WO2018027149A1 - Methods of treating alport syndrome - Google Patents

Methods of treating alport syndrome Download PDF

Info

Publication number
WO2018027149A1
WO2018027149A1 PCT/US2017/045536 US2017045536W WO2018027149A1 WO 2018027149 A1 WO2018027149 A1 WO 2018027149A1 US 2017045536 W US2017045536 W US 2017045536W WO 2018027149 A1 WO2018027149 A1 WO 2018027149A1
Authority
WO
WIPO (PCT)
Prior art keywords
subject
decrease
inhibitor
amount effective
osteopontin inhibitor
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2017/045536
Other languages
French (fr)
Inventor
Lina Shehadeh
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Miami
Original Assignee
University of Miami
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Miami filed Critical University of Miami
Publication of WO2018027149A1 publication Critical patent/WO2018027149A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/12Antihypertensives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides

Definitions

  • the present disclosure relates to methods of treating type IV collagenopathies such as Alport Syndrome.
  • Collagen type IV (Col4) is an essential component of basement membranes, which separate the epithelium from connective tissue.
  • Alport Syndrome is an inherited disease caused by mutations in three collagen type IV genes, COL4A3, COL4A4, and COL4A5. The disease is characterized by progressive renal failure, hypertension, proteinuria, greatly increased risk of cardiovascular disease, and loss of hearing and vision.
  • Current therapy for Alport Syndrome is aimed at ameliorating the symptoms and includes angiotensin-converting enzyme (ACE) inhibitors or angiotensin receptor blockers (ARB). Such treatments only slow the loss of kidney function or manage blood pressure and do not treat or prevent the other effects of the disease.
  • ACE angiotensin-converting enzyme
  • ARB angiotensin receptor blockers
  • the present disclosure is directed to methods of treating a Col4-related disease such as Alport Syndrome in a patient in need thereof comprising administering a therapeutically effective amount of an osteopontin inhibitor to the subject.
  • the present disclosure provides a method of improving cardiac systolic and diastolic function in a subject in need thereof comprising administering an osteopontin inhibitor in an amount effective to lower blood pressure, increase the mean corpuscular hemoglobin concentration (MCHC) in the blood, decrease myocardial fibrosis, increase stroke volume, increase cardiac output, decrease isovolumetric relaxation time, decrease interventricular wall thickness, decrease myocyte hypertrophy, or a combination of any of the foregoing, in the subject.
  • MCHC mean corpuscular hemoglobin concentration
  • the present disclosure provides a method of improving kidney function in a subject in need thereof comprising administering an osteopontin inhibitor in an amount effective to decrease the urine albumin/creatinine (ALB/CRE) ratio, decrease the thickness of a glomerulus basement membrane, decrease fibrotic cell proliferation and/or fibrosis, decrease lipid accumulation in a renal tubule, decrease one or more of plasma kidney injury molecule-1 (KIM-1), plasma blood urea nitrogen (BUN), plasma creatinine (CRE), renal Dynamin3 (Dnm3), and plasma Galectin-3 (Gal-3), or a combination of any of the foregoing, in the subject.
  • ARB/CRE urine albumin/creatinine
  • KIM-1 plasma kidney injury molecule-1
  • BUN plasma blood urea nitrogen
  • CRE plasma creatinine
  • Dnm3 renal Dynamin3
  • Galectin-3 Galectin-3
  • the present disclosure provides a method of treating hearing loss in a subject in need thereof, comprising administering an OPN inhibitor in an amount effective to improve or maintain hearing and/or decrease the thickness of the capillary basement membrane in the cochlea, in the subject.
  • the disclosure provides a method of treating g loss of vision in a subject in need thereof, comprising administering an OPN inhibitor in an amount effective to improve or maintain vision, treat or prevent a lenticonus, increase the anterior chamber depth and/or the anterior chamber angle in the eye, decrease the thickness of the capillary basement membrane in the retina, or a combination of any of the foregoing, in the subject.
  • the OPN inhibitor is administered in an amount effective to alter gene expression, for example, to (a) decrease expression of one or more genes selected from Snora75, LOC100302567, Dnm3, Mir24-1
  • the osteopontin inhibitor is selected from an antibody, an aptamer, a small interfering RNA, an antisense oligonucleotide, a regulatory nucleic acid, a small molecule inhibitor, and combinations thereof.
  • the osteopontin inhibitor is administered systemically, e.g., intravenously.
  • the osteopontin inhibitor is administered locally, e.g., to the eye and/or ear.
  • the subject has Alport Syndrome.
  • the disclosure provides:
  • a method of treating a Col4-related disease in a patient in need thereof comprising administering a therapeutically effective amount of an osteopontin inhibitor to the subject.
  • Galectin-3 Galectin-3 (Gal-3), and a combination of any of the foregoing.
  • a method of improving cardiac function in a subject in need thereof comprising administering an osteopontin inhibitor in an amount effective to lower blood pressure, increase the mean corpuscular hemoglobin concentration (MCHC) in the blood, decrease myocardial fibrosis, increase stroke volume, increase cardiac output, decrease isovolumetric relaxation time, decrease interventricular wall thickness, decrease myocyte hypertrophy, or a combination of any of the foregoing, in the subject.
  • MCHC mean corpuscular hemoglobin concentration
  • a method of improving kidney function in a subject in need thereof comprising administering an osteopontin inhibitor in an amount effective to decrease the urine
  • albumin/creatinine (ALB/CRE) ratio decrease the thickness of a glomerulus basement membrane, decrease fibrotic cell proliferation and/or fibrosis, decrease renal lipid accumulation, decrease one or more of plasma kidney injury molecule-1 (KIM-1), plasma blood urea nitrogen (BUN), plasma creatinine (CRE), renal Dynamin3 (Dnm3), and plasma Galectin-3 (Gal-3), or a combination of any of the foregoing, in the subject.
  • KIM-1 plasma kidney injury molecule-1
  • BUN plasma blood urea nitrogen
  • CRE plasma creatinine
  • Dnm3 renal Dynamin3
  • Galectin-3 Galectin-3
  • a method of treating hearing loss in a subject in need thereof, comprising administering an osteopontin inhibitor in an amount effective to improve or maintain hearing and/or decrease the thickness of the capillary basement membrane in the cochlea, in the subject.
  • a method of treating loss of vision in a subject in need thereof comprising administering an osteopontin inhibitor in an amount effective to improve or maintain vision, treat or prevent a lenticonus, increase the anterior chamber depth in the eye, increase the anterior chamber angle in the eye, decrease the thickness of the capillary basement membrane in the retina, or a combination of any of the foregoing, in the subject.
  • Figures 1A and 1B show OPN expression is increased in Alport mice.
  • Western blots and corresponding densitometry shows elevated OPN expressions in Col4a3 -/- versus WT or Col4a3 +/- mouse kidneys (Figure 1A) and plasma ( Figure 1B).
  • N 3-6 mice per group.
  • FIGS. 2A to 2G show OPN deficiency increases life span and attenuates Alport pathology in Col4a3 -/- mice.
  • OPN deficiency in Alport mice causes an increase in lifespan by Kaplan Meier survival curve (Figure 2A), a reduction in body weight loss (Figure 2B), a reduction of albuminuria as measured by albumin and creatinine (ALB/CRE) ELISA ( Figure 2C), a decrease in plasma Blood Urea Nitrogen (BUN) ( Figure 2D) and creatinine (CRE) (Figure 2E) levels, an increase in blood Mean Corpuscular Hemoglobin Concentration (MCHC) ( Figure 2F), and reductions in systolic blood pressure (SBP) and diastolic blood pressure (DBP) as recorded by tail-cuff blood pressure system (Figure 2G), all relative to Alport mice. Data were collected from animals at 8 to 9 weeks of age.
  • Figures 3A and 3B show OPN deficiency improved cardiac structure and function in Alport mice. Echocardiography studies show significant improvement of systolic (stroke volume; Fig.3A) and diastolic (isovolumetric relaxation time; Figure 3B) function in Alport hearts.
  • FIGS 4A through 4C show OPN deficiency prevents cardiac hypertrophy in Col4a3- /- mice.
  • OPN deficiency rescues cardiac hypertrophy shown by decreased thickness of interventricular septum (IVS) ( Figure 4A) and myocyte cross-sectional area (Figure 4B).
  • H&E images show rescue of IVS thickness ( Figure 4C). Values are mean ⁇ SEM. P values: **p ⁇ 0.01, ***p ⁇ 0.001 using 1-way ANOVA with Tukey’s post hoc test.
  • FIGS 5A through 5C show cardiac fibrosis is rescued by OPN deficiency in Col4a3- /- mice.
  • OPN deficiency reduces cardiac fibrosis reflected by decreased interstitial activated fibroblasts shown by Electron Microscopy (Figure 5A), dividing/EdU-positive MLC2-negative interstitial cells (Figure 5B), and plasma levels of Galectin-3 (Figure 5C) in Col4a3 -/- mice.
  • Gal- 3 Galectin-3.
  • C Collagen fibers, RER, Rough Endoplasmic Reticulum. Values are mean ⁇ SEM.
  • P values *p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001 using one way ANOVA with Tukey’s post hoc test.
  • Figure 6A to 6F show OPN deficiency reduces fibrotic cell proliferation and prevents severe renal pathology in mouse Alport kidney.
  • Figure 6A Fibrotic cell proliferation was visualized by EdU incorporation after 30 days of EdU injections and is elevated in Alport kidneys, but prevented by OPN deficiency.
  • Figure 6B Kim-1 expression is elevated in renal tubules of Alport mice and rescued by OPN deficiency as shown by immunofluorescent staining and corresponding quantification.
  • Figure 6C Dnm3 expression is elevated in Alport kidneys but reduced by OPN deficiency as shown by immunostaining.
  • FIG. 6D Oil red staining and corresponding quantification show extensive lipid accumulation in tubules of Col4a3 -/- mice, that is reduced with OPN deficiency.
  • Figures 7A and 7B show OPN deficiency improves high frequency hearing threshold in Col4a3 -/- mice and reduces pathology of inner ear.
  • Figure 7B Representative electron microscopy (EM) images show thickened basement membrane in Alport cochleas - a pathology that is reduced with OPN deficiency. Insets are shown at a higher magnification on the bottom.
  • Figures 8A and 8B show OPN deficiency attenuates tendency of lenticonus in Col4a3 -/- mice.
  • Figure 8B EM shows disrupted basement membrane of cornea in Col4a3 -/- mice– a pathology that is reduced with OPN deficiency. Insets are shown at a higher magnification on the bottom.
  • the present disclosure provides methods of treating Alport Syndrome in a patient in need thereof comprising administering a therapeutically effective amount of an osteopontin inhibitor.
  • Osteopontin a secreted phosphoprotein
  • Inhibition of OPN in Alport Syndrome subjects improves lifespan, decreases proteinuria and hypertension, improves renal and cochlear histology, and improves cardiac function, hearing ability, and eye abnormalities.
  • OPN inhibitor refers to a small molecule and/or biologic inhibitor of the osteopontin (secreted phosphoprotein 1; SPP1) gene or protein.
  • OPN inhibitors include antigen-binding peptides (e.g., antibodies), aptamers, and nucleic acids (e.g., microRNA, small interfering RNA, and antisense nucleotides). Examples of OPN inhibitors include, but are not limited to, the inhibitors described in U.S. Patent Application Nos.
  • the terms“type IV collagen-related disease,”“type IV collagenopathy” or“Col4- related disease” refers to a disease or disorder characterized by a defect in a Col4 gene or protein (e.g., COL4A1, COL4A2, COL4A3, COL4A4, COL4A5, and/or COL4A6). Examples include Alport Syndrome, Goodpasture’s Syndrome, and Col4-related vascular and cardiovascular diseases, such as hypertension and heart failure with preserved ejection fraction, respectively.
  • the terms“therapeutically effective amount” and“effective amount” depend on the condition of a subject and dosing regimen. The terms refer to an amount of an OPN inhibitor effective to achieve a desired biological, e.g., clinical effect.
  • a therapeutically effective amount varies with the nature of the disease being treated, the length of time that activity is desired, and the age and the condition of the subject.
  • a therapeutically effective amount of an OPN inhibitor according to the disclosure is an amount effective to decrease or improve one or more of the following symptoms: proteinuria, urinary albumin/creatinine levels, renal dysfunction/insufficiency, fibrotic cell proliferation, anemia, cardiac dysfunction, hearing deficits, eye/vision abnormalities (e.g., lenticonus), and hypertension.
  • a therapeutically effective amount of an OPN inhibitor is an amount effective to increase the longevity of the subject relative to the expected lifespan in view of disease progression.
  • the terms“patient” and“subject” may be used interchangeably and mean animals, such as dogs, cats, cows, horses, and sheep (i.e., non-human animals) and humans.
  • the term“pharmaceutically acceptable” means that the referenced substance, such as a compound of the present disclosure, or a composition containing the compound, or a particular excipient, are safe and suitable for administration to a patient.
  • pharmaceutically acceptable carrier refers to a medium that does not interfere with the effectiveness of the biological activity of the active ingredient(s) and is not toxic to the host to which it is administered.
  • excipient means any pharmaceutically acceptable additive, carrier, diluent, adjuvant, or other ingredient, other than the OPN inhibitor
  • “treating”,“treat” or“treatment” and the like include preventative (e.g., prophylactic) and palliative treatment.
  • the present disclosure provides methods of treating a Col4-related disease such as Alport Syndrome in a subject in need thereof comprising administering a therapeutically effective amount of an OPN inhibitor to the subject.
  • the OPN inhibitor is administered in an amount effective to treat a cardiac symptom of the disease in the subject.
  • the present disclosure provides a method of improving cardiac function in a subject in need thereof, optionally a subject having a Col4-related disease such as Alport Syndrome, comprising administering an OPN inhibitor in an amount effective to lower blood pressure, increase the mean corpuscular hemoglobin concentration (MCHC) in the blood, decrease myocardial fibrosis, increase stroke volume, increase cardiac output, decrease isovolumetric relaxation time, decrease interventricular wall thickness, decrease myocyte hypertrophy, or a combination of any of the foregoing, in the subject.
  • MCHC mean corpuscular hemoglobin concentration
  • the OPN inhibitor is administered in an amount effective to decrease the blood pressure of the subject, e.g., the systolic blood pressure and/or the diastolic blood pressure, for example, by at least about 1 mm Hg, at least about 2 mm Hg, at least about 3 mm Hg, at least about 4 mm Hg, at least about 5 mm Hg, at least bout 6 mm Hg, at least about 7 mm Hg, at least about 8 mm Hg, at least about 9 mm Hg, at least about 10 mm Hg, at least about 20 mm Hg, at least about 30 mm Hg, at least about 40 mm Hg, at least about 50 mm Hg, at least about 60 mm Hg, at least about 70 mm Hg, at least about 80 mm Hg, at least about 90 mm Hg, or at least about 100 mm Hg.
  • the blood pressure of the subject e.g., the systolic blood pressure and/or the diastolic
  • the OPN inhibitor is administered in an amount effective to increase the MCHC in the blood of the subject, for example, by at least about 1 g/dL, at least about 2 g/dL, at least about 3 g/dL, at least about 4 g/dL, at least about 5 g/dL, at least about 6 g/dL, at least about 7 g/dL, at least about 8 g/dL, at least about 9 g/dL, at least about 10 g/dL, at least about 15 g/dL, at least about 20 g/dL, at least about 25 g/dL, or at least about 30 g/dL.
  • the OPN inhibitor is administered in an amount effective to decrease myocardial fibrosis in the subject. In one aspect, the OPN inhibitor is administered in an amount effective to increase cardiac output, e.g., ejection fraction and/or endocardial stroke volume, in the subject for example, by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, or at least about 30%, compared to pre-treatment.
  • the disclosure provides a method of treating a Col4-related disease such as Alport Syndrome in a subject in need thereof comprising administering a therapeutically effective amount of an OPN inhibitor to the subject to treat a renal symptom of the disease.
  • the disclosure provides a method of improving kidney function in a subject in need thereof, optionally a subject having a Col4-related disease such as Alport Syndrome, comprises administering an OPN inhibitor in an amount effective to decrease the urine albumin/creatinine (ALB/CRE) ratio, decrease the thickness of a glomerulus basement membrane, decrease fibrotic cell proliferation and/or fibrosis, decrease lipid accumulation in a renal tubule, decrease one or more of plasma kidney injury molecule-1 (KIM-1), plasma blood urea nitrogen (BUN), plasma creatinine (CRE), renal Dynamin3 (Dnm3), and plasma Galectin-3 (Gal-3), or a combination of any of the foregoing in the subject.
  • ARB/CRE urine albumin/creatinine
  • BUN plasma blood urea nitrogen
  • CRE plasma creatinine
  • Dnm3 renal Dynamin3
  • Galectin-3 Galectin-3
  • the OPN inhibitor is administered in an amount effective to decrease the urine ALB/CRE, for example, by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300%, in the subject, compared to pre-treatment.
  • the OPN inhibitor is administered in an amount effective to decrease the thickness of a glomerulus basement membrane in the subject.
  • the OPN inhibitor is administered in an amount effective to decrease fibrotic cell proliferation and/or fibrosis in the subject.
  • the OPN inhibitor is administered in an amount effective to decrease lipid accumulation in a renal tubule in the subject.
  • the OPN inhibitor is administered in an amount effective to decrease a marker of renal dysfunction, for example, one or more of plasma KIM-1, plasma BUN, plasma CRE, renal Dnm3, and plasma Gal-3, optionally by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 125%, at least about 150%, at least about 175%, at least about 200%, at least about 250%, or at least about 300%.
  • the disclosure provides a method of treating Alport Syndrome in a subject in need thereof comprising administering a therapeutically effective amount of an OPN inhibitor to the subject to treat hearing loss.
  • the disclosure provides a method of treating hearing loss in a subject in need thereof, optionally a subject having a Col4-related disease such as Alport Syndrome, comprising administering an OPN inhibitor in an amount effective to improve or maintain hearing and/or decrease the thickness of the capillary basement membrane in a cochlea of the subject.
  • the OPN inhibitor is administered in an amount effective to improve or maintain hearing, including, for example, high frequency (e.g., greater than 8 kHz) hearing, in the subject.
  • the OPN inhibitor is administered in an amount effective the decrease the thickness of a basement membrane in the cochlea, e.g., in the stria vascularis, in the subject.
  • the disclosure provides a method of treating Alport Syndrome in a subject in need thereof comprising administering a therapeutically effective amount of an OPN inhibitor to the subject to treat loss of vision.
  • the disclosure provides a method of treating loss of vision in a subject in need thereof, optionally a subject having a Col4-related disease such as Alport Syndrome, comprising administering an OPN inhibitor in an amount effective to improve or maintain vision, treat or prevent a lenticonus, increase the anterior chamber depth in the eye, increase the anterior chamber angle in the eye, decrease the thickness of the capillary basement membrane in the retina, or a combination of any of the foregoing, in the subject.
  • the OPN inhibitor is administered in an amount effective to improve or maintain vision.
  • the OPN inhibitor is administered in an amount effective to treat or prevent an eye deformity, for example, a lenticonus, e.g., a lenticonus anterior, increased anterior chamber depth and/or increased anterior chamber angle in the eye, and/or thickening of the capillaries in the retinal basement membrane.
  • the OPN is administered in an amount effective to increase the anterior chamber depth in an eye of the subject, optionally by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, or at least about 30%.
  • the OPN inhibitor is administered in an amount effective to increase the anterior chamber angle in an eye of the subject, optionally by at least about 1 degree, at least about 2 degrees, at least about 3 degrees, at least about 4 degrees, at least about 5 degrees, at least about 6 degrees, at least about 7 degrees, at least about 8 degrees, at least about 9 degrees, at least about 10 degrees, at least about 11 degrees, at least about 12 degrees, at least about 13 degrees, at least about 14 degrees, or at least about 15 degrees.
  • the OPN inhibitor is administered in an amount effective to decrease the retinal basement membrane in the subject.
  • Treating a disease or disorder such as Alport Syndrome also encompasses prevention of one or symptoms typically associated with the disease, which may entail a complete prevention of the symptom or a delay in onset or worsening of the symptom.
  • kidney function can be evaluated, for example, using imaging (e.g., ultrasound and CT scans), biopsies, and detection methods (e.g., ELISA) for quantitating biomarkers in patient samples, including blood and urine samples.
  • Cardiac function and hypertension can be evaluated, for example, using electrocardiography, echocardiography, stress tests, positron emission tomography tests, imaging (e.g., magnetic resonance imaging and CT scans), and blood pressure cuffs.
  • Hearing can be evaluated, for example, using audiometry exams, otoacoustic emissions tests, auditory brainstem response tests, and encephalograms. Eye abnormalities and vision can be evaluated, for example, using optical coherence tomography studies
  • a particular administration regimen for a given subject will depend, in part, upon the compound or composition, the amount administered, the route of administration, and the cause and extent of any side effects.
  • the amount administered to a subject e.g., a mammal, such as a human
  • Dosage typically depends upon the route, timing, and frequency of administration.
  • the methods of the present disclosure comprise administering, e.g., from about 0.1 mg/kg to about 15 mg/kg or more of an OPN inhibitor based on the body weight of the subject, depending on the factors mentioned above.
  • the dosage ranges from about 0.1 mg/kg to about 0.5 mg/kg, about 1 mg/kg to about 3 mg/kg, about 0.5 mg/kg to about 5 mg/kg, about 0.2 mg/kg to about 0.8 mg/kg, about 5 mg/kg to about 15 mg/kg, about 4 mg/kg to about 12 mg/kg, or about 0.1 mg/kg to about 2 mg/kg.
  • an OPN inhibitor may be administered to a human patient in an amount from between about 1 mg to about 50 mg, for example, about 1 mg, about 5 mg, about 10 mg, about 15 mg, about 20 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, or about 50 mg.
  • the dosage is administered as needed, for example, one to three times daily, every other day, twice a week, weekly, every two weeks, monthly, or less frequently.
  • the treatment period will depend on the particular condition and may last one day to several days, weeks, months, or years.
  • the above dosages are exemplary of the average case, but there can be individual instances in which higher or lower dosages are merited, and such are within the scope of the present disclosure.
  • OPN inhibitors are known in the art.
  • the OPN inhibitor is a small molecule and/or biologic inhibitor of OPN.
  • OPN inhibitors include antigen-binding peptides (e.g., antibodies), aptamers, and nucleic acids (e.g., microRNA, small interfering RNA, and antisense nucleotides).
  • OPN inhibitors include, but are not limited to, the inhibitors described in U.S.
  • the OPN inhibitor may be a dictyopyrone derivative or a dihydrodictyopyrone derivative represented by any of Chemical Formulas 1-16:
  • the OPN inhibitor is a compound selected from compounds IPS-02001, IPS-02002, and IPS-02003:
  • the OPN inhibitor is polynucleotide aptamer that binds to and inhibits the function of osteopontin, such as an RNA aptamer that comprises a nucleotide sequence that is identical to any of SEQ ID NOS: 1-14 as shown in Table 4, or a nucleotide sequence that is at least 70% identical, e.g., at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any of SEQ ID NOS: 1-14.
  • the OPN inhibitor is a siRNA comprising the sequence
  • AAGAUGAUAGGUAUCUGAAAU (SEQ ID NO:15).
  • a composition comprising an OPN inhibitor may be in any suitable dosage form including, but not limited to, tablets, capsules, implants, depots, liquids, patches, lozenges, creams, gels, ointments, lotions, sprays, ear drops, and eye drops.
  • compositions suitable for injection or instillation may comprise physiologically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions, or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions.
  • suitable aqueous and nonaqueous carriers, diluents, solvents, or vehicles include water, ethanol, polyols (propylene glycol, polyethylene glycol, glycerol, and the like), suitable mixtures thereof, vegetable oils (such as olive oil) and injectable organic esters such as ethyl oleate.
  • compositions may also contain adjuvants such as preserving, wetting, emulsifying, and dispersing agents. Microorganism contamination can be prevented by adding various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, and the like.
  • the compositions may also include isotonic agents, for example, sugars, sodium chloride, and the like. Prolonged absorption of injectable pharmaceutical compositions can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin.
  • Suitable methods of administering a pharmaceutically acceptable composition comprising an OPN inhibitor are well-known in the art. Although more than one route can be used to administer a compound, a particular route can provide a more immediate and more effective reaction than another route.
  • a compound or composition described herein is introduced into a surgical site, applied or instilled into a body cavity, absorbed through the skin or mucous membranes, inhaled, ingested and/or introduced into circulation.
  • the compound or composition is administered orally.
  • the compound or composition is injected intravenously and/or intraperitoneally.
  • compositions through injection, infusion, or deposition by intravenous, intraperitoneal, intracerebral (intra- parenchymal), intracerebroventricular, intracardiac, intraarterial, intraportal, intralesional, intramedullary, intrathecal, intraventricular, intranasal, subcutaneous, renal, otic, or ocular means; by controlled, delayed, sustained or otherwise modified release systems; or by implantation devices.
  • intravenous, intraperitoneal, intracerebral (intra- parenchymal), intracerebroventricular, intracardiac, intraarterial, intraportal, intralesional, intramedullary, intrathecal, intraventricular, intranasal, subcutaneous, renal, otic, or ocular means by controlled, delayed, sustained or otherwise modified release systems; or by implantation devices.
  • a composition comprising an OPN inhibitor is administered locally to the eye and/or ear, e.g., ophthalmically, intraocularly, conjunctivally, intracorneally, intravitreally, retrobulbarly, auricularly, or intratympanically.
  • an OPN inhibitor is administered via implantation of a matrix, membrane, sponge, or another appropriate material onto which the compound has been absorbed or encapsulated.
  • the device is, in one aspect, implanted into or on the surface of any suitable tissue or organ, and delivery of an OPN inhibitor is, for example, via diffusion, timed-release bolus, or continuous administration.
  • an OPN inhibitor comprises a targeting moiety specific for OPN, such as an antigen binding protein including, but not limited to, antibodies, antibody fragments, antibody derivatives, antibody analogs, and fusion proteins.
  • EdU Injections.5-ethynyl-2’-deoxyuridine (A10044, LifeTechnologies) was prepared at 1 mg/ml stock and filtered through 0.2 ⁇ m Nalgene syringe filter (190-2520,
  • ThermoScientific 100 ⁇ l (100 ⁇ g) EdU stock was administered daily to each mouse through intraperitoneal injections for up to 30 days to identify mitotic cells.
  • Blood Pressure Recording Blood Pressure measurements were carried out using CODA mouse tail-cuff system (Kent Scientific). Anesthesia was induced with 5% vaporized isoflurane at 0.8 L/min flow rate and maintained with 1% isoflurane during blood pressure recordings. Heart rate was monitored and body temperature was controlled within 37 o C to 39 o C. Two tail cuffs, occlusion and VPR, were equipped onto the tails. Occlusion tail cuff was inflated and deflated to control blood flow. VPR tail cuff was incorporated with specially designed differential pressure transducer that measured the systolic and diastolic blood pressure by determining the blood volume in the tail. Animals were trained three times to minimize stress- related blood pressure changes caused by the system prior to recording the final blood pressure values. Twenty systolic and diastolic blood pressure readings were recorded from each mouse and the fifteen most consistent readings were used for analysis.
  • ABR Auditory Brainstem Response
  • electroencephalograms were amplified 100,000 times, band-pass filtered between 30 Hz and 1500 Hz and acquired using a sampling frequency of 10 Ksps in 102.4 ms long epochs.
  • Acoustic stimuli using tone bursts at 4, 8, and 16 kHz were delivered with insert ear phones.
  • eight, amplitude-modulated, tone bursts were presented to each ear at an average stimulation rate of 78.13 stimuli.
  • the raw EEGs were averaged in blocks of 64 epochs to obtain the auditory evoked potential responses.
  • Each epoch lasted 102.4 ms and contained eight tone pips modulated by a 3 ms trapezoidal envelope (1 ms rise time, 1 ms plateau, and 1 ms falling time).
  • ABR hearing threshold was defined as the minimum intensity required to produce an ABR response that was identifiable and consistent. Intensity level of stimuli were tested in 10 dB SPL intervals.
  • Ocular Measurements Anterior-segment images were captured by optical coherence tomography (OCT) using a SD-OCT system (Bioptigen, NC). Central corneal thickness (CCC), anterior chamber depth (ACD) and anterior chamber angle (ACA) were determined using Image J software (ver.2.0.0). Central corneal thickness was defined as the distance from the corneal epithelial surface to the corneal endothelium. Anterior chamber depth was defined as the distance from the corneal endothelium to the anterior surface of the lens capsule. Anterior chamber angle was defined as the angle formed between the anterior surface of the iris and the posterior surface of the cornea.
  • Echocardiography Cardiac function was evaluated by a Vevo2100 echocardiography imaging system (Visual Sonics, Toronto, Canada) with a MS400 linear array transducer. Briefly, mice were anesthetized with 4% isoflurane at 0.8 L/min flow rate and maintained with 1% isoflurane. Following anesthesia, the mice were fixed in a supine position on a platform with an integrated temperature sensor, a heater, and ECG electrodes. The heart rate was monitored constantly and body temperature was maintained at 37 °C during measurements. Depilatory cream was used to remove fur from the region of procedure, and medical ultrasonographic acoustic gel was applied as a coupling fluid between the real-time microvisualization scan probe and the skin. Endocardial % Ejection Fraction (EF) was recorded in B-Mode and analyzed using a VEVO 770 software.
  • EF Endocardial % Ejection Fraction
  • Kidney Epithelial Cells Isolation and Culture Kidneys were harvested in DMEM+F12 media (10565-18, Gibco, Bartlesville, OK) supplemented with 1% Penicillin/Streptavidin (400- 109, Gemini, Commack, NY). Medulla was removed, and the remaining kidney tissue was cut into pieces and digested in Collagenase type II (LS004176, Worthington, Columbus, OH) at 5mg/ml for 10min two times at 37 o C. Digested kidney pieces were then plated on a 2% gelatin (G2500-100g, Sigma, St. Louis, MO) coated 6-well plate.
  • DMEM+F12 media 10565-18, Gibco, Bartlesville, OK
  • Penicillin/Streptavidin 400- 109, Gemini, Commack, NY
  • Medulla was removed, and the remaining kidney tissue was cut into pieces and digested in Collagenase type II (LS004176, Worthington, Columbus, OH) at 5mg
  • Tubule epithelial media (PCS400030, PCS400040, ATCC, Manassas, Virginia) was used.
  • ELISA Albumin concentration was measured by ELISA (E90-134, Bethyl Laboratories, Montgomery, TX) using 1:500 to1:20,000 diluted urine samples collected from 8- to 9-week-old mice. Creatinine concentration was measured using 1:20 diluted urine samples by an ELISA assay (1012, Exocell, Philadelphia, PA). Albumin concentrations (mg/mL) were then normalized to creatinine (mg/mL) for analysis of albuminuria. Plasma Galectin-3 levels were measured by enzyme-linked immunosorbent assay (DY1197, R&D Systems, Minneapolis, Minnesota, USA) according to the manufacturer’s instruction.
  • Dnm3 was stained overnight and detected using biotinylated anti-Rabbit (BA- 1000, Vector Laboratories, Burlingame, CA) at RT for 30 minutes followed by DAB peroxidase (HRP) amplification (SK-4100, Vector Laboratories, Burlingame, CA).
  • biotinylated anti-Rabbit BA- 1000, Vector Laboratories, Burlingame, CA
  • HRP DAB peroxidase
  • OPN or KIM-1 staining 10 ⁇ m frozen kidney sections were air dried, rinsed with PBS, permeabilized with 0.2% triton for 3 minutes and blocked with 10% donkey serum for 30 min at RT.
  • OPN (ab3458, Abcam, Cambridge, MA) or Kim-1 (AF3689, R&D, Minneapolis, MN) antibodies were used at 4 o C overnight and detected using anti-Goat or anti-Rat Alexa Fluo- 488 at RT for 30 minutes.
  • Oil red staining frozen sections were processed as described above and incubated with 60% isopropanol for 5 min followed by oil red solution for 45 min.
  • immunostainings primary and secondary antibody incubations were done in 10% donkey Serum in 1% TBST.
  • Dnm3 and oil red staining images were captured on a Zeiss microscope using a 32x objective.
  • OPN, Kim-1 and EdU fluorescent images were captured on a Zeiss LSM710 confocal microscope using z-scanning at 40x magnification. Three to five kidneys/mice per group were used and six to ten images per kidney were acquired and quantified.
  • Kidneys, cochlea and eyes were fixed for 24 hours (hrs) in 10% formalin, followed by 24 hrs in 2% glutaraldehyde, rinsed in wash buffer three times, and then postfixed in 2% osmium tetroxide in 0.1 M phosphate buffer overnight. After buffer rinses, they were dehydrated through a series of graded ethanols and embedded using Embed/Araldite (Electron Microscopy Sciences, Hatfield, PA) overnight in a 64 °C oven. Silver/gold sections were cut on a Leica Ultracut R (Leica) and stained in uranyl acetate and lead citrate. Images were captured by a Gatan Orius SC 200D CCD camera (Gatan, Desion, CA, USA) in a JEM 1400 electron microscope (JEOL, Peabody, MA, USA).
  • Kidneys were lysed using Cell Disruption Buffer (Mirvana Paris Kit) and total RNA was extracted using Mirvana Paris Kit to yield a 260–280 nm absorbance ratio of 2.0.
  • RNA concentration and integrity was determined by using an Agilent Bioanalyzer. A 1 ⁇ g aliquot of total RNA from each of the samples (3 samples per group; 2 groups per experiment) was processed using instructions and reagents supplied by the
  • T7-Oligo (dT) Promoter Primer in the first-strand cDNA synthesis reaction.
  • RNase H- mediated-DNA polymerase I-second-strand cDNA synthesis the double-stranded cDNA was purified and served as a template for in vitro transcription in the presence of T7RNA polymerase and a biotinylated nucleotide analog/ribonucleotide mix, producing biotin-labeled
  • cRNA complementary RNA
  • cRNA probes were then purified, fragmented, and hybridized on Mouse ST2 gene expression arrays (45,101 probe sets). Background noise, housekeeping gene expression and 3’/5’ ratio values of all chips were within quality control limits set by Affymetrix. Expression ratios were calculated as the power-2 exponential of the log2 differences.
  • the acceptance criteria for gene array expression changes was a minimum 2-fold change in log2 (equivalent to 4-fold) and a one-way Analysis of Variance (ANOVA) t-test p-value of ⁇ 0.05. All microarray raw files were submitted to the NCBI Gene Expression Omnibus (GEO) database (GSEXXX).
  • GEO NCBI Gene Expression Omnibus
  • N refers to the number of individual mice or individual culture plates. All data are expressed as mean ⁇ S.E.M. P-values were calculated using Student’s t-tests. Where indicated, p-values were calculated using ANOVA and corrected for multiple comparisons using Tukey Posthoc correction in GraphPad Prism. Repeated symbols represent P- values of different orders of magnitude, i.e. *P ⁇ 0.05, **P ⁇ 0.01.
  • OPN is substantially expressed in the tubules of Col4a3 -/- mice.
  • the Col4a3 -/- knockout mouse phenocopies the symptom of Alport Syndrome, making it an ideal disease model
  • OPN deficiency increases life span and attenuates Alport pathology in Col4a3 -/- mice.
  • Alport mice develop severe renal dysfunction and die approximately at 10 weeks of age.
  • survivals of Col4a3 -/- , Col4a3- /- OPN +/- and Col4a3 -/- OPN -/- animals and their body weights at 9 to 12 weeks of age were recorded.
  • Kaplan Meier survival curves show that the Col4a3 -/- OPN -/- and Col4a3 -/- OPN +/- mice significantly outlived the Alport mice (Fig.2A), and that the body weights were also
  • Galectin-3 whose expression correlates with end-stage renal dysfunction (ESRD), was found to be expressed two times higher in Col4a3 -/- mice than WT and significantly decreased to control level in Col4a3 -/- OPN +/- and Col4a3 -/- OPN -/- mice (Fig.2F).
  • Blood MCHC levels were decreased in Col4a3 -/- mice (Fig.2G), suggesting anemia in the Alport mice, which was consistent with clinical reports that with onset of renal insufficiency, symptoms of chronic anemia may become evident as Alport disease progress.
  • OPN deficiency significantly improved MCHC levels in Alport mice. Blood pressure was recorded using CODA mouse tail-cuff system (Kent Scientific).
  • Col4a3 -/- mice develop significantly higher blood pressures relative to WT mice (Kevan et al.2016; submitted manuscript), but hypertension was markedly reduced in Col4a3 -/- OPN -/- and Col4a3 -/- OPN +/- mice (Fig.2H). Furthermore, since Alport patients have 1000x more risk of cardiovascular disease, cardiac function was analyzed by echocardiography, and OPN deficiency was found to reverse cardiac systolic and diastolic dysfunction (Fig.3A and Fig.3B).
  • the OPN inhibitor is administered in an amount effective to alter gene/transcript expression (e.g., as measured in the heart), for example, to decrease expression of the Snora75 and/or LOC100302567 gene(s) and/or increase expression of one or more genes selected from Syne1, Ogdhl, Myh11, Scd4, Aqp7, Slc17a7, Rps13, Hbb-b1
  • the OPN inhibitor is administered in an amount effective to normalize splicing events (e.g., as measured in the heart) relative to wild-type, for example, for one or more genes selected from Dhx36, Zfp106, Dst, Fubp1, Elf2, Btbd1, Lrrc2, Abcd3, Ctsa, Fyco1, Abhd6, Serpinh1, Fgd4, and Ttn.
  • Kidney Injury Molecule-1 (KIM-1) is a type 1 transmembrane protein whose expression is markedly up-regulated in the proximal tubules in acute tubular necrosis in rats and human patients (Han et al. Kidney Int.2002;62:237-244) and Alport mice. KIM-1 was found dramatically increased in Alport mice compared to WT and significantly decreased to control level in Col4a3 -/- OPN -/- mice (Fig.6B). Because Kim-1 is capable to promote renal fibrosis (Humphreys et al.
  • the OPN inhibitor is administered in an amount effective to alter gene/transcript expression (e.g., as measured in the kidney), for example, to decrease expression of one or more genes selected from Dnm3, Mir24-1
  • Dynamin3 (Dnm3) was found to be significantly downregulated in Col4a3 -/- OPN -/- versus Col4a3 -/- mice (Table 3).
  • Dnm3 was highly expressed in the proximal tubules of Col4a3 -/- mice and then normalized in the OPN deficient Alport mice (Fig.6C).
  • Fig.6C OPN deficient Alport mice
  • western blot on the kidneys was performed and found Dnm3 expression was significantly upregulated in Col4a3 -/- mice compared to WT, and significantly downregulated in Col4a3 -/- OPN -/- mice.
  • OPN deficiency reduces corneal pathology in Col4a3 -/- mice.
  • Alport patients may develop the eye abnormality lenticonus.
  • OCT optical coherence tomography
  • the central cornea thickness (CCC) was analyzed and a difference among groups was not observed (Fig. 8A), suggesting Alport animals do not have pathology changes in cornea thickness.
  • the anterior chamber depth (ACD) distance from cornea to lens, and anterior chamber angle -- angle between cornea and iris, was analyzed, and both were significantly reduced in Col4a3 -/- mice, but were rescued to control level in Col4a3 -/- OPN -/- mice (Fig.8A).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Epidemiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Cardiology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Methods of using an osteopontin inhibitor in treating a type IV collagenopathy such as Alport Syndrome in a subject in need thereof are disclosed. The methods comprise administering an osteopontin inhibitor in an amount effective to improve cardiac function, kidney function, hearing, and/or vision in the subject.

Description

METHODS OF TREATING ALPORT SYNDROME
CROSS-REFERENCE TO RELATED APPLICATION
AND INCORPORATION BY REFERENCE
[0001] This application claims the benefit of priority under 35 U.S.C. §119(e) of U.S.
Provisional Patent Application No.62/371,064, filed August 4, 2016, which is incorporated herein by reference.
[0002] This application contains, as a separate part of the disclosure, a sequence listing in computer-readable form (Filename: 50574A_Seqlisting.txt; Size: 4,166 bytes; Created: August 4, 2017 txt; Size: kilobytes; Created: August 4, 2017), which is incorporated by reference in its entirety.
FIELD OF THE INVENTION
[0003] The present disclosure relates to methods of treating type IV collagenopathies such as Alport Syndrome.
BACKGROUND
[0004] Collagen type IV (Col4) is an essential component of basement membranes, which separate the epithelium from connective tissue. Alport Syndrome is an inherited disease caused by mutations in three collagen type IV genes, COL4A3, COL4A4, and COL4A5. The disease is characterized by progressive renal failure, hypertension, proteinuria, greatly increased risk of cardiovascular disease, and loss of hearing and vision. Current therapy for Alport Syndrome is aimed at ameliorating the symptoms and includes angiotensin-converting enzyme (ACE) inhibitors or angiotensin receptor blockers (ARB). Such treatments only slow the loss of kidney function or manage blood pressure and do not treat or prevent the other effects of the disease.
[0005] There remains a need for therapeutic options for Alport Syndrome and other Col4- related diseases to improve cardiac and kidney function, as well as hearing and vision.
SUMMARY
[0006] The present disclosure is directed to methods of treating a Col4-related disease such as Alport Syndrome in a patient in need thereof comprising administering a therapeutically effective amount of an osteopontin inhibitor to the subject. In one aspect, the present disclosure provides a method of improving cardiac systolic and diastolic function in a subject in need thereof comprising administering an osteopontin inhibitor in an amount effective to lower blood pressure, increase the mean corpuscular hemoglobin concentration (MCHC) in the blood, decrease myocardial fibrosis, increase stroke volume, increase cardiac output, decrease isovolumetric relaxation time, decrease interventricular wall thickness, decrease myocyte hypertrophy, or a combination of any of the foregoing, in the subject. In another aspect, the present disclosure provides a method of improving kidney function in a subject in need thereof comprising administering an osteopontin inhibitor in an amount effective to decrease the urine albumin/creatinine (ALB/CRE) ratio, decrease the thickness of a glomerulus basement membrane, decrease fibrotic cell proliferation and/or fibrosis, decrease lipid accumulation in a renal tubule, decrease one or more of plasma kidney injury molecule-1 (KIM-1), plasma blood urea nitrogen (BUN), plasma creatinine (CRE), renal Dynamin3 (Dnm3), and plasma Galectin-3 (Gal-3), or a combination of any of the foregoing, in the subject. In one aspect, the present disclosure provides a method of treating hearing loss in a subject in need thereof, comprising administering an OPN inhibitor in an amount effective to improve or maintain hearing and/or decrease the thickness of the capillary basement membrane in the cochlea, in the subject. In another aspect, the disclosure provides a method of treating g loss of vision in a subject in need thereof, comprising administering an OPN inhibitor in an amount effective to improve or maintain vision, treat or prevent a lenticonus, increase the anterior chamber depth and/or the anterior chamber angle in the eye, decrease the thickness of the capillary basement membrane in the retina, or a combination of any of the foregoing, in the subject.
[0007] In one aspect, the OPN inhibitor is administered in an amount effective to alter gene expression, for example, to (a) decrease expression of one or more genes selected from Snora75, LOC100302567, Dnm3, Mir24-1|Mir3074-1, B930095G15Rik, 4933409K07Rik|Gm3893, 4933409K07Rik|Gm3893, 9530091C08Rik, and Gm20038 and/or (b) increase expression of one or more genes selected from Syne1, Ogdhl, Myh11, Scd4, Aqp7, Slc17a7, Rps13, Hbb-b1|Hbb- b2|Beta-s, Il15, Cnn1, and Alas2|Apex2.
[0008] In any of the methods of the disclosure, the osteopontin inhibitor is selected from an antibody, an aptamer, a small interfering RNA, an antisense oligonucleotide, a regulatory nucleic acid, a small molecule inhibitor, and combinations thereof. In one aspect, the osteopontin inhibitor is administered systemically, e.g., intravenously. In another aspect, the osteopontin inhibitor is administered locally, e.g., to the eye and/or ear. [0009] In one aspect of any of the methods of the present disclosure, the subject has Alport Syndrome.
[0010] In various aspects, the disclosure provides:
[0011] 1. A method of treating a Col4-related disease in a patient in need thereof comprising administering a therapeutically effective amount of an osteopontin inhibitor to the subject.
[0012] 2. The method of paragraph 1, comprising administering the osteopontin inhibitor in an amount effective to decrease the blood pressure of the subject.
[0013] 3. The method of paragraph 1 or 2, comprising administering the osteopontin inhibitor in an amount effective to increase the mean corpuscular hemoglobin concentration (MCHC) in the blood of the subject.
[0014] 4. The method of any one of paragraphs 1-3, comprising administering the osteopontin inhibitor in an amount effective to improve cardiac systolic/or and diastolic function in the heart of the subject.
[0015] 5. The method of any one of paragraphs 1-4, comprising administering the osteopontin inhibitor in an amount effective to decrease a marker of renal dysfunction in the subject, optionally a marker selected from plasma kidney injury molecule-1 (KIM-1), plasma blood urea nitrogen (BUN), plasma creatinine (CRE), renal Dynamin3 (Dnm3), plasma
Galectin-3 (Gal-3), and a combination of any of the foregoing.
[0016] 6. The method of any one of paragraphs 1-5, comprising administering the osteopontin inhibitor in an amount effective to decrease the urine albumin/creatinine ratio of the subject.
[0017] 7. The method of any one of paragraphs 1-6, comprising administering the osteopontin inhibitor in an amount effective to decrease the thickness of the basement membrane in the kidney, retina, and/or cochlea of the subject.
[0018] 8. The method of any one of paragraphs 1-7, comprising administering the osteopontin inhibitor in an amount effective to treat or prevent hearing loss in the subject. [0019] 9. The method of any one of paragraphs 1-8, comprising administering the osteopontin inhibitor in an amount effective to treat or prevent loss of vision.
[0020] 10. The method of any one of paragraphs 1-9, comprising administering the osteopontin inhibitor in an amount effective to increase the anterior chamber depth and/or the anterior chamber angle in the eye of the subject.
[0021] 11. A method of improving cardiac function in a subject in need thereof comprising administering an osteopontin inhibitor in an amount effective to lower blood pressure, increase the mean corpuscular hemoglobin concentration (MCHC) in the blood, decrease myocardial fibrosis, increase stroke volume, increase cardiac output, decrease isovolumetric relaxation time, decrease interventricular wall thickness, decrease myocyte hypertrophy, or a combination of any of the foregoing, in the subject.
[0022] 12. A method of improving kidney function in a subject in need thereof comprising administering an osteopontin inhibitor in an amount effective to decrease the urine
albumin/creatinine (ALB/CRE) ratio, decrease the thickness of a glomerulus basement membrane, decrease fibrotic cell proliferation and/or fibrosis, decrease renal lipid accumulation, decrease one or more of plasma kidney injury molecule-1 (KIM-1), plasma blood urea nitrogen (BUN), plasma creatinine (CRE), renal Dynamin3 (Dnm3), and plasma Galectin-3 (Gal-3), or a combination of any of the foregoing, in the subject.
[0023] 13. A method of treating hearing loss in a subject in need thereof, comprising administering an osteopontin inhibitor in an amount effective to improve or maintain hearing and/or decrease the thickness of the capillary basement membrane in the cochlea, in the subject.
[0024] 14. A method of treating loss of vision in a subject in need thereof, comprising administering an osteopontin inhibitor in an amount effective to improve or maintain vision, treat or prevent a lenticonus, increase the anterior chamber depth in the eye, increase the anterior chamber angle in the eye, decrease the thickness of the capillary basement membrane in the retina, or a combination of any of the foregoing, in the subject.
[0025] 15. The method of any one of paragraphs 1-14, wherein the subject has Alport Syndrome. [0026] 16. The method of any one of paragraphs 1-15, wherein the osteopontin inhibitor is selected from an antibody, an aptamer, a small interfering RNA, an antisense oligonucleotide, a regulatory nucleic acid, a small molecule inhibitor, and combinations thereof.
[0027] 17. The method of any one of paragraphs 1-16, comprising administering the osteopontin inhibitor subcutaneously or intravenously.
[0028] 18. The method of any one of paragraphs 1-17, comprising administering the osteopontin inhibitor locally to the eye or ear of the subject.
[0029] 19. The method of paragraph 18, comprising administering the osteopontin inhibitor intravitreally and/or intratympanically.
[0030] 20. The method of any one of paragraphs 1-19, comprising administering the osteopontin inhibitor at least once a day.
[0031] 21. The method of any one of paragraphs 1-20, comprising administering the osteopontin inhibitor in a dosage of between about 0.1 mg and about 50 mg.
[0032] 22. The method of any one of paragraphs 1-21, comprising administering the osteopontin inhibitor in an amount effective to: (a) decrease expression of the Snora75 and/or LOC100302567 gene(s) in the heart; (b) increase expression of one or more genes in the heart selected from Syne1, Ogdhl, Myh11, Scd4, Aqp7, Slc17a7, Rps13, Hbb-b1|Hbb-b2|Beta-s, Il15, Cnn1, and Alas2|Apex2; (c) decrease expression of one or more genes in the kidney selected from Dnm3, Mir24-1|Mir3074-1, B930095G15Rik, 4933409K07Rik|Gm3893,
4933409K07Rik|Gm3893, 9530091C08Rik, and Gm20038; and/or (d) normalize the splicing events relative to wild-type in one or more genes selected from Dhx36, Zfp106, Dst, Fubp1, Elf2, Btbd1, Lrrc2, Abcd3, Ctsa, Fyco1, Abhd6, Serpinh1, Fgd4, and Ttn.
[0033] The foregoing summary is not intended to define every aspect of the invention, and other features and advantages of the present disclosure will become apparent from the following detailed description, including the drawings. The present disclosure is intended to be related as a unified document, and it should be understood that all combinations of features described herein are contemplated, even if the combination of features are not found together in the same sentence, paragraph, or section of this disclosure. In addition, the disclosure includes, as an additional aspect, all embodiments of the invention narrower in scope in any way than the variations specifically mentioned above. With respect to aspects of the disclosure described or claimed with“a” or“an,” it should be understood that these terms mean“one or more” unless context unambiguously requires a more restricted meaning. With respect to elements described as one or more within a set, it should be understood that all combinations within the set are contemplated. If aspects of the disclosure are described as“comprising” a feature, embodiments also are contemplated“consisting of” or“consisting essentially of” the feature. Additional features and variations of the disclosure will be apparent to those skilled in the art from the entirety of this application, and all such features are intended as aspects of the disclosure.
BRIEF DESCRIPTION OF THE DRAWINGS
[0034] Figures 1A and 1B show OPN expression is increased in Alport mice. Western blots and corresponding densitometry shows elevated OPN expressions in Col4a3-/- versus WT or Col4a3+/- mouse kidneys (Figure 1A) and plasma (Figure 1B). N=3-6 mice per group.
Quantification is based on three independent experiments. Data are mean±SEM. *P < 0.05; **P < 0.01. n.d.u = normalized densitometry units.
[0035] Figures 2A to 2G show OPN deficiency increases life span and attenuates Alport pathology in Col4a3-/- mice. OPN deficiency in Alport mice causes an increase in lifespan by Kaplan Meier survival curve (Figure 2A), a reduction in body weight loss (Figure 2B), a reduction of albuminuria as measured by albumin and creatinine (ALB/CRE) ELISA (Figure 2C), a decrease in plasma Blood Urea Nitrogen (BUN) (Figure 2D) and creatinine (CRE) (Figure 2E) levels, an increase in blood Mean Corpuscular Hemoglobin Concentration (MCHC) (Figure 2F), and reductions in systolic blood pressure (SBP) and diastolic blood pressure (DBP) as recorded by tail-cuff blood pressure system (Figure 2G), all relative to Alport mice. Data were collected from animals at 8 to 9 weeks of age.
[0036] Figures 3A and 3B show OPN deficiency improved cardiac structure and function in Alport mice. Echocardiography studies show significant improvement of systolic (stroke volume; Fig.3A) and diastolic (isovolumetric relaxation time; Figure 3B) function in Alport hearts.
[0037] Figures 4A through 4C show OPN deficiency prevents cardiac hypertrophy in Col4a3- /- mice. OPN deficiency rescues cardiac hypertrophy shown by decreased thickness of interventricular septum (IVS) (Figure 4A) and myocyte cross-sectional area (Figure 4B). H&E images show rescue of IVS thickness (Figure 4C). Values are mean±SEM. P values: **p<0.01, ***p<0.001 using 1-way ANOVA with Tukey’s post hoc test.
[0038] Figures 5A through 5C show cardiac fibrosis is rescued by OPN deficiency in Col4a3- /- mice. OPN deficiency reduces cardiac fibrosis reflected by decreased interstitial activated fibroblasts shown by Electron Microscopy (Figure 5A), dividing/EdU-positive MLC2-negative interstitial cells (Figure 5B), and plasma levels of Galectin-3 (Figure 5C) in Col4a3-/- mice. Gal- 3, Galectin-3. C, Collagen fibers, RER, Rough Endoplasmic Reticulum. Values are mean±SEM. P values: *p<0.05, **p<0.01, ***p<0.001 using one way ANOVA with Tukey’s post hoc test.
[0039] Figure 6A to 6F show OPN deficiency reduces fibrotic cell proliferation and prevents severe renal pathology in mouse Alport kidney. (Figure 6A) Fibrotic cell proliferation was visualized by EdU incorporation after 30 days of EdU injections and is elevated in Alport kidneys, but prevented by OPN deficiency. (Figure 6B) Kim-1 expression is elevated in renal tubules of Alport mice and rescued by OPN deficiency as shown by immunofluorescent staining and corresponding quantification. (Figure 6C) Dnm3 expression is elevated in Alport kidneys but reduced by OPN deficiency as shown by immunostaining. (Figure 6D) Oil red staining and corresponding quantification show extensive lipid accumulation in tubules of Col4a3-/- mice, that is reduced with OPN deficiency. (Figure 6E) Western blot and corresponding densitometry shows Dnm3 expression is significantly increased in Alport kidneys and normalized with OPN deficiency. N=3-4 mice per group. (Figure 6F) Representative electron microscopy images show podocytes effacements and disruption of basement membrane in Col4a3-/- mice (center) as compared to normal or restored morphology in wild-type (left) or Col4a3-/-OPN-/- mice (right). Insets are shown at a higher magnification in the bottom row. In the zoomed-in images, scale bar = 20 µm. Data are mean±SEM. *P < 0.05; **P < 0.01***P < 0.001.
[0040] Figures 7A and 7B show OPN deficiency improves high frequency hearing threshold in Col4a3-/- mice and reduces pathology of inner ear. (Figure 7A) Auditory brainstem response (ABR) thresholds across stimulus frequencies (4 to 16 kHz) and clicks are shown. OPN deficiency caused an improvement of hearing ability of Alport mice at the 16 KHZ stimuli. N=6- 12 mice per group. (Figure 7B) Representative electron microscopy (EM) images show thickened basement membrane in Alport cochleas - a pathology that is reduced with OPN deficiency. Insets are shown at a higher magnification on the bottom. [0041] Figures 8A and 8B show OPN deficiency attenuates tendency of lenticonus in Col4a3-/- mice. (Figure 8A) Optical coherence tomography (OCT) studies show significant improvement in anterior chamber distance (ACD) and anterior chamber angle (ACA) dimension in Alport OPN deficient relative to Alport mice. N=2 mice per group. (Figure 8B) EM shows disrupted basement membrane of cornea in Col4a3-/- mice– a pathology that is reduced with OPN deficiency. Insets are shown at a higher magnification on the bottom.
DETAILED DESCRIPTION
[0042] The present disclosure provides methods of treating Alport Syndrome in a patient in need thereof comprising administering a therapeutically effective amount of an osteopontin inhibitor. Osteopontin (OPN), a secreted phosphoprotein, has not previously been studied in Alport Syndrome. Inhibition of OPN in Alport Syndrome subjects improves lifespan, decreases proteinuria and hypertension, improves renal and cochlear histology, and improves cardiac function, hearing ability, and eye abnormalities.
[0043] The following definitions may be useful in aiding the skilled practitioner in
understanding the disclosure. Unless otherwise defined herein, scientific and technical terms used in the present disclosure shall have the meanings that are commonly understood by those of ordinary skill in the art.
[0044] The term“osteopontin inhibitor” or“OPN inhibitor” refers to a small molecule and/or biologic inhibitor of the osteopontin (secreted phosphoprotein 1; SPP1) gene or protein. OPN inhibitors include antigen-binding peptides (e.g., antibodies), aptamers, and nucleic acids (e.g., microRNA, small interfering RNA, and antisense nucleotides). Examples of OPN inhibitors include, but are not limited to, the inhibitors described in U.S. Patent Application Nos.
20150366851, 20150004157, 20120264942, 20080262092, and International Patent Publication WO2009102438, incorporated herein by reference.
[0045] The terms“type IV collagen-related disease,”“type IV collagenopathy” or“Col4- related disease” refers to a disease or disorder characterized by a defect in a Col4 gene or protein (e.g., COL4A1, COL4A2, COL4A3, COL4A4, COL4A5, and/or COL4A6). Examples include Alport Syndrome, Goodpasture’s Syndrome, and Col4-related vascular and cardiovascular diseases, such as hypertension and heart failure with preserved ejection fraction, respectively. [0046] The terms“therapeutically effective amount” and“effective amount” depend on the condition of a subject and dosing regimen. The terms refer to an amount of an OPN inhibitor effective to achieve a desired biological, e.g., clinical effect. A therapeutically effective amount varies with the nature of the disease being treated, the length of time that activity is desired, and the age and the condition of the subject. For example, a therapeutically effective amount of an OPN inhibitor according to the disclosure is an amount effective to decrease or improve one or more of the following symptoms: proteinuria, urinary albumin/creatinine levels, renal dysfunction/insufficiency, fibrotic cell proliferation, anemia, cardiac dysfunction, hearing deficits, eye/vision abnormalities (e.g., lenticonus), and hypertension. In one aspect, a therapeutically effective amount of an OPN inhibitor is an amount effective to increase the longevity of the subject relative to the expected lifespan in view of disease progression.
[0047] As used herein, the terms“patient” and“subject” may be used interchangeably and mean animals, such as dogs, cats, cows, horses, and sheep (i.e., non-human animals) and humans.
[0048] As used herein, the term“pharmaceutically acceptable” means that the referenced substance, such as a compound of the present disclosure, or a composition containing the compound, or a particular excipient, are safe and suitable for administration to a patient. The term“pharmaceutically acceptable carrier” refers to a medium that does not interfere with the effectiveness of the biological activity of the active ingredient(s) and is not toxic to the host to which it is administered.
[0049] As used herein, the term“excipient” means any pharmaceutically acceptable additive, carrier, diluent, adjuvant, or other ingredient, other than the OPN inhibitor
[0050] As used herein the terms“treating”,“treat” or“treatment” and the like include preventative (e.g., prophylactic) and palliative treatment.
[0051] In jurisdictions that forbid the patenting of methods that are practiced on the human body, the meaning of“administering” of a composition to a human subject shall be restricted to prescribing a controlled substance that a human subject will self-administer by any technique (e.g., orally, inhalation, topical application, injection, insertion, etc.). The broadest reasonable interpretation that is consistent with laws or regulations defining patentable subject matter is intended. In jurisdictions that do not forbid the patenting of methods that are practiced on the human body, the“administering” of compositions includes both methods practiced on the human body and also the foregoing activities.
[0052] In one aspect, the present disclosure provides methods of treating a Col4-related disease such as Alport Syndrome in a subject in need thereof comprising administering a therapeutically effective amount of an OPN inhibitor to the subject. In one aspect, the OPN inhibitor is administered in an amount effective to treat a cardiac symptom of the disease in the subject. In another aspect, the present disclosure provides a method of improving cardiac function in a subject in need thereof, optionally a subject having a Col4-related disease such as Alport Syndrome, comprising administering an OPN inhibitor in an amount effective to lower blood pressure, increase the mean corpuscular hemoglobin concentration (MCHC) in the blood, decrease myocardial fibrosis, increase stroke volume, increase cardiac output, decrease isovolumetric relaxation time, decrease interventricular wall thickness, decrease myocyte hypertrophy, or a combination of any of the foregoing, in the subject. In one aspect, the OPN inhibitor is administered in an amount effective to decrease the blood pressure of the subject, e.g., the systolic blood pressure and/or the diastolic blood pressure, for example, by at least about 1 mm Hg, at least about 2 mm Hg, at least about 3 mm Hg, at least about 4 mm Hg, at least about 5 mm Hg, at least bout 6 mm Hg, at least about 7 mm Hg, at least about 8 mm Hg, at least about 9 mm Hg, at least about 10 mm Hg, at least about 20 mm Hg, at least about 30 mm Hg, at least about 40 mm Hg, at least about 50 mm Hg, at least about 60 mm Hg, at least about 70 mm Hg, at least about 80 mm Hg, at least about 90 mm Hg, or at least about 100 mm Hg. In another aspect, the OPN inhibitor is administered in an amount effective to increase the MCHC in the blood of the subject, for example, by at least about 1 g/dL, at least about 2 g/dL, at least about 3 g/dL, at least about 4 g/dL, at least about 5 g/dL, at least about 6 g/dL, at least about 7 g/dL, at least about 8 g/dL, at least about 9 g/dL, at least about 10 g/dL, at least about 15 g/dL, at least about 20 g/dL, at least about 25 g/dL, or at least about 30 g/dL. In one aspect, the OPN inhibitor is administered in an amount effective to decrease myocardial fibrosis in the subject. In one aspect, the OPN inhibitor is administered in an amount effective to increase cardiac output, e.g., ejection fraction and/or endocardial stroke volume, in the subject for example, by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, or at least about 30%, compared to pre-treatment. [0053] In one aspect, the disclosure provides a method of treating a Col4-related disease such as Alport Syndrome in a subject in need thereof comprising administering a therapeutically effective amount of an OPN inhibitor to the subject to treat a renal symptom of the disease. In another aspect, the disclosure provides a method of improving kidney function in a subject in need thereof, optionally a subject having a Col4-related disease such as Alport Syndrome, comprises administering an OPN inhibitor in an amount effective to decrease the urine albumin/creatinine (ALB/CRE) ratio, decrease the thickness of a glomerulus basement membrane, decrease fibrotic cell proliferation and/or fibrosis, decrease lipid accumulation in a renal tubule, decrease one or more of plasma kidney injury molecule-1 (KIM-1), plasma blood urea nitrogen (BUN), plasma creatinine (CRE), renal Dynamin3 (Dnm3), and plasma Galectin-3 (Gal-3), or a combination of any of the foregoing in the subject. In one aspect, the OPN inhibitor is administered in an amount effective to decrease the urine ALB/CRE, for example, by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300%, in the subject, compared to pre-treatment. In another aspect, the OPN inhibitor is administered in an amount effective to decrease the thickness of a glomerulus basement membrane in the subject. In another aspect, the OPN inhibitor is administered in an amount effective to decrease fibrotic cell proliferation and/or fibrosis in the subject. In one aspect, the OPN inhibitor is administered in an amount effective to decrease lipid accumulation in a renal tubule in the subject. In aspect, the OPN inhibitor is administered in an amount effective to decrease a marker of renal dysfunction, for example, one or more of plasma KIM-1, plasma BUN, plasma CRE, renal Dnm3, and plasma Gal-3, optionally by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 125%, at least about 150%, at least about 175%, at least about 200%, at least about 250%, or at least about 300%.
[0054] In one aspect, the disclosure provides a method of treating Alport Syndrome in a subject in need thereof comprising administering a therapeutically effective amount of an OPN inhibitor to the subject to treat hearing loss. In another aspect, the disclosure provides a method of treating hearing loss in a subject in need thereof, optionally a subject having a Col4-related disease such as Alport Syndrome, comprising administering an OPN inhibitor in an amount effective to improve or maintain hearing and/or decrease the thickness of the capillary basement membrane in a cochlea of the subject. In one aspect, the OPN inhibitor is administered in an amount effective to improve or maintain hearing, including, for example, high frequency (e.g., greater than 8 kHz) hearing, in the subject. In another aspect, the OPN inhibitor is administered in an amount effective the decrease the thickness of a basement membrane in the cochlea, e.g., in the stria vascularis, in the subject.
[0055] In one aspect, the disclosure provides a method of treating Alport Syndrome in a subject in need thereof comprising administering a therapeutically effective amount of an OPN inhibitor to the subject to treat loss of vision. In another aspect, the disclosure provides a method of treating loss of vision in a subject in need thereof, optionally a subject having a Col4-related disease such as Alport Syndrome, comprising administering an OPN inhibitor in an amount effective to improve or maintain vision, treat or prevent a lenticonus, increase the anterior chamber depth in the eye, increase the anterior chamber angle in the eye, decrease the thickness of the capillary basement membrane in the retina, or a combination of any of the foregoing, in the subject. In one aspect, the OPN inhibitor is administered in an amount effective to improve or maintain vision. In another aspect, the OPN inhibitor is administered in an amount effective to treat or prevent an eye deformity, for example, a lenticonus, e.g., a lenticonus anterior, increased anterior chamber depth and/or increased anterior chamber angle in the eye, and/or thickening of the capillaries in the retinal basement membrane. In another aspect, the OPN is administered in an amount effective to increase the anterior chamber depth in an eye of the subject, optionally by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, or at least about 30%. In another aspect, the OPN inhibitor is administered in an amount effective to increase the anterior chamber angle in an eye of the subject, optionally by at least about 1 degree, at least about 2 degrees, at least about 3 degrees, at least about 4 degrees, at least about 5 degrees, at least about 6 degrees, at least about 7 degrees, at least about 8 degrees, at least about 9 degrees, at least about 10 degrees, at least about 11 degrees, at least about 12 degrees, at least about 13 degrees, at least about 14 degrees, or at least about 15 degrees. In another aspect, the OPN inhibitor is administered in an amount effective to decrease the retinal basement membrane in the subject. [0056] One of ordinary skill will appreciate that treating a disease or disorder such as Alport Syndrome does not require complete eradication of the disease or disorder. Any beneficial physiologic response is contemplated, such as improvement of kidney function, prevention or delay of kidney failure, improvement of cardiac function or prevention of cardiovascular disease, decrease in proteinuria and/or hematuria, reduction in blood pressure, improvement in or maintenance of hearing and/or vision, and any combination of the foregoing. Treating a disease or disorder such as Alport Syndrome also encompasses prevention of one or symptoms typically associated with the disease, which may entail a complete prevention of the symptom or a delay in onset or worsening of the symptom.
[0057] In some aspects, therapeutic efficacy can be measured using laboratory or clinical tests known in the art to evaluate symptoms associated with a type IV collagenopathy. Kidney function can be evaluated, for example, using imaging (e.g., ultrasound and CT scans), biopsies, and detection methods (e.g., ELISA) for quantitating biomarkers in patient samples, including blood and urine samples. Cardiac function and hypertension can be evaluated, for example, using electrocardiography, echocardiography, stress tests, positron emission tomography tests, imaging (e.g., magnetic resonance imaging and CT scans), and blood pressure cuffs. Hearing can be evaluated, for example, using audiometry exams, otoacoustic emissions tests, auditory brainstem response tests, and encephalograms. Eye abnormalities and vision can be evaluated, for example, using optical coherence tomography studies
[0058] A particular administration regimen for a given subject will depend, in part, upon the compound or composition, the amount administered, the route of administration, and the cause and extent of any side effects. The amount administered to a subject (e.g., a mammal, such as a human) in accordance with the disclosure should be sufficient to effect the desired response over a reasonable time frame. Dosage typically depends upon the route, timing, and frequency of administration.
[0059] Purely by way of illustration, the methods of the present disclosure comprise administering, e.g., from about 0.1 mg/kg to about 15 mg/kg or more of an OPN inhibitor based on the body weight of the subject, depending on the factors mentioned above. In some aspects, the dosage ranges from about 0.1 mg/kg to about 0.5 mg/kg, about 1 mg/kg to about 3 mg/kg, about 0.5 mg/kg to about 5 mg/kg, about 0.2 mg/kg to about 0.8 mg/kg, about 5 mg/kg to about 15 mg/kg, about 4 mg/kg to about 12 mg/kg, or about 0.1 mg/kg to about 2 mg/kg. For example, an OPN inhibitor may be administered to a human patient in an amount from between about 1 mg to about 50 mg, for example, about 1 mg, about 5 mg, about 10 mg, about 15 mg, about 20 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, or about 50 mg. The dosage is administered as needed, for example, one to three times daily, every other day, twice a week, weekly, every two weeks, monthly, or less frequently. The treatment period will depend on the particular condition and may last one day to several days, weeks, months, or years. The above dosages are exemplary of the average case, but there can be individual instances in which higher or lower dosages are merited, and such are within the scope of the present disclosure.
[0060] Suitable OPN inhibitors, and pharmaceutically acceptable compositions thereof, are known in the art. In various aspects, the OPN inhibitor is a small molecule and/or biologic inhibitor of OPN. OPN inhibitors include antigen-binding peptides (e.g., antibodies), aptamers, and nucleic acids (e.g., microRNA, small interfering RNA, and antisense nucleotides).
Examples of OPN inhibitors include, but are not limited to, the inhibitors described in U.S.
Patent Application Nos.20150366851, 20150004157, 20120264942, 20080262092, International Patent Publication WO2009102438, Wang et al. Journal of Immunology.2009;182(4):2485-91, Dai et al. Cancer Immunol Immunother.2010;59(3):355-66, Zhao et al. Am J Transl Res.
2016;8(9):3645-3655, Xanthou et al. Nature Medicine.2007,13(5):570-578, Mohamed et al. PLOS One.2015; 10(4):e012331, Mason et al. Mol Cancer Ther.2008;7(3):548-558 (i.e., (-)- agelastatin A), Kiefer et al. Diabetes.2010;59:935-946, Paliwal et al. Aging.2012;4(8):553-566, Liaw et al. Arteriosclerosis, Thrombosis, and Vascular Biology.1997;17:188-193, Kon et al. J Cell Biochem.2002;84(2):420-432, and Jalvy et al. Cardiovascular Research.2007;75:738-747, incorporated herein by reference. For example, the OPN inhibitor may be a dictyopyrone derivative or a dihydrodictyopyrone derivative represented by any of Chemical Formulas 1-16:
Figure imgf000016_0001
Figure imgf000017_0001
Figure imgf000018_0001
Figure imgf000018_0002
.
In still another example, the OPN inhibitor is a compound selected from compounds IPS-02001, IPS-02002, and IPS-02003:
Figure imgf000019_0001
Figure imgf000020_0001
Figure imgf000020_0002
Figure imgf000020_0003
In another example, the OPN inhibitor is polynucleotide aptamer that binds to and inhibits the function of osteopontin, such as an RNA aptamer that comprises a nucleotide sequence that is identical to any of SEQ ID NOS: 1-14 as shown in Table 4, or a nucleotide sequence that is at least 70% identical, e.g., at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any of SEQ ID NOS: 1-14.
TABLE 4
Figure imgf000021_0001
In another example, the OPN inhibitor is a siRNA comprising the sequence
AAGAUGAUAGGUAUCUGAAAU (SEQ ID NO:15).
[0061] A composition comprising an OPN inhibitor may be in any suitable dosage form including, but not limited to, tablets, capsules, implants, depots, liquids, patches, lozenges, creams, gels, ointments, lotions, sprays, ear drops, and eye drops.
[0062] Compositions suitable for injection or instillation may comprise physiologically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions, or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Examples of suitable aqueous and nonaqueous carriers, diluents, solvents, or vehicles include water, ethanol, polyols (propylene glycol, polyethylene glycol, glycerol, and the like), suitable mixtures thereof, vegetable oils (such as olive oil) and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. [0063] The compositions may also contain adjuvants such as preserving, wetting, emulsifying, and dispersing agents. Microorganism contamination can be prevented by adding various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, and the like. The compositions may also include isotonic agents, for example, sugars, sodium chloride, and the like. Prolonged absorption of injectable pharmaceutical compositions can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin.
[0064] Suitable methods of administering a pharmaceutically acceptable composition comprising an OPN inhibitor are well-known in the art. Although more than one route can be used to administer a compound, a particular route can provide a more immediate and more effective reaction than another route. Depending on the circumstances, a compound or composition described herein is introduced into a surgical site, applied or instilled into a body cavity, absorbed through the skin or mucous membranes, inhaled, ingested and/or introduced into circulation. In one aspect, the compound or composition is administered orally. In another aspect, the compound or composition is injected intravenously and/or intraperitoneally. For example, in certain circumstances, it will be desirable to deliver the composition through injection, infusion, or deposition by intravenous, intraperitoneal, intracerebral (intra- parenchymal), intracerebroventricular, intracardiac, intraarterial, intraportal, intralesional, intramedullary, intrathecal, intraventricular, intranasal, subcutaneous, renal, otic, or ocular means; by controlled, delayed, sustained or otherwise modified release systems; or by implantation devices. In one aspect, a composition comprising an OPN inhibitor is administered locally to the eye and/or ear, e.g., ophthalmically, intraocularly, conjunctivally, intracorneally, intravitreally, retrobulbarly, auricularly, or intratympanically. Alternatively, an OPN inhibitor is administered via implantation of a matrix, membrane, sponge, or another appropriate material onto which the compound has been absorbed or encapsulated. Where an implantation device is used, the device is, in one aspect, implanted into or on the surface of any suitable tissue or organ, and delivery of an OPN inhibitor is, for example, via diffusion, timed-release bolus, or continuous administration. In one aspect, an OPN inhibitor comprises a targeting moiety specific for OPN, such as an antigen binding protein including, but not limited to, antibodies, antibody fragments, antibody derivatives, antibody analogs, and fusion proteins. [0065] The present disclosure will be more readily understood by reference to the following example, which is provided by way of illustration and is not intended to be limiting.
Example
[0066] Materials and Methods
[0067] Animals. Col4a3-/- Alport mice on C57Bl6 or 129X1/SvJ background were purchased from Jackson Lab, crossed at least 10 times, and confirmed by genotyping (Transnetyx, TN).
[0068] EdU Injections.5-ethynyl-2’-deoxyuridine (A10044, LifeTechnologies) was prepared at 1 mg/ml stock and filtered through 0.2 µm Nalgene syringe filter (190-2520,
ThermoScientific).100µl (100µg) EdU stock was administered daily to each mouse through intraperitoneal injections for up to 30 days to identify mitotic cells.
[0069] Blood Pressure Recording. Blood pressure measurements were carried out using CODA mouse tail-cuff system (Kent Scientific). Anesthesia was induced with 5% vaporized isoflurane at 0.8 L/min flow rate and maintained with 1% isoflurane during blood pressure recordings. Heart rate was monitored and body temperature was controlled within 37 oC to 39 oC. Two tail cuffs, occlusion and VPR, were equipped onto the tails. Occlusion tail cuff was inflated and deflated to control blood flow. VPR tail cuff was incorporated with specially designed differential pressure transducer that measured the systolic and diastolic blood pressure by determining the blood volume in the tail. Animals were trained three times to minimize stress- related blood pressure changes caused by the system prior to recording the final blood pressure values. Twenty systolic and diastolic blood pressure readings were recorded from each mouse and the fifteen most consistent readings were used for analysis.
[0070] Hearing Test. Auditory Brainstem Response (ABR) were performed on anesthetized mice at 8 to 9 weeks of age. ABR subdermal electrodes were placed on the vertex, both mastoids, and the left hind leg (ground). Using a commercial system (Intelligent Hearing
Systems, Miami, FL), electroencephalograms (EEG) were amplified 100,000 times, band-pass filtered between 30 Hz and 1500 Hz and acquired using a sampling frequency of 10 Ksps in 102.4 ms long epochs. Acoustic stimuli using tone bursts at 4, 8, and 16 kHz were delivered with insert ear phones. For each frequency and epoch, eight, amplitude-modulated, tone bursts were presented to each ear at an average stimulation rate of 78.13 stimuli. The raw EEGs were averaged in blocks of 64 epochs to obtain the auditory evoked potential responses. Each epoch lasted 102.4 ms and contained eight tone pips modulated by a 3 ms trapezoidal envelope (1 ms rise time, 1 ms plateau, and 1 ms falling time). ABR hearing threshold was defined as the minimum intensity required to produce an ABR response that was identifiable and consistent. Intensity level of stimuli were tested in 10 dB SPL intervals.
[0071] Ocular Measurements. Anterior-segment images were captured by optical coherence tomography (OCT) using a SD-OCT system (Bioptigen, NC). Central corneal thickness (CCC), anterior chamber depth (ACD) and anterior chamber angle (ACA) were determined using Image J software (ver.2.0.0). Central corneal thickness was defined as the distance from the corneal epithelial surface to the corneal endothelium. Anterior chamber depth was defined as the distance from the corneal endothelium to the anterior surface of the lens capsule. Anterior chamber angle was defined as the angle formed between the anterior surface of the iris and the posterior surface of the cornea.
[0072] Echocardiography. Cardiac function was evaluated by a Vevo2100 echocardiography imaging system (Visual Sonics, Toronto, Canada) with a MS400 linear array transducer. Briefly, mice were anesthetized with 4% isoflurane at 0.8 L/min flow rate and maintained with 1% isoflurane. Following anesthesia, the mice were fixed in a supine position on a platform with an integrated temperature sensor, a heater, and ECG electrodes. The heart rate was monitored constantly and body temperature was maintained at 37 °C during measurements. Depilatory cream was used to remove fur from the region of procedure, and medical ultrasonographic acoustic gel was applied as a coupling fluid between the real-time microvisualization scan probe and the skin. Endocardial % Ejection Fraction (EF) was recorded in B-Mode and analyzed using a VEVO 770 software.
[0073] Kidney Epithelial Cells Isolation and Culture. Kidneys were harvested in DMEM+F12 media (10565-18, Gibco, Bartlesville, OK) supplemented with 1% Penicillin/Streptavidin (400- 109, Gemini, Commack, NY). Medulla was removed, and the remaining kidney tissue was cut into pieces and digested in Collagenase type II (LS004176, Worthington, Columbus, OH) at 5mg/ml for 10min two times at 37 oC. Digested kidney pieces were then plated on a 2% gelatin (G2500-100g, Sigma, St. Louis, MO) coated 6-well plate. Tubule epithelial media (PCS400030, PCS400040, ATCC, Manassas, Virginia) was used. [0074] ELISA. Albumin concentration was measured by ELISA (E90-134, Bethyl Laboratories, Montgomery, TX) using 1:500 to1:20,000 diluted urine samples collected from 8- to 9-week-old mice. Creatinine concentration was measured using 1:20 diluted urine samples by an ELISA assay (1012, Exocell, Philadelphia, PA). Albumin concentrations (mg/mL) were then normalized to creatinine (mg/mL) for analysis of albuminuria. Plasma Galectin-3 levels were measured by enzyme-linked immunosorbent assay (DY1197, R&D Systems, Minneapolis, Minnesota, USA) according to the manufacturer’s instruction.
[0075] Blood Pathology. Blood samples were collected into Capiject tubes (T-MLHG, Terumo, Elkton, MD) by cardiac puncture and centrifuged to separate plasma from blood cells. Mean corpuscular hemoglobin concentration (MCHC), blood urea nitrogen (BUN) and creatinine levels were analyzed.
[0076] Histochemistry. De-paraffinized 4 µm kidney sections were processed for antigen retrieval using citrate buffer in a steamer for 45 minutes, permeabilized using 0.2% triton for 15 minutes, and blocked in 10% donkey serum in 1% TBST for 1 hour. EdU-555 was stained for 30 minutes as recommended by the manufacturer. Sections were then counter-stained for the glomeruli marker Synaptopodin (Synpo) (sc-21537, Santa Cruz Biotechnology, Santa Cruz, California) at 4 oC overnight, and staining was detected using anti-Goat Alexa Fluor-488 at RT for 30 minutes. Dnm3 was stained overnight and detected using biotinylated anti-Rabbit (BA- 1000, Vector Laboratories, Burlingame, CA) at RT for 30 minutes followed by DAB peroxidase (HRP) amplification (SK-4100, Vector Laboratories, Burlingame, CA).
[0077] For OPN or KIM-1 staining, 10 µm frozen kidney sections were air dried, rinsed with PBS, permeabilized with 0.2% triton for 3 minutes and blocked with 10% donkey serum for 30 min at RT. OPN (ab3458, Abcam, Cambridge, MA) or Kim-1 (AF3689, R&D, Minneapolis, MN) antibodies were used at 4 oC overnight and detected using anti-Goat or anti-Rat Alexa Fluo- 488 at RT for 30 minutes. For Oil red staining, frozen sections were processed as described above and incubated with 60% isopropanol for 5 min followed by oil red solution for 45 min. For immunostainings, primary and secondary antibody incubations were done in 10% donkey Serum in 1% TBST. Dnm3 and oil red staining images were captured on a Zeiss microscope using a 32x objective. OPN, Kim-1 and EdU fluorescent images were captured on a Zeiss LSM710 confocal microscope using z-scanning at 40x magnification. Three to five kidneys/mice per group were used and six to ten images per kidney were acquired and quantified.
[0078] Electron Microscopy. Kidneys, cochlea and eyes were fixed for 24 hours (hrs) in 10% formalin, followed by 24 hrs in 2% glutaraldehyde, rinsed in wash buffer three times, and then postfixed in 2% osmium tetroxide in 0.1 M phosphate buffer overnight. After buffer rinses, they were dehydrated through a series of graded ethanols and embedded using Embed/Araldite (Electron Microscopy Sciences, Hatfield, PA) overnight in a 64 °C oven. Silver/gold sections were cut on a Leica Ultracut R (Leica) and stained in uranyl acetate and lead citrate. Images were captured by a Gatan Orius SC 200D CCD camera (Gatan, Pleasanton, CA, USA) in a JEM 1400 electron microscope (JEOL, Peabody, MA, USA).
[0079] Microarrays and Bioinformatics. Kidneys were lysed using Cell Disruption Buffer (Mirvana Paris Kit) and total RNA was extracted using Mirvana Paris Kit to yield a 260–280 nm absorbance ratio of 2.0. RNA concentration and integrity was determined by using an Agilent Bioanalyzer. A 1 µg aliquot of total RNA from each of the samples (3 samples per group; 2 groups per experiment) was processed using instructions and reagents supplied by the
manufacturer (Affymetrix, Santa Clara, CA). Briefly, total RNA was reverse transcribed using a T7-Oligo (dT) Promoter Primer in the first-strand cDNA synthesis reaction. Following RNase H- mediated-DNA polymerase I-second-strand cDNA synthesis, the double-stranded cDNA was purified and served as a template for in vitro transcription in the presence of T7RNA polymerase and a biotinylated nucleotide analog/ribonucleotide mix, producing biotin-labeled
complementary RNA (cRNA). cRNA probes were then purified, fragmented, and hybridized on Mouse ST2 gene expression arrays (45,101 probe sets). Background noise, housekeeping gene expression and 3’/5’ ratio values of all chips were within quality control limits set by Affymetrix. Expression ratios were calculated as the power-2 exponential of the log2 differences. The acceptance criteria for gene array expression changes was a minimum 2-fold change in log2 (equivalent to 4-fold) and a one-way Analysis of Variance (ANOVA) t-test p-value of <0.05. All microarray raw files were submitted to the NCBI Gene Expression Omnibus (GEO) database (GSEXXX).
[0080] Western Blots. Protein concentration was measured using a Bradford assay. Samples were prepared and separated by a 4-12% Novex mini 15-well gradient gel (Bolt System, Life Technologies), and probed with OPN (AF808, R&D, Minneapolis, MN), Dnm3 (ab3458, Abcam, Cambridge, MA), Kim-1 (AF3689, R&D, Minneapolis, MN) and GAPDH (sc-25778, Santa Cruz Biotechnology, Santa Cruz, California) antibodies. Signals were detected by chemiluminescence (Femto, Thomas Scientific) on photographic films. Digitized images were analyzed using Image J (NIH). Protein band densitometry was normalized to that of GAPDH, and the averaged results were plotted as normalized densitometry units (n.d.u.).
[0081] Statistics. For all experiments, N refers to the number of individual mice or individual culture plates. All data are expressed as mean ± S.E.M. P-values were calculated using Student’s t-tests. Where indicated, p-values were calculated using ANOVA and corrected for multiple comparisons using Tukey Posthoc correction in GraphPad Prism. Repeated symbols represent P- values of different orders of magnitude, i.e. *P< 0.05, **P< 0.01.
Results
[0082] OPN is substantially expressed in the tubules of Col4a3-/- mice. The Col4a3-/- knockout mouse phenocopies the symptom of Alport Syndrome, making it an ideal disease model
(Cosgrove et al. Genes Dev.1996;10:2981-2992). OPN expression was studied by
immunostaining and western blots in kidney and/or plasma samples from WT and Col4a3-/- mice. Immunostaining showed that OPN was substantially expressed in the tubules of Col4a3-/- mice. Western blots revealed a dramatic increase of OPN expression in kidney (Fig.1A) and plasma (Fig.1B) of Col4a3-/- mice.
[0083] OPN deficiency increases life span and attenuates Alport pathology in Col4a3-/- mice. Alport mice develop severe renal dysfunction and die approximately at 10 weeks of age. In order to test whether OPN deficiency increases lifespan in Alport mice, survivals of Col4a3-/-, Col4a3- /-OPN+/- and Col4a3-/-OPN-/- animals and their body weights at 9 to 12 weeks of age were recorded. Kaplan Meier survival curves show that the Col4a3-/-OPN-/- and Col4a3-/- OPN+/- mice significantly outlived the Alport mice (Fig.2A), and that the body weights were also
significantly increased in OPN deficient animals (Fig.2B). Impressively, two Col4a3-/- OPN+/- mice lived up to 20 weeks (Fig.2A), doubling the typical lifespan of Alport animals. To study the functional effects of OPN deficiency on Alport pathology, urine and blood samples from animals at 8 to 9 weeks of age were analyzed. At 8 to 9 weeks of age, Alport mice develop severe proteinuria, renal dysfunction, hearing deficits and eye abnormalities. Using sandwich Elisa, urinary albumin/creatinine levels were quantified, which substantially increased in Alport animals by 161 times compared to wild type (WT), and were significantly decreased by 50% in Col4a3-/-OPN+/- and Col4a3-/-OPN-/- mice as compared to Col4a3-/- mice (Fig.2C). Other renal dysfunction parameters, plasma Blood Urea Nitrogen (BUN) and creatinine, were also measured, and very mild decrease were found in Col4a3-/-OPN+/- and Col4a3-/-OPN-/- mice as compared to Col4a3-/- mice (Fig.2D and Fig.2E). Interestingly, Galectin-3, whose expression correlates with end-stage renal dysfunction (ESRD), was found to be expressed two times higher in Col4a3-/- mice than WT and significantly decreased to control level in Col4a3-/-OPN+/- and Col4a3-/-OPN-/- mice (Fig.2F). Blood MCHC levels were decreased in Col4a3-/- mice (Fig.2G), suggesting anemia in the Alport mice, which was consistent with clinical reports that with onset of renal insufficiency, symptoms of chronic anemia may become evident as Alport disease progress. OPN deficiency significantly improved MCHC levels in Alport mice. Blood pressure was recorded using CODA mouse tail-cuff system (Kent Scientific). Col4a3-/- mice develop significantly higher blood pressures relative to WT mice (Kevan et al.2016; submitted manuscript), but hypertension was markedly reduced in Col4a3-/-OPN-/- and Col4a3-/- OPN+/- mice (Fig.2H). Furthermore, since Alport patients have 1000x more risk of cardiovascular disease, cardiac function was analyzed by echocardiography, and OPN deficiency was found to reverse cardiac systolic and diastolic dysfunction (Fig.3A and Fig.3B).
[0084] Cardiac hypertrophy and fibrosis are rescued by OPN deficiency in Col4a3-/- Mice. Echocardiography data demonstrated cardiac hypertrophy in Col4a3-/- mice, as reflected by increased thickness of intraventricular septum diastole (Figure 4A). Furthermore, quantification of WGA images of cardiac myocyte cross-sectional area acquired showed significant increase in myocyte area in Col4a3-/- hearts (Figure 4B), supporting the hypertrophic phenotype (n=3 mice per group and 12 images per mouse). However, Col4a3-/- mice on hetero-or homozygote OPN KO background show normal myocardial wall thickness and cardiomyocyte area (Figure 4A- 4C). In addition, OPN deficiency lowered fibrosis in Col4a3-/- mice as shown by decreasing interstitial“activated” fibroblasts as shown by electron microscopy (Figure 5A). Furthermore, microscopy and quantification data of EdU positive MLC2 negative interstitial cells showed reduction of fibrotic activity in the double knockout hearts (Figure 5B) (n=3 mice per group and 12 images per mouse). Additionally, elevated plasma levels of Galectin-3, a marker of diastolic dysfunction, in Col4a3-/- mice were also decreased by OPN deficiency (Figure 5C). [0085] In order to study the mechanism by which OPN reduces cardiac systolic and diastolic function in Alport animals, global gene microarray studies were performed using heart samples from WT, Col4a3-/- and Col4a3-/-OPN-/- mice. Two genes were found to be upregulated in Alport relative to WT kidneys, and then normalized by OPN deficiency (Table 1).
Figure imgf000029_0001
Figure imgf000030_0001
[0086] In one aspect, the OPN inhibitor is administered in an amount effective to alter gene/transcript expression (e.g., as measured in the heart), for example, to decrease expression of the Snora75 and/or LOC100302567 gene(s) and/or increase expression of one or more genes selected from Syne1, Ogdhl, Myh11, Scd4, Aqp7, Slc17a7, Rps13, Hbb-b1|Hbb-b2|Beta-s, Il15, Cnn1, and Alas2|Apex2.
[0087] It was also found that 14 genes showed significant difference in exonic expression (e.g., alternative splicing of exons) in the Col4a3-/- hearts, but the splicing events were normalized in the Col4a3-/- OPN-/- mice (Table 2). The data suggest that OPN deficiency may treat cardiac dysfunction via the identified gene/transcript targets listed in Tables 1 and 2.
Figure imgf000030_0002
[0088] In one aspect, the OPN inhibitor is administered in an amount effective to normalize splicing events (e.g., as measured in the heart) relative to wild-type, for example, for one or more genes selected from Dhx36, Zfp106, Dst, Fubp1, Elf2, Btbd1, Lrrc2, Abcd3, Ctsa, Fyco1, Abhd6, Serpinh1, Fgd4, and Ttn.
[0089] OPN deficiency reduces fibrotic cell proliferation and reduces kidney pathology in in Col4a3-/- kidney. Kidney Injury Molecule-1 (KIM-1) is a type 1 transmembrane protein whose expression is markedly up-regulated in the proximal tubules in acute tubular necrosis in rats and human patients (Han et al. Kidney Int.2002;62:237-244) and Alport mice. KIM-1 was found dramatically increased in Alport mice compared to WT and significantly decreased to control level in Col4a3-/-OPN-/- mice (Fig.6B). Because Kim-1 is capable to promote renal fibrosis (Humphreys et al. J Clin Invest.2013;123:4023-4035), decreased Kim-1 in Col4a3-/-OPN-/- mice indicated an anti-fibrotic effect of OPN deficiency in Alport mice. To understand the impact of OPN knock-out on fibrotic cell proliferation, EdU, a thymidine analogue that incorporates into newly synthesized DNA, was injected intraperitoneally into WT, Col4a3-/- and Col4a3-/-OPN-/- mice at a 100µg per 100uL concentration daily. Animals were sacrificed after a total of 30 injections. EdU incorporation was visualized by EdU fluorescent staining on paraffin kidney sections. To eliminate glomeruli, the kidney tissues were co-stained with Synaptopodin, a marker of glomeruli. The majority of EdU was present in tubules and interstitial space. In Col4a3-/- mice, extensive EdU incorporation was observed outside the glomeruli while WT and Col4a3-/- OPN-/- mice had almost undetectable level of EdU (Fig.6A). Electron microscopy showed thickened basement membrane and podocytes effacement in the Col4a3-/- mice as other groups have reported (Gomez et al. J Clin Invest.2015;125:141-156; Cosgrove et al. Genes Dev.
1996;10:2981-2992) (Fig.6E). In Col4a3-/-OPN-/- mice, structure of basement membrane and morphology of podocytes were much improved relative to the Alport mice (Fig.6E). These data demonstrate that OPN expression in the injured Alport tubules correlated with high fibrotic cell proliferation. In order to study the mechanism by which OPN reduces fibrotic cell proliferation in Alport animals, global gene microarray studies were performed using kidney samples from WT, Col4a3-/- and Col4a3-/-OPN-/- mice. Eleven genes were found to be upregulated in Alport relative to WT kidneys, and then normalized by OPN deficiency (Table 3). The data suggest that OPN deficiency may treat kidney dysfunction via the identified gene/transcript targets listed in Table 3.
Figure imgf000031_0001
Figure imgf000032_0001
[0090] In one aspect, the OPN inhibitor is administered in an amount effective to alter gene/transcript expression (e.g., as measured in the kidney), for example, to decrease expression of one or more genes selected from Dnm3, Mir24-1|Mir3074-1, B930095G15Rik,
4933409K07Rik|Gm3893, 4933409K07Rik|Gm3893, 9530091C08Rik, and Gm20038.
[0091] Interestingly, Dynamin3 (Dnm3) was found to be significantly downregulated in Col4a3-/-OPN-/- versus Col4a3-/- mice (Table 3). To validate the expression pattern of Dnm3, immunohistochemistry was performed on kidney sections and found that Dnm3 was highly expressed in the proximal tubules of Col4a3-/- mice and then normalized in the OPN deficient Alport mice (Fig.6C). To further validate kidney expression of Dnm3, western blot on the kidneys was performed and found Dnm3 expression was significantly upregulated in Col4a3-/- mice compared to WT, and significantly downregulated in Col4a3-/-OPN-/- mice.
[0092] Because DNM3 dysregulation in the tubules may have an effect on lipid accumulation in the tubules, Oil Red was used to stain for lipids in frozen kidney sections collected from the three genotypes. Impressively, extensive lipid deposition in the renal tubules was found in the Col4a3-/- mice relative to wild type mice, but was significantly reduced in the Col4a3-/-OPN-/- mice (Fig.6D). [0093] OPN deficiency improves high frequency hearing threshold and reduces cochlear pathology in Col4a3-/- mice. Otopathology of Alport syndrome is characterized by high frequency sensorineural hearing loss. In order to examine the effects of OPN deficiency on hearing ability of Alport mice, animals were recorded responding to a series of clicks and pure tones stimuli through auditory brainstem response (ABR) test. No differences were observed across genotypes in response to pure tones stimuli and 4, 8, 16 KHZ clicks stimuli. However, Col4a3-/- animals showed retarded responses to 16KHZ stimuli and Col4a3-/-OPN-/+ and Col4a3- /-OPN-/- mice had significantly improved hearing ability to Alport animals (Fig.7A). Previous studies have shown thickened capillary basement membrane in stria vascularies of Col4a3-/- cochlea (Cosgrove et al. Hear Res.1998;121:84-98). The EM studies showed that OPN deficiency reduced the thickening of capillary basement membrane of Alport cochleas (Fig.7B).
[0094] OPN deficiency reduces corneal pathology in Col4a3-/- mice. Alport patients may develop the eye abnormality lenticonus. Optical coherence tomography (OCT) studies were performed to visualize cornea structures in the Alport mice with or without OPN. The central cornea thickness (CCC) was analyzed and a difference among groups was not observed (Fig. 8A), suggesting Alport animals do not have pathology changes in cornea thickness. The anterior chamber depth (ACD)– distance from cornea to lens, and anterior chamber angle -- angle between cornea and iris, was analyzed, and both were significantly reduced in Col4a3-/- mice, but were rescued to control level in Col4a3-/-OPN-/- mice (Fig.8A). In addition, EM revealed that the thickening of the capillaries in the Alport retinal basement membrane was reduced by OPN deficiency. The data supported a tendency of lenticonus in Col4a3-/- mice that phenocopies symptoms of human Alport patients (Mahajan et al. International Journal of Scientific Study. 2013;01:4).
[0095] The foregoing Results are also observed in human kidney tubular cells and podocytes treated with an OPN inhibitor and Alport mice administered an OPN inhibitor, such as an OPN RNA aptamer, an OPN antibody, or an OPN small molecule inhibitor.
[0096] The foregoing Example demonstrates that reduction of OPN can improve lifespan, kidney function, cardiac function, renal and cochlear histology, eye deformities, and hearing ability in Alport subjects, demonstrating inhibition of OPN as a therapeutic target for Alport Syndrome. [0097] All publications, patents and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference. Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art in light of the teachings of this disclosure that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.

Claims

WHAT IS CLAIMED: 1. A method of treating a Col4-related disease in a patient in need thereof comprising administering a therapeutically effective amount of an osteopontin inhibitor to the subject.
2. The method of claim 1, comprising administering the osteopontin inhibitor in an amount effective to decrease the blood pressure of the subject.
3. The method of claim 1 or 2, comprising administering the osteopontin inhibitor in an amount effective to increase the mean corpuscular hemoglobin concentration (MCHC) in the blood of the subject.
4. The method of claim 1 or 2, comprising administering the osteopontin inhibitor in an amount effective to improve cardiac systolic/or and diastolic function in the heart of the subject.
5. The method of claim 1 or 2, comprising administering the osteopontin inhibitor in an amount effective to decrease a marker of renal dysfunction in the subject, optionally a marker selected from plasma kidney injury molecule-1 (KIM-1), plasma blood urea nitrogen (BUN), plasma creatinine (CRE), renal Dynamin3 (Dnm3), plasma Galectin-3 (Gal-3), and a combination of any of the foregoing.
6. The method of claim 1 or 2, comprising administering the osteopontin inhibitor in an amount effective to decrease the urine albumin/creatinine ratio of the subject.
7. The method of claim 1 or 2, comprising administering the osteopontin inhibitor in an amount effective to decrease the thickness of the basement membrane in the kidney, retina, and/or cochlea of the subject.
8. The method of claim 1 or 2, comprising administering the osteopontin inhibitor in an amount effective to treat or prevent hearing loss in the subject.
9. The method of claim 1 or 2, comprising administering the osteopontin inhibitor in an amount effective to treat or prevent loss of vision.
10. The method of claim 1 or 2, comprising administering the osteopontin inhibitor in an amount effective to increase the anterior chamber depth and/or the anterior chamber angle in the eye of the subject.
11. A method of improving cardiac function in a subject in need thereof comprising administering an osteopontin inhibitor in an amount effective to lower blood pressure, increase the mean corpuscular hemoglobin concentration (MCHC) in the blood, decrease myocardial fibrosis, increase stroke volume, increase cardiac output, decrease isovolumetric relaxation time, decrease interventricular wall thickness, decrease myocyte hypertrophy, or a combination of any of the foregoing, in the subject.
12. A method of improving kidney function in a subject in need thereof comprising administering an osteopontin inhibitor in an amount effective to decrease the urine
albumin/creatinine (ALB/CRE) ratio, decrease the thickness of a glomerulus basement membrane, decrease fibrotic cell proliferation and/or fibrosis, decrease renal lipid accumulation, decrease one or more of plasma kidney injury molecule-1 (KIM-1), plasma blood urea nitrogen (BUN), plasma creatinine (CRE), renal Dynamin3 (Dnm3), and plasma Galectin-3 (Gal-3), or a combination of any of the foregoing, in the subject.
13. A method of treating hearing loss in a subject in need thereof, comprising administering an osteopontin inhibitor in an amount effective to improve or maintain hearing and/or decrease the thickness of the capillary basement membrane in the cochlea, in the subject.
14. A method of treating loss of vision in a subject in need thereof, comprising administering an osteopontin inhibitor in an amount effective to improve or maintain vision, treat or prevent a lenticonus, increase the anterior chamber depth in the eye, increase the anterior chamber angle in the eye, decrease the thickness of the capillary basement membrane in the retina, or a combination of any of the foregoing, in the subject.
15. The method of any one of claims 1 and 11-14, wherein the subject has Alport Syndrome.
16. The method of any one of claims 1 and 11-14, wherein the osteopontin inhibitor is selected from an antibody, an aptamer, a small interfering RNA, an antisense oligonucleotide, a regulatory nucleic acid, a small molecule inhibitor, and combinations thereof.
17. The method of any one of claims 1 and 11-14, comprising administering the osteopontin inhibitor subcutaneously or intravenously.
18. The method of any one of claims 1 and 11-14, comprising administering the osteopontin inhibitor locally to the eye or ear of the subject.
19. The method of claim 18, comprising administering the osteopontin inhibitor intravitreally and/or intratympanically.
20. The method of any one of claims 1 and 11-14, comprising administering the osteopontin inhibitor at least once a day.
21. The method of any one of claims 1 and 11-14, comprising administering the osteopontin inhibitor in a dosage of between about 0.1 mg and about 50 mg. 22. The method of any one of claims 1 and 11-14, comprising administering the osteopontin inhibitor in an amount effective to: (a) decrease expression of the Snora75 and/or LOC100302567 gene(s) in the heart; (b) increase expression of one or more genes in the heart selected from Syne1, Ogdhl, Myh11, Scd4, Aqp7, Slc17a7, Rps13, Hbb-b1|Hbb-b2|Beta-s, Il15, Cnn1, and Alas2|Apex2; (c) decrease expression of one or more genes in the kidney selected from Dnm3, Mir24-1|Mir3074-1, B930095G15Rik, 4933409K07Rik|Gm3893,
4933409K07Rik|Gm3893, 9530091C08Rik, and Gm20038; and/or (d) normalize the splicing events relative to wild-type in one or more genes selected from Dhx36, Zfp106, Dst, Fubp1, Elf2, Btbd1, Lrrc2, Abcd3, Ctsa, Fyco1, Abhd6, Serpinh1, Fgd4, and Ttn.
22. Use of an osteopontin inhibitor in the manufacture of a medicament for treating a Col4-related disease in a patient in need thereof.
23. The use of claim 22, wherein the osteopontin inhibitor is in an amount effective to decrease the blood pressure of the subject.
24. The use of claim 22 or 23, wherein the osteopontin inhibitor is in an amount effective to increase the mean corpuscular hemoglobin concentration (MCHC) in the blood of the subject.
25. The use of claim 22 or 23, wherein the osteopontin inhibitor is in an amount effective to improve cardiac systolic/or and diastolic function in the heart of the subject.
26. The use of claim 22 or 23, wherein the osteopontin inhibitor is in an amount effective to decrease a marker of renal dysfunction in the subject, optionally a marker selected from plasma kidney injury molecule-1 (KIM-1), plasma blood urea nitrogen (BUN), plasma creatinine (CRE), renal Dynamin3 (Dnm3), plasma Galectin-3 (Gal-3), and a combination of any of the foregoing.
27. The use of claim 22 or 23, wherein the osteopontin inhibitor is in an amount effective to decrease the urine albumin/creatinine ratio of the subject.
28. The use of claim 22 or 23, wherein the osteopontin inhibitor is in an amount effective to decrease the thickness of the basement membrane in the kidney, retina, and/or cochlea of the subject.
29. The use of claim 22 or 23, wherein the osteopontin inhibitor is in an amount effective to treat or prevent hearing loss in the subject.
30. The use of claim 22 or 23, wherein the osteopontin inhibitor is in an amount effective to treat or prevent loss of vision.
31. The use of claim 22 or 23, wherein the osteopontin inhibitor is in an amount effective to increase the anterior chamber depth and/or the anterior chamber angle in the eye of the subject.
32. Use of an osteopontin inhibitor in the manufacture of a medicament for improving cardiac function in a subject in need thereof comprising the osteopontin inhibitor in an amount effective to lower blood pressure, increase the mean corpuscular hemoglobin concentration (MCHC) in the blood, decrease myocardial fibrosis, increase stroke volume, increase cardiac output, decrease isovolumetric relaxation time, decrease interventricular wall thickness, decrease myocyte hypertrophy, or a combination of any of the foregoing, in the subject.
33. Use of an osteopontin inhibitor in the manufacture of a medicament for improving kidney function in a subject in need thereof comprising the osteopontin inhibitor in an amount effective to decrease the urine albumin/creatinine (ALB/CRE) ratio, decrease the thickness of a glomerulus basement membrane, decrease fibrotic cell proliferation and/or fibrosis, decrease renal lipid accumulation, decrease one or more of plasma kidney injury molecule-1 (KIM-1), plasma blood urea nitrogen (BUN), plasma creatinine (CRE), renal Dynamin3 (Dnm3), and plasma Galectin-3 (Gal-3), or a combination of any of the foregoing, in the subject.
34. Use of an osteopontin inhibitor in the manufacture of a medicament for treating hearing loss in a subject in need thereof, comprising the osteopontin inhibitor in an amount effective to improve or maintain hearing and/or decrease the thickness of the capillary basement membrane in the cochlea, in the subject.
35. Use of an osteopontin inhibitor in the manufacture of a medicament for treating loss of vision in a subject in need thereof, comprising the osteopontin inhibitor in an amount effective to improve or maintain vision, treat or prevent a lenticonus, increase the anterior chamber depth in the eye, increase the anterior chamber angle in the eye, decrease the thickness of the capillary basement membrane in the retina, or a combination of any of the foregoing, in the subject.
36. The use of any one of claims 22 and 32-35, wherein the subject has Alport Syndrome.
37. The use of any one of claims 22 and 32-35, wherein the osteopontin inhibitor is selected from an antibody, an aptamer, a small interfering RNA, an antisense oligonucleotide, a regulatory nucleic acid, a small molecule inhibitor, and combinations thereof.
38. The use of any one of claims 22 and 32-35, wherein the osteopontin inhibitor is administered subcutaneously or intravenously.
39. The use of any one of claims 22 and 32-35, wherein the osteopontin inhibitor is administered locally to the eye or ear of the subject.
40. The use of any one of claims 22 and 32-35, wherein the osteopontin inhibitor is administered intravitreally and/or intratympanically.
41. The use of any one of claims 22 and 32-35, wherein the osteopontin inhibitor is administered at least once a day.
42. The use of any one of claims 22 and 32-35, wherein the osteopontin inhibitor is administered in a dosage of between about 0.1 mg and about 50 mg.
43. The use of any one of claims 22 and 32-35, wherein the osteopontin inhibitor is administered in an amount effective to: (a) decrease expression of the Snora75 and/or LOC100302567 gene(s) in the heart; (b) increase expression of one or more genes in the heart selected from Syne1, Ogdhl, Myh11, Scd4, Aqp7, Slc17a7, Rps13, Hbb-b1|Hbb-b2|Beta-s, Il15, Cnn1, and Alas2|Apex2; (c) decrease expression of one or more genes in the kidney selected from Dnm3, Mir24-1|Mir3074-1, B930095G15Rik, 4933409K07Rik|Gm3893,
4933409K07Rik|Gm3893, 9530091C08Rik, and Gm20038; and/or (d) normalize the splicing events relative to wild-type in one or more genes selected from Dhx36, Zfp106, Dst, Fubp1, Elf2, Btbd1, Lrrc2, Abcd3, Ctsa, Fyco1, Abhd6, Serpinh1, Fgd4, and Ttn.
PCT/US2017/045536 2016-08-04 2017-08-04 Methods of treating alport syndrome Ceased WO2018027149A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201662371064P 2016-08-04 2016-08-04
US62/371,064 2016-08-04

Publications (1)

Publication Number Publication Date
WO2018027149A1 true WO2018027149A1 (en) 2018-02-08

Family

ID=61073074

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/045536 Ceased WO2018027149A1 (en) 2016-08-04 2017-08-04 Methods of treating alport syndrome

Country Status (1)

Country Link
WO (1) WO2018027149A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111388674A (en) * 2020-03-30 2020-07-10 四川省人民医院 Application of RPS7 and SRP14 genes in the treatment of renal insufficiency or renal injury

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6458590B1 (en) * 1997-08-07 2002-10-01 The United States Of America, As Represented By The Department Of Health And Human Services Methods and compositions for treatment of restenosis
US20040037806A1 (en) * 2002-01-25 2004-02-26 Pharmacia Corporation Aldosterone blocker therapy to prevent or treat inflammation-related disorders
US20050147602A1 (en) * 2000-10-19 2005-07-07 Maine Medical Center Research Institute Compositions, methods and kits relating to CTHRC1, a novel modulator of collagen matrix
WO2009023411A1 (en) * 2007-08-09 2009-02-19 Bausch & Lomb Incorporated Compositions and methods for treating or controlling anterior- and posterior-segment ophthalmic diseases
US20120289604A1 (en) * 2009-07-16 2012-11-15 Pathologica Llc Pharmaceutical for oral delivery comprising mgbg and methods of treating disease
US20120288507A1 (en) * 2009-12-18 2012-11-15 Amgen Inc. Wise binding agents and epitopes
US20140140922A1 (en) * 2009-06-08 2014-05-22 Quark Pharmaceuticals, Inc. Methods for treating chronic kidney disease
US20150329866A1 (en) * 2006-10-25 2015-11-19 Quark Pharmaceuticals, Inc. NOVEL siRNAS AND METHODS OF USE THEREOF

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6458590B1 (en) * 1997-08-07 2002-10-01 The United States Of America, As Represented By The Department Of Health And Human Services Methods and compositions for treatment of restenosis
US20050147602A1 (en) * 2000-10-19 2005-07-07 Maine Medical Center Research Institute Compositions, methods and kits relating to CTHRC1, a novel modulator of collagen matrix
US20040037806A1 (en) * 2002-01-25 2004-02-26 Pharmacia Corporation Aldosterone blocker therapy to prevent or treat inflammation-related disorders
US20150329866A1 (en) * 2006-10-25 2015-11-19 Quark Pharmaceuticals, Inc. NOVEL siRNAS AND METHODS OF USE THEREOF
WO2009023411A1 (en) * 2007-08-09 2009-02-19 Bausch & Lomb Incorporated Compositions and methods for treating or controlling anterior- and posterior-segment ophthalmic diseases
US20140140922A1 (en) * 2009-06-08 2014-05-22 Quark Pharmaceuticals, Inc. Methods for treating chronic kidney disease
US20120289604A1 (en) * 2009-07-16 2012-11-15 Pathologica Llc Pharmaceutical for oral delivery comprising mgbg and methods of treating disease
US20120288507A1 (en) * 2009-12-18 2012-11-15 Amgen Inc. Wise binding agents and epitopes

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
KIM ET AL.: "Patterns of Gene Expression Associated with Pten Deficiency in the Developing Inner Ear", PLOS ONE, vol. 9, no. 6, 3 June 2014 (2014-06-03), pages 1 - 8, XP055461607 *
PEI ET AL.: "Osteopontin deficiency reduces kidney damage from hypercholesterolemia in Apolipoprotein E-deficient mice", SCIENTIFIC REPORTS, vol. 6, no. 28882, 29 June 2016 (2016-06-29), pages 1 - 12, XP055461604 *
XIE ET AL.: "Expression, roles, receptors, and regulation of osteopontin in the kidney", KIDNEY INT, vol. 60, no. 5, 1 November 2001 (2001-11-01), pages 1645 - 1657, XP055461603 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111388674A (en) * 2020-03-30 2020-07-10 四川省人民医院 Application of RPS7 and SRP14 genes in the treatment of renal insufficiency or renal injury

Similar Documents

Publication Publication Date Title
US10966962B2 (en) Method for treating neurodegenerative diseases
JP2018203747A5 (en)
JP2018203747A (en) Method of using cyclodextrin
JP2021152032A (en) Treatment of protein aggregation myopathic and neurodegenerative diseases by parenteral administration of trehalose
Xiaohong et al. CFLAR is a critical regulator of cerebral ischaemia-reperfusion injury through regulating inflammation and endoplasmic reticulum (ER) stress
CN118477076A (en) Methods for treating PIK3CA-associated overgrowth syndrome
EP3013425B1 (en) Leukotoxin for use in the treatment of ocular disease
Sun et al. Long-term and potent IOP-lowering effect of IκBα-siRNA in a nonhuman primate model of chronic ocular hypertension
JP2005314381A (en) Prophylactic/therapeutic/ameliorating agent for proliferative nephropathy
Song et al. Targeting a key pro-fibrotic factor S100A4 in cartilage to alleviate osteoarthritis progression and pain
WO2012006585A2 (en) Use of interleukin-15 to treat cardiovascular diseases
US20230193276A1 (en) Composition of drug targets and method of using thereof
EP2326328B1 (en) Use of dihydralazine for the treatment of diseases related to elevated semicarbazide sensitive amine-oxidase (ssao) activity
WO2018027149A1 (en) Methods of treating alport syndrome
WO2015181427A1 (en) Socs1-derived peptide for use in chronic complications relating to diabetes
US20060276385A1 (en) Anti-inflammatory agents and methods of their use
RU2653766C2 (en) Kirna and their use in the methods and compositions for treatment and/or prevention of eye diseases
CN109529019B (en) Application of human milk fat globule epidermal growth factor 8 in the preparation of drugs for the prevention/treatment of severe acute pancreatitis
JP2012502007A (en) Treatment of scleroderma
WO2007056510A2 (en) Chloride transport upregulation for the treatment of traumatic brain injury
Cao et al. Anti-Angiogenic and Anti-Scarring Dual Effect of Galectin-3 Inhibition in Mouse Models of Corneal Wound Healing
US8080579B2 (en) Compositions and methods for treatment of inflammatory bowel disease
EP3958971A1 (en) Pcsk9 inhibitors for neuropathy
US20260014132A1 (en) Protease activated receptor 2 (par2) inhibitor and its uses
CN111317811A (en) Use of short peptides for treating or preventing hypertension and related diseases

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17837774

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17837774

Country of ref document: EP

Kind code of ref document: A1