WO2018049155A1 - Compositions comprising polymeric nanoparticles and mcl-1 antagonists - Google Patents

Compositions comprising polymeric nanoparticles and mcl-1 antagonists Download PDF

Info

Publication number
WO2018049155A1
WO2018049155A1 PCT/US2017/050673 US2017050673W WO2018049155A1 WO 2018049155 A1 WO2018049155 A1 WO 2018049155A1 US 2017050673 W US2017050673 W US 2017050673W WO 2018049155 A1 WO2018049155 A1 WO 2018049155A1
Authority
WO
WIPO (PCT)
Prior art keywords
peg
peptide
ppg
pla
poly
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2017/050673
Other languages
French (fr)
Inventor
Surender Kharbanda
Donald Kufe
Harpal Singh
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanoproteagen Ltd
Dana Farber Cancer Institute Inc
Original Assignee
Nanoproteagen Ltd
Dana Farber Cancer Institute Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanoproteagen Ltd, Dana Farber Cancer Institute Inc filed Critical Nanoproteagen Ltd
Publication of WO2018049155A1 publication Critical patent/WO2018049155A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6921Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere
    • A61K47/6927Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores
    • A61K47/6929Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle
    • A61K47/6931Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle the material constituting the nanoparticle being a polymer
    • A61K47/6935Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle the material constituting the nanoparticle being a polymer the polymer being obtained otherwise than by reactions involving carbon to carbon unsaturated bonds, e.g. polyesters, polyamides or polyglycerol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/63Compounds containing para-N-benzenesulfonyl-N-groups, e.g. sulfanilamide, p-nitrobenzenesulfonyl hydrazide
    • A61K31/635Compounds containing para-N-benzenesulfonyl-N-groups, e.g. sulfanilamide, p-nitrobenzenesulfonyl hydrazide having a heterocyclic ring, e.g. sulfadiazine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A61K38/1761Apoptosis related proteins, e.g. Apoptotic protease-activating factor-1 (APAF-1), Bax, Bax-inhibitory protein(s)(BI; bax-I), Myeloid cell leukemia associated protein (MCL-1), Inhibitor of apoptosis [IAP] or Bcl-2
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/66Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid the modifying agent being a pre-targeting system involving a peptide or protein for targeting specific cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/48Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51Nanocapsules; Nanoparticles
    • A61K9/5107Excipients; Inactive ingredients
    • A61K9/513Organic macromolecular compounds; Dendrimers
    • A61K9/5146Organic macromolecular compounds; Dendrimers obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyethylene glycol, polyamines, polyanhydrides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/48Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51Nanocapsules; Nanoparticles
    • A61K9/5107Excipients; Inactive ingredients
    • A61K9/513Organic macromolecular compounds; Dendrimers
    • A61K9/5146Organic macromolecular compounds; Dendrimers obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyethylene glycol, polyamines, polyanhydrides
    • A61K9/5153Polyesters, e.g. poly(lactide-co-glycolide)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia

Definitions

  • the present disclosure relates to the field of nanotechnology, in particular, to the use of biodegradable polymeric nanoparticles for the delivery of therapeutic agents.
  • Cancer is one of the most devastating diseases and it involves various genetic alterations and cellular abnormalities. This complexity and heterogeneity promotes the aggressive growth of cancer cells leading to significant morbidity and mortality in patients (Das, M. et al. (2009) Ligand-based targeted therapy for cancer tissue. Expert Opin. Drug Deliv. 6, 285-304; Mohanty, C. et al. (2011) Receptor mediated tumor targeting: an emerging approach for cancer therapy. Curr. Drug Deliv. 8, 45-58).
  • MCL-1 Myeloid cell leukemia-1 (MCL-1) is an anti-apoptotic member in the BCL-2 family.
  • anti-apoptotic BCL-2 family proteins bind and sequester pro- apoptotic BCL-2 family proteins by trapping their a-helical BH3 domains in a hydrophobic groove.
  • Many cancer cells express high levels of anti-apoptotic BCL-2 family proteins, thereby maintaining cell survival in spite of expression of pro-apoptotic BCL-2 family proteins. Therefore, small molecules and peptides that effectively target anti-apoptotic BCL- 2 family members may induce cell death preferentially in cancer cells.
  • Such molecules have been developed and some of the small molecules, such as ABT-263 (navitoclax) and ABT- 199 (venetoclax), have been evaluated in clinical studies.
  • Peptide inhibitors of anti-apoptotic BCL-2 family proteins also show high efficacy in inducing cancer cell death.
  • free drug formulations of peptidic therapeutic agents require the use of large amounts and frequent administration of the peptide, thereby increasing the cost and inconvenience of therapy.
  • a delivery system that can effectively deliver therapeutic agents, such as therapeutic peptides, alone, or in combination with other therapeutic agents such as chemotherapeutic agents, into cancerous cells.
  • compositions comprising polymeric nanoparticles and MCL-1 antagonists, e.g. , a peptide capable of binding to MCL-1 and inhibiting the anti- apoptotic activity of MCL-1, and a polynucleotide encoding same. Also provided are methods for treating certain diseases, such as cancer, by administering the composition to a subj ect in need thereof.
  • the instant disclosure provides a composition comprising polymeric nanoparticles comprising a poly(lactic acid)-poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) (PLA-PEG-PPG-PEG) tetra block copolymer, and a peptide comprising an amino acid sequence which is at least 85% identical to the sequence of a specific MCL-1 antagonistic peptide (SEQ ID NO: 1).
  • the instant disclosure provides a composition comprising polymeric nanoparticles comprising a poly(lactic acid)-poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) (PLA- PEG-PPG-PEG) tetra block copolymer, and a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 85% identical to SEQ ID NO: 1.
  • the molecular weight of PLA is between about 2,000 and about 80,000 daltons.
  • the PLA-PEG-PPG-PEG tetra block copolymer is formed from chemical conjugation of PEG-PPG-PEG tri-block copolymer with PLA, and wherein the PEG-PPG-PEG tri-block copolymer can be of different molecular weights.
  • the polymeric nanoparticles have a diameter of about 30 nm to about 270 nm. In certain embodiments, the polymeric nanoparticles are loaded with the peptide or polynucleotide.
  • the instant disclosure provides a pharmaceutical composition
  • polymeric nanoparticles comprising a poly(lactic acid)-poly(ethylene glycol)- poly(propylene glycol)-poly(ethylene glycol) (PLA-PEG-PPG-PEG) tetra block copolymer, and a peptide comprising an amino acid sequence which is at least 85% identical to SEQ ID NO: 1, for use in treating cancer.
  • the instant disclosure provides a pharmaceutical composition
  • polymeric nanoparticles comprising a poly(lactic acid)-poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) (PLA-PEG-PPG- PEG) tetra block copolymer, and a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 85% identical to SEQ ID NO: 1, for use in treating cancer.
  • the polymeric nanoparticles are loaded with the peptide or the polynucleotide.
  • the polymeric nanoparticles consist essentially of poly(lactic acid)-poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) (PLA-PEG-PPG- PEG) tetra block copolymer.
  • the composition further comprises a therapeutic agent selected from the group consisting of a BCL-2 antagonist, a BCL-xL antagonist, a BCL-w antagonist.
  • the composition further comprises a chemotherapeutic agent.
  • the chemotherapeutic agent is selected from the group consisting of paclitaxel, doxorubicin, salinomycin, taurolidine, vincristine, daunorubicin, docetaxel, gemcitabine, decitabine, irinotecan, 7-ethyl-lO-hydroxy- camptothecin (SN-38), cytarabine, triptolide, geldanamycin, tanespimycin (17-N-allylamino- 17-demethoxy geldanamycin; 17-AAG), 5-FU, oxaliplatin, carboplatin, taxotere, methotrexate, and bortezomib.
  • the composition further comprises a targeted anti-cancer agent.
  • the composition further comprises an immunotherapeutic agent.
  • the polymeric nanoparticles further comprise a targeting moiety attached to the outside of the polymeric nanoparticles, and the targeting moiety is an antibody, peptide, or aptamer.
  • the instant disclosure provides a polymeric nanoparticle consisting essentially of a PLA-PEG-PPG-PEG tetra block copolymer, wherein the polymeric nanoparticles are loaded with a peptide comprising an amino acid sequence which is at least 85% identical to SEQ ID NO: 1, or a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 85% identical to SEQ ID NO: 1.
  • the peptide is a stapled peptide.
  • the instant disclosure provides a method for treating cancer in a subject in need thereof comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising polymeric nanoparticles comprising a PLA-PEG-PPG-PEG tetra block copolymer, and a peptide comprising an amino acid sequence which is at least 85% identical to SEQ ID NO: 1.
  • the instant disclosure provides a method for treating cancer in a subject in need thereof comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising polymeric nanoparticles comprising a PLA-PEG-PPG-PEG tetra block copolymer, and a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 85% identical to SEQ ID NO: 1.
  • the instant disclosure provides a method for activating the BCL2A1 pathway in a mammalian cell, comprising administering to the cell an effective amount of a composition comprising: polymeric nanoparticles comprising a PLA-PEG-PPG- PEG tetra block copolymer, and a peptide comprising an amino acid sequence which is at least 85% identical to SEQ ID NO: 1, or a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 85% identical to SEQ ID NO: 1.
  • the expression of BCL2A1 mRNA is increased in the cell after administration of the pharmaceutical composition. In certain embodiments, the expression of BCL2A1 protein is increased in the cell after administration of the
  • the expression of NF- ⁇ p65 protein is increased in the cell after administration of the pharmaceutical composition.
  • the expression of MUCl-C protein is increased in the cell after administration of the pharmaceutical composition.
  • the peptide is a stapled peptide.
  • the pharmaceutical composition further comprises a therapeutic agent selected from the group consisting of a BCL-2 antagonist, a BCL-xL antagonist, a BCL-w antagonist. In certain embodiments, the pharmaceutical composition further comprises a chemotherapeutic agent.
  • the chemotherapeutic agent is selected from the group consisting of paclitaxel, doxorubicin, salinomycin, taurolidine, vincristine, daunorubicin, docetaxel, gemcitabine, decitabine, irinotecan, 7-ethyl-lO-hydroxy-camptothecin (SN-38), cytarabine, triptolide, geldanamycin, tanespimycin (17-N-allylamino-17-demethoxygeldanamycin; 17- AAG), fluorouracil (5-FU), oxaliplatin, carboplatin, taxotere, methotrexate, and bortezomib.
  • the pharmaceutical composition further comprises a targeted anticancer agent.
  • the pharmaceutical composition further comprises an immunotherapeutic agent.
  • the cancer is leukemia or lymphoma. In certain embodiments, the cancer is leukemia or lymphoma. In certain
  • the cancer is acute myeloid leukemia or chronic lymphocytic leukemia. In certain embodiments, the cancer is multiple myeloma. In certain embodiments, the cancer is breast cancer. In certain embodiments, the cancer is resistant to treatment with a BCL-2 antagonist. In certain embodiments, the subject is resistant to treatment with a BCL-2 antagonist. In certain embodiments, the subject is refractory to treatment with a BCL-2 antagonist. In certain embodiments, the subject is in relapse after treatment with a BCL-2 antagonist. In certain embodiments, the BCL-2 antagonist is venetoclax (ABT-199). In certain embodiments, the cancer expresses a high level of MCL-1.
  • FIG. 1 provides a schematic diagram of the polymeric nanoparticles (NPs) of PLA- PEG-PPG-PEG tetra block copolymer.
  • FIG. 2 provides FTIR spectra of PLA, PEG-PPG-PEG and PLA-PEG-PPG-PEG nanoparticles.
  • FIG. 3A shows the Nuclear Magnetic Resonance (NMR) spectra of PLA-PEG-PPG- PEG nanoparticles synthesized from a block copolymer of PEG-PPG-PEG of 1,100 g/mol.
  • FIG. 3B shows the NMR spectra of PLA-PEG-PPG-PEG nanoparticles synthesized from a block copolymer of PEG-PPG-PEG of 4,400 g/mol.
  • FIG. 3C shows the NMR spectra of PLA-PEG-PPG-PEG nanoparticles synthesized from a block copolymer of PEG-PPG-PEG of 8,400 g/mol.
  • FIG. 4A and FIG. 4B show Transmission Electron Micrograph (TEM) images of PLA-PEG-PPG-PEG polymeric nanoparticles.
  • FIG. 5A, FIG. 5B, and FIG. 5C show photomicrographs of the cellular
  • FIG. 6 provides a graph showing in vitro release of encapsulated L-NuBCP-9 over time from the PLA-PEG-PPG-PEG nanoparticles synthesized using different copolymers at 25°C.
  • FIG. 7A provides a bar graph showing percent relative changes of hemoglobin in BALB/c mice treated with control ("CNTRL”, the bars on the left at each time point) or plain PLA-PEG-PPG-PEG nanoparticles ("Ant_can_pep", the bars on the right at each time point) to define any general toxicity by doing blood chemistry at a dose of 150 mg/kg body weight.
  • FIG. 7B provides a bar graph showing percent relative changes of neutrophils and lymphocyte count in BALB/c mice treated with control (“CNTRL”) or plain PLA-PEG-PPG- PEG nanoparticles ("Ant_can_pep”) to define any general toxicity by doing blood chemistry at a dose of 150 mg/kg body weight.
  • CNTRL control
  • Ant_can_pep plain PLA-PEG-PPG- PEG nanoparticles
  • FIG. 7C provides a bar graph showing percent relative changes of packed cell volume, MCV (Mean Corpuscular Volume), MCH (Mean Corpuscular Hemoglobin) and MCHC (Mean Corpuscular Hemoglobin Concentration), in BALB/c mice treated with control (“CNTRL”) or plain PLA-PEG-PPG-PEG nanoparticles ("Ant_can_pep") to define any general toxicity by doing blood chemistry at a dose of 150 mg/kg body weight.
  • CNTRL control
  • Ant_can_pep plain PLA-PEG-PPG-PEG nanoparticles
  • FIG. 8A provides a bar graph showing the levels of aspartate transaminase and alanine transaminase in BALB/c mice treated with plain PLA-PEG-PPG-PEG nanoparticles to define any general toxicity by doing blood chemistry at a dose of 150 mg/kg body weight.
  • the bars on the left, in the middle, and on the right represent measurement 7 days, 14 days, and 21 days after treatment, respectively.
  • FIG. 8B provides a bar graph showing the levels alkaline phosphatase in BALB/c mice treated with control ("CNTRL", the bars on the left at each time point) or plain PLA- PEG-PPG-PEG nanoparticles ("PLA-PEG", the bars on the right at each time point) to define any general toxicity by doing blood chemistry at a dose of 150 mg/kg body weight.
  • CNTRL control
  • PLA-PEG plain PLA- PEG-PPG-PEG nanoparticles
  • FIG. 8C provides a bar graph showing the levels of urea and blood urea nitrogen (BUN) in BALB/c mice treated with plain PLA-PEG-PPG-PEG nanoparticles to define any general toxicity by doing blood chemistry at a dose of 150 mg/kg body weight.
  • BUN blood urea nitrogen
  • FIG. 9 provides photomicrographs showing the histopathology of the brain, heart, liver, spleen, kidney and lung of BALB/c mice injected with plain PLA-PEG-PPG-PEG nanoparticles to define any general toxicity by doing histopathology of different organs.
  • FIG. 10A provides a bar graph showing the percentage of necrotic THP-1 cells after 72-hour exposure to plain PLA-PEG-PPG-PEG NPs ("THP-1 C"), or PLA-PEG-PPG-PEG NPs encapsulating MS-1 peptide (“MCL-1”) or BCL-2 targeting peptide NuBCP-9
  • FIG. 10B provides a bar graph showing the proliferation of THP-1 cells after 72-hour exposure to empty PLA-PEG-PPG-PEG NPs ("THP-1 C"), PLA-PEG-PPG-PEG NPs encapsulating MS-1 peptide ("MCL-1”) or BCL-2 targeting peptide NuBCP-9 (“NuBCP”). Cell growth was determined by Trypan blue exclusion analysis and results are shown as numbers of cells not stained by Trypan blue per ml.
  • FIG. 11 provides a bar graph showing the proliferation of U937 cells after 72- or 96- hour exposure to empty PLA-PEG-PPG-PEG NPs ("control") or different concentrations of MS-1 peptide/NPs ("MCL-1 7.5 uM” and "MCL-1 10 uM”).
  • Cell growth was determined using Trypan blue exclusion analysis and the results are shown as numbers of cells not stained by Trypan blue per ml.
  • the bars on the left and on the right represent cell numbers 72 hours and 96 hours after the treatment, respectively.
  • FIG. 12A provides a bar graph showing the proliferation of THP-1 cells ("THP”) which express a high level of MCL-1, and K562 cells ("K562”) which express a low level of MCL-1, after 96-hour exposure to empty PLA-PEG-PPG-PEG NPs ("OH”) or 5 ⁇ MS-1 peptide/NPs ("96H”).
  • THP-1 cells THP-1 cells
  • K562 K562 cells
  • 96H MS-1 peptide/NPs
  • FIG. 12B provides a bar graph showing the proliferation of THP-1 ("THP-l/C” and first "Mcl-l/NP”), U937 (“U937/C” and second "Mcl-l/NP”), K562 ("K562/C” and third "Mcl-l/NP”) and HL60 (“HL60/C” and fourth "Mcl-l/NP”) cells after 96-hour exposure to empty PLA-PEG-PPG-PEG NPs ("/C”) or 5 ⁇ MS-1 peptide/NPs (“Mcl-l/NP”).
  • THP-1 THP-1
  • U937 U937/C
  • second "Mcl-l/NP” K562
  • K562/C K562/C” and third "Mcl-l/NP”
  • HL60/C HL60/C” and fourth "Mcl-l/NP”
  • Cell proliferation was determined by Trypan blue exclusion analysis and the results are shown as percentage of proliferation as compared to the cells
  • FIG. 13 provides protein gel stains showing the cleavage of Caspase-3 in THP-1 cells after 24- or 96-hour exposure to 5 ⁇ MS-1 peptide/NPs ("MCL-l/NP").
  • Total cell lysates were analyzed by immunoblotting with an antibody recognizing full length Caspase-3 ("FL”), an antibody recognizing Caspase-3 cleaved fragment (“CF”), and an anti-Actin antibody.
  • FIG. 14A provides protein gel stains showing the expression of MCL-1 in ABT199- sensitive and resistant THP1 cells.
  • Wild-type (“THP-l/WT”) or ABT199-resistant (“THP- 1/ABT199”) THP-1 cells were treated with 5 ⁇ MS-1 peptide/NPs for 72 hours.
  • Total cell lysates were analyzed by immunoblotting with anti-MCL-1, anti-BCL-2 and anti-Actin antibodies.
  • FIG. 14B provides a bar graph showing the proliferation of wild-type (“THP-1” and first "MCL-1”) or ABT199-resistant (“THP-l/ABT” and second "MCL-1”) THP-1 cells after 72-hour exposure to empty PLA-PEG-PPG-PEG NPs or 5 ⁇ MS-1 peptide/NPs ("MCL- 1").
  • THP-1 wild-type
  • MCL-1 ABT199-resistant
  • MCL- 1 MS-1 peptide/NPs
  • FIG. 15A provides a bar graph showing the colony formation of U937 cells in soft agar.
  • 300 U937 cells were cultured in soft agar without FLT-3 ligand, containing empty PLA-PEG-PPG-PEG NPs ("Control"), 1.5 ⁇ or 7.5 ⁇ ⁇ - ⁇ peptide/NPs ("MCL-1 1.5 uM", "MCL-1 7.5 uM”) for 10-12 days. Colonies containing more than 50 cells were counted and the results are shown as numbers of colonies in each treatment condition.
  • FIG. 15B provides a bar graph showing the colony formation of U937 cells in soft agar with or without FLT-3 ligand.
  • 300 U937 cells were cultured in soft agar containing empty PLA-PEG-PPG-PEG NPs ("Control” and "FLT3-Ligand 50 ng"), 5 ⁇ or 7.5 ⁇ MS-1 peptide/NPs ("MCL-1 5 uM", “MCL-1 7.5 uM”) in the presence or absence of 50 ng/ml FLT-3 ligand for 10-12 days. Colonies containing more than 50 cells were counted and the results are shown as numbers of colonies in each treatment condition.
  • FIG. 16 provides a bar graph showing the stimulation of reactive oxygen species
  • ROS by MS-1 peptide/NPs in U937 and K562 cells.
  • U-937 (“U937-C” and first "MCL- 1/NP") or K-562 (“K562-C” and second "MCL-l/NP”) cells were treated with empty PLA- PEG-PPG-PEG NPs ("U937-C", “K562-C”) or 5 ⁇ MS-1 peptide/NPs (first and second "MCL-l/NP” for U937 and K562 cells, respectively) for 72 hours.
  • ROS levels were determined in each treatment condition and the results are shown as relative ROS levels as compared to untreated cells.
  • FIG. 17A shows a bar graph comparing the cell survival of BT-20 cells treated with empty NPs relative to the survival of BT-20 cells treated with 7.5 ⁇ MS-l/NPs for 5 days. The results are expressed as relative survival compared to that obtained with untreated cells (untreated cells were assigned a value of 1).
  • FIG. 17B shows immunoblots of ly sates from BT-20 cells treated with empty NPs or with 7.5 ⁇ MS-l/NPs for 5 days.
  • the specific proteins detected in the cell lysates are indicated for each immunoblot (MUC1-C, NF- ⁇ p65, BCL2A1; ⁇ -actin is an internal control).
  • FIG. 17C shows a graph of tumor volume over time from tumor-bearing nude mice treated with empty NPs (circles) or 20 mg/kg MS-l/NPs (squares) each week for 3 weeks. The results are expressed as tumor volume as a function of time (mean ⁇ SEM; 6 mice per group; *p ⁇ 0.01). Blinding was not done. Tumors were harvested on day 40.
  • FIG. 17D shows a bar graph comparing relative levels of MCL-1 mRNA in empty NP -treated and MS -1/NP -treated tumor cells. The results (mean ⁇ SD of 3 determinations) are expressed as relative mRNA levels compared with that obtained for empty NP -treated tumors (assigned a value of 1).
  • FIG. 17E shows a bar graph comparing relative levels of BCL2AlmRNA in empty
  • NP -treated and MS -1/NP -treated tumor cells The results (mean ⁇ SD of 3 determinations) are expressed as relative mRNA levels compared with that obtained for empty NP -treated tumors (assigned a value of 1).
  • FIG. 17F shows immunoblots of ly sates from empty NP -treated and MS- 1/NP -treated tumors, treated with the indicated antibodies (by antibodies that bind MCL-1, MUC1-C, p65, BCL2A1, or ⁇ -actin).
  • FIGS. 18A and 18B show bar graphs comparing the effect of MCL-l/NP treatment on the proliferation of leukocytes from two different AML patients, compared with healthy controls.
  • the present disclosure provides a composition comprising nanoparticles (also referred to herein as "NPs") loaded with an MCL-1 antagonist.
  • MCL-1 is highly expressed in certain cancer cells and is implicated in cell survival and proliferation. Inhibition of the activity of MCL-1 protein, for instance, by a peptide inhibitor named "MS-1 peptide", reduces cancer cell survival and proliferation. Delivery of this peptide to the intracellular space of cancer cells is facilitated by NPs.
  • the present disclosure provides methods for treating a disease, such as cancer, by administering a composition comprising the NPs loaded with an MCL-1 antagonistic peptide or polynucleotide. Methods for producing the composition are also provided.
  • Nanoparticles can be produced as nanocapsules or nanospheres. Protein loading in the nanoparticle can be carried out by either the adsorption process or the encapsulation process (Spada et al, 2011 ; Protein delivery of polymeric nanoparticles; World Academy of Science, Engineering and Technology: 76). Nanoparticles, by using both passive and active targeting strategies, can enhance the intracellular concentration of drugs in cancer cells while avoiding toxicity in normal cells. When nanoparticles bind to specific receptors and enter the cell, they are usually enveloped by endosomes via receptor-mediated endocytosis, thereby bypassing the recognition of P-glycoprotein, one of the main drug resistance mechanisms (Cho et al, 2008, Therapeutic Nanoparticles for Drug Delivery in Cancer, Clin. Cancer Res. ,2008, 14: 1310-1316). Nanoparticles are removed from the body by opsonization and phagocytosis (Sosnik et al, 2008; Polymeric Nanocarriers: New Endeavors for the
  • Nanocarrier based systems can be used for effective drug delivery with the advantages of improved intracellular penetration, localized delivery, protect drugs against premature degradation, controlled pharmacokinetic and drug tissue distribution profile, lower dose requirement and cost effectiveness (Farokhzad OC, et al ; Targeted nanoparticle-aptamer bioconjugates for cancer chemotherapy in vivo. Proc. Natl. Acad. Sci. USA 2006,103 (16): 6315-20; Fonseca C, et al , Paclitaxel-loaded PLGA nanoparticles: preparation, physicochemical characterization and in vitro anti-tumoral activity. J. Controlled Release 2002; 83 (2): 273-86; Hood et al , Nanomedicine, 2011, 6(7): 1257-1272).
  • Nanoparticles are indirectly proportional to their small dimensions. Due to their small size, the polymeric nanoparticles have been found to evade recognition and uptake by the reticulo-endothelial system (RES), and can thus circulate in the blood for an extended period (Borchard et al, 1996, Pharm. Res. 7: 1055-1058). Nanoparticles are also able to extravasate at the pathological site like the leaky vasculature of a solid tumor, providing a passive targeting mechanism. Due to the higher surface area leading to faster solubilization rates, nano-sized structures usually show higher plasma concentrations and area under the curve (AUC) values. Lower particle size helps in evading the host defense mechanism and increase the blood circulation time.
  • RES reticulo-endothelial system
  • Nanoparticle size affects drug release. Larger particles have slower diffusion of drugs into the system. Smaller particles offer larger surface area but lead to fast drug release. Smaller particles tend to aggregate during storage and transportation of nanoparticle dispersions. Hence, a compromise between a small size and maximum stability of nanoparticles is desired.
  • the size of nanoparticles used in a drug delivery system should be large enough to prevent their rapid leakage into blood capillaries but small enough to escape capture by fixed macrophages that are lodged in the
  • reticuloendothelial system such as the liver and spleen.
  • Nanoparticles In addition to their size, the surface characteristics of nanoparticles are also an important factor in determining the life span and fate during circulation. Nanoparticles should ideally have a hydrophilic surface to escape macrophage capture. Nanoparticles formed from block copolymers with hydrophilic and hydrophobic domains meet these criteria. Controlled polymer degradation also allows for increased levels of agent delivery to a diseased state. Polymer degradation can also be affected by the particle size. Degradation rates increase with increase in particle size in vitro (Biopolymeric nanoparticles; Sundar et al , 2010, Science and Technology of Advanced Materials; doi: 10.1088/1468- 6996/11/1/014104).
  • Poly(lactic acid) (PLA) has been approved by the United States Food and Drug Administration for applications in tissue engineering, medical materials and drug carriers and poly(lactic acid)-poly(ethylene glycol) PLA-PEG based drug delivery systems are known in the art.
  • US2006/0165987A1 describes a stealthy polymeric biodegradable nanosphere comprising poly(ester)-poly(ethylene) multiblock copolymers and optional components for imparting rigidity to the nanospheres and incorporating pharmaceutical compounds.
  • US2008/0081075A1 discloses a novel mixed micelle structure with a functional inner core and hydrophilic outer shells, self-assembled from a graft macromolecule and one or more block copolymer.
  • US2010/0004398A1 describes a polymeric nanoparticle of shell/core configuration with an interphase region and a process for producing the same.
  • these polymeric nanoparticles essentially require the use of about 1% to 2% emulsifier for the stability of the nanoparticles.
  • Emulsifiers stabilize the dispersed particles in a medium.
  • PVA, PEG, Tween 80 and Tween 20 are some of the common emulsifiers.
  • the use of emulsifiers is however, a cause of concern for in vivo applications as the leaching out of emulsifiers can be toxic to the subject (Safety Assessment on polyethylene glycols (PEGS) and their derivatives as used in cosmetic products, Toxicology, 2005 Oct. 15; 214 (1- 2): 1-38).
  • emulsifier also increases the mass of the nanoparticle thereby reducing the drug load, leading to higher dosage requirements.
  • Other disadvantages still prevalent in the nanoparticle drug carrier systems are poor oral bioavailability, instability in circulation, inadequate tissue distribution and toxicity.
  • a delivery system that can effectively deliver therapeutic agents including therapeutic peptides into the cytosol of diseased (e.g. , cancerous) cells without the disadvantages presented above is described herein.
  • the term "about” or “approximately” usually means within 20%, more preferably within 10%, and most preferably still within 5% of a given value or range.
  • biodegradable refers to both enzymatic and non-enzymatic breakdown or degradation of the polymeric structure.
  • nanoparticle refers to particles in the range between 10 nm to 1000 nm in diameter, wherein diameter refers to the diameter of a perfect sphere having the same volume as the particle.
  • diameter refers to the diameter of a perfect sphere having the same volume as the particle.
  • nanoparticle is used interchangeably as “nanoparticle(s)”. In some cases, the diameter of the particle is in the range of about 1-1000 nm, 10-500 nm, or 30-120 nm.
  • a population of particles may be present.
  • the diameter of the nanoparticles is an average of a distribution in a particular population.
  • polymer is given its ordinary meaning as used in the art, i.e., a molecular structure comprising one or more repeat units (monomers), connected by covalent bonds.
  • the repeat units may all be identical, or in some cases, there may be more than one type of repeat unit present within the polymer.
  • polynucleotide or “nucleic acid” refers to polynucleotides such as deoxyribonucleic acid (DNA), ribonucleic acid (RNA), its variants and derivatives thereof.
  • DNA deoxyribonucleic acid
  • RNA ribonucleic acid
  • the term "loaded with” encompasses, but is not limited to, the following manners NPs are complexed with an agent, such as a peptide or a polynucleotide: the agent can be complexed with NPs by co-synthesis or co-assembly; the agent can be conjugated to a building block of NPs before NP synthesis or assembly; and the agent can be complexed with post-synthesis or post-assembly NPs, for example, by adsorption, coating and/or encapsulation.
  • the NPs may be nanospheres, nanocapsules, or a mixture thereof.
  • NPs loaded with an agent may comprise the NPs and the agent either in separate phases or in the same phase, and the preparation of the NPs loaded with the agent may involve phase transition.
  • therapeutic agent and “drug” are used interchangeably and are also intended to encompass not only compounds or species that are inherently
  • a “targeting moiety” or “targeting agent” is a molecule that will bind selectively to the surface of targeted cells.
  • the targeting moiety may be a ligand that binds to the cell surface receptor found on a particular type of cell or expressed at a higher frequency on target cells than on other cells.
  • the targeting agent, or therapeutic agent can be a peptide or protein.
  • Proteins and “peptides” are used interchangeably to refer to amino acid sequences comprising at least 5 amino acids.
  • the amino acids can be in D- or L- configuration.
  • a protein can be, for example, a protein drug, an antibody, a recombinant antibody, a recombinant protein, an enzyme, or the like.
  • one or more of the amino acids of the peptide or protein can be modified, for example by the addition of a chemical entity such as a carbohydrate group, a phosphate group, a farnesyl group, an isofamesyl group, a fatty acid group, a linker for conjugation, functionalization, or other modification such as cyclization, bi-cyclization and any of numerous other modifications intended to confer more advantageous properties on peptides and proteins.
  • one or more of the amino acids of the peptide or protein can be modified by substitution with one or more non-naturally occurring amino acids.
  • the peptides or proteins may by selected from a combinatorial library such as a phage library, a yeast library, or an in vitro combinatorial library.
  • antibody refers to any molecule incorporating an amino acid sequence or molecule with secondary or tertiary structural similarity conferring binding affinity to a given antigen that is similar or greater to the binding affinity displayed by an immunoglobulin variable region containing molecule from any species.
  • the term antibody includes, without limitation native antibodies consisting of two heavy chains and two light chains; binding molecules derived from fragments of a light chain, a heavy chain, or both, variable domain fragments, heavy chain or light chain only antibodies, or any engineered combination of these domains, whether monospecific or bispecific, and whether or not conjugated to a second diagnostic or therapeutic moiety such as an imaging agent or a chemotherapeutic molecule.
  • the term includes without limitation immunoglobulin variable region derived binding moieties whether derived from a murine, rat, rabbit, goat, llama, camel, human or any other vertebrate species.
  • the term refers to any such immunoglobulin variable region binding moiety regardless of discovery method (hybridoma-derived, humanized, phage derived, yeast derived, combinatorial display derived, or any similar derivation method known in the art), or production method (bacterial, yeast, mammalian cell culture, or transgenic animal, or any similar method of production known in the art).
  • combination refers to the combined administration of two or more therapeutic agents (e.g. , co-delivery).
  • pharmaceutically acceptable refers to those compounds, materials, compositions and/or dosage forms, which are, within the scope of sound medical judgment, suitable for contact with the tissues a warm-blooded animal, e.g. , a mammal or human, without excessive toxicity, irritation allergic response and other problem
  • a "therapeutically effective amount" of a polymeric nanoparticle comprising one or more therapeutic agents is an amount sufficient to provide an observable or clinically significant improvement over the baseline clinically observable signs and symptoms of the disorders treated with the combination.
  • subject or “patient” as used herein is intended to include animals, which are capable of suffering from or afflicted with a cancer or any disorder involving, directly or indirectly, a cancer.
  • subjects include mammals, e.g. , humans, apes, monkeys, dogs, cows, horses, pigs, sheep, goats, cats, mice, rabbits, rats, and transgenic non-human animals.
  • the subject is a human, e.g., a human suffering from, at risk of suffering from, or potentially capable of suffering from cancers.
  • treating comprises a treatment relieving, reducing or alleviating at least one symptom in a subject or effecting a delay of progression of a disease.
  • treatment can be the diminishment of one or several symptoms of a disorder or complete eradication of a disorder, such as cancer.
  • the term “treat” also denotes to arrest and/or reduce the risk of worsening a disease.
  • prevent comprises the prevention of at least one symptom associated with or caused by the state, disease or disorder being prevented.
  • an antagonist refers to an agent that inhibits the expression and/or one or more functions of a target protein.
  • BCL-2 antagonist refers to an agent that inhibits the expression and/or one or more functions of an anti-apoptotic BCL-2 family protein.
  • an antagonist to a target protein is an agent that binds specifically to the target protein.
  • an antagonist to an anti-apoptotic BCL-2 family target protein is an agent that converts the anti-apoptotic protein to a pro- apoptotic protein.
  • an antagonist to an anti-apoptotic BCL-2 family target protein comprises a peptide derived from a BH3 domain.
  • the BH3 domain is a BH3 domain of a BH3-only protein.
  • biodegradable polymeric nanoparticles made up of block copolymer for the delivery of one or more therapeutics.
  • the biodegradable polymeric nanoparticles of the instant technology are formed of a block copolymer consisting essentially of poly(lactic acid) (PLA) chemically modified with a hydrophilic-hydrophobic block copolymer, wherein said hydrophilic-hydrophobic block copolymer is selected from poly(methyl methacrylate)-poly(methylacrylic acid) (PMMA-PMAA), poly(styrene)- poly(acrylic acid) (PS-PAA), poly(acrylic acid)-poly(vinylpyridine) (PAA-PVP), poly(acrylic acid)-poly(N,N-dimethylaminoethyl methacrylate) (PAA-PDMAEMA), poly(ethylene glycol)-poly(butylene glycol) (PEG-PBG), and poly(ethylene glycol)-pol
  • PMMA-PMAA poly(
  • polymeric nanoparticle refers to polymeric nanoparticles formed of a block copolymer comprising poly(lactic acid) (PLA) chemically modified with a hydrophilic-hydrophobic block copolymer, wherein said hydrophilic-hydrophobic block copolymer is selected from poly(methyl methacrylate)-poly(methylacrylic acid) (PMMA- PMAA), poly(styrene)-poly(acrylic acid) (PS-PAA), poly(acrylic acid)-poly(vinylpyridine) (PAA-PVP), poly(acrylic acid)-poly(N,N-dimethylaminoethyl methacrylate) (PAA- PDMAEMA), poly(ethylene glycol)-poly(butylene glycol) (PEG-PBG), and poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) (PEG-PPG-PEG).
  • PMMA- PMAA poly(methyl methacrylate)-
  • polymeric nanoparticles encompass polymeric nanoparticles formed of a block copolymer comprising or consisting essentially of poly(lactic acid) (PLA) chemically modified with poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) (PEG-PPG-PEG).
  • PLA poly(lactic acid)
  • PEG-PPG-PEG poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol)
  • the present disclosure provides a process for preparing the biodegradable polymeric nanoparticle comprising one or more therapeutics.
  • the resulting nanoparticle is not only non-toxic, safe, and biodegradable, but is stable in vivo, has high storage stability and can be safely used in a nanocarrier system or drug delivery system in the field of medicine.
  • the nanoparticles of the instant disclosure increase the half-life of the deliverable drug or therapeutic agent in vivo.
  • the present disclosure also provides a process for efficient drug loading (e.g. , a peptide comprising NuBCP-9 as a single agent, or NuBCP-9 and a chemotherapeutic agent or a targeted anti-cancer agent) on a biodegradable polymeric nanoparticle to form an effective and targeted drug delivery nanocarrier system which prevents premature degradation of active agents and has a strong potential for use in cancer therapy.
  • a process for efficient drug loading e.g. , a peptide comprising NuBCP-9 as a single agent, or NuBCP-9 and a chemotherapeutic agent or a targeted anti-cancer agent
  • compositions comprising the biodegradable polymeric nanoparticle for use in medicine and in other fields that employ a carrier system or a reservoir or depot of nanoparticles.
  • the nanoparticles of the present disclosure can be extensively used in prognostic, therapeutic, diagnostic or theranostic compositions.
  • the nanoparticles of the present disclosure are used for drug and agent delivery, as well as for disease diagnosis and medical imaging in human and animals.
  • the instant disclosure provides a method for the treatment of disease using the nanoparticles further comprising a therapeutic agent as described herein.
  • the nanoparticles of the present disclosure can also be use in other applications such as chemical or biological reactions where a reservoir or depot is required, as biosensors, as agents for immobilized enzymes and the like.
  • biodegradable polymeric nanoparticles without the use of any emulsifiers or stabilizers according to the processes described herein.
  • the biodegradable polymeric nanoparticles so obtained by the process are safe, stable and non-toxic.
  • the block copolymer PEG-PPG- PEG is covalently attached to the poly-lactic acid (PLA) matrix, resulting in the block copolymer becoming a part of the matrix, i.e., the nanoparticle delivery system.
  • the emulsifier e.g. PEG-PPG-PEG
  • the emulsifier is not a part of the nanoparticle matrix and therefore leaches out (FIG. 1).
  • nanoparticles of the prior art there is no leaching out of emulsifier into the medium from the nanoparticles provided herein.
  • the nanoparticles obtained by the present process are non-toxic and safe due to the absence of added emulsifiers, which can leach out in vivo.
  • the absence or reduced quantity of emulsifier also leads to nanoparticles with a higher drug to polymer ratio.
  • nanoparticles have higher stability, and an increased storage shelf life as compared to the polymeric nanoparticles present in the art.
  • the polymeric nanoparticles of the present disclosure are prepared to be biodegradable so that the degradation products may be readily excreted from the body.
  • the degradation also provides a method by which the encapsulated contents in the nanoparticle can be released at a site within the body.
  • Poly(lactic acid) is a hydrophobic polymer, and is the preferred polymer for synthesis of the polymeric nanoparticles of the instant disclosure.
  • poly (gly colic acid) PGA
  • block copolymer of poly lactic acid-co-gly colic acid PLGA
  • the hydrophobic polymer can also be biologically derived or a biopolymer.
  • the molecular weight of the PLA used is generally in the range of about 2,000 g/mol to 80,000 g/mol.
  • the PLA used is in the range of about 2,000 g/mol to 80,000 g/mol.
  • the average molecular weight of PLA may also be about 72,000 g/mol.
  • one g/mole is equivalent to one "dalton" (i.e., dalton and g/mol are
  • Block copolymers like poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) (PEG-PPG-PEG), poly(methyl methacrylate)-poly(methylacrylic acid) (PMMA- PMAA), poly(styrene)-poly(acrylic acid) (PS-PAA), poly(acrylic acid)-poly(vinylpyridine) (PAA-PVP), poly(acrylic acid)-poly(N,N-dimethylaminoethyl methacrylate) (PAA- PDMAEMA), polyethylene glycol)-poly(butylene glycol) (PEG-PBG) and PG-PR
  • Polyglycerol (PG) and its copolymers with polyester (PR) including adipic acid, pimelic acid and sebecic acid) are hydrophilic or hydrophilic-hydrophobic copolymers that can be used in the present technology and include ABA type block copolymers such as PEG-PPG-PEG, BAB block copolymers such as PPG-PEG-PPG, (AB) n type alternating multiblock copolymers and random multiblock copolymers.
  • Block copolymers may have two, three or more numbers of distinct blocks.
  • PEG is a preferred component as it imparts hydrophilicity, anti-phagocytosis against macrophage and resistance to immunological recognition.
  • the average molecular weight (M n ) of the hydrophilic- hydrophobic block copolymer is generally in the range of 1,000 to 20,000 g/mol. In a further embodiment, the average molecular weight (M n ) of the hydrophilic-hydrophobic block copolymer is about 4,000 g/mol to 15,000 g/mol. In some cases, the average molecular weight (M n ) of the hydrophilic-hydrophobic block copolymer is 4,400 g/mol, 8,400 g/mol, or 14,600 g/mol.
  • a block copolymer of the instant disclosure can consist essentially of a segment of poly(lactic acid) (PLA) and a segment of poly(ethylene glycol)-poly(propylene glycol)- polyethylene glycol) (PEG-PPG-PEG).
  • a specific biodegradable polymeric nanoparticle of the instant disclosure is formed of the block copolymer poly(lactic acid)-poly(ethylene glycol)-poly(propylene glycol)- poly(ethylene glycol) (PLA-PEG-PPG-PEG).
  • Another specific biodegradable polymeric nanoparticle of the instant disclosure is formed of the block copolymer poly (lactic acid)-poly (ethylene glycol)-poly (propylene glycol)-poly(ethylene glycol)-poly(lactic acid) (PLA-PEG-PPG-PEG-PLA).
  • biodegradable polymers of the instant disclosure are formable by chemically modifying PLA with a hydrophilic-hydrophobic block copolymer using a covalent bond.
  • biodegradable polymeric nanoparticles of the instant disclosure have a size in the range of about 30-120 nm.
  • the biodegradable polymer of the instant disclosure is substantially free of emulsifier, or may comprise extemal emulsifier by an amount of about 0.5% to 5% by weight.
  • the biodegradable polymeric nanoparticle of the present disclosure is PLA-PEG-PPG-PEG, and the average molecular weight of the poly(lactic acid) block is about 60,000 g/mol, the average weight of the PEG-PPG-PEG block is about 8,400 or about 14,600 g/mol, and the external emulsifier is about 0.5% to 5% by weight.
  • the biodegradable polymeric nanoparticle of the present disclosure is PLA-PEG-PPG-PEG, and the average molecular weight of the poly(lactic acid) block is less than or equal to approximately 16,000 g/mol, the average weight of the PEG- PPG-PEG block is about 8,400 g/mol or about 14,600 g/mol, and wherein the composition is substantially free of emulsifier.
  • the process for preparing biodegradable polymeric nanoparticles of the instant disclosure comprises dissolving poly(lactic acid) (PLA) and a hydrophilic-hydrophobic block copolymer in an organic solvent to obtain a solution; adding a carbodiimide coupling agent and a base to the solution to obtain a reaction mixture; stirring the reaction mixture to obtain a block copolymer of PLA chemically modified with the hydrophilic-hydrophobic block copolymer; dissolving the block copolymer from the previous step in organic solvent and homogenizing to obtain a homogenized mixture; adding the homogenized mixture to an aqueous phase to obtain an emulsion; and stirring the emulsion to obtain the polymeric nanoparticles.
  • PLA poly(lactic acid)
  • a hydrophilic-hydrophobic block copolymer in an organic solvent
  • adding a carbodiimide coupling agent and a base to the solution to obtain a reaction mixture
  • stirring the reaction mixture to obtain a block copolymer
  • Carbodiimide coupling agents are well-known in the art. Suitable carbodiimide coupling agents include, but are not limited to, N,N-dicyclohexylcarbodiimide (DCC), N-(3- diethylaminopropyl)-N-ethylcarbodiimide (EDC), and N,N-diisopropylcarbodiimide.
  • DCC N,N-dicyclohexylcarbodiimide
  • EDC diethylaminopropyl
  • EDC N-diisopropylcarbodiimide
  • the coupling reaction is usually carried out in the presence of catalysts and/or auxiliary bases such as trialkylamines, pyridine, or 4-dimethylamino pyridine (DMAP).
  • catalysts and/or auxiliary bases such as trialkylamines, pyridine, or 4-dimethylamino pyridine (DMAP).
  • the coupling reaction can be also carried out in combination with a
  • hydroxy derivative such as N-hydroxysuccinimide (NHS).
  • Other hydroxyderivatives include, but are not limited to, 1-hydroxybenzotriazole (HOBt), l-hydroxy-7-azabenzotriazole (HO At), 6-chloro- 1-hydroxybenzotriazole (Cl-HOBt).
  • Organic solvents useful in the preparation of the nanoparticles prepared herein are suitably acetonitrile (C 2 H 3 N), dimethyl formamide (DMF; C 3 H 7 NO), acetone ((CH 3 ) 2 CO) and dichloromethane (CH2CI2).
  • the process described above can optionally comprise the additional steps of washing the biodegradable polymeric nanoparticles with water, and drying the polymeric
  • the process may also optionally comprise a first step of adding emulsifier.
  • the nanoparticles resulting from this process may have a size in the range of 30-120 nm.
  • the PLA and the copolymer, PEG-PPG-PEG are dissolved in an organic solvent to obtain a polymeric solution.
  • N,N- dicyclohexylcarbodiimide (DCC) is added followed by 4-dimethylaminopyridine (DMAP) at -4°C to 0°C.
  • DCC N,N- dicyclohexylcarbodiimide
  • DMAP 4-dimethylaminopyridine
  • the solution is allowed to stir at 250 to 300 rpm at a low temperature ranging from -4°C to 0°C for 20 to 28 hours.
  • the nanoparticles of PLA-PEG-PPG-PEG have PLA covalently linked to PEG-PPG-PEG to form a PLA-PEG-PPG-PEG matrix.
  • nanoparticles are precipitated by an organic solvent like diethyl ether, methanol or ethanol and separated from the solution by conventional methods in the art including filtration, ultracentrifugation or ultrafiltration.
  • the nanoparticles are stored in a temperature ranging from 2°C to 8°C.
  • the process of the present disclosure provides the added advantage of not requiring additional steps of freezing or the use of decoy proteins as none, or a minimal amount, of emulsifiers are used in the process.
  • the process of preparing the nanoparticles of the instant disclosure is easily carried out in ambient room temperature conditions of 25°C-30°C and does not require excessive shearing to obtain the desired small particle size.
  • FIG. 2 A Fourier-transform infrared (FTIR) spectrum of one example of nanoparticles of the present disclosure is provided in FIG. 2.
  • the nuclear magnetic resonance (NMR) spectra of the nanoparticles are provided in FIGS. 3A, 3B, and 3C.
  • the nanoparticle is substantially spherical in configuration as shown in the TEM images of FIGS. 4A and 4B, however, the nanoparticles can adopt a non-spherical configuration upon swelling or shrinking.
  • the nanoparticle is amphiphilic in nature.
  • the zeta potential and PDI (Polydispersity Index) of the nanoparticles are provided in Table 2.
  • Storage stability of the nanoparticles of the present disclosure is better compared to the conventional emulsifier based systems as there is no addition of any free emulsifiers to the process and the block copolymer comprising the PEG moiety is covalently linked in the overall PLA-PEG-PPG-PEG matrix.
  • the storage shelf life of the nanoparticle ranges from 6 to 18 months.
  • the nanoparticles of the present disclosure have dimensions ranging from 30-120 nm as measured using a Transmission Electron Microscope (FIG. 4).
  • the diameter of the nanoparticles of the present disclosure will be less than 200 nm in diameter, and more suitably less than about 100 nm in diameter. In certain such
  • the nanoparticles of the present disclosure will be in the range of about 10 to 200 nm, in the range of about 20 to 150 nm, or in the range of about 30 to 120 nm in diameter.
  • a process for preparation of biodegradable polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer comprises (a) dissolving a PEG-PPG-PEG copolymer and poly(lactic acid) (PLA) in an organic solvent to obtain a solution (b) adding ⁇ , ⁇ ,- dicyclohexylcarbodiimide (DCC) and 4-(dimethylamino) pyridine (DMAP) to the solution at a temperature in the range of -4°C to 0°C to obtain a reaction mixture (c) stirring the reaction mixture at 250 to 400 rpm at a temperature ranging from -4°C to 0°C for 20 to 28 hours to obtain the PLA-PEG-PPG-PEG block copolymer (d) dissolving the PLA-PEG-PPG-PEG block copolymer in an organic solvent and homogenizing at 250 to 400 rpm to obtain a homogenized
  • a process for preparation of biodegradable polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer comprising (a) dissolving a PEG-PPG-PEG copolymer and poly(lactic acid) (PLA) in an organic solvent to obtain a solution (b) adding ⁇ , ⁇ ,- dicyclohexylcarbodiimide (DCC) and 4-(dimethylamino) pyridine (DMAP) to the solution at a temperature in the range of -4°C to 0°C to obtain a reaction mixture (c) stirring the reaction mixture at 250 to 400 rpm at a temperature ranging from -4°C to 0°C for 20 to 28 hours to obtain the PLA-PEG-PPG-PEG block copolymer (d) dissolving the PLA-PEG-PPG-PEG block copolymer in an organic solvent and homogenizing at 250 to 400 rpm to obtain a homogenized mixture
  • a process for preparation of biodegradable polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer comprising (a) dissolving a PEG-PPG-PEG copolymer and poly-lactic acid (PLA) in an organic solvent to obtain a solution (b) adding ⁇ , ⁇ ,- dicyclohexylcarbodiimide (DCC) and 4-(dimethylamino) pyridine (DMAP) to the solution at a temperature in the range of -4°C to 0°C to obtain a reaction mixture (c) stirring the reaction mixture at 250 to 400 rpm at a temperature ranging from -4°C to 0°C for 20 to 28 hours to obtain the PLA-PEG-PPG-PEG block copolymer (d) dissolving the PLA-PEG-PPG-PEG block copolymer in an organic solvent and homogenizing at 250 to 400 rpm to obtain a homogenized mixture (
  • biodegradable polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer wherein said process comprises (a) dissolving a PEG-PPG-PEG copolymer and poly -lactic acid (PLA) in an organic solvent to obtain a solution (b) adding ⁇ , ⁇ ,-dicyclohexylcarbodiimide (DCC) and 4-(dimethylamino) pyridine (DMAP) to the solution at a temperature in the range of -4°C to 0°C to obtain a reaction mixture (c) stirring the reaction mixture at 250 to 400 rpm at a temperature ranging from -4°C to 0°C for 20 to 28 hours to obtain the PLA-PEG-PPG-PEG block copolymer (d) dissolving the PLA-PEG-PPG-PEG block copolymer in an organic solvent and homogenizing at 250 to 400 rpm to obtain a homogenized mixture (e) adding the homogenized mixture to an aqueous phase to
  • a process for preparation of biodegradable polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer comprising (a) dissolving a PEG-PPG-PEG copolymer and poly(lactic acid) (PLA) in an organic solvent to obtain a solution (b) adding ⁇ , ⁇ ,-dicyclohexylcarbodiimide (DCC) and 4- (dimethylamino) pyridine (DMAP) to the solution at a temperature in the range of -4°C to 0°C to obtain a reaction mixture (c) stirring the reaction mixture at 250 to 400 rpm at a temperature ranging from -4°C to 0°C for 20 to 28 hours to obtain the PLA-PEG-PPG-PEG block copolymer (d) dissolving the PLA-PEG-PPG-PEG block copolymer in an organic solvent and homogenizing at 250 to 400 rpm to obtain a homogenized mixture (e
  • a process for preparation of biodegradable polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer comprising (a) dissolving a PEG-PPG-PEG copolymer and poly(lactic acid) (PLA) in an organic solvent to obtain a solution (b) adding ⁇ , ⁇ ,-dicyclohexylcarbodiimide (DCC) and 4- (dimethylamino) pyridine (DMAP) to the solution at a temperature in the range of -4°C to 0°C to obtain a reaction mixture (c) stirring the reaction mixture at 250 to 400 rpm at a temperature ranging from -4°C to 0°C for 20 to 28 hours to obtain the PLA-PEG-PPG-PEG block copolymer (d) dissolving the PLA-PEG-PPG-PEG block copolymer in an organic solvent and homogenizing at 250 to 400 rpm to obtain a homogenized mixture (e
  • Another embodiment provides a biodegradable polymeric nanoparticles of PLA-PEG- PPG-PEG block copolymer obtained by the process for preparation of biodegradable polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer, wherein said process comprises (a) dissolving a PEG-PPG-PEG copolymer and poly(lactic acid) (PLA) in an organic solvent to obtain a solution (b) adding ⁇ , ⁇ ,-dicyclohexylcarbodiimide (DCC) and 4- (dimethylamino) pyridine (DMAP) to the solution at a temperature in the range of -4°C to 0°C to obtain a reaction mixture (c) stirring the reaction mixture at 250 to 400 rpm at a temperature ranging from -4°C to 0°C for 20 to 28 hours to obtain the PLA-PEG-PPG-PEG block copolymer (d) dissolving the PLA-PEG-PPG-PEG block copolymer in
  • compositions comprising the biodegradable polymeric nanoparticle of PLA-PEG-PPG-PEG block copolymer obtained by the process for preparation of biodegradable polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer, wherein said process comprises (a) dissolving a PEG-PPG-PEG copolymer and poly(lactic acid) (PLA) in an organic solvent to obtain a solution (b) adding ⁇ , ⁇ ,- dicyclohexylcarbodiimide (DCC) and 4-(dimethylamino) pyridine (DMAP) to the solution at a temperature in the range of -4°C to 0°C to obtain a reaction mixture (c) stirring the reaction mixture at 250 to 400 rpm at a temperature ranging from -4°C to 0°C for 20 to 28 hours to obtain the PLA-PEG-PPG-PEG block copolymer (d) dissolving the PLA-PEG-PPG-PEG block copolymer
  • the nanoparticles of the present disclosure are capable of delivering active agents or entities to specific sites (FIG. 5).
  • the particle size and release properties of the PLA-PEG- PPG-PEG nanoparticle of the present disclosure can be controlled by varying the molecular weight of the PLA or PEG-PPG-PEG in the polymeric matrix.
  • the release of active agent or entity can be controlled from 12 hours to 60 days which is an improvement over conventional PLA-PEG systems available in the art (FIG. 6).
  • the drug loading capacity of the nanoparticle can also be controlled by varying the average molecular weight of the block copolymer in the polymeric matrix of the nanoparticles. There is an increase in the drug loading capacity of the nanoparticle with an increase in the block length of PEG-PPG-PEG block copolymer (Table 3).
  • polymeric nanoparticles made up of PLA-PEG-PPG-PEG block copolymer are amphiphilic in nature, both hydrophobic and hydrophilic drugs can be loaded on the nanoparticles.
  • the nanoparticles of the present disclosure possess high drug loading capacity due to the absence or minimal use of emulsifiers, resulting in reducing the dose load and frequency of therapeutics.
  • the ratio of active agent or entity to nanoparticle is higher in the nanoparticles of the present disclosure compared to conventional systems employing emulsifiers, since the weight of the emulsifier can add up to 50% of the total formulation weight (International Journal of Pharmaceutics, 15 June 2011, Volume 411, Issues 1-2, Pages 178-187; International Journal of Pharmaceutics, 2010, 387: 253-262).
  • the nanoparticles help to achieve single and low dose drug delivery coupled with reduced toxicity.
  • the weight percentage of the active agent to the nanocarrier system of PLA-PEG-PPG-PEG ranges from 2-20 % to the nanoparticle. The higher drug loading in the nanoparticle reduces the drug dose requirement since the effective dose can be administered at a reduced dosage level.
  • the enhanced internal loading in the polymeric nanoparticles with a prolonged activity of the loaded entities without hampering the total loading capacity of the nanoparticle leads to an effective delivery of highly potential therapeutics.
  • the efficacy of the anticancer peptide, L-NuBCP-9, also referred to herein as "NuBCP-9” (L-configuration of amino acid sequence FSRSLHSLL) loaded into a nanoparticle formulation is higher compared to the free peptide drug formulation and the conventional cell-penetrating peptide conjugated drug formulation in Primary HUVEC cell lines.
  • the PLA-PEG-PPG-PEG nanoparticles of the present disclosure are nontoxic as confirmed by in vitro cell line studies and in vivo mouse model studies. Hematological parameters assessed in mice treated with PLA-PEG-PPG-PEG nanoparticles at a dose of 150 mg/kg body weight showed no significant change in the complete blood count, red blood count, white blood count, neutrophil and lymphocyte levels with the control group (FIGS. 7A, 7B and 7C). Biochemical parameters assessed for liver and kidney functions showed no significant change in the total protein, albumin and globulin levels between the control and the nanoparticle-treated groups.
  • the levels of the liver enzymes, alanine transaminase (ALT), aspartate transaminase (AST) and alkaline phosphatase (ALP) were non-significantly increased in the PLA-PEG-PPG-PEG nanoparticle treated group compared to control group, as seen in FIGS. 8A and 8B.
  • the histopathology of the organs, brain, heart, liver, spleen, kidney and lung of mice injected with PLA-PEG-PPG-PEG nanoparticles is shown in FIG. 9.
  • the nanoparticles of the present disclosure can encapsulate and/or adsorb one or more entities.
  • entity can also be conjugated to directly to the block copolymer of the biodegradable nanoparticle.
  • Entities of the present disclosure include but are not limited to, small organic molecules, nucleic acids, polynucleotides, oligonucleotides, nucleosides, DNA, RNA, SiRNA, amino acids, peptides, protein, amines, antibodies and variants thereof, antibiotics, low molecular weight molecules, chemotherapeutics, drugs or therapeutic agents, metal ions, dyes, radioisotope, contrast agent, and/or imaging agents.
  • Suitable molecules that can be encapsulated are therapeutic agents. Included in therapeutic agents are proteins or peptides or fragments thereof, insulin, etc., hydrophobic drugs like doxorubicin, paclitaxil, gemcetabin, docetaxel etc; antibiotics like amphotericin B, isoniazid (INH) etc., and nucleic acids. Therapeutic agents also include chemotherapeutics such as paclitaxel, doxorubicin pimozide, perimethamine, indenoisoquinolines, or nor- indenoisoquinolines.
  • the therapeutic agent can comprise natural or non-natural (synthetic) amino acids.
  • Non-limiting examples include bicyclic compounds and peptidomimetics such as cyclic peptidomimetics.
  • the therapeutic agent comprises a peptide.
  • the peptide comprises an amino acid analog, e.g., cyanoalanine, canavanine, djenkolic acid, norleucine, 3-phosphoserine, homoserine, ihydroxyphenylalanine, 5-hydroxytryptophan, 1-methylhistidine, 3-methylhistidine, diaminopimelic acid, ornithine, or diaminobutyric acid.
  • the peptide comprises a modifying group.
  • the modifying group is an acyl group, for example, formyl, dansyl, acetyl, benzoyl, trifluoroacetyl, succinyl, and methoxysuccinyl; an aromatic group, for example, benzyloxycarbonyl (Cbz); or an aliphatic group, for example, t-butoxycarbonyl (Boc) or 9-Fluorenylmethoxycarbonyl (Fmoc).
  • the modifying group is attached to the N-terminus or C-terminus of the peptide.
  • the peptide is a linear peptide.
  • the peptide is a cyclic peptide.
  • the peptide is a stapled peptide comprising a synthetic linkage between at least two non-contiguous amino acid residues.
  • the stapled peptide comprises an alpha-helix.
  • a "stapled peptide” is a peptide comprising a selected number (e.g. , less than 20, 25 or 30) of standard or non-standard amino acids, further comprising at least one cross-linker between the at least two moieties. Stapled peptides and method of synthesis have been disclosed in U.S. Patent Nos. 8,592,377 and 8,586,707, and Walensky et al. (Science 305(5689): 1466-70), which are incorporated by reference in their entirety.
  • the cross-linker is a hydrocarbon chain.
  • the two moieties are conjugated to two amino acids having 2, 3, or 6 amino acids in between.
  • the stapled peptide has improved stability, resistance to proteases, or cell-penetrating ability as compared to a corresponding peptide without cross-linker.
  • the therapeutic agent comprises a natural or non-natural polynucleotide.
  • Non-limiting examples include DNA, RNA, and a morpholino comprising natural and/or non-natural nucleotides.
  • the polynucleotide comprises one or more modifications selected from the group consisting of phosphorothioate bond replacing the phosphate bond, 2'-0-methylation on the nucleoside, and modifications on the terminal nucleosides.
  • the modification protects the polynucleotide from degradation.
  • the modification prevents ligation of the polynucleotide with another polynucleotide in vitro or in a cell.
  • the modification increases the efficiency of transcription or translation.
  • Targeted delivery of the nanoparticles loaded with anticancer drugs can be achieved compared to the free drug formulations prevalent in the art.
  • the nanoparticles of the present disclosure can also be surface conjugated, bioconjugated, or adsorbed with one or more entities including targeting moieties on the surface of nanoparticles.
  • Targeting moieties cause nanoparticles to localize onto a tumor or a disease site and release a therapeutic agent.
  • the targeting moiety can bind to or associate with a linker molecules.
  • Targeting molecules include but are not limited to antibody molecules, growth receptor ligands, vitamins, peptides, haptens, aptamers, and other targeting molecules known to those skilled in the art.
  • Targets and imaging molecules can also be attached to the targeting moieties on the surface of the nanoparticles directly or via linker molecules.
  • targeting moieties include vitamins, ligands, amines, peptide fragments, antibodies, aptamers, a transferrin, an antibody or fragment thereof, sialyl Lewis X antigen, hyaluronic acid, mannose derivatives, glucose derivatives, cell specific lectins, galaptin, galectin, lactosylceramide, a steroid derivative, an RGD sequence, EGF, EGF-binding peptide, urokinase receptor binding peptide, a thrombospondin- derived peptide, an albumin derivative and/or a molecule derived from combinatorial chemistry.
  • the nanoparticles of the present disclosure may be surface functionalized and/or conjugated to other molecules of interest.
  • Small low molecular weight molecules like folic acid, prostate membrane specific antigen (PSMA), antibodies, aptamers, molecules that bind to receptors or antigens on the cell surface etc.
  • PSMA prostate membrane specific antigen
  • the matrix comprises of polymer and an entity.
  • the entity or targeting moiety can be covalently associated with surface of polymeric matrix.
  • Therapeutic agents can be associated with the surface of the polymeric matrix or encapsulated throughout the polymeric matrix of the nanoparticles. Cellular uptake of the conjugated nanoparticle is higher compared to plain nanoparticles.
  • the nanoparticle of the present disclosure can comprise one or more agents attached to the surface of nanoparticle via methods well known in the art and also encapsulate one or more agents to function as a multifunctional nanoparticle.
  • the nanoparticles of the present disclosure can function as multi-functional nanoparticles that can combine tumor targeting, tumor therapy and tumor imaging in an all-in-one system, providing a useful multi-modal approach in the battle against cancer.
  • the multifunctional nanoparticle can have one or more active agents with similar or different mechanisms of actions, similar or different sites of action; or similar and different functions.
  • Entity encapsulation in the PLA-PEG-PPG-PEG nanoparticle is prepared by emulsion precipitation method.
  • the PLA-PEG-PPG-PEG polymeric nanoparticle prepared using the process of the present disclosure is dissolved in an organic solvent comprising an organic solvent.
  • the entity is added to the polymeric solution in the weight range of 10-20% weight of the polymer.
  • the polymeric solution is then added drop-wise to the aqueous phase and stirred at room temperature for 10-12 hours to allow for solvent evaporation and nanoparticle stabilization.
  • the entity-loaded nanoparticles are collected by centrifugation, dried, and stored at 2°C - 8°C until further use.
  • Other additives like sugars, amino acids, methyl cellulose etc., may be added to the aqueous phase in the process for the preparation of the entity -loaded polymeric nanoparticles.
  • the entity-loading capacity of the nanoparticles of the present disclosure is high, reaching nearly about 70-90% as shown in Table 3.
  • the PLA-PEG-PPG-PEG based nanocarrier system of the present disclosure prevents premature degradation and effective and targeted delivery of anticancer peptide to the cancer cells.
  • Surface foliated biodegradable PLA-PEG-PPG-PEG nanoparticles encapsulating therapeutic peptides such as NuBCP-9, Bax BH3 etc., in the core can be effectively delivered into the cytosol of the cancer cells without the use of any cell penetrating peptides.
  • FIG. 7B shows the efficacy of the nanoparticles for sustained release and efficient delivery of drug compared with free drug formulations in the MCF-7 cell lines.
  • higher loading of the entity in the PLA-PEG-PPG-PEG nanoparticles is achieved by linking the active agent with low molecular weight PLA.
  • the entity is covalently linked with low molecular weight PLA by a reaction with a carbodiimide coupling reagent in combination with a hydroxy derivative.
  • the carbodiimide coupling agent is ethyl-dimethyl aminopropylcarbodiimide and the hydroxy derivative is N- hydroxy-succinimide (EDC/NHS) chemistry.
  • EDC/NHS N- hydroxy-succinimide
  • the molecular weight of PLA is in the range of about 2,000-10,000 g/mol.
  • nanoparticles of PLA-PEG-PPG-PEG block copolymer comprising one or more entities (e.g., one or more therapeutic agents).
  • the one or more entities comprise an MCL-1 antagonist.
  • a process for preparing biodegradable polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer comprising one or more entities (e.g. , one or more therapeutic agents), wherein said process comprises (a) homogenizing the entity with the polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer dissolved in an organic solvent at 250 to 400 rpm to obtain a primary emulsion (b) emulsifying the primary emulsion in an aqueous phase at 250 to 400 rpm to obtain a secondary emulsion, and (c) stirring the secondary emulsion at 25°C to 30°C at 250 to 400 rpm for 10 to 12 hours to obtain the nanoparticle of PLA-PEG-PPG-PEG comprising the entity.
  • entities e.g. , one or more therapeutic agents
  • a process for preparing biodegradable polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer comprising at least one entity comprises (a) homogenizing the entity with the polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer dissolved in an organic solvent at 250 to 400 rpm to obtain a primary emulsion (b) emulsifying the primary emulsion in an aqueous phase at 250 to 400 rpm to obtain a secondary emulsion, and (c) stirring the secondary emulsion at 25°C to 30°C at 250 to 400 rpm for 10 to 12 hours to obtain the nanoparticle of PLA-PEG-PPG-PEG comprising the entity, wherein said process optionally comprises the steps of washing the nanoparticles of PLA-PEG-PPG-PEG block copolymer comprising the entity with water and drying the nanoparticles by conventional method.
  • a process for preparing biodegradable polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer comprising at least one entity
  • said process comprises (a) homogenizing the entity with the polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer dissolved in an organic solvent at 250 to 400 rpm to obtain a primary emulsion (b) emulsifying the primary emulsion in an aqueous phase at 250 to 400 rpm to obtain a secondary emulsion, and (c) stirring the secondary emulsion at 25°C to 30°C at 250 to 400 rpm for 10 to 12 hours to obtain the nanoparticle of PLA-PEG-PPG-PEG comprising the entity, wherein the entity is selected from a group consisting of small organic molecules, nucleic acids, polynucleotides, oligonucleotides, nucleosides, DNA, RNA, amino acids, peptides, protein,
  • a process for preparing biodegradable polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer comprising at least one entity
  • said process comprises (a) homogenizing the entity with the polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer dissolved in an organic solvent at 250 to 400 rpm to obtain a primary emulsion (b) emulsifying the primary emulsion in an aqueous phase at 250 to 400 rpm to obtain a secondary emulsion, and (c) stirring the secondary emulsion at 25°C to 30°C at 250 to 400 rpm for 10 to 12 hours to obtain the nanoparticle of PLA-PEG-PPG-PEG comprising the entity, wherein the entity is a targeting moiety selected from the group consisting of vitamins, ligands, amines, peptide fragment, antibodies and aptamers.
  • a process for preparing biodegradable polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer comprising at least one entity comprises (a) homogenizing the entity with the polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer dissolved in an organic solvent at 250 to 400 rpm to obtain a primary emulsion (b) emulsifying the primary emulsion in an aqueous phase at 250 to 400 rpm to obtain a secondary emulsion, and (c) stirring the secondary emulsion at 25°C to 30°C at 250 to 400 rpm for 10 to 12 hours to obtain the nanoparticle of PLA-PEG-PPG-PEG comprising the entity, wherein the entity is linked to PLA.
  • a process for preparing biodegradable polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer comprising at least one entity, wherein said process comprises (a) homogenizing the entity with the polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer dissolved in an organic solvent at 250 to 400 rpm to obtain a primary emulsion (b) emulsifying the primary emulsion in an aqueous phase at 250 to 400 rpm to obtain a secondary emulsion, and (c) stirring the secondary emulsion at 25°C to 30°C at 250 to 400 rpm for 10 to 12 hours to obtain the nanoparticle of PLA-PEG-PPG-PEG comprising the entity, wherein the entity is linked to PLA of molecular weight in the range of 2,000 g/mol to 10,000 g/mol.
  • PPG-PEG comprising at least one entity obtained by the process comprising (a)
  • compositions comprising the biodegradable polymeric nanoparticle of PLA-PEG-PPG-PEG comprising at least one entity obtained by the process comprising (a) homogenizing the entity with the polymeric nanoparticles of PLA-PEG-PPG- PEG block copolymer dissolved in an organic solvent at 250 to 400 rpm to obtain a primary emulsion (b) emulsifying the primary emulsion in an aqueous phase at 250 to 400 rpm to obtain a secondary emulsion, and (c) stirring the secondary emulsion at 25°C to 30°C at 250 to 400 rpm for 10 to 12 hours to obtain the nanoparticle of PLA-PEG-PPG-PEG comprising the entity.
  • composition comprising the biodegradable polymeric nanoparticle of PLA-PEG-PPG-PEG comprising at least one entity obtained by the process comprising (a) homogenizing the entity with the polymeric nanoparticles of PLA- PEG-PPG-PEG block copolymer dissolved in an organic solvent at 250 to 400 rpm to obtain a primary emulsion (b) emulsifying the primary emulsion in an aqueous phase at 250 to 400 rpm to obtain a secondary emulsion, and (c) stirring the secondary emulsion at 25°C to 30°C at 250 to 400 rpm for 10 to 12 hours to obtain the nanoparticle of PLA-PEG-PPG-PEG comprising the entity, wherein the composition optionally comprises at least one
  • pharmaceutical excipient selected from the group consisting of preservative, antioxidant, thickening agent, chelating agent, isotonic agent, flavoring agent, sweetening agent, colorant, solubilizer, dye, flavors, binder, emollient, fillers, lubricants and preservative.
  • a pharmaceutical agent that can be delivered by the nanoparticles disclosed herein comprises a chemotherapeutic drug, e.g. , paclitaxel, an anticancer peptide, e.g., a peptide comprising an amino acid sequence which is at least 75% identical to MS-1 peptide (SEQ ID NO: 1), or a polynucleotide, e.g. , a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 75% identical to MS- 1 peptide (SEQ ID NO: 1).
  • chemotherapeutic drug e.g. , paclitaxel
  • an anticancer peptide e.g., a peptide comprising an amino acid sequence which is at least 75% identical to MS-1 peptide (SEQ ID NO: 1)
  • a polynucleotide e.g. , a polynucleotide encoding a peptide comprising an amino
  • the amino acid sequence is at least 80% identical to SEQ ID NO: 1. In certain embodiments, the amino acid sequence is at least 85% identical to SEQ ID NO: 1. In certain embodiments, the amino acid sequence is at least 90% identical to SEQ ID NO: 1. In certain embodiments, the amino acid sequence is at least 95% identical to SEQ ID NO: 1. In certain embodiments, the amino acid sequence is 100% identical to SEQ ID NO: 1. In certain embodiments, when delivered via a nanoparticle, the in vitro activity of the pharmaceutical agent against cancer cell proliferation, survival or colony formation is synergistically increased.
  • the pharmaceutical agent comprises a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 75% identical to SEQ ID NO: 1.
  • the polynucleotide comprises a sequence at least 75% identical to SEQ ID NO: 2.
  • the polynucleotide comprises a sequence at least 80% identical to SEQ ID NO: 2.
  • the polynucleotide comprises a sequence at least 85% identical to SEQ ID NO: 2.
  • the polynucleotide comprises a sequence at least 90% identical to SEQ ID NO: 2.
  • the polynucleotide comprises a sequence at least 95% identical to SEQ ID NO: 2.
  • the polynucleotide comprises a sequence 100% identical to SEQ ID NO: 2.
  • the pharmaceutical agent comprises a polynucleotide comprising a sequence which is at least 75%, 80%, 85%, 90%, 95% or 100% identical to 10 contiguous nucleotides in SEQ ID NOs: 3, 4 or 5, or a sequence complementary thereto. In certain embodiments, the pharmaceutical agent comprises a polynucleotide comprising a sequence which is at least 80%, 85%, 90%, 95% or 100% identical to 9 contiguous nucleotides in SEQ ID NOs: 3, 4 or 5, or a sequence complementary thereto.
  • the pharmaceutical agent comprises a polynucleotide comprising a sequence which is at least 85%, 90%, 95% or 100% identical to 8 contiguous nucleotides in SEQ ID NOs: 3, 4 or 5, or a sequence complementary thereto. In certain embodiments, the pharmaceutical agent comprises a polynucleotide comprising a sequence which is at least 90%, 95% or 100% identical to 7 contiguous nucleotides in SEQ ID NOs: 3, 4 or 5, or a sequence complementary thereto.
  • the therapeutic agent comprises a peptide.
  • the peptide comprises an amino acid analog, e.g. , cyanoalanine, canavanine, djenkolic acid, norleucine, 3-phosphoserine, homoserine, ihydroxy phenylalanine, 5- hydroxytryptophan, 1 -methylhistidine, 3-methylhistidine, diaminopimelic acid, ornithine, or diaminobutyric acid.
  • the peptide comprises a modifying group.
  • the modifying group is an acyl group, for example, formyl, dansyl, acetyl, benzoyl, trifluoroacetyl, succinyl, and methoxysuccinyl; an aromatic group, for example, benzyloxycarbonyl (Cbz); or an aliphatic group, for example, t-butoxycarbonyl
  • the modifying group is attached to the N-terminus or C-terminus of the peptide.
  • the peptide is a linear peptide.
  • the peptide is a cyclic peptide.
  • the peptide is a stapled peptide comprising a synthetic linkage between at least two non-contiguous amino acid residues.
  • the stapled peptide comprises an alpha-helix.
  • a "stapled peptide" is a peptide comprising a selected number (e.g.
  • the cross-linker is a hydrocarbon chain.
  • the two moieties are conjugated to two amino acids having 2, 3, or 6 amino acids in between.
  • the stapled peptide has improved stability, resistance to proteases, or cell-penetrating ability as compared to a corresponding peptide without cross-linker.
  • the therapeutic agent comprises a natural or non-natural polynucleotide.
  • Non-limiting examples include DNA, RNA, and a morpholino comprising natural and/or non-natural nucleotides.
  • the polynucleotide comprises one or more modifications selected from the group consisting of phosphorothioate bond replacing the phosphate bond, 2'-0-methylation on the nucleoside, and modifications on the terminal nucleosides.
  • the modification protects the polynucleotide from degradation.
  • the modification prevents ligation of the polynucleotide with another polynucleotide in vitro or in a cell.
  • the modification increases the efficiency of transcription or translation.
  • a polymeric nanoparticle comprising a poly (lactic acid)-poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) (PLA-PEG-PPG- PEG) tetra block copolymer, wherein the polymeric nanoparticle is loaded with
  • the polymeric nanoparticle is loaded with a peptide comprising the amino acid sequence of SEQ ID NO: 1.
  • the molecular weight of the PLA is between about 2,000 and about
  • the PLA-PEG-PPG-PEG tetra block copolymer is formed from chemical conjugation of PEG-PPG-PEG tri-block copolymer with PLA, and wherein the PEG-PPG-PEG tri-block copolymer can be of different molecular weights.
  • the polymeric nanoparticle is further loaded with a
  • chemotherapeutic agent or a targeted anti-cancer agent.
  • the polymeric nanoparticle is further loaded with a peptide comprising NuBCP-9. In another embodiment, the polymeric nanoparticle is further loaded with a peptide comprising MUC1.
  • the chemotherapeutic agent is paclitaxel.
  • the polymeric nanoparticle is loaded with paclitaxel and a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 in a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1 :9.
  • the chemotherapeutic agent is paclitaxel.
  • the polymeric nanoparticle is loaded with paclitaxel and a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 in a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1 :9.
  • the chemotherapeutic agent is gemcitabine.
  • the polymeric nanoparticle is loaded with gemcitabine and a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 in a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1 :9.
  • the chemotherapeutic agent is gemcitabine.
  • the polymeric nanoparticle is loaded with gemcitabine and a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 in a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1 :9.
  • the chemotherapeutic agent or targeted anti-cancer agent is selected from the group consisting of doxorubicin, daunorubicin, decitabine, irinotecan, 7- ethyl-10-hydroxy-camptothecin (SN-38), cytarabine, docetaxel, triptolide (a diterpinoid epoxide), geldanamycin (a HSP90 inhibitor), tanespimycin (17-N-allylamino-17- demethoxygeldanamycin; 17-AAG), fluorouracil (5-FU), oxaliplatin, carboplatin, taxotere, methotrexate, and bortezomib.
  • the polymeric nanoparticle consists essentially of a poly(lactic acid)-poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) (PLA-PEG-PPG- PEG) tetra block copolymer.
  • a polymeric nanoparticle comprising
  • a disease selected from the group consisting of an autoimmune disease, an inflammatory disease, a metabolic disorder, a developmental disorder, a cardiovascular disease, a liver disease, an intestinal disease, an infectious disease, an endocrine disease and a neurological disorder.
  • the polymeric nanoparticle consists essentially of a poly(lactic acid)-poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) (PLA-PEG-PPG- PEG) tetra block copolymer.
  • a polymeric nanoparticle comprising a pharmaceutical combination for use in the preparation of a medicament for the treatment or prevention of a disease such as cancer.
  • the polymeric nanoparticle comprising the pharmaceutical combination is for use in the preparation of a medicament for the treatment of cancer.
  • the present disclosure provides for the use of the biodegradable polymeric nanoparticle consisting essentially of PLA-PEG-PPG-PEG block copolymer comprising a pharmaceutical combination for the manufacture of a medicament.
  • composition comprising the polymeric nanoparticle, wherein the polymeric nanoparticle comprises a pharmaceutical agent (e.g., a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1, a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1, a pharmaceutical agent (e.g., a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1, a pharmaceutical agent (e.g., a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1, a pharmaceutical agent (e.g., a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1, a pharmaceutical
  • the therapeutic agent comprises a peptide.
  • the peptide comprises an amino acid analog, e.g., cyanoalanine, canavanine, djenkolic acid, norleucine, 3-phosphoserine, homoserine, ihydroxy phenylalanine, 5- hydroxytryptophan, 1 -methylhistidine, 3-methylhistidine, diaminopimelic acid, omithine, or diaminobutyric acid.
  • the peptide comprises a modifying group.
  • the modifying group is an acyl group, for example, formyl, dansyl, acetyl, benzoyl, trifluoroacetyl, succinyl, and methoxysuccinyl; an aromatic group, for example, benzyloxycarbonyl (Cbz); or an aliphatic group, for example, t-butoxycarbonyl (Boc) or 9-Fluorenylmethoxycarbonyl (Fmoc).
  • the modifying group is attached to the N-terminus or C-terminus of the peptide.
  • the peptide is a linear peptide.
  • the peptide is a cyclic peptide.
  • the peptide is a stapled peptide comprising a synthetic linkage between at least two non-contiguous amino acid residues.
  • the stapled peptide comprises an alpha-helix.
  • a "stapled peptide” is a peptide comprising a selected number (e.g. , less than 20, 25 or 30) of standard or non-standard amino acids, further comprising at least one cross-linker between the at least two moieties. Stapled peptides and their methods of synthesis have been disclosed in U.S. Patent Nos. 8,592,377 and 8,586,707, and Walensky et al. (Science 305(5689): 1466-70), which are incorporated by reference in their entirety.
  • the cross-linker is a hydrocarbon chain.
  • the two moieties are conjugated to two amino acids having 2, 3, or 6 amino acids in between.
  • the stapled peptide has improved stability, resistance to proteases, or cell-penetrating ability as compared to a corresponding peptide without cross-linker.
  • the therapeutic agent comprises a natural or non-natural polynucleotide.
  • Non-limiting examples include DNA, RNA, and a morpholino comprising natural and/or non-natural nucleotides.
  • the polynucleotide comprises one or more modifications selected from the group consisting of phosphorothioate bond replacing the phosphate bond, 2'-0-methylation on the nucleoside, and modifications on the terminal nucleosides.
  • the modification protects the polynucleotide from degradation.
  • the modification prevents ligation of the polynucleotide with another polynucleotide in vitro or in a cell.
  • the modification increases the efficiency of transcription or translation.
  • polymeric nanoparticles comprising a pharmaceutical agent for the manufacture of a medicament for the treatment or prevention of a disease, such as cancer.
  • the use of a polymeric nanoparticle comprising a pharmaceutical combination is for the manufacture of a medicament for the treatment of a disease such as cancer.
  • the polymeric nanoparticle further comprises a targeting moiety attached to the outside of the polymeric nanoparticle, and wherein the targeting moiety is an antibody, peptide, or aptamer.
  • composition comprising
  • polymeric nanoparticles comprising a poly(lactic acid)-poly(ethylene glycol)- poly(propylene glycol)-poly(ethylene glycol) (PLA-PEG-PPG-PEG) tetra block copolymer; b) optionally one or more chemotherapeutic agents or anti-cancer targeting agents; and
  • the composition comprises a peptide comprising the amino acid sequence of SEQ ID NO: 1.
  • the molecular weight of PLA is between about 2,000 and about 80,000 daltons.
  • the PLA-PEG-PPG-PEG tetra block copolymer is formed from chemical conjugation of PEG-PPG-PEG tri -block copolymer with PLA, and wherein the PEG-PPG-PEG tri-block copolymer can be of different molecular weights.
  • the polymeric nanoparticles are loaded with a) optionally a chemotherapeutic agent or a targeted anti-cancer agent; and b) a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1, or a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1.
  • the polymeric nanoparticle is loaded with a peptide comprising the amino acid sequence of SEQ ID NO: 1.
  • the chemotherapeutic agent is paclitaxel.
  • the polymeric nanoparticles are loaded with paclitaxel and a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 in a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1 :9.
  • the polymeric nanoparticles are loaded with paclitaxel and a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 in a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1 :9.
  • the chemotherapeutic agent is gemcitabine.
  • the polymeric nanoparticles are loaded with gemcitabine and a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 in a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1 :9.
  • the chemotherapeutic agent is gemcitabine.
  • the polymeric nanoparticles are loaded with gemcitabine and a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 in a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1 :9.
  • the chemotherapeutic agent or targeted anti-cancer agent is selected from the group consisting of doxorubicin, daunorubicin, decitabine, irinotecan, 7-ethyl-lO-hydroxy-camptothecin (SN-38), cytarabine, docetaxel, triptolide, geldanamycin, tanespimycin (17-N-allylamino-17-demethoxygeldanamycin; 17- AAG), fluorouracil (5-FU), oxaliplatin, carboplatin, taxotere, methotrexate, bortezomib, a peptide comprising NuBCP-9, or a polynucleotide encoding a peptide comprising NuBCP-9.
  • a pharmaceutical composition comprising a) polymeric nanoparticles comprising a poly (lactic acid)-poly (ethylene glycol)- poly(propylene glycol)-poly(ethylene glycol) (PLA-PEG-PPG-PEG) tetra block copolymer; b) optionally one or more therapeutic agents; and
  • a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1,
  • a disease selected from the group consisting of cancer, an autoimmune disease, an inflammatory disease, a metabolic disorder, a developmental disorder, a cardiovascular disease, liver disease, an intestinal disease, an infectious disease, an endocrine disease and a neurological disorder.
  • the composition is for use in treating cancer.
  • the cancer is breast cancer, prostate cancer, non-small cell lung cancer, metastatic colon cancer, pancreatic cancer, or a hematological malignancy.
  • the cancer is breast cancer.
  • a pharmaceutical composition comprising a) polymeric nanoparticles comprising a poly(lactic acid)-poly(ethylene glycol)- poly(propylene glycol)-poly(ethylene glycol) (PLA-PEG-PPG-PEG) tetra block copolymer; b) optionally one or more therapeutic agents; and
  • a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1, for use in treating a disease selected from the group consisting of cancer, an autoimmune disease, an inflammatory disease, a metabolic disorder, a developmental disorder, a cardiovascular disease, liver disease, an intestinal disease, an infectious disease, an endocrine disease and a neurological disorder.
  • the composition is for use in treating cancer.
  • the cancer is breast cancer, prostate cancer, non-small cell lung cancer, metastatic colon cancer, pancreatic cancer, or a hematological malignancy (e.g., acute myeloid leukemia, chronic lymphocytic leukemia, multiple myeloma).
  • the cancer is breast cancer.
  • the polymeric nanoparticles consist essentially of poly(lactic acid)-poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) (PLA-PEG-PPG-PEG) tetra block copolymer.
  • the polymeric nanoparticles further comprise a targeting moiety attached to the outside of the polymeric nanoparticles, and wherein the targeting moiety is an antibody, peptide, or aptamer.
  • Suitable pharmaceutical compositions or formulations can contain, for example, from about 0.1% to about 99.9%, preferably from about 1% to about 60%, of the active ingredient(s).
  • Pharmaceutical formulations for enteral or parenteral administration are, for example, those in unit dosage forms, such as sugar-coated tablets, tablets, capsules or suppositories, or ampoules. If not indicated otherwise, these are prepared in a manner known per se, for example by means of conventional mixing, granulating, sugar-coating, dissolving or lyophilizing processes. It will be appreciated that the unit content of a combination partner contained in an individual dose of each dosage form need not in itself constitute an effective amount since the necessary effective amount may be reached by administration of a plurality of dosage units.
  • compositions can contain, as the active ingredient, one or more of the nanoparticles in combination with one or more pharmaceutically acceptable carriers (excipients).
  • the active ingredient is typically mixed with an excipient, diluted by an excipient or enclosed within such a carrier in the form of, for example, a capsule, sachet, paper, or other container.
  • the excipient serves as a diluent, it can be a solid, semi-solid, or liquid material, which acts as a vehicle, carrier or medium for the active ingredient.
  • compositions can be in the form of tablets, pills, powders, lozenges, sachets, cachets, elixirs, suspensions, emulsions, solutions, syrups, aerosols (as a solid or in a liquid medium), ointments containing, for example, up to 10% by weight of the active compound, soft and hard gelatin capsules, suppositories, sterile injectable solutions, and sterile packaged powders.
  • excipients include lactose (e.g. lactose monohydrate), dextrose, sucrose, sorbitol, mannitol, starches (e.g. sodium starch glycolate), gum acacia, calcium phosphate, alginates, tragacanth, gelatin, calcium silicate, colloidal silicon dioxide, microcrystalline cellulose, polyvinylpyrrolidone (e.g. povidone), cellulose, water, syrup, methyl cellulose, and hydroxypropyl cellulose.
  • the formulations can additionally include: lubricating agents such as talc, magnesium stearate, and mineral oil; wetting agents;
  • emulsifying and suspending agents emulsifying and suspending agents
  • preserving agents such as methyl- and propylhydroxy- benzoates
  • sweetening agents emulsifying and suspending agents
  • flavoring agents emulsifying and suspending agents
  • liquid forms in which the compounds and compositions of the present disclosure can be incorporated for administration orally or by injection include aqueous solutions, suitably flavored syrups, aqueous or oil suspensions, and flavored emulsions with edible oils such as cottonseed oil, sesame oil, coconut oil, or peanut oil, as well as elixirs and similar pharmaceutical vehicles.
  • the present disclosure provides a method for treating disease comprising administering biodegradable polymeric nanoparticles (e.g. , consisting essentially of PLA-PEG-PPG-PEG) comprising a pharmaceutical combination (i.e., more than one therapeutic agent) to a subject in need thereof.
  • biodegradable polymeric nanoparticles e.g. , consisting essentially of PLA-PEG-PPG-PEG
  • a pharmaceutical combination i.e., more than one therapeutic agent
  • the disease is selected from the group consisting of cancer, an autoimmune disease, an inflammatory disease, a metabolic disorder, a developmental disorder, a cardiovascular disease, a liver disease, an intestinal disease, an infectious disease, an endocrine disease and a neurological disorder.
  • the present disclosure provides a method for activating the
  • the BCL2A1 pathway in a mammalian cell comprising administering biodegradable polymeric nanoparticles of the instant disclosure (e.g., consisting essentially of PLA-PEG-PPG-PEG) comprising a pharmaceutical combination (i.e., more than one therapeutic agent) to a subject in need thereof.
  • the nanoparticles of the instant disclosure further include an MCL-1 antagonistic peptide.
  • the MCL-1 antagonistic peptide is at least 85% identical to SEQ ID NO: 1.
  • the MCL-1 antagonistic peptide is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to SEQ ID NO: 1.
  • the nanoparticles of the instant disclosure further include a polynucleotide encoding a MCL-1 antagonistic peptide.
  • the polynucleotide comprises a nucleic acid sequence which is at least 85% identical to SEQ ID NO: 2.
  • the polynucleotide comprises a nucleic acid sequence which is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to SEQ ID NO: 2.
  • the mammalian cells may be cancer cells (e.g. leukemia, lymphoma, breast cancer).
  • the mammalian cells may be cancer cells that are resistant to treatment with a BCL-2 antagonist.
  • the expression of mRNA encoding proteins in the MUC1-C to NF-KB p65 to BCLA2A1 pathway are increased in the cell after administration of the biodegradable polymeric nanoparticles.
  • the expression of proteins that participate in the BCLA2A1 pathway e.g. MUC1-C, NF- ⁇ p65, BCLA2A1 are increased in the cell after administration of the biodegradable polymeric nanoparticles.
  • the cells treated with the biodegradable polymeric nanoparticles may undergo apoptosis and may have reduced ability to survive following treatment.
  • PLA-PEG-PPG-PEG tetra block copolymer is loaded with a peptide.
  • the peptide comprises a amino acid analog, e.g., cyanoalanine, canavanine, djenkolic acid, norleucine, 3-phosphoserine, homoserine, ihydroxyphenylalanine, 5 -hydroxy tryptophan, 1 -methylhistidine, 3-methylhistidine, diaminopimelic acid, ornithine, or diaminobutyric acid.
  • the peptide comprises a modifying group.
  • the modifying group is an acyl group, for example, formyl, dansyl, acetyl, benzoyl, trifluoroacetyl, succinyl, and methoxysuccinyl; an aromatic group, for example, benzyloxycarbonyl (Cbz); or an aliphatic group, for example, t-butoxycarbonyl
  • the modifying group is attached to the N-terminus or C-terminus of the peptide.
  • the peptide is a linear peptide.
  • the peptide is a cyclic peptide.
  • the peptide is a stapled peptide comprising a synthetic linkage between at least two non-contiguous amino acid residues.
  • PLA-PEG-PPG-PEG tetra block copolymer is loaded with a natural or non-natural polynucleotide.
  • Non-limiting examples include DNA, RNA, and a morpholino comprising natural and/or non-natural nucleotides.
  • the polynucleotide comprises one or more modifications selected from the group consisting of phosphorothioate bond replacing the phosphate bond, 2'-0-methylation on the nucleoside, and modifications on the terminal nucleosides.
  • the modification protects the polynucleotide from degradation.
  • the modification prevents ligation of the polynucleotide with another polynucleotide in vitro or in a cell.
  • the modification increases the efficiency of transcription or translation.
  • the polymeric nanoparticle is loaded with a peptide comprising the amino acid sequence of SEQ ID NO: 1.
  • the chemotherapeutic agent is paclitaxel.
  • the polymeric nanoparticle is loaded with paclitaxel and a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 in a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1 :9.
  • the chemotherapeutic agent is paclitaxel.
  • the polymeric nanoparticle is loaded with paclitaxel and a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: lin a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1:9.
  • the chemotherapeutic agent is gemcitabine.
  • the polymeric nanoparticle is loaded with gemcitabine and a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 in a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1 :9.
  • the chemotherapeutic agent is gemcitabine.
  • the polymeric nanoparticle is loaded with gemcitabine and a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 in a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1 :9.
  • the chemotherapeutic agent or targeted anti-cancer agent is selected from the group consisting of doxorubicin, daunorubicin, decitabine, irinotecan, 7- ethyl-10-hydroxy-camptothecin (SN-38), cytarabine, docetaxel, triptolide, geldanamycin, tanespimycin (17-N-allylamino-17-demethoxy geldanamycin; 17-AAG), fluorouracil (5-FU), oxaliplatin, carboplatin, taxotere, methotrexate, bortezomib, a peptide comprising NuBCP-9, or a polynucleotide encoding a peptide comprising NuBCP-9.
  • the polymeric nanoparticle is loaded with the chemotherapeutic or targeted anti-cancer agent (e.g. , doxorubicin, daunorubicin, decitabine, irinotecan, 7-ethyl-lO-hydroxy-camptothecin (SN-38), cytarabine, docetaxel, triptolide, geldanamycin, tanespimycin (17-N-allylamino-17- demethoxygeldanamycin; 17-AAG), fluorouracil (5-FU), oxaliplatin, carboplatin, taxotere, methotrexate, or bortezomib, a peptide comprising NuBCP-9, or a polynucleotide encoding a peptide comprising NuBCP-9); and a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 or a poly
  • the cancer is breast cancer, prostate cancer, non-small cell lung cancer, metastatic colon cancer, pancreatic cancer, or a hematological malignancy (e.g. , acute myeloid leukemia, chronic lymphocytic leukemia, multiple myeloma).
  • a hematological malignancy e.g. , acute myeloid leukemia, chronic lymphocytic leukemia, multiple myeloma.
  • the cancer is breast cancer.
  • a method for treating a disease in a subject in need thereof comprising administering to the subject a therapeutically effective amount of a polymeric nanoparticle consisting essentially of a PLA-PEG-PPG-PEG terra block copolymer, wherein the polymeric nanoparticle is loaded with
  • the polymeric nanoparticle is loaded with a peptide comprising the amino acid sequence of SEQ ID NO: 1.
  • the disease selected from the group consisting of cancer, an autoimmune disease, an inflammatory disease, a metabolic disorder, a developmental disorder, a cardiovascular disease, a liver disease, an intestinal disease, an infectious disease, an endocrine disease and a neurological disorder.
  • a method for treating cancer in a subject in need thereof comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising
  • polymeric nanoparticles comprising a PLA-PEG-PPG-PEG tetra block copolymer; b) optionally a chemotherapeutic agent, an anti-cancer targeted agent, and/or an immunotherapeutic agent; and
  • the pharmaceutical composition comprises a peptide comprising the sequence of SEQ ID NO: 1.
  • the chemotherapeutic agent is paclitaxel.
  • the polymeric nanoparticles are loaded with paclitaxel and a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 in a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1 :9.
  • the chemotherapeutic agent is paclitaxel.
  • the polymeric nanoparticles are loaded with paclitaxel and a peptide comprising a polynucleotide encoding an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 in a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1 :9.
  • the chemotherapeutic agent is gemcitabine.
  • the polymeric nanoparticles are loaded with gemcitabine and a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 in a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1 :9.
  • the chemotherapeutic agent is gemcitabine.
  • the polymeric nanoparticles are loaded with gemcitabine and a peptide comprising a polynucleotide encoding an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 in a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1 :9.
  • the chemotherapeutic agent or targeted anticancer agent is selected from the group consisting of doxorubicin, daunorubicin, decitabine, irinotecan, 7-ethyl-lO-hydroxy-camptothecin (SN-38), cytarabine, docetaxel, triptolide, geldanamycin, tanespimycin (17-N-allylamino-17-demethoxygeldanamycin; 17-AAG), fluorouracil (5-FU), oxaliplatin, carboplatin, taxotere, methotrexate, bortezomib, a peptide comprising NuBCP-9, or a polynucleotide encoding a peptide comprising NuBCP-9.
  • the targeted anti-cancer agent selectively inhibits one or more of the following target proteins: receptor tyrosine kinases (e.g., epidermal growth factor receptor (EGFR), ErbB2 (also called HER2/neu), ErbB3, ErbB4, Raf family kinases, platelet- derived growth factor (PDGF-R) and vascular endothelial growth factor receptor (VEGFR)), ALK, MEK, PARP, c-KIT, CDK, insulin-like growth factor- 1 receptor, neuregulin, transforming growth factor-a, estrogen receptor (ER), progesterone receptor, BCR-ABL, and BCL-2.
  • receptor tyrosine kinases e.g., epidermal growth factor receptor (EGFR), ErbB2 (also called HER2/neu), ErbB3, ErbB4, Raf family kinases, platelet- derived growth factor (PDGF-R) and vascular endothelial growth factor receptor (VEGFR)
  • ALK
  • the targeted anti-cancer agent targeting EGFR can be selected from gefitinib, erlotinib, afatinib, osimertinib, lapatinib and necitumumab.
  • the targeted anti-cancer agent targeting HER2 can be trastuzumab or lapatinib.
  • the targeted anti-cancer agent targeting B- Raf can be vermurafinib or dabrafenib.
  • the targeted anti-cancer agent targeting a plurality of receptor tyrosine kinases can be selected from sorafenib, sunitinib.
  • the targeted anti-cancer agent targeting ALK can be selected from: crizotinib, ceritinib, and alectinib.
  • the targeted MEK inhibitor can be trametinib or cobimetinib.
  • the targeted anti-cancer agent targeting ER can be selected from tamoxifen, clomifene, raloxifene, and fulvestrant.
  • the targeted anticancer agent targeting BCR-ABL can be selected from imatinib, nilotinib, dasatinib, bosutinib, ponatinib, bafetinib.
  • the targeted anti-cancer agent targeting BCL-2 can be selected from obatoclax, navitoclax, and gossypol.
  • the immunotherapeutic agent comprises one or more monoclonal antibodies, bispecific antibodies, immune checkpoint inhibitors, T cell receptor (TCR) therapies, chimeric antigen receptor (CAR) therapies, hormone therapies, cancer vaccines, and gene therapies.
  • Monoclonal antibody immunotherapies include monoclonal antibodies that induce immune responses to cancer cells. Non-limiting examples include antibodies binding to CD20 (e.g., rituximab, ibritumomab, tositumomab, ofatumumab), antibodies binding to CD33 (e.g., gemtuzumab), antibodies binding to CD30 (e.g. , brentuximab), antibodies binding to CD52 (e.g., alemtuzumab), antibodies binding to complement component 5 (C5) (e.g., eculizumab), agonistic antibodies binding to CD20 (e.g., rituximab, ibritumomab, tositumomab, ofatum
  • TNFSF4/OX40 agonistic antibodies binding to GITR
  • agonistic antibodies binding to 4- 1BB 4- 1BB
  • Bispecific antibodies include multi-specific antibodies that target one or more tumor antigens and one or more immune cell-specific protein, thereby bringing immune cells to the proximity of cancer cells.
  • Immune checkpoint inhibitors include antagonists to immune checkpoint proteins (e.g., antagonistic antibodies binding to PD-1, PD-L1, CTLA-4, TIM3, LAG3, TIGIT, VISTA, CEACAM1 ; inhibitors to IDOl/2 and/or TDO).
  • TCR therapies may be an isolated recombinant TCR.
  • the TCR therapy comprises a cell expressing a recombinant TCR on the surface that specifically binds to a major histocompatibility complex (MHC) molecule complexed with one or more tumor antigens.
  • MHC major histocompatibility complex
  • Recombinant TCR-expressing cells may be generated by methods known in the art.
  • Host T cells may be isolated from a subject having cancer or expressing tumor antigens and transfected or transduced with nucleic acid constructs encoding a recombinant TCR, then administered to the subject from whom they were isolated (Hombach, et al. 2001, Cancer Res. 61 : 1976-1982, incorporated by reference herein in its entirety).
  • CAR therapies may comprise a cell expressing a chimeric antigen receptor on the surface that specifically binds to a tumor antigen.
  • CAR-expressing cells may be generated by methods known in the art, and may be administered to the subject from whom they were isolated.
  • Cancer vaccines include tumor antigens, and monocytic cells or dendritic cells engineered to express one or more tumor antigens, optionally in combination of one or more adjuvants.
  • Other examples of immunotherapeutic agents include COX-2 inhibitors (e.g. , celecoxib, rofecoxib, valdecoxib) and tryptamine derivatives related to serotonin (e.g., alpha-methyl tryptophan).
  • the cancer is breast cancer, prostate cancer, non- small cell lung cancer, metastatic colon cancer, pancreatic cancer, or a hematological malignancy (e.g., acute myeloid leukemia, chronic lymphocytic leukemia, multiple myeloma).
  • a hematological malignancy e.g., acute myeloid leukemia, chronic lymphocytic leukemia, multiple myeloma.
  • a polymeric nanoparticle comprising a pharmaceutical combination may result not only in a beneficial effect, e.g. a synergistic therapeutic effect, e.g. with regard to alleviating, delaying progression of or inhibiting the symptoms, but also in further surprising beneficial effects, e.g. fewer side-effects, more durable response, improved pharmacodynamics and/or pharmacokinetics, an improved quality of life or a decreased morbidity, compared with a monotherapy (either monotherapy using the polymeric nanoparticle delivery system, or monotherapy where the agent is delivered by conventional means) applying only one of the pharmaceutically therapeutic agents used in combinations disclosed herein.
  • a beneficial effect e.g. a synergistic therapeutic effect, e.g. with regard to alleviating, delaying progression of or inhibiting the symptoms, but also in further surprising beneficial effects, e.g. fewer side-effects, more durable response, improved pharmacodynamics and/or pharmacokinetics, an improved quality of life or a decreased morbidity,
  • a polymeric nanoparticle comprising a pharmaceutical combination results in the beneficial effects described herein before.
  • the person skilled in the art is fully enabled to select a relevant test model to prove such beneficial effects.
  • the pharmacological activity of a composition comprising a polymeric nanoparticle and a therapeutic agent may, for example, be demonstrated in a clinical study or in an animal model.
  • the methods of treating disclosed herein can be particularly suited for a subject who has been diagnosed with at least one of the cancers described as treatable by the use of a polymeric nanoparticle described herein.
  • the biodegradable tetrablock polymeric nanoparticles for intracellular MS-1 peptide delivery are highly effective in inhibiting cancer survival and proliferation.
  • the subject has been diagnosed with a cancer named herein, and has proven refractory to treatment with at least one conventional chemotherapeutic agent, e.g., paclitaxel, nab-paclitaxel (ABRAXANE), docetaxel, vincristine, vinblastine, taxol, or a
  • the treatments disclosed herein are directed to subjects or patients who have received one or more treatments with a conventional chemotherapeutic or a BCL-2 antagonist, and remain in need of more effective treatment.
  • the treatments disclosed herein are directed to subjects or patients who have received treatment with a BCL-2 antagonist and remain in need of more effective treatment.
  • the BCL-2 antagonist is ABT199 (venetoclax) or
  • the reaction mixture was stirred for the next 24 hours followed by precipitation of the PLA-PEG- PPG-PEG block copolymer with diethyl ether and filtration using Whatman filter paper No.1.
  • the PLA-PEG-PPG-PEG block copolymer precipitates so obtained are dried under low vacuum and stored at 2°C to 8°C until further use.
  • the PLA-PEG-PPG-PEG nanoparticles were prepared by emulsion precipitation method. lOOmg of the PLA-PEG-PPG-PEG copolymer obtained by the above mentioned process was separately dissolved in an organic solvent, for example, acetonitrile, dimethyl formamide (DMF) or dichloromethane to obtain a polymeric solution.
  • an organic solvent for example, acetonitrile, dimethyl formamide (DMF) or dichloromethane
  • the nanoparticles were prepared by adding this polymeric solution dropwise to the aqueous phase of 20 ml distilled water. The solution was stirred magnetically at room temperature for 10 to 12 hours to allow residual solvent evaporation and stabilization of the nanoparticles. The nanoparticles were then collected by centrifugation at 25,000 rpm for 10 min and washed three times using distilled water. The nanoparticles were further lyophilized and stored at 2°C to 8°C until further use.
  • the shape of the nanoparticles obtained by the process mentioned above is essentially spherical as is seen in the Transmission Electron Microscopy image shown in FIGS. 4A-B.
  • the TEM images allowed for the determination of the particle size range, which is about 30 to 120 nm.
  • the hydrodynamic radius of the nanoparticle was measured using a dynamic light scattering (DLS) instrument and is in the range of 110-120 nm (Table 2).
  • the characteristics of the PLA-PEG-PPG-PEG nanoparticles synthesized using a range of molecular weights of the block copolymer, PEG-PPG-PEG, is shown in Table 2.
  • FTIR Fourier-transform infrared spectroscopy
  • the NMR spectra of the PLA-PEG-PPG-PEG nanoparticles obtained using different molecular weights of the block copolymer, PEG-PPG-PEG, are shown in FIGS. 3A-C.
  • the proton with a chemical shift of about 5.1 represents the ester proton of PL A
  • the proton with a chemical shift at around 3.5 represent the ether proton of PEG-PPG-PEG.
  • the presence of both the protons in the spectra confirms the conjugation of PLA with PEG- PPG-PEG.
  • Example 2 Preparation of an entity-loaded nanoparticle
  • PLA-PEG-PPG-PEG nanoparticles were prepared using the process of Example 1 is dissolved in 5 ml of an organic solvent like acetonitrile (CH 3 CN), dimethyl formamide (DMF; C 3 H7NO), acetone or dichloromethane (CH2CI2). Nanoparticles encapsulating MS-1 peptide were prepared using a double emulsion solvent evaporation method as reported by
  • PLA-PEG-PPG-PEG polymeric nanoparticles were prepared using different molecular weights of the PEG-PPG-PEG polymer using the process as mentioned above.
  • Pyrene loaded PLA-PEG-PPG-PEG polymeric nanoparticles were prepared using the PLA- PEG-PPG-PEG copolymer synthesized using varying molecular weights of the PEG-PPG- PEG polymer. Pyrene was taken in the range of 2-20% weight of the PLA-PEG-PPG-PEG block copolymer and fluorescent dye-loaded nanoparticles were prepared.
  • the entity loading capacity of the nanoparticles varied depending on the molecular weight of the PEG-PPG- PEG polymer used for the synthesis of the nanoparticles.
  • Table 3 provides the percentage of the imaging molecule encapsulated by the polymeric nanoparticles produced using different molecular weights of the block copolymer. Cellular internalization of the fluorescent dye, Rhodamine
  • Rhodamine loaded PLA-PEG-PPG-PEG polymeric nanoparticles were prepared using the process as mentioned above. Rhodamine was taken in the range of 2-20% weight of the PLA-PEG-PPG-PEG block copolymer and fluorescent dye-loaded nanoparticles were prepared.
  • a mixture containing 10 ml phosphate buffer saline and 10 mg PLA-PEG-PPG-PEG nanoparticles encapsulating rhodamine B-conjugated NuBCP-9 (drug) was stirred at 200 rpm at 37°C.
  • Supernatant samples of the mixture were collected by centrifugation at 25,000 rpm at different time intervals for a period of 6 days.
  • the nanoparticles were re-suspended in fresh buffer after each centrifugation. 2 ml of the supernatant was subjected to protein estimation using BCA kit (Pierce, USA) to evaluate the amount of drug release
  • PLA-PEG-PPG-PEG nanoparticles were intravenously injected in the animal group at a single dose of 150mg/kg body weight and hematology parameters were evaluated in the control and nanoparticle-treated groups at intervals of 7 days for a period of 21 days.
  • the control group received no nanoparticles.
  • PLA-PEG-PPG-PEG nanoparticles were intravenously injected in the animal group at a single dose of 150mg/kg body weight and hematology parameters were evaluated in the control and nanoparticle-treated groups at intervals of 7 days for a period of 21 days.
  • liver enzymes indicating liver damage such as alanine transaminase (ALT), aspartate transaminase (AST) and alkaline phosphatase (ALP), were non-significantly increased in the PLA-PEG-PPG-PEG
  • BALB/c mice were treated with PLA-PEG-PPG-PEG nanoparticles at a single dose of 150mg/kg body weight. After 21 days, the animals were sacrificed and histology of the organ tissues was carried out to assess any tissue damage, inflammation, or lesions due to toxicity caused by the PLA-PEG-PPG-PEG nanoparticles or their degradation products. No apparent histopathological abnormalities or lesions were observed in the brain, heart, liver, spleen, lung and kidney of the nanoparticle-treated animal (FIG. 9).
  • Example 5 In vitro studies to evaluate the efficacy of MS-1 peptide/NPs in inhibiting cancer cell proliferation and inducing cell death.
  • PLA-PEG-PPG-PEG polymeric nanoparticles (NPs) encapsulating MS-1 peptide prepared using the process as given in Example 2.
  • MCL-1 protein is an anti-apoptotic protein in the BCL-2 family.
  • a peptide antagonist to MCL-1 was developed, comprising the amino acid sequence of
  • AML cell line U937 Another acute myeloid leukemia cells (AML) cell line U937 also underwent reduced cell proliferation and/or cell death upon treatment of 7.5 ⁇ or 10 ⁇ of MS-1 peptide/NPs (FIG. 11).
  • AML acute myeloid leukemia cells
  • K562 and HL- 60 two other myeloid or pro-myeloid leukemia cell lines, K562 and HL- 60, were not sensitive to 10 ⁇ MS-1 peptide/NPs (FIGS. 12A and 12B).
  • the sensitivity to MS-1 peptide/NPs of these cell lines is correlated to their MCL-1 expression levels: THP-1 and U-937 cells express high levels of MCL-1, whereas HL-60 and K562 cells express low levels of MCL-1 (see Pan et al, Cancer Discov. 2014; 4(3):362-75).
  • ABT199 (venetoclax) is a small molecule inhibitor of BCL-2.
  • THP-1 cells were obtained by culturing wild-type THP-1 cells with low to high doses of ABT199 for at least 4-5 months while selecting the surviving cells.
  • the expression level of MCL-1 was increased in the ABT 199-resistant cells (FIG. 14A), suggesting that MCL-1 might contribute to survival of venetoclax-relapsed or refractory cancer cells.
  • wild-type or ABT 199-resistant THP-1 were treated with 5 ⁇ MS-1 peptide/NPs for 72 hours.
  • the inhibition of cell proliferation by MS-1 peptide/NPs in these two cell lines were similar (FIG. 14B). Therefore, MS-1 peptide/NPs could be effective in treating a venetoclax-relapsed or refractory cancer, or other cancers that are resistant to a BCL-2 inhibitor.
  • ROS Reactive oxygen species
  • ROS level is elevated by cellular stress, and could mediate, facilitate or accelerate cell death in many conditions.
  • the generation of ROS was examined in U937 cells which were sensitive to MS-1 peptide/NPs, and K562 cells which were resistant to MS-1 peptide/NPs.
  • the level of ROS was increased by MS-1 peptide/NPs treatment more significantly in U937 cells than in K562 cells. This result was consistent with the cytotoxicity data, suggesting the involvement of ROS in the cellular stress and cell death induced by MS-1 peptide/NPs.
  • Example 6 Targeting MCL-1 with MS-l/NPs activates the MUCl-C to NF- ⁇ p65 to BCL2A1 pathway.
  • the human mammary carcinoma cell line BT-20 was treated in vitro with either empty NPs or 7.5 ⁇ MS-l/NPs for 5 days, and the cell survival was measured.
  • Human BT-20 cell line was maintained in RPMI1640 medium containing 10% heat-inactivated fetal bovine serum (FBS), 100 units/ml penicillin, 100 g/ml streptomycin and 2 mM L-glutamine.
  • FBS heat-inactivated fetal bovine serum
  • BT-20 cells were treated either with empty nanoparticles, "NP", or with 7.5 ⁇ MCL-1 peptide-NPs, "MS- l/NPs" for 5 days.
  • FIG. 17A shows a bar graph of the relative cell survival of the MS-l/NP-treated BT-20 cells.
  • BT-20 cell survival of MS-l/NP-treated cells relative to empty NP -treated controls is drastically reduced over a 5 day period.
  • BT-20 cells were injected subcutaneously into the flanks of nude (nu nu) mice for analysis in an animal xenograft study.
  • Mice with established tumors were pair-matched and then treated with empty NPs or 20 mg/kg MCL-1 peptide-NPs (MS 1/NPs) each week for 3 weeks.
  • 17C shows a graph of changes in tumor volume over time for subjects treated with either empty NPs (circles) or MSl/NPs (squares). The results are expressed as tumor volume (mean ⁇ SEM; 6 mice per group; *p ⁇ 0.01). As shown in FIG. 17C, the volume of BT-20 cell tumors from mice treated with 20 mg/kg MS -1 /NPs increased much less rapidly over time than in control nude mice treated with empty NPs. Thus, the data show that MSl/NPs significantly inhibited the continued growth of the BT-20 cell tumors in vivo.
  • the bar graph of FIG. 17E shows that the relative mRNA levels of MCL-1 were lower for empty NP- treated control subjects.
  • the relative mRNA levels of apoptotic pathway protein BCL2A1 in MS-l/NP -treated tumor cells was significantly increased (pO.01).
  • mRNA data were further analyzed by immunoblot.
  • Whole cell lysates from the extracted tumor cells of the in vivo rodent tumor xenograft study were immunoblotted with antibodies against MUC1-C, NF- ⁇ p65, and BCL2A1.
  • ⁇ -actin was assessed as an internal control (see FIG. 17F).
  • Tumor cell lysates from MS 1/NP -treated xenograft tumors showed an increase in protein expression of proteins NF- ⁇ p65, and BCL2A1.
  • MS-l/NPs The apoptotic effects of MS-l/NPs were also analyzed in cultured leukocytes from human AML patients.
  • Leukocytes were obtained pre-therapy from two AML patients under an approved protocol, as well as from healthy human controls.
  • the leukocytes from the AML patients and the control patients were then cultured with 7.5 ⁇ MS-l/NPs for 72 hours, and cell survival was assessed using Trypan blue exclusion.
  • MS-l/NP treatment of leukocytes from both of the AML patients resulted in a significantly lower number of cultured leukocytes compared to the cultured leukocytes from healthy controls.
  • Table 1 provides the details of PEG-PPG-PEG block copolymer used for the preparation of the PLA-PEG-PPG-PEG copolymer. TABLE 1
  • Table 2 shows the characterization of PLA-PEG-PPG-PEG nanoparticles
  • Table 3 shows the loading efficacy of the PLA-PEG-PPG-PEG nanoparticles synthesized using varying molecular weights of the polymer PEG-PPG-PEG.
  • SEQ ID NO: 1 amino acid sequence of MS-1 peptide
  • SEQ ID NO: 2 nucleotide sequence of DNA encoding MS-1 peptide
  • SEQ ID NO: 3 nucleotide sequence of human MCL-1 mRNA, splice variant 1
  • SEQ ID NO: 4 nucleotide sequence of human MCL-1 mRNA, splice variant 2
  • SEQ ID NO: 5 nucleotide sequence of human MCL-1 mRNA, splice variant 3
  • SEQ ID NO: 6 amino acid sequence of NuBCP-9 peptide

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Nanotechnology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Optics & Photonics (AREA)
  • Hematology (AREA)
  • Oncology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Organic Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Zoology (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Cell Biology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicinal Preparation (AREA)

Abstract

The present invention relates to compositions comprising polymeric nanoparticles and MCL-1 antagonistic peptides or polynucleotides encoding same. Also provided are methods for treating certain diseases, such as cancer, by administering the composition to a subject in need thereof. Further provided are methods for activating the BCL2A1 pathway in a mammalian cell, by administering to the cell the composition.

Description

COMPOSITIONS COMPRISING POLYMERIC NANOP ARTICLE S
AND MCL-1 ANTAGONISTS
CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims the benefit of U.S. Provisional Patent Application Serial No. 62/385,001, filed September 8, 2016, the entire disclosure of which is hereby incorporated herein by reference. FIELD
The present disclosure relates to the field of nanotechnology, in particular, to the use of biodegradable polymeric nanoparticles for the delivery of therapeutic agents.
BACKGROUND
Cancer is one of the most devastating diseases and it involves various genetic alterations and cellular abnormalities. This complexity and heterogeneity promotes the aggressive growth of cancer cells leading to significant morbidity and mortality in patients (Das, M. et al. (2009) Ligand-based targeted therapy for cancer tissue. Expert Opin. Drug Deliv. 6, 285-304; Mohanty, C. et al. (2011) Receptor mediated tumor targeting: an emerging approach for cancer therapy. Curr. Drug Deliv. 8, 45-58).
Myeloid cell leukemia-1 (MCL-1) is an anti-apoptotic member in the BCL-2 family.
It is known in the art that anti-apoptotic BCL-2 family proteins bind and sequester pro- apoptotic BCL-2 family proteins by trapping their a-helical BH3 domains in a hydrophobic groove. Many cancer cells express high levels of anti-apoptotic BCL-2 family proteins, thereby maintaining cell survival in spite of expression of pro-apoptotic BCL-2 family proteins. Therefore, small molecules and peptides that effectively target anti-apoptotic BCL- 2 family members may induce cell death preferentially in cancer cells. Such molecules have been developed and some of the small molecules, such as ABT-263 (navitoclax) and ABT- 199 (venetoclax), have been evaluated in clinical studies.
Peptide inhibitors of anti-apoptotic BCL-2 family proteins also show high efficacy in inducing cancer cell death. Unfortunately, free drug formulations of peptidic therapeutic agents require the use of large amounts and frequent administration of the peptide, thereby increasing the cost and inconvenience of therapy. There is a pressing need for a delivery system that can effectively deliver therapeutic agents, such as therapeutic peptides, alone, or in combination with other therapeutic agents such as chemotherapeutic agents, into cancerous cells. SUMMARY
The instant disclosure provides compositions comprising polymeric nanoparticles and MCL-1 antagonists, e.g. , a peptide capable of binding to MCL-1 and inhibiting the anti- apoptotic activity of MCL-1, and a polynucleotide encoding same. Also provided are methods for treating certain diseases, such as cancer, by administering the composition to a subj ect in need thereof.
According, in one aspect the instant disclosure provides a composition comprising polymeric nanoparticles comprising a poly(lactic acid)-poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) (PLA-PEG-PPG-PEG) tetra block copolymer, and a peptide comprising an amino acid sequence which is at least 85% identical to the sequence of a specific MCL-1 antagonistic peptide (SEQ ID NO: 1). In another aspect, the instant disclosure provides a composition comprising polymeric nanoparticles comprising a poly(lactic acid)-poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) (PLA- PEG-PPG-PEG) tetra block copolymer, and a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 85% identical to SEQ ID NO: 1.
In certain embodiments, the molecular weight of PLA is between about 2,000 and about 80,000 daltons. In certain embodiments, the PLA-PEG-PPG-PEG tetra block copolymer is formed from chemical conjugation of PEG-PPG-PEG tri-block copolymer with PLA, and wherein the PEG-PPG-PEG tri-block copolymer can be of different molecular weights. In certain embodiments, the polymeric nanoparticles have a diameter of about 30 nm to about 270 nm. In certain embodiments, the polymeric nanoparticles are loaded with the peptide or polynucleotide.
In another aspect, the instant disclosure provides a pharmaceutical composition comprising polymeric nanoparticles comprising a poly(lactic acid)-poly(ethylene glycol)- poly(propylene glycol)-poly(ethylene glycol) (PLA-PEG-PPG-PEG) tetra block copolymer, and a peptide comprising an amino acid sequence which is at least 85% identical to SEQ ID NO: 1, for use in treating cancer. In yet another aspect, the instant disclosure provides a pharmaceutical composition comprising polymeric nanoparticles comprising a poly(lactic acid)-poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) (PLA-PEG-PPG- PEG) tetra block copolymer, and a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 85% identical to SEQ ID NO: 1, for use in treating cancer. In certain embodiments, the polymeric nanoparticles are loaded with the peptide or the polynucleotide.
In certain embodiments, the polymeric nanoparticles consist essentially of poly(lactic acid)-poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) (PLA-PEG-PPG- PEG) tetra block copolymer. In certain embodiments, the composition further comprises a therapeutic agent selected from the group consisting of a BCL-2 antagonist, a BCL-xL antagonist, a BCL-w antagonist. In certain embodiments, the composition further comprises a chemotherapeutic agent. In certain embodiments, the chemotherapeutic agent is selected from the group consisting of paclitaxel, doxorubicin, salinomycin, taurolidine, vincristine, daunorubicin, docetaxel, gemcitabine, decitabine, irinotecan, 7-ethyl-lO-hydroxy- camptothecin (SN-38), cytarabine, triptolide, geldanamycin, tanespimycin (17-N-allylamino- 17-demethoxy geldanamycin; 17-AAG), 5-FU, oxaliplatin, carboplatin, taxotere, methotrexate, and bortezomib. In certain embodiments, the composition further comprises a targeted anti-cancer agent. In certain embodiments, the composition further comprises an immunotherapeutic agent. In certain embodiments, the polymeric nanoparticles further comprise a targeting moiety attached to the outside of the polymeric nanoparticles, and the targeting moiety is an antibody, peptide, or aptamer.
In another aspect, the instant disclosure provides a polymeric nanoparticle consisting essentially of a PLA-PEG-PPG-PEG tetra block copolymer, wherein the polymeric nanoparticles are loaded with a peptide comprising an amino acid sequence which is at least 85% identical to SEQ ID NO: 1, or a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 85% identical to SEQ ID NO: 1.
In certain embodiments, the peptide is a stapled peptide.
In another aspect, the instant disclosure provides a method for treating cancer in a subject in need thereof comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising polymeric nanoparticles comprising a PLA-PEG-PPG-PEG tetra block copolymer, and a peptide comprising an amino acid sequence which is at least 85% identical to SEQ ID NO: 1. In yet another aspect, the instant disclosure provides a method for treating cancer in a subject in need thereof comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising polymeric nanoparticles comprising a PLA-PEG-PPG-PEG tetra block copolymer, and a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 85% identical to SEQ ID NO: 1.
In still another aspect, the instant disclosure provides a method for activating the BCL2A1 pathway in a mammalian cell, comprising administering to the cell an effective amount of a composition comprising: polymeric nanoparticles comprising a PLA-PEG-PPG- PEG tetra block copolymer, and a peptide comprising an amino acid sequence which is at least 85% identical to SEQ ID NO: 1, or a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 85% identical to SEQ ID NO: 1.
In certain embodiments, the expression of BCL2A1 mRNA is increased in the cell after administration of the pharmaceutical composition. In certain embodiments, the expression of BCL2A1 protein is increased in the cell after administration of the
pharmaceutical composition. In certain embodiments, the expression of NF-κΒ p65 protein is increased in the cell after administration of the pharmaceutical composition. In certain embodiments, the expression of MUCl-C protein is increased in the cell after administration of the pharmaceutical composition.
In certain embodiments, the peptide is a stapled peptide. In certain embodiments, the pharmaceutical composition further comprises a therapeutic agent selected from the group consisting of a BCL-2 antagonist, a BCL-xL antagonist, a BCL-w antagonist. In certain embodiments, the pharmaceutical composition further comprises a chemotherapeutic agent. In certain embodiments, the chemotherapeutic agent is selected from the group consisting of paclitaxel, doxorubicin, salinomycin, taurolidine, vincristine, daunorubicin, docetaxel, gemcitabine, decitabine, irinotecan, 7-ethyl-lO-hydroxy-camptothecin (SN-38), cytarabine, triptolide, geldanamycin, tanespimycin (17-N-allylamino-17-demethoxygeldanamycin; 17- AAG), fluorouracil (5-FU), oxaliplatin, carboplatin, taxotere, methotrexate, and bortezomib. In certain embodiments, the pharmaceutical composition further comprises a targeted anticancer agent. In certain embodiments, the pharmaceutical composition further comprises an immunotherapeutic agent.
In certain embodiments, the cancer is leukemia or lymphoma. In certain
embodiments, the cancer is acute myeloid leukemia or chronic lymphocytic leukemia. In certain embodiments, the cancer is multiple myeloma. In certain embodiments, the cancer is breast cancer. In certain embodiments, the cancer is resistant to treatment with a BCL-2 antagonist. In certain embodiments, the subject is resistant to treatment with a BCL-2 antagonist. In certain embodiments, the subject is refractory to treatment with a BCL-2 antagonist. In certain embodiments, the subject is in relapse after treatment with a BCL-2 antagonist. In certain embodiments, the BCL-2 antagonist is venetoclax (ABT-199). In certain embodiments, the cancer expresses a high level of MCL-1.
BRIEF DESCRIPTION OF THE DRAWINGS The following figures form part of the present specification and are included to further illustrate aspects of the present disclosure. The disclosure may be better understood by reference to the figures in combination with the detailed description of the specific embodiments presented herein.
FIG. 1 provides a schematic diagram of the polymeric nanoparticles (NPs) of PLA- PEG-PPG-PEG tetra block copolymer.
FIG. 2 provides FTIR spectra of PLA, PEG-PPG-PEG and PLA-PEG-PPG-PEG nanoparticles.
FIG. 3A shows the Nuclear Magnetic Resonance (NMR) spectra of PLA-PEG-PPG- PEG nanoparticles synthesized from a block copolymer of PEG-PPG-PEG of 1,100 g/mol.
FIG. 3B shows the NMR spectra of PLA-PEG-PPG-PEG nanoparticles synthesized from a block copolymer of PEG-PPG-PEG of 4,400 g/mol.
FIG. 3C shows the NMR spectra of PLA-PEG-PPG-PEG nanoparticles synthesized from a block copolymer of PEG-PPG-PEG of 8,400 g/mol.
FIG. 4A and FIG. 4B show Transmission Electron Micrograph (TEM) images of PLA-PEG-PPG-PEG polymeric nanoparticles.
FIG. 5A, FIG. 5B, and FIG. 5C show photomicrographs of the cellular
intemalisation of PLA-PEG-PPG-PEG nanoparticles encapsulating the fluorescent dye, Rhodamine B in MCF-7 cells.
FIG. 6 provides a graph showing in vitro release of encapsulated L-NuBCP-9 over time from the PLA-PEG-PPG-PEG nanoparticles synthesized using different copolymers at 25°C.
FIG. 7A provides a bar graph showing percent relative changes of hemoglobin in BALB/c mice treated with control ("CNTRL", the bars on the left at each time point) or plain PLA-PEG-PPG-PEG nanoparticles ("Ant_can_pep", the bars on the right at each time point) to define any general toxicity by doing blood chemistry at a dose of 150 mg/kg body weight.
FIG. 7B provides a bar graph showing percent relative changes of neutrophils and lymphocyte count in BALB/c mice treated with control ("CNTRL") or plain PLA-PEG-PPG- PEG nanoparticles ("Ant_can_pep") to define any general toxicity by doing blood chemistry at a dose of 150 mg/kg body weight. For each treatment and measurement, the bars on the left, in the middle, and on the right represent measurement 7 days, 14 days, and 21 days after treatment, respectively.
FIG. 7C provides a bar graph showing percent relative changes of packed cell volume, MCV (Mean Corpuscular Volume), MCH (Mean Corpuscular Hemoglobin) and MCHC (Mean Corpuscular Hemoglobin Concentration), in BALB/c mice treated with control ("CNTRL") or plain PLA-PEG-PPG-PEG nanoparticles ("Ant_can_pep") to define any general toxicity by doing blood chemistry at a dose of 150 mg/kg body weight. For each treatment and measurement, the bars on the left, in the middle, and on the right represent measurement 7 days, 14 days, and 21 days after treatment, respectively.
FIG. 8A provides a bar graph showing the levels of aspartate transaminase and alanine transaminase in BALB/c mice treated with plain PLA-PEG-PPG-PEG nanoparticles to define any general toxicity by doing blood chemistry at a dose of 150 mg/kg body weight. For each treatment and measurement, the bars on the left, in the middle, and on the right represent measurement 7 days, 14 days, and 21 days after treatment, respectively.
FIG. 8B provides a bar graph showing the levels alkaline phosphatase in BALB/c mice treated with control ("CNTRL", the bars on the left at each time point) or plain PLA- PEG-PPG-PEG nanoparticles ("PLA-PEG", the bars on the right at each time point) to define any general toxicity by doing blood chemistry at a dose of 150 mg/kg body weight.
FIG. 8C provides a bar graph showing the levels of urea and blood urea nitrogen (BUN) in BALB/c mice treated with plain PLA-PEG-PPG-PEG nanoparticles to define any general toxicity by doing blood chemistry at a dose of 150 mg/kg body weight. For each treatment and measurement, the bars on the left, in the middle, and on the right represent measurement 7 days, 14 days, and 21 days after treatment, respectively.
FIG. 9 provides photomicrographs showing the histopathology of the brain, heart, liver, spleen, kidney and lung of BALB/c mice injected with plain PLA-PEG-PPG-PEG nanoparticles to define any general toxicity by doing histopathology of different organs.
FIG. 10A provides a bar graph showing the percentage of necrotic THP-1 cells after 72-hour exposure to plain PLA-PEG-PPG-PEG NPs ("THP-1 C"), or PLA-PEG-PPG-PEG NPs encapsulating MS-1 peptide ("MCL-1") or BCL-2 targeting peptide NuBCP-9
("NuBCP"). Cell necrosis was determined by flow cytometry using Annexin V and PI staining, wherein the Pi-positive, Annexin V-negative cells are identified as necrotic. FIG. 10B provides a bar graph showing the proliferation of THP-1 cells after 72-hour exposure to empty PLA-PEG-PPG-PEG NPs ("THP-1 C"), PLA-PEG-PPG-PEG NPs encapsulating MS-1 peptide ("MCL-1") or BCL-2 targeting peptide NuBCP-9 ("NuBCP"). Cell growth was determined by Trypan blue exclusion analysis and results are shown as numbers of cells not stained by Trypan blue per ml.
FIG. 11 provides a bar graph showing the proliferation of U937 cells after 72- or 96- hour exposure to empty PLA-PEG-PPG-PEG NPs ("control") or different concentrations of MS-1 peptide/NPs ("MCL-1 7.5 uM" and "MCL-1 10 uM"). Cell growth was determined using Trypan blue exclusion analysis and the results are shown as numbers of cells not stained by Trypan blue per ml. For each treatment, the bars on the left and on the right represent cell numbers 72 hours and 96 hours after the treatment, respectively.
FIG. 12A provides a bar graph showing the proliferation of THP-1 cells ("THP") which express a high level of MCL-1, and K562 cells ("K562") which express a low level of MCL-1, after 96-hour exposure to empty PLA-PEG-PPG-PEG NPs ("OH") or 5 μΜ MS-1 peptide/NPs ("96H"). Cell proliferation was determined by Trypan blue exclusion analysis and the results are shown as percentage of proliferation as compared to the cells treated with plain NPs.
FIG. 12B provides a bar graph showing the proliferation of THP-1 ("THP-l/C" and first "Mcl-l/NP"), U937 ("U937/C" and second "Mcl-l/NP"), K562 ("K562/C" and third "Mcl-l/NP") and HL60 ("HL60/C" and fourth "Mcl-l/NP") cells after 96-hour exposure to empty PLA-PEG-PPG-PEG NPs ("/C") or 5 μΜ MS-1 peptide/NPs ("Mcl-l/NP"). Cell proliferation was determined by Trypan blue exclusion analysis and the results are shown as percentage of proliferation as compared to the cells treated with plain NPs.
FIG. 13 provides protein gel stains showing the cleavage of Caspase-3 in THP-1 cells after 24- or 96-hour exposure to 5 μΜ MS-1 peptide/NPs ("MCL-l/NP"). Total cell lysates were analyzed by immunoblotting with an antibody recognizing full length Caspase-3 ("FL"), an antibody recognizing Caspase-3 cleaved fragment ("CF"), and an anti-Actin antibody.
FIG. 14A provides protein gel stains showing the expression of MCL-1 in ABT199- sensitive and resistant THP1 cells. Wild-type ("THP-l/WT") or ABT199-resistant ("THP- 1/ABT199") THP-1 cells were treated with 5 μΜ MS-1 peptide/NPs for 72 hours. Total cell lysates were analyzed by immunoblotting with anti-MCL-1, anti-BCL-2 and anti-Actin antibodies.
FIG. 14B provides a bar graph showing the proliferation of wild-type ("THP-1" and first "MCL-1") or ABT199-resistant ("THP-l/ABT" and second "MCL-1") THP-1 cells after 72-hour exposure to empty PLA-PEG-PPG-PEG NPs or 5 μΜ MS-1 peptide/NPs ("MCL- 1"). Cell proliferation was determined by Trypan blue exclusion analysis and the results are shown as percentage of proliferation as compared to the cells treated with plain NPs.
FIG. 15A provides a bar graph showing the colony formation of U937 cells in soft agar. 300 U937 cells were cultured in soft agar without FLT-3 ligand, containing empty PLA-PEG-PPG-PEG NPs ("Control"), 1.5 μΜ or 7.5 μΜ Μβ-Ι peptide/NPs ("MCL-1 1.5 uM", "MCL-1 7.5 uM") for 10-12 days. Colonies containing more than 50 cells were counted and the results are shown as numbers of colonies in each treatment condition.
FIG. 15B provides a bar graph showing the colony formation of U937 cells in soft agar with or without FLT-3 ligand. 300 U937 cells were cultured in soft agar containing empty PLA-PEG-PPG-PEG NPs ("Control" and "FLT3-Ligand 50 ng"), 5 μΜ or 7.5 μΜ MS-1 peptide/NPs ("MCL-1 5 uM", "MCL-1 7.5 uM") in the presence or absence of 50 ng/ml FLT-3 ligand for 10-12 days. Colonies containing more than 50 cells were counted and the results are shown as numbers of colonies in each treatment condition.
FIG. 16 provides a bar graph showing the stimulation of reactive oxygen species
(ROS) by MS-1 peptide/NPs in U937 and K562 cells. U-937 ("U937-C" and first "MCL- 1/NP") or K-562 ("K562-C" and second "MCL-l/NP") cells were treated with empty PLA- PEG-PPG-PEG NPs ("U937-C", "K562-C") or 5 μΜ MS-1 peptide/NPs (first and second "MCL-l/NP" for U937 and K562 cells, respectively) for 72 hours. ROS levels were determined in each treatment condition and the results are shown as relative ROS levels as compared to untreated cells.
FIG. 17A shows a bar graph comparing the cell survival of BT-20 cells treated with empty NPs relative to the survival of BT-20 cells treated with 7.5 μΜ MS-l/NPs for 5 days. The results are expressed as relative survival compared to that obtained with untreated cells (untreated cells were assigned a value of 1).
FIG. 17B shows immunoblots of ly sates from BT-20 cells treated with empty NPs or with 7.5 μΜ MS-l/NPs for 5 days. The specific proteins detected in the cell lysates are indicated for each immunoblot (MUC1-C, NF-κΒ p65, BCL2A1; β-actin is an internal control).
FIG. 17C shows a graph of tumor volume over time from tumor-bearing nude mice treated with empty NPs (circles) or 20 mg/kg MS-l/NPs (squares) each week for 3 weeks. The results are expressed as tumor volume as a function of time (mean±SEM; 6 mice per group; *p<0.01). Blinding was not done. Tumors were harvested on day 40. FIG. 17D shows a bar graph comparing relative levels of MCL-1 mRNA in empty NP -treated and MS -1/NP -treated tumor cells. The results (mean±SD of 3 determinations) are expressed as relative mRNA levels compared with that obtained for empty NP -treated tumors (assigned a value of 1).
FIG. 17E shows a bar graph comparing relative levels of BCL2AlmRNA in empty
NP -treated and MS -1/NP -treated tumor cells. The results (mean±SD of 3 determinations) are expressed as relative mRNA levels compared with that obtained for empty NP -treated tumors (assigned a value of 1).
FIG. 17F shows immunoblots of ly sates from empty NP -treated and MS- 1/NP -treated tumors, treated with the indicated antibodies (by antibodies that bind MCL-1, MUC1-C, p65, BCL2A1, or β-actin).
FIGS. 18A and 18B show bar graphs comparing the effect of MCL-l/NP treatment on the proliferation of leukocytes from two different AML patients, compared with healthy controls. DETAILED DESCRIPTION
The present disclosure provides a composition comprising nanoparticles (also referred to herein as "NPs") loaded with an MCL-1 antagonist. MCL-1 is highly expressed in certain cancer cells and is implicated in cell survival and proliferation. Inhibition of the activity of MCL-1 protein, for instance, by a peptide inhibitor named "MS-1 peptide", reduces cancer cell survival and proliferation. Delivery of this peptide to the intracellular space of cancer cells is facilitated by NPs. Accordingly, the present disclosure provides methods for treating a disease, such as cancer, by administering a composition comprising the NPs loaded with an MCL-1 antagonistic peptide or polynucleotide. Methods for producing the composition are also provided.
Nanoparticles can be produced as nanocapsules or nanospheres. Protein loading in the nanoparticle can be carried out by either the adsorption process or the encapsulation process (Spada et al, 2011 ; Protein delivery of polymeric nanoparticles; World Academy of Science, Engineering and Technology: 76). Nanoparticles, by using both passive and active targeting strategies, can enhance the intracellular concentration of drugs in cancer cells while avoiding toxicity in normal cells. When nanoparticles bind to specific receptors and enter the cell, they are usually enveloped by endosomes via receptor-mediated endocytosis, thereby bypassing the recognition of P-glycoprotein, one of the main drug resistance mechanisms (Cho et al, 2008, Therapeutic Nanoparticles for Drug Delivery in Cancer, Clin. Cancer Res. ,2008, 14: 1310-1316). Nanoparticles are removed from the body by opsonization and phagocytosis (Sosnik et al, 2008; Polymeric Nanocarriers: New Endeavors for the
Optimization of the Technological Aspects of Drugs; Recent Patents on Biomedical Engineering, 1 : 43-59). Nanocarrier based systems can be used for effective drug delivery with the advantages of improved intracellular penetration, localized delivery, protect drugs against premature degradation, controlled pharmacokinetic and drug tissue distribution profile, lower dose requirement and cost effectiveness (Farokhzad OC, et al ; Targeted nanoparticle-aptamer bioconjugates for cancer chemotherapy in vivo. Proc. Natl. Acad. Sci. USA 2006,103 (16): 6315-20; Fonseca C, et al , Paclitaxel-loaded PLGA nanoparticles: preparation, physicochemical characterization and in vitro anti-tumoral activity. J. Controlled Release 2002; 83 (2): 273-86; Hood et al , Nanomedicine, 2011, 6(7): 1257-1272).
The uptake of nanoparticles is indirectly proportional to their small dimensions. Due to their small size, the polymeric nanoparticles have been found to evade recognition and uptake by the reticulo-endothelial system (RES), and can thus circulate in the blood for an extended period (Borchard et al, 1996, Pharm. Res. 7: 1055-1058). Nanoparticles are also able to extravasate at the pathological site like the leaky vasculature of a solid tumor, providing a passive targeting mechanism. Due to the higher surface area leading to faster solubilization rates, nano-sized structures usually show higher plasma concentrations and area under the curve (AUC) values. Lower particle size helps in evading the host defense mechanism and increase the blood circulation time. Nanoparticle size affects drug release. Larger particles have slower diffusion of drugs into the system. Smaller particles offer larger surface area but lead to fast drug release. Smaller particles tend to aggregate during storage and transportation of nanoparticle dispersions. Hence, a compromise between a small size and maximum stability of nanoparticles is desired. The size of nanoparticles used in a drug delivery system should be large enough to prevent their rapid leakage into blood capillaries but small enough to escape capture by fixed macrophages that are lodged in the
reticuloendothelial system, such as the liver and spleen.
In addition to their size, the surface characteristics of nanoparticles are also an important factor in determining the life span and fate during circulation. Nanoparticles should ideally have a hydrophilic surface to escape macrophage capture. Nanoparticles formed from block copolymers with hydrophilic and hydrophobic domains meet these criteria. Controlled polymer degradation also allows for increased levels of agent delivery to a diseased state. Polymer degradation can also be affected by the particle size. Degradation rates increase with increase in particle size in vitro (Biopolymeric nanoparticles; Sundar et al , 2010, Science and Technology of Advanced Materials; doi: 10.1088/1468- 6996/11/1/014104).
Poly(lactic acid) (PLA) has been approved by the United States Food and Drug Administration for applications in tissue engineering, medical materials and drug carriers and poly(lactic acid)-poly(ethylene glycol) PLA-PEG based drug delivery systems are known in the art. US2006/0165987A1 describes a stealthy polymeric biodegradable nanosphere comprising poly(ester)-poly(ethylene) multiblock copolymers and optional components for imparting rigidity to the nanospheres and incorporating pharmaceutical compounds.
US2008/0081075A1 discloses a novel mixed micelle structure with a functional inner core and hydrophilic outer shells, self-assembled from a graft macromolecule and one or more block copolymer. US2010/0004398A1 describes a polymeric nanoparticle of shell/core configuration with an interphase region and a process for producing the same.
However, these polymeric nanoparticles essentially require the use of about 1% to 2% emulsifier for the stability of the nanoparticles. Emulsifiers stabilize the dispersed particles in a medium. PVA, PEG, Tween 80 and Tween 20 are some of the common emulsifiers. The use of emulsifiers is however, a cause of concern for in vivo applications as the leaching out of emulsifiers can be toxic to the subject (Safety Assessment on polyethylene glycols (PEGS) and their derivatives as used in cosmetic products, Toxicology, 2005 Oct. 15; 214 (1- 2): 1-38). The use of emulsifier also increases the mass of the nanoparticle thereby reducing the drug load, leading to higher dosage requirements. Other disadvantages still prevalent in the nanoparticle drug carrier systems are poor oral bioavailability, instability in circulation, inadequate tissue distribution and toxicity. A delivery system that can effectively deliver therapeutic agents including therapeutic peptides into the cytosol of diseased (e.g. , cancerous) cells without the disadvantages presented above is described herein.
Those skilled in the art will be aware that the technology described herein is subject to variations and modifications other than those specifically described. It is to be understood that the technology described herein includes all such variations and modifications. The technology also includes all such steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features. Definitions
For convenience, before further description of the present technology, certain terms employed in the specification, examples and appended claims are collected here. These definitions should be read in light of the remainder of the disclosure and understood as by a person of skill in the art. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by a person of ordinary skill in the art. The terms used throughout this specification are defined as follows, unless otherwise limited in specific instances.
The articles "a," "an" and "the" are used to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article.
The terms "comprise" "comprising" "including" "containing" "characterized by" and grammatical equivalents thereof are used in the inclusive, open sense, meaning that additional elements may be included. It is not intended to be construed as "consists of only."
As used herein, "consisting of and grammatical equivalent thereof exclude any element, step or ingredient not specified in the claim.
As used herein, the term "about" or "approximately" usually means within 20%, more preferably within 10%, and most preferably still within 5% of a given value or range.
The term "biodegradable" as used herein refers to both enzymatic and non-enzymatic breakdown or degradation of the polymeric structure.
As used herein, the term "nanoparticle" refers to particles in the range between 10 nm to 1000 nm in diameter, wherein diameter refers to the diameter of a perfect sphere having the same volume as the particle. The term "nanoparticle" is used interchangeably as "nanoparticle(s)". In some cases, the diameter of the particle is in the range of about 1-1000 nm, 10-500 nm, or 30-120 nm.
In some cases, a population of particles may be present. As used herein, the diameter of the nanoparticles is an average of a distribution in a particular population.
As used herein, the term "polymer" is given its ordinary meaning as used in the art, i.e., a molecular structure comprising one or more repeat units (monomers), connected by covalent bonds. The repeat units may all be identical, or in some cases, there may be more than one type of repeat unit present within the polymer.
The term "polynucleotide" or "nucleic acid" refers to polynucleotides such as deoxyribonucleic acid (DNA), ribonucleic acid (RNA), its variants and derivatives thereof.
As used herein, the term "loaded with" encompasses, but is not limited to, the following manners NPs are complexed with an agent, such as a peptide or a polynucleotide: the agent can be complexed with NPs by co-synthesis or co-assembly; the agent can be conjugated to a building block of NPs before NP synthesis or assembly; and the agent can be complexed with post-synthesis or post-assembly NPs, for example, by adsorption, coating and/or encapsulation. The NPs may be nanospheres, nanocapsules, or a mixture thereof. NPs loaded with an agent may comprise the NPs and the agent either in separate phases or in the same phase, and the preparation of the NPs loaded with the agent may involve phase transition.
As used herein, the term "therapeutic agent" and "drug" are used interchangeably and are also intended to encompass not only compounds or species that are inherently
pharmaceutically or biologically active, but materials which include one or more of these active compounds or species, as well as conjugations, modification, and pharmacologically active fragments, and antibody derivatives thereof.
A "targeting moiety" or "targeting agent" is a molecule that will bind selectively to the surface of targeted cells. For example, the targeting moiety may be a ligand that binds to the cell surface receptor found on a particular type of cell or expressed at a higher frequency on target cells than on other cells.
The targeting agent, or therapeutic agent can be a peptide or protein. "Proteins" and "peptides" are used interchangeably to refer to amino acid sequences comprising at least 5 amino acids. The amino acids can be in D- or L- configuration. A protein can be, for example, a protein drug, an antibody, a recombinant antibody, a recombinant protein, an enzyme, or the like. In some cases, one or more of the amino acids of the peptide or protein can be modified, for example by the addition of a chemical entity such as a carbohydrate group, a phosphate group, a farnesyl group, an isofamesyl group, a fatty acid group, a linker for conjugation, functionalization, or other modification such as cyclization, bi-cyclization and any of numerous other modifications intended to confer more advantageous properties on peptides and proteins. In other instances one or more of the amino acids of the peptide or protein can be modified by substitution with one or more non-naturally occurring amino acids. The peptides or proteins may by selected from a combinatorial library such as a phage library, a yeast library, or an in vitro combinatorial library.
As used herein, the term "antibody" refers to any molecule incorporating an amino acid sequence or molecule with secondary or tertiary structural similarity conferring binding affinity to a given antigen that is similar or greater to the binding affinity displayed by an immunoglobulin variable region containing molecule from any species. The term antibody includes, without limitation native antibodies consisting of two heavy chains and two light chains; binding molecules derived from fragments of a light chain, a heavy chain, or both, variable domain fragments, heavy chain or light chain only antibodies, or any engineered combination of these domains, whether monospecific or bispecific, and whether or not conjugated to a second diagnostic or therapeutic moiety such as an imaging agent or a chemotherapeutic molecule. The term includes without limitation immunoglobulin variable region derived binding moieties whether derived from a murine, rat, rabbit, goat, llama, camel, human or any other vertebrate species. The term refers to any such immunoglobulin variable region binding moiety regardless of discovery method (hybridoma-derived, humanized, phage derived, yeast derived, combinatorial display derived, or any similar derivation method known in the art), or production method (bacterial, yeast, mammalian cell culture, or transgenic animal, or any similar method of production known in the art).
The term "combination," "therapeutic combination," or "pharmaceutical
combination" as used herein refer to the combined administration of two or more therapeutic agents (e.g. , co-delivery).
The term "pharmaceutically acceptable" as used herein refers to those compounds, materials, compositions and/or dosage forms, which are, within the scope of sound medical judgment, suitable for contact with the tissues a warm-blooded animal, e.g. , a mammal or human, without excessive toxicity, irritation allergic response and other problem
complications commensurate with a reasonable benefit/risk ratio.
A "therapeutically effective amount" of a polymeric nanoparticle comprising one or more therapeutic agents is an amount sufficient to provide an observable or clinically significant improvement over the baseline clinically observable signs and symptoms of the disorders treated with the combination.
The term "subject" or "patient" as used herein is intended to include animals, which are capable of suffering from or afflicted with a cancer or any disorder involving, directly or indirectly, a cancer. Examples of subjects include mammals, e.g. , humans, apes, monkeys, dogs, cows, horses, pigs, sheep, goats, cats, mice, rabbits, rats, and transgenic non-human animals. In an embodiment, the subject is a human, e.g., a human suffering from, at risk of suffering from, or potentially capable of suffering from cancers.
The term "treating" or "treatment" as used herein comprises a treatment relieving, reducing or alleviating at least one symptom in a subject or effecting a delay of progression of a disease. For example, treatment can be the diminishment of one or several symptoms of a disorder or complete eradication of a disorder, such as cancer. Within the meaning of the present disclosure, the term "treat" also denotes to arrest and/or reduce the risk of worsening a disease. The term "prevent", "preventing" or "prevention" as used herein comprises the prevention of at least one symptom associated with or caused by the state, disease or disorder being prevented.
The term "antagonist" refers to an agent that inhibits the expression and/or one or more functions of a target protein. The term "BCL-2 antagonist" refers to an agent that inhibits the expression and/or one or more functions of an anti-apoptotic BCL-2 family protein. In certain embodiments, an antagonist to a target protein is an agent that binds specifically to the target protein. In certain embodiments, an antagonist to an anti-apoptotic BCL-2 family target protein is an agent that converts the anti-apoptotic protein to a pro- apoptotic protein. In certain embodiments, an antagonist to an anti-apoptotic BCL-2 family target protein comprises a peptide derived from a BH3 domain. In certain embodiments, the BH3 domain is a BH3 domain of a BH3-only protein.
Polymeric Nanoparticles
Provided herein is a non-toxic, safe, biodegradable polymeric nanoparticle made up of block copolymer for the delivery of one or more therapeutics. The biodegradable polymeric nanoparticles of the instant technology are formed of a block copolymer consisting essentially of poly(lactic acid) (PLA) chemically modified with a hydrophilic-hydrophobic block copolymer, wherein said hydrophilic-hydrophobic block copolymer is selected from poly(methyl methacrylate)-poly(methylacrylic acid) (PMMA-PMAA), poly(styrene)- poly(acrylic acid) (PS-PAA), poly(acrylic acid)-poly(vinylpyridine) (PAA-PVP), poly(acrylic acid)-poly(N,N-dimethylaminoethyl methacrylate) (PAA-PDMAEMA), poly(ethylene glycol)-poly(butylene glycol) (PEG-PBG), and poly(ethylene glycol)-poly(propylene glycol)- poly(ethylene glycol) (PEG-PPG-PEG). Examples of copolymer nanoparticles and methods for use thereof are disclosed in U.S. Patent Application Nos. 14/396,594 and 62/358,373, which are incorporated by reference herein in their entirety.
As used herein, the "polymeric nanoparticle" refers to polymeric nanoparticles formed of a block copolymer comprising poly(lactic acid) (PLA) chemically modified with a hydrophilic-hydrophobic block copolymer, wherein said hydrophilic-hydrophobic block copolymer is selected from poly(methyl methacrylate)-poly(methylacrylic acid) (PMMA- PMAA), poly(styrene)-poly(acrylic acid) (PS-PAA), poly(acrylic acid)-poly(vinylpyridine) (PAA-PVP), poly(acrylic acid)-poly(N,N-dimethylaminoethyl methacrylate) (PAA- PDMAEMA), poly(ethylene glycol)-poly(butylene glycol) (PEG-PBG), and poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) (PEG-PPG-PEG). Thus, the "polymeric nanoparticles" encompass polymeric nanoparticles formed of a block copolymer comprising or consisting essentially of poly(lactic acid) (PLA) chemically modified with poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) (PEG-PPG-PEG).
The present disclosure provides a process for preparing the biodegradable polymeric nanoparticle comprising one or more therapeutics. The resulting nanoparticle is not only non-toxic, safe, and biodegradable, but is stable in vivo, has high storage stability and can be safely used in a nanocarrier system or drug delivery system in the field of medicine. In fact, the nanoparticles of the instant disclosure increase the half-life of the deliverable drug or therapeutic agent in vivo.
The present disclosure also provides a process for efficient drug loading (e.g. , a peptide comprising NuBCP-9 as a single agent, or NuBCP-9 and a chemotherapeutic agent or a targeted anti-cancer agent) on a biodegradable polymeric nanoparticle to form an effective and targeted drug delivery nanocarrier system which prevents premature degradation of active agents and has a strong potential for use in cancer therapy.
There is also provided a composition comprising the biodegradable polymeric nanoparticle for use in medicine and in other fields that employ a carrier system or a reservoir or depot of nanoparticles. The nanoparticles of the present disclosure can be extensively used in prognostic, therapeutic, diagnostic or theranostic compositions. Suitably, the nanoparticles of the present disclosure are used for drug and agent delivery, as well as for disease diagnosis and medical imaging in human and animals. Thus, the instant disclosure provides a method for the treatment of disease using the nanoparticles further comprising a therapeutic agent as described herein. The nanoparticles of the present disclosure can also be use in other applications such as chemical or biological reactions where a reservoir or depot is required, as biosensors, as agents for immobilized enzymes and the like.
Unexpected and surprising results were obtained during production of biodegradable polymeric nanoparticles without the use of any emulsifiers or stabilizers according to the processes described herein. The biodegradable polymeric nanoparticles so obtained by the process are safe, stable and non-toxic. In an embodiment, the block copolymer PEG-PPG- PEG is covalently attached to the poly-lactic acid (PLA) matrix, resulting in the block copolymer becoming a part of the matrix, i.e., the nanoparticle delivery system. In contrast, in the prior art, the emulsifier (e.g. PEG-PPG-PEG) is not a part of the nanoparticle matrix and therefore leaches out (FIG. 1). In contrast to nanoparticles of the prior art, there is no leaching out of emulsifier into the medium from the nanoparticles provided herein. The nanoparticles obtained by the present process are non-toxic and safe due to the absence of added emulsifiers, which can leach out in vivo. The absence or reduced quantity of emulsifier also leads to nanoparticles with a higher drug to polymer ratio. These
nanoparticles have higher stability, and an increased storage shelf life as compared to the polymeric nanoparticles present in the art. The polymeric nanoparticles of the present disclosure are prepared to be biodegradable so that the degradation products may be readily excreted from the body. The degradation also provides a method by which the encapsulated contents in the nanoparticle can be released at a site within the body.
Poly(lactic acid) (PLA), is a hydrophobic polymer, and is the preferred polymer for synthesis of the polymeric nanoparticles of the instant disclosure. However, poly (gly colic acid) (PGA) and block copolymer of poly lactic acid-co-gly colic acid (PLGA) may also be used. The hydrophobic polymer can also be biologically derived or a biopolymer.
The molecular weight of the PLA used is generally in the range of about 2,000 g/mol to 80,000 g/mol. Thus, in an embodiment, the PLA used is in the range of about 2,000 g/mol to 80,000 g/mol. The average molecular weight of PLA may also be about 72,000 g/mol. As used herein, one g/mole is equivalent to one "dalton" (i.e., dalton and g/mol are
interchangeable when referring to the molecular weight of a polymer.
Block copolymers like poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) (PEG-PPG-PEG), poly(methyl methacrylate)-poly(methylacrylic acid) (PMMA- PMAA), poly(styrene)-poly(acrylic acid) (PS-PAA), poly(acrylic acid)-poly(vinylpyridine) (PAA-PVP), poly(acrylic acid)-poly(N,N-dimethylaminoethyl methacrylate) (PAA- PDMAEMA), polyethylene glycol)-poly(butylene glycol) (PEG-PBG) and PG-PR
(Polyglycerol (PG) and its copolymers with polyester (PR) including adipic acid, pimelic acid and sebecic acid) are hydrophilic or hydrophilic-hydrophobic copolymers that can be used in the present technology and include ABA type block copolymers such as PEG-PPG-PEG, BAB block copolymers such as PPG-PEG-PPG, (AB)n type alternating multiblock copolymers and random multiblock copolymers. Block copolymers may have two, three or more numbers of distinct blocks. PEG is a preferred component as it imparts hydrophilicity, anti-phagocytosis against macrophage and resistance to immunological recognition.
In some embodiments, the average molecular weight (Mn) of the hydrophilic- hydrophobic block copolymer is generally in the range of 1,000 to 20,000 g/mol. In a further embodiment, the average molecular weight (Mn) of the hydrophilic-hydrophobic block copolymer is about 4,000 g/mol to 15,000 g/mol. In some cases, the average molecular weight (Mn) of the hydrophilic-hydrophobic block copolymer is 4,400 g/mol, 8,400 g/mol, or 14,600 g/mol.
A block copolymer of the instant disclosure can consist essentially of a segment of poly(lactic acid) (PLA) and a segment of poly(ethylene glycol)-poly(propylene glycol)- polyethylene glycol) (PEG-PPG-PEG).
A specific biodegradable polymeric nanoparticle of the instant disclosure is formed of the block copolymer poly(lactic acid)-poly(ethylene glycol)-poly(propylene glycol)- poly(ethylene glycol) (PLA-PEG-PPG-PEG).
Another specific biodegradable polymeric nanoparticle of the instant disclosure is formed of the block copolymer poly (lactic acid)-poly (ethylene glycol)-poly (propylene glycol)-poly(ethylene glycol)-poly(lactic acid) (PLA-PEG-PPG-PEG-PLA).
The biodegradable polymers of the instant disclosure are formable by chemically modifying PLA with a hydrophilic-hydrophobic block copolymer using a covalent bond.
The biodegradable polymeric nanoparticles of the instant disclosure have a size in the range of about 30-120 nm.
In an embodiment, the biodegradable polymer of the instant disclosure is substantially free of emulsifier, or may comprise extemal emulsifier by an amount of about 0.5% to 5% by weight.
In an embodiment, the biodegradable polymeric nanoparticle of the present disclosure is PLA-PEG-PPG-PEG, and the average molecular weight of the poly(lactic acid) block is about 60,000 g/mol, the average weight of the PEG-PPG-PEG block is about 8,400 or about 14,600 g/mol, and the external emulsifier is about 0.5% to 5% by weight.
In another embodiment, the biodegradable polymeric nanoparticle of the present disclosure is PLA-PEG-PPG-PEG, and the average molecular weight of the poly(lactic acid) block is less than or equal to approximately 16,000 g/mol, the average weight of the PEG- PPG-PEG block is about 8,400 g/mol or about 14,600 g/mol, and wherein the composition is substantially free of emulsifier.
Preparation of Polymeric Nanoparticles
The process for preparing biodegradable polymeric nanoparticles of the instant disclosure comprises dissolving poly(lactic acid) (PLA) and a hydrophilic-hydrophobic block copolymer in an organic solvent to obtain a solution; adding a carbodiimide coupling agent and a base to the solution to obtain a reaction mixture; stirring the reaction mixture to obtain a block copolymer of PLA chemically modified with the hydrophilic-hydrophobic block copolymer; dissolving the block copolymer from the previous step in organic solvent and homogenizing to obtain a homogenized mixture; adding the homogenized mixture to an aqueous phase to obtain an emulsion; and stirring the emulsion to obtain the polymeric nanoparticles.
Carbodiimide coupling agents are well-known in the art. Suitable carbodiimide coupling agents include, but are not limited to, N,N-dicyclohexylcarbodiimide (DCC), N-(3- diethylaminopropyl)-N-ethylcarbodiimide (EDC), and N,N-diisopropylcarbodiimide.
The coupling reaction is usually carried out in the presence of catalysts and/or auxiliary bases such as trialkylamines, pyridine, or 4-dimethylamino pyridine (DMAP).
The coupling reaction can be also carried out in combination with a
hydroxy derivative, such as N-hydroxysuccinimide (NHS). Other hydroxyderivatives include, but are not limited to, 1-hydroxybenzotriazole (HOBt), l-hydroxy-7-azabenzotriazole (HO At), 6-chloro- 1-hydroxybenzotriazole (Cl-HOBt).
Organic solvents useful in the preparation of the nanoparticles prepared herein are suitably acetonitrile (C2H3N), dimethyl formamide (DMF; C3H7NO), acetone ((CH3)2CO) and dichloromethane (CH2CI2).
The process described above can optionally comprise the additional steps of washing the biodegradable polymeric nanoparticles with water, and drying the polymeric
biodegradable polymeric nanoparticles. The process may also optionally comprise a first step of adding emulsifier. The nanoparticles resulting from this process may have a size in the range of 30-120 nm.
In a specific process, the PLA and the copolymer, PEG-PPG-PEG, are dissolved in an organic solvent to obtain a polymeric solution. To this solution, N,N- dicyclohexylcarbodiimide (DCC) is added followed by 4-dimethylaminopyridine (DMAP) at -4°C to 0°C. The solution is allowed to stir at 250 to 300 rpm at a low temperature ranging from -4°C to 0°C for 20 to 28 hours. The nanoparticles of PLA-PEG-PPG-PEG have PLA covalently linked to PEG-PPG-PEG to form a PLA-PEG-PPG-PEG matrix. The
nanoparticles are precipitated by an organic solvent like diethyl ether, methanol or ethanol and separated from the solution by conventional methods in the art including filtration, ultracentrifugation or ultrafiltration. The nanoparticles are stored in a temperature ranging from 2°C to 8°C.
The process of the present disclosure provides the added advantage of not requiring additional steps of freezing or the use of decoy proteins as none, or a minimal amount, of emulsifiers are used in the process. The process of preparing the nanoparticles of the instant disclosure is easily carried out in ambient room temperature conditions of 25°C-30°C and does not require excessive shearing to obtain the desired small particle size.
A Fourier-transform infrared (FTIR) spectrum of one example of nanoparticles of the present disclosure is provided in FIG. 2. The nuclear magnetic resonance (NMR) spectra of the nanoparticles are provided in FIGS. 3A, 3B, and 3C. The nanoparticle is substantially spherical in configuration as shown in the TEM images of FIGS. 4A and 4B, however, the nanoparticles can adopt a non-spherical configuration upon swelling or shrinking. The nanoparticle is amphiphilic in nature. The zeta potential and PDI (Polydispersity Index) of the nanoparticles are provided in Table 2. Storage stability of the nanoparticles of the present disclosure is better compared to the conventional emulsifier based systems as there is no addition of any free emulsifiers to the process and the block copolymer comprising the PEG moiety is covalently linked in the overall PLA-PEG-PPG-PEG matrix. The storage shelf life of the nanoparticle ranges from 6 to 18 months.
The nanoparticles of the present disclosure have dimensions ranging from 30-120 nm as measured using a Transmission Electron Microscope (FIG. 4). In suitable embodiments, the diameter of the nanoparticles of the present disclosure will be less than 200 nm in diameter, and more suitably less than about 100 nm in diameter. In certain such
embodiments, the nanoparticles of the present disclosure will be in the range of about 10 to 200 nm, in the range of about 20 to 150 nm, or in the range of about 30 to 120 nm in diameter.
Specific processes for nanoparticle formation and uses in pharmaceutical composition are provided herein for purpose of reference. These processes and uses may be carried out through a variety of methods apparent to those of skill in the art.
In an embodiment of the present disclosure, provided herein is a process for preparation of biodegradable polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer, wherein said process comprises (a) dissolving a PEG-PPG-PEG copolymer and poly(lactic acid) (PLA) in an organic solvent to obtain a solution (b) adding Ν,Ν,- dicyclohexylcarbodiimide (DCC) and 4-(dimethylamino) pyridine (DMAP) to the solution at a temperature in the range of -4°C to 0°C to obtain a reaction mixture (c) stirring the reaction mixture at 250 to 400 rpm at a temperature ranging from -4°C to 0°C for 20 to 28 hours to obtain the PLA-PEG-PPG-PEG block copolymer (d) dissolving the PLA-PEG-PPG-PEG block copolymer in an organic solvent and homogenizing at 250 to 400 rpm to obtain a homogenized mixture (e) adding the homogenized mixture to an aqueous phase to obtain an emulsion, and (f) stirring the emulsion at 25°C to 30°C at 250 to 400 rpm for 10 to 12 hours to obtain the nanoparticles of PLA-PEG-PPG-PEG block copolymer.
In another embodiment of the present disclosure, there is provided a process for preparation of biodegradable polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer, wherein said process comprises (a) dissolving a PEG-PPG-PEG copolymer and poly(lactic acid) (PLA) in an organic solvent to obtain a solution (b) adding Ν,Ν,- dicyclohexylcarbodiimide (DCC) and 4-(dimethylamino) pyridine (DMAP) to the solution at a temperature in the range of -4°C to 0°C to obtain a reaction mixture (c) stirring the reaction mixture at 250 to 400 rpm at a temperature ranging from -4°C to 0°C for 20 to 28 hours to obtain the PLA-PEG-PPG-PEG block copolymer (d) dissolving the PLA-PEG-PPG-PEG block copolymer in an organic solvent and homogenizing at 250 to 400 rpm to obtain a homogenized mixture (e) adding the homogenized mixture to an aqueous phase to obtain an emulsion, and (f) stirring the emulsion at 25°C to 30°C at 250 to 400 rpm for 10 to 12 hours to obtain the nanoparticles of PLA-PEG-PPG-PEG block copolymer, wherein said process optionally comprises the steps of washing the nanoparticles of PLA-PEG-PPG-PEG block copolymer with water and drying the nanoparticles by conventional method.
In another embodiment of the present disclosure, there is provided a process for preparation of biodegradable polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer, wherein said process comprises (a) dissolving a PEG-PPG-PEG copolymer and poly-lactic acid (PLA) in an organic solvent to obtain a solution (b) adding Ν,Ν,- dicyclohexylcarbodiimide (DCC) and 4-(dimethylamino) pyridine (DMAP) to the solution at a temperature in the range of -4°C to 0°C to obtain a reaction mixture (c) stirring the reaction mixture at 250 to 400 rpm at a temperature ranging from -4°C to 0°C for 20 to 28 hours to obtain the PLA-PEG-PPG-PEG block copolymer (d) dissolving the PLA-PEG-PPG-PEG block copolymer in an organic solvent and homogenizing at 250 to 400 rpm to obtain a homogenized mixture (e) adding the homogenized mixture to an aqueous phase to obtain an emulsion, and (f) stirring the emulsion at 25°C to 30°C at 250 to 400 rpm for 10 to 12 hours to obtain the nanoparticles of PLA-PEG-PPG-PEG block copolymer, wherein size of the nanoparticle is in the range of 30-120 nm.
In yet another embodiment, there is provided a process for preparation of
biodegradable polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer, wherein said process comprises (a) dissolving a PEG-PPG-PEG copolymer and poly -lactic acid (PLA) in an organic solvent to obtain a solution (b) adding Ν,Ν,-dicyclohexylcarbodiimide (DCC) and 4-(dimethylamino) pyridine (DMAP) to the solution at a temperature in the range of -4°C to 0°C to obtain a reaction mixture (c) stirring the reaction mixture at 250 to 400 rpm at a temperature ranging from -4°C to 0°C for 20 to 28 hours to obtain the PLA-PEG-PPG-PEG block copolymer (d) dissolving the PLA-PEG-PPG-PEG block copolymer in an organic solvent and homogenizing at 250 to 400 rpm to obtain a homogenized mixture (e) adding the homogenized mixture to an aqueous phase to obtain an emulsion, and (f) stirring the emulsion at 25°C to 30°C at 250 to 400 rpm for 10 to 12 hours to obtain the nanoparticles of PLA-PEG-PPG-PEG block copolymer, wherein molecular weight of the PEG-PPG-PEG copolymer is in the range of 1,000 g/mol to 10,000 g/mol.
In a further embodiment, there is provided a process for preparation of biodegradable polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer, wherein said process comprises (a) dissolving a PEG-PPG-PEG copolymer and poly(lactic acid) (PLA) in an organic solvent to obtain a solution (b) adding Ν,Ν,-dicyclohexylcarbodiimide (DCC) and 4- (dimethylamino) pyridine (DMAP) to the solution at a temperature in the range of -4°C to 0°C to obtain a reaction mixture (c) stirring the reaction mixture at 250 to 400 rpm at a temperature ranging from -4°C to 0°C for 20 to 28 hours to obtain the PLA-PEG-PPG-PEG block copolymer (d) dissolving the PLA-PEG-PPG-PEG block copolymer in an organic solvent and homogenizing at 250 to 400 rpm to obtain a homogenized mixture (e) adding the homogenized mixture to an aqueous phase to obtain an emulsion, and (f) stirring the emulsion at 25°C to 30°C at 250 to 400 rpm for 10 to 12 hours to obtain the nanoparticles of PLA-PEG-PPG-PEG block copolymer, wherein molecular weight of PLA is in the range of 10,000 g/mol to 60,000 g/mol.
In a further embodiment, there is provided a process for preparation of biodegradable polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer, wherein said process comprises (a) dissolving a PEG-PPG-PEG copolymer and poly(lactic acid) (PLA) in an organic solvent to obtain a solution (b) adding Ν,Ν,-dicyclohexylcarbodiimide (DCC) and 4- (dimethylamino) pyridine (DMAP) to the solution at a temperature in the range of -4°C to 0°C to obtain a reaction mixture (c) stirring the reaction mixture at 250 to 400 rpm at a temperature ranging from -4°C to 0°C for 20 to 28 hours to obtain the PLA-PEG-PPG-PEG block copolymer (d) dissolving the PLA-PEG-PPG-PEG block copolymer in an organic solvent and homogenizing at 250 to 400 rpm to obtain a homogenized mixture (e) adding the homogenized mixture to an aqueous phase to obtain an emulsion, and (f) stirring the emulsion at 25°C to 30°C at 250 to 400 rpm for 10 to 12 hours to obtain the nanoparticles of PLA-PEG-PPG-PEG block copolymer, wherein the solution of step (a) optionally comprises additives such as emulsifier. Another embodiment provides a biodegradable polymeric nanoparticles of PLA-PEG- PPG-PEG block copolymer obtained by the process for preparation of biodegradable polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer, wherein said process comprises (a) dissolving a PEG-PPG-PEG copolymer and poly(lactic acid) (PLA) in an organic solvent to obtain a solution (b) adding Ν,Ν,-dicyclohexylcarbodiimide (DCC) and 4- (dimethylamino) pyridine (DMAP) to the solution at a temperature in the range of -4°C to 0°C to obtain a reaction mixture (c) stirring the reaction mixture at 250 to 400 rpm at a temperature ranging from -4°C to 0°C for 20 to 28 hours to obtain the PLA-PEG-PPG-PEG block copolymer (d) dissolving the PLA-PEG-PPG-PEG block copolymer in an organic solvent and homogenizing at 250 to 400 rpm to obtain a homogenized mixture (e) adding the homogenized mixture to an aqueous phase to obtain an emulsion, and (f) stirring the emulsion at 25°C to 30°C at 250 to 400 rpm for 10 to 12 hours to obtain the nanoparticles of PLA-PEG-PPG-PEG block copolymer.
Another embodiment provides a composition comprising the biodegradable polymeric nanoparticle of PLA-PEG-PPG-PEG block copolymer obtained by the process for preparation of biodegradable polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer, wherein said process comprises (a) dissolving a PEG-PPG-PEG copolymer and poly(lactic acid) (PLA) in an organic solvent to obtain a solution (b) adding Ν,Ν,- dicyclohexylcarbodiimide (DCC) and 4-(dimethylamino) pyridine (DMAP) to the solution at a temperature in the range of -4°C to 0°C to obtain a reaction mixture (c) stirring the reaction mixture at 250 to 400 rpm at a temperature ranging from -4°C to 0°C for 20 to 28 hours to obtain the PLA-PEG-PPG-PEG block copolymer (d) dissolving the PLA-PEG-PPG-PEG block copolymer in an organic solvent and homogenizing at 250 to 400 rpm to obtain a homogenized mixture (e) adding the homogenized mixture to an aqueous phase to obtain an emulsion, and (f) stirring the emulsion at 25°C to 30°C at 250 to 400 rpm for 10 to 12 hours to obtain the nanoparticles of PLA-PEG-PPG-PEG block copolymer.
Polymeric Nanoparticles Comprising Therapeutics
The nanoparticles of the present disclosure are capable of delivering active agents or entities to specific sites (FIG. 5). The particle size and release properties of the PLA-PEG- PPG-PEG nanoparticle of the present disclosure can be controlled by varying the molecular weight of the PLA or PEG-PPG-PEG in the polymeric matrix. The release of active agent or entity can be controlled from 12 hours to 60 days which is an improvement over conventional PLA-PEG systems available in the art (FIG. 6). The drug loading capacity of the nanoparticle can also be controlled by varying the average molecular weight of the block copolymer in the polymeric matrix of the nanoparticles. There is an increase in the drug loading capacity of the nanoparticle with an increase in the block length of PEG-PPG-PEG block copolymer (Table 3).
As the polymeric nanoparticles made up of PLA-PEG-PPG-PEG block copolymer are amphiphilic in nature, both hydrophobic and hydrophilic drugs can be loaded on the nanoparticles. The nanoparticles of the present disclosure possess high drug loading capacity due to the absence or minimal use of emulsifiers, resulting in reducing the dose load and frequency of therapeutics. The ratio of active agent or entity to nanoparticle is higher in the nanoparticles of the present disclosure compared to conventional systems employing emulsifiers, since the weight of the emulsifier can add up to 50% of the total formulation weight (International Journal of Pharmaceutics, 15 June 2011, Volume 411, Issues 1-2, Pages 178-187; International Journal of Pharmaceutics, 2010, 387: 253-262). The nanoparticles help to achieve single and low dose drug delivery coupled with reduced toxicity. The weight percentage of the active agent to the nanocarrier system of PLA-PEG-PPG-PEG ranges from 2-20 % to the nanoparticle. The higher drug loading in the nanoparticle reduces the drug dose requirement since the effective dose can be administered at a reduced dosage level. The enhanced internal loading in the polymeric nanoparticles with a prolonged activity of the loaded entities without hampering the total loading capacity of the nanoparticle leads to an effective delivery of highly potential therapeutics. For example, the efficacy of the anticancer peptide, L-NuBCP-9, also referred to herein as "NuBCP-9", (L-configuration of amino acid sequence FSRSLHSLL) loaded into a nanoparticle formulation is higher compared to the free peptide drug formulation and the conventional cell-penetrating peptide conjugated drug formulation in Primary HUVEC cell lines.
The PLA-PEG-PPG-PEG nanoparticles of the present disclosure are nontoxic as confirmed by in vitro cell line studies and in vivo mouse model studies. Hematological parameters assessed in mice treated with PLA-PEG-PPG-PEG nanoparticles at a dose of 150 mg/kg body weight showed no significant change in the complete blood count, red blood count, white blood count, neutrophil and lymphocyte levels with the control group (FIGS. 7A, 7B and 7C). Biochemical parameters assessed for liver and kidney functions showed no significant change in the total protein, albumin and globulin levels between the control and the nanoparticle-treated groups. The levels of the liver enzymes, alanine transaminase (ALT), aspartate transaminase (AST) and alkaline phosphatase (ALP) were non-significantly increased in the PLA-PEG-PPG-PEG nanoparticle treated group compared to control group, as seen in FIGS. 8A and 8B. There is no significant change in the levels of urea and blood urea nitrogen (BUN) in mice treated with PLA-PEG-PPG-PEG nanoparticles compared with control (FIG. 8C). The histopathology of the organs, brain, heart, liver, spleen, kidney and lung of mice injected with PLA-PEG-PPG-PEG nanoparticles is shown in FIG. 9.
The nanoparticles of the present disclosure can encapsulate and/or adsorb one or more entities. The entity can also be conjugated to directly to the block copolymer of the biodegradable nanoparticle. Entities of the present disclosure include but are not limited to, small organic molecules, nucleic acids, polynucleotides, oligonucleotides, nucleosides, DNA, RNA, SiRNA, amino acids, peptides, protein, amines, antibodies and variants thereof, antibiotics, low molecular weight molecules, chemotherapeutics, drugs or therapeutic agents, metal ions, dyes, radioisotope, contrast agent, and/or imaging agents.
Suitable molecules that can be encapsulated are therapeutic agents. Included in therapeutic agents are proteins or peptides or fragments thereof, insulin, etc., hydrophobic drugs like doxorubicin, paclitaxil, gemcetabin, docetaxel etc; antibiotics like amphotericin B, isoniazid (INH) etc., and nucleic acids. Therapeutic agents also include chemotherapeutics such as paclitaxel, doxorubicin pimozide, perimethamine, indenoisoquinolines, or nor- indenoisoquinolines.
The therapeutic agent can comprise natural or non-natural (synthetic) amino acids. Non-limiting examples include bicyclic compounds and peptidomimetics such as cyclic peptidomimetics. In certain embodiments, the therapeutic agent comprises a peptide. In certain embodiments, the peptide comprises an amino acid analog, e.g., cyanoalanine, canavanine, djenkolic acid, norleucine, 3-phosphoserine, homoserine, ihydroxyphenylalanine, 5-hydroxytryptophan, 1-methylhistidine, 3-methylhistidine, diaminopimelic acid, ornithine, or diaminobutyric acid. In certain embodiments, the peptide comprises a modifying group. In certain embodiments, the modifying group is an acyl group, for example, formyl, dansyl, acetyl, benzoyl, trifluoroacetyl, succinyl, and methoxysuccinyl; an aromatic group, for example, benzyloxycarbonyl (Cbz); or an aliphatic group, for example, t-butoxycarbonyl (Boc) or 9-Fluorenylmethoxycarbonyl (Fmoc). In certain embodiments, the modifying group is attached to the N-terminus or C-terminus of the peptide. In certain embodiments, the peptide is a linear peptide. In certain embodiments, the peptide is a cyclic peptide. In certain embodiments, the peptide is a stapled peptide comprising a synthetic linkage between at least two non-contiguous amino acid residues.
In certain embodiments, the stapled peptide comprises an alpha-helix. A "stapled peptide" is a peptide comprising a selected number (e.g. , less than 20, 25 or 30) of standard or non-standard amino acids, further comprising at least one cross-linker between the at least two moieties. Stapled peptides and method of synthesis have been disclosed in U.S. Patent Nos. 8,592,377 and 8,586,707, and Walensky et al. (Science 305(5689): 1466-70), which are incorporated by reference in their entirety. In certain embodiments, the cross-linker is a hydrocarbon chain. In certain embodiments, the two moieties are conjugated to two amino acids having 2, 3, or 6 amino acids in between. In certain embodiments, the stapled peptide has improved stability, resistance to proteases, or cell-penetrating ability as compared to a corresponding peptide without cross-linker.
In certain embodiments, the therapeutic agent comprises a natural or non-natural polynucleotide. Non-limiting examples include DNA, RNA, and a morpholino comprising natural and/or non-natural nucleotides. In certain embodiments, the polynucleotide comprises one or more modifications selected from the group consisting of phosphorothioate bond replacing the phosphate bond, 2'-0-methylation on the nucleoside, and modifications on the terminal nucleosides. In certain embodiments, the modification protects the polynucleotide from degradation. In certain embodiments, the modification prevents ligation of the polynucleotide with another polynucleotide in vitro or in a cell. In certain
embodiments, the modification increases the efficiency of transcription or translation.
It is known that the L-form or L-configuration of the therapeutic peptides are economically cheaper to manufacture but have a disadvantage in drug applications since they are known to degrade very fast in the in vivo system compared to their D-forms. However, encapsulation of such L-peptides by the nanoparticles of the present disclosure does not result in degradation in circulation due to encapsulation in the core of the nanoparticles as confirmed by in vivo studies (FIGS. 11, 12 and 13).
Targeted delivery of the nanoparticles loaded with anticancer drugs can be achieved compared to the free drug formulations prevalent in the art. The nanoparticles of the present disclosure can also be surface conjugated, bioconjugated, or adsorbed with one or more entities including targeting moieties on the surface of nanoparticles. Targeting moieties cause nanoparticles to localize onto a tumor or a disease site and release a therapeutic agent. The targeting moiety can bind to or associate with a linker molecules. Targeting molecules include but are not limited to antibody molecules, growth receptor ligands, vitamins, peptides, haptens, aptamers, and other targeting molecules known to those skilled in the art. Drug molecules and imaging molecules can also be attached to the targeting moieties on the surface of the nanoparticles directly or via linker molecules. Specific, non-limiting examples of targeting moieties include vitamins, ligands, amines, peptide fragments, antibodies, aptamers, a transferrin, an antibody or fragment thereof, sialyl Lewis X antigen, hyaluronic acid, mannose derivatives, glucose derivatives, cell specific lectins, galaptin, galectin, lactosylceramide, a steroid derivative, an RGD sequence, EGF, EGF-binding peptide, urokinase receptor binding peptide, a thrombospondin- derived peptide, an albumin derivative and/or a molecule derived from combinatorial chemistry.
Further, the nanoparticles of the present disclosure may be surface functionalized and/or conjugated to other molecules of interest. Small low molecular weight molecules like folic acid, prostate membrane specific antigen (PSMA), antibodies, aptamers, molecules that bind to receptors or antigens on the cell surface etc., can be covalently bound to the block copolymer PEG-PPG-PEG or the PEG component of the polymeric matrix. In suitable embodiment of the present disclosure, the matrix comprises of polymer and an entity. In some cases the entity or targeting moiety can be covalently associated with surface of polymeric matrix. Therapeutic agents can be associated with the surface of the polymeric matrix or encapsulated throughout the polymeric matrix of the nanoparticles. Cellular uptake of the conjugated nanoparticle is higher compared to plain nanoparticles.
The nanoparticle of the present disclosure can comprise one or more agents attached to the surface of nanoparticle via methods well known in the art and also encapsulate one or more agents to function as a multifunctional nanoparticle. The nanoparticles of the present disclosure can function as multi-functional nanoparticles that can combine tumor targeting, tumor therapy and tumor imaging in an all-in-one system, providing a useful multi-modal approach in the battle against cancer. The multifunctional nanoparticle can have one or more active agents with similar or different mechanisms of actions, similar or different sites of action; or similar and different functions.
Entity encapsulation in the PLA-PEG-PPG-PEG nanoparticle is prepared by emulsion precipitation method. The PLA-PEG-PPG-PEG polymeric nanoparticle prepared using the process of the present disclosure is dissolved in an organic solvent comprising an organic solvent. The entity is added to the polymeric solution in the weight range of 10-20% weight of the polymer. The polymeric solution is then added drop-wise to the aqueous phase and stirred at room temperature for 10-12 hours to allow for solvent evaporation and nanoparticle stabilization. The entity-loaded nanoparticles are collected by centrifugation, dried, and stored at 2°C - 8°C until further use. Other additives like sugars, amino acids, methyl cellulose etc., may be added to the aqueous phase in the process for the preparation of the entity -loaded polymeric nanoparticles.
The entity-loading capacity of the nanoparticles of the present disclosure is high, reaching nearly about 70-90% as shown in Table 3. The PLA-PEG-PPG-PEG based nanocarrier system of the present disclosure prevents premature degradation and effective and targeted delivery of anticancer peptide to the cancer cells. Surface foliated biodegradable PLA-PEG-PPG-PEG nanoparticles encapsulating therapeutic peptides such as NuBCP-9, Bax BH3 etc., in the core can be effectively delivered into the cytosol of the cancer cells without the use of any cell penetrating peptides. In vitro studies with MCF-7 cell lines challenged with NuBCP-9 -loaded nanoparticles showed complete killing of cells in 48-72 hours as assessed by XTT assay (FIG. 7B; viable cells cleave the tetrazolium salt XTT to form a colorimetric cleavage product) and in vivo studies (FIGS. 11 and 12). FIG. 7B also shows the efficacy of the nanoparticles for sustained release and efficient delivery of drug compared with free drug formulations in the MCF-7 cell lines.
In suitable embodiments, higher loading of the entity in the PLA-PEG-PPG-PEG nanoparticles is achieved by linking the active agent with low molecular weight PLA. The entity is covalently linked with low molecular weight PLA by a reaction with a carbodiimide coupling reagent in combination with a hydroxy derivative. As an example, the carbodiimide coupling agent is ethyl-dimethyl aminopropylcarbodiimide and the hydroxy derivative is N- hydroxy-succinimide (EDC/NHS) chemistry. The molecular weight of PLA is in the range of about 2,000-10,000 g/mol. Higher loading of both hydrophobic and hydrophilic drugs in the PLA-PEG-PPG-PEG nanoparticles are achieved (Example 5, Tables 4 and 5). The nanoparticles with encapsulated PLA-drugs were delivered into the cytosol without the aid of cell penetrating peptides (CPPs).
Thus, provided herein is a process for preparing biodegradable polymeric
nanoparticles of PLA-PEG-PPG-PEG block copolymer comprising one or more entities (e.g., one or more therapeutic agents). In certain embodiments, the one or more entities comprise an MCL-1 antagonist.
In an embodiment, provided herein is a process for preparing biodegradable polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer comprising one or more entities (e.g. , one or more therapeutic agents), wherein said process comprises (a) homogenizing the entity with the polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer dissolved in an organic solvent at 250 to 400 rpm to obtain a primary emulsion (b) emulsifying the primary emulsion in an aqueous phase at 250 to 400 rpm to obtain a secondary emulsion, and (c) stirring the secondary emulsion at 25°C to 30°C at 250 to 400 rpm for 10 to 12 hours to obtain the nanoparticle of PLA-PEG-PPG-PEG comprising the entity.
In another embodiment there is provided a process for preparing biodegradable polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer comprising at least one entity, wherein said process comprises (a) homogenizing the entity with the polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer dissolved in an organic solvent at 250 to 400 rpm to obtain a primary emulsion (b) emulsifying the primary emulsion in an aqueous phase at 250 to 400 rpm to obtain a secondary emulsion, and (c) stirring the secondary emulsion at 25°C to 30°C at 250 to 400 rpm for 10 to 12 hours to obtain the nanoparticle of PLA-PEG-PPG-PEG comprising the entity, wherein said process optionally comprises the steps of washing the nanoparticles of PLA-PEG-PPG-PEG block copolymer comprising the entity with water and drying the nanoparticles by conventional method.
In another embodiment there is provided a process for preparing biodegradable polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer comprising at least one entity, wherein said process comprises (a) homogenizing the entity with the polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer dissolved in an organic solvent at 250 to 400 rpm to obtain a primary emulsion (b) emulsifying the primary emulsion in an aqueous phase at 250 to 400 rpm to obtain a secondary emulsion, and (c) stirring the secondary emulsion at 25°C to 30°C at 250 to 400 rpm for 10 to 12 hours to obtain the nanoparticle of PLA-PEG-PPG-PEG comprising the entity, wherein the entity is selected from a group consisting of small organic molecules, nucleic acids, polynucleotides, oligonucleotides, nucleosides, DNA, RNA, amino acids, peptides, protein, antibiotics, low molecular weight molecules, pharmacologically active molecules, drugs, metal ions, dyes, radioisotopes, contrast agents imaging agents, and targeting moiety.
In another embodiment there is provided a process for preparing biodegradable polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer comprising at least one entity, wherein said process comprises (a) homogenizing the entity with the polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer dissolved in an organic solvent at 250 to 400 rpm to obtain a primary emulsion (b) emulsifying the primary emulsion in an aqueous phase at 250 to 400 rpm to obtain a secondary emulsion, and (c) stirring the secondary emulsion at 25°C to 30°C at 250 to 400 rpm for 10 to 12 hours to obtain the nanoparticle of PLA-PEG-PPG-PEG comprising the entity, wherein the entity is a targeting moiety selected from the group consisting of vitamins, ligands, amines, peptide fragment, antibodies and aptamers.
In another embodiment there is provided a process for preparing biodegradable polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer comprising at least one entity, wherein said process comprises (a) homogenizing the entity with the polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer dissolved in an organic solvent at 250 to 400 rpm to obtain a primary emulsion (b) emulsifying the primary emulsion in an aqueous phase at 250 to 400 rpm to obtain a secondary emulsion, and (c) stirring the secondary emulsion at 25°C to 30°C at 250 to 400 rpm for 10 to 12 hours to obtain the nanoparticle of PLA-PEG-PPG-PEG comprising the entity, wherein the entity is linked to PLA.
In another embodiment there is provided a process for preparing biodegradable polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer comprising at least one entity, wherein said process comprises (a) homogenizing the entity with the polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer dissolved in an organic solvent at 250 to 400 rpm to obtain a primary emulsion (b) emulsifying the primary emulsion in an aqueous phase at 250 to 400 rpm to obtain a secondary emulsion, and (c) stirring the secondary emulsion at 25°C to 30°C at 250 to 400 rpm for 10 to 12 hours to obtain the nanoparticle of PLA-PEG-PPG-PEG comprising the entity, wherein the entity is linked to PLA of molecular weight in the range of 2,000 g/mol to 10,000 g/mol.
Another embodiment provides a biodegradable polymeric nanoparticle of PLA-PEG-
PPG-PEG comprising at least one entity obtained by the process comprising (a)
homogenizing the entity with the polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer dissolved in an organic solvent at 250 to 400 rpm to obtain a primary emulsion (b) emulsifying the primary emulsion in an aqueous phase at 250 to 400 rpm to obtain a secondary emulsion, and (c) stirring the secondary emulsion at 25°C to 30°C at 250 to 400 rpm for 10 to 12 hours to obtain the nanoparticle of PLA-PEG-PPG-PEG comprising the entity.
Another embodiment provides a composition comprising the biodegradable polymeric nanoparticle of PLA-PEG-PPG-PEG comprising at least one entity obtained by the process comprising (a) homogenizing the entity with the polymeric nanoparticles of PLA-PEG-PPG- PEG block copolymer dissolved in an organic solvent at 250 to 400 rpm to obtain a primary emulsion (b) emulsifying the primary emulsion in an aqueous phase at 250 to 400 rpm to obtain a secondary emulsion, and (c) stirring the secondary emulsion at 25°C to 30°C at 250 to 400 rpm for 10 to 12 hours to obtain the nanoparticle of PLA-PEG-PPG-PEG comprising the entity.
In another embodiment, there is provided a composition comprising the biodegradable polymeric nanoparticle of PLA-PEG-PPG-PEG comprising at least one entity obtained by the process comprising (a) homogenizing the entity with the polymeric nanoparticles of PLA- PEG-PPG-PEG block copolymer dissolved in an organic solvent at 250 to 400 rpm to obtain a primary emulsion (b) emulsifying the primary emulsion in an aqueous phase at 250 to 400 rpm to obtain a secondary emulsion, and (c) stirring the secondary emulsion at 25°C to 30°C at 250 to 400 rpm for 10 to 12 hours to obtain the nanoparticle of PLA-PEG-PPG-PEG comprising the entity, wherein the composition optionally comprises at least one
pharmaceutical excipient selected from the group consisting of preservative, antioxidant, thickening agent, chelating agent, isotonic agent, flavoring agent, sweetening agent, colorant, solubilizer, dye, flavors, binder, emollient, fillers, lubricants and preservative.
Polymeric Nanoparticles Comprising Pharmaceutical Agents
The biodegradable polymeric nanoparticles described herein can be used to deliver pharmaceutical agents. For example, a pharmaceutical agent that can be delivered by the nanoparticles disclosed herein comprises a chemotherapeutic drug, e.g. , paclitaxel, an anticancer peptide, e.g., a peptide comprising an amino acid sequence which is at least 75% identical to MS-1 peptide (SEQ ID NO: 1), or a polynucleotide, e.g. , a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 75% identical to MS- 1 peptide (SEQ ID NO: 1). In certain embodiments, the amino acid sequence is at least 80% identical to SEQ ID NO: 1. In certain embodiments, the amino acid sequence is at least 85% identical to SEQ ID NO: 1. In certain embodiments, the amino acid sequence is at least 90% identical to SEQ ID NO: 1. In certain embodiments, the amino acid sequence is at least 95% identical to SEQ ID NO: 1. In certain embodiments, the amino acid sequence is 100% identical to SEQ ID NO: 1. In certain embodiments, when delivered via a nanoparticle, the in vitro activity of the pharmaceutical agent against cancer cell proliferation, survival or colony formation is synergistically increased.
In certain embodiments, the pharmaceutical agent comprises a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 75% identical to SEQ ID NO: 1. In certain embodiments, the polynucleotide comprises a sequence at least 75% identical to SEQ ID NO: 2. In certain embodiments, the polynucleotide comprises a sequence at least 80% identical to SEQ ID NO: 2. In certain embodiments, the polynucleotide comprises a sequence at least 85% identical to SEQ ID NO: 2. In certain embodiments, the polynucleotide comprises a sequence at least 90% identical to SEQ ID NO: 2. In certain embodiments, the polynucleotide comprises a sequence at least 95% identical to SEQ ID NO: 2. In certain embodiments, the polynucleotide comprises a sequence 100% identical to SEQ ID NO: 2.
In certain embodiments, the pharmaceutical agent comprises a polynucleotide comprising a sequence which is at least 75%, 80%, 85%, 90%, 95% or 100% identical to 10 contiguous nucleotides in SEQ ID NOs: 3, 4 or 5, or a sequence complementary thereto. In certain embodiments, the pharmaceutical agent comprises a polynucleotide comprising a sequence which is at least 80%, 85%, 90%, 95% or 100% identical to 9 contiguous nucleotides in SEQ ID NOs: 3, 4 or 5, or a sequence complementary thereto. In certain embodiments, the pharmaceutical agent comprises a polynucleotide comprising a sequence which is at least 85%, 90%, 95% or 100% identical to 8 contiguous nucleotides in SEQ ID NOs: 3, 4 or 5, or a sequence complementary thereto. In certain embodiments, the pharmaceutical agent comprises a polynucleotide comprising a sequence which is at least 90%, 95% or 100% identical to 7 contiguous nucleotides in SEQ ID NOs: 3, 4 or 5, or a sequence complementary thereto.
In certain embodiments, the therapeutic agent comprises a peptide. In certain embodiments, the peptide comprises an amino acid analog, e.g. , cyanoalanine, canavanine, djenkolic acid, norleucine, 3-phosphoserine, homoserine, ihydroxy phenylalanine, 5- hydroxytryptophan, 1 -methylhistidine, 3-methylhistidine, diaminopimelic acid, ornithine, or diaminobutyric acid. In certain embodiments, the peptide comprises a modifying group. In certain embodiments, the modifying group is an acyl group, for example, formyl, dansyl, acetyl, benzoyl, trifluoroacetyl, succinyl, and methoxysuccinyl; an aromatic group, for example, benzyloxycarbonyl (Cbz); or an aliphatic group, for example, t-butoxycarbonyl
(Boc) or 9-Fluorenylmethoxycarbonyl (Fmoc). In certain embodiments, the modifying group is attached to the N-terminus or C-terminus of the peptide. In certain embodiments, the peptide is a linear peptide. In certain embodiments, the peptide is a cyclic peptide. In certain embodiments, the peptide is a stapled peptide comprising a synthetic linkage between at least two non-contiguous amino acid residues. In certain embodiments, the stapled peptide comprises an alpha-helix. A "stapled peptide" is a peptide comprising a selected number (e.g. , less than 20, 25 or 30) of standard or non-standard amino acids, further comprising at least one cross-linker between the at least two moieties. Stapled peptides and method of synthesis have been disclosed in U.S. Patent Nos. 8,592,377 and 8,586,707, and Walensky et al. (Science 305(5689): 1466-70), which are incorporated by reference in their entirety. In certain embodiments, the cross-linker is a hydrocarbon chain. In certain embodiments, the two moieties are conjugated to two amino acids having 2, 3, or 6 amino acids in between. In certain embodiments, the stapled peptide has improved stability, resistance to proteases, or cell-penetrating ability as compared to a corresponding peptide without cross-linker.
In certain embodiments, the therapeutic agent comprises a natural or non-natural polynucleotide. Non-limiting examples include DNA, RNA, and a morpholino comprising natural and/or non-natural nucleotides. In certain embodiments, the polynucleotide comprises one or more modifications selected from the group consisting of phosphorothioate bond replacing the phosphate bond, 2'-0-methylation on the nucleoside, and modifications on the terminal nucleosides. In certain embodiments, the modification protects the polynucleotide from degradation. In certain embodiments, the modification prevents ligation of the polynucleotide with another polynucleotide in vitro or in a cell. In certain
embodiments, the modification increases the efficiency of transcription or translation.
In an aspect, provided herein is a polymeric nanoparticle comprising a poly (lactic acid)-poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) (PLA-PEG-PPG- PEG) tetra block copolymer, wherein the polymeric nanoparticle is loaded with
a) optionally one or more chemotherapeutic agents; and
b) a peptide comprising a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1, or a polynucleotide encoding a peptide comprising a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1.
In an embodiment, the polymeric nanoparticle is loaded with a peptide comprising the amino acid sequence of SEQ ID NO: 1.
In an embodiment, the molecular weight of the PLA is between about 2,000 and about
80,000 daltons.
In another embodiment, the PLA-PEG-PPG-PEG tetra block copolymer is formed from chemical conjugation of PEG-PPG-PEG tri-block copolymer with PLA, and wherein the PEG-PPG-PEG tri-block copolymer can be of different molecular weights.
In an embodiment, the polymeric nanoparticle is further loaded with a
chemotherapeutic agent or a targeted anti-cancer agent.
In an embodiment, the polymeric nanoparticle is further loaded with a peptide comprising NuBCP-9. In another embodiment, the polymeric nanoparticle is further loaded with a peptide comprising MUC1.
In an embodiment, the chemotherapeutic agent is paclitaxel. In a further embodiment, the polymeric nanoparticle is loaded with paclitaxel and a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 in a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1 :9.
In an embodiment, the chemotherapeutic agent is paclitaxel. In a further embodiment, the polymeric nanoparticle is loaded with paclitaxel and a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 in a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1 :9.
In another embodiment, the chemotherapeutic agent is gemcitabine. In a further embodiment, the polymeric nanoparticle is loaded with gemcitabine and a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 in a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1 :9.
In another embodiment, the chemotherapeutic agent is gemcitabine. In a further embodiment, the polymeric nanoparticle is loaded with gemcitabine and a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 in a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1 :9.
In other embodiments, the chemotherapeutic agent or targeted anti-cancer agent is selected from the group consisting of doxorubicin, daunorubicin, decitabine, irinotecan, 7- ethyl-10-hydroxy-camptothecin (SN-38), cytarabine, docetaxel, triptolide (a diterpinoid epoxide), geldanamycin (a HSP90 inhibitor), tanespimycin (17-N-allylamino-17- demethoxygeldanamycin; 17-AAG), fluorouracil (5-FU), oxaliplatin, carboplatin, taxotere, methotrexate, and bortezomib.
In an embodiment, the polymeric nanoparticle consists essentially of a poly(lactic acid)-poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) (PLA-PEG-PPG- PEG) tetra block copolymer.
In another aspect, provided herein is a polymeric nanoparticle comprising
a) a poly(lactic acid)-poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) (PLA-PEG-PPG-PEG) tetra block copolymer;
b) optionally one or more therapeutics; and
c) a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1, or a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1,
for use in treating a disease selected from the group consisting of an autoimmune disease, an inflammatory disease, a metabolic disorder, a developmental disorder, a cardiovascular disease, a liver disease, an intestinal disease, an infectious disease, an endocrine disease and a neurological disorder.
In an embodiment, the polymeric nanoparticle consists essentially of a poly(lactic acid)-poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) (PLA-PEG-PPG- PEG) tetra block copolymer. Compositions
In an aspect, provided herein is a polymeric nanoparticle comprising a pharmaceutical combination for use in the preparation of a medicament for the treatment or prevention of a disease such as cancer. In an embodiment, the polymeric nanoparticle comprising the pharmaceutical combination is for use in the preparation of a medicament for the treatment of cancer.
In another aspect, the present disclosure provides for the use of the biodegradable polymeric nanoparticle consisting essentially of PLA-PEG-PPG-PEG block copolymer comprising a pharmaceutical combination for the manufacture of a medicament.
Also provided herein is a composition comprising the polymeric nanoparticle, wherein the polymeric nanoparticle comprises a pharmaceutical agent (e.g., a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1, a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1, a
chemotherapeutic agent or a targeted anti-cancer agent) and a pharmaceutically acceptable carrier. In certain embodiments, the therapeutic agent comprises a peptide. In certain embodiments, the peptide comprises an amino acid analog, e.g., cyanoalanine, canavanine, djenkolic acid, norleucine, 3-phosphoserine, homoserine, ihydroxy phenylalanine, 5- hydroxytryptophan, 1 -methylhistidine, 3-methylhistidine, diaminopimelic acid, omithine, or diaminobutyric acid. In certain embodiments, the peptide comprises a modifying group. In certain embodiments, the modifying group is an acyl group, for example, formyl, dansyl, acetyl, benzoyl, trifluoroacetyl, succinyl, and methoxysuccinyl; an aromatic group, for example, benzyloxycarbonyl (Cbz); or an aliphatic group, for example, t-butoxycarbonyl (Boc) or 9-Fluorenylmethoxycarbonyl (Fmoc). In certain embodiments, the modifying group is attached to the N-terminus or C-terminus of the peptide. In certain embodiments, the peptide is a linear peptide. In certain embodiments, the peptide is a cyclic peptide. In certain embodiments, the peptide is a stapled peptide comprising a synthetic linkage between at least two non-contiguous amino acid residues. In certain embodiments, the stapled peptide comprises an alpha-helix. A "stapled peptide" is a peptide comprising a selected number (e.g. , less than 20, 25 or 30) of standard or non-standard amino acids, further comprising at least one cross-linker between the at least two moieties. Stapled peptides and their methods of synthesis have been disclosed in U.S. Patent Nos. 8,592,377 and 8,586,707, and Walensky et al. (Science 305(5689): 1466-70), which are incorporated by reference in their entirety. In certain embodiments, the cross-linker is a hydrocarbon chain. In certain embodiments, the two moieties are conjugated to two amino acids having 2, 3, or 6 amino acids in between. In certain embodiments, the stapled peptide has improved stability, resistance to proteases, or cell-penetrating ability as compared to a corresponding peptide without cross-linker.
In certain embodiments, the therapeutic agent comprises a natural or non-natural polynucleotide. Non-limiting examples include DNA, RNA, and a morpholino comprising natural and/or non-natural nucleotides. In certain embodiments, the polynucleotide comprises one or more modifications selected from the group consisting of phosphorothioate bond replacing the phosphate bond, 2'-0-methylation on the nucleoside, and modifications on the terminal nucleosides. In certain embodiments, the modification protects the polynucleotide from degradation. In certain embodiments, the modification prevents ligation of the polynucleotide with another polynucleotide in vitro or in a cell. In certain
embodiments, the modification increases the efficiency of transcription or translation.
In an aspect, provided herein is use of polymeric nanoparticles comprising a pharmaceutical agent for the manufacture of a medicament for the treatment or prevention of a disease, such as cancer. In an embodiment, the use of a polymeric nanoparticle comprising a pharmaceutical combination is for the manufacture of a medicament for the treatment of a disease such as cancer.
In an embodiment of the compositions provided herein, the polymeric nanoparticle further comprises a targeting moiety attached to the outside of the polymeric nanoparticle, and wherein the targeting moiety is an antibody, peptide, or aptamer.
In an aspect, provided herein is a composition comprising
a) polymeric nanoparticles comprising a poly(lactic acid)-poly(ethylene glycol)- poly(propylene glycol)-poly(ethylene glycol) (PLA-PEG-PPG-PEG) tetra block copolymer; b) optionally one or more chemotherapeutic agents or anti-cancer targeting agents; and
c) a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1, or a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1.
In an embodiment of the composition, the composition comprises a peptide comprising the amino acid sequence of SEQ ID NO: 1.
In an embodiment of the composition, the molecular weight of PLA is between about 2,000 and about 80,000 daltons.
In an embodiment of the composition, the PLA-PEG-PPG-PEG tetra block copolymer is formed from chemical conjugation of PEG-PPG-PEG tri -block copolymer with PLA, and wherein the PEG-PPG-PEG tri-block copolymer can be of different molecular weights.
In an embodiment of the composition, the polymeric nanoparticles are loaded with a) optionally a chemotherapeutic agent or a targeted anti-cancer agent; and b) a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1, or a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1.
In an embodiment, the polymeric nanoparticle is loaded with a peptide comprising the amino acid sequence of SEQ ID NO: 1.
In a further embodiment of the composition, the chemotherapeutic agent is paclitaxel. In yet a further embodiment of the composition, the polymeric nanoparticles are loaded with paclitaxel and a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 in a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1 :9.
In yet a further embodiment of the composition, the polymeric nanoparticles are loaded with paclitaxel and a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 in a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1 :9.
In another embodiment of the composition, the chemotherapeutic agent is gemcitabine. In a further embodiment of the composition, the polymeric nanoparticles are loaded with gemcitabine and a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 in a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1 :9.
In another embodiment of the composition, the chemotherapeutic agent is gemcitabine. In a further embodiment of the composition, the polymeric nanoparticles are loaded with gemcitabine and a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 in a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1 :9.
In another embodiment of the composition, the chemotherapeutic agent or targeted anti-cancer agent is selected from the group consisting of doxorubicin, daunorubicin, decitabine, irinotecan, 7-ethyl-lO-hydroxy-camptothecin (SN-38), cytarabine, docetaxel, triptolide, geldanamycin, tanespimycin (17-N-allylamino-17-demethoxygeldanamycin; 17- AAG), fluorouracil (5-FU), oxaliplatin, carboplatin, taxotere, methotrexate, bortezomib, a peptide comprising NuBCP-9, or a polynucleotide encoding a peptide comprising NuBCP-9.
In another aspect, provided herein is a pharmaceutical composition comprising a) polymeric nanoparticles comprising a poly (lactic acid)-poly (ethylene glycol)- poly(propylene glycol)-poly(ethylene glycol) (PLA-PEG-PPG-PEG) tetra block copolymer; b) optionally one or more therapeutic agents; and
c) a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1,
for use in treating a disease selected from the group consisting of cancer, an autoimmune disease, an inflammatory disease, a metabolic disorder, a developmental disorder, a cardiovascular disease, liver disease, an intestinal disease, an infectious disease, an endocrine disease and a neurological disorder.
In an embodiment, the composition is for use in treating cancer. In a further embodiment, the cancer is breast cancer, prostate cancer, non-small cell lung cancer, metastatic colon cancer, pancreatic cancer, or a hematological malignancy. In yet a further embodiment, the cancer is breast cancer.
In another aspect, provided herein is a pharmaceutical composition comprising a) polymeric nanoparticles comprising a poly(lactic acid)-poly(ethylene glycol)- poly(propylene glycol)-poly(ethylene glycol) (PLA-PEG-PPG-PEG) tetra block copolymer; b) optionally one or more therapeutic agents; and
c) a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1, for use in treating a disease selected from the group consisting of cancer, an autoimmune disease, an inflammatory disease, a metabolic disorder, a developmental disorder, a cardiovascular disease, liver disease, an intestinal disease, an infectious disease, an endocrine disease and a neurological disorder.
In an embodiment, the composition is for use in treating cancer. In a further embodiment, the cancer is breast cancer, prostate cancer, non-small cell lung cancer, metastatic colon cancer, pancreatic cancer, or a hematological malignancy (e.g., acute myeloid leukemia, chronic lymphocytic leukemia, multiple myeloma). In yet a further embodiment, the cancer is breast cancer.
In an embodiment of any of the compositions provided herein, the polymeric nanoparticles consist essentially of poly(lactic acid)-poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) (PLA-PEG-PPG-PEG) tetra block copolymer.
In an embodiment of any of the compositions provided herein, the polymeric nanoparticles further comprise a targeting moiety attached to the outside of the polymeric nanoparticles, and wherein the targeting moiety is an antibody, peptide, or aptamer.
Suitable pharmaceutical compositions or formulations can contain, for example, from about 0.1% to about 99.9%, preferably from about 1% to about 60%, of the active ingredient(s). Pharmaceutical formulations for enteral or parenteral administration are, for example, those in unit dosage forms, such as sugar-coated tablets, tablets, capsules or suppositories, or ampoules. If not indicated otherwise, these are prepared in a manner known per se, for example by means of conventional mixing, granulating, sugar-coating, dissolving or lyophilizing processes. It will be appreciated that the unit content of a combination partner contained in an individual dose of each dosage form need not in itself constitute an effective amount since the necessary effective amount may be reached by administration of a plurality of dosage units.
The pharmaceutical compositions can contain, as the active ingredient, one or more of the nanoparticles in combination with one or more pharmaceutically acceptable carriers (excipients). In making the compositions disclosed herein, the active ingredient is typically mixed with an excipient, diluted by an excipient or enclosed within such a carrier in the form of, for example, a capsule, sachet, paper, or other container. When the excipient serves as a diluent, it can be a solid, semi-solid, or liquid material, which acts as a vehicle, carrier or medium for the active ingredient. Thus, the compositions can be in the form of tablets, pills, powders, lozenges, sachets, cachets, elixirs, suspensions, emulsions, solutions, syrups, aerosols (as a solid or in a liquid medium), ointments containing, for example, up to 10% by weight of the active compound, soft and hard gelatin capsules, suppositories, sterile injectable solutions, and sterile packaged powders.
Some examples of suitable excipients include lactose (e.g. lactose monohydrate), dextrose, sucrose, sorbitol, mannitol, starches (e.g. sodium starch glycolate), gum acacia, calcium phosphate, alginates, tragacanth, gelatin, calcium silicate, colloidal silicon dioxide, microcrystalline cellulose, polyvinylpyrrolidone (e.g. povidone), cellulose, water, syrup, methyl cellulose, and hydroxypropyl cellulose. The formulations can additionally include: lubricating agents such as talc, magnesium stearate, and mineral oil; wetting agents;
emulsifying and suspending agents; preserving agents such as methyl- and propylhydroxy- benzoates; sweetening agents; and flavoring agents.
The liquid forms in which the compounds and compositions of the present disclosure can be incorporated for administration orally or by injection include aqueous solutions, suitably flavored syrups, aqueous or oil suspensions, and flavored emulsions with edible oils such as cottonseed oil, sesame oil, coconut oil, or peanut oil, as well as elixirs and similar pharmaceutical vehicles.
Methods for Treating
In yet another aspect, the present disclosure provides a method for treating disease comprising administering biodegradable polymeric nanoparticles (e.g. , consisting essentially of PLA-PEG-PPG-PEG) comprising a pharmaceutical combination (i.e., more than one therapeutic agent) to a subject in need thereof.
In an embodiment, the disease is selected from the group consisting of cancer, an autoimmune disease, an inflammatory disease, a metabolic disorder, a developmental disorder, a cardiovascular disease, a liver disease, an intestinal disease, an infectious disease, an endocrine disease and a neurological disorder.
In still another aspect, the present disclosure provides a method for activating the
BCL2A1 pathway in a mammalian cell comprising administering biodegradable polymeric nanoparticles of the instant disclosure (e.g., consisting essentially of PLA-PEG-PPG-PEG) comprising a pharmaceutical combination (i.e., more than one therapeutic agent) to a subject in need thereof. In certain embodiments, the nanoparticles of the instant disclosure further include an MCL-1 antagonistic peptide. In certain embodiments, the MCL-1 antagonistic peptide is at least 85% identical to SEQ ID NO: 1. In other embodiments, the MCL-1 antagonistic peptide is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to SEQ ID NO: 1. In other embodiments, the nanoparticles of the instant disclosure further include a polynucleotide encoding a MCL-1 antagonistic peptide. In certain embodiments, the polynucleotide comprises a nucleic acid sequence which is at least 85% identical to SEQ ID NO: 2. In certain embodiments, the polynucleotide comprises a nucleic acid sequence which is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to SEQ ID NO: 2. The mammalian cells may be cancer cells (e.g. leukemia, lymphoma, breast cancer). The mammalian cells may be cancer cells that are resistant to treatment with a BCL-2 antagonist.
In certain embodiments, the expression of mRNA encoding proteins in the MUC1-C to NF-KB p65 to BCLA2A1 pathway are increased in the cell after administration of the biodegradable polymeric nanoparticles. In certain embodiments, the expression of proteins that participate in the BCLA2A1 pathway (e.g. MUC1-C, NF-κΒ p65, BCLA2A1) are increased in the cell after administration of the biodegradable polymeric nanoparticles. The cells treated with the biodegradable polymeric nanoparticles may undergo apoptosis and may have reduced ability to survive following treatment.
Also provided herein is a method for treating cancer in a subject in need thereof comprising administering to the subject a therapeutically effective amount of a polymeric nanoparticle comprising a PLA-PEG-PPG-PEG tetra block copolymer loaded with
a) optionally a chemotherapeutic agent and/or a targeted anti-cancer agent; and b) a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1, or a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1.
In certain embodiments, PLA-PEG-PPG-PEG tetra block copolymer is loaded with a peptide. In certain embodiments, the peptide comprises a amino acid analog, e.g., cyanoalanine, canavanine, djenkolic acid, norleucine, 3-phosphoserine, homoserine, ihydroxyphenylalanine, 5 -hydroxy tryptophan, 1 -methylhistidine, 3-methylhistidine, diaminopimelic acid, ornithine, or diaminobutyric acid. In certain embodiments, the peptide comprises a modifying group. In certain embodiments, the modifying group is an acyl group, for example, formyl, dansyl, acetyl, benzoyl, trifluoroacetyl, succinyl, and methoxysuccinyl; an aromatic group, for example, benzyloxycarbonyl (Cbz); or an aliphatic group, for example, t-butoxycarbonyl
(Boc) or 9-Fluorenylmethoxycarbonyl (Fmoc). In certain embodiments, the modifying group is attached to the N-terminus or C-terminus of the peptide. In certain embodiments, the peptide is a linear peptide. In certain embodiments, the peptide is a cyclic peptide. In certain embodiments, the peptide is a stapled peptide comprising a synthetic linkage between at least two non-contiguous amino acid residues.
In certain embodiments, PLA-PEG-PPG-PEG tetra block copolymer is loaded with a natural or non-natural polynucleotide. Non-limiting examples include DNA, RNA, and a morpholino comprising natural and/or non-natural nucleotides. In certain embodiments, the polynucleotide comprises one or more modifications selected from the group consisting of phosphorothioate bond replacing the phosphate bond, 2'-0-methylation on the nucleoside, and modifications on the terminal nucleosides. In certain embodiments, the modification protects the polynucleotide from degradation. In certain embodiments, the modification prevents ligation of the polynucleotide with another polynucleotide in vitro or in a cell. In certain embodiments, the modification increases the efficiency of transcription or translation.
In an embodiment, the polymeric nanoparticle is loaded with a peptide comprising the amino acid sequence of SEQ ID NO: 1.
In an embodiment, the chemotherapeutic agent is paclitaxel. In a further embodiment, the polymeric nanoparticle is loaded with paclitaxel and a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 in a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1 :9.
In an embodiment, the chemotherapeutic agent is paclitaxel. In a further embodiment, the polymeric nanoparticle is loaded with paclitaxel and a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: lin a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1:9.
In another embodiment, the chemotherapeutic agent is gemcitabine. In a further embodiment, the polymeric nanoparticle is loaded with gemcitabine and a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 in a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1 :9.
In another embodiment, the chemotherapeutic agent is gemcitabine. In a further embodiment, the polymeric nanoparticle is loaded with gemcitabine and a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 in a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1 :9.
In other embodiments, the chemotherapeutic agent or targeted anti-cancer agent is selected from the group consisting of doxorubicin, daunorubicin, decitabine, irinotecan, 7- ethyl-10-hydroxy-camptothecin (SN-38), cytarabine, docetaxel, triptolide, geldanamycin, tanespimycin (17-N-allylamino-17-demethoxy geldanamycin; 17-AAG), fluorouracil (5-FU), oxaliplatin, carboplatin, taxotere, methotrexate, bortezomib, a peptide comprising NuBCP-9, or a polynucleotide encoding a peptide comprising NuBCP-9. In a further embodiment, the polymeric nanoparticle is loaded with the chemotherapeutic or targeted anti-cancer agent (e.g. , doxorubicin, daunorubicin, decitabine, irinotecan, 7-ethyl-lO-hydroxy-camptothecin (SN-38), cytarabine, docetaxel, triptolide, geldanamycin, tanespimycin (17-N-allylamino-17- demethoxygeldanamycin; 17-AAG), fluorouracil (5-FU), oxaliplatin, carboplatin, taxotere, methotrexate, or bortezomib, a peptide comprising NuBCP-9, or a polynucleotide encoding a peptide comprising NuBCP-9); and a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 or a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 in a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1 :9.
In an embodiment, the cancer is breast cancer, prostate cancer, non-small cell lung cancer, metastatic colon cancer, pancreatic cancer, or a hematological malignancy (e.g. , acute myeloid leukemia, chronic lymphocytic leukemia, multiple myeloma). In a particular embodiment, the cancer is breast cancer.
In an aspect, provided herein is method for treating a disease in a subject in need thereof comprising administering to the subject a therapeutically effective amount of a polymeric nanoparticle consisting essentially of a PLA-PEG-PPG-PEG terra block copolymer, wherein the polymeric nanoparticle is loaded with
a) optionally one or more therapeutic agents; and
b) a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1, or a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1.
In an embodiment, the polymeric nanoparticle is loaded with a peptide comprising the amino acid sequence of SEQ ID NO: 1.
In an embodiment, the disease selected from the group consisting of cancer, an autoimmune disease, an inflammatory disease, a metabolic disorder, a developmental disorder, a cardiovascular disease, a liver disease, an intestinal disease, an infectious disease, an endocrine disease and a neurological disorder.
In another aspect, provided herein is a method for treating cancer in a subject in need thereof comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising
a) polymeric nanoparticles comprising a PLA-PEG-PPG-PEG tetra block copolymer; b) optionally a chemotherapeutic agent, an anti-cancer targeted agent, and/or an immunotherapeutic agent; and
c) a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1, or a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1.
In an embodiment of the method, the pharmaceutical composition comprises a peptide comprising the sequence of SEQ ID NO: 1.
In an embodiment of the method, the chemotherapeutic agent is paclitaxel. In a further embodiment of the method, the polymeric nanoparticles are loaded with paclitaxel and a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 in a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1 :9.
In an embodiment of the method, the chemotherapeutic agent is paclitaxel. In a further embodiment of the method, the polymeric nanoparticles are loaded with paclitaxel and a peptide comprising a polynucleotide encoding an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 in a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1 :9.
In another embodiment of the method, the chemotherapeutic agent is gemcitabine. In a further embodiment of the method, the polymeric nanoparticles are loaded with gemcitabine and a peptide comprising an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 in a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1 :9.
In another embodiment of the method, the chemotherapeutic agent is gemcitabine. In a further embodiment of the method, the polymeric nanoparticles are loaded with gemcitabine and a peptide comprising a polynucleotide encoding an amino acid sequence which is at least 75%, 80%, 85%, 90% or 95% identical to SEQ ID NO: 1 in a ratio of about 9: 1, 8:2, 7:3, 6:4, 5:5, 4:6, 3:7, 2:8, or 1 :9.
In another embodiment of the method, the chemotherapeutic agent or targeted anticancer agent is selected from the group consisting of doxorubicin, daunorubicin, decitabine, irinotecan, 7-ethyl-lO-hydroxy-camptothecin (SN-38), cytarabine, docetaxel, triptolide, geldanamycin, tanespimycin (17-N-allylamino-17-demethoxygeldanamycin; 17-AAG), fluorouracil (5-FU), oxaliplatin, carboplatin, taxotere, methotrexate, bortezomib, a peptide comprising NuBCP-9, or a polynucleotide encoding a peptide comprising NuBCP-9.
In certain embodiments, the targeted anti-cancer agent selectively inhibits one or more of the following target proteins: receptor tyrosine kinases (e.g., epidermal growth factor receptor (EGFR), ErbB2 (also called HER2/neu), ErbB3, ErbB4, Raf family kinases, platelet- derived growth factor (PDGF-R) and vascular endothelial growth factor receptor (VEGFR)), ALK, MEK, PARP, c-KIT, CDK, insulin-like growth factor- 1 receptor, neuregulin, transforming growth factor-a, estrogen receptor (ER), progesterone receptor, BCR-ABL, and BCL-2. The targeted anti-cancer agent targeting EGFR can be selected from gefitinib, erlotinib, afatinib, osimertinib, lapatinib and necitumumab. The targeted anti-cancer agent targeting HER2 can be trastuzumab or lapatinib. The targeted anti-cancer agent targeting B- Raf can be vermurafinib or dabrafenib. The targeted anti-cancer agent targeting a plurality of receptor tyrosine kinases can be selected from sorafenib, sunitinib. The targeted anti-cancer agent targeting ALK can be selected from: crizotinib, ceritinib, and alectinib. The targeted MEK inhibitor can be trametinib or cobimetinib. The targeted anti-cancer agent targeting ER can be selected from tamoxifen, clomifene, raloxifene, and fulvestrant. The targeted anticancer agent targeting BCR-ABL can be selected from imatinib, nilotinib, dasatinib, bosutinib, ponatinib, bafetinib. The targeted anti-cancer agent targeting BCL-2 can be selected from obatoclax, navitoclax, and gossypol.
In certain embodiment, the immunotherapeutic agent comprises one or more monoclonal antibodies, bispecific antibodies, immune checkpoint inhibitors, T cell receptor (TCR) therapies, chimeric antigen receptor (CAR) therapies, hormone therapies, cancer vaccines, and gene therapies. Monoclonal antibody immunotherapies include monoclonal antibodies that induce immune responses to cancer cells. Non-limiting examples include antibodies binding to CD20 (e.g., rituximab, ibritumomab, tositumomab, ofatumumab), antibodies binding to CD33 (e.g., gemtuzumab), antibodies binding to CD30 (e.g. , brentuximab), antibodies binding to CD52 (e.g., alemtuzumab), antibodies binding to complement component 5 (C5) (e.g., eculizumab), agonistic antibodies binding to
TNFSF4/OX40, agonistic antibodies binding to GITR, and agonistic antibodies binding to 4- 1BB (CD 137). Bispecific antibodies include multi-specific antibodies that target one or more tumor antigens and one or more immune cell-specific protein, thereby bringing immune cells to the proximity of cancer cells. Immune checkpoint inhibitors include antagonists to immune checkpoint proteins (e.g., antagonistic antibodies binding to PD-1, PD-L1, CTLA-4, TIM3, LAG3, TIGIT, VISTA, CEACAM1 ; inhibitors to IDOl/2 and/or TDO). TCR therapies may be an isolated recombinant TCR. Alternatively, the TCR therapy comprises a cell expressing a recombinant TCR on the surface that specifically binds to a major histocompatibility complex (MHC) molecule complexed with one or more tumor antigens.
Recombinant TCR-expressing cells may be generated by methods known in the art. Host T cells may be isolated from a subject having cancer or expressing tumor antigens and transfected or transduced with nucleic acid constructs encoding a recombinant TCR, then administered to the subject from whom they were isolated (Hombach, et al. 2001, Cancer Res. 61 : 1976-1982, incorporated by reference herein in its entirety). CAR therapies may comprise a cell expressing a chimeric antigen receptor on the surface that specifically binds to a tumor antigen. CAR-expressing cells may be generated by methods known in the art, and may be administered to the subject from whom they were isolated. Cancer vaccines include tumor antigens, and monocytic cells or dendritic cells engineered to express one or more tumor antigens, optionally in combination of one or more adjuvants. Other examples of immunotherapeutic agents include COX-2 inhibitors (e.g. , celecoxib, rofecoxib, valdecoxib) and tryptamine derivatives related to serotonin (e.g., alpha-methyl tryptophan).
In an embodiment of the method, the cancer is breast cancer, prostate cancer, non- small cell lung cancer, metastatic colon cancer, pancreatic cancer, or a hematological malignancy (e.g., acute myeloid leukemia, chronic lymphocytic leukemia, multiple myeloma).
The administration of a polymeric nanoparticle comprising a pharmaceutical combination may result not only in a beneficial effect, e.g. a synergistic therapeutic effect, e.g. with regard to alleviating, delaying progression of or inhibiting the symptoms, but also in further surprising beneficial effects, e.g. fewer side-effects, more durable response, improved pharmacodynamics and/or pharmacokinetics, an improved quality of life or a decreased morbidity, compared with a monotherapy (either monotherapy using the polymeric nanoparticle delivery system, or monotherapy where the agent is delivered by conventional means) applying only one of the pharmaceutically therapeutic agents used in combinations disclosed herein.
It can be shown by established test models that a polymeric nanoparticle comprising a pharmaceutical combination results in the beneficial effects described herein before. The person skilled in the art is fully enabled to select a relevant test model to prove such beneficial effects. The pharmacological activity of a composition comprising a polymeric nanoparticle and a therapeutic agent may, for example, be demonstrated in a clinical study or in an animal model.
The methods of treating disclosed herein can be particularly suited for a subject who has been diagnosed with at least one of the cancers described as treatable by the use of a polymeric nanoparticle described herein. For example, the biodegradable tetrablock polymeric nanoparticles for intracellular MS-1 peptide delivery are highly effective in inhibiting cancer survival and proliferation.
In some embodiments, the subject has been diagnosed with a cancer named herein, and has proven refractory to treatment with at least one conventional chemotherapeutic agent, e.g., paclitaxel, nab-paclitaxel (ABRAXANE), docetaxel, vincristine, vinblastine, taxol, or a
BCL-2 antagonist. Thus, in one embodiment, the treatments disclosed herein are directed to subjects or patients who have received one or more treatments with a conventional chemotherapeutic or a BCL-2 antagonist, and remain in need of more effective treatment. In a particular embodiment, the treatments disclosed herein are directed to subjects or patients who have received treatment with a BCL-2 antagonist and remain in need of more effective treatment. In certain embodiments, the BCL-2 antagonist is ABT199 (venetoclax) or
ABT263 (navitoclax).
Although the subject matter has been described in considerable detail with reference to certain preferred embodiments thereof, other embodiments are possible. As such, the spirit and scope of the appended claims should not be limited to the description of the preferred embodiment contained therein.
EXAMPLES
The disclosure will now be illustrated with working examples, and which is intended to illustrate the working of disclosure and not intended to restrictively any limitations on the scope of the present disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice of the disclosed methods and compositions, the exemplary methods, devices and materials are described herein. Example 1: Preparation of Polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer
Poly (lactic acid) (Mw. -45,000-72,000 g/mol), PEG-PPG-PEG (Table 1) and tissue culture reagents were obtained from Sigma-Aldrich (St. Louis, MO). All reagents were analytical grade or above and used as received, unless otherwise stated. Cell lines were obtained from NCCS Pune, India. MS-1 peptide was custom synthesized with 95% purity. Preparation of PLA-PEG-PPG-PEG block copolymer
5 gm of poly (lactic acid) (PLA) with an average molecular weight of 60,000 g/mol was dissolved in 100 ml CH2CI2 (dichloromethane) in a 250 ml round bottom flask. To this solution, 0.7 g of PEG-PPG-PEG polymer (molecular weight range of 1100-12,500 Mn) was added. The solution was stirred for 10-12 hours at 0°C. To this reaction mixture, 5 ml of 1% N,N-dicyclohexylcarbodimide (DCC) solution was added followed by slow addition of 5 ml of 0.1% 4-Dimethylaminopyridine (DMAP) at -4°C to 0°C/subzero temperatures. The reaction mixture was stirred for the next 24 hours followed by precipitation of the PLA-PEG- PPG-PEG block copolymer with diethyl ether and filtration using Whatman filter paper No.1. The PLA-PEG-PPG-PEG block copolymer precipitates so obtained are dried under low vacuum and stored at 2°C to 8°C until further use.
Preparation of PLA-PEG-PPG-PEG nanoparticles
The PLA-PEG-PPG-PEG nanoparticles were prepared by emulsion precipitation method. lOOmg of the PLA-PEG-PPG-PEG copolymer obtained by the above mentioned process was separately dissolved in an organic solvent, for example, acetonitrile, dimethyl formamide (DMF) or dichloromethane to obtain a polymeric solution.
The nanoparticles were prepared by adding this polymeric solution dropwise to the aqueous phase of 20 ml distilled water. The solution was stirred magnetically at room temperature for 10 to 12 hours to allow residual solvent evaporation and stabilization of the nanoparticles. The nanoparticles were then collected by centrifugation at 25,000 rpm for 10 min and washed three times using distilled water. The nanoparticles were further lyophilized and stored at 2°C to 8°C until further use.
Characterization of polymeric nanoparticles of PLA-PEG-PPG-PEG block copolymer
The shape of the nanoparticles obtained by the process mentioned above is essentially spherical as is seen in the Transmission Electron Microscopy image shown in FIGS. 4A-B. The TEM images allowed for the determination of the particle size range, which is about 30 to 120 nm. The hydrodynamic radius of the nanoparticle was measured using a dynamic light scattering (DLS) instrument and is in the range of 110-120 nm (Table 2).
The characteristics of the PLA-PEG-PPG-PEG nanoparticles synthesized using a range of molecular weights of the block copolymer, PEG-PPG-PEG, is shown in Table 2.
The Fourier-transform infrared spectroscopy (FTIR) spectra of the PLA, PLA-PEG, the block copolymer PEG-PPG-PEG and the polymeric nanoparticles PLA-PEG-PPG-PEG are given in FIG. 2A. The FTIR proved to be insensitive to the differences between these species. Therefore, further characterization was done using nuclear magnetic resonance (NMR) spectroscopy.
The NMR spectra of the PLA-PEG-PPG-PEG nanoparticles obtained using different molecular weights of the block copolymer, PEG-PPG-PEG, are shown in FIGS. 3A-C. In the figures, the proton with a chemical shift of about 5.1 represents the ester proton of PL A and the proton with a chemical shift at around 3.5 represent the ether proton of PEG-PPG-PEG. The presence of both the protons in the spectra confirms the conjugation of PLA with PEG- PPG-PEG. Example 2: Preparation of an entity-loaded nanoparticle
Preparation of a drug encapsulated polymeric nanoparticle
PLA-PEG-PPG-PEG nanoparticles were prepared using the process of Example 1 is dissolved in 5 ml of an organic solvent like acetonitrile (CH3CN), dimethyl formamide (DMF; C3H7NO), acetone or dichloromethane (CH2CI2). Nanoparticles encapsulating MS-1 peptide were prepared using a double emulsion solvent evaporation method as reported by
Kumar M. et al. (Cancer Research 74(12): 3271-3281, 2014, incorporated by reference herein in its entirety). MS-1 peptide was added into the dissolved PLA-PEG-PPG-PEG copolymer with a slight sonication. Then this mixture was added into the aqueous phase containing poloxomer F127. Comparison of the loading efficacy of the polymeric nanoparticle prepared using different weights of the co-polymer
PLA-PEG-PPG-PEG polymeric nanoparticles were prepared using different molecular weights of the PEG-PPG-PEG polymer using the process as mentioned above. Pyrene loaded PLA-PEG-PPG-PEG polymeric nanoparticles were prepared using the PLA- PEG-PPG-PEG copolymer synthesized using varying molecular weights of the PEG-PPG- PEG polymer. Pyrene was taken in the range of 2-20% weight of the PLA-PEG-PPG-PEG block copolymer and fluorescent dye-loaded nanoparticles were prepared. The entity loading capacity of the nanoparticles varied depending on the molecular weight of the PEG-PPG- PEG polymer used for the synthesis of the nanoparticles. Table 3 provides the percentage of the imaging molecule encapsulated by the polymeric nanoparticles produced using different molecular weights of the block copolymer. Cellular internalization of the fluorescent dye, Rhodamine
Rhodamine loaded PLA-PEG-PPG-PEG polymeric nanoparticles were prepared using the process as mentioned above. Rhodamine was taken in the range of 2-20% weight of the PLA-PEG-PPG-PEG block copolymer and fluorescent dye-loaded nanoparticles were prepared.
1 x 10s MCF-7 cells were initially plated and grown to 60% confluence on cover slip flasks. Cells were then washed twice with phosphate-buffered saline (PBS) and cultured in 10 ml of DMEM medium containing 10% Fetal Bovine Serum (FBS) and 1 %
penicillin/streptomycin for 24 h. The growth medium was then aspirated and the cells were washed twice with PBS. The rhodamine-loaded nanoparticles were added to cells attached to coverslips and incubated at 37°C for 12 hrs. After incubation, cells were washed, and coverslips were removed. This was followed by washing with PBS solution and finally fixed with 4% paraformaldehyde for 20 minutes at room temperature. After removing the fixing agent, the cells were washed and cells were stain with DAPI (fluorescent dye-stain nuclei cells) for 5 min and then rinsed in running tap water for 1 min. The coverslips were then analyzed using confocal fluorescent microscope (Olympus, Fluoview FV1000 Microscope, Japan). Cellular internalization of nanoparticles in MCF-7 cells was confirmed by using fluorescent dye (Rhodamine B) loaded nanoparticles in conjunction with Confocal Laser Scanning Microscope (CLSM) (FIG. 5). Example 3: Evaluation of the delivery potential of the PLA-PEG-PPG-PEG polymeric nanoparticle
In vitro release of encapsulated drug by the polymeric nanoparticle PLA-PEG-PPG-PEG
A mixture containing 10 ml phosphate buffer saline and 10 mg PLA-PEG-PPG-PEG nanoparticles encapsulating rhodamine B-conjugated NuBCP-9 (drug) was stirred at 200 rpm at 37°C. Supernatant samples of the mixture were collected by centrifugation at 25,000 rpm at different time intervals for a period of 6 days. The nanoparticles were re-suspended in fresh buffer after each centrifugation. 2 ml of the supernatant was subjected to protein estimation using BCA kit (Pierce, USA) to evaluate the amount of drug release
spectrophotometrically at 562 nm. The drug release was calculated by means of a standard calibration curve. It was observed that the release of the drug by the PLA-PEG-PPG-PEG polymeric nanoparticles can be controlled better than the conventional PLA nanoparticles (FIG. 6). Example 4: In vivo studies to evaluate the safety and toxicity of the nanoparticles
Studies were conducted in BALB/c mice to evaluate the toxicity and safety of the PLA-PEG-PPG-PEG polymeric nanoparticles prepared using the process as given in
Example 1. Hematology parameters
PLA-PEG-PPG-PEG nanoparticles were intravenously injected in the animal group at a single dose of 150mg/kg body weight and hematology parameters were evaluated in the control and nanoparticle-treated groups at intervals of 7 days for a period of 21 days. The control group received no nanoparticles.
There was no significant change in the Complete Blood Count (CBC), Red blood cell
(RBC) count, White blood cell (WBC) count, Neutrophils, lymphocytes, packed cell volume, MCV (Mean Corpuscular Volume), MCH (Mean Corpuscular Hemoglobin) and MCHC (Mean Corpuscular Hemoglobin Concentration) between the control and the nanoparticle- treated groups as seen in FIGS. 7A, 7B and 7C. Biochemistry blood assays for liver and kidney functions
PLA-PEG-PPG-PEG nanoparticles were intravenously injected in the animal group at a single dose of 150mg/kg body weight and hematology parameters were evaluated in the control and nanoparticle-treated groups at intervals of 7 days for a period of 21 days.
There were no significant changes in the total protein, albumin and globulin levels between the control and the treated groups. The levels of the liver enzymes indicating liver damage, such as alanine transaminase (ALT), aspartate transaminase (AST) and alkaline phosphatase (ALP), were non-significantly increased in the PLA-PEG-PPG-PEG
nanoparticle treated group (FIGS. 8 A and 8B). Urea and Blood urea nitrogen (BUN) is a good indicator of renal function. There was no significant change in the urea and BUN levels of treated mice compared to control (FIG. 8C).
Histopathology of the organs of mice treated with PLA-PEG-PPG-PEG nanoparticles
BALB/c mice were treated with PLA-PEG-PPG-PEG nanoparticles at a single dose of 150mg/kg body weight. After 21 days, the animals were sacrificed and histology of the organ tissues was carried out to assess any tissue damage, inflammation, or lesions due to toxicity caused by the PLA-PEG-PPG-PEG nanoparticles or their degradation products. No apparent histopathological abnormalities or lesions were observed in the brain, heart, liver, spleen, lung and kidney of the nanoparticle-treated animal (FIG. 9).
Example 5: In vitro studies to evaluate the efficacy of MS-1 peptide/NPs in inhibiting cancer cell proliferation and inducing cell death.
Studies were conducted with hematological cell lines to evaluate the efficacy of the
PLA-PEG-PPG-PEG polymeric nanoparticles (NPs) encapsulating MS-1 peptide prepared using the process as given in Example 2.
Preparation and characterization of MS-1 peptide
MCL-1 protein is an anti-apoptotic protein in the BCL-2 family. A peptide antagonist to MCL-1 was developed, comprising the amino acid sequence of
RPEIWMTQGLRRLGDEINAYYAR (SEQ ID NO: 1). This peptide, called MS-1 peptide herein, was modified from the BH3 peptide of Bim (BCL2L11) and specifically interacted with and inhibited the activity of MCL-1 (Foight et al., ACS Chemical Biology (2014) 9: 1962-1968, incorporated by reference herein in its entirety). In vitro cytotoxicity analysis
The sensitivity of cancer cells to antagonists targeting anti-apoptotic BCL-2 family proteins varies. To evaluate the cytotoxicity of the MS-1 peptide encapsulated in PLA-PEG- PPG-PEG nanoparticles, an in vitro analysis was conducted. THP-1 cells were treated with 5 μΜ MS-1 peptide/NPs or 5 μΜ BCL-2 targeting peptide NuBCP-9/NPs for 72 hours. The sequence of NuBCP-9 peptide is FSRSLHSLL (see Kolluri SK, et al. Cancer Cell 2008;
14:285-98, which is incorporated by reference in its entirety). As shown in FIGS. 10A and 10B, NuBCP-9/NPs had little impact on proliferation of THP-1 cells. In contrast, MS-1 peptide/NPs considerably abrogated cell proliferation, and necrosis was significantly induced. Treatment of MS-1 peptide alone did not induce cell necrosis or reduction of cell number. Apoptosis was also observed, as the cleavage of Caspase-3, a marker of caspase activation, was detected in THP-1 cells after 96-hour treatment with MS-1 peptide/NPs (FIG. 13). Thus, THP-1 cells were sensitive to MS-1 peptide/NPs.
Another acute myeloid leukemia cells (AML) cell line U937 also underwent reduced cell proliferation and/or cell death upon treatment of 7.5 μΜ or 10 μΜ of MS-1 peptide/NPs (FIG. 11). However, two other myeloid or pro-myeloid leukemia cell lines, K562 and HL- 60, were not sensitive to 10 μΜ MS-1 peptide/NPs (FIGS. 12A and 12B). The sensitivity to MS-1 peptide/NPs of these cell lines is correlated to their MCL-1 expression levels: THP-1 and U-937 cells express high levels of MCL-1, whereas HL-60 and K562 cells express low levels of MCL-1 (see Pan et al, Cancer Discov. 2014; 4(3):362-75).
In vitro toxicity to ABT 199-resistant AML cells
ABT199 (venetoclax) is a small molecule inhibitor of BCL-2. ABT 199-resistant
THP-1 cells were obtained by culturing wild-type THP-1 cells with low to high doses of ABT199 for at least 4-5 months while selecting the surviving cells. The expression level of MCL-1 was increased in the ABT 199-resistant cells (FIG. 14A), suggesting that MCL-1 might contribute to survival of venetoclax-relapsed or refractory cancer cells. To evaluate the efficacy of MS-1 peptide/NPs in these cells, wild-type or ABT 199-resistant THP-1 were treated with 5 μΜ MS-1 peptide/NPs for 72 hours. The inhibition of cell proliferation by MS-1 peptide/NPs in these two cell lines were similar (FIG. 14B). Therefore, MS-1 peptide/NPs could be effective in treating a venetoclax-relapsed or refractory cancer, or other cancers that are resistant to a BCL-2 inhibitor.
In vitro colony formation analysis
Cancer cells undergo clonal expansion. The colony formation ability of U937 cells was assessed by culturing the cells in soft agar containing different concentrations of MS-1 peptide/NPs. As shown in FIG. 15A, 1.5 μΜ of MS-1 peptide/NPs was sufficient to abrogate colony formation of U937 cells.
Colony formation was further examined in the presence of FLT-3 ligand, a cytokine that activates receptor tyrosine kinase FLT-3. This treatment mimicked constitutive FLT-3 activation due to mutations in FLT-3, such mutations being present in about 30% of all AML patients. As shown in FIG. 15B, while FLT-3 ligand partially inhibits colony formation, possibly due to its interactions with the FLT-3-receptor, MS-1 peptide/NPs completely abrogated colony formation regardless of the presence of FLT-3 ligand. FLT-3 activation did not reverse the cytotoxicity of MS-1 peptide/NPs, suggesting that MS-1 peptide/NPs could be effective in treating AML harboring FLT-3 mutations.
Reactive oxygen species (ROS) analysis
ROS level is elevated by cellular stress, and could mediate, facilitate or accelerate cell death in many conditions. The generation of ROS was examined in U937 cells which were sensitive to MS-1 peptide/NPs, and K562 cells which were resistant to MS-1 peptide/NPs. As shown in FIG. 16, the level of ROS was increased by MS-1 peptide/NPs treatment more significantly in U937 cells than in K562 cells. This result was consistent with the cytotoxicity data, suggesting the involvement of ROS in the cellular stress and cell death induced by MS-1 peptide/NPs. Example 6: Targeting MCL-1 with MS-l/NPs activates the MUCl-C to NF-κΒ p65 to BCL2A1 pathway.
In order to examine the effects of MS-l/NPs on the BCL2A1 pathway, the human mammary carcinoma cell line BT-20 was treated in vitro with either empty NPs or 7.5 μΜ MS-l/NPs for 5 days, and the cell survival was measured. Human BT-20 cell line was maintained in RPMI1640 medium containing 10% heat-inactivated fetal bovine serum (FBS), 100 units/ml penicillin, 100 g/ml streptomycin and 2 mM L-glutamine. BT-20 cells were treated either with empty nanoparticles, "NP", or with 7.5 μΜ MCL-1 peptide-NPs, "MS- l/NPs" for 5 days. Cell survival was determined by Trypan blue exclusion analysis and results are shown as numbers of cells not stained by Trypan blue per milliliter. FIG. 17A shows a bar graph of the relative cell survival of the MS-l/NP-treated BT-20 cells. BT-20 cell survival of MS-l/NP-treated cells relative to empty NP -treated controls is drastically reduced over a 5 day period.
To determine whether the decrease in BT-20 cell survival was due to an apoptotic mechanism, cell lysates from the treated and untreated BT-20 cells were immunoblotted for proteins in the MUCl-C to NF-κΒ p65 to BCL2A1 pathway as indicated in FIG. 17B. Each of MUCl-C, NF-KB p65, and BCL2A1 was assessed, β-actin was used as an internal control. MS-l/NP-treated BT-20 cell lysates showed an increase in protein expression of the apoptotic pathway proteins MUCl-C, NF-κΒ p65, and BCL2A1, compared with empty -NP -treated controls. Without being limited by any specific mechanism, these data demonstrate that MS- 1/NPs can drastically upregulate proteins in the BCL2A1 apoptotic pathway.
The apoptotic effect of MS-l/NPs in cancer cells was also analyzed in a rodent xenograft tumor model. BT-20 cells were injected subcutaneously into the flanks of nude (nu nu) mice for analysis in an animal xenograft study. Mice with established tumors were pair-matched and then treated with empty NPs or 20 mg/kg MCL-1 peptide-NPs (MS 1/NPs) each week for 3 weeks. Tumors were harvested on day 40, and the volumes of the tumors were measured. Tumor volumes were calculated by formula V=(L x W2)/2, wherein L and W are the larger and smaller diameters of the tumor, respectively. FIG. 17C shows a graph of changes in tumor volume over time for subjects treated with either empty NPs (circles) or MSl/NPs (squares). The results are expressed as tumor volume (mean ± SEM; 6 mice per group; *p<0.01). As shown in FIG. 17C, the volume of BT-20 cell tumors from mice treated with 20 mg/kg MS -1 /NPs increased much less rapidly over time than in control nude mice treated with empty NPs. Thus, the data show that MSl/NPs significantly inhibited the continued growth of the BT-20 cell tumors in vivo.
To confirm that the inhibited tumor cell growth was related to increased apoptosis, relative mRNA data obtained by qRT-PCR were examined in tumor cells extracted from tumors harvested during the in vivo tumor xenograft study discussed above. FIG. 17D shows a bar graph of relative levels of MCL-1 mRNA in MS- 1/NP -treated tumor cells versus corresponding empty NP -treated controls (mean ± SD of 3 determinations, p=0.6). The bar graph of FIG. 17E shows that the relative mRNA levels of MCL-1 were lower for empty NP- treated control subjects. The relative mRNA levels of apoptotic pathway protein BCL2A1 in MS-l/NP -treated tumor cells was significantly increased (pO.01). These data demonstrate that MS-l/NPs increased relative mRNA levels of apoptotic pathway protein BCL2A1 in vivo.
The mRNA data were further analyzed by immunoblot. Whole cell lysates from the extracted tumor cells of the in vivo rodent tumor xenograft study were immunoblotted with antibodies against MUC1-C, NF-κΒ p65, and BCL2A1. β-actin was assessed as an internal control (see FIG. 17F). Tumor cell lysates from MS 1/NP -treated xenograft tumors showed an increase in protein expression of proteins NF-κΒ p65, and BCL2A1.
The apoptotic effects of MS-l/NPs were also analyzed in cultured leukocytes from human AML patients. Leukocytes were obtained pre-therapy from two AML patients under an approved protocol, as well as from healthy human controls. The leukocytes from the AML patients and the control patients were then cultured with 7.5 μΜ MS-l/NPs for 72 hours, and cell survival was assessed using Trypan blue exclusion. As seen in the bar graphs of FIG. 18A and 18B, MS-l/NP treatment of leukocytes from both of the AML patients resulted in a significantly lower number of cultured leukocytes compared to the cultured leukocytes from healthy controls.
LIST OF TABLES
Table 1 provides the details of PEG-PPG-PEG block copolymer used for the preparation of the PLA-PEG-PPG-PEG copolymer. TABLE 1
SI. No. Mol. wt. Chemical Name Composition
1 1100 PEG-PPG-PEG 1100 PEG 10% wt.
2 4400 PEG-PPG-PEG 4400 PEG 30% wt.
3 8400 PEG-PPG-PEG 8400 PEG 80% wt.
Table 2 shows the characterization of PLA-PEG-PPG-PEG nanoparticles
Figure imgf000057_0001
Table 3 shows the loading efficacy of the PLA-PEG-PPG-PEG nanoparticles synthesized using varying molecular weights of the polymer PEG-PPG-PEG.
Figure imgf000057_0002
SEQUENCE LISTING
SEQ ID NO: 1 : amino acid sequence of MS-1 peptide
RPEIWMTQGLRRLGDEINAYYAR
SEQ ID NO: 2: nucleotide sequence of DNA encoding MS-1 peptide
CGCCCAGAAATCTGGATGACCCAGGGACTACGCCGACTCGGCGACGAAATTAAC
GCGTATTACGCACGC
SEQ ID NO: 3: nucleotide sequence of human MCL-1 mRNA, splice variant 1
NCBI Ref. No.: NM_021960.4
SEQ ID NO: 4: nucleotide sequence of human MCL-1 mRNA, splice variant 2
NCBI Ref. No.: NM_182763.2
SEQ ID NO: 5: nucleotide sequence of human MCL-1 mRNA, splice variant 3
NCBI Ref. No.: NM_001197320.1
SEQ ID NO: 6: amino acid sequence of NuBCP-9 peptide
FSRSLHSLL

Claims

1. A composition comprising
a) polymeric nanoparticles comprising a poly(lactic acid)-poly(ethylene glycol)- poly(propylene glycol)-poly(ethylene glycol) (PLA-PEG-PPG-PEG) tetra block copolymer; and
b) a peptide comprising an amino acid sequence which is at least 85% identical to SEQ ID NO: 1, or a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 85% identical to SEQ ID NO: 1.
2. The composition of claim 1, wherein the molecular weight of PLA is between about 2,000 and about 80,000 daltons.
3. The composition of claim 1, wherein the PLA-PEG-PPG-PEG tetra block copolymer is formed from chemical conjugation of PEG-PPG-PEG tri -block copolymer with PLA, and wherein the PEG-PPG-PEG tri-block copolymer can be of different molecular weights.
4. The composition of claim 1, wherein the polymeric nanoparticles have a diameter of about 30 nm to about 270 nm.
5. The composition of claim 1, wherein the polymeric nanoparticles are loaded with the peptide or polynucleotide.
6. A pharmaceutical composition comprising
a) polymeric nanoparticles comprising a poly(lactic acid)-poly(ethylene glycol)- poly(propylene glycol)-poly(ethylene glycol) (PLA-PEG-PPG-PEG) tetra block copolymer; and
b) a peptide comprising an amino acid sequence which is at least 85% identical to SEQ ID NO: 1, or a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 85% identical to SEQ ID NO: 1
for use in treating cancer.
7. The pharmaceutical composition of claim 6, wherein the polymeric nanoparticles are loaded with the peptide or the polynucleotide.
8. The composition of any one of claims 1 to 7, wherein the polymeric nanoparticles consist essentially of poly(lactic acid)-poly(ethylene glycol)- poly(propylene glycol)-poly(ethylene glycol) (PLA-PEG-PPG-PEG) tetra block
copolymer.
9. The composition of any one of claims 1-8, further comprising a therapeutic agent selected from the group consisting of a BCL-2 antagonist, a BCL-xL antagonist, a BCL-w antagonist.
10. The composition of any one of claims 1-8, further comprising a chemotherapeutic agent.
11. The composition of claim 10, wherein the chemotherapeutic agent is selected from the group consisting of paclitaxel, doxorubicin, salinomycin, taurolidine, vincristine, daunorubicin, docetaxel, gemcitabine, decitabine, irinotecan, 7-ethyl-10-hydroxy- camptothecin (SN-38), cytarabine, triptolide, geldanamycin, tanespimycin (17-N-allylamino- 17-demethoxy geldanamycin; 17-AAG), fluorouracil (5-FU), oxaliplatin, carboplatin, taxotere, methotrexate, and bortezomib.
12. The composition of any one of claims 1-8, further comprising a targeted anti-cancer agent.
13. The composition of any one of claims 1-8, further comprising an immunotherapeutic agent.
14. The composition of any one of claims 1-13, wherein the polymeric nanoparticles further comprise a targeting moiety attached to the outside of the polymeric nanoparticles, and wherein the targeting moiety is an antibody, peptide, or aptamer.
15. A polymeric nanoparticle consisting essentially of a PLA-PEG-PPG-PEG tetra block copolymer, wherein the polymeric nanoparticles are loaded with a peptide comprising an amino acid sequence which is at least 85% identical to SEQ ID NO: 1, or a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 85% identical to SEQ ID NO: 1.
16. The composition or polymeric nanoparticle of any one of claims 1-15, wherein the peptide is a stapled peptide.
17. A method for treating cancer in a subject in need thereof comprising
administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising:
a) polymeric nanoparticles comprising a PLA-PEG-PPG-PEG tetra block copolymer; and
b) a peptide comprising an amino acid sequence which is at least 85% identical to SEQ ID NO: 1, or a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 85% identical to SEQ ID NO: 1.
18. A method for activating the BCL2A1 pathway in a mammalian cell comprising
administering to the cell an effective amount of a composition comprising:
a) polymeric nanoparticles comprising a PLA-PEG-PPG-PEG tetra block copolymer; and
b) a peptide comprising an amino acid sequence which is at least 85% identical to SEQ ID NO: 1, or a polynucleotide encoding a peptide comprising an amino acid sequence which is at least 85% identical to SEQ ID NO: 1.
19. The method of claim 18, wherein expression of BCL2A1 mRNA is increased in the cell after administration of the pharmaceutical composition.
20. The method of claim 18, wherein expression of BCL2A1 protein is increased in the cell after administration of the pharmaceutical composition.
21. The method of claim 18, wherein expression of NF-κΒ p65 protein is increased in the cell after administration of the pharmaceutical composition.
22. The method of claim 18, wherein expression of MUC 1-C protein is increased in the cell after administration of the pharmaceutical composition.
23. The method of any one of claims 17-22, wherein the peptide is a stapled peptide.
24. The method of any one of claims 17-23, wherein the pharmaceutical composition further comprises a therapeutic agent selected from the group consisting of a BCL-2 antagonist, a BCL-xL antagonist, a BCL-w antagonist.
25. The method of any one of claims 17-23, wherein the pharmaceutical composition further comprises a chemotherapeutic agent.
26. The method of claim 25, wherein the chemotherapeutic agent is selected from the group consisting of paclitaxel, doxorubicin, salinomycin, taurolidine, vincristine, daunorubicin, docetaxel, gemcitabine, decitabine, irinotecan, 7-ethyl-l O-hydroxy- camptothecin (SN-38), cytarabine, triptolide, geldanamycin, tanespimycin (17-N-allylamino- 17-demethoxy geldanamycin; 17-AAG), fluorouracil (5-FU), oxaliplatin, carboplatin, taxotere, methotrexate, and bortezomib.
27. The method of any one of claims 17-23, wherein the pharmaceutical composition further comprises a targeted anti-cancer agent.
28. The method of any one of claims 17-23, wherein the pharmaceutical composition further comprises an immunotherapeutic agent.
29. The method of any one of claims 17-28, wherein the cancer is leukemia or lymphoma.
30. The method of any one of claims 17-28, wherein the cancer is acute myeloid leukemia or chronic lymphocytic leukemia.
31. The method of any one of claims 17-28, wherein the cancer is multiple myeloma.
32. The method of any one of claims 17-28, wherein the cancer is breast cancer.
33. The method of any one of claims 17-32, wherein the cancer is resistant to treatment with a BCL-2 antagonist.
34. The method of any one of claims 17-32, wherein the subject is resistant to treatment with a BCL-2 antagonist.
35. The method of any one of claims 17-32, wherein the subject is refractory to treatment with a BCL-2 antagonist.
36. The method of any one of claims 17-32, wherein the subject is in relapse after treatment with a BCL-2 antagonist.
37. The method of any one of claims 33-36, wherein the BCL-2 antagonist is venetoclax (ABT-199).
38. The method of any one of claims 17-36, wherein the cancer expresses a high level of MCL-1.
PCT/US2017/050673 2016-09-08 2017-09-08 Compositions comprising polymeric nanoparticles and mcl-1 antagonists Ceased WO2018049155A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201662385001P 2016-09-08 2016-09-08
US62/385,001 2016-09-08

Publications (1)

Publication Number Publication Date
WO2018049155A1 true WO2018049155A1 (en) 2018-03-15

Family

ID=61562219

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/050673 Ceased WO2018049155A1 (en) 2016-09-08 2017-09-08 Compositions comprising polymeric nanoparticles and mcl-1 antagonists

Country Status (1)

Country Link
WO (1) WO2018049155A1 (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020018778A1 (en) * 2018-07-18 2020-01-23 Surender Kharbanda Polymeric nanoparticles comprising salinomycin
EP3714257A4 (en) * 2017-11-22 2021-08-11 Hillstream Biopharma Inc. Polymeric nanoparticles comprising bortezomib
WO2022006271A3 (en) * 2020-06-30 2022-02-03 Hillstream Biopharma Inc. Nanoparticles and methods of manufacture thereof
WO2022251844A1 (en) * 2021-05-25 2022-12-01 Hillstream Biopharma, Inc. Polymeric nanoparticles comprising chemotherapeutic compounds and related methods
WO2024030092A1 (en) * 2022-08-01 2024-02-08 Istanbul Universitesi-Cerrahpasa Rektorlugu Synthesis of protein-based nanoparticular systems
EP4422602A4 (en) * 2022-08-01 2025-04-09 Istanbul Üniversitesi - Cerrahpasa Rektörlügü Synthesis of protein-based nanoparticular systems

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130023646A1 (en) * 2008-04-08 2013-01-24 Aileron Therapeutics, Inc. Biologically active peptidomimetic macrocycles
US20130315831A1 (en) * 2010-09-03 2013-11-28 Massachusetts Institute Of Technology Lipid-polymer hybrid particles
US20150065555A1 (en) * 2012-03-16 2015-03-05 Dicerna Pharmaceuticals, Inc. Methods and compositions for the specific inhibition of mcl1 by double-stranded rna

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130023646A1 (en) * 2008-04-08 2013-01-24 Aileron Therapeutics, Inc. Biologically active peptidomimetic macrocycles
US20130315831A1 (en) * 2010-09-03 2013-11-28 Massachusetts Institute Of Technology Lipid-polymer hybrid particles
US20150065555A1 (en) * 2012-03-16 2015-03-05 Dicerna Pharmaceuticals, Inc. Methods and compositions for the specific inhibition of mcl1 by double-stranded rna

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
KUMAR, M ET AL.: "Novel Polymeric Nanoparticles for Intracellular Delivery of Peptide Cargos: Antitumor Efficacy of the Bcl-2 Conversion Peptide NuBCP-9", CANCER RESEARCH, vol. 74, no. 12, 15 June 2014 (2014-06-15), pages 3271 - 3281, XP055474241 *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3714257A4 (en) * 2017-11-22 2021-08-11 Hillstream Biopharma Inc. Polymeric nanoparticles comprising bortezomib
WO2020018778A1 (en) * 2018-07-18 2020-01-23 Surender Kharbanda Polymeric nanoparticles comprising salinomycin
CN113164375A (en) * 2018-07-18 2021-07-23 希成生物医药 Polymer nanoparticles comprising salinomycin
JP2021530504A (en) * 2018-07-18 2021-11-11 ヒルストリーム・バイオファーマ・インコーポレイテッド High molecular weight nanoparticles containing salinomycin
WO2022006271A3 (en) * 2020-06-30 2022-02-03 Hillstream Biopharma Inc. Nanoparticles and methods of manufacture thereof
EP4171543A4 (en) * 2020-06-30 2024-12-04 Tharimmune, Inc. NANOPARTICLES AND METHODS FOR THE PRODUCTION THEREOF
WO2022251844A1 (en) * 2021-05-25 2022-12-01 Hillstream Biopharma, Inc. Polymeric nanoparticles comprising chemotherapeutic compounds and related methods
WO2024030092A1 (en) * 2022-08-01 2024-02-08 Istanbul Universitesi-Cerrahpasa Rektorlugu Synthesis of protein-based nanoparticular systems
EP4422602A4 (en) * 2022-08-01 2025-04-09 Istanbul Üniversitesi - Cerrahpasa Rektörlügü Synthesis of protein-based nanoparticular systems

Similar Documents

Publication Publication Date Title
US20220175874A1 (en) Polymeric nanoparticles and a process of preparation thereof
Miao et al. Co-administration of dual-targeting nanoparticles with penetration enhancement peptide for antiglioblastoma therapy
US20220175688A1 (en) Polymeric nanoparticles
US11622990B2 (en) VAP polypeptide and use thereof in preparation of drug for targeted diagnosis and treatment of tumor
Zhou et al. Alternative and injectable preformed albumin-bound anticancer drug delivery system for anticancer and antimetastasis treatment
WO2020092304A9 (en) Dendritic polymers complexed with immune checkpoint inhibitors for enhanced cancer immunotherapy
Aleksandrowicz et al. Drug delivery systems improving chemical and physical properties of anticancer drugs currently investigated for treatment of solid tumors
US20190192686A1 (en) Targeted nanodroplet emulsions for treating cancer
Hunt Precision targeting of intraperitoneal tumors with peptideguided nanocarriers
KR20210053881A (en) Polymer nanoparticles containing salinomycin
KR102918098B1 (en) Novel cyclic peptides based on nano-bio-structural control of peptide assemblies, peptidesomes with core/shell structure comprising thereof and uses thereof
KR20200090193A (en) Polymer nanoparticles containing Bortezomib
JP7158450B2 (en) Polymer nanoparticles and their preparation process
HK40043814A (en) Polymeric nanoparticles and a process of preparation thereof
WO2024174882A1 (en) Preparation and use of nanomicelle loaded with hydrophobic anti-cancer drug lithospermum oxime
HK40078343A (en) Stereocomplexes for the delivery of anti-cancer agents
Ray Novel approaches for targeted delivery of cancer therapeutics to nuclei of malignant cells
Ulvi Effective targeting of gemcitabine to pancreatic cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17849605

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17849605

Country of ref document: EP

Kind code of ref document: A1