WO2018020323A2 - Materials and methods for treatment of fatty acid disorders - Google Patents

Materials and methods for treatment of fatty acid disorders Download PDF

Info

Publication number
WO2018020323A2
WO2018020323A2 PCT/IB2017/001089 IB2017001089W WO2018020323A2 WO 2018020323 A2 WO2018020323 A2 WO 2018020323A2 IB 2017001089 W IB2017001089 W IB 2017001089W WO 2018020323 A2 WO2018020323 A2 WO 2018020323A2
Authority
WO
WIPO (PCT)
Prior art keywords
gene
method
cell
dna
acadvl
Prior art date
Application number
PCT/IB2017/001089
Other languages
French (fr)
Other versions
WO2018020323A3 (en
Inventor
Jeffrey William STEBBINS
Roman Lvovitch BOGORAD
Francine Marie GREGOIRE
Chad Albert COWAN
Ante Sven LUNDBERG
Hari Padmanabhan
Original Assignee
Crispr Therapeutics Ag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US201662366450P priority Critical
Priority to US201662366459P priority
Priority to US62/366,459 priority
Priority to US62/366,450 priority
Priority to US62/379,036 priority
Priority to US201662379036P priority
Application filed by Crispr Therapeutics Ag filed Critical Crispr Therapeutics Ag
Publication of WO2018020323A2 publication Critical patent/WO2018020323A2/en
Publication of WO2018020323A3 publication Critical patent/WO2018020323A3/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102Mutagenizing nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • C12N15/902Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/344Position-specific modifications, e.g. on every purine, at the 3'-end
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications

Abstract

The present application provides materials and methods for treating a patient with a fatty acid disorder such as medium chain acyl-coenzyme A dehydrogenase deficiency (MCADD), long-chain 3-hydroxyl-coenzyme A dehydrogenase deficiency (LCHADD), and/or very long-chain acyl-coenzyme A dehydrogenase deficiency (VLCADD) both ex vivo and in vivo. In addition, the present application provides materials and methods for genome editing to modulate the expression, function, or activity of a gene in a cell selected from the ACADM gene, the HADHA gene, and the ACADVL gene.

Description

MATERIALS AND METHODS FOR TREATMENT OF FATTY ACID DISORDERS

Related Applications

[0001 ] This application claims the benefit of U.S. Provisional Application No. 62/366,450, filed July 25, 2016; U.S. Provisional Application No. 62/366,459, filed July 25, 2016; and U.S. Provisional Application No. 62/379,036, filed August 24, 2016, the contents of each which is incorporated herein by reference in their entireties.

Field

[0002] The present application provides materials and methods for treating a patient with a fatty acid disorder such as medium chain acyl-coenzyme A

dehydrogenase deficiency (MCADD), long-chain 3-hydroxyl-coenzyme A

dehydrogenase deficiency (LCHADD), and/or very long-chain acyl-coenzyme A dehydrogenase deficiency (VLCADD) both ex vivo and in vivo. In addition, the present application provides materials and methods for genome editing to modulate the expression, function, or activity of a gene in a cell selected from the acyl- coenzyme A dehydrogenase for medium chain fatty acids (ACADM) gene, the long- chain 3-hydroxyl-coenzyme A dehydrogenase for long chain fatty acids (HADHA) gene, and the acyl-coenzyme A dehydrogenase for very long-chain fatty acids (ACADVL) gene.

Incorporation by Reference of Sequence Listing

[0003] The contents of the ASCII text file named "CRIS020001 WO_ST25", which was created on July 20, 2017and is 14,026,697 bytes in size, are hereby

incorporated by reference in their entirety and forms part of the disclosure.

Background

[0004] Medium-chain acyl-coenzyme A dehydrogenase (MCAD) deficiency (MCADD) is the most common fatty-acid oxidation disorder (FAOD) (Baruteau et a., J. Inherit. Metab. Dis., 36:795-803, 2013). In detail, MCAD is a key metabolic enzyme localized in the mitochondria and MCADD patients are unable beta-oxidize medium-chain (6-10 carbons) fatty-acids of dietary and metabolic origin into Acetyl- CoA used to generate ATP via the citric-acid cycle. In addition, reduced hepatic fatty-acid beta-oxidation lowers circulating levels of the fatty-acid beta-oxidation ketone byproducts acetoacetate and beta-hydroxybutyrate that are essential metabolites generating ATP via the citric-acid cycle in extra-hepatic tissues, such as cardiac-muscle, skeletal-muscle, and CNS. Of note, during times of fasting, illness and/or over-exertion MCADD patients may present with symptoms that include hypoketotic-hypoglycemia, hyper-ammonemia, transaminitis, as well as generalized hepatic-dysfunction (lafolla et al., J. Pediatr., 125:409-415, 1994;

Schatz et al., J. Inherit Metab. Dis., 33:513-520, 2010) Left untreated, symptomatic MCADD patients are at a risk of "sudden death" due to rapid metabolic- decompensation (Stanley et al., Metabolic Diseases, Chapter 13, pages 175-190). In detail, during periods fasting, illness and/or over-exertion MCADD patients compensate for ATP "underproduction" by mobilizing cellular glycogen-stores, which are used to generate pyruvate and ATP through glycolysis and the citric-acid cycle, respectively. Under these conditions, cellular glycogen-stores throughout the body of MCADD patients are rapidly depleted in order to maintain normal ATP homeostasis. This whole-body cellular glycogen depletion and the inability to replete glycogen from fatty-acid stores via beta-oxidation and glycogenesis results in hypoketotic-hypoglycemia followed by metabolic-decompensation leading to encephalopathy, seizures, hepatic-coma, and acute cardiorespiratory arrest (Bastin et al., Biochimie, 96: 1 13-120, 2014). In undiagnosed, clinically affected MCADD patients the risk of "sudden death" is 20-40% in the first 5 years of life (Wajner et al., Bioscience Reports, 36.1 :e00281 , 2016; Wilcken, J. Inherit. Metabol. Dis., 33:501 -506, 2010) Further, if MCADD patients have repeated non-fatal metabolic- decompensations without prompt treatment there are often sequelae, such as intellectual disability, developmental-delay, severe behavioral problems, hypotonia, and spasticity (lafolla, supra; Derks et al. , J. Pediatr., 148:665-670, 2006)

[0005] MCADD is an autosomal recessive disorder caused by a missense or deletion mutation within the ACADM gene that encodes for the MCAD and the worldwide birth MCADD prevalence is 1 in 14,600. The most common MCADD mutation occurring in 80% of patients is the substitution of guanine for adenine at coding position 985 (A985G, OMIM number 607008.001 ), which results in the substitution of a glutamate for a lysine at position 304 in the mature protein (K304E; corresponding to K329E in the full length pre-processed protein). (Grosse SD, et al. The epidemiology of medium chain acyl-CoA dehydrogenase deficiency: an update. Genetics in Medicine 2006; 8(4):205-212; Andresen BS, et al. Medium- chain acyl-CoA dehydrogenase (MCAD) mutations identified by MS/MS-based prospective screening of newborns differ from those observed in patients with clinical symptoms: identification and characterization of a new, prevalent mutation that results in mild MCAD deficiency." The American Journal of Human Genetics 2001 ; 68(6): 1408-1418; Matern D, Rinaldo P. Medium-Chain Acyl-Coenzyme A Dehydrogenase Deficiency. 2000 Apr 20 [Updated 2015 Mar 5]. In: Pagon RA, Adam MP, Ardinger HH, et al., editors. GeneReviews® [Internet]. Seattle (WA): University of Washington, Seattle; 1993-2016. available on the web at:

ncbi.nlm.nih.gov/books/NBK1424/; Maier EM, et al. Population spectrum of ACADM genotypes correlated to biochemical phenotypes in newborn screening for medium- chain acyl-CoA dehydrogenase deficiency. Human mutation 2005; 25(5): 443-452; Andresen BS, et al. The molecular basis of medium-chain acyl-CoA dehydrogenase (MCAD) deficiency in compound heterozygous patients: is there correlation between genotype and phenotype?. Human molecular genetics 1997; 6(5):695- 707; Catarzi, Serena, et al. "Medium-chain acyl-CoA deficiency: outlines from newborn screening, in silico predictions, and molecular studies." The Scientific World Journal 2013 (2013); Leal, J. , et al. "Regional differences in the frequency of the c. 985A> G ACADM mutation: findings from a meta-regression of genotyping and screening studies." Clinical genetics 85.3 (2014): 253-259; Maier EM, et al. Protein misfolding is the molecular mechanism underlying MCADD identified in newborn screening. Human molecular genetics 2009; 18(9): 1612-1623; Zschocke J, et al. Molecular and functional characterization of mild MCAD deficiency. Human genetics 2001 ; 108(5):404-408; Gregersen N, et al. Medium-chain acyl-CoA dehydrogenase (MCAD) deficiency: the prevalent mutation G985 (K304E) is subject to a strong founder effect from northwestern Europe. Human heredity 1993; 43(6):342-350; Yokota 11 , et al. Molecular survey of a prevalent mutation, 985A-to- G transition, and identification of five infrequent mutations in the medium-chain Acyl-CoA dehydrogenase (MCAD) gene in 55 patients with MCAD deficiency. American journal of human genetics 1991 ; 49(6): 1280; Gregersen N, et al. Genetic defects in fatty acid β-oxidation and acyl-CoA dehydrogenases. European Journal of Biochemistry 2004; 271 (3): 470-482; Rinaldo P, et al. . Medium-chain acyl-CoA dehydrogenase deficiency. Diagnosis by stable-isotope dilution measurement of urinary n-hexanoylglycine and 3-phenylpropionylglycine. N Engl J Med. 1988 Nov 17;319(20): 1308-13. Erratum in: N Engl J Med 1989 May 4;320(18): 1227) All US states use tandem mass spectrometry of dried blood spots to identify elevated hexanoyl-carnitine (C-6), octanoyl-carnitine (C-8), decanoyl-carnitine (C-10) findings that are highly sensitive and specific for MCADD (Bastin, supra, Rinaldo et al., N. Engl. J. Med., 319: 1308-1313, 1988). A positive signal in this newborn screen is usually followed serum acyl-carnitine profiling, urinary organic acids profiling for medium chain (C-6, C-8, & C-10) dicarboxylic aciduria, genetic testing, and patient fibroblast MCAD enzymatic activity assessment (Gartner et al., Neurol., 85:e37-40, 2015).

[0006] Behavioral and dietary modifications are the current standard of care for MCADD patients. The major strategy to prevent exacerbations in MCADD patients is the avoidance of prolonged fasting through frequent small meals that do not contain medium chain fatty acids as the primary energy source as well as the prevention of hypoglycemia during times of fasting, illness and/or over-exertion. The recommended maximum fasting times vary by age, with no more than 8 hours of fasting for ages 6-12 months, no more than 10 hours between age 1 and 2 years, and no more than 12 hours after age 2 years (Derks et al., J. Pediatr., 148:665-670, 2006). Children can receive complex carbohydrate supplementation (e.g. cornstarch, 2 g/kg).

[0007] Currently, there is one ongoing clinical trial Phase I trial exploring the clinical utility of glycerol phenylbutyrate for the treatment of MCADD adults (Clinical Trial NCT01881984). Glycerol phenyl-butyrate is a molecular chaperone for the common K304E variant of MCAD (International Publication No. WO 2013/158616).

[0008] Long-chain 3-hydroxyl-CoA dehydrogenase (LCHAD) deficiency affects the mitochondrial fatty acid beta-oxidation (FAO) pathway, which is the predominant ATP-generating pathway during times of increased energy

expenditure (e.g. fasting, fasting, illness and/or over-exertion) in multiple tissues (e.g. skeletal-muscle, cardiac-muscle, and liver) (Polinati PP, et al. Patient-Specific Induced Pluripotent Stem Cell-Derived RPE Cells: Understanding the Pathogenesis of Retinopathy in Long-Chain 3-Hydroxyacyl-CoA Dehydrogenase Deficiency. Invest Ophthalmol Vis Sci. 2015; 56(5):3371 -82). Importantly, symptomatic

LCHADD patients are at a risk of sudden death due to rapid metabolic- decompensation (Rinaldo P, et al. Fatty acid oxidation disorders. Annu. Rev.

Physiol. 2002; 64:477-502). In detail, during periods of fasting, illness and/or overexertion LCHADD patients compensate for ATP underproduction by mobilizing cellular glycogen-stores, which are used to generate pyruvate and ATP through glycolysis and the citric-acid cycle, respectively. Under these conditions, cellular glycogen-stores throughout the body of LCHADD patients are rapidly depleted in order to maintain normal ATP homeostasis. This whole-body cellular glycogen depletion and the inability to replete glycogen from fatty-acid stores via beta- oxidation and glycogenesis results in hypoketotic-hypoglycemia followed by metabolic-decompensation leading to encephalopathy, seizures, hepatic-coma, and acute cardiorespiratory arrest.

[0009] Of all FAO disorders (FAODs), LCHADD is associated with the greatest number of complications (Fletcher AL, et al. Observations regarding retinopathy in mitochondrial trifunctional protein deficiencies. Mol Genet Metab. 2012; 106(1 ): 18- 24). For example, LCHADD patients can present with severe liver pathology;

including acute liver failure in newborns and chronic liver failure in infancy, sometimes progressing to cirrhosis. Of note, up to 50% LCHADD patients suffer from irreversible retinopathy, and approximately 5-10% LCHADD patients suffer from irreversible peripheral-neuropathy (Spiekerkoetter U. Mitochondrial fatty acid oxidation disorders: clinical presentation of long-chain fatty acid oxidation defects before and after newborn screening. J Inherit Metab Dis. 2010; 33:527-532). The molecular pathology of retinopathy and peripheral-neuropathy seen in LCHADD patients is thought to be the accumulation of 3-hydroxyacylcarnitines (3-OHACs) in the retina and the PNS, respectively. In detail, when long-chain fatty acids are oxidized in LCHADD patients, the hydratase creates a 3-hydroxyl fatty acid (3- OHFA) but further oxidation by the dehydrogenase is impeded resulting in the accumulation of 3-OHFAs. Esterifi cation of these 3-OHFAs to carnitine leads to build up of 3-hydroxyacylcarnitine (3-OHACs) (Gillingham MB, et al. Optimal dietary therapy of long-chain 3-hydroxyacyl-CoA dehydrogenase deficiency. Mol. Genet. Metab. 2003; 79: 1 14-123). Significantly increased levels of 3-OHACs are seen in the plasma of LCHADD patients as compared to the levels of all other FAODs (Halldin MU, et al. Increased lipolysis in LCHAD deficiency. J. Inherit. Metab. Dis. 2007; 30:39-46. [PubMed: 17160563]; Sander J, et al. Neonatal screening for defects of the mitochondrial trifunctional protein. Mol. Genet. Metab. 2005; 85: 108- 1 14). 3-OHACs increase with metabolic crisis, prolonged fasting or prolonged exercise when the body attempts to utilize fatty acids for energy (Gillingham M, et al. Effect of feeding, exercise, and genotype on plasma 2 hydroxyacylcarnitines in children with LCHAD deficiency (LCHADD). Top. Clin. Nutr. 2009; 24:353-359). When patients with LCHADD eat regular meals, and consume a low-fat diet these levels fall and the progression of the retinopathy is slowed (Gillingham MB, et al. Effect of optimal dietary therapy upon visual function in children with longchain 3- hydroxyacyl CoA dehydrogenase and trifunctional protein deficiency. Mol. Genet. Metab. 2005; 86: 124-133). In addition, early diagnosis, treatment, and decreasing the number of metabolic crises are associated with slower progression of retinopathy (Fahnehjelm KT, et al. Ocular characteristics in 10 children with long- chain 3-hydroxyacyl-CoA dehydrogenase deficiency: a cross-sectional study with long-term follow-up. Acta Ophthalmol. 2008; 86:329-337). The precise

mechanisms of 3-OHACs retinal toxicity has not been elucidated, but there is a strong correlation between increased 3-OHAC plasma levels and reduced photo- transduction, as measured by electro-retinogram in a prospective study of LCHADD patients followed over 5 years. This study concluded that lowering 3-OHAC slows the progression of retinopathy (Gillingham et al., Mol. Genet. Metab. 2005).

[0010] LCHADD is an autosomal recessive disorder and LCHAD enzymatic reaction is catalyzed by the alpha-subunit of the Tri Functional Protein (TFP) and is essential for TFP function. In detail, the TFP is a protein complex bound to the inner mitochondrial membrane and catalyzes 3 distinct steps in the fatty-acid beta- oxidation. TFP hetero-octamer made up of four alpha-subunits and four beta- subunits and contains three distinct functional domains. The four alpha subunits contain the enoyl-CoA hydratase (ECH) and LCHAD activities while the four beta subunits contain the betaketothiolase activity. The alpha and beta-subunits are encoded by the HADHA (OMI M # 600890) and HADHB (OMIM # 143450) genes, respectively (Ushikubo S, et al. Molecular characterization of mitochondrial trifunctional protein deficiency: formation of the enzyme complex is important for stabilization of both alpha- and beta-subunits. Am. J. Hum. Genet. 1996; 58:979- 988). Mutations in HADHA and HADHB have varying effects on protein folding, oligomerization, and the enzymatic activities of TFP (Spiekerkoetter U, et al.

General mitochondrial trifunctional protein (TFP) deficiency as a result of either alpha- or beta-subunit mutations exhibits similar phenotypes because mutations in either subunit alter TFP complex expression and subunit turnover. Pediatr. Res. 2004; 55: 190-196). Among LCHADD patients, approximately 80% of the mutations are the common (G1528C) single nucleotide substitution in the HADHA gene that causes isolated TFP deficiency (Ij 1st L, et al. Molecular basis of long-chain 3- hydroxyacyl-CoA dehydrogenase deficiency (LCHADD): identification of the major disease-causing mutation in the alpha-subunit of the mitochondrial trifunctional protein. Biochim. Biophys. Acta. 1994; 1215:347-350; Ijlst L, et al. Common missense mutation G1528C in long-chain 3-hydroxyacyl-CoA dehydrogenase deficiency. Characterization and expression of the mutant protein, mutation analysis on genomic DNA and chromosomal localization of the mitochondrial trifunctional protein alpha subunit gene. J. Clin. Invest. 1996; 98: 1028-1033). This mutation leads to a glutamine substituted for a glutamate at position 474 (E474Q) in the alpha-subunit of TFP, which decreases only the dehydrogenase activity of the protein complex, leaving hydratase and thiolase activities relatively intact (Rinaldo et al., Annu. Rev. Physiol. 2002) (E474Q refer to the amino acid position in the mature protein and corresponds to position 510 in the full length pre-processed protein). Due to newborn screening, mutations in HADHA and HADHB genes are being discovered at a rapid pace. In detail, according to the Human Gene Mutation Database, in February 201 1 there were thirty-two discovered mutations in HADHA and twenty-nine in HADHB. As of December 201 1 , the same database lists fifty- eight mutations in HADHA and forty-three in HADHB. These mutations include missense and nonsense mutations, splice site variations that can result in exon skipping during mRNA splicing, and small insertions and/or deletions that result in misfolded, incomplete or truncated protein (world wide web at: hgmd.org). Function of the enzyme complex requires folding and oligomerization of subunits to occur correctly, as shown by pulse-chase experiments in cultured fibroblasts (Orii KE, et al. Formation of the enzyme complex in mitochondria is required for function of trifunctional beta-oxidation protein. Biochem. Biophys. Res. Commun. 1996;

219:773-777). Various mutations in both the alpha- and beta-subunits have been reported to destabilize the protein complex, leading to a decrease in all three enzyme activities and lower total protein levels in patient cells carrying these mutations. The common mutation does not have this effect; levels of mutant protein in cells homozygous for the common mutation are comparable to levels in control cells (Spiekerkoetter et al. Pediatr. Res. 2004). The common mutation in LCHAD, G1528C in the HADHA gene, is very prevalent in patients of European descent, but is relatively absent in Asian populations (Tyni T, et al. Ophthalmic pathology in long-chain 3-hydroxyacyl-CoA dehydrogenase deficiency caused by the G1528C mutation. Curr. Eye Res. 1998; 17:551-559; Wang R, et al. Screening for G1528C mutation in mitochondrial trifunctional protein gene in pregnant women with severe preeclampsia and new born infant. Zhonghua Fu Chan Ke Za Zhi. 2006; 41 :672- 675; Fukushima K, et al. Lack of common mutation in the alfa-subunit of the mitochondrial trifunctional protein and the polymorphism of CYP2E1 in three Japanese women with acute fatty liver of pregnancy/HELLP syndrome. Hepatol. Res. 2004; 30:226-231 ; Tyni T, et al. Long-chain 3-hydroxyacyl-coenzyme A dehydrogenase deficiency (LCHADD) with the G1528C mutation: clinical presentation of thirteen patients. J. Pediatr. 1997; 130:67-76). Mutation analysis in patients in China, Japan and Korea reveals zero patients carrying this mutation (Purevsuren J, et al. Clinical and molecular aspects of Japanese patients with mitochondrial trifunctional protein deficiency. Mol. Genet. Metab. 2009; 98:372- 377; Wang et al. Zhonghua Fu Chan Ke Za Zhi. 2006; Orii KE, et al. Genomic and mutational analysis of the mitochondrial trifunctional protein betasubunit (HADHB) gene in patients with trifunctional protein deficiency (TFPD). Hum. Mol. Genet. 1997; 6: 1215-1224; Purevsuren J, et al. Study of deep intronic sequence exonization in a Japanese neonate with a mitochondrial trifunctional protein deficiency. Mol. Genet. Metab. 2008; 95:46-51 ; Yamazaki H, et al. Mitochondrial trifunctional protein deficiency in a lethal neonate. Pediatr. Int. 2004; 46:178-180; Park HD, et al. Two novel HADHB gene mutations in a Korean patient with mitochondrial trifunctional protein deficiency. Ann. Clin. Lab. Sci. 2009; 39:399- 404; Tamaoki Y, et al. A survey of Japanese patients with mitochondrial fatty acid beta-oxidation and related disorders as detected from 1985 to 2000. Brain Dev. 2002; 24:675-680; Choi JH, et al. Identification of novel mutations of the HADHA and HADHB genes in patients with mitochondrial TFPD. Int. J. Mol. Med. 2007; 19:81-87). In contrast, European countries report allele frequencies from as low as 1 :680 in the Netherlands to a high of 1 :79 in one region of Poland (den Boer ME, et al. Heterozygosity for the common LCHADD mutation (1528g>C) is not a major cause of HELLP syndrome and the prevalence of the mutation in the Dutch population is low. Pediatr. Res. 2000; 48: 151-154; Piekutowska-Abramczuk D, et al. A comprehensive HADHA c.1528G>C frequency study reveals high prevalence of long-chain 3-hydroxyacyl-CoA dehydrogenase deficiency in Poland. J. Inherit. Metab. Dis. 2010). Out of approximately 1 .2 million children screened, five cases of TFPD have been diagnosed since beginning expanded newborn screening by the Northwest Regional Newborn Screening program that screens all children born in the states of Oregon, Idaho, Nevada, Alaska, and Hawaii. Based on these numbers, the minimal disease frequency for TFPD and LCHADD combined in this screening area is approximately 1 in 200,000.

[0011 ] Retinopathy has been reported in 30% to >50% of LCHADD/TFPD cases in Europe and the U.S. (Spiekerkoetter U. J Inherit Metab Dis. 2010; Purevsuren J, et al. Mol. Genet. Metab. 2009; Spiekerkoetter U, et al. Peripheral neuropathy, episodic myoglobinuria, and respiratory failure in deficiency of the mitochondrial trifunctional protein. Muscle Nerve. 2004; 29:66-72). This observation suggests that the common mutation is more clearly associated with the development of retinal pathology in LCHADD/TFPD. Further, patients with at least one G1528C allele typically have high 3-OHAC levels during metabolic crisis, after prolonged fasting or exercise, and when they consume a diet with excess long-chain fat (Gillingham MB, et al. Mol. Genet. Metab. 2003; Gillingham M, et al. Top. Clin. Nutr. 2009). These patients also more commonly develop retinopathy progressing to functional vision loss. In contrast, patients with other mutations trend toward lower 3-OHACs levels and do not as often progress to vision loss although some retinal pathology is often still evident (Fletcher et al. Mol Genet Metab. 2012).

[0012] Currently, clinical and dietary management of LCHADD/TFPD are based upon avoidance of fasting and medium-chain triglyceride (MCT) supplementation to prevent hypoglycemia and acute metabolic-decompensation (Saudubray JM, et al. Recognition and management of fatty acid oxidation defects: a series of 107 patients. J. Inherit. Metab. Dis 1999; 22:488-502). Reduction in dietary long-chain fatty acid intake along with MCT supplementation likely suppress long-chain fatty acid beta-oxidation and prevent the accumulation of toxic 3-OHACs. Caregivers must appreciate the danger of "sudden death" in LCHADD even during mild illnesses. During acute episodes of metabolic-decompensation, intravenous (IV) therapy with balanced glucose and electrolyte solution should be started promptly at 1 -1 /2 to twice maintenance for correction of hypoglycemia and acidosis. Blood glucose concentration should be kept above 80 mg/dl using a 10% dextrose IV solution. IV infiltrations or other IV interruptions, such as levocarnitine, must be remedied promptly. Metabolic acidosis may require treatment with boluses of sodium bicarbonate at 1 - 2 mEq/kg IV (available on the web at

fodsupport.org/pdf/lchad_protocol.pdf). Importantly, LCHADD patients must have an emergency letter with them at all times detailing explicit instructions regarding acute emergency treatment of exacerbations, as these treatments are not in routine clinical practice (available on the web at:

kdheks.gov/newborn_screening/download/ACT/LCHADD_lnfo_for_Health_Professi onals.pdf). Currently, there is one ongoing compassionate use clinical trial exploring the clinical utility of UX007 (Triheptanoin) for the treatment of LCHADD patients (available on the web at: clinicaltrials.gov/ct2/show/NCT01886378). Triheptanoin is metabolized to propionyl-CoA an anaplerotic substrate for the citric-acid cycle generating ATP (Roe CR, Brunengraber H. Anaplerotic treatment of long-chain fat oxidation disorders with triheptanoin: Review of 15 years. Experience. Mol Genet Metab. 2015; 1 16(4):260-8). [0013] Very Long-Chain acyl-coenzyme A Dehydrogenase deficiency (VLCADD) is an autosomal recessive disorder caused by a genetic deficiency of VLCAD activity (OMIM 201475 ACYL-CoA DEHYDROGENASE, VERY LONG-CHAIN, DEFICI ENCY OF, available on the web at:

omim.org/entry/201475?search=201475&highlight=201475). VLCADD is

characterized by absent or insufficient beta oxidation of long chain fatty acids.

Normally located in the inner mitochondrial membrane of most tissue cells, very long-chain acyl-coA dehydrogenase (VLCAD) oxidizes fatty acid chains, 14-20 carbons long, during the initial steps of beta oxidation. The oxidation catabolites (NADH, FADH2, acetyl-CoA, ketone bodies) are an important primary source of energy for some tissues, such as cardiac muscle; other tissues, such as skeletal muscle, also use oxidation catabolites during periods of metabolic stress that can occur following an illness or exercise (OMIM 201475; Andresen, Brage Storstein, et al. "Clear correlation of genotype with disease phenotype in very-long-chain Acyl- CoA dehydrogenase deficiency." The American Journal of Human Genetics 64.2 (1999): 479-494; Leslie ND, Valencia CA, Strauss AW, et al. Very Long-Chain Acyl- Coenzyme A Dehydrogenase Deficiency. 2009 May 28 [Updated 2014 Sep 1 1 ]. In: Pagon RA, Adam MP, Ardinger HH, et al., editors. GeneReviews® [Internet].

Seattle (WA): University of Washington, Seattle; 1993-2016.Available on the web at: ncbi.nlm.nih.gov/books/NBK6816/; Schiff, Manuel, et al. "Molecular and cellular pathology of very-long-chain acyl-CoA dehydrogenase deficiency." Molecular genetics and metabolism 109.1 (2013): 21 -27; Gregersen, Niels, Peter Bross, and Brage S. Andresen. "Genetic defects in fatty acid beta-oxidation and acyl-CoA dehydrogenases." European Journal of Biochemistry 271 .3 (2004): 470-482; Banta- Wright, Sandra A., Kathleen C. Shelton, and Michael J. Bennett. "Disorders of fatty acid oxidation in the era of tandem mass spectrometry in newborn screening." Newborn and Infant Nursing Reviews 8.1 (2008): 18-29; Boneh, A. , et al. "VLCAD deficiency: pitfalls in newborn screening and confirmation of diagnosis by mutation analysis." Molecular genetics and metabolism 88.2 (2006): 166-170; Gobin- Limballe, Stephanie, et al. "Compared effects of missense mutations in Very-Long- Chain Acyl-CoA Dehydrogenase deficiency: Combined analysis by structural, functional and pharmacological approaches." Biochimica et Biophysica Acta (BBA)- Molecular Basis of Disease 1802.5 (2010): 478-484; Gobin-Limballe, S., et al. "Genetic Basis for Correction of Very-Long-Chain Acyl-Coenzyme A

Dehydrogenase Deficiency by Bezafibrate in Patient Fibroblasts: Toward a

Genotype-Based Therapy." The American Journal of Human Genetics 81 .6 (2007): 1 133-1 143). With VLCADD, however, clinically significant symptoms can develop due to unmet tissue energy needs and the accumulation of long chain fatty acids. VLCADD presents clinically as one of three phenotypes: a severe neonatal form (VLCADD-C) that presents within the first months of life with symptoms of cardiomyopathy, arrhythmias, and hepatomegaly; a mild childhood form (VLCADD- H) that presents in early childhood with symptoms of recurrent hypoketotic hypoglycemia without cardiac involvement; and a mild adult form that presents after adolescence with symptoms of rhabdomyolysis and myoglobinuria (Andresen, American Journal of Human Genetics (1999); Spiekerkoetter, Ute, et al. "MS/MS- based newborn and family screening detects asymptomatic patients with very-long- chain acyl-CoA dehydrogenase deficiency." The Journal of pediatrics 143.3 (2003): 335-342; Goetzman, Eric S., et al. "Expression and characterization of mutations in human very long-chain acyl-CoA dehydrogenase using a prokaryotic system." Molecular genetics and metabolism 91 .2 (2007): 138-147; Leslie ND,

GeneReviews®; Schiff, Molecular genetics and metabolism 2013; Gregersen, European Journal of Biochemistry 2004; Banta- Wright, Newborn and Infant Nursing Reviews 2008; Boneh, Molecular genetics and metabolism 2006; Gobin-Limballe, Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease 2010; Gobin- Limballe, The American Journal of Human Genetics 2007; Tenopoulou, Margarita, et al. "Strategies for correcting very long chain acyl-CoA dehydrogenase

deficiency." Journal of Biological Chemistry 290.16 (2015): 10486-10494). The estimated incidence of total VLCADD cases varies from 1 :31 ,500 to 1 : 125,000; one source of variation could be the inclusion of asymptomatic VLCADD patients diagnosed based on newborn screening results (Spiekerkoetter, The Journal of pediatrics 2003; Leslie GeneReviews®; Banta-Wright, Newborn and Infant Nursing Reviews 2008; Boneh, Molecular genetics and metabolism 2006). Strauss, et al. (Molecular basis of human mitochondrial very-long-chain acyl-CoA dehydrogenase deficiency causing cardiomyopathy and sudden death in childhood. Proc. Nat. Acad. Sci. 92: 10496-10500, 1995) determined that the ACADVL gene contains 20 exons. The ACADVL gene is about 5.4 kb long (Zhou, C, Blumberg, B.

Overlapping gene structure of human VLCAD and DLG4. Gene 305: 161 -166, 2003). The cytogenetic location of the VLCAD gene is 17p13.1 (Genomic coordinates (GRCh38): 17:7,217, 124-7,225,266) (OMI M 609575 ACYL-CoA DEHYDROGENASE, VERY LONG-CHAIN (VLCAD) available on the web at www.omim.org/entry/609575?search=609575&highlight=609575#14).

[0014] Deficiency of very long-chain acyl-CoA dehydrogenase (VLCAD), which catalyzes the initial step of mitochondrial β-oxidation of long-chain fatty acids with a chain length of 14 to 20 carbons, is associated with three phenotypes (Andresen, The American Journal of Human Genetics 1999). The severe early-onset cardiac and multi-organ failure form typically presents in the first months of life with hypertrophic or dilated cardiomyopathy, pericardial effusion, and arrhythmias, as well as hypotonia, hepatomegaly, and intermittent hypoglycemia. Cardiomyopathy and arrhythmias are often lethal. Ventricular tachycardia, ventricular fibrillation, and atrioventricular block have been reported (Boneh, Molecular genetics and metabolism 88.2 (2006). Although the morbidity resulting from cardiomyopathy may be severe, cardiac dysfunction is reversible with early intensive supportive care and diet modification; normal cognitive outcome has been reported in these individuals (Leslie in GeneReviews®).

[0015] The hepatic or hypoketotic hypoglycemic form typically presents during early childhood with hypoketotic hypoglycemia and hepatomegaly, but without cardiomyopathy. Later-onset episodic myopathic VLCAD deficiency, probably the most common phenotype presents with intermittent rhabdomyolysis, muscle cramps and/or pain, and/or exercise intolerance. Hypoglycemia typically is not present at the time of symptoms. Ascertainment in adulthood has been reported (Leslie in GeneReviews®; Hoffman JD, et al. Rhabdomyolysis in the military:

recognizing late-onset very long-chain acyl CoA dehydrogenase deficiency. Mil Med. 2006; 171 :657-8).

[0016] Currently, there is no cure for VLCADD, and it is managed by reducing fat intake and avoiding periods of fasting. However even with careful diet management and preventative measures, most VLCADD patients will develop clinically significant symptoms (Leslie in GeneReviews®). Mortality of patients affected by the severe VLCADD-C is about 75-80% (Andresen, The American Journal of Human Genetics 1999; Leslie in GeneReviews®; Schiff, Molecular genetics and metabolism 2013). Mortality and morbidities associated with the milder forms are extremely low in diagnosed patients that carefully manage fat intake, however periods of hypoketotic hypoglycemia or rhabdomyolysis can still occur (Andresen, The American Journal of Human Genetics 1999; Leslie in GeneReviews®; Schiff, Molecular genetics and metabolism 2013; Gregersen, European Journal of Biochemistry 2004). Other potential therapies for disease treatment are currently under investigation. In a phase II clinical trial (#NCT00983788), investigators examined how well bezafibrate, a PPAR agonist that up-regulates an alternative fatty acid oxidation pathway, manages long-chain fatty acids levels and the associated symptoms in patients with the adult form of VLCADD. In previous studies, bezafibrate corrected fatty acid oxidation in fibroblasts that carried the A848T mutant allele (Gobin-Limballe, The American Journal of Human Genetics 2007). In a separate phase II clinical trial (#NCT01379625), investigators examined the effects of supplementing the diet with triheptanoin (UX007), a synthetic medium-length triglyceride, for treatment of fatty acid disorders, including the mild forms of VLCADD (Vockley, J., et al. "Response to Compassionate Use of Triheptanoin in Infants With Cardiomyopathy Due to Long Chain Fatty Acid Oxidation Defects (LC-FAODs)." Ultragenyx Pharmaceutical Inc, Novato, USA (2015). Neither of these methods is a cure for the underlying genetic cause of VLCADD and would require lifelong treatment (Leslie in GeneReviews®; Gobin- Limballe, The American Journal of Human Genetics 2007; Vockley Ultragenyx Pharmaceutical Inc, Novato, USA 2015).

[0017] An alternative treatment for patients with fatty acid disorders such as MCADD, LCHADD, and/or VLCADD includes genome engineering. Genome engineering refers to the strategies and techniques for the targeted, specific modification of the genetic information (genome) of living organisms. Genome engineering is a very active field of research because of the wide range of possible applications, particularly in the areas of human health; the correction of a gene carrying a harmful mutation, for example, or to explore the function of a gene. Early technologies developed to insert a transgene into a living cell were often limited by the random nature of the insertion of the new sequence into the genome. Random insertions into the genome may result in disrupting normal regulation of neighboring genes leading to severe unwanted effects. Furthermore, random integration technologies offer little reproducibility, as there is no guarantee that the sequence would be inserted at the same place in two different cells. Recent genome engineering strategies, such as zing finger nucleases (ZFNs), transcription activator like effector nucleases (TALENs), homing endonucleases (HEs), and MegaTALs, enable a specific area of the DNA to be modified, thereby increasing the precision of the correction or insertion compared to early technologies. These newer platforms offer a much larger degree of reproducibility, but still have their limitations.

[0018] Despite efforts from researchers and medical professionals worldwide who have been trying to address fatty acid disorders such as MCADD, LCHADD, and/or VLCADD, and despite the promise of genome engineering approaches, there still remains a critical need for developing safe and effective treatments for fatty acid disorders such as MCADD, LCHADD, and/or VLCADD, LCHADD, and/or VLCADD.

[0019] Prior approaches addressing fatty acid disorders such as MCADD, LCHADD, and/or VLCADD have limitations. The present invention solves these problems by using genome engineering tools to create permanent changes to the genome that can address a gene selected from the group consisting of ACADM, HADHA, and ACADVL and restore ACADM, HADHA, and/or ACADVL activity with a single treatment. Thus, the present invention corrects the underlying genetic defect causing the disease.

Summary

[0020] Provided herein are cellular, ex vivo and in vivo methods for creating permanent changes to the genome by deleting, inserting, or correcting one or more nucleotides, mutations, or exons in or near the ACADM gene or other DNA sequences that encode regulatory elements of the ACADM gene or knocking-in ACADM cDNA or minigene into a safe harbor locus by genome editing and restoring medium chain acyl-coenzyme A dehydrogenase (MCAD) activity, which can be used to treat medium chain acyl-coenzyme A dehydrogenase deficiency (MCADD). Also provided herein are components, kits and compositions for performing such methods, and cells produced by them.

[0021 ] Also provided herein is a method for inserting an ACADM gene in a cell, e.g., a human cell, by genome editing, the method comprising the step of:

introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near a safe harbor locus that results in a permanent insertion of the ACADM gene or minigene, and results in restoration of MCAD activity.

[0022] Also provided herein are cellular, ex vivo and in vivo methods for creating permanent changes to the genome by deleting, inserting, or correcting one or more nucleotides, mutations, or exons in or near the HADHA gene or other DNA sequences that encode regulatory elements of the HADHA gene or knocking-in HADHA cDNA or minigene into a safe harbor locus by genome editing and restoring long chain acyl-coenzyme A dehydrogenase (LCHAD) activity, which can be used to treat long chain acyl-coenzyme A dehydrogenase deficiency (LCHADD). Also provided herein are components, kits and compositions for performing such methods, and cells produced by them.

[0023] Also provided herein is a method for inserting an HADHA gene in a cell, e.g., a human cell, by genome editing, the method comprising the step of:

introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near a safe harbor locus that results in a permanent insertion of the HADHA gene or minigene, and results in restoration of LCHAD activity.

[0024] Also provided herein are cellular, ex vivo and in vivo methods for creating permanent changes to the genome by deleting, inserting, correcting or modulating the expression of or function of one or more mutations or exons in or near the ACADVL gene or other DNA sequences that encode regulatory elements of the ACADVL gene or knocking-in ACADVL cDNA or minigene into a safe harbor locus by genome editing and restoring very long acyl-coenzyme A dehydrogenase (VLCAD) activity, which can be used to treat very long acyl-coenzyme A

dehydrogenase deficiency (VLCADD). Also provided herein are components, kits and compositions for performing such methods, and cells produced by them.

[0025] Also provided herein is a method for inserting an ACADVL gene in a cell, e.g., a human cell, by genome editing, the method comprising the step of:

introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near a safe harbor locus that results in a permanent insertion of the ACADVL gene or minigene, and results in restoration of VLCAD activity.

[0026] In one aspect, provided herein is a method for editing an ACADM gene in a cell by genome editing, comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single- strand breaks (SSBs) or double-strand breaks (DSBs) within or near an ACADM gene or other DNA sequences that encode regulatory elements of an ACADM gene that results in a permanent deletion, insertion, or correction, of one or more nucleotides, mutations, or exons within or near the ACADM gene or other DNA sequences that encode regulatory elements of the ACADM gene, thereby restoring medium chain acyl coenzyme A dehydrogenase (MCAD) activity.

[0027] In one aspect, provided herein is a method for editing an HADHA gene in a cell by genome editing, comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single- strand breaks (SSBs) or double-strand breaks (DSBs) within or near an HADHA gene or other DNA sequences that encode regulatory elements of an HADHA gene that results in a permanent deletion, insertion, or correction, of one or more nucleotides, mutations, or exons within or near the HADHA gene or other DNA sequences that encode regulatory elements of the HADHA gene, thereby restoring Long-chain 3-hydroxyacyl-CoA dehydrogenase (LCHAD) activity.

[0028] In one aspect, provided herein is a method for editing an ACADVL gene in a cell by genome editing, comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single- strand breaks (SSBs) or double-strand breaks (DSBs) within or near an ACADVL gene or other DNA sequences that encode regulatory elements of an ACADVL gene that results in a permanent deletion, insertion, or correction, of one or more nucleotides, mutations, or exons within or near the ACADVL gene or other DNA sequences that encode regulatory elements of the ACADVL gene, thereby restoring very long chain acyl coenzyme A dehydrogenase (VLCAD) activity.

[0029] In one aspect, provided herein is a method for inserting a gene in a cell by genome editing, comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the ACADM gene, or a safe harbor locus, that results in a permanent insertion of the ACADM gene or minigene, thereby restoring medium chain acyl coenzyme A dehydrogenase (MCAD) activity.

[0030] In one aspect, provided herein is a method for inserting a gene in a cell by genome editing, comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the HADHA gene, or a safe harbor locus, that results in a permanent insertion of the HADHA gene or minigene, thereby restoring Long-chain 3-hydroxyacyl-CoA dehydrogenase

(LCHAD) activity.

[0031 ] In one aspect, provided herein is a method for inserting a gene in a cell by genome editing, comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the ACADVL gene, or a safe harbor locus, that results in a permanent insertion of the ACADVL gene or minigene, thereby restoring very long chain acyl coenzyme A dehydrogenase (VLCAD) activity.

[0032] In one aspect, provided herein is an in vivo method for treating a patient with MCADD comprising the step of editing a cell of the patient within or near an ACADM gene or other DNA sequences that encode regulatory elements of an ACADM gene, or a safe harbor locus. [0033] In some embodiments, the editing step comprises introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near an ACADM gene or other DNA sequences that encode regulatory elements of an ACADM gene that results in a permanent deletion, insertion, or correction, of one or more nucleotides, mutations, or exons within or near the ACADM gene, other DNA sequences that encode regulatory elements of the ACADM gene, thereby restoring medium chain acyl-coenzyme A dehydrogenase (MCAD) activity.

[0034] In some embodiments, the editing step comprises introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near a safe harbor locus that results in a permanent insertion of the ACADM gene, cDNA, or minigene, thereby restoring medium chain acyl-coenzyme A dehydrogenase (MCAD) activity.

[0035] In one aspect, provided herein is an in vivo method for treating a patient with LCHADD comprising the step of editing a cell of the patient within or near an HADHA gene in a cell or other DNA sequences that encode regulatory elements of an HADHA gene in a cell, or a safe harbor locus in a cell.

[0036] In some embodiments, the editing step comprises introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near an HADHA gene or other DNA sequences that encode regulatory elements of an HADHA gene that results in a permanent deletion, insertion, or correction, of one or more nucleotides, mutations, or exons within or near the HADHA gene, other DNA sequences that encode regulatory elements of the HADHA gene, thereby restoring Long-chain 3-hydroxyacyl-CoA dehydrogenase (LCHAD) activity.

[0037] In some embodiments, the editing step comprises introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near a safe harbor locus that results in a permanent insertion of the HADHA gene, cDNA, or minigene, thereby restoring Long-chain 3-hydroxyacyl-CoA dehydrogenase

(LCHAD) activity.

[0038] In one aspect, provided herein is an in vivo method for treating a patient with VLCADD comprising the step of editing a cell of the patient within or near an ACADVL gene in a cell or other DNA sequences that encode regulatory elements of an ACADVL gene in a cell, or a safe harbor locus in a cell.

[0039] In some embodiments, the editing step comprises introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near an ACADVL gene or other DNA sequences that encode regulatory elements of an ACADVL gene that results in a permanent deletion, insertion, or correction, of one or more nucleotides, mutations, or exons within or near the ACADVL gene, other DNA sequences that encode regulatory elements of the ACADVL gene, thereby restoring very long chain acyl coenzyme A dehydrogenase (VLCAD).

[0040] In some embodiments, the editing step comprises introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near a safe harbor locus that results in a permanent insertion of the ACADVL gene, cDNA, or minigene, thereby restoring very long chain acyl coenzyme A dehydrogenase (VLCAD) activity.

[0041 ] In some embodiments, the safe harbor locus is selected from the group consisting of AAVS1 (PPP1 R12C), ALB, Angptl3, ApoC3, ASGR2, CCR5, FIX (F9), G6PC, Gys2, HGD, Lp(a), Pcsk9, Serpinal , TF, and TTR. The safe harbor locus can be selected from the group consisting of: exon 1 -2 of AAVS1 (PPP1 R12C), exon 1 -2 of ALB, exon 1 -2 of Angptl3, exon 1 -2 of ApoC3, exon 1 -2 of ASGR2, exon 1 -2 of CCR5, exon 1 -2 of FIX (F9), exon 1 -2 of G6PC, exon 1 -2 of Gys2, exon 1 -2 of HGD, exon 1 -2 of Lp(a), exon 1 -2 of Pcsk9, exon 1 -2 of Serpinal , exon 1 -2 of TF, and exon 1 -2 of TTR.

[0042] In some embodiments, the method further comprises introducing into the cell one or more guide ribonucleic acids (gRNAs). [0043] In some embodiments, the one or more gRNAs are single-molecule guide RNA (sgRNAs).

[0044] In some embodiments, the gRNA or sgRNA comprises a spacer sequence consisting of an RNA sequence corresponding to any of SEQ ID NOs: 1 - 29,800, SEQ ID NOs: 29,801 -60,041 , or SEQ ID NOs: 60.042-69,825.

[0045] In some embodiments, the one or more gRNAs or one or more sgRNAs is one or more modified gRNAs or one or more modified sgRNAs.

[0046] In some embodiments, the one or more modified gRNAs or one or more modified sgRNAs includes one or more modifications selected from the group consisting of a modified backbone, a sugar moiety, an internucleoside linkage, and modified or universal bases.

[0047] In some embodiments, the one or more DNA endonucleases is pre- complexed with one or more gRNAs or one or more sgRNAs.

[0048] In some embodiments, the method further comprises introducing into the cell a polynucleotide donor template comprising: a) at least a portion of the wild- type ACADM gene, minigene or cDNA; b) at least a portion of the wild-type HADHA gene, minigene, or cDNA; or c) at least a portion of the wild-type ACADVL gene, minigene, cDNA.

[0049] In some embodiments, the donor template has homologous arms to the 1 p31 .1 region.

[0050] In some embodiments, the donor template has homologous arms to the 17p13.1 region.

[0051 ] In some embodiments, the donor template has homologous arms to the 2p23.3 region.

[0052] In some embodiments, the method further comprises introducing into the cell one guide ribonucleic acid (gRNA) and a polynucleotide donor template comprising at least a portion of a wild-type ACADM gene, a wild-type HADHA gene, or a wild-type ACADVL gene, and wherein the one or more DNA endonucleases is one or more Cas9 or Cpf1 endonucleases that effect one single-strand break (SSB) or double-strand break (DSB) at a locus within or near an ACADM gene, an HADHA gene, or an ACADVL gene, or other DNA sequences that encode regulatory elements of an ACADM gene, an HADHA gene, or an ACADVL gene that facilitates insertion of a new sequence from the polynucleotide donor template into the chromosomal DNA at the locus resulting in a permanent insertion or correction of a part of the ACADM gene, the HADHA gene, or the ACADVL gene or other DNA sequences that encode regulatory elements of the ACADM gene, the HADHA gene, or the ACADVL gene, thereby restoring MCAD activity, and wherein the gRNA comprises a spacer sequence that is complementary to a segment of the locus.

[0053] In some embodiments, the method further comprises introducing into the cell one guide ribonucleic acid (gRNA) and a polynucleotide donor template comprising at least a portion of a wild-type ACADM gene, a wild-type HADHA gene, or a wild-type ACADVL gene, and wherein the one or more DNA endonucleases is one or more Cas9 or Cpf1 endonucleases that effect one single-strand break (SSB) or double-strand break (DSB) at a locus within or near a safe harbor locus that facilitates insertion of a new sequence from the polynucleotide donor template into the chromosomal DNA at the locus resulting in a permanent insertion or correction of the ACADM gene, the HADHA gene, or the ACADVL gene or other DNA sequences that encode regulatory elements of the ACADM gene, the HADHA gene, or the ACADVL gene, thereby restoring MCAD activity, and wherein the gRNA comprises a spacer sequence that is complementary to a segment of the locus.

[0054] In some embodiments, the method further comprises introducing into the cell two guide ribonucleic acid (gRNAs) and a polynucleotide donor template comprising at least a portion of a wild-type ACADM gene, a wild-type HADHA gene, or a wild-type ACADVL gene, and wherein the one or more DNA endonucleases is one or more Cas9 or Cpf1 endonucleases that effect a pair of single-strand breaks

(SSBs) or double-strand breaks (DSBs), the first at a 5' locus and the second at a

3' locus, within or near an ACADM gene, an HADHA gene, or an ACADVL gene or other DNA sequences that encode regulatory elements of an ACADM gene, an

HADHA gene, or an ACADVL gene that facilitates insertion of a new sequence from the polynucleotide donor template into the chromosomal DNA between the 5' locus and the 3' locus resulting in a permanent insertion or correction of the chromosomal DNA between the 5' locus and the 3' locus within or near the ACADM gene, the HADHA gene, or the ACADVL gene or other DNA sequences that encode regulatory elements of the ACADM gene, the HADHA gene, or the ACADVL gene, thereby restoring MCAD activity, LCHAD activity, or VLCAD activity.

[0055] In some embodiments, the two gRNAs are selected from a first guide RNA comprising a spacer sequence that is complementary to a segment of the 5' locus and a second guide RNA comprises a spacer sequence that is

complementary to a segment of the 3' locus.

[0056] In some embodiments, the spacer sequence has an RNA sequence corresponding to SEQ ID NO: 1 -29,800.

[0057] In some embodiments, the spacer sequence has an RNA sequence corresponding to SEQ ID NO: 29,801 -60,041 .

[0058] In some embodiments, the spacer sequence has an RNA sequence corresponding to SEQ ID NO: 60,042-69,825.

[0059] In some embodiments, the method further comprises introducing into the cell two guide ribonucleic acid (gRNAs) and a polynucleotide donor template comprising at least a portion of a wild-type ACADM gene, a wild-type HADHA gene, or a wild-type ACADVL gene, and wherein the one or more DNA endonucleases is one or more Cas9 or Cpf1 endonucleases that effect a pair of single-strand breaks (SSBs) or double-strand breaks (DSBs), the first at a 5' locus and the second at a 3' locus, within or near a safe harbor locus that facilitates insertion of a new sequence from the polynucleotide donor template into the chromosomal DNA between the 5' locus and the 3' locus resulting in a permanent insertion of all or part of the donor template within or near the safe harbor locus, thereby restoring MCAD activity, LCHAD activity, or VLCAD activity.

[0060] In some embodiments, the one or two gRNAs are one or two single- molecule guide RNA (sgRNAs).

[0061 ] In some embodiments, the one or two gRNAs or one or two sgRNAs is one or two modified gRNAs or one or two modified sgRNAs. [0062] In some embodiments, the at least portion of the wild-type ACADM gene or minigene or cDNA is exon 1 , some or all of intron 1 , exon 2, some or all of intron 2, exon 3, some or all of intron 3, exon 4, some or all of intron 4, exon 5, some or all of intron 5, exon 6, some or all of intron 6, exon 7, some or all of intron 7, exon 8, some or all of intron 8, exon 9, some or all of intron 9, exon 10, some or all of intron 10, exon 1 1 , some or all of intron 1 1 , exon 12, fragments, or combinations thereof, or the entire ACADM gene, DNA sequences that encode wild-type regulatory elements of the ACADM gene.

[0063] In some embodiments, the at least portion of the wild-type HADHA gene or minigene or cDNA is exon 1 , some or all of intron 1 , exon 2, some or all of intron 2, exon 3, some or all of intron 3, exon 4, some or all of intron 4, exon 5, some or all of intron 5, exon 6, some or all of intron 6, exon 7, some or all of intron 7, exon 8, some or all of intron 8, exon 9, some or all of intron 9, exon 10, some or all of intron 10, exon 1 1 , some or all of intron 1 1 , exon 12, some or all of intron 12, exon 13, some or all of intron 13, exon 14, some or all of intron 14, exon 15, some or all of intron 15, exon 16, some or all of intron 16, exon 17, some or all of intron 17, exon 18, some or all of intron 18, exon 19, some or all of intron 19, exon 20, fragments, or combinations thereof, or the entire HADHA gene, DNA sequences that encode wild-type regulatory elements of the HADHA gene.

[0064] In some embodiments, the at least portion of the wild-type ACADVL gene or minigene or cDNA is exon 1 , some or all of intron 1 , exon 2, some or all of intron 2, exon 3, some or all of intron 3, exon 4, some or all of intron 4, exon 5, some or all of intron 5, exon 6, some or all of intron 6, exon 7, some or all of intron 7, exon 8, some or all of intron 8, exon 9, some or all of intron 9, exon 10, some or all of intron 10, exon 1 1 , some or all of intron 1 1 , exon 12, some or all of intron 12, exon 13, some or all of intron 13, exon 14, some or all of intron 14, exon 15, some or all of intron 15, exon 16, some or all of intron 16, exon 17, some or all of intron 17, exon 18, some or all of intron 18, exon 19, some or all of intron 19, exon 20, fragments, or combinations thereof, or the entire ACADVL gene, DNA sequences that encode wild-type regulatory elements of the ACADVL gene. [0065] In some embodiments, the donor template is either a single or double stranded polynucleotide.

[0066] In some embodiments, the donor template comprises the sequence of SEQ ID NO: 69,836-69,861 .

[0067] In some embodiments, the donor template has homologous arms to the 1 p31 .1 region.

[0068] In some embodiments, the donor template has homologous arms to the 17p13.1 region.

[0069] In some embodiments, the donor template has homologous arms to the 2p23.3 region.

[0070] In some embodiments, the gRNA or sgRNA is directed to one or more of the pathological variants. The majority (80%) of patients with clinically manifested MCAD deficiency are homozygous for a common mutation, A985G, and a further 18% have this mutation in one disease allele (Gregersen et al. 1991 ; Yokota et al. 1991 ; Pollitt and Leonard 1998). A large number of different mutations have been detected and characterized in patients with clinical presentation of MCAD deficiency (Andresen et al. 1997; B. S. Andresen, unpublished data). Exemplary additional mutations include, but are not limited to, 157C to T, 343-348 deletion, 347G to A, 351 A to C, 362C to T, 447G to A, 577A to G, 583G to A, 617G to T, 474T to G, 730T to C, 799G to A, 977T to C, 985A to G, 1008 T to A, 1045 C to T, 1055A to G, 1 124T to C, 1 152G to T, 955-956 deletion, 1 100-1 103 deletion, 999 inserted TAGAATGAGTTAC (SEQ ID NO: 69,826) and 1 190 inserted T and the variants described in Figures 3A-3E. See also Figure 2.

[0071 ] In some embodiments, the gRNA or sgRNA is directed to one or more of the pathological variants. (Spiekerkoetter U, Khuchua Z, Yue Z, Bennett MJ, Strauss AW. General mitochondrial trifunctional protein (TFP) deficiency, as a result of either alpha- or beta-subunit mutations exhibits similar phenotypes because mutations in either subunit alter TFP complex expression and subunit turnover. Pediatr. Res. 2004; 55: 190-196) Among LCHADD patients,

approximately 80% of the mutations are the common (G1528C) single nucleotide substitution in the HADHA gene that causes isolated TFP deficiency. (Ijlst L, Wanders RJ, Ushikubo S, Kamijo T, Hashimoto T. Molecular basis of long-chain 3- hydroxyacyl-CoA dehydrogenase deficiency: identification of the major disease- causing mutation in the alpha-subunit of the mitochondrial trifunctional protein (TFP). Biochim. Biophys. Acta. 1994; 1215:347-350; Ijlst L, Ruiter JP, Hoovers JM, Jakobs ME, Wanders RJ. Common missense mutation G1528C in long-chain 3- hydroxyacyl-CoA dehydrogenase deficiency. Characterization and expression of the mutant protein, mutation analysis on genomic DNA and chromosomal localization of the mitochondrial trifunctional protein alpha subunit gene. J. Clin. Invest. 1996; 98: 1028-1033) This mutation leads to a glutamine substituted for a glutamate at position 474 (E474Q) in the alpha-subunit of TFP, which decreases only the long-chain 3-hydroxyacyl-CoA dehydrogenase (LCHAD) activity of the protein complex, leaving hydratase and thiolase activities relatively intact. (Rinaldo P, Matern D, Bennett MJ. Fatty acid oxidation disorders. Annu. Rev. Physiol. 2002; 64:477-502).

[0072] In some embodiments, the gRNA or sgRNA is directed to one or more mutations selected from the group consisting of T848C and A848T.

[0073] In some embodiments, the insertion or correction is by homology directed repair (HDR) or non-homologous end joining (NHEJ).

[0074] In some embodiments, the method further comprises introducing into the cell two guide ribonucleic acid (gRNAs), and wherein the one or more DNA endonucleases is one or more Cas9 endonucleases that effect a pair of double- strand breaks (DSBs), the first at a 5' locus and the second at a 3' locus, within or near an ACADM gene, an HADHA gene, or an ACADVL gene, or other DNA sequences that encode regulatory elements of an ACADM gene that results in a permanent deletion of the chromosomal DNA between the 5' locus and the 3' locus within or near the ACADM gene, the HADHA gene, or the ACADVL gene, thereby restoring MCAD activity, LCHAD activity, or VLCAD activity.

[0075] In some embodiments, the two gRNAs are selected from a first guide RNA comprising a spacer sequence that is complementary to a segment of the 5' locus and a second guide RNA comprising a spacer sequence that is

complementary to a segment of the 3' locus.

[0076] In some embodiments, the spacer sequence of first and second guide RNAs has an RNA sequence corresponding to any one of SEQ ID NOs: 1 -29,800.

[0077] In some embodiments, the spacer sequence of first and second guide RNAs has an RNA sequence corresponding to any one of SEQ ID NOs: 29,801 - 60,041 .

[0078] In some embodiments, the spacer sequence of first and second guide RNAs has an RNA sequence corresponding to any one of SEQ ID NOs: 60,042- 69,825.

[0079] In some embodiments, the two gRNAs are two single-molecule guide RNA (sgRNAs).

[0080] In some embodiments, the two gRNAs or two sgRNAs are two modified gRNAs or two modified sgRNAs.

[0081 ] In some embodiments, the one or more DNA endonucleases is pre- complexed with one or two gRNAs or one or two sgRNAs.

[0082] In some embodiments, the deletion is a deletion of 1 kb or less.

[0083] In some embodiments, the endonuclease is encoded by an mRNA and wherein the endonuclease mRNA and gRNA are formulated into separate lipid nanoparticles or co-formulated into a lipid nanoparticle.

[0084] In some embodiments, the endonuclease is encoded by an mRNA and wherein, the endonuclease mRNA, gRNA, and donor template are each formulated into separate lipid nanoparticles or co-formulated into a lipid nanoparticle.

[0085] In some embodiments, the DNA endonuclease is encoded by an mRNA and wherein, the endonuclease mRNA is formulated into a lipid nanoparticle, and both the gRNA and donor template are delivered by a viral vector.

[0086] In some embodiments, the DNA endonuclease is encoded by an mRNA and wherein, the endonuclease mRNA, gRNA, and a donor template are each formulated in separate exosomes or co-formulated into an exosome. [0087] In some embodiments, the one or more DNA endonucleases is a Cas9 or Cpf1 endonuclease; or a homolog thereof, recombination of the naturally occurring molecule, codon-optimized, or modified version thereof, or combinations thereof.

[0088] In some embodiments, the method comprises introducing into the cell one or more polynucleotides encoding the one or more DNA endonucleases.

[0089] In some embodiments, the method comprises introducing into the cell one or more ribonucleic acids (RNAs) encoding the one or more DNA endonucleases.

[0090] In some embodiments, the one or more polynucleotides or one or more RNAs is one or more modified polynucleotides or one or more modified RNAs.

[0091 ] In some embodiments, the DNA endonuclease is a protein or polypeptide.

[0092] In some embodiments, the DNA endonuclease is a Cas9 or Cpfl endonuclease comprising one or more nuclear localization signals (NLSs).

[0093] In some embodiments, at least one NLS is at or within 50 amino acids of the amino-terminus of the Cas9 or Cpfl endonuclease and/or at least one NLS is at or within 50 amino acids of the carboxy-terminus of the Cas9 or Cpfl

endonuclease.

[0094] In some embodiments, the polynucleotide encoding a DNA endonuclease is codon optimized for expression in a eukaryotic cell.

[0095] In some embodiments, the ACADM gene is located on Chromosome 1 : 75,724,346 - 75,763,678 (Genome Reference Consortium - GRCh38/hg38).

[0096] In some embodiments, the HADHA gene is located at Chromosome 2: 26,190,634 - 26,244,725 (Genome Reference Consortium - GRCh38/hg38).

[0097] In some embodiments, the ACADVL gene is located at Chromosome 17: 7,217, 124 - 7,225,266 (Genome Reference Consortium - GRCh38/hg38).

[0098] In some embodiments, the restoration of MCAD activity is compared to wild-type or normal MCAD activity.

[0099] In some embodiments, the restoration of LCHAD activity is compared to wild-type or normal LCHAD activity. [00100] In some embodiments, the restoration of VLCAD activity is compared to wild-type or normal VLCAD activity.

[00101] In some embodiments, the cell is a human cell.

[00102] In some embodiments, the human cell is a hepatocyte.

[00103] In one aspect, the disclosure provides one or more guide ribonucleic acids (gRNAs) comprising a spacer sequence selected from the group consisting of the nucleic acid sequences in SEQ ID NOs: 1 -29,800, SEQ I D Nos: 29,801 -60,041 ; and SEQ ID Nos: 60,042-69,825.

[00104] In some embodiments, the one or more gRNAs are one or more single- molecule guide RNAs (sgRNAs).

[00105] In some embodiments, the one or more gRNAs or one or more sgRNAs is one or more modified gRNAs or one or more modified sgRNAs.

[00106] In one aspect, provided herein is a single-molecule guide RNA comprising at least a spacer sequence that is an RNA sequence corresponding to any of SEQ ID NOs: 1 -29,800, SEQ ID Nos: 29,801 -60,041 ; SEQ ID Nos: 60,042- 69,825.

[00107] In some embodiments, the single-molecule guide polynucleotide further comprises a spacer extension region.

[00108] In some embodiments, the single-molecule guide polynucleotide further comprises a tracrRNA extension region.

[00109] In some embodiments, the single-molecule guide polynucleotide is chemically modified.

[00110] In one aspect, provided herein is a DNA encoding a single-molecule guide RNA of the disclosure.

[00111] In some embodiments, the methods and compositions of the disclosure comprise one or more modified guide ribonucleic acids (gRNAs). Non-limiting examples of modifications comprise one or more nucleotides modified at the 2' position of the sugar, in some embodiments a 2'-0-alkyl, 2'-0-alkyl-0-alkyl, or 2'- fluoro-modified nucleotide. In some embodiments, RNA modifications include 2'- fluoro, 2'-amino or 2' O-methyl modifications on the ribose of pyhmidines, abasic residues, desoxy nucleotides, or an inverted base at the 3' end of the RNA.

[00112] In some embodiments, the one or more modified guide ribonucleic acids (gRNAs) comprise a modification that makes the modified gRNA more resistant to nuclease digestion than the native oligonucleotide. Non-limiting examples of such modifications include those comprising modified backbones, for example, phosphorothioates, phosphorothyos, phosphotriesters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages.

[00113] It is understood that the inventions described in this specification are not limited to the examples summarized in this Summary. Various other aspects are described and exemplified herein.

Brief Description of the Drawings

[00114] Figure 1A is an illustration depicting the type II CRISPR/Cas system.

[00115] Figure 1 B is another illustration depicting the type II CRISPR/Cas system.

[00116] Figure 2 is a schematic showing the genetic structure of the ACADM gene. The boxes indicate the coding and untranslated regions (UTR), respectively. The mutations associated with each coding region are listed above and below each box; the common A985G mutation is noted above coding region 1 1 .

[00117] Figures 3A-3E provide a list of additional disease-causing variants of the ACADM gene.

[00118] Figures 4A and 4B provide a list of additional disease-causing variants of the HADHA gene.

[00119] Figures 5A-5N provide a list of additional disease-causing variants of the ACADVL gene.

[00120] Figure 6 shows ACADM InDel measurements 48 h post-transfection in Huh7/Cas9 cells. [00121] Figure 7 shows HADHA InDel measurements 48 h post-transfection in Huh7/Cas9 cells.

[00122] Figure 8 shows ACADVL InDel measurements 48 h post-transfection in Huh7/Cas9 cells.

[00123] Figures 9A and 9B show ACADM Indel measurements 48 h post- transfection. Figure 9A shows % cutting efficiency of JS_19 gRNA in HDF cell culture. Figure 9B shows cutting efficiency of JS_19 compared to sg19 in HDF cell culture.

[00124] Figure 10 shows HDR correction of MCAD using ssODN.

[00125] Figure 1 1A, 1 1 B, 1 1 C, and 1 1 D show HDR correction of MCAD. Figures 1 1 A and 1 1 C show % correction of the mutant allele. Figures 1 1 B and 1 1 D show increased MCAD protein levels in response to gene correction.

[00126] Figure 12-14 describe the cutting efficiency of gRNAs with an S.

pyogenes Cas9 in HEK293T cells targeting the ACADVL gene.

Brief Description of the Sequence Listing

[00127] SEQ ID NOs: 1 -10,827 are 20 bp spacer sequences for targeting an ACADM gene with a S. pyogenes Cas9 endonuclease.

[00128] SEQ ID NOs: 10,828-12,058 are 20 bp spacer sequences for targeting an ACADM gene with a S. aureus Cas9 endonuclease.

[00129] SEQ ID NOs: 12,059-12,536 are 20 bp spacer sequences for targeting an ACADM gene with a S. thermophilus Cas9 endonuclease.

[00130] SEQ ID NOs: 12,537-12,733 are 20 bp spacer sequences for targeting an ACADM gene with a T. denticola Cas9 endonuclease.

[00131] SEQ ID NOs: 12,734-13,961 are 20 bp spacer sequences for targeting an ACADM gene with a N. meningitides Cas9 endonuclease.

[00132] SEQ ID NOs: 13,962-29,800 are 22 bp spacer sequences for targeting an ACADM gene with an Acidaminococcus and a Lachnospiraceae Cpf1 endonuclease. [00133] SEQ ID NOs: 29,801 -41 , 191 are 20 bp spacer sequences for targeting an HADHA gene with a S. pyogenes Cas9 endonuclease.

[00134] SEQ ID NOs: 41 , 192-42,553 are 20 bp spacer sequences for targeting an HADHA gene with a S. aureus Cas9 endonuclease.

[00135] SEQ ID NOs: 42,554-42,980 are 20 bp spacer sequences for targeting an HADHA gene with a S. thermophilus Cas9 endonuclease.

[00136] SEQ ID NOs: 42,981 -43, 173 are 20 bp spacer sequences for targeting an HADHA gene with a T. denticola Cas9 endonuclease.

[00137] SEQ ID NOs: 43, 174-44,402 are 20 bp spacer sequences for targeting an HADHA gene with a N. meningitides Cas9 endonuclease.

[00138] SEQ ID NOs: 44,403-60,041 are 22 bp spacer sequences for targeting an HADHA gene with an Acidaminococcus and a Lachnospiraceae Cpf1 endonuclease.

[00139] SEQ ID NOs: 60,042-65,507 are 20 bp spacer sequences for targeting an ACADVL gene with a S. pyogenes Cas9 endonuclease.

[00140] SEQ ID NOs: 65,508-65,951 are 20 bp spacer sequences for targeting an ACADVL gene with a S. aureus Cas9 endonuclease.

[00141] SEQ ID NOs: 65,952-66,009 are 20 bp spacer sequences for targeting an ACADVL gene with a S. thermophilus Cas9 endonuclease.

[00142] SEQ ID NOs: 66,010-66,029 are 20 bp spacer sequences for targeting an ACADVL gene with a T. denticola Cas9 endonuclease.

[00143] SEQ ID NOs: 66,030-66,252 are 20 bp spacer sequences for targeting an ACADVL gene with a N. meningitides Cas9 endonuclease.

[00144] SEQ ID NOs: 66,253-69,825 are 22 bp spacer sequences for targeting an ACADVL gene with an Acidaminococcus and a Lachnospiraceae Cpf1 endonuclease.

[00145] SEQ ID NOs: 69,826-69,827 and 69,862 are miscellaneous sequences described in the specification. [00146] SEQ ID NOs: 69,828- 69,830 show sample sgRNA sequences.

[00147] SEQ ID NOs: 69,831 -69,833 are an Alt-R™ tracrRNA, a universal CRISPR-Cas9 crRNA sequence, and spacer sequences shown in the working examples provided herein.

[00148] SEQ ID NO: 69,834 is a gRNA sequence targeting the G985 mutation of the ACADM gene used in the working examples provided herein.

[00149] SEQ ID NO: 69,835 is an sgRNA sequence used in the working examples provided herein.

[00150] SEQ ID NOs: 69,836-69,861 are single-stranded oligodeoxynucleotides (ssODN) sequences used in the working examples provided herein.

Detailed Description

[00151] Medium chain acyl-coenzyme A dehydrogenase deficiency

(MCADD):

[00152] MCADD is caused by mutations, or more rarely by deletions, to the ACADM gene. The ACADM gene is located at 1 p31 .1 , with genomic coordinates (GRCh38) at chr1 : 75,724,346 - 75,763,678. ACADM is comprised of twelve exons and has a total length of 63.23 kb. The gene has one promoter.

[00153] The ACADM gene encodes medium chain acyl-coenzyme A

dehydrogenase (MCAD), an enzyme that catalyzes the initial step of the

mitochondrial fatty acid beta-oxidation pathway. The ACADM gene is found in the mitochondria of several types of tissues, particularly the liver.

[00154] Long-chain 3-hydroxyl-coenzyme A dehydrogenase deficiency (LCHADD)

[00155] LCHADD is caused by mutations, or more rarely by deletions, to the HADHA gene. The HADHA gene is located at 2p23.3, with genomic coordinates (GRCh38) at chr2: 26,190,634 - 26,244,725. HADHA is comprised of twenty exons and has a total length of 52 kb. The gene has one promoter.

[00156] The HADHA gene encodes the alpha-subunit of the tri-functional protein (TFP), an enzyme that catalyzes the initial step of the mitochondrial fatty acid beta- oxidation pathway. The HADHA gene is found in the mitochondria of several types of tissues, particularly the liver.

[00157] Very long-chain acyl-coenzyme A dehydrogenase deficiency (VLCADD):

[00158] VLCADD is caused by mutations, or more rarely by deletions, to the ACADVL gene. The ACADVL gene is located at 17p13.1 , with genomic coordinates (GRCh38) at chr17: 7,217,124 - 7,225,266. ACADVL is comprised of twenty exons and has a total length of 5.4 kb. The gene has one promoter. Wild type VLCAD monomers form homodimers that integrate into the mitochondrial membrane.

[00159] The ACADVL gene encodes very long-chain acyl-coenzyme A dehydrogenase (VLCAD), an enzyme that catalyzes the initial step of the mitochondrial fatty acid beta-oxidation pathway. The ACADVL gene is found in the mitochondria of several types of tissues, particularly the liver.

[00160] Therapeutic approach

[00161] As the known forms of fatty acid disorders such as medium chain acyl- coenzyme A dehydrogenase deficiency (MCADD), long-chain 3-hydroxyl-coenzyme A dehydrogenase deficiency (LCHADD), and/or very long-chain acyl-coenzyme A dehydrogenase deficiency (VLCADD) are monogenic disorders with recessive inheritance, it is likely that correcting one of the mutant alleles per cell will be sufficient for correction and restoration or partial restoration of MCAD, TFP/LCHAD, and/or VLCAD function. The correction of one allele can coincide with one copy that remains with the original mutation, or a copy that was cleaved and repaired by non-homologous end joining (NHEJ) and therefore was not properly corrected. Bi- allelic correction can also occur. Various editing strategies that can be employed for specific mutations are discussed below.

[00162] Correction of one or possibly both of the mutant alleles provides an important improvement over existing or potential therapies, such as introduction of ACADM expression cassettes, HADHA expression cassettes, and/or ACADVL expression cassettes through lentivirus delivery and integration. Gene editing to correct the mutation has the advantage of precise genome modification and lower adverse effects, and for restoration of correct expression levels and temporal control. Sequencing the patient's ACADM alleles, HADHA alleles, and/or ACADVL alleles allows for design of the gene editing strategy to best correct the identified mutation(s).

[00163] For example, the mutation can be corrected by the insertions or deletions that arise due to the NHEJ repair pathway. If the patient's ACADM gene, HADHA gene, and/or ACADVL gene has an inserted or deleted base, a targeted cleavage can result in a NHEJ-mediated insertion or deletion that restores the frame. Missense mutations can also be corrected through NHEJ-mediated correction using one or more guide RNA. The ability or likelihood of the cut(s) to correct the mutation can be designed or evaluated based on the local sequence and micro-homologies. NHEJ can also be used to delete segments of the gene, either directly or by altering splice donor or acceptor sites through cleavage by one gRNA targeting several locations, or several gRNAs. This may be useful if an amino acid, domain or exon contains the mutations and can be removed or inverted, or if the deletion otherwise restored function to the protein. Pairs of guide strands have been used for deletions and corrections of inversions. NHEJ can also be used to promote targeted transgene integration at the cleaved locus, especially if the transgene donor template has been cleaved within the cell as well.

[00164] Alternatively, the donor for correction by homology directed repair (HDR) contains the corrected sequence with small or large flanking homology arms to allow for annealing. HDR is essentially an error-free mechanism that uses a supplied homologous DNA sequence as a template during DSB repair. The rate of homology directed repair (HDR) is a function of the distance between the mutation and the cut site so choosing overlapping or nearby target sites is important.

Templates can include extra sequences flanked by the homologous regions or can contain a sequence that differs from the genomic sequence, thus allowing sequence editing.

[00165] In addition to correcting mutations by NHEJ or HDR, a range of other options are possible. If there are small or large deletions or multiple mutations, a cDNA can be knocked in that contains the exons affected. A full length cDNA can be knocked into any "safe harbor" -i.e., non-deleterious insertion point that is not the ACADM gene itself, the HADHA gene itself, and/or the ACADVL gene itself-, with or without suitable regulatory sequences. If this construct is knocked-in near the ACADM regulatory elements, the HADHA regulatory elements, and/or the ACADVL regulatory elements, it should have physiological control, similar to the normal gene. Two or more (e.g., a pair) nucleases can be used to delete mutated gene regions, though a donor would usually have to be provided to restore function. In this case two gRNA and one donor sequence would be supplied.

[00166] Provided herein are methods to correct the specific mutation in the gene by inducing a double stranded break with Cas9 and a sgRNA or a pair of double stranded breaks around the mutation using two appropriate sgRNAs, and to provide a donor DNA template to induce Homology-Directed Repair (HDR). In some embodiments, the donor DNA template can be a short single stranded oligonucleotide, a short double stranded oligonucleotide, a long single or double stranded DNA molecule. These methods use gRNAs and donor DNA molecules for each of the variants of ACADM, HADHA, and/or ACADVL.

[00167] Provided herein are methods to knock-in ACADM cDNA or a minigene (comprised of one or more exons and introns or natural or synthetic introns) into the locus of the corresponding gene. These methods use a pair of sgRNA targeting the first exon and/or the first intron of the ACADM gene. In some embodiments, the donor DNA is single or double stranded DNA having homologous arms to the 1 p31 .1 region.

[00168] Provided herein are methods to knock-in ACADM cDNA or a minigene (comprised of one or more exons and introns or natural or synthetic introns) into the locus of the hot-spot, e.g., CCR5 gene. These methods use a pair of sgRNA targeting the first exon and/or the first intron of the gene located in the liver hotspot. In some embodiments, the donor DNA is single or double stranded DNA having homologous arms to the corresponding region.

[00169] Provided herein are methods to knock-in HADHA cDNA or a minigene (comprised of one or more exons and introns or natural or synthetic introns) into the locus of the corresponding gene. These methods use a pair of sgRNA targeting the first exon and/or the first intron of the HADHA gene. In some embodiments, the donor DNA is single or double stranded DNA having homologous arms to the 2p23.3 region.

[00170] Provided herein are methods to knock-in HADHA cDNA or a minigene (comprised of one or more exons and introns or natural or synthetic introns) into the locus of the hot-spot, e.g., CCR5 gene. These methods use a pair of sgRNA targeting the first exon and/or the first intron of the gene located in the liver hotspot. In some embodiments, the donor DNA is single or double stranded DNA having homologous arms to the corresponding region.

[00171] Provided herein are methods to knock-in ACADVL cDNA or a minigene (comprised of one or more exons and introns or natural or synthetic introns) into the locus of the corresponding gene. These methods use a pair of sgRNA targeting the first exon and/or the first intron of the ACADVL gene. In some embodiments, the donor DNA is single or double stranded DNA having homologous arms to the 17p13.1 region.

[00172] Provided herein are methods to knock-in ACADVL cDNA or a minigene (comprised of one or more exons and introns or natural or synthetic introns) into the locus of the hot-spot, e.g., CCR5 gene. These methods use a pair of sgRNA targeting the first exon and/or the first intron of the gene located in the liver hotspot. In some embodiments, the donor DNA is single or double stranded DNA having homologous arms to the corresponding region.

[00173] Provided herein are cellular, ex vivo and in vivo methods for using genome engineering tools to create permanent changes to the genome by 1 ) correcting, by insertions or deletions that arise due to the imprecise NHEJ pathway, one or more mutations within or near a gene selected from the group consisting of the ACADM gene, the HADHA gene, and the ACADVL gene, or other DNA sequences that encode regulatory elements of a gene selected from the group consisting of the ACADM gene, the HADHA gene, and the ACADVL gene, 2) 2) correcting, by HDR, one or more mutations within or near a gene selected from the group consisting of the ACADM gene, the HADHA gene, and the ACADVL gene or other DNA sequences that encode regulatory elements of a gene selected from the group consisting of the ACADM gene, the HADHA gene, and the ACADVL gene, or 3) deletion of the mutant region and/or knocking-in ACADM, HADHA, and/or ACADVL cDNA or minigene (comprised of, natural or synthetic enhancer and promoter, one or more exons, and natural or synthetic introns, and natural or synthetic 3'UTR and polyadenylation signal) into the gene locus or a safe harbor locus of a gene selected from the group consisting of the ACADM gene, the HADHA gene, and the ACADVL gene, and restoring activity. Such methods use endonucleases, such as CRISPR-associated (Cas9, Cpf1 and the like) nucleases, to permanently delete, insert, edit, correct, or replace one or more exons or portions thereof (i.e., mutations within or near the coding and/or splicing sequences) or insert in the genomic locus of a gene selected from the group consisting of the ACADM gene, the HADHA gene, and the ACADVL gene or other DNA sequences that encode regulatory elements of a gene selected from the group consisting of the ACADM gene, the HADHA gene, and the ACADVL gene. In this way, the examples set forth in the present disclosure restore the reading frame or the wild- type sequence of, or otherwise correct, the gene with a single treatment (rather than deliver potential therapies for the lifetime of the patient).

[00174] Provided herein are methods for treating a patient with a fatty acid disorder selected from the group consisting of medium chain acyl-coenzyme A dehydrogenase deficiency (MCADD), long-chain 3-hydroxyl-coenzyme A

dehydrogenase deficiency (LCHADD), very long-chain acyl-coenzyme A

dehydrogenase deficiency (VLCADD), and combinations thereof. An embodiment of such method is an ex vivo cell-based therapy. For example, a patient specific induced pluripotent stem cell (iPSC) is created. Then, the chromosomal DNA of these iPS cells is edited using the materials and methods described herein. Next, the genome-edited iPSCs are differentiated into hepatocytes. Finally, the hepatocytes are administered to the patient.

[00175] Another embodiment of such method is an ex vivo cell-based therapy. For example, a biopsy of the patient's liver is performed. Then, a liver specific progenitor cell or primary hepatocyte is isolated from the biopsied material. Next, the chromosomal DNA of these progenitor cells or primary hepatocytes is corrected using the materials and methods described herein. Finally, the progenitor cells or primary hepatocytes are administered to the patient.

[00176] Yet another embodiment of such method is an ex vivo cell-based therapy. For example, a biopsy of the patient's bone marrow is performed. Then, a mesenchymal stem cell is isolated from the biopsied material. Next, the

chromosomal DNA of these stem cells is corrected using the materials and methods described herein. Next, the stem cells are differentiated into hepatocytes. Finally, the hepatocytes are administered to the patient.

[00177] One advantage of an ex vivo cell therapy approach is the ability to conduct a comprehensive analysis of the therapeutic prior to administration.

Nuclease-based therapeutics have some level of off-target effects. Performing gene correction ex vivo allows one to fully characterize the corrected cell population prior to administration. The present disclosure includes sequencing the entire genome of the corrected cells to ensure that the off-target effects, if any, are in genomic locations associated with minimal risk to the patient. Furthermore, populations of specific cells, including clonal populations, can be isolated prior to administration.

[00178] Another advantage of ex vivo cell therapy relates to genetic correction in iPSCs compared to other primary cell sources. iPSCs are prolific, making it easy to obtain the large number of cells that will be required for a cell-based therapy.

Furthermore, iPSCs are an ideal cell type for performing clonal isolations. This allows screening for the correct genomic correction, without risking a decrease in viability. In contrast, other potential cell types, such as primary hepatocytes, are viable for only a few passages and difficult to clonally expand. Thus, manipulation of MCADD iPSCs, LCHADD iPSCs, and/or VLCADD iPSCs, will be much easier, and will shorten the amount of time needed to make the desired genetic correction.

[00179] Another embodiment of such method is an in vivo based therapy. In this method, the chromosomal DNA of the cells in the patient is corrected using the materials and methods described herein.

[00180] An advantage of in vivo gene therapy is the ease of therapeutic production and administration. The same therapeutic approach and therapy will have the potential to be used to treat more than one patient, for example a number of patients who share the same or similar genotype or allele. In contrast, ex vivo cell therapy typically requires using a patient's own cells, which are isolated, manipulated and returned to the same patient.

[00181] Also provided herein is a cellular method for editing a gene selected from the group consisting of the ACADM gene, the HADHA gene, and the ACADVL gene in a cell by genome editing. For example, a cell is isolated from a patient or animal. Then, the chromosomal DNA of the cell is edited using the materials and methods described herein.

[00182] The methods provided herein, regardless of whether a cellular or ex vivo or in vivo method, involve one or a combination of the following: 1 ) correcting, by insertions or deletions that arise due to the imprecise NHEJ pathway, one or more mutations within or near a gene selected from the group consisting of the ACADM gene, the HADHA gene, and the ACADVL gene, or other DNA sequences that encode regulatory elements of a gene selected from the group consisting of the

ACADM gene, the HADHA gene, and the ACADVL gene, correcting, by HDR or

NHEJ, one or more mutations in or near a gene selected from the group consisting of the ACADM gene, the HADHA gene, and the ACADVL gene, or other DNA sequences that encode regulatory elements of a gene selected from the group consisting of the ACADM gene, the HADHA gene, and the ACADVL gene, or 3) deletion of the mutant region and/or knocking-in ACADM, HADHA, and/or ACADVL cDNA or a minigene (comprised of one or more exons or introns or natural or synthetic introns) or introducing exogenous DNA or cDNA sequence selected from the group consisting of exogenous ACADM DNA or cDNA sequence, exogenous

HADHA DNA or cDNA sequence, and ACADVL DNA or cDNA sequence, or a fragment thereof into the locus of the gene or at a heterologous location in the genome (such as a safe harbor locus, such as, e.g., targeting an AAVS1

(PPP1 R12C), an ALB gene, an Angptl3 gene, an ApoC3 gene, an ASGR2 gene, a

CCR5 gene, a FIX (F9) gene, a G6PC gene, a Gys2 gene, an HGD gene, a Lp(a) gene, a Pcsk9 gene, a Serpinal gene, a TF gene, and a TTR gene). Assessment of efficiency of HDR/NHEJ mediated knock-in of cDNA into the first exon can utilize cDNA knock-in into "safe harbor" sites such as: single-stranded or double-stranded

DNA having homologous arms to one of the following regions, for example: ApoC3 (ch 1 :1 16829908- 1 16833071 ), Angptl3 (chrl :62, 597,487-62,606, 305), Serpinal (chr14:94376747- 94390692), Lp(a) (chr6: 160531483-160664259), Pcsk9

(chr1 :55,039,475- 55,064,852), FIX (chrX:139,530,736-139,563,458), ALB

(chr4:73,404,254- 73,421 ,41 1 ), TTR (chrl 8:31 ,591 ,766-31 ,599,023), TF

(chr3:133,661 ,997- 133,779,005), G6PC (chr17:42, 900,796-42,914,432), Gys2 (chi 2:21 ,536, 188- 21 ,604,857), AAVS1 (PPP1 R12C) (chrl 9:55,090,912- 55,1 17,599), HGD (chr3: 120,628, 167-120,682,570), CCR5 (chr3:46,370,854- 46,376,206), ASGR2 (chi 7:7, 101 ,322-7,1 14,310)). Both the correction and knock- in strategies utilize a donor DNA template in Homology-Directed Repair (HDR) or Non-Homologous End Joining (NHEJ). HDR in either strategy may be

accomplished by making one or more single-stranded breaks (SSBs) or double- stranded breaks (DSBs) at specific sites in the genome by using one or more endonucleases.

[00183] For example, an NHEJ correction strategy involves restoring the reading frame in a gene selected from the group consisting of the ACADM gene, the HADHA gene, and the ACADVL gene by inducing one single stranded break or double stranded break in the gene of interest with one or more CRISPR

endonucleases and a gRNA (e.g., crRNA + tracrRNA, or sgRNA), or two or more single stranded breaks or double stranded breaks in the gene of interest with two or more CRISPR endonucleases and two or more sgRNAs. This approach can require development and optimization of sgRNAs for a gene selected from the group consisting of the ACADM gene, the HADHA gene, and the ACADVL gene.

[00184] For example, the HDR correction strategy involves restoring the reading frame in a gene selected from the group consisting of the ACADM gene, the

HADHA gene, and the ACADVL gene by inducing one single stranded break or double stranded break in the gene of interest with one or more CRISPR

endonucleases and a gRNA (e.g., crRNA + tracrRNA, or sg RNA), or two or more double stranded breaks in the gene of interest with one or more CRISPR

endonuclease and two or more appropriate sgRNAs, in the presence of a donor

DNA template introduced exogenously to direct the cellular DSB response to

Homology-Directed Repair (the donor DNA template can be a short single stranded oligonucleotide, a short double stranded oligonucleotide, a long single or double stranded DNA molecule). In some embodiments, this approach requires

development and optimization of gRNAS and donor DNA molecules for the major variant of the ACADM gene (A985G variant) or any of the other variants described in Figures 3A-3E. In some embodiments, this approach requires development and optimization of gRNAS and donor DNA molecules for the major variant of the HADHA gene (G1528C single nucleotide substitution) or any of the other variants described in Figures 4A and 4B. In some embodiments, this approach requires development and optimization of gRNAS and donor DNA molecules for variants of the ACADVL gene (for example, the T848C or A848T mutations). The T848C (also called V283A in the full length pre-processed protein or V243A in the mature protein) mutation is a common missense mutation correlated with the mild forms of VLCADD. The A848T mutation, which could account for 20-30% of VLCADD cases, results in dysfunctional VLCAD protein with residual enzyme activity 20-25% of wild-type enzyme activity (Andresen, The American Journal of Human Genetics 1999; Spiekerkoetter, The Journal of pediatrics 2003); Goetzman, Molecular genetics and metabolism 2007); Leslie in GeneReviews®; Schiff, Molecular genetics and metabolism 2013; Gregersen, European Journal of Biochemistry 2004; Banta-Wright, Newborn and Infant Nursing Reviews 2008; Boneh, Molecular genetics and metabolism 2006; Gobin-Limballe, Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease 2010; Gobin-Limballe, The American Journal of Human Genetics 2007). Over 80 mutations that cause clinical VLCADD have been identified (Leslie in GeneReviews®; Gobin-Limballe, Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease 2010; Gobin-Limballe, The American Journal of Human Genetics 2007) and can be classified as either null mutations or missense mutations (Goetzman, Molecular genetics and metabolism 2007); Leslie in

GeneReviews®; Schiff, Molecular genetics and metabolism 2013; Gregersen, European Journal of Biochemistry 2004; Banta-Wright, Newborn and Infant Nursing Reviews 2008; Boneh, Molecular genetics and metabolism 2006; Gobin-Limballe, Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease 2010; Gobin- Limballe, The American Journal of Human Genetics 2007; Strauss Proc. Nat. Acad. Sci. 1995). Premature termination codons, nonsense mutations, or frame shifts can cause a null mutation that results in completely absent VLCAD. Missense mutations, which can be caused by single nucleotide deletions, result in

dysfunctional VLCAD protein. The null mutations directly correlate with the severe childhood form, however the correlation between the missense mutations and the clinical phenotypes is not as well defined. Some missense mutations cause the severe form, whereas others cause the mild forms (Andresen, The American Journal of Human Genetics 1999; Spiekerkoetter, The Journal of pediatrics 2003); Goetzman, Molecular genetics and metabolism 2007); Leslie in GeneReviews®; Schiff, Molecular genetics and metabolism 2013; Gregersen, European Journal of Biochemistry 2004; Banta-Wright, Newborn and Infant Nursing Reviews 2008; Boneh, Molecular genetics and metabolism 2006; Gobin-Limballe, Biochimica et Biophysica Acta (BBA)-Molecular Basis of Disease 2010; Gobin-Limballe, The American Journal of Human Genetics 2007). One study reported that of 54

VLCADD patients, 71 % of patients with VLCADD-C had a null mutation, 82% of patients with VLCADD-H had a missense mutation, and 93% of patients with the adult form also had missense mutations (Andresen, The American Journal of Human Genetics 1999). Figures 5A-5N provide a list of additional disease-causing variants of the ACADVL gene.

[00185] For example, the knock-in strategy involves knocking-in cDNA selected from the group consisting of ACADM cDNA, HADHA cDNA, and ACADVL cDNA or a minigene (comprised of, natural or synthetic enhancer and promoter, one or more exons, and natural or synthetic introns, and natural or synthetic 3'UTR and polyadenylation signal) into the locus of the gene using a gRNA (e.g., crRNA + tracrRNA, sgRNA) or a pair of sgRNAs targeting upstream of or in the first or other exon and/or intron of a gene selected from the group consisting of the ACADM gene, the HADHA gene, and the ACADVL gene, or in a safe harbor site (such as AAVS1 (PPP1 R12C), ALB, Angptl3, ApoC3, ASGR2, CCR5, FIX (F9), G6PC, Gys2, HGD, Lp(a), Pcsk9, Serpinal , TF, and/or TTR)). In some embodiments, the donor DNA will be single or double stranded DNA having homologous arms to the 1 p31 .1 region. In some embodiments, the donor DNA will be single or double stranded DNA having homologous arms to the 17p13.1 region. In some

embodiments, the donor DNA will be single or double stranded DNA having homologous arms to the 2p23.3 region. [00186] For example, the deletion strategy involves deleting one or more mutations in one or more of the twelve exons of the ACADM gene using one or more endonucleases and two or more gRNAs or sgRNAs. In another example, the deletion strategy involves deleting one or more mutations in one or more of the twenty exons of the HADHA gene using one or more endonucleases and two or more gRNAs or sgRNAs. In yet another example, the deletion strategy involves deleting one or more mutations in one or more of the twenty exons of the ACADVL gene using one or more endonucleases and two or more gRNAs or sgRNAs.

[00187] The advantages for the above strategies (correction and knock-in and deletion) are similar, including in principle both short and long term beneficial clinical and laboratory effects. In addition, it may be that only a low percentage of activity, e.g., MCAD activity, LCHAD activity, and/or VLCAD activity is required to provide therapeutic benefit. Another advantage for all strategies is that most patients have low-level gene and protein activity, therefore suggesting that additional protein expression, for example following gene correction, should not necessarily lead to an immune response against the target gene product. The knock-in approach does provide one advantage over the correction or deletion approach - the ability to treat all patients versus only a subset of patients. While there are common mutations in this gene, there are also many other possible mutations, and using the knock-in method could treat all of them. The other issue with gene editing in this manner is the need for a DNA donor for HDR.

[00188] In addition to the above genome editing strategies, another strategy involves modulating expression, function, or activity of ACADM, HADHA, and/or ACADVL by editing in the regulatory sequence.

[00189] In addition to the editing options listed above, Cas9 or similar proteins can be used to target effector domains to the same target sites that may be identified for editing, or additional target sites within range of the effector domain. A range of chromatin modifying enzymes, methylases or demethlyases may be used to alter expression of the target gene. One possibility is increasing the expression of MCAD, TFP, LCHAD, and/or VLCAD if the mutation leads to lower activity. These types of epigenetic regulation have some advantages, particularly as they are limited in possible off-target effects

[00190] A number of types of genomic target sites are present in addition to mutations in the coding and splicing sequences.

[00191] The regulation of transcription and translation implicates a number of different classes of sites that interact with cellular proteins or nucleotides. Often the DNA binding sites of transcription factors or other proteins can be targeted for mutation or deletion to study the role of the site, though they can also be targeted to change gene expression. Sites can be added through non-homologous end joining (NHEJ) or direct genome editing by homology directed repair (HDR).

Increased use of genome sequencing, RNA expression and genome-wide studies of transcription factor binding have increased the ability to identify how the sites lead to developmental or temporal gene regulation. These control systems may be direct or may involve extensive cooperative regulation that can require the integration of activities from multiple enhancers. Transcription factors typically bind 6-12 bp-long degenerate DNA sequences. The low level of specificity provided by individual sites suggests that complex interactions and rules are involved in binding and the functional outcome. Binding sites with less degeneracy may provide simpler means of regulation. Artificial transcription factors can be designed to specify longer sequences that have less similar sequences in the genome and have lower potential for off-target cleavage. Any of these types of binding sites can be mutated, deleted or even created to enable changes in gene regulation or expression (Canver, M.C. et ai, Nature (2015)).

[00192] Another class of gene regulatory regions having these features is microRNA (miRNA) binding sites. miRNAs are non-coding RNAs that play key roles in post-transcriptional gene regulation. miRNA may regulate the expression of 30% of all mammalian protein-encoding genes. Specific and potent gene silencing by double stranded RNA (RNAi) was discovered, plus additional small noncoding RNA (Canver, M.C. et ai, Nature (2015)). The largest class of noncoding RNAs important for gene silencing are miRNAs. In mammals, miRNAs are first transcribed as a long RNA transcripts, which can be separate transcriptional units, part of protein introns, or other transcripts. The long transcripts are called primary miRNA (pri-miRNA) that include imperfectly base-paired hairpin structures. These pri- miRNA are cleaved into one or more shorter precursor miRNAs (pre-miRNAs) by Microprocessor, a protein complex in the nucleus, involving Drosha.

[00193] Pre-miRNAs are short stem loops -70 nucleotides in length with a 2- nucleotide 3'-overhang that are exported, into the mature 19-25 nucleotide miRNA:miRNA* duplexes. The miRNA strand with lower base pairing stability (the guide strand) is loaded onto the RNA-induced silencing complex (RISC). The passenger guide strand (marked with *), may be functional, but is usually degraded. The mature miRNA tethers RISC to partly complementary sequence motifs in target mRNAs predominantly found within the 3' untranslated regions (UTRs) and induces posttranscriptional gene silencing (Bartel, D.P. Cell 136, 215-233 (2009); Saj, A. & Lai, E.C. Curr Opin Genet Dev 21 , 504-510 (201 1 )).

[00194] miRNAs are important in development, differentiation, cell cycle and growth control, and in virtually all biological pathways in mammals and other multicellular organisms. miRNAs are also involved in cell cycle control, apoptosis and stem cell differentiation, hematopoiesis, hypoxia, muscle development, neurogenesis, insulin secretion, cholesterol metabolism, aging, viral replication and immune responses.

[00195] A single miRNA can target hundreds of different mRNA transcripts, while an individual transcript can be targeted by many different miRNAs. More than 28645 microRNAs have been annotated in the latest release of miRBase (v.21 ). Some miRNAs are encoded by multiple loci, some of which are expressed from tandemly co-transcribed clusters. The features allow for complex regulatory networks with multiple pathways and feedback controls. miRNAs are integral parts of these feedback and regulatory circuits and can help regulate gene expression by keeping protein production within limits (Herranz, H. & Cohen, S.M. Genes Dev 24, 1339-1344 (2010); Posadas, D.M. & Carthew, R.W. Curr Opin Genet Dev 27, 1 -6 (2014)).

[00196] miRNA are also important in a large number of human diseases that are associated with abnormal miRNA expression. This association underscores the importance of the miRNA regulatory pathway. Recent miRNA deletion studies have linked miRNA with regulation of the immune responses (Stern-Ginossar, N. et ai, Science 317, 376-381 (2007)).

[00197] miRNA also have a strong link to cancer and may play a role in different types of cancer. miRNAs have been found to be downregulated in a number of tumors. miRNA are important in the regulation of key cancer-related pathways, such as cell cycle control and the DNA damage response, and are therefore used in diagnosis and are being targeted clinically. MicroRNAs delicately regulate the balance of angiogenesis, such that experiments depleting all microRNAs suppresses tumor angiogenesis (Chen, S. et ai , Genes Dev 28, 1054-1067 (2014)).

[00198] As has been shown for protein coding genes, miRNA genes are also subject to epigenetic changes occurring with cancer. Many miRNA loci are associated with CpG islands increasing their opportunity for regulation by DNA methylation (Weber, B., Stresemann, C, Brueckner, B. & Lyko, F. Cell Cycle 6, 1001 -1005 (2007)). The majority of studies have used treatment with chromatin remodeling drugs to reveal epigenetically silenced miRNAs.

[00199] In addition to their role in RNA silencing, miRNA can also activate translation (Posadas, D.M. & Carthew, R.W. Curr Opin Genet Dev il, 1 -6 (2014)). Knocking out these sites may lead to decreased expression of the targeted gene, while introducing these sites may increase expression.

[00200] Individual miRNA can be knocked out most effectively by mutating the seed sequence (bases 2-8 of the microRNA), which is important for binding specificity. Cleavage in this region, followed by mis-repair by NHEJ can effectively abolish miRNA function by blocking binding to target sites. miRNA could also be inhibited by specific targeting of the special loop region adjacent to the palindromic sequence. Catalytically inactive Cas9 can also be used to inhibit shRNA expression (Zhao, Y. et al., Sci Rep 4, 3943 (2014)). In addition to targeting the miRNA, the binding sites can also be targeted and mutated to prevent the silencing by miRNA. [00201] Human Cells

[00202] For ameliorating MCADD, as described and illustrated herein, the principal targets for gene editing are human cells. For example, in the ex vivo methods, the human cells are somatic cells, which after being modified using the techniques as described, can give rise to hepatocytes or progenitor cells. For example, in the in vivo methods, the human cells are parenchymal cells found in the liver (e.g., hepatocytes), kidney (e.g., renal cells) or cells from other affected organs.

[00203] For ameliorating LCHADD, as described and illustrated herein, the principal targets for gene editing are human cells. For example, in the ex vivo methods, the human cells are somatic cells, which after being modified using the techniques as described, can give rise to hepatocytes or progenitor cells. For example, in the in vivo methods, the human cells are parenchymal cells found in the liver (e.g., hepatocytes), kidney cells (e.g., renal cells) or cells from other affected organs.

[00204] For ameliorating VLCADD, as described and illustrated herein, the principal targets for gene editing are human cells in which VLCAD is expressed such as cells in the heart, lung, adrenal, parathyroid, gallbladder and the gastrointestinal track, as well as cells in the liver (parenchymal liver cells) and in skeletal muscle (Human protein Atlas, available on the web at

proteinatlas.org/ENSG00000072778-ACADVL/tissue). For example, in the ex vivo methods, the human cells are somatic cells, which after being modified using the techniques as described, can give rise to hepatocytes or progenitor cells. For example, in some embodiments of the in vivo methods, the human cells are parenchymal cells found in the liver (e.g., hepatocytes) or cells from other affected organs.

[00205] By performing gene editing in autologous cells that are derived from and therefore already completely immunologically matched with the patient in need, it is possible to generate cells that can be safely re-introduced to the patient, and effectively give rise to a population of cells that are effective in ameliorating one or more clinical conditions associated with the patient's disease. [00206] Progenitor cells (also referred to as stem cells herein) are capable of both proliferation and giving rise to more progenitor cells, these in turn having the ability to generate a large number of mother cells that can in turn give rise to differentiated or differentiable daughter cells. The daughter cells themselves can be induced to proliferate and produce progeny that subsequently differentiate into one or more mature cell types, while also retaining one or more cells with parental developmental potential. The term "stem cell" refers then, to a cell with the capacity or potential, under particular circumstances, to differentiate to a more specialized or differentiated phenotype, and which retains the capacity, under certain

circumstances, to proliferate without substantially differentiating. In some embodiments, the term progenitor or stem cell refers to a generalized mother cell whose descendants (progeny) specialize, often in different directions, by

differentiation, e.g., by acquiring completely individual characters, as occurs in progressive diversification of embryonic cells and tissues. Cellular differentiation is a complex process typically occurring through many cell divisions. A differentiated cell may derive from a multipotent cell that itself is derived from a multipotent cell, and so on. While each of these multipotent cells may be considered stem cells, the range of cell types that each can give rise to may vary considerably. Some differentiated cells also have the capacity to give rise to cells of greater

developmental potential. Such capacity may be natural or may be induced artificially upon treatment with various factors. In many biological instances, stem cells are also "multipotent" because they can produce progeny of more than one distinct cell type, but this is not required for "stem-ness."

[00207] Self-renewal is another important aspect of the stem cell. In theory, self- renewal can occur by either of two major mechanisms. Stem cells may divide asymmetrically, with one daughter retaining the stem state and the other daughter expressing some distinct other specific function and phenotype. Alternatively, some of the stem cells in a population can divide symmetrically into two stems, thus maintaining some stem cells in the population as a whole, while other cells in the population give rise to differentiated progeny only. Generally, "progenitor cells" have a cellular phenotype that is more primitive (i.e., is at an earlier step along a developmental pathway or progression than is a fully differentiated cell). Often, progenitor cells also have significant or very high proliferative potential. Progenitor cells can give rise to multiple distinct differentiated cell types or to a single differentiated cell type, depending on the developmental pathway and on the environment in which the cells develop and differentiate.

[00208] In the context of cell ontogeny, the adjective "differentiated," or

"differentiating" is a relative term. A "differentiated cell" is a cell that has progressed further down the developmental pathway than the cell to which it is being

compared. Thus, stem cells can differentiate into lineage-restricted precursor cells (such as a myocyte progenitor cell), which in turn can differentiate into other types of precursor cells further down the pathway (such as a myocyte precursor), and then to an end-stage differentiated cell, such as a myocyte, which plays a characteristic role in a certain tissue type, and may or may not retain the capacity to proliferate further.

[00209] Induced Pluripotent Stem Cells

[00210] In some embodiments, the genetically engineered human cells described herein are induced pluripotent stem cells (iPSCs). An advantage of using iPSCs is that the cells can be derived from the same subject to which the progenitor cells are to be administered. That is, a somatic cell can be obtained from a subject, reprogrammed to an induced pluripotent stem cell, and then re-differentiated into a progenitor cell to be administered to the subject (e.g., autologous cells). Because the progenitors are essentially derived from an autologous source, the risk of engraftment rejection or allergic response is reduced compared to the use of cells from another subject or group of subjects. In addition, the use of iPSCs negates the need for cells obtained from an embryonic source. Thus, in some embodiments, the stem cells used in the disclosed methods are not embryonic stem cells.

[00211] Although differentiation is generally irreversible under physiological contexts, several methods have been recently developed to reprogram somatic cells to iPSCs. Exemplary methods are known to those of skill in the art and are described briefly herein below.

[00212] The term "reprogramming" refers to a process that alters or reverses the differentiation state of a differentiated cell (e.g., a somatic cell). Stated another way, reprogramming refers to a process of driving the differentiation of a cell backwards to a more undifferentiated or more primitive type of cell. It should be noted that placing many primary cells in culture can lead to some loss of fully differentiated characteristics. Thus, simply culturing such cells included in the term differentiated cells does not render these cells non-differentiated cells (e.g., undifferentiated cells) or pluripotent cells. The transition of a differentiated cell to pluripotency requires a reprogramming stimulus beyond the stimuli that lead to partial loss of differentiated character in culture. Reprogrammed cells also have the characteristic of the capacity of extended passaging without loss of growth potential, relative to primary cell parents, which generally have capacity for only a limited number of divisions in culture.

[00213] The cell to be reprogrammed can be either partially or terminally differentiated prior to reprogramming. In some embodiments, reprogramming encompasses complete reversion of the differentiation state of a differentiated cell (e.g., a somatic cell) to a pluripotent state or a multipotent state. In some

embodiments, reprogramming encompasses complete or partial reversion of the differentiation state of a differentiated cell (e.g., a somatic cell) to an

undifferentiated cell (e.g., an embryonic-like cell). Reprogramming can result in expression of particular genes by the cells, the expression of which further contributes to reprogramming. In certain embodiments described herein, reprogramming of a differentiated cell (e.g., a somatic cell) causes the differentiated cell to assume an undifferentiated state (e.g., is an undifferentiated cell). The resulting cells are referred to as "reprogrammed cells," or "induced pluripotent stem cells (iPSCs or iPS cells)."

[00214] Reprogramming can involve alteration, e.g., reversal, of at least some of the heritable patterns of nucleic acid modification (e.g., methylation), chromatin condensation, epigenetic changes, genomic imprinting, etc., that occur during cellular differentiation. Reprogramming is distinct from simply maintaining the existing undifferentiated state of a cell that is already pluripotent or maintaining the existing less than fully differentiated state of a cell that is already a multipotent cell

(e.g., a myogenic stem cell). Reprogramming is also distinct from promoting the self-renewal or proliferation of cells that are already pluripotent or multipotent, although the compositions and methods described herein can also be of use for such purposes, in some embodiments.

[00215] Many methods are known in the art that can be used to generate pluripotent stem cells from somatic cells. Any such method that reprograms a somatic cell to the pluripotent phenotype would be appropriate for use in the methods described herein.

[00216] Reprogramming methodologies for generating pluripotent cells using defined combinations of transcription factors have been described. Mouse somatic cells can be converted to ES cell-like cells with expanded developmental potential by the direct transduction of Oct4, Sox2, Klf4, and c-Myc; see, e.g., Takahashi and Yamanaka, Cell 126(4): 663-76 (2006). iPSCs resemble ES cells, as they restore the pluripotency-associated transcriptional circuitry and much of the epigenetic landscape. In addition, mouse iPSCs satisfy all the standard assays for

pluripotency: specifically, in vitro differentiation into cell types of the three germ layers, teratoma formation, contribution to chimeras, germline transmission [see, e.g., Maherali and Hochedlinger, Cell Stem Cell. 3(6):595-605 (2008)], and tetraploid complementation.

[00217] Human iPSCs can be obtained using similar transduction methods, and the transcription factor trio, OCT4, SOX2, and NANOG, has been established as the core set of transcription factors that govern pluripotency; see, e.g. , Budniatzky and Gepstein, Stem Cells TransI Med. 3(4):448-57 (2014); Barrett et ai., Stem Cells Trans Med 3: 1 -6 sctm.2014-0121 (2014); Focosi et ai., Blood Cancer Journal 4: e21 1 (2014); and references cited therein. The production of iPSCs can be achieved by the introduction of nucleic acid sequences encoding stem cell- associated genes into an adult, somatic cell, historically using viral vectors.

[00218] iPSCs can be generated or derived from terminally differentiated somatic cells, as well as from adult stem cells, or somatic stem cells. That is, a non- pluripotent progenitor cell can be rendered pluripotent or multipotent by

reprogramming. In such instances, it may not be necessary to include as many reprogramming factors as required to reprogram a terminally differentiated cell. Further, reprogramming can be induced by the non-viral introduction of reprogramming factors, e.g., by introducing the proteins themselves, or by introducing nucleic acids that encode the reprogramming factors, or by introducing messenger RNAs that upon translation produce the reprogramming factors (see e.g., Warren et al., Cell Stem Cell, 7(5):618-30 (2010). Reprogramming can be achieved by introducing a combination of nucleic acids encoding stem cell- associated genes, including, for example, Oct-4 (also known as Oct-3/4 or Pouf51 ), Soxl, Sox2, Sox3, Sox 15, Sox 18, NANOG, Klfl, Klf2, Klf4, Klf5, NR5A2, c-Myc, 1 - Myc, n-Myc, Rem2, Tert, and LIN28. In some embodiments, reprogramming using the methods and compositions described herein can further comprise introducing one or more of Oct-3/4, a member of the Sox family, a member of the Klf family, and a member of the Myc family to a somatic cell. In some embodiments, the methods and compositions described herein further comprise introducing one or more of each of Oct-4, Sox2, Nanog, c-MYC and Klf4 for reprogramming. As noted above, the exact method used for reprogramming is not necessarily critical to the methods and compositions described herein. However, where cells differentiated from the reprogrammed cells are to be used in, e.g., human therapy, in some embodiments, the reprogramming is not effected by a method that alters the genome. Thus, in such embodiments, reprogramming is achieved, e.g., without the use of viral or plasmid vectors.

[00219] The efficiency of reprogramming (i.e., the number of reprogrammed cells) derived from a population of starting cells can be enhanced by the addition of various agents, e.g., small molecules, as shown by Shi et al. , Cell-Stem Cell 2:525- 528 (2008); Huangfu et al., Nature Biotechnology 26(7):795-797 (2008) and Marson et al., Cell-Stem Cell 3: 132-135 (2008). Thus, an agent or combination of agents that enhance the efficiency or rate of induced pluripotent stem cell production can be used in the production of patient-specific or disease-specific iPSCs. Some non-limiting examples of agents that enhance reprogramming efficiency include soluble Wnt, Wnt conditioned media, BIX-01294 (a G9a histone methyltransferase), PD0325901 (a MEK inhibitor), DNA methyltransferase inhibitors, histone deacetylase (HDAC) inhibitors, valproic acid, 5'-azacytidine, dexamethasone, suberoylanilide, hydroxamic acid (SAHA), vitamin C, and trichostatin (TSA), among others. [00220] Other non-limiting examples of reprogramming enhancing agents include: Suberoylanilide Hydroxamic Acid (SAHA (e.g., MK0683, vorinostat) and other hydroxamic acids), BML-210, Depudecin (e.g., (-)-Depudecin), HC Toxin, Nullscript (4-(l,3-Dioxo-IH,3H-benzo[de]isoquinolin-2-yl)-N-hydroxybutanamide), Phenylbutyrate (e.g., sodium phenylbutyrate) and Valproic Acid ((VP A) and other short chain fatty acids), Scriptaid, Suramin Sodium, Trichostatin A (TSA), APHA Compound 8, Apicidin, Sodium Butyrate, pivaloyloxymethyl butyrate (Pivanex, AN- 9), Trapoxin B, Chlamydocin, Depsipeptide (also known as FR901228 or FK228), benzamides (e.g., CI-994 (e.g., N-acetyl dinaline) and MS-27-275), MGCD0103, NVP-LAQ-824, CBHA (m-carboxycinnaminic acid bishydroxamic acid),

JNJ16241 199, Tubacin, A-161906, proxamide, oxamflatin, 3-CI-UCHA (e.g., 6-(3- chlorophenylureido)caproic hydroxamic acid), AOE (2-amino-8-oxo-9, 10- epoxydecanoic acid), CHAP31 and CHAP 50. Other reprogramming enhancing agents include, for example, dominant negative forms of the HDACs (e.g., catalytically inactive forms), siRNA inhibitors of the HDACs, and antibodies that specifically bind to the HDACs. Such inhibitors are available, e.g., from BIOMOL International, Fukasawa, Merck Biosciences, Novartis, Gloucester

Pharmaceuticals, Titan Pharmaceuticals, MethylGene, and Sigma Aldrich.

[00221] To confirm the induction of pluripotent stem cells for use with the methods described herein, isolated clones can be tested for the expression of a stem cell marker. Such expression in a cell derived from a somatic cell identifies the cells as induced pluripotent stem cells. Stem cell markers are selected from the non-limiting group including SSEA3, SSEA4, CD9, Nanog, Fbxl5, EcatI, Esgl, Eras, Gdf3, Fgf4, Cripto, Daxl, Zpf296, Slc2a3, Rexl, Utfl, and Natl. In one case, for example, a cell that expresses Oct4 or Nanog is identified as pluripotent. Methods for detecting the expression of such markers can include, for example, RT-PCR and immunological methods that detect the presence of the encoded polypeptides, such as Western blots or flow cytometric analyses. In some embodiments, detection involves not only RT-PCR, but also includes detection of protein markers. Intracellular markers may be best identified via RT-PCR, or protein detection methods such as immunocytochemistry, while cell surface markers are readily identified, e.g., by immunocytochemistry. [00222] The pluripotent stem cell character of isolated cells can be confirmed by tests evaluating the ability of the iPSCs to differentiate into cells of each of the three germ layers. As one example, teratoma formation in nude mice can be used to evaluate the pluripotent character of the isolated clones. The cells are introduced into nude mice and histology and/or immunohistochemistry is performed on a tumor arising from the cells. The growth of a tumor comprising cells from all three germ layers, for example, further indicates that the cells are pluripotent stem cells.

[00223] Hepatocytes

[00224] In some embodiments, the genetically engineered human cells described herein are hepatocytes. A hepatocyte is a cell of the main parenchymal tissue of the liver. Hepatocytes make up 70-85% of the liver's mass. These cells are involved in: protein synthesis; protein storage; transformation of carbohydrates; synthesis of cholesterol, bile salts and phospholipids; detoxification, modification, and excretion of exogenous and endogenous substances; and initiation of formation and secretion of bile.

[00225] ACADM, HADHA, and ACADVL are primarily expressed in hepatocytes (parenchymal liver cells), which are a major source of circulating protein, with secondary expression in monocytes and neutrophils. Therefore, the correction of ACADM, HADHA, and/or ACADVL would be primarily targeted at hepatocytes and the liver.

[00226] Creating patient specific iPSCs

[00227] One step of the ex vivo methods of the present disclosure involves creating a patient specific iPS cell, patient specific iPS cells, or a patient specific iPS cell line. There are many established methods in the art for creating patient specific iPS cells, as described in Takahashi and Yamanaka 2006; Takahashi, Tanabe et al. 2007. For example, the creating step comprises: a) isolating a somatic cell, such as a skin cell or fibroblast from the patient; and b) introducing a set of pluripotency-associated genes into the somatic cell in order to induce the cell to become a pluripotent stem cell. In some embodiments, the set of pluripotency- associated genes is one or more of the genes selected from the group consisting of OCT4, SOX2, KLF4, Lin28, NANOG, and cMYC. [00228] Performing a biopsy or aspirate of the patient's liver or bone marrow

[00229] A biopsy or aspirate is a sample of tissue or fluid taken from the body. There are many different kinds of biopsies or aspirates. Nearly all of them involve using a sharp tool to remove a small amount of tissue. If the biopsy will be on the skin or other sensitive area, numbing medicine is applied first. A biopsy or aspirate may be performed according to any of the known methods in the art. For example, in a liver biopsy, a needle is injected into the liver through the skin of the belly, capturing the liver tissue. For example, in a bone marrow aspirate, a large needle is used to enter the pelvis bone to collect bone marrow.

[00230] Isolating a liver specific progenitor cell or primary hepatocyte

[00231] Liver specific progenitor cells and primary hepatocytes may be isolated according to any method known in the art. For example, human hepatocytes are isolated from fresh surgical specimens. Healthy liver tissue is used to isolate hepatocytes by collagenase digestion. The obtained cell suspension is filtered through a 100-mm nylon mesh and sedimented by centrifugation at 50g for 5 minutes, resuspended, and washed two to three times in cold wash medium.

Human liver stem cells are obtained by culturing under stringent conditions of hepatocytes obtained from fresh liver preparations. Hepatocytes seeded on collagen-coated plates are cultured for 2 weeks. After 2 weeks, surviving cells are removed, and characterized for expression of stem cells markers (Herrera et al, STEM CELLS 2006;24: 2840 -2850).

[00232] Isolating a mesenchymal stem cell

[00233] Mesenchymal stem cells may be isolated according to any method known in the art, such as from a patient's bone marrow or peripheral blood. For example, marrow aspirate is collected into a syringe with heparin. Cells are washed and centrifuged on a Percoll™. The cells are cultured in Dulbecco's modified Eagle's medium (DMEM) (low glucose) containing 10% fetal bovine serum (FBS) (Pittinger MF, Mackay AM, Beck SC et al., Science 1999; 284: 143-147). [00234] Genome Editing

[00235] Genome editing generally refers to the process of modifying the nucleotide sequence of a genome, preferably in a precise or pre-determined manner. Examples of methods of genome editing described herein include methods of using site-directed nucleases to cut deoxyribonucleic acid (DNA) at precise target locations in the genome, thereby creating single-strand or double- strand DNA breaks at particular locations within the genome. Such breaks can be and regularly are repaired by natural, endogenous cellular processes, such as homology-directed repair (HDR) and non-homologous end-joining (NHEJ), as recently reviewed in Cox et al., Nature Medicine 21 (2), 121 -31 (2015). These two main DNA repair processes consist of a family of alternative pathways. NHEJ directly joins the DNA ends resulting from a double-strand break, sometimes with the loss or addition of nucleotide sequence, which may disrupt or enhance gene expression. HDR utilizes a homologous sequence, or donor sequence, as a template for inserting a defined DNA sequence at the break point. The homologous sequence may be in the endogenous genome, such as a sister chromatid.

Alternatively, the donor may be an exogenous nucleic acid, such as a plasmid, a single-strand oligonucleotide, a double-stranded oligonucleotide, a duplex oligonucleotide or a virus, that has regions of high homology with the nuclease- cleaved locus, but which may also contain additional sequence or sequence changes including deletions that can be incorporated into the cleaved target locus. A third repair mechanism is microhomology-mediated end joining (MMEJ), also referred to as "Alternative NHEJ", in which the genetic outcome is similar to NHEJ in that small deletions and insertions can occur at the cleavage site. MMEJ makes use of homologous sequences of a few basepairs flanking the DNA break site to drive a more favored DNA end joining repair outcome, and recent reports have further elucidated the molecular mechanism of this process; see, e.g., Cho and Greenberg, Nature 518, 174-76 (2015); Kent ef al. , Nature Structural and Molecular Biology, Adv. Online doi: 10.1038/nsmb.2961 (2015); Mateos-Gomez et al., Nature 518, 254-57 (2015); Ceccaldi et al., Nature 528, 258-62 (2015). In some instances it may be possible to predict likely repair outcomes based on analysis of potential microhomologies at the site of the DNA break. [00236] Each of these genome editing mechanisms can be used to create desired genomic alterations. A step in the genome editing process is to create one or two DNA breaks, the latter as double-strand breaks or as two single-stranded breaks, in the target locus as close as possible to the site of intended mutation. This can be achieved via the use of site-directed polypeptides, as described and illustrated herein.

[00237] Site-directed polypeptides, such as a DNA endonuclease, can introduce double-strand breaks or single-strand breaks in nucleic acids, e.g., genomic DNA. The double-strand break can stimulate a cell's endogenous DNA-repair pathways (e.g., homology-dependent repair or non-homologous end joining or alternative non-homologous end joining (A-NHEJ) or microhomology-mediated end joining). NHEJ can repair cleaved target nucleic acid without the need for a homologous template. This can sometimes result in small deletions or insertions (indels) in the target nucleic acid at the site of cleavage, and can lead to disruption or alteration of gene expression. HDR can occur when a homologous repair template, or donor, is available. The homologous donor template comprises sequences that are homologous to sequences flanking the target nucleic acid cleavage site. The sister chromatid is generally used by the cell as the repair template. However, for the purposes of genome editing, the repair template is often supplied as an exogenous nucleic acid, such as a plasmid, duplex oligonucleotide, single-strand

oligonucleotide, double-stranded oligonucleotide, or viral nucleic acid. With exogenous donor templates, it is common to introduce an additional nucleic acid sequence (such as a transgene) or modification (such as a single or multiple base change or a deletion) between the flanking regions of homology so that the additional or altered nucleic acid sequence also becomes incorporated into the target locus. MMEJ results in a genetic outcome that is similar to NHEJ in that small deletions and insertions can occur at the cleavage site. MMEJ makes use of homologous sequences of a few basepairs flanking the cleavage site to drive a favored end-joining DNA repair outcome. In some instances it may be possible to predict likely repair outcomes based on analysis of potential microhomologies in the nuclease target regions. [00238] Thus, in some cases, either non-homologous end joining or homologous recombination is used to insert an exogenous polynucleotide sequence into the target nucleic acid cleavage site. An exogenous polynucleotide sequence is termed a donor polynucleotide (or donor or donor sequence or polynucleotide donor template) herein. In some embodiments, the donor polynucleotide, a portion of the donor polynucleotide, a copy of the donor polynucleotide, or a portion of a copy of the donor polynucleotide is inserted into the target nucleic acid cleavage site. In some embodiments, the donor polynucleotide is an exogenous polynucleotide sequence, i.e., a sequence that does not naturally occur at the target nucleic acid cleavage site.

[00239] The modifications of the target DNA due to NHEJ and/or HDR can lead to, for example, mutations, deletions, alterations, integrations, gene correction, gene replacement, gene tagging, transgene insertion, nucleotide deletion, gene disruption, translocations and/or gene mutation. The processes of deleting genomic DNA and integrating non-native nucleic acid into genomic DNA are examples of genome editing.

[00240] CRISPR Endonuclease System

[00241] A CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) genomic locus can be found in the genomes of many prokaryotes (e.g., bacteria and archaea). In prokaryotes, the CRISPR locus encodes products that function as a type of immune system to help defend the prokaryotes against foreign invaders, such as virus and phage. There are three stages of CRISPR locus function:

integration of new sequences into the CRISPR locus, expression of CRISPR RNA (crRNA), and silencing of foreign invader nucleic acid. Five types of CRISPR systems (e.g., Type I, Type II, Type III, Type U, and Type V) have been identified.

[00242] A CRISPR locus includes a number of short repeating sequences referred to as "repeats." When expressed, the repeats can form secondary structures (e.g., hairpins) and/or comprise unstructured single-stranded sequences. The repeats usually occur in clusters and frequently diverge between species. The repeats are regularly interspaced with unique intervening sequences referred to as "spacers," resulting in a repeat-spacer-repeat locus architecture. The spacers are identical to or have high homology with known foreign invader sequences. A spacer-repeat unit encodes a crisprRNA (crRNA), which is processed into a mature form of the spacer-repeat unit. A crRNA comprises a "seed" or spacer sequence that is involved in targeting a target nucleic acid (in the naturally occurring form in prokaryotes, the spacer sequence targets the foreign invader nucleic acid). A spacer sequence is located at the 5' or 3' end of the crRNA.

[00243] A CRISPR locus also comprises polynucleotide sequences encoding CRISPR Associated (Cas) genes. Cas genes encode endonucleases involved in the biogenesis and the interference stages of crRNA function in prokaryotes. Some Cas genes comprise homologous secondary and/or tertiary structures.

[00244] Type II CRISPR Systems

[00245] crRNA biogenesis in a Type II CRISPR system in nature requires a trans-activating CRISPR RNA (tracrRNA). The tracrRNA is modified by

endogenous RNaselll, and then hybridizes to a crRNA repeat in the pre-crRNA array. Endogenous RNaselll is recruited to cleave the pre-crRNA. Cleaved crRNAs are subjected to exoribonuclease trimming to produce the mature crRNA form (e.g., 5' trimming). The tracrRNA remains hybridized to the crRNA, and the tracrRNA and the crRNA associate with a site-directed polypeptide (e.g., Cas9). The crRNA of the crRNA-tracrRNA-Cas9 complex guides the complex to a target nucleic acid to which the crRNA can hybridize. Hybridization of the crRNA to the target nucleic acid activates Cas9 for targeted nucleic acid cleavage. The target nucleic acid in a Type II CRISPR system is referred to as a protospacer adjacent motif (PAM). In nature, the PAM is essential to facilitate binding of a site-directed polypeptide (e.g. , Cas9) to the target nucleic acid. Type II systems (also referred to as Nmeni or CASS4) are further subdivided into Type ll-A (CASS4) and ll-B (CASS4a). Jinek et ai, Science, 337(6096):816-821 (2012) showed that the CRISPR/Cas9 system is useful for RNA-programmable genome editing, and international patent application publication number WO2013/176772 provides numerous examples and

applications of the CRISPR/Cas endonuclease system for site-specific gene editing. [00246] Type V CRISPR Systems

[00247] Type V CRISPR systems have several important differences from Type II systems. For example, Cpf1 is a single RNA-guided endonuclease that, in contrast to Type II systems, lacks tracrRNA. In fact, Cpf1 -associated CRISPR arrays are processed into mature crRNAS without the requirement of an additional trans-activating tracrRNA. The Type V CRISPR array is processed into short mature crRNAs of 42-44 nucleotides in length, with each mature crRNA beginning with 19 nucleotides of direct repeat followed by 23-25 nucleotides of spacer sequence. In contrast, mature crRNAs in Type II systems start with 20-24 nucleotides of spacer sequence followed by about 22 nucleotides of direct repeat. Also, Cpf1 utilizes a T-rich protospacer-adjacent motif such that Cpf1 -crRNA complexes efficiently cleave target DNA preceded by a short T-rich PAM, which is in contrast to the G-rich PAM following the target DNA for Type II systems. Thus, Type V systems cleave at a point that is distant from the PAM, while Type II systems cleave at a point that is adjacent to the PAM. In addition, in contrast to Type II systems, Cpf1 cleaves DNA via a staggered DNA double-stranded break with a 4 or 5 nucleotide 5' overhang. Type II systems cleave via a blunt double- stranded break. Similar to Type II systems, Cpf1 contains a predicted RuvC-like endonuclease domain, but lacks a second HNH endonuclease domain, which is in contrast to Type II systems.

[00248] Cas Genes/Polypeptides and Protospacer Adjacent Motifs

[00249] Exemplary CRISPR/Cas polypeptides include the Cas9 polypeptides in Fig. 1 of Fonfara et al., Nucleic Acids Research, 42: 2577-2590 (2014). The CRISPR/Cas gene naming system has undergone extensive rewriting since the Cas genes were discovered. Fig. 5 of Fonfara, supra, provides PAM sequences for the Cas9 polypeptides from various species.

[00250] Site-Directed Polypeptides

[00251] A site-directed polypeptide is a nuclease used in genome editing to cleave DNA. The site-directed polypeptide may be administered to a cell or a patient as either: one or more polypeptides, or one or more mRNAs encoding the polypeptide. [00252] In the context of a CRISPR/Cas9 or CRISPR/Cpf1 system, the site- directed polypeptide can bind to a guide RNA that, in turn, specifies the site in the target DNA to which the polypeptide is directed. In embodiments of CRISPR/Cas9 or CRISPR/Cpf1 systems herein, the site-directed polypeptide is an endonuclease, such as a DNA endonuclease.

[00253] In some embodiments, a site-directed polypeptide comprises a plurality of nucleic acid-cleaving (i.e., nuclease) domains. Two or more nucleic acid-cleaving domains can be linked together via a linker. In some embodiments, the linker comprises a flexible linker. In some embodiments, linkers comprise 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 30, 35, 40 or more amino acids in length.

[00254] Naturally-occurring wild-type Cas9 enzymes comprise two nuclease domains, a HNH nuclease domain and a RuvC domain. Herein, the "Cas9" refers to both naturally-occurring and recombinant Cas9s. Cas9 enzymes contemplated herein comprises a HNH or HNH-like nuclease domain, and/or a RuvC or RuvC-like nuclease domain.

[00255] HNH or HNH-like domains comprise a McrA-like fold. HNH or HNH-like domains comprises two antiparallel β-strands and an a-helix. HNH or HNH-like domains comprises a metal binding site (e.g., a divalent cation binding site). HNH or HNH-like domains can cleave one strand of a target nucleic acid (e.g., the complementary strand of the crRNA targeted strand).

[00256] RuvC or RuvC-like domains comprise an RNaseH or RNaseH-like fold. RuvC/RNaseH domains are involved in a diverse set of nucleic acid-based functions including acting on both RNA and DNA. The RNaseH domain comprises 5 β-strands surrounded by a plurality of a-helices. RuvC/RNaseH or

RuvC/RNaseH-like domains comprise a metal binding site (e.g., a divalent cation binding site). RuvC/RNaseH or RuvC/RNaseH-like domains can cleave one strand of a target nucleic acid (e.g., the non-complementary strand of a double-stranded target DNA).

[00257] Site-directed polypeptides can introduce double-strand breaks or single- strand breaks in nucleic acids, e.g., genomic DNA. The double-strand break can stimulate a cell's endogenous DNA-repair pathways (e.g., homology-dependent repair (HDR) or non-homologous end joining (NHEJ) or alternative non-homologous end joining (A-NHEJ) or microhomology-mediated end joining (MMEJ)). NHEJ can repair cleaved target nucleic acid without the need for a homologous template. This can sometimes result in small deletions or insertions (indels) in the target nucleic acid at the site of cleavage, and can lead to disruption or alteration of gene expression. HDR can occur when a homologous repair template, or donor, is available. The homologous donor template comprises sequences that are homologous to sequences flanking the target nucleic acid cleavage site. The sister chromatid is generally used by the cell as the repair template. However, for the purposes of genome editing, the repair template is often supplied as an exogenous nucleic acid, such as a plasmid, duplex oligonucleotide, single-strand

oligonucleotide or viral nucleic acid. With exogenous donor templates, it is common to introduce an additional nucleic acid sequence (such as a transgene) or modification (such as a single or multiple base change or a deletion) between the flanking regions of homology so that the additional or altered nucleic acid sequence also becomes incorporated into the target locus. MMEJ results in a genetic outcome that is similar to NHEJ in that small deletions and insertions can occur at the cleavage site. MMEJ makes use of homologous sequences of a few basepairs flanking the cleavage site to drive a favored end-joining DNA repair outcome. In some instances it may be possible to predict likely repair outcomes based on analysis of potential microhomologies in the nuclease target regions.

[00258] Thus, in some cases, homologous recombination is used to insert an exogenous polynucleotide sequence into the target nucleic acid cleavage site. An exogenous polynucleotide sequence is termed a donor polynucleotide (or donor or donor sequence) herein. In some embodiments, the donor polynucleotide, a portion of the donor polynucleotide, a copy of the donor polynucleotide, or a portion of a copy of the donor polynucleotide is inserted into the target nucleic acid cleavage site. In some embodiments, the donor polynucleotide is an exogenous

polynucleotide sequence, i.e., a sequence that does not naturally occur at the target nucleic acid cleavage site. [00259] The modifications of the target DNA due to NHEJ and/or HDR can lead to, for example, mutations, deletions, alterations, integrations, gene correction, gene replacement, gene tagging, transgene insertion, nucleotide deletion, gene disruption, translocations and/or gene mutation. The processes of deleting genomic DNA and integrating non-native nucleic acid into genomic DNA are examples of genome editing.

[00260] In some embodiments, the site-directed polypeptide comprises an amino acid sequence having at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% amino acid sequence identity to a wild-type exemplary site-directed polypeptide [e.g., Cas9 from S.

pyogenes, US2014/0068797 Sequence ID No. 8 or Sapranauskas et ai, Nucleic Acids Res, 39(21 ): 9275-9282 (201 1 )], and various other site-directed polypeptides. In some embodiments, the site-directed polypeptide comprises at least 70, 75, 80, 85, 90, 95, 97, 99, or 100% identity to a wild-type site-directed polypeptide (e.g., Cas9 from S. pyogenes, supra) over 10 contiguous amino acids.

[00261] In some embodiments, the site-directed polypeptide comprises an amino acid sequence having at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% amino acid sequence identity to the nuclease domain of a wild-type exemplary site-directed polypeptide (e.g., Cas9 from S. pyogenes, supra).

[00262] In some embodiments, the site-directed polypeptide comprises at most: 70, 75, 80, 85, 90, 95, 97, 99, or 100% identity to a wild-type site-directed polypeptide (e.g., Cas9 from S. pyogenes, supra) over 10 contiguous amino acids. In some embodiments, the site-directed polypeptide comprises at least: 70, 75, 80, 85, 90, 95, 97, 99, or 100% identity to a wild-type site-directed polypeptide (e.g., Cas9 from S. pyogenes, supra) over 10 contiguous amino acids in a HNH nuclease domain of the site-directed polypeptide. In some embodiments, the site-directed polypeptide comprises at most: 70, 75, 80, 85, 90, 95, 97, 99, or 100% identity to a wild-type site-directed polypeptide (e.g., Cas9 from S. pyogenes, supra) over 10 contiguous amino acids in a HNH nuclease domain of the site-directed polypeptide. In some embodiments, the site-directed polypeptide comprises at least: 70, 75, 80, 85, 90, 95, 97, 99, or 100% identity to a wild-type site-directed polypeptide (e.g., Cas9 from S. pyogenes, supra) over 10 contiguous amino acids in a RuvC nuclease domain of the site-directed polypeptide. In some embodiments, the site- directed polypeptide comprises at most: 70, 75, 80, 85, 90, 95, 97, 99, or 100% identity to a wild-type site-directed polypeptide (e.g., Cas9 from S. pyogenes, supra) over 10 contiguous amino acids in a RuvC nuclease domain of the site- directed polypeptide.

[00263] In some embodiments, the site-directed polypeptide comprises a modified form of a wild-type exemplary site-directed polypeptide. In some embodiments, the modified form of the wild- type exemplary site-directed polypeptide comprises a mutation that reduces the nucleic acid-cleaving activity of the site-directed polypeptide. In some embodiments, the modified form of the wild- type exemplary site-directed polypeptide has less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, or less than 1 % of the nucleic acid-cleaving activity of the wild-type exemplary site-directed polypeptide (e.g., Cas9 from S. pyogenes, supra). In some embodiments, the modified form of the site-directed polypeptide has no substantial nucleic acid-cleaving activity. When a site-directed polypeptide is a modified form that has no substantial nucleic acid-cleaving activity, it is referred to herein as "enzymatically inactive."

[00264] In some embodiments, the modified form of the site-directed polypeptide comprises a mutation such that it can induce a single-strand break (SSB) on a target nucleic acid (e.g., by cutting only one of the sugar-phosphate backbones of a double-strand target nucleic acid). In some embodiments, the mutation results in less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, or less than

1 % of the nucleic acid-cleaving activity in one or more of the plurality of nucleic acid-cleaving domains of the wild-type site directed polypeptide (e.g., Cas9 from S. pyogenes, supra). In some embodiments, the mutation results in one or more of the plurality of nucleic acid-cleaving domains retaining the ability to cleave the complementary strand of the target nucleic acid, but reducing its ability to cleave the non-complementary strand of the target nucleic acid. In some embodiments, the mutation results in one or more of the plurality of nucleic acid-cleaving domains retaining the ability to cleave the non-complementary strand of the target nucleic acid, but reducing its ability to cleave the complementary strand of the target nucleic acid. For example, residues in the wild-type exemplary S. pyogenes Cas9 polypeptide, such as Asp10, His840, Asn854 and Asn856, are mutated to inactivate one or more of the plurality of nucleic acid-cleaving domains (e.g., nuclease domains). In some embodiments, the residues to be mutated correspond to residues Asp10, His840, Asn854 and Asn856 in the wild-type exemplary S.

pyogenes Cas9 polypeptide (e.g., as determined by sequence and/or structural alignment). Non-limiting examples of mutations include D10A, H840A, N854A or N856A. One skilled in the art will recognize that mutations other than alanine substitutions are suitable.

[00265] In some embodiments, a D10A mutation is combined with one or more of H840A, N854A, or N856A mutations to produce a site-directed polypeptide substantially lacking DNA cleavage activity. In some embodiments, a H840A mutation is combined with one or more of D10A, N854A, or N856A mutations to produce a site-directed polypeptide substantially lacking DNA cleavage activity. In some embodiments, a N854A mutation is combined with one or more of H840A, D10A, or N856A mutations to produce a site-directed polypeptide substantially lacking DNA cleavage activity. In some embodiments, a N856A mutation is combined with one or more of H840A, N854A, or D10A mutations to produce a site- directed polypeptide substantially lacking DNA cleavage activity. Site-directed polypeptides that comprise one substantially inactive nuclease domain are referred to as "nickases".

[00266] Nickase variants of RNA-guided endonucleases, for example Cas9, can be used to increase the specificity of CRISPR-mediated genome editing. Wild type

Cas9 is typically guided by a single guide RNA designed to hybridize with a specified -20 nucleotide sequence in the target sequence (such as an endogenous genomic locus). However, several mismatches can be tolerated between the guide

RNA and the target locus, effectively reducing the length of required homology in the target site to, for example, as little as 13 nt of homology, and thereby resulting in elevated potential for binding and double-strand nucleic acid cleavage by the CRISPR/Cas9 complex elsewhere in the target genome - also known as off-target cleavage. Because nickase variants of Cas9 each only cut one strand, in order to create a double-strand break it is necessary for a pair of nickases to bind in close proximity and on opposite strands of the target nucleic acid, thereby creating a pair of nicks, which is the equivalent of a double-strand break. This requires that two separate guide RNAs - one for each nickase - must bind in close proximity and on opposite strands of the target nucleic acid. This requirement essentially doubles the minimum length of homology needed for the double-strand break to occur, thereby reducing the likelihood that a double-strand cleavage event will occur elsewhere in the genome, where the two guide RNA sites - if they exist - are unlikely to be sufficiently close to each other to enable the double-strand break to form. As described in the art, nickases can also be used to promote HDR versus NHEJ. HDR can be used to introduce selected changes into target sites in the genome through the use of specific donor sequences that effectively mediate the desired changes. Descriptions of various CRISPR/Cas systems for use in gene editing can be found, e.g., in international patent application publication number

WO2013/176772, and in Nature Biotechnology 32, 347-355 (2014), and references cited therein.

[00267] Mutations contemplated include substitutions, additions, and deletions, or any combination thereof. In some embodiments, the mutation converts the mutated amino acid to alanine. In some embodiments, the mutation converts the mutated amino acid to another amino acid (e.g. , glycine, serine, threonine, cysteine, valine, leucine, isoleucine, methionine, proline, phenylalanine, tyrosine, tryptophan, aspartic acid, glutamic acid, asparagines, glutamine, histidine, lysine, or arginine). In some embodiments, the mutation converts the mutated amino acid to a non-natural amino acid (e.g., selenomethionine). In some embodiments, the mutation converts the mutated amino acid to amino acid mimics (e.g.,

phosphomimics). In some embodiments, the mutation is a conservative mutation. For example, the mutation can convert the mutated amino acid to amino acids that resemble the size, shape, charge, polarity, conformation, and/or rotamers of the mutated amino acids (e.g., cysteine/serine mutation, lysine/asparagine mutation, histidine/phenylalanine mutation). In some embodiments, the mutation causes a shift in reading frame and/or the creation of a premature stop codon. In some embodiments, mutations cause changes to regulatory regions of genes or loci that affect expression of one or more genes.

[00268] In some embodiments, the site-directed polypeptide (e.g., variant, mutated, enzymatically inactive and/or conditionally enzymatically inactive site- directed polypeptide) targets nucleic acid. In some embodiments, the site-directed polypeptide (e.g., variant, mutated, enzymatically inactive and/or conditionally enzymatically inactive endoribonuclease) targets DNA. In some embodiments, the site-directed polypeptide (e.g., variant, mutated, enzymatically inactive and/or conditionally enzymatically inactive endoribonuclease) targets RNA.

[00269] In some embodiments, the site-directed polypeptide comprises one or more non-native sequences (e.g., the site-directed polypeptide is a fusion protein).

[00270] In some embodiments, the site-directed polypeptide comprises an amino acid sequence comprising at least 15% amino acid identity to a Cas9 from a bacterium (e.g., S. pyogenes), a nucleic acid binding domain, and two nucleic acid cleaving domains (i.e., a HNH domain and a RuvC domain).

[00271] In some embodiments, the site-directed polypeptide comprises an amino acid sequence comprising at least 15% amino acid identity to a Cas9 from a bacterium (e.g., S. pyogenes), and two nucleic acid cleaving domains (i.e., a HNH domain and a RuvC domain).

[00272] In some embodiments, the site-directed polypeptide comprises an amino acid sequence comprising at least 15% amino acid identity to a Cas9 from a bacterium (e.g., S. pyogenes), and two nucleic acid cleaving domains, wherein one or both of the nucleic acid cleaving domains comprise at least 50% amino acid identity to a nuclease domain from Cas9 from a bacterium (e.g., S. pyogenes).

[00273] In some embodiments, the site-directed polypeptide comprises an amino acid sequence comprising at least 15% amino acid identity to a Cas9 from a bacterium (e.g., S. pyogenes), two nucleic acid cleaving domains (i.e., a HNH domain and a RuvC domain), and non-native sequence (for example, a nuclear localization signal) or a linker linking the site-directed polypeptide to a non-native sequence.

[00274] In some embodiments, the site-directed polypeptide comprises an amino acid sequence comprising at least 15% amino acid identity to a Cas9 from a bacterium (e.g., S. pyogenes), two nucleic acid cleaving domains (i.e., a HNH domain and a RuvC domain), wherein the site-directed polypeptide comprises a mutation in one or both of the nucleic acid cleaving domains that reduces the cleaving activity of the nuclease domains by at least 50%.

[00275] In some embodiments, the site-directed polypeptide comprises an amino acid sequence comprising at least 15% amino acid identity to a Cas9 from a bacterium (e.g., S. pyogenes), and two nucleic acid cleaving domains (i.e., a HNH domain and a RuvC domain), wherein one of the nuclease domains comprises mutation of aspartic acid 10, and/or wherein one of the nuclease domains comprises a mutation of histidine 840, and wherein the mutation reduces the cleaving activity of the nuclease domain(s) by at least 50%.

[00276] In some embodiments, the one or more site-directed polypeptides, e.g. DNA endonucleases, include two nickases that together effect one double-strand break at a specific locus in the genome, or four nickases that together effect or cause two double-strand breaks at specific loci in the genome. Alternatively, one site-directed polypeptide, e.g. DNA endonuclease, effects or causes one double- strand break at a specific locus in the genome.

[00277] The site-directed polypeptide can be flanked at the N-terminus, the C- terminus, or both the N-terminus and C-terminus by one or more nuclear localization signals (NLSs). For example, a Cas9 endonuclease can be flanked by two NLSs, one NLS located at the N-terminus and the second NLS located at the C-terminus. The NLS can be any NLS known in the art, such as a SV40 NLS.

[00278] Genome-targeting Nucleic Acid

[00279] The present disclosure provides a genome-targeting nucleic acid that can direct the activities of an associated polypeptide (e.g., a site-directed polypeptide) to a specific target sequence within a target nucleic acid. In some embodiments, the genome-targeting nucleic acid is an RNA. A genome-targeting RNA is referred to as a "guide RNA" or "gRNA" herein. A guide RNA comprises at least a spacer sequence that hybridizes to a target nucleic acid sequence of interest, and a CRISPR repeat sequence. In Type II systems, the gRNA also comprises a second RNA called the tracrRNA sequence. In the Type I I guide RNA (gRNA), the CRISPR repeat sequence and tracrRNA sequence hybridize to each other to form a duplex. In the Type V guide RNA (gRNA), the crRNA forms a duplex. In both systems, the duplex binds a site-directed polypeptide, such that the guide RNA and site-direct polypeptide form a complex. In some embodiments, the genome-targeting nucleic acid provides target specificity to the complex by virtue of its association with the site-directed polypeptide. The genome-targeting nucleic acid thus directs the activity of the site-directed polypeptide.

[00280] Exemplary guide RNAs include the spacer sequences in SEQ ID NOs: 1 -29,800 for the ACADM gene, in SEQ ID NOs: 29,801 -60,041 for the HADHA gene, and in SEQ ID NOs: 60,042-69,825 for the ACADVL gene. As is understood by the person of ordinary skill in the art, each guide RNA is designed to include a spacer sequence complementary to its genomic target sequence. For example, each of the spacer sequences in SEQ ID NOs: 1 -29,800 for the ACADM gene, in SEQ ID NOs: 29,801 -60,041 for the HADHA gene, and in SEQ ID NOs: 60,042- 69,825 for the ACADVL gene may be put into a single RNA chimera or a crRNA (along with a corresponding tracrRNA). See Jinek et ai, Science, 337, 816-821 (2012) and Deltcheva et ai, Nature, 471 , 602-607 (201 1 ).

[00281] In some embodiments, the genome-targeting nucleic acid is a double- molecule guide RNA. In some embodiments, the genome-targeting nucleic acid is a single-molecule guide RNA.

[00282] A double-molecule guide RNA comprises two strands of RNA. The first strand comprises in the 5' to 3' direction, an optional spacer extension sequence, a spacer sequence and a minimum CRISPR repeat sequence. The second strand comprises a minimum tracrRNA sequence (complementary to the minimum CRISPR repeat sequence), a 3' tracrRNA sequence and an optional tracrRNA extension sequence.

[00283] A single-molecule guide RNA (sgRNA) in a Type II system comprises, in the 5' to 3' direction, an optional spacer extension sequence, a spacer sequence, a minimum CRISPR repeat sequence, a single-molecule guide linker, a minimum tracrRNA sequence, a 3' tracrRNA sequence and an optional tracrRNA extension sequence. The optional tracrRNA extension may comprise elements that contribute additional functionality (e.g., stability) to the guide RNA. The single-molecule guide linker links the minimum CRISPR repeat and the minimum tracrRNA sequence to form a hairpin structure. The optional tracrRNA extension comprises one or more hairpins.

[00284] The sgRNA comprises a 20 nucleotide spacer sequence at the 5' end of the sgRNA sequence. The sgRNA comprises a less than a 20 nucleotide spacer sequence at the 5' end of the sgRNA sequence. The sgRNA comprises a more than 20 nucleotide spacer sequence at the 5' end of the sgRNA sequence. The sgRNA comprises a variable length spacer sequence with 17-30 nucleotides at the 5' end of the sgRNA sequence (see Table 1 ).

[00285] The sgRNA comprises no uracil at the 3'end of the sgRNA sequence, such as in SEQ ID NO: 69,829 of Table 1 . The sgRNA comprises one or more uracil at the 3'end of the sgRNA sequence, such as in SEQ I D NO: 69,830 in Table 1 . For example, the sgRNA comprises 1 uracil (U) at the 3' end of the sgRNA sequence. The sgRNA comprises 2 uracil (UU) at the 3' end of the sgRNA sequence. The sgRNA comprises 3 uracil (UUU) at the 3' end of the sgRNA sequence. The sgRNA comprises 4 uracil (UUUU) at the 3' end of the sgRNA sequence. The sgRNA comprises 5 uracil (UUUUU) at the 3' end of the sgRNA sequence. The sgRNA comprises 6 uracil (UUUUUU) at the 3' end of the sgRNA sequence. The sgRNA comprises 7 uracil (UUUUUUU) at the 3' end of the sgRNA sequence. The sgRNA comprises 8 uracil (UUUUUUUU) at the 3' end of the sgRNA sequence.

[00286] The sgRNA can be unmodified or modified. For example, modified sgRNAs comprises one or more 2'-0-methyl phosphorothioate nucleotides. Table 1

Figure imgf000074_0001

[00287] A single-molecule guide RNA (sgRNA) in a Type V system comprises, in the 5' to 3' direction, a minimum CRISPR repeat sequence and a spacer sequence.

[00288] By way of illustration, guide RNAs used in the CRISPR/Cas/Cpf1 system, or other smaller RNAs can be readily synthesized by chemical means, as illustrated below and described in the art. While chemical synthetic procedures are continually expanding, purifications of such RNAs by procedures such as high performance liquid chromatography (HPLC, which avoids the use of gels such as PAGE) tends to become more challenging as polynucleotide lengths increase significantly beyond a hundred or so nucleotides. One approach used for generating RNAs of greater length is to produce two or more molecules that are ligated together. Much longer RNAs, such as those encoding a Cas9 or Cpfl endonuclease, are more readily generated enzymatically. Various types of RNA modifications can be introduced during or after chemical synthesis and/or enzymatic generation of RNAs, e.g. , modifications that enhance stability, reduce the likelihood or degree of innate immune response, and/or enhance other attributes, as described in the art.

[00289] Spacer Extension Sequence

[00290] In some embodiments of genome-targeting nucleic acids, a spacer extension sequence can modify activity, provide stability, and/or provide a location for modifications of a genome-targeting nucleic acid. A spacer extension sequence may modify on- or off-target activity or specificity. In some embodiments, a spacer extension sequence is provided. A spacer extension sequence may have a length of more than 1 , 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 1000, 2000, 3000, 4000, 5000, 6000, or 7000 or more nucleotides. A spacer extension sequence may have a length of less than 1 , 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 1000, 2000, 3000, 4000, 5000, 6000, 7000 or more nucleotides. In some

embodiments, a spacer extension sequence is less than 10 nucleotides in length. In some embodiments, a spacer extension sequence is between 10-30 nucleotides in length. In some embodiments, a spacer extension sequence is between 30-70 nucleotides in length.

[00291] In some embodiments, the spacer extension sequence comprises another moiety (e.g., a stability control sequence, an endoribonuclease binding sequence, a ribozyme). In some embodiments, the moiety decreases or increases the stability of a nucleic acid targeting nucleic acid. In some embodiments, the moiety is a transcriptional terminator segment (i.e., a transcription termination sequence). In some embodiments, the moiety functions in a eukaryotic cell. In some embodiments, the moiety functions in a prokaryotic cell. In some

embodiments, the moiety functions in both eukaryotic and prokaryotic cells. Non- limiting examples of suitable moieties include: a 5' cap (e.g., a 7-methylguanylate cap (m7 G)), a riboswitch sequence (e.g., to allow for regulated stability and/or regulated accessibility by proteins and protein complexes), a sequence that forms a dsRNA duplex (i.e., a hairpin), a sequence that targets the RNA to a subcellular location (e.g., nucleus, mitochondria, chloroplasts, and the like), a modification or sequence that provides for tracking (e.g., direct conjugation to a fluorescent molecule, conjugation to a moiety that facilitates fluorescent detection, a sequence that allows for fluorescent detection, etc.), and/or a modification or sequence that provides a binding site for proteins (e.g., proteins that act on DNA, including transcriptional activators, transcriptional repressors, DNA methyltransferases, DNA demethylases, histone acetyltransferases, histone deacetylases, and the like). [00292] Spacer Sequence

[00293] The spacer sequence hybridizes to a sequence in a target nucleic acid of interest. The spacer of a genome-targeting nucleic acid interacts with a target nucleic acid in a sequence-specific manner via hybridization (i.e., base pairing). The nucleotide sequence of the spacer thus varies depending on the sequence of the target nucleic acid of interest.

[00294] In a CRISPR/Cas system herein, the spacer sequence is designed to hybridize to a target nucleic acid that is located 5' of a PAM of the Cas9 enzyme used in the system. The spacer may perfectly match the target sequence or may have mismatches. Each Cas9 enzyme has a particular PAM sequence that it recognizes in a target DNA. For example, S. pyogenes recognizes in a target nucleic acid a PAM that comprises the sequence 5'-NRG-3', where R comprises either A or G, where N is any nucleotide and N is immediately 3' of the target nucleic acid sequence targeted by the spacer sequence.

[00295] In some embodiments, the target nucleic acid sequence comprises 20 nucleotides. In some embodiments, the target nucleic acid comprises than 20 nucleotides. In some embodiments, the target nucleic acid comprises more less than 20 nucleotides. In some embodiments, the target nucleic acid comprises at least: 5, 10, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 30 or more nucleotides. In some embodiments, the target nucleic acid comprises at most: 5, 10, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 30 or more nucleotides. In some embodiments, the target nucleic acid sequence comprises 20 bases immediately 5' of the first nucleotide of the PAM. For example, in a sequence comprising 5'- NNNNNNNNNNNNNNNNNNNNNRG-3' (SEQ ID NO: 69,826), the target nucleic acid comprises the sequence that corresponds to the Ns, wherein N is any nucleotide, and the underlined NRG sequence is the S. pyogenes PAM.

[00296] In some embodiments, the spacer sequence that hybridizes to the target nucleic acid has a length of at least about 6 nucleotides (nt). The spacer sequence can be at least about 6 nt, at least about 10 nt, at least about 15 nt, at least about 18 nt, at least about 19 nt, at least about 20 nt, at least about 25 nt, at least about 30 nt, at least about 35 nt or at least about 40 nt, from about 6 nt to about 80 nt, from about 6 nt to about 50 nt, from about 6 nt to about 45 nt, from about 6 nt to about 40 nt, from about 6 nt to about 35 nt, from about 6 nt to about 30 nt, from about 6 nt to about 25 nt, from about 6 nt to about 20 nt, from about 6 nt to about 19 nt, from about 10 nt to about 50 nt, from about 10 nt to about 45 nt, from about 10 nt to about 40 nt, from about 10 nt to about 35 nt, from about 10 nt to about 30 nt, from about 10 nt to about 25 nt, from about 10 nt to about 20 nt, from about 10 nt to about 19 nt, from about 19 nt to about 25 nt, from about 19 nt to about 30 nt, from about 19 nt to about 35 nt, from about 19 nt to about 40 nt, from about 19 nt to about 45 nt, from about 19 nt to about 50 nt, from about 19 nt to about 60 nt, from about 20 nt to about 25 nt, from about 20 nt to about 30 nt, from about 20 nt to about 35 nt, from about 20 nt to about 40 nt, from about 20 nt to about 45 nt, from about 20 nt to about 50 nt, or from about 20 nt to about 60 nt. In some

embodiments, the spacer sequence comprises 20 nucleotides. In some

embodiments, the spacer comprises 19 nucleotides. In some embodiments, the spacer comprises 22 nucleotides.

[00297] In some embodiments, the percent complementarity between the spacer sequence and the target nucleic acid is at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or 100%. In some embodiments, the percent complementarity between the spacer sequence and the target nucleic acid is at most about 30%, at most about 40%, at most about 50%, at most about 60%, at most about 65%, at most about 70%, at most about 75%, at most about 80%, at most about 85%, at most about 90%, at most about 95%, at most about 97%, at most about 98%, at most about 99%, or 100%. In some embodiments, the percent complementarity between the spacer sequence and the target nucleic acid is 100% over the six contiguous 5'-most nucleotides of the target sequence of the complementary strand of the target nucleic acid. In some embodiments, the percent complementarity between the spacer sequence and the target nucleic acid is at least 60% over about 20 contiguous nucleotides. In some embodiments, the length of the spacer sequence and the target nucleic acid differs by 1 to 6 nucleotides, which may be thought of as a bulge or bulges.

[00298] In some embodiments, the spacer sequence is designed or chosen using a computer program. The computer program can use variables, such as predicted melting temperature, secondary structure formation, predicted annealing temperature, sequence identity, genomic context, chromatin accessibility, % GC, frequency of genomic occurrence (e.g., of sequences that are identical or are similar but vary in one or more spots as a result of mismatch, insertion or deletion), methylation status, presence of SNPs, and the like.

[00299] Minimum CRISPR Repeat Sequence

[00300] In some embodiments, a minimum CRISPR repeat sequence is a sequence with at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% sequence identity to a reference CRISPR repeat sequence (e.g., crRNA from S. pyogenes).

[00301] A minimum CRISPR repeat sequence comprises nucleotides that can hybridize to a minimum tracrRNA sequence in a cell. The minimum CRISPR repeat sequence and a minimum tracrRNA sequence form a duplex, i.e. a base-paired double-stranded structure. Together, the minimum CRISPR repeat sequence and the minimum tracrRNA sequence bind to the site-directed polypeptide. At least a part of the minimum CRISPR repeat sequence hybridizes to the minimum tracrRNA sequence. In some embodiments, at least a part of the minimum CRISPR repeat sequence comprises at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% complementary to the minimum tracrRNA sequence. In some embodiments, at least a part of the minimum CRISPR repeat sequence comprises at most about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% complementary to the minimum tracrRNA sequence.

[00302] The minimum CRISPR repeat sequence can have a length from about 7 nucleotides to about 100 nucleotides. For example, the length of the minimum CRISPR repeat sequence is from about 7 nucleotides (nt) to about 50 nt, from about 7 nt to about 40 nt, from about 7 nt to about 30 nt, from about 7 nt to about 25 nt, from about 7 nt to about 20 nt, from about 7 nt to about 15 nt, from about 8 nt to about 40 nt, from about 8 nt to about 30 nt, from about 8 nt to about 25 nt, from about 8 nt to about 20 nt, from about 8 nt to about 15 nt, from about 15 nt to about 100 nt, from about 15 nt to about 80 nt, from about 15 nt to about 50 nt, from about 15 nt to about 40 nt, from about 15 nt to about 30 nt, or from about 15 nt to about 25 nt. In some embodiments, the minimum CRISPR repeat sequence is

approximately 9 nucleotides in length. In some embodiments, the minimum

CRISPR repeat sequence is approximately 12 nucleotides in length.

[00303] In some embodiments, the minimum CRISPR repeat sequence is at least about 60% identical to a reference minimum CRISPR repeat sequence (e.g., wild-type crRNA from S. pyogenes) over a stretch of at least 6, 7, or 8 contiguous nucleotides. For example, the minimum CRISPR repeat sequence is at least about 65% identical, at least about 70% identical, at least about 75% identical, at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 95% identical, at least about 98% identical, at least about 99% identical or 100% identical to a reference minimum CRISPR repeat sequence over a stretch of at least 6, 7, or 8 contiguous nucleotides.

[00304] Minimum tracrRNA Sequence

[00305] In some embodiments, a minimum tracrRNA sequence is a sequence with at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% sequence identity to a reference tracrRNA sequence (e.g., wild type tracrRNA from S. pyogenes).

[00306] A minimum tracrRNA sequence comprises nucleotides that hybridize to a minimum CRISPR repeat sequence in a cell. A minimum tracrRNA sequence and a minimum CRISPR repeat sequence form a duplex, i.e. a base-paired double- stranded structure. Together, the minimum tracrRNA sequence and the minimum CRISPR repeat bind to a site-directed polypeptide. At least a part of the minimum tracrRNA sequence can hybridize to the minimum CRISPR repeat sequence. In some embodiments, the minimum tracrRNA sequence is at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% complementary to the minimum CRISPR repeat sequence.

[00307] The minimum tracrRNA sequence can have a length from about 7 nucleotides to about 100 nucleotides. For example, the minimum tracrRNA sequence can be from about 7 nucleotides (nt) to about 50 nt, from about 7 nt to about 40 nt, from about 7 nt to about 30 nt, from about 7 nt to about 25 nt, from about 7 nt to about 20 nt, from about 7 nt to about 15 nt, from about 8 nt to about 40 nt, from about 8 nt to about 30 nt, from about 8 nt to about 25 nt, from about 8 nt to about 20 nt, from about 8 nt to about 15 nt, from about 15 nt to about 100 nt, from about 15 nt to about 80 nt, from about 15 nt to about 50 nt, from about 15 nt to about 40 nt, from about 15 nt to about 30 nt or from about 15 nt to about 25 nt long. In some embodiments, the minimum tracrRNA sequence is approximately 9 nucleotides in length. In some embodiments, the minimum tracrRNA sequence is approximately 12 nucleotides. In some embodiments, the minimum tracrRNA consists of tracrRNA nt 23-48 described in Jinek et ai, supra.

[00308] In some embodiments, the minimum tracrRNA sequence is at least about 60% identical to a reference minimum tracrRNA (e.g., wild type, tracrRNA from S. pyogenes) sequence over a stretch of at least 6, 7, or 8 contiguous nucleotides. For example, the minimum tracrRNA sequence is at least about 65% identical, about 70% identical, about 75% identical, about 80% identical, about 85% identical, about 90% identical, about 95% identical, about 98% identical, about 99% identical or 100% identical to a reference minimum tracrRNA sequence over a stretch of at least 6, 7, or 8 contiguous nucleotides.

[00309] In some embodiments, the duplex between the minimum CRISPR RNA and the minimum tracrRNA comprises a double helix. In some embodiments, the duplex between the minimum CRISPR RNA and the minimum tracrRNA comprises at least about 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotides. In some

embodiments, the duplex between the minimum CRISPR RNA and the minimum tracrRNA comprises at most about 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more

nucleotides.

[00310] In some embodiments, the duplex comprises a mismatch (i.e., the two strands of the duplex are not 100% complementary). In some embodiments, the duplex comprises at least about 1 , 2, 3, 4, or 5 or mismatches. In some

embodiments, the duplex comprises at most about 1 , 2, 3, 4, or 5 or mismatches. In some embodiments, the duplex comprises no more than 2 mismatches.

[00311] Bulges

[00312] In some embodiments, there is a "bulge" in the duplex between the minimum CRISPR RNA and the minimum tracrRNA. A bulge is an unpaired region of nucleotides within the duplex. In some embodiments, the bulge contributes to the binding of the duplex to the site-directed polypeptide. In some embodiments, the bulge comprises, on one side of the duplex, an unpaired 5'-XXXY-3' where X is any purine and Y comprises a nucleotide that can form a wobble pair with a nucleotide on the opposite strand, and an unpaired nucleotide region on the other side of the duplex. The number of unpaired nucleotides on the two sides of the duplex can be different.

[00313] In some embodiments, the bulge comprises an unpaired purine (e.g., adenine) on the minimum CRISPR repeat strand of the bulge. In some

embodiments, the bulge comprises an unpaired 5'-AAGY-3' of the minimum tracrRNA sequence strand of the bulge, where Y comprises a nucleotide that can form a wobble pairing with a nucleotide on the minimum CRISPR repeat strand.

[00314] In some embodiments, a bulge on the minimum CRISPR repeat side of the duplex comprises at least 1 , 2, 3, 4, or 5 or more unpaired nucleotides. In some embodiments, a bulge on the minimum CRISPR repeat side of the duplex comprises at most 1 , 2, 3, 4, or 5 or more unpaired nucleotides. In some

embodiments, a bulge on the minimum CRISPR repeat side of the duplex comprises 1 unpaired nucleotide.

[00315] In some embodiments, a bulge on the minimum tracrRNA sequence side of the duplex comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more unpaired nucleotides. In some embodiments, a bulge on the minimum tracrRNA sequence side of the duplex comprises at most 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more unpaired nucleotides. In some embodiments, a bulge on a second side of the duplex (e.g., the minimum tracrRNA sequence side of the duplex) comprises 4 unpaired nucleotides.

[00316] In some embodiments, a bulge comprises at least one wobble pairing. In some embodiments, a bulge comprises at most one wobble pairing. In some embodiments, a bulge comprises at least one purine nucleotide. In some embodiments, a bulge comprises at least 3 purine nucleotides. In some

embodiments, a bulge sequence comprises at least 5 purine nucleotides. In some embodiments, a bulge sequence comprises at least one guanine nucleotide. In some embodiments, a bulge sequence comprises at least one adenine nucleotide.

[00317] Hairpins

[00318] In various embodiments, one or more hairpins are located 3' to the minimum tracrRNA in the 3' tracrRNA sequence.

[00319] In some embodiments, the hairpin starts at least about 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 or more nucleotides 3' from the last paired nucleotide in the minimum CRISPR repeat and minimum tracrRNA sequence duplex. In some embodiments, the hairpin can start at most about 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more nucleotides 3' of the last paired nucleotide in the minimum CRISPR repeat and minimum tracrRNA sequence duplex.

[00320] In some embodiments, a hairpin comprises at least about 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 or more consecutive nucleotides. In some embodiments, a hairpin comprises at most about 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or more consecutive nucleotides.

[00321] In some embodiments, a hairpin comprises a CC dinucleotide (i.e., two consecutive cytosine nucleotides).

[00322] In some embodiments, a hairpin comprises duplexed nucleotides (e.g., nucleotides in a hairpin, hybridized together). For example, a hairpin comprises a CC dinucleotide that is hybridized to a GG dinucleotide in a hairpin duplex of the 3' tracrRNA sequence.

[00323] One or more of the hairpins can interact with guide RNA-interacting regions of a site-directed polypeptide.

[00324] In some embodiments, there are two or more hairpins, and in some embodiments there are three or more hairpins.

[00325] 3' tracrRNA sequence

[00326] In some embodiments, a 3' tracrRNA sequence comprises a sequence with at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% sequence identity to a reference tracrRNA sequence (e.g., a tracrRNA from S. pyogenes).

[00327] In some embodiments, the 3' tracrRNA sequence has a length from about 6 nucleotides to about 100 nucleotides. For example, the 3' tracrRNA sequence can have a length from about 6 nucleotides (nt) to about 50 nt, from about 6 nt to about 40 nt, from about 6 nt to about 30 nt, from about 6 nt to about 25 nt, from about 6 nt to about 20 nt, from about 6 nt to about 15 nt, from about 8 nt to about 40 nt, from about 8 nt to about 30 nt, from about 8 nt to about 25 nt, from about 8 nt to about 20 nt, from about 8 nt to about 15 nt, from about 15 nt to about 100 nt, from about 15 nt to about 80 nt, from about 15 nt to about 50 nt, from about 15 nt to about 40 nt, from about 15 nt to about 30 nt, or from about 15 nt to about 25 nt. In some embodiments, the 3' tracrRNA sequence has a length of

approximately 14 nucleotides.

[00328] In some embodiments, the 3' tracrRNA sequence is at least about 60% identical to a reference 3' tracrRNA sequence (e.g., wild type 3' tracrRNA sequence from S. pyogenes) over a stretch of at least 6, 7, or 8 contiguous nucleotides. For example, the 3' tracrRNA sequence is at least about 60% identical, about 65% identical, about 70% identical, about 75% identical, about 80% identical, about 85% identical, about 90% identical, about 95% identical, about 98% identical, about 99% identical, or 100% identical, to a reference 3' tracrRNA sequence (e.g., wild type 3' tracrRNA sequence from S. pyogenes) over a stretch of at least 6, 7, or 8 contiguous nucleotides.

[00329] In some embodiments, a 3' tracrRNA sequence comprises more than one duplexed region (e.g., hairpin, hybridized region). In some embodiments, a 3' tracrRNA sequence comprises two duplexed regions.

[00330] In some embodiments, the 3' tracrRNA sequence comprises a stem loop structure. In some embodiments, a stem loop structure in the 3' tracrRNA comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 or 20 or more nucleotides. In some embodiments, the stem loop structure in the 3' tracrRNA comprises at most 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more nucleotides. In some embodiments, the stem loop structure comprises a functional moiety. For example, the stem loop structure may comprise an aptamer, a ribozyme, a protein-interacting hairpin, a CRISPR array, an intron, or an exon. In some embodiments, the stem loop structure comprises at least about 1 , 2, 3, 4, or 5 or more functional moieties. In some embodiments, the stem loop structure comprises at most about 1 , 2, 3, 4, or 5 or more functional moieties.

[00331] In some embodiments, the hairpin in the 3' tracrRNA sequence comprises a P-domain. In some embodiments, the P-domain comprises a double- stranded region in the hairpin.

[00332] tracrRNA Extension Sequence

[00333] A tracrRNA extension sequence may be provided whether the tracrRNA is in the context of single-molecule guides or double-molecule guides. In some embodiments, a tracrRNA extension sequence has a length from about 1 nucleotide to about 400 nucleotides. In some embodiments, a tracrRNA extension sequence has a length of more than 1 , 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, or 400 nucleotides. In some embodiments, a tracrRNA extension sequence has a length from about 20 to about 5000 or more nucleotides. In some embodiments, a tracrRNA extension sequence has a length of more than 1000 nucleotides. In some embodiments, a tracrRNA extension sequence has a length of less than 1 , 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400 or more nucleotides. In some embodiments, a tracrRNA extension sequence can have a length of less than 1000 nucleotides. In some embodiments, a tracrRNA extension sequence comprises less than 10 nucleotides in length. In some embodiments, a tracrRNA extension sequence is 10-30 nucleotides in length. In some embodiments, a tracrRNA extension sequence is 30-70 nucleotides in length.

[00334] In some embodiments, the tracrRNA extension sequence comprises a functional moiety (e.g., a stability control sequence, ribozyme, endoribonuclease binding sequence). In some embodiments, the functional moiety comprises a transcriptional terminator segment (i.e., a transcription termination sequence). In some embodiments, the functional moiety has a total length from about 10 nucleotides (nt) to about 100 nucleotides, from about 10 nt to about 20 nt, from about 20 nt to about 30 nt, from about 30 nt to about 40 nt, from about 40 nt to about 50 nt, from about 50 nt to about 60 nt, from about 60 nt to about 70 nt, from about 70 nt to about 80 nt, from about 80 nt to about 90 nt, or from about 90 nt to about 100 nt, from about 15 nt to about 80 nt, from about 15 nt to about 50 nt, from about 15 nt to about 40 nt, from about 15 nt to about 30 nt, or from about 15 nt to about 25 nt. In some embodiments, the functional moiety functions in a eukaryotic cell. In some embodiments, the functional moiety functions in a prokaryotic cell. In some embodiments, the functional moiety functions in both eukaryotic and prokaryotic cells.

[00335] Non-limiting examples of suitable tracrRNA extension functional moieties include a 3' poly-adenylated tail, a riboswitch sequence (e.g., to allow for regulated stability and/or regulated accessibility by proteins and protein complexes), a sequence that forms a dsRNA duplex (i.e., a hairpin), a sequence that targets the

RNA to a subcellular location (e.g., nucleus, mitochondria, chloroplasts, and the like), a modification or sequence that provides for tracking (e.g., direct conjugation to a fluorescent molecule, conjugation to a moiety that facilitates fluorescent detection, a sequence that allows for fluorescent detection, etc.), and/or a modification or sequence that provides a binding site for proteins (e.g., proteins that act on DNA, including transcriptional activators, transcriptional repressors, DNA methyltransferases, DNA demethylases, histone acetyltransferases, histone deacetylases, and the like). In some embodiments, a tracrRNA extension sequence comprises a primer binding site or a molecular index (e.g., barcode sequence). In some embodiments, the tracrRNA extension sequence comprises one or more affinity tags.

[00336] Single-Molecule Guide Linker Sequence

[00337] In some embodiments, the linker sequence of a single-molecule guide nucleic acid has a length from about 3 nucleotides to about 100 nucleotides. In Jinek et ai, supra, for example, a simple 4 nucleotide "tetraloop" (-GAAA-) was used, Science, 337(6096):816-821 (2012). An illustrative linker has a length from about 3 nucleotides (nt) to about 90 nt, from about 3 nt to about 80 nt, from about 3 nt to about 70 nt, from about 3 nt to about 60 nt, from about 3 nt to about 50 nt, from about 3 nt to about 40 nt, from about 3 nt to about 30 nt, from about 3 nt to about 20 nt, from about 3 nt to about 10 nt. For example, the linker can have a length from about 3 nt to about 5 nt, from about 5 nt to about 10 nt, from about 10 nt to about 15 nt, from about 15 nt to about 20 nt, from about 20 nt to about 25 nt, from about 25 nt to about 30 nt, from about 30 nt to about 35 nt, from about 35 nt to about 40 nt, from about 40 nt to about 50 nt, from about 50 nt to about 60 nt, from about 60 nt to about 70 nt, from about 70 nt to about 80 nt, from about 80 nt to about 90 nt, or from about 90 nt to about 100 nt. In some embodiments, the linker of a single-molecule guide nucleic acid is between 4 and 40 nucleotides. In some embodiments, a linker is at least about 100, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, or 7000 or more nucleotides. In some embodiments, a linker is at most about 100, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, or 7000 or more nucleotides.

[00338] Linkers can comprise any of a variety of sequences, although in some examples, the linker will not comprise sequences that have extensive regions of homology with other portions of the guide RNA, which might cause intramolecular binding that could interfere with other functional regions of the guide. In Jinek et ai, supra, a simple 4 nucleotide sequence -GAAA- was used, Science, 337(6096):816- 821 (2012), but numerous other sequences, including longer sequences can likewise be used. [00339] In some embodiments, the linker sequence comprises a functional moiety. For example, the linker sequence may comprise one or more features, including an aptamer, a ribozyme, a protein-interacting hairpin, a protein binding site, a CRISPR array, an intron, or an exon. In some embodiments, the linker sequence comprises at least about 1 , 2, 3, 4, or 5 or more functional moieties. In some embodiments, the linker sequence comprises at most about 1 , 2, 3, 4, or 5 or more functional moieties.

[00340] Genome engineering strategies to correct cells by deletion, insertion, correction, or replacement of one or more mutations or exons within or near a gene selected from the group consisting of the ACADM gene, the HADHA gene, and the ACADVL gene, or by knocking-in cDNA selected from the group consisting of ACADM cDNA, HADHA cDNA, and ACADVL cDNA into the locus of the corresponding gene or safe harbor site.

[00341] The methods of the present disclosure can involve correction of one or both of the mutant alleles. Gene editing to correct the mutation has the advantage of restoration of correct expression levels and temporal control. Sequencing the patient's ACADM, HADHA, and/or ACADVL alleles allows for design of the gene editing strategy to best correct the identified mutation(s).

[00342] A step of the ex vivo methods of the present disclosure comprises editing/correcting the patient specific iPS cells using genome engineering.

Alternatively, a step of the ex vivo methods of the present disclosure comprises editing/correcting the progenitor cell, primary hepatocyte, or mesenchymal stem cell. Likewise, a step of the in vivo methods of the present disclosure comprises editing/correcting the cells in an MCADD patient, an LCHADD patient, and/or a VLCADD patient using genome engineering. Similarly, a step in the cellular methods of the present disclosure comprises editing/correcting a gene selected from the group consisting of the ACADM gene, the HADHA gene, and the ACADVL gene in a human cell by genome engineering.

[00343] MCADD patients exhibit a wide range of mutations in the ACADM gene. Any CRISPR endonuclease may be used in the methods of the disclosure, each CRISPR endonuclease having its own associated PAM, which may or may not be disease specific. For example, gRNA spacer sequences for targeting the ACADM gene with a CRISPR/Cas9 endonuclease from S. pyogenes have been identified in SEQ ID NOs: 1 -10,827. gRNA spacer sequences for targeting the ACADM gene with a CRISPR/Cas9 endonuclease from S. aureus have been identified in SEQ ID NOs: 10,828-12,058. gRNA spacer sequences for targeting the ACADM gene with a CRISPR/Cas9 endonuclease from S. thermophilus have been identified in SEQ ID NOs: 12,059-12,536. gRNA spacer sequences for targeting the ACADM gene with a CRISPR/Cas9 endonuclease from T. denticola have been identified in SEQ ID NOs: 12,537-12,733. gRNA spacer sequences for targeting the ACADM gene with a CRISPR/Cas9 endonuclease from N. meningitides have been identified in SEQ ID NOs: 12,734-13,961 . gRNA spacer sequences for targeting the ACADM gene with a CRISPR/Cpf1 endonuclease from Acidaminococcus and

Lachnospiraceae have been identified in SEQ ID NOs: 13,962-29,800.

[00344] LCHADD patients exhibit a wide range of mutations in the HADHA gene. Any CRISPR endonuclease may be used in the methods of the disclosure, each CRISPR endonuclease having its own associated PAM, which may or may not be disease specific. For example, gRNA spacer sequences for targeting the HADHA gene with a CRISPR/Cas9 endonuclease from S. pyogenes have been identified in SEQ ID NOs: 29,801 -41 , 191 . gRNA spacer sequences for targeting the HADHA gene with a CRISPR/Cas9 endonuclease from S. aureus have been identified in SEQ ID NOs: 41 , 192-42,553. gRNA spacer sequences for targeting the HADHA gene with a CRISPR/Cas9 endonuclease from S. thermophilus have been identified in SEQ ID NOs: 42,554-42,980. gRNA spacer sequences for targeting the HADHA gene with a CRISPR/Cas9 endonuclease from T. denticola have been identified in SEQ ID NOs: 42,981 -43, 173. gRNA spacer sequences for targeting the HADHA gene with a CRISPR/Cas9 endonuclease from N. meningitides have been identified in SEQ ID NOs: 43, 174-44,402. gRNA spacer sequences for targeting the HADHA gene with a CRISPR/Cpf1 endonuclease from Acidaminococcus and Lachnospiraceae have been identified in SEQ ID NOs: 44,403-60,041 .

[00345] VLCADD patients exhibit a wide range of mutations in the ACADVL gene. Any CRISPR endonuclease may be used in the methods of the disclosure, each CRISPR endonuclease having its own associated PAM, which may or may not be disease specific. For example, gRNA spacer sequences for targeting the ACADVL gene with a CRISPR/Cas9 endonuclease from S. pyogenes have been identified in SEQ ID NOs: 60,042-65,507. gRNA spacer sequences for targeting the ACADVL gene with a CRISPR/Cas9 endonuclease from S. aureus have been identified in SEQ ID NOs: 65,508-65,951 . gRNA spacer sequences for targeting the ACADVL gene with a CRISPR/Cas9 endonuclease from S. thermophilus have been identified in SEQ ID NOs: 65,952-66,009. gRNA spacer sequences for targeting the ACADVL gene with a CRISPR/Cas9 endonuclease from T. denticola have been identified in SEQ ID NOs: 66,010-66,029. gRNA spacer sequences for targeting the ACADVL gene with a CRISPR/Cas9 endonuclease from N. meningitides have been identified in SEQ ID NOs: 66,030-66,252. gRNA spacer sequences for targeting the ACADVL gene with a CRISPR/Cpf1 endonuclease from Acidaminococcus and Lachnospiraceae have been identified in SEQ ID NOs: 66,253-69,825.

[00346] For example, the mutation can be corrected by the insertions or deletions that arise due to the imprecise NHEJ repair pathway. If the patient's ACADM, HADHA, and/or ACADVL gene has an inserted or deleted base, a targeted cleavage can result in a NHEJ-mediated insertion or deletion that restores the frame. Missense mutations can also be corrected through NHEJ-mediated correction using one or more guide RNA. The ability or likelihood of the cut(s) to correct the mutation may be designed or evaluated based on the local sequence and micro-homologies. NHEJ can also be used to delete segments of the gene, either directly or by altering splice donor or acceptor sites through cleavage by one gRNA targeting several locations, or several gRNAs. This may be useful if an amino acid, domain or exon contains the mutations and can be removed or inverted, or if the deletion otherwise restored function to the protein. Pairs of guide strands have been used for deletions and corrections of inversions. NHEJ can also be used to promote targeted transgene integration at the cleaved locus, especially if the transgene donor template has been cleaved within the cell as well.

[00347] Alternatively, the donor for correction by HDR contains the corrected sequence with small or large flanking homology arms to allow for annealing. HDR is essentially an error-free mechanism that uses a supplied homologous DNA sequence as a template during DSB repair. The rate of homology directed repair (HDR) is a function of the distance between the mutation and the cut site so choosing overlapping or nearest target sites is important. Templates can include extra sequences flanked by the homologous regions or can contain a sequence that differs from the genomic sequence, thus allowing sequence editing.

[00348] In addition to correcting mutations by NHEJ or HDR, a range of other options are possible. If there are small or large deletions or multiple mutations, a cDNA can be knocked in that contains the exons affected. A full length cDNA can be knocked into any "safe harbor", but must use a supplied or other promoter. If this construct is knocked into the correct location, it will have physiological control, similar to the normal gene. Pairs of nucleases can be used to delete mutated gene regions, though a donor would usually have to be provided to restore function. In this case two gRNA would be supplied and one donor sequence.

[00349] Some genome engineering strategies involve correction of one or more mutations in or near a gene selected from the group consisting of the ACADM gene, the HADHA gene, and the ACADVL gene, and/or deleting mutant DNA selected from the group consisting of mutant ACADM DNA, mutant HADHA DNA, and mutant ACADVL DNA, and/or knocking-in cDNA or minigene (comprised of one or more exons and introns or natural or synthetic introns) selected from the group consisting of ACADM cDNA or minigene, HADHA cDNA or minigene, and ACADVL cDNA or minigene and/or knocking-in a cDNA interrupted by some or all introns selected from the group consisting of some or all ACADM introns, some or all HADHA introns, and some or all ACADVL introns into the locus or safe harbor locus. These strategies will restore MCAD activity, TFP activity, LCHAD activity, or VLCAD activity, and completely reverse, treat, and/or mitigate the diseased state. These strategies may require a more custom approach based on the location of the patient's mutation(s). Donor nucleotides for correcting mutations are small (< 300 bp). This is advantageous, as HDR efficiencies may be inversely related to the size of the donor molecule. Also, it is expected that the donor templates can fit into size constrained viral vector molecules, e.g., adeno-associated virus (AAV) molecules, which have been shown to be an effective means of donor template delivery. Also, it is expected that the donor templates can fit into other size constrained molecules, including, by way of non-limiting example, platelets and/or exosomes or other microvesicles.

[00350] Homology direct repair is a cellular mechanism for repairing double- stranded breaks (DSBs). The most common form is homologous recombination. There are additional pathways for HDR, including single-strand annealing and alternative-HDR. Genome engineering tools allow researchers to manipulate the cellular homologous recombination pathways to create site-specific modifications to the genome. It has been found that cells can repair a double-stranded break using a synthetic donor molecule provided in trans. Therefore, by introducing a double- stranded break near a specific mutation and providing a suitable donor, targeted changes can be made in the genome. Specific cleavage increases the rate of HDR more than 1 ,000 fold above the rate of 1 in 106 cells receiving a homologous donor alone. The rate of homology directed repair (HDR) at a particular nucleotide is a function of the distance to the cut site, so choosing overlapping or nearest target sites is important. Gene editing offers the advantage over gene addition, as correcting in situ leaves the rest of the genome unperturbed.

[00351] Supplied donors for editing by HDR vary markedly but generally contain the intended sequence with small or large flanking homology arms to allow annealing to the genomic DNA. The homology regions flanking the introduced genetic changes can be 30 bp or smaller, or as large as a multi-kilobase cassette that can contain promoters, cDNAs, etc. Both single-stranded and double-stranded oligonucleotide donors have been used. These oligonucleotides range in size from less than 100 nt to over many kb, though longer ssDNA can also be generated and used. Double-stranded donors are often used, including PCR amplicons, plasmids, and mini-circles. In general, it has been found that an AAV vector is a very effective means of delivery of a donor template, though the packaging limits for individual donors is <5kb. Active transcription of the donor increased HDR three-fold, indicating the inclusion of promoter may increase conversion. Conversely, CpG methylation of the donor decreased gene expression and HDR.

[00352] In addition to wildtype endonucleases, such as Cas9, nickase variants exist that have one or the other nuclease domain inactivated resulting in cutting of only one DNA strand. HDR can be directed from individual Cas nickases or using pairs of nickases that flank the target area. Donors can be single-stranded, nicked, or dsDNA.

[00353] The donor DNA can be supplied with the nuclease or independently by a variety of different methods, for example by transfection, nano-particle, microinjection, or viral transduction. A range of tethering options have been proposed to increase the availability of the donors for HDR. Examples include attaching the donor to the nuclease, attaching to DNA binding proteins that bind nearby, or attaching to proteins that are involved in DNA end binding or repair.

[00354] The repair pathway choice can be guided by a number of culture conditions, such as those that influence cell cycling, or by targeting of DNA repair and associated proteins. For example, to increase HDR, key NHEJ molecules can be suppressed, such as KU70, KU80 or DNA ligase IV.

[00355] Without a donor present, the ends from a DNA break or ends from different breaks can be joined using the several nonhomologous repair pathways in which the DNA ends are joined with little or no base-pairing at the junction. In addition to canonical NHEJ, there are similar repair mechanisms, such as alt-NHEJ. If there are two breaks, the intervening segment can be deleted or inverted. NHEJ repair pathways can lead to insertions, deletions or mutations at the joints.

[00356] NHEJ was used to insert a gene expression cassette into a defined locus in human cell lines after nuclease cleavage of both the chromosome and the donor molecule. (Cristea, et al., Biotechnology and Bioengineering 1 10:871 -880

(2012) ; Maresca, M., Lin, V.G., Guo, N. & Yang, Y., Genome Res 23, 539-546

(2013) ).

[00357] In addition to genome editing by NHEJ or HDR, site-specific gene insertions have been conducted that use both the NHEJ pathway and HR. A combination approach may be applicable in certain settings, possibly including intron/exon borders. NHEJ may prove effective for ligation in the intron, while the error-free HDR may be better suited in the coding region. [00358] As stated previously, the ACADM gene contains 12 exons. Any one or more of the 12 exons or nearby introns may be repaired in order to correct a mutation and restore MCAD activity. Alternatively, there are various mutations associated with MCADD, which are a combination of insertions, deletions, missense, nonsense, frameshift and other mutations, with the common effect of inactivating MCAD. Any one or more of the mutations may be repaired in order to restore the inactive MCAD. For example, one or more of the following pathological variants may be corrected: 157C to T, 343-348 deletion, 347G to A, 351 A to C, 362C to T, 447G to A, 577A to G, 583G to A, 617G to T, 474T to G, 730T to C, 799G to A, 977T to C, 985A to G, 1008 T to A, 1045 C to T, 1055A to G, 1 124T to C, 1 152G to T, 955-956 deletion, 1 100-1 103 deletion, 999 inserted

TAGAATGAGTTAC (SEQ ID NO: 69, 862) and 1 190 inserted T and the variants described in Figures 3A-3E. See also Figure 2. These variants include deletions, insertions and single nucleotide polymorphisms. As a further alternative, ACADM cDNA or minigene (comprised of, natural or synthetic enhancer and promoter, one or more exons, and natural or synthetic introns, and natural or synthetic 3' UTR and polyadenylation signal) may be knocked-in to the locus of the corresponding gene or knocked-in to a safe harbor site, such as AAVS1 (PPP1 R12C), ALB, Angptl3, ApoC3, ASGR2, CCR5, FIX (F9), G6PC, Gys2, HGD, Lp(a), Pcsk9, Serpinal , TF, and/or TTR. The safe harbor locus can be selected from the group consisting of: exon 1 -2 of AAVS1 (PPP1 R12C), exon 1 -2 of ALB, exon 1 -2 of Angptl3, exon 1 -2 of ApoC3, exon 1 -2 of ASGR2, exon 1 -2 of CCR5, exon 1 -2 of FIX (F9), exon 1 -2 of G6PC, exon 1 -2 of Gys2, exon 1 -2 of HGD, exon 1 -2 of Lp(a), exon 1 -2 of Pcsk9, exon 1 -2 of Serpinal , exon 1 -2 of TF, and exon 1 -2 of TTR. In some embodiments, the methods provide one gRNA or a pair of gRNAs that can be used to facilitate incorporation of a new sequence from a polynucleotide donor template to correct one or more mutations or to knock-in a part of or the entire ACADM gene or cDNA.

[00359] As stated previously, the HADHA gene contains twenty exons. Any one or more of the twenty exons or nearby introns may be repaired in order to correct a mutation and restore LCHAD activity. Alternatively, there are various mutations associated with LCHADD, which are a combination of insertions, deletions, missense, nonsense, frameshift and other mutations, with the common effect of inactivating LCHAD activity and/or TFP activity. Any one or more of the mutations may be repaired in order to restore the inactive LCHAD and/or TFP. For example, one or more of the following pathological variants may be corrected: G1528C and other variants described in Figures 4A and 4B. These variants include deletions, insertions and single nucleotide polymorphisms. As a further alternative, HADHA cDNA or minigene (comprised of, natural or synthetic enhancer and promoter, one or more exons, and natural or synthetic introns, and natural or synthetic 3' UTR and polyadenylation signal) may be knocked-in to the locus of the corresponding gene or knocked-in to a safe harbor site, such as AAVS1 (PPP1 R12C), ALB, Angptl3, ApoC3, ASGR2, CCR5, FIX (F9), G6PC, Gys2, HGD, Lp(a), Pcsk9, Serpinal , TF, and/or TTR. The safe harbor locus can be selected from the group consisting of: exon 1 -2 of AAVS1 (PPP1 R12C), exon 1 -2 of ALB, exon 1 -2 of Angptl3, exon 1 -2 of ApoC3, exon 1 -2 of ASGR2, exon 1 -2 of CCR5, exon 1 -2 of FIX (F9), exon 1 -2 of G6PC, exon 1 -2 of Gys2, exon 1 -2 of HGD, exon 1 -2 of Lp(a), exon 1 -2 of Pcsk9, exon 1 -2 of Serpinal , exon 1 -2 of TF, and exon 1 -2 of TTR. In some embodiments, the methods provide one gRNA or a pair of gRNAs that can be used to facilitate incorporation of a new sequence from a polynucleotide donor template to correct one or more mutations or to knock-in a part of or the entire HADHA gene or cDNA.

[00360] As stated previously, the ACADVL gene contains 20 exons. Any one or more of the 20 exons or nearby introns may be repaired in order to correct a mutation and restore VLCAD activity. Alternatively, there are various mutations associated with VLCADD, which are a combination of insertions, deletions, missense, nonsense, frameshift and other mutations, with the common effect of inactivating VLCAD. Any one or more of the mutations may be repaired in order to restore the inactive T848A and A848T. These variants include deletions, insertions and single nucleotide polymorphisms. As a further alternative, ACADVL cDNA or minigene (comprised of, natural or synthetic enhancer and promoter, one or more exons, and natural or synthetic introns, and natural or synthetic 3'UTR and polyadenylation signal) may be knocked-in to the locus of the corresponding gene or knocked-in to a safe harbor site, such as AAVS1 (PPP1 R12C), exon 1 -2 of ALB, exon 1 -2 of Angptl3, exon 1 -2 of ApoC3, exon 1 -2 of ASGR2, exon 1 -2 of CCR5, exon 1 -2 of FIX (F9), exon 1 -2 of G6PC, exon 1 -2 of Gys2, exon 1 -2 of HGD, exon 1 -2 of Lp(a), exon 1 -2 of Pcsk9, exon 1 -2 of Serpinal , exon 1 -2 of TF, and exon 1 - 2 of TTR. In some embodiments, the methods provide one gRNA or a pair of gRNAs that can be used to facilitate incorporation of a new sequence from a polynucleotide donor template to correct one or more mutations or to knock-in a part of or the entire ACADVL gene or cDNA.

[00361] Some embodiments of the methods provide gRNA pairs that make a deletion by cutting the gene twice, one gRNA cutting at the 5' end of one or more mutations and the other gRNA cutting at the 3' end of one or more mutations that facilitates insertion of a new sequence from a polynucleotide donor template to replace the one or more mutations, or deletion may exclude mutant amino acids or amino acids adjacent to it (e.g., premature stop codon) and lead to expression of a functional protein, or restore an open reading frame. The cutting may be accomplished by a pair of DNA endonucleases that each makes a DSB in the genome, or by multiple nickases that together make a DSB in the genome.

[00362] Alternatively, some embodiments of the methods provide one gRNA to make one double-strand cut around one or more mutations that facilitates insertion of a new sequence from a polynucleotide donor template to replace the one or more mutations. The double-strand cut may be made by a single DNA

endonuclease or multiple nickases that together make a DSB in the genome or single gRNA may lead to deletion (MMEJ), which may exclude mutant amino acid (e.g., premature stop codon) and lead to expression of a functional protein, or restore an open reading frame.

[00363] Illustrative modifications within a gene selected from the group consisting of the ACADM gene, the HADHA gene, and the ACADVL gene include replacements within or near (proximal) to the mutations referred to above, such as within the region of less than 3 kb, less than 2kb, less than 1 kb, less than 0.5 kb upstream or downstream of the specific mutation. Given the relatively wide variations of mutations in a gene selected from the group consisting of the ACADM gene, the HADHA gene, and the ACADVL gene, it will be appreciated that numerous variations of the replacements referenced above (including without limitation larger as well as smaller deletions), would be expected to result in restoration of MCAD activity, TFP activity, and/or VLCAD activity.

[00364] Such variants include replacements that are larger in the 5' and/or 3' direction than the specific mutation in question, or smaller in either direction.

Accordingly, by "near" or "proximal" with respect to specific replacements, it is intended that the SSB or DSB locus associated with a desired replacement boundary (also referred to herein as an endpoint) may be within a region that is less than about 3 kb from the reference locus noted. In some embodiments, the SSB or DSB locus is more proximal and within 2 kb, within 1 kb, within 0.5 kb, or within 0.1 kb. In the case of small replacement, the desired endpoint is at or "adjacent to" the reference locus, by which it is intended that the endpoint is within 100 bp, within 50 bp, within 25 bp, or less than about 10 bp to 5 bp from the reference locus.

[00365] Embodiments comprising larger or smaller replacements are expected to provide the same benefit, as long as the MCAD activity, TFP activity, and/or VLCAD activity is restored. It is thus expected that many variations of the replacements described and illustrated herein will be effective for ameliorating a fatty acid disorder selected from the group consisting of MCADD, LCHADD, VLCADD, and combinations thereof.

[00366] Another genome engineering strategy involves exon deletion. Targeted deletion of specific exons is an attractive strategy for treating a large subset of patients with a single therapeutic cocktail. Deletions can either be single exon deletions or multi-exon deletions. While multi-exon deletions can reach a larger number of patients, for larger deletions the efficiency of deletion greatly decreases with increased size. Therefore, deletions range from 40 to 10,000 base pairs (bp) in size. For example, deletions may range from 40-100; 100-300; 300-500; 500-1 ,000; 1 ,000-2,000; 2,000-3,000; 3,000-5,000; or 5,000-10,000 base pairs in size.

[00367] Deletions can occur in enhancer, promoter, 1 st intron, and/or 3'UTR leading to upregulation of the gene expression, and/or through deletion of the regulatory elements. [00368] As stated previously, the MCAD gene contains 12 exons. Any one or more of the 12 exons, or aberrant intronic splice acceptor or donor sites, may be deleted in order to restore the MCAD reading frame. In some embodiments, the methods provide gRNA pairs that can be used to delete exons 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 or 12 or any combination of them.

[00369] As stated previously, the HADHA gene contains 20 exons. Any one or more of the 20 exons, or aberrant intronic splice acceptor or donor sites, may be deleted in order to restore the HADHA reading frame. In some embodiments, the methods provide gRNA pairs that can be used to delete exons 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19 or 20 or any combination of them.

[00370] As stated previously, the VLCAD gene contains 20 exons. Any one or more of the 20 exons, or aberrant intronic splice acceptor or donor sites, may be deleted in order to restore the VLCAD reading frame. In some embodiments, the methods provide gRNA pairs that can be used to delete exons 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19 or 20 or any combination of them.

[00371] In order to ensure that the pre-mRNA is properly processed following deletion, the surrounding splicing signals can be deleted. Splicing donor and acceptors are generally within 100 base pairs of the neighboring intron. Therefore, in some embodiments, methods can provide all gRNAs that cut approximately +/- 100-3100 bp with respect to each exon/intron junction of interest.

[00372] For any of the genome editing strategies, gene editing can be confirmed by sequencing or PCR analysis.

[00373] Target Sequence Selection

[00374] Shifts in the location of the 5' boundary and/or the 3' boundary relative to particular reference loci are used to facilitate or enhance particular applications of gene editing, which depend in part on the endonuclease system selected for the editing, as further described and illustrated herein.

[00375] In a first, nonlimiting example of such target sequence selection, many endonuclease systems have rules or criteria that guide the initial selection of potential target sites for cleavage, such as the requirement of a PAM sequence motif in a particular position adjacent to the DNA cleavage sites in the case of CRISPR Type II or Type V endonucleases.

[00376] In another, nonlimiting example of target sequence selection or optimization, the frequency of "off-target" activity for a particular combination of target sequence and gene editing endonuclease (i.e. the frequency of DSBs occurring at sites other than the selected target sequence) is assessed relative to the frequency of on-target activity. In some cases, cells that have been correctly edited at the desired locus may have a selective advantage relative to other cells. Illustrative, but nonlimiting, examples of a selective advantage include the acquisition of attributes such as enhanced rates of replication, persistence, resistance to certain conditions, enhanced rates of successful engraftment or persistence in vivo following introduction into a patient, and other attributes associated with the maintenance or increased numbers or viability of such cells. In other cases, cells that have been correctly edited at the desired locus may be positively selected for by one or more screening methods used to identify, sort or otherwise select for cells that have been correctly edited. Both selective advantage and directed selection methods may take advantage of the phenotype associated with the correction. In some embodiments, cells may be edited two or more times in order to create a second modification that creates a new phenotype that is used to select or purify the intended population of cells. Such a second modification could be created by adding a second gRNA for a selectable or screenable marker. In some embodiments, cells can be correctly edited at the desired locus using a DNA fragment that contains the cDNA and also a selectable marker.

[00377] Whether any selective advantage is applicable or any directed selection is to be applied in a particular case, target sequence selection is also guided by consideration of off-target frequencies in order to enhance the effectiveness of the application and/or reduce the potential for undesired alterations at sites other than the desired target. As described further and illustrated herein and in the art, the occurrence of off-target activity is influenced by a number of factors including similarities and dissimilarities between the target site and various off target sites, as well as the particular endonuclease used. Bioinformatics tools are available that assist in the prediction of off-target activity, and frequently such tools can also be used to identify the most likely sites of off-target activity, which can then be assessed in experimental settings to evaluate relative frequencies of off-target to on-target activity, thereby allowing the selection of sequences that have higher relative on-target activities. Illustrative examples of such techniques are provided herein, and others are known in the art.

[00378] Another aspect of target sequence selection relates to homologous recombination events. Sequences sharing regions of homology can serve as focal points for homologous recombination events that result in deletion of intervening sequences. Such recombination events occur during the normal course of replication of chromosomes and other DNA sequences, and also at other times when DNA sequences are being synthesized, such as in the case of repairs of double-strand breaks (DSBs), which occur on a regular basis during the normal cell replication cycle but may also be enhanced by the occurrence of various events (such as UV light and other inducers of DNA breakage) or the presence of certain agents (such as various chemical inducers). Many such inducers cause DSBs to occur indiscriminately in the genome, and DSBs are regularly being induced and repaired in normal cells. During repair, the original sequence may be reconstructed with complete fidelity, however, in some cases, small insertions or deletions (referred to as "indels") are introduced at the DSB site.

[00379] DSBs may also be specifically induced at particular locations, as in the case of the endonucleases systems described herein, which can be used to cause directed or preferential gene modification events at selected chromosomal locations. The tendency for homologous sequences to be subject to recombination in the context of DNA repair (as well as replication) can be taken advantage of in a number of circumstances, and is the basis for one application of gene editing systems, such as CRISPR, in which homology directed repair is used to insert a sequence of interest, provided through use of a "donor" polynucleotide, into a desired chromosomal location.

[00380] Regions of homology between particular sequences, which can be small regions of "microhomology" that may comprise as few as ten basepairs or less, can also be used to bring about desired deletions. For example, a single DSB is introduced at a site that exhibits microhomology with a nearby sequence. During the normal course of repair of such DSB, a result that occurs with high frequency is the deletion of the intervening sequence as a result of recombination being facilitated by the DSB and concomitant cellular repair process.

[00381] In some circumstances, however, selecting target sequences within regions of homology can also give rise to much larger deletions, including gene fusions (when the deletions are in coding regions), which may or may not be desired given the particular circumstances.

[00382] The examples provided herein further illustrate the selection of various target regions for the creation of DSBs designed to induce replacements that result in restoration of MCAD activity, TFP activity, and or VLCAD activity, as well as the selection of specific target sequences within such regions that are designed to minimize off-target events relative to on-target events.

[00383] Nucleic acid modifications

[00384] In some embodiments, polynucleotides introduced into cells comprise one or more modifications that can be used individually or in combination, for example, to enhance activity, stability or specificity, alter delivery, reduce innate immune responses in host cells, or for other enhancements, as further described herein and known in the art.

[00385] In some embodiments, modified polynucleotides are used in the

CRISPR/Cas9 or CRISPR/Cpfl system, in which case the guide RNAs (either single-molecule guides or double-molecule guides) and/or a DNA or an RNA encoding a Cas9 or Cpf1 endonuclease introduced into a cell can be modified, as described and illustrated below. Such modified polynucleotides can be used in the CRISPR/Cas system to edit any one or more genomic loci.

[00386] Using the CRISPR/Cas9 or CRISPR/Cpf1 system for purposes of nonlimiting illustrations of such uses, modifications of guide RNAs can be used to enhance the formation or stability of the CRISPR/Cas9 or CRISPR/Cpf1 genome editing complex comprising guide RNAs, which may be single-molecule guides or double-molecule, and a Cas9 or Cpfl endonuclease. Modifications of guide RNAs can also or alternatively be used to enhance the initiation, stability or kinetics of interactions between the genome editing complex with the target sequence in the genome, which can be used, for example, to enhance on-target activity.

Modifications of guide RNAs can also or alternatively be used to enhance specificity, e.g., the relative rates of genome editing at the on-target site as compared to effects at other (off-target) sites.

[00387] Modifications can also or alternatively be used to increase the stability of a guide RNA, e.g., by increasing its resistance to degradation by ribonucleases (RNases) present in a cell, thereby causing its half-life in the cell to be increased. Modifications enhancing guide RNA half-life can be particularly useful in

embodiments in which a Cas9 or Cpf1 endonuclease is introduced into the cell to be edited via an RNA that needs to be translated in order to generate

endonuclease, because increasing the half-life of guide RNAs introduced at the same time as the RNA encoding the endonuclease can be used to increase the time that the guide RNAs and the encoded Cas9 or Cpfl endonuclease co-exist in the cell.

[00388] Modifications can also or alternatively be used to decrease the likelihood or degree to which RNAs introduced into cells elicit innate immune responses. Such responses, which have been well characterized in the context of RNA interference (RNAi), including small-interfering RNAs (siRNAs), as described below and in the art, tend to be associated with reduced half-life of the RNA and/or the elicitation of cytokines or other factors associated with immune responses.

[00389] One or more types of modifications can also be made to RNAs encoding an endonuclease that are introduced into a cell, including, without limitation, modifications that enhance the stability of the RNA (such as by increasing its degradation by RNAses present in the cell), modifications that enhance translation of the resulting product (i.e. the endonuclease), and/or modifications that decrease the likelihood or degree to which the RNAs introduced into cells elicit innate immune responses.

[00390] Combinations of modifications, such as the foregoing and others, can likewise be used. In the case of CRISPR/Cas9 or CRISPR/Cpfl , for example, one or more types of modifications can be made to guide RNAs (including those exemplified above), and/or one or more types of modifications can be made to RNAs encoding Cas endonuclease (including those exemplified above).

[00391] By way of illustration, guide RNAs used in the CRISPR/Cas9 or CRISPR/Cpf1 system, or other smaller RNAs can be readily synthesized by chemical means, enabling a number of modifications to be readily incorporated, as illustrated below and described in the art. While chemical synthetic procedures are continually expanding, purifications of such RNAs by procedures such as high performance liquid chromatography (HPLC, which avoids the use of gels such as PAGE) tends to become more challenging as polynucleotide lengths increase significantly beyond a hundred or so nucleotides. One approach used for generating chemically-modified RNAs of greater length is to produce two or more molecules that are ligated together. Much longer RNAs, such as those encoding a Cas9 endonuclease, are more readily generated enzymatically. While fewer types of modifications are generally available for use in enzymatically produced RNAs, there are still modifications that can be used to, e.g., enhance stability, reduce the likelihood or degree of innate immune response, and/or enhance other attributes, as described further below and in the art; and new types of modifications are regularly being developed.

[00392] By way of illustration of various types of modifications, especially those used frequently with smaller chemically synthesized RNAs, modifications can comprise one or more nucleotides modified at the 2' position of the sugar, in some embodiments a 2'-0-alkyl, 2'-0-alkyl-0-alkyl, or 2'-fluoro-modified nucleotide. In some embodiments, RNA modifications include 2'-fluoro, 2'-amino or 2' O-methyl modifications on the ribose of pyrimidines, abasic residues, or an inverted base at the 3' end of the RNA. Such modifications are routinely incorporated into oligonucleotides and these oligonucleotides have been shown to have a higher Tm (i.e., higher target binding affinity) than 2'-deoxyoligonucleotides against a given target.

[00393] A number of nucleotide and nucleoside modifications have been shown to make the oligonucleotide into which they are incorporated more resistant to nuclease digestion than the native oligonucleotide; these modified oligos survive intact for a longer time than unmodified oligonucleotides. Specific examples of modified oligonucleotides include those comprising modified backbones, for example, phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages. Some oligonucleotides are oligonucleotides with

phosphorothioate backbones and those with heteroatom backbones, particularly CH2 -NH-0-CH2, CH,~N(CH3)~0~CH2 (known as a methylene(methylimino) or MMI backbone), CH2 -O-N (CH3)-CH2, CH2 -N (CH3)-N (CH3)-CH2 and O-N (CH3)- CH2 -CH2 backbones, wherein the native phosphodiester backbone is represented as O- P- O- CH,); amide backbones [see De Mesmaeker ef a/. , Ace. Chem. Res., 28:366-374 (1995)]; morpholino backbone structures (see Summerton and Weller, U.S. Pat. No. 5,034,506); peptide nucleic acid (PNA) backbone (wherein the phosphodiester backbone of the oligonucleotide is replaced with a polyamide backbone, the nucleotides being bound directly or indirectly to the aza nitrogen atoms of the polyamide backbone, see Nielsen et ai, Science 1991 , 254, 1497). Phosphorus-containing linkages include, but are not limited to,

phosphorothioates, chiral phosphorothioates, phosphorodithioates,

phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates comprising 3'alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates comprising 3'-amino phosphoramidate and

aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'; see US patent nos. 3,687,808; 4,469,863; 4,476,301 ; 5,023,243; 5, 177, 196; 5, 188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321 , 131 ; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519, 126; 5,536,821 ; 5,541 ,306; 5,550, 1 1 1 ; 5,563,253; 5,571 ,799; 5,587,361 ; and 5,625,050.

[00394] Morpholino-based oligomeric compounds are described in Braasch and David Corey, Biochemistry, 41 (14): 4503-4510 (2002); Genesis, Volume 30, Issue 3, (2001 ); Heasman, Dev. Biol., 243: 209-214 (2002); Nasevicius et al., Nat. Genet., 26:216-220 (2000); Lacerra et al., Proc. Natl. Acad. Sci., 97: 9591 -9596 (2000); and U.S. Pat. No. 5,034,506, issued Jul. 23, 1991.

[00395] Cyclohexenyl nucleic acid oligonucleotide mimetics are described in Wang et al., J. Am. Chem. Soc, 122: 8595-8602 (2000).

[00396] Modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These comprise those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S, and CH2 component parts; see US patent nos. 5,034,506; 5,166,315; 5, 185,444;

5,214,134; 5,216, 141 ; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541 ,307; 5,561 ,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439.

[00397] One or more substituted sugar moieties can also be included, e.g., one of the following at the 2' position: OH, SH, SCH3, F, OCN, OCH3 OCH3, OCH3 0(CH2)n CH3, 0(CH2)n NH2, or O(CH2)n CH3, where n is from 1 to about 10; C1 to C10 lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; CI; Br; CN; CF3; OCF3; 0-, S-, or N-alkyl; 0-, S-, or N-alkenyl; SOCH3; S02 CH3; ON02; N02; N3; NH2; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino;

polyalkylamino; substituted silyl; an RNA cleaving group; a reporter group; an intercalator; a group for improving the pharmacokinetic properties of an

oligonucleotide; or a group for improving the pharmacodynamic properties of an oligonucleotide and other substituents having similar properties. In some embodiments, a modification includes 2'-methoxyethoxy (2'-0-CH2CH2OCH3, also known as 2'-0-(2-methoxyethyl)) (Martin et al, Helv. Chim. Acta, 1995, 78, 486). Other modifications include 2'-methoxy (2 -0-CH3), 2'-propoxy (2 -OCH2 CH2CH3) and 2'-fluoro (2'-F). Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3' position of the sugar on the 3' terminal nucleotide and the 5' position of 5' terminal nucleotide. Oligonucleotides may also have sugar mimetics, such as cyclobutyls in place of the pentofuranosyl group.

[00398] In some embodiments, both a sugar and an internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, for example, an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative United States patents that teach the preparation of PNA compounds comprise, but are not limited to, US patent nos. 5,539,082; 5,714,331 ; and 5,719,262. Further teaching of PNA compounds can be found in Nielsen et al, Science, 254: 1497-1500 (1991 ).

[00399] Guide RNAs can also include, additionally or alternatively, nucleobase

(often referred to in the art simply as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C), and uracil (U). Modified nucleobases include

nucleobases found only infrequently or transiently in natural nucleic acids, e.g., hypoxanthine, 6-methyladenine, 5-Me pyrimidines, particularly 5-methylcytosine

(also referred to as 5-methyl-2' deoxycytosine and often referred to in the art as 5-

Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC and gentobiosyl HMC, as well as synthetic nucleobases, e.g., 2-aminoadenine, 2-(methylamino)adenine, 2-

(imidazolylalkyl)adenine, 2-(aminoalklyamino)adenine or other heterosubstituted alkyladenines, 2-thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8- azaguanine, 7-deazaguanine, N6 (6-aminohexyl)adenine, and 2,6-diaminopurine.

Kornberg, A., DNA Replication, W. H. Freeman & Co., San Francisco, pp75-77

(1980); Gebeyehu et al., Nucl. Acids Res. 15:4513 (1997). A "universal" base known in the art, e.g., inosine, can also be included. 5-Me-C substitutions have been shown to increase nucleic acid duplex stability by 0.6-1 .2 °C. (Sanghvi, Y. S., in Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are embodiments of base substitutions.

[00400] Modified nucleobases comprise other synthetic and natural

nucleobases, such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudo-uracil), 4- thiouracil, 8-halo, 8-amino, 8-thiol, 8- thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5- bromo, 5-trifluoromethyl and other 5- substituted uracils and cytosines, 7-methylquanine and 7-methyladenine, 8- azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, and 3- deazaguanine and 3-deazaadenine.

[00401] Further, nucleobases comprise those disclosed in United States Patent No. 3,687,808, those disclosed in 'The Concise Encyclopedia of Polymer Science And Engineering', pages 858-859, Kroschwitz, J. I ., ed. John Wiley & Sons, 1990, those disclosed by Englisch et ai, Angewandle Chemie, International Edition', 1991 , 30, page 613, and those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications', pages 289- 302, Crooke, ST. and Lebleu, B. ea., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the disclosure. These include 5- substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, comprising 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5- methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1 .2°C (Sanghvi, Y.S., Crooke, ST. and Lebleu, B. , eds, 'Antisense Research and Applications', CRC Press, Boca Raton, 1993, pp. 276-278) and are embodiments of base substitutions, even more particularly when combined with 2'- O-methoxyethyl sugar modifications. Modified nucleobases are described in US patent nos. 3,687,808, as well as 4,845,205; 5, 130,302; 5, 134,066; 5, 175,273; 5,367,066; 5,432,272; 5,457, 187; 5,459,255; 5,484,908; 5,502, 177; 5,525,71 1 ; 5,552,540; 5,587,469; 5,596,091 ; 5,614,617; 5,681 ,941 ; 5,750,692; 5,763,588; 5,830,653; 6,005,096; and U.S. Patent Application Publication 2003/0158403.

[00402] Thus, the term "modified" refers to a non-natural sugar, phosphate, or base that is incorporated into a guide RNA, an endonuclease, or both a guide RNA and an endonuclease. It is not necessary for all positions in a given oligonucleotide to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single oligonucleotide, or even in a single nucleoside within an oligonucleotide.

[00403] In some embodiments, the guide RNAs and/or mRNA (or DNA) encoding an endonuclease are chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide. Such moieties comprise, but are not limited to, lipid moieties such as a cholesterol moiety [Letsinger ef a/., Proc. Natl. Acad. Sci. USA, 86: 6553-6556

(1989)]; cholic acid [Manoharan et al., Bioorg. Med. Chem. Let., 4: 1053-1060

(1994)]; a thioether, e.g. , hexyl-S- tritylthiol [Manoharan et al, Ann. N. Y. Acad. Sci.,

660: 306-309 (1992) and Manoharan et al. , Bioorg. Med. Chem. Let., 3: 2765-2770

(1993)]; a thiocholesterol [Oberhauser et al, Nucl. Acids Res., 20: 533-538 (1992)]; an aliphatic chain, e.g., dodecandiol or undecyl residues [Kabanov et al., FEBS

Lett., 259: 327-330 (1990) and Svinarchuk et al., Biochimie, 75: 49- 54 (1993)]; a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1 ,2-di-O- hexadecyl- rac-glycero-3-H-phosphonate [Manoharan et al., Tetrahedron Lett., 36:

3651 -3654 (1995) and Shea et al., Nucl. Acids Res., 18: 3777-3783 (1990)]; a polyamine or a polyethylene glycol chain [Mancharan et al. , Nucleosides &

Nucleotides, 14: 969-973 (1995)]; adamantane acetic acid [Manoharan et al.,

Tetrahedron Lett., 36: 3651 -3654 (1995)]; a palmityl moiety [(Mishra et al., Biochim.

Biophys. Acta, 1264: 229-237 (1995)]; or an octadecylamine or hexylamino- carbonyl-t oxycholesterol moiety [Crooke et al., J. Pharmacol. Exp. Then, 277: 923-

937 (1996)]. See also US Patent Nos. 4,828,979; 4,948,882; 5,218, 105; 5,525,465;

5,541 ,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731 ; 5,580,731 ; 5,591 ,584;

5, 109, 124; 5, 1 18,802; 5, 138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718;

5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941 ;

4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5, 1 12,963; 5,214, 136; 5,082,830; 5, 1 12,963; 5,214, 136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371 ,241 , 5,391 ,723; 5,416,203, 5,451 ,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574, 142; 5,585,481 ; 5,587,371 ; 5,595,726; 5,597,696; 5,599,923; 5,599, 928 and 5,688,941 .

[00404] Sugars and other moieties can be used to target proteins and complexes comprising nucleotides, such as cationic polysomes and liposomes, to particular sites. For example, hepatic cell directed transfer can be mediated via asialoglycoprotein receptors (ASGPRs); see, e.g., Hu, et ai, Protein Pept Lett. 21 (10): 1025-30 (2014). Other systems known in the art and regularly developed can be used to target biomolecules of use in the present case and/or complexes thereof to particular target cells of interest.

[00405] These targeting moieties or conjugates can include conjugate groups covalently bound to functional groups, such as primary or secondary hydroxyl groups. Conjugate groups of the disclosure include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Typical conjugate groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties, in the context of this disclosure, include groups that improve uptake, enhance resistance to degradation, and/or strengthen sequence-specific hybridization with the target nucleic acid. Groups that enhance the pharmacokinetic properties, in the context of this disclosure, include groups that improve uptake, distribution, metabolism or excretion of the compounds of the present disclosure. Representative conjugate groups are disclosed in

International Patent Application No. PCT/US92/09196, filed Oct. 23, 1992

(published as WO 1993/007883), and U.S. Pat. No. 6,287,860. Conjugate moieties include, but are not limited to, lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl-5-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac- glycerol or triethylammonium l,2-di-0-hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxy cholesterol moiety. See, e.g., U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218, 105; 5,525,465; 5,541 ,313; 5,545,730;

5,552,538; 5,578,717, 5,580,731 ; 5,580,731 ; 5,591 ,584; 5, 109, 124; 5, 1 18,802; 5, 138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941 ; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5, 1 12,963; 5,214, 136; 5,082,830; 5, 1 12,963; 5,214, 136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371 ,241 , 5,391 ,723; 5,416,203, 5,451 ,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481 ; 5,587,371 ; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941 .

[00406] Longer polynucleotides that are less amenable to chemical synthesis and are typically produced by enzymatic synthesis can also be modified by various means. Such modifications can include, for example, the introduction of certain nucleotide analogs, the incorporation of particular sequences or other moieties at the 5' or 3' ends of molecules, and other modifications. By way of illustration, the mRNA encoding Cas9 is approximately 4 kb in length and can be synthesized by in vitro transcription. Modifications to the mRNA can be applied to, e.g., increase its translation or stability (such as by increasing its resistance to degradation with a cell), or to reduce the tendency of the RNA to elicit an innate immune response that is often observed in cells following introduction of exogenous RNAs, particularly longer RNAs such as that encoding Cas9.

[00407] Numerous such modifications have been described in the art, such as polyA tails, 5' cap analogs (e.g., Anti Reverse Cap Analog (ARCA) or

m7G(5')ppp(5')G (mCAP)), modified 5' or 3' untranslated regions (UTRs), use of modified bases (such as Pseudo-UTP, 2-Thio-UTP, 5-Methylcytidine-5'- Triphosphate (5-Methyl-CTP) or N6-Methyl-ATP), or treatment with phosphatase to remove 5' terminal phosphates. These and other modifications are known in the art, and new modifications of RNAs are regularly being developed.

[00408] There are numerous commercial suppliers of modified RNAs, including for example, TriLink Biotech, AxoLabs, Bio-Synthesis Inc., Dharmacon and many others. As described by TriLink, for example, 5-Methyl-CTP can be used to impart desirable characteristics, such as increased nuclease stability, increased translation or reduced interaction of innate immune receptors with in vitro transcribed RNA. 5- Methylcytidine-5'-Triphosphate (5-Methyl-CTP), N6-Methyl-ATP, as well as

Pseudo-UTP and 2-Thio-UTP, have also been shown to reduce innate immune stimulation in culture and in vivo while enhancing translation, as illustrated in publications by Kormann et al. and Warren et al. referred to below.

[00409] It has been shown that chemically modified mRNA delivered in vivo can be used to achieve improved therapeutic effects; see, e.g., Kormann et al., Nature Biotechnology 29, 154-157 (201 1 ). Such modifications can be used, for example, to increase the stability of the RNA molecule and/or reduce its immunogenicity. Using chemical modifications such as Pseudo-U, N6-Methyl-A, 2-Thio-U and 5- Methyl-C, it was found that substituting just one quarter of the uridine and cytidine residues with 2-Thio-U and 5-Methyl-C respectively resulted in a significant decrease in toll-like receptor (TLR) mediated recognition of the mRNA in mice. By reducing the activation of the innate immune system, these modifications can be used to effectively increase the stability and longevity of the mRNA in vivo; see, e.g., Kormann et al., supra.

[00410] It has also been shown that repeated administration of synthetic messenger RNAs incorporating modifications designed to bypass innate anti-viral responses can reprogram differentiated human cells to pluripotency. See, e.g., Warren, et al., Cell Stem Cell, 7(5):618-30 (2010). Such modified mRNAs that act as primary reprogramming proteins can be an efficient means of reprogramming multiple human cell types. Such cells are referred to as induced pluripotency stem cells (iPSCs), and it was found that enzymatically synthesized RNA incorporating 5- Methyl-CTP, Pseudo-UTP and an Anti Reverse Cap Analog (ARCA) could be used to effectively evade the cell's antiviral response; see, e.g., Warren et al., supra.

[00411] Other modifications of polynucleotides described in the art include, for example, the use of polyA tails, the addition of 5' cap analogs (such as

m7G(5')ppp(5')G (mCAP)), modifications of 5' or 3' untranslated regions (UTRs), or treatment with phosphatase to remove 5' terminal phosphates - and new

approaches are regularly being developed. [00412] A number of compositions and techniques applicable to the generation of modified RNAs for use herein have been developed in connection with the modification of RNA interference (RNAi), including small-interfering RNAs (siRNAs). siRNAs present particular challenges in vivo because their effects on gene silencing via mRNA interference are generally transient, which can require repeat administration. In addition, siRNAs are double-stranded RNAs (dsRNA) and mammalian cells have immune responses that have evolved to detect and neutralize dsRNA, which is often a by-product of viral infection. Thus, there are mammalian enzymes such as PKR (dsRNA-responsive kinase), and potentially retinoic acid-inducible gene I (RIG-I), that can mediate cellular responses to dsRNA, as well as Toll-like receptors (such as TLR3, TLR7 and TLR8) that can trigger the induction of cytokines in response to such molecules; see, e.g., the reviews by Angart et ai, Pharmaceuticals (Basel) 6(4): 440-468 (2013); Kanasty et ai, Molecular Therapy 20(3): 513-524 (2012); Burnett et ai, Biotechnol J.

6(9): 1 130-46 (201 1 ); Judge and MacLachlan, Hum Gene Ther 19(2): 1 1 1 -24 (2008); and references cited therein.

[00413] A large variety of modifications have been developed and applied to enhance RNA stability, reduce innate immune responses, and/or achieve other benefits that can be useful in connection with the introduction of polynucleotides into human cells, as described herein; see, e.g., the reviews by Whitehead KA et ai, Annual Review of Chemical and Biomolecular Engineering, 2: 77-96 (201 1 ); Gaglione and Messere, Mini Rev Med Chem, 10(7):578-95 (2010); Chernolovskaya et al, Curr Opin Mol Ther., 12(2): 158-67 (2010); Deleavey et ai, Curr Protoc Nucleic Acid Chem Chapter 16:Unit 16.3 (2009); Behlke, Oligonucleotides

18(4):305-19 (2008); Fucini et ai , Nucleic Acid Ther 22(3): 205-210 (2012);

Bremsen et ai, Front Genet 3: 154 (2012).

[00414] As noted above, there are a number of commercial suppliers of modified

RNAs, many of which have specialized in modifications designed to improve the effectiveness of siRNAs. A variety of approaches are offered based on various findings reported in the literature. For example, Dharmacon notes that replacement of a non-bridging oxygen with sulfur (phosphorothioate, PS) has been extensively used to improve nuclease resistance of siRNAs, as reported by Kole, Nature Reviews Drug Discovery 1 1 :125-140 (2012). Modifications of the 2'-position of the hbose have been reported to improve nuclease resistance of the internucleotide phosphate bond while increasing duplex stability (Tm), which has also been shown to provide protection from immune activation. A combination of moderate PS backbone modifications with small, well-tolerated 2'-substitutions (2'-0-Methyl, 2'- Fluoro, 2'-Hydro) have been associated with highly stable siRNAs for applications in vivo, as reported by Soutschek et al. Nature 432: 173-178 (2004); and 2 -0- Methyl modifications have been reported to be effective in improving stability as reported by Volkov, Oligonucleotides 19: 191 -202 (2009). With respect to decreasing the induction of innate immune responses, modifying specific sequences with 2'-0-Methyl, 2'-Fluoro, 2'-Hydro have been reported to reduce TLR7/TLR8 interaction while generally preserving silencing activity; see, e.g., Judge et al., Mol. Ther. 13:494-505 (2006); and Cekaite et al., J. Mol. Biol. 365:90- 108 (2007). Additional modifications, such as 2-thiouracil, pseudouracil, 5- methylcytosine, 5-methyluracil, and N6-methyladenosine have also been shown to minimize the immune effects mediated by TLR3, TLR7, and TLR8; see, e.g., Kariko, K. et al., Immunity 23: 165-175 (2005).

[00415] As is also known in the art, and commercially available, a number of conjugates can be applied to polynucleotides, such as RNAs, for use herein that can enhance their delivery and/or uptake by cells, including for example, cholesterol, tocopherol and folic acid, lipids, peptides, polymers, linkers and aptamers; see, e.g., the review by Winkler, Ther. Deliv. 4:791 -809 (2013), and references cited therein.

[00416] Codon-Optimization

[00417] In some embodiments, a polynucleotide encoding a site-directed polypeptide is codon-optimized according to methods standard in the art for expression in the cell containing the target DNA of interest. For example, if the intended target nucleic acid is in a human cell, a human codon-optimized polynucleotide encoding Cas9 is contemplated for use for producing the Cas9 polypeptide. [00418] Complexes of a Genome-targeting Nucleic Acid and a Site-Directed Polypeptide

[00419] A genome-targeting nucleic acid interacts with a site-directed

polypeptide (e.g., a nucleic acid-guided nuclease such as Cas9), thereby forming a complex. The genome-targeting nucleic acid guides the site-directed polypeptide to a target nucleic acid.

[00420] Ribonucleoprotein complexes (RNPs)

[00421] The site-directed polypeptide and genome-targeting nucleic acid may each be administered separately to a cell or a patient. On the other hand, the site- directed polypeptide may be pre-complexed with one or more guide RNAs, or one or more crRNA together with a tracrRNA. The pre-complexed material may then be administered to a cell or a patient. Such pre-complexed material is known as a ribonucleoprotein particle (RNP). The site-directed polypeptide in the RNP can be, for example, a Cas9 endonuclease or a Cpf1 endonuclease. The site-directed polypeptide can be flanked at the N-terminus, the C-terminus, or both the N- terminus and C-terminus by one or more nuclear localization signals (NLSs). For example, a Cas9 endonuclease can be flanked by two NLSs, one NLS located at the N-terminus and the second NLS located at the C-terminus. The NLS can be any NLS known in the art, such as a SV40 NLS. The weight ratio of genome-targeting nucleic acid to site-directed polypeptide in the RNP can be 1 : 1 . For example, the weight ratio of sgRNA to Cas9 endonuclease in the RNP can be 1 : 1 .

[00422] Nucleic Acids Encoding System Components

[00423] The present disclosure provides a nucleic acid comprising a nucleotide sequence encoding a genome-targeting nucleic acid of the disclosure, a site- directed polypeptide of the disclosure, and/or any nucleic acid or proteinaceous molecule necessary to carry out the embodiments of the methods of the disclosure.

[00424] In some embodiments, the nucleic acid encoding a genome-targeting nucleic acid of the disclosure, a site-directed polypeptide of the disclosure, and/or any nucleic acid or proteinaceous molecule necessary to carry out the embodiments of the methods of the disclosure comprises a vector (e.g., a recombinant expression vector).

[00425] The term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid", which refers to a circular double-stranded DNA loop into which additional nucleic acid segments can be ligated. Another type of vector is a viral vector, wherein additional nucleic acid segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome.

[00426] In some embodiments, vectors are capable of directing the expression of nucleic acids to which they are operatively linked. Such vectors are referred to herein as "recombinant expression vectors", or more simply "expression vectors", which serve equivalent functions.

[00427] The term "operably linked" means that the nucleotide sequence of interest is linked to regulatory sequence(s) in a manner that allows for expression of the nucleotide sequence. The term "regulatory sequence" is intended to include, for example, promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are well known in the art and are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). Regulatory sequences include those that direct constitutive expression of a nucleotide sequence in many types of host cells, and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the target cell, the level of expression desired, and the like.

[00428] Expression vectors contemplated include, but are not limited to, viral vectors based on vaccinia virus, poliovirus, adenovirus, adeno-associated virus, SV40, herpes simplex virus, human immunodeficiency virus, retrovirus (e.g., Murine Leukemia Virus, spleen necrosis virus, and vectors derived from retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, a lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus) and other recombinant vectors. Other vectors contemplated for eukaryotic target cells include, but are not limited to, the vectors pXT1 , pSG5, pSVK3, pBPV, pMSG, and pSVLSV40 (Pharmacia). Other vectors may be used so long as they are compatible with the host cell.

[00429] In some embodiments, a vector comprises one or more transcription and/or translation control elements. Depending on the host/vector system utilized, any of a number of suitable transcription and translation control elements, including constitutive and inducible promoters, transcription enhancer elements, transcription terminators, etc. may be used in the expression vector. In some embodiments, the vector is a self-inactivating vector that either inactivates the viral sequences or the components of the CRISPR machinery or other elements.

[00430] Non-limiting examples of suitable eukaryotic promoters (i.e., promoters functional in a eukaryotic cell) include those from cytomegalovirus (CMV) immediate early, herpes simplex virus (HSV) thymidine kinase, early and late SV40, long terminal repeats (LTRs) from retrovirus, human elongation factor-1 promoter (EF1 ), a hybrid construct comprising the cytomegalovirus (CMV) enhancer fused to the chicken beta-actin promoter (CAG), murine stem cell virus promoter (MSCV), phosphoglycerate kinase-1 locus promoter (PGK), and mouse metallothionein-l.

[00431] For expressing small RNAs, including guide RNAs used in connection with Cas endonuclease, various promoters such as RNA polymerase III promoters, including for example U6 and H1 , can be advantageous. Descriptions of and parameters for enhancing the use of such promoters are known in art, and additional information and approaches are regularly being described; see, e.g., Ma, H. et al., Molecular Therapy - Nucleic Acids 3, e161 (2014)

doi: 10.1038/mtna.2014.12.

[00432] The expression vector may also contain a ribosome binding site for translation initiation and a transcription terminator. The expression vector may also include appropriate sequences for amplifying expression. The expression vector may also include nucleotide sequences encoding non-native tags (e.g., histidine tag, hemagglutinin tag, green fluorescent protein, etc.) that are fused to the site- directed polypeptide, thus resulting in a fusion protein.

[00433] In some embodiments, a promoter is an inducible promoter (e.g., a heat shock promoter, tetracycline-regulated promoter, steroid-regulated promoter, metal- regulated promoter, estrogen receptor-regulated promoter, etc.). In some embodiments, a promoter is a constitutive promoter (e.g., CMV promoter, UBC promoter). In some embodiments, the promoter is a spatially restricted and/or temporally restricted promoter (e.g., a tissue specific promoter, a cell type specific promoter, etc.).

[00434] In some embodiments, the nucleic acid encoding a genome-targeting nucleic acid of the disclosure and/or a site-directed polypeptide are packaged into or on the surface of delivery vehicles for delivery to cells. Delivery vehicles contemplated include, but are not limited to, nanospheres, liposomes, quantum dots, nanoparticles, polyethylene glycol particles, hydrogels, and micelles. As described in the art, a variety of targeting moieties can be used to enhance the preferential interaction of such vehicles with desired cell types or locations.

[00435] Introduction of the complexes, polypeptides, and nucleic acids of the disclosure into cells can occur by viral or bacteriophage infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, nucleofection, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE- dextran mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct micro-injection, nanoparticle- mediated nucleic acid delivery, and the like.

[00436] Delivery

[00437] Guide RNA polynucleotides (RNA or DNA) and/or endonuclease polynucleotide(s) (RNA or DNA) can be delivered by viral or non-viral delivery vehicles known in the art. Alternatively, endonuclease polypeptide(s) may be delivered by non-viral delivery vehicles known in the art, such as electroporation or lipid nanoparticles. In some embodiments, the DNA endonuclease may be delivered as one or more polypeptides, either alone or pre-complexed with one or more guide RNAs, or one or more crRNA together with a tracrRNA.

[00438] Polynucleotides may be delivered by non-viral delivery vehicles including, but not limited to, nanoparticles, liposomes, ribonucleoproteins, positively charged peptides, small molecule RNA-conjugates, aptamer-RNA chimeras, and RNA-fusion protein complexes. Some exemplary non-viral delivery vehicles are described in Peer and Lieberman, Gene Therapy, 18: 1 127-1 133 (201 1 ) (which focuses on non-viral delivery vehicles for siRNA that are also useful for delivery of other polynucleotides).

[00439] Polynucleotides, such as guide RNA, sgRNA, and mRNA encoding an endonuclease, may be delivered to a cell or a patient by a lipid nanoparticle (LNP).

[00440] A LNP refers to any particle having a diameter of less than 1000 nm, 500 nm, 250 nm, 200 nm, 150 nm, 100 nm, 75 nm, 50 nm, or 25 nm. Alternatively, a nanoparticle may range in size from 1 -1000 nm, 1 -500 nm, 1 -250 nm, 25-200 nm, 25-100 nm, 35-75 nm, or 25-60 nm.

[00441] LNPs may be made from cationic, anionic, or neutral lipids. Neutral lipids, such as the fusogenic phospholipid DOPE or the membrane component cholesterol, may be included in LNPs as 'helper lipids' to enhance transfection activity and nanoparticle stability. Limitations of cationic lipids include low efficacy owing to poor stability and rapid clearance, as well as the generation of

inflammatory or anti-inflammatory responses.

[00442] LNPs may also be comprised of hydrophobic lipids, hydrophilic lipids, or both hydrophobic and hydrophilic lipids.

[00443] Any lipid or combination of lipids that are known in the art may be used to produce a LNP. Examples of lipids used to produce LNPs are: DOTMA, DOSPA, DOTAP, DMRIE, DC-cholesterol, DOTAP-cholesterol, GAP-DMORIE-DPyPE, and GL67A-DOPE-DMPE-polyethylene glycol (PEG). Examples of cationic lipids are: 98N12-5, C12-200, DLin-KC2-DMA (KC2), DLin-MC3-DMA (MC3), XTC, MD1 , and 7C1 . Examples of neutral lipids are: DPSC, DPPC, POPC, DOPE, and SM.

Examples of PEG-modified lipids are: PEG-DMG, PEG-CerC14, and PEG-CerC20. [00444] The lipids may be combined in any number of molar ratios to produce a LNP. In addition, the polynucleotide(s) may be combined with lipid(s) in a wide range of molar ratios to produce a LNP.

[00445] As stated previously, the site-directed polypeptide and genome-targeting nucleic acid may each be administered separately to a cell or a patient. On the other hand, the site-directed polypeptide may be pre-complexed with one or more guide RNAs, or one or more crRNA together with a tracrRNA. The pre-complexed material may then be administered to a cell or a patient. Such pre-complexed material is known as a ribonucleoprotein particle (RNP).

[00446] RNA is capable of forming specific interactions with RNA or DNA. While this property is exploited in many biological processes, it also comes with the risk of promiscuous interactions in a nucleic acid-rich cellular environment. One solution to this problem is the formation of ribonucleoprotein particles (RNPs), in which the RNA is pre-complexed with an endonuclease. Another benefit of the RNP is protection of the RNA from degradation.

[00447] The endonuclease in the RNP may be modified or unmodified. Likewise, the gRNA, crRNA, tracrRNA, or sgRNA may be modified or unmodified. Numerous modifications are known in the art and may be used.

[00448] The endonuclease and sgRNA are generally combined in a 1 : 1 molar ratio. Alternatively, the endonuclease, crRNA and tracrRNA are generally combined in a 1 : 1 : 1 molar ratio. However, a wide range of molar ratios may be used to produce a RNP.

[00449] Adeno-associated virus (AAV)

[00450] A recombinant adeno-associated virus (AAV) vector may be used for delivery. Techniques to produce rAAV particles, in which an AAV genome to be packaged that includes the polynucleotide to be delivered, rep and cap genes, and helper virus functions are provided to a cell are standard in the art. Production of rAAV typically requires that the following components are present within a single cell (denoted herein as a packaging cell): a rAAV genome, AAV rep and cap genes separate from (i.e., not in) the rAAV genome, and helper virus functions. The AAV rep and cap genes may be from any AAV serotype for which recombinant virus can be derived, and may be from a different AAV serotype than the rAAV genome ITRs, including, but not limited to, AAV serotypes AAV-1 , AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-1 1 , AAV-12, AAV-13 and AAV rh.74. Production of pseudotyped rAAV is disclosed in, for example, international patent application publication number WO 01 /83692. See Table 2.

Table 2

Figure imgf000119_0001

[00451] A method of generating a packaging cell involves creating a cell line that stably expresses all of the necessary components for AAV particle production. For example, a plasmid (or multiple plasmids) comprising a rAAV genome lacking AAV rep and cap genes, AAV rep and cap genes separate from the rAAV genome, and a selectable marker, such as a neomycin resistance gene, are integrated into the genome of a cell. AAV genomes have been introduced into bacterial plasmids by procedures such as GC tailing (Samulski et al., 1982, Proc. Natl. Acad. S6. USA, 79:2077-2081 ), addition of synthetic linkers containing restriction endonuclease cleavage sites (Laughlin et al., 1983, Gene, 23:65-73) or by direct, blunt-end ligation (Senapathy & Carter, 1984, J. Biol. Chem., 259:4661 -4666). The packaging cell line is then infected with a helper virus, such as adenovirus. The advantages of this method are that the cells are selectable and are suitable for large-scale production of rAAV. Other examples of suitable methods employ adenovirus or baculovirus, rather than plasmids, to introduce rAAV genomes and/or rep and cap genes into packaging cells.

[00452] General principles of rAAV production are reviewed in, for example, Carter, 1992, Current Opinions in Biotechnology, 1533-539; and Muzyczka, 1992, Curr. Topics in Microbial, and Immunol., 158:97-129). Various approaches are described in Ratschin et al., Mol. Cell. Biol. 4:2072 (1984); Hermonat et al., Proc. Natl. Acad. Sci. USA, 81 :6466 (1984); Tratschin et al., Mo1 . Cell. Biol. 5:3251 (1985); McLaughlin et al., J. Virol., 62: 1963 (1988); and Lebkowski et al., 1988 Mol. Cell. Biol., 7:349 (1988). Samulski et al. (1989, J. Virol., 63:3822-3828); U.S. Patent No. 5, 173,414; WO 95/13365 and corresponding U.S. Patent No. 5,658,776; WO 95/13392; WO 96/17947; PCT/US98/18600; WO 97/09441 (PCT/US96/14423); WO 97/08298 (PCT/US96/13872); WO 97/21825 (PCT/US96/20777); WO

97/06243 (PCT/FR96/01064); WO 99/1 1764; Perrin et al. (1995) Vaccine 13: 1244- 1250; Paul et al. (1993) Human Gene Therapy 4:609-615; Clark et al. (1996) Gene Therapy 3: 1 124-1 132; U.S. Patent. No. 5,786,21 1 ; U.S. Patent No. 5,871 ,982; and U.S. Patent. No. 6,258,595.

[00453] AAV vector serotypes can be matched to target cell types. For example, the following exemplary cell types may be transduced by the indicated AAV serotypes among others. See Table 3. Table 3

Figure imgf000121_0001

[00454] In addition to adeno-associated viral vectors, other viral vectors can be used. Such viral vectors include, but are not limited to, lentivirus, alphavirus, enterovirus, pestivirus, baculovirus, herpesvirus, Epstein Barr virus, papovavirus, poxvirus, vaccinia virus, and herpes simplex virus.

[00455] In some embodiments, Cas9 mRNA, sgRNA targeting one or two loci in genes selected from the group consisting of ACADM genes, HADHA genes, and ACADVL genes, and donor DNA are each separately formulated into lipid nanoparticles, or are all co-formulated into one lipid nanoparticle, or co-formulated into two or more lipid nanoparticles.

[00456] In some embodiments, Cas9 mRNA is formulated in a lipid nanoparticle, while sgRNA and donor DNA are delivered in an AAV vector. In some

embodiments, Cas9 mRNA and sgRNA are co-formulated in a lipid nanoparticle, while donor DNA is delivered in an AAV vector. [00457] Options are available to deliver the Cas9 nuclease as a DNA plasmid, as mRNA or as a protein. The guide RNA can be expressed from the same DNA, or can also be delivered as an RNA. The RNA can be chemically modified to alter or improve its half-life, or decrease the likelihood or degree of immune response. The endonuclease protein can be complexed with the gRNA prior to delivery. Viral vectors allow efficient delivery; split versions of Cas9 and smaller orthologs of Cas9 can be packaged in AAV, as can donors for HDR. A range of non-viral delivery methods also exist that can deliver each of these components, or non-viral and viral methods can be employed in tandem. For example, nano-particles can be used to deliver the protein and guide RNA, while AAV can be used to deliver a donor DNA.

[00458] Exosomes

[00459] Exosomes, a type of microvesicle bound by phospholipid bilayer, can be used to deliver nucleic acids to specific tissue. Many different types of cells within the body naturally secrete exosomes. Exosomes form within the cytoplasm when endosomes invaginate and form multivesicular-endosomes (MVE). When the MVE fuses with the cellular membrane, the exosomes are secreted in the extracellular space. Ranging between 30-120nm in diameter, exosomes can shuttle various molecules from one cell to another in a form of cell-to-cell communication. Cells that naturally produce exosomes, such as mast cells, can be genetically altered to produce exosomes with surface proteins that target specific tissues, alternatively exosomes can be isolated from the bloodstream. Specific nucleic acids can be placed within the engineered exosomes with electroporation. When introduced systemically, the exosomes can deliver the nucleic acids to the specific target tissue.

[00460] Genetically Modified Cells

[00461] The term "genetically modified cell" refers to a cell that comprises at least one genetic modification introduced by genome editing (e.g. , using the

CRISPR/Cas9 or CRISPR/Cpf1 system). In some ex vivo embodiments herein, the genetically modified cell is a genetically modified progenitor cell. In some in vivo embodiments herein, the genetically modified cell is a genetically modified progenitor cell. In some in vivo embodiments herein, the genetically modified cell is a genetically modified liver cell. A genetically modified cell comprising an

exogenous genome-targeting nucleic acid and/or an exogenous nucleic acid encoding a genome-targeting nucleic acid is contemplated herein.

[00462] The term "control treated population" describes a population of cells that has been treated with identical media, viral induction, nucleic acid sequences, temperature, confluency, flask size, pH, etc., with the exception of the addition of the genome editing components. Any method known in the art can be used to measure restoration of a gene selected from the group consisting of ACADM, HADHA, and ACADVL or protein expression or activity, for example, Western Blot analysis of the MCAD protein, the LCHAD protein, and/or the VLCAD protein, or quantifying mRNA selected from the group consisting of ACADM mRNA, HADHA mRNA, and ACADVL mRNA.

[00463] The term "isolated cell" refers to a cell that has been removed from an organism in which it was originally found, or a descendant of such a cell. Optionally, the cell is cultured in vitro, e.g., under defined conditions or in the presence of other cells. Optionally, the cell is later introduced into a second organism or re-introduced into the organism from which it (or the cell from which it is descended) was isolated.

[00464] The term "isolated population" with respect to an isolated population of cells refers to a population of cells that has been removed and separated from a mixed or heterogeneous population of cells. In some embodiments, an isolated population is a substantially pure population of cells, as compared to the

heterogeneous population from which the cells were isolated or enriched. In some embodiments, the isolated population is an isolated population of human progenitor cells, e.g., a substantially pure population of human progenitor cells, as compared to a heterogeneous population of cells comprising human progenitor cells and cells from which the human progenitor cells were derived.

[00465] The term "substantially enhanced," with respect to a particular cell population, refers to a population of cells in which the occurrence of a particular type of cell is increased relative to pre-existing or reference levels, by at least 2- fold, at least 3-, at least 4-, at least 5-, at least 6-, at least 7-, at least 8-, at least 9, at least 10-, at least 20-, at least 50-, at least 100-, at least 400-, at least 1000-, at least 5000-, at least 20000-, at least 100000- or more fold depending, e.g., on the desired levels of such cells for ameliorating a fatty acid disorder selected from the group consisting of MCADD, LCHADD, VLCADD, and combinations thereof.

[00466] The term "substantially enriched" with respect to a particular cell population, refers to a population of cells that is at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70% or more with respect to the cells making up a total cell population.

[00467] The terms "substantially enriched" or "substantially pure" with respect to a particular cell population, refers to a population of cells that is at least about 75%, at least about 85%, at least about 90%, or at least about 95% pure, with respect to the cells making up a total cell population. That is, the terms "substantially pure" or "essentially purified," with regard to a population of progenitor cells, refers to a population of cells that contain fewer than about 20%, about 15%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2%, about 1 %, or less than 1 %, of cells that are not progenitor cells as defined by the terms herein.

[00468] Differentiation of genome edited iPSCs into hepatocytes

[00469] Another step of the ex vivo methods of the present disclosure comprises differentiating the genome edited iPSCs into hepatocytes. The differentiating step may be performed according to any method known in the art. For example, hiPSC are differentiated into definitive endoderm using various treatments, including activin and B27 supplement (Life Technology). The definitive endoderm is further differentiated into hepatocyte, the treatment includes: FGF4, HGF, BMP2, BMP4, Oncostatin M, Dexametason, etc. (Duan et al, STEM CELLS; 2010;28:674-686, Ma et al, STEM CELLS TRANSLATIONAL MEDICINE 2013;2:409-419).

[00470] Differentiation of genome edited mesenchymal stem cells into hepatocytes

[00471] Another step of the ex vivo methods of the present disclosure comprises differentiating the genome edited mesenchymal stem cells into hepatocytes. The differentiating step may be performed according to any method known in the art. For example, hMSC are treated with various factors and hormones, including insulin, transferrin, FGF4, HGF, bile acids (Sawitza I et al, Sci Rep. 2015; 5: 13320).

[00472] Administering cells into patients

[00473] Another step of the ex vivo methods of the present disclosure comprises administering the hepatocytes to patients. This administering step may be accomplished using any method of administration known in the art. For example, the genetically modified cells may be injected directly in the patient's liver or otherwise administered to the patient.

[00474] Another step of the ex vivo methods of the present disclosure comprises administering the progenitor cells or primary hepatocytes into patients. This administering step may be accomplished using any method of administration known in the art. For example, the genetically modified cells may be injected directly in the patient's liver or otherwise administered to the patient. The genetically modified cells may be purified ex vivo using a selected marker.

[00475] Pharmaceutically Acceptable Carriers

[00476] The ex vivo methods of administering progenitor cells to a subject contemplated herein involve the use of therapeutic compositions comprising progenitor cells.

[00477] Therapeutic compositions contain a physiologically tolerable carrier together with the cell composition, and optionally at least one additional bioactive agent as described herein, dissolved or dispersed therein as an active ingredient. In some embodiments, the therapeutic composition is not substantially

immunogenic when administered to a mammal or human patient for therapeutic purposes, unless so desired.

[00478] In general, the progenitor cells described herein are administered as a suspension with a pharmaceutically acceptable carrier. One of skill in the art will recognize that a pharmaceutically acceptable carrier to be used in a cell composition will not include buffers, compounds, cryopreservation agents, preservatives, or other agents in amounts that substantially interfere with the viability of the cells to be delivered to the subject. A formulation comprising cells can include e.g., osmotic buffers that permit cell membrane integrity to be maintained, and optionally, nutrients to maintain cell viability or enhance

engraftment upon administration. Such formulations and suspensions are known to those of skill in the art and/or can be adapted for use with the progenitor cells, as described herein, using routine experimentation.

[00479] A cell composition can also be emulsified or presented as a liposome composition, provided that the emulsification procedure does not adversely affect cell viability. The cells and any other active ingredient can be mixed with excipients that are pharmaceutically acceptable and compatible with the active ingredient, and in amounts suitable for use in the therapeutic methods described herein.

[00480] Additional agents included in a cell composition can include

pharmaceutically acceptable salts of the components therein. Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the polypeptide) that are formed with inorganic acids, such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, tartaric, mandelic and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases, such as, for example, sodium, potassium, ammonium, calcium or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2- ethylamino ethanol, histidine, procaine and the like.

[00481] Physiologically tolerable carriers are well known in the art. Exemplary liquid carriers are sterile aqueous solutions that contain no materials in addition to the active ingredients and water, or contain a buffer such as sodium phosphate at physiological pH value, physiological saline or both, such as phosphate-buffered saline. Still further, aqueous carriers can contain more than one buffer salt, as well as salts such as sodium and potassium chlorides, dextrose, polyethylene glycol and other solutes. Liquid compositions can also contain liquid phases in addition to and to the exclusion of water. Exemplary of such additional liquid phases are glycerin, vegetable oils such as cottonseed oil, and water-oil emulsions. The amount of an active compound used in the cell compositions that is effective in the treatment of a particular disorder or condition will depend on the nature of the disorder or condition, and can be determined by standard clinical techniques.

[00482] Administration & Efficacy

[00483] The terms "administering," "introducing" and "transplanting" are used interchangeably in the context of the placement of cells, e.g., progenitor cells, into a subject, by a method or route that results in at least partial localization of the introduced cells at a desired site, such as a site of injury or repair, such that a desired effect(s) is produced. The cells e.g., progenitor cells, or their differentiated progeny can be administered by any appropriate route that results in delivery to a desired location in the subject where at least a portion of the administered cells or components of the cells remain viable. The period of viability of the cells after administration to a subject can be as short as a few hours, e.g., twenty-four hours, to a few days, to as long as several years, or even the life time of the patient, i.e. , long-term engraftment. For example, in some embodiments described herein, an effective amount of myogenic progenitor cells is administered via a systemic route of administration, such as an intraperitoneal or intravenous route.

[00484] The terms "individual", "subject," "host" and "patient" are used interchangeably herein and refer to any subject for whom diagnosis, treatment or therapy is desired. In some embodiments, the subject is a mammal. In some embodiments, the subject is a human being.

[00485] When provided prophylactically, progenitor cells described herein can be administered to a subject in advance of any symptom of a fatty acid disorder selected from the group consisting of MCADD, LCHADD, VLCADD, and

combinations thereof, e.g., prior to the development of hypoketotic-hypoglycemia, hyper-ammonemia, transaminitis, as well as generalized hepatic-dysfunction.

Accordingly, the prophylactic administration of a liver progenitor cell population serves to prevent a fatty acid disorder selected from the group consisting of MCADD, LCHADD, VLCADD, and combinations thereof.

[00486] When provided therapeutically, liver progenitor cells are provided at (or after) the onset of a symptom or indication of a fatty acid disorder selected from the group consisting of MCADD, LCHADD, VLCADD, and combinations thereof, e.g., upon the onset of liver disease.

[00487] In some embodiments described herein, the liver progenitor cell population being administered according to the methods described herein comprises allogeneic liver progenitor cells obtained from one or more donors.

"Allogeneic" refers to a liver progenitor cell or biological samples comprising liver progenitor cells obtained from one or more different donors of the same species, where the genes at one or more loci are not identical. For example, a liver progenitor cell population being administered to a subject can be derived from one more unrelated donor subjects, or from one or more non-identical siblings. In some embodiments, syngeneic liver progenitor cell populations can be used, such as those obtained from genetically identical animals, or from identical twins. In other embodiments, the liver progenitor cells are autologous cells; that is, the liver progenitor cells are obtained or isolated from a subject and administered to the same subject, i.e., the donor and recipient are the same.

[00488] In one embodiment, the term "effective amount" refers to the amount of a population of progenitor cells or their progeny needed to prevent or alleviate at least one or more signs or symptoms of a fatty acid disorder such as MCADD, LCHADD, and/or VLCADD, and relates to a sufficient amount of a composition to provide the desired effect, e.g., to treat a subject having a fatty acid disorder such as MCADD, LCHADD, and/or VLCADD. The term "therapeutically effective amount" therefore refers to an amount of progenitor cells or a composition comprising progenitor cells that is sufficient to promote a particular effect when administered to a typical subject, such as one who has or is at risk for a fatty acid disorder such as MCADD, LCHADD, and/or VLCADD. An effective amount would also include an amount sufficient to prevent or delay the development of a symptom of the disease, alter the course of a symptom of the disease (for example but not limited to, slow the progression of a symptom of the disease), or reverse a symptom of the disease. It is understood that for any given case, an appropriate "effective amount" can be determined by one of ordinary skill in the art using routine experimentation. [00489] For use in the various embodiments described herein, an effective amount of progenitor cells comprises at least 102 progenitor cells, at least 5 X 102 progenitor cells, at least 103 progenitor cells, at least 5 X 103 progenitor cells, at least 104 progenitor cells, at least 5 X 104 progenitor cells, at least 105 progenitor cells, at least 2 X 105 progenitor cells, at least 3 X 105 progenitor cells, at least 4 X 105 progenitor cells, at least 5 X 105 progenitor cells, at least 6 X 105 progenitor cells, at least 7 X 105 progenitor cells, at least 8 X 105 progenitor cells, at least 9 X

105 progenitor cells, at least 1 X 106 progenitor cells, at least 2 X 106 progenitor cells, at least 3 X 106 progenitor cells, at least 4 X 106 progenitor cells, at least 5 X

106 progenitor cells, at least 6 X 106 progenitor cells, at least 7 X 106 progenitor cells, at least 8 X 106 progenitor cells, at least 9 X 106 progenitor cells, or multiples thereof. The progenitor cells are derived from one or more donors, or are obtained from an autologous source. In some embodiments described herein, the progenitor cells are expanded in culture prior to administration to a subject in need thereof.

[00490] Modest and incremental increases in the levels of a functional protein selected from the group consisting of functional MCAD, functional LCHAD, and functional VLCAD expressed in cells of patients having a fatty acid disorder selected from the group consisting of MCADD, LCHADD, VLCADD, and

combinations thereof can be beneficial for ameliorating one or more symptoms of the disease, for increasing long-term survival, and/or for reducing side effects associated with other treatments. Upon administration of such cells to human patients, the presence of liver progenitors that are producing increased levels of functional protein selected from the group consisting of functional MCAD, functional LCHAD, and functional VLCAD is beneficial. In some embodiments, effective treatment of a subject gives rise to at least about 3%, 5% or 7% functional protein selected from the group consisting of functional MCAD, functional LCHAD, and functional VLCAD relative to total MCAD, total LCHAD, or total VLCAD in the treated subject. In some embodiments, functional protein selected from the group consisting of functional MCAD, functional LCHAD, and functional VLCAD will be at least about 10% of total protein selected from the group consisting of MCAD, LCHAD, and VLCAD. In some embodiments, functional protein selected from the group consisting of functional MCAD, functional LCHAD, and functional VLCAD will be at least about 20% to 30% of total protein selected from the group consisting of MCAD, LCHAD, and VLCAD. Similarly, the introduction of even relatively limited subpopulations of cells having significantly elevated levels of functional protein selected from the group consisting of functional MCAD, functional LCHAD, and functional VLCAD can be beneficial in various patients because in some situations normalized cells will have a selective advantage relative to diseased cells.

However, even modest levels of liver progenitors with elevated levels of functional protein selected from the group consisting of functional MCAD, functional LCHAD, and functional VLCAD can be beneficial for ameliorating one or more aspects of a fatty acid disorder selected from the group consisting of MCADD, LCHADD, VLCADD, and combinations thereof in patients. In some embodiments, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% or more of the administered cells in patients to whom such cells are administered are producing increased levels of functional protein selected from the group consisting of functional MCAD, functional LCHAD, and functional VLCAD.

[00491] "Administered" refers to the delivery of a progenitor cell composition into a subject by a method or route that results in at least partial localization of the cell composition at a desired site. A cell composition can be administered by any appropriate route that results in effective treatment in the subject, i.e. administration results in delivery to a desired location in the subject where at least a portion of the composition delivered, i.e. at least 1 x 104 cells are delivered to the desired site for a period of time. Modes of administration include injection, infusion, instillation, or ingestion. "Injection" includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular,

intraarticular, sub capsular, subarachnoid, intraspinal, intracerebro spinal, and intrasternal injection and infusion. In some embodiments, the route is intravenous. For the delivery of cells, administration by injection or infusion is generally preferred.

[00492] In one embodiment, the cells are administered systemically. The phrases "systemic administration," "administered systemically", "peripheral administration" and "administered peripherally" refer to the administration of a population of progenitor cells other than directly into a target site, tissue, or organ, such that it enters, instead, the subject's circulatory system and, thus, is subject to metabolism and other like processes.

[00493] The efficacy of a treatment comprising a composition for the treatment of a fatty acid disorder selected from the group consisting of MCADD, LCHADD, VLCADD, and combinations thereof can be determined by the skilled clinician. However, a treatment is considered "effective treatment," if any one or all of the signs or symptoms of, as but one example, levels of functional MCAD, functional LCHAD, and/or functional VLCAD are altered in a beneficial manner (e.g., increased by at least 10%), or other clinically accepted symptoms or markers of disease are improved or ameliorated. Efficacy can also be measured by failure of an individual to worsen as assessed by hospitalization or need for medical interventions (e.g., chronic obstructive pulmonary disease, or progression of the disease is halted or at least slowed). Methods of measuring these indicators are known to those of skill in the art and/or described herein. Treatment includes any treatment of a disease in an individual or an animal (some non-limiting examples include a human, or a mammal) and includes: (1 ) inhibiting the disease, e.g., arresting, or slowing the progression of symptoms; or (2) relieving the disease, e.g., causing regression of symptoms; and (3) preventing or reducing the likelihood of the development of symptoms.

[00494] The treatment according to the present disclosure ameliorates one or more symptoms associated with a fatty acid disorder selected from the group consisting of MCADD, LCHADD, VLCADD, and combinations thereof by increasing the amount of functional MCAD, functional LCHAD, and/or functional VLCAD in the individual. Early signs typically associated with MCADD, include for example, hypoketotic-hypoglycemia, hyper-ammonemia, transaminitis, as well as generalized hepatic-dysfunction. Early signs typically associated with LCHADD, include for example, hypoketotic-hypoglycemia, hyper-ammonemia, transaminitis, as well as generalized hepatic-dysfunction. Early signs typically associated with VLCADD, include for example, for the severe form early-onset cardiac and multi-organ failure form, hypertrophic or dilated cardiomyopathy, pericardial effusion, arrhythmias, ventricular tachycardia, ventricular fibrillation and atrioventricular block, as well as hypotonia, hepatomegaly, and intermittent hypoglycaemia; for the hepatic or hypoketonic hypoglycemic form, hypoketotic hypoglycemia and hepatomegaly, but without cardiomyopathy; and for the later-onset episodic myopathic VLCAD deficiency, intermittent rhabdomyolysis, muscle cramps and/or pain, and/or exercise intolerance.

[00495] Kits

[00496] The present disclosure provides kits for carrying out the methods of the disclosure. A kit can include one or more of a genome-targeting nucleic acid, a polynucleotide encoding a genome-targeting nucleic acid, a site-directed polypeptide, a polynucleotide encoding a site-directed polypeptide, and/or any nucleic acid or proteinaceous molecule necessary to carry out the embodiments of the methods of the disclosure, or any combination thereof.

[00497] In some embodiments, a kit comprises: (1 ) a vector comprising a nucleotide sequence encoding a genome-targeting nucleic acid, and (2) the site- directed polypeptide or a vector comprising a nucleotide sequence encoding the site-directed polypeptide, and (3) a reagent for reconstitution and/or dilution of the vector(s) and or polypeptide.

[00498] In some embodiments, a kit comprises: (1 ) a vector comprising (i) a nucleotide sequence encoding a genome-targeting nucleic acid, and (ii) a nucleotide sequence encoding the site-directed polypeptide and (2) a reagent for reconstitution and/or dilution of the vector.

[00499] In some embodiments of any of the above kits, the kit comprises a single-molecule guide genome-targeting nucleic acid. In some embodiments of any of the above kits, the kit comprises a double-molecule genome-targeting nucleic acid. In some embodiments of any of the above kits, the kit comprises two or more double-molecule guides or single-molecule guides. In some embodiments, the kits comprise a vector that encodes the nucleic acid targeting nucleic acid.

[00500] In some embodiments of any of the above kits, the kit can further comprise a polynucleotide to be inserted to effect the desired genetic modification. [00501] Components of a kit may be in separate containers, or combined in a single container.

[00502] In some embodiments, a kit described above further comprises one or more additional reagents, where such additional reagents are selected from a buffer, a buffer for introducing a polypeptide or polynucleotide into a cell, a wash buffer, a control reagent, a control vector, a control RNA polynucleotide, a reagent for in vitro production of the polypeptide from DNA, adaptors for sequencing and the like. A buffer can be a stabilization buffer, a reconstituting buffer, a diluting buffer, or the like. In some embodiments, a kit can also include one or more components that may be used to facilitate or enhance the on-target binding or the cleavage of DNA by the endonuclease, or improve the specificity of targeting.

[00503] In addition to the above-mentioned components, a kit can further include instructions for using the components of the kit to practice the methods. The instructions for practicing the methods are generally recorded on a suitable recording medium. For example, the instructions may be printed on a substrate, such as paper or plastic, etc. The instructions may be present in the kits as a package insert, in the labeling of the container of the kit or components thereof (i.e., associated with the packaging or subpackaging), etc. The instructions can be present as an electronic storage data file present on a suitable computer readable storage medium, e.g. CD-ROM, diskette, flash drive, etc. In some instances, the actual instructions are not present in the kit, but means for obtaining the instructions from a remote source (e.g. via the Internet), can be provided. An example of this embodiment is a kit that includes a web address where the instructions can be viewed and/or from which the instructions can be downloaded. As with the instructions, this means for obtaining the instructions can be recorded on a suitable substrate.

[00504] Guide RNA Formulation

[00505] Guide RNAs of the disclosure are formulated with pharmaceutically acceptable excipients such as carriers, solvents, stabilizers, adjuvants, diluents, etc., depending upon the particular mode of administration and dosage form. Guide RNA compositions are generally formulated to achieve a physiologically compatible pH, and range from a pH of about 3 to a pH of about 1 1 , about pH 3 to about pH 7, depending on the formulation and route of administration. In alternative

embodiments, the pH is adjusted to a range from about pH 5.0 to about pH 8. In some embodiments, the compositions comprise a therapeutically effective amount of at least one compound as described herein, together with one or more pharmaceutically acceptable excipients. Optionally, the compositions comprise a combination of the compounds described herein, or may include a second active ingredient useful in the treatment or prevention of bacterial growth (for example and without limitation, anti-bacterial or anti-microbial agents), or may include a combination of reagents of the disclosure.

[00506] Suitable excipients include, for example, carrier molecules that include large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, and inactive virus particles. Other exemplary excipients include antioxidants (for example and without limitation, ascorbic acid), chelating agents (for example and without limitation, EDTA), carbohydrates (for example and without limitation, dextrin, hydroxyalkylcellulose, and hydroxyalkylmethylcellulose), stearic acid, liquids (for example and without limitation, oils, water, saline, glycerol and ethanol), wetting or emulsifying agents, pH buffering substances, and the like.

[00507] Other Possible Therapeutic Approaches

[00508] Gene editing can be conducted using nucleases engineered to target specific sequences. To date there are four major types of nucleases:

meganucleases and their derivatives, zinc finger nucleases (ZFNs), transcription activator like effector nucleases (TALENs), and CRISPR-Cas9 nuclease systems. The nuclease platforms vary in difficulty of design, targeting density and mode of action, particularly as the specificity of ZFNs and TALENs is through protein-DNA interactions, while RNA-DNA interactions primarily guide Cas9. Cas9 cleavage also requires an adjacent motif, the PAM, which differs between different CRISPR systems. Cas9 from Streptococcus pyogenes cleaves using a NRG PAM, CRISPR from Neisseria meningitidis can cleave at sites with PAMs including NNNNGATT, NNNNNGTTT and NNNNGCTT. A number of other Cas9 orthologs target protospacer adjacent to alternative PAMs.

[00509] CRISPR endonucleases, such as Cas9, can be used in the methods of the disclosure. However, the teachings described herein, such as therapeutic target sites, could be applied to other forms of endonucleases, such as ZFNs, TALENs, HEs, or MegaTALs, or using combinations of nucleases. However, in order to apply the teachings of the present disclosure to such endonucleases, one would need to, among other things, engineer proteins directed to the specific target sites.

[00510] Additional binding domains may be fused to the Cas9 protein to increase specificity. The target sites of these constructs would map to the identified gRNA specified site, but would require additional binding motifs, such as for a zinc finger domain. In the case of Mega-TAL, a meganuclease can be fused to a TALE DNA- binding domain. The meganuclease domain can increase specificity and provide the cleavage. Similarly, inactivated or dead Cas9 (dCas9) can be fused to a cleavage domain and require the sgRNA/Cas9 target site and adjacent binding site for the fused DNA-binding domain. This likely would require some protein engineering of the dCas9, in addition to the catalytic inactivation, to decrease binding without the additional binding site.

[00511] Zinc Finger Nucleases

[00512] Zinc finger nucleases (ZFNs) are modular proteins comprised of an engineered zinc finger DNA binding domain linked to the catalytic domain of the type II endonuclease Fokl. Because Fokl functions only as a dimer, a pair of ZFNs must be engineered to bind to cognate target "half-site" sequences on opposite DNA strands and with precise spacing between them to enable the catalytically active Fokl dimer to form. Upon dimerization of the Fokl domain, which itself has no sequence specificity per se, a DNA double-strand break is generated between the ZFN half-sites as the initiating step in genome editing.

[00513] The DNA binding domain of each ZFN is typically comprised of 3-6 zinc fingers of the abundant Cys2-His2 architecture, with each finger primarily recognizing a triplet of nucleotides on one strand of the target DNA sequence, although cross-strand interaction with a fourth nucleotide also can be important. Alteration of the amino acids of a finger in positions that make key contacts with the DNA alters the sequence specificity of a given finger. Thus, a four-finger zinc finger protein will selectively recognize a 12 bp target sequence, where the target sequence is a composite of the triplet preferences contributed by each finger, although triplet preference can be influenced to varying degrees by neighboring fingers. An important aspect of ZFNs is that they can be readily re-targeted to almost any genomic address simply by modifying individual fingers, although considerable expertise is required to do this well. In most applications of ZFNs, proteins of 4-6 fingers are used, recognizing 12-18 bp respectively. Hence, a pair of ZFNs will typically recognize a combined target sequence of 24-36 bp, not including the 5-7 bp spacer between half-sites. The binding sites can be separated further with larger spacers, including 15-17 bp. A target sequence of this length is likely to be unique in the human genome, assuming repetitive sequences or gene homologs are excluded during the design process. Nevertheless, the ZFN protein-DNA interactions are not absolute in their specificity so off-target binding and cleavage events do occur, either as a heterodimer between the two ZFNs, or as a

homodimer of one or the other of the ZFNs. The latter possibility has been effectively eliminated by engineering the dimerization interface of the Fokl domain to create "plus" and "minus" variants, also known as obligate heterodimer variants, which can only dimerize with each other, and not with themselves. Forcing the obligate heterodimer prevents formation of the homodimer. This has greatly enhanced specificity of ZFNs, as well as any other nuclease that adopts these Fokl variants.

[00514] A variety of ZFN-based systems have been described in the art, modifications thereof are regularly reported, and numerous references describe rules and parameters that are used to guide the design of ZFNs; see, e.g., Segal et ai, Proc Natl Acad Sci USA 96(6):2758-63 (1999); Dreier B et ai , J Mol Biol.

303(4):489-502 (2000); Liu Q et ai, J Biol Chem. 277(6):3850-6 (2002); Dreier et ai, J Biol Chem 280(42):35588-97 (2005); and Dreier et ai, J Biol Chem.

276(31 ):29466-78 (2001 ). [00516] Transcription Activator-Like Effector Nucleases (TALENs)

[00517] TALENs represent another format of modular nucleases whereby, as with ZFNs, an engineered DNA binding domain is linked to the Fokl nuclease domain, and a pair of TALENs operate in tandem to achieve targeted DNA cleavage. The major difference from ZFNs is the nature of the DNA binding domain and the associated target DNA sequence recognition properties. The TALEN DNA binding domain derives from TALE proteins, which were originally described in the plant bacterial pathogen Xanthomonas sp. TALEs are comprised of tandem arrays of 33-35 amino acid repeats, with each repeat recognizing a single basepair in the target DNA sequence that is typically up to 20 bp in length, giving a total target sequence length of up to 40 bp. Nucleotide specificity of each repeat is determined by the repeat variable diresidue (RVD), which includes just two amino acids at positions 12 and 13. The bases guanine, adenine, cytosine and thymine are predominantly recognized by the four RVDs: Asn-Asn, Asn-lle, His-Asp and Asn- Gly, respectively. This constitutes a much simpler recognition code than for zinc fingers, and thus represents an advantage over the latter for nuclease design. Nevertheless, as with ZFNs, the protein-DNA interactions of TALENs are not absolute in their specificity, and TALENs have also benefitted from the use of obligate heterodimer variants of the Fokl domain to reduce off-target activity.

[00518] Additional variants of the Fokl domain have been created that are deactivated in their catalytic function. If one half of either a TALEN or a ZFN pair contains an inactive Fokl domain, then only single-strand DNA cleavage (nicking) will occur at the target site, rather than a DSB. The outcome is comparable to the use of CRISPR/Cas9 or CRISPR/Cpf1 "nickase" mutants in which one of the Cas9 cleavage domains has been deactivated. DNA nicks can be used to drive genome editing by HDR, but at lower efficiency than with a DSB. The main benefit is that off- target nicks are quickly and accurately repaired, unlike the DSB, which is prone to NHEJ-mediated mis-repair.

[00519] A variety of TALEN-based systems have been described in the art, and modifications thereof are regularly reported; see, e.g., Boch, Science

326(5959): 1509-12 (2009); Mak et ai , Science 335(6069):716-9 (2012); and Moscou et al., Science 326(5959): 1501 (2009). The use of TALENs based on the "Golden Gate" platform, or cloning scheme, has been described by multiple groups; see, e.g., Cermak ef al., Nucleic Acids Res. 39(12):e82 (201 1 ); Li et al., Nucleic Acids Res. 39(14):6315-25(201 1 ); Weber et al., PLoS One. 6(2):e16765 (201 1 ); Wang et al., J Genet Genomics 47(6):339-47, Epub 2014 May 17 (2014); and Cermak T et al., Methods Mol Biol. 1239: 133-59 (2015).

[00520] Homing Endonucleases

[00521] Homing endonucleases (HEs) are sequence-specific endonucleases that have long recognition sequences (14-44 base pairs) and cleave DNA with high specificity - often at sites unique in the genome. There are at least six known families of HEs as classified by their structure, including LAGLIDADG (SEQ ID NO: 69,827), GIY-YIG, His-Cis box, H-N-H, PD-(D/E)xK, and Vsr-like that are derived from a broad range of hosts, including eukarya, protists, bacteria, archaea, cyanobacteria and phage. As with ZFNs and TALENs, HEs can be used to create a DSB at a target locus as the initial step in genome editing. In addition, some natural and engineered HEs cut only a single strand of DNA, thereby functioning as site- specific nickases. The large target sequence of HEs and the specificity that they offer have made them attractive candidates to create site-specific DSBs.

[00522] A variety of HE-based systems have been described in the art, and modifications thereof are regularly reported; see, e.g., the reviews by Steentoft et al., Glycobiology 24(8):663-80 (2014); Belfort and Bonocora, Methods Mol Biol. 7723: 1 -26 (2014); Hafez and Hausner, Genome 55(8):553-69 (2012); and references cited therein.

[00523] MegaTAL / Tev-mTALEN / MegaTev

[00524] As further examples of hybrid nucleases, the MegaTAL platform and Tev-mTALEN platform use a fusion of TALE DNA binding domains and catalytically active HEs, taking advantage of both the tunable DNA binding and specificity of the TALE, as well as the cleavage sequence specificity of the HE; see, e.g., Boissel et al., NAR 42: 2591 -2601 (2014); Kleinstiver et al., G3 4: 1 155-65 (2014); and Boissel and Scharenberg, Methods Mol. Biol. 1239: 171 -96 (2015). [00525] In a further variation, the MegaTev architecture is the fusion of a meganuclease (Mega) with the nuclease domain derived from the GIY-YIG homing endonuclease l-Tevl (Tev). The two active sites are positioned -30 bp apart on a DNA substrate and generate two DSBs with non-compatible cohesive ends; see, e.g., Wolfs et al., NAR 42, 8816-29 (2014). It is anticipated that other combinations of existing nuclease-based approaches will evolve and be useful in achieving the targeted genome modifications described herein.

[00526] dCas9-Fokl or dCpfl -Fok1 and Other Nucleases

[00527] Combining the structural and functional properties of the nuclease platforms described above offers a further approach to genome editing that can potentially overcome some of the inherent deficiencies. As an example, the

CRISPR genome editing system typically uses a single Cas9 endonuclease to create a DSB. The specificity of targeting is driven by a 20 or 22nucleotide sequence in the guide RNA that undergoes Watson-Crick base-pairing with the target DNA (plus an additional 2 bases in the adjacent NAG or NGG PAM sequence in the case of Cas9 from S. pyogenes). Such a sequence is long enough to be unique in the human genome, however, the specificity of the RNA/DNA interaction is not absolute, with significant promiscuity sometimes tolerated, particularly in the 5' half of the target sequence, effectively reducing the number of bases that drive specificity. One solution to this has been to completely deactivate the Cas9 or Cpfl catalytic function - retaining only the RNA-guided DNA binding function - and instead fusing a Fokl domain to the deactivated Cas9; see, e.g., Tsai et al., Nature Biotech 32: 569-76 (2014); and Guilinger et al., Nature Biotech. 32: 577-82 (2014). Because Fokl must dimerize to become catalytically active, two guide RNAs are required to tether two Fokl fusions in close proximity to form the dimer and cleave DNA. This essentially doubles the number of bases in the combined target sites, thereby increasing the stringency of targeting by CRISPR- based systems.

[00528] As further example, fusion of the TALE DNA binding domain to a catalytically active HE, such as l-Tevl , takes advantage of both the tunable DNA binding and specificity of the TALE, as well as the cleavage sequence specificity of l-Tevl, with the expectation that off-target cleavage may be further reduced.

[00529] Methods and Compositions of the Invention

[00530] Accordingly, the present disclosure relates in particular to the following non-limiting inventions: In a first method, Method 1 , the present disclosure provides a method for editing an ACADM gene in a cell by genome editing, comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the ACADM gene or other DNA sequences that encode regulatory elements of the ACADM gene that results in a permanent deletion, insertion, or correction of one or more nucleotides, mutations, or exons within or near the ACADM gene or other DNA sequences that encode regulatory elements of the ACADM gene, thereby restoring medium chain acyl coenzyme A dehydrogenase (MCAD) activity.

[00531] In another method, Method 2, the present disclosure provides a method for inserting an ACADM gene in a cell by genome editing, comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near an ACADM gene or other DNA sequences that encode regulatory elements of an ACADM gene that results in a permanent deletion or correction, of one or more mutations affecting the expression or function of the ACADM gene, thereby restoring medium chain acyl coenzyme A dehydrogenase (MCAD) activity.

[00532] In another method, Method 3, the present disclosure provides a method for inserting an HADHA gene in a cell by genome editing, comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near an HADHA gene or other DNA sequences that encode regulatory elements of an HADHA gene that results in a permanent deletion, insertion, or correction, of one or more nucleotides, mutations, or exons within or near the HADHA gene or other DNA sequences that encode regulatory elements of the HADHA gene, thereby restoring Long-chain 3-hydroxyacyl-CoA dehydrogenase (LCHAD) activity.

[00533] In another method, Method 4, the present disclosure provides a method for inserting an HADHA gene in a cell by genome editing, comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near an HADHA gene or other DNA sequences that encode regulatory elements of an HADHA gene that results in a permanent deletion or correction, of one or more mutations affecting the expression or function of the HADHA gene, thereby restoring long chain acyl coenzyme A dehydrogenase (LCHAD) activity.

[00534] In another method, Method 5, the present disclosure provides a method for editing an ACADVL gene in a cell by genome editing, comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near an ACADVL gene or other DNA sequences that encode regulatory elements of an ACADVL gene that results in a permanent deletion, insertion, or correction, of one or more nucleotides, mutations, or exons within or near the ACADVL gene or other DNA sequences that encode regulatory elements of the ACADVL gene, thereby restoring very long chain acyl coenzyme A dehydrogenase (VLCAD) activity.

[00535] In another method, Method 6, the present disclosure provides a method for inserting an ACADVL gene in a cell by genome editing, comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near an ACADVL gene or other DNA sequences that encode regulatory elements of an ACADVL gene that results in a permanent deletion or correction, of one or more mutations affecting the expression or function of the ACADVL gene, thereby restoring very long chain acyl coenzyme A dehydrogenase (VLCAD) activity.

[00536] In another method, Method 7, the present disclosure provides a method for inserting an ACADM gene in a cell by genome editing, comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the ACADM gene, or a safe harbor locus that results in a permanent insertion of the ACADM gene or minigene, thereby restoring ACADM activity.

[00537] In another method, Method 8, the present disclosure provides a method for inserting a gene in a cell by genome editing, comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the HADHA gene, or a safe harbor locus, that results in a permanent insertion of the HADHA gene or minigene, thereby restoring Long-chain 3-hydroxyacyl-CoA dehydrogenase (LCHAD) activity.

[00538] In another method, Method 9, the present disclosure provides a method for inserting a gene in a cell by genome editing, comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the ACADVL gene, or a safe harbor locus, that results in a permanent insertion of the ACADVL gene or minigene, thereby restoring very long chain acyl coenzyme A dehydrogenase (VLCAD) activity.

[00539] In another method, Method 10, the present disclosure provides an ex vivo method for treating a patient with medium chain acyl coenzyme A

dehydrogenase deficiency (MCADD) comprising the steps of: i) editing a patient specific induced pluripotent stem cell (iPSC) within or near the ACADM gene or other DNA sequences that encode regulatory elements of the ACADM gene of the iPSC; ii) differentiating the edited iPSC into a hepatocyte; and iii) administering the hepatocyte to the patient.

[00540] In another method, Method 1 1 , the present disclosure provides a method as provided in Method 10, wherein the method further comprises the step of creating a patient specific induced pluripotent stem cell (iPSC).

[00541] In another method, Method 12, the disclosure provides a method as provided in Method 1 1 , wherein the creating step comprises: a) isolating a somatic cell from the patient; and b) introducing a set of pluripotency-associated genes into the somatic cell to induce the cell to become a pluripotent stem cell.

[00542] In another method, Method 13, the disclosure provides a method as provided in Method 12, wherein the somatic cell is a fibroblast.

[00543] In another method, Method 14, the disclosure provides a method as provided in Method 12, wherein the set of pluripotency-associated genes is one or more of the genes selected from the group consisting of OCT4, SOX2, KLF4, Lin28, NANOG and cMYC.

[00544] In another method, Method 15, the disclosure provides a method as provided in any one of Methods 10-13, wherein the editing step comprises introducing into the iPSC one or more deoxyhbonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the ACADM gene or other DNA sequences that encode regulatory elements of the ACADM gene that results in a permanent deletion, insertion, or correction of one or more nucleotides, mutations, or exons within or near the ACADM gene or other DNA sequences that encode regulatory elements of the ACADM gene, thereby restoring medium chain acyl coenzyme A dehydrogenase (MCAD) activity.

[00545] In another method, Method 16, the disclosure provides a method as provided in any one of Methods 10-15, wherein the differentiating step comprises one or more of the following to differentiate the genome edited iPSC into a hepatocyte: contacting the genome edited iPSC with one or more of activin, B27 supplement, FGF4, HGF, BMP2, BMP4, Oncostatin M, Dexametason.

[00546] In another method, Method 17, the disclosure provides a method as provided in any one of Methods 10-16, wherein the administering step comprises administering the hepatocyte to the patient by transplantation, local injection, systemic infusion, or combinations thereof.

[00547] In another method, Method 18, the disclosure provides an ex vivo method for treating a patient with medium chain acyl-coenzyme A dehydrogenase deficiency (MCADD) comprising the steps of: i) editing within or near an ACADM gene or other DNA sequences that encode regulatory elements of the ACADM gene of a progenitor cell or primary hepatocyte; and iv) administering the progenitor cell or primary hepatocyte to the patient.

[00548] In another method, Method 19, the present disclosure provides a method as provided in Method 17, wherein the method further comprises the step of isolating a liver specific progenitor cell or primary hepatocyte.

[00549] In another method, Method 20, the present disclosure provides a method as provided in Method 19, wherein the method further comprises the steps of performing a biopsy of the patient's liver; and isolating a liver specific progenitor cell or primary hepatocyte.

[00550] In another method, Method 21 , the disclosure provides a method as provided in Method 19 or Method 20, wherein the isolating step comprises:

perfusion of fresh liver tissues with digestion enzymes, cell differential

centrifugation and cell culturing.

[00551] In another method, Method 22, the disclosure provides a method as provided in any one of Methods 17-21 , wherein the editing step comprises introducing into the progenitor cell or primary hepatocyte one or more

deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the ACADM gene or other DNA sequences that encode regulatory elements of the ACADM gene that results in a permanent deletion, insertion, or correction of one or more nucleotides, mutations, or exons within or near the ACADM gene or other DNA sequences that encode regulatory elements of the ACADM gene, thereby restoring medium chain acyl coenzyme A dehydrogenase (MCAD) activity.

[00552] In another method, Method 23, the disclosure provides an ex vivo method for treating a patient with medium chain acyl-coenzyme A dehydrogenase deficiency (MCADD) comprising the steps of: i) editing with or near a safe harbor locus of a progenitor cell or primary hepatocyte; and ii) administering the progenitor cell or primary hepatocyte to the patient. [00553] In another method, Method 24, the disclosure provides a method as provided in any one of Methods 17-23, wherein the administering step comprises administering the progenitor cell or primary hepatocyte to the patient by transplantation, local injection, systemic infusion, or combinations thereof.

[00554] In another method, Method 25, the disclosure provides an ex vivo method for treating a patient with medium chain acyl-coenzyme A dehydrogenase deficiency (MCADD) comprising the steps of: i) editing an ACADM gene or other DNA sequences that encode regulatory elements of an ACADM gene of a stem cell; ii) differentiating the stem cell into a hepatocyte; and iii) administering the hepatocyte to the patient.

[00555] In another method, Method 26, the present disclosure provides a method as provided in Method 25, wherein the method further comprises the step of isolating a stem cell.

[00556] In another method, Method 27, the present disclosure provides a method as provided in Method 26, wherein the method further comprises the steps of performing a biopsy of the patient's bone marrow; and isolating a stem cell.

[00557] In another method, Method 28, the disclosure provides a method as provided in Method 26 or Method 27, wherein the isolating step comprises:

aspiration of bone marrow and isolation of mesenchymal cells by density centrifugation using Percoll™.

[00558] In another method, Method 29, the disclosure provides a method as provided in any one of Methods 24-28, wherein the editing step comprises introducing into the stem cell one or more deoxyribonucleic acid (DNA)

endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the ACADM gene or other DNA sequences that encode regulatory elements of the ACADM gene that results in a permanent deletion, insertion, or correction of one or more nucleotides, mutations, or exons within or near the ACADM gene DNA sequences that encode regulatory elements of the ACADM gene, thereby restoring medium chain acyl-coenzyme A

dehydrogenase (MCAD) activity. [00559] In another method, Method 30, the present disclosure provides an ex vivo method for treating a patient with medium chain acyl-coenzyme A

dehydrogenase deficiency (MCADD) comprising the steps of: i) editing with or near a safe harbor locus of a stem cell; ii) differentiating the stem cell into a hepatocyte; and iii) administering the hepatocyte to the patient.

[00560] In another method, Method 31 , the present disclosure provides a method as provided in Method 23 or Method 30, wherein the editing step comprises introducing into the stem cell one or more deoxyribonucleic acid (DNA)

endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the safe harbor locus that facilitates insertion of a new sequence from the polynucleotide donor template into the chromosomal DNA at the locus resulting in a permanent insertion or correction of the ACADM gene or other DNA sequences that encode regulatory elements of the ACADM gene, thereby restoring MCAD activity, and wherein the gRNA comprises a spacer sequence that is complementary to a segment of the locus.

[00561] In another method, Method 32, the present disclosure provides a method as provided in Method 23 or Method 30, wherein the safe harbor locus is selected from the group consisting of AAVS1 (PPP1 R12C), ALB, Angptl3, ApoC3, ASGR2, CCR5, FIX (F9), G6PC, Gys2, HGD, Lp(a), Pcsk9, Serpinal , TF, and TTR.

[00562] In another method, Method 33, the disclosure provides a method as provided in any one of Methods 25-32, wherein the differentiating step comprises one or more of the following to differentiate the genome edited stem cell into a hepatocyte: contacting the genome edited stem cell with one or more of insulin, transferrin, FGF4, HGF, or bile acids.

[00563] In another method, Method 34, the disclosure provides a method as provided in any one of Methods 25-33, wherein the administering step comprises administering the hepatocyte to the patient by transplantation, local injection, systemic infusion, or combinations thereof.

[00564] In another method, Method 35, the present disclosure provides an ex vivo method for treating a patient with long chain acyl coenzyme A dehydrogenase deficiency (LCHADD) comprising the steps of: i) editing a patient specific induced pluripotent stem cell (iPSC) within or near the HADHA gene or other DNA sequences that encode regulatory elements of the HADHA gene of the iPSC; ii) differentiating the edited iPSC into a hepatocyte; and iii) administering the hepatocyte to the patient.

[00565] In another method, Method 36, the present disclosure provides a method as provided in Method 35, wherein the method further comprises the step of creating a patient specific induced pluripotent stem cell (iPSC).

[00566] In another method, Method 37, the disclosure provides a method as provided in Method 36, wherein the creating step comprises: a) isolating a somatic cell from the patient; and b) introducing a set of pluripotency-associated genes into the somatic cell to induce the cell to become a pluripotent stem cell.

[00567] In another method, Method 38, the disclosure provides a method as provided in Method 37, wherein the somatic cell is a fibroblast.

[00568] In another method, Method 39, the disclosure provides a method as provided in Method 37, wherein the set of pluripotency-associated genes is one or more of the genes selected from the group consisting of OCT4, SOX2, KLF4, Lin28, NANOG and cMYC.

[00569] In another method, Method 40, the disclosure provides a method as provided in any one of Methods 35-38, wherein the editing step comprises introducing into the iPSC one or more deoxyhbonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the HADHA gene or other DNA sequences that encode regulatory elements of the HADHA gene that results in a permanent deletion, insertion, or correction of one or more nucleotides, mutations, or exons within or near the HADHA gene or other DNA sequences that encode regulatory elements of the HADHA gene, thereby restoring long chain acyl coenzyme A dehydrogenase (LCHAD) activity.

[00570] In another method, Method 41 , the disclosure provides a method as provided in any one of Methods 35-40, wherein the differentiating step comprises one or more of the following to differentiate the genome edited iPSC into a hepatocyte: contacting the genome edited iPSC with one or more of activin, B27 supplement, FGF4, HGF, BMP2, BMP4, Oncostatin M, Dexametason.

[00571] In another method, Method 42, the disclosure provides a method as provided in any one of Methods 35-41 , wherein the administering step comprises administering the hepatocyte to the patient by transplantation, local injection, systemic infusion, or combinations thereof.

[00572] In another method, Method 43, the disclosure provides an ex vivo method for treating a patient with long chain acyl-coenzyme A dehydrogenase deficiency (LCHADD) comprising the steps of: i) editing within or near an HADHA gene or other DNA sequences that encode regulatory elements of the HADHA gene of a progenitor cell or primary hepatocyte; and iv) administering the progenitor cell or primary hepatocyte to the patient.

[00573] In another method, Method 44, the present disclosure provides a method as provided in Method 43, wherein the method further comprises the step of isolating a liver specific progenitor cell or primary hepatocyte.

[00574] In another method, Method 45, the present disclosure provides a method as provided in Method 44, wherein the method further comprises the steps of performing a biopsy of the patient's liver; and isolating a liver specific progenitor cell or primary hepatocyte.

[00575] In another method, Method 46, the disclosure provides a method as provided in Method 44 or Method 45, wherein the isolating step comprises:

perfusion of fresh liver tissues with digestion enzymes, cell differential

centrifugation and cell culturing.

[00576] In another method, Method 47, the disclosure provides a method as provided in any one of Methods 43-46, wherein the editing step comprises introducing into the progenitor cell or primary hepatocyte one or more

deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the HADHA gene or other DNA sequences that encode regulatory elements of the HADHA gene that results in a permanent deletion, insertion, or correction of one or more nucleotides, mutations, or exons within or near the HADHA gene or other DNA sequences that encode regulatory elements of the HADHA gene, thereby restoring long chain acyl coenzyme A dehydrogenase (LCHAD) activity.

[00577] In another method, Method 48, the disclosure provides an ex vivo method for treating a patient with long chain acyl-coenzyme A dehydrogenase deficiency (LCHADD) comprising the steps of: i) editing with or near a safe harbor locus of a progenitor cell or primary hepatocyte; and ii) administering the progenitor cell or primary hepatocyte to the patient.

[00578] In another method, Method 49, the disclosure provides a method as provided in any one of Methods 43-48, wherein the administering step comprises administering the progenitor cell or primary hepatocyte to the patient by

transplantation, local injection, systemic infusion, or combinations thereof.

[00579] In another method, Method 50, the disclosure provides an ex vivo method for treating a patient with long chain acyl-coenzyme A dehydrogenase deficiency (LCHADD) comprising the steps of: i) editing an HADHA gene or other DNA sequences that encode regulatory elements of an HADHA gene of a stem cell; ii) differentiating the stem cell into a hepatocyte; and iii) administering the

hepatocyte to the patient.

[00580] In another method, Method 51 , the present disclosure provides a method as provided in Method 50, wherein the method further comprises the step of isolating a stem cell.

[00581] In another method, Method 52, the present disclosure provides a method as provided in Method 51 , wherein the method further comprises the steps of performing a biopsy of the patient's bone marrow; and isolating a stem cell.

[00582] In another method, Method 53, the disclosure provides a method as provided in Method 51 or Method 52, wherein the isolating step comprises:

aspiration of bone marrow and isolation of mesenchymal cells by density

centrifugation using Percoll™. [00583] In another method, Method 54, the disclosure provides a method as provided in any one of Methods 50-53, wherein the editing step comprises introducing into the stem cell one or more deoxyribonucleic acid (DNA)

endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the HADHA gene or other DNA sequences that encode regulatory elements of the HADHA gene that results in a permanent deletion, insertion, or correction of one or more nucleotides, mutations, or exons within or near the HADHA gene DNA sequences that encode regulatory elements of the HADHA gene, thereby restoring long chain acyl-coenzyme A dehydrogenase (LCHAD) activity.

[00584] In another method, Method 55, the present disclosure provides an ex vivo method for treating a patient with long chain acyl-coenzyme A dehydrogenase deficiency (LCHADD) comprising the steps of: i) editing with or near a safe harbor locus of a stem cell; ii) differentiating the stem cell into a hepatocyte; and iii) administering the hepatocyte to the patient.

[00585] In another method, Method 56, the present disclosure provides a method as provided in Method 48 or Method 55, wherein the editing step comprises introducing into the stem cell one or more deoxyribonucleic acid (DNA)

endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the safe harbor locus that facilitates insertion of a new sequence from the polynucleotide donor template into the chromosomal DNA at the locus resulting in a permanent insertion or correction of the HADHA gene or other DNA sequences that encode regulatory elements of the HADHA gene, thereby restoring LCHAD activity, and wherein the gRNA comprises a spacer sequence that is complementary to a segment of the locus.

[00586] In another method, Method 57, the present disclosure provides a method as provided in Method 48 or Method 55, wherein the safe harbor locus is selected from the group consisting of AAVS1 (PPP1 R12C), ALB, Angptl3, ApoC3, ASGR2, CCR5, FIX (F9), G6PC, Gys2, HGD, Lp(a), Pcsk9, Serpinal , TF, and TTR. [00587] In another method, Method 58, the disclosure provides a method as provided in any one of Methods 50-57, wherein the differentiating step comprises one or more of the following to differentiate the genome edited stem cell into a hepatocyte: contacting the genome edited stem cell with one or more of insulin, transferrin, FGF4, HGF, or bile acids.

[00588] In another method, Method 59, the disclosure provides a method as provided in any one of Methods 50-58, wherein the administering step comprises administering the hepatocyte to the patient by transplantation, local injection, systemic infusion, or combinations thereof.

[00589] In another method, Method 60, the present disclosure provides an ex vivo method for treating a patient with very long chain acyl coenzyme A

dehydrogenase deficiency (VLCADD) comprising the steps of: i) editing a patient specific induced pluripotent stem cell (iPSC) within or near the ACADVL gene or other DNA sequences that encode regulatory elements of the ACADVL gene of the iPSC; ii) differentiating the edited iPSC into a hepatocyte; and iii) administering the hepatocyte to the patient.

[00590] In another method, Method 61 , the present disclosure provides a method as provided in Method 60, wherein the method further comprises the step of creating a patient specific induced pluripotent stem cell (iPSC).

[00591] In another method, Method 62, the disclosure provides a method as provided in Method 61 , wherein the creating step comprises: a) isolating a somatic cell from the patient; and b) introducing a set of pluripotency-associated genes into the somatic cell to induce the cell to become a pluripotent stem cell.

[00592] In another method, Method 63, the disclosure provides a method as provided in Method 62, wherein the somatic cell is a fibroblast.

[00593] In another method, Method 64, the disclosure provides a method as provided in Method 62, wherein the set of pluripotency-associated genes is one or more of the genes selected from the group consisting of OCT4, SOX2, KLF4, Lin28, NANOG and cMYC. [00594] In another method, Method 65, the disclosure provides a method as provided in any one of Methods 60-64, wherein the editing step comprises introducing into the iPSC one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the ACADVL gene or other DNA sequences that encode regulatory elements of the ACADVL gene that results in a permanent deletion, insertion, or correction of one or more nucleotides, mutations, or exons within or near the ACADVL gene or other DNA sequences that encode regulatory elements of the ACADVL gene, thereby restoring very long chain acyl coenzyme A dehydrogenase (VLCAD) activity.

[00595] In another method, Method 66, the disclosure provides a method as provided in any one of Methods 60-65, wherein the differentiating step comprises one or more of the following to differentiate the genome edited iPSC into a hepatocyte: contacting the genome edited iPSC with one or more of activin, B27 supplement, FGF4, HGF, BMP2, BMP4, Oncostatin M, Dexametason.

[00596] In another method, Method 67, the disclosure provides a method as provided in any one of Methods 60-66, wherein the administering step comprises administering the hepatocyte to the patient by transplantation, local injection, systemic infusion, or combinations thereof.

[00597] In another method, Method 68, the disclosure provides an ex vivo method for treating a patient with very long chain acyl-coenzyme A dehydrogenase deficiency (VLCADD) comprising the steps of: i) editing within or near an ACADVL gene or other DNA sequences that encode regulatory elements of the ACADVL gene of a progenitor cell or primary hepatocyte; and iv) administering the progenitor cell or primary hepatocyte to the patient.

[00598] In another method, Method 69, the present disclosure provides a method as provided in Method 68, wherein the method further comprises the step of isolating a liver specific progenitor cell or primary hepatocyte.

[00599] In another method, Method 70, the present disclosure provides a method as provided in Method 69, wherein the method further comprises the steps of performing a biopsy of the patient's liver; and isolating a liver specific progenitor cell or primary hepatocyte.

[00600] In another method, Method 71 , the disclosure provides a method as provided in Method 69 or Method 70, wherein the isolating step comprises:

perfusion of fresh liver tissues with digestion enzymes, cell differential

centrifugation and cell culturing.

[00601] In another method, Method 72, the disclosure provides a method as provided in any one of Methods 68-71 , wherein the editing step comprises introducing into the progenitor cell or primary hepatocyte one or more

deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the ACADVL gene or other DNA sequences that encode regulatory elements of the ACADVL gene that results in a permanent deletion, insertion, or correction of one or more nucleotides, mutations, or exons within or near the ACADVL gene or other DNA sequences that encode regulatory elements of the ACADVL gene, thereby restoring very long chain acyl coenzyme A dehydrogenase (VLCAD) activity.

[00602] In another method, Method 73, the disclosure provides an ex vivo method for treating a patient with very long chain acyl-coenzyme A dehydrogenase deficiency (VLCADD) comprising the steps of: i) editing with or near a safe harbor locus of a progenitor cell or primary hepatocyte; and ii) administering the progenitor cell or primary hepatocyte to the patient.

[00603] In another method, Method 74, the disclosure provides a method as provided in any one of Methods 68-73, wherein the administering step comprises administering the progenitor cell or primary hepatocyte to the patient by

transplantation, local injection, systemic infusion, or combinations thereof.

[00604] In another method, Method 75, the disclosure provides an ex vivo method for treating a patient with very long chain acyl-coenzyme A dehydrogenase deficiency (VLCADD) comprising the steps of: i) editing an ACADVL gene or other DNA sequences that encode regulatory elements of an ACADVL gene of a stem cell; ii) differentiating the stem cell into a hepatocyte; and iii) administering the hepatocyte to the patient. [00605] In another method, Method 76, the present disclosure provides a method as provided in Method 75, wherein the method further comprises the step of isolating a stem cell.

[00606] In another method, Method 77, the present disclosure provides a method as provided in Method 76, wherein the method further comprises the steps of performing a biopsy of the patient's bone marrow; and isolating a stem cell.

[00607] In another method, Method 78, the disclosure provides a method as provided in Method 76 or Method 77, wherein the isolating step comprises:

aspiration of bone marrow and isolation of mesenchymal cells by density

centrifugation using Percoll™.

[00608] In another method, Method 79, the disclosure provides a method as provided in any one of Methods 75-78, wherein the editing step comprises introducing into the stem cell one or more deoxyribonucleic acid (DNA)

endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the ACADVL gene or other DNA sequences that encode regulatory elements of the ACADVL gene that results in a permanent deletion, insertion, or correction of one or more nucleotides, mutations, or exons within or near the ACADVL gene DNA sequences that encode regulatory elements of the ACADVL gene, thereby restoring very long chain acyl-coenzyme A

dehydrogenase (VLCAD) activity.

[00609] In another method, Method 80, the present disclosure provides an ex vivo method for treating a patient with very long chain acyl-coenzyme A

dehydrogenase deficiency (VLCADD) comprising the steps of: i) editing with or near a safe harbor locus of a stem cell; ii) differentiating the stem cell into a hepatocyte; and iii) administering the hepatocyte to the patient.

[00610] In another method, Method 81 , the present disclosure provides a method as provided in Method 79 or Method 80, wherein the editing step comprises introducing into the stem cell one or more deoxyribonucleic acid (DNA)

endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the safe harbor locus that facilitates insertion of a new sequence from the polynucleotide donor template into the chromosomal DNA at the locus resulting in a permanent insertion or correction of the ACADVL gene or other DNA sequences that encode regulatory elements of the ACADVL gene, thereby restoring VLCAD activity, and wherein the gRNA comprises a spacer sequence that is complementary to a segment of the locus.

[00611] In another method, Method 82, the present disclosure provides a method as provided in Method 79 or Method 80, wherein the safe harbor locus is selected from the group consisting of AAVS1 (PPP1 R12C), ALB, Angptl3, ApoC3, ASGR2, CCR5, FIX (F9), G6PC, Gys2, HGD, Lp(a), Pcsk9, Serpinal , TF, and TTR.

[00612] In another method, Method 83, the disclosure provides a method as provided in any one of Methods 75-82, wherein the differentiating step comprises one or more of the following to differentiate the genome edited stem cell into a hepatocyte: contacting the genome edited stem cell with one or more of insulin, transferrin, FGF4, HGF, or bile acids.

[00613] In another method, Method 84, the disclosure provides a method as provided in any one of Methods 75-83, wherein the administering step comprises administering the hepatocyte to the patient by transplantation, local injection, systemic infusion, or combinations thereof.

[00614] In another method, Method 85, the disclosure provides an in vivo method for treating a patient with medium chain acyl-coenzyme A dehydrogenase deficiency (MCADD) comprising the step of editing a cell of the patient within or near the ACADM gene or other DNA sequences that encode regulatory elements of the ACADM gene or a safe harbor locus.

[00615] In another method, Method 86, the disclosure provides a method as provided in Method 85, wherein the editing step comprises introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the ACADM gene or other DNA sequences that encode regulatory elements of the ACADM gene that results in a permanent deletion, insertion, or correction of one or more nucleotides, mutations, or exons within or near or affecting the expression or function of the ACADM gene or other DNA sequences that encode regulatory elements of the ACADM gene, thereby restoring medium chain acyl-coenzyme A dehydrogenase (MCAD) activity.

[00616] In another method, Method 87, the disclosure provides a method as provided in Method 85, wherein the editing step comprises introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near a safe harbor locus that results in a permanent insertion of the ACADM gene, cDNA, or minigene, thereby restoring medium chain acyl-coenzyme A dehydrogenase (MCAD) activity.

[00617] In another method, Method 88, the disclosure provides an in vivo method for treating a patient with LCHADD comprising the step of editing a cell of the patient within or near an HADHA gene in a cell or other DNA sequences that encode regulatory elements of an HADHA gene in a cell, or a safe harbor locus in a cell.

[00618] In another method, Method 89, the disclosure provides a method as provided in Method 88, wherein the editing step comprises introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near an HADHA gene or other DNA sequences that encode regulatory elements of an HADHA gene that results in a permanent deletion, insertion, or correction, of one or more nucleotides, mutations, or exons within or near the HADHA gene, other DNA sequences that encode regulatory elements of the HADHA gene, thereby restoring Long-chain 3-hydroxyacyl-CoA dehydrogenase (LCHAD) activity.

[00619] In another method, Method 90, the disclosure provides a method as provided in Method 88, wherein the editing step comprises introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near a safe harbor locus that results in a permanent insertion of the HADHA gene, cDNA, or minigene, thereby restoring Long-chain 3-hydroxyacyl-CoA dehydrogenase

(LCHAD) activity. [00620] In another method, Method 91 , the disclosure provides an in vivo method for treating a patient with VLCADD comprising the step of editing a cell of the patient within or near an ACADVL gene in a cell or other DNA sequences that encode regulatory elements of an ACADVL gene in a cell, or a safe harbor locus in a cell.

[00621] In another method, Method 92, the disclosure provides a method as provided in Method 91 , wherein the editing step comprises introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near an ACADVL gene or other DNA sequences that encode regulatory elements of an ACADVL gene that results in a permanent deletion, insertion, or correction, of one or more nucleotides, mutations, or exons within or near the ACADVL gene, other DNA sequences that encode regulatory elements of the ACADVL gene, thereby restoring very long chain acyl coenzyme A dehydrogenase (VLCAD).

[00622] In another method, Method 93, the disclosure provides a method as provided in Method 91 , wherein the editing step comprises introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near a safe harbor locus that results in a permanent insertion of the ACADVL gene, cDNA, or minigene, thereby restoring very long chain acyl coenzyme A dehydrogenase (VLCAD) activity.

[00623] In another method, Method 93, the disclosure provides a method as provided in any one of Methods 87, 90, or 93, wherein the safe harbor locus is selected from the group consisting of AAVS1 (PPP1 R12C), ALB, Angptl3, ApoC3, ASGR2, CCR5, FIX (F9), G6PC, Gys2, HGD, Lp(a), Pcsk9, Serpinal , TF, and TTR.

[00624] In another method, Method 94, the disclosure provides a method as provided in any one of the preceding Methods 1 -93, wherein the method further comprises introducing into the cell one or more guide ribonucleic acids (gRNAs). [00625] In another method, Method 95, the disclosure provides a method as provided in Method 94, wherein the one or more gRNAs are single-molecule guide RNA (sgRNAs).

[00626] In another method, Method 96, the disclosure provides a method as provided in Method 95, wherein the gRNA or sgRNA comprises a spacer sequence consisting of an RNA sequence corresponding to any of SEQ ID NOs: 1 -29,800, SEQ ID NOs: 29,801 -60,041 , and SEQ ID NOs: 60,042-69,825.

[00627] In another method, Method 97, the disclosure provides a method as provided in any one of Methods 94-96, wherein the one or more gRNAs or one or more sgRNAs is one or more modified gRNAs or one or more modified sgRNAs.

[00628] In another method, Method 98, the disclosure provides a method as provided in Method 97, wherein the one or more modified gRNAs or one or more modified sgRNAs includes one or more modifications selected from the group consisting of a modified backbone, a sugar moiety, an internucleoside linkage, and modified or universal bases.

[00629] In another method, Method 99, the disclosure provides a method as provided in any one of Methods 94-98, wherein the one or more DNA

endonucleases is pre-complexed with one or more gRNAs or one or more sgRNAs.

[00630] In another method, Method 100, the disclosure provides a method as provided in any one of the preceding Methods 1 -99, wherein the method further comprises introducing into the cell a polynucleotide donor template comprising: a) at least a portion of the wild-type ACADM gene, minigene, or cDNA; b) at least a portion of the wild-type HADHA gene, minigene, or cDNA; or c) at least a portion of the wild-type ACADVL gene, minigene, or cDNA.

[00631] In another method, Method 101 , the disclosure provides a method as provided in Method 100, wherein the donor template has homologous arms to the 1 p31 .1 region, the 2p23.3 region, or the 17p13.1 region.

[00632] In another method, Method 102, the disclosure provides a method as provided in any one of Methods 1 , 4, or 7, wherein the method further comprises introducing into the cell one guide ribonucleic acid (gRNA) and a polynucleotide donor template comprising at least a portion of the wild-type ACADM gene, and wherein the one or more DNA endonucleases is one or more Cas9 or Cpf1 endonucleases that effect one single-strand break (SSB) or one double-strand break (DSB) at a locus within or near the ACADM gene or other DNA sequences that encode regulatory elements of the ACADM gene that facilitates insertion of a new sequence from the polynucleotide donor template into the chromosomal DNA at the locus resulting in permanent insertion or correction of a part of the ACADM gene or other DNA sequences that encode regulatory elements of the ACADM gene, thereby restoring MCAD activity, and wherein the gRNA comprises a spacer sequence that is complementary to a segment of the locus of safe harbor locus.

[00633] In another method, Method 103, the disclosure provides a method as provided in any one of Methods 1 , 4, or 7, wherein the method further comprises introducing into the cell one guide ribonucleic acid (gRNA) and a polynucleotide donor template comprising at least a portion of a wild-type ACADM gene, and wherein the one or more DNA endonucleases is one or more Cas9 or Cpf1 endonucleases that effect one single-strand break (SSB) or double-strand break (DSB) at a locus within or near a safe harbor locus that facilitates insertion of a new sequence from the polynucleotide donor template into the chromosomal DNA at the locus resulting in a permanent insertion or correction of the ACADM gene or other DNA sequences that encode regulatory elements of the ACADM gene, thereby restoring MCAD activity, and wherein the gRNA comprises a spacer sequence that is complementary to a segment of the locus.

[00634] In another method, Method 104, the disclosure provides a method as provided in any one of Methods 1 , 4 or 7, wherein the method further comprises introducing into the cell two guide ribonucleic acid (gRNAs) and a polynucleotide donor template comprising at least a portion of the wild-type ACADM gene, and wherein the one or more DNA endonucleases is one or more Cas9 or Cpf1 endonucleases that effect a pair of single-strand breaks (SSBs) or double-strand breaks (DSBs), the first at a 5' locus and the second at a 3' locus, within or near the

ACADM gene or other DNA sequences that encode regulatory elements of the

ACADM gene that facilitates insertion of a new sequence from the polynucleotide donor template into the chromosomal DNA between the 5' locus and the 3' locus resulting in permanent insertion or correction of the chromosomal DNA between the 5' locus and the 3' locus within or near the ACADM gene or other DNA sequences that encode regulatory elements of the ACADM gene, thereby restoring MCAD activity.

[00635] In another method, Method 105, the disclosure provides a method as provided in Method 104, wherein the first guide RNA comprises a spacer sequence that is complementary to a segment of the 5' locus and the second guide RNA comprises a spacer sequence that is complementary to a segment of the 3' locus.

[00636] In another method, Method 106, the disclosure provides a method as provided in any one of Methods 102-105, wherein the spacer sequence has an RNA sequence corresponding to a sequence selected from SEQ ID NO: 1 -29,800.

[00637] In another method, Method 107, the disclosure provides a method as provided in any one of Methods 1 , 4, or 7, wherein the method further comprises introducing into the cell two guide ribonucleic acid (gRNAs) and a polynucleotide donor template comprising at least a portion of a wild-type ACADM gene, and wherein the one or more DNA endonucleases is one or more Cas9 or Cpf1 endonucleases that effect a pair of single-strand breaks (SSBs) or double-strand breaks (DSBs), the first at a 5' locus and the second at a 3' locus, within or near a safe harbor locus that facilitates insertion of a new sequence from the

polynucleotide donor template into the chromosomal DNA between the 5' locus and the 3' locus resulting in a permanent insertion of all or part of the donor template within or near the safe harbor locus, thereby restoring MCAD activity.

[00638] In another method, Method 108, the disclosure provides a method as provided in any one of Methods 102-107, wherein the one or two gRNAs are one or two single-molecule guide RNA (sgRNAs).

[00639] In another method, Method 109, the disclosure provides a method as provided in any one of Methods 102-108, wherein the one or two gRNAs or one or two sgRNAs is one or two modified gRNAs or one or two modified sgRNAs.

[00640] In another method, Method 1 10, the disclosure provides a method as provided in any one of Methods 100 or 102-109, wherein the part of the wild-type ACADM gene or minigene or cDNA is exon 1 , intron 1 , exon 2, intron 2, exon 3, intron 3, exon 4, intron 4, exon 5, intron 5, exon 6, intron 6, exon 7, intron 7, exon 8, intron 8, exon 9, intron 9, exon 10, intron 10, exon 1 1 , intron 1 1 , exon 12, fragments, or combinations thereof, or the entire ACADM gene, DNA sequences that encode wild type regulatory elements of the ACADM gene.

[00641] In another method, Method 1 1 1 , the disclosure provides a method as provided in any one of Methods 100-1 10, wherein the donor template is either a single or double stranded polynucleotide.

[00642] In another method, Method 1 12, the disclosure provides a method as provided in Method 1 1 1 , wherein the donor template comprises a sequence selected from the group consisting of SEQ ID NO: 69,836-69,861 .

[00643] In another method, Method 1 13, the disclosure provides a method as provided in any one of Methods 100-1 12, wherein the donor template has arms homologous to the 1 p31 .1 region.

[00644] In another method, Method 1 14, the disclosure provides a method as provided in any one of Methods 1 , 4, or 7, wherein the gRNA or sgRNA is directed to one or more mutations selected from the group consisting of 157C to T, 343-348 deletion, 347G to A, 351 A to C, 362C to T, 447G to A, 577A to G, 583G to A, 617G to T, 474T to G, 730T to C, 799G to A, 977T to C, 985A to G, 1008 T to A, 1045 C to T, 1055A to G, 1 124T to C, 1 152G to T, 955-956 deletion, 1 100-1 103 deletion, 999 inserted TAGAATGAGTTAC (SEQ ID NO: 69, 862) and 1 190 inserted T.

[00645] In another method, Method 1 15, the disclosure provides a method as provided in any one of Methods 1 , 4, or 7, wherein the insertion or correction is by homology directed repair (HDR) or nonhomologous end-joining (NHEJ).

[00646] In another method, Method 1 16, the disclosure provides a method as provided in any one of Methods 1 , 4, or 7, wherein the method further comprises introducing into the cell two guide ribonucleic acid (gRNAs), and wherein the one or more DNA endonucleases is one or more Cas9 of Cpf1 endonucleases that effect a pair of double-strand breaks (DSBs), the first at a 5' DSB locus and the second at a 3' DSB locus, within or near the ACADM gene or other DNA sequences that encode regulatory elements of the ACADM gene that results in permanent deletion of the chromosomal DNA between the 5' locus and the 3' locus within or near the ACADM gene, thereby restoring MCAD activity.

[00647] In another method, Method 1 17, the disclosure provides a method as provided in Method 1 16, wherein the two guides are selected from a first guide RNA comprising a spacer sequence that is complementary to a segment of the 5' locus and a second guide RNA comprising a spacer sequence that is

complementary to a segment of the 3' locus.

[00648] In another method, Method 1 18, the disclosure provides a method as provided in Method 1 16 or Method 1 17, wherein the spacer sequence of first and second guide RNAs has an RNA sequence corresponding to any one of SEQ ID NOs: 1 -29,800.

[00649] In another method, Method 1 19, the disclosure provides a method as provided in Method 1 17 or Method 1 18, wherein the two gRNAs are two single- molecule guide RNA (sgRNAs).

[00650] In another method, Method 120, the disclosure provides a method as provided in any one of Methods 1 16-1 19, wherein the two gRNAs or two sgRNAs are two modified gRNAs or two modified sgRNAs.

[00651] In another method, Method 121 , the disclosure provides a method as provided in any one of Methods 109-1 14 or 1 16-120, wherein the one or more DNA endonucleases is pre-complexed with one or two gRNAs or one or two sgRNAs.

[00652] In another method, Method 122, the disclosure provides a method as provided in any one of Methods 1 15-121 , wherein the deletion is a deletion of 1 kb or less.

[00653] In another method, Method 123, the disclosure provides a method as provided in any one of Methods 2, 5, or 8, wherein the method further comprises introducing into the cell one guide ribonucleic acid (gRNA) and a polynucleotide donor template comprising at least a portion of the wild-type HADHA gene, and wherein the one or more DNA endonucleases is one or more Cas9 or Cpf1 endonucleases that effect one single-strand break (SSB) or one double-strand break (DSB) at a locus within or near the HADHA gene or other DNA sequences that encode regulatory elements of the HADHA gene that facilitates insertion of a new sequence from the polynucleotide donor template into the chromosomal DNA at the locus resulting in permanent insertion or correction of a part of the HADHA gene or other DNA sequences that encode regulatory elements of the HADHA gene, thereby restoring LCHAD activity, and wherein the gRNA comprises a spacer sequence that is complementary to a segment of the locus of safe harbor locus.

[00654] In another method, Method 124, the disclosure provides a method as provided in any one of Methods 2, 5, or 8, wherein the method further comprises introducing into the cell one guide ribonucleic acid (gRNA) and a polynucleotide donor template comprising at least a portion of a wild-type HADHA gene, and wherein the one or more DNA endonucleases is one or more Cas9 or Cpf1 endonucleases that effect one single-strand break (SSB) or double-strand break (DSB) at a locus within or near a safe harbor locus that facilitates insertion of a new sequence from the polynucleotide donor template into the chromosomal DNA at the locus resulting in a permanent insertion or correction of the HADHA gene or other DNA sequences that encode regulatory elements of the HADHA gene, thereby restoring LCHAD activity, and wherein the gRNA comprises a spacer sequence that is complementary to a segment of the locus.

[00655] In another method, Method 125, the disclosure provides a method as provided in any one of Methods 2, 5, or 8, wherein the method further comprises introducing into the cell two guide ribonucleic acid (gRNAs) and a polynucleotide donor template comprising at least a portion of the wild-type HADHA gene, and wherein the one or more DNA endonucleases is one or more Cas9 or Cpf1 endonucleases that effect a pair of single-strand breaks (SSBs) or double-strand breaks (DSBs), the first at a 5' locus and the second at a 3' locus, within or near the HADHA gene or other DNA sequences that encode regulatory elements of the HADHA gene that facilitates insertion of a new sequence from the polynucleotide donor template into the chromosomal DNA between the 5' locus and the 3' locus resulting in permanent insertion or correction of the chromosomal DNA between the 5' locus and the 3' locus within or near the HADHA gene or other DNA sequences that encode regulatory elements of the HADHA gene, thereby restoring LCHAD activity.

[00656] In another method, Method 126, the disclosure provides a method as provided in Method 125, wherein the first guide RNA comprises a spacer sequence that is complementary to a segment of the 5' locus and the second guide RNA comprises a spacer sequence that is complementary to a segment of the 3' locus.

[00657] In another method, Method 127, the disclosure provides a method as provided in any one of Methods 123-126, wherein the spacer sequence has an RNA sequence corresponding to a sequence selected from SEQ ID NO: 29,801 - 60,041 .

[00658] In another method, Method 128, the disclosure provides a method as provided in any one of Methods 2, 5, or 8, wherein the method further comprises introducing into the cell two guide ribonucleic acid (gRNAs) and a polynucleotide donor template comprising at least a portion of a wild-type HADHA gene, and wherein the one or more DNA endonucleases is one or more Cas9 or Cpf1 endonucleases that effect a pair of single-strand breaks (SSBs) or double-strand breaks (DSBs), the first at a 5' locus and the second at a 3' locus, within or near a safe harbor locus that facilitates insertion of a new sequence from the

polynucleotide donor template into the chromosomal DNA between the 5' locus and the 3' locus resulting in a permanent insertion of all or part of the donor template within or near the safe harbor locus, thereby restoring LCHAD activity.

[00659] In another method, Method 129, the disclosure provides a method as provided in any one of Methods 123-128, wherein the one or two gRNAs are one or two single-molecule guide RNA (sgRNAs).

[00660] In another method, Method 130, the disclosure provides a method as provided in any one of Methods 123-129, wherein the one or two gRNAs or one or two sgRNAs is one or two modified gRNAs or one or two modified sgRNAs.

[00661] In another method, Method 131 , the disclosure provides a method as provided in any one of Methods 100 or 123-130, wherein the part of the wild-type HADHA gene or minigene or cDNA is exon 1 , intron 1 , exon 2, intron 2, exon 3, intron 3, exon 4, intron 4, exon 5, intron 5, exon 6, intron 6, exon 7, intron 7, exon 8, intron 8, exon 9, intron 9, exon 10, intron 10, exon 1 1 , intron 1 1 , exon 12, intron 12, exon 13, intron 13, exon 14, intron 14, exon 15, intron 15, exon 16, intron 16, exon 17, intron 17, exon 18, intron 18, exon 19, intron 19, exon 20, fragments, or combinations thereof, or the entire HADHA gene, DNA sequences that encode wild type regulatory elements of the HADHA gene.

[00662] In another method, Method 132, the disclosure provides a method as provided in any one of Methods 100 or 123-131 , wherein the donor template is either a single or double stranded polynucleotide.

[00663] In another method, Method 133, the disclosure provides a method as provided in Method 132, wherein the donor template comprises a sequence selected from the group consisting of SEQ ID NO: 69,836-69,861 .

[00664] In another method, Method 134, the disclosure provides a method as provided in any one of Methods 100 or 123-133, wherein the donor template has arms homologous to the 2p23.3 region.

[00665] In another method, Method 135, the disclosure provides a method as provided in any one of Methods 2, 5, or 8, wherein the gRNA or sgRNA is directed to a G1528C mutation.

[00666] In another method, Method 136, the disclosure provides a method as provided in any one of Methods 2, 5, or 8, wherein the insertion or correction is by homology directed repair (HDR) or nonhomologous end-joining (NHEJ).

[00667] In another method, Method 137, the disclosure provides a method as provided in any one of Methods 2, 5, or 8, wherein the method further comprises introducing into the cell two guide ribonucleic acid (gRNAs), and wherein the one or more DNA endonucleases is one or more Cas9 of Cpf1 endonucleases that effect a pair of double-strand breaks (DSBs), the first at a 5' DSB locus and the second at a 3' DSB locus, within or near the HADHA gene or other DNA sequences that encode regulatory elements of the HADHA gene that results in permanent deletion of the chromosomal DNA between the 5' locus and the 3' locus within or near the HADHA gene, thereby restoring LCHAD activity. [00668] In another method, Method 138, the disclosure provides a method as provided in Method 137, wherein the two guides are selected from a first guide RNA comprising a spacer sequence that is complementary to a segment of the 5' locus and a second guide RNA comprising a spacer sequence that is

complementary to a segment of the 3' locus.

[00669] In another method, Method 139, the disclosure provides a method as provided in Method 137 or Method 138, wherein the spacer sequence of first and second guide RNAs has an RNA sequence corresponding to any one of SEQ ID NOs: 29,801 -60,041 .

[00670] In another method, Method 140, the disclosure provides a method as provided in Method 138 or Method 139, wherein the two gRNAs are two single- molecule guide RNA (sgRNAs).

[00671] In another method, Method 141 , the disclosure provides a method as provided in any one of Methods 137-140, wherein the two gRNAs or two sgRNAs are two modified gRNAs or two modified sgRNAs.

[00672] In another method, Method 142, the disclosure provides a method as provided in any one of Methods 130-135 or 137-141 , wherein the one or more DNA endonucleases is pre-complexed with one or two gRNAs or one or two sgRNAs.

[00673] In another method, Method 143, the disclosure provides a method as provided in any one of Methods 136-142, wherein the deletion is a deletion of 1 kb or less.

[00674] In another method, Method 144, the disclosure provides a method as provided in any one of Methods 3, 6, or 9, wherein the method further comprises introducing into the cell one guide ribonucleic acid (gRNA) and a polynucleotide donor template comprising at least a portion of the wild-type ACADVL gene, and wherein the one or more DNA endonucleases is one or more Cas9 or Cpf1 endonucleases that effect one single-strand break (SSB) or one double-strand break (DSB) at a locus within or near the ACADVL gene or other DNA sequences that encode regulatory elements of the ACADVL gene that facilitates insertion of a new sequence from the polynucleotide donor template into the chromosomal DNA at the locus resulting in permanent insertion or correction of a part of the ACADVL gene or other DNA sequences that encode regulatory elements of the ACADVL gene, thereby restoring VLCAD activity, and wherein the gRNA comprises a spacer sequence that is complementary to a segment of the locus of safe harbor locus.

[00675] In another method, Method 145, the disclosure provides a method as provided in any one of Methods 3, 6, or 9, wherein the method further comprises introducing into the cell one guide ribonucleic acid (gRNA) and a polynucleotide donor template comprising at least a portion of a wild-type ACADVL gene, and wherein the one or more DNA endonucleases is one or more Cas9 or Cpf1 endonucleases that effect one single-strand break (SSB) or double-strand break (DSB) at a locus within or near a safe harbor locus that facilitates insertion of a new sequence from the polynucleotide donor template into the chromosomal DNA at the locus resulting in a permanent insertion or correction of the ACADVL gene or other DNA sequences that encode regulatory elements of the ACADVL gene, thereby restoring VLCAD activity, and wherein the gRNA comprises a spacer sequence that is complementary to a segment of the locus.

[00676] In another method, Method 146, the disclosure provides a method as provided in any one of Methods 3, 6, or 9, wherein the method further comprises introducing into the cell two guide ribonucleic acid (gRNAs) and a polynucleotide donor template comprising at least a portion of the wild-type ACADVL gene, and wherein the one or more DNA endonucleases is one or more Cas9 or Cpf1 endonucleases that effect a pair of single-strand breaks (SSBs) or double-strand breaks (DSBs), the first at a 5' locus and the second at a 3' locus, within or near the ACADVL gene or other DNA sequences that encode regulatory elements of the ACADVL gene that facilitates insertion of a new sequence from the polynucleotide donor template into the chromosomal DNA between the 5' locus and the 3' locus resulting in permanent insertion or correction of the chromosomal DNA between the 5' locus and the 3' locus within or near the ACADVL gene or other DNA sequences that encode regulatory elements of the ACADVL gene, thereby restoring VLCAD activity. [00677] In another method, Method 147, the disclosure provides a method as provided in Method 146, wherein the first guide RNA comprises a spacer sequence that is complementary to a segment of the 5' locus and the second guide RNA comprises a spacer sequence that is complementary to a segment of the 3' locus.

[00678] In another method, Method 148, the disclosure provides a method as provided in any one of Methods 144-147, wherein the spacer sequence has an RNA sequence corresponding to a sequence selected from SEQ ID NO: 60,042- 69,825.

[00679] In another method, Method 149, the disclosure provides a method as provided in any one of Methods 3, 6, or 9, wherein the method further comprises introducing into the cell two guide ribonucleic acid (gRNAs) and a polynucleotide donor template comprising at least a portion of a wild-type ACADVL gene, and wherein the one or more DNA endonucleases is one or more Cas9 or Cpf1 endonucleases that effect a pair of single-strand breaks (SSBs) or double-strand breaks (DSBs), the first at a 5' locus and the second at a 3' locus, within or near a safe harbor locus that facilitates insertion of a new sequence from the

polynucleotide donor template into the chromosomal DNA between the 5' locus and the 3' locus resulting in a permanent insertion of all or part of the donor template within or near the safe harbor locus, thereby restoring VLCAD activity.

[00680] In another method, Method 150, the disclosure provides a method as provided in any one of Methods 144-149, wherein the one or two gRNAs are one or two single-molecule guide RNA (sgRNAs).

[00681] In another method, Method 151 , the disclosure provides a method as provided in any one of Methods 144-150, wherein the one or two gRNAs or one or two sgRNAs is one or two modified gRNAs or one or two modified sgRNAs.

[00682] In another method, Method 152, the disclosure provides a method as provided in any one of Methods 100 or 144-151 , wherein the part of the wild-type ACADVL gene or minigene or cDNA is exon 1 , intron 1 , exon 2, intron 2, exon 3, intron 3, exon 4, intron 4, exon 5, intron 5, exon 6, intron 6, exon 7, intron 7, exon 8, intron 8, exon 9, intron 9, exon 10, intron 10, exon 1 1 , intron 1 1 , exon 12, intron 12, exon 13, intron 13, exon 14, intron 14, exon 15, intron 15, exon 16, intron 16, exon 17, intron 17, exon 18, intron 18, exon 19, intron 19, exon 20, fragments, or combinations thereof, or the entire ACADVL gene, DNA sequences that encode wild type regulatory elements of the ACADVL gene.

[00683] In another method, Method 153, the disclosure provides a method as provided in any one of Methods 100 or 144-152, wherein the donor template is either a single or double stranded polynucleotide.

[00684] In another method, Method 154, the disclosure provides a method as provided in Method 153, wherein the donor template comprises a sequence selected from the group consisting of SEQ ID NO: 69,836-69,861 .

[00685] In another method, Method 155, the disclosure provides a method as provided in any one of Methods 100 or 144-154, wherein the donor template has arms homologous to the 17p13.1 region.

[00686] In another method, Method 156, the disclosure provides a method as provided in any one of Methods 3, 6, or 9, wherein the gRNA or sgRNA is directed to one or more mutations selected from the group consisting of T848C and A848T.

[00687] In another method, Method 157, the disclosure provides a method as provided in any one of Methods 3, 6, or 9, wherein the insertion or correction is by homology directed repair (HDR) or nonhomologous end-joining (NHEJ).

[00688] In another method, Method 158, the disclosure provides a method as provided in any one of Methods 3, 6, or 9, wherein the method further comprises introducing into the cell two guide ribonucleic acid (gRNAs), and wherein the one or more DNA endonucleases is one or more Cas9 of Cpf1 endonucleases that effect a pair of double-strand breaks (DSBs), the first at a 5' DSB locus and the second at a 3' DSB locus, within or near the ACADVL gene or other DNA sequences that encode regulatory elements of the ACADVL gene that results in permanent deletion of the chromosomal DNA between the 5' locus and the 3' locus within or near the ACADVL gene, thereby restoring VLCAD activity.

[00689] In another method, Method 159, the disclosure provides a method as provided in Method 158, wherein the two guides are selected from a first guide RNA comprising a spacer sequence that is complementary to a segment of the 5' locus and a second guide RNA comprising a spacer sequence that is

complementary to a segment of the 3' locus.

[00690] In another method, Method 160, the disclosure provides a method as provided in Method 158 or Method 159, wherein the spacer sequence of first and second guide RNAs has an RNA sequence corresponding to any one of SEQ ID NOs: 60,042-69,825.

[00691] In another method, Method 161 , the disclosure provides a method as provided in Method 159 or Method 160, wherein the two gRNAs are two single- molecule guide RNA (sgRNAs).

[00692] In another method, Method 162, the disclosure provides a method as provided in any one of Methods 158-161 , wherein the two gRNAs or two sgRNAs are two modified gRNAs or two modified sgRNAs.

[00693] In another method, Method 163, the disclosure provides a method as provided in any one of Methods 151 -156 or 158-162, wherein the one or more DNA endonucleases is pre-complexed with one or two gRNAs or one or two sgRNAs.

[00694] In another method, Method 164, the disclosure provides a method as provided in any one of Methods 157-163, wherein the deletion is a deletion of 1 kb or less.

[00695] In another method, Method 165, the disclosure provides a method as provided in any one of the preceding methods, wherein the endonuclease is encoded by an mRNA and wherein the endonuclease mRNA and gRNA are formulated into separate lipid nanoparticles or co-formulated into a lipid

nanoparticle.

[00696] In another method, Method 166, the disclosure provides a method as provided in any one of Methods 100-164, wherein the endonuclease is encoded by an mRNA and wherein the endonuclease mRNA, gRNA, and donor template are either each formulated into separate lipid nanoparticles or all co-formulated into a lipid nanoparticle.

[00697] In another method, Method 167, the disclosure provides a method as provided in any one of Methods 100-164, wherein the endonuclease is encoded by an mRNA and wherein the endonuclease mRNA is formulated into a lipid nanoparticle, and both the gRNA and donor template are delivered by a viral vector.

[00698] In another method, Method 168, the disclosure provides a method as provided in Method 166 or Method 167, wherein the viral vector is an adeno- associated virus (AAV) vector.

[00699] In another method, Method 169, the disclosure provides a method as provided in Method 168, wherein the AAV vector is an AAV6 vector.

[00700] In another method, Method 170, the disclosure provides a method as provided in any one of Methods 100-164, wherein the endonuclease is encoded by an mRNA and wherein the endonuclease mRNA, gRNA and a donor template are either each formulated into separate exosomes, or all co-formulated into an exosome.

[00701] In another method, Method 171 , the disclosure provides a method as provided in any one of Methods 100-164, wherein the endonuclease is encoded by an mRNA and wherein the endonuclease mRNA is formulated into a lipid nanoparticle, and the gRNA is delivered to the cell by electroporation and donor template is delivered to the cell by a viral vector.

[00702] In another method, Method 172, the disclosure provides a method as provided in Method 171 , wherein the viral vector is an adeno-associated virus (AAV) vector.

[00703] In another method, Method 173, the disclosure provides a method as provided in Method 172, wherein the AAV vector is an AAV6 vector.

[00704] In another method, Method 174, the disclosure provides a method as provided in any one of Methods 100-164, wherein the gRNA is delivered to the cell by electroporation and donor template is delivered to the cell by a viral vector.

[00705] In another method, Method 175, the disclosure provides a method as provided in Method 174, wherein the viral vector is an adeno-associated virus (AAV) vector. [00706] In another method, Method 176, the disclosure provides a method as provided in Method 175, wherein the AAV vector is an AAV6 vector.

[00707] In another method, Method 177, the disclosure provides a method as provided in any one of the preceding methods, wherein the one or more DNA endonucleases is a Cas9 or Cpf1 endonuclease; or a homolog thereof,

recombination of the naturally occurring molecule, codon-optimized, or modified version thereof, or combinations thereof.

[00708] In another method, Method 178, the disclosure provides a method as provided in Method 177, wherein the method comprises introducing into the cell one or more polynucleotides encoding the one or more DNA endonucleases.

[00709] In another method, Method 179, the disclosure provides a method as provided in Method 177, wherein the method comprises introducing into the cell one or more ribonucleic acids (RNAs) encoding the one or more DNA

endonucleases.

[00710] In another method, Method 180, the disclosure provides a method as provided in Method 178 or Method 179, wherein the one or more polynucleotides or one or more RNAs is one or more modified polynucleotides or one or more modified RNAs.

[00711] In another method, Method 181 , the disclosure provides a method as provided in Method 177, wherein the DNA endonuclease is a protein or

polypeptide.

[00712] In another method, Method 182, the disclosure provides a method as provided in any one of the preceding methods, wherein the DNA endonuclease is a Cas9 or Cpf1 endonuclease comprising one or more nuclear localization signals (NLSs).

[00713] In another method, Method 183, the disclosure provides a method as provided in Method 182, wherein at least one NLS is at or within 50 amino acids of the amino-terminus of the Cas9 or Cpfl endonuclease and/or at least one NLS is at or within 50 amino acids of the carboxy-terminus of the Cas9 or Cpfl

endonuclease. [00714] In another method, Method 184, the disclosure provides a method as provided in Method 183, wherein the polynucleotide encoding a DNA endonuclease is codon optimized for expression in a eukaryotic cell.

[00715] In another method, Method 185, the disclosure provides a method as provided in any one of the preceding methods, wherein the ACADM gene is located on Chromosome 1 : 75,724,346 - 75,763,678 (Genome Reference Consortium - GRCh38/hg38), the HADHA gene the HADHA gene is located on Chromosome 2: 26,190,634 - 26,244,725 (Genome Reference Consortium - GRCh38/hg38), or the ACADVL gene is located on Chromosome 17: 7,217, 125 - 7,225,266 (Genome Reference Consortium - GRCh38/hg38).

[00716] In another method, Method 186, the disclosure provides a method as provided in any one of the preceding methods, wherein restoration of ACADM activity is compared to wild-type or normal ACADM activity, wherein restoration of HADHA activity is compared to wild-type or normal HADHA activity, or wherein restoration of ACADVL activity is compared to wild-type or normal ACADVL activity.

[00717] In another method, Method 187, the disclosure provides a method as provided in any one of the preceding methods, wherein the cell is a human cell.

[00718] In another method, Method 188, the disclosure provides a method as provided in Method 187, wherein the human cell is a hepatocyte.

[00719] In another method, Method 189, the disclosure provides a method as provided in any one of the preceding methods, wherein the ACADM gene, the HADHA gene, or the ACADVL gene is operably linked to an exogenous promoter that drives expression of the ACADM gene, the HADHA gene, or the ACADVL gene.

[00720] In another method, Method 190, the disclosure provides a method as provided in any one of the preceding methods, wherein the one or more loci occurs at a location immediately 3' to an endogenous promoter locus.

[00721] In another method, Method 191 , the disclosure provides a method as provided in any one of the preceding methods, wherein the donor molecule contains one or more target sites for the endonuclease:gRNA. [00722] In another method, Method 192, the disclosure provides a method as provided in any one of the preceding methods, wherein the donor molecule or a molecule derived from the donor molecule is cleaved one or more times by the endonuclease:gRNA.

[00723] The disclosure also provides a composition, Composition 1 , of one or more guide ribonucleic acids (gRNAs) comprising a spacer sequence selected from the group consisting of the nucleic acid sequences in SEQ ID NOs: 1 -29,800.

[00724] The disclosure also provides a composition, Composition 2, of one or more guide ribonucleic acids (gRNAs) comprising a spacer sequence selected from the group consisting of the nucleic acid sequences in SEQ ID NOs: 29,801 -60,041 .

[00725] The disclosure also provides a composition, Composition 3, of one or more guide ribonucleic acids (gRNAs) comprising a spacer sequence selected from the group consisting of the nucleic acid sequences in SEQ ID NOs: 60,042-69,825.

[00726] In another composition, Composition 4, the present disclosure provides a composition as provided in any one of Compositions 1 -3, wherein the one or more gRNAs are one or more single-molecule guide RNAs (sgRNAs).

[00727] In another composition, Composition 5, the present disclosure provides a composition as provided in any one of Compositions 1 to 4, wherein the one or more gRNAs or one or more sgRNAs is one or more modified gRNAs or one or more modified sgRNAs.

[00728] In another composition, Composition 6, the present disclosure provides a composition of a single-molecule guide RNA comprising at least a spacer sequence that is an RNA sequence corresponding to any of SEQ ID NOs: 1 -29,800 , SEQ ID Nos: 29,801 -60,041 ; or SEQ ID Nos: 60,042-69,825.

[00729] In another composition, Composition 7, the present disclosure provides a composition as provided in Composition 6, wherein the single-molecule guide polynucleotide further comprises a spacer extension region.

[00730] In another composition, Composition 8, the present disclosure provides a composition as provided in Composition 6, wherein the single-molecule guide polynucleotide further comprises a tracrRNA extension region. [00731] In another composition, Composition 9, the present disclosure provides a composition as provided in any one of Compositions 6 to 8, wherein the single- molecule guide polynucleotide is chemically modified.

[00732] In another composition, Composition 10, the present disclosure provides a composition of a DNA encoding a single-molecule guide RNA as provided in any one of Compositions 6 to 9.

[00733] Definitions

[00734] The term "comprising" or "comprises" is used in reference to

compositions, methods, and respective component(s) thereof, that are essential to the invention, yet open to the inclusion of unspecified elements, whether essential or not.

[00735] The term "consisting essentially of" refers to those elements required for a given embodiment. The term permits the presence of additional elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment of the invention.

[00736] The term "consisting of" refers to compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.

[00737] The singular forms "a," "an," and "the" include plural references, unless the context clearly dictates otherwise.

[00738] Certain numerical values presented herein are preceded by the term "about." The term "about" is used to provide literal support for the numerical value the term "about" precedes, as well as a numerical value that is approximately the numerical value, that is the approximating unrecited numerical value may be a number which, in the context it is presented, is the substantial equivalent of the specifically recited numerical value. The term "about" means numerical values within +10% of the recited numerical value.

[00739] When a range of numerical values is presented herein, it is

contemplated that each intervening value between the lower and upper limit of the range, the values that are the upper and lower limits of the range, and all stated values with the range are encompassed within the disclosure. All the possible subranges within the lower and upper limits of the range are also contemplated by the disclosure.

[00740] The details of one or more embodiments of the invention are set forth in the accompanying description below. Although any materials and methods similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, the preferred materials and methods are now described. Other features, objects and advantages of the invention will be apparent from the description. In the description, the singular forms also include the plural unless the context clearly dictates otherwise. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In the case of conflict, the present description will control.

[00741] Any numerical range recited in this specification describes all subranges of the same numerical precision (i.e., having the same number of specified digits) subsumed within the recited range. For example, a recited range of "1 .0 to 10.0" describes all sub-ranges between (and including) the recited minimum value of 1 .0 and the recited maximum value of 10.0, such as, for example, "2.4 to 7.6," even if the range of "2.4 to 7.6" is not expressly recited in the text of the

specification. Accordingly, the Applicant reserves the right to amend this

specification, including the claims, to expressly recite any sub-range of the same numerical precision subsumed within the ranges expressly recited in this specification. All such ranges are inherently described in this specification such that amending to expressly recite any such sub-ranges will comply with written description, sufficiency of description, and added matter requirements, including the requirements under 35 U.S.C. § 1 12(a) and Article 123(2) EPC. Also, unless expressly specified or otherwise required by context, all numerical parameters described in this specification (such as those expressing values, ranges, amounts, percentages, and the like) may be read as if prefaced by the word "about," even if the word "about" does not expressly appear before a number. Additionally, numerical parameters described in this specification should be construed in light of the number of reported significant digits, numerical precision, and by applying ordinary rounding techniques. It is also understood that numerical parameters described in this specification will necessarily possess the inherent variability characteristic of the underlying measurement techniques used to determine the numerical value of the parameter.

[00742] The details of one or more aspects of the present disclosure are set forth in the accompanying description below. Although any materials and methods similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, the preferred materials and methods are now described. Other features, objects and advantages of the disclosure will be apparent from the description. In the description, the singular forms also include the plural unless the context clearly dictates otherwise. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. In the case of conflict, the present description will control.

[00743] The present invention is further illustrated by the following non-limiting examples.

Examples

[00744] The invention will be more fully understood by reference to the following examples, which provide illustrative non-limiting embodiments of the invention.

[00745] The examples describe the use of the CRISPR system as an illustrative genome editing technique to create defined therapeutic genomic deletions, insertions, or replacements, termed "genomic modifications" herein, in a gene selected from the group consisting of the ACADM gene, the HADHA gene, and the ACADVL gene that lead to permanent correction of mutations in the genomic locus, or expression at a heterologous locus, that restore MCAD activity, tri-functional protein (TFP)/ LCHAD activity, or VLCAD activity. Introduction of the defined therapeutic modifications represents a novel therapeutic strategy for the potential amelioration of MCADD, LCHADD, and/or VLCADD, as described and illustrated herein. Example 1 - CRISPR/SpCas9 target sites for the ACADM gene, the HADHA gene, and the ACADVL gene

[00746] Regions of the ACADM gene were scanned for target sites. Each area was scanned for a protospacer adjacent motif (PAM) having the sequence NRG. gRNA 20 bp spacer sequences corresponding to the PAM were identified, as shown in SEQ ID NOs: 1 -10,827.

[00747] Regions of the HADHA gene were scanned for target sites. Each area was scanned for a protospacer adjacent motif (PAM) having the sequence NRG. gRNA 20 bp spacer sequences corresponding to the PAM were identified, as shown in SEQ ID NOs: 29,801 -41 , 191 .

[00748] Regions of the ACADVL gene were scanned for target sites. Each area was scanned for a protospacer adjacent motif (PAM) having the sequence NRG. gRNA 20 bp spacer sequences corresponding to the PAM were identified, as shown in SEQ ID NOs: 60,042-65,507.

Example 2 - CRISPR/SaCas9 target sites for the ACADM gene, the HADHA gene, and the ACADVL gene

[00749] Regions of the ACADM gene were scanned for target sites. Each area was scanned for a protospacer adjacent motif (PAM) having the sequence NNGRRT. gRNA 20 bp spacer sequences corresponding to the PAM were identified, as shown in SEQ ID NOs: 10,828-12,058.

[00750] Regions of the HADHA gene were scanned for target sites. Each area was scanned for a protospacer adjacent motif (PAM) having the sequence NNGRRT. gRNA 20 bp spacer sequences corresponding to the PAM were identified, as shown in SEQ ID NOs: 41 , 192-42,553.

[00751] Regions of the ACADVL gene were scanned for target sites. Each area was scanned for a protospacer adjacent motif (PAM) having the sequence NNGRRT. gRNA 20 bp spacer sequences corresponding to the PAM were identified, as shown in SEQ ID NOs: 65,508-65,951 . Example 3 - CRISPR/StCas9 target sites for the ACADM gene, the HADHA gene, and the ACADVL gene

[00753] Regions of the ACADM gene were scanned for target sites. Each area was scanned for a protospacer adjacent motif (PAM) having the sequence NNAGAAW. gRNA 20 bp spacer sequences corresponding to the PAM were identified, as shown in SEQ I D NOs: 12,059-12,536.

[00754] Regions of the HADHA gene were scanned for target sites. Each area was scanned for a protospacer adjacent motif (PAM) having the sequence NNAGAAW. gRNA 20 bp spacer sequences corresponding to the PAM were identified, as shown in SEQ ID NOs: 42,554-42,980.

[00755] Regions of the ACADVL gene were scanned for target sites. Each area was scanned for a protospacer adjacent motif (PAM) having the sequence NNAGAAW. gRNA 20 bp spacer sequences corresponding to the PAM were identified, as shown in SEQ ID NOs: 65,952-66,009.

Example 4 - CRISPR/TdCas9 target sites for the ACADM gene, the HADHA gene, and the ACADVL gene

[00756] Regions of the ACADM gene were scanned for target sites. Each area was scanned for a protospacer adjacent motif (PAM) having the sequence NAAAAC. gRNA 20 bp spacer sequences corresponding to the PAM were identified, as shown in SEQ I D NOs: 12,537-12,733.

[00757] Regions of the HADHA gene were scanned for target sites. Each area was scanned for a protospacer adjacent motif (PAM) having the sequence NAAAAC. gRNA 20 bp spacer sequences corresponding to the PAM were identified, as shown in SEQ ID NOs: 42,981 -43, 173.

[00758] Regions of the ACADVL gene were scanned for target sites. Each area was scanned for a protospacer adjacent motif (PAM) having the sequence NAAAAC. gRNA 20 bp spacer sequences corresponding to the PAM were identified, as shown in SEQ ID NOs: 66,010-66,029. Example 5 - CRISPR/NmCas9 target sites for the ACADM gene, the HADHA gene, and the ACADVL gene

[00760] Regions of the ACADM gene were scanned for target sites. Each area was scanned for a protospacer adjacent motif (PAM) having the sequence

NNNNGATT. gRNA 20 bp spacer sequences corresponding to the PAM were identified, as shown in SEQ I D NOs: 12,734-13,961 .

[00761] Regions of the HADHA gene were scanned for target sites. Each area was scanned for a protospacer adjacent motif (PAM) having the sequence

NNNNGATT. gRNA 20 bp spacer sequences corresponding to the PAM were identified, as shown in SEQ ID NOs: 43, 174-44,402.

[00762] Regions of the ACADVL gene were scanned for target sites. Each area was scanned for a protospacer adjacent motif (PAM) having the sequence

NNNNGATT. gRNA 20 bp spacer sequences corresponding to the PAM were identified, as shown in SEQ ID NOs: 66,030-66,252.

Example 6 - CRISPR/Cpf1 target sites for the ACADM gene, the HADHA gene, and the ACADVL gene

[00763] Regions of the ACADM gene were scanned for target sites. Each area was scanned for a protospacer adjacent motif (PAM) having the sequence YTN. gRNA 22 bp spacer sequences corresponding to the PAM were identified, as shown in SEQ ID NOs: 13,962-29,800.

[00764] Regions of the HADHA gene were scanned for target sites. Each area was scanned for a protospacer adjacent motif (PAM) having the sequence YTN. gRNA 22 bp spacer sequences corresponding to the PAM were identified, as shown in SEQ ID NOs: 44,403-60,041 .

[00765] Regions of the ACADVL gene were scanned for target sites. Each area was scanned for a protospacer adjacent motif (PAM) having the sequence YTN. gRNA 22 bp spacer sequences corresponding to the PAM were identified, as shown in SEQ ID NOs: 66,253-69,825. Example 7 - Bioinformatics analysis of the guide strands

[00767] Candidate guides targeting the 1 p31 .1 region [genomic coordinates (GRCh38): 1 :75,724,346-75,763,67813: 100,089,014-100,530,436], the 2p23.3 region [genomic coordinates (GRCh38): 2:26, 190,634 - 26,244,725] and/or the 17p13.1 region [genomic coordinates (GRCh38): 17:7,217, 124 - 7,225,266] were screened and selected in a multi-step process that involves both theoretical binding and experimentally assessed activity at both on and off-target sites. By way of illustration, candidate guides having sequences that match a particular on-target site, such as a site within a gene selected from the group consisting of the ACADM gene, the HADHA gene, and the ACADVL gene, with adjacent PAM can be assessed for their potential to cleave at off-target sites having similar sequences, using one or more of a variety of bioinformatics tools available for assessing off- target binding, as described and illustrated in more detail below, in order to assess the likelihood of effects at chromosomal positions other than those intended.

Candidates predicted to have relatively lower potential for off-target activity can then be assessed experimentally to measure their on-target activity, and then off- target activities at various sites. Suitable guides have sufficiently high on-target activity to achieve desired levels of gene editing at the selected locus, and relatively lower off-target activity to reduce the likelihood of alterations at other chromosomal loci. The ratio of on-target to off-target activity is often referred to as the "specificity" of a guide.

[00768] For initial screening of predicted off-target activities, there are a number of bioinformatics tools known and publicly available that can be used to predict the most likely off-target sites; and since binding to target sites in the CRISPR/Cas9 or CRISPR/Cpf1 nuclease system is driven by Watson-Crick base pairing between complementary sequences, the degree of dissimilarity (and therefore reduced potential for off-target binding) is essentially related to primary sequence differences: mismatches and bulges, i.e. bases that are changed to a non- complementary base, and insertions or deletions of bases in the potential off-target site relative to the target site. An exemplary bioinformatics tool called COSMI D (CRISPR Off-target Sites with Mismatches, Insertions and Deletions) (available on the web at crispr.bme.gatech.edu) compiles such similarities. Other bioinformatics tools include, but are not limited to, autoCOSMID, and CCTop.

[00769] Bioinformatics analysis was used to minimize off-target cleavage in order to reduce the detrimental effects of mutations and chromosomal

rearrangements. Studies on CRISPR /Cas9 systems suggested the possibility of high off-target activity due to nonspecific hybridization of the guide strand to DNA sequences with base pair mismatches and/or bulges, particularly at positions distal from the PAM region. Therefore, it is important to have a bioinformatics tool that can identify potential off-target sites that have insertions and/or deletions between the RNA guide strand and genomic sequences, in addition to base-pair

mismatches. Bioinformatics-based tools based upon the off-target prediction algorithm CCTop were used to search genomes for potential CRISPR off-target sites (CCTop is available on the web at crispr.cos.uni-heidelberg.de). COSMID output ranked lists of the potential off-target sites based on the number and location of mismatches, allowing more informed choice of target sites, and avoiding the use of sites with more likely off-target cleavage.

[00770] Additional bioinformatics pipelines were employed that weigh the estimated on- and/or off-target activity of gRNA targeting sites in a region. Other features that may be used to predict activity include information about the cell type in question, DNA accessibility, chromatin state, transcription factor binding sites, transcription factor binding data, and other CHIP-seq data. Additional factors are weighed that predict editing efficiency, such as relative positions and directions of pairs of gRNAs, local sequence features and micro-homologies.

[00771] Transfection of tissue culture cells, allows screening of different constructs and a robust means of testing activity and specificity. Tissue culture cell lines, such as K562 or HEK293T are easily transfected and result in high activity. These cells will then be used for many early stage tests. For example, individual gRNAs for S. pyogenes Cas9 will be transfected into the cells using plasmids that are suitable for expression in human cells. Several days later, the genomic DNA is harvested and the target site amplified by PCR. The cutting activity can be measured by the rate of insertions, deletions and mutations introduced by NHEJ repair of the free DNA ends. Although this method cannot differentiate correctly repaired sequences from uncleaved DNA, the level of cutting can be gauged by the amount of mis-repair. Off-target activity can be observed by amplifying identified putative off-target sites and using similar methods to detect cleavage. Translocation can also be assayed using primers flanking cut sites, to determine if specific cutting and translocations happen. Un-guided assays have been developed allowing complementary testing of off-target cleavage including guide-seq. The gRNA or pairs of gRNA with significant activity can then be followed up in cultured cells to measure correction of the relevant mutation. Off-target events can be followed again. Similarly, cells can be transfected and the level of gene correction and possible off-target events measured. These experiments allow optimization of nuclease and donor design and delivery.

[00772] Initial evaluation and guide design for ACADVL gene editing, utilized the full ACADVL gene, together with 500bp upstream sequence. Initial bioinformatics analysis identified 1240 target sequences with an NGG PAM. A prioritized list of guides was designed from the 1240 bioinformatically identified target sequences. 192 guides were selected for IVT screening in HEK293 cells based on their Off- Target scores and location within ACADVL gene. Generally, guides were selected across all exons and select introns. However, guide selection focused around regions of the known mutations, c.848T>C is in Exon9 and c.104delC in Exon2.

[00773] Many mutations have been identified in the ACADVL gene, which lead to loss of ACADVL function, and cause VLCADD. The ACADVL mutation, c.848T>C (p. V243A) is a common mutation found in Exon 9 (Miller et al., Mol. Gen. and Met., 2015 and Goetzman, Eric S., et al. "Expression and

characterization of mutations in human very long-chain acyl-CoA dehydrogenase using a prokary otic system." Molecular genetics and metabolism 91 .2 (2007): 138- 147). Miller et al., found that the prevalence of c.848T>C was about 10% among US patients analyzed. While, Goetz et al. found 25/61 patients in his study had at least one copy with the c.848T>C mutation and 8/61 carried the c.104delC mutation. Example 8 - Testing of preferred guides in HEK293 cells for on-tarqet activity

[00775] To identify a large spectrum of pairs of gRNAs able to edit the cognate DNA target region, an in vitro transcribed (IVT) gRNA screen was conducted. The relevant genomic sequence was submitted for analysis using as described herein. The select gRNAs were in vitro transcribed, and transfected using Lipofectamine MessengerMAX into HEK293T cells that constitutively express Cas9. Cells were harvested 48 hours post transfection, the genomic DNA was isolated, and cutting efficiency was evaluated using TIDE analysis. (Figures 12-14).

[00776] gRNA with significant activity was followed up in cultured cells to measure gene editing in ACADVL. Off-target events can be followed again. A variety of cells can be transfected and the level of gene correction and possible off- target events measured. These experiments allow optimization of nuclease and donor design and delivery.

[00777] TABLE 4. gRNA sequences and cutting efficiencies in HEK293T cells

Figure imgf000184_0001
64290 ACADVL_T58 ACAGTGCACCGGGCGGCGGA CGG 93.8 0.9916

64066 ACADVL_T175 GCATACTGGGATGTGGCGAT AGG 93.7 0.9809

61536 ACADVL_T98 GTCTAACCGAGCCCTCAAGC GGG 93.6 0.9658

64090 ACADVL_T172 GCGGGATCGTTCACTTCCTG GGG 93.4 0.9521

61440 ACADVL_T209 TTG G CGTG G G CATTACCCTG GGG 93.2 0.9866

63467 ACADVL_T246 CCGTACTGCCTTAAGAGATG GGG 93.2 0.9683

63897 ACADVL_T116 G G CTG CATCTG ACCCG CTTG AGG 92.7 0.9665

61184 ACADVL_T187 TCCCCACAGCTCGCGGCTCA CGG 92.3 0.9451

64134 ACADVL_T90 TTATCCCTTCCCTTACCGGA CGG 92 0.9457

63958 ACADVL_T18 CACCAAACG G G CGTACTG G A GGG 91.9 0.9902

62028 ACADVL_T148 G G CCATCG ACCTCTATG CCA TGG 91.7 0.9558

64069 ACADVL_T59 G CG ATAG G G CG CCCTCACCT GGG 91.3 0.9786

61915 ACADVL_T335 CCTCTTCCCCCATAGGACAA AGG 91.3 0.9843

62067 ACADVL_T45 CTGTG ACACCTG GTGTATCG AGG 91.1 0.9843

62089 ACADVL_T97 GGCTGCAGCTCGGATCCGAG AGG 90.5 0.982

64280 ACADVL_T57 CG AATCTCTCCG GGCGCCGC TGG 89.7 0.9496

63466 ACADVL_T130 CCCGTACTGCCTTAAGAGAT GGG 89.7 0.9719

61156 ACADVL_T62 CTCGGATGGCCGCGAGCTTG GGG 89.6 0.9586

63465 ACADVL_T152 GCCCGTACTGCCTTAAGAGA TGG 89.5 0.9635

61727 ACADVL_T46 G CCACTAATCGTACCCAGTT TGG 88.7 0.9768

61193 ACADVL_T121 CCTGCCCGGCGGCCCTATGC CGG 88.6 0.9326

61810 ACADVL_T205 GGTGAGTGCTAACATGGACC AGG 88.4 0.9588

61434 ACADVL_T10 GCCCGTTTGGTGGAGATCGT GGG 88.2 0.9898

64166 ACADVL_T78 G G G CTACCTACCG CCTTG G C CGG 87.8 0.9647

64085 ACADVL_T219 CATCTCCAG AG CGTCATTCT TGG 87.8 0.9621

61666 ACADVL_T249 GG I G I I C I 1 I GA I GGAG I AC GGG 87.7 0.9353

61819 ACADVL_T288 GCCG CCATCAG CAAAATCTT TGG 87 0.9749

62029 ACADVL_T125 CATCG ACCTCTATG CCATG G TGG 87 0.9689

62070 ACADVL_T117 GGTGTATCGAGGTGAGACTC GGG 87 0.9328

62105 ACADVL_T315 TCCAAG G CCTTG GTG G AG CG GGG 87 0.9226

63751 ACADVL_T122 GTTACCTAG G G ACTCG G G CA GGG 86.6 0.9346

61282 ACADVL_T6 GTTCCCATACCCGTCCGGTA AGG 86.1 0.902

61446 ACADVL_T165 CATCAG AG CATCG GTTTCAA AGG 85.5 0.9875

63418 ACADVL_T56 CACCATG G CATAG AG GTCG A TGG 85.5 0.9087

61437 ACADVL_T194 G G CATG CATG ACCTTG G CGT GGG 85.1 0.9413

61430 ACADVL_T3 TCCCCTCCAGTACGCCCGTT TGG 84.7 0.993

64165 ACADVL_T48 CTCG G G G CTACCTACCG CCT TGG 84.5 0.897

64136 ACADVL_T5 CTTCCCTTACCG G ACG G GTA TGG 84.3 0.9331

61146 ACADVL_T157 CAGCGGCGCCCGGAGAGATT CGG 84 0.9352

61252 ACADVL_T140 ACCCCTCTGACGCTCTGACC AGG 83.6 0.9081

63959 ACADVL_T66 ACCAAACGGGCGTACTGGAG GGG 83.6 0.9827

63850 ACADVL_T321 ATG G G ATATTCAG G G CGTG G AGG 83.2 0.9

64257 ACADVL_T325 GCGCCGTGAGCCGCGAGCTG TGG 82.9 0.8805 63490 ACADVL_T135 GGACAAGTCCGCTGAGACTC AGG 82.7 0.917

64067 ACADVL_T183 CATACTG G G ATGTG G CG ATA GGG 82 0.9555

63853 ACADVL_T180 TATTCAGGGCGTGGAGGACG GGG 80.5 0.9827

64088 ACADVL_T82 TG G CG G G ATCGTTCACTTCC TGG 79.7 0.973

61194 ACADVL_T216 CTGCCCGGCGGCCCTATGCC GGG 78.2 0.9597

61435 ACADVL_T193 ATCGTG G G CATG CATG ACCT TGG 77.8 0.9047

61438 ACADVL_T145 CCTTG G CGTG G G CATTACCC TGG 77.3 0.978

61584 ACADVL_T526 CCCAGTGAGTGAATTTGGGT TGG 76.5 0.8677

64105 ACADVL_T196 ATTCCTTACCTCGAAGAAAC GGG 76 0.8245

61728 ACADVL_T92 CCACTAATCGTACCCAGTTT GGG 76 0.9206

64135 ACADVL_T74 TATCCCTTCCCTTACCGGAC GGG 74.9 0.8194

61667 ACADVL_T73 TGATGGAGTACGGGTGCCAT CGG 74.5 0.7784

64167 ACADVL_T75 CGC I I GGCCGG I 1 1 1 1 I CC TGG 74.3 0.9698

64068 ACADVL_T118 G G CG ATAG G G CG CCCTCACC TGG 74.2 0.7425

63484 ACADVL_T49 TCGCCACTCCGACTCAACTC CGG 73.2 0.8098

61285 ACADVL_T33 CATACCCGTCCGGTAAGGGA AGG 72.9 0.8007

61585 ACADVL_T494 CCAGTGAGTGAATTTGGGTT GGG 72 0.9399

61439 ACADVL_T176 CTTG G CGTG G G CATTACCCT GGG 70.8 0.9586

64137 ACADVL_T4 TTCCCTTACCG G ACG G GTAT GGG 70.7 0.9216

64238 ACADVL_T115 ACTTACCTGAGCGGCACCCC CGG 70.2 0.9254

61872 ACADVL_T308 G G GTAG G CACATCTCAG CAC GGG 69.9 0.6995

61155 ACADVL_T19 G CTCG G ATG G CCG CG AG CTT GGG 69.4 0.9196

64087 ACADVL_T185 TCCAG AG CGTCATTCTTG G C GGG 69.4 0.9642

63955 ACADVL_T2 TCTCCACCAAACG G G CGTAC TGG 68.3 0.814

61552 ACADVL_T492 CCCATTCTTCCACAGTAATG GGG 67.8 0.9861

61881 ACADVL_T164 TCCG AG ATCTTCG CATCTTC CGG 66.9 0.9922

61195 ACADVL_T16 TGCCCGGCGG CCCTATG CCG GGG 66.6 0.855

61258 ACADVL_T177 AAAAAACCGGCCAAGGCGGT AGG 64.9 0.9593

61817 ACADVL_T312 AG CCACG G ACTTCCAG ATAG AGG 64.4 0.9745

61824 ACADVL_T199 C I 1 I GGC I CGG I GAGG I CCC AGG 64.4 0.9743

61431 ACADVL_T26 CCTCCAGTACGCCCGTTTGG TGG 64.1 0.9836

63840 ACADVL_T377 AGACCGTGAAGATGTCTGCT AGG 63.8 0.9841

64243 ACADVL_T80 ACCCCCGGCATAGGGCCGCC GGG 63.7 0.9279

64240 ACADVL_T208 CTGAGCGGCACCCCCGGCAT AGG 62.2 0.8525

64242 ACADVL_T294 CACCCCCGGCATAGGGCCGC CGG 61.6 0.9054

63841 ACADVL_T210 CTG CTAG G CCCCCATTACTG TGG 61.6 0.977

63835 ACADVL_T293 CCTGTGGCTGGATCTGTAAC TGG 61.2 0.9867

61198 ACADVL_T50 CTATG CCGGGGGTGCCG CTC AGG 61.1 0.9037

63417 ACADVL_T292 G AACCACCACCATG G CATAG AGG 59.8 0.5982

63542 ACADVL_T124 TCCGGAAGATGCGAAGATCT CGG 58.8 0.8981

63681 ACADVL_T77 CCCAAACTG G GTACG ATTAG TGG 58.3 0.9585

64258 ACADVL_T83 CGCCGTGAGCCGCGAGCTGT GGG 57.3 0.9125

61196 ACADVL_T43 GCCCGGCGG CCCTATG CCG G GGG 56.1 0.9238 63486 ACADVL_T39 CACTCCG ACTCAACTCCG G G TGG 55.2 0.7763

61562 ACADVL_T564 CCAGTTACAG ATCCAG CCAC AGG 54.9 0.9789

61883 ACADVL_T159 I CGCA I C I I CCGGA I C I 1 I G AGG 54 0.6808

61154 ACADVL_T111 G G CTCG G ATG GCCGCGAGCT TGG 52.8 0.936

64289 ACADVL_T129 GTCCACAGTGCACCGGGCGG CGG 52.2 0.8209

61570 ACADVL_T709 GAAGA 1 CACAGC 1 1 1 I G I GG TGG 52.2 0.9754

61551 ACADVL_T656 TCCCATTCTTCCACAGTAAT GGG 52 0.9839

63545 ACADVL_T133 CG G AG CAC ACG CTCTACTCC AGG 51.9 0.992

61972 ACADVL_T280 TCTCAGCGGACTTGTCCACC CGG 51.8 0.9569

63895 ACADVL_T250 CACAG CAG AG GTTCG G ATG G AGG 51.7 0.8954

63852 ACADVL_T298 ATATTCAGGGCGTGGAGGAC GGG 51.7 0.98

61185 ACADVL_T160 CTCGCGGCTCACGGCGCTCC TGG 50.6 0.5957

61314 ACADVL_T190 TGTCCCGTTTCTTCG AG GTA AGG 50.2 0.9332

63828 ACADVL_T358 CCCAACCCAAATTCACTCAC TGG 48.6 0.9814

61578 ACADVL_T623 TGTGGTGGAGAGGGGCTTCG GGG 48.5 0.9744

63750 ACADVL_T126 GGTTACCTAGGGACTCGGGC AGG 46.7 0.9659

61535 ACADVL_T120 TGTCTAACCG AG CCCTCAAG CGG 44.9 0.467

61553 ACADVL_T588 CCATTCTTCCACAGTAATGG GGG 44.1 0.9856

63748 ACADVL_T184 TTTG G GTTACCTAG G G ACTC GGG 43 0.4519

64295 ACADVL_T109 GCGGACGGTTGCGGGCCCCG GGG 42.9 0.825

61187 ACADVL_T191 CG CG G CTCACG G CG CTCCTG GGG 41.8 0.4663

61131 ACADVL_T131 GGTTAGGGGCGCCAGGACGT GGG 40.8 0.9666

63580 ACADVL_T51 TG CTG ATG G CG G CCTCTATC TGG 39.5 0.9599

63548 ACADVL_T334 CTACTCCAG GTTCCTAG CAC AGG 39 0.9122

63558 ACADVL_T153 AGCCCATACCCCCCATGATT TGG 38.7 0.4384

63386 ACADVL_T302 1 1 1 I I A I GC I GGGCCG I G GGG 38.4 0.4749

63829 ACADVL_T424 CCAACCCAAATTCACTCACT GGG 37.7 0.7624

61692 ACADVL_T317 CATG AG AG G CATC ATTG CTA AGG 36.2 0.4311

63848 ACADVL_T192 AGAATGGGATATTCAGGGCG TGG 34.6 0.9895

62113 ACADVL_T119 CTTCTGAATACTCCCGGCCA GGG 33.1 0.965

63404 ACADVL_T283 AAAATAAATCTG G G CCG G CT GGG 31.9 0.82

61565 ACADVL_T357 TCCAGCCACAGGAGCCGTGA AGG 31.8 0.988

63836 ACADVL_T571 TG G ATCTGTAACTG GTGTCT TGG 30.5 0.9886

63763 ACADVL_T173 TCACCCAG CACGTTCTCCG A TGG 29.8 0.4359

61544 ACADVL_T344 CCCTCAATG G AAG CAAG CTT TGG 29.2 0.9793

63379 ACADVL_T40 GAGTCTCACCTCGATACACC AGG 27.5 0.2845

62030 ACADVL_T241 CG ACCTCTATG CC ATG GTG G TGG 27.3 0.3205

64247 ACADVL_T644 ATAGGGCCGCCGGGCAGGGC CGG 26.7 0.9403

61151 ACADVL_T174 ATTCG G AG ATG CAG G CG G CT CGG 25.8 0.9757

61851 ACADVL_T94 ATCCAAATCATG G G G G GTAT GGG 25.8 0.26

62001 ACADVL_T70 TCTTAAG G CAGTACG G G CTC TGG 25.6 0.9048

63384 ACADVL_T352 CA I 1 1 I I A I GC I GGGCCG TGG 25.3 0.825

63834 ACADVL_T341 TCCTTCACG G CTCCTGTG G C TGG 24.9 0.9885 61850 ACADVL_T236 CATCCAAATCATG G G G G GTA TGG 24.7 0.3014

61335 ACADVL_T88 TCCCG CCAAG AATG ACG CTC TGG 23.6 0.2583

62000 ACADVL_T167 CCCATCTCTTAAG G CAGTAC GGG 23.4 0.2868

61283 ACADVL_T7 TTCCCATACCCGTCCG GTAA GGG 23.3 0.9537

63899 ACADVL_T161 ATCTGACCCGCTTGAGGGCT CGG 21.9 0.9627

63485 ACADVL_T89 CG CCACTCCG ACTCAACTCC GGG 21.3 0.24

63429 ACADVL_T323 ATCTGTCCG GTAG GTG G G GT GGG 21.2 0.9822

63425 ACADVL_T106 CTGTTCATCTGTCCG GTAG G TGG 21.2 0.2229

62032 ACADVL_T214 CCATG GTG GTG GTTCTCTCG AGG 21.2 0.2117

61855 ACADVL_T265 TATG G G CTTCATG AAG GTAC AGG 20.2 0.2242

61977 ACADVL_T42 CACCCGGAGTTGAGTCGGAG TGG 19.7 0.9227

61887 ACADVL_T281 TGACATTCTTCGGCTGTTTG TGG 18.5 0.9907

64291 ACADVL_T169 CACCGGGCGGCGGACGGTTG CGG 18.4 0.9598

63833 ACADVL_T733 CTTCTCCTTCACG G CTCCTG TGG 18.3 0.9941

61433 ACADVL_T22 CGCCCGTTTGGTGGAGATCG TGG 17.4 0.9896

63359 ACADVL_T326 TCG G ATCCG AG CTG CAG CCT GGG 15.1 0.983

63424 ACADVL_T87 AAACTGTTCATCTGTCCG GT AGG 14.7 0.1574

63427 ACADVL_T132 GTTCATCTGTCCGGTAGGTG GGG 13 0.1473

61981 ACADVL_T276 CGGAGTGGCGAGCTGGTAAG TGG 11.8 0.1194

62112 ACADVL_T65 G CTTCTG AATACTCCCG G CC AGG 11.6 0.9891

64292 ACADVL_T47 ACCGGGCGGCGGACGGTTGC GGG 11.2 0.9946

63403 ACADVL_T201 G AAAATAAATCTG G G CCG G C TGG 11.1 0.9867

61884 ACADVL_T69 CGCA I C I I CCGGA I C I 1 I GA GGG 10.8 0.1113

61201 ACADVL_T309 CAG GTAAGTCACCG CAG CCT TGG 9.9 0.9631

63426 ACADVL_T100 TGTTCATCTGTCCGGTAGGT GGG 9.4 0.1017

64086 ACADVL_T144 CTCCAG AG CGTCATTCTTG G CGG 8.8 0.0937

63348 ACADVL_T320 CGGTAGAGCTCTTGCTGCCA GGG 8.8 0.0949

63385 ACADVL_T197 A I M I I A I G I GGGCCG I GGG 7.7 0.0818

61885 ACADVL_T227 GCA I I I CGGA I I 1 I GAG GGG 6.3 0.0665

62069 ACADVL_T178 TGGTGTATCGAGGTGAGACT CGG 5.6 0.0557

61941 ACADVL_T248 ACAG CTG AGGCGGTAGG CTT AGG 4.4 0.0477

61942 ACADVL_T76 CAG CTG AG G CG GTAG G CTTA GGG 3.9 0.0422

64246 ACADVL_T355 CGGCATAGGGCCGCCGGGCA GGG 3.3 0.9587

64293 ACADVL_T150 CGGCGGACGGTTGCGGGCCC CGG 3.2 0.9954

62090 ACADVL_T44 GCTGCAGCTCGGATCCGAGA GGG 3.1 0.0328

64245 ACADVL_T235 CCGGCATAGGGCCGCCGGGC AGG 2.8 0.9567

Note that the SEQ ID NOs represent the DNA sequence of the genomic target, while the gRNA spacer sequence will be the RNA version of the DNA sequence. Example 9 - Testing of preferred guides in Huh7 cells for on-tarqet activity

[00778] SpCas9 guides were designed against ACADM, HADHA or ACADVL genes. Specifically, guides were designed near the common mutation sites for the respective genes (e.g.: HADHA: G1528C, ACADVL: T848C and ACADM: A985G). A subset of guides were selected based on their off-target scores. This analysis resulted in 17 guides that target both wild-type and mutant genes (Table 5, JS_1 - JS_17).

[00779] 17 guides were selected for evaluation. The selected guides were purchased from Integrated DNA Technologies (Alt-R™ CRISPR-Cas9 crRNA).

Table 5. gRNA sequences

Figure imgf000189_0001

[00780] Note that the SEQ ID NOs represent the DNA sequence of the genomic target, while the gRNA spacer sequence will be the RNA version of the DNA sequence.

[00781] To determine the effects of CRISPR Cas9 gene editing on the ACADM, HADHA, and VLCAD genes, a human hepatoma cell line stably expressing SpCas9 nuclease (Huh7/cas9) was transfected gRNA, specifically Alt-R™ crRNA and Alt- R™ tracrRNA (catalog # 13778075;

AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCA CCGAGUCGGUGCUUU; SEQ ID NO: 69831 ) and custom designed Alt-R™ crRNA sequences comprised a 20nt spacer sequence of the invention followed by a universal crRNA sequence (5OUUUUAGAGCUAUGCU3'; SEQ ID NO: 69832), purchased from Integrated DNA Technologies. The spacer sequences disclosed herein were designed based on the target sequences in Table 5 above, where the spacer sequence for each crRNA corresponds to an RNA version of the target sequences listed in Table 5. 5'N2oGUUUUAGAGCUAUGCU3' (SEQ ID NO: 69833) represents the template format for the custom designed Alt-R™ crRNA sequences tested herein, where N20 represents the spacer sequence of Table 5.

[00782] 48h post transfection genomic DNA (gDNA) was isolated from

Huh7/cas9 cells that were transfected with gRNA by an enzyme-lysis procedure and cutting efficiency was evaluated using TIDE analysis.

[00783] Transfection of gRNA (JS_1 to JS_3) into Huh7/cas9 cells resulted in 38% to 68% HADHA Insertion deletions (InDels) Figure 7; Transfection of gRNA (JS_4 to JS_7) into Huh7/cas9 cells resulted in 58% to 82% ACADVL Insertion deletions (InDels) Figure 8; Transfection of gRNA (JS_8 to JS_10, JS_12 to JS_17) into Huh7/cas9 cells resulted in 22% to 92% AC A DM Insertion deletions (InDels) Figure 6.

[00784] This study demonstrates that gene editing with gRNAs targeting

HADHA, ACADVL and ACADM proximal to common mutations, with low predicted off-target scores, can be accomplished with high efficiency, indicating that gene correction can be accomplished by CRISPR/Cas9 gene editing.

Example 10 - Testing for on-target activity in Human Dermal Fibroblasts

(HDF) cells

[00785] A unique guide was designed to specifically target the common ACADM mutation (G985) which creates a mutant specific PAM site. Cutting efficiency was determined in Normal HDF and MCAD deficient HDF cells containing the biallelic common mutation G985. [00786] As described above, Alt-R™ crRNA and Alt-R™ tracrRNA were purchased from Integrated DNA Technologies. Normal HDF (catalog # GM03449) and MCAD deficient HDF cells (catalog # GM23496 or GM07844) were obtained from Coriell Institute.

Table 6. gRNA sequence targeting the G985 mutation.

Figure imgf000191_0001

[00787] MCAD deficient HDF cells were transfected with this gRNA, specifically Alt-R™ crRNA and Alt-R™ tracrRNA (catalog # 13778075;

AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCA CCGAGUCGGUGCUUU; SEQ ID NO: 69831 ) and custom designed Alt-R™ crRNA sequences comprised a 20nt spacer sequence of the invention followed by a universal crRNA sequence (5OUUUUAGAGCUAUGCU3'; SEQ ID NO: 69832), purchased from Integrated DNA Technologies. The spacer sequences disclosed herein were designed based on the target sequence in Table 6 above, where the spacer sequence corresponds to an RNA version of the target sequence listed in Table 6. 5'N2oGUUUUAGAGCUAUGCU3' (SEQ ID NO: 69833) represents the template format for the custom designed Alt-R™ crRNA sequences tested herein, where N20 represents the spacer sequence of Table 6.

[00788] Normal HDF and MCAD deficient HDF cells were co-transfected with guide RNA (gRNA) and spCas9 mRNA for 48 h. Post transfection genomic DNA was isolated from the cells by an enzyme-lysis procedure. Cutting efficiencies (% InDels) were evaluated using TIDE analysis.

[00789] gRNA (JS_19) and spCas9 mRNA were co-transfected into Normal HDF and MCAD deficient HDF shows mutant allele gene editing by JS_19. Specifically, JS_19 produced significantly higher InDels (52%) in MCAD deficient HDF cells containing a mutation at position 985 of the coding sequence compared to Normal HDF cells (4%) (Figure 9A).

[00790] In addition, an sgRNA (sg19, having the same spacer sequence as JS_19) was tested for cutting efficiency compared to JS_19, using the method described above. sg19 (SEQ ID NO: 69,835) was purchased from Axo

Laboratories. Co-transfection of sg19 and spCas9 mRNA into MCAD deficient HDF cells yielded 68% InDels near the 985 position of the MCAD coding region in these cells, demonstrating a better cutting efficiency compared to the split guide, JS_19 (Figure 9B).

sg19 (SEQ ID NO: 69,835)*:

5'usasusGCUGGCUGAAAUGGCAAGUUUUAGAgcuaGAAAuagcAAGUUAAAAUA AGGCUAGUCCGUUAUCaacuuGAAAaaguggcaccgagucggugcusususU3'

*a, c, g, u = 2'-0-methyl residues, S = phosphorothioate, A, C, G, U = RNA residues

Example 10 - Testing of preferred guides in cells for off-target activity

[00791] The gRNAs having the best on-target activity from the IVT screen in the above example are tested for off-target activity using Hybrid capture assays, GUIDE Seq and whole genome sequencing, in addition to other methods.

Example 11 - Testing different approaches for HDR gene editing

[00792] After testing the gRNAs for both on-target activity and off-target activity, the mutation correction and knock-in strategies will be tested for HDR gene editing.

[00793] To correct a specific mutation (e.g., A985G in region 1 1 , Figure 2 (the ACADM gene); G1528C (the HADHA gene); T848C or A848C (the ACADVL gene)) in the ACADM gene, the HADHA gene, and/or the ACADVL gene, either a double stranded break will be induced using Cas9 and an sgRNA or a pair of double stranded breaks around the mutation will be induced using two appropriate sgRNAs, and a donor DNA template will be provided to induce Homology-Directed Repair. For the mutation correction approach, the donor DNA template will be provided as a short single-stranded oligonucleotide, a short double-stranded oligonucleotide (PAM sequence intact/PAM sequence mutated), a long single- stranded DNA molecule (PAM sequence intact/PAM sequence mutated) or a long double-stranded DNA molecule (PAM sequence intact/PAM sequence mutated). In addition, the donor DNA template will be delivered by AAV. [00794] For the cDNA knock-in approach, a single-stranded or double-stranded DNA template will be used having homologous arms to the (a) ACADM gene

[chromosome 1 p31.1 genomic coordinates (GRCh38): 1 :75,724,346-75,763,678], (b) HADHA gene [chromosome 2p23.3 genomic coordinates (GRCh38):

2:26,190,634 - 26,244,725], (c) ACADVL gene [chromosome 17p13.1 genomic coordinates (GRCh38): 17:7,217,124 - 7,225,266], or (d) one of the following genes in "safe harbor" regions:

ApoC3 (chrl 1 : 1 16829908- 1 16833071 )

Angptl3 (chrl :62, 597,487-62,606,305)

Serpinal (chrl 4:94376747- 94390692)

Lp(a) (chro: 160531483-160664259)

Pcsk9 (chr1 :55,039,475- 55,064,852)

FIX (chrX: 139,530,736-139,563,458)

ALB (chr4:73,404,254- 73,421 ,41 1 )

TTR (chrl 8:31 ,591 ,766-31 ,599,023)

TF (chr3: 133,661 , 997- 133,779,005)

G6PC (chrl 7:42,900,796-42,914,432)

Gys2 (chr12:21 ,536,188- 21 ,604,857)

AAVS1 (PPP1 R12C) (chr19:55, 090,912-55,1 17,599)

HGD (chr3: 120,628, 167-120,682,570)

CCR5 (chr3:46,370,854-46,376,206)

ASGR2 (chr17:7,101 , 322-7, 1 14,310)

[00795] An exemplary DNA template comprises the 5'UTR correspondent to ACADM, HADHA, or ACADVL, or an alternative 5'UTR,the complete CDS of ACADM, HADHA, or ACADVL, and the 3'UTR of ACADM, HADHA, or ACADVL or modified 3'UTR and at least 80nt of the correspondent first intron. [00796] With respect knocking-in DNA into a gene in the "safe harbor" region, sgRNAs targeting the first exon and/or the first intron of the gene, for example, are used. As one example, MCAD cDNA, LCHAD cDNA, or VLCAD cDNA is knocked- in to the first exon of HGD, leading to disruption of HGD expression. HGD-/- hepatocytes have proliferation advantage when FAH activity is absent or reduced. Therefore, inhibition of FAH is additionally contemplated and can be achieved by treatment with shRNA (AAV) targeting FAH, or siRNA (LNP formulated, or conjugate with GalNAc, or with cholesterol) or treatment with CEHPOBA (Human protein Atlas, available on the web at proteinatlas.org/ENSG00000072778- ACADVL/tissue).

[00797] To correct a specific mutation (G1528C) in the HADHA gene, either a double stranded break will be induced using Cas9 and a sgRNA or a pair of double stranded breaks around the mutation will be induced using two appropriate sgRNAs, and a donor DNA template will be provided to induce Homology-Directed Repair. The donor DNA template will be provided as a short single-stranded oligonucleotide, a short double-stranded oligonucleotide (PAM sequence intact/PAM sequence mutated), a long single-stranded DNA molecule (PAM sequence intact/PAM sequence mutated) or a long double-stranded DNA molecule (PAM sequence intact/PAM sequence mutated). In addition, the donor DNA template will be delivered by AAV.

[00798] For the cDNA knock-in approach, a single-stranded or double-stranded DNA template will be used having homologous arms to the (a) HADHA gene

[chromosome 2p23.3 genomic coordinates (GRCh38): 2:26,190,634 - 26,244,725], or (b) one of the following "safe harbor" regions:

ApoC3 (chrl 1 : 1 16829908- 1 16833071 )

Angptl3 (chrl :62, 597,487-62,606,305)

Serpinal (chrl 4:94376747- 94390692)

Lp(a) (chro: 160531483-160664259)

Pcsk9 (chr1 :55,039,475- 55,064,852)

FIX (chrX: 139,530,736-139,563,458) ALB (chr4:73,404,254- 73,421 ,41 1 )

TTR (chi 8:31 ,591 ,766-31 ,599,023)

TF (chr3: 133,661 , 997- 133,779,005)

G6PC (chr17:42,900,796-42,914,432)

Gys2 (chr12:21 ,536,188- 21 ,604,857)

AAVS1 (PPP1 R12C) (chr19:55, 090,912-55,1 17,599)

HGD (chr3: 120,628, 167-120,682,570)

CCR5 (chr3:46,370,854-46,376,206)

ASGR2 (chr17:7,101 , 322-7, 1 14,310)

[00799] To correct a specific mutation (T848C or A848T) in the ACADVL gene, either a double stranded break will be induced using Cas9 and a sgRNA or a pair of double stranded breaks around the mutation will be induced using two appropriate sgRNAs, and a donor DNA template will be provided to induce Homology-Directed Repair. The donor DNA template will be provided as a short single-stranded oligonucleotide, a short double-stranded oligonucleotide (PAM sequence intact/PAM sequence mutated), a long single-stranded DNA molecule (PAM sequence intact/PAM sequence mutated) or a long double-stranded DNA molecule (PAM sequence intact/PAM sequence mutated). In addition, the donor DNA template will be delivered by AAV.

[00800] For the cDNA knock-in approach, a single-stranded or double-stranded DNA template will be used having homologous arms to the (a) ACADVL gene

[chromosome 17p13.1 genomic coordinates (GRCh38): 17:7,217, 124 - 7,225,266], or(b) one of the following genes in "safe harbor" regions:

ApoC3 (chrl 1 : 1 16829908- 1 16833071 )

Angptl3 (chrl :62, 597,487-62,606,305)

Serpinal (chrl 4:94376747- 94390692)

Lp(a) (chro: 160531483-160664259)

Pcsk9 (chr1 :55,039,475- 55,064,852) FIX (chrX: 139,530,736-139,563,458)

ALB (chr4:73,404,254- 73,421 ,41 1 )

TTR (chi 8:31 ,591 ,766-31 ,599,023)

TF (chr3: 133,661 , 997- 133,779,005)

G6PC (chr17:42,900,796-42,914,432)

Gys2 (chr12:21 ,536,188- 21 ,604,857)

AAVS1 (PPP1 R12C) (chr19:55, 090,912-55,1 17,599)

HGD (chr3: 120,628, 167-120,682,570)

CCR5 (chr3:46,370,854-46,376,206)

ASGR2 (chr17:7,101 , 322-7, 1 14,310)

[00801] An exemplary DNA template comprises the 5'UTR corresponding to ACADM, HADHA, or ACADVL or an alternative 5'UTR,the complete CDS of ACADM, HADHA, or ACADVL, and the 3'UTR of ACADM, HADHA, or ACADVL or modified 3'UTR and at least 80nt of the corresponding first intron.

Example 12 - Correction of ACADM by CRISPR Cas9 gene editing using single stranded oligo donors

[00802] The study tested the ability of CRISPR/Cas9 to correct the ACADM mutation G985 and restore protein levels using sgRNA and ssODN donor DNA by HDR mediated repair.

[00803] sgRNA (sg19) and Cas9 mRNA with or without Single-stranded oligodeoxynucleotides (ssODN) were co-transfected into Normal HDF and MCAD deficient HDF cells for 48 h. Homologous donor repair was evaluated by sequencing PCR products generated from genomic DNA isolated from transfected MCAD deficient HDF cells.

[00804] 26 ssODN donors were tested for their ability to correct the ACADM sequence in mutant HDF cells. The 26 donors were designed to be complementary to the non-PAM strand (HDR1-HDR13) or complementary to the PAM strand (HDR14-HDR26). The length of the donor sequence ranged from 50-150 bp. The ssODN overlapped with the DNA flanking the cut site in a symmetrical or asymmetrical fashion; the Length column in Table 6 indicates the number of ssODN base pairs aligning on either side of the cut site.

Table 6 List of ssODN used for G985 correction of ACADM

Figure imgf000197_0001
HDR10 69845 50-75 (ContainsPAM) TTC TTT TTA ATT CTA GCA CCA AGC

AAT ATC ATT TAT GCT GGC TGA AAT GGC AAT GAA AGT TGA ACT AGC TAG AAT GAG TTA CCA GAG AGC AGC TTG GGA GGT TGA TTC TGG TCG TCG AAA TAC CT

HDR1 1 69846 75-75 (ContainsPAM) TCT CAA TAA ATA TCC TTT AAT TTT

TTT CTT TTT AAT TCT AGC ACC AAG CAA TAT CAT TTA TGC TGG CTG AAA TGG CAA TGA AAG TTG AAC TAG CTA GAA TGA GTT ACC AGA GAG CAG CTT GGG AGG TTG ATT CTG GTC GTC GAA ATA CCT

HDR12 69847 25-100 (ContainsPAM) ATA TCA TTT ATG CTG GCT GAA ATG

GCA ATG AAA GTT GAA CTA GCT AGA ATG AGT TAC CAG AGA GCA GCT TGG GAG GTT GAT TCT GGT CGT CGA AAT ACC TAT TAT GCT TCT ATT GCA AAG GCA TT

HDR13 69848 50-100 (ContainsPAM) TTC TTT TTA ATT CTA GCA CCA AGC

AAT ATC ATT TAT GCT GGC TGA AAT GGC AAT GAA AGT TGA ACT AGC TAG AAT GAG TTA CCA GAG AGC AGC TTG GGA GGT TGA TTC TGG TCG TCG AAA TAC CTA TTA TGC TTC TAT TGC AAA GGC ATT

HDR14 69849 25-25 Complementary ATT CTA GCT AGT TCA ACT TTC ATT to PAM Strand GCC ATT TCA GCC AGC ATA AAT GAT

AT

HDR15 69850 50-25 Complementary ATT CTA GCT AGT TCA ACT TTC ATT to PAM Strand GCC ATT TCA GCC AGC ATA AAT GAT

ATT GCT TGG TGC TAG AAT TAA AAA GAA

HDR16 69851 75-25 Complementary ATT CTA GCT AGT TCA ACT TTC ATT to PAM Strand GCC ATT TCA GCC AGC ATA AAT GAT

ATT GCT TGG TGC TAG AAT TAA AAA GAA AAA AAT TAA AGG ATA TTT ATT GAG A

HDR17 69852 100-25 Complementary ATT CTA GCT AGT TCA ACT TTC ATT to PAM Strand GCC ATT TCA GCC AGC ATA AAT GAT

ATT GCT TGG TGC TAG AAT TAA AAA GAA AAA AAT TAA AGG ATA TTT ATT GAG AAA ACT TAA AAG TTT TTT CCT GGG GC

HDR18 69853 25-50 Complementary CTC CCA AGC TGC TCT CTG GTA ACT to PAM Strand CAT TCT AGC TAG TTC AAC TTT CAT

TGC CAT TTC AGC CAG CAT AAA TGA TAT

HDR19 69854 50-50 Complementary CTC CCA AGC TGC TCT CTG GTA ACT to PAM Strand CAT TCT AGC TAG TTC AAC TTT CAT

TGC CAT TTC AGC CAG CAT AAA TGA TAT TGC TTG GTG CTA GAA TTA AAA AGA A HDR20 69855 75-50 Complementary CTC CCA AGC TGC TCT CTG GTA ACT to PAM Strand CAT TCT AGC TAG TTC AAC TTT CAT

TGC CAT TTC AGC CAG CAT AAA TGA TAT TGC TTG GTG CTA GAA TTA AAA AGA AAA AAA TTA AAG GAT ATT TAT TGA GA

HDR21 69856 100-50 Complementary CTC CCA AGC TGC TCT CTG GTA ACT to PAM Strand CAT TCT AGC TAG TTC AAC TTT CAT

TGC CAT TTC AGC CAG CAT AAA TGA TAT TGC TTG GTG CTA GAA TTA AAA AGA AAA AAA TTA AAG GAT ATT TAT TGA GAA AAC TTA AAA GTT TTT TCC TGG GGC

HDR22 69857 25-75 Complementary AGG TAT TTC GAC GAC CAG AAT CAA to PAM Strand CCT CCC AAG CTG CTC TCT GGT AAC

TCA TTC TAG CTA GTT CAA CTT TCA TTG CCA TTT CAG CCA GCA TAA ATG ATA T

HDR23 69858 50-75 Complementary AGG TAT TTC GAC GAC CAG AAT CAA to PAM Strand CCT CCC AAG CTG CTC TCT GGT AAC

TCA TTC TAG CTA GTT CAA CTT TCA TTG CCA TTT CAG CCA GCA TAA ATG ATA TTG CTT GGT GCT AGA ATT AAA AAG AA

HDR24 69859 75-75 Complementary AGG TAT TTC GAC GAC CAG AAT CAA to PAM Strand CCT CCC AAG CTG CTC TCT GGT AAC

TCA TTC TAG CTA GTT CAA CTT TCA TTG CCA TTT CAG CCA GCA TAA ATG ATA TTG CTT GGT GCT AGA ATT AAA AAG AAA AAA ATT AAA GGA TAT TTA TTG AGA

HDR25 69860 25-100 Complementary AAT GCC TTT GCA ATA GAA GCA TAA to PAM Strand TAG GTA TTT CGA CGA CCA GAA TCA

ACC TCC CAA GCT GCT CTC TGG TAA CTC ATT CTA GCT AGT TCA ACT TTC ATT GCC ATT TCA GCC AGC ATA AAT GAT AT

HDR26 69861 50-100 Complementary AAT GCC TTT GCA ATA GAA GCA TAA to PAM Strand TAG GTA TTT CGA CGA CCA GAA TCA

ACC TCC CAA GCT GCT CTC TGG TAA CTC ATT CTA GCT AGT TCA ACT TTC ATT GCC ATT TCA GCC AGC ATA AAT GAT ATT GCT TGG TGC TAG AAT TAA AAA GAA

[00805] Co-transfection of gRNA (sg19), Cas9 mRNA, and

oligodeoxynucleotides HDR14, HDR21 , HDR22, or HDR26 into MCAD deficient HDF cells containing the biallelic common mutation A985G, resulted in 1 .6 ± 0.13%, 5.1 ± 0.095 %, 7.9 ± 0.97%, 4.9 ± 1 .5%, and 1 1 .9 ± 0.12% allelic correction to a normal ACADM sequence (A985), respectively, as compared to the control showing nominal gene editing (0.88 ± 0.21 %) (FIGURE 1 1 A). Similarly, co- transfection of sg19, Cas9 mRNA, and oligodeoxynucleotide HDR19 into MCAD deficient HDF cells, resulted in significant correction (18.71 ± 0.89%) (FIGURE 1 1 C). As shown in Figure 10, a non-PAM ssODN donor improved HDR frequencies and ssODN donors with >50bp on the PAM-proximal side of the break showed higher HDR efficiency.

[00806] MCAD protein levels were also measured in response to gene correction. Following detergent lysis, MCAD protein levels in normal HDF cells and MCAD deficient HDF cells containing the biallelic mutation G985 was measured by capillary electrophoresis immune-detection. In brief, MCAD protein was detected by MCAD primary antibody E-5 (Catalog # 365448, Santa Cruz Biotechnology) and the quantitation of MCAD protein was normalized by the internal control of β-actin (Monoclonal Anti-p-Actin antibody produced in mouse, catalog* A2228, sigma).

[00807] Cells containing the MCAD mutation A985G exhibit a decrease in protein levels. However, these studies demonstrate that protein levels can be restored by gene correction. Correction by gene editing in the presence of HDR 14, HDR19, HDR21 , HDR22, HDR26 increase MCAD protein levels as compared to controls. Co-transfection of gRNA (sg19), Cas9 mRNA, and HDR14, HDR21 , HDR22, and HDR26 into MCAD deficient HDF cells resulted in 2.7-fold, 4.3-fold, 3.8-fold and 10.0-fold increase in MCAD protein levels, respectively. Similarly, gene correction with HDR19 also increased MCAD protein levels 2.1 -fold in HDF cells compared to control (FIGURE 1 1 D).

[00808] Thus, selective ACADM CRISPR Cas9 gene-editing can be

accomplished by with gRNAs targeting a genomic sequence comprising 5' -TAT GCT GGC TGA AAT GGC AA-3' (SEQ ID NO: 69,834). ACADM gene-correction to a normal ACADM sequence (A985) and restoration of MCAD activity levels, can be accomplished by CRISPR/Cas9 and HDR using ssODNs homologous to ACADM exon 1 1 region.

Example 13 - Re-assessment of lead CRISPR-Cas9/DNA donor combinations

[00809] After testing the different strategies for HDR or NHEJ gene editing, the lead CRISPR-Cas9/DNA donor combinations will be re-assessed in primary human hepatocytes for efficiency of deletion, recombination, and off-target specificity. Cas9 mRNA or RNP will be formulated into lipid nanoparticles for delivery, sgRNAs will be formulated into nanoparticles or delivered as AAV, and donor DNA will be formulated into nanoparticles or delivered as AAV.

Example 14 - In vivo testing in relevant mouse model

[00810] After the Crispr-Cas9/DNA donor combinations have been re-assessed, the lead formulations will be tested in vivo in a FGR mouse model with the livers repopulated with human hepatocytes (normal, MCAD deficient, LCHAD deficient, or VLCAD deficient).

[00811] Note Regarding Illustrative Embodiments

[00812] While the present disclosure provides descriptions of various specific embodiments for the purpose of illustrating various aspects of the present invention and/or its potential applications, it is understood that variations and modifications will occur to those skilled in the art. Accordingly, the invention or inventions described herein should be understood to be at least as broad as they are claimed, and not as more narrowly defined by particular illustrative embodiments provided herein.

[00813] Any patent, publication, or other disclosure material identified herein is incorporated by reference into this specification in its entirety unless otherwise indicated, but only to the extent that the incorporated material does not conflict with existing descriptions, definitions, statements, or other disclosure material expressly set forth in this specification. As such, and to the extent necessary, the express disclosure as set forth in this specification supersedes any conflicting material incorporated by reference. Any material, or portion thereof, that is said to be incorporated by reference into this specification, but which conflicts with existing definitions, statements, or other disclosure material set forth herein, is only incorporated to the extent that no conflict arises between that incorporated material and the existing disclosure material. Applicants reserve the right to amend this specification to expressly recite any subject matter, or portion thereof, incorporated by reference herein.

Claims

Claims What is claimed is:
1 . A method for editing an ACADM gene in a cell by genome editing, comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near an ACADM gene or other DNA sequences that encode regulatory elements of an ACADM gene that results in a permanent deletion, insertion, or correction, of one or more nucleotides, mutations, or exons within or near the ACADM gene or other DNA sequences that encode regulatory elements of the ACADM gene, thereby restoring medium chain acyl coenzyme A dehydrogenase (MCAD) activity.
2. A method for editing an HADHA gene in a cell by genome editing, comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near an HADHA gene or other DNA sequences that encode regulatory elements of an HADHA gene that results in a permanent deletion, insertion, or correction, of one or more nucleotides, mutations, or exons within or near the HADHA gene or other DNA sequences that encode regulatory elements of the HADHA gene, thereby restoring Long-chain 3-hydroxyacyl-CoA dehydrogenase (LCHAD) activity.
3. A method for editing an ACADVL gene in a cell by genome editing, comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near an ACADVL gene or other DNA sequences that encode regulatory elements of an ACADVL gene that results in a permanent deletion, insertion, or correction, of one or more nucleotides, mutations, or exons within or near the ACADVL gene or other DNA sequences that encode regulatory elements of the ACADVL gene, thereby restoring very long chain acyl coenzyme A dehydrogenase (VLCAD) activity.
4. A method for inserting a gene in a cell by genome editing, comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the ACADM gene, or a safe harbor locus, that results in a permanent insertion of the ACADM gene or minigene, thereby restoring medium chain acyl coenzyme A dehydrogenase (MCAD) activity.
5. A method for inserting a gene in a cell by genome editing, comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the HADHA gene, or a safe harbor locus, that results in a permanent insertion of the HADHA gene or minigene, thereby restoring Long-chain 3- hydroxyacyl-CoA dehydrogenase (LCHAD) activity.
6. A method for inserting a gene in a cell by genome editing, comprising the step of introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near the ACADVL gene, or a safe harbor locus, that results in a
permanent insertion of the ACADVL gene or minigene, thereby restoring very long chain acyl coenzyme A dehydrogenase (VLCAD) activity.
7. An in vivo method for treating a patient with MCADD comprising the step of editing a cell of the patient within or near an ACADM gene or other DNA sequences that encode regulatory elements of an ACADM gene, or a safe harbor locus.
8. The method of claim 7, wherein the editing step comprises introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near an ACADM gene or other DNA sequences that encode regulatory elements of an ACADM gene that results in a permanent deletion, insertion, or correction, of one or more nucleotides, mutations, or exons within or near the ACADM gene, other DNA sequences that encode regulatory elements of the ACADM gene, thereby restoring medium chain acyl-coenzyme A dehydrogenase (MCAD) activity.
9. The method of claim 7, wherein the editing step comprises introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near a safe harbor locus that results in a permanent insertion of the ACADM gene, cDNA, or minigene, thereby restoring medium chain acyl-coenzyme A dehydrogenase (MCAD) activity.
10. An in vivo method for treating a patient with LCHADD comprising the step of editing a cell of the patient within or near an HADHA gene in a cell or other DNA sequences that encode regulatory elements of an HADHA gene in a cell, or a safe harbor locus in a cell.
1 1 . The method of claim 10, wherein the editing step comprises introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near an HADHA gene or other DNA sequences that encode regulatory elements of an HADHA gene that results in a permanent deletion, insertion, or correction, of one or more nucleotides, mutations, or exons within or near the HADHA gene, other DNA sequences that encode regulatory elements of the HADHA gene, thereby restoring Long-chain 3-hydroxyacyl-CoA dehydrogenase (LCHAD) activity.
12. The method of claim 10, wherein the editing step comprises introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near a safe harbor locus that results in a permanent insertion of the HADHA gene, cDNA, or minigene, thereby restoring Long-chain 3-hydroxyacyl-CoA dehydrogenase
(LCHAD) activity.
13. An in vivo method for treating a patient with VLCADD comprising the step of editing a cell of the patient within or near an ACADVL gene in a cell or other DNA sequences that encode regulatory elements of an ACADVL gene in a cell, or a safe harbor locus in a cell.
14. The method of claim 13, wherein the editing step comprises introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near an ACADVL gene or other DNA sequences that encode regulatory elements of an ACADVL gene that results in a permanent deletion, insertion, or correction, of one or more nucleotides, mutations, or exons within or near the ACADVL gene, other DNA sequences that encode regulatory elements of the ACADVL gene, thereby restoring very long chain acyl coenzyme A dehydrogenase (VLCAD).
15. The method of claim 13, wherein the editing step comprises introducing into the cell one or more deoxyribonucleic acid (DNA) endonucleases to effect one or more single-strand breaks (SSBs) or double-strand breaks (DSBs) within or near a safe harbor locus that results in a permanent insertion of the ACADVL gene, cDNA, or minigene, thereby restoring very long chain acyl coenzyme A dehydrogenase (VLCAD) activity.
16. The method of any one of claims 9, 12, or 15, wherein the safe harbor locus is selected from the group consisting of AAVS1 (PPP1 R12C), ALB, Angptl3, ApoC3, ASGR2, CCR5, FIX (F9), G6PC, Gys2, HGD, Lp(a), Pcsk9, Serpinal , TF, and TTR.
17. The method of any one of the preceding claims, wherein the method further comprises introducing into the cell one or more guide ribonucleic acids (gRNAs).
18. The method of claim 17, wherein the one or more gRNAs are single-molecule guide RNA (sgRNAs).
19. The method of claim 17 or 18, wherein the gRNA or sgRNA comprises a spacer sequence consisting of an RNA sequence corresponding to any of SEQ ID NOs: 1 - 29,800, SEQ ID NOs: 29,801 -60,041 , or SEQ ID NOs: 60.042-69,825.
20. The method of any one of claims 17-24, wherein the one or more gRNAs or one or more sgRNAs is one or more modified gRNAs or one or more modified sgRNAs.
21 . The method of claim 20, wherein the one or more modified gRNAs or one or more modified sgRNAs includes one or more modifications selected from the group consisting of a modified backbone, a sugar moiety, an internucleoside linkage, and modified or universal bases.
22. The method of any one of claims 17-21 , wherein the one or more DNA endonucleases is pre-complexed with one or more gRNAs or one or more sgRNAs.
23. The method of any one of the preceding claims, wherein the method further comprises introducing into the cell a polynucleotide donor template comprising: a) at least a portion of the wild-type ACADM gene, minigene or cDNA; b) at least a portion of the wild-type HADHA gene, minigene, or cDNA; or c) at least a portion of the wild-type ACADVL gene, minigene, cDNA.
24. The method of any one of claims 23, wherein the donor template has homologous arms to the 1 p31 .1 region.
25. The method of any one of claims 1 , 4 or 7-9, wherein the method further comprises introducing into the cell one guide ribonucleic acid (gRNA) and a polynucleotide donor template comprising at least a portion of a wild-type ACADM gene, and wherein the one or more DNA endonucleases is one or more Cas9 or Cpf1 endonucleases that effect one single-strand break (SSB) or double-strand break (DSB) at a locus within or near an ACADM gene, or other DNA sequences that encode regulatory elements of an ACADM gene that facilitates insertion of a new sequence from the polynucleotide donor template into the chromosomal DNA at the locus resulting in a permanent insertion or correction of a part of the ACADM gene or other DNA sequences that encode regulatory elements of the ACADM gene, thereby restoring MCAD activity, and wherein the gRNA comprises a spacer sequence that is complementary to a segment of the locus.
26. The method of any one of claims 1 , 4, or 7-9, wherein the method further comprises introducing into the cell one guide ribonucleic acid (gRNA) and a polynucleotide donor template comprising at least a portion of a wild-type ACADM gene, and wherein the one or more DNA endonucleases is one or more Cas9 or Cpf1 endonucleases that effect one single-strand break (SSB) or double-strand break (DSB) at a locus within or near a safe harbor locus that facilitates insertion of a new sequence from the polynucleotide donor template into the chromosomal DNA at the locus resulting in a permanent insertion or correction of the ACADM gene or other DNA sequences that encode regulatory elements of the ACADM gene, thereby restoring MCAD activity, and wherein the gRNA comprises a spacer sequence that is complementary to a segment of the locus.
27. The method of any one of claims 1 , 4 or 7-9, wherein the method further comprises introducing into the cell two guide ribonucleic acid (gRNAs) and a polynucleotide donor template comprising at least a portion of a wild-type ACADM gene, and wherein the one or more DNA endonucleases is one or more Cas9 or Cpfl endonucleases that effect a pair of single-strand breaks (SSBs) or double- strand breaks (DSBs), the first at a 5' locus and the second at a 3' locus, within or near an ACADM gene or other DNA sequences that encode regulatory elements of an ACADM gene that facilitates insertion of a new sequence from the
polynucleotide donor template into the chromosomal DNA between the 5' locus and the 3' locus resulting in a permanent insertion or correction of the chromosomal DNA between the 5' locus and the 3' locus within or near the ACADM gene or other DNA sequences that encode regulatory elements of the ACADM gene, thereby restoring MCAD activity.
28. The method of claim 27, wherein the two gRNAs are selected from a first guide RNA comprising a spacer sequence that is complementary to a segment of the 5' locus and a second guide RNA comprises a spacer sequence that is
complementary to a segment of the 3' locus.
29. The method of any one of claims 25, 27, or 28, wherein the spacer sequence has an RNA sequence corresponding to SEQ ID NO: 1 -29,800.
30. The method of any one of claims 1 , 4, or 7-9, wherein the method further comprises introducing into the cell two guide ribonucleic acid (gRNAs) and a polynucleotide donor template comprising at least a portion of a wild-type ACADM gene, and wherein the one or more DNA endonucleases is one or more Cas9 or Cpfl endonucleases that effect a pair of single-strand breaks (SSBs) or double- strand breaks (DSBs), the first at a 5' locus and the second at a 3' locus, within or near a safe harbor locus that facilitates insertion of a new sequence from the polynucleotide donor template into the chromosomal DNA between the 5' locus and the 3' locus resulting in a permanent insertion of all or part of the donor template within or near the safe harbor locus, thereby restoring MCAD activity.
31 . The method of any one of claims 25-30, wherein the one or two gRNAs are one or two single-molecule guide RNA (sgRNAs).
32. The method of any one of claims 25-31 , wherein the one or two gRNAs or one or two sgRNAs is one or two modified gRNAs or one or two modified sgRNAs.
33. The method of any one of claims 23 or 25-32, wherein the at least portion of the wild-type ACADM gene or minigene or cDNA is exon 1 , some or all of intron 1 , exon 2, some or all of intron 2, exon 3, some or all of intron 3, exon 4, some or all of intron 4, exon 5, some or all of intron 5, exon 6, some or all of intron 6, exon 7, some or all of intron 7, exon 8, some or all of intron 8, exon 9, some or all of intron 9, exon 10, some or all of intron 10, exon 1 1 , some or all of intron 1 1 , exon 12, fragments, or combinations thereof, or the entire ACADM gene, DNA sequences that encode wild-type regulatory elements of the ACADM gene.
34. The method of any one of claims 25-32, wherein the donor template is either a single or double stranded polynucleotide.
35. The method of claim 34, wherein the donor template comprises the sequence of SEQ ID NO: 69,836-69,861 .
36. The method of any one of claims 25-34, wherein the donor template has homologous arms to the 17p13.1 region.
37. The method of any one of claims 1 , 4, or 7-9, wherein the gRNA or sgRNA is directed to one or more mutations selected from the group consisting of 157C to T, 343-348 deletion, 347G to A, 351 A to C, 362C to T, 447G to A, 577A to G, 583G to A, 617G to T, 474T to G, 730T to C, 799G to A, 977T to C, 985A to G, 1008 T to A, 1045 C to T, 1055A to G, 1 124T to C, 1 152G to T, 955-956 deletion, 1 100-1 103 deletion, 999 inserted TAGAATGAGTTAC (SEQ ID NO: 69,826) and 1 190 inserted T.
38. The method of any one of claims 1 , 4 or 7-9, wherein the insertion or correction is by homology directed repair (HDR) or non-homologous end joining (NHEJ).
39. The method of any one of claims 1 , 4, or 7-9, wherein the method further comprises introducing into the cell two guide ribonucleic acid (gRNAs), and wherein the one or more DNA endonucleases is one or more Cas9 endonucleases that effect a pair of double-strand breaks (DSBs), the first at a 5' locus and the second at a 3' locus, within or near an ACADM gene or other DNA sequences that encode regulatory elements of an ACADM gene that results in a permanent deletion of the chromosomal DNA between the 5' locus and the 3' locus within or near the ACADM gene, thereby restoring MCAD activity.
40. The method of claim 39, wherein the two gRNAs are selected from a first guide RNA comprising a spacer sequence that is complementary to a segment of the 5' locus and a second guide RNA comprising a spacer sequence that is
complementary to a segment of the 3' locus.
41 . The method of claim 28 and 40, wherein the spacer sequence of first and second guide RNAs has an RNA sequence corresponding to any one of SEQ ID NOs: 1 -29,800.
42. The method of claim 40 or 41 , wherein the two gRNAs are two single-molecule guide RNA (sgRNAs).
43. The method of any one of claims 40, wherein the two gRNAs or two sgRNAs are two modified gRNAs or two modified sgRNAs.
44. The method of any one of claims 32-38 or 40-43, wherein the one or more DNA endonucleases is pre-complexed with one or two gRNAs or one or two sgRNAs.
45. The method of any one of claims 39-44, wherein the deletion is a deletion of 1 kb or less.
46. The method of any one of the preceding claims, wherein the endonuclease is encoded by an mRNA and wherein the endonuclease mRNA and gRNA are formulated into separate lipid nanoparticles or co-formulated into a lipid
nanoparticle.
47. The method of any one of claims 23-45, wherein the endonuclease is encoded by an mRNA and wherein, the endonuclease mRNA, gRNA, and donor template are each formulated into separate lipid nanoparticles or co-formulated into a lipid nanoparticle.
48. The method of any one of claims 23-45, wherein the DNA endonuclease is encoded by an mRNA and wherein, the endonuclease mRNA is formulated into a lipid nanoparticle, and both the gRNA and donor template are delivered by a viral vector.
49. The method of any one of claims 23-45, wherein the DNA endonuclease is encoded by an mRNA and wherein, the endonuclease mRNA, gRNA, and a donor template are each formulated in separate exosomes or co-formulated into an exosome.
50. The method of any one of the preceding claims, wherein the one or more DNA endonucleases is a Cas9 or Cpf1 endonuclease; or a homolog thereof,
recombination of the naturally occurring molecule, codon-optimized, or modified version thereof, or combinations thereof.
51 . The method of claim 50, wherein the method comprises introducing into the cell one or more polynucleotides encoding the one or more DNA endonucleases.
52. The method of claim 50, wherein the method comprises introducing into the cell one or more ribonucleic acids (RNAs) encoding the one or more DNA
endonucleases.
53. The method of any one of claims 51 or 52, wherein the one or more
polynucleotides or one or more RNAs is one or more modified polynucleotides or one or more modified RNAs.
54. The method of claim 50, wherein the DNA endonuclease is a protein or polypeptide.
55. The method of any of the preceding claims, wherein the DNA endonuclease is a Cas9 or Cpfl endonuclease comprising one or more nuclear localization signals (NLSs).
56. The method of claim 55, wherein at least one NLS is at or within 50 amino acids of the amino-terminus of the Cas9 or Cpf1 endonuclease and/or at least one NLS is at or within 50 amino acids of the carboxy-terminus of the Cas9 or Cpf1 endonuclease.
57. The method of claim 51 , 55 or 56, wherein the polynucleotide encoding a DNA endonuclease is codon optimized for expression in a eukaryotic cell.
58. The method of any one of the preceding claims, wherein the ACADM gene is located on Chromosome 1 : 75,724,346 - 75,763,678 (Genome Reference
Consortium - GRCh38/hg38).
59. The method of any one of the preceding claims, wherein the restoration of MCAD activity is compared to wild-type or normal MCAD activity.
60. The method of any one of claims 1 -6, wherein the cell is a human cell.
61 . The method of claim 60, wherein the human cell is a hepatocyte.
62. The method of any one of claims 7-15, wherein the cell is a hepatocyte.
63. One or more guide ribonucleic acids (gRNAs) comprising a spacer sequence selected from the group consisting of the nucleic acid sequences in SEQ ID NOs: 1 -29,800, SEQ ID Nos: 29,801 -60,041 ; and SEQ ID Nos: 60,042-69,825.
64. The one or more gRNAs of claim 63, wherein the one or more gRNAs are one or more single-molecule guide RNAs (sgRNAs).
65. The one or more gRNAs or sgRNAs of claim 63 or claim 64, wherein the one or more gRNAs or one or more sgRNAs is one or more modified gRNAs or one or more modified sgRNAs.
66. A single-molecule guide RNA comprising at least a spacer sequence that is an RNA sequence corresponding to any of SEQ ID NOs: 1 -29,800, SEQ ID Nos: 29,801 -60,041 ; SEQ ID Nos: 60,042-69,825.
67. The single-molecule guide polynucleotide of claim 66, wherein the single- molecule guide polynucleotide further comprises a spacer extension region.
68. The single-molecule guide polynucleotide of claim 67, wherein the single- molecule guide polynucleotide further comprises a tracrRNA extension region.
69. The single-molecule guide polynucleotide of claim 67-68, wherein the single- molecule guide polynucleotide is chemically modified.
70. A DNA encoding the single-molecule guide RNA of any one of claims 66-69.
PCT/IB2017/001089 2016-07-25 2017-07-25 Materials and methods for treatment of fatty acid disorders WO2018020323A2 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
US201662366450P true 2016-07-25 2016-07-25
US201662366459P true 2016-07-25 2016-07-25
US62/366,459 2016-07-25
US62/366,450 2016-07-25
US201662379036P true 2016-08-24 2016-08-24
US62/379,036 2016-08-24

Publications (2)

Publication Number Publication Date
WO2018020323A2 true WO2018020323A2 (en) 2018-02-01
WO2018020323A3 WO2018020323A3 (en) 2018-03-29

Family

ID=60143731

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2017/001089 WO2018020323A2 (en) 2016-07-25 2017-07-25 Materials and methods for treatment of fatty acid disorders

Country Status (1)

Country Link
WO (1) WO2018020323A2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018154387A1 (en) * 2017-02-22 2018-08-30 Crispr Therapeutics Ag Compositions and methods for gene editing

Citations (128)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3687808A (en) 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US4469863A (en) 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US4476301A (en) 1982-04-29 1984-10-09 Centre National De La Recherche Scientifique Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon
US4587044A (en) 1983-09-01 1986-05-06 The Johns Hopkins University Linkage of proteins to nucleic acids
US4605735A (en) 1983-02-14 1986-08-12 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
US4667025A (en) 1982-08-09 1987-05-19 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
US4762779A (en) 1985-06-13 1988-08-09 Amgen Inc. Compositions and methods for functionalizing nucleic acids
US4824941A (en) 1983-03-10 1989-04-25 Julian Gordon Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems
US4828979A (en) 1984-11-08 1989-05-09 Life Technologies, Inc. Nucleotide analogs for nucleic acid labeling and detection
US4835263A (en) 1983-01-27 1989-05-30 Centre National De La Recherche Scientifique Novel compounds containing an oligonucleotide sequence bonded to an intercalating agent, a process for their synthesis and their use
US4845205A (en) 1985-01-08 1989-07-04 Institut Pasteur 2,N6 -disubstituted and 2,N6 -trisubstituted adenosine-3'-phosphoramidites
US4876335A (en) 1986-06-30 1989-10-24 Wakunaga Seiyaku Kabushiki Kaisha Poly-labelled oligonucleotide derivative
US4904582A (en) 1987-06-11 1990-02-27 Synthetic Genetics Novel amphiphilic nucleic acid conjugates
US4948882A (en) 1983-02-22 1990-08-14 Syngene, Inc. Single-stranded labelled oligonucleotides, reactive monomers and methods of synthesis
US4958013A (en) 1989-06-06 1990-09-18 Northwestern University Cholesteryl modified oligonucleotides
US5023243A (en) 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5082830A (en) 1988-02-26 1992-01-21 Enzo Biochem, Inc. End labeled nucleotide probe
US5109124A (en) 1988-06-01 1992-04-28 Biogen, Inc. Nucleic acid probe linked to a label having a terminal cysteine
US5112963A (en) 1987-11-12 1992-05-12 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. Modified oligonucleotides
US5118802A (en) 1983-12-20 1992-06-02 California Institute Of Technology DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside
US5130302A (en) 1989-12-20 1992-07-14 Boron Bilogicals, Inc. Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same
US5134066A (en) 1989-08-29 1992-07-28 Monsanto Company Improved probes using nucleosides containing 3-dezauracil analogs
US5138045A (en) 1990-07-27 1992-08-11 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
US5166315A (en) 1989-12-20 1992-11-24 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5173414A (en) 1990-10-30 1992-12-22 Applied Immune Sciences, Inc. Production of recombinant adeno-associated virus vectors
US5175273A (en) 1988-07-01 1992-12-29 Genentech, Inc. Nucleic acid intercalating agents
US5177196A (en) 1990-08-16 1993-01-05 Microprobe Corporation Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US5188897A (en) 1987-10-22 1993-02-23 Temple University Of The Commonwealth System Of Higher Education Encapsulated 2',5'-phosphorothioate oligoadenylates
WO1993007883A1 (en) 1991-10-24 1993-04-29 Isis Pharmaceuticals, Inc. Derivatized oligonucleotides having improved uptake and other properties
US5214134A (en) 1990-09-12 1993-05-25 Sterling Winthrop Inc. Process of linking nucleosides with a siloxane bridge
US5214136A (en) 1990-02-20 1993-05-25 Gilead Sciences, Inc. Anthraquinone-derivatives oligonucleotides
US5216141A (en) 1988-06-06 1993-06-01 Benner Steven A Oligonucleotide analogs containing sulfur linkages
US5218105A (en) 1990-07-27 1993-06-08 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
US5235033A (en) 1985-03-15 1993-08-10 Anti-Gene Development Group Alpha-morpholino ribonucleoside derivatives and polymers thereof
US5245022A (en) 1990-08-03 1993-09-14 Sterling Drug, Inc. Exonuclease resistant terminally substituted oligonucleotides
US5254469A (en) 1989-09-12 1993-10-19 Eastman Kodak Company Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures
US5258506A (en) 1984-10-16 1993-11-02 Chiron Corporation Photolabile reagents for incorporation into oligonucleotide chains
US5262536A (en) 1988-09-15 1993-11-16 E. I. Du Pont De Nemours And Company Reagents for the preparation of 5'-tagged oligonucleotides
US5264562A (en) 1989-10-24 1993-11-23 Gilead Sciences, Inc. Oligonucleotide analogs with novel linkages
US5264564A (en) 1989-10-24 1993-11-23 Gilead Sciences Oligonucleotide analogs with novel linkages
US5264423A (en) 1987-03-25 1993-11-23 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5272250A (en) 1992-07-10 1993-12-21 Spielvogel Bernard F Boronated phosphoramidate compounds
US5276019A (en) 1987-03-25 1994-01-04 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5278302A (en) 1988-05-26 1994-01-11 University Patents, Inc. Polynucleotide phosphorodithioates
US5292873A (en) 1989-11-29 1994-03-08 The Research Foundation Of State University Of New York Nucleic acids labeled with naphthoquinone probe
US5317098A (en) 1986-03-17 1994-05-31 Hiroaki Shizuya Non-radioisotope tagging of fragments
US5321131A (en) 1990-03-08 1994-06-14 Hybridon, Inc. Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling
US5367066A (en) 1984-10-16 1994-11-22 Chiron Corporation Oligonucleotides with selectably cleavable and/or abasic sites
US5371241A (en) 1991-07-19 1994-12-06 Pharmacia P-L Biochemicals Inc. Fluorescein labelled phosphoramidites
US5391723A (en) 1989-05-31 1995-02-21 Neorx Corporation Oligonucleotide conjugates
US5399676A (en) 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
US5405939A (en) 1987-10-22 1995-04-11 Temple University Of The Commonwealth System Of Higher Education 2',5'-phosphorothioate oligoadenylates and their covalent conjugates with polylysine
US5405938A (en) 1989-12-20 1995-04-11 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5414077A (en) 1990-02-20 1995-05-09 Gilead Sciences Non-nucleoside linkers for convenient attachment of labels to oligonucleotides using standard synthetic methods
WO1995013365A1 (en) 1993-11-09 1995-05-18 Targeted Genetics Corporation Generation of high titers of recombinant aav vectors
WO1995013392A1 (en) 1993-11-09 1995-05-18 Medical College Of Ohio Stable cell lines capable of expressing the adeno-associated virus replication gene
US5432272A (en) 1990-10-09 1995-07-11 Benner; Steven A. Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases
US5434257A (en) 1992-06-01 1995-07-18 Gilead Sciences, Inc. Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages
US5451463A (en) 1989-08-28 1995-09-19 Clontech Laboratories, Inc. Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides
US5455233A (en) 1989-11-30 1995-10-03 University Of North Carolina Oligoribonucleoside and oligodeoxyribonucleoside boranophosphates
US5457187A (en) 1993-12-08 1995-10-10 Board Of Regents University Of Nebraska Oligonucleotides containing 5-fluorouracil
US5459255A (en) 1990-01-11 1995-10-17 Isis Pharmaceuticals, Inc. N-2 substituted purines
US5466677A (en) 1993-03-06 1995-11-14 Ciba-Geigy Corporation Dinucleoside phosphinates and their pharmaceutical compositions
US5470967A (en) 1990-04-10 1995-11-28 The Dupont Merck Pharmaceutical Company Oligonucleotide analogs with sulfamate linkages
US5476925A (en) 1993-02-01 1995-12-19 Northwestern University Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups
US5484908A (en) 1991-11-26 1996-01-16 Gilead Sciences, Inc. Oligonucleotides containing 5-propynyl pyrimidines
US5486603A (en) 1990-01-08 1996-01-23 Gilead Sciences, Inc. Oligonucleotide having enhanced binding affinity
US5489677A (en) 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
US5502177A (en) 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US5510475A (en) 1990-11-08 1996-04-23 Hybridon, Inc. Oligonucleotide multiple reporter precursors
US5512667A (en) 1990-08-28 1996-04-30 Reed; Michael W. Trifunctional intermediates for preparing 3'-tailed oligonucleotides
US5512439A (en) 1988-11-21 1996-04-30 Dynal As Oligonucleotide-linked magnetic particles and uses thereof
US5514785A (en) 1990-05-11 1996-05-07 Becton Dickinson And Company Solid supports for nucleic acid hybridization assays
US5519126A (en) 1988-03-25 1996-05-21 University Of Virginia Alumni Patents Foundation Oligonucleotide N-alkylphosphoramidates
US5525711A (en) 1994-05-18 1996-06-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Pteridine nucleotide analogs as fluorescent DNA probes
US5525465A (en) 1987-10-28 1996-06-11 Howard Florey Institute Of Experimental Physiology And Medicine Oligonucleotide-polyamide conjugates and methods of production and applications of the same
WO1996017947A1 (en) 1994-12-06 1996-06-13 Targeted Genetics Corporation Packaging cell lines for generation of high titers of recombinant aav vectors
US5539082A (en) 1993-04-26 1996-07-23 Nielsen; Peter E. Peptide nucleic acids
US5541307A (en) 1990-07-27 1996-07-30 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs and solid phase synthesis thereof
US5545730A (en) 1984-10-16 1996-08-13 Chiron Corporation Multifunctional nucleic acid monomer
US5550111A (en) 1984-07-11 1996-08-27 Temple University-Of The Commonwealth System Of Higher Education Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof
US5552540A (en) 1987-06-24 1996-09-03 Howard Florey Institute Of Experimental Physiology And Medicine Nucleoside derivatives
US5561225A (en) 1990-09-19 1996-10-01 Southern Research Institute Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages
US5565552A (en) 1992-01-21 1996-10-15 Pharmacyclics, Inc. Method of expanded porphyrin-oligonucleotide conjugate synthesis
US5571799A (en) 1991-08-12 1996-11-05 Basco, Ltd. (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response
US5574142A (en) 1992-12-15 1996-11-12 Microprobe Corporation Peptide linkers for improved oligonucleotide delivery
US5578718A (en) 1990-01-11 1996-11-26 Isis Pharmaceuticals, Inc. Thiol-derivatized nucleosides
US5580731A (en) 1994-08-25 1996-12-03 Chiron Corporation N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith
US5585481A (en) 1987-09-21 1996-12-17 Gen-Probe Incorporated Linking reagents for nucleotide probes
US5587371A (en) 1992-01-21 1996-12-24 Pharmacyclics, Inc. Texaphyrin-oligonucleotide conjugates
US5587361A (en) 1991-10-15 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5596086A (en) 1990-09-20 1997-01-21 Gilead Sciences, Inc. Modified internucleoside linkages having one nitrogen and two carbon atoms
US5595726A (en) 1992-01-21 1997-01-21 Pharmacyclics, Inc. Chromophore probe for detection of nucleic acid
US5596091A (en) 1994-03-18 1997-01-21 The Regents Of The University Of California Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
US5597696A (en) 1994-07-18 1997-01-28 Becton Dickinson And Company Covalent cyanine dye oligonucleotide conjugates
US5599923A (en) 1989-03-06 1997-02-04 Board Of Regents, University Of Tx Texaphyrin metal complexes having improved functionalization
US5602240A (en) 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
WO1997006243A1 (en) 1995-08-10 1997-02-20 Pasteur Merieux Serums Et Vaccins Method for purifying viruses by chromatography
US5608046A (en) 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
WO1997008298A1 (en) 1995-08-30 1997-03-06 Genzyme Corporation Chromatographic purification of adenovirus and aav
US5610289A (en) 1990-07-27 1997-03-11 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogues
WO1997009441A2 (en) 1995-09-08 1997-03-13 Genzyme Corporation Improved aav vectors for gene therapy
US5614617A (en) 1990-07-27 1997-03-25 Isis Pharmaceuticals, Inc. Nuclease resistant, pyrimidine modified oligonucleotides that detect and modulate gene expression
US5618704A (en) 1990-07-27 1997-04-08 Isis Pharmacueticals, Inc. Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling
US5623070A (en) 1990-07-27 1997-04-22 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5625050A (en) 1994-03-31 1997-04-29 Amgen Inc. Modified oligonucleotides and intermediates useful in nucleic acid therapeutics
US5633360A (en) 1992-04-14 1997-05-27 Gilead Sciences, Inc. Oligonucleotide analogs capable of passive cell membrane permeation
WO1997021825A1 (en) 1995-12-15 1997-06-19 Systemix, Inc. Method for obtaining retroviral packaging cell lines producing high transducing efficiency retroviral supernatant
US5663312A (en) 1993-03-31 1997-09-02 Sanofi Oligonucleotide dimers with amide linkages replacing phosphodiester linkages
US5677437A (en) 1990-07-27 1997-10-14 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5677439A (en) 1990-08-03 1997-10-14 Sanofi Oligonucleotide analogues containing phosphate diester linkage substitutes, compositions thereof, and precursor dinucleotide analogues
US5681941A (en) 1990-01-11 1997-10-28 Isis Pharmaceuticals, Inc. Substituted purines and oligonucleotide cross-linking
US5688941A (en) 1990-07-27 1997-11-18 Isis Pharmaceuticals, Inc. Methods of making conjugated 4' desmethyl nucleoside analog compounds
US5714331A (en) 1991-05-24 1998-02-03 Buchardt, Deceased; Ole Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility
US5719262A (en) 1993-11-22 1998-02-17 Buchardt, Deceased; Ole Peptide nucleic acids having amino acid side chains
US5750692A (en) 1990-01-11 1998-05-12 Isis Pharmaceuticals, Inc. Synthesis of 3-deazapurines
US5786211A (en) 1994-06-06 1998-07-28 Children's Hospital, Inc. Adeno-associated virus materials and methods
US5830653A (en) 1991-11-26 1998-11-03 Gilead Sciences, Inc. Methods of using oligomers containing modified pyrimidines
US5871982A (en) 1994-10-28 1999-02-16 The Trustees Of The University Of Pennsylvania Hybrid adenovirus-AAV virus and methods of use thereof
WO1999011764A2 (en) 1997-09-05 1999-03-11 Targeted Genetics Corporation Methods for generating high titer helper-free preparations of recombinant aav vectors
US6258595B1 (en) 1999-03-18 2001-07-10 The Trustees Of The University Of Pennsylvania Compositions and methods for helper-free production of recombinant adeno-associated viruses
US6287860B1 (en) 2000-01-20 2001-09-11 Isis Pharmaceuticals, Inc. Antisense inhibition of MEKK2 expression
WO2001083692A2 (en) 2000-04-28 2001-11-08 The Trustees Of The University Of Pennsylvania Recombinant aav vectors with aav5 capsids and aav5 vectors pseudotyped in heterologous capsids
US20030158403A1 (en) 2001-07-03 2003-08-21 Isis Pharmaceuticals, Inc. Nuclease resistant chimeric oligonucleotides
WO2013158616A1 (en) 2012-04-16 2013-10-24 University Of Pittsburgh - Of The Commonwealth System Of Higher Education Treatment of medium-chain acyl-coa dehydrogenase deficiency
WO2013176772A1 (en) 2012-05-25 2013-11-28 The Regents Of The University Of California Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105188767A (en) * 2012-07-25 2015-12-23 布罗德研究所有限公司 Inducible DNA binding proteins and genome perturbation tools and applications thereof
WO2015048577A2 (en) * 2013-09-27 2015-04-02 Editas Medicine, Inc. Crispr-related methods and compositions
KR20160105781A (en) * 2013-11-07 2016-09-07 에디타스 메디신, 인코포레이티드 CRISPR-RELATED METHODS AND COMPOSITIONS WITH GOVERNING gRNAS
EP3237642A4 (en) * 2014-12-24 2018-09-19 Massachusetts Institute of Technology Compositions and methods for manipulation of adipocyte energy consumption regulatory pathway
WO2016161380A1 (en) * 2015-04-01 2016-10-06 Editas Medicine, Inc. Crispr/cas-related methods and compositions for treating duchenne muscular dystrophy and becker muscular dystrophy

Patent Citations (146)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3687808A (en) 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US4469863A (en) 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US5023243A (en) 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
US4476301A (en) 1982-04-29 1984-10-09 Centre National De La Recherche Scientifique Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon
US4667025A (en) 1982-08-09 1987-05-19 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
US4789737A (en) 1982-08-09 1988-12-06 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives and production thereof
US4835263A (en) 1983-01-27 1989-05-30 Centre National De La Recherche Scientifique Novel compounds containing an oligonucleotide sequence bonded to an intercalating agent, a process for their synthesis and their use
US4605735A (en) 1983-02-14 1986-08-12 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
US5541313A (en) 1983-02-22 1996-07-30 Molecular Biosystems, Inc. Single-stranded labelled oligonucleotides of preselected sequence
US4948882A (en) 1983-02-22 1990-08-14 Syngene, Inc. Single-stranded labelled oligonucleotides, reactive monomers and methods of synthesis
US4824941A (en) 1983-03-10 1989-04-25 Julian Gordon Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems
US4587044A (en) 1983-09-01 1986-05-06 The Johns Hopkins University Linkage of proteins to nucleic acids
US5118802A (en) 1983-12-20 1992-06-02 California Institute Of Technology DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside
US5550111A (en) 1984-07-11 1996-08-27 Temple University-Of The Commonwealth System Of Higher Education Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof
US5545730A (en) 1984-10-16 1996-08-13 Chiron Corporation Multifunctional nucleic acid monomer
US5578717A (en) 1984-10-16 1996-11-26 Chiron Corporation Nucleotides for introducing selectably cleavable and/or abasic sites into oligonucleotides
US5552538A (en) 1984-10-16 1996-09-03 Chiron Corporation Oligonucleotides with cleavable sites
US5258506A (en) 1984-10-16 1993-11-02 Chiron Corporation Photolabile reagents for incorporation into oligonucleotide chains
US5367066A (en) 1984-10-16 1994-11-22 Chiron Corporation Oligonucleotides with selectably cleavable and/or abasic sites
US4828979A (en) 1984-11-08 1989-05-09 Life Technologies, Inc. Nucleotide analogs for nucleic acid labeling and detection
US4845205A (en) 1985-01-08 1989-07-04 Institut Pasteur 2,N6 -disubstituted and 2,N6 -trisubstituted adenosine-3'-phosphoramidites
US5235033A (en) 1985-03-15 1993-08-10 Anti-Gene Development Group Alpha-morpholino ribonucleoside derivatives and polymers thereof
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US4762779A (en) 1985-06-13 1988-08-09 Amgen Inc. Compositions and methods for functionalizing nucleic acids
US5317098A (en) 1986-03-17 1994-05-31 Hiroaki Shizuya Non-radioisotope tagging of fragments
US4876335A (en) 1986-06-30 1989-10-24 Wakunaga Seiyaku Kabushiki Kaisha Poly-labelled oligonucleotide derivative
US5286717A (en) 1987-03-25 1994-02-15 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5276019A (en) 1987-03-25 1994-01-04 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5264423A (en) 1987-03-25 1993-11-23 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US4904582A (en) 1987-06-11 1990-02-27 Synthetic Genetics Novel amphiphilic nucleic acid conjugates
US5552540A (en) 1987-06-24 1996-09-03 Howard Florey Institute Of Experimental Physiology And Medicine Nucleoside derivatives
US5585481A (en) 1987-09-21 1996-12-17 Gen-Probe Incorporated Linking reagents for nucleotide probes
US5188897A (en) 1987-10-22 1993-02-23 Temple University Of The Commonwealth System Of Higher Education Encapsulated 2',5'-phosphorothioate oligoadenylates
US5405939A (en) 1987-10-22 1995-04-11 Temple University Of The Commonwealth System Of Higher Education 2',5'-phosphorothioate oligoadenylates and their covalent conjugates with polylysine
US5525465A (en) 1987-10-28 1996-06-11 Howard Florey Institute Of Experimental Physiology And Medicine Oligonucleotide-polyamide conjugates and methods of production and applications of the same
US5112963A (en) 1987-11-12 1992-05-12 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. Modified oligonucleotides
US5082830A (en) 1988-02-26 1992-01-21 Enzo Biochem, Inc. End labeled nucleotide probe
US5519126A (en) 1988-03-25 1996-05-21 University Of Virginia Alumni Patents Foundation Oligonucleotide N-alkylphosphoramidates
US5278302A (en) 1988-05-26 1994-01-11 University Patents, Inc. Polynucleotide phosphorodithioates
US5453496A (en) 1988-05-26 1995-09-26 University Patents, Inc. Polynucleotide phosphorodithioate
US5109124A (en) 1988-06-01 1992-04-28 Biogen, Inc. Nucleic acid probe linked to a label having a terminal cysteine
US5216141A (en) 1988-06-06 1993-06-01 Benner Steven A Oligonucleotide analogs containing sulfur linkages
US5175273A (en) 1988-07-01 1992-12-29 Genentech, Inc. Nucleic acid intercalating agents
US5262536A (en) 1988-09-15 1993-11-16 E. I. Du Pont De Nemours And Company Reagents for the preparation of 5'-tagged oligonucleotides
US5512439A (en) 1988-11-21 1996-04-30 Dynal As Oligonucleotide-linked magnetic particles and uses thereof
US5599923A (en) 1989-03-06 1997-02-04 Board Of Regents, University Of Tx Texaphyrin metal complexes having improved functionalization
US5391723A (en) 1989-05-31 1995-02-21 Neorx Corporation Oligonucleotide conjugates
US5416203A (en) 1989-06-06 1995-05-16 Northwestern University Steroid modified oligonucleotides
US4958013A (en) 1989-06-06 1990-09-18 Northwestern University Cholesteryl modified oligonucleotides
US5451463A (en) 1989-08-28 1995-09-19 Clontech Laboratories, Inc. Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides
US5134066A (en) 1989-08-29 1992-07-28 Monsanto Company Improved probes using nucleosides containing 3-dezauracil analogs
US5254469A (en) 1989-09-12 1993-10-19 Eastman Kodak Company Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures
US5399676A (en) 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
US5264564A (en) 1989-10-24 1993-11-23 Gilead Sciences Oligonucleotide analogs with novel linkages
US5264562A (en) 1989-10-24 1993-11-23 Gilead Sciences, Inc. Oligonucleotide analogs with novel linkages
US5292873A (en) 1989-11-29 1994-03-08 The Research Foundation Of State University Of New York Nucleic acids labeled with naphthoquinone probe
US5455233A (en) 1989-11-30 1995-10-03 University Of North Carolina Oligoribonucleoside and oligodeoxyribonucleoside boranophosphates
US5130302A (en) 1989-12-20 1992-07-14 Boron Bilogicals, Inc. Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same
US5405938A (en) 1989-12-20 1995-04-11 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5166315A (en) 1989-12-20 1992-11-24 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5486603A (en) 1990-01-08 1996-01-23 Gilead Sciences, Inc. Oligonucleotide having enhanced binding affinity
US5459255A (en) 1990-01-11 1995-10-17 Isis Pharmaceuticals, Inc. N-2 substituted purines
US5587469A (en) 1990-01-11 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides containing N-2 substituted purines
US5750692A (en) 1990-01-11 1998-05-12 Isis Pharmaceuticals, Inc. Synthesis of 3-deazapurines
US5681941A (en) 1990-01-11 1997-10-28 Isis Pharmaceuticals, Inc. Substituted purines and oligonucleotide cross-linking
US5578718A (en) 1990-01-11 1996-11-26 Isis Pharmaceuticals, Inc. Thiol-derivatized nucleosides
US5414077A (en) 1990-02-20 1995-05-09 Gilead Sciences Non-nucleoside linkers for convenient attachment of labels to oligonucleotides using standard synthetic methods
US5214136A (en) 1990-02-20 1993-05-25 Gilead Sciences, Inc. Anthraquinone-derivatives oligonucleotides
US5536821A (en) 1990-03-08 1996-07-16 Worcester Foundation For Biomedical Research Aminoalkylphosphorothioamidate oligonucleotide deratives
US5321131A (en) 1990-03-08 1994-06-14 Hybridon, Inc. Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling
US5563253A (en) 1990-03-08 1996-10-08 Worcester Foundation For Biomedical Research Linear aminoalkylphosphoramidate oligonucleotide derivatives
US5541306A (en) 1990-03-08 1996-07-30 Worcester Foundation For Biomedical Research Aminoalkylphosphotriester oligonucleotide derivatives
US5470967A (en) 1990-04-10 1995-11-28 The Dupont Merck Pharmaceutical Company Oligonucleotide analogs with sulfamate linkages
US5514785A (en) 1990-05-11 1996-05-07 Becton Dickinson And Company Solid supports for nucleic acid hybridization assays
US5489677A (en) 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
US5602240A (en) 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
US5608046A (en) 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
US5610289A (en) 1990-07-27 1997-03-11 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogues
US5614617A (en) 1990-07-27 1997-03-25 Isis Pharmaceuticals, Inc. Nuclease resistant, pyrimidine modified oligonucleotides that detect and modulate gene expression
US5623070A (en) 1990-07-27 1997-04-22 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5677437A (en) 1990-07-27 1997-10-14 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5138045A (en) 1990-07-27 1992-08-11 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
US5688941A (en) 1990-07-27 1997-11-18 Isis Pharmaceuticals, Inc. Methods of making conjugated 4' desmethyl nucleoside analog compounds
US5541307A (en) 1990-07-27 1996-07-30 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs and solid phase synthesis thereof
US5218105A (en) 1990-07-27 1993-06-08 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
US5618704A (en) 1990-07-27 1997-04-08 Isis Pharmacueticals, Inc. Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling
US5245022A (en) 1990-08-03 1993-09-14 Sterling Drug, Inc. Exonuclease resistant terminally substituted oligonucleotides
US5677439A (en) 1990-08-03 1997-10-14 Sanofi Oligonucleotide analogues containing phosphate diester linkage substitutes, compositions thereof, and precursor dinucleotide analogues
US5567810A (en) 1990-08-03 1996-10-22 Sterling Drug, Inc. Nuclease resistant compounds
US5177196A (en) 1990-08-16 1993-01-05 Microprobe Corporation Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof
US5512667A (en) 1990-08-28 1996-04-30 Reed; Michael W. Trifunctional intermediates for preparing 3'-tailed oligonucleotides
US5214134A (en) 1990-09-12 1993-05-25 Sterling Winthrop Inc. Process of linking nucleosides with a siloxane bridge
US5561225A (en) 1990-09-19 1996-10-01 Southern Research Institute Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages
US5596086A (en) 1990-09-20 1997-01-21 Gilead Sciences, Inc. Modified internucleoside linkages having one nitrogen and two carbon atoms
US5432272A (en) 1990-10-09 1995-07-11 Benner; Steven A. Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases
US5173414A (en) 1990-10-30 1992-12-22 Applied Immune Sciences, Inc. Production of recombinant adeno-associated virus vectors
US5510475A (en) 1990-11-08 1996-04-23 Hybridon, Inc. Oligonucleotide multiple reporter precursors
US5714331A (en) 1991-05-24 1998-02-03 Buchardt, Deceased; Ole Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility
US5371241A (en) 1991-07-19 1994-12-06 Pharmacia P-L Biochemicals Inc. Fluorescein labelled phosphoramidites
US5571799A (en) 1991-08-12 1996-11-05 Basco, Ltd. (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response
US5587361A (en) 1991-10-15 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
WO1993007883A1 (en) 1991-10-24 1993-04-29 Isis Pharmaceuticals, Inc. Derivatized oligonucleotides having improved uptake and other properties
US5830653A (en) 1991-11-26 1998-11-03 Gilead Sciences, Inc. Methods of using oligomers containing modified pyrimidines
US5484908A (en) 1991-11-26 1996-01-16 Gilead Sciences, Inc. Oligonucleotides containing 5-propynyl pyrimidines
US5565552A (en) 1992-01-21 1996-10-15 Pharmacyclics, Inc. Method of expanded porphyrin-oligonucleotide conjugate synthesis
US5595726A (en) 1992-01-21 1997-01-21 Pharmacyclics, Inc. Chromophore probe for detection of nucleic acid
US5587371A (en) 1992-01-21 1996-12-24 Pharmacyclics, Inc. Texaphyrin-oligonucleotide conjugates
US5633360A (en) 1992-04-14 1997-05-27 Gilead Sciences, Inc. Oligonucleotide analogs capable of passive cell membrane permeation
US5434257A (en) 1992-06-01 1995-07-18 Gilead Sciences, Inc. Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages
US5272250A (en) 1992-07-10 1993-12-21 Spielvogel Bernard F Boronated phosphoramidate compounds
US5574142A (en) 1992-12-15 1996-11-12 Microprobe Corporation Peptide linkers for improved oligonucleotide delivery
US5476925A (en) 1993-02-01 1995-12-19 Northwestern University Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups
US5466677A (en) 1993-03-06 1995-11-14 Ciba-Geigy Corporation Dinucleoside phosphinates and their pharmaceutical compositions
US5663312A (en) 1993-03-31 1997-09-02 Sanofi Oligonucleotide dimers with amide linkages replacing phosphodiester linkages
US5539082A (en) 1993-04-26 1996-07-23 Nielsen; Peter E. Peptide nucleic acids
US5502177A (en) 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US5763588A (en) 1993-09-17 1998-06-09 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US6005096A (en) 1993-09-17 1999-12-21 Gilead Sciences, Inc. Pyrimidine derivatives
WO1995013365A1 (en) 1993-11-09 1995-05-18 Targeted Genetics Corporation Generation of high titers of recombinant aav vectors
WO1995013392A1 (en) 1993-11-09 1995-05-18 Medical College Of Ohio Stable cell lines capable of expressing the adeno-associated virus replication gene
US5658776A (en) 1993-11-09 1997-08-19 Targeted Genetics Corporation Generation of high titers of recombinant AAV vectors
US5719262A (en) 1993-11-22 1998-02-17 Buchardt, Deceased; Ole Peptide nucleic acids having amino acid side chains
US5457187A (en) 1993-12-08 1995-10-10 Board Of Regents University Of Nebraska Oligonucleotides containing 5-fluorouracil
US5599928A (en) 1994-02-15 1997-02-04 Pharmacyclics, Inc. Texaphyrin compounds having improved functionalization
US5596091A (en) 1994-03-18 1997-01-21 The Regents Of The University Of California Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
US5625050A (en) 1994-03-31 1997-04-29 Amgen Inc. Modified oligonucleotides and intermediates useful in nucleic acid therapeutics
US5525711A (en) 1994-05-18 1996-06-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Pteridine nucleotide analogs as fluorescent DNA probes
US5786211A (en) 1994-06-06 1998-07-28 Children's Hospital, Inc. Adeno-associated virus materials and methods
US5597696A (en) 1994-07-18 1997-01-28 Becton Dickinson And Company Covalent cyanine dye oligonucleotide conjugates
US5580731A (en) 1994-08-25 1996-12-03 Chiron Corporation N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith
US5591584A (en) 1994-08-25 1997-01-07 Chiron Corporation N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith
US5871982A (en) 1994-10-28 1999-02-16 The Trustees Of The University Of Pennsylvania Hybrid adenovirus-AAV virus and methods of use thereof
WO1996017947A1 (en) 1994-12-06 1996-06-13 Targeted Genetics Corporation Packaging cell lines for generation of high titers of recombinant aav vectors
WO1997006243A1 (en) 1995-08-10 1997-02-20 Pasteur Merieux Serums Et Vaccins Method for purifying viruses by chromatography
WO1997008298A1 (en) 1995-08-30 1997-03-06 Genzyme Corporation Chromatographic purification of adenovirus and aav
WO1997009441A2 (en) 1995-09-08 1997-03-13 Genzyme Corporation Improved aav vectors for gene therapy
WO1997021825A1 (en) 1995-12-15 1997-06-19 Systemix, Inc. Method for obtaining retroviral packaging cell lines producing high transducing efficiency retroviral supernatant
WO1999011764A2 (en) 1997-09-05 1999-03-11 Targeted Genetics Corporation Methods for generating high titer helper-free preparations of recombinant aav vectors
US6258595B1 (en) 1999-03-18 2001-07-10 The Trustees Of The University Of Pennsylvania Compositions and methods for helper-free production of recombinant adeno-associated viruses
US6287860B1 (en) 2000-01-20 2001-09-11 Isis Pharmaceuticals, Inc. Antisense inhibition of MEKK2 expression
WO2001083692A2 (en) 2000-04-28 2001-11-08 The Trustees Of The University Of Pennsylvania Recombinant aav vectors with aav5 capsids and aav5 vectors pseudotyped in heterologous capsids
US20030158403A1 (en) 2001-07-03 2003-08-21 Isis Pharmaceuticals, Inc. Nuclease resistant chimeric oligonucleotides
WO2013158616A1 (en) 2012-04-16 2013-10-24 University Of Pittsburgh - Of The Commonwealth System Of Higher Education Treatment of medium-chain acyl-coa dehydrogenase deficiency
US20140068797A1 (en) 2012-05-25 2014-03-06 University Of Vienna Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription
WO2013176772A1 (en) 2012-05-25 2013-11-28 The Regents Of The University Of California Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription

Non-Patent Citations (224)

* Cited by examiner, † Cited by third party
Title
"The Concise Encyclopedia of Polymer Science And Engineering", pages: 858 - 859
ANDRESEN BS ET AL.: "Medium-chain acyl-CoA dehydrogenase (MCAD) mutations identified by MS/MS-based prospective screening of newborns differ from those observed in patients with clinical symptoms: identification and characterization of a new, prevalent mutation that results in mild MCAD deficienc", THE AMERICAN JOURNAL OF HUMAN GENETICS, vol. 68, no. 6, 2001, pages 1408 - 1418, XP002525410, DOI: doi:10.1086/320602
ANDRESEN BS ET AL.: "The molecular basis of medium-chain acyl-CoA dehydrogenase (MCAD) deficiency in compound heterozygous patients: is there correlation between genotype and phenotype?", HUMAN MOLECULAR GENETICS, vol. 6, no. 5, 1997, pages 695 - 707, XP002182044, DOI: doi:10.1093/hmg/6.5.695
ANDRESEN, AMERICAN JOURNAL OF HUMAN GENETICS, 1999
ANDRESEN, BRAGE STORSTEIN ET AL.: "Clear correlation of genotype with disease phenotype in very-long-chain Acyl-CoA dehydrogenase deficiency", THE AMERICAN JOURNAL OF HUMAN GENETICS, vol. 64, no. 2, 1999, pages 479 - 494
ANDRESEN, THE AMERICAN JOURNAL OF HUMAN GENETICS, 1999
ANGART ET AL., PHARMACEUTICALS (BASEL, vol. 6, no. 4, 2013, pages 440 - 468
BANTA-WRIGHT, NEWBORN AND INFANT NURSING REVIEWS, 2008
BANTA-WRIGHT; SANDRA A.; KATHLEEN C. SHELTON; MICHAEL J. BENNETT: "Disorders of fatty acid oxidation in the era of tandem mass spectrometry in newborn screening", NEWBORN AND INFANT NURSING REVIEWS, vol. 8, no. 1, 2008, pages 18 - 29, XP022478767, DOI: doi:10.1053/j.nainr.2007.12.014
BARRETT ET AL., STEM CELLS TRANS MED, vol. 3, 2014, pages 1 - 6
BARTEL, D.P., CELL, vol. 136, 2009, pages 215 - 233
BARUTEAU, J. INHERIT. METAB. DIS., vol. 36, 2013, pages 795 - 803
BASTIN ET AL., BIOCHIMIE, vol. 96, 2014, pages 113 - 120
BEHLKE, OLIGONUCLEOTIDES, vol. 18, no. 4, 2008, pages 305 - 19
BELFORT; BONOCORA, METHODS MOL BIOL., vol. 1123, 2014, pages 1 - 26
BOCH, SCIENCE, vol. 326, no. 5959, 2009, pages 1509 - 12
BOER ME ET AL.: "Heterozygosity for the common LCHADD mutation (1528g>C) is not a major cause of HELLP syndrome and the prevalence of the mutation in the Dutch population is low", PEDIATR. RES., vol. 48, 2000, pages 151 - 154
BOISSEL ET AL., NAR, vol. 42, 2014, pages 2591 - 2601
BOISSEL; SCHARENBERG, METHODS MOL. BIOL., vol. 1239, 2015, pages 171 - 96
BONEH, A. ET AL.: "VLCAD deficiency: pitfalls in newborn screening and confirmation of diagnosis by mutation analysis", MOLECULAR GENETICS AND METABOLISM, vol. 88, no. 2, 2006, pages 166 - 170, XP024947066, DOI: doi:10.1016/j.ymgme.2005.12.012
BONEH, MOLECULAR GENETICS AND METABOLISM 2006
BONEH, MOLECULAR GENETICS AND METABOLISM, 2006
BONEH, MOLECULAR GENETICS AND METABOLISM, vol. 88, no. 2, 2006
BRAASCH; DAVID COREY, BIOCHEMISTRY, vol. 41, no. 14, 2002, pages 4503 - 4510
BREMSEN ET AL., FRONT GENET, vol. 3, 2012, pages 154
BUDNIATZKY; GEPSTEIN, STEM CELLS TRANSL MED., vol. 3, no. 4, 2014, pages 448 - 57
BURNETT ET AL., BIOTECHNOL J., vol. 6, no. 9, 2011, pages 1130 - 46
CANVER, M.C. ET AL., NATURE, 2015
CARTER, CURRENT OPINIONS IN BIOTECHNOLOGY, 1992, pages 1533 - 539
CATARZI, SERENA ET AL.: "Medium-chain acyl-CoA deficiency: outlines from newborn screening, in silico predictions, and molecular studies", THE SCIENTIFIC WORLD JOURNAL, 2013
CECCALDI ET AL., NATURE, vol. 528, 2015, pages 258 - 62
CEKAITE ET AL., J. MOL. BIOL., vol. 365, 2007, pages 90 - 108
CERMAK ET AL., NUCLEIC ACIDS RES., vol. 39, no. 12, 2011, pages e82
CERMAK T ET AL., METHODS MOL BIOL., vol. 1239, 2015, pages 133 - 59
CHEN, S. ET AL., GENES DEV, vol. 28, 2014, pages 1054 - 1067
CHERNOLOVSKAYA ET AL., CURR OPIN MOL THER., vol. 12, no. 2, 2010, pages 158 - 67
CHO; GREENBERG, NATURE, vol. 518, 2015, pages 174 - 76
CHOI JH ET AL.: "Identification of novel mutations of the HADHA and HADHB genes in patients with mitochondrial TFPD", INT. J. MOL. MED., vol. 19, 2007, pages 81 - 87
CLARK ET AL., GENE THERAPY, vol. 3, 1996, pages 1124 - 1132
COX ET AL., NATURE MEDICINE, vol. 21, no. 2, 2015, pages 121 - 31
CRISTEA ET AL., BIOTECHNOLOGY AND BIOENGINEERING, vol. 110, 2012, pages 871 - 880
CROOKE ET AL., J. PHARMACOL. EXP. THER., vol. 277, 1996, pages 923 - 937
CROOKE, S.T. AND LEBLEU, B.: "Antisense Research and Applications", 1993, CRC PRESS, article SANGHVI, Y. S.: "Chapter 15", pages: 289 - 302
CROOKE, S.T. AND LEBLEU, B.: "Antisense Research and Applications", 1993, CRC PRESS, article SANGHVI, Y.S., pages: 276 - 278
DE MESMAEKER, ACE. CHEM. RES., vol. 28, 1995, pages 366 - 374
DELEAVEY ET AL., CURR PROTOC NUCLEIC ACID CHEM CHAPTER, vol. 16, 2009
DELTCHEVA ET AL., NATURE, vol. 471, 2011, pages 602 - 607
DERKS ET AL., J. PEDIATR., vol. 148, 2006, pages 665 - 670
DREIER B ET AL., J MOL BIOL., vol. 303, no. 4, 2000, pages 489 - 502
DREIER, J BIOL CHEM, vol. 280, no. 42, 2005, pages 35588 - 97
DREIER, J BIOL CHEM., vol. 276, no. 31, 2001, pages 29466 - 78
DUAN ET AL., STEM CELLS, vol. 28, 2010, pages 674 - 686
ENGLISCH ET AL.: "Angewandle Chemie, International", vol. 30, 1990, JOHN WILEY & SONS, pages: 613
FAHNEHJELM KT ET AL.: "Ocular characteristics in 10 children with long-chain 3-hydroxyacyl-CoA dehydrogenase deficiency: a cross-sectional study with long-term follow-up", ACTA OPHTHALMOL., vol. 86, 2008, pages 329 - 337
FLETCHER AL ET AL.: "Observations regarding retinopathy in mitochondrial trifunctional protein deficiencies", MOL GENET METAB, vol. 106, no. 1, 2012, pages 18 - 24, XP028416681, DOI: doi:10.1016/j.ymgme.2012.02.015
FLETCHER ET AL., MOL GENET METAB., 2012
FOCOSI ET AL., BLOOD CANCER JOURNAL, vol. 4, 2014, pages e211
FONFARA ET AL., NUCLEIC ACIDS RESEARCH, vol. 42, 2014, pages 2577 - 2590
FUCINI ET AL., NUCLEIC ACID THER, vol. 22, no. 3, 2012, pages 205 - 210
FUKUSHIMA K ET AL.: "Lack of common mutation in the alfa-subunit of the mitochondrial trifunctional protein and the polymorphism of CYP2E1 in three Japanese women with acute fatty liver of pregnancy/HELLP syndrome", HEPATOL. RES., vol. 30, 2004, pages 226 - 231, XP004672434, DOI: doi:10.1016/j.hepres.2004.09.005
GAGLIONE; MESSERE, MINI REV MED CHEM, vol. 10, no. 7, 2010, pages 578 - 95
GARTNER ET AL., NEUROL., vol. 85, 2015, pages 37 - 40
GEBEYEHU ET AL., NUCL. ACIDS RES., vol. 15, 1997, pages 4513
GENESIS, vol. 30, no. 3, 2001
GILLINGHAM ET AL., MOL. GENET. METAB., 2005
GILLINGHAM M ET AL., TOP. CLIN. NUTR., 2009
GILLINGHAM M ET AL.: "Effect of feeding, exercise, and genotype on plasma 2 hydroxyacylcarnitines in children with LCHAD deficiency (LCHADD", TOP. CLIN. NUTR., vol. 24, 2009, pages 353 - 359
GILLINGHAM MB ET AL., MOL. GENET. METAB., 2003
GILLINGHAM MB ET AL.: "Effect of optimal dietary therapy upon visual function in children with longchain 3-hydroxyacyl CoA dehydrogenase and trifunctional protein deficiency", MOL. GENET. METAB, vol. 86, 2005, pages 124 - 133
GILLINGHAM MB ET AL.: "Optimal dietary therapy of long-chain 3-hydroxyacyl-CoA dehydrogenase deficiency", MOL. GENET. METAB., vol. 79, 2003, pages 114 - 123
GOBIN-LIMBALLE, BIOCHIMICA ET BIOPHYSICA ACTA (BBA)-MOLECULAR BASIS OF DISEASE, 2010
GOBIN-LIMBALLE, S. ET AL.: "Genetic Basis for Correction of Very-Long-Chain Acyl-Coenzyme A Dehydrogenase Deficiency by Bezafibrate in Patient Fibroblasts: Toward a Genotype-Based Therapy", THE AMERICAN JOURNAL OF HUMAN GENETICS, vol. 81, no. 6, 2007, pages 1133 - 1143
GOBIN-LIMBALLE, STEPHANIE ET AL.: "Compared effects of missense mutations in Very-Long-Chain Acyl-CoA Dehydrogenase deficiency: Combined analysis by structural, functional and pharmacological approaches", BIOCHIMICA ET BIOPHYSICA ACTA (BBA)- MOLECULAR BASIS OF DISEASE, vol. 1802, no. 5, 2010, pages 478 - 484, XP026960956
GOBIN-LIMBALLE, THE AMERICAN JOURNAL OF HUMAN GENETICS, 2007
GOEDDEL: "Gene Expression Technology: Methods in Enzymology", vol. 185, 1990, ACADEMIC PRESS
GOETZMAN, ERIC S. ET AL.: "Expression and characterization of mutations in human very long-chain acyl-CoA dehydrogenase using a prokaryotic system", MOLECULAR GENETICS AND METABOLISM, vol. 91, no. 2, 2007, pages 138 - 147, XP022084057, DOI: doi:10.1016/j.ymgme.2007.01.013
GOETZMAN, MOLECULAR GENETICS AND METABOLISM, 2007
GREGERSEN N ET AL.: "Genetic defects in fatty acid β-oxidation and acyl-CoA dehydrogenases", EUROPEAN JOURNAL OF BIOCHEMISTRY, vol. 271, no. 3, 2004, pages 470 - 482
GREGERSEN N ET AL.: "Medium-chain acyl-CoA dehydrogenase (MCAD) deficiency: the prevalent mutation G985 (K304E) is subject to a strong founder effect from northwestern Europe", HUMAN HEREDITY, vol. 43, no. 6, 1993, pages 342 - 350
GREGERSEN, EUROPEAN JOURNAL OF BIOCHEMISTRY, 2004
GREGERSEN, NIELS; PETER BROSS; BRAGE S. ANDRESEN: "Genetic defects in fatty acid beta-oxidation and acyl-CoA dehydrogenases", EUROPEAN JOURNAL OF BIOCHEMISTRY, vol. 271, no. 3, 2004, pages 470 - 482
GROSSE SD ET AL.: "The epidemiology of medium chain acyl-CoA dehydrogenase deficiency: an update", GENETICS IN MEDICINE, vol. 8, no. 4, 2006, pages 205 - 212
GUILINGER ET AL., NATURE BIOTECH., vol. 32, 2014, pages 577 - 82
HAFEZ; HAUSNER, GENOME, vol. 55, no. 8, 2012, pages 553 - 69
HALLDIN MU ET AL.: "Increased lipolysis in LCHAD deficiency", J. INHERIT. METAB. DIS., vol. 30, 2007, pages 39 - 46
HEASMAN, DEV. BIOL., vol. 243, 2002, pages 209 - 214
HERMONAT ET AL., PROC. NATL. ACAD. SCI. USA, vol. 81, 1984, pages 6466
HERRANZ, H.; COHEN, S.M., GENES DEV, vol. 24, 2010, pages 1339 - 1344
HERRERA ET AL., STEM CELLS, vol. 24, 2006, pages 2840 - 2850
HOFFMAN JD ET AL.: "Rhabdomyolysis in the military: recognizing late-onset very long-chain acyl CoA dehydrogenase deficiency", MIL MED., vol. 171, 2006, pages 657 - 8
HU ET AL., PROTEIN PEPT LETT., vol. 21, no. 10, 2014, pages 1025 - 30
HUANGFU ET AL., NATURE BIOTECHNOLOGY, vol. 26, no. 7, 2008, pages 795 - 797
IJLST L ET AL.: "Common missense mutation G1528C in long-chain 3-hydroxyacyl-CoA dehydrogenase deficiency. Characterization and expression of the mutant protein, mutation analysis on genomic DNA and chromosomal localization of the mitochondrial trifunctional protein alpha subunit gene", J. CLIN. INVEST., vol. 98, 1996, pages 1028 - 1033
IJLST L ET AL.: "Molecular basis of long-chain 3-hydroxyacyl-CoA dehydrogenase deficiency (LCHADD): identification of the major disease-causing mutation in the alpha-subunit of the mitochondrial trifunctional protein", BIOCHIM. BIOPHYS. ACTA, vol. 1215, 1994, pages 347 - 350
IJLST L; RUITER JP; HOOVERS JM; JAKOBS ME; WANDERS RJ: "Common missense mutation G1528C in long-chain 3-hydroxyacyl-CoA dehydrogenase deficiency. Characterization and expression of the mutant protein, mutation analysis on genomic DNA and chromosomal localization of the mitochondrial trifunctional protein alpha subunit gene", J. CLIN. INVEST., vol. 98, 1996, pages 1028 - 1033
IJLST L; WANDERS RJ; USHIKUBO S; KAMIJO T; HASHIMOTO T: "Molecular basis of long-chain 3-hydroxyacyl-CoA dehydrogenase deficiency: identification of the major disease-causing mutation in the alpha-subunit of the mitochondrial trifunctional protein (TFP", BIOCHIM. BIOPHYS. ACTA, vol. 1215, 1994, pages 347 - 350, XP023366780, DOI: doi:10.1016/0005-2760(94)90064-7
J INHERIT METAB DIS., vol. 33, 2010, pages 527 - 532
JINEK ET AL., SCIENCE, vol. 337, 2012, pages 816 - 821
JINEK, SCIENCE, vol. 337, no. 6096, 2012, pages 816 - 821
JUDGE ET AL., MOL. THER., vol. 13, 2006, pages 494 - 505
JUDGE; MACLACHLAN, HUM GENE THER, vol. 19, no. 2, 2008, pages 111 - 24
KABANOV ET AL., FEBS LETT., vol. 259, 1990, pages 327 - 330
KANASTY ET AL., MOLECULAR THERAPY, vol. 20, no. 3, 2012, pages 513 - 524
KARIKO, K. ET AL., IMMUNITY, vol. 23, 2005, pages 165 - 175
KENT ET AL., NATURE STRUCTURAL AND MOLECULAR BIOLOGY, ADV., 2015
KLEINSTIVER ET AL., G3, vol. 4, 2014, pages 1155 - 65
KOLE, NATURE REVIEWS DRUG DISCOVERY, vol. 11, 2012, pages 125 - 140
KORMANN, NATURE BIOTECHNOLOGY, vol. 29, 2011, pages 154 - 157
KORNBERG, A.: "DNA Replication", 1980, W. H. FREEMAN & CO., pages: 75 - 77
LACERRA ET AL., PROC. NATL. ACAD. SCI., vol. 97, 2000, pages 9591 - 9596
LAFOLLA ET AL., J. PEDIATR., vol. 125, 1994, pages 409 - 415
LAUGHLIN ET AL., GENE, vol. 23, 1983, pages 65 - 73
LEAL, J. ET AL.: "Regional differences in the frequency of the c. 985A> G ACADM mutation: findings from a meta-regression of genotyping and screening studies", CLINICAL GENETICS, vol. 85, no. 3, 2014, pages 253 - 259
LEBKOWSKI ET AL., MOL. CELL. BIOL., vol. 7, 1988, pages 349
LESLIE GENEREVIEWS@; BANTA-WRIGHT, NEWBORN AND INFANT NURSING REVIEWS, 2008
LESLIE ND, MOLECULAR GENETICS AND METABOLISM, 2013
LESLIE ND; VALENCIA CA; STRAUSS AW ET AL., VERY LONG-CHAIN ACYL-COENZYME A DEHYDROGENASE DEFICIENCY, 28 May 2009 (2009-05-28)
LETSINGER, PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 6553 - 6556
LI ET AL., NUCLEIC ACIDS RES., vol. 39, no. 14, 2011, pages 6315 - 25
LIU Q ET AL., J BIOL CHEM., vol. 277, no. 6, 2002, pages 3850 - 6
MA ET AL., STEM CELLS TRANSLATIONAL MEDICINE, vol. 2, 2013, pages 409 - 419
MA, H. ET AL., MOLECULAR THERAPY - NUCLEIC ACIDS, vol. 3, 2014, pages e161
MAHERALI; HOCHEDLINGER, CELL STEM CELL., vol. 3, no. 6, 2008, pages 595 - 605
MAIER EM ET AL.: "Population spectrum of ACADM genotypes correlated to biochemical phenotypes in newborn screening for medium-chain acyl-CoA dehydrogenase deficiency", HUMAN MUTATION, vol. 25, no. 5, 2005, pages 443 - 452
MAIER EM ET AL.: "rotein misfolding is the molecular mechanism underlying MCADD identified in newborn screening", HUMAN MOLECULAR GENETICS, vol. 18, no. 9, 2009, pages 1612 - 1623
MAK ET AL., SCIENCE, vol. 335, no. 6069, 2012, pages 716 - 9
MANCHARAN ET AL., NUCLEOSIDES & NUCLEOTIDES, vol. 14, 1995, pages 969 - 973
MANOHARAN ET AL., ANN. N. Y. ACAD. SCI., vol. 660, 1992, pages 306 - 309
MANOHARAN ET AL., BIOORG. MED. CHEM. LET., vol. 3, 1993, pages 2765 - 2770
MANOHARAN ET AL., BIOORG. MED. CHEM. LET., vol. 4, 1994, pages 1053 - 1060
MANOHARAN ET AL., TETRAHEDRON LETT., vol. 36, 1995, pages 3651 - 3654
MARESCA, M.; LIN, V.G.; GUO, N.; YANG, Y., ENOME RES, vol. 23, 2013, pages 539 - 546
MARSON ET AL., CELL-STEM CELL, vol. 3, 2008, pages 132 - 135
MARTIN ET AL., HELV. CHIM. ACTA, vol. 78, 1995, pages 486
MATEOS-GOMEZ ET AL., NATURE, vol. 518, 2015, pages 254 - 57
MCLAUGHLIN ET AL., J. VIROL., vol. 62, 1988, pages 1963
MILLER ET AL., MOL. GEN. AND MET., 2015
MISHRA ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 1264, 1995, pages 229 - 237
MOSCOU ET AL., SCIENCE, vol. 326, no. 5959, 2009, pages 1501
MUZYCZKA, CURR. TOPICS IN MICROBIAL. AND IMMUNOL., vol. 158, 1992, pages 97 - 129
N ENGL J MED, vol. 320, no. 18, 4 May 1989 (1989-05-04), pages 1227
NASEVICIUS ET AL., NAT. GENET., vol. 26, 2000, pages 216 - 220
NATURE BIOTECHNOLOGY, vol. 32, 2014, pages 347 - 355
NIELSEN ET AL., SCIENCE, vol. 254, 1991, pages 1497
NIELSEN ET AL., SCIENCE, vol. 254, 1991, pages 1497 - 1500
OBERHAUSER ET AL., NUCL. ACIDS RES., vol. 20, 1992, pages 533 - 538
ORII KE ET AL.: "Formation of the enzyme complex in mitochondria is required for function of trifunctional beta-oxidation protein", BIOCHEM. BIOPHYS. RES. COMMUN., vol. 219, 1996, pages 773 - 777
ORII KE ET AL.: "Genomic and mutational analysis of the mitochondrial trifunctional protein betasubunit (HADHB) gene in patients with trifunctional protein deficiency (TFPD", HUM. MOL. GENET., vol. 6, 1997, pages 1215 - 1224
PAGON RA, ADAM MP, ARDINGER HH, ET AL.: "GeneReviews@", 20 April 2000, UNIVERSITY OF WASHINGTON, article MATERN D; RINALDO P. ET AL.: "Medium-Chain Acyl-Coenzyme A Dehydrogenase Deficiency"
PARK HD ET AL.: "Two novel HADHB gene mutations in a Korean patient with mitochondrial trifunctional protein deficiency", ANN. CLIN. LAB. SCI., vol. 39, 2009, pages 399 - 404
PAUL ET AL., HUMAN GENE THERAPY, vol. 4, 1993, pages 609 - 615
PEDIATR. RES., vol. 55, 2004, pages 190 - 196
PEER; LIEBERMAN, GENE THERAPY, vol. 18, 2011, pages 1127 - 1133
PERRIN ET AL., VACCINE, vol. 13, 1995, pages 1244 - 1250
PIEKUTOWSKA-ABRAMCZUK D ET AL.: "A comprehensive HADHA c.1528G>C frequency study reveals high prevalence of long-chain 3-hydroxyacyl-CoA dehydrogenase deficiency in Poland", J. INHERIT. METAB. DIS., 2010
PITTINGER MF; MACKAY AM; BECK SC ET AL., SCIENCE, vol. 284, 1999, pages 143 - 147
POLINATI PP ET AL.: "Patient-Specific Induced Pluripotent Stem Cell-Derived RPE Cells: Understanding the Pathogenesis of Retinopathy in Long-Chain 3-Hydroxyacyl-CoA Dehydrogenase Deficiency", INVEST OPHTHALMOL VIS SCI., vol. 56, no. 5, 2015, pages 3371 - 82
POSADAS, D.M.; ARTHEW, R.W., CURROPIN GENET DEV, vol. 27, 2014, pages 1 - 6
POSADAS, D.M.; CARTHEW, R.W., CURR OPIN GENET DEV, vol. 27, 2014, pages 1 - 6
PUREVSUREN J ET AL., MOL. GENET. METAB., 2009
PUREVSUREN J ET AL.: "Clinical and molecular aspects of Japanese patients with mitochondrial trifunctional protein deficiency", MOL. GENET. METAB., vol. 98, 2009, pages 372 - 377, XP026743025, DOI: doi:10.1016/j.ymgme.2009.07.011
PUREVSUREN J ET AL.: "Study of deep intronic sequence exonization in a Japanese neonate with a mitochondrial trifunctional protein deficiency", MOL. GENET. METAB., vol. 95, 2008, pages 46 - 51, XP025430445, DOI: doi:10.1016/j.ymgme.2008.06.013
RATSCHIN ET AL., MOL. CELL. BIOL., vol. 4, 1984, pages 2072
RINALDO ET AL., ANNU. REV. PHYSIOL., 2002
RINALDO ET AL., N. ENGL. J. MED., vol. 319, 1988, pages 1308 - 1313
RINALDO P ET AL.: "Fatty acid oxidation disorders", ANNU. REV. PHYSIOL., vol. 64, 2002, pages 477 - 502
RINALDO P ET AL.: "Medium-chain acyl-CoA dehydrogenase deficiency. Diagnosis by stable-isotope dilution measurement of urinary n-hexanoylglycine and 3-phenylpropionylglycine", N ENGL J MED., vol. 319, no. 20, 17 November 1988 (1988-11-17), pages 1308 - 13
RINALDO P; MATERN D; BENNETT MJ: "Fatty acid oxidation disorders", ANNU. REV. PHYSIOL., vol. 64, 2002, pages 477 - 502
ROE CR; BRUNENGRABER H: "Anaplerotic treatment of long-chain fat oxidation disorders with triheptanoin: Review of 15 years. Experience", MOL GENET METAB., vol. 116, no. 4, 2015, pages 260 - 8, XP029346063, DOI: doi:10.1016/j.ymgme.2015.10.005
SAJ, A.; LAI, E.C., CURR OPIN GENET DEV, vol. 21, 2011, pages 504 - 510
SAMULSKI ET AL., J. VIROL., vol. 63, 1989, pages 3822 - 3828
SAMULSKI ET AL., PROC. NATL. ACAD., vol. 79, 1982, pages 2077 - 2081
SANDER J ET AL.: "Neonatal screening for defects of the mitochondrial trifunctional protein. Mol. Genet", METAB, vol. 85, 2005, pages 108 - 114
SAPRANAUSKAS ET AL., NUCLEIC ACIDS RES, vol. 39, no. 21, 2011, pages 9275 - 9282
SAUDUBRAY JM ET AL.: "Recognition and management of fatty acid oxidation defects: a series of 107 patients", J. INHERIT. METAB. DIS, vol. 22, 1999, pages 488 - 502
SAWITZA I ET AL., SCI REP., vol. 5, 2015, pages 13320
SCHATZ ET AL., J. INHERIT METAB. DIS., vol. 33, 2010, pages 513 - 520
SCHIFF, MANUEL ET AL.: "Molecular and cellular pathology of very-long-chain acyl-CoA dehydrogenase deficiency", MOLECULAR GENETICS AND METABOLISM, vol. 109, no. 1, 2013, pages 21 - 27, XP028547829, DOI: doi:10.1016/j.ymgme.2013.02.002
SCHIFF, MOLECULAR GENETICS AND METABOLISM, 2013
SCIENCE, vol. 337, no. 6096, 2012, pages 816 - 821
SEGAL, PROC NATL ACAD SCI USA, vol. 96, no. 6, 1999, pages 2758 - 63
SENAPATHY; CARTER, J. BIOL. CHEM., vol. 259, 1984, pages 4661 - 4666
SHEA ET AL., NUCL. ACIDS RES., vol. 18, 1990, pages 3777 - 3783
SHI ET AL., CELL-STEM CELL, vol. 2, 2008, pages 525 - 528
SOUTSCHEK ET AL., NATURE, vol. 432, 2004, pages 173 - 178
SPIEKERKOETTER ET AL., PEDIATR. RES., 2004
SPIEKERKOETTER U ET AL.: "General mitochondrial trifunctional protein (TFP) deficiency as a result of either alpha- or beta-subunit mutations exhibits similar phenotypes because mutations in either subunit alter TFP complex expression and subunit turnover", PEDIATR. RES., vol. 55, 2004, pages 190 - 196
SPIEKERKOETTER U ET AL.: "Peripheral neuropathy, episodic myoglobinuria, and respiratory failure in deficiency of the mitochondrial trifunctional protein", MUSCLE NERVE., vol. 29, 2004, pages 66 - 72
SPIEKERKOETTER U, J INHERIT METAB DIS., 2010
SPIEKERKOETTER, THE JOURNAL OF PEDIATRICS, 2003
SPIEKERKOETTER, UTE ET AL.: "MS/MS-based newborn and family screening detects asymptomatic patients with very-long-chain acyl-CoA dehydrogenase deficiency", THE JOURNAL OF PEDIATRICS, vol. 143, no. 3, 2003, pages 335 - 342
STANLEY ET AL.: "Metabolic Diseases", article "Chapter 13", pages: 175 - 190
STEENTOFT ET AL., GLYCOBIOLOGY, vol. 24, no. 8, 2014, pages 663 - 80
STERN-GINOSSAR, N. ET AL., SCIENCE, vol. 317, 2007, pages 376 - 381
STRAUSS ET AL.: "Molecular basis of human mitochondrial very-long-chain acyl-CoA dehydrogenase deficiency causing cardiomyopathy and sudden death in childhood", PROC. NAT. ACAD. SCI., vol. 92, 1995, pages 10496 - 10500
SVINARCHUK ET AL., BIOCHIMIE, vol. 75, 1993, pages 49 - 54
TAKAHASHI; YAMANAKA, CELL, vol. 126, no. 4, 2006, pages 663 - 76
TAMAOKI Y ET AL.: "A survey of Japanese patients with mitochondrial fatty acid beta-oxidation and related disorders as detected from 1985 to 2000", BRAIN DEV., vol. 24, 2002, pages 675 - 680
TENOPOULOU, MARGARITA ET AL.: "Strategies for correcting very long chain acyl-CoA dehydrogenase deficiency", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 290, no. 16, 2015, pages 10486 - 10494
TRATSCHIN ET AL., MO1. CELL. BIOL., vol. 5, 1985, pages 3251
TRAUSS, PROC. NAT. ACAD. SCI., 1995
TSAI ET AL., NATURE BIOTECH, vol. 32, 2014, pages 569 - 76
TYNI T ET AL.: "Long-chain 3-hydroxyacyl-coenzyme A dehydrogenase deficiency (LCHADD) with the G1528C mutation: clinical presentation of thirteen patients.", J. PEDIATR., vol. 130, 1997, pages 67 - 76, XP005143023, DOI: doi:10.1016/S0022-3476(97)70312-3
TYNI T ET AL.: "Ophthalmic pathology in long-chain 3-hydroxyacyl-CoA dehydrogenase deficiency caused by the G1528C mutation", CURR. EYE RES., vol. 17, 1998, pages 551 - 559
USHIKUBO S ET AL.: "Molecular characterization of mitochondrial trifunctional protein deficiency: formation of the enzyme complex is important for stabilization of both alpha- and beta-subunits", AM. J. HUM. GENET., vol. 58, 1996, pages 979 - 988
VOCKLEY, J. ET AL.: "Response to Compassionate Use of Triheptanoin in Infants With Cardiomyopathy Due to Long Chain Fatty Acid Oxidation Defects (LC-FAODs", 2015, ULTRAGENYX PHARMACEUTICAL INC
VOLKOV, OLIGONUCLEOTIDES, vol. 19, 2009, pages 191 - 202
WAJNER ET AL., BIOSCIENCE REPORTS, vol. 36, no. 1, 2016, pages e00281
WANG ET AL., J GENET GENOMICS, vol. 41, no. 6, 17 May 2014 (2014-05-17), pages 339 - 47
WANG ET AL., J. AM. CHEM. SOC., vol. 122, 2000, pages 8595 - 8602
WANG ET AL., ZHONGHUA FU CHAN KE ZA ZHI, 2006
WANG R ET AL.: "Screening for G1528C mutation in mitochondrial trifunctional protein gene in pregnant women with severe preeclampsia and new born infant", ZHONGHUA FU CHAN KE ZA ZHI, vol. 41, 2006, pages 672 - 675
WARREN ET AL., CELL STEM CELL, vol. 7, no. 5, 2010, pages 618 - 30
WEBER ET AL., PLOS ONE, vol. 6, no. 2, 2011, pages e16765
WEBER, B.; STRESEMANN, C.; BRUECKNER, B.; LYKO, F., CELL CYCLE, vol. 6, 2007, pages 1001 - 1005
WHITEHEAD KA ET AL., ANNUAL REVIEW OF CHEMICAL AND BIOMOLECULAR ENGINEERING, vol. 2, 2011, pages 77 - 96
WILCKEN, J. INHERIT. METABOL. DIS., vol. 33, 2010, pages 501 - 506
WINKLER, THER. DELIV., vol. 4, 2013, pages 791 - 809
WOLFS ET AL., NAR, vol. 42, 2014, pages 8816 - 29
YAMAZAKI H ET AL.: "Mitochondrial trifunctional protein deficiency in a lethal neonate", PEDIATR. INT., vol. 46, 2004, pages 178 - 180
YOKOTA 11 ET AL.: "Molecular survey of a prevalent mutation, 985A-toG transition, and identification of five infrequent mutations in the medium-chain Acyl-CoA dehydrogenase (MCAD) gene in 55 patients with MCAD deficiency", AMERICAN JOURNAL OF HUMAN GENETICS, vol. 49, no. 6, 1991, pages 1280
ZHAO, Y. ET AL., SCI REP, vol. 4, 2014, pages 3943
ZHOU, C.; BLUMBERG, B.: "Overlapping gene structure of human VLCAD and DLG4", GENE, vol. 305, 2003, pages 161 - 166, XP004411959, DOI: doi:10.1016/S0378-1119(02)01235-0
ZSCHOCKE J ET AL.: "Molecular and functional characterization of mild MCAD deficiency", HUMAN GENETICS, vol. 108, no. 5, 2001, pages 404 - 408

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018154387A1 (en) * 2017-02-22 2018-08-30 Crispr Therapeutics Ag Compositions and methods for gene editing

Also Published As

Publication number Publication date
WO2018020323A3 (en) 2018-03-29

Similar Documents

Publication Publication Date Title
CN102239260B (en) By inhibiting apolipoprotein for natural antisense transcripts apolipoprotein -a1 -a1 treatment of related diseases
WO2015071474A9 (en) Crispr-cas system materials and methods
US9376669B2 (en) Methods and products for expressing proteins in cells
WO2015138510A1 (en) Crispr/cas-related methods and compositions for treating leber&#39;s congenital amaurosis 10 (lca10)
Voit et al. Nuclease-mediated gene editing by homologous recombination of the human globin locus
US20170007679A1 (en) Crispr/cas-related methods and compositions for treating hiv infection and aids
US10208319B2 (en) Therapeutic uses of genome editing with CRISPR/Cas systems
CA2850624A1 (en) Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
EP3126497B1 (en) Crispr/cas-related methods and compositions for treating herpes simplex virus type 1 (hsv-1)
US9970001B2 (en) Methods and compositions for nuclease design
US9994831B2 (en) Methods and compositions for modifying a single stranded target nucleic acid
WO2015148863A2 (en) Crispr/cas-related methods and compositions for treating sickle cell disease
CN102317458B (en) By erythropoietin (epo) treatment inhibits natural antisense transcript of a disease associated epo
JP6099868B2 (en) Treatment of a sirtuin 1 related diseases by suppressing the natural antisense transcript against Sirtuin 1 (SIRT1)
WO2015153791A1 (en) Crispr/cas-related methods and compositions for treating herpes simplex virus type 2 (hsv-2)
WO2015134812A1 (en) Crispr/cas-related methods and compositions for treating usher syndrome and retinitis pigmentosa
WO2015148860A1 (en) Crispr/cas-related methods and compositions for treating beta-thalassemia
US20150240263A1 (en) Methods and compositions for nuclease-mediated targeted integration
KR20150006477A (en) Bi-functional short-hairpin rna (bi-shrna) specific for single-nucleotide kras mutations
CN102822342B (en) Pancreatic Developmental gene by inhibiting natural antisense transcript of treating pancreatic related diseases Developmental gene
US9771593B2 (en) Treatment of tumor necrosis factor receptor 2 (TNFR2) related diseases by inhibition of natural antisense transcript to TNFR2
CN102803493B (en) By suppressing sex hormone binding globulin (SHBG) natural antisense transcripts treating related diseases SHBG
CN108513575A (en) Nucleobase editors and uses thereof
US9074210B2 (en) Treatment of brain derived neurotrophic factor (BDNF) related diseases by inhibition of natural antisense transcript to BDNF
CN103180445B (en) By inhibiting α-L- iduronic acid enzyme (IDUA) natural antisense transcripts treating related diseases IDUA

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17787243

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE