WO2018102715A1 - Compositions and methods for treating and/or reducing corneal dystrophy - Google Patents

Compositions and methods for treating and/or reducing corneal dystrophy Download PDF

Info

Publication number
WO2018102715A1
WO2018102715A1 PCT/US2017/064264 US2017064264W WO2018102715A1 WO 2018102715 A1 WO2018102715 A1 WO 2018102715A1 US 2017064264 W US2017064264 W US 2017064264W WO 2018102715 A1 WO2018102715 A1 WO 2018102715A1
Authority
WO
WIPO (PCT)
Prior art keywords
corneal
glutamine
endothelium
dystrophy
cornea
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2017/064264
Other languages
French (fr)
Inventor
JR. Francis PRICE
Matthew FENG
Zhang WENLIN
Joseph Bonanno
Hongde LI
Jason TENNESSEN
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Indiana University Research and Technology Corp
Original Assignee
Indiana University Research and Technology Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Indiana University Research and Technology Corp filed Critical Indiana University Research and Technology Corp
Publication of WO2018102715A1 publication Critical patent/WO2018102715A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/02Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/185Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19Carboxylic acids, e.g. valproic acid
    • A61K31/194Carboxylic acids, e.g. valproic acid having two or more carboxyl groups, e.g. succinic, maleic or phthalic acid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/185Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19Carboxylic acids, e.g. valproic acid
    • A61K31/195Carboxylic acids, e.g. valproic acid having an amino group
    • A61K31/197Carboxylic acids, e.g. valproic acid having an amino group the amino and the carboxyl groups being attached to the same acyclic carbon chain, e.g. gamma-aminobutyric acid [GABA], beta-alanine, epsilon-aminocaproic acid or pantothenic acid
    • A61K31/198Alpha-amino acids, e.g. alanine or edetic acid [EDTA]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7004Monosaccharides having only carbon, hydrogen and oxygen atoms
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses

Definitions

  • Various aspects and embodiments disclosed herein relate generally to the modelling, treatment, prevention, and diagnosis of diseases characterized by the formation of corneal dystrophy.
  • Cornea Endothelium is a cell monolayer on the posterior surface of the cornea responsible for maintaining corneal transparency.
  • This abundant expression of Na + -K + - ATPase and numerous secondary membrane transporters facilitate an outward osmotic driving force that counteracts an inward imbibition pressure from corneal stromal glycosaminoglycans, thereby maintaining corneal hydration, thickness, and clarity.
  • Anterior chamber aqueous humor bathes its apical surface and provides all nutrients for the CE.
  • the robust transport activity places a heavy metabolic demand on the CE, which is consistent with a high mitochondrial density that is second in the human body only to photoreceptors.
  • the dependence on mitochondrial activity is consistent with reports of CE dysfunction associated with a number of mitochondrial disorders, such as Pearson Syndrome, Kearns-Sayre syndrome, and Leigh's syndrome.
  • Compromised CE loses its fluid transport efficacy, resulting in corneal edema and vision loss.
  • the CE does not proliferate or regenerate in vivo, and there is a continuous decrease in CE cell density throughout life. Therefore, cell protection is a high priority for patients with corneal endothelial dystrophies and/or for people undergoing intraocular surgeries, such as cataract surgery.
  • Endothelial corneal dystrophies are inherited disorders characterized by degenerated corneal endothelium and/or accelerated cell loss that may result in corneal edema, visual loss and require surgical transplantation.
  • SLC4A11 At least one gene that encodes a membrane transporter. Mutations in SLC4A11 may cause Congenital Hereditary Endothelial Dystrophy (CHED) and Harboyan Syndrome (endothelial dystrophy with perceptive deafness). See Vithana, E.N., et al. (2008), SLC4A11 mutations in Fuchs endothelial corneal dystrophy. HUMAN MOLECULAR GENETICS, 17: 656- 666.
  • CHED Congenital Hereditary Endothelial Dystrophy
  • Harboyan Syndrome endothelial dystrophy with perceptive deafness
  • SLC4A11 mutations are also present in several genes that cause age-related Fuchs Endothelial Corneal Dystrophy (FECD) and Peters anomaly (Corneal opacity resulted from dysgenesis of posterior layers of the cornea).
  • Fuchs Endothelial Corneal Dystrophy FECD
  • Peters anomaly Corneal opacity resulted from dysgenesis of posterior layers of the cornea.
  • SLC4A11 has been characterized as a novel H 3 :2H + co-transporter. See Zhang, W. et al. (2015), Human SLC4A11 Is a Novel NH3/H+ Co-transporter, THE JOURNAL OF BIOLOGICAL CHEMISTRY, 290: 16894-16905.
  • the CE may require high expression of an ammonia-linked transporter.
  • the existence of a specific Ammonia transporter suggests a highly active amino acid metabolism.
  • the amino acid glutamine can contribute up to 90% of ammonia generated in some cell types concentrating of glutamine in aqueous humor [glutamine] is about 0.63 mM similar to that of serum (0.61 mM).
  • Many stem cells and/or transformed cancer cells utilize glutamine as synthetic intermediates for cell growth. This study investigated whether the non-regenerating well-differentiated CE uses glutamine mainly for ATP generation to supply energy for its abundant Na -K -ATPase activity and support the physiological pump function necessary to maintaincorneal clarity.
  • Glutaminolysis via mitochondrial glutaminase is a highly dynamic and regulated metabolic pathway.
  • the substrate (glutamine) and/or products of its metabolism may provide short-term activity regulation while acidosis and oncogene s/proto- oncogenes such as c-Myc, p53 and p63 can affect long-term expressions.
  • a Slc4al l-/- mouse model of Congenital Hereditary Endothelial Dystrophy may exhibit altered ammonia handling resulting in the disruption of CE glutamine metabolism.
  • a first embodiment includes a method of protecting cornea endothelium, comprising the steps of: providing a patient diagnosed with corneal endothelial dystrophy, undergoing intraocular surgeries, and/or post-operative care, with a therapeutic regime that includes at least one therapeutically effective dose of at least one composition comprising glutamine, alpha-ketoglutarate, and/or any stabilized/direvatized forms thereof.
  • a second embodiment includes the method according to the first embodiment, wherein the at least one composition further comprises glucose.
  • a third embodiment includes a method of protecting or enhancing the viability of a corneal endothelium, comprising the steps of: contacting at least one portion of a corneal endothelium with a therapeutic regime that includes at least one therapeutically effective dose of at least one composition comprising glutamine, alpha-ketoglutarate, and/or any stabilized/direvatized forms thereof.
  • a fourth embodiment includes the method according to the third embodiment, wherein the at least one composition further comprises glucose.
  • a fifth embodiment includes the method according to any one of the third and the fourth embodiments, wherein the corneal endothelium is damaged or stressed.
  • a sixth embodiment includes the method according to any one of the third to the fifth embodiments, wherein the step of contacting is performed prior to transplantation, after transplantation, during transplantation, and/or during transportation of said coreal endothelium.
  • a seventh embodiment includes the method according to any one of the third to the sixth embodiments, wherein the corneal endothelium is damaged or stressed after trauma, and/or an injury comprising chemical injury, hypoxic injury, thermal/freezng injury, radiation injury, photoxic injury, reactive oxidation injury, and/or any other forms of injury occurred by localized nutritional dysfunction, corneal inlays, implants, and/or contact lenses.
  • An eighth embodiment includes a method of treating corneal endothelial dystrophies, comprising the steps of: treating a patient diagnosed with corneal endothelial dystrophies with at least one therapeutically effective composition that inhibits and/or reduces glutaminolysis.
  • a nineth embodiment includes the eighth embodiment, wherein the at least one therapeutically effective composition comprises at least one glutamine analogue, at least one glutaminase inhibitor, at least one gamma-glutamyl-transpeptidase (GGT) inhibitor, and/or at least one membrane glutamate excitatory amino acid transporter (EAAT) inhibitor.
  • the at least one therapeutically effective composition comprises at least one glutamine analogue, at least one glutaminase inhibitor, at least one gamma-glutamyl-transpeptidase (GGT) inhibitor, and/or at least one membrane glutamate excitatory amino acid transporter (EAAT) inhibitor.
  • a tenth embodiment includes the method according to any one of the eighth and the nineth embodiments, wherein the at least one glutaminase inhibitor comprises a glutaminase type 1 (GLS1) inhibitor.
  • the at least one glutaminase inhibitor comprises a glutaminase type 1 (GLS1) inhibitor.
  • An eleventh embodiment includes the method according to any one of the eighth to the tenth embodiments, wherein the at least one glutamine analogue comprises 6-Diazo-5-oxo- L-norleucine (DON).
  • DON 6-Diazo-5-oxo- L-norleucine
  • a twelfth embodiment includes the method according to any one of the eighth to the tenth embodiments, wherein the corneal endothelial dystrophy is at least one dystrophy selected from the group consisting of: Congenital Hereditary Endothelial Corneal Dystrophy, Fuchs Endothelial Corneal Dystrophy, Posterior Polymorphous Corneal Dystrophy, and/or Schnyder Crystalline Corneal Dystrophy.
  • a thirteenth embodiment includes a therapeutic composition for protecting cornea endothelium, comprising: at least one agent comprising glutamine, alpha-ketoglutarate, dimethyl alpha-ketoglutarate, and any stabilized/direvatized forms thereof; at least one pharmaceutically acceptable salt; and at least one physiological buffer.
  • a fourteenth embodiment includes a therapeutic composition for treating corneal endothelial dystrophies, comprising: at least one therapeutically effective agent that inhibits and/or reduces glutaminolysis; at least one pharmaceutically acceptable salt; and at least one physiological buffer.
  • a fifteenth embodiment includes the method of the fourteenth embodiment, wherein the at least one therapeutically effective agent comprises at least one glutamine analogue, at least one glutaminase inhibitor, at least one gamma-glutamyl-transpeptidase (GGT) inhibitor, and/or at least one membrane glutamate excitatory amino acid transporter (EAAT) inhibitor.
  • the at least one therapeutically effective agent comprises at least one glutamine analogue, at least one glutaminase inhibitor, at least one gamma-glutamyl-transpeptidase (GGT) inhibitor, and/or at least one membrane glutamate excitatory amino acid transporter (EAAT) inhibitor.
  • a sixteenth embodiment includes a kit comprising at least one composition according to any one of the twelfth to the fifteenth embodiments, and at least one container.
  • SEQ ID NO: 15 AGCAGATGCTGTTTCCAAACCAGG
  • SEQ ID NO 20 CAGGCATGGAGAAGTTGAGAACTG
  • SEQ ID NO 24 AGTCACTTCAATGGAGCACAGCTG
  • SEQ ID NO 21 TTATTGGAGGGTTGCTGCAAGCAC
  • FIG. 1 Expression of glutaminase, glutamate transporters and glutamine transporters in corneal endothelium.
  • A RT-PCR of human and mouse corneal endothelium tissue for glutaminase (GLS1, GLS2, GGT), glutamate dehydrogenase (GDH) and glutamate transporters (EAAT1-5);
  • B Immunofluorescence staining of human cornea section showing GLS1, GLS2 and GGT expression in cornea endothelium;
  • C RT-PCR of HCEC showing expression of GLS1, GLS2, GGT, EAAT1-3, ten glutamine transporters as well as SLC4A11.
  • D Immunofluorescence staining of HCEC showing cellular localization of GLS1 (mitochondria) and GGT (membrane).
  • FIG. 2. Glutamine contributes to TCA cycle in HCEC.
  • A Schematic illustration of proposed glutamine metabolism in corneal endothelium;
  • B Ammonia release is dose- dependent on glutamine concentration in HCEC culture;
  • C GC-MS results show -60% of carbons in TCA intermediates are from glutamine.
  • FIG. 3 Glutamine supplies energy for corneal endothelial pump function.
  • B Central corneal thickness (CCT) is better maintained with glutamine-supplemented perfusion. Left: time course of CCT change.
  • FIG. 4 Slc4aH ⁇ ⁇ mouse cornea endothelium shows sign of ammonia toxicity and altered glutaminolysis enzymes.
  • A Photography of Slc4all +/+ and Slc4aH ⁇ ⁇ mouse cornea, shows diffuse edema (increase of light reflection in clear stroma) in 12-week Slc4aH ⁇ ⁇ .
  • B H&E staining of 40-week Slc4all +/+ and Slc4aH ⁇ ⁇ mouse cornea section shows endothelial vacuolation and Descemet's membrane thickening.
  • C Nitrotyrosine immunostaining shows increased intensity in 40-week Slc4all " corneal endothelium, suggesting ammonia toxicity.
  • FIG. 5 Verification of glucose contribution to TCA cycle in HCEC.
  • A GC-MS results show -50% of carbons in TCA intermediates are from glucose.
  • B Percentage contribution of glucose into TCA intermediates does not change even in presence of sufficient glucose.
  • FIG. 6. (A) Picture of cornea mounted on to Barron Artificial Anterior chamber with Ringer's solution. (B) Alizarin Red staining visualization of rabbit corneal endothelium after deswelling experiment. Cell density was counted using these images. (C) Alizarin Red staining visualization of human corneal endothelium after deswelling experiment. Cell density was counted using these images.
  • FIG. 8 A diagram illustrating proposed mechanisms involved in human corneal endothelium.
  • the terms 'therapeutically effective dose,' 'therapeutically effective amounts,' and the like refers to a portion of a compound that has a net positive effect on the health and well being of a human or other animal.
  • Therapeutic effects may include an improvement in longevity, quality of life and the like these effects also may also include a reduced susceptibility to developing disease or deteriorating health or well being.
  • the effects may be immediate realized after a single dose and/or treatment or they may be cumulative realized after a series of doses and/or treatments.
  • Pharmaceutically acceptable salts include salts of compounds of the invention that are safe and effective for use in mammals and that possess a desired therapeutic activity.
  • Pharmaceutically acceptable salts include salts of acidic or basic groups present in compounds of the invention.
  • Pharmaceutically acceptable acid addition salts include, but are not limited to, hydrochloride, hydrobromide, hydroiodide, nitrate, sulfate, bisulfate, phosphate, acid phosphate, isonicotinate, acetate, lactate, salicylate, citrate, tartrate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzensulfonate, p-toluenesulfonate and pamoate (i.e., l, l'-methylene-bis
  • Certain compounds of the invention may form pharmaceutically acceptable salts with various amino acids.
  • Suitable base salts include, but are not limited to, aluminum, calcium, lithium, magnesium, potassium, sodium, zinc, and diethanol amine salts.
  • Suitable base salts include, but are not limited to, aluminum, calcium, lithium, magnesium, potassium, sodium, zinc, and diethanol amine salts.
  • “Pharmaceutically acceptable salts” as used herein unless defined otherwise refers to: Pharmaceutically acceptable salts, and common methodology for preparing them, are known in the art. See, e.g., P. Stahl, et al, HANDBOOK OF PHARMACEUTICAL SALTS: PROPERTIES, SELECTION AND USE, (VCHA/Wiley-VCH, 2002); S.M. Berge, et al, "Pharmaceutical Salts," Journal of Pharmaceutical Sciences, Vol. 66, No. 1, January 1977. [0086] Pharmaceutical formulation: The compounds of the invention and their salts may be formulated as pharmaceutical compositions for administration.
  • compositions and processes for making the same are known in the art for both humans and non- human mammals. See, e.g., REMINGTON: THE SCIENCE AND PRACTICE OF PHARMACY, (A. Gennaro, et al., eds., 19 th ed., Mack Publishing Co., 1995).
  • the pharmaceutical formulations of the present invention include those suitable for oral, parenteral (including subcutaneous, intradermal, intramuscular and intravenous) and rectal administration.
  • the formulations may be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. All methods include the step of bringing into association the active ingredient, i.e., the compound or salt of the present invention, with the carrier. In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredient with a liquid carrier or, a finely divided solid carrier or both, and then, if necessary, forming the associated mixture into the desired formulation.
  • the pharmaceutical formulations of the present invention suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions, and may also include an antioxidant, buffer, a bacteriostat and a solution which renders the composition isotonic with the blood of the recipient, and aqueous and non-aqueous sterile suspensions which may contain, for example, a suspending agent and a thickening agent.
  • the formulations may be presented in a single unit-dose or multi-dose containers, and may be stored in a lyophilized condition requiring the addition of a sterile liquid carrier prior to use.
  • phrases Pharmaceutically acceptable carrier unless stated or implied otherwise, is used herein to describe any ingredient other than the active component(s) that maybe included in a formulation.
  • the choice of carrier will to a large extent depend on factors such as the particular mode of administration, the effect of the carrier on solubility and stability, and the nature of the dosage form.
  • a tablet may be made by compressing or moulding the active ingredient with the pharmaceutically acceptable carrier.
  • Compressed tablets may be prepared by compressing in a suitable machine the active ingredient in a free-flowing form, such as a powder or granules, in admixture with, for example, a binding agent, an inert diluent, a lubricating agent, a disintegrating and/or a surface active agent.
  • Moulded tablets may be prepared by moulding in a suitable machine a mixture of the powdered active ingredient moistened with an inert liquid diluent.
  • the tablets may optionally be coated or scored and may be formulated so as to provide slow or controlled release of the active ingredient.
  • treating includes administering to a human or an animal patient at least one dose of a compounds, treating includes preventing or lessening the likelihood and or severity of a at least one disease as well as limiting the length of an illness or the severity of an illness it may or may not result in a cure of the disease.
  • inhibitortion or “inhibitory activity” each encompass whole or partial reduction of activity or effect of an enzyme or all and/or part of the pathway.
  • a “therapeutically effective amount” in general means the amount that, when administered to a subject or animal for treating a disease, is sufficient to affect the desired degree of treatment for the disease.
  • a “therapeutically effective agent” includes, but is not limited to, glutamine analogues, glutaminase (e.g., GLS 1 and/or GLS2) inhibitors, gamma-glutamyl- transpeptidase (GGT) inhibitors, and/or membrane glutamate excitatory amino acid transporter (EAAT) inhibitors.
  • glutamine analogues e.g., GLS 1 and/or GLS2
  • GTT gamma-glutamyl- transpeptidase
  • EAAT membrane glutamate excitatory amino acid transporter
  • a “selective" inhibitor is one that has at least 2, 5, 10, 20, 50, 100, or 200 fold greater inhibitory activity (for example, as determined by calculation of IC 50 , 3 ⁇ 4, or other measure of affinity or effect) for a particular isozyme of the inhibitor compared to other members of the family.
  • endothelial corneal dystrophy includes, but is not limited to, posterior corneal dystrophies.
  • Posterior corneal dystrophies include, but are not limted to, Congenital Hereditary Endothelial Corneal Dystrophy, Fuchs Endothelial Corneal Dystrophy, Posterior Polymorphous Corneal Dystrophy, and Schnyder Crystalline Corneal Dystrophy.
  • Human and/or mouse Corneal Endothelium expresses metabolic enzymes involved in glutaminolysis and glutamine and/or glutamate transporters. The expression of enzymes involved in glutaminolysis as well as glutamine and/or glutamate transporters in human and/or mouse CE tissue were examined. Conserved expressions of glutaminase (i.e, one of the enzymes involved in flutaminolysis) and glutamine and/or glutamate transporters were evident in both human and mouse CE.
  • both mitochondrial glutaminase, phosphate-activated glutaminase type 1 (GLS 1, kidney -type) and type 2 (GLS2, liver-type) were expressed in human and mouse CE and the expression of GLSl was higher than that of GLS2 in both human and mouse (FIG. 1A).
  • both human and mouse CE expressed gamma-glutamyl-transpeptidase (GGT), which had been shown to have a membrane glutaminase activity and to function along with membrane glutamate excitatory amino acid transporters (EAATs).
  • EAATs membrane glutamate excitatory amino acid transporters
  • HCEC immortalized human CE cell line
  • the expressions of GLSl, GLS2, and GGT were detected (FIGs. 1C and ID).
  • FIG. IB the expressions of GLSl, GLS2 and GGT in human CE tissue was verified by immunostaining healthy human donor cornea sections.
  • FIG. ID the expression of GLSl revealed mitochondrial localization on immunostaining of HCEC, whereas GGT showed membrane localization.
  • FIG. ID eleven putative glutamine transporters had been screened in HCEC.
  • HCEC expressed the following ten transporters: SLC1A5, Na + - glutamine/neutral amino acid antiport; SLC6A19, Na + - glutamine co-transport; SLC7A5, glutamine/ large neutral amino acid antiport; SLC7A8, glutamine/ small neutral amino acid antiport; SLC38A1, Na + -glutamine cotransport; SLC38A2, Na + -glutamine cotransport; SLC38A3, Na + -glutamine/H + antiport; SLC38A5, Na+-glutamine/H+ antiport; SLC38A7, Na + - glutamine/H + antiport; SLC38A8, Na + -Neutral Amino Acid Transporter.
  • Glutamine contributes to about half of the TCA cycle intermediate pool found in CE.
  • the inventors investigated whether CE utilizes aqueous humor glutamine via active uptake by glutamine transporters and the conversion of glutamine to glutamate through GGT/EAATs complex.
  • FIG. 2A glutamine and/or glutamate can be metabolized via the TCA cycle in mitochondria to produce energy.
  • glutamine-derived ammonia release in HCEC were examined.
  • FIG. 2B dose-dependent increases of ammonia production were observed when glutamine concentration increased, suggesting that CE may utilize glutamine efficiently.
  • HCEC cells were fed 4 mM of U- C5-glutamine in the presence of 2.5 g/L (13.9 mM) glucose, and gas chromatography mass spectrometry (GC/MS) was used to measure the TCA cycle intermediates derived from 13 C labeled glutamine.
  • GC/MS gas chromatography mass spectrometry
  • glutamine sourced carbons contribute to about 60% of the TCA cycle intermediate pool.
  • Glucose was another major source for TCA cycle intermediates in HCEC (FIG. 5).
  • 1 g/L (5.6 mM) and 2.5 g/L (13.9 mM) glucose did not change the percent distribution of TCA cycle intermediates (FIG. 5B), suggesting that HCECs may prefer metabolizing glutamine in the TCA cycle even in the presence of sufficient glucose.
  • Glutamine supplies ATP for the CE pump function.
  • the immortalized HCEC cell line it was observed that more than half of the TCA cycle intermediates originated from glutamine.
  • glutamine may have been used for ATP generation to supply energy for CE fluid transport.
  • the intracellular ATP content in HCEC was measured using conditional DMEM medium that indicated the following: 1) Glc/Gln: 5 g/L glucose + 4 mM glutamine; 2) -/Gin: 4 mM glutamine; 3) Glc/-: 5 g/L glucose; 4) -/-: neither glucose nor glutamine.
  • the concentration of ATP was the highest in Glc/Gln medium, and interestingly only slightly lower in -/Gin, but significantly lower in Glc/- and -/-.
  • the results indicate that glucose can sustain half of the CE energy supply, consistent with GC-MS data that more than half of TCA intermediates were labeled when cultured with U- 13 C6-glucose and unlabeled L-glutamine.
  • CE in vivo shows a similar active glutamine metabolism.
  • the effect of glutamine supplementation on perfused freshly dissected ex vivo rabbit corneas was examined. If glutamine is beneficial for energy production, the corneal thickness should be better maintained ⁇ i.e., thinner) over a prolonged perfusion period as a result of better pump activity.
  • central corneal thickness (CCT) was 2.5 ⁇ less in glutamine supplemented corneas after 3.5 h of perfusion.
  • glutamine supplementation facilitates a faster deswelling rate.
  • the Ringer's solution was collected and residual [glucose] and [glutamine] was measured by GC-MS.
  • the glucose and/or glutamine consumption rate per cell was estimated from the total glutamine/glucose consumed and total corneal endothelial cell count was determined using Alizarin Red staining.
  • 0.5- 0.7 pmol/cell/h glucose and 0.3-0.6 pmol/cell/hr glutamine was consumed (FIG. 3D).
  • Glutaminolysis has been shown to provide an essential component of CE metabolism that supports its crucial physiological pump function.
  • the inventors showed: 1) expression of GLS1 (kidney type), GLS2 (liver type) and GGT ( ⁇ -glutamyl-transpeptidase, membrane form) enzymes that can facilitate glutamine deamination; 2) the expression of a wide variety of Na + - glutamine, H + -glutamine transporters and glutamate transporters; 3) that glutamine contributed -60% of carbons in TCA cycle intermediates; and 4) that glutaminolysis sustained the ATP level in CE and in turn supported pump function.
  • Glutaminolysis metabolism in CE is conserved across all of the species investigated: rabbit, mouse and human.
  • CE Unlike tumor cells that manifest active glutaminolysis metabolism after metabolic reprogramming, or renal proximal tubule epithelium upregulation of glutaminolysis in response to acidosis, the active glutaminolysis in CE is present in normal corneal endothelium fulfilling its physiological function. Since CE does not proliferate in vivo, glutaminolysis is mainly dedicated to supporting energy metabolism. Previously, glucose was the only substrate thought as an energy source for CE. See Zurawski, C.A., et al. (1989), Glucose consumption in cultured corneal cells, CURRENT EYE RESEARCH, 8: 349-355.
  • CE pump function can be inhibited 33% by 6-Diazo-5-oxo-L-norleucine (DON), a glutamine analogue with a wide inhibitory effect on glutaminase and GGT.
  • DON 6-Diazo-5-oxo-L-norleucine
  • GGT GGT
  • DON irreversibly inhibits 95% of glutaminase activity and 90% of GGT activity, thereby inhibiting all major routes of glutamine metabolism in cells.
  • the glutaminolysis works cooperatively together with the membrane ammonia transporter SLC4A11 to maintain the energy supply for CE fluid transport, shedding some light on the pathophysiological changes in CE due to loss of SLC4A11 function.
  • Mutations in human Slc4al 1 gene are causative of CHED and Harboyan Syndrome, and are associated with FECD and Peters anomaly. All of the above endothelial dystrophies share common signs of corneal edema and endothelial degeneration, suggesting an essential functional role of SLC4A11 in maintaining corneal endothelium health and physiological function.
  • the model suggests ammonia transport function of SLC4A11 facilitates ammonia detoxification by removing NH 3 in corneal endothelium.
  • Loss of Slc4al l expression in the mouse leads to corneal endothelial dystrophy and secondary changes very similar to human CHED.
  • generalized ammonia toxicity in Slc4aH ⁇ ⁇ murine corneal endothelium was observed as revealed by nitrotyrosine staining.
  • expressions of three major enzymes catalyzing the first step of deamination in glutaminolysis Glsl, Gls2 and Ggt were altered in Slc4aH ⁇ ⁇ .
  • FECD is associated with multiple genes in which Slc4al l mutations are thought to contribute about 11% of FECD. Nevertheless, despite the diverse genetic background the expression of SLC4A11 mRNA in FECD is reduced. Given the upregulated GLS1 and downregulated GLS2 expression observed in Slc4all " CHED mouse CE, the expression of GLS1 and GLS2 in FECD patients' CE was investigated (FIG. 7). A similar trend of GLS1 upregulation and GLS2 downregulation in response to SLC4A11 downregulation in FECD patients was observed, but due to the diverse genetic background of FECD, the difference was not resolved with traditional statistical testing.
  • GSH oxidized glutathione
  • GSH is a thiol tripeptide (y-glutamyl- cysteinyl-glycine) that neutralizes oxygen free radicals and itself becomes oxidized glutathione disulfide (GSSG).
  • Extracellular GSSG can elevate intracellular GSH in CE measured by 35 S-GSSG radioactive tracing.
  • RNA extraction, PCR and qPCR and Nested PCR Total RNA, from human corneal endothelium tissue, mouse endothelium tissue, immortalized HCEC cell line, and FECD patient's corneal endothelium tissue were extracted and purified via RNeasy mini kit (#74104, Qiagen) with DNase digestion (#79254, Qiagen).
  • PCR, Nested PCR and real-time qPCR were performed with human and murine gene primers listed in Tables 1 and 2 respectively. Details can be found in supplemental experimental procedures.
  • Immortalized HCEC culture Immortalized HCEC were cultured at 37°C, 5% C02 in appropriate plates or flasks coated with undiluted FNC Coating Mix® (AthenaES). Complete medium (OptiMEM-I®; Invitrogen) contains 8% FBS (Hyclone Laboratories Inc.), EGF 5 ng/mL (Millipore), pituitary extract 100 ⁇ g/mL (Hyclone Laboratories), calcium chloride 200 mg/L, 0.08% chondroitin sulfate (Sigma-Aldrich), gentamicin 50 ⁇ g/mL, and antibiotic/antimycotic solution diluted 1 : 100 (Invitrogen).
  • Intracellular ATP assay HCEC were seeded at 1.5* 10 4 /ml in 12-well plate to sub- confluent, then put under serum-free conditional DMEM medium (glucose free, glutamine-free, pyruvate-free, Gibco #A1443001) with glucose and/or glutamine supplementation for 12 hours before measurement. ATP is extracted by boiling water method, and measured by luciferin- luciferase based ATP assay kit (A22066, Molecular Probes). See Yang, N.C., et al. (2002), A convenient one-step extraction of cellular ATP using boiling water for the luciferin-luciferase assay of ATP .
  • BR Base contains (mM): 148.5 Na + , 4 K + , 1.4 Ca2 + , 0.6 Mg2 + , 103.2 CI " , 28.5 HC0 3 " .
  • the addition of 5 mM glucose and/or 2 mM glutamine was made to BR base to get BR Glc/Gln, BR Glc/-, and BR -/Gin. All solutions were adjusted to pH 7.5 with IN HC1 and osmolarity 295 mOsm/L with mannitol.
  • rabbit or human cornea buttons with sclera skirt was mounted to a Barron® artificial anterior chamber (K20-2125, Katena Products Inc.) with corresponding Ringer's. Corneal thickness was monitored over time with Optical Coherent Tomography (OptoVue iVue SD-OCT). The corneal surface was kept moist with Artificial tears (Refresh®) after each measurement, and the cornea was kept in 37 °C incubator between measurements. Corneal Endothelial cells were stained with Alizarin red and counted after experiments for calculation of glutamine and/or glucose consumption rate. See supra Supplemental Experimental Procedures for more details.
  • RNA extraction Healthy human corneal endothelium: Human donor cornea were obtained from Indiana Lion Eye Bank in 4°C Optisol® GS medium. Corneal endothelium with Descemet's membrane was peeled off in Corneal Viewing Chamber (Stephens Instruments) using Submerged Cornea Using Backgrounds Away (SCUBA) technique. Peeled cornea endothelium sheet was processed immediately or stored in RNAlater® (AM7020, Ambion) at 4°C. Corneal endothelium sheet was rapidly frozen in liquid nitrogen and grinded following by RNeasy column (Qiagen) purification. Mouse corneal endothelium: Mouse cornea with sclera skirt was dissected from the globe.
  • Corneal endothelium with Descemet's membrane was peeled off followed by RNA extraction similar as described above.
  • FECD corneal endothelium Patients diseased cornea endothelium samples were collected during Decrements Membrane Endothelial Keratoplasty (DMEK) surgery, and shipped on ice overnight in Optisol® GS medium. Cornea endothelium sheet was put into RNAlater® in 4°C upon arrival or processed immediately. RNA extraction steps were the same as described above.
  • Immortalized HCEC cell line HCEC cells were culture in OptiMEM complete medium to confluent, RNA extraction steps were the same as described above. [00118] PCR and qPCR and Nested PCR.
  • RNA-to-cDNA Kit (Applied Biosy stems) at 10 ng RNA/ A L reverse transcription. Sequences of human and mouse gene primers used are listed in Supplemental Table 1 and Table 2 respectively. Conventional PCR was performed with MyCycler Thermal cycler (Bio-Rad) following the AmpliTaq® 360 DNA Polymerase protocol (Applied Biosystems). Real-time qPCR reactions were set up in triplicate using SYBR Green PCR Master Mix (Agilent Technologies). All assays used similar amplification efficiency, and a 2 _ ⁇ experimental design was used for relative quantification and normalized to ACTB (mouse) or GAPDH (human) for differential expression levels of target genes. Nested PCR was conducted for genes with no CT value in real-time qPCR. An additional 40 cycles of PCR are conducted on reverse transcription PCR product using the same gene primer.
  • Serum-free DMEM conditional medium was made using DMEM (glucose free, glutamine-free, pyruvate-free, GIB CO® #A1443001) supplemented with calcium chloride 200 mg/L, 0.08% chondroitin sulfate (Sigma-Aldrich), and the corresponding isotope-labeled glucose and/or glutamine.
  • DMEM glucose-free, glutamine-free, pyruvate-free, GIB CO® #A1443001
  • calcium chloride 200 mg/L 0.08% chondroitin sulfate (Sigma-Aldrich)
  • Fresh Rabbit Corneal Perfusion Freshly dissected rabbit cornea with conjunctiva and lids was atraumatically mounted on a plastic ring and pressed on a fixed hollow rod. Then lids and conjunctiva were everted over the globe and pulled down tightly to the rod and tied with a suture on mounting ring. After mounting, sclera posterior to the suture were removed with scalpel and scissors, as well as vitreous, ciliary body-iris, and lens to reveal the corneal endothelial surface. Then an anterior metal platform and a posterior plastic cap with openings connected to tubing were clamped against the mounting ring to form an artificial anterior chamber. The central tube provided inflow, and the two side tubes provided outflow.
  • the cornea chamber was fitted in a metal jacket with embedded electric heater and thermistor to maintain 37 °C.
  • Ringer's solutions contain (mM): 153.5 Na + , 4 K + , 1.4 Ca 2+ , 0.6 Mg 2+ , 113.2 CI " , 1 HP0 4 2" , 16.4 gluconate- and 28.5 HCO 3 " . All solutions were equilibrated with 5% C0 2 , pH adjusted to 7.5 and osmolarity adjusted to 295 mOsm/L with sucrose. 5 mM glucose and/or 1 mM glutamine were added. Perfusion solutions were maintained at 37°C in a water bath during experiment. [00123] Revised Corneal De-Swelling Experiments.
  • rabbit cornea rabbit eye balls stored on ice were shipped overnight from a regional supplier (Pel freez Biologicals). Corneal thickness was measured immediately before dissecting as data point of time zero by Optical Coherent Tomography with anterior segment attachment (OptoVue iVue SD-OCT). Then eye balls were assigned to experimental groups 1) Glc/Gln 2) Glc/- and 3) -/Gin and dissected to cornea button with sclera skirt, rinsed and mounted with corresponding Ringer's solution. Cornea with sclera skirt was mounted on to Barron® artificial anterior chamber (K20-2125, Katena Products, Inc.) and anterior chamber was filled with 350 ⁇ _, Ringer's solution corresponding to the assigned group.
  • Barron® artificial anterior chamber K20-2125, Katena Products, Inc.
  • Corneal thickness is monitored using OptoVue iVue SD- OCT with anterior segment attachment every 15 min till 150 min after mounting.
  • Artificial tears (Refresh®) is applied on epithelial surface every 15 min after OCT measurement, and Barron Chamber with mounted cornea is put in 37 °C incubator when not being measured.
  • Final fluid about 350 ⁇ .) after 150 min experiment in artificial anterior chamber is collected and prepared for GC-MS analysis for residual glutamine and glucose.
  • cornea button is stained with Alizarin Red for corneal endothelium visualization and counted under light microscope.
  • Total number of corneal endothelium cells per cornea was calculated as the product of corneal endothelium density and cornea dome surface area.
  • rabbit cornea diameter 13.2 mm and radius of curvature 7.26 mm were used for calculation.
  • Rabbit corneal endothelium glutamine and/or glucose consumption rate per cell was estimated with total glutamine/glucose consumed divided by total corneal endothelial cell count.
  • human donor cornea De-identified human donor cornea with sclera skirt was obtained from Indiana Lion Eye Bank, stored in 4 °C upon arrival until experiments. Cornea with sclera skirt was rinsed with ice-cold BR base solution to get rid of Optisol cornea storage medium, then soaked in ice-cold BR base solution for 1 h to let it swell. Then the human cornea was mounted similarly as rabbit cornea with 300 ⁇ _, BR Glc/Gln or BR Glc/-, and monitored for central corneal thickness with OCT every 15 min for 165min. Artificial tears were applied after each measurement, and Barron Chamber with mounted cornea was put in 37 °C incubator between measurement.
  • Final fluid (about 300 ⁇ ,) is collected and prepared for GC-MS analysis for residual glutamine and glucose.
  • total corneal endothelium cell count per cornea was estimated with Alizarin Red visualization of corneal endothelium under light microscope, and human cornea diameter 11.5 mm and radius of curvature 7.75 mm were used for calculation. Rabbit and human corneal endothelium density and total cell count were shown in Table 3.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Dermatology (AREA)
  • Molecular Biology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Cornea endothelium is the posterior cell monolayer of cornea that maintains corneal clarity via its pump function. This paper discloses that glutamine metabolism plays a crucial role in maintaining the energy supply for corneal endothelium physiological pump function. This glutaminolysis is present in healthy cornea endothelium and conserved across species. And it is disrupted when there is loss of ammonia-linked SLC4A11 transporter function, in conditions like Congenital Hereditary Endothelial Dystrophy (CHED) and Fuch's Endothelial Corneal Dystrophy (FECD).

Description

COMPOSITIONS AND METHODS FOR TREATING AND/OR REDUCING
CORNEAL DYSTROPHY
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional Application No. 62/429,559, filed December 2, 2016, the entire disclosure of which is hereby expressly incorporated by reference herein.
STATEMENT OF GOVERNMENTAL RIGHTS
[0002] This invention was made with government support under EY008834 awarded by National Institutes of Health. The government has certain rights in the invention.
FIELD OF THE INVENTION
[0003] Various aspects and embodiments disclosed herein relate generally to the modelling, treatment, prevention, and diagnosis of diseases characterized by the formation of corneal dystrophy.
BACKGROUND
[0004] Cornea Endothelium (CE) is a cell monolayer on the posterior surface of the cornea responsible for maintaining corneal transparency. This abundant expression of Na+-K+- ATPase and numerous secondary membrane transporters facilitate an outward osmotic driving force that counteracts an inward imbibition pressure from corneal stromal glycosaminoglycans, thereby maintaining corneal hydration, thickness, and clarity. Anterior chamber aqueous humor bathes its apical surface and provides all nutrients for the CE. The robust transport activity places a heavy metabolic demand on the CE, which is consistent with a high mitochondrial density that is second in the human body only to photoreceptors. The dependence on mitochondrial activity is consistent with reports of CE dysfunction associated with a number of mitochondrial disorders, such as Pearson Syndrome, Kearns-Sayre syndrome, and Leigh's syndrome.
[0005] Compromised CE loses its fluid transport efficacy, resulting in corneal edema and vision loss. The CE does not proliferate or regenerate in vivo, and there is a continuous decrease in CE cell density throughout life. Therefore, cell protection is a high priority for patients with corneal endothelial dystrophies and/or for people undergoing intraocular surgeries, such as cataract surgery. Endothelial corneal dystrophies are inherited disorders characterized by degenerated corneal endothelium and/or accelerated cell loss that may result in corneal edema, visual loss and require surgical transplantation.
[0006] Among genes that are associated with endothelial corneal dystrophies, is SLC4A11, at least one gene that encodes a membrane transporter. Mutations in SLC4A11 may cause Congenital Hereditary Endothelial Dystrophy (CHED) and Harboyan Syndrome (endothelial dystrophy with perceptive deafness). See Vithana, E.N., et al. (2008), SLC4A11 mutations in Fuchs endothelial corneal dystrophy. HUMAN MOLECULAR GENETICS, 17: 656- 666. SLC4A11 mutations are also present in several genes that cause age-related Fuchs Endothelial Corneal Dystrophy (FECD) and Peters anomaly (Corneal opacity resulted from dysgenesis of posterior layers of the cornea). In a normal healthy human CE, SLC4A11 is usually highly expressed, suggesting an important role in CE function. Further, the expression of SLC4A11 in FECD patients is significantly decreased despite the diverse genetic backgrounds found in FECD patients. Moreover, three strains of Slc4aH~ ~ mice have been shown not only to recapitulate various degrees of corneal endothelial and/or neural auditory phenotypes, but to also exhibit kidney phenotypes suggesting that of SLC4A11 is involved in multiple systems. See, for example, Groger, N. et al. (2010), SLC4A11 prevents osmotic imbalance leading to corneal endothelial dystrophy, deafness, and polyuria, THE JOURNAL OF BIOLOGICAL CHEMISTRY, 285: 14467-14474.
[0007] SLC4A11 has been characterized as a novel H3:2H+ co-transporter. See Zhang, W. et al. (2015), Human SLC4A11 Is a Novel NH3/H+ Co-transporter, THE JOURNAL OF BIOLOGICAL CHEMISTRY, 290: 16894-16905.
[0008] The CE may require high expression of an ammonia-linked transporter. The existence of a specific Ammonia transporter suggests a highly active amino acid metabolism. The amino acid glutamine can contribute up to 90% of ammonia generated in some cell types concentrating of glutamine in aqueous humor [glutamine] is about 0.63 mM similar to that of serum (0.61 mM). Many stem cells and/or transformed cancer cells utilize glutamine as synthetic intermediates for cell growth. This study investigated whether the non-regenerating well-differentiated CE uses glutamine mainly for ATP generation to supply energy for its abundant Na -K -ATPase activity and support the physiological pump function necessary to maintaincorneal clarity.
[0009] Glutaminolysis via mitochondrial glutaminase is a highly dynamic and regulated metabolic pathway. The substrate (glutamine) and/or products of its metabolism (NH3 & glutamate) may provide short-term activity regulation while acidosis and oncogene s/proto- oncogenes such as c-Myc, p53 and p63 can affect long-term expressions. Accordingly, a Slc4al l-/- mouse model of Congenital Hereditary Endothelial Dystrophy (CHED), may exhibit altered ammonia handling resulting in the disruption of CE glutamine metabolism.
[0010] In this study, the role of glutamine metabolism as an energy source for the CE pump function has been investigated using human, rabbit and/or mouse CE. Using a Slc4aH~ ~ mouse, the effect of Slc4al 1 in the absence of CE ammonia homeostasis and the expression of glutaminolysis enzymes were examined.
SUMMARY
[0011] A first embodiment includes a method of protecting cornea endothelium, comprising the steps of: providing a patient diagnosed with corneal endothelial dystrophy, undergoing intraocular surgeries, and/or post-operative care, with a therapeutic regime that includes at least one therapeutically effective dose of at least one composition comprising glutamine, alpha-ketoglutarate, and/or any stabilized/direvatized forms thereof.
[0012] A second embodiment includes the method according to the first embodiment, wherein the at least one composition further comprises glucose.
[0013] A third embodiment includes a method of protecting or enhancing the viability of a corneal endothelium, comprising the steps of: contacting at least one portion of a corneal endothelium with a therapeutic regime that includes at least one therapeutically effective dose of at least one composition comprising glutamine, alpha-ketoglutarate, and/or any stabilized/direvatized forms thereof.
[0014] A fourth embodiment includes the method according to the third embodiment, wherein the at least one composition further comprises glucose.
[0015] A fifth embodiment includes the method according to any one of the third and the fourth embodiments, wherein the corneal endothelium is damaged or stressed. [0016] A sixth embodiment includes the method according to any one of the third to the fifth embodiments, wherein the step of contacting is performed prior to transplantation, after transplantation, during transplantation, and/or during transportation of said coreal endothelium.
[0017] A seventh embodiment includes the method according to any one of the third to the sixth embodiments, wherein the corneal endothelium is damaged or stressed after trauma, and/or an injury comprising chemical injury, hypoxic injury, thermal/freezng injury, radiation injury, photoxic injury, reactive oxidation injury, and/or any other forms of injury occurred by localized nutritional dysfunction, corneal inlays, implants, and/or contact lenses.
[0018] An eighth embodiment includes a method of treating corneal endothelial dystrophies, comprising the steps of: treating a patient diagnosed with corneal endothelial dystrophies with at least one therapeutically effective composition that inhibits and/or reduces glutaminolysis.
[0019] A nineth embodiment includes the eighth embodiment, wherein the at least one therapeutically effective composition comprises at least one glutamine analogue, at least one glutaminase inhibitor, at least one gamma-glutamyl-transpeptidase (GGT) inhibitor, and/or at least one membrane glutamate excitatory amino acid transporter (EAAT) inhibitor.
[0020] A tenth embodiment includes the method according to any one of the eighth and the nineth embodiments, wherein the at least one glutaminase inhibitor comprises a glutaminase type 1 (GLS1) inhibitor.
[0021] An eleventh embodiment includes the method according to any one of the eighth to the tenth embodiments, wherein the at least one glutamine analogue comprises 6-Diazo-5-oxo- L-norleucine (DON).
[0022] A twelfth embodiment includes the method according to any one of the eighth to the tenth embodiments, wherein the corneal endothelial dystrophy is at least one dystrophy selected from the group consisting of: Congenital Hereditary Endothelial Corneal Dystrophy, Fuchs Endothelial Corneal Dystrophy, Posterior Polymorphous Corneal Dystrophy, and/or Schnyder Crystalline Corneal Dystrophy.
[0023] A thirteenth embodiment includes a therapeutic composition for protecting cornea endothelium, comprising: at least one agent comprising glutamine, alpha-ketoglutarate, dimethyl alpha-ketoglutarate, and any stabilized/direvatized forms thereof; at least one pharmaceutically acceptable salt; and at least one physiological buffer. [0024] A fourteenth embodiment includes a therapeutic composition for treating corneal endothelial dystrophies, comprising: at least one therapeutically effective agent that inhibits and/or reduces glutaminolysis; at least one pharmaceutically acceptable salt; and at least one physiological buffer.
[0025] A fifteenth embodiment includes the method of the fourteenth embodiment, wherein the at least one therapeutically effective agent comprises at least one glutamine analogue, at least one glutaminase inhibitor, at least one gamma-glutamyl-transpeptidase (GGT) inhibitor, and/or at least one membrane glutamate excitatory amino acid transporter (EAAT) inhibitor.
[0026] A sixteenth embodiment includes a kit comprising at least one composition according to any one of the twelfth to the fifteenth embodiments, and at least one container.
BRIEF DESCRIPTION OF SEQUENCES
[0027] SEQ ID NO: 1. ATCATCCTCGAAGCAGTCAACCTC
[0028] SEQ ID NO:2. CATGACTGATTCCTTCTCAGAGGC
[0029] SEQ ID NO :3. CTGTAATACAGGGCTGATAGAGTG
[0030] SEQ ID NO:4. TTCATATGCTCCCTGAAGCCTAGG
[0031] SEQ ID NO:5. CTCCCATCTCATCTACATCTCCTG
[0032] SEQ ID NO:6. GAAGATGAGAAGAGCTGGTTGGTC
[0033] SEQ ID NO:7. GAGACTTGGAACCTCATTGCTACC
[0034] SEQ ID NO : 8. CTGGAC AC AGAAATAGCC AAGAGG
[0035] SEQ ID NO:9. TGGGTGTTTACTGGCAACACAAGC
[0036] SEQ ID NO: 10. TTTCTCACCACCCACACCAAAGTC
[0037] SEQ ID NO: 11. TTGTTGCTGTGATCCTCACAGTGC
[0038] SEQ ID NO: 12. T AGATGAC C A AGGGA ATGC TGAC C
[0039] SEQ ID NO: 13. TTGCTTCCAGCAGTGGAAAATGGG
[0040] SEQ ID NO: 14. TTGCACTGTTTTCCCTAGCTAACC
[0041] SEQ ID NO: 15. AGCAGATGCTGTTTCCAAACCAGG
[0042] SEQ ID NO: 16. TCACCCTAGTGGTTTCCTCCATGC
[0043] SEQ ID NO: 17. CAAGAAGTTCCAACTTGGCTGTGC
[0044] SEQ ID NO : 18. TTC AC ACTGCTGT AGAAGGTGAGG [0045] SEQ ID NO Λ9. GTGGATCTCTTGGCATAACCACTG
[0046] SEQ ID NO 20. CAGGCATGGAGAAGTTGAGAACTG
[0047] SEQ ID NO 21. TACACAAGCATCCTAGGCACTCTG
[0048] SEQ ID NO 22. AGACGTCAGCAGAAACTTCTGTCC
[0049] SEQ ID NO 23. ATGTTGGAAAAGAGCCGAGTGGAC
[0050] SEQ ID NO 24. AGTCACTTCAATGGAGCACAGCTG
[0051] SEQ ID NO 25. TGTGGAGGTCACTTGTGAATCAGG
[0052] SEQ ID NO 26. AGAGACACCAACTTCTGGCAGAAG
[0053] SEQ ID NO 21. TTATTGGAGGGTTGCTGCAAGCAC
[0054] SEQ ID NO :28. AGCACAATGACCATAGTGACCAGG
[0055] SEQ ID NO :29. GGAGGACAGATTGTGACTGTAAGC
[0056] SEQ ID NO :30. GCTTTCCCTGTGGTTCTTCATGTC
[0057] SEQ ID NO :31. CTGACAGCTCTCATGATCTCTTCC
[0058] SEQ ID NO :32. ACTCAGCACAATCACCATGGTCAC
[0059] SEQ ID NO :33. TGCTGAGCTTTGAGGAGACTGTAC
[0060] SEQ ID NO :34. TGAGTGACGAGGAAGTAGATGAGG
[0061] SEQ ID NO :35. TTCAAACAGTACCGCACCAAGACC
[0062] SEQ ID NO :36. TACCCGCAATGAGGAACACAATGC
[0063] SEQ ID NO :37. CCAAGTTTGTGGATGTGACTGAGG
[0064] SEQ ID NO :38. GGAGAGCTGAAGTCGTCCATTTCA
[0065] SEQ ID NO :39. GCAACATGAGCTCTGAGTTCTACG
[0066] SEQ ID NO AO. GGATGATTGAGGGACACATGGATG
[0067] SEQ ID NO A\ . AGACTGTCCACAAGAATCTCGACG
[0068] SEQ ID NO :42. ATGAAGACCACACAGTTCAGCTGG
[0069] SEQ ID NO :43. ACCTCAAGGAGAAGAAGTGCTTCC
[0070] SEQ ID NO :44. GACACATCATGCCCATGACATTGG
[0071] SEQ ID NO :45. CAGTCACTTCTTGACATGTCTGGG
[0072] SEQ ID NO :46. TTTCTGCTGGACAATGATGCAGGG
BRIEF DESCRIPTION OF THE FIGURES [0073] FIG. 1. Expression of glutaminase, glutamate transporters and glutamine transporters in corneal endothelium. (A) RT-PCR of human and mouse corneal endothelium tissue for glutaminase (GLS1, GLS2, GGT), glutamate dehydrogenase (GDH) and glutamate transporters (EAAT1-5); (B) Immunofluorescence staining of human cornea section showing GLS1, GLS2 and GGT expression in cornea endothelium; (C) RT-PCR of HCEC showing expression of GLS1, GLS2, GGT, EAAT1-3, ten glutamine transporters as well as SLC4A11. (D) Immunofluorescence staining of HCEC showing cellular localization of GLS1 (mitochondria) and GGT (membrane).
[0074] FIG. 2. Glutamine contributes to TCA cycle in HCEC. (A) Schematic illustration of proposed glutamine metabolism in corneal endothelium; (B) Ammonia release is dose- dependent on glutamine concentration in HCEC culture; (C) GC-MS results show -60% of carbons in TCA intermediates are from glutamine.
[0075] FIG. 3. Glutamine supplies energy for corneal endothelial pump function. (A) ATP level in cultured HCEC in conditional mediums (n=23 in each); Glc/Gln vs -/Gin, p = 0.829; Glc/Gln vs Glc/-, p = 0.00083; Glc/- vs -/Gin, p = 0.002; Glc/Gln vs -/-, p < 10"6. (B) Central corneal thickness (CCT) is better maintained with glutamine-supplemented perfusion. Left: time course of CCT change. Right: linear slope constant comparison between Glc/-(r2 = 0.99) and Glc/Gln (r2 = 0.98), p < 0.0001. (C) Cold stored rabbit cornea deswelling curve in various Ringer's. Left: time course of CCT changes. Right: first-order exponential decay rate constant comparison between groups: Glc/Gln (r2 = 0.93) vs Glc/- (r2 = 0.90), p < 0.0001; Glc/- vs -/Gin (r2 = 0.96), p < 0.0001. (D) Rabbit cornea endothelium glucose and glutamine consumption rate. (E) Cold stored human cornea deswelling curve in various Ringer's. Left: time course of CCT changes. Right: first-order exponential decay rate constant comparison between groups: Glc/Gln (r2 = 0.92) vs Glc/- (r2 = 0.88), p < 0.0001. (F) Human cornea endothelium glucose and glutamine consumption rate. Error bar: mean ± s.e.m, ** is p < 0.01; *** is p < 0.001.
[0076] FIG. 4. Slc4aH~ ~ mouse cornea endothelium shows sign of ammonia toxicity and altered glutaminolysis enzymes. (A) Photography of Slc4all+/+ and Slc4aH~ ~ mouse cornea, shows diffuse edema (increase of light reflection in clear stroma) in 12-week Slc4aH~ ~. (B) H&E staining of 40-week Slc4all+/+ and Slc4aH~ ~ mouse cornea section shows endothelial vacuolation and Descemet's membrane thickening. (C) Nitrotyrosine immunostaining shows increased intensity in 40-week Slc4all" corneal endothelium, suggesting ammonia toxicity.
(D) Quantification of nitrotyrosine staining by mean fluorescence intensity (MFI), p = 0.044.
(E) Real-time qPCR of 12-week Slc4all+/+ and Slc4aH~ ~ mouse cornea endothelium shows upregulated Glsl (p = 0.0295) and none-detectable (N.D.) Gls2 in Slc4all^'. (F) Nested-PCR verification of Gls2 and Ggt are not detectable in 12-week Slc4aH~ ~ cornea endothelium. (G) Immunostaining verification of Glsl and Gls2 expression changes in 40-week Slc4all+/+ and Slc4aH~ ~ mouse cornea endothelium are consistent with real-time qPCR results of 12-week mouse. Error bar: mean ± s.e.m, * is p < 0.05.
[0077] FIG. 5. Verification of glucose contribution to TCA cycle in HCEC. (A) GC-MS results show -50% of carbons in TCA intermediates are from glucose. (B) Percentage contribution of glucose into TCA intermediates does not change even in presence of sufficient glucose.
[0078] FIG. 6. (A) Picture of cornea mounted on to Barron Artificial Anterior chamber with Ringer's solution. (B) Alizarin Red staining visualization of rabbit corneal endothelium after deswelling experiment. Cell density was counted using these images. (C) Alizarin Red staining visualization of human corneal endothelium after deswelling experiment. Cell density was counted using these images.
[0079] FIG. 7. Real-time qPCR of healthy human cornea endothelium (n = 4) and FECD cornea endothelium (n = 8) shows upregulated GLS1 (p = 0.751), downregulated GLS2 (p = 0.069) and downregulated SLC4A11 (p = 0.568).
[0080] FIG. 8. A diagram illustrating proposed mechanisms involved in human corneal endothelium.
DESCRIPTION
[0081] For the purposes of promoting an understanding of the principles of the novel technology, reference will now be made to the preferred embodiments thereof, and specific language will be used to describe the same. It will nevertheless be understood that no limitation of the scope of the novel technology is thereby intended, such alterations, modifications, and further applications of the principles of the novel technology being contemplated as would normally occur to one skilled in the art to which the novel technology relates are within the scope of this disclosure and the claims. [0082] As used herein, unless explicitly stated otherwise or clearly implied otherwise the term 'about' refers to a range of values plus or minus 10 percent, e.g. about 1.0 encompasses values from 0.9 to 1.1.
[0083] As used herein, unless explicitly stated otherwise or clearly implied otherwise the terms 'therapeutically effective dose,' 'therapeutically effective amounts,' and the like, refers to a portion of a compound that has a net positive effect on the health and well being of a human or other animal. Therapeutic effects may include an improvement in longevity, quality of life and the like these effects also may also include a reduced susceptibility to developing disease or deteriorating health or well being. The effects may be immediate realized after a single dose and/or treatment or they may be cumulative realized after a series of doses and/or treatments.
[0084] Pharmaceutically acceptable salts include salts of compounds of the invention that are safe and effective for use in mammals and that possess a desired therapeutic activity. Pharmaceutically acceptable salts include salts of acidic or basic groups present in compounds of the invention. Pharmaceutically acceptable acid addition salts include, but are not limited to, hydrochloride, hydrobromide, hydroiodide, nitrate, sulfate, bisulfate, phosphate, acid phosphate, isonicotinate, acetate, lactate, salicylate, citrate, tartrate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzensulfonate, p-toluenesulfonate and pamoate (i.e., l, l'-methylene-bis-(2-hydroxy-3-naphthoate)) salts. Certain compounds of the invention may form pharmaceutically acceptable salts with various amino acids. Suitable base salts include, but are not limited to, aluminum, calcium, lithium, magnesium, potassium, sodium, zinc, and diethanol amine salts. For addition information on some pharmaceutically acceptable salts that can be used to practice the invention please reviews such as Berge, et al., 66 J. PHARM. SCI. 1-19 (1977), Haynes, et al, J. Pharma. Sci., Vol. 94, No. 10, Oct. 2005, pgs. 2111-2120 and the like.
[0085] The term, "Pharmaceutically acceptable salts" as used herein unless defined otherwise refers to: Pharmaceutically acceptable salts, and common methodology for preparing them, are known in the art. See, e.g., P. Stahl, et al, HANDBOOK OF PHARMACEUTICAL SALTS: PROPERTIES, SELECTION AND USE, (VCHA/Wiley-VCH, 2002); S.M. Berge, et al, "Pharmaceutical Salts," Journal of Pharmaceutical Sciences, Vol. 66, No. 1, January 1977. [0086] Pharmaceutical formulation: The compounds of the invention and their salts may be formulated as pharmaceutical compositions for administration. Such pharmaceutical compositions and processes for making the same are known in the art for both humans and non- human mammals. See, e.g., REMINGTON: THE SCIENCE AND PRACTICE OF PHARMACY, (A. Gennaro, et al., eds., 19th ed., Mack Publishing Co., 1995). The pharmaceutical formulations of the present invention include those suitable for oral, parenteral (including subcutaneous, intradermal, intramuscular and intravenous) and rectal administration. The formulations may be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. All methods include the step of bringing into association the active ingredient, i.e., the compound or salt of the present invention, with the carrier. In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredient with a liquid carrier or, a finely divided solid carrier or both, and then, if necessary, forming the associated mixture into the desired formulation.
[0087] The pharmaceutical formulations of the present invention suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions, and may also include an antioxidant, buffer, a bacteriostat and a solution which renders the composition isotonic with the blood of the recipient, and aqueous and non-aqueous sterile suspensions which may contain, for example, a suspending agent and a thickening agent. The formulations may be presented in a single unit-dose or multi-dose containers, and may be stored in a lyophilized condition requiring the addition of a sterile liquid carrier prior to use.
[0088] The Phrase Pharmaceutically acceptable carrier, unless stated or implied otherwise, is used herein to describe any ingredient other than the active component(s) that maybe included in a formulation. The choice of carrier will to a large extent depend on factors such as the particular mode of administration, the effect of the carrier on solubility and stability, and the nature of the dosage form.
[0089] A tablet may be made by compressing or moulding the active ingredient with the pharmaceutically acceptable carrier. Compressed tablets may be prepared by compressing in a suitable machine the active ingredient in a free-flowing form, such as a powder or granules, in admixture with, for example, a binding agent, an inert diluent, a lubricating agent, a disintegrating and/or a surface active agent. Moulded tablets may be prepared by moulding in a suitable machine a mixture of the powdered active ingredient moistened with an inert liquid diluent. The tablets may optionally be coated or scored and may be formulated so as to provide slow or controlled release of the active ingredient.
[0090] The term, "treating" as used herein unless stated or implied otherwise, includes administering to a human or an animal patient at least one dose of a compounds, treating includes preventing or lessening the likelihood and or severity of a at least one disease as well as limiting the length of an illness or the severity of an illness it may or may not result in a cure of the disease.
[0091] As used herein, "inhibition" or "inhibitory activity" each encompass whole or partial reduction of activity or effect of an enzyme or all and/or part of the pathway.
[0092] A "therapeutically effective amount" in general means the amount that, when administered to a subject or animal for treating a disease, is sufficient to affect the desired degree of treatment for the disease.
[0093] As used herein, a "therapeutically effective agent" includes, but is not limited to, glutamine analogues, glutaminase (e.g., GLS 1 and/or GLS2) inhibitors, gamma-glutamyl- transpeptidase (GGT) inhibitors, and/or membrane glutamate excitatory amino acid transporter (EAAT) inhibitors.
[0094] A "selective" inhibitor is one that has at least 2, 5, 10, 20, 50, 100, or 200 fold greater inhibitory activity (for example, as determined by calculation of IC50, ¾, or other measure of affinity or effect) for a particular isozyme of the inhibitor compared to other members of the family.
[0095] As used herein, "endothelial corneal dystrophy" includes, but is not limited to, posterior corneal dystrophies. Posterior corneal dystrophies include, but are not limted to, Congenital Hereditary Endothelial Corneal Dystrophy, Fuchs Endothelial Corneal Dystrophy, Posterior Polymorphous Corneal Dystrophy, and Schnyder Crystalline Corneal Dystrophy.
[0096] Human and/or mouse Corneal Endothelium (CE) expresses metabolic enzymes involved in glutaminolysis and glutamine and/or glutamate transporters. The expression of enzymes involved in glutaminolysis as well as glutamine and/or glutamate transporters in human and/or mouse CE tissue were examined. Conserved expressions of glutaminase (i.e, one of the enzymes involved in flutaminolysis) and glutamine and/or glutamate transporters were evident in both human and mouse CE. Both mitochondrial glutaminase, phosphate-activated glutaminase type 1 (GLS 1, kidney -type) and type 2 (GLS2, liver-type) were expressed in human and mouse CE and the expression of GLSl was higher than that of GLS2 in both human and mouse (FIG. 1A). Referring now to FIG. 1A, both human and mouse CE expressed gamma-glutamyl-transpeptidase (GGT), which had been shown to have a membrane glutaminase activity and to function along with membrane glutamate excitatory amino acid transporters (EAATs). In the immortalized human CE cell line (HCEC), the expressions of GLSl, GLS2, and GGT were detected (FIGs. 1C and ID). Referring now to FIG. IB, the expressions of GLSl, GLS2 and GGT in human CE tissue was verified by immunostaining healthy human donor cornea sections. Referring now to FIG. ID, the expression of GLSl revealed mitochondrial localization on immunostaining of HCEC, whereas GGT showed membrane localization. Referring now to FIG. ID, eleven putative glutamine transporters had been screened in HCEC. HCEC expressed the following ten transporters: SLC1A5, Na+- glutamine/neutral amino acid antiport; SLC6A19, Na+- glutamine co-transport; SLC7A5, glutamine/ large neutral amino acid antiport; SLC7A8, glutamine/ small neutral amino acid antiport; SLC38A1, Na+-glutamine cotransport; SLC38A2, Na+-glutamine cotransport; SLC38A3, Na+-glutamine/H+ antiport; SLC38A5, Na+-glutamine/H+ antiport; SLC38A7, Na+- glutamine/H+ antiport; SLC38A8, Na+-Neutral Amino Acid Transporter. Among these glutamine transporters, Na+-glutamine co-transporters (SLC1A5, SLC38A1), glutamine/large neutral amino acids antiporter (SLC7A5) and Na+-glutamine/H+ antiporter (SLC38A3, SLC38A7) showed the highest expression. For glutamate transport (EAATs), human CE tissue expresses EAAT1 < EAAT2 ~ EAAT3 (FIG. 1A), whereas HCEC expresses EAAT2 < EAAT1 < EAAT3 (FIG. 1C).
[0097] Glutamine contributes to about half of the TCA cycle intermediate pool found in CE. Given the high expression of enzymes and transporters involved in glutamine metabolism, the inventors investigated whether CE utilizes aqueous humor glutamine via active uptake by glutamine transporters and the conversion of glutamine to glutamate through GGT/EAATs complex. Referring now to FIG. 2A, glutamine and/or glutamate can be metabolized via the TCA cycle in mitochondria to produce energy. To test this hypothesis, glutamine-derived ammonia release in HCEC were examined. Referring now to FIG. 2B, dose-dependent increases of ammonia production were observed when glutamine concentration increased, suggesting that CE may utilize glutamine efficiently. To further investigate if glutamine metabolized via GLS in mitochondria is used to maintain TCA cycle, HCEC cells were fed 4 mM of U- C5-glutamine in the presence of 2.5 g/L (13.9 mM) glucose, and gas chromatography mass spectrometry (GC/MS) was used to measure the TCA cycle intermediates derived from 13C labeled glutamine. Referring now to FIG. 2C, glutamine sourced carbons contribute to about 60% of the TCA cycle intermediate pool. Glucose was another major source for TCA cycle intermediates in HCEC (FIG. 5). Interestingly, however, 1 g/L (5.6 mM) and 2.5 g/L (13.9 mM) glucose did not change the percent distribution of TCA cycle intermediates (FIG. 5B), suggesting that HCECs may prefer metabolizing glutamine in the TCA cycle even in the presence of sufficient glucose.
[0098] Glutamine supplies ATP for the CE pump function. In the immortalized HCEC cell line, it was observed that more than half of the TCA cycle intermediates originated from glutamine. Given the physiological function of the CE, in non-regenerating well-differentiated CE in vivo, glutamine may have been used for ATP generation to supply energy for CE fluid transport. To test this hypothesis, the intracellular ATP content in HCEC was measured using conditional DMEM medium that indicated the following: 1) Glc/Gln: 5 g/L glucose + 4 mM glutamine; 2) -/Gin: 4 mM glutamine; 3) Glc/-: 5 g/L glucose; 4) -/-: neither glucose nor glutamine. Referring now to FIG. 3A, the concentration of ATP was the highest in Glc/Gln medium, and interestingly only slightly lower in -/Gin, but significantly lower in Glc/- and -/-. Referring now to FIG. 5, the results indicate that glucose can sustain half of the CE energy supply, consistent with GC-MS data that more than half of TCA intermediates were labeled when cultured with U-13C6-glucose and unlabeled L-glutamine.
[0099] Next whether CE in vivo shows a similar active glutamine metabolism was determined. The effect of glutamine supplementation on perfused freshly dissected ex vivo rabbit corneas was examined. If glutamine is beneficial for energy production, the corneal thickness should be better maintained {i.e., thinner) over a prolonged perfusion period as a result of better pump activity. Referring now to FIG. 3B, central corneal thickness (CCT) was 2.5 μπι less in glutamine supplemented corneas after 3.5 h of perfusion. Next, to estimate the rate of glutamine consumption by corneal endothelium in vivo, a modified version of the classic cornea de-swelling experiment adapted from Maurice with ex vivo 4°C stored rabbit and human corneas were performed. See, for example, Maurice, D.M. (1972), The location of the fluid pump in the cornea, THE JOURNAL OF PHYSIOLOGY, 221, 43-54. Briefly, Ringer's solution supplemented with glucose and/or glutamine supplementation filled artificial anterior chamber in contact with the CE apical surface (FIG. 6A). The cold cornea is swollen because the endothelial pump is inactive. When warmed up to 37 °C, the cornea will deswell due to reactivation of metabolism and in turn fluid transport activity. The deswelling rate is a measure of CE fluid transport efficiency. If glutamine metabolism enhances energy production, one would expect a faster de-swelling rate with glutamine addition. Referring now to FIGS 3C and 3E, in both rabbit and human cornea, glutamine supplementation facilitates a faster deswelling rate. At the end of the experiments, the Ringer's solution was collected and residual [glucose] and [glutamine] was measured by GC-MS. Referring now to FIG. 6B, the glucose and/or glutamine consumption rate per cell was estimated from the total glutamine/glucose consumed and total corneal endothelial cell count was determined using Alizarin Red staining. For rabbit CE, 0.5- 0.7 pmol/cell/h glucose and 0.3-0.6 pmol/cell/hr glutamine was consumed (FIG. 3D). For human CE, about 0.7 pmol/cell/h glucose and 0.4-0.8 pmol/cell/hr glutamine was consumed (FIG. 3F). There is a close consistency between rabbit and human CE. Taken together, these data show that glutamine enhances endothelial pump function by sustaining ATP production ex vivo in both rabbit and human.
[00100] Loss of the SLC4A11 ammonia transporter impairs CE health, produces signs of ammonia toxicity and alters glutaminolysis enzyme expression. Since SLC4A11 is an ammonia transporter, signs of potential ammonia toxicity, and alterations in glutaminolysis enzyme expression in the Slc4aH~ ~ mouse CE have been investigated. The Slc4aH~ ~ mouse recapitulated human CF£ED by showing diffuse corneal edema, vacuolated CE, and thickened Descemet's membrane (FIG. 4A and 4B). Nitrotyrosine was selected as a marker for generalized ammonia toxicity. Referring now to FIGs. 4C and 4D, elevated nitrotyrosine staining in Slc4aH~ ~ mouse CE relative to wild type were shown. Real-time qPCR revealed that Glsl expression is up-regulated by 3 fold whereas Gls2 expression is diminished in Slc4aH~ ~ CE, as early as 12-weeks of age (FIG. 4E). With nested-PCR verification, no Gls2 and Ggt expression could be detected in Slc4all~/~ CE (FIG. 4F). Referring now to FIG. 4G, the changes in Glsl and Gls2 expression were further confirmed by immunofluorescence of 40- weeks mouse cornea. Since SLC4A11 has been shown downregulated in some FECD, the expression of GLS1, GLS2 and SLC4A11 in FECD patients' diseased corneal endothelium was examined via real-time qPCR. Referring now to FIG. 7. A similar trend of changes in GLS1 and GLS2 expression was observed in response to downregulated SLC4A11 in human FECD, upregulation of GLS1 and downregulation of GLS2 in response to downregulated SLC4A11 similar to slc4aH~ ~ CHED mouse model. However, GLS2 downregulation exhibited borderline statistical significance (p = 0.069), while SLC4A11 and GLS1 did not show statistical significance when compared to normal control. By way of explanation and while not bound by any theory, this may be due to diverse genetic background in FECD patients.
[00101] This report describes the role of glutaminolysis in CE physiology. In this study, glutaminolysis has been shown to provide an essential component of CE metabolism that supports its crucial physiological pump function. In CE, the inventors showed: 1) expression of GLS1 (kidney type), GLS2 (liver type) and GGT (γ-glutamyl-transpeptidase, membrane form) enzymes that can facilitate glutamine deamination; 2) the expression of a wide variety of Na+- glutamine, H+-glutamine transporters and glutamate transporters; 3) that glutamine contributed -60% of carbons in TCA cycle intermediates; and 4) that glutaminolysis sustained the ATP level in CE and in turn supported pump function. Glutaminolysis metabolism in CE is conserved across all of the species investigated: rabbit, mouse and human.
[00102] Unlike tumor cells that manifest active glutaminolysis metabolism after metabolic reprogramming, or renal proximal tubule epithelium upregulation of glutaminolysis in response to acidosis, the active glutaminolysis in CE is present in normal corneal endothelium fulfilling its physiological function. Since CE does not proliferate in vivo, glutaminolysis is mainly dedicated to supporting energy metabolism. Previously, glucose was the only substrate thought as an energy source for CE. See Zurawski, C.A., et al. (1989), Glucose consumption in cultured corneal cells, CURRENT EYE RESEARCH, 8: 349-355. Interestingly, an early report indicated that CE pump function can be inhibited 33% by 6-Diazo-5-oxo-L-norleucine (DON), a glutamine analogue with a wide inhibitory effect on glutaminase and GGT. The result was interpreted to mean that DON inhibits GGT activity and shifts glutathione redox status in CE. However, DON irreversibly inhibits 95% of glutaminase activity and 90% of GGT activity, thereby inhibiting all major routes of glutamine metabolism in cells. See, for example, Thangavelu, K., et al. (2014), Structural basis for the active site inhibition mechanism of human kidney-type glutaminase (KGA), Sci REP 4: 3827. In this study, it was shown that the existence of glutamine metabolism in CE may sustain pump function, an alternative explanation of this effect is that DON inhibits glutaminolysis energy metabolism as a whole. Referring now to FIG. 3E, there is a 40% decrease in human corneal endothelium pump function in BR Glc/- group compared to BR Glc/Gln group, closely recapitulated the reported 33% inhibition effect from DON.
[00103] By way of explanation and while not wishing to be bound by this theory, the glutaminolysis works cooperatively together with the membrane ammonia transporter SLC4A11 to maintain the energy supply for CE fluid transport, shedding some light on the pathophysiological changes in CE due to loss of SLC4A11 function. Mutations in human Slc4al 1 gene are causative of CHED and Harboyan Syndrome, and are associated with FECD and Peters anomaly. All of the above endothelial dystrophies share common signs of corneal edema and endothelial degeneration, suggesting an essential functional role of SLC4A11 in maintaining corneal endothelium health and physiological function. Referring now to FIG. 2A, the model suggests ammonia transport function of SLC4A11 facilitates ammonia detoxification by removing NH3 in corneal endothelium. Loss of Slc4al l expression in the mouse leads to corneal endothelial dystrophy and secondary changes very similar to human CHED. Also, generalized ammonia toxicity in Slc4aH~ ~ murine corneal endothelium was observed as revealed by nitrotyrosine staining. Furthermore, expressions of three major enzymes catalyzing the first step of deamination in glutaminolysis Glsl, Gls2 and Ggt were altered in Slc4aH~ ~. It is of interest to note that a recent report on bovine nucleus pulposus intervertebral disc cells, and that SLC4A11 knock-down abolishes p53-Serl5 phosphorylation under high osmolality insult. See Mavrogonatou, E., et al. (2015), Deficiency in the alphal subunit of Net /t -ATPase enhances the anti-proliferative effect of high osmolality in nucleus pulposus intervertebral disc cells. Journal of cellular physiology 230: 3037-3048. It is thought that p53 directly associates with GLS2 gene response element (BS2) in promoter region and induces expression. The reduced expression of Gls2 in Slc4aH~ ~ CE observed here is consistent with these studies indicating, that the loss of Slc4al l expression may abolish p53-Serl5-pho and in turn abolish Gls2 expression (FIG. 4C). Given the dynamic and complex regulatory network of glutaminolysis and its crosstalk with glucose metabolism, more in-depth investigations are warranted.
[00104] While there is strong evidence that Slc4al 1 mutations are a cause for Congenital Hereditary Endothelial Dystrophy (CHED), FECD is associated with multiple genes in which Slc4al l mutations are thought to contribute about 11% of FECD. Nevertheless, despite the diverse genetic background the expression of SLC4A11 mRNA in FECD is reduced. Given the upregulated GLS1 and downregulated GLS2 expression observed in Slc4all" CHED mouse CE, the expression of GLS1 and GLS2 in FECD patients' CE was investigated (FIG. 7). A similar trend of GLS1 upregulation and GLS2 downregulation in response to SLC4A11 downregulation in FECD patients was observed, but due to the diverse genetic background of FECD, the difference was not resolved with traditional statistical testing.
[00105] Widely used ocular surgical irrigation solutions include 0.3 mM oxidized glutathione (GSSG) based on studies showing CE protection in terms of morphology and corneal thickness. Interestingly, the oxidized form, but not the reduced form, of glutathione (GSH) was found to have a protective effect on CE. GSH is a thiol tripeptide (y-glutamyl- cysteinyl-glycine) that neutralizes oxygen free radicals and itself becomes oxidized glutathione disulfide (GSSG). The addition of Extracellular GSSG can elevate intracellular GSH in CE measured by 35S-GSSG radioactive tracing. Referring now to FIG. 1, the presence of GGT in CE suggests that GSSG was broken down into a γ-glutamyl moiety and cysteinyl-glycine by GGT enzyme activity. GSSG in this case may serve as an alternative source of glutamate in glutamine-free irrigation solutions, and support glutaminolysis as well as de novo GSH synthesis. Thus, it will be of interest to investigate the beneficial effect of direct glutamine supplementation for CE protection in ocular irrigation solutions.
[00106] Aspects of this study provides evidence that glutamine metabolism, in addition to glucose metabolism, is an essential component of CE energy metabolism. That glutaminolysis is conserved across species in healthy CE and contributed a significant portion of the ATP supply critical for corneal endothelial active fluid transport and pump function. This study also suggests that the pathophysiological changes as a result of absence of SLC4A11 in CHED, FECD and Harboyan Syndrome at least in part because from the dysregulation of glutaminolysis and ammonia handling, and that SLC4A11 may facilitate glutaminolysis by helping removal of toxic ammonia from the CE. Lastly, this study provides the rational for an alternative surgical irrigation solution for corneal endothelium protection.
Experimental Procedures
[00107] RNA extraction, PCR and qPCR and Nested PCR. Total RNA, from human corneal endothelium tissue, mouse endothelium tissue, immortalized HCEC cell line, and FECD patient's corneal endothelium tissue were extracted and purified via RNeasy mini kit (#74104, Qiagen) with DNase digestion (#79254, Qiagen). PCR, Nested PCR and real-time qPCR were performed with human and murine gene primers listed in Tables 1 and 2 respectively. Details can be found in supplemental experimental procedures.
[00108] Immortalized HCEC culture. Immortalized HCEC were cultured at 37°C, 5% C02 in appropriate plates or flasks coated with undiluted FNC Coating Mix® (AthenaES). Complete medium (OptiMEM-I®; Invitrogen) contains 8% FBS (Hyclone Laboratories Inc.), EGF 5 ng/mL (Millipore), pituitary extract 100 μg/mL (Hyclone Laboratories), calcium chloride 200 mg/L, 0.08% chondroitin sulfate (Sigma-Aldrich), gentamicin 50 μg/mL, and antibiotic/antimycotic solution diluted 1 : 100 (Invitrogen). See Schmedt, T., et al. (2012), Telomerase Immortalization of Human Corneal Endothelial Cells Yields Functional Hexagonal Monolayers. PLOS ONE 7: e51427, disclosure of which is incorporated by reference in its entirety to the extent they are not inconsistent with the explicit teachings of this specification.
[00109] Immunofluorescence Staining. The following antibodies were used: Rabbit polyclonal anti-Glutaminase (GLSl) antibody 1 :200 (ab93434, Abeam); Rabbit anti-GLS2 antibody 1 :200 (abl l3509, Abeam); Mouse monoclonal anti-GGTl antibody 1 :200 (ab55138, Abeam); Rabbit anti-ZOl 1 :200 (402200, Life Technologies); Mouse anti-ZOl 1 :200 (339100, Invitrogen); Rabbit anti-Nitrotyrosine 1 :200 (A-21285, Thermo Scientific); Secondary Alexa- 488 and Alexa-568 antibodies (Molecular Probes) were used at 1 :200 concentrations. Detailed staining and imaging steps can be found in Supplemental Experimental Procedures. Mean fluorescence intensity (MFI) quantification of endothelium was conducted using ImageJ. Hematoxylin and Eosin (H&E) Staining: Deparaffinized sections (5 μπι) were stained with Hematoxylin and Eosin (H&E), and imaged with Axiolmager Ml microscope (Zeiss). Alizarin Red staining of Corneal Endothelium: Following protocol, rabbit and/or human cornea button was briefly immersed and rinsed with pH 4.2 0.9% saline, then stained with pH 4.2 0.2% Alizarin Red 0.9% saline for 2 min, and rinsed with pH 7.2 0.9% saline. See Park, S., et al. (2012). Protocol for vital dye staining of corneal endothelial cells. CORNEA 31 : 1476-1479, disclosure of which is incorporated by reference in its entirety to the extent they are not inconsistent with the explicit teachings of this specification.
[00110] Ammonia Assay. Samples of culture media were taken periodically and analysed for total ammonia (NH3) content using an enzymatic based dye production kit (Sigma).
[00111] Intracellular ATP assay: HCEC were seeded at 1.5* 104/ml in 12-well plate to sub- confluent, then put under serum-free conditional DMEM medium (glucose free, glutamine-free, pyruvate-free, Gibco #A1443001) with glucose and/or glutamine supplementation for 12 hours before measurement. ATP is extracted by boiling water method, and measured by luciferin- luciferase based ATP assay kit (A22066, Molecular Probes). See Yang, N.C., et al. (2002), A convenient one-step extraction of cellular ATP using boiling water for the luciferin-luciferase assay of ATP . ANALYTICAL BIOCHEMISTRY 306: 323-327, disclosure of which is incorporated by reference in its entirety to the extent they are not inconsistent with the explicit teachings of this specification.
[00112] Metabolite extraction and measurement HCEC cells were cultured with either U- 13C5-L-Glutamine or U-13C6-D-glucose for 12 hrs. Intracellular metabolite extraction was performed using a published protocol. See Sellick, C.A., et al. (201 1), Metabolite extraction from suspension-cultured mammalian cells for global metabolite profiling, NATURE PROTOCOLS 6: 1241-1249, disclosure of which is incorporated by reference in its entirety to the extent they are not inconsistent with the explicit teachings of this specificatio. For residue glucose and glutamine from ex vivo corneal deswelling experiments, total Ringer' s solution in the artificial anterior chamber were collected with 1 mL syringe through the connecting tubing of the Barron Chamber. A 10 μΐ. sample was used to detect the consumption by comparing with the fresh Ringer' s. The levels of metabolites were measured using GC/MS as reported previously. See Tennessen, J.M., et al. (2014), Methods for studying metabolism in Drosophila. METHODS 68: 105-1 15, disclosure of which is incorporated by reference in its entirety to the extent they are not inconsistent with the explicit teachings of this specification. See supra Supplemental Experimental Procedures for more details.
[00113] Fresh Rabbit Corneal Perfusion. The detailed method and setup were described in the previous publication. See Li, S., et al. (2016), Fluid transport by the cornea endothelium is dependent on buffering lactic acid efflux, AMERICAN JOURNAL OF PHYSIOLOGY - CELL PHYSIOLOGY 31 1 : CI 16-C126, disclosure of which is incorporated by reference in its entirety to the extent they are not inconsistent with the explicit teachings of this specification. BR Glc/- contains 5 mM glucose, while BR Glc/Gln contains 5 mM glucose and 1 mM glutamine. See Supplemental Experimental Procedures for details.
[00114] Revised Corneal De-Swelling Experiments. Four different Ringer' s solutions were used: 1) BR Base; 2) BR Glc/Gln; 3) BR Glc/- and 4) BR -/Gin. BR Base contains (mM): 148.5 Na+, 4 K+, 1.4 Ca2+, 0.6 Mg2+, 103.2 CI", 28.5 HC03 ". The addition of 5 mM glucose and/or 2 mM glutamine was made to BR base to get BR Glc/Gln, BR Glc/-, and BR -/Gin. All solutions were adjusted to pH 7.5 with IN HC1 and osmolarity 295 mOsm/L with mannitol.
[00115] In brief, rabbit or human cornea buttons with sclera skirt was mounted to a Barron® artificial anterior chamber (K20-2125, Katena Products Inc.) with corresponding Ringer's. Corneal thickness was monitored over time with Optical Coherent Tomography (OptoVue iVue SD-OCT). The corneal surface was kept moist with Artificial tears (Refresh®) after each measurement, and the cornea was kept in 37 °C incubator between measurements. Corneal Endothelial cells were stained with Alizarin red and counted after experiments for calculation of glutamine and/or glucose consumption rate. See supra Supplemental Experimental Procedures for more details.
[00116] Statistical Analysis. Statistical analysis was carried in SPSS Statistics v21 (IBM Corporation) and GraphPad Prime 6.0c (GraphPad Software, Inc.). Student T-test was used for two-group comparison. One-way ANOVA with post-hoc Tukey was used for data with more than two groups.
Supplemental Experimental Procedures
[00117] RNA extraction. Healthy human corneal endothelium: Human donor cornea were obtained from Indiana Lion Eye Bank in 4°C Optisol® GS medium. Corneal endothelium with Descemet's membrane was peeled off in Corneal Viewing Chamber (Stephens Instruments) using Submerged Cornea Using Backgrounds Away (SCUBA) technique. Peeled cornea endothelium sheet was processed immediately or stored in RNAlater® (AM7020, Ambion) at 4°C. Corneal endothelium sheet was rapidly frozen in liquid nitrogen and grinded following by RNeasy column (Qiagen) purification. Mouse corneal endothelium: Mouse cornea with sclera skirt was dissected from the globe. Corneal endothelium with Descemet's membrane was peeled off followed by RNA extraction similar as described above. FECD corneal endothelium: Patients diseased cornea endothelium samples were collected during Decrements Membrane Endothelial Keratoplasty (DMEK) surgery, and shipped on ice overnight in Optisol® GS medium. Cornea endothelium sheet was put into RNAlater® in 4°C upon arrival or processed immediately. RNA extraction steps were the same as described above. Immortalized HCEC cell line: HCEC cells were culture in OptiMEM complete medium to confluent, RNA extraction steps were the same as described above. [00118] PCR and qPCR and Nested PCR. Complementary DNA was generated with High Capacity RNA-to-cDNA Kit (Applied Biosy stems) at 10 ng RNA/AL reverse transcription. Sequences of human and mouse gene primers used are listed in Supplemental Table 1 and Table 2 respectively. Conventional PCR was performed with MyCycler Thermal cycler (Bio-Rad) following the AmpliTaq® 360 DNA Polymerase protocol (Applied Biosystems). Real-time qPCR reactions were set up in triplicate using SYBR Green PCR Master Mix (Agilent Technologies). All assays used similar amplification efficiency, and a 2_ΑΑα experimental design was used for relative quantification and normalized to ACTB (mouse) or GAPDH (human) for differential expression levels of target genes. Nested PCR was conducted for genes with no CT value in real-time qPCR. An additional 40 cycles of PCR are conducted on reverse transcription PCR product using the same gene primer.
[00119] Immunofluorescence Staining. Excised mouse eyes or human donor cornea button were fixed in 4% paraformaldehyde in 0.1 mol/L phosphate buffer (pH 7.4) at 4°C overnight and paraffin embedded. Five-micrometer sections were then mounted on Super Frost slides (Fisher Scientific). The sections were de-paraffinized and hydrated in a graded ethanol series (100%, 95% and 70% and 50% ethanol and ddH20 for 5 minutes each) and subject to antigen retrieval in 10 mM Na-citrate, then blocked with 2% BSA in PBS and incubated overnight at 4°C with 1st antibodies. After washes in PBS, slides were incubated with Fluor-conjugated 2nd antibody for one hour and washed. Sections were mounted with prolong anti-fade mounting reagent with DAPI (Molecular Probes, Life Technologies) and imaged with Axiolmager Ml microscope with AxioCam MRm camera (Zeiss).
[00120] Isotope labeling experiment and metabolite extraction. HCEC in 8% FBS OptiMEM-I in T75 flask seeded at 5* 104 were grown to confluent for 4 days then switched to serum-free OptiMEM-I for 12 h. Then the cells were labeled with serum-free DMEM conditional medium with 4 mM U-13C5-L-Glutamine (CLM-1822-H, Cambridge Isotope Laboratories) and 2.5 g/L D-glucose, incubate for 12 h. Serum-free DMEM conditional medium was made using DMEM (glucose free, glutamine-free, pyruvate-free, GIB CO® #A1443001) supplemented with calcium chloride 200 mg/L, 0.08% chondroitin sulfate (Sigma-Aldrich), and the corresponding isotope-labeled glucose and/or glutamine. An experiment with 2.5 g/L U- 13C6-D-glucose (CLM-1396-0, Cambridge Isotope Laboratories) and 4 mM L-glutamine was also performed as verification. Labeled cells were washed three times with ice-cold 0.9% NaCl, and quenched with 2 mL ice cold 100% methanol. Cells were scrapped off the T75 flask pellet and removed together with 2 mL methanol into centrifuge tube, vortexed thoroughly, centrifuged at 8000 g for 2 min. Supernatants were collected and the cell pellet was resuspended with 90% methanol 900 μΐ., vortexed thoroughly, centrifuged and supernatant collected. The procedure was repeated for a second time with 750 μΙ_, of 90% methanol. Total supernatant of two tubes (1500 μΙ_, each) was kept stationary at -20 °C for 1 hour, then centrifuged at 15,000 g for 5 min at 4 °C and the supernatant (1000 μΙ_, each) was collected to two new tubes. Then the sample was dried in a centrifugal evaporator at room temperature about 1 h, then the supernatant in the two tubes was pooled together and dried overnight.
[00121] Residue glucose and glutamine from ex vivo corneal deswelling experiments: Total Ringer's solution in the artificial anterior chamber was collected with 1 mL syringe through the connecting tubing of Barron Chamber. A volume of 10 μL sample was mixed with 5 μΐ. of 5 mM U-13C6-glucose and 5 μΐ. of 2 mM U-13C5-glutamine, and 500 μΓ. of 90% methanol. The sample was kept stationary at -20 °C for 1 hour, then centrifuged at 15,000 g for 5 min at 4 °C. The supernatant (500 μΐ.) was collected to a new tube and dried in a centrifugal evaporator at room temperature overnight. GC-MS was used to detect the levels of glucose and glutamine. Quantification was achieved by 13C-labeled internal standards.
[00122] Fresh Rabbit Corneal Perfusion. Freshly dissected rabbit cornea with conjunctiva and lids was atraumatically mounted on a plastic ring and pressed on a fixed hollow rod. Then lids and conjunctiva were everted over the globe and pulled down tightly to the rod and tied with a suture on mounting ring. After mounting, sclera posterior to the suture were removed with scalpel and scissors, as well as vitreous, ciliary body-iris, and lens to reveal the corneal endothelial surface. Then an anterior metal platform and a posterior plastic cap with openings connected to tubing were clamped against the mounting ring to form an artificial anterior chamber. The central tube provided inflow, and the two side tubes provided outflow. The cornea chamber was fitted in a metal jacket with embedded electric heater and thermistor to maintain 37 °C. Ringer's solutions contain (mM): 153.5 Na+, 4 K+, 1.4 Ca2+, 0.6 Mg2+, 113.2 CI", 1 HP04 2", 16.4 gluconate- and 28.5 HCO3 ". All solutions were equilibrated with 5% C02, pH adjusted to 7.5 and osmolarity adjusted to 295 mOsm/L with sucrose. 5 mM glucose and/or 1 mM glutamine were added. Perfusion solutions were maintained at 37°C in a water bath during experiment. [00123] Revised Corneal De-Swelling Experiments. For rabbit cornea: rabbit eye balls stored on ice were shipped overnight from a regional supplier (Pel freez Biologicals). Corneal thickness was measured immediately before dissecting as data point of time zero by Optical Coherent Tomography with anterior segment attachment (OptoVue iVue SD-OCT). Then eye balls were assigned to experimental groups 1) Glc/Gln 2) Glc/- and 3) -/Gin and dissected to cornea button with sclera skirt, rinsed and mounted with corresponding Ringer's solution. Cornea with sclera skirt was mounted on to Barron® artificial anterior chamber (K20-2125, Katena Products, Inc.) and anterior chamber was filled with 350 μΙ_, Ringer's solution corresponding to the assigned group. Corneal thickness is monitored using OptoVue iVue SD- OCT with anterior segment attachment every 15 min till 150 min after mounting. Artificial tears (Refresh®) is applied on epithelial surface every 15 min after OCT measurement, and Barron Chamber with mounted cornea is put in 37 °C incubator when not being measured. Final fluid (about 350 μΐ.) after 150 min experiment in artificial anterior chamber is collected and prepared for GC-MS analysis for residual glutamine and glucose.
[00124] Then cornea button is stained with Alizarin Red for corneal endothelium visualization and counted under light microscope. Total number of corneal endothelium cells per cornea was calculated as the product of corneal endothelium density and cornea dome surface area. For surface area, rabbit cornea diameter 13.2 mm and radius of curvature 7.26 mm were used for calculation. Rabbit corneal endothelium glutamine and/or glucose consumption rate per cell was estimated with total glutamine/glucose consumed divided by total corneal endothelial cell count.
[00125] For human donor cornea: De-identified human donor cornea with sclera skirt was obtained from Indiana Lion Eye Bank, stored in 4 °C upon arrival until experiments. Cornea with sclera skirt was rinsed with ice-cold BR base solution to get rid of Optisol cornea storage medium, then soaked in ice-cold BR base solution for 1 h to let it swell. Then the human cornea was mounted similarly as rabbit cornea with 300 μΙ_, BR Glc/Gln or BR Glc/-, and monitored for central corneal thickness with OCT every 15 min for 165min. Artificial tears were applied after each measurement, and Barron Chamber with mounted cornea was put in 37 °C incubator between measurement. Final fluid (about 300 μΐ,) is collected and prepared for GC-MS analysis for residual glutamine and glucose. Similarly, total corneal endothelium cell count per cornea was estimated with Alizarin Red visualization of corneal endothelium under light microscope, and human cornea diameter 11.5 mm and radius of curvature 7.75 mm were used for calculation. Rabbit and human corneal endothelium density and total cell count were shown in Table 3.
[00126] While the novel technology has been illustrated and described in detail in the figures and foregoing description, the same is to be considered as illustrative and not restrictive in character, it being understood that only the preferred embodiments have been shown and described and that all changes and modifications that come within the spirit of the novel technology are desired to be protected. As well, while the novel technology was illustrated using specific examples, theoretical arguments, accounts, and illustrations, these illustrations and the accompanying discussion should by no means be interpreted as limiting the technology. All patents, patent applications, and references to texts, scientific treatises, publications, and the like referenced in this application are incorporated herein by reference in their entirety to the extent they are not incorporated with the explicit teachings of this disclosure.
Table 1. Human Gene Primers (SEQ ID NOs: 1-26)
Figure imgf000027_0001
Table 1. Continued (SEQ ID NOs: 27-38)
Figure imgf000028_0001
Table 2. Murine Gene Primers (SEQ ID NOs: 39-46)
Figure imgf000029_0001
t
Table 3. Rabbit and Human Corneal Endothelium Density
Figure imgf000030_0001

Claims

CLAIMS We claim:
1. A method of protecting cornea endothelium, comprising the steps of:
providing a patient diagnosed with corneal endothelial dystrophy, undergoing intraocular surgeries, and/or post-operative care, with a therapeutic regime that includes at least one therapeutically effective dose of at least one composition comprising glutamine, alpha- ketoglutarate, and/or any stabilized/direvatized forms thereof.
2. The method according to claim 1, wherein the at least one composition further comprises glucose.
3. A method of protecting or enhancing the viability of a corneal endothelium, comprising the steps of:
contacting at least one portion of a corneal endothelium with a therapeutic regime that includes at least one therapeutically effective dose of at least one composition comprising glutamine, alpha-ketoglutarate, and/or any stabilized/direvatized forms thereof.
4. The method according to claim 3, wherein the at least one composition further comprises glucose.
5. The method according to any one of claims 3-4, wherein the corneal endothelium is damaged or stressed.
6. The method according to any one of the claims 3-5, wherein the step of contacting is performed prior to transplantation, after transplantation, during transplantation, and/or during transportation of said coreal endothelium.
7. The method according to any one of the claims 3-6, wherein the corneal endothelium is damaged or stressed after trauma, and/or an injury comprising chemical injury, hypoxic injury, thermal/freezng injury, radiation injury, photoxic injury, reactive oxidation injury, and any other forms of injury occurred by localized nutritional dysfunction, corneal inlays, implants, and/or contact lenses.
8. A method of treating corneal endothelial dystrophies, comprising the steps of:
treating a patient diagnosed with corneal endothelial dystrophies with at least one therapeutically effective composition that inhibits and/or reduces glutaminolysis.
9. The method according to claim 8, wherein the at least one therapeutically effective composition comprises at least one glutamine analogue, at least one glutaminase inhibitor, at least one gamma-glutamyl-transpeptidase (GGT) inhibitor, and/or at least one membrane glutamate excitatory amino acid transporter (EAAT) inhibitor.
10. The method according to any one of claims 8-9, wherein the at least one glutaminase inhibitor comprises a glutaminase type 1 (GLS1) inhibitor.
11. The method according to any one of claims 8-10, wherein the at least one glutamine analogue comprises 6-Diazo-5-oxo-L-norleucine (DON).
12. The method according to any one of claims 8-11, wherein the corneal endothelial dystrophy is at least one dystrophy selected from the group consisting of: Congenital Hereditary Endothelial Corneal Dystrophy, Fuchs Endothelial Corneal Dystrophy, Posterior Polymorphous Corneal Dystrophy, and/or Schnyder Crystalline Corneal Dystrophy.
13. A therapeutic composition for protecting cornea endothelium, comprising:
at least one agent comprising glutamine, alpha-ketoglutarate, dimethyl alpha- ketoglutarate, and any stabilized/direvatized forms thereof;
at least one pharmaceutically acceptable salt; and
at least one physiological buffer.
14. A therapeutic composition for treating corneal endothelial dystrophies, comprising: at least one therapeutically effective agent that inhibits and/or reduces glutaminolysis; at least one pharmaceutically acceptable salt; and
at least one physiological buffer.
15. The method of claim 14, wherein the at least one therapeutically effective agent comprises at least one glutamine analogue, at least one glutaminase inhibitor, at least one gamma-glutamyl-transpeptidase (GGT) inhibitor, and/or at least one membrane glutamate excitatory amino acid transporter (EAAT) inhibitor.
16. A kit, comprising:
at least one composition according to any one of claims 13-15; and
at least one container.
PCT/US2017/064264 2016-12-02 2017-12-01 Compositions and methods for treating and/or reducing corneal dystrophy Ceased WO2018102715A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201662429559P 2016-12-02 2016-12-02
US62/429,559 2016-12-02

Publications (1)

Publication Number Publication Date
WO2018102715A1 true WO2018102715A1 (en) 2018-06-07

Family

ID=62242730

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/064264 Ceased WO2018102715A1 (en) 2016-12-02 2017-12-01 Compositions and methods for treating and/or reducing corneal dystrophy

Country Status (1)

Country Link
WO (1) WO2018102715A1 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100152130A1 (en) * 2002-08-01 2010-06-17 Eisai Inc. Treatment of cancer with glutamine
US20130315996A1 (en) * 2010-11-19 2013-11-28 Albert-Ludwigs-Universitaet Freiburg Bio-functionalized stimulus-responsive dissolvable peg-hydrogels
WO2015101958A2 (en) * 2014-01-06 2015-07-09 Rhizen Pharmaceuticals Sa Novel inhibitors of glutaminase
US20160287564A1 (en) * 2015-03-30 2016-10-06 Calithera Biosciences, Inc. Methods of administering glutaminase inhibitors

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100152130A1 (en) * 2002-08-01 2010-06-17 Eisai Inc. Treatment of cancer with glutamine
US20130315996A1 (en) * 2010-11-19 2013-11-28 Albert-Ludwigs-Universitaet Freiburg Bio-functionalized stimulus-responsive dissolvable peg-hydrogels
WO2015101958A2 (en) * 2014-01-06 2015-07-09 Rhizen Pharmaceuticals Sa Novel inhibitors of glutaminase
US20160287564A1 (en) * 2015-03-30 2016-10-06 Calithera Biosciences, Inc. Methods of administering glutaminase inhibitors

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
GOROVITS ET AL.: "Glutamine Synthetase Protects Against Neuronal Degeneration in Injured Retinal Tissue", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 94, no. 13, 1 June 1997 (1997-06-01), pages 7024 - 7029, XP055490729 *
JUN ET AL.: "An alpha 2 Collagen VIII Transgenic Knock-In Mouse Model of Fuchs Endothelial Corneal Dystrophy Shows Early Endothelial Cell Unfolded Protein Response and Apoptosis", HUMAN MOLECULAR GENETICS, vol. 21, no. 2, 14 October 2011 (2011-10-14), pages 384 - 393, XP055490732 *
ZHANG ET AL.: "Glutaminolysis is Essential for Energy Production and Ion Transport in Human Corneal Endothelium", EBIOMEDICINE, vol. 16, 1 February 2017 (2017-02-01), pages 292 - 301, XP055490734 *

Similar Documents

Publication Publication Date Title
Zhang et al. Glutaminolysis is essential for energy production and ion transport in human corneal endothelium
Matthaei et al. Fuchs endothelial corneal dystrophy: clinical, genetic, pathophysiologic, and therapeutic aspects
Liedtke et al. Elongation of axons during regeneration involves retinal crystallin β b2 (crybb2)
Notara et al. The impact of age on the physical and cellular properties of the human limbal stem cell niche
US9605026B2 (en) Hydrogen-bond surrogate peptides and peptidomimetics for p53 reactivation
CN114650813A (en) Druggable targets for the treatment of retinal degeneration
EP3542822A1 (en) Method for producing myocardial stem cell used for treatment and/or prevention of cardiac arrest
US20240024408A1 (en) Methods and compositions for preventing or treating leber&#39;s hereditary optic neuropathy
Martis et al. Identification, expression, and roles of the cystine/glutamate antiporter in ocular tissues
Guo et al. PPP1CA/YAP/GS/Gln/mTORC1 pathway activates retinal Müller cells during diabetic retinopathy
CN111655258A (en) Composition for cryopreservation and method of use
JP6519851B2 (en) Ophthalmic cell differentiation markers and differentiation control
WO2022133247A2 (en) Composition and method of preserving viability of cell in a low temperature environment
US20180000867A1 (en) Disease Prevention and Alleviation by Human Myoblast Transplantation
US20140205655A1 (en) OLIGOOXOPIPERAZINES FOR p53 REACTIVATION
US12383554B2 (en) Compositions and methods to protect mammalian tissue against cold and other metabolic stresses
Zhang et al. YBX1-driven TUBB6 upregulation facilitates ocular angiogenesis via WNT3A-FZD8 pathway
WO2018102715A1 (en) Compositions and methods for treating and/or reducing corneal dystrophy
Salum et al. Modulation of dopamine uptake by nitric oxide in cultured mesencephalic neurons
Sun et al. Role of carbonic anhydrase IV in corneal endothelial HCO3− transport
KR20200005345A (en) kidney spheroid and method of preparing the same
US20250326808A1 (en) Treatment of the corneal endothelium
Perdue et al. Caveolin-1 is up-regulated in transdifferentiated lens epithelial cells but minimal in normal human and murine lenses
Medearis et al. The role of Bcl-xL in mouse RPE cell survival
US11857544B2 (en) Composition or method including (t)ew-7197 for treating or preventing corneal endothelial diseases

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17877367

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17877367

Country of ref document: EP

Kind code of ref document: A1