WO2018054571A1 - Scalable biotechnological production of dna single strand molecules of defined sequence and length - Google Patents

Scalable biotechnological production of dna single strand molecules of defined sequence and length Download PDF

Info

Publication number
WO2018054571A1
WO2018054571A1 PCT/EP2017/068051 EP2017068051W WO2018054571A1 WO 2018054571 A1 WO2018054571 A1 WO 2018054571A1 EP 2017068051 W EP2017068051 W EP 2017068051W WO 2018054571 A1 WO2018054571 A1 WO 2018054571A1
Authority
WO
WIPO (PCT)
Prior art keywords
dna
ssdna
single stranded
precursor
polynucleotide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2017/068051
Other languages
French (fr)
Inventor
Florian PRAETORIUS
Hendrik Dietz
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Technische Universitaet Muenchen
Original Assignee
Technische Universitaet Muenchen
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Technische Universitaet Muenchen filed Critical Technische Universitaet Muenchen
Priority to EP17746416.1A priority Critical patent/EP3516055B1/en
Priority to KR1020197008132A priority patent/KR102528337B1/en
Priority to JP2019515435A priority patent/JP7099724B2/en
Priority to CN201780058442.3A priority patent/CN109844113B/en
Priority to US16/329,495 priority patent/US11913050B2/en
Priority to DK17746416.1T priority patent/DK3516055T3/en
Priority to ES17746416T priority patent/ES2909073T3/en
Priority to PL17746416T priority patent/PL3516055T3/en
Publication of WO2018054571A1 publication Critical patent/WO2018054571A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00Preparation of compounds containing saccharide radicals
    • C12P19/26Preparation of nitrogen-containing carbohydrates
    • C12P19/28N-glycosides
    • C12P19/30Nucleotides
    • C12P19/34Polynucleotides, e.g. nucleic acids, oligoribonucleotides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/65Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70Vectors or expression systems specially adapted for E. coli
    • C12N15/73Expression systems using phage (lambda) regulatory sequences
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2795/00Bacteriophages
    • C12N2795/00011Details
    • C12N2795/14011Details ssDNA Bacteriophages
    • C12N2795/14041Use of virus, viral particle or viral elements as a vector
    • C12N2795/14042Use of virus, viral particle or viral elements as a vector virus or viral particle as vehicle, e.g. encapsulating small organic molecule
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/10Plasmid DNA
    • C12N2800/101Plasmid DNA for bacteria
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2521/00Reaction characterised by the enzymatic activity
    • C12Q2521/30Phosphoric diester hydrolysing, i.e. nuclease
    • C12Q2521/345DNAzyme

Definitions

  • the present invention relates to a method for the recombinant production of DNA single stranded molecules, comprising the steps of (1) providing a pseudogene nucleic acid; (2) integrating the pseudogene nucleic acid into a vector, transforming bacterial cells with said vector and producing a precursor ssDNA from said vector under bacterial culture conditions; (3) isolating the precursor ssDNA from the bacterial culture; (4) digesting the precursor ssDNA under reaction conditions where self-cleaving DNA sequences become active; and (5) separating and obtaining the target single stranded DNA oligo- or polynucleotide(s).
  • the method of the present invention is suitable for the mass production of DNA single stranded molecules.
  • the present invention further relates to the use of the target single stranded DNA oligo- or polynucleotide(s), in particular in DNA nanotechnology, or as research tools.
  • DNA oligonucleotides are needed in the life sciences and medicine for a variety of applications. Oligonucleotides are, for example, required as primers for performing the polymerase chain reaction (PCR) or real-time PCR (RT-PCR) or quantitative PCR (Q-PCR), respectively. In addition, oligonucleotides are needed as starting materials for the synthesis of new genes.
  • PCR polymerase chain reaction
  • RT-PCR real-time PCR
  • Q-PCR quantitative PCR
  • oligonucleotides are needed as starting materials for the synthesis of new genes.
  • the increasing demand for DNA oligonucleotides led to an industry which mainly specializes on the fast production of DNA oligonucleotides of any desired sequence in smallest amounts. DNA oligonucleotides are typically produced base by base in a cyclic chemical synthesis process on a solid phase.
  • This process can be carried out on microscopic beads or in an ink-jet method on a chip surface. Since the base addition reactions do not proceed with 100% efficiency, it is not possible to produce DNA single strands in any length. The yield decreases in an exponential manner with the desired length of the target DNA oligonucleotide. Typically, up to 100 bases long molecules can be produced with a justifiable effort. Some firms offer a (cost-intensive) synthesis of DNA oligonucleotides with a length of up to 200 bases. Furthermore, the synthesis of DNA oligonucleotides is typically limited to the milligram scale, which is sufficient for most of the applications hitherto.
  • DNA nanotechnology promises a particular potential for the generation of new drug delivery vehicles and further nanoparticles with potential medical or even chemical/physical relevance (Jones et ah, 2015). However, the starting materials needed (i.e.
  • DNA oligonucleotides are, at the moment, not available in a scalable manner. Furthermore, catalytically active DNA sequences (DNAzymes) and DNA aptamers attain an increasing interest with respect to applications as diagnostics, in therapy and sensing (Krug et al, 2015; Keefe et al, 2010; Ng et al, 2006; Torabi et al, 2015). For such applications a mass production of DNA oligonucleotides is of great interest.
  • DNAzymes catalytically active DNA sequences
  • DNA aptamers attain an increasing interest with respect to applications as diagnostics, in therapy and sensing (Krug et al, 2015; Keefe et al, 2010; Ng et al, 2006; Torabi et al, 2015). For such applications a mass production of DNA oligonucleotides is of great interest.
  • this object is solved by a method for the recombinant production of DNA single stranded molecules
  • pseudogene nucleic acid is a nucleic acid that comprises at least one target DNA oligo- or polynucleotide sequence and two self- cleaving DNA sequences flanking each target DNA oligo- or polynucleotide sequence,
  • precursor ssDNA comprises the pseudogene nucleic acid
  • this object is solved by using the target single stranded DNA oligo- or polynucleotide(s) obtained in the method of the present invention
  • 2,998, 2,999, 3,000 and sub-ranges such as from 50 to 150, from 100 to 250, from 200 to 500, from 500 to 2,500 etc.
  • This same principle applies to ranges reciting only one numerical value, such as "at least one”. Furthermore, such an interpretation should apply regardless of the breadth of the range or the characteristics being described.
  • the present invention provides a method for the recombinant production of DNA single stranded molecules, in particular single stranded DNA oligonucleotides and polypeptides.
  • Said method comprises the steps of
  • pseudogene nucleic acid is a nucleic acid that comprises at least one target DNA oligo- or polynucleotide sequence and two self-cleaving DNA sequences flanking each target DNA oligo- or polynucleotide sequence;
  • precursor ssDNA comprises the pseudogene nucleic acid
  • the "pseudogene nucleic acid” is a nucleic acid that comprises at least one target DNA oligo- or polynucleotide sequence and two self-cleaving DNA sequences flanking each target DNA oligo- or polynucleotide sequence.
  • the pseudogene nucleic acid comprises one or many target DNA oligo- or polynucleotide sequences, such as two, three, four or more than about 50 target DNA oligo- or polynucleotide sequences.
  • the target DNA oligo- or polynucleotide sequences can be identical or be different, in their sequence as well as in their length.
  • a target DNA oligo- or polynucleotide sequence has a length in the range from about 20 nucleotides to about several thousand nucleotides, covering and exceeding the range in which chemically synthesized oligonucleotides are available.
  • the self-cleaving DNA sequences flanking each of the target DNA oligo- or polynucleotide sequences in the pseudogene nucleic acid are self-cleaving deoxyribozymes or DNAzymes,
  • Deoxyribozymes are DNA molecules that form structures capable of catalyzing chemical reactions (Breaker, 1997). There are DNAs that catalyze self- processing reactions (Carmi et al, 1996). Such deoxyribozymes can be harnessed to create DNA constructs that become modified based on their inherent catalytic activities when exposed to specific reaction conditions. For example, there are engineered self-cleaving deoxyribozymes that employ oxidation (Carmi et al, 1996), depurination (Sheppard et al, 2000), or hydrolysis (see e.g. Chandra et al, 2009) mechanisms that have been created by using various directed evolution strategies.
  • I-R3 carries a small catalytic core composed of 17 nucleotides flanked by either 1 or 2 double stranded substructures.
  • Representatives of this deoxyribozyme class exhibit an observed rate constant (& 0 b s ) for DNA hydrolysis of ⁇ 1 muf 1 (half-life of ⁇ 40 s) when incubated at near neutral pH and in the presence of millimolar concentrations of Zn 2+ .
  • This deoxyribozyme cleaves the phosphoester bond between the 3' oxygen and the phosphorus center of an ApA linkage to yield a 3' cleavage fragment with a 5' phosphate group.
  • the self-cleaving DNA sequences used in the present invention i.e. the self-cleaving desoxyribozymes or DNAzymes
  • Zn 2+ -dependent DNAzymes e.g. I-R3 require the addition of Zn ions.
  • the pseudogene nucleic acid can be synthesized by conventional/established gene synthesis methods.
  • step (2) the pseudogene nucleic acid is integrated into a vector.
  • Said vector is introduced into bacterial cells via transformation and a precursor ssDNA is produced from said vector under bacterial culture conditions.
  • the vector is at least one vector, such as two, three, four or more vectors.
  • the "precursor single stranded DNA” or “precursor ssDNA” comprises the pseudogene nucleic acid in single stranded form and the vector backbone.
  • the bacteria are selected from E. coli, in particular K12-derived E. coli safety strains, such as DH5 alpha, XL- 1 blue or JM109.
  • the vector in step (2) is a phagemid.
  • the phagemid is at least one phagemid, such as two, three, four or more phagemids.
  • Said (at least one) phagemid comprises a plasmid backbone and can optionally comprise further component(s),
  • helper plasmid or a helper phage which comprises further component(s), such as
  • genes encoding the proteins of a bacteriophage e.g. M13 bacteriophage component(s) ensuring propagation of the helper plasmid during cell division,
  • both the (at least one) phagemid and the helper plasmid or the helper phage are introduced into the bacterial cells, preferably via simultaneous transformation.
  • the phagemid is amplified inside the bacterial cells via rolling circle amplification (RCA).
  • RCA rolling circle amplification
  • the rolling circle amplification results in the single stranded form of the phagemid, phagemid ssDNA".
  • Said phagemid ssDNA is in this embodiment the "precursor ssDNA”.
  • Said phagemid ssDNA is preferably packaged into phage-like particles on the cell surface which are preferably secreted from the cells into the surrounding medium.
  • the phage-like particles contain the phagemid ssDNA instead of the normal phage genome.
  • helper plasmid contains the genes encoding the proteins of Ml 3 bacteriophage
  • Ml 3 bacteriophage-like particles are formed which are secreted from the host cells without cell lysis.
  • the precursor ssDNA is isolated from the bacterial culture.
  • the isolation or purification comprises
  • downstream processing of ssDNA can include the following steps: separation of host cells and extracellular produced phage-like particles, PEG- mediated phage precipitation, chemical phage lysis and ssDNA precipitation with ethanol.
  • Said digest is carried out under reaction conditions where the self-cleaving DNA sequences become active.
  • step (4) said digestion of step (4) is triggered by the addition of Zn 2+ ions, i.e. the reaction conditions where the self- cleaving DNA sequences become active require the presence ofZn 2+ ions.
  • the target single stranded DNA oligo- or polynucleotide(s) will be separated, in particular from the self-cleaving DNA sequences which are the by-products of step (4).
  • the method of the present invention comprising the further step of
  • the target single stranded DNA oligo- or polynucleotide(s) can be self- assembled and/or folded into DNA origami structures, tile-based DNA nanostructures, or crystalline DNA nanomaterials.
  • they can be used as aptamers or DNAzymes to bind, detect, or process other molecules.
  • the bacterial culture is carried out in a bioreactor, such as a stirred-tank bioreactor.
  • Such an embodiment allows for the production of target ssDNA molecules in the gram scale. Thus, a mass production of single stranded DNA molecules is possible.
  • the present invention provides the use of the target single stranded DNA oligo- or polynucleotide(s) obtained in the method of the present invention in DNA nanotechnology.
  • the target single stranded DNA oligonucleotide(s) and polynucleotide(s) can be designed to be able to self-assemble into DNA origami structures, i.e. being a scaffold strand and several staple strands.
  • DNA origami structures can be:
  • the present invention provides the use of the target single stranded DNA oligo- or polynucleotide(s) obtained in the method of the present invention as research tools.
  • the present invention provides the use of the target single stranded DNA oligo- or polynucleotide(s) obtained in the method of the present invention as probes for diagnostics.
  • the present invention provides the use of the target single stranded DNA oligo- or polynucleotide(s) obtained in the method of the present invention in gene therapy.
  • the present invention provides the use of the target single stranded DNA oligo- or polynucleotide(s) obtained in the method of the present invention in molecular sensing / as a molecular sensor.
  • the method comprises seven steps, as shown in the flow diagram of Figure 1.
  • a pseudogene is designed or constructed which comprises the DNA nucleotide sequences to be produced in a special conditioned form. This form, which is described in more detail below, is essential for the method of the invention.
  • step (2) the pseudogene is generated via current/established methods of gene synthesis.
  • the pseudogene is integrated into vectors or plasmids and produced as "concatenated precursor ssDNA" in a liquid bacterial (E. coli) culture in a scalable manner (step (3)).
  • the concatenated precursor ssDNA is purified and isolated (step (4)).
  • step (5) the concatenated precursor ssDNA is digested in an autocatalytic manner, wherein said digest is an important feature of the method of the present invention.
  • the target single stranded DNA oligonucleotides which result from said digest are isolated using conventional methods (step (6)).
  • the target single stranded DNA oligonucleotides can then be further processed, such as for the generation of DNA origami structures in greater scale (step (7): downstream applications).
  • the "helper plasmid” contains the genes for the proteins of the Ml 3 bacteriophage and further information (plasmid backbone) which ensure propagation of the helper plasmid into the daughter cells during E. coli cell division.
  • each of the two plasmids needs to be generated via cloning.
  • a conventional gene synthesis needs to be carried out beforehand.
  • the phagemid is amplified (via rolling circle amplification). At the same time, the Ml 3 phage proteins are produced.
  • the single stranded phagemid contains a special packaging sequence through which it is recognized by the phage proteins and packaged to phage particles. Consequently, the cell secretes phage-like particles which contain - instead of the normal phage genome - the single stranded form of the phagemid and, thus, the DNA oligonucleotide sequences to be produced.
  • the phage particles can be isolated from the supernatant after the cells were pelleted.
  • the DNA contained in the phage particles can be purified.
  • the biotechnological process described above is scalable, as is the recombinant production of proteins in bacterial cultures (Kick et ah, 2015).
  • Figure 3 shows the structure of the pseudogene in said special conditioned form, namely the "concatenated precursor ssDNA".
  • the DNA oligonucleotide sequences to be produced axe flanked at both termini by catalytically active DNA sequences ("I-R3"), see Gu et al. (2013).
  • I-R3 catalytically active DNA sequences
  • These DNAzymes have a self-cleaving effect, i.e. said DNAzymes catalyze a backbone hydrolysis (at the positions shown in Figure 3's inset as black arrow heads) after addition of bivalent zinc cations and under suitable reaction conditions.
  • the concatenated precursor ssDNA can, thus, contain many different DNA oligonucleotide sequences.
  • the precursor ssDNA separates or falls into the desired single stranded DNA oligonucleotides and in the catalytic DNAzymes, which are a by-product.
  • the DNAzymes can be separated from the target DNA oligonucleotides, e.g. via chromatography.
  • An essential aspect of the invention is the use of catalytically active DNA sequences produced via directed evolution, i.e. DNAzymes (Gu et al, 2013).
  • Said catalytically active DNA sequences are contained in the concatenated precursor ssDNA and are amplified in the biotechnological process together with the target DNA oligonucleotide sequences.
  • the method presented by Gu et al. produces oligonucleotides of different lengths, but not of arbitrary sequence. Their precursor DNA contains several copies of the same redundant sequence.
  • the method, described herein enables the production of oligonucleotides with arbitrary sequence, as required for the production of DNA origami.
  • Gu et al. use the same terminal sequence and thus the same DNAzyme
  • the method of the present invention uses different DNAzyme sequences for producing different target oligonucleotide sequences.
  • Figure 1 Flow chart showing the biotechnological production of concatenated precursor single strand DNA.
  • Figure 2 Schematic illustration of the helper plasmid-assisted production of helper phagemid single strand DNA.
  • Figure 3 Schematic illustration of a phagemid containing 5 target sequences (bold lines) and (5+l)x2 flanking catalytic DNAzyme sequences (hairpin structures) for the extraction of the target molecules.
  • Figure 4 Production of a DNA origami nanorod using biotechnologically produced single stranded starting materials.
  • Figure 5 Illustration of the autocatalytic digest of the concatenated precursor ssDNA into the desired target DNA oligonucleotides by the contained DNAzyme sequences.
  • A, left Schematic representation of a DNAzyme (Type I-R3). Essential basepairs (as identified in our experiments) are shown as letters, exchangeable basepairs are indicated as lines. The triangle indicates the cleavage position.
  • Right Gel-electrophoretic analysis of the reaction kinetics of two variants of the DNAzyme differing in one basepair. The slower migrating band corresponds to the uncleaved oligonucleotide, the faster migrating band to the reaction product, ⁇ is defined as the first time point at which the intensity of the product band exceeds the intensity of the uncleaved DNAzyme.
  • the upper gel shows the cleavage of the original sequence as described in Gu et al., 2013, whereas the lower gel shows the cleavage of a variant in which a G-C-basepair is replaced by an A-T basepair.
  • This exchange leads to a significantly lower catalytic activity of the DNAzyme, although this basepair was classified as exchangeable in the original publication by Gu et al..
  • B left: Schematic representation of two phagemids containing the staples for the nanorod separated by DNAzymes.
  • Right Gelelectrophoretic analysis of the digestion kinetics of the two phagemids.
  • the lower variant was designed based on the classification of essential bases from the original publication by Gu et al, whereas the upper variant was designed based on our own findings concerning essential bases. While the upper, optimized variant shows fast and complete cleavage (after 40 minutes basically all DNA is in the bands corresponding to the desired products), the lower variant shows incomplete digestion even after 24 hours of incubation.
  • Figure 7 Nanostructures assembled from DNA oligonucleotides produced using the DNAzyme-based method of the invention.
  • A Top left: Schematic representation of a 48-helix-tube assembled from a 3200 bases long scaffold and 31 staple oligonucleotides that are all contained in one phagemid.
  • B Top left: schematic representation of a pointer object assembled from a 7249 bases long M13-scaffold and 161 staple oligonucleotides.
  • a DNA-based nanorod was generated from DNA materials which were exclusively produced by the method of the present invention.
  • the DNA-based nanorod was designed and developed with the DNA origami design method (see Rothemund, 2006; see also US patent applications 2007/117109 Al and 2012/ 251583 Al; US patent Nos. 7,842,793 B2 and 8,501,923 B2) and consists of 10 DNA double helices which are aligned in parallel in a honeycomb lattice and are cross-linked via strand connections (see Figure 4A).
  • scaffold strand For the nanorod a 2500 base long single stranded DNA backbone molecule (“scaffold strand”) is needed as well as 21 DNA oligonucleotides (“staple strands”) each with a length of about 100 bases. All required construction elements are derived from a phagemid which was especially constructed therefor.
  • a phagemid single stranded DNA was produced in an E.coli liquid culture and purified therefrom.
  • chemically competent DH5alpha cells were co- transformed with the phagemid and the helper plasmid.
  • the thus obtained strain was grown in 2xYT-medium containing 50 mg/1 Kanamycin and 100 mg/1 Carbenicillin. After incubation at 37°C overnight, the cultures were centrifuged at 4000 rcf for 30 min. Solid PEG 8000 and NaCl were added to the supernatant to a final concentration of 3% (m/v) each. Phage-like particles were then precipitated by centrifugation at 4000 rcf for 30 min. ssDNA was extracted from these particles as described in Kick et ah, 2015.
  • the phagemid single stranded DNA was then incubated in reaction buffer (50 mM Hepes pH7, 100 mM NaCl, 2 mM ZnCl 2 ) for three hours at 37°C. After the incubation, the DNA is completely digested into the desired segments, see Figure 5. Afterwards, the DNA is precipitated with ethanol and potassium acetate and solved in origami folding buffer (10 mM Tris, 5 mM NaCl, 1 mM EDTA, 20 mM MgCl 2 ). The DNA solution is heated for 15 min to 65°C and then slowly cooled down from 60°C to 40°C (three hours per one °C). Gel electrophoretic analysis (see Figure 4B) and transmission electron microscopy (see Figure 4C) confirm the successful assembly of the target structure.
  • reaction buffer 50 mM Hepes pH7, 100 mM NaCl, 2 mM ZnCl 2
  • origami folding buffer 10 mM Tris, 5 mM Na
  • DNAzyme oligonucleotides (as shown in Figure 6A): G-C (top): SEQ ID NO. 26
  • EXAMPLE 3 Further nanostructures assembled from DNA oligonucleotides produced using the DNAzyme-based method of the invention.
  • Keefe AD Pai S, Ellington A. Aptamers as therapeutics. Nat Rev Drug Discov. 2010 Jul;9(7):537-50. doi: 10.1038/nrd3141.
  • Kick B Praetorius F, Dietz H, Weuster-Botz D. Efficient Production of Single-Stranded Phage DNA as Scaffolds for DNA Origami. Nano Lett. 2015;15(7):4672-6. doi: 10.1021/acs.nanolett.5b01461.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to a method for the recombinant production of DNA single stranded molecules, comprising the steps of (1) providing a pseudogene nucleic acid; (2) integrating the pseudogene nucleic acid into a vector, transforming bacterial cells with said vector and producing a precursor ssDNA from said vector under bacterial culture conditions; (3) isolating the precursor ssDNA from the bacterial culture; (4) digesting the precursor ss DNA under reaction conditions where self-cleaving DNA sequences become active; and (5) separating and obtaining the target single stranded DNA oligo- or polynucleotide(s). The method of the present invention is suitable for the mass production of DNA single stranded molecules. The present invention further relates to the use of the target single stranded DNA oligo- or polynucleotide(s), in particular in DNA nanotechnology, or as research tools.

Description

Scalable biotechnological production of DNA single strand molecules of defined sequence and length
The present invention relates to a method for the recombinant production of DNA single stranded molecules, comprising the steps of (1) providing a pseudogene nucleic acid; (2) integrating the pseudogene nucleic acid into a vector, transforming bacterial cells with said vector and producing a precursor ssDNA from said vector under bacterial culture conditions; (3) isolating the precursor ssDNA from the bacterial culture; (4) digesting the precursor ssDNA under reaction conditions where self-cleaving DNA sequences become active; and (5) separating and obtaining the target single stranded DNA oligo- or polynucleotide(s). The method of the present invention is suitable for the mass production of DNA single stranded molecules. The present invention further relates to the use of the target single stranded DNA oligo- or polynucleotide(s), in particular in DNA nanotechnology, or as research tools.
BACKGROUND OF THE INVENTION
DNA oligonucleotides are needed in the life sciences and medicine for a variety of applications. Oligonucleotides are, for example, required as primers for performing the polymerase chain reaction (PCR) or real-time PCR (RT-PCR) or quantitative PCR (Q-PCR), respectively. In addition, oligonucleotides are needed as starting materials for the synthesis of new genes. The increasing demand for DNA oligonucleotides led to an industry which mainly specializes on the fast production of DNA oligonucleotides of any desired sequence in smallest amounts. DNA oligonucleotides are typically produced base by base in a cyclic chemical synthesis process on a solid phase. This process can be carried out on microscopic beads or in an ink-jet method on a chip surface. Since the base addition reactions do not proceed with 100% efficiency, it is not possible to produce DNA single strands in any length. The yield decreases in an exponential manner with the desired length of the target DNA oligonucleotide. Typically, up to 100 bases long molecules can be produced with a justifiable effort. Some firms offer a (cost-intensive) synthesis of DNA oligonucleotides with a length of up to 200 bases. Furthermore, the synthesis of DNA oligonucleotides is typically limited to the milligram scale, which is sufficient for most of the applications hitherto.
At the moment, new technologies are developed which require single stranded DNA oligonucleotides with user-defined sequence in high amounts (> gram scale) and/or with greater lengths (> 200 base length). This demand cannot be met by the existing processes for the synthesis of DNA oligonucleotides. In particular in the DNA nanotechnology, single stranded DNA oligonucleotides with user-defined sequences are needed in high amounts as "construction material". DNA nanotechnology promises a particular potential for the generation of new drug delivery vehicles and further nanoparticles with potential medical or even chemical/physical relevance (Jones et ah, 2015). However, the starting materials needed (i.e. DNA oligonucleotides) are, at the moment, not available in a scalable manner. Furthermore, catalytically active DNA sequences (DNAzymes) and DNA aptamers attain an increasing interest with respect to applications as diagnostics, in therapy and sensing (Krug et al, 2015; Keefe et al, 2010; Ng et al, 2006; Torabi et al, 2015). For such applications a mass production of DNA oligonucleotides is of great interest.
SUMMARY OF THE INVENTION
According to the present invention this object is solved by a method for the recombinant production of DNA single stranded molecules,
comprising the steps of
(1) providing a pseudogene nucleic acid,
wherein said pseudogene nucleic acid is a nucleic acid that comprises at least one target DNA oligo- or polynucleotide sequence and two self- cleaving DNA sequences flanking each target DNA oligo- or polynucleotide sequence,
(2) integrating the pseudogene nucleic acid into a vector, transforming bacterial cells with said vector and producing a precursor ssDNA from said vector under bacterial culture conditions,
wherein said precursor ssDNA comprises the pseudogene nucleic acid;
(3) isolating the precursor ssDNA from the bacterial culture;
(4) digesting the precursor ssDNA under reaction conditions where the self- cleaving DNA sequences become active; and
(5) separating the target single stranded DNA oligo- or polynucleotide(s) and obtaining the target single stranded DNA oligo- or polynucleotide(s).
According to the present invention this object is solved by using the target single stranded DNA oligo- or polynucleotide(s) obtained in the method of the present invention
- in DNA nanotechnology,
- as research tools,
- as probes for diagnostics
- in gene synthesis,
- in gene therapy,
- in molecular sensing / as molecular sensors.
DESCRIPTION OF THE PREFERRED EMBODIMENTS OF THE INVENTION
Before the present invention is described in more detail below, it is to be understood that this invention is not limited to the particular methodology, protocols and reagents described herein as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art. For the purpose of the present invention, all references cited herein are incorporated by reference in their entireties.
Concentrations, amounts, and other numerical data may be expressed or presented herein in a range format. It is to be understood that such a range format is used merely for convenience and brevity and thus should be interpreted flexibly to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited. As an illustration, a numerical range of "50 to 3,000 nucleotides" should be interpreted to include not only the explicitly recited values of 50 to 3,000, but also include individual values and sub-ranges within the indicated range. Thus, included in this numerical range are individual values such as 50, 51, 52... 2,998, 2,999, 3,000 and sub-ranges such as from 50 to 150, from 100 to 250, from 200 to 500, from 500 to 2,500 etc. This same principle applies to ranges reciting only one numerical value, such as "at least one". Furthermore, such an interpretation should apply regardless of the breadth of the range or the characteristics being described.
Method of producing ssDNA
The present invention provides a method for the recombinant production of DNA single stranded molecules, in particular single stranded DNA oligonucleotides and polypeptides.
Said method comprises the steps of
(1) providing a pseudogene nucleic acid,
wherein said pseudogene nucleic acid is a nucleic acid that comprises at least one target DNA oligo- or polynucleotide sequence and two self-cleaving DNA sequences flanking each target DNA oligo- or polynucleotide sequence;
(2) integrating the pseudogene nucleic acid into a vector, transforming bacterial cells with said vector and producing a precursor ssDNA from said vector under bacterial culture conditions,
wherein said precursor ssDNA comprises the pseudogene nucleic acid;
(3) isolating the precursor ssDNA from the bacterial culture;
(4) digesting the precursor ssDNA under reaction conditions where the self-cleaving DNA sequences become active; and
(5) separating and obtaining the target single stranded DNA oligo- or polynucleotide(s). (1) Design and provision of the pseudogene nucleic acid
The "pseudogene nucleic acid" is a nucleic acid that comprises at least one target DNA oligo- or polynucleotide sequence and two self-cleaving DNA sequences flanking each target DNA oligo- or polynucleotide sequence. Preferably, the pseudogene nucleic acid comprises one or many target DNA oligo- or polynucleotide sequences, such as two, three, four or more than about 50 target DNA oligo- or polynucleotide sequences.
The target DNA oligo- or polynucleotide sequences can be identical or be different, in their sequence as well as in their length.
Preferably, a target DNA oligo- or polynucleotide sequence has a length in the range from about 20 nucleotides to about several thousand nucleotides, covering and exceeding the range in which chemically synthesized oligonucleotides are available.
Preferably, the self-cleaving DNA sequences flanking each of the target DNA oligo- or polynucleotide sequences in the pseudogene nucleic acid are self-cleaving deoxyribozymes or DNAzymes,
such as
- Zn2+-dependent DNAzymes,
e.g. I-R3, and the other variants described in Gu et al, 2013 as well as variants derived from the ones described in Gu et al, 2013.
Deoxyribozymes (also called DNAzymes) are DNA molecules that form structures capable of catalyzing chemical reactions (Breaker, 1997). There are DNAs that catalyze self- processing reactions (Carmi et al, 1996). Such deoxyribozymes can be harnessed to create DNA constructs that become modified based on their inherent catalytic activities when exposed to specific reaction conditions. For example, there are engineered self-cleaving deoxyribozymes that employ oxidation (Carmi et al, 1996), depurination (Sheppard et al, 2000), or hydrolysis (see e.g. Chandra et al, 2009) mechanisms that have been created by using various directed evolution strategies.
Recently, two classes of engineered self-cleaving deoxyribozymes were described that hydrolyze DNA with high speed and sequence specificity (Gu et al, 2013). One such deoxyribozyme, named I-R3 (see Figure 3), carries a small catalytic core composed of 17 nucleotides flanked by either 1 or 2 double stranded substructures. Representatives of this deoxyribozyme class exhibit an observed rate constant (&0bs) for DNA hydrolysis of ~1 muf1 (half-life of ~40 s) when incubated at near neutral pH and in the presence of millimolar concentrations of Zn2+. This deoxyribozyme cleaves the phosphoester bond between the 3' oxygen and the phosphorus center of an ApA linkage to yield a 3' cleavage fragment with a 5' phosphate group.
PI- TAGTTGAGCTGT- P2 - P3 - P2'- ACGTTGAAG - ΡΓ
or
P2'- ACGTTGAAG - PI- P3 - ΡΓ- TAGTTGAGCTGT - P2 wherein TAGTTGAGCTGT is SEQ ID NO. 1 and ACGTTGAAG is SEQ ID NO. 2;
and wherein P3 is a spacer of arbitrary sequence and where PI and PI ' are two
complementary sequences that form a DNA double helix. The same holds true for P2 and P2'.
PI - [SEQ ID NO. 1] - P2 - P3 - P2' - [SEQ ID NO. 2] - PI'
P2'- [SEQ ID NO. 2] - PI- P3 - PI '- [SEQ ID NO. 1] - P2
The self-cleaving DNA sequences used in the present invention (i.e. the self-cleaving desoxyribozymes or DNAzymes) become only active (and catalyze self-cleaving) under defined reaction conditions.
For example, Zn2+-dependent DNAzymes, e.g. I-R3, require the addition of Zn ions.
The pseudogene nucleic acid can be synthesized by conventional/established gene synthesis methods.
For example, it can be ordered and synthesized by a commercial vendor. (2) Production of precursor ssDNA in bacterial culture
In step (2), the pseudogene nucleic acid is integrated into a vector. Said vector is introduced into bacterial cells via transformation and a precursor ssDNA is produced from said vector under bacterial culture conditions.
In some embodiments, the vector is at least one vector, such as two, three, four or more vectors.
The "precursor single stranded DNA" or "precursor ssDNA" comprises the pseudogene nucleic acid in single stranded form and the vector backbone. Preferably, the bacteria are selected from E. coli, in particular K12-derived E. coli safety strains, such as DH5 alpha, XL- 1 blue or JM109.
In a preferred embodiment, the vector in step (2) is a phagemid.
In some embodiments, the phagemid is at least one phagemid, such as two, three, four or more phagemids.
Said (at least one) phagemid comprises a plasmid backbone and can optionally comprise further component(s),
such as
- a packaging sequence,
- components) ensuring propagation of the phagemid during cell division, a selection marker,
typically an antibiotic resistance gene.
In said embodiment, furthermore a helper plasmid or a helper phage is used which comprises further component(s), such as
genes encoding the proteins of a bacteriophage, e.g. M13 bacteriophage component(s) ensuring propagation of the helper plasmid during cell division,
- a selection marker,
typically an antibiotic resistance gene.
In this embodiment, both the (at least one) phagemid and the helper plasmid or the helper phage are introduced into the bacterial cells, preferably via simultaneous transformation.
In this embodiment, where the vector is a phagemid (and which also uses a helper plasmid), the phagemid is amplified inside the bacterial cells via rolling circle amplification (RCA). The same applies for embodiments utilizing more than one phagemid.
The rolling circle amplification (RCA) results in the single stranded form of the phagemid, phagemid ssDNA". Said phagemid ssDNA is in this embodiment the "precursor ssDNA". Said phagemid ssDNA is preferably packaged into phage-like particles on the cell surface which are preferably secreted from the cells into the surrounding medium.
The phage-like particles contain the phagemid ssDNA instead of the normal phage genome.
For example, in an embodiment where the helper plasmid contains the genes encoding the proteins of Ml 3 bacteriophage, Ml 3 bacteriophage-like particles are formed which are secreted from the host cells without cell lysis.
(3) Obtaining the precursor ssDNA from the bacterial culture
The precursor ssDNA is isolated from the bacterial culture.
Said isolation or purification can be carried out by using conventional/established methods known in the art,
such as centrifugation, precipitation, solvent-based extraction, chromatographic methods, or combinations thereof.
In one embodiment, where (at least one) phagemid and a helper plasmid are utilized, the isolation or purification comprises
- extracting the phage-like particles from the cell culture, preferably from the culture supernatant,
such as via pelleting the cells and removing/extracting the phage-like particles from the supernatant, such as by precipitation (e.g. using PEG)
- extracting the phagemid ssDNA from the phage-like particles,
such as via chemical lysis of the protein coat and ethanol precipitation of the ssDNA.
For example, downstream processing of ssDNA can include the following steps: separation of host cells and extracellular produced phage-like particles, PEG- mediated phage precipitation, chemical phage lysis and ssDNA precipitation with ethanol.
See e.g. Kick et al., 2015.
(4) Autocatalytic digest of the precursor ssDNA The isolated precursor ssDNA is then digested, in an autocatalytic-manner, i.e. the self- cleaving DNA sequences will cleave the precursor ssDNA.
Said digest is carried out under reaction conditions where the self-cleaving DNA sequences become active.
In one embodiment, where Zn2+-dependent DNAzymes, e.g. I-R3, are utilized, said digestion of step (4) is triggered by the addition of Zn2+ ions, i.e. the reaction conditions where the self- cleaving DNA sequences become active require the presence ofZn2+ ions.
(5) Obtaining the target single stranded DNA molecule (s)
Next, the target single stranded DNA oligo- or polynucleotide(s) will be separated, in particular from the self-cleaving DNA sequences which are the by-products of step (4).
Said separation or purification can be carried out by using conventional/established methods known in the art,
such as
precipitation, e.g. with ethanol and potassium acetate, or with polyethylene glycol, chromatography,
or combinations thereof.
Finally, the target single stranded DNA oligo- or polynucleotide(s) are obtained.
(6) Further steps
In one embodiment, the method of the present invention, comprising the further step of
(6) further processing of the target single stranded DNA oligo- or polynucleotide(s) .
For example, the target single stranded DNA oligo- or polynucleotide(s) can be self- assembled and/or folded into DNA origami structures, tile-based DNA nanostructures, or crystalline DNA nanomaterials. Alternatively, they can be used as aptamers or DNAzymes to bind, detect, or process other molecules. - Mass production of ssDNA molecules
In one embodiment, the bacterial culture is carried out in a bioreactor, such as a stirred-tank bioreactor.
Such an embodiment allows for the production of target ssDNA molecules in the gram scale. Thus, a mass production of single stranded DNA molecules is possible.
Uses of the ssDNA molecules obtained
The present invention provides the use of the target single stranded DNA oligo- or polynucleotide(s) obtained in the method of the present invention in DNA nanotechnology.
For example, the target single stranded DNA oligonucleotide(s) and polynucleotide(s) can be designed to be able to self-assemble into DNA origami structures, i.e. being a scaffold strand and several staple strands.
DNA origami structures can be:
DNA nanorods,
such as described in Example 1 herein;
DNA nanopores,
such as described in European patent application No. 2 695 949;
DNA helix tubes
such as described in Example 3 herein;
DNA pointer objects,
such as described in Example 3 herein or in Bai et al, 2012;
therapeutically active DNA nanostructures or drug delivery vehicles,
positioning devices,
Nanosensors
The present invention provides the use of the target single stranded DNA oligo- or polynucleotide(s) obtained in the method of the present invention as research tools.
The present invention provides the use of the target single stranded DNA oligo- or polynucleotide(s) obtained in the method of the present invention as probes for diagnostics. The present invention provides the use of the target single stranded DNA oligo- or polynucleotide(s) obtained in the method of the present invention in gene therapy.
The present invention provides the use of the target single stranded DNA oligo- or polynucleotide(s) obtained in the method of the present invention in molecular sensing / as a molecular sensor.
Further description of preferred embodiments
We present a biotechnological method for the recombinant production of single stranded DNA oligonucleotides in bacteria. With said method, single stranded DNA molecules with a length of up to several thousand bases can be produced in any scalable amount. Due to this method, a mass production of DNA-based nanostructures becomes practically possible.
The method comprises seven steps, as shown in the flow diagram of Figure 1.
In step (1), a pseudogene is designed or constructed which comprises the DNA nucleotide sequences to be produced in a special conditioned form. This form, which is described in more detail below, is essential for the method of the invention.
In step (2), the pseudogene is generated via current/established methods of gene synthesis.
Next, the pseudogene is integrated into vectors or plasmids and produced as "concatenated precursor ssDNA" in a liquid bacterial (E. coli) culture in a scalable manner (step (3)).
Then, the concatenated precursor ssDNA is purified and isolated (step (4)).
In step (5), the concatenated precursor ssDNA is digested in an autocatalytic manner, wherein said digest is an important feature of the method of the present invention.
The target single stranded DNA oligonucleotides which result from said digest are isolated using conventional methods (step (6)). The target single stranded DNA oligonucleotides can then be further processed, such as for the generation of DNA origami structures in greater scale (step (7): downstream applications).
- Biotechnological production of concatenated precursor ssDNA
Two DNA plasmids are introduced into E. coli cells via simultaneous transformation (Figure 2). The "helper plasmid" contains the genes for the proteins of the Ml 3 bacteriophage and further information (plasmid backbone) which ensure propagation of the helper plasmid into the daughter cells during E. coli cell division. The "phagemid" (=phage-plasmid) contains the DNA oligonucleotide sequences to be produced in a special conditioned form ("concatenated precursor ssDNA") and further information which, among other things, ensure propagation of the phagemid during cell division.
At first, each of the two plasmids needs to be generated via cloning. For generating the phagemid with the concatenated precursor ssDNA, a conventional gene synthesis needs to be carried out beforehand.
Inside the cell, the phagemid is amplified (via rolling circle amplification). At the same time, the Ml 3 phage proteins are produced.
The single stranded phagemid contains a special packaging sequence through which it is recognized by the phage proteins and packaged to phage particles. Consequently, the cell secretes phage-like particles which contain - instead of the normal phage genome - the single stranded form of the phagemid and, thus, the DNA oligonucleotide sequences to be produced.
The phage particles can be isolated from the supernatant after the cells were pelleted. The DNA contained in the phage particles can be purified.
The biotechnological process described above is scalable, as is the recombinant production of proteins in bacterial cultures (Kick et ah, 2015).
- Further processing of the concatenated precursor ssDNA
Figure 3 shows the structure of the pseudogene in said special conditioned form, namely the "concatenated precursor ssDNA". The DNA oligonucleotide sequences to be produced axe flanked at both termini by catalytically active DNA sequences ("I-R3"), see Gu et al. (2013). These DNAzymes have a self-cleaving effect, i.e. said DNAzymes catalyze a backbone hydrolysis (at the positions shown in Figure 3's inset as black arrow heads) after addition of bivalent zinc cations and under suitable reaction conditions.
The concatenated precursor ssDNA can, thus, contain many different DNA oligonucleotide sequences.
After purification of the precursor ssDNA the catalysis can be started by adding zinc ("cleavage").
Due to the cleavage, the precursor ssDNA separates or falls into the desired single stranded DNA oligonucleotides and in the catalytic DNAzymes, which are a by-product. The DNAzymes can be separated from the target DNA oligonucleotides, e.g. via chromatography.
- Advantages of the method of the present invention
Methods for the biotechnological production of single stranded phagemid DNA with helper plasmids (Marchi et al, 2014) or enzymes (Schmidt et al, 2015) have been described in the art. Furthermore, methods containing digesting long circular ssDNA with the help of restriction endonucleases at user-defined sequences have been described in the art (Ducani et al, 2013).
In the method described by Ducani et al. (2013), protein-based restriction nucleases are utilized and, thus, required as additional reagents. These enzymes need to be either purchased or produced in a separate biotechnological process. Furthermore, in the method described by Ducani et al., all staple oligonucleotides are purified using preparative gel electrophoresis, which is tedious and does not scale. In the method, described herein, no further cost intensive or labor intensive reagents are needed for the digest, since all components required for generating the target DNA oligonucleotide sequences are already contained in the combined system of helper plasmid phagemid with pseudogene.
An essential aspect of the invention is the use of catalytically active DNA sequences produced via directed evolution, i.e. DNAzymes (Gu et al, 2013). Said catalytically active DNA sequences are contained in the concatenated precursor ssDNA and are amplified in the biotechnological process together with the target DNA oligonucleotide sequences. The method presented by Gu et al. produces oligonucleotides of different lengths, but not of arbitrary sequence. Their precursor DNA contains several copies of the same redundant sequence. The method, described herein, enables the production of oligonucleotides with arbitrary sequence, as required for the production of DNA origami. Furthermore, while Gu et al. use the same terminal sequence and thus the same DNAzyme, the method of the present invention uses different DNAzyme sequences for producing different target oligonucleotide sequences.
The following examples and drawings illustrate the present invention without, however, limiting the same thereto.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1: Flow chart showing the biotechnological production of concatenated precursor single strand DNA.
Figure 2: Schematic illustration of the helper plasmid-assisted production of helper phagemid single strand DNA.
Figure 3: Schematic illustration of a phagemid containing 5 target sequences (bold lines) and (5+l)x2 flanking catalytic DNAzyme sequences (hairpin structures) for the extraction of the target molecules.
Figure 4: Production of a DNA origami nanorod using biotechnologically produced single stranded starting materials.
A, Schematic representation of the phagemid (left) and the internal strand topology of the DNA nanorod.
B, View of an agarose gel on which the products of a self-assembly of a 10-helix bundle using staple oligonucleotides produced via chemical solid phase synthesis (left) are compared with the use of staple oligonucleotides produced by the method of the invention (right). Both samples show comparable migration properties which implies a comparable assembly quality. C, Transmission electron microscopy picture of nanorods whose staple oligonucleotides were produced by the method of the invention.
Figure 5: Illustration of the autocatalytic digest of the concatenated precursor ssDNA into the desired target DNA oligonucleotides by the contained DNAzyme sequences.
Shown is a view of the agarose gel on which the products of the digest reaction of the concatenated precursor ssDNA were electrophoretically separated as function of the incubation time.
Figure 6: Optimization of DNAzyme sequences.
A, left: Schematic representation of a DNAzyme (Type I-R3). Essential basepairs (as identified in our experiments) are shown as letters, exchangeable basepairs are indicated as lines. The triangle indicates the cleavage position. Right: Gel-electrophoretic analysis of the reaction kinetics of two variants of the DNAzyme differing in one basepair. The slower migrating band corresponds to the uncleaved oligonucleotide, the faster migrating band to the reaction product, τ is defined as the first time point at which the intensity of the product band exceeds the intensity of the uncleaved DNAzyme. The upper gel shows the cleavage of the original sequence as described in Gu et al., 2013, whereas the lower gel shows the cleavage of a variant in which a G-C-basepair is replaced by an A-T basepair. This exchange leads to a significantly lower catalytic activity of the DNAzyme, although this basepair was classified as exchangeable in the original publication by Gu et al..
B, left: Schematic representation of two phagemids containing the staples for the nanorod separated by DNAzymes. Right: Gelelectrophoretic analysis of the digestion kinetics of the two phagemids. The lower variant was designed based on the classification of essential bases from the original publication by Gu et al, whereas the upper variant was designed based on our own findings concerning essential bases. While the upper, optimized variant shows fast and complete cleavage (after 40 minutes basically all DNA is in the bands corresponding to the desired products), the lower variant shows incomplete digestion even after 24 hours of incubation.
Figure 7: Nanostructures assembled from DNA oligonucleotides produced using the DNAzyme-based method of the invention.
A, Top left: Schematic representation of a 48-helix-tube assembled from a 3200 bases long scaffold and 31 staple oligonucleotides that are all contained in one phagemid. Bottom left: Image of an agarose gel in which the undigested phagemid (left), the digested phagemid (center) and the folded 48-helix tube (right) have been electrophoresed. Right: Negative stain transmission electron micrograph (bottom) and class averages (top) of the 48-helix-tube. B, Top left: schematic representation of a pointer object assembled from a 7249 bases long M13-scaffold and 161 staple oligonucleotides. Bottom left: Image of an agarose gel in which the scaffold (left) and structures assembled using chemically synthesized (center) or biotechnologically produced (right) staples have been electrophoresed. Right: Negative stain transmission electron micrograph and class average (inset) of the pointer object.
EXAMPLES
EXAMPLE 1 Generation of a DNA-based nanorod
As a prototype, a DNA-based nanorod was generated from DNA materials which were exclusively produced by the method of the present invention. The DNA-based nanorod was designed and developed with the DNA origami design method (see Rothemund, 2006; see also US patent applications 2007/117109 Al and 2012/ 251583 Al; US patent Nos. 7,842,793 B2 and 8,501,923 B2) and consists of 10 DNA double helices which are aligned in parallel in a honeycomb lattice and are cross-linked via strand connections (see Figure 4A). For the nanorod a 2500 base long single stranded DNA backbone molecule ("scaffold strand") is needed as well as 21 DNA oligonucleotides ("staple strands") each with a length of about 100 bases. All required construction elements are derived from a phagemid which was especially constructed therefor.
1.1 Materials & Methods
- Sequences:
DNAzymes:
PI - [SEQ ID NO. 1] - P2 - P3 - P2' - [SEQ ID NO. 2] - PI '
P2'- [SEQ ID NO. 2] - PI- P3 - PI '- [SEQ ID NO. 1] - P2
Wherein is SEQ ID NO. 1 = TAGTTGAGCTGT and is SEQ ID NO. 2 = ACGTTGAAG;
and wherein P3 is a spacer of arbitrary sequence and where PI and Ρ are two
complementary sequences that form a DNA double helix. The same holds true for P2 and P2'. 21 oligonucleotides, each with a length of about 100 bases:
SEQ ID NO. 3:
TACTCTTAGAAGTGTCCCAACTACACTAGAAGGACAGTGGCGAGAGGATTACGCGCCTAGAT CAACTTTAATGTTGACTCGTGCACCCAACATGCTTTTTAGCTC
SEQ ID NO. 4:
GCACATTGAGGGCTGCTATTAAGACACGACTTATCCCTTTCTCAAAAGGCCAGCAAAGCGAT CTGGCCCCAATAGGGGAACAAGAGGCAGAACATATCAAAGCGA
SEQ ID NO. 5:
CTTACCGAGAATAGACACCCGCCTTACAGCGAGGCGAAGGGCTTTAAATCAATCTAGAGCAT CATACCAGGCGTTTCGTTCTTGGCGCCGCAACCACCTGTATGC
SEQ ID NO. 6:
TAGACCGCGAAAAATGACGGGGAAAGCCTGGCGAATAACTACGTTGCCTGACTCCCGGGGAT ATTCTCATAGCTCACTAACTATTGTGCTGTAGAGCTCCGTCTA
SEQ ID NO. 7:
GGCGACCAAACTCTCAGGGTTATTGTCTGATTTATCGCGTCCGGCGGTGCTACAGACCCCTG GTCCGCCCC C CT GACAAGT AT AAAAC C AGC AT T TAT C AAGGAT
SEQ ID NO. 8:
TCAGGGCATAAATCGCGTTAATATTTTGCGCGGGGATTAAGTTGCGCCTTATCCGGGCTGTA GT AT C CACAGAAT CAC GC GT AT GT T T GT C AT T GT AAAAAAGAA
SEQ ID NO. 9:
CTTCGGTGTTTGGTCCATCCAAAAAGGATCTTCACAGAAAAATGTTTGCAAGCAGCAGTATT TCATTCAGAAAGCGGTCTGTGACTGGTGATAACCCAATACTCA
SEQ ID NO. 10:
AAGGAGCGGGAAGGCAATGATGAGGCACCTATCTCAAGGCCACGGATACCTGTCCGGCCACT GGTGCGGGAGGGAAGCACTATTAAAGAACCAGTTTGGTTCCGC
SEQ ID NO. 11 :
CTACAGGAAGTTGGCTGCATAATTCTCTTTCACCAAATGCCGCAAAAAAAATTGTTGTGTCA CCCAGTTACCTTCGGAAACCACTGATCTTTTCTACGTTAAGGGAGCTAGA
SEQ ID NO. 12:
AGAGGCGTGGGCGCTCTTCCGATACGGTGTATCTCAGTTCGGCGACCGCTGGGTAACCCTAA ACACTACGTGAACCACCGAAATTCGCGTT
SEQ ID NO. 13:
TCATGAGGATCCTTCGCTGGTAGCGGTGGCTGAAGGCTCGTCCCTCCGAATGCCATCCGTAA GTGATCTTAGGGCGACACGGAATCCGCCTATGGCTTGGTATCT
SEQ ID NO. 14:
AAACTTGCATAGGCAAGCTCCCTCGTGCGTATGTACATTCGCTGTAGCGTCTTGCCCGGCGT CGGAAAACGGATACATATTTGAGACCCACGCTGCGCATTAGCA
SEQ ID NO. 15:
TTCGTTCATGTGAGCCCTTCGGGAAGCGCCCGGTACGCCAGCGGCGAACCCAACGTCAAAGG
Figure imgf000019_0001
Figure imgf000020_0001
Figure imgf000021_0001
2. E. coli culture conditions
In this example, a phagemid single stranded DNA was produced in an E.coli liquid culture and purified therefrom. To this end, chemically competent DH5alpha cells were co- transformed with the phagemid and the helper plasmid. The thus obtained strain was grown in 2xYT-medium containing 50 mg/1 Kanamycin and 100 mg/1 Carbenicillin. After incubation at 37°C overnight, the cultures were centrifuged at 4000 rcf for 30 min. Solid PEG 8000 and NaCl were added to the supernatant to a final concentration of 3% (m/v) each. Phage-like particles were then precipitated by centrifugation at 4000 rcf for 30 min. ssDNA was extracted from these particles as described in Kick et ah, 2015.
3. Digest and assembly of the target structure
The phagemid single stranded DNA was then incubated in reaction buffer (50 mM Hepes pH7, 100 mM NaCl, 2 mM ZnCl2) for three hours at 37°C. After the incubation, the DNA is completely digested into the desired segments, see Figure 5. Afterwards, the DNA is precipitated with ethanol and potassium acetate and solved in origami folding buffer (10 mM Tris, 5 mM NaCl, 1 mM EDTA, 20 mM MgCl2). The DNA solution is heated for 15 min to 65°C and then slowly cooled down from 60°C to 40°C (three hours per one °C). Gel electrophoretic analysis (see Figure 4B) and transmission electron microscopy (see Figure 4C) confirm the successful assembly of the target structure.
EXAMPLE 2 Optimization of DNAzyme sequences
In order to construct our phagemids, we do not simply place a constant DNAzyme sequence between the target oligonucleotides in the same way a restriction enzyme binding site would be inserted. The sequence of the DNAzyme depends on the terminal sequences of the oligonucleotides that are to be produced. While Gu et al. (Biotechniques 2013) simply use the same terminal sequence and thus the same DNAzyme, our method uses different DNAzyme sequences for producing different target oligonucleotide sequences.
In order to identify the essential bases in the DNAzyme sequence we screened about 40 different variants of individual DNAzymes as oligonucleotides (see Figure 6A for two examples) and 5 versions of the Full-length phagemid (see Figure 6B for two examples). We find that some bases that are not classified as essential in the original publication of the DNAzyme (Gu et al, JACS 2013) are indeed essential. This allowed us to construct phagemids that cleaved completely into the desired products in acceptable times (see Figure 6B).
DNAzyme oligonucleotides (as shown in Figure 6A): G-C (top): SEQ ID NO. 26
TTTTTTGCCCTGATAGTTGAGCTGTCACAGAATGTGACGTTGAAGTCAGGGCATAAAT A-T (bottom): SEQ ID NO. 27
TTTTTTGCCCTGATAGTTGAGCTaTCACAGAATGTGAtGTTGAAGTCAGGGCATAAAT
Phagemids (as shown in Figure 6B):
Optimized version (top): SEQ ID NO. 28
Figure imgf000022_0001
Figure imgf000023_0001
Figure imgf000024_0001
gg g g g tggtaac gtc g g cat ta c
EXAMPLE 3 Further nanostructures assembled from DNA oligonucleotides produced using the DNAzyme-based method of the invention.
In addition to the nanorod, we designed a 48-helix tube that assembles from a 3200 bases long scaffold and 31 staple oligonucleotides (see Figure 7A). As for the nanorod, all staples for this 48 -helix-tube are encoded on one phagemid, and the backbone of the phagemid serves as scaffold. Like the nanorod, this object assembles efficiently into the desired shape without using an excess of staples over scaffold, due to the intrinsically perfect 1 : 1 stoichiometry.
In order to demonstrate the applicability of our method to the assembly of existing, full-size DNA origami objects, we produced phagemids encoding for all 161 staple oligonucleotides that are needed for the assembly of a pointer object (see Figure 7B) that was previously used in cryo electron microscopy studies (Bai et al, 2012). In contrast to the nanorod and the 48- helix-bundle, the staples for the pointer are distributed over four individual phagemids, and a separate scaffold (M13mpl8, 7249 bases long, same sequence as was used in the original study by Bai et al.) is used. To compensate uncertainties in relative concentrations we used a slight excess of staples over scaffold (1.25 to 1). In comparison, the assembly using the chemically synthesized staples required a larger excess of 2.5 to 1.
Phagemid sequences
48hclix tube (Figure 7A): SEQ ID NO. 30
Figure imgf000025_0001
Figure imgf000026_0001
Figure imgf000027_0001
Figure imgf000028_0001
Figure imgf000029_0001
Figure imgf000030_0001
The features disclosed in the foregoing description, in the claims and/or in the accompanying drawings may, both separately and in any combination thereof, be material for realizing the invention in diverse forms thereof.
REFERENCES
Bai X, Martin T, Scheres S, and Dietz H. Cryo-EM structure of a 3D DNA-origami object. P Natl Acad Sci USA, vol 109 (2012), 20012.
Breaker RR. DNA enzymes. Nat Biotechnol. 1997;15(5):427-31.
Carmi N, Shultz LA, Breaker RR. In vitro selection of self-cleaving DNAs. Chem Biol. 1996;3(12):1039-46.
Chandra M, Sachdeva A, Silverman SK. DNA-catalyzed sequence-specific hydrolysis of DNA. Nat Chem Biol. 2009;5(10):718-20. doi: 10.1038/nchembio.201.
Ducani C, Kaul C, Moche M, Shih WM, Hogberg B. Enzymatic production of 'monoclonal stoichiometric' single-stranded DNA oligonucleotides. Nat Methods. 2013;10(7):647-52. doi: 10.1038/nmeth.2503.
Gu H, Furukawa K, Weinberg Z, Berenson DF, Breaker RR Small, highly active DNAs that hydrolyze DNA. J Am Chem Soc. 2013;135(24):9121-9. doi: 10.1021/ja403585e.
Gu H, Breaker RR. Production of single-stranded DNAs by self-cleavage of rolling-circle amplification products. Biotechniques. 2013;54(6):337-43. doi: 10.2144/000114009.
Jones MR, Seeman NC, Mirkin CA. Nanomaterials. Programmable materials and the nature of the DNA bond. Science 2015;347(6224):1260901. doi: 10.1126/science.1260901.
Keefe AD, Pai S, Ellington A. Aptamers as therapeutics. Nat Rev Drug Discov. 2010 Jul;9(7):537-50. doi: 10.1038/nrd3141. Kick B, Praetorius F, Dietz H, Weuster-Botz D. Efficient Production of Single-Stranded Phage DNA as Scaffolds for DNA Origami. Nano Lett. 2015;15(7):4672-6. doi: 10.1021/acs.nanolett.5b01461.
Krug N, Hohlfeld JM, Kirsten AM, Kornmann O, Beeh KM, Kappeler D, Korn S, Ignatenko S, Timmer W, Rogon C, Zeitvogel J, Zhang N, Bille J, Homburg U, Turowska A, Bachert C, Werfel T, Buhl R, Renz J, Garn H, Renz H. Allergen-induced asthmatic responses modified by a GATA3-specific DNAzyme. N Engl J Med. 2015;372(21): 1987-95. doi: 10.1056/NEJMoal411776.
Marchi AN, Saaem I, Vogen BN, Brown S, LaBean TH. Toward larger DNA origami. Nano Lett. 2014;14(10):5740-7. doi: 10.1021/nl502626s.
Ng EW, Shima DT, Calias P, Cunningham ET Jr, Guyer DR, Adamis AP. Pegaptanib, a targeted anti-VEGF aptamer for ocular vascular disease. Nat Rev Drug Discov. 2006;5(2): 123-32.
Rothemund PW. Folding DNA to create nanoscale shapes and patterns. Nature. 2006;440(7082):297-302.
Schmidt TL, Beliveau BJ, Uca YO, Theilmann M, Da Cruz F, Wu CT, Shih WM. Scalable amplification of strand subsets from chip-synthesized oligonucleotide libraries. Nat Commun. 2015;6:8634. doi: 10.1038/ncomms9634.
Sheppard TL, Ordoukhanian P, Joyce GF. A DNA enzyme with N-glycosylase activity. Proc NatlAcadSci USA. 2000;97(14):7802-7.
Torabi SF, Wu P, McGhee CE, Chen L, Hwang K, Zheng N, Cheng J, Lu Y. In vitro selection of a sodium-specific DNAzyme and its application in intracellular sensing. Proc Natl Acad Sci USA. 2015;112(19):5903-8. doi: 10.1073/pnas.l420361112.

Claims

Claims
1. A method for the recombinant production of DNA single strand molecules, comprising the steps of
(1) providing a pseudogene nucleic acid,
wherein said pseudogene nucleic acid is a nucleic acid that comprises at least one target DNA oligo- or polynucleotide sequence and two self- cleaving DNA sequences flanking each target DNA oligo- or polynucleotide sequence,
(2) integrating the pseudogene nucleic acid into a vector, transforming bacterial cells with said vector and producing a precursor ssDNA from said vector under bacterial culture conditions,
wherein said precursor ssDNA comprises the pseudogene nucleic acid;
(3) isolating the precursor ssDNA from the bacterial culture;
(4) digesting the precursor ssDNA under reaction conditions where the self- cleaving DNA sequences become active;
and
(5) separating the target single stranded DNA oligo- or polynucleotide(s) and obtaining the target single stranded DNA oligo- or polynucleotide(s).
2. The method of claim 1, wherein the self -cleaving DNA sequences are self-cleaving desoxyribozymes or DNAzymes,
such as Zn2+-dependent DNAzymes, e.g. I-R3.
3. The method of claim 1 or 2, wherein the pseudogene nucleic acid comprises two, three, four or more than about 50 target DNA oligonucleotide sequences.
4. The method of any one of claims 1 to 3, wherein a target DNA oligo- or polynucleotide sequence has a length in the range from about 20 nucleotides to about several thousand nucleotides.
5. The method of any one of claims 1 to 4, wherein the bacteria are selected from E. coli, in particular K12-derived E. coli safety strains, such as DH5alpha, XL-lblue or JM109.
6. The method of any one of claims 1 to 5, wherein the vector in step (2) is at least one phagemid, optionally comprising further component(s),
such as
a packaging sequence,
component(s) ensuring propagation of the phagemid during cell division, a selection marker,
typically an antibiotic resistance gene.
7. The method of claim 6, wherein furthermore a helper plasmid or a helper phage is used which comprises further component(s), such as
genes encoding the proteins of a bacteriophage, e.g. M13 bacteriophage component(s) ensuring propagation of the helper plasmid during cell division,
a selection marker,
typically an antibiotic resistance gene.
8. The method of any one of the preceding claims, wherein the vector in step (2) is at least one phagemid and is amplified inside the bacterial cells via rolling circle amplification (RCA) resulting in phagemid ssDNA.
9. The method of claim 8, wherein the phagemid ssDNA is packaged into phage-like particles which are preferably secreted from the cells.
10. The method of any one of claims 6 to 9, wherein step (3) comprises extracting the phage-like particles from the cell culture and extracting the phagemid ssDNA from the phage- like particles.
11. The method of any one of the preceding claims, wherein said digestion of step (4) is triggered by the addition of Zn2+ ions.
12. The method of any one of the preceding claims, wherein separating the target single stranded DNA oligo- or polynucleotide(s) in step (5) comprises
separating from the self-cleaving DNA sequences, such as DNAzymes, e.g. via chromatography.
13. The method of any one of the preceding claims, comprising the further step of
(6) further processing of the target single stranded DNA oligo- or polynucleotide(s),
such as self-assembly and/or folding into DNA origami structures, tile-based
DNA nanostructures, or crystalline DNA nanomaterials,
or the use as aptamers or DNAzymes to bind, detect, or process other molecules.
14. The method of any one of the preceding claims, wherein the bacterial culture is carried out in a bioreactor, such as a stirred-tank bioreactor.
15. Use of the target single stranded DNA oligo- or polynucleotide(s) obtained in the method of any one of the preceding claims
- in DNA nanotechnology,
- as research tools,
- as probes for diagnostics,
- in gene synthesis,
- in gene therapy,
- in molecular sensing.
PCT/EP2017/068051 2016-09-21 2017-07-17 Scalable biotechnological production of dna single strand molecules of defined sequence and length Ceased WO2018054571A1 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
EP17746416.1A EP3516055B1 (en) 2016-09-21 2017-07-17 Scalable biotechnological production of dna single strand molecules of defined sequence and length
KR1020197008132A KR102528337B1 (en) 2016-09-21 2017-07-17 Scalable biotechnological production of DNA single-stranded molecules of defined sequence and length
JP2019515435A JP7099724B2 (en) 2016-09-21 2017-07-17 Expandable bioengineering of DNA single-stranded molecules of defined sequence and length
CN201780058442.3A CN109844113B (en) 2016-09-21 2017-07-17 Scalable biotechnological production of sequence- and length-defined DNA single-stranded molecules
US16/329,495 US11913050B2 (en) 2016-09-21 2017-07-17 Scalable biotechnological production of DNA single strand molecules of defined sequence and length
DK17746416.1T DK3516055T3 (en) 2016-09-21 2017-07-17 SCALABLE BIOTECHNOLOGICAL PRODUCTION OF SINGLE STRANDED DNA MOLECULES WITH DEFINED SEQUENCE AND LENGTH
ES17746416T ES2909073T3 (en) 2016-09-21 2017-07-17 Scalable biotechnological production of single-stranded DNA molecules of defined sequence and length
PL17746416T PL3516055T3 (en) 2016-09-21 2017-07-17 Scalable biotechnological production of dna single strand molecules of defined sequence and length

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP16189976.0 2016-09-21
EP16189976 2016-09-21

Publications (1)

Publication Number Publication Date
WO2018054571A1 true WO2018054571A1 (en) 2018-03-29

Family

ID=57083098

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2017/068051 Ceased WO2018054571A1 (en) 2016-09-21 2017-07-17 Scalable biotechnological production of dna single strand molecules of defined sequence and length

Country Status (9)

Country Link
US (1) US11913050B2 (en)
EP (1) EP3516055B1 (en)
JP (1) JP7099724B2 (en)
KR (1) KR102528337B1 (en)
CN (1) CN109844113B (en)
DK (1) DK3516055T3 (en)
ES (1) ES2909073T3 (en)
PL (1) PL3516055T3 (en)
WO (1) WO2018054571A1 (en)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108707601A (en) * 2018-06-07 2018-10-26 南京大学 A kind of preparation method for the single-stranded cyclic DNA that sequence and length customize and its application in DNA paper folding arts
WO2020107560A1 (en) * 2018-11-28 2020-06-04 上海纳米技术及应用国家工程研究中心有限公司 Method for detecting micrornas based on rolling circle amplification and dna origami
US11513076B2 (en) 2016-06-15 2022-11-29 Ludwig-Maximilians-Universität München Single molecule detection or quantification using DNA nanotechnology
EP4450637A1 (en) 2023-04-21 2024-10-23 Technische Universität München Novel self-cleaving dnazymes and selection process
EP4455302A1 (en) 2023-04-25 2024-10-30 Technische Universität München Programmable nuclease resistance of nucleic acid assemblies
EP4663200A1 (en) 2024-06-10 2025-12-17 CPTx GmbH Compositions and methods
EP4674984A1 (en) 2024-07-04 2026-01-07 CPTx GmbH Compositions
WO2026008787A1 (en) 2024-07-04 2026-01-08 Cptx Gmbh Compositions

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017189914A1 (en) 2016-04-27 2017-11-02 Massachusetts Institute Of Technology Sequence-controlled polymer random access memory storage
WO2017189870A1 (en) 2016-04-27 2017-11-02 Massachusetts Institute Of Technology Stable nanoscale nucleic acid assemblies and methods thereof
US10940171B2 (en) 2017-11-10 2021-03-09 Massachusetts Institute Of Technology Microbial production of pure single stranded nucleic acids
WO2020154595A1 (en) 2019-01-24 2020-07-30 Massachusetts Institute Of Technology Nucleic acid nanostructure platform for antigen presentation and vaccine formulations formed therefrom
US11905532B2 (en) 2019-06-25 2024-02-20 Massachusetts Institute Of Technology Compositions and methods for molecular memory storage and retrieval
CN110699407B (en) * 2019-10-17 2023-08-01 复旦大学附属肿瘤医院 A kind of preparation method of long single-stranded DNA
EP4330388A1 (en) 2021-04-26 2024-03-06 Camena Bioscience Limited Compositions and methods for phosphoramedite-free enzymatic synthesis of nucleic acids
WO2024220771A1 (en) * 2023-04-21 2024-10-24 Ohio State Innovation Foundation Rapid enzyme-free release of single-stranded dna from unmodified dsdna templates
CN117143897B (en) * 2023-09-07 2025-05-16 华东理工大学 A method for preparing stable isotope labeled ssDNA by biological fermentation
CN118147189A (en) * 2024-04-03 2024-06-07 常州智胜生物科技有限公司 A tetrahedral framework nucleic acid and a preparation method thereof
CN118147131A (en) * 2024-04-03 2024-06-07 常州智胜生物科技有限公司 A nucleic acid fragment containing target single-stranded DNA and a method for preparing single-stranded DNA

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070117109A1 (en) 2005-06-14 2007-05-24 California Institute Of Technology Nanostructures, methods of making and using the same
EP2695949A1 (en) 2012-08-10 2014-02-12 Technische Universität München Nucleic acid based nanopores or transmembrane channels and their uses

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103276074B (en) 2013-05-21 2015-08-19 昆山彭济凯丰生物科技有限公司 A kind of method of synthesizing short single strand deoxyribonucleotide probe

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070117109A1 (en) 2005-06-14 2007-05-24 California Institute Of Technology Nanostructures, methods of making and using the same
US7842793B2 (en) 2005-06-14 2010-11-30 The California Institute Of Technology Methods of making nucleic acid nanostructures
US20120251583A1 (en) 2005-06-14 2012-10-04 The California Institute Of Technology Methods of making nucleic acid nanostructures
US8501923B2 (en) 2005-06-14 2013-08-06 California Institute Of Technology Nucleic acid nanostructures
EP2695949A1 (en) 2012-08-10 2014-02-12 Technische Universität München Nucleic acid based nanopores or transmembrane channels and their uses

Non-Patent Citations (25)

* Cited by examiner, † Cited by third party
Title
ALEXANDRIA N. MARCHI ET AL: "Toward Larger DNA Origami", NANO LETTERS, vol. 14, no. 10, 8 October 2014 (2014-10-08), US, pages 5740 - 5747, XP055347699, ISSN: 1530-6984, DOI: 10.1021/nl502626s *
BAI X; MARTIN T; SCHERES S; DIETZ H: "Cryo-EM structure of a 3D DNA-origami object", P NATL ACAD SCI USA, vol. 109, 2012, pages 20012
BENJAMIN KICK ET AL: "Efficient Production of Single-Stranded Phage DNA as Scaffolds for DNA Origami", NANO LETTERS, vol. 15, no. 7, 8 July 2015 (2015-07-08), US, pages 4672 - 4676, XP055347289, ISSN: 1530-6984, DOI: 10.1021/acs.nanolett.5b01461 *
BREAKER RR: "DNA enzymes", NAT BIOTECHNOL., vol. 15, no. 5, 1997, pages 427 - 31, XP002912052, DOI: doi:10.1038/nbt0597-427
CARMI N; SHULTZ LA; BREAKER RR: "In vitro selection of self-cleaving DNAs", CHEM BIOL., vol. 3, no. 12, 1996, pages 1039 - 46
CHANDRA M; SACHDEVA A; SILVERMAN SK: "DNA-catalyzed sequence-specific hydrolysis of DNA", NAT CHEM BIOL., vol. 5, no. 10, 2009, pages 718 - 20
COSIMO DUCANI ET AL: "Enzymatic production of 'monoclonal stoichiometric' single-stranded DNA oligonucleotides", HHS PUBLIC ACCESS AUTHOR MANUSCRIPT, vol. 10, no. 7, 2 June 2013 (2013-06-02), GB, pages 647 - 652, XP055347548, ISSN: 1548-7091, DOI: 10.1038/nmeth.2503 *
DUCANI C; KAUL C; MOCHE M; SHIH WM; HOGBERG B: "Enzymatic production of 'monoclonal stoichiometric' single-stranded DNA oligonucleotides", NAT METHODS, vol. 10, no. 7, 2013, pages 647 - 52, XP055347548, DOI: doi:10.1038/nmeth.2503
EVI STAHL ET AL: "Facile and Scalable Preparation of Pure and Dense DNA Origami Solutions", ANGEWANDTE CHEMIE INTERNATIONAL EDITION, vol. 53, no. 47, 24 October 2014 (2014-10-24), DE, pages 12735 - 12740, XP055347555, ISSN: 1433-7851, DOI: 10.1002/anie.201405991 *
GU ET AL., JACS, 2013
GU H ET AL: "Production of single-stranded DNAs by self-cleavage of rolling-circle amplification products", BIOTECHNIQUES RAPID DISPATCHES, INFORMA HEALTHCARE, US, vol. 54, no. 6, 1 June 2013 (2013-06-01), pages 337 - 343, XP002758881, ISSN: 0736-6205, DOI: 10.2144/000114009 *
GU H; BREAKER RR: "Production of single-stranded DNAs by self-cleavage of rolling-circle amplification products", BIOTECHNIQUES, vol. 54, no. 6, 2013, pages 337 - 43, XP002758881, DOI: doi:10.2144/000114009
GU H; FURUKAWA K; WEINBERG Z; BERENSON DF; BREAKER RR SMALL: "highly active DNAs that hydrolyze DNA", JAM CHEM SOC, vol. 135, no. 24, 2013, pages 9121 - 9
JONES MR; SEEMAN NC; MIRKIN CA: "Nanomaterials. Programmable materials and the nature of the DNA bond", SCIENCE, vol. 347, no. 6224, 2015, pages 1260901
KEEFE AD; PAI S; ELLINGTON A: "Aptamers as therapeutics", NAT REV DRUG DISCOV, vol. 9, no. 7, pages 537 - 50, XP055260503, DOI: doi:10.1038/nrd3141
KICK B; PRAETORIUS F; DIETZ H; WEUSTER-BOTZ D: "Efficient Production of Single-Stranded Phage DNA as Scaffolds for DNA Origami.", NANO LETT, vol. 15, no. 7, 2015, pages 4672 - 6, XP055347289, DOI: doi:10.1021/acs.nanolett.5b01461
KRUG N; HOHLFELD JM; KIRSTEN AM; KORNMANN O; BEEH KM; KAPPELER D; KORN S; IGNATENKO S; TIMMER W; ROGON C: "Allergen-induced asthmatic responses modified by a GATA3-specific DNAzyme", N ENGL J MED, vol. 372, no. 21, 2015, pages 1987 - 95, XP009187084, DOI: doi:10.1056/NEJMoa1411776
MARCHI AN; SAAEM I; VOGEN BN; BROWN S; LABEAN TH: "Toward larger DNA origami", NANO LETT, vol. 14, no. 10, 2014, pages 5740 - 7, XP055347699, DOI: doi:10.1021/nl502626s
NG EW; SHIMA DT; CALIAS P; CUNNINGHAM ET JR; GUYER DR; ADAMIS AP: "Pegaptanib, a targeted anti-VEGF aptamer for ocular vascular disease", NAT REV DRUG DISCOV, vol. 5, no. 2, 2006, pages 123 - 32, XP008064426, DOI: doi:10.1038/nrd1955
ROTHEMUND PW: "Folding DNA to create nanoscale shapes and patterns", NATURE, vol. 440, no. 7082, 2006, pages 297 - 302
SCHMIDT TL; BELIVEAU BJ; UCA YO; THEILMANN M; DA CRUZ F; WU CT; SHIH WM: "Scalable amplification of strand subsets from chip-synthesized oligonucleotide libraries", NAT COMMUN, vol. 6, 2015, pages 8634
SHEPPARD TL; ORDOUKHANIAN P; JOYCE GF: "A DNA enzyme with N-glycosylase activity", PROC NATL ACAD SCI USA, vol. 97, no. 14, 2000, pages 7802 - 7
THORSTEN L. SCHMIDT ET AL: "Scalable amplification of strand subsets from chip-synthesized oligonucleotide libraries", NATURE COMMUNICATIONS, vol. 6, 16 November 2015 (2015-11-16), pages 8634, XP055347700, DOI: 10.1038/ncomms9634 *
TORABI SF; WU P; MCGHEE CE; CHEN L; HWANG K; ZHENG N; CHENG J; LU Y: "In vitro selection of a sodium-specific DNAzyme and its application in intracellular sensing", PROC NATL ACAD SCI USA, vol. 112, no. 19, 2015, pages 5903 - 8
WHILE GU ET AL., BIOTECHNIQUES, 2013

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11513076B2 (en) 2016-06-15 2022-11-29 Ludwig-Maximilians-Universität München Single molecule detection or quantification using DNA nanotechnology
CN108707601A (en) * 2018-06-07 2018-10-26 南京大学 A kind of preparation method for the single-stranded cyclic DNA that sequence and length customize and its application in DNA paper folding arts
WO2020107560A1 (en) * 2018-11-28 2020-06-04 上海纳米技术及应用国家工程研究中心有限公司 Method for detecting micrornas based on rolling circle amplification and dna origami
EP4450637A1 (en) 2023-04-21 2024-10-23 Technische Universität München Novel self-cleaving dnazymes and selection process
WO2024218307A1 (en) 2023-04-21 2024-10-24 Technische Universität München Novel self-cleaving dnazymes and selection process
EP4455302A1 (en) 2023-04-25 2024-10-30 Technische Universität München Programmable nuclease resistance of nucleic acid assemblies
WO2024223679A1 (en) 2023-04-25 2024-10-31 Technische Universität München Programmable nuclease resistance of nucleic acid assemblies
EP4663200A1 (en) 2024-06-10 2025-12-17 CPTx GmbH Compositions and methods
WO2025257205A1 (en) 2024-06-10 2025-12-18 Cptx Gmbh Compositions and methods
EP4674984A1 (en) 2024-07-04 2026-01-07 CPTx GmbH Compositions
WO2026008787A1 (en) 2024-07-04 2026-01-08 Cptx Gmbh Compositions

Also Published As

Publication number Publication date
CN109844113A (en) 2019-06-04
PL3516055T3 (en) 2022-04-11
EP3516055B1 (en) 2021-12-22
CN109844113B (en) 2023-09-29
KR20190050991A (en) 2019-05-14
KR102528337B1 (en) 2023-05-02
DK3516055T3 (en) 2022-03-21
US11913050B2 (en) 2024-02-27
ES2909073T3 (en) 2022-05-05
JP2019528743A (en) 2019-10-17
JP7099724B2 (en) 2022-07-12
US20190203242A1 (en) 2019-07-04
EP3516055A1 (en) 2019-07-31

Similar Documents

Publication Publication Date Title
EP3516055B1 (en) Scalable biotechnological production of dna single strand molecules of defined sequence and length
AU2021231074C1 (en) Class II, type V CRISPR systems
AU2019204675B2 (en) Using rna-guided foki nucleases (rfns) to increase specificity for rna-guided genome editing
US11242523B2 (en) Compositions, methods and apparatus for oligonucleotides synthesis
RU2713328C2 (en) Hybrid dna/rna polynucleotides crispr and methods of appliance
EP3481838B1 (en) Novel processes for the production of oligonucleotides
KR20240007322A (en) Enzymes with ruvc domains
WO2015021990A1 (en) Rna probing method and reagents
JP2021528975A (en) Compositions, systems, and methods for amplification using CRISPR / CAS and transposases
EP4313118A1 (en) Adenosine deaminase variants and uses thereof
CN113728097A (en) Enzymes with RUVC domains
KR20150140663A (en) Methods for the production of libraries for directed evolution
EP4121532B1 (en) Crispr system high throughput diagnostic systems and methods
EP3872171A1 (en) Rna detection and transcription-dependent editing with reprogrammed tracrrnas
US20250179452A1 (en) Systems and methods for transposing cargo nucleotide sequences
EP4709863A2 (en) Systems and methods for transposing cargo nucleotide sequences
KR102674574B1 (en) A novel tracrRNA system for Cas9
JP7010941B2 (en) Systems used for DNA editing and their applications
EP4716752A2 (en) Endonuclease systems
CN120173913A (en) Novel Cas12a nuclease BEST3 and its application
JP5253703B2 (en) Gene fragment acquisition method
CN120944969A (en) A plasmid and its application
WO2005010184A1 (en) Method of detecting mutation

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17746416

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2019515435

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20197008132

Country of ref document: KR

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2017746416

Country of ref document: EP

Effective date: 20190423