WO2018091637A1 - Probiotic yeasts as novel vaccination vectors - Google Patents

Probiotic yeasts as novel vaccination vectors Download PDF

Info

Publication number
WO2018091637A1
WO2018091637A1 PCT/EP2017/079557 EP2017079557W WO2018091637A1 WO 2018091637 A1 WO2018091637 A1 WO 2018091637A1 EP 2017079557 W EP2017079557 W EP 2017079557W WO 2018091637 A1 WO2018091637 A1 WO 2018091637A1
Authority
WO
WIPO (PCT)
Prior art keywords
hiv
yeast
antigen
protein
composition
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2017/079557
Other languages
French (fr)
Inventor
Bruno Goncalo DOURADINHA MATEUS
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
RiMed Foundation
University of Pittsburgh
Original Assignee
RiMed Foundation
University of Pittsburgh
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by RiMed Foundation, University of Pittsburgh filed Critical RiMed Foundation
Publication of WO2018091637A1 publication Critical patent/WO2018091637A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C07K14/08RNA viruses
    • C07K14/15Retroviridae, e.g. bovine leukaemia virus, feline leukaemia virus human T-cell leukaemia-lymphoma virus
    • C07K14/155Lentiviridae, e.g. human immunodeficiency virus [HIV], visna-maedi virus or equine infectious anaemia virus
    • C07K14/16HIV-1 ; HIV-2
    • C07K14/162HIV-1 ; HIV-2 env, e.g. gp160, gp110/120, gp41, V3, peptid T, CD4-Binding site
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/06Fungi, e.g. yeasts
    • A61K36/062Ascomycota
    • A61K36/064Saccharomycetales, e.g. baker's yeast
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/11T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/19Dendritic cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/20Cellular immunotherapy characterised by the effect or the function of the cells
    • A61K40/24Antigen-presenting cells [APC]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/46Viral antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/52Bacterial cells; Fungal cells; Protozoal cells
    • A61K2039/523Bacterial cells; Fungal cells; Protozoal cells expressing foreign proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/16011Human Immunodeficiency Virus, HIV
    • C12N2740/16211Human Immunodeficiency Virus, HIV concerning HIV gagpol
    • C12N2740/16234Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Definitions

  • the present invention relates to genetically engineered probiotic yeast strains expressing HIV antigens and uses thereof.
  • HIV human immunodeficiency virus
  • ART drugs antiretroviral therapy drugs, which have extended the lifespan of HIV-infected people by preventing viral replication and, subsequently, allowing the immune cells to still be effective against pathogens and cancerous cells 1 .
  • ART drugs are unable to fully clear this virus from the organism; as all members of the Retroviridae family, HIV DNA can integrate in the host cell genome and stay dormant during extended periods without losing its replication fitness 2 ' 3 . To completely eradicate HIV, a vaccination strategy must be developed.
  • cerevisiae strains are known to naturally induce an immune response in the colon and to be resistant to the gastrointestinal harsh environments, such as acidic gastric juice and bile salts. Genetically engineered Saccharomyces cerevisiae strains expressing HIV antigens have shown promising pre-clinical results, as their can stimulate a T cell response. However, most 5. cerevisiae strains tend to induce a poor mucosal immune response, even if administered orally. The use of genetically engineered Saccharomyces cerevisiae strains expressing HIV antigen gpl60 induced a potent cellular immune response in mice 5 ' 6 .
  • cerevisiae strains which can be genetically manipulated to express on their surface H IV antigens.
  • H IV human immunodeficiency virus
  • a vaccine against this viral pathogen must not only elicit both cellular and humoral arms of the immune system, but also induce a mucosal immunity.
  • sexually transmitted HIV uses mucosal ports of entry, and a mucosal immune response would both prevent a new infection and its further spreading to uninfected individuals.
  • I n the present invention probiotic 5. cerevisiae strains were transformed with the bicistronic plasmid pCEV-Gl-Km (pCEV) in its simple form or with the HIV gag gene sequence optimized for expression in the cell wall of S.
  • pCEV bicistronic plasmid pCEV-Gl-Km
  • the inventor successfully expressed HIV Gag protein in the yeast surface, expression was confirmed by flow cytometry and fluorescence microscopy. He observed that genetic modification did not impair neither phagocytosis by human dendritic cells (DCs) from healthy donors in vitro nor resistance to simulated gastrointestinal stresses. I n fact, genetically modified strains were eagerly phagocytosed by human dendritic cells (DCs) in vitro and showed resistance to simulated gastrointestinal aggressive milieus. Cell surface markers and cytokines secreted by healthy donors DCs following genetically engineered yeasts, indicate that these immune cells polarize in a type 1 response.
  • the inventor matured DCs derived from an HIV+ patient with transformed yeasts and incubated them with autologous T cells from the same patient. I nterestingly, only DCs which have been in contact with pJRP-transformed probiotic S. cerevisiae strains were able to efficiently perform HIV Gag antigen presentation to T cells, as observed by clonal expansion of the former when later incubated with a Gag peptide pool.
  • the present results show that genetically engineered probiotic strains of S. boulardii 17 (Sb) and S. cerevisiae Sc47 are promising vaccination strategies against HIV.
  • Both strains are able to efficiently perform HIV antigen (such as Gag) presentation to T cells. Both strains elicit an HIV-specific T cell response. Further, both strains are resistant to simulated gastrointestinal stresses, such as intestinal proteases, bile salts and gastric acidic pH; both strains are eagerly phagocytosed by human dendritic cells in vitro; both strains are able to induce maturation of human dendritic cells in vitro; both strains promote cytokine production by human dendritic cells in vitro; both strains appear to favor a Thl immune response, based on the type of markers observed in human dendritic cells in vitro and the profile of cytokines secreted by those cells.
  • HIV antigen such as Gag
  • an immunotherapeutic composition comprising:
  • probiotic yeast is selected from yeast is 5. cerevisiae or S. boulardii.
  • probiotic yeast is selected from yeast is 5. cerevisiae Sc47 or 5. boulardii 17.
  • the at least one HIV antigen comprises or consists of an amino acid sequence that is at least 80% identica l to a n amino acid sequence encoded by the nucleotide sequence of SEQ I D NO:l (GAG optimized sequence) or a corresponding amino acid sequence from a different HIV strain
  • the at least one HIV antigen comprises or consists of an amino acid sequence that is at least 90%, 95 %, 99 % identical to an amino acid sequence encoded by the nucleotide sequence of SEQ. I D NO:l.
  • the HIV antigen comprises or consists of an amino acid sequence that is at least 90% identical to an amino acid sequence encoded by a nucleotide sequence of SEQ ID NO:l or a corresponding amino acid sequence from a different HIV strain.
  • HIV antigen consists of the amino acid sequence encoded by the nucleotide of SEQ ID NO:l.
  • the fusion protein comprises an amino acid sequence of SEQ. ID NO:9.
  • the HIV antigen is expressed by the yeast vehicle. More preferably the yeast vehicle is a whole yeast.
  • the invention also provides an immunotherapeutic composition comprising:
  • an HIV fusion protein or HIV protein comprising the amino acid sequence of SEQ. ID NO:l, wherein the fusion protein or protein is under the control of the TEF1 and/or PGK1 promoter; wherein the HIV fusion protein or protein is expressed by the yeast; wherein the composition elicits an HIV-specific T cell response and wherein the yeast is 5. cerevisiae Sc47 or 5. boulardii 17.
  • the fusion protein comprises the amino acid sequence of SEQ ID NO:9.
  • the immunotherapeutic composition as defined above further comprises a dendritic cell, wherein the dendritic cell has been loaded with the yeast.
  • the immunotherapeutic composition as defined above further comprises one or more adjuvant(s) and/or one or more additional compounds or compositions useful for treating or ameliorating a symptom of HIV infection.
  • the compound is an anti-viral compound.
  • the anti-viral compound is a fixed-dose combination (FDC) drug.
  • the additional composition is a DNA vaccine encoding at least one HIV antigen
  • the additional composition is a processed yeast, preferably the processed yeast was genetically modified to express at least one HIV antigen, still preferably the processed yeast is administered with at least one HIV antigen.
  • the additional composition comprises autologous T cells from the subject, wherein the autologous T cells have been stimulated ex vivo with at least one HIV antigen.
  • the additional composition comprises a protein subunit vaccine comprising at least one HIV antigen.
  • the HIV antigen is the same as the HIV antigen in the composition as defined above. More preferably the additional compound comprises a biological response modifier.
  • the additional compound or composition is administered prior, subsequently or concurrently to administration of the immunotherapeutic composition.
  • composition is formulated in a pharmaceutically acceptable excipient suitable for administration to a subject by injection or orally.
  • the invention further provides fusion protein comprising at least one HIV antigen, wherein the fusion protein comprises an amino acid sequence that is at least 95% identical to an amino acid sequence of SEQ ID NO:ll.
  • the invention further provides a recombinant nucleic acid molecule encoding the fusion protein as described above.
  • the invention further provides an isolated cell transfected with the recombinant nucleic acid as defined above.
  • the cell is a yeast cell.
  • the invention further provides a composition comprising the fusion protein as defined above, or the recombinant nucleic acid molecule as defined above or the isolated cell as defined above.
  • the invention further provides the immunotherapeutic composition as defined above, the fusion protein, the recombinant nucleic acid, the isolated transfected cell or the composition comprising any of said fusion protein, recombinant nucleic acid, isolated transfected cell for use in the treatment of human immunodeficiency virus (HIV) infection or in the treatment of at least one symptom resulting from HIV infection.
  • HIV human immunodeficiency virus
  • the invention further provides process for preparing the immunogenic composition as defined above, comprising the steps of:
  • boulardii preferably in S. cerevisiae SC47 orS. boulardii 17 host carrying a plasmid having a HIV antigen coding sequence, wherein the plasmid includes: (1) An Sc promoter sequence (such as TEF1 or PGK1) and optionally a AGA1 and/or a AGA2 sequence upstream of the HIV coding sequence; and (2) An Sc terminator of transcription sequence downstream of the HIV coding sequence;
  • the process further comprises purifying the HIV antigen after expression in a S. cerevisiae SC47 or S. boulardii 17 host.
  • the HIV antigen coding sequence has 80 % identity with SEQ. ID No: 1, preferably 90 %, 95 % or 99 % identity with SEQ. ID No: 1.
  • the present invention provides a method for the treatment of human immunodeficiency virus (HIV) infection or in the treatment of at least one symptom resulting from HIV infection, comprising administering to a subject that has been infected with HIV at least one composition as defined above, wherein administration of the composition to the subject reduces HIV infection or at least one symptom resulting from HIV infection in a subject.
  • HIV human immunodeficiency virus
  • the administration of the composition to the subject reduces HIV viral load in the subject.
  • composition to the subject increases or stabilizes CD4+ cell counts in the subject.
  • composition reduces the amount, duration or frequency of anti-viral therapy administered to the subject.
  • composition results in a functional cure of HIV infection in the subject.
  • the present invention also provides a method to elicit an antigen-specific, cell-mediated immune response against an HIV antigen, comprising administering to a subject at least one composition as defined above.
  • the immune response is a cytotoxic T lymphocyte (CTL) response.
  • CTL cytotoxic T lymphocyte
  • the present invention also provides a method to prevent HIV infection in a subject, comprising administering to a subject that has not been infected with HIV, at least one composition as defined above.
  • the present invention also provides a method to immunize a population of individuals against HIV, comprising administering to the population of individuals at least one composition as defined above.
  • the present invention also provides the composition as defined above for use to treat HIV infection or a symptom thereof or for use to prevent HIV infection or a symptom thereof.
  • the composition may be administered either systemically (in which case yeast cells will be previously heat killed) or orally (live yeasts producing the antigen in their surface).
  • AGA2 sequence might precede HIV antigen sequence if AGA1/AGA2 system is used for surface expression.
  • AGAlp/AGA2p system is not required for cytoplasmatic expression of HIV antigen, such as Gag.
  • This invention generally relates to compositions and methods for preventing and/or treating human immunodeficiency virus (HIV) infection.
  • the invention includes a yeast-based immunotherapeutic composition (also referred to as "yeast-based HIV immunotherapy”) comprising a yeast vehicle and HIV antigen(s) that have been designed to elicit a prophylactic and/or therapeutic immune response against HIV infection in an individual, and the use of such compositions to prevent and/or treat HIV infection and related symptoms thereof.
  • the invention also includes the recombinant nucleic acid molecules used in the yeast-based compositions of the invention, as well as the proteins and fusion proteins encoded thereby, for use in any immunotherapeutic composition and/or any therapeutic or prophylactic protocol for HIV infection, including any therapeutic or prophylactic protocol that combines the HIV-specific yeast-based compositions of the invention with any one or more other therapeutic or prophylactic compositions, agents, drugs, compounds, and/or protocols for HIV infection.
  • the yeast-based, HIV-specific immunotherapeutic compositions are unique among various types of immunotherapy, in that these compositions of the invention induce innate immune responses, as well as adaptive immune responses that specifically target HIV, including TH1 T cell responses and antigen- specific CD8+ T cell responses.
  • the breadth of the immune response elicited by HIV-specific yeast-based immunotherapy is well-suited to target HIV.
  • Yeast-based HIV immunotherapy by activating both the innate and the adaptive immune responses, and both CD4+ and CD8+ T cell responses, is expected to effectively target HIV-infected cells for destruction and/or is expected to effectively enhance viral clearance, as well as provide long term memory immunity against reactivating virus.
  • yeast-based HIV immunotherapy is combined with anti-viral drugs, and/or with other therapies for HIV, in order to reduce the viral load in an individual to a level that can be more effectively handled by the immune system.
  • yeast-based immunotherapeutic compositions are administered as biologicals or pharmaceutically acceptable compositions. Accordingly, rather than using yeast as an antigen production system followed by purification of the antigen from the yeast, the entire yeast vehicle as described herein must be suitable for, and formulated for, administration to a patient. Accordingly, the yeast-based immunotherapeutic compositions of the invention contain readily detectable yeast DNA and contain substantially more than 5% yeast protein; generally, yeast- based immunotherapeutics of the invention contain more than 70%, more tha n 80%, or generally more than 90% yeast protein. Yeast-based immunotherapeutic compositions are administered to a patient in order to immunize the patient for therapeutic and/or prophylactic purposes.
  • the yeast-based compositions are formulated for administration in a pharmaceutically acceptable excipient or formulation.
  • the composition should be formulated, in one aspect, to be suitable for administration to a human subject (e.g., the manufacturing conditions should be suitable for use in humans, and any excipients or formulations used to finish the composition and/or prepare the dose of the immunotherapeutic for administration should be suitable for use in humans).
  • yeast-based immunotherapeutic compositions are formulated for administration by injection of the patient or subject, such as by a parenteral route (e.g., by subcutaneous, intraperitoneal, intramuscular or intradermal injection, or another suitable parenteral route).
  • the yeast express the antigen (e.g., detectable by a Western blot), and the antigen is not aggregated in the yeast, the antigen does not form inclusion bodies in the yeast, and/or does not form very large particles (VLPs) or other large antigen particles in the yeast.
  • the antigen is produced as a soluble protein in the yeast, and/or is not secreted from the yeast or is not substantially or primarily secreted from the yeast.
  • particular combinations and/or arrangements of antigens in an HIV fusion protein are utilized in a yeast-based immunotherapeutic of the invention to intentionally form VLPs or aggregates within the yeast (discussed in more detail below).
  • the resulting antigen expressed by the yeast is believed, without being bound by theory, to have additional immunogenic properties related to its overall structure and form, as a separate characteristic from the immunogenic properties of the immune epitopes (e.g., T cell epitopes) carried within the antigen.
  • the immune epitopes e.g., T cell epitopes
  • the immunotherapeutic composition derives properties that activate the innate immune system not only from the yeast vehicle as discussed above (as with all yeast-based immunotherapeutics described herein), but also in part from the fusion protein antigen structure; in addition, the immunotherapeutic composition derives properties that activate the adaptive immune system in an antigen- specific manner from the fusion protein (via provision of various T cell epitopes), as with all of the yeast-based immunotherapeutics described herein.
  • the yeast-based immunotherapeutics should be readily phagocytosed by dendritic cells of the immune system, and the yeast and antigens readily processed by such dendritic cells, in order to elicit an effective immune response against HIV.
  • One embodiment of the present invention relates to a yeast-based immunotherapy composition which can be used to prevent and/or treat HIV infection and/or to alleviate at least one symptom resulting from the HIV infection.
  • the composition comprises: (a) a yeast vehicle; and (b) one or more antigens comprising HIV protein(s) and/or immunogenic domain(s) thereof.
  • the HIV proteins are most typically expressed as recombinant proteins by the yeast vehicle ⁇ e.g., by an intact yeast or yeast spheroplast, which can optionally be further processed to a yeast cytoplast, yeast ghost, or yeast membrane extract or fraction thereof), although it is an embodiment of the invention that one or more such HIV proteins are loaded into a yeast vehicle or otherwise complexed with, attached to, mixed with or administered with a yeast vehicle as described herein to form a composition of the present invention.
  • heterologous protein or heterologous antigen including a heterologous fusion protein, in connection with a yeast vehicle of the invention, means that the protein or antigen is not a protein or antigen that is naturally expressed by the yeast, although a fusion protein that includes heterologous antigen or heterologous protein may also include yeast sequences or proteins or portions thereof that are also naturally expressed by yeast ⁇ e.g., an alpha factor prepro sequence).
  • HIV fusion proteins are useful in a yeast-based immunotherapeutic composition of the invention.
  • Such fusion proteins, and/or the recombinant nucleic acid molecules encoding such proteins can also be used in, in combination with, or to produce, a non-yeast-based immunotherapeutic composition, which may include, without limitation, a DNA vaccine, a protein subunit vaccine, a recombinant viral-based immunotherapeutic composition, a killed or inactivated pathogen vaccine, a dendritic cell vaccine, and/or an autologous T cell vaccine (the subject's T cells that have been stimulated ex vivo using a fusion protein of the invention).
  • such fusion proteins can be used in a diagnostic assay for HIV and/or to generate antibodies against HIV.
  • Described herein are exemplary HIV fusion proteins providing selected portions of HIV antigens, including, for example, selected portions of and/or modified polymerase (Pol), selected portions of and/or modified Gag, and selected portions of and/or modified envelope (Env), as well as selected portions of and/or arrangements of any one, two, or all three of these antigens.
  • HIV is a Group VI (ssR A-RT) virus and a member of the virus family Retroviridae and the genus Lentivirus. It is widely accepted that HIV evolved at some point in time from closely related Simian immunodeficiency virus (SIV), and was transferred from non-human primates (SIV or HIV) to humans in the recent past. HIV can be divided into two main types or species, known as HIV type 1 (HIV-1) and HIV type 2 (HIV-2). HIV-1, the most common and pathogenic strain of the virus and the cause of most infections worldwide, is further divided into groups, which are each believed to represent an independent transmission of SIV into humans.
  • HIV type 1 HIV-1
  • HIV-1 the most common and pathogenic strain of the virus and the cause of most infections worldwide, is further divided into groups, which are each believed to represent an independent transmission of SIV into humans.
  • HIV-1 has been divided into Groups M (for "major” or “main"), N, 0 and P, with Group M being the most prevalent HIV-1 group.
  • Group M is further divided into clades, known generally as “subtypes” ⁇ e.g., subtypes A-K).
  • Subtypes may be further divided into sub-subtypes and also "circulating recombinant forms” (CRF) where two subtypes are believed to have recombined to form a new subtype.
  • HIV-2 has also been divided into groups, although only 2 groups (A and B) are epidemic. HIV-1 contains 39 open reading frames (ORFs) in all possible six reading frames (Dwivedi et al. Res. J.
  • HIV protein or functional, structural or immunogenic domain thereof may be used in a yeast-based immunotherapy composition
  • three particularly useful proteins include HIV Gag, HIV Pol and HIV Env, and/or any functional, structural or immunogenic domain of any of these proteins
  • gag group-specific antigen encodes the precursor Gag polyprotein, which is processed by viral protease during maturation to MA (matrix protein, pi 7); CA (capsid protein, p24); SP1 (spacer peptide 1, p2); NC (nucleocapsid protein, p7); SP2 (spacer peptide 2, pi) and p6 (King, Steven R.
  • pol polymerase encodes the viral enzymes: reverse transcriptase (RT), RNase H, integrase, and HIV protease (Votteler and Schubert, (2008) Human Immunodeficiency Viruses: Molecular Biology. Encyclopedia of Virology. (3rd ed.) 517- 525).
  • RT reverse transcriptase
  • RNase H RNase H
  • integrase integrase
  • HIV protease Votteler and Schubert, (2008) Human Immunodeficiency Viruses: Molecular Biology. Encyclopedia of Virology. (3rd ed.) 517- 525).
  • HIV protease is required to cleave the precursor Gag polyprotein to produce structural proteins; RT is required to transcribe DNA from RNA template; integrase integrates the double-stranded viral DNA into the host genome (Mushahwar (2007) Human Immunodeficiency Viruses: Molecular Virology, pathogenesis, diagnosis and treatment. Perspectives in Medical Virology. 13:75-87).
  • env (for "envelope") encodes gpl60, which is cleaved by cellular protease rather than viral to produce the surface lipoprotein gpl20 which attaches to the CD4 receptors present on lymphocytes and gp41 (transmembrane), proteins embedded in the viral envelope that enable the virus to attach to and fuse with target cells (Mushahwar, 2007, supra; King, 1994, supra).
  • nucleic acid and amino acid sequence for HIV genes and the proteins encoded thereby are known in the art for a variety of strains/isolates from the various known HIV types, groups, and subtypes. It is noted that variations may occur in the amino acid sequence between different viral isolates of the same protein or domain from HIV.
  • the guidance provided herein and the reference to the exemplary HIV sequences one of skill in the art will readily be able to produce a variety of HIV-based proteins, including fusion proteins, from any HIV type, group, subtype, genotype or strain (isolate), for use in the compositions and methods of the present invention, and as such, the invention is not limited to the specific sequences disclosed herein.
  • references to an HIV protein or HIV antigen anywhere in this disclosure, or to any functional, structural, or immunogenic domain thereof, can accordingly be made by reference to a particular sequence from one or more of the sequences presented in this disclosure, or by reference to the same, similar or corresponding sequence from a different HIV isolate (strain).
  • One embodiment of the invention relates to novel HIV antigens and fusion proteins and recombinant nucleic acid molecules encoding these antigens and proteins.
  • Described herein are several different novel HIV antigens for use in a yeast-based immunotherapeutic composition or other composition ⁇ e.g., other immunotherapeutic or diagnostic composition) that provide one or multiple (two, three, four, five, six, seven, eight, nine or more) antigens from one or more proteins, all contained within the same fusion protein and encoded by the same recombinant nucleic acid construct (recombinant nucleic acid molecule).
  • the antigens used in the compositions of the invention include at least one HIV protein or immunogenic domain thereof for immunizing an animal (prophylactically or therapeutically).
  • the composition can include one, two, three, four, a few, several or a plurality of HIV antigens, including one, two, three, four, five, six, seven, eight, nine, ten, or more immunogenic domains of one, two, three, four or more HIV proteins.
  • the antigen is a fusion protein.
  • fusion protein can include two or more proteins.
  • the fusion protein can include two or more immunogenic domains and/or two or more epitopes of one or more proteins.
  • An immunotherapeutic composition containing such antigens may provide antigen- specific immunization in a broad range of patients.
  • an antigen or fusion protein encompassed by the invention can include at least a portion of, or the full-length of, any one or more HIV proteins selected from: HIV Gag, HIV Env, or HIV Pol; and/or any one or more immunogenic domains of any one or more of these HIV proteins.
  • Other HIV proteins e.g., Nef, Vif, Vpr, Tat, Rev, Vpu
  • Recombinant nucleic acid molecules and the proteins encoded thereby, including fusion proteins, as one embodiment of the invention, may be used in yeast-based immunotherapy compositions, or for any other suitable purpose for HIV antigen(s), including in an in vitro assay, for the production of antibodies, or in another immunotherapy composition, including another vaccine, that is not based on the yeast- based immunotherapy described herein.
  • Expression of the proteins by yeast is one preferred embodiment, although other expression systems may be used to produce the proteins for applications other than a yeast-based immunotherapy composition.
  • the general use herein of the term "antigen” refers to any portion of a protein (peptide, partial protein, full-length protein), wherein the protein is naturally occurring or synthetically derived, to a cellular composition (whole cell, cell lysate or disrupted cells), to an organism (whole organism, lysate or disrupted cells) or to a carbohydrate, or other molecule, or a portion thereof.
  • An antigen may elicit an antigen-specific immune response (e.g., a humoral and/or a cell- mediated immune response) against the same or similar antigens that are encountered by an element of the immune system (e.g., T cells, antibodies).
  • An antigen can be as small as a single epitope, a single immunogenic domain or larger, and can include multiple epitopes or immunogenic domains.
  • the size of an antigen can be as small as about 8-12 amino acids (i.e., a peptide) and as large as: a full length protein, a multimer, a fusion protein, a chimeric protein, a whole cell, a whole microorganism, or any portions thereof (e.g., lysates of whole cells or extracts of microorganisms).
  • antigens can include carbohydrates, which can be loaded into a yeast vehicle or into a composition of the invention.
  • the antigen is expressed by the yeast vehicle from a recombinant nucleic acid molecule
  • the antigen is a protein, fusion protein, chimeric protein, or fragment thereof, rather than an entire cell or microorganism.
  • an antigen is of a minimum size capable of being expressed recombinantly in yeast, and is typically at least or greater than 25 amino acids in length, or at least or greater than 26, at least or greater than 27, at least or greater than 28, at least or greater than 29, at least or greater than 30, at least or greater than 31, at least or greater than 32, at least or greater than 33, at least or greater than 34, at least or greater than 35, at least or greater than 36, at least or greater than 37, at least or greater than 38, at least or greater than 39, at least or greater than 40, at least or greater than 41, at least or greater than 42, at least or greater than 43, at least or greater than 44, at least or greater than 45, at least or greater than 46, at least or greater than 47, at least or greater than 48, at least or greater than 49, or at least or greater than 50 amino acids in length, or is at least 25-50 amino acids in length, at least 30-50 amino acids in length, or at least 35-50 amino acids in length, or at least
  • a full-length protein, or a structural or functional domain thereof, or an immunogenic domain thereof, that is lacking one or more amino acids from the N- and/or the C-terminus may be expressed (e.g., lacking between about 1 and about 20 amino acids from the N- and/or the C-terminus).
  • Fusion proteins and chimeric proteins are also antigens that may be expressed in the invention.
  • a "target antigen” is an antigen that is specifically targeted by an immunotherapeutic composition of the invention (i.e., an antigen against which elicitation of an immune response is desired).
  • An "HIV antigen” is an antigen derived, designed, or produced from one or more HIV proteins such that targeting the antigen also targets the human immunodeficiency virus.
  • immunogen When referring to stimulation of an immune response, the term “immunogen” is a subset of the term “antigen”, and therefore, in some instances, can be used interchangeably with the term “antigen”.
  • An immunogen describes an antigen which elicits a humoral and/or cell-mediated immune response ⁇ i.e., is immunogenic), such that administration of the immunogen to an individual mounts an antigen-specific immune response against the same or similar antigens that are encountered by the immune system of the individual.
  • an immunogen elicits a cell-mediated immune response, including a CD4+ T cell response ⁇ e.g., TH1, TH2 and/or TH17) and/or a CD8+ T cell response ⁇ e.g., a CTL response).
  • a CD4+ T cell response e.g., TH1, TH2 and/or TH17
  • a CD8+ T cell response e.g., a CTL response
  • an immunogenic domain of a given antigen can be any portion, fragment or epitope of an antigen ⁇ e.g., a peptide fragment or subunit or an antibody epitope or other conformational epitope) that contains at least one epitope that acts as an immunogen when administered to an animal. Therefore, an immunogenic domain is larger than a single amino acid and is at least of a size sufficient to contain at least one epitope that can act as an im munogen. For example, a single protein ca n contain multiple different immunogenic domains. I mmunogenic domains need not be linear sequences within a protein, such as in the case of a humoral immune response, where conformational domains are contemplated.
  • a “functional domain” of a given protein is a portion or functional unit of the protein that includes sequence or structure that is directly or indirectly responsible for at least one biological or chemical function associated with, ascribed to, or performed by the protein.
  • a functional domain ca n include an active site for enzymatic activity, a ligand binding site, a receptor binding site, a binding site for a molecule or moiety such as calcium, a phosphorylation site, or a transactivation domain.
  • a "structural domain" of a given protein is a portion of the protein or an element in the protein's overall structure that has an identifiable structure ⁇ e.g., it may be a primary or tertiary structure belonging to and indicative of several proteins within a class or family of proteins), is self- stabilizing and/or may fold independently of the rest of the protein.
  • a structural domain is frequently associated with or features prominently in the biological function of the protein to which it belongs.
  • An epitope is defined herein as a single immunogenic site within a given antigen that is sufficient to elicit an immune response when provided to the immune system in the context of appropriate costimulatory signals and/or activated cells of the immune system. I n other words, an epitope is the part of an a ntigen that is actually recognized by components of the immune system, and may also be referred to as an antigenic determinant.
  • T cell epitopes are different in size and composition from B cell or antibody epitopes, and that epitopes presented through the Class I M HC pathway differ in size and structural attributes from epitopes presented through the Class II MHC pathway.
  • T cell epitopes presented by Class I MHC molecules are typically between 8 and 11 amino acids in length, whereas epitopes presented by Class I I M HC molecules are less restricted in length and may be from 8 amino acids up to 25 amino acids or longer.
  • T cell epitopes have predicted structural characteristics depending on the specific M HC molecules bound by the epitope. M ultiple different T cell epitopes have been identified in various HIV strains and for many human HLA types. Epitopes can be linear sequence epitopes or conformational epitopes (conserved binding regions). Most antibodies recognize conformational epitopes.
  • An HIV antigen useful in the present invention comprises one or more CTL epitopes (e.g., epitopes that are recognized by a T cell receptor of a cytotoxic T lymphocyte (CTL), when presented in the context of an appropriate Class I MHC molecule).
  • CTL cytotoxic T lymphocyte
  • the HIV antigen comprises one or more CD4+ T cell epitopes (e.g., epitopes that are recognized by a T cell receptor of a CD4+ T cell, in the context of an appropriate Class II MHC molecule).
  • the HIV antigen comprises one or more CTL epitopes and one or more CD4+ T cell epitopes.
  • the epitope can be modified to correspond to the sequence of the epitope within a type, group, subtype, genotype or strain/isolate of HIV, since there may be one or more amino acid differences at these epitopes among type, group, subtype, genotype or strain/isolate.
  • an HIV antigen useful in a yeast-based immunotherapeutic maximizes the inclusion of immunogenic domains, and particularly, T cell epitopes, that are conserved among HIV types, groups, subtypes, genotypes or strains/isolates, and/or includes immunogenic domains from several different types, groups, subtypes, genotypes or strains/isolates and/or includes immunogenic domains that can readily be modified to produce multiple yeast-based immunotherapeutic products that differ in some minor respects, but are tailored to treat different individuals or populations of individuals based on the HIV type, group, subtype, genotype or strain/isolate that infects such individuals or populations of individuals.
  • the HIV antigen can be produced based on an HIV-1 group(s) or subtype(s) that is most prevalent among individuals or populations of individuals to be protected or treated, and the HIV antigen includes the most conserved immunogenic domains from that group(s) or subtype(s).
  • immunogenic domains can be modified to correspond to a consensus sequence for that domain or epitope, or more than one version of the epitope can be included in the construct.
  • the inventors propose herein to improve the targeting of multi-dimensional regions of HIV in an immunotherapy approach by introducing Altered Peptide Ligand (APL) sites that, without being bound by theory, are believed by the inventors to further enhance an immune response in individuals who are not elite non- progressors, enabling or facilitating the ability of such individuals to mount a productive immune response against the most vulnerable targets in the virus.
  • APL Altered Peptide Ligand
  • any embodiment of the invention related to the design of an HIV antigen for a yeast-based immunotherapeutic composition in one aspect, artificial junctions between segments of a fusion protein comprising HIV antigens is minimized (i.e., the inclusion of non-natural sequences is limited or minimized to the extent possible).
  • yeast-based immunotherapeutic product of the invention allows the host immune system to process and present target antigens; accordingly, a fusion protein with many unnatural junctions may be less useful in a yeast-based immunotherapeutic as compared to one that retains more of the natural HIV protein sequences.
  • an N-terminal expression sequence and/or a C- terminal tag are optional, and if used, may be selected from several different sequences described below to improve expression, stability, and/or allow for identification and/or purification of the protein. In one aspect, one or both of the N- or C- terminal sequences are omitted altogether.
  • many different promoters suitable for use in yeast are known in the art and are encompassed for use to express HIV antigens according to the present invention.
  • short intervening linker sequences may be introduced between portions of the fusion protein for a variety of reasons, including the introduction of restriction enzyme sites to facilitate cloning and future manipulation of the constructs.
  • sequences described herein are exemplary, and may be modified as described in detail elsewhere herein to substitute, add, or delete sequences in order to accommodate preferences for HIV strain or isolate, or consensus sequences and inclusion of preferred T cell epitopes, including dominant and/or subdominant T cell epitopes.
  • proteins, including fusion proteins, which are used as a component of the yeast-based immunotherapeutic composition of the invention can be produced using constructs that are particularly useful for improving or enhancing the expression, or the stability of expression, of recombinant antigens in yeast.
  • the desired antigenic protein(s) or peptide(s) are fused at their amino-terminal (N-terminal) end to: (a) a specific synthetic peptide that stabilizes the expression of the fusion protein in the yeast vehicle or prevents posttranslational modification of the expressed fusion protein (such peptides are described in detail, for example, in U.S. Patent Publication No.
  • the present invention optionally includes the use of peptides that are fused to the C-terminus of the antigen-encoding construct, particularly for use in the selection and identification of the protein.
  • peptides include, but are not limited to, any synthetic or natural peptide, such as a peptide tag (e.g., hexahistidine) or any other short epitope tag.
  • Peptides attached to the C- terminus of an antigen according to the invention can be used with or without the addition of the N- terminal peptides discussed herein.
  • a synthetic peptide useful in a fusion protein is linked to the N-terminus of the antigen, the peptide consisting of at least two amino acid residues that are heterologous to the antigen, wherein the peptide stabilizes the expression of the fusion protein in the yeast vehicle or prevents posttranslational modification of the expressed fusion protein.
  • the synthetic peptide and N-terminal portion of the antigen together form a fusion protein that has the following requirements: (1) the amino acid residue at position one of the fusion protein is a methionine (i.e., the first amino acid in the synthetic peptide is a methionine); (2) the amino acid residue at position two of the fusion protein is not a glycine or a proline (i.e., the second amino acid in the synthetic peptide is not a glycine or a proline); (3) none of the amino acid residues at positions 2-6 of the fusion protein is a methionine (i.e., the amino acids at positions 2-6, whether part of the synthetic peptide or the protein, if the synthetic peptide is shorter than 6 amino acids, do not include a methionine); and (4) none of the amino acids at positions 2-6 of the fusion protein is a lysine or an arginine (i.e., the amino acids at positions 2-6, whether part of the synthetic peptide
  • the synthetic peptide can be as short as two amino acids, but in one aspect, is 2-6 amino acids (including 3, 4, 5 amino acids), and can be longer than 6 amino acids, in whole integers, up to about 200 amino acids, 300 amino acids, 400 amino acids, 500 amino acids, or more.
  • a fusion protein comprises an amino acid sequence of M-X2-X3-X4-X5-X6, wherein M is methionine; wherein X2 is any amino acid except glycine, proline, lysine or arginine; wherein X3 is any amino acid except methionine, lysine or arginine; wherein X4 is any amino acid except methionine, lysine or arginine; wherein X5 is any amino acid except methionine, lysine or arginine; and wherein X6 is any amino acid except methionine, lysine or arginine.
  • the X6 residue is a proline.
  • An exemplary synthetic sequence that enhances the stability of expression of an antigen in a yeast cell and/or prevents post- translational modification of the protein in the yeast includes the sequence M-A-D-E-A-P (SEQ. ID NO:15). Another exemplary synthetic sequence with the same properties is M-V.
  • these fusion partners do not appear to negatively impact the immune response against the immunizing antigen in the construct.
  • the synthetic fusion peptides can be designed to provide an epitope that can be recognized by a selection agent, such as an antibody.
  • the HIV antigen is linked at the N-terminus to a yeast protein, such as an alpha factor prepro sequence.
  • yeast protein such as an alpha factor prepro sequence.
  • Other sequences for yeast alpha factor prepro sequence are known in the art and are encompassed for use in the present invention.
  • HIV sequences used to design fusion proteins described herein are based on isolates of particular human immunodeficiency viruses. However, it is an embodiment of the invention to add to or substitute into any portion of an HIV antigen described herein that is based on or derived from one particular strain or isolate, with a corresponding sequence, or even a single or small amino acid substitution, insertion or deletion that occurs in a corresponding sequence, from any other HIV strain(s) or isolate(s).
  • an HIV antigen can be produced by substituting an entire sequence(s) of an HIV antigen described herein with the corresponding sequence(s) from one or more different HIV strain/isolates.
  • Adding to or substituting a sequence from one HIV strain for another allows for the customization of the immunotherapeutic composition for a particular individual or population of individuals (e.g., a population of individuals within a given country or region of a country, in order to target the HIV sequences that are most prevalent in that country or region of the country).
  • a "consensus sequence" is typically a sequence based on the most common nucleotide or amino acid at a particular position of a given sequence after multiple sequences are aligned.
  • an HIV antigen can be modified to change a T cell epitope in a given sequence from one isolate to correspond more closely or exactly with a T cell epitope from a different isolate, or to correspond more closely or exactly with a consensus sequence for the T cell epitope.
  • T cell epitopes can include dominant epitopes and/or sub-dominant epitopes. Alignments of major HIV proteins across exemplary sequences from various strains can be readily generated using publicly available software, which will inform the generation of consensus sequences, for example. Furthermore, consensus sequences for many HIV proteins have been published.
  • the HIV antigen(s) for use in a composition or method of the invention is a fusion protein comprising HIV antigens, wherein the HIV antigens comprise or consist of HIV Gag or at least one functional, structural or immunogenic domain thereof; HIV Pol or at least one functional, structural or immunogenic domain thereof; and/or HIV Env or at least one functional, structural or immunogenic domain thereof.
  • reference to a "full-length" protein includes the full-length amino acid sequence of the protein or functional domain, structural domain or immunological domain, as described herein or as otherwise known or described in a publicly available sequence.
  • General reference to a protein or domain can include both full- length and near full-length proteins, as well as other homologues thereof.
  • the HIV antigen comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the linear sequence of a full-length HIV protein, or of a functional, structural or immunogenic domain thereof.
  • the HIV antigen is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to a full-length HIV protein, or a functional, structural or immunogenic domain thereof.
  • yeast-based immunotherapeutic composition for HIV useful in the present invention is described herein.
  • yeast e.g., Saccharomyces cerevisiae
  • the HIV fusion protein is a single polypeptide with the following sequence elements fused in frame from N- to C-terminus, represented by 1) the amino acid sequence of AGA2 and 2) the a mino acid sequence of an HIV Gag.
  • sequence I D for H IV Gag is Genebank ref: AAB50258.1 and for AGA2 (NCBI ref: NM_001180897.3).
  • this fusion protein can be constructed using any of the N-terminal and/or C-terminal sequences as described herein, and/or amino acid linkers ca n be introduced between proteins or domains in the fusion protein.
  • the C-terminus of the fusion protein is modified to append a hexahistidine tag.
  • amino acid insertions, deletions, and/or substitutions can be made for one, two, three, four, five, six, seven, eight, nine, ten, or more amino acids of a wild- type or reference HIV protein, provided that the resulting HIV protein, when used as an antigen in a yeast- HIV immunotherapeutic composition of the invention, elicits an immune response against the target or wild-type or reference HIV protein, which may include an enhanced immune response, a diminished immune response, or a substantially similar immune response.
  • the invention includes the use of HIV agonist antigens (also referred to herein as "Altered Peptide Ligands” (APLs), which are HIV antigens that may include one or more T cell epitopes, and particularly, cytotoxic T lymphocyte (CTL) epitopes, that have been mutated by substitution of one or more amino acid residues for a different amino acid residue(s) to create an "agonist epitope”.
  • APLs HIV agonist antigens
  • CTL cytotoxic T lymphocyte
  • the purpose of the m utation is to elicit a T cell response against the HIV agonist epitope that is enhanced/amplified/improved as compared to the response against the native antigen, which may be achieved by improving the avidity or affinity of the epitope for an M HC molecule or for the T cell receptor that recognizes the epitope in the context of M HC presentation. HIV antigen agonists may therefore improve the potency or efficiency of a T cell response against native HIV proteins that infect a host.
  • the present invention includes multiple novel HIV antigens harboring HIV Altered Peptide Ligand (APL) mutations (HIV agonist epitopes). These mutations are incorporated into an HIV Gag antigen or fusion protein comprising an HIV Gag antigen that is expressed by a yeast-based immunotherapy composition for HIV and, upon immunization of a subject, are designed to generate improved, enhanced or amplified T cell responses against the HIV-infected target cells as compared to T cell responses generated by a yeast-based immunotherapeutic composition expressing natural (native, or wild-type) HIV Gag sequences. As discussed above, the improved T cell responses may be due to improved avidity or affinity of the T cell epitope(s) in the antigen for the MHC molecule or for the T cell receptor that recognizes the epitope in the context of the MHC molecule.
  • APL HIV Altered Peptide Ligand
  • APL variants of CTL epitopes are an emerging concept in cancer vaccines, wherein the target of the immunotherapy may be a self-antigen, where an effective vaccine must break immune tolerance.
  • Vaccination with APL peptides is one effective way to break tolerance.
  • APLs have been explored in CTL- inducing cancer vaccines, and also for use in enhancing antibody responses to infectious agents including HIV, the use of APLs or agonist peptides for CTL-inducing therapeutic vaccines targeting infectious diseases such as HIV ⁇ i.e., via a yeast-based immunotherapeutic of the invention) is believed to be a new concept unique to the present invention.
  • one embodiment of the present invention relates to a series of yeast-based immunotherapy compositions for HIV as described herein, in which the heterologous antigen expressed in the yeast is a highly conserved domain of HIV Gag with APL mutations at sites that are: i) highly invariant across HIV clades, and; ii) immunologically "vulnerable", on the basis that T cells targeting these sites are preferentially found in elite non-progressor patients ⁇ i.e., those that durably control HIV without medical intervention).
  • Some of these "vulnerable" HIV Gag residues were recently identified using a computational algorithm and when mutated, are predicted to destabilize the HIV capsid by disrupting Gag inter-subunit interactions (Dahirel et al., 2011, supra). The key role of these residues, termed “sector 3" residues (see discussion above), aligns with the observation that patients with T cells capable of targeting epitopes containing these residues control viral progression.
  • HIV elite non-progressors typically possess HLA types that are not the prevailing alleles in the general population.
  • An example of a prevailing allele in the general population and one which is present at relatively closely matched frequencies across multiple different races is HLA- A*0201. Therefore, the present inventor proposes that a yeast-based immunotherapeutic composition with the ability to induce high avidity T cell responses to sector 3 residues in patients with common HLA alleles such as HLA- A*0201 represent a powerful new approach to HIV immunotherapy.
  • H IV elite non-progressors bind MHC alleles other than the ubiquitous HLA-A*- 0201.
  • An additional facet included in the design of the HIV Gag-APL antigens of the invention therefore included the use of residues at key anchor positions that are preferred or at least compatible with binding to the HLA-A*0201.
  • Preferred HLA- A*0201 binding residues at upstream are L, M, and V, and tolerated residues at this position are T, Q, A, and I.
  • HLA-A*0201 binding residues at the C terminus are I, V, and L, and tolerated residues at the C terminus are M, T, and A (Sidney and Southwood et al 2001 Human I mmunology 62: 1200-1216).
  • One embodiment of the present invention relates to a yeast-based immunotherapy composition for HIV com prising at least one H IV Gag a ntigen (including full-length Gag and/or any functional, structural, or imm unogenic domain of H IV Gag) and incorporating at least one amino acid modification to create an APL epitope as described above.
  • the APL epitopes can be inserted by substitution into the native sequence of any of these Gag antigens, such that the APL epitope replaces the corresponding native sequence, and/or the APL epitopes, or HIV Gag sequence comprising one or more of the APL epitopes, can be added to any of the HIV antigens, thereby modifying the HIV antigen by addition (insertion).
  • H IV Gag antigens comprising SEQ I D NO :l
  • a yeast-based immunotherapy composition of the invention can include a yeast (e.g., Saccharomyces cerevisiae or boulardii) engineered to express a full-length H IV Gag protein represented by SEQ. I D NO:l.
  • this antigen ca n be constructed using any of the N-terminal and/or C-terminal sequences as described herein, and/or amino acid linkers ca n be introduced between proteins or domains in the fusion protein.
  • the C-terminus of the fusion protein is modified to append a hexahistidine tag.
  • Other similar and more complex fusion proteins constructed using the HIV antigens described herein a nd any one or more of the APL epitopes described herein are expressly encompassed by the invention and will be apparent to those skilled in the art based on the teachings provided herein.
  • the invention also includes homologues of any of the above-described fusion proteins, as well as the use of homologues, variants, or mutants of the individual HIV proteins or portions thereof (including any functional and/or immunogenic domains) that are part of such fusion proteins or otherwise described herein.
  • the invention includes the use of fusion proteins or individual (single) HIV proteins or HIV antigens, having amino acid sequences that are at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence of any one of the fusion proteins or individual HIV proteins or HIV antigens, respectively, described herein, including any of the HIV proteins, HIV antigens and fusion proteins referenced by a specific sequence identifier herein, over the full length of the fusion protein, or with respect to a defined segment in the fusion protein or a defined protein or domain thereof (immunogenic domain or functional domain (i.e., a domain with at least one biological activity)) that forms part of the fusion protein.
  • fusion proteins or individual (single) HIV proteins or HIV antigens having amino acid sequences that are at least 80%, 81%, 82%, 8
  • CTL epitopes epitopes that are recognized by cytotoxic T lymphocytes from patients infected with HIV
  • escape mutations mutations that arise in an HIV protein due to selective pressure from an anti-viral drug
  • this information can also be used to make substitutions or create variants or homologues of the HIV antigens described herein in order to provide a specific sequence in the HIV antigen of the invention.
  • HIV antigen comprising, consisting essentially of, or consisting of, an amino acid sequence represented by any one or more of SEQ. ID NO: 1.
  • the HIV antigen is suitable for use in any of the embodiments of the invention described herein, including in a yeast-based immunotherapy composition described herein.
  • the invention includes the use of at least one "yeast- based immunotherapeutic composition” (which phrase may be used interchangeably with "yeast-based immunotherapy product", “yeast-based immunotherapy composition”, “yeast- based composition”, “yeast-based immunotherapeutic", “yeast-based vaccine”, or derivatives of these phrases).
  • An "immunotherapeutic composition” is a composition that elicits an immune response sufficient to achieve at least one therapeutic benefit in a subject.
  • yeast-based immunotherapeutic composition refers to a composition that includes a yeast vehicle component and that elicits an immune response sufficient to achieve at least one therapeutic benefit in a subject.
  • a yeast-based immunotherapeutic composition is a composition that includes a yeast vehicle com ponent a nd ca n elicit or induce an immune response, such as a cellular immune response, including without limitation a T cell- mediated cellular immune response.
  • a yeast-based immunotherapeutic composition useful in the invention is capa ble of inducing a CD8 and/or a CD4 T cell-mediated immune response and in one aspect, a CD8 and a CD4 T cell-mediated immune response.
  • a yeast-based immunotherapeutic composition is capable of eliciting a humoral immune response.
  • a yeast-based immunotherapeutic composition useful in the present invention can, for example, elicit an immune response in an individua l such that the individual is protected from HIV infection and/or is treated for HIV infection or for symptoms resulting from HIV infection.
  • Yeast-based immunotherapy compositions of the invention may be either "prophylactic” or "therapeutic". When provided prophylactica lly, the compositions of the present invention are provided in advance of any symptom of HIV infection. Such a composition could be administered perinatally ⁇ e.g., to a mother before birth, which may followed by administration to the infant at or shortly after birth, for example to protect an infant of a mother who is or may have been infected with HIV), at or shortly after birth of an infant, in early childhood, in later childhood or adolescence, and/or to adults, particularly adults who may be at higher risk of becoming infected with HIV.
  • the prophylactic administration of the immunotherapy compositions serves to prevent subsequent HIV infection, to resolve an infection more quickly or more completely if HIV infection subsequently ensues, and/or to ameliorate the symptoms of HIV infection if infection subsequently ensues.
  • the immunotherapy compositions are provided at or after the onset of HIV infection, with the goal of ameliorating at least one symptom of the infection and preferably, with a goal of eliminating the infection, providing a long lasting remission of infection, and/or providing long term immunity against subsequent infections.
  • a yeast-based imm unotherapy composition includes a yeast vehicle and at least one antigen or immunogenic domain thereof expressed by, attached to, or mixed with the yeast vehicle, wherein the antigen is heterologous to the yeast, and wherein the a ntigen comprises one or more HIV antigens or immunogenic domains thereof.
  • the antigen or immunogenic domain thereof is provided as a fusion protein.
  • fusion protein can include two or more antigens.
  • the fusion protein can include two or more immunogenic domains of one or more antigens, or two or more epitopes of one or more antigens.
  • a yeast vehicle is any yeast cell (e.g., a whole or intact cell) or a derivative thereof (see below) that ca n be used in conjunction with one or more antigens, immunogenic domains thereof or epitopes thereof in a therapeutic composition of the invention, or in one aspect, the yeast vehicle can be used alone or as an adjuva nt.
  • the yeast vehicle can therefore include, but is not limited to, a live intact (whole) yeast microorganism (i.e., a yeast cell having all its components including a cell wall), a killed (dead) or inactivated intact yeast microorganism, or derivatives of intact/whole yeast including: a yeast spheroplast (i.e., a yeast cell lacking a cell wall), a yeast cytoplast (i.e., a yeast cell lacking a cell wall and nucleus), a yeast ghost (i.e., a yeast cell lacking a cell wall, nucleus and cytoplasm), a subcellular yeast membrane extract or fraction thereof (also referred to as a yeast membrane particle and previously as a subcellular yeast particle), any other yeast particle, or a yeast cell wall preparation.
  • a live intact (whole) yeast microorganism i.e., a yeast cell having all its components including a cell wall
  • a killed (dead) or inactivated intact yeast microorganism or
  • the yeast vehicle is a whole yeast.
  • the yeast is a "processed yeast” (described below; generally a yeast that has been ground up or processed in a manner to produce yeast cell wall preparations, yeast membrane particles and/or yeast fragments (i.e., not intact), as well as a soluble yeast proteins.
  • the yeast vehicle includes both a whole yeast and a processed yeast, administered either together, in concurrent but separate injections, or in sequential injections (e.g., temporally separated, which may include a prime -boost strategy).
  • Yeast spheroplasts are typically produced by enzymatic digestion of the yeast cell wall. Such a method is described, for example, in Franzusoff et a I, 1991, Meth. Enzymol. 194, 662-674., incorporated herein by reference in its entirety.
  • Yeast cytoplasts are typically produced by enucleation of yeast cells. Such a method is described, for example, in Coon, 1978, Natl. Cancer I nst. Monogr. 48, 45-55 incorporated herein by reference in its entirety.
  • Yeast ghosts are typically produced by resealing a permeabilized or lysed cell and can, but need not, contain at least some of the organelles of that cell.
  • a permeabilized or lysed cell can, but need not, contain at least some of the organelles of that cell.
  • Such a method is described, for example, in Franzusoff et a 1, 1983, J. Biol. Chem. 258, 3608-3614 and Bussey et al, 1979, Biochim. Biophys. Acta 553, 185-196, each of which is incorporated herein by reference in its entirety.
  • a yeast membrane particle refers to a yeast membrane that lacks a natural nucleus or cytoplasm.
  • the particle can be of any size, including sizes ranging from the size of a natural yeast membrane to microparticles produced by sonication or other membrane disruption methods known to those skilled in the art, followed by resealing.
  • a method for producing subcellular yeast membrane extracts is described, for example, in Franzusoff et al., 1991, Meth. Enzymol. 194, 662-674.
  • a yeast membrane particle is a recombinant yeast membrane particle that can be an intact, disrupted, or disrupted and resealed yeast membrane that includes at least one desired antigen or other protein of interest on the surface of the membrane or at least partially embedded within the membrane.
  • yeast cell wall preparation is a preparation of isolated yeast cell walls carrying an antigen on its surface or at least partially embedded within the cell wall such that the yeast cell wall preparation, when administered to an animal, stimulates a desired immune response against a disease target.
  • Yeast are unicellular microorganisms that belong to one of three classes: Ascomycetes, Basidiomycetes and Fungi Imperfecti.
  • One consideration for the selection of a type of yeast for use as an immune modulator is the pathogenicity of the yeast.
  • the yeast is a non-pathogenic strain such as Saccharomyces cerevisiae and Saccharomyces boulardii. The selection of a non-pathogenic yeast strain minimizes any adverse effects to the individual to whom the yeast vehicle is administered.
  • pathogenic yeast may be used if the pathogenicity of the yeast can be negated by any means known to one of skill in the art ⁇ e.g., mutant strains).
  • the S. cerevisiae strain is one such strain that is capable of supporting expression vectors that allow one or more target antigen(s) and/or antigen fusion protein(s) and/or other proteins to be expressed at high levels.
  • any mutant yeast strains can be used in the present invention, including those that exhibit reduced post-translational modifications of expressed target antigens or other proteins, such as mutations in the enzymes that extend N-linked glycosylation.
  • the yeast-based immunotherapy composition includes at least one antigen, immunogenic domain thereof, or epitope thereof.
  • the antigens contemplated for use in this invention include any HIV protein or immunogenic domain thereof, including mutants, variants and agonists of HIV proteins or domains thereof, against which it is desired to elicit an immune response for the purpose of prophylactically or therapeutically immunizing a host against HIV infection. HIV antigens that are useful in various embodiments of the invention are described in detail above, and elsewhere herein.
  • the yeast vehicle is manipulated such that the antigen is expressed or provided by delivery or translocation of an expressed protein product, partially or wholly, on the surface of the yeast vehicle (extracellular expression).
  • a spacer arm for positioning one or more protein(s) on the surface of the yeast vehicle.
  • a spacer arm can be used to create a fusion protein of the antigen(s) or other protein of interest with a protein that targets the antigen(s) or other protein of interest to the yeast cell wall.
  • one such protein that can be used to target other proteins is a yeast protein (e.g., cell wall protein 2 (cwp2), Aga2, Aga 1, Pir4 or Flol protein) that enables the antigen(s) or other protein to be targeted to the yeast cell wall such that the antigen or other protein is located on the surface of the yeast.
  • yeast protein e.g., cell wall protein 2 (cwp2), Aga2, Aga 1, Pir4 or Flol protein
  • Proteins other than yeast proteins may be used for the spacer arm; however, for any spacer arm protein, it is most desirable to have the immunogenic response be directed against the target antigen rather than the spacer arm protein.
  • the spacer arm protein that is used should not generate such a large immune response to the spacer arm protein itself such that the immune response to the target antigen(s) is overwhelmed.
  • Spacer arms can be constructed to have cleavage sites (e.g., protease cleavage sites) that allow the antigen to be readily removed or processed away from the yeast, if desired. Any known method of determining the magnitude of immune responses can be used (e.g., antibody production, lytic assays, etc.) and are readily known to one of skill in the art.
  • Another method for positioning the target antigen(s) or other proteins to be exposed on the yeast surface is to use signal sequences such as glycosylphosphatidyl inositol (GPI) to anchor the target to the yeast cell wall.
  • GPI glycosylphosphatidyl inositol
  • positioning can be accomplished by appending signal sequences that target the antigen(s) or other proteins of interest into the secretory pathway via translocation into the endoplasmic reticulum (ER) such that the antigen binds to a protein which is bound to the cell wall (e.g., cwp).
  • ER endoplasmic reticulum
  • the spacer arm protein is a yeast protein.
  • the yeast protein can consist of between about two and about 800 amino acids of a yeast protein. In one embodiment, the yeast protein is about 10 to 700 amino acids. In another embodiment, the yeast protein is about 40 to 600 amino acids. Other embodiments of the invention include the yeast protein being at least 250 amino acids, at least 300 amino acids, at least 350 amino acids, at least 400 amino acids, at least 450 amino acids, at least 500 amino acids, at least 550 amino acids, at least 600 amino acids, or at least 650 amino acids. In one embodiment, the yeast protein is at least 450 amino acids in length.
  • antigen and spacer arm combination should be expressed as a monomer or as dimer or as a trimer, or even more units connected together. This use of monomers, dimers, trimers, etc. allows for appropriate spacing or folding of the antigen such that some part, if not all, of the antigen is displayed on the surface of the yeast vehicle in a manner that makes it more immunogenic.
  • yeast proteins can stabilize the expression of fusion proteins in the yeast vehicle, prevents posttranslational modification of the expressed fusion protein, and/or targets the fusion protein to a particular compartment in the yeast (e.g., to be expressed on the yeast cell surface).
  • exemplary yeast proteins to use include, but are not limited to: Aga (including, but not limited to, Agal and/or Aga2); SUC2 (yeast invertase); alpha factor signal leader sequence; CPY; Cwp2p for its localization and retention in the cell wall; BUD genes for localization at the yeast cell bud during the initial phase of daughter cell formation; Flolp; Pir2p; and Pir4p.
  • yeast protein can be used for any of the embodiments above, for example, in the cytosol or the mitochondria or the endoplasmic reticulum or the nucleus.
  • suitable yeast protein that can be used for any of the embodiments above include, but are not limited to, TK, AF, SEC7; phosphoenolpyruvate carboxykinase PCK1, phosphoglycerokinase PGK and triose phosphate isomerase TPI gene products for their repressible expression in glucose and cytosolic localization; the heat shock proteins SSA1, SSA3, SSA4, SSC1, whose expression is induced and whose proteins are more thermostable upon exposure of cells to heat treatment; the mitochondrial protein CYC 1 for import into mitochondria; ACT1.
  • yeast vehicles Methods of producing yeast vehicles and expressing, combining and/or associating yeast vehicles with antigens and/or other proteins and/or agents of interest to produce yeast-based immunotherapy compositions are contemplated by the invention.
  • yeast vehicle-antigen complex or "yeast-antigen complex” is used generically to describe any association of a yeast vehicle with an antigen, and can be used interchangeably with "yeast-based immunotherapy composition” when such composition is used to elicit an immune response as described above.
  • association includes expression of the antigen by the yeast (a recombinant yeast), introduction of an antigen into a yeast, physical attachment of the antigen to the yeast, and mixing of the yeast and antigen together, such as in a buffer or other solution or formulation (e.g., a pharmaceutically acceptable excipient).
  • a yeast cell used to prepare the yeast vehicle is transfected with a heterologous nucleic acid molecule encoding a protein (e.g., the antigen) such that the protein is expressed by the yeast cell.
  • a yeast is also referred to herein as a recombinant yeast or a recombinant yeast vehicle.
  • the whole yeast cell, or a derivative or other modified vehicle produced from this yeast cell e.g., yeast spheroplasts, cytoplasts, ghosts, or subcellular particles
  • the yeast vehicle can then be loaded into a dendritic cell.
  • Yeast spheroplasts can also be directly transfected with a recombinant nucleic acid molecule (e.g., the spheroplast is produced from a whole yeast, and then transfected) in order to produce a recombinant spheroplast that expresses an antigen or other protein.
  • a recombinant nucleic acid molecule e.g., the spheroplast is produced from a whole yeast, and then transfected
  • the yeast vehicle and antigen(s) and/or other agents can be associated by any technique described herein.
  • the yeast vehicle was loaded intracellular ⁇ with the antigen(s) and/or agent(s).
  • the antigen(s) and/or agent(s) was covalently or non-covalently attached to the yeast vehicle.
  • the yeast vehicle and the antigen(s) and/or agent(s) were associated by mixing.
  • the antigen(s) and/or agent(s) is expressed recombinantly by the yeast vehicle or by the yeast cell or yeast spheroplast from which the yeast vehicle was derived.
  • a number of antigens and/or other proteins to be produced by a yeast vehicle of the present invention is any number of antigens and/or other proteins that can be reasonably produced by a yeast vehicle, and typically ranges from at least one to at least about 6 or more, including from about 2 to about 6 heterologous antigens and or other proteins.
  • nucleic acid molecule encoding at least one desired antigen or other protein is inserted into an expression vector in such a manner that the nucleic acid molecule is operatively linked to a transcription control sequence in order to be capable of effecting either constitutive or regulated expression of the nucleic acid molecule when transformed into a host yeast cell.
  • Nucleic acid molecules encoding one or more antigens and/or other proteins can be on one or more expression vectors operatively linked to one or more expression control sequences. Particularly important expression control sequences are those which control transcription initiation, such as promoter and upstream activation sequences.
  • Promoters for expression in Saccharomyces cerevisiae include, but are not limited to, promoters of genes encoding the following yeast proteins: alcohol dehydrogenase I (ADHI) or II (ADH2), CUP1, phosphoglycerate kinase (PGK), triose phosphate isomerase (TPI), translational elongation factor EF-1 alpha (TEF1), glyceraldehyde-3 -phosphate dehydrogenase (GAPDH; also referred to as TDH3, for triose phosphate dehydrogenase), galactokinase (GALI), galactose- 1 -phosphate uridyl- transferase (GAL7), UDP-galactose epimerase (GAL 10), cytochrome cl (CYCI), Sec7 protein (SEC7) and acid phosphat
  • ADHI alcohol dehydrogenase I
  • ADH2 phosphoglycerate kinase
  • Upstream activation sequences also referred to as enhancers
  • Upstream activation sequences for expression in Saccharomyces cerevisiae include, but are not limited to, the UASs of genes encoding the following proteins: PCKl, TPI, TDH3, CYCI, ADHI, ADH2, SUC2, GALI, GAL7 and GAL 10, as well as other UASs activated by the GAL4 gene product, with the ADH2 UAS being used in one aspect. Since the ADH2 UAS is activated by the ADR1 gene product, it may be preferable to overexpress the ADR1 gene when a heterologous gene is operatively linked to the ADH2 UAS.
  • Transcription termination sequences for expression in Saccharomyces cerevisiae include the termination sequences of the a-factor, GAPDH, and CYC1 genes.
  • Transcription control sequences to express genes in methyltrophic yeast include the transcription control regions of the genes encoding alcohol oxidase and formate dehydrogenase.
  • Transfection of a nucleic acid molecule into a yeast cell can be accomplished by any method by which a nucleic acid molecule ca n be introduced into the cell and includes, but is not limited to, diffusion, active transport, bath sonication, electroporation, microinjection, lipofection, adsorption, and protoplast fusion.
  • Transfected nucleic acid molecules ca n be integrated into a yeast chromosome or maintained on extrachromosomal vectors using techniques known to those skilled in the art. Examples of yeast vehicles carrying such nucleic acid molecules are disclosed in detail herein.
  • yeast cytoplast, yeast ghost, and yeast membrane particles or cell wall preparations can also be produced recombinantly by transfecting intact yeast microorganisms or yeast spheroplasts with desired nucleic acid molecules, producing the antigen therein, and then further manipulating the microorganisms or spheroplasts using techniques known to those skilled in the art to produce cytoplast, ghost or subcellular yeast membrane extract or fractions thereof containing desired antigens or other proteins.
  • Effective conditions for the production of recombinant yeast vehicles and expression of the antigen and/or other protein by the yeast vehicle include an effective medium in which a yeast strain can be cultured.
  • An effective medium is typically an aqueous medium comprising assimilable carbohydrate, nitrogen and phosphate sources, as well as appropriate salts, minerals, metals and other nutrients, such as vitamins and growth factors.
  • the medium may comprise complex nutrients or may be a defined minimal medium.
  • Yeast strains of the present invention can be cultured in a variety of containers, including, but not limited to, bioreactors, Erlenmeyer flasks, test tubes, microtiter dishes, and Petri plates. Culturing is carried out at a temperature, pH and oxygen content appropriate for the yeast strain. Such culturing conditions are well within the expertise of one of ordinary skill in the a rt (see, for example, Guthrie et al. (eds.), 1991, Methods in Enzymology, vol. 194, Academic Press, San
  • yeast are grown under neutral pH conditions.
  • neutral pH refers to a pH range between about pH 5.5 and about pH 8, and in one aspect, between about pH 6 and about 8.
  • neutral pH refers to a pH range between about pH 5.5 and about pH 8, and in one aspect, between about pH 6 and about 8.
  • the use of neutral pH to grow yeast cells means that the yeast cells a re grown in neutral pH for the majority of the time that they a re in culture.
  • yeast are grown in a medium maintained at a pH level of at least 5.5 (i.e., the pH of the culture medium is not allowed to drop below pH 5.5).
  • yeast are grown at a pH level maintained at about 6, 6.5, 7, 7.5 or 8.
  • a neutral pH in culturing yeast promotes several biological effects that are desirable characteristics for using the yeast as vehicles for immunomodulation.
  • culturing the yeast in neutral pH allows for good growth of the yeast without negative effect on the cell generation time (e.g., slowing of doubling time).
  • the yeast can continue to grow to high densities without losing their cell wall pliability.
  • the use of a neutral pH allows for the production of yeast with pliable cell wa lls and/or yeast that a re more sensitive to cell wall digesting enzymes (e.g., glucanase) at all harvest densities.
  • yeast with flexible cell walls can induce different or improved immune responses as compared to yeast grown under more acidic conditions, e.g., by promoting the secretion of cytokines by a ntigen presenting cells that have phagocytosed the yeast (e.g., TH I- type cytokines including, but not limited to, I FN- ⁇ , interleukin-12 (I L- 12), and I L-2, as well as proinflammatory cytokines such as I L-6).
  • cytokines e.g., TH I- type cytokines including, but not limited to, I FN- ⁇ , interleukin-12 (I L- 12), and I L-2, as well as proinflammatory cytokines such as I L-6.
  • the use of neutral pH for some antigens allows for release of the disulfide bonded a ntigen by treatment with dithiothreitol (DTT) that is not possible when such an antigen-expressing yeast is cultured in media at lower pH (e.g., pH 5).
  • DTT dithiothreitol
  • control of the amount of yeast glycosylation is used to control the expression of antigens by the yeast, particularly on the surface.
  • the amount of yeast glycosylation ca n affect the immunogenicity and antigenicity of the antigen expressed on the surface, since sugar moieties tend to be bulky. As such, the existence of sugar moieties on the surface of yeast and its impact on the three-dimensional space around the target antigen(s) should be considered in the modulation of yeast according to the invention. Any method can be used to reduce the amount of glycosylation of the yeast (or increase it, if desired).
  • yeast mutant strain that has been selected to have low glycosylation (e.g., mnnl, ochl and mnn9 mutants), or one could eliminate by mutation the glycosylation acceptor sequences on the target antigen.
  • a yeast with abbreviated glycosylation patterns e.g., Pichia.
  • a yeast vehicle is loaded intracellularly with the protein or peptide, or with carbohydrates or other molecules that serve as an antigen and/or are useful as immunomodulatory agents or biological response modifiers according to the invention. Subsequently, the yeast vehicle, which now contains the antigen and/or other proteins intracellularly, can be administered to an individual or loaded into a carrier such as a dendritic cell.
  • yeast vehicles that can be directly loaded with peptides, proteins, carbohydrates, or other molecules include intact yeast, as well as spheroplasts, ghosts or cytoplasts, which can be loaded with antigens and other agents after production.
  • intact yeast can be loaded with the antigen and/or agent, and then spheroplasts, ghosts, cytoplasts, or subcellular particles can be prepared therefrom.
  • antigens and/or other agents can be loaded into a yeast vehicle in this embodiment, from at least 1, 2, 3, 4 or any whole integer up to hundreds or thousands of antigens and/or other agents, such as would be provided by the loading of a microorganism or portions thereof, for example.
  • an antigen and/or other agent is physically attached to the yeast vehicle.
  • Physical attachment of the antigen and/or other agent to the yeast vehicle can be accomplished by any method suitable in the art, including covalent and non-covalent association methods which include, but are not limited to, chemically crosslinking the antigen and/or other agent to the outer surface of the yeast vehicle or biologically linking the antigen and/or other agent to the outer surface of the yeast vehicle, such as by using an antibody or other binding partner.
  • Chemical cross- linking can be achieved, for example, by methods including glutaraldehyde linkage, photoaffinity labeling, treatment with carbodiimides, treatment with chemicals capable of linking di-sulfide bonds, and treatment with other cross-linking chemicals standard in the art.
  • a chemical can be contacted with the yeast vehicle that alters the charge of the lipid bilayer of yeast membrane or the composition of the cell wall so that the outer surface of the yeast is more likely to fuse or bind to antigens and/or other agent having particular charge characteristics.
  • Targeting agents such as antibodies, binding peptides, soluble receptors, and other ligands may also be incorporated into an antigen as a fusion protein or otherwise associated with an antigen for binding of the antigen to the yeast vehicle.
  • the yeast vehicle and the antigen or other protein are associated with each other by a more passive, non-specific or non-covalent binding mechanism, such as by gently mixing the yeast vehicle and the antigen or other protein together in a buffer or other suitable formulation (e.g., admixture).
  • a more passive, non-specific or non-covalent binding mechanism such as by gently mixing the yeast vehicle and the antigen or other protein together in a buffer or other suitable formulation (e.g., admixture).
  • the yeast vehicle and the antigen or other protein are both loaded intracellular ⁇ into a carrier such as a dendritic cell or macrophage to form the therapeutic composition or vaccine of the present invention.
  • a recombinant yeast cell yeast that has been genetica lly engineered to express an antigen of the invention
  • yeast cell can be loaded into a dendritic cell as an intact cell, or the yeast cell can be killed, or it can be derivatized or otherwise modified such as by formation of yeast spheroplasts, cytoplasts, ghosts, or subcellular particles, any of which is followed by loading of the derivative into a dendritic cell.
  • an antigen or other protein can be loaded into a dendritic cell in the absence of the yeast vehicle.
  • intact yeast (with or without expression of heterologous antigens or other proteins) ca n be ground up or processed in a manner to produce yeast cell wall preparations, yeast membrane particles and/or yeast fragments (i.e., not intact), as well as a soluble yeast proteins.
  • yeast can be referred to herein as a “smashate” or "processed yeast”.
  • the processed yeast can, in some embodiments, be provided with or administered with one or more HIV antigens described herein, and/or in conjunction with other compositions that encode, include or have been in contact with HIV antigens (e.g., DNA vaccines, viral vector vaccines, protein subunit vaccines, autologous T cell vaccines, killed or inactivated pathogens, antibody vaccines) to enhance immune responses.
  • HIV antigens e.g., DNA vaccines, viral vector vaccines, protein subunit vaccines, autologous T cell vaccines, killed or inactivated pathogens, antibody vaccines
  • enzymatic treatment, chemical treatment or physical force e.g., mechanical shearing or sonication
  • mechanical shearing or sonication can be used to break up the yeast into parts that are used as an adjuvant.
  • yeast vehicles useful in the invention include yeast vehicles that have been killed or inactivated. Killing or inactivating of yeast can be accomplished by any of a variety of suitable methods known in the art. For example, heat inactivation of yeast is a standard way of inactivating yeast, and one of skill in the art can monitor the structural changes of the target antigen, if desired, by standard methods known in the art. Alternatively, other methods of inactivating the yeast can be used, such as chemical, electrical, radioactive or UV methods. See, for example, the methodology disclosed in standard yeast culturing textbooks such as Methods of Enzymology, Vol. 194, Cold Spring Harbor Publishing (1990).
  • yeast vehicles can be formulated into yeast-based immunotherapy compositions or products of the present invention, including preparations to be administered to a subject directly or first loaded into a carrier such as a dendritic cell, using a number of techniques known to those skilled in the art.
  • yeast vehicles can be dried by lyophilization.
  • Formulations comprising yeast vehicles can also be prepared by packing yeast in a cake or a tablet, such as is done for yeast used in baking or brewing operations.
  • yeast vehicles can be mixed with a pharmaceutically acceptable excipient, such as an isotonic buffer that is tolerated by a host or host cell.
  • excipients include water, saline, Ringer's solution, dextrose solution, Hank's solution, and other aqueous physiologically balanced salt solutions.
  • Nonaqueous vehicles such as fixed oils, sesame oil, ethyl oleate, or triglycerides may also be used.
  • Other useful formulations include suspensions containing viscosity-enhancing agents, such as sodium carboxymethylcellulose, sorbitol, glycerol or dextran.
  • Excipients can also contain minor amounts of additives, such as substances that enhance isotonicity and chemical stability.
  • buffers examples include phosphate buffer, bicarbonate buffer and Tris buffer
  • preservatives include thimerosal, m- or o-cresol, formalin and benzyl alcohol.
  • Standard formulations can either be liquid injectables or solids which can be taken up in a suitable liquid as a suspension or solution for injection.
  • the excipient in a non-liquid formulation, can comprise, for example, dextrose, human serum albumin, and/or preservatives to which sterile water or saline can be added prior to administration.
  • a composition can include additional agents, which may also be referred to as biological response modifier compounds, or the ability to produce such agents/modifiers.
  • additional agents which may also be referred to as biological response modifier compounds, or the ability to produce such agents/modifiers.
  • a yeast vehicle can be transfected with or loaded with at least one antigen and at least one agent/biological response modifier compound, or a composition of the invention can be administered in conjunction with at least one agent/biological response modifier.
  • Biological response modifiers include adjuvants and other compounds that can modulate immune responses, which may be referred to as immunomodulatory compounds, as well as compounds that modify the biological activity of another compound or agent, such as a yeast-based immunotherapeutic, such biological activity not being limited to immune system effects.
  • Certain immunomodulatory compounds can stimulate a protective immune response whereas others can suppress a harmful immune response, and whether an immunomodulatory is useful in combination with a given yeast-based immunotherapeutic may depend, at least in part, on the disease state or condition to be treated or prevented, and/or on the individual who is to be treated.
  • Certain biological response modifiers preferentially enhance a cell-mediated immune response whereas others preferentially enhance a humoral immune response (i.e., can stimulate an immune response in which there is an increased level of cell-mediated compared to humoral immunity, or vice versa.).
  • Certain biological response modifiers have one or more properties in common with the biological properties of yeast-based immunotherapeutics or enhance or complement the biological properties of yeast-based immunotherapeutics.
  • Agents/biological response modifiers useful in the invention may include, but are not limited to, cytokines, chemokines, hormones, lipidic derivatives, peptides, proteins, polysaccharides, small molecule drugs, antibodies and antigen binding fragments thereof (including, but not limited to, anti-cytokine antibodies, anti-cytokine receptor antibodies, anti-chemokine antibodies), vitamins, polynucleotides, nucleic acid binding moieties, aptamers, and growth modulators.
  • Agents useful in combination with a yeast-based immunotherapy composition in accordance with the invention include, but are not limited to: anti-CD40, CD40L, lymphocyte- activation gene 3 (LAG3) protein and/or IMP321 (T- cell immuno-stimulatory factor derived from the soluble form of LAG3), anti-CTLA-4 antibody (e.g., to release anergic T cells); T cell co - stimulators (e.g., anti-CD137, anti- CD28, anti-CD40); alemtuzumab (e.g., CamPath ® ), denileukin diftitox (e.g., ONTAK ® ); anti-CD4; anti-CD25; anti-PD-1, anti-PD-LI, anti-PD-L2; agents that block FOXP3 (e.g., to abrogate the activity/kill CD4+/CD25+ T regulatory cells); Flt3 ligand, imiquimod (AldaraTM), Toll-like receptor
  • any combination of such agents is contemplated by the invention, and any of such agents combined with or administered in a protocol with (e.g., concurrently, sequentially, or in other formats with) a yeast-based immunotherapeutic is a composition encom passed by the invention.
  • Such agents are well known in the art. These agents may be used alone or in combination with other agents described herein.
  • one or more therapies ca n be administered or performed prior to the first dose of yeast-based immunotherapy composition or after the first dose is administered.
  • Agents can include agonists and antagonists of a given protein or peptide or domain thereof.
  • an "agonist” is any compound or agent, including without limitation small molecules, proteins, peptides, antibodies, nucleic acid binding agents, etc., that binds to a receptor or ligand and produces or triggers a response, which may include agents that mimic the action of a naturally occurring substance that binds to the receptor or ligand.
  • An "antagonist” is any compound or agent, including without limitation small molecules, proteins, peptides, antibodies, nucleic acid binding agents, etc., that blocks or inhibits or reduces the action of an agonist.
  • compositions of the invention ca n further include or ca n be administered with (concurrently, sequentially, or intermittently with) any other compounds or compositions that a re useful for preventing or treating HIV infection or any compounds that treat or ameliorate any symptom of HIV infection.
  • agents are known to be useful for treating or ameliorating HIV infection. Such agents are described in detail elsewhere herein and include, but are not limited to, anti-viral compounds, including fixed-dose combinations (FDCs). These agents are typically administered for long periods of time (e.g., daily for the lifetime of the patient).
  • compositions of the invention ca n be used together with other immunotherapeutic compositions, including prophylactic and/or therapeutic immunotherapy, such compositions include, but are not limited to, DNA vaccines, dendritic cell vaccines, viral vector vaccines, protein subunit vaccines, autologous T cell vaccines, killed or inactivated pathogens, and/or antibody vaccines.
  • Compositions of the invention can also be administered or used together with biological response modifiers (described above), many of which have immunomodulatory properties (e.g., anti-PD-1 , anti-CTLA-4, etc.).
  • the invention also includes a kit comprising any of the compositions described herein, or any of the individual components of the compositions described herein.
  • compositions of the invention which can include any one or more ⁇ e.g., combinations of two, three, four, five, or more) yeast-based immunotherapeutic compositions described herein, HIV antigens including HIV proteins and fusion proteins, and/or recombinant nucleic acid molecules encoding such HIV proteins or fusion proteins described above, and other compositions comprising such yeast-based compositions, antigens, proteins, fusion proteins, or recombinant molecules described herein, can be used in a variety of in vivo and in vitro methods, including, but not limited to, to treat and/or prevent HIV infection and its sequelae, in diagnostic assays for HIV, or to produce antibodies against HIV.
  • One embodiment of the invention relates to a method to treat human immunodeficiency virus (HIV) infection, and/or to prevent, ameliorate or treat at least one symptom of HIV infection, in an individual or population of individuals.
  • the method includes the step of administering to an individual or a population of individuals who are infected with HIV one or more immunotherapeutic compositions of the invention.
  • the composition is an immunotherapeutic composition comprising one or more HIV antigens as described herein, which can include a yeast-based immunotherapeutic composition.
  • the composition includes a protein or fusion protein comprising HIV antigens as described herein, and/or recombinant nucleic acid molecule encoding such protein or fusion protein.
  • the individual or population of individuals has HIV infection.
  • the individual or population of individuals is additionally treated with at least one other therapeutic compound and/or additional composition useful for the treatment of HIV infection.
  • therapeutic compounds and/or additional compositions include, but are not limited to, direct- acting antiviral drugs ⁇ e.g., those described above or elsewhere herein, including, but not limited to, FDC drugs) and/or other immunotherapeutic or immunomodulatory agents, including, but not limited to, DNA vaccines ⁇ i.e., nucleic acid based vaccines encoding HIV antigens), viral vector vaccines ⁇ e.g., virus-based vectors encoding HIV antigens), dendritic cell vaccines ⁇ e.g., dendritic cells comprising HIV antigens, including dendritic cells comprising yeast expressing or carrying HIV antigens), protein subunit vaccines ⁇ e.g., recombinant HIV proteins), autologous T cell vaccines ⁇ e.g., T cells isolated from an individual and stimulated ex vivo, for example, with HIV antigens or other
  • SOC Standard Of Care
  • SOC generally refers to the current approved standard of care for the treatment of a specific disease.
  • SOC may be one of several different approved therapeutic protocols, and includes, but may not be limited to, anti-viral therapy.
  • FDAs fixed dose combination
  • cross-class drugs provided as a single pill taken once daily.
  • FDCs include, but are not limited to: ATRIPLA ® (tenofovir disoproxil fumarate/emtricitabine/efavirenz: tenofovir/NRTI + emtricitabine/NRTI, with efavirenz (a non- nucleoside reverse transcriptase inhibitor (NNRTI) from Bristol Myers-Squibb), Gilead Sciences, Inc.); COMPLERA ® (tenofovir disoproxil fumarate/emtricitabine/rilpivirine: tenofovir/NRTI + emtricitabine/NRTI, with rilpivirine (a NNRTI from Tibotec/Johnson & Johnson), Gilead Sciences, Inc.); and STRIBILD/OUAD ® (tenofovir disoproxil fumarate/emtricitabine/elvitegravir/cobicistat: tenofovir/NRTI + emtricitabine/NRTI, with cobic
  • the immunotherapeutic composition of the invention can be administered prior to, concurrently with, intermittently with, and/or after one or more anti-viral(s) and/or other immunotherapeutic or immunomodulatory agents.
  • the other therapeutic compounds may also be administered prior to or after treatment with the immunotherapeutic compositions of the invention.
  • a yeast-based HIV immunotherapy composition of the invention is administered concurrently or sequentially (including in a prime-boost strategy) with a second immunotherapy composition that enhances a humoral immune response to HIV antigens.
  • a second immunotherapy composition that enhances a humoral immune response to HIV antigens.
  • the yeast-based HIV immunotherapy composition is provided in the form of a whole, recombinant yeast expressing one or more HIV antigens
  • the immune response generated by this composition is primarily cellular in nature (e.g., elicits T cell responses), although priming of a humoral immune response also occurs.
  • compositions together with yeast-based immunotherapy that are particularly suited to enhance humoral immune responses.
  • Such compositions may include, but are not limited to: a processed yeast immunotherapy composition comprising H IV antigens (described elsewhere herein), a protein subunit vaccine expressing or otherwise comprising HIV antigens, or a DNA or viral vector vaccine expressing HIV antigens.
  • a whole recombinant yeast expressing one or more HIV antigens as described herein is administered concurrently with a processed yeast comprising one or more HIV antigens as described herein, either together in a single injection or in separate injections.
  • a whole recombinant yeast expressing one or more HIV antigens as described herein is administered sequentially (e.g., in a prime-boost strategy) with a processed yeast comprising one or more HIV antigens as described herein.
  • the processed yeast comprising one or more HIV antigens may also be included in the priming dose with the whole recombinant yeast expressing one or more HIV antigens.
  • a DNA vaccine encoding HIV antigen(s) is utilized in a prime-boost protocol with one or more yeast-based immunotherapy compositions.
  • DNA vaccines using in vivo electroporation have been used to elicit cellular immune responses in a variety of studies of viral disease including HIV, and may include boosters using viral vectors (see, e.g., Catanzaro et a I, J I nfect Dis 2006;194: 1638-1649).
  • viral vector immunotherapy and DNA immunotherapy are known to suffer from neutralization of the vaccine over time/repeated administrations.
  • Yeast-based immunotherapy does not suffer from neutralization effects and can be administered multiple times over long periods.
  • the yeast-based H IV immunothera py composition is a whole recombinant yeast expressing one or more HIV antigens as described herein.
  • the yeast-based HIV immunotherapy composition is a processed yeast comprising one or more H IV antigens as described herein.
  • the yeast-based H IV immunotherapy composition is a combination of a whole recombinant yeast expressing one or more HIV antigens as described herein and a processed yeast comprising one or more HIV antigens as described herein, wherein the whole yeast and the processed yeast are administered concurrently in a single injection or in separate injections. Additional therapeutic compounds and/or compositions may be further included in this method as described herein (e.g., anti-viral therapy, additional types of boosters such as protein subunit vaccines, immunomodulatory biological response modifiers, etc.).
  • a yeast-based HIV immunotherapy composition of the invention is loaded into a dendritic cell ex vivo to form a dendritic cell vaccine.
  • dendritic cells from a subject to be treated can be isolated from the subject, loaded with a yeast- based HIV immunotherapy composition of the invention, and then returned to the subject.
  • T cells isolated from the subject may be stimulated ex vivo with the same yeast-based HIV immunotherapy composition (and/or another immunotherapy composition or immunomodulator/bio logical response modifier) and also returned to the subject.
  • Dendritic cells are cells of monocyte and lymphocyte lineages, and are known to be the most potent antigen presenting cell (APC) and to stimulate antigen-specific T cell responses. Mature dendritic cells are typically identified as having the following cell surface marker phenotype: CD80+, CD86+, CD40low, CD54+, MHC Class I and MHC Class II, and are capable of FITC-dextran uptake.
  • the dendritic cell used in the composition of the present invention is preferably isolated from a patient to which the composition is to be administered ⁇ i.e., autologous cells). Dendritic cells can be isolated from the bone marrow or peripheral blood.
  • Such cells can be generated, for example, from peripheral blood monocytes by culture in the presence of granulocyte macrophage colony-stimulating factor, IL-4, and TNF", for example.
  • granulocyte macrophage colony-stimulating factor IL-4, and TNF
  • Other methods for isolating and generating dendritic cells are known in the art (See, for example, Wilson et a I, 1999, J Immunol 162: 3070-8; Romani et a I, 1994, J Exp Med 180: 83-93; Caux et al, 1996, J Exp Med 184: 695-706; and Kiertscher et a I, 1996, J Leukoc Biol 59: 208-18, each of which is incorporated herein by reference in its entirety).
  • a therapeutic composition effective to administer to a patient contains from about 0.5 x 10 6 to about 40 x 10 6 dendritic cells per single dose per individual patient.
  • a therapeutic composition contains from about 1 x 10 6 to about 20 x 10 6 dendritic cells per single dose per patient, and in another embodiment, from about 1 x 10 6 to about 10 x 10 6 dendritic cells per single dose per patient. These doses are given for a typical human or other primate.
  • Loading techniques include, but are not limited to: diffusion, active transport, liposome fusion, electroporation, phagocytosis, and bath sonication.
  • passive mechanisms for loading a dendritic cell with the yeast vehicle and/or antigen are used, such passive mechanisms including phagocytosis of the yeast vehicle and/or antigen by the dendritic cell.
  • Another embodiment of the invention relates to a method to immunize an individual or population of individuals against HIV in order to prevent HIV infection and/or reduce the severity of HIV infection in the individual or population of individuals.
  • the method includes the step of administering to an individual or population of individuals that is not infected with HIV (or believed not to be infected with HIV), a composition of the invention.
  • the composition is an immunotherapeutic composition comprising one or more HIV antigens as described herein, including one or more yeast-based immunotherapeutic compositions.
  • the composition includes a fusion protein comprising HIV antigens as described herein, or recombinant nucleic acid molecule encoding such fusion protein.
  • the phrase "treat" HIV infection, or any permutation thereof generally refers to applying or administering a composition of the invention once the infection (acute or chronic) has occurred, with the goal of reduction or elimination of detectable viral titer or viral load; reduction in at least one symptom resulting from the infection in the individual; delaying or preventing the onset and/or severity of symptoms and/or downstream sequelae caused by the infection (e.g., development of AIDS and diseases or conditions associated with AIDS); reduction of organ or physiological system damage resulting from the infection; improvement of immune responses against the virus; improved CD4+ T cell counts; improvement of long term memory immune responses against the virus; reduced reactivation of virus; reduction in the frequency, duration and/or amount of HAART or similar therapies needed to achieve long term remission; and/or improved general health of the individual or population of individuals.
  • a method to treat HIV according to the present invention results in a "functional cure” (i.e., containment of HIV replication and prevention of disease in the absence of ongoing treatment).
  • a composition of the invention before an infection with HIV has occurred, with the goal of preventing infection by HIV, or, should the infection later occur, at least reducing the severity, and/or length of infection and/or the physiological damage caused by the infection, including preventing or reducing the severity or incidence of at least one symptom resulting from the infection in the individual, and/or delaying or preventing the onset and/or severity of symptoms and/or downstream sequelae caused by the infection, in an individua l or population of individuals.
  • the present invention includes the delivery (administration, immunization) of one or more immunotherapeutic compositions of the invention, including a yeast-based immunotherapy composition, to a subject.
  • the administration process can be performed ex vivo or in vivo, but is typically performed in vivo.
  • Ex vivo administration refers to performing part of the regulatory step outside of the patient, such as administering a composition of the present invention to a population of cells (e.g., dendritic cells) removed from a patient under conditions such that a yeast vehicle, antigen(s) and any other agents or compositions are loaded into the cell, and returning the cells to the patient.
  • the therapeutic composition of the present invention can be returned to a patient, or administered to a patient, by any suitable mode of administration.
  • compositions ca n be systemic, mucosal and/or proximal to the location of the ta rget site (e.g., near a site of infection). Suitable routes of administration will be apparent to those of skill in the art, depending on the type of condition to be prevented or treated, the antigen used, and/or the target cell population or tissue.
  • Various acceptable methods of administration include, but are not limited to, intravenous administration, intraperitoneal administration, intramuscular administration, intranodal administration, intracoronary administration, intraarterial administration (e.g., into a carotid artery), subcutaneous administration, transdermal delivery, intratracheal administration, intraarticular administration, intraventricular administration, inhalation (e.g., aerosol), intracranial, intraspinal, intraocular, aural, intranasal, oral, pulmonary administration, impregnation of a catheter, and direct injection into a tissue.
  • routes of administration include: intravenous, intraperitoneal, subcutaneous, intradermal, intranodal, intramuscular, transdermal, inhaled, intranasal, oral, intraocular, intraarticular, intracranial, and intraspinal.
  • Parenteral delivery can include intradermal, intramuscular, intraperitoneal, intrapleural, intrapulmonary, intravenous, subcutaneous, atrial catheter and venal catheter routes.
  • Aural delivery ca n include ear drops
  • intranasal delivery can include nose drops or intranasal injection
  • intraocular delivery can include eye drops.
  • Aerosol (inhalation) delivery can also be performed using methods standard in the art (see, for example, Stribling et a I, Proc.
  • an immunotherapeutic composition of the invention is administered subcutaneously.
  • a suitable single dose is a dose that is capable of effectively providing a yeast vehicle and an antigen (if included) to a given cell type, tissue, or region of the patient body in an amount effective to elicit an antigen-specific immune response against one or more HIV antigens or epitopes, when administered one or more times over a suitable time period.
  • a single dose of a yeast vehicle of the present invention is from about 1 x 10 5 to about 5 x 10 7 yeast cell equivalents per kilogram body weight of the organism being administered the composition.
  • a single dose of a yeast vehicle of the present invention is from about 0.1 Y.U.
  • doses include doses between 1 Y.U and 40 Y.U., doses between 1 Y.U. and 50 Y.U., doses between 1 Y.U. and 60 Y.U., doses between 1 Y.U. and 70 Y.U., or doses between 1 Y.U. and 80 Y.U., and in one aspect, between 10 Y.U.
  • the doses are administered at different sites on the individual but during the same dosing period.
  • a 40 Y.U. dose may be administered via by injecting 10 Y.U. doses to four different sites on the individual during one dosing period, or a 20 Y.U. dose may be administered by injecting 5 Y.U. doses to four different sites on the individual, or by injecting 10 Y.U. doses to two different sites on the individual, during the same dosing period.
  • the invention includes administration of an amount of the yeast-based immunotherapy composition ⁇ e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 Y.U. or more) at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different sites on an individual to form a single dose.
  • the composition is administered orally.
  • Boosters or “boosts” of a therapeutic composition are administered, for example, when the immune response against the antigen has waned or as needed to provide an immune response or induce a memory response against a particular antigen or antigen(s).
  • Boosters can be administered from about 1, 2, 3, 4, 5, 6, 7, or 8 weeks apart, to monthly, to bimonthly, to quarterly, to annually, to several years after the original administration.
  • an administration schedule is one in which from about 1 x 10 5 to about 5 x 10 7 yeast cell equivalents of a com position per kg body weight of the organism is administered at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more times over a time period of from weeks, to months, to years.
  • the doses are administered weekly for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more doses, followed by monthly doses as needed to achieve the desired inhibition or elimination of the HIV virus.
  • the doses are administered in a 4-weekly protocol (every 4 weeks, or on day 1, week 4, week 8, week 12, etc., for between 2 and 10 doses or longer as determined by the clinician). Additional doses ca n be administered even after the individual achieves seroconversion, if desired, although such dosing may not be necessary.
  • a different (non- yeast-based) immunotherapeutic composition such as a DNA vaccine expressing HIV antigen(s)
  • a yeast-based HIV immunotherapeutic composition of the invention is used to boost the immune response.
  • a yeast-based immunotherapeutic composition of the invention comprising a whole yeast that recombinantly expresses one or more HIV antigens described herein is used to prime the immune system of a subject, alone or together with a yeast-based immunotherapeutic composition comprising a processed yeast (preferably including one or more HIV antigens, which may be the same antigens as used in the priming dose), followed by additional administrations of the processed yeast as a booster.
  • the booster dose can include, but is not limited to, any other immunotherapeutic composition, including compositions that particularly enhance humoral immune responses, such as a subunit vaccine or an antibody vaccine.
  • yeast-based immunotherapeutic compositions described herein With respect to administration of yeast-based immunotherapeutic compositions described herein, a single composition can be administered to an individual or population of individuals or combinations of such compositions ca n be administered. Accordingly, two or more compositions can be selected in a "spice rack" approach to most effectively prevent or treat HIV infection in a given individual or population of individuals.
  • This approach ca n include the administration of different HIV antigens in the context of different yeast-based immunotherapy compositions of the invention (e.g., the use of two or more different yeast-based compositions, each including a different HIV antigen(s)), and/or, within the same protocol, the administration of various forms of the yeast-based immunotherapeutic composition of the invention (e.g., whole recombinant yeast and processed yeast, each including the same or different HIV antigen(s)), and/or, within the same protocol, the use of yeast-based immunotherapeutic compositions with other types of compositions (e.g., other immunotherapy compositions such as autologous T cell vaccines, dendritic cell vaccines, antibody vaccines, subunit vaccines, DNA vaccines; biological response modifiers (described above); small molecule drugs such as a anti- virals, etc.).
  • yeast-based immunotherapeutic compositions e.g., whole recombinant yeast and processed yeast, each including the same or different HIV antigen(s)
  • one or more additional therapeutic agents, compounds or compositions are administered sequentially with the yeast-based immunotherapy composition.
  • one or more additional therapeutic agents are administered before the yeast-based immunotherapy composition is administered.
  • one or more additional therapeutic agents, compounds or compositions are administered after the yeast-based immunotherapy composition is administered.
  • one or more additional therapeutic agents, compounds or compositions are administered in alternating doses with the yeast-based immunotherapy composition, or in a protocol in which the yeast-based composition is administered at prescribed intervals in between or with one or more consecutive doses of the additional therapeutic agents, compounds or compositions, or vice versa.
  • one or more additional therapeutic agents are administered together with the yeast-based immunotherapy composition (e.g., together in the same composition or concurrently as separate compositions).
  • the yeast-based immunotherapy composition is administered in one or more doses over a period of time prior to commencing the administration of the additional therapeutic agents, compounds or compositions.
  • the yeast-based immunotherapeutic composition is administered as a monotherapy for a period of time, and then the therapeutic agents, compounds or compositions are added, either concurrently with new doses of yeast-based immunotherapy, or in an alternating fashion with yeast- based immunotherapy.
  • the therapeutic agents, compounds or compositions may be administered for a period of time prior to beginning administration of the yeast- based immunotherapy composition.
  • the yeast is engineered to express or carry the agent, or a different yeast is engineered or produced to express or carry the agent or compound.
  • additional doses of the immunotherapeutic composition are administered over the same period of time, or for at least a portion of that time, and may continue to be administered once the course of anti-viral compound has ended.
  • the dosing schedule for the immunotherapy over the entire period may be, and is expected to typically be, different than that for the anti-viral compound.
  • the immunotherapeutic composition may be administered daily, weekly, biweekly, monthly, bimonthly, or every 3-6 months, or at longer intervals as determined by the physician, and is most typically administered weekly followed by monthly or monthly, where current anti-virals for HIV are administered daily.
  • the immunotherapeutic composition is preferably administered weekly for between 4 and 12 weeks, followed by monthly administration (regardless of when the anti-viral therapy is added into the protocol).
  • the immunotherapeutic composition is administered weekly for four or five weeks, followed by monthly administration thereafter, until conclusion of the complete treatment protocol.
  • an immunotherapeutic composition and other agents, compounds or compositions can be administered together (concurrently).
  • concurrent use does not necessarily mean that all doses of all compounds are administered on the same day at the same time. Rather, concurrent use means that each of the therapy components (e.g., immunotherapy and anti-viral therapy) are started at approximately the same period (within hours, or up to 1-7 days of each other) and are administered over the same general period of time, noting that each component may have a different dosing schedule (e.g., immunotherapy monthly, anti-viral daily).
  • any one of the agents or immunotherapeutic compositions can be administered without the other agent(s).
  • anti-viral refers to any compound or drug, typically a small-molecule inhibitor or antibody, which targets one or more steps in the virus life cycle with direct anti-viral therapeutic effects.
  • the anti-viral compound or drug to be administered in the same therapeutic protocol with an immunotherapeutic composition of the invention is selected from: non-nucleoside reverse transcriptase inhibitors ( NRTI), nucleoside analogue reverse transcriptase inhibitors (NRTIs), integrase inhibitors and entry inhibitors.
  • Typical NRTIs include, but are not limited to: zidovudine (AZT) or tenofovir (TDF) and lamivudine (3TC) or emtricitabine (FTC).
  • the anti-viral compound is a fixed dose combination (FDCs), comprised of cross-class drugs provided as a single pill taken once daily.
  • FDCs include, but are not limited to: ATRI PLA ® (tenofovir disoproxil fumarate/emtricitabine/efavirenz: tenofovir/NRTI + emtricitabine/NRTI, with efavirenz (a non- nucleoside reverse transcriptase inhibitor (NNRTI) from Bristol Myers- Squibb), Gilead Sciences, I nc.), COM PLERA ® (tenofovir disoproxil fumarate/emtricitabine/rilpivirine: tenofovir/N RTI + emtricitabine/N RTI, with rilpivirine (a NN RTI from Tibotec/Johnson & Johnson), Gilead Sciences, I nc.); STRIBI LD/Q.UAD ® (tenofovir disoproxil fumarate/emtricitabine/elvitegravir/cobicistat: tenofovir/NRTI +
  • compositions and therapeutic compositions can be administered to animal, including any vertebrate, and particularly to any member of the Vertebrate class, Mammalia, including, without limitation, primates, rodents, livestock and domestic pets.
  • Livestock include mammals to be consumed or that produce useful products (e.g., sheep for wool production).
  • Mammals to treat or protect include humans, dogs, cats, mice, rats, goats, sheep, cattle, horses and pigs.
  • mammals include, but are not limited to, farm animals, sport animals, pets, primates, mice and rats.
  • the term “individual” can be used interchangeably with the term “animal”, “subject” or "patient”.
  • probiotics based on the available information and scientific evidence, was adopted after a joint Food and Agricultural Organization of the United Nations and World Health Organization expert consultation. In October 2001, this expert consultation defined probiotics as: "live micro-organisms which, when administered in adequate amounts, confer a health benefit on the host”.
  • analog refers to a chemical compound that is structurally similar to another compound but differs slightly in composition (as in the replacement of one atom by an atom of a different element or in the presence of a particular functional group, or the replacement of one functional group by another functional group).
  • an analog is a compound that is similar or comparable in function and appearance, but has a different structure or origin with respect to the reference compound.
  • substituted when used to describe a compound, means that at least one hydrogen bound to the unsubstituted compound is replaced with a different atom or a chemical moiety.
  • a derivative has a similar physical structure to the parent compound, the derivative may have different chemical and/or biological properties than the parent compound.
  • Such properties can include, but are not limited to, increased or decreased activity of the parent compound, new activity as compared to the parent compound, enhanced or decreased bioavailability, enhanced or decreased efficacy, enhanced or decreased stability in vitro and/or in vivo, and/or enhanced or decreased absorption properties.
  • biologically active indicates that a compound (including a protein or peptide) has at least one detectable activity that has an effect on the metabolic or other processes of a cell or organism, as measured or observed in vivo ⁇ i.e., in a natural physiological environment) or in vitro ⁇ i.e., under laboratory conditions).
  • the term “modulate” can be used interchangeably with “regulate” and refers generally to upregulation or downregulation of a particular activity.
  • the term “upregulate” can be used generally to describe any of: elicitation, initiation, increasing, augmenting, boosting, improving, enhancing, amplifying, promoting, or providing, with respect to a particular activity.
  • the term “downregulate” can be used generally to describe any of: decreasing, reducing, inhibiting, ameliorating, diminishing, lessening, blocking, or preventing, with respect to a particular activity.
  • any of the amino acid sequences described herein can be produced with from at least one, and up to about 20, additional heterologous amino acids flanking each of the C- and/or N-terminal ends of the specified amino acid sequence.
  • the resulting protein or polypeptide can be referred to as "consisting essentially of the specified amino acid sequence.
  • the heterologous amino acids are a sequence of amino acids that are not naturally found ⁇ i.e., not found in nature, in vivo) flanking the specified amino acid sequence, or that are not related to the function of the specified amino acid sequence, or that would not be encoded by the nucleotides that flank the naturally occurring nucleic acid sequence encoding the specified amino acid sequence as it occurs in the gene, if such nucleotides in the naturally occurring sequence were translated using standard codon usage for the organism from which the given amino acid sequence is derived.
  • the phrase "consisting essentially of, when used with reference to a nucleic acid sequence herein, refers to a nucleic acid sequence encoding a specified amino acid sequence that can be flanked by from at least one, and up to as many as about 60, additional heterologous nucleotides at each of the 5' and/or the 3' end of the nucleic acid sequence encoding the specified amino acid sequence.
  • the heterologous nucleotides are not naturally found (i.e., not found in nature, in vivo) flanking the nucleic acid sequence encoding the specified amino acid sequence as it occurs in the natural gene or do not encode a protein that imparts any additional function to the protein or changes the function of the protein having the specified amino acid sequence.
  • the phrase “selectively binds to” refers to the ability of an antibody, antigen-binding fragment or binding partner of the present invention to preferentially bind to specified proteins. More specifically, the phrase “selectively binds” refers to the specific binding of one protein to another (e.g., an antibody, fragment thereof, or binding partner to an antigen), wherein the level of binding, as measured by any standard assay (e.g., an immunoassay), is statistically significantly higher than the background control for the assay.
  • any standard assay e.g., an immunoassay
  • controls when performing an immunoassay, controls typically include a reaction well/tube that contain antibody or antigen binding fragment alone (i.e., in the absence of antigen), wherein an amount of reactivity (e.g., non-specific binding to the well) by the antibody or antigen-binding fragment thereof in the absence of the antigen is considered to be background. Binding can be measured using a variety of methods standard in the art including enzyme immunoassays (e.g., ELISA, immunoblot assays, etc.).
  • enzyme immunoassays e.g., ELISA, immunoblot assays, etc.
  • an isolated protein is a protein (including a polypeptide or peptide) that has been removed from its natural milieu (i.e., that has been subject to human manipulation) and can include purified proteins, partially purified proteins, recombinantly produced proteins, and synthetically produced proteins, for example.
  • purified proteins does not reflect the extent to which the protein has been purified.
  • an isolated protein of the present invention is produced recombinantly.
  • the terms "modification” and “mutation” can be used interchangeably, particularly with regard to the modifications/mutations to the amino acid sequence of proteins or portions thereof (or nucleic acid sequences) described herein.
  • homologue is used to refer to a protein or peptide which differs from a naturally occurring protein or peptide (i.e., the "prototype” or “wild- type” protein) by minor modifications to the naturally occurring protein or peptide, but which maintains the basic protein and side chain structure of the naturally occurring form.
  • Such changes include, but are not limited to: changes in one or a few amino acid side chains; changes one or a few amino acids, including deletions (e.g., a truncated version of the protein or peptide) insertions and/or substitutions; changes in stereochemistry of one or a few atoms; and/or minor derivatizations, including but not limited to: methylation, glycosylation, phosphorylation, acetylation, myristoylation, prenylation, palmitation, amidation and/or addition of glycosylphosphatidyl inositol.
  • a homologue can have enhanced, decreased, or substantially similar properties as compared to the naturally occurring protein or peptide.
  • a homologue can include an agonist of a protein or an antagonist of a protein.
  • Homologues can be produced using techniques known in the art for the production of proteins including, but not limited to, direct modifications to the isolated, naturally occurring protein, direct protein synthesis, or modifications to the nucleic acid sequence encoding the protein using, for example, classic or recombinant DNA techniques to effect random or targeted mutagenesis.
  • a homologue of a given protein may comprise, consist essentially of, or consist of, an amino acid sequence that is at least about 45%, or at least about 50%, or at least about 55%, or at least about 60%, or at least about 65%, or at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 91% identical, or at least about 92% identical, or at least about 93% identical, or at least about 94% identical, or at least about 95% identical, or at least about 96% identical, or at least about 97% identical, or at least about 98% identical, or at least about 99% identical (or any percent identity between 45% and 99%, in whole integer increments), to the amino acid sequence of the reference protein.
  • the homologue comprises, consists essentially of, or consists of, an amino acid sequence that is less than 100% identical, less than about 99% identical, less than about 98% identical, less than about 97% identical, less than about 96% identical, less than about 95% identical, and so on, in increments of 1%, to less than about 70% identical to the naturally occurring amino acid sequence of the reference protein.
  • a homologue may include proteins or domains of proteins that are "near full- length", which means that such a homologue differs from the full-length protein, functional domain or immunological domain (as such protein, functional domain or immunological domain is described herein or otherwise known or described in a publicly available sequence) by the addition of or deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids from the N- and/or the C-terminus of such full-length protein or full-length functional domain or full-length immunological domain.
  • reference to a percent (%) identity refers to an evaluation of homology which is performed using: (1) a BLAST 2.0 Basic BLAST homology search using blastp for amino acid searches and blastn for nucleic acid searches with standard default parameters, wherein the query sequence is filtered for low complexity regions by default (described in Altschul, S.F., Madden, T.L., Schaaffer, A.A., Zhang, J., Zhang, Z., Miller, W. & Lipman, D.J. (1997) "Gapped BLAST and PSI- BLAST: a new generation of protein database search programs.” Nucleic Acids Res.
  • BLAST 2 alignment using the parameters described below
  • PSI-BLAST with the standard default parameters (Position-Specific Iterated BLAST. It is noted that due to some differences in the standard parameters between BLAST 2.0 Basic BLAST and BLAST 2, two specific sequences might be recognized as having significant homology using the BLAST 2 program, whereas a search performed in BLAST 2.0 Basic BLAST using one of the sequences as the query sequence may not identify the second sequence in the top matches.
  • PSI- BLAST provides an automated, easy-to-use version of a "profile" search, which is a sensitive way to look for sequence homologues.
  • the program first performs a gapped BLAST database search.
  • the PSI-BLAST program uses the information from any significant alignments returned to construct a position-specific score matrix, which replaces the query sequence for the next round of database searching. Therefore, it is to be understood that percent identity can be determined by using any one of these programs.
  • BLAST 2 sequence alignment is performed in blastp or blastn using the BLAST 2.0 algorithm to perform a Gapped BLAST search (BLAST 2.0) between the two sequences allowing for the introduction of gaps (deletions and insertions) in the resulting alignment.
  • An isolated nucleic acid molecule is a nucleic acid molecule that has been removed from its natural milieu (i.e., that has been subject to human manipulation), its natural milieu being the genome or chromosome in which the nucleic acid molecule is found in nature.
  • isolated does not necessarily reflect the extent to which the nucleic acid molecule has been purified, but indicates that the molecule does not include an entire genome or an entire chromosome in which the nucleic acid molecule is found in nature.
  • An isolated nucleic acid molecule can include a gene.
  • An isolated nucleic acid molecule that includes a gene is not a fragment of a chromosome that includes such gene, but rather includes the coding region and regulatory regions associated with the gene, but no additional genes that are naturally found on the same chromosome.
  • An isolated nucleic acid molecule can also include a specified nucleic acid sequence flanked by (i.e., at the 5' and/or the 3' end of the sequence) additional nucleic acids that do not normally flank the specified nucleic acid sequence in nature (i.e., heterologous sequences).
  • Isolated nucleic acid molecule can include DNA, RNA (e.g., mRNA), or derivatives of either DNA or RNA (e.g., cDNA).
  • nucleic acid molecule primarily refers to the physical nucleic acid molecule and the phrase “nucleic acid sequence” primarily refers to the sequence of nucleotides on the nucleic acid molecule, the two phrases can be used interchangeably, especially with respect to a nucleic acid molecule, or a nucleic acid sequence, being capable of encoding a protein or domain of a protein.
  • a recombinant nucleic acid molecule is a molecule that can include at least one of any nucleic acid sequence encoding any one or more proteins described herein operatively linked to at least one of any transcription control sequence capable of effectively regulating expression of the nucleic acid molecule(s) in the cell to be transfected.
  • nucleic acid molecule primarily refers to the physical nucleic acid molecule and the phrase “nucleic acid sequence” primarily refers to the sequence of nucleotides on the nucleic acid molecule, the two phrases can be used interchangeably, especially with respect to a nucleic acid molecule, or a nucleic acid sequence, being capable of encoding a protein.
  • the phrase “recombinant molecule” primarily refers to a nucleic acid molecule operatively linked to a transcription control sequence, but can be used interchangeably with the phrase "nucleic acid molecule” which is administered to an animal.
  • a recombinant nucleic acid molecule includes a recombinant vector, which is any nucleic acid sequence, typically a heterologous sequence, which is operatively linked to the isolated nucleic acid molecule encoding a fusion protein of the present invention, which is capable of enabling recombinant production of the fusion protein, and which is capable of delivering the nucleic acid molecule into a host cell according to the present invention.
  • a vector can contain nucleic acid sequences that are not naturally found adjacent to the isolated nucleic acid molecules to be inserted into the vector.
  • the vector can be either RNA or DNA, either prokaryotic or eukaryotic, and preferably in the present invention, is a virus or a plasmid.
  • Recombinant vectors can be used in the cloning, sequencing, and/or otherwise manipulating of nucleic acid molecules, and can be used in delivery of such molecules (e.g., as in a DNA composition or a vira l vector-based composition).
  • Recom binant vectors are preferably used in the expression of nucleic acid molecules, and ca n also be referred to as expression vectors.
  • Preferred recombinant vectors are capable of being expressed in a transfected host cell.
  • nucleic acid molecules are operatively linked to expression vectors containing regulatory sequences such as transcription control sequences, translation control sequences, origins of replication, and other regulatory sequences that are compatible with the host cell and that control the expression of nucleic acid molecules of the present invention.
  • recombinant molecules of the present invention include nucleic acid molecules that are operatively linked to one or more expression control sequences.
  • the phrase "operatively linked” refers to linking a nucleic acid molecule to an expression control sequence in a manner such that the molecule is expressed when transfected (i.e., transformed, transduced or transfected) into a host cell.
  • the term “transfection” is used to refer to any method by which an exogenous nucleic acid molecule (i.e., a recombinant nucleic acid molecule) can be inserted into a cell.
  • the term “transformation” can be used interchangeably with the term “transfection” when such term is used to refer to the introduction of nucleic acid molecules into microbial cells, such as algae, bacteria and yeast.
  • transfection In microbial systems, the term "transformation" is used to describe an inherited change due to the acquisition of exogenous nucleic acids by the microorganism and is essentially synonymous with the term “transfection.” Therefore, transfection techniques include, but are not limited to, transformation, chemical treatment of cells, particle bombardment, electroporation, microinjection, lipofection, adsorption, infection and protoplast fusion.
  • Figure 1 Screening of pJRP- and pCEV-transformed Saccharomyces strains. Following transformations of Saccharomyces strains, plasmid DNA was extracted and submitted to PCR to confirm if they contain either the HIV gag (around 1.500 bp) or the aphAl (around 500 bp) genetic sequences to confirm the presence of pJRP or pCEV, respectively. Positive controls used were the plasmid containing the H IV gag sequence obtained commercially (for pJRP) and pCEV itself. Negative control for both screenings was an unrelated plasmid, pYC440 16 ' 44 .
  • Yeast strains (Sb, 905, Sc47, Lll, 4741 and 4743).
  • FIG. 1 Genetically engineered Saccharomyces strains express HIV Gag antigen. Expression of HIV Gag was determined by flow cytometry and it was observed only in pJRP-transformed strains. As observed in the dot plots, the levels of viral antigen vary heterogeneously between different strains. No HIV Gag was detected in any of the PCEV strains. Similar results were observed with fluorescence microscopy. Bar 10 ⁇ .
  • FIG. 3 Genetically modified probiotic Saccharomyces strains are avidly phagocytosed by human dendritic cells in vitro. After 4 h in co-culture, phagocytosis was assessed by flow cytometry. Yeasts were labelled with Calcofluor White stain (CFW), which was observed in almost all dendritic cells put in contact with all three yeast strains (Sb, Sc47 and 4743) either transformed with pCEV or pJRP. Quenching of non-internalized, CFW labelled yeasts was done with trypan blue.
  • CFW Calcofluor White stain
  • dendritic cells treated with paraformaldehyde thus rendered unable to perform phagocytosis, were similarly incubated with CFW labelled yeasts and treated with trypan blue. Results are shown as average phagocytosis levels using the dendritic cells of three different donors in percentage ⁇ standard deviation.
  • FIG. 4 Following phagocytosis of genetically engineered probiotic Saccharomyces strains, human dendritic cells undergo maturation and polarization to a specific type of immune response.
  • Results are presented as the average of the mean fluorescence intensity (MFI) normalized to the basal levels of DCs which were not incubated with yeasts, using DCs from three different healthy donors, ⁇ standard deviation. *, p ⁇ 0.05 and **, p ⁇ 0.01 versus immature DCs which have not been in contact with yeasts, just medium, and were processed likewise for maturation markers assessment
  • FIG. 8 Maps of pJRP H IV GAG plasmids restriction sites used to insert the sequences of AGA1 and fusion protein AGA2 HIV GAG are indicated.
  • probiotic Saccharomyces strains used in this work were 5. boulardii 17 (Sb), 5. cerevisiae UFMG A-905 (905), 5. cerevisiae Sc47 and 5. cerevisiae Lll (Lll).
  • Non-probiotic strains used were 5. cerevisiae BY4741 (4741) and 5. cerevisiae BY4743 (4743).
  • Yeast strains were obtained as described previously 11 and reported in the table below.
  • pCEV pCEV-Gl-Km
  • pCEV pCEV-Gl-Km
  • pCEV is a bicistronic plasmid (sequence reported below), thus allowing simultaneous expression of 2 different genes, and carries resistance for both ampicillin and geneticin (G418) as well as TEFl and PGKl promoters (Fig. 7).
  • Plasmid propagation and genetic manipulation were done using MAX Efficiency ® DH5aTM competent Escherichia coli cells from Thermo Fisher Scientific (Waltham, MA, USA), according to the manufacturer's instructions.
  • yeasts were grown in YPD, at either 37°C (probiotic) or 30°C (non-probiotic). E. coli was grown in LB at 37°C.
  • Plasmid construction To express the HIV Gag antigen on the surface of the yeast strains, the inventor first reverse translated the HIV-1 clade B HXB2 Gag protein sequence (NCBI Accession No. AAB50258.1) into its nucleotide sequence and optimized it for expression in 5. cerevisiae using the Leto 1.0 software developed by Entelechon ® (Ebersberg, Germany), resulting in the sequence observed below.
  • HIV Gag (Genebank ref: AAB50258.1)(SEQ ID No. 2)
  • Genscript Procataway, NJ, USA
  • the inventor added the restriction sites Sail and Nhel at the 5' and 3' ends, respectively, by PCR amplification using the primers GAG Sail F 5'-TAAGCAGTCGACAAAAAAATGGGAGCGAGAGCTTCCGTC-3' (SEQ ID No.
  • cerevisiae proteins AGAlp and AGA2p will lead to the co-expression of the foreign protein with AGA2p in the yeast surface 14 ' 15 .
  • the inventor extracted the genomic DNA of all 5. cerevisiae strains used in this work with a Yeast DNA extraction kit (Thermo Fisher Scientific) and proceeded to PCR amplification of AGA1 and AGA2 genes.
  • Primers used for amplification of AGA1 added the restriction sites Notl and Pad at the 5' and 3' extremities, respectively, and their sequences were ScAGAl Notl F 5'-TAAG C AG CGG CCG CATG AC ATTATCTTTCG CTCATT-3' (SEQ ID No. 18) and ScAGAl Pad R 5'- TG CTTATTAATTAATCATTATTAACTG AAAATTACATTG C AA -3' (SEQ ID No. 19). Since 5. cerevisiae and 5.
  • boulardii possess diverse AGA1 genetic sequences 14
  • the inventor used a different reverse primer for amplification of this sequence in the latter strain, SbAGAl Pad R 5'-TGCTTATTAATTAATCATTAACTAAAAATTACATTGCAA-3' (SEQ ID No. 20).
  • PCR amplification of AGA2 included the restriction sites of BamHI and Sail at the beginning and end of the sequence respectively, and the primers used were ScAGA2 BamHI F 5'-TAAGCAGGATCCATGCAGTTACTTCGCTGTTT-3' (SEQ ID No. 21) and ScAGA2 Sail R 5'- TGCTTAGTCGACAAAAACATACTGTGTGTTTA-3' (SEQ ID No. 22).
  • AGA1 and AGA2 sequences are the same for all strains but S. boulardii. Sb AGAl (Genebank ref: KC200251.1); ScAGAl (NCBI ref: NM_001183221.1).
  • Each yeast strain was transformed with its respective pJRP using the S.c. EasyCompTM Transformation Kit (Thermo Fisher Scientific), following manufacturer's instructions, as previously described 16 .
  • the yeasts were transformed with the empty plasmid pCEV.
  • Transformed yeasts were grown in selective YPD media containing 100 ⁇ g/ml of G418. Screening of transformed yeasts was done by first inducing protoplast formation by cell wall digestion with NovozymeTM (Trichoderma harzianum lysing enzymes) followed by extraction of plasmid DNA using a Wizard ® Plus SV Miniprep DNA Purification System from Promega (Madison, Wl, USA).
  • pJRP The presence of pJRP was confirmed by PCR amplification using the above described primers GAG Sail F and GAG Nhel R. Screening of pCEV was done using the primers G418 F 5'-ATTAAATTCCAACATGGATGC-3' (SEQ I D No. 23) and G418 R 5'-GACTGAATCCGGTGAGAATG-3' (SEQ. I D No. 15), which amplified partially the sequence of aminoglycoside 3'-phosphotransferase I I (APT 3' I I), the enzyme responsible for resistance to G418. Detection of expression of Gag protein in transformed yeasts by indirect immunofluorescence.
  • yeasts were grown to stationary phase overnight, washed with PBS and fixed in paraformaldehyde (PFA) 1% for 30 min. Following 3 PBS washes, yeasts were incubated in blocking solution (PBS containing 3% bovine serum albumin (BSA), 5% fetal bovine serum (FBS; GE Healthcare, Logan, UT, USA) and 0,1M glycine) for 30 min. The inventor then incubated the yeasts with an antibody anti-HIV-1 SF2 p24 rabbit polyclonal, diluted 1:200 in blocking solution, for 90 min.
  • PFA paraformaldehyde
  • Anti-HIV-1 SF2 p24 was obtained through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH. As negative control, a separate set of yeasts were incubated with plain blocking solution. Following 3 washes with PBS, yeasts were incubated with a goat anti-rabbit IgG (H+L) secondary antibody Alexa Fluor 488 (Thermo Fisher Scientific), diluted 1:2.000 in blocking solution, for 60 min. Yeasts were then washed twice in PBS, mounted in a microscopy slide and analyzed under a Zeiss Axioimager Ml fluorescence microscope (Carl Zeiss, Jena, Germany).
  • PBMCs Peripheral blood mononuclear cells
  • Fresh PBMCs from buffy coats were purified using Ficoll/Hypaque gradient (GE Healthcare). The collected whole blood was diluted in PBS at a 1:4 ratio and transferred to 50 mL conical plastic tubes containing 13 mL of Ficoll/Hypaque. The cells suspension was centrifuged at 975xg for 30 minutes at room temperature (RT). The resulting PBMC layer was aspirated and washed 4 times with PBS followed by centrifugation at 450xg for 10 minutes at RT. Monocytes were magnetically purified from PBMCs using a MACS column and CD14 MicroBeads (both from Myltenyi Biotech Inc., Auburn, CA, USA), according to the manufacturer's instructions.
  • the monocytes pellet was re-suspended at a concentration of 10 7 cells/ml of FBS 10% dimethyl sulfoxide (DMSO), dripped slowly under ice bath. Cells suspensions were distributed to labelled cryotubes, stored at -80 °C and transferred to liquid nitrogen after 48 h.
  • DMSO dimethyl sulfoxide
  • IMDM Iscove ' s Dublecco ' s Modified Medium
  • FBS recombinant human GM-CSF (Sanofi- Aventis, Bridgewater, NJ, USA) and IL-4 (R&D Systems, Minneapolis, MN, USA), both at 1.000 International Units (IU)/ml.
  • the purified monocytes were cultured during 5 days for differentiation into immature DCs, which were either kept immature or matured with transformed yeasts in the proportion of 1:10.
  • the immature DCs and the differentially polarized mature DCs obtained after seven days of culture were harvested and washed with PBS.
  • the culture supernatants were also collected for further multiplex analysis.
  • the inventor assessed the levels of the specific biomarkers by flow cytometry and multiplex. Unstimulated cells were used as a negative control.
  • DCs were stained with monoclonal antibodies against selected surface markers: PE Mouse Anti-Human CD86 and PE Mouse Anti-Human CD83 (both from Beckam Coulter, Brea, CA, USA), APC Mouse Anti-Human CCR7 (R&D Systems, Minneapolis, MN, USA), Alexa Fluor 488 Mouse Anti-Siglecl/CD169 (BioRad, Raleigh, NC, USA), PE Mouse Anti-Human OX40L (BD Biosciences), PECy7 Mouse Anti-Human CDllc (Biolegend, San Diego, CA, USA) and FITC Mouse Anti-Human CD14 (BD Biosciences).
  • PE Mouse Anti-Human CD86 and PE Mouse Anti-Human CD83 both from Beckam Coulter, Brea, CA, USA
  • APC Mouse Anti-Human CCR7 R&D Systems, Minneapolis, MN, USA
  • Alexa Fluor 488 Mouse Anti-Siglecl/CD169 BioRad, Raleigh, NC, USA
  • PE Mouse Anti-Human OX40L BD
  • Phagocytosis The levels of transformed yeasts phagocytosis by DCs were assessed by flow cytometry. Following overnight growth in YPD supplemented with G418, transformed yeasts were washed twice in PBS and labelled with 5 ⁇ g/ml of Calcofluor White Stain (CFW), a fluorescent probe that binds to chitin present in yeast cell wall 19 , for 30 min at RT, with gentle agitation. Yeasts were then incubated with immature DCs, as described above, for 4 h at 37 ° C. The levels of phagocytosis were assessed through flow cytometry as described above.
  • CCW Calcofluor White Stain
  • the inventor added trypan blue to the sample before analyzing it. Trypan blue acts as a CFW fluorescence quencher and is not internalized by DCs, meaning that only yeasts that have been phagocytosed will be detected 19 .
  • the inventor incubated yeasts with PFA killed DCs, which cannot perform phagocytosis. Results are shown in percentage and are the average of the phagocytosis levels of the DCs of the 3 healthy donors subtracted the levels of the unspecific background.
  • HIV-l-specific ELISpot To assess the immunogenicity of probiotic yeasts expressing HIV Gag, the inventor determined the magnitude of Gag-specific IFN- ⁇ responses induced by a 10-day co- culture of yeast-treated DCs and autologous T cells derived from an individual chronically infected with HIV-1. Co-cultures with untreated DCs were used as negative control. Briefly, T cells (both CD4 and CD8) isolated from PBMCs through immunomagnetic negative selection (StemCell Technologies, Cambridge, MA, USA) were co-cultured with yeast-treated or untreated DCs at a DC:T cell ratio of 1:10.
  • the cultures were allowed to grow for 10 days, and were supplemented with recombinant IL-2 (10 lU/mL; Chiron, Emeryville, CA, USA) on days 3 and 7.
  • the cells in culture were split as needed with IMDM 10% FBS supplemented with 10 ⁇ efavirenz (EFV).
  • EFV was obtained through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH.
  • the T cells were immediately evaluated for IFN- ⁇ production.
  • ELISpot assays for IFN- ⁇ production detection were performed as previously described 20 ' 21 by stimulating the T cells for 18 h with a pool of overlapping 15-mers peptides (1 ⁇ g/ml) representing the HIV-1 consensus B Gag (obtained through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH). Wells with T cells only were used as negative controls. ELISpot data were calculated as the means of spots in duplicate wells minus the mean plus 2 standard deviations of spots in duplicate negative controls.
  • yeasts were grown overnight in YPD media and cultures were diluted to a final 600 nm optical density ( ⁇ ) of 0,3 and incubated in YPD 0,5% pancreatin (Thermo Fisher Scientific) and 0,1% NaCI pH 8,0 (intestinal stress), YPD 0,1% mixture of primary and secondary bile salts (biliary stress) and in gastric juice pH 1,5 (Thermo Fisher Scientific) supplemented with 2% dextrose (gastric stress).
  • optical density
  • G418 was added to the referred media to a final concentration of 100 ⁇ g/ml.
  • probiotic Saccharomyces cerevisiae strains efficiently express HIV GAG in their surface albeit at different levels. If using microbial vectors for medical and veterinary vaccination strategies, it is believed that display of pathogenic proteins on the surface of the vector is the best approach for antigen presentation 14 ' 23 . While secretion of desired antigen might lead to its unspecific degradation by proteases before it will be able to induce an immune response, cytoplasmic overproduction of foreign proteins might be toxic to the host cell thus leading to their proteolytic cleavage as well. Aiming to express the HIV Gag antigen in the surface of probiotic S.
  • the inventor constructed a plasmid, pJRP, carrying this viral antigen fused to AGA2p.
  • pJRP plasmid carrying this viral antigen fused to AGA2p.
  • the inventor screened the colonies to determine which carried HIV gag (pJRP) and aphAl (G418 resistance gene in pCEV) genetic sequences (Fig. 1).
  • the inventor investigated if HIV Gag expression occurred in those colonies by fluorescence microscopy and flow cytometry (Fig. 2).
  • the inventor observed that all pJRP-transformed yeasts do express HIV Gag, although at different levels (Fig. 2). I nterestingly, flow cytometric ana lysis showed a very low expression of HIV Gag in 905 strain.
  • 905 is a probiotic strain which has a particular growth, forming clumps, unlike the other tested yeast strains 11 , and the inventor assume that a ny antigen expressed in the surface of 905 will be hindered from the antibodies used to detect HIV Gag.
  • the inventor mostly observed HIV Gag in isolated or smaller clusters of 905 and rarely in bigger clumps (data not shown). Conversely, no HIV Gag was ever detected in any of the non- or pCEV-transformed strains in both techniques (data not shown).
  • the inventor chose as reference probiotics Sb and Sc47, since they had the highest level of expression of HIV Gag by flow cytometry.
  • the inventor chose 4743 which, although has a similar level of expression of this viral antigen when compared to 4741, is a diploid strain and thus, more suitable to be compared with industrial yeast strains as Sb and Sc47 11 .
  • cerevisiae strains are avidly phagocytosed by and induce maturation of human dendritic cells in vitro. To efficiently present the carrying foreign antigens, yeasts must be efficiently phagocytosed by professional antigen presenting cells (APCs), such as DCs or macrophages 24 .
  • APCs professional antigen presenting cells
  • cerevisiae strains cell wall is constituted of sugar moieties such as mannan and ⁇ -1,3-D-glucan, which are recognized by APCs Toll-like receptors (TLR) as a warning sign of an occurring infection, prompting the phagocytosis of these yeasts by APCs. These cell wall components have therefore adjuvant properties, facilitating the uptake of the yeast and activating the innate immune system.
  • the inventor submitted both pCEV- and pJRP-transformed Sb, Sc47 and 4743 yeasts to DCs and quantified the level of phagocytosis (Fig. 3). All yeasts were avidly phagocytosed by DCs, confirming that genetic alteration of the former does not affect their uptake by APCs.
  • the levels of several cytokines secreted by DCs following stimulation with yeasts were also assessed.
  • An increase in the concentrations of I FN- ⁇ , I L-10, I L-12p70, I L- ⁇ , I L-6, I L-8 and TNF-a was observed in the growth medium when compa red to non-stimulated DCs (Fig. 5).
  • the higher levels of I FN- ⁇ , I L- 12p70, I L- ⁇ , I L-6 and TNF-a strongly corroborate that stimulation with yeasts induces polarization of DCs into a type 1 immune response 29 ' 30 .
  • Transformed probiotic S. cerevisiae strains engineered to express HIV Gag antigen are efficiently presented by dendritic cells from an HIV+ patient to autologous T cells and induce clonal expansion of the latter.
  • the inventor isolated DCs derived from an HIV+ patient and incubated them with both pCEV- and pJRP-transformed yeasts. Following maturation of DCs, they were incubated with autologous T cells, i.e., derived from the same patient, to perform HIV Gag antigen presentation to the latter. Later, T cells were stimulated with an HIV Gag peptide pool and their clonal expansion was assessed by ELISpot (Fig.
  • cerevisiae strains retain their ability to resist simulated gastrointestinal tract harsh environments. Probiotic microorganisms must endure the stringent conditions found in the gastrointestinal tract such as intestinal proteases, bile salts and gastric acidic pH 22 . Also, different 5. cerevisiae strains possess diverse levels of resistance to those stresses 11 ' 22 . To successfully deliver the antigens in the colonic mucosal tissue, genetically engineered yeasts must also survive the same harsh environments. Thus, to ensure that genetic manipulation does not affect their ability to subsist in the gastrointestinal tract, the inventor submitted the transformed yeasts to simulated intestinal, biliary and gastric conditions (Table 1).
  • cerevisiae strains as an immunization strategy against HIV. While the potential use of non-probiotic, laboratorial strains of 5. cerevisiae as therapeutic and prophylactic agents carrying foreign bio-therapeutic molecules has been described against cancer 6 ' 24 and several pathogens, such as HIV 5 ' 6 ' 31 , hepatitis B virus (HBV) 6 ' 8 , hepatitis C virus (HCV) 24 , hepatitis D virus (HDV) 6 and tuberculosis 6 , only recently the possibility of using similarly a probiotic strain, 5. boulardii has been reported 14 ' 32 ' 33 . Genetic modification of diploid, industrial strains, such as S.
  • boulardii is harder to achieve when compared to laboratorial, haploid strains, such as 5. cerevisiae s288c and 5. cerevisiae W303 9 ' 16 ' 34 which might explain why so far researchers have focused on haploid strains.
  • some advances in genetic transformation of S. boulardii have been achieved recently, such as successful application of CRISP-Cas9 platform 35 .
  • Use of industrial strains as probiotic strains has the advantage to produce higher levels of proteins, due to their lower doubling times 11 and they are also better suited to endure harsh conditions 34 , as gastrointestinal stresses and higher growth temperatures.
  • probiotic strains differ in the immune response they induce in the colon 9 ' 10 ' 36"38 , which makes them ideal vectors to manipulate the immune response towards a desired subtype, e.g., Thl vs. Th2/Treg, against a selected pathogen.
  • Genetic modification of probiotic 5. cerevisiae strains other than 5. boulardii has not been reported. I n the present invention, the inventor has shown for the first time genetic manipulation of probiotic strains different from 5. boulardii. Using the 5. cerevisiae AGAlp/AGA2p surface display system, the inventor was able to express HIV Gag antigen anchored to the cell wall of several 5. cerevisiae strains. This system has been already used successfully in laboratorial 5.
  • strain 905 has previously observed other biological phenotypical differences between strain 905 and the other strains such as resista nce to gastrointestinal stresses and levels of lipid droplets 11 .
  • strain 905 cellular machinery differs from its counterparts and is not able to properly display foreign antigens in the surface.
  • Sb and Sc47 had the higher levels of expression of HIV Gag antigen while both non-probiotic strains had similar levels (Fig. 2).
  • the inventor selected the 2 mentioned probiotic strains while 4743 was chosen over 4741, since the former shares the same diploid genotype than the probiotic strains.
  • Phagocytosis is a crucial biological mechanism to mount an effective immune response. Genetically engineered microbial vectors must be prone to suffer phagocytosis by APCs so the foreign proteins expressed by such vectors can be presented to CD4 + and CD8 + T cells. To the best of our knowledge, no study has yet shown that genetic modification of probiotic 5. cerevisiae strains affects in some way their phagocytosis by APCs. Others have shown that genetically engineered laboratorial 5. cerevisiae strains or unmodified probiotic 5.
  • cerevisiae strains are avidly phagocytosed by APCs 5 ' 10 ' 25 , and the inventor observed the same phenotype with pCEV- and pJRP-transformed yeasts (Fig. 3). This strengthens the assumption that genetically altered probiotic 5. cerevisiae strains can efficiently deliver antigens to APCs. The inventor also evaluated that these yeasts, following phagocytosis, induced the expression of DCs surface maturation markers 26 ' 27 , as CD86, CD83 and CCR7 (Fig. 4A). Of the tested strains, only Sb transformed yeasts with both plasmids showed a significant increase for all 3 maturation markers when matched with DCs alone (Fig. 4A).
  • CCR7 was upregulated following DCs contact with all 3 yeast strains transformed either with pCEV or pJRP (Fig. 4A).
  • the present results indicate that incubation with the tested pCEV- and pJRP-transformed strains is able to stimulate maturation of DCs.
  • the present results showed a higher level of the former compared to the non-stimulated control (Fig. 4B). I n agreement, levels of OX40L remain at basal levels for all tested transformed yeasts (Fig. 4B), suggesting that incubation with these strains induce a type 1 response.
  • Siglec-1 was increased in all tested strains, the increase observed for Siglec-1 is statistically significant for Sb tra nsformed with both plasmids (Fig. 4B). Quantification of the levels of cytokines secreted by mature DCs indicate increases in the medium concentrations of I FN- ⁇ , IL-10, I L-12p70, I L- ⁇ , IL- 6, I L-8 and TN F-a for all yeasts (Fig. 5), although not differing significantly of those observed in non-stimulated yeasts. As mentioned above, the increase of I FN- ⁇ , IL-12p70, I L- ⁇ , IL-6 and TNF- a levels also suggests a type 1 biased immune response.
  • probiotic microorganisms must possess so they ca n efficiently employ their beneficial effects in the colon is the resistance to the harsh environments of the gastrointestinal tract.
  • the inventor has previously shown that different probiotic strains submitted to biliary and gastric milieus exhibit different survival profiles, although none of them is completely abrogated by either stress 11 .
  • intestinal simulated conditions do not impact negatively the growth of S. cerevisiae strains 9 ' 11 ' 22 ' 39 .
  • Genetically engineered 5. boulardii strains have been administered to mice and later detected in their colon 40 ' 41 or submitted to simulated gastrointestinal aggressive milieus 40 ' 42 and successfully survived both in vivo and in vitro.
  • Saccharomyces boulardii the probiotic strain of Saccharomyces cerevisiae. Appl Env. Microbiol 73, 2458-67 (2007).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Epidemiology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Mycology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Immunology (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Microbiology (AREA)
  • Organic Chemistry (AREA)
  • Communicable Diseases (AREA)
  • AIDS & HIV (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Oncology (AREA)
  • Hematology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Biotechnology (AREA)
  • Botany (AREA)
  • Medical Informatics (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

The present invention refers to an immunotherapeutic composition comprising a probiotic yeast vehicle and a fusion protein or a protein comprising at least one HIV antigen and uses thereof. In particular the composition is for the treatment of human immunodeficiency virus (HIV) infection or in the treatment of at least one symptom resulting from HIV infection. The present invention also relates to a method to prepare said immunotherapeutic composition.

Description

Probiotic yeasts as novel vaccination vectors
TECHNICAL FIELD
The present invention relates to genetically engineered probiotic yeast strains expressing HIV antigens and uses thereof.
BACKGROUND ART
Currently, it is estimated that up to 40 million people worldwide are infected with human immunodeficiency virus (HIV) and that around 2 million new infections arise each year1. In the last 4 decades and a half, this virus has been responsible for the death of 35 million people, mostly of them in Sub-Saharan Africa. Infection with HIV leads to gradual dampening of the immune system, consequently allowing other infections to establish or exacerbated susceptibility to certain types of cancer. If untreated, patients will deteriorate and eventually succumb of one or more of the opportunistic illnesses acquired during the course of infection with HIV. To date, the only treatment available is antiretroviral therapy (ART) drugs, which have extended the lifespan of HIV-infected people by preventing viral replication and, subsequently, allowing the immune cells to still be effective against pathogens and cancerous cells1. However, ART drugs are unable to fully clear this virus from the organism; as all members of the Retroviridae family, HIV DNA can integrate in the host cell genome and stay dormant during extended periods without losing its replication fitness2'3. To completely eradicate HIV, a vaccination strategy must be developed. Although much effort has been put in that direction, a vaccine against HIV remains elusive, due to the high level of genetic mutability and diversity of the virus, viral persistence in the host cell genome and lack of adequate models in vitro and in vivo which can provide good correlates of protection, among others4.
So far, no vaccine is available against HIV. After multiple, unsuccessful attempts, the most promising strategy to date is RV144, a prime/boost regimen consisting in a canarypox virus encoding env/gag/pro genes and the recombinant Envelope protein subunit gpl204. Clinical trials in Thailand showed a 60% efficacy after 12 months which gradually decreased to 31,2% after 42 months. Thus, novel approaches are still needed for an HIV vaccine.
Probiotic 5. cerevisiae strains are known to naturally induce an immune response in the colon and to be resistant to the gastrointestinal harsh environments, such as acidic gastric juice and bile salts. Genetically engineered Saccharomyces cerevisiae strains expressing HIV antigens have shown promising pre-clinical results, as their can stimulate a T cell response. However, most 5. cerevisiae strains tend to induce a poor mucosal immune response, even if administered orally. The use of genetically engineered Saccharomyces cerevisiae strains expressing HIV antigen gpl60 induced a potent cellular immune response in mice5'6. However, a response against HIV must elicit both cellular and humoral arms of the immune system4 and also a mucosal immune response7, since this virus ca n be transmitted sexually through mucosal surfaces. While laboratorial 5. cerevisiae strains confer a weak mucosal response8, their probiotic counterparts induce a potent slgA secretion in the colon and have immunomodulatory properties9. I nterestingly, different probiotic 5. cerevisiae strains were shown to induce diverse types of immune response10.
Then there is still the need for probiotic 5. cerevisiae strains which can be genetically manipulated to express on their surface H IV antigens.
SUMMARY OF THE INVENTION
To date, no vaccine is available against human immunodeficiency virus (H IV), despite the multiple efforts put on it during the last decades. A vaccine against this viral pathogen must not only elicit both cellular and humoral arms of the immune system, but also induce a mucosal immunity. I n fact, sexually transmitted HIV uses mucosal ports of entry, and a mucosal immune response would both prevent a new infection and its further spreading to uninfected individuals. I n the present invention probiotic 5. cerevisiae strains were transformed with the bicistronic plasmid pCEV-Gl-Km (pCEV) in its simple form or with the HIV gag gene sequence optimized for expression in the cell wall of S. cerevisiae using the AGAlp/AGA2p system (pJRP). The inventor successfully expressed HIV Gag protein in the yeast surface, expression was confirmed by flow cytometry and fluorescence microscopy. He observed that genetic modification did not impair neither phagocytosis by human dendritic cells (DCs) from healthy donors in vitro nor resistance to simulated gastrointestinal stresses. I n fact, genetically modified strains were eagerly phagocytosed by human dendritic cells (DCs) in vitro and showed resistance to simulated gastrointestinal aggressive milieus. Cell surface markers and cytokines secreted by healthy donors DCs following genetically engineered yeasts, indicate that these immune cells polarize in a type 1 response.
To measure a specific HIV Gag response, the inventor matured DCs derived from an HIV+ patient with transformed yeasts and incubated them with autologous T cells from the same patient. I nterestingly, only DCs which have been in contact with pJRP-transformed probiotic S. cerevisiae strains were able to efficiently perform HIV Gag antigen presentation to T cells, as observed by clonal expansion of the former when later incubated with a Gag peptide pool. The present results show that genetically engineered probiotic strains of S. boulardii 17 (Sb) and S. cerevisiae Sc47 are promising vaccination strategies against HIV.
Both strains are able to efficiently perform HIV antigen (such as Gag) presentation to T cells. Both strains elicit an HIV-specific T cell response. Further, both strains are resistant to simulated gastrointestinal stresses, such as intestinal proteases, bile salts and gastric acidic pH; both strains are eagerly phagocytosed by human dendritic cells in vitro; both strains are able to induce maturation of human dendritic cells in vitro; both strains promote cytokine production by human dendritic cells in vitro; both strains appear to favor a Thl immune response, based on the type of markers observed in human dendritic cells in vitro and the profile of cytokines secreted by those cells.
Then the present invention provides an immunotherapeutic composition comprising:
a) a probiotic yeast vehicle; and
b) a fusion protein or a protein said fusion protein or said protein comprising at least one H IV antigen,
wherein the probiotic yeast is selected from yeast is 5. cerevisiae or S. boulardii.
I n a preferred embodiment the invention provides an immunotherapeutic composition comprising:
a) a probiotic yeast vehicle; and
b) a fusion protein or a protein said fusion protein or said protein comprising at least one H IV antigen,
wherein the probiotic yeast is selected from yeast is 5. cerevisiae Sc47 or 5. boulardii 17.
Preferably the at least one HIV antigen comprises or consists of an amino acid sequence that is at least 80% identica l to a n amino acid sequence encoded by the nucleotide sequence of SEQ I D NO:l (GAG optimized sequence) or a corresponding amino acid sequence from a different HIV strain, preferably the at least one HIV antigen comprises or consists of an amino acid sequence that is at least 90%, 95 %, 99 % identical to an amino acid sequence encoded by the nucleotide sequence of SEQ. I D NO:l. Preferably the HIV antigen comprises or consists of an amino acid sequence that is at least 90% identical to an amino acid sequence encoded by a nucleotide sequence of SEQ ID NO:l or a corresponding amino acid sequence from a different HIV strain.
Still preferably the HIV antigen consists of the amino acid sequence encoded by the nucleotide of SEQ ID NO:l.
Still preferably the fusion protein comprises an amino acid sequence of SEQ. ID NO:9.
Yet preferably the HIV antigen is expressed by the yeast vehicle. More preferably the yeast vehicle is a whole yeast.
The invention also provides an immunotherapeutic composition comprising:
a) a whole, inactivated probiotic yeast; and
b) an HIV fusion protein or HIV protein comprising the amino acid sequence of SEQ. ID NO:l, wherein the fusion protein or protein is under the control of the TEF1 and/or PGK1 promoter; wherein the HIV fusion protein or protein is expressed by the yeast; wherein the composition elicits an HIV-specific T cell response and wherein the yeast is 5. cerevisiae Sc47 or 5. boulardii 17.
Preferably the fusion protein comprises the amino acid sequence of SEQ ID NO:9.
In a preferred embodiment the immunotherapeutic composition as defined above further comprises a dendritic cell, wherein the dendritic cell has been loaded with the yeast.
In a preferred embodiment the immunotherapeutic composition as defined above further comprises one or more adjuvant(s) and/or one or more additional compounds or compositions useful for treating or ameliorating a symptom of HIV infection.
Preferably the compound is an anti-viral compound. Preferably the anti-viral compound is a fixed-dose combination (FDC) drug.
Preferably the additional composition is a DNA vaccine encoding at least one HIV antigen, preferably the additional composition is a processed yeast, preferably the processed yeast was genetically modified to express at least one HIV antigen, still preferably the processed yeast is administered with at least one HIV antigen.
Still preferably the additional composition comprises autologous T cells from the subject, wherein the autologous T cells have been stimulated ex vivo with at least one HIV antigen. Yet preferably the additional composition comprises a protein subunit vaccine comprising at least one HIV antigen.
Preferably the HIV antigen is the same as the HIV antigen in the composition as defined above. More preferably the additional compound comprises a biological response modifier.
Yet preferably the additional compound or composition is administered prior, subsequently or concurrently to administration of the immunotherapeutic composition.
In a preferred form the composition is formulated in a pharmaceutically acceptable excipient suitable for administration to a subject by injection or orally.
The invention further provides fusion protein comprising at least one HIV antigen, wherein the fusion protein comprises an amino acid sequence that is at least 95% identical to an amino acid sequence of SEQ ID NO:ll.
The invention further provides a recombinant nucleic acid molecule encoding the fusion protein as described above.
The invention further provides an isolated cell transfected with the recombinant nucleic acid as defined above. Preferably the cell is a yeast cell.
The invention further provides a composition comprising the fusion protein as defined above, or the recombinant nucleic acid molecule as defined above or the isolated cell as defined above. The invention further provides the immunotherapeutic composition as defined above, the fusion protein, the recombinant nucleic acid, the isolated transfected cell or the composition comprising any of said fusion protein, recombinant nucleic acid, isolated transfected cell for use in the treatment of human immunodeficiency virus (HIV) infection or in the treatment of at least one symptom resulting from HIV infection.
The invention further provides process for preparing the immunogenic composition as defined above, comprising the steps of:
(a) preparing a HIV component by expression in a S. cerevisiae or 5. boulardii , preferably in S. cerevisiae SC47 orS. boulardii 17 host carrying a plasmid having a HIV antigen coding sequence, wherein the plasmid includes: (1) An Sc promoter sequence (such as TEF1 or PGK1) and optionally a AGA1 and/or a AGA2 sequence upstream of the HIV coding sequence; and (2) An Sc terminator of transcription sequence downstream of the HIV coding sequence;
b) preparing at least one non-HIV component; and
c) mixing the HIV and non-HIV components to give the immunogenic composition.
Preferably the process further comprises purifying the HIV antigen after expression in a S. cerevisiae SC47 or S. boulardii 17 host.
Preferably the HIV antigen coding sequence has 80 % identity with SEQ. ID No: 1, preferably 90 %, 95 % or 99 % identity with SEQ. ID No: 1. The present invention provides a method for the treatment of human immunodeficiency virus (HIV) infection or in the treatment of at least one symptom resulting from HIV infection, comprising administering to a subject that has been infected with HIV at least one composition as defined above, wherein administration of the composition to the subject reduces HIV infection or at least one symptom resulting from HIV infection in a subject.
Preferably the administration of the composition to the subject reduces HIV viral load in the subject.
Preferably administration of the composition to the subject increases or stabilizes CD4+ cell counts in the subject.
Still preferably administration of the composition reduces the amount, duration or frequency of anti-viral therapy administered to the subject.
Still preferably administration of the composition results in a functional cure of HIV infection in the subject.
The present invention also provides a method to elicit an antigen-specific, cell-mediated immune response against an HIV antigen, comprising administering to a subject at least one composition as defined above. Preferably the immune response is a cytotoxic T lymphocyte (CTL) response.
The present invention also provides a method to prevent HIV infection in a subject, comprising administering to a subject that has not been infected with HIV, at least one composition as defined above.
The present invention also provides a method to immunize a population of individuals against HIV, comprising administering to the population of individuals at least one composition as defined above.
The present invention also provides the composition as defined above for use to treat HIV infection or a symptom thereof or for use to prevent HIV infection or a symptom thereof. In the present invention the composition may be administered either systemically (in which case yeast cells will be previously heat killed) or orally (live yeasts producing the antigen in their surface).
In the present invention AGA2 sequence might precede HIV antigen sequence if AGA1/AGA2 system is used for surface expression. AGAlp/AGA2p system is not required for cytoplasmatic expression of HIV antigen, such as Gag. This invention generally relates to compositions and methods for preventing and/or treating human immunodeficiency virus (HIV) infection. The invention includes a yeast-based immunotherapeutic composition (also referred to as "yeast-based HIV immunotherapy") comprising a yeast vehicle and HIV antigen(s) that have been designed to elicit a prophylactic and/or therapeutic immune response against HIV infection in an individual, and the use of such compositions to prevent and/or treat HIV infection and related symptoms thereof. The invention also includes the recombinant nucleic acid molecules used in the yeast-based compositions of the invention, as well as the proteins and fusion proteins encoded thereby, for use in any immunotherapeutic composition and/or any therapeutic or prophylactic protocol for HIV infection, including any therapeutic or prophylactic protocol that combines the HIV-specific yeast-based compositions of the invention with any one or more other therapeutic or prophylactic compositions, agents, drugs, compounds, and/or protocols for HIV infection. The yeast-based, HIV-specific immunotherapeutic compositions are unique among various types of immunotherapy, in that these compositions of the invention induce innate immune responses, as well as adaptive immune responses that specifically target HIV, including TH1 T cell responses and antigen- specific CD8+ T cell responses. The breadth of the immune response elicited by HIV-specific yeast-based immunotherapy is well-suited to target HIV. Yeast-based HIV immunotherapy, by activating both the innate and the adaptive immune responses, and both CD4+ and CD8+ T cell responses, is expected to effectively target HIV-infected cells for destruction and/or is expected to effectively enhance viral clearance, as well as provide long term memory immunity against reactivating virus.
I n one aspect of the invention, yeast-based HIV immunotherapy is combined with anti-viral drugs, and/or with other therapies for HIV, in order to reduce the viral load in an individual to a level that can be more effectively handled by the immune system.
Yeast-based immunotherapeutic compositions are administered as biologicals or pharmaceutically acceptable compositions. Accordingly, rather than using yeast as an antigen production system followed by purification of the antigen from the yeast, the entire yeast vehicle as described herein must be suitable for, and formulated for, administration to a patient. Accordingly, the yeast-based immunotherapeutic compositions of the invention contain readily detectable yeast DNA and contain substantially more than 5% yeast protein; generally, yeast- based immunotherapeutics of the invention contain more than 70%, more tha n 80%, or generally more than 90% yeast protein. Yeast-based immunotherapeutic compositions are administered to a patient in order to immunize the patient for therapeutic and/or prophylactic purposes. In one embodiment of the invention, the yeast-based compositions are formulated for administration in a pharmaceutically acceptable excipient or formulation. The composition should be formulated, in one aspect, to be suitable for administration to a human subject (e.g., the manufacturing conditions should be suitable for use in humans, and any excipients or formulations used to finish the composition and/or prepare the dose of the immunotherapeutic for administration should be suitable for use in humans). In one aspect of the invention, yeast-based immunotherapeutic compositions are formulated for administration by injection of the patient or subject, such as by a parenteral route (e.g., by subcutaneous, intraperitoneal, intramuscular or intradermal injection, or another suitable parenteral route).
In one embodiment, the yeast express the antigen (e.g., detectable by a Western blot), and the antigen is not aggregated in the yeast, the antigen does not form inclusion bodies in the yeast, and/or does not form very large particles (VLPs) or other large antigen particles in the yeast. In another embodiment, the antigen is produced as a soluble protein in the yeast, and/or is not secreted from the yeast or is not substantially or primarily secreted from the yeast. In yet another embodiment, particular combinations and/or arrangements of antigens in an HIV fusion protein are utilized in a yeast-based immunotherapeutic of the invention to intentionally form VLPs or aggregates within the yeast (discussed in more detail below). The resulting antigen expressed by the yeast is believed, without being bound by theory, to have additional immunogenic properties related to its overall structure and form, as a separate characteristic from the immunogenic properties of the immune epitopes (e.g., T cell epitopes) carried within the antigen. When the yeast expressing such fusion proteins are provided in a yeast-based HIV immunotherapeutic of the invention, the immunotherapeutic composition derives properties that activate the innate immune system not only from the yeast vehicle as discussed above (as with all yeast-based immunotherapeutics described herein), but also in part from the fusion protein antigen structure; in addition, the immunotherapeutic composition derives properties that activate the adaptive immune system in an antigen- specific manner from the fusion protein (via provision of various T cell epitopes), as with all of the yeast-based immunotherapeutics described herein. In all of the embodiments of the invention described herein, the yeast-based immunotherapeutics should be readily phagocytosed by dendritic cells of the immune system, and the yeast and antigens readily processed by such dendritic cells, in order to elicit an effective immune response against HIV.
Compositions of the Invention
One embodiment of the present invention relates to a yeast-based immunotherapy composition which can be used to prevent and/or treat HIV infection and/or to alleviate at least one symptom resulting from the HIV infection. The composition comprises: (a) a yeast vehicle; and (b) one or more antigens comprising HIV protein(s) and/or immunogenic domain(s) thereof. In conjunction with the yeast vehicle, the HIV proteins are most typically expressed as recombinant proteins by the yeast vehicle {e.g., by an intact yeast or yeast spheroplast, which can optionally be further processed to a yeast cytoplast, yeast ghost, or yeast membrane extract or fraction thereof), although it is an embodiment of the invention that one or more such HIV proteins are loaded into a yeast vehicle or otherwise complexed with, attached to, mixed with or administered with a yeast vehicle as described herein to form a composition of the present invention. According to the present invention, reference to a "heterologous" protein or "heterologous" antigen, including a heterologous fusion protein, in connection with a yeast vehicle of the invention, means that the protein or antigen is not a protein or antigen that is naturally expressed by the yeast, although a fusion protein that includes heterologous antigen or heterologous protein may also include yeast sequences or proteins or portions thereof that are also naturally expressed by yeast {e.g., an alpha factor prepro sequence).
One embodiment of the invention relates to various HIV fusion proteins. In one aspect, such HIV fusion proteins are useful in a yeast-based immunotherapeutic composition of the invention. Such fusion proteins, and/or the recombinant nucleic acid molecules encoding such proteins, can also be used in, in combination with, or to produce, a non-yeast-based immunotherapeutic composition, which may include, without limitation, a DNA vaccine, a protein subunit vaccine, a recombinant viral-based immunotherapeutic composition, a killed or inactivated pathogen vaccine, a dendritic cell vaccine, and/or an autologous T cell vaccine (the subject's T cells that have been stimulated ex vivo using a fusion protein of the invention). In another embodiment, such fusion proteins can be used in a diagnostic assay for HIV and/or to generate antibodies against HIV. Described herein are exemplary HIV fusion proteins providing selected portions of HIV antigens, including, for example, selected portions of and/or modified polymerase (Pol), selected portions of and/or modified Gag, and selected portions of and/or modified envelope (Env), as well as selected portions of and/or arrangements of any one, two, or all three of these antigens.
Human Immunodeficiency Virus, Genes, and Proteins
HIV is a Group VI (ssR A-RT) virus and a member of the virus family Retroviridae and the genus Lentivirus. It is widely accepted that HIV evolved at some point in time from closely related Simian immunodeficiency virus (SIV), and was transferred from non-human primates (SIV or HIV) to humans in the recent past. HIV can be divided into two main types or species, known as HIV type 1 (HIV-1) and HIV type 2 (HIV-2). HIV-1, the most common and pathogenic strain of the virus and the cause of most infections worldwide, is further divided into groups, which are each believed to represent an independent transmission of SIV into humans. Currently, HIV-1 has been divided into Groups M (for "major" or "main"), N, 0 and P, with Group M being the most prevalent HIV-1 group. Group M is further divided into clades, known generally as "subtypes" {e.g., subtypes A-K). Subtypes may be further divided into sub-subtypes and also "circulating recombinant forms" (CRF) where two subtypes are believed to have recombined to form a new subtype. HIV-2 has also been divided into groups, although only 2 groups (A and B) are epidemic. HIV-1 contains 39 open reading frames (ORFs) in all possible six reading frames (Dwivedi et al. Res. J. Biological Sci., 1(7), 52-54(2012)), although only a few of them are functional. Although any HIV protein or functional, structural or immunogenic domain thereof, may be used in a yeast-based immunotherapy composition, three particularly useful proteins include HIV Gag, HIV Pol and HIV Env, and/or any functional, structural or immunogenic domain of any of these proteins, gag (group-specific antigen) encodes the precursor Gag polyprotein, which is processed by viral protease during maturation to MA (matrix protein, pi 7); CA (capsid protein, p24); SP1 (spacer peptide 1, p2); NC (nucleocapsid protein, p7); SP2 (spacer peptide 2, pi) and p6 (King, Steven R. (1994) HIV: Virology and Mechanisms of disease. Annals of Emergency Medicine. 24:443-449). pol (polymerase) encodes the viral enzymes: reverse transcriptase (RT), RNase H, integrase, and HIV protease (Votteler and Schubert, (2008) Human Immunodeficiency Viruses: Molecular Biology. Encyclopedia of Virology. (3rd ed.) 517- 525). HIV protease is required to cleave the precursor Gag polyprotein to produce structural proteins; RT is required to transcribe DNA from RNA template; integrase integrates the double-stranded viral DNA into the host genome (Mushahwar (2007) Human Immunodeficiency Viruses: Molecular Virology, pathogenesis, diagnosis and treatment. Perspectives in Medical Virology. 13:75-87). env (for "envelope") encodes gpl60, which is cleaved by cellular protease rather than viral to produce the surface lipoprotein gpl20 which attaches to the CD4 receptors present on lymphocytes and gp41 (transmembrane), proteins embedded in the viral envelope that enable the virus to attach to and fuse with target cells (Mushahwar, 2007, supra; King, 1994, supra).
The nucleic acid and amino acid sequence for HIV genes and the proteins encoded thereby are known in the art for a variety of strains/isolates from the various known HIV types, groups, and subtypes. It is noted that variations may occur in the amino acid sequence between different viral isolates of the same protein or domain from HIV. Using the guidance provided herein and the reference to the exemplary HIV sequences, one of skill in the art will readily be able to produce a variety of HIV-based proteins, including fusion proteins, from any HIV type, group, subtype, genotype or strain (isolate), for use in the compositions and methods of the present invention, and as such, the invention is not limited to the specific sequences disclosed herein. Reference to an HIV protein or HIV antigen anywhere in this disclosure, or to any functional, structural, or immunogenic domain thereof, can accordingly be made by reference to a particular sequence from one or more of the sequences presented in this disclosure, or by reference to the same, similar or corresponding sequence from a different HIV isolate (strain).
Human Immunodeficiency Virus Antigens and Constructs
One embodiment of the invention relates to novel HIV antigens and fusion proteins and recombinant nucleic acid molecules encoding these antigens and proteins. Described herein are several different novel HIV antigens for use in a yeast-based immunotherapeutic composition or other composition {e.g., other immunotherapeutic or diagnostic composition) that provide one or multiple (two, three, four, five, six, seven, eight, nine or more) antigens from one or more proteins, all contained within the same fusion protein and encoded by the same recombinant nucleic acid construct (recombinant nucleic acid molecule). The antigens used in the compositions of the invention include at least one HIV protein or immunogenic domain thereof for immunizing an animal (prophylactically or therapeutically). The composition can include one, two, three, four, a few, several or a plurality of HIV antigens, including one, two, three, four, five, six, seven, eight, nine, ten, or more immunogenic domains of one, two, three, four or more HIV proteins. In some embodiments, the antigen is a fusion protein. In one aspect of the invention, fusion protein can include two or more proteins. In one aspect, the fusion protein can include two or more immunogenic domains and/or two or more epitopes of one or more proteins. An immunotherapeutic composition containing such antigens may provide antigen- specific immunization in a broad range of patients. For example, an antigen or fusion protein encompassed by the invention can include at least a portion of, or the full-length of, any one or more HIV proteins selected from: HIV Gag, HIV Env, or HIV Pol; and/or any one or more immunogenic domains of any one or more of these HIV proteins. Other HIV proteins (e.g., Nef, Vif, Vpr, Tat, Rev, Vpu) may be used in an antigen construct in the invention, although use of Gag, Env and Pol is particularly preferred.
Recombinant nucleic acid molecules and the proteins encoded thereby, including fusion proteins, as one embodiment of the invention, may be used in yeast-based immunotherapy compositions, or for any other suitable purpose for HIV antigen(s), including in an in vitro assay, for the production of antibodies, or in another immunotherapy composition, including another vaccine, that is not based on the yeast- based immunotherapy described herein. Expression of the proteins by yeast is one preferred embodiment, although other expression systems may be used to produce the proteins for applications other than a yeast-based immunotherapy composition.
According to the present invention, the general use herein of the term "antigen" refers to any portion of a protein (peptide, partial protein, full-length protein), wherein the protein is naturally occurring or synthetically derived, to a cellular composition (whole cell, cell lysate or disrupted cells), to an organism (whole organism, lysate or disrupted cells) or to a carbohydrate, or other molecule, or a portion thereof. An antigen may elicit an antigen-specific immune response (e.g., a humoral and/or a cell- mediated immune response) against the same or similar antigens that are encountered by an element of the immune system (e.g., T cells, antibodies). An antigen can be as small as a single epitope, a single immunogenic domain or larger, and can include multiple epitopes or immunogenic domains. As such, the size of an antigen can be as small as about 8-12 amino acids (i.e., a peptide) and as large as: a full length protein, a multimer, a fusion protein, a chimeric protein, a whole cell, a whole microorganism, or any portions thereof (e.g., lysates of whole cells or extracts of microorganisms). In addition, antigens can include carbohydrates, which can be loaded into a yeast vehicle or into a composition of the invention. It will be appreciated that in some embodiments (e.g., when the antigen is expressed by the yeast vehicle from a recombinant nucleic acid molecule), the antigen is a protein, fusion protein, chimeric protein, or fragment thereof, rather than an entire cell or microorganism. When the antigen is to be expressed in yeast, an antigen is of a minimum size capable of being expressed recombinantly in yeast, and is typically at least or greater than 25 amino acids in length, or at least or greater than 26, at least or greater than 27, at least or greater than 28, at least or greater than 29, at least or greater than 30, at least or greater than 31, at least or greater than 32, at least or greater than 33, at least or greater than 34, at least or greater than 35, at least or greater than 36, at least or greater than 37, at least or greater than 38, at least or greater than 39, at least or greater than 40, at least or greater than 41, at least or greater than 42, at least or greater than 43, at least or greater than 44, at least or greater than 45, at least or greater than 46, at least or greater than 47, at least or greater than 48, at least or greater than 49, or at least or greater than 50 amino acids in length, or is at least 25-50 amino acids in length, at least 30-50 amino acids in length, or at least 35-50 amino acids in length, or at least 40-50 amino acids in length, or at least 45-50 amino acids in length. Smaller proteins may be expressed, and considerably larger proteins (e.g., hundreds of amino acids in length or even a few thousand amino acids in length) may be expressed. In one aspect, a full-length protein, or a structural or functional domain thereof, or an immunogenic domain thereof, that is lacking one or more amino acids from the N- and/or the C-terminus may be expressed (e.g., lacking between about 1 and about 20 amino acids from the N- and/or the C-terminus). Fusion proteins and chimeric proteins are also antigens that may be expressed in the invention. A "target antigen" is an antigen that is specifically targeted by an immunotherapeutic composition of the invention (i.e., an antigen against which elicitation of an immune response is desired). An "HIV antigen" is an antigen derived, designed, or produced from one or more HIV proteins such that targeting the antigen also targets the human immunodeficiency virus.
When referring to stimulation of an immune response, the term "immunogen" is a subset of the term "antigen", and therefore, in some instances, can be used interchangeably with the term "antigen". An immunogen, as used herein, describes an antigen which elicits a humoral and/or cell-mediated immune response {i.e., is immunogenic), such that administration of the immunogen to an individual mounts an antigen-specific immune response against the same or similar antigens that are encountered by the immune system of the individual. In one embodiment, an immunogen elicits a cell-mediated immune response, including a CD4+ T cell response {e.g., TH1, TH2 and/or TH17) and/or a CD8+ T cell response {e.g., a CTL response).
An "immunogenic domain" of a given antigen can be any portion, fragment or epitope of an antigen {e.g., a peptide fragment or subunit or an antibody epitope or other conformational epitope) that contains at least one epitope that acts as an immunogen when administered to an animal. Therefore, an immunogenic domain is larger than a single amino acid and is at least of a size sufficient to contain at least one epitope that can act as an im munogen. For example, a single protein ca n contain multiple different immunogenic domains. I mmunogenic domains need not be linear sequences within a protein, such as in the case of a humoral immune response, where conformational domains are contemplated.
A "functional domain" of a given protein is a portion or functional unit of the protein that includes sequence or structure that is directly or indirectly responsible for at least one biological or chemical function associated with, ascribed to, or performed by the protein. For example, a functional domain ca n include an active site for enzymatic activity, a ligand binding site, a receptor binding site, a binding site for a molecule or moiety such as calcium, a phosphorylation site, or a transactivation domain.
A "structural domain" of a given protein is a portion of the protein or an element in the protein's overall structure that has an identifiable structure {e.g., it may be a primary or tertiary structure belonging to and indicative of several proteins within a class or family of proteins), is self- stabilizing and/or may fold independently of the rest of the protein. A structural domain is frequently associated with or features prominently in the biological function of the protein to which it belongs.
An epitope is defined herein as a single immunogenic site within a given antigen that is sufficient to elicit an immune response when provided to the immune system in the context of appropriate costimulatory signals and/or activated cells of the immune system. I n other words, an epitope is the part of an a ntigen that is actually recognized by components of the immune system, and may also be referred to as an antigenic determinant. Those of skill in the art will recognize that T cell epitopes are different in size and composition from B cell or antibody epitopes, and that epitopes presented through the Class I M HC pathway differ in size and structural attributes from epitopes presented through the Class II MHC pathway. For example, T cell epitopes presented by Class I MHC molecules are typically between 8 and 11 amino acids in length, whereas epitopes presented by Class I I M HC molecules are less restricted in length and may be from 8 amino acids up to 25 amino acids or longer. I n addition, T cell epitopes have predicted structural characteristics depending on the specific M HC molecules bound by the epitope. M ultiple different T cell epitopes have been identified in various HIV strains and for many human HLA types. Epitopes can be linear sequence epitopes or conformational epitopes (conserved binding regions). Most antibodies recognize conformational epitopes.
An HIV antigen useful in the present invention, in one embodiment, comprises one or more CTL epitopes (e.g., epitopes that are recognized by a T cell receptor of a cytotoxic T lymphocyte (CTL), when presented in the context of an appropriate Class I MHC molecule). In one aspect, the HIV antigen comprises one or more CD4+ T cell epitopes (e.g., epitopes that are recognized by a T cell receptor of a CD4+ T cell, in the context of an appropriate Class II MHC molecule). In one aspect, the HIV antigen comprises one or more CTL epitopes and one or more CD4+ T cell epitopes. In one embodiment, the epitope can be modified to correspond to the sequence of the epitope within a type, group, subtype, genotype or strain/isolate of HIV, since there may be one or more amino acid differences at these epitopes among type, group, subtype, genotype or strain/isolate.
In one embodiment of the invention, an HIV antigen useful in a yeast-based immunotherapeutic maximizes the inclusion of immunogenic domains, and particularly, T cell epitopes, that are conserved among HIV types, groups, subtypes, genotypes or strains/isolates, and/or includes immunogenic domains from several different types, groups, subtypes, genotypes or strains/isolates and/or includes immunogenic domains that can readily be modified to produce multiple yeast-based immunotherapeutic products that differ in some minor respects, but are tailored to treat different individuals or populations of individuals based on the HIV type, group, subtype, genotype or strain/isolate that infects such individuals or populations of individuals. For example, the HIV antigen can be produced based on an HIV-1 group(s) or subtype(s) that is most prevalent among individuals or populations of individuals to be protected or treated, and the HIV antigen includes the most conserved immunogenic domains from that group(s) or subtype(s). Alternatively or in addition, immunogenic domains can be modified to correspond to a consensus sequence for that domain or epitope, or more than one version of the epitope can be included in the construct.
In addition, as discussed in more detail below, the inventors propose herein to improve the targeting of multi-dimensional regions of HIV in an immunotherapy approach by introducing Altered Peptide Ligand (APL) sites that, without being bound by theory, are believed by the inventors to further enhance an immune response in individuals who are not elite non- progressors, enabling or facilitating the ability of such individuals to mount a productive immune response against the most vulnerable targets in the virus. In any embodiment of the invention related to the design of an HIV antigen for a yeast-based immunotherapeutic composition, in one aspect, artificial junctions between segments of a fusion protein comprising HIV antigens is minimized (i.e., the inclusion of non-natural sequences is limited or minimized to the extent possible). Without being bound by theory, it is believed that natural evolution has resulted in: i) contiguous sequences in the virus that most likely to be expressed well in another cell, such as a yeast; and ii) an immunoproteasome in antigen presenting cells that can properly digest and present those sequences to the immune system. The yeast-based immunotherapeutic product of the invention allows the host immune system to process and present target antigens; accordingly, a fusion protein with many unnatural junctions may be less useful in a yeast-based immunotherapeutic as compared to one that retains more of the natural HIV protein sequences.
In any of the HIV antigens described herein, including any of the fusion proteins, the following additional embodiments can apply. First, an N-terminal expression sequence and/or a C- terminal tag are optional, and if used, may be selected from several different sequences described below to improve expression, stability, and/or allow for identification and/or purification of the protein. In one aspect, one or both of the N- or C- terminal sequences are omitted altogether. In addition, many different promoters suitable for use in yeast are known in the art and are encompassed for use to express HIV antigens according to the present invention. Furthermore, short intervening linker sequences (e.g., 1 , 2, 3, 4, or 5, or larger, amino acid peptides) may be introduced between portions of the fusion protein for a variety of reasons, including the introduction of restriction enzyme sites to facilitate cloning and future manipulation of the constructs. Finally, as discussed in detail elsewhere herein, the sequences described herein are exemplary, and may be modified as described in detail elsewhere herein to substitute, add, or delete sequences in order to accommodate preferences for HIV strain or isolate, or consensus sequences and inclusion of preferred T cell epitopes, including dominant and/or subdominant T cell epitopes. A description of several different exemplary HIV antigens useful in the invention is provided below.
As discussed above, optionally, proteins, including fusion proteins, which are used as a component of the yeast-based immunotherapeutic composition of the invention, can be produced using constructs that are particularly useful for improving or enhancing the expression, or the stability of expression, of recombinant antigens in yeast. Typically, the desired antigenic protein(s) or peptide(s) are fused at their amino-terminal (N-terminal) end to: (a) a specific synthetic peptide that stabilizes the expression of the fusion protein in the yeast vehicle or prevents posttranslational modification of the expressed fusion protein (such peptides are described in detail, for example, in U.S. Patent Publication No. 2004- 0156858 Al , published August 12, 2004, incorporated herein by reference in its entirety); (b) at least a portion of an endogenous yeast protein, including but not limited to alpha factor, wherein either fusion partner provides improved stability of expression of the protein in the yeast and/or a prevents post-translational modification of the proteins by the yeast cells (such proteins are also described in detail, for example, in U.S. Patent Publication No. 2004-0156858 Al , supra); and/or (c) at least a portion of a yeast protein that causes the fusion protein to be expressed on the surface of the yeast (e.g., an Aga protein, described in more detail herein). In addition, the present invention optionally includes the use of peptides that are fused to the C-terminus of the antigen-encoding construct, particularly for use in the selection and identification of the protein. Such peptides include, but are not limited to, any synthetic or natural peptide, such as a peptide tag (e.g., hexahistidine) or any other short epitope tag. Peptides attached to the C- terminus of an antigen according to the invention can be used with or without the addition of the N- terminal peptides discussed herein.
In one embodiment, a synthetic peptide useful in a fusion protein is linked to the N-terminus of the antigen, the peptide consisting of at least two amino acid residues that are heterologous to the antigen, wherein the peptide stabilizes the expression of the fusion protein in the yeast vehicle or prevents posttranslational modification of the expressed fusion protein. The synthetic peptide and N-terminal portion of the antigen together form a fusion protein that has the following requirements: (1) the amino acid residue at position one of the fusion protein is a methionine (i.e., the first amino acid in the synthetic peptide is a methionine); (2) the amino acid residue at position two of the fusion protein is not a glycine or a proline (i.e., the second amino acid in the synthetic peptide is not a glycine or a proline); (3) none of the amino acid residues at positions 2-6 of the fusion protein is a methionine (i.e., the amino acids at positions 2-6, whether part of the synthetic peptide or the protein, if the synthetic peptide is shorter than 6 amino acids, do not include a methionine); and (4) none of the amino acids at positions 2-6 of the fusion protein is a lysine or an arginine (i.e., the amino acids at positions 2-6, whether part of the synthetic peptide or the protein, if the synthetic peptide is shorter than 5 amino acids, do not include a lysine or an arginine). The synthetic peptide can be as short as two amino acids, but in one aspect, is 2-6 amino acids (including 3, 4, 5 amino acids), and can be longer than 6 amino acids, in whole integers, up to about 200 amino acids, 300 amino acids, 400 amino acids, 500 amino acids, or more.
In one embodiment, a fusion protein comprises an amino acid sequence of M-X2-X3-X4-X5-X6, wherein M is methionine; wherein X2 is any amino acid except glycine, proline, lysine or arginine; wherein X3 is any amino acid except methionine, lysine or arginine; wherein X4 is any amino acid except methionine, lysine or arginine; wherein X5 is any amino acid except methionine, lysine or arginine; and wherein X6 is any amino acid except methionine, lysine or arginine. In one embodiment, the X6 residue is a proline. An exemplary synthetic sequence that enhances the stability of expression of an antigen in a yeast cell and/or prevents post- translational modification of the protein in the yeast includes the sequence M-A-D-E-A-P (SEQ. ID NO:15). Another exemplary synthetic sequence with the same properties is M-V. In addition to the enhanced stability of the expression product, these fusion partners do not appear to negatively impact the immune response against the immunizing antigen in the construct. In addition, the synthetic fusion peptides can be designed to provide an epitope that can be recognized by a selection agent, such as an antibody.
In one embodiment, the HIV antigen is linked at the N-terminus to a yeast protein, such as an alpha factor prepro sequence. Other sequences for yeast alpha factor prepro sequence are known in the art and are encompassed for use in the present invention.
The HIV sequences used to design fusion proteins described herein are based on isolates of particular human immunodeficiency viruses. However, it is an embodiment of the invention to add to or substitute into any portion of an HIV antigen described herein that is based on or derived from one particular strain or isolate, with a corresponding sequence, or even a single or small amino acid substitution, insertion or deletion that occurs in a corresponding sequence, from any other HIV strain(s) or isolate(s). In one embodiment, an HIV antigen can be produced by substituting an entire sequence(s) of an HIV antigen described herein with the corresponding sequence(s) from one or more different HIV strain/isolates. Adding to or substituting a sequence from one HIV strain for another, for example, allows for the customization of the immunotherapeutic composition for a particular individual or population of individuals (e.g., a population of individuals within a given country or region of a country, in order to target the HIV sequences that are most prevalent in that country or region of the country). Similarly, it is also an embodiment of the invention to use all or a portion of a consensus sequence derived from, determined from, or published for, a given HIV strain to make changes in the sequence of a given HIV antigen to more closely or exactly correspond to the consensus sequence. According to the present invention and as generally understood in the art, a "consensus sequence" is typically a sequence based on the most common nucleotide or amino acid at a particular position of a given sequence after multiple sequences are aligned.
As a particular example of the above-mentioned types of modifications, an HIV antigen can be modified to change a T cell epitope in a given sequence from one isolate to correspond more closely or exactly with a T cell epitope from a different isolate, or to correspond more closely or exactly with a consensus sequence for the T cell epitope. Such T cell epitopes can include dominant epitopes and/or sub-dominant epitopes. Alignments of major HIV proteins across exemplary sequences from various strains can be readily generated using publicly available software, which will inform the generation of consensus sequences, for example. Furthermore, consensus sequences for many HIV proteins have been published.
In one embodiment of the invention, the HIV antigen(s) for use in a composition or method of the invention is a fusion protein comprising HIV antigens, wherein the HIV antigens comprise or consist of HIV Gag or at least one functional, structural or immunogenic domain thereof; HIV Pol or at least one functional, structural or immunogenic domain thereof; and/or HIV Env or at least one functional, structural or immunogenic domain thereof. According to any embodiment of the present invention, reference to a "full-length" protein (or a full-length functional domain, a full-length structural domain, or a full-length immunological domain) includes the full-length amino acid sequence of the protein or functional domain, structural domain or immunological domain, as described herein or as otherwise known or described in a publicly available sequence. A protein or domain that is "near full-length", which is also a type of homologue of a protein, differs from a full-length protein or domain, by the addition or deletion or omission of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids from the N- and/or C- terminus of such a full-length protein or full-length domain. General reference to a protein or domain can include both full- length and near full-length proteins, as well as other homologues thereof.
In one aspect, the HIV antigen comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the linear sequence of a full-length HIV protein, or of a functional, structural or immunogenic domain thereof. In one aspect, the HIV antigen is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to a full-length HIV protein, or a functional, structural or immunogenic domain thereof. One example of a yeast-based immunotherapeutic composition for HIV useful in the present invention is described herein. I n this embodiment, yeast (e.g., Saccharomyces cerevisiae) are engineered to express an HIV Gag protein, under the control of the TEF1 and/or PGK1 promoter. I n each case, the HIV fusion protein is a single polypeptide with the following sequence elements fused in frame from N- to C-terminus, represented by 1) the amino acid sequence of AGA2 and 2) the a mino acid sequence of an HIV Gag. For instance sequence I D for H IV Gag is Genebank ref: AAB50258.1 and for AGA2 (NCBI ref: NM_001180897.3).
As discussed above, this fusion protein can be constructed using any of the N-terminal and/or C-terminal sequences as described herein, and/or amino acid linkers ca n be introduced between proteins or domains in the fusion protein. I n one aspect, the C-terminus of the fusion protein is modified to append a hexahistidine tag.
Agonist Antigens
I n some aspects of the invention, amino acid insertions, deletions, and/or substitutions can be made for one, two, three, four, five, six, seven, eight, nine, ten, or more amino acids of a wild- type or reference HIV protein, provided that the resulting HIV protein, when used as an antigen in a yeast- HIV immunotherapeutic composition of the invention, elicits an immune response against the target or wild-type or reference HIV protein, which may include an enhanced immune response, a diminished immune response, or a substantially similar immune response. For example, the invention includes the use of HIV agonist antigens (also referred to herein as "Altered Peptide Ligands" (APLs), which are HIV antigens that may include one or more T cell epitopes, and particularly, cytotoxic T lymphocyte (CTL) epitopes, that have been mutated by substitution of one or more amino acid residues for a different amino acid residue(s) to create an "agonist epitope". The purpose of the m utation is to elicit a T cell response against the HIV agonist epitope that is enhanced/amplified/improved as compared to the response against the native antigen, which may be achieved by improving the avidity or affinity of the epitope for an M HC molecule or for the T cell receptor that recognizes the epitope in the context of M HC presentation. HIV antigen agonists may therefore improve the potency or efficiency of a T cell response against native HIV proteins that infect a host.
The present invention includes multiple novel HIV antigens harboring HIV Altered Peptide Ligand (APL) mutations (HIV agonist epitopes). These mutations are incorporated into an HIV Gag antigen or fusion protein comprising an HIV Gag antigen that is expressed by a yeast-based immunotherapy composition for HIV and, upon immunization of a subject, are designed to generate improved, enhanced or amplified T cell responses against the HIV-infected target cells as compared to T cell responses generated by a yeast-based immunotherapeutic composition expressing natural (native, or wild-type) HIV Gag sequences. As discussed above, the improved T cell responses may be due to improved avidity or affinity of the T cell epitope(s) in the antigen for the MHC molecule or for the T cell receptor that recognizes the epitope in the context of the MHC molecule.
The idea of using APL variants of CTL epitopes is an emerging concept in cancer vaccines, wherein the target of the immunotherapy may be a self-antigen, where an effective vaccine must break immune tolerance. Vaccination with APL peptides is one effective way to break tolerance. However, while APLs have been explored in CTL- inducing cancer vaccines, and also for use in enhancing antibody responses to infectious agents including HIV, the use of APLs or agonist peptides for CTL-inducing therapeutic vaccines targeting infectious diseases such as HIV {i.e., via a yeast-based immunotherapeutic of the invention) is believed to be a new concept unique to the present invention.
Accordingly, one embodiment of the present invention relates to a series of yeast-based immunotherapy compositions for HIV as described herein, in which the heterologous antigen expressed in the yeast is a highly conserved domain of HIV Gag with APL mutations at sites that are: i) highly invariant across HIV clades, and; ii) immunologically "vulnerable", on the basis that T cells targeting these sites are preferentially found in elite non-progressor patients {i.e., those that durably control HIV without medical intervention). Some of these "vulnerable" HIV Gag residues were recently identified using a computational algorithm and when mutated, are predicted to destabilize the HIV capsid by disrupting Gag inter-subunit interactions (Dahirel et al., 2011, supra). The key role of these residues, termed "sector 3" residues (see discussion above), aligns with the observation that patients with T cells capable of targeting epitopes containing these residues control viral progression.
Of note, HIV elite non-progressors typically possess HLA types that are not the prevailing alleles in the general population. An example of a prevailing allele in the general population and one which is present at relatively closely matched frequencies across multiple different races is HLA- A*0201. Therefore, the present inventor proposes that a yeast-based immunotherapeutic composition with the ability to induce high avidity T cell responses to sector 3 residues in patients with common HLA alleles such as HLA- A*0201 represent a powerful new approach to HIV immunotherapy.
The epitopes in H IV elite non-progressors bind MHC alleles other than the ubiquitous HLA-A*- 0201. An additional facet included in the design of the HIV Gag-APL antigens of the invention therefore included the use of residues at key anchor positions that are preferred or at least compatible with binding to the HLA-A*0201. Preferred HLA- A*0201 binding residues at upstream (Ausua lly position 2) are L, M, and V, and tolerated residues at this position are T, Q, A, and I. Preferred HLA-A*0201 binding residues at the C terminus are I, V, and L, and tolerated residues at the C terminus are M, T, and A (Sidney and Southwood et al 2001 Human I mmunology 62: 1200-1216).
One embodiment of the present invention relates to a yeast-based immunotherapy composition for HIV com prising at least one H IV Gag a ntigen (including full-length Gag and/or any functional, structural, or imm unogenic domain of H IV Gag) and incorporating at least one amino acid modification to create an APL epitope as described above. The APL epitopes can be inserted by substitution into the native sequence of any of these Gag antigens, such that the APL epitope replaces the corresponding native sequence, and/or the APL epitopes, or HIV Gag sequence comprising one or more of the APL epitopes, can be added to any of the HIV antigens, thereby modifying the HIV antigen by addition (insertion). Multiple different APL epitopes from the same native epitope sequence ca n be used in a single HIV antigen according to the invention. For example, H IV Gag antigens comprising SEQ I D NO :l, may be combined to form a single HIV fusion protein, and may further be added to or incorporated by substitution into any of the HIV antigens described herein. By way of a simple example, a yeast-based immunotherapy composition of the invention can include a yeast (e.g., Saccharomyces cerevisiae or boulardii) engineered to express a full-length H IV Gag protein represented by SEQ. I D NO:l. As discussed above, this antigen ca n be constructed using any of the N-terminal and/or C-terminal sequences as described herein, and/or amino acid linkers ca n be introduced between proteins or domains in the fusion protein. In one aspect, the C-terminus of the fusion protein is modified to append a hexahistidine tag. Other similar and more complex fusion proteins constructed using the HIV antigens described herein a nd any one or more of the APL epitopes described herein are expressly encompassed by the invention and will be apparent to those skilled in the art based on the teachings provided herein. The invention also includes homologues of any of the above-described fusion proteins, as well as the use of homologues, variants, or mutants of the individual HIV proteins or portions thereof (including any functional and/or immunogenic domains) that are part of such fusion proteins or otherwise described herein. In one aspect, the invention includes the use of fusion proteins or individual (single) HIV proteins or HIV antigens, having amino acid sequences that are at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence of any one of the fusion proteins or individual HIV proteins or HIV antigens, respectively, described herein, including any of the HIV proteins, HIV antigens and fusion proteins referenced by a specific sequence identifier herein, over the full length of the fusion protein, or with respect to a defined segment in the fusion protein or a defined protein or domain thereof (immunogenic domain or functional domain (i.e., a domain with at least one biological activity)) that forms part of the fusion protein. Many CTL epitopes (epitopes that are recognized by cytotoxic T lymphocytes from patients infected with HIV) and escape mutations (mutations that arise in an HIV protein due to selective pressure from an anti-viral drug) are known in the art, and this information can also be used to make substitutions or create variants or homologues of the HIV antigens described herein in order to provide a specific sequence in the HIV antigen of the invention.
Another aspect of the invention includes an HIV antigen comprising, consisting essentially of, or consisting of, an amino acid sequence represented by any one or more of SEQ. ID NO: 1. The HIV antigen is suitable for use in any of the embodiments of the invention described herein, including in a yeast-based immunotherapy composition described herein.
Yeast-Based Immunotherapy Compositions
In various embodiments of the invention, the invention includes the use of at least one "yeast- based immunotherapeutic composition" (which phrase may be used interchangeably with "yeast-based immunotherapy product", "yeast-based immunotherapy composition", "yeast- based composition", "yeast-based immunotherapeutic", "yeast-based vaccine", or derivatives of these phrases). An "immunotherapeutic composition" is a composition that elicits an immune response sufficient to achieve at least one therapeutic benefit in a subject. As used herein, yeast-based immunotherapeutic composition refers to a composition that includes a yeast vehicle component and that elicits an immune response sufficient to achieve at least one therapeutic benefit in a subject. More particularly, a yeast-based immunotherapeutic composition is a composition that includes a yeast vehicle com ponent a nd ca n elicit or induce an immune response, such as a cellular immune response, including without limitation a T cell- mediated cellular immune response. I n one aspect, a yeast-based immunotherapeutic composition useful in the invention is capa ble of inducing a CD8 and/or a CD4 T cell-mediated immune response and in one aspect, a CD8 and a CD4 T cell-mediated immune response. Optionally, a yeast-based immunotherapeutic composition is capable of eliciting a humoral immune response. A yeast-based immunotherapeutic composition useful in the present invention can, for example, elicit an immune response in an individua l such that the individual is protected from HIV infection and/or is treated for HIV infection or for symptoms resulting from HIV infection.
Yeast-based immunotherapy compositions of the invention may be either "prophylactic" or "therapeutic". When provided prophylactica lly, the compositions of the present invention are provided in advance of any symptom of HIV infection. Such a composition could be administered perinatally {e.g., to a mother before birth, which may followed by administration to the infant at or shortly after birth, for example to protect an infant of a mother who is or may have been infected with HIV), at or shortly after birth of an infant, in early childhood, in later childhood or adolescence, and/or to adults, particularly adults who may be at higher risk of becoming infected with HIV. The prophylactic administration of the immunotherapy compositions serves to prevent subsequent HIV infection, to resolve an infection more quickly or more completely if HIV infection subsequently ensues, and/or to ameliorate the symptoms of HIV infection if infection subsequently ensues. When provided therapeutically, the immunotherapy compositions are provided at or after the onset of HIV infection, with the goal of ameliorating at least one symptom of the infection and preferably, with a goal of eliminating the infection, providing a long lasting remission of infection, and/or providing long term immunity against subsequent infections.
Typically, a yeast-based imm unotherapy composition includes a yeast vehicle and at least one antigen or immunogenic domain thereof expressed by, attached to, or mixed with the yeast vehicle, wherein the antigen is heterologous to the yeast, and wherein the a ntigen comprises one or more HIV antigens or immunogenic domains thereof. I n some embodiments, the antigen or immunogenic domain thereof is provided as a fusion protein. Several HIV fusion proteins suitable for use in the compositions and methods of the invention have been described herein. I n one aspect of the invention, fusion protein can include two or more antigens. In one aspect, the fusion protein can include two or more immunogenic domains of one or more antigens, or two or more epitopes of one or more antigens. I n any of the yeast-based immunotherapy compositions used in the present invention, the following aspects related to the yeast vehicle are included in the invention. According to the present invention, a yeast vehicle is any yeast cell (e.g., a whole or intact cell) or a derivative thereof (see below) that ca n be used in conjunction with one or more antigens, immunogenic domains thereof or epitopes thereof in a therapeutic composition of the invention, or in one aspect, the yeast vehicle can be used alone or as an adjuva nt. The yeast vehicle can therefore include, but is not limited to, a live intact (whole) yeast microorganism (i.e., a yeast cell having all its components including a cell wall), a killed (dead) or inactivated intact yeast microorganism, or derivatives of intact/whole yeast including: a yeast spheroplast (i.e., a yeast cell lacking a cell wall), a yeast cytoplast (i.e., a yeast cell lacking a cell wall and nucleus), a yeast ghost (i.e., a yeast cell lacking a cell wall, nucleus and cytoplasm), a subcellular yeast membrane extract or fraction thereof (also referred to as a yeast membrane particle and previously as a subcellular yeast particle), any other yeast particle, or a yeast cell wall preparation.
I n one aspect of the invention, the yeast vehicle is a whole yeast. I n one aspect, the yeast is a "processed yeast" (described below; generally a yeast that has been ground up or processed in a manner to produce yeast cell wall preparations, yeast membrane particles and/or yeast fragments (i.e., not intact), as well as a soluble yeast proteins.. I n one aspect, the yeast vehicle includes both a whole yeast and a processed yeast, administered either together, in concurrent but separate injections, or in sequential injections (e.g., temporally separated, which may include a prime -boost strategy).
Yeast spheroplasts are typically produced by enzymatic digestion of the yeast cell wall. Such a method is described, for example, in Franzusoff et a I, 1991, Meth. Enzymol. 194, 662-674., incorporated herein by reference in its entirety. Yeast cytoplasts are typically produced by enucleation of yeast cells. Such a method is described, for example, in Coon, 1978, Natl. Cancer I nst. Monogr. 48, 45-55 incorporated herein by reference in its entirety.
Yeast ghosts are typically produced by resealing a permeabilized or lysed cell and can, but need not, contain at least some of the organelles of that cell. Such a method is described, for example, in Franzusoff et a 1, 1983, J. Biol. Chem. 258, 3608-3614 and Bussey et al, 1979, Biochim. Biophys. Acta 553, 185-196, each of which is incorporated herein by reference in its entirety.
A yeast membrane particle (subcellular yeast membrane extract or fraction thereof) refers to a yeast membrane that lacks a natural nucleus or cytoplasm. The particle can be of any size, including sizes ranging from the size of a natural yeast membrane to microparticles produced by sonication or other membrane disruption methods known to those skilled in the art, followed by resealing. A method for producing subcellular yeast membrane extracts is described, for example, in Franzusoff et al., 1991, Meth. Enzymol. 194, 662-674. One may also use fractions of yeast membrane particles that contain yeast membrane portions and, when the antigen or other protein was expressed recombinantly by the yeast prior to preparation of the yeast membrane particles, the antigen or other protein of interest. Antigens or other proteins of interest can be carried inside the membrane, on either surface of the membrane, or combinations thereof (i.e., the protein can be both inside and outside the membrane and/or spanning the membrane of the yeast membrane particle). In one embodiment, a yeast membrane particle is a recombinant yeast membrane particle that can be an intact, disrupted, or disrupted and resealed yeast membrane that includes at least one desired antigen or other protein of interest on the surface of the membrane or at least partially embedded within the membrane.
An example of a yeast cell wall preparation is a preparation of isolated yeast cell walls carrying an antigen on its surface or at least partially embedded within the cell wall such that the yeast cell wall preparation, when administered to an animal, stimulates a desired immune response against a disease target.
Yeast are unicellular microorganisms that belong to one of three classes: Ascomycetes, Basidiomycetes and Fungi Imperfecti. One consideration for the selection of a type of yeast for use as an immune modulator is the pathogenicity of the yeast. In one embodiment, the yeast is a non-pathogenic strain such as Saccharomyces cerevisiae and Saccharomyces boulardii. The selection of a non-pathogenic yeast strain minimizes any adverse effects to the individual to whom the yeast vehicle is administered. However, pathogenic yeast may be used if the pathogenicity of the yeast can be negated by any means known to one of skill in the art {e.g., mutant strains).
The S. cerevisiae strain is one such strain that is capable of supporting expression vectors that allow one or more target antigen(s) and/or antigen fusion protein(s) and/or other proteins to be expressed at high levels. In addition, any mutant yeast strains can be used in the present invention, including those that exhibit reduced post-translational modifications of expressed target antigens or other proteins, such as mutations in the enzymes that extend N-linked glycosylation.
In most embodiments of the invention, the yeast-based immunotherapy composition includes at least one antigen, immunogenic domain thereof, or epitope thereof. The antigens contemplated for use in this invention include any HIV protein or immunogenic domain thereof, including mutants, variants and agonists of HIV proteins or domains thereof, against which it is desired to elicit an immune response for the purpose of prophylactically or therapeutically immunizing a host against HIV infection. HIV antigens that are useful in various embodiments of the invention are described in detail above, and elsewhere herein.
In one aspect of the invention, the yeast vehicle is manipulated such that the antigen is expressed or provided by delivery or translocation of an expressed protein product, partially or wholly, on the surface of the yeast vehicle (extracellular expression). One method for accomplishing this aspect of the invention is to use a spacer arm for positioning one or more protein(s) on the surface of the yeast vehicle. For example, one can use a spacer arm to create a fusion protein of the antigen(s) or other protein of interest with a protein that targets the antigen(s) or other protein of interest to the yeast cell wall. For example, one such protein that can be used to target other proteins is a yeast protein (e.g., cell wall protein 2 (cwp2), Aga2, Aga 1, Pir4 or Flol protein) that enables the antigen(s) or other protein to be targeted to the yeast cell wall such that the antigen or other protein is located on the surface of the yeast. Proteins other than yeast proteins may be used for the spacer arm; however, for any spacer arm protein, it is most desirable to have the immunogenic response be directed against the target antigen rather than the spacer arm protein. As such, if other proteins are used for the spacer arm, then the spacer arm protein that is used should not generate such a large immune response to the spacer arm protein itself such that the immune response to the target antigen(s) is overwhelmed. One of skill in the art should aim for a small immune response to the spacer arm protein relative to the immune response for the target antigen(s). Spacer arms can be constructed to have cleavage sites (e.g., protease cleavage sites) that allow the antigen to be readily removed or processed away from the yeast, if desired. Any known method of determining the magnitude of immune responses can be used (e.g., antibody production, lytic assays, etc.) and are readily known to one of skill in the art. Another method for positioning the target antigen(s) or other proteins to be exposed on the yeast surface is to use signal sequences such as glycosylphosphatidyl inositol (GPI) to anchor the target to the yeast cell wall. Alternatively, positioning can be accomplished by appending signal sequences that target the antigen(s) or other proteins of interest into the secretory pathway via translocation into the endoplasmic reticulum (ER) such that the antigen binds to a protein which is bound to the cell wall (e.g., cwp).
In one aspect, the spacer arm protein is a yeast protein. The yeast protein can consist of between about two and about 800 amino acids of a yeast protein. In one embodiment, the yeast protein is about 10 to 700 amino acids. In another embodiment, the yeast protein is about 40 to 600 amino acids. Other embodiments of the invention include the yeast protein being at least 250 amino acids, at least 300 amino acids, at least 350 amino acids, at least 400 amino acids, at least 450 amino acids, at least 500 amino acids, at least 550 amino acids, at least 600 amino acids, or at least 650 amino acids. In one embodiment, the yeast protein is at least 450 amino acids in length. Another consideration for optimizing antigen surface expression, if that is desired, is whether the antigen and spacer arm combination should be expressed as a monomer or as dimer or as a trimer, or even more units connected together. This use of monomers, dimers, trimers, etc. allows for appropriate spacing or folding of the antigen such that some part, if not all, of the antigen is displayed on the surface of the yeast vehicle in a manner that makes it more immunogenic.
Use of yeast proteins can stabilize the expression of fusion proteins in the yeast vehicle, prevents posttranslational modification of the expressed fusion protein, and/or targets the fusion protein to a particular compartment in the yeast (e.g., to be expressed on the yeast cell surface). For delivery into the yeast secretory pathway, exemplary yeast proteins to use include, but are not limited to: Aga (including, but not limited to, Agal and/or Aga2); SUC2 (yeast invertase); alpha factor signal leader sequence; CPY; Cwp2p for its localization and retention in the cell wall; BUD genes for localization at the yeast cell bud during the initial phase of daughter cell formation; Flolp; Pir2p; and Pir4p.
Other sequences can be used to target, retain and/or stabilize the protein to other parts of the yeast vehicle, for example, in the cytosol or the mitochondria or the endoplasmic reticulum or the nucleus. Examples of suitable yeast protein that can be used for any of the embodiments above include, but are not limited to, TK, AF, SEC7; phosphoenolpyruvate carboxykinase PCK1, phosphoglycerokinase PGK and triose phosphate isomerase TPI gene products for their repressible expression in glucose and cytosolic localization; the heat shock proteins SSA1, SSA3, SSA4, SSC1, whose expression is induced and whose proteins are more thermostable upon exposure of cells to heat treatment; the mitochondrial protein CYC 1 for import into mitochondria; ACT1.
Methods of producing yeast vehicles and expressing, combining and/or associating yeast vehicles with antigens and/or other proteins and/or agents of interest to produce yeast-based immunotherapy compositions are contemplated by the invention.
According to the present invention, the term "yeast vehicle-antigen complex" or "yeast-antigen complex" is used generically to describe any association of a yeast vehicle with an antigen, and can be used interchangeably with "yeast-based immunotherapy composition" when such composition is used to elicit an immune response as described above. Such association includes expression of the antigen by the yeast (a recombinant yeast), introduction of an antigen into a yeast, physical attachment of the antigen to the yeast, and mixing of the yeast and antigen together, such as in a buffer or other solution or formulation (e.g., a pharmaceutically acceptable excipient). These types of complexes are described in detail below.
In one embodiment, a yeast cell used to prepare the yeast vehicle is transfected with a heterologous nucleic acid molecule encoding a protein (e.g., the antigen) such that the protein is expressed by the yeast cell. Such a yeast is also referred to herein as a recombinant yeast or a recombinant yeast vehicle. The whole yeast cell, or a derivative or other modified vehicle produced from this yeast cell (e.g., yeast spheroplasts, cytoplasts, ghosts, or subcellular particles), can then be administered to a subject, including in a pharmaceutically acceptable excipient. In one aspect of the invention, the yeast vehicle can then be loaded into a dendritic cell. Yeast spheroplasts can also be directly transfected with a recombinant nucleic acid molecule (e.g., the spheroplast is produced from a whole yeast, and then transfected) in order to produce a recombinant spheroplast that expresses an antigen or other protein.
In general, the yeast vehicle and antigen(s) and/or other agents can be associated by any technique described herein. In one aspect, the yeast vehicle was loaded intracellular^ with the antigen(s) and/or agent(s). In another aspect, the antigen(s) and/or agent(s) was covalently or non-covalently attached to the yeast vehicle. In yet another aspect, the yeast vehicle and the antigen(s) and/or agent(s) were associated by mixing. In another aspect, and in one embodiment, the antigen(s) and/or agent(s) is expressed recombinantly by the yeast vehicle or by the yeast cell or yeast spheroplast from which the yeast vehicle was derived. A number of antigens and/or other proteins to be produced by a yeast vehicle of the present invention is any number of antigens and/or other proteins that can be reasonably produced by a yeast vehicle, and typically ranges from at least one to at least about 6 or more, including from about 2 to about 6 heterologous antigens and or other proteins.
Expression of an antigen or other protein in a yeast vehicle of the present invention is accomplished using techniques known to those skilled in the art. Briefly, a nucleic acid molecule encoding at least one desired antigen or other protein is inserted into an expression vector in such a manner that the nucleic acid molecule is operatively linked to a transcription control sequence in order to be capable of effecting either constitutive or regulated expression of the nucleic acid molecule when transformed into a host yeast cell. Nucleic acid molecules encoding one or more antigens and/or other proteins can be on one or more expression vectors operatively linked to one or more expression control sequences. Particularly important expression control sequences are those which control transcription initiation, such as promoter and upstream activation sequences. Any suitable yeast promoter can be used in the present invention and a variety of such promoters are known to those skilled in the art. Promoters for expression in Saccharomyces cerevisiae include, but are not limited to, promoters of genes encoding the following yeast proteins: alcohol dehydrogenase I (ADHI) or II (ADH2), CUP1, phosphoglycerate kinase (PGK), triose phosphate isomerase (TPI), translational elongation factor EF-1 alpha (TEF1), glyceraldehyde-3 -phosphate dehydrogenase (GAPDH; also referred to as TDH3, for triose phosphate dehydrogenase), galactokinase (GALI), galactose- 1 -phosphate uridyl- transferase (GAL7), UDP-galactose epimerase (GAL 10), cytochrome cl (CYCI), Sec7 protein (SEC7) and acid phosphatase (PH05), including hybrid promoters such as ADH2/GAPDH and CYC1/GAL10 promoters, and including the ADH2/GAPDH promoter, which is induced when glucose concentrations in the cell are low {e.g., about 0.1 to about 0.2 percent), as well as the CUP1 promoter and the TEF1 promoter. Likewise, a number of upstream activation sequences (UASs), also referred to as enhancers, are known. Upstream activation sequences for expression in Saccharomyces cerevisiae include, but are not limited to, the UASs of genes encoding the following proteins: PCKl, TPI, TDH3, CYCI, ADHI, ADH2, SUC2, GALI, GAL7 and GAL 10, as well as other UASs activated by the GAL4 gene product, with the ADH2 UAS being used in one aspect. Since the ADH2 UAS is activated by the ADR1 gene product, it may be preferable to overexpress the ADR1 gene when a heterologous gene is operatively linked to the ADH2 UAS. Transcription termination sequences for expression in Saccharomyces cerevisiae include the termination sequences of the a-factor, GAPDH, and CYC1 genes.
Transcription control sequences to express genes in methyltrophic yeast include the transcription control regions of the genes encoding alcohol oxidase and formate dehydrogenase.
Transfection of a nucleic acid molecule into a yeast cell according to the present invention can be accomplished by any method by which a nucleic acid molecule ca n be introduced into the cell and includes, but is not limited to, diffusion, active transport, bath sonication, electroporation, microinjection, lipofection, adsorption, and protoplast fusion. Transfected nucleic acid molecules ca n be integrated into a yeast chromosome or maintained on extrachromosomal vectors using techniques known to those skilled in the art. Examples of yeast vehicles carrying such nucleic acid molecules are disclosed in detail herein. As discussed above, yeast cytoplast, yeast ghost, and yeast membrane particles or cell wall preparations can also be produced recombinantly by transfecting intact yeast microorganisms or yeast spheroplasts with desired nucleic acid molecules, producing the antigen therein, and then further manipulating the microorganisms or spheroplasts using techniques known to those skilled in the art to produce cytoplast, ghost or subcellular yeast membrane extract or fractions thereof containing desired antigens or other proteins.
Effective conditions for the production of recombinant yeast vehicles and expression of the antigen and/or other protein by the yeast vehicle include an effective medium in which a yeast strain can be cultured. An effective medium is typically an aqueous medium comprising assimilable carbohydrate, nitrogen and phosphate sources, as well as appropriate salts, minerals, metals and other nutrients, such as vitamins and growth factors. The medium may comprise complex nutrients or may be a defined minimal medium. Yeast strains of the present invention can be cultured in a variety of containers, including, but not limited to, bioreactors, Erlenmeyer flasks, test tubes, microtiter dishes, and Petri plates. Culturing is carried out at a temperature, pH and oxygen content appropriate for the yeast strain. Such culturing conditions are well within the expertise of one of ordinary skill in the a rt (see, for example, Guthrie et al. (eds.), 1991, Methods in Enzymology, vol. 194, Academic Press, San Diego).
I n some embodiments of the invention, yeast are grown under neutral pH conditions. As used herein, the general use of the term "neutral pH" refers to a pH range between about pH 5.5 and about pH 8, and in one aspect, between about pH 6 and about 8. One of skill the art will appreciate that minor fluctuations (e.g., tenths or hundredths) can occur when measuring with a pH meter. As such, the use of neutral pH to grow yeast cells means that the yeast cells a re grown in neutral pH for the majority of the time that they a re in culture. In one embodiment, yeast are grown in a medium maintained at a pH level of at least 5.5 (i.e., the pH of the culture medium is not allowed to drop below pH 5.5). I n another aspect, yeast are grown at a pH level maintained at about 6, 6.5, 7, 7.5 or 8. The use of a neutral pH in culturing yeast promotes several biological effects that are desirable characteristics for using the yeast as vehicles for immunomodulation. For example, culturing the yeast in neutral pH allows for good growth of the yeast without negative effect on the cell generation time (e.g., slowing of doubling time). The yeast can continue to grow to high densities without losing their cell wall pliability. The use of a neutral pH allows for the production of yeast with pliable cell wa lls and/or yeast that a re more sensitive to cell wall digesting enzymes (e.g., glucanase) at all harvest densities. This trait is desirable because yeast with flexible cell walls can induce different or improved immune responses as compared to yeast grown under more acidic conditions, e.g., by promoting the secretion of cytokines by a ntigen presenting cells that have phagocytosed the yeast (e.g., TH I- type cytokines including, but not limited to, I FN-γ, interleukin-12 (I L- 12), and I L-2, as well as proinflammatory cytokines such as I L-6). I n addition, greater accessibility to the antigens located in the cell wall is afforded by such culture methods. In another aspect, the use of neutral pH for some antigens allows for release of the disulfide bonded a ntigen by treatment with dithiothreitol (DTT) that is not possible when such an antigen-expressing yeast is cultured in media at lower pH (e.g., pH 5).
I n one embodiment, control of the amount of yeast glycosylation is used to control the expression of antigens by the yeast, particularly on the surface. The amount of yeast glycosylation ca n affect the immunogenicity and antigenicity of the antigen expressed on the surface, since sugar moieties tend to be bulky. As such, the existence of sugar moieties on the surface of yeast and its impact on the three-dimensional space around the target antigen(s) should be considered in the modulation of yeast according to the invention. Any method can be used to reduce the amount of glycosylation of the yeast (or increase it, if desired). For example, one could use a yeast mutant strain that has been selected to have low glycosylation (e.g., mnnl, ochl and mnn9 mutants), or one could eliminate by mutation the glycosylation acceptor sequences on the target antigen. Alternatively, one could use a yeast with abbreviated glycosylation patterns, e.g., Pichia. One can a lso treat the yeast using methods that reduce or alter the glycosylation. In one embodiment of the present invention, as an alternative to expression of an antigen or other protein recombinantly in the yeast vehicle, a yeast vehicle is loaded intracellularly with the protein or peptide, or with carbohydrates or other molecules that serve as an antigen and/or are useful as immunomodulatory agents or biological response modifiers according to the invention. Subsequently, the yeast vehicle, which now contains the antigen and/or other proteins intracellularly, can be administered to an individual or loaded into a carrier such as a dendritic cell. Peptides and proteins can be inserted directly into yeast vehicles of the present invention by techniques known to those skilled in the art, such as by diffusion, active transport, liposome fusion, electroporation, phagocytosis, freeze-thaw cycles and bath sonication. Yeast vehicles that can be directly loaded with peptides, proteins, carbohydrates, or other molecules include intact yeast, as well as spheroplasts, ghosts or cytoplasts, which can be loaded with antigens and other agents after production. Alternatively, intact yeast can be loaded with the antigen and/or agent, and then spheroplasts, ghosts, cytoplasts, or subcellular particles can be prepared therefrom. Any number of antigens and/or other agents can be loaded into a yeast vehicle in this embodiment, from at least 1, 2, 3, 4 or any whole integer up to hundreds or thousands of antigens and/or other agents, such as would be provided by the loading of a microorganism or portions thereof, for example.
In another embodiment of the present invention, an antigen and/or other agent is physically attached to the yeast vehicle. Physical attachment of the antigen and/or other agent to the yeast vehicle can be accomplished by any method suitable in the art, including covalent and non-covalent association methods which include, but are not limited to, chemically crosslinking the antigen and/or other agent to the outer surface of the yeast vehicle or biologically linking the antigen and/or other agent to the outer surface of the yeast vehicle, such as by using an antibody or other binding partner. Chemical cross- linking can be achieved, for example, by methods including glutaraldehyde linkage, photoaffinity labeling, treatment with carbodiimides, treatment with chemicals capable of linking di-sulfide bonds, and treatment with other cross-linking chemicals standard in the art. Alternatively, a chemical can be contacted with the yeast vehicle that alters the charge of the lipid bilayer of yeast membrane or the composition of the cell wall so that the outer surface of the yeast is more likely to fuse or bind to antigens and/or other agent having particular charge characteristics. Targeting agents such as antibodies, binding peptides, soluble receptors, and other ligands may also be incorporated into an antigen as a fusion protein or otherwise associated with an antigen for binding of the antigen to the yeast vehicle.
I n yet another embodiment, the yeast vehicle and the antigen or other protein are associated with each other by a more passive, non-specific or non-covalent binding mechanism, such as by gently mixing the yeast vehicle and the antigen or other protein together in a buffer or other suitable formulation (e.g., admixture).
I n one embodiment of the invention, the yeast vehicle and the antigen or other protein are both loaded intracellular^ into a carrier such as a dendritic cell or macrophage to form the therapeutic composition or vaccine of the present invention. For example, a recombinant yeast cell (yeast that has been genetica lly engineered to express an antigen of the invention) can be loaded into a dendritic cell as an intact cell, or the yeast cell can be killed, or it can be derivatized or otherwise modified such as by formation of yeast spheroplasts, cytoplasts, ghosts, or subcellular particles, any of which is followed by loading of the derivative into a dendritic cell. Alternatively, an antigen or other protein can be loaded into a dendritic cell in the absence of the yeast vehicle.
I n one embodiment, intact yeast (with or without expression of heterologous antigens or other proteins) ca n be ground up or processed in a manner to produce yeast cell wall preparations, yeast membrane particles and/or yeast fragments (i.e., not intact), as well as a soluble yeast proteins. Such a yeast can be referred to herein as a "smashate" or "processed yeast". The processed yeast can, in some embodiments, be provided with or administered with one or more HIV antigens described herein, and/or in conjunction with other compositions that encode, include or have been in contact with HIV antigens (e.g., DNA vaccines, viral vector vaccines, protein subunit vaccines, autologous T cell vaccines, killed or inactivated pathogens, antibody vaccines) to enhance immune responses. For example, enzymatic treatment, chemical treatment or physical force (e.g., mechanical shearing or sonication) can be used to break up the yeast into parts that are used as an adjuvant.
I n one embodiment of the invention, yeast vehicles useful in the invention include yeast vehicles that have been killed or inactivated. Killing or inactivating of yeast can be accomplished by any of a variety of suitable methods known in the art. For example, heat inactivation of yeast is a standard way of inactivating yeast, and one of skill in the art can monitor the structural changes of the target antigen, if desired, by standard methods known in the art. Alternatively, other methods of inactivating the yeast can be used, such as chemical, electrical, radioactive or UV methods. See, for example, the methodology disclosed in standard yeast culturing textbooks such as Methods of Enzymology, Vol. 194, Cold Spring Harbor Publishing (1990). Any of the inactivation strategies used should take the secondary, tertiary or quaternary structure of the target antigen into consideration and preserve such structure as to optimize its immunogenicity. Yeast vehicles can be formulated into yeast-based immunotherapy compositions or products of the present invention, including preparations to be administered to a subject directly or first loaded into a carrier such as a dendritic cell, using a number of techniques known to those skilled in the art. For example, yeast vehicles can be dried by lyophilization. Formulations comprising yeast vehicles can also be prepared by packing yeast in a cake or a tablet, such as is done for yeast used in baking or brewing operations. In addition, yeast vehicles can be mixed with a pharmaceutically acceptable excipient, such as an isotonic buffer that is tolerated by a host or host cell. Examples of such excipients include water, saline, Ringer's solution, dextrose solution, Hank's solution, and other aqueous physiologically balanced salt solutions. Nonaqueous vehicles, such as fixed oils, sesame oil, ethyl oleate, or triglycerides may also be used. Other useful formulations include suspensions containing viscosity-enhancing agents, such as sodium carboxymethylcellulose, sorbitol, glycerol or dextran. Excipients can also contain minor amounts of additives, such as substances that enhance isotonicity and chemical stability. Examples of buffers include phosphate buffer, bicarbonate buffer and Tris buffer, while examples of preservatives include thimerosal, m- or o-cresol, formalin and benzyl alcohol. Standard formulations can either be liquid injectables or solids which can be taken up in a suitable liquid as a suspension or solution for injection. Thus, in a non-liquid formulation, the excipient can comprise, for example, dextrose, human serum albumin, and/or preservatives to which sterile water or saline can be added prior to administration.
In one embodiment of the present invention, a composition can include additional agents, which may also be referred to as biological response modifier compounds, or the ability to produce such agents/modifiers. For example, a yeast vehicle can be transfected with or loaded with at least one antigen and at least one agent/biological response modifier compound, or a composition of the invention can be administered in conjunction with at least one agent/biological response modifier. Biological response modifiers include adjuvants and other compounds that can modulate immune responses, which may be referred to as immunomodulatory compounds, as well as compounds that modify the biological activity of another compound or agent, such as a yeast-based immunotherapeutic, such biological activity not being limited to immune system effects. Certain immunomodulatory compounds can stimulate a protective immune response whereas others can suppress a harmful immune response, and whether an immunomodulatory is useful in combination with a given yeast-based immunotherapeutic may depend, at least in part, on the disease state or condition to be treated or prevented, and/or on the individual who is to be treated. Certain biological response modifiers preferentially enhance a cell-mediated immune response whereas others preferentially enhance a humoral immune response (i.e., can stimulate an immune response in which there is an increased level of cell-mediated compared to humoral immunity, or vice versa.). Certain biological response modifiers have one or more properties in common with the biological properties of yeast-based immunotherapeutics or enhance or complement the biological properties of yeast-based immunotherapeutics. There are a number of techniques known to those skilled in the art to measure stimulation or suppression of immune responses, as well as to differentiate cell-mediated immune responses from humoral immune responses, and to differentiate one type of cell-mediated response from another (e.g., a TH17 response versus a TH1 response).
Agents/biological response modifiers useful in the invention may include, but are not limited to, cytokines, chemokines, hormones, lipidic derivatives, peptides, proteins, polysaccharides, small molecule drugs, antibodies and antigen binding fragments thereof (including, but not limited to, anti-cytokine antibodies, anti-cytokine receptor antibodies, anti-chemokine antibodies), vitamins, polynucleotides, nucleic acid binding moieties, aptamers, and growth modulators. Agents useful in combination with a yeast-based immunotherapy composition in accordance with the invention include, but are not limited to: anti-CD40, CD40L, lymphocyte- activation gene 3 (LAG3) protein and/or IMP321 (T- cell immuno-stimulatory factor derived from the soluble form of LAG3), anti-CTLA-4 antibody (e.g., to release anergic T cells); T cell co - stimulators (e.g., anti-CD137, anti- CD28, anti-CD40); alemtuzumab (e.g., CamPath®), denileukin diftitox (e.g., ONTAK®); anti-CD4; anti-CD25; anti-PD-1, anti-PD-LI, anti-PD-L2; agents that block FOXP3 (e.g., to abrogate the activity/kill CD4+/CD25+ T regulatory cells); Flt3 ligand, imiquimod (Aldara™), Toll-like receptor (TLR) agonists, including but not limited to TLR-2 agonists, TLPv-4 agonists, TLR-7 agonists, and TLR-9 agonists; TLR antagonists, including but not limited to TLR-2 antagonists, TLR-4 antagonists, TLR-7 antagonists, and TLR-9 antagonists; anti-inflammatory agents and immunomodulators, including but not limited to, COX-2 inhibitors (e.g., Celecoxib, NSAIDS), glucocorticoids, statins, and thalidomide and analogues thereof including IMiDs (which are structural and functional analogues of thalidomide (e.g., REVLI M I D® (lenalidomide), POMALYST® (pomalidomide)) and any agents that modulate the number of, modulate the activation state of, and/or modulate the survival of antigen-presenting cells or of TH17, TH 1 , and/or Treg cells. Any combination of such agents is contemplated by the invention, and any of such agents combined with or administered in a protocol with (e.g., concurrently, sequentially, or in other formats with) a yeast-based immunotherapeutic is a composition encom passed by the invention. Such agents are well known in the art. These agents may be used alone or in combination with other agents described herein. I n addition, one or more therapies ca n be administered or performed prior to the first dose of yeast-based immunotherapy composition or after the first dose is administered.
Agents can include agonists and antagonists of a given protein or peptide or domain thereof. As used herein, an "agonist" is any compound or agent, including without limitation small molecules, proteins, peptides, antibodies, nucleic acid binding agents, etc., that binds to a receptor or ligand and produces or triggers a response, which may include agents that mimic the action of a naturally occurring substance that binds to the receptor or ligand. An "antagonist" is any compound or agent, including without limitation small molecules, proteins, peptides, antibodies, nucleic acid binding agents, etc., that blocks or inhibits or reduces the action of an agonist.
Compositions of the invention ca n further include or ca n be administered with (concurrently, sequentially, or intermittently with) any other compounds or compositions that a re useful for preventing or treating HIV infection or any compounds that treat or ameliorate any symptom of HIV infection. A variety of agents are known to be useful for treating or ameliorating HIV infection. Such agents are described in detail elsewhere herein and include, but are not limited to, anti-viral compounds, including fixed-dose combinations (FDCs). These agents are typically administered for long periods of time (e.g., daily for the lifetime of the patient). I n addition, compositions of the invention ca n be used together with other immunotherapeutic compositions, including prophylactic and/or therapeutic immunotherapy, such compositions include, but are not limited to, DNA vaccines, dendritic cell vaccines, viral vector vaccines, protein subunit vaccines, autologous T cell vaccines, killed or inactivated pathogens, and/or antibody vaccines. Compositions of the invention can also be administered or used together with biological response modifiers (described above), many of which have immunomodulatory properties (e.g., anti-PD-1 , anti-CTLA-4, etc.). The invention also includes a kit comprising any of the compositions described herein, or any of the individual components of the compositions described herein.
Methods for Administration or Use of Compositions of the Invention
Compositions of the invention, which can include any one or more {e.g., combinations of two, three, four, five, or more) yeast-based immunotherapeutic compositions described herein, HIV antigens including HIV proteins and fusion proteins, and/or recombinant nucleic acid molecules encoding such HIV proteins or fusion proteins described above, and other compositions comprising such yeast-based compositions, antigens, proteins, fusion proteins, or recombinant molecules described herein, can be used in a variety of in vivo and in vitro methods, including, but not limited to, to treat and/or prevent HIV infection and its sequelae, in diagnostic assays for HIV, or to produce antibodies against HIV.
One embodiment of the invention relates to a method to treat human immunodeficiency virus (HIV) infection, and/or to prevent, ameliorate or treat at least one symptom of HIV infection, in an individual or population of individuals. The method includes the step of administering to an individual or a population of individuals who are infected with HIV one or more immunotherapeutic compositions of the invention. In one aspect, the composition is an immunotherapeutic composition comprising one or more HIV antigens as described herein, which can include a yeast-based immunotherapeutic composition. In one aspect, the composition includes a protein or fusion protein comprising HIV antigens as described herein, and/or recombinant nucleic acid molecule encoding such protein or fusion protein. In one embodiment, the individual or population of individuals has HIV infection. In one aspect, the individual or population of individuals is additionally treated with at least one other therapeutic compound and/or additional composition useful for the treatment of HIV infection. Such therapeutic compounds and/or additional compositions include, but are not limited to, direct- acting antiviral drugs {e.g., those described above or elsewhere herein, including, but not limited to, FDC drugs) and/or other immunotherapeutic or immunomodulatory agents, including, but not limited to, DNA vaccines {i.e., nucleic acid based vaccines encoding HIV antigens), viral vector vaccines {e.g., virus-based vectors encoding HIV antigens), dendritic cell vaccines {e.g., dendritic cells comprising HIV antigens, including dendritic cells comprising yeast expressing or carrying HIV antigens), protein subunit vaccines {e.g., recombinant HIV proteins), autologous T cell vaccines {e.g., T cells isolated from an individual and stimulated ex vivo, for example, with HIV antigens or other immunomodulatory agents), killed or inactivated pathogens (e.g., killed or inactivated HIV strains), antibody vaccines (e.g., therapeutic or prophylactic antibodies), and/or biological response modifiers (described elsewhere herein).
"Standard Of Care" or "SOC" generally refers to the current approved standard of care for the treatment of a specific disease. In HIV infection, SOC may be one of several different approved therapeutic protocols, and includes, but may not be limited to, anti-viral therapy. Currently approved anti-viral drugs for the treatment of HIV infection include fixed dose combination (FDCs) drugs, comprised of cross-class drugs provided as a single pill taken once daily. Such FDCs include, but are not limited to: ATRIPLA® (tenofovir disoproxil fumarate/emtricitabine/efavirenz: tenofovir/NRTI + emtricitabine/NRTI, with efavirenz (a non- nucleoside reverse transcriptase inhibitor (NNRTI) from Bristol Myers-Squibb), Gilead Sciences, Inc.); COMPLERA® (tenofovir disoproxil fumarate/emtricitabine/rilpivirine: tenofovir/NRTI + emtricitabine/NRTI, with rilpivirine (a NNRTI from Tibotec/Johnson & Johnson), Gilead Sciences, Inc.); and STRIBILD/OUAD® (tenofovir disoproxil fumarate/emtricitabine/elvitegravir/cobicistat: tenofovir/NRTI + emtricitabine/NRTI, with cobicistat-boosted elvitegravir (integrase inhibitor from Japan Tobacco), Gilead Sciences, Inc.) and 572-TRII® (abcavir/NRTI + lamivudine/NRTI, with dolutegravir (integrase inhibitor from Pfizer/Shionogi), ViiV (Glaxo SmithKline, Pfizer, Shionogi). The immunotherapeutic composition of the invention can be administered prior to, concurrently with, intermittently with, and/or after one or more anti-viral(s) and/or other immunotherapeutic or immunomodulatory agents. The other therapeutic compounds may also be administered prior to or after treatment with the immunotherapeutic compositions of the invention.
In one embodiment of the invention, a yeast-based HIV immunotherapy composition of the invention is administered concurrently or sequentially (including in a prime-boost strategy) with a second immunotherapy composition that enhances a humoral immune response to HIV antigens. For example, when the yeast-based HIV immunotherapy composition is provided in the form of a whole, recombinant yeast expressing one or more HIV antigens, the immune response generated by this composition is primarily cellular in nature (e.g., elicits T cell responses), although priming of a humoral immune response also occurs. In order to enhance functional cures of HIV infection, it is, in one embodiment of the invention, desirable to induce both a strong cellular and a strong humoral immune response against HIV. Therefore, the invention contemplates the use of compositions together with yeast-based immunotherapy that are particularly suited to enhance humoral immune responses. Such compositions may include, but are not limited to: a processed yeast immunotherapy composition comprising H IV antigens (described elsewhere herein), a protein subunit vaccine expressing or otherwise comprising HIV antigens, or a DNA or viral vector vaccine expressing HIV antigens.
In one aspect of the invention, a whole recombinant yeast expressing one or more HIV antigens as described herein is administered concurrently with a processed yeast comprising one or more HIV antigens as described herein, either together in a single injection or in separate injections. I n one aspect, a whole recombinant yeast expressing one or more HIV antigens as described herein is administered sequentially (e.g., in a prime-boost strategy) with a processed yeast comprising one or more HIV antigens as described herein. Optionally, the processed yeast comprising one or more HIV antigens may also be included in the priming dose with the whole recombinant yeast expressing one or more HIV antigens.
In one embodiment, a DNA vaccine encoding HIV antigen(s) is utilized in a prime-boost protocol with one or more yeast-based immunotherapy compositions. DNA vaccines using in vivo electroporation have been used to elicit cellular immune responses in a variety of studies of viral disease including HIV, and may include boosters using viral vectors (see, e.g., Catanzaro et a I, J I nfect Dis 2006;194: 1638-1649). However, viral vector immunotherapy and DNA immunotherapy are known to suffer from neutralization of the vaccine over time/repeated administrations. Yeast-based immunotherapy does not suffer from neutralization effects and can be administered multiple times over long periods. Therefore, it is an embodiment of the invention to prime an individual with a DNA vaccine for HIV using a suitable method such as electroporation, followed by boosters using a yeast-based HIV immunotherapy composition of the invention. Such a method (or any method of the invention that utilizes yeast-based HIV immunotherapy as at least one component) is effective for eliciting a robust immune response and maintaining long term immunological pressure on infected cells. I n one aspect, the yeast- based H IV immunothera py composition is a whole recombinant yeast expressing one or more HIV antigens as described herein. I n another aspect, the yeast-based HIV immunotherapy composition is a processed yeast comprising one or more H IV antigens as described herein. I n another aspect, the yeast-based H IV immunotherapy composition is a combination of a whole recombinant yeast expressing one or more HIV antigens as described herein and a processed yeast comprising one or more HIV antigens as described herein, wherein the whole yeast and the processed yeast are administered concurrently in a single injection or in separate injections. Additional therapeutic compounds and/or compositions may be further included in this method as described herein (e.g., anti-viral therapy, additional types of boosters such as protein subunit vaccines, immunomodulatory biological response modifiers, etc.).
In one embodiment of the invention, a yeast-based HIV immunotherapy composition of the invention is loaded into a dendritic cell ex vivo to form a dendritic cell vaccine. For example, dendritic cells from a subject to be treated can be isolated from the subject, loaded with a yeast- based HIV immunotherapy composition of the invention, and then returned to the subject. Optionally, before, after, or at the same time, T cells isolated from the subject (autologous T cells) may be stimulated ex vivo with the same yeast-based HIV immunotherapy composition (and/or another immunotherapy composition or immunomodulator/bio logical response modifier) and also returned to the subject. Dendritic cells are cells of monocyte and lymphocyte lineages, and are known to be the most potent antigen presenting cell (APC) and to stimulate antigen-specific T cell responses. Mature dendritic cells are typically identified as having the following cell surface marker phenotype: CD80+, CD86+, CD40low, CD54+, MHC Class I and MHC Class II, and are capable of FITC-dextran uptake. The dendritic cell used in the composition of the present invention is preferably isolated from a patient to which the composition is to be administered {i.e., autologous cells). Dendritic cells can be isolated from the bone marrow or peripheral blood. Such cells can be generated, for example, from peripheral blood monocytes by culture in the presence of granulocyte macrophage colony-stimulating factor, IL-4, and TNF", for example. Other methods for isolating and generating dendritic cells are known in the art (See, for example, Wilson et a I, 1999, J Immunol 162: 3070-8; Romani et a I, 1994, J Exp Med 180: 83-93; Caux et al, 1996, J Exp Med 184: 695-706; and Kiertscher et a I, 1996, J Leukoc Biol 59: 208-18, each of which is incorporated herein by reference in its entirety). A therapeutic composition effective to administer to a patient contains from about 0.5 x 106to about 40 x 106 dendritic cells per single dose per individual patient. Preferably, a therapeutic composition contains from about 1 x 106to about 20 x 106dendritic cells per single dose per patient, and in another embodiment, from about 1 x 106 to about 10 x 106 dendritic cells per single dose per patient. These doses are given for a typical human or other primate. To "load" a component into a cell references any technique by which the component is either forced to enter the cell (e.g., by electroporation) or is placed in an environment (e.g., in contact with or near to a cell) where the component will be substantially likely to enter the cell by some process (e.g., phagocytosis). Loading techniques include, but are not limited to: diffusion, active transport, liposome fusion, electroporation, phagocytosis, and bath sonication. In a preferred embodiment, passive mechanisms for loading a dendritic cell with the yeast vehicle and/or antigen are used, such passive mechanisms including phagocytosis of the yeast vehicle and/or antigen by the dendritic cell.
Another embodiment of the invention relates to a method to immunize an individual or population of individuals against HIV in order to prevent HIV infection and/or reduce the severity of HIV infection in the individual or population of individuals. The method includes the step of administering to an individual or population of individuals that is not infected with HIV (or believed not to be infected with HIV), a composition of the invention. In one aspect, the composition is an immunotherapeutic composition comprising one or more HIV antigens as described herein, including one or more yeast-based immunotherapeutic compositions. In one aspect, the composition includes a fusion protein comprising HIV antigens as described herein, or recombinant nucleic acid molecule encoding such fusion protein.
As used herein, the phrase "treat" HIV infection, or any permutation thereof (e.g., "treated for HIV infection", etc.) generally refers to applying or administering a composition of the invention once the infection (acute or chronic) has occurred, with the goal of reduction or elimination of detectable viral titer or viral load; reduction in at least one symptom resulting from the infection in the individual; delaying or preventing the onset and/or severity of symptoms and/or downstream sequelae caused by the infection (e.g., development of AIDS and diseases or conditions associated with AIDS); reduction of organ or physiological system damage resulting from the infection; improvement of immune responses against the virus; improved CD4+ T cell counts; improvement of long term memory immune responses against the virus; reduced reactivation of virus; reduction in the frequency, duration and/or amount of HAART or similar therapies needed to achieve long term remission; and/or improved general health of the individual or population of individuals. In one embodiment, a method to treat HIV according to the present invention results in a "functional cure" (i.e., containment of HIV replication and prevention of disease in the absence of ongoing treatment). To "prevent" HIV infection, or any permutation thereof (e.g., "prevention of HIV infection", etc.), generally refers to applying or administering a composition of the invention before an infection with HIV has occurred, with the goal of preventing infection by HIV, or, should the infection later occur, at least reducing the severity, and/or length of infection and/or the physiological damage caused by the infection, including preventing or reducing the severity or incidence of at least one symptom resulting from the infection in the individual, and/or delaying or preventing the onset and/or severity of symptoms and/or downstream sequelae caused by the infection, in an individua l or population of individuals.
The present invention includes the delivery (administration, immunization) of one or more immunotherapeutic compositions of the invention, including a yeast-based immunotherapy composition, to a subject. The administration process can be performed ex vivo or in vivo, but is typically performed in vivo. Ex vivo administration refers to performing part of the regulatory step outside of the patient, such as administering a composition of the present invention to a population of cells (e.g., dendritic cells) removed from a patient under conditions such that a yeast vehicle, antigen(s) and any other agents or compositions are loaded into the cell, and returning the cells to the patient. The therapeutic composition of the present invention can be returned to a patient, or administered to a patient, by any suitable mode of administration. Administration of a composition ca n be systemic, mucosal and/or proximal to the location of the ta rget site (e.g., near a site of infection). Suitable routes of administration will be apparent to those of skill in the art, depending on the type of condition to be prevented or treated, the antigen used, and/or the target cell population or tissue. Various acceptable methods of administration include, but are not limited to, intravenous administration, intraperitoneal administration, intramuscular administration, intranodal administration, intracoronary administration, intraarterial administration (e.g., into a carotid artery), subcutaneous administration, transdermal delivery, intratracheal administration, intraarticular administration, intraventricular administration, inhalation (e.g., aerosol), intracranial, intraspinal, intraocular, aural, intranasal, oral, pulmonary administration, impregnation of a catheter, and direct injection into a tissue. I n one aspect, routes of administration include: intravenous, intraperitoneal, subcutaneous, intradermal, intranodal, intramuscular, transdermal, inhaled, intranasal, oral, intraocular, intraarticular, intracranial, and intraspinal. Parenteral delivery can include intradermal, intramuscular, intraperitoneal, intrapleural, intrapulmonary, intravenous, subcutaneous, atrial catheter and venal catheter routes. Aural delivery ca n include ear drops, intranasal delivery can include nose drops or intranasal injection, and intraocular delivery can include eye drops. Aerosol (inhalation) delivery can also be performed using methods standard in the art (see, for example, Stribling et a I, Proc. Natl. Acad. Sci. USA 189: 11277-11281, 1992). Other routes of administration that modulate mucosal immunity may be useful in the treatment of viral infections. Such routes include bronchial, intradermal, intramuscular, intranasal, other inhalatory, rectal, subcutaneous, topical, transdermal, vaginal and urethral routes. In one aspect, an immunotherapeutic composition of the invention is administered subcutaneously.
With respect to the yeast-based immunotherapy compositions of the invention, in general, a suitable single dose is a dose that is capable of effectively providing a yeast vehicle and an antigen (if included) to a given cell type, tissue, or region of the patient body in an amount effective to elicit an antigen-specific immune response against one or more HIV antigens or epitopes, when administered one or more times over a suitable time period. For example, in one embodiment, a single dose of a yeast vehicle of the present invention is from about 1 x 105 to about 5 x 107 yeast cell equivalents per kilogram body weight of the organism being administered the composition. In one aspect, a single dose of a yeast vehicle of the present invention is from about 0.1 Y.U. (1 x 106 cells) to about 100 Y.U. (1 x 109 cells) per dose (i.e., per organism), including any interim dose, in increments of 0.1 x 106 cells (i.e., 1.1 x 106, 1.2 x 106, 1.3 x 106...). In one embodiment, doses include doses between 1 Y.U and 40 Y.U., doses between 1 Y.U. and 50 Y.U., doses between 1 Y.U. and 60 Y.U., doses between 1 Y.U. and 70 Y.U., or doses between 1 Y.U. and 80 Y.U., and in one aspect, between 10 Y.U. and 40 Y.U., 50 Y.U., 60 Y.U., 70 Y.U., or 80 Y.U. In one embodiment, the doses are administered at different sites on the individual but during the same dosing period. For example, a 40 Y.U. dose may be administered via by injecting 10 Y.U. doses to four different sites on the individual during one dosing period, or a 20 Y.U. dose may be administered by injecting 5 Y.U. doses to four different sites on the individual, or by injecting 10 Y.U. doses to two different sites on the individual, during the same dosing period. The invention includes administration of an amount of the yeast-based immunotherapy composition {e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 Y.U. or more) at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different sites on an individual to form a single dose. Preferably the composition is administered orally.
"Boosters" or "boosts" of a therapeutic composition are administered, for example, when the immune response against the antigen has waned or as needed to provide an immune response or induce a memory response against a particular antigen or antigen(s). Boosters can be administered from about 1, 2, 3, 4, 5, 6, 7, or 8 weeks apart, to monthly, to bimonthly, to quarterly, to annually, to several years after the original administration. In one embodiment, an administration schedule is one in which from about 1 x 105 to about 5 x 107 yeast cell equivalents of a com position per kg body weight of the organism is administered at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more times over a time period of from weeks, to months, to years. I n one embodiment, the doses are administered weekly for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more doses, followed by monthly doses as needed to achieve the desired inhibition or elimination of the HIV virus. I n one embodiment, the doses are administered in a 4-weekly protocol (every 4 weeks, or on day 1, week 4, week 8, week 12, etc., for between 2 and 10 doses or longer as determined by the clinician). Additional doses ca n be administered even after the individual achieves seroconversion, if desired, although such dosing may not be necessary.
I n one embodiment of the invention, as discussed above, a different (non- yeast-based) immunotherapeutic composition, such as a DNA vaccine expressing HIV antigen(s), can be used to prime the immune system of a subject, and a yeast-based HIV immunotherapeutic composition of the invention is used to boost the immune response. I n one embodiment, a yeast-based immunotherapeutic composition of the invention comprising a whole yeast that recombinantly expresses one or more HIV antigens described herein is used to prime the immune system of a subject, alone or together with a yeast-based immunotherapeutic composition comprising a processed yeast (preferably including one or more HIV antigens, which may be the same antigens as used in the priming dose), followed by additional administrations of the processed yeast as a booster. Alternatively, the booster dose can include, but is not limited to, any other immunotherapeutic composition, including compositions that particularly enhance humoral immune responses, such as a subunit vaccine or an antibody vaccine.
With respect to administration of yeast-based immunotherapeutic compositions described herein, a single composition can be administered to an individual or population of individuals or combinations of such compositions ca n be administered. Accordingly, two or more compositions can be selected in a "spice rack" approach to most effectively prevent or treat HIV infection in a given individual or population of individuals. This approach ca n include the administration of different HIV antigens in the context of different yeast-based immunotherapy compositions of the invention (e.g., the use of two or more different yeast-based compositions, each including a different HIV antigen(s)), and/or, within the same protocol, the administration of various forms of the yeast-based immunotherapeutic composition of the invention (e.g., whole recombinant yeast and processed yeast, each including the same or different HIV antigen(s)), and/or, within the same protocol, the use of yeast-based immunotherapeutic compositions with other types of compositions (e.g., other immunotherapy compositions such as autologous T cell vaccines, dendritic cell vaccines, antibody vaccines, subunit vaccines, DNA vaccines; biological response modifiers (described above); small molecule drugs such as a anti- virals, etc.). These various approaches using different compositions can be used in sequential administration protocols and/or by co-administration and/or also consolidated into one injection and/or in separate injections.
In one aspect of the invention, one or more additional therapeutic agents, compounds or compositions (such as any of those described above or elsewhere herein) are administered sequentially with the yeast-based immunotherapy composition. In another embodiment, one or more additional therapeutic agents are administered before the yeast-based immunotherapy composition is administered. In another embodiment, one or more additional therapeutic agents, compounds or compositions are administered after the yeast-based immunotherapy composition is administered. In one embodiment, one or more additional therapeutic agents, compounds or compositions are administered in alternating doses with the yeast-based immunotherapy composition, or in a protocol in which the yeast-based composition is administered at prescribed intervals in between or with one or more consecutive doses of the additional therapeutic agents, compounds or compositions, or vice versa. In one embodiment, one or more additional therapeutic agents are administered together with the yeast-based immunotherapy composition (e.g., together in the same composition or concurrently as separate compositions). In one embodiment, the yeast-based immunotherapy composition is administered in one or more doses over a period of time prior to commencing the administration of the additional therapeutic agents, compounds or compositions. In other words, the yeast-based immunotherapeutic composition is administered as a monotherapy for a period of time, and then the therapeutic agents, compounds or compositions are added, either concurrently with new doses of yeast-based immunotherapy, or in an alternating fashion with yeast- based immunotherapy. Alternatively, the therapeutic agents, compounds or compositions may be administered for a period of time prior to beginning administration of the yeast- based immunotherapy composition. In one aspect, the yeast is engineered to express or carry the agent, or a different yeast is engineered or produced to express or carry the agent or compound. In one aspect of the invention, when a treatment course of anti-viral compound therapy begins, additional doses of the immunotherapeutic composition are administered over the same period of time, or for at least a portion of that time, and may continue to be administered once the course of anti-viral compound has ended. However, the dosing schedule for the immunotherapy over the entire period may be, and is expected to typically be, different than that for the anti-viral compound. For example, the immunotherapeutic composition may be administered daily, weekly, biweekly, monthly, bimonthly, or every 3-6 months, or at longer intervals as determined by the physician, and is most typically administered weekly followed by monthly or monthly, where current anti-virals for HIV are administered daily. During an initial period of monotherapy administration of the immunotherapeutic composition, if utilized, the immunotherapeutic composition is preferably administered weekly for between 4 and 12 weeks, followed by monthly administration (regardless of when the anti-viral therapy is added into the protocol). In one aspect, the immunotherapeutic composition is administered weekly for four or five weeks, followed by monthly administration thereafter, until conclusion of the complete treatment protocol.
In one aspect of the invention, an immunotherapeutic composition and other agents, compounds or compositions can be administered together (concurrently). As used herein, concurrent use does not necessarily mean that all doses of all compounds are administered on the same day at the same time. Rather, concurrent use means that each of the therapy components (e.g., immunotherapy and anti-viral therapy) are started at approximately the same period (within hours, or up to 1-7 days of each other) and are administered over the same general period of time, noting that each component may have a different dosing schedule (e.g., immunotherapy monthly, anti-viral daily). In addition, before or after the concurrent administration period, any one of the agents or immunotherapeutic compositions can be administered without the other agent(s).
As used herein, the term "anti-viral" refers to any compound or drug, typically a small-molecule inhibitor or antibody, which targets one or more steps in the virus life cycle with direct anti-viral therapeutic effects. In one embodiment of the invention, the anti-viral compound or drug to be administered in the same therapeutic protocol with an immunotherapeutic composition of the invention is selected from: non-nucleoside reverse transcriptase inhibitors ( NRTI), nucleoside analogue reverse transcriptase inhibitors (NRTIs), integrase inhibitors and entry inhibitors. Typical NRTIs include, but are not limited to: zidovudine (AZT) or tenofovir (TDF) and lamivudine (3TC) or emtricitabine (FTC). In one embodiment, the anti-viral compound is a fixed dose combination (FDCs), comprised of cross-class drugs provided as a single pill taken once daily. Such FDCs include, but are not limited to: ATRI PLA®(tenofovir disoproxil fumarate/emtricitabine/efavirenz: tenofovir/NRTI + emtricitabine/NRTI, with efavirenz (a non- nucleoside reverse transcriptase inhibitor (NNRTI) from Bristol Myers- Squibb), Gilead Sciences, I nc.), COM PLERA® (tenofovir disoproxil fumarate/emtricitabine/rilpivirine: tenofovir/N RTI + emtricitabine/N RTI, with rilpivirine (a NN RTI from Tibotec/Johnson & Johnson), Gilead Sciences, I nc.); STRIBI LD/Q.UAD® (tenofovir disoproxil fumarate/emtricitabine/elvitegravir/cobicistat: tenofovir/NRTI + emtricitabine/NRTI, with cobicistat-boosted elvitegravir (integrase inhibitor from Japa n Tobacco), Gilead Sciences, I nc.); and 572-TRI I® (abcavir/N RTI + lamivudine/NRTI, with dolutegravir (integrase inhibitor from Pfizer/Shionogi), ViiV (GlaxoSmithKline, Pfizer, Shionogi). Anti-virals useful in the invention include any analog or derivative of any of these compounds, or any composition comprising or containing such compound, drug, analog or derivative.
I n the method of the present invention, compositions and therapeutic compositions can be administered to animal, including any vertebrate, and particularly to any member of the Vertebrate class, Mammalia, including, without limitation, primates, rodents, livestock and domestic pets. Livestock include mammals to be consumed or that produce useful products (e.g., sheep for wool production). Mammals to treat or protect include humans, dogs, cats, mice, rats, goats, sheep, cattle, horses and pigs.
An "individual" is a vertebrate, such as a mammal, including without limitation a human. Mammals include, but are not limited to, farm animals, sport animals, pets, primates, mice and rats. The term "individual" can be used interchangeably with the term "animal", "subject" or "patient".
General Techniques Useful in the Invention
The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, nucleic acid chemistry, and immunology, which are well known to those skilled in the art. Such techniques are explained fully in the literature, such as, Methods of Enzymology, Vol. 194, Guthrie et a I, eds., Cold Spring Harbor Laboratory Press (1990); Biology and activities of yeasts. Skinner, et al, eds., Academic Press (1980); Methods in yeast genetics : a laboratory course manual. Rose et a I, Cold Spring Ha rbor Laboratory Press (1990); The Yeast Saccharomyces: Cell Cycle and Cell Biology, Pringle et a I, eds., Cold Spring Harbor Laboratory Press (1997); The Yeast Saccharomyces: Gene Expression, Jones et al, eds., Cold Spring Harbor Laboratory Press (1993); The Yeast Saccharomyces: Genome Dynamics, Protein Synthesis, and Energetics, Broach et al, eds., Cold Spring Harbor Laboratory Press (1992); Molecular Cloning: A Laboratory Manual, second edition (Sambrook et al., 1989) and Molecular Cloning: A Laboratory Manual, third edition (Sambrook and Russel, 2001), (jointly referred to herein as "Sambrook"); Current Protocols in Molecular Biology (F.M. Ausubel et al, eds., 1987, including supplements through 2001); PCR: The Polymerase Chain Reaction, (Mullis et al, eds., 1994); Harlow and Lane (1988), Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York; Harlow and Lane (1999) Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (jointly referred to herein as "Harlow and Lane"), Beaucage et al. eds., Current Protocols in Nucleic Acid Chemistry, John Wiley & Sons, Inc., New York, 2000); Casarett and Doull's Toxicology The Basic Science of Poisons, C. Klaassen, ed., 6th edition (2001), and Vaccines, S. Plotkin and W. Orenstein, eds., 3rd edition (1999). General Definitions
A consensus definition of the term "probiotics", based on the available information and scientific evidence, was adopted after a joint Food and Agricultural Organization of the United Nations and World Health Organization expert consultation. In October 2001, this expert consultation defined probiotics as: "live micro-organisms which, when administered in adequate amounts, confer a health benefit on the host".
As used herein, the term "analog" refers to a chemical compound that is structurally similar to another compound but differs slightly in composition (as in the replacement of one atom by an atom of a different element or in the presence of a particular functional group, or the replacement of one functional group by another functional group). Thus, an analog is a compound that is similar or comparable in function and appearance, but has a different structure or origin with respect to the reference compound. The terms "substituted", "substituted derivative" and "derivative", when used to describe a compound, means that at least one hydrogen bound to the unsubstituted compound is replaced with a different atom or a chemical moiety.
Although a derivative has a similar physical structure to the parent compound, the derivative may have different chemical and/or biological properties than the parent compound. Such properties can include, but are not limited to, increased or decreased activity of the parent compound, new activity as compared to the parent compound, enhanced or decreased bioavailability, enhanced or decreased efficacy, enhanced or decreased stability in vitro and/or in vivo, and/or enhanced or decreased absorption properties.
In general, the term "biologically active" indicates that a compound (including a protein or peptide) has at least one detectable activity that has an effect on the metabolic or other processes of a cell or organism, as measured or observed in vivo {i.e., in a natural physiological environment) or in vitro {i.e., under laboratory conditions).
According to the present invention, the term "modulate" can be used interchangeably with "regulate" and refers generally to upregulation or downregulation of a particular activity. As used herein, the term "upregulate" can be used generally to describe any of: elicitation, initiation, increasing, augmenting, boosting, improving, enhancing, amplifying, promoting, or providing, with respect to a particular activity. Similarly, the term "downregulate" can be used generally to describe any of: decreasing, reducing, inhibiting, ameliorating, diminishing, lessening, blocking, or preventing, with respect to a particular activity.
In one embodiment of the present invention, any of the amino acid sequences described herein can be produced with from at least one, and up to about 20, additional heterologous amino acids flanking each of the C- and/or N-terminal ends of the specified amino acid sequence. The resulting protein or polypeptide can be referred to as "consisting essentially of the specified amino acid sequence. According to the present invention, the heterologous amino acids are a sequence of amino acids that are not naturally found {i.e., not found in nature, in vivo) flanking the specified amino acid sequence, or that are not related to the function of the specified amino acid sequence, or that would not be encoded by the nucleotides that flank the naturally occurring nucleic acid sequence encoding the specified amino acid sequence as it occurs in the gene, if such nucleotides in the naturally occurring sequence were translated using standard codon usage for the organism from which the given amino acid sequence is derived. Similarly, the phrase "consisting essentially of, when used with reference to a nucleic acid sequence herein, refers to a nucleic acid sequence encoding a specified amino acid sequence that can be flanked by from at least one, and up to as many as about 60, additional heterologous nucleotides at each of the 5' and/or the 3' end of the nucleic acid sequence encoding the specified amino acid sequence. The heterologous nucleotides are not naturally found (i.e., not found in nature, in vivo) flanking the nucleic acid sequence encoding the specified amino acid sequence as it occurs in the natural gene or do not encode a protein that imparts any additional function to the protein or changes the function of the protein having the specified amino acid sequence.
According to the present invention, the phrase "selectively binds to" refers to the ability of an antibody, antigen-binding fragment or binding partner of the present invention to preferentially bind to specified proteins. More specifically, the phrase "selectively binds" refers to the specific binding of one protein to another (e.g., an antibody, fragment thereof, or binding partner to an antigen), wherein the level of binding, as measured by any standard assay (e.g., an immunoassay), is statistically significantly higher than the background control for the assay. For example, when performing an immunoassay, controls typically include a reaction well/tube that contain antibody or antigen binding fragment alone (i.e., in the absence of antigen), wherein an amount of reactivity (e.g., non-specific binding to the well) by the antibody or antigen-binding fragment thereof in the absence of the antigen is considered to be background. Binding can be measured using a variety of methods standard in the art including enzyme immunoassays (e.g., ELISA, immunoblot assays, etc.).
Reference to a protein or polypeptide used in the present invention includes full-length proteins, fusion proteins, or any fragment, domain, conformational epitope, or homologue of such proteins, including functional domains and immunological domains of proteins. More specifically, an isolated protein, according to the present invention, is a protein (including a polypeptide or peptide) that has been removed from its natural milieu (i.e., that has been subject to human manipulation) and can include purified proteins, partially purified proteins, recombinantly produced proteins, and synthetically produced proteins, for example. As such, "isolated" does not reflect the extent to which the protein has been purified. Preferably, an isolated protein of the present invention is produced recombinantly. According to the present invention, the terms "modification" and "mutation" can be used interchangeably, particularly with regard to the modifications/mutations to the amino acid sequence of proteins or portions thereof (or nucleic acid sequences) described herein.
As used herein, the term "homologue" is used to refer to a protein or peptide which differs from a naturally occurring protein or peptide (i.e., the "prototype" or "wild- type" protein) by minor modifications to the naturally occurring protein or peptide, but which maintains the basic protein and side chain structure of the naturally occurring form. Such changes include, but are not limited to: changes in one or a few amino acid side chains; changes one or a few amino acids, including deletions (e.g., a truncated version of the protein or peptide) insertions and/or substitutions; changes in stereochemistry of one or a few atoms; and/or minor derivatizations, including but not limited to: methylation, glycosylation, phosphorylation, acetylation, myristoylation, prenylation, palmitation, amidation and/or addition of glycosylphosphatidyl inositol. A homologue can have enhanced, decreased, or substantially similar properties as compared to the naturally occurring protein or peptide. A homologue can include an agonist of a protein or an antagonist of a protein. Homologues can be produced using techniques known in the art for the production of proteins including, but not limited to, direct modifications to the isolated, naturally occurring protein, direct protein synthesis, or modifications to the nucleic acid sequence encoding the protein using, for example, classic or recombinant DNA techniques to effect random or targeted mutagenesis.
A homologue of a given protein may comprise, consist essentially of, or consist of, an amino acid sequence that is at least about 45%, or at least about 50%, or at least about 55%, or at least about 60%, or at least about 65%, or at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 91% identical, or at least about 92% identical, or at least about 93% identical, or at least about 94% identical, or at least about 95% identical, or at least about 96% identical, or at least about 97% identical, or at least about 98% identical, or at least about 99% identical (or any percent identity between 45% and 99%, in whole integer increments), to the amino acid sequence of the reference protein. In one embodiment, the homologue comprises, consists essentially of, or consists of, an amino acid sequence that is less than 100% identical, less than about 99% identical, less than about 98% identical, less than about 97% identical, less than about 96% identical, less than about 95% identical, and so on, in increments of 1%, to less than about 70% identical to the naturally occurring amino acid sequence of the reference protein. A homologue may include proteins or domains of proteins that are "near full- length", which means that such a homologue differs from the full-length protein, functional domain or immunological domain (as such protein, functional domain or immunological domain is described herein or otherwise known or described in a publicly available sequence) by the addition of or deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids from the N- and/or the C-terminus of such full-length protein or full-length functional domain or full-length immunological domain. As used herein, unless otherwise specified, reference to a percent (%) identity refers to an evaluation of homology which is performed using: (1) a BLAST 2.0 Basic BLAST homology search using blastp for amino acid searches and blastn for nucleic acid searches with standard default parameters, wherein the query sequence is filtered for low complexity regions by default (described in Altschul, S.F., Madden, T.L., Schaaffer, A.A., Zhang, J., Zhang, Z., Miller, W. & Lipman, D.J. (1997) "Gapped BLAST and PSI- BLAST: a new generation of protein database search programs." Nucleic Acids Res. 25:3389-3402, incorporated herein by reference in its entirety); (2) a BLAST 2 alignment (using the parameters described below); (3) and/or PSI-BLAST with the standard default parameters (Position-Specific Iterated BLAST. It is noted that due to some differences in the standard parameters between BLAST 2.0 Basic BLAST and BLAST 2, two specific sequences might be recognized as having significant homology using the BLAST 2 program, whereas a search performed in BLAST 2.0 Basic BLAST using one of the sequences as the query sequence may not identify the second sequence in the top matches. In addition, PSI- BLAST provides an automated, easy-to-use version of a "profile" search, which is a sensitive way to look for sequence homologues. The program first performs a gapped BLAST database search. The PSI-BLAST program uses the information from any significant alignments returned to construct a position-specific score matrix, which replaces the query sequence for the next round of database searching. Therefore, it is to be understood that percent identity can be determined by using any one of these programs.
Two specific sequences can be aligned to one another using BLAST 2 sequence as described in Tatusova and Madden, (1999), "Blast 2 sequences - a new tool for comparing protein and nucleotide sequences", FEMS Microbiol Lett. 174:247-250, incorporated herein by reference in its entirety. BLAST 2 sequence alignment is performed in blastp or blastn using the BLAST 2.0 algorithm to perform a Gapped BLAST search (BLAST 2.0) between the two sequences allowing for the introduction of gaps (deletions and insertions) in the resulting alignment.
An isolated nucleic acid molecule is a nucleic acid molecule that has been removed from its natural milieu (i.e., that has been subject to human manipulation), its natural milieu being the genome or chromosome in which the nucleic acid molecule is found in nature. As such, "isolated" does not necessarily reflect the extent to which the nucleic acid molecule has been purified, but indicates that the molecule does not include an entire genome or an entire chromosome in which the nucleic acid molecule is found in nature. An isolated nucleic acid molecule can include a gene. An isolated nucleic acid molecule that includes a gene is not a fragment of a chromosome that includes such gene, but rather includes the coding region and regulatory regions associated with the gene, but no additional genes that are naturally found on the same chromosome. An isolated nucleic acid molecule can also include a specified nucleic acid sequence flanked by (i.e., at the 5' and/or the 3' end of the sequence) additional nucleic acids that do not normally flank the specified nucleic acid sequence in nature (i.e., heterologous sequences). Isolated nucleic acid molecule can include DNA, RNA (e.g., mRNA), or derivatives of either DNA or RNA (e.g., cDNA). Although the phrase "nucleic acid molecule" primarily refers to the physical nucleic acid molecule and the phrase "nucleic acid sequence" primarily refers to the sequence of nucleotides on the nucleic acid molecule, the two phrases can be used interchangeably, especially with respect to a nucleic acid molecule, or a nucleic acid sequence, being capable of encoding a protein or domain of a protein.
A recombinant nucleic acid molecule is a molecule that can include at least one of any nucleic acid sequence encoding any one or more proteins described herein operatively linked to at least one of any transcription control sequence capable of effectively regulating expression of the nucleic acid molecule(s) in the cell to be transfected. Although the phrase "nucleic acid molecule" primarily refers to the physical nucleic acid molecule and the phrase "nucleic acid sequence" primarily refers to the sequence of nucleotides on the nucleic acid molecule, the two phrases can be used interchangeably, especially with respect to a nucleic acid molecule, or a nucleic acid sequence, being capable of encoding a protein. In addition, the phrase "recombinant molecule" primarily refers to a nucleic acid molecule operatively linked to a transcription control sequence, but can be used interchangeably with the phrase "nucleic acid molecule" which is administered to an animal.
A recombinant nucleic acid molecule includes a recombinant vector, which is any nucleic acid sequence, typically a heterologous sequence, which is operatively linked to the isolated nucleic acid molecule encoding a fusion protein of the present invention, which is capable of enabling recombinant production of the fusion protein, and which is capable of delivering the nucleic acid molecule into a host cell according to the present invention. Such a vector can contain nucleic acid sequences that are not naturally found adjacent to the isolated nucleic acid molecules to be inserted into the vector. The vector can be either RNA or DNA, either prokaryotic or eukaryotic, and preferably in the present invention, is a virus or a plasmid. Recombinant vectors can be used in the cloning, sequencing, and/or otherwise manipulating of nucleic acid molecules, and can be used in delivery of such molecules (e.g., as in a DNA composition or a vira l vector-based composition). Recom binant vectors are preferably used in the expression of nucleic acid molecules, and ca n also be referred to as expression vectors. Preferred recombinant vectors are capable of being expressed in a transfected host cell.
I n a recombinant molecule of the present invention, nucleic acid molecules are operatively linked to expression vectors containing regulatory sequences such as transcription control sequences, translation control sequences, origins of replication, and other regulatory sequences that are compatible with the host cell and that control the expression of nucleic acid molecules of the present invention. I n particular, recombinant molecules of the present invention include nucleic acid molecules that are operatively linked to one or more expression control sequences. The phrase "operatively linked" refers to linking a nucleic acid molecule to an expression control sequence in a manner such that the molecule is expressed when transfected (i.e., transformed, transduced or transfected) into a host cell. According to the present invention, the term "transfection" is used to refer to any method by which an exogenous nucleic acid molecule (i.e., a recombinant nucleic acid molecule) can be inserted into a cell. The term "transformation" can be used interchangeably with the term "transfection" when such term is used to refer to the introduction of nucleic acid molecules into microbial cells, such as algae, bacteria and yeast. In microbial systems, the term "transformation" is used to describe an inherited change due to the acquisition of exogenous nucleic acids by the microorganism and is essentially synonymous with the term "transfection." Therefore, transfection techniques include, but are not limited to, transformation, chemical treatment of cells, particle bombardment, electroporation, microinjection, lipofection, adsorption, infection and protoplast fusion.
The present invention will be illustrated by mea ns of non limiting examples referring to the following figures.
Figure 1. Screening of pJRP- and pCEV-transformed Saccharomyces strains. Following transformations of Saccharomyces strains, plasmid DNA was extracted and submitted to PCR to confirm if they contain either the HIV gag (around 1.500 bp) or the aphAl (around 500 bp) genetic sequences to confirm the presence of pJRP or pCEV, respectively. Positive controls used were the plasmid containing the H IV gag sequence obtained commercially (for pJRP) and pCEV itself. Negative control for both screenings was an unrelated plasmid, pYC44016'44.
Yeast strains (Sb, 905, Sc47, Lll, 4741 and 4743).
Figure 2. Genetically engineered Saccharomyces strains express HIV Gag antigen. Expression of HIV Gag was determined by flow cytometry and it was observed only in pJRP-transformed strains. As observed in the dot plots, the levels of viral antigen vary heterogeneously between different strains. No HIV Gag was detected in any of the PCEV strains. Similar results were observed with fluorescence microscopy. Bar 10 μιη.
Figure 3. Genetically modified probiotic Saccharomyces strains are avidly phagocytosed by human dendritic cells in vitro. After 4 h in co-culture, phagocytosis was assessed by flow cytometry. Yeasts were labelled with Calcofluor White stain (CFW), which was observed in almost all dendritic cells put in contact with all three yeast strains (Sb, Sc47 and 4743) either transformed with pCEV or pJRP. Quenching of non-internalized, CFW labelled yeasts was done with trypan blue. As basal control, dendritic cells treated with paraformaldehyde (PFA) thus rendered unable to perform phagocytosis, were similarly incubated with CFW labelled yeasts and treated with trypan blue. Results are shown as average phagocytosis levels using the dendritic cells of three different donors in percentage ± standard deviation.
Figure 4. Following phagocytosis of genetically engineered probiotic Saccharomyces strains, human dendritic cells undergo maturation and polarization to a specific type of immune response. A) The expression of surface markers of activation CD86, CD83 and CCR7 indicates that contact with both pCEV- and pJRP-transformed yeasts induces maturation of DCs. As a consequence of maturation, B) polarization of DCs appears to be towards a type 1 response, due to the higher levels of Siglec-1 observed in contrast with no increase in the levels of OX40L, the latter a biomarker of a type 2 response. Results are presented as the average of the mean fluorescence intensity (MFI) normalized to the basal levels of DCs which were not incubated with yeasts, using DCs from three different healthy donors, ± standard deviation. *, p<0.05 and **, p<0.01 versus immature DCs which have not been in contact with yeasts, just medium, and were processed likewise for maturation markers assessment
Figure 5. Genetically engineered probiotic Saccharomyces strains induce human immature dendritic cells to produce higher levels of cytokines which would induce a T cellular immune response. Following incubation with yeasts transformed with both plasmids, higher levels of IFN-γ, IL-10, IL-12p70, IL-Ιβ, IL-6, IL-8 and TNF-a were detected in the medium where DCs were grown. Results are presented as the average of the cytokine concentration observed using DCs derived from 3 healthy donors, ± standard deviation. While cytokine basal levels of DCs, i.e., which were not incubated with yeasts, are negligible for IFN-γ, IL-10, IL-12p70 and IL-Ιβ, for the remaining tested cytokines, concentration was normalized to its respective basal level. Figure 6. Genetically engineered probiotic Saccharomyces strains expressing HIV Gag induce specific T cell clonal expansion. Maturation of an HIV+ patient DCs with transformed yeasts and subsequent incubation with autologous T cells showed that efficient HIV Gag antigen presentation only occurred when DCs were incubated with pJRP-transformed probiotic strains. Following stimulation of T cells with a HIV Gag peptide pool, clonal expansion of activated T cells is only observed if they were activated by DCs which had previously phagocyted pJRP- transformed probiotic strains Sb or Sc47, but not likewise transformed non-probiotic strain 4743. Neither immature DCs (iDCs) or pCEV-tra nsformed strains induced relevant T cell clonal expansion. Results are presented as the average of the immunospots normalized to the basal levels of T cells not subjected to peptide pool, done in triplicate, ± standard deviation. *, p<0.05 and **, p<0.01.
Figure 7. Map of pCEV-Gl-Km plasmid, which upon insertion of AGA1 and fusion protein AGA2 HIV Gag sequences, yield pJRP plasmids
Figure 8. Maps of pJRP H IV GAG plasmids restriction sites used to insert the sequences of AGA1 and fusion protein AGA2 HIV GAG are indicated.
DETAILED DESCRIPTION OF THE INVENTION
Methods
Reagents, strains, plasmid and growth media. Unless specified otherwise, all chemicals were purchased from Sigma-Aldrich (St. Louis, MO, USA).
The probiotic Saccharomyces strains used in this work were 5. boulardii 17 (Sb), 5. cerevisiae UFMG A-905 (905), 5. cerevisiae Sc47 and 5. cerevisiae Lll (Lll). Non-probiotic strains used were 5. cerevisiae BY4741 (4741) and 5. cerevisiae BY4743 (4743). Yeast strains were obtained as described previously11 and reported in the table below.
Figure imgf000059_0001
The plasmid used in this work was pCEV-Gl-Km (pCEV)12, a gift from Lars Nielsen and Claudia Vickers through Addgene (plasmid # 46813; Cambridge, MA, USA). pCEV is a bicistronic plasmid (sequence reported below), thus allowing simultaneous expression of 2 different genes, and carries resistance for both ampicillin and geneticin (G418) as well as TEFl and PGKl promoters (Fig. 7).
Figure imgf000059_0002
AAGGAAGGAGTTAGACAACCTGAAGTCTAGGTCCCTATTTAT I I I I I I ATAGTTATGTTAGTATTAAGAACGTTAT TTATATTTCAAATTTTTCTT I I I I I I CTGTACAGACGCGTGTACGCATGTAACATTATACTGAAAACCTTGCTTGAG AAGGTTTTGGGACGCTCGAAGATCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTA TTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTC ACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCA GCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATC ACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGA AGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCG TGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGC ACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACG ACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTC TTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACC TTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGG I I I I I I I GTTTGCAAG CAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTG GAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTA AAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGA GGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATA CGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCA GCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATT AATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGC ATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGA TCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTG TT ATC ACTC ATG GTTATG G C AG C ACTG C ATAATTCTCTTACTGTC ATG CC ATCCGTAAG ATG CTTTTCTGTG ACTG G TGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGG ATAATACCG CG CC AC AT AG C AG A ACTTT AA AAGTG CTC ATC ATTG G AA AACGTTCTTCG G G G CG A A AACTCTC AA GGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTC ACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAA TGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACAT ATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGAACGAAG CATCTGTGCTTCATTTTGTAGAACAAAAATGCAACGCGAGAGCGCTAATTTTTCAAACAAAGAATCTGAGCTGCA TTTTTACAGAACAGAAATGCAACGCGAAAGCGCTATTTTACCAACGAAGAATCTGTGCTTCATTTTTGTAAAACAA AAATGCAACGCGAGAGCGCTAATTTTTCAAACAAAGAATCTGAGCTGCATTTTTACAGAACAGAAATGCAACGC GAGAGCGCTATTTTACCAACAAAGAATCTATACTTCTTTTTTGTTCTACAAAAATGCATCCCGAGAGCGCTATTTTT CT AAC A AAG C ATCTTAG ATTACTTTTTTTCTCCTTTGTG CG CTCT AT AATG C AGTCTCTTG ATAACTTTTTG C ACTGT AGGTCCGTTAAGGTTAGAAGAAGGCTACTTTGGTGTCTATTTTCTCTTCCATAAAAAAAGCCTGACTCCACTTCCC GCGTTTACTGATTACTAGCGAAGCTGCGGGTGCATTTTTTCAAGATAAAGGCATCCCCGATTATATTCTATACCGA TGTGGATTGCGCATACTTTGTGAACAGAAAGTGATAGCGTTGATGATTCTTCATTGGTCAGAAAATTATGAACGG TTTCTTCTATTTTGTCTCTATATACTACGTATAGGAAATGTTTACATTTTCGTATTGTTTTCGATTCACTCTATGAAT AGTTCTTACTACAA I I I I I I TGTCTAAAGAGTAATACTAGAGATAAACATAAAAAATGTAGAGGTCGAGTTTAGAT GCAAGTTCAAGGAGCGAAAGGTGGATGGGTAGGTTATATAGGGATATAGCACAGAGATATATAGCAAAGAGAT ACTTTTGAGCAATGTTTGTGGAAGCGGTATTCGCAATATTTTAGTAGCTCGTTACAGTCCGGTGCGTTTTTGGTTT TTTGAAAGTGCGTCTTCAGAGCGCTTTTGGTTTTCAAAAGCGCTCTGAAGTTCCTATACTTTCTAGAGAATAGGAA CTTCGGAATAGGAACTTCAAAGCGTTTCCGAAAACGAGCGCTTCCGAAAATGCAACGCGAGCTGCGCACATACA GCTCACTGTTCACGTCGCACCTATATCTGCGTGTTGCCTGTATATATATATACATGAGAAGAACGGCATAGTGCGT GTTTATG CTT AA ATG CGTACTTAT ATG CGTCTATTTATGT AG G ATG AA AG GT AGTCTAGTACCTCCTGTG ATATTA TCCCATTCCATGCGGGGTATCGTATGCTTCCTTCAGCACTACCCTTTAGCTGTTCTATATGCTGCCACTCCTCAATT GGATTAGTCTCATCCTTCAATGCTATCATTTCCTTTGATATTGGATCATGGTAGACAACCCTTAATATAACTTCGTA TAATGTATGCTATACGAAGTTATTAGGTCTAGAGATCTGTTTAGCTTGCCTCGTCCCCGCCGGGTCACCCGGCCA GCGACATGGAGGCCCAGAATACCCTCCTTGACAGTCTTGACGTGCGCAGCTCAGGGGCATGATGTGACTGTCGC
Figure imgf000061_0001
Plasmid propagation and genetic manipulation were done using MAX Efficiency® DH5a™ competent Escherichia coli cells from Thermo Fisher Scientific (Waltham, MA, USA), according to the manufacturer's instructions.
In all assays reported here, except if stated otherwise, yeasts were grown in YPD, at either 37°C (probiotic) or 30°C (non-probiotic). E. coli was grown in LB at 37°C.
Plasmid construction. To express the HIV Gag antigen on the surface of the yeast strains, the inventor first reverse translated the HIV-1 clade B HXB2 Gag protein sequence (NCBI Accession No. AAB50258.1) into its nucleotide sequence and optimized it for expression in 5. cerevisiae using the Leto 1.0 software developed by Entelechon® (Ebersberg, Germany), resulting in the sequence observed below.
Nucleotide sequence of HIV-1 clade B HXB2 Gag optimized for expression in 5. cerevisiae (SEQ. I D No. 1)
Figure imgf000061_0002
Figure imgf000062_0001
Identity between the original (SEQ. ID No. 3) and optimized gag genetic sequences is of 73.47% as shown below.
Figure imgf000062_0002
Figure imgf000063_0001
Using NCBI nucleotide BLAST online tool, the inventor observed an identity of up 77% between the optimized gag sequence and patient isolated HIV sequenced strains. Protein identity was not assessed as it would match 100% with the original sequence, since codon optimization did not change the amino acid sequence as reported below.
HIV Gag (Genebank ref: AAB50258.1)(SEQ ID No. 2)
Figure imgf000063_0002
Figure imgf000064_0001
To ensure a better translation, the inventor added the 5. cerevisiae Kozak consensus sequence AAAAAA before the start codon13. The resulting optimized gag gene sequence was artificially synthetized by Genscript (Piscataway, NJ, USA). For insertion of this gene in pCEV, the inventor added the restriction sites Sail and Nhel at the 5' and 3' ends, respectively, by PCR amplification using the primers GAG Sail F 5'-TAAGCAGTCGACAAAAAAATGGGAGCGAGAGCTTCCGTC-3' (SEQ ID No. 16) and GAG Nhel R 5'-TGCTTAGCTAGCTCAATTGGCTGCTCGGATCATTTCC-3' (SEQ ID No. 17). Following digestion of both amplification product and plasmid with the referred enzymes, the resulting construct was inserted in pCEV, originating pCEV HIV GAG. Competent DH5a f. coli were transformed with pCEV HIV GAG and grown in LB containing 100 μg/ml of ampicillin. Positive colonies were confirmed by both PCR screening using the referred primers and diagnostic digestion using the aforementioned restriction enzymes.
By fusing a desired foreign protein with AGA2p, simultaneous expression of the surface 5. cerevisiae proteins AGAlp and AGA2p will lead to the co-expression of the foreign protein with AGA2p in the yeast surface14'15. Thus, the inventor extracted the genomic DNA of all 5. cerevisiae strains used in this work with a Yeast DNA extraction kit (Thermo Fisher Scientific) and proceeded to PCR amplification of AGA1 and AGA2 genes. Primers used for amplification of AGA1 added the restriction sites Notl and Pad at the 5' and 3' extremities, respectively, and their sequences were ScAGAl Notl F 5'-TAAG C AG CGG CCG CATG AC ATTATCTTTCG CTCATT-3' (SEQ ID No. 18) and ScAGAl Pad R 5'- TG CTTATTAATTAATCATTATTAACTG AAAATTACATTG C AA -3' (SEQ ID No. 19). Since 5. cerevisiae and 5. boulardii possess diverse AGA1 genetic sequences14, the inventor used a different reverse primer for amplification of this sequence in the latter strain, SbAGAl Pad R 5'-TGCTTATTAATTAATCATTAACTAAAAATTACATTGCAA-3' (SEQ ID No. 20). Similarly, PCR amplification of AGA2 included the restriction sites of BamHI and Sail at the beginning and end of the sequence respectively, and the primers used were ScAGA2 BamHI F 5'-TAAGCAGGATCCATGCAGTTACTTCGCTGTTT-3' (SEQ ID No. 21) and ScAGA2 Sail R 5'- TGCTTAGTCGACAAAAACATACTGTGTGTTTA-3' (SEQ ID No. 22). Following digestion of both sequences and plasmid with the referred restriction enzymes, AGA1 and AGA2 sequences. Sc AGAl sequence is the same for all strains but S. boulardii. Sb AGAl (Genebank ref: KC200251.1); ScAGAl (NCBI ref: NM_001183221.1).
Figure imgf000065_0001
Figure imgf000066_0001
Figure imgf000067_0001
Figure imgf000068_0001
Figure imgf000069_0001
G CTTCC ACTTCTCC A AGTTC A AC ATCTATT AG CTCT ACTTTTACTG ATTC AACTTC ATCCCTTG G CTCCTCTATAG C A TCTTCATCAACGTCTGTGTCATTATACAGCCCATCCACACCTGTTTACTCCGTCCCTTCGACTTCGTCAAATGTTGC AACTCCTTCTATGACTTCTTCAACTGTTGAAACAACTGTTAGTTCACAAAGTTCGTCTGAATATATCACCAAATCCT CAATTTCTACTACTATCCCATCATTTTCCATGTCTACATATTTCACCACTGTTAGTGGAGTCACTACAATGTATACG ACATGGTGTCCTTATAGCTCTGAATCTGAGACTAGCACATTAACCAGTATGCATGAAACGGTTACAACAGACGCT ACAGTCTGCACTCACGAGTCTTGCATGCCCTCGCAGACAACAAGTTTGATTACATCTTCTATAAAAATGTCCACTA AAAACGTCGCAACTTCTGTAAGCACCTCAACGGTTGAATCCTCATATGCATGCTCCACATGTGCTGAAACGTCAC ACTCGTATTCTTCCGTGCAAACAGCTTCATCAAGTTCTGTAACACAGCAGACCACATCCACAAAGAGTTGGGTAA GTTCAATGACAACTTCGGATGAAGATTTCAATAAGCACGCTACCGGTAAGTATCATGTAACATCTTCAGGTACCT CAACCATTTCGACTAGTGTAAGTGAAGCCACGAGTACATCAAGCATTGACTCAGAATCTCAAGAACAATCATCAC ACTTATTATCGACATCGGTCCTTTCATCCTCCTCCTTGTCTGCTACATTATCCTCTGACAGTACTATTTTGCTATTCA GTTCTGTATCATCACTAAGTGTCGAACAGTCACCAGTTACCACACTTCAAATTTCTTCAACATCAGAGATTTTACAA CCCACTTCTTCCACAGCTATTGCTACAATATCTGCCTCTACATCATCACTTTCCGCAACATCTATCTCTACACCATCT ACCTCTGTGGAATCGACTATTGAATCTTCATCATTGACTCCGACGGTATCTTCTATTTTCCTCTCATCATCATCTGCT CCCTCTTCTCTACAAACATCTGTTACCACTACAGAAGTTTCCACTACTTCAATCTCCATACAATACCAAACTTCATCA ATGGTAACAATTAGCCAATATATGGGCAGTGGATCGCAAACGCGTTTGCCATTAGGAAAGTTGGTCTTCGCCATC ATG G C AGTTG CTTG C AATGTA ATTTTC AGTTA AG CG G CCG CTTGTA ATTA AA ACTTAG ATTAG ATTG CTATG CTTT CTTTCTAATGAGCAAGAAGTAAAAAAAGTTGTAATAGAACAAGAAAAATGAAACTGAAACTTGAGAAATTGAAG ACCGTTTATTAACTTAAATATCAATGGGAGGTCATCGAAAGAGAAAAAAATCAAAAAAAAAAATTTTCAAGAAAA AGAAACGTGATAAAAATTTTTATTGCCTTTTTCGACGAAGAAAAAGAAACGAGGCGGTCTCTTTTTTCTTTTCCAA ACCTTTAGTACGGGTAATTAACGACACCCTAGAGGAAGAAAGAGGGGAAATTTAGTATGCTGTGCTTGGGTGTT TTGAAGTGGTACGGCGATGCGCGGAGTCCGAGAAAATCTGGAAGAGTAAAAAAGGAGTAGAAACATTTTGAAG CTATGGTGTGTGCGGCCGGCCTGGAAGTACCTTCAAAGAATGGGGTCTTATCTTGTTTTGCAAGTACCACTGAGC AGGATAATAATAGAAATGATAATATACTATAGTAGAGATAACGTCGATGACTTCCCATACTGTAATTGCTTTTAGT TGTGTATTTTTAGTGTGCAAGTTTCTGTAAATCGATTAA I I I I I I I TTCTTTCCTCTTTTTATTAACCTTAATTTTTAT TTTAG ATTCCTG ACTTC AACTC A AG ACG C AC AG ATATTATAAC ATCTG C ATA AT AG G C ATTTG C A AG A ATTACTCG TGAGTAAGGAAAGAGTGAGGAACTATCGCATACCTGCATTTAAAGATGCCGATTTGGGCGCGAATCCTTTATTTT GGCTTCACCCTCATACTATTATCAGGGCCAGAAAAAGGAAGTGTTTCCCTCCTTCTTGAATTGATGTTACCCTCAT AAAGCACGTGGCCTCTTATCGAGAAAGAAATTACCGTCGCTCGTGATTTGTTTGCAAAAAGAACAAAACTGAAAA AACCCAGACACGCTCGACTTCCTGTCTTCCTATTGATTGCAGCTTCCAATTTCGTCACACAACAAGGTCCTAGCGA CG G CTC AC AG GTTTTGTA AC A AG C A ATCG A AG GTTCTG G A ATG G CG G G A AAG G GTTTAGTACC AC ATG CTATG A TGCCCACTGTGATCTCCAGAGCAAAGTTCGTTCGATCGTACTGTTACTCTCTCTCTTTCAAACAGAATTGTCCGAAT CGTGTGACAACAACAGCCTGTTCTCACACACTCTTTTCTTCTAACCAAGGGGGTGGTTTAGTTTAGTAGAACCTCG TG A AACTTAC ATTTAC ATATATATAA ACTTG C ATAA ATTG GTC AATG C AAG AA AT AC AT ATTTG GTCTTTTCT AATT CGTAGTTTTTCAAGTTCTTAGATGCTTTCTTTTTCTCTTTTTTACAGATCATCAAGGAAGTAATTATCTACTTTTTAC A AC A A AT AT AAA AC AAG GATCC ATG C AGTT ACTTCG CTGTTTTTC A ATATTTTCTGTTATTG CTTC AGTTTT AG C AC AGGAACTGACAACTATATGCGAGCAAATCCCCTCACCAACTTTAGAATCGACGCCGTACTCTTTGTCAACGACTA CTATTTTGGCCAACGGGAAGGCAATGCAAGGAGTTTTTGAATATTACAAATCAGTAACGTTTGTCAGTAATTGCG GTTCTCACCCCTCAACAACTAGCAAAGGCAGCCCCATAAACACACAGTATGTTTTTGTCGACAAAAAAATGGGAG CGAGAGCTTCCGTCCTAAGCGGTGGAGAGCTGGATAGGTGGGAGAAAATTAGACTGAGACCAGGAGGGAAGA AGAAGTACAAGCTAAAGCACATCGTTTGGGCTTCCAGGGAATTAGAAAGATTTGCCGTGAATCCTGGGTTGTTA GAGACTTCAGAGGGCTGCCGTCAAATTCTTGGACAACTACAACCATCTCTTCAGACCGGTTCTGAAGAACTTAGG TCTCTGTATAACACAGTAGCAACTTTGTATTGCGTACACCAAAGAATCGAGATTAAAGACACCAAAGAAGCTTTG GACAAAATTGAGGAGGAACAGAACAAATCAAAGAAAAAAGCGCAACAGGCAGCAGCTGATACGGGTCATTCAA ACC AG GTT AGTC AA A ACTACCC AATCGTG C AG AATATAC A AG GTC A AATG GTG CATC AAG C A ATCTC ACC A AG G ACTTTGAATGCGTGGGTAAAAGTAGTTGAAGAAAAGGCCTTCTCTCCGGAAGTTATTCCAATGTTCTCTGCTCTGT CCGAAGGTGCGACTCCCCAAGACTTGAATACAATGCTGAATACTGTTGGAGGCCATCAGGCTGCTATGCAGATG CTGAAAGAGACAATTAACGAAGAGGCAGCTGAATGGGATAGGGTTCATCCTGTCCATGCTGGTCCTATTGCTCC AGGTCAAATGAGAGAACCAAGAGGTTCTGATATCGCAGGAACCACGTCAACTCTACAGGAGCAAATAGGTTGG
Figure imgf000071_0001
Figure imgf000072_0001
ATACAGCCCATCCACACCTGTTTACTCCGTCCCTTCGACTTCGTCAAATGTTGCAACTCCTTCTATGACTTCTTCAAC TGTTGAAACAACTGTTAGTTCACAAAGTTCGTCTGAATATATCACCAAATCCTCAATTTCTACTACTATCCCATCAT TTTCCATGTCTACATATTTCACCACTGTTAGTGGAGTCACTACAATGTATACGACATGGTGTCCTTATAGCTCTGAA TCTGAGACTAGCACATTAACCAGTATGCATGAAACGGTTACAACAGACGCTAAAGTCTGCACTCACGAGTCTTGC ATGCCCTCGCAGACAACAAGTTTGATTACATCTTCTATAAAAATGTCCACTAAAAACGTCGCAACTTCTGTAAGCA CCTCAACGGTTGAATCCTCATATGCATGCTCCACATGTGCTGAAACGTCACACTCGTATTCTTCCGTGCAAACAGC TTCATCAAATTCTGTAACACAGCAGACCACATCCACAAAGAGTTGGGTAAGTTCAATGACAACTTCGGATGAAGA TTTCAATAAGCACGCTACCGGTAAGTATCATGCAACATCTTCAGGTACCTCAACCATTTCGACTAGTGTAAGTGAA GCCACGAGTACATCAAGCATTGACTCAGAATCTCAAGAACAATCATCACACTTATTATCGACATCGGTCCCTTCAT CCTCCTCCTTGTCTGCTACATTATCCTCTGACAGTACTATTTTGCTATTCAGTTCTGTATCATCACTAAGTGTCGAAC AGTCACCAGTTACCACACTTCAAATTTCTTCAACATCAGAGATTTTGCAACCCACTTCTTCCACAGCTATTGCTACA ATATCTGCATCTACATCATCACTTTCCGCAACATCTATCTCTACACCATCTACCTCTGTGGAATCGACTATTGAATC TTCATCATTGACTCCGACGGTATCTTCTATTTCCCTCTCATCATCATCTGCTCCCTCTTCTCTACAAACATCTGTTAC CACTACAGAAGTTTCCACTACTTCAATCTCCATACAATACCAAACTTCATCAATGGTAACAATTAGCCAATATATG GGCAGTGGATCGCAAACGCGTTTGCCATTAGGAAAGTTGGTCTTCGCCATCATGGCAGTTGCTTGCAATGTAATT TTTAGTTAAGCGGCCGCTTGTAATTAAAACTTAGATTAGATTGCTATGCTTTCTTTCTAATGAGCAAGAAGTAAAA AAAGTTGTAATAGAACAAGAAAAATGAAACTGAAACTTGAGAAATTGAAGACCGTTTATTAACTTAAATATCAAT GGGAGGTCATCGAAAGAGAAAAAAATCAAAAAAAAAAATTTTCAAGAAAAAGAAACGTGATAAAAATTTTTATT GCCTTTTTCGACGAAGAAAAAGAAACGAGGCGGTCTC I I I I I I CTTTTCCAAACCTTTAGTACGGGTAATTAACGA CACCCTAGAGGAAGAAAGAGGGGAAATTTAGTATGCTGTGCTTGGGTGTTTTGAAGTGGTACGGCGATGCGCG GAGTCCGAGAAAATCTGGAAGAGTAAAAAAGGAGTAGAAACATTTTGAAGCTATGGTGTGTGCGGCCGGCCTG GAAGTACCTTCAAAGAATGGGGTCTTATCTTGTTTTGCAAGTACCACTGAGCAGGATAATAATAGAAATGATAAT ATACTATAGTAGAGATAACGTCGATGACTTCCCATACTGTAATTGCTTTTAGTTGTGTATTTTTAGTGTGCAAGTTT CTGTAAATCGATTAA I I I I I I I TTCTTTCCTCTTTTTATTAACCTTAATTTTTATTTTAGATTCCTGACTTCAACTCAA GACGCACAGATATTATAACATCTGCATAATAGGCATTTGCAAGAATTACTCGTGAGTAAGGAAAGAGTGAGGAA CTATCGCATACCTGCATTTAAAGATGCCGATTTGGGCGCGAATCCTTTATTTTGGCTTCACCCTCATACTATTATCA GGGCCAGAAAAAGGAAGTGTTTCCCTCCTTCTTGAATTGATGTTACCCTCATAAAGCACGTGGCCTCTTATCGAG AAAGAAATTACCGTCGCTCGTGATTTGTTTGCAAAAAGAACAAAACTGAAAAAACCCAGACACGCTCGACTTCCT GTCTTCCT ATTG ATTG C AG CTTCC AATTTCGTC AC AC A AC AAG GTCCTAG CG ACG G CTC AC AG GTTTTGTA AC A AG CAATCGAAGGTTCTGGAATGGCGGGAAAGGGTTTAGTACCACATGCTATGATGCCCACTGTGATCTCCAGAGCA AAGTTCGTTCGATCGTACTGTTACTCTCTCTCTTTCAAACAGAATTGTCCGAATCGTGTGACAACAACAGCCTGTT CTC AC AC ACTCTTTTCTTCTAACC AAG G G G GTG GTTT AGTTTAGTAG A ACCTCGTG A AACTTAC ATTTAC ATATATA TAAACTTGCATAAATTGGTCAATGCAAGAAATACATATTTGGTCTTTTCTAATTCGTAGTTTTTCAAGTTCTTAGAT GCTTTCTTTTTCTCTTTTTTACAGATCATCAAGGAAGTAATTATCTACTTTTTACAACAAATATAAAACAAGGATCC ATG C AGTTACTTCG CTGTTTTTC A ATATTTTCTGTTATTG CTTC AGTTTTAG C AC AG G A ACTG AC AACT AT ATG CG A GCAAATCCCCTCACCAACTTTAGAATCGACGCCGTACTCTTTGTCAACGACTACTATTTTGGCCAACGGGAAGGC AATGCAAGGAGTTTTTGAATATTACAAATCAGTAACGTTTGTCAGTAATTGCGGTTCTCACCCCTCAACAACTAGC AAAGGCAGCCCCATAAACACACAGTATGTTTTTGTCGACAAAAAAATGGGAGCGAGAGCTTCCGTCCTAAGCGG TGGAGAGCTGGATAGGTGGGAGAAAATTAGACTGAGACCAGGAGGGAAGAAGAAGTACAAGCTAAAGCACAT CGTTTGGGCTTCCAGGGAATTAGAAAGATTTGCCGTGAATCCTGGGTTGTTAGAGACTTCAGAGGGCTGCCGTC AAATTCTTGGACAACTACAACCATCTCTTCAGACCGGTTCTGAAGAACTTAGGTCTCTGTATAACACAGTAGCAAC TTTGTATTGCGTACACCAAAGAATCGAGATTAAAGACACCAAAGAAGCTTTGGACAAAATTGAGGAGGAACAGA AC A AATC A A AG A AA AA AG CG C A AC AG G C AG C AG CTG ATACG G GTC ATTC AA ACC AG GTTAGTC A AA ACTACCC A ATCGTGCAGAATATACAAGGTCAAATGGTGCATCAAGCAATCTCACCAAGGACTTTGAATGCGTGGGTAAAAGT AGTTGAAGAAAAGGCCTTCTCTCCGGAAGTTATTCCAATGTTCTCTGCTCTGTCCGAAGGTGCGACTCCCCAAGA CTTGAATACAATGCTGAATACTGTTGGAGGCCATCAGGCTGCTATGCAGATGCTGAAAGAGACAATTAACGAAG AGGCAGCTGAATGGGATAGGGTTCATCCTGTCCATGCTGGTCCTATTGCTCCAGGTCAAATGAGAGAACCAAGA GGTTCTGATATCGCAGGAACCACGTCAACTCTACAGGAGCAAATAGGTTGGATGACAAACAATCCTCCTATACCC GTCGGTGAGATATATAAGAGATGGATTATCTTGGGGTTGAATAAGATTGTTAGAATGTACAGCCCAACTTCTATA
Figure imgf000074_0001
TATATAGCAAAGAGATACTTTTGAGCAATGTTTGTGGAAGCGGTATTCGCAATATTTTAGTAGCTCGTTACAGTCC GGTGCGTTTTTGGTTTTTTGAAAGTGCGTCTTCAGAGCGCTTTTGGTTTTCAAAAGCGCTCTGAAGTTCCTATACT TTCTAGAGAATAGGAACTTCGGAATAGGAACTTCAAAGCGTTTCCGAAAACGAGCGCTTCCGAAAATGCAACGC GAGCTGCGCACATACAGCTCACTGTTCACGTCGCACCTATATCTGCGTGTTGCCTGTATATATATATACATGAGAA GAACGGCATAGTGCGTGTTTATGCTTAAATGCGTACTTATATGCGTCTATTTATGTAGGATGAAAGGTAGTCTAG TACCTCCTGTGATATTATCCCATTCCATGCGGGGTATCGTATGCTTCCTTCAGCACTACCCTTTAGCTGTTCTATAT G CTG CC ACTCCTC A ATTG G ATTAGTCTC ATCCTTC A ATG CTATC ATTTCCTTTG AT ATTG G ATC ATG GTAG AC A ACC CTTAATATAACTTCGTATAATGTATGCTATACGAAGTTATTAGGTCTAGAGATCTGTTTAGCTTGCCTCGTCCCCGC CGGGTCACCCGGCCAGCGACATGGAGGCCCAGAATACCCTCCTTGACAGTCTTGACGTGCGCAGCTCAGGGGCA TGATGTGACTGTCGCCCGTACATTTAGCCCATACATCCCCATGTATAATCATTTGCATCCATACATTTTGATGGCCG CACGGCGCGAAGCAAAAATTACGGCTCCTCGCTGCAGACCTGCGAGCAGGGAAACGCTCCCCTCACAGACGCGT TGAATTGTCCCCACGCCGCGCCCCTGTAGAGAAATATAAAAGGTTAGGATTTGCCACTGAGGTTCTTCTTTCATAT ACTTCCTTTTAAAATCTTGCTAGGATACAGTTCTCACATCACATCCGAACATAAACAACCATGGGTAAGGAAAAG ACTCACGTTTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAAT GTCGGGCAATCAGGTGCGACAATCTATCGATTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGG CAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCC GACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGCAAAACAGCATTC CAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCAT TCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATA ACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATG CATAAGCTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGA GGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTAT GGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATAT GAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAATCAGTACTGACAATAAAAAGATTCTTGTTTTCAA GAACTTGTCATTTGTATAG I I I I I I I ATATTGTAGTTGTTCTATTTTAATCAAATGTTAGCGTGATTTATA I I I I I I TT CGCCTCGACATCATCTGCCCAGATGCGAAGTTAAGTGCGCAGAAAGTAATATCATGCGTCAATCGTATGTGAATG CTGGTCGCTATACTGCTGTCGATTCGATACTAACGCCGCCATCCAGTGTCGAAAACGAGCTCTCGAGAACCCTTA ATATAACTTCGTATAATGTATGCTATACGAAGTTATTAGGTGATATCAGATCCACTA Yeast transformation. Each yeast strain was transformed with its respective pJRP using the S.c. EasyComp™ Transformation Kit (Thermo Fisher Scientific), following manufacturer's instructions, as previously described16. As a negative control, the yeasts were transformed with the empty plasmid pCEV. Transformed yeasts were grown in selective YPD media containing 100 μg/ml of G418. Screening of transformed yeasts was done by first inducing protoplast formation by cell wall digestion with Novozyme™ (Trichoderma harzianum lysing enzymes) followed by extraction of plasmid DNA using a Wizard® Plus SV Miniprep DNA Purification System from Promega (Madison, Wl, USA). The presence of pJRP was confirmed by PCR amplification using the above described primers GAG Sail F and GAG Nhel R. Screening of pCEV was done using the primers G418 F 5'-ATTAAATTCCAACATGGATGC-3' (SEQ I D No. 23) and G418 R 5'-GACTGAATCCGGTGAGAATG-3' (SEQ. I D No. 15), which amplified partially the sequence of aminoglycoside 3'-phosphotransferase I I (APT 3' I I), the enzyme responsible for resistance to G418. Detection of expression of Gag protein in transformed yeasts by indirect immunofluorescence. To confirm if the HIV Gag antigen was expressed in the transformed yeasts, the inventor performed an indirect immunofluorescence. Briefly, yeasts were grown to stationary phase overnight, washed with PBS and fixed in paraformaldehyde (PFA) 1% for 30 min. Following 3 PBS washes, yeasts were incubated in blocking solution (PBS containing 3% bovine serum albumin (BSA), 5% fetal bovine serum (FBS; GE Healthcare, Logan, UT, USA) and 0,1M glycine) for 30 min. The inventor then incubated the yeasts with an antibody anti-HIV-1 SF2 p24 rabbit polyclonal, diluted 1:200 in blocking solution, for 90 min. Anti-HIV-1 SF2 p24 was obtained through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH. As negative control, a separate set of yeasts were incubated with plain blocking solution. Following 3 washes with PBS, yeasts were incubated with a goat anti-rabbit IgG (H+L) secondary antibody Alexa Fluor 488 (Thermo Fisher Scientific), diluted 1:2.000 in blocking solution, for 60 min. Yeasts were then washed twice in PBS, mounted in a microscopy slide and analyzed under a Zeiss Axioimager Ml fluorescence microscope (Carl Zeiss, Jena, Germany). Fluorescence pictures were processed using ImageJ software (NIH, Bethesda, MD, USA). As extra negative controls, the inventor used both non- and PCEV-transformed yeasts. The entire procedure was done at room temperature (RT) and all incubations were done with gentle agitation. Detection of expression of Gag protein in transformed yeasts by flow cytometry. To further confirm the expression of HIV Gag antigen, the inventor submitted the transformed yeasts stained as described above to a flow cytometry analysis using an LSRFortessa cytometer (BD Biosciences, San Jose, CA, USA). The results were analyzed with FlowJo 887 software (FlowJo, LLC, Ashland, OR) and, for each strain, the percentage of pJRP- and pCEV-transformed yeasts was confronted.
Study participants. Where indicated, anonymous healthy, HIV-l-negative, blood buffy coat donors were used in DCs phagocytosis and phenotyping experiments. Human subject research was approved by the University of Pittsburgh Institutional Review Board, and informed consent was obtained from all participants. One HIV-l-infected participant, was chosen from the Multicenter AIDS Cohort Study (MACS), a natural history study of men who have sex with men17'18. Dendritic cells maturation induced by transformed yeasts. Peripheral blood mononuclear cells (PBMCs) were purchased from the Western Pennsylvania Blood Bank (Pittsburgh, PA, USA) in the form of buffy coat from 3 healthy individuals. Fresh PBMCs from buffy coats were purified using Ficoll/Hypaque gradient (GE Healthcare). The collected whole blood was diluted in PBS at a 1:4 ratio and transferred to 50 mL conical plastic tubes containing 13 mL of Ficoll/Hypaque. The cells suspension was centrifuged at 975xg for 30 minutes at room temperature (RT). The resulting PBMC layer was aspirated and washed 4 times with PBS followed by centrifugation at 450xg for 10 minutes at RT. Monocytes were magnetically purified from PBMCs using a MACS column and CD14 MicroBeads (both from Myltenyi Biotech Inc., Auburn, CA, USA), according to the manufacturer's instructions. The monocytes pellet was re-suspended at a concentration of 107 cells/ml of FBS 10% dimethyl sulfoxide (DMSO), dripped slowly under ice bath. Cells suspensions were distributed to labelled cryotubes, stored at -80 °C and transferred to liquid nitrogen after 48 h.
For dendritic cells (DCs) maturation, cryopreserved monocytes were quickly thawed by immersion in a 37°C water bath and washed twice with RPMI-1640 (Thermo Fisher Scientific) at 450xg for 8 min at 4 °C. After the second wash, the cells were quantified and re-suspended at a concentration of 5xl05 cells/ml in RPMI-1640. The cells were then transferred to a 24-well plate (5xl05 cells per well) and incubated for 2 h at 37°C and 5% C02 allowing the monocytes to adhere to the plastic plate. Subsequently, non-adhered cells were washed off the plate and 1 ml of Iscove's Dublecco's Modified Medium (IMDM; Thermo Fisher Scientific) supplemented with 10% FBS was added to each well, supplemented with recombinant human GM-CSF (Sanofi- Aventis, Bridgewater, NJ, USA) and IL-4 (R&D Systems, Minneapolis, MN, USA), both at 1.000 International Units (IU)/ml. The purified monocytes were cultured during 5 days for differentiation into immature DCs, which were either kept immature or matured with transformed yeasts in the proportion of 1:10. The immature DCs and the differentially polarized mature DCs obtained after seven days of culture were harvested and washed with PBS. The culture supernatants were also collected for further multiplex analysis. To determine which DC polarizing subtype was induced by yeasts, the inventor assessed the levels of the specific biomarkers by flow cytometry and multiplex. Unstimulated cells were used as a negative control. DCs were stained with monoclonal antibodies against selected surface markers: PE Mouse Anti-Human CD86 and PE Mouse Anti-Human CD83 (both from Beckam Coulter, Brea, CA, USA), APC Mouse Anti-Human CCR7 (R&D Systems, Minneapolis, MN, USA), Alexa Fluor 488 Mouse Anti-Siglecl/CD169 (BioRad, Raleigh, NC, USA), PE Mouse Anti-Human OX40L (BD Biosciences), PECy7 Mouse Anti-Human CDllc (Biolegend, San Diego, CA, USA) and FITC Mouse Anti-Human CD14 (BD Biosciences). Approximately 106 cells were washed twice with PBS at 450xg for 5 min at 4°C, transferred to 96-well round bottom plates and incubated with LIVE/DEAD Fixable Blue Dead Cell Stain kit (Thermo Fisher Scientific), diluted 1:1.000 in PBS, for 20 min on ice and protected from light. Cells were then washed twice with FACS buffer (1 M HEPES, 5% BSA, 0.1 M EDTA, lxPBS, pH 7.4) at 860xg for 5 min at 4°C and incubated for 20 min at 4°C with the fluorescently labeled antibodies diluted in FACS buffer. After two additional washes with FACS buffer, cells were fixed in FACS buffer containing 1% PFA, transferred to polypropylene tubes and analyzed by flow cytometry as described above. For multiplex assays, the inventor assessed the levels of IL-Ιβ, IL-6, IL-8, IL-10, IL-12p70, TNF-a and IFN-γ, using a V- PLEX custom human biomarkers plate (MSD, Rockville, MD, USA) according to the manufacturer's instructions, in the supernatants of the same samples submitted to flow cytometry.
Phagocytosis. The levels of transformed yeasts phagocytosis by DCs were assessed by flow cytometry. Following overnight growth in YPD supplemented with G418, transformed yeasts were washed twice in PBS and labelled with 5 μg/ml of Calcofluor White Stain (CFW), a fluorescent probe that binds to chitin present in yeast cell wall19, for 30 min at RT, with gentle agitation. Yeasts were then incubated with immature DCs, as described above, for 4 h at 37°C. The levels of phagocytosis were assessed through flow cytometry as described above. To discriminate between internalized yeasts and those bound externally to DCs, the inventor added trypan blue to the sample before analyzing it. Trypan blue acts as a CFW fluorescence quencher and is not internalized by DCs, meaning that only yeasts that have been phagocytosed will be detected19. To determine potential unspecific background, the inventor incubated yeasts with PFA killed DCs, which cannot perform phagocytosis. Results are shown in percentage and are the average of the phagocytosis levels of the DCs of the 3 healthy donors subtracted the levels of the unspecific background.
HIV-l-specific ELISpot. To assess the immunogenicity of probiotic yeasts expressing HIV Gag, the inventor determined the magnitude of Gag-specific IFN-γ responses induced by a 10-day co- culture of yeast-treated DCs and autologous T cells derived from an individual chronically infected with HIV-1. Co-cultures with untreated DCs were used as negative control. Briefly, T cells (both CD4 and CD8) isolated from PBMCs through immunomagnetic negative selection (StemCell Technologies, Cambridge, MA, USA) were co-cultured with yeast-treated or untreated DCs at a DC:T cell ratio of 1:10. The cultures were allowed to grow for 10 days, and were supplemented with recombinant IL-2 (10 lU/mL; Chiron, Emeryville, CA, USA) on days 3 and 7. The cells in culture were split as needed with IMDM 10% FBS supplemented with 10 μΜ efavirenz (EFV). EFV was obtained through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH. On day 10, the T cells were immediately evaluated for IFN-γ production. ELISpot assays for IFN-γ production detection were performed as previously described20'21 by stimulating the T cells for 18 h with a pool of overlapping 15-mers peptides (1 μg/ml) representing the HIV-1 consensus B Gag (obtained through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH). Wells with T cells only were used as negative controls. ELISpot data were calculated as the means of spots in duplicate wells minus the mean plus 2 standard deviations of spots in duplicate negative controls.
Simulated gastrointestinal stresses. To ensure that genetic engineering do not affect the ability of probiotic yeasts to survive the harsh situations found in the gastrointestinal tract, the inventor submitted the transformed yeasts to treatments which mimic those aggressive environments, as described elsewhere11'22. The viability of the yeasts was measured after 60 min in simulated intestinal, bile salts and gastric pH conditions. Briefly, yeasts were grown overnight in YPD media and cultures were diluted to a final 600 nm optical density (Οϋεοο) of 0,3 and incubated in YPD 0,5% pancreatin (Thermo Fisher Scientific) and 0,1% NaCI pH 8,0 (intestinal stress), YPD 0,1% mixture of primary and secondary bile salts (biliary stress) and in gastric juice pH 1,5 (Thermo Fisher Scientific) supplemented with 2% dextrose (gastric stress). In the case of transformed yeasts, G418 was added to the referred media to a final concentration of 100 μg/ml. After 60 min, yeasts were plated in YPD plates, supplemented with 100 μg/ml of G418 in the case of transformed yeasts, allowed to grow for 48 h and quantified. Viability was determined as the ratio between the number of colony forming units (CFU) after 60 min of submission to a particular gastrointestinal stress and the CFU originated in the same conditions but before the treatment started. Results were multiplied by 100 to present the yeast viability in percentage and are representative of 3 different experiments. Statistics. Statistical analyses were done with GraphPad Prism 5.0 software (GraphPad Software, La Jolla, CA, USA). Significant results are indicated as Student's paired, two-tailed t- test, p values obtained yielded values inferior to 0.05 (*) or to 0.01 (**).
Results
Genetically engineered probiotic Saccharomyces cerevisiae strains efficiently express HIV GAG in their surface albeit at different levels. If using microbial vectors for medical and veterinary vaccination strategies, it is believed that display of pathogenic proteins on the surface of the vector is the best approach for antigen presentation14'23. While secretion of desired antigen might lead to its unspecific degradation by proteases before it will be able to induce an immune response, cytoplasmic overproduction of foreign proteins might be toxic to the host cell thus leading to their proteolytic cleavage as well. Aiming to express the HIV Gag antigen in the surface of probiotic S. cerevisiae strains, and using the AGAlp/AGA2p system, the inventor constructed a plasmid, pJRP, carrying this viral antigen fused to AGA2p. Following transformation of the referred strains with their specific pJRP (see Material & Methods) and the empty control plasmid, pCEV, the inventor screened the colonies to determine which carried HIV gag (pJRP) and aphAl (G418 resistance gene in pCEV) genetic sequences (Fig. 1).
Once the inventor had identified positive colonies for all strains and both plasmids, the inventor then investigated if HIV Gag expression occurred in those colonies by fluorescence microscopy and flow cytometry (Fig. 2). The inventor observed that all pJRP-transformed yeasts do express HIV Gag, although at different levels (Fig. 2). I nterestingly, flow cytometric ana lysis showed a very low expression of HIV Gag in 905 strain. As observed before, 905 is a probiotic strain which has a particular growth, forming clumps, unlike the other tested yeast strains11, and the inventor assume that a ny antigen expressed in the surface of 905 will be hindered from the antibodies used to detect HIV Gag. Similarly, using fluorescence microscopy, the inventor mostly observed HIV Gag in isolated or smaller clusters of 905 and rarely in bigger clumps (data not shown). Conversely, no HIV Gag was ever detected in any of the non- or pCEV-transformed strains in both techniques (data not shown). For further assays, the inventor chose as reference probiotics Sb and Sc47, since they had the highest level of expression of HIV Gag by flow cytometry. As non-probiotic, the inventor chose 4743 which, although has a similar level of expression of this viral antigen when compared to 4741, is a diploid strain and thus, more suitable to be compared with industrial yeast strains as Sb and Sc4711.
Genetically modified 5. cerevisiae strains are avidly phagocytosed by and induce maturation of human dendritic cells in vitro. To efficiently present the carrying foreign antigens, yeasts must be efficiently phagocytosed by professional antigen presenting cells (APCs), such as DCs or macrophages24. 5. cerevisiae strains cell wall is constituted of sugar moieties such as mannan and β-1,3-D-glucan, which are recognized by APCs Toll-like receptors (TLR) as a warning sign of an occurring infection, prompting the phagocytosis of these yeasts by APCs. These cell wall components have therefore adjuvant properties, facilitating the uptake of the yeast and activating the innate immune system. When genetically engineered S. cerevisiae expressing viral or tumor antigens are up-taken by APCs the yeasts will be degraded and the antigens presented through M HC class I and class I I pathways and, consequently, leading to activation of antigen- specific CD8+ and CD4+ T cells and to enhancement of the production of costimulatory molecules (CD80, I FN-γ, I L-12, etc)5'24. It has been shown that probiotic 5. cerevisiae strains, including Sb, are also efficiently phagocytosed10'25. However, no study has shown that if genetically engineered probiotic 5. cerevisiae strains affects efficient phagocytosis by DCs. Thus, the inventor submitted both pCEV- and pJRP-transformed Sb, Sc47 and 4743 yeasts to DCs and quantified the level of phagocytosis (Fig. 3). All yeasts were avidly phagocytosed by DCs, confirming that genetic alteration of the former does not affect their uptake by APCs.
Following phagocytosis of genetically engineered yeasts by DCs, the inventor then assessed if maturation of the latter ca n be induced by the former. Flow cytometry analyses showed an upregulation of CD86, CD83 and CCR7 on the surface of DCs (Fig. 4A), indicating that these APCs went through a maturation process26'27 after being stimulated with the yeasts. The inventor also observed higher levels of Siglec-1 (Fig. 4B), a marker for a type 1 im mune response (Mailliard, personal communication). Concomitantly, the levels of OX40L (Fig. 4B), a type 2 response marker28, did not differ from those observed in yeast free DCs cultures. The levels of several cytokines secreted by DCs following stimulation with yeasts were also assessed. An increase in the concentrations of I FN-γ, I L-10, I L-12p70, I L-Ιβ, I L-6, I L-8 and TNF-a was observed in the growth medium when compa red to non-stimulated DCs (Fig. 5). The higher levels of I FN-γ, I L- 12p70, I L-Ιβ, I L-6 and TNF-a strongly corroborate that stimulation with yeasts induces polarization of DCs into a type 1 immune response29'30.
Transformed probiotic S. cerevisiae strains engineered to express HIV Gag antigen are efficiently presented by dendritic cells from an HIV+ patient to autologous T cells and induce clonal expansion of the latter. To confirm if pJ RP-transformed yeasts can induce a specific immune response against HIV Gag antigen, the inventor isolated DCs derived from an HIV+ patient and incubated them with both pCEV- and pJRP-transformed yeasts. Following maturation of DCs, they were incubated with autologous T cells, i.e., derived from the same patient, to perform HIV Gag antigen presentation to the latter. Later, T cells were stimulated with an HIV Gag peptide pool and their clonal expansion was assessed by ELISpot (Fig. 6). I nterestingly, only pJRP-transformed probiotic strains Sb and Sc47 had a significant increase, both when matched with immature DCs and when confronted with their pCEV-transformed counterparts (Fig. 6). Levels of T cell expansion induced by non-probiotic strain 4743 were non- significant (Fig. 6).
Genetically altered 5. cerevisiae strains retain their ability to resist simulated gastrointestinal tract harsh environments. Probiotic microorganisms must endure the stringent conditions found in the gastrointestinal tract such as intestinal proteases, bile salts and gastric acidic pH22. Also, different 5. cerevisiae strains possess diverse levels of resistance to those stresses11'22. To successfully deliver the antigens in the colonic mucosal tissue, genetically engineered yeasts must also survive the same harsh environments. Thus, to ensure that genetic manipulation does not affect their ability to subsist in the gastrointestinal tract, the inventor submitted the transformed yeasts to simulated intestinal, biliary and gastric conditions (Table 1).
Table 1. Levels of resistance (in %) of genetically engineered probiotic Saccharomyces cerevisiae strains to simulated gastrointestinal stresses
Figure imgf000082_0001
As expected, intestina l proteases do not impair the growth of the studied yeast strains. On the other hand, both bile salts and gastric pH decreased their levels of survival although not entirely. This indicates that genetic ma nipulation of yeasts does not interfere with their ability to resist gastrointestinal stresses. Although levels of resistance to simulated conditions of non- transformed yeasts differ from their genetically engineered counterparts (Table 1), no direct comparison may be performed between them, since only the latter were submitted to these stresses conditions in media supplemented with G418, a selective drug which also interferes with the yeast strains growth.
Discussion
Here the inventor describe the potential of genetically engineered probiotic 5. cerevisiae strains as an immunization strategy against HIV. While the potential use of non-probiotic, laboratorial strains of 5. cerevisiae as therapeutic and prophylactic agents carrying foreign bio-therapeutic molecules has been described against cancer6'24 and several pathogens, such as HIV5'6'31, hepatitis B virus (HBV)6'8, hepatitis C virus (HCV)24, hepatitis D virus (HDV)6 and tuberculosis6, only recently the possibility of using similarly a probiotic strain, 5. boulardii has been reported14'32'33. Genetic modification of diploid, industrial strains, such as S. boulardii, is harder to achieve when compared to laboratorial, haploid strains, such as 5. cerevisiae s288c and 5. cerevisiae W3039'16'34 which might explain why so far researchers have focused on haploid strains. However, some advances in genetic transformation of S. boulardii have been achieved recently, such as successful application of CRISP-Cas9 platform35. Use of industrial strains as probiotic strains has the advantage to produce higher levels of proteins, due to their lower doubling times11 and they are also better suited to endure harsh conditions34, as gastrointestinal stresses and higher growth temperatures. Also, diverse probiotic strains differ in the immune response they induce in the colon9'10'36"38, which makes them ideal vectors to manipulate the immune response towards a desired subtype, e.g., Thl vs. Th2/Treg, against a selected pathogen. Genetic modification of probiotic 5. cerevisiae strains other than 5. boulardii has not been reported. I n the present invention, the inventor has shown for the first time genetic manipulation of probiotic strains different from 5. boulardii. Using the 5. cerevisiae AGAlp/AGA2p surface display system, the inventor was able to express HIV Gag antigen anchored to the cell wall of several 5. cerevisiae strains. This system has been already used successfully in laboratorial 5. cerevisiae1 strains and in 5. boulardii14. Following successful transformation of the tested yeast strains (Fig. 1), the inventor assessed their ability to express this foreign viral antigen. All strains expressed HIV Gag in their surface (Fig. 2) although at different levels. Despite detection of HIV Gag protein in the surface of strain 905 by fluorescence microscopy, cytometric analysis indicated a very low level of expression of this protein (Fig. 2). As mentioned earlier, this could be accounted into the fact this particular strain grows in clumps unlike the remaining tested strains, which might impair either the detection of HIV Gag antigen by antibodies or the proper exposition of the viral protein on the surface of 905. The inventor has previously observed other biological phenotypical differences between strain 905 and the other strains such as resista nce to gastrointestinal stresses and levels of lipid droplets11. Thus, another possibility is that strain 905 cellular machinery differs from its counterparts and is not able to properly display foreign antigens in the surface. Of the other tested probiotic strains, Sb and Sc47 had the higher levels of expression of HIV Gag antigen while both non-probiotic strains had similar levels (Fig. 2). For further studies, the inventor selected the 2 mentioned probiotic strains while 4743 was chosen over 4741, since the former shares the same diploid genotype than the probiotic strains.
Phagocytosis is a crucial biological mechanism to mount an effective immune response. Genetically engineered microbial vectors must be prone to suffer phagocytosis by APCs so the foreign proteins expressed by such vectors can be presented to CD4+ and CD8+ T cells. To the best of our knowledge, no study has yet shown that genetic modification of probiotic 5. cerevisiae strains affects in some way their phagocytosis by APCs. Others have shown that genetically engineered laboratorial 5. cerevisiae strains or unmodified probiotic 5. cerevisiae strains are avidly phagocytosed by APCs5'10'25, and the inventor observed the same phenotype with pCEV- and pJRP-transformed yeasts (Fig. 3). This strengthens the assumption that genetically altered probiotic 5. cerevisiae strains can efficiently deliver antigens to APCs. The inventor also evaluated that these yeasts, following phagocytosis, induced the expression of DCs surface maturation markers26'27, as CD86, CD83 and CCR7 (Fig. 4A). Of the tested strains, only Sb transformed yeasts with both plasmids showed a significant increase for all 3 maturation markers when matched with DCs alone (Fig. 4A). On the other hand, CCR7 was upregulated following DCs contact with all 3 yeast strains transformed either with pCEV or pJRP (Fig. 4A). Thus, the present results indicate that incubation with the tested pCEV- and pJRP-transformed strains is able to stimulate maturation of DCs. When expression of either Siglec-1 or OX40L, biomarkers which indicate a type 1 or type 228 immune response respectively, was assessed, the present results showed a higher level of the former compared to the non-stimulated control (Fig. 4B). I n agreement, levels of OX40L remain at basal levels for all tested transformed yeasts (Fig. 4B), suggesting that incubation with these strains induce a type 1 response. Siglec-1 was increased in all tested strains, the increase observed for Siglec-1 is statistically significant for Sb tra nsformed with both plasmids (Fig. 4B). Quantification of the levels of cytokines secreted by mature DCs indicate increases in the medium concentrations of I FN-γ, IL-10, I L-12p70, I L-Ιβ, IL- 6, I L-8 and TN F-a for all yeasts (Fig. 5), although not differing significantly of those observed in non-stimulated yeasts. As mentioned above, the increase of I FN-γ, IL-12p70, I L-Ιβ, IL-6 and TNF- a levels also suggests a type 1 biased immune response.
The above-mentioned results indicated that all yeasts, regardless of the plasmid they carry, can induce an immune response, most probably due to the adjuvant sugar moieties they possess in their cell wall. Although this adjuvant potential is desired in a vaccine preparation, the inventor had to confirm if only pJRP-transformed yeasts could indeed induce a specific immune response against HIV Gag antigen. Using DCs and T cells derived from an HIV+ patient, the inventor showed that only pJRP-containing probiotic strains Sb and Sc47 were indeed efficiently degraded by DCs a nd H IV Gag peptides presented to T cells (Fig. 6). This presentation led to a specific clonal expansion of a T cell immune response against HIV Gag, when these cells were pulsed to a HIV Gag peptide pool. Thus, DCs which phagocytosed pJRP-transformed yeasts specifically activated T cells against this particular antigen.
Since immature, yeast-free DCs from the same patient were not able to induce the same phenotype, the inventor believes that the T cell activation observed was due to previous DCs maturation with the pJRP-transformed yeasts. Similarly, pCEV-transformed yeasts were unable to induce T cell activation (Fig. 6), strengthening the immunization potential of their pJRP- transformed counterparts. I nterestingly, pJRP-transformed non-probiotic 4743 strain did not induce a specific T cell response against HIV Gag, suggesting that this strain is lesser capable of the probiotic strains used in terms of immunization potential. Note that all T cells were accounted in this experiment, whether they were CD4, CD8, effector or memory cells.
An important feature that probiotic microorganisms must possess so they ca n efficiently employ their beneficial effects in the colon is the resistance to the harsh environments of the gastrointestinal tract. The inventor has previously shown that different probiotic strains submitted to biliary and gastric milieus exhibit different survival profiles, although none of them is completely abrogated by either stress11. Conversely, intestinal simulated conditions do not impact negatively the growth of S. cerevisiae strains9'11'22'39. Genetically engineered 5. boulardii strains have been administered to mice and later detected in their colon40'41 or submitted to simulated gastrointestinal aggressive milieus40'42 and successfully survived both in vivo and in vitro. Thus, although the inventor assumes that the transformed probiotic yeasts developed during this work will also be able to sustain the referred stresses, the inventor sought to confirm it, by submitting them to media simulating intestinal, gastric and biliary conditions and assessing their survival. While intestinal proteases did not impair the growth of both pCEV- and pJRP- transformed yeasts (Table 1), on the other hand, both bile salts and gastric juice pa rtially affected their via bility (Table 1). Thus, genetic modification of Sb, Sc47 and 4743 do not annul their ability to survive the harsh environments of the gastrointestinal stresses, suggesting they will be still be viable when they reach the colon and of expressing foreign antigens to induce a desired mucosal immune response. Also, although survival profiles differ between non- transformed and genetically altered strains (Table 1), it is noteworthy to mention that simulated gastrointestinal stresses media of the latter contained the selective drug G418. This drug obviously affects yeast growth as only pCEV- or pJ RP-transformed strains would survive in media where G418 is present. It has been shown in mammalian cell lines that G418 induces a metabolic load43 and the same was suggested to happen in 5. cerevisiae strains genetically engineered to be resistant to this drug12. So, transformed yeasts would also suffer from the extra metabolic burden of foreign proteins production such as HIV Gag and APT 3' I I, which non-transformed yeasts in antibiotic free media are not subjected to. Thus, a comparison in viability following submission to gastrointestinal stresses between non-transformed and genetically engineered strains is not possible due to the imposed diversity of growth conditions between them.
I n conclusion, the inventor efficiently genetically engineered 6 different 5. cerevisiae strains to express the HIV Gag antigen in their surface (Fig. 1). Of those 6 strains, 2 probiotic (Sb and Sc47) and a non-probiotic (4743) were chosen for further studies, due to the higher levels of HIV Gag observed (Fig. 2). The present results showed that, regardless of transformed with either an empty plasmid (pCEV) or with HIV Gag-encoding plasmid (pJRP), the yeasts were eagerly phagocytosed by human DCs (Fig. 3) and were able to induce maturation of these immune cells (Fig. 4A). Following uptake of genetically modified yeasts, DCs seem to polarize in a type 1 immune response, as assessed by increase in Siglec-1 levels and manutention of OX40L levels (Fig. 4B) and increase in IFN-γ, I L-12p70, I L-Ιβ, I L-6 and TNF-a medium concentrations (Fig. 5). Only pJRP-transformed probiotic strains were able to induce a specific T cell immune response against HIV Gag in vitro, using DCs and T cells derived from an HIV+ patient (Fig. 6). Also, genetic modification of these yeast strains does not impair their resistance to simulated gastrointestinal harsh environments such as intestinal proteases, bile salts a nd acidic gastric pH (Table 1). The present results support the potential of genetically engineered probiotic 5. cerevisiae strains as a novel vaccination vector.
References
1. World Health Organization. HIV/AIDS Fact Sheet. (2016). Available at:
http://www.who.int/mediacentre/factsheets/fs360/en/. (Accessed: 11th October 2016)
2. Freed, E. 0. HIV-1 assembly, release and maturation. Nat Rev Microbiol 13, 484-496 (2015).
3. Shen, L. & Siliciano, R. F. Viral reservoirs, residual viremia, and the potential of highly active antiretroviral therapy to eradicate HIV infection. J Allergy Clin Immunol 122, 22- 28 (2008).
4. Stephenson, K. E., D'Couto, H. T. & Barouch, D. H. New concepts in HIV-1 vaccine
development. Curr Opin Immunol 41, 39-46 (2016).
5. Stubbs, A. C. et al. Whole recombinant yeast vaccine activates dendritic cells and elicits protective cell-mediated immunity. Nat Med 7, 625-9 (2001).
6. Globeimmune. Tarmogen Platform. Available at:
https://www.globeimmune.com/platform/technology/. (Accessed: 11th May 2016)
7. Holmgren, J. & Czerkinsky, C. Mucosal immunity and vaccines. Nat Med 11, S45-53
(2005).
8. Schreuder, M. P., Deen, C, Boersma, W. J., Pouwels, P. H. & Klis, F. M. Yeast expressing hepatitis B virus surface antigen determinants on its surface: implications for a possible oral vaccine. Vaccine 14, 383-8 (1996).
9. Palma, M. L. et al. Probiotic Saccharomyces cerevisiae strains as biotherapeutic tools: is there room for improvement? Appl Microbiol Biotechnol 99, 6563-70 (2015).
10. Kourelis, a et al. Immunostimulatory activity of potential probiotic yeast strains in the dorsal air pouch system and the gut mucosa. J Appl Microbiol 109, 260-71 (2010).
11. Zamith-Miranda, D. et al. Lipid droplet levels vary heterogeneously in response to
simulated gastrointestinal stresses in different probiotic Saccharomyces cerevisiae strains. J Funct Foods 21, 193-200 (2016).
12. Vickers, C. E., Bydder, S. F., Zhou, Y. & Nielsen, L. K. Dual gene expression cassette
vectors with antibiotic selection markers for engineering in Saccharomyces cerevisiae.
Microb Cell Fact 12, 96 (2013).
13. Hamilton, R., Watanabe, C. K. & de Boer, H. A. Compilation and comparison of the
sequence context around the AUG startcodons in Saccharomyces cerevisiae mRNAs. Nucl Acids Res 15, 3581-3593 (1987).
14. Wang, T. et al. The establishment of Saccharomyces boulardii surface display system using a single expression vector. Fungal Genet Biol 64, 1-10 (2014).
15. Boder, E. T. & Wittrup, K. D. Yeast surface display for screening combinatorial
polypeptide libraries. Nat Biotechnol 15, 553-557 (1997).
16. Douradinha, B. et al. Novel insights in genetic transformation of the probiotic yeast Saccharomyces boulardii. Bioengineered 5, 1-9 (2014).
17. Detels, R. et al. The multicenter AIDS Cohort Study, 1983 to .... Public Health 126, 196- 198 (2012).
18. Kaslow, R. et al. The Multicenter AIDS Cohort Study: rationale, organization, and
selected characteristics of the participants. Am J Epidemiol 126, 310-8 (1987).
19. Dementhon, K., El-Kirat-Chatel, S. & Noel, T. Development of an in vitro model for the Multi-Parametric quantification of the cellular interactions between Candida yeasts and phagocytes. PLoS One 7, (2012). 20. Huang, X.-L, Fan, Z., Borowski, L. & Rinaldo, C. R. Maturation of dendritic cells for enhanced activation of anti-HIV-1 CD8+ T cell immunity. J Leukoc Biol 83, 1530-1540 (2008).
21. Colleton, B. A. et al. Primary human immunodeficiency virus type 1-specific CD8+ T-cell responses induced by myeloid dendritic cells. J Virol 83, 6288-6299 (2009).
22. Fietto, J. L. R. et al. Molecular and physiological comparisons between Saccharomyces cerevisiae and Saccharomyces boulardii. Can J Microbiol 621, 615-621 (2004).
23. Wyszyhska, A., Kobierecka, P., Bardowski, J. & Jagusztyn-Krynicka, E. K. Lactic acid
bacteria - 20 years exploring their potential as live vectors for mucosal vaccination. Appl Microbiol Biotechnol 99, 2967-2977 (2015).
24. Ardiani, A., Higgins, J. P. & Hodge, J. W. Vaccines based on whole recombinant
Saccharomyces cerevisiae cells. FEMS Yeast Res 10, 1060-9 (2010).
25. Braga, J. M., Oliveira, R. R., de Castro Martins, R., Vieira, L. Q. & Sobrinho, A. P. R.
Assessment of the cytotoxicity of a mineral trioxide aggregate-based sealer with respect to macrophage activity. Dent. Traumatol 31, 390-395 (2015).
26. Cereda, V. et al. Maturation of human dendritic cells with Saccharomyces cerevisiae (yeast) reduces the number and function of regulatory T cells and enhances the ratio of antigen-specific effectors to regulatory T cells. Vaccine 29, 4992-4999 (2011).
27. Berk, E., Muthuswamy, R. & Kalinski, P. Lymphocyte-Polarized Dendritic Cells Are Highly Effective in Inducing Tumor-Specific CTLs. Vaccine 30, 6216-6224 (2012).
28. Ito, T. et al. Plasmacytoid Dendritic Cells Regulate Th Cell Responses through OX40
Ligand and Type I IFNs. J Immunol 172, 4253-4259 (2004).
29. Motta, J. M. & Rumjanek, V. M. Sensitivity of dendritic cells to microenvironment
signals. J Immunol Res (2016). doi:10.1155/2016/4753607
30. Kim, H. J., Kim, H.-O., Lee, K., Baek, E. J. & Kim, H.-S. Two-step maturation of immature DCs with proinflammatory cytokine cocktail and poly(l :C) enhances migratory and T cell stimulatory capacity. Vaccine 28, 2877-2886 (2010).
31. Sakuragi, S., Goto, T., Sano, K. & Morikawa, Y. HIV type 1 Gag virus-like particle budding from spheroplasts of Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 99, 7956-61 (2002).
32. Michael, S. et al. Quantitative Phenotyping of Inflammatory Bowel Disease in the IL-10- deficient Mouse by Use of Noninvasive Magnetic Resonance Imaging. Inflamm Bowel Dis 19, 185-93 (2013).
33. Pohlmann, C. et al. Use of engineered intestinal microorganisms as in situ cytokine
delivery system. Bioengineered 4, 1-8 (2013).
34. Latorre-Garcia, L., Adam, A. C. & Polaina, J. Overexpression of the glucoamylase- encoding STA1 gene of Saccharomyces cerevisiae var. diastaticus in laboratory and industrial strains of Saccharomyces. World J Microbiol Biotechnol 24, 2957-2963 (2008).
35. Liu, J. et al. Metabolic Engineering of Probiotic Saccharomyces boulardii. Appl Env.
Microbiol 82, 2280-2287 (2016).
36. Martins, F. S. et al. Saccharomyces cerevisiae strain 905 reduces the translocation of Salmonella enterica serotype Typhimurium and stimulates the immune system in gnotobiotic and conventional mice. J Med Microbiol 56, 352-9 (2007).
37. Generoso, S. V et al. Saccharomyces cerevisiae strain UFMG 905 protects against
bacterial translocation, preserves gut barrier integrity and stimulates the immune system in a murine intestinal obstruction model. Arch Microbiol 192, 477-84 (2010).
38. Sivignon, A. et al. Saccharomyces cerevisiae CNCM 1-3856 Prevents Colitis Induced by AIEC Bacteria in the Transgenic Mouse Model Mimicking Crohn's Disease. Inflamm Bowel Dis 21, 276-286 (2015).
Martins, F. D. S. et al. Estudo do potencial probiotico de linhagens de Saccharomyces cerevisiae atraves de testes in vitro. Rev Biol Cienc Ter 5, (2005).
Hudson, L. E. et al. Functional Heterologous Protein Expression by Genetically
Engineered Probiotic Yeast Saccharomyces boulardii. PLoS One 9, ell2660 (2014). Edwards-Ingram, L. et al. Genotypic and physiological characterization of
Saccharomyces boulardii, the probiotic strain of Saccharomyces cerevisiae. Appl Env. Microbiol 73, 2458-67 (2007).
Hamedi, H. et al. Generation of a Uracil Auxotroph Strain of the Probiotic Yeast Saccharomyces boulardii as a Host for the Recombinant Protein Production. Avicenna J Med Biotechnol 5, 29-34 (2013).
Yallop, C. A. & Svendsen, I. The effects of G418 on the growth and metabolism of recombinant mammalian cell lines. Cytotechnol 35, 101-114 (2001).
Reis, V. C. B. et al. Genetic characterization and construction of an auxotrophic strain of Saccharomyces cerevisiae JP1, a Brazilian industrial yeast strain for bioethanol production. J Ind Microbiol Biotechnol 39, 1673-83 (2012).

Claims

Claims
1. An immunotherapeutic composition comprising:
a) a probiotic yeast vehicle; and
b) a fusion protein or a protein wherein said fusion protein or said protein comprises at least one HIV antigen, and
wherein the probiotic yeast is selected from 5. cerevisiae Sc47 or 5. boulardii 17.
2. The immunotherapeutic composition of Claim 1, wherein the at least one HIV antigen comprises or consists of an amino acid sequence that is at least 80% identical to an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO:l (GAG optimized sequence) or a corresponding amino acid sequence from a different HIV strain.
3. The immunotherapeutic composition of Claim 1, wherein the HIV antigen comprises or consists of an amino acid sequence that is at least 90% identical to an amino acid sequence encoded by a nucleotide sequence of SEQ. ID NO:l or a corresponding amino acid sequence from a different HIV strain.
4. The immunotherapeutic composition of Claim 1, wherein the HIV antigen consists of the amino acid sequence encoded by the nucleotide of SEQ. ID NO:l.
5. The immunotherapeutic composition of Claim 1, wherein the fusion protein comprises an amino acid sequence of SEQ ID NO:9.
6. The immunotherapeutic composition of any one of Claims 1 to 5, wherein the HIV antigen is expressed by the yeast vehicle.
7. The immunotherapeutic composition of any one of Claims 1 to 6, wherein the yeast vehicle is a whole yeast.
8. An immunotherapeutic composition comprising:
a) a whole, inactivated probiotic yeast; and b) an HIV fusion protein or protein wherein said HIV fusion protein or said protein comprises the amino acid sequence of SEQ ID NO:l, wherein the fusion protein or protein is under the control of the TEFl and/or PGKl promoter; wherein the HIV fusion protein or protein is expressed by the yeast; wherein the composition elicits an HIV-specific T cell response and wherein the yeast is 5. cerevisiae Sc47 or 5. boulardii 17.
9. The immunotherapeutic composition of Claim 8, wherein the fusion protein comprises the amino acid sequence of SEQ. ID NO:9.
10. The immunotherapeutic composition of any one of Claims 1 to 9, further comprising a dendritic cell, wherein the dendritic cell has been loaded with the yeast.
11. The immunotherapeutic composition of any one of Claims 1 to 10, further comprising one or more adjuvant(s) and/or one or more additional compounds or compositions useful for treating or ameliorating a symptom of HIV infection.
12. The immunotherapeutic composition of Claim 11, wherein the compound is an anti-viral compound.
13. The immunotherapeutic composition of Claim 12, wherein the anti-viral compound is a fixed-dose combination (FDC) drug.
14. The immunotherapeutic composition of Claim 11, wherein the additional composition is a DNA vaccine encoding at least one HIV antigen, preferably the additional composition is a processed yeast, preferably the processed yeast was genetically modified to express at least one HIV antigen, still preferably the processed yeast is administered with at least one HIV antigen.
15. The immunotherapeutic composition of Claim 11, wherein the additional composition comprises autologous T cells from the subject, wherein the autologous T cells have been stimulated ex vivo with at least one HIV antigen.
16. The immunotherapeutic composition of Claim 11, wherein the additional composition comprises a protein subunit vaccine comprising at least one HIV antigen.
17. The immunotherapeutic composition of any one of Claims 14-16 , wherein the HIV antigen is the same as the HIV antigen in the composition of any one of Claims 1 to 10.
18. The immunotherapeutic composition of Claim 11, wherein the additional compound comprises a biological response modifier.
19. The immunotherapeutic composition of any one of Claims 11 to 18, wherein the additional compound or composition is administered prior, subsequently or concurrently to administration of the immunotherapeutic composition.
20. The immunotherapeutic composition of any one of Claims 1 to 19, wherein the composition is formulated in a pharmaceutically acceptable excipient suitable for administration to a subject by injection.
21. The immunotherapeutic composition according to any one of Claim 1 to 20 for use in the treatment of human immunodeficiency virus (HIV) infection or in the treatment of at least one symptom resulting from HIV infection.
22. A process for preparing the immunogenic composition according to any one of Claim 1 to 20, comprising the steps of:
(a) preparing a HIV component by expression in a S. cerevisiae SC47 or 5. boulardii 17 host carrying a plasmid having a HIV antigen coding sequence, wherein the plasmid includes: (1) An
Sc promoter sequence (such as TEFl or PGKl) and optionally a AGAl and/or a AGA2 sequence upstream of the HIV coding sequence; and (2) An Sc terminator of transcription sequence downstream of the HIV coding sequence;
b) preparing at least one non-HIV component; and
c) mixing the HIV and non-HIV components to give the immunogenic composition.
23. The process according to Claim 22, comprising purifying the HIV antigen after expression in a S. cerevisiae SC47 or S. boulardii 17 host.
PCT/EP2017/079557 2016-11-17 2017-11-17 Probiotic yeasts as novel vaccination vectors Ceased WO2018091637A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
IT102016000116554A IT201600116554A1 (en) 2016-11-17 2016-11-17 Probiotic yeasts as novel vaccination vectors
IT102016000116554 2016-11-17

Publications (1)

Publication Number Publication Date
WO2018091637A1 true WO2018091637A1 (en) 2018-05-24

Family

ID=58609729

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2017/079557 Ceased WO2018091637A1 (en) 2016-11-17 2017-11-17 Probiotic yeasts as novel vaccination vectors

Country Status (2)

Country Link
IT (1) IT201600116554A1 (en)
WO (1) WO2018091637A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114269374A (en) * 2019-05-21 2022-04-01 艾斯佩罗疫苗公司 Yeast-based oral vaccination

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0518443A1 (en) * 1984-10-31 1992-12-16 Chiron Corporation Recombinant proteins of viruses associated with lymphadenopathy syndrome and/or acquired immune deficiency syndrome
WO2001092470A2 (en) * 2000-03-02 2001-12-06 Emory University Dna expression vectors and methods of use
US20040156858A1 (en) 2002-12-16 2004-08-12 Alex Franzusoff Yeast-based vaccines as immunotherapy

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0518443A1 (en) * 1984-10-31 1992-12-16 Chiron Corporation Recombinant proteins of viruses associated with lymphadenopathy syndrome and/or acquired immune deficiency syndrome
WO2001092470A2 (en) * 2000-03-02 2001-12-06 Emory University Dna expression vectors and methods of use
US20040156858A1 (en) 2002-12-16 2004-08-12 Alex Franzusoff Yeast-based vaccines as immunotherapy

Non-Patent Citations (82)

* Cited by examiner, † Cited by third party
Title
"Globeimmune", TARMOGEN PLATFORM, 11 May 2016 (2016-05-11), Retrieved from the Internet <URL:https://www.globeimmune.com/platform/technology>
"Methods of Enzymology", vol. 194, 1990, COLD SPRING HARBOR PUBLISHING
"World Health Organization", HIV/AIDS FACT SHEET, 11 October 2016 (2016-10-11), Retrieved from the Internet <URL:http://www.who.int/mediacentre/factsheets/fs360/en>
ALTSCHUL, S.F.; MADDEN, T.L.; SCHAAFFER, A.A.; ZHANG, J.; ZHANG, Z.; MILLER, W.; LIPMAN, D.J.: "Gapped BLAST and PSI- BLAST: a new generation of protein database search programs", NUCLEIC ACIDS RES., vol. 25, 1997, pages 3389 - 3402, XP002905950, DOI: doi:10.1093/nar/25.17.3389
ARDIANI, A.; HIGGINS, J. P; HODGE, J. W.: "Vaccines based on whole recombinant Saccharomyces cerevisiae cells", FEMS YEAST RES, vol. 10, 2010, pages 1060 - 9
BEAUCAGE ET AL.: "Current Protocols in Nucleic Acid Chemistry", 2000, JOHN WILEY & SONS, INC.
BERK, E.; MUTHUSWAMY, R.; KALINSKI, P.: "Lymphocyte-Polarized Dendritic Cells Are Highly Effective in Inducing Tumor-Specific CTLs", VACCINE, vol. 30, 2012, pages 6216 - 6224
BODER, E. T.; WITTRUP, K. D.: "Yeast surface display for screening combinatorial polypeptide libraries", NAT BIOTECHNOL, vol. 15, 1997, pages 553 - 557, XP002945515, DOI: doi:10.1038/nbt0697-553
BRAGA, J. M.; OLIVEIRA, R. R.; DE CASTRO MARTINS, R.; VIEIRA, L. Q.; SOBRINHO, A. P. R.: "Assessment of the cytotoxicity of a mineral trioxide aggregate-based sealer with respect to macrophage activity", DENT. TRAUMATOL, vol. 31, 2015, pages 390 - 395
BROACH ET AL: "The Yeast Saccharomyces: Genome Dynamics, Protein Synthesis, and Energetics", 1992, COLD SPRING HARBOR LABORATORY PRESS
BUSSEY ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 553, 1979, pages 185 - 196
CASARETT; DOULL'S: "Toxicology The Basic Science of Poisons, 6th ed,", 2001
CATANZARO, J INFECT DIS, vol. 194, 2006, pages 1638 - 1649
CAUX ET AL., J EXP MED, vol. 184, 1996, pages 695 - 706
CEREDA, V. ET AL.: "Maturation of human dendritic cells with Saccharomyces cerevisiae (yeast) reduces the number and function of regulatory T cells and enhances the ratio of antigen-specific effectors to regulatory T cells", VACCINE, vol. 29, 2011, pages 4992 - 4999
COLLETON, B. A. ET AL.: "Primary human immunodeficiency virus type 1-specific CD8+ T-cell responses induced by myeloid dendritic cells", J VIROL, vol. 83, 2009, pages 6288 - 6299
COON, NATL. CANCER INST. MONOGR., vol. 48, 1978, pages 45 - 55
DEMENTHON, K.; EL-KIRAT-CHATEL, S.; NOEL, T.: "Development of an in vitro model for the Multi-Parametric quantification of the cellular interactions between Candida yeasts and phagocytes", PLOS ONE, vol. 7, 2012
DETELS, R. ET AL.: "The multicenter AIDS Cohort Study", PUBLIC HEALTH, vol. 126, 1983, pages 196 - 198
DOURADINHA, B. ET AL.: "Novel insights in genetic transformation of the probiotic yeast Saccharomyces boulardii", BIOENGINEERED, vol. 5, 2014, pages 1 - 9
DWIVEDI ET AL., RES. J. BIOLOGICAL SCI., vol. 1, no. 7, 2012, pages 52 - 54
EDWARDS-INGRAM, L. ET AL.: "Genotypic and physiological characterization of Saccharomyces boulardii, the probiotic strain of Saccharomyces cerevisiae", APPL ENV. MICROBIOL, vol. 73, 2007, pages 2458 - 67, XP002484204, DOI: doi:10.1128/AEM.02201-06
F.M. AUSUBEL ET AL: "Current Protocols in Molecular Biology", 1987
FIETTO, J. L. R. ET AL.: "Molecular and physiological comparisons between Saccharomyces cerevisiae and Saccharomyces boulardii", CAN J MICROBIOL, vol. 621, 2004, pages 615 - 621
FRANZUSOFF ET AL., METH. ENZYMOL., vol. 194, 1991, pages 662 - 674
FRANZUSOFF, J. BIOL. CHEM., vol. 258, 1983, pages 3608 - 3614
FRANZUSOFF, METH. ENZYMOL., vol. 194, 1991, pages 662 - 674
FREED, E. 0.: "HIV-1 assembly, release and maturation", NAT REV MICROBIOL, vol. 13, 2015, pages 484 - 496
GENEROSO, S. V ET AL.: "Saccharomyces cerevisiae strain UFMG 905 protects against bacterial translocation, preserves gut barrier integrity and stimulates the immune system in a murine intestinal obstruction model", ARCH MICROBIOL, vol. 192, 2010, pages 477 - 84, XP019838537
GUTHRIE ET AL.: "Methods in Enzymology", vol. 194, 1991, ACADEMIC PRESS
GUTHRIE ET AL: "Methods of Enzymology", vol. 194, 1990, COLD SPRING HARBOR LABORATORY PRESS
H ZHANG ET AL.: "Antibodies elicited by yeast glycoproteins recognize HIV-1 virions and potently neutralize virions with high mannose N-glycans", VACCINE, vol. 39, no. 33, 13 August 2015 (2015-08-13), ELSEVIER, pages 5140 - 5147, XP029272457, ISSN: 0264-410X *
HAMEDI, H. ET AL.: "Generation of a Uracil Auxotroph Strain of the Probiotic Yeast Saccharomyces boulardii as a Host for the Recombinant Protein Production", AVICENNA J MED BIOTECHNOL, vol. 5, 2013, pages 29 - 34
HAMILTON, R.; WATANABE, C. K.; DE BOER, H. A.: "Compilation and comparison of the sequence context around the AUG startcodons in Saccharomyces cerevisiae mRNAs", NUCL ACIDS RES, vol. 15, 1987, pages 3581 - 3593
HARLOW; LANE: "Antibodies, A Laboratory Manual", 1988, COLD SPRING HARBOR PUBLICATIONS
HARLOW; LANE: "Using Antibodies: A Laboratory Manual", 1999, COLD SPRING HARBOR LABORATORY PRESS
HOLMGREN, J.; CZERKINSKY, C.: "Mucosal immunity and vaccines", NAT MED, vol. 11, 2005, pages 45 - 53
HUANG, X.-L.; FAN, Z.; BOROWSKI, L.; RINALDO, C. R.: "Maturation of dendritic cells for enhanced activation of anti-HIV-1 CD8+ T cell immunity", J LEUKOC BIOL, vol. 83, 2008, pages 1530 - 1540, XP002595702, DOI: doi:10.1189/JLB.1107795
HUDSON, L. E. ET AL.: "Functional Heterologous Protein Expression by Genetically Engineered Probiotic Yeast Saccharomyces boulardii", PLOS ONE, vol. 9, 2014, pages e112660
ITO, T. ET AL.: "Plasmacytoid Dendritic Cells Regulate Th Cell Responses through OX40 Ligand and Type I IFNs", J IMMUNOL, vol. 172, 2004, pages 4253 - 4259
JONES ET AL,: "The Yeast Saccharomyces: Gene Expression", 1993, COLD SPRING HARBOR LABORATORY PRESS
KASLOW, R. ET AL.: "The Multicenter AIDS Cohort Study: rationale, organization, and selected characteristics of the participants", AM J EPIDEMIOL, vol. 126, 1987, pages 310 - 8
KIERTSCHER, J LEUKOC BIOL, vol. 59, 1996, pages 208 - 18
KIM, H. J.; KIM, H.-O.; LEE, K.; BAEK, E. J.; KIM, H.-S.: "Two-step maturation of immature DCs with proinflammatory cytokine cocktail and poly(I:C) enhances migratory and T cell stimulatory capacity", VACCINE, vol. 28, 2010, pages 2877 - 2886
KING, STEVEN R.: "HIV: Virology and Mechanisms of disease", ANNALS OF EMERGENCY MEDICINE, vol. 24, 1994, pages 443 - 449, XP029121834, DOI: doi:10.1016/S0196-0644(94)70181-4
KOURELIS, A ET AL.: "Immunostimulatory activity of potential probiotic yeast strains in the dorsal air pouch system and the gut mucosa", J APPL MICROBIOL, vol. 109, 2010, pages 260 - 71
L H NAGY ET AL.: "Chronic HIV infection enhances the responsiveness of antigen presenting cells to commensal Lactobacillus", PLOS ONE, vol. 8, no. 8, E72789, August 2013 (2013-08-01), Public Library of Science, pages 1 - 12, XP002772797, ISSN: 1932-6203 *
LATORRE-GARCIA, L.; ADAM, A. C.; POLAINA, J.: "Overexpression of the glucoamylase-encoding STA1 gene of Saccharomyces cerevisiae var. diastaticus in laboratory and industrial strains of Saccharomyces", WORLD J MICROBIOL BIOTECHNOL, vol. 24, 2008, pages 2957 - 2963, XP019650407, DOI: doi:10.1007/s11274-008-9837-9
LIU, J. ET AL.: "Metabolic Engineering of Probiotic Saccharomyces boulardii", APPL ENV. MICROBIOL, vol. 82, 2016, pages 2280 - 2287
MARTINS, F. D. S. ET AL.: "Estudo do potencial probiotico de linhagens de Saccharomyces cerevisiae atraves de testes in vitro", REV BIOL CIENC TER, vol. 5, 2005
MARTINS, F. S. ET AL.: "Saccharomyces cerevisiae strain 905 reduces the translocation of Salmonella enterica serotype Typhimurium and stimulates the immune system in gnotobiotic and conventional mice", J MED MICROBIOL, vol. 56, 2007, pages 352 - 9
MICHAEL, S. ET AL.: "Quantitative Phenotyping of Inflammatory Bowel Disease in the IL-10-deficient Mouse by Use of Noninvasive Magnetic Resonance Imaging", INFLAMM BOWEL DIS, vol. 19, 2013, pages 185 - 93
MOTTA, J. M.; RUMJANEK, V. M.: "Sensitivity of dendritic cells to microenvironment signals", J IMMUNOL RES, 2016
MULLIS ET AL: "PCR: The Polymerase Chain Reaction", 1994
MUSHAHWAR: "Human Immunodeficiency Viruses: Molecular Virology, pathogenesis, diagnosis and treatment", PERSPECTIVES IN MEDICAL VIROLOGY, vol. 13, 2007, pages 75 - 87
PALMA, M. L. ET AL.: "Probiotic Saccharomyces cerevisiae strains as biotherapeutic tools: is there room for improvement?", APPL MICROBIOL BIOTECHNOL, vol. 99, 2015, pages 6563 - 70
POHLMANN, C. ET AL.: "Use of engineered intestinal microorganisms as in situ cytokine delivery system", BIOENGINEERED, vol. 4, 2013, pages 1 - 8
PRINGLE ET AL: "The Yeast Saccharomyces: Cell Cycle and Cell Biology", 1997, COLD SPRING HARBOR LABORATORY PRESS
REIS, V. C. B. ET AL.: "Genetic characterization and construction of an auxotrophic strain of Saccharomyces cerevisiae JP1, a Brazilian industrial yeast strain for bioethanol production", J IND MICROBIOL BIOTECHNOL, vol. 39, 2012, pages 1673 - 83, XP055117921, DOI: doi:10.1007/s10295-012-1170-5
ROMANI, J EXP MED, vol. 180, 1994, pages 83 - 93
ROSE: "Methods in yeast genetics : a laboratory course manual", 1990, COLD SPRING HARBOR LABORATORY PRESS
S. PLOTKIN AND W. ORENSTEIN: "Vaccines, 3rd ed.", 1999
SAKURAGI, S.; GOTO, T.; SANO, K.; MORIKAWA, Y.: "HIV type 1 Gag virus-like particle budding from spheroplasts of Saccharomyces cerevisiae", PROC NATL ACAD SCI, vol. 99, 2002, pages 7956 - 61
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual, 2nd ed.", 1989
SAMBROOK; RUSSEL: "Molecular Cloning: A Laboratory Manual, 3rd ed", 2001
SCHREUDER, M. P.; DEEN, C.; BOERSMA, W. J.; POUWELS, P. H.; KLIS, F. M.: "Yeast expressing hepatitis B virus surface antigen determinants on its surface: implications for a possible oral vaccine", VACCINE, vol. 14, 1996, pages 383 - 8, XP004057292, DOI: doi:10.1016/0264-410X(95)00206-G
SHEN, L.; SILICIANO, R. F.: "Viral reservoirs, residual viremia, and the potential of highly active antiretroviral therapy to eradicate HIV infection", J ALLERGY CLIN IMMUNOL, vol. 122, 2008, pages 22 - 28, XP022831378, DOI: doi:10.1016/j.jaci.2008.05.033
SIDNEY; SOUTHWOOD ET AL., HUMAN IMMUNOLOGY, vol. 62, 2001, pages 1200 - 1216
SIVIGNON, A. ET AL.: "Saccharomyces cerevisiae CNCM 1-3856 Prevents Colitis Induced by AIEC Bacteria in the Transgenic Mouse Model Mimicking Crohn's Disease", INFLAMM BOWEL DIS, vol. 21, 2015, pages 276 - 286
SKINNER, ET AL: "Biology and activities of yeasts", 1980, ACADEMIC PRESS
STEPHENSON, K. E.; D'COUTO, H. T.; BAROUCH, D. H.: "New concepts in HIV-1 vaccine development", CURR OPIN IMMUNOL, vol. 41, 2016, pages 39 - 46, XP029688143, DOI: doi:10.1016/j.coi.2016.05.011
STRIBLING, PROC. NATL. ACAD. SCI., vol. 189, 1992, pages 11277 - 11281
STUBBS, A. C. ET AL.: "Whole recombinant yeast vaccine activates dendritic cells and elicits protective cell-mediated immunity", NAT MED, vol. 7, 2001, pages 625 - 9, XP008073223, DOI: doi:10.1038/87974
TATUSOVA; MADDEN: "Blast 2 sequences - a new tool for comparing protein and nucleotide sequences", FEMS MICROBIOL LETT., vol. 174, 1999, pages 247 - 250
V CHAMCHA ET AL.: "Oral immunization with a recombinant Lactococcus lactis - expressing HIV-1 antigen on group A streptococcus pilus induces strong mucosal immunity in the gut", THE JOURNAL OF IMMUNOLOGY, vol. 195, 19 October 2015 (2015-10-19), The American Association of Immunologists, pages 5025 - 5034, XP021116244, ISSN: 0022-1767 *
VICKERS, C. E.; BYDDER, S. F.; ZHOU, Y.; NIELSEN, L. K.: "Dual gene expression cassette vectors with antibiotic selection markers for engineering in Saccharomyces cerevisiae", MICROB CELL FACT, vol. 12, 2013, pages 96, XP021166195, DOI: doi:10.1186/1475-2859-12-96
VOTTELER; SCHUBERT: "Encyclopedia of Virology, 3rd ed.", 2008, article "Human Immunodeficiency Viruses: Molecular Biology", pages: 517 - 525
WANG, T. ET AL.: "The establishment of Saccharomyces boulardii surface display system using a single expression vector", FUNGAL GENET BIOL, vol. 64, 2014, pages 1 - 10
WILSON, J IMMUNOL, vol. 162, 1999, pages 3070 - 8
WYSZYRISKA, A.; KOBIERECKA, P.; BARDOWSKI, J.; JAGUSZTYN-KRYNICKA, E. K.: "Lactic acid bacteria - 20 years exploring their potential as live vectors for mucosal vaccination", APPL MICROBIOL BIOTECHNOL, vol. 99, 2015, pages 2967 - 2977
YALLOP, C. A.; SVENDSEN, I.: "The effects of G418 on the growth and metabolism of recombinant mammalian cell lines", CYTOTECHNOL, vol. 35, 2001, pages 101 - 114, XP009018660, DOI: doi:10.1023/A:1017550902771
ZAMITH-MIRANDA, D. ET AL.: "Lipid droplet levels vary heterogeneously in response to simulated gastrointestinal stresses in different probiotic Saccharomyces cerevisiae strains", J FUNCT FOODS, vol. 21, 2016, pages 193 - 200

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114269374A (en) * 2019-05-21 2022-04-01 艾斯佩罗疫苗公司 Yeast-based oral vaccination

Also Published As

Publication number Publication date
IT201600116554A1 (en) 2018-05-17

Similar Documents

Publication Publication Date Title
US10849971B2 (en) Compositions and methods for the treatment or prevention of human immunodeficiency virus infection
US11612649B2 (en) HIV pre-immunization and immunotherapy
JP7551157B2 (en) HIV Vaccination and Immunotherapy
Zhou et al. PD1-based DNA vaccine amplifies HIV-1 GAG-specific CD8+ T cells in mice
TWI845955B (en) Hiv vaccines and methods of making and using
US11304996B2 (en) Yeast-based immunotherapy and type I interferon sensitivity
JP2013522302A (en) Pharmacogenomics and therapeutic response guide treatment of infectious diseases using yeast-based immunotherapy
US20200384021A1 (en) Hiv immunotherapy with no pre-immunization step
CN103732250A (en) Yeast-based compositions and methods for the treatment or prevention of hepatitis delta virus infection
TW201412329A (en) Yeast-based vaccine for inducing an immune response
Rosa et al. A DNA vaccine encoding multiple HIV CD4 epitopes elicits vigorous polyfunctional, long-lived CD4+ and CD8+ T cell responses
EP2651439A2 (en) Compositions and methods for the treatment or prevention of human adenovirus-36 infection
KR20230131481A (en) HIV vaccine and methods of use thereof
Palma et al. Genetically engineered probiotic Saccharomyces cerevisiae strains mature human dendritic cells and stimulate Gag-specific memory CD8+ T cells ex vivo
CA3170359A1 (en) Yeast lysate covid-19 vaccine
Iida et al. Augmentation of antigen-specific cytokine responses in the early phase of vaccination with a live-attenuated simian/human immunodeficiency chimeric virus expressing IFN-γ
TWI921717B (en) Hiv vaccines and methods of using
TWI921443B (en) Hiv vaccines and methods of using
Yildirim Development of novel strategies for HIV-1 vaccines
Qi¹ et al. Single-cell analysis of the adaptive immune response
Roff T-cell based HIV vaccines
NZ726228B2 (en) Yeast-based immunotherapy and type i interferon sensitivity

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17805145

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17805145

Country of ref document: EP

Kind code of ref document: A1