WO2018098484A1 - Drug targets of delayed aging and human brain diseases - Google Patents
Drug targets of delayed aging and human brain diseases Download PDFInfo
- Publication number
- WO2018098484A1 WO2018098484A1 PCT/US2017/063485 US2017063485W WO2018098484A1 WO 2018098484 A1 WO2018098484 A1 WO 2018098484A1 US 2017063485 W US2017063485 W US 2017063485W WO 2018098484 A1 WO2018098484 A1 WO 2018098484A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- ddq
- molecule
- cells
- drp
- mitochondrial
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07F—ACYCLIC, CARBOCYCLIC OR HETEROCYCLIC COMPOUNDS CONTAINING ELEMENTS OTHER THAN CARBON, HYDROGEN, HALOGEN, OXYGEN, NITROGEN, SULFUR, SELENIUM OR TELLURIUM
- C07F9/00—Compounds containing elements of Groups 5 or 15 of the Periodic Table
- C07F9/02—Phosphorus compounds
- C07F9/28—Phosphorus compounds with one or more P—C bonds
- C07F9/50—Organo-phosphines
- C07F9/5022—Aromatic phosphines (P-C aromatic linkage)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/66—Phosphorus compounds
- A61K31/675—Phosphorus compounds having nitrogen as a ring hetero atom, e.g. pyridoxal phosphate
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/16—Amides, e.g. hydroxamic acids
- A61K31/165—Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide
- A61K31/166—Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide having the carbon of a carboxamide group directly attached to the aromatic ring, e.g. procainamide, procarbazine, metoclopramide, labetalol
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/513—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim having oxo groups directly attached to the heterocyclic ring, e.g. cytosine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/517—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with carbocyclic ring systems, e.g. quinazoline, perimidine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/66—Phosphorus compounds
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/66—Phosphorus compounds
- A61K31/662—Phosphorus acids or esters thereof having P—C bonds, e.g. foscarnet, trichlorfon
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
- A61P25/16—Anti-Parkinson drugs
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C251/00—Compounds containing nitrogen atoms doubly-bound to a carbon skeleton
- C07C251/72—Hydrazones
- C07C251/86—Hydrazones having doubly-bound carbon atoms of hydrazone groups bound to carbon atoms of six-membered aromatic rings
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D239/00—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings
- C07D239/70—Heterocyclic compounds containing 1,3-diazine or hydrogenated 1,3-diazine rings condensed with carbocyclic rings or ring systems
- C07D239/72—Quinazolines; Hydrogenated quinazolines
- C07D239/95—Quinazolines; Hydrogenated quinazolines with hetero atoms directly attached in positions 2 and 4
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07F—ACYCLIC, CARBOCYCLIC OR HETEROCYCLIC COMPOUNDS CONTAINING ELEMENTS OTHER THAN CARBON, HYDROGEN, HALOGEN, OXYGEN, NITROGEN, SULFUR, SELENIUM OR TELLURIUM
- C07F9/00—Compounds containing elements of Groups 5 or 15 of the Periodic Table
- C07F9/02—Phosphorus compounds
- C07F9/547—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom
- C07F9/553—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom having one nitrogen atom as the only ring hetero atom
- C07F9/576—Six-membered rings
- C07F9/60—Quinoline or hydrogenated quinoline ring systems
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/28—Neurological disorders
- G01N2800/2814—Dementia; Cognitive disorders
- G01N2800/2821—Alzheimer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/28—Neurological disorders
- G01N2800/2835—Movement disorders, e.g. Parkinson, Huntington, Tourette
Definitions
- the present invention relates generally to tryptamine, dopamine and quinolone derivatives and their use in delay aging and diseases of the human brain.
- the composition and methods use such a compound and may also be used in combination with a potentiator to delay aging.
- AD Alzheimer's Disease
- ⁇ has been found to induce synaptic dysfunction and mitochondrial oxidative damage, resulting in abnormal activation of redox-mediated events, as well as an abnormal elevation of cytoplasmic Ca2+, ultimately causing neuronal damage.
- AD pathogenesis has been linked to DNA damage. In mammals, including humans, an accumulation of oxidative DNA damage in particularly mutant DNA, including brain tissue, has been found in aging persons.
- WO2008/074068 entitled, "Substituted quinoline derivatives as antiamyloidogeneic agents,” discloses heterocyclic compounds, processes for their preparation and their use as pharmaceutical or veterinary agents, in particular for the treatment, amelioration and/or prophylaxis of conditions caused by or associated with unbalanced metal levels and/or oxidative stress, such as neurological conditions and cellular proliferative disorders, for example Alzheimer's disease, Parkinson's disease, Huntington's disease or brain cancer or tumors.
- compositions and methods using such compositions for the treatment of neurodegenerative disorders contain a catalyst for the dismutation of superoxide, including superoxide dismutase enzyme (SOD) and low molecular weight organic ligand derived metal complexes that function as mimics of the enzyme (SOD mimetics or SODms).
- SOD superoxide dismutase enzyme
- SOD mimetics or SODms low molecular weight organic ligand derived metal complexes that function as mimics of the enzyme
- the inventors designed a number of molecules with the aid of molecular docking software to reduce/prevent interactions between ⁇ and Drp 1 ; ⁇ and p-tau; ⁇ and VDAC 1 .
- the inventors implemented the use of four distinct scaffolding structures with molecular docking simulation to fit the active sites of each enzyme and extrapolate R-groups with high binding affinity against abnormal protein interactions.
- the present invention includes methods for identifying molecules that can delay aging process and prevent and/or stop neurodegeneration.
- the inventors discovered molecules that cause delayed aging and protect cells from oxidative insults.
- the inventors also identified specific molecule that can be modified to increase their effectiveness, and methods for using the same to treat neurodegenerative disease. It was found that the molecules possess certain features, e.g., (1) delayed aging, (2) protect human cells from oxidative insults, (3) reduce the toxicity of mutant proteins, (4) inhibit abnormal protein interactions in the brain cells, and/or (5) enhance cell survival.
- the present invention includes a molecule that inhibits the interaction of ⁇ and Drp 1 proteins.
- the molecule inhibits the interaction of ⁇ and Drpl proteins in nerve cells.
- the molecule inhibits mitochondrial, intracellular, and extracellular damage caused by the interaction of ⁇ and Drpl in or about nerve cells.
- the molecule is water-soluble.
- the molecule is adapted for oral, intravenous, intramuscular, intraperitoneal, subcutaneous, parenteral, or pulmonary administration.
- the ⁇ and Drpl proteins are human.
- the molecule delays age-dependent disease process in Alzheimer's, Huntington's, Parkinson's and ALS.
- the molecule at least one of: delays aging in neurons, protects neurons from oxidative insults, inhibits abnormal protein-protein interactions and protect neurons from mutant protein(s)-induced toxicities, and enhances cell survival.
- the molecule is selected from at least one of: phosphonium cation based structures; quinoline based alpha aminophosphonates; napthaline based alpha aminophosphonates, or hexahydropyramidine carboxylates structures.
- the composition is selected from at least one of:
- Mdiv-1 (3-(2,4-Dichloro-5-methoxyphenyl)-2,3-dihydro-2-thioxo-4(lH)-quinazolinone, 3-(2,4-Dichloro- 5-methoxyphenyl)-2-sulfanyl-4(3H)-quinazolinone):
- the shaded regions are modified to at lease one of: increase the inhibition of ⁇ and Drpl binding, increase crossing the blood-brain4oarrier, increase solubility, or increase the metabolic half-life of the molecule.
- Another embodiment of the present invention includes a method for identifying a molecule that inhibits the interaction of ⁇ and Drpl proteins comprising: obtaining a database of molecular coordinates for the regions of the ⁇ and Drp 1 proteins that interact; obtaining a database of molecules comprising molecular coordinates; identifying the molecules from the database of molecules that fit between the regions in which the ⁇ and Drp 1 proteins that interact; and testing in vitro the ability of the one or more molecules that fit between the regions in which the ⁇ and Drpl proteins to prevent binding of ⁇ and Drpl proteins.
- the method further comprises testing the inhibition of the one or more molecules to inhibit the interaction of ⁇ and Drp l proteins in nerve cells.
- the method further comprises testing the molecule to inhibit mitochondrial, intracellular, and extracellular damage caused by the interaction of ⁇ and Drp l in or about nerve cells.
- the molecule is water soluble.
- the method further comprises adapting the molecule for oral, intravenous, intramuscular, intraperitoneal, subcutaneous, parenteral, or pulmonary administration.
- the method further comprises testing the one or more molecules to delay age-dependent disease process in Alzheimer's, Huntington's, Parkinson's and ALS.
- the one or more molecules at least one of: delays aging in neurons, protects neurons from oxidative insults, inhibits abnormal protein-protein interactions and protect neurons from mutant protein(s)-induced toxicities, and enhances cell survival.
- the method further comprises selecting from at least one of: phosphonium cation based structures; quinoline based alpha aminophosphonates; napthaline based alpha aminophosphonates, or hexahydropyramidine carboxylates structures.
- the molecule tested is, or is based on, at least one of:
- MitoQ (Phosphonium, [ 10-(4,5 -dimethoxy-2-methyl-3 ,6-dioxo- 1 ,4-cyclohexadien- 1 -yl)decyl]triphenyl-, methanesulfonate), shown here in the non-limiting form of a mesylate.
- Mdivi-1 (3-(2,4-Dichloro-5-methoxyphenyl)-2,3-dihydro-2-thioxo-4(lH)-quinazolinone, 3-(2,4- Dichloro-5-methoxyphenyl)-2-sulfanyl-4(3H)-quinazolinone):
- the shaded regions are modified to at lease one of: increase the inhibition of ⁇ and Drpl binding, increase crossing the blood-brain-barrier, increase solubility, or increase the metabolic half-life of the molecule.
- Yet another embodiment of the present invention includes a method of treating a neuropathy caused by the interaction of ⁇ and Drpl proteins comprising providing a molecule that inhibits the interaction of the ⁇ and Drpl proteins.
- the molecule inhibits the interaction of ⁇ and Drpl proteins in nerve cells.
- the molecule inhibits mitochondrial, intracellular, and extracellular damage caused by the interaction of ⁇ and Drpl in or about nerve cells.
- the molecule is water soluble.
- the molecule is adapted for oral, intravenous, intramuscular, intraperitoneal, subcutaneous, parenteral, or pulmonary administration.
- the ⁇ and Drp 1 proteins are human.
- the neuropathy is an age-dependent disease selected from Alzheimer's, Huntington's, Parkinson's disease or ALS.
- the molecule at least one of: delays aging in neurons; protects neurons from oxidative insults; inhibits abnormal protein-protein interactions and protect neurons from mutant protein(s)-induced toxicities; and enhances cell survival.
- the molecule is selected from at least one of: phosphonium cation based structures; quinoline based alpha aminophosphonates; napthaline based alpha aminophosphonates, or hexahydropyramidine carboxylates structures.
- the molecule is, or is based on, at least one of:
- Mdivi-1 (3-(2,4-Dichloro-5-methoxyphenyl)-2,3-dihydro-2-thioxo-4(lH)-quinazolinone, 3-(2,4- Dichloro-5-methoxyphenyl)-2-sulfanyl-4(3H)-quinazolinone):
- the shaded regions are modified to at lease one of: increase the inhibition of ⁇ and Drpl binding, increase crossing the blood-brain-barrier, increase solubility, or increase the metabolic half-life of the molecule.
- FIGS. 1A to 1C show the interaction of designed drug molecules against ⁇ and Drpl Complex.
- FIG. 1A Interaction of Drpl (PDB ID: 4hlu) and ⁇ 1-40 (PDBID: lba4) proteins.
- FIG IB Inhibition of Drpl and ⁇ 40 peptide Interaction by DDQ.
- FIG 1C Interaction of Drpl and designed drug molecules. The inventors designed 82 molecules based on existing mitochondrial division inhibiting drug molecules in AD and subjected to molecular docking studies.
- DDQ DDQ-Drpl complex
- Few of these molecules showed better docking score compared to existed drug molecules.
- DDQ is only involved in the prevention of ⁇ -Drpl interaction by interacting at the active site such as ser8 and Leu34 of ⁇ and ASN16 Glul6 of Drpl .
- DDQ showed better binding score (-10.8462) than existed drug molecules.
- DDQ is readily stopping the Drpl before forming the complex.
- the inventors selected DDQ for detailed analysis but the methods and techniques apply equally to the four compounds without undue experimentation.
- FIG. 2 shows a schematic of the synthetic procedure used to develop DDQ.
- FIG. 3 is a flowchart with the strategy of DDQ treatments in cell cultures. As shown in FIG. 3, the inventors studied five different groups of cells: (1) untreated SHSY5Y cells; (2) SHSY5Y cells treated (incubated) with DDQ (250 nM) for 24 hours; (3) SHSY5Y cells incubated with the ⁇ 1-42 peptide (20 ⁇ final concentration) for 6 hours; (4) SHSY5Y cells incubated with ⁇ 1-42 for 6 hours, followed by DDQ treatment for 24 hours, and (5) SHSY5Y cells treated with DDQ for 24 hours, followed by ⁇ 1-42 incubation for 6 hours.
- FIGS. 4A to 4C show the results of immunoblotting analysis mitochondrial dynamics, biogenesis and synaptic proteins.
- FIG. 4A Representative Immunoblotting images (mitochondrial fission, fusion proteins and synaptic proteins) of DDQ, ⁇ , ⁇ +DDQ and DDQ+ ⁇ treated and untreated SHSY-5Y cells.
- FIG 4B Representative Immunoblotting images (mitochondrial biogenesis proteins) of DDQ, ⁇ , ⁇ +DDQ and DDQ+ ⁇ treated and untreated SHSY-5Y cells.
- FIG. 4C Quantitative densitometry analysis of mitochondrial dynamics and synaptic proteins. Quantitative densitometry analysis of mitochondrial biogenesis.
- Fission proteins levels were increased in cells treated with ⁇ ; and reduced in cells treated with DDQ, ⁇ +DDQ and DDQ+ ⁇ treated cells.
- mitochondrial fusion proteins Mfnl and Mfn2 and synaptic proteins, synaptophysin and PSD95 were decreased in cells treated with ⁇ , and enhanced in cells treated with DDQ, ⁇ +DDQ and DDQ+ ⁇ treated cells.
- FIGS. 5A and 5B show a co-immunoprecipitation analysis of Drpl and ⁇ in SHSY5Y cells.
- FIG. 5A shows immunoprecipitation with the 6E10 antibody and immunoblotting with the 6E10 antibody, indicating that the specificity of 6E10 in the Co-IP analysis. In cells treated with DDQ+ ⁇ and ⁇ +DDQ, 4 kDa ⁇ levels were reduced relative cells treated ⁇ alone.
- FIG. 5B shows Co-IP with ⁇ antibody 6E10 and western blotting with Drpl antibody, indicating that Drpl interacts with 4 kDa ⁇ . Reduced interaction between ⁇ and Drpl was found in cells pretreated with DDQ and then ⁇ added. Reduced interaction was strong in DDQ+ ⁇ cells compared to cells treated with ⁇ alone.
- FIG. 6 shows the co-immunoprecipitation analysis of mutant APPSwe/Ind cells treated with DDQ.
- Lanes 1 and 2 represents IP with 6E10 and western blot with 6E10 and lanes 3 and 4 represents IP with 6E10 and western blot with Drpl antibody respectively.
- FIGS. 7A and 7B shows an immunofluorescence analysis. Immunofluorescence analysis of human neuroblastoma (SHSY5Y) cells treated with ⁇ , DDQ, ⁇ +DDQ and DDQ+ ⁇ relative to untreated cells.
- FIG. 7A shows representative immunofluorescence images of mitochondrial dynamic proteins and synaptic proteins.
- FIG. 7B shows quantitative immunofluorescence analysis of mitochondrial dynamics and synaptic proteins.
- FIG. 8 Double labeling Immunofluorescence analysis of Drp l and ⁇ . Double-labeling immunofluorescence analysis of ⁇ (6E10 antibody) and Drpl in SHSY5Y cells. The localization of Drp l (green) and ⁇ (red) and the colocalization of Drp l and ⁇ (yellow, merged) at 60 ⁇ the original magnification. Top panel, represents ⁇ treated cells, middle panel shows ⁇ +DDQ treated cells and the bottom panel shows DDQ+ ⁇ treated cells. As shown in FIGS.
- FIGS. 9A and 9B show sandwich ELISA analysis of ⁇ 40 and 42 in mutant APPSwe/Ind cells treated and untreated with DDQ.
- the inventors performed sandwich ELISA using protein lysates mutant APP cells treated and untreated with DDQ.
- FIG. 9A shows ⁇ 42
- FIG. 9B shows ⁇ 40.
- Significantly reduced levels of ⁇ 42 in mutant APPSwe/Ind cells treated with DDQ compared to mutant APPSwe/Ind cells untreated with DDQ.
- ⁇ 40 levels were significantly increased in mutant APPSwe/Ind cells treated with DDQ relative to mutant APPSwe/Ind cells untreated with DDQ.
- FIG. 10 shows electron microscopy of SH-SY5Y cells.
- the inventors quantified mitochondrial architectures within the cell in all 5 groups to identify mitochondrial number and morphology. Average number of mitochondria per cell is shown in graphs. Error bars indicate the standard deviation. Mitochondrial number is significantly decreased in DDQ-treated SH-SY5Y cells, relative to untreated cells. On the contrary, mitochondrial number is significantly increased ⁇ -treated SH-SY5Y cells. DDQ- pre and post-treated cells in the presence of ⁇ showed reduced mitochondrial number compared to cells treated with ⁇ alone. Mitochondrial length was measured for all groups of cells. Mitochondrial length was significantly reduced ⁇ -treated SH-SY5Y cells. DDQ-pre and post-treated cells in the presence of ⁇ showed increased mitochondrial length compared to cells treated with ⁇ alone.
- SHSY5Y control human neuroblastoma
- ⁇ amyloid ⁇
- FIG. 12 shows cell viability analysis.
- the present invention includes methods for identifying molecules that can delay aging process and prevent and/or stop neurodegeneration and novel compositions that delay aging and protect cells from oxidative insults, and method of using the same. It was found that the molecules identified were able to: (1) delay aging, (2) protect human cells from oxidative insults, (3) reduce the toxicity of mutant proteins, (4) inhibit abnormal protein interactions in the brain cells and (5) enhance cell survival. To date, no drugs have been developed to prevent and/or reduce abnormal protein interactions in Alzheimer's, Huntington's, and Parkinson's. The newly developed molecules inhibit these abnormal interactions and enhance cell survival and delay aging process.
- Neurons are the building blocks of the nervous system, which includes the brain and spinal cord. Neurons normally don't reproduce or replace themselves, so when they become damaged or die they cannot be replaced by the body. Examples of neurodegenerative diseases are Alzheimer's, Huntington's disease, Parkinson's and amyotrophic lateral sclerosis (ALS). Various factors such as pathogenic mutations, genetic modifiers, abnormal interactions between disease causing proteins such amyloid beta or ⁇ (in Alzheimer's), mutant huntingtin (in Huntington's), mutant SOD1 (in ALS) and parkin, DJ1 (in Parkinson's) and other diet and metabolism. In addition, aging is a major risk factor for neurodegenerative diseases.
- ALS amyotrophic lateral sclerosis
- amyloid beta precursor protein is the source of ⁇ , the central player in the pathophysiology of the disease.
- This released ⁇ induces synaptic dysfunction, mitochondrial oxidative damage, resulting in abnormal activation of redox-mediated events as well as elevation of cytoplasmic Ca 2+ , ultimately causing neuronal damage in AD.
- mutant AD proteins ⁇ and phosphorylated tau interacts mitochondrial fission protein, dynamin-related protein 1 (Drpl), induces mitochondrial fragmentation, mitochondrial dysfunction and synaptic damage in AD neurons.
- Drpl dynamin-related protein 1
- mutant AD proteins ⁇ and phosphorylated interacts with mitochondrial outer-membrane protein, voltage -dependent anion channel protein 1 (VDAC1), blocks mitochondrial permeability transition pores and causes gating of mitochondrial pore activities, ultimately leading to impairments in oxidative phosphorylation and low ATP production in AD neurons 9 .
- VDAC1 voltage -dependent anion channel protein 1
- AD ⁇ -induced synaptic dysfunction is a complicated process involving multiple pathways, components, and biological events, such as oxidative stress, kinase activation, and protein interactions. These complexities lead to the formation and accumulation of ⁇ and phosphorylated tau, mitochondrial dysfunction, and ultimately neuronal death.
- drug targets i.e., molecules
- synaptic damage and mitochondrial dysfunction are early events in AD pathogenesis. Mitochondrial dysfunction is mainly due to the abnormal interaction of Drpl with ⁇ , and with phosphorylated tau. Development of drugs capable of targeting underlying mechanisms of disease pathogenesis is needed in order to slow AD progression.
- the major focus of the proposed research effort is to develop a drug that can target the toxicity in involved in these interactions in order to prevent mitochondrial dysfunction and synaptic damage in AD progression.
- ⁇ mitochondrial dysfunction
- AD Extracellular canonical localization of ⁇ has been identified in different subcellular compartments, including the endoplasmic reticulum; the Golgi apparatus (or the trans-Golgi network); early, late, and recycling endosomes; and the lysosome, where the ⁇ are generated.
- ⁇ has also been found in mitochondria, and research from different independent research groups has clearly established that ⁇ progressively accumulates in the mitochondria.
- ⁇ has been found to induce mitochondrial dysfunction via different mechanisms.
- ⁇ is taken up by mitochondria via the translocase of the outer membrane (TOM) complex and is imported into the inner membrane; ⁇ alters the enzyme activity of the respiratory chain complexes I, and IV; ⁇ affects mitochondrial dynamics by an impaired balance of fission and fusion; ⁇ impairs mitochondrial permeability transition pore gating via the interaction of ⁇ with VDAC1 ; ⁇ induces decreased mitochondrial respiration; ⁇ affects new mitochondrial biogenesis; and ⁇ increases reactive oxygen species (ROS) generation.
- TOM translocase of the outer membrane
- ROS reactive oxygen species
- Drp l which maintains and remodels mammalian mitochondria, interacts with ⁇ and phosphorylates tau, leading to excessive mitochondrial fragmentation, impaired axonal transport of mitochondria, and ultimately, neuronal damage and cognitive decline.
- Drp l structure and function Based on published studies and NCBI databases, the human Drp l has been found to have several splice variants: variant 1 consists of 736 amino acids; in variant 2, exon 15 is spliced out; in variant 3, exons 15 and 16 are spliced out and have a total of 699 amino acids; variant 4 has 725 amino acids; variant 5, 710 amino acids; and variant 6, 749 amino acids.
- Drp l contains a highly conserved GTPase and is involved in various cellular functions.
- variant 1 consists of 712 amino acids; in variant 2, exon 3 is spliced out; and in variant 3, exons 15 and 16 are spliced out.
- Drp l is involved in mitochondrial division, mitochondrial distribution, peroxisomal fragmentation, phosphorylation, SUMOlyation, and ubiquitination.
- Drp l expression and mitochondrial dysfunction Studies of Drp l in mammalian cells suggest that normal expression of Drp l is critical for normal mitochondrial dynamics and normal mitochondrial distribution and dendritic morphology in neurons. In AD and other neurodegenerative diseases, Drp 1 levels are altered via the interaction of Drp l with ⁇ , leading to abnormal mitochondrial dynamics (increased fission and reduced fusion), in some cases with perinuclear clusters of mitochondria and disruption of inter-mitochondrial connectivity.
- Drp l associated with ⁇ The present inventors have shown that mutant AD proteins, ⁇ , and phosphorylated tau interact with Drp l, which induces mitochondrial fragmentation, mitochondrial dysfunction, and synaptic damage in neurons. These abnormal interactions are believed to be age- and disease-progression dependent, indicating that the interaction between aging and disease progression may play key roles in AD pathogenesis and development. Increasing evidence suggests that in AD, the accumulation of ⁇ in synapses and synaptic mitochondria causes synaptic mitochondrial failure and synaptic degeneration.
- the present inventors developed water-soluble molecules that can reduce amyloid beta ( ⁇ ) and Drp 1 levels, and that can reduce/prevent abnormal interactions between ⁇ and Drp l in Alzheimer's disease (AD) affected neurons.
- the present invention targets: (1) increased production and accumulation of ⁇ and increased expression of Drp l, and (2) abnormal interaction between ⁇ and Drp l induce synaptic dysfunction and mitochondrial damage, resulting dysfunction of neurons affected by AD.
- the therapeutic compositions and methods disclosed herein involve treating AD-affected neurons with such molecules in order to reduce ⁇ and Drp 1 levels, and to inhibit the interaction of ⁇ and Drp 1.
- the inventors conducted molecular docking studies and designed 82 scaffold structures. These structures were screened for existing molecules, using molecular docking software (MOE). The inventors developed the following criteria for selecting these 82 structures for further research as inhibitors of AD progression: 1) showed optimum binding energy values and 2) were capable of identifying and dissociating the binding sites of the abnormal interactions between ⁇ and Drp 1. To begin, the inventors selected the best molecules of the 82, which exhibited the best optimum binding energy values and binding capabilities for these proposed in vitro and in vivo studies.
- MOE molecular docking software
- the following scaffold structures were designed to: ( 1) delay aging and (2) inhibit abnormal protein interactions. These designed structures screened for in silico studies using molecular docking software. Further, the inventors selected molecules that showed (1) optimum binding energy values and (2) identify and dissociate the binding sites of abnormal protein interactions - ⁇ and Drpl, and phosphorylated tau and Drpl; ⁇ and VDAC1 and phosphorylated tau and VDAC1 in AD neurons.
- B Quinoline based alpha aminophosphonates
- C Napthaline based alpha aminophosphonates
- D Hexahydropyramidine carboxylates structures.
- ⁇ and Drpl complex Ser8, Leu34, Glyl20, Gly25 of ⁇ are interacting with ASN98, ILU22, ASN12, Glu22 of Drpl respectively; the inventors predicted these sites as active interacting sites of ⁇ and Drpl complex.
- Designed molecular structures were introduced into ⁇ and Drpl complex in order to identify the interactions of ligands in the complex and identify their inhibitory properties against ⁇ -Drp 1 interaction. Few molecules showed good binding score against this complex.
- DDQ only interacted at specific interacting sites in the ⁇ -Drpl complex and exhibited the best docking capability and received the best docking score than all other molecules.
- DDQ is obstructing these ⁇ and Drpl bindings by direct interactions at active sites such as ser8 and Leu34 of ⁇ and ASN16 Glul6 of Drpl .
- DDQ is readily bound with Drpl independently before forming a complex. Therefore, the inventors selected DDQ as a selective target to treat against AD neuronal cells.
- MitoQ Phosphonium, [10-(4,5- dimethoxy-2-methyl-3,6-dioxo-l,4-cyclohexadien- l-yl)decyl]triphenyl-, methanesulfonate), in the non- limiting form of a mesylate.
- Each of the compounds can be formulated with one or more pharmaceutically acceptable salts, and if applicable, hydrates, solvates, tautomeric forms, stereoisomers, and prodrugs of the compounds described herein.
- pharmaceutically acceptable or “physiologically acceptable” refer to compounds, salts, compositions, dosage forms and other materials which are useful in preparing a pharmaceutical composition that is suitable for veterinary or human pharmaceutical use.
- the term "pharmaceutically acceptable salt” of a given compound refers to salts that retain the biological effectiveness and properties of the given compound, and which are not biologically or otherwise undesirable.
- the terms "pharmaceutically acceptable salts” or “physiologically acceptable salts” refer to salts with inorganic acids and salts with an organic acid.
- the free base can be obtained by basifying a solution of the acid salt.
- an addition salt, particularly a pharmaceutically acceptable addition salt may be produced by dissolving the free base in a suitable organic solvent and treating the solution with an acid, in accordance with conventional procedures for preparing acid addition salts from base compounds.
- Pharmaceutically acceptable acid addition salts may be prepared from inorganic and organic acids.
- Salts derived from inorganic acids include hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like.
- Salts derived from organic acids include acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, malic acid, malonic acid, succinic acid, maleic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethane sulfonic acid, p-toluene-sulfonic acid, salicylic acid, and the like.
- pharmaceutically acceptable base addition salts can be prepared from inorganic and organic bases.
- Salts derived from inorganic bases include, by way of example only, sodium, potassium, lithium, ammonium, calcium and magnesium salts.
- Salts derived from organic bases include, but are not limited to, salts of primary, secondary and tertiary amines, such as alkyl amines (i.e., NH 2 (alkyl)), dialkyl amines (i.e., HN(alkyl) 2 ), trialkyl amines (i.e., N(alkyl) 3 ), substituted alkyl amines (i.e., NH 2 (substituted alkyl)), di(substituted alkyl) amines (i.e., HN(substituted alkyl) 2 ), tri(substituted alkyl) amines (i.e., N(substituted alkyl) 3 ), alkenyl amines (i.e., NH 2 (alkenyl)), dialken
- Suitable amines include, by way of example only, isopropylamine, trimethyl amine, diethyl amine, tri(iso-propyl) amine, tri(n-propyl) amine, ethanolamine, 2-dimethylaminoethanol, piperazine, piperidine, morpholine, N-ethylpiperidine, and the like.
- hydrate refers to the complex formed by the combining of a compound and water.
- solvate refers to an association or complex of one or more solvent molecules and a compound of the invention.
- solvents that form solvates include, but are not limited to, water, isopropanol, ethanol, methanol, dimethylsulfoxide, ethylacetate, acetic acid, and ethanolamine.
- pharmaceutically acceptable carrier or “pharmaceutically acceptable excipient” or “excipient” refer to any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.
- any of these regions may be modified or substituted with one or more of the following: alkyl, alkenyl, alkynyl, alkylene, alkoxy, haloalkyl, haloalkoxy, cycloalkyl, aryl, heterocyclyl, heteroaryl, and/or heteroalkyl) wherein at least one hydrogen atom is replaced by a bond to a non-hydrogen atom such as, but not limited to alkyl, alkenyl, alkynyl, alkoxy, alkylthio, acyl, amido, amino, amidino, aryl, aralkyl, azido, carbamoyl, carboxyl, carboxyl ester, cyano, cycloalkyl, cycloalkylalkyl, guanadino, halo, halogen, haloalkyl, haloalkoxy, hydroxyalkyl, heteroalkyl, heteroaryl, heteroaryl
- Dethylphosphite (DEP) was added to the solution of (Z)-4-(2-(quinolin-4- ylmethyleneamino)ethyl)benzene- l,2-diolin in drop-wise fashion, at room temperature in the presence of the S1O 2 OSO 3 H catalyst.
- the reaction mixture was stirred continuously for 4 hours at 65 °C.
- the resulting mixture was purified by column chromatography, using a 100-200 mesh silica gel as the adsorbent and a mixture of ethyl acetate and hexane (1 :4) as the eluent, to derive the pure DDQ.
- synthesized DDQ is forwarded to screen its reducing effect of ⁇ and Drpl levels and to determine its inhibiting capacity against ⁇ and Drpl complex formation.
- the inventors treated DDQ in human neuroblastoma (SHSY5Y) cells as shown in FIG. 3. These treated cells were used to quantify the effect of DDQ on gene expression and protein levels of synaptic, AD- related, and mitochondrial-related genes.
- the inventors determined the ⁇ and Drpl interaction inhibitory property of DDQ and also quantified the number of mitochondria in the treated cells.
- mRNA levels of mitochondrial dynamics, mitochondrial biogenesis and synaptic genes were measured by using Sybr-Green chemistry-based quantitative real time RT-PCR.
- Table 2 mRNA fold changes of mitochondrial structural, mitochondrial biogenesis and synaptic genes in Human Neuroblastoma (SHSY5Y) cells treated with DDQ, ⁇ , ⁇ +DDQ and DDQ+ ⁇ relative to the untreated SHSY5Y cells and cells treated with ⁇ +DDQ and DDQ+ ⁇ relative to the ⁇ -treated SHSY5Y cells.
- Mitochondrial biogenesis genes (PGCla, Nrfl, Nrf2 and TFAM) expressions were significantly decreased in ⁇ effected neuronal cells and healthy increase in DDQ treated cells relative to untreated cells.
- Mitochondrial biogenesis protein levels were significantly increased in DDQ treated cells relative to untreated cells ( Figure 4B, D).
- DDQ reduces ⁇ and Drpl levels.
- the inventors conducted immunoblotting analysis, in cells treated with DDQ, ⁇ +DDQ and DDQ+ ⁇ . As shown in Figure 5A, the inventors found reduced levels of 4 kDa ⁇ in cells treated ⁇ +DDQ and DDQ+ ⁇ relative to cells treated with ⁇ alone. The inventors also found reduced levels of Drpl in cells treated DDQ, ⁇ +DDQ and DDQ+ ⁇ relative to untreated and ⁇ treated cells ( Figure 4A).
- mutant APP Swe /ind cells treated with DDQ Co-immunoprecipitation and immunoblotting analysis of mutant APP Swe /ind cells treated with DDQ.
- the inventors performed immunoprecipitation with ⁇ (6E10) antibody and immunoblotting analysis with 6E10 and the inventors also performed co-immunoprecipitation analysis with ⁇ (6E10) antibody and immunoblotting analysis with Drp l antibody.
- the inventors found reduced levels of full-length APP and 4 kDa ⁇ in lane 2 of mutant APP Swe /ind cells treated with DDQ compared to lane 1 of mutant APP Swe /ind cells untreated with DDQ.
- the inventors also found reduced levels of Drp 1 in lane 4 of mutant APP Swe Ind cells treated with DDQ compared to lane 3 of mutant APP Swe Ind cells untreated with DDQ.
- Double -labeling immunofluorescence analysis of Drpl and ⁇ To determine whether Drp l localizes and interacts with ⁇ , the inventors conducted double -labeling analysis of Drp l and ⁇ in DDQ pre-treated, post-treated and untreated, ⁇ incubated cells. As shown in Figure 8, the immunoreactivity of Drp l was colocalized with ⁇ immunoreactivity (monomelic), indicating that Drpl interacts with ⁇ .
- Drp 1 results in reduced co-localization of Drp 1 with ⁇ in DDQ pre-treated and post-treated ⁇ incubated cells relative to ⁇ incubated cells alone.
- Drpl and ⁇ colocalization is markedly reduced in DDQ pre-treated cells than DDQ post-treated cells.
- DDQ reduces soluble ⁇ 42 in mutant APP Swe /ind cells treated with DDQ.
- the present inventors have developed a robust and reproducible method for identifying drug molecules that reduce Drp 1 and ⁇ levels and also to inhibit abnormal interaction between Drp 1 and ⁇ that reduce excessive mitochondrial fragmentation and maintain mitochondrial function and synaptic activity in AD neurons.
- the elevated levels of ⁇ and increased expressions of mitochondrial fission protein Drp l, and abnormal interactions between ⁇ and Drp l, have been found to induce synaptic dysfunction and mitochondrial damage, causing neuronal dysfunction in AD neurons.
- the inventors have designed 82 molecular crystal structures based on existing drug molecules and screened by molecular docking studies.
- the inventors designed these molecules with multiple functions including anti-inflammatory, anti-antioxidant, pro-longevity, and anti- amyloid functions.
- the inventors selected DDQ as a novel drug target because, it bound at ⁇ and Drp l interacting sites to inhibit ⁇ and Drp l complex formation and also showed better docking score than other designed molecules and existing molecules such as MitoQ, Mdivi l and SS31.
- DDQ is formulated to dissolve in water.
- DDQ is obstructing ⁇ and Drp 1 binding sites by direct interactions at active sites of ⁇ (ser8 and Leu34) and Drp l (ASN16 and Glul6) (FIG. IB).
- FIG. 2 shows a schematic of the synthetic procedure used to develop DDQ.
- the inventors examined the protective effects of DDQ in healthy human neuroblastoma cells, and also in neurons incubated with ⁇ 42.
- the inventors studied preventive (DDQ+ ⁇ ) and intervention ( ⁇ +DDQ) effects of DDQ against ⁇ in AD neurons.
- the inventors measured mR A and protein levels of mitochondrial dynamics, biogenesis and synaptic genes using real time RT-PCR, immunoblotting and immunofluorescence analysis.
- the inventors also assessed mitochondrial function by measuring H 2 O 2 , lipid peroxidation, cytochrome oxidase activity, GTPase-Drpl activity and mitochondrial ATP. Further, the inventors studied cell viability using the MTT assay. Mitochondrial number and morphology was studied using transmission electron microscopy.
- Mitochondrial fission protein levels were increased and fusion, biogenesis and synaptic proteins levels were decreased in ⁇ treated neurons relative to untreated neurons, indicating the toxicity of ⁇ .
- DDQ enhanced fusion activity; reduced fission machinery; and increased mitochondrial biogenesis & synaptic activities.
- DDQ pre- and post-treated of ⁇ incubated cells showed appropriate mitochondrial dynamics and synaptic activities similar to untreated neurons.
- DDQ pre- and post-treated of ⁇ incubated neurons showed reduced abnormal mitochondrial dysfunction, maintained cell viability and synaptic activity, relative to ⁇ treated neurons.
- the protective effects of DDQ were stronger in pretreated neurons than in post-treated neurons, as such, DDQ works better in prevention than treatment in AD-like neurons. Mitochondrial count is significantly decreased in DDQ-treated neurons relative to untreated neurons.
- DDQ reduces the levels of ⁇ and Drpl and interaction between ⁇ and Drpl .
- the inventors studied Drpl and ⁇ and their interactions. The inventors found that ⁇ interacts with Drpl in ⁇ incubated cells, and this interaction is gradually reduced by pre- and post-treatment of DDQ and the reduction of Drpl and ⁇ is stronger in DDQ pre-treated cells than post-treated. Further, the inventors also found reduced levels of ⁇ and Drp 1 in DDQ treated AD ( ⁇ +DDQ and DDQ+ ⁇ ) neurons ( Figure 5).
- the reduced interaction between ⁇ and Drp 1 may be due to the reduced synthesis/production of ⁇ and Drp l in DDQ pre- and post-treated cells.
- This reduced interaction of ⁇ with Drp l in DDQ pre-and post- treated cells may reduce mitochondrial fragmentation and keep mitochondria in normal count, normal length and normal function and further it may protect to neuronal cells from ⁇ attack.
- DDQ DDQ is obstructing ⁇ and Drp l binding sites by direct interactions at active sites of ⁇ (ser8 and Leu34) and Drp l (ASN16 and Glul6) ( Figure 1).
- DDQ is readily bound with Drp l (independently before forming a Drp l- ⁇ complex), leaving less Drp l binding sites with ⁇ .
- additional research is needed to determine the precise effects of DDQ's role in reducing physical interaction between ⁇ and Drp 1.
- DDQ reduces ⁇ 42 in mutant APP Swe /ind cells.
- the inventors measured both ⁇ 42 and ⁇ 40 in mutant APP Swe /ind cells treated and untreated with DDQ.
- ⁇ 42 levels were significantly reduced and ⁇ 40 levels were significantly increased in DDQ-treated mutant APP Swe /ind cells ( Figure 9) relative to DDQ-untreated APP Swe /ind cells.
- DDQ maintains mitochondrial function and cell viability.
- the inventors assessed mitochondrial function assays in all treated and untreated cells. The parameters included H 2 O 2 production, lipid peroxidation, ATP production, GTPase Drp l enzymatic activity and cell viability. In ⁇ treated cells, mitochondrial function was found to be defective and cell viability was also reduced. These observations agree with others on ⁇ induced defective mitochondrial function and cell viability.
- DDQ treated cells showed enhanced mitochondrial function (Figure 1 1) and increased cell viability (Figure 12), implying that DDQ treated cells exhibited increased mitochondrial ATP, cytochrome oxidase activity and cell viability, and reduced free radicals and oxidative stress. These observations strongly suggest that DDQ reduces cellular toxicity and boosts mitochondrial function and promotes cell longevity.
- the inventors designed and synthesized DDQ based on the best docking score and its binding interactions with ⁇ and Drpl complex.
- AD neurons treated with DDQ the inventors found reduced levels of mitochondrial fission gene expressions and proteins and increased levels of mitochondrial fusion, biogenesis and synaptic gene expressions and proteins relative to neurons incubated with ⁇ alone indicating that DDQ is protective against ⁇ - and Drpl-induced toxicities.
- DDQ have protective effects on neuronal cells and it protects against ⁇ induced mitochondrial and synaptic toxicities in AD neurons.
- LCMS mass spectra were recorded on a Jeol SX 102 DA/600 Mass spectrometer.
- ⁇ 1-42 peptide was purchased from Anaspec, Fremont, CA, USA.
- Dulbecco's Modified Eagle Medium/F- 12 (DMEM/F12), penicillin/streptomycin, Trypsin-EDTA and fetal bovine serum were purchased from GIBCO (Gaithersberg, MD).
- SHSY5Y cells SHSY5Y cells were purchased from American Tissue Type Collection (ATCC), Virginia, USA.
- Electrostatic potential was applied to a cut-off value of 1.5 A at a dielectric value of 1.
- a non-bonded cut- off value of 8 A was applied to the Leonard-Jones terms.
- the completed structure was energy-minimized, using the MMFF94x force field at a gradient cut off value of 0.05.
- Molecular dynamic simulations were carried out at a constant temperature of 300 K for a heat time of 10 picoseconds. All simulations were carried out, over a total of 2000 picoseconds. The time step was considered 0.001, and the temperature relaxation time was set to 0.2 picoseconds. The position, velocity, and acceleration were determined and the data collected and saved every 0.5 picoseconds.
- PDB structure of ⁇ was constructed in the MOE working environment and subjected to energy minimization.
- MMFF94x force fields were included, and the related potential energy terms were enabled for all bonded interactions, Van der Waals interactions, and electrostatic interactions and restraints.
- the non-bonded cut-off value was enabled between 8- 10 A.
- a generalized born implicit salvation model was enabled, all parameters were fixed, the gradient was set to 0.05, and the partial charges of the force field were enabled in order to run calculations during the minimization process.
- Dynamic simulations were carried out, using the Nose-Poincare-Anderson equational algorithm. Consequently, the inventors formed ⁇ and Drp l complex, which further used as receptor to find the binding interactions designed molecules.
- the 3D structures of all designed structures were constructed in the MOE working environment and subjected to energy minimization.
- MMFF94x force fields were included, and the related potential energy terms were enabled for all bonded interactions, Van der Waals interactions, and electrostatic interactions and restraints.
- the non-bonded cut-off value was enabled between 8-10 A.
- a generalized Born implicit salvation model was enabled, all parameters were fixed, the gradient was set to 0.05, and the partial charges of the force field were enabled in order to run calculations during the minimization process.
- Dynamic simulations were carried out, using the Nose-Poincare-Anderson equational algorithm.
- the temperature for the proteins was set to 30 K and was increased to 300 K for run-time temperature. Heat time and cool time were set to 0 picoseconds.
- the site for the Prediction of Binding Site for Ligand Activity of the crystallographic structure of Drp l was defined.
- the MOE dock module was used to dock the compounds into specified binding sites along with the reference compound exemestane. Exemestane was found in contact with 3S7S, determined by alpha PMI (Principle Moments of Inertia) placement methodology, where Poses were generated by aligning principal moments of inertia and ligand conformations to a randomly generated subset of alpha spheres in the receptor site. Thirty docked conformations were generated for each ligand and ranked by an alpha HB scoring function, which is a linear combination of the geometric fit of the ligand to the binding site and hydrogen bonding effects. From all the receptor-ligand complexes, the conformation with the lowest docking score was chosen for additional analysis.
- DDQ In vitro biological studies of DDQ. DDQ exhibited a good molecular docking score and better binding interactions compared to the other molecules those the inventors developed. Therefore, the inventors decided to quantify the biological effects of DDQ in AD pathogenesis. Therefore, the inventors treated AD neurons with DDQ and quantified the effect of DDQ on gene expression levels of synaptic, AD- related, and mitochondrial-related genes. For these treatments, the inventors performed the following protocols: The inventors treated SHSY5Y cells in five different groups as explained in Figure 3.
- Figure 3 illustrates the experimental strategy of the cell culture work and including treatments.
- the cells were grown in a medium (1 : 1 DMEM and F12, 10% FBS, lx penicillin, and streptomycin) at 37°C in a humified incubator with a 5% CO 2 environment. After seeding were allowed to grow for 24-48 hrs or until 80% confluence in six-well plates and used for experiments.
- the inventors used five different groups of cells - (1) untreated SHSY5Y cells; (2) SHSY5Y cells treated with DDQ (250 nM final concentration) for 24 hrs; (3) SHSY5Y cells incubated with ⁇ peptide 1-42 (20uM final concentration) for 6 hrs; (4) SHSY5Y cells treated ⁇ for 6 hrs +DDQ for 24 hrs and (5) SHSY5Y cells treated DDQ for 24 hrs and ⁇ for 6 hrs. Half a million SHSY5Y cells were suspended per well into six-well plates. The inventors used ⁇ peptide 1-42 and DDQ 250 nM in the experiments.
- the inventors harvested cells, conducted experiments to measure the levels mRNA using Sybr-Green based real-time RT-PCR, proteins using immunoblotting and immunofluorescence analysis and cell viability using MTT assay. The inventors counted the number of mitochondria by electron microscopy.
- Table 4 Summary of antibody dilutions and conditions used in the immunoblotting analysis of mitochondrial structural and synaptic proteins in the SHSY5Y cell treated with DDQ, ⁇ , ⁇ +DDQ and DDQ+ ⁇ .
- SHSY5Y cells mutant APP Swe/ in d cells and co-immunoprecipitation analysis.
- SHSY5Y cells To determine whether ⁇ interact with Drpl, the inventors used protein lysates from ⁇ incubated (DDQ pre-treated, post-treated and untreated) SHSY5Y cells.
- Mutant APP Swe /ind cells The inventors purchased mutant APP Swe cDNA clone (pCAX-APP swe/ind) from Addgene - https://www.addgene.org and verified expression of mutant APP APP Swe /ind cDNA and further sub-cloned into a mammalian expression vector (Arubala P. Reddy - unpublished observations). The inventors transfected mutant APP Swe /ind cDNA into mouse neuroblastoma (N2a) cells for 24 hrs and after transfection, cells were treated with DDQ (250nM) for 24 hrs.
- DDQ 250nM
- the inventors performed co-immunoprecipitation (co-IP) assays using the Dynabeads Kit for Immunoprecipitation (Invitrogen). Briefly, 50 of Dynabeads containing protein G was incubated with 10 ⁇ g 6E10 or 10 ⁇ g of the Drpl antibodies (both mono- and polyclonal antibodies; Santa Cruz), with rotation, for 1 h at room temperature. The inventors used all the reagents and buffers provided in the kit. Details of antibodies used for co-IP and western blotting are given Table 5. The Dynabeads- ⁇ complex was washed three times with a washing buffer and was then incubated overnight with 400 ⁇ g of protein at 4°C, with rotation.
- the incubated Dynabead antigen/antibody complexes were washed again 3 times with a washing buffer, and an immunoprecipitant was eluted from the Dynabeads, using a NuPAGE LDS sample buffer.
- the ⁇ and Drp 1 IP elute was loaded onto a 4-20 gradient gel, followed by western blot analysis of ⁇ and/or Drpl antibodies.
- the inventors also cross-checked the results by performing co-IP experiments, using both anti- ⁇ and anti-Drpl antibodies [10].
- the neurons were incubated with appropriate secondary antibodies.
- the cells were washed neurons 3 times with PBS, and slides were mounted. Photographs were taken with a multiphoton laser scanning microscope system (ZeissMeta LSM510). To quantify the immunoreactivity of proteins of interest, for each treatment 10-15 photographs were taken at x20 magnification.
- Table 6 Summary of antibody dilutions and conditions used in the immunohistochemistry/ immunofluorescence analysis of Drpl, Synaptophysin and PSD95 in the SHSY5Y cell treated with DDQ, ⁇ , ⁇ +DDQ and DDQ+ ⁇ .
- Drpl and ⁇ the inventors conducted double-labeling immunofluorescence analysis, using an anti- Drplantibody (rabbit polyclonal, Santa Cruz Biotechnology) and 6E10 (Covance). As described earlier, the sections from AD patients and control subjects were deparaffinized and treated with sodium borohydrate to reduce autofluorescence.
- the ⁇ incubated (DDQ pre-treated, post-treated and untreated) cells were incubated overnight with the anti-Drpl antibody (1 :200) at room temperature.
- the sections were washed with 0.5% Triton in PBS. They were then incubated with a secondary biotinylated anti-rabbit antibody at a 1 :400 dilution (Vector Laboratories, Burlingame, CA, USA) or a secondary biotinylated anti -mouse antibody (1:400) for 1 h at room temperature. They were incubated for 1 h with labeled streptavidin, an HRP solution (Molecular Probes). The cells were washed three times each with PBS for 10 min, at pH 7.4, and treated with Tyramide Alexa488 for 10 min at room temperature.
- the cells were blocked for 1 h with a blocking solution containing 0.5% Triton in PBS+10% donkey serum+1% BSA. Then they were incubated overnight with 6E10 ( 1 :200 dilution, Covance) at room temperature. Next, they were incubated with the donkey anti-mouse secondary antibody labeled with Alexa 594 for 1 h at room temperature. They were cover-slipped with Prolong Gold and photographed with a confocal microscope [10].
- the SHSY5Y cells were dehydrated, infiltrated overnight in 1 : 1 acetone :Epon 812 and infiltrated for 1 h with 100% Epon 812 resin. They were then embedded in the resin. After polymerization, 60 to 80 nm thin sections were cut on a Reichert ultramicrotome and stained for 5 min in lead citrate. They were rinsed and post-stained for 30 min in uranyl acetate and then were rinsed again and dried. Electron microscopy was performed at 60 kV on a Philips Morgagne TEM equipped with a CCD, and images were collected at magnifications of ⁇ 1000-37 000. The numbers of mitochondria were counted in the SHSY5Y cells batches 1-5, and statistical significance was determined, using one-way ANOVA.
- Statistical analyses were conducted in 2 ways: 1. untreated cells versus cells treated with ⁇ , DDQ, DDQ+ ⁇ and ⁇ +DDQ and 2. Cells treated with ⁇ versus DDQ+ ⁇ and ⁇ +DDQ for mRNA and protein levels, cell viability and mitochondrial functional parameters H 2 O 2 , cytochrome oxidase activity, lipid peroxidation, ATP production and cell viability using appropriate statistical analysis.
- compositions of the invention can be used to achieve methods of the invention.
- the words “comprising” (and any form of comprising, such as “comprise” and “comprises"), “having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “includes” and “include”) or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.
- “comprising” may be replaced with “consisting essentially of or “consisting of.
- the phrase “consisting essentially of requires the specified integer(s) or steps as well as those that do not materially affect the character or function of the claimed invention.
- the term “consisting” is used to indicate the presence of the recited integer (e.g., a feature, an element, a characteristic, a property, a method/process step or a limitation) or group of integers (e.g., feature(s), element(s), characteristic(s), propertie(s), method/process steps or limitation(s)) only.
- A, B, C, or combinations thereof refers to all permutations and combinations of the listed items preceding the term.
- A, B, C, or combinations thereof is intended to include at least one of: A, B, C, AB, AC, BC, or ABC, and if order is important in a particular context, also BA, CA, CB, CBA, BCA, ACB, BAC, or CAB.
- expressly included are combinations that contain repeats of one or more item or term, such as BB, AAA, AB, BBC, AAABCCCC, CBBAAA, CABABB, and so forth.
- BB BB
- AAA AAA
- AB BBC
- AAABCCCCCC CBBAAA
- CABABB CABABB
- words of approximation such as, without limitation, "about”, “substantial” or “substantially” refers to a condition that when so modified is understood to not necessarily be absolute or perfect but would be considered close enough to those of ordinary skill in the art to warrant designating the condition as being present.
- the extent to which the description may vary will depend on how great a change can be instituted and still have one of ordinary skilled in the art recognize the modified feature as still having the required characteristics and capabilities of the unmodified feature.
- a numerical value herein that is modified by a word of approximation such as "about” may vary from the stated value by at least ⁇ 1, 2, 3, 4, 5, 6, 7, 10, 12 or 15%.
- compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.
- each dependent claim can depend both from the independent claim and from each of the prior dependent claims for each and every claim so long as the prior claim provides a proper antecedent basis for a claim term or element.
- Mattson MP (2004) Pathways towards and away from Alzheimer's disease. Nature. 430, 631-639.
- Mitochondria are a direct site of A beta accumulation in Alzheimer's disease neurons: implications for free radical generation and oxidative damage in disease progression. Hum Mol Genet. 15, 1437-1449.
- Devi L Prabhu BM, Galati DF, Avadhani NG, Anandatheerthavarada HK (2006) Accumulation of amyloid precursor protein in the mitochondrial import channels of human Alzheimer's disease brain is associated with mitochondrial dysfunction. J. Neurosci. 26, 9057-9068.
- Amyloid-beta overproduction causes abnormal mitochondrial dynamics via differential modulation of mitochondrial fission/fusion proteins. Proc. Natl. Acad. Sci. USA., 105, 19318-19323.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Organic Chemistry (AREA)
- Epidemiology (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biochemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Psychology (AREA)
- Hospice & Palliative Care (AREA)
- Psychiatry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The present invention includes a molecule, a method of identifying said molecule, and a method of using said molecule to inhibit the interaction of Αβ and Drpl proteins. The molecules including diethyl (3,4-dihydroxyphenethylamine)(quinolin-4- yl)methylphosphonate (DDQ); [ 10-(4,5-dimethoxy2-methyl-3,6-dioxo- 1,4-cyclohexadien- 1 -yl)decyl]triphenylphosphonium methanesulfonate (MitoQ); 3-Hydroxynaphthalene-2-carboxylic acid (3,4-dihydroxy-benzylidene)-hydrazide (Dynasore); and/or 3-(2,4Dichloro-5-methoxyphenyl)-2,3-dihydro-2-thioxo-4(lH)-quinazolinone / 3-(2,4-Dichloro-5-methoxyphenyl)-2-sulfanyl- 4(3H)-quinazolinone (Mdivi-1).
Description
DRUG TARGETS OF DELAYED AGING AND HUMAN BRAIN DISEASES
TECHNICAL FIELD OF THE INVENTION
The present invention relates generally to tryptamine, dopamine and quinolone derivatives and their use in delay aging and diseases of the human brain. The composition and methods use such a compound and may also be used in combination with a potentiator to delay aging.
INCORPORATION-BY-REFERENCE OF MATERIALS FILED ON COMPACT DISC
The present application includes a Sequence Listing, which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on November 27, 2017, is named TECH2009WO_SeqList and is 8 kilobytes in size.
BACKGROUND OF THE INVENTION
Without limiting the scope of the invention, its background is described in connection with neurological conditions. The World Alzheimer's Report estimated that in 2015, 47.5 million people had AD-related dementia ("dementia") worldwide, and these numbers were expected to rise to 75.6 million by 2030 and to 131.5 million by 2050. Over 9.9 million new cases of AD-related dementia are diagnosed every year worldwide, which translates to 1 new case every 3.2 seconds. In high-income countries, such as the United States and Germany, seven in 10 persons aged 70 years and older will pass away with some form of dementia. Dementia has a huge economic impact on society, on the persons with dementia, and on their families and caretakers. The estimated total healthcare cost of dementia worldwide in 2015 was estimated at $818 billion, and the World Alzheimer' s Report foresees dementia as a trillion-dollar disease by 2018. While scientists are trying to determine causes of Alzheimer's Disease ("AD"), they have pinpointed several cellular changes that increase a person's risk for developing it, including synaptic loss and dysfunction, Αβ production and accumulation, inflammatory responses, phosphorylated tau formation and accumulation, cell cycle deregulation, and hormonal imbalance. Aging is the number one risk factor for AD. Mounting evidence indicates that Αβ plays a key role in AD pathophysiology. Intra-neuronal Αβ and Αβ deposits early in the disease process, and intracellular hyperphosphorylated tau and neurofibrillary tangles later in the disease process, have been found in postmortem brains from AD patients. In addition, Αβ has been found to induce synaptic dysfunction and mitochondrial oxidative damage, resulting in abnormal activation of redox-mediated events, as well as an abnormal elevation of cytoplasmic Ca2+, ultimately causing neuronal damage. AD pathogenesis has been linked to DNA damage. In mammals, including humans, an accumulation of oxidative DNA damage in particularly mutant DNA, including brain tissue, has been found in aging persons.
One example is Patent Application Publication No. WO2008/074068, entitled, "Substituted quinoline derivatives as antiamyloidogeneic agents," discloses heterocyclic compounds, processes for their preparation and their use as pharmaceutical or veterinary agents, in particular for the treatment, amelioration and/or prophylaxis of conditions caused by or associated with unbalanced metal levels and/or oxidative stress, such as neurological conditions and cellular proliferative disorders, for example Alzheimer's disease, Parkinson's disease, Huntington's disease or brain cancer or tumors.
Another example is Patent Application Publication No. WO2002/058686, entitled, "Method of treatment of neurodegenerative disorders using pentaaza-macrocyclic ligand complexes," discloses pharmaceutical compositions and methods using such compositions for the treatment of neurodegenerative disorders. Such compositions contain a catalyst for the dismutation of superoxide, including superoxide dismutase enzyme (SOD) and low molecular weight organic ligand derived metal complexes that function as mimics of the enzyme (SOD mimetics or SODms).
SUMMARY OF THE INVENTION
The inventors designed a number of molecules with the aid of molecular docking software to reduce/prevent interactions between Αβ and Drp 1 ; Αβ and p-tau; Αβ and VDAC 1 . Specifically, the inventors implemented the use of four distinct scaffolding structures with molecular docking simulation to fit the active sites of each enzyme and extrapolate R-groups with high binding affinity against abnormal protein interactions. Thus, the present invention includes methods for identifying molecules that can delay aging process and prevent and/or stop neurodegeneration. The inventors discovered molecules that cause delayed aging and protect cells from oxidative insults. The inventors also identified specific molecule that can be modified to increase their effectiveness, and methods for using the same to treat neurodegenerative disease. It was found that the molecules possess certain features, e.g., (1) delayed aging, (2) protect human cells from oxidative insults, (3) reduce the toxicity of mutant proteins, (4) inhibit abnormal protein interactions in the brain cells, and/or (5) enhance cell survival.
In one embodiment, the present invention includes a molecule that inhibits the interaction of Αβ and Drp 1 proteins. In one aspect, the molecule inhibits the interaction of Αβ and Drpl proteins in nerve cells. In another aspect, the molecule inhibits mitochondrial, intracellular, and extracellular damage caused by the interaction of Αβ and Drpl in or about nerve cells. In another aspect, the molecule is water-soluble. In another aspect, the molecule is adapted for oral, intravenous, intramuscular, intraperitoneal, subcutaneous, parenteral, or pulmonary administration. In another aspect, the Αβ and Drpl proteins are human. In another aspect, the molecule delays age-dependent disease process in Alzheimer's, Huntington's, Parkinson's and ALS. In another aspect, the molecule at least one of: delays aging in neurons, protects neurons from oxidative insults, inhibits abnormal protein-protein interactions and protect neurons from
mutant protein(s)-induced toxicities, and enhances cell survival. In another aspect, the molecule is selected from at least one of: phosphonium cation based structures; quinoline based alpha aminophosphonates; napthaline based alpha aminophosphonates, or hexahydropyramidine carboxylates structures. In another aspect, the composition is selected from at least one of:
lphosphonate):
MitoQ : (Phosphonium, [ 10-(4,5 -dimethoxy-2-methyl-3 ,6-dioxo- 1 ,4-cyclohexadien- 1 -yl)decyl]triphenyl-,
Dynasore: (3-Hydroxy-naphthalene-2-carboxylic acid (3,4-dihydroxy-benzylidene)-hydrazide) shown here in the non-limiting form of a hydrate:
Mdiv-1 : (3-(2,4-Dichloro-5-methoxyphenyl)-2,3-dihydro-2-thioxo-4(lH)-quinazolinone, 3-(2,4-Dichloro- 5-methoxyphenyl)-2-sulfanyl-4(3H)-quinazolinone):
In another aspect, the shaded regions are modified to at lease one of: increase the inhibition of Αβ and Drpl binding, increase crossing the blood-brain4oarrier, increase solubility, or increase the metabolic half-life of the molecule.
Another embodiment of the present invention includes a method for identifying a molecule that inhibits the interaction of Αβ and Drpl proteins comprising: obtaining a database of molecular coordinates for the regions of the Αβ and Drp 1 proteins that interact; obtaining a database of molecules comprising molecular coordinates; identifying the molecules from the database of molecules that fit between the regions in which the Αβ and Drp 1 proteins that interact; and testing in vitro the ability of the one or more molecules that fit between the regions in which the Αβ and Drpl proteins to prevent binding of Αβ and Drpl proteins. In one aspect, the method further comprises testing the inhibition of the one or more molecules
to inhibit the interaction of Αβ and Drp l proteins in nerve cells. In another aspect, the method further comprises testing the molecule to inhibit mitochondrial, intracellular, and extracellular damage caused by the interaction of Αβ and Drp l in or about nerve cells. In another aspect, the molecule is water soluble. In another aspect, the method further comprises adapting the molecule for oral, intravenous, intramuscular, intraperitoneal, subcutaneous, parenteral, or pulmonary administration. In another aspect, the method further comprises testing the one or more molecules to delay age-dependent disease process in Alzheimer's, Huntington's, Parkinson's and ALS. In another aspect, the one or more molecules at least one of: delays aging in neurons, protects neurons from oxidative insults, inhibits abnormal protein-protein interactions and protect neurons from mutant protein(s)-induced toxicities, and enhances cell survival. In another aspect, the method further comprises selecting from at least one of: phosphonium cation based structures; quinoline based alpha aminophosphonates; napthaline based alpha aminophosphonates, or hexahydropyramidine carboxylates structures. In another aspect, the molecule tested is, or is based on, at least one of:
methylphosphonate):
MitoQ : (Phosphonium, [ 10-(4,5 -dimethoxy-2-methyl-3 ,6-dioxo- 1 ,4-cyclohexadien- 1 -yl)decyl]triphenyl-, methanesulfonate), shown here in the non-limiting form of a mesylate.
Dynasore: (3-Hydroxy-naphthalene-2-carboxylic acid (3,4-dihydroxy-benzylidene)-hydrazide) shown here in the non-limitin form of a hydrate:
Mdivi-1 : (3-(2,4-Dichloro-5-methoxyphenyl)-2,3-dihydro-2-thioxo-4(lH)-quinazolinone, 3-(2,4- Dichloro-5-methoxyphenyl)-2-sulfanyl-4(3H)-quinazolinone):
In another aspect, the shaded regions are modified to at lease one of: increase the inhibition of Αβ and Drpl binding, increase crossing the blood-brain-barrier, increase solubility, or increase the metabolic half-life of the molecule.
Yet another embodiment of the present invention includes a method of treating a neuropathy caused by the interaction of Αβ and Drpl proteins comprising providing a molecule that inhibits the interaction of the Αβ and Drpl proteins. In one aspect, the molecule inhibits the interaction of Αβ and Drpl proteins in nerve cells. In another aspect, the molecule inhibits mitochondrial, intracellular, and extracellular damage caused by the interaction of Αβ and Drpl in or about nerve cells. In another aspect, the molecule is water soluble. In another aspect, the molecule is adapted for oral, intravenous, intramuscular, intraperitoneal, subcutaneous, parenteral, or pulmonary administration. In another aspect, the Αβ and Drp 1 proteins are human. In another aspect, the neuropathy is an age-dependent disease selected from Alzheimer's, Huntington's, Parkinson's disease or ALS. In another aspect, the molecule at least one of: delays aging in neurons; protects neurons from oxidative insults; inhibits abnormal protein-protein interactions and protect neurons from mutant protein(s)-induced toxicities; and enhances cell survival. In another aspect, the molecule is selected from at least one of: phosphonium cation based structures; quinoline based alpha aminophosphonates; napthaline based alpha aminophosphonates, or hexahydropyramidine carboxylates structures. In another aspect, the molecule is, or is based on, at least one of:
DDQ (diethyl(3,4-dihydroxyphenethylamine)(quinolin-4-yl)methylphosphonate):
Dynasore: (3-Hydroxy-naphthalene-2-carboxylic acid (3,4-dihydroxy-benzylidene)-hydrazide) shown here in the non-limiting form of a hydrate:
Mdivi-1 : (3-(2,4-Dichloro-5-methoxyphenyl)-2,3-dihydro-2-thioxo-4(lH)-quinazolinone, 3-(2,4- Dichloro-5-methoxyphenyl)-2-sulfanyl-4(3H)-quinazolinone):
In another aspect, the shaded regions are modified to at lease one of: increase the inhibition of Αβ and Drpl binding, increase crossing the blood-brain-barrier, increase solubility, or increase the metabolic half-life of the molecule.
BRIEF DESCRIPTION OF THE DRAWINGS
For a more complete understanding of the features and advantages of the present invention, reference is now made to the detailed description of the invention along with the accompanying figures and in which: FIGS. 1A to 1C show the interaction of designed drug molecules against Αβ and Drpl Complex. FIG. 1A. Interaction of Drpl (PDB ID: 4hlu) and Αβ1-40 (PDBID: lba4) proteins. FIG IB. Inhibition of Drpl and Αβ40 peptide Interaction by DDQ. FIG 1C. Interaction of Drpl and designed drug molecules. The inventors designed 82 molecules based on existing mitochondrial division inhibiting drug molecules in AD and subjected to molecular docking studies. The inventors prepared Αβ and Drpl complex and introduced these molecular structures into this complex. Few of these molecules showed better docking score compared to existed drug molecules. Amongst DDQ is only involved in the prevention of Αβ-Drpl interaction by interacting at the active site such as ser8 and Leu34 of Αβ and ASN16 Glul6 of Drpl . And also DDQ showed better binding score (-10.8462) than existed drug molecules. DDQ is readily stopping the Drpl before forming the complex. DDQ exhibited binding interaction at Arg225 (C=0→0-P) and phenyl part of DDQ is also showing one arene cationic interaction at Arg225. Hence, among all designed molecules the inventors selected DDQ for detailed analysis but the methods and techniques apply equally to the four compounds without undue experimentation.
FIG. 2 shows a schematic of the synthetic procedure used to develop DDQ.
FIG. 3 is a flowchart with the strategy of DDQ treatments in cell cultures. As shown in FIG. 3, the inventors studied five different groups of cells: (1) untreated SHSY5Y cells; (2) SHSY5Y cells treated (incubated) with DDQ (250 nM) for 24 hours; (3) SHSY5Y cells incubated with the Αβ1-42 peptide (20 μΜ final concentration) for 6 hours; (4) SHSY5Y cells incubated with Αβ1-42 for 6 hours, followed by DDQ treatment for 24 hours, and (5) SHSY5Y cells treated with DDQ for 24 hours, followed by Αβ1-42 incubation for 6 hours.
FIGS. 4A to 4C show the results of immunoblotting analysis mitochondrial dynamics, biogenesis and synaptic proteins. FIG. 4A. Representative Immunoblotting images (mitochondrial fission, fusion proteins and synaptic proteins) of DDQ, Αβ, Αβ+DDQ and DDQ+Αβ treated and untreated SHSY-5Y cells. FIG 4B. Representative Immunoblotting images (mitochondrial biogenesis proteins) of DDQ, Αβ, Αβ+DDQ and DDQ+Αβ treated and untreated SHSY-5Y cells. FIG. 4C. Quantitative densitometry analysis of mitochondrial dynamics and synaptic proteins. Quantitative densitometry analysis of mitochondrial biogenesis. Fission proteins levels were increased in cells treated with Αβ; and reduced in cells treated with DDQ, Αβ+DDQ and DDQ+Αβ treated cells. Whereas mitochondrial fusion proteins Mfnl and Mfn2 and synaptic proteins, synaptophysin and PSD95 were decreased in cells treated with Αβ, and enhanced in cells treated with DDQ, Αβ+DDQ and DDQ+Αβ treated cells.
FIGS. 5A and 5B show a co-immunoprecipitation analysis of Drpl and Αβ in SHSY5Y cells. FIG. 5A shows immunoprecipitation with the 6E10 antibody and immunoblotting with the 6E10 antibody, indicating that the specificity of 6E10 in the Co-IP analysis. In cells treated with DDQ+Αβ and Αβ+DDQ, 4 kDa Αβ levels were reduced relative cells treated Αβ alone. FIG. 5B shows Co-IP with Αβ antibody 6E10 and western blotting with Drpl antibody, indicating that Drpl interacts with 4 kDa Αβ. Reduced interaction between Αβ and Drpl was found in cells pretreated with DDQ and then Αβ added. Reduced interaction was strong in DDQ+Αβ cells compared to cells treated with Αβ alone.
FIG. 6 shows the co-immunoprecipitation analysis of mutant APPSwe/Ind cells treated with DDQ. The inventors' transfected mutant APPSwe cDNA construct into mouse neuroblastoma (N2a) cells. After 24 hrs of transfection, cells were treated with DDQ (250nM) for 24 hrs. Harvested mutant APPSwe/Ind cells treated and untreated with DDQ and prepared protein lysates and performed immunoprecipitation with Αβ (6E10) antibody and conducted immunoblotting analysis with 6E10 and Drpl antibodies. Lanes 1 and 2 represents IP with 6E10 and western blot with 6E10 and lanes 3 and 4 represents IP with 6E10 and western blot with Drpl antibody respectively. As shown in Figure, reduced levels of full-length APP and 4 kDa Αβ were found in lane 2 mutant APPSwe/Ind cells treated with DDQ compared to lane 1 of mutant APPSwe/Ind cells untreated with DDQ. Reduced levels of Drpl were found in lane 4 of mutant APPSwe cells treated with DDQ compared to lane 3 of mutant APPSwe/Ind cells untreated with DDQ.
FIGS. 7A and 7B shows an immunofluorescence analysis. Immunofluorescence analysis of human neuroblastoma (SHSY5Y) cells treated with Αβ, DDQ, Αβ+DDQ and DDQ+Αβ relative to untreated cells. FIG. 7A shows representative immunofluorescence images of mitochondrial dynamic proteins and synaptic proteins. FIG. 7B shows quantitative immunofluorescence analysis of mitochondrial dynamics and synaptic proteins.
FIG. 8. Double labeling Immunofluorescence analysis of Drp l and Αβ. Double-labeling immunofluorescence analysis of Αβ (6E10 antibody) and Drpl in SHSY5Y cells. The localization of Drp l (green) and Αβ (red) and the colocalization of Drp l and Αβ (yellow, merged) at 60 χ the original magnification. Top panel, represents Αβ treated cells, middle panel shows Αβ+DDQ treated cells and the bottom panel shows DDQ+Αβ treated cells. As shown in FIGS. 7A and 7B, increased levels of Drp l and intra-neuronal Αβ (full-length APP) and colocalization of Drp l and Αβ in top panel, where as in the middle panel Αβ+DDQ cells, reduced Drp l and Αβ and also reduced colocalization and in the bottom panel Drpl and Αβ levels markedly reduced compared to top panel and also colocalization of Drp l and Αβ. These findings strongly suggest that DDQ 1) reduces Drp l and Αβ levels and also 2) inhibit the interaction of Drp l and Αβ in SHSY5Y cells. These findings agree with the Co-IP findings.
FIGS. 9A and 9B show sandwich ELISA analysis of Αβ40 and 42 in mutant APPSwe/Ind cells treated and untreated with DDQ. The inventors performed sandwich ELISA using protein lysates mutant APP cells treated and untreated with DDQ. FIG. 9A shows Αβ42 and FIG. 9B shows Αβ40. Significantly reduced levels of Αβ42 in mutant APPSwe/Ind cells treated with DDQ compared to mutant APPSwe/Ind cells untreated with DDQ. On the contrary, Αβ40 levels were significantly increased in mutant APPSwe/Ind cells treated with DDQ relative to mutant APPSwe/Ind cells untreated with DDQ.
FIG. 10 shows electron microscopy of SH-SY5Y cells. The inventors quantified mitochondrial architectures within the cell in all 5 groups to identify mitochondrial number and morphology. Average number of mitochondria per cell is shown in graphs. Error bars indicate the standard deviation. Mitochondrial number is significantly decreased in DDQ-treated SH-SY5Y cells, relative to untreated cells. On the contrary, mitochondrial number is significantly increased Αβ-treated SH-SY5Y cells. DDQ- pre and post-treated cells in the presence of Αβ showed reduced mitochondrial number compared to cells treated with Αβ alone. Mitochondrial length was measured for all groups of cells. Mitochondrial length was significantly reduced Αβ-treated SH-SY5Y cells. DDQ-pre and post-treated cells in the presence of Αβ showed increased mitochondrial length compared to cells treated with Αβ alone.
FIG. 1 1 shows mitochondrial function. Mitochondrial functional parameters in control human neuroblastoma (SHSY5Y) cells, in amyloid β (Αβ) incubated SHSY5Y cells, in SHSY5Y cells treated with DDQ and in SHSY5Y cells incubated with Αβ and then treated with DDQ and in SHSY5Y cells treated with DDQ and then incubated with Αβ (n=4). The inventors' analyzed mitochondrial functional
data in two ways: (1) the control SHSY5Y cells were compared with the SHSY5Y cells treated with Αβ, DDQ, Αβ+DDQ and DDQ+Αβ and (2) Αβ incubated SHSY5Y cells were compared with Αβ+DDQ SHSY5Y cells and DDQ+Αβ treated cells. The inventors performed statistical analysis using ANOVA following the Dunnett correction, for: (a) H202 production, (b) lipid peroxidation, (c) cytochrome oxidase activity, (d) ATP levels, and (e) GTPase-Drpl activity.
FIG. 12 shows cell viability analysis. Cell viability of human neuroblastoma (SHSY5Y) cells, while treated with DDQ, Αβ, Αβ+DDQ and DDQ+Αβ relative to untreated cells. Cell viability of pre-treated DDQ and post-treated DDQ in Αβ incubated SHSY5Y cells relative to Αβ treated cells.
DETAILED DESCRIPTION OF THE INVENTION
While the making and using of various embodiments of the present invention are discussed in detail below, it should be appreciated that the present invention provides many applicable inventive concepts that can be embodied in a wide variety of specific contexts. The specific embodiments discussed herein are merely illustrative of specific ways to make and use the invention and do not delimit the scope of the invention.
To facilitate the understanding of this invention, a number of terms are defined below. Terms defined herein have meanings as commonly understood by a person of ordinary skill in the areas relevant to the present invention. Terms such as "a", "an" and "the" are not intended to refer to only a singular entity, but include the general class of which a specific example may be used for illustration. The terminology herein is used to describe specific embodiments of the invention, but their usage does not delimit the invention, except as outlined in the claims.
An arising characteristic of neurodegenerative disease is the improper regulation of proteins responsible for mitochondrial fusion, fission, localization, membrane transport, and more in neurons. Recent research by the inventors has revealed the critical role of various enzymes specifically as mitochondrial regulators, including amyloid-β (Αβ), dynamin-related protein 1 (Drpl), phosphorylated tau (p-tau), and voltage- dependent anion channel protein 1 (VDAC1). The inventors have shown that interactions between combinations of these enzymes contribute to mitochondrial dysfunction and bioenergetic compromise that may cause neurodegeneration.
The present invention includes methods for identifying molecules that can delay aging process and prevent and/or stop neurodegeneration and novel compositions that delay aging and protect cells from oxidative insults, and method of using the same. It was found that the molecules identified were able to: (1) delay aging, (2) protect human cells from oxidative insults, (3) reduce the toxicity of mutant proteins, (4) inhibit abnormal protein interactions in the brain cells and (5) enhance cell survival. To date, no drugs have been developed to prevent and/or reduce abnormal protein interactions in Alzheimer's, Huntington's,
and Parkinson's. The newly developed molecules inhibit these abnormal interactions and enhance cell survival and delay aging process.
Neurons are the building blocks of the nervous system, which includes the brain and spinal cord. Neurons normally don't reproduce or replace themselves, so when they become damaged or die they cannot be replaced by the body. Examples of neurodegenerative diseases are Alzheimer's, Huntington's disease, Parkinson's and amyotrophic lateral sclerosis (ALS). Various factors such as pathogenic mutations, genetic modifiers, abnormal interactions between disease causing proteins such amyloid beta or Αβ (in Alzheimer's), mutant huntingtin (in Huntington's), mutant SOD1 (in ALS) and parkin, DJ1 (in Parkinson's) and other diet and metabolism. In addition, aging is a major risk factor for neurodegenerative diseases.
Especially, in brain cells strong evidence indicates the amyloid beta precursor protein (APP), is the source of Αβ, the central player in the pathophysiology of the disease. This released Αβ induces synaptic dysfunction, mitochondrial oxidative damage, resulting in abnormal activation of redox-mediated events as well as elevation of cytoplasmic Ca2+, ultimately causing neuronal damage in AD. Recent evidence from our lab suggests mutant AD proteins Αβ and phosphorylated tau interacts mitochondrial fission protein, dynamin-related protein 1 (Drpl), induces mitochondrial fragmentation, mitochondrial dysfunction and synaptic damage in AD neurons. These abnormal interactions are age, mutant protein and disease progression dependent, indicating that age aging and abnormal protein interactions play a key role in AD development and pathogenesis. More recently, the present inventors found that mutant AD proteins Αβ and phosphorylated interacts with mitochondrial outer-membrane protein, voltage -dependent anion channel protein 1 (VDAC1), blocks mitochondrial permeability transition pores and causes gating of mitochondrial pore activities, ultimately leading to impairments in oxidative phosphorylation and low ATP production in AD neurons9. These abnormal protein-protein interactions lead to mitochondrial dysfunction, bioenergetics compromise and consequent synaptic dysfunction and loss and neuronal dysfunction in AD.
In AD, Αβ-induced synaptic dysfunction is a complicated process involving multiple pathways, components, and biological events, such as oxidative stress, kinase activation, and protein interactions. These complexities lead to the formation and accumulation of Αβ and phosphorylated tau, mitochondrial dysfunction, and ultimately neuronal death. Despite the numbers of clinical trials conducted to identify drug targets (i.e., molecules) that may reduce mutant protein toxicity in AD, such molecules remain unidentified. Recent research established that synaptic damage and mitochondrial dysfunction are early events in AD pathogenesis. Mitochondrial dysfunction is mainly due to the abnormal interaction of Drpl with Αβ, and with phosphorylated tau. Development of drugs capable of targeting underlying mechanisms of disease pathogenesis is needed in order to slow AD progression. The major focus of the
proposed research effort is to develop a drug that can target the toxicity in involved in these interactions in order to prevent mitochondrial dysfunction and synaptic damage in AD progression.
Αβ, mitochondrial dysfunction, and AD: Extracellular canonical localization of Αβ has been identified in different subcellular compartments, including the endoplasmic reticulum; the Golgi apparatus (or the trans-Golgi network); early, late, and recycling endosomes; and the lysosome, where the Αβ are generated. In studies of postmortem brains from both AD patients and mouse models of AD, Αβ has also been found in mitochondria, and research from different independent research groups has clearly established that Αβ progressively accumulates in the mitochondria. Αβ has been found to induce mitochondrial dysfunction via different mechanisms. Αβ is taken up by mitochondria via the translocase of the outer membrane (TOM) complex and is imported into the inner membrane; Αβ alters the enzyme activity of the respiratory chain complexes I, and IV; Αβ affects mitochondrial dynamics by an impaired balance of fission and fusion; Αβ impairs mitochondrial permeability transition pore gating via the interaction of Αβ with VDAC1 ; Αβ induces decreased mitochondrial respiration; Αβ affects new mitochondrial biogenesis; and Αβ increases reactive oxygen species (ROS) generation.
Recent studies have shown that Drp l, which maintains and remodels mammalian mitochondria, interacts with Αβ and phosphorylates tau, leading to excessive mitochondrial fragmentation, impaired axonal transport of mitochondria, and ultimately, neuronal damage and cognitive decline.
Drp l structure and function: Based on published studies and NCBI databases, the human Drp l has been found to have several splice variants: variant 1 consists of 736 amino acids; in variant 2, exon 15 is spliced out; in variant 3, exons 15 and 16 are spliced out and have a total of 699 amino acids; variant 4 has 725 amino acids; variant 5, 710 amino acids; and variant 6, 749 amino acids. Drp l contains a highly conserved GTPase and is involved in various cellular functions. Similar to the human Drp l, the mouse Drp l has been found in multiple variants: variant 1 consists of 712 amino acids; in variant 2, exon 3 is spliced out; and in variant 3, exons 15 and 16 are spliced out. Recent research findings suggest that Drp l is involved in mitochondrial division, mitochondrial distribution, peroxisomal fragmentation, phosphorylation, SUMOlyation, and ubiquitination.
Drp l expression and mitochondrial dysfunction: Studies of Drp l in mammalian cells suggest that normal expression of Drp l is critical for normal mitochondrial dynamics and normal mitochondrial distribution and dendritic morphology in neurons. In AD and other neurodegenerative diseases, Drp 1 levels are altered via the interaction of Drp l with Αβ, leading to abnormal mitochondrial dynamics (increased fission and reduced fusion), in some cases with perinuclear clusters of mitochondria and disruption of inter-mitochondrial connectivity.
Drp l associated with Αβ: The present inventors have shown that mutant AD proteins, Αβ, and phosphorylated tau interact with Drp l, which induces mitochondrial fragmentation, mitochondrial
dysfunction, and synaptic damage in neurons. These abnormal interactions are believed to be age- and disease-progression dependent, indicating that the interaction between aging and disease progression may play key roles in AD pathogenesis and development. Increasing evidence suggests that in AD, the accumulation of Αβ in synapses and synaptic mitochondria causes synaptic mitochondrial failure and synaptic degeneration.
Currently, there are no selective drug targets capable of preventing the abnormal interactions between Αβ and Drp l, and of delaying the age-dependent AD process (not only the AD process, but also other the processes of other neurological diseases, such as Huntington's, Parkinson's, and ALS). The present inventors have conducted studies, the goal of which is to develop drug molecules or molecular inhibitors capable of inhibiting or reducing abnormal interactions between Αβ and Drp 1 and of protecting neurons from multiple injuries caused by Αβ and Drp l interactions and Αβ- and Drp l -induced mitochondrial and synaptic toxicities. In these studies, the inventors identified four molecules that have demonstrated their capability to: ( 1) delay aging in neurons, (2) protect neurons from oxidative insults, (3) inhibit abnormal protein-protein interactions and protect neurons from mutant protein(s)-induced toxicities, and (4) enhance cell survival.
Very few molecules have been developed to prevent AD, but those that are the most promising are insoluble in water, rendering them problematic treatments due to water insolubility. As such, the present inventors developed water-soluble molecules that can reduce amyloid beta (Αβ) and Drp 1 levels, and that can reduce/prevent abnormal interactions between Αβ and Drp l in Alzheimer's disease (AD) affected neurons. The present invention targets: (1) increased production and accumulation of Αβ and increased expression of Drp l, and (2) abnormal interaction between Αβ and Drp l induce synaptic dysfunction and mitochondrial damage, resulting dysfunction of neurons affected by AD. The therapeutic compositions and methods disclosed herein involve treating AD-affected neurons with such molecules in order to reduce Αβ and Drp 1 levels, and to inhibit the interaction of Αβ and Drp 1.
To achieve this objective, the inventors conducted molecular docking studies and designed 82 scaffold structures. These structures were screened for existing molecules, using molecular docking software (MOE). The inventors developed the following criteria for selecting these 82 structures for further research as inhibitors of AD progression: 1) showed optimum binding energy values and 2) were capable of identifying and dissociating the binding sites of the abnormal interactions between Αβ and Drp 1. To begin, the inventors selected the best molecules of the 82, which exhibited the best optimum binding energy values and binding capabilities for these proposed in vitro and in vivo studies.
The following scaffold structures were designed to: ( 1) delay aging and (2) inhibit abnormal protein interactions. These designed structures screened for in silico studies using molecular docking software. Further, the inventors selected molecules that showed (1) optimum binding energy values and (2) identify
and dissociate the binding sites of abnormal protein interactions - Αβ and Drpl, and phosphorylated tau and Drpl; Αβ and VDAC1 and phosphorylated tau and VDAC1 in AD neurons. A: Phosphonium cation based structures; B: Quinoline based alpha aminophosphonates; C: Napthaline based alpha aminophosphonates and D: Hexahydropyramidine carboxylates structures.
R- Aikyl/ «ryi R- Aikyl/ aryi R- Aikyl at l IV- Alkvi arvl
R*-Alkvl
A B C D
Molecular Docking results. The inventors prepared a protein complex of Αβ and Drpl by retrieving the crystal structures of Αβ (PDB ID: lba4) and dynamin-l-like protein (PDB ID: 4hlu) from a protein data bank. In Αβ and Drpl complex, Ser8, Leu34, Glyl20, Gly25 of Αβ are interacting with ASN98, ILU22, ASN12, Glu22 of Drpl respectively; the inventors predicted these sites as active interacting sites of Αβ and Drpl complex. Designed molecular structures were introduced into Αβ and Drpl complex in order to identify the interactions of ligands in the complex and identify their inhibitory properties against Αβ-Drp 1 interaction. Few molecules showed good binding score against this complex. Particularly, DDQ only interacted at specific interacting sites in the Αβ-Drpl complex and exhibited the best docking capability and received the best docking score than all other molecules. Correspondingly, DDQ is obstructing these Αβ and Drpl bindings by direct interactions at active sites such as ser8 and Leu34 of Αβ and ASN16 Glul6 of Drpl . DDQ is readily bound with Drpl independently before forming a complex. Therefore, the inventors selected DDQ as a selective target to treat against AD neuronal cells. The inventors synthesized DDQ by following protocol. Table 1 is a summary of molecular docking of the Drpl compounds.
Table 1. Molecular docking of the Drpl compounds.
MitoQ (Phosphonium, [10-(4,5- dimethoxy-2-methyl-3,6-dioxo-l,4-cyclohexadien- l-yl)decyl]triphenyl-, methanesulfonate), in the non- limiting form of a mesylate.
Dynasore (3-Hydroxy-naphthalene-2-carboxylic acid (3,4-dihydroxy-benzylidene)-hydrazide) in the non- limiting form of a hydrate:
Mdivi-1 (3-(2,4-Dichloro-5-methoxyphenyl)-2,3-dihydro-2-thioxo-4(lH)-quinazolinone, 3-(2,4-Dichloro- 5-methox henyl)-2-sulfanyl-4(3H)-quinazolinone):
Each of the compounds can be formulated with one or more pharmaceutically acceptable salts, and if applicable, hydrates, solvates, tautomeric forms, stereoisomers, and prodrugs of the compounds described herein.
As used herein, the terms "pharmaceutically acceptable" or "physiologically acceptable" refer to compounds, salts, compositions, dosage forms and other materials which are useful in preparing a pharmaceutical composition that is suitable for veterinary or human pharmaceutical use.
As used herein, the term "pharmaceutically acceptable salt" of a given compound refers to salts that retain the biological effectiveness and properties of the given compound, and which are not biologically or otherwise undesirable.
As used herein, the terms "pharmaceutically acceptable salts" or "physiologically acceptable salts" refer to salts with inorganic acids and salts with an organic acid. In addition, if the compounds described herein
are obtained as an acid addition salt, the free base can be obtained by basifying a solution of the acid salt. Conversely, if the product is a free base, an addition salt, particularly a pharmaceutically acceptable addition salt, may be produced by dissolving the free base in a suitable organic solvent and treating the solution with an acid, in accordance with conventional procedures for preparing acid addition salts from base compounds. Those skilled in the art will recognize various synthetic methodologies that may be used to prepare nontoxic pharmaceutically acceptable addition salts. Pharmaceutically acceptable acid addition salts may be prepared from inorganic and organic acids. Salts derived from inorganic acids include hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like. Salts derived from organic acids include acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, malic acid, malonic acid, succinic acid, maleic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethane sulfonic acid, p-toluene-sulfonic acid, salicylic acid, and the like. Likewise, pharmaceutically acceptable base addition salts can be prepared from inorganic and organic bases. Salts derived from inorganic bases include, by way of example only, sodium, potassium, lithium, ammonium, calcium and magnesium salts. Salts derived from organic bases include, but are not limited to, salts of primary, secondary and tertiary amines, such as alkyl amines (i.e., NH2(alkyl)), dialkyl amines (i.e., HN(alkyl)2), trialkyl amines (i.e., N(alkyl)3), substituted alkyl amines (i.e., NH2 (substituted alkyl)), di(substituted alkyl) amines (i.e., HN(substituted alkyl)2), tri(substituted alkyl) amines (i.e., N(substituted alkyl)3), alkenyl amines (i.e., NH2(alkenyl)), dialkenyl amines (i.e., HN(alkenyl)2), dialkenyl amines (i.e., N(alkenyl)3), substituted alkenyl amines (i.e., NH2 (substituted alkenyl)), di(substituted alkenyl) amines (i.e., HN(substituted alkenyl)2), tri(substituted alkenyl) amines (i.e., N(substituted alkenyl)3, mono-, di- or tri-cycloalkyl amines (i.e., NH2 (cycloalkyl), HN(cycloalkyl)2, N(cycloalkyl)3), mono-, di- or tri-arylamines (i.e., NH2 (aryl), HN(aryl)2, N(aryl)3), or mixed amines, etc. Specific examples of suitable amines include, by way of example only, isopropylamine, trimethyl amine, diethyl amine, tri(iso-propyl) amine, tri(n-propyl) amine, ethanolamine, 2-dimethylaminoethanol, piperazine, piperidine, morpholine, N-ethylpiperidine, and the like. The term "hydrate" refers to the complex formed by the combining of a compound and water.
As used herein, the term "solvate" refers to an association or complex of one or more solvent molecules and a compound of the invention. Examples of solvents that form solvates include, but are not limited to, water, isopropanol, ethanol, methanol, dimethylsulfoxide, ethylacetate, acetic acid, and ethanolamine. As used herein, the terms "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" or "excipient" refer to any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media
or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.
The compounds described herein, diethyl(3,4-dihydroxyphenethylamine)(quinolin-4- yl)methylphosphonate (DDQ) ; phosphonium, [ 10-(4,5 -dimethoxy-2-methyl-3 ,6-dioxo- 1 ,4-cyclohexadien- l-yl)decyl]triphenyl-, methanesulfonate) (MitoQ); (3-Hydroxy-naphthalene-2-carboxylic acid (3,4- dihydroxy-benzylidene)-hydrazide (Dynasore); and/or (3-(2,4-Dichloro-5-methoxyphenyl)-2,3-dihydro-2- thioxo-4(lH)-quinazolinone, 3-(2,4-Dichloro-5-methoxyphenyl)-2-sulfanyl-4(3H)-quinazolinone) (Mdiv- 1), may be modified as will be known by the skilled artisan to target those regions of the molecules shown as clouds in FIG. 1A, for example, any of these regions may be modified or substituted with one or more of the following: alkyl, alkenyl, alkynyl, alkylene, alkoxy, haloalkyl, haloalkoxy, cycloalkyl, aryl, heterocyclyl, heteroaryl, and/or heteroalkyl) wherein at least one hydrogen atom is replaced by a bond to a non-hydrogen atom such as, but not limited to alkyl, alkenyl, alkynyl, alkoxy, alkylthio, acyl, amido, amino, amidino, aryl, aralkyl, azido, carbamoyl, carboxyl, carboxyl ester, cyano, cycloalkyl, cycloalkylalkyl, guanadino, halo, halogen, haloalkyl, haloalkoxy, hydroxyalkyl, heteroalkyl, heteroaryl, heteroarylalkyl, heterocyclyl, heterocyclylalkyl, hydrazine, hydrazone, imino, imido, hydroxy, oxo, oxime, nitro, sulfonyl, sulfinyl, alkylsulfonyl, alkylsulfinyl, thiocyanate, sulfinic acid, sulfonic acid, sulfonamido, thiol, thioxo, N-oxide, hydrogen, alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, aryl, heteroaryl or heterocyclyl
Synthesis of diethyl (3,4-dihydroxyphenethylamino)(quinolin-4-yl)methylphosphonate. Synthesis of diethyl (3,4-dihydroxyphenethylamino)(quinolin-4-yl)methylphosphonate (DDQ). To synthesize DDQ, the inventors followed two steps pudovik reaction. In the first step 4-(2-(quinolin-4- ylmethyleneamino)ethyl)benzene-l,2-diol was prepared by stirring 4-(2-aminoethyl)benzene- l,2-diol with quinoline-4-carbaldehyde at reflection temp 80 °C of THF. The inventors isolated the intermediates and 4-(2-(quinolin-4-ylmethyleneamino)ethyl)benzene-l,2-diol is selected for the second step reaction. In the second step, Dethylphosphite (DEP) was added to the solution of (Z)-4-(2-(quinolin-4- ylmethyleneamino)ethyl)benzene- l,2-diolin in drop-wise fashion, at room temperature in the presence of the S1O2 OSO3H catalyst. The reaction mixture was stirred continuously for 4 hours at 65 °C. The reaction between DEP and Z)-4-(2-(quinolin-4-ylmethyleneamino)ethyl)benzene- l,2-diol was monitored by thin-layer chromatography, using silica gel as the adsorbent and a mixture of ethyl acetate and hexane (1 :2) as the eluent. After the reaction was complete, the mixture was quenched with water, and four samples of ethyl acetate (each at 10 mL) were then extracted. The samples were concentrated, using reduced pressure. The resulting mixture was purified by column chromatography, using a 100-200 mesh silica gel as the adsorbent and a mixture of ethyl acetate and hexane (1 :4) as the eluent, to derive the pure DDQ.
Spectral data for diethyl (3,4-dihydroxyphenethylamino)(quinolin-4-yl)methylphosphonate (DDQ). Yield: 82%; IR (KBr): 3509 and 3472 (20H), 3309 (N-H), 1270 (P = O), 1019 (P-C Ar ) cm"1 ; lH NMR (400 MHz, DMSO-d6): δ 1.18 (CH3, 6H), 2.61-2.92 ((Ar-CH2 and CH2-NH, 4H), 3.13 (NH, 1H), 4.12 (CH2-CH3, 4H), 4.82 (P-CH, 1H), 6.68-8.55 (9 ArH), 9.38 and 9.45 (Ar-OH, 2); 31P NMR (161.9 MHz, DMSO-d6): δ 8.935;[ref.46] LC MS (%): m/z 431.7 (19%) [ΜΗ+'], 430.9 (89%) [M+-], 236.0 (100%) [ref. 47-48].
Based on the molecular docking results, synthesized DDQ is forwarded to screen its reducing effect of Αβ and Drpl levels and to determine its inhibiting capacity against Αβ and Drpl complex formation. So that, the inventors treated DDQ in human neuroblastoma (SHSY5Y) cells as shown in FIG. 3. These treated cells were used to quantify the effect of DDQ on gene expression and protein levels of synaptic, AD- related, and mitochondrial-related genes. The inventors determined the Αβ and Drpl interaction inhibitory property of DDQ and also quantified the number of mitochondria in the treated cells.
mRNA levels of mitochondrial dynamics, mitochondrial biogenesis and synaptic genes. Using the reagent TriZol (Invitrogen), the inventors isolated total RNA from all DDQ-treated and untreated cells. mRNA levels of mitochondrial dynamic (Drpl, Fisl, Mfnl and Mfh2), mitochondrial biogenesis genes (PGCla, Nrfl, Nrf2 and TFAM) and synaptic genes (PSD95, synaptophysin, synapsin 1, synapsin 2, synaptobrevin 1, synaptobrevin 2, synaptopodin, and GAP43) were measured by using Sybr-Green chemistry-based quantitative real time RT-PCR.
As shown in Table 2, in Αβ treated cells Drpl and in Fisl (mitochondrial fission genes) expression levels were significantly increased by 2.2 fold (P=0.004), and 1.7 fold (P=0.003) respectively, compared to untreated cells. In contrast, mRNA expression levels of mitochondrial fusion genes were significantly decreased (Mfnl by 2.3 fold (P=0.005) and Mfn2 by 2.6 fold (P=0.001)) in Αβ treated cells relative to untreated cells. This indicating the presence of abnormal mitochondrial dynamics in cells treated with Αβ. Drpl (2.2 fold decrease, P=0.01 in DDQ treated cells) and Fisl (4.4 fold decrease, P=0.001) mRNA levels were significantly decreased and fusion genes, Mfnl (1.7 fold P=0.02) and Mfh2 (2.3 fold P=0.002) mRNA levels are increased in DDQ treated cells relative to untreated cells. mRNA changes were significantly reduced for fission genes Drpl and Fisl, and increased for fusion genes Mfnl and Mfh2 in cells incubated with Αβ and then treated with DDQ relative to untreated cells. Similarly, cells pretreated with DDQ and incubated with Αβ relative to untreated cells, mRNA levels were unchanged for fission genes Drpl and Fisl, and fusion genes Mfnl and Mfn2.
Table 2. mRNA fold changes of mitochondrial structural, mitochondrial biogenesis and synaptic genes in Human Neuroblastoma (SHSY5Y) cells treated with DDQ, Αβ, Αβ+DDQ and DDQ+Αβ relative to the
untreated SHSY5Y cells and cells treated with Αβ+DDQ and DDQ+Αβ relative to the Αβ-treated SHSY5Y cells.
Mitochondrial biogenesis genes (PGCla, Nrfl, Nrf2 and TFAM) expressions were significantly decreased in Αβ effected neuronal cells and healthy increase in DDQ treated cells relative to untreated cells. Biogenesis genes mRNA expression of Αβ effected neuronal cells was decreased as PGCla by 4.4 fold (P=0.001), Nrfl by 4.1 fold (P=0.004), Nrf2 by 2.8 fold (P=0.01) and TFAM by 4.6 fold (P=0.002)) relative to untreated cells. Biogenesis genes mRNA levels in DDQ treated cells relative were significantly increased as PGCla (1.5 fold decrease, P=0.02), Nrfl by 1.9 fold (P=0.01), Nrf2 by 2.7 fold (P=0.01) and TFAM by 1.7 fold (P=0.02) relative to untreated cells (Table 2). These observations indicate that DDQ increases mitochondrial biogenesis activity. Mitochondrial biogenesis genes PGCla (2.5 fold P=0.01), Nrfl (2.6 fold P=0.003), Nrf2 (2.1 fold P=0.03) and TFAM (2.3 fold P=0.01) levels were significantly increased in cells incubated with Αβ followed by treated with DDQ relative to Αβ treated cells. DDQ pretreated followed by Αβ incubated cells exhibited increased of mRNA levels for biogenesis genes
(PGCla (3.9 fold P= 0.002), Nrfl (4.9 fold P= 0.0003), Nrf2 (2.6 P= 0.01) and TFAM (3.2 P= 0.002)) relative to Αβ treated cells. These results suggest that DDQ pretreatment prevented Αβ induced biogenesis toxicity.
In cells treated with Αβ compared with untreated cells, mRNA expression levels were decreased for synaptophysin by 3.7 fold (P=0.0002), PSD95 by 2.5 fold (P=0.004), synapsinl by 1.9 (P=0.02), synapsin2 by 1.4 (P=0.04), synaptobrevinl by 2.4 (P=0.003), synaptobrevin2 by 2.3 (P=0.01), synaptopodin by 2.3 (P=0.001) and GAP43 by 1.9 (P=0.001) indicating that Αβ reduces synaptic activity. mRNA levels were significantly increased for synaptophysin by 1.4 fold (P=0.04), PSD95 by 1.4 (P=0.03), Synapsin2 by 1.7 (P=0.01), synaptobrevin2 by 1.3, and GAP43 by 1.2 fold in DDQ treated cells relative to untreated cells. These observations indicate that DDQ boosts synaptic activity in healthy cells. In cells incubated with Αβ and then treated with DDQ relative to untreated cells, mRNA levels were increased. These observations indicate that DDQ rescued synaptic activity from Αβ induced toxicity. In cells pretreated with DDQ and incubated with Αβ relative to Αβ cells, mRNA levels were increased for synaptic mitochondrial biogenesis and mitochondrial fusion genes, indicating that DDQ enhances synaptic and mitochondrial fusion activities.
In cells incubated with Αβ and then treated with DDQ and pretreated with DDQ and incubated with Αβ relative to Αβ treated cells, the fold change of mitochondrial fission genes (Drpl and Fisl) were down- regulated and mitochondrial fusion genes (Mf l and Mfh2) were significantly upregulated. Similarly, synaptic gene expression levels were upregulated in cells incubated with Αβ and then treated with DDQ and pretreated with DDQ and incubated with Αβ relative to Αβ treated cells. This indicating that DDQ is protecting synaptic genes from Αβ.
Immunoblotting analysis. To determine the effects of Αβ on mitochondrial proteins and the useful effects of DDQ at the protein level, the inventors quantified mitochondrial proteins in five independent treatments of cells with Αβ, DDQ, Αβ+DDQ and DDQ+Αβ.
Comparison with untreated cells. In SHSY5Y cells treated with Αβ compared with untreated SHSY5Y cells, significantly increased proteins levels were found for Drpl (P=0.01) and Fisl (P=0.01) (Figure 4A, C). In contrast, decreased levels of mitochondrial fusion proteins, Mfhl (P=0.002) and Mfh2 (P=0.004) were found in cells incubated with Αβ compared with untreated cells. Synaptophysin (P=0.001) and PSD95 (P=0.01) levels were significantly reduced in Αβ incubated cells relative to untreated cells (Figure 4A, C).
Mitochondrial fission proteins, Drpl (P=0.03) and Fisl were significantly reduced and fusion protein Mfn2 P=0.004 was significantly increased in DDQ treated cells relative to untreated cells (Figure 4A, C).
Mitochondrial biogenesis protein levels were significantly increased in DDQ treated cells relative to untreated cells (Figure 4B, D).
Mitochondrial biogenesis proteins PGCla (P=0.01), Nrfl (P=0.001), Nrf2 (P=0.01) and TFAM (P=0.01) levels were decreased in Αβ incubated cells relative to untreated cells. Interestingly, significant increase of mitochondrial biogenesis protein levels was observed in DDQ treated cells relative to untreated cells (Figure 4B and D).
Mitochondrial fission proteins Drpl (P=0.01) and Fisl (P=0.02) were reduced and fusion protein Mfnl (P=0.04) was significantly increased in Αβ+DDQ treated cells relative to untreated cells (Figure 4A, C). Synaptic proteins, synaptophysin (P=0.01) and PSD95 (P=0.04) levels significantly increased in Αβ+DDQ treated cells relative to untreated cells. Decreased levels of Drpl (P=0.004) were found in DDQ+Αβ treated cells relative to untreated cells (Figure 4A, C). Overall, these findings suggest that DDQ reduces fission activity and enhances fusion activity in the presence of Αβ.
Comparison with Αβ treated cells. As shown in Figure 4 (A, B), significantly reduced levels of fission protein, Drpl were found in cells treated with Αβ+DDQ (Drpl, P=0.01) and DDQ+Αβ (Drpl, P=0.001; Fisl, P=0.04) relative to Αβ treated cells. In contrast, fusion proteins were increased in Αβ+DDQ (Mfnl, P=0.01; Mfn2, P=0.01) and DDQ+Αβ (Mfnl, P=0.02; Mfn2, P=0.01) treated cells relative to Αβ treated cells.
In Αβ+DDQ cells exhibited increased mitochondrial biogenesis protein levels (Nrfl (P=0.04), Nrf2 (P=0.01) and TFAM (P=0.01) relative to Αβ treated cells. Similarly, DDQ pre-treated (DDQ+Αβ) cells showed significantly increased levels of mitochondrial biogenesis proteins (Nrfl (P=0.01), Nrf2 (P=0.01) and TFAM (P=0.004) relative to Αβ treated cells (Figure 4B, D).
Synaptic proteins were increased in Αβ+DDQ (synaptophysin, P=0.01; PSD95, P=0.03) and DDQ+Αβ (synaptophysin, P=0.04; PSD95, P=0.001) treated cells relative to Αβ treated cells (Figure 4A, C), indicating that DDQ enhances synaptic activity in the presence of Αβ in cells.
DDQ reduces Αβ and Drpl levels. To determine whether DDQ reduces Αβ and Drpl levels, the inventors conducted immunoblotting analysis, in cells treated with DDQ, Αβ+DDQ and DDQ+Αβ. As shown in Figure 5A, the inventors found reduced levels of 4 kDa Αβ in cells treated Αβ+DDQ and DDQ+Αβ relative to cells treated with Αβ alone. The inventors also found reduced levels of Drpl in cells treated DDQ, Αβ+DDQ and DDQ+Αβ relative to untreated and Αβ treated cells (Figure 4A).
Co-immunoprecipitation and immunoblotting analysis using DDQ treated SHSY5Y cells+Αβ. To determine whether DDQ reduces the interaction of Αβ with Drpl in Αβ incubated cells, the inventors performed co-immunoprecipitation analysis using the Drp 1 antibody, and immunoblotting analysis using
Αβ recognizing 6E10 antibody and protein lysates of DDQ pre-treated, DDQ post-treated and Αβ incubated cells. As shown in Figure 5B, the inventors found reduced interaction between Αβ and Drpl in DDQ pre-treated, DDQ post-treated relative to Αβ incubated cells. Reduced interaction was strong in DDQ pre-treated than DDQ post-treated cells, indicating that prevention is better than treatment.
Co-immunoprecipitation and immunoblotting analysis of mutant APPSwe/ind cells treated with DDQ. To determine whether DDQ reduces the interaction of Αβ with Drp 1 in mutant APPSwe/ind cells, the inventors used mutant APPSwe/ind cDNA construct transfected into mouse neuroblastoma (N2a) cells and further cells were treated with DDQ. The inventors performed immunoprecipitation with Αβ (6E10) antibody and immunoblotting analysis with 6E10 and the inventors also performed co-immunoprecipitation analysis with Αβ (6E10) antibody and immunoblotting analysis with Drp l antibody. As shown in Figure 6, the inventors found reduced levels of full-length APP and 4 kDa Αβ in lane 2 of mutant APPSwe/ind cells treated with DDQ compared to lane 1 of mutant APPSwe/ind cells untreated with DDQ. The inventors also found reduced levels of Drp 1 in lane 4 of mutant APPSwe Ind cells treated with DDQ compared to lane 3 of mutant APPSwe Ind cells untreated with DDQ. These findings further confirm that DDQ reduces full-length APP and 4 kDa Αβ and reduces interaction between Drp l and Αβ.
Immunofluorescence analysis of Drp l, synaptophysin and PSD95. To determine the effect of Αβ and DDQ on Drp l, synaptophysin and PSD95 levels and localizations, immunofluorescence analysis was performed in cells treated as shown in FIG. 7.
As shown in Figure 7A and B, the inventors found significantly increased Drp l (P=0.003) levels in Αβ treated cells relative to untreated cells, indicating that Αβ enhances fission activity in cells. In contrast, decreased Drp l levels were found in DDQ treated cells relative to untreated cells, but this was not significant. The synaptic proteins synaptophysin (P=0.002) and PSD95 (P=0.001) were significantly reduced in Αβ treated cells relative to untreated cells (Figure 7A and B).
Significantly reduced levels of fission protein Drp lwere found in cells treated with Αβ+DDQ (P=0.03) and DDQ+ Αβ (P=0.004) relative to Αβ treated cells (Figure 7A and B). In contrast, synaptic proteins were increased in Αβ+DDQ (synaptophysin, P=0.04; PSD95, P=0.03) and DDQ+Αβ (synaptophysin, P=0.004; PSD95, P=0.01) treated cells relative to Αβ treated cells (Figure 7A and B), indicating that DDQ enhances synaptic activity in the presence of Αβ in cells. Overall, the immunofluorescence findings agreed with the immunoblotting results.
Double -labeling immunofluorescence analysis of Drpl and Αβ. To determine whether Drp l localizes and interacts with Αβ, the inventors conducted double -labeling analysis of Drp l and Αβ in DDQ pre-treated, post-treated and untreated, Αβ incubated cells. As shown in Figure 8, the immunoreactivity of Drp l was
colocalized with Αβ immunoreactivity (monomelic), indicating that Drpl interacts with Αβ.
Further, the inventors found reduced co-localization of Drp 1 with Αβ in DDQ pre-treated and post-treated Αβ incubated cells relative to Αβ incubated cells alone. Drpl and Αβ colocalization is markedly reduced in DDQ pre-treated cells than DDQ post-treated cells. These observations matched the immunoprecipitation findings of Drpl and 6E10. Overall, these observations suggest that DDQ reduces Drpl and Αβ interactions.
DDQ reduces soluble Αβ42 in mutant APPSwe/ind cells treated with DDQ. To determine whether DDQ reduces Αβ levels, the inventors performed sandwich ELISA using protein lysates of mutant APPSwe/ind cells treated with DDQ. As shown in Figure 9, the inventors found significantly decreased levels of Αβ42 in DDQ treated mutant APPSwe/ind cells (P=0.01) relative to DDQ untreated mutant APPSwe/ind cells. On the contrary, Αβ40 levels were significantly increased in DDQ treated mutant APPSwe/ind cells (P=0.03) relative to DDQ untreated mutant APPSwe/ind cells. These observations indicate that DDQ reduces Αβ42 levels in mutant APPSwe Ind cells.
Transmission electron microscopy. To determine the effects of DDQ on mitochondrial number and morphology, and any rescual effects of DDQ on mitochondria in the untreated and Αβ treated cells, the inventors used TEM on untreated, DDQ, Αβ, Αβ+DDQ and DDQ+Αβ, treated SHSY5Y cells.
Mitochondrial number and length comparison of DDQ, Αβ, Αβ+DDQ and DDQ+Αβ treated cells with untreated cells. Mitochondrial number: As shown in Figure 10, the inventors found significantly increased number of mitochondria in Αβ treated cells relative to untreated cells (P=0.03), suggesting that Αβ treatment enhances mitochondrial number, in other words Αβ treatment enhances mitochondrial fragmentation. On the other hand, DDQ treatment reduced the number of mitochondria relative to untreated cells (P =0.003), suggesting that DDQ treatment reduces mitochondrial fragmentation. Interestingly, Αβ+DDQ and DDQ+Αβ treated cells have exhibited approximately equal number of mitochondria relative to untreated cells (Figure 10).
Mitochondrial length. The inventors also measured mitochondrial length in order to understand whether DDQ treatment alters mitochondrial length. As shown in Figure 10, the inventors found mitochondrial length is significantly increased in cells treated with DDQ relative to untreated cells. On the contrary, mitochondrial length is significantly reduced in Αβ treated cells (P=0.005) relative to untreated cells. Mitochondrial length is not significantly changed in Αβ+DDQ and DDQ+Αβ treated cells relative to untreated cells, indicating that DDQ preventing/rescuing mitochondrial length in the presence of Αβ.
Mitochondrial number and length comparison of Αβ+DDQ and DDQ+Αβ treated cells with Αβ treated cells. The number of mitochondria were significantly reduced in DDQ-pre (P=0.001) and post-treated
(P=0.02) cells relative to cells treated with Αβ alone (Figure 10). Mitochondrial length is significantly increased in DDQ-pre (P=0.02) and post-treated (P=0.02) cells relative to cells treated with Αβ alone. These findings indicate that DDQ reduces excessive mitochondrial fragmentation and increased mitochondrial length in AD neurons.
Mitochondrial functional assays. H2O2 production: As shown in FIG. 11, significantly increased levels of hydrogen peroxide (H2O2) were found in mitochondria from cells incubated with Αβ (P=0.001). In measurements taken of H2O2 from mitochondria isolated from cells treated with DDQ, significantly decreased levels of H2O2 (P=0.01) were found relative to untreated cells. These findings suggest that Αβ increases free radical production and DDQ reduces H2O2 in the presence of Αβ. Significantly increased levels were found in cells incubated with Αβ+DDQ (P=0.01) and DDQ+Αβ (P=0.03) relative to untreated cells. When the data were compared between cells incubated with Αβ and Αβ+DDQ (P=0.04) and DDQ+Αβ (P=0.002) cells, H2O2 levels were significantly reduced, indicating that DDQ reduces H2O2 levels in the presence of Αβ (Figure 11).
Lipid peroxidation: Significantly increased levels of lipid peroxidation (4-hydroxy-nonenol) were found (P=0.002) in Αβ treated relative to untreated cells (FIG. 11). However, significantly decreased levels were found in the DDQ treated cells (P=0.04) relative to untreated cells. The inventors also found significantly reduced levels of lipid peroxidation in Αβ+DDQ (P=0.04) and DDQ+Αβ (P=0.04) relative to cells incubated with Αβ alone, indicating that DDQ reduces lipid peroxidation levels in the presence of Αβ (Figure 11).
ATP production: As shown in Figure 11, significantly decreased levels of ATP were found in cells that were incubated with Αβ (P=0.01) relative to untreated cells. Significantly increased levels of ATP were found in cells treated with DDQ compared with untreated cells. Significantly increased levels were found in cells incubated with Αβ+DDQ (P=0.03) relative to untreated cells (Figure 11). Significantly increased ATP levels were found in Αβ+DDQ (P=0.04) and DDQ+Αβ treated (P=0.01) cells relative to Αβ incubated cells, indicating DDQ increases ATP levels in the presence of Αβ.
Cytochrome oxidase activity: Significantly decreased levels of cytochrome oxidase activity were found in cells that were incubated with Αβ (P=0.04) (Figure 11). However, significantly increased levels of cytochrome oxidase activity were found in DDQ treated cells relative to untreated cells. Cytochrome oxidase activity levels were unchanged in Αβ+DDQ and DDQ+Αβ cells relative to untreated cells. Similar to ATP levels, cytochrome oxidase activity levels were increased in Αβ+DDQ and DDQ+Αβ treated (P=0.03) cells relative to Αβ incubated cells (FIG. 11), indicating DDQ increases cytochrome oxidase activity levels in the presence of Αβ.
GTPase-Drp l activity: To determine whether Αβ affects GTPase-Drpl activity in cells that treated with Αβ incubation, the inventors measured GTPase-Drp l activity from Drp l IP elutes of all cell treatments. Interestingly, the inventors also found significantly increased Drp 1 enzymatic activity in Αβ treated cells (P=0.01) relative to untreated cells. The inventors found decreased levels were found in the DDQ treated cells (P=0.04) relative to untreated cells. Significantly increased Drpl enzymatic activity was observed in cells incubated with Αβ+DDQ (P=0.04) relative to untreated cells. Drp l enzymatic activity was reduced in cells treated like Αβ+DDQ (P=0.05) and DDQ+Αβ (P=0.02) relative to cells incubated with Αβ, indicating that DDQ reduces GTPase-Drpl activity in the presence of Αβ (Figure 1 1).
Cell viability. Significantly decreased levels of cell viability were found in Αβ treated cells (P=0.01) (Figure 12) relative to untreated cells. Cell viability was also significantly increased in cells treated with DDQ (P=0.01) compared with untreated cells. Cell viability levels were unchanged in cells treated with Αβ+DDQ and DDQ+Αβ relative to untreated cells. Significantly increased cell viability levels were found in cells treated with DDQ+Αβ (P=0.03) relative to Αβ incubated cells, suggesting that DDQ increases cell viability in the presence of Αβ.
The present inventors have developed a robust and reproducible method for identifying drug molecules that reduce Drp 1 and Αβ levels and also to inhibit abnormal interaction between Drp 1 and Αβ that reduce excessive mitochondrial fragmentation and maintain mitochondrial function and synaptic activity in AD neurons. The elevated levels of Αβ and increased expressions of mitochondrial fission protein Drp l, and abnormal interactions between Αβ and Drp l, have been found to induce synaptic dysfunction and mitochondrial damage, causing neuronal dysfunction in AD neurons. As the target to develop aqua- soluble drug molecule, that is capable of reducing Αβ and Drp l levels in AD neurons and also that can inhibit Αβ and Drp l interaction, the inventors have designed 82 molecular crystal structures based on existing drug molecules and screened by molecular docking studies. The inventors designed these molecules with multiple functions including anti-inflammatory, anti-antioxidant, pro-longevity, and anti- amyloid functions. For the first time, the inventors selected DDQ as a novel drug target because, it bound at Αβ and Drp l interacting sites to inhibit Αβ and Drp l complex formation and also showed better docking score than other designed molecules and existing molecules such as MitoQ, Mdivi l and SS31. Additionally, DDQ is formulated to dissolve in water. DDQ is obstructing Αβ and Drp 1 binding sites by direct interactions at active sites of Αβ (ser8 and Leu34) and Drp l (ASN16 and Glul6) (FIG. IB). DDQ is readily bound with Drp l (independently before forming a Drp l- Αβ complex), leaving less Drp l binding sites with Αβ - meaning DDQ interfere with Drp l and Αβ interactions (FIG. 1C). FIG. 2 shows a schematic of the synthetic procedure used to develop DDQ.
The inventors examined the protective effects of DDQ in healthy human neuroblastoma cells, and also in neurons incubated with Αβ42. The inventors studied preventive (DDQ+Αβ) and intervention (Αβ+DDQ) effects of DDQ against Αβ in AD neurons. The inventors measured mR A and protein levels of mitochondrial dynamics, biogenesis and synaptic genes using real time RT-PCR, immunoblotting and immunofluorescence analysis. The inventors also assessed mitochondrial function by measuring H2O2, lipid peroxidation, cytochrome oxidase activity, GTPase-Drpl activity and mitochondrial ATP. Further, the inventors studied cell viability using the MTT assay. Mitochondrial number and morphology was studied using transmission electron microscopy.
Mitochondrial fission protein levels were increased and fusion, biogenesis and synaptic proteins levels were decreased in Αβ treated neurons relative to untreated neurons, indicating the toxicity of Αβ. On the contrary, DDQ enhanced fusion activity; reduced fission machinery; and increased mitochondrial biogenesis & synaptic activities. DDQ pre- and post-treated of Αβ incubated cells showed appropriate mitochondrial dynamics and synaptic activities similar to untreated neurons. Likewise, DDQ pre- and post-treated of Αβ incubated neurons showed reduced abnormal mitochondrial dysfunction, maintained cell viability and synaptic activity, relative to Αβ treated neurons. Further, the protective effects of DDQ were stronger in pretreated neurons than in post-treated neurons, as such, DDQ works better in prevention than treatment in AD-like neurons. Mitochondrial count is significantly decreased in DDQ-treated neurons relative to untreated neurons. These findings strongly suggest that DDQ is a promising molecule to treat AD neurons.
DDQ reduces the levels of Αβ and Drpl and interaction between Αβ and Drpl . Using co- immunoprecipitation, immunoblotting and double-labeling immunofluorescence analyses, the inventors studied Drpl and Αβ and their interactions. The inventors found that Αβ interacts with Drpl in Αβ incubated cells, and this interaction is gradually reduced by pre- and post-treatment of DDQ and the reduction of Drpl and Αβ is stronger in DDQ pre-treated cells than post-treated. Further, the inventors also found reduced levels of Αβ and Drp 1 in DDQ treated AD (Αβ+DDQ and DDQ+Αβ) neurons (Figure 5).
Using co-immunoprecipitation and immunoblotting analysis and mutant APPSwe/ind cells, the inventors also studied Drpl and full-length APP and Αβ levels, and also Drpl interaction with Αβ. The inventors found reduced levels of Drpl, full-length APP and Αβ in DDQ-treated mutant APPSwe/ind cells relative to DDQ untreated APPSwe/ind cells, indicating that DDQ reduces Drpl, full-length APP and Αβ levels in mutant APPSwe Ind cells (Figure 6).
The double-labeling immunofluorescence analysis (Figure 8.) strongly agreed with the co-IP data. The previous findings state that these interaction/co localization increases as AD progresses (10). The double-
labeling immunofluorescence analysis of Αβ and Drp l in DDQ pre-treated and post-treated in the presence Αβ showed reduced Αβ and Drp l colocalization relative to neurons incubated with Αβ alone.
The reduced interaction between Αβ and Drp 1 may be due to the reduced synthesis/production of Αβ and Drp l in DDQ pre- and post-treated cells. This reduced interaction of Αβ with Drp l in DDQ pre-and post- treated cells may reduce mitochondrial fragmentation and keep mitochondria in normal count, normal length and normal function and further it may protect to neuronal cells from Αβ attack. These findings lead to the conclusion that DDQ reduced Αβ and Drp 1 levels and also prevented/recused the interaction of Αβ and Drp l ; and inhibit mitochondrial fragmentation in neurons affected by AD. The current findings of Figure 5 (SHSY5Y cells pre- and post-treated DDQ and Αβ) and Figure 6 (mutant APPSwe/ind cells treated with DDQ) strongly suggest that DDQ reduces the synthesis/production of full-length APP, Αβ and Drp 1 and these reduced levels of full-length APP, Αβ and Drp 1 are one of the possible reasons for reduced interaction between Αβ and Drp l in AD neurons.
Further, as expected DDQ is obstructing Αβ and Drp l binding sites by direct interactions at active sites of Αβ (ser8 and Leu34) and Drp l (ASN16 and Glul6) (Figure 1). DDQ is readily bound with Drp l (independently before forming a Drp l- Αβ complex), leaving less Drp l binding sites with Αβ. However, additional research is needed to determine the precise effects of DDQ's role in reducing physical interaction between Αβ and Drp 1.
DDQ reduces Αβ42 in mutant APPSwe/ind cells. To determine whether DDQ reduces Αβ42 levels, the inventors measured both Αβ42 and Αβ40 in mutant APPSwe/ind cells treated and untreated with DDQ. Interestingly, Αβ42 levels were significantly reduced and Αβ40 levels were significantly increased in DDQ-treated mutant APPSwe/ind cells (Figure 9) relative to DDQ-untreated APPSwe/ind cells. These observations are interesting and may have therapeutic value for AD. It is possible that DDQ blocks/reduces the activity of epsilon cleavage site (that is responsible for Αβ42 production) at C-terminal region of Αβ in mutant APPSwe/ind cells. Additional research is still needed in order to determine how DDQ reduces the levels of Αβ42 and increases Αβ40 levels in AD neurons.
DDQ maintains mitochondrial function and cell viability. To determine differences in mitochondrial function among DDQ-treated and untreated cells (as shown Figure 3), the inventors assessed mitochondrial function assays in all treated and untreated cells. The parameters included H2O2 production, lipid peroxidation, ATP production, GTPase Drp l enzymatic activity and cell viability. In Αβ treated cells, mitochondrial function was found to be defective and cell viability was also reduced. These observations agree with others on Αβ induced defective mitochondrial function and cell viability. Interestingly, DDQ treated cells showed enhanced mitochondrial function (Figure 1 1) and increased cell viability (Figure 12), implying that DDQ treated cells exhibited increased mitochondrial ATP,
cytochrome oxidase activity and cell viability, and reduced free radicals and oxidative stress. These observations strongly suggest that DDQ reduces cellular toxicity and boosts mitochondrial function and promotes cell longevity.
In summary, for the first time, the inventors designed and synthesized DDQ based on the best docking score and its binding interactions with Αβ and Drpl complex. In AD neurons treated with DDQ, the inventors found reduced levels of mitochondrial fission gene expressions and proteins and increased levels of mitochondrial fusion, biogenesis and synaptic gene expressions and proteins relative to neurons incubated with Αβ alone indicating that DDQ is protective against Αβ- and Drpl-induced toxicities. Hence, it is proved that DDQ have protective effects on neuronal cells and it protects against Αβ induced mitochondrial and synaptic toxicities in AD neurons. Further it is required to do more preclinical using AD mouse models and clinical studies using AD patients of DDQ to determine it's the preventive effects against Αβ induced neuronal toxicities in AD affected animal and human models.
Chemicals and Reagents: Chemicals for synthesis of DDQ were procured from Sigma- Aldrich and Merck were used as such, without further purification. All solvents used for spectroscopic and other physical studies were reagent grade and were further purified by literature methods. Infrared spectra (IR) were obtained on a Perkin-Elmer Model 281-B spectrophotometer. Samples were analyzed as potassium bromide disks. Absorptions were reported in wave numbers (cm 1). ¾ and 31P NMR spectra were recorded as solutions in DMSO-de on a Bruker AMX 400 MHz spectrometer operating at 400 MHz for ¾ and 161.9 MHz for 31P NMR. The ¾ chemical shifts were expressed in parts per million (ppm) with reference to tetramethylsilane (TMS) and 31P chemical shifts to 85% H3PO4. LCMS mass spectra were recorded on a Jeol SX 102 DA/600 Mass spectrometer. Αβ 1-42 peptide was purchased from Anaspec, Fremont, CA, USA. Dulbecco's Modified Eagle Medium/F- 12 (DMEM/F12), penicillin/streptomycin, Trypsin-EDTA and fetal bovine serum were purchased from GIBCO (Gaithersberg, MD). SHSY5Y cells. SHSY5Y cells were purchased from American Tissue Type Collection (ATCC), Virginia, USA.
Molecular docking. Molecular docking simulations were generated and prepared, using MOE software. The crystal structures of Αβ (PDB ID: lba4) and dynamin-l-like protein (PDB ID: 4hlu) were retrieved from the Protein Data Bank. PDB structure of Drpl was loaded into the MOE working environment, ignoring all heteroatoms and water molecules. When receptor was loaded into MOE molecular modeling software, the heteroatoms and water molecules were removed, and polar hydrogens were added to relieve any close contact between the X and Y-axis. Protonation of the 3D structure was carried out for all of the atoms, in the implicit solvated environment at 300 K that had a pH of 7 and a salt concentration of 0.1. Electrostatic potential was applied to a cut-off value of 1.5 A at a dielectric value of 1. A non-bonded cut-
off value of 8 A was applied to the Leonard-Jones terms. After protonation, the completed structure was energy-minimized, using the MMFF94x force field at a gradient cut off value of 0.05. Molecular dynamic simulations were carried out at a constant temperature of 300 K for a heat time of 10 picoseconds. All simulations were carried out, over a total of 2000 picoseconds. The time step was considered 0.001, and the temperature relaxation time was set to 0.2 picoseconds. The position, velocity, and acceleration were determined and the data collected and saved every 0.5 picoseconds.
PDB structure of Αβ was constructed in the MOE working environment and subjected to energy minimization. MMFF94x force fields were included, and the related potential energy terms were enabled for all bonded interactions, Van der Waals interactions, and electrostatic interactions and restraints. The non-bonded cut-off value was enabled between 8- 10 A. A generalized born implicit salvation model was enabled, all parameters were fixed, the gradient was set to 0.05, and the partial charges of the force field were enabled in order to run calculations during the minimization process. Dynamic simulations were carried out, using the Nose-Poincare-Anderson equational algorithm. Consequently, the inventors formed Αβ and Drp l complex, which further used as receptor to find the binding interactions designed molecules.
The 3D structures of all designed structures were constructed in the MOE working environment and subjected to energy minimization. MMFF94x force fields were included, and the related potential energy terms were enabled for all bonded interactions, Van der Waals interactions, and electrostatic interactions and restraints. The non-bonded cut-off value was enabled between 8-10 A. A generalized Born implicit salvation model was enabled, all parameters were fixed, the gradient was set to 0.05, and the partial charges of the force field were enabled in order to run calculations during the minimization process. Dynamic simulations were carried out, using the Nose-Poincare-Anderson equational algorithm. The temperature for the proteins was set to 30 K and was increased to 300 K for run-time temperature. Heat time and cool time were set to 0 picoseconds. The site for the Prediction of Binding Site for Ligand Activity of the crystallographic structure of Drp l was defined. The MOE dock module was used to dock the compounds into specified binding sites along with the reference compound exemestane. Exemestane was found in contact with 3S7S, determined by alpha PMI (Principle Moments of Inertia) placement methodology, where Poses were generated by aligning principal moments of inertia and ligand conformations to a randomly generated subset of alpha spheres in the receptor site. Thirty docked conformations were generated for each ligand and ranked by an alpha HB scoring function, which is a linear combination of the geometric fit of the ligand to the binding site and hydrogen bonding effects. From all the receptor-ligand complexes, the conformation with the lowest docking score was chosen for additional analysis.
In vitro biological studies of DDQ. DDQ exhibited a good molecular docking score and better binding
interactions compared to the other molecules those the inventors developed. Therefore, the inventors decided to quantify the biological effects of DDQ in AD pathogenesis. Therefore, the inventors treated AD neurons with DDQ and quantified the effect of DDQ on gene expression levels of synaptic, AD- related, and mitochondrial-related genes. For these treatments, the inventors performed the following protocols: The inventors treated SHSY5Y cells in five different groups as explained in Figure 3.
Figure 3 illustrates the experimental strategy of the cell culture work and including treatments. The cells were grown in a medium (1 : 1 DMEM and F12, 10% FBS, lx penicillin, and streptomycin) at 37°C in a humified incubator with a 5% CO2 environment. After seeding were allowed to grow for 24-48 hrs or until 80% confluence in six-well plates and used for experiments. The inventors used five different groups of cells - (1) untreated SHSY5Y cells; (2) SHSY5Y cells treated with DDQ (250 nM final concentration) for 24 hrs; (3) SHSY5Y cells incubated with Αβ peptide 1-42 (20uM final concentration) for 6 hrs; (4) SHSY5Y cells treated Αβ for 6 hrs +DDQ for 24 hrs and (5) SHSY5Y cells treated DDQ for 24 hrs and Αβ for 6 hrs. Half a million SHSY5Y cells were suspended per well into six-well plates. The inventors used Αβ peptide 1-42 and DDQ 250 nM in the experiments. After treatments, the inventors harvested cells, conducted experiments to measure the levels mRNA using Sybr-Green based real-time RT-PCR, proteins using immunoblotting and immunofluorescence analysis and cell viability using MTT assay. The inventors counted the number of mitochondria by electron microscopy.
Data were compared two ways - (1) untreated cells versus cells treated with Αβ, DDQ, DDQ+Αβ and Αβ+DDQ, and (2) Cells treated with Αβ versus DDQ+Αβ and Αβ+DDQ
Quantification of mitochondrial dynamics, biogenesis and synaptic genes expression using real-time RT- PCR. Using the reagent TriZol (Invitrogen), the inventors isolated total RNA from control and experimental groups (Figure 3). Using primer express Software (Applied Biosystems), the inventors designed the oligonucleotide primers for the housekeeping genes β-actin, mitochondrial structural genes; fission (Drpl and Fisl); fusion genes (MFN1, MFN2); mitochondrial biogenesis genes PGCla, Nrfl, Nrf2 and TFAM; and synaptic genes (PSD95, synaptophysin, synapsin 1, synapsin 2, synaptobrevin 1, synaptobrevin 2, synaptopodin, and GAP43). The primer sequences and amplicon sizes are listed in Table 3. Using SYBR-Green chemistry -based quantitative real-time RT-PCR, the inventors measured mRNA expression of the genes mentioned above as described by Manczak et al. [10].
Table 3. Summary of real-time RT-PCR oligonucleotide primers used in measuring mRNA expression in mitochondrial and synaptic genes in untreated-SHSY5Y, DDQ-SHSY5Y, Αβ-SHSYSY, Ap+DDQ-SHSY5Y and DDQ+A -SHSY5Y treated cell line.
Gene DNA Sequence (5'-3') PCR SEQ ID
Product NO:
Size
Drpl Forward Primer TGGGCGCCGACATCA 54 1
Reverse Primer GCTCTGCGTTCCCACTACGA 2
Fisl Forward Primer TACGTCCGCGGGTTGCT 54 3
Reverse Primer CCAGTTCCTTGGCCTGGTT 4
MFN1 Forward Primer TCTCCAAGCCCAACATCTTCA 62 5
Reverse Primer ACTCCGGCTCCGAAGCA 6
MFN2 Forward Primer TGGTGAGGTGCTATCTCGGA 72 7
Reverse Primer AACAGAGCTCTTCCCACTGC 8
Synaptic genes
Synaptophysin Forward Primer CATTCAGGCTGCACCAAGTG 59 9
Reverse Primer TGGTAGTGCCCCCTTTAACG 10
PSD95 Forward Primer GGACATTCAGGCGCACAAG 58 11
Reverse Primer TCCCGTAGAGGTGGCTGTTG 12
Synapsin 1 Forward Primer TGAGGACATCAGTGTCGGGTAA 64 13
Reverse Primer GGCAATCTGCTCAAGCATAGC 14
Synapsin 2 Forward Primer TCCCACTCATTGAGCAGACATACT 63 15
Reverse Primer GGGAACGTAGGAAGCGTAAGC 16
Synaptobrevin 1 Forward Primer TGCTGCCAAGCTAAAAAGGAA 68 17
Reverse Primer CAGATAGCTCCCAGCATGATCA 18
Synaptobrevin 2 Forward Primer CGGAAGAGTCAGTCTCCATTGG 64 19
Reverse Primer CACCTGCAGATAATGTCGTGCTA 20
Neurogranin Forward Primer AGCCGGACGACGACATTCTA 79 21
Reverse Primer AAACTCGCCTGGATTTTGGC 22
GAP43 Forward Primer CTGAGGAGGAGAAAGACGCTGTA 57 23
Reverse Primer TCCTGTCGGGCACTTTCC 24
Synaptopodin Forward Primer TCCTGCGCCCTGAACCTA 70 25
Reverse Primer GACGGGCGACAGAGCATAGA 26
GAPDH Forward Primer TTCCCGTTCAGCTCTGGG 59 27
Reverse Primer CCCTGCATCCACTGGTGC 28
Mitochondrial Biogenesis genes
PGCl Forward primer GCAGTCGCAACATGCTCAAG 83 29
Reverse primer GGGAACCCTTGGGGTCATTT 30
Nrfl Forward primer AGAAACGGAAACGGCCTCAT 96 31
Reverse primer CATCCAACGTGGCTCTGAGT 32
Nrf2 Forward primer ATGGAGCAAGTTTGGCAGGA 96 33
Reverse primer GCTGGGAACAGCGGTAGTAT 34
TFAM Forward primer TCCACAGAACAGCTACCCAA 84 35
Reverse primer CCACAGGGCTGCAATTTTCC 36
Housekeeping Genes
Beta Actin Forward Primer AGACCTGTACGCCAACACAG 72 37
Reverse Primer TCTGCATCCTGTCGGCAAT 38
Immunoblotting analysis. To determine whether DDQ, or Αβ alters the protein levels of mitochondrial and synaptic genes that showed altered mRNA expressions in the real-time RT-PCR, the inventors performed immunoblotting analyses of protein lysates from cells of control and experimental treatments
in independent cells treatments (n=3) as described in Manczak et al. [13]. Details of proteins, dilutions of antibodies used for immunoblotting analysis was given in Table 4.
Table 4. Summary of antibody dilutions and conditions used in the immunoblotting analysis of mitochondrial structural and synaptic proteins in the SHSY5Y cell treated with DDQ, Αβ, Αβ+DDQ and DDQ+Αβ.
SHSY5Y cells, mutant APPSwe/ind cells and co-immunoprecipitation analysis. SHSY5Y cells: To
determine whether Αβ interact with Drpl, the inventors used protein lysates from Αβ incubated (DDQ pre-treated, post-treated and untreated) SHSY5Y cells.
Mutant APPSwe/ind cells: The inventors purchased mutant APPSwe cDNA clone (pCAX-APP swe/ind) from Addgene - https://www.addgene.org and verified expression of mutant APP APPSwe/ind cDNA and further sub-cloned into a mammalian expression vector (Arubala P. Reddy - unpublished observations). The inventors transfected mutant APPSwe/ind cDNA into mouse neuroblastoma (N2a) cells for 24 hrs and after transfection, cells were treated with DDQ (250nM) for 24 hrs. The inventors harvested mutant APPSwe/ind cells treated and untreated with DDQ and prepared protein lysates and performed co-immunoprecipitation using Αβ (6E10) antibody and conducted immunoblotting analysis with 6E10 and Drpl antibodies.
The inventors performed co-immunoprecipitation (co-IP) assays using the Dynabeads Kit for Immunoprecipitation (Invitrogen). Briefly, 50 of Dynabeads containing protein G was incubated with 10 μg 6E10 or 10 μg of the Drpl antibodies (both mono- and polyclonal antibodies; Santa Cruz), with rotation, for 1 h at room temperature. The inventors used all the reagents and buffers provided in the kit. Details of antibodies used for co-IP and western blotting are given Table 5. The Dynabeads-Αβ complex was washed three times with a washing buffer and was then incubated overnight with 400 μg of protein at 4°C, with rotation. The incubated Dynabead antigen/antibody complexes were washed again 3 times with a washing buffer, and an immunoprecipitant was eluted from the Dynabeads, using a NuPAGE LDS sample buffer. The Αβ and Drp 1 IP elute was loaded onto a 4-20 gradient gel, followed by western blot analysis of Αβ and/or Drpl antibodies. The inventors also cross-checked the results by performing co-IP experiments, using both anti-Αβ and anti-Drpl antibodies [10].
Table 5. Summary of antibody dilutions and conditions used in the co-immunoprecipitation.
Immunofluorescence analysis. To study immune-reactivity of proteins of interest, cells were grown on coverslips using regular cell culture medium and treated as shown in strategy Figure 3 and performed immunofluorescence analysis using the antibodies in these treated and untreated cells as described by Manzcak et al [13]. Details of proteins, dilutions of antibodies used for immunofluorescence analysis was
given in Table 6. Cells were washed with warm PBS, fixed in freshly prepared 4% paraformaldehyde in PBS for 10 min, and then washed with PBS and permeabilized with 0.1% Triton-XlOO in PBS. They were blocked with 1% blocking solution (Invitrogen) for 1 hr at room temperature. All neurons were incubated overnight with primary antibodies. The neurons were incubated with appropriate secondary antibodies. The cells were washed neurons 3 times with PBS, and slides were mounted. Photographs were taken with a multiphoton laser scanning microscope system (ZeissMeta LSM510). To quantify the immunoreactivity of proteins of interest, for each treatment 10-15 photographs were taken at x20 magnification.
Table 6. Summary of antibody dilutions and conditions used in the immunohistochemistry/ immunofluorescence analysis of Drpl, Synaptophysin and PSD95 in the SHSY5Y cell treated with DDQ, Αβ, Αβ+DDQ and DDQ+Αβ.
Double labeling immunofluorescence analysis of Drpl and Αβ. To determine the interaction between
Drpl and Αβ, the inventors conducted double-labeling immunofluorescence analysis, using an anti- Drplantibody (rabbit polyclonal, Santa Cruz Biotechnology) and 6E10 (Covance). As described earlier, the sections from AD patients and control subjects were deparaffinized and treated with sodium borohydrate to reduce autofluorescence.
For the first labeling, the Αβ incubated (DDQ pre-treated, post-treated and untreated) cells were incubated overnight with the anti-Drpl antibody (1 :200) at room temperature. On the day after this primary antibody incubation, the sections were washed with 0.5% Triton in PBS. They were then incubated with a secondary biotinylated anti-rabbit antibody at a 1 :400 dilution (Vector Laboratories, Burlingame, CA, USA) or a secondary biotinylated anti -mouse antibody (1:400) for 1 h at room temperature. They were incubated for 1 h with labeled streptavidin, an HRP solution (Molecular Probes). The cells were washed
three times each with PBS for 10 min, at pH 7.4, and treated with Tyramide Alexa488 for 10 min at room temperature.
For the second labeling, the cells were blocked for 1 h with a blocking solution containing 0.5% Triton in PBS+10% donkey serum+1% BSA. Then they were incubated overnight with 6E10 ( 1 :200 dilution, Covance) at room temperature. Next, they were incubated with the donkey anti-mouse secondary antibody labeled with Alexa 594 for 1 h at room temperature. They were cover-slipped with Prolong Gold and photographed with a confocal microscope [10].
Transmission electron microscopy. To determine the effects of DDQ on the numbers of mitochondria and any rescue effects of DDQ on mitochondria in the mutant SHSY5Y neurons, the inventors used TEM on untreated and treated SHSY5Y cells (as shown in fig 3). [Batches 1-5] . All SHSY5Y cells batches 1-5 were fixed in 100 um sodium cacodylate (pH 7.2), 2.5% glutaraldehyde, 1.6% paraformaldehyde, 0.064% picric acid and 0.1% ruthenium red. They were gently washed and post-fixed for 1 h in 1% osmium tetroxide plus 08% potassium ferricyanide, in 100 mm sodium cacodylate, pH 7.2. After a thorough rinsing in water, the SHSY5Y cells were dehydrated, infiltrated overnight in 1 : 1 acetone :Epon 812 and infiltrated for 1 h with 100% Epon 812 resin. They were then embedded in the resin. After polymerization, 60 to 80 nm thin sections were cut on a Reichert ultramicrotome and stained for 5 min in lead citrate. They were rinsed and post-stained for 30 min in uranyl acetate and then were rinsed again and dried. Electron microscopy was performed at 60 kV on a Philips Morgagne TEM equipped with a CCD, and images were collected at magnifications of χ 1000-37 000. The numbers of mitochondria were counted in the SHSY5Y cells batches 1-5, and statistical significance was determined, using one-way ANOVA.
Mitochondrial function assays. Hydrogen peroxide production. Using an Amplex® Red H2O2 Assay Kit (Molecular Probes, Eugene, OR), the inventors measured the production of H2O2 in independent experiments (n=4) of SHSY5Y neurons treated 1) with and 2) without DDQ, DDQ treated and then incubated with Αβ, as described in Manczak et al. [13] .
Cytochrome oxidase activity. Cytochrome oxidase activity was measured in the mitochondria isolated from SHSY5Y cells of control and experimental treatments (n=4), as described in Manczak et al.33. Enzyme activity was assayed spectrophotometrically using a Sigma Kit (Sigma-Aldrich) following manufacturer's instructions.
ATP levels. ATP levels were measured in mitochondria isolated from SHSY5Y neurons of control and experimental treatments (n=4) using the ATP determination kit (Molecular Probes) as described in Manczak et al. [13] .
Lipid peroxidation assay. Lipid peroxidates are unstable indicators of oxidative stress in neurons. 4- hydroxy-2-nonenol (HNE) is the final product of lipid peroxidation that was measured in the cell lysates from SHSY5Y cells of control and experimental treatments (n=4), using an HNE-His ELISA Kit (Cell BioLabs, Inc., San Diego, CA) as described in Manczak et al. [13].
Cell viability test (MTT assay). Mitochondrial respiration, an indicator of cell viability, was assessed in the SHSY5Y cells from control and experimental treatments (n=4), using the mitochondrial-dependent reduction of 3-(4,5-dimethyl-thiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) to formazan as described in Manczak et al. [13].
Statistical analyses. Statistical analyses were conducted in 2 ways: 1. untreated cells versus cells treated with Αβ, DDQ, DDQ+Αβ and Αβ+DDQ and 2. Cells treated with Αβ versus DDQ+Αβ and Αβ+DDQ for mRNA and protein levels, cell viability and mitochondrial functional parameters H2O2, cytochrome oxidase activity, lipid peroxidation, ATP production and cell viability using appropriate statistical analysis.
It is contemplated that any embodiment discussed in this specification can be implemented with respect to any method, kit, reagent, or composition of the invention, and vice versa. Furthermore, compositions of the invention can be used to achieve methods of the invention.
It will be understood that particular embodiments described herein are shown by way of illustration and not as limitations of the invention. The principal features of this invention can be employed in various embodiments without departing from the scope of the invention. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, numerous equivalents to the specific procedures described herein. Such equivalents are considered to be within the scope of this invention and are covered by the claims.
All publications and patent applications mentioned in the specification are indicative of the level of skill of those skilled in the art to which this invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
The use of the word "a" or "an" when used in conjunction with the term "comprising" in the claims and/or the specification may mean "one," but it is also consistent with the meaning of "one or more," "at least one," and "one or more than one." The use of the term "or" in the claims is used to mean "and/or" unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and "and/or." Throughout this application, the term "about" is used to indicate that a value includes the inherent variation of error for the
device, the method being employed to determine the value, or the variation that exists among the study subjects.
As used in this specification and claim(s), the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "includes" and "include") or "containing" (and any form of containing, such as "contains" and "contain") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. In embodiments of any of the compositions and methods provided herein, "comprising" may be replaced with "consisting essentially of or "consisting of. As used herein, the phrase "consisting essentially of requires the specified integer(s) or steps as well as those that do not materially affect the character or function of the claimed invention. As used herein, the term "consisting" is used to indicate the presence of the recited integer (e.g., a feature, an element, a characteristic, a property, a method/process step or a limitation) or group of integers (e.g., feature(s), element(s), characteristic(s), propertie(s), method/process steps or limitation(s)) only.
The term "or combinations thereof as used herein refers to all permutations and combinations of the listed items preceding the term. For example, "A, B, C, or combinations thereof is intended to include at least one of: A, B, C, AB, AC, BC, or ABC, and if order is important in a particular context, also BA, CA, CB, CBA, BCA, ACB, BAC, or CAB. Continuing with this example, expressly included are combinations that contain repeats of one or more item or term, such as BB, AAA, AB, BBC, AAABCCCC, CBBAAA, CABABB, and so forth. The skilled artisan will understand that typically there is no limit on the number of items or terms in any combination, unless otherwise apparent from the context.
As used herein, words of approximation such as, without limitation, "about", "substantial" or "substantially" refers to a condition that when so modified is understood to not necessarily be absolute or perfect but would be considered close enough to those of ordinary skill in the art to warrant designating the condition as being present. The extent to which the description may vary will depend on how great a change can be instituted and still have one of ordinary skilled in the art recognize the modified feature as still having the required characteristics and capabilities of the unmodified feature. In general, but subject to the preceding discussion, a numerical value herein that is modified by a word of approximation such as "about" may vary from the stated value by at least ±1, 2, 3, 4, 5, 6, 7, 10, 12 or 15%.
All of the compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of
the invention. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims. To aid the Patent Office, and any readers of any patent issued on this application in interpreting the claims appended hereto, applicants wish to note that they do not intend any of the appended claims to invoke paragraph 6 of 35 U.S.C. § 112, 35 U.S.C. 112, paragraph (f), or equivalent thereto, as it exists on the date of filing hereof unless the words "means for" or "step for" are explicitly used in the particular claim.
For each of the claims, each dependent claim can depend both from the independent claim and from each of the prior dependent claims for each and every claim so long as the prior claim provides a proper antecedent basis for a claim term or element.
REFERENCES
1. World Alzheimer Report 2015: The Global Impact of Dementia.
2. Mattson MP (2004) Pathways towards and away from Alzheimer's disease. Nature. 430, 631-639.
3. LaFerla FM, Green KN, Oddo S (2007) Intracellular amyloid-beta in Alzheimer's disease. Nat Rev Neurosci. 8, 499-509.
4. Selkoe DJ. (2001) Alzheimer's disease: genes, proteins, and therapy. Physiol Rev. 81, 741-766.
5. Du H, Guo L, Yan S, Sosunov AA, McKhann GM, Yan SS (2010) Early deficits in synaptic mitochondria in an Alzheimer's disease mouse model. Proc Natl Acad Sci U S A. 107, 18670-18675.
6. Reddy P.H., Tripathi R., Troung Q., Tirumala K., Reddy T.P., Anekonda V., Shirendeb U.P., Calkins M.J., Reddy A.P., Mao P., Manczak M (2012) Abnormal mitochondrial dynamics and synaptic degeneration as early events in Alzheimer's disease: implications to mitochondria-targeted antioxidant therapeutics. Biochim. Biophys. Acta, 1822, 639-649.
7. Zhu Z, Yan J, Jiang W, Yao XG, Chen J, Chen L, Li C, Hu L, Jiang H, Shen X. (2013) Arctigenin effectively ameliorates memory impairment in Alzheimer's disease model mice targeting both β-amyloid production and clearance. J Neurosci. 33, 13138-13149.
8. Reddy PH. (2011) Abnormal tau, mitochondrial dysfunction, impaired axonal transport of mitochondria, and synaptic deprivation in Alzheimer's disease. Brain Res. 1415, 136-148.
9. Reddy PH, Manczak M, Mao P, Calkins MJ, Reddy AP, Shirendeb U. (2010) Amyloid-beta and mitochondria in aging and Alzheimer's disease: implications for synaptic damage and cognitive decline. J Alzheimers Dis. 20, S499-512.
10. Manczak M., Calkins MJ and Reddy P.H (2011) Impaired mitochondrial dynamics and abnormal interaction of amyloid beta with mitochondrial protein Drp 1 in neurons from patients with Alzheimer's disease: implications for neuronal damage. Hum Mol Genet. 20, 2495-2509.
11. Manczak M, Reddy PH (2012) Abnormal interaction of VDAC1 with amyloid beta and
phosphorylated tau causes mitochondrial dysfunction in Alzheimer's disease. Hum Mol Genet. 21, 5131- 5146.
12. Manczak M, Reddy PH (2012) Abnormal interaction between the mitochondrial fission protein Drpl and hyperphosphorylated tau in Alzheimer's disease neurons: implications for mitochondrial dysfunction and neuronal damage. Hum Mol Genet. 21, 2538-2547.
13. Manczak M, Kandimalla R, Fry D, Sesaki H, Reddy PH (2016) Protective effects of reduced dynamin-related protein 1 against amyloid beta-induced mitochondrial dysfunction and synaptic damage in Alzheimer's disease. Hum Mol Genet. Hum Mol Genet 25, 5148-5166.
14. Kandimalla R, Manczak M, Fry D, Suneetha Y, Sesaki H, Reddy PH (2016) Reduced dynamin- related protein 1 protects against phosphorylated Tau-induced mitochondrial dysfunction and synaptic damage in Alzheimer's disease. Hum Mol Genet. 25, 4881-4897.
15. Reddy PH, Beal MF (2008) Amyloid beta, mitochondrial dysfunction and synaptic damage: implications for cognitive decline in aging and Alzheimer's disease. Trends Mol Med.14, 45-53.
16. Lustbader JW, Cirilli M, Lin C, Xu HW, Takuma K, Wang N, Caspersen C, Chen X, Pollak S, Chaney M, Trinchese F, Liu S, Gunn-Moore F, Lue LF, Walker DG, Kuppusamy P, Zewier ZL, Arancio O, Stern D, Yan SS, Wu H (2004) ABAD directly links Abeta to mitochondrial toxicity in Alzheimer's disease. Science. 304, 448-452.
17. Manczak M, Anekonda TS, Henson E, Park BS, Quinn J, Reddy PH (2006) Mitochondria are a direct site of A beta accumulation in Alzheimer's disease neurons: implications for free radical generation and oxidative damage in disease progression. Hum Mol Genet. 15, 1437-1449.
18. Devi L, Prabhu BM, Galati DF, Avadhani NG, Anandatheerthavarada HK (2006) Accumulation of amyloid precursor protein in the mitochondrial import channels of human Alzheimer's disease brain is associated with mitochondrial dysfunction. J. Neurosci. 26, 9057-9068.
19. Yao J, Irwin RW, Zhao L, Nilsen J, Hamilton RT, Brinton RD (2009) Mitochondrial bioenergetic deficit precedes Alzheimer's pathology in female mouse model of Alzheimer's disease. Proc Natl Acad Sci U S A. 106, 14670-14675.
20. Hansson Petersen CA, Alikhani N, Behbahani H, Wiehager B, Pavlov PF, Alafuzoff I, Leinonen V, Ito A, Winblad B, Glaser E, Ankarcrona M (2008) The amyloid beta-peptide is imported into mitochondria via the TOM import machinery and localized to mitochondrial cristae. Proc Natl Acad Sci U S A. 105, 13145-13150.
21. Caspersen C, Wang N, Yao J, Sosunov A, Chen X, Lustbader JW, Xu HW, Stern D, McKhann G, Yan SD (2005) Mitochondrial Abeta: a potential focal point for neuronal metabolic dysfunction in Alzheimer's disease. FASEB J. 19, 2040-2041.
22. Du H, Guo L, Fang F, Chen D, Sosunov AA, McKhann GM, Yan Y, Wang C, Zhang H,
Molkentin JD, et al (2008) Cyclophilin D deficiency attenuates mitochondrial and neuronal perturbation and ameliorates learning and memory in Alzheimer's disease. Nat. Med.14, 1097-1105.
23. Reddy PH (2009) Amyloid beta, mitochondrial structural and functional dynamics in Alzheimer's disease. Exp Neurol. 218, 286-292.
24. Du H, Guo L, Yan SS (2012) Synaptic mitochondrial pathology in Alzheimer's disease. Antioxid Redox Signal. 16, 1467-1475.
25. Sheng JH, Ng TP, Li CB, Lu GH, He W, Qian YP, Wang JH, Yu SY (2012) The peripheral messenger RNA expression of glycogen synthase kinase-3 genes in Alzheimer's disease patients: a preliminary study. Psychogeriatrics. 12, 248-254.
26. Reddy PH (2006) Amyloid precursor protein-mediated free radicals and oxidative damage: implications for the development and progression of Alzheimer's disease. J Neurochem. 96, 1-13.
27. Swerdlow RH, Burns JM, Khan SM (2010) The Alzheimer's disease mitochondrial cascade hypothesis. J Alzheimers Dis. 20 Suppl 2:S265-279.
28. Maria Manczak, Peizhong Mao, Marcus Calkins, Anda Cornea, Arubula Reddy, Michael Murphy, Hazel Szeto, Byung Park, Hemachandra Reddy. (2010) Mitochondria-targeted antioxidants protect against amyloid-beta toxicity in Alzheimer's disease neurons. J. Alzheimers Dis., 20(Suppl. 2), S609-S631.
29. Marcus Calkins, Maria Manczak, Peizhong Mao, Ulziibat Shirendeb, Hemachandra Reddy. (2011) Impaired mitochondrial biogenesis, defective axonal transport of mitochondria, abnormal mitochondrial dynamics and synaptic degeneration in a mouse model of Alzheimer's disease. Hum. Mol. Genet, 20, 4515-4529.
30. Swerdlow, RH (2012) Mitochondria and cell bioenergetics: increasingly recognized components and a possible etiologic cause of Alzheimer's disease. Antioxid Redox Signal. 16, 1434-1455.
31. Wang X., Su B., Lee H.G., Li X., Perry G., Smith M.A., Zhu X (2009) Impaired balance of mitochondrial fission and fusion in Alzheimer's disease. J. Neurosci. 29, 9090-9103.
32. Xinglong Wang, Bo Su, Sandra Siedlak, Paula Moreira, Hisashi Fujioka, Yang Wang, Gemma Casadesus, Xiongwei Zhu. (2008) Amyloid-beta overproduction causes abnormal mitochondrial dynamics via differential modulation of mitochondrial fission/fusion proteins. Proc. Natl. Acad. Sci. USA., 105, 19318-19323.
33. Zheng Li, Ken-Ichi Okamoto, Yasunori Hayashi, Morgan Sheng. (2004) The importance of dendritic mitochondria in the morphogenesis and plasticity of spines and synapses. Cell. 119(6):873-87.
34. Reddy PH, Reddy TP, Manczak M, Calkins MJ, Shirendeb U, Mao P (2011) Dynamin-related protein 1 and mitochondrial fragmentation in neurodegenerative diseases. Brain Res Rev. 67, 103-118.
35. Kandimalla R, Reddy PH. (2016) Multiple faces of dynamin-related protein 1 and its role in
Alzheimer's disease pathogenesis. Biochim Biophys Acta. 1862, 814-828.
36. Gouras GK, Tsai J, Naslund J, Vincent B, Edgar M, Checler F, Greenfield JP, Haroutunian V, Buxbaum JD, Xu H, Greengard P, Relkin NR (2000) Intraneuronal Abeta-42 accumulation in human brain. Am J Pathol. 156, 15-20.
37. Gouras G.K., Almeid C.G., Takahashi R.H (2005) Intraneuronal Abeta accumulation and origin of plaques in Alzheimer's disease. Neurobiol. Aging. 26, 1235-1244.
38. Gouras GK, Tampellini D, Takahashi RH, Capetillo-Zarate E. (2010) Intraneuronal beta-amyloid accumulation and synapse pathology in Alzheimer's disease. Acta Neuropathol. 119, 523-541.
39. Cassidy-Stone A, Chipuk JE, Ingerman E, Song C, Yoo C, Kuwana T, Kurth MJ, Shaw JT, Hinshaw JE, Green DR, Nunnari J. (2008) Chemical inhibition of the mitochondrial division dynamin reveals its role in Bax/Bak-dependent mitochondrial outer membrane permeabilization. Dev Cell. 14, 193-204.
40. Macia E, Ehrlich M, Massol R, Boucrot E, Brunner C, Kirchhausen T (2006) Dynasore, a cell- permeable inhibitor of dynamin. Dev Cell. 10, 839-850.
41. Reddy PH, Manczak M and Yin (2017) Mitochondria-Division Inhibitor 1 Protects Against Amyloid-β induced Mitochondrial Fragmentation and Synaptic Damage in Alzheimer's Disease J Alzheimer Dis (in press)
42. Reddy PH, Manczak and Kandimalla (2017) Mitochondria-targeted small molecule SS31 : a potential candidate for the treatment of Alzheimer's disease. Hum Mol Genet doi: 10.1093/hmg/ddx052, Advance Access Publication Date: 10 February 2017.
43. Kuruva CS, Reddy PH, (2017) Amyloid beta modulators and neuroprotection in Alzheimer's disease: a critical appraisal, Drug Discov Today. 2, 223-233.
44. Kacprzak V, Patel NA, Riley E, Yu L, Yeh J J, Zhdanova IV. Dopaminergic control of anxiety in young and aged zebrafish. Pharmacol Biochem Behav. 2017 Apr 10. pii: S0091-3057(16)30212-X.
45. Molecular Operating Environment (MOE) (2011).10; Chemical Computing Group Inc., 1010 Sherbooke St. West, Suite #910, Montreal, QC, Canada, H3A 2R7, 2011.
46. Kuruva KC, Avilala J, Kumar YN, Golla N, Chamarthi N, Ghosh SK. (2014) Amino acid esters substituted phosphorylated emtricitabine and didanosine derivatives as antiviral and anticancer agents. Appl Biochem Biotechnol. 173, 1303-1318.
47. Ordonez M, Rojas-Cabrera H, Cativiela C (2009) An overview of stereoselective synthesis of a- aminophosphonic acids and derivatives. Tetrahedron. 65, 17-49.
48. Li YJ, Wang CY, Ye MY, Yao GY, Wang HS (2015) Novel Coumarin-Containing Aminophosphonatesas Antitumor Agent: Synthesis, Cytotoxicity, DNA-Binding and Apoptosis Evaluation. Molecules. 20, 14791-14809.
Claims
1. A molecule that inhibits the interaction of Αβ and Drpl proteins.
2. The molecule of claim 1, wherein the molecule inhibits the interaction of Αβ and Drp l proteins in nerve cells.
3. The molecule of claim 1, wherein the molecule inhibits mitochondrial, intracellular, and extracellular damage caused by the interaction of Αβ and Drp l in or about nerve cells.
4. The molecule of claim 1, wherein the molecule is water soluble.
5. The molecule of claim 1, wherein the molecule is adapted for oral, intravenous, intramuscular, intraperitoneal, subcutaneous, parenteral, or pulmonary administration.
6. The molecule of claim 1, wherein the Αβ and Drp l proteins are human.
7. The molecule of claim 1, wherein the molecule delays age-dependent disease process in
Alzheimer's, Huntington's, Parkinson's and ALS.
8. The molecule of claim 1, wherein the molecule at least one of: delays aging in neurons, protects neurons from oxidative insults, inhibits abnormal protein-protein interactions, protect neurons from mutant protein(s)-induced toxicities, or enhances cell survival.
9. The molecule of claim 1, wherein the molecule is selected from at least one of: phosphonium cation based structures; quinoline based alpha aminophosphonates; napthaline based alpha
aminophosphonates, or hexahydropyramidine carboxylates structures.
10. The molecule of claim 1, wherein the composition is selected from at least one of:
lphosphonate) :
MitoQ: (Phosphonium, [10-(4,5-dimethoxy-2-methyl-3,6-dioxo- l,4-cyclohexadien- l-yl)decyl]triphenyl-, methanesulfonate), shown here in the form of a mesylate.
Mdivi-1 : (3-(2,4-Dichloro-5-methoxyphenyl)-2,3-dihydro-2-thioxo-4(lH)-quinazolinone, 3-(2,4- Dichloro-5-methoxyphenyl)-2-sulfanyl-4(3H)-quinazolinone):
1 1. The molecule of claim 10, wherein the shaded regions are modified to at lease one of: increase the inhibition of Αβ and Drp 1 binding, increase crossing the blood-brain-barrier, increase solubility, or increase the metabolic half-life of the molecule.
12. A method for identifying a molecule that inhibits the interaction of Αβ and Drpl proteins comprising:
obtaining a database of molecular coordinates for the regions of the Αβ and Drp 1 proteins that interact;
obtaining a database of molecules comprising molecular coordinates;
identifying the molecules from the database of molecules that fit between the regions in which the Αβ and Drp 1 proteins that interact; and
testing in vitro the ability of the one or more molecules that fit between the regions in which the Αβ and Drp l proteins to prevent binding of Αβ and Drp l proteins.
13. The method of claim 12, further comprising testing the inhibition of the one or more molecules to inhibit the interaction of Αβ and Drp l proteins in nerve cells.
14. The method of claim 12, further comprising testing the molecule to inhibit mitochondrial, intracellular, and extracellular damage caused by the interaction of Αβ and Drp l in or about nerve cells.
15. The method of claim 12, wherein the molecule is water soluble.
16. The method of claim 12, further comprising adapting the molecule for oral, intravenous, intramuscular, intraperitoneal, subcutaneous, parenteral, or pulmonary administration.
17. The method of claim 12, further comprising testing the one or more molecules to delay age- dependent disease process in Alzheimer's, Huntington's, Parkinson's and ALS.
18. The method of claim 12, wherein the one or more molecules at least one of: delays aging in neurons, protects neurons from oxidative insults, inhibits abnormal protein-protein interactions and protect neurons from mutant protein(s)-induced toxicities, and enhances cell survival.
19. The method of claim 12, wherein the molecule is selected from at least one of: phosphonium cation based structures; quinoline based alpha aminophosphonates; napthaline based alpha
aminophosphonates, or hexahydropyramidine carboxylates structures.
20. The method of claim 12, wherein the molecule tested is, or is based on, at least one of:
DDQ (diethyl(3,4-dihydroxyphenethylamine)(quinolin-4-yl)methylphosphonate):
MitoQ : (Phosphonium, [ 10-(4,5 -dimethoxy-2-methyl-3 ,6-dioxo- 1 ,4-cyclohexadien- 1 -yl)decyl]triphenyl-
Dynasore: (3-Hydroxy-naphthalene-2-carboxylic acid (3,4-dihydroxy-benzylidene)-hydrazide) shown here in the form of a hydrate:
Mdivi- 1 : (3-(2,4-Dichloro-5-methoxyphenyl)-2,3-dihydro-2-thioxo-4(lH)-quinazolinone, 3-(2,4- Dichloro-5-methoxyphenyl)-2-sulfanyl-4(3H)-quinazolinone):
21. The method of claim 12, wherein the shaded regions are modified to at lease one of: increase the inhibition of Αβ and Drp 1 binding, increase crossing the blood-brain-barrier, increase solubility, or increase the metabolic half-life of the molecule.
22. A method of treating a neuropathy caused by the interaction of Αβ and Drp l proteins comprising providing a molecule that inhibits the interaction of the Αβ and Drp l proteins.
23. The method of claim 22, wherein the molecule inhibits the interaction of Αβ and Drpl proteins in nerve cells.
24. The method of claim 22, wherein the molecule inhibits mitochondrial, intracellular, and extracellular damage caused by the interaction of Αβ and Drp l in or about nerve cells.
25. The method of claim 22, wherein the molecule is water soluble.
26. The method of claim 22, wherein the molecule is adapted for oral, intravenous, intramuscular, intraperitoneal, subcutaneous, parenteral, or pulmonary administration.
27. The method of claim 22, wherein the Αβ and Drpl proteins are human.
28. The method of claim 22, wherein the neuropathy is an age-dependent disease selected from Alzheimer's, Huntington's, Parkinson's disease or ALS.
29. The method of claim 22, wherein the molecule at least one of: delays aging in neurons, protects neurons from oxidative insults, inhibits abnormal protein-protein interactions, protect neurons from mutant protein(s)-induced toxicities, or enhances cell survival.
30. The method of claim 22, wherein the molecule is selected from at least one of: phosphonium cation based structures; quinoline based alpha aminophosphonates; napthaline based alpha
aminophosphonates, or hexahydropyramidine carboxylates structures.
31. The method of claim 22, wherein the molecule is, or is based on, at least one of:
methylphosphonate):
MitoQ : (Phosphonium, [ 10-(4,5 -dimethoxy-2-methyl-3 ,6-dioxo- 1 ,4-cyclohexadien- 1 -yl)decyl]triphenyl-, methanesulfonate), shown here in the form of a mesylate.
Dynasore: (3-Hydroxy-naphthalene-2-carboxylic acid (3,4-dihydroxy-benzylidene)-hydrazide) shown here in the form of a h drate:
Mdiv-1 : (3-(2,4-Dichloro-5-methoxyphenyl)-2,3-dihydro-2-thioxo-4(lH)-quinazolinone, 3-(2,4-Dichloro- 5-methoxyphenyl)-2-sulfanyl-4(3H)-quinazolinone):
32. The method of claim 22, wherein the shaded regions are modified to at lease one of: increase the inhibition of Αβ and Drp 1 binding, increase crossing the blood-brain-barrier, increase solubility, or increase the metabolic half-life of the molecule.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US16/463,904 US10987367B2 (en) | 2016-11-28 | 2017-11-28 | Drug targets of delayed aging and human brain diseases |
| US17/192,340 US12208108B2 (en) | 2016-11-28 | 2021-03-04 | Drug targets of delayed aging and human brain diseases |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201662426956P | 2016-11-28 | 2016-11-28 | |
| US62/426,956 | 2016-11-28 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US16/463,904 A-371-Of-International US10987367B2 (en) | 2016-11-28 | 2017-11-28 | Drug targets of delayed aging and human brain diseases |
| US17/192,340 Continuation-In-Part US12208108B2 (en) | 2016-11-28 | 2021-03-04 | Drug targets of delayed aging and human brain diseases |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2018098484A1 true WO2018098484A1 (en) | 2018-05-31 |
Family
ID=62196080
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2017/063485 Ceased WO2018098484A1 (en) | 2016-11-28 | 2017-11-28 | Drug targets of delayed aging and human brain diseases |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US10987367B2 (en) |
| WO (1) | WO2018098484A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112703559A (en) * | 2018-07-26 | 2021-04-23 | 核物理国家研究院 | Method for identifying intermediates |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP7734917B2 (en) | 2019-01-28 | 2025-09-08 | ミトコンドリア エモーション, インク. | Trans-4-hydroxycyclohexylphenylamide mitofusin activator and method of use thereof |
| AU2019427489B2 (en) | 2019-01-28 | 2025-03-13 | Mitochondria Emotion, Inc. | Mitofusin activators and methods of use thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140155471A1 (en) * | 2011-07-12 | 2014-06-05 | University Of Rochester | Treating neurological disease or injury with a dynamin-related protein 1 (drp1) encoding nucleic acid |
| KR20140086704A (en) * | 2012-12-28 | 2014-07-08 | 울산대학교 산학협력단 | Pharmaceutical Composition Comprising Dynasore for prevention or treatment of Neurodegenarative Diseases |
| KR20160121295A (en) * | 2015-04-10 | 2016-10-19 | 성균관대학교산학협력단 | Pharmaceutical composition containing mitochondrial division inhibitor for preventing or treating alzheimer's disease |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1353655A2 (en) | 2001-01-26 | 2003-10-22 | Metaphore Pharmaceuticals Inc. | Method of treatment of neurodegenerative disorders using pentaaza-macrocyclic ligand complexes |
| WO2008074068A1 (en) | 2006-12-20 | 2008-06-26 | Prana Biotechnology Limited | Substituted quinoline derivatives as antiamyloidogeneic agents |
| KR102300032B1 (en) | 2014-07-10 | 2021-09-09 | 코웨이 주식회사 | Apparatus for distributing gas capable of measuring remainder of gas in real time and apparatus for purifying water having the same |
-
2017
- 2017-11-28 WO PCT/US2017/063485 patent/WO2018098484A1/en not_active Ceased
- 2017-11-28 US US16/463,904 patent/US10987367B2/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140155471A1 (en) * | 2011-07-12 | 2014-06-05 | University Of Rochester | Treating neurological disease or injury with a dynamin-related protein 1 (drp1) encoding nucleic acid |
| KR20140086704A (en) * | 2012-12-28 | 2014-07-08 | 울산대학교 산학협력단 | Pharmaceutical Composition Comprising Dynasore for prevention or treatment of Neurodegenarative Diseases |
| KR20160121295A (en) * | 2015-04-10 | 2016-10-19 | 성균관대학교산학협력단 | Pharmaceutical composition containing mitochondrial division inhibitor for preventing or treating alzheimer's disease |
Non-Patent Citations (6)
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112703559A (en) * | 2018-07-26 | 2021-04-23 | 核物理国家研究院 | Method for identifying intermediates |
Also Published As
| Publication number | Publication date |
|---|---|
| US20190374558A1 (en) | 2019-12-12 |
| US10987367B2 (en) | 2021-04-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Kuruva et al. | Aqua-soluble DDQ reduces the levels of Drp1 and A β and inhibits abnormal interactions between A β and Drp1 and protects Alzheimer’s disease neurons from A β-and Drp1-induced mitochondrial and synaptic toxicities | |
| Xu et al. | Role of autophagy in sevoflurane-induced neurotoxicity in neonatal rat hippocampal cells | |
| WO2018109198A1 (en) | Bicyclic oga inhibitor compounds | |
| US20180161335A1 (en) | Methods to treat neurological diseases | |
| CA3171258A1 (en) | Mdm2 degraders and uses thereof | |
| RU2654910C2 (en) | Benzylideneguanidine derivatives and therapeutic use thereof for treatment of protein misfolding related diseases | |
| AU2019291099A1 (en) | Oga inhibitor compounds | |
| CA3017645C (en) | 1,5-disubstituted 1,2,3-triazoles are inhibitors of rac/cdc42 gtpases | |
| EP3280404B1 (en) | Methods for selecting phosphatase selective and non-selective phosphatase inhibitors | |
| US10987367B2 (en) | Drug targets of delayed aging and human brain diseases | |
| Weiss-Sadan et al. | Cathepsins drive anti-inflammatory activity by regulating autophagy and mitochondrial dynamics in macrophage foam cells | |
| EP3947344B1 (en) | 2,2'-(1,3-phenylenedimethylidyne)-bis-hydrazinecarboximidamide derivatives as retromer stabilizers for the treatment of neurological diseases | |
| Li et al. | H2S probe CPC inhibits autophagy and promotes apoptosis by inhibiting glutathionylation of Keap1 at Cys434 | |
| US12208108B2 (en) | Drug targets of delayed aging and human brain diseases | |
| Yang et al. | Isowalsuranolide targets TrxR1/2 and triggers lysosomal biogenesis and autophagy via the p53-TFEB/TFE3 axis | |
| KR20220118483A (en) | OGA inhibitor compounds | |
| Tu et al. | Discovery of lipoic acid-4-phenyl-1 H-pyrazole hybrids as novel bifunctional ROCK inhibitors with antioxidant activity | |
| CA3160367A1 (en) | Oga inhibitor compounds | |
| US20250179024A1 (en) | Amyloid and associated pathology modulators and methods thereof | |
| Liu et al. | MLL1 downregulation drives hair cell ferroptosis via mitochondrial and endoplasmic reticulum stress mechanisms through PERK–eIF2α–Atf4–Chop and PI3K/Akt–Lrp1 signaling pathway | |
| JP2021527668A (en) | OGA inhibitor compound | |
| US20260021068A1 (en) | Methods and compositions for inhibition of tyrosine and phenylalanine-mediated dna damage and repair | |
| Hu et al. | Aloe-emodin attenuated Aβ-induced tau phosphorylation by autophagy-NLRP3 inflammasome pathway | |
| Jia et al. | Dysregulation of a novel autophagosome-mitochondria contact contributes to autophagy dysfunction and neurodegeneration in tauopathy | |
| WO2021110656A1 (en) | Oga inhibitor compounds |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17875039 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 17875039 Country of ref document: EP Kind code of ref document: A1 |

































