WO2018017925A1 - Targeting lytic and latent herpes simplex virus 1 infection with crispr/cas9 - Google Patents
Targeting lytic and latent herpes simplex virus 1 infection with crispr/cas9 Download PDFInfo
- Publication number
- WO2018017925A1 WO2018017925A1 PCT/US2017/043225 US2017043225W WO2018017925A1 WO 2018017925 A1 WO2018017925 A1 WO 2018017925A1 US 2017043225 W US2017043225 W US 2017043225W WO 2018017925 A1 WO2018017925 A1 WO 2018017925A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- grna
- herpesvirus
- complementary
- targeting domain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1131—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
- C12N15/1133—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses against herpetoviridae, e.g. HSV
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/16011—Herpesviridae
- C12N2710/16611—Simplexvirus, e.g. human herpesvirus 1, 2
Definitions
- the present disclosure is based, in part, on the use of CRISPR/Cas9 system to efficiently target lytic and latent HSV genomes, thereby inhibiting HSV lytic replication as well as reactivation of the quiescent HSV- 1.
- the results demonstrate that a combination of at least two gRNAs can synergistically enhance the inhibitory effect of CRISPR/Cas9 system on HSV lytic replication and reactivation of latent HSV-1.
- the inventors found that by causing genetic modifications/alterations in the genes of Rsl, UL54, UL29, UL30 or a homolog thereof in the genome of a herpesvirus, the lytic replication as well as the reactivation of the quiescent herpesvirus are inhibited.
- This strategy is therefore useful for the inactivation of quiescent, latent herpesvirus, useful for the inhibition of the herpesvirus in the active, lytic phase of an infection of a host cell, and also useful in the treatment of herpesvirus infection and herpesvirus related diseases.
- the method comprises introducing into said cell (a), (b), and (c).
- the Cas9 nuclease with the help of the gRNAs, cause a genetic modification or alteration in the genome of the herpesvirus.
- the genetic modification occurs in the genes Rsl, UL54, UL29, or UL30 in the herpesvirus.
- the genetic modification is an insertion or a deletion.
- the first gRNA and second gRNA are both not complementary to the same gene selected from the gene Rsl (SEQ ID NO: 3), UL54 (SEQ ID NO: 4), UL29 (SEQ ID NO: 5), UL30 (SEQ ID NO: 6). Meaning the gRNAs target a different gene in the herpesvirus.
- the technology herein relates to a gRNA molecule for use in the of inactivating a herpesvirus in a mammalian cell, wherein the gRNA molecule comprising a targeting domain which is complementary with a target sequence from the Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus.
- the herpesvirus is a quiescent, latent herpesvirus.
- the herpesvirus is active in the lytic phase of an infection of a host / mammalian cell.
- the technology herein relates to a composition for use in the of inactivating a herpesvirus in a mammalian cell or for use in treatment of lytic and latent HSV-1 infection and HSV-1 related disease, wherein the composition comprises a nucleic acid sequence encoding a Cas9 nuclease and a nucleic acid sequence encoding at least one gRNA molecule comprising a targeting domain which is complementary with a first target sequence from the Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvims.
- each of the at least two gRNA molecule comprising a targeting domain which is complementary with the genes selected from Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus, wherein the at least two gRNAs are both not complementary to the same gene selected.
- the nucleic acid sequences described herein are encompassed in an expression vector or two.
- the technology herein relates to a composition consisting of, or consisting essentially of (a) a first gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding Rsl or a conserved homolog thereof in the herpesvirus; (b) a second gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL54 or a conserved homolog thereof in the herpesvirus; (c) a third gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL29 or a conserved homolog thereof in the herpesvirus; and (d) a fourth gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL30 or a conserved homolog thereof in the herpesvirus.
- the technology herein relates to a composition
- a composition comprising: (a) a first gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding Rs 1 or a conserved homolog thereof in the herpesvirus; (b) a second gRNA comprising a targeting domain which is complementary with a target sequence in a gene selected from the group consisting of UL54, UL29, and UL30 or a conserved homolog thereof in the herpesvirus; and (c) a third gRNA comprising a targeting domain which is complementary with a target sequence in a gene selected from the group consisting of UL54, UL29, and UL30 or a conserved homolog thereof in the herpesvirus; wherein the selected genes targeted by the second and third gRNAs are not the same.
- the technology herein relates to a method of inactivating or inhibiting of a herpesvirus in a mammalian cell, the method comprising introducing into the cell: (a) a Cas9 molecule;
- the herpesvirus is herpes simplex virus- 1 (HSV-1).
- the gRNA targeting domain is complementary with a target domain from the UL29 gene or a conserved homolog thereof in the herepesvirus.
- the gRNA molecule compnses a nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 11, SEQ. ID. NO: 12, SEQ. ID. NO: 26, SEQ. ID. NO: 27, SEQ. ID. NO: 28, SEQ. ID. NO: 29, SEQ ID. NO: 30, SEQ. ID. NO: 31, SEQ. ID. NO: 32, SEQ ID. NO: 33, SEQ. ID. NO: 34, SEQ. ID. NO: 35 or SEQ. ID. NO: 36.
- disease refers to any alternation in state of the body or of some of the organs, interrupting or disturbing the performance of the functions and/or causing symptoms such as discomfort, dysfunction, distress, or even death to the person afflicted or those in contact with a person.
- a disease or disorder can also be related to a distemper, ailing, ailment, malady, disorder, sickness, illness, complaint, or affectation
- administering refers to the placement of a composition as disclosed herein into a subject by a method or route which results in at least partial delivery of the composition at a desired site.
- Pharmaceutical compositions disclosed herein can be administered by any appropriate route which results in an effective treatment in the subject, e.g. intracerebroventricular administration, intranasal administration, intracranial administration, intracelial administration, intracerebellar administration, or intrathecal administration
- Domestic and game animals include, for example, cows, horses, pigs, deer, bison, buffalo, feline species, e.g., domestic cat, and canine species, e.g., dog, fox, wolf, avian species, e.g., chicken, emu, ostrich, and fish, e.g., trout, catfish and salmon.
- feline species e.g., domestic cat
- canine species e.g., dog, fox, wolf
- avian species e.g., chicken, emu, ostrich, and fish, e.g., trout, catfish and salmon.
- a subject can be male or female.
- the subject is one who has been previously diagnosed with or identified as suffering from or under medical supervision for a herpesvirus infection.
- the herpesvirus infection is HSV-1 infection.
- an “effective amount” is well within the capability of those skilled in the art. Generally, an “effective amount” can vary with the subject's history, age, condition, sex, as well as the severity and type of the microbial infection in the subject, and administration of other pharmaceutically active agents. Furthermore, therapeutically effective amounts will vary, as recognized by those skilled in the art, depending on the specific infection treated, the route of administration, the excipient selected, and the possibility of combination therapy.
- the "targeting domain" of the gRNA is complementary to the "target sequence" on the target nucleic acid sequence.
- Guidance on the selection of targeting domains can be found, e.g., in Fu Y el al. NAT BIOTECHNOL 2014 (doi: 10.1038/nbt.2808) and Sternberg SH el a/.. NATURE 2014 (doi: 10. 1038/naturel301 1).
- the targeting domain has full complementarity with the target sequence.
- the targeting domain has or includes 1 , 2, 3, 4, .5, 6, 7 or 8 nucleotides that are not complementary with the corresponding nucleotide of the targeting domain.
- the degree of complementarity, together with other properties of the gRNA is sufficient to allow targeting of a Cas9 molecule to the target nucleic acid.
- the term "in combination” refers to the use of more than one gRNA simultaneously or sequentially and in a manner such that their respective effects are additive or synergistic.
- a combination of gRNAs can be, for example, a first gRNA and a second gRNA.
- the first gRNA is a gRNA comprising a targeting domain which is complementary with a target sequence from the gene Rsl (SEQ ID NO: 3), UL54 (SEQ ID NO: 4), UL29 (SEQ ID NO: 5), UL30 (SEQ ID NO: 6) or a conserved variant thereof.
- An isolated nucleic acid also refers to a DNA molecule that is incorporated into a vector, an autonomously replicating plasmid, a virus, or into the genomic DNA of a prokaryote or eukaryote.
- an isolated nucleic acid can include an engineered nucleic acid such as a DNA molecule that is part of a hybrid or fusion nucleic acid.
- FIG. 3 A shows the experimental scheme of Cas9/gRNA-mediated inhibition of reactivation of quiescent dl09 genomes in HFFs.
- Fig. 5A shows protein immunoblots of various proteins expressed in HFFs transduced with lentivirus expressing Cas9 and gRNA were infected with HSV-1 at and MOI of 3 with or without phosphonoacetate (PAA), and harvested at 10 hpi. Proteins were detected using immunoblotting with antibodies specific for the indicated proteins. Three SDS-PAGE gels loaded with the same amount of proteins were used to detect multiple proteins. Immunoblots of GAPDH were shown as a control under the individual immunoblots.
- HFFs transduced with lentivirus expressing Cas9 and gRNA were infected with HSV-1 at an MOI of 3 with (Fig. 6A and Fig. 6B) or without (Fig. 6C and Fig. 6D) phosphonoacetate (PAA) and harvested at the indicated time post infection.
- the accumulated DNAs were detected by real time PCR amplifying in the UL29 gene (Fig. 6A and Fig. 6C) or over the UL30-2 gRNA (Fig. 6B and Fig. 6D) targeting site.
- compositions comprising (a) a nucleic acid sequence that encodes a CRISPR-associated endonuclease and (b) a nucleic acid sequence that encodes one or a combination of several guide RNAs that is complementary to target sequences in herpesvirus. Also featured herein are compositions comprising a CRISPR-associated endonuclease polypeptide and one or a combination of several guide RNAs that are complementary to target sequences in herpesvirus. Also featured herein are methods of inactivating latent and lytic herpesvirus, and methods of treatment of herpesvirus infection and herpesvirus related disease.
- Herpesviridae comprises a large family of DNA viruses and include herpes simplex virus- 1 (HSV-1), herpes simplex virus-2 (HSV-2), varicella zoster virus, Epstein-Barr virus, cytomegalovirus, human herpesvirus 6, human herpesvirus 7, and Kaposi's sarcoma- associated herpesvirus.
- Herpesvirus once acquired remain with the host for life, and in case of HSV-1 and HSV-2, typically remain latent in the form of stable dsDNA episome in the nuclei of sensory neurons.
- HSVs express Latency Associated Transcript (LAT) RNA.
- LAT Latency Associated Transcript
- a promoter for a Cas9 molecule or a gRNA molecule can be, independently, inducible, tissue specific, or cell specific.
- the Cas9 molecule is provided as a polypeptide and the gRNA is transcribed in vitro from DNA, and then introduced into a subject or into an infected cell.
- the Cas9 molecule is provided as a polypeptide and the gRNA is provided as an RNA.
- the compositions described herein comprise nucleic acid sequences encoding Cas9 molecule and or gRNA.
- Cas9 is guided by a mature crRNA that contains about 20 base pairs (bp) of unique target sequence (called spacer) and a trans-activated small RNA (tracrRNA) that serves as a guide for ribonuclease Ill-aided processing of pre-crRNA.
- spacer base pairs
- tracrRNA trans-activated small RNA
- the crRNA:tracrRNA duplex directs Cas9 to target DNA via complementary base pairing between the spacer on the crRNA and the complementary sequence (called protospacer) on the target DNA.
- Cas9 recognizes a trinucleotide (NGG) protospacer adjacent motif (PAM) to specify the cut site (the 3rd nucleotide from PAM).
- NGS trinucleotide
- PAM protospacer adjacent motif
- Cas9 molecule as used herein is a CRISPR-associated endonuclease can also be referred to as Cas9 nuclease.
- CRISPR systems have been identified and characterized from many different bacteria and any of these Cas9 enzymes may be used in the methods and compositions described herein.
- the nucleic acid sequence can be codon optimized for efficient expression in mammalian cells, i.e., "humanized.”
- a humanized Cas9 nuclease sequence can be for example, the Cas9 nuclease sequence encoded by any of the expression vectors listed in Genbank accession numbers KM099231.1 GL669193757; KM099232.1 GL669193761; or KM099233.1 GI:669193765.
- the Cas9 nuclease sequence can be for example, the sequence contained within a commercially available vector such as PX330 or PX260 from ADDGENE (Cambridge, MA).
- the Cas9 molecule is a polypeptide comprising the sequence of SEQ ID No: 1, or SEQ ID NO: 2 or a functional fragment thereof.
- the Cas9 nucleotide sequence can be modified to encode biologically active variants of Cas 9, and these variants can have or can include, for example, an amino acid sequence that differs from a wild type Cas9 by virtue of containing one or more mutations (e.g., an addition, deletion, or substitution mutation or a combination of such mutations).
- One or more of the substitution mutations can be a substitution (e.g., a conservative amino acid substitution or non- conservative amino acid substitution).
- modified version of a nuclease is used.
- the bonds between the amino acid residues can be conventional peptide bonds or another covalent bond (such as an ester or ether bond), and the polypeptides can be modified by amidation, phosphorylation or glycosylation.
- a modification can affect the polypeptide backbone and/or one or more side chains.
- Chemical modifications can be naturally occurring modifications made in vivo following translation of an mRNA encoding the polypeptide (e.g., glycosylation in a bacterial host) or synthetic modifications made in vitro.
- Polypeptides can be generated by a variety of methods including, for example, recombinant techniques or chemical synthesis. Once generated, polypeptides can be isolated and purified to any desired extent by means well known in the art. For example, one can use lyophilization following, for example, reversed phase or normal phase HPLC, or size exclusion or partition chromatography on polysaccharide gel media such as Sephadex G-25. The composition of the final polypeptide may be confirmed by amino acid analysis after degradation of the peptide by standard means, by amino acid sequencing, or by FAB-MS techniques. Salts, including acid salts, esters, amides, and N-acyl derivatives of an amino group of a polypeptide may be prepared using methods known in the art, and such peptides are useful in the context of the present disclosure.
- Non-limiting exemplary polypeptide sequences for Cas9 molecule are provided below:
- gRNA guide RNA
- the methods, compositions, and kits described herein can comprise a nucleic acid sequence encoding a gRNA comprising a targeting domain that is complementary to a target sequence in a herpesvirus.
- gRNA Guide RNA
- sgRNA single guide RNA
- the gRNA sequence can be configured as a single sequence or as a combination of one or more different sequences, e.g., a multiplex configuration. Multiplex configurations can include combinations of two, three, four, five, six, seven, eight, nine, ten, or more different gRNAs, for example any combination of sequences complementary to a target sequence within genes, Rsl (SEQ ID NO: 3), UL54 (SEQ ID NO: 4), UL29 (SEQ ID NO: 5), UL30 (SEQ ID NO: 6) or a homolog thereof. However, any number of gRNAs may be introduced into a combination to target sequences within one or more regions of genome.
- the target sequences are important for genome structure, viral replication, and infection latency, respectively.
- in vitro experiments allow for the determination of the most essential targets within a viral genome. For example, to understand the most essential targets for effective incapacitation of a genome, subsets of gRNAs are transfected into model cells. Assays can determine which gRNAs or which combination is the most effective at targeting essential sequences within the viral genome. For example, as shown in FIG. 3B, in the case of the HSV-1 genome targeting, a combination of two gRNAs in the CRISPR/Cas9/gRNA targeted two different viral genes which are identified as being important for infection latency.
- compositions, and kits described herein comprise of a first gRNA comprising a targeting domain which is complementary with a target sequence from the gene Rsl (SEQ ID NO: 3), UL54 (SEQ ID NO: 4), UL29 (SEQ ID NO: 5), UL30 (SEQ ID NO: 6) or a conserved variant thereof and a second a second gRNA comprising a targeting domain which is complementary with a second target sequence from the gene Rsl (SEQ ID NO: 3), UL54 (SEQ ID NO: 4), UL29 (SEQ ID NO: 5), UL30 (SEQ ID NO: 6) or a homolog thereof.
- the first gRNA and the second gRNA target different genes selected from the group consisting of Rsl, UL54, UL29, and UL30.
- epoxyqueuosine galactosyl-queuosine; mannosyl-queuosine; 7-cyano-7-deazaguanosine; arachaeosine [also called 7-formamido-7 -deazaguanosine]; and 7 -aminomethyl-7- deazaguanosine.
- word size 1; window size: 5; scoring method: percentage; number of top diagonals: 5; gap penalty: 3.
- weight matrix blosum; gap opening penalty: 10.0; gap extension penalty: 0.05; hydrophilic gaps: on; hydrophilic residues: Gly, Pro, Ser, Asn, Asp, Gin, Glu, Arg, and Lys; residue- specific gap penalties: on.
- ClustalW can be run, for example, at the Baylor College of Medicine Search Launcher website and at the European Bioinformatics Institute website on the World Wide Web.
- exogenous nucleic acid sequence or polypeptide is part of, or encoded by, a recombinant nucleic acid construct, or is not in its natural environment.
- an exogenous nucleic acid can be a sequence from one species introduced into another species, i.e., a heterologous nucleic acid. Typically, such an exogenous nucleic acid is introduced into the other species via a recombinant nucleic acid construct.
- An exogenous nucleic acid can also be a sequence that is native to an organism and that has been reintroduced into cells of that organism.
- exogenous nucleic acid that includes a native sequence can often be distinguished from the naturally occurring sequence by the presence of non-natural sequences linked to the exogenous nucleic acid, e .g., non-native regulatory sequences flanking a native sequence in a recombinant nucleic acid construct.
- stably transformed exogenous nucleic acids typically are integrated at positions other than the position where the native sequence is found.
- CRISPR/Cas9/gRNA complexes are administered to the subject.
- the CRISPR/Cas9/gRNA complexes are designed to not leave intact genomes of a virus after transfection and complexes are designed for efficient transfection.
- CRISPR/Cas9/gRNA to be introduced into cells by various methods, including viral vectors and non-viral vectors. Accordingly, vectors comprising nucleic acid sequences such as those described herein also are provided.
- a "vector” is a replicon, such as a plasmid, phage, or cosmid, into which another DNA segment may be inserted so as to bring about the replication of the inserted segment.
- a vector is capable of replication when associated with the proper control elements.
- Suitable vector backbones include, for example, those routinely used in the art such as plasmids, viruses, artificial chromosomes, BACs, YACs, or PACs.
- a "recombinant viral vector” refers to a viral vector comprising one or more heterologous gene products or sequences. Since many viral vectors exhibit size-constraints associated with packaging, the heterologous gene products or sequences are typically introduced by replacing one or more portions of the viral genome. Such viruses may become replication-defective, requiring the deleted function(s) to be provided in trans during viral replication and encapsidation (by using, e.g., a helper virus or a packaging cell line carrying gene products necessary for replication and/or encapsidation).
- lipofection reagents are sold commercially (e.g., Transfectam and Lipofectin).
- Cationic and neutral lipids that are suitable for efficient receptor-recognition lipofection of polynucleotides include those described in U.S. Pat. No. 7,166,298 to lessee or U.S. Pat. No. 6,890,554 to Jesse, the contents of each of which are incorporated by reference in their entireties. Delivery can be to cells (e.g. in vitro or ex vivo administration) or target tissues (e.g. in vivo administration).
- liposomes are used to effectuate introduction into a cell or tissue.
- the pharmacology of a liposomal formulation of nucleic acid is largely determined by the extent to which the nucleic acid is encapsulated inside the liposome bilayer Encapsulated nucleic acid shares the extended circulation lifetime and biodistribution of the intact liposome, while those that are surface associated adopt the pharmacology of naked nucleic acid once they disassociate from the liposome. Therefore, nucleic acid sequences may be entrapped within liposomes with conventional passive loading technologies, such as ethanol drop method (as in SALP), reverse phase evaporation method, and ethanol dilution method (as in SNALP).
- SALP ethanol drop method
- SNALP ethanol dilution method
- the complexes of the disclosure are conjugated to or encapsulated into a liposome or polymerosome for delivery to a cell.
- liposomal anthracyclines have achieved highly efficient encapsulation, and include versions with greatly prolonged circulation such as liposomal daunorubicin and pegylated liposomal doxorubicin. See Krishna etal., Carboxymethylcellulose-sodium based transdermal drug delivery system for propranolol, J Pharm
- Controlled-release technology such as transdermal and transmucosal controlled-release delivery systems, nasal and buccal aerosol sprays, drug-impregnated lozenges, encapsulated cells, oral soft gels, iontophoretic devices to administer drugs through skin, and a variety of programmable, implanted drug-delivery devices are used in conjunction with the complexes of the disclosure of accomplishing targeted and controlled delivery.
- the mutation comprises a point mutation, that is, the replacement of a single nucleotide with another nucleotide.
- Useful point mutations are those that have functional consequences, for example, mutations that result in the conversion of an amino acid codon into a termination codon or that result in the production of a nonfunctional protein.
- the Cas9 nuclease is used to cleave the genome.
- the Cas9 nuclease is capable of creating a double strand break in the genome.
- the Cas9 endonuclease causes a double strand break in one or more locations in the viral genome.
- the genomic sequence for HSV-1 and other herpes viruses are available publically and can be obtained for example from genbankTM For example, HSV-1, NC 001806.2.
- the target sequence for the methods and compositions herein can be in a coding region or non-coding region of the genome.
- compositions which contain, as the active ingredient, nucleic acids and vectors described herein in combination with one or more pharmaceutically acceptable carriers.
- pharmaceutically acceptable or “pharmacologically acceptable” to refer to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal or a human, as appropriate.
- pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial, isotonic and absorption delaying agents, buffers, excipients, binders, lubricants, gels, surfactants and the like, that may be used as media for a pharmaceutically acceptable substance.
- the active ingredient is typically mixed with an excipient, diluted by an excipient or enclosed within such a carrier in the form of, for example, a capsule, tablet, sachet, paper, or other container.
- an excipient serves as a diluent, it can be a solid, semisolid, or liquid material (e.g., normal saline), which acts as a vehicle, carrier or medium for the active ingredient.
- the gRNA sequence can include a sequence complementary to a single region, or it can include any combination of sequences complementary to different regions of the viral genome.
- the sequence encoding Cas9 polypeptide and the sequence encoding the gRNA sequence can be on separate vectors.
- Non-limiting exemplary sequences of the Cas9 polypeptide are presented in SEQ ID NO: 1 and SEQ ID NO: 2.
- a subject is effectively treated whenever a clinically beneficial result ensues. This may mean, for example, a complete resolution of the symptoms of a disease, a decrease in the severity of the symptoms of the disease, or a slowing of the disease's progression.
- These methods can further include the steps of a) identifying a subject (e.g., a patient and, more specifically, a human patient) who has an herpesvirus infection (e.g., HSV-1 infection); and b) providing to the subject a composition comprising a nucleic acid encoding a CRISPR-associated nuclease, e.g., Cas9, and a guide RNA complementary to an herpesvirus target sequence, e.g. a protein coding sequence.
- a subject can be identified using standard clinical tests, for example, viral antigen detection, viral DNA detection, detection of antibodies to HSV-1.
- the infection is diagnosed based on the presence of characteristic herpesvirus sores.
- a therapeutically effective amount of a composition is provided to the subject, resulting in a complete resolution of the symptoms of the infection, a decrease in the severity of the symptoms of the infection, or a slowmg of the infection's progression is considered a therapeutically effective amount.
- the present methods may also include a monitoring step to help optimize dosing and scheduling as well as predict outcome.
- compositions described herein are also useful for the treatment, for example, as a prophylactic treatment, of a subject at risk for having a herpesvirus infection, e.g., an HSV-1 infection or at a risk of recurrence of herpesvirus infection.
- These methods can further include the steps of a) identifying a subject at risk for having a herpesvirus infection; b) providing to the subject a composition comprising a nucleic acid encoding a CRISPR-associated nuclease, e.g., Cas9, and a guide RNA complementary to a herpesvirus target sequence.
- compositions can be administered to an individual in need of treatment.
- the compositions may also be administered with another therapeutic agent, for example, an anti-viral agent, e.g., anti-viral drugs.
- anti-viral agents include acyclovir, ganciclovir, foscarnet, cidofovir, famciclovir, valganciclovir, and valaciclovir.
- Concurrent administration of two or more therapeutic agents does not require that the agents be administered at the same time or by the same route, as long as there is an overlap in the time period during which the agents are exerting their therapeutic effect. Simultaneous or sequential administration is contemplated, as is administration on different days or weeks.
- the therapeutic agents may be administered under a metronomic regimen, e.g., continuous low-doses of a therapeutic agent.
- the subject is resistant or unresponsive to treatment with one or more of the anti-viral drugs.
- Packaged products e.g., sterile containers containing one or more of the compositions described herein and packaged for storage, shipment, or sale at concentrated or ready-to-use
- kits including at least one composition of this disclosure, e.g., a nucleic acid sequence encoding a CRISPR-associated endonuclease, for example, a Cas9 endonuclease, and one or combination of gRNAs disclosed herein, or a vector encoding that nucleic acid and instructions for use, are also within the scope of the disclosure.
- a product can include a container (e.g., a vial, jar, bottle, bag, or the like) containing one or more compositions of this disclosure.
- a first gRNA comprising a targeting domain which is complementary with a target sequence from the gene Rsl (SEQ ID NO: 3), UL54 (SEQ ID NO: 4), UL29 (SEQ ID NO: 5), UL30 (SEQ ID NO: 6) or a homolog thereof; and optionally (c) a second gRNA comprising a targeting domain which is complementary with a second target sequence from the gene Rsl, UL54, UL29, UL30 or a homolog thereof in the herpesvirus.
- herpesvirus is selected from the group; herpes simplex virus- 1 (HSV-1), herpes simplex virus-2 (HSV-2), varicella zoster virus, Epstein- Barr virus, cytomegalovirus, human herpesvirus 6, human herpesvirus 7, or Kaposi's sarcoma- associated herpesvirus.
- herpesvirus is herpes simplex virus- 1 (HSV-1).
- non-viral vector is selected from the group consisting of a nanoparticle, a cationic lipid, a cationic polymer, a metallic nanoparticle, a nanorod, a liposome, microbubbles, a cell penetrating peptide and a liposphere.
- SEQ. ID. NO: 20 SEQ. ID. NO: 21, SEQ. ID. NO: 22, SEQ. ID. NO: 23, SEQ. ID. NO: 24 or SEQ ID.
- composition of paragraph 38 further comprising a fourth gRNA molecule
- a first gRNA comprising a targeting domain which is complementary with a target sequence from the gene Rsl, UL54, UL29, UL30 or a homolog thereof;
- a method of inactivating or inhibiting a herpesvirus in a mammalian cell comprising introducing into the cell:
- a second gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL54 or a conserved homolog thereof in the herpesvirus;
- a first gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding Rsl or a conserved homolog thereof in the herpesvirus;
- a fourth gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL30 or a conserved homolog thereof in the herpesvirus.
- a first gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding Rsl or a conserved homolog thereof in the herpesvirus;
- a third gRNA comprising a targeting domain which is complementary with a target sequence in a gene selected from the group consisting of UL54, UL29, and UL30 or a conserved homolog thereof in the herpesvirus; wherein the selected genes targeted by the second and third gRNAs are not the same.
- a) a Cas9 molecule b) a first gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding Rsl or a conserved homolog thereof in the herpesvirus;
- a composition comprising:
- a second gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL54 or a conserved homolog thereof in the herpesvirus;
- a fourth gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL30 or a conserved homolog thereof in the herpesvirus.
- a third gRNA comprising a targeting domain which is complementary with a target sequence in a gene selected from the group consisting of UL54, UL29, and UL30 or a conserved homolog thereof in the herpesvirus; wherein the selected genes targeted by the second and third gRNAs are not the same.
- DNA assembly was performed using NEBuilder® HiFi DNA Assembly (NEB) and three DNA fragments, the purified linear lentiCRISPRv2, a double -stranded DNA gBlock (IDT) containing sgRNA cloning sites and tracrRNA sequences (IDT, 5' CTTTATATATCTTGTGGAAAGGACGAAACACCGGAGACGtGATATCaCGTCTCAGTTTTAGTA CTCTGGAAACAGAATCTACTAAAACAAGGCAAAATGCCGTGTTTATCTCGTCAACTTGTTGG CGAGATTTTTGAATTCGTAGACTCGAGGCGTTG ACATTG 3' (SEQ ID NO: 62)), and PCR fragment containing SaCas9-mCherry according to the manufacturer's protocol.
- IDTT double -stranded DNA gBlock
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Virology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
Described herein are methods and compositions for inactivation of replicating and latent herpesvirus and treatment of lytic and latent herpesvirus infection and herpesvirus related diseases. Novel therapeutic guide RNAs, and nucleic acid sequence and combinations thereof, further comprised in an expression vector, for use in methods and compositions herein are also featured. In one aspect the present disclosure is related to compositions for inactivation of replicating and latent HSV-1 virus and treatment of lytic and latent HSV-1 infection.
Description
TARGETING LYTIC AND LATENT HERPES SIMPLEX VIRUS 1 INFECTION WITH
CRISPR/CAS9
CROSS REFERENCE TO RELATED APPLICATION
[0001] This application is an International Application filed on July 21, 2017, which designated the U.S., and which claims the benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application No. 62/365,826, filed July 22, 2016; the contents of which are incorporated herein by reference in their entireties.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on July 17, 2017, is named 002806-08755 l-PCT_SL.txt and is 4,411 bytes in size.
TECHNICAL FIELD
[0003] The present disclosure relates to compositions and methods for the treatment of latent and lytic herpes simplex virus-1 infection using CRISPR Cas9 nuclease system.
BACKGROUND
[0004] Herpes simplex virus (HSV) 1 and 2 are prevalent human pathogens causing significant morbidity and mortality in neonates and adults. After primary infection, HSV undergoes lytic replication in epithelial tissues followed by a spread to sensory neurons where the virus establishes latency for life. Lytic infection can cause herpetic cold sores and genital herpes. Latent HSV can reactivate to cause more severe diseases including herpes keratitis, meningitis, and encephalitis. In addition, HSV-2 infection can increase risk of HIV acquisition. No approved vaccine for HSV-1 and -2 is currently available. There are several effective anti-HSV drugs can be used to treat lytic infection by targeting viral enzymes expressed during the lytic replication cycle. However, there is no treatment available for latent HSV infection. This is because the latent HSV genomes express no or minimal viral genes, which limits the number of therapeutic targets. Therefore, there is an unmet need for antiviral therapeutic strategies to inactivate latent HSV genomes.
[0005] Genome editing technologies have been evolving rapidly in the past decade and include
Zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganuclease, and Clustered regularly-interspaced short palindromic repeats)/Cas9 (CRISPR)-based systems. All of these systems utilize programmable sequence-specific binding protein domains and DNA nucleases to cause breaks in the sugar-phosphate DNA backbone of double stranded DNA, which triggers cellular DNA repair mechanisms including the error-prone non-homologous end joining (NHEJ) and homology-directed repair (HDR). During the NHEJ, random deletions and insertions can occur, which induces mutations in the targeted DNA. Alternatively, specific DNA fragments can be introduced to the cleavage site during HDR. Multiple applications have already demonstrated that these tools can be used efficiently in vitro and in vivo. TALENs have been used to edit genomes in rice,
[0006] Zebrafish, and human cell lines. ZFNs have achieved genome editing more broadly including Caenorhabditis elegans, zebrafish, Drosophila, tobacco, mouse, and pig. Recently ZFNs have
been adapted for therapeutic applications to repair Parkinson's disease-associated mutations in human iPS cells and to mutate HIV coreceptor C-C chemokine receptor type 5 (CCR5) to generate HIV-resistant CD4+ T. Although these systems are applicable for genome editing in various fields, these nuclease systems require designing entire sequence-specific nucleases to cleave target sites.
[0007] CRISPR/Cas9 system has recently emerged, and has been more rapidly adapted in genome editing fields than the other systems, due to its simplicity and versatility. Unlike other nuclease systems, CRISPR/Cas9 system uses the same Cas9 nuclease but different guide RNAs (gRNAs) to provide sequence specificity to Cas9. Therefore, Cas9 can cleave different sites of DNA by switching gRNA. Furthermore, multiple gRNAs can be introduced in a cell together to enhance knockout of target genes. It is important to have this flexibility when targeting viral DNAs because DNA viruses mutate their genomes over passages. Also, different HSV-1 strains have sequence variations. Therefore, CRISPR/Cas9 might be a more feasible approach than other genome editing systems to target large DNA viral genomes.
SUMMARY
[0008] The present disclosure is based, in part, on the use of CRISPR/Cas9 system to efficiently target lytic and latent HSV genomes, thereby inhibiting HSV lytic replication as well as reactivation of the quiescent HSV- 1. The results demonstrate that a combination of at least two gRNAs can synergistically enhance the inhibitory effect of CRISPR/Cas9 system on HSV lytic replication and reactivation of latent HSV-1. The inventors found that by causing genetic modifications/alterations in the genes of Rsl, UL54, UL29, UL30 or a homolog thereof in the genome of a herpesvirus, the lytic replication as well as the reactivation of the quiescent herpesvirus are inhibited. This strategy is therefore useful for the inactivation of quiescent, latent herpesvirus, useful for the inhibition of the herpesvirus in the active, lytic phase of an infection of a host cell, and also useful in the treatment of herpesvirus infection and herpesvirus related diseases.
[0009] Accordingly, the disclosure features compositions comprising a nucleic acid encoding a
CRISPR-associated endonuclease and a guide RNA (gRNA) that is complementary to a target sequence in a herpesvirus. Also featured are compositions comprising a CRISPR-associated endonuclease polypeptide and a guide RNA that is complementary to a target sequence in herpesvirus. Also featured are methods of inactivating latent and lytic herpesvirus and treatment of herpesvirus infection and herpesvirus related disease. The targeted sequences are from the genome of the genes of Rsl, UL54, UL29, UL30. The inventors disclose novel therapeutic gRNAs, nucleic acid sequences, and combinations thereof, which are further comprised in an expression vector or more vectors, for use in methods and compositions herein. In one aspect, the present disclosure is related to compositions and methods for the inactivation of replicating and latent HSV-1 virus, and for the treatment of lytic and latent HSV-1 infection and HSV-1 related disease.
[0010] In one aspect, the technology described herein relates to a method of inactivating a herpesvirus in a mammalian cell, the method comprising introducing into the cell: (a) a Cas9 molecule and b) a first gRNA comprising a targeting domain which is complementary with a target sequence selected from the gene Rsl (SEQ ID NO: 3), UL54 (SEQ ID NO: 4), UL29 (SEQ ID NO: 5), UL30 (SEQ ID NO: 6)
or a homolog thereof; and optionally (c) a second gRNA comprising a targeting domain which is complementary with a second target sequence selected from the gene Rsl, UL54, UL29, UL30 or a homolog thereof in the herpesvirus. In some embodiments, the method comprises introducing into said cell (a), (b), and (c). In one embodiment of the method, the Cas9 nuclease ,with the help of the gRNAs, cause a genetic modification or alteration in the genome of the herpesvirus. Specifically, the genetic modification occurs in the genes Rsl, UL54, UL29, or UL30 in the herpesvirus. In one embodiment of the method, the genetic modification is an insertion or a deletion. In one embodiment of the method, the first gRNA and second gRNA are both not complementary to the same gene selected from the gene Rsl (SEQ ID NO: 3), UL54 (SEQ ID NO: 4), UL29 (SEQ ID NO: 5), UL30 (SEQ ID NO: 6). Meaning the gRNAs target a different gene in the herpesvirus.
[0011] In one aspect, the technology herein relates to a gRNA molecule for use in the of inactivating a herpesvirus in a mammalian cell, wherein the gRNA molecule comprising a targeting domain which is complementary with a target sequence from the Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus. In one embodiment, the herpesvirus is a quiescent, latent herpesvirus. In another embodiment, the herpesvirus is active in the lytic phase of an infection of a host / mammalian cell.
[0012] In one aspect, the technology herein relates to a gRNA molecule for use in the manufacture of medicament for inactivating a herpesvirus in a mammalian cell, wherein the gRNA molecule comprising a targeting domain which is complementary with a target sequence from the Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus. In one embodiment, the herpesvirus is a quiescent, latent herpesvirus. In another embodiment, the herpesvirus is active in the lytic phase of an infection of a host / mammalian cell.
[0013] In another aspect, the technology herein relates to a gRNA molecule for use in the treatment of lytic and latent HSV-1 infection and HSV-1 related disease, wherein the gRNA molecule comprising a targeting domain which is complementary with a target sequence from the Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus. In one embodiment, the herpesvirus is a quiescent, latent herpesvirus. In another embodiment, the herpesvirus is active in the lytic phase of an infection of a host / mammalian cell.
[0014] In another aspect, the technology herein relates to a gRNA molecule for use in the manufacture of medicament for the treatment of lytic and latent HSV-1 infection and HSV-1 related disease, wherein the gRNA molecule comprising a targeting domain which is complementary with a target sequence from the Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus. In one embodiment, the herpesvirus is a quiescent, latent herpesvirus. In another embodiment, the herpesvirus is active in the lytic phase of an infection of a host / mammalian cell.
[0015] In one aspect, the technology herein relates to a gRNA molecule comprising a targeting domain or sequence which is complementary with a target sequence from an Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus. In some embodiments, the targeting domain or
sequence is complementary with a target domain from the Rsl gene or a conserved homolog thereof in the herepesvirus.
[0016] In one aspect, the technology herein relates to a composition comprising a Cas9 nuclease and at least one gRNA molecule comprising a targeting domain which is complementary with a first target sequence from the Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus. Embodied herein are compositions with a combination of two gRNA molecules, each gRNA targeting a different gene selected from the Rsl, UL29, UL30, UL54 gene. For examples, UL30 and UL29, UL30 and UL54, UL30 and Rstl, UL29 and Rstl, UL29 and UL54, and UL54 and Rstl.
[0017] In some embodiments, provided herein are compositions comprising, or consisting of, or consisting essentially of a Cas9 nuclease and a gRNA molecule comprising a targeting domain which is complementary with a first target sequence from the Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus.
[0018] In some embodiments, provided herein are compositions comprising, or consisting of, or consisting essentially of a Cas9 nuclease and two gRNA molecule, where each gRNA comprising a targeting domain which is complementary with a first target sequence from the Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus, wherein each gRNA targeting a different gene selected from the Rsl, UL29, UL30, UL54 gene. In some embodiments, the combinations of targeted genes are selected from the group consisting of UL30 and UL29, UL30 and UL54, UL30 and Rstl, UL29 and Rstl, UL29 and UL54, and UL54 and Rstl.
[0019] In another aspect, the technology herein relates to a composition for use in the of inactivating a herpesvirus in a mammalian cell or for use in treatment of lytic and latent HSV-1 infection and HSV-1 related disease, wherein the composition comprises a Cas9 nuclease and at least one gRNA molecule comprising a targeting domain which is complementary with a first target sequence from the Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus.
[0020] In another aspect, the technology herein relates to a composition for the manufacture of medicament for use in the of inactivating a herpesvirus in a mammalian cell or for use in treatment of lytic and latent HSV-1 infection and HSV-1 related disease, wherein the composition comprises a Cas9 nuclease and at least one gRNA molecule comprising a targeting domain which is complementary with a first target sequence from the Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus.
[0021] In one aspect, the technology herein relates to a composition comprising, or consisting of, or consisting essentially a first gRNA molecule comprising a targeting domain which is complementary with a first target sequence from the Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus. In some embodiments, the composition comprises, consists of, or consists essentially at least two gRNA molecules, where each gRNA comprises a targeting domain which is complementary with the genes selected from Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus, wherein the at least two gRNAs are both not complementary to the same gene selected.
[0022] In another aspect, the technology herein relates to a composition for use in the of inactivating a herpesvirus in a mammalian cell or for use in treatment of lytic and latent HSV-1 infection
and HSV-1 related disease, wherein the composition comprises a first gRNA molecule comprising a targeting domain which is complementary with a first target sequence from the Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvims. In some embodiments, the composition comprises at least two gRNA molecules, where each gRNA comprises a targeting domain which is complementary with the genes selected from Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvims, wherein the at least two gRNAs are both not complementary to the same gene selected.
[0023] In another aspect, the technology herein relates to a composition for the manufacture of medicament for use in the of inactivating a herpesvirus in a mammalian cell or for use in treatment of lytic and latent HSV-1 infection and HSV-1 related disease, wherein the composition comprises a first gRNA molecule comprising a targeting domain which is complementary with a first target sequence from the Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvims. In some embodiments, the composition comprises at least two gRNA molecules, where each gRNA comprises a targeting domain which is complementary with the genes selected from Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvims, wherein the at least two gRNAs are both not complementary to the same gene selected.
[0024] In one aspect, the technology herein relates to a composition comprising, or consisting of, or consisting essentially a nucleic acid sequence encoding a Cas9 nuclease and a nucleic acid sequence encoding at least one gRNA molecule comprising a targeting domain which is complementary with a first target sequence from the Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvims. In some embodiments, there are at least two gRNA molecules being encoded by nucleic acid sequences in the compositions, each of the at least two gRNA molecule comprising a targeting domain which is complementary with the genes selected from Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvims, wherein the at least two gRNAs are both not complementary to the same gene selected. In one embodiment, the nucleic acid sequences described herein are encompassed in an expression vector or two.
[0025] In another aspect, the technology herein relates to a composition for use in the of inactivating a herpesvirus in a mammalian cell or for use in treatment of lytic and latent HSV-1 infection and HSV-1 related disease, wherein the composition comprises a nucleic acid sequence encoding a Cas9 nuclease and a nucleic acid sequence encoding at least one gRNA molecule comprising a targeting domain which is complementary with a first target sequence from the Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvims. In some embodiments, there are at least two gRNA molecules being encoded by nucleic acid sequences in the compositions, each of the at least two gRNA molecule comprising a targeting domain which is complementary with the genes selected from Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvims, wherein the at least two gRNAs are both not
complementary to the same gene selected. In one embodiment, the nucleic acid sequences described herein are encompassed in an expression vector or two.
[0026] In another aspect, the technology herein relates to a composition for the manufacture of medicament for use in the of inactivating a herpesvirus in a mammalian cell or for use in treatment of lytic
and latent HSV-1 infection and HSV-1 related disease, wherein the composition comprises a nucleic acid sequence encoding a Cas9 nuclease and a nucleic acid sequence encoding at least one gRNA molecule comprising a targeting domain which is complementary with a first target sequence from the Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus. In some embodiments, there are at least two gRNA molecules being encoded by nucleic acid sequences in the compositions, each of the at least two gRNA molecule comprising a targeting domain which is complementary with the genes selected from Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus, wherein the at least two gRNAs are both not complementary to the same gene selected. In one embodiment, the nucleic acid sequences described herein are encompassed in an expression vector or two.
[0027] Accordingly, in one aspect, the technology herein relates to a composition comprising a vector comprising a nucleic acid sequence encoding a Cas9 nuclease and a nucleic acid sequence encoding at least one gRNA molecule comprising a targeting domain which is complementary with a first target sequence from the Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus. In some embodiments, there are at least two gRNA molecules being encoded by nucleic acid sequences in the compositions, each of the at least two gRNA molecule comprising a targeting domain which is complementary with the genes selected from Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus, wherein the at least two gRNAs are both not complementary to the same gene selected.
[0028] In another aspect, the technology herein relates to a composition for use in the of inactivating a herpesvirus in a mammalian cell or for use in treatment of lytic and latent HSV-1 infection and HSV-1 related disease, wherein the composition comprises a vector comprising a nucleic acid sequence encoding a Cas9 nuclease and a nucleic acid sequence encoding at least one gRNA molecule comprising a targeting domain which is complementary with a first target sequence from the Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus. In some embodiments, there are at least two gRNA molecules being encoded by nucleic acid sequences in the compositions, each of the at least two gRNA molecule comprising a targeting domain which is complementary with the genes selected from Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus, wherein the at least two gRNAs are both not complementary to the same gene selected.
[0029] In another aspect, the technology herein relates to a composition for the manufacture of medicament for use in the of inactivating a herpesvirus in a mammalian cell or for use in treatment of lytic and latent HSV-1 infection and HSV-1 related disease, wherein the composition comprises a vector comprising a nucleic acid sequence encoding a Cas9 nuclease and a nucleic acid sequence encoding at least one gRNA molecule comprising a targeting domain which is complementary with a first target sequence from the Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus. In some embodiments, there are at least two gRNA molecules being encoded by nucleic acid sequences in the compositions, each of the at least two gRNA molecule comprising a targeting domain which is complementary with the genes selected from Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus, wherein the at least two gRNAs are both not complementary to the same gene selected.
[0030] In another aspect, the technology herein relates to a composition comprising: (a) a first gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding Rs 1 or a conserved homolog thereof in the herpesvirus; (b) a second gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL54 or a conserved homolog thereof in the herpesvirus; (c) a third gRNA compnsing a targeting domain which is complementary with a target sequence in a gene encoding UL29 or a conserved homolog thereof in the herpesvirus; and (d) a fourth gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL30 or a conserved homolog thereof in the herpesvirus.
[0031] In another aspect, the technology herein relates to a composition consisting of, or consisting essentially of (a) a first gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding Rsl or a conserved homolog thereof in the herpesvirus; (b) a second gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL54 or a conserved homolog thereof in the herpesvirus; (c) a third gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL29 or a conserved homolog thereof in the herpesvirus; and (d) a fourth gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL30 or a conserved homolog thereof in the herpesvirus.
[0032] In another aspect, the technology herein relates to a composition comprising: (a) a first gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding Rs 1 or a conserved homolog thereof in the herpesvirus; (b) a second gRNA comprising a targeting domain which is complementary with a target sequence in a gene selected from the group consisting of UL54, UL29, and UL30 or a conserved homolog thereof in the herpesvirus; and (c) a third gRNA comprising a targeting domain which is complementary with a target sequence in a gene selected from the group consisting of UL54, UL29, and UL30 or a conserved homolog thereof in the herpesvirus; wherein the selected genes targeted by the second and third gRNAs are not the same.
[0033] In another aspect, the technology herein relates to a composition comprising: (a) a first gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding Rs 1 or a conserved homolog thereof in the herpesvirus; (b) a second gRNA comprising a targeting domain which is complementary with a target sequence in a gene selected from the group consisting of UL54, UL29, and UL30 or a conserved homolog thereof in the herpesvirus.
[0034] In another aspect, the technology herein relates to a method for treating herpesvirus infection or a herpesvirus related disease comprising administering to a subject in need thereof or contacting or introducing to a cell from said subject with a therapeutically effective amount of any one of compositions herein. In one embodiment of any aspects, the cell is contacted with any of the composition described herein. In another embodiment of any aspects, any of the composition described herein is introduced into the cell. In another embodiment of any aspects, the Cas 9/gRNA complex is introduced into the cell. In another embodiment of any aspects, the Cas 9/gRNA complex is made in vitro prior to contact and introduction into the cell. In one embodiment of any aspects, the cell is contacted with any of the nucleic acid sequences encoding a Cas 9 nuclease, or a gRNA described herein, wherein the gRNA comprises a
complementary with a target sequence from the gene Rs 1, UL54, UL29, UL30 or a homolog thereof from the genome of a herpesvirus.
[0035] In another aspect, the technology herein relates to a method of inactivating of a latent herpesvirus in a mammalian cell, the method comprising introducing into the cell, (a) a Cas9 molecule and (b) a first gRNA comprising a targeting domain which is complementary with a target sequence from the gene Rsl, UL54, UL29, UL30 or a homolog thereof and (c) a second gRNA comprising a targeting domain which is complementary with a second target sequence from the gene Rsl, UL54, UL29, UL30 or a homolog thereof; wherein the selected gene targeted by the second gRNA is not the same as the first.
[0036] In another aspect the technology herein relates to a method of inactivating or inhibiting a herpesvirus in a mammalian cell, the method comprising introducing into the cell: (a) a Cas9 molecule; (b) a first gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding Rsl or a conserved homolog thereof in the herpesvirus; (c) a second gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL54 or a conserved homolog thereof in the herpesvirus; (d) a third gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL29 or a conserved homolog thereof in the herpesvirus; and€ a fourth gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL30 or a conserved homolog thereof in the herpesvirus.
[0037] In another aspect, the technology herein relates to a method of inactivating or inhibiting of a latent herpesvirus in a mammalian cell, the method comprising introducing into the cell: (a) a Cas9 molecule; (b) a first gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding Rsl or a conserved homolog thereof in the herpesvirus; (c) a second gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL54 or a conserved homolog thereof in the herpesvirus; (d) a third gRNA comprising a targeting domain which is
complementary with a target sequence in a gene encoding UL29 or a conserved homolog thereof in the herpesvirus; and (e) a fourth gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL30 or a conserved homolog thereof in the herpesvirus.
[0038] In another aspect, the technology herein relates to a method of inactivating or inhibiting of a herpesvirus in a mammalian cell, the method comprising introducing into the cell: (a) a Cas9 molecule; (b) a first gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding Rsl or a conserved homolog thereof in the herpesvirus; (c) a second gRNA comprising a targeting domain which is complementary with a target sequence in a gene selected from the group consisting of UL54, UL29, and UL30 or a conserved homolog thereof in the herpesvirus; and (d) a third gRNA comprising a targeting domain which is complementary with a target sequence in a gene selected from the group consisting of UL54, UL29, and UL30 or a conserved homolog thereof in the herpesvirus; wherein the selected genes targeted by the second and third gRNAs are not the same.
[0039] In another aspect, the technology herein relates to a method of inactivating or inhibiting of a latent herpesvirus in a mammalian cell, the method comprising introducing into the cell: (a) a Cas9 molecule; (b) a first gRNA comprising a targeting domain which is complementary with a target sequence
in a gene encoding Rsl or a conserved homolog thereof in the herpesvirus; (c) a second gRNA comprising a targeting domain which is complementary with a target sequence in a gene selected from the group consisting of UL54, UL29, and UL30 or a conserved homolog thereof in the herpesvirus; and (d) athird gRNA comprising a targeting domain which is complementary with a target sequence in a gene selected from the group consisting of UL54, UL29, and UL30 or a conserved homolog thereof in the herpesvirus; wherein the selected genes targeted by the second and third gRNAs are not the same.
[0040] In another aspect, the technology herein relates to a method of inactivating or inhibiting of a herpesvirus in a mammalian cell, the method comprising introducing into the cell: (a) a Cas9 molecule;
(b) a first gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding Rsl or a conserved homolog thereof in the herpesvirus; and (c) a second gRNA comprising a targeting domain which is complementary with a target sequence in a gene selected from the group consisting of UL54, UL29, and UL30 or a conserved homolog thereof in the herpesvirus.
[0041] In another aspect, the technology herein relates to a method of inactivating or inhibiting of a latent herpesvirus in a mammalian cell, the method comprising introducing into the cell: (a) a Cas9 molecule; (b) a first gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding Rsl or a conserved homolog thereof in the herpesvirus; and (c) a second gRNA comprising a targeting domain which is complementary with a target sequence in a gene selected from the group consisting of UL54, UL29, and UL30 or a conserved homolog thereof in the herpesvirus.
[0042] In another aspect, the technology herein relates to a kit (a) one or a combination of gRNA molecule of the above noted aspects and (b) a Cas9 molecule or a functional fragment thereof
[0043] In another aspect, the technology herein relates to a kit comprising any of the composition described herein.
[0044] In some embodiments of any aspects disclosed herein, the kit further comprises one or more items selected from the group consisting of packaging material, a package insert comprising instructions for use, a sterile fluid, a syringe and a sterile container.
[0045] In some embodiments of any aspects disclosed herein, the gRNA molecule comprises a nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 7, SEQ. ID. NO: 8, SEQ. ID. NO: 49, SEQ. ID. NO: 50, SEQ ID. NO: 51, SEQ. ID. NO: 52, SEQ. ID. NO: 53, SEQ ID. NO: 54, SEQ. ID. NO: 55, SEQ. ID. NO: 56, SEQ. ID NO: 57, SEQ. ID. NO: 58, or SEQ. ID. NO: 59.
[0046] In some embodiments of any aspects disclosed herein, the first gRNA comprises a sequence that is selected from Table 1, Table 2, Table 3, Table 4, or Table 5 and the second gRNA comprises a sequence that is selected from Table 1, Table 2, Table 3, Table 4, or Table 5, wherein the second gRNA sequence is not the same as that of the first gRNA.
[0047] In some embodiments of any aspects disclosed herein, the first gRNA comprises the sequence UL30-1 (SEQ ID NO: 13) or UL30-2 (SEQ ID NO: 14) and the second gRNA compnses the sequence UL29-1 (SEQ ID NO: 11) or UL29-2 (SEQ ID NO: 12).
[0048] In some embodiments of any aspects disclosed herein, the first gRNA comprises the sequence UL30-2 (SEQ ID NO: 14) and the second gRNA comprises the sequence UL29-2 (SEQ ID NO: 12).
[0049] In some embodiments of any aspects disclosed herein, the herpesvirus is herpes simplex virus- 1 (HSV-1).
[0050] In some embodiments of any aspects disclosed herein, the introducing step comprises introducing into the cell a vector that encodes for one or combination of a Cas 9 molecule, a first gRNA, and a second gRNA. In some embodiments of the method, the introducing step comprises introducing into the cell one or more nucleic acid sequences that encode for one or combination of a Cas 9 molecule, a first gRNA, and a second gRNA. In some embodiments of the method, the vector is a viral vector. In some embodiments of the method, the viral vector is selected from the group; retrovirus, lentivirus, adenovirus, herpesvirus, poxvirus, alpha virus, vaccinia virus, and adeno-associated viruses.
[0051] In some embodiments of any aspects disclosed herein, the vector is a non-viral vector. In some embodiments of the method, the non-viral vector is selected from the group consisting of a nanoparticle, a cationic lipid, a cationic polymer, a metallic nanoparticle, a nanorod, a liposome, microbubbles, a cell penetrating peptide and a liposphere. In some embodiments of the method, the non- viral vector comprises poly ethelenegly col.
[0052] In some embodiments of any aspects disclosed herein, the introducing step comprises introducing a complex of Cas9 molecule and one or both of the first gRNA and the second gRNA.
[0053] In some embodiments of of any aspects disclosed herein, the Cas9 molecule comprises a sequence of SEQ ID NO: 1 or SEQ ID NO: 2 or a functional fragment thereof.
[0054] In some embodiments of any aspects disclosed herein, the introducing results in genetic modifications/alterations of the target sequence in the genome of the herpesvirus. In some embodiments of any aspects disclosed herein, the alteration is a mutation selected from the group consisting of a deletion, an insertion, or a point mutation. In some embodiments, the alteration results in inactivation of viral gene expression, viral replication or viral reactivation. In some embodiments, the inactivation is in vivo or ex vivo.
[0055] In some embodiments of any aspects disclosed herein, the cell comprises a cultured cell, a tissue explant extracted from, or a cell line derived from a subject having a herpesvirus infection. In some embodiments of any aspects disclosed herein, the mammalian cell is a sensory neuron.
[0056] In some embodiments of any aspects disclosed herein, the methods are used in the treatment of herpesvirus infection or a herpesvirus related disease. In some embodiments, the herpesvirus related disease is selected from the group consisting of genital herpes, HSV gingivostomatitis and recurrent herpes labialis, HSV keratitis or keratoconjunctivitis, meningitis or herpes simplex encephalitis (HSE).
[0057] In some embodiments of any aspects disclosed herein, the gRNA targeting domain is complementary with a target domain from the UL29 gene or a conserved homolog thereof in the herepesvirus. In some embodiments, the gRNA molecule compnses a nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 11, SEQ. ID. NO: 12, SEQ. ID. NO: 26, SEQ. ID. NO: 27, SEQ. ID.
NO: 28, SEQ. ID. NO: 29, SEQ ID. NO: 30, SEQ. ID. NO: 31, SEQ. ID. NO: 32, SEQ ID. NO: 33, SEQ. ID. NO: 34, SEQ. ID. NO: 35 or SEQ. ID. NO: 36.
[0058] In some embodiments of any aspects disclosed herein, the gRNA targeting domain is complementary with a target domain from the UL30 gene or a conserved homolog thereof in the herepesvirus. In some embodiments of any aspects disclosed herein, the gRNA molecule comprises a nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 13, SEQ. ID. NO: 14, SEQ. ID. NO: 15, SEQ. ID. NO: 16, SEQ ID. NO: 17, SEQ. ID. NO: 18, SEQ. ID. NO: 19, SEQ ID. NO: 20, SEQ. ID. NO: 21, SEQ. ID. NO: 22, SEQ. ID NO: 23, SEQ. ID. NO: 24 or SEQ. ID. NO: 25.
[0059] In some embodiments of any aspects disclosed herein, the gRNA targeting domain is complementary with a target domain from the UL54 gene or a conserved homolog thereof in the herepesvirus.
[0060] In some embodiments of any aspects disclosed herein, the gRNA molecule comprises a nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 9, SEQ. ID. NO: 10, SEQ. ID. NO: 37, SEQ. ID. NO: 38, SEQ ID. NO: 39, SEQ. ID. NO: 40, SEQ. ID. NO: 41, SEQ ID. NO: 42, SEQ. ID. NO: 43, SEQ. ID. NO: 44, SEQ. ID NO: 45, SEQ. ID. NO: 46, SEQ. ID. NO: 47 or SEQ. ID. NO: 48.
[0061] In some embodiments of any aspects disclosed herein, the composition further comprising a second gRNA molecule comprising a targeting domain which is complementary with a second target sequence from the Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus; wherein the selected genes targeted by the first and second gRNAs are not the same. In some embodiments, the composition further comprising a third gRNA molecule comprising a targeting domain which is complementary with a third target sequence from the Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus; wherein the selected genes targeted by the first, second and third gRNAs are not the same. In some embodiments, the composition a fourth gRNA molecule comprising a targeting domain which is complementary with a fourth target sequence from the Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus; wherein the selected genes targeted by the first, second, third and fourth gRNAs are not the same.
[0062] In some embodiments of any aspects disclosed herein, the gRNA comprising a targeting domain which is complementary to the target sequence of Rsl comprises nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 7, SEQ. ID. NO: 8, SEQ. ID. NO: 49, SEQ. ID. NO: 50, SEQ. ID. NO: 51, SEQ. ID. NO: 52, SEQ. ID NO: 53, SEQ. ID. NO: 54, SEQ. ID. NO: 55, SEQ. ID. NO: 56, SEQ. ID. NO: 57, SEQ. ID. NO: 58, or SEQ. ID. NO: 59.
[0063] In some embodiments, of any aspects disclosed herein the gRNA comprising a targeting domain which is complementary to the target sequence of UL29 comprises nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 11, SEQ. ID. NO: 12, SEQ. ID. NO: 26, SEQ. ID. NO: 27, SEQ. ID. NO: 28, SEQ. ID. NO: 29, SEQ. ID. NO: 30, SEQ. ID NO: 31, SEQ. ID. NO: 32, SEQ. ID. NO: 33, SEQ. ID. NO: 34, SEQ. ID NO: 35 or SEQ. ID. NO: 36.
[0064] In some embodiments of any aspects disclosed herein, the gRNA comprising a targeting domain which is complementary to the target sequence of UL30 comprises nucleic acid sequence selected
from the group consisting of SEQ. ID. NO: 13, SEQ. ID. NO: 14, SEQ. ID. NO: 15, SEQ. ID. NO: 16, SEQ. ID. NO: 17, SEQ. ID. NO: 18, SEQ. ID. NO: 19, SEQ. ID NO: 20, SEQ. ID. NO: 21, SEQ. ID. NO: 22, SEQ. ID. NO: 23, SEQ. ID. NO: 24 or SEQ. ID. NO: 25.
[0065] In some embodiments of any aspects disclosed herein, the gRNA comprising a targeting domain which is complementary to the target sequence of UL54 comprises nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 9, SEQ. ID. NO: 10, SEQ. ID. NO: 37, SEQ. ID. NO: 38, SEQ. ID. NO: 39, SEQ. ID. NO: 40, SEQ. ID NO: 41, SEQ. ID. NO: 42, SEQ. ID. NO: 43, SEQ. ID. NO: 44, SEQ. ID. NO: 45, SEQ. ID. NO: 46, SEQ. ID. NO: 47 OR SEQ. ID. NO: 48.
[0066] In some embodiments of any aspects disclosed herein, the composition further comprises a
Cas9 molecule. In some embodiments, the Cas9 molecule and gRNAs are introduced as a complex. In some embodiments, the Cas9 molecule and the gRNAs are introduced into the cell by one or more vectors comprising nucleic acid sequences that encode Cas9, and the respective gRNAs.
[0067] In some embodiments of any aspects disclosed herein, the composition can comprise of a third or a fourth gRNA, wherein the third and fourth gRNAs comprisesa targeting domains which are complementary with a second target sequence from the gene Rs 1, UL54, UL29, UL30 or a homolog thereof; wherein the selected gene targeted by the first, second, third, and fourth gRNAs are different.
[0068] In some embodiments of the above noted aspects, the gRNA targeting Rsl comprising a nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 7, SEQ. ID. NO: 8, SEQ. ID. NO: 49, SEQ. ID. NO: 50, SEQ ID. NO: 51, SEQ. ID. NO: 52, SEQ. ID. NO: 53, SEQ ID. NO: 54, SEQ. ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, or SEQ ID NO: 5
[0069] In some embodiments of the above noted aspects, the gRNA targeting UL54 comprising a nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 9, SEQ. ID. NO: 10, SEQ. ID. NO: 37, SEQ. ID. NO: 38, SEQ ID. NO: 39, SEQ. ID. NO: 40, SEQ. ID. NO: 41, SEQ ID. NO: 42, SEQ. ID. NO: 43, SEQ. ID. NO: 44, SEQ. ID NO: 45, SEQ. ID. NO: 46, SEQ. ID. NO: 47 or SEQ. ID. NO: 48.
[0070] In some embodiments of the above noted aspects, the gRNA targeting UL29 comprising a nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 11, SEQ. ID. NO: 12, SEQ. ID. NO: 26, SEQ. ID. NO: 27, SEQ ID. NO: 28, SEQ. ID. NO: 29, SEQ. ID. NO: 30, SEQ ID. NO: 31, SEQ. ID. NO: 32, SEQ. ID. NO: 33, SEQ. ID NO: 34, SEQ. ID. NO: 35 or SEQ. ID. NO: 36.
[0071] In some embodiments of the above noted aspects, the first gRNA targeting UL30 comprising a nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 13, SEQ. ID. NO: 14, SEQ. ID. NO: 15, SEQ. ID. NO: 16, SEQ. ID. NO: 17, SEQ. ID. NO: 18, SEQ. ID NO: 19, SEQ. ID. NO: 20, SEQ. ID. NO: 21, SEQ ID. NO: 22, SEQ. ID. NO: 23, SEQ. ID. NO: 24 or SEQ. ID. NO: 25.
[0072] In some embodiments of the above noted aspects, the Cas9 molecule and the gRNAs are introduced into the cell by one or more vectors comprising nucleic acid sequences that encode the Cas9, and the respective gRNAs.
[0073] In another aspect, the technology herein relates to the gRNA molecule described in the aspects above or a combination thereof for use in treating HSV-1 infection and related diseases in a subject. Definitions
[0074] Unless stated otherwise, or implicit from context, the following terms and phrases include the meanings provided below. Unless explicitly stated otherwise, or apparent from context, the terms and phrases below do not exclude the meaning that the term or phrase has acquired in the art to which it pertains. The definitions are provided to aid in describing particular embodiments, and are not intended to limit the claimed disclosure, because the scope of the disclosure is limited only by the claims. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.
[0075] As used herein the term "comprising" or "comprises" is used in reference to compositions, methods, and respective component(s) thereof, that are useful to an embodiment, yet open to the inclusion of unspecified elements, whether useful or not.
[0076] The term "consisting of refers to compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.
[0077] As used herein the term "consisting essentially of refers to those elements required for a given embodiment. The term permits the presence of elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment of the disclosure.
[0078] The terms "disease", "disorder", or "condition" are used interchangeably herein, refer to any alternation in state of the body or of some of the organs, interrupting or disturbing the performance of the functions and/or causing symptoms such as discomfort, dysfunction, distress, or even death to the person afflicted or those in contact with a person. A disease or disorder can also be related to a distemper, ailing, ailment, malady, disorder, sickness, illness, complaint, or affectation
[0079] As used herein the term "in need thereof means having an infection, being diagnosed with an infection, or being in need of preventing an infection, e.g., for one at risk of developing and/or contracting an infection. A subject in need thereof can be a subject in need of treating or preventing an infection.
[0080] As used herein, the term "administering," refers to the placement of a composition as disclosed herein into a subject by a method or route which results in at least partial delivery of the composition at a desired site. Pharmaceutical compositions disclosed herein can be administered by any appropriate route which results in an effective treatment in the subject, e.g. intracerebroventricular administration, intranasal administration, intracranial administration, intracelial administration, intracerebellar administration, or intrathecal administration
[0081] As used herein, a "subject", "patient", "individual" and like terms are used interchangeably and refers to a vertebrate, preferably a mammal, more preferably a primate, still more preferably a human. Mammals include, without limitation, humans, primates, rodents, wild or domesticated animals, including feral animals, farm animals, sport animals, and pets. Primates include, for example, chimpanzees, cynomologous monkeys, spider monkeys, and macaques, e.g., Rhesus. Rodents include, for example, mice, rats, woodchucks, ferrets, rabbits and hamsters. Domestic and game animals include, for example, cows, horses, pigs, deer, bison, buffalo, feline species, e.g., domestic cat, and canine species, e.g., dog, fox, wolf,
avian species, e.g., chicken, emu, ostrich, and fish, e.g., trout, catfish and salmon. The terms, "individual," "patient" and "subject" are used interchangeably herein. A subject can be male or female.
[0082] In one embodiment of any aspect described herein, the subject is a mammal. The mammal can be a human, non-human primate, mouse, rat, dog, cat, horse, or cow, but is not limited to these examples. Mammals other than humans can be advantageously used as subjects that represent animal models of conditions or disorders associated with herpesvirus.
[0083] In one embodiment of any aspect described herein, the subject is one who has been previously diagnosed with or identified as suffering from or under medical supervision for a herpesvirus infection. In one embodiment, the herpesvirus infection is HSV-1 infection.
[0084] In one embodiment of any aspect described herein, the subject is one who is diagnosed and currently being treated for, or seeking treatment, monitoring, adjustment or modification of an existing therapeutic treatment, or is at a risk of developing a herpesvirus infection. In one embodiment, the herpesvirus infection is HSV-1 infection.
[0085] The term "herpesvirus infection" can be used interchangeably with "herpesvirus disease" refers to the undesired proliferation or presence of invasion of herpesvirus (e.g., HSV-1) in a host organism. In some embodiments, the infection can be caused by actively replicating lytic herpesvirus and can be referred to as lytic infection. Such an infection is usually symptomatic. In some embodiments, the infection can be caused by quiescent or latent herpesvirus and can be referred to as latent infection. Such an infection is usually asymptomatic. A latent viral infection can reactivate to become a lytic viral infection and can result in recurrence of active symptomatic herpesvirus related disease.
[0086] As used herein, the terms "protein", "peptide" and "polypeptide" are used interchangeably to designate a series of amino acid residues connected to each other by peptide bonds between the alpha- amino and carboxy groups of adjacent residues. The terms "protein", "peptide" and "polypeptide" refer to a polymer of amino acids, including modified amino acids (e.g., phosphorylated, glycated, glycosylated, etc.) and amino acid analogs, regardless of its size or function. "Protein" and "polypeptide" are often used in reference to relatively large polypeptides, whereas the term "peptide" is often used in reference to small polypeptides, but usage of these terms in the art overlaps. The terms "protein", "peptide" and "polypeptide" are used interchangeably herein when referring to a gene product and fragments thereof.
[0087] As used here, the term "pharmaceutically acceptable" refers to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
[0088] As used here, the term "pharmaceutically acceptable carrier" means a pharmaceutically- acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid or solvent encapsulating material necessary or used in formulating an active ingredient or agent for delivery to a subject. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient.
[0089] An effective amount of any composition provided herein can be administered to an individual in need of treatment. The term "effective" as used herein refers to any amount that induces a desired response while not inducing significant toxicity in the patient. Such an amount can be determined by assessing a patient's response after administration of a known amount of a particular composition. In addition, the level of toxicity, if any, can be determined by assessing a patient's clinical symptoms before and after administering a known amount of a particular composition. It is noted that the effective amount of a particular composition administered to a patient can be adjusted according to a desired outcome as well as the patient's response and level of toxicity. Significant toxicity can vary for each particular patient and depends on multiple factors including, without limitation, the patient's disease state, age, and tolerance to side effects.
[0090] Determination of an "effective amount" is well within the capability of those skilled in the art. Generally, an "effective amount "can vary with the subject's history, age, condition, sex, as well as the severity and type of the microbial infection in the subject, and administration of other pharmaceutically active agents. Furthermore, therapeutically effective amounts will vary, as recognized by those skilled in the art, depending on the specific infection treated, the route of administration, the excipient selected, and the possibility of combination therapy.
[0091] A gRNA molecule, as that term is used herein, refers to a nucleic acid that promotes the specific targeting or homing of a gRNA molecule/Cas9 molecule complex to a target nucleic acid. gRNA molecules can be unimolecular (having a single RNA molecule), sometimes referred to herein as "chimeric" gRNAs, or modular (comprising more than one, and typically two, separate RNA molecules). Non-limiting exemplary gRNAs comprises the nucleic acid sequences described in Table 1-5.
[0092] A "targeting domain" as the used herein refers to, a nucleotide sequence that is complementary, e.g., at least 80, 85, 90, or 95% complementary, e.g., fully complementary, to the target sequence on the target nucleic acid. The targeting domain is part of an RNA molecule and will therefore comprise the base uracil (U), while any DNA encoding the gRNA molecule will comprise the base thymine (T). While not wishing to be bound by theory, it is believed that the complementarity of the targeting domain with the target sequence contributes to specificity of the interaction of the gRNA molecule/Cas9 molecule complex with a target nucleic acid. It is understood that in a targeting domain-target sequence pair, the uracil bases in the targeting domain will pair with the adenine bases in the target sequence. In one embodiment of any aspect described herein, the target domain itself comprises, in the 5' to 3' direction, an optional secondary domain, and a core domain. In one embodiment, the core domain is fully
complementary with the target sequence. In one embodiment, the targeting domain is 5 to 50, 10 to 40, 10 to 30, 15 to 30, or 15 to 25 nucleotides in length. In one embodiment, the targeting domain is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides in length. The strand of the target nucleic acid with which the targeting domain is complementary is referred to herein as the complementary strand. Some or all of the nucleotides of the target domain can have a modification.
[0093] In one embodiment of any aspect described herein, the "targeting domain" of the gRNA is complementary to the "target sequence" on the target nucleic acid sequence. Guidance on the selection of
targeting domains can be found, e.g., in Fu Y el al. NAT BIOTECHNOL 2014 (doi: 10.1038/nbt.2808) and Sternberg SH el a/.. NATURE 2014 (doi: 10. 1038/naturel301 1). Typically the targeting domain has full complementarity with the target sequence. In some embodiments, the targeting domain has or includes 1 , 2, 3, 4, .5, 6, 7 or 8 nucleotides that are not complementary with the corresponding nucleotide of the targeting domain. In an embodiment, the degree of complementarity, together with other properties of the gRNA, is sufficient to allow targeting of a Cas9 molecule to the target nucleic acid.
[0094] As used herein, the term "in combination" refers to the use of more than one gRNA simultaneously or sequentially and in a manner such that their respective effects are additive or synergistic. A combination of gRNAs can be, for example, a first gRNA and a second gRNA. In some embodiments, the first gRNA is a gRNA comprising a targeting domain which is complementary with a target sequence from the gene Rsl (SEQ ID NO: 3), UL54 (SEQ ID NO: 4), UL29 (SEQ ID NO: 5), UL30 (SEQ ID NO: 6) or a conserved variant thereof. The second gRNA is a gRNA comprising a targeting domain which is complementary with a second target sequence from the gene Rsl (SEQ ID NO: 3), UL54 (SEQ ID NO: 4), UL29 (SEQ ID NO: 5), UL30 (SEQ ID NO: 6) or a homolog thereof.
[0095] "Domain", as used herein, is used to describe segments of a protein or nucleic acid.
[0096] Unless otherwise indicated, a domain is not required to have any specific functional property. Calculations of homology or sequence identity between two sequences (the terms are used interchangeably herein) are performed as follows. The sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes) The optimal alignment is determined as the best score using the GAP program in the GCG software package with a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frame shift gap penalty of 5. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences.
[0097] In one embodiment of any aspect described herein, as used herein, the term "target sequence" refers to a nucleic acid sequence within the viral genome which comprises a sequence to which the targeting domain of the gRNA hybridizes. The target seuqnece can be, for example, a sequence within coding region of genes Rsl (SEQ ID NO: 3), UL54 (SEQ ID NO: 4), UL29 (SEQ ID NO: 5), UL30 (SEQ ID NO: 6) or a conserved variant thereof. The target sequence can be for example in the coding region or a non-coding region of the genome.
[0098] As used herein, the terms "nucleic acid" and "polynucleotide" interchangeably to refer to both RNA and DNA, including eDNA, genomic DNA, synthetic DNA, and DNA (or RNA) containing nucleic acid analogs, any of which may encode a polypeptide of the disclosure and all of which are encompassed by the disclosure. Polynucleotides can have essentially any three dimensional structure. A nucleic acid can be double-stranded or single-stranded (i.e., a sense strand or an antisense strand). Non-
limiting examples of polynucleotides include genes, gene fragments, exons, introns, messenger RNA (mRNA) and portions thereof, transfer RNA, ribosomal RNA, siRNA, micro-RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers, as well as nucleic acid analogs. In the context of the present disclosure, nucleic acids can encode a fragment of a naturally occurring Cas9 or a biologically active variant thereof and a gRNA where in the gRNA is complementary to a sequence in herpesvirus genome (e.g. HSV-1 genome).
[0099] As used herein, an "isolated" nucleic acid can be, for example, a naturally-occurring DNA molecule or a fragment thereof, provided that at least one of the nucleic acid sequences normally found immediately flanking that DNA molecule in a naturally-occurring genome is removed or absent. Thus, an isolated nucleic acid includes, without limitation, a DNA molecule that exists as a separate molecule, independent of other sequences (e.g., a chemically synthesized nucleic acid, or a cDNA or genomic DNA fragment produced by the polymerase chain reaction (PCR) or restriction endonuclease treatment). An isolated nucleic acid also refers to a DNA molecule that is incorporated into a vector, an autonomously replicating plasmid, a virus, or into the genomic DNA of a prokaryote or eukaryote. In addition, an isolated nucleic acid can include an engineered nucleic acid such as a DNA molecule that is part of a hybrid or fusion nucleic acid. A nucleic acid existing among many (e.g., dozens, or hundreds to millions) of other nucleic acids within, for example, cDNA libraries or genomic libraries, or gel slices containing a genomic DNA restriction digest, is not an isolated nucleic acid.
[0100] The terms "increased" 'increase", or "enhance" are all used herein to generally mean an increase by a statically significant amount; for the avoidance of doubt, the terms "increased", "increase", or "enhance", mean an increase of at least 10% as compared to a reference level, for example an increase of at least about 10%, at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, or at least about a 2- fold, or at least about a 3 -fold, or at least about a 4-fold, or at least about a 5 -fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater as compared to a reference level.
[0101] The terms, "decrease", "reduce", "reduction", "lower" or "lowering," or "inhibit" are all used herein generally to mean a decrease by a statistically significant amount. For example, "decrease", "reduce", "reduction", or "inhibit" means a decrease by at least 10% as compared to a reference level, for example a decrease by at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% decrease (e.g. absent level or non-detectable level as compared to a reference level), or any decrease between 10-100% as compared to a reference level. In the context of a marker or symptom, by these terms is meant a statistically significant decrease in such level. The decrease can be, for example, at least 10%, at least 20%, at least 30%, at least 40% or more, and is preferably down to a level accepted as within the range of normal for an individual without a given microbial infection or microbial disease.
[0102] In one embodiment of any aspect described herein, the inactivation of the lytic or latent herpesvirus in the host is at least 10% compared to control which is an absence of Cas9/gRNA or a non- targeting gRNA.
[0103] In one embodiment of any aspect described herein, the inactivation of the lytic or latent herpesvirus in the host means at leash 10% reduction in the protein expression of the genes sl, UL30, UL29, or UL54, depending on the target sequence of the gRNA used.
[0104] The term "anti-viral agent" refers to an agent is an agent that prevents, inhibits, slows, or reduces the growth and proliferation of a virus (e.g. herpesvirus). The "agent" can be a small molecule chemical compound, antibody, nucleic acid molecule, or polypeptide, or fragments thereof.
BRIEF DESCRIPTION OF THE DRAWINGS
[0105] Fig. 1 shows SpCas9/gRNA-catalyzed cleavage of HSV DNA fragments in vitro.
[0106] Figs. 2A-2D show effect of CRISPR/Cas9 on HSV lytic infection.
[0107] Fig. 2A shows the experimental scheme of Cas9/gRNA-mediated inhibition of HSV lytic infection.
[0108] Fig. 2B shows protein immunoblots of various proteins expressed in HFFs transduced with lentivirus expressing Cas9 and gRNA were infected with HSV-1 at and MOI of 5 and harvested at 10 hpi. Proteins were detected using immunoblotting with antibodies specific for the indicated proteins. Three SDS-PAGE gels loaded with the same amount of proteins were used to detect multiple proteins.
Immunoblots of GAPDH were shown as a control under the individual immunoblots. Transduction with Cas 9 and gRNA targeting UL30 reduced the expression of UL30. Transduction with Cas 9 and gRNA targeting UL54 reduced the expression of ICP27. Transduction with Cas 9 and gRNA targeting UL29 reduced the expression of ICP8. Transduction with Cas 9 and gRNA targeting Rsl reduced the expression ofICP4.
[0109] Figs. 2C and 2D show histograms demonstrating the effects of the various Cas9/gRNAs on the HSV-1 infection in infected cells. Single gRNAs and combinations of two different gRNAs targeting two distinct genes are used in the gene editing. The output effect is scored as plague forming units/ mL produced after HFFs were transduced with lentivirus expressing Cas9 and gRNAs. Two groups of the HFFs were tested; HFFs infected with HSV-1 at and MOI of 0.1 (left) or 5 (right), harvested at 48 hpi or 24 hpi respectively. Viral yields were determined by plaque assays. The histogram shows the mean values and standard error from three (at an MOI of 0.1) or four (at an MOI of 5) independent experiments.
[0110] Figs. 3A-3B show the effect of CRISPR Cas9 on reactivation of HSV quiescent infection.
[0111] Fig. 3 A shows the experimental scheme of Cas9/gRNA-mediated inhibition of reactivation of quiescent dl09 genomes in HFFs.
[0112] Fig. 3B shows two histograms demonstrating the effects of the Cas9/gRNAs on the HSV-1 quiescent infection in infected cells. HFF were infected with dl09 to establish quiescent infection for 7-10 days and transduced with lentivirus expressing Cas9 and gRNAs for 7-10 days. To reactivate quiescent dl09 genomes, HFFs were superinfected with wild-type HSV-1 at an MOI of 5 and harvested at 24 hpi.
GFP-positive viral yields were determined by plaque assays on F06 and V27 cells. The histogram shows the mean values and standard error from two independent experiments.
[0113] Figs. 4A-4D show that CRIPSR/Cas9-driven mutations at gRNA target sites on quiescent dl09 genomes. HFFs were infected with dl09 to establish quiescent infection for 7-10 days and transduced with lentivirus expressing Cas9 and gRNAs for 7-10 days.
[0114] Fig. 4A is a histogram showing the indel mutation frequencies at the indicated gRNA targeting sites.
[0115] Fig. 4B are exemplary of sequences (SEQ ID NOS 65, 65, 66, 67, 67, 68, 69, 70, 71, 72, and 72, respectively, in order of appearance) that show mutations. Target sequence is boxed.
[0116] Figs. 4C and 4D show indel mutation frequencies are shown at the indicated single or two gRNA targeting sties in two independent experiments.
[0117] Fig. 5A shows shows protein immunoblots of various proteins expressed in HFFs transduced with lentivirus expressing Cas9 and gRNA were infected with HSV-1 at and MOI of 3 with or without phosphonoacetate (PAA), and harvested at 10 hpi. Proteins were detected using immunoblotting with antibodies specific for the indicated proteins. Three SDS-PAGE gels loaded with the same amount of proteins were used to detect multiple proteins. Immunoblots of GAPDH were shown as a control under the individual immunoblots.
[0118] Fig. 5B shows the kinetics of CRIPSR/Cas9-induced mutations at gRNA target sites with or without HSV replication. HFFs transduced with lentivirus expressing Cas9 and gRNA were infected with HSV-1 at and MOI of 3 with or without phosphonoacetate (PAA) and harvested at the indicated time post infection. Indel mutation frequencies are shown at the indicated time post infection at the gRNA targeting sites.
[0119] Figs. 6A-6D show the effect of CRISPR/Cas9 on input and replicating HSV genome.
HFFs transduced with lentivirus expressing Cas9 and gRNA were infected with HSV-1 at an MOI of 3 with (Fig. 6A and Fig. 6B) or without (Fig. 6C and Fig. 6D) phosphonoacetate (PAA) and harvested at the indicated time post infection. The accumulated DNAs were detected by real time PCR amplifying in the UL29 gene (Fig. 6A and Fig. 6C) or over the UL30-2 gRNA (Fig. 6B and Fig. 6D) targeting site.
DETAILED DESCRIPTION
[0120] Definitions of common terms in cell biology and molecular biology can be found in "The
Merck Manual of Diagnosis and Therapy", 19th Edition, published by Merck Research Laboratories, 2006 (ISBN 0-911910-19-0); Robert S Porter et al (eds ), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); Immunology by Werner Luttmann, published by Elsevier, 2006. Definitions of common terms in molecular biology can also be found in Benjamin Lewin, Genes X, published by Jones & Bartlett Publishing, 2009 (ISBN- 10: 0763766321); Kendrew et al. (eds.), , Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8) and Current Protocols in Protein Sciences 2009, Wiley Intersciences, Coligan et al., eds.
[0121] Unless otherwise stated, the present disclosure was performed using standard procedures of virology, microbiology, molecular biology and recombinant DNA techniques within the skill of the art, as described, for example in Sambrook et al., Molecular Cloning: A Laboratory Manual (3 ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (2001); Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (1995); Current Protocols in Protein Science (CPPS) (John E. Coligan, et. al., ed., John Wiley and Sons, Inc.), Current Protocols in Cell Biology (CPCB) (Juan S. Bonifacino et. al. ed., John Wiley and Sons, Inc.), and Culture of Animal Cells: A Manual of Basic Technique by R. Ian Freshney, Publisher: Wiley-Liss; 5th edition (2005), Animal Cell Culture Methods (Methods in Cell Biology, Vol. 57, Jennie P. Mather and David Barnes editors, Academic Press, 1st edition, 1998) which are all incorporated by reference herein in their entireties.
[0122] Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood as modified in all instances by the term "about." The term "about" when used in connection with percentages may mean ±1% of the value being referred to. For example, about 100 means from 99 to 101.
[0123] Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described below. The term "comprises" means "includes." The abbreviation, "e.g." is derived from the Latin exempli gratia, and is used herein to indicate a non-limiting example. Thus, the abbreviation "e.g." is synonymous with the term "for example."
[0124] As used in this specification and appended claims, the singular forms "a," "an", and "the" include plural references unless the context clearly dictates otherwise. Thus for example, reference to "the method" included one or more methods, and/or steps of the type described herein and/or which will become apparent to those persons skilled in the art upon reading this disclosure and so forth.
[0125] In this application and the claims, the use of the singular includes the plural unless specifically stated otherwise. In addition, use of "or" means "and/or" unless stated otherwise. Moreover, the use of the term "including", as well as other forms, such as "includes" and "included", is not limiting. Also, terms such as "element" or "component" encompass both elements and components comprising one unit and elements and components that comprise more than one unit unless specifically stated otherwise.lt is understood that the foregoing detailed description and the following examples are illustrative only and are not to be taken as limitations upon the scope of the disclosure. Various changes and modifications to the disclosed embodiments, which will be apparent to those of skill in the art, may be made without departing from the spirit and scope of the disclosure. Further, all patents and other publications; including literature references, issued patents, published patent applications, and co-pending patent applications; cited throughout this application are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the technology described herein. These publications are provided solely for their disclosure pnor to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior disclosure or for any other reason.
All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.
[0126] The present disclosure is based, in part, on the use of CRISPR/Cas9 system to efficiently target lytic and latent HSV genomes, thereby inhibiting HSV lytic replication as well as reactivation of quiescent HSV-1. The results demonstrate that combination of two gRNAs can synergistically enhance the inhibitory effect of CRISPR/Cas9 system on HSV lytic replication and reactivation of latent HSV-1.
Accordingly, the disclosure features compositions comprising (a) a nucleic acid sequence that encodes a CRISPR-associated endonuclease and (b) a nucleic acid sequence that encodes one or a combination of several guide RNAs that is complementary to target sequences in herpesvirus. Also featured herein are compositions comprising a CRISPR-associated endonuclease polypeptide and one or a combination of several guide RNAs that are complementary to target sequences in herpesvirus. Also featured herein are methods of inactivating latent and lytic herpesvirus, and methods of treatment of herpesvirus infection and herpesvirus related disease. The inventors disclosed novel therapeutic guide RNAs, nucleic acid sequences, and combinations thereof, further comprised in an expression vector, for use in methods and compositions described herein. In one aspect, the present disclosure is related to compositions and methods for the inactivation of replicating and latent HSV-1 virus and treatment of lytic and latent HSV-1 infection and HSV-1 related disease. In some embodiments, the target sequences in herpesvirus are the genomic sequences of the genes Rsl, UL29, UL30, UL54. By disrupting these genes at the genomic level, by gene editing, this prevents the expression of these genes, prevents the reactivation of the inactive, latent virus, and also inhibits the lytic replication of the virus.
Herpesvirus
[0127] Infection and related diseases - The Herpesviridae comprises a large family of DNA viruses and include herpes simplex virus- 1 (HSV-1), herpes simplex virus-2 (HSV-2), varicella zoster virus, Epstein-Barr virus, cytomegalovirus, human herpesvirus 6, human herpesvirus 7, and Kaposi's sarcoma- associated herpesvirus. Herpesvirus, once acquired remain with the host for life, and in case of HSV-1 and HSV-2, typically remain latent in the form of stable dsDNA episome in the nuclei of sensory neurons. During latent infection of a cell, HSVs express Latency Associated Transcript (LAT) RNA. LAT regulates the host cell genome and interferes with natural cell death mechanisms. By maintaining the host cells, LAT expression preserves a reservoir of the virus, which allows subsequent reactivation, usually symptomatic, periodic recurrences or "outbreaks". Whether or not recurrences are symptomatic, viral shedding occurs to infect a new host cells or host. No effective therapies for latent herpesvirus infection are currently available. Accordingly in some embodiments the compositions and methods disclosed herein can be used to inactivate lytic herpesvirus in a mammalian cell. In some embodiments the compositions and methods disclosed herein can be used to inactivate latent herpesvirus in a mammalian cell. In some embodiments, the methods and compositions disclosed herein can be used to inhibit lytic herpesvirus infection. In some embodiments, the methods and compositions disclosed herein can be used to inhibit reactivation of latent herpesvirus genome. In some embodiments, the methods and composition disclosed herein can be used to treat a lytic
herepesvirus infection. In some embodiments, the methods and composition disclosed herein can be used to treat a latent herpesvirus infection. In one embodiment of any aspect is this disclosure, the herpesvirus is HSV-1 and herpesvirus infection is HSV-1 infection.
[0128] HSV-1 generally causes painful blistering of the mucous membranes of the lips and mouth.
During primary infection, the virus most often infects cells of the oropharynx and 5 ana-genital region, causing painful vesicles in the affected region. Reactivation of HSV -1 infection most often occurs in the oropharynx and ana-genital region. However, reactivation infections of the eye and central nervous system are the most severe and damaging HSV manifestations, as they can lead to blindness and permanent neurologic disability, respectively. Mucocutaneous infections are the most common clinical manifestations of HSV-1 and 2. Gingivostomatitis, which is usually caused by HSV-1, occurs most frequently in children less than five years of age. Genital herpes is most frequently caused by HSV-2 but an ever increasing number of cases are attributed to HSV-1. Herpes simplex keratitis is usually caused by HSV-1 and is accompanied by conjunctivitis in many cases. It is considered the most common infectious cause of blindness in the United States. HSV infections can manifest at any skin site. Common among health care workers are lesions on abraded skin of the fingers, known as herpetic whitlows. Manifestations of neonatal herpes simplex virus infection can be divided into three categories: 1) skin, eye and mouth disease; 2) encephalitis; and 3) disseminated infection. As the name implies, skin, eye and mouth disease consists of cutaneous lesions and does not involve other organ systems. Involvement of the central nervous system may occur with encephalitis or disseminated infection, and generally results in diffuse encephalitis.
Disseminated infection involves multiple organ systems and can produce disseminated intravascular coagulation, hemorrhagic pneumonitis, encephalitis, and cutaneous lesions. Herpes simplex encephalitis is characterized by hemorrhagic necrosis of the inferiomedial portion of the temporal lobe. Disease begins unilaterally, and then spreads to the contralateral temporal lobe. Clinical manifestations of herpes simplex encephalitis include headache, fever, altered consciousness, and abnormalities of speech and behavior. Focal seizures may also occur. HSV infections in the immunocompromised host are clinically more severe, may be progressive, and require more time for healing. Manifestations of HSV infections in this patient population include pneumonitis, esophagitis, hepatitis, colitis, and disseminated cutaneous disease.
Individuals suffering from human immunodeficiency virus infection may have extensive perineal or orofacial ulcerations. HSV infections are also noted to be of increased severity in individuals who are burned. In some embodiments, the methods and compositions of the present disclosure can be used for treatment and prevention of herpesvirus related diseases. In some embodiments, the herpesvirus related disease can be genital herpes, HSV gingivostomatitis and recurrent herpes labialis, HSV keratitis or keratoconjunctivitis, meningitis or Herpes simplex encephalitis (HSE).
Compositions:
[0129] Embodiments of the methods and compositions of the present disclosure use the
CRISPR Cas technology and specifically designed gRNAs that target specific target sequences of selected genes to cause genetic modification in the genome of Rsl, UL29, UL30, UL54. Although CRISPR/Cas has been previously utilized to inhibit active HSV-1 replication; see for example WO 2015/153789 Al, van
Diemen FR et al., 2016, Roehm PC et al., 2016, the contents of which are incorporated herein, none of the reports have successfully inhibited latent herpesvirus genome (e.g. latent HSV-1 genome). CRISPR methodologies employ a nuclease, CRISPR-associated (Cas9), that complexes with small RNAs as guides (gRNAs) to cleave DNA in a sequence-specific manner upstream of the protospacer adjacent motif (PAM) in any genomic location. The compositions described herein include a nucleic acid sequence that encodes a Cas9 molecule, and a nucleic acid sequence that encodes one or a combination of several guide RNAs, where each gRNA comprises a targeting domain complementary to target sequence in herpesvirus, e.g. HSV-1. Also featured are compositions comprising a Cas9 molecule, wherein the Cas9 molecule is a polypeptide, and one or a combination of guide RNAs with each gRNA comprising a targeting domain complementary to a target sequence in herpesvirus, e.g., HSV-1. The components, e.g., a Cas9 molecule or gRNA molecule, or both, can be delivered, formulated, or administered in a variety of forms. When a component is delivered encoded in DNA, the DNA will typically include a control or regulatory region, e.g., comprising a promoter, to effect expression. Useful promoters for Cas9 molecule sequences include CMV, EF- 1 a, MSCV, PGK, CAG control promoters. Useful promoters for gRNAs include H 1, EF- 1 a and U6 promoters. Promoters with similar or dissimilar strengths can be selected to tune the expression of components. Sequences encoding a Cas9 molecule can comprise a nuclear localization signal (NLS), e.g., an SV40 NLS. In one embodiment of any one aspect described herein, the promoter is a neuron-specific promoter, such as synapsin I (SYN), calcium/calmodulin-dependent protein kinase II, tubulin alpha I, neuron-specific enolase and platelet-derived growth factor beta chain promoters (See Hioki H. et al., Gene Therapy, 2007, 14:872-82), or hybrid promoters formed by fusing cytomegalovirus enhancer (E) to known neuron-specific promoters as described above.
[0130] In an embodiment of any one aspect described herein, a promoter for a Cas9 molecule or a gRNA molecule can be, independently, inducible, tissue specific, or cell specific. In one embodiment of any one aspect described herein, the Cas9 molecule is provided as a polypeptide and the gRNA is transcribed in vitro from DNA, and then introduced into a subject or into an infected cell. In one embodiment of any one aspect described herein, the Cas9 molecule is provided as a polypeptide and the gRNA is provided as an RNA. In one embodiment of any one aspect described herein, the compositions described herein comprise nucleic acid sequences encoding Cas9 molecule and or gRNA.
[0131] In one embodiment of any one aspect described herein, the promoter is operably linked to the encoding nucleic acid sequence such that protein expression can occur from the encoded sequence.
[0132] CRISPR Cas9 - In bacteria the CRISPR/Cas loci encode RNA-guided adaptive immune systems against mobile genetic elements (viruses, transposable elements and conjugative plasmids). Three types (Ι-ΙΠ) ofCRISPR systems have been identified. CRISPR clusters contain spacers, the sequences complementary to antecedent mobile elements. CRISPR clusters are transcribed and processed into mature CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) RNA (crRNA). The CRISPR- associated endonuclease, Cas9, belongs to the type II CRISPR/Cas system and has strong endonuclease activity to cut target DNA. Cas9 is guided by a mature crRNA that contains about 20 base pairs (bp) of unique target sequence (called spacer) and a trans-activated small RNA (tracrRNA) that serves as a guide
for ribonuclease Ill-aided processing of pre-crRNA. The crRNA:tracrRNA duplex directs Cas9 to target DNA via complementary base pairing between the spacer on the crRNA and the complementary sequence (called protospacer) on the target DNA. Cas9 recognizes a trinucleotide (NGG) protospacer adjacent motif (PAM) to specify the cut site (the 3rd nucleotide from PAM). The crRNA and tracrRNA can be expressed separately or engineered into an artificial fusion small guide RNA (sgRNA) via a synthetic stem loop (AGAAAU) to mimic the natural crRNA/tracrRNA duplex. Such sgRNA, like shRNA, can be synthesized or in vitro transcribed for direct RNA transfection or expressed from U6 or HI-promoted RNA expression vector, although cleavage efficiencies of the artificial sgRNA are lower than those for systems with the crRNA and tracrRNA expressed separately.
[0133] Cas9 and guide RNA (gRNA) may be synthesized by known methods. Accordingly,
Cas9/guide-RNA (gRNA) uses a non-specific DNA cleavage protein Cas9, and an RNA oligo to hybridize to target and recruit the Cas9/gRNA com- plex. See Chang et al., 2013, Genome editing with RNA- guided Cas9 nuclease in zebrafish embryos, Cell Res 23:465-472; Hwang et al., 2013, Efficient genome editing in zebrafish using a CRISPR-Cas system, Nat. Biotechnol 31:227-229; Xiao et al., 2013, Chromosomal deletions and inversions mediated by TALENS and CRISPR/Cas in zebrafish, Nucl Acids Res 1-11.
[0134] CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) is found in bacteria and is believed to protect the bacteria from phage infection. It has recently been used as a means to alter gene expression in eukaryotic DNA. It has been used to introduce insertions or deletions as a way of increasing or decreasing transcription in the DNA of a targeted cell or population of cells. See for example, Horvath et al , Science (2010) 327: 167-170; Terns etal, Current Opinion in Microbiology (2011) 14:321- 327; Bhaya et alAnnu Rev Genet (2011) 45:273-297; Wiedenheft et al. Nature (2012) 482:331-338); JinekM et al. Science (2012) 337:816-821; Cong Let al. Science (2013) 339:819-823; JinekMet al. (2013) eLife 2:e00471; Mali Pet al (2013) Science 339:823-826; Qi LS et al. (2013) Celll52: 1173-1183; Gilbert LA et al. (2013) Cell 154: 442-451; Yang H et al. (2013) Celll54: 1370-1379; and Wang H et al. (2013) Celll53:910-918).
[0135] Cas9 molecule- The methods and compositions of the present disclosure comprises a
CRISPR-associated endonuclease. In some embodiments, the CRISPR-associated endonuclease is a Cas9 nuclease.
[0136] The "Cas9 molecule" as used herein is a CRISPR-associated endonuclease can also be referred to as Cas9 nuclease. CRISPR systems have been identified and characterized from many different bacteria and any of these Cas9 enzymes may be used in the methods and compositions described herein. For example Cas9 proteins from any of Corynebacter, Sutterella, Legionela, Treponema, Filifactor, Eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteriodes, Flavivola, Flavobacteriun, Sphaerochaeta, Azospirillim, Gluconacetobacter, Neisseria, Roseburia, Parvibaculum, Staphylococcus, Nitratifractor, Mycoplasma, and Campylobactor may be used. Several Cas9 constructs are available from ADDGENE.
[0137] In the Examples herein, CRISPR systems and Cas9 proteins from Streptococcus pyogenes
(SpCas9) and Staphylococcus aureus (SaCas9) are used, although the disclosed methods, compositions, or
kits are not limited to only Cas9. Each of these proteins relies on a distinct recognition site or PAM. The PAM for SpCas9 is 5'-NGG-3', and for SaCas9 is 5'-NNGRRT-3', where R is purine. Each has a distinct sgRNA scaffold sequence making up the 3' portion of the gRNA. The length of the target sequence specific 5' portion of the sgRNA also varies between the Cas9 enzymes as well. SpCas9 uses a 13-15 nucleotide target sequences. SaCas9 uses an 18-24 nucleotide target sequence.
[0138] The methods, compositions, and kits described herein comprise a nucleic acid encoding the
Cas9 molecule. In one embodiment, the "Cas9 molecule" as used herein refers to a nucleotide sequence that encodes for the wild type SpCas9 polypeptide or a functional fragment thereof (SEQ ID No: 1). In another embodiment, the "Cas9 molecule" as used herein refers to the = wild type SaCas9 polypeptide or a functional fragment thereof (SEQ. ID. No: 2). Exemplary nucleic acids encoding Cas9 molecules are described in Cong et al , SCIENCE 2013, 399(6121):819-823; Wang et al , CELL 2013, 153(4):910-918; Mali et al. , SCIENCE 2013, 399(6121):823-826; Jinek et al, SCIENCE 2012, 337(6096):816-821. In some embodiments, the CRISPR-associated endonuclease useful for the methods, compositions, or kits described herein include, for example thermophilus; Psuedomona aeruginosa, Escherichia coli, or other sequenced bacteria genomes and archaea, or other prokaryotic microogranisms. Alternatively, the wild type Cas9 sequence can be modified. The nucleic acid sequence can be codon optimized for efficient expression in mammalian cells, i.e., "humanized." A humanized Cas9 nuclease sequence can be for example, the Cas9 nuclease sequence encoded by any of the expression vectors listed in Genbank accession numbers KM099231.1 GL669193757; KM099232.1 GL669193761; or KM099233.1 GI:669193765. Alternatively, the Cas9 nuclease sequence can be for example, the sequence contained within a commercially available vector such as PX330 or PX260 from ADDGENE (Cambridge, MA). In some embodiments the Cas9 molecule is a polypeptide comprising the sequence of SEQ ID No: 1, or SEQ ID NO: 2 or a functional fragment thereof.
[0139] In some embodiments, the "Cas9 molecule" can have an amino acid sequence that is a variant or a fragment of any of the Cas9 endonuclease sequences of Genbank accession numbers
KM099231.1 GI:669193757; KM099232.1 GI:669193761; or KM099233.1 GI:669193765 or Cas9 amino acid sequence of PX330 or PX260 (ADDGENE, Cambridge, MA). The Cas9 nucleotide sequence can be modified to encode biologically active variants of Cas 9, and these variants can have or can include, for example, an amino acid sequence that differs from a wild type Cas9 by virtue of containing one or more mutations (e.g., an addition, deletion, or substitution mutation or a combination of such mutations). One or more of the substitution mutations can be a substitution (e.g., a conservative amino acid substitution or non- conservative amino acid substitution). Conservative amino acid substitutions typically include substitutions within the following groups: glycine and alanine; valine, isoleucine, and leucine; aspartic acid and glutamic acid; asparagine, glutamine, serine and threonine; lysine, histidine and arginine; and phenylalanine and tyrosine. The amino acid residues in the Cas9 amino acid sequence can be non-naturally occurring amino acid residues. Naturally occurring ammo acid residues include those naturally encoded by the genetic code as well as non-standard amino acids (e.g., ammo acids having the D-configuration instead of the L- configuration). The polypeptides that are biologically active variants of a CRISPR-associated endonuclease
can be characterized in terms of the extent to which their sequence is similar to or identical to the corresponding wild-type polypeptide. For example, the sequence of a biologically active variant can be at least or about 80% identical to corresponding residues in the wild-type polypeptide. For example, a biologically active variant of a CRISPR-associated endonuclease can have an amino acid sequence with at least or about 80% sequence identity (e.g., at least or about 85%, 90%, 95%, 97%, 98%, or 99% sequence identity) to a CRISPR associated endonuclease or to a homolog or ortholog thereof.
[0140] The present Cas 9 molecule can also include amino acid residues that are modified versions of standard residues (e.g. pyrrolysine can be used in place of lysine and selenocysteine can be used in place of cysteine). Non-naturally occurring amino acid residues are those that have not been found in nature, but that conform to the basic formula of an amino acid and can be incorporated into a peptide. These can include for example, D-alloisoleucine (2R,3S)-2-amino-3-methylpentanoic acid and Lcyclopentyl glycine (S)-2-amino-2-cyclopentyl acetic acid.
[0141] Some embodiments of any aspect disclosed herein, modified version of a nuclease is used.
Modified versions of the Cas9 enzyme containing a single inactive catalytic domain, either RuvC- or HNH, are called 'nickases'. With only one active nuclease domain, the Cas9 nickase cuts only one strand of the target DNA, creating a single-strand break or 'nick'. Similar to the inactive dCas9 (RuvC- and HNH-), a Cas9 nickase is still able to bind DNA based on gRNA specificity, though nickases will only cut one of the DNA strands.
[0142] The majority of CRISPR plasmids are derived from S. pyogenes. There are two catalytic domain in Cas9, they are HNH and RuvC domains. The RuvC domain can be inactivated by a D10A mutation and the HNH domain can be inactivated by an H840A mutation. The Cas9 nuclease sequence can be a mutated sequence. For example, the Cas9 nuclease can be mutated in the conserved HNH and RuvC domains, which are involved in strand specific cleavage. For example, an aspartate-to-alanine (DIOA) mutation in the RuvC catalytic domain allows the Cas9 nickase mutant (Cas9n) to nick rather than cleave DNA to yield single-stranded breaks, and the subsequent preferential repair through HDR can potentially decrease the frequency of unwanted indel mutations from off-target double-stranded breaks.
[0143] In some embodiments of any aspect disclosed herein, methods, compositions, or kits of the disclosure can include a CRISPR-associated endonuclease polypeptide encoded by any of the nucleic acid sequences described above. The terms "peptide," "polypeptide," and "protein" are used interchangeably herein, although typically they refer to peptide sequences of varying sizes. The "polypeptides" to convey that they are linear polymers of amino acid residues, and to help distinguish them from full-length proteins. A polypeptide of this disclosure can "constitute" or "include" a fragment of a CRISPR-associated endonuclease, and the disclosure encompasses polypeptides that constitute or include biologically active variants of a CRISPR-associated endonuclease. It will be understood that the polypeptides can therefore include only a fragment of a CRISPR-associated endonuclease (or a biologically active variant thereof) but may include additional residues as well. Biologically active variants will retain sufficient activity to cleave target DNA.
[0144] The bonds between the amino acid residues can be conventional peptide bonds or another covalent bond (such as an ester or ether bond), and the polypeptides can be modified by amidation, phosphorylation or glycosylation. A modification can affect the polypeptide backbone and/or one or more side chains. Chemical modifications can be naturally occurring modifications made in vivo following translation of an mRNA encoding the polypeptide (e.g., glycosylation in a bacterial host) or synthetic modifications made in vitro. A biologically active variant of a CRISP -associated endonuclease can include one or more structural modifications resulting from any combination of naturally occurring (i.e., made naturally in vivo) and synthetic modifications (i.e., naturally occurring or non-naturally occurring modifications made in vitro). Examples of modifications include, but are not limited to, amidation (e.g., replacement of the free carboxyl group at the C-terminus by an amino group); biotinylation (e.g., acylation of lysine or other reactive amino acid residues with a biotin molecule); glycosylation (e.g., addition of a glycosyl group to either asparagines, hydroxylysine, serine or threonine residues to generate a glycoprotein or glycopeptide); acetylation (e.g ., the addition of an acetyl group, typically at the N-terminus of a polypeptide); alkylation (e.g., the addition of an alkyl group); isoprenylation (e.g., the addition of an isoprenoid group); lipoylation (e.g. attachment of a lipoate moiety); and phosphorylation (e.g., addition of a phosphate group to serine, tyrosine, threonine or histidine).
[0145] A biologically active variant of a CRISPR-associated endonuclease polypeptide will retain sufficient biological activity to be useful in the present methods. The biologically active variants will retain sufficient activity to function in targeted DNA cleavage. The biological activity can be assessed in ways known to one of ordinary skill in the art and includes, without limitation, in vitro cleavage assays or functional assays.
[0146] Polypeptides can be generated by a variety of methods including, for example, recombinant techniques or chemical synthesis. Once generated, polypeptides can be isolated and purified to any desired extent by means well known in the art. For example, one can use lyophilization following, for example, reversed phase or normal phase HPLC, or size exclusion or partition chromatography on polysaccharide gel media such as Sephadex G-25. The composition of the final polypeptide may be confirmed by amino acid analysis after degradation of the peptide by standard means, by amino acid sequencing, or by FAB-MS techniques. Salts, including acid salts, esters, amides, and N-acyl derivatives of an amino group of a polypeptide may be prepared using methods known in the art, and such peptides are useful in the context of the present disclosure.
[0147] Non-limiting exemplary polypeptide sequences for Cas9 molecule are provided below:
SEQ ID NO: 1 CRISPR-associated endonuclease Cas9 Streptococcus pyogenes serotype Ml GenBank: AAK33936.1
1 mdkkysigld igtnsvgwav itdeykvpsk kfkvlgntdr hsikknliga llfdsgetae
61 atrlkrtarr rytrrknric ylqeifsnem akvddsffhr leesflveed kkherhpifg
121 nivdevayhe kyptiyhlrk klvdstdkad lrliylalah mikfrghfli egdlnpdnsd
181 vdklfiqlvq tynqlfeenp inasgvdaka ilsarlsksr rlenliaqlp gekknglfgn
241 lialslgltp nfksnfdlae daklqlskdt ydddldnlla qigdqyadlf laaknlsdai
301 llsdilrvnt eitkaplsas mikrydehhq dltllkalvr qqlpekykei ffdqskngya 361 gyidggasqe efykfikpil ekmdgteell vklnredllr kqrtfdngsi phqihlgelh 421 ailrrqedfy pflkdnreki ekiltfripy yvgplargns rfawmtrkse etitpwnfee 481 vvdkgasaqs fiermtnfdk nlpnekvlpk hsllyeyftv yneltkvkyv tegmrkpafl 541 sgeqkkaivd llfktnrkvt vkqlkedyfk kiecfdsvei sgvedrihas lgtyhdllki 601 ikdkdfldne enedilediv ltltlfedre mieerlktya hlfddkvmkq lkrrrytgwg 661 rlsrklingi rdkqsgktil dflksdgfan rnfmqlihdd sltfkediqk aqvsgqgdsl 721 hehianlags paikkgilqt vkvvdelvkv mgrhkpeniv iemarenqtt qkgqknsrer 781 mkrieegike lgsqilkehp ventqlqnek lylyylqngr dmyvdqeldi nrlsdydvdh 841 ivpqsflkdd sidnkvltrs dknrgksdnv pseevvkkmk nywrqllnak litqrkfdnl 901 tkaergglse ldkagfikrq lvetrqitkh vaqildsrmn tkydendkli revkvitlks 961 klvsdfrkdf qfykvreinn yhhahdayln avvgtalikk ypklesefvy gdykvydvrk 1021 miakseqeig katakyffys nimnffktei tlangeirkr plietngetg eivwdkgrdf 1081 atvrkvlsmp qvnivkktev qtggfskesi Ipkmsdkli arkkdwdpkk yggfdsptva 1141 ysvlwakve kgkskklksv kellgitime rssfeknpid fleakgykev kkdliiklpk 1201 yslfelengr krmlasagel qkgnelalps kyvnflylas hyeklkgspe dneqkqlfve 1261 qhkhyldeii eqisefskrv iladanldkv lsaynkhrdk pireqaenii hlftltnlga 1321 paafkyfdtt idrkrytstk evldatlihq sitglyetri dlsqlggd
[0148] SEQ ID NO: 2 CRISPR-associated endonuclease Cas9 Staphyh
GenBank: CCK74173.1
1 mkrnyilgld igitsvgygi idyetrdvid agvrlfkean vennegrrsk rgarrlkrrr
61 rhriqrvkkl lfdynlltdh selsginpye arvkglsqkl seeefsaall hlakrrgvhn
121 vneveedtgn elstkeqisr nskaleekyv aelqlerlkk dgevrgsinr fktsdyvkea 181 kqllkvqkay hqldqsfidt yidlletrrt yyegpgegsp fgwkdikewy emlmghctyf 241 peelrsvkya ynadlynaln dlnnlvitrd enekleyyek fqiienvfkq kkkptlkqia 301 keilvneedi kgyrvtstgk peftnlkvyh dikditarke iienaelldq iakiltiyqs
361 sediqeeltn lnseltqeei eqisnlkgyt gthnlslkai nlildelwht ndnqiaifnr
421 lklvpkkvdl sqqkeipttl vddfilspvv krsfiqsikv inaiikkygl pndiiielar
481 eknskdaqkm inemqkrnrq tnerieeiir ttgkenakyl iekiklhdmq egkclyslea 541 ipledllnnp fnyevdhiip rsvsfdnsfn nkvlvkqeen skkgnrtpfq ylsssdskis 601 yetfkkhiln lakgkgrisk tkkeylleer dinrfsvqkd finrnlvdtr yatrglmnll 661 rsyfrvnnld vkvksinggf tsflrrkwkf kkernkgykh haedaliian adfifkewkk 721 Idkakkvmen qmfeekqaes mpeieteqey keifitphqi khikdfkdyk yshrvdkkpn 781 relindtlys trkddkgntl ivnnlnglyd kdndklkkli nkspekllmy hhdpqtyqkl 841 klimeqygde knplykyyee tgnyltkysk kdngpvikki kyygnklnah Iditddypns
901 rnkvvklslk pyrfdvyldn gvykfvtvkn ldvikkenyy evnskcyeea kklkkisnqa
961 efiasfynnd likingelyr vigvnndlln rievnmidit yreylenmnd kφpriikti
1021 asktqsikky stdilgnlye vkskkhpqii kkg
[0149] As versatile as the Cas9 protein is as a nuclease, nickase, or platform; it requires the targeting specificity of a guide RNA (gRNA) in order to act. As discussed below, gRNA or single guide RNA can be specifically designed to target a herpesvirus viral genome. The methods, compositions, and kits described herein can comprise a nucleic acid sequence encoding a gRNA comprising a targeting domain that is complementary to a target sequence in a herpesvirus. The herpesvirus can be e.g., herpes simplex virus-1 (HSV-1), herpes simplex virus-2 (HSV-2), varicella zoster virus, Epstein-Barr virus, cytomegalovirus, human herpesvirus 6, human herpesvirus 7, or Kaposi's sarcoma-associated herpesvirus. In preferred embodiments, the herpesvirus is HSV-1. In some embodiments, the target sequences are the genes Rsl, UL54, UL29, and UL 30 of a herpesvirus.
[0150] Guide RNA (gRNA) - A CRISPR/Cas9 of the present disclosure works optimally with gRNA that targets the herpesvirus viral genome. gRNA or single guide RNA (sgRNA) leads the
CRISPR Cas9 complex to the viral genome in order to cause viral genomic disruption at the selected gene in the herpesvirus. Accordingly, the methods, compositions, and kits described herein comprise a nucleic acid sequence encoding a guide RNA (gRNA) comprising a targeting domain that is complementary to a target sequence in aherpesvirus (e.g., HSV-1). The herpesvirus can be e.g., herpes simplex virus-1 (HSV- 1), herpes simplex virus-2 (HSV-2), varicella zoster virus, Epstein-Barr virus, cytomegalovirus, human herpesvirus 6, human herpesvirus 7, or Kaposi's sarcoma-associated herpesvirus. Commercially available guide RNAs and Cas9 nucleases may be used with the present disclosure. In an aspect of the disclosure, guide RNAs are designed, whether or not commercially purchased, to target a specific viral genome. The viral genome is identified and guide RNA to target selected portions of the viral genome are developed and incorporated into the composition of the disclosure. In an aspect of the disclosure, a reference genome of a particular strain of the virus is selected for guide RNA design.
[0151] For example, guide RNAs that target the HSV-1 genome are a component of the system in the present example. In relation to HSV-1, for example, the reference genome from strains KOS or McKrae can be used as a design guide. For example, one or more genes of the HSV-1, selected from the group genes Rsl, UL54, UL29, and UL30 of a herpesvirus, can be targeted with one or a combination of gRNAs (Table 1-5). In some embodiments, specific CRISPR/Cas9/gRNA complexes are introduced into a cell, here, targeting the herpesvirus genes Rsl, UL54, UL29, and UL30. A guide RNA is designed to target at least one category of sequences of the viral genome. In addition to latent infections, this disclosure can also be used to control actively replicating viruses by targeting the viral genome before it is packaged or after it is ejected.
[0152] In some embodiments, a combination of gRNAs may be introduced into a cell. The introduction is via contacting the cell with vectors carrying nucleic acid sequences that encode the herpesvirus genes Rsl, UL54, UL29, and UL30. The guide RNAs can be designed to target numerous
categories of sequences of the viral genome. By targeting several areas along the genome, the double strand DNA break or single strand DNA break at multiple locations fragments the genome, lowering the possibility of repair. Even with repair mechanisms, the large deletions render the virus incapacitated. In some embodiments, the gRNA targets a sequence within a coding region of the genome. In some embodiments, the gRNA targets a sequence within a non-coding region of the genome. For example, the gRNA can target a protein coding sequence or a regulatory sequence in HSV-1 genome. In some embodiments, the gRNA can be designed to target one or more of immediate early viral genes, early viral genes or late viral genes. In some embodiments, the gRNA are designed to target the Rsl (SEQ ID NO: 3), UL54 (SEQ ID NO: 4), UL29 (SEQ ID NO: 5), UL30 (SEQ ID NO: 6) or a conserved variant thereof, in the coding regions or at the regulatory regions of these genes. In some embodiments, the gRNA target a sequence within the protein coding sequence of one or more viral protein (e.g., ICP4, ICP8, ICP27).
[0153] The gRNA sequence can be a sense or anti-sense sequence. The gRNA sequence generally includes a proto-spacer adjacent motif (PAM). The sequence of the PAM can vary depending upon the specificity requirements of the CRISPR endonuclease used. In the CRISPR-Cas system derived from S. pyogenes, the target DNA typically immediately precedes a 5'-NGG proto-spacer adjacent motif (PAM). Thus, for the S. pyogenes Cas9, the PAM sequence can be AGG, TGG, CGG or GGG. Other Cas9 orthologs may have different PAM specificities. For example, Cas9 from S. thermophilus requires 5' - NNAGAA for CRISPR 1 and 5'-NGGNG for CRISPR3) and Neiseria menigiditis requires 5'- NNNNGATT). The specific sequence of the gRNA may vary, but, regardless of the sequence, useful gRNA sequences will be those that minimize off-target effects while achieving high efficiency and complete ablation of the genomically integrated herpesvirus (e.g., HSV-1) The length of the gRNA sequence can vary from about 20 to about 60 or more nucleotides, for example about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, about 40, about 45, about 50, about 55, about 60 or more nucleotides. Useful selection methods identify regions having extremely low homology between the foreign viral genome and host cellular genome including endogenous retroviral DNA, include bioinformatic screening using 12-bp+NGG target-selection criteria to exclude off-target human transcriptome or (even rarely) untranslated-genomic sites
Combination of gRNAs:
[0154] The gRNA sequence can be configured as a single sequence or as a combination of one or more different sequences, e.g., a multiplex configuration. Multiplex configurations can include combinations of two, three, four, five, six, seven, eight, nine, ten, or more different gRNAs, for example any combination of sequences complementary to a target sequence within genes, Rsl (SEQ ID NO: 3), UL54 (SEQ ID NO: 4), UL29 (SEQ ID NO: 5), UL30 (SEQ ID NO: 6) or a homolog thereof. However, any number of gRNAs may be introduced into a combination to target sequences within one or more regions of genome. In some embodiments, the target sequences are important for genome structure, viral replication, and infection latency, respectively. In some aspects of the disclosure, in vitro experiments allow for the determination of the most essential targets within a viral genome. For example, to understand the
most essential targets for effective incapacitation of a genome, subsets of gRNAs are transfected into model cells. Assays can determine which gRNAs or which combination is the most effective at targeting essential sequences within the viral genome. For example, as shown in FIG. 3B, in the case of the HSV-1 genome targeting, a combination of two gRNAs in the CRISPR/Cas9/gRNA targeted two different viral genes which are identified as being important for infection latency. A combination can be designed, for example, by selecting one or more gRNAs from Table 1-5. An exemplary combination can be gRNA comprising the sequence UL30-1 (SEQ ID NO: 13) or UL30-2 (SEQ ID NO: 14) combined with gRNA comprising the sequence UL29-1 (SEQ ID NO: 11) or UL29-2 (SEQ ID NO: 12). In some embodiments of any aspect in this disclosure, gRNA comprising the sequence UL30-2 (SEQ ID NO: 14) is combined with gRNA comprising the sequence UL29-2 (SEQ ID NO: 12). For example in the methods, compositions, and kits described herein comprise of a first gRNA comprising a targeting domain which is complementary with a target sequence from the gene Rsl (SEQ ID NO: 3), UL54 (SEQ ID NO: 4), UL29 (SEQ ID NO: 5), UL30 (SEQ ID NO: 6) or a conserved variant thereof and a second a second gRNA comprising a targeting domain which is complementary with a second target sequence from the gene Rsl (SEQ ID NO: 3), UL54 (SEQ ID NO: 4), UL29 (SEQ ID NO: 5), UL30 (SEQ ID NO: 6) or a homolog thereof. In some embodiments of any aspect in this disclosure, the first gRNA and the second gRNA target different genes selected from the group consisting of Rsl, UL54, UL29, and UL30.
[0155] When the compositions are administered in an expression vector, the gRNAs can be encoded by a single vector. Alternatively, multiple vectors can be engineered to each include two or more different gRNAs. Useful configurations will result in the excision of viral sequences between cleavage sites which can result in the ablation of herpes viral genome or herpes viral protein expression Thus, the use of two or more different gRNAs promotes excision of the viral sequences between the cleavage sites recognized by the CRISPR endonuclease. The excised region can vary in size from a single nucleotide to several thousand nucleotides. Exemplary excised regions are described in the examples. When the compositions are administered as a nucleic acid or are contained within an expression vector, the CRISPR endonuclease can be encoded by the same nucleic acid or vector as the guide RNA sequences. Alternatively or in addition, the CRISPR endonuclease can be encoded in a physically separate nucleic acid from the gRNA sequences or in a separate vector.
[0156] In some embodiments, the RNA molecules e.g. crRNA, tracrRNA, gRNA are engineered to comprise one or more modified nucleobases. For example, known modifications of RNA molecules can be found, for example, in Genes VI, Chapter 9 ("interpreting the Genetic Code"), Lewis, ed. (1997, Oxford University Press, New York), and Modification and Editing of RNA, Grosjean and Benne, eds. (1998, ASM Press, Washington DC). Modified RNA components include the following: 2'-0-methylcytidine; N4 - methylcytidine; N4 -2'-0-dimethylcytidine; N4 - acetylcytidine; 5-methylcytidine; 5,2'-0-dimethylcytidine; 5-hydroxymethylcytidine; 5- formylcytidine; 2'-0-methyl-5-formaylcytidine; 3 -methylcytidine; 2- thiocytidine; lysidine; 2'-0- methyluridme; 2-thiouridine; 2-thio-2'-0-methyluridine; 3,2'-0-dimethyluridine; 3-(3-amino-3- carboxypropyl)uridme; 4-thiouridine; nbosylthymine; 5,2'-0-dimethyluridine; 5-methyl-2- thiouridine; 5-hydroxyuridine; 5-methoxyuridine; uridine 5-oxyacetic acid; uridine 5-oxyacetic acid methyl
ester; 5-carboxymethyluridine; 5-methoxycarbonylmethyluridine; 5- methoxycarbonylmethyl-2'-0- methyluridine; 5-methoxycarbonylmethyl-2'-thiouridine; 5- carbamoylmethyluridine; 5-carbamoylmethyl- 2'-0-methyluridine; 5- (carboxyhydroxymethyl)uridine; 5-(carboxyhydroxymethyl) uridinemethyl ester; 5- aminomethyl-2-thiouridine; 5-methylaminomethyluridine; 5-methylaminomethyl-2-thiouridine; 5- methylaminomethyl-2-selenouridine ; 5-carboxymethylaminomethyluridine ; 5 - carboxymet ylaminomethyl-2'-0-methyl- uridine; 5-carboxymethylaminomethyl-2-thiouridine;
dihydrouridme; dihydroribosylthymine; 2'-methyladenosine; 2-methyladenosine; N.sup.6N- methyladenosine; N6, N6-dimethyladenosine; N6,2'-0-trimethyladenosine; 2-methylthio-N6N- isopentenyladenosine; N6-(cis-hydroxyisopentenyl)-adenosine; 2-methylthio-N6-(cis~
hydroxyisopentenyl)-adenosine; N 6-glycinylcarbamoyl)adenosine; N6-threonylcarbamoyl adenosine; N6- methyl-N6-threonylcarbamoyl adenosine; 2-methylthio-N6-methyl-N6- threonylcarbamoyl adenosine; N6- hydroxynorvalylcarbamoyl adenosine; 2-methylthio-N 6- hydroxnorvalylcarbamoyl adenosine; 2'-0- ribosyladenosine (phosphate); inosine; 2'0-methyl inosine; 1-methyl inosine; 1 ;2'-0-dimethyl inosine; 2 -0- methyl guanosine; 1-methyl guanosine; N2 -methyl guanosine; N2 ,N2 -dimethyl guanosine; N2 , 2'-0- dimethyl guanosine; N2 , N2 , 2'-0- trimethyl guanosine; 2'-0-ribosyl guanosine (phosphate); 7-methyl guanosine; N2 ;7-dimethyl guanosine; N2 ; N2 ;7-trimethyl guanosine; wyosine; methylwyosine; under- modified hydroxywybutosine; wybutosine; hydroxy wybuto sine; peroxywybutosine; queuosine;
epoxyqueuosine; galactosyl-queuosine; mannosyl-queuosine; 7-cyano-7-deazaguanosine; arachaeosine [also called 7-formamido-7 -deazaguanosine]; and 7 -aminomethyl-7- deazaguanosine.
Exemplary gRNA sequences are described below:
Table 1. RNAs and their se uences.
Table 2. gRNAs and their sequences.
CRISPR SauCas9 (21b) guide sequence (w/ NGGRRT- SEQ ID NO
underlined) for U6
UL30 G (in bold) added if necessary
sau UL30-1 GCGTCCCGACTGGGGCGAGGTAGGGGT SEQ ID NO 15 sau UL30-2 GAAGTTTTGCCTCAAACAAGGCGGGGGT SEQ ID NO 16 sau UL30-3 GCGGCGTGGACCACGCCCCGGCGGGGT SEQ ID NO 17 sau UL30-4 GTGCCCCCCCGGAGAAGCGCGCCGGGGT SEQ ID NO 18 sau UL30-5 GACACGTGAAAGACGGTGACGGTGGGGT SEQ ID NO 19 sau UL30-6 GACCAGCCGAAGGTGACGAACCCGGGGT SEQ ID NO 20 sau UL30-7 GGCCATCAAGAAGTACGAGGGTGGGGT SEQ ID NO 21 sau UL30-24 GAAACCCCAAAAGCCGCTTGGGTGGGAT SEQ ID NO 22
sau UL30-25 GCCACCCGAACCCCTAAAGAGGGGGGAT SEQ ID NO: 23 sau UL30-26 GCATGCCGGCCCGGGCGAGCCTGGGGGT SEQ ID NO: 24 sau UL30-27 GCCATCCCACCCAAGCGGCTTTTGGGGT SEQ ID NO: 25
Table 3. RNAs and their se uences.
Table 4. RNAs and their se uences.
Table 5. gRNAs and their sequences.
CRISPR SauCas9 (21b) guide sequence (w/ NGGRRT) SEQ ID NO for U6
a4
sau a4-l GCCGGGCGTCGTCGAGGTCGTGGGGGT SEQ ID NO: 49 sau a4-2 GCCGCTCGTCGCGGTCTGGGCTCGGGGT SEQ ID NO: 50 sau a4-3 GGGGGTGGTCGGGGTCGTGGTCGGGGT SEQ ID NO: 51 sau a4-4 GATCGTCGTCGGCTAGAAAGGCGGGGGT SEQ ID NO: 52 sau a4-5 GGCGCGGCGACAGGCGGTCCGTGGGGT SEQ ID NO: 53 sau a4-6 GCGAGGCCGCGGGGTCGGGCGTCGGGAT SEQ ID NO: 54 sau a4-7 GGGTCCGGGGCGGCGAGGCCGCGGGGT SEQ ID NO: 55 sau a4-8 GCGCGAGGCGCGGGCCGTCGGGCGGGGT SEQ ID NO: 56 sau a4-9 GCGGACGACGAGGACGAGGACCCGGAGT SEQ ID NO: 57 sau a4-15 GCCGATGCGGGGCGATCCTCCGGGGAT SEQ ID NO: 58
sau a4-16 GTACGCGGACGAAGCGCGGGAGGGGGAT SEQ ID NO: 59 sau a4-17 GCGCGTCGACGGCGGGGGTCGTCGGGGT SEQ ID NO: 60 sau a4-18 GCGCTAGTTCCGCGTCGACGGCGGGGGT SEQ ID NO: 61
Nucleic acids encoding CRISPR/Cas9/gRNAs:
[0157] Embodiments of the present disclosure encompass nucleic acids that encode a fragment of a naturally occurring Cas9 or a biologically active variant thereof and a gRNA where in the gRNA is complementary to a sequence in Herpesvirus genome (HSV-1 genome). In some embodiments, the nucleic acid sequence can be an isolated nucleic acid sequence. Isolated nucleic acid molecules can be produced by standard techniques. For example, polymerase chain reaction (PCR) techniques can be used to obtain an isolated nucleic acid sequence containing a nucleotide sequence described herein, including nucleotide sequences encoding a polypeptide described herein. PCR can be used to amplify specific sequences from DNA as well as RNA, including sequences from total genomic DNA or total cellular RNA. Various PCR methods are described in, for example, PCR Primer: A Laboratory Manual, Dieffenbach and Dveksler, eds., Cold Spring Harbor Laboratory Press, 1995. Generally, sequence information from the ends of the region of interest or beyond is employed to design oligonucleotide primers that are identical or similar in sequence to opposite strands of the template to be amplified. Various PCR strategies also are available by which site- specific nucleotide sequence modifications can be introduced into a template nucleic acid.
[0158] Isolated nucleic acid sequences also can be chemically synthesized, either as a single nucleic acid molecule (e.g., using automated DNA synthesis in the 3' to 5' direction using phosphoramidite technology) or as a series of oligonucleotides. For example, one or more pairs of long oligonucleotides (e.g., >50-100 nucleotides) can be synthesized that contain the desired sequence, with each pair containing a short segment of complementarity (e.g., about 15 nucleotides) such that a duplex is formed when the oligonucleotide pair is annealed. DNA polymerase is used to extend the oligonucleotides, resulting in a single, double-stranded nucleic acid molecule per oligonucleotide pair, which then can be ligated into a vector. Isolated nucleic acids of the disclosure also can be obtained by mutagenesis of, e.g., a naturally occurring portion of a Cas9 -encoding DNA (in accordance with, for example, the formula above).
[0159] Two nucleic acids or the polypeptides they encode may be described as having a certain degree of identity to one another. For example, a Cas9 protein and a biologically active variant thereof may be described as exhibiting a certain degree of identity. Alignments may be assembled by locating short Cas9 sequences in the Protein Information Research (PIR) website of Georgetown university, followed by analysis with the "short nearly identical sequences" Basic Local Alignment Search Tool (BLAST) algorithm on the NCBI website National Institute of Health.
[0160] As used herein, the term "percent sequence identity" refers to the degree of identity between any given query sequence and a subject sequence. For example, a naturally occurring Cas9 can be the query sequence and a fragment of a Cas9 protein can be the subject sequence. Similarly, a fragment of a
Cas9 protein can be the query sequence and a biologically active variant thereof can be the subject sequence. To determine sequence identity, a query nucleic acid or amino acid sequence can be aligned to one or more subject nucleic acid or amino acid sequences, respectively, using the computer program
ClustalW (version 1.83, default parameters), which allows alignments of nucleic acid or protein sequences to be carried out across their entire length (global alignment). See Chenna et al., Nucleic Acids Res., 11:3497-3500, 2003.
[0161] ClustalW calculates the best match between a query and one or more subject sequences and aligns them so that identities, similarities and differences can be determined. Gaps of one or more residues can be inserted into a query sequence, a subject sequence, or both, to maximize sequence alignments. For fast pair wise alignment of nucleic acid sequences, the following default parameters are used: word size: 2; window size: 4; scoring method: percentage; number of top diagonals: 4; and gap penalty: 5. For multiple alignments of nucleic acid sequences, the following parameters are used: gap opening penalty: 10.0; gap extension penalty: 5.0; and weight transitions: yes. For fast pair wise alignment of protein sequences, the following parameters are used: word size: 1; window size: 5; scoring method: percentage; number of top diagonals: 5; gap penalty: 3. For multiple alignment of protein sequences, the following parameters are used: weight matrix: blosum; gap opening penalty: 10.0; gap extension penalty: 0.05; hydrophilic gaps: on; hydrophilic residues: Gly, Pro, Ser, Asn, Asp, Gin, Glu, Arg, and Lys; residue- specific gap penalties: on. The output is a sequence alignment that reflects the relationship between sequences. ClustalW can be run, for example, at the Baylor College of Medicine Search Launcher website and at the European Bioinformatics Institute website on the World Wide Web. To determine a percent identity between a query sequence and a subject sequence, ClustalW divides the number of identities in the best alignment by the number of residues compared (gap positions are excluded), and multiplies the result by 100. The output is the percent identity of the subject sequence with respect to the query sequence. It is noted that the percent identity value can be rounded to the nearest tenth. For example, 78.11, 78 .12, 78.13, and 78.14 are rounded down to 78.1, while 78.15, 78.16, 78.17, 78.18, and 78.19 are rounded up to 78.2. The nucleic acid sequences and polypeptides described herein may be referred to as "exogenous".
[0162] The term "exogenous" indicates that the nucleic acid sequence or polypeptide is part of, or encoded by, a recombinant nucleic acid construct, or is not in its natural environment. For example, an exogenous nucleic acid can be a sequence from one species introduced into another species, i.e., a heterologous nucleic acid. Typically, such an exogenous nucleic acid is introduced into the other species via a recombinant nucleic acid construct. An exogenous nucleic acid can also be a sequence that is native to an organism and that has been reintroduced into cells of that organism. An exogenous nucleic acid that includes a native sequence can often be distinguished from the naturally occurring sequence by the presence of non-natural sequences linked to the exogenous nucleic acid, e .g., non-native regulatory sequences flanking a native sequence in a recombinant nucleic acid construct. In addition, stably transformed exogenous nucleic acids typically are integrated at positions other than the position where the native sequence is found.
[0163] Recombinant constructs are also provided herein and can be used to transform cells in order to express Cas9 and/or a guide RNA complementary to a target sequence in herpesvirus (e.g., HSV- 1). A recombinant nucleic acid construct comprises a nucleic acid encoding a Cas9 and/or a gRNA complementary to a target sequence in HSV-1 as described herein, operably linked to a regulatory region
suitable for expressing the Cas9 and/or a guide RNA complementary to a target sequence in herpesvirus genome in the cell. It will be appreciated that a number of nucleic acids can encode a polypeptide having a particular amino acid sequence. The degeneracy of the genetic code is well known in the art. For many amino acids, there is more than one nucleotide triplet that serves as the codon for the amino acid. For example, codons in the coding sequence for Cas9 can be modified such that optimal expression in a particular organism is obtained, using appropriate codon bias tables for that organism.
Introduction into the cell
[0164] Methods of the disclosure comprise contacting an herpersvirus-nfected mammalian cell with a Cas9 molecule and one or a combination of gRNAs to allow the introduction of an effective amount of CRISPR/Cas9/gRNAs complex into the cell. In some embodiments of any method described, the contacting is with compositions comprising a nucleic acid encoding a Cas9 molecule and one or a combination of gRNAs that comprise a targeting domain complementary to target sequence in herpesvirus. In some embodiments of any method described, the contacting is with compositions comprising a Cas9 molecule, wherein the Cas9 molecule is a Cas9 polypeptide and one or a combination of gRNAs that comprise a targeting domain complementary to target sequence in herpesvirus. In some embodiments of any method described, the contacting is done in vivo. In some embodiment, the contacting step is done ex vivo.
[0165] It should be appreciated that complexes can be introduced into cells in an in vitro model or an in vivo model. In one embodiment of any aspect described, the CRISPR/Cas9/gRNA complexes are introduced into the cell or the subject. In one embodiment of any aspect described, the
CRISPR/Cas9/gRNA complexes are administered to the subject. In one embodiment of any aspect described, the CRISPR/Cas9/gRNA complexes are designed to not leave intact genomes of a virus after transfection and complexes are designed for efficient transfection.
[0166] Aspects of the disclosure allow for CRISPR/Cas9/gRNA to be introduced into cells by various methods, including viral vectors and non-viral vectors. Accordingly, vectors comprising nucleic acid sequences such as those described herein also are provided. A "vector" is a replicon, such as a plasmid, phage, or cosmid, into which another DNA segment may be inserted so as to bring about the replication of the inserted segment. Generally, a vector is capable of replication when associated with the proper control elements. Suitable vector backbones include, for example, those routinely used in the art such as plasmids, viruses, artificial chromosomes, BACs, YACs, or PACs. The term "vector" includes cloning and expression vectors, as well as viral vectors and integrating vectors. An "expression vector" is a vector that includes a regulatory region. A wide variety of host/expression vector combinations may be used to express the nucleic acid sequences described herein. Suitable expression vectors include, without limitation, plasmids and viral vectors derived from, for example, bacteriophage, baculoviruses, and retroviruses. Numerous vectors and expression systems are commercially available from such corporations as Novagen (Madison, WI), Clontech (Palo Alto, CA), Stratagene (La Jolla, CA), and Invitrogen Life Technologies (Carlsbad, CA).
[0167] The vectors provided herein also can include, for example, origins of replication, scaffold attachment regions (SARs), and/or markers. A marker gene can confer a selectable phenotype on a host cell. For example, a marker can confer biocide resistance, such as resistance to an antibiotic (e.g., kanamycin, G418, bleomycin, or hygromycin). As noted above, an expression vector can include a tag sequence designed to facilitate manipulation or detection (e.g., purification or localization) of the expressed polypeptide. Tag sequences, such as green fluorescent protein (GFP), glutathione S-transferase (GST), polyhistidine, c-myc, hemagglutinin, or Flag™ tag (Kodak, New Haven, CT) sequences typically are expressed as a fusion with the encoded polypeptide. Such tags can be inserted anywhere within the polypeptide, including at either the carboxyl or amino terminus.
[0168] Additional expression vectors also can include, for example, segments of chromosomal, non-chromosomal and synthetic DNA sequences. Suitable vectors include derivatives of SV 40 and known bacterial plasmids, e.g., E. coli plasmids col El, pCRl, pBR322, pMal-C2, pET, pGEX, pMB9 and their derivatives, plasmids such as RP4; phage DNAs, e.g., the numerous derivatives of phage 1, e.g., NM989, and other phage DNA, e.g., M13 and filamentous single stranded phage DNA; yeast plasmids or derivatives thereof, vectors useful in eukaryotic cells, such as vectors useful in insect or mammalian cells; vectors derived from combinations of plasmids and phage DNAs, such as plasmids that have been modified to employ phage DNA or other expression control sequences.
[0169] Yeast expression systems can also be used. For example, the non-fusion pYES2 vector
(Xbal, Sphl, Shol, Notl, GstXI, EcoRI, BstXI, BamHl, Sacl, Kpnl, and Hindlll cloning sites; Invitrogen) or the fusion pYESHisA, B, C (Xbal, Sphl, Shol, Notl, BstXI, EcoRI, BamHl, Sacl, Kpnl, and Hmdlll cloning sites, N-terminal peptide purified with ProBond resin and cleaved with enterokinase; Invitrogen), to mention just two, can be employed according to the disclosure.
[0170] In one embodiment of any aspect described, the vector also comprises a regulatory region.
The term "regulatory region" refers to nucleotide sequences that influence transcription or translation initiation and rate, and stability and/or mobility of a transcription or translation product. Regulatory regions include, without limitation, promoter sequences, enhancer sequences, response elements, protein recognition sites, inducible elements, protein binding sequences, 5' and 3' untranslated regions (UTRs ), transcriptional start sites, termination sequences, polyadenylation sequences, nuclear localization signals, and introns.
[0171] Vectors include, for example, viral vectors (such as adenoviruses ("Ad"), adeno-associated viruses (AAV), and vesicular stomatitis virus (VSV) and retroviruses), liposomes and other lipid-containing complexes, and other macromolecular complexes capable of mediating delivery of a polynucleotide to a host cell. Vectors can also comprise other components or functionalities that further modulate gene delivery and/or gene expression, or that otherwise provide beneficial properties to the targeted cells. As described and illustrated in more detail below, such other components include, for example, components that influence binding or targeting to cells (including components that mediate cell-type or tissue-specific binding); components that influence uptake of the vector nucleic acid by the cell; components that influence localization of the polynucleotide within the cell after uptake (such as agents mediating nuclear
localization); and components that influence expression of the polynucleotide. Such components also might include markers, such as detectable and/or selectable markers that can be used to detect or select for cells that have taken up and are expressing the nucleic acid delivered by the vector. Such components can be provided as a natural feature of the vector (such as the use of certain viral vectors which have components or functionalities mediating binding and uptake), or vectors can be modified to provide such functionalities. Other vectors include those described by Chen et al; BioTechniques, 34: 167-171 (2003). A large vanety of such vectors are known in the art and are generally available.
[0172] A "recombinant viral vector" refers to a viral vector comprising one or more heterologous gene products or sequences. Since many viral vectors exhibit size-constraints associated with packaging, the heterologous gene products or sequences are typically introduced by replacing one or more portions of the viral genome. Such viruses may become replication-defective, requiring the deleted function(s) to be provided in trans during viral replication and encapsidation (by using, e.g., a helper virus or a packaging cell line carrying gene products necessary for replication and/or encapsidation). Modified viral vectors in which a polynucleotide to be delivered is carried on the outside of the viral particle have also been described (see, e.g., Curiel, D T, et al. PNAS 88: 8850-8854, 1991). Suitable nucleic acid delivery systems include recombinant viral vector, typically sequence from at least one of an adenovirus, adenovirus- associated virus (AAV), helper dependent adenovirus, retrovirus, or hemagglutinating virus of Japan- liposome (HVJ) complex. In such cases, the viral vector comprises a strong eukaryotic promoter operably linked to the polynucleotide e.g., a cytomegalovirus (CMV) promoter. The recombinant viral vector can include one or more of the polynucleotides therein, preferably about one polynucleotide.
[0173] It should be appreciated that any viral vector may be incorporated into the present disclosure to effectuate introduction of the CRISPR/Cas9/gRNA complex into a cell. Some viral vectors may be more effective than others, depending on the CRISPR/Cas9/gRNA complex designed for digestion or incapacitation. In one embodiment of any aspect described, the vectors contain essential components such as origin of replication, which is necessary for the replication and maintenance of the vector in the host cell. In one embodiment of any aspect described, viral vectors are used as delivery vectors to deliver the complexes into a cell. Use of viral vectors as delivery vectors are known in the art. See for example U.S. Pub. 2009/0017543 to Wilkes et al., the contents of which are incorporated herein by reference in its entirety. In one embodiment of any aspect described, the viral vectors used for delivery of the Cas9 molecule and/or one or combination of gRNAs can be for example retrovirus, lentivirus, adenovirus, herpesvirus, poxvirus, alpha virus, vaccinia virus, avian viruses, or adeno-associated viruses.
[0174] In one embodiment of any aspect described, the contacting non-viral vectors may be used to effectuate the introduction of the CRISPR/Cas9/gRNA complex into a cell. Methods of non-viral delivery of nucleic acid sequences include lipofection, nucleofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipid:nucleic acid conjugates, naked DNA, artificial virions, and agent-enhanced uptake of DNA. Lipofection is described in e.g., U.S. Pat. Nos. 5,049,386, 4,946,787; and 4,897,355) and lipofection reagents are sold commercially (e.g., Transfectam and Lipofectin). Cationic and neutral lipids that are suitable for efficient receptor-recognition lipofection of polynucleotides include
those described in U.S. Pat. No. 7,166,298 to lessee or U.S. Pat. No. 6,890,554 to Jesse, the contents of each of which are incorporated by reference in their entireties. Delivery can be to cells (e.g. in vitro or ex vivo administration) or target tissues (e.g. in vivo administration). Synthetic vectors are typically based on cationic lipids or polymers which can complex with negatively charged nucleic acids to form particles with a diameter in the order of 100 nm. Modifying the surfaces of the cationic non-virals can minimize their interaction with blood components, reduce reticuloendothelial system uptake, decrease their toxicity and increase their binding affinity with the target cells. In some embodiments of the disclosure, non-viral vectors are modified to effectuate targeted delivery and transfection. PEGylation (i.e. modifying the surface with polyethyleneglycol) is the predominant method used to reduce the opsonization and aggregation of non-viral vectors and minimize the clearance by reticuloendothelial system, leading to a prolonged circulation lifetime after intravenous (i.v.) administration. In some embodiments, the non-viral vector comprises polyethelene glycol.
[0175] In one embodiment of any aspect described, the non-viral vector is selected from the group consisting of a nanoparticle, a cationic lipid, a cationic polymer, a metallic nanoparticle, a nanorod, a liposome, microbubbles, a cell penetrating peptide and a liposphere. In one embodiment of any aspect described, targeted controlled-release systems responding to the unique environments of tissues and extemal stimuli are utilized. Because the near-infrared light can penetrate deeply into tissues, the surface of gold nanorod, which have strong absorption bands in the near infra-red region could be modified with nucleic acids for controlled release. In some embodiments of the disclosure, liposomes are used to effectuate introduction into a cell or tissue. The pharmacology of a liposomal formulation of nucleic acid is largely determined by the extent to which the nucleic acid is encapsulated inside the liposome bilayer Encapsulated nucleic acid shares the extended circulation lifetime and biodistribution of the intact liposome, while those that are surface associated adopt the pharmacology of naked nucleic acid once they disassociate from the liposome. Therefore, nucleic acid sequences may be entrapped within liposomes with conventional passive loading technologies, such as ethanol drop method (as in SALP), reverse phase evaporation method, and ethanol dilution method (as in SNALP). In some embodiments, linear polyethylenimine (L-PEI) is used as a non-viral vector due to its versatility and comparatively high transfection efficiency. Low intensity Ultrasound mediated micro bubbles destruction has been proposed as an innovative method for noninvasive delivering of drugs and nucleic acids to different tissues.
Microbubbles are used to carry a drug or gene until a specific area of interest is reached, and then ultrasound is used to burst the micro bubbles, causing site-specific delivery of the bioactive materials. Furthermore, the ability of albumin-coated microbubbles to adhere to vascular regions with glycocalix damage or endothelial dysfunction is another possible mechanism to deliver drugs even in the absence of ultrasound. See Tsutsui et al., 2004. Besides ultrasound-mediated delivery, magnetic targeting delivery could be used for delivery.
[0176] Synthetic cationic polymer-based nanoparticles (-100 nm diameter) have been developed that offer enhanced transfection efficiency combined with reduced cytotoxicity, as compared to traditional liposomes. In some embodiments, the complexes are conjugated to nano-systems for systemic therapy, such
as liposomes, albumin-based particles, PEGylated proteins, biodegradable polymer-drug composites, polymeric micelles, dendrimers, among others. See Davis et al., 2008, Nanotherapeutic particles: an emerging treatment modality for cancer, Nat Rev Drug Discov. 7(9):771-782, incorporated by reference in its entirety.
[0177] In one embodiment of any aspect described, the complexes of the disclosure are conjugated to or encapsulated into a liposome or polymerosome for delivery to a cell. For example, liposomal anthracyclines have achieved highly efficient encapsulation, and include versions with greatly prolonged circulation such as liposomal daunorubicin and pegylated liposomal doxorubicin. See Krishna etal., Carboxymethylcellulose-sodium based transdermal drug delivery system for propranolol, J Pharm
Pharmacal. 1996 April; 48(4):367 -70. Liposomes and polymerosomes can contain a plurality of solutions and compounds. In certain embodiments, the complexes of the disclosure are coupled to or encapsulated in polymersomes. As a class of artificial vesicles, polymersomes are tiny hollow spheres that enclose a solution, made using amphiphilic synthetic block copolymers to form the vesicle membrane. Common polymersomes contain an aqueous solution in their core and are useful for encapsulating and protecting sensitive molecules, such as drugs, enzymes, other proteins and peptides, and DNA and RNA fragments. Polymerosomes can be generated from double emulsions by known techniques, see Lorenceau et al., 2005, Generation of Polymerosomes from Double-Emulsions, Langmuir 21(20):9183-6, incorporated by reference.
[0178] In one embodiment of any aspect described, the introduction of the Cas9 molecule, gRNAs etc, the nucleic acid sequences encoding these molecules, and vectors described herein into a cell is via a gene gun or a biolistic particle delivery system. A gene gun is a device for injecting cells with genetic information, where the payload may be an elemental particle of a heavy metal coated with plasmid DNA. This technique may also be referred to as bioballistics or biolistics. Gene guns have also been used to deliver DNA vaccines. The gene gun is able to transfect cells with a wide variety of organic and nonorganic species, such as DNA plasmids, fluorescent proteins, dyes, etc.
[0179] In one embodiment of any aspect described, the introduction of the Cas9 molecule, gRNAs etc, the nucleic acid sequences encoding these molecules, and vectors described herein into the cell is via electroporation.
[0180] Aspects of the disclosure provide for numerous uses of delivery vectors. Selection of the delivery vector is based upon the cell or tissue targeted and the specific makeup of the
CRISPR Cas9/gRNA and can be easily determined by one skilled in the art. Aspects of the disclosure utilize the CRISPR/Cas9/gRNA complexes for the targeted delivery. Common known pathways include transdermal, transmucal, nasal, ocular and pulmonary routes. Drug delivery systems may include liposomes, proliposomes, microspheres, gels, prodrugs, cyclodextrins, etc. Aspects of the disclosure utilize nanoparticles composed of biodegradable polymers to be transferred into an aerosol for targeting of specific sites or cell populations in the lung, providing for the release of the drug in a predetermined manner and degradation within an acceptable period of time. Controlled-release technology (CRT), such as transdermal and transmucosal controlled-release delivery systems, nasal and buccal aerosol sprays, drug-impregnated
lozenges, encapsulated cells, oral soft gels, iontophoretic devices to administer drugs through skin, and a variety of programmable, implanted drug-delivery devices are used in conjunction with the complexes of the disclosure of accomplishing targeted and controlled delivery.
[0181] Standard methods, for example, immunoassays to detect the CRISPR- associated endonuclease, or nucleic acid-based assays such as PCR to detect the gRNA, can be used to confirm that the complex has been taken up and expressed by the cell into which it has been introduced.
Inactivation of the virus
[0182] Once introduced in the cell the CRISPR/Cas9/gRNA complex inactivate the virus in the infected cell. The "inactivation" as used herein is to incapacitate or destroy the virus by alteration or disruption of viral genome resulting in loss of ability to cause an infection in the host or host cell. In one embodiment of any aspect described, the inactivation comprises a genetic modification or alteration that inhibits the expression of the targeted genes described here.
[0183] In one embodiment of any aspect described, the methods, compositions, and kits of the present disclosure comprise CRISPR/Ca9s and gRNA or complex thereof to cause an alteration or disruption within one or more viral genes to order to inactivate the virus. In one embodiment of any aspect described, an"alteration" or "disruption" as used herein is a systematic mutation in the target sequence of a target gene within the HSV genome. In some embodiments, the "mutation" is an insertion, a deletion or a rearrangements within one or more target sequences of one or more target genes of the herpesvirus genome. In some embodiments, the viral genome is latent. In some embodiments, the target genes can be selected from Rsl (SEQ ID NO: 3), UL54 (SEQ ID NO: 4), UL29 (SEQ ID NO: 5), UL30 (SEQ ID NO: 6) or a homolog thereof In one embodiment of any aspect described, the methods, compositions, and kits of the present disclosure are used to inactivate latent virus in a cell and prevent its reactivation by, for example, causing large or repeated deletions in the genome, reducing the probability of reconstructing the full genome. Once transfected within the cell, the CRISPR/Cas9/gRNA complexes cause repeated insertions or deletions to render the genome incapacitated, or due to number of insertions or deletions, the probability of repair is significantly reduced.
[0184] While not wishing to be bound by theory, the mechanism by which such mutations inactivate the vims can vary, for example the mutation can affect viral replication, viral gene expression or viral excision. In one embodiment of any aspect described, the mutations is located in the regulatory sequences or structural gene sequences and result in defective production of herpesvirus. In one embodiment of any aspect described, the mutation comprises a deletion. The size of the deletion can vary from a single nucleotide base pair to about 10,000 base pairs. In one embodiment of any aspect described, the mutation comprises an insertion that is the addition of one or more nucleotide base pairs to the viral target sequence. The size of the inserted sequence also may vary, for example from about one base pair to about 300 nucleotide base pairs. In one embodiment of any aspect described, the mutation comprises a point mutation, that is, the replacement of a single nucleotide with another nucleotide. Useful point mutations are those that have functional consequences, for example, mutations that result in the conversion of an amino acid codon into a termination codon or that result in the production of a nonfunctional protein.
[0185] In one embodiment of any aspect described, the Cas9 nuclease is used to cleave the genome. The Cas9 nuclease is capable of creating a double strand break in the genome. In one embodiment of any aspect described, the Cas9 endonuclease causes a double strand break in one or more locations in the viral genome. In one embodiment of any aspect described, the insertions into the genome are designed to cause incapacitation, or altered genomic expression. Additionally, insertions/deletions are also used to introduce a premature stop codon either by creating one at the double strand break or by shifting the reading frame to create one downstream of the double strand break. Any of these outcomes of the HEJ repair pathway can be leveraged to disrupt one or more target genes. The changes introduced by the use of the CRISPR/gRNA/Cas9 system are permanent to the genome. In some embodiments, the inactivation of viral gene can inhibit viral replication in the mammalian cell.
[0186] In one embodiment of any aspect described, the alteration is caused in the coding region of the genome. In some embodiments, the alteration is caused in the non-coding region of the genome. In one embodiment, the alterations are in one or more of genes; Rsl (SEQ ID NO: 3), UL54 (SEQ ID NO: 4), UL29 (SEQ ID NO: 5), UL30 (SEQ ID NO: 6) or a homolog thereof.
[0187] In one embodiment of any aspect described, at least one insertion is caused by the Cas9 molecule and gRNAs of the compositions described herein. In one embodiment, numerous insertions are caused in the genome, thereby inactivating the virus. In one embodiment of any aspect described, the number of insertions lowers the probability that the genome may be repaired. In some embodiments of the disclosure, at least one deletion is caused by the Cas9 molecule and gRNAs of the compositions described herein. In one embodiment of any aspect described, numerous deletions are caused in the genome, thereby inactivating the virus. In one embodiment of any aspect described, the number of deletions lowers the probability that the genome may be repaired. In one embodiment of any aspect described, the Cas9 molecule and gRNAs of the compositions herein causes significant genomic disruption, resulting in effective destruction of the viral genome, while leaving the host genome intact.
[0188] In some embodiments of the disclosure, a template sequence is inserted into the genome. In order to introduce nucleotide modifications to genomic DNA, a DNA repair template containing the desired sequence must be present during HDR. The DNA template is normally transfected into the cell along with the gRNA/Cas9. The length and binding position of each homology arm is dependent on the size of the change being introduced. In the presence of a suitable template, HDR can introduce specific nucleotide changes at the Cas9 induced double strand break.
[0189] In one embodiment of any aspect described, the mammalian cell is a sensory neuron. In some embodiments, the inactivation is in vivo. In some embodiments, the inactivation of the virus is ex vivo. Where the inactivation is ex vivo; the mammalian cell can be for example a cultured cell from a subject having a herpesvirus infection, a tissue explant or a cell line. In some embodiments, where the inactivation is ex vivo, the cell is sensory neuron.
[0190] It will be appreciated that the methods and compositions of this disclosure can be used to target any herpesvirus, without affecting the host genetic material. Methods, compositions, and kits described herein comprise a gRNA comprising a targeting sequence that is complementary to and therefore
hybridizes to a specific target sequence within the viral genome. Methods, compositions, and kits of the disclosure may further use a targeted Cas9 nuclease, or a vector encoding the nuclease which uses the gRNA to bind exclusively to the specific target sequence of the viral genome and make double stranded or single stranded cuts, which cause genetic modification in the viral genome, thereby altering, disrupting or removing viral sequence from the host.
[0191] Non limiting exemplary sequences of target genes within the HSV-1 genome are presented below. It is to be appreciated that the target genes can be a homolog of the ones presented herein the sequence for which are publicly available and can be obtained from for example from GENBANK™. A gRNA described in the present disclosure comprises a targeting domain that is complementary to a target sequence within the sequence of a target gene.
SEQ ID NO: 3 Rsl Gene ID: 2703392
TATATGAGCCCGAGGACGCCCCGATCGTCCACACGGAGCGCGGCTGCCGACACGGATCCACGACCCGACG CGGGACCGCCAGAGACAGACCGTCAGACGCTCGCCGCGCCGGGACGCCGATACGCGGACGAAGCGCGGGA GGGGGATCGGCCGTCCCTGTCCTTTTTCCCACCCAAGCATCGACCGGTCCGCGCTAGTTCCGCGTCGACG GCGGGGGTCGTCGGGGTCCGTGGGTCTCGCCCCCTCCCCCCATCGAGAGTCCGTAGGTGACCTACCGTGC TACGTCCGCCGTCGCAGCCGTATCCCCGGAGGATCGCCCCGCATCGGCGATGGCGTCGGAGAACAAGCAG CGCCCCGGCTCCCCGGGCCCCACCGACGGGCCGCCGCCCACCCCGAGCCCAGACCGCGACGAGCGGGGGG CCCTCGGGTGGGGCGCGGAGACGGAGGAGGGCGGGGACGACCCCGACCACGACCCCGACCACCCCCACGA CCTCGACGACGCCCGGCGGGACGGGAGGGCCCCCGCGGCGGGCACCGACGCCGGCGAGGACGCCGGGGAC GCCGTCTCGCCGCGACAGCTGGCTCTGCTGGCCTCCATGGTAGAGGAGGCCGTCCGGACGATCCCGACGC CCGACCCCGCGGCCTCGCCGCCCCGGACCCCCGCCTTTCGAGCCGACGACGATGACGGGGACGAGTACGA CGACGCAGCCGACGCCGCCGGCGACCGGGCCCCGGCCCGGGGCCGCGAACGGGAGGCCCCGCTACGCGGC GCGTATCCGGACCCCACGGACCGCCTGTCGCCGCGCCCGCCGGCCCAGCCGCCGCGGAGACGTCGTCACG GCCGGTGGCGGCCATCGGCGTCATCGACCTCGTCGGACTCCGGGTCCTCGTCCTCGTCGTCCGCATCCTC TTCGTCCTCGTCGTCCGACGAGGACGAGGACGACGACGGCAACGACGCGGCCGACCACGCACGCGAGGCG CGGGCCGTCGGGCGGGGTCCGTCGAGCGCGGCGCCGGCAGCCCCCGGGCGGACGCCGCCCCCGCCCGGGC CACCCCCCCTCTCCGAGGCCGCGCCCAAGCCCCGGGCGGCGGCGAGGACCCCCGCGGCCTCCGCGGGCCG CATCGAGCGCCGCCGGGCCCGCGCGGCGGTGGCCGGCCGCGACGCCACGGGCCGCTTCACGGCCGGGCAG CCCCGGCGGGTCGAGCTGGACGCCGACGCGGCCTCCGGCGCCTTCTACGCGCGCTATCGCGACGGGTACG TCAGCGGGGAGCCGTGGCCCGGCGCCGGGCCCCCGCCCCCGGGGCGGGTGCTGTACGGCGGCCTGGGCGA CAGCCGCCCGGGCCTCTGGGGGGCGCCCGAGGCGGAGGAGGCGCGACGCCGGTTCGAGGCCTCGGGCGCC CCGGCGGCCGTGTGGGCGCCCGAGCTGGGCGACGCCGCGCAGCAGTACGCCCTGATCACGCGGCTGCTGT ACACCCCGGACGCGGAGGCCATGGGGTGGCTCCAGAACCCGCGCGTGGTCCCCGGGGACGTGGCGCTGGA CCAGGCCTGCTTCCGGATCTCGGGCGCCGCGCGCAACAGCAGCTCCTTCATCACCGGCAGCGTGGCGCGG GCCGTGCCCCACCTGGGCTACGCCATGGCGGCCGGCCGCTTCGGCTGGGGCCTGGCGCACGCGGCGGCCG CCGTGGCCATGAGCCGCCGATACGACCGCGCGCAGAAGGGCTTCCTGCTGACCAGCCTGCGCCGCGCCTA CGCGCCCCTGTTGGCGCGCGAGAACGCGGCGCTGACGGGGGCCGCGGGGAGCCCCGGCGCCGGCGCAGAT GACGAGGGGGTCGCCGCCGTCGCCGCCGCCGCACCGGGCGAGCGCGCGGTGCCCGCCGGGTACGGCGCCG CGGGGATCCTCGCCGCCCTGGGGCGGCTGTCCGCCGCGCCCGCCTCCCCCGCGGGGGGCGACGACCCCGA CGCCGCCCGCCACGCCGACGCCGACGACGACGCCGGGCGCCGCGCCCAGGCCGGCCGCGTGGCCGTCGAG TGCCTGGCCGCCTGCCGCGGGATCCTGGAGGCGCTGGCCGAGGGCTTCGACGGCGACCTGGCGGCCGTCC CGGGGCTGGCCGGGGCCCGGCCCGCCAGCCCCCCGCGGCCGGAGGGACCCGCGGGCCCCGCTTCCCCGCC GCCGCCGCACGCCGACGCGCCCCGCCTGCGCGCGTGGCTGCGCGAGCTGCGGTTCGTGCGCGACGCGCTG
GTGCTCATGCGCCTGCGCGGGGACCTGCGCGTGGCCGGCGGCAGCGAGGCCGCCGTGGCCGCCGTGCGCG CCGTGAGCCTGGTCGCCGGGGCCCTGGGCCCCGCGCTGCCGCGGGACCCGCGCCTGCCGAGCTCCGCGGC CGCCGCCGCCGCGGACCTGCTGTTTGACAACCAGAGCCTGCGCCCCCTGCTGGCGGCGGCGGCCAGCGCA CCGGACGCCGCCGACGCGCTGGCGGCCGCCGCCGCCTCCGCCGCGCCGCGGGAGGGGCGCAAGCGCAAGA GTCCCGGCCCGGCCCGGCCGCCCGGAGGCGGCGGCCCGCGACCCCCGAAGACGAAGAAGAGCGGCGCGGA CGCCCCCGGCTCGGACGCCCGCGCCCCCCTCCCCGCGCCCGCGCCCCCCTCCACGCCCCCGGGGCCCGAG CCCGCCCCCGCCCAGCCCGCGGCGCCCCGGGCCGCCGCGGCGCAGGCCCGCCCGCGCCCCGTGGCGCTGT CGCGCCGGCCCGCCGAGGGCCCCGACCCCCTGGGCGGCTGGCGGCGGCAGCCCCCGGGGCCCAGCCACAC GGCGGCGCCCGCGGCCGCCGCCCTGGAGGCCTACTGCTCCCCGCGCGCCGTGGCCGAGCTCACGGACCAC CCGCTGTTCCCCGTCCCCTGGCGACCGGCCCTCATGTTTGACCCGCGGGCCCTGGCCTCGATCGCCGCGC GGTGCGCCGGGCCCGCCCCCGCCGCCCAGGCCGCGTGCGGCGGCGGCGACGACGACGATAACCCCCACCC CCACGGGGCCGCCGGGGGCCGCCTCTTTGGCCCCCTGCGCGCCTCGGGCCCGCTGCGCCGCATGGCGGCC TGGATGCGCCAGATCCCCGACCCCGAGGACGTGCGCGTGGTGGTGCTGTACTCGCCGCTGCCGGGCGAGG ACCTGGCCGGCGGCGGGGCCTCGGGGGGGCCGCCGGAGTGGTCCGCCGAGCGCGGCGGGCTGTCCTGCCT GCTGGCGGCCCTGGCCAACCGGCTGTGCGGGCCGGACACGGCCGCCTGGGCGGGCAACTGGACCGGCGCC CCCGACGTGTCGGCGCTGGGCGCACAGGGCGTGCTGCTGCTGTCCACGCGGGACCTGGCCTTCGCCGGGG CCGTGGAGTTTCTGGGGCTGCTCGCCAGCGCCGGCGACCGGCGGCTCATCGTGGTCAACACCGTGCGCGC CTGCGACTGGCCCGCCGACGGGCCCGCGGTGTCGCGGCAGCACGCCTACCTGGCGTGCGAGCTGCTGCCC GCCGTGCAGTGCGCCGTGCGCTGGCCGGCGGCGCGGGACCTGCGCCGCACGGTGCTGGCCTCGGGCCGCG TGTTCGGCCCGGGGGTCTTCGCGCGCGTGGAGGCCGCGCACGCGCGCCTGTACCCCGACGCGCCGCCGCT GCGCCTGTGCCGCGGCGGCAACGTGCGCTACCGCGTGCGCACGCGCTTCGGCCCGGACACGCCGGTGCCC ATGTCCCCGCGCGAGTACCGCCGGGCCGTGCTGCCGGCGCTGGACGGCCGGGCGGCGGCCTCGGGGACCA CCGACGCCATGGCGCCCGGCGCGCCGGACTTCTGCGAGGAGGAGGCCCACTCGCACCGCGCCTGCGCGCG CTGGGGCCTGGGCGCGCCGCTGCGGCCCGTGTACGTGGCGCTGGGGCGCGAGGCGGTGCGCGCCGGCCCG GCCCGGTGGCGCGGGCCGCGGAGGGACTTTTGCGCCCGCGCCCTGCTGGAGCCCGACGACGACGCCCCCC CGCTGGTGCTGCGCGGCGACGACGACGGCCCGGGGGCCCTGCCGCCGGCGCCGCCCGGGATTCGCTGGGC CTCGGCCACGGGCCGCAGCGGCACCGTGCTGGCGGCGGCGGGGGCCGTGGAGGTGCTGGGGGCGGAGGCG GGCTTGGCCACGCCCCCGCGGCGGGAAGTTGTGGACTGGGAAGGCGCCTGGGACGAAGACGACGGCGGCG CGTTCGAGGGGGACGGGGTGCTGTAACGGGCCGGGACGGGGCGGGGCGCTTGTGAGACCCGAAGACGCAA T AAAC G G CAACAAC C T GA
SEQ ID NO: 4 UL54 Gene ID: 2703392
ATGGCGACTGACATTGATATGCTAATTGACCTCGGCCTGGACCTCTCCGACAGCGATCTGGACGAGGACC CCCCCGAGCCGGCGGAGAGCCGCCGCGACGACCTGGAATCGGACAGCAGCGGGGAGTGTTCCTCGTCGGA CGAGGACATGGAAGACCCCCACGGAGAGGACGGACCGGAGCCGATACTCGACGCCGCTCGCCCGGCGGTC CGCCCGTCTCGTCCAGAAGACCCCGGCGTACCCAGCACCCAGACGCCTCGTCCGACGGAGCGGCAGGGCC CCAACGATCCTCAACCAGCGCCCCACAGTGTGTGGTCGCGCCTCGGGGCCCGGCGACCGTCTTGCTCCCC CGAGCAGCACGGGGGCAAGGTGGCCCGCCTCCAACCCCCACCGACCAAAGCCCAGCCTGCCCGCGGCGGA CGCCGTGGGCGTCGCAGGGGTCGGGGTCGCGGTGGTCCCGGGGCTGCCGATGGTTTGTCGGACCCCCGCC GGCGTGCCCCCAGAACCAATCGCAACCCTGGGGGACCCCGCCCCGGGGCGGGGTGGACGGACGGCCCCGG CGCCCCCCATGGCGAGGCGTGGCGCGGCAGTGAGCAGCCCGACCCACCCGGAGGCCAGCGGACACGGGGC GTGCGCCAAGCACCCCCCCCGCTAATGACGCTGGCGATTGCCCCCCCGCCCGCGGACCCCCGCGCCCCGG CCCCGGAGCGAAAGGCGCCCGCCGCCGACACCATCGACGCCACCACGCGGTTGGTCCTGCGCTCCATCTC CGAGCGCGCGGCGGTCGACCGCATCAGCGAGAGCTTTGGCCGCAGCGCACAGGTCATGCACGACCCCTTT GGGGGGCAGCCGTTTCCCGCCGCGAATAGCCCCTGGGCCCCGGTGCTGGCGGGCCAAGGAGGGCCCTTTG ACGCCGAGACCAGACGGGTCTCCTGGGAAACCTTGGTCGCCCACGGCCCGAGCCTCTATCGCACTTTTGC
CGGCAATCCTCGGGCCGCATCGACCGCCAAGGCCATGCGCGACTGCGTGCTGCGCCAAGAAAATTTCATC GAGGCGCTGGCCTCCGCCGACGAGACGCTGGCGTGGTGCAAGATGTGCATCCACCACAACCTGCCGCTGC GCCCCCAGGACCCCATTATCGGGACGGCCGCGGCTGTGCTGGATAACCTCGCCACGCGCCTGCGGCCCTT TCTCCAGTGCTACCTGAAGGCGCGAGGCCTGTGCGGCCTGGACGAACTGTGTTCGCGGCGGCGTCTGGCG GACATTAAGGACATTGCATCCTTCGTGTTTGTCATTCTGGCCAGGCTCGCCAACCGCGTCGAGCGTGGCG TCGCGGAGATCGACTACGCGACCCTTGGTGTCGGGGTCGGAGAGAAGATGCATTTCTACCTCCCCGGGGC CTGCATGGCGGGCCTGATCGAAATCCTAGACACGCACCGCCAGGAGTGTTCGAGTCGTGTCTGCGAGTTG ACGGCCAGTCACATCGTCGCCCCCCCGTACGTGCACGGCAAATATTTTTATTGCAACTCCCTGTTTTAGG
TACAATAAA
SEQ ID NO: 5 UL29 Gene ID: 2703458
ATGGAGACAAAGCCCAAGACGGCAACCACCATCAAGGTCCCCCCCGGGCCCCTGGGATACGTGTACGCTC GCGCGTGTCCGTCCGAAGGCATCGAGCTTCTGGCGTTACTGTCGGCACGCAGCGGCGATTCCGACGTCGC CGTGGCGCCCCTGGTCGTGGGCCTGACCGTGGAGAGCGGCTTTGAGGCCAACGTGGCCGTGGTCGTGGGT TCTCGCACGACGGGGCTCGGGGGTACCGCGGTGTCCCTGAAACTGACGCCCTCGCACTACAGCTCGTCCG TGTACGTCTTTCACGGCGGCCGGCACCTGGACCCCAGCACCCAGGCCCCGAACCTGACGCGACTTTGCGA GCGGGCACGCCGCCATTTTGGCTTTTCGGACTACACCCCCCGGCCCGGCGACCTCAAACACGAGACGACG GGGGAGGCGCTGTGTGAGCGCCTCGGCCTGGACCCGGACCGCGCCCTCCTGTATCTGGTCGTTACCGAGG GCTTCAAGGAGGCCGTGTGCATCAACAACACCTTTCTGCACCTGGGAGGCTCGGACAAGGTAACCATAGG CGGGGCGGAGGTGCACCGCATACCCGTGTACCCGTTGCAGCTGTTCATGCCGGATTTTAGCCGTGTCATC GCAGAGCCGTTCAACGCCAACCACCGATCGATCGGGGAGAATTTTACCTACCCGCTTCCGTTTTTTAACC GCCCCCTCAACCGCCTCCTGTTCGAGGCGGTCGTGGGACCCGCCGCCGTGGCACTGCGATGCCGAAACGT GGACGCCGTGGCCCGCGCGGCCGCCCACCTGGCGTTTGACGAAAACCACGAGGGCGCCGCCCTCCCCGCC GACATTACGTTCACGGCCTTCGAAGCCAGCCAGGGTAAGACCCCGCGGGGCGGGCGCGACGGCGGCGGCA AGGGCCCGGCGGGCGGGTTCGAACAGCGCCTGGCCTCCGTCATGGCCGGAGACGCCGCCCTGGCCCTCGA GTCTATCGTGTCGATGGCCGTCTTTGACGAGCCGCCCACCGACATCTCCGCGTGGCCGCTGTTCGAGGGC CAGGACACGGCCGCGGCCCGCGCCAACGCCGTCGGGGCGTACCTGGCGCGCGCCGCGGGACTCGTGGGGG CCATGGTATTTAGCACCAACTCGGCCCTCCATCTCACCGAGGTGGACGACGCCGGCCCGGCGGACCCAAA GGACCACAGCAAACCCTCCTTTTACCGCTTCTTCCTCGTGCCCGGGACCCACGTGGCGGCCAACCCACAG GTGGACCGCGAGGGACACGTGGTGCCCGGGTTCGAGGGTCGGCCCACCGCGCCCCTCGTCGGCGGAACCC AGGAATTTGCCGGCGAGCACCTGGCCATGCTGTGTGGGTTTTCCCCGGCGCTGCTGGCCAAGATGCTGTT TTACCTGGAGCGCTGCGACGGCGGCGTGATCGTCGGGCGCCAGGAGATGGACGTGTTTCGATACGTCGCG GACTCCAACCAGACCGACGTGCCCTGTAACCTATGCACCTTCGACACGCGCCACGCCTGCGTACACACGA CGCTCATGCGCCTCCGGGCGCGCCATCCAAAGTTCGCCAGCGCCGCCCGCGGAGCCATCGGCGTCTTCGG GACCATGAACAGCATGTACAGCGACTGCGACGTGCTGGGAAACTACGCCGCCTTCTCGGCCCTGAAGCGC GCGGACGGATCCGAGACCGCCCGGACCATCATGCAGGAGACGTACCGCGCGGCGACCGAGCGCGTCATGG CCGAACTCGAGACCCTGCAGTACGTGGACCAGGCGGTCCCCACGGCCATGGGGCGGCTGGAGACCATCAT CACCAACCGCGAGGCCCTGCATACGGTGGTGAACAACGTCAGGCAGGTCGTGGACCGCGAGGTGGAGCAG CTGATGCGCAACCTGGTGGAGGGGAGGAACTTCAAGTTTCGCGACGGTCTGGGCGAGGCCAACCACGCCA TGTCCCTGACGCTGGACCCGTACGCGTGCGGGCCGTGCCCCCTGCTTCAGCTTCTCGGGCGGCGATCCAA CCTCGCCGTGTACCAGGACCTGGCCCTGAGTCAGTGCCACGGGGTGTTCGCCGGGCAGTCGGTCGAGGGG CGCAACTTTCGCAATCAATTCCAACCGGTGCTGCGGCGGCGCGTGATGGACATGTTTAACAACGGGTTTC TGTCGGCCAAAACGCTGACGGTCGCGCTCTCGGAGGGGGCGGCTATCTGCGCCCCCAGCCTAACGGCCGG CCAGACGGCCCCCGCCGAGAGCAGCTTCGAGGGCGACGTTGCCCGCGTGACCCTGGGGTTTCCCAAGGAG CTGCGCGTCAAGAGCCGCGTGTTGTTCGCGGGCGCGAGCGCCAACGCGTCCGAGGCCGCCAAGGCGCGGG TCGCCAGCCTCCAGAGCGCCTACCAGAAGCCCGACAAGCGCGTGGACATCCTCCTCGGACCGCTGGGCTT
TCTGCTGAAGCAGTTCCACGCGGCCATCTTCCCCAACGGCAAGCCCCCGGGGTCCAACCAGCCGAACCCG CAGTGGTTCTGGACGGCCCTCCAACGCAACCAGCTTCCCGCCCGGCTCCTGTCGCGCGAGGACATCGAGA CCATCGCGTTCATTAAAAAGTTTTCCCTGGACTACGGCGCGATAAACTTTATTAACCTGGCCCCCAACAA CGTGAGCGAGCTGGCGATGTACTACATGGCAAACCAGATTCTGCGGTACTGCGATCACTCGACATACTTC ATCAACACCCTTACGGCCATCATCGCGGGGTCCCGCCGTCCCCCCAGCGTGCAGGCTGCGGCCGCGTGGT CCGCGCAGGGCGGGGCGGGCCTGGAGGCCGGGGCCCGCGCGCTGATGGACGCCGTGGACGCGCATCCGGG CGCGTGGACGTCCATGTTCGCCAGCTGCAACCTGCTGCGGCCCGTCATGGCGGCGCGCCCCATGGTCGTG TTGGGGTTGAGCATCAGCAAGTACTACGGCATGGCCGGCAACGACCGTGTGTTTCAGGCCGGGAACTGGG CCAGCCTGATGGGCGGCAAAAACGCGTGCCCGCTCCTTATTTTTGACCGCACCCGCAAGTTCGTCCTGGC CTGTCCCCGGGCCGGGTTTGTGTGCGCGGCCTCAAGCCTCGGCGGCGGAGCGCACGAAAGCTCGCTGTGC GAGCAGCTCCGGGGCATTATCTCCGAGGGCGGGGCGGCCGTCGCCAGTAGCGTGTTCGTGGCGACCGTGA AAAGCCTGGGGCCCCGCACCCAGCAGCTGCAGATCGAGGACTGGCTGGCGCTCCTGGAGGACGAGTACCT AAGCGAGGAGATGATGGAGCTGACCGCGCGTGCCCTGGAGCGCGGCAACGGCGAGTGGTCGACGGACGCG GCCCTGGAGGTGGCGCACGAGGCCGAGGCCCTAGTCAGCCAACTCGGCAACGCCGGGGAGGTGTTTAACT TTGGGGATTTTGGCTGCGAGGACGACAACGCGACGCCGTTCGGCGGCCCGGGGGCCCCGGGACCGGCATT TGCCGGCCGCAAACGGGCGTTCCACGGGGATGACCCGTTTGGGGAGGGGCCCCCCGACAAAAAGGGAGAC CTGACGTTGGATATGCTGTGAGGGGTTGGGGGGTGGGGGAACCTAGGGCGGGGCGGGGAATGTGTGTAAA ATAAA
SEQ ID NO: 6 UL30 Gene ID: 2703458
ATGTTTTCCGGTGGCGGCGGCCCGCTGTCCCCCGGAGGAAAGTCGGCGGCCAGGGCGGCGTCCGGGTTTT TTGCGCCCGCCGGCCCTCGCGGAGCCAGCCGGGGACCCCCGCCTTGTTTGAGGCAAAACTTTTACAACCC CTACCTCGCCCCAGTCGGGACGCAACAGAAGCCGACCGGGCCAACCCAGCGCCATACGTACTATAGCGAA TGCGATGAATTTCGATTCATCGCCCCGCGGGTGCTGGACGAGGATGCCCCCCCGGAGAAGCGCGCCGGGG TGCACGACGGTCACCTCAAGCGCGCCCCCAAGGTGTACTGCGGGGGGGACGAGCGCGACGTCCTCCGCGT CGGGTCGGGCGGCTTCTGGCCGCGGCGCTCGCGCCTGTGGGGCGGCGTGGACCACGCCCCGGCGGGGTTC AACCCCACCGTCACCGTCTTTCACGTGTACGACATCCTGGAGAACGTGGAGCACGCGTACGGCATGCGCG CGGCCCAGTTCCACGCGCGGTTTATGGACGCCATCACACCGACGGGGACCGTCATCACGCTCCTGGGCCT GACTCCGGAAGGCCACCGGGTGGCCGTTCACGTTTACGGCACGCGGCAGTACTTTTACATGAACAAGGAG GAGGTCGACAGGCACCTACAATGCCGCGCCCCACGAGATCTCTGCGAGCGCATGGCCGCGGCCCTGCGCG AGTCCCCGGGCGCGTCGTTCCGCGGCATCTCCGCGGACCACTTCGAGGCGGAGGTGGTGGAGCGCACCGA CGTGTACTACTACGAGACGCGCCCCGCTCTGTTTTACCGCGTCTACGTCCGAAGCGGGCGCGTGCTGTCG TACCTGTGCGACAACTTCTGCCCGGCCATCAAGAAGTACGAGGGTGGGGTCGACGCCACCACCCGGTTCA TCCTGGACAACCCCGGGTTCGTCACCTTCGGCTGGTACCGTCTCAAACCGGGCCGGAACAACACGCTAGC CCAGCCGCGGGCCCCGATGGCCTTCGGGACATCCAGCGACGTCGAGTTTAACTGTACGGCGGACAACCTG GCCATCGAGGGGGGCATGAGCGACCTACCGGCATACAAGCTCATGTGCTTCGATATCGAATGCAAGGCGG GGGGGGAGGACGAGCTGGCCTTTCCGGTGGCCGGGCACCCGGAGGACCTGGTCATCCAGATATCCTGTCT GCTCTACGACCTGTCCACCACCGCCCTGGAGCACGTCCTCCTGTTTTCGCTCGGTTCCTGCGACCTCCCC GAATCCCACCTGAACGAGCTGGCGGCCAGGGGCCTGCCCACGCCCGTGGTTCTGGAATTCGACAGCGAAT TCGAGATGCTGTTGGCCTTCATGACCCTTGTGAAACAGTACGGCCCCGAGTTCGTGACCGGGTACAACAT CATCAACTTCGACTGGCCCTTCTTGCTGGCCAAGCTGACGGACATTTACAAGGTCCCCCTGGACGGGTAC GGCCGCATGAACGGCCGGGGCGTGTTTCGCGTGTGGGACATAGGCCAGAGCCACTTCCAGAAGCGCAGCA AGATAAAGGTGAACGGCATGGTGAACATCGACATGTACGGGATTATAACCGACAAGATCAAGCTCTCGAG CTACAAGCTCAACGCCGTGGCCGAAGCCGTCCTGAAGGACAAGAAGAAGGACCTGAGCTATCGCGACATC CCCGCCTACTACGCCGCCGGGCCCGCGCAACGCGGGGTGATCGGCGAGTACTGCATACAGGATTCCCTGC TGGTGGGCCAGCTGTTTTTTAAGTTTTTGCCCCATCTGGAGCTCTCGGCCGTCGCGCGCTTGGCGGGTAT
TAACATCACCCGCACCATCTACGACGGCCAGCAGATCCGCGTCTTTACGTGCCTGCTGCGCCTGGCCGAC
CAGAAGGGCTTTATTCTGCCGGACACCCAGGGGCGATTTAGGGGCGCCGGGGGGGAGGCGCCCAAGCGTC CGGCCGCAGCCCGGGAGGACGAGGAGCGGCCAGAGGAGGAGGGGGAGGACGAGGACGAACGCGAGGAGGG CGGGGGCGAGCGGGAGCCGGAGGGCGCGCGGGAGACCGCCGGCAGGCACGTGGGGTACCAGGGGGCCAGG GTCCTTGACCCCACTTCCGGGTTTCACGTGAACCCCGTGGTGGTGTTCGACTTTGCCAGCCTGTACCCCA GCATCATCCAGGCCCACAACCTGTGCTTCAGCACGCTCTCCCTGAGGGCCGACGCAGTGGCGCACCTGGA GGCGGGCAAGGACTACCTGGAGATCGAGGTGGGGGGGCGACGGCTGTTCTTCGTCAAGGCTCACGTGCGA GAGAGCCTCCTCAGCATCCTCCTGCGGGACTGGCTCGCCATGCGAAAGCAGATCCGCTCGCGGATTCCCC AGAGCAGCCCCGAGGAGGCCGTGCTCCTGGACAAGCAGCAGGCCGCCATCAAGGTCGTGTGTAACTCGGT GTACGGGTTCACGGGAGTGCAGCACGGACTCCTGCCGTGCCTGCACGTTGCCGCGACGGTGACGACCATC GGCCGCGAGATGCTGCTCGCGACCCGCGAGTACGTCCACGCGCGCTGGGCGGCCTTCGAACAGCTCCTGG CCGATTTCCCGGAGGCGGCCGACATGCGCGCCCCCGGGCCCTATTCCATGCGCATCATCTACGGGGACAC GGACTCCATCTTTGTGCTGTGCCGCGGCCTCACGGCCGCCGGGCTGACGGCCGTGGGCGACAAGATGGCG AGCCACATCTCGCGCGCGCTGTTTCTGCCCCCCATCAAACTCGAGTGCGAAAAGACGTTCACCAAGCTGC TGCTGATCGCCAAGAAAAAGTACATCGGCGTCATCTACGGGGGTAAGATGCTCATCAAGGGCGTGGATCT GGTGCGCAAAAACAACTGCGCGTTTATCAACCGCACCTCCAGGGCCCTGGTCGACCTGCTGTTTTACGAC GATACCGTCTCCGGAGCGGCCGCCGCGTTAGCCGAGCGCCCCGCGGAGGAGTGGCTGGCGCGACCCCTGC CCGAGGGACTGCAGGCGTTCGGGGCCGTCCTCGTAGACGCCCATCGGCGCATCACCGACCCGGAGAGGGA CATCCAGGACTTTGTCCTCACCGCCGAACTGAGCAGACACCCGCGCGCGTACACCAACAAGCGCCTGGCC CACCTGACGGTGTATTACAAGCTCATGGCCCGCCGCGCGCAGGTCCCGTCCATCAAGGACCGGATCCCGT ACGTGATCGTGGCCCAGACCCGCGAGGTAGAGGAGACGGTCGCGCGGCTGGCCGCCCTCCGCGAGCTAGA CGCCGCCGCCCCAGGGGACGAGCCCGCCCCCCCCGCGGCCCTGCCCTCCCCGGCCAAGCGCCCCCGGGAG ACGCCGTCGCCTGCCGACCCCCCGGGAGGCGCGTCCAAGCCCCGCAAGCTGCTGGTGTCCGAGCTGGCCG AGGATCCCGCATACGCCATTGCCCACGGCGTCGCCCTGAACACGGACTATTACTTCTCCCACCTGTTGGG GGCGGCGTGCGTGACATTCAAGGCCCTGTTTGGGAATAACGCCAAGATCACCGAGAGTCTGTTAAAAAGG TTTATTCCCGAAGTGTGGCACCCCCCGGACGACGTGGCCGCGCGGCTCCGGACCGCAGGGTTCGGGGCGG TGGGTGCCGGCGCTACGGCGGAGGAAACTCGTCGAATGTTGCATAGAGCCTTTGATACTCTAGCATGAGC CCCCCGTCGAAGCTGATGTCCCTCATTTTACAATAAA
[0192] The genomic sequence for HSV-1 and other herpes viruses are available publically and can be obtained for example from genbank™ For example, HSV-1, NC 001806.2. The target sequence for the methods and compositions herein can be in a coding region or non-coding region of the genome. Pharmaceutical compositions
[0193] As described above, the compositions described herein can be prepared in a variety of ways known to one of ordinary skill in the art. Regardless of their original source or the manner in which they are obtained, the compositions described herein can be formulated in accordance with their use. For example, the nucleic acids and vectors described above can be formulated within compositions for application to cells in tissue culture or for administration to a patient or subject. Any of the
pharmaceutical compositions of this disclosure can be formulated for use in the preparation of a medicament, and particular uses are indicated below in the context of treatment, e.g., the treatment of a subject having an herpesvirus infection or at risk for contracting and herpesvirus infection (e.g., an HSV-
1 infection). When employed as pharmaceuticals, any of the nucleic acids and vectors can be administered in the form of pharmaceutical compositions. These compositions can be prepared in a manner well known in the pharmaceutical art, and can be administered by a variety of routes, depending
upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including intranasal), pulmonary (e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), ocular, oral or parenteral. Methods for ocular delivery can include topical administration (eye drops), subconjunctival, periocular or intravitreal injection or introduction by balloon catheter or ophthalmic inserts surgically placed in the conjunctival sac. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular administration. Parenteral administration can be in the form of a single bolus dose, or may be, for example, by a continuous perfusion pump. Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, powders, and the like. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
[0194] This disclosure also includes pharmaceutical compositions which contain, as the active ingredient, nucleic acids and vectors described herein in combination with one or more pharmaceutically acceptable carriers. We use the terms "pharmaceutically acceptable" (or "pharmacologically acceptable") to refer to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal or a human, as appropriate. The term "pharmaceutically acceptable carrier," as used herein, includes any and all solvents, dispersion media, coatings, antibacterial, isotonic and absorption delaying agents, buffers, excipients, binders, lubricants, gels, surfactants and the like, that may be used as media for a pharmaceutically acceptable substance. In making the compositions of this disclosure, the active ingredient is typically mixed with an excipient, diluted by an excipient or enclosed within such a carrier in the form of, for example, a capsule, tablet, sachet, paper, or other container. When the excipient serves as a diluent, it can be a solid, semisolid, or liquid material (e.g., normal saline), which acts as a vehicle, carrier or medium for the active ingredient. Thus, the compositions can be in the form of tablets, pills, powders, lozenges, sachets, cachets, elixirs, suspensions, emulsions, solutions, syrups, aerosols (as a solid or in a liquid medium), lotions, creams, ointments, gels, soft and hard gelatin capsules, suppositories, sterile injectable solutions, and sterile packaged powders. As is known in the art, the type of diluent can vary depending upon the intended route of administration. The resulting compositions can include additional agents, such as preservatives. In some embodiments, the carrier can be, or can include, a lipid-based or polymer-based colloid. In some embodiments, the carrier material can be a colloid formulated as a liposome, a hydrogel, a micropaticle, a nanoparticle, or a block copolymer micelle. As noted, the carrier material can form a capsule, and that material may be a polymer-based colloid.
[0195] The nucleic acid sequences of this disclosure can be delivered to an appropriate cell or a subject using a viral or non-viral delivery vector descnbed above. The nucleic acids and vectors may also be applied to a surface of a device (e.g., a catheter) or contained within a pump, patch, or other drug delivery device. The nucleic acids and vectors of this disclosure can be administered alone, or in a
mixture, in the presence of a pharmaceutically acceptable excipient or carrier (e.g., physiological saline). The excipient or carrier is selected on the basis of the mode and route of administration. Suitable pharmaceutical carriers, as well as pharmaceutical necessities for use in pharmaceutical formulations, are described in Remington's Pharmaceutical Sciences (E. W. Martin), a well-known reference text in this field, and in the USP/NF (United States Pharmacopeia and the National Formulary).
[0196] Alternatively, the compositions can comprise CRISPR-associated endonuclease polypeptide, e.g., Cas9 polypeptide or a variant Cas9 polypeptide and one or a combination of gRNAs. Non-limiting example of such a composition can be a nanoparticle CRISPR-associated endonuclease polypeptide, e.g., Cas9 polypeptide or a variant Cas9 polypeptide and one or a combination of gRNAs. The present formulations can encompass a vector encoding Cas9 polypeptide and a gRNA sequence complementary to a target herpesvirus. The gRNA sequence can include a sequence complementary to a single region, or it can include any combination of sequences complementary to different regions of the viral genome. Alternatively the sequence encoding Cas9 polypeptide and the sequence encoding the gRNA sequence can be on separate vectors. Non-limiting exemplary sequences of the Cas9 polypeptide are presented in SEQ ID NO: 1 and SEQ ID NO: 2.
Applications and methods of treatment
[0197] The methods, compositions, and kits described herein are useful for inactivating a herpesvirus (e.g., HSV-1 virus). The methods, compositions, and kits described herein are useful to inactivate latent virus as well as actively replicating lytic viruses. As such the methods and compositions are useful for preventing reactivation of herpesvirus infection. In some embodiments, the methods and compositions are useful for treatment of herpesvirus infection e.g., an HSV-1 infection and/or herpesvirus related disease.
[0198] A subject is effectively treated whenever a clinically beneficial result ensues. This may mean, for example, a complete resolution of the symptoms of a disease, a decrease in the severity of the symptoms of the disease, or a slowing of the disease's progression. These methods can further include the steps of a) identifying a subject (e.g., a patient and, more specifically, a human patient) who has an herpesvirus infection (e.g., HSV-1 infection); and b) providing to the subject a composition comprising a nucleic acid encoding a CRISPR-associated nuclease, e.g., Cas9, and a guide RNA complementary to an herpesvirus target sequence, e.g. a protein coding sequence. A subject can be identified using standard clinical tests, for example, viral antigen detection, viral DNA detection, detection of antibodies to HSV-1. In some embodiments of any one aspect described herein, the infection is diagnosed based on the presence of characteristic herpesvirus sores.
[0199] In some embodiments of any one aspect described herein, a therapeutically effective amount of a composition is provided to the subject, resulting in a complete resolution of the symptoms of the infection, a decrease in the severity of the symptoms of the infection, or a slowmg of the infection's progression is considered a therapeutically effective amount. In some embodiments of any one aspect described herein, the present methods may also include a monitoring step to help optimize dosing and scheduling as well as predict outcome. In some embodiments of any one aspect described herein, one can
first determine whether a patient has a latent herpesvirus infection (e.g., latent HSV-1 infection), and then make a determination as to whether or not to treat the patient with one or more of the compositions described herein.
[0200] The compositions described herein are also useful for the treatment, for example, as a prophylactic treatment, of a subject at risk for having a herpesvirus infection, e.g., an HSV-1 infection or at a risk of recurrence of herpesvirus infection. These methods can further include the steps of a) identifying a subject at risk for having a herpesvirus infection; b) providing to the subject a composition comprising a nucleic acid encoding a CRISPR-associated nuclease, e.g., Cas9, and a guide RNA complementary to a herpesvirus target sequence. A subject at risk for having an HSV-1 infection can be, for example, an individual whose occupation may bring him or her into contact with HSV-1 -infected populations, e.g., healthcare workers or first responders. The compositions can also be administered to a pregnant or lactating woman having an HSV-1 infection in order to reduce the likelihood of transmission of HSV-1 from the mother to her offspring. In some embodiments, the subject can be previously treated for an herpesvirus infection and is suspected to harbor a latent infection.
[0201] The methods of this disclosure can be expressed in terms of the preparation of a medicament. Accordingly, the disclosure encompasses the use of the agents and compositions described herein in the preparation of a medicament. The compounds described herein are useful in therapeutic compositions and regimens or for the manufacture of a medicament for use in treatment of diseases or conditions as described herein. Any composition described herein can be administered to any part of the host's body for subsequent delivery to a target cell. A composition can be delivered to, without limitation, the brain, the cerebrospinal fluid, joints, nasal mucosa, blood, lungs, intestines, muscle tissues, skin, or the peritoneal cavity of a mammal. In terms of routes of delivery, a composition can be administered by intravenous, intracranial, intraperitoneal, intramuscular, subcutaneous, intramuscular, intrarectal, intravaginal, intrathecal, intratracheal, intradermal, or transdermal injection, by oral or nasal administration, or by gradual perfusion over time. In a further example, an aerosol preparation of a composition can be given to a host by inhalation.
[0202] A person skilled in the art would be able to determine an appropriate dosage for the compositions disclosed herein. The compositions are administered in sufficient amounts to enter the desired cells and to guarantee sufficient levels of functionality of the transferred nucleic acid composition to provide a therapeutic benefit without undue adverse, or with medically acceptable physiological effects as determined by those skilled in the medical arts. Typically, the dosage required will depend on the route of administration, the nature of the formulation, the nature of the patient's illness, the patient's size, weight, surface area, age, and sex, other drugs being administered, and the judgment of the attending clinicians. Wide variations in the needed dosage are to be expected in view of the variety of cellular targets and the differing efficiencies of various routes of administration. Variations in these dosage levels can be adjusted using standard empirical routines for optimization, as is well understood in the art. Administrations can be single or multiple (e.g., 2- or 3-, 4-, 6-, 8-, 10-, 20-, 50-, 100-, 150-, or
more fold). Encapsulation of the compounds in a suitable delivery vehicle (e.g., polymeric microparticles or implantable devices) may increase the efficiency of delivery.
[0203] The duration of treatment with any composition provided herein can be any length of time from as short as one day to as long as the life span of the host (e.g., many years). For example, a composition can be administered once a week (for, for example, 4 weeks to many months or years); once a month (for, for example, three to twelve months or for many years); or once a year for a period of 5 years, ten years, or longer. It is also noted that the frequency of treatment can be variable. For example, the present composition described herein can be administered once (or twice, three times, etc.) daily, weekly, monthly, or yearly.
[0204] An effective amount of any composition provided herein can be administered to an individual in need of treatment. The compositions may also be administered with another therapeutic agent, for example, an anti-viral agent, e.g., anti-viral drugs. Exemplary anti-viral agents include acyclovir, ganciclovir, foscarnet, cidofovir, famciclovir, valganciclovir, and valaciclovir. Concurrent administration of two or more therapeutic agents does not require that the agents be administered at the same time or by the same route, as long as there is an overlap in the time period during which the agents are exerting their therapeutic effect. Simultaneous or sequential administration is contemplated, as is administration on different days or weeks. The therapeutic agents may be administered under a metronomic regimen, e.g., continuous low-doses of a therapeutic agent. In some embodiments, the subject is resistant or unresponsive to treatment with one or more of the anti-viral drugs.
[0205] As described, a therapeutically effective amount of a composition (i.e., an effective dosage) means an amount sufficient to produce a therapeutically (e.g., clinically) desirable result The compositions can be administered one from one or more times per day to one or more times per week; including once every other day. The skilled artisan will appreciate that certain factors can influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of the compositions of the disclosure can include a single treatment or a series of treatments.
[0206] Also provided are methods of inactivating a herpesvirus in a mammalian cell (e.g., a sensory neuron). In some embodiments, the herpesvirus is a HSV-1. The methods can include exposing the cell to a composition comprising an isolated nucleic acid encoding a Cas9 molecule and one or combination of gRNAs wherein the gRNA comprises a targeting domain complementary to a target sequence in the herpesvirus genome. The contacting step can take place in vivo, that is, the compositions can be administered directly to a subject having herpesvirus infection (e.g., HSV-1 infection). The methods are not so limited however, and the contacting step can take place ex vivo. For example, a cell or plurality of cells, or a tissue explant, can be removed from a subject having a herpesvirus infection infection and placed in culture, and then contacted with a composition comprising a Cas9 molecule and one or combination of gRNA, wherein the gRNA is complementary to the nucleic acid sequence in the herpesvirus (e.g., HSV-1 virus). As described above, composition can be a nucleic acid encoding a Cas9
molecule and one or combination of gRNA wherein the gRNA comprises a targeting domain complementary with a target sequence in the herpesvirus; an expression vector comprising the nucleic acid sequence; or a pharmaceutical composition comprising a nucleic acid encoding a CRISPR- associated endonuclease and one or combination of gRNA; or an expression vector comprising the nucleic acid sequence. In some embodiments, the gene editing complex can comprise a CRISPR- associated endonuclease polypeptide and one or a combination of gRNA wherein the gRNA comprises a targeting domain complementary to a target sequence in the herpesvirus nucleic acid.
[0207] Regardless of whether compositions are administered as nucleic acids or polypeptides, they are formulated in such a way as to promote uptake by the mammalian cell. Useful vector systems and formulations are described above.
Kits
[0208] Packaged products (e.g., sterile containers containing one or more of the compositions described herein and packaged for storage, shipment, or sale at concentrated or ready-to-use
concentrations) and kits, including at least one composition of this disclosure, e.g., a nucleic acid sequence encoding a CRISPR-associated endonuclease, for example, a Cas9 endonuclease, and one or combination of gRNAs disclosed herein, or a vector encoding that nucleic acid and instructions for use, are also within the scope of the disclosure. A product can include a container (e.g., a vial, jar, bottle, bag, or the like) containing one or more compositions of this disclosure. In addition, an article of manufacture further may include, for example, packaging materials, instructions for use, syringes, delivery devices, buffers or other control reagents for treating or monitoring the condition for which prophylaxis or treatment is required. In some embodiments, the kit can include one or more additional anti-viral agents.
[0209] The additional agents can be packaged together in the same container as a nucleic acid sequence encoding a CRISPR-associated endonuclease, for example, a Cas9 endonuclease, and one or combination of gRNAs disclosed herein, or a vector encoding nucleic acid or they can be packaged separately. The nucleic acid sequence encoding a CRISPR- associated endonuclease, for example, a Cas9 endonuclease, and one or combination of gRNAs disclosed herein, or a vector encoding nucleic acid and the additional agent may be combined just before use or administered separately. The product may also include a legend (e.g., a printed label or insert or other medium describing the product's use (e.g., an audio- or videotape). The legend can be associated with the container (e.g., affixed to the container) and can describe the manner in which the compositions therein should be administered (e.g., the frequency and route of administration), indications therefor, and other uses. The compositions can be ready for administration (e.g., present in dose -appropriate units), and may include one or more additional pharmaceutically acceptable adjuvants, carriers or other diluents and/or an additional therapeutic agent. Alternatively, the compositions can be provided in a concentrated form with a diluent and instructions for dilution.
[0210] The present invention can be defined in any of the following numbered paragraphs:
[I] . A method of inactivation of a herpesvirus in a mammalian cell, the method comprising introducing into the cell:
(a) a Cas9 molecule and
(b) a first gRNA comprising a targeting domain which is complementary with a target sequence from the gene Rsl (SEQ ID NO: 3), UL54 (SEQ ID NO: 4), UL29 (SEQ ID NO: 5), UL30 (SEQ ID NO: 6) or a homolog thereof; and optionally (c) a second gRNA comprising a targeting domain which is complementary with a second target sequence from the gene Rsl, UL54, UL29, UL30 or a homolog thereof in the herpesvirus.
[2] . The method of paragraph 1, comprising introducing into said cell (a), (b), and (c).
[3] . The method of any one of paragraphs 1-2, wherein (b) comprises a first sequence selected from Table 1, Table 2, Table 3, Table 4, or Table 5 and (c) comprises a second sequence selected from Table 1, Table 2, Table 3, Table 4, or Table 5, wherein the second sequence is not the same as the first.
[4] . The method of any one of paragraphs 1-3, wherein (b) comprises the sequence UL30-1 (SEQ ID NO: 13) or UL30-2 (SEQ ID NO: 14) and (c) comprises the sequence UL29-1 (SEQ ID NO: 11) or UL29-2 (SEQ ID NO: 12).
[5] . The method of paragraph 4, wherein (b) comprises the sequence UL30-2 (SEQ ID NO: 14) and (c) comprises the sequence UL29-2 (SEQ ID NO: 12).
[6] . The method of any one of paragraphs 1-5, wherein the herpesvirus is latent.
[7] , The method of any one of paragraphs 1-6, wherein the herpesvirus is selected from the group; herpes simplex virus- 1 (HSV-1), herpes simplex virus-2 (HSV-2), varicella zoster virus, Epstein- Barr virus, cytomegalovirus, human herpesvirus 6, human herpesvirus 7, or Kaposi's sarcoma- associated herpesvirus.
[8] . The method of paragraph 7, wherein the herpesvirus is herpes simplex virus- 1 (HSV-1).
[9] . The method of any one of paragraphs 1-8, wherein the introducing step comprises introducing into the cell a vector that encodes for one or combination of (a), (b) and (c).
[10] . The method of paragraph 9, wherein the vector is a viral vector.
[I I] . The method of paragraph 10, wherein the viral vector is selected from the group;
retrovirus, lentivirus, adenovirus, herpesvirus, poxvirus, alpha virus, vaccinia virus, and adeno- associated viruses.
[12] . The method of paragraph 9, wherein the vector is a non-viral vector.
[13] . The method of paragraph 12, wherein the non-viral vector is selected from the group consisting of a nanoparticle, a cationic lipid, a cationic polymer, a metallic nanoparticle, a nanorod, a liposome, microbubbles, a cell penetrating peptide and a liposphere.
[14] . The method of paragraph 13, wherein the non-viral vector compnses poly ethelenegly col.
[15] . The method of any one of paragraphs 1-8, wherein the introducing step comprises
introducing a complex of Cas9 molecule and one or both of (b) and (c).
[16] . The method of any one of paragraphs 1-15, wherein the Cas9 molecule is a Cas9 polypeptide or a functional fragment thereof.
[17] . The method of any one of paragraphs 1-16, wherein the Cas9 molecule comprises a sequence of SEQ ID NO: 1 or SEQ ID NO: 2 or a functional fragment thereof.
[18] . The method of any one of paragraphs 1-17, wherein the introducing results in alteration of the target sequence.
[1 ] . The method of paragraph 18, wherein the alteration is a mutation selected from the group consisting of a deletion, an insertion, or a point mutation.
[20] . The method of any one of paragraphs 18-19, wherein the alteration results in inactivation of viral gene expression, viral replication or viral reactivation.
[21] . The method of any one of paragraphs 1-20, wherein the inactivation is in vivo.
[22] . The method of any one of paragraphs 1-20, wherein the inactivation is ex vivo.
[23] . The method of paragraph 22, wherein the cell comprises a cultured cell from a subject having a herpesvirus infection, a tissue explant or a cell line.
[24] . The method of any one of paragraphs 1-23, wherein the mammalian cell is a sensory neuron.
[25] . The method of any one of paragraphs 1-24, for use in treatment of herpesvirus infection or a herpesvirus related disease.
[26] . The method of paragraph 25, wherein the herpesvirus related disease is selected from the group; genital herpes, HSV gingivostomatitis and recurrent herpes labialis, HSV keratitis or keratoconjunctivitis, meningitis or herpes simplex encephalitis (HSE).
[27] . A gRNA molecule comprising a targeting domain which is complementary with a target sequence from the Rs l, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus.
[28] . The gRNA molecule of paragraph 27, wherein said targeting domain is complementary with a target domain from the Rsl gene or a conserved homolog thereof in the herepesvirus.
[29] . The gRNA molecule of paragraph 28, wherein the gRNA molecule comprises a nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 7, SEQ. ID. NO: 8, SEQ. ID. NO: 49, SEQ. ID. NO: 50, SEQ. ID. NO: 51, SEQ. ID. NO: 52, SEQ. ID. NO: 53, SEQ. ID. NO: 54, SEQ. ID. NO: 55, SEQ. ID. NO: 56, SEQ. ID. NO: 57, SEQ. ID. NO: 58, or SEQ ID. NO: 59.
[30] . The gRNA molecule of paragraph 27, wherein said targeting domain is complementary with a target domain from the UL29 gene or a conserved homolog thereof in the herepesvirus.
[31] . The gRNA molecule of paragraph 30, wherein the gRNA molecule comprises a nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 11, SEQ. ID. NO: 12, SEQ.
ID. NO: 26, SEQ. ID. NO: 27, SEQ. ID. NO: 28, SEQ. ID. NO: 29, SEQ. ID. NO: 30, SEQ. ID.
NO: 31, SEQ. ID. NO: 32, SEQ. ID. NO: 33, SEQ. ID. NO: 34, SEQ. ID. NO: 35 or SEQ ID.
NO: 36.
[32] . The gRNA molecule of paragraph 27, wherein said targeting domain is complementary with a target domain from the UL30 gene or a conserved homolog thereof in the herepesvirus.
[33] . The gRNA molecule of paragraph 32, wherein the gRNA molecule comprises a nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 13, SEQ. ID. NO: 14, SEQ.
ID. NO: 15, SEQ. ID. NO: 16, SEQ. ID. NO: 17, SEQ. ID. NO: 18, SEQ. ID. NO: 19, SEQ. ID.
NO: 20, SEQ. ID. NO: 21, SEQ. ID. NO: 22, SEQ. ID. NO: 23, SEQ. ID. NO: 24 or SEQ ID.
NO: 25.
[34] . The gRNA molecule of paragraph 27, wherein said targeting domain is complementary with a target domain from the UL54 gene or a conserved homolog thereof in the herepesvirus.
[35] . The gRNA molecule of paragraph 32, wherein the gRNA molecule comprises a nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 9, SEQ. ID. NO: 10, SEQ. ID. NO: 37, SEQ. ID. NO: 38, SEQ. ID. NO: 39, SEQ. ID. NO: 40, SEQ. ID. NO: 41, SEQ. ID. NO: 42, SEQ. ID. NO: 43, SEQ. ID. NO: 44, SEQ. ID. NO: 45, SEQ. ID. NO: 46, SEQ. ID. NO: 47 or SEQ. ID. NO: 48.
[36] . A composition comprising a first gRNA molecule comprising a targeting domain which is complementary with a first target sequence from the Rs l, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus.
[37] . The composition of paragraph 36 further comprising a second gRNA molecule
comprising a targeting domain which is complementary with a second target sequence from the Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus; wherein the selected genes targeted by the first and second gRNAs are not the same.
[38] . The composition of paragraph 37 further comprising a third gRNA molecule comprising a targeting domain which is complementary with a third target sequence from the Rs 1, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus; wherein the selected genes targeted by the first, second and third gRNAs are not the same.
[39] . The composition of paragraph 38 further comprising a fourth gRNA molecule
comprising a targeting domain which is complementary with a fourth target sequence from the Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus; wherein the selected genes targeted by the first, second, third and fourth gRNAs are not the same.
[40] . The composition of any one of paragraphs 36-39, wherein the gRNA comprising a
targeting domain which is complementary to the target sequence of Rs 1 comprises nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 7, SEQ. ID. NO: 8, SEQ. ID. NO: 49, SEQ. ID. NO: 50, SEQ. ID. NO: 51, SEQ. ID. NO: 52, SEQ. ID. NO: 53, SEQ. ID. NO: 54, SEQ. ID. NO: 55, SEQ. ID. NO: 56, SEQ. ID. NO: 57, SEQ. ID. NO: 58, or SEQ. ID. NO: 59.
[41] . The composition of any one of paragraphs 36-39, wherein the gRNA comprising a
targeting domain which is complementary to the target sequence of UL29 comprises nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 11, SEQ. ID. NO: 12, SEQ. ID. NO: 26, SEQ. ID. NO: 27, SEQ. ID. NO: 28, SEQ. ID. NO: 29, SEQ. ID. NO: 30, SEQ. ID. NO:
31, SEQ. ID. NO: 32, SEQ. ID. NO: 33, SEQ. ID. NO: 34, SEQ. ID. NO: 35 or SEQ. ID NO: 36.
[42] . The composition of any one of paragraphs 36-39, wherein the gRNA comprising a
targeting domain which is complementary to the target sequence of UL30 comprises nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 13, SEQ. ID. NO: 14, SEQ. ID. NO: 15, SEQ. ID. NO: 16, SEQ. ID. NO: 17, SEQ. ID. NO: 18, SEQ. ID. NO: 19, SEQ. ID. NO: 20, SEQ. ID. NO: 21, SEQ. ID. NO: 22, SEQ. ID. NO: 23, SEQ. ID. NO: 24 or SEQ. ID NO: 25.
[43] . The composition of any one of paragraphs 36-39, wherein the gRNA comprising a
targeting domain which is complementary to the target sequence of UL54 comprises nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 9, SEQ. ID. NO: 10, SEQ. ID. NO: 37, SEQ. ID. NO: 38, SEQ. ID. NO: 39, SEQ. ID. NO: 40, SEQ. ID. NO: 41, SEQ. ID. NO: 42, SEQ. ID. NO: 43, SEQ. ID. NO: 44, SEQ. ID. NO: 45, SEQ. ID. NO: 46, SEQ. ID. NO: 47 or SEQ. ID. NO: 48.
[44] . The composition of any one of paragraphs 36-43, further comprising a Cas9 molecule.
[45] . The composition of claim 44, wherein the Cas9 molecule and gRNAs are introduced as a complex.
[46] . The composition of paragraph 44, wherein the Cas9 molecule and the gRNAs are
introduced into the cell by one or more vectors comprising nucleic acid sequences that encodes Cas9, and the respective gRNAs.
[47] , A kit comprising, (a) one or a combination of gRNA molecule of paragraph 27-35 and
(b) a Cas9 molecule or a functional fragment thereof.
[48] . A kit comprising compositions of any one of paragraphs 36-46.
[49] . The kit of paragraph 47-48 further comprising one or more items selected from the group consisting of packaging material, a package insert comprising instructions for use, a sterile fluid, a syringe and a sterile container.
[50] . A method for treating herpesvirus infection or a herpesvirus related disease comprising contacting a subject in need thereof or a cell from said subject with a therapeutically effective amount of compositions of any one of paragraphs 36-46.
[51] . A method of inactivation of a latent herpesvirus in a mammalian cell, the method
comprising introducing into the cell,
a) a Cas9 molecule and
b) a first gRNA comprising a targeting domain which is complementary with a target sequence from the gene Rsl, UL54, UL29, UL30 or a homolog thereof; and
c) a second gRNA comprising a targeting domain which is complementary with a second target sequence from the gene Rs l, UL54, UL29, UL30 or a homolog thereof; wherein the selected gene targeted by the second gRNA is not the same as the first.
[52] . A method of inactivating or inhibiting a herpesvirus in a mammalian cell, the method comprising introducing into the cell:
a) a Cas9 molecule;
b) a first gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding Rsl or a conserved homolog thereof in the herpesvirus;
c) a second gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL54 or a conserved homolog thereof in the herpesvirus;
d) a third gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL29 or a conserved homolog thereof in the herpesvirus; and
e) a fourth gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL30 or a conserved homolog thereof in the herpesvirus.
[ 3] . A method of inactivating or inhibiting of a latent herpesvirus in a mammalian cell, the method comprising introducing into the cell:
a) a Cas9 molecule;
b) a first gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding Rsl or a conserved homolog thereof in the herpesvirus;
c) a second gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL54 or a conserved homolog thereof in the herpesvirus;
d) a third gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL29 or a conserved homolog thereof in the herpesvirus; and
e) a fourth gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL30 or a conserved homolog thereof in the herpesvirus.
[54] . A method of inactivating or inhibiting of a herpesvirus in a mammalian cell, the method comprising introducing into the cell:
a) a Cas9 molecule;
b) a first gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding Rsl or a conserved homolog thereof in the herpesvirus;
c) a second gRNA comprising a targeting domain which is complementary with a target sequence in a gene selected from the group consisting of UL54, UL29, and UL30 or a conserved homolog thereof in the herpesvirus; and
d) a third gRNA comprising a targeting domain which is complementary with a target sequence in a gene selected from the group consisting of UL54, UL29, and UL30 or a conserved homolog thereof in the herpesvirus; wherein the selected genes targeted by the second and third gRNAs are not the same.
[55] . A method of inactivating or inhibiting of a latent herpesvirus in a mammalian cell, the method comprising introducing into the cell:
a) a Cas9 molecule;
b) a first gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding Rsl or a conserved homolog thereof in the herpesvirus;
c) a second gRNA comprising a targeting domain which is complementary with a target sequence in a gene selected from the group consisting of UL54, UL29, and UL30 or a conserved homolog thereof in the herpesvirus; and
d) a third gRNA comprising a targeting domain which is complementary with a target sequence in a gene selected from the group consisting of UL54, UL29, and UL30 or a conserved homolog thereof in the herpesvirus; wherein the selected genes targeted by the second and third gRNAs are not the same.
[56] . A method of inactivating or inhibiting of a herpesvirus in a mammalian cell, the method comprising introducing into the cell:
a) a Cas9 molecule;
b) a first gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding Rsl or a conserved homolog thereof in the herpesvirus; and
c) a second gRNA comprising a targeting domain which is complementary with a target sequence in a gene selected from the group consisting of UL54, UL29, and UL30 or a conserved homolog thereof in the herpesvirus.
[57] . A method of inactivating or inhibiting of a latent herpesvirus in a mammalian cell, the method comprising introducing into the cell:
a) a Cas9 molecule;
b) a first gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding Rsl or a conserved homolog thereof in the herpesvirus; and
c) a second gRNA comprising a targeting domain which is complementary with a target sequence in a gene selected from the group consisting of UL54, UL29, and UL30 or a conserved homolog thereof in the herpesvirus.
[58] . A composition comprising:
a) a first gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding Rsl or a conserved homolog thereof in the herpesvirus;
b) a second gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL54 or a conserved homolog thereof in the herpesvirus;
c) a third gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL29 or a conserved homolog thereof in the herpesvirus; and
d) a fourth gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL30 or a conserved homolog thereof in the herpesvirus.
[59] . A composition comprising :
a) a first gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding Rsl or a conserved homolog thereof in the herpesvirus;
b) a second gRNA comprising a targeting domain which is complementary with a target sequence in a gene selected from the group consisting of UL54, UL29, and UL30 or a conserved homolog thereof in the herpesvirus; and
c) a third gRNA comprising a targeting domain which is complementary with a target sequence in a gene selected from the group consisting of UL54, UL29, and UL30 or a conserved homolog thereof in the herpesvirus; wherein the selected genes targeted by the second and third gRNAs are not the same.
[60] . A composition comprising:
a) a first gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding Rsl or a conserved homolog thereof in the herpesvirus;
b) a second gRNA comprising a targeting domain which is complementary with a target sequence in a gene selected from the group consisting of UL54, UL29, and UL30 or a conserved homolog thereof in the herpesvirus.
[61] . The method or composition of any one of the preceding paragraphs, wherein the gRNA targeting Rs l comprising a nucleic acid sequence selected from the group consisting of SEQ. ID.
NO: 7, SEQ ID. NO: 8, SEQ. ID. NO: 49, SEQ. ID. NO: 50, SEQ. ID. NO: 51, SEQ. ID. NO:
52, SEQ. ID. NO: 53, SEQ. ID. NO: 54, SEQ. ID. NO: 55, SEQ. ID. NO: 56, SEQ. ID. NO: 57,
SEQ. ID. NO: 58, or SEQ. ID. NO: 59.
[62] . The method or composition of any one of the preceding paragraphs, wherein the gRNA targeting UL54 comprising a nucleic acid sequence selected from the group consisting of SEQ.
ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID
NO: 40, SEQ. ID. NO: 41, SEQ. ID. NO: 42, SEQ. ID. NO: 43, SEQ. ID. NO: 44, SEQ. ID. NO:
45, SEQ. ID. NO: 46, SEQ. ID. NO: 47 or SEQ. ID. NO: 48.
[63] . The method or composition of any one of the preceding paragraphs, wherein the gRNA targeting UL29 comprising a nucleic acid sequence selected from the group consisting of SEQ.
ID. NO: 11, SEQ. ID. NO: 12, SEQ. ID. NO: 26, SEQ. ID. NO: 27, SEQ. ID. NO: 28, SEQ. ID.
NO: 29, SEQ. ID. NO: 30, SEQ. ID. NO: 31, SEQ. ID. NO: 32, SEQ. ID. NO: 33, SEQ. ID. NO:
34, SEQ. ID. NO: 35 or SEQ. ID. NO: 36.
[64] . The method or composition of any one of the preceding paragraphs, wherein the first gRNA targeting UL30 comprising a nucleic acid sequence selected from the group consisting of
SEQ. ID. NO: 13, SEQ. ID. NO: 14, SEQ. ID. NO: 15, SEQ. ID. NO: 16, SEQ. ID. NO: 17,
SEQ. ID. NO: 18, SEQ. ID. NO: 19, SEQ. ID. NO: 20, SEQ. ID. NO: 21, SEQ. ID. NO: 22,
SEQ. ID. NO: 23, SEQ. ID. NO: 24 or SEQ ID. NO: 25.
[65] . The method of any one of the preceding paragraphs, wherein the Cas9 molecule and the gRNAs are introduced into the cell by one or more vectors comprising nucleic acid sequences that encode Cas9, and the respective gRNAs.
[66] . A gRNA molecule of any one of paragraphs 27-35 or a combination thereof for use in treating HSV-1 infection and related diseases in a subject.
EXAMPLE
[0211] The following examples illustrate some embodiments and aspects of this disclosure. It will be apparent to those skilled in the relevant art that various modifications, additions, substitutions, and the like can be performed without altering the spirit or scope of the disclosure, and such
modifications and variations are encompassed within the scope of the disclosure as defined in the claims which follow. The technology described herein is further illustrated by the following examples which in no way should be construed as being further limiting.
Materials and Method
[0212] Cells and viruses: HFF, F06, V27, and Vero cells were obtained from the American
Type Culture Collection. U20S and Vero cells were maintained in Dulbecco's modified Eagle medium (DMEM; Life Technologies and CORNING) supplemented with 5% (v/v) fetal bovine serum (FBS; Life Technologies) and 5% (v/v) bovme calf serum (BCS; Life Technologies) and, 2 mM L-glutamme in 5% C02. HFF cells were maintained in DMEM supplemented with 10% (v/v) FBS. The HSV-1 KOS wild- type (WT) strain (Schaffer 1970) used in this study were grown and titrated on Vero. HSV-1 dl09 used in this study were re-isolated on U20S ICP4/27 using two round of plaque purifications (Miyagawa 2015f). HSV-1 dl09 were grown and titrated on U20S ICP4/27 and F06 cells. Infections were conducted with virus diluted in phosphate -buffered saline (PBS) containing 0.1% glucose (wt/vol), 0.1% BCS (v/v) for 1 hour with shaking at 37°C. A medium was changed to DMEM containing 1% BCS and incubated at 37°C.
[0213] Plasmid construction: We cloned SaCas9, its trans-activating crRNA (tracrRNA), and mCherry into lentiCRISPRv2 plasmid. The lentiCRISPRv2 were digested using BsmBI (NEB) and BamHI (NEB) and purified using DNA purification kit (Zymo). DNA assembly was performed using NEBuilder® HiFi DNA Assembly (NEB) and three DNA fragments, the purified linear lentiCRISPRv2, a double -stranded DNA gBlock (IDT) containing sgRNA cloning sites and tracrRNA sequences (IDT, 5' CTTTATATATCTTGTGGAAAGGACGAAACACCGGAGACGtGATATCaCGTCTCAGTTTTAGTA CTCTGGAAACAGAATCTACTAAAACAAGGCAAAATGCCGTGTTTATCTCGTCAACTTGTTGG CGAGATTTTTGAATTCGTAGACTCGAGGCGTTG ACATTG 3' (SEQ ID NO: 62)), and PCR fragment containing SaCas9-mCherry according to the manufacturer's protocol. The SaCas9-mCherry was generated using primers (5' TGAATTCGTAGACTCGAGGCGTTG ACATTG 3' (SEQ ID NO: 63) and 5 ' TCAGCAGAGAGAAGTTTGTTGCGCCGGAACCGCTAGCCTTGTACAGCTCGTCCATGC 3' (SEQ ID NO: 64)) and pX601-AAV-CMV-SaCas9-T2A-mCherry as a template. pX601-AAV-CMV- SaCas9-T2A-mCherry was cloned using pX601-AAV-CMV: :NLS-SaCas9-NLS-3xHA- bGHpA;U6::BsaI-sgRNA (Addgene) by adding T2A-mCherry sequences.
[0214] Establishment of quiescent dl09 genomes in HFF cells: We established quiescent dl09
HSV-1 genome in HFF cells as described with slightly modification. Briefly, HFF cells were infected with dl09 HSV-1 at an MOI of 10 in PBS containing 0.1% glucose (wt/vol) and 0.1% BCS (v/v) for 1
hour with shaking at 37°C and incubated at 37°C for 7-10 days in DMEM supplemented with 10% (v/v) FBS.
[0215] Lentivirus preparation and transduction: 293T cells (3x106) were plated in a 100 mm dish at 20-24 hours before transfection. The cells were transfected with lentiSaCas9-mCherry-Puro (5 μg), psPAX2 (4 μg), and pVSV-G (lpg) using Effectene (Qiagen) according to the manufacturer's protocol or using polyethyleneimine (PEI, Polysciences, Inc. #23966). For PEI transfection, total 10 μg of DNAs in 500 pL of Opti-MEMI (Gibco, #31985) and 30 μg of PEI in 500 pL of Opti-MEMI were mixed and incubated at ambient temperature for 20 min. The mixtures were added directly to 293T cells containing fresh 5 mL of DMEM (supplemented with 10% (vol/vol) FBS and 2 mM glutamine). The cells were incubated at 37°C for 8-12 hours, replaced with lOmL of fresh DMEM supplemented with 10% (vol/vol) FBS and 2 mM glutamine, and incubated at 37°C. Then, at every 12-24 hours for 48-60 hours, media were harvested and replaced with fresh DMEM 10% and the harvested media were saved on ice. The collected media were pooled and filtered using 0.45 pm syringe filter (Pall, #4654) and kept on ice until lentivirus transduction. To transduce HFF cells with lentivirus for lytic infection assay, HFF cells were plated at a density of 2xl05/well in T25 flask one day prior to transduction and transduced with 2 mL of lentivirus containing 3 pg/mL of polybrene (Santa Cruz). To transduce quiescent dl09 infected cells, the cells were transduced with 2 or 10 mL of lentiviruses containing 2-4 pg/mL of polybrene in 6-well plates or in T150 flasks. The next day, the transduction medium was replaced with fresh medium and cells were incubated for 2 days at 37°C followed by puromycin treatment (1 pg/mL) for 7-10 days.
[0216] SDS-PAGE and immunoblotting: For immunoblotting, HFF cells were lysed in lxNuPAGE sample buffer (Life Technologies). The proteins were resolved in NuPAGE 4-12% Bis-Tris Gels (Life Technologies) and then transferred to a polyvmylidene difluoride (PVDF, Perkin-Elmer Life Sciences). The membranes were blocked in Odyssey Blocking Buffer (LI-CO ). The membranes were then incubated with antibodies specific for HSV-1 ICP8 (1 :5000, rabbit serum 3-83 (Knipe 1988), HSV-1 ICP4 (1 :2000, monoclonal mouse (mAb) 58-S (purified from HB-8183 hybridoma cells (ATCC), , ICP27 (1 :5000, mAb, Eastcoast), and GAPDH (1 : 10000, mAb, Abeam). The membranes were incubated with secondary antibodies, IRDye 680RD and IRDye 800 (LI-COR), for 45 min. Near-infrared fluorescence was detected using Odyssey (LI-COR). Protein expression level was quantified using Image J or ImageStudio V4 (LI-COR).
Results
[0217] In vitro screen of gRNAs targeting HSV-1 genome sites: To select potential gRNA that could efficiently cleave HSV- 1 genomes in cultured cells and in vivo, we screened gRNAs using in vitro cleavage assay. Multiple Cas9s are recently identified and Staphylococcus aureus Cas9 (SaCas9) is shown to be small enough to be packaged in adeno associated virus (AAV), which has been used to transduce external genes in mouse brain in vivo model. As we were planning to test CRISPR/Cas9 in mouse neuronal cells in vivo using AAVs, we screened gRNAs for SaCas9. As purified Staphylococcus
aureus Cas9 (SaCas9) was not commercially available, we performed the cleavage assay using
Streptococcus pyogenes Cas9 (SpCas9). Protospacer adjacent motif (PAM) sequences of SpCas9 (NGG) and 5 Cas9 (NNGRR) (2014 Ran and Zhang) are not mutually exclusive and it was shown that cleavage efficiencies between SpCas9 and SaCas9 were compatible at the sites of shared PAM sequences (2015 Friedland and Bumcrot). To screen potential gRNAs targeting HSV genomes for in cultured cells and in vivo, we incubated amplified PCR fragments containing gRNA target viral sequences with SpCas9 and gRNA complexes, and measured DNA cleavage by gel electrophoresis .We screened many potential gRNA sequences targeting 4 essential HSV genes, and we found that certain gRNAs promoted cleavage more efficiently, for example UL30-3 and UL30-4 (Fig. 1).
[0218] Cas9/gRNA inhibits HSV lytic infection: Based on the in vitro cleavage screen, we selected two gRNAs per each target gene and evaluated their knockout efficiencies in cells using immunoblotting. We transduced HFFs with lentiviruses expressing SaCas9 and gRNAs (Cas9/gRNAs) targeting immediate early (IE) and early (E) genes and treated puromycin for longer than 7 days (Fig. 2A). Then, we infected the gRNA/Cas9-expressing cells with HSV-1 at an MOI of 5 and harvested protein lysates at 10 hpi. The cells expressing gRNAs targeting IE genes Rsl and UL54, showed reduced levels of the corresponding proteins ICP4 and ICP27, compared to protein levels from Cas9 expressing control cells (Fig. 2B top). The cells transduced with a lentivirus expressing gRNA targeting UL29 showed reduced or undetectable levels of ICP8 protein compared to Cas9 expressing control cells. The cells expressing gRNAs targeting UL30 showed reduced levels of ICP8 protein, but little or no change in the levels of ICP4 and ICP27. These results confirm that our candidate gRNAs can successfully knock out the genes they are targeting. We noticed that although the in vitro cleavage assay showed equivalent cleavage efficiencies of the selected gRNAs, two gRNAs targeting the same viral gene had a different effect on a protein level. These results imply that different Cas9/gRNAs may have different catalytic activities in cells. It is possible that the expression levels of different Cas9/gRNAs varies, which could be responsible for the observed difference in knockout efficiency. To exclude this possibility, we detected SaCas9-HA using anti HA antibody by immunoblotting (Fig. 2B bottom). Although the levels of SaCas9- HA varies in different gRNA/Cas9 expressing cells, the SaCas9-HA levels do not correlate to the knockout efficiencies and the lowest level of SaCas9-HA in UL54-2 gRNA/Cas9 expressing cells showed equivalent reduction of ICP27 compared to UL54-1 gRNA/Cas9 expressing cells implying that the level of SaCas9 is not a major contributor to the difference of knockout efficiency of HSV-1 genes in this assay. We also transduced HFF cells with two different gRNA/Cas9s and although the protein level of gRNA-targeting gene was reduced, the reduction level of each protein was less significant in double gRNAs expressing cells than in the single gRNA/Cas9 transduced cells (Fig. 2B).
[0219] To evaluate whether Cas9/gRNAs-mediated knockout of viral IE and E genes is sufficient to inhibit HSV- 1 lytic replication, we infected the transduced cells with wildtype HSV- 1 at an MOI of 0.1 or 5, and harvested cells at 48 hpi or 24 hpi respectively (Fig. 2A). We observed that all of the Cas9/gRNAs expressing cells, except for the UL29-2 gRNA expressing cells, reduced viral yields
more than 1 log compared to the viral yields from Cas9 expressing cells at both MOIs (Figs. 2C and 2D). The gRNA most efficient at inhibiting HSV-1 replication was UL30-2, which reduced viral yields more than 3 logs at an MOI of 5 and more than 4 logs at an MOI of 0.1. These results demonstrate that Cas9/gRNAs can disrupt expression of herpesviral genes, which results in inhibition of HSV-1 lytic replication.
[0220] Cas9/gRNA inhibits reactivation of quiescent HSV-1 genomes: During the early stages of HSV-1 lytic infection, viral genomes are loaded with histones, which become modified with euchromatic marks and are quickly removed. However, latent HSV-1 genomes are known to accumulate heterochromatic marks, implying that the chromatin structure of the latent viral genomes is more compact than that of replicating viral DNA. Recently, it was reported that nucleosomes impede Cas9/gRNA accessibility to gRNA target sites of DNA (Horbeck and Weissman, 2016 eLife). This raises the possibility that latently infected HSV-1 genomes might be harder to be accessed and targeted by Cas9/gRNA complexes than the replicating HSV genomes. To evaluate whether Cas9/gRNA can target viral genes in latently infected HSV genomes, we used a quiescent infection system using the replication- defective HSV-1 dl09 virus, which expresses GFP, but does not express any IE proteins . To establish quiescent dl09 infection in cultured cells, we infected HFF cells with d 109 at an MOI of 10 and allowed quiescence to be established for 7-10 days (Fig. 3A). The cells were then transduced with lentiviruses expressing Cas9 and gRNAs targeting HSV-1 E genes UL29 and UL30. To test whether gRNAs targeting E genes can prevent reactivation of the quiescent dl09 genomes, we superinfected the cells with wildtype HSV-1 at an MOI of 5 and harvested cells 24 h later. To determine reactivation of dl09, we performed a plaque assay on F06 cells that complement dl09, and counted GFP -positive plaques.
Recombination between wildtype HSV-1 and dl09 can produce false GFP -positive plaques that may encode other IE genes of wildtype HSV. To exclude these false GFP-positive plaques, we also counted GFP-positive plaques formed on V27 cells, which express ICP27 protein . Because the ICP27 was originally replaced with GFP during the construction of dl09, any recombinant GFP-positive but ICP27- negative HSV mutants that arise, can replicate in the V27 cells. To calculate the number of plaques from reactivated dl09 genomes only, we subtracted the number of GFP-positive plaques on V27 from the number of GFP-positive plaques on F06 cells (Fig. 3B left). Based on this calculation, we observed that viral yields from the cells expressing individual gRNAs showed more than 2 log reduction in reactivation of quiescent dl09 genomes. Similar to the lytic infection assay, we also observed that UL30-2 gRNA expressing cells showed greater inhibitory effect on reactivation of quiescent dl09 genomes than other gRNAs. These results show that Cas9/gRNA can also prevent reactivation of quiescent dl09 genomes.
[0221] Next, we sought to determine whether using double Cas9/gRNAs to target two viral genes could increase the efficiency of inhibition of HSV reactivation from quiescence. To evaluate the synergistic effect of gRNAs, we transduced quiescent dl09-infected HFF cells with one or two lentiviruses expressing gRNAs targeting E genes, and reactivated the quiescent dl09 genomes as described above. Again, we observed that individual gRNA expressing cells showed 2 or more log reduction in reactivation of quiescent dl09 genomes (Fig. 3B right). As we expected, the cells expressing
two different gRNAs showed higher reduction (over 1 log additional) in reactivation of quiescent dl09 genomes. Interestingly, we found that the cells transduced with two lentiviruses expressing UL29-2 and UL30-5 gRNAs developed equal or fewer number of GFP -positive plaques on F06 cells than the number of GFP -positive plaques on V27 after superinfection with wildtype HSV-1, suggesting a complete inhibition of reactivation of quiescent dl09 genomes (Fig. 3B right). These results demonstrate that two different gRNAs can synergistically prevent reactivation of quiescent dl09 genomes.
[0222] To understand the mechanism of Cas9/gRNA-medicated inhibition of quiescent dl09 genome reactivation, we sequenced the gRNA target sites in cells quiescently infected with dl09 and transduced with different Cas9/gRNA lentivurses. As we expected, UL30-2 gRNA targeting site showed highest indel mutation frequency (37%) compared to the other gRNA targeting sites (Figs. 4A and 4B). UL29-2 gRNA targeting sites showed undetectable level of indel mutation frequency. These results demonstrate that different gRNAs may have different levels of Cas9/gRNA catalytic activities to chromatinized HSV genomes in cells. We also sequenced two different gRNA targeting sites in viral DNA from cells transduced with two different gRNAs/Cas9 simultaneously in two independent experiments (Figs. 4C and 4D). Although two independent experiments showed variations of indel mutations but both experiments showed that two different gRNAs efficiently induced indel mutations simultaneously. Again, the UL30-2 gRNA targeting site showed highest indel mutation frequency compared to the other gRNA targeting site. These data support the idea that the different levels of catalytic activities on the chromatinized viral DNA with different gRNA targeting sites.
[0223] Altogether, our results confirm that Cas9/gRNA can induce DNA cleavage and mutations in quiescent dl09 genomes, resulting in a knockout of gRNA- targeted genes, which prevents reactivation of quiescent dl09 genomes.
[0224] Editing of Lytic Viral Genomes by Cas9. To confirm the effects of Cas9/gRNA editing on HSV lytic genomes, we performed indel mutation analysis of viral DNA with the most efficient gRNA, UL30-2. At various times postinfection, total DNA was harvested from infected cells, amplified the sequences around the target site of the UL30-2 gRNA by PCR, miseq was performed to measure the indel mutation rate. We also evaluated the effect of Cas9 and the gRNA on input HSV genomes by infecting cells in the presence of sodium phosphonacetate (PAA), an inhibitor of the HSV DNA polymerase. The indel mutations accumulated from 4 hpi and increased more than 80% during the replication by 24 hpi (Cas9/UL30-2-PAA vs Cas9-PAA). (Fig. 5B) However, unexpectedly, input viral DNA did not accumulate indel mutations over 24 hpi (Cas9/UL30-2+PAA vs Cas9+PAA) (Fig. 5B). To confirm whether Cas9/gRNA cannot target input viral DNA, we infected the Cas9/gRNA-expressing cells with HSV-1 at an MOI of 1 with or without PAA, harvested protein lysates at 10 hpi, and measured HSV protein levels by immunoblotting (Fig. 5A). Interestingly, the cells expressing gRNAs targeting Rsl and UL30 showed similar reduction of the ICP4 and UL30 with or without PAA compared to the protein levels from Cas9 expressing control cells (Fig. 5A). These data argue that viral DNA can be targeted by gRNA targeting site with Cas9 to reduce the protein level without inducing high level of indel mutations.
[0225] Effect of UL30-2 gRNA on Viral DNA Replication. Because we detected the reduction of sequence specific gRNA targeting proteins without inducing high level of indel mutation without viral DNA replication, we hypothesized that Cas9/gRNA may cleave the input viral DNA but cellular DNA repair mechanism may not function, which remains the cleaved viral DNA. To further assess the mechanism of action of Cas9/gRNA, we measured HSV DNA replication in infected cells with Cas9 plus or minus the UL30-2 gRNA. We infected Cas9/gRNA transduced cells with WT HSV-1 at an MOI of 3 and measured the accumulation of DNA sequences in the neighboring UL29 gene by real-time PCR relative to a standard curve of viral DNA. To assess the cleaved DNA induced by UL30-2 gRNA, we designed real time PCR primers to amplify PCR fragments over the UL30-2 gRNA targeting site. We observed in infected cells with just Cas9 that UL29 gene sequences increased by more than 103-fold, while in infected cells with Cas9 and UL30-2 gRNA, UL29 sequences increased by only 102-fold (Fig. 6A). In the cells with Cas9, UL30 sequences increased by more than 103-fold, similar to the UL29 sequences, but in the cells with Cas9 and UL30-2 gRNA, UL30 sequences increased by only 10-fold (Fig. 6B). Thus, Cas9 and the gRNA were reducing general viral DNA replication by more than 10-fold, but causing a further loss of UL30 sequences over the gRNA target site. These results show that Cas9 editing of replicating HSV DNA reduces general DNA replication but exerts a novel effect of further reducing target gene sequences.
[0226] We also evaluated the effect of Cas9 and gRNA on input HSV genomes by infecting cells in the presence of sodium phosphonacetate, an inhibitor of the HSV DNA polymerase. Infected cells showed a similar loss of UL29 sequences over 24 hours with or without the UL30-2 gRNA (Fig. 6C), as observed before for input viral DNA in the absence of viral DNA synthesis. UL30 sequences in input genomes also decreased by 40% without the gRNA but showed a 60% decrease in the presence of the gRNA (Fig. 6D). These data argue that input viral DNA can be cleaved by Cas9 but the cleaved DNAs were not repaired without replication. Therefore, there was a slight decrease in input viral DNA due to Cas9 editing but a much larger reduction in replicating DNA, showing that Cas9 targets replicating or replicated viral DNA with the UL30-2 gRNA better than it does input viral DNA.
[0227] Human herpesviruses (HHVs) establish latency in different cell types for life.
Current therapeutic treatments for HHVs target viral proteins that are expressed by actively replicating virus during its lytic cycle. However, no viral proteins are expressed during latent infection, which limits the availability of therapeutic targets and allow viruses to evade host immune response. It is unclear what triggers spontaneous reactivation of latent herpesviruses, making latent infection a risk of recurrent herpetic disease for life. Several approaches have been proposed to suppress reactivation, including epigenetic drug-mediated suppression and antagonizing miRNAs, but these methods requires lifelong treatment. Therefore, novel strategies are needed to treat latent herpesviral infections. Here, we use the genome editing system CRISPR/Cas9 to disrupt lytic and latent HSV-1 infection. We found that CRISPR/Cas9 can successfully inhibit lytic infection and reactivation of HSV-1 and can be used as a potential therapeutic.
[0228] Factors to consider to design and select gRNAs. We screened our gRNAs using bare
DNA template in vitro. Our gRNAs targets downstream sequence of 5 ' end of ORFs to disrupt N- terminus of proteins. Recent study demonstrated that chromatinized DNAs are less accessible by Cas9 than bare DNA implying that chromatin structure and status might need to be considered to select gRNAs. Bioinformatic analyses showed that transcription start sites (TSS) are generally less nucleosomal regions than other sites in cell culture system. Therefore, it might be possible that targeting near TSS sites might enhance the knockout efficiency of target genes. Analyzing nucleosomal regions in latent HSV genomes will provide a better insight to select gRNAs. In addition to histones, multiple histone modifying factors, mediators, and RNA pol II complex recognize specific sequences where Cas9/gRNA need to compete. Therefore, it might be also useful to understand whether Cas9/gRNA complex can bind and cleave those specific sequences in vitro and in vivo. These factors are especially important to design gRNA to target latent HSV genomes as they are more chromatinized than genomes during lytic infection.
[0229] Kinetics of Cas9/gRNA activity might be important to inhibit HSV lytic infection.
So far, it is not known that how fast Cas9/gRNA complex can recognize target DNAs. Packaged viral genomes do not associate with histone but during the lytic infection, the input viral genomes load histones quickly, especially heterochromatic marks, and ICPO and VP 16 remove and/or induce modification of histones. Therefore, it is possible that Cas9/gRNA need to compete with histones and other DNA binding factors at the early replication step. Although our results showed that gRNAs targeting IE genes could efficiently reduce viral yields at high and low MOI infections, levels of ICP4 still remain high enough to support ICP8 gene expression (Fig. 2B), implying that the kinetics of Cas9/gRNA might not as fast as ICP4 transcription. Furthermore, reduction of viral yields at low and high MOI infections do not show significant different, which might also support the idea that kinetics of Cas9/gRNA-DNA complex formation might not be faster than initial IE gene expression. Therefore, targeting multiple essential genes from IE, E and L genes might be more synergistic than targeting multiple IE genes to inhibit lytic replication.
[0230] We tested multiple gRNAs targeting essential IE and E genes. ICP4 and ICP27 are critical for E and late gene expressions. ICP4 interacts with RNA pol II complex and regulate viral and cellular gene expression. ICP27 is important for viral gene transcription and mRNA export. Interestingly, our results showed that ICP8 could express in ICP4 or ICP27 knocked out cells. CRISPR/Cas9 system showed various levels of mutation/knockout efficiencies in vitro and in vivo models. Therefore, it is possible that Cas9/gRNA transduced cells may still express minimal level of ICP4 and ICP27 to support ICP8 gene expression. It might be interesting to detect other E and L proteins to evaluate ICP4 and ICP27 function for expression of specific E and/or L proteins. Recent study demonstrated that targeting RL2 also efficiently reduce the viral yield in lytic infections (Roehm 2016). Therefore, combination of gRNAs targeting Rs 1 , UL54, and RL2 might be more efficient to reduce the levels of E and L gene expressions.
[0231] E genes encode proteins responsible for HSV replications. Our results demonstrate that one of UL30 targeting gRNAs is more efficient than other gRNAs targeting IE and E genes.
Interestingly, knockout UL30 also significantly reduced ICP8 expression (Fig. 2B) but not ICP4 and ICP27, implying that UL30 might have a functional role for expression of other E gene proteins. It is also possible that blocking replication by knocking out viral polymerase gene might limit the amount of template DNAs for robust expression of E and L gene expression.
[0232] During the reactivation of HSV, ICPO and VP 16 are important to initiate early transcription and replications. Therefore, it might be more efficient to suppress reactivation by knocking out UL48 and/or RL2 with other essential IE genes. CRIPSR/Cas9 might be a useful tool to understand kinetics and functional connections of HSV protein expressions during lytic infection and reactivation.
[0233] In vitro and in vivo HSV latency models. We used an in vitro model for quiescent infection in primary human fibroblasts infected with the replication-deficient dl09 virus to test whether CRISPR/Cas9 can inactivate and inhibit HSV reactivation. Quiescent dl09 genomes resemble the chromatinized viral genomes observed during in vivo latency, and follow changes of chromatin status during reactivation. Interestingly, quiescent dl09 genomes is less permissive than primary trigeminal mouse neurons and reactivation is induced less effectively with the treatment of HDAC inhibitors than mouse neurons (Frenczy and DeLuca 2009) implying that this system might be more heterochromatic than latent HSV genomes in vivo. Human stem cell (iPS or hESC)-derived neuronal cell culture model or immortalized human dorsal root ganglia model might be a more biologically relevant experimental system to test the mechanism of CRIPSR/Cas9 inhibition of establishment of HSV latency and reactivation.
[0234] Advantages and disadvantages of genome editing systems to treat DNA viruses.
Genome editing systems have been applied to treat DNA viruses. ZFNs and TALENs were used to inhibit HBV transcription (Zimmerman 2008 and Chen 2014) and homing endonucleases (HEs) were used to inhibit lytic (Grosse 2011) and latent reactivation of HSV (Aubbert 2014) in cultured cells. CRISPR/Cas9 was used to disrupt latent EBV infection in Burkitt's lymphoma cell lines and lytic infection of HSV in TC260 cell lines (Roehm 2016). Despite of these studies many issues still remain to be addresses for use of genome editing technologies for lytic and latent viral infections. First, many DNA viruses are large and mutate frequently during their replications, resulting in individual viral sequences are different in even the same strain of viruses. Second, these systems cannot precisely control their mutational activities. Nuclease s-mediated DNA breaks can be repaired using cellular DNA repair mechanism NHEI but the NHEI can also generate diverse mutations including synonymous substitution, nonsynonymous substitution, insertion, and deletions. The correctly repaired sequence can be targeted again by the same nucleases but other mutations can no longer be targeted by the same nucleases, which can express nuclease-target genes without losing their functions. Therefore, treatment of multiple nucleases that recognize different sequences can minimize these issues and increase knockout efficiency of target genes. But it is hard to generate and introduce multiple sequence-specific nucleases to target cells using HEs, ZFNs, and TALENs systems. Unlike other nucleases, the same Cas9 can target multiple sites by using different small gRNAs, which is more flexible and cost effective than other systems. Our results also demonstrated that two gRNAs can efficiently enhance the inhibition of HSV lytic infection
and reactivation of latent infection. As multiple gRNAs can expressed from a single plasmid, introducing multiple gRNAs might further improve inhibitory efficiency. Recently, another Cas9 Cpfl that can create 5' overhang instead of blunt end by other Cas9 showed enhanced the efficiency of insertions and deletion mutations. Therefore, knockout of HSV genomes using Cpfl and multiple gRNAs might further improve the inhibition of HSV lytic infection and reactivation. Third, off-target effect and toxicity of nucleases have to be considered. Our Cas9 expressing control cells also showed reduced viral expression and slower growth compared to untransduced control cells implying that Cas9 may affect cell cycle and gene profiles. Recent study proposed that instead of introducing DNA, delivering proteins and protein/RNA complex directly to cells reduced the off-target effect of cytotoxicity.
REFERENCES
1. Roehm PC et al. Inhibition of HSV- 1 Replication by Gene Editing Strategy. Sci Rep. 2016 Apr 11 ;6:23146.
2. van Diemen FR et al. CRISPR/Cas9-Mediated Genome Editing of Herpesviruses Limits Productive and Latent Infections. PLoS Pathog. 2016 Jun 30; 12(6):el005701.
3. Ferenczy MW et al. Epigenetic modulation of gene expression from quiescent herpes simplex virus genomes. J Virol. 2009 Sep;83(17):8 14-24.
4. Aubert M et al. In vitro Inactivation of Latent HSV by Targeted Mutagenesis Using an HSV- specific Homing Endonuclease. Mol Ther Nucleic Acids. 2014 Feb 4;3 :e l46.
5. Zimmerman KA et al. Zinc finger proteins designed to specifically target duck hepatitis B virus covalently closed circular DNA inhibit viral transcription in tissue culture I Virol. 2008
Aug;82(16): 8013-21.
6. Chen et al. HBsAg-negative Hepatitis B Virus Infection and Hepatocellular Carcinoma. Discov Med. 2014 Oct; 18(99): 189-93.
7. Maeder et al, WO 2015/153789 Al CRISPR/CAS-related methods and compositions for treating herpes simplex virus type 1 (HSV-1).
Claims
1. A method of inactivation of a herpesvirus in a mammalian cell, the method comprising introducing into the cell:
(c) a Cas9 molecule and
(d) a first gRNA comprising a targeting domain which is complementary with a target sequence from the gene Rsl (SEQ ID NO: 3), UL54 (SEQ ID NO: 4), UL29 (SEQ ID NO: 5), UL30 (SEQ ID NO: 6) or a homolog thereof; and
optionally (c) a second gRNA comprising a targeting domain which is complementary with a second target sequence from the gene Rsl, UL54, UL29, UL30 or a homolog thereof in the herpesvirus.
2. The method of claim 1, comprising introducing into said cell (a), (b), and (c).
3. The method of any one of claims 1-2, wherein (b) comprises a first sequence selected from Table 1, Table 2, Table 3, Table 4, or Table 5 and (c) comprises a second sequence selected from Table 1, Table 2, Table 3, Table 4, or Table 5, wherein the second sequence is not the same as the first.
4. The method of any one of claims 1-3, wherein (b) comprises the sequence UL30- 1 (SEQ ID NO: 13) or UL30-2 (SEQ ID NO: 14) and (c) comprises the sequence UL29-1 (SEQ ID NO: 1 1) or UL29-2 (SEQ ID NO: 12).
5. The method of claim 4, wherein (b) comprises the sequence UL30-2 (SEQ ID NO: 14) and (c) comprises the sequence UL29-2 (SEQ ID NO: 12).
6. The method of any one of claims 1-5, wherein the herpesvirus is latent.
7. The method of any one of claims 1-6, wherein the herpesvirus is selected from the group; herpes simplex virus- 1 (HSV-1), herpes simplex virus-2 (HSV-2), varicella zoster virus, Epstein-Barr virus, cytomegalovirus, human herpesvirus 6, human herpesvirus 7, or Kaposi's sarcoma-associated herpesvirus.
8. The method of claim 7, wherein the herpesvirus is herpes simplex virus- 1 (HSV-1).
9. The method of any one of claims 1-8, wherein the introducing step comprises introducing into the cell a vector that encodes for one or combination of (a), (b) and (c).
10. The method of claim 9, wherein the vector is a viral vector.
11. The method of claim 10, wherein the viral vector is selected from the group; retrovirus, lentivirus, adenovirus, herpesvirus, poxvirus, alpha virus, vaccinia virus, and adeno-associated viruses.
12. The method of claim 9, wherein the vector is a non-viral vector.
13. The method of claim 12, wherein the non-viral vector is selected from the group consisting of a nanoparticle, a cationic lipid, a cationic polymer, a metallic nanoparticle, a nanorod, a liposome, microbubbles, a cell penetrating peptide and a liposphere.
14. The method of claim 13, wherein the non-viral vector comprises polyetheleneglycol.
15. The method of any one of claims 1-8, wherein the introducing step comprises introducing a complex of Cas9 molecule and one or both of (b) and (c).
16. The method of any one of claims 1-15, wherein the Cas9 molecule is a Cas9 polypeptide or a functional fragment thereof.
17. The method of any one of claims 1-16, wherein the Cas9 molecule comprises a sequence of SEQ ID NO: 1 or SEQ ID NO: 2 or a functional fragment thereof.
18. The method of any one of claims 1-17, wherein the introducing results in alteration of the target sequence.
19. The method of claim 18, wherein the alteration is a mutation selected from the group consisting of a deletion, an insertion, or a point mutation.
20. The method of any one of claims 18-19, wherein the alteration results in inactivation of viral gene expression, viral replication or viral reactivation.
21. The method of any one of claims 1-20, wherein the inactivation is in vivo.
22. The method of any one of claims 1-20, wherein the inactivation is ex vivo.
23. The method of claim 22, wherein the cell comprises a cultured cell from a subject having a herpesvirus infection, a tissue explant or a cell line.
24. The method of any one of claims 1-23, wherein the mammalian cell is a sensory neuron.
25. The method of any one of claims 1-24, for use in treatment of herpesvirus infection or a herpesvirus related disease.
26. The method of claim 25, wherein the herpesvirus related disease is selected from the group; genital herpes, HSV gingivostomatitis and recurrent herpes labialis, HSV keratitis or keratoconjunctivitis, meningitis or herpes simplex encephalitis (HSE).
27. A gRNA molecule comprising a targeting domain which is complementary with a target sequence from the Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus.
28. The gRNA molecule of claim 27, wherein said targeting domain is complementary with a target domain from the Rsl gene or a conserved homolog thereof in the herepesvirus.
29. The gRNA molecule of claim 28, wherein the gRNA molecule comprises a nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 7, SEQ. ID. NO: 8, SEQ. ID. NO: 49, SEQ. ID. NO: 50, SEQ. ID. NO: 51, SEQ. ID. NO: 52, SEQ. ID. NO: 53, SEQ. ID. NO: 54, SEQ. ID. NO: 55, SEQ. ID. NO: 56, SEQ. ID. NO: 57, SEQ. ID. NO: 58, or SEQ. ID. NO: 59.
30. The gRNA molecule of claim 27, wherein said targeting domain is complementary with a target domain from the UL29 gene or a conserved homolog thereof in the herepesvirus.
31. The gRNA molecule of claim 30, wherein the gRNA molecule comprises a nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 1 1, SEQ. ID. NO: 12, SEQ. ID. NO: 26, SEQ. ID. NO: 27, SEQ. ID. NO: 28, SEQ. ID. NO: 29, SEQ. ID. NO: 30, SEQ. ID. NO: 31, SEQ. ID. NO: 32, SEQ. ID. NO: 33, SEQ. ID. NO: 34, SEQ. ID. NO: 35 or SEQ. ID. NO: 36.
32. The gRNA molecule of claim 27, wherein said targeting domain is complementary with a target domain from the UL30 gene or a conserved homolog thereof in the herepesvirus.
33. The gRNA molecule of claim 32, wherein the gRNA molecule comprises a nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 13, SEQ. ID. NO: 14, SEQ. ID. NO: 15, SEQ. ID. NO: 16, SEQ. ID. NO: 17, SEQ. ID. NO: 18, SEQ. ID. NO: 19, SEQ. ID. NO: 20, SEQ. ID. NO: 21, SEQ. ID. NO: 22, SEQ. ID. NO: 23, SEQ. ID. NO: 24 or SEQ. ID. NO: 25.
34. The gRNA molecule of claim 27, wherein said targeting domain is complementary with a target domain from the UL54 gene or a conserved homolog thereof in the herepesvirus.
35. The gRNA molecule of claim 32, wherein the gRNA molecule comprises a nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 9, SEQ. ID. NO: 10, SEQ. ID. NO: 37, SEQ. ID. NO: 38, SEQ. ID. NO: 39, SEQ. ID. NO: 40, SEQ. ID. NO: 41, SEQ. ID. NO: 42, SEQ. ID. NO: 43, SEQ. ID. NO: 44, SEQ. ID. NO: 45, SEQ. ID. NO: 46, SEQ. ID. NO: 47 or SEQ. ID. NO: 48.
36. A composition comprising a first gRNA molecule comprising a targeting domain which is complementary with a first target sequence from the Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus.
37. The composition of claim 36 further comprising a second gRNA molecule comprising a targeting domain which is complementary with a second target sequence from the Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus; wherein the selected genes targeted by the first and second gR As are not the same.
38. The composition of claim 37 further comprising a third gRNA molecule comprising a targeting domain which is complementary with a third target sequence from the Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus; wherein the selected genes targeted by the first, second and third gRNAs are not the same.
39. The composition of claim 38 further comprising a fourth gRNA molecule comprising a targeting domain which is complementary with a fourth target sequence from the Rsl, UL29, UL30, UL54 gene or a conserved homolog thereof in the herepesvirus; wherein the selected genes targeted by the first, second, third and fourth gRNAs are not the same.
40. The composition of any one of claims 36-39, wherein the gRNA comprising a targeting domain which is complementary to the target sequence of Rsl comprises nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 7, SEQ. ID. NO: 8, SEQ. ID. NO: 49, SEQ. ID. NO: 50, SEQ. ID. NO: 51, SEQ. ID. NO: 52, SEQ. ID. NO: 53, SEQ. ID. NO: 54, SEQ. ID. NO: 55, SEQ ID. NO: 56, SEQ. ID. NO: 57, SEQ. ID. NO: 58, or SEQ. ID. NO: 59.
41. The composition of any one of claims 36-39, wherein the gRNA comprising a targeting domain which is complementary to the target sequence of UL29 comprises nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 1 1, SEQ. ID. NO: 12, SEQ. ID. NO: 26, SEQ. ID. NO: 27, SEQ. ID. NO: 28, SEQ. ID. NO: 29, SEQ. ID. NO: 30, SEQ. ID. NO: 31, SEQ. ID. NO: 32, SEQ. ID. NO: 33, SEQ. ID. NO: 34, SEQ. ID. NO: 35 or SEQ. ID. NO: 36.
42. The composition of any one of claims 36-39, wherein the gRNA comprising a targeting domain which is complementary to the target sequence of UL30 comprises nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 13, SEQ. ID. NO: 14, SEQ. ID. NO: 15, SEQ. ID. NO: 16, SEQ.
ID. NO: 17, SEQ. ID. NO: 18, SEQ. ID. NO: 19, SEQ. ID. NO: 20, SEQ. ID. NO: 21, SEQ. ID. NO: 22, SEQ. ID. NO: 23, SEQ. ID. NO: 24 or SEQ. ID. NO: 25.
43. The composition of any one of claims 36-39, wherein the gRNA comprising a targeting domain which is complementary to the target sequence of UL54 comprises nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 9, SEQ. ID. NO: 10, SEQ. ID. NO: 37, SEQ. ID. NO: 38, SEQ. ID. NO: 39, SEQ. ID. NO: 40, SEQ. ID. NO: 41, SEQ. ID. NO: 42, SEQ. ID. NO: 43, SEQ. ID. NO: 44, SEQ. ID. NO: 45, SEQ. ID. NO: 46, SEQ. ID. NO: 47 or SEQ. ID. NO: 48.
44. The composition of any one of claims 36-43, further comprising a Cas9 molecule.
45. The composition of claim 44, wherein the Cas9 molecule and gRNAs are introduced as a complex.
46. The composition of claim 44, wherein the Cas9 molecule and the gRNAs are introduced into the cell by one or more vectors comprising nucleic acid sequences that encodes Cas9, and the respective gRNAs.
47. A kit comprising, (a) one or a combination of gRNA molecule of claim 27-35 and (b) a Cas9 molecule or a functional fragment thereof.
48. A kit comprising compositions of any one of claims 36-46.
49. The kit of claim 47-48 further comprising one or more items selected from the group consisting of packaging material, a package insert comprising instructions for use, a sterile fluid, a syringe and a sterile container.
50. A method for treating herpesvirus infection or a herpesvirus related disease comprising contacting a subject in need thereof or a cell from said subject with a therapeutically effective amount of compositions of any one of claims 36-46
51. A method of inactivation of a latent herpesvirus in a mammalian cell, the method comprising introducing into the cell,
(a) a Cas9 molecule and
(b) a first gRNA comprising a targeting domain which is complementary with a target sequence from the gene Rsl, UL54, UL29, UL30 or a homolog thereof; and
(c) a second gRNA comprising a targeting domain which is complementary with a second target sequence from the gene Rsl, UL54, UL29, UL30 or a homolog thereof; wherein the selected gene targeted by the second gRNA is not the same as the first.
52. A method of inactivating or inhibiting a herpesvirus in a mammalian cell, the method comprising introducing into the cell:
(a) a Cas9 molecule;
(b) a first gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding Rsl or a conserved homolog thereof in the herpesvirus;
(c) a second gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL54 or a conserved homolog thereof in the herpesvirus;
(d) a third gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL29 or a conserved homolog thereof in the herpesvirus; and
(e) a fourth gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL30 or a conserved homolog thereof in the herpesvirus.
53. A method of inactivating or inhibiting of a latent herpesvirus in a mammalian cell, the method comprising introducing into the cell:
(a) a Cas9 molecule;
(b) a first gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding Rsl or a conserved homolog thereof in the herpesvirus;
(c) a second gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL54 or a conserved homolog thereof in the herpesvirus;
(d) a third gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL29 or a conserved homolog thereof in the herpesvirus; and
(e) a fourth gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL30 or a conserved homolog thereof in the herpesvirus.
54. A method of inactivating or inhibiting of a herpesvirus in a mammalian cell, the method comprising introducing into the cell:
(a) a Cas9 molecule;
(b) a first gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding Rsl or a conserved homolog thereof in the herpesvirus;
(c) a second gRNA comprising a targeting domain which is complementary with a target sequence in a gene selected from the group consisting of UL54, UL29, and UL30 or a conserved homolog thereof in the herpesvirus; and
(d) a third gRNA comprising a targeting domain which is complementary with a target sequence in a gene selected from the group consisting of UL54, UL29, and UL30 or a conserved homolog thereof in the herpesvirus;
wherein the selected genes targeted by the second and third gRNAs are not the same.
55. A method of inactivating or inhibiting of a latent herpesvirus in a mammalian cell, the method comprising introducing into the cell:
(a) a Cas9 molecule;
(b) a first gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding Rsl or a conserved homolog thereof in the herpesvirus;
(c) a second gRNA comprising a targeting domain which is complementary with a target sequence in a gene selected from the group consisting of UL54, UL29, and UL30 or a conserved homolog thereof in the herpesvirus; and
(d) a third gRNA comprising a targeting domain which is complementary with a target sequence in a gene selected from the group consisting of UL54, UL29, and UL30 or a conserved homolog thereof in the herpesvirus;
wherein the selected genes targeted by the second and third gRNAs are not the same.
56. A method of inactivating or inhibiting of a herpesvirus in a mammalian cell, the method comprising introducing into the cell:
(a) a Cas9 molecule;
(b) a first gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding Rsl or a conserved homolog thereof in the herpesvirus; and
(c) a second gRNA comprising a targeting domain which is complementary with a target sequence in a gene selected from the group consisting of UL54, UL29, and UL30 or a conserved homolog thereof in the herpesvirus.
57. A method of inactivating or inhibiting of a latent herpesvirus in a mammalian cell, the method comprising introducing into the cell:
(a) a Cas9 molecule;
(b) a first gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding Rsl or a conserved homolog thereof in the herpesvirus; and
(c) a second gRNA comprising a targeting domain which is complementary with a target sequence in a gene selected from the group consisting of UL54, UL29, and UL30 or a conserved homolog thereof in the herpesvirus.
58. A composition comprising:
(a) a first gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding Rsl or a conserved homolog thereof in the herpesvirus;
(b) a second gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL54 or a conserved homolog thereof in the herpesvirus;
(c) a third gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL29 or a conserved homolog thereof in the herpesvirus; and
(d) a fourth gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding UL30 or a conserved homolog thereof in the herpesvirus.
59. A composition comprising:
(a) a first gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding Rsl or a conserved homolog thereof in the herpesvirus;
(b) a second gRNA comprising a targeting domain which is complementary with a target sequence in a gene selected from the group consisting of UL54, UL29, and UL30 or a conserved homolog thereof in the herpesvirus; and
(c) a third gRNA comprising a targeting domain which is complementary with a target sequence in a gene selected from the group consisting of UL54, UL29, and UL30 or a conserved homolog thereof in the herpesvirus;
wherein the selected genes targeted by the second and third gRNAs are not the same.
60. A composition comprising:
(a) a first gRNA comprising a targeting domain which is complementary with a target sequence in a gene encoding Rsl or a conserved homolog thereof in the herpesvirus;
(b) a second gRNA comprising a targeting domain which is complementary with a target sequence in a gene selected from the group consisting of UL54, UL29, and UL30 or a conserved homolog thereof in the herpesvirus.
61. The method or composition of any one of the preceding claims, wherein the gRNA targeting Rsl comprising a nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 7, SEQ. ID. NO: 8, SEQ. ID. NO: 49, SEQ. ID. NO: 50, SEQ. ID. NO: 51, SEQ. ID. NO: 52, SEQ. ID. NO: 53, SEQ. ID. NO: 54, SEQ. ID. NO: 55, SEQ. ID. NO: 56, SEQ. ID. NO: 57, SEQ. ID. NO: 58, or SEQ. ID. NO: 59.
62. The method or composition of any one of the preceding claims, wherein the gRNA targeting UL54 comprising a nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 9, SEQ. ID. NO: 10, SEQ. ID. NO: 37, SEQ. ID. NO: 38, SEQ. ID. NO: 39, SEQ. ID. NO: 40, SEQ. ID. NO: 41, SEQ. ID. NO: 42, SEQ. ID. NO: 43, SEQ. ID. NO: 44, SEQ. ID. NO: 45, SEQ. ID. NO: 46, SEQ. ID. NO: 47 or SEQ. ID. NO: 48.
63. The method or composition of any one of the preceding claims, wherein the gRNA targeting UL29 comprising a nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 1 1, SEQ. ID. NO: 12, SEQ. ID. NO: 26, SEQ. ID. NO: 27, SEQ. ID. NO: 28, SEQ. ID. NO: 29, SEQ. ID. NO: 30, SEQ. ID. NO: 31, SEQ. ID. NO: 32, SEQ. ID. NO: 33, SEQ. ID. NO: 34, SEQ. ID. NO: 35 or SEQ. ID. NO: 36.
64. The method or composition of any one of the preceding claims, wherein the first gRNA targeting UL30 comprising a nucleic acid sequence selected from the group consisting of SEQ. ID. NO: 13, SEQ. ID. NO: 14, SEQ. ID. NO: 15, SEQ. ID. NO: 16, SEQ. ID. NO: 17, SEQ. ID. NO: 18, SEQ. ID. NO: 19, SEQ. ID. NO: 20, SEQ. ID. NO: 21, SEQ. ID. NO: 22, SEQ. ID. NO: 23, SEQ. ID. NO: 24 or SEQ. ID. NO: 25.
65. The method of any one of the preceding claims, wherein the Cas9 molecule and the gRNAs are introduced into the cell by one or more vectors comprising nucleic acid sequences that encode Cas9, and the respective gRNAs.
66. A gRNA molecule of any one of claims 27-35 or a combination thereof for use in treating HSV-1 infection and related diseases in a subject.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201662365826P | 2016-07-22 | 2016-07-22 | |
| US62/365,826 | 2016-07-22 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2018017925A1 true WO2018017925A1 (en) | 2018-01-25 |
Family
ID=60996097
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2017/043225 Ceased WO2018017925A1 (en) | 2016-07-22 | 2017-07-21 | Targeting lytic and latent herpes simplex virus 1 infection with crispr/cas9 |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2018017925A1 (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020160412A1 (en) * | 2019-02-01 | 2020-08-06 | Editas Medicine, Inc. | Crispr/cas-related methods and compositions targeting virus genomes |
| US20200392208A1 (en) * | 2018-02-01 | 2020-12-17 | Editas Medicine, Inc. | Crispr/cas-related methods and compositions for treating herpes simplex virus (hsv) related keratitis |
| WO2022241215A3 (en) * | 2021-05-13 | 2023-02-02 | Forge Biologics, Inc. | Adenoviral helper plasmid |
| CN115927473A (en) * | 2022-07-15 | 2023-04-07 | 上海本导基因技术有限公司 | Gene therapy medicine for herpes simplex virus infectious diseases |
| WO2024113302A1 (en) * | 2022-12-01 | 2024-06-06 | 深圳先进技术研究院 | Grna targeting hsv essential genes, crispr/cas gene editing system, delivery system, and use |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015059490A1 (en) * | 2013-10-25 | 2015-04-30 | Virttu Biologics Limited | Determining hsv replication activity |
| WO2015153789A1 (en) * | 2014-04-01 | 2015-10-08 | Editas Medicine, Inc. | Crispr/cas-related methods and compositions for treating herpes simplex virus type 1 (hsv-1) |
-
2017
- 2017-07-21 WO PCT/US2017/043225 patent/WO2018017925A1/en not_active Ceased
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015059490A1 (en) * | 2013-10-25 | 2015-04-30 | Virttu Biologics Limited | Determining hsv replication activity |
| WO2015153789A1 (en) * | 2014-04-01 | 2015-10-08 | Editas Medicine, Inc. | Crispr/cas-related methods and compositions for treating herpes simplex virus type 1 (hsv-1) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20200392208A1 (en) * | 2018-02-01 | 2020-12-17 | Editas Medicine, Inc. | Crispr/cas-related methods and compositions for treating herpes simplex virus (hsv) related keratitis |
| WO2020160412A1 (en) * | 2019-02-01 | 2020-08-06 | Editas Medicine, Inc. | Crispr/cas-related methods and compositions targeting virus genomes |
| WO2022241215A3 (en) * | 2021-05-13 | 2023-02-02 | Forge Biologics, Inc. | Adenoviral helper plasmid |
| CN115927473A (en) * | 2022-07-15 | 2023-04-07 | 上海本导基因技术有限公司 | Gene therapy medicine for herpes simplex virus infectious diseases |
| WO2024011980A1 (en) * | 2022-07-15 | 2024-01-18 | 上海本导基因技术有限公司 | Gene therapy drug for herpes simplex virus infectious diseases |
| WO2024113302A1 (en) * | 2022-12-01 | 2024-06-06 | 深圳先进技术研究院 | Grna targeting hsv essential genes, crispr/cas gene editing system, delivery system, and use |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20230001016A1 (en) | Rna guided eradication of human jc virus and other polyomaviruses | |
| JP7522088B2 (en) | RNA-guided removal of herpes simplex type 1 and other related herpesviruses | |
| US20240139294A1 (en) | Methods and compositions for rna-guided treatment of hiv infection | |
| US20180201921A1 (en) | CRISPRs | |
| US20190032057A1 (en) | Methods and compositions for rna-guided treatment of hiv infection | |
| US20190093092A1 (en) | Rna guided eradication of varicella zoster virus | |
| AU2017219605A1 (en) | Excision of retroviral nucleic acid sequences | |
| US20220241391A1 (en) | Methods of blocking asfv infection through interruption of cellular and viral receptor interactions | |
| JP2020505390A (en) | Lentiviruses and non-integrating lentiviruses as viral vectors for delivering CRISPR therapeutics | |
| US20240050547A1 (en) | Methods of blocking / neutralizing asfv infection through interruption of cellular and viral receptor interactions | |
| WO2024118959A1 (en) | Methods of blocking / neutralizing asfv infection through interruption of cellular and viral receptor interactions |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17831932 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 17831932 Country of ref document: EP Kind code of ref document: A1 |


