WO2018071405A1

WO2018071405A1 - Vectors and vaccine cells for immunity against zika virus

Info

Publication number: WO2018071405A1
Application number: PCT/US2017/055912
Authority: WO
Inventors: Natasa Strbo; Laura ROMERO
Original assignee: University of Miami
Current assignee: University of Miami
Priority date: 2016-10-11
Filing date: 2017-10-10
Publication date: 2018-04-19
Anticipated expiration: 2019-04-11
Also published as: CA3040123A1; US11666649B2; US20210290750A1

Abstract

The present invention provides an expression vector, host cells, methods and kits for the treatment or prevention of a flavivirus infection in a subject.

Description

VECTORS AND VACCINE CELLS FOR IMMUNITY AGAINST ZIKA VIRUS

FIELD

[0001] The present invention relates, in part, to compositions and methods useful for immune modulation in connection with, for example, infection by the Zika virus.

RELATED APPLICATIONS

[0002] This application claims priority to and the benefit of US Provisional Patent Application No. 62/406,506, which was filed on October 11, 2016, the contents of which are incorporated herein by reference in their entirety.

INCORPORATION BY REFERENCE OF MATERIAL SUBMITTED

ELECTRONICALLY

[0003] The contents of the text file named "HTB-ZOL-029PCUMIP-114_Sequence Listing_ST25", which was created on October 3, 2017 and is 294 KB in size, are hereby incorporated herein by reference in their entirety.

BACKGROUND

[0004] The Zika virus (ZIKV) is a member of the virus family Flaviviridae. It is spread by, among others daytime-active Aedes mosquitoes, such as A. ctegypti and A. ctlbopictus.

[0005] Although in most instances ZIKV infection results in a self-limiting febrile illness associated with rash and conjunctivitis, severe neurological phenotypes can occur, including Guillain-Barre syndrome and meningoencephalitis (Carteaux et al. NEJM 374: 1595-1596 (2016); Oehler et al., Eurosurveillance 19(9), 06 March 2014). Infection in pregnant women is of major concern, as it is linked to catastrophic fetal abnormalities including microcephaly, spontaneous abortion, and intrauterine growth restriction (IUGR) due to placental insufficiency (Brasil et al., NEJM doi:10.1056/NEJMoal602412 (4 March 2016)). Currently, effective ZIKV vaccines do not exist or target only adults without impacting an existing fetus in a pregnant woman.

[0006] Accordingly, there remains an urgent need for ZIKV vaccines that could prevent and/or mitigate ZIKV infections and which will not only protect adults from Zika infection but also pregnant women and their embryos and fetuses. SUMMARY

[0007] Accordingly, in various aspects, the present invention relates to compositions and methods that provide vaccine protection from flavivirus infection, e.g., Zika infection. Importantly, in various aspects, the compositions and methods protect adult subjects, inclusive of pregnant female adult subjects and their fetuses.

[0008] In various embodiments, the present compositions and methods protect a fetus from flavivirus infection, e.g., Zika infection, and the catastrophic fetal abnormalities associated therewith, by providing placental protection that is mediated by a chaperone-, e.g. gp96-, based vaccine that induces Zika antigen specific cytotoxic T cell (CTL) responses in the placenta and/or decidua.

[0009] In various embodiments, the present invention provides an expression vector system comprising (i) a nucleic acid encoding a fusion protein comprising a chaperone protein and an immunoglobulin, or a fragment thereof, and (ii) a nucleic acid encoding a flavivirus protein, or an antigenic portion thereof, wherein each nucleic acid is operably linked to a promoter. In exemplary embodiments, the flavivirus protein is a Zika virus (ZIKV) protein. Accordingly, the present invention provides an expression vector system comprising (i) a nucleic acid encoding a fusion protein comprising a chaperone protein and an immunoglobulin, or a fragment thereof, (i) a nucleic acid encoding a ZIKV protein, or an antigenic portion thereof, wherein each nucleic acid is operably linked to a promoter. Related host cells comprising the expression vector system of the present invention are provided herein.

[0010] The present invention also provides a composition comprising an expression vector system, a host cell, or a population of cells, as presently disclosed herein, and an excipient, carrier, or diluent. In exemplary aspects, the composition is a pharmaceutical composition.

[0011] Additionally, provided by the present invention is a kit comprising an expression vector system, a host cell, a population of cells, or a composition, as presently disclosed herein.

[0012] The present invention further provides a method of eliciting an immune response against a flavivirus in a subject, comprising administering to the subject the expression vector of the present invention or a population of cells transfected with the expression vector, in an amount effective to elicit an immune response against flavivirus in the subject. In exemplary embodiments, the flavivirus is a Zika virus. Accordingly, the present invention further provides a method of eliciting an immune response against ZIKV in a subject, comprising administering to the subject the expression vector of the present invention or a population of cells transfected with the expression vector, in an amount effective to elicit an immune response against ZIKV in the subject.

[0013] The present inventions furthermore provide a method of treating or preventing a flavivirus infection in a subject, comprising administering to the subject the expression vector of the present invention or a population of cells transfected with the expression vector, in an amount effective to treat or prevent the flavivirus infection. In exemplary embodiments, the flavivirus infection is a ZIKV infection. Accordingly, the present inventions furthermore provide a method of treating or preventing a Zika virus (ZIKV) infection in a subject, comprising administering to the subject the expression vector of the present invention or a population of cells transfected with the expression vector, in an amount effective to treat or prevent the ZIKV infection.

BRIEF DESCRIPTION OF THE DRAWINGS

[0100] Figure 1 is a schematic illustration of an exemplary expression vector of the present invention.

[0101] Figure 2 is a set of representative dot plots of gated CD3+CD8+ T cells in placenta and decidua and the frequency of OT1 positive cells.

[0102] Figure 3 is a schematic illustration of an exemplary expression vector of the present invention and the sequence thereof and having a sequence of SEQ ID NO: 24. Both forward and reverse nucleotide sequences are shown. The reverse sequence is underlined.

[0103] Figures 4 and 5 provide a schematic of the experiment described in Example 2 and additional experimental schematics.

[0104] Figure 6 provides a photo of tissue and anatomical drawings of a pregnant mouse from Erlebacher, Nature Reviews Immunology 13: 23-33 (2013).

[0105] Figure 7 is a schematic illustration of an exemplary expression B45 vector expressing Gp96-Ig and ZIKA Pre-Membrane and Envelope protein of the present invention and the sequence thereof and having a sequence of SEQ ID NO: 35. Gp96-Ig construct was cloned in the first expression cassette and ZIKA Pre-membrane Envelope construct was cloned in the second expression cassette. [0106] Figure 8A-E illustrate single cell cloning of vaccine 293 cells expressing gp96-Ig and ZIKA envelope. Figure 8 A is a Western blot showing that transfected cells were successfully transfected with ZIKA envelope (lane 2). Figure 8B shows MBS430270 (MyBiosource) Anti-EnvelopeE (ZikaVirus) Polyclonal antibody primary antibody (1:1000) and HRP-anti-rabit IgG as a secondary antibody (Jackson Immuno research) (1:5000). Figure 8C shows ELISA for gp96-Ig for clone 5G4 and Figure 8D is a western blot for ZIKA env and Figure 8E shows for clone 5G4.

[0107] Figure 9 is a confocal microscopy image illustrating the expression of DNA vaccination with in vivo electroporation (EP) of Gp96-Ig-gfp DNA vaccine.

[0108] Figure lOA-C is a histological staining and a bar graph illustrating that secreted gp96-Ig vaccination during mouse pregnancy is safe. Pregnant Wildtype (WT) mice were injected s.c. with PBS control (Figure 10A) or with 293-gp96-Ig-ZIKAEnv (Figure 10B) at GD 7.5. Figure IOC is a bar graph showing the total number of live born pups at GD 19-21, form control (CTRL) dams that have received only PBS or dams that received 293-gp96-Ig- ZUCA at GD 7.5. (n=8-12)

[0109] Figure 11 is a histological staining showing accumulation of CD8 T cells in the maternal decidua after secreted Gp96ZlKAEnv-Ig vaccination.

[0110] Figure 12A-B is a set of bar graphs illustrating that Gp96-Ig-ZIKVEnv vaccine induces antigen experienced (CD1 la+) effector memory CD8 T cells in decidua. Figure 12A shows the percentage of CD8+ cells with CD3+ cells in control and vaccinated mice. Figure 12B shows decidua CD8+ T cells in control and vaccinated mice.

[0111] Figure 13A-B is a confocal microscopy image illustrating the Co-expression of CD 11a and CD8 in placenta of Gp96-Ig-ZIKVenv vaccinated mice. Figure 13A shows the expression in control and Figure 13B shows the expression in Zika vaccinated.

[0112] Figure 14A-B is a set of bar graphs illustrating Gp96-Ig-ZIKVEnv vaccine induced ZIKV-Env-specific CD8+ T lymphocyte responses, as assessed by multiparameter intracellular cytokine staining (ICS) assays. Figure 14A shows the percentage of cytokines within CD8+ cells in control and vaccinated mice and Figure 14B shows the percentage of cytokines within CD8+CD1 la+ T cells. DETAILED DESCRIPTION

[0113] The present invention is based, in part, on the surprising discover}' that an expression vector system described herein was able to stimulate immune responses in the placenta thereby providing direct protection against ZIKV infection to the unborn fetus.

[0114] Expression Vectors and Host Cells

[0115] The present invention provides an expression vector system comprising (i) a nucleic acid encoding a fusion protein comprising a chaperone protein and an immunoglobulin, or a fragment thereof, (i) a nucleic acid encoding a flavivirus protein, or an antigenic portion thereof, wherein each nucleic acid is operably linked to a promoter. In exemplary embodiments, the flavivirus protein is a Zika virus (ZIKV) protein. Accordingly, the present invention provides an expression vector system comprising (i) a nucleic acid encoding a fusion protein comprising a chaperone protein and an immunoglobulin, or a fragment thereof, (i) a nucleic acid encoding a Zika virus (ZIKV) protein, or an antigenic portion thereof, wherein each nucleic acid is operably linked to a promoter.

[0116] As used herein, the term "expression vector system" refers to one expression vector comprising all components or a set of two or more expression vectors designed to function together. For purposes herein, the term "expression vector" means a genetically-modified oligonucleotide or polynucleotide construct that permits the expression of an mRNA, protein, polypeptide, or peptide by a host cell, when the construct comprises a nucleotide sequence encoding the mRNA, protein, polypeptide, or peptide, and the expression vector is contacted with the cell under conditions sufficient to have the mRNA, protein, polypeptide, or peptide expressed within the cell. The expression vectors) of the disclosure are not naturally- occurring as a whole. However, parts of the vectors can be naturally-occurring.

[0117] The expression vectors of the present invention comprise any type of nucleotides, including, but not limited to DNA and RNA, which may be single- stranded or double- stranded, synthesized or obtained in part from natural sources, and which in exemplary aspects contain natural, non-natural or altered nucleotides. In exemplary aspects, the altered nucleotides or non-naturally occurring internucleotide linkages do not hinder the transcription or replication of the vector. In exemplary aspects, the expression vector system comprises one or more modified or non-natural nucleotides selected from the group consisting of: 5- fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4- acetylcytosine, 5-(carboxyhydroxymethyl) uracil, 5- carboxymethylaminomethyl-2- thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D- galactosyl queuosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-climethylguanine, 2- methyladenine, 2-methylguanine, 3-me1hylcytosine, 5-methylcytosine, N -substituted adenine, 7-methylguanine, 5-methylammomethyluracil, 5- methoxyaminornethyl-2- thiouracil, beta-D-mannosyl queuosine, 5'- methoxycarbox>Tnethyluracil, 5-methoxyuracil, 2- methylthio-N6-isopentenyladenine, uracil-5 -oxyacetic acid (v), wybutoxosine, pseudouracil, queuosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, 3- (3 -amino-3 -N-2-carboxypropyl ) uracil, and 2,6- diaminopurine.

[0118] The expression vectors disclosed herein in illustrative aspects comprise naturally- occurring or non-naturally-occurring internucleotide linkages, or both types of linkages. In exemplary aspects, the expression vector system comprises one or more modified internucleotide linkages such as phosphoroamidate linkages and phosphorothioate linkages.

[0014] The expression vector system of the present invention may comprise any one or more suitable expression vectors, and may include one or more expression vectors used to transform or transfect any suitable host. Suitable expression vectors include those designed for propagation and expansion or for expression or both, such as plasmids and viruses. In various embodiments, the expression vector system in exemplary aspects comprises one or more expression vectors such as those from the pUC series (Fermentas Life Sciences), the pBluescript series (Stratagene, LaJoIIa, CA), the pET series (Novagen, Madison, WI), the pGEX series (Pharmacia Biotech, Uppsala, Sweden), and the pEX series (Clontech, Palo Aho, CA). Bacteriophage vectors, such as λΘΤΙΟ, λΘΉ 1, IZapIl (Stratagene), λΕΜΒ1_4, and λΝΜΙ 149, also can be used. Examples of plant expression vectors include pBIOl, pBI101.2, pBI101.3, pBI121 and pBIN19 (Clontech). Examples of animal expression vectors include pEUK-Cl, pMAM and pMAMneo (Clontech). In exemplary aspects, the expression vector system comprises a pBCMGSNeo expression vector and/or a pBCMGHis expression vector, as described in Yamazaki et al., 1999, supra. In exemplary aspects, the expression vector system comprises a viral vector, e.g., a retroviral vector, an adenovirus vector, an adeno-associated virus (AAV) vector, or a lentivirus vector.

[0015] The expression vectors and systems comprising the expression vectors of the present invention can be prepared using standard recombinant DNA techniques described in, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, and Ausubel et al., Current Protocols in Molecular Biology (1994). Constructs of expression vectors, which are circular or linear, can be prepared to contain a replication system functional in a prokaryotic or eukaryotic host cell. Replication systems can be derived, e.g., from ColEl, 2 μ plasmid, λ, SV40, bovine papilloma virus, and the like.

[0016] The expression vector system may be designed for either transient expression, for stable expression, or for both. In exemplary aspects, the recombinant expression vector system comprises elements necessary for integration into the host genome. Also, the recombinant expression vectors can be made for constitutive expression or for inducible expression. For example, the recombinant expression vector system may comprise one or more suicide genes and/or one or more constitutive or inducible promoters.

[0017] In exemplary aspects, the expression vector system comprises regulatory sequences, such as transcription and translation initiation and termination codons, which are specific to the type of host (e.g., bacterium, fungus, or animal) into which the vector is to be introduced, as appropriate and taking into consideration whether the vector is DNA- or RNA- based.

[0018] The expression vector system in exemplar}' aspects comprises a native promoter operably linked to the nucleic acid comprising a nucleotide sequence encoding the fusion protein or the flavivirus (e.g., ZIKV) protein, or an antigenic portion thereof, or the nucleotide sequence which is complementary to or which hybridizes to the nucleotide sequence encoding the fusion protein or the flavivirus (e.g., ZIKV) protein, or an antigenic portion thereof. The selection of promoters, e.g., strong, weak, inducible, tissue-specific and developmental- specific, is within the ordinary skill of the artisan. Similarly, the combining of a nucleotide sequence with a promoter is also within the skill of the artisan. The promoter can be a non-viral promoter or a viral promoter, e.g., a cytomegalovirus (CMV) promoter, an SV40 promoter, an RSV promoter, metallothionein (Mth) promoter, or a promoter found in the long-terminal repeat of the murine stem cell virus.

[0019] An expression vector also can include transcription enhancer elements, such as those found in SV40 virus, Hepatitis B virus, cytomegalovirus, immunoglobulin genes, metallothionein, and β-actin (see, Bittner et ah, Meth Enzymol 1987, 153:516-544; and Gorman, Curr Op Biotechnol 1990, 1:36-47). In addition, an expression vector can contain sequences that permit maintenance and replication of the vector in more than one type of host cell, or integration of the vector into the host chromosome. Such sequences include, without limitation, to replication origins, autonomously replicating sequences (ARS), centromere DNA, and telomere DNA.

[0119] In exemplary aspects, the nucleic acid encoding the fusion protein is operably linked to the same promoter which is also operably linked to the nucleic acid encoding the flavivirus (e.g., ZIKV) protein or an antigenic portion thereof. In exemplary aspects, the nucleic acid encoding the fusion protein is operably linked to a promoter which is different from the promoter which is operably linked to the nucleic acid encoding the flavivirus (e.g., ZIKV) protein, or an antigenic portion thereof. In exemplary aspects, the nucleic acid encoding the fusion protein is operably linked to a CMV promoter. In exemplary aspects, the nucleic acid encoding the flavivirus (e.g., ZIKV) protein, or an antigenic portion thereof, is operably linked to a Mth promoter

[0120] In exemplary aspects, the expression vector system of the present invention comprises only one recombinant expression vector. In exemplary aspects, the nucleic acid encoding the fusion protein and the nucleic acid encoding the flavivirus (e.g., ZIKV) protein, or antigenic portion thereof, are present on the same expression vector.

[0121] Alternatively, the expression vector system comprises more than one expression vector. In exemplary aspects, the expression vector system comprises one expression vector comprising the nucleic acid encoding the fusion protein and one expression vector per number of different flavivirus (e.g., ZIKV) proteins, or antigenic portion, encoded by the system. In exemplary aspects, the expression vector system comprises a nucleic acid encoding the fusion protein and one or two different flavivirus (e.g., ZIKV) protein, or antigenic portion, and thereby comprises three expression vectors. In exemplary aspects, the recombinant expression vector system comprises two, three, four, five, or more recombinant expression vectors. In exemplary aspects, the expression vector system comprises at least two expression vectors and the nucleic acid encoding the fusion protein is present on an expression vector which is different from the expression vector comprising the nucleic acid encoding the flavivirus (e.g., ZIKV) protein, or antigenic portion thereof.

[0122] The expression vector system of the present invention in exemplary aspects comprises additional components. For example, in exemplary aspects, each vector of the recombinant expression vector system comprises a selectable marker. In exemplary aspects, the selectable marker is a gene product which confers resistance to an antibiotic, including but not limited to ampicillin, kanamycin, neomycin/G418, tetracycline, geneticin, triclosan, puromycin, zeocin, and hygromycin. in exemplary aspects, the selectable marker is one or more of kanamycin resistance genes, puromycin resistance genes, zeocin resistance genes, neomycin/G418 resistance genes, hygromycin resistance genes, histidinol resistance genes, tetracycline resistance genes, geneticin resistance genes, triclosan resistance genes, R- fluroorotic acid resistance genes, 5-fluorouracil resistance genes and ampicillin resistance genes. Combination of any of the selectable markers described herein is contemplated. In exemplary aspects, when the system comprises more than one recombinant expression vector, each vector comprises a selectable marker. In exemplary aspects, each vector has the same selectable marker. Alternatively, each vector within the system comprises a different selectable marker.

[0123] In some embodiments, the expression vector system further comprises a nucleic acid encoding a bovine papilloma virus (BPV) protein. The BPV early region encodes nonstructural proteins El to E7. El and E2 are nonstructural proteins derived from bovine papilloma virus (BPV). E5, E6 and E7 are viral oncoproteins derived from BPV and have the Gene Accession ID Numbers 1489021, 3783667 and 3783668, respectively. In exemplary aspects, the expression vector system further comprises a nucleotide sequence which encodes a BPV El and/or a BPV E2. In exemplary aspects, the expression vector system further comprises a nucleic acid encoding an El amino acid sequence of SEQ ID NO: 19 and/or an E2 amino acid sequence of SEQ ID NO: 22. In exemplary aspects, the expression vector system does not comprise a nucleic acid encoding a BPV viral oncoprotein. In exemplary aspects, the expression vector system does not comprise a nucleic acid encoding ES, E6, and/or E7. In exemplary aspects, the expression vector system does not comprise nucleotides 3878 to 4012 of GenBank Accession No. NC_001522.1 encoding E5, nucleotides 91 to 519 of GenBank Accession No. NC_007612.1 encoding E6, and/or nucleotides 522 to 836 of GenBank Accession No. NC_007612.1 encoding E7. In exemplary aspects, the expression vector system does not comprise any one of SEQ ID NOs: 32-34.

[0124] In some embodiments, the expression vector system comprises one or more elements shown in Figure 1. In some embodiments, the expression vector system comprises the vector shown in Figure 1 or Figure 3. In exemplary aspects, the expression vector system of the present invention comprises the sequence of SEQ ID NO: 24 and/or 25.

[0125] In various embodiments, the expression vector system of the present invention encodes proteins that can be expressed in prokaryotic and eukaryotic cells. In various embodiments, expression vectors can be introduced into host cells for producing the fusion protein and the ZIKV proteins. There are a variety of techniques available for introducing nucleic acids into viable cells. Techniques suitable for the transfer of nucleic acid into mammalian cells in vitro include the use of liposomes, electroporation, microinjection, cell fusion, polymer-based systems, DEAE-dextran, viral transduction, the calcium phosphate precipitation method, etc. For in vivo gene transfer, a number of techniques and reagents may also be used, including eletroporation, liposomes; natural polymer-based delivery vehicles, such as chitosan and gelatin; viral vectors arc also suitable for in vivo transduction.

[0126] The present invention further provides a cell (e.g., a host cell) comprising the expression vector system described herein. Cells (e.g., host cells) may be cultured in vitro or genetically engineered, for example. Host cells can be obtained from normal or affected subjects, including healthy humans, patients infected with the ZIKA virus, private laboratory deposits, public culture collections such as the American Type Culture Collection, or from commercial suppliers.

[0127] Cells that can be used include, without limitation, epithelial cells, endothelial cells, keratinocytes, fibroblasts, muscle cells, hepatocytes; blood cells such as T lymphocytes, B lymphocytes, monocytes, macrophages, neutrophils, eosinophils, megakaryocytes, or granulocytes, various stem or progenitor cells, such as hematopoietic stem or progenitor cells (e.g., as obtained from bone marrow), umbilical cord blood, peripheral blood, fetal liver, etc., and tumor cells (e.g., human tumor cells). The choice of cell type can be determined by one of skill in the art. In various embodiments, the cells are irradiated.

[0128] Flavivirus

[0129] As used herein, the term "flavivirus" refers to any one of the genus of viruses in the family Flaviviridae, including, but not limited to the West Nile virus, dengue virus, tick- borne encephalitis virus, yellow fever virus, Zika virus and several other viruses which may cause encephalitis. The term "flavivirus" also refers to any insect-specific flavi viruses, including, for example, cell fusing agent virus (CFAV), Palm Creek virus (PCV), and Parramatta River virus (PaRV) (McLean et al., Virology 486: 272-283 (2015). In exemplary aspects, the flavivirus is Dengue virus, West Nile virus, or Yellow fever virus.

[0130] Flavivirus Proteins

[0131] In various embodiments, the expression vector system of the present invention comprises a nucleic acid encoding a flavivirus protein, or an antigenic portion thereof. In some embodiments, the expression vector comprises two or more nucleic acids each encoding a different flavivirus protein, or an antigenic portion thereof. In exemplary aspects, the flavivirus is Dengue virus, West Nile virus, or Yellow fever virus and the flavivirus protein is selected from the group consisting of: flavivirus polyprotein [Dengue virus 2] which is described in the NCBI database as NCBI Reference Sequence: NP_056776.2; polyprotein precursor [Yellow fever virus] which is described in the NCBI database as NCBI Reference Sequence: NP_041726.1; and flavivirus polyprotein [West Nile virus] which is described in the NCBI database as NCBI Reference Sequence: NP_041724.2.

[0132] In various embodiments, the flavivirus is ZIKV. In some embodiments, the expression vector system of the present invention comprises a nucleic acid encoding a Zika virus (ZIKV) protein, or an antigenic portion thereof. In exemplary aspects, the expression vector comprises two or more nucleic acids each encoding a different ZIKV protein, or an antigenic portion thereof. The structure of the ZIKV virus is known. See, for example, Kostyuchenko et al. (2016) Nature 533:425-428, the contents of which are hereby incorporated by reference. In various embodiments, the expression vector system of the invention comprises a nucleic acid encoding any of the known ZIKV protein or an antigenic portion, fragments, or variants thereof. In various embodiments, the ZIKV protein is one or more of membrane glycoprotein precursor M, envelope protein E, nonstructural protein NS1, nonstructural protein NS2A, nonstructural protein NS2B, nonstructural protein NS3, nonstructural protein NS4A, and nonstructural protein NS4B, or antigenic portions, fragments, or variants thereof. In some embodiments, the membrane glycoprotein precursor M comprises the amino acid sequence of SEQ ID NO: 10, the envelope protein E comprises the amino acid sequence of SEQ ID NO: 11, the nonstructural protein NS1 comprises the amino acid sequence of SEQ ID NO: 12, the nonstructural protein NS2A comprises the amino acid sequence of SEQ ID NO: 13, the nonstructural protein NS2B comprises the amino acid sequence of SEQ ID NO: 14, the nonstructural protein NS3 comprises the amino acid sequence of SEQ ID NO: 15, the nonstructural protein NS4A comprises the amino acid sequence of SEQ ID NO: 16, and the nonstructural protein NS4B comprises the amino acid sequence of SEQ ID NO: 17. In some embodiments, the expression vector system comprises a nucleic acid encoding the ZIKV protein membrane glycoprotein precursor M and a nucleic acid encoding the ZIKV protein envelope protein E, or antigenic portions, fragments, or variants thereof. In some embodiments, the expression vector system comprises a nucleic acid encoding the amino acid sequence of SEQ ID NO: 10 and a nucleic acid encoding the amino acid sequence of SEQ ID NO: 11. [0133] Alternatively, in some embodiments, the expression vector system of the present invention may comprise a nucleic acid encoding a ZIKV protein variant that contains one or more substitutions, deletions, or additions as compared to any known wild type amino acid sequence of the ZIKV protein or a ZIKV amino acid sequence disclosed herein.

[0134] In various embodiments, the ZIKV protein may comprises an amino acid sequence that has at least about 60%, or at least about 61%, or at least about 62%, or at least about 63%, or at least about 64%, or at least about 65%, or at least about 66%, or at least about 67%, or at least about 68%, or at least about 69%, or at least about 70%, or at least about 71%, or at least about 72%, or at least about 73%, or at least about 74%, or at least about 75%, or at least about 76%, or at least about 77%, or at least about 78%, or at least about 79%, or at least about 80%, or at least about 81%, or at least about 82%, or at least about 83%, or at least about 84%, or at least about 85%, or at least about 86%, or at least about 87%, or at least about 88%, or at least about 89%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% sequence identity with any known wild type amino acid sequence of the ZIKV protein or a ZIKV amino acid sequence disclosed herein (e.g. about 60%, or about 61%, or about 62%, or about 63%, or about 64%, or about 65%, or about 66%, or about 67%, or about 68%, or about 69%, or about 70%, or about 71%, or about 72%, or about 73%, or about 74%, or about 75%, or about 76%, or about 77%, or about 78%, or about 79%, or about 80%, or about 81%, or about 82%, or about 83%, or about 84%, or about 85%, or about 86%, or about 87%, or about 88%, or about 89%, or about 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99% sequence identity).

[0135] Thus, in some embodiments, the ZIKV protein portion of the nucleic acid can encode an amino acid sequence that differs from any known wild type amino acid sequence of the ZIKV protein or a ZIKV amino acid sequence disclosed herein at one or more amino acid positions, such that it contains one or more conservative substitutions, non-conservative substitutions, splice variants, isoforms, homologues from other species, and polymorphisms.

[0136] In some embodiments, present invention provides an expression vector system comprising (i) a nucleic acid encoding the amino acid sequence of SEQ ID NO: 2, optionally lacking the terminal KDEL sequence and (ii) a nucleic acid encoding the amino acid sequence of SEQ ID NO: 11, wherein each nucleic acid is operably linked to a promoter. In some embodiments, present invention provides a method of treating or preventing a flavivirus infection in a subject, comprising administering to the subject this expression.

[0137] In some embodiments, present invention provides a biological cell comprising a first recombinant protein having an amino acid sequence of at least about 90%, or at least about 95% or at least about 97%, or at least about 98%, or at least about 99% sequence identity with SEQ ID NO: 2, optionally lacking the terminal KDEL sequence and a second recombinant protein having an amino acid sequence of at least about 90%, or at least about 95% or at least about 97%, or at least about 98%, or at least about 99% sequence identity with SEQ ID NO: 11. In some embodiments, present invention provides a method of treating or preventing a flavivirus infection in a subject, comprising administering to the subject this expression.

[0138] As defined herein, a "conservative substitution" denotes the replacement of an amino acid residue by another, biologically similar, residue. Typically, biological similarity, as referred to above, reflects substitutions on the wild type sequence with conserved amino acids. For example, conservative amino acid substitutions would be expected to have little or no effect on biological activity, particularly if they represent less than 10% of the total number of residues in the polypeptide or protein. Conservative substitutions may be made, for instance, on the basis of similarity in polarity, charge, size, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the amino acid residues involved. The 20 naturally occurring amino acids can be grouped into the following six standard amino acid groups: (1) hydrophobic: Met, Ala, Val, Leu, He; (2) neutral hydrophilic: Cys, Ser, Thr; Asn, Gin; (3) acidic: Asp, Glu; (4) basic: His, Lys, Arg; (5) residues that influence chain orientation: Gly, Pro; and (6) aromatic: Trp, Tyr, Phe. Accordingly, conservative substitutions may be effected by exchanging an amino acid by another amino acid listed within the same group of the six standard amino acid groups shown above. For example, the exchange of Asp by Glu retains one negative charge in the so modified polypeptide. In addition, glycine and proline may be substituted for one another based on their ability to disrupt a-helices. Additional examples of conserved amino acid substitutions, include, without limitation, the substitution of one hydrophobic residue for another, such as isoleucine, valine, leucine, or methionine, or the substitution of one polar residue for another, such as the substitution of arginine for lysine, glutamic for aspartic acid, or glutamine for asparagine, and the like. The term "conservative substitution^'" also includes the use of a substituted amino acid residue in place of an un-substituted parent amino acid residue, provided that antibodies raised to the substituted polypeptide also immunoreact with the un- substituted polypeptide.

[0139] As used herein, "non-conservative substitutions" are defined as exchanges of an amino acid by another amino acid listed in a different group of the six standard amino acid groups (1) to (6) shown above.

[0140] In various embodiments, the substitutions may also include non-classical amino acids (e.g. selenocysteine, pyrrolysine, N-formylmethionine β-alanine, GABA and δ- Aminolevulinic acid, 4-aminobenzoic acid (PABA), D-isomers of the common amino acids, 2,4-diaminobutyric acid, a-amino isobutyric acid, 4-aminobutyric acid, Abu, 2-amino butyric acid, γ-Abu, ε-Ahx, 6-amino hexanoic acid, Aib, 2-amino isobutyric acid, 3-amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosme, citrulline, homocitrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, β-alanine, fluoro-amino acids, designer amino acids such as β methyl amino acids, C a-methyl amino acids, Ν a-methyl amino acids, and amino acid analogs in general).

[0141] Mutations may also be made to the nucleotide sequences of the present ZIKV protein sequence by reference to the genetic code, including taking into account codon degeneracy.

[0142] Chaperones/Fusion proteins

[0100] In various embodiments, the expression vector system of the present invention comprises a nucleic acid encoding a fusion protein comprising a chaperone protein and an immunoglobulin, or a fragment thereof. In exemplary aspects, the chaperone protein is any one of: gp96, Heat shock protein 70 (Hsp70), BiP, or Grp78. The amino acid sequences of such chaperone proteins are known in the art and are provided herein as, SEQ ID NOs: 29-31. In exemplary aspects, the chaperone protein is gp96. The coding region of human gp96 is 2,412 bases in length, and encodes an 803 amino acid protein that includes a 21 amino acid signal peptide at the amino terminus, a potential transmembrane region rich in hydrophobic residues, and an ER retention peptide sequence at the carboxyl terminus (GENBANK® Accession No. X15187; see, Maki et al, Proc Natl Acad Sci USA 1990, 87:5658-5562). The DNA and protein sequences of human gp96 are provided below:

[0020] In exemplary aspects, the gp96 comprises the amino acid sequence of SEQ ID NO: 2. In exemplary aspects, the gp96 comprises the amino acid sequence of SEQ ID NO: 2 but without the terminal KDEL sequence,

[0022] Thus, in some embodiments, the gp96 portion of nucleic acid encoding a gp96-Ig fusion polypeptide can encode an amino acid sequence that differs from the wild type gp96 polypeptide at one or more amino acid positions, such that it contains one or more conservative substitutions, non-conservative substitutions, splice variants, isoforms, homologues from other species, and polymorphisms as described previously.

[0023] In various embodiments, the expression vector system of the present invention comprises a nucleic acid encoding a fusion protein comprising a chaperone protein and an immunoglobulin, or a fragment thereof having the SEQ YD NO: 35.

[0024] In various embodiments, the expression vector system comprises a nucleotide sequence that has at least about 60%, or at least about 61%, or at least about 62%, or at least about 63%, or at least about 64%, or at least about 65%, or at least about 66%, or at least about 67%, or at least about 68%, or at least about 69%, or at least about 70%, or at least about 71%, or at least about 72%, or at least about 73%, or at least about 74%, or at least about 75%, or at least about 76%, or at least about 77%, or at least about 78%, or at least about 79%, or at least about 80%, or at least about 81%, or at least about 82%, or at least about 83%, or at least about 84%, or at least about 85%, or at least about 86%, or at least about 87%, or at least about 88%, or at least about 89%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% sequence identity with SEQ ID NO: 35 (e.g. about 60%, or about 61%, or about 62%, or about 63%, or about 64%, or about 65%, or about 66%, or about 67%, or about 68%, or about 69%, or about 70%, or about 71%, or about 72%, or about 73%, or about 74%, or about 75%, or about 76%, or about 77%, or about 78%, or about 79%, or about 80%, or about 81%, or about 82%, or about 83%, or about 84%, or about 85%, or about 86%, or about 87%, or about 88%, or about 89%, or about 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99% sequence identity with SEQ ID NO: 35).

[0025] Mutations may also be made to the nucleotide sequences of the present fusion proteins by reference to the genetic code, including taking into account codon degeneracy.

[0026] In some embodiments, the chape rone protein may be a heat shock protein. In various embodiments, the heat shock protein is one or more of hsp40, hsp60, hsp70, hsp90, and hspl lO family members, inclusive of fragments, variants, mutants, derivatives or combinations thereof (Hickey, et al, 1989, Mol. Cell. Biol. 9:2615-2626; Jindal, 1989, Mol. Cell. Biol. 9:2279-2283).

[0027] In various aspects, the fusion protein comprises an immunoglobulin or antibody. The antibody may be any type of antibody, i.e., immunoglobulin, known in the art. In illustrative embodiments, the antibody is an antibody of class or isotype IgA, IgD, IgE, IgG, or IgM. In illustrative embodiments, the antibody described herein comprises one or more alpha, delta, epsilon, gamma, and/or mu heavy chains. In illustrative embodiments, the antibody described herein comprises one or more kappa or light chains. In illustrative aspects, the antibody is an IgG antibody and optionally is one of the four human subclasses: IgGl, IgG2, IgG3 and IgG4. Also, the antibody in some embodiments is a monoclonal antibody. In other embodiments, the antibody is a polyclonal antibody. In some embodiments, the antibody is structurally similar to or derived from a naturally-occurring antibody, e.g., an antibody isolated and/or purified from a mammal, e.g., mouse, rabbit, goat, horse, chicken, hamster, human, and the like. In this regard, the antibody may be considered as a mammalian antibody, e.g., a mouse antibody, rabbit antibody, goat antibody, horse antibody, chicken antibody, hamster antibody, human antibody, and the like. In illustrative aspects, the antibody comprises sequence of only mammalian antibodies.

[0143] In illustrative aspects, the fusion protein comprises a fragment of an immunoglobulin or antibody. Antibody fragments include, but are not limited to, the F(ab')2 fragment which may be produced by pepsin digestion of the antibody molecule; the Fab' fragments which may be generated by reducing the disulfide bridges of the F(ab')2 fragment, and the two Fab' fragments which may be generated by treating the antibody molecule with papain and a reducing agent. In exemplary aspects, the fusion protein comprises an Fc fragment of an antibody.

[0144] DNAs encoding immunoglobulin light or heavy chain constant regions are known or readily available from cDNA libraries. See, for example, Adams et al, Biochemistry 1980, 19:2711-2719; Gough et al, Biochemistry 1980 19:2702-2710; Dolby et al, Proc Natl Acad Sci USA 1980, 77:6027-6031; Rice et al, Proc Natl Acad Sci USA 1982, 79:7862-7865; Falkner et al, Nature 1982, 298:286-288; and Morrison et al, Ann Rev Immunol 1984, 2:239-256.

[0145] In some embodiments, a gp96 peptide can be fused to the hinge, CH2 and CH3 domains of murine IgGl (Bowen et al, J Immunol 1996, 156:442-449). This region of the IgGl molecule contains three cysteine residues that normally are involved in disulfide bonding with other cysteines in the lg molecule. Since none of the cysteines are required for the peptide to function as a tag, one or more of these cysteine residues can be substituted by another amino acid residue, such as, for example, serine. [0146] In illustrative aspects, the fusion protein comprises an Fc fragment of an IgGl antibody. In illustrative aspects, the Fc fragment comprises the amino acid sequence of SEQ ID NO: 5.

[0147] In exemplary aspects, the fusion protein comprises a gp96 chaperone protein fused to a Fc fragment of an IgGl antibody. In illustrative aspects, the fusion protein comprises the amino acid sequence of SEQ ID NO: 8.

[0148] A nucleic acid encoding a gp96-Ig fusion sequence can be produced using the methods described in U.S. Patent No. 8,685,384, which is incorporated herein by reference in its entirety. In some embodiments, the gp96 portion of a gp96-Ig fusion protein can contain all or a portion of a wild type gp96 sequence (e.g., the human sequence set forth herein). For example, a secretable gp96-Ig fusion protein can include the first 799 amino acids of the human gp96 sequence provided herein, such that it lacks the C -terminal KDEL sequence. Alternatively, the gp96 portion of the fusion protein can have an amino acid sequence that contains one or more substitutions, deletions, or additions as compared to any known wild type amino acid sequences of gp96 or a gp96 amino acid sequence disclosed herein.

[0149] In various embodiments, the gp96-Ig fusion protein and/or the flavivirus protein or an antigenic portion thereof, further comprises a linker. In various embodiments, the linker may be derived from naturally-occurring multi-domain proteins or are empirical linkers as described, for example, in Chichili et al, (2013), Protein Sci. 22(2): 153-167, Chen et al, (2013), Adv Drug Deliv Rev. 65(10): 1357-1369, the entire contents of which are hereby incorporated by reference. In some embodiments, the linker may be designed using linker designing databases and computer programs such as those described in Chen et al, (2013), Adv Drug Deliv Rev. 65(10): 1357-1369 and Crasto et. al, (2000), Protein Eng. 13(5):309- 312, the entire contents of which are hereby incorporated by reference. In some embodiments, the linker is a synthetic linker such as PEG. In other embodiments, the linker is a polypeptide. In some embodiments, the linker is less than about 100 amino acids long. For example, the linker may be less than about 100, about 95, about 90, about 85, about 80, about 75, about 70, about 65, about 60, about 55, about 50, about 45, about 40, about 35, about 30, about 25, about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 12, about 11, about 10, about 9, about 8, about 7, about 6, about 5, about 4, about 3, or about 2 amino acids long. In some embodiments, the linker is flexible. In another embodiment, the linker is rigid. In various embodiments, the linker is substantially comprised of glycine and serine residues (e.g. about 30%, or about 40%, or about 50%, or about 60%, or about 70%, or about 80%, or about 90%, or about 95%, or about 97% glycines and serines).

[0150] In various embodiments, the linker is a hinge region of an antibody (e.g., of IgG, IgA, IgD, and IgE, inclusive of subclasses (e.g. IgGl, IgG2, IgG3, and IgG4, and IgAl and IgA2)). The hinge region, found in IgG, IgA, IgD, and IgE class antibodies, acts as a flexible spacer, allowing the Fab portion to move freely in space. In contrast to the constant regions, the hinge domains are structurally diverse, varying in both sequence and length among immunoglobulin classes and subclasses. For example, the length and flexibility of the hinge region varies among the IgG subclasses. The hinge region of IgGl encompasses amino acids 216-231 and, because it is freely flexible, the Fab fragments can rotate about their axes of symmetry and move within a sphere centered at the first of two inter-heavy- chain disulfide bridges. IgG2 has a shorter hinge than IgGl, with 12 amino acid residues and four disulfide bridges. The hinge region of IgG2 lacks a glycine residue, is relatively short, and contains a rigid poly-proline double helix, stabilized by extra inter-heavy chain disulfide bridges. These properties restrict the flexibility of the IgG2 molecule. IgG3 differs from the other subclasses by its unique extended hinge region (about four times as long as the IgGl hinge), containing 62 amino acids (including 21 prolines and 11 cysteines), forming an inflexible poly-proline double helix. In IgG3, the Fab fragments are relatively far away from the Fc fragment, giving the molecule a greater flexibility. The elongated hinge in IgG3 is also responsible for its higher molecular weight compared to the other subclasses. The hinge region of IgG4 is shorter than that of IgGl and its flexibility is intermediate between that of IgGl and IgG2. The flexibility of the hinge regions reportedly decreases in the order IgG3>IgGl>IgG4>IgG2.

[0151] Additional illustrative linkers include, but are not limited to, linkers having the sequence LE, GGGGS, (GGGGS)n(n=M), (Gly)8 , (Gly)e , (EAAAK)_n (n=l-3),

A(EAAAK)nA (n = 2-5), AEAAAKEAAAKA, A(EAAAK)₄ALEA(EAAAK)₄A, PAPAP, KESGSVSSEQLAQFRSLD, EGKSSGSG SESKST, GSAGSAAGSGEF, and (XP)n, with X designating any amino acid, e.g., Ala, Lys, or Glu.

[0152] In various embodiments, the linker may be functional. For example, without limitation, the linker may function to improve the folding and/or stability, improve the expression, improve the pharmacokinetics, and/or improve the bioactivity of the present compositions. In another example, the linker may function to target the compositions to a particular cell type or location. [0153] Host Cells

[0154] Also provided by the present invention is a host cell comprising any one of the expression vector systems described herein. As used herein, the term "host cell" refers to any type of cell that can contain the inventive expression vector system. The host cell can be a eukaryotic cell, e.g., plant, animal, fungi, or algae, or can be a prokaryotic cell, e.g., bacteria or protozoa. The host cell can be a cultured cell or a primary cell, i.e.. isolated directly from an organism, e.g., a human. The host cell can be an adherent cell or a suspended cell, i.e.. a cell that grows in suspension. In illustrative aspects, the host cell is a mammalian host cell. In illustrative aspects, the host cell is a human host cell. In illustrative aspects, the human host cell is an NIH 3T3 cell or an HEK 293 cell. The presently disclosed host cells are not limited to just these two types of cells, however, and may be any cell type described herein. For example, the cells that can be used include, without limitation, epithelial cells, endothelial cells, keratinocytes, fibroblasts, muscle cells, hepatocytcs; blood cells such as T lymphocytes, B lymphocytes, monocytes, macrophages, neutrophils, eosinophils, megakaryocytes, or granulocytes, various stem or progenitor cells, such as hematopoietic stem or progenitor cells (e.g., as obtained from bone marrow), umbilical cord blood, peripheral blood, fetal liver, etc., and tumor cells (e.g., human tumor cells). The choice of cell type can be determined by one of skill in the art. In various embodimens, the cells are irradiated.

[0155] Also provided by the present invention is a population of cells comprising at least one host cell described herein. The population of cells can be a heterogeneous population comprising the host cell comprising any of the recombinant expression vectors described, in addition to at least one other cell. Alternatively, the population of cells can be a substantially homogeneous population, in which the population comprises mainly host cells (e.g., consisting essentially of) comprising the expression vectors). The population also can be a clonal population of cells, in which all cells of the population are clones of a single host cell comprising the recombinant expression vectors), such that all cells of the population comprise the recombinant expression vectors). In one embodiment of the invention, the population of cells is a clonal population comprising host cells comprising the expression vector(s) as described herein. In illustrative aspects, the cell population of the present invention is one wherein at least 50% of the cells are host cells as described herein. In illustrative aspects, the cell population of the present invention is one wherein at least 60%, at least 70%, at least 80% or at least 90% or more of the cells are host cells as described herein. [0156] Compositions

[0157] The present invention also provides a composition comprising an expression vector system or a host cell or a population of cells, as described herein, and an excipient, carrier, or diluent. In exemplary aspects, the composition is a pharmaceutical composition. In illustrative aspects, the composition may comprise virus particles containing the vector expression system In illustrative aspects, the composition is a sterile composition and optionally is suitable for administration to a human. In illustrative aspects, the composition is ready for use. In illustrative aspects, the composition comprises a unit dose of host cells. In illustrative aspects, the unit dose is about 10³, about 10⁶, about 10⁷, about 10⁸, about 10⁹, about 10¹⁰, about 10¹¹, about 10¹², about 10¹³, about 10¹⁴, about 10¹⁵, or more host cells transfected with the expression vector system.

[0158] The pharmaceutical composition can comprise any pharmaceutically acceptable ingredient, including, for example, acidifying agents, additives, adsorbents, aerosol propellants, air displacement agents, alkalizing agents, anticaking agents, anticoagulants, antimicrobial preservatives, antioxidants, antiseptics, bases, binders, buffering agents, chelating agents, coating agents, coloring agents, desiccants, detergents, diluents, disinfectants, disintegrants, dispersing agents, dissolution enhancing agents, dyes, emollients, emulsifying agents, emulsion stabilizers, fillers, film forming agents, flavor enhancers, flavoring agents, flow enhancers, gelling agents, granulating agents, humectants, lubricants, mucoadhesives, ointment bases, ointments, oleaginous vehicles, organic bases, pastille bases, pigments, plasticizers, polishing agents, preservatives, sequestering agents, skin penetrants, solubilizing agents, solvents, stabilizing agents, suppository bases, surface active agents, surfactants, suspending agents, sweetening agents, therapeutic agents, thickening agents, tonicity agents, toxicity agents, viscosity-increasing agents, water-absorbing agents, water- miscible cosolvents, water softeners, or wetting agents.

[0159] The pharmaceutical compositions may be formulated to achieve a physiologically compatible pH. In some embodiments, the pH of the pharmaceutical composition may be at least 5, at least 5.S, at least 6, at least 6.5, at least 7, at least 7.5, at least 8, at least 8.5, at least 9, at least 9.5, at least 10, or at least 10.5 up to and including pH 11, depending on the formulation and route of administration, for example between 4 and 7, or 4.5 and 5.5. In illustrative embodiments, the pharmaceutical compositions may comprise buffering agents to achieve a physiological compatible pH. The buffering agents may include any compounds capable of buffering at the desired pH such as, for example, phosphate buffers (e.g., PBS), triethanolamine, Tris, bicine, TAPS, tricine, HEPES, TES, MOPS, PIPES, cacodylate, MES, acetate, citrate, succinate, histidine or other pharmaceutically acceptable buffers.

[0160] The present invention therefore provides compositions including pharmaceutical compositions containing an expression vector system or a cell containing the expression vector system as described herein, in combination with a physiologically and pharmaceutically acceptable carrier. In various embodiments, the physiologically and pharmaceutically acceptable carrier can include any of the well-known components useful for immunization. The carrier can facilitate or enhance an immune response to an antigen administered in a vaccine. The cell formulations can contain buffers to maintain a preferred pH range, salts or other components that present an antigen to an individual in a composition that stimulates an immune response to the antigen. The physiologically acceptable carrier also can contain one or more adjuvants that enhance the immune response to an antigen. Pharmaceutically acceptable carriers include, for example, pharmaceutically acceptable solvents, suspending agents, or any other pharmacologically inert vehicles for delivering compounds to a subject. Pharmaceutically acceptable carriers can be liquid or solid, and can be selected with the planned manner of administration in mind so as to provide for the desired bulk, consistency, and other pertinent transport and chemical properties, when combined with one or more therapeutic compounds and any other components of a given pharmaceutical composition. Typical pharmaceutically acceptable carriers include, without limitation: water, saline solution, binding agents (e.g., polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g., lactose or dextrose and other sugars, gelatin, or calcium sulfate), lubricants (e.g., starch, polyethylene glycol, or sodium acetate), disintegrates (e.g., starch or sodium starch glycolate), and wetting agents (e.g., sodium lauryl sulfate). Compositions can be formulated for subcutaneous, intramuscular, or intradermal administration, or in any manner acceptable for administration.

[0161] An adjuvant refers to a substance which, when added to an immunogenic agent such as a cell containing the expression vector system of the invention, nonspecifically enhances or potentiates an immune response to the agent in the recipient host upon exposure to the mixture. Adjuvants can include, for example, oil-in-water emulsions, water-in oil emulsions, alum (aluminum salts), liposomes and microparticles, such as, polysytrene, starch, polyphosphazene and polylactide/polyglycosides.

[0162] Adjuvants can also include, for example, squalene mixtures (SAF-I), muramyl peptide, saponin derivatives, mycobacterium cell wall preparations, monophosphoryl lipid A, mycotic acid derivatives, nonionic block copolymer surfactants, Quil A, cholera toxin B subunit, polyphosphazene and derivatives, and immunostimulating complexes (ISCOMs) such as those described by Takahashi et al, Nature 1990, 344:873-875. For veterinary use and for production of antibodies in animals, mitogenic components of Freund's adjuvant (both complete and incomplete) can be used. In humans, Incomplete Freund's Adjuvant (IFA) is a useful adjuvant. Various appropriate adjuvants are well known in the art (see, for example, Warren and Chedid, CRC Critical Reviews in Immunology 1988, 8:83; and Allison and Byars, in Vaccines: New Approaches to Immunological Problems, 1992, Ellis, ed., Butterworth-Heinemann, Boston). Additional adjuvants include, for example, bacille Calmett-Guerin (BCG), DETOX (containing cell wall skeleton of Mycobacterium phlei (CWS) and monophosphoryl lipid A from Salmonella minnesota (MPL)), and the like (see, for example, Hoover et al, J Clin Oncol 1993, 11:390; and Woodlock et al, J Immunother 1999, 22:251-259).

[0163] Routes of Administration

[0164] Methods of administering cells to a subject are well-known, and include, but not limited to perfusions, infusions and injections. See, e.g., Burch et al., Clin Cancer Res 6(6): 2175-2182 (2000), Dudley et al., J Clin Oncol 26(32): 5233-5239 (2008); Khan et al., Cell Transplant 19:409-418 (2010); Gridelli et al., Liver Transpl 18:226-237 (2012)).

[0165] Methods of Use

[0166] Without being bound to a particular theory, the methods of the present invention advantageously rely on the chaperone function of the secreted fusion protein. The fusion protein chaperones the one or more ZIKV proteins or antigen portions thereof, which are efficiently taken up by activated antigen presenting cells (APCs). The APCs act to cross- present the ZIKV proteins or antigen portions thereof via MHC I to CD8+ CTLs, whereupon an avid, antigen specific, cytotoxic CD8+ T cell response is stimulated. Without being bound to a particular theory, the expression vector systems of the present invention are advantageously capable of initiating both an innate immune response (including, e.g., activation of APCs, pro-inflammatory cytokine release, activation of NK cells), and an adaptive immune response (including, e.g., priming, activation and proliferation of antigen specific CTLs). Such dual-activation leads to successful clearance of the antigen/pathogen.

[0101] Accordingly, in various embodiments, the present invention provides a method of eliciting an immune response against a flavivirus, e.g., Zika virus (ZIKV), in a subject. In illustrative embodiments, the method comprises administering to the subject the expression vector as disclosed herein, or a population of cells transfected with the expression vector. If the subject is a pregnant female, the immune response is detected in the placenta and/or decidua in various embodiments. For example, in various instances, the method inhibits or reduces the severit of infection in a fetus and/or inhibits or reduces the severity of the biological effects of ZIKV infection of the fetus. In some embodiments, methods of the invention induce immune responses in the placenta and prevent flavivirus (e.g., ZIKV) infection to the embryo or fetus. In some embodiments, methods of the invention induce virus-specific T cell response (e.g., CD8 T cells or cytotoxic T lymphocytes) in the placenta and/or the decidua resulting in clearance of the virus (for example, before it reaches the embryo or fetus).

[0102] In various embodiments, the present methods stimulate an immune response, e.g. against a flavivirus, e.g., Zika virus, in various structures within the placenta and/or the decidua, where the flavivirus, e.g., Zika. virus, is transmitted and/or infects the placenta, without wishing to be bound by theory, via the blood-syncytiotrophoblast interface and or the uterus-trophoblast interface.

[0103] The present invention also provides a method of treating or preventing a Zika virus infection in a subject, comprising administering to the subject the expression vector as disclosed herein, or a population of cells transfected with the expression vector. In various embodiments, the subject is an embryo or fetus.

[0167] The present invention also provides a method of treating or preventing one or more birth defects in an embryo or fetus, including fetal brain defects (such as microcephaly), eye defects, hearing loss, and impaired growth, fever, rash, joint pain, or conjunctivitis (red eyes). The present invention also provides a method of treating or preventing one or more symptoms/associated diseases of Zika infection including without limitation Guillain-Barre syndrome, muscle pain, headache, fever, rash, joint pain, and conjunctivitis.

[0168] As used herein, the term "treat,^'" as well as words related thereto, do not necessarily imply 100% or complete treatment. Rather, there are varying degrees of treatment of which one of ordinary skill in the art recognizes as having a potential benefit or therapeutic effect. In this respect, the methods of treating a ZIKV infection of the present invention can provide any amount or any level of treatment. Furthermore, the treatment provided by the method of the present invention may include treatment of one or more conditions or symptoms or signs of the infection, being treated. Also, the treatment provided by the methods of the present invention may encompass slowing the progression of the infection. For example, the methods can treat the infection by virtue of eliciting an immune response against ZIKV, stimulating or activating CD8+ T cells specific for ZIKV to proliferate, and the like.

[0169] As used herein, the term "prevent" and words stemming therefrom encompasses inhibiting or otherwise blocking infection by ZIKV. As used herein, the term "inhibit" and words stemming therefrom may not be a 100% or complete inhibition or abrogation. Rather, there are varying degrees of inhibition of which one of ordinary skill in the art recognizes as having a potential benefit or therapeutic effect. In this respect, the presently disclosed expression vector systems or host cells may inhibit ZIKV infection to any amount or level. In illustrative embodiments, the inhibition provided by the methods of the present invention is at least or about a 10% inhibition (e.g., at least or about a 20% inhibition, at least or about a 30% inhibition, at least or about a 40% inhibition, at least or about a 50% inhibition, at least or about a 60% inhibition, at least or about a 70% inhibition, at least or about a 80% inhibition, at least or about a 90% inhibition, at least or about a 95% inhibition, at least or about a 98% inhibition).

[0104] In various embodiments, methods of the invention prevent, alleviate, and/or treat one or more symptoms associated with ZIKV infection. Illustrative symptoms that may be treated include, but are not limited to fever, rash (e.g., skin rash), muscle and/or joint pain, swollen joints, malaise, headache, conjunctivitis (red eyes), post-infection asthenia, digestive problems including abdominal pain, diarrhea, constipation, mucous membrane ulcerations (aphthae), pruritus, meningoencephalitis, and Guillain-Barre syndrome.

[0105] In various embodiments, methods of the invention may prevent, alleviate, and/or treat one or more symptoms associated with ZIKV infection in pregnant women including those symptoms described above. Additionally, methods of the invention may prevent spontaneous abortions in pregnant women.

[0106] Without wishing to be bound by theory, it is believed that the present invention enhances placental functions against ZIKV infection. In various embodiments, administration of the expression vector system of the invention or the cell including the expression vector system prevents and/or reduces pathological changes in the placenta induced by ZIKV infection. [0107] Without wishing to be bound by theory, it is believed that methods of the invention prevent the placenta from conveying the ZIKV to the embryo or fetus. For example, methods of the invention may prevent the ZIKV from reaching the fetal brain by transplacental passage, leakage through the trophoblastic plugs, and/or diffusion into the amniotic and yolk sac during embryogenesis. In some embodiments, methods of the invention may prevent the transmission of ZIKV to the placenta through the blood-syncytiotrophoblast interface where the placenta is bathed in maternal blood. In another embodiment, methods of the invention may prevent the transmission of ZIKV to the placenta through the uterus-trophoblast interface where the extra villous trophoblast in humans invade the uterine epithelium and come in contact with maternal immune cells. Alternatively, or additionally, methods of the invention may prevent the placenta from mounting an abnormal response against the ZIKV thus causing defects in the embryo or the fetus. In some embodiments, methods of the invention prevent the ZIKV in semen from reaching the embryo or fetus.

[0108] Accordingly, in various embodiments, methods of the invention prevent, alleviate, and/or treat one or more symptoms associated with ZIKV infection in an embryo or a fetus including an unborn embryo or fetus. In some embodiments, the expression vector system of the invention stimulates immune responses in the placenta and prevent the embryo or fetus from developing congenital abnormalities including microcephaly and other fetal brain defects. Additionally, methods of the invention may prevent the embryo or fetus from developing other health issues including, but not limited to, eye defects, hearing loss, and impaired growth.

[0109] The present expression vector system and cells comprising the same may be administered by any route considered appropriate by a medical practitioner. Illustrative routes of administration include, for example: oral, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, sublingual, intranasal, intracerebral, intravaginal, transdermal, rectally, by inhalation, by electroporation, or topically. Administration can be local or systemic.

[0170] In illustrative aspects, the method comprises intramuscular (1M) administration of the expression vector. In illustrative aspects, the method comprises electroporation or electroporation following the IM administration of expression vector. In various embodiments, electroporation is used to help deliver vectors (genes) into the cell by applying short and intense electric pulses that transiently permeabilize the cell membrane, thus allowing transport of molecules otherwise not transported through a cellular membrane. Methods for electroporating a nucleic acid construct into cells and electroporation devices for such delivery are known. See, for example, Flanagan et al. Cancer Gene Ther (2012) 18:579- 586, WO 2014/066655, US 9,020,605, the entire contents are incorporated by reference.

[0171] In exemplary aspects, DNA (50 μg) containing expression vector that contains gp96-Ig and Z1KV antigens in 50 \iL of saline is injected in the tibialis anterior muscle of anesthetized wild-type C57BL/6 mice. A two-needle array electrode pair is inserted into muscle immediately after DNA deliver)' and the injection site is electroporated with field strength of 50 V/cm (constant) and six electric pulses of 50 ms each by using the AgilePulse in Vivo System (BTX, Harvard Apparatus).

[0172] In illustrative aspects, the method comprises subcutaneously administering the population of cells. In illustrative aspects, the method comprises subcutaneously administering the population of cells to an arm or leg of the subject.

[0173] In various embodiments, the vector or the cell can be administered to a subject one or more times (e.g., once, twice, two to four times, three to five times, five to eight times, six to ten times, eight to 12 times, or more than 12 times). A vector or a cell as provided herein can be administered one or more times per day, one or more times per week, every other week, one or more times per month, once every two to three months, once every three to six months, or once every six to 12 months. A vector or a cell can be administered over any suitable period of time, such as a period from about 1 day to about 12 months. In some embodiments, for example, the period of administration can be from about 1 day to 90 days; from about 1 day to 60 days; from about 1 day to 30 days; from about 1 day to 20 days; from about 1 day to 10 days; from about 1 day to 7 days. In some embodiments, the period of administration can be from about 1 week to 50 weeks; from about 1 week to 50 weeks; from about 1 week to 40 weeks; from about 1 week to 30 weeks; from about 1 week to 24 weeks; from about 1 week to 20 weeks; from about 1 week to 16 weeks; from about 1 week to 12 weeks; from about 1 week to 8 weeks; from about 1 week to 4 weeks; from about 1 week to 3 weeks; from about 1 week to 2 weeks; from about 2 weeks to 3 weeks; from about 2 weeks to 4 weeks; from about 2 weeks to 6 weeks; from about 2 weeks to 8 weeks; from about 3 weeks to 8 weeks; from about 3 weeks to 12 weeks; or from about 4 weeks to 20 weeks.

[0174] Embodiments that relate to methods of treatment are also envisioned to apply to medical uses and uses in manufacture of medicaments.

[0175] Combination Therapy [0176] In various embodiments, the composition of the present invention is coadministered in conjunction with additional therapeutic agent(s). Co-administration can be simultaneous or sequential.

[0177] In some embodiments, the additional therapeutic agent is an agent that is used to provide relief to symptoms of Z1KV infections. Such agents include anti-inflammatory agents such as a steroidal anti-inflammatory agent or a non-steroidal anti-inflammatory agent (NSAID). Steroids, particularly the adrenal corticosteroids and their synthetic analogues, are well known in the art. Examples of corticosteroids useful in the present invention include, without limitation, hydroxyltriamcinolone, alpha-methyl dexamethasone, beta-methyl betamethasone, beclomethasone dipropionate, betamethasone benzoate, betamethasone dipropionate, betamethasone valerate, clobetasol valerate, desonide, desoxymethasone, dexamethasone, diflorasone diacetate, diflucortolone valerate, fluadrenolone, fluclorolone acetonide, flumethasone pivalate, fluosinolone acetonide, fluocinonide, flucortine butylester, fluocortolone, fluprednidene (fluprednylidene) acetate, flurandrenolone, halcinonide, hydrocortisone acetate, hydrocortisone butyrate, methylprednisolone, triamcinolone acetonide, cortisone, cortodoxone, flucetonide, fludrocortisone, difluorosone diacetate, fluradrenolone acetonide, medrysone, amcinafel, amcinafide, betamethasone and the balance of its esters, chloroprednisone, clocortelone, clescinolone, dichlorisone, difluprednate, flucloronide, flunisolide, fluoromethalone, fluperolone, fluprednisolone, hydrocortisone, meprednisone, paramethasone, prednisolone, prednisone, beclomethasone dipropionate. (NSAIDS) that may be used in the present invention, include but are not limited to, salicylic acid, acetyl salicylic acid, methyl salicylate, glycol salicylate, salicylmides, benzyl-2,5- diacetoxybenzoic acid, ibuprofen, fulindac, naproxen, ketoprofen, etofenamate, phenylbutazone, and indomethacin.

[0178] In an embodiment, the additional therapeutic agent is chloroquine, including chloroquine phosphate.

[0179] In an embodiment, the additional therapeutic agent is a composition comprising all- natural herbal ingredients as disclosed in US 2016/0250181, the contents of which are hereby incorporated by reference. In some embodiments, the composition comprises a combination of one or more artemisinin, berberine, capsaicin and Tinospora Cordifolia.

[0180] In various embodiments, the additional therapeutic agent is a Zika vaccine (e.g. which allows use of two vaccines in a subject for possible improved response), including GLS-5700 (Inovio Phannaceuticals) and VRC-ZKADNA085-00-VP (NIAID). For instance, in various embodiments, the present vaccines in combination with known Zika vaccines allows for stimulation of both humoral- and T cell-based immunity.

[0181] Subjects

[0182] In illustrative embodiments, the subject is a mammal, including, but not limited to, mammals of the order Rodentia, such as mice and hamsters, and mammals of the order Logomorpha, such as rabbits, mammals from the order Carnivora, including Felines (cats) and Canines (dogs), mammals from the order Artiodactyla, including Bovines (cows) and Swines (pigs) or of the order Perssodactyla, including Equines (horses). In some aspects, the mammals are of the order Primates, Ceboids, or Simoids (monkeys) or of the order Anthropoids (humans and apes).

[0183] In various embodiments, the mammal is a human. In some embodiments, the human is an adult aged 18 years or older. In some embodiments, the human is a child aged 17 years or less. In an embodiment, the subject is male, e.g., a male human. In another embodiment, the subject is a female subject. In illustrative embodiments, the subject is a female subject, e.g., a female human, aged from about 16 years to about 50 years. In illustrative embodiments, the female human is capable of giving birth. In illustrative embodiments, the subject is a pregnant female. In illustrative embodiments, the human pregnant female is in the first trimester, second trimester, or third trimester of pregnancy. In illustrative embodiments, the subject is a female and the population of cells is administered prior to pregnancy. In illustrative embodiments, the subject is not pregnant. In various embodiments, the subject is an embryo or a fetus including an unborn embryo or fetus. As referred to herein, an embryo is developed from the time of fertilization until the end of the eighth week of gestation, at which time it is referred to as a fetus.

[0184] Kits

[0185] Kits comprising host cells (or a cell population comprising the same) or expression vector systems or a composition comprising any one of the foregoing of the present invention are also provided. In illustrative aspects, the kits comprise a unit dose of cells comprising the expression vector systems of the present invention. In illustrative aspects, the kit comprises a sterile, GMP-grade unit dose of the cells. In illustrative aspects, a unit dose of cells comprises 10^s, 10⁶, 10⁷, 10⁸, 10⁹, 10¹⁰, 10¹¹, 10¹² 10¹³, or more than 10¹⁵ cells comprising the expression vector system of the present invention. [0186] In illustrative aspects, the unit dose of cells are packaged in an intravenous bag. In illustrative aspects, the unit dose of cells are provided in a cryogenic form. In illustrative aspects, the unit dose of cells are ready to use. In illustrative aspects, the unit dose of cells are provided in a tube, a flask, a dish, or like container.

[0187] In illustrative aspects, the cells are cryopreserved. In illustrative aspects, the cells are not frozen.

[0188] The following examples are given merely to illustrate the present invention and not in any way to limit its scope.

EXAMPLES

Example 1

[0028] This example demonstrates, inter alia, a method of constructing an expression vector encoding a gp96-Ig fusion protein.

[0029] An expression vector comprising a nucleic acid encoding a gp96-IgFc fusion protein and one or more ZIKV antigens is constructed. The expression vector is shown in Figure 1. For reference, Yamazaki et al., The Journal of Immunology 163: 5178-5182 (1999) describes the construction of a similar expression vector comprising a nucleic acid encoding gp96-Ig fusion protein and the transfection of the expression vector into cells. Briefly, Yamazaki et al., 1999, supra, teaches that the KDEL sequence was deleted and replaced with the hinge, CH2 and CH3 domains of murine IgGl (see, References 16- 23 of Yamazaki et al., 1999, supra); double-stranded cDNA was prepared from Jurkat DNA (see, Reference 24 of Yamazaki et al., 1999, supra) with the GeneAmp RNA PCR Kit (Perkin-Elmer Cetus, Norwalk, CT) and amplified by PCR. The PCR primers were 5'- ATTACTCGAGGGCCGCACGC CATGAGGG-3¹ and 5'-

GCCCGGATCCTTCAGCTGTAGATTCCTT TGC-3' (Maki et al., PNAS USA 87: 5658(1990); Maki et al., Somat CellMol Genet 19:73 (1993)). The PCR primers included an Xho\ site (forward primer) and a BamHl site (reverse primer). The hinge, CH2 and CH3 domains of murine IgGl, was amplified by using murine IgGl cDNA as a template and mutating the three cysteines of the hinge portion to serines (see, References 21, 25 of Yamazaki et al., 1999, supra). The PCR primers were 5'- GCGAGGATCCGTGCCCAGGGATTCTGGTT CTAAG-3' and 5'-

CTAAGCGGCCGCAAGGACACTGGGATCATTT ACCAGG-3'. The PCR primers included a BamHl site (forward primer) and NoA site (reverse primer). Gp96 was inserted into Xhol and BamYO. sites of the eukaryotic expression vector, pBCMGSNeo and pBCMGHis (see References 26-29 of Yamazaki et al., 1999, supra) and transfected into SCLC-2, SCLC-7, B16F10, MC57, LLC NIH3T3, EL4, E.G7, and P815. Transfected cells were selected with 1 mg/ml of G418 or 2.5-10 mM of L-Histidinol (Sigma, St. Louis, MO). A second expression vector encoding chicken ovalbumin (OVA) named apc-NEO-OVA was co-transfected into the cells that were transfected with pBCMGSneo expressing gp96-Ig. The production of the gp96- IG fusion protein by transfected cells and the secretion of the fusion protein into the culture medium was assayed via ELISA. Transfected cells were administered to mice and shown to enhance the CD8 T cell immune response.

Example 2

[0030] This example demonstrates the induction of antigen specific CTL responses in placenta and decidua of pregnant B6 mice by secreted gp96^OVA-Ig.

[0031] The placenta acts as a barrier against infections, due to multiple unique structural, cellular, and immune properties. The detrimental effects of congenital viruses on pregnancy and fetal outcomes occur in part because of impaired placental function and profound pathological changes in ZIKV -infected placentas have been observed. Induction of appropriate immune responses in placenta are key to successful prevention of viral infections from developing fetus. Induction of virus-specific CD8 T cells responses in the placenta is hypothesized to lead to clearance of the pathogen/virus.

[0032] To test the ability of vaccine cells to stimulate CD8 T cells in the placenta and decidua, NIH3T3 cells were co- transfected with a gp96-Ig expression vector were made as described in Example 1 and Yamazaki et al., 1999, supra, and a second expression vector encoding chicken ovalbumin (OVA) named apc-NEO-OVA. Such cells are referred to as 3T3- gp96-OVA-Ig cells. An illustrative schematic of the experiment is depicted in Figure 4.

[0033] B6 females were mated with B6 mice and gestation day (GD) 0.5 was determined by the presence of vaginal plug. At GD 5.5, 1 million of OT1 cells (T cells comprising T cell receptors specific for the OVA antigen) were injected in the tail vein. Two days' post- injection, 2.5 million 3T3-gp96-OVA-Ig or 3T3-gp96-Ig cells were injected subcutaneously. Five days later, mice were euthanized. Pregnant uteri were collected and from individual fetal/placental units (FPU) placental disk was separated form decidua (maternal endometrium). Placental and decidual single cells suspension was obtained by collagenase D digestion. Cells were labeled with antiCD8 antibody and frequency of OT1 cells was determent by flow cytometry. Representative dot plots of gated CD3+CD8+ T cells in the placenta and decidua and the frequency of OT1 positive cells are shown in Figure 2.

[0034] After subcutaneous injection of vaccine cells (3T3-OVA-gp96-Ig) into pregnant B6 mice, OVA specific CD8 T cells (OT1) were detected in high frequencies in placenta and decidua (10-15% of all CD8 T cells in placenta and decidua were OVA specific T cells) (Figure 2) without damaging maternal-fetal interface and preserving healthy fetus.

[0035] These data support that complexes of gp96-Ig fusion protein chaperoning the OVA antigens are recognized by antigen presenting cells (APCs) local to the site of SC injection. The APCs prime or activate the innate and adaptive arms of the immune system, and activate CD8-specific T cells having T cell receptors that specifically bind and recognize the OVA antigen chaperoned by the gp96-lg fusion protein, thereby causing proliferation of these T cells and priming of these T cells. Primed cells circulate in the blood and make their way into the placenta through means of normal circulation.

[0036] This example provides proof-of-principle that the administration of cells expressing gp96-Ig fusion protein and an antigen of interest can lead to stimulation of antigen-specific CD8 T cells located in the placenta and decidua of pregnant subjects.

Example 3

[0037] This example demonstrates a method of administering cells comprising an illustrative expression vector of the present invention.

[0038] An expression vector encoding the gp96-Ig fusion protein and ZIKV antigens was constructed. A map of the expression vector made is shown in Figure 1. HEK293 cells were then transfected with the gp96-Ig-ZIKV antigen expression vector.

[0039] Transfected HEK293 cells are first irradiated (12,000 rads) and then suspended in freezing medium containing 10%DMSO, 25% human serum albumin, sodium bicarbonate

8.4% and sodium chloride 0.9% and subcutaneously administered to the upper outer arm or thigh of a human female. The number of cells that are injected depends on the amount of secreted gp96-Ig: equivalent number of cells that produce 10-20 micrograms of gp96-Ig in in vitro established assay. Based on previous experiments (e.g., J Immunol. 2013 Mar

15;190(6):2495-9. doi: 10.4049/jimmunol.1202655. Epub 2013 Feb 11. PMD: 23401588;

Vaccine. 2011 Mar 21;29(14):2619-25. doi: 10.1016/j.vaccine.2011.01.044. Epub 2011 Jan

28. PMJD:21277409; Mucosal Immunol. 2010 Mar;3(2): 182-92. doi: 10.1038/mi.2009.127.

Epub 2009 Nov 18. PMH>: 19924120; J Immunol. 2007 Aug 15;179(4):2310-7. ΡΜΠ): 17675492), the complexes of gp96-Ig chaperoning the ZIKV antigens are recognized by APCs local to the injection site. The APCs prime or activate the innate and adaptive arms of the immune system, and activate CD8-specific T cells having T cell receptors that specifically bind and recognize the ZIKV antigens chaperoned by the gp96-Ig fusion protein, thereby causing proliferation of these T cells and priming of these T cells. Primed T cells circulate in the blood and make their way into the placenta through means of normal circulation. In this experiment, the number of cells injected depends on the amount of secreted gp96-Ig, i.e., equivalent number of cells are used that produces 10-20 micrograms of gp96-Ig in in vitro established assays.

Example 4

[0040] This example demonstrates a method of administering illustrative expression vectors of the present invention.

[0041] The expression vector of Figure 1 is generated and formulated into a sterile composition. The composition is injected into the muscle of the upper outer arm or thigh of a human female subject. Subsequently, electroporation (EP) pulses arc delivered, a slow resealing of the membrane occurs on the second to minutes' time scale. The end result of the process is that upwards of 100-1000-fold enhancement of vector delivery and increased expression of the encoded ZIKV antigens and gp96-Ig fusion protein, which in turn, leads to elevated immune responses relative to delivery of DNA alone without electroporation. See, e.g., Luckay et al., J Virol 81:5257-5269 (2007); Liu et al., J Virol 82: 4844-4852 (2008); Hirao et al.. Vaccine 26:3112-3120 (2008); Rosati et al., Vaccine 26: 5223-5229 (2008); Simon et al., Vaccine 26:5202-5209 (2008); Hirao et al., Mol Ther 18:1568-1576 (2010); Dobano et al., Vaccine 25: 6635-6645 (2007); LeBlanc et al., Vaccine 26:185-192 (2008); Ahlen et al., J Immunol 179:4741-4753 (2007); Luxembourg et al., Vaccine 26: 4025-4033 (2008); van Drunen Littel-van den Hurk et al., Vaccine 26: 5503-5509 (2008); Kim et al., Exp Mol Med 40: 669-676 (2008); Nystrom et al., J Infect Dis 201: 1867-1879 (2010); Trollet et al., Infect Immun 77:2221-2229 (2009); Best et al., Vaccine 27: 5450-5459 (2009); Seo et al., Vaccine 27: 5906-5912 (2009); Livingston et al., Vaccine 28: 1056-1061 (2010); Laddy et al., J Virol 83: 4624-4630 (2009); Laddy et al., PLoS One 3:e2517 (2008); and Hirao et al., Vaccine 26: 440^48 (2008).

[0042] Experiments are also performed in mice. Specifically, 50 micrograms of DNA containing expression vector that contains gp96-Ig and ZIKV antigens in 50 micro liters of saline was injected in the tibialis anterior muscle of anesthetized wild-type C57BL/6 mice. A two-needle array electrode pair was inserted into muscle immediately after DNA delivery and the injection site was electroporated with field strength of 50 V/cm (constant) and six electric pulses of 50 ms each by using the AgilePulse In Vivo System (BTX, Harvard Apparatus).

Example 5

[0043] This example demonstrates the generation of gp96-Ig and ZIKA envelope vaccine and induction of ZIKV-Env-specific CD8+ T lymphocyte responses.

[0044] HEK-293-gp96-Ig was transfected with the B45 vector expressing gp9-Ig and ZIKV-envelope. The cells were transfected using Effectin-based transfection protocol and subsequently selected in the presence of selection marker (geneticin, G418). a stable transfection of HEK-293 cells that co express gp96-Ig and ZIKV-envelope as shown in the figure below was established (Figure 8A). Production of gp96-Ig was confirmed by ELISA using human IgGl as a standard. Western blotting was also used to confirm that cells express ZIKA envelope (Figure 8B, lane 2). MBS430270 (MyBiosource) Anti-Envelope E (ZikaVirus) Polyclonal antibody as a primary antibody (1:1000) and HRP-anti-rabbit IgG as a secondary antibody (Jackson Immunoresearch) (1:5000) were used to confirm (Figure 8B). The expression of gp96-Ig production was improved in an already established cell line, 293- gp96-Ig-ZIKVenv (Figure 8A, C) by performing single cell cloning. Data showed several highly gp96-Ig- expressing cell clones (Figure 8C). Clone 5G4 was further expanded, high production of gp96-Ig confirmed by ELISA (Figure 8D) and ZIKA envelope expression confirmed by Western blotting (Figure 8E). Vaccine cells were irradiated and stored in freezing media at concentration lOfySOOul at -135 °C and used for in vivo experiments.

[0045] Data shows that continuous cell secretion of gp96-lg in vivo is more effective for CD8 CTL induction than injection of purified gp96-Ig. This increased efficiency is attributed to continuous secretion and stimulation of the immune system, similar to attenuated viral vaccines. However, DNA vaccines are more attractive due to their safety and ease of engineering and manufacturing compared to cell-based vaccine approach.

[0046] In order to confirm efficacy of DNA vaccine delivery, transfection efficiency of B45 plasmid entry into target (muscle) cells after in vivo electroporation (EP) by fluorescent microscopy was measured. B45 plasmid containing secreted gp96-Ig (in the 1st expression cassette) and EGFP (in the 2nd expression cassette) was injected into muscle (tibialis anterior) (50 micrograms) followed by a brief electric field pulse that induces temporary and reversible pores in the muscle cell membrane. B45 plasmid (prepared using Endotoxin-free DNA purification kit, Qiagen, CA) at previously determined dose of 50 micrograms was used. In vivo electroporation was applied after injection of the plasmid(s) into muscles using AgilePulse IM in Vivo gene delivery system (BTX Harvard Apparatus). Left muscle was injected with PBS. Expression of EGFP protein was analyzed in longitudinal sections of the tibialis anterior muscle 48 h after injection (Figure 9). Frozen tissue samples were cut in 10 micron sections, stained with anti-gfp-AF488 antibody and examined under the fluorescent microscope. Nuclei were stained with DAPI (blue). Results indicated very high level of expression of gp96-Ig-gfp in the injected site. This results confirms that in vivo transfection of gp96-Ig is successful and that immunization protocols can begin with gp96-Ig-ZIKV DNA and electroporation.

[0047] Without wishing to be bound by theory, a critical issue for protective Z1KV vaccines is induction of protective immune responses at maternal/fetal interface. In order to develop ZIKV protective vaccine, immunogenicity and efficacy was tested in a pregnant mouse model to measure immunogenicity of secreted gp96-Ig vaccine (Figure lOA-C and Figure 11). First, to confirm preliminary data that vaccination with gp96-Ig during pregnancy is safe, female mice were first evaluated for the stage of the estrous cycle by visual observation for 2 weeks. Females in the proestrus cycle were put with one male for 24 h. Appearance of a vaginal plug was marked as day 0.5 of pregnancy, gestation day (GD) 0.5 at which time male mice were removed. Pregnant mice at GD 7.5 were vaccinated with established vaccine cells (293-gp96-Ig-ZIKVenv) or with mock control (PBS). Mice were followed up until the end of pregnancy (GD 19.5-21.5) or humanely euthanized 5 days after vaccination (GD 12.5) (Figure 10). Results indicated that vaccinated mice have the same number of live-born pups as control mice (n=12). In addition, histological findings confirm that there was no difference among fetal-placental units from control vs vaccinated dams with an overall conclusion that gp96-lg vaccination during pregnancy does not induce pathological changes in placenta or in fetus. (Figure 10A, B and C).

[0048] To confirmation of preliminary data showing that gp96-Ig vaccination induces CD8 T cell responses in placenta. Pregnant WT mice were injected s.c with 293-gp96-lg- ZKAEnv at GD 7.5. mdividual Fetal-Placental Unit at GD 12.5 was fixed in 10% neutral buffered formalin solution and embedded in paraffin. Deparaffinized sections were fixed in acetone and staining was performed using primary antibody against CDS (clone YTS 169) followed by incubation with secondary goat-anti-rabbit antibody and pe roxidase -linked avidin (Dako). 3 Amino-9 ethylcarbazole (Sigma-Aldrich) was used as the chromogen resulting in the brown staining. Serial section incubated with an Ab of the same isotype were used for control staining. White arrows correspond to the same section area of black arrows (Figure 11). Results showed mat dams vaccinated s.c. with 293-gp96-Ig-ZIKVenv (0.2X10⁶) at GD 7.5, accumulate CD8 specific cells in the maternal decidua (Figure 11). This is the first finding that confirms the presence of gp96-Ig-ZlKVenv-induced CD8 T cells around arteries and larger blood vessels in the maternal decidua.

[0049] CDS T cells in decidua was evaluated by flow cytometry (Figure 12). Pregnant WT mice were injected s.c with 293-gp96-Ig-ZIKAEnv or PBS (CTRL) at GD 7.5. Individual Fetal-Placental Unit at GD 12.5 were collected and decidua was dissected form the placental tissue. Decidual single cell suspension was prepared by physical dissociation, cells were passed through the mesh and stained for following cell surface markers: live/dead marker, CD45, CD3, CDl la, CD69, CD25, CD62L. After surface staining cells were fixed/permeabilized and stained for Ki67. Cells were analyzed on Fortessa (BD) flow cytometer. Live, CD45+ CD3+ lymphocytes were analyzed for expression of CD8 and frequency of CD8 + T cells is shown (n=6 +/- SEM, p=0.05). Gated CDS T cells were analyzed for the expression of following markers: CDl la, Ki67, CD69, CD25 and CD62L. Results indicated that frequency of decidual CD8 T cells was significantly increased in vaccinated vs control (PBS treated) pregnant mice. Phenotype of decidual CD8 T cells revealed that in vaccinated dams CD8 T cells were highly proliferating cells (high Ki67 expression), activated (high CD69 and CD25 expression) effector memory CD8 T cells (high CDl la and lower CD62L expression) compared to non- vaccinated controls (Figure 12). Increased expression of integrin molecule CDlla on CD8 T cells after various types of infections and/or antigen stimulations can distinguish naive from antigen-experienced effector and memory CD8 T cells in both lymphoid and non-lymphoid tissues. Thus, CDl la marker can be used to determine the magnitude and kinetics of most, if not all, antigen- specific polyclonal CD8 T cell responses.

[0050] CDl la marker was confirmed by immunofluorescence (IF) staining of frozen placental tissue, predominant distribution of CDl la marker (red) on CD8 (green) positive cells (shown as orange overlay) (Figure 13) in placenta from vaccinated pregnant animals. Briefly, pregnant WT mice were injected s.c with 293-gp96-Ig-ZIKAEnv or PBS (CTRL) at GD 7.5. Individual Fetal-Placental Unit at GD 12.5 were collected and total placental tissue dissected and frozen in OCT medium. 7um tissue sections were fixed with paraformaldehyde, permeabilized with 0.3% Triton X-100 in PBS and blocked with 5% serum for 1 hour at 24°C. Samples were incubated with primary antibodies anti-CD 8 -F1TC and anti-CD 11a- PECy5 for 3 hours at RT. Tissues were stained with DAPI (DNA stain) for 1 min. Representative samples for vaccinated and control PBS placenta are shown.

[0051] Decidua CD8 T cells Z1KV specificity was confirmed by stimulation of isolated decidual cells with overlapping ZIKV envelope peptide library and intracellular cytokine staining assay (ICS) (Figure 14). Pregnant WT mice were injected s.c with 293-gp96-Ig- ZIKAEnv or PBS (CTRL) at GD 7.5. Individual Fetal-Placental Unit at GD 12.5 were collected and decidua was dissected form the placental tissue. ZIKV-specific CD8+ T lymphocyte responses were assessed using decidual cells and analyzed by flow cytometry. Cells were stimulated for 6 h at 37°C with 2 ng/ml of overlapping 15-amino-acid peptides covering the prM or Env proteins (JPT, Berlin, Germany). Following 4 h incubation, brefeldin-A and monensin (BioLegend, CA, USA) were added, and samples were incubated for total of 6 h at 37°C. Cells were then washed, stained, permeabilized with Cytofix/Cytoperm (BD Biosciences, CA, USA). Data was acquired using an Fortessa flow cytometer (BD Biosciences, CA, USA) and analyzed using FlowJo v.10.2 (Treestar, OR, USA). Monoclonal antibodies included: CD45, CD3, CD8o, CD 11a, IL-2, IFN-γ and TNFa. Antibodies were purchased from BD Biosciences, eBioscience, or BioLegend, CA, USA. Vital dye exclusion (LIVE/DEAD) was purchased from Life Technologies, CA, USA. (n=4). The Gp96-Ig-ZIKAenv vaccine induced ZIKAEnv-specific CD8+ lymphocyte that produce IFN-γ, TNFa and IL-2 after ZIKA envelope peptide stimulation. In addition, 50% of all GDI la+ CD8+ T cells represent ZKA-specific CD8 T cells (Figure 14).

[0052] Overall the results indicate, inter aha, success in generating a B45 plasmid that expresses gp96-Ig and ZIKV envelope protein and also confirms that vaccination with cell based secreted gp96-Ig-ZIKA is safe and induces CD8 T cell responses in maternal decidua. Additionally, in vitro stimulation with Zika peptide activates CD8+ specific antigen, indicating an antigen specific effect. This T-cell specific response is beneficial as it improves over existing methods directed to antibody protection only. Vaccination with gp96 provides a unique T-cell mediated response that is protective in the placenta.

[0053] All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein. [0054] The use of the terms "a" and "an" and "the" and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms "comprising," "having," "including," and "containing" are to be construed as open-ended terms (i.e., meaning "including, but not limited to,") unless otherwise noted.

[0055] Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range and each endpoint, unless otherwise indicated herein, and each separate value and endpoint is incorporated into the specification as if it were individually recited herein.

[0056] All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or illustrative language (e.g., "such as") provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

[0057] Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

[0058] As used herein, all headings are simply for organization and are not intended to limit the disclosure in any manner. The content of any individual section may be equally applicable to all sections. REFERENCES

1. Luckay A, Sidhu MK, Kjeken R, Megati S, Chong SY, Roopchand V, Garcia-Hand D, Abdullah R, Braun R, Montefiori DC, et al. Effect of plasmid DNA vaccine design and in vivo electroporation on the resulting vaccine-specific immune responses in rhesus macaques. J Virol. 2007;81:5257-5269.

2. Liu J, Ewald BA, Lynch DM, Denhohz M, Abbink P, Lemckert AA, Carville A, Mansfield KG, Havenga MJ, Goudsmit J, et al. Magnitude and phenotype of cellular immune responses elicited by recombinant adenovirus vectors and heterologous prime-boost regimens in rhesus monkeys. J Virol. 2008;82:4844-4852.

3. Hirao LA, Wu L, Khan AS, Hokey DA, Yan J, Dai A, Betts MR, Draghia-Akli R, Weiner DB. Combined effects of IL-12 and electroporation enhances the potency of DNA vaccination in macaques. Vaccine. 2008;26:3112-3120.

4. Rosati M, Valentin A, Jalah R, Patel V, von Gegerfelt A, Bergamaschi C, Alicea C, Weiss D, Treece J, Pal R, et al. Increased immune responses in rhesus macaques by DNA vaccination combined with electroporation. Vaccine. 2008;26:5223-5229.

5. Simon AJ, Casimiro DR, Finnefrock AC, Davies ME, Tang A, Chen M, Chastain M, Kath GS, Chen L, Shiver JW. Enhanced in vivo transgene egression and immunogenicity from plasmid vectors following electrostimulation in rodents and primates. Vaccine. 2008;26:5202-5209.

6. Hirao LA, Wu L, Satishchandran A, Khan AS, Draghia-Akli R, Finnefrock AC, Bett AJ, Betts MR, Casimiro DR, Sardesai NY, et al. Comparative analysis of immune responses induced by vaccination with SIV antigens by recombinant Ad5 vector or plasmid DNA in rhesus macaques. Mol Ther. 2010;18:1568-1576.

7. Dobano C, Widera G, Rabussay D, Doolan DL. Enhancement of antibody and cellular immune responses to malaria DNA vaccines by in vivo electroporation. Vaccine. 2007;25:6635-6645.

8. LeBlanc R, Vasquez Y, Hannaman D, Kumar N. Markedly enhanced immunogenicity of a Pfs25 DNA-based malaria transmission-blocking vaccine by in vivo electroporation. Vaccine. 2008;26:185-192.

9. Ahlen G, Soderholm J, Tjelle T, Kjeken R, Frelin L, Hoglund U, Blomberg P, Fons M, Mathiesen I, Sallberg M. In vivo electroporation enhances the immunogenicity of hepatitis C virus nonstructural 3/4A DNA by increased local DNA uptake, protein expression, inflammation, and infiltration of CD3+ T cells. J Immunol. 2007;179:4741-4753.

10. Luxembourg A, Hannaman D, Wills K, Bernard R, Tennant BC, Menne S, Cote PJ.

Immunogenicity in mice and rabbits of DNA vaccines expressing woodchuck hepatitis virus antigens. Vaccine. 2008;26:4025-4033.

11. van Drunen Littel-van den Hurk S, Luxembourg A, Ellefsen B, Wilson D, Ubach A, Hannaman D, van den Hurk JV. Electroporation-based DNA transfer enhances gene expression and immune responses to DNA vaccines in cattle. Vaccine. 2008;26:5503- 5509.

12. Kim CY, Kang ES, Kim SB, Kim HE, Choi JH, Lee DS, Im SJ, Yang SH, Sung YC, Kim BM, et al. Increased in vivo immunological potency of HB-1 10, a novel therapeutic HBV DNA vaccine, by electroporation. Exp Mol Med. 2008;40:669-676.

13. Ny strom J, Chen A, Frelin L, Ahlen G, Koh S, Brass A, Peterson DL, Pons M, Milich DR, Hultgren C, et al. Improving on the ability of endogenous hepatitis B core antigen to prime cytotoxic T lymphocytes. J Infect Dis. 2010;201 : 1867-1879.

14. Trollet C, Pereira Y, Burgain A, Litzler E, Mezrahi M, Seguin J, Manich M, Popoff MR, Scherman D, Bigey P. Generation of high-titer neutralizing antibodies against botulinum toxins A, B, and E by DNA electrotransfer. Infect Immun. 2009;77:2221- 2229.

15. Best SR, Peng S, Juang CM, Hung CF, Hannaman D, Saunders JR, Wu TC, Pai SI.

Administration of HPV DNA vaccine via electroporation elicits the strongest CD8+ T cell immune responses compared to intramuscular injection and intradermal gene gun delivery. Vaccine. 2009;27:5450-5459.

16. Seo SH, Jin HT, Park SH, Youn JI, Sung YC. Optimal induction of HPV DNA vaccine-induced CD8+ T cell responses and therapeutic antitumor effect by antigen engineering and electroporation. Vaccine. 2009;27:5906-5912.

17. Livingston BD, Little SF, Luxembourg A, Ellefsen B, Hannaman D. Comparative performance of a licensed anthrax vaccine versus electroporation based delivery of a PA encoding DNA vaccine in rhesus macaques. Vaccine. 2010;28:1056-1061.

18. Laddy DJ, Yan J, Khan AS, Andersen H, Conn A, Greenhouse J, Lewis M, Manischewitz J, King LR, Golding H, et al. Electroporation of synthetic DNA antigens offers protection in nonhuman primates challenged with highly pathogenic avian influenza virus. J Virol. 2009;83:4624-4630. 19. Laddy DJ, Yan J, Kutzler M, Kobasa D, Kobinger GP, Khan AS, Greenhouse J, Sardesai NY, Diaghia-Akli R, Weiner DB. Heterosubtypic protection against pathogenic human and avian influenza viruses via in vivo electroporation of synthetic consensus DNA antigens. PLoS One. 2008;3:e2517.

20. Hirao LA, Wu L, Khan AS, Satishchandran A, Draghia-Akli R, Weiner DB.

Intradermal/subcutaneous immunization by electroporation improves plasmid vaccine delivery and potency in pigs and rhesus macaques. Vaccine. 2008;26:440-448.

Claims

CLAIMS: What is claimed is

1. An expression vector system comprising (i) a nucleic acid encoding a fusion protein comprising a chape rone protein and an immunoglobulin, or a fragment thereof, and (ii) a nucleic acid encoding a flavivirus protein, or an antigenic portion thereof, wherein each nucleic acid is operably linked to a promoter.

2. The expression vector system of claim 1, wherein the nucleic acid encoding the fusion protein is operably linked to a promoter which is different from the promoter which is operably linked to the nucleic acid encoding the flavivirus protein, or an antigenic portion thereof.

3. The expression vector system of claim 2, wherein the nucleic acid encoding the fusion protein is operably linked to a CMV promoter.

4. The expression vector system of claim 2 or 3, wherein the nucleic acid encoding the flavivirus protein, or an antigenic portion thereof, is operably linked to an Mth promoter.

5. The expression vector system of any one of claims 1 to 4, wherein the nucleic acid encoding the fusion protein and the nucleic acid encoding the flavivirus protein, or antigenic portion thereof, are present on the same expression vector.

6. The expression vector system of any one of claims 1 to 4, wherein the nucleic acid encoding the fusion protein is present on an expression vector which is different from the expression vector comprising the nucleic acid encoding the flavivirus protein, or antigenic portion thereof.

7. The expression vector system of any one of claims 1 to 6, comprising two or more nucleic acids each encoding a different flavivirus protein, or an antigenic portion thereof.

8. The expression vector system of any one of the previous claims, wherein the chaperone protein is selected from the group consisting of: gp96, Hsp70, BiP, and Grp78.

9. The expression vector system of any one of the previous claims wherein the chaperone protein comprises an amino acid sequence of any one of SEQ ID NOs: 2, 29, 30, and31.

10. The expression vector system of claim 8, wherein the chaperone protein is gp96 comprising the amino acid sequence of SEQ ID NO: 2.

11. The expression vector system of any one of the previous claims, wherein the fusion protein comprises an Fc fragment of an immunoglobulin.

12. The expression vector system of claim 11, wherein the immunoglobulin is an IgGl immunoglobulin.

13. The expression vector system of claim 11 or 12, wherein the Fc fragment comprises the amino acid sequence of SEQ ID NO: 5.

14. The expression vector system of any one of the previous claims, wherein the fusion protein comprises the amino acid sequence of SEQ ID NO: 8.

15. The expression vector system of any one of the previous claims, wherein the flavivirus protein is a Zika virus protein, Dengue virus protein, Yellow Fever virus protein, or West Nile virus protein.

16. The expression vector system of claim 15, wherein the flavivirus protein is selected from the group consisting of: flavivirus polyprotein from Dengue Virus 2, polyprotein precursor from Yellow Fever Virus, or flavivirus polyprotein from West Nile Virus.

17. The expression vector system of claim of claim 16, wherein the flavivirus protein comprises an amino acid sequence of any one of SEQ ID NOs: 26-28.

18. The expression vector system of any one of the previous claims, wherein the flavivirus protein is a ZIKV protein selected from the group consisting of: membrane glycoprotein precursor M, envelope protein E, nonstructural protein NS1, nonstructural protein NS2A, nonstructural protein NS2B, nonstructural protein NS3, nonstructural protein NS4A, and nonstructural protein NS4B.

19. The expression vector system of claim 18, wherein the membrane glycoprotein precursor M comprises the amino acid sequence of one or more of SEQ ID NO: 10, the envelope protein E comprises the amino acid sequence of SEQ ID NO: 11, the nonstructural protein NS1 comprises the amino acid sequence of SEQ ID NO: 12, the nonstructural protein NS2A comprises the amino acid sequence of SEQ ID NO: 13, the nonstructural protein NS2B comprises the amino acid sequence of SEQ ID NO: 14, the nonstructural protein NS3 comprises the amino acid sequence of SEQ ID NO: 15, the nonstructural protein NS4A comprises the amino acid sequence of SEQ ID NO: 16, and the nonstructural protein NS4B comprises the amino acid sequence of SEQ ID NO: 17.

20. The expression vector system of any one of the previous claims, comprising a nucleic acid encoding the ZIKV protein membrane glycoprotein precursor M and/or a nucleic acid encoding the ZIKV protein envelope protein E.

21. The expression vector system of any one of the previous claims, comprising a nucleic acid encoding the amino acid sequence of SEQ ID NO: 10 and/or a nucleic acid encoding the amino acid sequence of SEQ ID NO: 11.

22. The expression vector system of any one of the previous claims, further comprising a nucleic acid encoding a bovine papillomavirus (BPV) El protein and/or a BPV E2 protein.

23. The expression vector system of any one of the previous claims, further comprising a nucleic acid encoding a BPV El protein of SEQ ID NO: 19 and/or a BPV E2 protein of SEQ ID NO: 22.

24. The expression vector system of any one of the previous claims, which does not comprise a nucleic acid encoding an E5 sequence, E6 sequence, E7 sequence.

25. The expression vector system of any one of the previous claims, comprising one or more elements shown in Figure 1 or Figure 3.

26. The expression vector system of any one of the previous claims, comprising the sequence of any one of SEQ ID NO: 24, 25, and 35.

27. A host cell comprising the expression vector system of any one of the previous claims.

28. The host cell of claim 27, which is a mammalian host cell.

29. The host cell of claim 28, which is a human host cell.

30. The host cell of claim 29, which is an NIH 3T3 cell or an HEK 293 cell.

31. A population of cells wherein at least 50% of the cells are host cells according to any one of claims 28 to 30.

32. A composition comprising an expression vector system of any one of claims 1 to 26 or a host cell of any one of claims 27 to 30, or a population of cells of claim 31, and an excipient, carrier, or diluent.

33. The composition of claim 32, which is a sterile composition.

34. The composition of any one of claims 32 or 33, which is suitable for administration to a human.

35. The composition of any one of claims 32 to 34, which is ready for use.

36. The composition of any one of claims 32 to 35, comprising at least or about 10⁶ cells transfected with the expression vector system.

37. A kit comprising an expression vector system of any one of claims 1 to 26 or a host cell of any one of claims 27 to 30 or a population of cells of claim 31 or a composition of anv one of claims 32 to 36.

38. A method of eliciting an immune response against flavivirus in a subject, comprising administering to the subject the expression vector of any one of claims 1 to 26, or a population of cells transfectcd with the expression vector.

39. A method of treating or preventing a flavivirus infection in a subject, comprising administering to the subject the expression vector of any one of claims 1 to 26, or a population of cells transfected with the expression vector.

40. The method of claim 38 or 39, wherein the flavivirus is selected from the group consisting of: Dengue virus. Yellow Fever virus, West Nile virus, and Zika virus (ZIKV).

41. The method of claim 40, wherein the flavivirus is ZIKV .

42. The method of claim 38 or 39, wherein the flavivirus infection is selected from the group consisting of: Dengue virus infection, Yellow Fever virus infection, West Nile virus infection, and Zika virus (ZIKV) infection.

43. The method of claim 40, wherein the flavivirus infection is a ZIKV infection.

44. The method of any one of claims 38 to 42, wherein the subject is female.

45. The method of claim 44, wherein the subject is a pregnant female.

46. The method of claim 45, wherein the pregnant female is human.

47. The method of claim 46, wherein the human pregnant female is in the first trimester of pregnancy.

48. The method of any one of claims 38 to 42, wherein the subject is male.

49. The method of any one of claims 38 to 42, wherein the subject is not pregnant.

50. The method of claim 49, wherein the subject is a female and the population of cells is administered prior to pregnancy.

51. The method of any one of claims 38 to 50, comprising subcutaneously administering the population of cells to the subject.

52. The method of claim 51, comprising subcutaneously administering the population of cells to an arm or leg of the subject.

53. The method of any one of claims 38 to 50, comprising intramuscularly administering the expression vector.

54. The method of any one of claims 38 to 53, comprising electroporating an expression vector containing ZIKV antigens and gp96-Ig.

55. A method of treating or preventing a flavivirus infection in a subject, comprising administering to the subject an expression vector comprising a sequence having at least 90% identity with SEQ ID NO: 35 or a population of cells transfected an expression vector comprising a sequence having at least 90% identity with SEQ ID NO: 35.

56. A method of treating or preventing a flavivirus infection in a subject, comprising administering to the subject an expression vector comprising a sequence having at least 95% identity with SEQ ID NO: 35 or a population of cells transfected an expression vector comprising a sequence having at least 95% identity with SEQ ID NO: 35.

57. An expression vector system comprising (i) a nucleic acid encoding the amino acid sequence of SEQ ID NO: 2 and (ii) a nucleic acid encoding the amino acid sequence of SEQ ID NO: 11, wherein each nucleic acid is operably linked to a promoter.

58. The expression vector system of claim 57, wherein SEQ ID NO: 2 lacks the terminal KDEL sequence.

59. A method of treating or preventing a flavivirus infection in a subject, comprising administering to the subject the expression vector of claim 57 or claim 58.

60. A biological cell comprising a first recombinant protein having an amino acid sequence of at least 95% sequence identity with SEQ ID NO: 2 and a second recombinant protein having an amino acid sequence of at least 95% sequence identity with SEQ ID NO: 11.

61. The biological cell of claim 60, wherein the first recombinant protein has at least 97% sequence identity with SEQ ID NO: 2 and the second recombinant protein having an amino acid sequence of at least 97% sequence identity with SEQ ID NO: 11.

62. The biological cell of claim 60, wherein the first recombinant protein has at least 98% sequence identity with SEQ ID NO: 2 and the second recombinant protein having an amino acid sequence of at least 98% sequence identity with SEQ ID NO: 11.

63. The biological cell of any one of claims 60-62, wherein SEQ ID NO: 2 lacks the terminal KDEL sequence.

64. A method of treating or preventing a flavivirus infection in a subject, comprising administering to the subject the biological cell of any one of claims 60-63.