WO2018071216A1 - Methods and compositions for treating genetic eye diseases - Google Patents

Methods and compositions for treating genetic eye diseases Download PDF

Info

Publication number
WO2018071216A1
WO2018071216A1 PCT/US2017/054727 US2017054727W WO2018071216A1 WO 2018071216 A1 WO2018071216 A1 WO 2018071216A1 US 2017054727 W US2017054727 W US 2017054727W WO 2018071216 A1 WO2018071216 A1 WO 2018071216A1
Authority
WO
WIPO (PCT)
Prior art keywords
capn5
substrate
seq
peptide
inhibitor
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2017/054727
Other languages
French (fr)
Inventor
Vinit B. MAHAJAN
Alexander G. BASSUK
Diana F. COLGAN
Gabriel VELEZ
Kellie SCHAEFER
Marcus TORAL
Shu Wu
Lokesh Gakhar
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Iowa Research Foundation UIRF
Original Assignee
University of Iowa Research Foundation UIRF
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Iowa Research Foundation UIRF filed Critical University of Iowa Research Foundation UIRF
Priority to US16/340,657 priority Critical patent/US11981943B2/en
Publication of WO2018071216A1 publication Critical patent/WO2018071216A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6472Cysteine endopeptidases (3.4.22)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/08Solutions
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475Growth factors; Growth regulators
    • C07K14/49Platelet-derived growth factor [PDGF]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/81Protease inhibitors
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/81Protease inhibitors
    • C07K14/8107Endopeptidase (E.C. 3.4.21-99) inhibitors
    • C07K14/8139Cysteine protease (E.C. 3.4.22) inhibitors, e.g. cystatin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y304/00Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/22Cysteine endopeptidases (3.4.22)
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/573Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K7/00Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/64Cyclic peptides containing only normal peptide links

Definitions

  • Uveitis Intraocular inflammation
  • Uveitis remains a common yet diffi cult-to-treat cause of visual loss in all ages, for which the molecular cause is unknown.
  • ADNIV Autosomal Dominant Neovascular Inflammatory Vitreoretinopathy
  • CAPN5 encodes the protease calpain-5, a calcium-activated intracellular cysteine protease, which is expressed in many tissues including photoreceptors and their nuclei. It is one of 16 calpain proteases, which cleave subdomains from target proteins to irreversibly change their function. The disease mechanisms are not understood, but the disease mimics several common diseases such as diabetic
  • retinopathy retinopathy, retinitis pigmentosa, and proliferative vitreoretinopathy.
  • the present inventors have discovered therapeutic agents, such as peptides, that inhibit the CAPN5 enzyme.
  • the present invention provides therapies to treat or prevent the onset of Autosomal Dominant Neovascular Inflammatory Vitreoretinopathy (ADNIV) and its sequelae by administering to a mammal in need of such therapy, an effective amount of these therapeutic agents that inhibit CAPN5.
  • ADNIV Autosomal Dominant Neovascular Inflammatory Vitreoretinopathy
  • the present invention provides in certain embodiments a CAPN5 substrate comprising an amino acid sequence of 10-30 amino acids in length having at least 80% sequence identity to a peptide, wherein the peptide is PDGFB (SEQ ID NO: 18), HOG (SEQ ID NO: 19), CAPN5- 370-390 (SEQ ID NO:20), CAPN5-390-410 (SEQ ID NO:21), CAPN5-370-380 (SEQ ID NO:23) or CAPN14 (SEQ ID NO: 32).
  • PDGFB SEQ ID NO: 18
  • HOG SEQ ID NO: 19
  • CAPN5- 370-390 SEQ ID NO:20
  • CAPN5-390-410 SEQ ID NO:21
  • CAPN5-370-380 SEQ ID NO:23
  • CAPN14 SEQ ID NO: 32
  • the present invention provides in certain embodiments a CAPN5 substrate having at least 90% sequence identity to a peptide, wherein the peptide is PDGFB (SEQ ID NO: 18), IRX3 (SEQ ID NO: 19), CAPN5-370-390 (SEQ ID NO:20), CAPN5-390-410 (SEQ ID NO:21), CAPN5-370-380 (SEQ ID NO:23) or CAPN14 (SEQ ID NO: 32).
  • the present invention provides in certain embodiments a CAPN5 substrate having at least 95% sequence identity to a peptide, wherein the peptide is PDGFB (SEQ ID NO: 18), IRX3 (SEQ ID NO: 19), CAPN5-370-390 (SEQ ID NO:20), CAPN5-390-410 (SEQ ID NO:21), CAPN5-370-380 (SEQ ID NO:23) or CAPN14 (SEQ ID NO: 32).
  • the peptide is CAPN5-370-380 (SEQ ID NO:23).
  • the present invention provides in certain embodiments a CAPN5 substrate or CAPN5 inhibitor as described above, wherein the peptide contains an unnatural (also called an
  • the unnatural amino acid residue renders the peptide bond uncleavable by calpain.
  • the modified amino acid residue is methylated.
  • the methylated amino acid residue is methyl-arginine, methyl- glycine, or methyl-isoleucine.
  • the unnatural amino acid residue is a D-amino acid.
  • the D-amino acid is D-glutamine or D-asparagine.
  • the unnatural amino acid residue is Acm-cysteine.
  • the present invention provides in certain embodiments a CAPN5 substrate or CAPN5 inhibitor as described above, wherein the peptide forms an alpha-helix. In certain embodiments, the peptide forms a circular peptide.
  • the peptide is from 5 to 11 amino acids in length.
  • the inhibitory peptide occupies the catalytic groove or region that prevents formation of the catalytic triad.
  • the inhibitory peptide is soluble in aqueous solutions.
  • the present invention provides a CAPN5 substrate that is Pep-1- Mod (SEQ ID NO:33), Pep-2-Mod (SEQ ID NO:34), Pep-3-Mod (SEQ ID NO:35), Pep-4-Mod (SEQ ID NO:36), Pep-5-Mod (SEQ ID NO:37) or Pep-6-Mod (SEQ ID NO:38).
  • the CAPN5 substrate is Pep-6-Mod (SEQ ID NO:38).
  • CAPN5 substrate or CAPN5 inhibitor as described above and a physiologically acceptable carrier.
  • the present invention provides in certain embodiments a method of identifying an inhibitor of CAPN5 comprising, contacting CAPN5 with a CAPN5 substrate described above in the presence of a target inhibitor, and measuring an activity level of the CAPN5 in the presence of the target inhibitor as compared to an activity level of CAPN5 in the absence of the target inhibitor.
  • the present invention provides CAPN5 inhibitor identified by this method.
  • the present invention provides in certain embodiments a method of treating CAPN5- related inflammation by administering a therapeutic agent comprising the CAPN5 substrate or CAPN5 inhibitor as described above.
  • the present invention provides in certain embodiments a method of treating uveitis by administering a therapeutic agent comprising the CAPN5 substrate or CAPN5 inhibitor as described above.
  • the present invention provides in certain embodiments a therapeutic method for preventing or treating a pathological condition or symptom in a mammal, such as a human, wherein an anti -inflammatory activity is desired, comprising administering to a mammal in need of such therapy, an effective amount of a therapeutic agent comprising the CAPN5 substrate or CAPN5 inhibitor as described above.
  • the present invention provides in certain embodiments a therapeutic method for preventing or treating intraocular inflammation in a mammal, such as a human, comprising administering to a mammal in need of such therapy, an effective amount of a therapeutic agent comprising the CAPN5 substrate or CAPN5 inhibitor as described above.
  • the present invention provides in certain embodiments a method to treat intraocular inflammation comprising administering a therapeutically effective amount of a therapeutic agent comprising the CAPN5 substrate or CAPN5 inhibitor as described above to a mammal.
  • the present invention provides in certain embodiments a CAPN5 substrate or CAPN5 inhibitor as described above for use in medical therapy.
  • the present invention provides in certain embodiments the use of a CAPN5 substrate or CAPN5 inhibitor as described above for the manufacture of a medicament useful for the treatment of intraocular inflammation in a mammal.
  • the present invention provides in certain embodiments a solution comprising a carrier and a CAPN5 substrate or CAPN5 inhibitor as described above dispersed in the carrier.
  • the present invention provides in certain embodiments an isolated or purified nucleic acid that is less than 150 nucleotides in length encoding a peptide as described above.
  • the isolated or purified nucleic acid is less than 120 nucleotides in length.
  • the present invention provides in certain embodiments an expression cassette comprising the nucleic acid described above.
  • thee expression cassette further comprises a promoter.
  • the present invention provides in certain embodiments a vector comprising the expression cassette described above.
  • the present invention provides in certain embodiments a cell comprising the expression cassette or the vector described above.
  • the present invention provides the CAPN5 substrate as described above, further comprising a detection agent to form a labelled CAPN5 substrate.
  • the detection agent is a fluorescent or colorimetric chemical agent.
  • the present invention provides a method of detecting CAPN5 comprising administering a labelled CAPN5 substrate_described above.
  • protein protein
  • peptide and “polypeptide” are used interchangeably herein.
  • Peptide sequences specifically recited herein are written with the amino terminus on the left and the carboxy terminus on the right.
  • therapeutic agent refers to any agent or material that has a beneficial effect on the mammalian recipient.
  • therapeutic agent embraces both therapeutic and prophylactic molecules having nucleic acid or protein components.
  • Treating refers to ameliorating at least one symptom of, curing and/or preventing the development of a given disease or condition.
  • FIGS 1A-1B CAPN5 has two autoproteolysis sites.
  • Figure 1 A Calcium-activated CAPN5 autoproteolysis releases a 60 kDa and 45 kDa fragment.
  • Figure IB SBP-tagged CAPN5-PC (WT, and R243L) incubated with 1 mM calcium produced 60 kDa fragments.
  • R243L CAPN5 produced the 60 kDa fragment at earlier time points than WT.
  • FIG. 1 Diagram of Assay. I OUM of FRET substrates were added to a solution containing 2mM DTT, 5uM Calcium, and CAPN5 Buffer (20mM Tris, 300mM NaCl, pH 7.5) to a volume of lOOuL. The solution was pipetted into a 96 well plate in wells that contained 24uM of CAPN5-WT, CAPN5-R243L, or no CAPN5. The fluorescence of each well was measured using a Tecan Infinite M200 Pro plate reader.
  • CAPN5-WT proteolyzes the substrate, CAPN5 (p370-380), at a higher rate than other peptides.
  • CAPN5-WT proteolyzes the substrate, CAPN5 (p370-380)
  • the greatest fluorescent intensity is detected with substrate CAPN5 (p370-380).
  • CAPN5-R243L proteolyzes three substrates at a higher rate than other peptides.
  • CAPN5-R243L proteolyzes three substrates at a higher rate than other peptides.
  • the greatest fluorescent intensity is detected with substrates CAPN5 (p370-390), CAPN5 (370-380), and PDGFB (155- 170).
  • FIGS. 5A-5B The CAPN5-370-80 peptide comprises a sequence motif that is conserved among calpains.
  • FIG. 5A Multiple sequence alignment of the CAPN5-370-80 peptide with homologous sequences from other human calpains reveals highly related sequences that are specific to their corresponding calpains. There is high sequence conservation in the p.G376-377 positions, highlighting the functional importance of these residues in calpain structure and function.
  • FIG. 5B A homology model of domain III from human CAPN5 was generated using CAPN2 (PDB: 1KFU) as a template in MODELLER. Further conservation analysis was performed using the ConSurf server and was visualized on the domain III model in PyMOL. Results of this analysis identified p.G376-377 to be 100% conserved across 88 homologous calpain sequences. Structural modeling placed these residues on an exposed flexible loop, which would serve as an accessible site for calpain autoproteolysis.
  • FIG. 1 Schematic of Calpain Domains and various truncations of Homo sapiens calpain 5 (CAPN5).
  • FIGS 7A-7B Graphs showing CAPNl vs. CAPN5 cleavage.
  • Fig. 7A EPLFAERK
  • Fig. 7B CAPN5(p370-380)
  • FIG. 12A Proteolytic kinetics of CAPN5 is influenced by peptide length near its autoproteolytic site. Peptides substrates that were 7, 11, and 21 amino acids long were incubated in calpain activity buffer. The solution was brought to 37°C. CAPN5 was then added and fluorescence was measured.
  • Fig. 12A Substrate CAPN5p.372-378.
  • Fig. 12B Substrate CAPN5p.370-380.
  • Fig. 12C Substrate CAPN5p.370-390.
  • Fig. 12A Substrate CAPN5p.372-378.
  • Fig. 12B Substrate CAPN5p.370-380.
  • Fig. 12C Substrate CAPN5p.370-390.
  • FIG. 13A-13C Tested peptides show calpain-specificity. Peptides were incubated in calpain activity buffer.
  • Fig. 13A The fluorescence measured for our lead peptide
  • the peptide shows high proteolysis when incubated with CAPN5-WT and very limited proteolysis when incubated with CPAN1-WT (green).
  • FIGS 14A-14D CAPN5 specifically targets a peptide corresponding to its own autocatalytic site and not homologous regions in other calpains.
  • Fig. 14A An alignment of the peptides shows very limited sequence homology.
  • Fig. 14B CAPN5 did not proteolyze homologous regions of other CAPN members as well as it proteolyzed its own site, although there was some proteolysis of the CAPN14 peptide. The data points were plotted and fit using the Michaelis-Menten equation (not shown) and the substrate inhibition equation (shown).
  • Fig. 14C Peptides tested in (Fig. 14B) were incubated with CAPNl . CAPNl does not appear to proteolyze these regions. The data points were plotted and fit using the Michaelis-Menten equation.
  • Fig. 14D Kinetics data from the Michaelis-Menten and substrate inhibitions equations are shown in a table.
  • Figures 15A-15D The classical calpain inhibitor SNJ-1945 inhibits CAPNl but is not a good inhibitor of CAPN5.
  • Fig. 15A Various concentrations of SNJ-1945 were incubated in a reaction with 50 ⁇ EPLFAERK (a CAPNl substrate) and CAPNl WT in activity. Data is plotted for CAPNl as initial velocity ( ⁇ /sec) versus SNJ-1945 concentration. Addition of 1 ⁇ SNJ-1945 slows the initial reaction rate by 100%.
  • Fig. 15B CAPN1 WT was incubated with and without SNJ-1945 at increasing concentrations of EPLFAERK substrate. Data is plotted for CAPN1 as initial velocity ( ⁇ /sec) versus substrate concentration.
  • Fig. 15C shows
  • Various concentrations of SNJ-1945 were incubated in a reaction with CAPN5p.370-80 and CAPN5 WT in an activity buffer. Data is plotted for CAPN5 as initial velocity ( ⁇ /sec) versus SNJ-1945 concentration. Only after addition of 100 ⁇ SNJ-1945 did the initial reaction rate slow to 100%.
  • Fig. 15D CAPN5 WT was incubated with and without SNJ-1945 at increasing concentrations of CAPN5 p.370-80 substrate. Data is plotted for CAPN5 as initial velocity ( ⁇ /sec) versus substrate concentration. Increasing substrate concentration for CAPN5 overcomes the inhibition by SNJ-1945.
  • FIGS 16A-16B Second generation inhibitors based off lead compound competitively inhibit CAPN5.
  • First generation lead compound CAPN5 p.370-80 was modified using amide cyclization to generate a second generation competitive cyclic inhibitor.
  • Fig.l6A Various concentrations of Cyclic CAPN5 p.370-80 were incubated in a reaction with CAPN5p.370-80 and CAPN5 WT in an activity buffer. Data is plotted for CAPN5 as initial velocity ( ⁇ /sec) versus Cyclic CAPN5 p.370-80 concentration. Addition of 10 ⁇ Cyclic CAPN5 p.370-80 slows the initial reaction rate by 40%.
  • CAPN5 WT was incubated with and without 10 ⁇ Cyclic CAPN5 p.370-80 at increasing concentrations of CAPN5 p.370-80 substrate.
  • Data is plotted for CAPN5 as initial velocity ( ⁇ /sec) versus substrate concentration. Increasing concentrations of substrate does not overcome inhibition by cyclic peptide.
  • FIGS 18A-18D Modification of lead compound reveals potential for competitive inhibition.
  • Fig. 18A Structural model of the CAPN5 protease core with the peptide docked to it using AutoDock VINA.
  • Fig. 18B Scanning modifications were made to the amino acids of the lead compound to make the bonds un-cleavable by CAPN5. Despite modifications, the peptide still fit in the catalytic groove using docking predictions.
  • Fig. 18C N-terminal
  • FIGS 19A-19G Non-modified and modified peptides.
  • Fig. 19A Unmodified CAPN5-370-80 peptide (RQNRGGGCINH).
  • Fig. 19B Pep- 1 -Mod containing methyl - Arginine and D-Glutamine.
  • Fig. 19C Pep-2-Mod containing D-Asparagine and methyl- Arginine.
  • Fig. 19D Pep-3 -Mod containing N-Me Glycine and N-Me Glycine.
  • Fig. 19E Pep- 4-Mod containing N-Me Glycine and Acm-Cysteine.
  • Fig. 19F Pep-5-Mod containing N-Me Isoleucine and D-Glutamine.
  • Fig. 19G Pep-6-Mod, which is a cyclization amide.
  • FIG. 20A Modification and activity of CAPN5-370-80 peptide.
  • Fig. 20A Modification and activity of CAPN5-370-80 peptide.
  • Fig. 20C Peptides incubated for 15 minutes at various concentrations with 5 ⁇ g of MBP-CAPN5 WT in a buffer containing 20 mM Tris, 300 mM NaCl, 2 mM DTT, pH 7.5 to measure activity. Data is plotted as initial velocity ( ⁇ /sec) versus peptide concentration. Modification of the amino acids slows the reaction rate.
  • Fig. 20D Close-up of graph region highlighting the differences in proteolytic activity at 5 ⁇ substrate.
  • CAPN5 inhibition is one strategy for therapeutically inhibiting retinal damage.
  • the studies described herein demonstrate novel molecules and assays used to inhibit CAPN5 activity.
  • a CAPN5 in vitro proteolysis assay and a specific substrate was needed. Potential substrates were identified from a recent CAPN5 proteolysis screen of the retinal proteome. These CAPN5 proteolytic targets were verified in vitro, and narrowed down the exact site of cleavage, until it was possible to identify short polypeptides that are CAPN5 substrates. This approach was used on several targets, including CAPN5 itself. These substrates are modified to design a CAPN5 -specific inhibitor.
  • the present invention provides in certain embodiments a CAPN5 substrate comprising an amino acid sequence of 10-30 amino acids in length having at least 80% sequence identity to a peptide, wherein the peptide is PDGFB (SEQ ID NO: 18), IRX3 (SEQ ID NO: 19), CAPN5- 370-390 (SEQ ID NO:20), CAPN5-390-410 (SEQ ID NO:21) or CAPN5-370-390 (SEQ ID NO:23).
  • PDGFB SEQ ID NO: 18
  • IRX3 SEQ ID NO: 19
  • CAPN5- 370-390 SEQ ID NO:20
  • CAPN5-390-410 SEQ ID NO:21
  • CAPN5-370-390 SEQ ID NO:23
  • the peptide has at least 81%, 82%, 83%, 84%, 85%, 86%, 87%,88%,89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to a peptide, wherein the peptide is PDGFB (SEQ ID NO: 18), IRX3 (SEQ ID NO: 19), CAPN5-370-390 (SEQ ID NO:20), CAPN5-390-410 (SEQ ID NO:21) or CAPN5-370-390 (SEQ ID NO:23). In certain embodiments the peptide is CAPN5-370-390 (SEQ ID NO:23).
  • amino acid includes the residues of the natural amino acids (e.g., Ala, Arg,
  • the term also includes peptides with reduced peptide bonds, which will prevent proteolytic degradation of the peptide.
  • the term includes the amino acid analog a-amino-isobutyric acid.
  • the term also includes natural and unnatural amino acids bearing a conventional amino protecting group (e.g., acetyl or benzyl oxycarbonyl), as well as natural and unnatural amino acids protected at the carboxy terminus (e.g., as a (Ci-C 6 )alkyl, phenyl or benzyl ester or amide; or as an a-methylbenzyl amide).
  • a conventional amino protecting group e.g., acetyl or benzyl oxycarbonyl
  • natural and unnatural amino acids protected at the carboxy terminus e.g., as a (Ci-C 6 )alkyl, phenyl or benzyl ester or amide; or as an a-methylbenzyl amide.
  • Other suitable amino and carboxy protecting groups are known to those skilled in the art (See for example, T.W. Greene, Protecting Groups
  • the peptides are modified by C-terminal amidation, head to tail cyclic peptides, or containing Cys residues for disulfide cyclization, siderophore modification, or N-terminal acetylation.
  • peptide describes a sequence of 7 to 50 amino acids or peptidyl residues. Preferably a peptide comprises 7 to 25, or 7 to 15 or 7 to 13 amino acids.
  • Peptide derivatives can be prepared as disclosed in U.S. Patent Numbers 4,612,302; 4,853,371; and 4,684,620.
  • the term “enzyme” includes variants or biologically active or inactive fragments of a polypeptides.
  • a "variant" of one of the polypeptides is a polypeptide that is not completely identical to a native protein. Such variant protein can be obtained by altering the amino acid sequence by insertion, deletion or substitution of one or more amino acid.
  • the amino acid sequence of the protein is modified, for example by substitution, to create a polypeptide having substantially the same or improved qualities as compared to the native polypeptide. The substitution may be a conserved substitution.
  • a “conserved substitution” is a substitution of an amino acid with another amino acid having a similar side chain.
  • a conserved substitution would be a substitution with an amino acid that makes the smallest change possible in the charge of the amino acid or size of the side chain of the amino acid (alternatively, in the size, charge or kind of chemical group within the side chain) such that the overall peptide retains its spacial conformation but has altered biological activity.
  • common conserved changes might be Asp to Glu, Asn or Gin; His to Lys, Arg or Phe; Asn to Gin, Asp or Glu and Ser to Cys, Thr or Gly.
  • Aline is commonly used to substitute for other amino acids.
  • the 20 essential amino acids can be grouped as follows: alanine, valine, leucine, isoleucine, proline, phenylalanine, tryptophan and methionine having nonpolar side chains; glycine, serine, threonine, cystine, tyrosine, asparagine and glutamine having uncharged polar side chains;
  • amino acid changes are achieved by changing the codons of the corresponding nucleic acid sequence. It is known that such polypeptides can be obtained based on substituting certain amino acids for other amino acids in the polypeptide structure in order to modify or improve biological activity. For example, through substitution of alternative amino acids, small conformational changes may be conferred upon a polypeptide that results in increased activity. Alternatively, amino acid substitutions in certain polypeptides may be used to provide residues, which may then be linked to other molecules to provide peptide-molecule conjugates which retain sufficient properties of the starting polypeptide to be useful for other purposes.
  • hydropathic index of amino acids in conferring interactive biological function on a polypeptide, wherein it is found that certain amino acids may be substituted for other amino acids having similar hydropathic indices and still retain a similar biological activity.
  • substitution of like amino acids may be made on the basis of hydrophilicity, particularly where the biological function desired in the polypeptide to be generated is intended for use in immunological embodiments. The greatest local average hydrophilicity of a
  • protein as governed by the hydrophilicity of its adjacent amino acids, correlates with its immunogenicity. Accordingly, it is noted that substitutions can be made based on the hydrophilicity assigned to each amino acid.
  • the variant protein has at least 50%, at least about 80%, or even at least about 90% but less than 100%, contiguous amino acid sequence homology or identity to the amino acid sequence of a corresponding native protein.
  • the amino acid sequence of the variant polypeptide corresponds essentially to the native polypeptide's amino acid sequence.
  • “correspond essentially to” refers to a polypeptide sequence that will elicit a biological response substantially the same as the response generated by the native protein. Such a response may be at least 60% of the level generated by the native protein, and may even be at least 80% of the level generated by native protein.
  • a variant may include amino acid residues not present in the corresponding native protein or deletions relative to the corresponding native protein.
  • a variant may also be a truncated "fragment" as compared to the corresponding native protein, i.e., only a portion of a full-length protein.
  • Protein variants also include peptides having at least one D-amino acid.
  • the variant protein may be expressed from an isolated DNA sequence encoding the variant protein.
  • "Recombinant” is defined as a peptide or nucleic acid produced by the processes of genetic engineering. It should be noted that it is well-known in the art that, due to the redundancy in the genetic code, individual nucleotides can be readily exchanged in a codon, and still result in an identical amino acid sequence.
  • protein protein
  • peptide amino acid sequence
  • polypeptide are used interchangeably herein.
  • the peptide forms an alpha-helix.
  • the inhibitor is a circular peptide.
  • the present disclosure provides methods to screen for and identify amino acid sequences that target, e.g., specifically target CAPN5.
  • the present invention provides in certain embodiments a method of identifying an inhibitor of CAPN5 comprising, contacting CAPN5 with a CAPN5 substrate in the presence of a target inhibitor, and measuring an activity level of CAPN5 substrate as described above in the presence of the target inhibitor as compared to an activity level of CAPN5 in the absence of the target inhibitor.
  • the present invention provides in certain embodiments a composition comprising the CAPN5 substrate or CAPN5 inhibitor as described above and a physiologically acceptable carrier.
  • the present invention provides in certain embodiments a therapeutic method for preventing or treating a pathological condition or symptom in a mammal, such as a human, wherein an anti -inflammatory activity is desired, comprising administering to a mammal in need of such therapy, an effective amount of a therapeutic agent comprising the CAPN5 substrate or CAPN5 inhibitor as described above.
  • the present invention provides in certain embodiments a therapeutic method for preventing or treating intraocular inflammation in a mammal, such as a human, comprising administering to a mammal in need of such therapy, an effective amount of a therapeutic agent comprising the CAPN5 substrate or CAPN5 inhibitor as described above.
  • the present invention provides in certain embodiments a method to treat intraocular inflammation comprising administering a therapeutically effective amount of a therapeutic agent comprising the CAPN5 substrate or CAPN5 inhibitor as described above to a mammal.
  • the present invention provides in certain embodiments a CAPN5 substrate or CAPN5 inhibitor as described above for use in medical therapy.
  • the present invention provides in certain embodiments the use of a CAPN5 substrate or CAPN5 inhibitor as described above for the manufacture of a medicament useful for the treatment of intraocular inflammation in a mammal.
  • the present invention provides in certain embodiments a solution comprising a carrier and a CAPN5 substrate or CAPN5 inhibitor as described above dispersed in the carrier.
  • the present invention provides in certain embodiments an isolated or purified nucleic acid that is less than 50 nucleotides in length encoding a peptide as described above.
  • the isolated or purified nucleic acid is less than 20 nucleotides in length.
  • the peptide is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
  • the present invention provides in certain embodiments an expression cassette comprising the nucleic acid described above.
  • thee expression cassette further comprises a promoter.
  • the present invention provides in certain embodiments a vector comprising the expression cassette described above.
  • the present invention provides in certain embodiments a cell comprising the expression cassette or the vector described above.
  • nucleic acid refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form, composed of monomers (nucleotides) containing a sugar, phosphate and a base which is either a purine or pyrimidine. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides.
  • nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues.
  • a "nucleic acid fragment” is a fraction of a given nucleic acid molecule. Deoxyribonucleic acid (DNA) in the majority of organisms is the genetic material while ribonucleic acid (RNA) is involved in the transfer of information contained within DNA into proteins.
  • nucleotide sequence refers to a polymer of DNA or RNA that can be single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases capable of incorporation into DNA or RNA polymers.
  • nucleic acid refers to a polymer of DNA or RNA that can be single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases capable of incorporation into DNA or RNA polymers.
  • nucleic acid “nucleic acid molecule,” “nucleic acid fragment,” “nucleic acid sequence or segment,” or “polynucleotide” may also be used interchangeably with gene, cDNA, DNA and RNA encoded by a gene.
  • an "isolated” or “purified” DNA molecule or an “isolated” or “purified” polypeptide is a DNA molecule or polypeptide that exists apart from its native environment and is therefore not a product of nature.
  • An isolated DNA molecule or polypeptide may exist in a purified form or may exist in a non-native environment such as, for example, a transgenic host cell or bacteriophage.
  • an "isolated” or “purified” nucleic acid molecule or protein, or biologically active portion thereof is substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.
  • an "isolated" nucleic acid is free of sequences that naturally flank the nucleic acid (i.e., sequences located at the 5' and 3 ' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived.
  • the isolated nucleic acid molecule can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequences that naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived.
  • a protein that is substantially free of cellular material includes preparations of protein or polypeptide having less than about 30%, 20%, 10%, 5%, (by dry weight) of contaminating protein.
  • biologically active portion thereof is recombinantly produced, preferably culture medium represents less than about 30%, 20%, 10%, or 5% (by dry weight) of chemical precursors or non-protein-of- interest chemicals.
  • Fragments and variants of the disclosed nucleotide sequences and proteins or partial-length proteins encoded thereby are also encompassed by the present invention.
  • fragment or portion is meant a full length or less than full length of the nucleotide sequence encoding, or the amino acid sequence of, a polypeptide or protein.
  • genes include coding sequences and/or the regulatory sequences required for their expression.
  • gene refers to a nucleic acid fragment that expresses mRNA, functional RNA, or specific protein, including regulatory sequences.
  • Genes also include nonexpressed DNA segments that, for example, form recognition sequences for other proteins.
  • Genes can be obtained from a variety of sources, including cloning from a source of interest or synthesizing from known or predicted sequence information, and may include sequences designed to have desired parameters.
  • Naturally occurring is used to describe an object that can be found in nature as distinct from being artificially produced.
  • a protein or nucleotide sequence present in an organism including a virus
  • which can be isolated from a source in nature and which has not been intentionally modified by man in the laboratory is naturally occurring.
  • chimeric refers to any gene or DNA that contains 1) DNA sequences, including regulatory and coding sequences that are not found together in nature or 2) sequences encoding parts of proteins not naturally adjoined, or 3) parts of promoters that are not naturally adjoined. Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or comprise regulatory sequences and coding sequences derived from the same source, but arranged in a manner different from that found in nature.
  • transgene refers to a gene that has been introduced into the genome by
  • Transgenes may include, for example, DNA that is either heterologous or homologous to the DNA of a particular cell to be transformed.
  • transgenes may comprise native genes inserted into a non-native organism, or chimeric genes.
  • endogenous gene refers to a native gene in its natural location in the genome of an organism.
  • a “foreign” gene refers to a gene not normally found in the host organism but that is introduced by gene transfer.
  • protein protein
  • variants are a sequence that is substantially similar to the sequence of the native molecule.
  • variants include those sequences that, because of the degeneracy of the genetic code, encode the identical amino acid sequence of the native protein.
  • Naturally occurring allelic variants such as these can be identified with the use of well-known molecular biology techniques, as, for example, with polymerase chain reaction (PCR) and hybridization techniques.
  • variant nucleotide sequences also include synthetically derived nucleotide sequences, such as those generated, for example, by using site-directed mutagenesis that encode the native protein, as well as those that encode a polypeptide having amino acid substitutions.
  • nucleotide sequence variants of the invention will have at least 40, 50, 60, to 70%, e.g., preferably 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, to 79%, generally at least 80%, e.g., 81%-84%, at least 85%, e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%), 95%), 96%), 97%), to 98%, sequence identity to the native (endogenous) nucleotide sequence.
  • Consatively modified variations of a particular nucleic acid sequence refers to those nucleic acid sequences that encode identical or essentially identical amino acid sequences, or where the nucleic acid sequence does not encode an amino acid sequence, to essentially identical sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given polypeptide. For instance the codons CGT, CGC, CGA, CGG, AGA, and AGG all encode the amino acid arginine. Thus, at every position where an arginine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded protein.
  • nucleic acid variations are "silent variations" which are one species of “conservatively modified variations.” Every nucleic acid sequence described herein which encodes a polypeptide also describes every possible silent variation, except where otherwise noted.
  • each codon in a nucleic acid except ATG, which is ordinarily the only codon for methionine
  • each "silent variation" of a nucleic acid which encodes a polypeptide is implicit in each described sequence.
  • Recombinant DNA molecule is a combination of DNA sequences that are joined together using recombinant DNA technology and procedures used to j oin together DNA sequences as described, for example, in Sambrook and Russell, Molecular Cloning: A
  • heterologous DNA sequence each refer to a sequence that originates from a source foreign to the particular host cell or, if from the same source, is modified from its original form.
  • a heterologous gene in a host cell includes a gene that is endogenous to the particular host cell but has been modified.
  • the terms also include non-naturally occurring multiple copies of a naturally occurring DNA sequence.
  • the terms refer to a DNA segment that is foreign or heterologous to the cell, or homologous to the cell but in a position within the host cell nucleic acid in which the element is not ordinarily found. Exogenous DNA segments are expressed to yield exogenous polypeptides.
  • a "homologous" DNA sequence is a DNA sequence that is naturally associated with a host cell into which it is introduced.
  • Wild-type refers to the normal gene, or organism found in nature without any known mutation.
  • Gene refers to the complete genetic material of an organism.
  • a "vector” is defined to include, inter alia, any plasmid, cosmid, phage or binary vector in double or single stranded linear or circular form which may or may not be self transmissible or mobilizable, and which can transform prokaryotic or eukaryotic host either by integration into the cellular genome or exist extrachromosomally ⁇ e.g., autonomous replicating plasmid with an origin of replication).
  • Coding vectors typically contain one or a small number of restriction endonuclease recognition sites at which foreign DNA sequences can be inserted in a determinable fashion without loss of essential biological function of the vector, as well as a marker gene that is suitable for use in the identification and selection of cells transformed with the cloning vector. Marker genes typically include genes that provide tetracycline resistance, hygromycin resistance or ampicillin resistance.
  • “Expression cassette” as used herein means a DNA sequence capable of directing expression of a particular nucleotide sequence in an appropriate host cell, comprising a promoter operably linked to the nucleotide sequence of interest which is operably linked to termination signals. It also typically comprises sequences required for proper translation of the nucleotide sequence.
  • the coding region usually codes for a protein of interest but may also code for a functional RNA of interest, for example antisense RNA or a nontranslated RNA, in the sense or antisense direction.
  • the expression cassette comprising the nucleotide sequence of interest may be chimeric, meaning that at least one of its components is heterologous with respect to at least one of its other components.
  • the expression cassette may also be one that is naturally occurring but has been obtained in a recombinant form useful for heterologous expression.
  • the expression of the nucleotide sequence in the expression cassette may be under the control of a constitutive promoter or of an inducible promoter that initiates transcription only when the host cell is exposed to some particular external stimulus.
  • the promoter can also be specific to a particular tissue or organ or stage of development.
  • Such expression cassettes will comprise the transcriptional initiation region of the invention linked to a nucleotide sequence of interest.
  • Such an expression cassette is provided with a plurality of restriction sites for insertion of the gene of interest to be under the
  • the expression cassette may additionally contain selectable marker genes.
  • Coding sequence refers to a DNA or RNA sequence that codes for a specific amino acid sequence and excludes the non-coding sequences. It may constitute an "uninterrupted coding sequence", i.e., lacking an intron, such as in a cDNA or it may include one or more introns bounded by appropriate splice junctions.
  • An "intron” is a sequence of RNA which is contained in the primary transcript but which is removed through cleavage and re-ligation of the RNA within the cell to create the mature mRNA that can be translated into a protein.
  • open reading frame and “ORF” refer to the amino acid sequence encoded between translation initiation and termination codons of a coding sequence.
  • initiation codon and termination codon refer to a unit of three adjacent nucleotides ('codon') in a coding sequence that specifies initiation and chain termination, respectively, of protein synthesis (mRNA translation).
  • a “functional RNA” refers to an antisense RNA, ribozyme, or other RNA that is not translated.
  • RNA transcript refers to the product resulting from RNA polymerase catalyzed transcription of a DNA sequence.
  • RNA transcript refers to the product resulting from RNA polymerase catalyzed transcription of a DNA sequence.
  • RNA sequence derived from posttranscriptional processing of the primary transcript and is referred to as the mature RNA.
  • mRNA essential RNA
  • cDNA refers to a single- or a double-stranded DNA that is complementary to and derived from mRNA.
  • regulatory sequences each refer to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences include enhancers, promoters, translation leader sequences, introns, and polyadenylation signal sequences. They include natural and synthetic sequences as well as sequences that may be a combination of synthetic and natural sequences. As is noted above, the term “suitable regulatory sequences” is not limited to promoters.
  • suitable regulatory sequences useful in the present invention will include, but are not limited to constitutive promoters, tissue-specific promoters, development-specific promoters, inducible promoters and viral promoters.
  • 5' non-coding sequence refers to a nucleotide sequence located 5' (upstream) to the coding sequence. It is present in the fully processed mRNA upstream of the initiation codon and may affect processing of the primary transcript to mRNA, mRNA stability or translation efficiency.
  • 3 ' non-coding sequence refers to nucleotide sequences located 3 ' (downstream) to a coding sequence and include polyadenylation signal sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or gene expression.
  • polyadenylation signal is usually characterized by affecting the addition of polyadenylic acid tracts to the 3 ' end of the mRNA precursor.
  • translation leader sequence refers to that DNA sequence portion of a gene between the promoter and coding sequence that is transcribed into RNA and is present in the fully processed mRNA upstream (5') of the translation start codon.
  • the translation leader sequence may affect processing of the primary transcript to mRNA, mRNA stability or translation efficiency.
  • mature protein refers to a post-translationally processed polypeptide without its signal peptide.
  • Precursor protein refers to the primary product of translation of an mRNA.
  • Signal peptide refers to the amino terminal extension of a polypeptide, which is translated in conjunction with the polypeptide forming a precursor peptide and which is required for its entrance into the secretory pathway.
  • signal sequence refers to a nucleotide sequence that encodes the signal peptide.
  • Promoter refers to a nucleotide sequence, usually upstream (5') to its coding sequence, which controls the expression of the coding sequence by providing the recognition for RNA polymerase and other factors required for proper transcription.
  • Promoter includes a minimal promoter that is a short DNA sequence comprised of a TATA- box and other sequences that serve to specify the site of transcription initiation, to which regulatory elements are added for control of expression.
  • Promoter also refers to a nucleotide sequence that includes a minimal promoter plus regulatory elements that is capable of controlling the expression of a coding sequence or functional RNA. This type of promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers.
  • an “enhancer” is a DNA sequence that can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue specificity of a promoter. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even be comprised of synthetic DNA segments. A promoter may also contain DNA sequences that are involved in the binding of protein factors that control the effectiveness of transcription initiation in response to physiological or developmental conditions.
  • the "initiation site” is the position surrounding the first nucleotide that is part of the transcribed sequence, which is also defined as position +1. With respect to this site all other sequences of the gene and its controlling regions are numbered. Downstream sequences (i.e. further protein encoding sequences in the 3' direction) are denominated positive, while upstream sequences (mostly of the controlling regions in the 5' direction) are denominated negative.
  • promoter elements particularly a TATA element, that are inactive or that have greatly reduced promoter activity in the absence of upstream activation are referred to as "minimal or core promoters.”
  • minimal or core promoters In the presence of a suitable transcription factor, the minimal promoter functions to permit transcription.
  • a “minimal or core promoter” thus consists only of all basal elements needed for transcription initiation, e.g., a TATA box and/or an initiator.
  • Constant expression refers to expression using a constitutive or regulated promoter.
  • Consditional and regulated expression refer to expression controlled by a regulated promoter.
  • “Operably-linked” refers to the association of nucleic acid sequences on single nucleic acid fragment so that the function of one is affected by the other.
  • a regulatory DNA sequence is said to be “operably linked to” or “associated with” a DNA sequence that codes for an RNA or a polypeptide if the two sequences are situated such that the regulatory DNA sequence affects expression of the coding DNA sequence (i.e., that the coding sequence or functional RNA is under the transcriptional control of the promoter). Coding sequences can be operably-linked to regulatory sequences in sense or antisense orientation.
  • “Expression” refers to the transcription and/or translation in a cell of an endogenous gene, transgene, as well as the transcription and stable accumulation of sense (mRNA) or functional RNA.
  • expression may refer to the transcription of the antisense DNA only. Expression may also refer to the production of protein.
  • Transcription stop fragment refers to nucleotide sequences that contain one or more regulatory signals, such as polyadenylation signal sequences, capable of terminating
  • transcription stop fragments are known to the art.
  • Translation stop fragment refers to nucleotide sequences that contain one or more regulatory signals, such as one or more termination codons in all three frames, capable of terminating translation. Insertion of a translation stop fragment adjacent to or near the initiation codon at the 5' end of the coding sequence will result in no translation or improper translation. Excision of the translation stop fragment by site-specific recombination will leave a site-specific sequence in the coding sequence that does not interfere with proper translation using the initiation codon.
  • c/s-acting sequence and "c/s-acting element” refer to DNA or RNA sequences whose functions require them to be on the same molecule.
  • trans-acting sequence and "trans-acting element” refer to DNA or RNA sequences whose function does not require them to be on the same molecule.
  • Chrosomally-integrated refers to the integration of a foreign gene or DNA construct into the host DNA by covalent bonds. Where genes are not “chromosomally integrated” they may be “transiently expressed.” Transient expression of a gene refers to the expression of a gene that is not integrated into the host chromosome but functions independently, either as part of an autonomously replicating plasmid or expression cassette, for example, or as part of another biological system such as a virus.
  • sequence relationships between two or more nucleic acids or polynucleotides are used to describe the sequence relationships between two or more nucleic acids or polynucleotides: (a) “reference sequence,” (b) “comparison window,” (c) “sequence identity,” (d) “percentage of sequence identity,” and (e) “substantial identity.”
  • reference sequence is a defined sequence used as a basis for sequence comparison.
  • a reference sequence may be a subset or the entirety of a specified sequence; for example, as a segment of a full length cDNA or gene sequence, or the complete cDNA or gene sequence.
  • comparison window makes reference to a contiguous and specified segment of a polynucleotide sequence, wherein the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
  • the comparison window is at least 20 contiguous nucleotides in length, and optionally can be 30, 40, 50, 100, or longer.
  • implementations include, but are not limited to: CLUSTAL in the PC/Gene program (available from Intelligenetics, Mountain View, California); the ALIGN program (Version 2.0) and GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Version 8 (available from Genetics Computer Group (GCG), 575 Science Drive, Madison, Wisconsin, USA). Alignments using these programs can be performed using the default parameters.
  • HSPs high scoring sequence pairs
  • Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues; always ⁇ 0).
  • M forward score for a pair of matching residues
  • N penalty score for mismatching residues; always ⁇ 0.
  • a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when the cumulative alignment score falls off by the quantity X from its maximum achieved value, the cumulative score goes to zero or below due to the accumulation of one or more negative-scoring residue alignments, or the end of either sequence is reached.
  • the BLAST algorithm In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences.
  • One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
  • P(N) the smallest sum probability
  • a test nucleic acid sequence is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid sequence to the reference nucleic acid sequence is less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.
  • Gapped BLAST in BLAST 2.0
  • PSI-BLAST in BLAST 2.0
  • the default parameters of the respective programs e.g., BLASTN for nucleotide sequences, BLASTX for proteins
  • the BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix. See the world-wide-web at ncbi.nlm.nih.gov. Alignment may also be performed manually by visual inspection.
  • comparison of nucleotide sequences for determination of percent sequence identity to the promoter sequences disclosed herein is preferably made using the BlastN program (version 1.4.7 or later) with its default parameters or any equivalent program.
  • equivalent program is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide or amino acid residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by the preferred program.
  • sequence identity or “identity” in the context of two nucleic acid or polypeptide sequences makes reference to a specified percentage of residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window, as measured by sequence comparison algorithms or by visual inspection.
  • percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule.
  • sequences differ in conservative substitutions the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution.
  • Sequences that differ by such conservative substitutions are said to have "sequence similarity” or “similarity.” Means for making this adjustment are well known to those of skill in the art.
  • percentage of sequence identity means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity.
  • polynucleotide sequences means that a polynucleotide comprises a sequence that has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79%, at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%, at least 90%, 91%, 92%, 93%, or 94%, and at least 95%, 96%, 97%, 98%, or 99% sequence identity, compared to a reference sequence using one of the alignment programs described using standard parameters.
  • nucleotide sequences are substantially identical if two molecules hybridize to each other under stringent conditions (see below).
  • stringent conditions are selected to be about 5°C lower than the thermal melting point (T m ) for the specific sequence at a defined ionic strength and pH.
  • T m thermal melting point
  • stringent conditions encompass temperatures in the range of about 1°C to about 20°C, depending upon the desired degree of stringency as otherwise qualified herein.
  • Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides they encode are substantially identical. This may occur, e.g., when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code.
  • One indication that two nucleic acid sequences are substantially identical is when the polypeptide encoded by the first nucleic acid is immunologically cross reactive with the polypeptide encoded by the second nucleic acid.
  • substantially identical in the context of a peptide indicates that a peptide comprises a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%, at least 90%, 91%, 92%, 93%, or 94%), or 95%), 96%, 97%, 98% or 99%, sequence identity to the reference sequence over a specified comparison window.
  • An indication that two peptide sequences are substantially identical is that one peptide is immunologically reactive with antibodies raised against the second peptide.
  • a peptide is substantially identical to a second peptide, for example, where the two peptides differ only by a conservative substitution.
  • sequence comparison typically one sequence acts as a reference sequence to which test sequences are compared.
  • test and reference sequences are input into a computer, subsequence coordinates are designated if necessary, and sequence algorithm program parameters are designated.
  • sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.
  • hybridizing specifically to refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent conditions when that sequence is present in a complex mixture (e.g., total cellular) DNA or RNA.
  • Bod(s) substantially refers to complementary hybridization between a probe nucleic acid and a target nucleic acid and embraces minor mismatches that can be accommodated by reducing the stringency of the hybridization media to achieve the desired detection of the target nucleic acid sequence.
  • T m The thermal melting point (T m ) is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Specificity is typically the function of
  • T m can be approximated from the equation of Meinkoth and Wahl: T m 81.5°C + 16.6 (log M) +0.41 (%GC) - 0.61 (% form) - 500/L; where M is the molarity of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs.
  • T m is reduced by about 1°C for each 1% of mismatching; thus, T m , hybridization, and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the Tm can be decreased 10°C. Generally, stringent conditions are selected to be about 5°C lower than the T m for the specific sequence and its complement at a defined ionic strength and pH.
  • An example of highly stringent wash conditions is 0.15 M NaCl at 72EC for about 15 minutes.
  • An example of stringent wash conditions is a 0.2X SSC wash at 65EC for 15 minutes.
  • a high stringency wash is preceded by a low stringency wash to remove background probe signal.
  • An example medium stringency wash for a duplex of, e.g., more than 100 nucleotides is IX SSC at 45EC for 15 minutes.
  • An example low stringency wash for a duplex of, e.g., more than 100 nucleotides, is 4-6X SSC at 40EC for 15 minutes.
  • stringent conditions typically involve salt concentrations of less than about 1.5 M, more preferably about 0.01 to 1.0 M, Na ion concentration (or other salts) at pH 7.0 to 8.3, and the temperature is typically at least about 30EC and at least about 60°C for long probes (e.g., >50 nucleotides).
  • Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
  • a signal to noise ratio of 2X (or higher) than that observed for an unrelated probe in the particular hybridization assay indicates detection of a specific hybridization.
  • Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the proteins that they encode are substantially identical. This occurs, e.g., when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code.
  • Very stringent conditions are selected to be equal to the T m for a particular probe.
  • An example of stringent conditions for hybridization of complementary nucleic acids which have more than 100 complementary residues on a filter in a Southern or Northern blot is 50% formamide, e.g., hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0. IX SSC at 60 to 65°C.
  • Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 37°C, and a wash in 0.5X to IX SSC at 55 to 60°C.
  • the genes and nucleotide sequences of the invention include both the naturally occurring sequences as well as mutant forms.
  • the polypeptides of the invention encompass naturally occurring proteins as well as variations and modified forms thereof. Such variants will continue to possess the desired activity.
  • the deletions, insertions, and substitutions of the polypeptide sequence encompassed herein are not expected to produce radical changes in the characteristics of the polypeptide. However, when it is difficult to predict the exact effect of the substitution, deletion, or insertion in advance of doing so, one skilled in the art will appreciate that the effect will be evaluated by routine screening assays.
  • transgenic refers to the transfer of a nucleic acid fragment into the genome of a host cell, resulting in genetically stable inheritance.
  • Host cells containing the transformed nucleic acid fragments are referred to as “transgenic” cells, and organisms comprising transgenic cells are referred to as “transgenic organisms”.
  • Transformed refers to a host cell or organism into which a heterologous nucleic acid molecule has been introduced.
  • the nucleic acid molecule can be stably integrated into the genome generally known in the art.
  • Known methods of PCR include, but are not limited to, methods using paired primers, nested primers, single specific primers, degenerate primers, gene-specific primers, vector-specific primers, partially
  • mismatched primers and the like.
  • transformed transformed
  • transformant and “transgenic” cells have been through the transformation process and contain a foreign gene integrated into their chromosome.
  • untransformed refers to normal cells that have not been through the transformation process.
  • a "transgenic" organism is an organism having one or more cells that contain an expression vector.
  • portion or fragment as it relates to a nucleic acid molecule, sequence or segment of the invention, when it is linked to other sequences for expression, is meant a sequence having at least 80 nucleotides, more preferably at least 150 nucleotides, and still more preferably at least 400 nucleotides. If not employed for expressing, a "portion” or “fragment” means at least 9, preferably 12, more preferably 15, even more preferably at least 20, consecutive nucleotides, e.g., probes and primers (oligonucleotides), corresponding to the nucleotide sequence of the nucleic acid molecules of the invention.
  • the agents of the invention are preferably administered so as to result in a reduction in at least one symptom associated with a disease.
  • the amount administered will vary depending on various factors including, but not limited to, the composition chosen, the particular disease, the weight, the physical condition, and the age of the mammal, and whether prevention or treatment is to be achieved. Such factors can be readily determined by the clinician employing animal models or other test systems, which are well known to the art.
  • Administration of therapeutic agents may be accomplished through the administration of the therapeutic agent, such as a peptide.
  • the therapeutic agent such as a peptide.
  • Pharmaceutical formulations, dosages and routes of administration for peptide are generally known.
  • the present invention envisions treating uveitis in a mammal by the administration of an agent, e.g., a peptide.
  • Administration of the therapeutic agents in accordance with the present invention may be continuous or intermittent, depending, for example, upon the recipient's physiological condition, whether the purpose of the administration is therapeutic or prophylactic, and other factors known to skilled practitioners.
  • the administration of the agents of the invention may be essentially continuous over a preselected period of time or may be in a series of spaced doses. Both local and systemic administration is contemplated.
  • One or more suitable unit dosage forms having the therapeutic agent(s) of the invention which, as discussed below, may optionally be formulated for sustained release (for example using microencapsulation, see WO 94/07529, and U.S. Patent No. 4,962,091 the disclosures of which are incorporated by reference herein), can be administered by a variety of routes including parenteral, including by intravenous and intramuscular routes, as well as by direct injection into the diseased tissue.
  • the therapeutic agent may be directly administered to the eye.
  • the formulations may, where appropriate, be conveniently presented in discrete unit dosage forms and may be prepared by any of the methods well known to pharmacy. Such methods may include the step of bringing into association the therapeutic agent with liquid carriers, solid matrices, semi-solid carriers, finely divided solid carriers or combinations thereof, and then, if necessary, introducing or shaping the product into the desired delivery system.
  • the therapeutic agents of the invention are prepared for administration, they are preferably combined with a pharmaceutically acceptable carrier, diluent or excipient to form a pharmaceutical formulation, or unit dosage form.
  • a pharmaceutically acceptable carrier diluent or excipient to form a pharmaceutical formulation, or unit dosage form.
  • the total active ingredients in such formulations include from 0.1 to 99.9% by weight of the formulation.
  • a "pharmaceutically acceptable” is a carrier, diluent, excipient, and/or salt that is compatible with the other ingredients of the formulation, and not deleterious to the recipient thereof.
  • the active ingredient for administration may be present as a powder or as granules, as a solution, a suspension or an emulsion.
  • compositions containing the therapeutic agents of the invention can be prepared by procedures known in the art using well known and readily available ingredients.
  • the therapeutic agents of the invention can also be formulated as solutions appropriate for parenteral administration, for instance by intraocular routes.
  • the pharmaceutical formulations of the therapeutic agents of the invention can also take the form of an aqueous or anhydrous solution or dispersion, or alternatively the form of an emulsion or suspension.
  • the therapeutic agent may be formulated for parenteral administration (e.g., by injection, for example, bolus injection or continuous infusion) and may be presented in unit dose form in ampules, pre-filled syringes, small volume infusion containers or in multi-dose containers with an added preservative.
  • the active ingredients may take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • the active ingredients may be in powder form, obtained by aseptic isolation of sterile solid or by lyophilization from solution, for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water, before use.
  • the pharmaceutical formulations of the present invention may include, as optional ingredients, pharmaceutically acceptable carriers, diluents, solubilizing or emulsifying agents, and salts of the type that are well-known in the art.
  • pharmaceutically acceptable carriers such as phosphate buffered saline solutions pH 7.0-8.0 saline solutions and water.
  • therapeutic agent refers to any agent or material that has a beneficial effect on the mammalian recipient.
  • therapeutic agent embraces both therapeutic and prophylactic molecules having nucleic acid or protein components.
  • Treating refers to ameliorating at least one symptom of, curing and/or preventing the development of a given disease or condition.
  • CAPN5 undergoes increased autoproteolysis.
  • Autoproteolysis was used as a starting point for finding a CAPN5 -specific substrate.
  • CAPN5 cleaves itself at two sites, releasing a 60 kDa or 45 kDa enzyme (Figs. 1A-B).
  • a time course of CAPN5 autoproteolysis showed that the R243L mutant had a faster rate of autoproteolysis than WT CAPN5 (Fig. IB).
  • the sequence comprising this site was used to home in on a peptide substrate.
  • CAPN5 cleavage peptides Identification of optimal CAPN5 cleavage peptides. Possible substrate sequences were narrowed down to 10-20 amino acids (data not shown). CAPN5 autoproteolysis cleavages sites were narrowed down to two peptides, which we term CAPN5-370-390 and CAPN5-390-410 (Table 1). FRET peptides were designed based on determined cleavage sites (Biopeptek; Table 1).
  • Peptide substrates dissolved in DMSO and H 2 0 were incubated with WT CAPN5 at 37°C in the presence or absence of calcium until a change in fluorescence was no longer detected.
  • CAPN5-370-380 fragment was the most sensitive to cleavage by both WT and
  • R243L CAPN5 (Figs. 3 and 4). As expected, R243LCAPN5 (hyperactive) cleaved substrate fragments at a higher rate (Fig. 4). Inhibitor peptides were identified that serve as the lead compounds for optimization. Figures 3 and 4 show that CAPN5 amino acids 370-380 represent a putative new therapeutic compound for CAPN5 inhibition.
  • the CAPN5-370-80 peptide comprises a sequence motif that is conserved among calpains ( Figures 5 A and 5B).
  • a previously-identified CAPN1 peptide, EPLFAERK (SEQ ID NO: 22) is specific to CAPNl as it is not proteolyzed by CAPN5.
  • a peptide derived from a suspected CAPN5 autoproteolysis site, CAPN5 (370-380, RQNRGGGCINH (SEQ ID NO:23)
  • CAPN5 370-380, RQNRGGGCINH (SEQ ID NO:23)
  • I IKCEGDKVR SAVQKGTSTP EYNVKGI FYR KKLSQPITVQ VWNHRVLKDE FLGQVHLKAD
  • EQKLISEEDL * (SEQ ID NO: 3) hCAPN5-truncationl : 1-200 amino acids + 3x myc (indicated in bold), 693 nucleotides, 231 amino acids DNA sequence:
  • hCAPN5-truncation2 1-400 amino acids + 3x myc (indicated in bold), 1293 nts, 431 amino acids
  • hCAPN5-truncation6 181-420 amino acids+3x myc (indicated in bold), 813nts, 271 amino acids
  • V ma x is the maximum velocity or rate at which an enzyme catalyzes a reaction; when all enzyme active sites are saturated with substrate.
  • K m is the substrate concentration at which the reaction rate is half of the maximum. It is an inverse measure of affinity. Thus, a higher K m value means more substrate is needed to saturate the enzyme.
  • Cyclic peptides have been generated that block the binding site otherwise occupied by the 10 amino acid target peptide.
  • a highly specific peptide that is a proteolytic target of CAPN5 was identified. This peptide is modified to become protease resistant for use as an inhibitor.
  • Proteolytic kinetics of CAPN5 is influenced by peptide length near its autoproteolytic site. Peptides substrates that were 7, 11, and 21 amino acids long were incubated in calpain activity buffer. The solution was brought to 37°C. CAPN5 was then added and fluorescence was measured. There was mild cleavage of the 7 aa peptide was observed (Fig. 12A), and rapid and high cleavage of the 11 aa peptide (Fig. 12B). The 21 aa peptide was cleaved slower and does not show cleavage substrate inhibition (Fig. 12C). The kinetics data from the Michaelis- Menten and substrate inhibition equations are shown in a table (Fig. 12D).
  • the peptides that were tested showed calpain-specificity. Peptides were incubated in calpain activity buffer, and the solution was brought to 37°C. Calpain was added and fluorescence was measured. The fluorescence measured for the lead peptide, CAPN5p370-380, was plotted and lines were fit using the following substrate inhibition equation,
  • Y Vmax*X/(Km+X*(l+X/Ki)).
  • the peptide shows high proteolysis when incubated with CAPN5-WT and very limited proteolysis when incubated with CPAN1-WT (Fig. 13A).
  • the fluorescence measure for a previously published calpain-1 peptide, EPLFAERK, was plotted and lines were fit using the following Michaelis-Menten equation, Y Vmax*X/(Km+X) (Fig. 13B).
  • the peptide shows high proteolysis when incubated with CAPNl -WT and very limited proteolysis when incubated with CAPN5-WT, suggesting substrate specificity.
  • Kinetics data from the Michaelis-Menten and substrate inhibition equations are shown in a table (Fig. 13C).
  • CAPN5 specifically targets a peptide corresponding to its own autocatalytic site and not homologous regions in other calpains.
  • An alignment of the peptides shows very limited sequence homology (Fig. 14A).
  • Peptides corresponding to the homologous regions of the CAPN5 autoproeolysis site in other calpain family members were incubated with CAPN5 protease.
  • CAPN5 did not proteolyze homologous regions of other CAPN members as well as it proteolyzed its own site, although there was some proteolysis of the CAPN 14 peptide (Fig. 14B).
  • Peptides tested in Fig. 14B were incubated with CAPNl .
  • CAPNl does not appear to proteolyze these regions (Fig. 14C).
  • Kinetics data from the Michaelis-Menten and substrate inhibitions equations are shown in a table (Fig. 14D).
  • the classical calpain inhibitor SNJ-1945 inhibits CAPNl but is not a good inhibitor of CAPN5.
  • Various concentrations of SNJ-1945 were incubated in a reaction with 50 ⁇
  • EPLFAERK a CAPNl substrate
  • CAPNl WT in activity. Addition of 1 ⁇ SNJ-1945 slows the initial reaction rate by 100% (Fig. 15A).
  • CAPNl WT was incubated with and without SNJ-1945 at increasing concentrations of EPLFAERK substrate (Fig. 15B).
  • Various concentrations of SNJ-1945 were incubated in a reaction with CAPN5p.370-80 and CAPN5 WT in an activity buffer. Only after addition of 100 ⁇ SNJ-1945 did the initial reaction rate slow to 100% (Fig. 15C).
  • CAPN5 WT was incubated with and without SNJ-1945 at increasing concentrations of CAPN5 p.370-80 substrate (Fig. 15D).
  • Second generation inhibitors based off lead compound competitively inhibit CAPN5.
  • First generation lead compound CAPN5 p.370-80 was modified using amide cyclization to generate a second generation competitive cyclic inhibitor.
  • Various concentrations of Cyclic CAPN5 p.370-80 were incubated in a reaction with CAPN5p.370-80 and CAPN5 WT in an activity buffer. Addition of 10 ⁇ Cyclic CAPN5 p.370-80 slows the initial reaction rate by 40% (Fig. 16A).
  • CAPN5 WT was incubated with and without 10 ⁇ Cyclic CAPN5 p.370-80 at increasing concentrations of CAPN5 p.370-80 substrate. Increasing concentrations of substrate does not overcome inhibition by cyclic peptide (Fig. 16B).
  • the co-crystallization of CAPN5 with CAPN5p.370-80 peptide is shown in Fig. 17. Modification of lead compound reveals potential for competitive inhibition.
  • Fig. 18A Structural model of the CAPN5 protease core with the peptide docked to it using AutoDock VINA is shown in Fig. 18A. Scanning modifications were made to the amino acids of the lead compound to make the bonds un-cleavable by CAPN5 (Fig. 18B). Despite modifications, the peptide still fit in the catalytic groove using docking predictions. N-terminal (EDANS) and C- terminal GLU-(DABCYL) FRET tags were added to the peptides for our standard CAPN5 assay and were dissolved in 70% DMSO (Fig. 18C). Peptides incubated for 15 minutes at various concentrations with 5 ⁇ g of MBP-CAPN5 WT. Modification of the amino acids slows the reaction rate. Data is plotted as initial velocity (uM/sec) versus peptide concentration fit to the substrate inhibition equation (Fig. 18D).
  • the CAPN5-370-80 peptide was modified (Figs. 19A-19G) and the activity was evaluated (Figs. 20A-20D).
  • a structural model of the CAPN5 protease core with the peptide docked to it using AutoDock VINA is provided in Fig. 20A.
  • Chemical structure of the CAPN5- 370-80 peptide (RQNRGGGCINH) is provided in Fig. 20B. Scanning modifications were made to the amino acids of the peptide to make the bonds un-cleavable by CAPN5.
  • N-terminal (EDANS) and C-terminal GLU- (DABCYL) FRET tags were added to the peptides for the standard CAPN5 assay and were dissolved in 70% DMSO.
  • Data is plotted as initial velocity (uM/sec) versus peptide concentration. Modification of the amino acids slows the reaction rate. Close-up of graph region highlighting the differences in proteolytic activity at 5 ⁇ substrate is provided in Fig. 20D.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Wood Science & Technology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Rheumatology (AREA)
  • Pain & Pain Management (AREA)
  • Toxicology (AREA)
  • Ophthalmology & Optometry (AREA)
  • Epidemiology (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)

Abstract

The present disclosure provides CAPN5 substrates and CAPN5 inhibitors, nucleic acids encoding CAPN5 substrates or CAPN5 inhibitors, methods to deliver CAPN5 substrate or CAPN5 inhibitor agents to the eye, and methods of identifying inhibitors of CAPN5.

Description

METHODS AND COMPOSITIONS FOR TREATING GENETIC EYE DISEASES
RELATED APPLICATIONS
This application claims priority to United States Provisional Application Serial No. 62/406,806 that was filed on October 11, 2016, and United States Provisional Application Serial No. 62/525,510 that was filed on June 27, 2017. The entire content of the applications referenced above are hereby incorporated by reference herein.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
This invention was made with government support under ROl EY024665 and ROl
EY025225 awarded by National Institutes of Health. The government has certain rights in the invention.
INTRODUCTION
Uveitis (intraocular inflammation) remains a common yet diffi cult-to-treat cause of visual loss in all ages, for which the molecular cause is unknown.
Autosomal Dominant Neovascular Inflammatory Vitreoretinopathy (ADNIV) is an inherited disease characterized by retinal and iris neovascularization, abnormal retinal pigmentation, anterior chamber and vitreous inflammation, cystoid macular edema, vitreous hemorrhage, and traction retinal detachment. Mutations in the CAPN5 gene cause ADNIV. CAPN5 is the first nonsyndromic gene for autoimmune uveitis, and among the very few
Mendelian autoimmune diseases where the gene is identified. CAPN5 encodes the protease calpain-5, a calcium-activated intracellular cysteine protease, which is expressed in many tissues including photoreceptors and their nuclei. It is one of 16 calpain proteases, which cleave subdomains from target proteins to irreversibly change their function. The disease mechanisms are not understood, but the disease mimics several common diseases such as diabetic
retinopathy, retinitis pigmentosa, and proliferative vitreoretinopathy.
Therapies for genetic diseases of the eye, including ADNIV, need to be developed. SUMMARY
The present inventors have discovered therapeutic agents, such as peptides, that inhibit the CAPN5 enzyme. The present invention provides therapies to treat or prevent the onset of Autosomal Dominant Neovascular Inflammatory Vitreoretinopathy (ADNIV) and its sequelae by administering to a mammal in need of such therapy, an effective amount of these therapeutic agents that inhibit CAPN5.
The present invention provides in certain embodiments a CAPN5 substrate comprising an amino acid sequence of 10-30 amino acids in length having at least 80% sequence identity to a peptide, wherein the peptide is PDGFB (SEQ ID NO: 18), HOG (SEQ ID NO: 19), CAPN5- 370-390 (SEQ ID NO:20), CAPN5-390-410 (SEQ ID NO:21), CAPN5-370-380 (SEQ ID NO:23) or CAPN14 (SEQ ID NO: 32).
The present invention provides in certain embodiments a CAPN5 substrate having at least 90% sequence identity to a peptide, wherein the peptide is PDGFB (SEQ ID NO: 18), IRX3 (SEQ ID NO: 19), CAPN5-370-390 (SEQ ID NO:20), CAPN5-390-410 (SEQ ID NO:21), CAPN5-370-380 (SEQ ID NO:23) or CAPN14 (SEQ ID NO: 32).
The present invention provides in certain embodiments a CAPN5 substrate having at least 95% sequence identity to a peptide, wherein the peptide is PDGFB (SEQ ID NO: 18), IRX3 (SEQ ID NO: 19), CAPN5-370-390 (SEQ ID NO:20), CAPN5-390-410 (SEQ ID NO:21), CAPN5-370-380 (SEQ ID NO:23) or CAPN14 (SEQ ID NO: 32).
In certain embodiments the peptide is CAPN5-370-380 (SEQ ID NO:23).
The present invention provides in certain embodiments a CAPN5 substrate or CAPN5 inhibitor as described above, wherein the peptide contains an unnatural (also called an
"artificial") amino acid residue.
In certain embodiments, the unnatural amino acid residue renders the peptide bond uncleavable by calpain.
In certain embodiments, the modified amino acid residue is methylated.
In certain embodiments, the methylated amino acid residue is methyl-arginine, methyl- glycine, or methyl-isoleucine.
In certain embodiments, the unnatural amino acid residue is a D-amino acid.
In certain embodiments, the D-amino acid is D-glutamine or D-asparagine.
In certain embodiments, the unnatural amino acid residue is Acm-cysteine.
The present invention provides in certain embodiments a CAPN5 substrate or CAPN5 inhibitor as described above, wherein the peptide forms an alpha-helix. In certain embodiments, the peptide forms a circular peptide.
In certain embodiments, the peptide is from 5 to 11 amino acids in length.
In certain embodiments, the inhibitory peptide occupies the catalytic groove or region that prevents formation of the catalytic triad.
In certain embodiments, the inhibitory peptide is soluble in aqueous solutions. In certain embodiments, the present invention provides a CAPN5 substrate that is Pep-1- Mod (SEQ ID NO:33), Pep-2-Mod (SEQ ID NO:34), Pep-3-Mod (SEQ ID NO:35), Pep-4-Mod (SEQ ID NO:36), Pep-5-Mod (SEQ ID NO:37) or Pep-6-Mod (SEQ ID NO:38).
In certain embodiments, the CAPN5 substrate is Pep-6-Mod (SEQ ID NO:38).
The present invention provides in certain embodiments a composition comprising the
CAPN5 substrate or CAPN5 inhibitor as described above and a physiologically acceptable carrier.
The present invention provides in certain embodiments a method of identifying an inhibitor of CAPN5 comprising, contacting CAPN5 with a CAPN5 substrate described above in the presence of a target inhibitor, and measuring an activity level of the CAPN5 in the presence of the target inhibitor as compared to an activity level of CAPN5 in the absence of the target inhibitor. In certain embodiments, the present invention provides CAPN5 inhibitor identified by this method.
The present invention provides in certain embodiments a method of treating CAPN5- related inflammation by administering a therapeutic agent comprising the CAPN5 substrate or CAPN5 inhibitor as described above.
The present invention provides in certain embodiments a method of treating uveitis by administering a therapeutic agent comprising the CAPN5 substrate or CAPN5 inhibitor as described above.
The present invention provides in certain embodiments a therapeutic method for preventing or treating a pathological condition or symptom in a mammal, such as a human, wherein an anti -inflammatory activity is desired, comprising administering to a mammal in need of such therapy, an effective amount of a therapeutic agent comprising the CAPN5 substrate or CAPN5 inhibitor as described above.
The present invention provides in certain embodiments a therapeutic method for preventing or treating intraocular inflammation in a mammal, such as a human, comprising administering to a mammal in need of such therapy, an effective amount of a therapeutic agent comprising the CAPN5 substrate or CAPN5 inhibitor as described above.
The present invention provides in certain embodiments a method to treat intraocular inflammation comprising administering a therapeutically effective amount of a therapeutic agent comprising the CAPN5 substrate or CAPN5 inhibitor as described above to a mammal.
The present invention provides in certain embodiments a CAPN5 substrate or CAPN5 inhibitor as described above for use in medical therapy. The present invention provides in certain embodiments the use of a CAPN5 substrate or CAPN5 inhibitor as described above for the manufacture of a medicament useful for the treatment of intraocular inflammation in a mammal.
The present invention provides in certain embodiments a solution comprising a carrier and a CAPN5 substrate or CAPN5 inhibitor as described above dispersed in the carrier.
The present invention provides in certain embodiments an isolated or purified nucleic acid that is less than 150 nucleotides in length encoding a peptide as described above.
In certain embodiments, the isolated or purified nucleic acid is less than 120 nucleotides in length.
The present invention provides in certain embodiments an expression cassette comprising the nucleic acid described above. In certain embodiments, thee expression cassette, further comprises a promoter.
The present invention provides in certain embodiments a vector comprising the expression cassette described above.
The present invention provides in certain embodiments a cell comprising the expression cassette or the vector described above.
In certain embodiments, the present invention provides the CAPN5 substrate as described above, further comprising a detection agent to form a labelled CAPN5 substrate.
In certain embodiments, the detection agent is a fluorescent or colorimetric chemical agent.
In certain embodiments, the present invention provides a method of detecting CAPN5 comprising administering a labelled CAPN5 substrate_described above.
The terms "protein," "peptide" and "polypeptide" are used interchangeably herein. Peptide sequences specifically recited herein are written with the amino terminus on the left and the carboxy terminus on the right.
As used herein, the term "therapeutic agent" refers to any agent or material that has a beneficial effect on the mammalian recipient. Thus, "therapeutic agent" embraces both therapeutic and prophylactic molecules having nucleic acid or protein components.
"Treating" as used herein refers to ameliorating at least one symptom of, curing and/or preventing the development of a given disease or condition.
BRIEF DESCRIPTION OF THE DRAWINGS
Figures 1A-1B. CAPN5 has two autoproteolysis sites. Figure 1 A. Calcium-activated CAPN5 autoproteolysis releases a 60 kDa and 45 kDa fragment. Figure IB. SBP-tagged CAPN5-PC (WT, and R243L) incubated with 1 mM calcium produced 60 kDa fragments.
R243L CAPN5 produced the 60 kDa fragment at earlier time points than WT.
Figure 2. Diagram of Assay. I OUM of FRET substrates were added to a solution containing 2mM DTT, 5uM Calcium, and CAPN5 Buffer (20mM Tris, 300mM NaCl, pH 7.5) to a volume of lOOuL. The solution was pipetted into a 96 well plate in wells that contained 24uM of CAPN5-WT, CAPN5-R243L, or no CAPN5. The fluorescence of each well was measured using a Tecan Infinite M200 Pro plate reader.
Figure 3. CAPN5-WT proteolyzes the substrate, CAPN5 (p370-380), at a higher rate than other peptides. When CAPN5-WT is added to a variety of substrates, the greatest fluorescent intensity is detected with substrate CAPN5 (p370-380).
Figure 4. CAPN5-R243L proteolyzes three substrates at a higher rate than other peptides. When CAPN5-R243L is added to a variety of substrates, the greatest fluorescent intensity is detected with substrates CAPN5 (p370-390), CAPN5 (370-380), and PDGFB (155- 170).
Figures 5A-5B. The CAPN5-370-80 peptide comprises a sequence motif that is conserved among calpains. (Fig. 5A) Multiple sequence alignment of the CAPN5-370-80 peptide with homologous sequences from other human calpains reveals highly related sequences that are specific to their corresponding calpains. There is high sequence conservation in the p.G376-377 positions, highlighting the functional importance of these residues in calpain structure and function. (Fig. 5B) A homology model of domain III from human CAPN5 was generated using CAPN2 (PDB: 1KFU) as a template in MODELLER. Further conservation analysis was performed using the ConSurf server and was visualized on the domain III model in PyMOL. Results of this analysis identified p.G376-377 to be 100% conserved across 88 homologous calpain sequences. Structural modeling placed these residues on an exposed flexible loop, which would serve as an accessible site for calpain autoproteolysis.
Figure 6. Schematic of Calpain Domains and various truncations of Homo sapiens calpain 5 (CAPN5).
Figures 7A-7B. Graphs showing CAPNl vs. CAPN5 cleavage. Fig. 7A. EPLFAERK, Fig. 7B. CAPN5(p370-380)
Figure 8. Kinetics of initial slope for CAPN5-WT and CAPN5-R243L.
Figure 9. Kinetics of steady slope for CAPN5-WT and CAPN5-R243L.
Figure 10. Peptides are specific to CAPNl or CAPN5.
Figure 11. Peptides are specific to CAPNl or CAPN5. Figures 12A-12D. Proteolytic kinetics of CAPN5 is influenced by peptide length near its autoproteolytic site. Peptides substrates that were 7, 11, and 21 amino acids long were incubated in calpain activity buffer. The solution was brought to 37°C. CAPN5 was then added and fluorescence was measured. Fig. 12A: Substrate CAPN5p.372-378. Fig. 12B: Substrate CAPN5p.370-380. Fig. 12C. Substrate CAPN5p.370-390. Fig. 12A &C: The data from these peptides were fit using the Michaelis-Menten equation: Y=Vmax*X/(Km+X) B. The data from this peptide was fit using the substrate inhibition equation: Y=Vmax*X/(Km + X*(l+X/Ki)) Fig. 12D: Kinetics data from the Michaelis-Menten and substrate inhibition equations are shown in the table.
Figures 13A-13C. Tested peptides show calpain-specificity. Peptides were incubated in calpain activity buffer. Fig. 13A: The fluorescence measured for our lead peptide,
CAPN5p370-380, was plotted and lines were fit using the following substrate inhibition equation, Y=Vmax*X/(Km+X*(l+X/Ki)). The peptide shows high proteolysis when incubated with CAPN5-WT and very limited proteolysis when incubated with CPAN1-WT (green). Fig. 13B: The fluorescence measure for a previously published calpain-1 peptide, EPLFAERK, was plotted and lines were fit using the following Michaelis-Menten equation, Y=
Vmax*X/(Km+X). The peptide shows high proteolysis when incubated with CAPNl-WT (green) and very limited proteolysis when incubated with CAPN5-WT (blue), suggesting substrate specificity. Fig. 13C: Kinetics data from the Michaelis-Menten and substrate inhibition equations are shown in a table.
Figures 14A-14D: CAPN5 specifically targets a peptide corresponding to its own autocatalytic site and not homologous regions in other calpains. Fig. 14A: An alignment of the peptides shows very limited sequence homology. Fig. 14B: CAPN5 did not proteolyze homologous regions of other CAPN members as well as it proteolyzed its own site, although there was some proteolysis of the CAPN14 peptide. The data points were plotted and fit using the Michaelis-Menten equation (not shown) and the substrate inhibition equation (shown). Fig. 14C: Peptides tested in (Fig. 14B) were incubated with CAPNl . CAPNl does not appear to proteolyze these regions. The data points were plotted and fit using the Michaelis-Menten equation. Fig. 14D: Kinetics data from the Michaelis-Menten and substrate inhibitions equations are shown in a table.
Figures 15A-15D: The classical calpain inhibitor SNJ-1945 inhibits CAPNl but is not a good inhibitor of CAPN5. Fig. 15A: Various concentrations of SNJ-1945 were incubated in a reaction with 50 μΜ EPLFAERK (a CAPNl substrate) and CAPNl WT in activity. Data is plotted for CAPNl as initial velocity (μΜ/sec) versus SNJ-1945 concentration. Addition of 1 μΜ SNJ-1945 slows the initial reaction rate by 100%. Fig. 15B: CAPN1 WT was incubated with and without SNJ-1945 at increasing concentrations of EPLFAERK substrate. Data is plotted for CAPN1 as initial velocity (μΜ/sec) versus substrate concentration. Fig. 15C:
Various concentrations of SNJ-1945 were incubated in a reaction with CAPN5p.370-80 and CAPN5 WT in an activity buffer. Data is plotted for CAPN5 as initial velocity (μΜ/sec) versus SNJ-1945 concentration. Only after addition of 100 μΜ SNJ-1945 did the initial reaction rate slow to 100%. Fig. 15D: CAPN5 WT was incubated with and without SNJ-1945 at increasing concentrations of CAPN5 p.370-80 substrate. Data is plotted for CAPN5 as initial velocity (μΜ/sec) versus substrate concentration. Increasing substrate concentration for CAPN5 overcomes the inhibition by SNJ-1945.
Figures 16A-16B. Second generation inhibitors based off lead compound competitively inhibit CAPN5. First generation lead compound CAPN5 p.370-80 was modified using amide cyclization to generate a second generation competitive cyclic inhibitor. (Fig.l6A) Various concentrations of Cyclic CAPN5 p.370-80 were incubated in a reaction with CAPN5p.370-80 and CAPN5 WT in an activity buffer. Data is plotted for CAPN5 as initial velocity (μΜ/sec) versus Cyclic CAPN5 p.370-80 concentration. Addition of 10 μΜ Cyclic CAPN5 p.370-80 slows the initial reaction rate by 40%. (Fig. 16B) CAPN5 WT was incubated with and without 10 μΜ Cyclic CAPN5 p.370-80 at increasing concentrations of CAPN5 p.370-80 substrate. Data is plotted for CAPN5 as initial velocity (μΜ/sec) versus substrate concentration. Increasing concentrations of substrate does not overcome inhibition by cyclic peptide.
Figure 17. Co-crystallizatoin of CAPN5 with CAPN5p370-80 peptide.
Figures 18A-18D. Modification of lead compound reveals potential for competitive inhibition. Fig. 18A. Structural model of the CAPN5 protease core with the peptide docked to it using AutoDock VINA. Fig. 18B. Scanning modifications were made to the amino acids of the lead compound to make the bonds un-cleavable by CAPN5. Despite modifications, the peptide still fit in the catalytic groove using docking predictions. Fig. 18C. N-terminal
(EDANS) and C-terminal GLU-(DABCYL) FRET tags were added to the peptides for our standard CAPN5 assay and were dissolved in 70% DMSO. Peptides incubated for 15 minutes at various concentrations with 5 μg of MBP-CAPN5 WT. Data is plotted as initial velocity (uM/sec) versus peptide concentration fit to the Michaelis-Menten equation. Modification of the amino acids slows the reaction rate. Fig.l8D. Data is plotted as initial velocity (μΜ/sec) versus peptide concentration fit to the substrate inhibition equation.
Figures 19A-19G. Non-modified and modified peptides. Fig. 19A. Unmodified CAPN5-370-80 peptide (RQNRGGGCINH). Fig. 19B. Pep- 1 -Mod containing methyl - Arginine and D-Glutamine. Fig. 19C. Pep-2-Mod containing D-Asparagine and methyl- Arginine. Fig. 19D. Pep-3 -Mod containing N-Me Glycine and N-Me Glycine. Fig. 19E. Pep- 4-Mod containing N-Me Glycine and Acm-Cysteine. Fig. 19F. Pep-5-Mod containing N-Me Isoleucine and D-Glutamine. Fig. 19G. Pep-6-Mod, which is a cyclization amide.
Figures 20A-20D. Modification and activity of CAPN5-370-80 peptide. Fig. 20A.
Structural model of the CAPN5 protease core with the peptide docked to it using AutoDock VINA. Fig. 20B. Chemical structure of the CAPN5-370-80 peptide (RQNRGGGCINH).
Scanning modifications were made to the amino acids of the peptide to make the bonds un- cleavable by CAPN5. The location of the modifications are denoted with circles N-terminal (ED ANS) and C-terminal GLU-(D ABC YL) FRET tags were added to the peptides for the standard CAPN5 assay and were dissolved in 70% DMSO. Fig. 20C. Peptides incubated for 15 minutes at various concentrations with 5 μg of MBP-CAPN5 WT in a buffer containing 20 mM Tris, 300 mM NaCl, 2 mM DTT, pH 7.5 to measure activity. Data is plotted as initial velocity (μΜ/sec) versus peptide concentration. Modification of the amino acids slows the reaction rate. Fig. 20D. Close-up of graph region highlighting the differences in proteolytic activity at 5μΜ substrate.
Figure 21. Results from the testing of classical calpain inhibitors Calpain Inhibitor IV, Leupeptin and SNJ-1945 are provided. DETAILED DESCRIPTION
CAPN5 inhibition is one strategy for therapeutically inhibiting retinal damage. The studies described herein demonstrate novel molecules and assays used to inhibit CAPN5 activity. To demonstrate CAPN5 inhibition, a CAPN5 in vitro proteolysis assay and a specific substrate was needed. Potential substrates were identified from a recent CAPN5 proteolysis screen of the retinal proteome. These CAPN5 proteolytic targets were verified in vitro, and narrowed down the exact site of cleavage, until it was possible to identify short polypeptides that are CAPN5 substrates. This approach was used on several targets, including CAPN5 itself. These substrates are modified to design a CAPN5 -specific inhibitor.
Peptides of the Present Invention
The present invention provides in certain embodiments a CAPN5 substrate comprising an amino acid sequence of 10-30 amino acids in length having at least 80% sequence identity to a peptide, wherein the peptide is PDGFB (SEQ ID NO: 18), IRX3 (SEQ ID NO: 19), CAPN5- 370-390 (SEQ ID NO:20), CAPN5-390-410 (SEQ ID NO:21) or CAPN5-370-390 (SEQ ID NO:23). In certain embodiments, the peptide has at least 81%, 82%, 83%, 84%, 85%, 86%, 87%,88%,89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to a peptide, wherein the peptide is PDGFB (SEQ ID NO: 18), IRX3 (SEQ ID NO: 19), CAPN5-370-390 (SEQ ID NO:20), CAPN5-390-410 (SEQ ID NO:21) or CAPN5-370-390 (SEQ ID NO:23). In certain embodiments the peptide is CAPN5-370-390 (SEQ ID NO:23).
The term "amino acid" includes the residues of the natural amino acids (e.g., Ala, Arg,
Asn, Asp, Cys, Glu, Gin, Gly, His, Hyl, Hyp, He, Leu, Lys, Met, Phe, Pro, Ser, Thr, Tip, Tyr, and Val) in D or L form, as well as unnatural amino acids (e.g., phosphoserine,
phosphothreonine, phosphotyrosine, hydroxyproline, gamma-carboxyglutamate; hippuric acid, octahydroindole-2-carboxylic acid, statine, l,2,3,4,-tetrahydroisoquinoline-3-carboxylic acid, penicillamine, ornithine, citruline, a-methyl-alanine, para-benzoylphenylalanine, phenyl glycine, propargylglycine, sarcosine, and tert-butylglycine). The term also includes peptides with reduced peptide bonds, which will prevent proteolytic degradation of the peptide. Also, the term includes the amino acid analog a-amino-isobutyric acid. The term also includes natural and unnatural amino acids bearing a conventional amino protecting group (e.g., acetyl or benzyl oxycarbonyl), as well as natural and unnatural amino acids protected at the carboxy terminus (e.g., as a (Ci-C6)alkyl, phenyl or benzyl ester or amide; or as an a-methylbenzyl amide). Other suitable amino and carboxy protecting groups are known to those skilled in the art (See for example, T.W. Greene, Protecting Groups In Organic Synthesis; Wiley: New York, 1981, and references cited therein).
In certain embodiments, the peptides are modified by C-terminal amidation, head to tail cyclic peptides, or containing Cys residues for disulfide cyclization, siderophore modification, or N-terminal acetylation.
The term "peptide" describes a sequence of 7 to 50 amino acids or peptidyl residues. Preferably a peptide comprises 7 to 25, or 7 to 15 or 7 to 13 amino acids. Peptide derivatives can be prepared as disclosed in U.S. Patent Numbers 4,612,302; 4,853,371; and 4,684,620.
Peptide sequences specifically recited herein are written with the amino terminus on the left and the carboxy terminus on the right.
As used herein, the term "enzyme" includes variants or biologically active or inactive fragments of a polypeptides. A "variant" of one of the polypeptides is a polypeptide that is not completely identical to a native protein. Such variant protein can be obtained by altering the amino acid sequence by insertion, deletion or substitution of one or more amino acid. The amino acid sequence of the protein is modified, for example by substitution, to create a polypeptide having substantially the same or improved qualities as compared to the native polypeptide. The substitution may be a conserved substitution. A "conserved substitution" is a substitution of an amino acid with another amino acid having a similar side chain. A conserved substitution would be a substitution with an amino acid that makes the smallest change possible in the charge of the amino acid or size of the side chain of the amino acid (alternatively, in the size, charge or kind of chemical group within the side chain) such that the overall peptide retains its spacial conformation but has altered biological activity. For example, common conserved changes might be Asp to Glu, Asn or Gin; His to Lys, Arg or Phe; Asn to Gin, Asp or Glu and Ser to Cys, Thr or Gly. Aline is commonly used to substitute for other amino acids. The 20 essential amino acids can be grouped as follows: alanine, valine, leucine, isoleucine, proline, phenylalanine, tryptophan and methionine having nonpolar side chains; glycine, serine, threonine, cystine, tyrosine, asparagine and glutamine having uncharged polar side chains;
aspartate and glutamate having acidic side chains; and lysine, arginine, and histidine having basic side chains.
The amino acid changes are achieved by changing the codons of the corresponding nucleic acid sequence. It is known that such polypeptides can be obtained based on substituting certain amino acids for other amino acids in the polypeptide structure in order to modify or improve biological activity. For example, through substitution of alternative amino acids, small conformational changes may be conferred upon a polypeptide that results in increased activity. Alternatively, amino acid substitutions in certain polypeptides may be used to provide residues, which may then be linked to other molecules to provide peptide-molecule conjugates which retain sufficient properties of the starting polypeptide to be useful for other purposes.
One can use the hydropathic index of amino acids in conferring interactive biological function on a polypeptide, wherein it is found that certain amino acids may be substituted for other amino acids having similar hydropathic indices and still retain a similar biological activity. Alternatively, substitution of like amino acids may be made on the basis of hydrophilicity, particularly where the biological function desired in the polypeptide to be generated is intended for use in immunological embodiments. The greatest local average hydrophilicity of a
"protein", as governed by the hydrophilicity of its adjacent amino acids, correlates with its immunogenicity. Accordingly, it is noted that substitutions can be made based on the hydrophilicity assigned to each amino acid.
In using either the hydrophilicity index or hydropathic index, which assigns values to each amino acid, it is preferred to conduct substitutions of amino acids where these values are ±2, with ±1 being particularly preferred, and those with in ±0.5 being the most preferred substitutions. The variant protein has at least 50%, at least about 80%, or even at least about 90% but less than 100%, contiguous amino acid sequence homology or identity to the amino acid sequence of a corresponding native protein.
The amino acid sequence of the variant polypeptide corresponds essentially to the native polypeptide's amino acid sequence. As used herein "correspond essentially to" refers to a polypeptide sequence that will elicit a biological response substantially the same as the response generated by the native protein. Such a response may be at least 60% of the level generated by the native protein, and may even be at least 80% of the level generated by native protein.
A variant may include amino acid residues not present in the corresponding native protein or deletions relative to the corresponding native protein. A variant may also be a truncated "fragment" as compared to the corresponding native protein, i.e., only a portion of a full-length protein. Protein variants also include peptides having at least one D-amino acid.
The variant protein may be expressed from an isolated DNA sequence encoding the variant protein. "Recombinant" is defined as a peptide or nucleic acid produced by the processes of genetic engineering. It should be noted that it is well-known in the art that, due to the redundancy in the genetic code, individual nucleotides can be readily exchanged in a codon, and still result in an identical amino acid sequence. The terms "protein," "peptide" and
"polypeptide" are used interchangeably herein.
In certain embodiments, the peptide forms an alpha-helix.
In certain embodiments, the inhibitor is a circular peptide.
Screening Methods
The present disclosure provides methods to screen for and identify amino acid sequences that target, e.g., specifically target CAPN5. The present invention provides in certain embodiments a method of identifying an inhibitor of CAPN5 comprising, contacting CAPN5 with a CAPN5 substrate in the presence of a target inhibitor, and measuring an activity level of CAPN5 substrate as described above in the presence of the target inhibitor as compared to an activity level of CAPN5 in the absence of the target inhibitor.
Compositions and Methods of Use
The present invention provides in certain embodiments a composition comprising the CAPN5 substrate or CAPN5 inhibitor as described above and a physiologically acceptable carrier.
The present invention provides in certain embodiments a therapeutic method for preventing or treating a pathological condition or symptom in a mammal, such as a human, wherein an anti -inflammatory activity is desired, comprising administering to a mammal in need of such therapy, an effective amount of a therapeutic agent comprising the CAPN5 substrate or CAPN5 inhibitor as described above.
The present invention provides in certain embodiments a therapeutic method for preventing or treating intraocular inflammation in a mammal, such as a human, comprising administering to a mammal in need of such therapy, an effective amount of a therapeutic agent comprising the CAPN5 substrate or CAPN5 inhibitor as described above.
The present invention provides in certain embodiments a method to treat intraocular inflammation comprising administering a therapeutically effective amount of a therapeutic agent comprising the CAPN5 substrate or CAPN5 inhibitor as described above to a mammal.
The present invention provides in certain embodiments a CAPN5 substrate or CAPN5 inhibitor as described above for use in medical therapy.
The present invention provides in certain embodiments the use of a CAPN5 substrate or CAPN5 inhibitor as described above for the manufacture of a medicament useful for the treatment of intraocular inflammation in a mammal.
The present invention provides in certain embodiments a solution comprising a carrier and a CAPN5 substrate or CAPN5 inhibitor as described above dispersed in the carrier.
Nucleic Acids of the Present Invention
The present invention provides in certain embodiments an isolated or purified nucleic acid that is less than 50 nucleotides in length encoding a peptide as described above.
In certain embodiments, the isolated or purified nucleic acid is less than 20 nucleotides in length. In certain embodiments, the peptide is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
The present invention provides in certain embodiments an expression cassette comprising the nucleic acid described above. In certain embodiments, thee expression cassette, further comprises a promoter.
The present invention provides in certain embodiments a vector comprising the expression cassette described above.
The present invention provides in certain embodiments a cell comprising the expression cassette or the vector described above.
The term "nucleic acid" refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form, composed of monomers (nucleotides) containing a sugar, phosphate and a base which is either a purine or pyrimidine. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues. A "nucleic acid fragment" is a fraction of a given nucleic acid molecule. Deoxyribonucleic acid (DNA) in the majority of organisms is the genetic material while ribonucleic acid (RNA) is involved in the transfer of information contained within DNA into proteins. The term "nucleotide sequence" refers to a polymer of DNA or RNA that can be single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases capable of incorporation into DNA or RNA polymers. The terms "nucleic acid," "nucleic acid molecule," "nucleic acid fragment," "nucleic acid sequence or segment," or "polynucleotide" may also be used interchangeably with gene, cDNA, DNA and RNA encoded by a gene.
The invention encompasses isolated or substantially purified nucleic acid or protein compositions. In the context of the present invention, an "isolated" or "purified" DNA molecule or an "isolated" or "purified" polypeptide is a DNA molecule or polypeptide that exists apart from its native environment and is therefore not a product of nature. An isolated DNA molecule or polypeptide may exist in a purified form or may exist in a non-native environment such as, for example, a transgenic host cell or bacteriophage. For example, an "isolated" or "purified" nucleic acid molecule or protein, or biologically active portion thereof, is substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. In one embodiment, an "isolated" nucleic acid is free of sequences that naturally flank the nucleic acid (i.e., sequences located at the 5' and 3 ' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, the isolated nucleic acid molecule can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequences that naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived. A protein that is substantially free of cellular material includes preparations of protein or polypeptide having less than about 30%, 20%, 10%, 5%, (by dry weight) of contaminating protein. When the protein of the invention, or
biologically active portion thereof, is recombinantly produced, preferably culture medium represents less than about 30%, 20%, 10%, or 5% (by dry weight) of chemical precursors or non-protein-of- interest chemicals. Fragments and variants of the disclosed nucleotide sequences and proteins or partial-length proteins encoded thereby are also encompassed by the present invention. By "fragment" or "portion" is meant a full length or less than full length of the nucleotide sequence encoding, or the amino acid sequence of, a polypeptide or protein.
The term "gene" is used broadly to refer to any segment of nucleic acid associated with a biological function. Thus, genes include coding sequences and/or the regulatory sequences required for their expression. For example, gene refers to a nucleic acid fragment that expresses mRNA, functional RNA, or specific protein, including regulatory sequences. Genes also include nonexpressed DNA segments that, for example, form recognition sequences for other proteins. Genes can be obtained from a variety of sources, including cloning from a source of interest or synthesizing from known or predicted sequence information, and may include sequences designed to have desired parameters.
"Naturally occurring" is used to describe an object that can be found in nature as distinct from being artificially produced. For example, a protein or nucleotide sequence present in an organism (including a virus), which can be isolated from a source in nature and which has not been intentionally modified by man in the laboratory, is naturally occurring.
The term "chimeric" refers to any gene or DNA that contains 1) DNA sequences, including regulatory and coding sequences that are not found together in nature or 2) sequences encoding parts of proteins not naturally adjoined, or 3) parts of promoters that are not naturally adjoined. Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or comprise regulatory sequences and coding sequences derived from the same source, but arranged in a manner different from that found in nature.
A "transgene" refers to a gene that has been introduced into the genome by
transformation and is stably maintained. Transgenes may include, for example, DNA that is either heterologous or homologous to the DNA of a particular cell to be transformed.
Additionally, transgenes may comprise native genes inserted into a non-native organism, or chimeric genes. The term "endogenous gene" refers to a native gene in its natural location in the genome of an organism. A "foreign" gene refers to a gene not normally found in the host organism but that is introduced by gene transfer.
The terms "protein," "peptide" and "polypeptide" are used interchangeably herein.
A "variant" of a molecule is a sequence that is substantially similar to the sequence of the native molecule. For nucleotide sequences, variants include those sequences that, because of the degeneracy of the genetic code, encode the identical amino acid sequence of the native protein. Naturally occurring allelic variants such as these can be identified with the use of well-known molecular biology techniques, as, for example, with polymerase chain reaction (PCR) and hybridization techniques. Variant nucleotide sequences also include synthetically derived nucleotide sequences, such as those generated, for example, by using site-directed mutagenesis that encode the native protein, as well as those that encode a polypeptide having amino acid substitutions. Generally, nucleotide sequence variants of the invention will have at least 40, 50, 60, to 70%, e.g., preferably 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, to 79%, generally at least 80%, e.g., 81%-84%, at least 85%, e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%), 95%), 96%), 97%), to 98%, sequence identity to the native (endogenous) nucleotide sequence.
"Conservatively modified variations" of a particular nucleic acid sequence refers to those nucleic acid sequences that encode identical or essentially identical amino acid sequences, or where the nucleic acid sequence does not encode an amino acid sequence, to essentially identical sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given polypeptide. For instance the codons CGT, CGC, CGA, CGG, AGA, and AGG all encode the amino acid arginine. Thus, at every position where an arginine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded protein. Such nucleic acid variations are "silent variations" which are one species of "conservatively modified variations." Every nucleic acid sequence described herein which encodes a polypeptide also describes every possible silent variation, except where otherwise noted. One of skill will recognize that each codon in a nucleic acid (except ATG, which is ordinarily the only codon for methionine) can be modified to yield a functionally identical molecule by standard techniques. Accordingly, each "silent variation" of a nucleic acid which encodes a polypeptide is implicit in each described sequence.
"Recombinant DNA molecule" is a combination of DNA sequences that are joined together using recombinant DNA technology and procedures used to j oin together DNA sequences as described, for example, in Sambrook and Russell, Molecular Cloning: A
Laboratory Manual, Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press (3 rd edition, 2001).
The terms "heterologous DNA sequence," "exogenous DNA segment" or "heterologous nucleic acid," each refer to a sequence that originates from a source foreign to the particular host cell or, if from the same source, is modified from its original form. Thus, a heterologous gene in a host cell includes a gene that is endogenous to the particular host cell but has been modified. The terms also include non-naturally occurring multiple copies of a naturally occurring DNA sequence. Thus, the terms refer to a DNA segment that is foreign or heterologous to the cell, or homologous to the cell but in a position within the host cell nucleic acid in which the element is not ordinarily found. Exogenous DNA segments are expressed to yield exogenous polypeptides.
A "homologous" DNA sequence is a DNA sequence that is naturally associated with a host cell into which it is introduced.
"Wild-type" refers to the normal gene, or organism found in nature without any known mutation.
"Genome" refers to the complete genetic material of an organism.
A "vector" is defined to include, inter alia, any plasmid, cosmid, phage or binary vector in double or single stranded linear or circular form which may or may not be self transmissible or mobilizable, and which can transform prokaryotic or eukaryotic host either by integration into the cellular genome or exist extrachromosomally {e.g., autonomous replicating plasmid with an origin of replication).
"Cloning vectors" typically contain one or a small number of restriction endonuclease recognition sites at which foreign DNA sequences can be inserted in a determinable fashion without loss of essential biological function of the vector, as well as a marker gene that is suitable for use in the identification and selection of cells transformed with the cloning vector. Marker genes typically include genes that provide tetracycline resistance, hygromycin resistance or ampicillin resistance.
"Expression cassette" as used herein means a DNA sequence capable of directing expression of a particular nucleotide sequence in an appropriate host cell, comprising a promoter operably linked to the nucleotide sequence of interest which is operably linked to termination signals. It also typically comprises sequences required for proper translation of the nucleotide sequence. The coding region usually codes for a protein of interest but may also code for a functional RNA of interest, for example antisense RNA or a nontranslated RNA, in the sense or antisense direction. The expression cassette comprising the nucleotide sequence of interest may be chimeric, meaning that at least one of its components is heterologous with respect to at least one of its other components. The expression cassette may also be one that is naturally occurring but has been obtained in a recombinant form useful for heterologous expression. The expression of the nucleotide sequence in the expression cassette may be under the control of a constitutive promoter or of an inducible promoter that initiates transcription only when the host cell is exposed to some particular external stimulus. In the case of a multicellular organism, the promoter can also be specific to a particular tissue or organ or stage of development.
Such expression cassettes will comprise the transcriptional initiation region of the invention linked to a nucleotide sequence of interest. Such an expression cassette is provided with a plurality of restriction sites for insertion of the gene of interest to be under the
transcriptional regulation of the regulatory regions. The expression cassette may additionally contain selectable marker genes.
"Coding sequence" refers to a DNA or RNA sequence that codes for a specific amino acid sequence and excludes the non-coding sequences. It may constitute an "uninterrupted coding sequence", i.e., lacking an intron, such as in a cDNA or it may include one or more introns bounded by appropriate splice junctions. An "intron" is a sequence of RNA which is contained in the primary transcript but which is removed through cleavage and re-ligation of the RNA within the cell to create the mature mRNA that can be translated into a protein.
The terms "open reading frame" and "ORF" refer to the amino acid sequence encoded between translation initiation and termination codons of a coding sequence. The terms
"initiation codon" and "termination codon" refer to a unit of three adjacent nucleotides ('codon') in a coding sequence that specifies initiation and chain termination, respectively, of protein synthesis (mRNA translation).
A "functional RNA" refers to an antisense RNA, ribozyme, or other RNA that is not translated.
The term "RNA transcript" refers to the product resulting from RNA polymerase catalyzed transcription of a DNA sequence. When the RNA transcript is a perfect
complementary copy of the DNA sequence, it is referred to as the primary transcript or it may be a RNA sequence derived from posttranscriptional processing of the primary transcript and is referred to as the mature RNA. "Messenger RNA" (mRNA) refers to the RNA that is without introns and that can be translated into protein by the cell. "cDNA" refers to a single- or a double-stranded DNA that is complementary to and derived from mRNA.
"Regulatory sequences" and "suitable regulatory sequences" each refer to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences include enhancers, promoters, translation leader sequences, introns, and polyadenylation signal sequences. They include natural and synthetic sequences as well as sequences that may be a combination of synthetic and natural sequences. As is noted above, the term "suitable regulatory sequences" is not limited to promoters. However, some suitable regulatory sequences useful in the present invention will include, but are not limited to constitutive promoters, tissue-specific promoters, development-specific promoters, inducible promoters and viral promoters. "5' non-coding sequence" refers to a nucleotide sequence located 5' (upstream) to the coding sequence. It is present in the fully processed mRNA upstream of the initiation codon and may affect processing of the primary transcript to mRNA, mRNA stability or translation efficiency.
"3 ' non-coding sequence" refers to nucleotide sequences located 3 ' (downstream) to a coding sequence and include polyadenylation signal sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or gene expression. The
polyadenylation signal is usually characterized by affecting the addition of polyadenylic acid tracts to the 3 ' end of the mRNA precursor.
The term "translation leader sequence" refers to that DNA sequence portion of a gene between the promoter and coding sequence that is transcribed into RNA and is present in the fully processed mRNA upstream (5') of the translation start codon. The translation leader sequence may affect processing of the primary transcript to mRNA, mRNA stability or translation efficiency.
The term "mature" protein refers to a post-translationally processed polypeptide without its signal peptide. "Precursor" protein refers to the primary product of translation of an mRNA. "Signal peptide" refers to the amino terminal extension of a polypeptide, which is translated in conjunction with the polypeptide forming a precursor peptide and which is required for its entrance into the secretory pathway. The term "signal sequence" refers to a nucleotide sequence that encodes the signal peptide.
"Promoter" refers to a nucleotide sequence, usually upstream (5') to its coding sequence, which controls the expression of the coding sequence by providing the recognition for RNA polymerase and other factors required for proper transcription. "Promoter" includes a minimal promoter that is a short DNA sequence comprised of a TATA- box and other sequences that serve to specify the site of transcription initiation, to which regulatory elements are added for control of expression. "Promoter" also refers to a nucleotide sequence that includes a minimal promoter plus regulatory elements that is capable of controlling the expression of a coding sequence or functional RNA. This type of promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers. Accordingly, an "enhancer" is a DNA sequence that can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue specificity of a promoter. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even be comprised of synthetic DNA segments. A promoter may also contain DNA sequences that are involved in the binding of protein factors that control the effectiveness of transcription initiation in response to physiological or developmental conditions.
The "initiation site" is the position surrounding the first nucleotide that is part of the transcribed sequence, which is also defined as position +1. With respect to this site all other sequences of the gene and its controlling regions are numbered. Downstream sequences (i.e. further protein encoding sequences in the 3' direction) are denominated positive, while upstream sequences (mostly of the controlling regions in the 5' direction) are denominated negative.
Promoter elements, particularly a TATA element, that are inactive or that have greatly reduced promoter activity in the absence of upstream activation are referred to as "minimal or core promoters." In the presence of a suitable transcription factor, the minimal promoter functions to permit transcription. A "minimal or core promoter" thus consists only of all basal elements needed for transcription initiation, e.g., a TATA box and/or an initiator.
"Constitutive expression" refers to expression using a constitutive or regulated promoter. "Conditional" and "regulated expression" refer to expression controlled by a regulated promoter.
"Operably-linked" refers to the association of nucleic acid sequences on single nucleic acid fragment so that the function of one is affected by the other. For example, a regulatory DNA sequence is said to be "operably linked to" or "associated with" a DNA sequence that codes for an RNA or a polypeptide if the two sequences are situated such that the regulatory DNA sequence affects expression of the coding DNA sequence (i.e., that the coding sequence or functional RNA is under the transcriptional control of the promoter). Coding sequences can be operably-linked to regulatory sequences in sense or antisense orientation.
"Expression" refers to the transcription and/or translation in a cell of an endogenous gene, transgene, as well as the transcription and stable accumulation of sense (mRNA) or functional RNA. In the case of antisense constructs, expression may refer to the transcription of the antisense DNA only. Expression may also refer to the production of protein.
"Transcription stop fragment" refers to nucleotide sequences that contain one or more regulatory signals, such as polyadenylation signal sequences, capable of terminating
transcription. Examples of transcription stop fragments are known to the art.
"Translation stop fragment" refers to nucleotide sequences that contain one or more regulatory signals, such as one or more termination codons in all three frames, capable of terminating translation. Insertion of a translation stop fragment adjacent to or near the initiation codon at the 5' end of the coding sequence will result in no translation or improper translation. Excision of the translation stop fragment by site-specific recombination will leave a site-specific sequence in the coding sequence that does not interfere with proper translation using the initiation codon.
The terms "c/s-acting sequence" and "c/s-acting element" refer to DNA or RNA sequences whose functions require them to be on the same molecule.
The terms "trans-acting sequence" and "trans-acting element" refer to DNA or RNA sequences whose function does not require them to be on the same molecule.
"Chromosomally-integrated" refers to the integration of a foreign gene or DNA construct into the host DNA by covalent bonds. Where genes are not "chromosomally integrated" they may be "transiently expressed." Transient expression of a gene refers to the expression of a gene that is not integrated into the host chromosome but functions independently, either as part of an autonomously replicating plasmid or expression cassette, for example, or as part of another biological system such as a virus.
The following terms are used to describe the sequence relationships between two or more nucleic acids or polynucleotides: (a) "reference sequence," (b) "comparison window," (c) "sequence identity," (d) "percentage of sequence identity," and (e) "substantial identity."
(a) As used herein, "reference sequence" is a defined sequence used as a basis for sequence comparison. A reference sequence may be a subset or the entirety of a specified sequence; for example, as a segment of a full length cDNA or gene sequence, or the complete cDNA or gene sequence.
(b) As used herein, "comparison window" makes reference to a contiguous and specified segment of a polynucleotide sequence, wherein the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Generally, the comparison window is at least 20 contiguous nucleotides in length, and optionally can be 30, 40, 50, 100, or longer. Those of skill in the art understand that to avoid a high similarity to a reference sequence due to inclusion of gaps in the polynucleotide sequence a gap penalty is typically introduced and is subtracted from the number of matches.
Methods of alignment of sequences for comparison are well known in the art. Thus, the determination of percent identity between any two sequences can be accomplished using a known mathematical algorithm. Computer implementations of these mathematical algorithms can be utilized for comparison of sequences to determine sequence identity. Such
implementations include, but are not limited to: CLUSTAL in the PC/Gene program (available from Intelligenetics, Mountain View, California); the ALIGN program (Version 2.0) and GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Version 8 (available from Genetics Computer Group (GCG), 575 Science Drive, Madison, Wisconsin, USA). Alignments using these programs can be performed using the default parameters.
Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (available on the world wide web at ncbi.nlm.nih.gov/). This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold. These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues; always < 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when the cumulative alignment score falls off by the quantity X from its maximum achieved value, the cumulative score goes to zero or below due to the accumulation of one or more negative-scoring residue alignments, or the end of either sequence is reached.
In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences. One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a test nucleic acid sequence is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid sequence to the reference nucleic acid sequence is less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.
To obtain gapped alignments for comparison purposes, Gapped BLAST (in BLAST 2.0) can be utilized. Alternatively, PSI-BLAST (in BLAST 2.0) can be used to perform an iterated search that detects distant relationships between molecules. When utilizing BLAST, Gapped BLAST, PSI-BLAST, the default parameters of the respective programs (e.g., BLASTN for nucleotide sequences, BLASTX for proteins) can be used. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 1 1, an expectation (E) of 10, a cutoff of 100, M=5, N=-4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix. See the world-wide-web at ncbi.nlm.nih.gov. Alignment may also be performed manually by visual inspection.
For purposes of the present invention, comparison of nucleotide sequences for determination of percent sequence identity to the promoter sequences disclosed herein is preferably made using the BlastN program (version 1.4.7 or later) with its default parameters or any equivalent program. By "equivalent program" is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide or amino acid residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by the preferred program.
(c) As used herein, "sequence identity" or "identity" in the context of two nucleic acid or polypeptide sequences makes reference to a specified percentage of residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window, as measured by sequence comparison algorithms or by visual inspection. When percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. When sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution.
Sequences that differ by such conservative substitutions are said to have "sequence similarity" or "similarity." Means for making this adjustment are well known to those of skill in the art.
Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of
conservative substitutions is calculated, e.g., as implemented in the program PC/GENE
(Intelligenetics, Mountain View, California).
(d) As used herein, "percentage of sequence identity" means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity.
(e)(i) The term "substantial identity" of polynucleotide sequences means that a polynucleotide comprises a sequence that has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79%, at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%, at least 90%, 91%, 92%, 93%, or 94%, and at least 95%, 96%, 97%, 98%, or 99% sequence identity, compared to a reference sequence using one of the alignment programs described using standard parameters. One of skill in the art will recognize that these values can be appropriately adjusted to determine corresponding identity of proteins encoded by two nucleotide sequences by taking into account codon degeneracy, amino acid similarity, reading frame positioning, and the like. Substantial identity of amino acid sequences for these purposes normally means sequence identity of at least 70%, at least 80%, 90%, at least 95%.
Another indication that nucleotide sequences are substantially identical is if two molecules hybridize to each other under stringent conditions (see below). Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. However, stringent conditions encompass temperatures in the range of about 1°C to about 20°C, depending upon the desired degree of stringency as otherwise qualified herein. Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides they encode are substantially identical. This may occur, e.g., when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code. One indication that two nucleic acid sequences are substantially identical is when the polypeptide encoded by the first nucleic acid is immunologically cross reactive with the polypeptide encoded by the second nucleic acid.
(e)(ii) The term "substantial identity" in the context of a peptide indicates that a peptide comprises a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%, at least 90%, 91%, 92%, 93%, or 94%), or 95%), 96%, 97%, 98% or 99%, sequence identity to the reference sequence over a specified comparison window. An indication that two peptide sequences are substantially identical is that one peptide is immunologically reactive with antibodies raised against the second peptide. Thus, a peptide is substantially identical to a second peptide, for example, where the two peptides differ only by a conservative substitution.
For sequence comparison, typically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.
As noted above, another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions. The phrase "hybridizing specifically to" refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent conditions when that sequence is present in a complex mixture (e.g., total cellular) DNA or RNA. "Bind(s) substantially" refers to complementary hybridization between a probe nucleic acid and a target nucleic acid and embraces minor mismatches that can be accommodated by reducing the stringency of the hybridization media to achieve the desired detection of the target nucleic acid sequence.
"Stringent hybridization conditions" and "stringent hybridization wash conditions" in the context of nucleic acid hybridization experiments such as Southern and Northern hybridizations are sequence dependent, and are different under different environmental parameters. Longer sequences hybridize specifically at higher temperatures. The thermal melting point (Tm) is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Specificity is typically the function of
post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, the Tm can be approximated from the equation of Meinkoth and Wahl: Tm 81.5°C + 16.6 (log M) +0.41 (%GC) - 0.61 (% form) - 500/L; where M is the molarity of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. Tm is reduced by about 1°C for each 1% of mismatching; thus, Tm, hybridization, and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the Tm can be decreased 10°C. Generally, stringent conditions are selected to be about 5°C lower than the Tm for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3, or 4°C lower than the Tm; moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10°C lower than the Tm; low stringency conditions can utilize a hybridization and/or wash at 1 1, 12, 13, 14, 15, or 20°C lower than the Tm. Using the equation, hybridization and wash compositions, and desired temperature, those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a temperature of less than 45°C (aqueous solution) or 32°C (formamide solution), it is preferred to increase the SSC concentration so that a higher temperature can be used. Generally, highly stringent hybridization and wash conditions are selected to be about 5EC lower than the Tm for the specific sequence at a defined ionic strength and pH.
An example of highly stringent wash conditions is 0.15 M NaCl at 72EC for about 15 minutes. An example of stringent wash conditions is a 0.2X SSC wash at 65EC for 15 minutes. Often, a high stringency wash is preceded by a low stringency wash to remove background probe signal. An example medium stringency wash for a duplex of, e.g., more than 100 nucleotides, is IX SSC at 45EC for 15 minutes. An example low stringency wash for a duplex of, e.g., more than 100 nucleotides, is 4-6X SSC at 40EC for 15 minutes. For short probes (e.g., about 10 to 50 nucleotides), stringent conditions typically involve salt concentrations of less than about 1.5 M, more preferably about 0.01 to 1.0 M, Na ion concentration (or other salts) at pH 7.0 to 8.3, and the temperature is typically at least about 30EC and at least about 60°C for long probes (e.g., >50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. In general, a signal to noise ratio of 2X (or higher) than that observed for an unrelated probe in the particular hybridization assay indicates detection of a specific hybridization. Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the proteins that they encode are substantially identical. This occurs, e.g., when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code.
Very stringent conditions are selected to be equal to the Tm for a particular probe. An example of stringent conditions for hybridization of complementary nucleic acids which have more than 100 complementary residues on a filter in a Southern or Northern blot is 50% formamide, e.g., hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0. IX SSC at 60 to 65°C. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, lM NaCl, 1% SDS (sodium dodecyl sulphate) at 37°C, and a wash in IX to 2X SSC (20X SSC = 3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55°C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 37°C, and a wash in 0.5X to IX SSC at 55 to 60°C.
Thus, the genes and nucleotide sequences of the invention include both the naturally occurring sequences as well as mutant forms. Likewise, the polypeptides of the invention encompass naturally occurring proteins as well as variations and modified forms thereof. Such variants will continue to possess the desired activity. The deletions, insertions, and substitutions of the polypeptide sequence encompassed herein are not expected to produce radical changes in the characteristics of the polypeptide. However, when it is difficult to predict the exact effect of the substitution, deletion, or insertion in advance of doing so, one skilled in the art will appreciate that the effect will be evaluated by routine screening assays.
Individual substitutions deletions or additions that alter, add or delete a single amino acid or a small percentage of amino acids (typically less than 5%, more typically less than 1%) in an encoded sequence are "conservatively modified variations," where the alterations result in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. The following five groups each contain amino acids that are conservative substitutions for one another: Aliphatic: Glycine (G), Alanine (A), Valine (V), Leucine (L), Isoleucine (I); Aromatic: Phenylalanine (F), Tyrosine (Y), Tryptophan (W); Sulfur-containing: Methionine (M), Cysteine (C); Basic:
Arginine (R), Lysine (K), Histidine (H); Acidic: Aspartic acid (D), Glutamic acid (E),
Asparagine (N), Glutamine (Q). In addition, individual substitutions, deletions or additions which alter, add or delete a single amino acid or a small percentage of amino acids in an encoded sequence are also "conservatively modified variations."
The term "transformation" refers to the transfer of a nucleic acid fragment into the genome of a host cell, resulting in genetically stable inheritance. Host cells containing the transformed nucleic acid fragments are referred to as "transgenic" cells, and organisms comprising transgenic cells are referred to as "transgenic organisms".
"Transformed," "transgenic," and "recombinant" refer to a host cell or organism into which a heterologous nucleic acid molecule has been introduced. The nucleic acid molecule can be stably integrated into the genome generally known in the art. Known methods of PCR include, but are not limited to, methods using paired primers, nested primers, single specific primers, degenerate primers, gene-specific primers, vector-specific primers, partially
mismatched primers, and the like. For example, "transformed," "transformant," and "transgenic" cells have been through the transformation process and contain a foreign gene integrated into their chromosome. The term "untransformed" refers to normal cells that have not been through the transformation process.
A "transgenic" organism is an organism having one or more cells that contain an expression vector.
By "portion" or "fragment," as it relates to a nucleic acid molecule, sequence or segment of the invention, when it is linked to other sequences for expression, is meant a sequence having at least 80 nucleotides, more preferably at least 150 nucleotides, and still more preferably at least 400 nucleotides. If not employed for expressing, a "portion" or "fragment" means at least 9, preferably 12, more preferably 15, even more preferably at least 20, consecutive nucleotides, e.g., probes and primers (oligonucleotides), corresponding to the nucleotide sequence of the nucleic acid molecules of the invention.
Dosages, Formulations and Routes of Administration of the Agents of the Invention
The agents of the invention are preferably administered so as to result in a reduction in at least one symptom associated with a disease. The amount administered will vary depending on various factors including, but not limited to, the composition chosen, the particular disease, the weight, the physical condition, and the age of the mammal, and whether prevention or treatment is to be achieved. Such factors can be readily determined by the clinician employing animal models or other test systems, which are well known to the art.
Administration of therapeutic agents may be accomplished through the administration of the therapeutic agent, such as a peptide. Pharmaceutical formulations, dosages and routes of administration for peptide are generally known.
The present invention envisions treating uveitis in a mammal by the administration of an agent, e.g., a peptide. Administration of the therapeutic agents in accordance with the present invention may be continuous or intermittent, depending, for example, upon the recipient's physiological condition, whether the purpose of the administration is therapeutic or prophylactic, and other factors known to skilled practitioners. The administration of the agents of the invention may be essentially continuous over a preselected period of time or may be in a series of spaced doses. Both local and systemic administration is contemplated.
One or more suitable unit dosage forms having the therapeutic agent(s) of the invention, which, as discussed below, may optionally be formulated for sustained release (for example using microencapsulation, see WO 94/07529, and U.S. Patent No. 4,962,091 the disclosures of which are incorporated by reference herein), can be administered by a variety of routes including parenteral, including by intravenous and intramuscular routes, as well as by direct injection into the diseased tissue. For example, the therapeutic agent may be directly administered to the eye. The formulations may, where appropriate, be conveniently presented in discrete unit dosage forms and may be prepared by any of the methods well known to pharmacy. Such methods may include the step of bringing into association the therapeutic agent with liquid carriers, solid matrices, semi-solid carriers, finely divided solid carriers or combinations thereof, and then, if necessary, introducing or shaping the product into the desired delivery system.
When the therapeutic agents of the invention are prepared for administration, they are preferably combined with a pharmaceutically acceptable carrier, diluent or excipient to form a pharmaceutical formulation, or unit dosage form. The total active ingredients in such formulations include from 0.1 to 99.9% by weight of the formulation. A "pharmaceutically acceptable" is a carrier, diluent, excipient, and/or salt that is compatible with the other ingredients of the formulation, and not deleterious to the recipient thereof. The active ingredient for administration may be present as a powder or as granules, as a solution, a suspension or an emulsion.
Pharmaceutical formulations containing the therapeutic agents of the invention can be prepared by procedures known in the art using well known and readily available ingredients. The therapeutic agents of the invention can also be formulated as solutions appropriate for parenteral administration, for instance by intraocular routes.
The pharmaceutical formulations of the therapeutic agents of the invention can also take the form of an aqueous or anhydrous solution or dispersion, or alternatively the form of an emulsion or suspension.
Thus, the therapeutic agent may be formulated for parenteral administration (e.g., by injection, for example, bolus injection or continuous infusion) and may be presented in unit dose form in ampules, pre-filled syringes, small volume infusion containers or in multi-dose containers with an added preservative. The active ingredients may take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Alternatively, the active ingredients may be in powder form, obtained by aseptic isolation of sterile solid or by lyophilization from solution, for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water, before use.
The pharmaceutical formulations of the present invention may include, as optional ingredients, pharmaceutically acceptable carriers, diluents, solubilizing or emulsifying agents, and salts of the type that are well-known in the art. Specific non-limiting examples of the carriers and/or diluents that are useful in the pharmaceutical formulations of the present invention include water and physiologically acceptable buffered saline solutions such as phosphate buffered saline solutions pH 7.0-8.0 saline solutions and water.
As used herein, the term "therapeutic agent" refers to any agent or material that has a beneficial effect on the mammalian recipient. Thus, "therapeutic agent" embraces both therapeutic and prophylactic molecules having nucleic acid or protein components.
"Treating" as used herein refers to ameliorating at least one symptom of, curing and/or preventing the development of a given disease or condition.
The invention will now be illustrated by the following non-limiting Examples. EXAMPLE 1
Mutant CAPN5 undergoes increased autoproteolysis. Autoproteolysis was used as a starting point for finding a CAPN5 -specific substrate. CAPN5 cleaves itself at two sites, releasing a 60 kDa or 45 kDa enzyme (Figs. 1A-B). A time course of CAPN5 autoproteolysis showed that the R243L mutant had a faster rate of autoproteolysis than WT CAPN5 (Fig. IB). The sequence comprising this site was used to home in on a peptide substrate.
Identification of optimal CAPN5 cleavage peptides. Possible substrate sequences were narrowed down to 10-20 amino acids (data not shown). CAPN5 autoproteolysis cleavages sites were narrowed down to two peptides, which we term CAPN5-370-390 and CAPN5-390-410 (Table 1). FRET peptides were designed based on determined cleavage sites (Biopeptek; Table 1).
Figure imgf000031_0001
An assay to determine efficiency of CAPN5 peptide targets is demonstrated in Fig. 2.
Peptide substrates dissolved in DMSO and H20 were incubated with WT CAPN5 at 37°C in the presence or absence of calcium until a change in fluorescence was no longer detected.
Interestingly, the CAPN5-370-380 fragment was the most sensitive to cleavage by both WT and
R243L CAPN5 (Figs. 3 and 4). As expected, R243LCAPN5 (hyperactive) cleaved substrate fragments at a higher rate (Fig. 4). Inhibitor peptides were identified that serve as the lead compounds for optimization. Figures 3 and 4 show that CAPN5 amino acids 370-380 represent a putative new therapeutic compound for CAPN5 inhibition.
The CAPN5-370-80 peptide comprises a sequence motif that is conserved among calpains (Figures 5 A and 5B). A previously-identified CAPN1 peptide, EPLFAERK (SEQ ID NO: 22), is specific to CAPNl as it is not proteolyzed by CAPN5. Alternatively, a peptide derived from a suspected CAPN5 autoproteolysis site, CAPN5 (370-380, RQNRGGGCINH (SEQ ID NO:23)), is specific to CAPN5 and is not proteolyzed by CAPNl .
Example 2
Various truncations of Homo sapiens calpain 5 (CAPN5) were generated, as shown in Figure 6. Nucleic acid and protein sequences for Homo sapiens calpain 5 (CAPN5) and various truncations are provided below:
Homo sapiens calpain 5 (CAPN5), mRNA
NCBI Reference Sequence: NM_004055.4
GenBank Graphics
>gi|87044927: 186-2108 Homo sapiens calpain 5 (CAPN5), mRNA
DNA sequence:
ATGT TCTCGTGTGTGAAGCCCTATGAGGACCAGAACTACTCAGCCCTGAGGCGGGACTGCCGGC GCAGGAAGGTGCTCT TCGAGGACCCCCTCT TCCCCGCCACTGACGACTCACTCTACTATAAGGG CACGCCGGGGCCCGCCGTCAGGTGGAAGCGACCCAAGGGCATCTGCGAGGACCCCCGCCTCT T T GTGGATGGCATCAGCTCCCACGACCTGCACCAGGGCCAGGTGGGCAACTGCTGGT T TGTGGCAG CCTGCTCGTCACT TGCCTCCCGGGAGTCGCTGTGGCAAAAGGTCATCCCAGACTGGAAGGAGCA GGAATGGGACCCCGAAAAGCCCAACGCCTACGCGGGCATCT TCCACT TCCACT TCTGGCGCT TC GGGGAATGGGTGGACGTGGTCATCGATGACCGGCTGCCCACAGTCAACAACCAGCTCATCTACT GCCACTCCAACTCCCGCAATGAGT T T TGGTGCGCCCTAGTGGAGAAGGCCTATGCCAAACTGGC AGGCTGT TACCAGGCCCTGGATGGAGGCAACACAGCAGACGCACTGGTGGACT TCACGGGTGGT G T T T C T GAG C C C AT C G AC C T G AC C GAG G G T G AC T T T G C C AAC GAT GAG AC T AAG AG G AAC C AG C TCT T TGAGCGCATGT TAAAGGTGCACAGCCGGGGCGGCCTCATCAGTGCCTCCATCAAGGCAGT GACAGCAGCTGACATGGAGGCCCGCCTGGCGTGCGGCCTGGTAAAGGGCCACGCATACGCCGTC ACTGATGTGCGCAAGGTGCGCCTGGGCCACGGCCTACTGGCCT TCT TCAAGTCAGAGAAGT TGG ACATGATCCGCCTGCGCAACCCCTGGGGCGAGCGGGAGTGGAACGGGCCCTGGAGTGACACCTC G GAG GAG T G G C AGAAAG T GAG C AAGAG T GAG C G G GAGAAGAT G G G T G T GAC C G T G C AG GAC GAC GGTGAGT TCTGGATGACCT TCGAGGACGTGTGCCGGTACT TCACGGACATCATCAAGTGCCGCG TGATCAACACATCCCACCTGAGCATCCACAAGACGTGGGAGGAGGCCCGGCTGCATGGCGCCTG GACGCTGCATGAGGACCCGCGACAGAACCGCGGTGGCGGCTGCATCAACCACAAGGACACCT TC T T C C AGAAC C C AC AG T AC AT C T T C GAAG T CAAGAAG C C AGAAGAT GAAG TCCTGATCTGCATCC AGCAGCGGCCAAAGCGGTCTACGCGCCGGGAGGGCAAGGGTGAGAACCTGGCCAT TGGCT T TGA CAT C T AC AAG G T G GAG GAGAAC C G C C AG T AC C G CAT G C AC AG C C T G C AG C AC AAG G C C G C C AG C TCCATCTACATCAACTCACGCAGCGTCT TCCTGCGCACCGACCAGCCCGAGGGCCGCTATGTCA TCATCCCCACAACCT TCGAGCCAGGCCACACTGGCGAGT TCCTGCTCCGAGTCT TCACTGATGT GCCCTCCAACTGCCGGGAGCTGCGCCTGGATGAGCCCCCACACACCTGCTGGAGCTCCCTCTGT GGCTACCCCCAGCTGGTGACCCAGGTACATGTCCTGGGAGCTGCTGGCCTCAAGGACTCCCCAA CAGGGGCTAACTCT TATGTGATCATCAAGTGTGAGGGAGACAAAGTCCGCTCGGCTGTGCAGAA GGGCACCTCCACACCAGAGTACAATGTGAAAGGCATCT TCTACCGCAAGAAGCTGAGCCAGCCC ATCACTGTACAGGTCTGGAACCACCGAGTGCTGAAGGATGAAT T TCTGGGCCAGGTGCACCTAA AGGCTGACCCGGACAACCTCCAGGCCCTGCATACCCTCCACCTCCGGGACCGAAATAGCCGGCA GCCCAGCAACCTGCCAGGCACTGTGGCCGTGCACAT TCTCAGCAGCACCTCCCTCATGGCTGTC TGA ( SEQ ID NO : l ) hcapn5-FL: capn5 full length + 3x myc (indicated in bold), 2013 nucleotides, 671 amino acids DNA sequence:
ATGT TCTCGTGTGTGAAGCCCTATGAGGACCAGAACTACTCAGCCCTGAGGCGGGACTGCCGGC GCAGGAAGGTGCTCT TCGAGGACCCCCTCT TCCCCGCCACTGACGACTCACTCTACTATAAGGG CACGCCGGGGCCCGCCGTCAGGTGGAAGCGACCCAAGGGCATCTGCGAGGACCCCCGCCTCT T T GTGGATGGCATCAGCTCCCACGACCTGCACCAGGGCCAGGTGGGCAACTGCTGGT T TGTGGCAG CCTGCTCGTCACT TGCCTCCCGGGAGTCGCTGTGGCAAAAGGTCATCCCAGACTGGAAGGAGCA GGAATGGGACCCCGAAAAGCCCAACGCCTACGCGGGCATCT TCCACT TCCACT TCTGGCGCT TC GGGGAATGGGTGGACGTGGTCATCGATGACCGGCTGCCCACAGTCAACAACCAGCTCATCTACT GCCACTCCAACTCCCGCAATGAGT T T TGGTGCGCCCTAGTGGAGAAGGCCTATGCCAAACTGGC AGGCTGT TACCAGGCCCTGGATGGAGGCAACACAGCAGACGCACTGGTGGACT TCACGGGTGGT G T T T C T GAG C C C AT C G AC C T G AC C GAG G G T G AC T T T G C C AAC GAT GAG AC T AAG AG G AAC C AG C TCT T TGAGCGCATGT TAAAGGTGCACAGCCGGGGCGGCCTCATCAGTGCCTCCATCAAGGCAGT GACAGCAGCTGACATGGAGGCCCGCCTGGCGTGCGGCCTGGTAAAGGGCCACGCATACGCCGTC ACTGATGTGCGCAAGGTGCGCCTGGGCCACGGCCTACTGGCCT TCT TCAAGTCAGAGAAGT TGG ACATGATCCGCCTGCGCAACCCCTGGGGCGAGCGGGAGTGGAACGGGCCCTGGAGTGACACCTC G GAG GAG T G G C AGAAAG T GAG C AAGAG T GAG C G G GAGAAGAT G G G T G T GAC C G T G C AG GAC GAC GGTGAGTTCTGGATGACCTTCGAGGACGTGTGCCGGTACTTCACGGACATCATCAAGTGCCGCG TGATCAACACATCCCACCTGAGCATCCACAAGACGTGGGAGGAGGCCCGGCTGCATGGCGCCTG GACGCTGCATGAGGACCCGCGACAGAACCGCGGTGGCGGCTGCATCAACCACAAGGACACCTTC TTCCAGAACCCACAGTACATCTTCGAAGTCAAGAAGCCAGAAGATGAAGTCCTGATCTGCATCC AGCAGCGGCCAAAGCGGTCTACGCGCCGGGAGGGCAAGGGTGAGAACCTGGCCATTGGCTTTGA CATCTACAAGGTGGAGGAGAACCGCCAGTACCGCATGCACAGCCTGCAGCACAAGGCCGCCAGC TCCATCTACATCAACTCACGCAGCGTCTTCCTGCGCACCGACCAGCCCGAGGGCCGCTATGTCA TCATCCCCACAACCTTCGAGCCAGGCCACACTGGCGAGTTCCTGCTCCGAGTCTTCACTGATGT GCCCTCCAACTGCCGGGAGCTGCGCCTGGATGAGCCCCCACACACCTGCTGGAGCTCCCTCTGT GGCTACCCCCAGCTGGTGACCCAGGTACATGTCCTGGGAGCTGCTGGCCTCAAGGACTCCCCAA CAGGGGCTAACTCTTATGTGATCATCAAGTGTGAGGGAGACAAAGTCCGCTCGGCTGTGCAGAA GGGCACCTCCACACCAGAGTACAATGTGAAAGGCATCTTCTACCGCAAGAAGCTGAGCCAGCCC ATCACTGTACAGGTCTGGAACCACCGAGTGCTGAAGGATGAATTTCTGGGCCAGGTGCACCTAA AGGCTGACCCGGACAACCTCCAGGCCCTGCATACCCTCCACCTCCGGGACCGAAATAGCCGGCA GCCCAGCAACCTGCCAGGCACTGTGGCCGTGCACATTCTCAGCAGCACCTCCCTCATGGCTGTC GAGCAGAAAC TCATC TCAGAAGAGGATC TGGAGCAGAAAC TCATC TCAGAAGAGGATC TGGAGC AGAAACTCATCTCAGAAGAGGATCTGTGA (SEQ ID NO: 2)
Protein sequence:
MFSCVKPYED QNYSALRRDC RRRKVLFEDP LFPATDDSLY YKGTPGPAVR WKRPKGICED
PRLFVDGISS HDLHQGQVGN CWFVAACSSL ASRESLWQKV IPDWKEQEWD PEKPNAYAGI
FHFHFWRFGE WVDWIDDRL PTVNNQLIYC HSNSRNEFWC ALVEKAYAKL AGCYQALDGG
NTADALVDFT GGVSEPIDLT EGDFANDETK RNQLFERMLK VHSRGGLISA SIKAVTAADM
EARLACGLVK GHAYAVTDVR KVRLGHGLLA FFKSEKLDMI RLRNPWGERE WNGPWSDTSE
EWQKVSKSER EKMGVTVQDD GEFWMTFEDV CRYFTDI IKC RVINTSHLSI HKTWEEARLH
GAWTLHEDPR QNRGGGCINH KDTFFQNPQY I FEVKKPEDE VLICIQQRPK RSTRREGKGE
NLAIGFDIYK VEENRQYRMH SLQHKAASSI YINSRSVFLR TDQPEGRYVI IPTTFEPGHT
GEFLLRVFTD VPSNCRELRL DEPPHTCWSS LCGYPQLVTQ VHVLGAAGLK DSPTGANSYV
I IKCEGDKVR SAVQKGTSTP EYNVKGI FYR KKLSQPITVQ VWNHRVLKDE FLGQVHLKAD
PDNLQALHTL HLRDRNSRQP SNLPGTVAVH ILSSTSLMAV EQKLISEEDL EQKLISEEDL
EQKLISEEDL * (SEQ ID NO: 3) hCAPN5-truncationl : 1-200 amino acids + 3x myc (indicated in bold), 693 nucleotides, 231 amino acids DNA sequence:
ATGTTCTCGTGTGTGAAGCCCTATGAGGACCAGAACTACTCAGCCCTGAGGCGGGACTGCCGGC GCAGGAAGGTGCTCTTCGAGGACCCCCTCTTCCCCGCCACTGACGACTCACTCTACTATAAGGG CACGCCGGGGCCCGCCGTCAGGTGGAAGCGACCCAAGGGCATCTGCGAGGACCCCCGCCTCTTT GTGGATGGCATCAGCTCCCACGACCTGCACCAGGGCCAGGTGGGCAACTGCTGGTTTGTGGCAG CCTGCTCGTCACTTGCCTCCCGGGAGTCGCTGTGGCAAAAGGTCATCCCAGACTGGAAGGAGCA GGAATGGGACCCCGAAAAGCCCAACGCCTACGCGGGCATCTTCCACTTCCACTTCTGGCGCTTC GGGGAATGGGTGGACGTGGTCATCGATGACCGGCTGCCCACAGTCAACAACCAGCTCATCTACT GCCACTCCAACTCCCGCAATGAGTTTTGGTGCGCCCTAGTGGAGAAGGCCTATGCCAAACTGGC AGGCTGTTACCAGGCCCTGGATGGAGGCAACACAGCAGACGCACTGGTGGACTTCACGGGTGGT GTTTCTGAGCCCATCGACCTGAC CGAGCAGAAAC TCATC TCAGAAGAGGATC TGGAGCAGAAAC TCATC TCAGAAGAGGATC TGGAGCAGAAAC TCATC TCAGAAGAGGATC TGTGA ( SEQ ID NO: 4)
Protein sequence:
MFSCVKPYED QNYSALRRDC RRRKVLFEDP LFPATDDSLY YKGTPGPAVR WKRPKGICED PRLFVDGISS HDLHQGQVGN CWFVAACSSL ASRESLWQKV IPDWKEQEWD PEKPNAYAGI FHFHFWRFGE WVDWIDDRL PTVNNQLIYC HSNSRNEFWC ALVEKAYAKL AGCYQALDGG NTADALVDFT GGVSEPIDLT EQKLISEEDL EQKLISEEDL EQKLISEEDL *
(SEQ ID NO: 5) hCAPN5-truncation2: 1-400 amino acids + 3x myc (indicated in bold), 1293 nts, 431 amino acids
DNA sequence:
ATGTTCTCGTGTGTGAAGCCCTATGAGGACCAGAACTACTCAGCCCTGAGGCGGGACTGCCGGC GCAGGAAGGTGCTCTTCGAGGACCCCCTCTTCCCCGCCACTGACGACTCACTCTACTATAAGGG CACGCCGGGGCCCGCCGTCAGGTGGAAGCGACCCAAGGGCATCTGCGAGGACCCCCGCCTCTTT GTGGATGGCATCAGCTCCCACGACCTGCACCAGGGCCAGGTGGGCAACTGCTGGTTTGTGGCAG CCTGCTCGTCACTTGCCTCCCGGGAGTCGCTGTGGCAAAAGGTCATCCCAGACTGGAAGGAGCA GGAATGGGACCCCGAAAAGCCCAACGCCTACGCGGGCATCTTCCACTTCCACTTCTGGCGCTTC GGGGAATGGGTGGACGTGGTCATCGATGACCGGCTGCCCACAGTCAACAACCAGCTCATCTACT GCCACTCCAACTCCCGCAATGAGTTTTGGTGCGCCCTAGTGGAGAAGGCCTATGCCAAACTGGC AGGCTGTTACCAGGCCCTGGATGGAGGCAACACAGCAGACGCACTGGTGGACTTCACGGGTGGT GTTTCTGAGCCCATCGACCTGACCGAGGGTGACTTTGCCAACGATGAGACTAAGAGGAACCAGC TCTTTGAGCGCATGTTAAAGGTGCACAGCCGGGGCGGCCTCATCAGTGCCTCCATCAAGGCAGT GACAGCAGCTGACATGGAGGCCCGCCTGGCGTGCGGCCTGGTAAAGGGCCACGCATACGCCGTC ACTGATGTGCGCAAGGTGCGCCTGGGCCACGGCCTACTGGCCTTCTTCAAGTCAGAGAAGTTGG ACATGATCCGCCTGCGCAACCCCTGGGGCGAGCGGGAGTGGAACGGGCCCTGGAGTGACACCTC GGAGGAGTGGCAGAAAGTGAGCAAGAGTGAGCGGGAGAAGATGGGTGTGACCGTGCAGGACGAC GGTGAGTTCTGGATGACCTTCGAGGACGTGTGCCGGTACTTCACGGACATCATCAAGTGCCGCG TGATCAACACATCCCACCTGAGCATCCACAAGACGTGGGAGGAGGCCCGGCTGCATGGCGCCTG GACGCTGCATGAGGACCCGCGACAGAACCGCGGTGGCGGCTGCATCAACCACAAGGACACCTTC TTCCAGAACCCACAGTACATCTTCGAAGTCAAGAAGCCAGAAGAT GAAGAGCAGAAAC TCATC T CAGAAGAGGATC TGGAGCAGAAAC TCATC TCAGAAGAGGATC TGGAGCAGAAAC TCATC TCAGA AGAGGATCTGTGA (SEQ ID NO: 6) Protein sequence
MFSCVKPYED QNYSALRRDC RRRKVLFEDP LFPATDDSLY YKGTPGPAVR WKRPKGICED PRLFVDGISS HDLHQGQVGN CWFVAACSSL ASRESLWQKV IPDWKEQEWD PEKPNAYAGI FHFHFWRFGE WVDWIDDRL PTVNNQLIYC HSNSRNEFWC ALVEKAYAKL AGCYQALDGG NTADALVDFT GGVSEPIDLT EGDFANDETK RNQLFERMLK VHSRGGLISA SIKAVTAADM EARLACGLVK GHAYAV DVR KVRLGHGLLA FFKSEKLDMI RLRNPWGERE WNGPWSDTSE EWQKVSKSER EKMGVTVQDD GEFWM FEDV CRYFTDI IKC RVINTSHLSI HKTWEEARLH GAWTLHEDPR QNRGGGCINH KDTFFQNPQY IFEVKKPEDE EQKLI SEEDL EQKLISEEDL EQKLISEEDL * (SEQ ID NO: 7) hCAPN5-truncation3 : l-550amino acids+3x myc (indicated in bold), 1743 nts, 581 amino acids
DNA sequence:
ATGTTCTCGTGTGTGAAGCCCTATGAGGACCAGAACTACTCAGCCCTGAGGCGGGACTGCCGGC GCAGGAAGGTGCTCTTCGAGGACCCCCTCTTCCCCGCCACTGACGACTCACTCTACTATAAGGG CACGCCGGGGCCCGCCGTCAGGTGGAAGCGACCCAAGGGCATCTGCGAGGACCCCCGCCTCTTT GTGGATGGCATCAGCTCCCACGACCTGCACCAGGGCCAGGTGGGCAACTGCTGGTTTGTGGCAG CCTGCTCGTCACTTGCCTCCCGGGAGTCGCTGTGGCAAAAGGTCATCCCAGACTGGAAGGAGCA GGAATGGGACCCCGAAAAGCCCAACGCCTACGCGGGCATCTTCCACTTCCACTTCTGGCGCTTC GGGGAATGGGTGGACGTGGTCATCGATGACCGGCTGCCCACAGTCAACAACCAGCTCATCTACT GCCACTCCAACTCCCGCAATGAGTTTTGGTGCGCCCTAGTGGAGAAGGCCTATGCCAAACTGGC AGGCTGTTACCAGGCCCTGGATGGAGGCAACACAGCAGACGCACTGGTGGACTTCACGGGTGGT GTTTCTGAGCCCATCGACCTGACCGAGGGTGACTTTGCCAACGATGAGACTAAGAGGAACCAGC TCTTTGAGCGCATGTTAAAGGTGCACAGCCGGGGCGGCCTCATCAGTGCCTCCATCAAGGCAGT GACAGCAGCTGACATGGAGGCCCGCCTGGCGTGCGGCCTGGTAAAGGGCCACGCATACGCCGTC ACTGATGTGCGCAAGGTGCGCCTGGGCCACGGCCTACTGGCCTTCTTCAAGTCAGAGAAGTTGG ACATGATCCGCCTGCGCAACCCCTGGGGCGAGCGGGAGTGGAACGGGCCCTGGAGTGACACCTC GGAGGAGTGGCAGAAAGTGAGCAAGAGTGAGCGGGAGAAGATGGGTGTGACCGTGCAGGACGAC GGTGAGTTCTGGATGACCTTCGAGGACGTGTGCCGGTACTTCACGGACATCATCAAGTGCCGCG TGATCAACACATCCCACCTGAGCATCCACAAGACGTGGGAGGAGGCCCGGCTGCATGGCGCCTG GACGCTGCATGAGGACCCGCGACAGAACCGCGGTGGCGGCTGCATCAACCACAAGGACACCTTC TTCCAGAACCCACAGTACATCTTCGAAGTCAAGAAGCCAGAAGATGAAGTCCTGATCTGCATCC AGCAGCGGCCAAAGCGGTCTACGCGCCGGGAGGGCAAGGGTGAGAACCTGGCCATTGGCTTTGA CATCTACAAGGTGGAGGAGAACCGCCAGTACCGCATGCACAGCCTGCAGCACAAGGCCGCCAGC TCCATCTACATCAACTCACGCAGCGTCTTCCTGCGCACCGACCAGCCCGAGGGCCGCTATGTCA TCATCCCCACAACCTTCGAGCCAGGCCACACTGGCGAGTTCCTGCTCCGAGTCTTCACTGATGT GCCCTCCAACTGCCGGGAGCTGCGCCTGGATGAGCCCCCACACACCTGCTGGAGCTCCCTCTGT GGCTACCCCCAGCTGGTGACCCAGGTACATGTCCTGGGAGCTGCTGGCCTCAAGGACTCCCCAA CAGGGGCTAACTCTTATGTGATCATCAAGTGTGAGGGAGACAAAGTCCGC GAGCAGAAAC TCAT C TCAGAAGAGGATC TGGAGCAGAAAC TCATC TCAGAAGAGGATC TGGAGCAGAAAC TCATC TCA GAAGAGGATCTG TGA (SEQ ID NO : 8 ) Protein sequence:
MFSCVKPYED QNYSALRRDC RRRKVLFEDP LFPATDDSLY YKGTPGPAVR WKRPKGICED PRLFVDGISS HDLHQGQVGN CWFVAACSSL ASRESLWQKV IPDWKEQEWD PEKPNAYAGI FHFHFWRFGE WVDWIDDRL PTVNNQLIYC HSNSRNEFWC ALVEKAYAKL AGCYQALDGG NTADALVDFT GGVSEPIDLT EGDFANDETK RNQLFERMLK VHSRGGLISA S IKAVTAADM EARLACGLVK GHAYAVTDVR KVRLGHGLLA FFKSEKLDMI RLRNPWGERE WNGPWSDTSE EWQKVSKSER EKMGVTVQDD GEFWMTFEDV CRYFTDI IKC RVINTSHLSI HKTWEEARLH GAWTLHEDPR QNRGGGCINH KDTFFQNPQY I FEVKKPEDE VLICIQQRPK RSTRREGKGE NLAIGFDIYK VEENRQYRMH SLQHKAASSI YINSRSVFLR TDQPEGRYVI IPTTFEPGHT GEFLLRVFTD VPSNCRELRL DEPPHTCWSS LCGYPQLVTQ VHVLGAAGLK DSPTGANSYV I IKCEGDKVR EQKLISEEDL EQKLISEEDL EQKLISEEDL *(SEQ ID NO: 9)
hCAPN5 -truncation^ 1-100 amino acids+3x myc (indicated in bold), 393 nts, 131 amino acids DNA sequence:
ATGTTCTCGTGTGTGAAGCCCTATGAGGACCAGAACTACTCAGCCCTGAGGCGGGACTGCCGGC GCAGGAAGGTGCTCTTCGAGGACCCCCTCTTCCCCGCCACTGACGACTCACTCTACTATAAGGG CACGCCGGGGCCCGCCGTCAGGTGGAAGCGACCCAAGGGCATCTGCGAGGACCCCCGCCTCTTT GTGGATGGCATCAGCTCCCACGACCTGCACCAGGGCCAGGTGGGCAACTGCTGGTTTGTGGCAG CCTGCTCGTCACTTGCCTCCCGGGAGTCGCTGTGGCAAAAGGTCGAGCAGAAACTCATCTCAGA AGAGGATC TGGAGCAGAAAC TCATC TCAGAAGAGGATC TGGAGCAGAAAC TCATC TCAGAAGAG GATCTGTGA (SEQ ID NO: 10)
Protein sequence:
MFSCVKPYED QNYSALRRDC RRRKVLFEDP LFPATDDSLY YKGTPGPAVR WKRPKGICED PRLFVDGISS HDLHQGQVGN CWFVAACSSL ASRESLWQKV EQKLISEEDL EQKLISEEDL EQKLISEEDL * SEQ ID NO: 11) hCAPN5-truncation5: 26-343 amino acids+3x myc (indicated in bold), 1047nts, 349 amino acids
DNA sequence:
CTCTTCGAGGACCCCCTCTTCCCCGCCACTGACGACTCACTCTACTATAAGGGCACGCCGGGGC CCGCCGTCAGGTGGAAGCGACCCAAGGGCATCTGCGAGGACCCCCGCCTCTTTGTGGATGGCAT CAGCTCCCACGACCTGCACCAGGGCCAGGTGGGCAACTGCTGGTTTGTGGCAGCCTGCTCGTCA CTTGCCTCCCGGGAGTCGCTGTGGCAAAAGGTCATCCCAGACTGGAAGGAGCAGGAATGGGACC CCGAAAAGCCCAACGCCTACGCGGGCATCTTCCACTTCCACTTCTGGCGCTTCGGGGAATGGGT GGACGTGGTCATCGATGACCGGCTGCCCACAGTCAACAACCAGCTCATCTACTGCCACTCCAAC TCCCGCAATGAGTTTTGGTGCGCCCTAGTGGAGAAGGCCTATGCCAAACTGGCAGGCTGTTACC AGGCCCTGGATGGAGGCAACACAGCAGACGCACTGGTGGACTTCACGGGTGGTGTTTCTGAGCC CATCGACCTGACCGAGGGTGACTTTGCCAACGATGAGACTAAGAGGAACCAGCTCTTTGAGCGC ATGTTAAAGGTGCACAGCCGGGGCGGCCTCATCAGTGCCTCCATCAAGGCAGTGACAGCAGCTG ACATGGAGGCCCGCCTGGCGTGCGGCCTGGTAAAGGGCCACGCATACGCCGTCACTGATGTGCG CAAGGTGCGCCTGGGCCACGGCCTACTGGCCTTCTTCAAGTCAGAGAAGTTGGACATGATCCGC CTGCGCAACCCCTGGGGCGAGCGGGAGTGGAACGGGCCCTGGAGTGACACCTCGGAGGAGTGGC AGAAAGTGAGCAAGAGTGAGCGGGAGAAGATGGGTGTGACCGTGCAGGACGACGGTGAGTTCTG GATGACCTTCGAGGACGTGTGCCGGTACTTCACGGACATCATCAAGTGCCGCGTGATCGAGCAG AAAC TCATC TCAGAAGAGGATC TGGAGCAGAAAC TCATC TCAGAAGAGGATC TGGAGCAGAAAC TCATCTCAGAAGAGGATCTGTGA SEQ ID NO: 12)
Protein sequence:
LFEDPLFPAT DDSLYYKGTP GPAVRWKRPK GICEDPRLFV DGISSHDLHQ
GQVGNCWFVA ACSSLASRES LWQKVIPDWK EQEWDPEKPN AYAGI FHFHF
WRFGEWVDW IDDRLPTVNN QLIYCHSNSR NEFWCALVEK AYAKLAGCYQ
ALDGGNTADA LVDFTGGVSE PIDLTEGDFA NDETKRNQLF ERMLKVHSRG
GLISASIKAV TAADMEARLA CGLVKGHAYA VTDVRKVRLG HGLLAFFKSE KLDMIRLRNP WGEREWNGPW SDTSEEWQKV SKSEREKMGV TVQDDGEFWM
TFEDVCRYFT DIIKCRVIEQ KLISEEDLEQ KLISEEDLEQ KLISEEDL*
SEQ ID NO: 13) hCAPN5-truncation6: 181-420 amino acids+3x myc (indicated in bold), 813nts, 271 amino acids
DNA sequence:
AACACAGCAGACGCACTGGTGGACTTCACGGGTGGTGTTTCTGAGCCCATCGACCTGACCGAGG GTGACTTTGCCAACGATGAGACTAAGAGGAACCAGCTCTTTGAGCGCATGTTAAAGGTGCACAG CCGGGGCGGCCTCATCAGTGCCTCCATCAAGGCAGTGACAGCAGCTGACATGGAGGCCCGCCTG GCGTGCGGCCTGGTAAAGGGCCACGCATACGCCGTCACTGATGTGCGCAAGGTGCGCCTGGGCC ACGGCCTACTGGCCTTCTTCAAGTCAGAGAAGTTGGACATGATCCGCCTGCGCAACCCCTGGGG CGAGCGGGAGTGGAACGGGCCCTGGAGTGACACCTCGGAGGAGTGGCAGAAAGTGAGCAAGAGT GAGCGGGAGAAGATGGGTGTGACCGTGCAGGACGACGGTGAGTTCTGGATGACCTTCGAGGACG TGTGCCGGTACTTCACGGACATCATCAAGTGCCGCGTGATCAACACATCCCACCTGAGCATCCA CAAGACGTGGGAGGAGGCCCGGCTGCATGGCGCCTGGACGCTGCATGAGGACCCGCGACAGAAC CGCGGTGGCGGCTGCATCAACCACAAGGACACCTTCTTCCAGAACCCACAGTACATCTTCGAAG TCAAGAAGCCAGAAGATGAAGTCCTGATCTGCATCCAGCAGCGGCCAAAGCGGTCTACGCGCCG GGAGGGCAAGGGTGAGGAGCAGAAACTCATCTCAGAAGAGGATCTGGAGCAGAAACTCATCTCA GAAGAGGATCTGGAGCAGAAACTCATCTCAGAAGAGGATCTGTGA SEQ ID NO: 14)
Protein sequence:
NTADALVDFT GGVSEPIDLT EGDFANDETK RNQLFERMLK VHSRGGLISA
S IKAVTAADM EARLACGLVK GHAYAVTDVR KVRLGHGLLA FFKSEKLDMI
RLRNPWGERE WNGPWSDTSE EWQKVSKSER EKMGVTVQDD GEFWMTFEDV
CRYFTDI IKC RVINTSHLSI HKTWEEARLH GAWTLHEDPR QNRGGGCINH
KDTFFQNPQY I FEVKKPEDE VLICIQQRPK RSTRREGKGE EQKLISEEDL EQKLISEEDL EQKLISEEDL * SEQ ID NO: 15) hCAPN5 -truncation?: 421-560 amino acids+3x myc (indicated in bold), 513nts, 171 amino acids DNA sequence:
AACCTGGCCATTGGCTTTGACATCTACAAGGTGGAGGAGAACCGCCAGTACCGCATGCACAGCC TGCAGCACAAGGCCGCCAGCTCCATCTACATCAACTCACGCAGCGTCTTCCTGCGCACCGACCA GCCCGAGGGCCGCTATGTCATCATCCCCACAACCTTCGAGCCAGGCCACACTGGCGAGTTCCTG CTCCGAGTCTTCACTGATGTGCCCTCCAACTGCCGGGAGCTGCGCCTGGATGAGCCCCCACACA CCTGCTGGAGCTCCCTCTGTGGCTACCCCCAGCTGGTGACCCAGGTACATGTCCTGGGAGCTGC TGGCCTCAAGGACTCCCCAACAGGGGCTAACTCTTATGTGATCATCAAGTGTGAGGGAGACAAA GTCCGCTCGGCTGTGCAGAAGGGCACCTCCACACC AGAGCAGAAAC T CAT C T CAGAAGAGGAT C TGGAGCAGAAACTCATCTCAGAAGAGGATCTGGAGCAGAAACTCATCTCAGAAGAGGATCTGTG A SEQ ID NO: 16)
Protein sequence:
NLAIGFDIYK VEENRQYRMH SLQHKAASSI YINSRSVFLR TDQPEGRYVI IPTTFEPGHT GEFLLRVFTD VPSNCRELRL DEPPHTCWSS LCGYPQLVTQ VHVLGAAGLK DSPTGANSYV I IKCEGDKVR SAVQKGTSTP EQKLISEEDL EQKLISEEDL EQKLISEEDL * SEQ ID NO: 17)
The particular locations for truncation were carefully determined. Cutting the enzyme in the middle of a helix or sheet could potentially destabilize the protein, causing it not to fold properly, precipitate and make it difficult to do cleavage tests. Thus, sections of the protein were selected that do not interrupt a secondary structure element.
Example 3
Enzyme Kinetics
In enzymatic studies, the Vmax is the maximum velocity or rate at which an enzyme catalyzes a reaction; when all enzyme active sites are saturated with substrate. The Km is the substrate concentration at which the reaction rate is half of the maximum. It is an inverse measure of affinity. Thus, a higher Km value means more substrate is needed to saturate the enzyme. Figures 7-11.
Example 4
Inhibitors of CAPN5
Cyclic peptides have been generated that block the binding site otherwise occupied by the 10 amino acid target peptide.
Based on comparative homology to other Calpain molecules (Fig. 5A), these inhibitors can also to inhibit other Calpain molecules.
Example 5
Specificity of CAPN5 Inhibitors
A highly specific peptide that is a proteolytic target of CAPN5 was identified. This peptide is modified to become protease resistant for use as an inhibitor.
Proteolytic kinetics of CAPN5 is influenced by peptide length near its autoproteolytic site. Peptides substrates that were 7, 11, and 21 amino acids long were incubated in calpain activity buffer. The solution was brought to 37°C. CAPN5 was then added and fluorescence was measured. There was mild cleavage of the 7 aa peptide was observed (Fig. 12A), and rapid and high cleavage of the 11 aa peptide (Fig. 12B). The 21 aa peptide was cleaved slower and does not show cleavage substrate inhibition (Fig. 12C). The kinetics data from the Michaelis- Menten and substrate inhibition equations are shown in a table (Fig. 12D).
The peptides that were tested showed calpain-specificity. Peptides were incubated in calpain activity buffer, and the solution was brought to 37°C. Calpain was added and fluorescence was measured. The fluorescence measured for the lead peptide, CAPN5p370-380, was plotted and lines were fit using the following substrate inhibition equation,
Y=Vmax*X/(Km+X*(l+X/Ki)). The peptide shows high proteolysis when incubated with CAPN5-WT and very limited proteolysis when incubated with CPAN1-WT (Fig. 13A). The fluorescence measure for a previously published calpain-1 peptide, EPLFAERK, was plotted and lines were fit using the following Michaelis-Menten equation, Y= Vmax*X/(Km+X) (Fig. 13B). The peptide shows high proteolysis when incubated with CAPNl -WT and very limited proteolysis when incubated with CAPN5-WT, suggesting substrate specificity. Kinetics data from the Michaelis-Menten and substrate inhibition equations are shown in a table (Fig. 13C).
CAPN5 specifically targets a peptide corresponding to its own autocatalytic site and not homologous regions in other calpains. An alignment of the peptides shows very limited sequence homology (Fig. 14A). Peptides corresponding to the homologous regions of the CAPN5 autoproeolysis site in other calpain family members were incubated with CAPN5 protease. CAPN5 did not proteolyze homologous regions of other CAPN members as well as it proteolyzed its own site, although there was some proteolysis of the CAPN 14 peptide (Fig. 14B). Peptides tested in Fig. 14B were incubated with CAPNl . CAPNl does not appear to proteolyze these regions (Fig. 14C). Kinetics data from the Michaelis-Menten and substrate inhibitions equations are shown in a table (Fig. 14D).
Example 6
Second Generation Inhibitors
The classical calpain inhibitor SNJ-1945 inhibits CAPNl but is not a good inhibitor of CAPN5. Various concentrations of SNJ-1945 were incubated in a reaction with 50 μΜ
EPLFAERK (a CAPNl substrate) and CAPNl WT in activity. Addition of 1 μΜ SNJ-1945 slows the initial reaction rate by 100% (Fig. 15A). CAPNl WT was incubated with and without SNJ-1945 at increasing concentrations of EPLFAERK substrate (Fig. 15B). Various concentrations of SNJ-1945 were incubated in a reaction with CAPN5p.370-80 and CAPN5 WT in an activity buffer. Only after addition of 100 μΜ SNJ-1945 did the initial reaction rate slow to 100% (Fig. 15C). CAPN5 WT was incubated with and without SNJ-1945 at increasing concentrations of CAPN5 p.370-80 substrate (Fig. 15D).
Second generation inhibitors based off lead compound competitively inhibit CAPN5.
First generation lead compound CAPN5 p.370-80 was modified using amide cyclization to generate a second generation competitive cyclic inhibitor. Various concentrations of Cyclic CAPN5 p.370-80 were incubated in a reaction with CAPN5p.370-80 and CAPN5 WT in an activity buffer. Addition of 10 μΜ Cyclic CAPN5 p.370-80 slows the initial reaction rate by 40% (Fig. 16A). CAPN5 WT was incubated with and without 10 μΜ Cyclic CAPN5 p.370-80 at increasing concentrations of CAPN5 p.370-80 substrate. Increasing concentrations of substrate does not overcome inhibition by cyclic peptide (Fig. 16B). The co-crystallization of CAPN5 with CAPN5p.370-80 peptide is shown in Fig. 17. Modification of lead compound reveals potential for competitive inhibition. (A)
Structural model of the CAPN5 protease core with the peptide docked to it using AutoDock VINA is shown in Fig. 18A. Scanning modifications were made to the amino acids of the lead compound to make the bonds un-cleavable by CAPN5 (Fig. 18B). Despite modifications, the peptide still fit in the catalytic groove using docking predictions. N-terminal (EDANS) and C- terminal GLU-(DABCYL) FRET tags were added to the peptides for our standard CAPN5 assay and were dissolved in 70% DMSO (Fig. 18C). Peptides incubated for 15 minutes at various concentrations with 5 μg of MBP-CAPN5 WT. Modification of the amino acids slows the reaction rate. Data is plotted as initial velocity (uM/sec) versus peptide concentration fit to the substrate inhibition equation (Fig. 18D).
Example 8
Modification and Activity of CAPN5-370-80 Peptide
The CAPN5-370-80 peptide was modified (Figs. 19A-19G) and the activity was evaluated (Figs. 20A-20D). A structural model of the CAPN5 protease core with the peptide docked to it using AutoDock VINA is provided in Fig. 20A. Chemical structure of the CAPN5- 370-80 peptide (RQNRGGGCINH) is provided in Fig. 20B. Scanning modifications were made to the amino acids of the peptide to make the bonds un-cleavable by CAPN5. The location of the modifications are denoted with circles N-terminal (EDANS) and C-terminal GLU- (DABCYL) FRET tags were added to the peptides for the standard CAPN5 assay and were dissolved in 70% DMSO. Peptides incubated for 15 minutes at various concentrations with 5 μg of MBP-CAPN5 WT in a buffer containing 20 mM Tris, 300 mM NaCl, 2 mM DTT, pH 7.5 to measure activity (Fig. 20C). Data is plotted as initial velocity (uM/sec) versus peptide concentration. Modification of the amino acids slows the reaction rate. Close-up of graph region highlighting the differences in proteolytic activity at 5μΜ substrate is provided in Fig. 20D.
Example 9
Testing of Classical Calpain Inhibitors for CAPN5
Results from the testing of classical calpain inhibitors Calpain Inhibitor IV, Leupeptin and SNJ-1945 are provided in Figure 21.
All publications, patents and patent applications are incorporated herein by reference. While in the foregoing specification this invention has been described in relation to certain preferred embodiments thereof, and many details have been set forth for purposes of illustration, it will be apparent to those skilled in the art that the invention is susceptible to additional embodiments and that certain of the details described herein may be varied considerably without departing from the basic principles of the invention.
The use of the terms "a" and "an" and "the" and similar referents in the context of describing the invention are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms "comprising,"
"having," "including," and "containing" are to be construed as open-ended terms (i.e., meaning "including, but not limited to") unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as") provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.
Embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein.
Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any
combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

Claims

WHAT IS CLAIMED IS:
1. A CAPN5 substrate comprising an amino acid sequence of 5-30 amino acids in length having at least 80% sequence identity to a peptide, wherein the peptide is CAPN5- 370-380 (SEQ ID NO:23), PDGFB (SEQ ID NO: 18), IRX3 (SEQ ID NO: 19), CAPN5-370-390 (SEQ ID NO:20), CAPN5-390-410 (SEQ ID NO:21), or CAPN14 (SEQ ID NO: 32).
2. The CAPN5 substrate of claim 1 having at least 90% sequence identity to a peptide, wherein the peptide is CAPN5-370-380 (SEQ ID NO:23), PDGFB (SEQ ID NO: 18), IRX3 (SEQ ID NO: 19), CAPN5-370-390 (SEQ ID NO:20), CAPN5-390-410 (SEQ ID NO:21), or CAPN14 (SEQ ID NO: 32).
3. The CAPN5 substrate of claim 1 having at least 95% sequence identity to a peptide, wherein the peptide is PDGFB (SEQ ID NO: 18), IRX3 (SEQ ID NO: 19), CAPN5- 370-390 (SEQ ID NO:20), CAPN5-390-410 (SEQ ID NO:21), CAPN5-370-380 (SEQ ID NO:23) or CAPN14 (SEQ ID NO: 32).
4. The CAPN5 substrate of any one of claims 1-3, wherein the peptide is CAPN5-370- 380 (SEQ ID NO:23).
5. The CAPN5 substrate according to any one of claims 1 to 4, wherein the peptide contains an unnatural amino acid residue.
6. The CAPN5 substrate according to claim 5, wherein the unnatural amino acid residue renders the peptide bond uncleavable by calpain.
7. The CAPN5 substrate according to claim 5, wherein modified amino acid residue is methylated.
8. The CAPN5 substrate according to claim 5, wherein methylated amino acid residue is methyl-arginine, methyl -glycine, or methyl-isoleucine.
9. The CAPN5 substrate according to claim 5, wherein the unnatural amino acid residue is a D-amino acid.
10. The CAPN5 substrate according to claim 5, wherein the D-amino acid is D-glutamine or D-asparagine.
11. The CAPN5 substrate according to claim 5, wherein the unnatural amino acid residue is Acm-cysteine.
12. The CAPN5 substrate according to any one of claims 1 to 11, wherein the peptide forms an alpha-helix.
13. The CAPN substrate according to any one of claims 1 to 11, wherein the peptide forms a circular peptide.
14. The CAPN5 substrate according to any one of claims 1 to 13, wherein the peptide is from 5 to 11 amino acids in length.
15. The CAPN5 substrate of any one of claims 1 to 14, wherein the inhibitory peptide occupies the catalytic groove or region that prevents formation of the catalytic triad.
16. The CAPN5 substrate of any one of claims 1 to 15, wherein the inhibitory peptide is soluble in aqueous solutions.
17. A CAPN5 inhibitory peptide, wherein the inhibitor is Pep-6-Mod (SEQ ID NO:38), Pep-l-Mod (SEQ ID NO:33), Pep-2-Mod (SEQ ID NO:34), Pep-3-Mod (SEQ ID NO:35), Pep-4-Mod (SEQ ID NO:36), or Pep-5-Mod (SEQ ID NO:37).
18. A CAPN5 substrate, wherein the inhibitor is Pep-6-Mod (SEQ ID NO:38).
19. A composition comprising the CAPN5 substrate according to any of claims 1 to 18 and a physiologically acceptable carrier.
20. A method of identifying a CAPN5 inhibitor comprising, contacting CAPN5 with a CAPN5 substrate of any one of claims 1-19 in the presence of a target inhibitor, and measuring an activity level of the CAPN5 in the presence of the target inhibitor as compared to an activity level of CAPN5 in the absence of the target inhibitor.
21. A CAPN5 inhibitor identified by the method of claim 20.
22. A method of treating CAPN5-related inflammation by administering a therapeutic agent comprising the CAPN5 substrate of any one of claims 1 to 18, the composition of claim 19, or the CAPN5 inhibitor of claim 21.
23. A method of treating uveitis by administering a therapeutic agent comprising the CAPN5 substrate of any one of claims 1 to 18, the composition of claim 19, or CAPN5 inhibitor of claim 21.
24. A therapeutic method for preventing or treating a pathological condition or symptom in a mammal, such as a human, wherein an anti-inflammatory activity is desired, comprising administering to a mammal in need of such therapy, an effective amount of a therapeutic agent comprising the CAPN5 substrate of any one of claims 1 to 18, the composition of claim 19, or the CAPN5 inhibitor of claim 21.
25. A therapeutic method for preventing or treating intraocular inflammation in a
mammal, such as a human, comprising administering to a mammal in need of such therapy, an effective amount of a therapeutic agent comprising the CAPN5 substrate of any one of claims 1 to 18, the composition of claim 19, or the CAPN5 inhibitor of claim 21.
26. A method to treat intraocular inflammation comprising administering a
therapeutically effective amount of a therapeutic agent comprising the CAPN5 substrate of any one of claims 1 to 18, the composition of claim 19, or the CAPN5 inhibitor of claim 21 to a mammal.
27. A CAPN5 substrate of any one of claims 1 to 18, a composition of claim 19, or a CAPN5 inhibitor of claim 21 for use in medical therapy.
28. The use of a CAPN5 substrate of any one of claims 1 to 18, a composition of claim 19, or a CAPN5 inhibitor of claim 21 for the manufacture of a medicament useful for the treatment of intraocular inflammation in a mammal.
29. A solution comprising a carrier and a CAPN5 substrate of any one of claims 1 to 18 or a CAPN5 inhibitor of claim 21 dispersed in the carrier.
30. An isolated or purified nucleic acid that is less than 150 nucleotides in length
encoding a peptide according to any of claims 1 to 19 or 21.
31. The isolated or purified nucleic acid of claim 30 that is less than 120 nucleotides in length.
32. An expression cassette comprising the nucleic acid of claim 30 or31.
33. The expression cassette of claim 32, further comprising a promoter.
34. A vector comprising the expression cassette of any of claims 32 or 33.
35. A cell comprising the expression cassette of any of claims 32 or 33, or the vector of claim 34.
36. The CAPN5 substrate of any one of claims 1 to 18 or a CAPN5 inhibitor of claim 21, further comprising a detection agent to form a labelled CAPN5 substrate.
37. The CAPN5 substrate or CAPN5 inhibitor of claim 36, wherein the detection agent is a fluorescent or colorimetric chemical agent.
38. A method of detecting CAPN5 comprising administering a labelled CAPN5 substrate or CAPN5 inhibitor of claim 36 or 37.
39. A CAPN5 substrate of any one of claims 1 to 18, a composition of claim 19, or a CAPN5 inhibitor of claim 21 for the prophylactic or therapeutic treatment of a pathological condition or symptom wherein anti-inflammatory activity is desired.
40. A CAPN5 substrate of any one of claims 1 to 18, a composition of claim 19, or a CAPN5 inhibitor of claim 21 for the prophylactic or therapeutic treatment of intraocular inflammation is desired.
PCT/US2017/054727 2016-10-11 2017-10-02 Methods and compositions for treating genetic eye diseases Ceased WO2018071216A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US16/340,657 US11981943B2 (en) 2016-10-11 2017-10-02 Methods and composition for detecting CAPN5

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201662406806P 2016-10-11 2016-10-11
US62/406,806 2016-10-11
US201762525510P 2017-06-27 2017-06-27
US62/525,510 2017-06-27

Publications (1)

Publication Number Publication Date
WO2018071216A1 true WO2018071216A1 (en) 2018-04-19

Family

ID=61906182

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/054727 Ceased WO2018071216A1 (en) 2016-10-11 2017-10-02 Methods and compositions for treating genetic eye diseases

Country Status (2)

Country Link
US (1) US11981943B2 (en)
WO (1) WO2018071216A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20220364142A1 (en) * 2019-10-11 2022-11-17 The Board Of Trustees Of The Leland Stanford Junior University Compositions and methods for measuring and inhibiting calpain-5 activity
WO2023234703A1 (en) * 2022-05-31 2023-12-07 주식회사 세네릭스 Novel d-amino acid derivative and pharmaceutical composition comprising same

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20240120032A1 (en) * 2020-10-14 2024-04-11 The Board Of Trustees Of The Leland Stanford Junior University Crystal Structure of The Human G267s Calpain-5 Protease Core Domain and Its Use in Rational Drug Design for Identifying Inhibitors of Calpain-5

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030003477A1 (en) * 1999-09-09 2003-01-02 Millennium Pharmaceuticals, Inc. 26176, a novel calpain protease and uses thereof
US6569665B1 (en) * 1996-12-04 2003-05-27 Basf Aktiengesellschaft Calpaines, production and use thereof
US20040014093A1 (en) * 2002-03-14 2004-01-22 Franck Duclos Polynucleotide encoding a novel cysteine protease of the calpain superfamily, Protease-42

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP4429385B2 (en) 1994-07-15 2010-03-10 セフアロン・インコーポレーテツド Active calpain expressed by baculovirus
US6342611B1 (en) * 1997-10-10 2002-01-29 Cytovia, Inc. Fluorogenic or fluorescent reporter molecules and their applications for whole-cell fluorescence screening assays for capsases and other enzymes and the use thereof
AU1450900A (en) 1998-10-21 2000-05-08 Arch Development Corporation Methods of treatment of type 2 diabetes
JP2002241304A (en) 2001-02-14 2002-08-28 Senju Pharmaceut Co Ltd Preventive or therapeutic agent for inflammatory disease of anterior eye part
WO2002088303A2 (en) 2001-04-03 2002-11-07 Bristol-Myers Squibb Company Polynucleotide encoding a novel cysteine protease of the calpain superfamily, can-12, and variants thereof
EP1987055A1 (en) * 2006-02-10 2008-11-05 Dermagen AB Novel antimicrobial peptides and use thereof
AU2007284651B2 (en) 2006-08-09 2014-03-20 Institute For Systems Biology Organ-specific proteins and methods of their use
RU2011127198A (en) 2008-12-04 2013-01-10 Эбботт Лэборетриз IMMUNOGLOBULINS WITH DOUBLE VARIABLE DOMAINS AND THEIR APPLICATION
US20120240246A1 (en) 2009-11-17 2012-09-20 St. Jude Children's Research Hospital Variant Calpastatins and Variant Calpains for Modulating the Activity or Stability of Calpain

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6569665B1 (en) * 1996-12-04 2003-05-27 Basf Aktiengesellschaft Calpaines, production and use thereof
US20030003477A1 (en) * 1999-09-09 2003-01-02 Millennium Pharmaceuticals, Inc. 26176, a novel calpain protease and uses thereof
US20040014093A1 (en) * 2002-03-14 2004-01-22 Franck Duclos Polynucleotide encoding a novel cysteine protease of the calpain superfamily, Protease-42

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
GAKHAR ET AL.: "Small-angle x-ray scattering of calpain-5 reveals a highly open conformation among calpains", JOURNAL OF STRUCTURAL BIOLOGY, vol. 196, no. 3, 27 July 2016 (2016-07-27), pages 309 - 318, XP029811996, Retrieved from the Internet <URL:doi: 10.1016/j.jsb.2016.07.017> *
SCHAEFER ET AL.: "Calpain-5 Expression in the Retina Localizes to Photoreceptor Synapses", INVESTIGATIVE OPHTHALMOLOGY & VISUAL SCIENCE, vol. 57, no. 6, 6 May 2016 (2016-05-06), pages 2509 - 2521, XP055476308, Retrieved from the Internet <URL:doi:10.1167/iovs.15-18680.> *
WERT ET AL.: "CAPN5 mutation in hereditary uveitis: the R243L mutation increases calpain catalytic activity and triggers intraocular inflammation in a mouse mode l", HUMAN MOLECULAR GENETICS, vol. 24, no. 16, 20 May 2015 (2015-05-20), pages 4584 - 4598, XP055476310, Retrieved from the Internet <URL:doi:10.1093/hmg/ddv189> *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20220364142A1 (en) * 2019-10-11 2022-11-17 The Board Of Trustees Of The Leland Stanford Junior University Compositions and methods for measuring and inhibiting calpain-5 activity
US12486528B2 (en) * 2019-10-11 2025-12-02 The Board Of Trustees Of The Leland Stanford Junior University Compositions and methods for measuring and inhibiting calpain-5 activity
WO2023234703A1 (en) * 2022-05-31 2023-12-07 주식회사 세네릭스 Novel d-amino acid derivative and pharmaceutical composition comprising same
KR20230166465A (en) * 2022-05-31 2023-12-07 주식회사 세네릭스 Novel D-amino acid derivatives and compositions comprising the same
KR102662922B1 (en) 2022-05-31 2024-05-03 주식회사 세네릭스 Novel D-amino acid derivatives and compositions comprising the same
JP2025513314A (en) * 2022-05-31 2025-04-24 セネリックス カンパニー リミテッド Novel D-amino acid derivatives and pharmaceutical compositions containing the same
JP7749269B2 (en) 2022-05-31 2025-10-06 セネリックス カンパニー リミテッド Novel D-amino acid derivatives and pharmaceutical compositions containing the same

Also Published As

Publication number Publication date
US20190284544A1 (en) 2019-09-19
US11981943B2 (en) 2024-05-14

Similar Documents

Publication Publication Date Title
EP3583118B1 (en) Transferrin receptor transgenic models
CN111770758A (en) Methods and compositions for treating Angelman syndrome
US11981943B2 (en) Methods and composition for detecting CAPN5
US7777000B2 (en) Anti-viral activity of cathelicidin peptides
JP2002523029A (en) Human histone deacetylase gene HD4
US7071004B1 (en) 14094, a novel human trypsin family member and uses thereof
US10590168B2 (en) Substrates for FLT3 kinase and uses thereof
JPH11253183A (en) Frizzled-3 polypeptide and polynucleotide
AU780693B2 (en) Hedgehog fusion proteins and uses
CN113082193B (en) Regulated endocrine-specific protein 18 and uses of its gene
JP2002504327A (en) Cerebellin-2-related polypeptide and DNA encoding the polypeptide
US20040053283A1 (en) Gene 4
US20100015654A1 (en) Negative regulation of NK cell functions by EAT-2, a sap-related adaptor expressed in innate immune cells
JP2003189883A (en) New ubiquitin-specific protease
US20220135651A1 (en) A membrane-bound fit-1 decoy and uses thereof
US20090226929A1 (en) Titinic ion channel, compositions and methods of use
WO2001055425A1 (en) Novel polypeptide---human protein phosphatase 2c26 and polynucleotide encoding it
WO2001085903A2 (en) A novel polypeptide- human protein 9 which contains a p5cr characteristic sequence fragment and a polynucleotide encoding the same
CA2386236A1 (en) Human inwardly rectifying potassium channel subunit
WO2001047996A1 (en) A NOVEL POLYPEPTIDE, Cu/Zn SOD PROTEIN FAMILY 9 AND THE POLYNUCLEOTIDE ENCODING THEREOF
JP2000050886A (en) Novel human cathepsin L2 protein, gene encoding the same, and use thereof
WO2001096572A1 (en) A novel polypeptide- multi-copper oxidase 12 and the polynucleotide encoding said polypeptide
WO2001049858A1 (en) A NOVEL POLYPEPTIDE, η -GLUTAMYL TRANSPEPTIDASE 9 AND THE POLYNUCLEOTIDE ENCODING THE POLYPEPTIDE
WO2002033077A1 (en) Novel polypeptide--- a regulatory protein 10.01 being related to human development and polynucleotide encoding it
WO2001046439A1 (en) Novel polypeptide - human dnaj protein39 and polynucleotide encoding it

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17859979

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17859979

Country of ref document: EP

Kind code of ref document: A1