WO2018022982A1 - Age-associated clonal hematopoiesis accelerates cardio-metabolic disease development - Google Patents

Age-associated clonal hematopoiesis accelerates cardio-metabolic disease development Download PDF

Info

Publication number
WO2018022982A1
WO2018022982A1 PCT/US2017/044350 US2017044350W WO2018022982A1 WO 2018022982 A1 WO2018022982 A1 WO 2018022982A1 US 2017044350 W US2017044350 W US 2017044350W WO 2018022982 A1 WO2018022982 A1 WO 2018022982A1
Authority
WO
WIPO (PCT)
Prior art keywords
tet2
mutation
inhibitor
seq
mediated
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2017/044350
Other languages
French (fr)
Inventor
Kenneth Walsh
Jose FUSTER
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Boston University
Original Assignee
Boston University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Boston University filed Critical Boston University
Publication of WO2018022982A1 publication Critical patent/WO2018022982A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • C12N5/0647Haematopoietic stem cells; Uncommitted or multipotent progenitors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/24Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
    • C07K16/244Interleukins [IL]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K2035/124Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells the cells being hematopoietic, bone marrow derived or blood cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/54F(ab')2
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/55Fab or Fab'
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • C12N2310/141MicroRNAs, miRNAs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Definitions

  • the technical field relates to compositions, methods, and assays for the treatment, prevention and diagnosis of cardio-metabolic diseases, chronic kidney disease, and other age-dependent chronic diseases that involve pathological inflammatory responses.
  • CVD cardiovascular disease
  • the present invention is directed, in part, to a new paradigm of causal risk for cardiovascular and related diseases and provides novel compositions, methods, and assays for treating, preventing, and/or diagnosing the same.
  • Epidemiological studies show that hematopoietic stem cells (HSCs) develop mutations that promote their clonal expansion at a relatively high frequency in the aging population. While very few of the HSCs acquire subsequent mutations in oncogenes that lead to blood cancers, the mechanistic findings of the studies described herein, using Tet2 as an example, show that a single mutation that occurs frequently can predispose an individual to CVD and stroke that are common in the elderly (>50% of individuals).
  • HSCs hematopoietic stem cells
  • IL-lbeta blockade or NLRP3 inflammasome inhibition can be particularly effective for the prevention/treatment of CVD in individuals carrying somatic mutations in TET2.
  • other clonal hematopoiesis driver gene mutations mediate IL- ⁇ pro-inflammatory diseases as well.
  • Tet2-/- macrophages exhibited a pronounced increase in proinflammatory cytokine/chemokine expression, particularly of IL- ⁇ .
  • Tet2 deficiency also enhanced NLRP3 inflammasome priming and IL-1 receptor 1 expression, supporting a predominant role for increased IL- ⁇ signaling in the exacerbated atherosclerosis associated with Tet2 -deficient cell expansion.
  • a TET2 mutation-mediated IL- ⁇ proinflammatory disease comprising administering a therapeutically effective amount of a pharmaceutical composition comprising an inhibitor of TET2 mutation-mediated IL- ⁇ (interleukin- ⁇ ) proinflammatory activity and a pharmaceutically acceptable carrier to a subject having one or more TET2 somatic mutations in a sub-population of peripheral blood hematopoietic cells.
  • a pharmaceutical composition comprising an inhibitor of TET2 mutation-mediated IL- ⁇ (interleukin- ⁇ ) proinflammatory activity and a pharmaceutically acceptable carrier to a subject having one or more TET2 somatic mutations in a sub-population of peripheral blood hematopoietic cells.
  • the one or more TET2 somatic mutations in the sub-population of peripheral blood hematopoietic cells cause clonal hematopoiesis in the subject.
  • At least 2% of the peripheral blood hematopoietic cells have the one or more TET2 mutations.
  • the one or more TET2 somatic mutations are selected from an S282F mutation in SEQ ID NO: 3, an N312S mutation in SEQ ID NO: 3, an L346P mutation in SEQ ID NO: 3, an S460F mutation in SEQ ID NO: 3, a D666G mutation in SEQ ID NO: 3, a P941S mutation in SEQ ID NO: 3, and a CI 135Y mutation in SEQ ID NO: 3.
  • the inhibitor of TET2 mutation-mediated IL- ⁇ proinflammatory activity is an IL- ⁇ inhibitor.
  • the IL- ⁇ inhibitor is an IL- ⁇ inhibitor antibody or antigen-binding fragment thereof that binds to IL- ⁇ and reduces IL- ⁇ binding to its receptor(s).
  • the IL- ⁇ inhibitor antibody or antigen-binding fragment thereof is selected from ABT981, an anti-interleukin- 1 ⁇ inhibitor antibody by ABZYME, APX002, Canakinumab/Ilaris, CDP48, immunereszumab, LY2189102, MEDI8968, and XOMA052.
  • the IL- ⁇ inhibitor is an IL- 1 receptor antagonist.
  • the IL-1 receptor antagonist is selected from CDP484, CP412245, CYT013 ILlbQb, XL 130, AMG108, HL 2351, ILlHyl, AXXO, orthokine, PRT 1000, anakinra, and rilonacept.
  • the IL- ⁇ inhibitor is a small molecule or microRNA inhibitor that inhibits IL- ⁇ -mediated pro-inflammatory activity.
  • the small molecule inhibitor is selected from AC201, CP412245, MCC950 or CRID3, inflabion, inflammasome modulator OPSONA, PGE3935199, PGE527667, TRK530, ⁇ -hydroxybutyrate (BHB), and microRNA-223.
  • the small molecule inhibitor is MCC950.
  • the method further comprises monitoring hematopoietic cell clonality, IL- ⁇ proinflammatory activity, or a combination thereof following the administration of the inhibitor of TET2 mutation-mediated IL- ⁇ ⁇ proinflammatory activity.
  • the method further comprises decreasing the number or percentage of hematopoietic cells comprising the one or more TET2 mutations in the subject by performing therapeutic cytapheresis on the subject.
  • the method further comprises administering one or more additional therapeutic agents to the subject, in addition to the inhibitor of TET2 mutation-mediated IL- ⁇ ⁇ (interleukin- ⁇ ) proinflammatory activity.
  • the TET2 mutation-mediated IL- ⁇ proinflammatory disease is a cardiometabolic disease or disorder.
  • the TET2 mutation-mediated IL- ⁇ proinflammatory disease is a chronic kidney disease or disorder.
  • kits for treating a subject having, or at risk for, a TET2 mutation-mediated IL- ⁇ proinflammatory disease comprising: (a) sequencing a hematopoietic cell sample from a subject to identify one or more somatic mutations in TET2 in the hematopoietic cell sample; and (b) administering a therapeutically effective amount of a
  • composition comprising an inhibitor of TET2 mutation-mediated IL- ⁇ (interleukin- 1 ⁇ ) proinflammatory activity and a pharmaceutically acceptable carrier if one or more somatic mutations in TET2 are identified in the hematopoietic cell sample.
  • TET2 mutation-mediated IL- ⁇ interleukin- 1 ⁇
  • the hematopoietic cell sample is a peripheral blood hematopoietic cell sample.
  • the hematopoietic cell sample is enriched for myeloid-derived cells.
  • the one or more TET2 somatic mutations identified in the hematopoietic cell sample cause clonal hematopoiesis in the subject.
  • At least 2% of the hematopoietic cells are identified as having one or more TET2 mutations.
  • the one or more TET2 somatic mutations are selected from an S282F mutation in SEQ ID NO: 3, an N312S mutation in SEQ ID NO: 3, an L346P mutation in SEQ ID NO: 3, an S460F mutation in SEQ ID NO: 3, a D666G mutation in SEQ ID NO: 3, a P941 S mutation in SEQ ID NO: 3, and a C I 135Y mutation in SEQ ID NO: 3.
  • the inhibitor of TET2 mutation-mediated IL- ⁇ proinflammatory activity is an IL- ⁇ inhibitor.
  • the IL- ⁇ inhibitor is an IL- ⁇ inhibitor antibody or antigen-binding fragment thereof that binds to IL- ⁇ and reduces IL- ⁇ binding to its receptor(s).
  • the IL- ⁇ inhibitor antibody or antigen-binding fragment thereof is selected from ABT981, an anti-interleukin- 1 ⁇ inhibitor antibody by ABZYME, APX002, Canakinumab/Ilaris, CDP48, immunereszumab, LY2189102, MEDI8968, and XOMA052.
  • the IL- ⁇ inhibitor is an IL-1 receptor antagonist.
  • the IL-1 receptor antagonist is selected from CDP484, CP412245, CYT013 ILlbQb, XL 130, AMG108, HL 2351, ILlHyl, AXXO, orthokine, PRT 1000, anakinra, and rilonacept.
  • the IL- ⁇ inhibitor is a small molecule or microR A inhibitor that inhibits IL- ⁇ -mediated pro-inflammatory activity.
  • the small molecule or microRNA inhibitor is selected from AC201, CP412245, MCC950 or CRID3, inflabion, inflammasome modulator OPSONA, PGE3935199, PGE527667, TRK530, ⁇ -hydroxybutyrate (BHB), and microRNA-223.
  • the small molecule inhibitor is MCC950.
  • the method further comprises monitoring hematopoietic cell clonality, IL- ⁇ proinflammatory activity, or a combination thereof following the administration of the inhibitor of TET2 mutation-mediated IL- ⁇ proinflammatory activity.
  • the method further comprises decreasing the number or percentage of hematopoietic cells comprising the one or more TET2 mutations in the subject by performing therapeutic cytapheresis on the subject.
  • the method further comprises administering one or more additional therapeutic agents to the subject, in addition to the inhibitor of TET2 mutation-mediated IL- ⁇ proinflammatory activity.
  • the TET2 mutation-mediated IL- ⁇ proinflammatory disease is a cardiometabolic disease or disorder.
  • the TET2 mutation-mediated IL- ⁇ proinflammatory disease is a chronic kidney disease or disorder.
  • compositions comprising an inhibitor of TET2 mutation-mediated IL- ⁇ (interleukin- ⁇ ) proinflammatory activity and a pharmaceutically acceptable carrier for use in a subject having one or more TET2 somatic mutations in a sub-population of hematopoietic cells.
  • TET2 mutation-mediated IL- ⁇ interleukin- ⁇
  • a pharmaceutically acceptable carrier for use in a subject having one or more TET2 somatic mutations in a sub-population of hematopoietic cells.
  • the one or more TET2 somatic mutations in the sub-population of hematopoietic cells cause clonal hematopoiesis in the subject.
  • compositions and all such compositions described herein at least 2% of the hematopoietic cells in the subject have the one or more TET2 mutations.
  • the one or more TET2 somatic mutations are selected from an S282F mutation in SEQ ID NO: 3, an N312S mutation in SEQ ID NO: 3, an L346P mutation in SEQ ID NO: 3, an S460F mutation in SEQ ID NO: 3, a D666G mutation in SEQ ID NO: 3, a P941S mutation in SEQ ID NO: 3, and a CI 135Y mutation in SEQ ID NO: 3.
  • the inhibitor of TET2 mutation-mediated IL- ⁇ proinflammatory activity is an IL- ⁇ inhibitor.
  • IL- ⁇ inhibitor is an IL- ⁇ inhibitor antibody or antigen-binding fragment thereof that binds to IL- ⁇ and reduces IL- ⁇ binding to its receptor(s).
  • the IL- ⁇ inhibitor antibody or antigen-binding fragment thereof is selected from ABT981, an anti- interleukin- ⁇ inhibitor antibody by ABZYME, APX002, Canakinumab/Ilaris, CDP48,
  • the IL- ⁇ inhibitor is an IL-1 receptor antagonist.
  • IL-1 receptor antagonist is selected from CDP484, CP412245, CYT013 ILlbQb, XL 130, AMG108, HL 2351, ILlHyl, AXXO, orthokine, PRT 1000, anakinra, and rilonacept.
  • the IL- ⁇ inhibitor is a small molecule inhibitor that inhibits IL- ⁇ -mediated pro-inflammatory activity.
  • the small molecule inhibitor is selected from AC201, CP412245, MCC950 or CRID3, inflabion, inflammasome modulator OPSONA, PGE3935199, PGE527667, TRK530, ⁇ -hydroxybutyrate (BHB), and microRNA-223.
  • the small molecule inhibitor is MCC950.
  • the TET2 mutation-mediated IL- ⁇ proinflammatory disease is a cardiometabolic disease or disorder.
  • the TET2 mutation-mediated IL- ⁇ proinflammatory disease is chronic kidney disease or disorder. Definitions
  • an "inhibitor of TET2 mutation-mediated IL- ⁇ (interleukin- ⁇ ) proinflammatory activity” refers to any agent or molecule that significantly blocks, inhibits, reduces, or interferes with the downstream effects of somatic mutations in TET2 that lead to increased IL- ⁇ proinflammatory activity or signaling in vitro, in situ, and/or in vivo, including increased IL- ⁇ transcription, increased NLRP3 inflammasome-mediated IL- ⁇ secretion, and/or increased IL-1- receptor I (IL-lRl)-mediated IL- ⁇ signaling.
  • IL-lRl IL-1- receptor I
  • inhibit(s)/inhibiting/inhibited or decrease(s)/decreasing/decreased generally means either a reduction or inhibition of at least 5%, at least 10%, at least 25%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or more, compared to the level of IL- ⁇ transcription, IL- ⁇ translation, NLRP3 inflammasome-mediated IL- ⁇ secretion, and/or IL- ⁇ binding to IL-1 receptor and consequent IL-1 -receptor I (IL-lRl)-mediated IL- ⁇ signaling under the same conditions but without the presence of inhibitors of TET2 mutation-mediated IL- ⁇ proinflammatory activity described herein.
  • IL-lRl IL-1 -receptor I
  • a disease or medical condition is considered to be mediated by "IL- ⁇ (interleukin- ⁇ ) proinflammatory activity" if the spontaneous or experimental disease or medical condition is associated with, or mediated by, for example, elevated levels of IL- 1 ⁇ in bodily fluids or tissue, or if cells or tissues taken from the body produce elevated levels of IL-1 ⁇ in culture.
  • IL- ⁇ interleukin- ⁇ proinflammatory activity
  • cardiovascular condition, disease or disorder is intended to include all disorders characterized by insufficient, undesired or abnormal blood vessel or cardiac function, e.g. hypertension, ischemic heart disease, hypertensive heart disease and pulmonary hypertensive heart disease, valvular disease, cardiac arrhythmia, vascular disease, myocardial infarction, congestive heart failure, peripheral vascular disease, myocarditis, atherosclerosis, restenosis, and any condition which leads to congestive heart failure in a subject, particularly a human subject.
  • disorders characterized by insufficient, undesired or abnormal blood vessel or cardiac function e.g. hypertension, ischemic heart disease, hypertensive heart disease and pulmonary hypertensive heart disease, valvular disease, cardiac arrhythmia, vascular disease, myocardial infarction, congestive heart failure, peripheral vascular disease, myocarditis, atherosclerosis, restenosis, and any condition which leads to congestive heart failure in a subject, particularly a human subject
  • an "IL- ⁇ inhibitory compound” or “IL- ⁇ inhibitor” or “inhibitor of IL- 1 ⁇ ” refers to a compound or agent capable of specifically inhibiting or specifically preventing activation of cellular receptors to IL- ⁇ and consequent downstream effects of IL-1 ⁇ signaling.
  • antibodies or “antigen-binding fragments” thereof include monoclonal, human, humanized or chimeric antibodies, single chain antibodies, Fab fragments, F(ab') fragments, fragments produced by a Fab expression library, and/or binding fragments of any of the above.
  • Antibodies also refer to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e. , molecules that contain antigen or target binding sites or "antigen- binding fragments.”
  • the immunoglobulin molecules described herein can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g. , IgGl, IgG2, IgG3, IgG4, IgAl and IgA2) or subclass of immunoglobulin molecule, as is understood by one of skill in the art.
  • antibody fragment or "antigen-binding fragment” include: (i) the Fab fragment, having VL, CL, VH and CHI domains; (ii) the Fab' fragment, which is a Fab fragment having one or more cysteine residues at the C-terminus of the CHI domain; (iii) the Fd fragment having VH and CHI domains; (iv) the Fd' fragment having VH and CHI domains and one or more cysteine residues at the C-terminus of the CHI domain; (v) the Fv fragment having the VL and VH domains of a single arm of an antibody; (vi) a dAb fragment (Ward et al , Nature 341, 544-546 (1989)) which consists of a VH domain or a VL domain ; (vii) isolated CDR regions; (viii) F(ab') 2 fragments, a bivalent fragment including two Fab' fragments linked by a disulphide bridge at the hinge region;
  • an "interleukin-1 receptor antagonist” (“IL-lra”) is any agent or molecule, including small molecules and antibody or antigen-binding fragments thereof, that binds to an interleukin-1 receptor thereby preventing binding of IL- ⁇ to the receptor and thereby inhibiting IL-i -mediated pro-inflammatory activity.
  • small molecule inhibitors include, but are not limited to, small peptides or peptide-like molecules, soluble peptides, and synthetic non-peptidyl organic or inorganic compounds.
  • a small molecule inhibitor or antagonist can have a molecular weight of any of about 100 to about 20,000 daltons (Da), about 500 to about 15,000 Da, about 1000 to about 10,000 Da.
  • TET2 activating compound or "TET2 potentiator” or “TET2 activator” or “TET2 agonist” refer to a molecule or agent that mimics or up-regulates (e.g., increases, potentiates or supplements) the biological activity of TET2, thereby decreasing or inhibiting IL- ⁇ (interleukin-1 ⁇ ) proinflammatory activity caused by deficient TET2 activity.
  • TET2 potentiator or TET2 activator or “TET2 agonist” refer to a molecule or agent that mimics or up-regulates (e.g., increases, potentiates or supplements) the biological activity of TET2, thereby decreasing or inhibiting IL- ⁇ (interleukin-1 ⁇ ) proinflammatory activity caused by deficient TET2 activity.
  • IL- ⁇ interleukin-1 ⁇
  • biological sample refers to a cell or population of cells or a quantity of tissue or fluid from a subject comprising one or more hematopoietic cells. Most often, the biological sample has been removed from a subject, but the term “biological sample” can also refer to cells or tissue analyzed in vivo, i.e., without removal from the subject.
  • the term "population of hematopoietic cells” encompasses a
  • heterogeneous or homogeneous population of hematopoietic cells and/or hematopoietic progenitor cells are heterogeneous or homogeneous population of hematopoietic cells and/or hematopoietic progenitor cells.
  • isolated and “methods of isolation,” as used herein, refer to any process whereby a cell or population of cells, such as a population of hematopoietic cells, is removed from a subject or sample in which it was originally found, or a descendant of such a cell or cells.
  • FIGS. 1A-1G demonstrate expansion of Tet2-deficient cells after competitive bone marrow transplantation in LDLR-KO mice.
  • LDLR-KO mice were transplanted with bone marrow cell suspensions containing 10% CD45.2+ Tet2-/- cells (10% KO BMT) or 10% CD45.2+ Tet2+/+ cells (10% WT BMT) and 90% CD45.1+ Tet2+/+ cells.
  • IB Representative images of CD45.1/CD45.2 flow cytometry analysis of WBC populations.
  • 1C Representative images of CD45.1/CD45.2 flow cytometry analysis of WBC populations.
  • FIGS. 2A-2H demonstrate exacerbated atherosclerosis after Tet2 -deficient hematopoietic cell expansion.
  • 2A Body weight.
  • 2B Blood glucose levels.
  • 2C Insulin tolerance Test.
  • 2D Plasma cholesterol levels.
  • 2E Aortic root plaque size, average of five independent sections. Representative images of hematoxylin-eosin-stained sections are shown and atherosclerotic plaques are delineated by discontinuous lines.
  • 2F Plaque macrophage content, evaluated by immunohistochemical staining of the macrophage marker Mac3.
  • 2G Plaque macrophage content, evaluated by immunohistochemical staining of the macrophage marker Mac3.
  • CD45.2+ cells within the total immune cell (CD45+) population, F4/80+ macrophages and CD3+ T cells in the atherosclerotic aortic arch (n 4 pools of 2 aortic arches per genotype). 2H. Representative images of CD45.1/CD45.2 flow cytometry analysis of aortic macrophages and T cells. Statistical significance was evaluated by two-tailed unpaired Student t test (2A, 2D, 2E, 2F), regular 2-way ANOVA with Sidak multiple comparison tests (2B, 2G, ***p ⁇ 0.001) or repeated measures 2-way ANOVA (2C).
  • FIGS. 3A-3G demonstrate increased pro-inflammatory activation of Tet2-deficient macrophages.
  • 3A Heat map of genes with expression change greater than 1.5-fold (q-value ⁇ 0.05) from the genome-wide expression profiling by microarray.
  • 3B PANTHER analysis of genome-wide expression profiling by microarray.
  • 3C Heat map of selected genes upregulated in Tet2-/- macrophages with expression change greater than 1.5-fold (q-value ⁇ 0.05) from the genome-wide expression profiling by microarray.
  • 3D-3F qRT-PCR analysis of transcript levels of pro-inflammatory cytokines (3D), chemokines (3E) and COX2 (3F).
  • 3G ELISA analysis of IL-6 protein levels in the supernatant of cultured macrophages treated as indicated for 16 hours. Statistical significance in 3C-3F was evaluated by 2-way ANOVA (p value for genotype effect shown in graph) with Sidak multiple comparison tests (*p ⁇ 0.05, ** p ⁇ 0.01, *** p ⁇ 0.001).
  • FIGS. 4A-4K demonstrate enhanced NLRP3 inflammasome -mediated IL- ⁇ production and signaling in Tet2 -deficient macrophages.
  • FIGS. 5A-5B depict an exemplary research strategy to study the role of clonal hematopoiesis associated with Tet2 deficiency in atherosclerosis development in hyperlipidemic mice.
  • 5A Competitive bone marrow transplantation strategy.
  • 5B Timeline of bone marrow transplantation and hematological, metabolic and atherosclerosis studies.
  • FIGS. 6A-6E demonstrate effects of expansion of Tet2 -deficient hematopoietic cells on bone-marrow derived cell populations.
  • LDLR-KO mice were transplanted with bone marrow cell suspensions containing 10% CD45.2+ Tet2-/- cells (10% KO-BMT) or 10% CD45.2+ Tet2+/+ cells (10% WT-BMT) and 90% CD45.1+ Tet2+/+ cells.
  • 6A Representative images of the flow cytometry analysis of the purity of the CD45.2+ WBC fractions analyzed in FIG.1C. 6B.
  • FIG. 7 depicts an exemplary gating strategy for the flow cytometry analysis of immune cell populations in aortic arch samples (related to FIGS. 2G, 2H).
  • FIGS. 9A-9B demonstrate atherosclerotic plaque cell apoptosis and proliferation in the aortic root of HFD-fed 10% KO-BMT mice and WT controls.
  • 9A TU EL staining to detect apoptotic cells. An image representative of plaque cell apoptosis in 10% KO-BMT mice is shown and atherosclerotic plaque is delineated by discontinuous lines.
  • 9B Plaque cell proliferation, examined by immunofluore scent analysis of the proliferating cell-specific antigen Ki67 and the macrophage marker (CD68). Atherosclerotic plaques are delineated by discontinuous lines. An image representative of plaque cell proliferation in 10% KO-BMT mice is shown. Examples of proliferating (Ki67+) macrophages (Mac3+) are indicated by arrows.
  • FIGS. 10A-10D demonstrate effects of Tet2 deficiency on culture macrophage proliferation, apoptosis and oxLDL uptake.
  • 10A Cell-cycle progression analysis by propidium iodide staining and flow cytometry after synchronization of macrophages in GO-phase by 36 h of MCSF deprivation and subsequent re-stimulation with 15% L929-cell conditioned medium (LCM) as a source of MCSF.
  • LCM L929-cell conditioned medium
  • FIGS. 11A-11C demonstrate effects of Tet2 deficiency on the expression of proinflammatory cytokines/chemokines by cultured macrophages.
  • qRT-PCR was used to analyze the expression of pro-inflammatory cytokine/chemokine expression.
  • 12A-12B demonstrate effects of Tet2 deficiency on the expression of proinflammatory cytokines/chemokines by cultured macrophages in the presence of low doses of oxLDL, TNF and IFN- ⁇ .
  • Gene expression of selected pro-inflammatory cytokines (12A) or chemokines (12B) was analyzed by qRT-PCR.
  • FIGS. 13A-13B demonstrate effects of Tet2-deficient hematopoietic cell expansion on the expression of pro-inflammatory cytokines, chemokines and adhesion molecules in the
  • FIGS. 14A-14D demonstrate role of changes in histone acetylation in the increased expression of pro-inflammatory cytokines in Tet2-deficient macrophages.
  • TSA Trichostatin A
  • FIGS. 15A-15B demonstrate effects of Tet2-deficiency on the expression of
  • FIG. 16 depicts a schematic illustrating a common mechanistic basis between cancer and cardiometabolic disease, such as cardiovascular disease.
  • FIGS. 17A-17D demonstrate that clonal hematopoiesis associated with Tet2 deficiency promotes obesity-induced metabolic dysfunction. Mice were subjected to competitive bone marrow transplantation and fed a high fat/high sucrose (HFHS) diet for 12 weeks to induce obesity and associated metabolic dysfunction. 17A. Body weight. 17B. Fasting blood glucose levels. 17 .
  • HFHS high fat/high sucrose
  • FIG. 18 shows that the NLRP3 inflammasome is essential for the accelerated
  • Atherosclerosis associated with clonal expansion of Tet2 -deficient hematopoietic cells.
  • FIGS. 19A-19F show that hematopoietic Tet2-KO mice display worse post-infarction remodeling.
  • 19A Scheme of the experimental study. Mice underwent partial (10%) bone marrow reconstitution with Tet2 -deficient cells or WT cells following lethal irradiation. After 8 weeks of recovery, mice underwent permanent LAD ligation.
  • 19B Tet2-KO Bone marrow cells (CD45.2+) display a competitive advantage over wild type competitor cells (CD45.1+) in their ability to expand into multiple blood cell lineages in vivo. 19C.
  • Echocardiographic evaluation shows that mice with partial reconstitution of Tet2 -deficient cells display worsening cardiac remodeling after LAD ligation compared to mice receiving bone marrow from wild-type mice.
  • 19D Representative images of myocardial tissue sections stained with Masson-Trichrome dye at 4 weeks after ligation. Hearts were sliced sequentially from the ligation site to apex.
  • 19E Wheat germ agglutinin-staining of the heart sections from hearts isolated at 4 weeks after LAD ligation. Staining shows that the non-infarcted, remote area of the heart display greater hypertrophy of the cardiac myocytes. 19F.
  • qPCR analysis of the remote area showing IL-lbeta transcript is elevated in hearts from mice that received partial reconstitution with Tet2 -deficient bone marrow at 4 weeks after LAD ligation.
  • BMT bone marrow transplantation
  • LAD left anterior descending
  • WT wild-type
  • EF ejection fraction
  • LV left ventricle
  • WBC white blood cells.
  • FIGS. 20A-20F demonstrate that conditional myeloid Tet2-deficiency in mice leads to worse cardiac remodeling in hearts subjected to LAD ligation.
  • 20A Scheme of the study. Control and Tet2 -knockout (KO) mice underwent LAD ligation. Conditional Tet2-KO mice were constructed by crossing Tet2flox/flox mice with transgenic mice expressing ere recombinase from the LysM myeloid cell-specific promoter. 20B. The efficiency of Tet2 ablation was analyzed in peritoneal macrophages (pMACs) from the conditional Tet2-KO mice. 20C.
  • pMACs peritoneal macrophages
  • Echocardiographic evaluation shows that mice with conditional Tet2 ablation in myeloid cells display worsening cardiac remodeling after LAD ligation surgery compared to wild-type mice.
  • 20D Representative images of myocardial tissue sections stained with Masson-Trichrome dye at 4 weeks after LAD ligation surgery. Hearts were sliced sequentially from the ligation site to apex. e. qPCR analysis of IL-lbeta transcript in the remote area of the myocardium showing greater IL-lbeta up-regulation in conditional Tet2-KO mice relative to wild-type mice after LAD ligation surgery. 20F.
  • FIGS. 21A-21C show that inflammasome inhibition reverse the exacerbated postinfarction remodeling associated with hematopoietic Tet2-deficiency.
  • 21A Scheme of the experimental study. Mice underwent partial (10%) bone marrow reconstitution with Tet2 -deficient cells or WT cells following lethal irradiation. After 8 weeks of recovery, mice underwent permanent LAD ligation. PBS or MCC-950 infusion by osmotic pump was initiated 1 week after LAD ligation for 4 weeks. 21B.
  • Echocardiographic analysis of ejection fraction shows that treatment with the NLRP3 inflammasome inhibitor MCC950 protects against adverse cardiac remodeling in mice reconstituted with Tet2-KO and wild-type bone marrow, and eliminates the differences in cardiac parameters between Tet2-deficient and WT conditions at the 5 week time point post-LAD ligation. 21C. MCC950 inhibits the increase in cardiac myocyte hypertrophy after LAD ligation in mice reconstituted with Tet2-KO and wild-type bone marrow, and eliminates the differences in cell size between Tet2 -deficient and WT conditions.
  • FIG. 22A-22E show the inflammasome inhibitor MCC950 inhibits adverse cardiac remodeling in pressure overloaded hearts and eliminates differences in cardiac parameters between mice that are partially reconstituted with wild-type and Tet2-deficient bone marrow.
  • 22A Scheme of the experimental study. Mice underwent partial (10%) bone marrow reconstitution with Tet2-deficient cells or WT cells following lethal irradiation. After 8 weeks of recovery, mice underwent permanent TAC surgery to produce pressure overload on the heart. 22B.
  • HW heart weight
  • LW wet lung weight
  • TL tibia length
  • MCC950 eliminates the differences in the echocardiographic parameters between the Tet2 -deficient and WT conditions.
  • the MCC950 treatment eliminates the difference in this parameter between the Tet2 -deficient and WT conditions.
  • FIGS. 23A and 23B show that myeloid cell Tet2 -deficiency promotes renal fibrosis and macrophage infiltration in kidneys of angiotensin Il-treated mice. Both groups of mice were treated by infusion of angiotensin II (2mg/kg/day) for 4 weeks prior to harvest. Perivascular and interstitial fibrosis was evaluated by collagen deposition using Masson's trichrome staining on paraffin sections 23A. Macrophage infiltration 23B in kidneys was detected by a rat anti-Mac3 monoclonal antibody, followed by ImmPRESS TM HRP Anti-Rat IgG and DAB Substrate (Vector Laboratories).
  • Microscopy images were required on a Keyence BZ-9000 microscope and analyzed using Image J software. Representative images are shown.
  • FIGS. 24A-24D show that myeloid cell Tet2-deficiency promotes the expression of proinflammatory cytokines, fibrosis related cytokines and adhesion molecules in kidneys of angiotensin II-treated mice.
  • FIG. 25 shows the effects of Tet2 deficiency in myeloid cells on the structure and morphology of tubules in mice subjected to the unilateral ureteral obstruction (UUO) model of kidney failure. Tubular atrophy or dilation and inflammatory cells infiltration in kidneys of mice after UUO surgery were evaluated by H&E staining. Presentative images are shown. Microscopic images were acquired on a Keyence BZ-9000 microscope and analyzed using Image J software.
  • UUO unilateral ureteral obstruction
  • FIG. 26 demonstrates the effects of Tet2 deficiency in myeloid cells on renal tubular interstitial fibrosis in mice subjected to the unilateral ureteral obstruction (UUO) model of kidney failure. Fibrosis was evaluated by collagen deposition using Masson's trichrome staining of paraffin sections. Microscopic images were acquired on a Keyence BZ-9000 microscope and analyzed using Image J software.
  • UUO unilateral ureteral obstruction
  • experimental evidence mechanistically links clinically relevant somatic mutations in hematopoietic cells to cardiovascular disease (CVD), metabolic, renal, and other chronic diseases that have a large inflammatory component.
  • CVD cardiovascular disease
  • the experimental demonstrations described herein provide novel evidence of the causal contribution of a scenario of genome mosaicism in the hematopoietic system and subsequent clonal hematopoiesis to a non-hematological disorder.
  • Tet2 -deficient hematopoietic cells
  • Tet2 functions as a novel inhibitor of vascular inflammation in the setting of atherosclerosis, which provides the first demonstration of the role of Tet2 in chronic sterile inflammation (distinct from pathogen-induced inflammation); and
  • Tet2 inhibits pro-inflammatory IL- ⁇ ⁇ signaling at multiple levels, by modulating IL- ⁇ transcription, NLRP3 inflammasome- mediated IL- ⁇ secretion and IL-1 -Receptor 1 -mediated IL- ⁇ signaling. Accordingly, the studies described herein support a new paradigm of causal risk for cardiovascular diseases and other inflammation-mediated diseases.
  • HSCs Hematopoietic stem cells
  • HPCs hematopoietic progenitor cells
  • Compositions and Theranostic Methods for Treating IL- ⁇ Proinflammatory Activity are provided herein.
  • compositions comprising an inhibitor of TET2 mutation-mediated IL- ⁇ (interleukin- ⁇ ) proinflammatory activity and a pharmaceutically acceptable carrier for use in a subject having one or more TET2 somatic mutations in a sub-population of hematopoietic cells.
  • TET2 mutation-mediated IL- ⁇ interleukin- ⁇
  • a pharmaceutically acceptable carrier for use in a subject having one or more TET2 somatic mutations in a sub-population of hematopoietic cells.
  • kits for treating a subject having, or at risk for, a TET2 mutation-mediated IL- ⁇ proinflammatory disease comprising administering a therapeutically effective amount of a pharmaceutical composition comprising an inhibitor of TET2 mutation-mediated IL- ⁇ (interleukin- ⁇ ) proinflammatory activity and a pharmaceutically acceptable carrier to a subject having one or more TET2 somatic mutations in a sub-population of hematopoietic cells.
  • a pharmaceutical composition comprising an inhibitor of TET2 mutation-mediated IL- ⁇ (interleukin- ⁇ ) proinflammatory activity and a pharmaceutically acceptable carrier to a subject having one or more TET2 somatic mutations in a sub-population of hematopoietic cells.
  • Methods of cytosine dioxygenase TET2 or “TET2” is a member of the family of TET proteins, which have been shown to be responsible for conversion of 5 -methylcytosine (5mC) to 5- hydroxymethylcytosine (5hmC), as well as function in embryonic stem cell regulation, myelopoiesis, and zygote development (Dawlaty et al, 2011; Gu et al., 2011; Iqbal et al., 2011; Ito et al, 2010; Ko et al., 2010; Koh et al, 2011; Wossidlo et al., 2011).
  • TET2 is a dioxygenase that catalyzes the conversion of the modified genomic base 5-methylcytosine (5mC) into 5-hydroxymethylcytosine (5hmC) and plays a key role in active DNA demethylation.
  • TET2 has a preference for 5- hydroxymethylcytosine in CpG motifs, and has also been shown to mediate subsequent conversion of 5hmC into 5-formylcytosine (5fC), and conversion of 5fC to 5-carboxylcytosine (5caC).
  • Methylation at the C5 position of cytosine bases is an epigenetic modification of the mammalian genome which plays an important role in transcriptional regulation.
  • TET2 In addition to its role in DNA demethylation, TET2 has also been shown to be involved in the recruitment of the O-GlcNAc transferase OGT to CpG-rich transcription start sites of active genes, thereby promoting histone H2B GlcNAcylation by OGT. Similarly, TET2 has been reported to recruit histone deacetylases (HDACs) to specific gene promoters, contributing to histone deacetylation and gene repression (Zhang et al 2015).
  • HDACs histone deacetylases
  • TERT2 refers to the genomic sequence of NG_028191.1 (SEQ ID NO: 1) encoding: the mRNA sequence of NM_001127208.2 (isoform 1, SEQ ID NO: 2), which encodes the 2002 amino acid polypeptide having the amino acid sequence of NP_001120680.1 (isoform 1, SEQ ID NO: 3); the mRNA sequence of NM_017628.4 (isoform 2, SEQ ID NO: 4) encoding the 1165 amino acid polypeptide having the amino acid sequence of NP_060098.3 (isoform 2, SEQ ID NO: 5); together with any additional naturally occurring allelic, splice variants, and processed forms thereof.
  • TET2 refers to human TET2. Reference to specific sub-fragments or sub-sequences of TET2 can be identified in the application, e.g., by "nucleic acids 211-402 of TET2.” Specific nucleic acid or amino acid residues of TET2 can be referred to as, for example, "S282 of TET2" or “S282 of SEQ ID NO: 3.” [000102] A"somatic mutation,” as used herein, refers to a change in the genetic structure of a subject that is not inherited from a parent, and also not passed to offspring.
  • a somatic mutation is a genetic change that occurs in any cell after the first cell division, wherein the mutation is replicated in all cells that descend from the mutated cell.
  • the somatic cells that descend from the original mutated cell comprise a clonal variant within the body of the subject.
  • these mutations are present in cells of somatic origin and not present in the germline, they are often called a somatic cell mutation or an acquired mutation.
  • Somatic mutations will be present in only a subset of the cells contributing DNA to an analysis, since the mutant sequence will be present in fewer than 50% of the sequence reads arising from that genomic site.
  • somatic mutations are identified as when a specific sequence is measured as occurring at a fraction of total sequences that deviates significantly from the frequency expected for the far-larger number of inherited variants- namely around 0%, around 50% or around 100%.
  • Somatic mutations can occur in a sub-population of cells for example, such as a sub- population of hematopoietic cells.
  • Somatic mutations in TET2 relevant to the compositions and methods described herein include any nucleic acid or consequent amino acid somatic mutations in TET2, found in a subset of hematopoietic cells, leading to increased pro-inflammatory IL- ⁇ signaling, including increased IL- ⁇ transcription, increased NLRP3 inflammasome-mediated IL- ⁇ secretion, and/or increased IL-1 -Receptor 1 -mediated IL- ⁇ signaling.
  • Such somatic mutations in the TET2 gene can be disruptive, in that they have an observed or predicted effect on protein function, or non-disruptive.
  • non-disruptive mutation is typically a missense mutation, in which a codon is altered such that it codes for a different amino acid, but the encoded protein, i.e., TET2, is still expressed.
  • Somatic mutations in TET2 include, for example, frameshift mutations, nonsense mutations, missense mutations or splice-site variant mutations, as those terms are known to those of ordinary skill in the art.
  • one or more somatic mutations in TET2 in addition to leading to increased pro-inflammatory IL- ⁇ signaling, also result in clonal hematopoiesis.
  • clonal hematopoiesis refers to clonal outgrowth of a sub-population of hematopoietic cells having one or more somatic mutations in TET2.
  • TET2 mutations relevant to the compositions and methods described herein include any nucleic acid mutations in the genomic sequence of TET2 of SEQ ID NO: 1 leading to: an S460F mutation in SEQ ID NO: 3 ; a D666G mutation in SEQ ID NO: 3; a P941 S mutation in SEQ ID NO: 3; a CI 135Y missense mutation in SEQ ID NO: 3; a R73 frameshift insertion mutation in SEQ ID NO: 3; a Y85 frameshift deletion mutation in SEQ ID NO: 3; a S 123 frameshift deletion mutation in SEQ ID NO: 3; an El 70 frameshift deletion mutation in SEQ ID NO: 3; a D 162 frameshift deletion mutation in SEQ ID NO: 3 ; an 1181 frameshift deletion mutation in SEQ ID NO: 3; a T221 frameshift insertion mutation in SEQ ID NO: 3; an L260 frameshift deletion mutation in SEQ ID NO: 3; an 1274 frameshift deletion mutation in SEQ ID NO: 3;
  • the one or more TET2 somatic mutations are selected from an S282F mutation in SEQ ID NO: 3, an N312S mutation in SEQ ID NO: 3, an L346P mutation in SEQ ID NO: 3, an S460F mutation in SEQ ID NO: 3, a D666G mutation in SEQ ID NO: 3, a P941 S mutation in SEQ ID NO: 3, and a C I 135Y mutation in SEQ ID NO: 3.
  • compositions and methods described herein require, in some embodiments, sequencing of at least part of the genome in a sample comprising hematopoietic cells, including, for example, an enriched for population of myeloid cells, obtained from a subject. Sequencing can be carried out according to any suitable technique, many of which are generally known in the art. Many proprietary sequencing systems are available commercially and can be used in the context of the methods described herein, such as for example from Illumina, USA.
  • Single-cell sequencing methods are known in the art, as noted for example by Eberwine et al., Nature Methods 1 1, 25-27 (2014) doi: 10.1038/nmeth.2769 Published online 30 December 2013; and single-cell sequencing in microfluidic droplets (Nature 510, 363-369 (2014) doi: 10.1038/nature l3437).
  • Sequencing of DNA can be performed on tissues or cells. Sequencing of specific cell types (for example, hematopoietic cells obtained by flow sorting or myeloid lineage hematopoietic cells) can identify mutations in specific cell types that provide specific predictive value for use with the compositions and methods described herein. Sequencing can also be conducted in single cells, using appropriate single-cell sequencing strategies. Single-cell analyses can be used to identify high- risk combinations of mutations co-occurring in the same cells. Co-occurrence signifies that the mutations are occurring in the same cell clone and carry a greater risk, and therefore have a greater predictive value, thanoccurrence of the same mutations in different individual cells, for example.
  • specific cell types for example, hematopoietic cells obtained by flow sorting or myeloid lineage hematopoietic cells
  • Single-cell analyses can be used to identify high- risk combinations of mutations co-occurring in the same cells. Co-occurrence signifies that the mutations are occurring in the same cell clone
  • sequences such as those with high GC content, repetitive elements and/or low sequence complexity are prone to sequencing errors and false positive creation due to artifacts caused by enzyme slippage and other reading errors. Hence, care must be taken to ensure that any sequence changes observed in these regions are real and not artifact.
  • an "inhibitor of TET2 mutation-mediated IL- ⁇ (interleukin- ⁇ ) proinflammatory activity” refers to any agent or molecule that significantly blocks, inhibits, reduces, or interferes with the downstream effects of somatic mutations in TET2 that lead to increased IL- ⁇ proinflammatory activity or signaling in vitro, in situ, and/or in vivo, including increased IL- ⁇ transcription, increased NLRP3 inflammasome-mediated IL- ⁇ secretion, and/or increased IL- 1- receptor I (IL-lRl)-mediated IL- ⁇ signaling.
  • IL-lRl IL- 1- receptor I
  • Exemplary inhibitors of TET2 mutation-mediated IL- 1 ⁇ (interleukin- ⁇ ) proinflammatory activity contemplated for use in the various aspects and embodiments described herein include, but are not limited to, antibodies or antigen-binding fragments thereof that specifically bind to IL- ⁇ and/or antibodies or antigen-binding fragments thereof that specifically bind to IL-1 receptors, such as IL1R1, thereby inhibiting/reducing/blocking IL- ⁇ interaction(s) with its receptors; small molecule agents that target or specifically bind IL- ⁇ , IL-1- receptors, and/or IL-1 signaling components, such as caspase-1, and inhibit/reduce/block IL- ⁇ - mediated proinflammatory activity; RNA or DNA aptamers that bind to IL- ⁇ or IL-1 -receptors and inhibit/reduce/block IL-i -mediated proinflammatory activity; and/or IL-1 receptor fragments or fusion polypeptides thereof that block endogenous IL- ⁇ interactions with endogen
  • NLRP3 inflammasome-mediated IL- ⁇ secretion and inhibitors thereof foe use as inhibitors of TET2 mutation-mediated IL- ⁇ (interleukin- ⁇ ) proinflammatory activity, as described herein, as known to those of skill in the art
  • TET2 mutation-mediated IL- ⁇ interleukin- ⁇
  • the NLRP3 inflammasome is present primarily in immune and inflammatory cells following activation by inflammatory stimuli; these cells include macrophages, monocytes, DCs, and splenic neutrophils. Activation of the NLRP3 inflammasome occurs in two steps.
  • the first step involves a priming or initiating signal, in which many PAMPs or DAMPs are recognized by TLRs, leading to activation of nuclear factor kappa B (NF-KB)-mediated signaling, which in turn up-regulates transcription of inflammasome-related components, including inactive NLRP3, proIL- ⁇ , and proIL-18 (Bauernfeind et al., 2009; Franchi et al, 2012, 2014).
  • the second step of inflammasome activation is the oligomerization of NLRP3 and subsequent assembly of NLRP3, ASC, and procaspase-1 into a complex.
  • TET2 mutation-mediated IL- ⁇ (interleukin- ⁇ ) proinflammatory activity useful in the methods and compositions described herein can thus target any of the steps and/or components leading to NLRP3 inflammasome activation (see, for example, non- limiting examples in B-Z Shao et al., NLRP3 inflammasome and its inhibitors: a review; Front Pharmacol. 2015; 6: 262).
  • the inhibitors of TET2 mutation-mediated IL- ⁇ proinflammatory activity described herein result in a significant inhibition or reduction or decrease in any of the pathways leading to IL- ⁇ -mediated proinflammatory activity or signaling, such as IL- ⁇ transcription, IL- ⁇
  • IL-lRl IL-l receptor-receptor I
  • decrease(s)/decreasing/decreased generally means either a reduction or inhibition of at least 5%, at least 10%, at least 25%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or more, compared to the level of IL- ⁇ transcription, IL- ⁇ translation,NLRP3 inflammasome-mediated IL- ⁇ secretion, and/or IL- ⁇ binding to IL-1 receptor and consequent IL-l- receptor I (IL-lPvl)-mediated IL- ⁇ signaling under the same conditions but without the presence of inhibitors of TET2 mutation-mediated IL- ⁇ proinflammatory activity described herein.
  • IL-lPvl IL-l- receptor I
  • a disease or medical condition is considered to be mediated by "IL- ⁇ (interleukin- ⁇ ) proinflammatory activity" if the spontaneous or experimental disease or medical condition is associated with, or mediated by, for example, elevated levels of IL- 1 ⁇ in bodily fluids or tissue, or if cells or tissues taken from the body produce elevated levels of IL-1 in culture.
  • IL- ⁇ interleukin- ⁇
  • diseases mediated by IL- ⁇ proinflammatory activity are also recognized by the following additional two conditions: (1) pathological findings associated with the disease or medical condition can be mimicked experimentally in animals by the administration of IL-1 ⁇ ; and (2) the pathology induced in experimental animal models of the disease or medical condition can be inhibited or abolished by treatment with agents which inhibit the action of IL- 1 ⁇ .
  • a non-limiting list of disorders and diseases known to be mediated by or exacerbated by aberrant, elevated IL- ⁇ activity include hereditary syndromes with mutations in inflammasome-associated genes, such as cryopyrin- associated periodic syndromes (CAPS), Familial Mediterranean fever, Pyogenic arthritis, pyoderma gangrenosum and acne (PAPA) syndrome, Deficiency of IL-IRa (DIRA); Crystal-induced arthropathies, such as gout; systemic-onset juvenile arthritis or Still disease; adult-onset Still disease; rheumatoid arthritis;
  • CAPS cryopyrin- associated periodic syndromes
  • DIRA Deficiency of IL-IRa
  • Crystal-induced arthropathies such as gout; systemic-onset juvenile arthritis or Still disease; adult-onset Still disease; rheumatoid arthritis;
  • osteoarthritis Schnitzler syndrome; Behcet disease; Crohn's disease; periodontal diseases; COPD (Chronic Obstructive Pulmonary Disease); and neutrophil-triggered skin diseases, such as pyoderma gangrenosum, psoriasis pustulosa, Sweet syndrome; and chronic kidney disorders.
  • COPD Chironic Obstructive Pulmonary Disease
  • neutrophil-triggered skin diseases such as pyoderma gangrenosum, psoriasis pustulosa, Sweet syndrome; and chronic kidney disorders.
  • a disease mediated by IL- ⁇ (interleukin- ⁇ ) proinflammatory activity is a cardiometabolic disease.
  • Cardiometabolic diseases include cardiovascular diseases, as well as those disorders that complicate the risk and clinical management of cardiovascular conditions by potentiating and/or exacerbating hypertension, hyperlipidemia, atherosclerosis and cardiomyopathy, and include insulin resistance, hyperglycemia, obesity, type 2 diabetes mellitus, metabolic syndrome, hyperlipidemia and oxidative stress.
  • cardiac condition, disease or disorder is intended to include all disorders characterized by insufficient, undesired or abnormal blood vessel or cardiac function, e.g. hypertension, ischemic heart disease, hypertensive heart disease and pulmonary hypertensive heart disease, valvular disease, cardiac arrhythmia, vascular disease, myocardial infarction, congestive heart failure, myocarditis, atherosclerosis, restenosis, and any condition which leads to congestive heart failure in a subject, particularly a human subject.
  • Insufficient or abnormal cardiac function can be the result of disease, injury and/or aging.
  • myocardial ischemia refers to circulatory disturbances caused by coronary atherosclerosis and/or inadequate oxygen supply to the myocardium.
  • an acute myocardial infarction represents an irreversible ischemic insult to myocardial tissue.
  • This insult results in an occlusive (e.g., thrombotic or embolic) event in the coronary circulation and produces an environment in which the myocardial metabolic demands exceed the supply of oxygen to the myocardial tissue.
  • a disease mediated by IL- ⁇ (interleukin- ⁇ ) proinflammatory activity is a chronic kidney disease.
  • chronic kidney disease refers to renal diseases that slowly and progressively worsen over time due to the progressive loss of nephrons and consequent loss of renal function.
  • the loss of function usually takes months or years to occur. It may be so slow that symptoms do not appear until kidney function is less than one-tenth of normal.
  • the final stage of chronic kidney disease is called end-stage renal disease (ESRD).
  • ESRD end-stage renal disease
  • the kidneys are no longer able to remove enough wastes and excess fluids from the body.
  • the patient needs dialysis or a kidney transplant. Diabetes, which leads to diabetic nephropathy, and high blood pressure are the two most common causes of chronic kidney disease and account for most cases.
  • kidneys and lead to chronic kidney disease include, but are not limited to,: autoimmune disorders (such as systemic lupus erythematosus and scleroderma); birth defects of the kidneys (such as polycystic kidney disease); certain toxic chemicals; glomerulonephritis; injury or trauma; kidney stones and infection; problems with the arteries leading to or inside the kidneys; some pain medications and other drugs (such as cancer drugs); reflux nephropathy (in which the kidneys are damaged by the backward flow of urine into the kidneys); etc.
  • autoimmune disorders such as systemic lupus erythematosus and scleroderma
  • birth defects of the kidneys such as polycystic kidney disease
  • certain toxic chemicals such as systemic lupus erythematosus and scleroderma
  • glomerulonephritis such as systemic lupus erythematosus and scleroderma
  • certain toxic chemicals such as systemic lupus ery
  • Proteinuria can, in some embodiments, be indicative of kidney disease, but, by itself, is not conclusive. In some embodiments of these aspects and all such aspects described herein, a subject having or at risk for a chronic kidney disease has diabetic nephropathy.
  • an inhibitor of TET2 mutation- mediated IL- ⁇ (interleukin- ⁇ ) proinflammatory activity is an IL- ⁇ inhibitory compound.
  • an "IL- ⁇ inhibitory compound” or “IL- ⁇ inhibitor” or “inhibitor of IL- ⁇ ” refers to a compound or agent capable of specifically inhibiting or specifically preventing activation of cellular receptors to IL- ⁇ and consequent downstream effects of IL- ⁇ signaling.
  • Classes of interleukin- ⁇ inhibitors include: interleukin-1 receptor antagonists such as IL-lra; anti-IL- 1 receptor antibodies (e.g., EP 623674), the contents of which is hereby incorporated by reference in its entirety; IL- ⁇ binding proteins such as soluble IL-1 receptors (e.g., U.S. Pat. No. 5,492,888, U.S. Pat. No.
  • anti-IL-1 ⁇ monoclonal antibodies e.g., WO 9501997, WO 9402627, WO 9006371, U.S. Pat. No.
  • the IL- ⁇ inhibitor is selected from any of the IL- ⁇ or inflammasome inhibitors listed in Table 1.
  • Table 1 Exemplary List of IL- ⁇ inhibitors for use as TET2 mutation-mediated IL- ⁇
  • IL 1 molecule- n lB lbeta IL- interleukin 1 beta Beta Mab Antibody (IL1B) lbeta
  • IL1B interleukin 1 beta Beta Mab Antibody (IL1B) lbeta) monoclonal NOVARTIS, IL 1 Inhibitor antibody derived Beta Monoclonal from a mouse Antibody monoclonal NOVARTIS, antibody (mAb) Interleukin 1 Beta acting against IL-1 Monoclonal beta.
  • CDP48 interleukin 1 Large Interleuki Interleukin- Subcutaneous CDP484 is a
  • beta antibody molecule- n l 1 Beta (IL- PEGylated antibody CDP 484 (pegylated) Antibody Receptor, 1 Beta) fragment targeting
  • CP molecule n l 1 Beta (IL- potent inhibitor of 412,245, CP Receptor, 1 Beta) stimulus-coupled 412245, Type II Receptor IL-lbeta post- CP412,245 (IL1R2) Antagonist translational
  • CYT013 ILlbQb Interleuki Interleukin- Subcutaneous CYT013ILlbQb is interleukin 1 beta n l 1 Beta (IL- a therapeutic
  • Receptor 1 Beta vaccine consisting interleukin 1 Type II Receptor of modified receptor antagonist (IL1R2) Antagonist interleukin- 1 beta protein molecules coupled to the virus-like particle Qb.
  • the vaccine induces antibodies production against IL-1 beta to decrease inflammation and reduce disease progression.
  • P-456773 inhibitor Blocking apoptosis- associated specklike protein (ASC) oligomerization, Inhibiting of canonical and non- canonical NLRP3 inflammasome.
  • ASC apoptosis- associated specklike protein
  • Inflabion diacerein Small Interleuki Interleukin- Oral Inflabion contains molecule n 1 (IL1) 1 (IL-1) diacerein as an
  • Diacerin is an anthraquinone derivative that acts via inhibition of interleukin- lbeta.
  • Inhibitor mediated release of interleukin (IL)- lbeta It is a specific ILl- ⁇ inhibitor.
  • LY2189102 interleukin 1, Large Interleuki Interleukin- Intravenous, LY2189102
  • LY beta molecule- n l 1 Beta (IL- Subcutaneous contains interleukin 2189102 monoclonal Antibody Receptor, 1 Beta) 1, beta monoclonal antibody Type II Receptor antibody as an
  • IL1R2 humanized (IL1R2) Antagonist active ingredient. It is targeted against interleukin- 1 beta.
  • MEDI8968 interleukin 1 Large Interleuki Interleukin- Subcutaneous MEDI8968 is a
  • receptor molecule- n lA lalpha IL- fully human IgG2 MEDI 8968 monoclonal Antibody (ILIA), 1 alpha
  • PGE3935199 Caspase, Caspase- 1 Oral PGE3935199 is a
  • PGE527667 Caspase, Caspase- 1 Oral PGE527667 is a
  • TRK530 Interleuki Interleukin- Oral TRK530 is an
  • n lB lbeta IL- immunomodulatory TRK 530 (IL1B) lbeta
  • Inhibitor derivative that is directed against interleukin lb.
  • n l 1 PASylated interleukin 1 Receptor Receptor interleukin 1 receptor antagonist (IL1R) Antagonist receptor antagonist protein (pasylated) protein as an active ingredient.
  • IL-1R PASylated interleukin 1 Receptor Receptor interleukin 1 receptor antagonist
  • Interleukin 1 receptor antagonist protein acts by preventing the interaction of IL-1 with the receptor.
  • XOMA052 gevokizumab Large Interleuki Interleukin- Intravenous, XOMA052 contains
  • S molecule- n lB lbeta IL- Subcutaneous gevokizumab as an 78989, S78989, Antibody (IL1B) lbeta
  • active ingredient IL- Subcutaneous gevokizumab
  • XMA005.2, Inhibitor Gevokizumab is a XOMA 052 humanized
  • receptor molecule- n 1 (IL1) 1 IL-1
  • IL-1 receptor molecule-1
  • IL-1 receptor molecule-1 AMG 108 monoclonal Antibody Inhibitor receptor
  • HL 2351 (human) antibody that binds to and inhibits the action of interleukin- 1 (IL-1).
  • HL 2351, ILlRa Interleuki Interleukin- Subcutaneous HL2351 is a long hyFc n 1 (IL1) 1 (IL-1) acting fusion
  • Inhibitor protein of IL-IRa and hybrid fc fragment (hyFc) which inhibits interleukin-1.
  • ILlHyl Interleuki Interleukin- ILlHyl is an
  • IL-1 1F5 interleukin-1 1F5
  • IL lHyl Receptor Receptor receptor antagonist interleukin 1 (IL1R) Antagonist that acts by family, member 5, blocking the interleukin 1 HY1 binding of
  • IL-1 interleukin-1
  • IIL1R Interleukin 1 Antagonist protein acts by receptor antagonist preventing the protein interaction of IL-1 (recombinant, with the receptor. human)
  • Orthokine Interleuki Interleukin- Intra-articular Orthokine is an
  • IL-1 autologous serum interleukin 1 Receptor Receptor solution derived receptor antagonist
  • IL-1R autologous serum interleukin 1 Receptor Receptor solution derived receptor antagonist
  • IL-IRa interleukin-1 receptor antagonist
  • PRT 1000 Interleuki Interleukin- PRT 1000 contains
  • n l 1 (IL-1) MB-IL IRA which interleukin 1 Receptor Receptor is an interleukin-1 receptor antagonist (IL1R) Antagonist receptor antagonist protein protein (IL1RA), fused with a matrix binding domain. It is a potent cytokine inhibitor and prevents the interaction of IL1 with the receptor.
  • IL1R interleukin-1 receptor antagonist
  • IL1RA Antagonist receptor antagonist protein protein
  • IL-1 receptor type 1 IL-1 receptor type 1
  • IL-lRAcP IL- 1 receptor accessory protein
  • RNA NLRP3 protein expression by binding to a conserved site in the 3' UTR of the NLRP3 transcript,.
  • the IL- ⁇ inhibitor is an IL- ⁇ inhibitor antibody or antigen-binding fragment thereof that binds to IL- ⁇ and
  • antibodies or "antigen-binding fragments” thereof include monoclonal, human, humanized or chimeric antibodies, single chain antibodies, Fab fragments, F(ab') fragments, fragments produced by a Fab expression library, and/or binding fragments of any of the above. Antibodies also refer to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e.
  • immunoglobulin molecules described herein can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g. , IgGl, IgG2, IgG3, IgG4, IgAl and IgA2) or subclass of immunoglobulin molecule, as is understood by one of skill in the art.
  • antibody fragment or "antigen-binding fragment” include: (i) the Fab
  • the fragment having VL, CL, VH and CHI domains; (ii) the Fab' fragment, which is a Fab fragment having one or more cysteine residues at the C-terminus of the CHI domain; (iii) the Fd fragment having VH and C H 1 domains; (iv) the Fd' fragment having V H and C H 1 domains and one or more cysteine
  • the IL- ⁇ inhibitor antibody or antigen-binding fragment thereof is selected from ABT981, an anti-interleukin- ⁇ inhibitor antibody by ABZYME, APX002, Canakinumab/Ilaris, CDP48, immunereszumab,
  • the IL- ⁇ inhibitor is an IL- 1 receptor antagonist.
  • an "interleukin-1 receptor antagonist” (“IL-lra”) is any agent or molecule, including small molecules and antibody or antigen-binding fragments thereof, that binds to an interleukin- 1 receptor thereby preventing binding of IL- 1 ⁇ to the receptor and thereby inhibiting IL- ⁇ -mediated pro-inflammatory activity.
  • Interleukin 1 receptor antagonists as well as methods of making and using thereof, are described in, for example, U.S. Pat. No.
  • the proteins include glycosylated as well as non-glycosylated IL-1 receptor antagonists.
  • the IL-1 receptor antagonist is selected from CDP484, CP412245, CYT013 ILlbQb, XL 130, AMG108, HL 2351, ILlHyl, AXXO, orthokine, PRT 1000, anakinra, and rilonacept.
  • the IL- ⁇ inhibitor is a small molecule or microRNA inhibitor that inhibits IL- ⁇ -mediated pro-inflammatory activity.
  • small molecule inhibitors can target or specifically bind IL- ⁇ , IL-1 -receptors, and/or IL-1 signaling components, such as caspase-1, and/or the NLRP3 inflammasome, or components thereof, thereby inhibiting/reducing/blocking IL- ⁇ -mediated proinflammatory activity.
  • small molecule inhibitors include, but are not limited to, small peptides or peptide-like molecules, soluble peptides, and synthetic non-peptidyl organic or inorganic compounds.
  • a small molecule inhibitor or antagonist can have a molecular weight of any of about 100 to about 20,000 daltons (Da), about 500 to about 15,000 Da, about 1000 to about 10,000 Da.
  • the small molecule or microRNA IL- ⁇ inhibitor is selected from, AC201, MCC950 or CRID3, inflabion, inflammasome modulator OPSONA, PGE3935199, PGE527667, TRK530, ⁇ -hydroxybutyrate (BHB), and microR A-223.
  • the small molecule IL- ⁇ inhibitor is MCC950.
  • an inhibitor of TET2 mutation- mediated IL- ⁇ (interleukin- ⁇ ) proinflammatory activity is a TET2 activating compound or TET2 potentiatior.
  • TET2 activating compound or “TET2 potentiatior” or “TET2 activator” or “TET2 agonist” refer to a molecule or agent that mimics or up-regulates (e.g., increases, potentiates or supplements) the biological activity of TET2, thereby decreasing or inhibiting IL- ⁇ (interleukin- ⁇ ) proinflammatory activity caused by deficient TET2 activity.
  • a TET2 potentiator or agonist can be, in some embodiments, a TET2 protein fragment or derivative thereof having at least one bioactivity of the wild-type TET2.
  • a TET2 activator can also be a compound which increases TET2 dioxygenase activity, TET2 mutation-mediated histone H2B GlcNAcylation, and/or TET2 mutation-mediated histone deacetylase recruitment to specific gene promoters, for example.
  • TET2 activating compounds or agonists contemplated for use in the various aspects and embodiments described herein include, but are not limited to, R A or DNA aptamers; TET2 structural analogs or TET2 fragments, derivatives, or fusion polypeptides thereof; and small molecule agents that target or bind to TET2 and act as functional mimics of TET2.
  • a subject in need of the pharmaceutical compositions and methods comprising inhibitors of TET2 mutation-mediated IL- ⁇ (interleukin- ⁇ ) proinflammatory activity and a pharmaceutically acceptable carrier described herein has or identified as having one or more TET2 somatic mutations in a sub-population of their hematopoietic cells.
  • a "sub-population" of hematopoietic cells comprising the one or more TET2 mutations in the subject refers to at least 1% of hematopoietic cells, at least 2% of hematopoietic cells, at least 3% of hematopoietic cells, at least 4% of hematopoietic cells, at least 5% of hematopoietic cells, at least 6% of hematopoietic cells, at least 7% of hematopoietic cells, at least 8% of hematopoietic cells, at least 9% of hematopoietic cells, at least 10% of hematopoietic cells, at least 1 1% of hematopoietic cells, at least 12% of hematopoietic cells, at least 13% of hematopoietic cells, at least 15% of hematopoietic cells, at least 15% of hematopoietic cells, at least 20% of hematop
  • hematopoietic cells between 5-10% of hematopoietic cells, between 5-15% of hematopoietic cells, between 5-20% of hematopoietic cells, between 10-15% of hematopoietic cells, between 10-20% of hematopoietic cells, between 15-20% of hematopoietic cells, present in a sample obtained from the subject.
  • a sub-population of cells in a subject can refer to a specific cell type or lineage within the hematopoietic cells in the subject, such as myeloid lineage cells or macrophages.
  • the "sub-population" of cells comprising the one or more TET2 mutations in the subject refers to at least 1% of myeloid cells, at least 2% of myeloid cells, at least 3% of myeloid cells, at least 4% of myeloid cells, at least 5% of myeloid cells, at least 6% of myeloid cells, at least 7% of myeloid cells, at least 8% of myeloid cells, at least 9% of myeloid cells, at least 10% of myeloid cells, at least 1 1% of myeloid cells, at least 12% of myeloid cells, at least 13% of myeloid cells, at least 15% of myeloid cells, at least 15% of myeloidcells, at least 20% of myeloidcells, or more, or between 1-5% of myeloid cells, between 1-10% of myeloid cells, between 1-15% of myeloid cells, between 1-20% of myeloid cells, between 5-10% of myeloid cells, between 5-15% of myeloid cells, between
  • biological sample refers to a cell or population of cells or a quantity of tissue or fluid from a subject comprising one or more hematopoietic cells. Most often, the biological sample has been removed from a subject, but the term “biological sample” can also refer to cells or tissue analyzed in vivo, i.e., without removal from the subject. Thus, a “sample” of hematopoietic cells can be obtained from any tissue or organ in the subject comprising cells of hematopoietic origin, including blood, spleen, lymph nodes, cord blood, placenta, and bone marrow.
  • Hematopoietic cells include myeloid cells (monocytes and macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes/platelets, dendritic cells), and lymphoid lineages (T-cells, B-cells, NKT-cells, NK-cells), as well as progenitor cell populations, including multipotent cells, such as hematopoietic stem cells.
  • myeloid cells monocytes and macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes/platelets, dendritic cells
  • T-cells lymphoid lineages
  • B-cells B-cells
  • NKT-cells NKT-cells
  • NK-cells NK-cells
  • progenitor cell populations including multipotent cells, such as hematopoietic stem cells.
  • hematopoietic progenitor cells a population of hematopoietic cells comprising at least two different cell types is referred to herein as a "heterogeneous population.”
  • a"companion diagnostic refers to a diagnostic method and or reagent that are used to identify subjects susceptible to treatment with a particular treatment or to monitor treatment and/or to identify an effective dosage for a subject or sub-group or other group of subjects.
  • a TET2 mutation-mediated IL- ⁇ proinflammatory disease comprising: (a) sequencing a hematopoietic cell sample from the subject to identify one or more somatic mutations in TET2, and (b) administering a therapeutically effective amount of a pharmaceutical composition comprising an inhibitor of TET2 mutation-mediated IL- ⁇ (interleukin- ⁇ ) proinflammatory activity and a pharmaceutically acceptable carrier if one or more somatic mutations in TET2 are identified in the hematopoietic cell sample.
  • a pharmaceutical composition comprising an inhibitor of TET2 mutation-mediated IL- ⁇ (interleukin- ⁇ ) proinflammatory activity and a pharmaceutically acceptable carrier if one or more somatic mutations in TET2 are identified in the hematopoietic cell sample.
  • a sample of hematopoietic cells for use in the methods and uses described herein can, in some embodiments, undergo further processing, such as via flow cytometric sorting and/or magnetic bead based sorting methods, to become an enriched population of hematopoietic cells for analysis of TET2 mutations, using any method known to one of skill in the art.
  • a sample comprising hematopoietic cells isolated from a subject is then further processed, for example, by cell sorting (e.g., magnetic sorting or FACS), to obtain a population of enriched or isolated hematopoietic cells or a sub-population thereof, for example, myeloid-derived cells.
  • cell sorting e.g., magnetic sorting or FACS
  • isolated refers to any process whereby a cell or population of cells, such as a population of hematopoietic cells, is removed from a subject or sample in which it was originally found, or a descendant of such a cell or cells.
  • isolated population refers to a population of cells that has been removed and separated from a biological sample, or a mixed or heterogeneous population of cells found in such a sample. Such a mixed population includes, for example, a population of hematopoietic cells obtained from peripheral blood.
  • an isolated population is a substantially pure population of cells as compared to the heterogeneous population from which the cells were isolated or enriched from.
  • the isolated population is an isolated population of myeloid cells.
  • the isolated population comprises a substantially pure population of myeloid cells as compared to a heterogeneous population of hematopoietic cells comprising various other cells types.
  • substantially pure refers to a population of cells that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99% pure, with respect to the cells making up a total cell population.
  • the terms “enriching” or “enriched” are used interchangeably herein and mean that the yield (fraction) of cells of one type, such as hematopoietic cells for use in the methods and uses described herein, is increased by at least 15%, by at least 20%, by at least 25%, by at least 30%, by at least 35%, by at least 40%, by at least 45%, by at least 50%, by at least 55%, by at least 60%, by at least 65%, by at least 70%, or by at least 75%, over the fraction of cells of that type in the starting biological sample, culture, or preparation.
  • markers specific for different hematopoietic cell types are used to isolate or enrich for these cells.
  • a "marker,” as used herein, describes the characteristics and/or phenotype of a cell. Markers can be used for selection of cells comprising characteristics of interest. Markers will vary with specific cells. Markers are characteristics, whether morphological, functional or biochemical (enzymatic), particular to a cell type, or molecules expressed by the cell type. Preferably, such markers are proteins, and more preferably, possess an epitope for antibodies or other binding molecules available in the art.
  • a marker may consist of any molecule found in a cell including, but not limited to, proteins (peptides and polypeptides), lipids, polysaccharides, nucleic acids and steroids.
  • morphological characteristics or traits include, but are not limited to, shape, size, appearance (e.g., smooth, translucent), and nuclear to cytoplasmic ratio.
  • functional characteristics or traits include, but are not limited to, the ability to adhere to particular substrates, ability to incorporate or exclude particular dyes, ability to migrate under particular conditions, and the ability to differentiate along particular lineages. Markers may be detected by any method available to one of skill in the art.
  • a "cell-surface marker” refers to any molecule that is expressed on the surface of a cell.
  • Cell-surface expression usually requires that a molecule possesses a transmembrane domain.
  • Some molecules that are normally not found on the cell-surface can be engineered by recombinant techniques to be expressed on the surface of a cell.
  • Many naturally occurring cell-surface markers are termed "CD” or “cluster of differentiation” molecules.
  • Cell-surface markers often provide antigenic determinants to which antibodies can bind to.
  • a cell can be designated “positive” or “negative” for any cell-surface marker, and both such designations are useful for the practice of the methods described herein.
  • a cell is considered “positive” for a cell-surface marker if it expresses the marker on its cell-surface in amounts sufficient to be detected using methods known to those of skill in the art, such as contacting a cell with an antibody that binds specifically to that marker, and subsequently performing flow cytometric analysis of such a contacted cell to determine whether the antibody is bound the cell. It is to be understood that while a cell may express messenger RNA for a cell-surface marker, in order to be considered positive for the methods described herein, the cell must express it on its surface.
  • a cell is considered "negative" for a cell-surface marker if it does not express the marker on its cell-surface in amounts sufficient to be detected using methods known to those of skill in the art, such as contacting a cell with an antibody that binds specifically to that marker and subsequently performing flow cytometric analysis of such a contacted cell to determine whether the antibody is bound the cell.
  • the agents can all comprise the same label or tag, such as fluorescent tag, and thus all cells positive for that label or tag can be excluded or removed, to leave uncontacted hematopoietic stem or progenitor cells for use in the methods described herein.
  • an agent specific for a cell-surface molecule such as an antibody or antigen-binding fragment, is labeled with a tag to facilitate the isolation of the hematopoietic stem cells.
  • label or "tag”, as used herein, refer to a composition capable of producing a detectable signal indicative of the presence of a target, such as, the presence of a specific cell-surface marker in a biological sample. Suitable labels include fluorescent molecules, radioisotopes, nucleotide chromophores, enzymes, substrates, chemiluminescent moieties, magnetic particles, bioluminescent moieties, and the like.
  • a label is any composition detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical or chemical means needed for the methods to isolate and enrich endothelial cell progenitor cells.
  • a variety of methods to isolate a substantially pure or enriched population of cells are available to a skilled artisan, including immunoselection techniques, such as high-throughput cell sorting using flow cytometric methods, affinity methods with antibodies labeled to magnetic beads, biodegradable beads, non-biodegradable beads, and antibodies panned to surfaces including dishes, and any combination of such methods.
  • beads can be coated with antibodies by a skilled artisan using standard techniques known in the art, such as commercial bead conjugation kits.
  • a negative selection step is performed to remove cells expressing one or more lineage markers, followed by fluorescence activated cell sorting to positively select cells expressing one or more specific cell-surface markers.
  • flow cytometry refers to a technique for counting and examining microscopic particles, such as cells and chromosomes, by suspending them in a stream of fluid and passing them through an electronic detection apparatus.
  • Flow cytometry allows simultaneous multiparametric analysis of the physical and/or chemical parameters of up to thousands of particles per second, such as fluorescent parameters.
  • Modern flow cytometric instruments usually have multiple lasers and fluorescence detectors. Increasing the number of lasers and detectors allows for labeling by multiple antibodies, and can more precisely identify a target population by their phenotypic markers.
  • Certain flow cytometric instruments can take digital images of individual cells, allowing for the analysis of fluorescent signal location within or on the surface of cells.
  • fluorescence-activated cell sorting or “flow cytometric based sorting” methods refer to flow cytometric methods for sorting a heterogeneous mixture of cells from a single biological sample into one or more containers, one cell at a time, based upon the specific light scattering and fluorescent characteristics of each cell and provides fast, objective and quantitative recording of fluorescent signals from individual cells as well as physical separation of cells of particular interest. Accordingly, in some embodiments, fluorescence-activated cell sorting (FACS) can be used with the methods described herein to isolate and enrich for populations of cells, such as myeloid cells, from a sample of hematopoietic cells.
  • FACS fluorescence-activated cell sorting
  • the methods further comprise monitoring clonality of TET2 somatic mutations in a subject.
  • the size or percentage of the clone harboring a TET2 somatic mutation is determined to monitor the effectiveness of the treatment.
  • the methods further comprise decreasing the number or percentage of hematopoietic clones comprising the one or more TET2 mutation(s) in the subject by transfusing the subject with hematopoietic stem cells in which the mutations are absent or reduced, for example, by administering a bone marrow transplant.
  • the subject is transfused with autologous bone marrow.
  • the subject is transfused with allogeneic bone marrow.
  • a bone marrow transplant is a procedure where healthy bone marrow stem cells, are infused into a subject to replace damaged or diseased bone marrow, or to replace damaged peripheral blood cells generated from bone marrow stem cells.
  • chemotherapy, radiation, or both Prior to the transplant, chemotherapy, radiation, or both can be given.
  • ablative myeloablative
  • high-dose chemotherapy, radiation, or both are given to kill peripheral cells, as well as all healthy bone marrow that remains, and allows new stem cells to grow in the bone marrow.
  • Reduced intensity treatments also called a mini transplant, can also be performed where lower doses of chemotherapy and radiation are received before a transplant. For the methods described herein, where the issues arise from somatic mutations in the periphery, total ablation of the bone marrow may not be required.
  • apheresis can be used to collect blood stem cells. Briefly, blood is withdrawn from the subject's body and one or more blood components are removed, such as all leukocytes or all myeloid cells, and transfusion of the remaining cells are performed. Before apheresis, daily injections of growth factor can be administered to increase stem cell production and move stem cells into circulating blood so they can be collected. During apheresis, blood is drawn from a vein and circulated through a machine. The machine separates blood into different parts, including hematopoietic stem cells. These stem cells can be collected and frozen for future use in the bone marrow transplant.
  • the methods further comprise decreasing the number or percentage of hematopoietic cells or clones comprising the one or more TET2 mutations in the subject by performing therapeutic cytapheresis on the subject.
  • Therapeutic cytapheresis removes cellular components from blood, returning plasma. It is most often used to remove defective RBCs and substitute normal ones in patients with sickle cell anemia who have the following conditions: acute chest syndrome, stroke, pregnancy, or frequent, severe sickle cell crises.
  • Other known uses of cytapheresis include collection of peripheral blood stem cells for autologous or allogeneic bone marrow reconstitution (an alternative to bone marrow transplantation) and collection of lymphocytes for use in immune modulation cancer therapy
  • a subject undergoing therapeutic cytapheresis can also be administered one or more agents to stimulate hematopoietic stem cell migration from the bone marrow to the blood, following removal of all cellular components from the blood using therapeutic cytapheresis .
  • a subject undergoing therapeutic cytapheresis can further be transfused with autologous blood.
  • the subject is further transfused with allogeneic blood.
  • the blood can undergo processing steps prior to transfusion to remove and/or decrease the number of hematopoietic cells having the one or more TET2 mutations.
  • processing steps can include flow cytometric or magnetic bead-based sorting and enrichment methods to remove hematopoietic cells having the one or more TET2 mutations
  • the subject is administered or transfused with hematopoietic cells that have been modified to correct any somatic mutations in TET2, using any method known in the art to modify or incorporate target genes into the genome of a cell so as to facilitate the expression of such genes, also referred to herein as "gene targeting” or “gene therapy” methods.
  • CRISPR clustered regularly interspaced short palindromic repeats
  • Cas9 Cas9 nuclease
  • Polynucleotides containing these foreign sequences and the repeat-spacer elements of the CRISPR locus are in turn transcribed in a host cell to create a guide RNA, which can subsequently anneal to a target sequence and localize the Cas9 nuclease to this site.
  • highly site-specific cas9- mediated DNA cleavage can be engendered in a foreign polynucleotide because the interaction that brings cas9 within close proximity of the target DNA molecule is governed by RNA:DNA hybridization.
  • RNA:DNA hybridization As a result, one can theoretically design a CRISPR/Cas system to cleave any target DNA molecule of interest.
  • ZFNs zinc finger nucleases
  • TALENs transcription activator-like effector nucleases
  • Transposons are polynucleotides that encode transposase enzymes and contain a polynucleotide sequence or gene of interest flanked by 5 ' and 3 ' excision sites. Once a transposon has been delivered into a cell, expression of the transposase gene commences and results in active enzymes that cleave the gene of interest from the transposon. This activity is mediated by the site-specific recognition of transposon excision sites by the transposase. In certain cases, these excision sites may be terminal repeats or inverted terminal repeats.
  • the gene of interest can be integrated into the genome of a mammalian cell by transposase-catalyzed cleavage of similar excision sites that exist within the nuclear genome of the cell. This allows the gene of interest to be inserted into the cleaved nuclear DNA at the complementary excision sites, and subsequent covalent ligation of the phosphodiester bonds that join the gene of interest to the DNA of the mammalian cell genome completes the incorporation process.
  • the transposon may be a retrotransposon, such that the gene encoding the target gene is first transcribed to an RNA product and then reverse-transcribed to DNA before incorporation in the mammalian cell genome.
  • transposon systems include the piggybac transposon (described in detail in, e.g., WO 2010/085699) and the sleeping beauty transposon (described in detail in, e.g., US2005/01 12764), the disclosures of each of which are incorporated herein by reference.
  • Additional genome editing techniques that can be used to incorporate polynucleotides encoding target genes into the genome of a hematopoietic cell include the use of ARCUSTM meganucleases that can be rationally designed so as to site-specifically cleave genomic DNA.
  • the use of these enzymes for the incorporation of genes encoding target genes into the genome of a mammalian cell is advantageous in view of the defined structure-activity relationships that have been established for such enzymes.
  • Single chain meganucleases can be modified at certain amino acid positions in order to create nucleases that selectively cleave DNA at desired locations, enabling the site-specific incorporation of a target gene into the nuclear DNA of a hematopoietic stem cell.
  • These single-chain nucleases have been described extensively in, e.g., US 8,021,867 and US 8,445,251, the disclosures of each of which are incorporated herein by reference.
  • Another example of a platform that can be used to facilitate the expression of a target gene in a hematopoietic cell is by the integration of the polynucleotide encoding a target gene into the nuclear genome of the cell.
  • a variety of techniques have been developed for the introduction of exogenous genes into a eukaryotic genome.
  • One such technique involves the insertion of a target gene into a vector, such as a viral vector.
  • Vectors for use with the compositions and methods of the invention can be introduced into a cell by a variety of methods, including transformation, transfection, direct uptake, projectile bombardment, and by encapsulation of the vector in a liposome, and are well known in the art.
  • transfecting or transforming cells examples include calcium phosphate precipitation, electroporation, microinjection, infection, lipofection and direct uptake. Such methods are described in more detail, for example, in Green, et al., Molecular Cloning: A Laboratory Manual, Fourth Edition, Cold Spring Harbor University Press, New Y ork (2014); and Ausubel, et al ., Current Protocols in Molecular Biology, John Wiley & Sons, New York (2015), the disclosures of each of which are incorporated herein by reference.
  • viral vectors useful in the methods described herein include a retrovirus, adenovirus (e.g., Ad5, Ad26, Ad34, Ad35, and Ad48), parvovirus (e.g., adeno-associated viruses), coronavirus, negative strand RNA viruses such as orthomyxovirus (e.g., influenza virus), rhabdovirus (e.g., rabies and vesicular stomatitis virus), paramyxovirus (e.g.
  • a retrovirus e.g., Ad5, Ad26, Ad34, Ad35, and Ad48
  • parvovirus e.g., adeno-associated viruses
  • coronavirus e.g., coronavirus
  • negative strand RNA viruses such as orthomyxovirus (e.g., influenza virus), rhabdovirus (e.g., rabies and vesicular stomatitis virus), paramyxovirus (e.g.
  • RNA viruses such as picomavirus and alphavirus
  • double stranded DNA viruses including herpes virus (e.g., Herpes Simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and poxvirus (e.g., vaccinia, modified vaccinia Ankara (MVA), fowlpox and canarypox).
  • herpes virus e.g., Herpes Simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus
  • poxvirus e.g., vaccinia, modified vaccinia Ankara (MVA), fowlpox and canarypox
  • Other viruses include Norwalk virus, togavirus, flavivirus, reoviruses, papovavirus, hepadnavirus, and hepatitis virus, for example.
  • retroviruses examples include: avian leukosis-sarcoma, mammalian C-type, B-type viruses, D-type viruses, HTLV-BLV group, lentivirus, spumavirus (Coffin, J. M., Retroviridae: The viruses and their replication, In Fundamental Virology, Third Edition, B. N. Fields, et al, Eds., Lippincott-Raven Publishers, Philadelphia, 1996, the disclosure of which is incorporated herein by reference).
  • viral vectors include murine leukemia viruses, murine sarcoma viruses, mouse mammary tumor virus, bovine leukemia virus, feline leukemia virus, feline sarcoma virus, avian leukemia virus, human T-cell leukemia virus, baboon endogenous virus, Gibbon ape leukemia virus, Mason Pfizer monkey virus, simian immunodeficiency virus, simian sarcoma virus, Rous sarcoma virus and lentiviruses.
  • vectors are described in, e.g., US 5,801,030, the disclosure of which is incorporated herein by reference.
  • the methods further comprise initiating a monitoring regimen following the administration of one or more treatments to the subject.
  • monitoring includes repeating the diagnostic steps of the method on the subject on a monthly, bi-monthly or quarterly basis to determine whether there is, for example, reduced IL- ⁇ (interleukin- ⁇ ) proinflammatory activity or decreased percentages of hematopoietic cells in the blood having one or more TET2 mutations described herein.
  • IL- ⁇ interleukin- ⁇
  • the theranostic methods comprise further administering one or more additional therapeutic agents to the subject, in addition to the inhibitor of TET2 mutation-mediated IL- ⁇ (interleukin- ⁇ ) proinflammatory activity.
  • additional therapeutic agent can be co-administered with the inhibitor of TET2 mutation-mediated IL- 1 ⁇ (interleukin- ⁇ ) proinflammatory activity.
  • co-administering or to "coadminister” means the administration of an inhibitor described herein and another compound, e.g., a therapeutic agent, separately, simultaneously, and/or sequentially over a period of time as determined by a qualified care giver.
  • Non-limiting examples of additional therapeutic agents that can be administered to a subject having one or more TET2 somatic mutations include quinidine, procainamide, disopyramide, lidocaine, phenytoin, mexiletine, flecainide, propafenone, moricizine, propranolol, esmolol, timolol, metoprolol, atenolol, bisoprolol, amiodarone, sotalol, ibutilide, dofetilide, dronedarone, E-4031, verapamil, diltiazem, adenosine, digoxin, magnesium sulfate, warfarin, heparins, anti-platelet drugs (e.g., aspirin and clopidogrel), beta blockers (e.g., metoprolol and carvedilol), angiotensin-converting enzyme (ACE) inhibitors (e.g., cap
  • the additional therapeutic agent is an angiotensin-converting enzyme (ACE) inhibitor, an angiotensin II receptor blocker (ARB), or a mineralocorticoid receptor (MR) antagonist.
  • ACE angiotensin-converting enzyme
  • ARB angiotensin II receptor blocker
  • MR mineralocorticoid receptor
  • ACE inhibitors for use with the compositions and methods described herein include, but are not limited to, benazepril (marketed in the U.S. as LOTENSINTM), captopril (marketed in the U.S. as CAPOTENTM), enalapril/enalaprilat (marketed in the U.S. as VASOTECTM oral and injectable), fosinopril (marketed in the U.S. as MONOPRILTM), lisinopril (marketed in the U.S. as ZESTRILTM and PRINIVILTM), moexipril (marketed in the U.S. as UNIVASCTM), perindopril (marketed in the U.S.
  • benazepril marketed in the U.S. as LOTENSINTM
  • captopril marketed in the U.S. as CAPOTENTM
  • enalapril/enalaprilat marketed in the U.S. as VASOTECTM oral and injectable
  • ARBs for use with the inhibitors described herein include candesartan (marketed in the U.S. as ATACANDTM), irbesartan (marketed in the U.S. as AVAPR0 1M ), olmesartan (marketed in the U.S. as BENICAR ), losartan (marketed in the U.S. as COZAARTM), valsartan (marketed in the U.S. as DIOVANTM), telmisartan (marketed in the U.S. as MICARDISTM), and eprosartan (marketed in the U.S. as TEVETENTM).
  • the method further comprises administering to the subject an effective amount of a diuretic.
  • Diuretics include, but are not limited to, torsemide (marketed in the U.S. as DEMADEXTM), furosemide (marketed in the U.S. as LASIXTM), bumetanide (marketed in the U.S. as BUMEXTM), ethacrynic acid (marketed in the U.S. as EDECRINTM), torsemide (marketed in the U.S. as DEMADEXTM), amiloride, (marketed in the U.S. as MID AMORTM), acetazolamide (marketed in the U.S.
  • DIAMOXTM DIAMOXTM
  • pamabrom marketed in the U.S. as AQUA-BANTM
  • mannitol marketed in the U.S. as ARIDOLTM or OSMITROLTM
  • traimterene marketed in the U.S. as DYRENIUMTM
  • spironolactone marketed in the U.S. as ALDACTONETM
  • amiloride marketed in the U.S. as MIDAMORTM
  • indapamide marketed in the U.S. as LOZOLTM
  • hydrochlorothiazide marketed in the U.S. as
  • HYDRODIURILTM metolazone (marketed in the U.S. as ZAROXOLYNTMor MYKROXTM), methylclothiazide (marketed in the U.S. as AQUATENSENTM or ENDURONTM), hydrocholorthiazide (marketed in the U.S. as AQUAZIDE HTMor ESIDRIXTM or MICROZIDETM), chlorothiazide (marketed in the U.S. as DIURILTM), bendroflumethiazide (marketed in the U.S. as NATURETINTM), polythiazide (marketed in the U.S. as RENESETM), hydroflumethiazide (marketed in the U.S. as SALURONTM), and chlorthalidone (marketed in the U.S. as THALITONETM).
  • DIURILTM bendroflumethiazide
  • NATURETINTM polythiazide
  • RENESETM polythiazide
  • hydroflumethiazide marketed in
  • the terms “treat” or “treatment” or “treating” as used herein in reference to use of inhibitors of TET2 mutation-mediated IL- ⁇ proinflammatory activity for the treatment of a cardiovascular disease or disorder refers to therapeutic treatment, wherein the object is to prevent or slow the development of the disease, such as slow down the development of a cardiac disorder, or reducing at least one adverse effect or symptom of a cardiovascular condition, disease or disorder, i.e., any disorder characterized by insufficient or undesired cardiac function.
  • Adverse effects or symptoms of cardiac disorders are well-known in the art and include, but are not limited to, dyspnea, chest pain, palpitations, dizziness, syncope, edema, cyanosis, pallor, fatigue and death.
  • Treatment is generally "effective” if one or more symptoms or clinical markers are reduced as that term is defined herein.
  • a treatment is “effective” if the progression of a disease is reduced or halted. That is, “treatment” includes not just the improvement of symptoms or decrease of markers of the disease, but also a cessation or slowing of progress or worsening of a symptom that would be expected in absence of treatment.
  • Beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptom(s), diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable.
  • Treatment can also mean prolonging survival as compared to expected survival if not receiving treatment.
  • the term "treating" when used in reference to a treatment of a cardiovascular disease or disorder is used to refer to the reduction of a symptom and/or a biochemical marker of a cardiovascular disease or disorder, for example a reduction in at least one biochemical marker of a cardiovascular disease by at least about 10% would be considered an effective treatment.
  • biochemical markers of cardiovascular disease include a reduction of, for example, creatine phosphokinase (CPK), aspartate aminotransferase (AST), lactate dehydrogenase (LDH) in the blood, and/or a decrease in a symptom of cardiovascular disease, such as atherosclerosis, and/or an improvement in blood flow and cardiac function as determined by someone of ordinary skill in the art as measured by electrocardiogram (ECG or EKG), or echocardiogram (heart ultrasound), Doppler ultrasound and nuclear medicine imaging.
  • CPK creatine phosphokinase
  • AST aspartate aminotransferase
  • LDH lactate dehydrogenase
  • a reduction in a symptom of a cardiovascular disease by at least about 10% would also be considered effective treatment by the methods as disclosed herein.
  • a reduction in a symptom of cardiovascular disease for example a reduction of at least one of the following; dyspnea, chest pain, palpitations, dizziness, syncope, edema, cyanosis etc. by at least about 10% or a cessation of such systems, or a reduction in the size one such symptom of a cardiovascular disease by at least about 10% would also be considered as affective treatments by the methods as disclosed herein.
  • the therapeutic agent it is preferred, but not required that the therapeutic agent actually eliminate the cardiovascular disease or disorder, rather just reduce a symptom to a manageable extent.
  • the term "effective amount” as used herein refers to the amount of therapeutic agent of pharmaceutical composition to alleviate at least one or more symptom of the disease or disorder, and relates to a sufficient amount of pharmacological composition to provide the desired effect.
  • the term “effective amount” refers to the amount that is safe and sufficient to prevent or delay the development or a cardiovascular disease or disorder. The amount can thus cure or cause the cardiovascular disease or disorder to go into remission, slow the course of cardiovascular disease progression, slow or inhibit a symptom of a cardiovascular disease or disorder, slow or inhibit the establishment of secondary symptoms of a cardiovascular disease or disorder or inhibit the development of a secondary symptom of a cardiovascular disease or disorder.
  • the effective amount for the treatment of the cardiovascular disease or disorder depends on the type of cardiovascular disease to be treated, the severity of the symptoms, the subject being treated, the age and general condition of the subject, the mode of administration and so forth. Thus, it is not possible to specify the exact “effective amount”. However, for any given case, an appropriate "effective amount" can be determined by one of ordinary skill in the art using only routine experimentation.
  • efficacy of treatment can be judged by an ordinarily skilled practitioner, for example, efficacy can be assessed in animal models of a cardiovascular disease or disorder as discussed herein, and any treatment or administration of the compositions or formulations that leads to a decrease of at least one symptom of the cardiovascular disease or disorder as disclosed herein, for example, decreased levels of atherosclerosis in the blood vessels, increased heart ejection fraction, decreased rate of heart failure, decreased infarct size, decreased associated morbidity (pulmonary edema, renal failure, arrhythmias) improved exercise tolerance or other quality of life measures, and decreased mortality indicates effective treatment.
  • reduce in terms of the methods of treatment of chronic kidney disease and proteinuria described herein is meant the ability to cause an overall decrease preferably of 20% or greater, 30% or greater, 40% or greater, 45% or greater, more preferably of 50% or greater, of 55% or greater, of 60 % or greater, of 65% or greater, of 70% or greater, and most preferably of 75% or greater, 80% or greater, 85% or greater, 90% or greater, or 95% or greater, for a given parameter or symptom of a chronic kidney disease.
  • Reduce or inhibit can refer to, for example, symptoms of the disorder being treated, for example, high blood pressure, protein in the urine, etc.
  • appetite loss ; general ill feeling and fatigue; headaches; itching (pruritus) and dry skin; nausea; weight loss without trying to lose weight; etc.
  • sleep problems such as insomnia, restless leg syndrome, and obstructive sleep apnea
  • swelling of the feet and hands edema
  • vomiting typically in the morning.
  • an effective amount of a composition comprising an inhibitor of TET2 mutation-mediated IL- ⁇ (interleukin- ⁇ ) proinflammatory activity described herein is administered to a subject in order to alleviate one or more symptoms of chronic kidney disease.
  • TET2 mutation-mediated IL- ⁇ interleukin- ⁇
  • Alleviating a symptom chronic kidney disease is ameliorating any condition or symptom associated with the chronic kidney disease.
  • alleviating a symptom of a chronic kidney disease can involve reducing one or more symptoms of the chronic kidney disease in the subject relative to an untreated control suffering from chronic kidney disease or relative to the subject prior to the treatment.
  • reduction or degree of prevention is at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more, as measured by any standard technique.
  • the chronic kidney disease is significantly reduced or undetectable, as detected by any standard method known in the art, in which case the chronic kidney disease is considered to have been treated.
  • a patient who is being treated for a chronic kidney disease is one who a medical practitioner has diagnosed as having such a condition. Diagnosis can be by any suitable means known to one of ordinary skill in the art.
  • Diagnosis and monitoring can involve, for example, detecting the level of specific proteins or molecules in a urine, blood, or serum sample, such as, for example, albumin, calcium, cholesterol, complete blood count (CBC), electrolytes, magnesium, phosphorous, potassium, sodium, or any combination thereof; assays to detect, for example, creatinine clearance; creatinine levels; BUN (blood urea nitrogen); through the use of specific techniques or procedures, such as an abdominal CT scan, abdominal MRI, abdominal ultrasound, kidney biopsy, kidney scan, kidney ultrasound; via detection of changes in results of assays or tests for
  • erythropoietin PTH
  • bone density test or Vitamin D
  • Vitamin D any combination of such detection methods and assays.
  • compositions and methods described herein ideally result in a therapeutic significant reduction in one or more symptoms.
  • a therapeutically significant reduction in a symptom is, e.g. at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 125%, at least about 150% or more in a measured parameter as compared to a control or non-treated subject.
  • Measured or measurable parameters include clinically detectable markers of disease, for example, elevated or depressed levels of a biological marker, as well as parameters related to a clinically accepted scale of symptoms or markers for a disease or disorder. It will be understood, that the total daily usage of the compositions and formulations as disclosed herein will be decided by the attending physician within the scope of sound medical judgment. The exact amount required will vary depending on factors such as the type of disease being treated.
  • the inhibitors of TET2 mutation-mediated IL- ⁇ proinflammatory activity described herein can be administered using any means or route known to those of ordinary skill in the art and known to provide desired effects.
  • the terms "administering,” and “introducing” are used interchangeably herein and refer to the placement of the therapeutic agents as disclosed herein into a subject by a method or route which results in delivering of such agent(s) at a desired site.
  • the compounds can be administered by any appropriate route which results in an effective treatment in the subject, including topical administration.
  • Routes of administration include, but are not limited to aerosol, direct injection, intradermal, transdermal (e.g., in slow release polymers), intravitreal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, topical, oral, transmucosal, buccal, rectal, vaginal, transdermal, intranasal and parenteral routes.
  • parenteral administration and “administered parenterally” as used herein mean modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, sub capsular, subarachnoid, intraspinal, intracerebro spinal, and intrasternal injection and infusion.
  • systemic administration "administeredministered
  • peripheral administration and “administered peripherally” as used herein mean the administration therapeutic compositions other than directly into a tumor such that it enters the animal's system and, thus, is subject to metabolism and other like processes.
  • phrases "pharmaceutically acceptable” is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
  • pharmaceutically acceptable carrier means a pharmaceutically acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in maintaining the activity of or carrying or transporting the subject agents from one organ, or portion of the body, to another organ, or portion of the body.
  • each carrier must also be “acceptable” in the sense of being compatible with the other ingredients of the formulation.
  • the pharmaceutical formulation contains a compound of the invention in combination with one or more pharmaceutically acceptable ingredients.
  • the carrier can be in the form of a solid, semi-solid or liquid diluent, cream or a capsule.
  • These pharmaceutical preparations are a further object of the invention.
  • the amount of active compounds is between 0.1-95% by weight of the preparation, preferably between 0.2-20% by weight in preparations for parenteral use and preferably between 1 and 50% by weight in preparations for oral administration.
  • targeted delivery composition of the invention is formulated into pharmaceutical compositions or pharmaceutical formulations for parenteral administration, e.g., intravenous; mucosal, e.g., intranasal; enteral, e.g., oral; topical, e.g., transdermal; ocular, e.g., via corneal scarification or other mode of administration.
  • the pharmaceutical composition contains a compound of the invention in combination with one or more pharmaceutically acceptable ingredients.
  • the carrier can be in the form of a solid, semi-solid or liquid diluent, cream or a capsule.
  • This gene encodes a multifaceted epigenetic regulator of gene transcription that modulates hematopoietic stem and progenitor cell (HSPC) self-renewal ( 12- 15), but whose role in CVD remains largely unexplored.
  • HSPC hematopoietic stem and progenitor cell
  • BMT bone marrow transplantation
  • Lethally irradiated Ldlr-/- recipients were transplanted with suspensions of BM cells containing 10% Tet2-/- cells and 90% Tet2+/+ cells (10% KO-BMT mice), and then fed a high fat diet (HFD) for 9 weeks to induce atherosclerosis development (FIGS. 5A-5B).
  • HFD high fat diet
  • Tet2+/+ cells were obtained from mice carrying the CD45.1 variant of the CD45 hematopoietic antigen, whereas Tet2-/- cells were obtained from mice carrying the CD45.2 variant of this protein.
  • Control mice (10% WT-BMT) were transplanted with 10% CD45.2+ Tet2+/+ cells and 90% CD45.1+ Tet2+/+ cells.
  • CD45.2+ cells in 10% KO-BMT mice expanded further over time, reaching 42% of blood cells after 2 weeks of HFD (6 weeks after BMT) and 56% after 8 weeks of HFD (12 weeks after BMT), whereas the frequency of CD45.2+ cells remained constant in WT controls.
  • Tet2- deficient HSPCs This clonal expansion of Tet2- deficient HSPCs is similar to that observed when human cells carrying somatic TET2 mutations are transplanted into immune-deficient mice (16), showing that Tet2-/-murine cells and human TET2 mutant cells exhibit similar properties.
  • the efficient ablation of Tet2 in CD45.2+ cells of 10% KO- BMT mice was confirmed by qRT-PCR analysis of magnetically-sorted white blood cell (WBC) fractions (FIG. 1C), which exhibited a -92% purity of CD45.2+ cells (FIG. 6A). No changes were observed in the expression of Tetl or Tet3, two related epigenetic modulators.
  • BM genotype did not affect these metabolic parameters, it had a profound effect in atherosclerotic plaque size as 10% KO-BMT mice exhibited 73% larger plaques in the aortic root than WT controls (FIG. 2E). This was paralleled by an increase in macrophage numbers in the intima of the aortic wall in 10% KO-BMT mice (FIG. 2F), whereas no significant differences between genotypes were observed in lesional content of collagen or vascular smooth muscle cells (FIG. 8). No differences were observed either in plaque cell apoptosis measured by TUNEL (FIG. 9A).
  • Tet2 -deficient HSPCs expand preferentially into the myeloid lineage, mainly the macrophage population within the atherosclerotic plaque. Based on this observation, it was hypothesized that the expansion of Tet2 -deficient hematopoietic cells accelerates atherosclerosis mainly by generating a pool of macrophages with enhanced pro-atherogenic activities. To test this possibility, it was evaluated whether Tet2 deficiency affects macrophage functions relevant to atherosclerosis development. Consistent with the in vivo data, Tet2 deficiency did not have a significant effect in MCSF-induced proliferation (FIG. 10A) or oxysterol-induced apoptosis (FIG.
  • chemokines such as CXCL 1,2,3, CCL3 or CCL5
  • enzymes such as COX-2
  • FIG. 3G The increased expression of most of these proinflammatory genes was apparent at early time-points of stimulation and sustained over time. This pattern of gene expression was also evident in Tet2-/- macrophages stimulated with higher doses of LPS (100 ng/ml) and IFNy (20 ng/ml, FIG. 11C). Consistent with its effects at the level of transcription, Tet2 deficiency resulted in increased secretion of IL-6 protein (FIG. 3G).
  • Tet2 acts as a negative transcriptional regulator of pro-inflammatory responses, and are consistent with a previous study reporting that Tet2 represses IL-6 expression at late phase of LPS stimulation (77).
  • the results described herein reveal that Tet2 has broader effects on proinflammatory cytokine/chemokine expression than previously reported, particularly when
  • macrophages are co-stimulated with TH1 cytokines such as IFNy.
  • Tet2 Although many details of its role in regulating chromatin architecture remain unknown, Tet2 has emerged as a multifaceted epigenetic regulator that is able to facilitate both transcription activation and repression depending on the molecular and cellular context. Given that Tet2 loss-of- function is associated with increased IL- ⁇ gene expression, experiments were focused on potential mechanisms of Tet2 -mediated transcriptional repression in macrophages.
  • HDAC inhibition with TSA reduced transcript expression of other pro-inflammatory cytokines, such as IL-6 or TNF, in agreement with previous reports (27), and did not affect differences between genotypes (FIG. 14C). Consistent with these findings, H3 acetylation at the IL-6 promoter was comparable in Tet2-deficient and WT macrophages (FIG. 14D). Overall, these data indicate that reduced Hdac-mediated histone deacetylation can account for the effects of Tet2 loss-of-function on IL- ⁇ ⁇ expression in
  • IL- ⁇ is synthesized as an inactive protein (pro-IL- ⁇ ), which requires proteolytic cleavage for its secretion
  • IL- ⁇ cleavage is frequently mediated by the NLRP3 inflammasome, a multiprotein complex that is activated by a variety of danger signals and plays key roles in multiple inflammatory conditions.
  • NLRP3 inflammasome activation is a two-step process requiring a priming signal, that promotes pro-IL- ⁇ and NLRP3 expression, and an activation signal, that promotes inflammasome assembly.
  • IL- ⁇ cleavage was evaluated by Western Blot analysis in LPS/IFNy-primed macrophages treated with ATP for inflammasome activation.
  • FIGS. 4C, 4D Tet2- deficient macrophages exhibit significant increases in intracellular pro-IL- ⁇ and cleaved IL- ⁇ , consistent with the observed changes at the transcriptional level.
  • the effect on cleaved IL- ⁇ levels was substantially greater than that on pro-IL- ⁇ levels (1.6-fold, FIG.
  • Tet2 deficiency also increased basal expression of the activating IL- ⁇ receptor IL-1R1, without affecting the expression of the inhibitory IL- ⁇ receptor IL-1R2 or the IL-1 receptor antagonist (IL-1RA) (FIG. 4J). Consistent with his observation, Tet2 -deficient macrophages exhibited an enhanced response to treatment with recombinant IL- ⁇ , as reflected by a ⁇ 3-fold increase in IL-6 and IL- ⁇ transcript levels compared to WT macrophages (FIG. 4K).
  • the studies described herein provide mouse genetic evidence supporting a causal connection between exacerbated CVD in humans and clonal hematopoiesis associated with somatic TET2 mutations in HSPCs, and it represents the first report of a direct contribution of genome mosaicism in the hematopoietic system to the development of a non-hematological disease, specifically atherosclerosis. Furthermore, when considered in light of previous cancer studies (13, 14, 24), the results presented herein indicate that the expansion of TET2 -mutant HSPCs represents a pathophysiological mechanism that is shared between blood cancers and CVD.
  • mice C57B1/6J Ldlr-deficient mice (Ldlr-/-), C57B1/6J Tet2-deficient mice (Tet2-/-) (12) and C57B1/6 Cd45.1 Pep Boy mice were obtained from Jackson Laboratories. Mice were maintained on a 12-h light/dark schedule in a specific pathogen-free animal facility and given food and water ad libitum. The number of mice included in each study is indicated in the legends of the figures.
  • BM cells were isolated from femurs and tibias of donor mice after euthanasia.
  • Donor CD45.2+ cells were obtained from Tet2+/+ or -/- littermates; donor CD45.1+ cells were obtained from Pep Boy mice.
  • Recipient Ldlr-/- mice were irradiated in a pie cage (Braintree Scientific) to limit mobility and ensure equal dose of irradiation and were exposed to two radiation doses of 550 rad three hours apart using an X-RAD 320 Biological Irradiator. After the second irradiation, each recipient mouse was injected with 10 7 BM cells i.v. Sterilized caging, food and water were provided during the first 14 days post-transplant and water was supplemented with antibiotics (Sulfatrim). Mice that did not recover full pre -irradiation body weight 28 days after transplant were excluded from further analysis. Starting four weeks after BMT, mice were fed a high fat Western diet (Harlan-Teklad, Adjusted Calories Diet; 42% from fat, 0.2% cholesterol) for nine weeks to promote hyperlipidemia and the development of atherosclerosis.
  • Plasma cholesterol levels were determined using an enzymatic assay (Cholesterol E, WAKO Diagnostics). Blood glucose levels were measured with an ACCU-CHEK glucometer (Roche Diagnostics). Insulin tolerance tests (ITT) were performed on 5 h- fasted mice injected intraperitoneally with 0.6U/Kg human insulin (Humulin R, Eli Lilly), and blood glucose levels were measured immediately before and 15, 30, 60, 90, and 120 minutes after glucose injection.
  • ITT Insulin tolerance tests
  • VSMCs Vascular smooth muscle ceils
  • SMA mouse anti-smooth muscle a- actin
  • clone 1A4, SIGMA Vector Red Alkaline Phosphatase Substrate
  • Macrophages were detected with a rat anti-Mac3 monoclonal antibody (clone M3/84, Santa Cruz Biotechnologies), followed by biotin- conjugated goat anti-rat secondary antibody (Santa Cruz Biotechnologies), streptavidin-HRP (Vector Laboratories) and DAB substrate (Vector Laboratories). Specimens were counterstained with hematoxylin. Collagen content was determined by a modified Masson's trichrome staining with Fast Green as collagen stain. Microscopy images were acquired on a KEYENCE BZ-9000 microscope and analyzed using IMAGEJ software using the Color Deconvolution plugin.
  • Macrophage proliferation within atherosclerotic plaques was assessed by double immunofluorescent staining with monoclonal antibodies against Ki-67 (clone SP6, Vector Laboratories) and CD68 (Clone FA-1 1, AbD Serotec). After deparaffinization, antigen retrieval and blockade of non-specific interactions (5% horse serum in PBS, 45 min), histological sections were incubated for 2 h at 37 °C with primary antibodies. CD68 was visualized with Alexa Fluor 488-conjugated anti-rat IgG and Ki-67 with Alexa Fluor 635- conjugated anti-rabbit IgG (both from Life Technologies).
  • Peripheral blood was obtained from the facial vein. Bone marrow ceils were flushed out of two femurs and two tibias per mouse. Spleen was gently pressed through a 70 ⁇ , ⁇ cell strainer in PBS containing 10% fetal bovine serum (FBS) to prepare single cell suspensions. Aortic arches were digested for 45 minutes at 37°C in RPMI containing 10% FBS and 0.25 mg/ml LIBERASETM (Roche Life Science).
  • FBS fetal bovine serum
  • fluorescent antibodies were used for staining and flow cytometry analysis: eFluor450-conjugated anti-CD45.2, FITC-conjugated anti-CD45.2, Pe-Cy7-conjugated anti-CD45.1, FITC-conjugated anti-CD l ib, eFluor450-conjugated anti-CD l IB, PE-conjugated anti-CD l 15, APC-conjugated anti-CD3, FITC- conjugated anti-Lineage cocktail (from eBioscience); APC-Cy7-conjugated anti-B220, PerCP-Cy5.5- conjugated anti-Ly6G, PE-Cy7-conjugated anti-c-Kit, AlexaFluor647-conjugated anti-Sca-1 (from BD Biosciences); APC-conjugated anti-mouse F4/80 (from R&D Systems); PerCP-Cy5.5 anti- CD45.1 (from
  • HPSCs were identified as Lineage-, c-Kit+, Scal+; monocytes, as CD45+, CD 1 lb+, CD 1 15Hi; neutrophils, as CD45+, CD 1 lb+, CD 1 15 Lo , Ly6g+, T lymphocytes as CD45+, CD11B+, B220-, CD3+; B lymphocytes as CD45+, CDl lb-, CD3-, B220+; and aortic macrophages as CD45+, CD 11B+, F4/80 Hl . Dead cells were excluded from analysis with DAPI staining. 123count EBEADS (eBioscience) were used to quantify absolute cell numbers. A BD LSR II Flow Cytometer (BD Bioscience) was used for data acquisition. Data were analyzed with FLOWJO Software.
  • macrophages were treated for 8 hours with a combination of oxLDL, TNF, IFNy and cholesterol crystals.
  • Cholesterol Sigma was dissolved in 95% Ethanol, heated to 60° and cooled down at room temperature to allow crystallization.
  • RNA was reverse transcribed with ISCRIPTTM Advanced cDNA Synthesis Kit kits (Bio-Rad).
  • qRT-PCR was performed with Power SYBR® Green reagent (ThermoFisher Scientific) in a VIIA7 PCR system.
  • Primers for mouse gene expression studies are shown in Table 2.
  • TAQMAN® assays for human gene expression studies were from Life Technologies. Results were analyzed with the AACt method. 36B4, ⁇ -actin or the combination of both were used as reference genes for normalization. The following primers were used:
  • macrophages was isolated using an ALLPREP DNA/RNA Mini Kit (Qiagen), and checked for quality prior to submission to the Boston University Medical Campus Microarray Core Facility. The samples were amplified, labeled and hybridized on 6 Mouse Gene 2.0 ST arrays (Affymetrix, Santa Clara, CA) per the manufacturer's instructions. Gene level signal values were normalized together using the Robust Multiarray Average (RMA) algorithm, and annotated to BrainArray Cdf files (26) using affyPLM package (version 1.34.0) included in the Bioconductor software suite (v. 2.12). Differential expression was assessed using the moderated pairwise t test implemented in the limma package (version 3.14.4).
  • RMA Robust Multiarray Average
  • IL-6 and IL- ⁇ were analyzed in macrophage culture supernatants using commercial enzyme-linked immunoabsorbent assays (ELISA) according to manufacturer's instructions (R&D Systems).
  • Histone H3 acetylation was evaluated by chromatin immunoprecipitation combined with qRT-PCR (ChlP-qPCR) using the SimpleChlP Plus Enzymatic Chromatin Immunoprecipitation Kit (Cell Signaling Technologies) and anti-acetyl-Histone H3 antibody (EMD Millipore).
  • qRT-PCR was performed on a CFX96 thermal cycler (Bio-Rad) using SsoAdvanced Universal SYBR Green Master Mix (Bio-Rad). ChlP-qPCR data was analyzed using the percent input method. Acetylated H3 percent input was normalized to histone H3 ChIP percent input and presented as the ratio H3Ac:H3. The following primers were used:
  • An NLEP3 inhibitor showed greater atheroprotective activity in chimeric mice reconstituted with TET2 ⁇ deficient cells than in nonchimeric mice.
  • MCC950 exerts greater atheroprotective actions in conditions of clonal hematopoiesis associated with TET2 deficiency, as it decreased atherosclerotic plaque size by -50% in 10% KO-BMT mice, whereas it led to a nonstatistically significant -20% reduction in 10% WT-BMT controls.
  • NLRP3 -mediated IL-1 ⁇ overproduction is essential for the atherogenic consequences of clonal expansion of TET2- deficient cells.
  • Tet2-mediated clonal hematopoiesis accelerates experimental heart failure
  • Heart failure was induced in C57/B16 mice by pressure overload, achieved by transverse aortic constriction (TAC), or by chronic ischemia, induced by the permanent ligation of the left anterior descending (LAD) artery (FIGS. 19, 20).
  • TAC transverse aortic constriction
  • LAD left anterior descending
  • Tet2 -deficient hematopoietic cells were used to partially reconstitute the bone marrow of lethally irradiated mice, leading to their clonal expansion.
  • Tet2 was specifically ablated in myeloid cells using Cre recombinase expressed from the LysM promoter.
  • Tet2- deficiency led to worsened cardiac remodeling and function regardless of the means of Tet2 ablation.
  • Tet2-deficincy led to greater hypertrophy and systolic dysfunction regardless of the means of Tet2 ablation.
  • Tet2 deficiency was associated with a failure to resolve inflammation at late time points, and this was associated with increased IL- ⁇ expression.
  • Treatment with the NLRP3 inflammasome inhibitor MCC950 protected against the development of heart failure and eliminated differences in cardiac parameters between Tet2-deficient and wild-type (WT) mice (FIGS. 21, 22).
  • Kidney failure is estimated to afflict 5 to 10% of the world population. Risk factors for kidney disease include hypertension and diabetes. It is increasingly appreciated that there is crosstalk between the heart and kidneys, and that renal function is a strong predictor of outcome in ischemic CVD and heart failure.
  • Tet2 in myeloid hematopoietic cells is associated with greater kidney pathology in two models of murine renal failure. These data indicate that individuals with TET2 -mediated clonal hematopoiesis are at greater risk of kidney failure. Because Tet2- deficiency is associated with elevated IL- ⁇ signaling, therapies that target the NLRP3 inflammasome are useful for individuals with kidney failure.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Hematology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Developmental Biology & Embryology (AREA)
  • Cell Biology (AREA)
  • Pathology (AREA)
  • Plant Pathology (AREA)
  • Mycology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

As demonstrated herein, a preferential and progressive expansion of a subset of hematopoietic cells bearing somatic mutations in TET2 leads to pro-inflammatory IL-1β signaling at multiple levels, including increased IL-1β transcription, increased NLRP3 inflammasome-mediated IL-1β secretion, and increased IL-1-Receptor 1-mediated IL-1β signaling. Accordingly, provided herein are compositions, methods, and assays for modulating TET2 mutation-mediated IL-1β (interleukin-1β) proinflammatory activity, particularly when caused by somatic mutations in TET2.

Description

AGE-ASSOCIATED CLONAL HEMATOPOIESIS ACCELERATES CARDIO-METABOLIC
DISEASE DEVELOPMENT
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims benefit under 35 U.S.C. § 119(e) of U.S. Provisional No. 62/368,338, filed July 29, 2016, the contents of which are incorporated herein by reference in their entirety.
GOVERNMENT SUPPORT
[0002] This invention was made with Government Support under Contract Nos. HL081587, HL116591, HL131006, and HL132564 awarded by the National Institutes of Health (NIH). The Government has certain rights in the invention
TECHNICAL FIELD
[0003] The technical field relates to compositions, methods, and assays for the treatment, prevention and diagnosis of cardio-metabolic diseases, chronic kidney disease, and other age- dependent chronic diseases that involve pathological inflammatory responses.
BACKGROUND
[0004] Macrovascular diseases (CVD and stroke) steeply increase with age and account for >85% of chronic disease deaths in those >70 years of age (from Belsky et al. Proc. Natl. Acad. Sci. USA 2015). While cardiovascular disease (CVD) is the leading cause of death in the elderly, almost 60% of elderly patients with atherosclerotic CVD have either no or just one conventional CV risk factors (e.g. hypertension, hypercholesterolemia, etc.). As can be seen in Khot et al. (JAMA 2003), more than 60% of patients with CVD display either zero or one conventional risk factors. Similarly, retrospective analysis of CVD patients revealed that up to 50% of these patients were classified as low-risk when applying predictive scales based on traditional risk factors (Akosah et al. JACC 2003). Consistent with these findings, the recent PESA and AWHS studies have reported that subclinical atherosclerosis can be detected in more than 57% of asymptomatic adults categorized as "low CV risk" on the basis of conventional 10-year risk prediction algorithms (Fernandez-Friera et al.
Circulation 2015; Laclaustra et al. JACC 2016). Among others, these clinical studies suggest that there are as-yet-unidentified causal risk factors that drive cardiovascular disease in the human population.
SUMMARY
[0005] The present invention is directed, in part, to a new paradigm of causal risk for cardiovascular and related diseases and provides novel compositions, methods, and assays for treating, preventing, and/or diagnosing the same. Epidemiological studies show that hematopoietic stem cells (HSCs) develop mutations that promote their clonal expansion at a relatively high frequency in the aging population. While very few of the HSCs acquire subsequent mutations in oncogenes that lead to blood cancers, the mechanistic findings of the studies described herein, using Tet2 as an example, show that a single mutation that occurs frequently can predispose an individual to CVD and stroke that are common in the elderly (>50% of individuals). Accordingly, the findings described herein demonstrate that there is a common mechanistic basis between age-associated CVD and hematological cancers. These data provide the first experimental evidence supporting a mechanism whereby somatic mutations in HSCs represent a new causal risk factor for CVD, potentially adding to the predictive capabilities of the conventional risk factors (hyperlipidemia, hypertension, diabetes and smoking) that were deduced approximately 50 years ago. These data also provide the first mechanistic evidence for how somatic mutations in HSCs can lead to chronic, noncancerous diseases, providing novel personalized therapies or preventive strategies for individuals carrying somatic mutations in blood cells. For example, where neutralizing antibodies against IL- Ιβ are being tested in large, ongoing clinical trials for the treatment of CVD, the data described herein indicate that IL-lbeta blockade or NLRP3 inflammasome inhibition can be particularly effective for the prevention/treatment of CVD in individuals carrying somatic mutations in TET2. In some embodiments, other clonal hematopoiesis driver gene mutations mediate IL-Ιβ pro-inflammatory diseases as well.
[0006] As described herein, competitive bone marrow transplantation strategies into Ldlr_/" mice were used to examine the contribution of the clonal expansion of Tet2 -deficient hematopoietic cells to atherosclerosis development. Bone marrow reconstitution with as few as 10% Tet2-/- cells was sufficient for its expansion into all blood cell lineages and led to a marked increase in atherosclerotic plaque size. Mechanistically, the exacerbated atherosclerosis was related to the effects of Tet2 on proinflammatory activation of macrophages, but independent of changes in blood cell counts and macrophage proliferation or apoptosis. Tet2-/- macrophages exhibited a pronounced increase in proinflammatory cytokine/chemokine expression, particularly of IL-Ιβ. Tet2 deficiency also enhanced NLRP3 inflammasome priming and IL-1 receptor 1 expression, supporting a predominant role for increased IL-Ιβ signaling in the exacerbated atherosclerosis associated with Tet2 -deficient cell expansion. These results provide mouse genetic evidence supporting a causal connection between somatic mutations in TET2 in blood cells and cardiometabolic diseases, such as CVD, in humans, and document a new mechanism of pro-inflammatory IL-Ι β signaling regulation.
[0007] Accordingly, provided herein, in some aspects, are methods for treating a subject having, or at risk for, a TET2 mutation-mediated IL-Ιβ proinflammatory disease comprising administering a therapeutically effective amount of a pharmaceutical composition comprising an inhibitor of TET2 mutation-mediated IL-Ιβ (interleukin-ΐβ) proinflammatory activity and a pharmaceutically acceptable carrier to a subject having one or more TET2 somatic mutations in a sub-population of peripheral blood hematopoietic cells.
[0008] In some embodiments of these methods and all such methods described herein, the one or more TET2 somatic mutations in the sub-population of peripheral blood hematopoietic cells cause clonal hematopoiesis in the subject.
[0009] In some embodiments of these methods and all such methods described herein, at least 2% of the peripheral blood hematopoietic cells have the one or more TET2 mutations.
[00010] In some embodiments of these methods and all such methods described herein, the one or more TET2 somatic mutations are selected from an S282F mutation in SEQ ID NO: 3, an N312S mutation in SEQ ID NO: 3, an L346P mutation in SEQ ID NO: 3, an S460F mutation in SEQ ID NO: 3, a D666G mutation in SEQ ID NO: 3, a P941S mutation in SEQ ID NO: 3, and a CI 135Y mutation in SEQ ID NO: 3.
[00011] In some embodiments of these methods and all such methods described herein, the inhibitor of TET2 mutation-mediated IL-Ιβ proinflammatory activity is an IL-Ιβ inhibitor.
[00012] In some embodiments of these methods and all such methods described herein, the IL-Ιβ inhibitor is an IL-Ιβ inhibitor antibody or antigen-binding fragment thereof that binds to IL-Ιβ and reduces IL-Ιβ binding to its receptor(s).
[00013] In some embodiments of these methods and all such methods described herein, the IL-Ιβ inhibitor antibody or antigen-binding fragment thereof is selected from ABT981, an anti-interleukin- 1β inhibitor antibody by ABZYME, APX002, Canakinumab/Ilaris, CDP48, immunereszumab, LY2189102, MEDI8968, and XOMA052.
[00014] In some embodiments of these methods and all such methods described herein, the IL-Ιβ inhibitor is an IL- 1 receptor antagonist.
[00015] In some embodiments of these methods and all such methods described herein, the IL-1 receptor antagonist is selected from CDP484, CP412245, CYT013 ILlbQb, XL 130, AMG108, HL 2351, ILlHyl, AXXO, orthokine, PRT 1000, anakinra, and rilonacept.
[00016] In some embodiments of these methods and all such methods described herein, the IL-Ιβ inhibitor is a small molecule or microRNA inhibitor that inhibits IL-^-mediated pro-inflammatory activity.
[00017] In some embodiments of these methods and all such methods described herein, the small molecule inhibitor is selected from AC201, CP412245, MCC950 or CRID3, inflabion, inflammasome modulator OPSONA, PGE3935199, PGE527667, TRK530, β-hydroxybutyrate (BHB), and microRNA-223. In some such embodiments, the small molecule inhibitor is MCC950.
[00018] In some embodiments of these methods and all such methods described herein, the method further comprises monitoring hematopoietic cell clonality, IL-Ιβ proinflammatory activity, or a combination thereof following the administration of the inhibitor of TET2 mutation-mediated IL-Ι β proinflammatory activity.
[00019] In some embodiments of these methods and all such methods described herein, the method further comprises decreasing the number or percentage of hematopoietic cells comprising the one or more TET2 mutations in the subject by performing therapeutic cytapheresis on the subject.
[00020] In some embodiments of these methods and all such methods described herein, the method further comprises administering one or more additional therapeutic agents to the subject, in addition to the inhibitor of TET2 mutation-mediated IL-Ι β (interleukin- ΐβ) proinflammatory activity.
[00021] In some embodiments of these methods and all such methods described herein, the TET2 mutation-mediated IL-Ιβ proinflammatory disease is a cardiometabolic disease or disorder.
[00022] In some embodiments of these methods and all such methods described herein, the TET2 mutation-mediated IL-Ιβ proinflammatory disease is a chronic kidney disease or disorder.
[00023] Also provided herein, in some aspects, are methods for treating a subject having, or at risk for, a TET2 mutation-mediated IL- Ιβ proinflammatory disease comprising: (a) sequencing a hematopoietic cell sample from a subject to identify one or more somatic mutations in TET2 in the hematopoietic cell sample; and (b) administering a therapeutically effective amount of a
pharmaceutical composition comprising an inhibitor of TET2 mutation-mediated IL-Ιβ (interleukin- 1β) proinflammatory activity and a pharmaceutically acceptable carrier if one or more somatic mutations in TET2 are identified in the hematopoietic cell sample.
[00024] In some embodiments of these methods and all such methods described herein, the hematopoietic cell sample is a peripheral blood hematopoietic cell sample.
[00025] In some embodiments of these methods and all such methods described herein, the hematopoietic cell sample is enriched for myeloid-derived cells.
[00026] In some embodiments of these methods and all such methods described herein, the one or more TET2 somatic mutations identified in the hematopoietic cell sample cause clonal hematopoiesis in the subject.
[00027] In some embodiments of these methods and all such methods described herein, at least 2% of the hematopoietic cells are identified as having one or more TET2 mutations.
[00028] In some embodiments of these methods and all such methods described herein, the one or more TET2 somatic mutations are selected from an S282F mutation in SEQ ID NO: 3, an N312S mutation in SEQ ID NO: 3, an L346P mutation in SEQ ID NO: 3, an S460F mutation in SEQ ID NO: 3, a D666G mutation in SEQ ID NO: 3, a P941 S mutation in SEQ ID NO: 3, and a C I 135Y mutation in SEQ ID NO: 3.
[00029] In some embodiments of these methods and all such methods described herein, the inhibitor of TET2 mutation-mediated IL-Ιβ proinflammatory activity is an IL- Ιβ inhibitor. [00030] In some embodiments of these methods and all such methods described herein, the IL-Ιβ inhibitor is an IL-Ιβ inhibitor antibody or antigen-binding fragment thereof that binds to IL-Ιβ and reduces IL-Ιβ binding to its receptor(s).
[00031] In some embodiments of these methods and all such methods described herein, the IL-Ιβ inhibitor antibody or antigen-binding fragment thereof is selected from ABT981, an anti-interleukin- 1β inhibitor antibody by ABZYME, APX002, Canakinumab/Ilaris, CDP48, immunereszumab, LY2189102, MEDI8968, and XOMA052.
[00032] In some embodiments of these methods and all such methods described herein, the IL-Ιβ inhibitor is an IL-1 receptor antagonist.
[00033] In some embodiments of these methods and all such methods described herein, the IL-1 receptor antagonist is selected from CDP484, CP412245, CYT013 ILlbQb, XL 130, AMG108, HL 2351, ILlHyl, AXXO, orthokine, PRT 1000, anakinra, and rilonacept.
[00034] In some embodiments of these methods and all such methods described herein, the IL-Ιβ inhibitor is a small molecule or microR A inhibitor that inhibits IL-^-mediated pro-inflammatory activity.
[00035] In some embodiments of these methods and all such methods described herein, the small molecule or microRNA inhibitor is selected from AC201, CP412245, MCC950 or CRID3, inflabion, inflammasome modulator OPSONA, PGE3935199, PGE527667, TRK530, β-hydroxybutyrate (BHB), and microRNA-223. In some such embodiments, the small molecule inhibitor is MCC950.
[00036] In some embodiments of these methods and all such methods described herein, the method further comprises monitoring hematopoietic cell clonality, IL-Ιβ proinflammatory activity, or a combination thereof following the administration of the inhibitor of TET2 mutation-mediated IL-Ιβ proinflammatory activity.
[00037] In some embodiments of these methods and all such methods described herein, the method further comprises decreasing the number or percentage of hematopoietic cells comprising the one or more TET2 mutations in the subject by performing therapeutic cytapheresis on the subject.
[00038] In some embodiments of these methods and all such methods described herein, the method further comprises administering one or more additional therapeutic agents to the subject, in addition to the inhibitor of TET2 mutation-mediated IL-Ιβ proinflammatory activity.
[00039] In some embodiments of these methods and all such methods described herein, the TET2 mutation-mediated IL-Ιβ proinflammatory disease is a cardiometabolic disease or disorder.
[00040] In some embodiments of these methods and all such methods described herein, the TET2 mutation-mediated IL-Ιβ proinflammatory disease is a chronic kidney disease or disorder.
[00041] Also provided herein, in some aspects, are pharmaceutical compositions comprising an inhibitor of TET2 mutation-mediated IL-Ιβ (interleukin-ΐβ) proinflammatory activity and a pharmaceutically acceptable carrier for use in a subject having one or more TET2 somatic mutations in a sub-population of hematopoietic cells.
[00042] In some embodiments of these compositions and all such compositions described herein, the one or more TET2 somatic mutations in the sub-population of hematopoietic cells cause clonal hematopoiesis in the subject.
[00043] In some embodiments of these compositions and all such compositions described herein, at least 2% of the hematopoietic cells in the subject have the one or more TET2 mutations.
[00044] In some embodiments of these compositions and all such compositions described herein, the one or more TET2 somatic mutations are selected from an S282F mutation in SEQ ID NO: 3, an N312S mutation in SEQ ID NO: 3, an L346P mutation in SEQ ID NO: 3, an S460F mutation in SEQ ID NO: 3, a D666G mutation in SEQ ID NO: 3, a P941S mutation in SEQ ID NO: 3, and a CI 135Y mutation in SEQ ID NO: 3.
[00045] In some embodiments of these compositions and all such compositions described herein, the inhibitor of TET2 mutation-mediated IL-Ιβ proinflammatory activity is an IL-Ιβ inhibitor.
[00046] The pharmaceutical composition of claim 35, wherein the IL- ^inhibitor is an IL-Ιβ inhibitor antibody or antigen-binding fragment thereof that binds to IL-Ιβ and reduces IL-Ιβ binding to its receptor(s).
[00047] In some embodiments of these compositions and all such compositions described herein, the IL-Ιβ inhibitor antibody or antigen-binding fragment thereof is selected from ABT981, an anti- interleukin-ΐβ inhibitor antibody by ABZYME, APX002, Canakinumab/Ilaris, CDP48,
immunereszumab, LY2189102, MEDI8968, and XOMA052.
[00048] In some embodiments of these compositions and all such compositions described herein, the IL-Ιβ inhibitor is an IL-1 receptor antagonist.
[00049] The pharmaceutical composition of claim 38, wherein the IL-1 receptor antagonist is selected from CDP484, CP412245, CYT013 ILlbQb, XL 130, AMG108, HL 2351, ILlHyl, AXXO, orthokine, PRT 1000, anakinra, and rilonacept.
[00050] In some embodiments of these compositions and all such compositions described herein, the IL-Ιβ inhibitor is a small molecule inhibitor that inhibits IL-^-mediated pro-inflammatory activity.
[00051] In some embodiments of these compositions and all such compositions described herein, the small molecule inhibitor is selected from AC201, CP412245, MCC950 or CRID3, inflabion, inflammasome modulator OPSONA, PGE3935199, PGE527667, TRK530, β-hydroxybutyrate (BHB), and microRNA-223. In some such embodiments, the small molecule inhibitor is MCC950.
[00052] In some embodiments of these compositions and all such compositions described herein, the TET2 mutation-mediated IL-Ιβ proinflammatory disease is a cardiometabolic disease or disorder. [00053] In some embodiments of these compositions and all such compositions described herein, the TET2 mutation-mediated IL-Ιβ proinflammatory disease is chronic kidney disease or disorder. Definitions
[00054] Unless otherwise defined herein, scientific and technical terms used in connection with the present application shall have the meanings that are commonly understood by those of ordinary skill in the art to which this disclosure belongs. It should be understood that this invention is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such can vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims. Definitions of common terms in immunology, and molecular biology can be found in The Merck Manual of Diagnosis and Therapy, 19th Edition, published by Merck Sharp & Dohme Corp., 2011 (ISBN 978-0-911910-19-3); Robert S. Porter et al. (eds.), The Encyclopedia of Molecular Cell Biology and Molecular Medicine, published by Blackwell Science Ltd., 1999-2012 (ISBN
9783527600908); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a
Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8); Immunology by Werner Luttmann, published by Elsevier, 2006; Janeway's Immunobiology, Kenneth Murphy, Allan Mowat, Casey Weaver (eds.), Taylor & Francis Limited, 2014 (ISBN 0815345305, 9780815345305); Lewin's Genes XI, published by Jones & Bartlett Publishers, 2014 (ISBN- 1449659055); Michael Richard Green and Joseph Sambrook, Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (2012) (ISBN 1936113414); Davis et al , Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (2012) (ISBN 044460149X); Laboratory Methods in Enzymology: DNA, Jon Lorsch (ed.) Elsevier, 2013 (ISBN 0124199542); Current Protocols in Molecular Biology (CPMB), Frederick M. Ausubel (ed.), John Wiley and Sons, 2014 (ISBN 047150338X, 9780471503385), Current Protocols in Protein Science (CPPS), John E. Coligan (ed.), John Wiley and Sons, Inc., 2005; and Current Protocols in Immunology (CPI) (John E. Coligan, ADA M Kruisbeek, David H Margulies, Ethan M Shevach, Warren Strobe, (eds.) John Wiley and Sons, Inc., 2003 (ISBN 0471142735, 9780471142737), the contents of which are all incorporated by reference herein in their entireties.
[00055] As used herein, an "inhibitor of TET2 mutation-mediated IL-Ιβ (interleukin-ΐβ) proinflammatory activity" refers to any agent or molecule that significantly blocks, inhibits, reduces, or interferes with the downstream effects of somatic mutations in TET2 that lead to increased IL-Ιβ proinflammatory activity or signaling in vitro, in situ, and/or in vivo, including increased IL-Ιβ transcription, increased NLRP3 inflammasome-mediated IL-Ιβ secretion, and/or increased IL-1- receptor I (IL-lRl)-mediated IL-Ιβ signaling.
[00056] As used herein, the terms reduce(s)/reduced/reducing/reduction,
inhibit(s)/inhibiting/inhibited or decrease(s)/decreasing/decreased generally means either a reduction or inhibition of at least 5%, at least 10%, at least 25%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or more, compared to the level of IL-Ιβ transcription, IL-Ιβ translation, NLRP3 inflammasome-mediated IL-Ιβ secretion, and/or IL-Ιβ binding to IL-1 receptor and consequent IL-1 -receptor I (IL-lRl)-mediated IL-Ιβ signaling under the same conditions but without the presence of inhibitors of TET2 mutation-mediated IL-Ιβ proinflammatory activity described herein.
[00057] A disease or medical condition is considered to be mediated by "IL-Ιβ (interleukin-ΐβ) proinflammatory activity" if the spontaneous or experimental disease or medical condition is associated with, or mediated by, for example, elevated levels of IL- 1 β in bodily fluids or tissue, or if cells or tissues taken from the body produce elevated levels of IL-1 β in culture.
[00058] As used herein, the phrase "cardiovascular condition, disease or disorder" is intended to include all disorders characterized by insufficient, undesired or abnormal blood vessel or cardiac function, e.g. hypertension, ischemic heart disease, hypertensive heart disease and pulmonary hypertensive heart disease, valvular disease, cardiac arrhythmia, vascular disease, myocardial infarction, congestive heart failure, peripheral vascular disease, myocarditis, atherosclerosis, restenosis, and any condition which leads to congestive heart failure in a subject, particularly a human subject.
[00059] As used herein, an "IL-Ιβ inhibitory compound" or "IL-Ιβ inhibitor" or "inhibitor of IL- 1β" refers to a compound or agent capable of specifically inhibiting or specifically preventing activation of cellular receptors to IL-Ιβ and consequent downstream effects of IL-1 β signaling.
[00060] As used herein, "antibodies" or "antigen-binding fragments" thereof include monoclonal, human, humanized or chimeric antibodies, single chain antibodies, Fab fragments, F(ab') fragments, fragments produced by a Fab expression library, and/or binding fragments of any of the above.
Antibodies also refer to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e. , molecules that contain antigen or target binding sites or "antigen- binding fragments." The immunoglobulin molecules described herein can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g. , IgGl, IgG2, IgG3, IgG4, IgAl and IgA2) or subclass of immunoglobulin molecule, as is understood by one of skill in the art.
[00061] The terms "antibody fragment" or "antigen-binding fragment" include: (i) the Fab fragment, having VL, CL, VH and CHI domains; (ii) the Fab' fragment, which is a Fab fragment having one or more cysteine residues at the C-terminus of the CHI domain; (iii) the Fd fragment having VH and CHI domains; (iv) the Fd' fragment having VH and CHI domains and one or more cysteine residues at the C-terminus of the CHI domain; (v) the Fv fragment having the VL and VH domains of a single arm of an antibody; (vi) a dAb fragment (Ward et al , Nature 341, 544-546 (1989)) which consists of a VH domain or a VL domain ; (vii) isolated CDR regions; (viii) F(ab')2 fragments, a bivalent fragment including two Fab' fragments linked by a disulphide bridge at the hinge region; (ix) single chain antibody molecules (e.g. single chain Fv; scFv) (Bird et al., Science 242:423-426 (1988); and Huston et al, PNAS (USA) 85:5879-5883 (1988)); (x) "diabodies" with two antigen binding sites, comprising a heavy chain variable domain (VH) connected to a light chain variable domain (VL) in the same polypeptide chain (see, e.g. , EP 404,097; WO 93/11161; and Hollinger et al. , Proc. Natl. Acad. Sci. USA, 90:6444-6448 (1993)); (xi) "linear antibodies" comprising a pair of tandem Fd segments (VH-Ch1-VH-Ch1) which, together with complementary light chain polypeptides, form a pair of antigen binding regions (Zapata et al. Protein Eng. 8(10): 1057-1062 (1995); and U.S. Pat. No. 5,641,870); and modified versions of any of the foregoing (e.g., modified by the covalent attachment of polyalkylene glycol (e.g., polyethylene glycol, polypropylene glycol, polybutylene glycol) or other suitable polymer).
[00062] . As used herein, an "interleukin-1 receptor antagonist" ("IL-lra") is any agent or molecule, including small molecules and antibody or antigen-binding fragments thereof, that binds to an interleukin-1 receptor thereby preventing binding of IL-Ιβ to the receptor and thereby inhibiting IL-i -mediated pro-inflammatory activity.
[00063] As used herein, "small molecule inhibitors" include, but are not limited to, small peptides or peptide-like molecules, soluble peptides, and synthetic non-peptidyl organic or inorganic compounds. A small molecule inhibitor or antagonist can have a molecular weight of any of about 100 to about 20,000 daltons (Da), about 500 to about 15,000 Da, about 1000 to about 10,000 Da.
[00064] As used herein, the terms "TET2 activating compound " or "TET2 potentiator" or "TET2 activator" or "TET2 agonist" refer to a molecule or agent that mimics or up-regulates (e.g., increases, potentiates or supplements) the biological activity of TET2, thereby decreasing or inhibiting IL-Ιβ (interleukin-1 β) proinflammatory activity caused by deficient TET2 activity.
[00065] The terms "biological sample" or "sample" as used herein refers to a cell or population of cells or a quantity of tissue or fluid from a subject comprising one or more hematopoietic cells. Most often, the biological sample has been removed from a subject, but the term "biological sample" can also refer to cells or tissue analyzed in vivo, i.e., without removal from the subject.
[00066] As used herein, the term "population of hematopoietic cells" encompasses a
heterogeneous or homogeneous population of hematopoietic cells and/or hematopoietic progenitor cells.
[00067] The terms "isolate" and "methods of isolation," as used herein, refer to any process whereby a cell or population of cells, such as a population of hematopoietic cells, is removed from a subject or sample in which it was originally found, or a descendant of such a cell or cells.
BRIEF DESCRIPTION OF THE DRAWINGS
[00068] FIGS. 1A-1G demonstrate expansion of Tet2-deficient cells after competitive bone marrow transplantation in LDLR-KO mice. LDLR-KO mice were transplanted with bone marrow cell suspensions containing 10% CD45.2+ Tet2-/- cells (10% KO BMT) or 10% CD45.2+ Tet2+/+ cells (10% WT BMT) and 90% CD45.1+ Tet2+/+ cells. 1A. Percentage of CD45.2+ white blood cells (WBC) in peripheral blood, evaluated by flow cytometry (n=9 mice/genotype). IB. Representative images of CD45.1/CD45.2 flow cytometry analysis of WBC populations. 1C. qRT-PCR analysis of Tetl, Tet2 and Tet3 transcript levels in magnetically-sorted CD45.2+ WBCs from 10% KO-BMT (n=9) and 10% KO-BMT mice (n=7). 1D-1F. Percentage of CD45.2+ cells within the main hematopoietic lineages in bone marrow (ID), spleen (IE) and peripheral blood (IF) 13 weeks after bone marrow transplantation, measured by flow cytometry (n=15, 10% WT-BMT mice; n=18, 10% KO-BMT mice). 1G. Representative images of CD45.1/CD45.2 flow cytometry analysis of peripheral blood monocytes and T cells in 10% KO-BMT mice. Statistical significance was evaluated by 2-way ANOVA with Sidak multiple comparison tests (*p<0.05, ** p<0.01, *** p<0.001).
[00069] FIGS. 2A-2H demonstrate exacerbated atherosclerosis after Tet2 -deficient hematopoietic cell expansion. 10% KO-BMT (n=8) and 10% WT-BMT mice (n=10) were fed a high fat atherogenic diet for 9 weeks. 2A. Body weight. 2B. Blood glucose levels. 2C. Insulin tolerance Test. 2D. Plasma cholesterol levels. 2E. Aortic root plaque size, average of five independent sections. Representative images of hematoxylin-eosin-stained sections are shown and atherosclerotic plaques are delineated by discontinuous lines. 2F. Plaque macrophage content, evaluated by immunohistochemical staining of the macrophage marker Mac3. 2G. Percentage of CD45.2+ cells within the total immune cell (CD45+) population, F4/80+ macrophages and CD3+ T cells in the atherosclerotic aortic arch (n=4 pools of 2 aortic arches per genotype). 2H. Representative images of CD45.1/CD45.2 flow cytometry analysis of aortic macrophages and T cells. Statistical significance was evaluated by two-tailed unpaired Student t test (2A, 2D, 2E, 2F), regular 2-way ANOVA with Sidak multiple comparison tests (2B, 2G, ***p<0.001) or repeated measures 2-way ANOVA (2C).
[00070] FIGS. 3A-3G demonstrate increased pro-inflammatory activation of Tet2-deficient macrophages. Thiogly collate -elicited peritoneal macrophages were isolated from Tet2-/- mice or WT controls (n=3 mice/genotype in 3A-3C; n=4 mice/genotype in 3D-3F) and treated with a combination of 10 ng/ml LPS and 2 ng/ml IFNy to induce pro-inflammatory activation. 3A. Heat map of genes with expression change greater than 1.5-fold (q-value<0.05) from the genome-wide expression profiling by microarray. 3B. PANTHER analysis of genome-wide expression profiling by microarray. Three over-represented protein classes were identified in Tet2-/- macrophages compared to all genes in Mus musculus (with a Bonferroni correction P-value<0.05). 3C. Heat map of selected genes upregulated in Tet2-/- macrophages with expression change greater than 1.5-fold (q-value<0.05) from the genome-wide expression profiling by microarray. 3D-3F. qRT-PCR analysis of transcript levels of pro-inflammatory cytokines (3D), chemokines (3E) and COX2 (3F). 3G. ELISA analysis of IL-6 protein levels in the supernatant of cultured macrophages treated as indicated for 16 hours. Statistical significance in 3C-3F was evaluated by 2-way ANOVA (p value for genotype effect shown in graph) with Sidak multiple comparison tests (*p<0.05, ** p<0.01, *** p<0.001).
[00071] FIGS. 4A-4K demonstrate enhanced NLRP3 inflammasome -mediated IL-Ιβ production and signaling in Tet2 -deficient macrophages. 4A, 4B. qRT-PCR analysis of IL-Ιβ transcript levels in Tet2-/- and +/+ peritoneal macrophages treated with a combination of 25 μg/ml oxLDL, 5 ng/ml TNF and 2 ng/ml IFNy (4A, n=6 mice/genotype) or in aortic arch samples (4B) obtained from HFD-fed 10%WT-BMT mice (n=9) and 10% KO-BMT mice (n=8). 4C, 4D. Western Blot analysis of intracellular IL-Ιβ and J3-actin in peritoneal macrophages isolated from Tet2-/- mice and WT controls (n=3/genotype) after 6 hours of LPS/IFNy treatment (4C) or after the same treatment combined with a final 15 minute incubation with 5 mM ATP (4D). 4E. Western Blot analysis of IL-Ιβ protein levels in the supernatant of Tet2-/- and +/+ macrophages (n=3/genotype) after 6 hours of LPS/IFNy treatment combined with a final 30 minute incubation with 5 mM ATP. 4F. ELISA analysis of IL-Ιβ protein levels in the supernatant of Tet2-/- and +/+ macrophages (n=3/genotype) after 6 hours of LPS/IFNy treatment combined with a final 30 minute incubation with 5 mM ATP in the presence or absence of 10 μΜ MCC950. 4G. qRT-PCR analysis of NLRP3 transcript levels in LPS/IFNy-treated peritoneal macrophages isolated from Tet2-/- mice or WT controls (n=4/genotype). 4H. Western Blot analysis of NLRP3 protein levels in peritoneal macrophages isolated from Tet2-/- mice and WT controls
(n=3/genotype) and treated for 6 hours with LPS/IFNy. 41. ELISA analysis of IL-Ιβ protein levels in the supernatant of Tet2-/- and WT macrophages (n=3/genotype) after 8 hours of oxLDL/TNF/IFNy stimulation in the presence of 1 mg/ml cholesterol crystals. 4J. qRT-PCR analysis of IL-1R1, IL-1R2 and IL-Ιβ RA transcript levels in LPS/IFNy-treated peritoneal macrophages isolated from Tet2-/- mice and WT controls (n=4/genotype). 4K. qRT-PCR analysis of IL-6 and IL-Ιβ transcript levels in Tet2-/- or WT macrophages after 12 hours of treatment with 10 ng/ml IL-Ιβ. Statistical significance was evaluated in 4A, 4F and 4G by 2-way ANOVA (p value for effect of genotype shown in graph) with Sidak multiple comparison test (*p<0.05, ** p<0.01, *** p<0.001); in 4C, 4D, 4E, 4H, 41, 4J and 4K, by two-tailed unpaired Student t test; and in B, by two-tailed unpaired Student t test with Welsh's correction for unequal variances.
[00072] FIGS. 5A-5B depict an exemplary research strategy to study the role of clonal hematopoiesis associated with Tet2 deficiency in atherosclerosis development in hyperlipidemic mice. 5A. Competitive bone marrow transplantation strategy. 5B. Timeline of bone marrow transplantation and hematological, metabolic and atherosclerosis studies.
[00073] FIGS. 6A-6E demonstrate effects of expansion of Tet2 -deficient hematopoietic cells on bone-marrow derived cell populations. LDLR-KO mice were transplanted with bone marrow cell suspensions containing 10% CD45.2+ Tet2-/- cells (10% KO-BMT) or 10% CD45.2+ Tet2+/+ cells (10% WT-BMT) and 90% CD45.1+ Tet2+/+ cells. 6A. Representative images of the flow cytometry analysis of the purity of the CD45.2+ WBC fractions analyzed in FIG.1C. 6B. Absolute cell number of Lin-, Scal+, Kit+ (LSK) cells in the bone marrow and spleen of 10% KO-BMT mice and WT controls 13 weeks post-BMT (9 weeks on HFD), quantified by flow cytometry. 6C, 6D. Percentage of CD45.2+ LSK cells in bone marrow (6C) and spleen (6D), evaluated by flow cytometry. 6E. Absolute cell numbers of main WBC populations in peripheral blood.
[00074] FIG. 7 depicts an exemplary gating strategy for the flow cytometry analysis of immune cell populations in aortic arch samples (related to FIGS. 2G, 2H).
[00075] FIG. 8 depicts atherosclerotic plaque composition in the aortic root of HFD-fed 10% KO- BMT mice (n=10) and WT controls (n=8). Immunohistochemical staining was used to evaluate plaque content of vascular smooth muscle cells (SM-actin+ area). A modified Masson Trichrome staining was used to quantify collagen content in the plaque. Representative images of plaques in 10%-KO-BMT mice are shown for each staining and atherosclerotic plaques are delineated by discontinuous lines.
[00076] FIGS. 9A-9B demonstrate atherosclerotic plaque cell apoptosis and proliferation in the aortic root of HFD-fed 10% KO-BMT mice and WT controls. 9A. TU EL staining to detect apoptotic cells. An image representative of plaque cell apoptosis in 10% KO-BMT mice is shown and atherosclerotic plaque is delineated by discontinuous lines. 9B. Plaque cell proliferation, examined by immunofluore scent analysis of the proliferating cell-specific antigen Ki67 and the macrophage marker (CD68). Atherosclerotic plaques are delineated by discontinuous lines. An image representative of plaque cell proliferation in 10% KO-BMT mice is shown. Examples of proliferating (Ki67+) macrophages (Mac3+) are indicated by arrows.
[00077] FIGS. 10A-10D demonstrate effects of Tet2 deficiency on culture macrophage proliferation, apoptosis and oxLDL uptake. Bone-marrow-derived (10A) or peritoneal (10B, IOC) macrophages were obtained from Tet2-/- mice or WT controls (n=3 mice/genotype). 10A. Cell-cycle progression analysis by propidium iodide staining and flow cytometry after synchronization of macrophages in GO-phase by 36 h of MCSF deprivation and subsequent re-stimulation with 15% L929-cell conditioned medium (LCM) as a source of MCSF. 10B. Quantification of apoptotic macrophages after 16 hours of treatment with 20 μg/ml 7-ketocholesterol, identified by flow cytometry as the sub-GO/Gl population after propidium iodide staining. IOC. Quantification of fluorescent dil-oxLDL uptake by macrophages, detected by flow cytometry. 10D. qRT-PCR analysis of expression of the scavenger receptors SR-A and CD36.
[00078] FIGS. 11A-11C demonstrate effects of Tet2 deficiency on the expression of proinflammatory cytokines/chemokines by cultured macrophages. Peritoneal macrophages were obtained from Tet2-KO mice or WT controls (n=4 mice/genotype in 11A, 1 IB; n=3 in 11C) and treated with 10 ng/ml LPS and 2 ng/ml IFN-γ (11A, 1 IB) or 100 ng/ml LPS and 20 ng/ml IFN-γ (11C). qRT-PCR was used to analyze the expression of pro-inflammatory cytokine/chemokine expression. [00079] FIGS. 12A-12B demonstrate effects of Tet2 deficiency on the expression of proinflammatory cytokines/chemokines by cultured macrophages in the presence of low doses of oxLDL, TNF and IFN-γ. Peritoneal macrophages were obtained from Tet2-KO mice or WT controls (n=6 mice/genotype) and treated with 25 μg/ml oxLDL, 5 ng/ml TNF and 2 ng/ml IFNy. Gene expression of selected pro-inflammatory cytokines (12A) or chemokines (12B) was analyzed by qRT-PCR.
[00080] FIGS. 13A-13B demonstrate effects of Tet2-deficient hematopoietic cell expansion on the expression of pro-inflammatory cytokines, chemokines and adhesion molecules in the
atherosclerotic vascular wall. 13A. Aortic arch samples were obtained from 10% WT-BMT mice (n=9) or 10% KO-BMT mice (n=8) and gene expression was analyzed by q-RT-PCR analysis. 13B. The Pearson correlation coefficient (r) was used to evaluate the association between SELP and IL-Ιβ expression in the aortic wall.
[00081] FIGS. 14A-14D demonstrate role of changes in histone acetylation in the increased expression of pro-inflammatory cytokines in Tet2-deficient macrophages. 14A. qRT-PCR analysis of IL-Ιβ expression in peritoneal macrophages isolated from Tet2-/- or +/+ mice (n=3 mice/genotype) and treated for 8 hours with 10 ng/mL LPS and 2 ng/ml IFNy in the absence or presence of 0.5 μΜ Trichostatin A (TSA). 14B. ChIP analysis of H3 acetylation in the IL-Ιβ promoter of macrophages isolated from Tet2-/- or +/+ mice (n=6/genotype) after 10 hours of LPS/IFNy treatment. 14C. qRT- PCR analysis of IL-6 expression in peritoneal macrophages isolated from Tet2-/-/ mice or +/+ controls (n=3 mice/genotype) and treated for 8 hours with 10 ng/mL LPS and 2 ng/ml IFNy in the absence or presence of 0.5 μΜ TSA. 14D. ChIP analysis of H3 acetylation in the IL-6 promoter of macrophages isolated from Tet2-/- or +/+ mice (n=6/genotype) after 10 hours of LPS/IFNy treatment.
[00082] FIGS. 15A-15B demonstrate effects of Tet2-deficiency on the expression of
inflammasome components. Peritoneal macrophages were isolated from Tet2-/- or +/+ mice (n=3 mice/genotype) and treated with 10 ng/ml LPS and 2 ng/ml IFN-γ (15A) or 25μg/ml oxLDL, 5 ng/ml TNF and 2 ng/ml IFN-γ (15B) for the indicated times. Gene expression was analyzed by qRT-PCR analysis.
[00083] FIG. 16 depicts a schematic illustrating a common mechanistic basis between cancer and cardiometabolic disease, such as cardiovascular disease.
[00084] FIGS. 17A-17D demonstrate that clonal hematopoiesis associated with Tet2 deficiency promotes obesity-induced metabolic dysfunction. Mice were subjected to competitive bone marrow transplantation and fed a high fat/high sucrose (HFHS) diet for 12 weeks to induce obesity and associated metabolic dysfunction. 17A. Body weight. 17B. Fasting blood glucose levels. 17 .
Systemic insulin sensitivity assessed by an oral insulin tolerance test (ITT). 17D. IL-Ιβ transcript expression in epididymal fat, assessed by quantitative PCR.
[00085] FIG. 18 shows that the NLRP3 inflammasome is essential for the accelerated
atherosclerosis associated with clonal expansion of Tet2 -deficient hematopoietic cells. Aortic root plaque size in high fat/high cholesterol diet-fed 10% KO-BMT mice and 10% WT-BMT. Mice received a continuous infusion of the inflammasome inhibitor MCC950 (5 mg/kg/day) or phosphate buffered saline vehicle via subcutaneous osmotic pumps. Representative images of
hematoxylin/eosin-stained sections are shown; plaques are delineated by discontinuous lines (scale bar: 100 μιη). Statistical significance was evaluated by 2-way AN OVA with Tukey multiple comparison test (*p<0.05, ****p<0.001).
[00086] FIGS. 19A-19F show that hematopoietic Tet2-KO mice display worse post-infarction remodeling. 19A. Scheme of the experimental study. Mice underwent partial (10%) bone marrow reconstitution with Tet2 -deficient cells or WT cells following lethal irradiation. After 8 weeks of recovery, mice underwent permanent LAD ligation. 19B. Tet2-KO Bone marrow cells (CD45.2+) display a competitive advantage over wild type competitor cells (CD45.1+) in their ability to expand into multiple blood cell lineages in vivo. 19C. Echocardiographic evaluation shows that mice with partial reconstitution of Tet2 -deficient cells display worsening cardiac remodeling after LAD ligation compared to mice receiving bone marrow from wild-type mice. 19D. Representative images of myocardial tissue sections stained with Masson-Trichrome dye at 4 weeks after ligation. Hearts were sliced sequentially from the ligation site to apex. 19E. Wheat germ agglutinin-staining of the heart sections from hearts isolated at 4 weeks after LAD ligation. Staining shows that the non-infarcted, remote area of the heart display greater hypertrophy of the cardiac myocytes. 19F. qPCR analysis of the remote area showing IL-lbeta transcript is elevated in hearts from mice that received partial reconstitution with Tet2 -deficient bone marrow at 4 weeks after LAD ligation. BMT = bone marrow transplantation, LAD = left anterior descending, WT = wild-type, EF= ejection fraction, LV = left ventricle, WBC = white blood cells.
[00087] FIGS. 20A-20F demonstrate that conditional myeloid Tet2-deficiency in mice leads to worse cardiac remodeling in hearts subjected to LAD ligation. 20A. Scheme of the study. Control and Tet2 -knockout (KO) mice underwent LAD ligation. Conditional Tet2-KO mice were constructed by crossing Tet2flox/flox mice with transgenic mice expressing ere recombinase from the LysM myeloid cell-specific promoter. 20B. The efficiency of Tet2 ablation was analyzed in peritoneal macrophages (pMACs) from the conditional Tet2-KO mice. 20C. Echocardiographic evaluation shows that mice with conditional Tet2 ablation in myeloid cells display worsening cardiac remodeling after LAD ligation surgery compared to wild-type mice. 20D. Representative images of myocardial tissue sections stained with Masson-Trichrome dye at 4 weeks after LAD ligation surgery. Hearts were sliced sequentially from the ligation site to apex. e. qPCR analysis of IL-lbeta transcript in the remote area of the myocardium showing greater IL-lbeta up-regulation in conditional Tet2-KO mice relative to wild-type mice after LAD ligation surgery. 20F. qPCR analysis of bone marrow-derived macrophages showing that IL-lbeta transcript is up-regulated in Tet2 knockout compared to wild-type cells under baseline conditions in vitro. [00088] FIGS. 21A-21C show that inflammasome inhibition reverse the exacerbated postinfarction remodeling associated with hematopoietic Tet2-deficiency. 21A. Scheme of the experimental study. Mice underwent partial (10%) bone marrow reconstitution with Tet2 -deficient cells or WT cells following lethal irradiation. After 8 weeks of recovery, mice underwent permanent LAD ligation. PBS or MCC-950 infusion by osmotic pump was initiated 1 week after LAD ligation for 4 weeks. 21B. Echocardiographic analysis of ejection fraction (EF) shows that treatment with the NLRP3 inflammasome inhibitor MCC950 protects against adverse cardiac remodeling in mice reconstituted with Tet2-KO and wild-type bone marrow, and eliminates the differences in cardiac parameters between Tet2-deficient and WT conditions at the 5 week time point post-LAD ligation. 21C. MCC950 inhibits the increase in cardiac myocyte hypertrophy after LAD ligation in mice reconstituted with Tet2-KO and wild-type bone marrow, and eliminates the differences in cell size between Tet2 -deficient and WT conditions.
[00089] FIG. 22A-22E show the inflammasome inhibitor MCC950 inhibits adverse cardiac remodeling in pressure overloaded hearts and eliminates differences in cardiac parameters between mice that are partially reconstituted with wild-type and Tet2-deficient bone marrow. 22A. Scheme of the experimental study. Mice underwent partial (10%) bone marrow reconstitution with Tet2-deficient cells or WT cells following lethal irradiation. After 8 weeks of recovery, mice underwent permanent TAC surgery to produce pressure overload on the heart. 22B. Measurement of heart weight (HW) and wet lung weight (LW) adjusted by tibia length (TL), showing that MCC950 ameliorates the increase of cardiac and lung mass after pressure overload in both strains of mice and eliminates the differences in these parameters between the Tet2 -deficient and WT conditions. 22C. Measurement of myocyte cross-sectional area (CSA) shows that MCC950 inhibits hypertrophy after pressure overload both in wild type and hematopoietic Tet2-KO mice and eliminates the difference in this parameters between the Tet2 -deficient and WT conditions. 22D. Echocardiographic parameters show that mice reconstituted with Tet2- knockout bone marrow show greater deterioration of cardiac function after pressure overload that can be reversed by treatment with MCC950. Treatment with MCC950 eliminates the differences in the echocardiographic parameters between the Tet2 -deficient and WT conditions. LVPWTd = left ventricle posterior wall thickness at diastole, FS = fractional shortening. 22E. Picro sirius staining shows that mice reconstituted with Tet2- knockout bone marrow exhibit greater cardiac fibrosis after pressure overload that can be reversed by treatment with MCC950. The MCC950 treatment eliminates the difference in this parameter between the Tet2 -deficient and WT conditions.
[00090] FIGS. 23A and 23B show that myeloid cell Tet2 -deficiency promotes renal fibrosis and macrophage infiltration in kidneys of angiotensin Il-treated mice. Both groups of mice were treated by infusion of angiotensin II (2mg/kg/day) for 4 weeks prior to harvest. Perivascular and interstitial fibrosis was evaluated by collagen deposition using Masson's trichrome staining on paraffin sections 23A. Macrophage infiltration 23B in kidneys was detected by a rat anti-Mac3 monoclonal antibody, followed by ImmPRESS TM HRP Anti-Rat IgG and DAB Substrate (Vector Laboratories).
Microscopy images were required on a Keyence BZ-9000 microscope and analyzed using Image J software. Representative images are shown.
[00091] FIGS. 24A-24D show that myeloid cell Tet2-deficiency promotes the expression of proinflammatory cytokines, fibrosis related cytokines and adhesion molecules in kidneys of angiotensin II-treated mice. 24A-24D. Gene expression patterns of pro-inflammatory cytokines 24A, collagen 24B, fibrosis-related genes 24C and adhesion molecules 24D were quantified by qRT-PCR in control in kidneys isolated from wild-type (WT) mice (n = 5) and mice deficient in Tet2 in myeloid (mye Tet2-KO mice) (n=8). Both groups of mice were treated by infusion of angiotensin II (2mg/kg/day) for 4 weeks prior to harvest. Data are shown as mean ±SEM, statistical significance was evaluated by unpaired Student's t test (normally distributed continuous variables) or Mann-Whitney U test (non- normally distributed continuous variables) (*p<0.05, *Τ<0.01).
[00092] FIG. 25 shows the effects of Tet2 deficiency in myeloid cells on the structure and morphology of tubules in mice subjected to the unilateral ureteral obstruction (UUO) model of kidney failure. Tubular atrophy or dilation and inflammatory cells infiltration in kidneys of mice after UUO surgery were evaluated by H&E staining. Presentative images are shown. Microscopic images were acquired on a Keyence BZ-9000 microscope and analyzed using Image J software.
[00093] FIG. 26 demonstrates the effects of Tet2 deficiency in myeloid cells on renal tubular interstitial fibrosis in mice subjected to the unilateral ureteral obstruction (UUO) model of kidney failure. Fibrosis was evaluated by collagen deposition using Masson's trichrome staining of paraffin sections. Microscopic images were acquired on a Keyence BZ-9000 microscope and analyzed using Image J software.
DETAILED DESCRIPTION
[00094] Advances in DNA sequencing have revealed that aging is associated with an increased frequency of somatic mutations in proliferative tissues, particularly in the hematopoietic system. Recently, large exome sequencing studies in humans have shown that aging is associated with an increased frequency of somatic mutations in the hematopoietic system which provide a competitive growth advantage to the mutant cell and therefore allow its clonal expansion (i.e., clonal
hematopoiesis) (Jaiswal et al, Genovese et al. NEJM 2014; Xi et al, Nat Med 2014). Furthermore, recent studies employing ultra-deep sequencing suggest that somatic mutations in blood cells are much more prevalent than previously recognized (McKerrell, Cell Reports 2015). However, while recent human studies suggest that somatic mutations can be associated with a broad spectrum of human disease, there is a lack of experimental evidence supporting their causal contribution to age- associated disorders other than cancer (Science special issues on "Mutation and Human Disease" (September 2015) and "Why We Age" (December 2015)). In contrast, herein, experimental evidence is provided that mechanistically links clinically relevant somatic mutations in hematopoietic cells to cardiovascular disease (CVD), metabolic, renal, and other chronic diseases that have a large inflammatory component. The experimental demonstrations described herein provide novel evidence of the causal contribution of a scenario of genome mosaicism in the hematopoietic system and subsequent clonal hematopoiesis to a non-hematological disorder.
[00095] Epidemiological studies show that HSPCs develop mutations that promote their clonal expansion at a relatively high frequency in the aging population. While very few of the HSCs acquire subsequent mutations in oncogenes that lead to blood cancers, the mechanistic findings of the studies described herein, using Tet2 as an example, show that a single mutation that occurs frequently can predispose an individual to CVD and stroke that are common in the elderly (>50% of individuals). As described herein, one of the most frequently mutated genes in human peripheral blood is TET2, an epigenetic regulator of gene transcription known to play pivotal roles in the modulation of hematopoiesis and myelopoiesis. The studies described herein demonstrate for the first time that (i) Progressive expansion of Tet2 -deficient hematopoietic cells (i.e., clonal hematopoiesis), as occurs in human individuals carrying somatic mutations in this gene, is shown to promote atherogenesis in LDLR-/- mice; (ii) Tet2 functions as a novel inhibitor of vascular inflammation in the setting of atherosclerosis, which provides the first demonstration of the role of Tet2 in chronic sterile inflammation (distinct from pathogen-induced inflammation); and (iii) Tet2 inhibits pro-inflammatory IL-Ι β signaling at multiple levels, by modulating IL-Ιβ transcription, NLRP3 inflammasome- mediated IL-Ιβ secretion and IL-1 -Receptor 1 -mediated IL-Ιβ signaling. Accordingly, the studies described herein support a new paradigm of causal risk for cardiovascular diseases and other inflammation-mediated diseases.
[00096] Hematopoietic stem cells (HSCs) and hematopoietic progenitor cells (HPCs) divide to produce blood cells by a continuous regeneration process. As the cells divide, they are prone to accumulating mutations, including deletions, insertions, and substitutions, that generally do not affect function. However, some mutations confer advantages in self-renewal, proliferation or both, resulting in clonal expansion of the cells comprising the mutations in question. The frequency of such somatic mutation events increases with age.
[00097] The studies described herein demonstrate that preferential and progressive expansion of a subset of hematopoietic cells bearing somatic mutations in TET2 lead to pro-inflammatory IL-Ιβ signaling at multiple levels, including increased IL-Ιβ transcription, increased NLRP3
inflammasome-mediated IL- Ιβ secretion, and increased IL- 1 -Receptor 1 -mediated IL-Ιβ signaling. Accordingly, provided herein are compositions, methods, and assays for modulating TET2 mutation- mediated IL-Ιβ (interleukin-ΐβ) proinflammatory activity, particularly when caused by somatic mutations in TET2. Compositions and Theranostic Methods for Treating IL-Ιβ Proinflammatory Activity
[00098] Accordingly, in some aspects, provided herein are pharmaceutical compositions comprising an inhibitor of TET2 mutation-mediated IL-Ιβ (interleukin-ΐβ) proinflammatory activity and a pharmaceutically acceptable carrier for use in a subject having one or more TET2 somatic mutations in a sub-population of hematopoietic cells.
[00099] Also provided herein, in some aspects, are methods for treating a subject having, or at risk for, a TET2 mutation-mediated IL-Ιβ proinflammatory disease comprising administering a therapeutically effective amount of a pharmaceutical composition comprising an inhibitor of TET2 mutation-mediated IL-Ιβ (interleukin-ΐβ) proinflammatory activity and a pharmaceutically acceptable carrier to a subject having one or more TET2 somatic mutations in a sub-population of hematopoietic cells.
[000100] "Methylcytosine dioxygenase TET2" or "TET2" is a member of the family of TET proteins, which have been shown to be responsible for conversion of 5 -methylcytosine (5mC) to 5- hydroxymethylcytosine (5hmC), as well as function in embryonic stem cell regulation, myelopoiesis, and zygote development (Dawlaty et al, 2011; Gu et al., 2011; Iqbal et al., 2011; Ito et al, 2010; Ko et al., 2010; Koh et al, 2011; Wossidlo et al., 2011). TET2 is a dioxygenase that catalyzes the conversion of the modified genomic base 5-methylcytosine (5mC) into 5-hydroxymethylcytosine (5hmC) and plays a key role in active DNA demethylation. TET2 has a preference for 5- hydroxymethylcytosine in CpG motifs, and has also been shown to mediate subsequent conversion of 5hmC into 5-formylcytosine (5fC), and conversion of 5fC to 5-carboxylcytosine (5caC). Methylation at the C5 position of cytosine bases is an epigenetic modification of the mammalian genome which plays an important role in transcriptional regulation. In addition to its role in DNA demethylation, TET2 has also been shown to be involved in the recruitment of the O-GlcNAc transferase OGT to CpG-rich transcription start sites of active genes, thereby promoting histone H2B GlcNAcylation by OGT. Similarly, TET2 has been reported to recruit histone deacetylases (HDACs) to specific gene promoters, contributing to histone deacetylation and gene repression (Zhang et al 2015).
[000101] Accordingly, the terms "TET2" or "TET-2," as used herein, refers to the genomic sequence of NG_028191.1 (SEQ ID NO: 1) encoding: the mRNA sequence of NM_001127208.2 (isoform 1, SEQ ID NO: 2), which encodes the 2002 amino acid polypeptide having the amino acid sequence of NP_001120680.1 (isoform 1, SEQ ID NO: 3); the mRNA sequence of NM_017628.4 (isoform 2, SEQ ID NO: 4) encoding the 1165 amino acid polypeptide having the amino acid sequence of NP_060098.3 (isoform 2, SEQ ID NO: 5); together with any additional naturally occurring allelic, splice variants, and processed forms thereof. Typically, TET2 refers to human TET2. Reference to specific sub-fragments or sub-sequences of TET2 can be identified in the application, e.g., by "nucleic acids 211-402 of TET2." Specific nucleic acid or amino acid residues of TET2 can be referred to as, for example, "S282 of TET2" or "S282 of SEQ ID NO: 3." [000102] A"somatic mutation," as used herein, refers to a change in the genetic structure of a subject that is not inherited from a parent, and also not passed to offspring. Hence, a somatic mutation is a genetic change that occurs in any cell after the first cell division, wherein the mutation is replicated in all cells that descend from the mutated cell. The somatic cells that descend from the original mutated cell comprise a clonal variant within the body of the subject. Where these mutations are present in cells of somatic origin and not present in the germline, they are often called a somatic cell mutation or an acquired mutation. Somatic mutations will be present in only a subset of the cells contributing DNA to an analysis, since the mutant sequence will be present in fewer than 50% of the sequence reads arising from that genomic site. In other words, somatic mutations are identified as when a specific sequence is measured as occurring at a fraction of total sequences that deviates significantly from the frequency expected for the far-larger number of inherited variants- namely around 0%, around 50% or around 100%.
[000103] Somatic mutations can occur in a sub-population of cells for example, such as a sub- population of hematopoietic cells. Somatic mutations in TET2 relevant to the compositions and methods described herein include any nucleic acid or consequent amino acid somatic mutations in TET2, found in a subset of hematopoietic cells, leading to increased pro-inflammatory IL-Ιβ signaling, including increased IL- Ιβ transcription, increased NLRP3 inflammasome-mediated IL- Ιβ secretion, and/or increased IL-1 -Receptor 1 -mediated IL-Ιβ signaling. Such somatic mutations in the TET2 gene can be disruptive, in that they have an observed or predicted effect on protein function, or non-disruptive. As used herein, a "non-disruptive mutation" is typically a missense mutation, in which a codon is altered such that it codes for a different amino acid, but the encoded protein, i.e., TET2, is still expressed. Somatic mutations in TET2 include, for example, frameshift mutations, nonsense mutations, missense mutations or splice-site variant mutations, as those terms are known to those of ordinary skill in the art.
[000104] In some embodiments, one or more somatic mutations in TET2, in addition to leading to increased pro-inflammatory IL-Ιβ signaling, also result in clonal hematopoiesis. As used herein, "clonal hematopoiesis" refers to clonal outgrowth of a sub-population of hematopoietic cells having one or more somatic mutations in TET2.
[000105] TET2 mutations relevant to the compositions and methods described herein include any nucleic acid mutations in the genomic sequence of TET2 of SEQ ID NO: 1 leading to: an S460F mutation in SEQ ID NO: 3 ; a D666G mutation in SEQ ID NO: 3; a P941 S mutation in SEQ ID NO: 3; a CI 135Y missense mutation in SEQ ID NO: 3; a R73 frameshift insertion mutation in SEQ ID NO: 3; a Y85 frameshift deletion mutation in SEQ ID NO: 3; a S 123 frameshift deletion mutation in SEQ ID NO: 3; an El 70 frameshift deletion mutation in SEQ ID NO: 3; a D 162 frameshift deletion mutation in SEQ ID NO: 3 ; an 1181 frameshift deletion mutation in SEQ ID NO: 3; a T221 frameshift insertion mutation in SEQ ID NO: 3; an L260 frameshift deletion mutation in SEQ ID NO: 3; an 1274 frameshift deletion mutation in SEQ ID NO: 3; a L31 1 frameshift insertion mutation in SEQ ID NO: 3; a Q341 nonsense mutation in SEQ ID NO: 3; a Q383 nonsense mutation in SEQ ID NO: 3 ; a S423 nonsense mutation in SEQ ID NO: 3; a L427 frameshift insertion mutation in SEQ ID NO: 3 ; a S420 frameshift deletion mutation in SEQ ID NO: 3; a S424 frameshift deletion mutation in SEQ ID NO: 3; a S462 frameshift deletion mutation in SEQ ID NO: 3; an 1472 frameshift deletion mutation in SEQ ID NO: 3; a Q481 nonsense mutation in SEQ ID NO: 3; a T518 frameshift insertion mutation in SEQ ID NO: 3; a S530 nonsense mutation in SEQ ID NO: 3; a S543 frameshift deletion mutation in SEQ ID NO: 3; a Q530 nonsense mutation in SEQ ID NO: 3; a L532 frameshift deletion mutation in SEQ ID NO: 3; a L532 nonsense mutation in SEQ ID NO: 3; a R544 nonsense mutation in SEQ ID NO: 3; a W585 nonsense mutation in SEQ ID NO: 3; a Q595 frameshift deletion mutation in SEQ ID NO: 3; a L579 frameshift insertion mutation in SEQ ID NO: 3; a S588 nonsense mutation in SEQ ID NO: 3; a G634 frameshift deletion mutation in SEQ ID NO: 3 ; a Q656 frameshift deletion mutation in SEQ ID NO: 3; a P690 frameshift deletion mutation in SEQ ID NO: 3; a R686 frameshift deletion mutation in SEQ ID NO: 3; an E692 frameshift insertion mutation in SEQ ID NO: 3; a Q705 nonsense mutation in SEQ ID NO: 3 ; a F713 frame shift deletion mutation in SEQ ID NO: 3; a Q734 nonsense mutation in SEQ ID NO: 3 ; a S757 nonsense mutation in SEQ ID NO: 3; a L759 frameshift deletion mutation in SEQ ID NO: 3 ; a Q764 frameshift deletion mutation in SEQ ID NO: 3; a 1771 frameshift deletion mutation in SEQ ID NO: 3; a Q779 nonsense mutation in SEQ ID NO: 3; an H783 frameshift insertion mutation in SEQ ID NO: 3; a Q770 nonsense mutation in SEQ ID NO: 3; a E819 frameshift deletion mutation in SEQ ID NO: 3; a H839 frameshift deletion mutation in SEQ ID NO: 3; a K858 frameshift deletion mutation in SEQ ID NO: 3; a Q886 nonsense mutation in SEQ ID NO: 3; a L878 frameshift deletion mutation in SEQ ID NO: 3; an M906 frameshift insertion mutation in SEQ ID NO: 3; a Q909 nonsense mutation in SEQ ID NO: 3; a Q910 nonsense mutation in SEQ ID NO: 3; a Q912 frameshift deletion mutation in SEQ ID NO: 3; a Q937 nonsense mutation in SEQ ID NO: 3; a Q916 nonsense mutation in SEQ ID NO: 3; a P989 frameshift insertion mutation in SEQ ID NO: 3; an A1014 frameshift insertion mutation in SEQ ID NO: 3; a Q 1042 nonsense mutation in SEQ ID NO: 3; a Q 1030 nonsense mutation in SEQ ID NO: 3; an HI 064 frameshift insertion mutation in SEQ ID NO: 3; a T1078 frameshift deletion mutation in SEQ ID NO: 3; a Tl 107 frameshift deletion mutation in SEQ ID NO: 3; a Nl 103frameshift deletion mutation in SEQ ID NO: 3; a Tl 1 14 frameshift deletion mutation in SEQ ID NO: 3; a Q l 127 frameshift insertion mutation in SEQ ID NO: 3; an S282F mutation in SEQ ID NO: 3; a N312S mutation in SEQ ID NO: 3; an L346P mutation in SEQ ID NO: 3; and an G to A splice site mutation at position 106158509 of SEQ ID NO: 1.
[000106] In some embodiments of the compositions and methods described herein, the one or more TET2 somatic mutations are selected from an S282F mutation in SEQ ID NO: 3, an N312S mutation in SEQ ID NO: 3, an L346P mutation in SEQ ID NO: 3, an S460F mutation in SEQ ID NO: 3, a D666G mutation in SEQ ID NO: 3, a P941 S mutation in SEQ ID NO: 3, and a C I 135Y mutation in SEQ ID NO: 3.
[000107] The compositions and methods described herein require, in some embodiments, sequencing of at least part of the genome in a sample comprising hematopoietic cells, including, for example, an enriched for population of myeloid cells, obtained from a subject. Sequencing can be carried out according to any suitable technique, many of which are generally known in the art. Many proprietary sequencing systems are available commercially and can be used in the context of the methods described herein, such as for example from Illumina, USA. Single-cell sequencing methods are known in the art, as noted for example by Eberwine et al., Nature Methods 1 1, 25-27 (2014) doi: 10.1038/nmeth.2769 Published online 30 December 2013; and single-cell sequencing in microfluidic droplets (Nature 510, 363-369 (2014) doi: 10.1038/nature l3437).
[000108] Sequencing of DNA can be performed on tissues or cells. Sequencing of specific cell types (for example, hematopoietic cells obtained by flow sorting or myeloid lineage hematopoietic cells) can identify mutations in specific cell types that provide specific predictive value for use with the compositions and methods described herein. Sequencing can also be conducted in single cells, using appropriate single-cell sequencing strategies. Single-cell analyses can be used to identify high- risk combinations of mutations co-occurring in the same cells. Co-occurrence signifies that the mutations are occurring in the same cell clone and carry a greater risk, and therefore have a greater predictive value, thanoccurrence of the same mutations in different individual cells, for example. Certain sequences, such as those with high GC content, repetitive elements and/or low sequence complexity are prone to sequencing errors and false positive creation due to artifacts caused by enzyme slippage and other reading errors. Hence, care must be taken to ensure that any sequence changes observed in these regions are real and not artifact.
[000109] The inhibitors of TET2 mutation-mediated IL- Ιβ proinflammatory activity are particularly useful for subjects having one or more somatic mutations in TET2 in a population of hematopoietic cells. As used herein, an "inhibitor of TET2 mutation-mediated IL-Ιβ (interleukin-ΐβ) proinflammatory activity" refers to any agent or molecule that significantly blocks, inhibits, reduces, or interferes with the downstream effects of somatic mutations in TET2 that lead to increased IL- Ιβ proinflammatory activity or signaling in vitro, in situ, and/or in vivo, including increased IL-Ιβ transcription, increased NLRP3 inflammasome-mediated IL- Ιβ secretion, and/or increased IL- 1- receptor I (IL-lRl)-mediated IL-Ιβ signaling. Exemplary inhibitors of TET2 mutation-mediated IL- 1β (interleukin-ΐβ) proinflammatory activity contemplated for use in the various aspects and embodiments described herein include, but are not limited to, antibodies or antigen-binding fragments thereof that specifically bind to IL- Ιβ and/or antibodies or antigen-binding fragments thereof that specifically bind to IL-1 receptors, such as IL1R1, thereby inhibiting/reducing/blocking IL-Ιβ interaction(s) with its receptors; small molecule agents that target or specifically bind IL-Ιβ, IL-1- receptors, and/or IL-1 signaling components, such as caspase-1, and inhibit/reduce/block IL-Ιβ- mediated proinflammatory activity; RNA or DNA aptamers that bind to IL-Ιβ or IL-1 -receptors and inhibit/reduce/block IL-i -mediated proinflammatory activity; and/or IL-1 receptor fragments or fusion polypeptides thereof that block endogenous IL-Ιβ interactions with endogenous IL-1 receptors.
[000110] In regard to NLRP3 inflammasome-mediated IL-Ιβ secretion, and inhibitors thereof foe use as inhibitors of TET2 mutation-mediated IL-Ιβ (interleukin-ΐβ) proinflammatory activity, as described herein, as known to those of skill in the art, the NLRP3 inflammasome is present primarily in immune and inflammatory cells following activation by inflammatory stimuli; these cells include macrophages, monocytes, DCs, and splenic neutrophils. Activation of the NLRP3 inflammasome occurs in two steps. The first step involves a priming or initiating signal, in which many PAMPs or DAMPs are recognized by TLRs, leading to activation of nuclear factor kappa B (NF-KB)-mediated signaling, which in turn up-regulates transcription of inflammasome-related components, including inactive NLRP3, proIL-Ιβ, and proIL-18 (Bauernfeind et al., 2009; Franchi et al, 2012, 2014). The second step of inflammasome activation is the oligomerization of NLRP3 and subsequent assembly of NLRP3, ASC, and procaspase-1 into a complex. This triggers the transformation of procaspase-1 to caspase-1, as well as the production and secretion of mature IL-Ιβ and IL-18 (Kim et al., 2015; Ozaki et al., 2015; Rabeony et al., 2015). An inhibitor of TET2 mutation-mediated IL-Ιβ (interleukin-ΐβ) proinflammatory activity useful in the methods and compositions described herein can thus target any of the steps and/or components leading to NLRP3 inflammasome activation (see, for example, non- limiting examples in B-Z Shao et al., NLRP3 inflammasome and its inhibitors: a review; Front Pharmacol. 2015; 6: 262).
[000111] The inhibitors of TET2 mutation-mediated IL-Ιβ proinflammatory activity described herein result in a significant inhibition or reduction or decrease in any of the pathways leading to IL- Ιβ-mediated proinflammatory activity or signaling, such as IL-Ιβ transcription, IL-Ιβ
translation,NLRP3 inflammasome-mediated IL-Ιβ secretion, and/or IL-Ιβ binding to IL-1 receptor and consequent IL-l-receptor I (IL-lRl)-mediated IL-Ιβ signaling. As used herein, the terms reduce(s)/reduced/reducing/reduction, inhibit(s)/inhibiting/inhibited or
decrease(s)/decreasing/decreased generally means either a reduction or inhibition of at least 5%, at least 10%, at least 25%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or more, compared to the level of IL-Ιβ transcription, IL-Ιβ translation,NLRP3 inflammasome-mediated IL-Ιβ secretion, and/or IL-Ιβ binding to IL-1 receptor and consequent IL-l- receptor I (IL-lPvl)-mediated IL-Ιβ signaling under the same conditions but without the presence of inhibitors of TET2 mutation-mediated IL-Ιβ proinflammatory activity described herein. Assays for measuring such inhibition or reduced interactions are known in the art and are described herein in the Examples. [000112] A disease or medical condition is considered to be mediated by "IL-Ιβ (interleukin-ΐβ) proinflammatory activity" if the spontaneous or experimental disease or medical condition is associated with, or mediated by, for example, elevated levels of IL- 1 β in bodily fluids or tissue, or if cells or tissues taken from the body produce elevated levels of IL-1 in culture. In many cases, such diseases mediated by IL-Ιβ proinflammatory activity are also recognized by the following additional two conditions: (1) pathological findings associated with the disease or medical condition can be mimicked experimentally in animals by the administration of IL-1 β; and (2) the pathology induced in experimental animal models of the disease or medical condition can be inhibited or abolished by treatment with agents which inhibit the action of IL- 1 β. A non-limiting list of disorders and diseases known to be mediated by or exacerbated by aberrant, elevated IL-Ιβ activity include hereditary syndromes with mutations in inflammasome-associated genes, such as cryopyrin- associated periodic syndromes (CAPS), Familial Mediterranean fever, Pyogenic arthritis, pyoderma gangrenosum and acne (PAPA) syndrome, Deficiency of IL-IRa (DIRA); Crystal-induced arthropathies, such as gout; systemic-onset juvenile arthritis or Still disease; adult-onset Still disease; rheumatoid arthritis;
osteoarthritis; Schnitzler syndrome; Behcet disease; Crohn's disease; periodontal diseases; COPD (Chronic Obstructive Pulmonary Disease); and neutrophil-triggered skin diseases, such as pyoderma gangrenosum, psoriasis pustulosa, Sweet syndrome; and chronic kidney disorders.
[000113] In some embodiments of the compositions and methods described herein, a disease mediated by IL-Ιβ (interleukin-ΐβ) proinflammatory activity is a cardiometabolic disease.
Cardiometabolic diseases include cardiovascular diseases, as well as those disorders that complicate the risk and clinical management of cardiovascular conditions by potentiating and/or exacerbating hypertension, hyperlipidemia, atherosclerosis and cardiomyopathy, and include insulin resistance, hyperglycemia, obesity, type 2 diabetes mellitus, metabolic syndrome, hyperlipidemia and oxidative stress.
[000114] As used herein, the phrase "cardiovascular condition, disease or disorder" is intended to include all disorders characterized by insufficient, undesired or abnormal blood vessel or cardiac function, e.g. hypertension, ischemic heart disease, hypertensive heart disease and pulmonary hypertensive heart disease, valvular disease, cardiac arrhythmia, vascular disease, myocardial infarction, congestive heart failure, myocarditis, atherosclerosis, restenosis, and any condition which leads to congestive heart failure in a subject, particularly a human subject. Insufficient or abnormal cardiac function can be the result of disease, injury and/or aging. The term "myocardial ischemia" refers to circulatory disturbances caused by coronary atherosclerosis and/or inadequate oxygen supply to the myocardium. For example, an acute myocardial infarction represents an irreversible ischemic insult to myocardial tissue. This insult results in an occlusive (e.g., thrombotic or embolic) event in the coronary circulation and produces an environment in which the myocardial metabolic demands exceed the supply of oxygen to the myocardial tissue. [000115] In some embodiments of the compositions and methods described herein, a disease mediated by IL-Ιβ (interleukin-ΐβ) proinflammatory activity is a chronic kidney disease.
[000116] In regard to the methods of treating chronic kidney disease mediated by IL-Ιβ
(interleukin-ΐβ) proinflammatory activity, the term "chronic kidney disease" or CKD refers to renal diseases that slowly and progressively worsen over time due to the progressive loss of nephrons and consequent loss of renal function. In the early stages, there may be no symptoms. The loss of function usually takes months or years to occur. It may be so slow that symptoms do not appear until kidney function is less than one-tenth of normal. The final stage of chronic kidney disease is called end-stage renal disease (ESRD). At this stage, the kidneys are no longer able to remove enough wastes and excess fluids from the body. The patient needs dialysis or a kidney transplant. Diabetes, which leads to diabetic nephropathy, and high blood pressure are the two most common causes of chronic kidney disease and account for most cases. Other diseases and conditions that can damage the kidneys and lead to chronic kidney disease, include, but are not limited to,: autoimmune disorders (such as systemic lupus erythematosus and scleroderma); birth defects of the kidneys (such as polycystic kidney disease); certain toxic chemicals; glomerulonephritis; injury or trauma; kidney stones and infection; problems with the arteries leading to or inside the kidneys; some pain medications and other drugs (such as cancer drugs); reflux nephropathy (in which the kidneys are damaged by the backward flow of urine into the kidneys); etc. As used herein, "proteinuria" refers to the presence of an excess of serum proteins in the urine. Proteinuria can, in some embodiments, be indicative of kidney disease, but, by itself, is not conclusive. In some embodiments of these aspects and all such aspects described herein, a subject having or at risk for a chronic kidney disease has diabetic nephropathy.
[000117] In some embodiments of the aspects descried herein, an inhibitor of TET2 mutation- mediated IL-Ιβ (interleukin-ΐβ) proinflammatory activity is an IL-Ιβ inhibitory compound. As used herein, an "IL-Ιβ inhibitory compound" or "IL- Ιβ inhibitor" or "inhibitor of IL-Ιβ" refers to a compound or agent capable of specifically inhibiting or specifically preventing activation of cellular receptors to IL-Ιβ and consequent downstream effects of IL-Ιβ signaling. Classes of interleukin-ΐβ inhibitors include: interleukin-1 receptor antagonists such as IL-lra; anti-IL- 1 receptor antibodies (e.g., EP 623674), the contents of which is hereby incorporated by reference in its entirety; IL-Ιβ binding proteins such as soluble IL-1 receptors (e.g., U.S. Pat. No. 5,492,888, U.S. Pat. No.
5,488,032, and U.S. Pat. No. 5,464,937, U.S. Pat. No. 5,319,071, and U.S. Pat. No. 5, 180,812, the contents of which are hereby incorporated by reference in their entireties); anti-IL-1 β monoclonal antibodies (e.g., WO 9501997, WO 9402627, WO 9006371, U.S. Pat. No. 4,935,343, EP 364778, EP 267611 and EP 220063, the contents of which are hereby incorporated by reference in their entireties); IL-1 receptor I accessory proteins (e.g., WO 96/23067, the disclosure of which is hereby incorporated by reference), and other compounds and proteins which block in vivo synthesis, including in vivo transcription, in vivo translation, and/or extracellular release of IL-1 β. [000118] In some embodiments of the aspects described herein, the IL-Ιβ inhibitor is selected from any of the IL-Ιβ or inflammasome inhibitors listed in Table 1.
Table 1: Exemplary List of IL-Ιβ inhibitors for use as TET2 mutation-mediated IL-Ιβ
(interleukin-ΐβ) proinflammatory activity.
Figure imgf000027_0001
Canakinumab/Ilaris canakinumab Large Interleuki Interleukin- Subcutaneous Canakinumab is an
Also known as IL 1 molecule- n lB lbeta (IL- interleukin 1 beta Beta Mab Antibody (IL1B) lbeta) monoclonal NOVARTIS, IL 1 Inhibitor antibody derived Beta Monoclonal from a mouse Antibody monoclonal NOVARTIS, antibody (mAb) Interleukin 1 Beta acting against IL-1 Monoclonal beta.
Antibody
NOVARTIS
CDP48 interleukin 1, Large Interleuki Interleukin- Subcutaneous CDP484 is a
Also known as beta antibody molecule- n l 1 Beta (IL- PEGylated antibody CDP 484 (pegylated) Antibody Receptor, 1 Beta) fragment targeting
Type II Receptor pro-inflammatory (IL1R2) Antagonist cytokine interleukin
1-beta.
CP412245 Small Interleuki Interleukin- CP412245 is a
Also known as CP molecule n l 1 Beta (IL- potent inhibitor of 412,245, CP Receptor, 1 Beta) stimulus-coupled 412245, Type II Receptor IL-lbeta post- CP412,245 (IL1R2) Antagonist translational
processing. It is a diarylsulfonylurea compound that blocks formation of mature IL-1 without increasing the amount of procytokine that is released extracellularly.
CYT013 ILlbQb, Interleuki Interleukin- Subcutaneous CYT013ILlbQb is interleukin 1 beta n l 1 Beta (IL- a therapeutic
Also known as Receptor, 1 Beta) vaccine consisting interleukin 1 Type II Receptor of modified receptor antagonist (IL1R2) Antagonist interleukin- 1 beta protein molecules coupled to the virus-like particle Qb. The vaccine induces antibodies production against IL-1 beta to decrease inflammation and reduce disease progression. MCC 950 or Small NLRP3
MCC950/CRID3/C molecule inflammasome
P-456773 inhibitor. Blocking apoptosis- associated specklike protein (ASC) oligomerization, Inhibiting of canonical and non- canonical NLRP3 inflammasome. immunere szumab interleukin 1, Large Interleuki Targeted against beta antibody molecule- n lB interleukin- 1 beta.
Antibody (IL1B)
Inflabion diacerein Small Interleuki Interleukin- Oral Inflabion contains molecule n 1 (IL1) 1 (IL-1) diacerein as an
Inhibitor active ingredient.
Diacerin (diacerein) is an anthraquinone derivative that acts via inhibition of interleukin- lbeta.
Inflammasome Small Interleuki Interleukin- Inflammasome modulator molecule n lB lbeta (IL- modulator interferes
OPSONA (IL1B) lbeta) with inflammasome
Inhibitor mediated release of interleukin (IL)- lbeta. It is a specific ILl-β inhibitor.
LY2189102 interleukin 1, Large Interleuki Interleukin- Intravenous, LY2189102
Also known as LY beta molecule- n l 1 Beta (IL- Subcutaneous contains interleukin 2189102 monoclonal Antibody Receptor, 1 Beta) 1, beta monoclonal antibody Type II Receptor antibody as an
(humanized) (IL1R2) Antagonist active ingredient. It is targeted against interleukin- 1 beta.
MEDI8968 interleukin 1 Large Interleuki Interleukin- Subcutaneous MEDI8968 is a
Also known as receptor molecule- n lA lalpha (IL- fully human IgG2 MEDI 8968 monoclonal Antibody (ILIA), 1 alpha) monoclonal
antibody Interleuki Inhibitor, antibody (mAb)
(human) n lB Interleukin- that binds
(IL1B) lbeta (IL- selectively to
lbeta) Interleukin- 1 Inhibitor Receptor I (IL-lRl) to inhibit the binding of IL-1 alpha and IL-1 beta. PGE3935199 Caspase, Caspase- 1 Oral PGE3935199 is a
Also known as Apoptosis Inhibitor caspase- 1 inhibitor. PGE 3935199 -Related Interleukin- 1β
Cysteine converting enzyme
Peptidase (Caspase- 1, ICE) is
1 involved in the
(CASP1) processing of Pro- IL-Ιβ to the active cytokine IL-Ιβ.
PGE527667 Caspase, Caspase- 1 Oral PGE527667 is a
Also known as Apoptosis Inhibitor Caspase-1 inhibitor. PGE 527667 -Related Interleukin- 1β
Cysteine converting enzyme
Peptidase (Caspase-1, ICE) is
1 involved in the
(CASP1) processing of Pro- IL-Ιβ to the active cytokine IL-Ιβ.
TRK530 Interleuki Interleukin- Oral TRK530 is an
Also known as n lB lbeta (IL- immunomodulatory TRK 530 (IL1B) lbeta) bisphosphonate
Inhibitor derivative that is directed against interleukin lb.
XL 130 Large Interleuki Interleukin- XL 130 contains
Also known as molecule n l 1 (IL-1) PASylated interleukin 1 Receptor Receptor interleukin 1 receptor antagonist (IL1R) Antagonist receptor antagonist protein (pasylated) protein as an active ingredient.
Interleukin 1 receptor antagonist protein acts by preventing the interaction of IL-1 with the receptor.
XOMA052 gevokizumab Large Interleuki Interleukin- Intravenous, XOMA052 contains
Also known as S molecule- n lB lbeta (IL- Subcutaneous gevokizumab as an 78989, S78989, Antibody (IL1B) lbeta) active ingredient. XMA005.2, Inhibitor Gevokizumab is a XOMA 052 humanized
monoclonal antibody directed against interleukin lb.
AMG108 interleukin 1 Large Interleuki Interleukin- Subcutaneous AMG108 is a fully
Also known as receptor molecule- n 1 (IL1) 1 (IL-1) human interleukin 1 AMG 108 monoclonal Antibody Inhibitor receptor
antibody monoclonal
(human) antibody that binds to and inhibits the action of interleukin- 1 (IL-1). HL 2351, ILlRa Interleuki Interleukin- Subcutaneous HL2351 is a long hyFc n 1 (IL1) 1 (IL-1) acting fusion
Inhibitor protein of IL-IRa and hybrid fc fragment (hyFc) which inhibits interleukin-1.
ILlHyl Interleuki Interleukin- ILlHyl is an
Also known as IL n l 1 (IL-1) interleukin-1 1F5, IL lHyl, Receptor Receptor receptor antagonist interleukin 1 (IL1R) Antagonist that acts by family, member 5, blocking the interleukin 1 HY1 binding of
interleukin-1 (IL-1) to cell receptors.
Interleukin 1 ra Large Interleuki Interleukin- Recombinant AXXO molecule n l 1 (IL-1) human interleukin 1
Also known as Receptor Receptor receptor antagonist interleukin 1 (IL1R) Antagonist protein acts by receptor antagonist preventing the protein interaction of IL-1 (recombinant, with the receptor. human)
Orthokine Interleuki Interleukin- Intra-articular Orthokine is an
Also known as n l 1 (IL-1) autologous serum interleukin 1 Receptor Receptor solution derived receptor antagonist (IL1R) Antagonist from the patient's protein blood. It contains the interleukin-1 receptor antagonist (IL-IRa) protein that prevents the interaction of IL-1 with the receptor.
PRT 1000 Interleuki Interleukin- PRT 1000 contains
Also known as n l 1 (IL-1) MB-IL IRA which interleukin 1 Receptor Receptor is an interleukin-1 receptor antagonist (IL1R) Antagonist receptor antagonist protein protein (IL1RA), fused with a matrix binding domain. It is a potent cytokine inhibitor and prevents the interaction of IL1 with the receptor.
Anakinra/ ineret Large Interleuki Interleukin- interleukin 1 (IL1) molecule n l 1 (IL-1) receptor antagonist.
Receptor Receptor
(IL1R) Antagonist Rilonacept Large Rilonacept has one molecule extracellular
domain of IL-1 receptor type 1 (IL- 1R1) and one of IL- 1 receptor accessory protein (IL-lRAcP) bound to the Fc portion of IgG β-hydroxybut rate Small Blocking ASC (BHB) molecule oligomerization,
NLRP3 Inhibiting inhibitor K+/potassium efflux;
MicroRNA-223 Micro Suppressing
RNA NLRP3 protein expression by binding to a conserved site in the 3' UTR of the NLRP3 transcript,.
[000119] In some embodiments of the aspects described herein, the IL-Ιβ inhibitor is an IL-Ιβ inhibitor antibody or antigen-binding fragment thereof that binds to IL-Ιβ and
reduces/inhibits/prevents IL-Ιβ binding to its receptor(s), thereby inhibiting IL-^-mediated proinflammatory activity. As used herein, "antibodies" or "antigen-binding fragments" thereof include monoclonal, human, humanized or chimeric antibodies, single chain antibodies, Fab fragments, F(ab') fragments, fragments produced by a Fab expression library, and/or binding fragments of any of the above. Antibodies also refer to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e. , molecules that contain antigen or target binding sites or "antigen- binding fragments." The immunoglobulin molecules described herein can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g. , IgGl, IgG2, IgG3, IgG4, IgAl and IgA2) or subclass of immunoglobulin molecule, as is understood by one of skill in the art.
[000120] The terms "antibody fragment" or "antigen-binding fragment" include: (i) the Fab
fragment, having VL, CL, VH and CHI domains; (ii) the Fab' fragment, which is a Fab fragment having one or more cysteine residues at the C-terminus of the CHI domain; (iii) the Fd fragment having VH and CH1 domains; (iv) the Fd' fragment having VH and CH1 domains and one or more cysteine
residues at the C-terminus of the CHI domain; (v) the Fv fragment having the VL and VH domains of a single arm of an antibody; (vi) a dAb fragment (Ward et al , Nature 341, 544-546 (1989)) which consists of a VH domain or a VL domain ; (vii) isolated CDR regions; (viii) F(ab')2 fragments, a bivalent fragment including two Fab' fragments linked by a disulphide bridge at the hinge region; (ix) single chain antibody molecules (e.g. single chain Fv; scFv) (Bird et al, Science 242:423-426 (1988); and Huston et al, PNAS (USA) 85:5879-5883 (1988)); (x) "diabodies" with two antigen binding sites, comprising a heavy chain variable domain (VH) connected to a light chain variable domain (VL) in the same polypeptide chain (see, e.g. , EP 404,097; WO 93/1 1 161 ; and Hollinger et al. , Proc. Natl. Acad. Sci. USA, 90:6444-6448 ( 1993)); (xi) "linear antibodies" comprising a pair of tandem Fd segments (VH-CH1-VH-CH1) which, together with complementary light chain polypeptides, form a pair of antigen binding regions (Zapata et al. Protein Eng. 8(10): 1057-1062 (1995); and U.S. Pat. No. 5,641,870); and modified versions of any of the foregoing (e.g. , modified by the covalent attachment of polyalkylene glycol (e.g. , polyethylene glycol, polypropylene glycol, polybutylene glycol) or other suitable polymer).
[000121] Accordingly, in some embodiments of the aspects described herein, the IL-Ιβ inhibitor antibody or antigen-binding fragment thereof is selected from ABT981, an anti-interleukin-ΐβ inhibitor antibody by ABZYME, APX002, Canakinumab/Ilaris, CDP48, immunereszumab,
LY2189102, MEDI8968, and XOMA052.
[000122] In some embodiments of the aspects described herein, the IL- Ιβ inhibitor is an IL- 1 receptor antagonist. As used herein, an "interleukin-1 receptor antagonist" ("IL-lra") is any agent or molecule, including small molecules and antibody or antigen-binding fragments thereof, that binds to an interleukin- 1 receptor thereby preventing binding of IL- 1 β to the receptor and thereby inhibiting IL-^-mediated pro-inflammatory activity. Interleukin 1 receptor antagonists, as well as methods of making and using thereof, are described in, for example, U.S. Pat. No. 5,075,222; WO 91/08285; WO 91/17184; AU 9173636; WO 92/16221 ; W093/21946; WO 94/06457; WO 94/21275; FR 2706772; WO 94/21235; DE 4219626, WO 94/20517; WO 96/22793 and WO 97/28828, the contents of which are incorporated herein by reference in their entireties. The proteins include glycosylated as well as non-glycosylated IL-1 receptor antagonists.
[000123] Accordingly, in some embodiments of the aspects described herein, the IL-1 receptor antagonist is selected from CDP484, CP412245, CYT013 ILlbQb, XL 130, AMG108, HL 2351, ILlHyl, AXXO, orthokine, PRT 1000, anakinra, and rilonacept.
[000124] In some embodiments of the aspects described herein, the IL- Ιβ inhibitor is a small molecule or microRNA inhibitor that inhibits IL-^-mediated pro-inflammatory activity. Such small molecule inhibitors can target or specifically bind IL-Ιβ, IL-1 -receptors, and/or IL-1 signaling components, such as caspase-1, and/or the NLRP3 inflammasome, or components thereof, thereby inhibiting/reducing/blocking IL-^-mediated proinflammatory activity. As used herein, "small molecule inhibitors" include, but are not limited to, small peptides or peptide-like molecules, soluble peptides, and synthetic non-peptidyl organic or inorganic compounds. A small molecule inhibitor or antagonist can have a molecular weight of any of about 100 to about 20,000 daltons (Da), about 500 to about 15,000 Da, about 1000 to about 10,000 Da.
[000125] Accordingly, in some embodiments of the aspects described herein, the small molecule or microRNA IL-Ιβ inhibitor is selected from, AC201, MCC950 or CRID3, inflabion, inflammasome modulator OPSONA, PGE3935199, PGE527667, TRK530, β-hydroxybutyrate (BHB), and microR A-223. In some embodiments of the aspects described herein, the small molecule IL- Ιβ inhibitor is MCC950.
[000126] In some embodiments of the aspects descried herein, an inhibitor of TET2 mutation- mediated IL-Ιβ (interleukin-ΐβ) proinflammatory activity is a TET2 activating compound or TET2 potentiatior. As used herein, the terms "TET2 activating compound " or "TET2 potentiatior" or "TET2 activator" or "TET2 agonist" refer to a molecule or agent that mimics or up-regulates (e.g., increases, potentiates or supplements) the biological activity of TET2, thereby decreasing or inhibiting IL-Ιβ (interleukin-ΐβ) proinflammatory activity caused by deficient TET2 activity. A TET2 potentiator or agonist can be, in some embodiments, a TET2 protein fragment or derivative thereof having at least one bioactivity of the wild-type TET2. A TET2 activator can also be a compound which increases TET2 dioxygenase activity, TET2 mutation-mediated histone H2B GlcNAcylation, and/or TET2 mutation-mediated histone deacetylase recruitment to specific gene promoters, for example. Exemplary TET2 activating compounds or agonists contemplated for use in the various aspects and embodiments described herein include, but are not limited to, R A or DNA aptamers; TET2 structural analogs or TET2 fragments, derivatives, or fusion polypeptides thereof; and small molecule agents that target or bind to TET2 and act as functional mimics of TET2.
[000127] A subject in need of the pharmaceutical compositions and methods comprising inhibitors of TET2 mutation-mediated IL-Ιβ (interleukin-ΐβ) proinflammatory activity and a pharmaceutically acceptable carrier described herein has or identified as having one or more TET2 somatic mutations in a sub-population of their hematopoietic cells. As used herein, a "sub-population" of hematopoietic cells comprising the one or more TET2 mutations in the subject refers to at least 1% of hematopoietic cells, at least 2% of hematopoietic cells, at least 3% of hematopoietic cells, at least 4% of hematopoietic cells, at least 5% of hematopoietic cells, at least 6% of hematopoietic cells, at least 7% of hematopoietic cells, at least 8% of hematopoietic cells, at least 9% of hematopoietic cells, at least 10% of hematopoietic cells, at least 1 1% of hematopoietic cells, at least 12% of hematopoietic cells, at least 13% of hematopoietic cells, at least 15% of hematopoietic cells, at least 15% of hematopoietic cells, at least 20% of hematopoietic cells, or more, or between 1-5% of hematopoietic cells, between 1-10% of hematopoietic cells, between 1-15% of hematopoietic cells, between 1-20% of
hematopoietic cells, between 5-10% of hematopoietic cells, between 5-15% of hematopoietic cells, between 5-20% of hematopoietic cells, between 10-15% of hematopoietic cells, between 10-20% of hematopoietic cells, between 15-20% of hematopoietic cells, present in a sample obtained from the subject. In some embodiments, a sub-population of cells in a subject can refer to a specific cell type or lineage within the hematopoietic cells in the subject, such as myeloid lineage cells or macrophages. In such embodiments, the "sub-population" of cells comprising the one or more TET2 mutations in the subject refers to at least 1% of myeloid cells, at least 2% of myeloid cells, at least 3% of myeloid cells, at least 4% of myeloid cells, at least 5% of myeloid cells, at least 6% of myeloid cells, at least 7% of myeloid cells, at least 8% of myeloid cells, at least 9% of myeloid cells, at least 10% of myeloid cells, at least 1 1% of myeloid cells, at least 12% of myeloid cells, at least 13% of myeloid cells, at least 15% of myeloid cells, at least 15% of myeloidcells, at least 20% of myeloidcells, or more, or between 1-5% of myeloid cells, between 1-10% of myeloid cells, between 1-15% of myeloid cells, between 1-20% of myeloid cells, between 5-10% of myeloid cells, between 5-15% of myeloid cells, between 5-20% of myeloid cells, between 10-15% of myeloid cells, between 10-20% of myeloid cells, between 15-20% of myeloid cells, or greater than 20% of myeloid cells present in a sample obtained from the subject.
[000128] The terms "biological sample" or "sample" as used herein refers to a cell or population of cells or a quantity of tissue or fluid from a subject comprising one or more hematopoietic cells. Most often, the biological sample has been removed from a subject, but the term "biological sample" can also refer to cells or tissue analyzed in vivo, i.e., without removal from the subject. Thus, a "sample" of hematopoietic cells can be obtained from any tissue or organ in the subject comprising cells of hematopoietic origin, including blood, spleen, lymph nodes, cord blood, placenta, and bone marrow. Hematopoietic cells (HSCs) include myeloid cells (monocytes and macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes/platelets, dendritic cells), and lymphoid lineages (T-cells, B-cells, NKT-cells, NK-cells), as well as progenitor cell populations, including multipotent cells, such as hematopoietic stem cells. As used herein, the term "population of hematopoietic cells" encompasses a heterogeneous or homogeneous population of hematopoietic cells and/or
hematopoietic progenitor cells. In other words, a population of hematopoietic cells comprising at least two different cell types is referred to herein as a "heterogeneous population."
[000129] In some aspects, provided herein are sensitive and specific companion diagnostic and treatment methods, also referred to herein as "theranostic methods," to detect and closely monitor TET2 somatic mutations associated with disease, particularly IL-Ιβ mediated disorders, including cardiometabolic diseases. As used herein, a"companion diagnostic" refers to a diagnostic method and or reagent that are used to identify subjects susceptible to treatment with a particular treatment or to monitor treatment and/or to identify an effective dosage for a subject or sub-group or other group of subjects.
[000130] Accordingly, in some aspects, provided herein are theranostic methods for treating a subject having, or at risk for, a TET2 mutation-mediated IL-Ιβ proinflammatory disease comprising: (a) sequencing a hematopoietic cell sample from the subject to identify one or more somatic mutations in TET2, and (b) administering a therapeutically effective amount of a pharmaceutical composition comprising an inhibitor of TET2 mutation-mediated IL- Ιβ (interleukin- ΐβ) proinflammatory activity and a pharmaceutically acceptable carrier if one or more somatic mutations in TET2 are identified in the hematopoietic cell sample. [000131] A sample of hematopoietic cells for use in the methods and uses described herein can, in some embodiments, undergo further processing, such as via flow cytometric sorting and/or magnetic bead based sorting methods, to become an enriched population of hematopoietic cells for analysis of TET2 mutations, using any method known to one of skill in the art.
[000132] In some embodiments of the aspects described herein, a sample comprising hematopoietic cells isolated from a subject, such as a sample obtained from peripheral blood, is then further processed, for example, by cell sorting (e.g., magnetic sorting or FACS), to obtain a population of enriched or isolated hematopoietic cells or a sub-population thereof, for example, myeloid-derived cells.
[000133] The terms "isolate" and "methods of isolation," as used herein, refer to any process whereby a cell or population of cells, such as a population of hematopoietic cells, is removed from a subject or sample in which it was originally found, or a descendant of such a cell or cells. The term "isolated population," as used herein, refers to a population of cells that has been removed and separated from a biological sample, or a mixed or heterogeneous population of cells found in such a sample. Such a mixed population includes, for example, a population of hematopoietic cells obtained from peripheral blood. In some embodiments, an isolated population is a substantially pure population of cells as compared to the heterogeneous population from which the cells were isolated or enriched from. In some embodiments of this aspect and all such aspects described herein, the isolated population is an isolated population of myeloid cells. In other embodiments of this aspect and all aspects described herein, the isolated population comprises a substantially pure population of myeloid cells as compared to a heterogeneous population of hematopoietic cells comprising various other cells types.
[000134] The term "substantially pure," with respect to a particular cell population, refers to a population of cells that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99% pure, with respect to the cells making up a total cell population.
[000135] The terms "enriching" or "enriched" are used interchangeably herein and mean that the yield (fraction) of cells of one type, such as hematopoietic cells for use in the methods and uses described herein, is increased by at least 15%, by at least 20%, by at least 25%, by at least 30%, by at least 35%, by at least 40%, by at least 45%, by at least 50%, by at least 55%, by at least 60%, by at least 65%, by at least 70%, or by at least 75%, over the fraction of cells of that type in the starting biological sample, culture, or preparation.
[000136] In some embodiments of the aspects described herein, markers specific for different hematopoietic cell types are used to isolate or enrich for these cells. A "marker," as used herein, describes the characteristics and/or phenotype of a cell. Markers can be used for selection of cells comprising characteristics of interest. Markers will vary with specific cells. Markers are characteristics, whether morphological, functional or biochemical (enzymatic), particular to a cell type, or molecules expressed by the cell type. Preferably, such markers are proteins, and more preferably, possess an epitope for antibodies or other binding molecules available in the art. However, a marker may consist of any molecule found in a cell including, but not limited to, proteins (peptides and polypeptides), lipids, polysaccharides, nucleic acids and steroids. Examples of morphological characteristics or traits include, but are not limited to, shape, size, appearance (e.g., smooth, translucent), and nuclear to cytoplasmic ratio. Examples of functional characteristics or traits include, but are not limited to, the ability to adhere to particular substrates, ability to incorporate or exclude particular dyes, ability to migrate under particular conditions, and the ability to differentiate along particular lineages. Markers may be detected by any method available to one of skill in the art.
[000137] Accordingly, as used herein, a "cell-surface marker" refers to any molecule that is expressed on the surface of a cell. Cell-surface expression usually requires that a molecule possesses a transmembrane domain. Some molecules that are normally not found on the cell-surface can be engineered by recombinant techniques to be expressed on the surface of a cell. Many naturally occurring cell-surface markers are termed "CD" or "cluster of differentiation" molecules. Cell-surface markers often provide antigenic determinants to which antibodies can bind to.
[000138] A cell can be designated "positive" or "negative" for any cell-surface marker, and both such designations are useful for the practice of the methods described herein. A cell is considered "positive" for a cell-surface marker if it expresses the marker on its cell-surface in amounts sufficient to be detected using methods known to those of skill in the art, such as contacting a cell with an antibody that binds specifically to that marker, and subsequently performing flow cytometric analysis of such a contacted cell to determine whether the antibody is bound the cell. It is to be understood that while a cell may express messenger RNA for a cell-surface marker, in order to be considered positive for the methods described herein, the cell must express it on its surface. Similarly, a cell is considered "negative" for a cell-surface marker if it does not express the marker on its cell-surface in amounts sufficient to be detected using methods known to those of skill in the art, such as contacting a cell with an antibody that binds specifically to that marker and subsequently performing flow cytometric analysis of such a contacted cell to determine whether the antibody is bound the cell. In some embodiments, where agents specific for cell-surface lineage markers used, the agents can all comprise the same label or tag, such as fluorescent tag, and thus all cells positive for that label or tag can be excluded or removed, to leave uncontacted hematopoietic stem or progenitor cells for use in the methods described herein. In some embodiments of the aspects described herein, an agent specific for a cell-surface molecule, such as an antibody or antigen-binding fragment, is labeled with a tag to facilitate the isolation of the hematopoietic stem cells. The terms "label" or "tag", as used herein, refer to a composition capable of producing a detectable signal indicative of the presence of a target, such as, the presence of a specific cell-surface marker in a biological sample. Suitable labels include fluorescent molecules, radioisotopes, nucleotide chromophores, enzymes, substrates, chemiluminescent moieties, magnetic particles, bioluminescent moieties, and the like. As such, a label is any composition detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical or chemical means needed for the methods to isolate and enrich endothelial cell progenitor cells.
[000139] In some embodiments of the aspects described herein, a variety of methods to isolate a substantially pure or enriched population of cells, such as myeloid cells, are available to a skilled artisan, including immunoselection techniques, such as high-throughput cell sorting using flow cytometric methods, affinity methods with antibodies labeled to magnetic beads, biodegradable beads, non-biodegradable beads, and antibodies panned to surfaces including dishes, and any combination of such methods.
[000140] As defined herein, "positive selection" refers to techniques that result in the isolation or enrichment of cells expressing specific cell-surface markers, while "negative selection" refers techniques that result in the isolation or enrichment of cells not expressing specific cell-surface markers. In some embodiments, beads can be coated with antibodies by a skilled artisan using standard techniques known in the art, such as commercial bead conjugation kits. In some
embodiments, a negative selection step is performed to remove cells expressing one or more lineage markers, followed by fluorescence activated cell sorting to positively select cells expressing one or more specific cell-surface markers.
[000141] As defined herein, "flow cytometry" refers to a technique for counting and examining microscopic particles, such as cells and chromosomes, by suspending them in a stream of fluid and passing them through an electronic detection apparatus. Flow cytometry allows simultaneous multiparametric analysis of the physical and/or chemical parameters of up to thousands of particles per second, such as fluorescent parameters. Modern flow cytometric instruments usually have multiple lasers and fluorescence detectors. Increasing the number of lasers and detectors allows for labeling by multiple antibodies, and can more precisely identify a target population by their phenotypic markers. Certain flow cytometric instruments can take digital images of individual cells, allowing for the analysis of fluorescent signal location within or on the surface of cells.
[000142] A common variation of flow cytometric techniques is to physically sort particles based on their properties, so as to purify populations of interest, using "fluorescence-activated cell sorting" As defined herein, "fluorescence-activated cell sorting" or "flow cytometric based sorting" methods refer to flow cytometric methods for sorting a heterogeneous mixture of cells from a single biological sample into one or more containers, one cell at a time, based upon the specific light scattering and fluorescent characteristics of each cell and provides fast, objective and quantitative recording of fluorescent signals from individual cells as well as physical separation of cells of particular interest. Accordingly, in some embodiments, fluorescence-activated cell sorting (FACS) can be used with the methods described herein to isolate and enrich for populations of cells, such as myeloid cells, from a sample of hematopoietic cells.
[000143] In some embodiments of the methods described herein, the methods further comprise monitoring clonality of TET2 somatic mutations in a subject. In other words, following the treatment, the size or percentage of the clone harboring a TET2 somatic mutation is determined to monitor the effectiveness of the treatment.
[000144] In some embodiments of the methods described herein, the methods further comprise decreasing the number or percentage of hematopoietic clones comprising the one or more TET2 mutation(s) in the subject by transfusing the subject with hematopoietic stem cells in which the mutations are absent or reduced, for example, by administering a bone marrow transplant.
[000145] In some such embodiments, the subject is transfused with autologous bone marrow. Alternatively, or additionally, in some embodiments, the subject is transfused with allogeneic bone marrow.
[000146] A bone marrow transplant is a procedure where healthy bone marrow stem cells, are infused into a subject to replace damaged or diseased bone marrow, or to replace damaged peripheral blood cells generated from bone marrow stem cells. Prior to the transplant, chemotherapy, radiation, or both can be given. In what is known as ablative (myeloablative) treatment, typically used for cancer treatments, high-dose chemotherapy, radiation, or both are given to kill peripheral cells, as well as all healthy bone marrow that remains, and allows new stem cells to grow in the bone marrow. Reduced intensity treatments, also called a mini transplant, can also be performed where lower doses of chemotherapy and radiation are received before a transplant. For the methods described herein, where the issues arise from somatic mutations in the periphery, total ablation of the bone marrow may not be required.
[000147] If an autologous stem cell transplant is used, apheresis can be used to collect blood stem cells. Briefly, blood is withdrawn from the subject's body and one or more blood components are removed, such as all leukocytes or all myeloid cells, and transfusion of the remaining cells are performed. Before apheresis, daily injections of growth factor can be administered to increase stem cell production and move stem cells into circulating blood so they can be collected. During apheresis, blood is drawn from a vein and circulated through a machine. The machine separates blood into different parts, including hematopoietic stem cells. These stem cells can be collected and frozen for future use in the bone marrow transplant.
[000148] In some embodiments of the methods described herein, the methods further comprise decreasing the number or percentage of hematopoietic cells or clones comprising the one or more TET2 mutations in the subject by performing therapeutic cytapheresis on the subject.
[000149] Therapeutic cytapheresis removes cellular components from blood, returning plasma. It is most often used to remove defective RBCs and substitute normal ones in patients with sickle cell anemia who have the following conditions: acute chest syndrome, stroke, pregnancy, or frequent, severe sickle cell crises. Other known uses of cytapheresis include collection of peripheral blood stem cells for autologous or allogeneic bone marrow reconstitution (an alternative to bone marrow transplantation) and collection of lymphocytes for use in immune modulation cancer therapy
(adoptive immunotherapy).
[000150] In the methods described herein, a subject undergoing therapeutic cytapheresis can also be administered one or more agents to stimulate hematopoietic stem cell migration from the bone marrow to the blood, following removal of all cellular components from the blood using therapeutic cytapheresis .
[000151] In some embodiments, a subject undergoing therapeutic cytapheresis can further be transfused with autologous blood. Alternatively, or additionally, in some embodiments, the subject is further transfused with allogeneic blood.
[000152] In those embodiments where the subject is transfused with autologous blood, the blood can undergo processing steps prior to transfusion to remove and/or decrease the number of hematopoietic cells having the one or more TET2 mutations. Such processing steps can include flow cytometric or magnetic bead-based sorting and enrichment methods to remove hematopoietic cells having the one or more TET2 mutations
[000153] In some embodiments of the methods described herein, the subject is administered or transfused with hematopoietic cells that have been modified to correct any somatic mutations in TET2, using any method known in the art to modify or incorporate target genes into the genome of a cell so as to facilitate the expression of such genes, also referred to herein as "gene targeting" or "gene therapy" methods.
[000154] One system for the integration or modification of target genes into the genome of a hematopoietic cell is the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas system, a system that originally evolved as an adaptive defense mechanism in bacteria and archaea against viral infection. The CRISPR/Cas system includes palindromic repeat sequences within plasmid DNA and an associated Cas9 nuclease. This ensemble of DNA and protein directs site specific DNA cleavage of a target sequence by first incorporating foreign DNA into CRISPR loci. Polynucleotides containing these foreign sequences and the repeat-spacer elements of the CRISPR locus are in turn transcribed in a host cell to create a guide RNA, which can subsequently anneal to a target sequence and localize the Cas9 nuclease to this site. In this manner, highly site-specific cas9- mediated DNA cleavage can be engendered in a foreign polynucleotide because the interaction that brings cas9 within close proximity of the target DNA molecule is governed by RNA:DNA hybridization. As a result, one can theoretically design a CRISPR/Cas system to cleave any target DNA molecule of interest. This technique has been exploited in order to edit eukaryotic genomes (Hwang et al. Nature Biotechnology 31 :227 (2013) and can be used as an efficient means of site- specifically editing hematopoietic stem cell genomes in order to cleave DNA prior to the incorporation of a gene encoding a target gene, such as a TET2 gene lacking the somatic mutations described herein. The use of CRISPR/Cas to modulate gene expression has been described in, e.g., US 8,697,359, the disclosure of which is incorporated herein by reference. Alternative methods for site- specifically cleaving genomic DNA prior to the incorporation of a gene of interest in a hematopoietic cell include the use of zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs). Unlike the CRISPR/Cas system, these enzymes do not contain a guiding polynucleotide to localize to a specific target sequence. Target specificity is instead controlled by DNA binding domains within these enzymes. The use of ZFNs and TALENs in genome editing applications is described, e.g., in Urnov et al. Nature Reviews Genetics 1 1 :636 (2010); and in loung et al. Nature Reviews Molecular Cell Biology 14:49 (2013), the disclosure of both of which are incorporated herein by reference.
[000155] Another method that can be used for incorporating polynucleotides encoding target genes into hematopoietic stem cells involves the use of transposons. Transposons are polynucleotides that encode transposase enzymes and contain a polynucleotide sequence or gene of interest flanked by 5 ' and 3 ' excision sites. Once a transposon has been delivered into a cell, expression of the transposase gene commences and results in active enzymes that cleave the gene of interest from the transposon. This activity is mediated by the site-specific recognition of transposon excision sites by the transposase. In certain cases, these excision sites may be terminal repeats or inverted terminal repeats. Once excised from the transposon, the gene of interest can be integrated into the genome of a mammalian cell by transposase-catalyzed cleavage of similar excision sites that exist within the nuclear genome of the cell. This allows the gene of interest to be inserted into the cleaved nuclear DNA at the complementary excision sites, and subsequent covalent ligation of the phosphodiester bonds that join the gene of interest to the DNA of the mammalian cell genome completes the incorporation process. In certain cases, the transposon may be a retrotransposon, such that the gene encoding the target gene is first transcribed to an RNA product and then reverse-transcribed to DNA before incorporation in the mammalian cell genome. Exemplary transposon systems include the piggybac transposon (described in detail in, e.g., WO 2010/085699) and the sleeping beauty transposon (described in detail in, e.g., US2005/01 12764), the disclosures of each of which are incorporated herein by reference.
[000156] Additional genome editing techniques that can be used to incorporate polynucleotides encoding target genes into the genome of a hematopoietic cell include the use of ARCUS™ meganucleases that can be rationally designed so as to site-specifically cleave genomic DNA. The use of these enzymes for the incorporation of genes encoding target genes into the genome of a mammalian cell is advantageous in view of the defined structure-activity relationships that have been established for such enzymes. Single chain meganucleases can be modified at certain amino acid positions in order to create nucleases that selectively cleave DNA at desired locations, enabling the site-specific incorporation of a target gene into the nuclear DNA of a hematopoietic stem cell. These single-chain nucleases have been described extensively in, e.g., US 8,021,867 and US 8,445,251, the disclosures of each of which are incorporated herein by reference.
[000157] Another example of a platform that can be used to facilitate the expression of a target gene in a hematopoietic cell is by the integration of the polynucleotide encoding a target gene into the nuclear genome of the cell. A variety of techniques have been developed for the introduction of exogenous genes into a eukaryotic genome. One such technique involves the insertion of a target gene into a vector, such as a viral vector. Vectors for use with the compositions and methods of the invention can be introduced into a cell by a variety of methods, including transformation, transfection, direct uptake, projectile bombardment, and by encapsulation of the vector in a liposome, and are well known in the art. Examples of suitable methods of transfecting or transforming cells include calcium phosphate precipitation, electroporation, microinjection, infection, lipofection and direct uptake. Such methods are described in more detail, for example, in Green, et al., Molecular Cloning: A Laboratory Manual, Fourth Edition, Cold Spring Harbor University Press, New Y ork (2014); and Ausubel, et al ., Current Protocols in Molecular Biology, John Wiley & Sons, New York (2015), the disclosures of each of which are incorporated herein by reference.
[000158] Examples of viral vectors useful in the methods described herein include a retrovirus, adenovirus (e.g., Ad5, Ad26, Ad34, Ad35, and Ad48), parvovirus (e.g., adeno-associated viruses), coronavirus, negative strand RNA viruses such as orthomyxovirus (e.g., influenza virus), rhabdovirus (e.g., rabies and vesicular stomatitis virus), paramyxovirus (e.g. measles and Sendai), positive strand RNA viruses, such as picomavirus and alphavirus, and double stranded DNA viruses including herpes virus (e.g., Herpes Simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and poxvirus (e.g., vaccinia, modified vaccinia Ankara (MVA), fowlpox and canarypox). Other viruses include Norwalk virus, togavirus, flavivirus, reoviruses, papovavirus, hepadnavirus, and hepatitis virus, for example. Examples of retroviruses include: avian leukosis-sarcoma, mammalian C-type, B-type viruses, D-type viruses, HTLV-BLV group, lentivirus, spumavirus (Coffin, J. M., Retroviridae: The viruses and their replication, In Fundamental Virology, Third Edition, B. N. Fields, et al, Eds., Lippincott-Raven Publishers, Philadelphia, 1996, the disclosure of which is incorporated herein by reference). Other examples of viral vectors include murine leukemia viruses, murine sarcoma viruses, mouse mammary tumor virus, bovine leukemia virus, feline leukemia virus, feline sarcoma virus, avian leukemia virus, human T-cell leukemia virus, baboon endogenous virus, Gibbon ape leukemia virus, Mason Pfizer monkey virus, simian immunodeficiency virus, simian sarcoma virus, Rous sarcoma virus and lentiviruses. Other examples of vectors are described in, e.g., US 5,801,030, the disclosure of which is incorporated herein by reference. [000159] In some embodiments, the methods further comprise initiating a monitoring regimen following the administration of one or more treatments to the subject. For example, monitoring includes repeating the diagnostic steps of the method on the subject on a monthly, bi-monthly or quarterly basis to determine whether there is, for example, reduced IL-Ιβ (interleukin-ΐβ) proinflammatory activity or decreased percentages of hematopoietic cells in the blood having one or more TET2 mutations described herein.
[000160] In some embodiments of the methods described herein, the theranostic methods comprise further administering one or more additional therapeutic agents to the subject, in addition to the inhibitor of TET2 mutation-mediated IL-Ιβ (interleukin-ΐβ) proinflammatory activity. Such an additional therapeutic agent can be co-administered with the inhibitor of TET2 mutation-mediated IL- 1β (interleukin-ΐβ) proinflammatory activity. As used herein, the phrase "co-administering" or to "coadminister" means the administration of an inhibitor described herein and another compound, e.g., a therapeutic agent, separately, simultaneously, and/or sequentially over a period of time as determined by a qualified care giver.
[000161] Non-limiting examples of additional therapeutic agents that can be administered to a subject having one or more TET2 somatic mutations include quinidine, procainamide, disopyramide, lidocaine, phenytoin, mexiletine, flecainide, propafenone, moricizine, propranolol, esmolol, timolol, metoprolol, atenolol, bisoprolol, amiodarone, sotalol, ibutilide, dofetilide, dronedarone, E-4031, verapamil, diltiazem, adenosine, digoxin, magnesium sulfate, warfarin, heparins, anti-platelet drugs (e.g., aspirin and clopidogrel), beta blockers (e.g., metoprolol and carvedilol), angiotensin-converting enzyme (ACE) inhibitors (e.g., captopril, zofenopril, enalapril, ramipril, quinapril, perindopril, lisinopril, benazepril, fosinopril, casokinins and lactokinins), statins (e.g., atorvastatin, cerivastatin, fluvastatin, lovastatin, pitavastatin, mevastatin, pravastatin, rosuvastatin, and simvastatin), aldosterone antagonist agents (e.g., eplerenone and spironolactone), digitalis, diuretics, digoxin, inotropes (e.g., Milrinone), vasodilators and omega-3 fatty acids and combinations thereof.
[000162] In some aspects and embodiments of the methods directed to treatment of chronic kidney diseases, the additional therapeutic agent is an angiotensin-converting enzyme (ACE) inhibitor, an angiotensin II receptor blocker (ARB), or a mineralocorticoid receptor (MR) antagonist.
[000163] ACE inhibitors for use with the compositions and methods described herein include, but are not limited to, benazepril (marketed in the U.S. as LOTENSIN™), captopril (marketed in the U.S. as CAPOTEN™), enalapril/enalaprilat (marketed in the U.S. as VASOTEC™ oral and injectable), fosinopril (marketed in the U.S. as MONOPRIL™), lisinopril (marketed in the U.S. as ZESTRIL™ and PRINIVIL™), moexipril (marketed in the U.S. as UNIVASC™), perindopril (marketed in the U.S. as ACEON™), quinapril (marketed in the U.S. as ACCUPRIL™), ramipril (marketed in the U.S. as ALTACE™), and trandolapril (marketed in the U.S. as MAVIK™). ARBs for use with the inhibitors described herein include candesartan (marketed in the U.S. as ATACAND™), irbesartan (marketed in the U.S. as AVAPR01M), olmesartan (marketed in the U.S. as BENICAR ), losartan (marketed in the U.S. as COZAAR™), valsartan (marketed in the U.S. as DIOVAN™), telmisartan (marketed in the U.S. as MICARDIS™), and eprosartan (marketed in the U.S. as TEVETEN™).
[000164] In some embodiments of these methods and all such methods described herein, the method further comprises administering to the subject an effective amount of a diuretic. Diuretics include, but are not limited to, torsemide (marketed in the U.S. as DEMADEX™), furosemide (marketed in the U.S. as LASIX™), bumetanide (marketed in the U.S. as BUMEX™), ethacrynic acid (marketed in the U.S. as EDECRIN™), torsemide (marketed in the U.S. as DEMADEX™), amiloride, (marketed in the U.S. as MID AMOR™), acetazolamide (marketed in the U.S. as DIAMOX™), pamabrom (marketed in the U.S. as AQUA-BAN™), mannitol (marketed in the U.S. as ARIDOL™ or OSMITROL™), traimterene (marketed in the U.S. as DYRENIUM™), spironolactone (marketed in the U.S. as ALDACTONE™), amiloride (marketed in the U.S. as MIDAMOR™), indapamide (marketed in the U.S. as LOZOL™), hydrochlorothiazide (marketed in the U.S. as
HYDRODIURIL™), metolazone (marketed in the U.S. as ZAROXOLYN™or MYKROX™), methylclothiazide (marketed in the U.S. as AQUATENSEN™ or ENDURON™), hydrocholorthiazide (marketed in the U.S. as AQUAZIDE H™or ESIDRIX™ or MICROZIDE™), chlorothiazide (marketed in the U.S. as DIURIL™), bendroflumethiazide (marketed in the U.S. as NATURETIN™), polythiazide (marketed in the U.S. as RENESE™), hydroflumethiazide (marketed in the U.S. as SALURON™), and chlorthalidone (marketed in the U.S. as THALITONE™). For a complete listing also see, e.g., Physician's Desk Reference, 2017 Edition, PDR Network (2016).
[000165] As used herein, the terms "treat" or "treatment" or "treating" as used herein in reference to use of inhibitors of TET2 mutation-mediated IL-Ιβ proinflammatory activity for the treatment of a cardiovascular disease or disorder refers to therapeutic treatment, wherein the object is to prevent or slow the development of the disease, such as slow down the development of a cardiac disorder, or reducing at least one adverse effect or symptom of a cardiovascular condition, disease or disorder, i.e., any disorder characterized by insufficient or undesired cardiac function. Adverse effects or symptoms of cardiac disorders are well-known in the art and include, but are not limited to, dyspnea, chest pain, palpitations, dizziness, syncope, edema, cyanosis, pallor, fatigue and death. Treatment is generally "effective" if one or more symptoms or clinical markers are reduced as that term is defined herein. Alternatively, a treatment is "effective" if the progression of a disease is reduced or halted. That is, "treatment" includes not just the improvement of symptoms or decrease of markers of the disease, but also a cessation or slowing of progress or worsening of a symptom that would be expected in absence of treatment. Beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptom(s), diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. "Treatment" can also mean prolonging survival as compared to expected survival if not receiving treatment.
[000166] In some embodiments, the term "treating" when used in reference to a treatment of a cardiovascular disease or disorder is used to refer to the reduction of a symptom and/or a biochemical marker of a cardiovascular disease or disorder, for example a reduction in at least one biochemical marker of a cardiovascular disease by at least about 10% would be considered an effective treatment. Examples of such biochemical markers of cardiovascular disease include a reduction of, for example, creatine phosphokinase (CPK), aspartate aminotransferase (AST), lactate dehydrogenase (LDH) in the blood, and/or a decrease in a symptom of cardiovascular disease, such as atherosclerosis, and/or an improvement in blood flow and cardiac function as determined by someone of ordinary skill in the art as measured by electrocardiogram (ECG or EKG), or echocardiogram (heart ultrasound), Doppler ultrasound and nuclear medicine imaging. A reduction in a symptom of a cardiovascular disease by at least about 10% would also be considered effective treatment by the methods as disclosed herein. As alternative examples, a reduction in a symptom of cardiovascular disease, for example a reduction of at least one of the following; dyspnea, chest pain, palpitations, dizziness, syncope, edema, cyanosis etc. by at least about 10% or a cessation of such systems, or a reduction in the size one such symptom of a cardiovascular disease by at least about 10% would also be considered as affective treatments by the methods as disclosed herein. In some embodiments, it is preferred, but not required that the therapeutic agent actually eliminate the cardiovascular disease or disorder, rather just reduce a symptom to a manageable extent.
[000167] The term "effective amount" as used herein refers to the amount of therapeutic agent of pharmaceutical composition to alleviate at least one or more symptom of the disease or disorder, and relates to a sufficient amount of pharmacological composition to provide the desired effect. With reference to the treatment of, for example, a cardiovascular condition or disease in a subject, the term "effective amount" refers to the amount that is safe and sufficient to prevent or delay the development or a cardiovascular disease or disorder. The amount can thus cure or cause the cardiovascular disease or disorder to go into remission, slow the course of cardiovascular disease progression, slow or inhibit a symptom of a cardiovascular disease or disorder, slow or inhibit the establishment of secondary symptoms of a cardiovascular disease or disorder or inhibit the development of a secondary symptom of a cardiovascular disease or disorder. The effective amount for the treatment of the cardiovascular disease or disorder depends on the type of cardiovascular disease to be treated, the severity of the symptoms, the subject being treated, the age and general condition of the subject, the mode of administration and so forth. Thus, it is not possible to specify the exact "effective amount". However, for any given case, an appropriate "effective amount" can be determined by one of ordinary skill in the art using only routine experimentation. The efficacy of treatment can be judged by an ordinarily skilled practitioner, for example, efficacy can be assessed in animal models of a cardiovascular disease or disorder as discussed herein, and any treatment or administration of the compositions or formulations that leads to a decrease of at least one symptom of the cardiovascular disease or disorder as disclosed herein, for example, decreased levels of atherosclerosis in the blood vessels, increased heart ejection fraction, decreased rate of heart failure, decreased infarct size, decreased associated morbidity (pulmonary edema, renal failure, arrhythmias) improved exercise tolerance or other quality of life measures, and decreased mortality indicates effective treatment.
[000168] By "reduce" or "inhibit" in terms of the methods of treatment of chronic kidney disease and proteinuria described herein is meant the ability to cause an overall decrease preferably of 20% or greater, 30% or greater, 40% or greater, 45% or greater, more preferably of 50% or greater, of 55% or greater, of 60 % or greater, of 65% or greater, of 70% or greater, and most preferably of 75% or greater, 80% or greater, 85% or greater, 90% or greater, or 95% or greater, for a given parameter or symptom of a chronic kidney disease. Reduce or inhibit can refer to, for example, symptoms of the disorder being treated, for example, high blood pressure, protein in the urine, etc.
[000169] High blood pressure is almost always present during all stages of chronic kidney disease. A nervous system exam may show signs of nerve damage. The health care provider may hear abnormal heart or lung sounds when listening with a stethoscope. The early symptoms of chronic kidney disease are also symptoms of other illnesses. These symptoms can be the only signs of kidney disease until the condition is more advanced. Symptoms of chronic kidney disease can include:
appetite loss; general ill feeling and fatigue; headaches; itching (pruritus) and dry skin; nausea; weight loss without trying to lose weight; etc. Other symptoms that can develop, especially when kidney function has gotten worse, include: abnormally dark or light skin; bone pain; brain and nervous system symptoms; drowsiness and confusion; problems concentrating or thinking; numbness in the hands, feet, or other areas; muscle twitching or cramps; breath odor; easy bruising, bleeding, or blood in the stool; excessive thirst; frequent hiccups; low level of sexual interest and impotence; stopping of menstrual periods (amenorrhea); shortness of breath; sleep problems, such as insomnia, restless leg syndrome, and obstructive sleep apnea; swelling of the feet and hands (edema); vomiting, typically in the morning.
[000170] Accordingly, in some embodiments of the methods described herein, an effective amount of a composition comprising an inhibitor of TET2 mutation-mediated IL- Ιβ (interleukin-ΐβ) proinflammatory activity described herein is administered to a subject in order to alleviate one or more symptoms of chronic kidney disease. As used herein, "alleviating a symptom chronic kidney disease" is ameliorating any condition or symptom associated with the chronic kidney disease.
Alternatively, alleviating a symptom of a chronic kidney disease can involve reducing one or more symptoms of the chronic kidney disease in the subject relative to an untreated control suffering from chronic kidney disease or relative to the subject prior to the treatment. As compared with an equivalent untreated control, or the subject prior to the treatment with the inhibitor, such reduction or degree of prevention is at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more, as measured by any standard technique. Desirably, the chronic kidney disease is significantly reduced or undetectable, as detected by any standard method known in the art, in which case the chronic kidney disease is considered to have been treated. A patient who is being treated for a chronic kidney disease is one who a medical practitioner has diagnosed as having such a condition. Diagnosis can be by any suitable means known to one of ordinary skill in the art. Diagnosis and monitoring can involve, for example, detecting the level of specific proteins or molecules in a urine, blood, or serum sample, such as, for example, albumin, calcium, cholesterol, complete blood count (CBC), electrolytes, magnesium, phosphorous, potassium, sodium, or any combination thereof; assays to detect, for example, creatinine clearance; creatinine levels; BUN (blood urea nitrogen); through the use of specific techniques or procedures, such as an abdominal CT scan, abdominal MRI, abdominal ultrasound, kidney biopsy, kidney scan, kidney ultrasound; via detection of changes in results of assays or tests for
erythropoietin, PTH; bone density test, or Vitamin D; or any combination of such detection methods and assays.
[000171] The compositions and methods described herein ideally result in a therapeutic significant reduction in one or more symptoms. A therapeutically significant reduction in a symptom is, e.g. at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 125%, at least about 150% or more in a measured parameter as compared to a control or non-treated subject. Measured or measurable parameters include clinically detectable markers of disease, for example, elevated or depressed levels of a biological marker, as well as parameters related to a clinically accepted scale of symptoms or markers for a disease or disorder. It will be understood, that the total daily usage of the compositions and formulations as disclosed herein will be decided by the attending physician within the scope of sound medical judgment. The exact amount required will vary depending on factors such as the type of disease being treated.
[000172] The inhibitors of TET2 mutation-mediated IL- Ιβ proinflammatory activity described herein can be administered using any means or route known to those of ordinary skill in the art and known to provide desired effects. As used herein, the terms "administering," and "introducing" are used interchangeably herein and refer to the placement of the therapeutic agents as disclosed herein into a subject by a method or route which results in delivering of such agent(s) at a desired site. The compounds can be administered by any appropriate route which results in an effective treatment in the subject, including topical administration.
[000173] Routes of administration include, but are not limited to aerosol, direct injection, intradermal, transdermal (e.g., in slow release polymers), intravitreal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, topical, oral, transmucosal, buccal, rectal, vaginal, transdermal, intranasal and parenteral routes.
[000174] The phrases "parenteral administration" and "administered parenterally" as used herein mean modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, sub capsular, subarachnoid, intraspinal, intracerebro spinal, and intrasternal injection and infusion. The phrases "systemic administration," "administered
systemically", "peripheral administration" and "administered peripherally" as used herein mean the administration therapeutic compositions other than directly into a tumor such that it enters the animal's system and, thus, is subject to metabolism and other like processes.
[000175] The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio. The phrase "pharmaceutically acceptable carrier" as used herein means a pharmaceutically acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in maintaining the activity of or carrying or transporting the subject agents from one organ, or portion of the body, to another organ, or portion of the body. In addition to being "pharmaceutically acceptable" as that term is defined herein, each carrier must also be "acceptable" in the sense of being compatible with the other ingredients of the formulation. The pharmaceutical formulation contains a compound of the invention in combination with one or more pharmaceutically acceptable ingredients. The carrier can be in the form of a solid, semi-solid or liquid diluent, cream or a capsule. These pharmaceutical preparations are a further object of the invention. Usually the amount of active compounds is between 0.1-95% by weight of the preparation, preferably between 0.2-20% by weight in preparations for parenteral use and preferably between 1 and 50% by weight in preparations for oral administration. For the clinical use of the methods of the present invention, targeted delivery composition of the invention is formulated into pharmaceutical compositions or pharmaceutical formulations for parenteral administration, e.g., intravenous; mucosal, e.g., intranasal; enteral, e.g., oral; topical, e.g., transdermal; ocular, e.g., via corneal scarification or other mode of administration. The pharmaceutical composition contains a compound of the invention in combination with one or more pharmaceutically acceptable ingredients. The carrier can be in the form of a solid, semi-solid or liquid diluent, cream or a capsule.
[000176] It is understood that the foregoing description and the following examples are illustrative only and are not to be taken as limitations upon the scope of the invention. Various changes and modifications to the disclosed embodiments, which will be apparent to those of skill in the art, may be made without departing from the spirit and scope of the present invention. Further, all patents, patent applications, and publications identified are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the present invention. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents are based on the information available to the applicants and do not constitute any admission as to the correctness of the dates or contents of these documents.
[000177] All patents and other publications identified are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that could be used in connection with the present invention. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.
EXAMPLES
Example 1
[000178] Recent human studies have shown that aging is paralleled by an increased frequency of somatic mutations in the hematopoietic system that allow the expansion of mutant hematopoietic cells (clonal hematopoiesis), and are associated with increased risk of atherosclerotic cardiovascular disease (ACVD). However, whether there is a direct causal connection between these mutations and CVD remains unknown. Mutations in the epigenetic modifier TET2 are frequent in the hematopoietic system of elderly individuals and have been associated with clonal hematopoiesis.
[000179] While CVD is the leading cause of death in the elderly, almost 60% of elderly patients with atherosclerotic CVD have either no or just one conventional CV risk factors (e.g. hypertension, hypercholesterolemia, etc.) ( 1). Furthermore, increasing evidence suggests that most middle-aged individuals at low CV risk, based on traditional risk factors, exhibit significant subclinical atherosclerosis (2, 3). These clinical data indicate the possibility of previously unidentified age- dependent factors that contribute to the development of CVD. The accumulation of somatic DNA mutations is a hallmark of aging, particularly in proliferating tissues, which over time can become a mosaic of cells with different genotypes due to the clonal expansion of single, de novo mutations (4). However, while human studies indicate that somatic mutations may be associated with a broad spectrum of human disease (5-7), there is very little information on the potential causal role of somatic mutations in age-associated disorders other than cancer.
[000180] Recent human studies have shown that normal aging is associated with an increased frequency of somatic mutations in the hematopoietic system, which provide a competitive growth advantage to the mutant cell and therefore allow its progressive clonal expansion (clonal
hematopoiesis) (7-1 1). This acquired clonal mosaicism in the hematopoietic system of healthy individuals predicts an increased risk of subsequent hematologic cancer (7-9), but it has also recently been associated with higher prevalence of vascular complications of diabetes, greater incidence of atherosclerotic conditions (i.e. coronary heart disease, stroke) and increased frequency of CVD- related deaths (6, 7). While these human studies suggest a connection between somatic mutations in hematopoietic cells, clonal hematopoiesis and atherosclerosis, their descriptive nature does not allow cause-effect relationships, or even directionality, to be established. These associations could simply reflect shared consequences of the aging process or be secondary to confounding factors, especially given that they were uncovered in elderly populations with high proportions of diabetic individuals (6, 7).
[000181] Most of the reported somatic mutations associated with age-related clonal hematopoiesis occur in a small number of genes encoding epigenetic regulators (7-10). The present study focuses on one of these genes, TET2, the first gene reported to exhibit somatic mutations in blood cells in individuals with clonal hematopoiesis without hematological malignancies (10). More than 70 different mutations have been reported in the TET2 gene in blood cells (7-10), which are likely to result in loss of gene function given that most are small insertions/deletions or non-sense mutations. This gene encodes a multifaceted epigenetic regulator of gene transcription that modulates hematopoietic stem and progenitor cell (HSPC) self-renewal ( 12- 15), but whose role in CVD remains largely unexplored. To mimic the human scenario of clonal hematopoiesis and test the hypothesis that clonal expansion of Tet2 -deficient hematopoietic cells contributes to atherosclerosis, a competitive bone marrow transplantation (BMT) strategy was used to generate atherosclerosis-prone Ldlr-/- chimeric mice with a small proportion of Tet2 -deficient hematopoietic stem and progenitor cells (HSPCs). Lethally irradiated Ldlr-/- recipients were transplanted with suspensions of BM cells containing 10% Tet2-/- cells and 90% Tet2+/+ cells (10% KO-BMT mice), and then fed a high fat diet (HFD) for 9 weeks to induce atherosclerosis development (FIGS. 5A-5B). To distinguish donor Tet2-/- and Tet2+/+ cells in this experimental setting, Tet2+/+ cells were obtained from mice carrying the CD45.1 variant of the CD45 hematopoietic antigen, whereas Tet2-/- cells were obtained from mice carrying the CD45.2 variant of this protein. Control mice (10% WT-BMT) were transplanted with 10% CD45.2+ Tet2+/+ cells and 90% CD45.1+ Tet2+/+ cells.
[000182] Flow cytometry analysis of CD45.2+ cells in the blood of transplanted mice established that this BMT strategy led to clonal expansion of Tet2-/- hematopoietic cells. Immediately prior to the start of HFD feeding (4 weeks after BMT), CD45.2+ cells already represented approximately 28% of blood cells in 10% KO-BMT mice, compared with the expected -10% in WT controls (FIGS. 1A, IB). CD45.2+ cells in 10% KO-BMT expanded further over time, reaching 42% of blood cells after 2 weeks of HFD (6 weeks after BMT) and 56% after 8 weeks of HFD (12 weeks after BMT), whereas the frequency of CD45.2+ cells remained constant in WT controls. This clonal expansion of Tet2- deficient HSPCs is similar to that observed when human cells carrying somatic TET2 mutations are transplanted into immune-deficient mice (16), showing that Tet2-/-murine cells and human TET2 mutant cells exhibit similar properties. The efficient ablation of Tet2 in CD45.2+ cells of 10% KO- BMT mice was confirmed by qRT-PCR analysis of magnetically-sorted white blood cell (WBC) fractions (FIG. 1C), which exhibited a -92% purity of CD45.2+ cells (FIG. 6A). No changes were observed in the expression of Tetl or Tet3, two related epigenetic modulators. Although the absolute number of HSPCs, defined as Lineage-, Scal+, c-Kit+ (LSK) cells was comparable in the BM and spleen of 10% KO-BMT mice and WT controls (FIG. 6B), CD45.2+ cells represented 69% of LSK cells in the BM (FIG. 6C) and 61% in the spleen (FIG. 6D) of 10% KO-BMT mice at 13 weeks post- BMT. These data further support the idea that Tet2 -deficient HSPCs exhibit a competitive growth advantage over WT counterparts, which allows their clonal expansion, consistent with previous studies reporting that Tet2 inactivation enhances HSPC self-renewal (12-15). The transplanted Tet2-/- BM cells expanded into all blood cell lineages, although with marked differences, with the highest
CD45.2+ frequency in the myeloid lineage and the lowest in the T-lymphoid lineage in BM (FIG. ID), spleen (FIG. IE) and blood (FIGS. IF, 1G) of 10% KO-BMT mice, in agreement with previous studies with Tet2-deficient mice (12-15) and TET2 -mutant human cells (16). This expansion of Tet2- /- HSPCs, did not affect total blood cell counts as the numbers of T cells, B cells, neutrophils and monocytes were comparable in 10% KO-BMT mice and WT controls (FIG. 6E), consistent with human studies showing that cancer-free individuals carrying TET2 mutations do not exhibit significant changes in the absolute numbers of WBC subsets (7, 10).
[000183] Having demonstrated that the BMT strategy led to the clonal expansion of Tet2 -deficient HSPCs cells and therefore mimics the human scenario of clonal hematopoiesis associated with TET2 mutations, it was next evaluated whether this affects the development of atherosclerosis and related metabolic abnormalities. No significant differences between genotypes were observed in body weight (FIG. 2A), blood glucose levels (FIG. 2B) or systemic insulin sensitivity (FIG. 2C) after nine weeks of HFD-feeding. As expected, HFD-fed Ldlr-/- mice developed marked hypercholesterolemia, which was comparable in 10% WT-BMT mice and 10% KO-BMT mice (FIG. 2D). While BM genotype did not affect these metabolic parameters, it had a profound effect in atherosclerotic plaque size as 10% KO-BMT mice exhibited 73% larger plaques in the aortic root than WT controls (FIG. 2E). This was paralleled by an increase in macrophage numbers in the intima of the aortic wall in 10% KO-BMT mice (FIG. 2F), whereas no significant differences between genotypes were observed in lesional content of collagen or vascular smooth muscle cells (FIG. 8). No differences were observed either in plaque cell apoptosis measured by TUNEL (FIG. 9A). Similarly, proliferation rates of total plaque cells or lesional macrophages were comparable in 10% KO-BMT mice and WT controls, as evidenced by immunofluorescent co-staining of the macrophage marker CD68 and the proliferation antigen Ki- 67 (FIG. 9B)
[000184] The above-described expansion of Tet2 -deficient hematopoietic cells observed in BM, spleen and blood was reflected in the immune cell composition of the atherosclerotic vascular wall, as revealed by flow cytometry analysis of aortic arch samples from HFD-fed mice. CD45.2+ cells represented 59% of total immune cells, 63% of macrophages and 35% of T-cells present in the aortic wall of 10% KO-BMT (FIGS. 1G, 1H, and 7). The low number of neutrophils or B cells in the aortic arch at this early stage of atherosclerosis precluded their inclusion in this analysis. Overall, these data demonstrate that clonal expansion of Tet2 -deficient hematopoietic cells accelerates atherosclerosis development in a manner independent of alterations in systemic metabolism or macrophage proliferation or apoptosis in the plaque.
[000185] As described above, Tet2 -deficient HSPCs expand preferentially into the myeloid lineage, mainly the macrophage population within the atherosclerotic plaque. Based on this observation, it was hypothesized that the expansion of Tet2 -deficient hematopoietic cells accelerates atherosclerosis mainly by generating a pool of macrophages with enhanced pro-atherogenic activities. To test this possibility, it was evaluated whether Tet2 deficiency affects macrophage functions relevant to atherosclerosis development. Consistent with the in vivo data, Tet2 deficiency did not have a significant effect in MCSF-induced proliferation (FIG. 10A) or oxysterol-induced apoptosis (FIG. 10B) of cultured macrophages. Similarly, it did not affect oxidized LDL (oxLDL) uptake (FIG. IOC) or the expression of scavenger receptors SR-A and CD36 (FIG. 10D). To evaluate whether Tet2 deficiency affects pro-inflammatory macrophage activation, Affymetrix microarray was performed on Tet2-deficient macrophages treated with a combination of lipopolysaccharide (LPS, 10 ng/ml) and IFNy (2 ng/ml). A widespread alteration in gene expression was found in Tet2-/- macrophages where 475 genes were significantly altered by a fold change greater than 1.5-fold compared to WT macrophages (q<0.05, FIG. 3A).
[000186] PANTHER functional annotation software revealed that transcripts encoding for cytokine, chemokine and signaling molecules were the top three over-represented protein classes altered in the transcriptome of Tet2 -deficient macrophages (FIG. 3B). Genes in these protein classes encoding for proteins with known pro-inflammatory actions were mostly upregulated in Tet2- deficient macrophages (FIG. 3C), indicating that Tet2 inhibits pro-inflammatory activation of macrophages. Consistent with this observation, qRT-PCR analysis confirmed that Tet2 -deficient macrophages exhibit markedly increased expression of pro-inflammatory cytokines, such as IL-6, IL- 1β, IL-la, or TNF (FIG. 3D, FIG. 11A.); chemokines, such as CXCL 1,2,3, CCL3 or CCL5 (FIG. 3E FIG. 11B); and enzymes, such as COX-2 (FIG. 3F). The increased expression of most of these proinflammatory genes was apparent at early time-points of stimulation and sustained over time. This pattern of gene expression was also evident in Tet2-/- macrophages stimulated with higher doses of LPS (100 ng/ml) and IFNy (20 ng/ml, FIG. 11C). Consistent with its effects at the level of transcription, Tet2 deficiency resulted in increased secretion of IL-6 protein (FIG. 3G). These data indicate that Tet2 acts as a negative transcriptional regulator of pro-inflammatory responses, and are consistent with a previous study reporting that Tet2 represses IL-6 expression at late phase of LPS stimulation (77). The results described herein reveal that Tet2 has broader effects on proinflammatory cytokine/chemokine expression than previously reported, particularly when
macrophages are co-stimulated with TH1 cytokines such as IFNy.
[000187] However, the situation in vivo in the atherosclerotic plaque is particularly complex, as lesional macrophages are exposed to multiple signals simultaneously. Therefore, the antiinflammatory actions of Tet2 in cultured macrophages were further evaluated by testing their effect on macrophage response to a cocktail of low doses of oxLDL (25 μg/ml), TNF (5 ng/ml) and IFNy (2 ng/ml), three pro-inflammatory stimuli present in atherosclerotic plaques. Under these conditions, Tet2 ablation resulted in generally increased pro-inflammatory cytokine/chemokine expression in this context, although to a lesser extent than after LPS/IFNy stimulation (FIGS. 12A-12B), with the exception of IL-Ιβ, which was markedly upregulated in Tet2 -deficient macrophages at all time-points of oxLDL/TNF/IFNy stimulation (FIG. 4A). These data indicate a predominant role for IL-Ιβ in the exacerbated atherosclerosis associated with Tet2 -deficient HSPC expansion. Supporting this notion, gene expression analysis in the aortic arch of mice fed a HFD for 9 weeks revealed a significant >2- fold increase in transcript levels of IL-Ιβ in 10% KO-BMT compared to control BMT mice (FIG. 4B). In contrast, no significant differences between genotypes were observed in the aortic expression of other cytokines/chemokines or other macrophage-enriched genes at this early time point, with the exception of the chemokine CXCL3, which was also significantly upregulated in the aortic arch of 10% KO-BMT mice (FIGS. 13A, 13B). Under the conditions of these assays atherosclerotic plaques in the aortic arch are small and in a nascent stage (18), indicating that the increased IL-Ιβ expression is an early event driving the accelerated atherosclerosis development associated with Tet2 -deficient HSPC expansion. Because endothelial cell activation is a key mechanism contributing to early atherogenesis, it was evaluated whether the increased IL-Ιβ expression in 10% KO-BMT mice was paralleled by changes in the aortic expression of endothelial adhesion molecules. The expression of P-se lectin, an adhesion molecule essential for monocyte/neutrophil recruitment to the arterial wall in early atherogenesis (19, 20), was significantly increased in 10% KO-BMT, and trends of increased expression were observed for other adhesion molecules, such as E-selectin and ICAM1 (FIG. 13A). There was a significant correlation between IL-Ιβ and P-selectin expression in the aortic arch samples (FIG. 13B), further indicating the contribution of IL-Ιβ to the aortic expression of P-selectin. Overall, these results support a central role for IL-Ιβ in the increased atherosclerosis associated with clonal expansion of Tet2 -deficient hematopoietic cells, which, without wishing to be limited or constrained by theory, may be mediated by exacerbated endothelial cell activation in the arterial wall.
[000188] Although many details of its role in regulating chromatin architecture remain unknown, Tet2 has emerged as a multifaceted epigenetic regulator that is able to facilitate both transcription activation and repression depending on the molecular and cellular context. Given that Tet2 loss-of- function is associated with increased IL-Ιβ gene expression, experiments were focused on potential mechanisms of Tet2 -mediated transcriptional repression in macrophages. Consistent with previous studies showing that Tet2 can inhibit gene transcription via Hdac 1/2 -mediated histone deacetylation (17), treatment with the Hdac inhibitor Trichostatin A (TSA) resulted in increased IL-Ιβ expression in LPS/IFNy-treated macrophages and abolished expression differences between Tet2 -deficient and WT genotypes (FIG. 14A). Further supporting a role for Hdac-induced histone deacetylation in Tet2- mediated repression of IL- Ιβ, CHIP-qPCR analysis revealed greater histone H3 acetylation at the IL- 1β promoter in Tet2 -deficient macrophages (FIG. 14B). In contrast, HDAC inhibition with TSA reduced transcript expression of other pro-inflammatory cytokines, such as IL-6 or TNF, in agreement with previous reports (27), and did not affect differences between genotypes (FIG. 14C). Consistent with these findings, H3 acetylation at the IL-6 promoter was comparable in Tet2-deficient and WT macrophages (FIG. 14D). Overall, these data indicate that reduced Hdac-mediated histone deacetylation can account for the effects of Tet2 loss-of-function on IL-Ι β expression in
macrophages, while alternative mechanisms contribute to its effects on the expression of other genes.
[000189] Given that IL-Ιβ is synthesized as an inactive protein (pro-IL- Ιβ), which requires proteolytic cleavage for its secretion, the effects of Tet2-deficiency on IL- Ιβ post-translational processing were evaluated. IL-Ιβ cleavage is frequently mediated by the NLRP3 inflammasome, a multiprotein complex that is activated by a variety of danger signals and plays key roles in multiple inflammatory conditions. NLRP3 inflammasome activation is a two-step process requiring a priming signal, that promotes pro-IL- Ιβ and NLRP3 expression, and an activation signal, that promotes inflammasome assembly. To investigate whether Tet2 deficiency facilitates NLRP3 -mediated IL-Ιβ processing and secretion, IL-Ιβ cleavage was evaluated by Western Blot analysis in LPS/IFNy-primed macrophages treated with ATP for inflammasome activation. As shown in FIGS. 4C, 4D, Tet2- deficient macrophages exhibit significant increases in intracellular pro-IL- Ιβ and cleaved IL-Ιβ, consistent with the observed changes at the transcriptional level. However, the effect on cleaved IL-Ιβ levels (2.5-fold. FIG.4D) was substantially greater than that on pro-IL-Ιβ levels (1.6-fold, FIG. 4C), indicating that Tet2 loss-of-function promotes IL-Ιβ secretion by macrophages beyond its effects on IL-Ι β transcription and the production of pro-IL-Ιβ protein. Consistent with these findings, a >3-fold increase was observed in secreted IL-Ιβ levels in the supernatant of LPS/IFNy/ATP-treated, Tet2- deficient macrophages compared to WT controls both by Western Blot (FIG. 4E) and ELISA analysis (FIG. 4F). IL-Ιβ secretion was completely abrogated by co-treatment with MCC950 (FIG. 4F), a specific NLRP3 inhibitor (22), indicating that Tet2 -deficiency affects NLRP3 -mediated IL-Ιβ secretion. To test this possibility, the effect of Tet2 on the expression of key inflammasome components was evaluated. NLRP3 transcript and protein levels were significantly increased in Tet2- /- macrophages compared to WT controls after LPS/IFNy treatment (FIGS.4G, 4H), whereas no change was observed in the expression of other NLRP3 inflammasome components (FIG. 15A). Consistent with these findings, Tet2 deficiency also enhanced NLRP3 expression in macrophages treated with low dose OXLDL/TNF/IFNY (FIG. 15B), as well as IL-Ιβ secretion induced by co- treatment with cholesterol crystals (FIG. 41), a relevant inducer of inflammasome activation and IL- 1β secretion in atherosclerotic plaques (23). Overall, these data demonstrate that Tet2 deficiency contributes to IL-Ιβ production by enhancing NLRP3 priming in addition to promoting IL-Ιβ gene transcription, and are consistent with a central role of enhanced IL-Ιβ signaling in the increased atherosclerosis associated with expansion of Tet2-deficient hematopoietic cells. Supporting this notion, Tet2 deficiency also increased basal expression of the activating IL-Ιβ receptor IL-1R1, without affecting the expression of the inhibitory IL-Ιβ receptor IL-1R2 or the IL-1 receptor antagonist (IL-1RA) (FIG. 4J). Consistent with his observation, Tet2 -deficient macrophages exhibited an enhanced response to treatment with recombinant IL-Ιβ, as reflected by a ~3-fold increase in IL-6 and IL-Ιβ transcript levels compared to WT macrophages (FIG. 4K).
[000190] The studies described herein provide mouse genetic evidence supporting a causal connection between exacerbated CVD in humans and clonal hematopoiesis associated with somatic TET2 mutations in HSPCs, and it represents the first report of a direct contribution of genome mosaicism in the hematopoietic system to the development of a non-hematological disease, specifically atherosclerosis. Furthermore, when considered in light of previous cancer studies (13, 14, 24), the results presented herein indicate that the expansion of TET2 -mutant HSPCs represents a pathophysiological mechanism that is shared between blood cancers and CVD. These studies show that Tet2 loss-of-function accelerates atherosclerosis development by exacerbating pro-inflammatory IL-Ιβ signaling in macrophages at multiple levels including elevated expression of pro-IL-Ιβ, modulation of the NLRP3 inflammasome that mediates pro-IL-Ιβ maturation, and activation of the IL- 1 βκϋερΐθΓ IL- 1 Rl . IL- 1 β is a potential therapeutic target in the setting of atherosclerosis, and neutralizing antibodies against this cytokine are being evaluated in human clinical trials for the treatment of CVD (25). In addition, pharmacological inhibitors of the NLRP3 inflammasome have displayed efficacy in preclinical models of inflammatory diseases (22). In this regard, the studies described herein are of particular clinical relevance, as it suggests that IL-Ιβ blockade or NLRP3 inflammasome inhibition can be particularly effective for the prevention/treatment of CVD in individuals carrying somatic mutations in TET2 and other related genes in hematopoietic cells. Materials and Methods [000191] Mice. C57B1/6J Ldlr-deficient mice (Ldlr-/-), C57B1/6J Tet2-deficient mice (Tet2-/-) (12) and C57B1/6 Cd45.1 Pep Boy mice were obtained from Jackson Laboratories. Mice were maintained on a 12-h light/dark schedule in a specific pathogen-free animal facility and given food and water ad libitum. The number of mice included in each study is indicated in the legends of the figures.
[000192] Bone Marrow Transplantation and atherosclerosis induction. Lethally irradiated Ldlr-/- recipients were transplanted with suspensions of BM cells containing 10% CD45.2+ Tet2-/- cells and 90% CD45.1+ Tet2+/+ cells (10% KO-BMT mice), or 10% CD45.2+ Tet2+/+ cells and 90% CD45.1+ Tet2+/+ cells (10% WT-BMT mice) (Fig. S I). BM cells were isolated from femurs and tibias of donor mice after euthanasia. Donor CD45.2+ cells were obtained from Tet2+/+ or -/- littermates; donor CD45.1+ cells were obtained from Pep Boy mice. Recipient Ldlr-/- mice were irradiated in a pie cage (Braintree Scientific) to limit mobility and ensure equal dose of irradiation and were exposed to two radiation doses of 550 rad three hours apart using an X-RAD 320 Biological Irradiator. After the second irradiation, each recipient mouse was injected with 107 BM cells i.v. Sterilized caging, food and water were provided during the first 14 days post-transplant and water was supplemented with antibiotics (Sulfatrim). Mice that did not recover full pre -irradiation body weight 28 days after transplant were excluded from further analysis. Starting four weeks after BMT, mice were fed a high fat Western diet (Harlan-Teklad, Adjusted Calories Diet; 42% from fat, 0.2% cholesterol) for nine weeks to promote hyperlipidemia and the development of atherosclerosis.
[000193] Assessment of systemic metabolism. Plasma cholesterol levels were determined using an enzymatic assay (Cholesterol E, WAKO Diagnostics). Blood glucose levels were measured with an ACCU-CHEK glucometer (Roche Diagnostics). Insulin tolerance tests (ITT) were performed on 5 h- fasted mice injected intraperitoneally with 0.6U/Kg human insulin (Humulin R, Eli Lilly), and blood glucose levels were measured immediately before and 15, 30, 60, 90, and 120 minutes after glucose injection.
[000194] Quantification of atherosclerosis burden. Mice were euthanized and aortas were removed after in situ perfusion with phosphate-buffered saline (PBS) injected through the left ventricle of the heart. Tissue fixation was achieved by immersion in 4% paraformaldehyde in PBS overnight at 4°C. Aortic tissue was then dehydrated and embedded in paraffin for sectioning. All histological sections comprising the aortic root as determined by the location of the aortic valve leaflets were cut at a thickness of 6 μιη. An operator who was blinded to genotype quantified plaque size in aortic root sections by computer-assisted morphometric analysis of microscopy images acquired on a KEYENCE BZ-9000 microscope. For each mouse, atherosclerosis plaque size in aortic root cross-sections was calculated as the average of 5 independent sections separated by ~18 um.
[000195] Immunohistochemical analysis of atherosclerotic plaque composition. Plaque composition was exam ined by immunohistochemical techniques performed by a researcher blinded to genotype. Vascular smooth muscle ceils (VSMCs) were identified with mouse anti-smooth muscle a- actin (SMA) monoclonal alkaline phosphatase-conjugated antibody (clone 1A4, SIGMA) and Vector Red Alkaline Phosphatase Substrate (Vector Laboratories). Macrophages were detected with a rat anti-Mac3 monoclonal antibody (clone M3/84, Santa Cruz Biotechnologies), followed by biotin- conjugated goat anti-rat secondary antibody (Santa Cruz Biotechnologies), streptavidin-HRP (Vector Laboratories) and DAB substrate (Vector Laboratories). Specimens were counterstained with hematoxylin. Collagen content was determined by a modified Masson's trichrome staining with Fast Green as collagen stain. Microscopy images were acquired on a KEYENCE BZ-9000 microscope and analyzed using IMAGEJ software using the Color Deconvolution plugin.
[000196] Assessment of plaque cell proliferation and apoptosis. Macrophage proliferation within atherosclerotic plaques was assessed by double immunofluorescent staining with monoclonal antibodies against Ki-67 (clone SP6, Vector Laboratories) and CD68 (Clone FA-1 1, AbD Serotec). After deparaffinization, antigen retrieval and blockade of non-specific interactions (5% horse serum in PBS, 45 min), histological sections were incubated for 2 h at 37 °C with primary antibodies. CD68 was visualized with Alexa Fluor 488-conjugated anti-rat IgG and Ki-67 with Alexa Fluor 635- conjugated anti-rabbit IgG (both from Life Technologies). Nuclei were stained with DAPI and slides were mounted in SLOWFADE GOLD ANTIFADE Reagent (Life Technologies) to acquire images on a LEICA SP5 confocal microscope fitted with a 40* oil -immersion objective. Settings were adjusted to maximize the signal-to-noise ratio. The sequential mode was used for image acquisition in order to avoid any interference from overlapping fluorescence. Images were analyzed with ImageJ software by a researcher who was blinded to genotype. Plaque apoptosis was determined using the terminal deoxynucleotidyl transferase dUTP nick-end labelling (TUNEL) method, following the
manufacturer's recommendations (In Situ Cell Death Detection Kit Fluorescein, Roche). Images were acquired on a KEYENCE BZ-9000 microscope.
[000197] Flow cytometry analyses of blood and tissue samples. Peripheral blood was obtained from the facial vein. Bone marrow ceils were flushed out of two femurs and two tibias per mouse. Spleen was gently pressed through a 70 μ,ηι cell strainer in PBS containing 10% fetal bovine serum (FBS) to prepare single cell suspensions. Aortic arches were digested for 45 minutes at 37°C in RPMI containing 10% FBS and 0.25 mg/ml LIBERASE™ (Roche Life Science). The following fluorescent antibodies were used for staining and flow cytometry analysis: eFluor450-conjugated anti-CD45.2, FITC-conjugated anti-CD45.2, Pe-Cy7-conjugated anti-CD45.1, FITC-conjugated anti-CD l ib, eFluor450-conjugated anti-CD l IB, PE-conjugated anti-CD l 15, APC-conjugated anti-CD3, FITC- conjugated anti-Lineage cocktail (from eBioscience); APC-Cy7-conjugated anti-B220, PerCP-Cy5.5- conjugated anti-Ly6G, PE-Cy7-conjugated anti-c-Kit, AlexaFluor647-conjugated anti-Sca-1 (from BD Biosciences); APC-conjugated anti-mouse F4/80 (from R&D Systems); PerCP-Cy5.5 anti- CD45.1 (from BioLegend). HPSCs were identified as Lineage-, c-Kit+, Scal+; monocytes, as CD45+, CD 1 lb+, CD 1 15Hi; neutrophils, as CD45+, CD 1 lb+, CD 1 15Lo, Ly6g+, T lymphocytes as CD45+, CD11B+, B220-, CD3+; B lymphocytes as CD45+, CDl lb-, CD3-, B220+; and aortic macrophages as CD45+, CD 11B+, F4/80Hl. Dead cells were excluded from analysis with DAPI staining. 123count EBEADS (eBioscience) were used to quantify absolute cell numbers. A BD LSR II Flow Cytometer (BD Bioscience) was used for data acquisition. Data were analyzed with FLOWJO Software.
[000198] Cell culture studies. Thiogly collate -elicited macrophages were obtained from the peritoneal cavity of mice 4 days after intraperitoneal injection of 1 ml of aged 4% Brewer's thiogly collate broth (BD Difco). Macrophages were allowed to adhere for 4 hours and cultured in RPMI medium supplemented with antibiotics and 10% FBS (PERFORMANCE PLUS FBS, Gibco). Bone marrow-derived macrophages were obtained from suspensions of femoral BM that were differentiated for 7 days in the presence of RPMI medium supplemented with antibiotics, 10% fetal bovine serum and 15% L929-cell conditioned medium as a source of macrophage colony-stimulating factor (MCSF). Cell cycle progression and apoptosis of cultured macrophages was evaluated by flow cytometry analysis of DNA content. After fixation in 80% ethanol for 1 h at -20°C, cells were incubated for 30 min with 50 μg/mL propidium iodide containing 0.25 mg/mL RNAse A (both from SIGMA). For cell cycle analysis, DNA histograms were fitted into cell cycle distributions using the MODFIT 3.0 software (Verity Software House). For analysis of apoptosis induced by treatment with 7-ketocholesterol (Sigma), hypodiploid (SubGl) cells were quantified using with FLOWJO Software. Uptake of fluorescent dil -conjugated oxidized LDL (Alfa Aesar) was evaluated by flow cytometry analysis. Pro-inflammatory activation of macrophages was achieved by treatment with various combinations of multiple stimuli as described in main text and figure legends. The following stimuli were used: LPS (Invivogen), recombinant IFNy protein (Peprotech), oxLDL (Alfa Aesar) and recombinant TNF protein (Peprotech). For NLRP3 inflammasome activation, LPS/IFNy-primed macrophages were treated with 5mM ATP (SIGMA) for 15 or 30 minutes. Alternatively, macrophages were treated for 8 hours with a combination of oxLDL, TNF, IFNy and cholesterol crystals. For cholesterol crystal preparation, Cholesterol (Sigma) was dissolved in 95% Ethanol, heated to 60° and cooled down at room temperature to allow crystallization.
[000199] Gene expression analysis by qRT-PCR. Total RNA from tissues and cultured cells was isolated using QIAZOL reagent and RNEASY kits (QIAGEN). RNA (0.3-1.5 μg) was reverse transcribed with ISCRIPT™ Advanced cDNA Synthesis Kit kits (Bio-Rad). qRT-PCR was performed with Power SYBR® Green reagent (ThermoFisher Scientific) in a VIIA7 PCR system. Primers for mouse gene expression studies are shown in Table 2. TAQMAN® assays for human gene expression studies were from Life Technologies. Results were analyzed with the AACt method. 36B4, β-actin or the combination of both were used as reference genes for normalization. The following primers were used:
TABLE 2: SEQ ID NOs: 8-57
Gene Forward Primer Reverse Primer (SEQ ID NOs: 8-32) (SEQ ID NOs: 33-57)
36B4 GCTCCAAGCAGATGCAGCA CCGGATGTGAGGCAGCAG
β-actin GGCTGTATTCCCCTCCATCG CCAGTTGGTAACAATGCCATGT
IL-Ι β TGACAGTGATGAGAATGACCTGTTC TTGGAAGCAGCCCTTCATCT
IL-6 GCTACCAAACTGGATATAATCAGGA CCAGGTAGCTATGGTACTCCAGAA
IL-l GCACCTTACACCTACCAGAGT AAACTTCTGCCTGACGAGCTT
TNF CGGAGTCCGGGCAGG GCTGGGTAGAGAATGGATGAA
CCL2 MCP1 CAGCCAGATGCAGTTAACGC GCCTACTCATTGGGATCATCTTG
CXCL1 CCGAAGTCATAGCCACACTCAA CAAGGGAGCTTCAGGGTCAA
CXCL2 TGACTTCAAGAACATCCAGAGCTT CTTGAGAGTGGCTATGACTTCTGTCT
CXCL3 TTTGAGACCATCCAGAGCTTGA CCTTGAGAGTGGCTATGACTTCTGT
CCL3 GCGCCATATGGAGCTGACA CGTGGAATCTTCCGGCTGTA
CCL5 CAGCAGCAAGTGCTCCAATC CACACACTTGGCGGTTCCTT
COX2 TGGTGCCTGGTCTGATGA GTGGTAACCGCTCAGGTGTTG
SR-A TCAGACTGAAGGACTGGGAACA GGAGGCCCTTGAATGAAGGT
CD36 TGCCCATGCCGAGAGTCT CAGAGGCGCACCAAACCT
SELP CATCTGGTTCAGTGCTTTGATCT ACCCGTGAGTTATTCCATGAGT
SELE ATGCCTCGCGCTTTCTCTC GTAGTCCCGCTGACAGTATGC
ICAM1 GTGATGCTCAGGTATCCATCCA CACAGTTCTCAAAGCACAGCG
VCAM TAGAGTGCAAGGAGTTCGGG CCGGCATATACGAGTGTGAA
IL-1R1 GTGCTACTGGGGCTCATTTGT GGAGTAAGAGGACACTTGCGAAT
IL-1R2 GTTTCTGCTTTCACCACTCCA GAGTCCAATTTACTCCAGGTCAG
IL1RA TCCCAGATTCTGAAGGCTTG GTGAGACGTTGGAAGGCAGT
NLRP3 ATTACCCGCCCGAGAAAGG TCGCAGCAAAGATCCACACAG
PYCARD GACAGTGCAACTGCGAGAAG CGACTCCAGATAGTAGCTGACAA
CASP1 ACAAGGCACGGGACCTATG TCCCAGTCAGTCCTGGAAATG
[000200] Gene expression analysis by microarrays. Total RNA from Tet2-/- and +/+
macrophages was isolated using an ALLPREP DNA/RNA Mini Kit (Qiagen), and checked for quality prior to submission to the Boston University Medical Campus Microarray Core Facility. The samples were amplified, labeled and hybridized on 6 Mouse Gene 2.0 ST arrays (Affymetrix, Santa Clara, CA) per the manufacturer's instructions. Gene level signal values were normalized together using the Robust Multiarray Average (RMA) algorithm, and annotated to BrainArray Cdf files (26) using affyPLM package (version 1.34.0) included in the Bioconductor software suite (v. 2.12). Differential expression was assessed using the moderated pairwise t test implemented in the limma package (version 3.14.4). Both .eel files and expression values were deposited into MIAME compliant NCBI Gene Expression Omnibus with accession number: GSE81398. Multiple hypothesis testing was performed by calculating the Benjamini-Hochberg false discovery rate and an additional filtered FDR q-value was calculated after removing genes that were expressed below array-wise median value to reduce the probability of producing false positive results. In this study, genes with a fold change >1.5 or <-1.5 fold with a filtered q-value<0.05 were considered as statistically significant differentially expressed genes (DEG). The list of DEG was uploaded to PANTHER Classification System for statistical overrepresentation test using default settings (27). Heap map was generated by using GENE-E software from Broad Institute, found on the worldwide web at
broadinstitute .org/cancer/software/GENE-E/index.html . [000201] Analysis of cytokine secretion. IL-6 and IL-Ιβ were analyzed in macrophage culture supernatants using commercial enzyme-linked immunoabsorbent assays (ELISA) according to manufacturer's instructions (R&D Systems).
[000202] SDS-PAGE and Western Blot. Protein extracts from cultured macrophages were obtained using ice-cold lysis buffer (Cell Signaling Technologies) supplemented with protease and phosphatase inhibitors (Roche Applied Science). Equal amounts of protein lysates were resolved by SDS-PAGE. The following antibodies were used for immunoblotting: rabbit polyclonal anti- IL-Ιβ (GeneTex), mouse monoclonal anti-NLRP3 (Clone Cryo-2, AdipoGen Life Sciences) and rabbit monoclonal anti-p-actin (Cell Signaling Technologies).
[000203] Analysis of histone acetylation. Histone H3 acetylation was evaluated by chromatin immunoprecipitation combined with qRT-PCR (ChlP-qPCR) using the SimpleChlP Plus Enzymatic Chromatin Immunoprecipitation Kit (Cell Signaling Technologies) and anti-acetyl-Histone H3 antibody (EMD Millipore). qRT-PCR was performed on a CFX96 thermal cycler (Bio-Rad) using SsoAdvanced Universal SYBR Green Master Mix (Bio-Rad). ChlP-qPCR data was analyzed using the percent input method. Acetylated H3 percent input was normalized to histone H3 ChIP percent input and presented as the ratio H3Ac:H3. The following primers were used:
TABLE 3: SEQ ID NOs: 58-61
Figure imgf000060_0001
* With respect to the 5' end of the downstream primers. Based on GRCm38.p3 C57BL/6J
[000204] Statistical analysis Data are shown as mean ± SEM unless otherwise stated. Statistical significance of differences in experiments with two groups and only one variable was assessed by unpaired Student's t tests (with Welch correction for unequal variance when appropriate) or Mann- Whitney U Tests. Differences in experiments with more than one independent variable were evaluated by two-way analysis of variance (ANOVA) with post-hoc Sidak's multiple comparison tests. Results of ITT experiments were evaluated by two-way repeated measures ANOVA. All statistical tests were performed using GRAPHPAD PRISM software (GraphPad Software Inc.).
Example 2
An NLEP3 inhibitor showed greater atheroprotective activity in chimeric mice reconstituted with TET2~deficient cells than in nonchimeric mice.
[000205] The data described herein demonstrate a central role of enhanced IL-Ιβ signaling in the increased atherosclerosis associated with expansion of TET2-deficient hematopoietic cells. In support of this idea, when 10% KO-BMT mice were continuously infused with the NLRP3 inhibitor MCC950, the difference in aortic plaque size between these chimeric mice and nonchimeric control mice was eliminated (FIG. 18). These studies revealed that MCC950 exerts greater atheroprotective actions in conditions of clonal hematopoiesis associated with TET2 deficiency, as it decreased atherosclerotic plaque size by -50% in 10% KO-BMT mice, whereas it led to a nonstatistically significant -20% reduction in 10% WT-BMT controls. Overall, these studies demonstrate that NLRP3 -mediated IL-1 β overproduction is essential for the atherogenic consequences of clonal expansion of TET2- deficient cells.
Example 3
Tet2-mediated clonal hematopoiesis accelerates experimental heart failure
[000206] Recent studies have shown that cells of the hematopoietic system undergo clonal expansion due in part to the occurrence of somatic mutations in oncogenes. This condition is common in the elderly, and associated with an increased incidence of coronary heart disease. As shown herein, in part, the epigenetic regulator TET2 is frequently mutated in individuals exhibiting clonal hematopoiesis, and experimental studies have shown that inactivating mutations at this locus can promote atherosclerotic cardiovascular disease. Here, it was investigated whether hematopoietic mutations in Tet2 can contribute to heart failure independent of atherosclerotic disease in two models of murine heart failure.
[000207] Methods and Results Heart failure was induced in C57/B16 mice by pressure overload, achieved by transverse aortic constriction (TAC), or by chronic ischemia, induced by the permanent ligation of the left anterior descending (LAD) artery (FIGS. 19, 20). In both models, Tet2 -deficient hematopoietic cells were used to partially reconstitute the bone marrow of lethally irradiated mice, leading to their clonal expansion. Alternatively, Tet2 was specifically ablated in myeloid cells using Cre recombinase expressed from the LysM promoter. In mice, undergoing LAD ligation, Tet2- deficiency led to worsened cardiac remodeling and function regardless of the means of Tet2 ablation. In mice undergoing TAC, Tet2-deficincy led to greater hypertrophy and systolic dysfunction regardless of the means of Tet2 ablation. In both models, Tet2 deficiency was associated with a failure to resolve inflammation at late time points, and this was associated with increased IL-Ιβ expression. Treatment with the NLRP3 inflammasome inhibitor MCC950 protected against the development of heart failure and eliminated differences in cardiac parameters between Tet2-deficient and wild-type (WT) mice (FIGS. 21, 22).
[000208] Conclusions The deficiency in Tet2 in hematopoietic cells is associated with greater cardiac dysfunction and inflammation in murine models of myocardial ischemia and hypertrophy. These effects were eliminated by inhibiting the NLRP3 inflammasome. These data indicate that individuals with TET2-meidated clonal hematopoiesis are at greater risk of developing heart failure independent of atherosclerotic burden, and that these individuals exhibit a greater benefit from therapies that target the NLRP3 inflammasome. Example 4
Tet2-deficiency accelerates kidney disease
[000209] Background Kidney failure is estimated to afflict 5 to 10% of the world population. Risk factors for kidney disease include hypertension and diabetes. It is increasingly appreciated that there is crosstalk between the heart and kidneys, and that renal function is a strong predictor of outcome in ischemic CVD and heart failure.
[000210] Results Using the angiotensin II-infusion model it was shown that ablation of Tet2 (using Cre recombinase expressed from the LysM promoter) leads to kidney dysfunction, inflammation and fibrosis. Myeloid deficiency of Tet2 led to increased: 1) inflammation (both macrophage infiltration and IL-6 and IL-Ιβ gene expression); 2) vascular and interstitial fibrosis/collagen accumulation, 3) dilated tubules/renal tubular cell hypertrophy; 4) glomerular hypertrophy/Bowman's capsule expansion; and 5) glomerular basement membrane thickening/ glomerulosclerosis (FIGS. 23, 24). Similar results have been obtained in mice subjected to the unilateral ureteral obstruction (UUO) model of kidney failure (FIG. 25).
[000211] Conclusions The deficiency in Tet2 in myeloid hematopoietic cells is associated with greater kidney pathology in two models of murine renal failure. These data indicate that individuals with TET2 -mediated clonal hematopoiesis are at greater risk of kidney failure. Because Tet2- deficiency is associated with elevated IL- Ιβ signaling, therapies that target the NLRP3 inflammasome are useful for individuals with kidney failure.

Claims

1. A method for treating a subject having, or at risk for, a TET2 mutation-mediated IL-Ιβ proinflammatory disease comprising administering a therapeutically effective amount of a pharmaceutical composition comprising an inhibitor of TET2 mutation-mediated IL-Ιβ (interleukin- 1β) proinflammatory activity and a pharmaceutically acceptable carrier to a subject having one or more TET2 somatic mutations in a sub-population of peripheral blood hematopoietic cells.
2. The method of claim 1, wherein the one or more TET2 somatic mutations in the sub- population of peripheral blood hematopoietic cells cause clonal hematopoiesis in the subject.
3. The method of any one of claims 1 or 2, wherein at least 2% of the peripheral blood hematopoietic cells have the one or more TET2 mutations.
4. The method of any one of claims 1-3, wherein the one or more TET2 somatic mutations are selected from an S282F mutation in SEQ ID NO: 3, an N312S mutation in SEQ ID NO: 3, an L346P mutation in SEQ ID NO: 3, an S460F mutation in SEQ ID NO: 3, a D666G mutation in SEQ ID NO: 3, a P941 S mutation in SEQ ID NO: 3, and a C I 135Y mutation in SEQ ID NO: 3.
5. The method of any one of claims 1-4, wherein the inhibitor of TET2 mutation-mediated IL-Ι β proinflammatory activity is an IL-Ιβ inhibitor.
6. The method of claim 5, wherein the IL- Ιβ inhibitor is an IL- Ιβ inhibitor antibody or antigen-binding fragment thereof that binds to IL- Ιβ and reduces IL- Ιβ binding to its receptor(s).
7. The method of claim 6, wherein the IL- Ιβ inhibitor antibody or antigen-binding fragment thereof is selected from ABT981 , an anti -interleukin- 1 β inhibitor antibody by ABZYME, APX002, Canakinumab/Ilaris, CDP48, immunereszumab, LY2189102, MEDI8968, and XOMA052.
8. The method of claim 5, wherein the IL- Ιβ inhibitor is an IL-1 receptor antagonist.
9. The method of claim 8, wherein the IL-1 receptor antagonist is selected from CDP484, CP412245, CYT013 ILlbQb, XL 130, AMG108, HL 2351, ILlHyl, AXXO, orthokine, PRT 1000, anakinra, and rilonacept.
10. The method of claim 5, wherein the IL- Ιβ inhibitor is a small molecule or microRNA inhibitor that inhibits IL-^-mediated pro-inflammatory activity.
1 1. The method of claim 10, wherein the small molecule or microRNA inhibitor is selected from AC201, CP412245, MCC950 or CRID3, inflabion, inflammasome modulator OPSONA, PGE3935199, PGE527667, TRK530, β-hydroxybutyrate (BHB), and microRNA-223.
12. The method of claim 1 1, wherein the small molecule inhibitor is MCC950.
13. The method of any one of claims 1- 12, further comprising monitoring hematopoietic cell clonality, IL-Ιβ proinflammatory activity, or a combination thereof following the administration of the inhibitor of TET2 mutation-mediated IL-Ι β proinflammatory activity.
14. The method of any one of claims 1- 13, further comprising decreasing the number or percentage of hematopoietic cells comprising the one or more TET2 mutations in the subject by performing therapeutic cytapheresis on the subject.
15. The method of any one of claims 1- 14, further comprising administering one or more additional therapeutic agents to the subject, in addition to the inhibitor of TET2 mutation-mediated IL-Ι β (interleukin-ΐβ) proinflammatory activity
16. A method for treating a subject having, or at risk for, a TET2 mutation-mediated IL-Ιβ proinflammatory disease comprising: (a) sequencing a hematopoietic cell sample from a subject to identify one or more somatic mutations in TET2 in the hematopoietic cell sample; and (b) administering a therapeutically effective amount of a pharmaceutical composition comprising an inhibitor of TET2 mutation-mediated IL-Ι β (interleukin-ΐβ) proinflammatory activity and a pharmaceutically acceptable carrier if one or more somatic mutations in TET2 are identified in the hematopoietic cell sample.
17. The method of claim 16, wherein the hematopoietic cell sample is a peripheral blood hematopoietic cell sample.
18. The method of any one of claims 16 or 17, wherein the hematopoietic cell sample is enriched for myeloid-derived cells.
19. The method of any one of claims 16-18, wherein the one or more TET2 somatic mutations identified in the hematopoietic cell sample cause clonal hematopoiesis in the subject.
20. The method of any one of claims 16- 19, wherein at least 2% of the hematopoietic cells are identified as having one or more TET2 mutations.
21. The method of any one of claims 16-20, wherein the one or more TET2 somatic mutations are selected from an S282F mutation in SEQ ID NO: 3, an N312S mutation in SEQ ID NO: 3, an L346P mutation in SEQ ID NO: 3, an S460F mutation in SEQ ID NO: 3, a D666G mutation in SEQ ID NO: 3, a P941S mutation in SEQ ID NO: 3, and a CI 135Y mutation in SEQ ID NO: 3.
22. The method of any one of claims 16-21, wherein the inhibitor of TET2 mutation- mediated IL-Ιβ proinflammatory activity is an IL-Ιβ inhibitor.
23. The method of claim 22, wherein the IL-Ιβ inhibitor is an IL-Ιβ inhibitor antibody or antigen-binding fragment thereof that binds to IL-Ιβ and reduces IL-Ιβ binding to its receptor(s).
24. The method of claim 23, wherein the IL-Ιβ inhibitor antibody or antigen-binding fragment thereof is selected from ABT981 , an anti-interleukin- 1 β inhibitor antibody by ABZYME, APX002, Canakinumab/Ilaris, CDP48, immunereszumab, LY2189102, MEDI8968, and XOMA052.
25. The method of claim 22, wherein the IL-Ιβ inhibitor is an IL-1 receptor antagonist.
26. The method of claim 25, wherein the IL-1 receptor antagonist is selected from CDP484, CP412245, CYT013 ILlbQb, XL 130, AMG108, HL 2351, ILlHyl, AXXO, orthokine, PRT 1000, anakinra, and rilonacept.
27. The method of claim 22, wherein the IL-Ιβ inhibitor is a small molecule or microRNA inhibitor that inhibits IL-^-mediated pro-inflammatory activity.
28. The method of claim 27, wherein the small molecule or microRNA inhibitor is selected from AC201, CP412245, MCC950 or CRID3, inflabion, inflammasome modulator OPSONA, PGE3935199, PGE527667, TRK530, β-hydroxybutyrate (BHB), and microRNA-223.
29. The method of claim 28, wherein the small molecule inhibitor is MCC950.
30. The method of any one of claims 16-29, further comprising monitoring hematopoietic cell clonality, IL-Ιβ proinflammatory activity, or a combination thereof following the administration of the inhibitor of TET2 mutation-mediated IL-Ιβ proinflammatory activity.
31. The method of any one of claims 16-30, further comprising decreasing the number or percentage of hematopoietic cells comprising the one or more TET2 mutations in the subject by performing therapeutic cytapheresis on the subject.
32. The method of any one of claims 16-31, further comprising administering one or more additional therapeutic agents to the subject, in addition to the inhibitor of TET2 mutation-mediated IL-Ιβ proinflammatory activity.
33. The method of any one of claims 1-32, wherein the TET2 mutation-mediated IL-Ιβ proinflammatory disease is a cardiometabolic disease or disorder.
34. The method of any one of claims 1-32, wherein the TET2 mutation-mediated IL-Ιβ proinflammatory disease is a chronic kidney disease or disorder.
35. A pharmaceutical composition comprising an inhibitor of TET2 mutation-mediated IL- 1β (interleukin-ΐβ) proinflammatory activity and a pharmaceutically acceptable carrier for use in a subject having one or more TET2 somatic mutations in a sub-population of hematopoietic cells.
36. The pharmaceutical composition of claim 35, wherein the one or more TET2 somatic mutations in the sub-population of hematopoietic cells cause clonal hematopoiesis in the subject.
37. The pharmaceutical composition of any one of claims 35 or 36, wherein at least 2% of the hematopoietic cells in the subject have the one or more TET2 mutations.
38. The pharmaceutical composition of any one of claims 35-37, wherein the one or more TET2 somatic mutations are selected from an S282F mutation in SEQ ID NO: 3, an N312S mutation in SEQ ID NO: 3, an L346P mutation in SEQ ID NO: 3, an S460F mutation in SEQ ID NO: 3, a D666G mutation in SEQ ID NO: 3, a P941 S mutation in SEQ ID NO: 3, and a C I 135Y mutation in SEQ ID NO: 3.
39. The pharmaceutical composition of any one of claims 35-38, wherein the inhibitor of TET2 mutation-mediated IL-Ι β proinflammatory activity is an IL-Ιβ inhibitor.
40. The pharmaceutical composition of claim 39, wherein the IL- ^inhibitor is an IL-Ιβ inhibitor antibody or antigen-binding fragment thereof that binds to IL-Ιβ and reduces IL-Ιβ binding to its receptor(s).
41. The pharmaceutical composition of claim 40, wherein the IL- Ιβ inhibitor antibody or antigen-binding fragment thereof is selected from ABT981, an anti-interleukin-ΐβ inhibitor antibody by ABZYME, APX002, Canakinumab/Ilaris, CDP48, immunereszumab, LY2189102, MEDI8968, and XOMA052.
42. The pharmaceutical composition of claim 39, wherein the IL-Ι β inhibitor is an IL-1 receptor antagonist.
43. The pharmaceutical composition of claim 42, wherein the IL-1 receptor antagonist is selected from CDP484, CP412245, CYT013 ILlbQb, XL 130, AMG108, HL 2351, ILlHyl, AXXO, orthokine, PRT 1000, anakinra, and rilonacept.
44. The pharmaceutical composition of claim 39, wherein the IL-Ι β inhibitor is a small molecule inhibitor that inhibits IL-i -mediated pro-inflammatory activity.
45. The pharmaceutical composition of claim 44, wherein the small molecule or microR A inhibitor is selected from AC201, CP412245, MCC950 or CRID3, inflabion, inflammasome modulator OPSONA, PGE3935199, PGE527667, TRK530, β-hydroxybutyrate (BHB), and microRNA-223.
46. The pharmaceutical composition of claim 45, wherein the small molecule inhibitor is MCC950.
47. The pharmaceutical composition of any one of claims 35-46, wherein the TET2 mutation-mediated IL-Ιβ proinflammatory disease is a cardiometabolic disease or disorder.
48. The pharmaceutical composition of any one of claims 35-46, wherein the TET2 mutation-mediated IL-Ιβ proinflammatory disease is a chronic kidney disease or disorder.
PCT/US2017/044350 2016-07-29 2017-07-28 Age-associated clonal hematopoiesis accelerates cardio-metabolic disease development Ceased WO2018022982A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201662368338P 2016-07-29 2016-07-29
US62/368,338 2016-07-29

Publications (1)

Publication Number Publication Date
WO2018022982A1 true WO2018022982A1 (en) 2018-02-01

Family

ID=61012394

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/044350 Ceased WO2018022982A1 (en) 2016-07-29 2017-07-28 Age-associated clonal hematopoiesis accelerates cardio-metabolic disease development

Country Status (2)

Country Link
US (1) US10041044B2 (en)
WO (1) WO2018022982A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109432078A (en) * 2018-12-04 2019-03-08 南华大学 Application in cognitive disorder drug caused by MCC950 or derivatives thereof is radiated in preparation prevention or treatment
CN110025610A (en) * 2019-05-09 2019-07-19 中国科学院昆明动物研究所 The purposes of MCC950

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3458466B1 (en) 2016-05-20 2024-08-07 Cedars-Sinai Medical Center Diagnosis of inflammatory bowel disease based on genes
GB201815045D0 (en) * 2018-09-14 2018-10-31 Univ Ulster Bispecific antibody targeting IL-1R1 and NLPR3
US20220356240A1 (en) * 2019-09-26 2022-11-10 Beth Israel Deaconess Medical Center, Inc. Anti-inflammatory therapy in arrhythmogenic cardiomyopathy (acm)
AU2021258334A1 (en) 2020-04-24 2022-11-24 LifeVault Bio, Inc. Methods of predicting susceptibility to infectious disease and related methods of treatment
JP7839260B2 (en) * 2021-07-13 2026-04-01 セロダス エーピーエス IL1RA-derived peptide for the treatment of diabetic nephropathy
US20260015427A1 (en) 2024-06-25 2026-01-15 Kiniksa Pharmaceuticals, Gmbh Formulations of anti-interleukin 1 receptor 1 antibodies

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016090077A1 (en) * 2014-12-03 2016-06-09 Celgene Corporation Activin-actrii antagonists and uses for treating anemia
WO2016110818A2 (en) * 2015-01-08 2016-07-14 Linnane Pharma Ab Novel therapy
WO2016179035A1 (en) * 2015-05-01 2016-11-10 H. Lee Moffitt Cancer Center And Research Institute, Inc. Inflammasome activation in myelodysplastic syndromes
WO2017049166A1 (en) * 2015-09-17 2017-03-23 Novartis Ag Car t cell therapies with enhanced efficacy

Family Cites Families (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS6291197A (en) 1985-10-17 1987-04-25 Dainippon Pharmaceut Co Ltd Anti-human interleukin 1 antibody, its production and use thereof
US4935343A (en) 1986-08-08 1990-06-19 Syntex (U.S.A.) Inc. Monoclonal antibodies for interleukin-1β
US5319071A (en) 1987-11-25 1994-06-07 Immunex Corporation Soluble interleukin-1 receptors
US4968607A (en) 1987-11-25 1990-11-06 Immunex Corporation Interleukin-1 receptors
WO1989004838A1 (en) 1987-11-25 1989-06-01 Immunex Corporation Interleukin-1 receptors
US5075222A (en) 1988-05-27 1991-12-24 Synergen, Inc. Interleukin-1 inhibitors
EP0364778B1 (en) 1988-10-01 1996-03-13 Otsuka Pharmaceutical Co., Ltd. Antibody against interleukin-1beta
FR2640146B1 (en) 1988-12-08 1993-12-24 Commissariat A Energie Atomique ANTI-INTERLEUKIN MONOCLONAL ANTIBODIES 1 (ALPHA) AND 1 (BETA), THEIR PRODUCTION METHOD AND APPLICATIONS OF SAID ANTIBODIES TO DETECTION OF INTERLEUKINS 1 (ALPHA) AND 1 (BETA) AND THERAPEUTICS
EP0502956B1 (en) 1989-11-29 1997-04-23 Amgen Boulder Inc. Production of recombinant human interleukin-1 inhibitor
WO1991017184A1 (en) 1990-04-27 1991-11-14 The Upjohn Company Modified interleukin-1 inhibitors
US5350683A (en) 1990-06-05 1994-09-27 Immunex Corporation DNA encoding type II interleukin-1 receptors
US5858355A (en) 1990-12-20 1999-01-12 University Of Pittsburgh Of The Commonwealth System Of Higher Education IRAP gene as treatment for arthritis
ATE240740T1 (en) 1991-03-15 2003-06-15 Amgen Inc PEGYLATION OF POLYPEPTIDES
ATE188610T1 (en) 1992-04-30 2000-01-15 Amgen Inc METHODS OF TREATING INTERLEUKIN-1 AND TUMOR-NECROSIS FACTOR-CAUSED DISEASES
DE4219626A1 (en) 1992-06-16 1993-12-23 Wehling Peter Priv Doz Dr Med Incorporating therapeutic gene via vector into body cells - in=vivo or in vitro, for subsequent expression and secretion of active protein, partic. for treating degenerative diseases of spine and nerves
JPH0630788A (en) 1992-07-16 1994-02-08 Otsuka Pharmaceut Co Ltd Recombinant antibody for human interleukin-1
ATE257389T1 (en) 1992-09-17 2004-01-15 Amgen Inc PHARMACEUTICAL COMPOSITIONS CONTAINING INTERLEUKIN-1 INHIBITORS
CA2157782A1 (en) 1993-03-08 1994-09-15 Joseph C. Glorioso Gene transfer for treating a connective tissue of a mammalian host
EP0689449B1 (en) 1993-03-19 2002-10-30 Vacsyn S.A. Therapeutical compositions for use in humans, characterised by a combination of a muramyl peptide and a cytokine
US6326353B1 (en) 1993-03-23 2001-12-04 Sequus Pharmaceuticals, Inc. Enhanced circulation effector composition and method
FR2706772A1 (en) 1993-06-22 1994-12-30 Vacsyn Sa Prevention and treatment of septic syndrome with an immunosuppressant, in particular cyclosporin.
WO1995001997A1 (en) 1993-07-09 1995-01-19 Smithkline Beecham Corporation RECOMBINANT AND HUMANIZED IL-1β ANTIBODIES FOR TREATMENT OF IL-1 MEDIATED INFLAMMATORY DISORDERS IN MAN
PE64396A1 (en) 1995-01-23 1997-01-28 Hoffmann La Roche INTERLEUKIN 1 RECEIVER ACCESSORY PROTEIN
SK288144B6 (en) 1996-02-09 2013-12-02 Amgen, Inc. Pharmaceutical composition and its use for treating inflammatory diseases
EP3224381B1 (en) 2014-11-25 2019-09-04 The Brigham and Women's Hospital, Inc. Method of identifying a person having a predisposition to or afflicted with a cardiometabolic disease

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016090077A1 (en) * 2014-12-03 2016-06-09 Celgene Corporation Activin-actrii antagonists and uses for treating anemia
WO2016110818A2 (en) * 2015-01-08 2016-07-14 Linnane Pharma Ab Novel therapy
WO2016179035A1 (en) * 2015-05-01 2016-11-10 H. Lee Moffitt Cancer Center And Research Institute, Inc. Inflammasome activation in myelodysplastic syndromes
WO2017049166A1 (en) * 2015-09-17 2017-03-23 Novartis Ag Car t cell therapies with enhanced efficacy

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DELHOMMEAU, F ET AL.: "Mutation in TET2 in Myeloid Cancers", THE NEW ENGLAND JOURNAL OF MEDICINE, vol. 360, no. 22, 28 May 2009 (2009-05-28), pages 2289 - 2301, XP055459127 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109432078A (en) * 2018-12-04 2019-03-08 南华大学 Application in cognitive disorder drug caused by MCC950 or derivatives thereof is radiated in preparation prevention or treatment
CN110025610A (en) * 2019-05-09 2019-07-19 中国科学院昆明动物研究所 The purposes of MCC950

Also Published As

Publication number Publication date
US10041044B2 (en) 2018-08-07
US20180030412A1 (en) 2018-02-01

Similar Documents

Publication Publication Date Title
US10041044B2 (en) Age-associated clonal hematopoiesis accelerates cardio-metabolic disease development
US11318163B2 (en) Combination immune therapy and cytokine control therapy for cancer treatment
US20200009191A1 (en) Combination immune therapy and cytokine control therapy for cancer treatment
US12274714B2 (en) Early apoptotic cells for use treating sepsis
AU2017219415B2 (en) Combination immune therapy and cytokine control therapy for cancer treatment
US20260009081A1 (en) Clonal hematopoiesis and cytokine targets
US20200061116A1 (en) Combination immune therapy and cytokine control therapy for cancer treatment
CN107530376A (en) Combined immunization therapy and cell factor control therapy for treatment of cancer
JP2011526244A (en) How to treat inflammation
JP2014522844A (en) Composition, method and kit for treating leukemia
US20200323905A1 (en) Methods and compositions for modulating the immune system
KR20200029544A (en) Immunomodulatory retinoid and rexinoid compounds combined with immunomodulators for cancer immunotherapy
JP2021523103A (en) Matrix-bound vesicles (MBVS) containing IL-33 and their use
Zhang et al. Persistence of cirrhosis is maintained by intrahepatic regulatory T cells that inhibit fibrosis resolution by regulating the balance of tissue inhibitors of metalloproteinases and matrix metalloproteinases
US20240262909A1 (en) Tim-3 modulates anti-tumor immunity by regulating inflammasome activation
CA3158110A1 (en) Renal cell carcinoma (rcc) therapy using genetically engineered t cells targeting cd70
CA3195019A1 (en) Treatment of nsclc patients with tumor infiltrating lymphocyte therapies
AU2017332161A1 (en) Chimeric antigen receptor (car) that targets chemokine receptor CCR4 and its use
WO2019071029A1 (en) Prevention and treatment of gvhd and autoimmune diseases
AU2020350221A1 (en) Combination cancer therapy and cytokine control therapy for cancer treatment
US20250297310A1 (en) Hematopoietic loss of y chromosome leads to cardiac fibrosis and dysfunction and is associated with death due to heart failure
EP4061849A1 (en) Bispecific antibodies against chi3l1 and ctla4 with enhanced cytotoxic effects on tumor cells
Dou et al. Reconstituted CD74+ NK cells trigger chronic graft versus host disease after allogeneic bone marrow transplantation
Wright Exploring the Role of Endothelial Cells in the Development of Diastolic Dysfunction Associated with Inflammatory Arthritis
US20220135981A1 (en) Targeting senescent cells

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17835333

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17835333

Country of ref document: EP

Kind code of ref document: A1