WO2018104499A1 - Méthodes de traitement et de limitation du développement de l'obésité et de troubles de stéatose hépatique - Google Patents

Méthodes de traitement et de limitation du développement de l'obésité et de troubles de stéatose hépatique Download PDF

Info

Publication number
WO2018104499A1
WO2018104499A1 PCT/EP2017/081958 EP2017081958W WO2018104499A1 WO 2018104499 A1 WO2018104499 A1 WO 2018104499A1 EP 2017081958 W EP2017081958 W EP 2017081958W WO 2018104499 A1 WO2018104499 A1 WO 2018104499A1
Authority
WO
WIPO (PCT)
Prior art keywords
apociii
hfd
subject
aso
obesity
Prior art date
Application number
PCT/EP2017/081958
Other languages
English (en)
Inventor
Lisa JUNTTI-BERGGREN
Per Olof Berggren
Original Assignee
Juntti Berggren Lisa
Per Olof Berggren
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Juntti Berggren Lisa, Per Olof Berggren filed Critical Juntti Berggren Lisa
Publication of WO2018104499A1 publication Critical patent/WO2018104499A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism

Definitions

  • T2D type 2 diabetes
  • methods for treating or limiting development of obesity comprising administering to an obese subject, or to a subject at risk of obesity, an amount effective of an apolipoprotein CIII (apoCIII) inhibitor to reduce apoCIII expression and/or activity to control levels, thereby reducing body weight or reducing the rate of body weight increase in the obese subject or the subject at risk of obesity.
  • the subject is obese.
  • the subject is at risk of obesity, such as having a parent that is obese, having a sedentary lifestyle, consuming a high fat diet, having Prader-Willi syndrome or Cushing's syndrome, taking medications that lead to weight gain, including but not limited to antidepressants, anti-seizure medications, diabetes medications, antipsychotic medications, steroids and beta blockers, being age 55 or older (55, 60, 65, 70 years of age, or older), being sleep deprived (including but not limited to having sleep apnea), and/or quitting smoking.
  • the subject is on a high fat diet, wherein the apoCIII inhibitor limits the diet-induced increase of apoCIII in the subject.
  • the subject has diabetes, such as type 2 diabetes or type 1 diabetes.
  • the treating comprises normalizing glucose tolerance and/or limiting fatty liver disease.
  • reducing body weight or reducing the rate of body weight increase comprises reducing fat levels in the subject, or reducing the increase in fat levels in the subject.
  • the apoCIII inhibitor is selected from the group consisting of anti-apoCIII antibody, anti-apoCIII aptamer, apoCIII small interfering RNA, apoCIII small internally segmented interfering RNA, apoCIII short hairpin RNA, apoCIII microRNA, and apoCIII antisense oligonucleotides.
  • the apoCIII inhibitor comprises or consists of ASO-ISIS 353982 (AS02).
  • fatty liver disease FLD
  • nonalcoholic fatty liver NAFL
  • NASH nonalcoholic steatohepatitis
  • methods for treating FLD, NAFL, and/or NAFLD comprising administering to a subject having FLD, NAFL, and/or NAFLD (such as NASH) an amount effective of an apoCIII inhibitor to treat FLD, NAFL, and/or NAFLD (such as NASH).
  • methods for limiting development of FLD, NAFL, and/or NAFLD comprising administering to a subject at risk of FLD, NAFL, and/or NAFLD (such as NASH) an amount effective of an apoCIII inhibitor to limit development of FLD, NAFL, and/or NAFLD (such as NASH).
  • the method is for treating or limiting development of NAFLD (such as NASH).
  • the apoCIII inhibitor reduces apoCIII expression and/or activity in the subject to control levels.
  • the subject has a risk factor for fatty liver disease selected from the group consisting of diabetes, obesity, insulin-resistance, a patatin-like phospholipase domain-containing 3 (PNPLA3) 148 MM variant, single-nucleotide polymorphisms (SNPs) T455C and C482T in apolipoprotein CIII (APOC3), hypertension, dyslipidemia, abetalipoproteinemia, , glycogen storage diseases, Weber-Christian disease, acute fatty liver of pregnancy, lipodystrophy, malnutrition, severe weight loss, refeeding syndrome, jejunoileal bypass, gastric bypass, jejunal diverticulosis with bacterial overgrowth, exposure to drugs or toxins (including but not limited to exposure to amiodarone, methotrexate, diltiazem, expired tetracycline, highly active antiretroviral therapy, glucocorticoids, tamoxifen- and environmental 148 MM variant,
  • the subject is on a high fat diet, wherein the apoCIII inhibitor limits the diet-induced increase of apoCIII in the subject.
  • the apoCIII inhibitor is selected from the group consisting of anti- apoCIII antibody, anti-apoCIII aptamer, apoCIII small interfering RNA, apoCIII small internally segmented interfering RNA, apoCIII short hairpin RNA, apoCIII microRNA, and apoCIII antisense oligonucleotides.
  • the apoCIII inhibitor comprises or consists of ASO-ISIS 353982 (AS02).
  • a compound for treating obesity limiting development of obesity, treating FLD, NAFL, and/or NAFLD (such as NASH), or limiting development of FLD, NAFL, and/or NAFLD (such as NASH), comprising
  • test compounds that reduce plasma apoCIII levels and/or activity in the second test animal compared to plasma apoCIII levels and/or activity in the first test animal are candidate compounds for treating or limiting development of obesity or FLD, NAFL, and/or NAFLD (such as NASH).
  • the method further comprises
  • test compounds that lead to plasma apoCIII levels and/or activity in the second test animal similar to plasma apoCIII levels and/or activity in the third test animal are candidate compounds for treating or limiting development of obesity or FLD, NAFL, and/or NAFLD (such as NASH).
  • the candidate compounds are candidate compounds for treating obesity or FLD, NAFL, and/or NAFLD (such as NASH) in a diabetic subject.
  • the test animals are mice.
  • the high fat diet comprises on a caloric basis between about 40% and about 80% fat, about 10% to about 30% carbohydrate, and about 10% to about 30% protein.
  • the high fat diet comprises on a caloric basis about 60% fat, about 20% carbohydrate, and about 20% protein.
  • the non-high fat diet comprises, on a caloric basis, about 5% to about 15% fat, about 50% to about 75% carbohydrates, and about 15% to about 40% protein.
  • the non-high fat diet comprises, on a caloric basis, about 11.4% fat, about 63% carbohydrates, and about 26% protein.
  • FIG. 1 Lowering apoCIII reverses diet-induced obesity, insulin resistance and IGT in mice on HFD.
  • Black arrow indicates the time point when the ASO targeting apoCIII started to be administered in untreated mice on HFD for 10 weeks (see methods)
  • b Representative picture of ASO+HFD (left) and Scr+HFD (right) mice at the end of the study
  • c Representative immunoblot and densitometry analysis of circulating apoCIII in albumin-depleted plasma samples from
  • H&E Hematoxylin and eosin
  • FIG. 2 Four weeks of ASO treatment improves insulin sensitivity and glucose tolerance despite consumption of a HFD.
  • Black arrow at 10 weeks of diet intervention indicates the time point when the HFD-fed mice were divided into two groups, one receiving the Scr ASO and the other one receiving the active ASO against apoCIII for 4 additional weeks until completion of the study.
  • Mice on control diet were given saline (see methods),
  • CAMS Lab Animal Monitoring System
  • g Averaged V0 2 (left) and representative traces for VO2 (right), h, Averaged VCO2 (left) and representative traces for VCO2 (right), i, Averaged daily food intake (left) and cumulative food intake (right), j, Averaged energy expenditure (left) and representative traces for energy expenditure. All data are mean + s.e.m. One-way ANOVA followed by Tukey's post-hoc test for a-f; Non- parametric Friedman test followed by Dunn's multiple comparison test for g-h. *P ⁇ 0.05 Scr+HFD versus Control mice and #P ⁇ 0.05 ASO+HFD versus Scr+HFD mice.
  • mRNA transcript levels of e, apoCIII; f, Lipc; g, Ppara; h, Rxr; i, Cptl; j, Ldlr; k, Srbl; 1, Cd36; and m, ATP-binding cassette sub-family G member 5 (Abcg5, left) and 8 (Abcg8, right) were quantified and represented as fold increase/decrease relative to Control mice (dashed line), ⁇ -actin was used as a housekeeping gene. All data are mean + s.e.m. and analyzed by one-way ANOVA followed by Tukey's post-hoc test. *P ⁇ 0.05 Scr+HFD versus Control mice and #P ⁇ 0.05 ASO+HFD versus Scr+HFD mice.
  • FIG. 4 Lowering apoCIII with ASO treatment prevents diet-induced obesity, insulin resistance and IGT.
  • Black arrow indicates that the treatment with either the Scr ASO or the active ASO against apoCIII started simultaneously with the HFD intervention.
  • ASO treatment reducing apoCIII prevents dyslipidemia and ectopic fat accumulation by inducing liver lipid catabolism
  • methods for treating or limiting development of obesity comprising administering to an obese subject or a subject at risk of obesity an amount effective of an apolipoprotein CIII (apoCIII) inhibitor to reduce apoCIII expression and/or activity to control levels, thereby reducing body weight or reducing the rate of body weight increase in the obese subject or the subject at risk of obesity.
  • apoCIII apolipoprotein CIII
  • reducing apoCIII expression and/or activity to control levels can both limit and reverse the deleterious effects of diet in obese subjects or subjects at risk of obesity, thus reducing body weight or reducing the rate of body weight increase in the obese subject or the subject at risk of obesity.
  • Targeting apoCIII may thus be central to avoiding the negative consequences of an unhealthy diet, for example, in association with diabesity.
  • the obese subject is a subject that has a body mass index (BMI) of 30 and above, where BMI is a person' s height in kilograms divided by their height in meters squared.
  • BMI body mass index
  • the subject at risk of obesity is one that has one or more risk factors for developing obesity, including but not limited to having a parent that is obese, having a sedentary lifestyle, consuming a high fat diet, having Prader-Willi syndrome or Cushing's syndrome, taking medications that lead to weight gain, including but not limited to antidepressants, anti-seizure medications, diabetes medications, antipsychotic medications, steroids and beta blockers, being age 55 or older (55, 60, 65, 70 years of age, or older), being sleep deprived (including but not limited to having sleep apnea), and/or quitting smoking.
  • treating obesity means accomplishing one or more of the following: (a) reducing the severity of obesity or obesity complications; (b) limiting or preventing development of obesity complications; (c) inhibiting worsening of obesity complications or of symptoms characteristic of obesity; (d) limiting or preventing recurrence of obesity complications or of symptoms characteristic of obesity; (e) limiting or preventing recurrence of obesity complications or of symptoms characteristic of obesity in patients that were previously symptomatic; (f) reducing body weight or reducing the rate of body weigh increase; (g) normalizing glucose tolerance, (h) reducing liver steatosis; and/or (i) reducing fat levels in the subject, or reducing the increase in fat levels in the subject.
  • limiting development of obesity means accomplishing one or more of the following: (a) slowing or preventing the onset of obesity or obesity complications; (b) reducing body weight or reducing the rate of body weigh increase; (c) normalizing glucose tolerance, (d) reducing liver steatosis; and/or (e) reducing fat levels in the subject, or reducing the increase in fat levels in the subject.
  • non-alcoholic fatty liver disease such as non-alcoholic steatohepatitis (NASH)
  • methods for treating or limiting development of FLD fatty liver disease (FLD ), non-alcoholic fatty liver ( NAFL).
  • NAFLD non-alcoholic steatohepatitis
  • methods for treating or limiting development of FLD comprising administering to a subject having FLD, NAFL, and/or NAFLD (such as NASH) or at risk of FLD, NAFL, and/or NAFLD (such as NASH) an amount effective of an apoCIII inhibitor to treat or limit development of FLD, NAFL, and/or NAFLD (such as NASH).
  • reducing apoCIII expression and/or activity can both treat and limit development of FLD, NAFL, and/or NAFLD (such as NASH).
  • fatty liver disease is a condition associated with intracytoplasmic accumulation of large vacuoles of triglyceride fat in liver cells via steatosis (i.e., abnormal retention of lipids within a cell).
  • the fatty liver disease may be steatosis (non-alcoholic fatty liver (NAFL)).
  • NAFLD nonalcoholic fatty liver disease
  • non-alcoholic fatty liver disease including but not limited to non-alcoholic
  • NAFLD steatohepatitis
  • NAFLD is one of the types of fatty liver which occurs when fat is deposited (steatosis) in the liver due to causes other than excessive alcohol use.
  • alcohol consumption of over 20 g/day about 25 ml/day of net ethanol excludes the condition.
  • the fatty liver disease, such as NAFLD may involve worsening liver fibrosis, which can progress to development of cirrhosis and increased risk of end stage liver disease.
  • the subject at risk of FLD, NAFL, and/or NAFLD is one that has one or more risk factors for developing FLD, NAFL, and/or NAFLD, including but not limited to diabetes, obesity, insulin-resistance, a patatin-like phospholipase domain- containing 3 (PNPLA3) 148MM variant, single-nucleotide polymorphisms (SNPs) T455C and C482T in apolipoprotein CIII (APOC3), hypertension, dyslipidemia,
  • PNPLA3 patatin-like phospholipase domain- containing 3
  • SNPs single-nucleotide polymorphisms
  • APOC3 apolipoprotein CIII
  • abetalipoproteinemia , glycogen storage diseases, Weber-Christian disease, acute fatty liver of pregnancy, lipodystrophy, malnutrition, severe weight loss, refeeding syndrome, jejunoileal bypass, gastric bypass, jejunal diverticulosis with bacterial overgrowth, exposure to drugs or toxins (including but not limited to exposure to amiodarone, methotrexate, diltiazem, expired tetracycline, highly active antiretroviral therapy, glucocorticoids, tamoxifen- and
  • treating FLD, NAFL, and/or NAFLD means accomplishing one or more of the following: (a) reducing the severity of FLD, NAFL, and/or NAFLD (such as NASH) or FLD, NAFL, and/or NAFLD (such as NASH) complications; (b) limiting or preventing development of FLD, NAFL, and/or NAFLD (such as NASH) complications; (c) inhibiting worsening of FLD, NAFL, and/or NAFLD (such as NASH) complications or of symptoms characteristic of FLD, NAFL, and/or NAFLD (such as NASH); (d) limiting or preventing recurrence of FLD, NAFL, and/or NAFLD (such as NASH) complications or of symptoms characteristic of FLD, NAFL, and/or NAFLD (such as NASH); (e) limiting or preventing recurrence of FLD, NAFL, and/or NAFLD (such as NASH) complications or
  • NASH means slowing or preventing the onset of FLD, NAFL, and/or NAFLD (such as NASH) or FLD, NAFL, and/or NAFLD (such as NASH) complications.
  • Steatosis 0 ⁇ 5% Refers to amount of surface area involved by steatosis as
  • Total NAS score represents the sum of scores for steatosis, lobular inflammation, and ballooning, and ranges from 0-8. Diagnosis of NASH (or, alternatively, fatty liver not diagnostic of NASH) should be made first, then NAS is used to grade activity. In the reference study, NAS scores of 0-2 occurred in cases largely considered not diagnostic of NASH, scores of 3-4 were evenly divided among those considered not diagnostic, borderline, or positive for NASH. Scores of 5-8 occurred in cases that were largely considered diagnostic of NASH
  • the apoCIII inhibitor reduces apoCIII expression and/or activity in the subject to control levels.
  • Any suitable control level can be used, including apoCIII expression and/or activity levels from a subject or population of subjects known not to be obese, not having known risk factors for developing obesity, or known not to have FLD or risk factors for FLD.
  • reducing apoCIII expression to control levels means to reduce apoCIII expression and/or activity in the obese subject, the subject at risk of obesity, the subject having FLD, or the subject at risk of FLD between 10%-90% compared to apoCIII expression and/or activity prior to treatment.
  • reducing apoCIII expression and/or activity to control levels means to reduce apoCIII expression and/or activity in the obese subject, the subject at risk of obesity, the subject having FLD, or the subject at risk of FLD between about 10 -80 , 10%-70%, 10%-60%, 10%-50%, 10%-40%, 10%-30%, 10%-20%, 20 -90 , 20 -80 , 20 -70 , 20 -60 , 20 -50 , 20 -40 , 20 -30 , 30 -90 , 30 -80 , 30 -70 , 30 -60 , 30 -50 , 30 -40 , 40 -90 , 40 -80 , 40 -70 , 40 -60 , 40 -50 , 50%-90%, 50%-80%, 50%-70%, 50%-60%, 60%-90%, 60%-80%, 60%-70%, 70%-90%, 70%-80%, 80%-90%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%,
  • reducing apoCIII expression and/or activity to control levels means to reduce apoCIII expression and/or activity in the obese subject, the subject at risk of obesity, the subject having FLD, or the subject at risk of FLD, between about 30% to about 80% compared to apoCIII expression and/or activity prior to treatment.
  • apoCIII expression and/or activity is detected in blood or serum samples.
  • albumin is removed from serum samples using standard techniques, such as via use of Montage Albumin Deplete Kit (Millipore) or AlbuSorbTM (Biotech Support Group). The collected sera samples can then be freeze-dried overnight and run on sep-PakTM CI 8.
  • the eluted proteins can be freeze-dried and thereafter dissolved in 100 ⁇ . 0.1% TFA and run on an ACE C18 10- x 0.21-cm column 20- 60%, and the area under the curve, where apoCIII elutes, evaluated.
  • ApoCIII can be identified using any suitable technique, including but not limited to MALDI mass spectrometry.
  • an "inhibitor" of ApoCIII expression and/or activity includes compounds that reduce the transcription of ApoCIII DNA into RNA, compounds that reduce translation of the ApoCIII RNA into protein, and compounds that reduce activity of ApoCIII protein.
  • the inhibitor is a partial inhibitor, such that the expression and/or activity ApoCIII reduced to control levels, as noted above, and as exemplified herein.
  • Such inhibitors are selected from the group consisting of antisense oligonucleotides directed against the ApoCIII DNA, or mRNA; small interfering RNAs (siRNAs), short hairpin RNAs (shRNAs), microRNAs (miRNA) or small internally segmented interfering RNAs (sisiRNA) directed against the ApoCIII, protein, DNA, or mRNA, ApoCIII antibodies, aptamers that bind to ApoCIII, and any other chemical or biological compound that can interfere with ApoCIII expression and/or activity.
  • siRNAs small interfering RNAs
  • shRNAs short hairpin RNAs
  • miRNA microRNAs
  • miRNA small internally segmented interfering RNAs
  • the apoCIII inhibitor is selected from the group consisting of apoCIII small interfering RNA, apoCIII small internally segmented interfering RNA, apoCIII short hairpin RNA, apoCIII microRNA, apoCIII antisense oligonucleotides, ApoCIII antibodies, and aptamers that bind to ApoCIII.
  • the subject may be any subject that can benefit from the methods of treatment disclosed herein, including humans, cattle, dogs, cats, guinea pigs, rabbits, rats, mice, horses, chickens, and so on. Most preferably, the subject is human. In another specific embodiment, the subject has diabetes, such as type 1 or 2 diabetes.
  • the subject is on a high fat diet (i.e.: a diet rich in fats, especially saturated fats); in this embodiment, the apoCIII inhibitor limits the diet-induced increase of apoCIII.
  • the high fat diet may be one that provides on a caloric basis at least 30% of energy as fat (i.e.: at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, or more).
  • the high fat diet comprises on a caloric basis between about 40% and about 80% fat, about 10% to about 30% carbohydrate, and about 10% to about 30% protein.
  • the high fat diet comprises on a caloric basis about 60% fat, about 20% carbohydrate, and about 20% protein.
  • the methods disclosed herein can significantly reduce the risk of obesity and/or FLD, NAFL, and/or NAFLD (such as NASH) complications, including but not limited to limiting development of, limiting the rate of development of, and/or limiting severity of coronary heart disease, high blood pressure, stroke, sleep apnea, gallstones, and osteoarthritis in the obese subject, and limiting the rate of development of, and/or reducing hepatocyte necrosis, hepatic fibrosis, liver lipid/fat content, liver inflammation, reducing the rate of increase in liver lipid/fat content, reducing the rate of increase of liver inflammation, limiting any
  • reducing the histologically defined NAS activity score >/ 2 (see below) with no worsening of liver fibrosis; reducing liver fibrosis, reducing the rate of increase in liver fibrosis, reducing liver failure, slowing the progression to liver failure, and reducing the rate of or progression to cirrhosis.
  • the apoCIII inhibitor is an antisense oligonucleotide.
  • Any suitable apoCIII antisense oligo nucleotide inhibitor can be used that results in the partial inhibition of apoCIII expression and/or activity to control levels as defined above.
  • Exemplary such antisense oligonucleotides include (but are not limited to) the following (see US
  • CACGATGAGGAGCATTCGGG 60 AGGGCCACGATGAGGAGCAT 61 CCACGAGGGCCACGATGAGG 62 GAGAGCCACGAGGGCCACGA 63 GCCAGGAGAGCCACGAGGGC 64 CAGAGGCCAGGAGAGCCACG 65 TCGGGCAGAGGCCAGGAGAG 66 TCAGCTCGGGCAGAGGCCAG 67 CCTCATCAGCTCGGGCAGAG 68 CTCTCCCTCATCAGCTCGGG 69 GATCCCTCCCTCATCAGC 70 GCAAGGATCCCTCCCTCA 71 CAGCAGCAAGGATCCCTCTCTC 72 GAGCCCAGCAGCAAGGATCC 73 GCATAGAGCCCAGCAGCAAG 74 GCCCTGCATAGAGCCCAGCA 75 ATGTAGCCCTGCATAGAGCC 76 GTTCCATGTAGCCCTGCATA 77 GGCTTGTTCCATGTAGCCCT 78 # REGION SEQUENCE
  • the antisense inhibitors listed above are chimeric oligonucleotides ("gapmers") 20 nucleotides in length, composed of a central "gap" region consisting of eight 2'-deoxynucleotides, which is flanked on both sides (5' and 3' directions) by 3-nucleotide "wings.”
  • the wings are composed of 2 '-0-(2-methoxyethyl) nucleotides, also known as (2'-MOE) nucleotides.
  • all cytidine residues may be 5-methylcytidines.
  • the apoCIII inhibitor comprises or consists of 353982 (referred to below as AS02), GAGAATATACTTTCCCCTTA (SEQ ID NO: 50).
  • the antisense apoCIII inhibitors may comprise an oligonucleotide that is less than 100% complementary to the human apoCIII mRNA (i.e.: having 1, 2, 3, 4, or 5 residues that are not complementary out of between 12-25 nucleotides of the inhibitor), which can result in the partial inhibition taken advantage of in the methods disclosed herein.
  • the inhibitor may be administered by any suitable route, including but not limited to oral, topical, parenteral, intranasal, pulmonary, or rectal in dosage unit formulations containing conventional non-toxic pharmaceutically acceptable carriers, adjuvants and vehicles.
  • parenteral as used herein includes percutaneous, subcutaneous, intravascular (e.g., intravenous), intramuscular, or intrathecal injection or infusion techniques and the like.
  • a pharmaceutical formulation comprising an inhibitor disclosed herein and a pharmaceutically acceptable carrier.
  • the inhibitor may be present in association with one or more non-toxic pharmaceutically acceptable carriers and/or diluents and/or adjuvants, and if desired other active ingredients.
  • the inhibitor may be in a form suitable for oral use, for example, as tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsion, hard or soft capsules, or syrups or elixirs.
  • the inhibitor can also be administered locally via implantation of a membrane, sponge, or other appropriate material onto which the inhibitor has been absorbed or encapsulated, and delivery of the desired molecule can be via diffusion, timed- release bolus, nano-containers or continuous administration.
  • the dosage range depends on the choice of inhibitor, the route of administration, the nature of the formulation, the nature of the subject's condition, and the judgment of the attending practitioner. For example, oral administration would be expected to require higher dosages than administration by intravenous injection. Variations in these dosage levels can be adjusted using standard empirical routines for optimization, as is well understood in the art
  • Acceptable formulation materials preferably are nontoxic to recipients at the dosages and concentrations employed.
  • the therapeutic composition can contain formulation materials for modifying, maintaining, or preserving, for example, the pH, osmolality, viscosity, clarity, color, isotonicity, odor, sterility, stability, rate of dissolution or release, adsorption, or penetration of the composition.
  • Suitable formulation materials include, but are not limited to, amino acids (such as glycine, glutamine, asparagine, arginine, or lysine), antimicrobials, antioxidants (such as ascorbic acid, sodium sulfite, or sodium hydrogen-sulfite), buffers (such as borate, bicarbonate, Tris-HCl, citrates, phosphates, or other organic acids), bulking agents (such as mannitol or glycine), chelating agents (such as ethylenediamine tetraacetic acid (EDTA)), complexing agents (such as caffeine, polyvinylpyrrolidone, beta-cyclodextrin, or hydroxypropyl-beta-cyclodextrin), fillers, monosaccharides, disaccharides, and other carbohydrates (such as glucose, mannose, or dextrins), proteins (such as serum albumin, gelatin, or immunoglobulins), coloring, flavoring and diluting agents, emuls
  • compositions will be determined by a skilled artisan depending upon, for example, the intended route of administration, delivery format, and desired dosage. Such compositions can influence the physical state, stability, rate of in vivo release, and rate of in vivo clearance of the inhibitor.
  • test compounds that reduce plasma apoCIII levels and/or activity in the second test animal compared to plasma apoCIII levels and/or activity in the first test animal are candidate compounds for treating or limiting development of obesity and/or fatty liver disease.
  • reducing apoCIII expression and/or activity to control levels can both limit and reverse the deleterious effects of diet in obese subjects, subjects at risk of obesity, subjects with fatty liver disease, or subjects at risk of fatty liver disease, thus reducing body weight, reducing the rate of body weight increase in the obese subject or subject at risk of obesity, and treating or limiting development of fatty liver disease.
  • Targeting apoCIII may thus be central to avoiding the negative consequences of an unhealthy diet, such as diabesity and/or fatty liver disease, and the methods can be used to identify therapeutics for treating or limiting development of obesity and/or fatty liver disease.
  • reducing plasma apoCIII levels and/or activity in the second test animal compared to plasma apoCIII levels in the first test animal means to reduce apoCIII expression and/or activity in the second test animal between 10%-90% compared to apoCIII expression and/or activity in the first test animal.
  • reducing apoCIII expression and/or activity in the second test animal means to reduce apoCIII expression and/or activity in the obese subject between about 10%-80%, 10%-70%, 10%- 60%, 10%-50%, 10%-40%, 10%-30%, 10%-20%, 20%-90%, 20%-80%, 20%-70%, 20%- 60%, 20%-50%, 20%-40%, 20%-30%, 30%-90%, 30%-80%, 30%-70%, 30%-60%, 30%- 50%, 30%-40%, 40%-90%, 40%-80%, 40%-70%, 40%-60%, 40%-50%, 50%-90%, 50%- 80%, 50%-70%, 50%-60%, 60%-90%, 60%-80%, 60%-70%, 70%-90%, 70%-80%, 80%- 90%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, or about 90% compared to apoCIII expression and/or activity in the first test animal.
  • Reducing plasma apoCIII levels and/or activity in the second test animal compared to plasma apoCIII levels in the first test animal means to reduce apoCIII expression and/or activity in the second test animal between about 30% and about 80% compared to apoCIII expression and/or activity in the first test animal
  • the test animals may be any suitable animal model of obesity, obesity risk, fatty liver disease, or fatty liver disease risk including dogs, cats, guinea pigs, rabbits, rats, and mice models of obesity, obesity risk, fatty liver disease, or fatty liver disease risk.
  • the animal model is a model of diabetic obesity or obesity risk.
  • the method further comprises
  • test compounds that lead to plasma apoCIII levels and/or activity in the second test animal similar to plasma apoCIII levels and/or activity in the third test animal are candidate compounds for treating or limiting development of obesity or fatty liver disease.
  • the first and second test animals may be on any suitable high fat diet.
  • the high fat diet comprises on a caloric basis between about 40% and about 80% fat, about 10% to about 30% carbohydrate, and about 10% to about 30% protein.
  • the high fat diet comprises on a caloric basis about 60% fat, about 20% carbohydrate, and about 20% protein.
  • the third test animal may be on any suitable non-high fat diet.
  • the non-high fat diet comprises, on a caloric basis, about 5% to about 15% fat, about 50% to about 75% carbohydrates, and about 15% to about 40% protein.
  • the non-high fat diet comprises, on a caloric basis, about 11.4% fat, about 63% carbohydrates, and about 26% protein.
  • the methods further comprise large-scale synthesis of the test compounds that reduce plasma apoCIII levels and/or activity in the second test animal compared to plasma apoCIII levels and/or activity in the first test animal.
  • test compound(s) may be any suitable test compounds, including but not limited to nucleic acids, polypeptides, and small molecules.
  • test compounds comprise polypeptide sequences
  • polypeptides may be chemically synthesized or recombinantly expressed. Recombinant expression can be accomplished using standard methods in the art, as disclosed above.
  • expression vectors can comprise bacterial or viral expression vectors, and such host cells can be prokaryotic or eukaryotic. Synthetic polypeptides, prepared using the well-known techniques of solid phase, liquid phase, or peptide
  • condensation techniques can include natural and unnatural amino acids.
  • Amino acids used for peptide synthesis may be standard Boc (Na-amino protected Na- t-butyloxycarbonyl) amino acid resin with standard deprotecting, neutralization, coupling and wash protocols, or standard base-labile Na-amino protected 9-fluorenylmethoxycarbonyl (Fmoc) amino acids. Both Fmoc and Boc ⁇ -amino protected amino acids can be obtained from Sigma, Cambridge Research Biochemical, or other chemical companies familiar to those skilled in the art.
  • the polypeptides can be synthesized with other Na-protecting groups that are familiar to those skilled in this art. Solid phase peptide synthesis may be accomplished by techniques familiar to those in the art and provided, such as by using automated synthesizers.
  • test compounds comprise antibodies
  • such antibodies can be polyclonal or monoclonal.
  • the antibodies can be humanized, fully human, or murine forms of the antibodies.
  • Such antibodies can be made by well-known methods, such as described in Harlow and Lane, Antibodies; A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., (1988).
  • nucleic acids may be chemically synthesized or recombinantly expressed as well. Recombinant expression techniques are well known to those in the art (See, for example, Sambrook, et al., 1989, supra).
  • the nucleic acids may be DNA or RNA, and may be single stranded or double.
  • such nucleic acids can be chemically or enzymatically synthesized by manual or automated reactions, using standard techniques in the art. If synthesized chemically or by in vitro enzymatic synthesis, the nucleic acid may be purified prior to introduction into the cell.
  • the nucleic acids can be purified from a mixture by extraction with a solvent or resin, precipitation, electrophoresis, chromatography, or a combination thereof.
  • the nucleic acids may be used with no or a minimum of purification to avoid losses due to sample processing.
  • test compounds comprise compounds other than polypeptides, antibodies, or nucleic acids
  • test compounds can be made by any of the variety of methods in the art for conducting organic chemical synthesis. All references cited are herein incorporated by reference in their entirety. Within this application, unless otherwise stated, the techniques utilized may be found in any of several well-known references such as: Molecular Cloning: A Laboratory Manual (Sambrook, et al.,
  • T2D obesity and type-2 diabetes
  • Apolipoprotein CIII is an 8.8 kDa polypeptide mainly synthesized in the liver.
  • ITT insulin resistance to impaired glucose tolerance
  • HFD high-fat diet
  • ASO antisense oligonucleotide
  • apoCIII is a player in the progression from insulin resistance to impaired glucose tolerance and overt diabetes upon HFD exposure.
  • the control group was fed a standard chow diet and the three remaining groups were all on HFD. Additionally, two of them were given i.p. injections with either antisense apo CIII, reducing the levels of the apolipoprotein to undetectable levels, or a scrambled (scr) inactive, not affecting the levels of the apolipoprotein (data not shown).
  • ApoCIII in plasma was evaluated by Western blotting, as there is no reliable method for quantitative measurements. Treatments started when the mice were 8 weeks old.
  • Body weight (BW) was measured once per week and after two months the first intraperitoneal glucose tolerance test (IPGTT) was performed. After this time period there was an equivalent increase in BW in all mice on HFD and only the control group had a normal glucose handling and, as expected, a lower weight.
  • IPGTT intraperitoneal glucose tolerance test
  • Tgs triglycerides associated to very low-density lipoproteins
  • IDL/LDL-Tgs intermediate/low-density lipoproteins
  • 2-week on ASO treatment was not enough to improve IPITT and IPGTT in ASO+HFD mice as compared to Scr- treated ones on HFD.
  • mice treated for 4 weeks with the active ASO against apoCIII showed an improved performance in the IPITT (Fig. 2e) and in the IPGTT (Fig. 2f) as compared to Scr+HFD mice.
  • these improvements occurred when ASO+HFD mice were still obese and deheaded in the absence of recovery in any of the parameters determined in the metabolic cages (Fig. 2g-j).
  • Scr+HFD and ASO+HFD groups significantly increased BW and weight gain during the first 3 weeks of study (Fig. 4).
  • ASO-treated mice on HFD exhibited increased 0 2 consumption, CO2 production and, consequently, a higher RER as compared to Scr+HFD animals.
  • These changes, all indicative of higher fuel utilization in ASO+HFD mice, were not attributable to changes in food intake, calorie intake or physical activity, but to higher energy expenditure.
  • ASO+HFD mice showed significantly reduced adipocyte size in VATand SAT sections as compared to Scr+HFD, being the area of the visceral and the subcutaneous adipocytes of the ASO-treated mice comparable to those from chow diet-fed mice.
  • Gene expression data showed a robust upregulation ( ⁇ 10-fold) in Ucpl expression levels in VAT from ASO+H D as compared to Scr-HFD mice (. These changes were accompanied by an increase in other thermogenic genes as well as beige/brite markers, such as Pgcla, Prdml6, Cdl37 and Tmem26.
  • gene expression analysis in SAT from ASO+HFD mice revealed a significant upregulation in all the genes involved in the biochemical pathways studied in the current work.
  • liver is known to be a main producer of apoCIII in the body and, hence, a main target tissue for the active ASO
  • ORO the molecular mechanism by which lowering apoCIII with ASO treatment leads to a normolipidemic, lean and insulin sensitive phenotype
  • Lipc also exert functions as ligand/bridging factor for receptor-mediated uptake of lipoproteins.
  • ASO treatment significantly upregulated genes involved in lipoproteins uptake, such as Ldlr (Fig. 5g), Srbl (Fig. 5h) and the fatty acid translocase Cd36 (Fig. 5i), which might be responsible for the improved systemic lipid profiles observed in the
  • ASO+HFD mice as compared to their Scr+HFD counterparts, we also found that ASO+HFD mice exhibited an upregulation of liver Ppara (Fig. 5j), Rxr (Fig. 5k) and the mitochondrial fatty acid ⁇ -oxidation gene Cptl (Fig. 51), as compared to their Scr+HFD counterparts. Finally, we could observe that ASO+HFD mice displayed a gain-of-function in the hepatic Abcg5 and Abcg8 genes as compared to the Scr-treated ones on HFD. These results confirmed that lowering apoCIII induces hepatobiliary cholesterol efflux, thus contributing for the reduction in plasma lipoprotein particles associated to cholesterol.
  • fatty acids can be efficiently channeled into BAT and WAT due to a metabolic program that boosts TRL uptake and its catabolism.
  • the uptake process is associated with increased permeability for lipoproteins and is crucially dependent on local lipases and the fatty acid translocase CD36; whereas the lipid utilization in BAT and WAT is fundamentally mediated by the activation of thermogenic pathways.
  • mice C57B16/j male mice were purchased from Charles River, USA. Age-matched mice were used in all studies. All animals were acclimated to our animal facilities for a period of 2 weeks prior starting the experiments and had ad libitum access to chow and water. Mice were housed 3-6 animals per cage in a temperature- and humidity-controlled room with 12 h light- 12 h dark cycles. Animal care and experimentations were carried out according to the Animal Experiment Ethics Committee at Karolinska Institutet, Sweden.
  • mice were randomly divided into two groups with a similar average of body weight and assigned either to standard chow (R70, Lantmannen, Sweden) or HFD (Open Source Diets D 12492, Research Diets, New Brunswick, NJ, USA).
  • standard chow R70, Lantmannen, Sweden
  • HFD Open Source Diets D 12492, Research Diets, New Brunswick, NJ, USA.
  • the normal chow provided 2.99 kcal g "1 (% of kcal from: fat 11.4%; proteins 25.8%; and carbohydrates 62.8%)
  • the HFD provided 5.24 kcal g "1 (% of kcal from: fat 60%; proteins 20%; and carbohydrates 20%).
  • Antisense oligonucleotides were provided by Ionis Pharmaceuticals, Inc. (Carlsbad, USA). Sequences of the antisense oligonucleotides were as follows: Active antisense (ASO) against apoCIII gene (ION-353982, 5 ' -GAGAATATACTTTCCCCTTA-3 ' SEQ ID NO: 50); and inactive or scrambled (Scr) antisense (ION- 141923 , 5 '-CCTTCCCTGAAGGTTCCTCC- 3' SEQ ID NO: 120), used as a control. Underlined sequences indicate the 2'-0-methoxyethyl- phosphorothioate modified bases. Efficacy and security profiles were ensured by Ionis Pharmaceuticals, Inc. (Carlsbad, USA).
  • protocol 1 Three experimental set ups were used in the current study, namely protocol 1, protocol 2, protocol
  • mice in protocol 1 were assigned either to HFD or to standard chow. Diet intervention started at the age of 8 weeks and lasted for 24 additional weeks. At start, mice assigned to the HFD group were divided into two: One receiving a weekly i.p injection of the Scr antisense (12.5 mg kg ) and the other one remained untreated. HFD-fed mice were subjected to the above mentioned procedure during the first 10 weeks of the study to ensure that the Scr antisense did not affect the obesogenic/diabeto genie properties of the HFD. After 10 weeks on diet, the untreated HFD group started to receive two i.p injections per week of the active ASO (25 mg kg "1 ) during the last 14 weeks of the study.
  • mice fed with chow diet during 24 weeks did not receive any antisense treatment and were used as healthy controls.
  • Mice in protocol 2 were assigned either to HFD or to standard chow. Diet intervention started at the age of 8 weeks and lasted for 14 additional weeks.
  • HFD-fed mice were divided into two groups: One receiving two i.p injections per week of the Scr antisense (25 mg kg "1 ) and the other one administered twice per week with the active ASO (25 mg kg "1 ) during the last 4 weeks of the study, respectively.
  • Animals fed with chow diet during 14 weeks were given two i.p injections of saline during the whole time course of the study and were used as healthy controls.
  • mice in protocol 3 were assigned either to HFD or to standard chow. Diet intervention started at the age of 8 weeks and lasted for 14 additional weeks. At start, mice assigned to the HFD group were divided into two: One receiving two i.p injections per week of the Scr antisense (25 mg kg "1 ) and the other one administered twice per week with the active ASO (25 mg kg "1 ) during the whole time course of the study. Animals fed with chow diet during 14 weeks were given two i.p injections of saline during the whole time course of the study and were used as healthy controls. All groups in each protocol will be referred to as Control, Scr+HFD and ASO+HFD, respectively. The protocol to which each experimental group and their controls belong will be specified in each case and where it corresponds. Body weight was monitored twice per week in all
  • IPITTs and IPGTTs are IPITTs and IPGTTs.
  • IPITTs were performed after 12-h overnight starvation for animals in protocol 1 and after 6-h fasting during day time for animals in protocols 2 and 3. In protocol 1, IPITT was performed at the end of the experiment. In protocols 2 and 3, IPITTs were performed after 4, 8, 10, 12 and 14 weeks of study. In the IPITTs, fasting glucose (0 time point) was measured followed by an i.p injection of insulin (0.25 U kg "1 of body weight). Subsequently, blood glucose was measured again 10 min later and, immediately after, mice received an i.p injection of glucose (1 g kg "1 of body weight), as previously described 31 . Blood glucose levels were measured at 15, 30, 60, 90 and 120 min after glucose administration using a FreeStyle LiteTM glucose meter (Abbot Diabetes Care).
  • IPGTTs were performed after 12-h overnight starvation for animals in protocol 1 and after 6-h fasting during day time for animals in protocols 2 and 3.
  • protocol 1 IPGTTs were performed after 8 weeks of study and every 4 weeks until the end of the experiment.
  • protocols 2 and 3 IPGTTs were performed after 4, 8, 10, 12 and 14 weeks of study.
  • basal blood glucose (0 time point) was measured in samples drawn from the tail vein. Thereafter, mice received an i.p injection of glucose (1.5 g kg "1 body weight), and glucose levels were measured after 10, 30, 60 and 120 min using a FreeStyle Lite glucose meter (Abbot Diabetes Care).
  • Insulin levels were determined in plasma samples from blood collected from the tail vein at the same time points as for the IPGTT in animals from protocols 2 and 3. In vivo glucose-stimulated insulin secretion was analyzed in plasma samples using an ultrasensitive mouse insulin enzyme-linked immunosorbent assay (ELISA) Kit (Crystal Chem Inc, Downers Grove, IL).
  • ELISA ultrasensitive mouse insulin enzyme-linked immunosorbent assay
  • SEC Size-exclusion chromatography
  • Lipid profiles were obtained by size-exclusion chromatography. Plasma samples from three subsets of non-fasting mice on HFD following the same Scr or ASO treatment procedures were used for these experiments. Plasma lipoproteins were separated by size class using a LaChrom EliteTM HPLC system (Hitachi, Germany) and SuperoseTM 6 PC 3.2/300 gel column (GE Helthcare, Sweden). Plasma triglycerides and cholesterol concentrations were determined using GPO-PAP and CHOD-PAP methods (Roche, Switzerland), respectively. The triglycerides and cholesterol associated to the different lipoprotein fractions were measured as the area under the curve using EZChromeTM Elite software (Aglient
  • mice on HFD for 14 weeks were treated either with the Scr antisense or with the active ASO following the same treatment procedures.
  • all mice were acclimated for 24 h in single cages. Subsequently, they were monitored for 4 consecutive days in the OxymaxTM Lab Animal Monitoring System (Comprehensive Laboratory Animal Monitoring System, CLAMS; Columbus Instruments, Columbus, OH) with ad libitum access to food except for a 12-h fasting period during the last night.
  • the following parameters were continuously monitored: 0 2 consumption (VO2), CO2 production (VCO2), respiratory exchange ratio, food intake, calorie intake, energy expenditure and movement. Movement was reported as total beam breaks for the XYZ axis. Energy expenditure was calculated as the relationship between heat and body weight of each individual animal, and presented in the figures as kcal per kg of mouse per h.
  • Body temperature was monitored in animals belonging to protocol 2 and 3 after 4, 8, 10, 12 and 14 weeks of study using a FLUKETM 5 1 K/J thermometer (Fluke Corporation). Body composition.
  • mice used for energy metabolism studies in the metabolic cages were also subjected to an EchoMRI-100TM system (Echo Medical Systems, USA) to assess total lean and fat mass.
  • the measurement is based on nuclear magnetic resonance (NMR) that takes advantage of the difference in density of the hydrogen nuclei in adipose tissue, water and bone.
  • livers were dissected out, washed in PBS, frozen in liquid nitrogen and stored at -80°C until use. Tissues were sectioned into 20 ⁇ thick sections with a cryostat (MicromTM HM500M/Cryostar NX70; Thermo Scientific) and collected onto SuperFrost PlusTM microscope slides (VWR International). After 2 h equilibrating at room temperature, liver sections were formalin-post-fixed during 30 min, stained with H&E (Histolab) and mounted VectaMount permanent mounting medium (Vector Laboratories, Inc.). Pictures were taken at 20X and 40X magnification objectives in an optical microscope (Leica).
  • mice were anesthetized with isoflurane and transcardially perfused with PBS followed by freshly prepared 4% paraformaldehyde in PBS. Adipose tissues were dissected out and post-fixed overnight. After fixation, tissue samples were processed with a sucrose gradient [10-30% (wt/vol) sucrose solution in PBS containing 0.01% (wt/vol) sodium azide and 0.02% (wt/vol) bacitracin], frozen in dry ice and preserved at -80°C until use. Tissues were sectioned into
  • ORO staining was performed in formalin-fixed liver tissue from animals in protocols 2 and 3following the same above mentioned fixation and cryo sectioning procedures. After 2 h equilibrating at room temperature, slides containing liver sections were rinsed in 60% (vol/vol) isopropylic alcohol, stained in freshly prepared 0.1% (vol/vol) ORO (Sigma- Aldrich) in 60% (vol/vol) isopropylic alcohol solution for 30 min, washed in distilled water and mounted in aqueous media. Liver sections from all experimental groups and controls were immediately imaged under a 20X magnification objective using an optical microscope (Leica). Lipid visualization by ORO staining was performed in three non-consecutive liver sections separated by 100 ⁇ . For each section, 3 fields of view were collected in 3 individual animals per experimental group and controls.
  • liver samples from animals belonging to protocol 1, 2, and 3 were frozen in liquid nitrogen and stored at -80°C until use. Hepatic triglyceride content was determined following the previously described protocol 33 for liver triglycerides determination by carcass saponification in 0.1M KOH in 99% ethanol. Triglycerides were analyzed using Free Glycerol Reagent and Glycerol Standards (Sigma- Aldrich) to construct the standard curve. The glycerol concentration (triolein equivalents) was measured by spectrophotometry
  • plasma was albumin depleted using
  • Apolipoprotein CIII links islet insulin resistance to beta-cell failure in diabetes. Proc Natl Acad Sci U SA 112, E2611-2619, doi: 10.1073/pnas.l423849112 (2015).
  • proliferators as hypolipidemic drugs Suppression of apolipoprotein C-III. / Biol Chem 270, 13470-13475 (1995). 25 Kersten S. Integrated physiology and systems biology of PPARa. Mol Metab 3, 354- 371 (2014).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Obesity (AREA)
  • Hematology (AREA)
  • Diabetes (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Epidemiology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne des méthodes de traitement ou de limitation du développement de l'obésité ou de traitement ou de limitation du développement de diverses maladies de stéatose hépatique par administration d'un inhibiteur de l'apolipoprotéine CIII.
PCT/EP2017/081958 2016-12-08 2017-12-08 Méthodes de traitement et de limitation du développement de l'obésité et de troubles de stéatose hépatique WO2018104499A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201662431762P 2016-12-08 2016-12-08
US62/431,762 2016-12-08
US201762562695P 2017-09-25 2017-09-25
US62/562,695 2017-09-25

Publications (1)

Publication Number Publication Date
WO2018104499A1 true WO2018104499A1 (fr) 2018-06-14

Family

ID=61027637

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2017/081958 WO2018104499A1 (fr) 2016-12-08 2017-12-08 Méthodes de traitement et de limitation du développement de l'obésité et de troubles de stéatose hépatique

Country Status (1)

Country Link
WO (1) WO2018104499A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113812378A (zh) * 2021-09-29 2021-12-21 湖北天勤生物技术研究院有限公司 一种食蟹猴肥胖症模型的建立方法及其应用
CN114129557A (zh) * 2020-09-03 2022-03-04 南京农业大学 控制肥胖的黄酮-蛋白质纤维水凝胶及其制备方法

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120129911A1 (en) * 2009-03-16 2012-05-24 Sacks Frank M Compositions and methods of targeting apolipoprotein b for the reduction of apolipoprotein c-iii
US20120184595A1 (en) * 2009-01-26 2012-07-19 Protive Biotherapeutics, Inc. Compositions and methods for silencing apolipoprotein c-iii expression
US8530439B2 (en) 2003-04-16 2013-09-10 Isis Pharmaceuticals, Inc. Modulation of apolipoprotein C-III expression
AU2013231079A1 (en) * 2003-04-16 2013-10-10 Ionis Pharmaceuticals, Inc. Modulation of apolipoprotein c-iii expression
US20150259416A1 (en) * 2014-03-12 2015-09-17 Biocrine Ab Methods for treating and/or limiting development of diabetes
US20160009792A1 (en) * 2013-02-25 2016-01-14 Imetabolic Biopharma, Llc Apolipoprotein c3 (apociii) antagonists and methods of their use to remove apociii inhibition of lipoprotein lipase (lpl)
WO2016081444A1 (fr) * 2014-11-17 2016-05-26 Alnylam Pharmaceuticals, Inc. Compositions d'arni d'apolipoprotéine c3 (apoc3) et procédés d'utilisation de ces compositions

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8530439B2 (en) 2003-04-16 2013-09-10 Isis Pharmaceuticals, Inc. Modulation of apolipoprotein C-III expression
AU2013231079A1 (en) * 2003-04-16 2013-10-10 Ionis Pharmaceuticals, Inc. Modulation of apolipoprotein c-iii expression
US20120184595A1 (en) * 2009-01-26 2012-07-19 Protive Biotherapeutics, Inc. Compositions and methods for silencing apolipoprotein c-iii expression
US20120129911A1 (en) * 2009-03-16 2012-05-24 Sacks Frank M Compositions and methods of targeting apolipoprotein b for the reduction of apolipoprotein c-iii
US20160009792A1 (en) * 2013-02-25 2016-01-14 Imetabolic Biopharma, Llc Apolipoprotein c3 (apociii) antagonists and methods of their use to remove apociii inhibition of lipoprotein lipase (lpl)
US20150259416A1 (en) * 2014-03-12 2015-09-17 Biocrine Ab Methods for treating and/or limiting development of diabetes
WO2016081444A1 (fr) * 2014-11-17 2016-05-26 Alnylam Pharmaceuticals, Inc. Compositions d'arni d'apolipoprotéine c3 (apoc3) et procédés d'utilisation de ces compositions

Non-Patent Citations (43)

* Cited by examiner, † Cited by third party
Title
ALTOMONTE, J. ET AL.: "Foxol mediates insulin action on apoC-III and triglyceride metabolism", J CLIN INVEST, vol. 114, 2004, pages 1493 - 1503
ATZMON, G. ET AL.: "Lipoprotein genotype and conserved pathway for exceptional longevity in humans", PLOS BIOL, vol. 4, 2006, pages ell3
AVAIL, K. ET AL.: "Apolipoprotein CIII links islet insulin resistance to beta-cell failure in diabetes", PROC NATL ACAD SCI USA, vol. 112, 2015, pages E2611 - 2619
BARTELT A. ET AL.: "Brown adipose tissue activity controls triglyceride clearance", NAT MED., vol. 17, 2011, pages 200 - 205
CANNON, B.; NEDERGAARD, J.: "Brown adipose tissue: function and physiological significance", PHYSIOL. REV, vol. 84, 2004, pages 277 - 359, XP008146196, DOI: doi:10.​1152/​physrev.​00015.​2003
CHEN, M.; BRESLOW, J. L.; LI, W.; LEFF, T.: "Transcriptional regulation of the apoC-III gene by insulin in diabetic mice: correlation with changes in plasma triglyceride levels", J LIPID RES, vol. 35, 1994, pages 1918 - 1924
COHEN, P. ET AL.: "Ablation of PRDM16 and beige adipose causes metabolic dysfunction and a subcutaneous to visceral fat switch", CELL, vol. 156, 2014, pages 304 - 316, XP028811723, DOI: doi:10.1016/j.cell.2013.12.021
D. GOEDDEL: "Gene Expression Technology (Methods in Enzymology)", vol. 185, 1991, ACADEMIC PRESS
DEL PRATO S: "Role of glucotoxicity and lipotoxicity in the pathophysiology of Type 2 diabetes mellitus and emerging treatment strategies", DIABET MED, vol. 26, 2009, pages 1185 - 1192
E.J. MURRAY: "Gene Transfer and Expression Protocols", THE HUMANA PRESS INC., pages: 109 - 128
GENNARO: "REMINGTON'S PHARMACEUTICAL SCIENCES, 18th ed.", 1990, MACK PUBLISHING COMPANY
GRAF G.A. ET AL.: "ABCG5 and ABCG8 are obligate heterodimers for protein trafficking and biliary cholesterol excretion", J BIOL CHEM, vol. 278, 2003, pages 48275 - 48282, XP002371099, DOI: doi:10.1074/jbc.M310223200
HARLOW; LANE: "Antibodies; A Laboratory Manual", 1988, COLD SPRING HARBOR LABORATORY
HERTZ R.; BISHARA-SHIEBAN J.; BAR-TANA J.: "Mode of action of peroxisome proliferators as hypolipidemic drugs. Suppression of apolipoprotein C-III", J BIOL CHEM, vol. 270, 1995, pages 13470 - 13475, XP002089812
HOLLAND W.L. ET AL.: "Lipid mediators of insulin resistance", NUTR REV, vol. 65, 2007, pages 39 - 46
HOLLAND W.L. ET AL.: "Lipid-induced insulin resistance mediated by the proinflammatory receptor TLR4 requires saturated fatty acid-induced ceramide biosynthesis in mice", J CLIN INVEST, vol. 121, 2011, pages 1858 - 1870
INNIS ET AL.: "PCR Protocols: A Guide to Methods and Applications", 1990, ACADEMIC PRESS
KERSTEN S.: "Integrated physiology and systems biology of PPARa", MOL METAB, vol. 3, 2014, pages 354 - 371
KINNUNEN P. K.; EHNOLM C.: "Effect of serum and C-apoproteins from very low density lipoproteins on human postheparin plasma hepatic lipase", FEBS LETT, vol. 65, 1976, pages 354 - 357
KOUNNAS M.Z. ET AL.: "The cellular internalization and degradation of hepatic lipase is mediated by low density lipoprotein receptor-related protein and requires cell surface proteoglycans", J. BIOL. CHEM, vol. 270, 1995, pages 9307 - 12
KUMASHIRO N. ET AL.: "Cellular mechanism of insulin resistance in nonalcoholic fatty liver disease", PROC NATL ACAD SCI USA, vol. 108, 2011, pages 16381 - 16385
LO, K. A.; SUN, L.: "Turning WAT into BAT: a review on regulators controlling the browning of white adipocytes", BIOSCI REP, vol. 33, 2013
M.P. DEUTSHCER: "Methods in Enzymology", 1990, ACADEMIC PRESS, INC., article "Guide to Protein Purification"
MATIC M. ET AL.: "Estrogen signalling and the metabolic syndrome: targeting the hepatic estrogen receptor alpha action", PLOS ONE, vol. 8, 2013, pages e57458
MENDIVIL C.O. ET AL.: "Metabolism of very-low-density lipoprotein and low-density lipoprotein containing apolipoprotein C-III and not other small apolipoproteins", ARTERIOSCLER THROMB VASE BIOL, vol. 30, 2010, pages 239 - 45
MENDIVIL, C. O.; ZHENG, C.; FURTADO, J.; LEI, J.; SACKS, F. M.: "Metabolism of very-low-density lipoprotein and low-density lipoprotein containing apolipoprotein C-III and not other small apolipoproteins", ARTERIOSCLER THROMB VASC BIOL, vol. 30, 2010, pages 239 - 245
NORRIS A.W. ET AL.: "Muscle-specific PPARy-deficient mice develop increased adiposity and insulin resistance but respond to thiazolidinediones", J CLIN INVEST, vol. 112, 2003, pages 608 - 618
OELKRUG, R.; POLYMEROPOULOS, E.T.; JASTROCH, M.: "Brown adipose tissue: physiological function and evolutionary significance", J. COMP. PHYSIOL B, vol. 185, 2015, pages 587 - 606, XP035515470, DOI: doi:10.1007/s00360-015-0907-7
OOI E.M.; BARRETT P.H.; CHAN D.C.; WATTS G.F.: "Apolipoprotein C-III: understanding an emerging cardiovascular risk factor", CLIN SCIENCE, vol. 114, 2008, pages 611 - 624
PARINI P. ET AL.: "Lipoprotein profiles in plasma and interstitial fluid analyzed with an automated gel-filtration system", EUR J CLIN INVEST, vol. 36, 2006, pages 98 - 104
PERRY, R. J.; SAMUEL, V. T.; PETERSEN, K. F.; SHULMAN, G. I.: "The role of hepatic lipids in hepatic insulin resistance and type 2 diabetes", NATURE, vol. 510, 2014, pages 84 - 91
PETERSEN, K. F. ET AL.: "Apolipoprotein C3 gene variants in nonalcoholic fatty liver disease", N ENGL J MED, vol. 362, 2010, pages 1082 - 1089, XP055416311, DOI: doi:10.1056/NEJMoa0907295
POLLIN, T. I. ET AL.: "A null mutation in human APOC3 confers a favorable plasma lipid profile and apparent cardioprotection", SCIENCE, vol. 322, 2008, pages 1702 - 1705, XP055221520, DOI: doi:10.1126/science.1161524
R.I. FRESHNEY: "Culture of Animal Cells: A Manual of Basic Technique, 2nd ed.", 1987, LISS, INC.
SACKS F.M.; ZHENG C.; COHN J.S.: "Complexities of plasma apolipoprotein C-III metabolism", J LIPID RES, vol. 52, 2011, pages 1067 - 1070
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS
SILVA J.E.: "Thermogenic mechanisms and their hormonal regulation", PHYSIOL REV, vol. 86, 2006, pages 435 - 64
THOMAS A BELL ET AL: "Therapeutic inhibition of apoC-III for the treatment of hypertriglyceridemia", CLINICAL LIPIDOLOGY, vol. 10, no. 2, 1 April 2015 (2015-04-01), GB, pages 191 - 203, XP055461807, ISSN: 1758-4299, DOI: 10.2217/clp.15.7 *
TSENG Y.H.; CYPESS A.M.; KAHN C.R.: "Cellular bioenergetics as a target for obesity therapy", NAT REV DRUG DISCOV, vol. 9, 2010, pages 465 - 82
WILLIAMS, K.J.: "Molecular processes that handle-and mishandle-dietary lipids", J. CLIN. INVEST, vol. 118, 2008, pages 3247 - 3259
WILUND K.R. ET AL.: "High-level expression of ABCG5 and ABCG8 attenuates diet-induced hypercholesterolemia and atherosclerosis in Ldlr-/- mice", J LIPID RES, vol. 45, 2004, pages 1429 - 1436
WU, J. ET AL.: "Beige adipocytes are a distinct type of thermogenic fat cell in mouse and human", CELL, vol. 150, 2012, pages 366 - 376, XP055088017, DOI: doi:10.1016/j.cell.2012.05.016
ZHENG, C.; KHOO, C.; IKEWAKI, K.; SACKS, F. M.: "Rapid turnover of apolipoprotein C-III-containing triglyceride-rich lipoproteins contributing to the formation of LDL subfractions", J LIPID RES, vol. 48, 2007, pages 1190 - 1203, XP002503622, DOI: doi:10.1194/jlr.p600011-jlr200

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114129557A (zh) * 2020-09-03 2022-03-04 南京农业大学 控制肥胖的黄酮-蛋白质纤维水凝胶及其制备方法
CN113812378A (zh) * 2021-09-29 2021-12-21 湖北天勤生物技术研究院有限公司 一种食蟹猴肥胖症模型的建立方法及其应用
CN113812378B (zh) * 2021-09-29 2023-02-03 湖北天勤生物技术研究院有限公司 一种食蟹猴肥胖症模型的建立方法及其应用

Similar Documents

Publication Publication Date Title
Zhao et al. Branched-chain amino acids exacerbate obesity-related hepatic glucose and lipid metabolic disorders via attenuating Akt2 signaling
Zhao et al. The interaction between oxidative stress and mast cell activation plays a role in acute lung injuries induced by intestinal ischemia–reperfusion
US20170037118A1 (en) Methods for treating and/or limiting development of diabetes
Cui et al. Oxidative stress contributes to the induction and persistence of TGF-β1 induced pulmonary fibrosis
Krishnapuram et al. Template to improve glycemic control without reducing adiposity or dietary fat
Li et al. The neutrophil elastase inhibitor, sivelestat, attenuates sepsis-related kidney injury in rats
Sun et al. Suppression of FoxO3a attenuates neurobehavioral deficits after traumatic brain injury through inhibiting neuronal autophagy
Kawasaki et al. Blockade of B-cell-activating factor signaling enhances hepatic steatosis induced by a high-fat diet and improves insulin sensitivity
Zhang et al. Oxymatrine ameliorates L-arginine-induced acute pancreatitis in rats
Sun et al. Heat shock protein 65 promotes atherosclerosis through impairing the properties of high density lipoprotein
Zhou et al. Effects of kallistatin on oxidative stress and inflammation on renal ischemia-reperfusion injury in mice
Zilu et al. Effects of XIAP on high fat diet-induced hepatic steatosis: a mechanism involving NLRP3 inflammasome and oxidative stress
US20080124319A1 (en) Methods for treating inflammation by disrupting MCH-mediated signaling
Liu et al. Platelet activating factor receptor acts to limit colitis‐induced liver inflammation
Xu et al. MicroRNA-144-3p enhances LPS induced septic acute lung injury in mice through downregulating Caveolin-2
WO2018104499A1 (fr) Méthodes de traitement et de limitation du développement de l'obésité et de troubles de stéatose hépatique
JP7111605B2 (ja) 糖尿病を治療および／または発症を制限するための方法
JP2022551987A (ja) 肝疾患を治療するための組成物および方法
Wang et al. Follistatin Attenuates Myocardial Fibrosis in Diabetic Cardiomyopathy via the TGF-β–Smad3 Pathway
Kurano et al. Apolipoprotein M/sphingosine 1-phosphate protects against diabetic nephropathy
He et al. Transthyretin contributes to insulin resistance and diminishes exercise-induced insulin sensitivity in obese mice by inhibiting AMPK activity in skeletal muscle
Du et al. C1q/tumour necrosis factor-related protein-3 alleviates high-glucose-induced lipid accumulation and necroinflammation in renal tubular cells by activating the adenosine monophosphate-activated protein kinase pathway
Zhang et al. Ketogenic diet alleviates β-cell dedifferentiation but aggravates hepatic lipid accumulation in db/db mice
WO2023006127A1 (fr) Utilisation de gp73 en tant que cible de traitement et marqueur de diagnostic pour une stéatose hépatique non alcoolique sans obésité
Chen et al. 5‑Aminosalicylic acid attenuates paraquat‑induced lung fibroblast activation and pulmonary fibrosis of rats

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17835593

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17835593

Country of ref document: EP

Kind code of ref document: A1