTEN deletion (FIGs. 5C and 5D).
  • the mutant ArmcxlATM failed to alter either neuronal survival or axon regeneration (FIGs. 5A-5D).
  • YFP+/CTB+ axons should be derived from aRGCs, while the YFP-/CTB+ axons are likely to be from non-aRGCs.
  • Armcxl overexpression induced a significant increase in regenerating axons from non-aRGCs as quantified at 0.5 mm distal from the lesion sites.
  • aRGC-derived regenerating axons also showed a trend of increase, but did not reach statistical significance (FIGs. 5F).
  • Armcxl knockdown reduces axon regeneration and neuronal survival in dKO mice
  • Armcxl is further shown necessary for the axon regeneration and neuronal survival phenotypes observed in high regenerative conditions induced by the co-deletion of PTEN and SOCS3 and an accompanying treatment of CNTF (dKO). Together with the fact that Armcxl expression is injury-induced and correlates with high regenerative ability, our results suggest Armcxl as a key regulator of mitochondrial transport in injured axons, which could impact neuronal survival and axon regeneration. Modulated mitochondrial transport might constitute a new strategy to promote neuronal repair of the injured CNS.
  • Armcxl is able to interact with the Miro/Trak mitochondrial transport complex. However, it remains to be determined whether Armcxl mobilizes stationary mitochondria in a calcium dependent manner as has been proposed for Armcx3 (Lopez Domenech et al., 2012). Like other members of the Armcx cluster, Armcxl has a nuclear localization signal ( Figure ID and (Lopez-Domenech et al., 2012)). In these studies, some overexpressed Armcxl was also found to be localized to the nuclei of transfected neurons. Thus, although other functions of Armcxl cannot be ruled out, the results from the
  • ArmcxlATM mutant suggest that the mitochondria-targeted Armcxl protein is responsible for its function in promoting axon regeneration and RGC survival.
  • enhancing mitochondrial transport by genetic deletion of the gene encoding the mitochondria-anchoring protein syntaphilin also facilitated axon regeneration by rescuing energy deficits in injured axons (Zhou et al., 2016).
  • Armcxl acts by regulating energy supply or other mechanisms, such as regulation of calcium homeostasis, signaling via reactive oxygen species, or changes in the production of metabolites requires further studies.
  • sustained axon regeneration likely involves the enhanced axonal transport of not only mitochondria but also other axonal building blocks.
  • mitochondria the same as axonal mitochondria; these differentially localized mitochondria may be responsible for distinct effects on neuronal survival and axon regeneration.
  • the Armcx-cluster specificity to Eutherian mammals might imply that it has evolved as an additional layer of mitochondrial transport regulation to match the increasing complexity of the mammalian CNS. Our results suggest that this extra layer of regulation might be especially important when stress, such as an injury, is applied to the axon. Because mitochondrial transport failure has been reported in many neurodegenerative diseases (De Vos et al., 2008), increasing mitochondrial transport has been proposed as an exciting option to counteract axonal degeneration and subsequent neuronal death (Hinckelmann et al., 2013). With this perspective, the present study suggests that Armcxl and its homologues could be a set of important targets of therapeutic interventions for neuronal protection and repair.
  • Retinal ganglion cells do not extend axons by default: promotion by neurotrophic signaling and electrical activity.
  • Doublecortin-Like Kinases Promote Neuronal Survival and Induce Growth Cone Reformation via Distinct Mechanisms. Neuron.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Medicinal Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Physics & Mathematics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Pathology (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Epidemiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Zoology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicinal Preparation (AREA)

Abstract

Disclosed are compositions and methods for promoting survival of or axon regeneration in neurons by increasing mitochondrial motility in the neuron. Also disclosed are methods to treat neuronal injury and disease and disorders characterized by neuronal injury. Agents that increase Armcx1 activity, such as Armcx1 polypeptide or vectors comprising nucleic acid encoding Armcx1 polypeptide, are proposed for use in the methods. Pharmaceutical composition comprising the agents, and methods for identifying additional agents are also disclosed.

Description

NEURONAL SURVIVAL AND AXONAL REGENERATION THROUGH
INCREASING MITOCHONDRIAL MOTILITY
RELATED APPLICATIONS
[0001] This Application claims the benefit under 35 U.S.C. § 119(e) of U. S.
Provisional Application serial number 62/431,206, filed December 7, 2016, the contents of which are incorporated herein by reference in their entirety.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on December 7, 2017, is named 701039-088421-PCT_SL.txt and is 4,721 bytes in size.
FIELD OF THE INVENTION
[0003] The present invention relates to field of neuronal survival and regeneration.
GOVERNMENTAL SUPPORT
[0004] This invention was made with government support under Grant No.
R01EY021242, R01GM069808, P30 HD018655 and P30EY012196 awarded by the National Institutes of Health (NIH). The government has certain rights in the invention.
BACKGROUND
[0005] After axotomy, a battery of alterations, such as membrane breakdown, cytoskeleton disassembly and calcium influx, occurs in injured axonal stumps. However, it remains poorly understood how injured neurons cope with such stresses and decide their survival and regenerative responses (Abe and Cavalli, 2008; Bradke et al., 2012; Goldberg and Barres, 2000; He and Jin, 2016). In intact conditions, neuronal mitochondria are transported along the axon across considerable distances to meet local needs for ATP and calcium buffering. Whereas mitochondria remain uniformly distributed along axons in non- growing conditions, mitochondrial distribution is biased towards the active growth cone when the axon is growing, suggesting that mitochondrial transport is regulated to support axonal growth (Morris and Hollenbeck, 1993). Thus, it is conceivable that mitochondrial dynamics might be important for regulating axonal and neuronal injury responses. [0006] In all species, axonal mitochondria move bi-directionally along microtubule tracks. Their movement can be continuous or interrupted by pauses (for review see (Schwarz, 2013)). Previous studies revealed that an evolutionarily conserved protein complex that includes the mitochondrial GTPase Miro (also called RhoTl/2) and the adaptor Milton (also called Trakl/2) is essential for regulating the transport of mitochondria. However, considering the complexity of mitochondrial dynamics and its extensive regulation by signaling pathways (Courchet et al., 2013; Pekkurnaz et al., 2014; 3 Wang et al., 2011), it is unknown what regulatory mechanisms might act in fine tuning mitochondrial transport during pathological conditions, such as after an injury. In injured axons of the peripheral nervous system (PNS), it has been shown that regenerating axons increase mitochondrial movement (Mar et al., 2014; Misgeld et al., 2007), but the mechanisms underlying this response remain unclear. In addition, as most injured axons in the adult CNS cannot regenerate spontaneously, the regulation of mitochondrial transport and its relevance to axon regeneration in these axons has not been formally investigated. Therefore, whether increasing mitochondrial movement could have an impact on neuronal survival and axon regeneration remains an open question.
SUMMARY
[0007] Aspects of the present invention relate to the discovery that expression of
Armcxl correlates with high axonal regeneration, modulates the transport of the axonal mitochondria and promotes neuronal survival and axonal regeneration. Described herein are compositions and methods to promote survival of neurons and/or axons regeneration of neurons. Provided herein are methods and compositions useful for neuronal injury or a disease or disorder causing neuronal injury or resulting from neuronal injury.
[0008] In one aspect provided herein is a method for promoting survival of, or axon regeneration in an injured mature central nervous system (CNS) neuron, the method comprising: contacting the neuron with an effective amount of an agent capable of increasing mitochondrial motility in the injured neuron, thereby promoting survival of, or axon regeneration in the injured neuron.
[0009] In some embodiments, the method of the foregoing aspect further comprises detecting the resultant promotion of the survival of, or axon regeneration in the injured neuron in the subject.
[0010] In some embodiments, the injured neuron results from traumatic injury, traumatic brain injury, optic nerve injury, acute spinal cord injury, stroke, restorative CNS surgery or CNS degeneration. [0011] In some embodiments, the injured neuron is a sensory neuron.
[0012] In some embodiments, the injured neuron is in the spinal cord or the optic nerve.
[0013] In some embodiments, the agent is administered intravenously, intracortically, intracerebrally, intrathecally, intranasally, ocularly or locally at the injured neuron.
[0014] In some embodiments, the agent is Armcxl polypeptide. In some
embodiments, the Armcxl polypeptide is recombinant. In some embodiments, the Armxcl polypeptide comprises a carrier peptide or lipophilic molecular group and/or is encapsulated in a liposome or a nanoparticle.
[0015] In some embodiments, the agent is a vector comprising a nucleic acid sequence that encodes an Armcxl polypeptide.
[0016] In some embodiments, the vector is a viral vector or non-viral vector. In some embodiments, the viral vector is selected from the group consisting of retrovirus, lentivirus, adenovirus, herpesvirus, poxvirus, alpha virus, vaccinia virus, and adeno-associated viruses. In some embodiments, the non-viral vector is selected from the group consisting of a nanoparticle, a cationic lipid, a cationic polymer, a metallic nanoparticle, a nanorod, a liposome, microbubbles, a cell penetrating peptide and a liposphere.
[0017] In some embodiments, the Armcxl polypeptide is of human origin. In some embodiments, the Armcxl polypeptide comprises the sequence of SEQ ID NO: l . In some embodiments the Armcxl polypeptide has at least 95% amino acid sequence identity to SEQ ID NO: 1 and retains at least 80% of the biological activity of human Armcxl of SEQ ID NO: l .
[0018] In some embodiments, the detecting step is effected by an indirect assay of axon regeneration.
[0019] In some embodiments, the detecting step is effected by a direct assay of axon regeneration.
[0020] In some embodiments, the method of the foregoing aspect further comprises an antecedent step of determining that the neuron is injured, and has axotomy-induced stress.
[0021] In some embodiments, the method of the foregoing aspect further comprises contacting the injured neuron with a PTEN inhibitor, inhibitor of suppressor of cytokine signaling 3 (SOCS3), inosine, oncomodulin, BNDF, NGF, CNTF, or combinations thereof.
[0022] In some embodiments, the inhibitor of SOCS3 comprises a SOCS3 specific hpRNA or siRNA. [0023] In some embodiments, the PTEN inhibitor is, (a) potassium
bisperoxo(bipyridine)oxovanadate (V) (bpV(bipy)); (b) dipotassium bisperoxo(5- hydroxypyridine-2-carboxyl)oxovanadate (V) (bpV(HOpic)); (c) potassium bisperoxo(l, 10- phenanthroline)oxovanadate (V), (bpV(phen)); or (d) dipotassium
bisperoxo(picolinato)oxovanadate (V), (bpV(pic)).
[0024] In some embodiments, the neuron is human.
[0025] In another aspect, technology herein relates to a method of treating a subject for neuronal injury, comprising: administering to the subject an agent that increases mitochondrial motility in injured neurons, wherein the administering results in contacting the injured neurons of the subject with the agent in an amount sufficient to promote survival of, or axon regeneration in the injured neurons, such that the subject is treated.
[0026] In some embodiments, the agent is administered intravenously, intracortically, intracerebrally, intrathecally, intranasally, ocularly or locally at the site of neuronal injury.
[0027] In some embodiments, the neuronal injury results from a traumatic injury, traumatic brain injury, optic nerve injury, acute spinal cord injury, stroke, restorative CNS surgery or CNS degeneration.
[0028] In some embodiments, the neuronal injury results from restorative CNS injusry and wherein the agent is administered prior to, during or following restorative CNS surgery.
[0029] In some embodiments, the agent is Armcxl polypeptide.
[0030] In some embodiments, the Armcxl polypeptide is recombinant.
[0031] In some embodiments, the Armxcl polypeptide comprises a carrier peptide or lipophilic molecular group and/or is encapsulated in a liposome or a nanoparticle.
[0032] In some embodiments, the agent is a vector comprising a nucleic acid sequence that encodes a Armcxl polypeptide.
[0033] In some embodiments, the vector is a viral vector or non-viral vector. In some embodiments, the viral vector is selected from the group consisting of retrovirus, lentivirus, adenovirus, herpesvirus, poxvirus, alpha virus, vaccinia virus, and adeno-associated viruses. In some embodiments, the non-viral vector is selected from the group consisting of a nanoparticle, a cationic lipid, a cationic polymer, a metallic nanoparticle, a nanorod, a liposome, microbubbles, a cell penetrating peptide and a liposphere.
[0034] In some embodiments, the Armcxl polypeptide is of human origin.
[0035] In some embodiments, the Armcxl polypeptide comprises the sequence of
SEQ ID NO: l . [0036] In some embodiments, the Armcxl polypeptide has at least 95% amino acid sequence identity to SEQ ID NO: 1 and retains at least 80% of the biological activity of human Armcxl of SEQ ID NO: 1.
[0037] In another aspect, technology herein relates to a method of treating a subject for a disease or disorder characterized by neuronal death or diminished potential for axonal growth, comprising administering to the subject an agent that increases mitochondrial motility, in an amount sufficient to promote survival of, or axonal growth in neurons, such that the subject is treated.
[0038] In some embodiments, the disorder is selected from group comprising of glaucoma, stroke, head trauma, spinal injury, optic injury, ischemia, hypoxia,
neurodegenerative disease, multiple sclerosis, infectious disease, cancer, and autoimmune disease.
[0039] In some embodiments, the agent is Armcxl polypeptide or a vector comprising a nucleic acid sequence encoding an Armcxl polypeptide.
[0040] In another aspect of the technology herein is a method for promoting survival of, or axon regeneration in an injured mature central nervous system neuron in a subject determined to have a neuronal injury, the method comprising, administering to the subject Armcxl polypeptide or an analog thereof in an amount sufficient to promote survival of, or axon regeneration of the injured neuron.
[0041] In another aspect, technology herein relates to a device for promoting survival of, or axon regeneration in an injured mature central nervous system (CNS) neuron in situ, comprising a therapeutically effective amount of an agent that increases mitochondrial motility in the neuron, and wherein the device locally releases the agent into the CNS for promoting survival of, or axon regeneration in an injured mature central system (CNS) neuron.
[0042] In some embodiments, the device of the foregoing aspect comprises a CNS- implantable solid or semi-solid device selected from a biodegradable matrix, fiber, pump, stent, adsorbable gelatin osmotic pump or indwelling catheter.
[0043] In another aspect, provided herein is a pharmaceutical composition comprising an effective amount of Armcxl polypeptide or a vector comprising a nucleic acid sequence encoding the Armcxl polypeptide and a pharmaceutically acceptable carrier, for use in promoting survival of, or regeneration of axon in injured neurons.
[0044] In some embodiments, the Armcxl polypeptide is of human origin. [0045] In some embodiments, the Armcxl polypeptide comprises the sequence of
SEQ ID NO: 1.
[0046] In some embodiments, the Armcxl polypeptide has at least 95% amino acid sequence identity to SEQ ID NO: 1 and retains at least 80% of the biological activity of human Armcxl of SEQ ID NO: 1.
[0047] In some embodiments, the Armcxl polypeptide is fused to a carrier polypeptide.
[0048] In some embodiments, the vector is a viral or non-viral vector. In some embodiments, the viral vector is selected from the group consisting of retrovirus, lentivirus, adenovirus, herpesvirus, poxvirus, alpha virus, vaccinia virus, and adeno-associated viruses. In some embodiments, the non-viral vector is selected from the group consisting of a nanoparticle, a cationic lipid, a cationic polymer, a metallic nanoparticle, a nanorod, a liposome, microbubbles, a cell penetrating peptide and a liposphere.
[0049] In some embodiments, the Armcxl polypeptide or the vector comprising a nucleic acid sequence encoding the Armcxl polypeptide is formulated with a lipophilic molecular group and/or encapsulated in a liposome or a nanoparticle.
[0050] In some embodiments, the pharmaceutical compositions of the foregoing aspects, are formulated for administration to the brain, spinal cord, or optical nerve.
[0051] In some embodiments, the composition is formulated for administration via intracerebroventricular, intranasal, intracranial, intracelial, intracerebellar, or intrathecal administration route.
[0052] In some embodiments, the pharmaceutical composition is contained in a delivery device selected from the group consisting of a syringe, a blunt tip syringe, a catheter, an inhaler, a nebulizer, a nasal spray pump, a nasal irrigation pump or nasal lavage pump, and an implantable pump.
[0053] In another aspect, the technology herein relates to a pharmaceutical composition comprising an agent that increases mitochondrial motility in injured neuron and a pharmaceutically acceptable carrier, for use in promoting survival of, or regeneration of axon in injured neurons.
[0054] In some embodiments, the agent is Armcxl polypeptide or a vector comprising a nucleic acid sequence encoding the Armcxl polypeptide.
[0055] In another aspect, the technology herein relates to a method for identifying an agent effective in promoting survival of, or axon regeneration in neurons after injury, the method comprising: (a) contacting a neuron with a candidate agent; (b) determining expression level of Armcxl in the neurons from step (a); and (c) identifying the candidate agent as effective if the expression level of Armcxl is increased relative to a reference level upon the contact of the neuron with the candidate agent; or identifying the candidate agent as ineffective if the expression level of Armcxl is not changed relative to a reference level upon the contact of the neuron with the candidate agent.
[0056] In some embodiments, the reference level is expression level of Armcxl in neurons prior to contact with the candidate agent.
[0057] In some embodiments, the contacting is in vitro or in vivo.
Definitions:
[0058] Unless stated otherwise, or implicit from context, the following terms and phrases include the meanings provided below. Unless explicitly stated otherwise, or apparent from context, the terms and phrases below do not exclude the meaning that the term or phrase has acquired in the art to which it pertains. The definitions are provided to aid in describing particular embodiments, and are not intended to limit the claimed invention, because the scope of the invention is limited only by the claims. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.
[0059] As used herein the term "comprising" or "comprises" is used in reference to compositions, methods, and respective component(s) thereof, that are useful to an
embodiment, yet open to the inclusion of unspecified elements, whether useful or not.
[0060] As used herein the term "consisting essentially of refers to those elements required for a given embodiment. The term permits the presence of elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment of the invention.
[0061] As used herein the term "consisting of refers to compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.
[0062] The terms "disease", "disorder", or "condition" are used interchangeably herein, refer to any alternation in state of the body or of some of the organs, interrupting or disturbing the performance of the functions and/or causing symptoms such as discomfort, dysfunction, distress, or even death to the person afflicted or those in contact with a person. A disease or disorder can also be related to a distemper, ailing, ailment, malady, disorder, sickness, illness, complaint, or affectation. [0063] The term "in need thereof when used in the context of a therapeutic or prophylactic treatment, means having a disease, being diagnosed with a disease, or being in need of preventing a disease, e.g., for one at risk of developing the disease. Thus, a subject in need thereof can be a subject in need of treating or preventing a disease.
[0064] As used herein, mitochondrial "motility" refers to mitochondrial movement within a cell. Motility of mitochondria is another aspect of mitochondrial dynamics beyond fusion and fission. This aspect is critically important in highly polarized cells, such as neurons. In some embodiments, increase in mitochondrial motility refers to the fraction of time mitochondria is in motion rather than paused. In some embodiments, increase in mitochondrial motility refers to increase in the motile mitochondrial pool.
[0065] As used here, the term "pharmaceutically acceptable" refers to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
[0066] As used here, the term "pharmaceutically acceptable carrier" means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid or solvent encapsulating material necessary or used in formulating an active ingredient or agent for delivery to a subject. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient.
[0067] In certain embodiments, Armcxl polypeptide or vector comprising a nucleic acid sequence encoding an Armcxl polypeptide or compositions provided herein can be formulated in liposomes to promote delivery across membranes. As used herein, the term "liposome" refers to a vesicular structure having lipid-containing membranes enclosing an aqueous interior. In cell biology, a vesicular structure is a hollow, lamellar, spherical structure, and provides a small and enclosed compartment, separated from the cytosol by at least one lipid bilayer. Liposomes can have one or more lipid membranes. Oligolamellar large vesicles and multilamellar vesicles have multiple, usually concentric, membrane layers and are typically larger than lOOnm. Liposomes with several nonconcentric membranes, i.e., several smaller vesicles contained within a larger vesicle, are termed multivesicular vesicles.
[0068] Liposomes can further comprise one or more additional lipids and/or other components such as sterols, e.g.,, cholesterol. Additional lipids can be included in the liposome compositions for a variety of purposes, such as to prevent lipid oxidation, to stabilize the bilayer, to reduce aggregation during formation or to attach ligands onto the liposome surface. Any of a number of additional lipids and/or other components can be present, including amphipathic, neutral, cationic, anionic lipids, and programmable fusion lipids. Such lipids and/or components can be used alone or in combination. One or more components of the liposome can comprise a ligand, e.g.,, a targeting ligand.
[0069] Liposome compositions can be prepared by a variety of methods that are known in the art. See e.g., patents cited as reference, (25, 26, 27, 28, 29, 30). Niosomes are non-phospholipid based synthetic vesicles that have properties and function like liposomes.
[0070] As used herein, the term "nanoparticle" refers to a particle having a size between 1 and 1000 nm which can be manufactured from artificial or natural macromolecular substances. To such nanoparticles can be bound drugs or other biologically active materials by covalent, ionic or adsorptive linkage, or the latter can be incorporated into the material of the nanoparticles. Nanoparticles may or may not exhibit size-related properties that differ significantly from those observed in fine particles or bulk materials. Nanoparticles provide improved bioavailability by enhancing aqueous solubility, increasing resistance time in the body (increasing half-life for clearance/increasing specificity for its cognate receptors and targeting drug to specific location in the body (its site of action). This results in concomitant reduction in quantity of the drug required and dosage toxicity, enabling the safe delivery of toxic therapeutic drugs and protection of non-target tissues and cells from severe side effects. Non-limiting examples of nanoparticles include solid lipid nanoparticles (comprise lipids that are in solid phase at room temperature and surfactants for emulsification, the mean diameters of which range from 50 nm to 1000 nm for colloid drug delivery applications), liposomes, nanoemulsions (oil-in-water emulsions done on a nano-scale), albumin nanoparticles, and polymeric nanoparticles.
[0071] Nanoparticles can be surface coated to modulate their stability, solubility, and targeting. A coating that is multivalent or polymeric confers high stability (34). A non- limiting example includes coating with hydrophilic polymer such as polyethylene glycol or ploysorbate-80.
[0072] As used herein the term "lipophilic molecular group" refers to a lipid moiety, such as a fatty acid, glyceride or phospholipid which when coupled to a therapeutic molecule to be a targeted to the brain, increases its lipophilicity and hence movement across blood brain barrier. The lipophilic molecular group can be attached to the therapeutic molecule through an ester bond. As it relates to the present disclosure a lipophilic molecular group can enable uptake of the agents or compositions herein into the mitochondria of the neurons. [0073] As used herein the term "carrier polypeptide" refers to a peptide which exhibits substantially no bioactivity. In some embodiments, the carrier peptide is a
mitochondria targeting peptide and which is capable of targeting the agent to the
mitochondria of the neuron. Examples of mitochondria target peptide are known in the art. See e.g., Mitochondrion. 2013 Nov; 13(6):610-4., Protein Eng. 1990 Oct;4(l):33-7., the contents of which are incorporated herein by reference in its entirety). In some embodiments, the carrier peptide capable of passing the blood-brain barrier. The carrier peptide can be an endogenous peptide whose receptor is present on the cerebral capillary endothelial cell, such as insulin, insulin-like growth factor (IGF), leptin and transferrin or fragments thereof (see, e.g.,, reference 35). The carrier peptide can be, for example, a short cell penetrating peptide of less than 30 amino acids that are amphipathic in nature and are able to interact with lipidic membranes. Non-limiting examples of carrier peptides include SynB3, TAT ( HIV-1 trans- activating transcriptor).
[0074] As used herein, the term "in combination" refers to the use of more than one prophylactic and/or therapeutic agent simultaneously or sequentially and in a manner such that their respective effects are additive or synergistic.
[0075] The term "effective amount" can be used interchangbly with "therapeutically effective amount" as used herein, refers to an amount sufficient to affect a beneficial or desired clinical result upon treatment. Specifically, the term "effective amount" means an amount of an agent e.g., Armcxl polypeptide, sufficient to measurably increase at least one of; mitochondrial motility in injured neurons, ii. survival of injured neurons , or iii) axon regeneration in injured neurons by at least 3 fold, at least 2.5 fold, at least 2 fold, at least 1.5 fold upon contacting with injured neurons, ex vivo or in vivo with effective amount relative to absence of contacting. The increase in at least one of the desired biological activity can result in a measurable effect in terms of neuronal repair in a treated subject against for e.g., neurodegenerative disease, brain trauma, stroke. The effective amounts may vary, as recognized by those skilled in the art, depending on the number of neurons to be contacted, the duration of contact, the specific underlying disease resulting in neuronal injury, intensity of prior therapy such as chemotherapy or radiotherapy. The effective amount of an active therapeutic agent used to practice the present disclosure for the treatment of a CNS disease or neuronal injury varies depending upon the manner of administration, the age, body weight, and general health of the subject. Ultimately, the attending clinician will decide the appropriate amount and dosage regimen. Such amount is referred to as an "effective" amount. [0076] An effective amount can therefore result in a clinical outcome of at least one selected from; increased survival of injured neurons or increased axon regeneration in injured neurons and cause treatment, reverse, alleviate, ameliorate, inhibit, slow down or stop the progression or severity of the disease characterized by, resulting in, or due to neuronal injury.
[0077] By "promoting regeneration of axon" is meant increasing the number of axons or the distance of extension of axons relative to a control condition (e.g., in non-injured neurons). Preferably the increase is by at least 2-fold, 2.5-fold, 3-fold or more.
[0078] By "fragment" is meant a portion of a polypeptide that has at least 50% of the biological activity of the polypeptide from which it is derived. This portion contains, preferably, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the entire length of the reference nucleic acid molecule or polypeptide. A fragment of a polypeptide or nucleic acid molecule may contain 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 nucleotides or amino acids.
[0079] By "neuron" is meant any nerve cell derived from the nervous system of a mammal (e.g., mature neuron of the central nervous system).
[0080] By "restorative CNS surgery" is meant any procedure carried out on the central nervous system to enhance neurological function. An exemplary restorative CNS surgery is a peripheral nerve graft or a reinsertion of avulsed nerve roots.
[0081] As used herein, the terms "treat," "treatment," "treating," or "amelioration" refer to therapeutic treatments, wherein the object is to reverse, alleviate, ameliorate, inhibit, slow down or stop the progression or severity of a disorder or syndrome, (e.g.,, neuronal injury, glaucoma, stroke, head trauma, spinal injury, optic injury, ischemia, hypoxia, neurodegenerative disease, multiple sclerosis, infectious disease, cancer, and autoimmune disease) characterized by or making a patient susceptible to neuronal death and or inhibition of axon generation. The term "treating" includes reducing or alleviating at least one adverse effect or symptom of a syndrome. Treatment is generally "effective" if one or more symptoms or clinical markers are reduced. In the case of neuronal death or lack of axon generation, "effective treatment" refers to a treatment that increases the number of surviving neurons and/or increases the number of axons in the neurons) and maintains normal function of the neurons. Alternatively, or in addition, treatment is "effective" if the progression of a disease is reduced or halted. That is, "treatment" includes not just the improvement of symptoms or markers, but also a cessation of, or at least slowing of, progress or worsening of symptoms compared to what would be expected in the absence of treatment. Beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptom(s), diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, remission (whether partial or total), and/or decreased mortality. For example, treatment is considered effective if the condition is stabilized. The term "treatment" of a disease also includes providing relief from the symptoms or side-effects of the disease (including palliative treatment).
[0082] As used herein, the term "gene expression" includes both gene transcription, whereby DNA (or RNA in the case of some RNA-containing viruses) corresponding to a gene is transcribed to generate an RNA molecule and RNA translation, whereby an RNA molecule is translated to generate a protein encoded by the gene. As used herein, the term "protein expression" is used to refer both to gene expression comprising transcription of DNA (or RNA) to form an RNA molecule and subsequent processing and translation of the RNA molecule to form protein and to gene expression comprising translation of mRNA to form protein.
[0083] The term "encode" refers to any process whereby the information in one molecule is used to direct the production of a second molecule that has a different chemical nature from the first molecule. For example, a DNA molecule can encode an RNA molecule (e.g., by the process of transcription incorporating a DNA-dependent RNA polymerase enzyme). Also, an RNA molecule can encode a polypeptide, as in the process of translation. When used to describe the process of translation, the term "encode" also extends to the triplet codon that encodes an amino acid. In some aspects, an RNA molecule can encode a DNA molecule, e.g., by the process of reverse transcription incorporating an RNA-dependent DNA polymerase. In another aspect, a DNA molecule can encode a polypeptide, where it is understood that "encode" as used in that case incorporates both the processes of transcription and translation.
[0084] As used herein, a "subject", "patient", "individual" and like terms are used interchangeably and refers to a vertebrate, preferably a mammal, e.g., a primate, e.g., a human. Mammals include, without limitation, humans, primates, rodents, wild or
domesticated animals, including feral animals, farm animals, sport animals, and pets.
Primates include, for example, chimpanzees, cynomologous monkeys, spider monkeys, and macaques, e.g., Rhesus. Rodents include, for example, mice, rats, woodchucks, ferrets, rabbits and hamsters. Domestic and game animals include, for example, cows, horses, pigs, deer, bison, buffalo, feline species, e.g., domestic cat, and canine species, e.g., dog, fox, wolf, avian species, e.g., chicken, emu, ostrich, and fish, e.g., trout, catfish and salmon. The terms, "individual," "patient" and "subject" are used interchangeably herein. In some embodiments, the subject is a human. A subject can be male or female.
[0085] A "pharmaceutical composition" refers to a chemical or biological
composition suitable for administration to a mammalian subject. Such compositions may be specifically formulated for administration via one or more of a number of routes, including but not limited to, oral, parenteral, intravenous, intraarterial, subcutaneous, intranasal, sublingual, intraspinal, intracerebroventricular, ocular and the like.
[0086] Mammals other than humans can be advantageously used as subjects that represent animal models of conditions or disorders disclosed herein. In one embodiment, the subject is a non-human primate animal in a model for neurodegeneration or nervous system (CNS or PNS) injury. Neurons derived from said subjects are also suitable for performance of the methods described herein.
[0087] A subject can be one who has been previously diagnosed with or identified as suffering from or under medical supervision for a disorder characterized by neuronal injury. A subject can be one who has undergone or will be undergoing a CNS restorative surgery or axotomy. A subject can be one who is diagnosed and currently being treated for, or seeking treatment, monitoring, adjustment or modification of an existing therapeutic treatment, or is at a risk of developing such a disorder.
[0088] As used herein, the term "administering," refers to the placement of an agent
(e.g., Armcxl polypeptide or a vector comprising a nucleic acid sequence encoding the Armcxl polypeptide) as disclosed herein into a subject by a method or route that results in at least partial delivery of the agent at a desired site (e.g., at or near the site of neuronal injury) such that the administering results in contact of the injured neurons with the agent.
Pharmaceutical compositions comprising the agent or cell preparation disclosed herein can be administered by any appropriate route which results in an effective treatment in the subject, e.g., intracerebroventricular ("icv") administration, intranasal administration, intracranial administration, intracelial administration, intracerebellar administration, or intrathecal administration. Administration can be continuous or intermittent. In various aspects, a preparation or an agent can be administered therapeutically; that is, administered to treat an existing disease or condition. In further various aspects, a preparation can be administered prophylactically; that is, administered for prevention of a disease or condition (e.g., neuronal injury). [0089] The term "contacting" as used herein, refers to bringing a disclosed agent (e.g.
Armcxl polypeptide or a vector comprising a nucleic acid sequence encoding the Armcxl polypeptide) and a cell (e.g., injured neuron), a target receptor, or other biological entity together in such a manner that the agent can affect the activity of the target (e.g.,
mitochondria, neuronal cell, axon etc.), either directly; i.e., by interacting with the target itself, or indirectly; i.e., by interacting with another molecule, co-factor, factor, or protein on which the activity of the target is dependent.
[0090] As used herein, the terms "protein", "peptide" and "polypeptide" are used interchangeably to designate a series of amino acid residues connected to each other by peptide bonds between the alpha-amino and carboxy groups of adjacent residues. The terms "protein", "peptide" and "polypeptide" refer to a polymer of amino acids, including modified amino acids (e.g.,phosphorylated, glycated, glycosylated, etc.) and amino acid analogs, regardless of its size or function. "Protein" and "polypeptide" are often used in reference to relatively large polypeptides, whereas the term "peptide" is often used in reference to small polypeptides, but usage of these terms in the art overlaps. The terms "protein", "peptide" and "polypeptide" are used interchangeably herein when referring to a gene product and fragments thereof.
[0091] The term "neurodegeneration" refers to a physiological state caused by neuronal injury associated with neuronal loss and/or damage, or loss of axon regeneration. In specific aspects, neurodegeneration refers to neuronal injury resulting in impaired cognitive function.
[0092] The term "neuronal injury" as used herein refers to any damage or dysfunction exhibited by neurons, including but not limited to loss of myelin, dendrite retraction, dendritic spine density reduction, axonal damage, loss of axon regeneration and neuronal death.
[0093] The term "small molecule" refers to a molecule of a size comparable to those organic molecules generally used in pharmaceuticals. The term excludes biological macromolecules (e.g., proteins, nucleic acids, etc.). Preferred small organic molecules range in size up to about 5000 Da, more preferably up to 2000 Da, and most preferably up to about 1000 Da.
[0094] As used herein, the term "neurite growth" or "neurite outgrowth" includes the process by which axons or dendrites extend from a neuron. The outgrowth can result in a new neuritic projection or in the extension of a previously existing cellular process. Neurite outgrowth may include linear extension of an axonal process by five cell-diameters or more. [0095] "Central nervous system (CNS) neurons" include the neurons of the brain, the cranial nerves and the spinal cord. The invention relates not only to CNS neurons but also to peripheral neurons that make projections (axons) in CNS, for instance dorsal root ganglion neurons.
[0096] As used herein the term "brain injury" is the destruction or degeneration of brain cells is in the brain of a living organism. Brain injuries can result from direct impacts to the head. Such injuries are for example traumatic brain injury and spinal cord injury. The present invention may also be used in treating other neuronal disorders, which include disease, disorder, or condition directly or indirectly affecting the normal functioning or anatomy of a subject's nervous system. The disorder may be a neuronal injury, which can be acute or chronic. Examples of acute injury are those that results from surgery, trauma, compression, contusion, transection or other physical injury, vascular pharmacologic or other insults including hemorrhagic or ischemic damage. Chronic neuronal injury may result from repetitive stress, inflammation/oxidative stress within a neural tissue caused by disease, neurodegenerative or other neurological diseases. The method and compositions provided herein can be beneficial in all diseases where the CSPG matrix is inhibitory for regeneration or maintenance of axons, such as TBI, SCI, multiple sclerosis (MS disease) and amyotrophic lateral sclerosis (ALS).
[0097] "Traumatic brain injury, TBI" as used herein includes the condition in which a traumatic blow to the head causes damage to the brain or connecting spinal cord, with or without penetrating the skull. It relates more specifically to the actual mechanical damage that occurs at the type of trauma, such as shearing, tearing and stretching of axons, neurons and blood vessels. Usually, the initial trauma can result in expanding hematoma,
subarachnoid hemorrhage, cerebral edema, raised intracranial pressure, and cerebral hypoxia, which can, in turn, lead to severe secondary events due to low cerebral blood flow.
[0098] "A spinal cord injury, SCI" as used herein is damage to any part of the spinal cord or nerves at the end of the spinal canal. It often causes permanent changes in strength, sensation and other body functions below the site of the injury. The spinal cord injury may be a complete severing of the spinal cord, a partial severing of the spinal cord, or a crushing or compression injury of the spinal cord. Spinal cord injury SCI proceeds over minutes, hours, days and even months after the initial traumatic insult and can lead to significant expansion of the original damage. These secondary events are a consequence of delayed biochemical, metabolic and cellular changes, which are initiated by the primary injury, and includes inflammation, free radical induced cell death and glutamate excitotoxicity. Axonal sprouting, from surviving neurons, is associated with spontaneous motor and sensory recovery following TBI and SCI. Although the CNS has a limited capacity to regenerate, spontaneous pericontusional axon sprouting does take place approximately 1-2 weeks after trauma.
However, this process typically fails due to an inhibitory axonal environment promoted by chon- rioting sulphate proteoglycans (CSPGs). Astrocytes, at the site of injury, produce CSPGs, beyond which the axons cannot regenerate (Silver and Miller, 2004). Inhibition of CSPG activity represents one potential approach to neuroregeneration, following either TBI or SCI. Evidence in support of this theory has been provided through the use of
chondroitinase ABC (ChABC, an enzyme that degrades CSPGs) at the site of trauma in rodent models of TBI and SCI. ChABC treatment resulted in an enhanced and prolonged sprouting response with an increase in sensory, motor and autonomic function (Harris et al., 2010, Starkey et al., 2012).
[0099] The terms "increased" 'increase", "increasing" or "enhance" are all used herein to generally mean an increase by a statically significant amount; for the avoidance of doubt, the terms "increased", "increase", or "enhance", mean an increase of at least 10% as compared to a reference level, for example an increase of at least about 10%, at least about 20%), or at least about 30%>, or at least about 40%>, or at least about 50%>, or at least about 60%), or at least about 70%>, or at least about 80%>, or at least about 90%> or up to and including a 100%> increase or any increase between 10-100%) as compared to a reference level, or at least about a 2-fold, or at least about a 3 -fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater as compared to a reference level. The increase can be, for example, at least 10%>, at least 20%), at least 30%>, at least 40%> or more, and is preferably to a level accepted as within the range of normal for an individual without a given disease.
[00100] As used herein the term "reference level" refers to a level of expression of Armcxl in a "control sample". A control sample can be one that has not been contacted with an agent of the present disclosure. In certain embodiments, a control sample is obtained prior to administration of the inhibitor. In certain embodiments, a reference standard is used as a surrogate for a control sample.
[00101] As used herein, the term "vector" is used in reference to a vehicle used to introduce a nucleic acid sequence into a cell. A viral vector is virus that has been modified to allow recombinant DNA sequences to be introduced into host cells or cell organelles. A non- viral vector delivers an amplified amount of agent or nucleic acid to a target tissue, cell or subcellular area, and comprise a lipid based or solid platform suitable for binding a number of substances (e.g., nanoparticle, liposomes etc.).
[00102] "Nucleic acid sequence", as used herein, refers to a polymer of nucleotides in which the 3' position of one nucleotide sugar is linked to the 5' position of the next by a phosphodiester bridge. In a linear nucleic acid strand, one end typically has a free 5' phosphate group, the other a free 3' hydroxyl group. Nucleic acid sequences may be used herein to refer to oligonucleotides, or polynucleotides, and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin that may be single- or double-stranded, and represent the sense or antisense strand.
[00103] The terms, "decrease", "reduce", "reduction", "lower" or "lowering," or "inhibit" are all used herein generally to mean a decrease by a statistically significant amount. For example, "decrease", "reduce", "reduction", or "inhibit" means a decrease by at least 10% as compared to a reference level, for example a decrease by at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%), or at least about 80%, or at least about 90% or up to and including a 100% decrease (e.g., absent level or non-detectable level as compared to a reference level), or any decrease between 10-100%) as compared to a reference level. In the context of a marker or symptom, by these terms is meant a statistically significant decrease in such level. The decrease can be, for example, at least 10%, at least 20%, at least 30%, at least 40% or more, and is preferably down to a level accepted as within the range of normal for an individual without a given disease.
[00104] The term "statistically significant" or "significantly" refers to statistical significance and generally means a difference of two standard deviations (2SD) or more.
[00105] Definitions of common terms in cell biology and molecular biology can be found in "The Merck Manual of Diagnosis and Therapy", 19th Edition, published by Merck Research Laboratories, 2006 (ISBN 0-911910-19-0); Robert S. Porter et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0- 632-02182-9); Immunology by Werner Luttmann, published by Elsevier, 2006. Definitions of common terms in molecular biology can also be found in Benjamin Lewin, Genes X, published by Jones & Bartlett Publishing, 2009 (ISBN- 10: 0763766321); Kendrew et al. (eds.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8) and Current Protocols in Protein Sciences 2009, Wiley Intersciences, Coligan et al., eds. [00106] Unless otherwise stated, the present invention was performed using standard procedures, as described, for example in Sambrook et al., Molecular Cloning: A Laboratory Manual (3 ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (2001); Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (1995); Current Protocols in Protein Science (CPPS) (John E. Coligan, et. al., ed., John Wiley and Sons, Inc.), Current Protocols in Cell Biology (CPCB) (Juan S.
Bonifacino et. al. ed., John Wiley and Sons, Inc.), and Culture of Animal Cells: A Manual of Basic Technique by R. Ian Freshney, Publisher: Wiley-Liss; 5th edition (2005), Animal Cell Culture Methods (Methods in Cell Biology, Vol. 57, Jennie P. Mather and David Barnes editors, Academic Press, 1st edition, 1998) which are all incorporated by reference herein in their entireties.
[00107] Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood as modified in all instances by the term "about." The term "about" when used in connection with percentages means ±1% of the value being referred to. For example, about 100 means from 99 to 101.
[00108] Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described below. The abbreviation, "e.g.," is derived from the Latin exempli gratia, and is used herein to indicate a non-limiting example. Thus, the abbreviation "e.g.," is synonymous with the term "for example."
[00109] As used in this specification and appended claims, the singular forms "a," "an", and "the" include plural references unless the context clearly dictates otherwise. Thus for example, reference to "the method" included one or more methods, and/or steps of the type described herein and/or which will become apparent to those persons skilled in the art upon reading this disclosure and so forth.
[00110] In this application and the claims, the use of the singular includes the plural unless specifically stated otherwise. In addition, use of "or" means "and/or" unless stated otherwise. Moreover, the use of the term "including", as well as other forms, such as
"includes" and "included", is not limiting. Also, terms such as "element" or "component" encompass both elements and components comprising one unit and elements and components that comprise more than one unit unless specifically stated otherwise. BRIEF DESCRIPTION OF THE DRAWINGS
[00111] FIGs. 1A-1H show Armcxl is up-regulated in high regeneration conditions in vivo and localizes to mitochondria. (FIG. 1A) In situ hybridization showing Armcxl mRNA levels in mouse retina cross-sections of wild type and high regeneration mutant PTEN, SOCS3 double KO +CNTF (dKO) and PTEN single KO (PTEN"/_) in intact conditions or 3 days post optic nerve crush. Arrow head indicates the retinal ganglion cells layer (GCL). Scale bar: 50μιη. (FIG. IB) Immunohistochemistry showing the level of endogenous Armcxl protein in intact retina or 3 days post optic nerve crush in wild type and high regeneration mutant dKO. Tuj l antibody is used as a RGC marker. Scale bar: 50μιη. (FIG. 1C) Quantification of the percentage of Armcxl positive RGCs from matched sections of 2-3 animals per condition. One-way ANOVA with Tuckey's multiple comparison test. (FIG. ID) Scheme of Armcxl constructs full length and mutant. (FIG. IE) Immunoblot using anti-HA antibody on HEK cell extract transfected either with Armcxl-HA full length or Armcxl-HA lacking the trans membrane domain (ArmcxlATM-HA). Lower panel shows unspecific bands of lower molecular weights used as loading control. (FIG. 1F-1G)
Immunohistochemistry using anti-HA antibody of mouse cortical neurons co-transfected with MitoDsRed2 and Armcxl-HA (FIG. IF) or Armcxl ΔΤΜ-ΗΑ (FIG. 1G). Low magnification picture of transfected neurons can be seen in FIG. 7B, discussed below. Lower panel shows signal intensity measured by line scan. Scale bar: 25μπι. (FIG. 1H) Representative immunoblot showing the specific co-immunoprecipitation (IP) of Mirol-Myc with Armcxl- HA in HEK cells (n=3).
[00112] FIGs. 2A-2G show Armcxl increases mitochondrial transport and axonal outgrowth of adult RGCs. (FIG. 2A) Representative kymographs from live imaging of TMRM labeled mitochondria in RGC axons of adult retina explant from PTEN^ mice co- injected with AAV-Cre and either AAV-PLAP, AAV- Armcxl or AAV- Arm cx 1 ΔΤΜ. (FIG. 2B) Percentage of motile and stationary mitochondria in adult RGC axons of the indicated genotypes. n=12-17 axons from 3 independent experiments. Kruskal-Wallis test with Dunn's multiple comparisons test on the number of axons. (FIG. 2C) Box plot showing the moving frequency of mitochondria in RGC axons of adult retina explants from the indicated genotypes. n=221-348 mitochondria from 3 independent experiments (11-16 axons). Kruskal- Wallis test with Dunn's multiple comparisons test (FIG. 2D) Mitochondrial density in adult RGCs axons. n=l 116 axons from 3 independent experiments. One-way ANOVA with Tuckey's multiple comparisons test. (FIG. 2E) Tuj 1 immunostaining of explants of the indicated genotype. Scale bar: 500μπι (upper row) and ΙΟΟμπι (lower row). (FIG. 2F) Quantification of the number of axons growing out of the explant normalized by explant's size. n=14-16 explants (21-182 axons) from 2 independent experiments. One-way ANOVA with Tuckey's multiple comparisons test. (FIG. 2G) Quantification of the axonal outgrowth for explants of the indicated genotypes. n=14-16 explants from 2 independent experiments. PTEN_/- +Armcxl vs PTEN_/_ +PLAP: *p < 0.05 and **p < 0.01. PTEN_/_ +Armcxl vs PTEN- ^ARMCXIATM: °p < 0.05 and °°p< 0.01. One-way ANOVA with Tuckey's multiple
[00113] FIGs. 3A-3D show Effect of Armcxl overexpression in E18 cortical neurons. (FIG. 3A) Representative kymographs from live imaging of mitochondria in El 8 cortical neurons co-transfected with MitoDsRed and either GFP or Armcxl -F2A-GFP. Traces from motile mitochondria were isolated and represented by the bellow kymographs. (FIG. 3B) Percentage of motile and stationary mitochondria per axon of El 8 cortical neurons transfected as in A. n=8-10 axons from 3 independent experiments. Two tailed Student's Unpaired t-test on the number of axons. (FIG. 3C) Box plot showing the moving frequency (percentage of time each mitochondria in motion) of mitochondria in axons from cortical neurons of the indicated genotypes. The horizontal line shows the median of the distribution. n=74-137 mitochondria from 3 independent experiments (8-10 axons). Mann- Whitney U test. (FIG. 3D) Representative images of El 8 cortical neurons transfected with GFP or Armcxl -F2A-GFP. Scale bar: ΙΟΟμιη. (FIG. 3E) Box plots showing the
distribution of the measurements of the longest neurite in El 8 cortical neurons transfected as in (FIG. 3D). N=54-97 neurons from 3 independent experiments ran in duplicate. Mann- Whitney U test.
[00114] FIGs. 4A-4E shows Armcxl promotes axonal regeneration and neuronal survival. (FIG. 4A) Optical sections (approximately 14μπι) from whole mount cleared optic nerve from wild type mice injected with AAV -PLAP, AAV-Armcxl or AAV-ArmcxlATM, 15 days post optic nerve crush (dashed line). Axons were labeled with CTB injection. Scale bar: ΙΟΟμπι. (FIG. 4B) Full nerve thickness z projections of the cleared optic nerves shown in FIG. 4A. (FIG. 4C) Bar plot showing the average total number of axons growing past the injury site based on the z projection of the whole mount cleared optic nerve. Each dot represents one mouse. n=5-8 mice from 2 independent experiments. One-way ANOVA, Tuckey's multiple comparison test. (FIG.4D) Tuj 1 immunohistochemistry on whole mount retina from wild type mice shown in FIG. 4A. The retina from the crushed eye (right) and intact eye (left) of the same animal is shown. Scale bar: 40μπι. (FIG.4E) Average percentage of RGC survival as measured by Tuj 1 staining. Each dot represents one animal. N = 5-9 mice from two independent experiments. One-way ANOVA, Tuckey's multiple comparison test. [00115] FIGs. 5A-5F show Armcxl potentiates axonal regeneration of PTEN deleted RGCs. (FIG. 5A) Optic nerve sections of PTEN^ mice co-injected with AAV-Cre and the indicated AAVs, 15 days post optic nerve crush (dashed line). Axons were labeled with intraocular CTB injection. Scale bar: ΙΟΟμιη. Pictures of the full nerve can be seen in FIG. l 1, discussed below. (FIG.5B) Bar plot showing the average estimated number of axons growing past the injury site. Each dot represents one animal (2-6 cryo-sections per animal). n=8-9 mice from 2 independent experiments. One-way ANOVA, Tuckey's multiple comparison test. (FIG.5C) Tuj 1 immunohistochemistry of whole mount retina from PTEN^ mice shown in FIG. 5A. Retina from the crushed eye (right) and intact eye (left) of the same animal is shown. Scale bar: 40μιη. (FIG. 5D) Average percentage of RGC survival per animal measured by Tuj 1 staining. Each dot represents one animal. n=8-9 animals. One-way ANOVA, Tuckey's multiple comparison test. Scale bar: 40μιη. (FIG.5E) Optic nerve longitudinal sections 15 days post crush of Kcng4-YFP mice injected with CTB and the indicated AAVs. The YFP channel (was visualized as green) shows the axons projecting from the aRGCs (Kcng4-YFP) and the RFP channel (was visualized as red) shows the CTB labeled axons from all RGCs. (FIG.5F) CTB and YFP axons quantified 0.5 mm from the injury site. n=4 mice per condition. Mann-Whitney U test. Scale bar: 300μπι.
[00116] FIGs. 6A-6F show Armcxl is necessary for axonal regeneration. (FIG. 6A)
Experimental timeline and (left) immunohistochemistry using Armcxl antibody on retina cross sections of dKO mice injected either with AAV-shScramble or AAV-shArmcxl . Mice were euthanized 3 days post optic nerve crush. (Right) Quantification of the number of Armcxl positive RGCs 3 days post optic nerve crush in matching sections of the indicated genotypes. Scale bar: 40μπι. n=3 mice randomly chosen from the cohort shown in (FIG. 6B). Two tailed Student's Unpaired t-test. (FIG. 6B) Experimental timeline and (left) optic nerve sections of dKO mice injected with indicated AAVs, 15 days post optic nerve crush (dashed line). Axons were labeled with CTB injection. Scale bar: ΙΟΟμπι. Pictures of the full nerve are shown in FIG. 121, discussed below. (Right) Bar plot showing the average estimated number of axons growing past the injury site per animal. Each dot represents one animal (2-6 cryo-sections per mice). n=4 per condition. One-way ANOVA, Tuckey's multiple comparison test. (FIG. 6C) (Left) Tuj 1 immunohistochemistry on whole mount retina from dKO mice injected with AAVs as shown in FIG. 6B. Retina from the crushed eye {upper) and intact eye {lower) of the same animal is shown. Scale bar: 40μπι. (Right) Bar plot of the average percentage of RGC survival per animal measured by Tuj 1 staining. Each dot represents one animal. N=5 per condition. Two tailed Student's Unpaired t-test. [00117] FIGs. 7A-7B show expression of Armcxl homologues in high regeneration capacities RGCs and Armcxl co-localization with mitochondria. (FIG. 7A) In situ hybridization showing the mRNA levels of selected members of the Armcx cluster in mouse retina cross-sections of Wt and high regeneration mutant PTEN, SOCS3 double KO +CNTF (dKO) in intact conditions or 3 days post optic nerve crush. Scale bar=5C^m. (FIG. 7B) Immunohistochemistry using anti-HA antibody of mouse cortical neurons co-transfected with MitoDsRed2 and either Armcxl-HA full length or ArmcxlATM-HA. Scale bar=2C^m for the low magnification images and 5μπι for the high magnification images.
[00118] FIGs. 8A-8C shows characterization of AAV infected adult retina explants. (FIG. 8A) Representative images of whole mount retinas from Wt mice injected with the indicated AAVs. 15 days post viral injections, mice were euthanized and
immunohistochemistry using indicated antibodies was performed. Scale bar=10C^m. (FIG. 8B) Quantification of the percentage of RGCs infected with AAV-Armcxl-HA (upper) and Armcx 1ΔΤΜ-ΗΑ (lower). n=1632-2331 RGCs from 2 retina per conditions. (FIG. 8C) Adult retina explant culture of PTEIN mice co-injected with indicated AAVs. Explants were immunostained with Tuj 1 antibody. The majority of Cre infected RGCs axons were also infected with MitoDsRed Flex Switch. Scale bar=10C^m. (FIG. 8D) Box plot showing the moving frequency of motile mitochondria in axons from adult retina explants of PTEN^ mice injected with the indicated AAVs. The horizontal line indicates the median and the whiskers the maximum and minimum of the distribution. n=221-348 mitochondria from 11-16 axons, from 3 independent experiments. Kruskal-Wallis test with Dunn's multiple comparisons test.
[00119] FIGs. 9A-9C shows Armcxl overexpression does not affect mitochondrial density and transport of BDNF positive vesicles. (FIG. 9A) Quantification of the mitochondrial density in axons of El 8 cortical neurons co-transfected with MitoDsRed and either GFP or Armcx 1-F2A-GFP. n=8-10 axons from 3 independent experiments. Two tailed Student's Unpaired t-test. (FIG. 9B) Representative kymographs from live imaging experiments of BDNF positive vesicles in El 8 cortical neurons co-transfected with BDNF- RFP and either GFP or Armcx 1-F2A-GFP. (FIG. 9C) Box plot showing the moving frequency of BDNF positive vesicles in axons from cortical neurons of the indicated genotypes. The horizontal line shows the median of the distribution. n=127-142 vesicles from 9 axons, 3 independent experiments. Mann-Whitney U test.
[00120] FIGs. 10A-10D show Armcxl improve axonal regeneration independently of its survival effect. (FIG. 10A) Tuj 1 immunohistochemistry on whole mount retina from mice of the indicated genotypes. Retina from the crushed eye and intact eye of the same animal is shown. Scale bar=4C^m. (FIG. 10B) Average percentage of RGC survival as measured by Tuj 1 staining. Each dot represents one animal. n=4-5 animals per condition. One-way ANOVA, Tukey's multiple comparison test. (FIG. IOC) Optical sections
(approximately 14μιη) from whole mount cleared optic nerve collected 15 days post optic nerve crush (dashed red line) from Wt mice injected with AAV -PLAP, and Bcl2 mice injected with either AAV-PLAP or AAV-Armcxl . Axons were labeled with intraocular CTB injection. Scale bar=10C^m. (FIG. 10D) Quantification of the average total number of axons growing past the injury site based on the z projection of the whole mount cleared optic nerve. Each dot represents one animal. n=4-5 animals per condition. One-way ANOVA, Holm- Sidak's multiple comparison test.
[00121] FIGs. 11A-11C shows Armcxl overexpression in PTEN_/" potentiates regeneration phenotype and partially recapitulates axonal regeneration phenotype of dKO. Related to Figure 5. (FIG. 11 A) Optic nerve sections of PTEN^ mice co-injected with AAV Cre and the indicated AAVs, 15 days post optic nerve crush. Axons were labeled with CTB injection. Scale bar=50C^m. (FIG. 11B) Side by side comparison of optic nerve sections of PTEN_/" mice injected with the indicated AAVs and dKO, 15 days post optic nerve crush (dashed red line). All AAVs were injected and incubated in parallel in all conditions. Axons were labeled with intraocular CTB injection. Scale bar=10C^m. (FIG. 11C) Bar plot showing the average estimated number of axons at 0.2mm from the injury site. Each dot represents one animal (2-6 cryo-sections per animal). n=4 animals per condition. One-way ANOVA, Tuckey's multiple comparison test.
[00122] FIGs. 12A-12K Armcxl is necessary for dKO high regeneration phenotype. (FIG. 12A) Immunohistochemistry using the indicated antibody of HEK cells co-transfected with Armcxl-HA and either shRNA-Scramble-GFP, shRNA-Armcxl #2, shRNA-Armcxl #5. Scale bar=10C^m (FIG. 12B) Quantification of the intensity ratio from HA and GFP antibody signal. n=5 per conditions from 2 independent experiments with 2-3 technical replicates. One-way ANOVA, Tukey's multiple comparison test. (FIG. 12C)
Representative kymographs from live imaging of mitochondria in El 8 cortical neurons co- transfected with MitoDsRed and either shRNA Scramble or shRNA Armcxl . (FIG. 12D) Percentage of motile and stationary mitochondria per axon of El 8 cortical neurons transfected as in C. n=12-14 axons from 3 independent experiments. Two tailed Student's Unpaired t-test on the number of axons. (FIG. 12E) Box plot showing the moving frequency of mitochondria in axons from cortical neurons transfected as in C. n= 142- 149 mitochondria from 3 independent experiments (12-14 axons). Mann-Whitney U test. (FIG. 12F) Quantification of the mitochondrial density in axons of El 8 cortical neurons co-transfected with either shScramble or shArmcxl . n=12-14 axons from 3 independent experiments. Two tailed Student's Unpaired t-test (FIG. 12G) Representative images of El 8 cortical neurons transfected with shRNA Scramble or shRNA Armcxl using anti GFP and RFP antibody, respectively. Scale bar=10C^m. (FIG. 12H) Box plots showing the distribution of the measurements of the longest neurites in El 8 cortical neurons transfected either with shRNA Scramble or shRNA Armcxl . n= 57 neurons per conditions from 3 independent experiments. Mann-Whitney U test. (FIG. 121) Representative images and quantification of
immunohistochemistry on whole mount retinas from Wt mice injected with either shRNA Scramble (upper) or shRNA Armcxl (lower). Tissues were stained with antibody against Tuj l, GFP (shRNA Scramble) or RFP (shRNA Armcxl). Scale bar=8(^m. (FIG. 12J) Optic nerve sections of dKO mice injected with the indicated AAVs, 15 days post optic nerve crush. Axons were labeled with CTB injection. Images with tissues were stitched and black tiles were added to complete the rectangular shape. Scale bar 500μπι. (FIG. 12K)
Experimental time line and (left) CTB-traced optic nerve sections (first column) and Tuj 1 immunostaining of whole mount retina (second column) of Wt mice intra- vitreally injected with either AAV-shScramble or AAV-shArmcxl . Mice were euthanized 5 weeks post injection. Scale bar=10C^m and 40μπι, respectively. (Right) Quantification of RGC survival of mice with the indicated treatment. n=4-5 mice per condition. Mann-Whitney U test.
DETAILED DESCRIPTION
[00123] The present disclosure is based in part on the discovery that expression of
Armcxl correlates with high axonal regeneration, modulates the transport of the axonal mitochondria and promotes neuronal survival and axonal regeneration. Described herein are compositions and methods to promote survival of neurons and/or axons regeneration of neurons. Provided herein are methods and compositions useful for neuronal injury or a disease or disorder causing neuronal injury or resulting from neuronal injury.
[00124] The methods and compositions provided herein encompasses contacting neurons with an agent for promoting their survival or axon regeneration. In some
embodiments, the agent is a one that is capable of increasing mitochondrial motility in the neurons. In some embodiments, the agent is an Armcxl polypeptide. In some embodiments, the agent is a vector comprising a nucleic acid sequence encoding an Armcxl polypeptide. Armadillo Repeat Containing, X-Linked protein 1 (Armcxl) [00125] Armcxl is a protein that is inserted in the mitochondria. As used herein the term "Armcxl" or "Armcxl protein" or "Armcxl polypeptide" generally refers to an Armcxl polypeptide that is similar or identical in sequence to a wild-type Armcxl . In some embodiments, the term " Armcxl polypeptide " refers to a polypeptide having an amino acid sequence that is at least 80%, at least 85%>, at least 90%>, at least 95%>, at least 97%>, at least 99%), or 100%), identical to that of a wild-type Armcxl and that retains the ability, at a minimum, to increase mitochondrial motility in injured neurons and/or promote survival of injured neurons and/or promote axon regeneration of injured neurons in vivo. Accordingly in some embodiments, "Armcxl polypeptide" can be full length Armcxl . In some
embodiments, "Armcxl" can be a functional fragment of a full length Armcxl, a species homologue and/or functional fragments thereof, an ortholog of Armcxl and/or functional fragments thereof. The Armcxl polypeptide can be a mammalian Armcxl protein. The Armcxl polypeptide can also be a functional isoform of the full length Armcxl or functional fragment thereof.
[00126] In some embodiments, "Armcxl" is a wild-type Armcxl of human origin, having the following amino acid sequence, or a functional fragment thereof:
1 mgrtreagcv aagvvigaga cycvyrlawg rdenekiwde deestdtsei gvetvkgakt
61 nagagsgakl qgdsevkpev slgledcpgv kekahsgshs gggleakaka lfntlkeqas
121 akagkgarvg tisgnrtlap slpcpggrgg gchptrsgsr aggrasgksk gkarskstra
181 pattwpvrrg kfnfpykidd ilsapdlqkv lnilertndp fiqevalvtl gnnaaysfnq
241 nairelggvp iiakliktkd piirektyna lnnlsvnaen qgkiktyisq vcddtmvcrl
301 dsavqmaglr lltnmtvtnh yqhllsysfp dffallflgn hftkiqimkl iinftenpam
361 trelvsckvp selislfnke wdreillnil tlfenindni kneglassrk efsrsslffl
421 fkesgvcvkk ikalanhndl vvkvkvlkvl tkl (SEQ ID NO: l)
(See GenBank Accession No. NP_057692.1, which is incorporated herein by reference in its entirety).
[00127] A "functional fragment" refers to fragment of the full length Armcxl (e.g., corresponding to SEQ ID NO: 1) of at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140 consecutive amino acids of full length wild-type Armcxl, that has at least about 70%, 80%, 90%, 100% or more than 100% of the function of wild-type Armcxl (e.g., of SEQ ID NO: 1) at neuronal survival and/or axon regeneration of injured axons in vivo or in vitro. The functional activity can be tested by one of ordinary skill in the art by the assays described in the examples.
[00128] The polypeptide and coding nucleic acid sequences of Armcxl and of other members of the family of human origin and those of a number of animals are publically available, e.g., from the NCBI website and are contemplated for use in the methods and compositions herein. Examples include, but are not limited to, Mouse (GenBank Accession No. AAH21410.1), Rat (GenBank Accession No. AAH85780.1), Bovine (GenBank
Accession No. XP_015317042.1).
[00129] The nucleic acid sequence of Armcxl of human origin is known in the art and is available publically for e.g., from genebank Gene ID: 51309, which is incorporated herein by reference in its entirety).
[00130] In some embodiments, the Armcxl polypeptide can be a mammalian homolog of human Armcxl or a functional fragment thereof. In some embodiments, Armcxl polypeptide has an amino acid sequence at least 85%, at least 90%, at least 95%, at least 97% or at least 99% identical to the amino acid sequence of SEQ ID NO: 1 and increases at least one of i. mitochondrial motility in neurons,ii. survival of injured neurons and iii. axon regeneration of injured neurons. In some embodiments, Armcxl polypeptide has an amino acid sequence that has at least 85%, at least 90%, at least 95%, at least 97% or at least 99% amino acid sequence homology to amino acid sequence of SEQ ID NO: 1 and increases at least one of i. mitochondrial motility in neurons,ii. survival of injured neurons and iii. axon regeneration of injured neurons. In some embodiments, Armcxl is a functional fragment of SEQ ID NO: 1 of at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140 consecutive amino acids of SEQ ID NO: l, that has at least about 50%,60%, 70%, 80%, 90%, 100% or more than 100% of the function of wild type Armcxl (e.g., human Armcxl of SEQ ID NO: 1) of increasing at least one of i. mitochondrial motility in neurons, ii. survival of injured neurons and iii. axon regeneration of injured neurons, in vivo or in vitro. The functional activity can be tested by one of ordinary skill in the art by the assays described in the examples.
[00131] Percent (%) amino acid sequence identity for a given polypeptide sequence relative to a reference sequence is defined as the percentage of identical amino acid residues identified after aligning the two sequences and introducing gaps if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Percent (%) amino acid sequence homology for a given polypeptide sequence relative to a reference sequence is defined as the percentage of identical or strongly similar amino acid residues identified after aligning the two sequences and introducing gaps if necessary, to achieve the maximum percent homology. Non identities of amino acid sequences include conservative substitutions, deletions or additions that do not affect the biological activity of Armcxl . Strongly similar amino acids can include, for example, conservative substitutions known in the art. Percent identity and/or homology can be calculated using alignment methods known in the art, for instance alignment of the sequences can be conducted using publicly available software software such as BLAST, Align, ClustalW2. Those skilled in the art can determine the appropriate parameters for alignment, but the default parameters for BLAST are specifically contemplated.
[00132] In one embodiment, "Armcxl polypeptide" useful in the methods and compositions described herein consists of, consists essentially of, or comprises an amino acid sequence, or is a fragment thereof derived from SEQ ID NO: 1, provided that the polypeptide retains at least one biological activity of full length Armcxl of SEQ ID NO: 1, the biological activity being selected from at a minimum, increasing i. mitochondrial motility in neurons, ii. survival of injured neurons and iii. axon regeneration of injured neurons, in vivo or in vitro.
[00133] The polypeptides described herein can comprise conservative amino acid substitutions at one or more amino acid residues, e.g., at essential or non-essential amino acid residues but will retain a therapeutically or physiologically relevant activity of an inhibitory peptide as that term is described herein. A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, in a conservative substitution variant, a nonessential amino acid residue in the polypeptide is preferably replaced with another amino acid residue from the same side chain family.
[00134] In some embodiments, Armcxl can be a variant of wild type Armcxl . The term "variant" as used herein refers to a polypeptide or nucleic acid that is "substantially similar" to a wild-type Armcxl . A molecule is said to be "substantially similar" to another molecule if both molecules have substantially similar structures (i.e., they are at least 50% similar in amino acid sequence as determined by BLASTp alignment set at default parameters) and are substantially similar in at least one therapeutically or physiologically relevant biological activity. A variant differs from the naturally occurring polypeptide or nucleic acid by one or more amino acid or nucleic acid deletions, additions, substitutions or side-chain modifications, yet retains one or more therapeutically relevant, specific functions or desired biological activities of the naturally occurring molecule, (e.g., at least one of i. mitochondrial motility in neurons, ii. survival of injured neurons and iii. axon regeneration of injured neurons, in vivo or in vitro.).
[00135] Amino acid substitutions include alterations in which an amino acid is replaced with a different naturally-occurring or a non-conventional amino acid residue. Some substitutions can be classified as "conservative," in which case an amino acid residue contained in a polypeptide is replaced with another naturally occurring amino acid of similar character either in relation to polarity, side chain functionality or size. Substitutions encompassed by variants as described herein can also be "non-conservative," in which an amino acid residue which is present in a peptide is substituted with an amino acid having different properties (e.g., substituting a charged or hydrophobic amino acid with an uncharged or hydrophilic amino acid), or alternatively, in which a naturally-occurring amino acid is substituted with a non-conventional amino acid. Also encompassed within the term "variant," when used with reference to a polynucleotide or polypeptide, are variations in primary, secondary, or tertiary structure, as compared to a reference polynucleotide or polypeptide, respectively (e.g., as compared to a wild- type polynucleotide or polypeptide). Polynucleotide changes can result in amino acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the reference sequence. Variants can also include insertions, deletions or substitutions of amino acids in the peptide sequence. To be therapeutically useful, such variants will retain a therapeutically or physiologically relevant activity as that term is used herein.
[00136] The Armcxl polypeptide can be recombinant, purified, isolated, naturally occurring or synthetically produced. The term "recombinant" when used in reference to a nucleic acid, protein, cell or a vector indicates that the nucleic acid, protein, vector or cell containing them have been modified by introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or a protein, or that the cell is derived from a cell so modified. The term "heterologous" (meaning 'derived from a different organism') refers to the fact that often the transferred protein was initially derived from a different cell type or a different species from the recipient. Typically the protein itself is not transferred, but instead the genetic material coding for the protein (often the complementary DNA or cDNA) is added to the recipient cell. Methods of generating and isolating recombinant polypeptides are known to those skilled in the art and can be performed using routine techniques in the field of recombinant genetics and protein expression. For standard recombinant methods, see
Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY (1989); Deutscher, Methods in Enzymology 182:83-9(1990); Scopes, Protein Purification: Principles and Practice, Springer- Verlag, NY (1982).
[00137] In some embodiments, Armcxl can be an agonist of wild-type Armcxl, an analog or a derivative thereof. The term "Armcxl agonist" as defined herein can be a compound that enhances or stimulates the normal biological activity of Armcxl by increasing transcription or translation of Armcxl -encoding nucleic acid, and/or by inhibiting or blocking activity of a molecule that inhibits Armcxl expression or Armcxl activity, and/or by enhancing normal Armcxl biological activity (including, but not limited to enhancing the stability of Armcxl or enhancing binding of Armcxl to a receptor and/or directly binding to and activating a potential Armcxl receptor. The "biological activity" can be defined herein as including at least one of the activity selected from e.g., increasing i. mitochondrial motility in neurons, ii. survival of injured neurons and iii. axon regeneration of injured neurons, in vivo or in vitro. The activity of the agonist can be for example, at least 80%, at least 85%>, at least 90%), at least 95%, at least 97% or at least 99% of the biological activity of human Armcxl of SEQ ID NO: l .
[00138] It is contemplated herein that in the methods and compositions can comprise
Armcxl analogs or Armcxl derivatives. By "Armcxl analog" it is meant a peptide whose sequence is derived from that of Armcxl including insertions, substitutions, extensions, and/or deletions, having at least some amino acid identity to Armcxl or region of an Armcxl polypeptide. Analogs may have at least 50 or 55% amino acid sequence identity with a native Armcxl (e.g., human Armcxl, SEQ ID NO: 1) or at least 70%, 80%, 90%, or 95% amino acid sequence identity with a native Armcxl . In one embodiment, such analogs may comprise conservative or non-conservative amino acid substitutions (including non-natural amino acids and L and D forms). Armcxl agonist analogs are analogs as herein described and function as an Armcxl agonist.
[00139] An "Armcxl derivative" is defined as a molecule having the amino acid sequence of a wild-type Armcxl (e.g., human Armcxl, SEQ ID NO: 1) or analog thereof, but additionally having a chemical modification of one or more of its amino acid side groups, alpha. -carbon atoms, terminal amino group, or terminal carboxylic acid group for example by ubiquitination, labeling, pegylation (derivatization with polyethylene glycol) or addition of other molecules. A chemical modification includes, but is not limited to, adding chemical moieties, creating new bonds, and removing chemical moieties. Such modifications can improve the molecule's solubility, absorption, biological half-life, etc. The modifications can alternatively decrease the toxicity of the molecule, or eliminate or attenuate an undesirable side effect of the molecule, etc. Moieties capable of mediating such effects are disclosed in Remington's Pharmaceutical Sciences, 18th edition, A. R. Gennaro, Ed., MackPubl., Easton, PA (1990). Furthermore, one or more side groups, or terminal groups, may be protected by protective groups known to the ordinarily-skilled synthetic chemist. The term "functional" when used in conjunction with "derivative" or "variant" refers to a polypeptide which possesses a therapeutically or physiologically relevant biological activity that is substantially similar to a biological activity of the entity or molecule of which it is a derivative or variant. By "substantially similar" in this context is meant that at least 50% of the relevant or desired biological activity of a corresponding wild-type peptide is retained. In some embodiments, the derivative retains at least 60%>, at least 70%, at least 80%>, at least 90%, at least 95%, or more, including 100% or even more (i.e., the derivative or variant has improved activity relative to wild-type) of the Armcxl .
[00140] In some embodiments, the agonist of wild-type Armcxl, an analog or a derivative thereof, retains at least one biological activity of full length ANG of SEQ ID NO: 1, the biological activity being selected from at a minimum, at least one of i. mitochondrial motility in neurons, ii. survival of injured neurons and iii. axon regeneration of injured neurons, in vivo or in vitro. In some embodiments, the agonist of wild-type Armcxl, an analog or a derivative thereof, retains at least 50%, at least 60%, at least 70%, at least 80%, at least 90%), at least 100% or more than 100% of the biological activity of full length Armcxl of SEQ ID NO: 1.
[00141] In some embodiments, an agent of the methods and compositions herein, is a vector comprising a nucleic acid sequence encoding for an Armcxl polypeptide. In some embodiments, the vector is a viral vector. In some embodiments, the vector is non-viral vector. In some embodiments, the vector is an expression vector comprising a nucleic acid sequence encoding an Armcxl polypeptide. Viral and non-viral -based gene transfer methods can be used to introduce nucleic acids encoding Armcxl polypeptides to cells or target tissues of the subject. Such methods can be used to administer nucleic acids encoding Armcxl polypeptides to cells in vitro. Alternatively, or in addition, such polynucleotides can be administered for in vivo or ex vivo gene therapy uses. Non-viral vector delivery systems include DNA plasmids, naked nucleic acid, and nucleic acid complexed with, for example, a liposome or other delivery vehicle. Viral vector delivery systems include both DNA and RNA viruses, and can have either episomal or integrated genomes after delivery to the cell. Gene therapy procedures are described, for example, in Anderson, Science 256:808-813 (1992); Nabel & Feigner, TIBTECH 11 :211-217 (1993); Mitani & Caskey, TIBTECH 11 : 162-166 (1993); Dillon, TIBTECH 11 : 167-175 (1993); Miller, Nature 357:455-460 (1992); Van Brunt, Biotechnology 6(10): 1149-1154 (1988); Vigne, Restorative Neurology and Neuroscience 8:35-36 (1995); Kremer & Perricaudet, British Medical Bulletin 51(1):31- 44 (1995); Haddada et al., in Current Topics in Microbiology and Immunology Doerfler and Bohm (eds) (1995); and Yu et al., Gene Therapy 1 : 13-26 (1994).
[00142] Methods of non-viral delivery of nucleic acids encoding engineered polypeptides of the invention include lipofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipid:nucleic acid conjugates, naked DNA, artificial virions, and agent-enhanced uptake of DNA. Lipofection is described, e.g.,, in U.S. Pat. No. 5,049,386, U.S. Pat. No. 4,946,787; and U.S. Pat. No. 4,897,355, and lipofection reagents are sold commercially (e.g.,, Transfectam™ and Lipofectin™). Cationic and neutral lipids that are suitable for efficient receptor-recognition lipofection of polynucleotides include those of Feigner, WO 91/17424, WO 91/16024. Delivery can be to cells (ex vivo administration) or target tissues (in vivo administration). The preparation of lipid:nucleic acid complexes, including targeted liposomes such as immunolipid complexes, is well known to one of skill in the art (see, e.g.,, Crystal, Science270:404-410 (1995); Blaese et al., Cancer Gene Ther. 2:291-297 (1995); Behr et al., Bioconjugate Chem. 5:382-389 (1994); Remy et al., Bioconjugate Chem. 5:647-654 (1994); Gao et al., Gene Therapy 2:710-722 (1995); Ahmad et al., Cancer Res.52:4817-4820 (1992); U.S. Pat. Nos. 4, 186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028, and 4,946,787).
[00143] RNA or DNA viral based systems can be used to target the delivery of polynucleotides carried by the virus to specific cells in the body and deliver the
polynucleotides to the nucleus. Viral vectors can be administered directly to patients (in vivo) or they can be used to transfect cells in vitro. In some cases, the transfected cells are administered to patients (ex vivo). Conventional viral based systems for the delivery of polypeptides of the invention could include retroviral, lentivirus, adenoviral, adeno- associated and herpes simplex virus vectors for gene transfer. Viral vectors are currently the most efficient and versatile method of gene transfer in target cells and tissues. Integration in the host genome is possible with the retrovirus, lentivirus, and adeno-associated virus gene transfer methods, often resulting in long term expression of the inserted transgene, and high transduction efficiencies.
Biological activity of agent
[00144] The technology herein is partly based on the discovery that protein Armcxl increases mitochondrial motility, survival of injured neurons and regeneration of axon post injury. Accordingly the minimum set of biological activity of an agent (e.g., Armcxl) is at least one or combination of; i. increasing mitochondrial motility, ii. promoting survival of neurons (e.g. injured neurons) or iii. promoting regeneration of axons in the neurons (e.g., injured neurons).
[00145] Increased mitochondrial motility can be e.g., increase in the total pool of motile mitochondria or increase in the fraction of time mitochondria is in motion in neurons contacted by the agents, compared to that in absence of contact with the agent. The increase can be e.g., at least 10%, 20%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75% or more relative to in neurons not contacted with the agent.
[00146] Increased survival of neurons is indicated by the number of neurons surviving from a specific injury or condition upon contact with an agent disclosed herein (e.g., Armcxl polypeptide), as compared to the number of neurons surviving in absence of said contact, and also by the length of time the survival persists upon contact with an agent disclosed herein (e.g., Armcxl polypeptide), as compared to that in absence of contact. Survival is considered to be sustained if it persists for an extended period of time post-injury (e.g., greater than 2 weeks post -injury, greater than 3 weeks, and greater than 4 weeks postinjury). In one embodiment, greater than 10% of neurons (e.g., 15%, 20%, 25%, 30%, 35%, 0%, 45%, 50%, 55%), 60%), 65%), 70%) and 75%), survive upon contact with one or more agents disclosed herein. In one embodiment, greater than 20% of neurons (e.g., 25%, 30%, 35%, 0%, 45%, 50%), 55%), 60%), 65%), 70% and 75%), survive for an extended period of time post-injury.
[00147] Increased regeneration or outgrowth is indicated by the number of neurons
(injured and also uninjured) and by extended length of the axonal outgrowth of the neurons upon contact with the agent disclosed herein (e.g., Armcxl), as compared to that in absence of the said contact, and by the time frame post-injury that the outgrowth occurs upon contact with an agent disclosed herein (e.g. Armcxl), as compared to the time frame postinjury that outgrowth occurs in absence of said contact. Increased regeneration and axonal outgrowth occurs if greater than 10% or greater than 20% (e.g., 15%, 20%, 25%, 30%, 35%, 0%, 45%, 50%), 55%), 60%), 65%), 70% and 75%) of the neurons regenerate injured axons or generate new axons. In some embodiments, the regenerated axons extend at least 0.5 mm distal to the lesion epicenter. In one embodiment, greater than 10% or greater than 20% (e.g., 15%, 20%, 25%, 30%, 35%, 0%, 45%, 50%, 55%, 60%, 65%, 70% and 75%) of neurons regenerate injured axons or generate axons over 1 mm distal to the lesion site. In one embodiment, greater than 10% (e.g., 15%, 20%, 25%, 30%, 35%, 0%, 45%, 50%, 55%, 60%, 65%, 70% and 75%)) or greater than 20% of neurons regenerate or generate new axons that extend at least 2 mm distal from the lesion site.
Other Agents
[00148] An activator of protein translation (e.g., a mTOR pathway activator; a PTEN inhibitor; a TSCl/2 inhibitor; an Akt activator; a Ras/MEK pathway activator; or a PRAS40 inhibitor can promote the survival of, or axon regeneration in the neuron. See for e,g, US 20090305333 Al, the contents of which are incorporated herein in its entirety. PTEN inhibitors e.g., in US 20090305333 Al, US 8367352 B2, US 20140213609 Al (the contents of which are incorporated herein by reference in their entireties) can be useful in the methods and compositions herein, in combination with the agents disclosed herein (e.g., agents increasing mitochondrial motility, Armcxl polypeptide). Inhibition of SOCS3 was reported to promote neuron regeneration (US20110124706 Al, the contents of which are incorporated by reference herein in its entirety).
[00149] The inventors discovered that when combined with PTEN deletion and/or inhibition of SOCS3, overexpression of Armcxl, significantly increased the survival of or, axon regeneration in neurons compared to inhibition of PTEN or SOCS3 alone. It has been reported that a combination of PTEN inhibitor and inhibitor of SOCS3, promoted sustained survival of, and/or axon regeneration in injured neurons in comparison to PTEN inhibitor or SOCS3 inhibitor alone (See for example reference US 20140256795 Al, the contents of which are incorporated herein in its entireties.) Accordingly, in one aspect, the methods described herein further comprises contacting injured neurons with other agents that can promote at least one of; i. mitochondrial motility, ii. survival of injured axons, or iii. axon regeneration in injured neurons in combination with the agents disclosed herein (e.g., agents that increase mitochondrial motility, Armcxl).
[00150] The agents of the present disclosure (e.g., agents that increase mitochondrial motility, Armcxl polypeptide, or vector comprising a nucleic acid sequence encoding Armcxl polypeptide). [00151] In some embodiments, the methods and compositions of the present disclosure can comprise contacting the injured neurons or administering to the subject, an effective amount of one or more other agents selected from activator of protein translation, PTEN inhibitor, inhibitor of suppressor of cytokine signaling 3 (SOCS3) in combination with the agents disclosed herein (e.g., e.g., agents increasing mitochondrial motility, Armcxl polypeptide, vector comprising a nucleic acid sequence encoding an Armcxl polypeptide). In some embodiments, the methods and compositions herein comprises of contacting neurons with effective amounts of combination of Armcxl polypeptide, inhibitor of PTEN and inhibitor of SOCS3. In some embodiments, the neurons can also be contacted with nerve growth factor, trophic factor, or hormone that promotes neural cell survival, growth, and/or differentiation, such as brain-derived neurotrophic factor (BDNF), ciliary neurotrophic factor (CNTF), nerve growth factor (NGF), inosine, oncomodulin, NT-3, etc, in addition to the agents disclosed herein (e.g., Armcxl polypeptide), and/ or one of the other agents disclosed above (e.g., activator of protein translation, PTEN inhibitor, inhibitor of SOCS3).
[00152] In one embodiment, the injury results from acute spinal cord injury and the method additionally comprises contacting the neuron with methylprednisolone sufficient to reduce inflammation of the spinal cord. In one embodiment, the agents are administered in combination with trophic and/or growth factors (e.g., denervation-induced cytokines) known in the art to promote or enhance neuronal survival/regeneration, growth and/or
differentiation. Examples include, without limitation, brain-derived neurotrophic factor (BDNF), ciliary neurotrophic factor (CNTF) (W02011/066182), fibroblast growth factor (FGF), chondroitiniase, nerve growth factor (NGF), NT-3 (Piantino et al, Exp Neurol. 2006 October;201(2):359-67), inosine (Chen et al, Proc Natl Acad Sci USA. (2002) 99:9031-6; U.S. Pat. No. 6,551,612 to Benowitz; U.S. Pat. No. 6,440,455 to Benowitz; and US Pat Publ 20050277614 to Benowitz), oncomodulin (Yin et al, Nat Neurosci. (2006) 9:843-52; US Pat Publ 20050054558 to Benowitz; US Pat Publ 20050059594 to Benowitz; and U.S. Pat. No. 6,855,690 to Benowitz). Another such agent is an agent to remove extracellular matrix molecules (e.g., chondroitin sulphate proteoglycans) that are inhibitory to neuronal outgrowth, such as chondroitenase ABC (ChABC), which breaks up chondroitin sulphate proteoglycans.
[00153] In one embodiment, the agents are administered in combination with one or more factors that facilitate neuronal synapse formation. Examples of such factors include, without limitation, activators of Rab3A, NMDA-I, synapsin-1, tetanus toxin receptor, BDNF- receptor and a GAB A receptor. Such factors are described in U.S. Patent Application Publication 2008/0214458. Neuronal synapse formation can be modulated, for example, by modulating the activity of the transcriptional factor myocyte enhancer factor 2 (MEF2) (e.g., MEF2A), MEF2C, MEF2D, dMEF2, CeMEF2, Activating transcription factor 6 beta
[00154] (ATF6), Estrogen related receptor alpha (ERR1), Estrogen related receptor beta (ERR2), Estrogen related receptor gamma (ERR3), Erythroblastosis virus E26 oncogene homolog 1 (ETS1), Forkhead box protein C2 (FOXC2), Gata binding factor 1 (GATA-1), Heat shock factor 1 (HSF1), HSF4, MLL3, Myeloblastosis oncogene homolog (MYB), Nuclear receptor coactivator 2 (NCOA2), Nuclear receptor corepressor 1 (NCOR1),
Peroxisome proliferative activated receptor gamma (PPARg), SMAD nuclear interacting protein 1 (SNIP1), SRY-box containing protein 3 (SOX3), SOX8, SOX9, Sterol regulatory element-binding transcription factor 2 (SREBP2), or Thyroid hormone receptor beta-1 (THRB1) (described in U.S. Patent Application Publication 20100112600).
[00155] The other agent(s) can be administered to the same site or to a different site as the agents of the present disclosure (e.g., agents that increase mitochondrial motility, Armcxl polypeptide or a vector comprising a nucleic acid sequence encoding an Armcxl
polypeptide). The other agent may be contacted to the same site of the neuron or to a different site of the neuron. In one embodiment, the agents of the present disclosure (e.g., agents that increase mitochondrial motility, Armcxl polypeptide or a vector comprising a nucleic acid sequence encoding an Armcxl polypeptide) is contacted to the neuron(s) at the neuron's region of origin in the brain (e.g., by administration to cortical neurons at the cerebral ventricle) and the other agent is contacted to the neuron at the site of injury (e.g., the lesioned axon such as a cortical spinal tract axon). Other combinations of site of contact and routes of administration discussed herein are also envisioned.
[00156] The contacting with one or more of the other agents (e.g., activator of protein translation, PTEN inhibitor, inhibitor or SOCS3, BDNF, CNTF, inosine, oncomodulin, NT-3) can occur prior to, with or after the contacting with the agents disclosed herein (e.g., Armcxl polypeptide). An effective amount of the inhibitors are contacted with the neuron using a suitable method sufficient to promote sustained survival of the neuron and/or regeneration and/or sustained compensatory outgrowth of the neuronal axon. An effective amount is the amount required to produce statistically significant and reproducible sustained survival, sustained regeneration, or a combination of both, as compared to an appropriate control. For in vitro methods, the inhibitors are, for example, added to the culture medium, usually at nanomolar or micromolar concentrations. The respective inhibitors can be added in the same formulation, or in different formulations. [00157] For in vivo applications, one or more other agents can be administered to the subject by any method that results in contacting both a therapeutically effective amount of each to the neuron at relatively the same time, or in some embodiments, separately at different times. The respective other agents can be administered at the same time or at different times, depending upon various factors associated with each inhibitor (e.g., half-life, administration route, etc.). The respective other agents can be administered by the same route of administration or through different routes of administration e.g., orally, by intravenous (i.v.) bolus, by i.v. infusion, subcutaneously, intramuscularly, ocularly (intraocularly, periocularly, retrobulbarly, intravitreally, subconjunctivally, topically, by subtenon administration, etc., intracranially, intraperitoneally, intraventricularly, intrathecally, by epidural, etc. The administration of the respective other agents can be for differing prolonged periods, or for the same length of period such that their activities on the contacted neurons completely or substantially overlap. The respective other agents can be administered in a formulation which contains one or more of other agents (a pharmaceutical composition, as described herein), or they can be in separate formulations (separate pharmaceutical compositions) for separate administration.
[00158] It is contemplated herein, that contacting the neurons with a combination of agents disclosed herein and those known in the art results in increased survival of, and/or axon regeneration of injured neurons compared to when the neurons are contacted with individual agents alone.
[00159] Increased survival of neurons is indicated by the number of neurons surviving from a specific injury or condition, as compared to the number of neurons surviving as a result of the effects of the individual agent (either Armcxl, PTEN or SOCS3), and also by the length of time the survival persists, as compared to the length of time survival persists as a result of the effects of the individual agent (either Armcxl, PTEN or SOCS3). Survival is considered to be sustained if it persists for an extended period of time post-injury (e.g., greater than 2 weeks post -injury, greater than 3 weeks, and greater than 4 weeks postinjury). In one embodiment, greater than 10% of neurons (e.g., 15%, 20%, 25%, 30%, 35%, 0%, 45%), 50%), 55%), 60%), 65%>, 70% and 75%), survive upon contact with one or more agents disclosed herein. In one embodiment, greater than 20% of neurons (e.g., 25%, 30%, 35%, 0%, 45%, 50%, 55%, 60%, 65%, 70% and 75%), survive for an extended period of time post- injury. [00160] Increased regeneration or outgrowth is indicated by the number of neurons
(injured and also uninjured) and by extended length of the axonal outgrowth of the neurons, as compared to the number of neurons and extended length of the axonal outgrowth of the neurons that results from the effects of the individual agent (e.g., either Armcxl, PTEN or SOCS3), and by the time frame post-injury that the outgrowth occurs, as compared to the time frame postinjury that outgrowth occurs resulting from the effects of the individual agent (e.g., either PTEN or SOCS3). Increased regeneration and axonal outgrowth occurs if greater than 10% or greater than 20% (e.g., 15%, 20%, 25%, 30%, 35%, 0%, 45%, 50%, 55%, 60%, 65%), 70%) and 75%) of the neurons regenerate injured axons or generate new axons. In some embodiments, the regenerated axons extend at least 0.5 mm distal to the lesion epicenter. In one embodiment, greater than 10% or greater than 20% (e.g., 15%, 20%, 25%, 30%, 35%, 0%, 45%, 50%, 55%, 60%, 65%, 70% and 75%) of neurons regenerate injured axons or generate axons over 1 mm distal to the lesion site. In one embodiment, greater than 10%> (e.g., 15%, 20%, 25%, 30%, 35%, 0%, 45%, 50%, 55%, 60%, 65%, 70% and 75%) or greater than 20%) of neurons regenerate or generate new axons that extend at least 2 mm distal from the lesion site.
[00161] Sustained regeneration and axonal outgrowth can be indicated by a significant amount of outgrowth occurs on or after 2 weeks post-injury. For example significant outgrowth occurs for up to 3 weeks or 4 weeks post-injury.
Neurons
[00162] The methods and compositions described herein are suited for the promotion of survival of, and/or axon regeneration in and sustained axonal outgrowth of CNS (central nervous system) neurons. It is contemplated herein that the methods and compositions of the present disclosure are not limited to neurons of the CNS, but can also be adapted for PNS (peripheral nervous system) neurons. CNS neurons include, without limitation, a cerebellar granule neuron, or an ocular neuron. In one embodiment, the neuron is the optic nerve. In one embodiment, the neuron is a sensory neuron (e.g., dorsal root ganglion (DRG) sensory neuron). As used herein, the term "PNS neurons" is intended to include the neurons commonly understood as categorized in the peripheral nervous system, including sensory neurons and motor neurons. The present invention provides methods and compositions for preventing and/or treating peripheral nerve damage (peripheral neuropathy) in a subject. Peripheral nerves such as dorsal root ganglia, otherwise known as spinal ganglia, are known to extend down the spinal column. These nerves can be injured as a result of spinal injury. Such peripheral nerve damage associated with spinal cord injury can also benefit from neuron axonal outgrowth produced by the methods described herein. In some embodiments, the neurons are in the spinal cord. In some embodiments, the neurons are in the optic nerve. In some embodiments, the neurons are axotomized neurons (for example during surgery). In some embodiments, the neuron is human. In one embodiment, the neuron is a terminally differentiated neuron. In one embodiment, the neuron is an adult neuron (e.g., in a subject that has reached maturity, such as in humans older than 18 years). In one embodiment, the neuron is non-embryonic. In one embodiment, the neuron is in an immature organism (e.g., embryo, infant, child). All mammals are suitable subjects for performance of the methods described herein. In one embodiment, the mammal is a human, non-human primate, companion animal (e.g., dog, cat), livestock animal (e.g., horse, cow, pig, sheep), or rodent (mouse, rat, rabbit). In one embodiment, the subject is a non-human primate animal in a model for neurodegeneration or nervous system (CNS or PNS) injury. Neurons derived from said subjects are also suitable for performance of the methods described herein. In some embodiments, the neurons are injured neurons.
Neuronal injury
[00163] As used in the art, the term injury refers to damage (e.g., to a system or a cell).
Damage to a system is evidenced by aberrant function, reduction of function, loss of function of the system, or loss of essential components (e.g., specialized cells such as neurons).
Damage or injury to a specific neuron is also evidenced by aberrant function, loss of function, reduced function, and/or cell death. Some forms of injury to a neuron can be directly detected (e.g., by visualization as with a severed or crushed neuronal axon). Accordingly, in some embodiments, the methods disclosed herein comprises an antecedent step of determining that the neuron is injured and/or has axotomy-induced stress. Neuronal injury can result from a variety of insults, including, but not limited to physicial injury (e.g., severing, crushing), toxic effects, atrophy (e.g., due to lack of trophic factors).
[00164] The term "neuronal injury" as used herein refers to any damage or dysfunction exhibited by neurons, including but not limited to loss of myelin, dendrite retraction, dendritic spine density reduction, axonal damage, loss of axon regeneration and neuronal death. Neuronal injury may be complete loss of a neuron, or loss of a part of the neuron (e.g., an axon). Such damage may results from acute or traumatic injury to the neuron (e.g., crush, severing) such as the result of external physical trauma to the subject (e.g., contusion, laceration, acute spinal cord injury, traumatic brain injury, cortical impact, etc.). Acute or traumatic injury to a neuron can also result from an acute condition, such as stroke, that results in acute ischemia to the neuron resulting in acute injury. The specific location of neuronal injury will vary with the specific cause of the injury, and the specific individual. In one embodiment, the injured CNS neuron is located in CNS white matter, particularly white matter that has been subjected to traumatic injury. The specific location of a lesion to a specific neuron will vary with respect to the injury. In one embodiment, the injury is in the axon or dendrite of a neuron. In on embodiment, the injured neuron is in the spinal cord. In one embodiment, the injured neuron is in the optic nerve.
[00165] Injury to a neuron may also be incurred from a chronic injury (e.g., repetitive stress injury) or condition (e.g., chronic inflammation or disease). Chronic injury leads to neurodegeneration such as caused by neurotoxicity or a neurological disease or disorder (e.g. Huntington's disease, Parkinson's disease, Alzheimer's disease, multiple system atrophy (MSA), etc.).
[00166] In one embodiment of the methods disclosed herein, injured neurons results from an ocular injury or disorder (e.g. toxic amblyopia, optic atrophy, higher visual pathway lesions, disorders of ocular motility, third cranial nerve palsies, fourth cranial nerve palsies, sixth cranial nerve palsies, internuclear ophthalmoplegia, gaze palsies, eye damage from free radicals, etc.), or an optic neuropathy (e.g. ischemic optic neuropathies, toxic optic neuropathies, ocular ischemic syndrome, optic nerve inflammation, infection of the optic nerve, optic neuritis, optic neuropathy, papilledema, papillitis, retrobulbar neuritis, commotio retinae, glaucoma, macular degeneration, retinitis pigmentosa, retinal detachment, retinal tears or holes, diabetic retinopathy, iatrogenic retinopathy, optic nerve drusen, etc.). Injury to a neuron can be detected by the skilled practitioner through a variety of assays known in the art. Loss of function assays can be used to determine neuronal injury. Physical damage to the neuron (e.g., axonal crushing or severing) can sometimes be observed diagnostically through routine methods. One way to detect a lesion is through detection of axotomy-induced stress.
Diseases and disorders
[00167] The methods and compositions disclosed herein are useful for the treatment of neuronal injury. The methods and compositions of the invention are useful for treatment of diseases or disorders resulting from or leading to the neuronal injury described herein. In some embodiments, the disorder is selected from the group consisting of glaucoma, stroke, head trauma, spinal injury, optic injury, ischemia, hypoxia, neurodegenerative disease, multiple sclerosis, infectious disease, cancer, and autoimmune disease. [00168] In some embodiments, the methods and compositions described herein can be used specifically to treat damage associated with peripheral neuropathies including, but not limited to, the following: diabetic neuropathies, virus-associated neuropathies, including acquired immunodeficiency syndrome (AIDS) related neuropathy, infectious mononucleosis with polyneuritis, viral hepatitis with polyneuritis; Guillian-Barre syndrome; botulism-related neuropathy; toxic polyneuropathies including lead and alcohol-related neuropathies;
nutritional neuropathies including subacute combined degeneration; angiopathic neuropathies including neuropathies associated with systemic lupus erythematosis; sarcoid-associated neuropathy; carcinomatous neuropathy; compression neuropathy (e.g. carpal tunnel syndrome) and hereditary neuropathies, such as Charcot-Marie-Tooth disease, peripheral nerve damage associated with spinal cord injury can also be treated with the present method. The subject is treated in accordance with the present method for CNS or peripheral nerve damage as the result injury, including those listed above. Subjects at risk for developing such CNS or damage are also so treated.
Administration
[00169] Agent of the present disclosure is contacted with the neuron using a suitable drug delivery method and treatment protocol sufficient to promote regeneration of the axon. For in vitro methods, the agent is added to the culture medium, usually at nanomolar or micromolar concentrations. For in vivo applications, the agent can be administered orally, by intravenous (i.v.) bolus, by i.v. infusion, subcutaneously, intramuscularly, ocularly
(intraocularly, periocularly, retrobulbarly, intravitreally, subconjunctivally, topically, by subtenon administration, etc.), intracranially, intraperitoneally, intraventricularly,
intrathecally, by epidural, etc. Depending on the intended route of delivery, the agent or compositions comprising the agent may be administered in one or more dosage form(s) (e.g. liquid, ointment, solution, suspension, emulsion, tablet, capsule, caplet, lozenge, powder, granules, cachets, douche, suppository, cream, mist, eye drops, gel, inhalant, patch, implant, injectable, infusion, etc.). The dosage forms may include a variety of other ingredients, including binders, solvents, bulking agents, plasticizers etc. In a specific embodiment, the agent is contacted with the neuron using an implantable device that contains the activator and that is specifically adapted for delivery to a CNS axon of neuron. Examples of devices include solid or semi-solid devices such as controlled release biodegradable matrices, fibers, pumps, stents, adsorbable gelatin (e.g. Gelfoam), etc. The device may be loaded with premeasured, discrete and contained amounts of the activator sufficient to promote regeneration of the axon. In a particular embodiment, the device provides continuous contact of the neuron with the activator at nanomolar or micromolar concentrations, preferably for at least 2, 5, or 10 days.
[00170] Administration is to a subject by a route that results in contacting an effective amount of the agents disclosed herein (e.g., agent that increases mitochondrial mobility, Armcxl polypeptide or a vector comprising a nucleic acid sequence encoding an Armcxl polypeptide) to the target neuron(s). As the term is used herein, the target neuron is the neuron which is intentionally contacted by the administered agent. A target neuron can be an injured neuron or a non-injured neuron (e.g., for compensatory axonal outgrowth to a region of denervation, or used as a control in the methods herein). The target neuron may be contacted at one or more specific target sites of the neuron. As the term is used herein, the target site of the neuron is the region of the neuron to which the agent is intentionally contacted. Regions of the neuron include the dendrites, cell body, and the axon. In some embodiments, the target site of the neuron is the mitochondria of the neuron. Methods for targeting the agents to mitochondria of a cell are known in the art. See for e.g., AAPS J. 2006 Jun; 8(2): E277-E283., Antioxid Redox Signal. 2011 Dec 15; 15(12):3021-38, Biochim Biophys Acta. 2008 Jul-Aug; 1777(7-8): 1028-31, the contents of which are incorporated herein by reference in their entireties. Non-limiting exemplary methods for targeting the agents and compositions disclosed herein to the mitochondria of a neuron can include for e.g., conjugation of an agent with a lipohilic molecular group, encapsulation of agents in a liposome or nanoparticle.
[00171] Since regeneration and axonal generation in the treatment of a neuronal injury includes compensatory promotion of axonal outgrowth of uninjured neurons, benefit is expected from mere delivery of the inhibitors and/or other agents to an injury site. As such, suitable target neurons are actual damaged neurons, and also neurons that are in the immediate area of an injury site or an area of dennervation. The specific location and extent of an injury site can be determined by the skilled practioner. Examples of injury sites are the site of physical damage or disruption of neuronal activity. The immediate area of an injury site will vary with respect to the specific injury, the nature of the injury, and the nature of the injured neurons (e.g., axonal length, specific function, etc.) and can be determined by the skilled practitioner. Typically a lesion is in the axon of the injured neuron. In one
embodiment, the immediate area of the injury site is within about 1-10 mm of identified damaged neurons (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mm). In one embodiment, the administration is localized so as to be highly targeted to a specific site. In one embodiment, the administration is systemic, and results in delivery of the appropriate concentration to the specific site.
[00172] Depending on the intended route of delivery, the compositions may be administered in one or more dosage form(s) (e.g. liquid, ointment, solution, suspension, emulsion, tablet, capsule, caplet, lozenge, powder, granules, cachets, douche, suppository, cream, mist, eye drops, gel, inhalant, patch, implant, injectable, infusion, etc.). The dosage forms may include a variety of other ingredients, including binders, solvents, bulking agents, plasticizers etc.
[00173] In a specific embodiment, the inhibitors are contacted with the neuron using an implantable device that contains the inhibitors and that is specifically adapted for delivery to a neuron. Examples of devices include solid or semi-solid devices such as controlled release biodegradable matrices, fibers, pumps, stents, adsorbable gelatin (e.g. Gelfoam), etc. The device may be loaded with premeasured, discrete and contained amounts of the inhibitors sufficient to promote sustained regeneration or sustained survival of the neuron. In one embodiment, the device provides continuous contact of the neuron with the inhibitors at nanomolar or micromolar concentrations, (e.g., for at least 2, 5, or 10 days, or for at least 2, 3, or 4 weeks, or for greater than 4 weeks, e.g., 5, 6, 7, or 8 weeks).
[00174] In one embodiment, administration of an agent disclosed herein to a subject (e.g., in a single or in different pharmaceutical compositions, with or without other agents described herein) results in the inhibitors directly contacting an injured neuron in need of regeneration. In one embodiment, administration results in contacting neurons proximal to a site of neuronal injury. Neurons can be contacted at any point along their length (e.g., at the axon, dendrite and/or the cell body).
[00175] Administration to the subject can be by any one or combination of a variety of methods (e.g., intravenously, intracortically, intracerebrally, intrathecally, intranasally, ocularly, parenterally, enterally and/or topically or locally at the injured neuron.). The appropriate method(s) will depend upon the circumstances of the individual (e.g. the location of the target neuron(s), the condition of the individual, the desired duration of the contact, whether local or systemic treatment is desired). The administration can be by any methods described herein that will result in contact of sufficient agent(s) to the target neuron to promote survival of neuron, axon regeneration, or a combination of both. For instance, parenteral, enteral and topical administration can be used. The phrases "parenteral
administration" and "administered parenterally" as used herein means modes of
administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, intracortical, intracerebral, intranasal, ocular, sub capsular, subarachnoid, intraspinal, intracerebro spinal, and intrastemal injection and infusion. Enteral administration involves the esophagus, stomach, and small and large intestines (i.e., the gastrointestinal tract). The phrases "systemic administration,"
"administered systemically", "peripheral administration" and "administered peripherally" as used herein mean the administration of a compound other than directly into the central nervous system, such that it enters the animal's system and, thus, is subject to metabolism and other like processes, for example, subcutaneous administration. Administration may be topical (including ophthalmic, vaginal, rectal, intranasal, epidermal, and transdermal), oral or pulmonary administration, e.g. , by inhalation or insufflation, or intracranial, e.g., intrathecal or intraventricular, administration, topically to the eye, or by intraocular injection.
[00176] Specific routes of administration and the dosage regimen will be determined by skilled clinicians based on factors such as the exact nature of the condition being treated, the severity of the condition, and the age and general physical condition of the patient.
Provided herein are methods for promoting survival of neuron, axon regeneration, or a combination of both in an injured neuron of central nervous system neurons following an injury. The method involves administering to a subject an agent that increases mitochondrial motility (e.g., Armcxl polypeptide or a vector comprising a nucleic acid sequence encoding Armcxl polypeptide to thereby contact the site of injury.
[00177] The term "administering" to a subject includes dispensing, delivering or applying an active compound in a pharmaceutical formulation to a subject by any suitable route for delivery of the active compound to the desired location in the subject to thereby contact the desired portion(s) of the neuron(s), (e.g., the injury, the injured neuron, or the site of desired outgrowth of the neuron). This includes, without limitation, delivery by either the parenteral or oral route, intramuscular injection, subcutaneous/intradermal injection, intravenous injection, buccal administration, transdermal delivery and administration by the rectal, colonic, vaginal, intranasal or respiratory tract route, intraocular, ocular. Another form of administration suitable for treatment of spinal cord injury is injection into the spinal column or spinal canal. In one embodiment, the agent(s) is contacted in vivo by introduction into the central nervous system of a subject, e.g., into the cerebrospinal fluid of the subject. In certain aspects of the invention, the agent(s) is introduced intrathecally, e.g., into a cerebral ventricle, the lumbar area, or the cisterna magna. In another aspect, the agent(s) is introduced intraocullarly, to thereby contact retinal ganglion cells or the optic nerve. Modes of administration are described in US 7,238,529.
[00178] In one embodiment, administration occurs following neuronal injury in the subject, not prior to or at the time of neuronal injury. In another embodiment of the invention, the agent(s) formulation is administered into a subject intrathecally. As used herein, the term "intrathecal administration" is intended to include delivering an inhibitor(s) formulation directly into the cerebrospinal fluid of a subject, by techniques including lateral
cerebroventricular injection through a burrhole or cisternal or lumbar puncture or the like (described in Lazorthes et al. Advances in Drug Delivery Systems and Applications in Neurosurgery, 143-192 and Omaya et al., Cancer Drug Delivery, 1 : 169-179, the contents of which are incorporated herein by reference). The term "lumbar region" is intended to include the area between the third and fourth lumbar (lower back) vertebrae. The term "cisterna magna" is intended to include the area where the skull ends and the spinal cord begins at the back of the head. The term "cerebral ventricle" is intended to include the cavities in the brain that are continuous with the central canal of the spinal cord. Administration of an agent(s) to any of the above mentioned sites can be achieved by direct injection of the agent(s) formulation or by the use of infusion pumps. For injection, the agent(s) formulation of the invention can be formulated in liquid solutions, preferably in physiologically compatible buffers such as Hank's solution or Ringer's solution. In addition, the inhibitor(s) formulation may be formulated in solid form and re-dissolved or suspended immediately prior to use. Lyophilized forms are also included. The injection can be, for example, in the form of a bolus injection or continuous infusion (e.g., using infusion pumps) of the agent(s) formulation.
[00179] In one embodiment of the methods and compositions disclosed herein, said agent(s) formulation is administered by lateral cerebroventricular injection into the brain of a subject in the inclusive period from the time of the injury to a time determined by the skilled practitioner (e.g., 100 hours). The injection can be made, for example, through a burr hole made in the subject's skull. In another embodiment, said encapsulated therapeutic agent is administered through a surgically inserted shunt into the cerebral ventricle of a subject in the inclusive period from the time of the injury to a time determined by the skilled practitioner (e.g., 100 hours thereafter). For example, the injection can be made into the lateral ventricles, which are larger, even though injection into the third and fourth smaller ventricles can also be made.
[00180] In yet another embodiment, said agent(s) formulation is administered by injection into the cisterna magna, or lumbar area of a subject in the inclusive period from the time of the injury to a time determined by the skilled practitioner (e.g., 100 hours thereafter). Administration can be continuous, or can be by repeated doses. In one embodiment, the repeated doses are formulated so that an effective amount of the inhibitors is continually present at the injury site.
[00181] Viral and non-viral-based gene transfer methods can be used to introduce nucleic acids encoding Armcxl polypeptides to cells or target tissues of the subject. Such methods can be used to administer nucleic acids encoding Armcxl polypeptides to cells in vitro. Alternatively, or in addition, such polynucleotides can be administered for in vivo or ex vivo gene therapy uses. Non-viral vector delivery systems include DNA plasmids, naked nucleic acid, and nucleic acid complexed with, for example, a liposome or other delivery vehicle. Viral vector delivery systems include both DNA and RNA viruses, and can have either episomal or integrated genomes after delivery to the cell. Gene therapy procedures are described, for example, in Anderson, Science 256:808-813 (1992); Nabel & Feigner, TIBTECH 11 :211-217 (1993); Mitani & Caskey, TIBTECH 11 : 162-166 (1993); Dillon, TIBTECH 11 : 167-175 (1993); Miller, Nature 357:455-460 (1992); Van Brunt,
Biotechnology 6(10): 1149-1154 (1988); Vigne, Restorative Neurology and Neuroscience 8:35-36 (1995); Kremer & Perricaudet, British Medical Bulletin 51(l):31-44 (1995);
Haddada et al., in Current Topics in Microbiology and Immunology Doerfler and Bohm (eds) (1995); and Yu et al., Gene Therapy 1 : 13-26 (1994).
[00182] Methods of non-viral delivery of nucleic acids encoding engineered polypeptides of the invention include lipofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipid:nucleic acid conjugates, naked DNA, artificial virions, and agent-enhanced uptake of DNA. Lipofection is described, e.g.,, in U.S. Pat. No. 5,049,386, U.S. Pat. No. 4,946,787; and U.S. Pat. No. 4,897,355, and lipofection reagents are sold commercially (e.g.,, Transfectam™ and Lipofectin™). Cationic and neutral lipids that are suitable for efficient receptor-recognition lipofection of polynucleotides include those of Feigner, WO 91/17424, WO 91/16024. Delivery can be to cells (ex vivo administration) or target tissues (in vivo administration). The preparation of lipid:nucleic acid complexes, including targeted liposomes such as immunolipid complexes, is well known to one of skill in the art (see, e.g.,, Crystal, Science270:404-410 (1995); Blaese et al., Cancer Gene Ther. 2:291-297 (1995); Behr et al., Bioconjugate Chem. 5:382-389 (1994); Remy et al., Bioconjugate Chem. 5:647-654 (1994); Gao et al., Gene Therapy 2:710-722 (1995); Ahmad et al., Cancer Res.52:4817-4820 (1992); U.S. Pat. Nos. 4, 186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028, and 4,946,787). [00183] RNA or DNA viral based systems can be used to target the delivery of polynucleotides carried by the virus to specific cells in the body and deliver the
polynucleotides to the nucleus. Viral vectors can be administered directly to patients (in vivo) or they can be used to transfect cells in vitro. In some cases, the transfected cells are administered to patients (ex vivo). Conventional viral based systems for the delivery of polypeptides of the invention could include retroviral, lentivirus, adenoviral, adeno- associated and herpes simplex virus vectors for gene transfer. Viral vectors are currently the most efficient and versatile method of gene transfer in target cells and tissues. Integration in the host genome is possible with the retrovirus, lentivirus, and adeno-associated virus gene transfer methods, often resulting in long term expression of the inserted transgene, and high transduction efficiencies.
[00184] In one respect, the present invention relates to the herein described
compositions, methods, and respective component(s) thereof, as essential to the invention, yet open to the inclusion of unspecified elements, essential or not ("comprising). In some embodiments, other elements to be included in the description of the composition, method or respective component thereof are limited to those that do not materially affect the basic and novel characteristic(s) of the invention ("consisting essentially of). This applies equally to steps within a described method as well as compositions and components therein. In other embodiments, the inventions, compositions, methods, and respective components thereof, described herein are intended to be exclusive of any element not deemed an essential element to the component, composition or method ("consisting of).
[00185] All patents, patent applications, and publications identified are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the present invention. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.
[00186] The present invention may be as defined in any of the following numbered paragraphs: 1. A method for promoting survival of, or axon regeneration in an injured mature central nervous system (CNS) neuron comprising contacting the neuron with an effective amount of an agent capable of increasing mitochondrial motility in the injured neuron, thereby promoting survival of, or axon regeneration in the injured neuron.
2. The method of paragraph 1, further comprising detecting the resultant promotion of the survival of, or axon regeneration in the injured neuron in the subject.
3. The method of any one of paragraphs 1-2, wherein the injured neuron results from traumatic injury, traumatic brain injury, optic nerve injury, acute spinal cord injury, stroke, restorative CNS surgery or CNS degeneration.
4. The method of any one of paragraphs 1-3, wherein the injured neuron is a sensory neuron.
5. The method of any one of paragraphs 1-4, wherein the injured neuron is in the spinal cord.
6. The method of any one of paragraphs 1-4, wherein the injured neuron is in the optic nerve.
7. The method of any one of paragraphs 1-6, wherein the agent is administered intravenously, intracortically, intracerebrally, intrathecally, intranasally, ocularly or locally at the injured neuron.
8. The method of any one of paragraphs 1-7, wherein the agent is Armcxl polypeptide.
9. The method of paragraph 8, wherein the Armcxl polypeptide is recombinant.
10. The method of any one of paragraphs 8-9, wherein the Armxcl polypeptide comprises a carrier peptide or lipophilic molecular group and/or is encapsulated in a liposome or a nanoparticle.
11. The method of any one of paragraphs 1-7, wherein the agent is a vector comprising a nucleic acid sequence that encodes a Armcxl polypeptide.
12. The method of paragraph 11, wherein the vector is a viral vector or non-viral vector. 13. The method of paragraph 12, wherein the viral vector is selected from the group consisting of retrovirus, lentivirus, adenovirus, herpesvirus, poxvirus, alpha virus, vaccinia virus, and adeno-associated viruses.
14. The method of paragraph 12, wherein the non-viral vector is selected from the group consisting of a nanoparticle, a cationic lipid, a cationic polymer, a metallic nanoparticle, a nanorod, a liposome, microbubbles, a cell penetrating peptide and a liposphere.
15. The method of any one of paragraphs 8-14, wherein the Armcxl polypeptide is of human origin.
16. The method of any one of paragraphs 8-15, wherein the Armcxl polypeptide comprises the sequence of SEQ ID NO: 1.
17. The method of any one of paragraphs 8-16, wherein the Armcxl polypeptide has at least 95% amino acid sequence identity to SEQ ID NO: 1 and retains at least 80% of the biological activity of human Armcxl of SEQ ID NO: 1.
18. The method of any one of paragraphs 2-17, wherein the detecting step is effected by an indirect assay of axon regeneration.
19. The method of any one of paragraphs 2-17, wherein the detecting step is effected by a direct assay of axon regeneration.
20. The method of any one of paragraphs 1-19, further comprising an antecedent step of determining that the neuron is injured, and has axotomy-induced stress.
21. The method of any one of paragraphs 1-20, further comprising contacting the injured neuron with a PTEN inhibitor, inhibitor of suppressor of cytokine signaling 3 (SOCS3), inosine, oncomodulin, BNDF, NGF, CNTF, or combinations thereof.
22. The method of paragraph 21, wherein the inhibitor of SOCS3 comprises a SOCS3 specific hpRNA or siRNA. 23. The method of paragraph 21, wherein the PTEN inhibitor is,
(a) potassium bisperoxo(bipyridine)oxovanadate (V) (bpV(bipy));
(b) dipotassium bisperoxo(5-hydroxypyridine-2-carboxyl)oxovanadate (V)
(bpV(HOpic));
(c) potassium bisperoxo(l, 10-phenanthroline)oxovanadate (V), (bpV(phen)); or
(d) dipotassium bisperoxo(picolinato)oxovanadate (V), (bpV(pic)).
24. The method of any one of paragraphs 1-23, wherein the neuron is human.
25. A method of treating a subject for neuronal injury, comprising:
administering to the subject an agent that increases mitochondrial motility in injured neurons, wherein the administering results in contacting the injured neurons of the subject with the agent in an amount sufficient to promote survival of, or axon regeneration in the injured neurons, such that the subject is treated.
26. The method of paragraph 25, wherein the agent is administered intravenously, intracortically, intracerebrally, intrathecally, intranasally, ocularly or locally at the site of neuronal injury.
27. The method of any one of paragraphs 1-26, wherein the neuronal injury results from a traumatic injury, traumatic brain injury, optic nerve injury, acute spinal cord injury, stroke, restorative CNS surgery or CNS degeneration.
28. The method of paragraph 27, wherein the neuronal injury results from restorative CNS injury and wherein the agent is administered prior to, during or following restorative CNS surgery.
29. The method of any one of paragraphs 25-28, wherein the agent is Armcxl polypeptide.
30. The method of paragraph 29, wherein the Armcxl polypeptide is recombinant. 31. The method of any one of paragraphs 28-30, wherein the Armxcl polypeptide comprises a carrier peptide or lipophilic molecular group and/or is encapsulated in a liposome or a nanoparticle.
32. The method of any one of paragraphs 25-28, wherein the agent is a vector comprising a nucleic acid sequence that encodes a Armcxl polypeptide.
33. The method of paragraph 32, wherein the vector is a viral vector or non-viral vector.
34. The method of paragraph 33, wherein the viral vector is selected from the group consisting of retrovirus, lentivirus, adenovirus, herpesvirus, poxvirus, alpha virus, vaccinia virus, and adeno-associated viruses.
35. The method of paragraph 33, wherein the non-viral vector is selected from the group consisting of a nanoparticle, a cationic lipid, a cationic polymer, a metallic nanoparticle, a nanorod, a liposome, microbubbles, a cell penetrating peptide and a liposphere.
36. The method of any one of paragraphs 29-35, wherein the Armcxl polypeptide is of human origin.
37. The method of any one of paragraphs 29-36, wherein the Armcxl polypeptide comprises the sequence of SEQ ID NO: 1.
38. The method of any one of paragraphs 29-37, wherein the Armcxl polypeptide has at least 95% amino acid sequence identity to SEQ ID NO: 1 and retains at least 80% of the biological activity of human Armcxl of SEQ ID NO: 1.
39. A method of treating a subject for a disease or disorder characterized by neuronal death or diminished potential for axonal growth, comprising administering to the subject an agent that increases mitochondrial motility, in an amount sufficient to promote survival of, or axonal growth in neurons, such that the subject is treated.
40. The method of paragraph 39, wherein the disorder is selected from group comprising of glaucoma, stroke, head trauma, spinal injury, optic injury, ischemia, hypoxia, neurodegenerative disease, multiple sclerosis, infectious disease, cancer, and autoimmune disease.
41. The method of paragraph 39-40, wherein the agent is Armcxl polypeptide or a vector comprising a nucleic acid sequence encoding an Armcxl polypeptide.
42. A method for promoting survival of, or axon regeneration in an injured mature central nervous system neuron in a subject determined to have a neuronal injury, the method comprising, administering to the subject Armcxl polypeptide or an analog thereof in an amount sufficient to promote survival of, or axon regeneration of the injured neuron.
43. A device for promoting survival of, or axon regeneration in an injured mature central nervous system (CNS) neuron comprising a therapeutically effective amount of an agent that increases mitochondrial motility in the neuron, and wherein the device locally releases the agent into the CNS for promoting survival of, or axon regeneration in an injured mature central system (CNS) neuron.
44. The device of paragraph 43, comprising a CNS-implantable solid or semi-solid device selected from a biodegradable matrix, fiber, pump, stent, adsorbable gelatin osmotic pump or indwelling catheter.
45. A pharmaceutical composition comprising an effective amount of Armcxl polypeptide or a vector comprising a nucleic acid sequence encoding the Armcxl polypeptide and a pharmaceutically acceptable carrier, for use in promoting survival of, or regeneration of axon in injured neurons.
46. The pharmaceutical composition of paragraph 45, wherein the Armcxl polypeptide is of human origin.
47. The pharmaceutical composition of any one of paragraphs 45-46, wherein the Armcxl polypeptide comprises the sequence of SEQ ID NO: l . 48. The pharmaceutical composition of any one of paragraphs 45-47, wherein the Armcxl polypeptide has at least 95% amino acid sequence identity to SEQ ID NO: 1 and retains at least 80% of the biological activity of human Armcxl of SEQ ID NO: l .
49. The pharmaceutical composition of any one of paragraphs 45-48, wherein the Armcxl polypeptide is fused to a carrier polypeptide.
50. The pharmaceutical composition of any one of paragraphs 45-49, wherein the vector is a viral or non-viral vector.
51. The pharmaceutical composition of paragraph 50, wherein the viral vector is selected from the group consisting of retrovirus, lentivirus, adenovirus, herpesvirus, poxvirus, alpha virus, vaccinia virus, and adeno-associated viruses.
52. The pharmaceutical composition of paragraph 50, wherein the non-viral vector is selected from the group consisting of a nanoparticle, a cationic lipid, a cationic polymer, a metallic nanoparticle, a nanorod, a liposome, microbubbles, a cell penetrating peptide and a liposphere.
53. The pharmaceutical composition of any one of paragraphs 45-52, wherein the Armcxl polypeptide or the vector comprising a nucleic acid sequence encoding the Armcxl polypeptide is formulated with a lipophilic molecular group and/or encapsulated in a liposome or a nanoparticle.
54. The pharmaceutical composition of any one of paragraphs 45-53, formulated for administration to the brain, spinal cord, or optical nerve.
55. The pharmaceutical composition of any one of paragraphs 45-54, wherein the
composition is formulated for administration via intracerebroventricular, intranasal, intracranial, intracelial, intracerebellar, or intrathecal administration route.
56. The pharmaceutical composition of any one of paragraphs 45-55, wherein the
composition is contained in a delivery device selected from the group consisting of a syringe, a blunt tip syringe, a catheter, an inhaler, a nebulizer, a nasal spray pump, a nasal irrigation pump or nasal lavage pump, and an implantable pump.
57. A pharmaceutical composition comprising an agent that increases mitochondrial motility in injured neuron and a pharmaceutically acceptable carrier, for use in promoting survival of, or regeneration of axon in injured neurons.
58. The pharmaceutical composition of paragraph 57, wherein the agent is Armcxl polypeptide or a vector comprising a nucleic acid sequence encoding the Armcxl
polypeptide.
59. A pharmaceutical composition formulated for ocular administration to a subject in need thereof, comprising an effective amount of Armcxl polypeptide or a vector comprising nucleic acid sequence encoding the Armcxl polypeptide, wherein the effective amount is the amount required for promoting survival of, or axon regeneration of axon in an injured mature CNS neuron in the subject.
60. A method for identifying an agent effective in promoting survival of, or axon
regeneration in neurons after injury, the method comprising:
(a) contacting a neuron with a candidate agent;
(b) determining expression level of Armcxl in the neurons from step (a); and
(c) identifying the candidate agent as effective if the expression level of Armcxl is increased relative to a reference level upon the contact of the neuron with the candidate agent; or identifying the candidate agent as ineffective if the expression level of Armcxl is not changed relative to a reference level upon the contact of the neuron with the candidate agent.
61. The method of paragraph 59, wherein the reference level is expression level of Armcxl in neurons prior to contact with the candidate agent.
62. The method of any one of paragraphs 59-60, wherein the contacting is in vitro or in vivo.
[00187] It is understood that the foregoing detailed description and the following examples are illustrative only and are not to be taken as limitations upon the scope of the invention. Various changes and modifications to the disclosed embodiments, which will be apparent to those of skill in the art, may be made without departing from the spirit and scope of the invention. Further, all patents and other publications; including literature references, issued patents, published patent applications, and co-pending patent applications; cited throughout this application are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the technology described herein. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.
EXAMPLES
[00188] The following examples illustrate some embodiments and aspects of the invention. It will be apparent to those skilled in the relevant art that various modifications, additions, substitutions, and the like can be performed without altering the spirit or scope of the invention, and such modifications and variations are encompassed within the scope of the invention as defined in the claims which follow. The technology described herein is further illustrated by the following examples which in no way should be construed as being further limiting.
Experimental procedure
[00189] Mouse Strains. PTENF; SOCS3f/f mice were obtained by breeding PTE-VP (Park et al., 2008) and SOCS3f/f (Smith et al., 2009). Kcng4-cre; Thyl-stop-YFP line was a kind gift from Josh Sanes laboratory (Duan et al., 2015). For Bcl-2 experiments, because of mouse strain availability we used the Bcl-2/PTENf/f/SOCS3f/f line (Bei et al. 2016). Without expressing the Cre recombinase this line show no axon regeneration ((Bei et al. 2016) and Figure S4D) and is considered as base line controls. Throughout all paper dKO conditions used as a model of high regeneration refers to PTEISF; SOCS3f/f mice +AAV Cre +AAV CNTF (Sun et al., 2012). CNTF is used to potentiate the effect of SOCS3 deletion alone (Smith et al., 2009).
[00190] Constructs. The Armcxl -HA, Armcx 1 ΔΤΜ-ΗΑ, PLAP and
ArmcxlF2AGFP vectors were generated from the pAAV-MCS constructs (Stratagene). For shRNA Armcxl constructs, two targeting sequences against
Armcxl (shRNA2; targeting sequence
GAGAGGCAAACCTCAAGATGACTC and shRNA5;
TCAGTCAAGTGTGTGACGATACC were cloned into p AAV- Armcx 1 -2in-shRNA- mCherry vector from ViGene Biosciences. The construct was generated by ViGene Sciences, Inc. Control shRNA Scramble construct was generated from the pAAV-U6-GFP
(Cellbiolabs).
[00191] Retina Explant culture. P21 PTEISF mice were injected with AAV2-Cre and AAV2-PLAP (placental phosphatase alkaline) as control, AAV2-ArmcxlHA or AAV2-ArmcxlHAATM. 2 weeks after, retinas were dissected out in Hibernate- A (Brain Bits). Retina explants were then plated onto Poly-L-Lysin (Sigma) and Laminin (Sigma) coated glass bottom dishes (MatTek) in Neurobasal-A (Life Technology) supplemented with B-27 (Life Technology), L-Glutamine (Life Technology) and Penicillin/Streptomycin (Life Technology). To evaluate axonal outgrowth, explants were fixed in PFA 4%/Sucrose 1,5% in PBS after 2 weeks and labeled with primary antibody anti-Tuj 1 (Covance Research Products Inc Cat# MMS-435P, RRID: AB 2313773 or Covance Research Products Inc Cat# MRB-435P-100, RRID:AB_10175616), secondary antibody Alexa-488 (1/400- Life Technology). For live imaging experiments, explant were incubated with
tetramethylrhodamine methyl ester (TMRM) (Life Technologies) as described in (Verburg and Hollenbeck, 2008).
[00192] In situ hybridization and Immunohistochemistry. Animals were perfused intracardially with PBS followed by paraformaldehyde (PFA-Sigma) 4% in PBS (w/v). After dissection, tissues were post fixed in PFA 4% in PBS overnight at 4°C and then incubated in Sucrose (Sigma) 15% in PBS for 48h at 4°C. Samples were embedded in Tissu-Tek and frozen at -80°C. Eyes were sectioned by cryostat at 20um. In situ hybridization was performed following classical protocol as described in (Nawabi et al., 2010). For
Immunohistochemistry of whole mount retina, retinas from perfused animals were washed in PBS and blocked in 96 wells plates with PBS-Triton 0.3%-BSA 2% during one hour.
Antibodies against HA (Roche Cat #11867431001, RRID:AB_390919) and Tuj 1 (Covance Research Products Inc Cat# MRB-435P-100, RRID:AB_10175616) were apply on retina in blocking buffer and apply on retina overnight at 4°C. After PBS wash, retinas were incubated for a minimum of 2 hours at room temperature with Alexa secondary antibodies, washed with PBS and mount with fluoromount (SouthernBiotech). Retinas cross sections for
immunohistochemistry study of Armcxl was prepared as described above. Immunohistochemistry using Armcxl antibody (Abeam Cat# ab65144, RRID:AB_1 141088) was performed using Tyramide Signal Amplification system (TSA, Perkin Elmer) following manufacturer protocol. Tuj 1 positive RGCs (Covance Research Products Inc Cat# MMS- 435P, RRID:AB_2313773) were determined positive for Armcxl when signal intensity was minimum 60% above background.
[00193] Cortical neurons culture and transfection. Cortical neurons were isolated from El 8 mouse embryo (Charles River). Briefly, cortices were chemically dissociated in papain solution (Worthington Biochemicals) for lOmn at 37°C followed by two wash in trypsin inhibition solution (Sigma T9253) and mechanical dissociation using PI 000 plastic tip in plain Neurobasal medium (Life Technology). Dissection, dissociation and wash were done in HBSS (Gibco 1470-112) with 45% glucose and kynurenic acid (Sigma K3375) solution (HBSS, kyuneric acid lOmM, lOOmM Hepes, lOOmM MgC12). Cells were plated on poly-l-lysine hydrobromide (Sigma) coated 35mm glass bottom dish (MatTek, (90Ό00 cells/wells). Neurons were cultured in Neurobasal medium (Life Technology) supplemented with B-27 (Life Technology), L-Glutamine (Life Technology) and Penicillin/Streptomycin (Life Technology). Half of the medium was replaced every other day. Plasmid DNA transfections were performed using Lipofectamin 2000 (Invitrogen) following manufacturer procedure. We used 0.3 μg of vector GFP, AAV-ArmcxlF2AGFP, MitoDsred2 (Promega) and 0.5 μg of shRNA plasmids. To study mitochondrial and BDNF positive vesicles transport neurons were transfected at DIV 5. At DIV7 the culture medium was replaced by Hibernate E low fluorescence (BrainBites) to maintain cell viability in C02- free conditions during live imaging. For neurites outgrowth experiments, neurons were transfected at DIV1.
[00194] Cortical Neurons Immunohistochemistry. For immunohistochemistry of cortical neurons, DIV 5-7 neurons were fixed with 4% PF A/1.5%) Sucrose in PBS and immunostained using standard procedure (Glater et al., 2006). Briefly, fixed neurons in glass bottom dish were incubated for 5mn in PBS-Triton 0.3% followed by 1 hour in blocking solution (NGS 10%, Triton 0.1% in PBS). Primary antibodies against HA (Roche Cat# 11867431001, RRID:AB_390919), GFP (Abeam Cat# abl3970, RRID:AB_300798) or RFP (Abeam Cat# ab62341, RRID:AB_945213) were incubated overnight. After PBS wash, secondary anti-rat antibody (1/400, Life Technologies) was added for 1 hour. Cover slips were mounted using Fuoromount-G (SouthernBiotech).
[00195] Protein analyses and Co-immunoprecipitation. For Western blot analyzing of Armcxl constructs, proteins were extracted from Lipofectamin transfected HEK cells (0^g of DNA) and immunoblot was performed as described in (Cartoni et al., 2005) with minor modifications. Co-immunoprecipation was performed as described in (Lopez-Domenech et al., 2012). Briefly, HEK cells were transfected with 2.5μg of each plasmid. 3 days later, cells were lysed in lysis buffer (Tris-HCl pH: 7.5, NaCl 150mM, MgC12 1.5mM, EDTA 5mM Triton 1%, Glycerol 10% and protease inhibitor cocktail). Immunoprecipitation was performed using Dynabeads Protein G (Novex 10003D) and following manufacturer protocol including mixing beads with 20μg of antibody (Roche Cat# 11867431001, RRID:AB_390919) for lOmn on wheels at room temperature and a 1 hour incubation at room temperature with the cell homogenate. For elution a wash buffer was used (TrisHCl pH: 8, NaCl 500mM, EDTA ImM, EGTA ImM, Triton 1%, P-40 0.5%).
[00196] Live imaging. Adult retina explants. Time-lapse movies were acquired on a
PerkinElmer Spinning Disc confocal microscope equipped with a temperature-controlled chamber at 37°C and with a 20 x oil objective. Each frame was captured every 2s. and 60 frames were acquired in total for each recording with laser power set to 30% for each channel to minimize damage. A portion of 80-120 μπι of axon located 150μπι from the tip was selected for analysis. Volocity software (PerkinElmer) was used for live recording. For both the retina explant and the cortical neuron images, a custom-made Image J macro was used for kymograph based motility analysis as described in (Pekkurnaz et al., 2014). Image J raw data were extracted as excel spreadsheets (Microsoft Excel) and statistical analysis was performed with GraphPad Prism version 6.0 for Mac OS X (GraphPad Software, Inc., La Jolla, CA, USA). E18 cortical neurons. Neurons were transferred into pre-warmed Hibernate medium without phenol red, which buffers C02 (Brain Bits). Transfected axons were detected using the GFP channel. Single axons were imaged on an inverted Nikon Eclipse Ti-U microscope and 1 frame was captured every 2s. 60 frames were acquired in total for each recording.
[00197] Mitochondrial transport analysis. From the kymograph generated by the live imaging files, mitochondrial transport was analyzed as in (Pekkurnaz et al., 2014).
Briefly, mitochondria were defined as motile when the average of the instantaneous velocity was higher than 0.05μπι/8 (Wang and Schwarz, 2009). Mitochondria whose velocity was equal or lower than this threshold were considered as stationary. The moving frequency was defined as the percentage of time each mitochondrion spent in motion during the time of the recording and was calculated by dividing the time spent in motion by the total recording time. Hence, the motile pool of mitochondria were the mitochondria with a moving frequency higher than 0. The moving frequency of the motile mitochondria was calculated by excluding the stationary mitochondria. The moving frequency of individual mitochondria was used for statistical analysis. For the percentage of mitochondria in motion per axons, statistics were done on the number of axons. The density of mitochondria in axons was calculated by counting the number of mitochondria on the first frame of the recording used for
mitochondrial transport analysis normalized by the length of the axons.
[00198] Surgical procedures. All experiments procedures were performed in compliance with animal protocols approved by the IACUC at Boston Children's Hospital. For all procedures, mice were anaesthetized with ketamine and pyrazine. Eye ointment containing atropine sulfate was applied to protect the cornea during surgery. Animals received Buprenorphine (0,05 mg/kg, Bedford lab) for 24 hours as post-operative analgesic. Surgical procedures were achieved as described in (Park et al., 2008). AAV virus injection: luL of AAV2 viruses were injected into the right eye of the different mice lines. A glass micropipette was inserted to peripheral retina, behind ora serrate in a way to avoid damage to the lens. When two viruses were injected, viruses were mixed and injected at the same time. The following viruses were used: AAV2-Cre, AAV2-PLAP, AAV2- Armcx 1 HA, AAV2- Armcx 1 ΗΑΔΤΜ, AAV2-CNTF, AAV2-shRNA Scramble and AAV2-shRNA Armcxl . The titers of the viruses were comprised between 1012 -1013gc/mL. Viruses were produced at the Boston Children's Hospital viral core. Optic nerve injury: Four weeks following AAV2 injection (5 weeks for AAV-shRNAs), the right optic nerve was exposed intraorbitally and crushed with forceps (Dumont #5 FST) for 5 seconds approximately 1mm behind the eye ball. RGC anterograde labeling: 2-3 days before animals were euthanized, 1.5ul of cholera toxin β subunit (CTB-2ug/ul, in sterile PBS-Life Technologies) coupled with Alexa-555 (CTB-Alexa-555) was injected into the vitreous with Hamilton syringe (Hamilton) to label axons in optic nerve.
[00199] Axon regeneration imaging and quantification. Optic nerves cryo- sections of 14μπι thick were imaged with a 20x objective using a PerkinElmer Spinning Disc confocal microscope equipped with a motorized stage and Volocity software (Perkin Elmer). For each nerve section, Z-projected to maximum intensity stacked images were stitched together with a 20% of overlap between each image to generate a single picture of the whole optic nerve. Regenerating axons were quantified as described in (Park et al., 2008). For whole mount optic nerve imaging, the protocol described in (Pernet et al., 2013) was followed with minor modifications. Briefly, optic nerves from perfused mice were post-fixed overnight washed three times lOmn in PBS and incubated at room temperature for 20 min in increasing concentration of ethanol (50%, 80%, 95%, 100%). Nerves were kept at 4°C overnight in ethanol 100% with constant agitation. Nerves were then put in Hexan (Sigma) for 3 hours at room temperature on a shaker. The clearing was completed by replacing Hexan by a solution of Benzyl alcohol/Benzyl Benzoate (1 : 2). Nerves were stored in the dark at room temperature in this final solution. For imaging, we used PerkinElmer Spinning Disc confocal microscope equipped with 20x objective and a motorized stage and Volocity software (Perkin Elmer). The whole nerve was acquired using optical sections of 2μπι and stitched images of the Z stacks projections to maximum intensity.
[00200] RGC survival imaging and quantification. Whole mount retinas were immunostained with anti-Tuj l antibody (Covance Research Products Inc Cat# MMS-435P, RRID:AB_2313773 or Covance Research Products Inc Cat# MRB-435P-100,
RRID:AB_10175616). Because of the layering pattern of the retina with the RGCs layer sitting on the top of a whole mount preparation, Tuj 1 staining efficiently labeled RGCs (Belin et al., 2015; Nawabi et al., 2015; Park et al., 2008; Smith et al., 2009). Pictures from 10 regions per retina were taken under an epifluorescence microscope (Nikon 80i- 20X objective). Tuj 1 positive RGCs were counted in intact and injured eye for each animal. The number of Tuj 1 positive RGCs in intact eye of each animal was considered as 100% for this particular animal and was compared to its injured eye to quantify the survival.
[00201] Statistical Analysis. Statistical analysis was performed with GraphPad Prism v6.0. Normality tests were run to assess the distribution of the data to be statistically analyzed. Non normal distributions were analyzed using non-parametric test: Mann- Whitney U test was used to determine the significance of differences between two conditions and the Kruskal-Wallis nonparametric ANOVA test when multiple conditions were compared. Normal distributions were analyzed using parametric test: Student's t-test was used to determine the significance of differences between two conditions and the oneway ANOVA test with Tuckey's multiple comparison test unless otherwise specified, p < 0.05 was considered significant. For box plot graph, whiskers represent the maximum and minimum of the distribution and the horizontal bar in the box the median. For bar plots, all data are shown as mean +/- SEM.
Results
Armcxl expression is up-regulated in RGCs with high regenerative capacity
[00202] Because of the essential role of mitochondria in axonal physiology, using a loss of function approach to determine how regulators of mitochondrial dynamics influence axon regeneration might be difficult to interpret. Instead, that neurons characterized by a high regenerative capacity after axonal injury were thought to constitute an ideal starting point to identify mitochondrial transport regulators involved in axon regeneration. In previous studies (Sun et al., 2012), gene expression profiles were compared in injured RGCs with poor regenerative ability (wild type mice) and with induced high regenerative ability, referred to in this paper as the dKO model (PTENf/f;SOCS3f/f mice with vitreous injection of AAVs expressing Cre (AAV-Cre) and CNTF (AAV-CNTF), CNTF being used to further elevate the Jak/STAT signaling after SOCS3 deletion, Smith et al., 2009; Sun et al., 2012). From these datasets, no genes that have previously been implicated in mitochondrial transport, such as Milton or Miro, were found to be differentially expressed in these neurons with different regenerative ability. However, Armcxl, a member of a cluster of genes in which a family member, Armcx3, had been implicated in regulating mitochondrial transport (Lopez- Domenech et al., 2012), appeared to be highly expressed in injured RGCs with induced regenerative ability (Sun et al., 2012).
[00203] The expression of Armcxl and its paralogs in RGCs was first verified by in situ hybridization. As shown in FIG. 1 A, low levels of Armcxl signal were detected in some RGCs of wild type mice, which were not affected by injury. In stark contrast, 3 days after injury, Armcxl signal was significantly increased in the RGCs of the PTENf/f;SOCS3f/fmice with vitreous injection of AAV-Cre and CNTF (dKO), but not of PTENf/fmice with vitreous injection of AAV-Cre (PTEN-/-), consistent with the gene profiling results (Sun et al., 2012). In comparison, other Armcx members, including 3, 5, and 6, were expressed at low levels in all conditions (FIG. 7). The up-regulation of Armcxl in dKO injured RGCs was further supported by immunohistochemistry (FIGs. IB and 1C), which showed that RGCs positively stained with anti-Armcxl increased approximately two-fold in the dKO after injury compared to other conditions (FIG. 1C; 40% in injured dKO compared to 20% in other conditions). Based on these results, Armcxl was selected for further studies.
Armcxl localizes to mitochondria and interacts with mitochondrial transport machinery
[00204] Similar to other members of the Armcx cluster, Armcxl has a putative mitochondrial outer membrane-targeting sequence flanking the trans-membrane (TM) domain (FIG. ID) (Mou et al., 2009). A mutant of Armcxl was designed that lacks its transmembrane domain, ArmcxlATM (FIGs. ID and IE) and assessed the localization of Armcxl and Armcx 1ΔΤΜ by co-transfecting HA-tagged Armcxl or Armcx 1ΔΤΜ with the mitochondrial marker MitoDsRed in mouse cortical neurons. The vast majority of Armcxl protein was shown to be was targeted to mitochondria (FIG. IF and FIG. 7B), while the absence of the TM domain of Armcxl prevented its mitochondrial localization (FIG. 1G and FIG. 7B).
[00205] Armcx3 was recently shown to regulate mitochondrial transport by interacting with the mitochondria trafficking regulatory complex that connects mitochondria to the motor proteins (Lopez-Domenech et al., 2012), but the role of Armcxl is unknown. Co- immunoprecipitation using Armcxl-HA and Mirol-Myc showed that Armcxl interacted with Mirol (FIG. 1H), the protein linking mitochondria to the Trakl-Kinesin motor complex. Together, these results indicate that the mitochondria-localized Armcxl protein is up- regulated in RGCs with induced regenerative ability and suggest that Armcxl might be a candidate in regulating mitochondrial trafficking.
Armcxl overexpression enhances mitochondrial transport in adult RGC axons
[00206] Axonal mitochondria are distributed in two pools: the motile pool, which can move bi-directionally and may pause before resuming movement, and the stationary pool, which is fixed in position typically for the observable duration of an experiment. The proportion of these two pools has been suggested as an important indicator of mitochondrial trafficking in axons (Schwarz, 2013). As a first step to assess the role of Armcxl in the injury responses of adult RGCs, we examined whether enhancing the expression of Armcxl would increase mitochondrial transport in adult RGC axons using retina explant cultures coupled with live imaging microscopy. Because of the poor neuronal survival and neurite growth of adult wild type retinal explants, we took advantage of the PTEN-/-mice whose RGCs showed better survival and axonal outgrowth in explant cultures (Nawabi et al., 2015). Since PTEN deletion alone did not significantly increase Armcxl levels (FIG. 1 A), this mutant is suitable for assessing the effects of overexpressed Armcxl . PTENf/f adult mice were intravitreally injected with AAV-Cre and AAVs expressing either full length Armcxl or the Armcxl ΔΤΜ mutant. As a control, AAV expressing placental alkaline phosphatase (PLAP), a well- established non-fluorescent and inert control for viral injection (Bei et al.; Belin et al., 2015; Nawabi et al., 2015), was used . Immunohistochemistry on whole mount retina confirmed the efficient infection of RGCs by AAVs encoding Armcxl full length and mutant (FIG. 8 A and 8B). To confirm that multiple viral co-injections allowed efficient targeting of RGCs in explant culture, AAV expressing a mitochondrial protein (Cre-dependent MitoDsRed;
AAV2-FLEX-MitoDsRed) was co-injected with AAV-Cre to the vitreous body of
PTENf/fmice. This showed that the vast majority of the neurites growing out of the resultant explants were MitoDsRed positive (FIG. 8C). [00207] The proportion of motile versus stationary mitochondria in axons overexpressing Armcxl was assessed using live recording of mitochondrial transport. Unlike dissociated neuronal culture in which the morphology of mitochondria in the soma is used to confirm neuronal health prior to imaging, explant culture does not allow access to RGC cell bodies. To circumvent this issue, mitochondrial membrane potential was used as a marker of axonal health by labeling mitochondria with tetramethylrhodamine methyl ester (TMRM), a membrane potential dependent fluorescent dye (Trushina et al., 2012; Verburg and
Hollenbeck, 2008; Zhang et al., 2016). Armcxl overexpression induced a significant increase of the motile mitochondria pool compared to the PLAP control (FIGs. 2A and 2B). In contrast, the mutant ArmcxlATM failed to do so (FIGs. 2A, 2B), suggesting that the effect of Armcxl on mitochondrial motility is dependent on its mitochondrial localization.
Consistent with the increase of the motile mitochondrial pool, Armcxl overexpression increased the moving frequency of the total pool of mitochondria, i.e. the fraction of time mitochondria in motion rather than paused (FIG. 2C). To further determine whether the overexpression of Armcxl increased the transport of mitochondria from the motile pool, we specifically analyzed the moving frequency of this pool and did not observe any difference between control and Armcxl overexpression (FIG. 8D). Since Armcxl overexpression increased the proportion of motile mitochondria with no accompanying changes of mitochondrial density (FIG. 2D), Armcxl was concluded to likely increase mitochondrial transport by recruiting stationary mitochondria into the motile pool.
Armcxl promotes retinal neurite outgrowth
[00208] In addition to mitochondrial movement, the effects of Armcxl on neurite outgrowth was also assessed from these retinal explants. Immunohistochemistry against the neuronal marker Tuj 1 revealed that Armcxl overexpression triggered a substantial increase in axons growing out of the explants (FIGs. 2E-2G) independent of their size (FIG. 2F).
Detailed analysis showed that the Armcxl -induced axonal outgrowth was more evident at short distances (FIG. 2E lower panel and FIG. 2G). Consistent with the mitochondrial transport data, the overexpression of the non-mitochondrial Armcxl mutant (Armcxl ΔΤΜ) failed to reproduce the outgrowth phenotype observed with full length Armcxl (FIGs. 2E- 2G), suggesting a direct link between Armcxl localization on mitochondria and enhanced axonal outgrowth.
Armcxl regulates mitochondrial transport and neurite outgrowth in embryonic neurons [00209] In order to test whether Armcxl overexpression has a general effect on mitochondrial transport and neurite outgrowth, similar analyses were performed as described above in cultured El 8 cortical neurons, a well-established system for investigating mitochondrial trafficking (Pekkurnaz et al., 2014; Wang and Schwarz, 2009; Wang et al., 2011). Whether Armcxl overexpression could alter the proportion of motile versus stationary mitochondria in these neurons was first addressed. The mitochondrial marker MitoDsRed was co-transfected with either Armcxl or GFP as a control. Armcxl expression was coupled with a GFP reporter linked by an F2A sequence allowing the identification of transfected neurons. Whereas in wild type axons around 50% of mitochondria were motile, Armcxl overexpression significantly increased the percentage of motile mitochondria up to 80% (FIGs. 3A and 3B). Consistently, Armcxl overexpression also significantly increased the moving frequency of mitochondria (FIGs. 3C) with no effect on mitochondrial density (FIG. 9A). In contrast to its effect on mitochondria trafficking, overexpressing Armcxl did not affect the transport of BD F positive vesicles (FIG. 9B and 9C), consistent with a specific localization of Armcxl to mitochondria. In addition, Armcxl overexpression significantly increased the average length of the longest neurites of embryonic cortical neurons (FIG. 3D and 3E). These results together suggest that Armcxl overexpression leads to similar effects on enhancing mitochondria movement and neurite growth in both adult RGC axons and embryonic cortical neurons.
Armcxl promotes neuronal survival and axon regeneration after optic nerve injury
[00210] The above results suggest that Armcxl might have a role in promoting neurite outgrowth. We hypothesized that this role could be important to promote axonal regeneration after an injury. To directly test this hypothesis, the effects of Armcxl overexpression on axon regeneration and neuronal survival in adult RGCs was examined after an optic nerve crush injury. AAVs encoding Armcxl, ArmcxlATM or PLAP were injected into the vitreous body of adult wild type mice and optic nerve crush was performed one month after viral injection. 15 days after injury, the regenerating axons were labeled with the anterograde tracer CTB. Armcxl overexpression induced a significantly higher number of regenerating axons in comparison to PLAP control (FIGs. 4A-4C). Consistent with in vitro data, this effect was dependent on Armcxl mitochondrial localization since the overexpression of Armcxl ΔΤΜ failed to recapitulate the enhanced regeneration (FIGs. 4A-4C). The effect of Armcxl overexpression on the survival of RGCs (FIGs. 4D and 4E) was also analyzed. Consistent with previous studies (Belin et al., 2015; Nawabi et al., 2015; Park et al., 2008; Smith et al., 2009), about 25% of RGCs survived in the control group (FIGs. 4D and 4E). Strikingly, overexpressing Armcxl, but not the non-mi tochondrial mutant Armcxl ΔΤΜ, led to an increase of approximatively 45% of neuronal survival compared to the control group (FIGs. 4D and 4E), suggesting that Armcxl may not only promote axon regeneration but also protect injured neurons from cell death.
[00211] In principle, the observed regenerative effects of Armcxl overexpression might reflect a direct effect of Armcxl on axon regeneration or be merely secondary to increased neuronal survival. Several strategies such as p53 deletion (Park et al., 2008), manipulating ER stress pathways (Hu et al., 2012), and Apafl -deleted mice are able to increase neuronal survival but not axon regeneration in the same optic nerve injury model, suggesting that axon regeneration requires an independent mechanism. To directly test this in the context of Armcxl, a transgenic mouse line was used in which Bcl-2 is overexpressed under a pan neuronal promoter (Martinou et al., 1994). Consistent with previous results using Bcl-2 transgenic mice (Bei et al.; Bonfanti et al., 1996; Goldberg et al., 2002), about 80% of RGCs survived but no significant increase in axon regeneration occurred 2 weeks after injury (FIG. 10). With Armcxl overexpression, high neuronal survival remained at 15 days after injury in these mice (FIG. 10A and 10B). Importantly, even with this high survival rate, Armcxl overexpression improved axon regeneration of Bcl-2 mice (FIG. IOC and 10D) but did not further enhance the extent of axon regeneration beyond what was observed by Armcxl overexpression in the absence of Bcl-2 (FIG. IOC and 10D compare to the results in FIGs. 4A-4C). Therefore, these findings substantiate the notion that, in addition to promoting neuronal survival, Armcxl is also directly involved in regulating the process of axon regeneration after injury.
Armcxl potentiates the regeneration of PTEN deleted RGCs
[00212] Although Armcxl has a positive effect on axon regeneration in wild type mice, the limited numbers of regenerating axons might reflect compromised regenerative ability associated with injured RGCs. As our previous studies showed that PTEN deletion in adult RGCs is able to increase neuronal survival and axon regeneration by elevating mTOR activity in injured RGCs (Park et al., 2008), we tested the effect of Armcxl in this regeneration-permissive background. AAVs expressing Cre together with AAVs expressing Armcxl, Armcxl ΔΤΜ or PLAP as a control, were co-injected to the vitreous body of adult PTENf/f mice and optic nerve crush was performed 4 weeks after viral injection. After an additional 15 days, the regenerating fibers were labeled with the anterograde tracer CTB and examined in optic nerve cross-sections. In this PTEN-deleted background, Armcxl overexpression induced a significant increase in the number of regenerating axons in comparison with PTEN deletion alone (FIGs. 5A and 5B and 11 A). This increase is most striking for the short-regenerating axons, consistent with the results of neurite outgrowth in retinal explants (FIGs. 2E-2G). In a side-by-side study the high regeneration capacity of PTEN deleted RGCs overexpressing Armcxl fell within the same range as the dKO phenotype (FIG. 1 IB and 11C). In addition, Armcxl overexpression also further increased RGC survival induced by PTEN deletion (FIGs. 5C and 5D). As expected, the mutant ArmcxlATM failed to alter either neuronal survival or axon regeneration (FIGs. 5A-5D).
[00213] Previous studies demonstrated that among different RGC subtypes analyzed, PTEN inhibition selectively promotes regeneration from aRGCs (Duan et al., 2015). The high number of injured axons growing beyond the injury site when Armcxl was
overexpressed in PTEN deleted mice (FIGs. 5 A and 5B) prompted us to test the effects of Armcxl on promoting the regeneration of different RGC subtypes. To this end, the mouse line Kcng4-Cre; Thyl-stop-YFP line 1 (Kcng4-YFP) that labels aRGCs and their axons (Duan et al., 2015; 2014) was used. To inhibit PTEN expression, AAVs expressing shRNA against PTEN (Duan et al., 2015; Zukor et al., 2013) were injected with or without AAV- Armcxl to the Kcng4-YFP mice. At 15 days post injury, CTB injection was performed in order to label all regenerating axons from both aRGCs and non-aRGCs. Therefore,
YFP+/CTB+ axons should be derived from aRGCs, while the YFP-/CTB+ axons are likely to be from non-aRGCs. As shown in FIGs. 5E and 5F, Armcxl overexpression induced a significant increase in regenerating axons from non-aRGCs as quantified at 0.5 mm distal from the lesion sites. aRGC-derived regenerating axons also showed a trend of increase, but did not reach statistical significance (FIGs. 5F). These results suggest that in contrast to the selective effects of PTEN inhibition on aRGCs, Armcxl is likely to promote axons regeneration from non-aRGCs and possibly from aRGCs to some extent.
Armcxl knockdown reduces axon regeneration and neuronal survival in dKO mice
[00214] The positive effect of Armcxl overexpression on axonal regeneration and neuronal survival led us to assess the functional outcomes of silencing Armcxl expression in both in vitro and in vivo models. We tested five shRNAs targeting different regions of Armcxl and found two with knockdown efficiency close to 80% (FIG. 12A and 12B). In order to maximize the knockdown efficiency a vector harboring these two different shRNAs was generated for the subsequent experiments (Song et al., 2008). The effects of Armcxl knockdown on mitochondrial movement and other functional readouts in cultured El 8 cortical neurons was assessed by co-transfecting MitoDsRed with either shRNAs against Armcxl or shRNA Scramble as a control. To facilitate the identification of transfected neurons these shRNA constructs were designed to carry a fluorescent protein reporter.
Knockdown of Armcxl had a significant effect on mitochondrial transport in axons, decreasing the motile pool from 60% to 20% (FIGs. 12C and 12D). Armcxl silencing also significantly decreased the moving frequency of mitochondria (FIG. 12E), without affecting mitochondrial density (FIG. 12F). Importantly, knockdown of Armcxl also significantly reduced neurite growth from transfected neurons (FIG. 12G and 12H). Thus, these results are consistent with our overexpression data and support a role of Armcxl in regulating mitochondria movement and neurite growth in cultured cortical neurons.
[00215] Finally, whether the up-regulation of Armcxl in RGCs of dKO mice is necessary for their high-regeneration phenotype was tested. To directly test this hypothesis, Armcxl was knocked down in dKO mice in which Armcxl is up-regulated (Sun et al., 2012, FIGs. lA-lC). AAV carrying shRNAs against Armcxl and the control shRNA Scramble were generated. These two viruses were both able to efficiently infect RGCs (FIG. 121). To assess the effects of shRNA Armcxl virus on Armcxl expression in injured dKO RGCs we injected AAV- Armcxl shRNAs or Scramble in the retina of dKO mice. 5 weeks post injection of the shRNA AAVs, optic nerve crush was performed the animals terminated 3 days post injury. Approximately 50% of RGCs were Armcxl positive in dKO retinas with injection of AAV expressing shRNA-Scramble (FIG. 6A), consistent with our immunohistochemistry results from FIGs. IB and 1C. In contrast, AAV expressing Armcxl-shRNAs significantly reduced this number, bringing the percentage of Armcxl positive RGCs to a level comparable to wild type condition, i.e. around 20% (FIG. 6A).
[00216] To study the effect of Armcxl down-regulation on axon regeneration in dKO mice, mice from the same cohort described above were used but terminated 15 days post injury. As shown in FIG. 6B and FIG. 12J, knocking down Armcxl significantly inhibited the axon regeneration phenotype. Whole mount retina analysis revealed that shRNAs of Armcxl also significantly reduced RGC survival in dKO mice, compared to the control Scramble shRNA (FIGs. 6C). In a separate control, the same AAV vectors were injected to the vitreous bodies of wild type mice and analyzed these mice at 5 weeks post injection. CTB traced optic nerve axons did not show any sign of degeneration comparing to control injected with AAV-shRNA Scramble and RGC survival was not significantly different between conditions (FIG. 12K). Together, these results suggest that injury-induced Armcxl expression is required for the increased neuronal survival and axon regeneration phenotypes of the dKO model.
Discussion
[00217] In this study, the mitochondrial protein Armcxl is shown sufficient to (1) increase mitochondrial transport by recruiting stationary mitochondria, (2) protect
axotomized neurons from cell death, and (3) promote axon regeneration. Armcxl is further shown necessary for the axon regeneration and neuronal survival phenotypes observed in high regenerative conditions induced by the co-deletion of PTEN and SOCS3 and an accompanying treatment of CNTF (dKO). Together with the fact that Armcxl expression is injury-induced and correlates with high regenerative ability, our results suggest Armcxl as a key regulator of mitochondrial transport in injured axons, which could impact neuronal survival and axon regeneration. Modulated mitochondrial transport might constitute a new strategy to promote neuronal repair of the injured CNS.
[00218] The precise mechanisms of Armcxl in injured axons remain to be determined.
Similar to Armcx3, Armcxl is able to interact with the Miro/Trak mitochondrial transport complex. However, it remains to be determined whether Armcxl mobilizes stationary mitochondria in a calcium dependent manner as has been proposed for Armcx3 (Lopez Domenech et al., 2012). Like other members of the Armcx cluster, Armcxl has a nuclear localization signal (Figure ID and (Lopez-Domenech et al., 2012)). In these studies, some overexpressed Armcxl was also found to be localized to the nuclei of transfected neurons. Thus, although other functions of Armcxl cannot be ruled out, the results from the
ArmcxlATM mutant suggest that the mitochondria-targeted Armcxl protein is responsible for its function in promoting axon regeneration and RGC survival. In the same line, a recent study showed that enhancing mitochondrial transport by genetic deletion of the gene encoding the mitochondria-anchoring protein syntaphilin also facilitated axon regeneration by rescuing energy deficits in injured axons (Zhou et al., 2016). However, whether Armcxl acts by regulating energy supply or other mechanisms, such as regulation of calcium homeostasis, signaling via reactive oxygen species, or changes in the production of metabolites, requires further studies. In addition, sustained axon regeneration likely involves the enhanced axonal transport of not only mitochondria but also other axonal building blocks. Thus, it would be interesting to identify other regulators of axonal transport in neurons with increased regenerative ability. [00219] In the PTEN deletion background, Armcxl overexpression further increased the number of regenerating axons (FIGs. 5A, 5B and 11). Interestingly, this is in contrast with other treatments, such as overexpression of DCLK2, a cytoskeleton regulator, which increases the length of regenerating axons without substantially affecting the number of regenerating axons induced by PTEN deletion (Nawabi et al., 2015). These results, together with our loss of function experiment where Armcxl down-regulation inhibited dKO-induced axon regeneration (FIG. 6A-6C), suggest that Armcxl is more important for the initiation phase of axon regeneration. The increased regeneration observed with Armcxl
overexpression is unlikely to be merely secondary to improved neuronal survival because RGC loss is efficiently prevented by Bcl-2 expression, although Bcl-2 does not increase regeneration. Moreover, in the Bcl-2 expressing background Armcxl enhances regeneration without an additive effect on RGC survival (FIG. 10). Finally, even though expression of Armcxl shRNA reduced RGC regeneration in dKO mice back to a level comparable to wild type mice (FIG. 6B and FIG. 4A), RGCs survival was less drastically affected (FIG. 6C and FIG. 4E).
[00220] In a PTEN deletion background, Armcxl overexpression was also shown to facilitate additional axon regeneration from non-aRGCs, a cell type that otherwise exhibits little regeneration. It is possible that different RGC sub-types have different needs in terms of mitochondrial function; non-aRGCs may have a greater dependency on mobilization of mitochondria by Armcxl in order to cope with injury -induced stresses such as calcium influx and energy imbalance. However, it is unknown whether Armcxl effects somatic
mitochondria the same as axonal mitochondria; these differentially localized mitochondria may be responsible for distinct effects on neuronal survival and axon regeneration.
Nevertheless, as visual functions appear to be executed by different classes of RGCs (Sanes and Masland, 2015; Wernet et al., 2014), these results might be insightful for designing more efficient neural repair strategies to target different populations of RGCs.
[00221] The Armcx-cluster specificity to Eutherian mammals might imply that it has evolved as an additional layer of mitochondrial transport regulation to match the increasing complexity of the mammalian CNS. Our results suggest that this extra layer of regulation might be especially important when stress, such as an injury, is applied to the axon. Because mitochondrial transport failure has been reported in many neurodegenerative diseases (De Vos et al., 2008), increasing mitochondrial transport has been proposed as an exciting option to counteract axonal degeneration and subsequent neuronal death (Hinckelmann et al., 2013). With this perspective, the present study suggests that Armcxl and its homologues could be a set of important targets of therapeutic interventions for neuronal protection and repair.
REFERENCES
Abe, N., and Cavalli, V. (2008). Nerve injury signaling. Current Opinion in Neurobiology 18, 276-283.
Bei, F., Lee, H.H.C., Liu, X., Gunner, G, Jin, H., Ma, L., Wang, C, Hou, L., Hensch, T.K., Frank, E., et al. Restoration of Visual Function by Enhancing Conduction in Regenerated Axons. Cell 164, 219-232.
Belin, S., Nawabi, H., Wang, C, Tang, S., Latremoliere, A., Warren, P., Schorle, H., Uncu, C, Woolf, C.J., He, Z., et al. (2015). Injury-Induced Decline of Intrinsic Regenerative Ability Revealed by Quantitative Proteomics. Neuron 86, 1000-1014.
Bonfanti, L., Strettoi, E., Chierzi, S., Cenni, M.C., Liu, X.H., Martinou, J.C., Maffei, L., and Rabacchi, S.A. (1996). Protection of retinal ganglion cells from natural and axotomyinduced cell death in neonatal transgenic mice overexpressing bcl-2. J Neurosci 16, 4186-4194.
Bradke, F., Fawcett, J.W., and Spira, M.E. (2012). Assembly of a new growth cone after axotomy: the precursor to axon regeneration. Nature Reviews Neuroscience 13, 183-193. Cartoni, R., Leger, B., Hock, M.B., Praz, M., Crettenand, A., Pich, S., Ziltener, J.-L., Luthi, F., Deriaz, O., Zorzano, A., et al. (2005). Mitofusins 1/2 and ERRalpha expression are increased in human skeletal muscle after physical exercise. The Journal of Physiology 567, 349-358.
Courchet, J., Lewis, T.L., Jr., Lee, S., Courchet, V., Liou, D.-Y., Aizawa, S., and Polleux, F. (2013). Terminal Axon Branching Is Regulated by the LKB1-NUAK1 Kinase Pathway via Presynaptic Mitochondrial Capture. Cell 153, 1510-1525.
Cregg, J.M., DePaul, M.A., Filous, A.R., Lang, B.T., Tran, A., and Silver, J. (2014).
Functional regeneration beyond the glial scar. Experimental Neurology 253, 197-207.
De Vos, K.J., Grierson, A. J., Ackerley, S., and Miller, C.C.J. (2008). Role of Axonal Transport in Neurodegenerative Diseases*. Annu. Rev. Neurosci. 31, 151-173.
Duan, X., Krishnaswamy, A., la Huerta, De, L, and Sanes, J.R. (2014). Type II cadherins guide assembly of a direction-selective retinal circuit. Cell 158, 793-807.
Duan, X., Qiao, M., Bei, F., Kim, I. -J., He, Z., and Sanes, J.R. (2015). Subtype-Specific Regeneration of Retinal Ganglion Cells following Axotomy: Effects of Osteopontin and mTOR Signaling. Neuron 85, 1244-1256. Glater, E.E., Megeath, L.J., Stowers, R.S., and Schwarz, T.L. (2006). Axonal transport of mitochondria requires milton to recruit kinesin heavy chain and is light chain independent. The Journal of Cell Biology 173, 545-557.
Goldberg, J.L., and Barres, B.A. (2000). The relationship between neuronal survival and regeneration. Annu. Rev. Neurosci. 23, 579-612.
Goldberg, J.L., Espinosa, J.S., Xu, Y., Davidson, N., Kovacs, G.T.A., and Barres, B.A.
(2002). Retinal ganglion cells do not extend axons by default: promotion by neurotrophic signaling and electrical activity. Neuron 33, 689-702.
Hammarlund, M., and Jin, Y. (2014). Axon regeneration in C. elegans. Current Opinion in Neurobiology 27, 199-207.
He, Z ., and Jin, Y. (2016). Intrinsic control of axon regeneration. Neuron 90, 437-451.
Hinckelmann, M.-V., Zala, D., and Saudou, F. (2013). Releasing the brake: restoring fast axonal transport in neurodegenerative disorders. Trends in Cell Biology.
Hu, Y., Park, K.K., Yang, L., Wei, X., Yang, Q., Cho, K.-S., Thielen, P., Lee, A.-H., Cartoni, R., Glimcher, L.H., et al. (2012). Differential effects of unfolded protein response pathways on axon injury -induced death of retinal ganglion cells. Neuron 73, 445-452.
Lopez-Domenech, G., Serrat, R., Mirra, S., D'Aniello, S., Somorjai, L, Abad, A., Vitureira, N., Garcia-Arumi, E., Alonso, M.T., Rodriguez-Prados, M., et al. (2012). The Eutherian Armcx genes regulate mitochondrial trafficking in neurons and interact with Miro and Trak2. Nature Communications 3, 814.
Lu, Y., Belin, S., and He, Z. (2014). Signaling regulations of neuronal regenerative ability. Current Opinion in Neurobiology 27, 135-142.
Mar, F.M., Simoes, A.R., Leite, S., Morgado, M.M., Santos, T.E., Rodrigo, IS., Teixeira, C.A., Misgeld, T., and Sousa, M.M. (2014). CNS Axons Globally Increase Axonal Transport after Peripheral Conditioning. Journal of Neuroscience 34, 5965-5970.
Martinou, J.-C, Dubois-Dauphin, M., Staple, J.K., Rodriguez, I, Frankowski, H., Missotten, M., Albertini, P., Talabot, D., Catsicas, S., and Pietra, C. (1994). Overexpression of BCL-2 in transgenic mice protects neurons from naturally occurring cell death and experimental ischemia. Neuron 13, 1017-1030.
Misgeld, T., Kerschensteiner, M., Bareyre, F.M., Burgess, R.W., and Lichtman, J.W. (2007). Imaging axonal transport of mitochondria in vivo. Nature Publishing Group 4, 559-561. Morris, R.L., and Hollenbeck, P.J. (1993). The regulation of bidirectional mitochondrial transport is coordinated with axonal outgrowth. J Cell Sci 104 ( Pt 3), 917-927. Mou, Z., Tapper, A.R., and Gardner, P.D. (2009). The armadillo repeat-containing protein, ARMCX3, physically and functionally interacts with the developmental regulatory factor SoxlO. Journal of Biological Chemistry 284, 13629-13640.
Nawabi, H., Briancon-Marjollet, A., Clark, C, Sanyas, L, Takamatsu, H., Okuno, T., Kumanogoh, A., Bozon, M., Takeshima, K., Yoshida, Y., et al. (2010). A midline switch of receptor processing regulates commissural axon guidance in vertebrates. Genes &
Development 24, 396-410.
Nawabi, H., Belin, S., Cartoni, R., Williams, P.R., Wang, C, Latremoliere, A., Wang, X., Zhu, J., Taub, D.G., Fu, X., et al. (2015). Doublecortin-Like Kinases Promote Neuronal Survival and Induce Growth Cone Reformation via Distinct Mechanisms. Neuron.
Park, K.K., Liu, K., Hu, Y., Smith, P.D., Wang, C, Cai, B., Xu, B., Connolly, L., Kramvis, L, Sahin, M., et al. (2008). Promoting axon regeneration in the adult CNS by modulation of the PTEN/mTOR pathway. Science 322, 963-966.
Pekkurnaz, G., Trinidad, J.C., Wang, X., Kong, D., and Schwarz, T.L. (2014). Glucose Regulates Mitochondrial Motility via Milton Modification by O-GlcNAc Transferase. Cell 158, 54-68.
Pernet, V., Joly, S., Jordi, N., Dalkara, D., Guzik-Kornacka, A., Flannery, J.G., and Schwab, M.E. (2013). Misguidance and modulation of axonal regeneration by Stat3 and Rho/ROCK signaling in the transparent optic nerve. Cell Death Dis 4, e734-
Sanes, J.R., and Masland, R.H. (2015). The types of retinal ganglion cells: current status and implications for neuronal classification. Annu. Rev. Neurosci.
Schwarz, T.L. (2013). Mitochondrial trafficking in neurons. Cold Spring Harb Perspect Biol 5.
Smith, P., Sun, F., Park, K.K., Cai, B., Wang, C, Kuwako, K., Martinez-Carrasco, I., Connolly, L., and He, Z. (2009). SOCS3 deletion promotes optic nerve regeneration in vivo. Neuron 64, 617-623.
Song, J., Giang, A., Lu, Y., Pang, S., and Chiu, R. (2008). Multiple shRNA expressing vector enhances efficiency of gene silencing. BMB Rep 41, 358-362.
Sun, F., Park, K.K., Belin, S., Wang, D., Lu, T., Chen, G., Zhang, K., Yeung, C, Feng, G., Yankner, B.A., et al. (2012). Sustained axon regeneration induced by co-deletion of PTEN and SOCS3. Nature 480, 372-375.
Trushina, E., Nemutlu, E., Zhang, S., Christensen, T., Camp, J., Mesa, J., Siddiqui, A., Tamura, Y., Sesaki, H., Wengenack, T.M., et al. (2012). Defects in mitochondrial dynamics and metabolomic signatures of evolving energetic stress in mouse models of familial Alzheimer's disease. PLoS ONE 7, e32737.
Verburg, J., and Hollenbeck, P.J. (2008). Mitochondrial Membrane Potential in Axons Increases with Local Nerve Growth Factor or Semaphorin Signaling. Journal of Neuroscience 28, 8306-8315.
Wang, X., and Schwarz, T.L. (2009). The Mechanism of Ca. Cell 136, 163-174.
Wang, X., Winter, D., Ashrafi, G., Schlehe, J., Wong, Y.L., Selkoe, D., Rice, S., Steen, J.,
LaVoie, M.J., and Schwarz, T.L. (2011). PINKl and Parkin Target Mirofor Phosphorylation and Degradation to Arrest Mitochondrial Motility. Cell 147, 893-906.
Wernet, M.F., Huberman, A.D., and Desplan, C. (2014). So many pieces, one puzzle: cell type specification and visual circuitry in flies and mice. Genes &Amp; Development 28,
2565-2584.
Zhang, L., Trushin, S., Christensen, T.A., Bachmeier, B.V., Gateno, B., Schroeder, A., Yao,
J., Itoh, K., Sesaki, H., Poon, W.W., et al. (2016). Altered brain energetics induces mitochondrial fission arrest in Alzheimer's Disease. Sci. Rep. 6, 18725.
Zhou, B., Yu, P., Lin, M.-Y., Sun, T., Chen, Y., and Sheng, Z.-H. (2016). Facilitation of axon regeneration by enhancing mitochondrial transport and rescuing energy deficits. J Cell Biol
104, jcb.201605101.
Zukor, K., Belin, S., Wang, C, Keelan, N., Wang, X., and He, Z. (2013). Short hairpin RNA against PTEN enhances regenerative growth of corticospinal tract axons after spinal cord injury. - PubMed - NCBI. J Neurosci 33, 15350-15361.

Claims

1. A method for promoting survival of, or axon regeneration in an injured mature central nervous system (CNS) neuron comprising contacting the neuron with an effective amount of an agent capable of increasing mitochondrial motility in the injured neuron, thereby promoting survival of, or axon regeneration in the injured neuron.
2. The method of claim 1, further comprising detecting the resultant promotion of the survival of, or axon regeneration in the injured neuron in the subject.
3. The method of any one of claims 1-2, wherein the injured neuron results from traumatic injury, traumatic brain injury, optic nerve injury, acute spinal cord injury, stroke, restorative CNS surgery or CNS degeneration.
4. The method of any one of claims 1-3, wherein the injured neuron is a sensory neuron.
5. The method of any one of claims 1-4, wherein the injured neuron is in the spinal cord.
6. The method of any one of claims 1-4, wherein the injured neuron is in the optic nerve.
7. The method of any one of claims 1-6, wherein the agent is administered intravenously, intracortically, intracerebrally, intrathecally, intranasally, ocularly or locally at the injured neuron.
8. The method of any one of claims 1-7, wherein the agent is Armcxl polypeptide.
9. The method of claim 8, wherein the Armcxl polypeptide is recombinant.
10. The method of any one of claims 8-9, wherein the Armxcl polypeptide comprises a carrier peptide or lipophilic molecular group and/or is encapsulated in a liposome or a nanoparticle.
11. The method of any one of claims 1-7, wherein the agent is a vector comprising a nucleic acid sequence that encodes a Armcxl polypeptide.
12. The method of claim 11, wherein the vector is a viral vector or non-viral vector.
13. The method of claim 12, wherein the viral vector is selected from the group consisting of retrovirus, lentivirus, adenovirus, herpesvirus, poxvirus, alpha virus, vaccinia virus, and adeno-associated viruses.
14. The method of claim 12, wherein the non-viral vector is selected from the group consisting of a nanoparticle, a cationic lipid, a cationic polymer, a metallic nanoparticle, a nanorod, a liposome, microbubbles, a cell penetrating peptide and a liposphere.
15. The method of any one of claims 8-14, wherein the Armcxl polypeptide is of human origin.
16. The method of any one of claims 8-15, wherein the Armcxl polypeptide comprises the sequence of SEQ ID NO: 1.
17. The method of any one of claims 8-16, wherein the Armcxl polypeptide has at least 95% amino acid sequence identity to SEQ ID NO: 1 and retains at least 80% of the biological activity of human Armcxl of SEQ ID NO: 1.
18. The method of any one of claims 2-17, wherein the detecting step is effected by an indirect assay of axon regeneration.
19. The method of any one of claims 2-17, wherein the detecting step is effected by a direct assay of axon regeneration.
20. The method of any one of claims 1-19, further comprising an antecedent step of determining that the neuron is injured, and has axotomy-induced stress.
21. The method of any one of claims 1-20, further comprising contacting the injured neuron with a PTEN inhibitor, inhibitor of suppressor of cytokine signaling 3 (SOCS3), inosine, oncomodulin, BNDF, NGF, CNTF, or combinations thereof.
22. The method of claim 21, wherein the inhibitor of SOCS3 comprises a SOCS3 specific hpRNA or siRNA.
23. The method of claim 21, wherein the PTEN inhibitor is,
(a) potassium bisperoxo(bipyridine)oxovanadate (V) (bpV(bipy));
(b) dipotassium bisperoxo(5-hydroxypyridine-2-carboxyl)oxovanadate (V)
(bpV(HOpic));
(c) potassium bisperoxo(l, 10-phenanthroline)oxovanadate (V), (bpV(phen)); or
(d) dipotassium bisperoxo(picolinato)oxovanadate (V), (bpV(pic)).
24. The method of any one of claims 1-23, wherein the neuron is human.
25. A method of treating a subject for neuronal injury, comprising:
administering to the subject an agent that increases mitochondrial motility in injured neurons, wherein the administering results in contacting the injured neurons of the subject with the agent in an amount sufficient to promote survival of, or axon regeneration in the injured neurons, such that the subject is treated.
26. The method of claim 25, wherein the agent is administered intravenously, intracortically, intracerebrally, intrathecally, intranasally, ocularly or locally at the site of neuronal injury.
27. The method of any one of claims 1-26, wherein the neuronal injury results from a traumatic injury, traumatic brain injury, optic nerve injury, acute spinal cord injury, stroke, restorative CNS surgery or CNS degeneration.
28. The method of claim 27, wherein the neuronal injury results from restorative CNS injury and wherein the agent is administered prior to, during or following restorative CNS surgery.
29. The method of any one of claims 25-28, wherein the agent is Armcxl polypeptide.
30. The method of claim 29, wherein the Armcxl polypeptide is recombinant.
31. The method of any one of claims 28-30, wherein the Armxcl polypeptide comprises a carrier peptide or lipophilic molecular group and/or is encapsulated in a liposome or a nanoparticle.
32. The method of any one of claims 25-28, wherein the agent is a vector comprising a nucleic acid sequence that encodes a Armcxl polypeptide.
33. The method of claim 32, wherein the vector is a viral vector or non-viral vector.
34. The method of claim 33, wherein the viral vector is selected from the group consisting of retrovirus, lentivirus, adenovirus, herpesvirus, poxvirus, alpha virus, vaccinia virus, and adeno-associated viruses.
35. The method of claim 33, wherein the non-viral vector is selected from the group consisting of a nanoparticle, a cationic lipid, a cationic polymer, a metallic nanoparticle, a nanorod, a liposome, microbubbles, a cell penetrating peptide and a liposphere.
36. The method of any one of claims 29-35, wherein the Armcxl polypeptide is of human origin.
37. The method of any one of claims 29-36, wherein the Armcxl polypeptide comprises the sequence of SEQ ID NO: 1.
38. The method of any one of claims 29-37, wherein the Armcxl polypeptide has at least 95% amino acid sequence identity to SEQ ID NO: 1 and retains at least 80% of the biological activity of human Armcxl of SEQ ID NO: 1.
39. A method of treating a subject for a disease or disorder characterized by neuronal death or diminished potential for axonal growth, comprising administering to the subject an agent that increases mitochondrial motility, in an amount sufficient to promote survival of, or axonal growth in neurons, such that the subject is treated.
40. The method of claim 39, wherein the disorder is selected from group comprising of glaucoma, stroke, head trauma, spinal injury, optic injury, ischemia, hypoxia, neurodegenerative disease, multiple sclerosis, infectious disease, cancer, and autoimmune disease.
41. The method of claim 39-40, wherein the agent is Armcxl polypeptide or a vector comprising a nucleic acid sequence encoding an Armcxl polypeptide.
42. A method for promoting survival of, or axon regeneration in an injured mature central nervous system neuron in a subject determined to have a neuronal injury, the method comprising, administering to the subject Armcxl polypeptide or an analog thereof in an amount sufficient to promote survival of, or axon regeneration of the injured neuron.
43. A device for promoting survival of, or axon regeneration in an injured mature central nervous system (CNS) neuron comprising a therapeutically effective amount of an agent that increases mitochondrial motility in the neuron, and wherein the device locally releases the agent into the CNS for promoting survival of, or axon regeneration in an injured mature central system (CNS) neuron.
44. The device of claim 43, comprising a CNS-implantable solid or semi-solid device selected from a biodegradable matrix, fiber, pump, stent, adsorbable gelatin osmotic pump or indwelling catheter.
45. A pharmaceutical composition comprising an effective amount of Armcxl polypeptide or a vector comprising a nucleic acid sequence encoding the Armcxl polypeptide and a pharmaceutically acceptable carrier, for use in promoting survival of, or regeneration of axon in injured neurons.
46. The pharmaceutical composition of claim 45, wherein the Armcxl polypeptide is of human origin.
47. The pharmaceutical composition of any one of claims 45-46, wherein the Armcxl polypeptide comprises the sequence of SEQ ID NO: l .
48. The pharmaceutical composition of any one of claims 45-47, wherein the Armcxl polypeptide has at least 95% amino acid sequence identity to SEQ ID NO: 1 and retains at least 80% of the biological activity of human Armcxl of SEQ ID NO: l .
49. The pharmaceutical composition of any one of claims 45-48, wherein the Armcxl polypeptide is fused to a carrier polypeptide.
50. The pharmaceutical composition of any one of claims 45-49, wherein the vector is a viral or non-viral vector.
51. The pharmaceutical composition of claim 50, wherein the viral vector is selected from the group consisting of retrovirus, lentivirus, adenovirus, herpesvirus, poxvirus, alpha virus, vaccinia virus, and adeno-associated viruses.
52. The pharmaceutical composition of claim 50, wherein the non-viral vector is selected from the group consisting of a nanoparticle, a cationic lipid, a cationic polymer, a metallic nanoparticle, a nanorod, a liposome, microbubbles, a cell penetrating peptide and a liposphere.
53. The pharmaceutical composition of any one of claims 45-52, wherein the Armcxl polypeptide or the vector comprising a nucleic acid sequence encoding the Armcxl polypeptide is formulated with a lipophilic molecular group and/or encapsulated in a liposome or a nanoparticle.
54. The pharmaceutical composition of any one of claims 45-53, formulated for
administration to the brain, spinal cord, or optical nerve.
55. The pharmaceutical composition of any one of claims 45-54, wherein the composition is formulated for administration via intracerebroventricular, intranasal, intracranial, intracelial, intracerebellar, or intrathecal administration route.
56. The pharmaceutical composition of any one of claims 45-55, wherein the composition is contained in a delivery device selected from the group consisting of a syringe, a blunt tip syringe, a catheter, an inhaler, a nebulizer, a nasal spray pump, a nasal irrigation pump or nasal lavage pump, and an implantable pump.
57. A pharmaceutical composition comprising an agent that increases mitochondrial motility in injured neuron and a pharmaceutically acceptable carrier, for use in promoting survival of, or regeneration of axon in injured neurons.
58. The pharmaceutical composition of claim 57, wherein the agent is Armcxl polypeptide or a vector comprising a nucleic acid sequence encoding the Armcxl polypeptide.
59. A pharmaceutical composition formulated for ocular administration to a subject in need thereof, comprising an effective amount of Armcxl polypeptide or a vector comprising nucleic acid sequence encoding the Armcxl polypeptide, wherein the effective amount is the amount required for promoting survival of, or axon regeneration of axon in an injured mature CNS neuron in the subject.
60. A method for identifying an agent effective in promoting survival of, or axon
regeneration in neurons after injury, the method comprising:
(a) contacting a neuron with a candidate agent;
(b) determining expression level of Armcxl in the neurons from step (a); and
(c) identifying the candidate agent as effective if the expression level of Armcxl is increased relative to a reference level upon the contact of the neuron with the candidate agent; or identifying the candidate agent as ineffective if the expression level of Armcxl is not changed relative to a reference level upon the contact of the neuron with the candidate agent.
61. The method of claim 59, wherein the reference level is expression level of Armcxl in neurons prior to contact with the candidate agent.
62. The method of any one of claims 59-60, wherein the contacting is in vitro or in vivo.
PCT/US2017/065113 2016-12-07 2017-12-07 Neuronal survival and axonal regeneration through increasing mitochondrial motility Ceased WO2018106918A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US16/467,750 US11413325B2 (en) 2016-12-07 2017-12-07 Neuronal survival and axonal regeneration through increasing mitochondrial motility

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201662431206P 2016-12-07 2016-12-07
US62/431,206 2016-12-07

Publications (1)

Publication Number Publication Date
WO2018106918A1 true WO2018106918A1 (en) 2018-06-14

Family

ID=62491654

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/065113 Ceased WO2018106918A1 (en) 2016-12-07 2017-12-07 Neuronal survival and axonal regeneration through increasing mitochondrial motility

Country Status (2)

Country Link
US (1) US11413325B2 (en)
WO (1) WO2018106918A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020149925A1 (en) * 2019-01-14 2020-07-23 Children's Medical Center Corporation High-throughput screening of regulators of axonal transport
WO2021046322A1 (en) * 2019-09-05 2021-03-11 The Board Of Trustees Of The Leland Stanford Junior University A small molecule therapeutic for parkinson's disease paired with a biomarker of therapeutic activity
EP3840729A4 (en) * 2018-08-23 2022-05-18 Rutgers, The State University of New Jersey TREATMENT OF SCIENCE AND BRAIN INJURY USING GSX1

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070178535A1 (en) * 2005-12-07 2007-08-02 Yadong Huang Methods of identifying agents that modulate mitochondrial function

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070178535A1 (en) * 2005-12-07 2007-08-02 Yadong Huang Methods of identifying agents that modulate mitochondrial function

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CARTONI ET AL.: "The mammalian-specific protein Armcx1 regulates mitochondrial transport during axon regeneration", NEURON, vol. 92, 21 December 2016 (2016-12-21), pages 1294 - 1307, XP029859795 *
CHANG ET AL.: "Mitochondrial trafficking and morphology in healthy and injured neurons", PROGRESS IN NEUROBIOLOGY, vol. 80.5, 2006, pages 241 - 268, XP027920078 *
LOPEZ-DOMENECH ET AL.: "The Eutherian Armcx genes regulate mitochondrial trafficking in neurons and interact with Miro and Trak2", NATURE COMMUNICATIONS, vol. 3, 2012, pages 814, XP055510621 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3840729A4 (en) * 2018-08-23 2022-05-18 Rutgers, The State University of New Jersey TREATMENT OF SCIENCE AND BRAIN INJURY USING GSX1
WO2020149925A1 (en) * 2019-01-14 2020-07-23 Children's Medical Center Corporation High-throughput screening of regulators of axonal transport
WO2021046322A1 (en) * 2019-09-05 2021-03-11 The Board Of Trustees Of The Leland Stanford Junior University A small molecule therapeutic for parkinson's disease paired with a biomarker of therapeutic activity
US12544375B2 (en) 2019-09-05 2026-02-10 The Board Of Trustees Of The Leland Junior University Small molecule therapeutic for parkinson's disease paired with a biomarker of therapeutic activity

Also Published As

Publication number Publication date
US20200061154A1 (en) 2020-02-27
US11413325B2 (en) 2022-08-16

Similar Documents

Publication Publication Date Title
Zhang et al. Generation of a novel mouse model of Parkinson’s disease via targeted knockdown of glutamate transporter GLT-1 in the substantia nigra
US20220220173A1 (en) Tdp-43 mitochondrial localization inhibitor for the treatment of neurogenerative disease
Wu et al. Recombinant adiponectin peptide promotes neuronal survival after intracerebral haemorrhage by suppressing mitochondrial and ATF4‐CHOP apoptosis pathways in diabetic mice via Smad3 signalling inhibition
US20160256571A1 (en) Invention
US20180201937A1 (en) Inhibitors of cacna1a/alpha1a subunit internal ribosomal entry site (ires) and methods of treating spinocerebellar ataxia type 6
US9988626B2 (en) Neurocalcin delta inhibitors and therapeutic and non-therapeutic uses thereof
EP3999102A1 (en) Use of frataxin for treating leigh syndrome, french canadian type
US11413325B2 (en) Neuronal survival and axonal regeneration through increasing mitochondrial motility
KR20230159847A (en) Compositions and methods for targeting inflammatory or activated cells and treating or ameliorating inflammatory conditions and pain
US20170246200A1 (en) Microrna-132/212 for the treatment of neurodegenerative disorders
CN102946896A (en) SOX9 inhibitor
EP3622958B1 (en) Use of potassium ion channel inhibitor for treatment of depression and pharmaceutical composition
US12496328B2 (en) Compositions for the treatment of sarcopenia or disuse atrophy
US20200138921A1 (en) Methods of preventing and treating diseases characterized by synaptic dysfunction and neurodegeneration including alzheimer&#39;s disease
US20090281163A1 (en) Regulatory elements that mediate retinal cell-specific gene expression
WO2022174036A2 (en) Methods and materials for treating tdp-43 proteinopathies
EP2522359A1 (en) Compounds with thioredoxin-like fold domain for the treatment of degenerative disorders
WO2017103224A1 (en) Method of treatment of amyotrophic lateral sclerosis
US20190314421A1 (en) Nucleic acid constructs including a txnip promoter for the treatment of disease
Long et al. Advances in RPGR gene therapy for X-linked retinitis pigmentosa: From preclinical insights to clinical application
Sironi Loss of C9orf72 Function Impairs the Peripheral Neuromuscular System and Anticipates Symptoms in ALS Mice
US20250283074A1 (en) Clusterin overexpression in alzheimer’s disease
WO2017185027A1 (en) A gene therapy based antidepressant
Loan et al. Treatment options in motor neuron disease: Amyotrophic lateral sclerosis and spinal muscular atrophy
CN119630405A (en) HMGB1 inhibitors for the treatment of APOE4-related tauopathies including Alzheimer&#39;s disease

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17878513

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17878513

Country of ref document: EP

Kind code of ref document: A1