WO2018087345A1 - COMBINATION THERAPY OF AN HBsAg INHIBITOR, A NUCLEOS(T)IDE ANALOGUE AND AN INTERFERON - Google Patents

COMBINATION THERAPY OF AN HBsAg INHIBITOR, A NUCLEOS(T)IDE ANALOGUE AND AN INTERFERON Download PDF

Info

Publication number
WO2018087345A1
WO2018087345A1 PCT/EP2017/078974 EP2017078974W WO2018087345A1 WO 2018087345 A1 WO2018087345 A1 WO 2018087345A1 EP 2017078974 W EP2017078974 W EP 2017078974W WO 2018087345 A1 WO2018087345 A1 WO 2018087345A1
Authority
WO
WIPO (PCT)
Prior art keywords
compound
oxo
methoxypropoxy
quinolizine
methoxy
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2017/078974
Other languages
French (fr)
Inventor
Hassan JAVANBAKHT
Steffen Wildum
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
F Hoffmann La Roche AG
Hoffmann La Roche Inc
Original Assignee
F Hoffmann La Roche AG
Hoffmann La Roche Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by F Hoffmann La Roche AG, Hoffmann La Roche Inc filed Critical F Hoffmann La Roche AG
Publication of WO2018087345A1 publication Critical patent/WO2018087345A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47Quinolines; Isoquinolines
    • A61K31/4738Quinolines; Isoquinolines ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/4745Quinolines; Isoquinolines ortho- or peri-condensed with heterocyclic ring systems condensed with ring systems having nitrogen as a ring hetero atom, e.g. phenantrolines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • A61K31/52Purines, e.g. adenine
    • A61K31/522Purines, e.g. adenine having oxo groups directly attached to the heterocyclic ring, e.g. hypoxanthine, guanine, acyclovir
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19Cytokines; Lymphokines; Interferons
    • A61K38/21Interferons [IFN]
    • A61K38/212IFN-alpha
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/20Antivirals for DNA viruses

Definitions

  • the present invention is directed to compositions and methods for treating hepatitis B virus infection.
  • the present invention is directed to a combination therapy comprising administration of an HBsAg inhibitor, a nucleos(t)ide analogue and an interferon for use in the treatment or prophylaxis of chronic Hepatitis B virus infections.
  • HBV Hepatitis B virus
  • HBV belongs to the Hepadnaviridae family of viruses. Following entry into hepatocyte, its viral genome is delivered into nucleus where a covalently closed circular DNA (cccDNA) is formed through DNA repair of partially double-stranded viral genome. cccDNA serves as the template for transcription of viral RNAs. Viral pre-genomic RNA interacts with other two viral components, capsid protein and polymerase to form capsid particles where viral DNA replication occurs. HBV has an icosahedral core comprising of 240 copies of the capsid (or core) protein.
  • capsid protein The predominant biological function of capsid protein is to act as a structural protein to encapsidate pre-genomic RNA and form immature capsid particles in the cytoplasm. This step is prerequisite for viral DNA replication. When a near full-length relaxed circular DNA is formed through reverse-transcription of viral pregenomic RNA, an immature capsid becomes a mature capsid. Most copies of the encapsidated genome efficiently associate with cellular lipids and viral envelope proteins (S, M, and L) for virion assembly and secretion. However, non-infectious particles are also produced that greatly outnumber the infectious virions. These empty, enveloped particles are referred to as subviral particles (SVPs).
  • SVPs subviral particles
  • the S, M, and L envelope proteins are expressed from a single ORF (open reading frame) that contains three different start codons. All three proteins share a 226aa sequence, the S-domain, at their C-termini. S-domain contains the HBsAg epitope (Lambert, C. & R. Prange. Virol J, 2007, 4, 45). Viral proteins expressed from the HBV genome include HBsAg, HBV polymerase, HBV
  • HBV empty subviral particles may participate to the maintenance of the immunological tolerant state observed in chronically infected patients (CHB).
  • CHB chronically infected patients
  • HBsAg as well as other HBV antigens, may also play a role in suppressing host innate immune responses.
  • the persistent exposure to HBsAg and other viral antigens can lead to HBV-specific T-cell deletion or to progressive functional impairment (Kondo et al. Journal of Immunology 1993, 150, 4659- 4671; Kondo et al. Journal of Medical Virology 2004, 74, 425-433; Fisicaro et al.
  • HBsAg has been reported to suppress the function of immune cells such as monocytes, dendritic cells (DCs) and natural killer (NK) cells by direct interaction (Op den Brouw et al. Immunology, 2009b, 126, 280-9; Woltman et al. PLoS One, 2011, 6, el5324; Shi et al. J Viral Hepat. 2012, 19, e26-33; Kondo et al. ISRN
  • IFN-a interferon alpha
  • ISGs interferon-stimulated genes
  • IFN-a has an immunomodulatory effect that can indirectly inhibit HBV replication by affecting cell-mediated immunity in vivo (Micco L., et al., J. Hepatol, 2013, 58, 225-233).
  • nucleos(t)ide analogues e.g. Lamivudine, Adefovir, Tenofovir, Telbivudine and Entecavir
  • nucleos(t)ide analogues have demonstrated very low rates of HBsAg clearance comparable to those observed naturally (Janssen et al. Lancet, 2005, 365, 123-9; Marcellin et al. N. Engl. J. Med., 2004, 351, 1206-17; Buster et al. Hepatology, 2007, 46, 388- 94).
  • HBsAg inhibitors inhibit HBV DNA and expression of viral proteins (including HBsAg) by specifically reducing HBV mRNAs.
  • HBV infection remains a major health problem worldwide which concerns an estimated 240 million chronic carriers who have a higher risk of liver cirrhosis and hepatocellular carcinoma.
  • HBeAg loss and/ or HBV-DNA reduction
  • HBV clearance and/or seroconversion and/or normalization of ALT, and/ or promoting the production of anti-HBs to address the Hepatitis B virus (HBV) infections.
  • the present invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising an HBsAg inhibitor, a nucleos(t)ide analogue and an interferon, in a pharmaceutically acceptable carrier for the treatment or prophylaxis of HBV infection.
  • the "HBsAg inhibitor” is a compound of formula (I), (II) or any one of the compounds disclosed in patent application WO 2015/113990 and WO2016/071215, particularly the "HBsAg inhibitor” herein is (+)-10-methoxy-6-isopropyl-9-(3- methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine-3-carboxylic acid, (-)- 10-methoxy-6- isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine-3-carboxylic acid, (+)- 10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine-3- carboxylic acid, (-)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7
  • the "interferon” herein is selected from the group consisting of interferon alpha, peginterferon-alpha 2a, recombinant interferon alpha-2a, interferon alpha-2a, peginterferon alpha-2b, recombinant interferon alpha-2b, interferon alpha- 2b, glycosylated interferon alpha- 2b, interferon alpha-2b XL, recombinant interferon alpha-2c, interferon alpha- 2c, interferon beta, peginterferon beta- la, interferon beta- la, interferon delta, peginterferon lambda- 1 , interferon lambda, interferon omega, interferon tau, gamma interferon, interferon alfacon-1, interferon alpha-nl, interferon alpha-n3,albinterferon alpha-2b, BLX-883 (Biolex Inc.
  • the interferon is a y-branched pegylated recombinant human interferon alpha-2b injection Pai Ge Bin (Amoytop Biotech).
  • the interferon is a non-conjugated interferon alfa or a pegylated alfa-type interferon; particularly the interferon is Roferon A ® (Hoffmann-La Roche, Inc.), Intron A ® (Schering-Plough Corp.), Pegasys ® (Hoffmann-La Roche, Inc.), Peglntron ® (Schering Corp.) or wIFN; more particularly the interferon is Pegasys ® or wIFN.
  • Roferon A ® Hoffmann-La Roche, Inc.
  • Intron A ® Schering-Plough Corp.
  • Pegasys ® Hoffmann-La Roche, Inc.
  • Peglntron ® Schering Corp.
  • wIFN more particularly the interferon is Pegasys ® or wIFN.
  • the "nucleos(t)ide analogue” is any nucleoside and nucleotide analogue known to those skilled in the art.
  • the "nucleos(t)ide analogue” is Lamivudine, Adefovir dipivoxil, Entecavir, Telbivudine, Clevudine, Tenofovir disoproxil and Tenofovir disoproxil fumarate.
  • the “nucleos(t)ide analogue” is Entecavir.
  • Fig. 1 Study design of the woodchuck drug combination study. WHV-infected woodchucks were treated with Compound 1A, Compound 12 and Compound 13 alone or in combination for 14 weeks, and then monitored for another 10 weeks without treatment.
  • Fig. 2 Effect of Compound 1A, Compound 12 and Compound 13 alone or in combination on WHsAg in WHV-infected woodchucks. Shown are mean values and error bars represent the standard error of the mean (SEM). Dashed line shows the lower limit of detection (LLOD) at 30 ng/ml.
  • Fig. 3 Observed effect (circles) and predicted additive effect (triangles) of the triple combination of Compound 1A, Compound 12 and Compound 13 on WHsAg in WHV-infected woodchucks. Additivity effect of triple drug combination was predicted using the Bliss independence model. Error bars represent the 95% confidence intervals. DETAILED DESCRIPTION OF THE INVENTION
  • Ci-6alkyl refers to a monovalent linear or branched saturated hydrocarbon group of 1 to 6 carbon atoms.
  • Ci-6alkyl has 1 to 6 carbon atoms, and in more particular embodiments 1 to 4 carbon atoms.
  • Examples of Ci-6alkyl include methyl, ethyl, propyl, isopropyl, n-butyl, iso-butyl, sec-butyl or ie/t-butyl.
  • halo or halogen are used interchangeably herein and refer to fluoro, chloro, bromo, or iodo. Halogen is particularly fluorine, chlorine or bromine.
  • Ci-6alkoxy refers to a group of Ci-6alkyl-O-, wherein the "Ci- 6alkyl” is as defined above; for example methoxy, ethoxy, propoxy, zsopropoxy, w-butoxy, iso- butoxy, 2-butoxy, ie/t-butoxy and the like.
  • Particular "Ci-6alkoxy” groups are methoxy and ethoxy and more particularly methoxy.
  • C3-7cycloalkyl refers to a saturated carbon ring containing from 3 to 7 carbon atoms, particularly from 3 to 6 carbon atoms, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and the like.
  • Particular "C3-7cycloalkyl” groups are cyclopropyl, cyclopentyl and cyclohexyl.
  • C2-6alkenyl refers to an unsaturated, linear or branched chain alkenyl group containing 2 to 6, particularly 2 to 4 carbon atoms, for example vinyl, propenyl, allyl, butenyl and the like. Particular “C2-6alkenyl” group is allyl.
  • C2-6alkynyl refers to an unsaturated, linear or branched chain alkynyl group containing 2 to 6, particularly 2 to 4 carbon atoms, for example ethynyl, 1- propynyl, propargyl, butynyl and the like.
  • Particular “C2-6alkynyl” groups are ethynyl, 1- propynyl and propargyl.
  • C X H2 X alone or in combination signifies a saturated, linear- or branched chain alkyl group containing 1 to 6, particularly 1 to 4 carbon atoms.
  • C y H2 y or “C z H2 y” alone or in combination signifies a bond or a saturated, linear- or branched chain alkyl group containing 1 to 6, particularly 1 to 4 carbon atoms.
  • monocyclic heteroaryl denotes a monovalent aromatic heterocyclic mono- ring system of 5 to 8 ring atoms, comprising 1, 2, 3 or 4 heteroatoms selected from N, O and S, the remaining ring atoms being carbon.
  • Examples of monocyclic heteroaryl moieties include pyrrolyl, furanyl, thienyl, imidazolyl, oxazolyl, thiazolyl, triazolyl, oxadiazolyl, thiadiazolyl, tetrazolyl, pyridinyl, pyrazinyl, pyrazolyl, pyridazinyl, pyrimidinyl, triazinyl, azepinyl, diazepinyl, isoxazolyl, isothiazolyl and the like.
  • W-containing monocyclic heteroaryl refers to a monocyclic heteroaryl wherein at least one of the heteroatoms is N.
  • W-containing monocyclic heteroaryl are pyrrolyl, imidazolyl, oxazolyl, thiazolyl, triazolyl, oxadiazolyl, thiadiazolyl, tetrazolyl, pyridinyl, pyrazinyl, pyrazolyl, pyridazinyl, pyrimidinyl, triazinyl, azepinyl, diazepinyl, isoxazolyl, isothiazolyl and the like.
  • Particular 'W-containing monocyclic heteroaryl” groups are imidazolyl, pyrazolyl and triazolyl, and more particularly imidazol-l-yl, pyrazol-l-yl and 1,2,4-triazol-l-yl.
  • the term "monocyclic heterocycloalkyl” is a monovalent saturated or partly unsaturated monocyclic ring system of 3 to 7 ring atoms, comprising 1, 2, or 3 ring heteroatoms selected from N, O and S, the remaining ring atoms being carbon.
  • Examples for monocyclic heterocycloalkyl are aziridinyl, oxiranyl, azetidinyl, oxetanyl, pyrrolidinyl, 2-oxo-pyrrolidinyl, tetrahydrofuranyl, tetrahydro-thienyl, pyrazolidinyl, imidazolidinyl, oxazolidinyl, isoxazolidinyl, thiazolidinyl, piperidinyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperazinyl, morpholinyl, thiomorpholinyl, l,l-dioxo-thiomorpholin-4-yl, azepanyl, diazepanyl, homopiperazinyl, or oxazepanyl.
  • Particular "monocyclic heterocycloalkyl” groups are morpholinyl, 2-oxo- pyrrolidinyl, pyrrolidinyl, tetrahydropyranyl, and more particularly pyrrolidin-l-yl, 2-oxo- pyrrolidin-l-yl, tetrahydropyran-4-yl and morpholin-l-yl.
  • diastereomer refers to a stereoisomer with two or more centers of chirality and whose molecules are not mirror images of one another. Diastereomers have different physical properties, e.g. melting points, boiling points, spectral properties, activities and reactivities. As used herein, the term “enantiomers” refers to two stereoisomers of a compound which are non-superimposable mirror images of one another.
  • the term “pharmaceutically acceptable salts” refers to salts which are not biologically or otherwise undesirable. Pharmaceutically acceptable salts include both acid and base addition salts.
  • the term “prodrug” refers to a form or derivative of a compound which is metabolized in vivo, e.g., by biological fluids or enzymes by a subject after administration, into a pharmacologically active form of the compound in order to produce the desired pharmacological effect. Prodrugs are described e.g. in the Organic Chemistry of Drug Design and Drug Action by Richard B. Silverman, Academic Press, San Diego, 2004, Chapter 8 Prodrugs and Drug Delivery Systems, pp. 497-558.
  • pharmaceutically acceptable acid addition salt refers to those pharmaceutically acceptable salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, carbonic acid, phosphoric acid, and organic acids selected from aliphatic, cycloaliphatic, aromatic, araliphatic, heterocyclic, carboxylic, and sulfonic classes of organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, gluconic acid, lactic acid, pyruvic acid, oxalic acid, malic acid, maleic acid, maloneic acid, succinic acid, fumaric acid, tartaric acid, citric acid, aspartic acid, ascorbic acid, glutamic acid, anthranilic acid, benzoic acid, cinnamic acid, mandelic acid, embonic acid, phenylacetic acid, methanesulfonic acid, ethanesulfonic acid, p-toluene
  • pharmaceutically acceptable base addition salt refers to those pharmaceutically acceptable salts formed with an organic or inorganic base.
  • acceptable inorganic bases include sodium, potassium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, and aluminum salts.
  • Salts derived from pharmaceutically acceptable organic nontoxic bases includes salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, 2-diethylaminoethanol, trimethamine, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, ethylenediamine, glucosamine, methylglucamine, theobromine, purines, piperizine, piperidine, N-ethylpiperidine, and polyamine resins.
  • substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as isopropylamine, trimethylamine, diethylamine, trieth
  • hepatitis B virus or “HBV” refers to a member of the Hepadnaviridae family having a small double-stranded DNA genome of approximately 3,200 base pairs and a tropism for liver cells.
  • HBV includes hepatitis B virus that infects any of a variety of mammalian (e.g., human, non-human primate, etc.) and avian (duck, etc.) hosts.
  • HBV includes any known HBV genotype, e.g., serotype A, B, C, D, E, F, and G; any HBV serotype or HBV subtype; any HBV isolate; HBV variants, e.g., HBeAg-negative variants, drug-resistant HBV variants (e.g., lamivudine-resistant variants; adefovir-resistant mutants; tenofovir-resistant mutants; entecavir-resistant mutants; etc.); and the like.
  • HBV genotype e.g., serotype A, B, C, D, E, F, and G
  • HBV serotype or HBV subtype e.g., HBeAg-negative variants
  • drug-resistant HBV variants e.g., lamivudine-resistant variants; adefovir-resistant mutants; tenofovir-resistant mutants; entecavir-resistant mutants; etc.
  • HBV DNA refers to DNA material of HBV.
  • HBsAg refers to hepatitis B surface antigen
  • HBeAg refers to hepatitis B e antigen.
  • HBsAg inhibitor refers to a compound that inhibits expression of the hepatitis B virus surface antigen. Unless otherwise indicated, an HBsAg inhibitor can include the compound in any pharmaceutically acceptable form, including any isomer (e.g., diastereomer or enantiomer), salt, solvate, polymorph, and the like.
  • IFN interferon means the family of highly homologous species-specific proteins that inhibit viral replication and cellular proliferation and modulate immune response.
  • Type I Human interferons are grouped into two classes; Type I, including alpha and beta-interferon, and Type II, which is represented by gamma-interferon only. Recombinant forms of each group have been developed and are commercially available. Subtypes in each group are based on antigenic/structural characteristics.
  • interferon further includes conjugates, for instance interferon alfa (IFN-a) conjugates that can be prepared by coupling an interferon alfa to a water-soluble polymer.
  • IFN-a interferon alfa
  • a non-limiting list of such polymers includes other polyalkylene o ide homopolymers such as polyethylene glycol (PEG), polypropylene glycols, polyoxyethylenated polyols, copolymers thereof and block copolymers thereof.
  • polyalkylene oxide-based polymers effectively non-antigenic materials such as dextran, polyv inylpyrrolidones, polyacrylamides, polyvinyl alcohols, carbohydrate-based polymers and the like can be used.
  • interferon alfa-polymer conjugates are described in U.S. Pat. No. 4,766, 106, U.S. Pat. No. 4,917.888, European Patent Application No. 0 236 987, European Patent Application Nos. 0510 356, 0 593 868 and 0 809 996 (pegylated interferon alfa-2a) and International Publication No. WO 95/13090.
  • pegylated means covalent conjugates of one or more
  • PEG polyethylene glycol
  • Preferred conjugates for use in the formulations of the invention have one to four PEG molecules per interferon molecule, and more preferably, the conjugates are between a single PEG molecule and a single interferon molecule.
  • the pegylated interferon may comprise a single positional isomer or a mixture of conjugate positional isomers, e.g, the PEG molecules are covalently attached to different amino acid residues on the individual interferon molecules.
  • nucleos(t)ide analogue refers to nucleosides which contain a nucleobase analogue and a sugar and nucleotides which contain a nucleobase analogue, a sugar and one to three phosphate groups.
  • Nucleoside analogue drugs include but are not limited to deoxyadenosine analogues (Didanosine and Vidarabine), adenosine analogues (BCX4430), deoxycytidine analogues (Cytarabine, Emtricitabine, Lamivudine and Zalcitabine), guanosine and deoxyguanosine analogues (Abacavir, Aciclovir and Entecavir), thymidine and
  • Nucleotide analogue drugs include Adefovir dipivoxil (ADV), Tenofovir disoproxil and Tenofovir disoproxil fumarate (TDF).
  • Nucleobase means any nitrogen-containing heterocyclic moiety capable of forming Watson-Crick-type hydrogen bonds and stacking interactions in pairing with a complementary nucleobase or nucleobase analogue (i.e., derivatives of nucleobases) when that nucleobase is incorporated into a polymeric structure.
  • Nucleobase means any nitrogen-containing heterocyclic moiety capable of forming Watson-Crick-type hydrogen bonds and stacking interactions in pairing with a complementary nucleobase or nucleobase analogue (i.e., derivatives of nucleobases) when that nucleobase is incorporated into a polymeric structure.
  • Heterocyclic refers to a molecule with a ring system in which one or more ring atom is a heteroatom, e.g., nitrogen, oxygen, or sulfur (i.e., not carbon).
  • terapéuticaally effective amount refers to an amount of a compound or molecule of the present invention that, when administered to a subject, (i) treats or prevents the particular disease, condition or disorder, (ii) attenuates, ameliorates or eliminates one or more symptoms of the particular disease, condition, or disorder, or (iii) prevents or delays the onset of one or more symptoms of the particular disease, condition or disorder described herein.
  • the therapeutically effective amount will vary depending on the compound, the disease state being treated, the severity of the disease treated, the age and relative health of the subject, the route and form of administration, the judgment of the attending medical or veterinary practitioner, and other factors.
  • the present invention relates to a pharmaceutical composition comprising an HBsAg inhibitor and an interferon, in a pharmaceutically acceptable carrier.
  • HBsAg inhibitor is a compound of formula (I):
  • R 1 is hydrogen, halogen, Ci-6alkyl, Ci-6alkylamino or Ci-6alkoxy;
  • R 2 is hydrogen; halogen; Ci-6alkyl, which is unsubstituted or once, twice or three times
  • Ci-6alkoxy which is unsubstituted or once, twice or three times substituted by fluoro; cyano; C3-7cycloalkyl; hydroxy or phenyl-C x H2 X -0-;
  • R 3 is hydrogen
  • Ci-6alkyl which is unsubstituted or once, twice or three times substituted by fluoro;
  • R 7 is hydrogen; Ci-6alkyl, which is unsubstituted or substituted with one to three substituents independently selected from fluoro, hydroxy and C 2 -6alkenyl; Ci- 6alkoxyCi-6alkyl; Ci-6alkoxyCi-6alkoxyCi-6alkyl; aminoCi-salkyl; Ci- 6alkylcarbonylaminoCi-8alkyl; Ci-6alkylsulfonylaminoCi-8alkyl; Ci-6alkylsulfanylCi-6alkyl; Ci-6alkylsulfonylCi-6alkyl; cyanoCi-6alkyl; C3-7cycloalkylCi-6alkyl; cyanoC3-7cycloalkylCi- 6alkyl; phenylCi-6alkyl; pyrrolidinylcarbonylCi-6alkyl; C 2 -6alkynyl; hydroxy
  • R 5 is hydrogen or Ci-6alkyl
  • R 6 is hydrogen; Ci-6alkyl, which is unsubstituted or once, twice or three times substituted by fluoro; C3-7cycloalkyl, which is unsubstituted or once, twice or three times substituted by fluoro or Ci-6alkyl; or phenyl-C x H2 X -;
  • x is 1-6;
  • Compounds of formula (I), Compounds 1A to 3 A and Compounds IB to 3B can be obtained according to the synthetic procedures disclosed in WO 2015/113990.
  • the "HBsAg inhibitor" of the present invention relates to
  • the "HBsAg inhibitor” is a compound of formula (II): wherein
  • R 8 , R 9 , R 10 and R 11 are independently selected from hydrogen, halogen, Ci-6alkyl, diCi- 6alkylamino, cyano, N-containing monocyclic heterocycloalkyl and OR 14 , wherein R 14 is hydrogen; Ci-6alkyl; or Ci-6alkyl which is substituted once or more times by fluoro,
  • R 12 is hydrogen or Chalky
  • R 13 is hydrogen, Ci-6alkyl, phenyl-C x H2 X -, Ci-6alkylcarbonyl, Ci-6alkylsulfonyl, benzoyl or monocyclic heterocycloalkyl, wherein
  • x is 1-6;
  • W is a bond, C y H 2y C(R 15 )(R 16 )CzH2z or C y H 2y CH(R 15 )CH(R 16 )CzH2z, wherein
  • R 15 and R 16 are independently selected from hydrogen, fluoro, hydroxy and Ci-6alkyl, y is 0-6;
  • z is 0-6;
  • X is a bond; O; S; S(0) 2 ; or NR 17 , wherein R 17 is hydrogen, C 1-6 alkyl;
  • Compounds of formula (II), Compounds 4A to 6 A and Compounds 4B to 6B can be obtained according to the synthetic procedures disclosed in WO 2016/071215.
  • the "HBsAg inhibitor" of the present invention relates to
  • an HBsAg inhibitor can include any one of the compounds in any pharmaceutically acceptable form, including any isomer (e.g., diastereomer or enantiomer), salt, solvate, polymorph, and the like.
  • suitable nucleos(t)ide analogues of the present invention may be used include nucleoside analogue drugs and nucleotide analogue drugs.
  • Nucleoside analogue drugs include but are not limited to deoxyadenosine analogues (Didanosine and Vidarabine), adenosine analogues (BCX4430), deoxycytidine analogues (Cytarabine, Emtricitabine, Lamivudine and Zalcitabine), guanosine and deoxyguanosine analogues
  • Nucleotide analogue drugs include but are not limited to Adefovir dipivoxil (ADV), Tenofovir disoproxil and Tenofovir disoproxil fumarate (TDF).
  • the "nucleos(t)ide analogue” is Lamivudine, Adefovir dipivoxil, Entecavir, Telbivudine, Clevudine, Tenofovir disoproxil or Tenofovir disoproxil fumarate. More particularly, the "nucleos(t)ide analogue” is Entecavir.
  • Suitable interferons in accordance with the present invention may be any naturally- occurring or recombinant interferon alfa, beta or gamma known to those skilled in the art.
  • Natural and recombinant alfa-interferons that may be used include interferon alfa-nl (e.g., Surniferon ® , Sumitomo), interferon alfa-n3, interferon alfa-2a (Roferon A ® ), interferon alfa-2b (Intron A ® ), interferon alfa-2c (Berofor ® , Boehringer Ingelheim, Inc.), and consensus interferon (Infergen ® , InterMune, Inc.).
  • Preferred interferons are interferon alfa-2a and interferon alfa-2b.
  • suitable interferons in accordance with the present invention include, but are not limited to, recombinant interferon alfa-2b such as Intron A ® ; recombinant interferon alfa-2a such as Roferon A ® ; recombinant interferon beta- lb such as Betaferon ® (Bayer AG); recombinant interferon beta-la such as Avonex ® (Biogen Canada Inc.) and Rebif ® (Merck KGaA); and recombinant interferon gamma- lb such as Imukin ® (Boehringer Ingelheim).
  • recombinant interferon alfa-2b such as Intron A ®
  • recombinant interferon alfa-2a such as Roferon A ®
  • recombinant interferon beta- lb such as Betaferon ® (Bayer AG)
  • recombinant interferon beta-la such as Avonex
  • interferon alfa-2a or alfa-2b is preferred.
  • interferon alfa-2a is further intended to include “pegylated” analogs meaning polyethylene glycol modified conjugates of interferon alfa-2a such as Pegasys ® , interferon alfa-2b such as Peglntron ® and Pai Ge Bin, and interferon beta- la such as Plegridy ® (Biogen Canada Inc.).
  • pegylated recombinant interferon alfa-2a or alfa 2b is preferred.
  • the "interferon” is a non-conjugated interferon alfa or a pegylated conjugate thereof.
  • interferon alfa- 2a such as Roferon A ®
  • interferon alfa-2b such as Intron A ®
  • pegylated interferon alfa-2a such as Pegasys ®
  • pegylated interferon alfa-2b such as Peglntron ® and Pai Ge Bin respectively.
  • interferon is a non-conjugated interferon alfa-2a (for instance Roferon A ® ) or a pegylated alfa- type interferon (for instance Pegasys ® ):
  • the above pegylated alfa-type interferon is an alfa-2a interferon.
  • the pharmaceutical composition comprises an
  • HBsAg viral expression inhibitor a nucleos(t)ide analogue and an interferon, wherein the
  • HBsAg inhibitor the nucleos(t)ide analogue and the interferon are independently selected from Table 1.
  • Table 1 List of HBsAg inhibitors, interferons and nucleos(t)ide analogues
  • the present invention relates to a pharmaceutical composition
  • HBsAg inhibitor comprising an HBsAg inhibitor, a nucleos(t)ide analogue and an interferon which is selected from any one of the following combinations:
  • the present invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising an HBsAg inhibitor and an interferon which is selected from any one of the following combinations:
  • the nucleos(t)ide analogue used in the combination is Lamivudine, Adefovir dipivoxil, Telbivudine, Clevudine, Tenofovir disoproxil or Tenofovir disoproxil fumarate.
  • the pharmaceutical composition consists of an HBsAg inhibitor, a nucleos(t)ide analogue and an interferon, in a pharmaceutically acceptable carrier. More particularly, the composition consists of:
  • interferons examples include, but not limited to,
  • Typical dosages of an HBsAg inhibitor , a nucleos(t)ide analogue and/or an interferon can be in the ranges recommended by the manufacturer, and where indicated by in vitro responses in an animal model, can be reduced by up to about one order of magnitude concentration or amount.
  • the actual dosage will depend upon the judgment of the physician, the condition of the patient, and the effectiveness of the therapeutic method based on the in vitro responsiveness of the appropriate animal models.
  • Another embodiment of the present invention relates to a method for manufacturing a medicament for treatment or prophylaxis of hepatitis B virus infection, characterized in that an HBsAg inhibitor, a nucleos(t)ide analogue and an interferon are used in the medicament.
  • a further embodiment of the present invention relates to the method for manufacturing a medicament for treatment or prophylaxis of hepatitis B virus infection, characterized in that the HBsAg inhibitor, the nucleos(t)ide analogue and the interferon are co-administered in the same formulation or different formulation.
  • co-administer refers to any administration of the
  • HBsAg inhibitor the nucleos(t)ide analogue and interferon as the three active agents, either separately or together, where the three active agents are administered as part of an appropriate dose regimen designed to obtain the benefit of the combination therapy.
  • the three active agents can be administered either as part of the same pharmaceutical composition or in separate pharmaceutical compositions.
  • the three active agents can be administered either at the same time, or sequentially.
  • the pharmaceutical composition of the HBsAg inhibitor, the nucleos(t)ide analogue and the interferon can be administered with various pharmaceutically acceptable inert carriers in the form of tablets, capsules, lozengens, troches, hard candies, powders, sprays, creams, salves, suppositories, jellies, gels, pastes, lotions, ointments, elixirs, syrups, and the like. Administration of such dosage forms can be carried out in single or multiple doses. Carries include solid diluents of fillers, sterile aqueous media and various non-toxic organic solvents. Administration of such dosage forms can be carried out through, but not limited to, oral administration, parenteral administration, veterinary administration.
  • a further embodiment of the present invention relates to the method for manufacturing a medicament for treatment or prophylaxis of hepatitis B virus infection, characterized in that the HBsAg inhibitor, the nucleos(t)ide analogue and the interferon are intended for administration to a subject by the same route or different routes.
  • a further embodiment of the present invention relates to the method for manufacturing a medicament for treatment or prophylaxis of hepatitis B virus infection, characterized in that the HBsAg inhibitor, the nucleos(t)ide analogue and the interferon thereof are intended for administration to a subject by parenteral or oral administration.
  • a further embodiment of the present invention relates to the method for manufacturing a medicament for treatment or prophylaxis of hepatitis B virus infection, characterized in that the administration of the HBsAg inhibitor, the nucleos(t)ide analogue and the interferon thereof to a subject is simultaneous or sequential.
  • the administration of agents simultaneously can be performed by separately or sequentially administering agents at the same time, or together as a fixed combination.
  • the administration of agents separately or sequentially can be in any order.
  • HBsAg inhibitor thereof is a compound of formula (I), or formula (II), or pharmaceutically acceptable salt, enantiomer or diastereomer thereof.
  • HBsAg inhibitor thereof is a compound of formula (I), or formula (II), or pharmaceutically acceptable salt, enantiomer or diastereomer thereof.
  • the HBsAg inhibitor thereof is a compound of formula (I), or formula (II), or pharmaceutically acceptable salt, enantiomer or diastereomer thereof.
  • the HBsAg inhibitor thereof is
  • nucleos(t)ide analogue is Lamivudine, Adefovir dipivoxil, Entecavir, Telbivudine, Clevudine, Tenofovir disoproxil or Tenofovir disoproxil fumarate.
  • nucleos(t)ide analogue is Entecavir.
  • Another embodiment of the present invention relates to the method for manufacturing a medicament for treatment or prophylaxis of hepatitis B virus infection, characterized in that the interferon thereof is a non-conjugated interferon alfa, a pegylated alfa-type interferon or a y- branched pegylated recombinant human interferon alpha-2b; particularly the interferon is Roferon A ® , Intron A ® , Pegasys ® , Peglntron ® ' Pai Ge Bin or wIFN; more particularly the interferon is Pegasys ® or wIFN.
  • the interferon is Roferon A ® , Intron A ® , Pegasys ® , Peglntron ® ' Pai Ge Bin or wIFN; more particularly the interferon is Pegasys ® or wIFN.
  • Another embodiment of the present invention relates to the method for manufacturing a medicament for treatment or prophylaxis of hepatitis B virus infection, characterized in that the HBsAg inhibitor, the nucleos(t)ide analogue and the interferon used in the medicament are
  • kits comprising a container comprising an HBsAg inhibitor, a nucleos(t)ide analogue and an interferon, said kit can further comprise a sterile diluent.
  • kits can further comprise a package insert comprising printed instructions directing the use of a combined treatment of an HBsAg inhibitor, a nucleos(t)ide analogue and an interferon as a method for treatment or prophylaxis of hepatitis B virus infection.
  • Another embodiment of the present invention relates to the said kit, wherein the HBsAg inhibitor is
  • nucleos(t)ide analogue is Lamivudine, Adefovir dipivoxil, Entecavir, Telbivudine, Clevudine, Tenofovir disoproxil or Tenofovir disoproxil fumarate.
  • nucleos(t)ide analogue is Entecavir.
  • the interferon thereof is a non-conjugated interferon alfa, a pegylated alfa-type interferon or a y- branched pegylated recombinant human interferon alpha-2b; particularly the interferon is Roferon A ® , Intron A ® , Pegasys ® , Peglntron ® , Pai Ge Bin or wIFN; more particularly the interferon is Pegasys ® or wIFN.
  • Another embodiment of the present invention relates to the said kit, characterized in that the HBsAg inhibitor, the nucleos(t)ide analogue and the interferon used in the container are
  • Another embodiment of the present invention relates to a method for the treatment or prophylaxis of hepatitis B virus infection, comprising administration to a subject with an effective amount of an HBsAg inhibitor, or pharmaceutically acceptable salt, enantiomer or diastereomer thereof; an effective amount of a nucleos(t)ide analogue and an effective amount of an interferon; wherein the HBsAg inhibitor thereof is
  • Another embodiment of the present invention relates to a method for the treatment or prophylaxis of hepatitis B virus infection, comprising administration to a subject with an effective amount of an HBsAg inhibitor, or pharmaceutically acceptable salt, enantiomer or diastereomer thereof; an effective amount of a nucleos(t)ide analogue and an effective amount of an interferon, wherein the nucleos(t)ide analogue is Lamivudine, Adefovir dipivoxil, Entecavir, Telbivudine, Clevudine, Tenofovir disoproxil or Tenofovir disoproxil fumarate. Particularly the nucleos(t)ide analogue is Entecavir.
  • Another embodiment of the present invention relates to a method for the treatment or prophylaxis of hepatitis B virus infection, comprising administration to a subject with an effective amount of an HBsAg inhibitor, or pharmaceutically acceptable salt, enantiomer or diastereomer thereof; an effective amount of a nucleos(t)ide analogue and an effective amount of an interferon, wherein the interferon thereof is a non-conjugated interferon alfa, a pegylated alfa- type interferon or a y-branched pegylated recombinant human interferon alpha-2b; particularly the interferon is Roferon A ® , Intron A ® , Pegasys ® , Peglntron ® , Pai Ge Bin or wIFN; more particularly the interferon is Pegasys ® or wIFN.
  • a further embodiment of the present invention relates to a method for the treatment or prophylaxis of hepatitis B virus infection, wherein the HBsAg inhibitor, the nucleos(t)ide analogue and the interferon used in the subject are
  • Another embodiment of the present invention relates to use of the pharmaceutical composition herein mentioned above as an antiviral medicament, in particular as the medicament for treatment or prophylaxis of hepatitis B virus infection.
  • Another embodiment of the present invention relates to the use of an HBsAg inhibitor, a nucleos(t)ide analogue and an interferon for the manufacture of the pharmaceutical composition herein mentioned above as an antiviral medicament, in particular the medicament for treatment or prophylaxis of hepatitis B virus infection.
  • Genotype cDNA-uPAwild/+/SCID (cDNA-uPAwild/+: B6; 129SvEv-Plau, SCID: C.B- 17/Icr-scid /scid Jcl)
  • HBV genotype C (Code No.: PBB004, Lot: 140309, PhoenixBio Co., Ltd.)
  • Serum HBV DNA level l.OxlO 6 copies/mL or more on Day -10 (plateau)
  • BD195 BD Biosciences, Woburn, MA, USA
  • the group composition was randomized based on the arithmetic mean values for body weight and geometric mean values for blood h-Alb concentration and serum HBV DNA concentration. Mice were assigned to groups and treated with single compounds or combinations of compounds for 35 days as summarized in Table 2.
  • HBV DNA was extracted from 5 ⁇ of serum using the SMITEST EX-R&D Nucleic Acid Extraction Kit (MEDICAL & BIOLOGICAL LABORATORIES CO., LTD., Nagoya, Japan). The DNA was dissolved in 20 nuclease-free water (Life Technologies Corporation, Carlsbad, CA, USA).
  • HBV DNA Serum from an HBV-infected PXB-mouse was used as the HBV DNA standard.
  • Synthetic HBV DNA was used to determine the concentration of the HBV DNA standard which had been divided into aliquots and stored at -80°C until the quantification of the serum HBV DNA level.
  • the HBV DNA was extracted from the HBV DNA standard and used for real-time PCR after appropriate dilution. For this study, the range of the standard used was between 4.0xl0 4 and 2.0x10 9 copies/mL.
  • the real-time detection PCR to measure the serum HBV DNA concentration was performed using the TaqMan Fast Advanced Master Mix (Life Technologies Corporation, Carlsbad, CA, USA) and ABI Prism 7500 sequence detector system (Life Technologies Corporation).
  • the PCR reaction mixture was added into 5 of the extracted DNA.
  • the initial activation of uracil-N-glycosylase at 50°C for 2 minutes was followed by the polymerase activation at 95°C for 20 seconds.
  • Subsequent PCR amplification consisted of 53 cycles of denaturation at 95°C for 3 seconds and annealing and extension at 60°C for 32 seconds per cycle in an ABI 7500 sequence detector.
  • the average serum HBV DNA level was calculated from the values of the two separate wells.
  • the primers and probe consisted of the following sequence given in Table 3 respectively: Table 3. Sequences of the primers and probe used for HBV DNA quantification
  • the lowest quantification limit of this assay was 4.0xl0 4 copies/mL serum.
  • HsAg Hepatitis B surface antigen quantification in mouse serum
  • Serum HBsAg concentration was determined by SRL, Inc. (Tokyo, Japan) based on ChemiLuminescence ImmunoAssay (CLIA) developed by Abbott (ARCHITECT® SYSTEM).
  • CLIA ChemiLuminescence ImmunoAssay
  • the dilution factor was 60, and the measurement range of this assay was between 0.05 and 250 IU/mL. For the 60-fold diluted samples, the measurement range was adjusted to be between 3.0 and 15000 IU/mL.
  • the HBsAg concentration decrease with the therapy of combination of Compound 1A plus Compound 13 plus Compound 9 was most evident and was measured to be -1.16 Log from the initial level.
  • Example 2 Combination of an HBsAg inhibitor, a nucleos(t)ide analogue and an interferon, in woodchucks
  • Woodchucks were born in captivity and were infected at 3 days of age with WHV strain WHV7-11. Chronically infected animals were all anti-WHs negative, with detectable serum WHV DNA, WHsAg and anti-WHc at approximately 1 year post-infection. Absence of liver tumors in woodchucks with low GGT was confirmed by ultrasonography. Chronic WHV carrier woodchucks were assigned and stratified by gender, body weight, and by pretreatment serum markers (WHsAg and WHV DNA concentrations, serum GGT and SDH activities) into the treatment groups as summarized in Figure 1. Compound treatment of the woodchucks was performed for 14 weeks.
  • Compound 13 (0.1 mg/kg) and Compound 1A (10 mg/kg), alone or in combination, were orally administered twice a day.
  • Compound 12 (100 ⁇ g/woodchuck) was administered in addition to Compound 13 and/or Compound 1A subcutaneously as follows: three times per week (TIW) for week 0 to 2, no treatment for week 2 to 4, and two times per week (BID) for week 6 to 14.
  • TIW three times per week
  • BID two times per week
  • WHsAg Serum WHsAg was measured by WHV-specific enzyme immunoassays as described in
  • Inhibition 1 - (WHsAg at day x / WHsAg at day 0).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Virology (AREA)
  • Communicable Diseases (AREA)
  • Zoology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oncology (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention is directed to compositions and methods for treating hepatitis B virus infection. In particular, the present invention is directed to a combination therapy comprising administration of an HBs Ag inhibitor, a nucleos(t)ide analogue and an interferon for use in the treatment or prophylaxis of chronic Hepatitis B virus infections.

Description

Combination therapy of an HBsAg inhibitor, a nucleos(t)ide analogue and an interferon
The present invention is directed to compositions and methods for treating hepatitis B virus infection. In particular, the present invention is directed to a combination therapy comprising administration of an HBsAg inhibitor, a nucleos(t)ide analogue and an interferon for use in the treatment or prophylaxis of chronic Hepatitis B virus infections. FIELD OF THE INVENTION
Chronic infection of Hepatitis B virus (HBV) is a serious public health problem
worldwide, with more than 240 million people chronically infected worldwide. HBV belongs to the Hepadnaviridae family of viruses. Following entry into hepatocyte, its viral genome is delivered into nucleus where a covalently closed circular DNA (cccDNA) is formed through DNA repair of partially double-stranded viral genome. cccDNA serves as the template for transcription of viral RNAs. Viral pre-genomic RNA interacts with other two viral components, capsid protein and polymerase to form capsid particles where viral DNA replication occurs. HBV has an icosahedral core comprising of 240 copies of the capsid (or core) protein. The predominant biological function of capsid protein is to act as a structural protein to encapsidate pre-genomic RNA and form immature capsid particles in the cytoplasm. This step is prerequisite for viral DNA replication. When a near full-length relaxed circular DNA is formed through reverse-transcription of viral pregenomic RNA, an immature capsid becomes a mature capsid. Most copies of the encapsidated genome efficiently associate with cellular lipids and viral envelope proteins (S, M, and L) for virion assembly and secretion. However, non-infectious particles are also produced that greatly outnumber the infectious virions. These empty, enveloped particles are referred to as subviral particles (SVPs). The S, M, and L envelope proteins are expressed from a single ORF (open reading frame) that contains three different start codons. All three proteins share a 226aa sequence, the S-domain, at their C-termini. S-domain contains the HBsAg epitope (Lambert, C. & R. Prange. Virol J, 2007, 4, 45). Viral proteins expressed from the HBV genome include HBsAg, HBV polymerase, HBV
X protein and core protein, and are involved in the multiple steps of the viral life cycle. Many observations showed that several HBV viral proteins could counteract the initial host cellular response by interfering with the viral recognition signaling system. Among these, the excessive secretion of HBV empty subviral particles may participate to the maintenance of the immunological tolerant state observed in chronically infected patients (CHB). HBsAg, as well as other HBV antigens, may also play a role in suppressing host innate immune responses. The persistent exposure to HBsAg and other viral antigens can lead to HBV-specific T-cell deletion or to progressive functional impairment (Kondo et al. Journal of Immunology 1993, 150, 4659- 4671; Kondo et al. Journal of Medical Virology 2004, 74, 425-433; Fisicaro et al.
Gastroenterology, 2010, 138, 682-93;). Moreover HBsAg has been reported to suppress the function of immune cells such as monocytes, dendritic cells (DCs) and natural killer (NK) cells by direct interaction (Op den Brouw et al. Immunology, 2009b, 126, 280-9; Woltman et al. PLoS One, 2011, 6, el5324; Shi et al. J Viral Hepat. 2012, 19, e26-33; Kondo et al. ISRN
Gasteroenterology, 2013, Article ID 935295). Therefore, targeting HBsAg together with HBV DNA levels in CHB patients may significantly improve CHB patient immune reactivation and remission (Wieland, S. F. & F. V. Chisari. / Virol, (2005), 79, 9369-80; Kumar et al. / Virol, (2011), 85, 987-95; Woltman et al. PLoS One, (2011), 6, el5324; Op den Brouw et al.
Immunology, (2009b), 126, 280-9).
One of the first-line treatments for hepatitis B is IFN-a (interferon alpha), albeit it is limited by its poor, long-term response, and side effects. IFN-a, as a front-line host defense against viral infections, is known to induce interferon-stimulated genes (ISGs), which play a diverse and pleiotropic role in targeting various viral functions at different steps of viral replication cycle, thereby potently suppressing viral infection. In addition, IFN-a has an immunomodulatory effect that can indirectly inhibit HBV replication by affecting cell-mediated immunity in vivo (Micco L., et al., J. Hepatol, 2013, 58, 225-233). Even though IFN- administration has shown to inhibit HBV replication in vitro and in vivo (Christen V., et al., J. Virol. 2007, 81: 159-165; Guan S.H., et al., J. Gastroenterol, 2007, 13:228-235; Wieland S.F., et al., J. Virol., 2000, 74, 4165-4173), a large number of individuals, particularly those displaying high viral loads, respond poorly, suggesting that HBV may have evolved mechanisms to antagonize the IFN response, as eluded earlier. Chronic HBV infection is generally characterized by dysfunctional innate and adaptive immune responses (Boni C, J. Virol., 2007, 81, 4215- 4225). For example, in HBV infected chimpanzees, IFN-a, was not induced (Wieland S., et al., Proc. Natl. Acad. Sci. U S A, 2004, 101, 6669-6674). When treated with Pegylated IFN-a, the effectiveness of a sustained virological response was achieved in only about 30% of HBeAg- positive and 40% of HBeAg-negative cases in clinical studies (Perrillo R., Hepatology, 2009, 49, S103-111; Janssen H.L., et al., Lancet, 2005, 365, 123-129; Lau G.K., et al., N. Engl. J. Med., 2005, 352, 2682-2695). The antiviral mechanisms of the interferon alpha and the reasons for the differential therapeutic response among the treated patients remain to be elucidated.
Current HBV therapies also include nucleos(t)ide analogues (e.g. Lamivudine, Adefovir, Tenofovir, Telbivudine and Entecavir), which target viral polymerase by inhibiting HBV polymerase reverse transcription activities. This leads to a decreased viral load and an abolishment of HBV progeny production, but cccDNAs remain intact, and syntheses of all viral proteins and RNAs, and HBsAg level are not affected in the infected hepatocytes. Even with prolonged therapy, nucleos(t)ide analogues have demonstrated very low rates of HBsAg clearance comparable to those observed naturally (Janssen et al. Lancet, 2005, 365, 123-9; Marcellin et al. N. Engl. J. Med., 2004, 351, 1206-17; Buster et al. Hepatology, 2007, 46, 388- 94).
On the other hand, several novel chemical series such as pyridazones and triazinones derivatives (WO2016/023877), dihydroquinolizinones derivatives (WO 2015/113990, WO 2015/173164, WO/2016/071215 and WO 2016/128335), and tetrahydropyridopyrimidines and tetrahydropyridopyridines derivatives (WO2016/107832) have been discovered to have the ability to inhibit HBsAg. Unlike current therapies, HBsAg inhibitors inhibit HBV DNA and expression of viral proteins (including HBsAg) by specifically reducing HBV mRNAs.
The Hepatitis B virus (HBV) infection remains a major health problem worldwide which concerns an estimated 240 million chronic carriers who have a higher risk of liver cirrhosis and hepatocellular carcinoma. Hence, there is certainly an unmet medical need for treatments with improved success rate of inducing HBsAg loss, and/or HBeAg loss, and/ or HBV-DNA reduction, and/or HBV clearance and/or seroconversion, and/or normalization of ALT, and/ or promoting the production of anti-HBs to address the Hepatitis B virus (HBV) infections.
SUMMARY OF THE INVENTION
The present invention relates to a pharmaceutical composition comprising an HBsAg inhibitor, a nucleos(t)ide analogue and an interferon, in a pharmaceutically acceptable carrier for the treatment or prophylaxis of HBV infection.
In one embodiment, the "HBsAg inhibitor" is a compound of formula (I), (II) or any one of the compounds disclosed in patent application WO 2015/113990 and WO2016/071215, particularly the "HBsAg inhibitor" herein is (+)-10-methoxy-6-isopropyl-9-(3- methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine-3-carboxylic acid, (-)- 10-methoxy-6- isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine-3-carboxylic acid, (+)- 10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine-3- carboxylic acid, (-)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, (+)-6-ie/t-butyl-10-methoxy-9-(3- methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine-3-carboxylic acid, (-)-6-ie/t-butyl-10- methoxy-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine-3-carboxylic acid, (+)- 10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, (-)- 10-methoxy-6-(2-methoxy- 1 , 1 -dimethyl- ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine-3-carboxylic acid, (+)-6-(2- hydroxy- l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, (-)-6-(2-hydroxy- 1,1 -dimethyl-ethyl)- 10- methoxy-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine-3-carboxylic acid, (+)- 10-chloro-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, (-)-10-chloro-6-(2-methoxy-l,l-dimethyl-ethyl)- 9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine-3-carboxylic acid, or
pharmaceutically acceptable salt, enantiomer or diastereomer thereof.
In one embodiment, the "interferon" herein is selected from the group consisting of interferon alpha, peginterferon-alpha 2a, recombinant interferon alpha-2a, interferon alpha-2a, peginterferon alpha-2b, recombinant interferon alpha-2b, interferon alpha- 2b, glycosylated interferon alpha- 2b, interferon alpha-2b XL, recombinant interferon alpha-2c, interferon alpha- 2c, interferon beta, peginterferon beta- la, interferon beta- la, interferon delta, peginterferon lambda- 1 , interferon lambda, interferon omega, interferon tau, gamma interferon, interferon alfacon-1, interferon alpha-nl, interferon alpha-n3,albinterferon alpha-2b, BLX-883 (Biolex Inc. and OctoPlus), DA-3021 (Dong- A Pharmaceutical), PEG-Infergen (InterMune Inc. and Inhale Therapeutic Systems), Belerofon (Nautilus Biotech) and wIFN. In one embodiment, the interferon is a y-branched pegylated recombinant human interferon alpha-2b injection Pai Ge Bin (Amoytop Biotech). In one embodiment, the interferon is a non-conjugated interferon alfa or a pegylated alfa-type interferon; particularly the interferon is Roferon A® (Hoffmann-La Roche, Inc.), Intron A® (Schering-Plough Corp.), Pegasys® (Hoffmann-La Roche, Inc.), Peglntron® (Schering Corp.) or wIFN; more particularly the interferon is Pegasys® or wIFN.
In one embodiment, the "nucleos(t)ide analogue" is any nucleoside and nucleotide analogue known to those skilled in the art. In a further embodiment, the "nucleos(t)ide analogue" is Lamivudine, Adefovir dipivoxil, Entecavir, Telbivudine, Clevudine, Tenofovir disoproxil and Tenofovir disoproxil fumarate. Particularly the "nucleos(t)ide analogue" is Entecavir.
BRIEF DESCRIPTION OF THE FIGURE(S)
Fig. 1: Study design of the woodchuck drug combination study. WHV-infected woodchucks were treated with Compound 1A, Compound 12 and Compound 13 alone or in combination for 14 weeks, and then monitored for another 10 weeks without treatment.
Fig. 2: Effect of Compound 1A, Compound 12 and Compound 13 alone or in combination on WHsAg in WHV-infected woodchucks. Shown are mean values and error bars represent the standard error of the mean (SEM). Dashed line shows the lower limit of detection (LLOD) at 30 ng/ml.
Fig. 3: Observed effect (circles) and predicted additive effect (triangles) of the triple combination of Compound 1A, Compound 12 and Compound 13 on WHsAg in WHV-infected woodchucks. Additivity effect of triple drug combination was predicted using the Bliss independence model. Error bars represent the 95% confidence intervals. DETAILED DESCRIPTION OF THE INVENTION
DEFINITIONS
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. As used herein, the term "Ci-6alkyl" refers to a monovalent linear or branched saturated hydrocarbon group of 1 to 6 carbon atoms. In particular embodiments, Ci-6alkyl has 1 to 6 carbon atoms, and in more particular embodiments 1 to 4 carbon atoms. Examples of Ci-6alkyl include methyl, ethyl, propyl, isopropyl, n-butyl, iso-butyl, sec-butyl or ie/t-butyl.
As used herein, the term "halo" or "halogen" are used interchangeably herein and refer to fluoro, chloro, bromo, or iodo. Halogen is particularly fluorine, chlorine or bromine.
As used herein, the term "Ci-6alkoxy" refers to a group of Ci-6alkyl-O-, wherein the "Ci- 6alkyl" is as defined above; for example methoxy, ethoxy, propoxy, zsopropoxy, w-butoxy, iso- butoxy, 2-butoxy, ie/t-butoxy and the like. Particular "Ci-6alkoxy" groups are methoxy and ethoxy and more particularly methoxy. As used herein, the term "C3-7cycloalkyl" refers to a saturated carbon ring containing from 3 to 7 carbon atoms, particularly from 3 to 6 carbon atoms, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and the like. Particular "C3-7cycloalkyl" groups are cyclopropyl, cyclopentyl and cyclohexyl. As used herein, the term "C2-6alkenyl" refers to an unsaturated, linear or branched chain alkenyl group containing 2 to 6, particularly 2 to 4 carbon atoms, for example vinyl, propenyl, allyl, butenyl and the like. Particular "C2-6alkenyl" group is allyl.
As used herein, the term "C2-6alkynyl" refers to an unsaturated, linear or branched chain alkynyl group containing 2 to 6, particularly 2 to 4 carbon atoms, for example ethynyl, 1- propynyl, propargyl, butynyl and the like. Particular "C2-6alkynyl" groups are ethynyl, 1- propynyl and propargyl.
As used herein, the term "CXH2X" alone or in combination signifies a saturated, linear- or branched chain alkyl group containing 1 to 6, particularly 1 to 4 carbon atoms.
As used herein, the term "CyH2y" or "CzH2y" alone or in combination signifies a bond or a saturated, linear- or branched chain alkyl group containing 1 to 6, particularly 1 to 4 carbon atoms.
As used herein, the term "monocyclic heteroaryl" denotes a monovalent aromatic heterocyclic mono- ring system of 5 to 8 ring atoms, comprising 1, 2, 3 or 4 heteroatoms selected from N, O and S, the remaining ring atoms being carbon. Examples of monocyclic heteroaryl moieties include pyrrolyl, furanyl, thienyl, imidazolyl, oxazolyl, thiazolyl, triazolyl, oxadiazolyl, thiadiazolyl, tetrazolyl, pyridinyl, pyrazinyl, pyrazolyl, pyridazinyl, pyrimidinyl, triazinyl, azepinyl, diazepinyl, isoxazolyl, isothiazolyl and the like.
As used herein, the term 'W-containing monocyclic heteroaryl" refers to a monocyclic heteroaryl wherein at least one of the heteroatoms is N. Examples for W-containing monocyclic heteroaryl are pyrrolyl, imidazolyl, oxazolyl, thiazolyl, triazolyl, oxadiazolyl, thiadiazolyl, tetrazolyl, pyridinyl, pyrazinyl, pyrazolyl, pyridazinyl, pyrimidinyl, triazinyl, azepinyl, diazepinyl, isoxazolyl, isothiazolyl and the like. Particular 'W-containing monocyclic heteroaryl" groups are imidazolyl, pyrazolyl and triazolyl, and more particularly imidazol-l-yl, pyrazol-l-yl and 1,2,4-triazol-l-yl. As used herein, the term "monocyclic heterocycloalkyl" is a monovalent saturated or partly unsaturated monocyclic ring system of 3 to 7 ring atoms, comprising 1, 2, or 3 ring heteroatoms selected from N, O and S, the remaining ring atoms being carbon. Examples for monocyclic heterocycloalkyl are aziridinyl, oxiranyl, azetidinyl, oxetanyl, pyrrolidinyl, 2-oxo-pyrrolidinyl, tetrahydrofuranyl, tetrahydro-thienyl, pyrazolidinyl, imidazolidinyl, oxazolidinyl, isoxazolidinyl, thiazolidinyl, piperidinyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperazinyl, morpholinyl, thiomorpholinyl, l,l-dioxo-thiomorpholin-4-yl, azepanyl, diazepanyl, homopiperazinyl, or oxazepanyl. Particular "monocyclic heterocycloalkyl" groups are morpholinyl, 2-oxo- pyrrolidinyl, pyrrolidinyl, tetrahydropyranyl, and more particularly pyrrolidin-l-yl, 2-oxo- pyrrolidin-l-yl, tetrahydropyran-4-yl and morpholin-l-yl.
As used herein, the term "diastereomer" refers to a stereoisomer with two or more centers of chirality and whose molecules are not mirror images of one another. Diastereomers have different physical properties, e.g. melting points, boiling points, spectral properties, activities and reactivities. As used herein, the term "enantiomers" refers to two stereoisomers of a compound which are non-superimposable mirror images of one another.
As used herein, the term "pharmaceutically acceptable salts" refers to salts which are not biologically or otherwise undesirable. Pharmaceutically acceptable salts include both acid and base addition salts. As used herein, the term "prodrug" refers to a form or derivative of a compound which is metabolized in vivo, e.g., by biological fluids or enzymes by a subject after administration, into a pharmacologically active form of the compound in order to produce the desired pharmacological effect. Prodrugs are described e.g. in the Organic Chemistry of Drug Design and Drug Action by Richard B. Silverman, Academic Press, San Diego, 2004, Chapter 8 Prodrugs and Drug Delivery Systems, pp. 497-558. The term "pharmaceutically acceptable acid addition salt" refers to those pharmaceutically acceptable salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, carbonic acid, phosphoric acid, and organic acids selected from aliphatic, cycloaliphatic, aromatic, araliphatic, heterocyclic, carboxylic, and sulfonic classes of organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, gluconic acid, lactic acid, pyruvic acid, oxalic acid, malic acid, maleic acid, maloneic acid, succinic acid, fumaric acid, tartaric acid, citric acid, aspartic acid, ascorbic acid, glutamic acid, anthranilic acid, benzoic acid, cinnamic acid, mandelic acid, embonic acid, phenylacetic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, and salicyclic acid.
The term "pharmaceutically acceptable base addition salt" refers to those pharmaceutically acceptable salts formed with an organic or inorganic base. Examples of acceptable inorganic bases include sodium, potassium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, and aluminum salts. Salts derived from pharmaceutically acceptable organic nontoxic bases includes salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, 2-diethylaminoethanol, trimethamine, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, ethylenediamine, glucosamine, methylglucamine, theobromine, purines, piperizine, piperidine, N-ethylpiperidine, and polyamine resins.
As used herein, "hepatitis B virus" or "HBV" refers to a member of the Hepadnaviridae family having a small double-stranded DNA genome of approximately 3,200 base pairs and a tropism for liver cells. "HBV" includes hepatitis B virus that infects any of a variety of mammalian (e.g., human, non-human primate, etc.) and avian (duck, etc.) hosts. "HBV" includes any known HBV genotype, e.g., serotype A, B, C, D, E, F, and G; any HBV serotype or HBV subtype; any HBV isolate; HBV variants, e.g., HBeAg-negative variants, drug-resistant HBV variants (e.g., lamivudine-resistant variants; adefovir-resistant mutants; tenofovir-resistant mutants; entecavir-resistant mutants; etc.); and the like.
As used herein, "HBV DNA" refers to DNA material of HBV.
As used herein, "HBsAg" refers to hepatitis B surface antigen.
As used herein, "HBeAg" refers to hepatitis B e antigen. As used herein, "HBsAg inhibitor" refers to a compound that inhibits expression of the hepatitis B virus surface antigen. Unless otherwise indicated, an HBsAg inhibitor can include the compound in any pharmaceutically acceptable form, including any isomer (e.g., diastereomer or enantiomer), salt, solvate, polymorph, and the like. The term "interferon" or "IFN" as used herein means the family of highly homologous species-specific proteins that inhibit viral replication and cellular proliferation and modulate immune response. Human interferons are grouped into two classes; Type I, including alpha and beta-interferon, and Type II, which is represented by gamma-interferon only. Recombinant forms of each group have been developed and are commercially available. Subtypes in each group are based on antigenic/structural characteristics.
As used herein, the term "interferon" further includes conjugates, for instance interferon alfa (IFN-a) conjugates that can be prepared by coupling an interferon alfa to a water-soluble polymer. A non-limiting list of such polymers includes other polyalkylene o ide homopolymers such as polyethylene glycol (PEG), polypropylene glycols, polyoxyethylenated polyols, copolymers thereof and block copolymers thereof. As an alternative to polyalkylene oxide-based polymers, effectively non-antigenic materials such as dextran, polyv inylpyrrolidones, polyacrylamides, polyvinyl alcohols, carbohydrate-based polymers and the like can be used. Such interferon alfa-polymer conjugates are described in U.S. Pat. No. 4,766, 106, U.S. Pat. No. 4,917.888, European Patent Application No. 0 236 987, European Patent Application Nos. 0510 356, 0 593 868 and 0 809 996 (pegylated interferon alfa-2a) and International Publication No. WO 95/13090.
As used herein the term "pegylated" means covalent conjugates of one or more
polyethylene glycol (PEG) molecules and one or more alpha- or beta- type interferon molecules. Preferred conjugates for use in the formulations of the invention have one to four PEG molecules per interferon molecule, and more preferably, the conjugates are between a single PEG molecule and a single interferon molecule. The pegylated interferon may comprise a single positional isomer or a mixture of conjugate positional isomers, e.g, the PEG molecules are covalently attached to different amino acid residues on the individual interferon molecules. For example, U.S. Pat. No. 5,951,974 describes the preparation of mixtures of PEG-interferon alpha conjugate positional isomers in which some of the isomers are conjugates between PEG and a histidine residue of the interferon molecule, other isomers in the mixture are conjugates between PEG and an interferon lysine residue and still other isomers are conjugates between PEG and the amino terminus of the interferon molecule. As used herein, the "nucleos(t)ide analogue" refers to nucleosides which contain a nucleobase analogue and a sugar and nucleotides which contain a nucleobase analogue, a sugar and one to three phosphate groups. Nucleoside analogue drugs include but are not limited to deoxyadenosine analogues (Didanosine and Vidarabine), adenosine analogues (BCX4430), deoxycytidine analogues (Cytarabine, Emtricitabine, Lamivudine and Zalcitabine), guanosine and deoxyguanosine analogues (Abacavir, Aciclovir and Entecavir), thymidine and
deoxythymidine analogues (Stavudine, Telbivudine and Zidovudine) and deoxyuridine analogues (Idoxuridine and Trifluridine), and pyrimidine analogues (Clevudine). Nucleotide analogue drugs include Adefovir dipivoxil (ADV), Tenofovir disoproxil and Tenofovir disoproxil fumarate (TDF).
The term "Nucleobase" means any nitrogen-containing heterocyclic moiety capable of forming Watson-Crick-type hydrogen bonds and stacking interactions in pairing with a complementary nucleobase or nucleobase analogue (i.e., derivatives of nucleobases) when that nucleobase is incorporated into a polymeric structure. "Heterocyclic" refers to a molecule with a ring system in which one or more ring atom is a heteroatom, e.g., nitrogen, oxygen, or sulfur (i.e., not carbon).
The term "therapeutically effective amount" refers to an amount of a compound or molecule of the present invention that, when administered to a subject, (i) treats or prevents the particular disease, condition or disorder, (ii) attenuates, ameliorates or eliminates one or more symptoms of the particular disease, condition, or disorder, or (iii) prevents or delays the onset of one or more symptoms of the particular disease, condition or disorder described herein. The therapeutically effective amount will vary depending on the compound, the disease state being treated, the severity of the disease treated, the age and relative health of the subject, the route and form of administration, the judgment of the attending medical or veterinary practitioner, and other factors.The present invention relates to a pharmaceutical composition comprising an HBsAg inhibitor and an interferon, in a pharmaceutically acceptable carrier.
Compounds of the general formula (I) and (II) which contain one or several chiral centers can either be present as racemates, diastereomeric mixtures, or optically active single isomers. The racemates can be separated according to known methods into the enantiomers. Particularly, diastereomeric salts which can be separated by crystallization are formed from the racemic mixtures by reaction with an optically active acid such as e.g. D- or L-tartaric acid, mandelic acid, malic acid, lactic acid or camphorsulfonic acid. The present invention relates to a pharmaceutical composition comprising an HBsAg inhibitor, a nucleos(t)ide analogue and an interferon, in a pharmaceutically acceptable carrier. In one embodiment of the present invention, the "HBsAg inhibitor" is a compound of formula (I):
Figure imgf000013_0001
wherein
R1 is hydrogen, halogen, Ci-6alkyl, Ci-6alkylamino or Ci-6alkoxy;
R2 is hydrogen; halogen; Ci-6alkyl, which is unsubstituted or once, twice or three times
substituted by fluoro; Ci-6alkoxy, which is unsubstituted or once, twice or three times substituted by fluoro; cyano; C3-7cycloalkyl; hydroxy or phenyl-CxH2X-0-;
R3 is hydrogen;
halogen;
Ci-6alkyl, which is unsubstituted or once, twice or three times substituted by fluoro;
cyano;
pyrrolidinyl;
amino;
phenyl-CxH2x-N(Ci-6alkyl)-;
Ci-6alkoxycarbonylpiperazinyl;
or R7-0- , wherein R7 is hydrogen; Ci-6alkyl, which is unsubstituted or substituted with one to three substituents independently selected from fluoro, hydroxy and C2-6alkenyl; Ci- 6alkoxyCi-6alkyl; Ci-6alkoxyCi-6alkoxyCi-6alkyl; aminoCi-salkyl; Ci- 6alkylcarbonylaminoCi-8alkyl; Ci-6alkylsulfonylaminoCi-8alkyl; Ci-6alkylsulfanylCi-6alkyl; Ci-6alkylsulfonylCi-6alkyl; cyanoCi-6alkyl; C3-7cycloalkylCi-6alkyl; cyanoC3-7cycloalkylCi- 6alkyl; phenylCi-6alkyl; pyrrolidinylcarbonylCi-6alkyl; C2-6alkynyl; hydroxyCi-6alkylC2- 6alkynyl; aminoCi-6alkoxyCi-6alkyl; Ci-6alkylaminoCi-6alkoxyCi-6alkyl; diCi- 6alkylaminoCi-6alkoxyCi-6alkyl; carboxyCi-6alkyl; or Ci-6alkoxycarbonylaminoCi-8alkyl; heteroarylCi-6alkyl, wherein heteroaryl is N-containing monocyclic heteroaryl; or heterocycloalkylCi-6alkyl, wherein heterocycloalkyl is monocyclic heterocycloalkyl; R4 is hydrogen, halogen, Ci-6alkyl, cyano or Ci-6alkoxy;
R5 is hydrogen or Ci-6alkyl;
R6 is hydrogen; Ci-6alkyl, which is unsubstituted or once, twice or three times substituted by fluoro; C3-7cycloalkyl, which is unsubstituted or once, twice or three times substituted by fluoro or Ci-6alkyl; or phenyl-CxH2X-;
x is 1-6;
or pharmaceutically acceptable salts, or enantiomers thereof.
Compounds of formula (I), Compounds 1A to 3 A and Compounds IB to 3B can be obtained according to the synthetic procedures disclosed in WO 2015/113990. Particularly, the "HBsAg inhibitor" of the present invention relates to
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(-)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(+)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine- 3-carboxylic acid;
(-)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine-3- carboxylic acid;
(+)-6-iert-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(-)-6-ieri-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
or any other compound disclosed in WO 2015/113990;
or pharmaceutically acceptable salt, enantiomer or diastereomer thereof.
In another embodiment of the present invention, the "HBsAg inhibitor" is a compound of formula (II):
Figure imgf000015_0001
wherein
R8, R9, R10 and R11 are independently selected from hydrogen, halogen, Ci-6alkyl, diCi- 6alkylamino, cyano, N-containing monocyclic heterocycloalkyl and OR14, wherein R14 is hydrogen; Ci-6alkyl; or Ci-6alkyl which is substituted once or more times by fluoro,
C3-7cycloalkyl, phenyl, hydroxyl, amino, Ci-6alkoxy, Ci-6alkylsulfanyl, Ci-6alkylsulfonyl, diCi-6alkylamino, Ci-6alkoxycarbonylamino, monocyclic heterocycloalkyl, pyrazoyl or imidazolyl;
R12 is hydrogen or Chalky;
R13 is hydrogen, Ci-6alkyl, phenyl-CxH2X-, Ci-6alkylcarbonyl, Ci-6alkylsulfonyl, benzoyl or monocyclic heterocycloalkyl, wherein
x is 1-6;
W is a bond, CyH2yC(R15)(R16)CzH2z or CyH2yCH(R15)CH(R16)CzH2z, wherein
R15 and R16 are independently selected from hydrogen, fluoro, hydroxy and Ci-6alkyl, y is 0-6;
z is 0-6;
X is a bond; O; S; S(0)2; or NR17, wherein R17 is hydrogen, C1-6alkyl;
or R13 and R17, together with the nitrogen to which they are attached, form monocyclic heterocycloalkyl;
or pharmaceutically acceptable salts, or enantiomers thereof.
Compounds of formula (II), Compounds 4A to 6 A and Compounds 4B to 6B can be obtained according to the synthetic procedures disclosed in WO 2016/071215. Particularly, the "HBsAg inhibitor" of the present invention relates to
(+)-10-methoxy-6-(2-methoxy-l, l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid; (-)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(+)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(-)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(+)- 10-chloro-6-(2-methoxy- 1 , 1 -dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(-)-10-chloro-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
or pharmaceutically acceptable salt, enantiomer or diastereomer thereof.
Unless otherwise indicated, an HBsAg inhibitor can include any one of the compounds in any pharmaceutically acceptable form, including any isomer (e.g., diastereomer or enantiomer), salt, solvate, polymorph, and the like. In one embodiment of the present invention, suitable nucleos(t)ide analogues of the present invention may be used include nucleoside analogue drugs and nucleotide analogue drugs.
Nucleoside analogue drugs include but are not limited to deoxyadenosine analogues (Didanosine and Vidarabine), adenosine analogues (BCX4430), deoxycytidine analogues (Cytarabine, Emtricitabine, Lamivudine and Zalcitabine), guanosine and deoxyguanosine analogues
(Abacavir, Aciclovir and Entecavir), thymidine and deoxythymidine analogues (Stavudine, Telbivudine and Zidovudine), deoxyuridine analogues (Idoxuridine and Trifluridine), and pyrimidine analogues (Clevudine). Nucleotide analogue drugs include but are not limited to Adefovir dipivoxil (ADV), Tenofovir disoproxil and Tenofovir disoproxil fumarate (TDF).
In a particular embodiment of the present invention, the "nucleos(t)ide analogue" is Lamivudine, Adefovir dipivoxil, Entecavir, Telbivudine, Clevudine, Tenofovir disoproxil or Tenofovir disoproxil fumarate. More particularly, the "nucleos(t)ide analogue" is Entecavir.
Suitable interferons in accordance with the present invention may be any naturally- occurring or recombinant interferon alfa, beta or gamma known to those skilled in the art.
Natural and recombinant alfa-interferons that may be used include interferon alfa-nl (e.g., Surniferon®, Sumitomo), interferon alfa-n3, interferon alfa-2a (Roferon A®), interferon alfa-2b (Intron A®), interferon alfa-2c (Berofor®, Boehringer Ingelheim, Inc.), and consensus interferon (Infergen®, InterMune, Inc.). Preferred interferons are interferon alfa-2a and interferon alfa-2b.
In one embodiment of the present invention, suitable interferons in accordance with the present invention include, but are not limited to, recombinant interferon alfa-2b such as Intron A®; recombinant interferon alfa-2a such as Roferon A®; recombinant interferon beta- lb such as Betaferon® (Bayer AG); recombinant interferon beta-la such as Avonex® (Biogen Canada Inc.) and Rebif® (Merck KGaA); and recombinant interferon gamma- lb such as Imukin® (Boehringer Ingelheim). The use of recombinant interferon alfa-2a or alfa-2b is preferred. The terms "interferon alfa-2a", "interferon alfa-2b" and "interferon beta- la" are further intended to include "pegylated" analogs meaning polyethylene glycol modified conjugates of interferon alfa-2a such as Pegasys®, interferon alfa-2b such as Peglntron® and Pai Ge Bin, and interferon beta- la such as Plegridy® (Biogen Canada Inc.). The use of pegylated recombinant interferon alfa-2a or alfa 2b is preferred. In one embodiment of the present invention, the "interferon" is a non-conjugated interferon alfa or a pegylated conjugate thereof.
More specifically, the "interferon" is selected from the group consisting of interferon alfa- 2a such as Roferon A®, interferon alfa-2b such as Intron A®, pegylated interferon alfa-2a such as Pegasys® and pegylated interferon alfa-2b such as Peglntron® and Pai Ge Bin respectively. Obtaining and isolating interferon alfa from natural or recombinant sources is well known
(Pestka, Arch. Biochem. Biophys. 221, 1 (1983); European Pat. No. 043980.
Further more specifically, the "interferon" is a non-conjugated interferon alfa-2a (for instance Roferon A®) or a pegylated alfa- type interferon (for instance Pegasys®):
In yet another embodiment the above pegylated alfa-type interferon is an alfa-2a interferon. In one embodiment of the present invention, the pharmaceutical composition comprises an
HBsAg viral expression inhibitor, a nucleos(t)ide analogue and an interferon, wherein the
HBsAg inhibitor, the nucleos(t)ide analogue and the interferon are independently selected from Table 1. Table 1: List of HBsAg inhibitors, interferons and nucleos(t)ide analogues
Figure imgf000018_0001
Figure imgf000019_0001
Figure imgf000020_0001
Figure imgf000021_0001
More particularly, the present invention relates to a pharmaceutical composition
comprising an HBsAg inhibitor, a nucleos(t)ide analogue and an interferon which is selected from any one of the following combinations:
Compound 1A, Compound 13 and Compound 7; Compound 1A, Compound 13 and Compound 8; Compound 1A, Compound 13 and Compound 9; Compound 1A, Compound 13 and Compound 10; Compound 1A, Compound 13 and Compound 11; Compound 1A, Compound 13 and Compound 12; Compound IB, Compound 13 and Compound 7; Compound IB, Compound 13 and Compound 8; Compound IB, Compound 13 and Compound 9;
Compound IB, Compound 13 and Compound 10; Compound IB, Compound 13 and Compound 11; Compound IB, Compound 13 and Compound 12; Compound 2A, Compound 13 and Compound 7; Compound 2 A, Compound 13 and Compound 8; Compound 2A, Compound 13 and Compound 9; Compound 2A, Compound 13 and Compound 10; Compound 2A, Compound 13 and Compound 11; Compound 2A, Compound 13 and Compound 12; Compound 2B, Compound 13 and Compound 7; Compound 2B, Compound 13 and Compound 8; Compound 2B, Compound 13 and Compound 9; Compound 2B, Compound 13 and Compound 10; Compound 2B, Compound 13 and Compound 11; Compound 2B, Compound 13 and Compound 12; Compound 3 A, Compound 13 and Compound 7; Compound 3 A, Compound 13 and Compound 8; Compound 3A, Compound 13 and Compound 9; Compound 3A, Compound 13 and Compound 10; Compound 3A, Compound 13 and Compound 11; Compound 3A, Compound 13 and Compound 12; Compound 3B, Compound 13 and Compound 7; Compound 3B, Compound 13 and Compound 8; Compound 3B, Compound 13 and Compound 9; Compound 3B, Compound 13 and Compound 10; Compound 3B, Compound 13 and Compound 11; Compound 3B, Compound 13 and Compound 12; Compound 4A, Compound 13 and Compound 7; Compound 4A, Compound 13 and Compound 8; Compound 4A, Compound 13 and Compound 9; Compound 4A, Compound 13 and Compound 10; Compound 4A, Compound 13 and Compound 11; Compound 4A, Compound 13 and Compound 12; Compound 4B, Compound 13 and Compound 7; Compound 4B, Compound 13 and Compound 8; Compound 4B, Compound 13 and Compound 9; Compound 4B, Compound 13 and Compound 10; Compound 4B, Compound 13 and Compound 11; Compound 4B, Compound 13 and Compound 12; Compound 5 A, Compound 13 and Compound 7; Compound 5 A, Compound 13 and Compound 8; Compound 5A, Compound 13 and Compound 9; Compound 5A, Compound 13 and Compound 10; Compound 5A, Compound 13 and Compound 11; Compound 5A, Compound 13 and Compound 12; Compound 5B, Compound 13 and Compound 7; Compound 5B, Compound 13 and Compound 8; Compound 5B, Compound 13 and Compound 9; Compound 5B, Compound 13 and Compound 10; Compound 5B, Compound 13 and Compound 11; Compound 5B, Compound 13 and Compound 12; Compound 6A, Compound 13 and Compound 7; Compound 6 A, Compound 13 and Compound 8; Compound 6 A, Compound 13 and Compound 9; Compound 6A, Compound 13 and Compound 10; Compound 6A, Compound 13 and Compound 11; Compound 6A, Compound 13 and Compound 12; Compound 6B, Compound 13 and Compound 7; Compound 6B, Compound 13 and Compound 8; Compound 6B, Compound 13 and Compound 9; Compound 6B, Compound 13 and Compound 10; Compound 6B, Compound 13 and Compound 11; Compound 6B, Compound 13 and Compound 12; Compound 1A, Compound 14 and Compound 7; Compound 1A, Compound 14 and Compound 8; Compound 1A, Compound 14 and Compound 9; Compound 1A, Compound 14 and Compound 10; Compound 1A, Compound 14 and Compound 11; Compound 1A, Compound 14 and Compound 12; Compound IB, Compound 14 and Compound 7; Compound IB, Compound 14 and Compound 8; Compound IB, Compound 14 and Compound 9; Compound IB, Compound 14 and Compound 10; Compound IB, Compound 14 and Compound 11; Compound IB, Compound 14 and Compound 12; Compound 2A, Compound 14 and Compound 7; Compound 2A, Compound 14 and Compound 8; Compound 2A, Compound 14 and Compound 9; Compound 2A, Compound 14 and Compound 10; Compound 2A, Compound 14 and Compound 11; Compound 2A, Compound 14 and Compound 12; Compound 2B, Compound 14 and Compound 7; Compound 2B, Compound 14 and Compound 8; Compound 2B, Compound 14 and Compound 9; Compound 2B, Compound 14 and Compound 10; Compound 2B, Compound 14 and Compound 11; Compound 2B, Compound 14 and Compound 12; Compound 3A, Compound 14 and Compound 7; Compound 3 A, Compound 14 and Compound 8; Compound 3 A, Compound 14 and Compound 9; Compound 3 A, Compound 14 and Compound 10; Compound 3A, Compound 14 and Compound 11; Compound 3A, Compound 14 and Compound 12; Compound 3B, Compound 14 and Compound 7; Compound 3B, Compound 14 and Compound 8; Compound 3B, Compound 14 and Compound 9; Compound 3B, Compound 14 and Compound 10; Compound 3B, Compound 14 and Compound 11; Compound 3B, Compound 14 and Compound 12; Compound 4A, Compound 14 and Compound 7; Compound 4A, Compound 14 and Compound 8; Compound 4A, Compound 14 and Compound 9; Compound 4A, Compound 14 and Compound 10; Compound 4A, Compound 14 and Compound 11; Compound 4A, Compound 14 and Compound 12; Compound 4B, Compound 14 and Compound 7; Compound 4B, Compound 14 and Compound 8; Compound 4B, Compound 14 and Compound 9; Compound 4B, Compound 14 and Compound 10; Compound 4B, Compound 14 and Compound 11; Compound 4B, Compound 14 and Compound 12; Compound 5A, Compound 14 and Compound 7; Compound 5 A, Compound 14 and Compound 8; Compound 5 A, Compound 14 and Compound 9; Compound 5 A, Compound 14 and Compound 10; Compound 5A, Compound 14 and Compound 11; Compound 5A, Compound 14 and Compound 12; Compound 5B, Compound 14 and Compound 7; Compound 5B, Compound 14 and Compound 8; Compound 5B, Compound 14 and Compound 9; Compound 5B, Compound 14 and Compound 10; Compound 5B, Compound 14 and Compound 11; Compound 5B, Compound 14 and Compound 12; Compound 6A, Compound 14 and Compound 7; Compound 6A, Compound 14 and Compound 8; Compound 6 A, Compound 14 and Compound 9; Compound 6A, Compound 14 and Compound 10; Compound 6A, Compound 14 and Compound 11; Compound 6A, Compound 14 and Compound 12; Compound 6B, Compound 14 and Compound 7; Compound 6B, Compound 14 and Compound 8; Compound 6B, Compound 14 and Compound 9; Compound 6B, Compound 14 and Compound 10; Compound 6B, Compound 14 and Compound 11; Compound 6B, Compound 14 and Compound 12; Compound 1A, Compound 15 and Compound 7; Compound 1A, Compound 15 and Compound 8; Compound 1A, Compound 15 and Compound 9; Compound 1A, Compound 15 and Compound 10; Compound 1A, Compound 15 and Compound 11; Compound 1A, Compound 15 and Compound 12; Compound IB, Compound 15 and Compound 7; Compound IB, Compound 15 and Compound 8; Compound IB, Compound 15 and Compound 9; Compound IB, Compound 15 and Compound 10; Compound IB, Compound 15 and Compound 11; Compound IB, Compound 15 and Compound 12; Compound 2A, Compound 15 and Compound 7; Compound 2A, Compound 15 and Compound 8; Compound 2A, Compound 15 and Compound 9; Compound 2A, Compound 15 and Compound 10; Compound 2A, Compound 15 and Compound 11; Compound 2A, Compound 15 and Compound 12; Compound 2B, Compound 15 and Compound 7; Compound 2B, Compound 15 and Compound 8; Compound 2B, Compound 15 and Compound 9; Compound 2B, Compound 15 and Compound 10; Compound 2B, Compound 15 and Compound 11; Compound 2B, Compound 15 and Compound 12; Compound 3A, Compound 15 and Compound 7; Compound 3 A, Compound 15 and Compound 8; Compound 3 A, Compound 15 and Compound 9; Compound 3 A, Compound 15 and Compound 10; Compound 3A, Compound 15 and Compound 11; Compound 3A, Compound 15 and Compound 12; Compound 3B, Compound 15 and Compound 7; Compound 3B, Compound 15 and Compound 8; Compound 3B, Compound 15 and Compound 9; Compound 3B, Compound 15 and Compound 10; Compound 3B, Compound 15 and Compound 11; Compound 3B, Compound 15 and Compound 12; Compound 4A, Compound 15 and Compound 7; Compound 4A, Compound 15 and Compound 8; Compound 4A, Compound 15 and Compound 9; Compound 4A, Compound 15 and Compound 10; Compound 4A, Compound 15 and Compound 11; Compound 4A, Compound 15 and Compound 12; Compound 4B, Compound 15 and Compound 7; Compound 4B, Compound 15 and Compound 8; Compound 4B, Compound 15 and Compound 9; Compound 4B, Compound 15 and Compound 10; Compound 4B, Compound 15 and Compound 11; Compound 4B, Compound 15 and Compound 12; Compound 5A, Compound 15 and Compound 7; Compound 5 A, Compound 15 and Compound 8; Compound 5 A, Compound 15 and Compound 9; Compound 5 A, Compound 15 and Compound 10; Compound 5A, Compound 15 and Compound 11; Compound 5A, Compound 15 and Compound 12; Compound 5B, Compound 15 and Compound 7; Compound 5B, Compound 15 and Compound 8; Compound 5B, Compound 15 and Compound 9; Compound 5B, Compound 15 and Compound 10; Compound 5B, Compound 15 and Compound 11; Compound 5B, Compound
15 and Compound 12;Compound 6A, Compound 15 and Compound 7; Compound 6A, Compound 15 and Compound 8; Compound 6 A, Compound 15 and Compound 9; Compound 6A, Compound 15 and Compound 10; Compound 6A, Compound 15 and Compound 11; Compound 6A, Compound 15 and Compound 12; Compound 6B, Compound 15 and Compound 7; Compound 6B, Compound 15 and Compound 8; Compound 6B, Compound 15 and Compound 9; Compound 6B, Compound 15 and Compound 10; Compound 6B, Compound 15 and Compound 11; Compound 6B, Compound 15 and Compound 12; Compound 1A, Compound 16 and Compound 7; Compound 1A, Compound 16 and Compound 8; Compound 1A, Compound 16 and Compound 9; Compound 1A, Compound 16 and Compound 10; Compound 1A, Compound 16 and Compound 11; Compound 1A, Compound 16 and Compound 12; Compound IB, Compound 16 and Compound 7; Compound IB, Compound 16 and Compound 8; Compound IB, Compound 16 and Compound 9; Compound IB, Compound 16 and Compound 10; Compound IB, Compound 16 and Compound 11; Compound IB, Compound 16 and Compound 12; Compound 2A, Compound 16 and Compound 7; Compound 2A, Compound 16 and Compound 8; Compound 2A, Compound 16 and Compound 9; Compound 2A, Compound 16 and Compound 10; Compound 2A, Compound 16 and Compound 11; Compound 2A, Compound 16 and Compound 12; Compound 2B, Compound 16 and Compound 7; Compound 2B, Compound 16 and Compound 8; Compound 2B, Compound 16 and Compound 9; Compound 2B, Compound 16 and Compound 10; Compound 2B, Compound 16 and Compound 11; Compound 2B, Compound 16 and Compound 12; Compound 3A, Compound 16 and Compound 7; Compound 3 A, Compound 16 and Compound 8; Compound 3 A, Compound 16 and Compound 9; Compound 3 A, Compound 16 and Compound 10; Compound 3A, Compound 16 and Compound 11; Compound 3A, Compound 16 and Compound 12; Compound 3B, Compound 16 and Compound 7; Compound 3B, Compound 16 and Compound 8; Compound 3B, Compound 16 and Compound 9; Compound 3B, Compound 16 and Compound 10; Compound 3B, Compound 16 and Compound 11; Compound 3B, Compound
16 and Compound 12; Compound 4A, Compound 16 and Compound 7; Compound 4A, Compound 16 and Compound 8; Compound 4A, Compound 16 and Compound 9; Compound 4A, Compound 16 and Compound 10; Compound 4A, Compound 16 and Compound 11; Compound 4A, Compound 16 and Compound 12; Compound 4B, Compound 16 and Compound 7; Compound 4B, Compound 16 and Compound 8; Compound 4B, Compound 16 and Compound 9; Compound 4B, Compound 16 and Compound 10; Compound 4B, Compound 16 and Compound 11; Compound 4B, Compound 16 and Compound 12; Compound 5A, Compound 16 and Compound 7; Compound 5 A, Compound 16 and Compound 8; Compound 5 A, Compound 16 and Compound 9; Compound 5 A, Compound 16 and Compound 10; Compound 5A, Compound 16 and Compound 11; Compound 5A, Compound 16 and Compound 12; Compound 5B, Compound 16 and Compound 7; Compound 5B, Compound 16 and Compound 8; Compound 5B, Compound 16 and Compound 9; Compound 5B, Compound 16 and Compound 10; Compound 5B, Compound 16 and Compound 11; Compound 5B, Compound
16 and Compound 12; Compound 6A, Compound 16 and Compound 7; Compound 6A, Compound 16 and Compound 8; Compound 6 A, Compound 16 and Compound 9; Compound 6A, Compound 16 and Compound 10; Compound 6A, Compound 16 and Compound 11; Compound 6A, Compound 16 and Compound 12; Compound 6B, Compound 16 and Compound 7; Compound 6B, Compound 16 and Compound 8; Compound 6B, Compound 16 and Compound 9; Compound 6B, Compound 16 and Compound 10; Compound 6B, Compound 16 and Compound 11; Compound 6B, Compound 16 and Compound 12; Compound 1A, Compound 17 and Compound 7; Compound 1A, Compound 17 and Compound 8; Compound 1A, Compound 17 and Compound 9; Compound 1A, Compound 17 and Compound 10; Compound 1A, Compound 17 and Compound 11; Compound 1A, Compound 17 and Compound 12; Compound IB, Compound 17 and Compound 7; Compound IB, Compound 17 and Compound 8; Compound IB, Compound 17 and Compound 9; Compound IB, Compound 17 and Compound 10; Compound IB, Compound 17 and Compound 11; Compound IB, Compound
17 and Compound 12; Compound 2A, Compound 17 and Compound 7; Compound 2A, Compound 17 and Compound 8; Compound 2A, Compound 17 and Compound 9; Compound 2A, Compound 17 and Compound 10; Compound 2A, Compound 17 and Compound 11; Compound 2A, Compound 17 and Compound 12; Compound 2B, Compound 17 and Compound 7; Compound 2B, Compound 17 and Compound 8; Compound 2B, Compound 17 and Compound 9; Compound 2B, Compound 17 and Compound 10; Compound 2B, Compound 17 and Compound 11; Compound 2B, Compound 17 and Compound 12; Compound 3A, Compound 17 and Compound 7; Compound 3 A, Compound 17 and Compound 8; Compound 3 A, Compound 17 and Compound 9; Compound 3 A, Compound 17 and Compound 10; Compound 3A, Compound 17 and Compound 11; Compound 3A, Compound 17 and Compound 12; Compound 3B, Compound 17 and Compound 7; Compound 3B, Compound 17 and Compound 8; Compound 3B, Compound 17 and Compound 9; Compound 3B, Compound 17 and Compound 10; Compound 3B, Compound 17 and Compound 11; Compound 3B, Compound 17 and Compound 12; Compound 4A, Compound 17 and Compound 7; Compound 4A, Compound 17 and Compound 8; Compound 4A, Compound 17 and Compound 9; Compound 4A, Compound 17 and Compound 10; Compound 4A, Compound 17 and Compound 11; Compound 4A, Compound 17 and Compound 12; Compound 4B, Compound 17 and Compound 7; Compound 4B, Compound 17 and Compound 8; Compound 4B, Compound 17 and Compound 9; Compound 4B, Compound 17 and Compound 10; Compound 4B, Compound 17 and Compound 11; Compound 4B, Compound 17 and Compound 12; Compound 5A, Compound 17 and Compound 7; Compound 5 A, Compound 17 and Compound 8; Compound 5 A, Compound 17 and Compound 9; Compound 5 A, Compound 17 and Compound 10; Compound 5A, Compound 17 and Compound 11; Compound 5A, Compound 17 and Compound 12; Compound 5B, Compound 17 and Compound 7; Compound 5B, Compound 17 and Compound 8; Compound 5B, Compound 17 and Compound 9; Compound 5B, Compound 17 and Compound 10; Compound 5B, Compound 17 and Compound 11; Compound 5B, Compound
17 and Compound 12; Compound 6A, Compound 17 and Compound 7; Compound 6A, Compound 17 and Compound 8; Compound 6 A, Compound 17 and Compound 9; Compound
6A, Compound 17 and Compound 10; Compound 6A, Compound 17 and Compound 11; Compound 6A, Compound 17 and Compound 12; Compound 6B, Compound 17 and Compound 7; Compound 6B, Compound 17 and Compound 8; Compound 6B, Compound 17 and Compound 9; Compound 6B, Compound 17 and Compound 10; Compound 6B, Compound 17 and Compound 11; Compound 6B, Compound 17 and Compound 12; Compound 1A, Compound 18 and Compound 7; Compound 1A, Compound 18 and Compound 8; Compound 1A, Compound 18 and Compound 9; Compound 1A, Compound 18 and Compound 10; Compound 1A, Compound 18 and Compound 11; Compound 1A, Compound 18 and Compound 12; Compound IB, Compound 18 and Compound 7; Compound IB, Compound 18 and Compound 8; Compound IB, Compound 18 and Compound 9; Compound IB, Compound 18 and Compound 10; Compound IB, Compound 18 and Compound 11; Compound IB, Compound
18 and Compound 12; Compound 2A, Compound 18 and Compound 7; Compound 2A, Compound 18 and Compound 8; Compound 2A, Compound 18 and Compound 9; Compound 2A, Compound 18 and Compound 10; Compound 2A, Compound 18 and Compound 11; Compound 2A, Compound 18 and Compound 12; Compound 2B, Compound 18 and Compound 7; Compound 2B, Compound 18 and Compound 8; Compound 2B, Compound 18 and Compound 9; Compound 2B, Compound 18 and Compound 10; Compound 2B, Compound 18 and Compound 11; Compound 2B, Compound 18 and Compound 12; Compound 3A, Compound 18 and Compound 7; Compound 3 A, Compound 18 and Compound 8; Compound 3 A, Compound 18 and Compound 9; Compound 3 A, Compound 18 and Compound 10; Compound 3 A, Compound 18 and Compound 11; Compound 3 A, Compound 18 and Compound 12; Compound 3B, Compound 18 and Compound 7; Compound 3B, Compound 18 and Compound 8; Compound 3B, Compound 18 and Compound 9; Compound 3B, Compound 18 and Compound 10; Compound 3B, Compound 18 and Compound 11; Compound 3B, Compound
18 and Compound 12; Compound 4A, Compound 18 and Compound 7; Compound 4A, Compound 18 and Compound 8; Compound 4A, Compound 18 and Compound 9; Compound 4A, Compound 18 and Compound 10; Compound 4A, Compound 18 and Compound 11; Compound 4A, Compound 18 and Compound 12; Compound 4B, Compound 18 and Compound 7; Compound 4B, Compound 18 and Compound 8; Compound 4B, Compound 18 and Compound 9; Compound 4B, Compound 18 and Compound 10; Compound 4B, Compound 18 and Compound 11; Compound 4B, Compound 18 and Compound 12; Compound 5A, Compound 18 and Compound 7; Compound 5 A, Compound 18 and Compound 8; Compound 5 A, Compound 18 and Compound 9; Compound 5 A, Compound 18 and Compound 10; Compound 5 A, Compound 18 and Compound 11; Compound 5 A, Compound 18 and Compound 12; Compound 5B, Compound 18 and Compound 7; Compound 5B, Compound 18 and Compound 8; Compound 5B, Compound 18 and Compound 9; Compound 5B, Compound 18 and Compound 10; Compound 5B, Compound 18 and Compound 11; Compound 5B, Compound 18 and Compound 12; Compound 6A, Compound 18 and Compound 7; Compound 6A, Compound 18 and Compound 8; Compound 6 A, Compound 18 and Compound 9; Compound 6A, Compound 18 and Compound 10; Compound 6A, Compound 18 and Compound 11; Compound 6A, Compound 18 and Compound 12; Compound 6B, Compound 18 and Compound 7; Compound 6B, Compound 18 and Compound 8; Compound 6B, Compound 18 and Compound 9; Compound 6B, Compound 18 and Compound 10; Compound 6B, Compound 18 and Compound 11; Compound 6B, Compound 18 and Compound 12; Compound 1A, Compound 19 and Compound 7; Compound 1A, Compound 19 and Compound 8; Compound 1A, Compound 19 and Compound 9; Compound 1A, Compound 19 and Compound 10; Compound 1A, Compound 19 and Compound 11; Compound 1A, Compound 19 and Compound 12; Compound IB, Compound 19 and Compound 7; Compound IB, Compound 19 and Compound 8; Compound IB, Compound 19 and Compound 9; Compound IB, Compound 19 and Compound 10; Compound IB, Compound 19 and Compound 11; Compound IB, Compound
19 and Compound 12; Compound 2A, Compound 19 and Compound 7; Compound 2A, Compound 19 and Compound 8; Compound 2A, Compound 19 and Compound 9; Compound 2A, Compound 19 and Compound 10; Compound 2A, Compound 19 and Compound 11; Compound 2A, Compound 19 and Compound 12; Compound 2B, Compound 19 and Compound 7; Compound 2B, Compound 19 and Compound 8; Compound 2B, Compound 19 and Compound 9; Compound 2B, Compound 19 and Compound 10; Compound 2B, Compound 19 and Compound 11; Compound 2B, Compound 19 and Compound 12; Compound 3A, Compound 19 and Compound 7; Compound 3 A, Compound 19 and Compound 8; Compound 3 A, Compound 19 and Compound 9; Compound 3 A, Compound 19 and Compound 10; Compound 3A, Compound 19 and Compound 11; Compound 3A, Compound 19 and Compound 12; Compound 3B, Compound 19 and Compound 7; Compound 3B, Compound 19 and Compound 8; Compound 3B, Compound 19 and Compound 9; Compound 3B, Compound 19 and Compound 10; Compound 3B, Compound 19 and Compound 11; Compound 3B, Compound 19 and Compound 12; Compound 4A, Compound 19 and Compound 7; Compound 4A, Compound 19 and Compound 8; Compound 4A, Compound 19 and Compound 9; Compound 4A, Compound 19 and Compound 10; Compound 4A, Compound 19 and Compound 11; Compound 4A, Compound 19 and Compound 12; Compound 4B, Compound 19 and Compound 7; Compound 4B, Compound 19 and Compound 8; Compound 4B, Compound 19 and Compound 9; Compound 4B, Compound 19 and Compound 10; Compound 4B, Compound 19 and Compound 11; Compound 4B, Compound 19 and Compound 12; Compound 5A, Compound 19 and Compound 7; Compound 5 A, Compound 19 and Compound 8; Compound 5 A, Compound 19 and Compound 9; Compound 5 A, Compound 19 and Compound 10;
Compound 5A, Compound 19 and Compound 11; Compound 5A, Compound 19 and Compound 12; Compound 5B, Compound 19 and Compound 7; Compound 5B, Compound 19 and Compound 8; Compound 5B, Compound 19 and Compound 9; Compound 5B, Compound 19 and Compound 10; Compound 5B, Compound 19 and Compound 11; Compound 5B, Compound 19 and Compound 12;Compound 6A, Compound 19 and Compound 7; Compound 6A, Compound 19 and Compound 8; Compound 6 A, Compound 19 and Compound 9; Compound 6A, Compound 19 and Compound 10; Compound 6A, Compound 19 and Compound 11; Compound 6A, Compound 19 and Compound 12; Compound 6B, Compound 19 and Compound 7; Compound 6B, Compound 19 and Compound 8; Compound 6B, Compound 19 and Compound 9; Compound 6B, Compound 19 and Compound 10; Compound 6B, Compound 19 and Compound 11; and Compound 6B, Compound 19 and Compound 12; in a pharmaceutically acceptable carrier. Anyone of Compounds 1A to 6 A, IB to 6B and 7 to 11 of the aforementioned combinations can be replaced by its corresponding pharmaceutically acceptable salt, enantiomer or diastereomer, which is another aspect of this invention.
More particularly, the present invention relates to a pharmaceutical composition comprising an HBsAg inhibitor and an interferon which is selected from any one of the following combinations:
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Roferon A®;
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Intron A®;
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegasys®;
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegintron®;
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pai Ge Bin;
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and wIFN;
(-)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Roferon A®;
(-)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Intron A®;
(-)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegasys®;
(-)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegintron®;
(-)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pai Ge Bin;
(-)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and wIFN;
(+)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine- 3-carboxylic acid, Entecavir and Roferon A®; (+)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine- 3-carboxylic acid, Entecavir and Intron A®;
(+)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine- 3-carboxylic acid, Entecavir and Pegasys®;
(+)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine- 3-carboxylic acid, Entecavir and Pegintron®;
(+)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine- 3-carboxylic acid, Entecavir and Pai Ge Bin;
(+)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine- 3-carboxylic acid, Entecavir and wIFN;
(-)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine-3- carboxylic acid, Entecavir and Roferon A®;
(-)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine-3- carboxylic acid, Entecavir and Intron A®;
(-)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine-3- carboxylic acid, Entecavir and Pegasys®;
(-)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine-3- carboxylic acid, Entecavir and Pegintron®;
(-)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine-3- carboxylic acid, Entecavir and Pai Ge Bin;
(-)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine-3- carboxylic acid, Entecavir and wIFN;
(+)-6-iert-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Roferon A®;
(+)-6-ieri-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Intron A®;
(+)-6-iert-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegasys®;
(+)-6-iert-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegintron®;
(+)-6-iert-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pai Ge Bin; (+)-6-iert-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- di ydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and wIFN;
(-)-6-iert-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Roferon A®;
(-)-6-ieri-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Intron A®;
(-)-6-ieri-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegasys®;
(-)-6-ieri-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegintron®;
(-)-6-iert-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pai Ge Bin;
(-)-6-ieri-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and wIFN;
(+)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Roferon A®;
(+)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Intron A®;
(+)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegasys®;
(+)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegintron®;
(+)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pai Ge Bin;
(+)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and wIFN;
(-)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Roferon A®;
(-)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Intron A®;
(-)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegasys®; (-)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- di ydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegintron®;
(-)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- di ydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pai Ge Bin;
(-)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and wIFN;
(+)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Roferon A®;
(+)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Intron A®;
(+)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegasys®;
(+)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegintron®;
(+)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pai Ge Bin;
(+)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and wIFN;
(-)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Roferon A®;
(-)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Intron A®;
(-)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegasys®;
(-)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegintron®;
(-)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pai Ge Bin;
(-)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and wIFN;
(+)- 10-chloro-6-(2-methoxy- 1 , 1 -dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Roferon A®; (+)- 10-chloro-6-(2-methoxy- 1 , 1 -dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Intron A®;
(+)- 10-chloro-6-(2-methoxy- 1 , 1 -dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegasys®;
(+)- 10-chloro-6-(2-methoxy- 1 , 1 -dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegintron®;
(+)- 10-chloro-6-(2-methoxy- 1 , 1 -dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pai Ge Bin;
(+)- 10-chloro-6-(2-methoxy- 1 , 1 -dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and wIFN;
(-)-10-chloro-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Roferon A®;
(-)-10-chloro-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Intron A®;
(-)-10-chloro-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegasys®;
(-)-10-chloro-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegintron®;
(-)-10-chloro-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pai Ge Bin; and
(-)-10-chloro-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and wIFN;
in a pharmaceutically acceptable carrier.
In another particular embodiment of the present invention, the nucleos(t)ide analogue used in the combination is Lamivudine, Adefovir dipivoxil, Telbivudine, Clevudine, Tenofovir disoproxil or Tenofovir disoproxil fumarate.
In one embodiment of the present invention, the pharmaceutical composition consists of an HBsAg inhibitor, a nucleos(t)ide analogue and an interferon, in a pharmaceutically acceptable carrier. More particularly, the composition consists of:
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegasys®; or
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and wIFN; in a pharmaceutically acceptable carrier.
In another embodiment of the present invention, other interferons, nucleos(t)ide analogues or HBsAg inhibitors can also be used in the pharmaceutical composition including small molecules or large molecules. Examples of other interferons include, but not limited to,
Surniferon, Sumitomo, Berofor, Infergen, Multiferon, Rebif, Avonex, Cinnovex, Betaseron / Betaferon, Imukin, Plegridy, Actimmune, Reiferon Retard and Pegetron.
Typical dosages of an HBsAg inhibitor , a nucleos(t)ide analogue and/or an interferon can be in the ranges recommended by the manufacturer, and where indicated by in vitro responses in an animal model, can be reduced by up to about one order of magnitude concentration or amount. Thus, the actual dosage will depend upon the judgment of the physician, the condition of the patient, and the effectiveness of the therapeutic method based on the in vitro responsiveness of the appropriate animal models.
Another embodiment of the present invention relates to a method for manufacturing a medicament for treatment or prophylaxis of hepatitis B virus infection, characterized in that an HBsAg inhibitor, a nucleos(t)ide analogue and an interferon are used in the medicament.
A further embodiment of the present invention relates to the method for manufacturing a medicament for treatment or prophylaxis of hepatitis B virus infection, characterized in that the HBsAg inhibitor, the nucleos(t)ide analogue and the interferon are co-administered in the same formulation or different formulation. For purposes of the present invention, "co-administer" refers to any administration of the
HBsAg inhibitor, the nucleos(t)ide analogue and interferon as the three active agents, either separately or together, where the three active agents are administered as part of an appropriate dose regimen designed to obtain the benefit of the combination therapy. Thus, the three active agents can be administered either as part of the same pharmaceutical composition or in separate pharmaceutical compositions. Also, the three active agents can be administered either at the same time, or sequentially.
The pharmaceutical composition of the HBsAg inhibitor, the nucleos(t)ide analogue and the interferon can be administered with various pharmaceutically acceptable inert carriers in the form of tablets, capsules, lozengens, troches, hard candies, powders, sprays, creams, salves, suppositories, jellies, gels, pastes, lotions, ointments, elixirs, syrups, and the like. Administration of such dosage forms can be carried out in single or multiple doses. Carries include solid diluents of fillers, sterile aqueous media and various non-toxic organic solvents. Administration of such dosage forms can be carried out through, but not limited to, oral administration, parenteral administration, veterinary administration. A further embodiment of the present invention relates to the method for manufacturing a medicament for treatment or prophylaxis of hepatitis B virus infection, characterized in that the HBsAg inhibitor, the nucleos(t)ide analogue and the interferon are intended for administration to a subject by the same route or different routes.
A further embodiment of the present invention relates to the method for manufacturing a medicament for treatment or prophylaxis of hepatitis B virus infection, characterized in that the HBsAg inhibitor, the nucleos(t)ide analogue and the interferon thereof are intended for administration to a subject by parenteral or oral administration.
A further embodiment of the present invention relates to the method for manufacturing a medicament for treatment or prophylaxis of hepatitis B virus infection, characterized in that the administration of the HBsAg inhibitor, the nucleos(t)ide analogue and the interferon thereof to a subject is simultaneous or sequential. In any of the methods of the present invention, the administration of agents simultaneously can be performed by separately or sequentially administering agents at the same time, or together as a fixed combination. Also, in any of the methods of the present invention, the administration of agents separately or sequentially can be in any order.
Another embodiment of the present invention relates to the method for manufacturing a medicament of composition for treatment or prophylaxis of hepatitis B virus infection, characterized in that HBsAg inhibitor thereof is a compound of formula (I), or formula (II), or pharmaceutically acceptable salt, enantiomer or diastereomer thereof. Particularly, the HBsAg inhibitor thereof is
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(-)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(+)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine- 3-carboxylic acid; (-)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine- 3-carboxylic acid;
(+)-6-iert-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- di ydrobenzo[a]quinolizine-3-carboxylic acid;
(-)-6-ieri-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(+)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(-)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(+)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(-)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(+)-10-chloro-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid; or
(-)-10-chloro-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof. Another embodiment of the present invention relates to the method for manufacturing a medicament for treatment or prophylaxis of hepatitis B virus infection, characterized in that the nucleos(t)ide analogue is Lamivudine, Adefovir dipivoxil, Entecavir, Telbivudine, Clevudine, Tenofovir disoproxil or Tenofovir disoproxil fumarate. Particularly the nucleos(t)ide analogue is Entecavir. Another embodiment of the present invention relates to the method for manufacturing a medicament for treatment or prophylaxis of hepatitis B virus infection, characterized in that the interferon thereof is a non-conjugated interferon alfa, a pegylated alfa-type interferon or a y- branched pegylated recombinant human interferon alpha-2b; particularly the interferon is Roferon A®, Intron A®, Pegasys®, Peglntron®' Pai Ge Bin or wIFN; more particularly the interferon is Pegasys® or wIFN. Another embodiment of the present invention relates to the method for manufacturing a medicament for treatment or prophylaxis of hepatitis B virus infection, characterized in that the HBsAg inhibitor, the nucleos(t)ide analogue and the interferon used in the medicament are
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegasys®; or
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and wIFN;
in a pharmaceutically acceptable carrier.
Another embodiment of the present invention relates to a kit comprising a container comprising an HBsAg inhibitor, a nucleos(t)ide analogue and an interferon, said kit can further comprise a sterile diluent.
A further embodiment of the present invention relates to the said kit, wherein the kit can further comprise a package insert comprising printed instructions directing the use of a combined treatment of an HBsAg inhibitor, a nucleos(t)ide analogue and an interferon as a method for treatment or prophylaxis of hepatitis B virus infection.
Another embodiment of the present invention relates to the said kit, wherein the HBsAg inhibitor is
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(-)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(+)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine- 3-carboxylic acid;
(-)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine- 3-carboxylic acid;
(+)-6-iert-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(-)-6-ieri-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(+)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid; (-)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(+)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- di ydrobenzo[a]quinolizine-3-carboxylic acid;
(-)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(+)- 10-chloro-6-(2-methoxy- 1 , 1 -dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid; or
(-)-10-chloro-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof.
Another embodiment of present invention relates to the said kit, characterized in that the nucleos(t)ide analogue is Lamivudine, Adefovir dipivoxil, Entecavir, Telbivudine, Clevudine, Tenofovir disoproxil or Tenofovir disoproxil fumarate. Particularly the nucleos(t)ide analogue is Entecavir.
Another embodiment of the present invention relates to the said kit, characterized in that the interferon thereof is a non-conjugated interferon alfa, a pegylated alfa-type interferon or a y- branched pegylated recombinant human interferon alpha-2b; particularly the interferon is Roferon A®, Intron A®, Pegasys®, Peglntron®, Pai Ge Bin or wIFN; more particularly the interferon is Pegasys® or wIFN.
Another embodiment of the present invention relates to the said kit, characterized in that the HBsAg inhibitor, the nucleos(t)ide analogue and the interferon used in the container are
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegasys®; or
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and wIFN;
or pharmaceutically acceptable salt, or enantiomer, or diastereomer thereof.
Another embodiment of the present invention relates to a method for the treatment or prophylaxis of hepatitis B virus infection, comprising administration to a subject with an effective amount of an HBsAg inhibitor, or pharmaceutically acceptable salt, enantiomer or diastereomer thereof; an effective amount of a nucleos(t)ide analogue and an effective amount of an interferon; wherein the HBsAg inhibitor thereof is
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(-)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(+)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine- 3-carboxylic acid;
(-)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine- 3-carboxylic acid;
(+)-6-iert-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(-)-6-ieri-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(+)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(-)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(+)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(-)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(+)- 10-chloro-6-(2-methoxy- 1 , 1 -dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid; or
(-)-10-chloro-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof.
Another embodiment of the present invention relates to a method for the treatment or prophylaxis of hepatitis B virus infection, comprising administration to a subject with an effective amount of an HBsAg inhibitor, or pharmaceutically acceptable salt, enantiomer or diastereomer thereof; an effective amount of a nucleos(t)ide analogue and an effective amount of an interferon, wherein the nucleos(t)ide analogue is Lamivudine, Adefovir dipivoxil, Entecavir, Telbivudine, Clevudine, Tenofovir disoproxil or Tenofovir disoproxil fumarate. Particularly the nucleos(t)ide analogue is Entecavir.
Another embodiment of the present invention relates to a method for the treatment or prophylaxis of hepatitis B virus infection, comprising administration to a subject with an effective amount of an HBsAg inhibitor, or pharmaceutically acceptable salt, enantiomer or diastereomer thereof; an effective amount of a nucleos(t)ide analogue and an effective amount of an interferon, wherein the interferon thereof is a non-conjugated interferon alfa, a pegylated alfa- type interferon or a y-branched pegylated recombinant human interferon alpha-2b; particularly the interferon is Roferon A®, Intron A®, Pegasys®, Peglntron®, Pai Ge Bin or wIFN; more particularly the interferon is Pegasys® or wIFN.
A further embodiment of the present invention relates to a method for the treatment or prophylaxis of hepatitis B virus infection, wherein the HBsAg inhibitor, the nucleos(t)ide analogue and the interferon used in the subject are
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegasys®; or
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and wIFN;
in a pharmaceutically acceptable carrier.
Another embodiment of the present invention relates to use of the pharmaceutical composition herein mentioned above as an antiviral medicament, in particular as the medicament for treatment or prophylaxis of hepatitis B virus infection.
Another embodiment of the present invention relates to the use of an HBsAg inhibitor, a nucleos(t)ide analogue and an interferon for the manufacture of the pharmaceutical composition herein mentioned above as an antiviral medicament, in particular the medicament for treatment or prophylaxis of hepatitis B virus infection.
EXAMPLES
The invention will be more fully understood by reference to the following examples. They should not, however, be construed as limiting the scope of the invention.
ABBREVIATIONS CI Combination index
CTG CellTiter-Glo®
FBS Fetal Bovine Serum
FIC Fractional inhibition concentration
GE Genome equivalent
HBsAg Hepatitis B surface antigen
IU International units
nM Nanomolar
PBS Phosphate buffered saline
PEG Polyethyleneglycol
Pen/Strep Penicillin/Streptomycin
qPCR Real-time quantitative polymerase chain reaction
SD Standard deviation
Sec Second
UDG Uracil DNA glycosylase
PXB Phoenix Bio
h-Alb Human albumin
WHV Woodchuck hepatitis virus
anti-WHs Antibody against the woodchuck hepatitis surface antigen
WHV DNA Woodchuck hepatitis virus DNA
WHsAg Woodchuck hepatitis surface antigen
anti-WHc Antibody against the woodchuck hepatitis core antigen
GGT Gamma-glutamyltransferase
SDH Sorbitol dehydrogenase
p.o. per os
s.c. subcutaneous
QD once daily
BIW twice weekly
Example 1
Combination of an HBsAg inhibitor, a nucleos(t)ide analogue and an interferon, in HBV infected PXB mice
Compound treatment of HBV infected PXB mice Four days prior to the first administration (Day -4), all the candidate HBV infected PXB mice (PhoenixBio Co., Ltd., 3-4-1, Kagamiyama, Higashi-Hiroshima, 739-0046 Japan) were weighed and those with a healthy appearance and which met all of the following criteria were assigned to the study.
Genotype: cDNA-uPAwild/+/SCID (cDNA-uPAwild/+: B6; 129SvEv-Plau, SCID: C.B- 17/Icr-scid /scid Jcl)
Age: 19-weeks or more on Day 0 (Actual ages on Day 0: from 21 to 25-weeks)
Gender: Male
Weight: 16.4 g or more on Day -4 (Actual weights on Day -4: from 16.5 to 23.7 g)
Blood h-Alb level: Not specified (Actual levels on Day -10: from 8.5 to 15.5 mg/mL) HBV genotype: C (Code No.: PBB004, Lot: 140309, PhoenixBio Co., Ltd.)
Serum HBV DNA level: l.OxlO6 copies/mL or more on Day -10 (plateau)
(Actual levels on Day -10: from 2.5>< 106 to 4.8xl08 copies/mL)
Donor of hepatocytes: BD195 (BD Biosciences, Woburn, MA, USA)
To minimize variance between the groups, the group composition was randomized based on the arithmetic mean values for body weight and geometric mean values for blood h-Alb concentration and serum HBV DNA concentration. Mice were assigned to groups and treated with single compounds or combinations of compounds for 35 days as summarized in Table 2.
Table 2. Treatment groups and dose levels
Figure imgf000043_0001
BIW, for 35 days,
Compound 9 0.025 s.c. (days 0, 3, 7, 10, 14,
17, 21, 24, 28, 31)
HBV DNA quantification in mouse serum
HBV DNA was extracted from 5 μΐ of serum using the SMITEST EX-R&D Nucleic Acid Extraction Kit (MEDICAL & BIOLOGICAL LABORATORIES CO., LTD., Nagoya, Japan). The DNA was dissolved in 20 nuclease-free water (Life Technologies Corporation, Carlsbad, CA, USA).
Serum from an HBV-infected PXB-mouse was used as the HBV DNA standard. Synthetic HBV DNA was used to determine the concentration of the HBV DNA standard which had been divided into aliquots and stored at -80°C until the quantification of the serum HBV DNA level. The HBV DNA was extracted from the HBV DNA standard and used for real-time PCR after appropriate dilution. For this study, the range of the standard used was between 4.0xl04 and 2.0x109 copies/mL.
The real-time detection PCR to measure the serum HBV DNA concentration was performed using the TaqMan Fast Advanced Master Mix (Life Technologies Corporation, Carlsbad, CA, USA) and ABI Prism 7500 sequence detector system (Life Technologies Corporation). The PCR reaction mixture was added into 5 of the extracted DNA. The initial activation of uracil-N-glycosylase at 50°C for 2 minutes was followed by the polymerase activation at 95°C for 20 seconds. Subsequent PCR amplification consisted of 53 cycles of denaturation at 95°C for 3 seconds and annealing and extension at 60°C for 32 seconds per cycle in an ABI 7500 sequence detector. The average serum HBV DNA level was calculated from the values of the two separate wells.
The primers and probe consisted of the following sequence given in Table 3 respectively: Table 3. Sequences of the primers and probe used for HBV DNA quantification
Sequence Information
Target
Identification
Location Dye 5' Nucleotides 3' Dye Forward primer
166-186 n/a CACATCAGGATTCCTAGGACC n/a (SEQ ID 1)
Reverse primer
344-325 n/a AGGTTGGTGAGTGATTGGAG n/a (SEQ ID 2)
TaqMan probe
242-267 FAM CAGAGTCTAGACTCGTGGTGGACTTC TAMRA (SEQ ID 3)
The lowest quantification limit of this assay was 4.0xl04 copies/mL serum.
Hepatitis B surface antigen (HBsAg) quantification in mouse serum
Serum HBsAg concentration was determined by SRL, Inc. (Tokyo, Japan) based on ChemiLuminescence ImmunoAssay (CLIA) developed by Abbott (ARCHITECT® SYSTEM). The dilution factor was 60, and the measurement range of this assay was between 0.05 and 250 IU/mL. For the 60-fold diluted samples, the measurement range was adjusted to be between 3.0 and 15000 IU/mL.
Results
The antiviral effects of Compound 1A, Compound 9, and Compound 13 alone or in combination against HBV determined by the serum HBV DNA concentration were summarized in Table 4.
Table 4: Antiviral effect of single drugs and drug combinations on HBV DNA
Figure imgf000045_0001
The HBV DNA concentration decrease with the therapy of combination of Compound 1A plus Compound 13 plus Compound 9 was most evident and was measured to be -3.37 log from the initial level. The antiviral effects of Compound 1A, Compound 9 and Compound 13 alone or in combination against HBV determined by the serum HBsAg concentration were summarized in Table 5.
Table 5. Antiviral effect of single drugs and drug combinations on HBsAg
Figure imgf000046_0001
The HBsAg concentration decrease with the therapy of combination of Compound 1A plus Compound 13 plus Compound 9 was most evident and was measured to be -1.16 Log from the initial level.
Example 2 Combination of an HBsAg inhibitor, a nucleos(t)ide analogue and an interferon, in woodchucks
Infection and compound treatment of woodchucks
Woodchucks were born in captivity and were infected at 3 days of age with WHV strain WHV7-11. Chronically infected animals were all anti-WHs negative, with detectable serum WHV DNA, WHsAg and anti-WHc at approximately 1 year post-infection. Absence of liver tumors in woodchucks with low GGT was confirmed by ultrasonography. Chronic WHV carrier woodchucks were assigned and stratified by gender, body weight, and by pretreatment serum markers (WHsAg and WHV DNA concentrations, serum GGT and SDH activities) into the treatment groups as summarized in Figure 1. Compound treatment of the woodchucks was performed for 14 weeks. Compound 13 (0.1 mg/kg) and Compound 1A (10 mg/kg), alone or in combination, were orally administered twice a day. Compound 12 (100 μg/woodchuck) was administered in addition to Compound 13 and/or Compound 1A subcutaneously as follows: three times per week (TIW) for week 0 to 2, no treatment for week 2 to 4, and two times per week (BID) for week 6 to 14. The study design is summarized in Figure 1.
Blood samples were drawn from woodchucks once per week and used to determine WHsAg levels.
Measurement of WHsAg Serum WHsAg was measured by WHV-specific enzyme immunoassays as described in
(Cote PJ, Roneker C, Cass K, Schodel F, Peterson D, et al. (1993) New enzyme immunoassays for the serologic detection of woodchuck hepatitis virus infection. Viral Immunol 6: 161-169. PMID: 8216715).
Results As shown in Figure 2, Compound 13 alone and Compound 1A alone showed mean log 10 reductions of -1.4 and -1.7 for WHsAg, respectively, on week 14 compared to baseline levels. Two-drug combination of Compound 1A with Compound 13 resulted in an increased WHsAg log 10 reduction of -3.4. The highest inhibition of WHsAg was observed with the triple therapy of combination of Compound 1A and Compound 13 and Compound 12 (-4.7 loglO reduction). Effect of combination of Compound 1A and Compound 13 and Compound 12 on WHsAg was analyzed according to the Bliss independence method (Zhao W. et al., A New Bliss Independence Model to Analyze Drug Combination Data. J Biomol Screen. 2014 Jun;19(5):817- 21; J. Foucquier & M. Guedj, Analysis of drug combinations: current methodological landscape. Pharmacol Res Perspect. 2015 Jun;3(3):e00149). Inhibition values were calculated from the measured WHsAg raw data values using equation:
Inhibition = 1 - (WHsAg at day x / WHsAg at day 0).
The predicted effect assuming additivity of the triple combination was then calculated based on the inhibition values of the single drugs using equation: Yab,p = Ya + Yb - YaYb , meaning drug A at dose a inhibits Ya of WHsAg and drug B at dose b inhibits Yb of WHsAg. In this analysis, drug A was defined as Compound 1A and drug B was defined as combination of Compound 12 and Compound 13. Values were transformed using equation: %WHsAg = (1 - Yab,p) x 100 and plotted against the time. As shown in Figure 4, most of the 95% confidence intervals of the triple combination effects are below the predicted additive effects and do not overlap with these, suggesting that triple combination of Compound 1A and Compound 13 and Compound 12 show a synergistic effect on WHsAg inhibition.

Claims

1. A pharmaceutical composition comprising an HBsAg inhibitor, a nucleos(t)ide analogue and an interferon, in a pharmaceutically acceptable carrier.
2. The pharmaceutical composition according to claim 1, wherein the HBsAg inhibitor is a compound of formula (I):
Figure imgf000049_0001
wherein
R1 is hydrogen, halogen, Ci-6alkyl, Ci-6alkylamino or Ci-6alkoxy;
R2 is hydrogen; halogen; Ci-6alkyl, which is unsubstituted or once, twice or three times
substituted by fluoro; Ci-6alkoxy, which is unsubstituted or once, twice or three times substituted by fluoro; cyano; C3-7cycloalkyl; hydroxy or phenyl-CxH2X-0-;
R3 is hydrogen;
halogen;
Ci-6alkyl, which is unsubstituted or once, twice or three times substituted by fluoro;
cyano;
pyrrolidinyl;
amino;
phenyl-CxH2x-N(Ci-6alkyl)-;
Ci-6alkoxycarbonylpiperazinyl;
or R7-0- , wherein R7 is hydrogen; Ci-6alkyl, which is unsubstituted or substituted with one to three substituents independently selected from fluoro, hydroxy and C2-6alkenyl; Ci- 6alkoxyCi-6alkyl; Ci-6alkoxyCi-6alkoxyCi-6alkyl; aminoCi-salkyl; Ci- 6alkylcarbonylaminoCi-8alkyl; Ci-6alkylsulfonylaminoCi-8alkyl; Ci-6alkylsulfanylCi-6alkyl; Ci-6alkylsulfonylCi-6alkyl; cyanoCi-6alkyl; C3-7cycloalkylCi-6alkyl; cyanoC3-7cycloalkylCi- 6alkyl; phenylCi-6alkyl; pyrrolidinylcarbonylCi-6alkyl; C2-6alkynyl; hydroxyCi-6alkylC2- 6alkynyl; aminoCi-6alkoxyCi-6alkyl; Ci-6alkylaminoCi-6alkoxyCi-6alkyl; diCi- 6alkylaminoCi-6alkoxyCi-6alkyl; carboxyCi-6alkyl; or Ci-6alkoxycarbonylaminoCi-8alkyl; heteroarylCi-6alkyl, wherein heteroaryl is N-containing monocyclic heteroaryl; or heterocycloalkylCi-6alkyl, wherein heterocycloalkyl is monocyclic heterocycloalkyl;
R4 is hydrogen, halogen, Ci-6alkyl, cyano or Ci-6alkoxy;
R5 is hydrogen or Ci-6alkyl;
R6 is hydrogen; Ci-6alkyl, which is unsubstituted or once, twice or three times substituted by fluoro; C3-7cycloalkyl, which is unsubstituted or once, twice or three times substituted by fluoro or Ci-6alkyl; or phenyl-CxH2X-;
x is 1-6;
or a pharmaceutically acceptable salt, or enantiomer thereof.
3. The pharmaceutical composition according to claim lor 2, wherein the HBsAg inhibitor is (+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(-)- 10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(+)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine- 3-carboxylic acid;
(-)- 10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine-3- carboxylic acid;
(+)-6-iert-butyl- 10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid; or
(-)-6-ieri-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof.
4. The pharmaceutical composition according to claim 1, wherein the HBsAg inhibitor is a compound of formula (II):
Figure imgf000051_0001
wherein
R8, R9, R10 and R11 are independently selected from hydrogen, halogen, Ci-6alkyl, diCi- 6alkylamino, cyano, N-containing monocyclic heterocycloalkyl and OR14, wherein
R14 is hydrogen; Ci-6alkyl; or Ci-6alkyl which is substituted once or more times by fluoro, C3-7cycloalkyl, phenyl, hydroxyl, amino, Ci-6alkoxy, Ci-6alkylsulfanyl, Ci-6alkylsulfonyl, diCi-6alkylamino, Ci-6alkoxycarbonylamino, monocyclic heterocycloalkyl, pyrazoyl or imidazolyl;
R12 is hydrogen or Chalky;
R13 is hydrogen, Ci-6alkyl, phenyl-CxH2X-, Ci-6alkylcarbonyl, Ci-6alkylsulfonyl, benzoyl or monocyclic heterocycloalkyl, wherein
x is 1-6;
W is a bond, CyH2yC(R15)(R16)CzH2z or CyH2yCH(R15)CH(R16)CzH2z, wherein
R15 and R16 are independently selected from hydrogen, fluoro, hydroxy and Ci-6alkyl, y is 0-6;
z is 0-6;
X is a bond; O; S; S(0)2; or NR17, wherein R17 is hydrogen, C1-6alkyl;
or R13 and R17, together with the nitrogen to which they are attached, form monocyclic heterocycloalkyl;
or a pharmaceutically acceptable salts, or enantiomers thereof.
5. The pharmaceutical composition according to claim 1 or 4, wherein the HBsAg inhibitor (+)-10-methoxy-6-(2-methoxy-l, l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(-)- 10-methoxy-6-(2-methoxy- l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid; (+)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(-)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(+)- 10-chloro-6-(2-methoxy- 1 , 1 -dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid; or
(-)-10-chloro-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof.
6. The pharmaceutical composition according to any one of claims 1 to 5, wherein the nucleos(t)ide analogue is Lamivudine, Adefovir dipivoxil, Entecavir, Telbivudine, Clevudine, Tenofovir disoproxil or Tenofovir disoproxil fumarate; more particularly the nucleos(t)ide analogue is Entecavir.
7. The pharmaceutical composition according to any one of claims 1 to 6, wherein the interferon is a non-conjugated interferon alfa, a pegylated alfa-type interferon or a y-branched pegylated recombinant human interferon alpha- 2b; particularly the interferon is Roferon A®, Intron A®, Pegasys®, Peglntron®, Pai Ge Bin or wIFN; more particularly the interferon is Pegasys® or wIFN.
8. The pharmaceutical composition according to claim 1, wherein the composition consists of an HBsAg inhibitor, a nucleos(t)ide analogue and an interferon, in a pharmaceutically acceptable carrier.
9. The pharmaceutical composition according to claim 1 or 8, wherein the composition consists of
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Roferon A®;
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Intron A®;
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegasys®;
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegintron®; (+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- di ydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pai Ge Bin;
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and wIFN;
(-)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Roferon A®;
(-)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Intron A®;
(-)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegasys®;
(-)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegintron®;
(-)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pai Ge Bin;
(-)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and wIFN;
(+)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine- 3-carboxylic acid, Entecavir and Roferon A®;
(+)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine- 3-carboxylic acid, Entecavir and Intron A®;
(+)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine- 3-carboxylic acid, Entecavir and Pegasys®;
(+)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine- 3-carboxylic acid, Entecavir and Pegintron®;
(+)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine- 3-carboxylic acid, Entecavir and Pai Ge Bin;
(+)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine- 3-carboxylic acid, Entecavir and wIFN;
(-)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine-3- carboxylic acid, Entecavir and Roferon A®;
(-)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine-3- carboxylic acid, Entecavir and Intron A®; (-)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine-3- carboxylic acid, Entecavir and Pegasys®;
(-)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine-3- carboxylic acid, Entecavir and Pegintron®;
(-)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine-3- carboxylic acid, Entecavir and Pai Ge Bin;
(-)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine-3- carboxylic acid, Entecavir and wIFN;
(+)-6-iert-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Roferon A®;
(+)-6-ieri-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Intron A®;
(+)-6-iert-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegasys®;
(+)-6-iert-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegintron®;
(+)-6-iert-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pai Ge Bin;
(+)-6-iert-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and wIFN;
(-)-6-iert-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Roferon A®;
(-)-6-ieri-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Intron A®;
(-)-6-ieri-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegasys®;
(-)-6-ieri-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegintron®;
(-)-6-iert-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pai Ge Bin;
(-)-6-ieri-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and wIFN; (+)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- di ydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Roferon A®;
(+)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- di ydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Intron A®;
(+)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegasys®;
(+)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegintron®;
(+)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pai Ge Bin;
(+)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and wIFN;
(-)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Roferon A®;
(-)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Intron A®;
(-)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegasys®;
(-)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegintron®;
(-)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pai Ge Bin;
(-)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and wIFN;
(+)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Roferon A®;
(+)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Intron A®;
(+)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegasys®;
(+)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegintron®; (+)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- di ydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pai Ge Bin;
(+)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- di ydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and wIFN;
(-)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Roferon A®;
(-)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Intron A®;
(-)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegasys®;
(-)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegintron®;
(-)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pai Ge Bin;
(-)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and wIFN;
(+)- 10-chloro-6-(2-methoxy- 1 , 1 -dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Roferon A®;
(+)- 10-chloro-6-(2-methoxy- 1 , 1 -dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Intron A®;
(+)- 10-chloro-6-(2-methoxy- 1 , 1 -dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegasys®;
(+)- 10-chloro-6-(2-methoxy- 1 , 1 -dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegintron®;
(+)- 10-chloro-6-(2-methoxy- 1 , 1 -dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pai Ge Bin;
(+)- 10-chloro-6-(2-methoxy- 1 , 1 -dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and wIFN;
(-)-10-chloro-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Roferon A®;
(-)-10-chloro-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Intron A®; (-)-10-chloro-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegasys®;
(-)-10-chloro-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegintron®;
(-)-10-chloro-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pai Ge Bin; or
(-)-10-chloro-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and wIFN
in a pharmaceutically acceptable carrier.
10. The pharmaceutical composition according to claim 1 or 8, wherein the composition consists of
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegasys®; or
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and wIFN;
in a pharmaceutically acceptable carrier.
11. A method for manufacturing a medicament for treatment or prophylaxis of hepatitis B virus infection, characterized in that an HBsAg inhibitor, a nucleos(t)ide analogue and an interferon are used in the medicament.
12. The method according to claim 11, wherein the HBsAg inhibitor, the nucleos(t)ide analogue and the interferon are co-administered in the same formulation or different formulation.
13. The method according to claim 11 or 12, wherein the HBsAg inhibitor, the nucleos(t)ide analogue and the interferon are intended for administration to a subject by the same route or different routes.
14. The method according to any one of claims 11 to 13, wherein the HBsAg inhibitor, the nucleos(t)ide analogue and the interferon are intended for administration to a subject by parenteral or oral administration.
15. The method according to any one of claims 11 to 14, wherein the administration is simultaneous or sequential.
16. The method according to any one of claims 11 to 15, wherein the HBsAg inhibitor is a compound of formula (I) or formula (II), or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof.
17. The method according to any one of claims 11 to 16, wherein the HBsAg inhibitor is
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(-)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(+)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine- 3-carboxylic acid;
(-)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine-3- carboxylic acid;
(+)-6-ieri-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(-)-6-ieri-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(+)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(-)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(+)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(-)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(+)- 10-chloro-6-(2-methoxy- 1 , 1 -dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid); or
(-)-10-chloro-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo [a] quinolizine-3-carboxylic acid) ;
or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof.
18. The method according to any one of claims 11 to 17, wherein the nucleos(t)ide analogue is Lamivudine; Adefovir dipivoxil, Entecavir, Telbivudine, Clevudine, Tenofovir disoproxil or Tenofovir disoproxil fumarate. Particularly the nucleos(t)ide analogue is Entecavir.
19. The method according to any one of claims 11 to 18, wherein the interferon is a non- conjugated interferon alfa, a pegylated alfa-type interferon or a y-branched pegylated
recombinant human interferon alpha- 2b; particularly the interferon is Roferon A®, Intron A®, Pegasys®, Peglntron®, Pai Ge Bin or wIFN; more particularly the interferon is Pegasys® or wIFN.
20. The method according to any one of claims 11 to 19, wherein the HBsAg inhibitor , the nucleos(t)ide analogue and the interferon used in the medicament are
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegasys®; or
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and wIFN.
21. A kit comprising a container comprising an HBsAg inhibitor, a nucleos(t)ide analogue and an interferon.
22. The kit according to claim 21, further comprising a sterile diluent.
23. The kit according to claim 21 or 22, further comprising a package insert comprising printed instructions directing the use of a combined treatment of an HBsAg inhibitor, a nucleos(t)ide analogue and an interferon as a method for treatment or prophylaxis of hepatitis B virus infection.
24. The kit according to any one of claims 21 to 23, wherein the HBsAg inhibitor is
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(-)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(+)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine- 3-carboxylic acid;
(-)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine-3- carboxylic acid;
(+)-6-ieri-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(-)-6-ieri-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid; (+)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(-)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(+)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(-)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(+)- 10-chloro-6-(2-methoxy- 1 , 1 -dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid); or
(-)-10-chloro-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof.
25. The kit according to any one of claims 21 to 24, wherein the nucleos(t)ide analogue is Lamivudine, Adefovir dipivoxil, Entecavir, Telbivudine, Clevudine, Tenofovir disoproxil or
Tenofovir disoproxil fumarate. Particularly the nucleos(t)ide analogue is Entecavir .
26. The kit according to any one of claims 21 to 25, wherein the interferon is a non-conjugated interferon alfa, a pegylated alfa-type interferon or a y-branched pegylated recombinant human interferon alpha- 2b; particularly the interferon is Roferon A®, Intron A®, Pegasys®, Peglntron®, Pai Ge Bin or wIFN; more particularly the interferon is Pegasys® or wIFN.
27. The kit according to any one of claims 21 to 26, wherein the HBsAg inhibitor, the nucleos(t)ide analogue and the interferon used in the container are
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegasys®; or
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and wIFN.
28. A method for the treatment or prophylaxis of hepatitis B virus infection, comprising administration to a subject with an effective amount of an HBsAg inhibitor, or a
pharmaceutically acceptable salt, enantiomer or diastereomer thereof; an effective amount of a nucleos(t)ide analogue and an effective amount of an interferon.
29. The method according to claim 28, wherein the HBsAg inhibitor is
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(-)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(+)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine- 3-carboxylic acid;
(-)-10-chloro-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7-dihydrobenzo[a]quinolizine-3- carboxylic acid;
(+)-6-ieri-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(-)-6-ieri-butyl-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(+)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(-)-10-methoxy-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(+)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(-)-6-(2-hydroxy-l,l-dimethyl-ethyl)-10-methoxy-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
(+)- 10-chloro-6-(2-methoxy- 1 , 1 -dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid); or
(-)-10-chloro-6-(2-methoxy-l,l-dimethyl-ethyl)-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid;
or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof.
30. The method according to claim 28 or 29, wherein the nucleos(t)ide analogue is Lamivudine, Adefovir dipivoxil, Entecavir, Telbivudine, Clevudine, Tenofovir disoproxil or Tenofovir disoproxil fumarate. Particularly the nucleos(t)ide analogue is Entecavir.
31. The method according to any one of claims 28 to 30, wherein the interferon is a non- conjugated interferon alfa, a pegylated alfa-type interferon or a y-branched pegylated
recombinant human interferon alpha- 2b; particularly the interferon is Roferon A®, Intron A®, Pegasys®, Peglntron®, Pai Ge Bin or wIFN; more particularly the interferon is Pegasys® or wIFN.
32. The method according to any one of claims 28 to 31, wherein the HBsAg inhibitor, the nucleos(t)ide analogue and the interferon used are
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and Pegasys®; or
(+)-10-methoxy-6-isopropyl-9-(3-methoxypropoxy)-2-oxo-6,7- dihydrobenzo[a]quinolizine-3-carboxylic acid, Entecavir and wIFN.
33. The use of pharmaceutical composition according to any one of claims 1 to 10 as an antiviral medicament, in particular as the medicament for treatment or prophylaxis of hepatitis B virus infection.
34. The use of an HBsAg inhibitor, a nucleos(t)ide analogue and an interferon for the manufacture of pharmaceutical composition according to any one of claims 1 to 10 as an antiviral medicament, in particular the medicament for treatment or prophylaxis of hepatitis B virus infection.
35. The invention as hereinbefore described.
PCT/EP2017/078974 2016-11-14 2017-11-13 COMBINATION THERAPY OF AN HBsAg INHIBITOR, A NUCLEOS(T)IDE ANALOGUE AND AN INTERFERON Ceased WO2018087345A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP16198553 2016-11-14
EP16198553.6 2016-11-14

Publications (1)

Publication Number Publication Date
WO2018087345A1 true WO2018087345A1 (en) 2018-05-17

Family

ID=57321156

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2017/078974 Ceased WO2018087345A1 (en) 2016-11-14 2017-11-13 COMBINATION THERAPY OF AN HBsAg INHIBITOR, A NUCLEOS(T)IDE ANALOGUE AND AN INTERFERON

Country Status (1)

Country Link
WO (1) WO2018087345A1 (en)

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019229264A1 (en) * 2018-06-01 2019-12-05 Sanofi Combination therapy for treating hepatitis b virus infection
WO2020061435A1 (en) 2018-09-21 2020-03-26 Enanta Pharmaceuticals, Inc. Functionalized heterocycles as antiviral agents
US10729688B2 (en) 2018-03-29 2020-08-04 Enanta Pharmaceuticals, Inc. Hepatitis B antiviral agents
US10738035B2 (en) 2015-05-13 2020-08-11 Enanta Pharmaceuticals, Inc. Hepatitis B antiviral agents
US10934306B2 (en) 2016-03-07 2021-03-02 Enanta Pharmaceuticals, Inc. Hepatitis B antiviral agents
US10952978B2 (en) 2017-08-28 2021-03-23 Enanta Pharmaceuticals, Inc. Hepatitis B antiviral agents
WO2021110562A1 (en) * 2019-12-03 2021-06-10 Evotec International Gmbh Interferon-associated antigen binding proteins and uses thereof
WO2021110561A1 (en) * 2019-12-03 2021-06-10 Evotec International Gmbh Interferon-associated antigen binding proteins for use in treating hepatitis b infection
US11058678B2 (en) 2018-01-22 2021-07-13 Enanta Pharmaceuticals, Inc. Substituted heterocycles as antiviral agents
US11198693B2 (en) 2018-11-21 2021-12-14 Enanta Pharmaceuticals, Inc. Functionalized heterocycles as antiviral agents
US11236108B2 (en) 2019-09-17 2022-02-01 Enanta Pharmaceuticals, Inc. Functionalized heterocycles as antiviral agents
US11236111B2 (en) 2019-06-03 2022-02-01 Enanta Pharmaceuticals, Inc. Hepatitis B antiviral agents
RU2777056C2 (en) * 2018-06-01 2022-08-01 Санофи Combination therapy for treatment of infection caused by hepatitis b virus
US11472808B2 (en) 2019-06-04 2022-10-18 Enanta Pharmaceuticals, Inc. Substituted pyrrolo[1,2-c]pyrimidines as hepatitis B antiviral agents
US11738019B2 (en) 2019-07-11 2023-08-29 Enanta Pharmaceuticals, Inc. Substituted heterocycles as antiviral agents
US11760755B2 (en) 2019-06-04 2023-09-19 Enanta Pharmaceuticals, Inc. Hepatitis B antiviral agents
US11802125B2 (en) 2020-03-16 2023-10-31 Enanta Pharmaceuticals, Inc. Functionalized heterocyclic compounds as antiviral agents

Citations (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0043980A2 (en) 1980-07-01 1982-01-20 F. HOFFMANN-LA ROCHE & CO. Aktiengesellschaft Mature human leukocyte interferon A, process for its microbial preparation, intermediates therefor and compositions containing it.
EP0236987A2 (en) 1986-03-10 1987-09-16 F. Hoffmann-La Roche Ag Chemically modified protein and production thereof
US4766106A (en) 1985-06-26 1988-08-23 Cetus Corporation Solubilization of proteins for pharmaceutical compositions using polymer conjugation
US4917888A (en) 1985-06-26 1990-04-17 Cetus Corporation Solubilization of immunotoxins for pharmaceutical compositions using polymer conjugation
EP0510356A1 (en) 1991-03-25 1992-10-28 F. Hoffmann-La Roche Ag Polyethylene glycol protein conjugates
EP0593868A1 (en) 1992-08-26 1994-04-27 F. Hoffmann-La Roche Ag PEG-interferon conjugates
WO1995013090A1 (en) 1993-11-10 1995-05-18 Enzon, Inc. Improved interferon polymer conjugates
EP0809996A2 (en) 1996-05-31 1997-12-03 F. Hoffmann-La Roche Ag Interferon conjugates
US5951974A (en) 1993-11-10 1999-09-14 Enzon, Inc. Interferon polymer conjugates
CN1504237A (en) * 2002-12-02 2004-06-16 赖庆莲 Medicine composition containing alfa-interferon , adefovir and FTC
WO2015113990A1 (en) 2014-01-30 2015-08-06 F. Hoffmann-La Roche Ag Novel dihydroquinolizinones for the treatment and prophylaxis of hepatitis b virus infection
WO2015173164A1 (en) 2014-05-13 2015-11-19 F. Hoffmann-La Roche Ag Novel dihydroquinolizinones for the treatment and prophylaxis of hepatitis b virus infection
WO2016023877A1 (en) 2014-08-14 2016-02-18 F. Hoffmann-La Roche Ag Novel pyridazones and triazinones for the treatment and prophylaxis of hepatitis b virus infection
WO2016071215A1 (en) 2014-11-03 2016-05-12 F. Hoffmann-La Roche Ag Novel 6,7-dihydrobenzo[a]quinolizin-2-one derivatives for the treatment and prophylaxis of hepatitis b virus infection
WO2016107832A1 (en) 2014-12-30 2016-07-07 F. Hoffmann-La Roche Ag Novel tetrahydropyridopyrimidines and tetrahydropyridopyridines for the treatment and prophylaxis of hepatitis b virus infection
WO2016128335A1 (en) 2015-02-11 2016-08-18 F. Hoffmann-La Roche Ag Novel 2-oxo-6,7-dihydrobenzo[a]quinolizine-3-carboxylic acid derivatives for the treatment and prophylaxis of hepatitis b virus infection
WO2017102648A1 (en) * 2015-12-15 2017-06-22 F. Hoffmann-La Roche Ag Combination therapy of an hbsag inhibitor and a nucleos(t)ide analogue
WO2017114812A1 (en) * 2015-12-29 2017-07-06 F. Hoffmann-La Roche Ag Combination therapy of an hbsag inhibitor and an interferon

Patent Citations (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0043980A2 (en) 1980-07-01 1982-01-20 F. HOFFMANN-LA ROCHE & CO. Aktiengesellschaft Mature human leukocyte interferon A, process for its microbial preparation, intermediates therefor and compositions containing it.
US4766106A (en) 1985-06-26 1988-08-23 Cetus Corporation Solubilization of proteins for pharmaceutical compositions using polymer conjugation
US4917888A (en) 1985-06-26 1990-04-17 Cetus Corporation Solubilization of immunotoxins for pharmaceutical compositions using polymer conjugation
EP0236987A2 (en) 1986-03-10 1987-09-16 F. Hoffmann-La Roche Ag Chemically modified protein and production thereof
EP0510356A1 (en) 1991-03-25 1992-10-28 F. Hoffmann-La Roche Ag Polyethylene glycol protein conjugates
EP0593868A1 (en) 1992-08-26 1994-04-27 F. Hoffmann-La Roche Ag PEG-interferon conjugates
US5951974A (en) 1993-11-10 1999-09-14 Enzon, Inc. Interferon polymer conjugates
WO1995013090A1 (en) 1993-11-10 1995-05-18 Enzon, Inc. Improved interferon polymer conjugates
EP0809996A2 (en) 1996-05-31 1997-12-03 F. Hoffmann-La Roche Ag Interferon conjugates
CN1504237A (en) * 2002-12-02 2004-06-16 赖庆莲 Medicine composition containing alfa-interferon , adefovir and FTC
WO2015113990A1 (en) 2014-01-30 2015-08-06 F. Hoffmann-La Roche Ag Novel dihydroquinolizinones for the treatment and prophylaxis of hepatitis b virus infection
WO2015173164A1 (en) 2014-05-13 2015-11-19 F. Hoffmann-La Roche Ag Novel dihydroquinolizinones for the treatment and prophylaxis of hepatitis b virus infection
WO2016023877A1 (en) 2014-08-14 2016-02-18 F. Hoffmann-La Roche Ag Novel pyridazones and triazinones for the treatment and prophylaxis of hepatitis b virus infection
WO2016071215A1 (en) 2014-11-03 2016-05-12 F. Hoffmann-La Roche Ag Novel 6,7-dihydrobenzo[a]quinolizin-2-one derivatives for the treatment and prophylaxis of hepatitis b virus infection
WO2016107832A1 (en) 2014-12-30 2016-07-07 F. Hoffmann-La Roche Ag Novel tetrahydropyridopyrimidines and tetrahydropyridopyridines for the treatment and prophylaxis of hepatitis b virus infection
WO2016128335A1 (en) 2015-02-11 2016-08-18 F. Hoffmann-La Roche Ag Novel 2-oxo-6,7-dihydrobenzo[a]quinolizine-3-carboxylic acid derivatives for the treatment and prophylaxis of hepatitis b virus infection
WO2017102648A1 (en) * 2015-12-15 2017-06-22 F. Hoffmann-La Roche Ag Combination therapy of an hbsag inhibitor and a nucleos(t)ide analogue
WO2017114812A1 (en) * 2015-12-29 2017-07-06 F. Hoffmann-La Roche Ag Combination therapy of an hbsag inhibitor and an interferon

Non-Patent Citations (27)

* Cited by examiner, † Cited by third party
Title
BONI C., J. VIROL., vol. 81, 2007, pages 4215 - 4225
BUSTER ET AL., HEPATOLOGY, vol. 46, 2007, pages 388 - 94
CHRISTEN V. ET AL., J. VIROL., vol. 81, 2007, pages 159 - 165
COTE PJ; RONEKER C; CASS K; SCHODEL F; PETERSON D ET AL.: "New enzyme immunoassays for the serologic detection of woodchuck hepatitis virus infection", VIRAL IMMUNOL, vol. 6, 1993, pages 161 - 169
FISICARO ET AL., GASTROENTEROLOGY, vol. 138, 2010, pages 682 - 93
GUAN S.H. ET AL., J. GASTROENTEROL, vol. 13, 2007, pages 228 - 235
J. FOUCQUIER; M. GUEDJ: "Analysis of drug combinations: current methodological landscape", PHARMACOL RES PERSPECT, vol. 3, no. 3, June 2015 (2015-06-01), pages e00149
JANSSEN ET AL., LANCET, vol. 365, 2005, pages 123 - 9
JANSSEN H.L. ET AL., LANCET, vol. 365, 2005, pages 123 - 129
KONDO ET AL., ISRN GASTEROENTEROLOGY, 2013
KONDO ET AL., JOURNAL OF IMMUNOLOGY, vol. 150, 1993, pages 4659 - 4671
KONDO ET AL., JOURNAL OF MEDICAL VIROLOGY, vol. 74, 2004, pages 425 - 433
KUMAR ET AL., J VIROL, vol. 85, 2011, pages 987 - 95
LAMBERT, C.; R. PRANGE., VIROL J, vol. 4, 2007, pages 45
LAU G.K. ET AL., N. ENGL. J. MED., vol. 352, 2005, pages 2682 - 2695
MARCELLIN ET AL., N. ENGL. J. MED., vol. 351, 2004, pages 1206 - 17
MICCO L. ET AL., J. HEPATOL, vol. 58, 2013, pages 225 - 233
OP DEN BROUW ET AL., IMMUNOLOGY, vol. 126, 2009, pages 280 - 9
PERRILLO R., HEPATOLOGY, vol. 49, 2009, pages 103 - 111
PESTKA, ARCH. BIOCHEM. BIOPHYS., vol. 221, 1983, pages 1
RICHARD B. SILVERMAN: "Prodrugs and Drug Delivery Systems", 2004, ACADEMIC PRESS, article "Organic Chemistry of Drug Design and Drug Action", pages: 497 - 558
SHI ET AL., J VIRAL HEPAT., vol. 19, 2012, pages e26 - 33
WIELAND S. ET AL., PROC. NATL. ACAD. SCI., vol. 101, 2004, pages 6669 - 6674
WIELAND S.F. ET AL., J. VIROL., vol. 74, 2000, pages 4165 - 4173
WIELAND, S. F.; F. V. CHISARI., J VIROL, vol. 79, 2005, pages 9369 - 80
WOLTMAN ET AL., PLOS ONE, vol. 6, 2011, pages e15324
ZHAO W. ET AL.: "A New Bliss Independence Model to Analyze Drug Combination Data", J BIOMOL SCREEN., vol. 19, no. 5, June 2014 (2014-06-01), pages 817 - 21

Cited By (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10738035B2 (en) 2015-05-13 2020-08-11 Enanta Pharmaceuticals, Inc. Hepatitis B antiviral agents
US12054493B2 (en) 2016-03-07 2024-08-06 Enanta Pharmaceuticals, Inc. Hepatitis B antiviral agents
US10934306B2 (en) 2016-03-07 2021-03-02 Enanta Pharmaceuticals, Inc. Hepatitis B antiviral agents
US10952978B2 (en) 2017-08-28 2021-03-23 Enanta Pharmaceuticals, Inc. Hepatitis B antiviral agents
US12496282B2 (en) 2017-08-28 2025-12-16 Enanta Pharmaceuticals, Inc. Hepatitis B antiviral agents
US12011425B2 (en) 2017-08-28 2024-06-18 Enanta Pharmaceuticals, Inc. Hepatitis B antiviral agents
US11596611B2 (en) 2017-08-28 2023-03-07 Enanta Pharmaceuticals, Inc. Hepatitis B antiviral agents
US11058678B2 (en) 2018-01-22 2021-07-13 Enanta Pharmaceuticals, Inc. Substituted heterocycles as antiviral agents
US10729688B2 (en) 2018-03-29 2020-08-04 Enanta Pharmaceuticals, Inc. Hepatitis B antiviral agents
AU2019276372B2 (en) * 2018-06-01 2025-05-29 Evotec International Gmbh Combination therapy for treating hepatitis B virus infection
WO2019229264A1 (en) * 2018-06-01 2019-12-05 Sanofi Combination therapy for treating hepatitis b virus infection
CN112912098A (en) * 2018-06-01 2021-06-04 赛诺菲 Combination therapy for the treatment of hepatitis B virus infection
RU2777056C2 (en) * 2018-06-01 2022-08-01 Санофи Combination therapy for treatment of infection caused by hepatitis b virus
US11377450B2 (en) 2018-09-21 2022-07-05 Enanta Pharmaceuticals, Inc. Functionalized heterocycles as antiviral agents
WO2020061435A1 (en) 2018-09-21 2020-03-26 Enanta Pharmaceuticals, Inc. Functionalized heterocycles as antiviral agents
US10865211B2 (en) 2018-09-21 2020-12-15 Enanta Pharmaceuticals, Inc. Functionalized heterocycles as antiviral agents
US12264159B2 (en) 2018-11-21 2025-04-01 Enanta Pharmaceuticals, Inc. Functionalized heterocycles as antiviral agents
US11198693B2 (en) 2018-11-21 2021-12-14 Enanta Pharmaceuticals, Inc. Functionalized heterocycles as antiviral agents
US11891393B2 (en) 2018-11-21 2024-02-06 Enanta Pharmaceuticals, Inc. Functionalized heterocycles as antiviral agents
US11236111B2 (en) 2019-06-03 2022-02-01 Enanta Pharmaceuticals, Inc. Hepatitis B antiviral agents
US11472808B2 (en) 2019-06-04 2022-10-18 Enanta Pharmaceuticals, Inc. Substituted pyrrolo[1,2-c]pyrimidines as hepatitis B antiviral agents
US11760755B2 (en) 2019-06-04 2023-09-19 Enanta Pharmaceuticals, Inc. Hepatitis B antiviral agents
US11738019B2 (en) 2019-07-11 2023-08-29 Enanta Pharmaceuticals, Inc. Substituted heterocycles as antiviral agents
US11236108B2 (en) 2019-09-17 2022-02-01 Enanta Pharmaceuticals, Inc. Functionalized heterocycles as antiviral agents
JP2023505168A (en) * 2019-12-03 2023-02-08 エヴォテック・インターナショナル・ゲゼルシャフト・ミット・ベシュレンクテル・ハフツング Interferon-associated antigen-binding proteins and uses thereof
WO2021110562A1 (en) * 2019-12-03 2021-06-10 Evotec International Gmbh Interferon-associated antigen binding proteins and uses thereof
US12275796B2 (en) 2019-12-03 2025-04-15 Evotec International Gmbh Interferon-associated antigen binding proteins and uses thereof
WO2021110561A1 (en) * 2019-12-03 2021-06-10 Evotec International Gmbh Interferon-associated antigen binding proteins for use in treating hepatitis b infection
US11802125B2 (en) 2020-03-16 2023-10-31 Enanta Pharmaceuticals, Inc. Functionalized heterocyclic compounds as antiviral agents

Similar Documents

Publication Publication Date Title
US10596173B2 (en) Combination therapy of an HBV capsid assembly inhibitor and an interferon
US20190275052A1 (en) Combination therapy of an hbv capsid assembly inhibitor and a nucleos(t)ide analogue
JP2018531272A6 (en) Combination therapy of HBV capsid assembly inhibitor and interferon
WO2017114812A1 (en) Combination therapy of an hbsag inhibitor and an interferon
WO2017102648A1 (en) Combination therapy of an hbsag inhibitor and a nucleos(t)ide analogue
Rivkin A review of entecavir in the treatment of chronic hepatitis B infection
Zhou et al. Novel nucleoside analogue FNC is effective against both wild-type and lamivudine-resistant HBV clinical isolates
CN108712905B (en) Anti-Liver Tumor Virus Agent
JP2018512428A5 (en)
AU2020415307A1 (en) Method of treating virus infection using a TLR7 agonist
CN106902347A (en) The purposes of close cyclosporine inhibitor
CN112121044A (en) Application of amlexanox in preparing anti-hepatitis virus medicine
WO2017156391A1 (en) Compounds and compositions for the treatment of infections
US20220370447A1 (en) Method of treating hbv infection using a core protein allosteric modulator
Asmuth et al. Treatments for hepatitis B
KR102662826B1 (en) Synergistic effect of EYP001 and IFN for treatment of HBV infection
US20190290673A1 (en) Compositions and methods for the treatment of hbv infection
CN114259492A (en) Application of nitazoxanide in treating hepatitis B
HK40007651A (en) Combination therapy of an hbv capsid assembly inhibitor and a nucleos(t)ide analogue
Marcellin O. 048 Treatment of chronic hepatitis B with the combination of pegylated interferon with a nucleoside/nucleotide analogue
Hadziyannis O. 047 Treatment paradigms in hepatitis B e antigen negative (HBeAg-negative) chronic hepatitis B patients
HK40066536B (en) Synergistic effect of eyp001 and pegylated ifn-alpha for the treatment of hbv infection

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17797631

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17797631

Country of ref document: EP

Kind code of ref document: A1